<%BANNER%>

Use of Molecular and Biochemical Methods to Determine Citrus Tristeze Virus (CTV) Viral Components and Resistance in Can...

Permanent Link: http://ufdc.ufl.edu/UFE0023949/00001

Material Information

Title: Use of Molecular and Biochemical Methods to Determine Citrus Tristeze Virus (CTV) Viral Components and Resistance in Candidate Rootstocks to Replace Sour Orange
Physical Description: 1 online resource (183 p.)
Language: english
Creator: Mohamed, Azza
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: citrus, ctv, hetromobilty, molecular, resistance, rootstock, rt, serology, somatic, topworking
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Citrus tristeza virus (CTV) is the causal agent of the most destructive viral disease of citrus and has a big impact on citrus production all over the world. CTV is a phloem-limited virus belongs to Closteroviridae family. The virus causes a wide range of symptoms depending on the isolate and the host. Sour orange (Citrus aurantium L.) has been a widely used rootstock for citrus because of its desirable qualities including resistance to phytophthora diseases and citrus blight, wide adaptation, and ability to produce good yields of high quality fruits. Unfortunately, citrus scions on sour orange rootstock are highly susceptible to quick decline (QD) disease caused by CTV. This has lead to the elimination of sour orange rootstock in Florida. The current rootstocks in Florida are primarily trifoliate hybrids which are not adapted to high pH, calcareous soils. Several new rootstocks have been developed in attempts to replace sour orange rootstock. Previous efforts to screen new hybrid rootstock candidates in the greenhouse for resistance to QD have been confounded by another CTV disease called seedling yellows that affect only juvenile plants. The main objective of the present study was to develop a new assay that bypasses the seedling yellows effect. Seventy two selections, including parental pummelos, pre-selected sour-orange-like pummelo-mandarin rootstock hybrids, and sour orange were top-worked onto 15-year old 'Hamlin' sweet orange trees known to carry the three CTV isolates important in Florida (T30, T36 and VT). Virus infection was determined by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Over all, there was a significant difference in terms of shoot growth between the tested rootstock candidates and the sour orange that was stunted and showed strong disease symptoms. Movement of the various CTV genotypes from the 'Hamlin' interstock into the grafts was determined by molecular techniques including multiple molecular markers (MMM) analysis and heteroduplex mobility assay (HMA). Several CTV-induced quick decline resistant/tolerant selections, including some pummelo parents and new hybrids, were identified using quantitative real time PCR (qRT-PCR).
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Azza Mohamed.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Grosser, Jude W.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0023949:00001

Permanent Link: http://ufdc.ufl.edu/UFE0023949/00001

Material Information

Title: Use of Molecular and Biochemical Methods to Determine Citrus Tristeze Virus (CTV) Viral Components and Resistance in Candidate Rootstocks to Replace Sour Orange
Physical Description: 1 online resource (183 p.)
Language: english
Creator: Mohamed, Azza
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: citrus, ctv, hetromobilty, molecular, resistance, rootstock, rt, serology, somatic, topworking
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Citrus tristeza virus (CTV) is the causal agent of the most destructive viral disease of citrus and has a big impact on citrus production all over the world. CTV is a phloem-limited virus belongs to Closteroviridae family. The virus causes a wide range of symptoms depending on the isolate and the host. Sour orange (Citrus aurantium L.) has been a widely used rootstock for citrus because of its desirable qualities including resistance to phytophthora diseases and citrus blight, wide adaptation, and ability to produce good yields of high quality fruits. Unfortunately, citrus scions on sour orange rootstock are highly susceptible to quick decline (QD) disease caused by CTV. This has lead to the elimination of sour orange rootstock in Florida. The current rootstocks in Florida are primarily trifoliate hybrids which are not adapted to high pH, calcareous soils. Several new rootstocks have been developed in attempts to replace sour orange rootstock. Previous efforts to screen new hybrid rootstock candidates in the greenhouse for resistance to QD have been confounded by another CTV disease called seedling yellows that affect only juvenile plants. The main objective of the present study was to develop a new assay that bypasses the seedling yellows effect. Seventy two selections, including parental pummelos, pre-selected sour-orange-like pummelo-mandarin rootstock hybrids, and sour orange were top-worked onto 15-year old 'Hamlin' sweet orange trees known to carry the three CTV isolates important in Florida (T30, T36 and VT). Virus infection was determined by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Over all, there was a significant difference in terms of shoot growth between the tested rootstock candidates and the sour orange that was stunted and showed strong disease symptoms. Movement of the various CTV genotypes from the 'Hamlin' interstock into the grafts was determined by molecular techniques including multiple molecular markers (MMM) analysis and heteroduplex mobility assay (HMA). Several CTV-induced quick decline resistant/tolerant selections, including some pummelo parents and new hybrids, were identified using quantitative real time PCR (qRT-PCR).
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Azza Mohamed.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Grosser, Jude W.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0023949:00001


This item has the following downloads:


Full Text

PAGE 1

USE OF MOLECULAR AND BIOCHEMICA L METHODS TO DETERMINE CITRUS TRISTEZA VIRUS (CTV) VI RAL COMPONENTS AND RE SISTANCE IN CANDIDATE ROOTSTOCKS TO REPLACE SOUR ORANGE By AZZA HOSNI IBRAHIM MOHAMED A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Azza Hosni Ibrahim Mohamed 2

PAGE 3

To the memory of my parents and my br others who passed away during my program To my family whose encouragement kept me going To my beloved husband Ahma d for his help and support To my lovely daughter Aala whose love and smile lighten the long, dark tunnel for me and help me find a way where there is none apparent To my best friend Haja Am al whose name means hope 3

PAGE 4

ACKNOWLEDGMENTS The completion of this dissertation woul d not have been possible without the encouragement, help and support of many people. First, I would like to express my sincere gratitude and appreciation to my major advisor Dr. Jude W. Gr osser for his encouragement, valuable guidance and advice for both my persona l and my professional life. I cannot thank him enough for his financial support, and for being very understanding to my condition as a graduate student. I especially tha nk him a lot for his time and effort in reviewing this manuscript. For what he did for me, I will be always in dept a nd grateful to him. His high ethical standards and respectful views for the others will always be memorable. I deeply thank Dr. Ronald H. Brlansky, for allowing me use the facilities in his lab and greenhouse and for his helpful suggestions and comments, and also for reviewi ng this manuscript. I wo uld like to thank Dr. Fredrick Gmitter and Dr. Charles A. Powell for serving on my committee, giving me guidelines and advice for my research during my entire program, and reviewing this manuscript. I am especially grateful to my former major professor Dr. Richard Lee for his financial support for the first one and half years of my program and his encouragement along all these years. I want to extend my gratitude to Debbie Howd, Diann Achor for their technical help. I am very thankful to our librarian at CREC Jennifer Dawson for her professional help. I want to thank Mrs Cecile Robertson for her endless help and kindness. Special th anks go to Dr. Edgardo Etxeberria for letting me use his lab and thanks to Pedro Gonzales for his help. Great thanks and appreciation go to Dr. Larry Duncan for his spec ial support and dedicatio n to graduate students at the CREC. I want to thank Dr. W.O. Dawson and his team for their assistance and providing me with the CTV isolates needed in this study. I thank Dr. Siddarame Gowda for his help. I want to express my gratitude to Gary Barth for his va luable discussion and sup port all the time and for proof reading this manuscript. 4

PAGE 5

Some people who deserve special mention are Dr. Manjunath Keremane, Dr. Kajal Biswas and Dr. Avijit Roy for their help. I thank Dr Fahiem El Borai for his time, help and encouragement that meant a lot to me. I thank all my friends (Eaman, Marwa, Faten, Naglaa, Ekta, Dalia, Safaa, Rashida, Samya, Lucian a, Maysoon, Eaman, Abeer, Ling and Maysaa) for their encouragement and support. I also thank B ecky McCoy for taking care of my plants in the greenhouse. I am grateful to Troy Gainey and the groove crew, especially Michael Clock, for taking care of my trees in the field. Without them, the work would be more delayed. I want to thank Dr. Pete Timme r for his proof reading a grea t part of this manuscript. Special thanks go to Dr. Reza Ehsani for giving me a space in his lab to finish my writing. I want to extend my gratitude to all the sincere and unc onditional friends that I have in my lab, Chuck, Milica, Manjul, Monica, Jamouna, Divya and Pamela for their help and support. Special thanks go to Ralph Story for his help with the field work and Julie Gmitter for her help in processing the samples. I also thank Allan Burrage, Zenaida Viloria, Gemma Pasquali, Anna Redondo, Mukkades Kayum, Kanjana Mahattanatawee and Ma rty Dekkers for their help and support. I thank the entire CREC community fo r their help and cooperation. I ex tend my appreciation to all the people in the personnel office at the CREC and the people at the Horticultural Sciences Department in Gainesville for their help and unde rstanding to process the paper work in a timely manner. Finally, I thank the Citrus Research and Education Center at University of Florida for its generous financial support during my graduate st udies at the University of Florida. A special recognition goes to all my department members in Egypt for being understanding and giving me the permission to stay aboard to continue with my program. 5

PAGE 6

My most sincere thanks and appreciation go to my family, for their understanding, support, believing in me and unconditional love they provid ed me throughout my life. I want to thank all my friends in Egypt and the USA either in Gaines ville or in Lake Alfre d, for their love, support and encouragement which kept me going and achieved my goal. Special thanks go to my friends Haja Amal and Tahereh for their pure love and their sincere support. Their continuous encouragement and concern are highly apprecia ted. I would like to express my sincere appreciation to my beloved husband Ahmad Omar for his love, support and his continuous help throughout my program. 6

PAGE 7

TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES .........................................................................................................................10LIST OF FIGURES .......................................................................................................................12ABSTRACT ...................................................................................................................... .............14 CHAPTER 1 INTRODUCTION ................................................................................................................ ..162 REVIEW OF LITERATURE .................................................................................................21Disease History .......................................................................................................................21Citrus Tristeza Virus Classification ........................................................................................22CTV Host Range .....................................................................................................................23Morphological and Cytologica l Characteristics of CTV ........................................................23CTV Symptoms ......................................................................................................................24Transmission of CTV ........................................................................................................... ..25Virus, Vector, and Pl ant Interactions ......................................................................................26Detection of CTV ...................................................................................................................26Genome Organization of CTV ................................................................................................29Replication of CTV ............................................................................................................ .....30CTV Gene Expression Strategies ...........................................................................................31Genetic Diversity of CTV .......................................................................................................31CTV Control ...........................................................................................................................34Genetic Engineering for CTV Resistance ...............................................................................34Natural Resistance and Breed ing for CTV Resistance ...........................................................36The Quick Decline Problem and Its Impact on Florida Citrus Industry .................................38The Current Rootstocks in Florida .........................................................................................39Building QD-resistant Sour Orange-like R ootstocks Using Conventional Breeding and Somatic Hybridization ........................................................................................................40Somatic Hybridization and Breeding at the Tetraploid Level with a Focus on Mandarin + Pummelo Combinations ..................................................................................41What Will These New Rootstock Candidates Provide? .........................................................43Dissertation Objectives ...........................................................................................................443 DEVELOPMENT OF A TOP-WORKING METHOD AND BIOCHEMICAL STUDIES TO EVALUATE ROOTSTOCK CANDIDATES FOR CITRUS TRISTEZA VIRUS (CTV) QUICK-DECLINE (QD) RE SISTANCE IN EFFORTS TO REPLACE SOUR ORANGE ................................................................................................................... .50Introduction .................................................................................................................. ...........50 7

PAGE 8

Materials and Methods ...........................................................................................................51Top-working ................................................................................................................... .51Seedling Yellows (SY) Assay .........................................................................................52Chlorophyll a, chlorophyll b, and total chlorophyll conten t in the test rootstock candidates .............................................................................................................53Starch assay and biochemical aspects of CTV-quick decline problem ...........................53Starch content in the roots and the leaves as an indicator of CTV QD infection .....54Results and Discussion ........................................................................................................ ...55Top-working Experiment ................................................................................................55Shoot growth ............................................................................................................55Disease symptoms ....................................................................................................57Top-working advantage to fast fruiting ....................................................................58General considerations for improving the top-working QD-resistance assay ..........58Seedling Yellows Experiment and Total Chlorophyll Content .......................................59Starch content and biochemical aspects of CTV-QD problem .......................................604 USE OF SEROLOGICAL METHODS TO DETERMINE CITRUS TRISTEZA VIRUS (CTV) STATUS AND RESISTANCE IN TOP-WORKED ROOTSTOCK CANDIDATES TO REPLACE SOUR ORANGE ................................................................81Introduction .................................................................................................................. ...........81Materials and Methods ...........................................................................................................83ELISA ......................................................................................................................... .....83Plant materials ..........................................................................................................83ELISA method ..........................................................................................................84Direct Tissue Blots Immunoassay (DTBI) ......................................................................86Western Blot Analysis .....................................................................................................87Results and Discussion ........................................................................................................ ...89ELISA ......................................................................................................................... .....89Direct Tissue Blot Immunoassay (DTBI) ........................................................................90Western Blot Analysis .....................................................................................................91Conclusions .............................................................................................................................915 MOLECULAR CHARECTERIZATION OF CITRUS TRISTEZA VIRUS (CTV) IN SELECTED HYBRID ROOTST OCK CANDIDATES TO potentially REPLACE SOUR ORANGE ..................................................................................................................1 12Introduction .................................................................................................................. .........112Multiple Molecular Markers (MMM) ...........................................................................114Heteroduplex Mobility Assay (HMA) ...........................................................................115Quantitative Real-Time PCR (qRT-PCR) Method to Determine and Quantify CTV Accumulation .............................................................................................................116Materials and Methods .........................................................................................................117Multiple Molecular Markers (MMM) ...........................................................................117Plant materials and virus isolates ...........................................................................117Multiple molecular markers primers ......................................................................118Total RNA isolation and comple mentary DNA (cDNA) synthesis .......................119 8

PAGE 9

Polymerase chain reaction (PCR) ..........................................................................119Heteroduplex Mobility Assay (HMA) ...........................................................................120Plant materials and virus isolates ...........................................................................120Total RNA isolation and comple mentary DNA (cDNA) synthesis .......................120DNA purification, cloning and transformation ......................................................122Colony PCR and heteroduplex mobility assay (HMA) ..........................................123DNA miniprep, sequencing and sequence analysis ...............................................124Quantitative Teal-Time PCR (qRT-PCR) Method to Determine and Quantify CTV Accumulation .............................................................................................................124Plant materials and virus isolates ...........................................................................124RT-PCR primers .....................................................................................................125RNA extraction ......................................................................................................125PCR conditions .......................................................................................................125Results and Discussion ........................................................................................................ .126Multiple Molecular Markers (MMM) ...........................................................................126The Heteroduplex Mobility Assay (HMA) ...................................................................128Quantitative Real-Time PCR (qRT-PCR) Method to Determine and Quantify CTV Accumulation .............................................................................................................130Summary and Conclusions ...................................................................................................1316 CONCLUSIONS ................................................................................................................. .146 APPENDIX A ELISA BUFFERS AND STARCH SOLUTIONS ...............................................................155B WESTERN BLOT ANALYSIS ...........................................................................................157C PCR REACTION MI X AND PROGRAM ..........................................................................158D QUANTITATIVE REAL TIME-PCR .................................................................................159LIST OF REFERENCES .............................................................................................................160BIOGRAPHICAL SKETCH .......................................................................................................183 9

PAGE 10

LIST OF TABLES Table page 1-1 Total production of citrus fruit ...........................................................................................202-1 Characteristics of the top-ten citrus rootstocks of citrus in Florida ...................................493-1 Identification and description of the ge rmplasms included in the field top-working study. ........................................................................................................................ ..........753-2 Shoot growth of the rootstock candidates and the sour orange in average18 months after grafting .......................................................................................................................783-3 Shoot length (cm) and the seedling yellows symptoms of test rootstock candidates inoculated with T36 in the greenho use 8 months after inoculation. ..................................793-4 Total chlorophyll content (mg/g) in test rootstock candidates. ..........................................793-5 Summary of the starch content (mg/g dry weight) in Hamlin sw eet orange leaf and the rootstocks roots ............................................................................................................804-1 Samples selected from the topworked rootstock candidates to be further tested ..........1014-2 Summary of polyclonal and the MCA13, monoclonal Enzyme-linked Immunosorbent Assays (ELISA) results for the source trees prior to the top-working. .1024-3 Summary of the CTV polyclonal antibody Enzyme-linked Immunosorbent Assays (ELISA) results for the source trees grafted rootstock candidates .................................1034-4 Summary of the CTV monoclonal, MC A13 antibody Enzyme-linked Immunosorbent Assays-Indirect (ELISA-I) results for the s ource trees, grafted rootstock candidates .....1064-5 Summary of rootstock ca ndidates categories based on the performance in the field (shoot growth and CTV symptoms) in relation to MCA13 (DAS-I) ELISA. .................1094-6 Summary of the serological tests results on the root stock candidates + Marsh and Ruby Red grapefruit. ........................................................................................................1105-1 Sequence of Multiple Molecular Markers .......................................................................1415-2 Genotype profiles of TW (top-worked sc ion) source isolates and sub-isolates. ..............1425-3 Summary of the multiple molecular markers (MMM) results .........................................1435-4 The comparison of nucleotide sequence iden tities of the different genotypes from the rootstock candidate. .........................................................................................................144 10

PAGE 11

5-5 Detection and relative quantif ication of CTV in selected te st rootstock material using quantitative Real-time PCR. ............................................................................................145A-1 ELISA buffers ..................................................................................................................155A-2 Starch determination solutions. ........................................................................................156B-1 Western blot analysis buffers and solutions.....................................................................157D-1 Primers pairs used for quantitative real-time PCR assay. ................................................159D-2 Real-time PCR reaction. ..................................................................................................159 11

PAGE 12

LIST OF FIGURES Figure page 2-1 Citrus tristeza virus as seen with a transmi ssion electron microscope ..............................452-2 Symptoms caused by Citrus tristeza virus ........................................................................462-3 Citrus tristeza virus (CTV) genome ...................................................................................472-4 Long term rootstock trends ................................................................................................ 472-5 CTV infection trend with severe isolates. ..........................................................................483-1 Summary of the top-working technique ............................................................................633-2 Shoot length (cm) of the pummel parents and the sour orange .........................................643-3 Shoot length (cm) of the somatic hybrids rootstock candidates and the sour orange ........653-4 Shoot length (cm) of the tetrazygs ro otstock candidates and the sour orange ...................663-5 Shoot length (cm) of the diploid hybrids rootstock candidates and the sour orange .........673-6 Shoot length (cm) of the open pollinated te traploid rootstock candidates and the sour orange ........................................................................................................................ .........683-7 Shoot length (cm) of Marsh grapefruit, Ruby Red grapefruit and the sour orange ...........693-8 Seedling yellows symptoms of rootstock candidates.........................................................703-9 Shoot length (cm) and the seedling yellows symptoms of test rootstock candidates ........713-10 Total chlorophyll content (mg/g dry we ight) in test root stock candidates. .......................723-11 Iodine staining of the roots of the te st rootstocks infected with CTV-T36 .......................733-12 Starch content (mg/g dry weight) 12 months after inocul ation of T36 CTV-QD isolate in the greenhouse. ...................................................................................................7 44-1 CTV monoclonal, MCA13 antibody Enzyme -linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test genot ypes (pummelo seedling parent group) ........934-2 CTV monoclonal, MCA13 antibody Enzyme -linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test genotypes (somatic hybrid group) .........................944-3 CTV monoclonal, MCA13 antibody Enzyme -linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked te st genotypes (tetrazyg group) ....................................95 12

PAGE 13

4-4 CTV monoclonal, MCA13 antibody Enzyme -linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test ge notypes the grafted rootstock candidates (Diploid hybrid group ) ......................................................................................................9 64-5 CTV monoclonal, MCA13 antibody Enzyme -linked Immunosorbent Assays-Indirect (ELISA-I) results for the grafted rootst ock candidates (OP) tetraploids group .................974-6 CTV monoclonal, MCA13 antibody Enzyme -linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked commercial scions .......................................................984-7 Tissue prints of representative health y and CTV positive and top-worked rootstock candidates after incubation with the MCA13 DTBI ..........................................................994-8 Western blot analysis of total soluble protein of healthy and infected samples using the MCA13 monoclonal antibody ....................................................................................1015-1 Citrus tristeza virus (CTV) genome indicating different ORFs .......................................1345-2 Heteroduplex Mobility Assay (HMA) .............................................................................1355-3 Multiple molecular ma rker (MMM) profiles. ..................................................................1365-4 PAGE 1 showing the retarded mobility of heteroduplexes 1 (HtD2). .............................1375-5 PAGE 2 showing the retarded mobility of heteroduplexes 2 (HtD2) ..............................1385-6 Phylogenetic tree showing genetic relationships of the CTV genotypes .........................1395-7 Q-RT-PCR amplification. ................................................................................................140 13

PAGE 14

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy USE OF MOLECULAR AND BIOCHEMICA L METHODS TO DETERMINE CITRUS TRISTEZA VIRUS (CTV) VI RAL COMPONENTS AND RE SISTANCE IN CANDIDATE ROOTSTOCKS TO REPLACE SOUR ORANGE By Azza Hosni Ibrahim Mohamed May 2009 Chair: Jude W. Grosser Major: Horticultural Sciences Citrus tristeza virus (CTV) is the causal agent of the most destructive viral disease of citrus and has a big impact on citrus production all ove r the world. CTV is a phloem-limited virus that belongs to Closteroviridae family. The virus causes a wide range of symptoms depending on the isolate and the host. Sour orange ( Citrus aurantium L.) has been a widely used rootstock for citrus because of its desirable qualities includi ng resistance to phytophthora diseases and citrus blight, wide adaptation, and ability to produce goo d yields of high quality fruits. Unfortunately, citrus scions on sour orange r ootstock are highly susceptible to quick decline (QD) disease caused by CTV. This has lead to the reduction of sour orange rootstock in Florida and in other citrus areas. The current rootstoc ks in Florida are primarily tr ifoliate hybrids which are not adapted to high pH, calcareous soils. Several new rootstocks have been developed in attempts to replace sour orange rootstock. Pr evious efforts to screen new hybr id rootstock candidates in the greenhouse for resistance to tristeza-QD have been confounded by another CTV disease called seedling yellows that affect only juvenile plants. The main objective of the present study was to develop a new assay that bypasses the seedling yello ws effect. Seventytwo selections, including parental pummelos, pre-selected sour-orange-like pummelo-ma ndarin rootstock hybrids, and 14

PAGE 15

15 sour orange were top-worked onto 15-year old Hamlin sweet or ange trees known to carry the three CTV genotypes important in Florida (T30, T 36 and VT). Virus infection was determined by double-antibody sandwich enzyme-linked immunos orbent assay (DAS-ELISA). Over all, there was a significant difference in terms of shoot growth between the tested rootstock candidates and the sour orange that was stunted and show ed strong disease symptoms. Movement of the various CTV genotypes from th e Hamlin interstock into the grafts was determined by molecular techniques including mu ltiple molecular markers (MMM) analysis and heteroduplex mobility assay (HMA). Several CT V-induced quick decline resistant/tolerant selections, including some pummelo parents and new hybrids, were identified using quantitative real time PCR (qRT-PCR).

PAGE 16

CHAPTER 1 INTRODUCTION Citrus is one of the most widely grown a nd economically important fruit crops worldwide with an annual production of mo re than 100 million metric tons. Brazil has the highest citrus production followed by China and the United States of America (USA) (Table1-1) according to FAOSTAT (2007). United States production of citr us is worth about $21 billion annually with the state of Florida producing the majority of the USAs citrus. Citr us is a very valuable fruit in terms of nutrition as it is a good source of vitamin C, minerals and antioxidants. The center of origin of citrus is believed to be SouthEast Asia, 4000 years BC (D avies and Albrigo, 1994). Citrus is primarily produced within tropical a nd subtropical regions (within 40 North-South latitude). Mediterranean countries are considered the leader s for the international fresh fruit market. Egypt produces a significant amount of high quality citrus fr uits, approximately 2.8 million tons in 2005, ranking eleventh in citrus production (Table 1-1). World citrus production is being threatened by many viral, bacterial and fungal diseases. The most threatening diseases to citrus are citrus greening, citrus canker and citrus tristeza. Citrus tristeza caused by citrus tristeza virus (CTV), is the most destructive viral disease of citrus and has a big impact on citrus production all over the world. CTV is a single-stranded, positivesense RNA virus in the genus Closterovius, family Closteroviridae (Bar-Joseph et al., 1989) and it is vectored by aphid species wi th the brown citrus aphid, Toxoptera citricida, being the most efficient vector. CTV is considered the larges t known plant RNA virus with a genome about 20 kb long. Genome organization, mechanisms of gene expression, population complexity and sequence variation among different isolates combined with the hostpathogen interaction are all important factors controlling CTV biology and disease symptom development. For a better understanding of the pathogenecity of CTV, genetic analysis of the whole CTV genome is 16

PAGE 17

desirable (Satyanarayana et al., 1999; Ayllon et al., 2001; Satyanarayana et al., 2002a; Satyanarayana et al., 2002b). Othe r factors attributi ng to the poor understa nding of the disease mechanism are the virus restriction to phloem tissu e, the low titer in virus-infected plants, and the population diversity. The genetic analysis of CTV genome has been advanced by the development of a full length infectious cDNA clone and a protoplast system for CTV replication (Price et al., 1996; Saty anarayana et al., 1999). CTV isolates vary in their bi ological reactions on different hosts. Therefore, CTV causes a wide range of symptoms depending on the isolate and the host. Most field isolates are mixtures of different strains with one that usually app ears to be dominant (major population). The most important disease caused by CTV is known as qui ck decline (QD), (McCl ean, 1950; Grant et al., 1951). On sour orange rootstock some CTV isolates cause an incompatibility at the budunion causing the tree to decline. Tree decline results in the necrosis and the death of the phloem at the budunion whereby sugars produced in leaves are bl ocked from being transported to the roots. Eventually, the feeder roots use up stored starch a nd start to die, leading to the ultimate death of the tree (Brlansky et al., 2008; Futch and Brlansky, 2008). The introduction of the primary CTV vector, the brown citrus aphi d, into Florida in 1995 (Halbert and Brown, 1996) resulted in the rapid spr ead of severe CTV isolates and therefore the CTV-decline isolates. This immediately jeopardized millions of commercial citrus trees planted on sour orange rootstock in Florida, since trees on sour orange ar e highly susceptible to citrus tristeza quick decline disease (Ba r-Joseph et al., 1989). This has l ead to reduction of sour orange ( Citrus aurantium L.) rootstock. As a result, less desirabl e rootstocks are currently used (Bauer et al., 2005). Currently there is no rootstock that provides an adequate replacement for sour 17

PAGE 18

orange for several reasons including problems w ith soil adaptation, fru it quality, horticultural problems and disease resistance. Unfortunately, there is no effective method for controlling or eliminating CTV from citrus infected trees, especially in the field. When citrus trees ar e grown in the field in Florida, they are most likely to become CTV infected at some point of their life, even though planted virus free (Sieburth et al., 2005) Developing transgenic citrus with resistance to CTV is considered to be the best long-term approach for controlling CTV diseases. Molecular studies have revealed CTV resistant gene (s) in Poncirus trifoliata ; but the transfer of this gene (s) into commercially important citrus scions and rootstoc k is a laborious and it will require more years of research to become reality (Deng et al., 2001b). Moreover, commercialization of transgenic citrus must still overcome regulatory hurdles a nd achieve consumer acceptance. Development of a replacement for sour orange that is resistant to QD and provides the acceptable horticulture qualities has become a primary breedi ng objective (Grosse r et al., 2004a). Several new citrus rootstock candidates have been developed usi ng either conventional breeding or a somatic hybridization approach by th e University of Florida and the Agricultural Research Service of the U.S. Department of Agricultural (USDA), (Bowman and Rouse, 2006). The citrus improvement program based on soma tic hybridization has been led by Dr. Jude Grosser at the University of Florida-IFAS Citr us Research & Education Center with a primary goal of developing improved citrus rootstocks (Grosser et al., 2000; Grosser and Chandler, 2002). Sour orange has been shown by molecular markers to be a probable hybrid of mandarin and pummelo (Nicolosi et al., 2000 ). Therefore superior sour-ora nge-like rootstock hybrids have been produced by different combinations of pummelo and mandarin using the somatic hybridization technique, resulting in allotetraploid hybr ids (Grosser et al., 2003). Hybrids 18

PAGE 19

produced at the tetraploid level preserve the dominant traits of both parents and have the potential to control tree size via polyploidy (Grosser et al., 1995; Grosser et al., 1998; Grosser et al., 2000; Nicolosi et al., 2000; Grosser and Chandler, 2002). Mo reover, somatic hybridization has the advantage of the immediate use of pres elected pummelo seedlings as parents, whereas conventional breeding with the same material would require several years of waiting for the material to overcome juvenility to flower (Gro sser et al., 2004a). Promisi ng rootstocks must be evaluated for virus resistance a nd horticultural performance over a number of years before being released for commercial use. The development of a good screen of the root stock candidates for resistance to tristeza quick decline would facilitate the development of a replacement rootstock for sour orange. Moreover, sequencing and molecular characteriz ation of the different CTV genotype complex should improve our understanding of the virus bi ology in these tested rootstock candidates to replace sour orange rootstock. Therefore, the ma in purpose of this study was to develop a more efficient screen of new candidate rootstocks for resistance to CTV-induced quick decline disease. In the past, the CTV-induced disease seed ling yellows (SY) has confounded screening experiments conducted in the greenhouse (Garns ey S.M., unpublished data). Therefore, topworking of the new rootstock candidates to mature CTV-infected trees in the field was chosen as a means to bypass the seedling yello ws problem in the greenhouse. Field tree virus infection was detected by serological techniques including tissue blot immunoassa y (TBIA) and double antibody sandwich, indirect enzyme-linked i mmunosorbent assay (DASI-ELISA). Several molecular and biochemical methods were used to assay and study the movement of the virus from the infected interstock in to the virus free grafted materials. These methods include multiple molecular markers (MMM) analysis and heterod uplex mobility assay (HMA). Quantitative real 19

PAGE 20

20 time PCR (qRT-PCR) was used to provide a fast and a reliable assay to detect and quantify the virus titer in the source and the tested rootst ocks after top-working (R uiz-Ruiz et al., 2007). Based on the study done by Garnsey and Young (1975) that showed the depletion of starch content in the roots of CTV dec lining trees, starch, sucrose and total carbohydrates content were also studied in leaves and root s of these rootstock candidates. The measurements were done 12 months after inoculation with a QD inducing CTV isolate (T36) in a parallel gr eenhouse study. Table 1-1. Total production of citr us fruit (Mt) (FAOSTAT, 2007). Country Production (Mt) Metric ton Brazil 20,185 China 15,166 United States of America 10,410 Mexico 6,672 Spain 5,347 India 5,242 Iran 3,624 Italy 3,489 Argentina 3,036 Turkey 2,910 Egypt 2,800 South Africa 1,930 Morocco 1,245 Japan 1,207

PAGE 21

CHAPTER 2 REVIEW OF LITERATURE Disease History Tristeza which means sadness in Spanish and Portuguese is one of the most devastating and economically important diseases in the citrus industry worldwide. The disease is caused by a phloem-limited, Closterovirus known as citrus tristeza virus (CTV) and occurs in most citrus production areas in the world. Although citrus tristeza is believed to have originated in Southeast Asia (Wallace, 1956), the disease was first recogn ized as a decline dise ase of citrus scions propagated on sour orange ( Citrus aurantium L.) rootstock in South Africa in the 1910s (Webber, 1943). CTV is not transmitted by seeds, ther efore, most of the early establishments of citrus, which were propagated only through seeds were CTV-free (McClean, 1957). Initial spread of the disease is belie ved to have been through the in fected propagating materials. Another CTV decline disease causin g devastating death of millions of citrus trees grafted on sour orange rootstock was reported in Argentina and Brazil during th e1930s (Costa and Grant, 1951; Bar-Joseph et al., 1989). More than ten million trees have been lost in Spain from 1956 to late 1980s (Cambra et al., 1988 ). During the nineteenth century, Phytophthora root rot of sweet orange trees was the main concern and caused great losses of citrus. Therefore, the use of grafted trees onto the Phytophthora tolerant sour orange ( Citrus aurantium L.) rootstock became common (Klotz, 1978). However, problems associated with sour orange as a rootstock started to be recognized in Australia, South Africa and Java as incompatibility problems (Webber, 1925; Toxopeus, 1937). The decline problem was first thought to be a graft incompatibility between rootstock and scion, a root disease, or a nutritional problem, but Meneghini (1946) transmitted the disease with aphids and confirmed the viral nature of the disease (Bar-Jos eph et al., 1989; Lee and Rocha21

PAGE 22

Pena, 1992). Besides quick decline, other diseases known to be associated with CTV infection include stem pitting (Da Graca et al., 1984) and the economically insignificant seedling yellows (Roistacher, 1982) The latter disease ha s confounded the greenhouse screening of new rootstock candidates for quick decline resistance (Garnsey, unpublished data). Quick decline disease was confirmed in the United States for the first time in California in 1939 (Fawcett and Wallace, 1946; Wallace, 1956) a nd become epidemic in Florida (Grant, 1952). CTV is believed to have b een introduced into the United States first in California with Meyer lemon imported from China in 1908 and then introduced to Texas and Florida with the movement of Meyer lemon trees (Wallace and Drake, 1955). Recently, Lee et al., (2002) reported an ep idemic situation in the Bog Walk Valley, Jamaica, where the entire valley was undergoing a severe decline. Incidences and outbreaks of CTV isolates have been reported in many ne w citrus growing regi ons throughout the world (Davino et al., 2003; Papic et al., 2005). Citrus Tristeza Virus Classification Citrus tristeza virus is a member of genus Closterovirus family Closteroviridae based on morphological, biological, mol ecular and phylogenetic analyses (Bar-Joseph et al., 1979a; Koonin and Dolija, 1993; Dolja et al., 1994). The Closteroviridae family contains more than 30 plant viruses with flexuous, filamentous virion s and viruses have either a mono or bipartite genome and with positive-sense, single-stranded RNA (Bar-Jos eph et al., 1989; Karasev, 2000). The Closteroviruses are most constantly found in the phloem and therefore are called phloemlimited (Esau, 1960). The Closteroviruses are tran smitted by insects such as aphids, mealy bugs and whiteflies in a semi-persistent manner (Brunt et al., 1996). The virus particles of this group produce characteristic inclusion bodies in the infected cell s (Bar-Joseph et al., 1979b). 22

PAGE 23

CTV Host Range Citrus tristeza virus (CTV) has a narrow natural host range and is essentially limited to the genus Citrus in the Rutaceae. Citrus tristeza virus infects most species, cultivars and hybrids of Citrus spp. Muller and Garnsey (1984). Some citrus relatives such as Poncirus trifoliata (L.) Raf., Swinglea glutinosa (Blanco) Merr., Severinia buxifolia (Poir.)Tenore and some pummelos [ C. grandis (L.) Osb.] are reported to be resistant to CTV infection. Also, some hybrids between P. trifoliata and sweet orange or grap efruit have shown CTV resistance (Garnsey et al., 1987a; Garnsey et al., 1997). CTV has b een inoculated into about 200 plant species outside the Rutaceae, but the virus only multiplies in some species of Passiflora especially in Passiflora gracilis (Muller et al., 1974; Roista cher and Bar-Joseph, 1987a). Morphological and Cytologica l Characteristics of CTV The CTV genome is a single-stranded, positive-sense RNA virus about 20,000 nt in length. CTV virions are encapsidated with two coat proteins (CP), the 25-kDa major CP, that encapsidates about 95% of the genome, and the 27-kDa minor CP that encapsidates the remaining 5% of the 5 end of the genome (Febres et al., 1996; Satyanarayana et al., 2004). The viral particles are arranged in a rattlesnake structur e (Agranovsky et al., 1995). Coat protein minor (CPm) accumulates in the host cel l wall fraction (Febres et al., 1994). Citrus tristeza virus has long thread-like, flexuous pa rticles about 2000 nm by 11 nm (Bar-Joseph et al., 1979a). The inclusion bodies are found in the phloem and phloem-associat ed cells (Schneider, 1959; Brlansky et al., 1988). The occurrence of the CTV inclusion bodies can be used as a method for rapid diagnosis of CTV (Brlansky and Lee, 1990). CTV produces distinct in clusion bodies that can be seen by light and elec tron microscopy (Garnsey et al ., 1980; Brlansky, 1987; Brlansky et al., 1988). There are two types of the inclusion b odies presented as cross-banded patterns of aggregated virus particles and/ or in aggregates of fibrilcontaining vesicles surrounded by 23

PAGE 24

cytoplasmic membranes (Garnsey et al., 1980; Brlansky, 1987; Brlansky et al., 1988). Virus particles can easily be observed w ith the electron microscope (EM) in leaf-dip preparations from infected citrus plants (Figure 2-1), (Bar-Joseph et al., 1972). CTV Symptoms Citrus tristeza virus causes a range of symptoms depending on the host and the isolate. et al., 1994; Rocha-Pena et al., 1995). CT V symptoms range from symptomless or mild to death of trees on sour orange rootstock. The most importa nt symptoms caused by different CTV isolates can be divided into five groups including mild vein clearing, seedling yellows (SY), stem pitting on grapefruit (SP-G) and on sweet orange (SP-O) and quick dec line (QD). Mild vein clearing (Figure 2-2 A) symptoms in leaves are usually produced by some mild isolates even on the most sensitive host, Mexican lime (Bar-Joseph et al., 1989). The SY symp toms include severe chlorosis and stunting of sour orange (Figure 2-2 B), lemon and grapefruit seedlings (Roistacher, 1982). The SY symptoms can also be vein cork ing in Mexican lime (Figure 2-2 C). The SY symptoms are commonly observed in nurseries (F raser, 1952) and greenhous es but they are not usually seen in the field (Roistacher, 1982). The SP disease is considered a serious problem caused by CTV because of the reduced tree vigor and the small fruits regardless of rootstock. Trees affected with CTV stem pitting strains do not decline severely, but have reduced fruit production and quality (Garnsey and Lee, 1988), (Figure2-2 G). The diseas e also induces leaf cupping, stunting, chlorosis, vein co rking and pitting of scions es pecially grapefruit and sweet orange (Figure 2-2 D, E, and F) (Lee et al., 1994; Rocha-Pena et al., 1995). Sometimes, the longitudinal pits on the trunk are more pronounced producing a ropey appearance along with a reduction in fruit number and size (Figure 2-2 G). The histology of stem pitting caused by an Australian CTV isolate was studied in sweet orange using light and electron microscopy (Brlansky et al., 2002). Pits in the wood often contain a yellow gum, as shown by the scanning 24

PAGE 25

electron microscopy and irregular growth of the phloem occurs in the area of these xylem pits (Brlansky et al., 2002). The QD sy mptoms are more severe a nd can occur on sweet orange, grapefruit and mandarin trees grafted onto sour orange rootstock ( Citrus aurantium L .). The brown citrus aphid (BCA), Toxoptera citricida (Kirkadly) is considered the primary factor for the spread and increase of CT V quick decline isolates. The cause of the decline problem was unknown for many years and was thought possibly to be a graft incompatibility. The QD phenomenon develops from virus-induced phloem n ecrosis in the bark of the rootstock at the graft union that prevents the movement of carboh ydrates from the canopy to the root system and causes the roots to starve. Depletion of starch in the root system causes the roots to degenerate and inhibits formation of new fi brous roots and trees decline rapi dly (Figure 2-1 H) (Garnsey et al., 1987a; Lee et al., 1994; Rocha-Pena et al., 19 95). A standardized panel of host range plants has been established by Garnsey et al., (1987b) to study the biological characteristics of different CTV isolates. The indicator plants include Mexican lime as a unive rsal indicator for all the CTV isolates, sour orange for SY, Duncan grapefru it for SP-G, Madam Vinous for SP-O, and sweet orange grafted onto sour orange for QD (Garnsey et al., 1987a). Transmission of CTV Citrus tristeza virus is easily gr aft-transmitted among the compatible Citrus species (Roistacher, 1976) The virus has been mechanically transmitted by stem-slash inoculation with partially purified preparations (Muller and Garnsey, 1984). In 1946, Meneghini was able to transmit tristeza using infected aphids and to prove the viral nature of tristeza. CTV is transmitted by many aphid species (Blackman and Eastop, 1984; Viggiani, 1988). The most important species of aphids that can transmit CTV in nature include T. citricida Aphis gossypii A. spiraecola and T. aurantii (Roistacher and Bar-Joseph, 1987b; Brunt et al., 1990). Toxoptera citricida, the brown citrus aphid (BCA), is the most efficient vector of CTV, transmitting the 25

PAGE 26

virus in a semi-persistent manner. Efficient transmission of CTV requires 30 min to 24 h of acquisition feeding (Sasaki, 1974; Roistacher and Bar-Joseph, 1987a) The aphid usually retains the ability to tran smit the virus for one to three days after acquisition (Yokomi et al., 1994). Brown citrus aphid was first reported in 1946 in Brazil. Transmissibility of CTV by aphid is affected by donor and receptor host species and environmental conditions (Bar-Joseph et al., 197 7) and the virus strain (Roistacher and BarJoseph, 1984). Over the years, BCA has been respons ible for the natural sp read of CTV in most citrus-growing areas including South America (C osta and Grant, 1951), Australia, and Asia (Tanaka, 1969) and South Africa (McClean, 1975). The BCA move d to Central America and the Caribbean Basin in the 1990s, (Yokomi et al., 1994; Rocha-Pena et al., 1995) and was reported in Florida in 1995 (Halbert and Brown, 1996). Virus, Vector, and Plant Interactions CTV transmission efficiency is affected by the species of aphid, the donor, the receptor plant, and the CTV isolate. Sweet orange is mo re suitable for acquisition and more sensitive to infection than grapefruit or lemon seedlings (Bar -Joseph et al., 1989). There is also a noticeable decrease in transmission from plants maintained at higher temperatures (Bar-Joseph and Lee, 1989). Red grapefruit cultivars present a problem with cross protection strategies due to the slow distribution of protecting CTV is olates throughout the plant (Lee et al., 1987; Broadbent et al., 1995). Pigmented grapefruits are more sensitive to stem pitting symptoms than non-pigmented grapefruit (Marais and Breytenbach, 1996). Moreover, grapefruits have been shown to influence the strain composition of CTV isolates (Van Vuuren and van der Vyver, 2000). Detection of CTV Several techniques have been developed fo r the detection and differentiation of CTV isolates. Garnsey et al., (1987b) succeeded in establishing a set of host range standards for 26

PAGE 27

indexing purposes with the Mexican lime as the universal indicator for CTV. Although this is a reliable approach, it is expensive and time consum ing for large-scale experiments. The presence or absence of inclusion bodies can be used as a method for rapid diagnosis of CTV (Brlansky and Lee, 1990). Citrus tristeza virus produces two types of inclusion bodies that can be seen by Azure A staining or in situ immunofluorescence with light mi croscopy (Garnsey et al., 1980; Brlansky, 1987; Brlansky et al., 1988). Several sero logical techniques have been used to detect CTV since the 1970s (Bar-Joseph et al., 1979b; Garnsey et al., 1993). Improvement in virus purification allowed for the development of specific antibodies used in the serologically specific electron microscopy (SSEM) technique (Brlansky et al., 1984). Enzyme-linked Immunosorbent Assay (ELI SA) and direct tissue blot immunoassay (DTBIA) using polyclonal and monoclonal antisera are used comm only to detect CTV infection (Cambra et al., 1991; Cambra et al., 2002). The specific monoclonal antibody MCA -13 was developed against the T36 isolate of CTV, which di fferentiates mild from severe CTV isolates in Florida (Permar et al., 1990). In the Florid a bud wood certification program, MCA-13 positive trees cannot be used for propagati on. In spite of this, some CTV isolates have been reported to cause decline on sour orange and yet are MC A13 negative (Hilf and Garnsey, 2002). Brown citrus aphid (BCA) has been reported to separate the mixtures of CTV genotypes from field isolates and severe sub-isolates hidden among the mild isolates have been detected from different CTV isolates (Brlansky et al., 2003). In addition, some other techniques such as polymerase chain reaction by two-step revers e-transcription RT-PCR have been used for the detection of CTV in host plants (Cevik, 1995; Metha et al., 19 97; Hilf and Garnsey, 20 00; Huang et al., 2004) and in aphids (Cevik, 1995; Metha et al., 1997; Hilf and Garnsey, 2000; Huang et al., 2004). Immunocapture (IC)-RT-PCR (Cambra et al., 20 00; Cambra et al., 2002); and multiplex RT27

PAGE 28

PCR (Roy et al., 2005) are also used to detect CTV. The Multiple Molecular Markers (MMM) method based on the amplification of molecu lar markers using sequence specific primers designed for the non-conserved regions of T36,V T, T30 and T3 isolates (Hilf and Garnsey, 2000) is also used in the detection an d differentiation of CTV isolates. The single strand conformation polymorphism (SSCP) method is based on the difference in the mobility of ssDNA fragments on polyacrylamide gels due to their conformation under the el ectrophoresis conditions which depend on the nucleotide sequence. This technique is used to characterize population variants in CTV from different regions of th e genome (Rubio et al., 1996; Rubio et al., 2000). Besides sequencing, several other methods including restriction fragment length polymorphism (RFLP) (Gillings et al., 1993)and hybridization with strain-specific probes (SSP) (Cevik, 1995) have been used to study the sequence variati on of the CTV genome. The heteroduplex mobility assay (HMA) is another technique to estimate th e genotype variation in human and plant viruses (Cai et al., 1991; Delwart et al., 1993; Lin et al., 2000; Berry and C., 2001). This method was applied to detect the unknown genotypes in mixt ures of CTV isolates (Biswas et al., 2004). Conventional PCR techniques can detect low viru s titer; however, they are not quantitative. On the other hand, the real-time PCR method allows rapid detection of target-specific amplicons and accurate quantification at the same time. Moreover, real-time qRT-PCR has been reported for the detection for viruses in differe nt insect vectors (Boonham et al., 2002; Fabre et al., 2003; Olmos et al., 2005) as well as from different woody plants (Marbot et al., 2003; Schneider et al., 2004; Varga and James, 2005; Osman and Rowhani, 2006; Varga and James, 2006; Osman et al., 2007). There are some recent reports about usin g quantitative real time PCR to detect and quantify CTV (Ruiz-Ruiz et al ., 2007; Saponari et al., 2008). 28

PAGE 29

Genome Organization of CTV Citrus tristeza virus is the largest known pl ant virus with a positive-sense RNA genome containing 19,296 to 19,302 nt, depending on the isolat e (Karasev et al., 1 995; Mawassi et al., 1996; Vives et al., 1999; Yang et al., 1999; Suastika et al., 2001) The large size of the CTV genome, the genome organization, the number and functions of the different genes, and the population complexity besides mechanisms of ge ne(s) expression are important molecular and biochemical aspects of CTV. The effect of thes e factors individually and/or combined with the disease development have been inves tigated (Satyanarayana et al., 1999). Based on sequence analysis, the CTV genome is organized into 12 open reading frames (ORF) with the potential to code for 19 protein products (Pappu et al., 1994; Karasev et al., 1995). CTV genomic RNA has an untranslated region of 107 nt at 5end of the genome (highly variable) and 3 UTR of 273 nt (highly conserved among CTV is olates) (Pappu et al., 1994; Karasev et al., 1995). The CTV genome can be divided into four modules: the core module, the chaperon module, the upstream module and the CP (coat pr otein) module. The core module contains the domains of RNA-dependent RNA polymerase, he licase and methyl transferase that are all associated with virus replication. The chaper one module includes one heat shock protein 70 homolog (HP70), one protein dist antly related to heat shock pr otein HP90, and a small protein with membrane-binding domains. The upstream module contains a domain of two papain-like proteases. The CP module consists of the major coat protein (p25) and the minor coat protein (p27) genes and four 3 terminal ORFs (F igure 2-3). The heat-shock protein 70 homolog (HP70h) is postulated to have a cell-to-cell movement function. In CTV, the HP70h, p61, CP and CPm are also required for effici ent virion assembly (Satyanaraya na et al., 2000). CTV p20 (ORF 10 product) is found in infected protoplasts and in CTV inclusi on bodies (Gowda et al., 2000). 29

PAGE 30

Mexican lime plants transformed with the CTV p23 gene exhibit typical CTV symptoms of vein clearing (Ghorbel et al., 2001), suggesting that the p23 is a sy mptom determinant. P20 and p23 have also been reported to have post-transcrip tional gene silencing (P TGS) suppressor activity (Lu et al., 2003; Reed et al., 2003). CTV contains some genes (p6 and p20) that play a role in the systemic infection of CTV (Satyanarayana et al., 2008). Replication of CTV Replication of CTV as a positive-sense RNA virus starts by producing genome -length negative sense or complimentary RNA strands from the genomic RNA that acts as a template for positive-sense RNA synthesis. RNA-dependent RNA polymerase (RdRp), helicase and methyl transferase are involved in the replication pr ocess and encoded by ORF1a and ORF 1b (Figure 23). The large complex genome, the phloem-limited na ture of the virus and the low concentrations in the infected plants has hi ndered the progress toward understa nding the replication strategy of CTV. The development of a full-length cDNA inf ectious clone (Satyanara yana et al., 1999) and protoplast system for CTV replication (Price et al ., 1996; Navas-Castillo et al., 1997) have been used to determine the function of some of the replication-associated genes. This replicon provides a model system for manipulation and st udying replication at th e cellular level (BarJoseph et al., 2002). p23 has been shown to be involved in the asymme trical accumulation of RNA (Satyanarayana et al., 2002b) and elucidated replication signa ls present in the 3' UTR for replication (Satyanarayana et al., 2002a). ORF 1a and 1b are necessary for the replication process (Satyanarayana et al., 1999). Moreover, Cis-acting seque nces, present at the 3 and 5UTR of CTV genome have been proven to be required for replication (Satyanarayana et al., 1999; Ayllon et al., 2001). CTV-infected plants usually contains def ective RNA (D-RNA) that results from both genomic RNA termini with extensive internal deletions of up to 17 kb (Ayllon et al., 1999b). 30

PAGE 31

Yang et al., (1997) reported the involvement of CTV ORF 11 subgenomic RNA (sgRNA) as building blocks in the recombination process leading to the generation of D-RNAs. These DRNAs are thought to be created by the genera l recombination mechanisms (Nagy and Simon, 1997; Ayllon et al., 1999b). CTV Gene Expression Strategies Open reading frame (ORF 1a is expressed as a 349kDa polyprotein and includes two papain-like proteases, helicaselike and methyl transeferase-like domains. ORF 1b encodes an RNA-dependent RNA polymerase (RdRp) via a +1 ribosomal frame shift (Karasev et al., 1995; Cevik, 2001). The 3' ORFs are expressed via posi tive and negative sense strands at the 3' coterminal subgenomic RNAs (Karasev et al., 1995). Different 3 co-terminal sgRNAs are present as dsRNA in abundant quantities in infected pl ants. The sgRNAs for p20 and p23 are expressed at higher rates followed by the two CP (p25 and p27) gene sgRNAs (Hilf et al., 1995; Pappu et al., 1997). Overall, CTV produces a complex array of RNAs including a full-length complementary, negative-sense RNA that acts as a template for further transcription and single and/or double-stranded subgenomic RNAs (Hilf et al., 1995; Mawassi et al., 1995a) and positivesense large molecular weight transcripts (LaMTs ) and low molecular weight transcripts (LMTs) (Mawassi et al., 1995b; Che et al., 2001) (Che et al ., 2001; Mawassi et al., 1995b). Approximately 35 RNA species have been s hown to be produced during CTV replication (Petersen, 2003). Genetic Diversity of CTV Citrus tristeza virus isolates usually contains comple x populations of distinct genotypes possibly due to multiple aphid transmissions, the perennial nature of the host, and vegetative propagation and genetic properties of the virus su ch as defective RNAs (D-RNAs) formation and recombination (Cevik, 2001). The complexity of CTV populations causes problems for diagnosis 31

PAGE 32

and strain identifica tion, therefore understanding the disease mechanisms and symptom development in different host plants is importa nt. Several studies on th e sequence variability among CTV isolates have been performed using the coat protein gene sequences (Cevik, 1995; Cevik et al., 1996a; Cevik et al., 1996b). Comparison of the CP sequences from several biologically and geographically CTV isolates showed that there is a minor sequence difference in the CP genes with different biological character istics. This suggested that minor differences related to a specific biological activity may be involved in those biological charact eristics of the CTV isolates (Cevik et al., 1996a). CTV field isolates usually contain multiple genomic variants, which can be separated upon grafting to different host plants (Moreno et al., 1993) or aphi d transmission (Tsai et al., 2000; Brlansky et al., 2003). Uneven distribution of th e genomic RNA variants of CTV within the infected plant and the selectiv ity of aphid transmission change the population (d'Urso et al., 2000). Variable differential distribution of the genomic RNA variants in different plant parts may result in acquisition of different viral populat ions by aphids, depending on the vector probing site. Also, the high selectivity of individual aphids to CTV ge notypes may change the population diversity of the variants (More no et al., 1993; d'Urso et al., 200 0). Moreno et al., (1993) showed that sub-isolates obtained from mild CTV isolat es by several host passages were more severe and expressed stem pitting. Also, Broa dbent et al., (1996) reported that single aphid transmissions of Australian CTV isolates using BCA separated some of the sub-is olates. Population diversity has been studied using several techniques such as pe ptide maps of the coat protein, hybridizations with cDNA probes, dsRNA patterns, SSCP and mu ltiple molecular markers in an attempt to differentiate CTV isolates and strains (Lee et al., 1988; Moreno and Guerri, 1997; Hilf and Garnsey, 2000; Niblett et al., 2000). Graft and aphid transmi ssions have been reported 32

PAGE 33

responsible for the haplotype (sequence varian ts) distribution and fr equency using (SSCP) analysis of two genes, p18 and p21 (Ayllon et al., 1999a). The complete sequences of several CTV isol ates have been repor ted: T36 (19,296 nt) and T30 (19,259 nt) from Florida (Pappu et al., 199 4; Karasev et al., 1995 ; Albiach-Marti et al., 2000), VT isolate (19,226 nt) from Israel (Mawassi et al., 199 6), T385 (19,259 nt) from Spain (Vives et al., 1999), SY568 (19,249 nt) from Calif ornia (Yang et al., 1999 ), and Nuaga isolate (19,302 nt) from Japan (Suastika et al., 2001). Th e genomic organization in all the sequenced isolates of CTV was similar, but the genomic se quences were significantly different (Mawassi et al., 1996; Vives et al., 1999). CTV fi eld isolates usually contain mi xtures of different populations and may contain multiple defective RNAs (D-RNA s) (Mawassi et al., 1995a; Mawassi et al., 1995b) From this mixture, strains of CTV having di stinct properties can be selected resulting in change of the viral strain s in different parts of the infected plants (Hilf et al., 1999). It is not known whether symptom development is due to the predominant strain or to the viral population, the combination of genomic RNA and defective RNA or other factors (Albiach-Marti et al., 2000). Since some CTV strains ar e more efficiently transmitted by certain aphid species, the structure of a population may change by time. Ov erall, CTV is one of the most diverse and highly complex plant RNA viruses. The multiple genotypes found in field samples, the numerous RNA species present in infected tissue, and the unknown function of most of its genes leave many questions about the virus biology, the infe ction process and the di sease mechanisms. In this study, the multiple molecular markers (MMM ) and the heteroduplex mobility assay were used to study the genetic divers ity of the CTV isolate and sub-isolates in mature local sweet orange field trees and the moveme nt of identified CTV isolates from the sweet orange interstock into new hybrid rootstock candidates top-worked onto these trees. Also, nucleotide sequence 33

PAGE 34

analysis was also used to validate CTV strain differentiation and estim ation of the molecular genetic variation (Rubio et al., 2001). CTV Control A number of management strategies have been developed for CTV control in order to minimize economic losses. These strategies are available for use based on the absence or presence of CTV in different citrus-growing areas (Bar-Joseph and Lee, 1989; Lee and RochaPena, 1992). The strategies include quaranti ne and budwood certificat ion to prevent the introduction of CTV, eradication programs to prev ent the spread of the virus, the use of mild strain cross protection (M SCP), the use of CTV-tolerant root stocks, breeding for CTV resistance, and genetic engineering (Bar-Joseph a nd Lee, 1989; Lee and Rocha-Pena, 1992). Cross protection is the phenomenon in which a pl ant previously infected with a mild strain of the virus is protected against the infection by other more severe strains of the same virus or closely related viruses (Fulton, 1986). Different temperature regimes and field site conditions have to be tested for the mild strain before such CTV isolates are evaluated as a management strategy (Powell et al., 1992). Mild strain cross protection has been applied in several countries including Brazil, India, Austra lia, South Africa and Japan (Roc ha-Pena et al., 1995). Without CTV cross-protection, grapefruit production would be uneconomic in South Africa due to stem pitting disease (Von Broembsen and Lee, 1988; Van Vuuren et al., 1993; Van Vuuren and da Graa, 2000). Cross protection has value only for stem pitting disease and has not proven effective against quick decline disease as evid enced by the breakdown of mild strain crossprotection in Florida (Lee et al., 1996). Genetic Engineering for CTV Resistance Recent advances in plant molecular biology and genetic engineering are providing new approaches and are opening new avenues for the generation and the evaluation of transgenic 34

PAGE 35

plants for virus resistance outside of conve ntional breeding methods (Cevik, 2001). Genetic engineering allows the inserti on of specific genes into the ge nome of currently successful cultivars, theoretically adding desirable traits without otherw ise altering cultivar integrity. Genetic engineering has the potential for devel oping plants that have either host or pathogenderived resistance against CTV inf ection. Virus resistance has been engineered in several plants by transferring genes or sequences from viruses and/or other sources (Fuchs and Gonsalves, 1997). The majority of transgenic plants engineered for virus resistance has been developed using sequences derived from plant viral genomes. Several citrus species have been transformed with either a functional or untranslatable coat protein (CP) gene of CTV (Moore et al., 1993; Gutirrez et al., 1997; Domnguez et al., 2000; Ghor bel et al., 2000; Yang et al., 2000; Ghorbel et al., 2001; Dominguez et al., 2002 ; Herron et al., 2002; Febres et al., 2003; Batuman et al., 2006; Febres et al., 2008). The manipulation of nonstructural genes, such as movement protein and replication-associated proteins such as RNA-dependent RNA polymerase (RdRp), is a promising strategy for developing virus resistance in transgenic plants (Beachy, 1994; Palukaitis and Zaitlin, 1997). Replicase-mediated and the R NA-mediated resistances were shown to be highly specific and effective on ly against the specific strain of the virus from which the transgenic sequences were obtaine d or against closely related stra ins of the same virus with a high degree of sequence homology (Audy et al., 1994; Zaitlin et al ., 1994; Palukaitis and Zaitlin, 1997). Pathogen-derived resistance (PDR) has b een found to be effective and reproducible in transgenic Mexican lime plants carrying the p25 CP gene of severe and mild isolates of CTV (Dominguez et al., 2002). Various degrees of re sistance were reported (10-33%) whereas other transgenic plants showed a significant delay in virus accumulation and symptom development. Closteroviruses like CTV have been shown to suppress plant antiviral machinery at several 35

PAGE 36

stages in the post-translational gene silencing (PTGS) pathway a nd might also have the capacity to silence other cellular nucleic acid invade rs (Herron, 2003). The CTV ORF 10 product, p20, has been demonstrated experimentally to have PTGS-suppressor function in N. benthamiana assays (Reed et al., 2003). Activity of these proteins is thought to occur after the Dicer-mediated dsRNA cleavage step in the PTGS path way (Reed et al., 2003). Grapefruit ( Citrus Paradisi ) plants were transformed with several constructs derived from the CTV genome such as the RdRp construct containing the full length gene 1b, major coat protein (p25) and minor coat protein (p27), and then the transgenic plants were tested fo r their resistance to the virus. Most transgenic lines (27 lines) were susceptible but a few (6 lines) were partia lly resistant and only one line, transformed with the 3 end of CTV, was resi stant. The accumulation of siRNA has indicated that a PTGS mechanism is i nduced in these transgenic pl ants (Febres et al., 2008). Natural Resistance and Breeding for CTV Resistance There is no known genetic resistance in the genus Citrus that is effective against all CTV isolates, and CTV-infected citrus species and hyb rids vary in their reac tion from sensitive to tolerant (Muller and Garnsey, 1984; Mestre et al., 1997c). However, some citrus relatives, such as P. trifoliata (Tanaka et al., 1971; Hutchson, 1985; Kitajima et al., 1994), Severinia buxifolia and Swinglea glutinosa (Muller et al., 1968; Salibe, 1977) are reported to be resistant or may be immune (meaning that they do not support virus rep lication) to CTV (Garnsey et al., 1987a). Of these three relatives, P. trifoliata is the only species that is routinely sexually compatible with citrus. Some hybrids between P. trifoliata and sweet orange or grapef ruit are resistant to CTV infection. CTV is not able to replicate or cause symptoms in these hosts (Garnsey et al., 1987a). The resistance found in P. trifoliata was conferred initially by a single dominant Mendelian gene designated Ctv (Gmitter et al., 1996; Fang et al., 1998). The development of CTV-resistant cultivars would provide the best l ong-term control but the integration of the CTV 36

PAGE 37

resistance gene into new scion cultivars by conventional breeding will require several generations and much time to eliminate th e undesirable fruit characteristics from Poncirus (Deng et al., 2001). Moreover, applying classical breeding is difficult because of the problems associated with citrus breeding including la rge plant size, inbreeding depression, polyembryony, heterozygosity, sterility, selfand cross-incompat ibility and a long juvenility period (Soost and Roose, 1996). On the other hand, the progress that has been made toward mapping the location of Ctv gene (Deng et al., 1996; Gmitter et al., 1996; Fang et al., 1998; Deng et al., 2001b; Deng et al., 2001a; Fagoaga et al., 2005) makes clonin g of the gene and us ing it to transform commercially important citrus cultivars a real ity. The region containing this gene has been mapped, and markers flanking and co-segregating with Ctv have been developed (Fang et al., 1998). Further studies suggested that in P. trifoliata var Flying Dragon, there are at least two genes responsible for CTV resistance based on the short distance accumulation observed in some Ctv-Rr progeny segregant plants derived by selfpollination. Bulked segregant analysis of this population identified five RAPD ma rkers linked to another locus cal led Ctm that is located in a different linkage group from the Ctv resistant gene (Mestre et al ., 1997b). The fact that CTV can replicate in protoplasts of CTV -resistant plants (Albiach-Marti et al., 1999), has raised questions as to whether Ctv confers resistance by blocking virus re plication or by inte rfering with virus loading or unloading from the phloem (Mestre et al., 1997a). Deng et al ., (2000) identified 22 sequences similar to the nucleotid e binding site-leucine rich rep eat (NBS-LRR) class resistance gene in the citrus genome with one of the fragments being closely linked and another cosegregating with Ctv gene. Different bacterial artificial chromosome libraries have been developed and some BAC clones and BAC contigs containing resistance gene candidates have been characterized to further identify resistan ce genes to CTV (Deng et al., 2001a; Yang et al., 37

PAGE 38

2001). The Ctv locus was localized within a genomic region of approximately 180 kb (Deng et al., 2001a). Advanced studies on the resistance gene found in P. trifoliata revealed several resistant gene candidates for CTV. Five resistance genes (R1R5) with complete ORFs have been identified and can be considered as candidates for Ctv (Yang et al., 2003). Refinement of genetic maps has delimited this gene to a 121-kb region composed of ten candidate Ctv resistance genes (Rai, 2006). The Quick Decline Problem and Its Im pact on Florida Citrus Industry Citrus tristeza virus is one of the most severe pathoge ns affecting citrus worldwide. CTV is a major cause of the decline and eventually death of citrus trees on sour orange rootstock. Initially declining trees exhibit small leaves, h eavy fruit set with small fruits and honeycombing on the inside face of the bark from the rootstock side of the budunion. The decline results from phloem necrosis at the budunion, prev enting the transportation of st arch and sugars to the roots and causing starch depletion in the roots. Then the death of the feed er roots leads to the ultimate death of the tree. Trees on sour orange rootstock are primarily affected by CTV-QD. Sweet oranges are more affected than grapefruit wherea s lemons on sour orange rootstock, for example are not affected by CTV-QD (Brlansky et al., 2008; Futch and Brlansky, 2008). During the 1940s and 1950s more than nine million sweet ora nge trees on sour orange rootstock were destroyed by CTV-QD in Brazil an d the Brazilian citrus industry was almost wiped out (Bove and Ayres, 2007). Tristeza was first reported in Florida in the 1950s a nd in 1980 it produced a great loss due to the quick dec line problem caused by CTV (Futch and Brlansky, 2008). The total number of trees killed in South America wa s around 25 million and reached 100 million worldwide (Bove and Ayres, 2007). The introduction of the brown citrus aphid vector to Florida in 1995 has caused the spread of severe CTV strains including the quick d ecline-inducing isolates. Sour orange was the most important rootstoc k worldwide because it offers many desirable 38

PAGE 39

horticultural traits, tolerance to Phytophthora dise ases as well as to citrus blight, and its adaptation to virtually all soil conditions. Unfortunately sour or ange is susceptible to CTV-QD disease (Stover and Castle, 2002). Therefore, sour orange rootst ock use in new plantings has been virtually eliminated in Florida (Brown and Spreen, 2000). The remaining sour orangerooted trees (approx. 15 million) in Florida are exp ected to die within the next decade due to QD (Grosser et al., 2004a). CTV is also threatening the citrus industry in other citrus growing areas such as Mexico and Texas since more than 95% of their citrus trees are on sour orange rootstock (Grosser et al., 2004a). Figure (2-4 ) shows the decline of sour or ange rootstock usage and Figure (2-5) shows the increase in severe CTV inf ections [Citrus Budwood Registration Bureau (CBRB)], (Annual Report, 2003). As a result of th e loss of sour orange, often less desirable rootstocks are currently us ed (Bauer et al., 2005). The Current Rootstocks in Florida The rootstocks commonly used in Florida ofte n do not satisfy all selection criteria for citrus production in a specific location, because th e top rootstocks are trifoliate hybrids which are not adapted to high pH, calcareous soils (Gro sser and Chandler, 2000; Grosser et al., 2004a; Bauer et al., 2005) The ten top cu rrent rootstocks used in Fl orida are Swingle citrumelo, Carrizo citrange, Kuharske citrange, Cleopatra mandari n (Cleo), Volkamer lemon, US812, Sour Orange, Sun Chu Sha mandarin and US-802 (CBRB), (Annual Report, 2007). In addition, Benton citrange, C-32 citrange, C-35 citrange, Cle opatra x Trifoliate (TF); (X639), Goutou, Kinkoji, 1584 (TF x Milam), US-852 (Changsha x TF), US-897 (Cleo x TF), Smooth Flat Seville and trifoliate orange rootstocks (Castle et al., 2006) are being used to a lesser extent. The attributes of some of the common rootstocks in Florida ar e summarized by Castle et al., (2006) and are presented in Table (2-1 ). Swingle was developed by crossing C. paradisi and P. trifoliata and became widely planted starting in the late 1980s (Figure 2-4) as a CTV-resistant 39

PAGE 40

productive rootstock with good yield and fruit quality (Fallahi et al., 1989; Castle et al., 1993). Swingle citrumelo rootstock has been the most popular commercial rootstock in Florida (Annual Report, 2007), however, Swingle was reported to pe rform poorly in high pH calcareous soils in the flatwoods areas of Florid a (Castle and Stover, 2001; Bauer et al., 2005). Carrizo ( Citrus sinensis x P. trifoliat a) rootstock is also CTV resistant, but susceptible to citrus blight (Castle, 1987; Castle and Tucker, 1998). Cleopatra mandarin ( C. reticulata ) rootstock is tolerant to CTV, but trees on this rootstock are often debilitated by Phytophthora diseases and blight (Bowman and Roman, 1999; Castle et al., 2006). In more challenging soils, the current top rootstocks, especially for sweet orange and grapefruit scions, have proven to be inadequate replacements for sour orange. Therefore, developmen t of a replacement rootstock that can be used in high pH soils and has adequate disease resistance especially to CTVQD has become a primary breeding objective (Grosser et al., 2004b). Building QD-resistant Sour Orange-like R ootstocks Using Conventional Breeding and Somatic Hybridization Citrus rootstock improvement is difficult a nd time consuming because the large number of traits needed including tolerance to dis eases such as citrus tristeza virus, Phytophthora spp., citrus blight, Diaprepes, ne matodes, and huanglongbing (citrus greening), and adaptation to challenging and/or high salinity so ils while retaining th e ability to produce high yielding trees with quality fruit. In addition, the ability to pr oduce nucellar seeds and to control tree size must be combined in any successful new rootstock fo r citriculture in Flor ida (Grosser et al., 2003; Ananthakrishnan et al., 2006). Approaches su ch as conventional breeding and somatic hybridization are being used to develop new rootstocks in an attempt to provide the best rootstocks for citrus. A wide range of new citrus r ootstock germplasm has been developed by the University of Florida and the Agricultural Research Service of the U.S. Department of 40

PAGE 41

Agricultural (USDA-Natural Resources Cons ervation Service) (Bowman and Rouse, 2006). Approaches such as conventional breeding and so matic hybridization are be ing used to develop these new rootstocks in an attemp t to provide the best rootstock for citrus, and some of the new advanced selections are currently being evaluated in different locations around the state (Grosser and Gmitter, 1990; Gmitter et al., 1992; Louzada et al., 1992; Grosser et al., 1994; Grosser et al., 1995; Grosser et al., 1996; Gr osser et al., 1998; Bowman a nd Roman, 1999; Wutscher and Bowman, 1999; Bowman, 2000; Grosser and Ch andler, 2000; Bowman and Garnsey, 2001; Bowman et al., 2002; Grosser and Chandler, 200 2; Grosser et al., 2003; Grosser et al., 2004a; Medina-Urrutia et al., 2004; Ananthakrishnan et al., 2006; Bowman and Rouse, 2006; Bowman, 2007; Grosser et al., 2007a ; Grosser et al., 2007b). Using conventional breeding, the USDA has assessed a few thousand candidate super sour orange hybrids and has id entified to date 300 hybrids fo r further evaluation (Bowman 2007). US-812 is a newly released citrus rootst ock from the USDA, developed by crossing Sunki mandarin ( C. reticulata ) and Benecke trifoliate orange ( P. trifoliata ). It is highly tolerant to CTV and citrus blight, gives good fruit quality with hi gh yield, provides moderate tree size, and seems to have broader soil adaptation than other popular trifoliate hybrid rootstocks. This rootstock was released by the USDA in May 2001 (Bowman and Rouse, 2006). Somatic Hybridization and Breeding at th e Tetraploid Level with a Focus on Mandarin + Pummelo Combinations Somatic hybridization is a powerful approach that can overcome the sexual barriers associated with conventional breeding (Saito et al., 1991; (Grosser and Gmitter, 1990; Saito et al., 1991). For the past several years, developing superior sour orange-l ike rootstock hybrids has been a primary goal of the citrus rootstock im provement program, a successful program based on somatic hybridization that has been led by Dr. Jude Grosser at the University of Florida, IFAS; 41

PAGE 42

Citrus Research & Education Cent er. A primary focus of this progr am has been citrus rootstock improvement (Grosser et al., 2000; Grosser and Chandler, 2002). The somatic hybridization approach has been used to produce allotetraploid hybrids and subsequently tetrazygs that are zygotic tetraploid hybrids pr oduced from conventional crossing of allotetraploid somatic hybrids (Grosser and Gmitter, 1990; Grosser and Chandler, 2000; Grosser et al., 2003). Citrus rootst ock breeding and selection at th e tetraploid level is a very useful approach allowing the mixing of the geneti c pool of three or four parents. Allotetraploid hybrids produced by somatic hybridization comb ine the intact nuclear genomes of the complementary parents in order to overcome a weakness in one parent by complementation (Grosser and Gmitter, 1990; Grosser and Chandl er, 2000). Molecular marker studies indicated that sour orange is probably a hybrid of pummelo and mandarin (Nicolosi et al., 2000). Therefore, mandarin and pummelo parents were selected for desi rable rootstock attributes and these were combined to develop mandarin + pummelo somatic hybrids (Grosser et al., 2004a; Ananthakrishnan et al., 2006; Gros ser et al., 2007b; Chen et al., 2008) in attempt to develop an adequate replacement for sour orange. To date, more than 100 allotetraploid somatic hybrid combinations have been tested for their rootst ock potential with several hybrid selections showing promise, as they have been screened and show a tolerance to the Diaprepes/Phytophthora complex (Grosser et al. 2003, 2007). Fruit collection from these hybrids (propagated by top-working) followed by seed ge rmination showed that several tetraploid hybrids were able to produce nucel lar seeds (Grosser et al., 2007b). Several combinations of superior pummelo seedlings with [(Changsha and Amblycarpa) mandarins; Murcott and W. Murcott tangors, and Page tangelo] were developed using somatic hybridization. Pummelo zygotic seedlings (C. grandis), selected from a greenhouse 42

PAGE 43

screening for soil adaptation and Phytophthora resistance, were used as leaf parents in somatic hybridization experiments. Some of these pummelo selections also showed resistance/tolerance to CTV-induced quick decline after 2 years in th e field. The mandarin-type parents were chosen for their performance in the protoplast system and general rootstock performance with wide soil adaptation (Grosser et al., 2003; Grosser et al., 2004a; Ananthakrishnan et al., 2006; Grosser et al., 2007b). What Will These New Root stock Candidates Provide? Better rootstocks for citriculture should offer improved yield a nd fruit quality, better adaptation to different soil conditions, tolerance to diseases and tree size control (Wheaton et al., 1991). For example, new combinations of manda rins with pre-selected pummelos at the tetraploid level are expected to provide new s our-orange-like rootstocks with improved disease resistance and the ability to control tree size (G rosser et al., 2000). A rece nt study by Grosser et al., (unpublished data) on the eff ect of polyploidy on tree size on 47 year old sweet orange trees was conducted. The results for the tested somatic tetraploid hybrids, (based on % of Carrizo average canopy volume) sweet ora nge scion showed a dramatic d ecrease in the size of the trees, ranging from 29-85% of Ca rrizo-size. The polyploid hybrid s of two diploid rootstocks reduce the size of the sweet orange scion as compar ed to either of the di ploid rootstocks alone. For example, using the Cleopatra mandarin (Cleo) + Carrizo somatic hybrid rootstock gave 61% which is lower than Cleo (100%) or Carrizo alone (100%); Cleo + Swingle gave 35% and Swingle alone was 78%. The same trend was seen with Milam+ Kinkoji which gave 42% where Kinkoji alone was 95% (Grosser et al., unpublished data ). The small test trees were obtained on a somatic hybrid of sour orange + Benton citra nge (29%). Using the c onventional breeding and somatic hybridization techniques will make many rootstock options available in the future (Stover and Castle, 2002). 43

PAGE 44

Dissertation Objectives Previous efforts to screen new hybrid rootstocks in the greenhous e for resistance to tristeza quick decline (QD) have been confounded by seed ling yellows. Also, several studies have shown that inoculation of sweet ora nge grafted on sour orange with CTV quick declineinducing isolates does not induce decline in the greenhous e. Recently, a new procedure was used where sour orange was budded into the infected sweet orange (reciprocal budding) with different CTV isolates to screen for the ability of these isolates to cause decline (Pina et al., 2005). The main objective of the present work was to develop a reliable a ssay in the field (onto non-juvenile trees) in order to bypass the seed ling yellows problem caused by some CTV decline isolates (i.e.T36) in greenhous e assays (Garnsey, 1990). The t op-working procedure was done by grafting buds of the new rootstoc k candidates onto 15-yearold fiel d trees that showed a mixture of T30, T36, and VT genotypes of CTV. The goal was to screen new rootstocks to find a QD resistant potential replacement for sour orange and to study the citr us hybrid/CTV isolate interactions at the molecular level to learn mo re about tolerance/resistance mechanisms. Focus was on the evaluation of allotetraploid hybrids obtained primarily from somatic hybridization, tetrazygs hybrids from crosses of somatic hybrids, and a few selected open-pollinated, tetraploid seedlings from a selected mandarin + pummelo somatic hybrid female (Table 3-1). The specific goals were the following:Serological studies of CTV isol ates to determine the virus t iter in the source and rootstock candidates; trees produ ced by top-working. Molecular characterization of CTV isolates by using multiple molecular markers methods (MMM) on the source tree and the grafted rootstock candidates. Molecular characterization of CTV isolates by using the heteroduplex mobility assay to determine which CTV genotypes moved from the sweet orange interstock into the grafted materials. 44

PAGE 45

Detection of citrus tristeza virus (CTV) by using quantitativ e real time PCR (qRT-PCR) to determine the level of resistance or tole rance in the new rootstock candidates. Biochemical studies on CTV-infected rootst ock candidates inoculat ed in the greenhouse with quick decline-inducing isolates to determine the effect of CTV infection on total carbohydrate content in th e leaves and the roots based on the previous study by Garnsey and Young (1975) on the starch reserves in root s from citrus trees affected by tristeza quick decline isolates. Figure 2-1. Citrus tristeza virus as seen with a transmission el ectron microscope (TEM) after positive staining. The bar equals 55 nm. CTV is a long flexuous rod about 11 X 2,000 nm. Photo downloaded from http://edis.ifas.ufl.edu/CH089 website (P.D. Roberts, R.J. McGovern, R.F. Lee and C.L. Niblett). 45

PAGE 46

Figure 2-2. Symptoms caused by Citrus tristeza virus A) Vein-clearing symptoms in the leaf of a Mexican lime seedling (Lee, R.F.). B) Seedling yellows reaction on sour orange seedlings in the greenhouse (Roistacher, C. N.). C) Vein corking symptoms on leaves of a Mexican lime seedling inoculated with a very severe seedling-yellows tristeza isolate (Roistacher, C.N.). D) Stem p itting on grapefruit due to CTV virus in Venezuela (Lee, R.F.). E) Stem pitting on Pera sweet orange, occurring in Brazil (Lee, R.F.). F) Stem pitting causing a ropey appearance of a Marsh grapefruit trunk in South Africa (Lee, R.F.). G) Grapefruit collected from a Marsh grapefruit tree on rough lemon rootstock in Colombia affected by stem pitting strains of tristeza (Lee, R.F.). H) Sweet orange tr ee on sour orange rootstock with tristeza-induced quick decline (Lee, R.F.). Photograph in this figure were downloaded from http://www.ecoport.org The supplier of the photograph is given in the parenthesis. 46

PAGE 47

Figure 2-3. Citrus tristeza virus (CTV) genome shown the two papain -like proteases, the methyl transferase, Helicase RNA-dependent R NA polymerase (RdRp) and open reading frames (ORFs 1a, 1b, and 2-11). Diagram wa s adapted from (Satyanarayana et al., 1999). Figure 2-4. Long term rootstock trends CBRB, (Annual Report, 2003) 47

PAGE 48

Figure 2-5. CTV infection tre nd with severe isolates. 48

PAGE 49

Table 2-1. Characteristics of the top-ten citrus rootstocks of citrus in Florida adapted from (Castle et al., 2006). Characteristics Rootstock Swingle Citrumelo Carrizo citrange Kuharske citrange Kinkoji Cleopatra mandarin Volkamer lemon US-812 (Sunki x Benecke TF) Sour Orange Sun Chu Sha mandarin US-802 (Pummelo x TF) Salinity P P (P-I) ? G I ? I (I) ? High pH P P (P) (I) I T G G I+ (I) Clay soil P P ? (G) G I (I) G G (G) Freezes G G (G) ? G P (G) G (G) G Tree size I Lg Lg I Lg Lg I I Lg Lg Yield/tree I H (H) (I) L-I H H I L-I H Juice quality I I-H I L-I H L H H H L-I Blight T I ? ? S-T* S G G ? G Phytophthora nicotianae (foot and root rot) T+ I T T S T T T** S T P. palmivora / root weevil complex (S) (S) (S) (S) (S) (S) (S) T (S) (T) Burrowing nematode S T T+ (S) S S ? S S ? Citrus nematode T T (T) (S) S S T S S T Xyloporosis T T (T) (T) T T ? T T ? Exocortis (T) S (S) (T) T T ? T T ? Tristeza T T (T) T T T T S T T Key to symbols: G= good; H= high; I= intermed iate; L=low; Lg = large; P=poor; S=susceptible; T=tolerant; () = expected rating. S-T* means that while incidence of blight is low among trees, s ubstantial losses can occur when the trees are 12 to 15 years old th e infection is high in trees T**= Sour orange has good foot rot tole rance but mediocre ro ot rot tolerance. 49

PAGE 50

CHAPTER 3 DEVELOPMENT OF A TOP-WORKING ME THOD AND BIOCHEMICAL STUDIES TO EVALUATE ROOTSTOCK CANDIDATES FOR CITRUS TRISTEZA VIRUS (CTV) QUICK-DECLINE (QD) RESISTANCE IN EFFORTS TO REPLACE SOUR ORANGE Introduction Changing the cultivar of an existing tree is known as top-working. Top-working has been done in several crops such as pine trees (B ramlett and Burris, 1995); pears (XinZhong et al., 2005); apple trees (Blazek, 2002); walnut (Rez aee, 2008) and citrus (Button, 1975). Both rootstock and the interstock must be compatible with the new top, and compatibility of various citrus combinations was studied by Tanaka (1981 ). In citrus, the topworking of established citrus trees is sometimes desirable for a number of reasons. For example, it is advantageous to change to a different variety when the original selection is nonproductive, or of poor quality (Opitz, 1961). Trees threatened by virus disease may be saved by t op-working to a tolerant scion (Platt and Opitz, 1973). Several pr ocedures including Tbudding a nd grafting can be used to top work citrus trees, but some of these procedures require considerable horticultural skills. Topworking trees usually become productive sooner th an nursery trees because of the already wellestablished root system (Platt and Opitz, 1973). In this study, top-working t echnique was applied as a new method to screen new citrus rootstock candidates developed for quick decline (QD) disease caused by citrus tristeza virus (CTV) resistance in an effort to find a replacemen t for sour orange. Previous efforts to screen new hybrid rootstock candidates in the greenhouse for resistance to quick decline have been confounded by another less important CTV disease called seedling yellows (Garnsey, S. M; unpublished data). Other researcher s reported on the difficulty and the length of time in inducing QD symptoms in sweet orange grafted onto s our orange rootstock under greenhouse conditions (Pina et al., 2005). Therefore, topworking was used here in an e ffort to develop a reliable assay 50

PAGE 51

for QD resistance. An added benefit of this appro ach is that the end result is a seed producing tree of any new rootstock candidate s howing resistance to quick decline. Materials and Methods Top-working Pre-selected rootstock candidate s developed mainly via protop last fusion (Table3-1) were top-worked using the hanging bud method (Fig. 3-1) onto 15 year old Hamlin/Carrizo trees infected by three different strains of CTV common to Florida (T 30, T36 and VT); the three CTV isolates important in Florida (T30, T36 and VT). Seventytwo selecti ons, including parental pummelos and pre-selected sour-orange-lik e pummelo-mandarin rootstock hybrids produced in vitro via protoplast fusion (Figure 3-1) were us ed. The germplasm included in the present CTV study was divided into different categories including selected z ygotic pummelos (somatic hybrid parents), somatic hybrids, tetrazygs (zygotic tetraploids from cr osses of two somatic hybrids), diploid hybrids, and open pollinated tetraploids (Table 3-1). Virus infection in the Hamlin interstock was determined prior to top-working by doubleantibody sandwich enzyme-linked immunosorbent assay (ELISA). The 15-year old Hamlin sweet orange trees were located in the North-40 re search field, north of the Citrus Research and Education Center (CREC). The trees were pr uned down to 4 scaffolds. The top-working procedure using the hanging bud method (Figure 3-1) was applied one month after the pruning to allow the tree to recover from the shock of th e severe pruning. One branch of each tree was dedicated for sour orange (control), and then th e three remaining scaffold branches were all grafted with one rootstock ca ndidate selection. Summer was the best season for grafting, therefore grafting was done in June and July. The buds were wrapped using the grafting tape for 3-4 weeks then they were unwra pped carefully. If the buds were alive and appeared to be well callused in, the budded limbs were shortened or girdled to stimulate bud growth. As the shoots 51

PAGE 52

grew, they were tied to the stumps of the gi rdled and defoliated branch es. Trees were painted white to reduce unwanted sprouting from the Hamlin interstock. The regular maintenance of the field including i rrigation, fertilization, pesticide treatments and weed control were performed by the CREC grove crew according to a routine schedule. The new graft was maintained, observations of diseas e symptom development and shoot growth were recorded periodically. The da ta for the shoot growth were analyzed by one-way ANOVA (analysis of variance) using SAS (2000). Mean (a verage) values were separated using the Least Significant Difference (LSD) separation of means at a probability level of 0.05. Seedling Yellows (SY) Assay A small experiment in the greenhouse was carried out to evaluate some of the tested rootstock candidates (sub-population of the top-work ed field study selections), to study their SY reaction in the greenhouse. Seedlings of nine different somatic hybrid rootstock candidates (A+ HBJL-1, A+ HBJL-3, Page + HBJL-3, A + SN7, A+ HBJL-5, A+ Chandler #A1-11, A+ 4-4-996, A+ 4-3-99-2 and A+ 7-2-99-5) were used in this experiment along with sour orange seedlings as a control. Three replicates were inoculated for each rootstock candidate along with 3 healthy un-inoculated controls for each. Th e test seedlings were inoculated with the quick decline isolate (T36) in citrus macrophylla provided by Dr. Dawsons lab using the invertedT budding method. The experiment was done in Dr. R.H. Brlanskys greenhouse and the plants were maintained as the rest of the plants in the greenhouse. After 2-3 weeks, the grafts were unwrapped then all plants were trimmed down to the same height to force new flush, and visually monitored for SY reactions on the new fl ush. After 8 months all the plants were tested for CTV by ELISA to confirm the CTV infection. Visual assessments of SY symptoms were done according to methods detailed by Garnsey et al., (1987b) and with the help of Cecile J. 52

PAGE 53

Robertson. The severity score (0-3) was assigne d to each plant where 0 = no symptoms, and it was assigned to the un-inoculated healthy control, whereas the sour orange was scored as a 3. Chlorophyll a, chlorophyll b, and total chlorophy ll content in the test rootstock candidates Chlorophyll a, chlorophyll b and total chlorophy ll were measured to determine the loss of the chlorophyll content due to the CTV T36 infection and relate this to the chlorosis in leaves as a symptom of the SY. The procedure was done acco rding to Mackinney (1941). Ten leaves were randomly sampled from each plant where similar si zed leaves were uniformly collected from the test rootstocks in the SY experiment. The l eaves were ground in liquid nitrogen. Then, the extracts were prepared by crushing the plan t material in 4 ml 80 % acetone. During this operation, the mortars were kept into the ice bath. The decanted supernatants obtained from each replicate (three) were recombined and the total volume was adjusted to 10 ml, and optical density (absorbance) evaluated at OD 663 nm and OD 645 nm in order to determine chlorophyll a and chlorophyll b respectively using UV-Vis spectrophotometer. The chlorophyll concentrations as g/L were obtained from the following equations: Chlorophyll a (mg/g) = {(0.1127 x OD663 x d 0.0259 x OD645 x d)}/M Chlorophyll b (mg/g) = {(0.229 x OD645 x d 0.0467 x OD630 x d)/M Where d = dilutions (1) and M = sample weight (0.25 g). The total chlorophyll co ncentration (mg/g) = Ch lorophyll a + Chlorophyll b. Starch assay and biochemical aspects of CTV-quick decline problem To test the compatibility or the incompa tibility between the top-worked rootstock candidates and the Ham lin interstock, anatom y of the bud-union was examined to determine the presence of any necrosis in the bud-union area. Samples of the bud-union of sour orange or tested hybrids on infected sweet orange were taken and freeze sectioned using a microtone. Ten to twenty sections for each sample were st ained then examined under the microscope and 53

PAGE 54

compared to the negative control from the gr eenhouse (healthy sour oran ge on healthy Hamlin sweet orange) and no necrotic ce lls were detected. The results showed no differences between sour orange and all test CTV-inf ected rootstock candidates. A possibl e explanation for this is that it may be too soon for the necrotic cells to have formed. Azure A staining also was used to stain sections of test rootstocks a nd sour orange from the field then the CTV inclusion bodies were counted in the infected tissue and there were no significant differe nces in the number of the CTV inclusion bodies in the infected tissue of sour orange, infect ed rootstock candidates or the interstock. Starch content in the roots and the leaves as an indicator of CTV QD infection The problem with the quick de cline of sweet orange on sour orange is a budunion problem where necrosis occurs causing the death of phloem tissue, and thus sugars produced in leaves are blocked from being transported to the roots. Eventually, the feeder roots use up stored starch and start to die, leading to the ultimate death of the tree (Brlansky et al., 2008; Futch and Brlansky, 2008). Although the Spanish assay (Pina et al., 2005) to assess QD usi ng reciprocal grafting (grafting sour orange on CTV-QD infected sweet orange) was working well to determine the QD affect in the greenhouse, no simila r results on the Florida rootstoc ks were reported. After several useful discussions with Dr. R. H. Brlansky, it was still questi onable if the reciprocal model would provide as accurate results as the standard ordinary sweet ora nge on sour orange graft. For better understanding, another experiment was conducte d in the greenhouse by using selected test somatic hybrids (A + 4-3-99-2, A + 4-4-99-6, A + HBJL-1, A + HBJL-3, A + HBJL-5, A + Chandler #A1-11, Page + HBJL-3, A + SN7 and A + 7-2-99-5) as a rootstock along with sour orange as a control. Three rep licates were inoculated for each test rootstock along with three healthy controls. The quic k decline isolate T36 in Citrus macrophylla (kindly provided by Dr. Dawsons lab) was used for the inoculation of the sour orange and the test ed rootstocks, then the 54

PAGE 55

CTV infection was confirmed by MCA13 ELISA six months after inoculation. The pathogen free Hamlinsweet orange provided by Dr. R. H. Brlansky was T-budded into these rootstocks. Starch content in the leaves and the roots wa s then measured, based on the previous study by Garnsey and Young (1975) who showed that starch reserves were depleted in roots from citrus trees affected by tristeza quick decline isolates. Iodine staining using iodine solution (8.8 g KI + 2.2 g I2 /L) was conducted according to Hong and Truc (2003) to test for starch accumulati on in the roots of the infected seedlings from the greenhouse along with the hea lthy controls Starch content in leaves and roots (mg/g dry weight) was done according to Nelson (1944) and Somogy (1952) colorimetric method (see Appendix a). The measurment was done at OD520 nm using Shimadzu UV-Visible spectrophotometer UV-160. Five standars of gluc ose were prepared: 0, 10, 20, 40, and 60 g/ L and were run along with the samples. The starch content (mg/g) = [glucose concentration from the spectrophotometer X sample vol ume (5 mL)] /dry weight (g). The data for the starch content were analyzed by one-way ANOVA (analysis of variance) using SAS (2000). Mean (average) values were separated using the Least Signifi cant Difference (LSD) separation of means at a probability level of 0.05. Results and Discussion Top-working Experiment Shoot growth The shoot growth of the grafted materials on the Hamlin interstock s was recorded every three months, and the presented data 18 months after top-working graft (Table 3-2). Overall, there were significant differences in the shoot length among all the test selections, especially in comparison with sour orange that was severely stunted. These field results were in agreement with a greenhouse study conducted by Pina et al., (2005). They stat ed that inoculation of sweet 55

PAGE 56

orange grafted onto sour orange with QDinducing isolates does not induce decline in the greenhouse. In order to overcome this problem they developed a quick decline assay using reciprocal grafting in the gr eenhouse where sour orange was budded into the infected sweet orange with different CTV isolates to screen for the ability of these isolates to cause graft union necrosis and decline. The results showed that buds propagated on healthy seedlings or on those infected with a non-decline isolate grew norma lly; producing shoots at least 20 cm long after 2 months, whereas buds propagated on seedlings infected with QD-inducing isolates did not sprout or produced very weak shoots less than 5 cm. These results may be caused by failure to produce a normal budunion on seedlings infected with QD -inducing isolates. This procedure allows evaluation of decline ability in 6-8 months af ter inoculation under greenhouse conditions in Spain (Pina et al., 2005). In th e present study, overall the highes t shoot growth in the seventyfour tested germplasms was with the 5-1-992 pummelo seedling, whereas the somatic hybrid Amb + HBJL-4 showed the lowest shoot growth. In the parental Pummelo seedling category, the highest three shoot growth obtai ned were from seedlings 5-1-99-2 (268.67cm 50), HBJL-3 (254.00 cm .25.24) and 8-1-99-2B (252.33 cm 34.0), (Table 3-2 and Figure 3-2). The lowest shoot growth in the pummelo seedlings were in 4-4-99-4, MG10 and SN3, with shoot growth 123.00 cm 21.63, 116.67 cm .50 and 140.00 cm 11.14 respectively (Table 3-2 and Figure 3-2). For the somatic hybrid category, the highest three shoot growth we re obtained by Amb+ HBJL-1, Amb+ HBJL-3, and Amb+HBJL-2B with values 286.33 cm 13.32, 280.33 cm .54 and 278.67 cm 29.54, respectively (Table 3-2 and Figure 3-3). Whereas, the lowest shoot growth were obtained by somatic hybrids Amb+HBJL-4 (98.67cm .01) and Amb + Chandler#69 (99.33 cm 8.02). In the tetrazyg ca tegory, the highest grow th rate was obtained by Green 6 (265.00 cm 34.07). However the te trazyg N+HBP x SO +RP-04-7 showed the 56

PAGE 57

lowest shoot growth (108.00 cm 38.74), (Table 3-2 and Figure 3-4). For the diploid hybrid category, the highest shoot grow th was for Volk x P (268.67 cm .74) whereas the rootstock 46x20-04-12 showed the lowest shoot growth (108.33 cm .86), (Table 3-2 and Figure 3-5). The open-pollinated tetraploid group included 22 47-OP-A2 rootstock with the highest shoot growth 226.33 cm .69, whereas the rootstoc k SORP-OP-02-8 showed the lowest shoot growth (146.00-06.56), (Table 3-2 and Figure 3-6) There was no significa nt difference between Marsh grapefruit and Ruby Red Grapefru it, 237.33 cm 14.84 and 224.67 cm .01 respectively (Table 3-2 and Figure 3-7). The sour orange shoot growth mean was 66.67 2.52 and there were significant differences between the shoot growth of most of the test hybrid rootstocks and sour orange except A+7-2-99-5, A+HBJL-4, Amb+ Chandl er #69, Murcott+ Chandler#80, Murcott+ Chandler#A-11, Amb+SN7 and Amb+MG-1. These re sults clearly showed that except for the few stunted rootstock candidates mentioned abov e, the top-worked rootstock candidates are growing well, indicating a normal formation of the budunion. It is important to note that there was a strong correlation between the shoot growth and the MCA13, ELISA data presented in Chapter (4). In general, most r ootstock candidates in the category with no virus or with low CTV titer based on MCA13, ELISA, exhibited a high shoot growth, whereas the slightly tolerant and susceptible category hybrids with high CTV titer exhibited low shoot growth. Disease symptoms Stems of all the grafts were collected 12 months after grafting. The bark was peeled and no stem pitting symptoms were found, even after ob servation under the light microscope. Visual observation of stem pitting symptoms is an obvi ous indicator generally used to identify the presence of stem pitting isolates. In general, no seedling yellows-type symptoms were observed in any of the top-worked trees, in cluding the sour orange grafts. This result indicates that top57

PAGE 58

working overcame the seedling yellows (SY) effect that has previously caused problems with our greenhouse QD resistance assays. Vein clearing was noticed in all the sour orange and in two somatic hybrid rootstock candidates (Murcott+ Chandler # 80 and Amb +7-2-99-5). The only other clearly observed symptom wa s the stunted growth in all top-worked sour orange, the diploid pummelo seedling MG-10, and in the fo llowing somatic hybrid rootstock candidates: Amb+ 7-2-99-5, Amb+ Chandler # 69, Amb+MG1, Amb+ HBJL-4, Murcott+ Chandler # 80, Murcott + Chandler # A1-11 and Amb+ SN7. These results indicate that these selections are highly susceptible to CTV infection. Top-working advantage to fast fruiting Another advantage of the top-working appr oach is to speed flowering and fruiting, allowing for a more rapid assessment of the test rootstock candidates fo r seed propagation. Some of the top-worked rootstock candidates incl uding SRxSH-99-5, 4-3-99-2, 5-1-99-2, 4-4-99-4 and 7-2-99-2 are already bearing fruits (Figure 3-1). Many of the top-worked rootstock selections are growing well and are expected to fruit during the next year or two. As they fruit, seed will be extracted to determine seediness (excluding the pa rental pummelos). Microsatellite analysis will be conducted on germinated seedlings to determin e if they are of zygotic or nucellar origin. Nucellar seedlings are very favorable since, the st andard nursery propagation of rootstocks relies on nucellar seedlings for rootstock uniformity. Alternatively, good rootstock candidates producing zygotic seedlings could be propa gated using a rooted cutting method. General considerations for improving the top-working QD-resistance assay Choosing healthy, relatively young trees is critical for successful top-working. Grafting can be done to scaffold branches or a trunk. If the trunk is used, it minimizes the new sprouts from the interstock. You have to have a flowing sap for a successful graft. 58

PAGE 59

The hanging bud method provides a high efficient method for top-working. Girdle above the graft to enhance the bud growth. Painting the trees with whitewash from the ground level to just above the bud insertion to inhibit sprouting. Interstock sprouts must be removed in a ti mely fashion to ensure proper subsequent genotypic identification. The number of buds required per tree for su ccessful top-working depends on the tree condition. The use of bright color spray paint facilitates the identification of grafted branches. Even under the best conditions, it was uncomm on to have 100% budtake in top-working, but 80-90% success was common, which we considered good. Bud shoots should be allowed to grow to about 15 inches and then pruned to nine inches for strengthening, with repeated pruning as needed. Vigorous shoots growing from ne w grafts are more susceptibl e to wind breakage, this can be minimized by the add ition of physical supports. If available, it would be benefici al in future work if at least three replicate trees were used for each candidate rootstock selection. Whitewash ing the trees prior to grafting is highly recommended. Leafminer damage on new flush was a significant problem. Careful management of irrigation, fertiliza tion and pesticides is a necessity. Seedling Yellows Experiment and Total Chlorophyll Content Results showed that all the rootstock candidates have a SY reaction 8 months after inoculation of T36 isolate. The typical SY sy mptoms caused by CTV are a severe chlorosis, stunting and vein corking of s our orange, lemon or grapefruit The SY symptoms are commonly observed in nurseries (Fraser, 1952) and greenhouses but they are not usually seen in the field (Roistacher, 1982). Shoot measurements in cm (Table 3-3 and Figure 3-10) and the total chlorophyll in mg/g tissue (Table 3-4) indicated that somatic hybrids A + 7-2-99-5 (35 cm) and A + SN7 (25 cm) were as bad as sour orange (30 cm) rootstock compared to their controls in terms of the stunting reaction. They also gave th e same score of SY symptoms (3), the highest 59

PAGE 60

score possible with low chlorophyll content (0.34 mg/g, 0.30 mg/g and 0.29 mg/g), respectively. Somatic hybrids A + HBJL-1, A+HBJL-3 and A+ HBJL-5 showed shoot length (76 cm, 80 cm, and 72 cm) with SY scores of 2.5, 2 and 3 resp ectively and the total ch lorophyll content was 0.86 mg/g, 1.09 mg/g and 0.36 mg/g, respectively. So matic hybrids; A+ 4-3-99-2, A+4-4-99-6 and A+ Chandler #A1 -11 produced shoot lengths of 99 cm, 63 cm and 59 cm, respectively with SY scores of 2.5, 2.5 and 3 respectively. Page + HBJL-3 had a score of 3 in terms of SY symptoms with shoot growth of 53cm. (Table 3-3 and Fi gures 3-8 and 3-9). Total chlorophyll data is presented in Table (3-9) and Figure (3-10). In ge neral, there was a strong correlation between the losses of total chlorophyll content and the severity score of SY symptoms. In conclusion, most of SY data was in cont rast with data from the field top-working experiment. In the current SY study, the somatic hybrid A + 7-2-99-5 showed strong SY symptoms in the greenhouse study, and a high sus ceptibility to CTV in the top-working field study, and it was rated as a susceptible rootstock. However, several othe r tested somatic hybrid rootstocks (A + Chandler #A1-11, A+ HBJL-5,and A+ 4-4-99-6) showed a strong SY reaction in the greenhouse study, but none of these showed any SY reaction or any disease symptoms in the field and they were rated as tolerant or intermediate. Theref ore, there is clearly no strong correlation between the SY and QD diseases, a nd the top-working approach provides a more reliable screen for CTV-QD resistan ce in the new rootstock candidates. Starch content and biochemica l aspects of CTV-QD problem The results of the iodine staining showed that the starch content decreased in the roots in CTV-infected rootstock candidates as compared to the healthy controls (Figure 3-11). These visual results were supported by quantification of starch content (mg/g dry weight) in the leaves and the roots of the test rootstock candidates. Da ta is presented in Table (3-5) and Figures (3-12 and 3-13). The rootstock candidate s; A+ Chandler #A1-11, A+ 7-299-5 and sour orange showed 60

PAGE 61

increases in starch content in the leaves (125.51 mg/g 1.92 dry weight, 127.49 mg/g 2.83 dry weight and 135.52 mg/g 2.06 dry we ight respectively) as compared to the healthy controls (Table 3-5). These rootstocks show severe SY symptoms in the greenhou se assay. These results were in contrast with the data from the field top-working experiment for the rootstock candidate A + Chandler #A1-11. The rootstock candi dates A + 4-3-99-2 (63.82 mg/g 2.35), and A+HBJL-1 (84.58 mg/g 5.32) gave the lowest starch content in the leav es with no significant difference to the control (Table 3-5). The deplet ion of the starch content in the roots of CTV infected rootstocks was not severe. However, it was more pronounced in rootstocks, A+ 7-2-99-5 (79.56 mg/g 3.35), Page + HBJL-3 (84.58 mg/g dry weight 2.06) and the sour orange control (69.91 mg/g 3.92). In general, there was no signif icant difference in starch content (mg/g) in roots of healthy and CTVinfected rootstoc ks; A + HBJL-1 (122.57 mg/g 2.62), A+ HBJL-5 (123.35 mg\g 2.76) and A+ Chandler #A1-11 (88.21 mg/g 2.59 ) compared to the healthy controls (129.95mg/g 2.29, 121.31mg/g 4.84 a nd 100.16 mg/g 5.59), respectively (Table 3-5). Interestingly, at the end of the experiment, plants were removed from the soil to examine the root systems. There were no observable differe nces between the root systems in the infected and healthy rootstocks. All show ed healthy and strong root systems, including the sour orange rootstock, which supports the absence of QD pheno menon in the greenhouse after infection with the CTVQD T36 isolate. The activities of su crose synthase and sucr ose phosphate synthase enzymes which in return affected the starch accu mulation in the leaves were determined (data not shown). These two enzymes are among the enzy mes that control the sucrose synthesis. In general these enzymes activities were 2-10 fold hi gher in the healthy tested leaves than in the CTV infected leaves of Hamlin sweet or ange grafted on sour orange rootstock. 61

PAGE 62

In conclusion, the carbohydrate data suggest s that CTV QD infection alters carbohydrate metabolism and this phenomenon should be furthe r studied to understand the role of CTV-QD infection in the carbohydrate formation and transl ocation. This suggests that the CTV infection may alter some of the genes that control ca rbohydrate metabolism and targeting of starch translocation to the phloem, resulting in phloem necrosis. Further investigation to determine the relationship between carbohydrates and CTV-QD disease might pr ovide an answer about the mechanism and affect of CTV QD infection on ca rbohydrate synthesis and tr ansport, and help to explain why QD is difficult to read in the greenhouse. It could be because there is enough carbon available in greenhouse seedlings to temporarily carry out photosynthesis. If the QD is only a budunion necrosis problem, it should still be dete rmined why there is budunion problem in the field with mature trees, but that is not obvious in the gree nhouse. The role of carbohydrate metabolism and transport in the QD phenomenon requires further study. 62

PAGE 63

Figure 3-1. Summary of the top-wo rking technique. A) Protoplast fusion protocol. B, C, D, E and F) Hanging bud steps. G) Sour orange to the left and 2247-OP-A2 to the right. H) Examples of the top-worked trees. I) Over view of the top-worked groove. J, K and L) Examples of the top-worked trees (4-3-99-2, 7-2-99-2 and (SRXSH) 99-5) respectively after fruiting. 63

PAGE 64

Pummelo shoot growthGermplasm 4-3 99-2 43 -99-2 s e t 7 4 -4 -994 5-1 -992 7-2 -99 -1 7-2 99-2 7-3-99-1 8-1-99-4A 8 -1-99 2B 8 -1-9 94B 8 -1994B set 2 8-2-99-1 Chandler #A1-11 H B JL-3 R6T16 H B JL3 R 1 0T20 H B JL-4 HBJL-5 HBJL7 HBJ L -12 MG-10 MG-1 1 S N 3 Sour or an ge Growth (cm) 0 50 100 150 200 250 300 Figure 3-2. Shoot length (cm) of the pummel parents and the sour orange in average18 months after grafting. 64

PAGE 65

Somatic hybrids shoot growthGermplasm A m b + 4 3 9 9 2 A m b + 4 4 9 9 6 A m b + 5 1 9 9 1 B A m b + 5 1 9 9 3 A m b + 7 2 9 9 5 A m b + 7 3 9 9 1 A m b + 8 1 9 9 4 A A m b + C h a n d l e r A m b + C h a n d l e r # A 1 1 1 A m b + C h a n d l e r # 6 9 A m b + H B J L 1 A m b + H B J L 2 B A m b + H B J L 3 A m b + H B J L 4 A m b + H B J L 5 A m b + H B J L 7 A m b + H B P A m b + M G 1 A m b + S N 7 A m b + M G 1 0 C h a n g s h a + H B J L 3 C h a n g s h a + H B J L 5 C h a n g s h a + H B J L 7 M u r c o t t + 4 4 9 9 6 M u r c o t t + C h a n d l e r # A 1 1 1 M u r c o t t + C h a n d l e r # 8 0 M u r c o t t + H B J L 1 M u r c o t t + S N 3 P a g e + H B J L 3 P a g e + H B J L 7 S u c c a r i + H B P W M u r c o t t + H B J L 7 S o u r o r a n g e Growth (cm) 0 50 100 150 200 250 300 350 Figure 3-3. Shoot length (cm) of the somatic hybrid s rootstock candidates and the sour orange in average18 months after grafting. 65

PAGE 66

Tetrazygs shoot growthGermplasm 2 2 4 7 x 6 05 6 0 0 2 ( B lu e 2 ) 2 2 4 7 x 6 05 6 0 0 7 ( B lu e 7 ) 2 2 4 7 x 6 0 73 0 0 4 ( Gr e e n 4) 224 7 x 6 0 73-00-6 (Gree n 6) 2 2 4 7 x 607 3 0 0-8 ( G reen 8) 2247 x 2 0 60-00-1 (P u rple 1) 224 7 x 2060-0 0 3 ( Purple 3 ) 2247 x 15 7 1-00-4 (Whi t e 4) N + HBP x S O + R P -04-7 (SR x S H )-99-5 S o ur orange Growth (cm) 0 50 100 150 200 250 300 Figure 3-4. Shoot length (cm) of the tetrazygs rootstock candida tes and the sour orange in average18 months after grafting. 66

PAGE 67

Diploid hybrid shoot growthGermplasm 4 3 x 2 0 0 4 1 4 6 x 2 0 0 4 1 2 4 6 x 2 0 0 4 1 9 V o l k x P S o u r o r a n g e Growth (cm) 0 50 100 150 200 250 300 Figure 3-5. Shoot length (cm) of the diploid hybrids rootstock candi dates and the sour orange in average18 months after grafting. 67

PAGE 68

Open pollinated tetrap loid shoot growthGermplasm 2 2 4 7 O P A 1 2 2 4 7 O P A 2 2 2 4 7 O P A 5 S O R P O P 0 2 8 S o u r o r a n g e Growth (cm) 0 50 100 150 200 250 Figure 3-6. Shoot length (cm) of the open pollinated tetraploid r ootstock candidates and the sour orange in average18 m onths after grafting. 68

PAGE 69

Grapefruit shoot growthGermplasm M a r s h g r a p e f r u i t R u b y R e d g r a p e f r u i t S o u r o r a n g e Growth (cm) 0 50 100 150 200 250 Figure 3-7. Shoot length (cm) of Marsh grapefruit, Ruby Red grapefruit and the sour orange in average18 months after grafting. 69

PAGE 70

SY experiment A+HBJL-1 A+HBJL-3 A+4-4-99-6 A+HBJL -5 A+4-3-99-2 A+7-2-99-5 Page+HBJL-3 A+SN7 A+Chandler#A111 Sour orange Figure 3-8. Seedling yellows symptoms of rootstock candidates 8 months after inoculation of T36 in the greenhouse. White arrows refer to rootstock candidate s and black arrows refer to control plants. 70

PAGE 71

Figure 3-9. Shoot length (cm) and the seedling yellows symptoms of test rootstock candidates inoculated with T36 in the greenho use 8 months after inoculation. 71

PAGE 72

Figure 3-10. Total chlorophyll content (mg/g dry weight) in test rootstock candidates showing chlorosis symptoms 8 mont hs after inoculation with T36 in the greenhouse. 72

PAGE 73

A B C D E F G J H I L K Figure 3-11. Iodine staining of the roots of the te st rootstocks infected with CTV-T36. A) Root of sour orange CTV infected rootstock. B) Root of sour orange rootstock healthy control. C) Root of CTV in fected A+4-3-99-2 rootstock. D) Root of CTV infected A+4-4-99-6 rootstock. E) Root of CTVin fected A+HBJL-1 root stock. F) Root of CTVinfected A+HBJL-3 rootstock. G) Root of CTVinfected A+HBJL-5 rootstock. H) Root of CTVinfected A + Chandler #A1-11 rootstock. I) Root of CTV infected A+7-2-99-5 rootstock. J) Root of A+7-2-99-5 rootstock healthy. K) Root of CTV infected A+SN7 rootstock. L) Root of CTV infected Page +HBJL-3 rootstock. 73

PAGE 74

Germplasm A+ 7-2-995 A+ C h andler #A1-11 A+ HBJL-1 A + HB J L3 A+ HBJL-5 A + S N7 A+4-3-99-2 A + 4499-6 Page +H B JL-3 S our Ora ng e Starch mg/g dry weight 0 20 40 60 80 100 120 140 160 Control Infected Figure 3-12. Starch content (mg/g dry weight) 12 months after inoc ulation of T36 CTV-QD isolate in the greenhouse. 74

PAGE 75

Table 3-1. Identification and description of the germplasms included in the field top-working study. Germplasm Description Pummelo parent (Citrus. grandis L. Osb.) 4-3-99-2 Pummelo parent: selected seedling of Sha Tian You Pummelo 4-3-99-2 set 7 Pummelo parent: selected seedling of Sha Tian You Pummelo 4-4-99-4 Pummelo parent: selected seedling of Siamese Pummelo 5-1-99-2 Pummelo parent: selected seedling of Hirado Buntan Pummelo (HBP) 7-2-99-1 Pummelo parent: selected seedling of Large Pink Pummelo 7-2-99-2 Pummelo parent: selected seedling of Large Pink Pummelo 7-3-99-1 Pummelo parent: selected seedling of Siamese Sweet Pummelo 8-1-99-4A Pummelo parent: selected seedling of Liang Ping Yau Pummelo 8-1-99-2B Pummelo parent: selected seedling of Liang Ping Yau Pummelo 8-1-99-4B Pummelo parent: selected seedling of Liang Ping Yau Pummelo 8-1-99-4B set2 Pummelo parent: selected seedling of Liang Ping Yau Pummelo 8-2-99-1 Pummelo parent: selected seedling of pummelo from the DPI Chandler #A1-11 Pummelo parent: selected seedling of Chandler pummelo HBJL-3 R6T16 Pummelo parent: selected seedling of Hirado Buntan Pummelo HBJL-3 R10T20 Pummelo parent: selected seedling of Hirado Buntan Pummelo HBJL-4 Pummelo parent: selected seedling of Hirado Buntan Pummelo HBJL-5 Pummelo parent: selected seedling of Hirado Buntan Pummelo HBJL-7 Pummelo parent: selected seedling of Hirado Buntan Pummelo HBJL-12 Pummelo parent: selected seedling of Hirado Buntan Pummelo MG-10 Pummelo parent: selected seedling of Hirado Buntan Pummelo MG-11 Pummelo parent: selected seedling of Hirado Buntan Pummelo SN3 Somatic Hybrids Pummelo parent: selected seedling of Hirado Buntan Pummelo Obtained from mandarin + pummelo protoplast fusion Amblycarpa (Amb) + 4-399-2 Somatic hybrid: Amblycarpa mandarin ( Citrus amblycarpa Oche) + selected seedling of Sha Tian You Pummelo Amb + 4-4-99-6 Somatic hybrid: Amblycarpa mandarin + selected seedling of Siamese Pummelo Amb + 5-1-99-1B Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + 5-1-99-3 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + 7-2-99-5 Somatic hybrid: Amblycarpa mandarin + selected seedling of Large Pink Pummelo Amb + 7-3-99-1 Somatic hybrid: Amblycarpa mandarin + selected seedling of Siamese sweet Pummelo Amb + 8-1-99-4A Somatic hybrid: Amblycarpa mandarin + selected seedling of Liang Ping Yau Pummelo Amb + Chandler Somatic hybrid: Amblycarpa mandarin + selected seedling of Chandler pummelo Amb + Chandler # 69 Somatic hybrid: Amblycarpa mandarin + selected seedling of Chandler pummelo Amb + Chandler #A1-11 Somatic hybrid: Amblycarpa mandarin + selected seedling of Chandler pummelo 75

PAGE 76

Table 3-1. Continued. Germplasm Description Amb + HBJL-1 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + HBJL-2B Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + HBJL-3 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + HBJL-4 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + HBJL-5 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + HBJL-7 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + HBP Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + MG1 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + MG-10 Somatic hybrid: Amblycarpa mandarin + selected seedling of Hirado Buntan Pummelo Amb + SN7 Somatic hybrid: Amblycarpa mandarin + selected seedling of Liang Ping Yau Pummelo Changsha + HBJL-3 Somatic hybrid: Changsha mandarin ( C. reticulata Blanco) + selected seedling of Hirado Buntan Pummelo Changsha + HBJL-5 Somatic hybrid: Changsha mandarin + selected seedling of Hirado Buntan Pummelo Changsha + HBJL-7 Somatic hybrid: Changsha mandarin + selected seedling of Hirado Buntan Pummelo Murcott + 4-4-99-6 Somatic hybrid: Murcott tangor ( C. reticulata Blanco x C. sinensis Osbeck) + selected seedling of Siamese Pummelo Murcott + Chandler #80 Somatic hybrid: Murcott + selected seedling of Chandler pummelo # 80 Murcott + Chandler #A1-11 Somatic hybrid: Murcott + selected seedling of Chandler pummelo # A1-11 Murcott + HBJL-1 Somatic hybrid: Murcott + selected seedling of Hirado Buntan Pummelo Murcott + SN3 Somatic hybrid: Murcott + selected seedling of Hirado Buntan Pummelo Page + HBJL-3 Somatic hybrid: Page tangelo [(Minneola( C. reticulata Blanco X C. paradisi Macf) x Clementine mandarin ( C. reticulata Blanco)] + selected seedling of Hirado Buntan Pummelo Page + HBJL-7 Somatic hybrid: Page tangelo + selected seedling of Hirado Buntan Pummelo Succari + HBP Somatic hybrid: Succari Sweet orange + Hirado Buntan Pummelo W.Murcott + HBJL-7 Somatic hybrid: W. Murcott tangor ( C. reticulata Blanco x C. sinensis Osbeck) + selected seedling of Hirado Buntan Pummelo 76

PAGE 77

77 Table 3-1. Continued. Germplasm Description Tetrazygs Origin: from crosses of allotetraploid somatic hybrids 2247 x 6056-00-2 (Blue 2) Tetrazygy: Nova* mandarin hybrid + HBP somatic hybrid/ Sour Orange (S.O)**+ Palestine sweet lime (PSL) 2247 x 6056-00-7 (Blue 7) Tetrazygy: Nova mandarin + HBP somatic hybrid/ S.O + PSL somatic hybrid 2247 x 6073-00-4 (Green 4) Tetrazygy: Nova mandarin + HBP somatic hybrid/ S.O + Carrizo citrange somatic hybrid 2247 x 6073-00-6 (Green6) Tetrazygy: Nova mandarin + HBP somatic hybrid/ S.O + Carrizo citrange somatic hybrid 2247 x 6073-00-8 (Green 8) Tetrazygy: Nova mandarin + HBP somatic hybrid/ S.O + Carrizo citrange somatic hybrid 2247 x 2060-00-1 (Purple 1) Tetrazygy: Nova mandarin + HBP somatic hybrid/ Cleopatra mandarin (Cleo) + S.O somatic hybrid 2247 x 2060-00-3 (Purple 3) Tetrazygy: Nova mandarin + HBP somatic hybrid/ Cleo + S.O somatic hybrid 2247 x 1571-00-4 (White 4) Tetrazygy: Nova mandarin + HBP somatic hybrid / Succari sweet orange + Argentine trifoliate orange ( Poncirus trifoliata) somatic hybrid N + HBP x SO + RP-04-7 Tetrazygy: Nova mandarin + HBP somatic hybrid/ S.O + rangpur (RP) somatic hybrid (SR x SH) 99-5 Tetrazygy: S.O + RP somatic hybrid / Cleo + Sour orange somatic hybrid Diploid Hybrids Obtained from conventional crosses 43 x 20-04-1 Diploid Hybrid: Ling Ping Yau sdlg. Pummelo x Cleopatra mandarin 46 x 20-04-12 Diploid Hybrid: Hirado Buntan Pummelo x Cleopatra 46 x 20-04-19 Diploid Hybrid: HBP x Cleopatra Volk x P Diploid Hybrid : Volkamerian lemon ( C. Volkameriana ) / unknown pummelo OP tetraploids Source: open pollination of allotetraploid somatic hybrid 2247-OP-A1 Tetraploid : selected Mandarin/ pummelo seedling from open pollination of (Nova + HBP zyg somatic hybrid) 2247-OP-A2 Tetraploid : Mandarin/ pummelo seedling from open pollination of (Nova + HBP zyg somatic hybrid) 2247-OP-A5 Tetraploid : Mandarin/ pummelo seedling from open pollination of (Nova + HBP zyg somatic hybrid) SORP-OP-02-8 Tetraploid : Mandarin/ pummelo seedling from open pollination of (S.O + rangpur somatic hybrid) Grapefruit Citrus Paradisi Macfad Commercial cultivars Marsh grapefruit Marsh Grapefruit, buds from DPI*** Ruby Red grapefruit Ruby Red Grapefruit, buds from DPI *Nova mandarin: Fina Clementine and Or lando tangelo (Duncan grapefruit X Dancy tangerine) made by F.G. Gardner and J. Bello ws in 1942 and released in 1964 (Saunt, 1990). **Sour orange: (Cirus aurantium L.). ***DPI:Division of Plant Indus try in Winter Haven Florida.

PAGE 78

Table 3-2. Shoot growth of the rootstock ca ndidates and the sour orange in average18 months after grafting (means were separate d using the LSD separation of means at p=0.05). Germplasm Shoot growth (cm) StDev Gemplasm Shoot growth (cm) StDev germplasm Shoot growth (cm) StDev Pummelo Somatic Hybrids Tetrazygs 4-3-99-2 204.00 36.10 Amb + 7-3-99-1 163.33 10.02 2247 x 6056-00-2 (Blue 2) 148.00 62.23 4-3-99-2 set 7 179.67 21.20 Amb + 8-1-99-4A 162.00 36.59 2247 x 6056-00-7 (Blue 7) 211.67 29.19 4-4-99-4 123.00 21.63 Amb+ Chandler 251.67 31.01 2247 x 6073-00-4 (Green 4) 233.33 50.29 5-1-99-2 268.67 56.50 Amb + Chandler #A1-11 158.67 14.36 2247 x 6073-00-6 (Green6) 265.00 34.07 7-2-99-1 151.00 48.77 Amb + Chandler # 69 99.33 8.02 2247 x 6073-00-8 (Green 8) 239.33 22.81 7-2-99-2 217.67 38.44 Amb + HBJL-1 286.33 13.32 2247 x 2060-00-1 (Purple 1) 216.67 48.21 7-3-99-1 161.33 09.29 Amb + HBJL-2B 278.67 29.54 2247 x 2060-00-3 (Purple 3) 197.00 11.14 8-1-99-4A 216.33 16.29 Amb + HBJL-3 280.33 23.54 2247 x 1571-00-4 (White 4) 154.67 14.01 8-1-99-2B 252.33 34.00 Amb + HBJL-4 98.67 18.01 N + HBP x SO + RP-04-7 108.00 38.74 8-1-99-4B 213.67 41.68 Amb + HBJL-5 265.67 12.50 (SR x SH)-99-5 183.17 15.97 8-1-99-4B set 2 207.67 15.63 Amb + HBJL-7 215.00 29.51 Diploid Hybrid 8-2-99-1 180.33 27.61 Amb + HBP 161.67 37.10 43 x 20-04-1 153.67 12.22 Chandler #A1-11 143.33 24.01 Amb + MG1 100.33 19.86 46 x 20-04-12 108.33 19.86 HBJL-3 R6T16 227.67 25.42 Amb+ SN7 102.67 07.37 46 x 20-04-19 146.00 08.00 HBJL-3 R10T20 254.00 25.24 Amb + MG-10 149.00 18.25 Volk x P 268.67 20.74 HBJL-4 166.67 16.26 Changsha + HBJL-3 256.67 15.63 Open pollinated tetraploid HBJL-5 201.00 14.11 Changsha + HBJL-5 271.33 15.04 2247-OP-A1 215.00 22.61 HBJL-7 221.00 24.76 Changsha + HBJL-7 271.00 15.62 2247-OP-A2 226.33 05.69 HBJL-12 235.33 13.58 Murcott + 4-4-99-6 249.00 25.51 2247-OP-A5 186.00 24.43 MG-10 116.67 16.50 Murcott + Chandler #A 1-11 100.67 09.29 SORP-OP-02-8 146.00 06.56 MG-11 165.00 6.00 Murcott + Chandler #80 102.67 06.66 Grapefruit SN3 140.00 11.14 Murcott + HBJL-1 203.33 06.51 Marsh grapefruit 237.33 14.84 Somatic Hybrids Murcott + SN3 151.33 09.07 Ruby Red grapefruit 224.67 48.01 Amb + 4-3-99-2 225.67 22.37 Page + HBJL-3 162.33 10.69 Amb + 4-4-99-6 242.67 24.21 Page + HBJL-7 211.00 17.58 Amb + 5-1-99-1B 229.33 12.01 Succari + HBP 120.33 22.37 Amb + 5-1-99-3 148.00 35.79 W.Murcott + HBJL-7 268.00 07.94 Amb + 7-2-99-5 103.00 34.60 Sour orange 66.67 2.52 LSD 41.197 P value 0.0001 78

PAGE 79

Table 3-3. Shoot length (cm) and the seedling ye llows symptoms of test rootstock candidates inoculated with T36 in the greenho use 8 months after inoculation. Germplasm Shoot length (cm) Symptoms Resistance level based on performance in the field Rootstock Healthy T36 SY score A+ 4-3-99-2 139 99 2.5 Resistant A+ 4-4-99-6 118 63 2.5 Intermediate A+ 7-2-99-5 100 35 3.0 Susceptible A+ Chandler #A1-11 116 59 3.0 Tolerant A+ HBJL-1 127 76 2.5 Resistant A+ HBJL-3 112 80 2.0 Intermediate A+ HBJL-5 126 72 3.0 Intermediate A + SN7 136 25 2.5 Susceptible Page + HBJL-3 109 53 3.0 Slightly tolerant Sour orange (S.O) 124 30 3.0 Susceptible Table 3-4. Total chlorophyll content (mg/g) in test rootstock candidates showing chlorosis symptoms 8 months after inocula tion with T36 in the greenhouse. Germplasm Total chlorophyll (mg/g) Rootstock Healthy T36 A+ 4-3-99-2 1.21 0.52 A+ 4-4-99-6 1.4 0.75 A+ 7-2-99-5 1.73 0.34 A+ Chandler #A1-11 0.99 0.42 A+ HBJL-1 1.32 0.86 A+ HBJL-3 1.52 1.09 A+ HBJL-5 0.81 0.36 A + SN7 0.67 0.30 Page + HBJL-3 1.83 0.52 S.O 1.09 0.29 79

PAGE 80

Table 3-5. Summary of the starch content (mg/g dry weight) in Hamlin sweet orange leaf and the rootstocks roots (means were separa ted using the LSD separation of means at p=0.05). Rootstock Starch content in Hamlin sweet orange leaf (mg/g dry weight StDev) Starch content in the rootstocks roots (mg/g dry weight StDev) Healthy control CTV-infected Healthy control CTV-infected A+4-3-99-2 54.12 4.69 63.82 2.35 140.50 5.29 130.82 2.02 A+4-4-99-6 70.76 10.13 86.66 3.23 136.29 7.50 148.52 3.72 A+HBJL-1 76.33 7.64 84.58 5.32 129.95 2.29 122.57 2.62 A+HBJL-3 80.46 12.76 101.69 3.86 124.64 4.75 112.07 2.61 A+HBJL-5 90.87 10.59 112.40 4.94 121.31 4.84 123.35 2.76 A+Chandler #A1-11 89.67 6.04 125.51 1.92 100.16 5.59 88.21 2.59 A+7-2-99-5 97.01 9.62 127.49 2.83 110.59 4.74 79.56 3.35 A+SN7 88.07 2.16 113.02 2.07 141.89 4.68 108.27 7.61 Page+HBJL-3 71.19 2.46 121.81 3.09 108.72 7.41 84.58 2.06 Sour orange 64.54 6.58 135.52 2.06 116.49 9.09 69.91 3.92 LSD 10.13 8.11 P value 0.0001 80

PAGE 81

CHAPTER 4 USE OF SEROLOGICAL METH ODS TO DETERMINE CITRUS TRISTEZA VIRUS (CTV) STATUS AND RESISTANCE IN TOP-WO RKED ROOTSTOCK CANDIDATES TO REPLACE SOUR ORANGE Introduction Citrus tristeza virus is often a concern wherever citr us is produced commercially. CTV isolates differ in the symptoms they cause de pending on the isolate, the host and or the scionrootstock combination. From the disease management point of view, the stem pitting and the quick decline (QD) diseases are the two major disease synd romes produced by CTV infection. Certain isolates cause the stem pitting of scions regardless of the rootstock, which reduces vigor, fruit yield and quality on the infected trees. Va riously sized pits or gr ooves in the wood often contain a yellow gum and irregula r growth of the phloem occurs in the area of these xylem pits (Brlansky et al., 2002). Other isolates cause declin e and death of citrus trees grafted on sour orange ( Citrus aurantium L.), the most desirable horticultu ral rootstock. The QD is caused by a virus-induced phloem necrosis in the bark of the rootst ock just below the bud union that prevents the movement of carbohydrates from the canopy to the roots. Lack of carbohydrates supply in the root system causes the roots to degenerate an d inhibits formation of new fibrous roots that result in the decline of the inf ected trees (Garnsey et al., 1987a). The QD problem is more severe and can occur on sweet orange, mandarin and grapef ruit scions grafted on sour orange rootstock. Millions of citrus trees on s our orange rootstock were lost due to the quick decline disease caused by CTV. Therefore the use of sour ora nge rootstock is no longer feasible and less desirable rootstocks are being utilized. The primary rootstocks used currently in Florida are trifoliate hybrids, and in general they are not adapted to high pH, calcareous soils (Grosser et al., 2000; Grosser et al., 2004a; Ba uer et al., 2005). The CREC citr us improvement program is focusing mainly on developing new rootstocks for CTV-induced QD resistance with the effort to 81

PAGE 82

replace sour orange rootstoc k. Screening the rootstock candi dates for CTV-QD resistance is required as a part of the rootstock improvement program. Several techniques have been developed for CT V detection and differentiation of CTV isolates. Biological indexing was applied by inoculating a select ed group of citrus genotypes (Garnsey et al., 1987b). The major disadvantage of this biological indexing is the time required to complete the indexing (Lee et al., 1994). Al so the electron microscopy (EM) of negatively stained extracts was another method used for det ection of CTV infected trees (Bar-Joseph et al., 1989). This technique received limited applica tion because of the high cost, it was time consuming and required specific skills (Rocha-P ea and Lee, 1991). The development of quick, accurate serological tests for CTV was not possible until purification methods for CTV were developed. Antisera was then prepared against pu rified virus and used in diverse serological techniques (Rocha-Pea and L ee, 1991). Serological tests in troduced a fast and reliable a technique to screen for CTV inf ection on a large scale and have been used for long time to detect CTV (Gonsalves et al., 1978; Bar-Joseph et al., 1979b; Garnsey et al., 1979; Brlansky et al., 1984; Rocha Pea et al., 1991). Polyclonal antibodies have been made in several animal species against different CTV isolates (Rocha Pea et al., 1991). Monoclonal antibody MCA13 was raised against a declineinduci ng CTV isolate (T36) collected from a sweet orange grafted onto sour orange rootstock in Florida (Permar et al., 1990). This antibody differentiates between mild and severe CTV isolates. It reacts with decline isolates from Florida and a majority of decline and stem pitting isolates from various citrus growing regions (Permar et al., 1990). The MCA13 reactive site was mapped to a single amino acid in the coat protein (CP) by in vitro studies using Echerichia coli system (Pappu et al., 1993). Mutation of a single nucleotide resulting in the change of the amino acid phenylalanine to tyrosi ne at the position 124 of the CP prevented the 82

PAGE 83

MCA13 reactivity of a severe isolate, whereas the CP of a mild isol ate with a position 124 change from tyrosine to phenylalanine reac ted positively with MCA13, monoclonal antibody (Pappu et al., 1993). Several studi es on serological detection of different CTV isolates with a number of polyclonal and monoclonal antibodies suggested that multiple epitopes exist in the CTV coat protein (Brlansky et al., 1984; Vela et al., 1988). Enzy me-linked immunosorbent assay (ELISA) is the most convenient, reliable, and relatively inexpensive procedure. Therefore, ELISA is widely used to measure the concentrat ion of soluble proteins including viral protein such as CTV (Rocha-Pea and Lee, 1991). In gene ral, the protein is attached to the antibody coated on an assay plate and detected using a th ree-step process. Color development after adding the substrate is quantified and is proportional to the viral protein bounds to the plate (Garnsey and Cambra, 1991). The serological techniques such as, ELISA and direct tissue blots immunoassay (DTBI) allow screening for large number of samples. DTBI is rapid, required little sample preparation and could be stored at room temperature for 30 days at least prior to assay (Garnsey et al., 1993). In addition, western blot analysis can be used to detect a specific protein in a tissue extract using specific antibodies to the target protein (Gutirrez et al., 1997). Materials and Methods ELISA Plant materials Samples were collected from 15-yearold fiel d trees (source) of H amlin sweet orange on Carrizo citrange prior and after the top-working, as well as from the newly topgrafted scions (that included preselected candida te rootstock hybrids, some of their pummelo parents and two grapefruit varieties). The total number of the test ed citrus genotypes was 74 (72 test selections and Ruby Red and Marsh grapefruit), and their iden tity is described in Table (3-1). Marsh and Ruby red grapefruit were used here to compare th e CTV titer in grapefruit with sweet orange and 83

PAGE 84

the tested materials. All 74 test genotypes were top-worked as described in Chapter (3) along with the sour orange. Samples from the tested materials were collected and assayed 18 months after the successful top-worki ng graft. One important point to consider when performing serological tests for CTV detection is the selection of the tissue that contai ns the virus particles. CTV is a phloem-limited virus and therefore, it is present at highest c oncentrations in phloemrich tissues (Bar-Joseph et al ., 1979b). The best tissues for CT V detection have proven to be bark, petioles, and midribs of recent flushes (Gar nsey et al., 1979). Time of sample collection also is a critical factor and needs to be c onsidered. Prolonged hot w eather can re sult in the uneven distribution of CTV in grapefruit and some times in sweet orange. Therefore, for routine serological tests, field samples are collected pref erably in the spring or autumn (Lee et al., 1988). Ambient temperatures above 30C are known to suppress the field symptoms and detection of CTV through serological tests (R oistacher et al., 1974; Mathews et al., 1997). Visual assessments of symptoms were made periodically over almost a twoyear period according to methods detailed by Garnsey et al., (1987b) and a severity score (0-3) was assigned to each symptom in each graft (rootstock candidates and sour orange) for the individual topworked trees, where 0 = no symptoms and 3 = se vere CTV symptoms (data not presented). The shoot growth of all the top-worked citrus test genotypes was also measured (Table3-2). Tissue samples of healthy and positive controls were also included in the serological tests. In this study, the serological tests were used to determine the CTV titer mainly in the rootstock candidates and the corresponding sour orange graft using pol yclonal and monoclonal (MCA13) antibodies. ELISA method Enzyme-linked immunosorbent assay (ELISA) was used to estimate the virus concentration in the CTVinfected plants using polyclonal and monoclonal CTV specific antibodies (Rocha-Pea and Lee, 1991). The ELISA test was performed 3 times at 6 months 84

PAGE 85

intervals but the data presented here is from th e samples collected 18 months after grafting since it is believed that CTV symptoms would appear on infected trees 10-12 months after inoculation (McGovern et al., 1994; Al-Senan et al., 1997). The broad spectrum or general ELISA was conduc ted using two CTV polyclonal antisera (antiCTV 1052 and 1052 IgG alkalin phosphatase labele d), kindly provided by Dr. R. H. Brlansky (Citrus Research and Education Center, University of Florida, Lake Alfred, FL). For the general polyclonal (broad spectrum) ELISA, the double antibody sandwich direct (DAS) ELISA method was carried out according to Garnsey and Cambra (1991). The MCA13 ELISA test was conducted using monoclonal MCA13 antiserum ( purchased from Tom Permar, at Nokomis Corporation) and the procedure was done accordi ng to Permar et al., (1990). For both ELISA assays, wells of costar high bi nding (Corning, Acton, MA) or Immu lon 2-HB microtiter 96 well plates were rinsed with deionized water to re move polystyrene fragments (McLaughlin et al., 1981). After that, they were coated with 200 L of the rabbit polyclonal coating antiserum IgG 1052 developed against T36 CTV isolate. The coating antibody was diluted to 1:10,000 in sodium carbonate coating buffer pH 9.6 (see ap pendix A) for both general and monoclonal MCA13 assays. Then the plates were incubate d for overnight at 4C. After incubation, the antibody was discarded and plates were washed three times with phosphate-buffered saline with Tween20 (PBST; 0.02 M phosphate, 0.14 M sodium chloride at pH 7.4, 0.1 % [v/v] Tween20). The bark (0.5 g) from each sample was pulverized in 10 ml extraction buffer (PBST) using a KLECO tissue pulverizer. The homogenized sap (200 L) for each sample was added to duplicate test wells on the antibody -coated plates and incubated at 4C overnight. The plates for DAS-ELISA were then rinsed with PBST for 3 times 10 min each and 200 L per well of the 1052 antibody conjugated withAlkaline phosphatase (AP) at a dilution of 1:10,000 in conjugate 85

PAGE 86

buffer (PBST and 0.2% [w/v] bovine serum album in, BSA). For the monoclonal test, Double Antibody Sandwich Indirect (DAS -I) ELISA was performed using MCA13 specific monoclonal antibody. The MCA13 plates were washed as pr evious and 200 L per well of the MCA13, monoclonal antibody was added at a dilution of 1:30,000 in the antibody buffer (PBST and 0.2% [w/v] BSA). The MCA13 plates were then incuba ted at 37C for 4 h. After washing the plates three times, 10 min each with PBST, a 200 L al iquots of goat Anti-Mouse IgG antibody (Whole Molecule) (AP) Sigma A-3562 (GAM) for MCA13 ELISA DAS-I at 1:30,000 dilutions in conjugate buffer (PBST and 0.2% [w/v] BSA) were added and incubated under the same conditions. Polyclonal and MCA13 plates were again washed three times, 10 min each with PBST and phosphatase substrate (1 g/ml; -nitrophenyl phosphate Sigma S-0942 in 10% [v/v] triethanolamine, pH 9.8), was added. The plates we re kept in the dark at room temperature until color development was complete. The resulti ng yellow color was measured at 405 nm (OD405) during the reaction (1-3h.) using a microplate re ader (Bio-Rad 550, BioRad, Hercules, CA). The data represented the average OD405 of duplicated samples of the test ed materials, healthy control, CTVinfected (positive) samples and extraction buffer controls in each test. The buffer value was Subtracted from all the values and sample s were considered positive when their average OD405 value was more than twice that of the healthy control (Clark et al., 1988; Lee et al., 2005). Direct Tissue Blots Immunoassay (DTBI) Samples of the top-worked rootstock candidates were collected a year after grafting. Due to the large number of samples and the limited amount of the antibody, only the most important samples were selected from the 74 test genotyp es. The selection was based on ELISA results using the specific monoclonal antibody, MCA13 (Table 4-4). Seventeen MCA13 negative samples and 21 of the MCA13 positive samples we re selected for this assay (Table 4-1). Reaction of the grafted materials to the MC A13 monoclonal antibody wa s tested by DTBI in 86

PAGE 87

order to confirm the MCA13 reaction result s especially for the negative results. Tissue blots were prepared as described by Garnsey et al ., (1993). Three young stems were taken from each tree, then cut and the freshcut stem was pr essed onto a nitrocellulose membrane. Stems of healthy and positive greenhouse controls were in cluded. The membrane was air dried and then blocked in PBS + 1% BSA for 1 h. Blocking solution was removed and the primary antibody, MCA13 at a 1:20,000 dilution in antibody buffer (P BS + 1% BSA) was added. The membrane was incubated for three h at room temperature with shaking at 25 RPM. After this, membranes were washed three times in PBST with gentle agitation for 5 min each. After the final wash, secondary antibody GAM-AP was added at 1:15,000 dilutions and the membrane was incubated for either 2 h at 37C or for ove rnight at room temperature. Then the membrane was washed as previously. The blots were treated with a mixture of 5-bromo-4-chloro -3-indolyl phosphate ptoluidine (BCIP) and -nitro blue tetrazolium (NBT) (Sigma B-1911) till the development of the purple color (Garnsey et al., 1993). Western Blot Analysis To carry out western blot anal ysis, total protein was extracted from the samples previously tested by direct tissue blot immunoassay ( Table 4-1). About 0.2 g tissue from the tested materials was collected 18 months after top-working. Tissue was ground in liquid n itrogen. To isolate the soluble fractions, the ground tissue was thawed in an equal amount of phosphate buffered saline, PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4 pH 7.4) and 200 l extraction buffer [50 mM Tris-HCl, pH 6.5; 1 mM EDTA; 150 mM Na Cl; 0.1% Triton X-100]. The following protease inhibitors: 2 g/ml Antipain; 2 g/ml Leupeptin; 2 g/ml Aprotinin; 1 mM of 4-[2-aminoethyl]-benzenesulfonyl fluorid e (AEBSF) Sigma; and 5% of 2mercaptoethanol were added immediately prior to using the extraction buffer. Samples were incubated 87

PAGE 88

with shaking for 30 min at 4C and then centr ifuged at 10,000 RPM for 10 min at 4C. The supernatant was re-centrifuged at 13,000 RPM for another 10 min at 4C. Total protein concentration was determined in the supernatant by the Bradford assay using BSA as a standard (Bradford, 1979), then samples were either immedi ately subjected to western blot analyses or stored at -80C till needed. For western analysis, aliquots of the soluble plant extracts containing 100 g total proteins were mixed with an equal volume of dissociation buffer (140 mM SDS, 160 mM Tris-HCl pH 7.8, 1% (v/v) glycerol, 142 mM -mercapto-ethanol) then boiled for 5 min. Samples were separated on a precast 12% poly acrylamide Tris-HCl gel (BioRad) in a MiniProtean III cell (Bio-Rad) accord ing to Laemmli (1970) using Tris-glycine as the SDS-PAGE electrophoresis buffer (Appendix B). Proteins were electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane (ImmobilonTM-P; Millipore Cor poration, Bedford, MA, USA, Cat. No. IPVH 000 10) using Trans-Bl ot Cell (BioRad) using the transfer buffer (Appendix B). The non-specific binding sites on th e membrane were then blocked with Blotto [5% non-fat dried milk in TTBS (100 mM Tris-HCl, pH 7.9; 150 mM NaCl; 0.1% Tween 20) with shaking for one h at room temperature. The membrane was incubated with the primary monoclonal antibody (MCA13) at 1:30,000 diluti ons (in TBS with 2% BSA) at room temperature with shaking overnight. After that, the membrane was washed for 10 min each in TTBS. The blot then was incubated with the secondary antibody (GAM-AP) in TBS + 2% BSA at 1:20,000 for 3 h at room temperature with shaking, followed by three 10-min. washes in TTBS. The membrane blots were develope d using BCIP/NBT liquid substrate system. 88

PAGE 89

Results and Discussion ELISA ELISA data for the source samples before a nd after top-working, as well as the newly topworked test genotypes, using CTV polycl onal and the monoclona l antibody MCA13 are presented in Tables (4-2), (4-3) and (4-4), resp ectively. The ELISA data presented as OD values at 405 nm is the average of two replications per sample after a 2-h reaction. Positive (+) values are higher and minus (-) values are lower than th e value of twice the valu e of the healthy control (Clark et al., 1988). The entire source Hamlin sweet orange trees were CTV positive using both the polyclonal and MCA13 monoc lonal ELISA. Therefore, all of the source trees were characterized as MCA13 positive (Table 4-2). Of the 72 test genotypes plus the Marsh and Ruby Red grapefruit (Table 3-1), only eight genotypes were negative (pumme lo seedlings 7-2-99-1, 8-1-994B set 2, HBJL-3 R10T20, HBJL-5; somatic hybrids Amb +4-3-99-2, Amb +5-1-99-3, Murcott + HBJL -1; and open-pollinated tetraploid 2247OP-A2), and the remainder were positive for CTV in the polyclonal ELISA test When the sa me samples were tested with the monoclonal antibody, ten more candidates were found to be MCA13 negative (Table 4-4). The test hybrids that showed negative results by MCA13 monoclona l antibody were pummelo seedlings 5-1-99-2, 7-2-99-1, 8-1-99-2B, 8-1-99-4B set 2, Chandler #A1-11, HBJL3 R10T20, HBJL-5; somatic hybrids Amb +4-3-99-2, Amb +5-1-99-3, Amb +C handler, Amb + HBJL -1, Amb + HBJL -2B, Murcott + HBJL -1, W. Murc ott + HBJL -7; tetrazyg 2247 x 6073-00-6 (GREEN 6); diploid hybrid Volk x P; and tetrazyg 2247-OP-A2. All of these showed a high shoot growth. The positive values of the polyclonal ELISA ranged from OD405 0.08 for pummelo 4-3-99-2 set 7 to 0.74 for diploid hybrid Volk x P, whereas the OD405 values for the corresponding sour orange control were 1.416 and 2.850 respectively. Th e value for the healthy control was OD405 0.035. In 89

PAGE 90

general the OD405 for sour orange ranged from 1.09-3.185 (Table 4-3). For MCA13 ELISA, positive values ranged from OD405 0.060 for 8-1-99-4B to 0.374 for 46x 20-04-12 whereas the OD405 values for the corresponding sour orange control were 1.348 and 1.345 respectively. For MCA13 ELISA, data are shown for each category in Figures (4-1 to 4-6). In the Pummelo seedling group, data ranged from OD405 0.078 for 4-3-99-2set7 to 0.261 for 8-1-99-4A (Figure 41). Group 2 (somatic hybrids) showed values between 0.065 for Changsha + HBJL-7 and 0.521 for Amb + MG-1 (Figure 4-2). The tetrazygs group showed OD405 values between 0.064 to 0.308 for Green 4 and (SRXSH) 99-5 respectively (Figure 43). For the diploid hybrids, the lowest CTV titer was shown in Volk x P (0.029) and the highest OD405 value was 0.374 for 46x20-0412 (Figure 4-4). In the open pol linated tetraploid group the OD405 value varied from 0.017 for 2247-OP-A5 to 0.219 for Sorp-OP-02-8 (Figure 4-5) Marsh and Ruby Red grapefruit were used here to test the difference in the severe CTV accumulation in the field compared to the Hamlin sweet orange (Figure 4-6). Ruby Red showed a lower value (0.116) than Marsh grapefruit (0.153), and Hamlin sweet orange showed a very high value (OD405 +1.105) compared to both grapefruit varieties. This data was in agreement with (Bar-Joseph and Lee, 1989), who stated that sweet orange is more sensitive to infection than grapefruit. In general the OD405 for sour orange ranged from 0.981-2.861(Table 4-4) and the value for the healthy control was OD405 0.026. Direct Tissue Blot Immunoassay (DTBI) Table (4-1) represents a list of the samples selected for direct tissue blot immunoassay using the MCA13, monoclonal antibody based on the ELISA, MC A13 data. Tissue pr ints were quickly performed and were as sensitive as ELISA in detecting CTV. The results are shown in Table (46) and the prints of representative samples are shown in Figure (4-7). The imprint of the CTVinfected stems was clearly visible with deep pu rplestained area indicati ng the presence of the CTV virion in the phloem of the stems (Figure 4-7). The healthy tissue imprint showed no color 90

PAGE 91

that was easily distinguished from the intense purple color in the stained phloem of the CTVinfected samples. The results were in agreemen t with the ELISA data. DTBI is a reliable and sensitive procedure for CTV detection and provide s a fast tool to screen a large number of samples (Garnsey et al., 1993). Western Blot Analysis Samples listed in Table (4-1) were further an alyzed by western blotting for the CTV coat protein (CP) using the MCA13 monoclonal antib ody. The specific bands were developed on the membrane in purple color. Strong purple bands co rresponding to the coat protein, 25kDa in size were detected in the infected samples indicating the presence of CTV quick decline isolate from Florida (Figure 2-8 A-E). The sour orange co rresponding to the listed MCA13 negative samples (1-7) were tested and the result s are shown in Figure (4-8 E). Conclusions Rootstock candidates developed in efforts to replace sour ora nge rootstock were screened using a top-working technique by grafting each of 72 selections, mostly mandarin + pummelo somatic hybrids, but also includi ng selected parental pummelo s eedlings, along with sour orange. Test genotypes were top-worked onto establishe d CTVinfected Hamlin field trees. The virus infection was then detected by serological techniques including ti ssue blot immunoassay (TBIA), double antibody sandwich enzyme linked immu nosorbent assay (DAS-ELISA) and western analysis. DAS-ELISA using polycl onal antibodies has previously been used to evaluate virus titer in citrus plants (Garnsey, et al 1985 and Lee et al, 1991). Positive reaction for some samples was not achieved unless reaction wi th the substrate was continued for 2 h. This may reflect a low titer of the virus in those plants. A higher tite r in the MCA13-ELISA may be relative estimate of the severe CTV infection, since the MCA13 monoclonal antibody reacts especially with severe CTV isolate (Permar et al., 1990). Its use provides a tool to scr een for severe CTV infection, 91

PAGE 92

92 especially in the Florida budwood registrati on program to prevent propagation of budwood containing potentially damaging isolates, while allowing propagation of budwood carrying mild isolates already endemic in the state (Sieburt h, 2000). The relatively quick tissue print method using MCA13 was determined to be a good method for high throughput and to validate traditional ELISA. Seventeen of the test genotypes were MCA13 negative in this study, and the data revealed various degrees of CTV resistance /tolerance in the remaining test genotypes. The rootstock candidates were divide d into 5 categories based on the performance in the field (shoot growth and CTV symptoms) in relation to MC A13 (DAS-I) ELISA the MCA13 ELISA results combined with the shoot length data: resistant; tolerant, intermediate, slightly tolerant and susceptible (Table 4-5). Hybrid rootstock candidates from the resistant and highly tolerant groups should definitely be incl uded in further studies to dete rmine their rootstock potential.

PAGE 93

Germplasm (GP) 4 3 9 9 2 4 3 9 9 2 s e t 7 4 4 9 9 4 5 1 9 9 2 7 2 9 9 1 7 2 9 9 2 7 3 9 9 1 8 1 9 9 4 A 8 1 9 9 2 B 8 1 9 9 4 B 8 1 9 9 4 B s e t 2 8 2 9 9 1 C h a n d l e r # A 1 1 1 H B J L 3 R 6 T 1 6 H B J L 3 R 1 0 T 2 0 H B J L 4 H B J L 5 H B J L 7 H B J L 1 2 M G 1 0 M G 1 1 S N 3 H e a l t h y OD405 (Average 2XH) -0.5 0.0 0.5 1.0 1.5 2.0 S.O-Aver-2xH GP-Aver-2xH Figure 4-1. CTV monoclonal, MCA13 antibody Enzy me-linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test ge notypes (pummelo seedling parent group) and sour orange control, collected 18 months after top-work grafting. 93

PAGE 94

Germplasm (GP) A m b + 4 3 9 9 2 A m b + 4 4 9 9 6 A m b + 5 1 9 9 1 B A m b + 5 1 9 9 3 A m b + 7 2 9 9 5 A m b + 7 3 9 9 1 A m b + 8 1 9 9 4 A A m b + C h a n d l e r A m b + C h a n d l e r # 6 9 A m b + C h a n d l e r # A 1 1 1 A m b + H B J L 1 A m b + H B J L 2 B A m b + H B J L 3 A m b + H B J L 4 A m b + H B J L 5 A m b + H B J L 7 A m b + H B P A m b + M G 1 A m b + M G 1 0 A m b + S N 7 C h a n g s h a + H B J L 3 C h a n g s h a + H B J L 5 C h a n g s h a + H B J L 7 M u r c o t t + 4 4 9 9 6 M u r c o t t + C h a n d l e r # 8 0 M u r c o t t + C h a n d l e r # A 1 1 1 M u r c o t t + H B J L 1 M u r c o t t + S N 3 P a g e + H B J L 3 P a g e + H B J L 7 S u c c a r i + H B P W M u r c o t t + H B J L 7 H e a l t h y OD405 (Average 2XH) -0.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 S.O-Aver-2xH GP-Aver-2xH Figure 4-2. CTV monoclonal, MCA13 antibody Enzy me-linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test ge notypes (somatic hybrid group) and sour orange control collected 18 months after grafting. 94

PAGE 95

Germplasm (GP) 2 2 4 7 x 6 0 5 6 0 0 2 ( B l u e 2 ) 2 2 4 7 x 6 0 5 6 0 0 7 ( B l u e 7 ) 2 2 4 7 x 6 0 7 3 0 0 4 ( G r e e n 4 ) 2 2 4 7 x 6 0 7 3 0 0 6 ( G r e e n 6 ) 2 2 4 7 x 6 0 7 3 0 0 8 ( G r e e n 8 ) 2 2 4 7 x 2 0 6 0 0 0 1 ( P u r p l e 1 ) 2 2 4 7 x 2 0 6 0 0 0 3 ( P u r p l e 3 ) 2 2 4 7 x 1 5 7 1 0 0 4 ( W h i t e 4 ) N + H B P x S O + R P 0 4 7 ( S R x S H ) 9 9 5 H e a l t h y OD405 (Average 2XH) -0.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 S.O-Aver-2xH GP-Aver-2xH Figure 4-3. CTV monoclonal, MCA13 antibody Enzy me-linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test genot ypes (tetrazyg group) and sour orange control collected 18 months after grafting. 95

PAGE 96

Germplasm (GP) 43 x 20-04-1 46 x 2 0 0 4-12 46 x 20-04-19 V olk x P Healthy OD405 (Average 2XH) -0.2 0.0 0.2 0.4 0.6 0.8 1.0 S.O-Aver-2xH GP-Aver-2xH Figure 4-4. CTV monoclonal, MCA13 antibody Enzy me-linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked test ge notypes the grafted rootstock candidates (Diploid hybrid group ) and s our orange control collected 18 months after grafting. 96

PAGE 97

Germplasm (GP) 2 247O P -A 1 2 247-OP-A2 2247-OP -A 5 S ORP-OP028 H ealt h y OD405 (Average 2XH) -0.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 S.O-Aver-2xH GP-Aver-2xH Figure 4-5. CTV monoclonal, MCA13 antibody Enzy me-linked Immunosorbent Assays-Indirect (ELISA-I) results for the grafted rootstock candidates (OP) tetraploids group and sour orange control collected 18 months after grafting. 97

PAGE 98

Germplasm (GP) Marsh grap e fr u it Ruby Red grapefruit Hamlin He a lthy OD405 (Average 2XH) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 S.O-Aver-2xH GP-Aver-2xH Figure 4-6. CTV monoclonal, MCA13 antibody Enzy me-linked Immunosorbent Assays-Indirect (ELISA-I) results for top-worked commercial scions and sour orange control collected 18 months after grafting. 98

PAGE 99

Figure 4-7. Tissue prints of representative healthy and CTV positive and top-worked rootstock candidates after incubation w ith the MCA13 DTBI. A) Positive control. B) Healthy control. C and D) Examples of the CTVMCA13 samples (Table 4-1).E-N) Examples of the CTVinfected samples (Table 4-1). 99

PAGE 100

100

PAGE 101

Figure 4-8. Western blot analysis of total soluble protein of hea lthy and infected samples using the MCA13 monoclonal antibody. A) Lanes 1-7, CTVMCA13 positive samples 1-7 of selected rootstock candidates (Tab le 4-1); lane 8, greenhouse CTV positive control; lane 9, greenhouse CTV negative c ontrol; and lane10, Kaleidoscope prestained protein standard. B) Lane 1-7, CTVMCA13 positive samples 7-14 of selected rootstock candidates (Table 41); lane 8, greenhouse CTV positive control; lane 9, greenhouse CTV negative control; and lane10, Kaleidoscope pre-stained protein standard. C) Lane1-7, more CTVMCA13 positive samples 14-21 of selected rootstock candidates (Table 4-1); lane 8, greenhouse CTV positive control; lane 9, greenhouse CTV negative control; and lane 10, Kaleidoscope pr e-stained protein standard. D) Lane 1-7, repr esentative of CTVMCA13 negative samples 1-7 of selected rootstock candidates (Table 41); lane 8, greenhouse CTV positive control; lane 9, greenhouse CTV negative control; la ne10, Kaleidoscope pre-stained protein standard. E) Lane 1-7, repr esentative of sour orange graft corresponding to the negative samples 1-7 of selected rootstock candidates (Table 4-1); lane 8, greenhouse CTV positive control; lane 9, greenhous e CTV negative control; and lane10, Kaleidoscope pre-stai ned protein standard. Table 4-1. Samples selected from the topworked rootstock candidates to be further tested by direct tissue blots immunoassay and we stern analysis based on ELISA MCA13 results. ELISA MCA13 negative samples Selected ELISA MCA13 positive samples 1 7-2-99-1 1 4-4-99-4 2 8-1-99-2B 2 Amb +8-1-99-4A 3 8-1-99-4B set 2 3 2247x 6056-00-7 (Blue7) 4 HBJL3 R10T20 4 2247-1571-00-4 (White4) 5 Amb +5-1-99-3 5 2247-OP-A1 6 Amb + HBJL -2B 6 Sorp-OP-02-8 7 VolkX P 7 8-199-4A 8 HBJL-5 8 Amb + 7-2-99-5 9 Chandler #A1-11 9 Amb +Chandler #69 10 5-1-99-2 10 Amb+HBJL-4 11 Amb +Chandler 11 Amb+HBJL-7 12 Amb + HBJL -1 12 Amb +HBP 13 Amb +4-3-99-2 13 Amb +MG1 14 Murcott + HBJL -1 14 Amb +SN7 15 W. Murcott + HBJL -7 15 Changsha+HBJL-5 16 2247 x 6073-00-6 (GREEN 6) 16 Murcott+ 4-4-99-6 17 2247-OP-A2 17 Murcott+ Chandler #A1-11 18 2247x 6056-00-2 (Blue2) 19 N+HBP x SO+RP-04-7 20 (SRxSH)99-5 21 46x20-04-12 101

PAGE 102

Table 4-2. Summary of polyclonal and the MC A13, monoclonal Enzyme-linked Immunosorbent Assays (ELISA) results for the source trees prior to the top-working. Source(S) OD405 Valuea Source OD405 Valuea Source OD405 Valuea Poly MCA13 Poly MCA13 Poly MCA13 S1 2.011 1.728 S26 2.613 1.216 S51 2.038 1.166 S2 1.558 1.195 S27 1.725 1.236 S52 1.709 1.070 S3 3.132 2.480 S28 1.150 0.812 S53 2.160 1.657 S4 1.940 1.062 S29 1.371 1.270 S54 1.135 1.001 S5 1.514 1.171 S30 1.502 1.201 S55 2.223 1.194 S6 1.970 1.713 S31 2.294 1.385 S56 2.023 1.970 S7 2.658 1.351 S32 2.127 1.817 S57 1.816 1.602 S8 2.404 1.844 S33 1.768 1.052 S58 1.919 1.796 S9 2.247 1.686 S34 2.613 1.645 S59 1.601 1.386 S10 2.167 1.157 S35 3.490 2.040 S60 1.830 1.193 S11 2.260 1.129 S36 2.026 0.947 S61 2.018 1.736 S12 2.513 1.220 S37 1.884 0.783 S62 1.340 1.031 S13 1.342 1.154 S38 3.185 1.501 S63 1.529 2.430 S14 1.941 1.195 S39 1.746 1.193 S64 1.391 2.107 S15 2.065 1.276 S40 1.331 1.001 S65 2.163 2.064 S16 1.099 0.987 S41 2.019 1.708 S66 2.240 2.101 S17 1.830 1.358 S42 1.013 0.746 S67 1.020 0.790 S18 1.409 1.193 S43 2.113 2.055 S68 1.806 1.653 S19 2.435 1.077 S44 2.144 2.362 S69 2.409 2.027 S20 2.452 1.170 S45 2.107 1.189 S70 2.063 1.518 S21 1.719 1.291 S46 1.135 0.906 S71 1.817 1.768 S22 1.491 1.213 S47 1.612 1.018 S72 1.109 0.643 S23 2.393 1.170 S48 2.108 2.000 S73 1.241 1.066 S24 1.857 1.355 S49 2.189 1.880 S74 1.019 1.000 S25 2.120 1.423 S50 2.210 1.285 S75 1.743 1.317 Healthy 0.04x 0.032y a Average (Avr) of two replications per samples after a 2h reaction. x,y Healthy control for polyclonal and,MC A13 monoclonal, ELISA respectively. 102

PAGE 103

Table 4-3. Summary of the CTV polyclonal an tibody Enzyme-linked Immunosorbent Assays (ELISA) results for the source trees, grafte d rootstock candidate s and sour orange control collected 18 months after top-working. Sour Orange source Germplasm Average Avr2xH Average Avr2xH Average Avr2xH Pummelo 1 2.400 2.330 0.975 0.905 4-3-99-2 0.186 0.116 2 1.416 1.346 1.052 0.982 4-3-99-2 set 7 0.080 0.010 3 3.185 3.115 0.850 0.780 4-4-99-4 0.242 0.172 4 1.910 1.840 0.551 0.481 5-1-99-2 0.153 0.083 5 1.452 1.382 0.568 0.498 7-2-99-1 0.067 -0.003 6 2.283 2.213 0.377 0.307 7-2-99-2 0.190 0.120 7 2.585 2.515 0.954 0.884 7-3-99-1 0.118 0.048 8 2.538 2.468 1.461 1.391 8-1-99-4A 0.289 0.219 9 2.147 2.077 1.052 0.982 8-1-99-2B 0.122 0.052 10 2.014 1.944 1.560 1.490 8-1-99-4B 0.093 0.023 11 2.190 2.120 1.074 1.004 8-1-99-4B set 2 0.051 -0.019 12 2.470 2.400 0.275 0.205 8-2-99-1 0.164 0.094 13 1.487 1.417 0.858 0.788 Chandler #A1-11 0.145 0.075 14 1.763 1.693 1.052 0.982 HBJL-3 R6T16 0.160 0.090 15 2.220 2.150 0.886 0.816 HBJL-3 R10T20 0.041 -0.029 16 1.381 1.311 1.052 0.982 HBJL-4 0.276 0.206 17 1.240 1.170 1.179 1.109 HBJL-5 0.043 -0.027 18 1.556 1.486 2.028 1.958 HBJL-7 0.210 0.140 19 2.169 2.099 0.997 0.927 HBJL-12 0.154 0.084 20 2.638 2.568 1.500 1.430 MG-10 0.270 0.200 21 1.090 1.020 0.761 0.691 MG-11 0.186 0.116 22 1.451 1.381 1.140 1.070 SN3 0.194 0.124 Somatic Hybrid 23 2.944 2.874 0.827 0.757 Amb + 4-3-99-2 0.030 -0.040 24 1.685 1.615 1.192 1.122 Amb + 4-4-99-6 0.171 0.101 25 2.436 2.366 0.693 0.623 Amb + 5-1-99-1B 0.139 0.069 26 2.423 2.353 1.216 1.146 Amb + 5-1-99-3 0.052 -0.018 27 1.640 1.570 1.019 0.949 Amb + 7-2-99-5 0.315 0.245 28 1.497 1.427 1.586 1.516 Amb + 7-3-99-1 0.224 0.154 29 1.138 1.068 1.195 1.125 Amb + 8-1-99-4A 0.263 0.193 30 1.290 1.220 1.640 1.570 Amb + Chandler 0.186 0.116 31 2.461 2.3910 0.834 0.764 Amb + Chandler #A1-11 0.134 0.064 32 2.343 2.273 1.071 1.001 Amb + Chandler # 69 0.326 0.256 33 1.664 1.594 0.965 0.895 Amb + HBJL-1 0.158 0.088 34 2.731 2.661 1.390 1.320 Amb + HBJL-2B 0.237 0.167 35 3.116 3.046 0.953 0.883 Amb + HBJL-3 0.139 0.069 103

PAGE 104

Table 4-3. Continued. Sour Orange source Germplasm Average Avr2xH Average Avr2xH Average Avr2xH 36 1.900 1.830 1.045 0.975 Amb + HBJL-4 0.340 0.270 37 1.537 1.467 0.797 0.727 Amb + HBJL-5 0.142 0.072 38 2.769 2.699 1.140 1.070 Amb + HBJL-7 0.354 0.284 39 1.475 1.405 0.981 0.911 Amb + HBP 0.373 0.303 40 1.538 1.468 1.720 1.650 Amb + MG1 0.676 0.606 41 1.843 1.773 1.052 0.982 Amb+ SN7 0.421 0.351 42 1.564 1.494 1.300 1.230 Amb + MG-10 0.185 0.115 43 1.781 1.711 1.416 1.346 Changsha + HBJL-3 0.094 0.024 44 1.930 1.860 1.094 1.024 Changsha + HBJL-5 0.467 0.397 45 1.857 1.787 0.834 0.764 Changsha + HBJL-7 0.086 0.016 46 1.249 1.179 1.052 0.982 Murcott + 4-4-99-6 0.279 0.209 47 1.380 1.310 1.038 0.968 Murcott + Chandler #A1-11 0.310 0.240 48 1.786 1.716 0.849 0.779 Murcott + Chandler #80 0.144 0.074 49 1.735 1.665 0.242 0.172 Murcott + HBJL-1 0.050 -0.020 50 1.884 1.814 0.770 0.700 Murcott + SN3 0.240 0.170 51 2.472 2.402 0.093 0.023 Page + HBJL-3 0.165 0.095 52 1.610 1.540 1.696 1.626 Page + HBJL-7 0.173 0.103 53 2.436 2.366 1.370 1.300 Succari + HBP 0.226 0.156 54 1.553 1.483 1.010 0.940 W.Murcott + HBJL-7 0.197 0.127 Tetrazygs 55 1.795 1.725 1.260 1.190 2247 x 6056-00-2 (Blue 2) 0.340 0.270 56 2.361 2.291 0.937 0.867 2247 x 6056-00-7 (Blue 7) 0.242 0.172 57 1.590 1.520 0.850 0.780 2247 x 6073-00-4 (Green 4) 0.094 0.024 58 1.454 1.384 1.052 0.982 2247 x 6073-00-6 (Green6) 0.133 0.063 59 1.416 1.346 1.052 0.982 2247 x 6073-00-8 (Green 8) 0.150 0.080 60 1.430 1.360 1.319 1.249 2247 x 2060-00-1 (Purple 1) 0.198 0.128 61 2.557 2.487 1.052 0.982 2247 x 2060-00-3 (Purple 3) 0.167 0.097 62 1.783 1.713 0.723 0.653 2247 x 1571-004 (White 4) 0.277 0.207 63 1.840 1.770 1.515 1.445 N + HBP x SO + RP-04-7 0.346 0.276 64 1.214 1.144 1.244 1.174 (SR x SH) 99-5 0.435 0.365 Diploid Hybrids 65 1.912 1.842 1.027 0.957 43 x 20-04-1 0.232 0.162 66 1.450 1.380 0.831 0.761 46 x 20-04-12 0.415 0.345 67 1.616 1.546 0.974 0.904 46 x 20-04-19 0.176 0.106 68 2.850 2.780 1.030 0.960 Volk x P 0.740 0.670 Open pollinated (OP) tetraploids 69 1.853 1.783 0.848 0.778 2247-OP-A1 0.241 0.171 70 1.334 1.264 1.146 1.076 2247-OP-A2 0.047 -0.023 71 1.287 1.217 1.059 0.989 2247-OP-A5 0.149 0.079 104

PAGE 105

Table 4-3. Continued. Sour Orange source Germplasm Average Avr2xH Average Avr2xH Average Avr2xH 72 1.480 1.410 0.987 0.917 SORP-OP-02-8 0.250 0.180 Grapefruit 73 1.425 1.355 1.224 1.154 Marsh grapefruit 0.171 0.101 74 1.582 1.512 1.363 1.293 Ruby Red grapefruit 0.142 0.072 Healthy = 0.035 and 2X healthy= 0.07. Hamlin sweet orange = 1.205. 105

PAGE 106

Table 4-4. Summary of the CTV monoclonal, MCA13 antibody Enzyme-linked Immunosorbent Assays-Indirect (ELISA-I) results for the source trees, grafted rootstock candidates and sour orange control collect ed 18 months after grafting. Sour Orange source Germplasm Average Avr2xH Avera ge Avr2xH Average Avr2xH Pummelo 1 2.031 1.979 0.891 0.839 4-3-99-2 0.154 0.102 2 1.504 1.452 0.883 0.831 4-3-99-2 set 7 0.078 0.026 3 2.861 2.809 0.693 0.641 4-4-99-4 0.217 0.165 4 2.093 2.041 0.392 0.340 5-1-99-2 0.045 -0.007 5 1.317 1.265 0.414 0.362 7-2-99-1 0.050 -0.002 6 1.822 1.770 0.215 0. 3 7-2-99-2 0.096 0.044 7 2.370 2.318 0.651 0.599 7-3-99-1 0.090 0.038 8 2.105 2.053 1.090 1.038 8-1-99-4A 0.261 0.209 9 2.214 2.162 0.883 0.831 8-1-99-2B 0.023 -0.029 10 1.737 1.685 1.314 1.262 8-1-99-4B 0.060 0.008 11 2.146 2.094 1.860 1.808 8-1-99-4B set 2 0.038 -0.014 12 1.950 1.898 0.231 0.179 8-2-99-1 0.113 0.061 13 1.523 1.471 0.787 0.735 Chandler #A1-11 0.039 -0.013 14 1.464 1.412 0.883 0.831 HBJL-3 R6T16 0.094 0.042 15 2.101 2.049 0.719 0.667 HBJL-3 R10T20 0.032 -0.020 16 1.146 1.094 0.883 0.831 HBJL-4 0.150 0.098 17 0.981 0.929 1.026 0.974 HBJL-5 0.026 -0.026 18 1.357 1.305 1.911 1.859 HBJL-7 0.192 0.140 19 1.960 1.908 0.793 0.741 HBJL-12 0.124 0.072 20 2.153 2.101 1.426 1.374 MG-10 0.180 0.128 21 1.981 1.929 0.065 0.013 MG-11 0.137 0.085 22 1.219 1.167 0.981 0.929 SN3 0.154 0.102 Somatic Hybrid 23 2.577 2.525 0.737 0.685 Amb + 4-3-99-2 0.019 -0.033 24 1.452 1.400 1.059 1.007 Amb + 4-4-99-6 0.127 0.075 25 2.320 2.268 0.518 0.466 Amb + 5-1-99-1B 0.092 0.040 26 2.293 2.241 1.136 1.084 Amb + 5-1-99-3 0.048 -0.004 27 1.490 1.438 0.934 0.882 Amb + 7-2-99-5 0.279 0.227 28 1.371 1.319 1.285 1.233 Amb + 7-3-99-1 0.190 0.138 29 1.005 0.953 1.080 1.028 Amb + 8-1-99-4A 0.213 0.161 30 1.926 1.874 1.457 1.405 Amb + Chandler 0.027 -0.025 31 1.770 1.718 0.663 0.611 Amb + Chandler #A1-11 0.081 0.029 32 1.415 1.363 1.000 0.948 Amb + Chandler # 69 0.254 0.202 33 1.310 1.258 0.814 0.762 Amb + HBJL-1 0.031 -0.021 34 2.4920 2.440 1.157 1.105 Amb + HBJL-2B 0.044 -0.008 35 2.704 2.652 0.870 0.818 Amb + HBJL-3 0.127 0.075 106

PAGE 107

Table 4-4. Continued. Sour Orange source Germplasm Average Avr2xH Avera ge Avr2xH Average Avr2xH 36 1.583 1.531 0.915 0.863 Amb + HBJL-4 0.291 0.239 37 1.442 1.390 0.671 0.619 Amb + HBJL-5 0.120 0.068 38 1.717 1.665 0.953 0.901 Amb + HBJL-7 0.284 0.232 39 1.307 1.255 1.011 0.959 Amb + HBP 0.310 0.258 40 1.459 1.407 1.509 1.457 Amb + MG1 0.521 0.469 41 1.621 1.569 0.883 0.831 Amb+ SN7 0.404 0.352 42 1.493 1.441 1.2130 1.1610 Amb + MG-10 0.166 0.114 43 1.595 1.543 1.296 1.244 Changsha + HBJL-3 0.082 0.030 44 1.318 1.266 0.675 0.623 Changsha + HBJL-5 0.373 0.321 45 1.408 1.356 0.549 0.497 Changsha + HBJL-7 0.065 0.013 46 1.065 1.013 0.883 0.831 Murcott + 4-4-99-6 0.254 0.202 47 1.213 1.1610 0.992 0.940 Murcott + Chandler #A1-11 0.270 0.218 48 1.661 1.609 0.781 0.729 Murcott + Chandler #80 0.098 0.046 49 1.584 1.532 0.1950 0.1430 Murcott + HBJL-1 0.041 -0.011 50 1.753 1.701 0.614 0.562 Murcott + SN3 0.202 0.150 51 1.904 1.852 0.073 0.021 Page + HBJL-3 0.151 0.099 52 1.574 1.522 1.485 1.433 Page + HBJL-7 0.145 0.093 53 1.600 1.548 1.210 1.158 Succari + HBP 0.211 0.159 54 1.413 1.361 0.893 0.841 W.Murcott + HBJL-7 0.034 -0.018 Tetrazygs 55 1.621 1.569 0.920 0.868 2247 x 6056-00-2 (Blue 2) 0.280 0.228 56 2.201 2.149 0.841 0.789 2247 x 6056-00-7 (Blue 7) 0.217 0.165 57 1.348 1.296 0.707 0.655 2247 x 6073-00-4 (Green 4) 0.0640 0.012 58 1.293 1.241 0.883 0.831 2247 x 6073-00-6 (Green6) 0.046 -0.006 59 1.375 1.323 0.883 0.831 2247 x 6073-00-8 (Green 8) 0.084 0.032 60 1.341 1.289 1.120 1.068 2247 x 2060-00-1 (Purple 1) 0.143 0.091 61 2.184 2.132 0.883 0.831 2247 x 2060-00-3 (Purple 3) 0.125 0.073 62 1.477 1.425 0.530 0.478 2247 x 1571-00-4 (White 4) 0.250 0.198 63 1.610 1.558 1.429 1.377 N + HBP x SO + RP-04-7 0.296 0.244 64 1.173 1.121 1.084 1.032 (SR x SH) 99-5 0.308 0.256 Diploid Hybrids 65 1.867 1.815 0.873 0.821 43 x 20-04-1 0.201 0.149 66 1.345 1.293 0.764 0.712 46 x 20-04-12 0.374 0.322 67 1.426 1.374 0.786 0.734 46 x 20-04-19 0.158 0.106 68 2.540 2.488 0.910 0.858 Volk x P 0.029 -0.023 Open pollinated (OP) tetraploids 69 1.706 1.654 0.735 0.683 2247-OP-A1 0.214 0.162 70 1.192 1.140 1.081 1.029 2247-OP-A2 0.017 -0.035 71 1.126 1.074 0.860 0.808 2247-OP-A5 0.120 0.068 107

PAGE 108

108 Table 4-4. Continued. Sour Orange source Germplasm Average Avr2xH Averag e Avr2xH Average Avr2xH 72 1.163 1.111 0.841 0.789 SORP-OP-02-8 0.219 0.167 Grapefruit 73 1.310 1.258 1.077 1.025 Marsh grapefruit 0.153 0.101 74 1.207 1.155 1.186 1.134 Ruby Red grapefruit 0.116 0.064 Healthy = 0.026 and 2X healthy= (OD405) 0.052. Hamlin sweet orange = (OD405) 1.105.

PAGE 109

Table 4-5. Summary of rootstock candidates cate gories based on the performance in the field (shoot growth and CTV symptoms) in relation to MCA13 (DAS-I) ELISA. Resistant Tolerant Slightly tolerant Susceptible 5-1-99-2 4-3-99-2 set 7 4-3-99-2 8-1-99-4A 7-2-99-1 7-2-99-2 44-99-4 Amb + 7-2-99-5 8-1-99-2B 7-3-99-1 HBJL-7 Amb + Chandler # 69 8-1-99-4B set 2 8-1-99-4B MG-10 Amb + HBJL-4 Chandler #A1-11 HBJL-3 R6T16 SN3 Amb + HBJL-7 HBJL-3 R10T20 Amb + 5-1-99-1B Amb + 7-3-99-1 Amb + HBP HBJL-5 Amb + Chandler #A1-11 Amb + 8-1-99-4A Amb + MG1 Amb +4-3-99-2 Changsha + HBJL3 Amb + MG-10 Amb+ SN7 Amb +5-1-99-3 Changsha + HBJL7 Murcott + SN3 Changsha + HBJL-5 Amb +Chandler Murcott + Chandler #80 Page + HBJL-3 Murcott + 4-4-99-6 Amb + HBJL -1 2247 x 6073-00-4 (Green 4) Succari + HBP Murcott + Chandler #A1-11 Amb + HBJL -2B 2247 x 6073-00-8 (Green 8) 2247 x 6056-00-7 (Blue 7) 2247 x 6056-00-2 (Blue2) 2) Murcott + HBJL -1 Intermediate 2247 x 1571-00-4 (White 4) N + HBP x SO + RP04-7 WMurcott + HBJL -7 8-2-99-1 43 x 20-04-1 (SRXSH) 99-5 2247 x 6073-00-6 (GREEN 6) HBJL-4 46 x 20-04-19 46 x 20-04-12 VolkX P HBJL-12 2247-OP-A1 2247-OP-A2 MG-11 SORP-OP-02-8 Amb + 4-4-99-6 Marsh grapefruit Amb + HBJL-3 Amb + HBJL-5 Page + HBJL-7 2247 x 2060-00-1 (Purple 1) 2247 x 2060-00-3 (Purple 3) 2247-OP-A5 Ruby Red grapefruit 109

PAGE 110

Table 4-6. Summary of the serological tests re sults on the rootstock candidates + Marsh and Ruby Red grapefruit. Germplasm Polyclonal Average MCA13 Average (DTBI) Western blot Pummelo 1 4-3-99-2 0.186/+ a 0.154 NA NA 2 4-3-99-2 set 7 0.08 0.078 NA NA 3 4-4-99-4 0.242 0.217 + + 4 5-1-99-2 0.153 0.045/5 7-2-99-1 0.067/0.050/6 7-2-99-2 0.19 0.096 NA NA 7 7-3-99-1 0.118 0.09 NA NA 8 8-1-99-4A 0.289 0.261 + + 9 8-1-99-2B 0.122 0.023/10 8-1-99-4B 0.093 0.060/11 8-1-99-4B set 2 0.051/0.038/12 8-2-99-1 0.164 0.113 NA NA 13 Chandler #A1-11 0.145 0.039/14 HBJL-3 R6T16 0.16 0.094 NA NA 15 HBJL-3 R10T20 0.041/0.032/16 HBJL-4 0.276 0.15 NA NA 17 HBJL-5 0.043/0.026/NA NA 18 HBJL-7 0.21 0.192 NA NA 19 HBJL-12 0.154 0.124 NA NA 20 MG-10 0.27 0.18 NA NA 21 MG-11 0.186 0.137 NA NA 22 SN3 0.194 0.154 NA NA Somatic Hybrid 23 Amb + 4-3-99-2 0.030/0.019/24 Amb + 4-4-99-6 0.171 0.127 NA NA 25 Amb + 5-1-99-1B 0.139 0.092 NA NA 26 Amb + 5-1-99-3 0.052/0.048/27 Amb + 7-2-99-5 0.315 0.279 + + 28 Amb + 7-3-99-1 0.224 0.19 NA NA 29 Amb + 8-1-99-4A 0.263 0.213 + + 30 Amb + Chandler 0.186 0.027/31 Amb + Chandler #A1-11 0.134 0.081 NA NA 32 Amb + Chandler # 69 0.326 0.254 + + 33 Amb + HBJL-1 0.158 0.031/34 Amb + HBJL-2B 0.237 0.044/35 Amb + HBJL-3 0.139 0.127 NA NA 36 Amb + HBJL-4 0.34 0.291 + + 37 Amb + HBJL-5 0.142 0.12 NA NA 38 Amb + HBJL-7 0.354 0.284 + + 39 Amb + HBP 0.373 0.31 + + 40 Amb + MG1 0.676 0.521 + + 110

PAGE 111

111 Table 4-6. Continued. Germplasm Polyclonal Average MCA13 Average (DTBI) Western blot 41 Amb+ SN7 0.421a 0.404 + + 42 Amb + MG-10 0.185 0.166 NA NA 43 Changsha + HBJL-3 0.094 0.082 NA NA 44 Changsha + HBJL-5 0.467 0.373 + + 45 Changsha + HBJL-7 0.086 0.065 NA NA 46 Murcott + 4-4-99-6 0.279 0.254 + + 47 Murcott + Chandler #A1-11 0.31 0.27 + NA + NA 48 Murcott + Chandler #80 0.144 0.098 NA NA 49 Murcott + HBJL-1/0.05 0.041/50 Murcott + SN3 0.24 0.202 NA NA 51 Page + HBJL-3 0.165 0.151 NA NA 52 Page + HBJL-7 0.173 0.145 NA NA 53 Succari + HBP 0.226 0.211 NA NA 54 W.Murcott + HBJL-7 0.197 0.034/Tetrazygs 55 2247 x 6056-00-2 (Blue 2) 0.34 0.28 + + 56 2247 x 6056-00-7 (Blue 7) 0.242 0.217 + + 57 2247 x 6073-00-4 (Green 4) 0.094 0.064 58 2247 x 6073-00-6 (Green6) 0.133 0.046/NA NA 59 2247 x 6073-00-8 (Green 8) 0.15 0.084 NA NA 60 2247 x 2060-00-1 (Purple 1) 0.198 0.143 NA NA 61 2247 x 2060-00-3 (Purple 3) 0.167 0.125 NA NA 62 2247 x 1571-00-4 (White 4) 0.277 0.25 + + 63 N + HBP x SO + RP-04-7 0.346 0.296 + + 64 (SR x SH) 99-5 0.308 0.256 + + Diploid Hybrids 65 43 x 20-04-1 0.232 0.201 NA NA 66 46 x 20-04-12 0.415 0.374 + + 67 46 x 20-04-19 0.176 0.158 NA NA Open pollinated (OP) tetraploids 68 Volk x P 0.74 0.029/69 2247-OP-A1 0.241 0.214 + + 70 2247-OP-A2 0.047/b 0.017/71 2247-OP-A5 0.149 0.12 NA NA 72 SORP-OP-02-8 0.25 0.219 + + Grapefruit 73 Marsh grapefruit 0.171 0.153 NA NA 74 Ruby Red grapefruit 0.142 0.116 NA NA Healthy for polyclonal ELISA = 0.035 and 2X healthy= 0.070. Healthy for MCA13 ELISA = 0.026 and 2X healthy= 0.052. a, bOD Values higher than 2x healthy value are pos itive (+) and values lower than 2x healthy are negative respectively. NA = not applicable.

PAGE 112

CHAPTER 5 MOLECULAR CHARECTERIZATION OF CI TRUS TRISTEZA VIRUS (CTV) IN SELECTED HYBRID ROOTSTOC K CANDIDATES TO POTENTIALLY REPLACE SOUR ORANGE Introduction Citrus tristeza virus (CTV), genus Closterovirus, family Closteroviridae is the causal agent of devastating epidemics that changed the cour se of the citrus industry worldwide, killing millions of citrus trees on sour orange root stock (Moreno et al., 2008). CTV has a narrow host range that is limited mostly to the genus Citrus in the family Rutaceae. Most of the species, cultivars and hybrids of citrus are infected by CTV (Mulle r and Garnsey, 1984). CTV causes different symptoms on different hosts. The most important diseases caused by CTV are quickdecline (QD), on sour orange rootstock and st em-pitting on grapefruit ( SPG) (Garnsey et al., 1987a; Rocha-Pena et al., 1995). The virus is phloem-limited and transmitted by aphids in a semi-persistent manner and by infected buds. Toxoptera citricida (Kirkaldy), commonly known as the brown citrus aphid (BCA), is the most efficient vector of CTV (Hermosa de Mendoza et al., 1984; Yokomi et al., 1994). The breakdown of cross protection against CTVdecline inducing isolates of CTV in gr apefruit trees has been reported following the introduction of the BCA into Florida (Powell et al., 2003). The inci dence of all strains of CTV has increased in south Florida, following the intr oduction of BCA in Florida. However the increase of severe strains has been greater th an that of the mild strains (Halbert et al., 2004). CTV virions are composed of two capsid pr oteins and a single-stranded, positive-sense genomic RNA (gRNA) of ~20 kb, containing 12 open reading frames (ORFs) and two untranslated regions (UTRs). The 3 UTR is highl y conserved among different CTV isolates with nucleotide identities as high as 97%, whereas the 5 UTR region is highly variable with nucleotide identities as low as 44% (Karasev et al., 1995). Two conserved blocks of genes, ORF 112

PAGE 113

1a & 1b and ORFs 3 to ORFs 7 have been identified in CTV that also are conserved in other Closteroviruses (Karasev, 2000). Field isolates of CTV exist as complex populations consistin g of a number of different CTV genotypes, with large sequence variation among the genotypes. Thus, CTV isolates are populations of CTV genotypes, in which one genotype may predominate (Ayllon et al., 1999a; Hilf et al., 1999). Characterization of the population structure is crucia l to understanding the biology and evolution of CTV isolat es, and may have important implications in the selection of pre-immunizing isolates (Iglesias et al., 2005), and the breedi ng of resistant scions and rootstocks. CTV isolates differ in type and severity of symptoms induced in different citrus species and cultivars, and in their aphid transmissibility ha ve been reported worldwide (Roistacher and Moreno, 1991). These factors complicate the scr eening for resistance to CTVinduced diseases in citrus breeding program s. A more thorough unde rstanding of CTV field biology should facilitate the improvement of screening methods and subsequently the development of resistant cultivars. Several methods have been described for the characterization of CTV field isolates. The standard method is a biological characterization using a panel of indica tor plants developed by Garnsey et al., (1987b). The serolo gical differentiation of CTV isolates has been reported using the monoclonal antibody MCA 13 (Permar et al., 1990). Monoclonal antibody, MCA13 discriminates between severe and mild CTV isolates by reacting only to the severe isolates. The major disadvantage of MCA13 is th at it is not able to different iate between the QD isolates and the SP isolates. Therefore, this antibody is not always useful, esp ecially in mixed infection of CTV. Molecular characterization of CTV isol ates by PCR-based and molecular hybridization techniques has been developed for CTV detec tion (Mathews et al., 1997; Cambra et al., 2000; 113

PAGE 114

Roy et al., 2005) and strain differentiation (Cevik et al., 1996b; Hilf and Garnsey, 2000; Niblett et al., 2000; Sieburth et al., 2005) allowing for more thorough char acterization of field isolates. Characterization of CTV isolates on the basis of the full gene tic sequence provides the best comparison, but it is a difficult and time consum ing process. The present molecular techniques were used to better understand th e population diversity of CTV in Hamlin sweet orange field trees used in the previously described top-working study. The molecular techniques including multiple molecular markers (MMM) and heterod uplex mobility assay (HMA), followed by the DNA sequencing of the amplified region, were a pplied to detect the different CTV genotypes residing in the Hamlin interstock, and subs equently the different ial movement of CTV genotypes from this interstock into the top-worked test hybrid rootstock candidates. CTV titer in top-worked trees was estimate d using quantitative real time PCR (qRT-PCR). The working hypothesis was that there may be differential move ment of the CTV genotypes contained in the original Hamlin interstock isolate into the newl y top-worked test material, thus the possibility of differential resistances/su sceptibilities among th e test hybrid rootstock candidates maybe revealed. Multiple Molecular Markers (MMM) MMM is a method used for molecular characteri zation of CTV isolates and identification of specific CTV genotypes. The MMM method is ba sed on the amplification of selected regions of the CTV genome using CTV genotype specific primers, designed from non-conserved regions of VT, T3, T30 and T36 CTV isolates. The met hod provides a rapid technique for the detection of CTV genotypes (Hilf and Garnsey, 2000). MMM method can be used to characterize unknown CTV isolates based on the sequence sp ecific amplification of RT-PCR products, producing a profile designated as the Isola te Genotype (Hilf and Garnsey, 2000). The MMM method provides a rapid technique for the detect ion of CTV genotypes and also provides an 114

PAGE 115

initial assessment of the molecu lar variability within the CTV population from different citrus growing regions of the world (Hilf and Garnse y, 2000). Based on the MMM analysis of over 400 accessions from Florida, T36 and/or T30 genotypes were the primary CTV genotypes detected in commercial citrus trees in Flor ida, followed by the VT genotype, detected in some Meyer lemon trees, while the T3 genotype was never detected in commercial citrus (Hilf and Garnsey, 2002). It is very important that the complete MMM profil e is considered, not only the reaction to one or two primer markers (Brlansky et al., 2003). For example, an isolate was designated as a T36 genotype if it reacted with at least the T36 Pol; however, this isolate may not react with all T36 markers (T36 5 and T36 K-17). VT genotype and T30 genotype also were designated if reactions occurred with the VT-Pol and T30 Po l, respectively. Moreover, T3 genotype was designated only when there is a reaction with both T3-K17 and VT -Pol, and/or VT-5 (Brlansky et al., 2003). Heteroduplex Mobility Assay (HMA) Heteroduplex mobility assay is a simple method for the detection and estimation of the genotypic variations between viral strains. The DNA heteroduplexes are formed as a result of nucleotide differences between closely related sequences, upon denaturation and re-annealing of the sequences (Delwart et al., 1993). The DNA heteroduplexes, thus formed, have a reduced mobility on polyacrylamide gel electrophoresis (D elwart et al., 1993). HMA analysis has been used for the characterization of several R NA viruses in human and in plant RNA and DNA viruses (Cai et al., 1991; Delw art et al., 1993; Lin et al., 2000 ; Berry and C., 2001). HMA was developed for the detection of unknown CTV genotype s present in the mixed infections of CTV, which cannot be detected by other PCRbased detection methods (Bis was et al., 2004). The sensitivity of HMA has been reported to be a bout 5 %, however, sequence differences as low as 2.3 % have been reported (Berry and C., 2001). 115

PAGE 116

Quantitative Real-Time PCR (qRT-PCR) Method to Determine and Quantify CTV Accumulation None of the serological or molecular methods used provides a reliable estimation of virus accumulation. In contrast to conventional P CR where only the amount of end product is determined (Freeman et al., 1999), real-time PCR allows tracking of the changes of PCR product during the reaction. QRT-PCR has been reported for detection of viru ses from different woody plants. qRT-PCR has been reported for the detect ion for viruses in different insect vectors (Boonham et al., 2002; Fabre et al., 2003; Olmos et al., 2005) as well as from different woody plants (Marbot et al., 2003; Schne ider et al., 2004; Varga and Ja mes, 2005; Osman and Rowhani, 2006; Varga and James, 2006; Osman et al., 2007) There are some recent reports about using qRT-PCR to detect and quantify CTV from citrus and aphids (Ruiz-Ruiz et al., 2007; Saponari et al., 2008) Quantification of CTV titer by using reverse transcriptase quantitative real time PCR (qRT-PCR) is very useful in evaluating th e tested hybrid rootstock candidates for CTV resistance. Use of the qRT PCR analysis will add more sensitivity and accuracy without the need for post-PCR analysis. This will minimize the labor and the biohazard of using the Ethidium Bromide (a carcinogenic agent). QRT PCR is very se nsitive and it can detect as little as a 2 fold change. The Real Time PCR technique is base d on monitoring the fluorescence emitted from double -stranded DNA binding dye (SYPR Green I) or Flourophorelabeled specific probes that hybridize with target sequences during the expone ntial phase of the PCR reaction (In TaqMan assay). This fluorescent signal is proportiona l to the accumulation of PCR product generated which is proportional to the quant ity of initial DNA template in the sample (Livak et al., 1995). Fluorescence levels are detected during each cycle of amplification by specialized instrumentation. During the early cycles of amplif ication, the fluorescence level is low, but at a 116

PAGE 117

critical point, fluorescence accumulates to a level detectable by the instrument. This point is called the threshold cycl e (Ct) and depends primarily on th e starting amount of nucleic acid (Heid et al., 1996). The higher the initial amount of nucleic acid in the reaction, the smaller the Ct values. In practice, there is a linear relationship between the log of the starting quantity of the template and its Ct value during the real-time PCR reaction. Accordingly, the Ct is defined as the cycle at which the fluorescence r eaction reaches the threshold line. This technique is currently widely used in the medical field to estimate th e viral load (Hubert a nd Niesters, 2001). Real Time PCR can be used to analyze and quantify the virus titer in a la rge number of known samples in less than 3h. With the RNA viruses li ke CTV, it is not easy to get a high quality cDNA to be used in the time-consuming conventional PCR, but here the cDNA is made in the same tube and at the same time with a very hi gh efficiency. QRT-PCR is a rapid, quantitative, reliable and a very sensitive method. Using the qRT-PCR required less RNA as compared to the current methods that require the extraction of larger quantities of RN A from the infected materials. Materials and Methods Multiple Molecular Markers (MMM) Plant materials and virus isolates The CTV isolate pre-existing in the Hamlin inte rstock of all top-worked trees (designated TW) was obtained from North-40 field trees at the Citrus Research and Education Center (CREC) Lake Alfred, Florida, USA. This isol ate is MCA-13 positive by the ELISA test using the monoclonal antibody MCA 13, which has been reported to discriminate between mild and severe isolates in Florida (Permar et al., 1990). Samples of eleven selected top-worked representative rootstock candidates (Pummelo seedlings HBJL -3R10T20, HBJL-5, and 8-1-99-2B; and somatic hybrids A+7-2-99-5, A+5-1-99-3, A+ HBJL-5, Page + HBJL-3 Page + HBJL-7, A + Chandler 117

PAGE 118

#A1-11, A+4-3-99-2; and open-pollinated tetraploid 2247-OP-A2), along w ith the corresponding sour orange as a control, and the corresponding s ource isolate from the interstock were collected 16 months after successful top-wo rk grafting. These rootstock repr esentatives were chosen based on the MCA13, ELISA results to represent various le vels of CTV resistance in the test candidate rootstock population as described in Chapter 4 (Table 4-5). Cate gory I, the highly CTV tolerant selections, was represented by the somatic hybr id A + Chandler #A1-11. Category II, the selections showing an intermediate level of CTV resistance was represented by somatic hybrids A+ HBJL-5 and Page + HBJL-7. Ca tegory III, the slightly resistant selections was represented by the somatic hybrid Page + HBJL3. Category IV, the highly susceptible selections, was represented by the somatic hybrid A+ 7-2-99-5. Fina lly, Category V, the resistant selections, was represented by somatic hybrids A+ 4-3-3-99-2 and A+5-1-99-3; open-po llinated tetraploid 2247OP-A2; and pummelo seedlings HBJL-3R1 0T20, HBJL-5, and 8-1-99-2B (Table5-5). Multiple molecular markers primers Nine pairs of specific primers develope d by Hilf and Garnsey (2000) and one CTV universal primer, T36CP (Table 51) were used for genotyping of CTV in the source (Hamlin interstock) and the top-worked materials (test rootstock candida tes and the corresponding control sour orange). The MMM primers are designed fr om four different regions of the CTV genome (CP, POL, 5 and K17; Figure 5-1) of T36,T30, T3 isolates from Florida and VT isolate from Israel. Ten pairs of genotype specific primer pairs designated as T36POL, T36 5, T36K17, T30POL, T30 5, T30K17, VT POL, VT5, VTK 17,T3 K17 and the universal primer T36CP were synthesized (Integrated DNA technologies Inc., Coralville, IA), (Hilf and Garnsey, 2000). The universal T36 CP primer pair was obtained fr om the T36 sequence and is considered to be the general marker for CTV, and it is not useful for isolate discrimination since all isolates of 118

PAGE 119

CTV are expected to amplify with primers designed to the CP ge ne region of the viral genome due to the high similarity between diff erent CTV isolates in this region. Total RNA isolation and comple mentary DNA (cDNA) synthesis An analysis of variable sequences in the first three open reading frames (Figure 5.1) showed that the first ORF 1a is probably the mo st reliable for such analysis (Manjunath, K. L., unpublished data). A 403base region (nucleot ide 1081-1484) was selected for analysis of population mixtures by HMA. Bark of CTV-in fected tissue (100 mg) was ground in liquid nitrogen and the total RNA was extracted by using the RNeasy Plant Mini Kit (QIAGEN, Valencia, CA) according to the manufacturers in structions. The extraction was re-suspended in 30-40 l of RNase-free water depending on the pellet si ze, and either used immediately or stored at -80 C for later use. Ten l the RNA extract was used to synthesize the first strand complimentary DNA (cDNA) using a mixture of antisense primers as shown in Table (5-1). Reverse transcription was carried out using a final volume of 25 l using Superscript II (Invitrogen, Carlsbad, CA) according to the manuf acturers instructions. The PCR master mix was prepared as in appendix C. For better resu lts, cDNAs were purified using a QIA quick PCR purification kit (QIAGEN, Valencia, CA), accord ing to manufacturers protocol and the final elution was made in 40 l of elution buffer (EB). The CDNA purification step was very important in order to obtain good PCR amplif ication with the different MMM primers. Polymerase chain reaction (PCR) PCR reactions were carried out from each sample in 25 l PCR reaction volume. Twelve PCR amplifications were carried out using the ten primer pairs (T able 5-1). For each primer pair, 2.5 l of the purified cDNAs was amplified in a 25 l reaction volume in1X PCR reaction mixture using GoTaq Green Master Mix 2X (s ee appendix c) was used. PCR was performed using a programmable thermo-cycler. The PCR profile was summarized in appendix c. The RT119

PAGE 120

PCR products were analyzed on 1% agarose gels in 1X TAE buffer (40 mM Tris-Acetate and 1 mM EDTA, pH 8.0) containing 200 ng of ethidium bromide per ml. Ten l of PCR product and 5 l of a 100bp DNA ladder were loaded. DNA bands were visualized using a standard UVimaging system. Heteroduplex Mobility Assay (HMA) Plant materials and virus isolates Based on the MMM analysis, five somatic hybrid rootstock candidates ( A+ Chandler #A1-11, Page+HBJL-3, A+7-2-99-5, Page + HBJL -7, A+HBJL-5 and) were selected as representative hybrid rootstock candidates from each of the 5 re sistance categories (based on MCA13-ELISA results), along with the corresponding sour orange control and the source isolate from the interstock. The somatic hybrid A + Chandler #A1-11 was chosen as a representative of the highly tolerant rootstock candidates. The somatic hybrid Page + HBJL-3 represented the slightly tolerant group. The somatic hybrid A+ 72-99-5 was chosen as a representative of the susceptible rootstock candidates. The somatic hybrids A+ HBJL-5 and Page + HBJL-7 were chosen as representatives of the intermediate resistant rootstocks. Th e resistant group was not represented here since the MCA 13-ELISA results showed no CTV replication and because there was no PCR amplification in the MMM analysis Samples were collected approximately 16 months after top-work grafting. The virus infect ion was detected by sero logical techniques such as double antibody sandwich enzyme linked immunos orbent assay indirect (DASI-ELISA) as in Chapter (4). Total RNA isolation and comple mentary DNA (cDNA) synthesis CTV-infected tissue (100 mg) from bark was pulverized in liquid nitrogen and the total RNA extracted using the RNeasy Plant Mini K it (QIAGEN, Valencia, CA) according to the manufacturers instru ctions. The final total RNA extr action was re-suspended in 40 l of RNase120

PAGE 121

free water. The RNA extract was either used immedi ately or stored at -80 C. For the first strand complimentary DNA (cDNA) synthesis, 10 l of total RNA was mixed separately with the antisense primer, CN 491 (5GTGTARG TCCCRCGCATMGGAACC 3) (200 nM). The preparation was gently mixed then centrifuged at 10,000 rpm for 10 s, then incubated at in water bath at 70 C for 10 min and transferred to ic e for 5 min. A reaction mixture was prepared by adding 5X first strand buffer (Invitrog en), 0.1 M dithiothreiotol (DTT), 200 M of dNTPs mixture (Promega, Madison, WI) and nucleotide fr ee water. This reaction mixture was incubated at 42 C for 2 min in a water bath. and then kept at room temperature fo r 10 min. Twenty U of Superscript II RNase H-Reverse transcriptase (In vitrogen, Carlsbad, CA) and 40 U of RNasin (Promega, Madison, WI) was added to the reac tion mixture and centrif uged at 10, 000 rpm for 10 s. Nine l of this mixture was added to each tube containing the RNA preparations. Twenty l of the total content was incubate d at 50 C for 1h, 72C for 15 min. a nd then transferred to ice for slow cooling. The 50 l reaction volume containing 5 l of the cDNA was used in the PCR reaction carried by 5 U of Taq DNA polymerase (Promega, Madison, WI) in 1X PCR reaction buffer, 200 nM of each of CN 488 (5TG TTCCGTCCTGSGCGGAAYAATT 3) and CN 491 (5GTGTARGTCCCRCGCATMGGAACC3) pr imer pair, 1.5 mM MgCl2 and 200 M of dNTPs mixture. The reaction was carried out in a programmable thermo cycler. A-30 cycle PCR was performed according to the following steps: denaturation at 94 C for 2 min and 94 C for 30 s, annealing at 62 C for 45 s, and primer extensi on at 72 C for 45 s, (10 min at 72 C for the last extension step). The PCR products (5 l) were analyzed by electrophoresis on 1% agarose gel in 1X TAE buffer (40 mM Tris-A cetate and 1 mM EDTA, pH 8.0). DNA bands were visualized under a UV image system. 121

PAGE 122

DNA purification, clonin g and transformation The 403 bp region (1081-10484 nt) was amplifie d by RTPCR from total RNA. Twenty l of the PCR product was loaded on 0.8% agar ose gel and the DNA bands were separate by electrophoresis at low voltage for better separation. The amplified band was excised using a sterilized razor blade, and pur ified by using QIAGEN Gel Purifi cation kit (QIAGEN, Valencia, CA) following the manufacturers prot ocol. Final elution was made in 40 l of the elution buffer. Two l of the purified DNA was run on 1% agarose gel to confirm the purification step. The purified PCR products were then ligated into pGEM-T Easy plas mid vector according to the manufacturer (Promega, A1360). Three l of the gel purified PCR product was mixed with 5 l 2X rapid ligation buffer, 1 l of the T4 DNA ligase, 1 l of pGEM-T Easy vector (50ng) and 2 l of Promega nuclease-free water. For better ligati on product, the ratio should be 1 vector to 3 DNA. The ligation reaction was perfor med at 4 C for overnight. Three l of the ligation reaction mixture was then added to the 50 l of the DH-5 E. coli chemical competent cells, which were then incubated on ice for 30 min. The cel ls were transferred by heat-shock method at 42 C for 45s-1min, transferred to ice for 10-15 min and 800 l of Luria-Bertani (LB) medium pH7 (10 g trypton, 5g yeast extract, 5g NaCl, and 15g agar) was added to the mixture. The cells were grown at 37 C and 210 rpm for 45 min-1 h and three volumes 50, 100, and 150 l cells were plated on LB agar plates containing 50 g/ml of kanamycin and 80 ng/ml of X-gal. The plates were left open to dry in the hood then in cubated at 37 C overnight Master plates with 50 colonies each were prepared with the white coloni es by subculture on a fresh LB agar plate with kanamycin. The master plates were kept at 4 C until the colony PCR reaction was performed on them. 122

PAGE 123

Colony PCR and heteroduplex mobility assay (HMA) The transformed colonies were screened fo r the target insert using colony PCR by extraction of individual colonies in an extraction buffer (1 % Triton X100, 20mM Tris HCl, pH 8.0 and 2mM EDTA, pH 8.0). The colony extracts were then heated at 95 C for 10 min. Five l of the colony extract was used in a final volume of 50 l for the PCR reaction using CN 488 and CN 491 primer pair. PCR amplification conditions were 94 C for 2 min; 30 cycles of 94 C for 30 s, 62 C for 45 s, 72 C for 45 s; followe d by incubation at 72 C for 10 min. The PCR products were analyzed using 1% agarose gels and visualized on a UV image system. About 2530 clones from each test sample were used fo r the formation of heteroduplexes following a protocol slightly modified from (Delwart et al., 1993). The modification of this protocol was done by K.L. Manjunath. Colony PCR product (4.5 l) from the reference clone was mixed with the equal volume of the test clone and 1 l of 10X annealing buffer (100 mM tris-HCl, pH7.8, 1M NaCl and 20 mM EDTA). The reaction was done in a thermocycler block where the DNA mixture(reference DNA+ the tested colony DNA) was denatured at 95 C for 10 min, then slowly annealed at 68 C for 1 h and th en kept at 4 C for 10 min. The mixture was then electrophoresed on 10 % Criterion precast polyacrylamide gel (B iorad) in chilled Tr is-borate EDTA (TBE) buffer (0.088 M Tris-borate, 0.08 M boric acid and 0.02M EDTA) at 120 volts for 3.5 h at 4 C in a Criterion cell (Biorad). Th e Biorad unit was disassembled and the gel was cut from the upper edge for labeling the lanes and carefully stained in 1X TBE buffer containing 200 ng/ml of ethidium bromide for 20 min. A UV imaging system was used for visualization of DNA heteroduplex pattern. Tested clones that show ed heteroduplex formation during the first screening were selected for the second HMA screening by using one of these clones as a new reference clone. Therefore, the to tal number of clones from each sample were reduced to 2-3 123

PAGE 124

different groups (genotypes), based on the sequence differences after 2-3 HMA screenings indicated by the different HtD patterns. DNA miniprep, sequencing and sequence analysis Two to three clones from each group were cult ured from the master plate in 5ml LB medium without antibiotics a nd incubated over night at 37C with shaking at 210rpm. The DNA miniprep was done using Miniprep Quiapr ep spin miniprep from QUIAGEN. The DNA concentration was measured before sending for sequencing using the nanodrop at OD260. These clones were sequenced at the DNA Sequencing Core Laboratory at University of Florida, Gainesville, FL. These sequences were aligned with other CTV-full length sequences available in the database using CLUSTAL X (Thompson et al., 1997 ). The phyloge netic relationship among the sequences of the amplified regions from the tested CTV isolat es, using the universal primers (CN 488 and CN 491), was determined using program CLUSTAL X. The dendograms were generated using the Tr eeView program (version 1.6.6.), a nd then the Genedoc version 2.6.002 program (Nicholas and Nicholas, 1997). Quantitative Teal-Time PCR (qRT-PCR) Method to Determine and Quantify CTV Accumulation Plant materials and virus isolates Ten selected representative rootstock candidates were chosen based on the ELISA, MCA13 results and according to the seedlings av ailable. Somatic hybrid rootstock candidates Page + HBJL-3, A + SN7, A+4-3-99-2, A+HBJL -1, A+ HBJL-5, A+HBJL-3, A+7-2-99-5, A + Chandler #A1-11, Page + HBJL-7, A+4-4-99-6, and control sour orange we re inoculated in the greenhouse with the CTV, T36QD isolate kindly provided by the Dr. W.O. Dawson laboratory. Samples were collected approximately 12 months after inoculation. The virus infection was detected by double antibody sandwich enzyme linked immunosorbent as say indirect (DASI124

PAGE 125

ELISA). Samples of pummelo seedlings HBJL3, HBJL-5, and 8-1-99-2B, the somatic hybrid A+5-1-99-3, and open-pollinated tetraploid 2247-OP-A2 were collected 16 months after the successful top-working. The test rootstocks designation by ELISAMCA13 is presented in Table (5-5). RT-PCR primers The conserved region of the T36-CTV coat prot ein gene was used to design the primers. Forward primer, start positi on (69):TGCCGAGTCTTCTTTCAGT TCCGT and reverse primer, start position (172):TGTTC AAAGCAGCGTTCTGTTGGG. Primers were designed with the Primer Express 2.0 software (Applied Biosystems-P erkin-Elmer, Foster City, CA, USA). Primers were synthesized by Integrated DNA Technologies (IDT, Coralville, IA, USA). This primer pair can be used to detect and quantify the CTV in all infected sample regardless of the isolate. RNA extraction Total RNA from the test samples and the cont rols was extracted by RNeasy Plant Mini Kit (QIAGEN, Valencia, CA) according to the manuf acturers instructions and as previously described in the MMM and HMA section. Purifi ed RNA was measured by UV absorption at 260 nm, whereas RNA purity was evaluated based on the UV absorption ratio at 260/280 nm. The standard curve was generated from purified T36 (5 folds). This standard curve was used for relative quantification of the CTV titer in the unknown samples. A no-template control (NTC) was also prepared as a negative control for the analysis. PCR conditions Quantitative multiplex real-time PCR (qRT-PCR) assay was done in a fluorometric thermal cycler (ABI PRISMTM 7000 Sequence De tection System, Applied Biosystems-PerkinElmer, Foster City, CA) in a final volume of 25 l. The reaction mixture contained 1x SYBR Green Mix (2X) (Applied Biosystems), the RNA sample and an optimal concentration specific 125

PAGE 126

primer. The amplification conditions were one cycl e of one 30 min cycle at 48C to synthesize the cDNA, and then one cycle of one 2 min cycl e at 50C and a 10 min cycle at 95C, followed by 40 cycles of 15 s at 95C and 1 min at 60 C. Fluorescence was m onitored during the 60C annealing step. The data was analyzed with ABI PRISMTM 7000 SDS software ver.1.1 provided by P. E. Applied Biosystems. A standard curve was generated using purified RNA from the T36 isolate kindly provided by Dr. William O. Daws ons laboratory (CREC) and five-fold serial dilutions were prepared and used to obtain the standard curve. PCR amplification efficiency of the reaction is an important factor when us ing a relative quantific ation method. The common logarithm of dilution series of RNA was plotted against the Ct values of those dilutions. The PCR efficiency was calculated from the equatio n E = 10-(1/slope)1 as described by Ginzinger (2002). The ideal slope should be -3.32 for 100% PCR efficiency, which means that the PCR product concentration doubles dur ing every cycle within the e xponential phase of the reaction (Gibson et al., 1996). Results and Discussion Multiple Molecular Markers (MMM) Based on the amplification with the different MMM, a specific genotype profile (Isolate Genotypes) was assigned to each isolate accordi ng to Hilf and Garnsey (2000, 2002). The results of MMM analysis for the tested samples are presen ted in Tables (5-2) and (5-3), and in Figure (5-2). All the interstock source isolates were designated as group I and contained a mixture of T36, T30 and VT genotypes, as amplifications were obtained with the entire three markers specific to the T36, T30 and VT isolates (Figure 5-3 A) and (Tables 5-2 and 5-3). As expected, PCR products were obtained with the universal prim er used as a positive control: T36 CP. There were no products obtained with the markers speci fic to the T3 isolate. The somatic hybrids A+ Chandler #A1-11, A + HBJL-5 and Page + HB JL-7 representative isolate of group II 126

PAGE 127

(intermediate to high CTV tolerance), amplified with the T30 and T36 specific primers, but didnt amplify with either T3 or VT-pol. Theref ore, the isolate in these hybrids contained T30 and T36 only, but not VT (Figure 5-3 B, E and F and Tables 5-2 and 5-3). In group III (CTV susceptible), the representative rootstock candidate somatic hybrid A+ 7-2-99-5 showed amplification with primers specif ic to T30, T36 and VT, showing similar genotypes as the source isolate except, this isolate didnt amplify with T36 5, T36 K17, T30 5 or T30 K17. This isolate also didnt amplify with primers specific to T 3. As expected, this isolate amplified with the universal primer, T36CP (Figure 5-3 C). The profile is describe d in Tables (5-2) and (5-3). Group IV (slightly CTV tolerant), represente d by the rootstock candidate Page + HBJL-3 contained two different genotypes T30 and VT, as amplifications were obtained with the Primers specific to these isolates; T30 pol and VTpol re spectively ( Figure 5-3 D). The complete profile is presented in Tables (5-2) and (5-3). All sour orange sa mples corresponding to the test rootstocks gave the same profile and it was simila r to the source isolate. The isolate found in the control sour orange containe d T30, T36 and VT. This isolate reacted with T36 pol, T365, T30pol, T305, T30K17, VTpol, VT5, and VTK17, in addition to the amplification with T36 CP primer. There was no amplification with T36 K17 or the primers specific to T3. Thus, the sour orange isolate (same as group III) had a profile very similar to the source isolate except that the sour orange isolate lacked the amplification with T36 K17 primer (Figure 5-3 G) and Tables (52) and (5-3). Finally, a few of the test rootstocks namely so matic hybrids A+4-3-99-2and A+5-199-3, open-pollinated tetraploid 2247-OP-A2, and pummelo seedlings; HBJL-3R10T20, HBJL5, and 8-1-99-2B didnt amplify for any of the tested CTV genotypes, indicating a broad-based resistance to CTV replication (designated Group V). 127

PAGE 128

The Heteroduplex Mobility Assay (HMA) HMA results showed a range of differential virus movement as demonstrated by the different genotypes found in each rootstock can didate. HMA results supported the MMM results used to classify rootstock candi dates into different groups (I-IV, not including the CTV resistant group V) based on the number and combination of detected genotype s that successfully migrated from the Hamlin interstock into the test hybri ds. Figures (5-4) and (5-5 ) showed the different patterns of HMA, indicating different CTV genot ypes. HMA of the sour ce isolate, A+7-2-99-5 rootstock and sour orange control showed three different HtD patterns (F igures 5-4 A and C and 5-5 A), respectively. Rootstocks, A+ Chandler # A1-11, Page+ HBJL-3 and A +HBJL-5 show only two different patterns of HtD based on the am plification with the universal primer pair 488, 491 (Figures 5-4 B and D; and 55 B and C), respectively. Colonies with different HMA patterns were sequenced. The dendogram in Figure (5-6) was generated in TreeView to determine the relationships among the tested hybrids accordi ng to CTV genotypes and also between CTV genotypes in these test rootst ocks and the most commonly kno wn CTV isolates from the GenBank database [Accession number, AF260651 (T30), Y1842 (T385), AB 046398 (NUAGA), EU937519 (VT), AF001623 (SY568), AY340974 (QAHA).and U16304 (T36)]. The comparison of nucleotide sequence identities of the diffe rent genotypes from the rootstock candidate representatives (A+7-2-99-5, A+Chandler#A1-11, Page+HBJL-3, 4Page+HBJL-7, A+HBJL-5), sour orange, and the source isolate, obtained after heteroduplex mobility assay (HMA) of the 403 bp amplicon from CTV genome (ORF1a) with se quenced CTV isolates from the GenBank database is shown in Table (5-4 ) and the phylogenetic tree showi ng genetic relationships of the different CTV genotypes is presented in Figur e (5-6). The number before each rootstock indicates the colony number used for DNA se quencing. Rootstock candidate, A+7-2-99-5 acquired a nucleotide sequence closely relate d to both the T30 and T385 isolate with 98 % 128

PAGE 129

sequence homology. It was also clustered with T36 (96 % sequence homology). The nucleotide sequence of CTV in this rootst ock was distantly related to the NUAGA CTV isolate (only 89% similar). The SY568, VT and QAHA CTV isolate from Egypt shared nucleotide similarities of 94%, 92% and 92% respectively. The mild isol ate (T30), QD isolate (T36) and the VT SP isolates from Israel were the most important CTV isolate to determine the sequence homology between them and the test rootstoc ks in this study. The isolate in sour orange was closely related to that of A+7-2-99-5 and the source, and all clustered with T30 and T36 CTV isolates with nucleotide identity of 99% and 96%, respectivel y. The nucleotide sequence from this isolate shared only 85% homology with the VT isolate. The source isolate was closely related to T30, T36 with 99 % and 96% similar ity, respectively, than to the VT (91% nucleotide homology). Isolates found in the Page + HBJL-7 rootstock was more similar to both T30 and T385 isolate (99% and 98%) than to VT and T36 (90% and 91 %), respectively. In the phylogenetic tree, the isolate from rootstock candidate A+ HBJL-5 is grouped with T30 and T36 isolates with sequence homology 99% and 92%, respectively. This isolate shared sequence identity with VT (89%) and in the tree it was not included w ith the same group with VT. The isolate from A+ Chandler A1 which has a nucleotide sequence highly similar to the T30 sequence (98 %). Therefore; it was grouped with the T30 isolate. It was also grouped with T36 is olated with sequence homology (91%). This isolate is more dist antly related to VT isolate (89%) and it was not clustered with theVT group in the phylogenetic tree. Page + HB JL-3 was closely related to T30 (98%) and shared 92% nucleotide sequence identity with VT is olate. This isolate was more distantly related to T36 (80% sequence homology) and it did not group with T36. In general there was a strong correlation between the identity of the sequence homology and the generated phylogenetic tree. The highest nucleotide sequence homology with any tested isolate and the VT isolate from the 129

PAGE 130

GenBank was 92%, whereas the nucleotide sequen ce homology with the other isolates from Florida, T30 and T36, was 99%. These results proved that the VT isolate from Israel is more distantly related to the isolates found in the current work and s hows the need for the complete sequence of the VT isolate currently found to comp are with the VT isolate from Israel. Since VT is found as a mixture, aphid tran smission could be a useful tool to separate the CTV genotypes in this isolate as needed to sequence the pure VT isolate. Quantitative Real-Time PCR (qRT-PCR) Method to Determine and Quantify CTV Accumulation Analysis of qRT-PCR data on the rootstock candidates inoculated with T36 in a small greenhouse companion study revealed that some of the tested rootstocks including the somatic hybrids A+7-2-99-5 and A+SN7 showed hi gh CTV titers (4.996 ng/L and 4.400 ng/L, respectively) by qRT-PCR, with very low Ct values (13.14.04 and 13.31.098, respectively), indicating that these rootstock candidates are susceptible to CTV infection and replication. On the other hand, rootstocks such as somatic hybr ids A+HBJL-1, A+4-3-99-2, and A + Chandler #A1 showed very low CTV titer, with highe r Ct values (25.33.3,; 23.55 .0 and 21.93.569, respectively), and the virus titer was 0.001 ng/L, 0.002 ng/L and 0.008 ng/L respectively, suggesting some level of tole rance to CTV replication. The somatic hybrids A+ HBJL-5, A+ HBJL-3, and A+4-4-99-6 showed intermediate CTV titers (0.415ng/L, 0.235ng/L and 1.139ng/L, respectively). Above all the test rootstocks, sour orange showed the highest CTV titer, 16.07 ng/L with Ct =11.55.05, as expected for a susceptible control. In addition, five rootstock candidates from the top-working grafts (somatic hybrid A+5-1-99-3, open-pollinated tetraploid 2247-OP-A2, and pummelo seedli ngs; HBJL-3 R10T20, HBJL-5, and 8-1-99-2B) were tested by qRT-PCR since they were negative by MMM and MCA13ELISA. Rootstock candidate A+5-1-99-3 showed a CTV titer = 0.0 19 ng/ L with a high Ct value (20.71.216), 130

PAGE 131

and 2247-OP-A2 rootstock candidate showed a CTV titer=0.01 ng/ L with high Ct (21.67.318). The CTV titer in rootstocks; HB JL-3 R10T20, HBJL-5, and 8-1-99-2B was, 0.033 ng/L, 0.029 ng/L, and 0.089 ng/L respectively. Summary and Conclusions Field isolates of CTV often are present mixt ures of different CTV genotypes (Mawassi et al., 1995a; Mawassi et al., 1995b). The differential selection of host to different genes has been reported (Ayllon et al., 1999b; Ayllon et al., 19 99a). The population diversity of CTV may change due to several effects, such as grafting with a different citrus genotype. In some cases, this can lead to the formation of new CTV genot ypes and therefore be pa rtially responsible for the broad biological, serological and also molecular variability among CT V isolates (Ayllon et al., 1999b; Ayllon et al., 1999a) The molecular characterization of the CTV field isolates in the top-worked hybrid rootstock can didates using MMM and HMA c onducted in this study also showed significant changes in the population stru cture of CTV isolates moving from the Hamlin sweet orange interstock into the ne wly grafted top-worked hybrid material. The changes in the CTV genotype composition also suggest differential selection properties of different citrus hosts (t est rootstock candidates). Using MMM, an isolate was designated as T 36 genotype if it reacte d with at least the PCR marker for the T36 Pol, however it may not react with all the T36 markers. The T30 genotype and the VT genotype also were designated if a reaction occurred with T30 pol and VT pol markers, respectively. The T3 genotype should react with not only T3 K17, but also with the VT pol and/or with the VT 5 markers (Brlansky et al., 2003). The isolate, T36 CP, and the universal; primer pair CN 488, and 491 are used as a control. The strength of the amplified band can be used as an indicator of which genotype is dominant in each sub-isolate. Using the MMM and the sequence analysis in the HMA, the hybrid rootstock candida tes that allowed CTV 131

PAGE 132

replication were divided into 4 groups (I-IV) in Table (5-3) base d on the different combination of CTV genotypes that were observe d. Group V was composed of hybrid rootstock candidates that did not show any amplification with the MMM, indicating no CTV replication from any of the viral genotypes, indicating broad resistance to CTV. The present study demonstrated both qualitative and quantitative changes in the original CTV genotypes found in the original Hamlin interstock isolate upon top-working with genetically different hybrid ro otstock candidates. The change s in the CTV genotypes suggest specific selection pressures by the host scion on th e viral sequences. Interes ting enough is that all the top-worked sour orange samples gave the exact MMM profile that was very similar to the one found in the Hamlin interstock source isolate. Most of the known molecular methods for CTV detection are limited by the lack of information available for CTV sequences. New and better molecular tools are required for the fast and efficient detection of new CTV genotypes. The HMA and the sequence information generated on this study provide valuable information about the population diversity of CTV. Moreover, this study suggests a dist ant relationship of the VT isolate found in the Florida field under this study and the VT isolate known as stem pitting (SP) isolate from Israel. Determining the comple te sequence of the Florida field VT isolate will be very helpful for comparison with the comp lete genome sequence of the VT isolate from Israel, as needed to ultimately prove that this Florida VT isolate may be different from the Israeli VT isolate that causes economically damaging SP. This suggestion is supported by the fact that neither the source Hamlin interstock nor the hy brid rootstock candidate s containing the Florida VT isolate developed any stem pitting symptoms over a 2-year period of observation. Quantitative real time PCR is very useful in different purposes including potential association of the symptoms se verity with accumulation of specific variants, evaluation of 132

PAGE 133

resistance of citrus varieties to different viruses (Ruiz-Ruiz et al., 2007). Based on the analysis of the qRT-PCR results, some of the tested root stocks, such as the somatic hybrid A+7-2-99-5, showed a very high quantity of CTV and severe disease symptoms, making this rootstock very susceptible to CTV infection. This hybrid also showed a strong seedling yellows reaction in the companion greenhouse challenge. In contrast, a group of somatic hybrid rootstock candidates including somatic hybrids A+HBJL -1, A+4-3-99-2, and A+ Chandler #A1 showed zero to very low CTV titer and no disease symptoms, suggesting some resistance to CTV replication and QD disease. Many hybrids showed intermediate leve ls of CTV titer, but no disease symptoms. The results obtained from real-time PCR for quant ifying CTV accumulation are very accurate and important for effective screening of new rootstoc k candidates. Moreover, the high efficiency of this technology allow the analyses of large num bers of samples in less than 3 h. qRTPCR provided a fast, reliable and accurate method to de termine the level of CTV tolerance in the preselected rootstock candidates. A final group of new rootstoc k candidates including somatic hybrids A+4-3-99-2 and A+51-99-3, and the open-pollinated tetraploid 2247-OP-A2, were MC A13 negative and shown by the molecular analysis (MMM) to be resistant to CTV replication. In the qRT-PCR test these rootstock candidates showed very low CTV tite r (0.002-0.019), respectively. Such low titers could be accounted for by virus movement al one, possibly with no replication. Thus, these hybrid rootstock candidates have potential to repl ace sour orange rootstock in Florida if they meet other required horticultu ral criteria. These rootstoc ks are among many top-worked rootstock candidates that are expected to begin fruiting next year. Seeds will be extracted from the fruits, counted, and tested by microsatellite analysis to dete rmine if embryos are of nucellar or zygotic origin, with nucella r origin being required for st andard nursery propagation. CTV133

PAGE 134

resistant zygotic hybrids would stil l have value as rootstock breedi ng parents. In the future, qRTPCR should be performed using the strain specif ic primers. This assay could have numerous potential applications for differe ntiation of CTV strains in the CTV complex at once, using the strain-specific primers. Quantitative multiplex TaqMan Assay can use up to four different probes simultaneously in the same reaction to different iate and quantify the different CTV genotypes in isolate containing mixtures. Applying this technique to screen the rest of top-worked rootstocks for strain differentiation will be very us eful for fast and reliable results. Figure 5-1. Citrus tristeza viru s (CTV) genome indicating different ORFs and approximate portions of the genome amplified with genotype specific molecular markers by Hilf et al, 2000. The sequencespecific markers amp lified are indicated by the lime green blocks and the name of the amplified marker underneath. 134

PAGE 135

Figure 5-2. Heteroduplex Mobility Assay (HMA). A) The HMA reaction. B) The polyacrylamide gel of the HMA reaction. 135

PAGE 136

Figure 5-3. Multiple molecular marker (MMM) prof iles of CTV source isolate and selected test rootstocks, created by PCR amplification using sequencespecific primers. A) Profile of CTV source isolate. B) Profile of CTV in rootstock A + Chandler #A-11. C) Profile of CTV in rootstock A+7-2-99-5. D) Profile of CTV in rootstock Page+HBJL3. E) Profile of CTV in rootstock Page+ HB JL-7. F) Profile of CTV in rootstock A+ HBJL-5. G) Profile of CTV in rootstock sour orange. Ten l of MMM-PCR product was loaded in lanes 1-10. Lanes (1-3) show amplification of T36 POL, T36 5 and T36 K17 markers, specific for T36 isol ate from Florida. Lanes (4-6) show amplification of T30 POL, T30 5 and T30 K17 markers, specific for mild T30 isolate from Florida. Lanes 7-9 show amplification of VT POL, VT 5 and VT K17 markers, specific for VT isolate from Israel. Lane 10 show amplification of T3 K17 marker, specific for T3 isolate from Fl orida. Lane G shows amplification of general markers: T36 CP. M = 100pb DNA ladder. 136

PAGE 137

Figure 5-4. PAGE 1 showing the retarded mobility of heteroduplexes 1 (HtD2) formed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a. Each lane represents the homodupl ex (HmD) or the HtD formed between the reference clone and each of the test clones. A) HtD profiles of CTV source isolate. B, C, and D) Profiles of CTV in tested r ootstocks. B) Representative of group II; A+Chandler A1-11. C) Representative of group III; A+7-2-99-5. D) Representative of group IV; Page+HBJL-3. C1 and C2: positiv e control; R: Clone # 1 as a reference with the HmD band; Lanes 1-22 represent th e tested clones showing either HmD or HtD formations. 137

PAGE 138

Figure 5-5. PAGE 2 showing the retarded mobility of heteroduplexes 2 (HtD2) formed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a. Each lane represents the homodupl ex (HmD) or the HtD formed between the reference clone and each of the test clone s. A) HtD profiles of CTV sour orange isolate. B) Profiles of CTV in tested r ootstock A+ HBJL-5. C) Profiles of CTV in tested rootstock Page + HBJL-7. Lanes C1 and C2; positive control. Lane R; Clone # 1 as a reference with the HmD band; Lanes 1-22 represent the tested clones showing either HmD or HtD formations. 138

PAGE 139

Figure 5-6. Phylogenetic tree s howing genetic relationships of the CTV genotypes found in topworked scions A+7-2-99-5, A+Chandl er#A1-11, Page+HBJL-3, 4Page+HBJL-7, A+HBJL-5, sour orange and the intersto ck source obtained after heteroduplex analysis (HMA) of the 403 bp amplicon, with the already sequenced CTV isolates. The number before each rootstock or source indicated the colony number used for DNA sequencing from this specific samp le. Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) the phy logenetic relationshi p of the sequences were generated using the program TreeView version 1.6.6. 139

PAGE 140

A B Figure 5-7. Q-RT-PCR amplification. A) Amplification curve. B) The standard curve. 140

PAGE 141

141 Table 5-1. Sequence of Multiple Molecular Markers (MMM) primers (Hilf and Garnsey, 2000). Primer Primer sequence (5-3) Amplified size(bp) *T36 CP SENS ANTISENSE ATGGACGACGAA ACAAAGAAATTG TCAACGTGTGTTGAATTTCCCA 672 T36 SENS ANTISENSE GATGCTAGCGATGGTCAAAT CTCAGCTCGCTTTCTCGCAT 714 T36 -5 SENS ANTISENSE CTCAGCTCGCTTTCTCGCAT AATTTCACAAATTCAACCTG 500 T36 K17 SENS ANTISENSE CTTTGCCTGACGGAGGGACC GTTTTCTCGTTTGAAGCGGAAA 409 T30 POL SENS ANTISENSE GATGCTAGCGATGGTCAAAT CTCAGCTCGCTTTCTCGCAT 696 T30 5 SENS ANTISENSE CGATTCAAATTCACCCGTATC TAGTTTCGCAACACGCCTGCG 594 T30 K17 SENS ANTISENSE GTTGTCGCGCCTAAAGTTCGGCA TATGACATCAAAAATAGCTGAA 409 VT POL SENS ANTISENSE GACGCTAGCGATGGTCAAGC CTCGGCTCGCTTTCTTACGT 695 VT 5 SENS ANTISENSE AATTTCTCAAATTCACCCGTAC CTTCGCCTTGGCAATGGACTT 492 VT K17 SENS ANTISENSE GTTGTCGCGCTTTAAGTTCGGTA TACGACGTTAAAAATGGCTGAA 409 T3 K17 SENS ANTISENSE GTTATCACGCCTAAAGTTTGGT CATGACATCGAAGATAGCCGAA 409 *Universal primer pair

PAGE 142

Table 5-2. Genotype profiles of TW (top-worked scion) source isolates an d sub-isolates, created by RT-PCR amplification of ten genotype-specific markers and one general marker. Ten geno type-specific markers are T 36 POL, T36 5, T36 K17, T30 POL, T30 5, T30 K17, VT POL, VT 5, VT K1 7 and T3 K17 and the general marker, T36 CP. Isolate / subisolate MCA -13a T36 CP T36 POL T36 5 T36 K17 T30 POL T30 5 T30 K17 VT POL VT 5 VT K17 T3 K17 Hamlin interstock (TW) source + + + + + + + + + + + A + Chandler #A1-11 + + + + + + + A+ 7-2-99-5 + + + + + + + Page + HBJL-3 + + + + + + Page + HBJL-7 + + + + + + + A+ HBJL-5 + + + + + + + + sour orange + + + + + + + + + + A+4-3-99-2* A+5-1-99-3* 2247-OP-A2* HBJL-3* R10T20 HBJL-5* 8-1-99-2B* 142 a= Monoclonal antibody, MCA-13, Double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) *Rootstocks candidates collected from field shown no PCR amplifi cation with all the MMM primers

PAGE 143

Table 5-3. Summary of the multiple molecular markers (MMM) results showing differential movement of CTV genotypes from the sweet orange interstock into the top-worked test rootstock material. Citrus Germplasm Group CTV Resistance Category based on the performance MCA13a Subisolate CTV genotypes identified 1 Source I susceptible + 3 T36, T30, VT 2 A + Chandler #A1-11 II tolerant + 2 T36, T30 3 A+ HBJL-5 intermediate + 2 T36, T30 4 Page + HBJL-7 intermediate + 2 T36, T30 5 A+ 7-2-99-5 III susceptible + 3 T36, T30, VT 6 sour orange susceptible + 3 T36, T30, VT 7 Page + HBJL-3 IV Slightly tolerant + 2 T30, VT 8 A+4-3-99-2 V resistant Virtually no virus replication 9 A+5-1-99-3 resistant Virtually no virus replication 10 2247-OP-A2 resistant Virtually no virus replication 11 HBJL-3 R10T20 resistant Virtually no virus replication 12 HBJL-5 resistant Virtually no virus replication 13 8-1-99-2B resistant Virtually no virus replication a= A Monoclonal antibody, MCA-13, Double-anti body sandwich enzyme-linked immunosorbent assay indirect (DASI-ELISA) 143

PAGE 144

Table 5-4. The comparison of nucleotide sequence identities of the different genotypes from the r ootstock candidate representat ives (A+7-2-99-5, A+Chandler#A1-11, Page+HBJL3, 4Page+HBJL-7, A+HBJL-5), sour or ange, and the source, obtained after heteroduplex mobility assay (HMA) of the 403 bp amplicon from CTV genome (ORF1a) with sequenced CTV isolates from GenBank database. Nucleotide sequence analysis was done using CLUSTALX (Thomps on et al., 1997) and GeneDoc version 2.6.002 (Nicholas and Nicholas, 1997). Colony number 8Sour orange 1Source 4Page+HBJL-7 3A+HBJL-5 2A+Chandler#A1-11 6 Page + HBJL-3 T30* T385* 13Sour orange 14Page+HBJL-3 15A+7-2-99-5 10Source SY568 VT NUAGA* 7A+Chandler#A1-11 11Page+HBJL-7 16A+HBJL-5 9Sour orange 12A+7-2-99-5 17Source QAHA T36* 1 A+7-2-99-5 99 98 98 98 97 97 98 98 86 88 87 86 91 85 89 83 83 82 84 82 80 77 81 1 Sour orange 99 98 98 98 98 99 98 87 88 88 86 91 85 89 83 83 82 83 83 80 78 82 1 Source 99 99 98 98 99 99 87 88 88 86 92 90 90 83 84 83 83 83 80 78 82 1 Page+HBJL-7 99 98 98 99 98 87 88 88 86 92 90 98 83 84 82 83 83 80 78 82 1 A+HBJL-5 98 98 99 98 87 88 88 86 92 89 89 83 84 82 83 83 80 78 82 1 A+Chandler#A1-11 98 98 97 86 87 87 85 91 89 89 82 83 82 82 82 80 77 81 1 Page + HBJL-3 98 97 86 87 87 85 91 89 89 83 83 82 83 82 79 77 81 T30* 99 87 87 88 86 92 90 90 83 84 83 83 83 80 78 82 T385* 87 88 88 86 92 89 89 83 84 82 83 82 80 77 81 2 Sour orange 88 93 88 93 92 84 80 80 81 80 81 80 75 79 2 Page+HBJL-3 93 93 88 94 92 84 81 81 82 81 82 78 76 80 2 A+7-2-99-5 88 94 92 85 80 81 82 81 81 78 76 80 2 Source 91 91 83 79 79 78 79 78 78 73 77 SY568 96 88 83 84 83 84 84 76 79 83 VT 87 82 83 82 82 82 81 79 82 NUAGA* 83 83 81 82 82 79 78 82 2 A+Chandler#A1-11 99 95 93 92 80 87 91 2 Page+HBJL-7 -5 96 92 92 90 87 91 144 2 22982 35 8426 3 566 5 A+HBJL 9 9 8 8 9 3 Sour orange 92 92 90 92 96 A+7-2-99 ce 9 9 9 9 Sour 9 9 9 QAHA 9 The nucleotide sequences retrieved from GenBank [A ccession number, AF260651 (T30), Y 1842 0(T385), AB 046398 (NUAGA), EU937519 (VT), AF001623 (SY568), U16304 (T36)] and AY340974 (QAHA).

PAGE 145

Table 5-5. Detection and relative qu antification of CTV in selected test rootstock material using quantitative Real-time PCR. Controls & Topworked scion germplasm Resistance classification Ct S.D.a CTV titer (ng/ l total RNA) CV %b Healthy tissue Not detected Infected tissue 11.24 0.150 20.020 1.34 Page+HBJL-3 Slightly tolerant 13.93 0.235 2.786 1.68 A+SN7 Susceptible 13.31 0.098 4.400 0.74 A+4-3-99-2 Resistant 23.55 .007 0.002 0.03 A+HBJL-1 Resistant 25.33 0.300 0.001 1.18 A+ HBJL 5 Intermediate 16.53 0.211 0.415 1.27 A + HBJL 3 Intermediate 17.31 0.143 0.235 0.38 A+7-2-99-5 Susceptible 13.14 0.040 4.996 0.31 A + Chandler #A1 11 Tolerant 21.93 0.569 0.008 2.59 A+4 4 99 6 Intermediate 15.15 0.101 1.139 0.67 sour orange Susceptible 11.55 0.050 16.07 0.56 A+5 1 99 3* Resistant 20.71.216 0.019 1.04 2247 OP A2* Resistant 21.67.318 0.010 1.38 HBJL 3 R10T20* Resistant 19.97.212 0.033 1.06 HBJL 5* Resistant 20.14.665 0.029 3.30 8 1 99 2B* Resistant 18.63 .136 0.089 0.73 Top-worked field samples collected 16 months after top-working graft a S.D.=Standard divion bCV= Coefficient of Variance 145

PAGE 146

CHAPTER 6 CONCLUSIONS Citrus is the most extensively grown fruit crop worldwide. Citrus tristeza is the most economically important viral pathogen in citrus. The primary diseases caused by citrus tristeza virus (CTV) are quick decline (QD) that kills co mmercial trees grafted to sour orange rootstock, and stem-pitting (SP), a non-lethal disease that reduces the fruit quality a nd productivity of sweet oranges and grapefruit. The introduction of the pr imary CTV vector, the br own citrus aphid, into Florida in 1995 resulted in th e rapid spread of CTV-QD isolat es. This immediately jeopardized millions of commercial citrus trees planted on sour orange rootstock in Florida, since it is highly susceptible to citrus tristeza quick decline diseas e. This eventually eliminated the use of sour orange ( Citrus aurantium L.) rootstock, with a few minor exceptions. Currently there is no rootstock that provides an adequate replacement fo r sour orange. The primary problem is that the top rootstocks in Florida are tr ifoliate hybrids, and in general they are not adapted to high pH, calcareous soils. A primary objective of citrus improvement programs has been the development of new rootstocks that perform similarly to sour orange, but are of cour se resistant to CTV-induced QD. Since sour orange has been shown to be a pum melo-mandarin hybrid, researchers have produced many diploid and tetraploid pummelo-mandarin hybrids with a goal of id entifying QD resistant hybrids that can otherwise perfor m like sour orange. If successful, not only would citrus growers have an answer to QD, but also possibly to citrus blight, since pummelo-mandarin hybrids generally show a high to lerance to this malady. Citrus blight remains a serious problem in Florida and Brazil, where it kills an estimated one million and 10 million trees, respectively, on an annual basis. Screening new rootstock germplasms in the greenhouse has been hampered by a CTV-induced seedling yellows (SY) disease of no commercial impor tance. Inoculated trees in 146

PAGE 147

greenhouse screening assays that sh ow disease symptoms are genera lly considered susceptible to QD; however, such symptoms could be due only to SY, and it has not been proven whether or not there is a high correlation between QD and SY. Trees showing seedling yellows symptoms can often recover over time or following field planting. Thus, re lying only on greenhouse screens could result in the discarding of QD resistant hybrids. A major obj ective of the present study was to determine if a field-screen that relied on the top-working of new candidate rootstock hybrids onto established CTV-infected field trees could bypass the co nfounding of SY encountered in greenhouse screening for CTV-induced QD. A new field assay to assess the reaction of new hybrid rootstock candidates to CTV was developed by applying a top-working techni que, using the hanging bud method. Seventy-two citrus genotypes, including pre-selected pum melo parents, and pummelo/mandarin hybrids including somatic hybrids, tetrazygs from controll ed tetraploid crosses, diploid hybrids and open pollinated tetraploids, were included in this st udy. All selections were made based on advice from Dr. Grosser, based on availa bility, previous observa tions, and results from other screens for soil adaptation, insect and disease resistance. Several allotetraplo id combinations of selected pummelo seedlings with Changsha and Ambly carpa mandarins; Murcott and W. Murcott tangors, and Page tangelo, were developed using somatic hybridizat ion. Pummelo zygotic seedlings were used as leaf parent in somatic hybridization experiments and were selected from a greenhouse screening for soil adaptation and Phytophthora resistance. Some of these pummelo selections also showed resist ance/tolerance to CTV-induced qui ck decline after grafting with Valencia scion containing T36 CTV after 2 years in the field. The mandarin-type parents were chosen based on their performance in the protoplast system and general rootstock performance with wide soil adaptation. Ther efore, these somatic hybrids are considered as good candidates to 147

PAGE 148

replace sour orange rootstock. All of these new rootstock candidates, mostly developed via protoplast fusion were top-worked along with sour orange as a c ontrol onto 15 year old Hamlin trees infected with three different strains of CTV common to Florida (T30, T36 and VT). Although, some limitations were encountered in this experiment, including the bud availability of some of the test hybrids and th e limited number of H amlin interstock trees available for top-working, the hanging bud met hod provided a highly efficient method (80-90% success) for top-working. In the present study, different scaffold branches on individual trees were used as replications for the individual hybrids. If available, it would be beneficial in future work if at least three replicate trees were used for each candidate rootstock selection. Careful management of irrigation, fertilization and pest icides is a necessity. Eighteen months after successful top-working, the shoot growth of the new hybrid shoots were measured. Overall, there were significant differences in the shoot grow th among the tested selections and the CTVsusceptible sour orange control shoots, which were consistently stunted. The highest three shoot growth obtained from the parental pummelo s eedlings were from seedlings 5-1-99-2, HBJL-3 and 8-1-99-2B. For the somatic hybrids, the highest three shoots grow ths were from Amb+ HBJL-3, Amb+ HBJL-1, Amb+HBJL-2B. Examination of the top-worked test stems for stem pitting symptoms showed no stem pitting evidence, even after observation under th e light microscope. In general, no seedling yellows-type symptoms were observed in any of the top-worked scions, even from the MCA13 positive materials, including the grafted sour orange. This result indicates that top-working overcame the seedling yellows (SY) effect that has previously caused problems with our greenhouse QD resistance assays. The only othe r clearly observed CTV symptom was the stunted growth in all top-worked sour orange. This method was proven to bypass the SY effect 148

PAGE 149

that confounds CTV screening in the greenhous e. To support this foundation, a SY companion experiment in the greenhouse was conducted by i noculating representatives of the top-worked rootstock candidates with the T36, CTV quick declin e isolate from Florida. After the successful T-budding, the buds were unwrapped and left to push. The plants were trimmed when the new buds pushed strong new flushes that were then monitored for the SY symptoms. The data was in contrast with data from the fi eld top-working experiment. Some tested somatic hybrid rootstock candidates (A + 7-2-99-5 and A + Chandler #69) showed strong SY symptoms in the greenhouse study, and a high susceptibility to CTV in the top-working field study. However, several other tested somatic hybrid rootstocks (A + Ch andler #A1-11, A+ HBJL -5, A+ 4-4-99-6 and Page+HBJL-3) showed a very strong SY reac tion in the greenhouse st udy, but none of these showed any SY reaction or any disease symptoms in the field. In another experiment, the somatic hybrids A+ 5-1-99-3 and A + HBJL-5 showed a strong SY reaction in the greenhouse, but again in the current field study showed no symptoms whatsoever (J.W. Grosser, personal communication). Thus, there is clearly no str ong correlation between the SY and QD diseases, and the top-working approach provides a more re liable screen for CTV-QD resistance in the new rootstock candidates. Another advantage of the to p-working approach is to speed flowering and fruiting, allowing for a more rapid assessment of the hybrids for amenability to seed propagation, with the final result being a seed tree. The virus infection was detected in the grafted materials by serological techniques including tissue blot i mmunoassay (TBIA), double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) and western analysis MCA 13 monoclonal antibody provides a tool to screen for se vere CTV infection, especially in the Florida budwood registration program to prevent propagation of budwood containing potentially damaging isolates. The 149

PAGE 150

relatively quick tissue print method using the monoclonal antibody, MCA13 was determined to be a good method for high throughput and to valida te traditional ELISA. Se venteen of the test genotypes were MCA13 negative in this study. The test hybrid candidates that showed negative results by MCA13 monoclonal antibody were pumme lo seedlings: 5-1-99-2, 7-2-99-1, 8-1-992B, 8-1-99-4B set 2, Chandler #A1-11, HBJ-L3 R10T20 and HBJL-5; and somatic hybrids: Amb +4-3-99-2, Amb +5-1-99-3, Amb +Chandler, Amb + HBJL -1, Amb + HB JL -2B, Murcott + HBJL -1 and W. Murcott + HBJL -7. The tetrazygy 2247 x 6073-00-6 (GREEN 6), the diploid hybrid Volk x P, and the open pollinated tetr aploid 2247-OP-A2 were also MCA-13 negative. These results suggest that these rootstock candidates should be re sistant to CTV-induced QD. It was unfortunate that efforts to top-work pummelo seedlings HBJL-1 and HBJL-2B were unsuccessful, since somatic hybrids made with these parents were resistant (two somatic hybrids made with HBJL-1). Original 5-year old trees of pummelo seedlings HBJL-1, HBJL-2B and 5-199-2 exist in a grove adjacent to the top-worked trees, so we plan to run ELISA on these trees to determine if they have become infected by CT V. The tetrazyg Green 6 has Carrizo citrange parentage, and could possibly contain the trif oliate orange CTV resistance gene. The openpollinated tetraploid 2247-OP-A2 came from the Nova mandarin +HBP zygotic pummelo somatic hybrid mother plant, and this test hybrid also performed extremely well in a Diaprepes/Phytopthhora screen (J.W. Grosser, personal communication). Although the pollen parent is unknown, the seed tree has a mandari n-type appearance with narrow leaves and petioles, suggesting some additional mandarin parentage. The data also revealed various degrees of CTV resistance/tolerance in the remaining te sted genotypes. The rootstock candidates were divided into 5 categories based on the MCA13 ELISA, resistant; highly tolerant, intermediate, slightly tolerant and susceptible. 150

PAGE 151

The interstock Hamlin field trees contain mi xture of different genotypes and one of this study objectives was to determine the different CTV genotypes moved and replicate in the newly top-worked scions (test root stock candidates and the corres ponding sour orange control). Molecular techniques including multiple molecula r markers (MMM) analysis, and heteroduplex mobility assay (HMA) coupled with the DNA seque ncing of the amplified region were done to determine the population diversity and the differential movement of CTV genotypes from the interstock into the newly graf ted test rootstock materials. The results of both MMM and HMA molecular techniques showed that a range of different genotype combinations moved to the tested materials and therefore, the new rootstock candidates were classified into four different groups based on the number of the detected ge notypes (Table 5-3 and Figures5-3, 5-4, 5-5 and 5-6). The population diversity of CTV ma y change due to several factor s, such as grafting with a different citrus genotype. In some cases this can lead to the formation of new CTV genotypes (Ayllon et al., 1999b; Ayllon et al., 1999a). The molecular characterization of the CTV field isolates in the top-worked hybrid rootstock candidates using MMM and HMA conducted in this study also showed significant changes in the population structure of CTV genotypes moving from the Hamlin sweet orange interstock (prove d to be mixture of T30, T36 and VT) into the newly grafted top-worked hybrid material. The changes in the CTV genotype composition also suggest differential selection properties of these different root stocks candidates. As mentioned above, based on the MMM and the sequence analysis in the HMA, the hybrid rootstock candidates were divided into 4 groups (I-IV) in Table (5-3) based on the different combination of CTV genotypes that were observed, whereas group V was composed of hybrid rootstock candidates that didnt show any amplification with the MMM, showing no CTV 151

PAGE 152

replication from any of the viral genotypes, and indicating broad resistance to CTV. The resistant hybrids indicated by the MMM analysis were somatic hybrids A+4-3-99-2 and A+5-1-99-3, open-pollinated tetraploid 2247-OP-A2, and pummelo seedlings HBJL-3R10T20, HBJL-5, and 8-1-99-2B. The pummelo seedlings can be used as a leaf parent to develop more somatic hybrids via protoplast fusion system or can be crosse d with other interesti ng varieties to produce diploids. The somatic hybrids: A+ 4-3-99-2, A+5-1-99-3 can be tested for use as direct roostocks (propagated by seeds or by rooted cuttings depending on amenability to seed propagation). These CTV resistant somatic hybrids may also have va lue as tetraploid breeding parents. The open pollinated tetraploid 224-OP-A2 could also be used as a breeding parent. The HMA and the sequence information generate d in this study provide very valuable information about the CTV population diversity. Fu rthermore, this study suggested the distant relationship of the VT isolate found in the field u nder this study and the VT isolate known as the stem pitting (SP) isolate from Israel. This raised the need for determining the complete sequence of the Florida field VT isolate as needed for comparison with the complete genome sequence of the VT isolate from Israel. It is possible that the common Flor ida field VT isolate may be a completely different isolate than the VT isolate from Israel, since no stem pitting symptoms developed in any of the VT infected materials in the current study. This information could be useful regarding current and future re gulatory considerations of SP isolates. None of the used serological or molecular methods provides a reliable estimation of the CTV accumulation, therefore quantification of CTV titer by using reverse transcriptase quantitative real time PCR (qRT-PCR) is important in evaluating the candi date rootstocks for CTV resistance. It is highly sensitive and the most accurate technique to quantify and compare virus infection such as CTV, and to determine the level of resistance/to lerance among the tested 152

PAGE 153

rootstocks. Real Time PCR is rapid, reliable, quantitative, an d a very accurate method. This technique will allow us to not only detect but al so quantify and differentiate the different CTV genotypes in field samples in one single react ion if strain specific primers are used. Based on qRT-PCR results, the test hybrid rootstock candidates including A+HBJL-1, A+4-3-99-2, A+ Chandler #A1, A+5-1-99-3 and 2247-OP-A2, showed zero to very low CTV titer, good growth and no disease symptoms, s uggesting resistance to CTV replication and QD disease. Many hybrids showed intermediate leve ls of CTV titer, but good growth and no disease symptoms in the top-working study. The results obtained from r eal-time PCR for CTV quantification were very helpful in screening the rootstock candidates. The current study has identified a large pool of appare ntly QD resistant hybrid s that have potential to replace sour orange rootstock, if they show adequate nur sery and horticultural performance in ongoing studies. These candidate rootstocks are expected to fruit during th e next year or two. As they fruit, seed will be extracted to determine seediness. Microsatellite analysis will be performed on germinated seedlings to determine if they are of zygotic or nucellar origin, as standard nursery propagation of rootstocks relies on nucellar seedlings for rootstock uniformity. Alternatively, good rootstock candidates producing predominantly zygotic seedlings could be propagated using a rooted cutting method. As mentioned, CTV-re sistant pummelo seedlings producing zygotic seedlings could be used for additional breeding at the diploid level or as fusion parents in somatic hybridization experiments. CTV-resistant tetraploid hybrids produ cing zygotic seedlings should have value in the tetrap loid rootstock breeding program. There are a large number of traits needed to be packaged in order to develop an improved citrus rootstock. Although many of the tested rootstocks allowed fo r CTV replication, many exhibited no apparent disease symptoms, suggesting some level of tolerance to CTV-induced 153

PAGE 154

154 QD. Several years of field testing will be required to determine if yield and fruit quality will be adequate for any of these rootstocks to repla ce sour orange. Many of th e top-worked rootstock selections are growing well and ar e expected to become fruit be aring seed trees in the near future. Overall, this study has significantly advanced the efforts of the CREC variety improvement team regarding the development of a replacement for sour orange rootstock that will possess the good traits of sour orange but with resistance to CTV-induced QD. It is recommended that this approach be continued for screening additional promising diploid and tetraploid pummelo/mandarin hybrids being cr eated by the CREC breeding team. Use of a professional top-working team could improve top-wo rking efficiency. It s hould also be realized that regulatory considerations may hamper future use of this appro ach, as it is illegal to move CTV-infected budwood from one field location to another. Thus, new hybrids to be tested must come directly from certif ied production greenhouses.

PAGE 155

APPENDIX A ELISA BUFFERS AND STARCH SOLUTIONS Table A-1. ELISA buffers Coating buffer (CB) 1 L 2 L 4 L N2CO3 1.59 g 3.18 g 6.36 g NaHC3 2.93 g 5.86 g 11.72 g NaN3 0.20 g 0.40 g 0.80 g pH = 9.6 Phosphate Buffer Saline (PBS)* NaCl 8.00 g 16.00 g 32.00 g KH2PO4 0.20 g 0.40 g 0.80 g Na2HPO4-12H2O (anhydrous) 2.90 g (1.15 g) 5.80 g (2.30 g) 11.60 g (4.60 g) KCl 0.20 g 0.40 g 0.80 g pH = 7.2 to 7.4 Conjugate Buffer: (Prepared Fresh) PBST 1 L 2 L 4 L BSA 2.00 g 4.00 g 8.00 g pH = 7.4 Substrate Buffer (SB): (Prepared Fresh) Diethanolamine 97 mL 194 mL 388 mL pH = 9.8 by HCl Reaction Stopping Solution NaOH 120 g 240 g 480 g *Tween-Phosphate Buffer Saline (TPBS) (Was hing Buffer): 1 L PBS + 0.5 ml Tween-2 Extraction Buffer (EB): 1 L PBST 155

PAGE 156

Table A-2. Starch determination solutions Reagent A 1 L Reagent B 1 L Potassium Sodium Tartrate 12 g Ammonium Molybdate 50 g Na2CO3 Anhydrous 24 g H2SO4 (96%) 42 mL CuSO4.5H2O 4 g Disodium-hydrogen Arse nate Heptahydrate 6 g NaHCO3 16 g Na2SO4 180 g 156

PAGE 157

APPENDIX B WESTERN BLOT ANALYSIS Table B-1. Western blot anal ysis buffers and solutions. Tris Buffered Saline (TBS)* 1 L 4 L 8 L 10 L Tris base 12.11 g 48.44 g 96.88 g 121.1 g NaCl 8.775 g 35.1 g 70.2 g 87.75 g pH = 7.9 Autoclave 5 X Transfer Buffer 1 L 2 L Final for 1X Tris base 15.1 g 30.2 g 24.9 mM Glycine 72.0 g 144.0 g 191.8 mM 5 X Running Buffer 1 L Glycine 72 g Tris base 15 g 10% SDS 50 mL Loading Dye 2X 1 mL 4X 1 mL Final Tris-HCl pH 6.8 125 L 250 L 62.5 mM Glycerol 200 L 400 L 10% SDS 200 L of 20% 20 mg 2% 5% -ME 100 L 200 L 0.5% Bromophenol blue 2 mg 4 mg 0.1% H2O To 1 mL To 1 mL *Tween-Tris Buffered Saline (TTBS): 1 L TBS + 1 ml Tween-20 157

PAGE 158

158 APPENDIX C PCR REACTION MIX AND PROGRAM PCR reaction mixture Reagents Volume GoTaq Green Master Mix 2X 12.5 L 5 M F primer 1.5 L 5 M R primer 1.5 L DNA template (100 ng/L) 2.5 L Nuclease-Free Water 7.0 L Total 25.0 L PCR program Step 1 2 minute at 94 C Denaturation Step 2 30 second at 94 C Denaturation Step 3 30 second at 56 C Annealing Step 4 45seconds at 72 C Elongation Step 5 Repeat steps 2-4 30 times Step 6 10 minute at 72 C Elongation Step 7 4 C forever Step 8 End

PAGE 159

APPENDIX D QUANTITATIVE REAL TIME-PCR Table D-1. Primers pairs used for quantitative real-time PCR assay. N ame Orientatio n Se q uence ( 5 -3 ) Len g th Position Forward p rimer TGCCGAGTCTTCTTTCA 16 69 Reverse primer TGTTCAAAGCAGCGTTC 16 172 Table D-2. Real-time PCR reaction Number of reactions 1 X ( L ) 50X SYBR GREEN PCR Master Mix ( 2X ) 12.5 625 Multiscribe (50u/ul) 0.125 6.25 RNase inhibito r ( 20U/Ul) 0.5 25 F primer (5 mM) 1.5 75 R primer (5 mM) 1.5 75 Free Nuclease Wate r 7.875 318.75 RNA 1 125 Total 25 1250 159

PAGE 160

LIST OF REFERENCES Agranovsky, A.A., Lesemann, D.E., Maiss, E., Hull, R., and Atabekov, J.G. (1995). 'Rattlesnake' structure of a filamentous plant RNA virus built of two capsid proteins. Proceedings of the National Academy of Sciences-USA 92, 2470-2473. Al-Senan, A., Bonsi, C.K., and Basiouny, F.M. (1997). Indexing of citrus tristeza virus using serological and biological tests. Proceedi ng of Florida State Horticultural Society 110, 7779. Albiach-Marti, M., Gross er, J.W., Hilf, M.E., Gowda, S. M., M. Satyanarayana, T., Garnsey, S.M., and Dawson, W.O. (1999). Citrus tristeza virus (CTV) resistant plants are not immune at the cellu lar level. In The18th Annual Meeting of the American Society for Virology (University of Massac husetts, Amherst, Mass), pp. 192. Albiach-Marti, M.R., Guerri, J., de Mendoza, A.H., Laigret, F., Ballester-Olmos, J.F., and Moreno, P. (2000). Aphid transmission alters the genomic and defective RNA populations of citrus tristeza virus isolates. Phytopathology 90, 134-138. Ananthakrishnan, G., Calovic, M., Serrano, P., and Grosser, J.W. (2006). Production of additional allotetraploid somatic hybrids comb ining mandarins and sw eet orange with preselected pummelos as potential candidates to replace sour orange rootstock. In Vitro Cellular & Developmental Biology-Plant 42, 367-371. Annual Report. (2003). Bureau of Citrus Budwood Re gistration (Winter Haven, Florida). Annual Report. (2007). Bureau of Citrus Budwood Re gistration (Winter Haven, Florida). Audy, P., Palukaitis, P., Sl ack, S.A., and Zaitlin, M. (1994). Replicase-mediated resistance to potato virus Y in transgenic tobacco plan ts. Molecular Plant-Mi crobe Interactions 7, 15-22. Ayllon, M.A., Rubio, L., Moya, A., Guerri, J., and Moreno, P. (1999a). The haplotype distribution of two genes of citrus tristeza virus i s altered after host change or aphid transmission. Virology 255, 32-39. Ayllon, M.A., Lopez, C., Navas-Castillo, J., Garnsey, S.M., Guerri, J., Flores, R., and Moreno, P. (2001). Polymorphism of the 5' terminal region of citrus tristeza virus (CTV) RNA: incidence of three sequen ce types in isolates of differe nt origin and pathogenicity. Archives of Virology 146, 27-40. Ayllon, M.A., Lopez, C., Navas-Castillo, J., Mawassi, M., Dawson, W.O., Guerri, J., Flores, R., and Moreno, P. (1999b). New defective RNAs from citrus tristeza virus: evidence for a replicase-driven template switching mechanis m in their generation. Journal of General Virology 80, 817-821. Bar-Joseph, M., and Lee, R.F. (1989). Citrus tristeza virus In Description of Plant Viruses (Kew, Surrey, UK: Commonwealth Mycological Institute/Association of Applied Biology. 160

PAGE 161

Bar-Joseph, M., Loebenstein, G., and Cohen, J. (1972). Partial purifi cation of virus-like particles associated with citrus tristeza virus. Phytopathology 60, 75-78. Bar-Joseph, M., Raccha, B., and Loebenstein, G. (1977). Evaluation of main variables that affect citrus tristeza virus transmission by aphids. In Proceedings of the International Society of Citriculture, pp. 958-961. Bar-Joseph, M., Garnsey, S.M., and Gonsalves, D. (1979a). The closteroviruses: a distinct group of elongated plant viruses. Advances in Virus Research 25, 93-168. Bar-Joseph, M., Marcus, R., and Lee, R.F. (1989). The continuous challenge of citrus tristeza virus control. Annual Review of Phytopathology 27, 291-316. Bar-Joseph, M., Garnsey, S.M., Gonsalves, D., Moscovitz, M., Purcifull, D.E., Clark, M.F., and Loebenstein, G. (1979b). The use of enzym-linked immunosorbent assay for detection of citrus tristeza. Phytopathology 69, 190-194. Bar-Joseph, M., Che, X., Mawassi, M., Gowda, S., Satyanarayana, T., Ayllon, M.A., Albiach, M., Garnsey, S.M., and Dawson, W.O. (2002). The continuous challenge of citrus tristeza virus molecular reseach. In Proceedings of the 15th Conference of the International Organization of Citrus Virologists (IOCV) (Riverside, CA), pp. 1-7. Batuman, O., Mawassi, M., and Bar-Joseph, M. (2006). Transgenes consisting of a dsRNA of an RNAi suppressor plus the 3 UTR provide resistance to citrus tristeza virus sequences in Nicotiana benthamiana but not in citrus. Virus Genes 33, 319-327. Bauer, M., Castle, W.S., Boman, B.J., and Obreza, T.A. (2005). Economic longevity of citrus trees on swingle citromelo rootst ock and their suitbility for so ils in the Indian River region. Proceeding of Florida State Horticultural Society 118, 24-27. Beachy, R.N. (1994). Mechanisms and applications of pa thogen-derived resistance in transgenic plants. Current Opinion in Biotechnology 8, 215-220. Berry, S., and C., R.M.E. (2001). Differentiation of cassava -infecting begomoviruses using heteroduplex mobility assays. Journal of Virological Methods 92, 151-163. Biswas, K.K., Manjunath, K.L., Marais, L.J., and Lee, R.F. (2004). Single aphids transmit multiple genotypes of citrus tristeza virus, but often with changed population dynamics. Phytopathology 94:S8 Blackman, R.L., and Eastop, V.F. (1984). Aphids on world crops. (John Wiley & Sons Chichester, United Kingdom). Blazek, J. (2002). Prediction of profitability of t opworking in older apple orchards under contemporary economic conditions of the Czech Republic. Horticultural Science 29, 85-91. 161

PAGE 162

Boonham, N., Smith, P., Walsh, K., Tame, J., Morris, J., Spence, N., Bennison, J., and Barker, I. (2002). The detection of tomato spotted wilt virus (TSWV) in individual thrips using real-time fluorescent RT-PCR (TaqMan). Journal of Virological Methods 101, 37-48. Bove, J.M., and Ayres, A.J. (2007). Etiology of three recent di seases of citrus in Sao Paulo State: Sudden death, variegated ch lorosis and huanglongbing. Lubmb Life 59, 346-354. Bowman, K.D. (2000). New hybrid citrus developed by U. S. Department of Agriculture. In 9th International Citrus Congre ss (Orlando, Florida), pp. 51. Bowman, K.D. (2007). Raising Rootstocks : USDA res earchers are working hard to develop new disease-resistanct rootstocks. Florida Grower. Bowman, K.D., and Roman, M.F. (1999). New rootstocks for orange and mandarin. Proceeding of Caribbean Food Crops Society 35, 119-130. Bowman, K.D., and Garnsey, S.M. (2001). A comparison of five sour orange rootstocks and their response to citrus tristeza virus Proceeding of Florida State Horticultural Society 114, 73-77. Bowman, K.D., and Rouse, R.E. (2006). US-812 citrus rootstock. HortScience 41, 832-836. Bowman, K.D., Albano, J.P., and Graham, J.H. (2002). Greenhouse testing of rootstocks for resistance to Phytophthora species in flatwoods soil. Proceeding of Florida State Horticultural Society 115, 10-13. Bradford, M.M. (1979). A rapid and sensitive met hod for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248-254. Bramlett, D.L., and Burris, L.C. (1995). Topworking young scions into reproductively-mature Loblolly pine. In 23rd Southern Forestry Tree Improvement Conference (Event Asheville, NC), pp. 234-241. Brlansky, R.H. (1987). Inclusion bodies produced in citrus by citrus tristeza virus. Phytophylactica 19, 211-213. Brlansky, R.H., and Lee, R.F. (1990). Numbers of inclusion bodies produced by mild and severe strains of citrus tristeza virus in seven citrus hosts. Plant Disease 74, 297-299. Brlansky, R.H., Lee, R.F., and Garnsey, S.M. (1988). In situ immunofluorescence for the detection of citrus tristeza inclusion bodies. Plant Disease 72, 1039-1041. Brlansky, R.H., Garnsey, S.M., Lee, R.F., and Purcifull, D.E. (1984). Application of citrus tristeza virus antisera for use in labele d antibody, immuno-electron microscopical, sodium dodecyl sulphate immunodiffusion te sts. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists (IOCV), S.M. Garnsey, L.V. Timmer, and J.A. Dodds, eds (Riverside, CA), pp. 342-345. 162

PAGE 163

Brlansky, R.H., Howd, D.S., Broad bent, P., and Damsteegt, V.D. (2002). Histology of sweet orange stem pitting caused by Australian isolate of citrus tristeza virus Plant Disease 86, 1169-1174. Brlansky, R.H., Damsteegt, V.D., Roy, A., and Howd, D.S. (2003). Molecular analyses of citrus tristeza virus subisolates seperated by aphid transmissions. Plant Disease 87, 397-401. Brlansky, R.H., Hilf, M.E., Sieburth, P.J., Dawson, W.O., Roberts, P.D., and Timmer, L.W. (2008). 2008 Florida citrus pest management guide: tristeza1 (Gainesville FL: University of Florida, IFAS). Broadbent, P., Brlansky, R.H., and Indsto, J. (1996). Biological charac terization of Australian isolates of citrus tristeza virus and separation of subisolates by single aphid transmissions. Plant Disease 80, 329-333. Broadbent, P., Dephoff, C.M., Franks, N., Gillings, M., and Industo, J. (1995). Preimmunization of grapefruit with a mild protective isolate of Citrus tristeza in Australia. In Proceedings of the 3rd International Workshop on Citrus tristeza virus and Brown citrus aphid in Central America and the Caribbean, R. L. Lee, M. Rocha-Pea, C.L. Niblett, F. Ochoa, S.M. Garnsey, R.K. Yokomi, and R. Lastra, eds (FAO-USDA-OICD-University of Florida, Lake Alfred, Florida), pp. 163-168. Brown, M.G., and Spreen, T.H. (2000). An economic assessment of the impact of the citrus tristeza virus on the Florida grapefruit industry. Pro ceeding of Florida State Horticultural Society 113, 79-82. Brunt, A., Crabtree, K., and Gibbs, A. (1990). Viruses of tropical plants. (Wallingford, Oxon, UK: CAB International). Brunt, A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.J., Watson, L., and Zurcher, E.J. (1996). Plant viruses online: descriptions and lists from the VIDE database.Version: 20th August 1996. Button, J. (1975). The topworking of citrus trees. Citrus and Subtropical Fruit Journal 5-8. Cai, S.P., Eng, B., Kan, Y.W., and Chui, D.H.K. (1991). A rapid and si mple electrophoretic method for detection of mutations involving sma ll insertions and deletions: applications to -thalassemia. Human Genetics 87, 720-728. Cambra, M., Serra, J., Vilalba, D., and Moreno, P. (1988 ). Present situation of citrus tristeza virus in the Valencian commun ity. In Proceedings of the 10th Conference of the International Organization of Citrus Virologi sts (IOCV), L.V. Timmer, S.M. Garnsey, and L. Nararro, eds (Riverside, CA), pp. 1-7. Cambra, M., Camarasa, E., Gorris, M.T., Garnsey, S.M., and Carbonell, E. (1991). Comparison of different immunosorbent assays for citrus tristeza virus (CTV). In Proceedings of the 11th Conference of the International Or ganization of Citrus Virologists (IOCV), R.H. Brlansky, R.F. Lee, and L.V. Timmer, eds (Riverside, CA), pp. 38-45. 163

PAGE 164

Cambra, M., Gorris, M.T., Olmos, A., Martinez, M.C., Roman, M.P., Bertolini, E., Lopez, A., and Carbonell, E.A. (2002). European diagnostic protocols (DIAGPRO) for citrus tristeza virus in adult trees. In Proceedings of the 15th Conference of the International Organization of Citrus Virologist s (IOCV) (Riverside, CA), pp. 69-78. Cambra, M., Olmos, A., Gorris, M.T., Marroqu n, C., Esteban, O., Garnsey, S.M., Llauger, R., Batista, L., Pena, I., and Hermoso de Mendoza, A. (2000). Detection of citrus tristeza virus by print capture and squa sh capture-PCR in plant ti ssue and single aphids. In Proceedings of the 14th Conference of the International Or ganization of Citrus Virologists (IOCV), J.V. da Graca, R.F. Lee, and R.K. Yokomi, eds (Riverside, CA), pp. 42-49. Castle, B., and Stover, E. (2001). Update on use of Swingle ci trumelo rootstock. In University of Florida, Extention: Fact Sheet (Gai nesville, FL: University of Florida). Castle, W.S. (1987). Citrus rootstocks. In Rootstocks for Fruit Crops, R.C. Rom and R. Carlson, eds (Wiley J and Sons, New York. Castle, W.S., and Tucker, D.P.A. (1998). Florida citrus root stocks selection guide. In University of Florida Corporation Extension (Gainesville, FL: University of Florida). Castle, W.S., Tucker, D.P.H., Krezdorn, A.H., and Youtsey, C.O. (1993). Rootstocks for Florida citrus. (Gainesville, FL: University of Florida, IFAS). Castle, W.S., Bowman, K.D., Grham, J.H., and Tucker, D.P.H. (2006). Forida citrus rootstock selection guide U.o. Florida, ed (Lak e Alfred, FL: University of Florida, IFAS, CREC). Cevik, B. (1995). Molecular differentiation of strains of citrus tristeza virus using the coat protein gene sequences. In Department of Plant Pathology (Gainesv ille: University of Florida.), pp. 112. Cevik, B. (2001). Characterization of the RNA-depe ndent RNA polymerase gene of citrus tristeza closterovirus (Gainesville, FL: University of Florida). Cevik, B., Pappu, S.S., Pappu, H.R., Benscher, D., Irey, M., Lee, R.F., and Niblett, C.L. (1996a). Application of bi-directional PCR to citrus tristeza virus : detection and strain differentiation. In Proceedings of the 13th Conference of the Intern ational Organization of Citrus Virologists (IOCV), J. V. da Graca, P. Moreno, and R.K. Yokomi, eds (Riverside, CA), pp. 17-24. Cevik, B., Pappu, S.S., Pappu, H.R., Tight, D., Benscher, D., Futch, S.H., Rucks, P., Lee, R.F., and Niblett, C.L. (1996b). Molecular cloning and sequen cing of coat protein genes of citrus tristeza virus isolates from Meyer lemon and Ho mely tangor trees in Florida. In Proceedings of the 13th Conference of the International Or ganization of Citrus Virologists (IOCV) (Riverside, CA), pp. 47. 164

PAGE 165

Che, X., Piestun, D., Mawassi, M., Yang, G., Satyanarayana, T., Gowda, S., Dawson, W.O., and Bar-Joseph, M. (2001). 5' Coterminal subgenomic RNAs in citrus tristeza virus infected cells. Virology 283, 374-381. Chen, C., Grosser, J.W., Calovic, M., Serrano, P., Pasquali, G., Gmitter, J., and Gmitter, F.G. (2008). Verification of Mandarin and Pummelo Somatic Hybrids by Expressed Sequence TagSimple Sequence Repeat Marker An alysis. Journal of the American Society for Horticultural Science 133, 794. Clark, M.F., Lister, R. M., and Bar-Joseph, M. (1988). ELISA techniques. In Methods for Plant Molecular Biology, A.a.W. Weissb ach, H, ed (San Diago, CA), pp. 507-530. Costa, A.S., and Grant, T.J. (1951). Studies on the transmission of the tristeza virus by the vector Aphid citricidus. Phytopathology 41, 105-122. d'Urso, F., Ayllon, M.A., Rubio, L., Sambad e, A., de Mendoza, A.H., Guerri, J., Moreno, P., and Moreno, P. (2000). Contribution of uneven distri bution of genomic RNA variants of citrus tristeza virus (CTV) within the plan t to changes in the vi ral population following aphid transmission. Plant Pathology 49, 288-294. Da Graca, J.V., Marais, L.J., and Von Broembsen, L.A. (1984). Severe tristeza stem pitting decline of young grape fruits in Sout h Africa. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists (IOCV), S.M. Garnsey, L.V. Timmer, and J.A. Dodds, eds (Riverside, CA), pp. 62-65. Davies, F.S., and Albrigo, L.G. (1994). Citrus. (Wallingford: CAB International). Davino, S., Davino, M., Sambade, A., Guardo, M., and Caruso, A. (2003). The first citrus tristeza virus outbreak found in a relevant citrus producing area of Sicily, Italy. Plant Disease 87, 314. Delwart, L.E., Shpaer, G.E., Louwagie, J., McCutchan, E.F., Grez, M., RubsamenWaigmann, H., and Millins, J.I. (1993). Genetic relationships determined by a DNA heteroduplex mobility assay: Analysis of HIV-1 env genes. Science 262, 1257-1261. Deng, Z., S., H., S., X., and Gmitter, F.G. (1996). Development and characterization of scar markers linked to the citrus tristeza virus resistance gene from Poncirus trifoliata Genome 40, 697-704. Deng, Z., Huang, S., Ling, P., Chen, C., Yu, C ., Weber, C.A., Moore, G.A., and Gmitter, F.G. (2000). Cloning and characterization of NB S-LRR class resistance-gene candidate sequences in citrus. Theore tical and Applied Genetics 101, 814-822. Deng, Z., Tao, Q., Chang, Y.L., Huang, S., Ling, P., Yu, C., Chen, C., Gmitter, F.G., and Zhang, H.B. (2001a). Construction of a bacterial artific ial chromosome (BAC) library for citrus and identification of BA C contigs containing resistance gene candidates. Theoretical and Applied Genetics 102, 1177-1184. 165

PAGE 166

Deng, Z., Huang, S., Ling, P., Yu, C., Tao, Q ., Chen, C., Wendell, M.K., Zhang, H.B., and Gmitter, F.G. (2001b). Fine genetic mapping and BAC contig development for the citrus tristeza virus resistance gene locus in Poncirus trifoliata (Raf.). Molecular Genetics and Genomics 265, 739-747. Dolja, V.V., Karasev, A.V., and Koonin, E.V. (1994). Molecular biology and evaluation of closteroviruses: sophisticated build-up of large RNA ge nomes. Annual Review of Phytopathology 32, 261-285. Dominguez, A., Hermoso de Mendoza, A., Guerri, J., Cambra, M., Navarro, L., Moreno, P., and Pena, L. (2002). Pathogen derived resistance to citrus tristeza virus (CTV) in transgenic Mexican lime ( Citrus aurantifolia (Christ.) Swing.) plants expressing its p25 coat protein gene. Molecular Breeding 10, 1-10. Domnguez, A., Guerri, J., Cambra, M., Navarro, L., Moreno, P., and Pea, L. (2000). Efficient production of transgenic citrus pl ants expressing the co at protein gene of citrus tristeza virus. Plant Cell Reports 19, 427-433. Esau, K. (1960). Cytological and histological symptoms of beet yellows. Virology 10, 73-85. Fabre, F., Kervarrec, C., Mieuzet, L., Riault, G., Vialatte, A., and Jacquot, E. (2003). Improvement of barley yellow dwarf virusPAV detection in si ngle aphids using a fluorescent real-time RT-PCR. J ournal of Virological Methods 110, 51-60. Fagoaga, C., Lopez, C., Moreno, P., Nava rro, L., Flores, R., and Pena, L. (2005). Viral-like symptoms induced by the ectopic expression of the p23 gene of citrus tristeza virus are citrus specific and do not corr elate with the pathogenicity of the virus strain. Molecular Plant-Microbe Interactions 18, 435-445. Fallahi, E., Moon, J., J. W., and Ross, D.R. (1989). Yield and quality of 'Redblush' grapefruit on twelve rootstocks. Journa l of the American Society for Horticultural Science 114, 187190. Fang, D.Q., Federici, C.T., and Roose, M.L. (1998). A high-resolution linkage map of the citrus tristeza virus resistance gene region in Poncirus trifoliata (L.) Raf. Genetics 150, 883890. FAOSTAT. (2007). FAOSTAT Database on Agriculture : Citrus Production (Rome, Italy: Food and Agriculture Organization of the United Nations). Fawcett, H.S., and Wallace, J.M. (1946). Evidence of th e virus nature of c itrus quick decline. California Citrograph 32, 88-89. Febres V.J., Lee, R.F., and Moore, G.A. (2008). Transgenic resistan ce to Citrus tristeza virus in grapefruit. Plant Cell Rep 27, 93. 166

PAGE 167

Febres, V.J., Niblett, C.L., Lee, R.F., and Moore, G.A. (2003). Characteriza tion of grapefruit plants ( Citrus paradisi Macf. ) transformed with Citrus tr isteza closterovirus genes. Plant Cell Reports 21, 421-428. Febres, V.J., Pappu, H.R., Anderson, E.J., Pappu, S.S., Lee, R.F., and Niblett, C.L. (1994). The diverged copy of the citrus tristeza virus coat protein is expr essed in vivo. Virology 201, 178-181. Febres, V.J., Ashoulin, L., Mawassi, M., Frank, A., Bar-Joseph, M., Manjunath, K.L., Lee, R.F., and Niblett, C.L. (1996). The p27 protein is present at one end of citrus tristeza virus particles. Phytopathology 86, 1331-1335. Fraser, L.R. (1952). Seedling yellows, an unreported virus disease of citrus. Agricultural Gazette of New South Wales 63, 125-131. Freeman, W.M., Walker, S.J., and Vrana, S.J. (1999). Quantitative RT-PCR: Pitfalls and potential. Biotechniques 26, 112-1125. Fuchs, M., and Gonsalves, D. (1997). Environmentally safe approaches to crop disease control In Genetic Engineering (CRC Press), pp. 333-368 Fulton, R.W. (1986). Practices and precautions in the use of cross protec tion for plant virus disease control. Annual Review of Phytopathology 67, 965-968. Futch, S.H., and Brlansky, R.H. (2008). Field diagnosis of citrus tristeza virus 1 (Gainesville, FL: University of Florida, IFAS). Garnsey, S.M. (1990). Seedling yellows isolates of citrus tristeza virus in commercial citrus in Florida. Proceeding of Florid a State Horticultural Society 103, 83-87. Garnsey, S.M., and Young, R.H. (1975). Water flow rates and st arch reserves in roots from citrus trees affected by blight and tristeza. Proceeding of Flor ida State Horticultural Society 4, 79-84. Garnsey, S.M., and Lee, R.F. (1988). Tristeza. In Compendium of Citrus Diseases, J.O. Whiteside, S.M. Garnsey, and L.W. Timm er, eds (APS Press, St. Paul), pp. 48-50. Garnsey, S.M., and Cambra, M. (1991). Enzyme-Linked immunosorbent assay (ELISA) for cirrus pathogens. In Graft-Transmissible Di seases of Citrus: Handbook for Detection and Diagnosis, C.N. Roistacher, ed, pp. 193-216. Garnsey, S.M., Gonsalves, D., and purcifull, D.E. (1979). Rapid diagnosis of citrus tristeza virus infections by sodium dodecyl sulfate immunodiffusion procedures. Phytopathology 69, 88-95. 167

PAGE 168

Garnsey, S.M., Christie, R.G., and Derrick, K.S. (1980). Detection of citrus tristeza virus II. Light and electron microscopy of inclusions a nd virus particles. In Proceedings of the 8th Conference of the Internationa l Organization of Citrus Viro logists (IOCV), E.C. Calavan, S.M. Garnsey, and L.W. Timmer, eds (Riverside, CA), pp. 9-16. Garnsey, S.M., Barrett, H. C., and Hutchison, D.J. (1987a). Identification of citrus tristeza virus resistance in citrus relatives and potential applications. Phytophylactica 19, 187-191. Garnsey, S.M., Su, H., and Tsai, M. (1997). Differential suscep tibility of pummelo and Swingle citrumelo to isolates of citrus tristeza virus In Proceedings of the 3rd Conference of the International Organization of Citrus Virolo gists (IOCV), J. Da Graca, P. Moreno, and R. Yokomi, eds (Riverside, CA), pp. 38-146. Garnsey, S.M., Permar, T.A., Cambra, M., and Henderson, C.T. (1993). Direct tissue blot Immunoassay (DTBIA) for detection of citrus tristeza virus (CTV). In Proceedings of the 12th Conference of the Internati onal Organization of Citrus Virologists (IOCV) (Riverside, CA), pp. 39-50. Garnsey, S.M., Gumpf, D.J., Roistacher, C.N., Ci verolo, E.L., Lee, R.F., Yokomi, R.K., and Bar-Joseph, M. (1987b). Toward a standard evaluati on of the biologically properties of c itrus tristeza virus Phytophylactica 19, 151-157. Ghorbel, R., Domnguez, A., Navarro, L., and Pea, L. (2000). High efficiency genetic transformation of sour orange (Citrus aura ntium) and production of transgenic trees containing the coat protein gene of citrus tristeza virus Tree Physiology 20, 1183-1189. Ghorbel, R., Lpez, C., Fagoaga, C., Moreno, P., Navarro, L., Flores, R., and Pea, L. (2001). Transgenic citrus plants expressing the citrus tristeza virus p23 protein exhibit virallike symptoms. Molecular Plant Pathology 2, 27-36. Gibson, U.E., Heid, C.A., and Williams, P.M. (1996). A novel method for real time quantitative RT-PCR Genome Research 6 995-1001. Gillings, M., Broadbent, P., Indsto, J., and Lee, R.F. (1993). Characterisation of isolates and strains of citrus tristeza closte rovirus using restriction analys is of the coat protein gene amplified by the polymerase chain reac tion. Journal of Vi rological Methods 44, 305-317. Ginzinger, D.G. (2002). Gene quantification using real -time quantitative PCR: An emerging technology hits the mainstream. Experimental Hematology 30, 503-512. Gmitter, F.G., Lee R.F., powell, A.C., and Hu, X.L. (1992). Rootstocks similar to sour orange for Florida citrus trees. Proceedi ng of Florida State Horticultural Society 105, 56-60. Gmitter, F.G., Xiao, S.Y., Huang, S., Hu, X.L., Garnsey, S.M., and Deng, Z. (1996). A localized linkage map of the citrus tristeza virus resistance gene region. Theoretical and Applied Genetics 92, 688-695. 168

PAGE 169

Gonsalves, D., purcifull, D.E., and Garnsey, S.M. (1978). Purification and serology of citrus tristese virus. Phytopathology 68, 553-559. Gowda, S., Satyanarayana, T., Davis, C.L., N avas-Castillo, J., Albiach-Mart, M., Mawassi, M., Valkov, N., Bar-Joseph, M., Moreno, P., and Dawson, W.O. (2000). The p20 gene product of citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology 274, 246-254. Grant, T.J. (1952). Evidence of tristeza, or quick dec line, virus in Florida. Proceeding of Florida State Horticultural Society 65, 28-31. Grant, T.J., Costa, A.S., Moreira, S., and ( 1951). Tristeza disease of citrus in Brazil-other citrus disease may be variation of more spect acular tristeza or quick decline. Citrus Leave 31, 36-37. Grosser, J.W., and Gmitter, F.G. (1990). Protoplast fusion a nd citrus improvement Plant Breeding Reviews 8, 339-374. Grosser, J.W., and Chandler, J.L. (2000). Somatic hybridization of high yield, cold hardy and disease resistanct parents for citrus rootstoc k improvement. Journal of Horticultural Science & Biotechnology 75, 641-644. Grosser, J.W., and Chandler, J.l. (2002). Somatic hybridizati on for citrus rootstock improvement. In Proceedings of the 7th International Citrus Seminar (Estacao Experimental De Citricultura De Bebedouro, SP, Brazil). Grosser, J.W., Gmitter, F.G., and Castle, W.S. (1995). Production and evaluation of citrus somatic hybrid rootstocks: Progress report. In Proceeding of Florida State Horticultural Society, pp. 140-143. Grosser, J.W., Garnsey, S.M., and Halliday, C. (1996). Assay of sour orange somatic hybrid rootstocks for quick decline disease caused by citrus tristeza virus In Proceedings of the International Society of Citriculture, pp. 353-356. Grosser, J.W., Ollitrault, P., and Olivares-Fuster, O. (2000). Somatic hybrid ization in citrus: An effective tool to facilitate variety im provement. In Vitro Cellular & Developmental Biology-Plant 36, 434-449. Grosser, J.W., Chandler, J.L., and Duncan, L.W. (2007a). Production of mandarin + pummelo somatic hybrid citrus rootstocks with potential for improved tolerence/ resistance to sting nematode. Scientia Horticulturae 113. Grosser, J.W., Chen, C., and Gmitter, F.G. (2007b). Microsatellite genotyping of seedlings from somatic hybrid and 'Tetrazygy' citrus ro otstock candidates to determine maternal or zygotic origin. Hortscience 42, 904. 169

PAGE 170

Grosser, J.W., Louzada, E.S., Gmi tter, F.G., and Chandler, J.L. (1994). Somatic hybridization of complimentary citrus rootstocks: Five new hybrids. HortScience 29, 812813. Grosser, J.W., Medina-Urrutia, V., Govindarajulu, A., and Serrano, P. (2004a). Building a Replacement Sour Orange Rootstock: Somatic Hybridization of Selected Mandarin + Pummelo Combination. Journal of the Amer ican Society for Ho rticultural Science 129, 530534. Grosser, J.W., Medina-Urrutia, V., Ananthakrishnan, G., and Serrano, P. (2004b). Building a replacement sour orange rootstock: Somatic hybridization of selected mandarin plus pummelo combinations. Journal of the Amer ican Society for Horticultural Science 129, 530534. Grosser, J.W., Jiang, J., Louzada, E.S., Chandler, J.L., and GmittterJr, F.G. (1998). Somatic hybridization an integral component of citrus cultiv ar improvement: II. Rootstock improvement. HortScience 33, 1060-1061. Grosser, J.W., Graham, J.H., McCoy, C.W., Hoyt e, A., Rubio, H.M., Bright, D.B., and Chandler, J.L. (2003). Development of Tetrazyg rootstocks tolerant of the diaprepes/phytophthora complex under greenhouse conditions. Proceeding of Florida State Horticultural Society 116, 262-267. Gutirrez, E.M.A., Luth, D., and Moore, G.A. (1997). Factors affecting the agrobacterium mediated transformation in citrus and production of sour orange ( Citrus aurantium L.) plants expressing the coat protein gene of citrus tristeza virus Plant Cell Reports 16, 745-753. Halbert, S.E., Gene, H., Cevic, B., Brow n, L.G., Rosales, I.M., Manjunath, K.L., Pomerinke, M., Davison, D.A., Lee, R.F., and Niblett, C.L. (2004). Distribution and characterization of citrus tristeza virus in South Florida following establishment of Toxoptera citricida Plant Disease 88, 935 Halbert, S.E.H., and Brown, L. (1996). Toxoptera citricidae (K irkaldy), Brown citrus aphididentification, biology and manage ment stratigies. In Florida Deptartment of Agriculture and Consumer Servce, Entomology, pp. 6. Heid, C.A., Stevens, J., Livak, K.J., and Williams, P.M. (1996). Real time quantitative PCR Genome Research 6, 986-994. Hermosa de Mendoza, A., Ballester-Olmos, J.F., and Pina-Lorca, J.A. (1984). Transmission of citrus tristeza virus by aphids ( Homoptera, Aphididae ) in spain. In Proceedings of the 9th Conference of the International Organization of Citrus Virol ogists (IOCV) (Riverside, CA), pp. 68-70. Herron, C.M. (2003). Citrus tristeza virus : Characterization of texas isolates, studies on aphid transmission and pathologen-derived control strategies (Texas: Texas A&M University). 170

PAGE 171

Herron, C.M., Yang, Z.N., Molina, J.J., da Graa, J.V., van Vuuren, J.P., and Mirkov, T.E. (2002). Assessments of Rio Re d grapefruit scions with a citrus tristeza virus untranslatable coat protein transgene for resist ance to the virus. Phytopathology 92, S36. Hilf, M.E., and Garnsey, S.M. (2000). Characterization and classification of citrus tristeza virus isolates by amplification of multiple molecular markers. In Proceedings of the 14th Conference of the International Organization of Citrus Virol ogists (IOCV), J.V. da Graca, R.F. Lee, and R.K. Yokomi, eds (Riverside, CA), pp. 18-27. Hilf, M.E., and Garnsey, S.M. (2002). Citrus tristeza virus in Florida: A synthesis of historical and contemporary biological, serological a nd genetic data. In Proceedings of the 15th Conference of the International Organization of Citrus Virol ogists (IOCV) (Riverside, CA), pp. 13-20. Hilf, M.E., Karasev, A.V., Pappu, H.R., Gump f, D.J., Niblett, C.L., and Garnsey, S.M. (1995). Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208, 576-582. Hilf, M.E., Karasev, A., Maria, R., Albi ach, M., Dawson, W.O., and Garnsey, S.M. (1999). Two paths of seuence divergence in the citrus tristeza virus complex. Phytopathology 89, 336-342. Hong, L.T., and Truc, N.T.N. (2003). Iodine reac tion quick detection of huanglongbing disease In Proceedings of the 2003 Annual Work shop of JIRCAS Mekong Delta Project. Huang, Z., Rundell, A.P., Guan, X., and Powell, A.C. (2004). Detection and isolate differentiation of citrus tristeza virus in infected field trees based on reverse transcriptionpolymerase chain reaction. Plant Disease 88, 625-629. Hubert, G.M., and Niesters. (2001). Quantitation of Viral Load Using Real Time Amplification techniques. Methods 25, 419-429. Hutchson, D.J. (1985). Rootstock development screening and selection for disease tolerance and horticulture characteristics. Fruit Varieties Journal 39, 1-25. Iglesias, N.G., Marengo, J., Reiquelme, K ., Costa, N., Plata, M.I., and Semorile, L. (2005). Characterization of the population stru cture of a grapefruit isolate of citrus tristeza virus (CTV) selected for pre-immunization assays in Argentina. In Proceedings of the 16th Conference of the International Organization of Citrus Virol ogists (IOCV), M.E. Hilf, N. Duran-Vila, and M.A. Rocha-Pea, eds (Riverside, CA), pp. 150-158. Karasev, A.V. (2000). Genetic diversity, and evolution of closteroviruses. Annual Review of Phytopathology 38, 293-324. Karasev, A.V., Boyko, V.P., Gowda, S., Nikolae va, O.V., Hilf, M.E., Koonin, E.V., Niblett, C.L., Cline, K., Gumpf, D.J., and Lee, R.F. (1995). Complete sequence of the citrus tristeza virus RNA genome. Virology 208, 511-520. 171

PAGE 172

Kitajima, E.W., Silva, D.M., Oliveira, A. R., Muller, G.W., and Costa, A.S. (1994). Threadlike particles associated with tristeza disease of citrus. Nature 201, 1011-1012. Klotz, L.J. (1978). Fungal, bacterial and non-parasitic diseases and injuries in the seed bed nursery and orchard. In The Citrus Industry, E. C. Calavan and G.E. Carman, eds (Berkeley, CA: University of California Press. Koonin, E.V., and Dolija, V.V. (1993). Evolution and taxonomy of positive-strand RNAviruses: implications of comparative an alysis of amino acid sequences. Crit. Rev. Biochem. Molecular Biology 28, 375-430. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lee, R.F., and Rocha-Pena, M.A. (1992). Citrus tristeza virus. In Plant Disease of International Importance Disease of Fruit Crops, J. Ku mar, H.S. Chaube, U.S. Singh, and A.N. Mukhopadhya, eds (NJ: Prentice Hall Englewood Cliffs ), pp. 226-249. Lee, R.F., Baker, P.S., and Rocha-Pea, M.A. (1994). The citrus tristeza virus (CTV): an introduction to current priorities, with special reference to the worsening situation in Central America and the Caribbean. (Ascot, Berks. UK: International Institute of Biological Control). Lee R.F., Dekkers, M.G.H., and Bar-Joseph, M. (2005). Development of stable, uniform antigen controls for use in ELISA for citrus tristeza virus. In Proceedings of the 16th Conference of the International Organization of Citrus Virol ogists (IOCV), M.E. Hilf, N. Duran-Vila, and M.A. Rocha-Pea, eds (Riverside, CA), pp. 127-136. Lee, R.F., Garnsey, S.M., Brlansky, R.H., and Goheen, A.C. (1987). A purification procedure for the enhancement of citrus tristeza virus yields and its applica tion to other phloem-limited viruses. Phytopathology 77 543-549. Lee, R.F., Calvert, L.A., Nagel, J., and Hubbard, J.D. (1988). Citrus tristeza virus : characterization of coat proteins. Phytopathology 78, 1221-1226. Lee R.F., Garnsey, S.M., Marais, L.J., Moll, J.N., and Youtsey, C.O. (1988). Distribution of citrus tristeza virus in grapefruit and sweet orange in Florida and South Africa. In Proceedings of the 10th Conference of the International Or ganization of Citrus Virologists (IOCV), L.V. Timmer, S.M. Garnsey, and L. Nararro, eds (Riverside, CA), pp. 33-38. Lee, R.F., McConnell, P., Manjunath, K.L., Ce vik, B., Nikolaeva, O. V., Dekkers, M.G.H., and Niblett, C.L. (2002). The citrus tristeza virus epidemic in Bog Walk valley, Jamaica. In Proceedings of the 15th Conference of the International Or ganization of Citrus Virologists (IOCV) (Riverside, CA. ), pp. 95-101. 172

PAGE 173

Lee, R.F., Pappu, H.R., Pappu, S.S., Rocha-Pena, M.A., Febres, V.J., Manjunath, K.L., Nikolaeva, O.V., Karasev, A., Cevik, B., Akbulut, M., Bencher, D., Anderson, E.J., Price, M., Ochoa-Corona, F.M., and Niblett, C.L. (1996). Progress on strain differentiation of citrus tristeza virus. Phytopathology 14, 79-87. Lin, S.S., Hou, R.F., and Yeh, S.D. (2000). Heteroduplex Mobility and Sequence Analyses for assessment of variability of Zucchini yellow mosaic virus Phytopathology 90, 228-235. Livak, K.J., Flood, S.J., Marmar o, J., Giusti, W., and Deetz, K. (1995). Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridizati on,. PCR: Methods and Applications 4, 357-362. Louzada, E.S., Grosser, J.W., Gmitter, F.G., Deng, X.X., Tusa, N., Nielson, B., and Chandler, J.L. (1992). Eight new somatic hybrid citr us rootstocks with potential for improved disease resistance. HortScience 27, 1033-1036. Lu, R., Folimonov, A., Li, W.-X., Choi, Y.G., Shintaku, M., Falk, B.W., Dawson, W.O., and Ding, S.W. (2003). Citrus tristeza virus genome encodes two distinct suppressors of RNA silencing. In American Society of Virology Meeting (Davis, CA). Mackinney, G. (1941). Absorption of light by chlorophyl l solutions Journal of Biological Chemistry 140, 315-322. Marais, L.J., and Breytenbach, J.H.J. (1996). The effect of tristeza stem pitting on the Star Ruby grapefruit industry in southe rn Africa. In Proceedings of the International Society of Citriculture, pp. 357-365. Marbot, S., Salmon, M., Vandrame, M., Huwaert, A., Kummert, J., Dutrecq, O., and Lepoivre, P. (2003). Development of real-time RT -PCR assay for detection of prunus necrotic virus in fruit trees. Plant Disease 87, 1344-1348. Mathews, D.M., Riley, K., and Dodds, J.A. (1997). Comparison of detection methods for citrus tristeza virus in field trees during months of nonoptimal titer. Plant Disease 81, 525-529. Mawassi, M., Mietkiewska, E., Gofman, R., Yang, G., and Bar-Joseph, M. (1996). Unusual sequence relationships between two isolates of citrus tristeza virus Journal of General Virology 77, 2359-2364. Mawassi, M., Karasev, A., Mietkiewska, E., Ga fny, R., Lee, R.F., Dawson, W.O., and BarJoseph, M. (1995a). Defective RNA mo lecules associated with citrus tristeza virus. Virology 208, 383-387. Mawassi, M., Mietkiewska, E., Hilf, M.E., Asho ulin, L., Karasev, A.V., Gafny, R., Lee, R.F., Garnsey, S.M., Dawson, W.O., and Bar-Joseph, M. (1995b). Multiplespecies of defective RNAs in plants infected with citrus tristeza virus. Virology 214, 264-268. McClean, A.P.D. (1957). Tristeza virus of citrus; Evid ence for absence of seed transmission. Plant Disease Reporter 41, 821. 173

PAGE 174

McClean, A.P.D. (1975). Stem pitting disease (tristeza virus) on limes in field plantings in South Africa. Phytophylactica 7, 75-80. McClean, A.P.D. ( 1950). Possible identity of three citrus diseases. Nature 165, 767-768. McGovern, R.J., Lee R.F., and Niblett, C.L. (1994). Ttristeza (Gainesville, FL: Florida Coopration Extention Servce, University of Florida), pp. 1-4. McLaughlin, M.R., Barnett, O.W., Burrows, P.M., and Baum, R.H. (1981). Improved ELISA conditions for detection of plant viruses. Journal of Virological Methods 3, 13-25. Medina-Urrutia, V., F., M.K.L., Serrano, P., and Guo, W. (2004). New intergeneric somatic hybrids combining amplycarpa mandarin with six trifoliate/ trifoliate hybrid selections for lime rootstock improvement. HortScience 39, 355-360. Meneghini, M. (1946). Sobre a natureza e transmissibilid ade do doencia "tristeza" dos citrus. Biologico 12, 285-287. Mestre, P.F., Asins, M.J., Pina, J.A., and Navarro, L. (1997a). Efficient search for new resistant genotypes to the citrus tristeza closterovirus in the orange subfamily Aurantioideae. Theoretical and Applied Genetics 95, 1282-1288. Mestre, P.F., Asins, M.J., Carbonell, E.A., and Navarro, L. (1997b). New gene(s) involved in the resistance of Poncirus trifoliata (L.) Raf. To citrus tristeza virus Theoretical and Applied Genetics 95, 691-695. Mestre, P.F., Asins, M.J., Pina, J.A., Carbonell, E.A., and Navarro, L. (1997c). Molecular markers flanking citrus tristeza virus resistance gene from Poncirus trifoliata (L) Raf. Theoretical and Applied Genetics 94, 458-464. Metha, P., Brlansky, R.H., Gowda, S., and Yokomi, R.K. (1997). Reverse transcription polymerase chain reaction detection of citrus tristeza virus in aphids. Plant Disease 81, 1066-1069. Moore, G.A., Gutirrez, E.M.A., Jaca no, C., McCaffery, M., and Cline, K. (1993). Production of transgenic citrus plants expre ssing the citrus tristeza coat protein gene. HortScience 28, 152. Moreno, P., and Guerri, J. (1997). Variability of citrus tristeza clostero virus (CTV): methods to differentiate isolates. In Filamentous Viruses of Woody Plants, P. Monette, ed (Trivandrum, India: Research Signpost), pp. 97-107. Moreno, P., Guerri, J., Ballesterolmos, J.F., Albiach, R., and Martinez, M.E. (1993). Separation and interferen ce of strains from a citrus tristeza virus isolate evidenced by biological-activity and d ouble-stranded-RNA (dsRNA) analysis. Plant Pathology 42, 35-41. 174

PAGE 175

Moreno, P., Ambros, S., Albiach-Ma rti, M.R., Guerri, J., and Pena, L. (2008). Citrus tristeza virus : a pathogen that changed the course of the citrus industry. Molecular Plant Pathology 9, 251. Muller, G.W., and Garnsey, S.M. (1984). Susceptibility of citrus varities, species, citrus relatives, and non-rutecous plants to slash-cut machanical inoculation with citrus tristeza virus. In Proceedings of the 8th Conference of the Internati onal Organization of Citrus Virologists (IOCV), S.M.T. Garnsey, L. V. A nd Didds, J. A, ed (Riverside, CA), pp. 62-65. Muller, G.W., Rodriguez, O., and Costa, A.S. (1968). A tristeza virus complex severe to sweet orange cultivars. In Proceedings of the 4th Conference of the Intern ational Organization of Citrus Virologists (IOCV), J.F. L. Childs, ed (Gainesville: Un iversity of Florida Press), pp. 64-71. Muller, G.W., Costa, A.S., Kitajima, E.W., and Camorgo, J.B. (1974). Additional evidence that tristeza multipleis in Passifl ora spp. In Proceedings of the 6th Conference of the International Organization of C itrus Virologists (IOCV), L.G. Weathers and M. Cohen, eds (Riverside, CA), pp. 75-77. Nagy, P.D., and Simon, A.E. (1997). New insights into the mechanisms of RNA recombination. Virology 235, 1-9. Navas-Castillo, J., Albiach-Marti, M.R., Gowda, S., Hilf, M.E., Garnsey, S.M., and Dawson, W.O. (1997). Kinetics of accumulation of citrus tristeza virus RNAs. Virology 228, 92-97. Nelson, N., J. (1944). A photometric adaptation of the Somogy method for the determination of glucose Journal of Biological Chemistry 153 375-379. Niblett, C.L., Genc, H., Cevik, B., Halbert, S., Brown, L., Nolasco, G., Bonacalza, B., Manjunath, K.L., Febres, V.J., Pappu, H.R., and Lee, R.F. (2000). Progress on strain differentiation of citrus tristeza virus and its application to th e epidemiology of citrus tristeza disease. Virus Research 71, 97-106. Nicholas, K.B., and Nicholas, H.B. (1997). GeneDoc a tool for editing and annotating multiple sequence alignments. Nicolosi, E., Deng, Z.N., Gent ile, A., La Malfa, S., Cont inella, G., and Tribulato, E. (2000). Citrus phylogeny and genetic or igin of important species as investigated by molecular markers. Theoretical and Applied Genetics 100, 1155-1166. Olmos, A., Bertolini, E., Gil, M., and Cambra, M. (2005). Real-time a ssay for quantitative detection of non-persistently transmitted Plum pox virus RNA targets in single aphids. Journal of Virological Methods 128, 151-155. Opitz, K.W. (1961). Guide to top-work ing. California Citrograph 46, 320. 175

PAGE 176

Osman, F., and Rowhani, A. (2006). Application of a spotting sample preparation technique for the detection of pathogens in woody plan ts by RT-PCR and real-time PCR (TaqMan). Journal of Virological Methods 133, 130-136. Osman, F., Leutenegger, C., Golino, D., and Rowhani, A. (2007). Real-time RT-PCR (TaqMan) assays for the detection of Grap evine Leafroll associat ed viruses 1 and 9. Journal of Virological Methods 141, 22-29. Palukaitis, P., and Zaitlin, M. (1997). Replicase-mediated resistance to plant virus disease Advances in Virus Research 48, 349-377. Papic, T., Santos, C., and Nolasco, G. (2005). First report of Citrus tristeza virus in the State Union of Serbia and Montenegro. Plant Disease 89, 434. Pappu, H.R., pappu, S.S., Manjunath, K.L., Lee R.F., and Niblett, C.L. (1993). Molecular charecterization of a structural epitope that is largely conser ved among severe isolates of a plant virus In Proceedings of the Nationa l Academy of Sciences-USA (USA), pp. 36413644. Pappu, H.R., Karasev, A.V., Anderson, E.J., Pappu, S.S., Hilf, M.E., Febres, V.J., Eckloff, R.M., McCaffery, M., Boyko, V., and Gowda, S. (1994). Nucleotide sequence and organization of eight 3' open reading frames of the citrus tristeza Closterovirus genome. Virology 199, 35-46. Pappu, S.S., Febres, V.J., Pappu, H.R., Lee, R.F., and Civerolo, E.L. (1997). Characterization of the 3' proximal gene of citrus tristeza closterovirus genome. Virus Research 47, 51-57. Permar, T.A., Garnsey, S.M., Gumpf, D.J., and Lee, R.F. (1990). A monoclonal antibody that discriminates strains of citrus tristeza virus Phytopathology 80, 224-228. Petersen, Y. (2003). Pokeweed antiviral protein-medi ated resistance to citrus pathogens (Gainesville: University of Florida). Pina, J.A., Moreno, P., Juarez, J., Guerri, J., Cambra, M., Gorris, T., and Vavarro, L. (2005). A new procedure to index for citrus tristeza virus -induced decline on sour orange rootstock. In Proceedings of the 16th Conference of the Internati onal Organization of Citrus Virologists (IOCV), M.E. Hilf, N. Duran-Vila, and M.A. Rocha Pea, eds (Riverside, CA), pp. 491. Platt, R.G., and Opitz, K.W. (1973). Production technology:The propagation of citrus. In The Citrus Industry, W. Reuther, ed, pp. 1-45. Powell, C.A., Pelosi, R.R., and Cohen, M. (1992). Superinfection of orange trees containing mild isolates of Citrus tristeza virus and severe Florida isolates of citrus tristeza virus Plant Disease 76, 141-144. 176

PAGE 177

Powell, C.A., Pelosi, R.R., Rundell, P.A., and Cohen, H. (2003). Breakdown of crossprotection of grapefruit from decline-inducing isolates of citrus tristeza virus following introduction of brown citrus aphid. Plant Disease 87, 1116-1118. Price, M., Schell, J., Grosser, J.W., Pappu, S.S., Pappu, H.R., Febres, V.J., Manjunath, K.L., Niblett, C.L., Derrick, K.S., and Lee, R.F. (1996). Replication of citrus tristeza closterovirus in citrus protoplasts. Phytopathology 86, 830-833. Rai, M. (2006). Refinement of the citrus tristeza virus resistance gene (CTV) positional map in Poncirus trifoliata and generation of transgenic grapefruit (Citrus para disi) plant lines with candidate resistance genes in th is region. Plant Molecular Biology 61, 399-414. Reed, J.C., Kasschau, K.D., Prokhnevsky, A.I ., Gopinath, K., Pogue, G.P., Carrington, J.C., and Dolja, V.V. (2003). Suppressor of RNA silenci ng encoded by Beet yellows virus. Virology 306, 203-209. Rezaee, R. (2008). Introducing a simple and efficien t procedure for topworking Persian walnut trees. Journal of the American Pomological Society 62, 21-26. Rocha-Pena, M.A., Lee, R.F., Lastra, R., Niblett, C.L., Ochoa-Corona, F.M., Garnsey, S.M., and Yokomi, R.K. (1995). Citrus tristeza virus and its aphid vector Toxoptera citricida : threats to citrus production in the Caribbean and Ce ntral and North America. Plant Disease 79, 437-445. Rocha-Pea, M.A., and Lee, R.F. (1991). Serologica l techniques for th e detection of citrus tristeza virus. Journal of Virological Methods 34, 311-331. Rocha Pea, M.A., Lee R.F., permar, T.A., Yokomi, R., and Garnsey, S.M. (1991). Use of Enzyme-Linked Immunosorbent and DotImmun obinding Assay to evaluate two mild-strain cross protection experiments after challenging with a severe citrus tristeza virus isolate In Proceedings of the 11th Conference of the International Or ganization of Citrus Virologists (IOCV) (Riverside, CA), pp. 93-102. Roistacher, C.N. (1976). Detection of citrus tristeza virus by graft transmissi on. In Proceedings of the 7th Conference of the Internat ional Organization of Citrus Virologists (IOCV), E.C. Calavan, ed (Riverside, CA), pp. 175-184. Roistacher, C.N. (1982). A blueprint of disaster I: The history of seedling yellows disease. California Citrograph 67, 48-53. Roistacher, C.N., and Bar-Joseph, M. (1984). Aphid transmission of citrus tristeza and seedling yellows tristeza by small populati on of Aphis gossypii. Plant Disease 68, 494-499. Roistacher, C.N., and Bar-Joseph, M. (1987a). Aphid transmission of citrus tristeza virus : a rewiew. Phytophylactica 19, 163-167. 177

PAGE 178

Roistacher, C.N., and Bar-Joseph, M. (1987b). Transmission of citrus tristeza virus (CTV) by Aphis gossypii and by graft inoculation to and from Passiflora spp. Phytophylactica 19, 179182. Roistacher, C.N., Blue, R.L., Nauer, E.M., and Calavan, E.C. (1974). Suppression of tristeza virus symptoms in Mexican Lime seedlings grown at warm temperatures. Plant Disease Reporter 58, 757-760. Roistacher, R.N., and Moreno, P. (1991). The worldwide threat from destructive isolatesf citrus tristeza virusa review. In Proceedings of the 11th Conference of the International Organization of Citrus Virologi sts (IOCV), R.H. Brlansky, R.F. Lee, and L.V. Timmer, eds (Riverside, CA), pp. 7-19. Roy, A., Fayad, A., Barthe, G., and Brlansky, R.H. (2005). A multiplex polymerase chain reaction method for reliable, se nsitive and simultaneous detec tion of multiple viruses in citrus trees. Journal of Virological Methods 129, 47-55. Rubio, L., Guerri, J., and Moreno, P. (2000). Characterization of citrus tristeza virus isolates by single-strand conformation polymorphism an alysis of DNA complemetary to their RNA population. In Proceedings of the 14th Conference of the Internati onal Organization of Citrus Virologists (IOCV), J.V. da Graca, R.F. Lee, and R.K. Yokomi, eds (Riverside, CA), pp. 1217. Rubio, L., Ayllon, M.A., Guerri, J., Pappu, H.R., Niblett, C.L., and Moreno, P. (1996). Differentiation of citrus trist eza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of coat protein gene. Annals of Applied Biology 129, 479-489. Rubio, L., Ayllon, M.A., Kong, P., Fernandez, A., Polek, M., Guerri, J., Moreno, P., and Falk, B.W. (2001). Genetic variation of citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. Journal of Virology 75, 8054-8062. Ruiz-Ruiz, S., Moreno, P., Guerri, J., and Ambros, S. (2007). A real-time RT-PCR assay for detection and absolute quantitation of citrus tristeza virus in different plant tissues. Journal of Virological Methods 145, 96-105. Saito, W., Ohgawara, T., Shimizu, J., and Ishii, S. (1991). Acid citrus somatic hybrids between Sudachi ( Citrus sudachi Hort. ex Shirai) and lime (C. aurantifolia Swing.) produced by electrof usion. HortScience 77, 125-130. Salibe, A.A. (1977). The stem-pitting effects of triste za on different citrus hosts and their economic significance. In Proceedings of the In ternational Society of Horticulture pp. 953955. Saponari, M., Keremane, M., and Yokomia, R.K. (2008). Quantitative detection of citrus tristeza virus in citrus and aphids by real-time reverse transcription-PCR (TaqMan). Journal of Virological Methods 147, 43. 178

PAGE 179

Sasaki, A. (1974). Studies on hasaku dwarf: Special bulle tin of fruit tree expe rimental station of hiroshima prefecture 2, pp. 106. Satyanarayana, T., Gowda, S., Ayllon, M.A., and Dawson, W.O. (2004). Closterovirus bipolar virion: Evidence for initiation of assemb ly by minor coat protei n and itsrestriction to the genomic RNA 5' region. Proceedings of the National Academy of Sciences-USA 101, 799-804. Satyanarayana, T., Gowda, S., Mawassi, M., Albiach-Mart, M.R., and Dawson, W.O. (2000). HSP70 homolog and p61 in addition to the two coat protein genes of Citrus tristeza closterovirus are required for efficient asse mbly of infectious virions. Phytopathology 90, S69. Satyanarayana, T., Gowda, S., Ayllon, M.A., Albiach-Marti, M.R., and Dawson, W.O. (2002a). Mutational analysis of the replication signals in the 3'-nontranslated region of citrus tristeza virus virus. Virology 300, 140-152. Satyanarayana, T., Gowda, S., Ayllon, M.A., Albiach-Marti, M.R., Rabindran, S., and Dawson, W.O. (2002b). The p23 protein of citrus tristeza virus controls asymmetrical RNA accumulation. Virology 76, 473-483. Satyanarayana, T., Robertson, C.J., Garnsey, S.M., Bar-Joseph, M., Gowda, S., and Dawson, W.O. (2008). Three genes of citrus tristeza virus are dispensable for infection and movement throughout some varietie s of citrus trees. Virology 376 297. Satyanarayana, T., Gowda, S., Boyko, V.P., Al biach-Marti, M.R., Mawassi, M., NavasCastillo, J., Karasev, A.V., Dolja, V., Hilf, M.E., Lewandowski, D.J., Moreno, P., BarJoseph, M., Garnsey, S.M., and Dawson, W.O. (1999). An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replicati on. Proceedings of the National Academy of Sciences-USA 96, 7433-7438. Saunt, J. (1990). Citrus varieties of the world. (N orwich, England: Sinclair International Limited). Schneider, H. (1959). The anatomy of tristeza virus-infe cted citrus. In Citrus Virus Diseases, J.M. Wallace, ed (Berkeley: Univer sity of California Press), pp. 73-84. Schneider, W.L., Sherman, D.J., Stone, A.L., Damsteegt, V.D., and Frederick, R.D. (2004). Specific detection and quantification of plum pox virus by real-time fluorescent reverse transcription-PCR. Journa l of Virological Methods 120, 97-105. Sieburth, P.J. (2000). Pathogen testing in the Florida mandatory citrus budwood protection program. In Proceedings of the 14th Conference of the Internati onal Organization of Citrus Virologists (IOCV), J.V. a Graca, R.F. Lee, and R.K. Yokomi, eds (Riverside, CA), pp. 408410. 179

PAGE 180

Sieburth, P.J., Nolan, K.G., Hilf, M.E., Lee, R.F., Moreno, P., and Garnsey, S.M. (2005). Discrimination of stem-pitti ng from other isolates of citrus tristeza virus In Proceedings of the 16th Conference of the International Organizat ion of Citrus Virologists (IOCV), M.E. Hilf, N. Duran-Vila, and M.A. Roch a-Pea, eds (Riverside, CA), pp. 1-10. Somogy, M. (1952). Notes on sugar determinatio n Journal of Biological Chemistry. 195, 19-23. Soost, R.K., and Roose, M.L. (1996). Citrus. In Fruit Breeding J. Janick and J.N. Moore, eds (John Wiley, New York. ), pp. 257-323 Stover, E., and Castle, B. (2002). Citrus rootstock usage, char acteristics, and selection in the Florida Indian River region. HortTechnology 12, 143-147. Suastika, G., Natsuaki, T., Terui, H ., Kano, T., Ieki, H., and Okuda, S. (2001). Nucleotide sequence of citrus tristeza virus seedling yellows isolate. Jour nal of General Plant Pathology 67, 73-77. Tanaka, H. (1969). Virus of citrus fruits in Japan. Agriculture Horticulture 44, 455-459. Tanaka, H., Yamada, S., and Nakanishi, J. (1971). Approach to elimin ating tristeza virus from from citrus trees by using trifoliate orange se edlings. Bulletin Horticu ltural Research Station, Japan 11, 157-165. Tanaka, M. (1981). Citrus interstock-scion combinat ions and topworking procedures in the Wakayama region of Japan. International Society of Citriculture, 1981. Volume 1 127-130. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997 ). The ClustalX windows interface: flexible strategi es for multiple sequence alignment aided by quality analysis tools. Nuclic Acids Research. 25, 4876-4882. Toxopeus, H.J. (1937). Stock-action in-compatibility in citrus and its cause. Journal of Pomology and Horticultural Science 14, 360-367. Tsai, J.H., Liu, Y.H., Wang, J.J., and Lee, R.F. (2000). Recovery of orange stem pitting strains of citrus tristeza virus (CTV) following single aphid transmission with Toxoptera citricida from a Florida decline isolate of CT V. Proceeding of Florida State Horticultural Society 113, 75-78. USDA-Natural Resources Conservation Service. (1987). Soil survey of Indian River County, Florida. USDA/UF/FDACS Nati onal Cooperative Soil Survey. Van Vuuren, S.P., and da Graa, J.V. (2000). Evaluation of graft-tr ansmissible isolates from dwarfed citrus trees as dwarfing agents. Plant Disease 84, 239-242. 180

PAGE 181

Van Vuuren, S.P., and van der Vyver, J.B. (2000). Comparison of South African preimmunizing citrus tristeza virus virus isolates with foreign isolates in three grapefruit selections. In Proceedings of the 14th Conference of the Internati onal Organization of Citrus Virologists (IOCV), J.V. da Graa, R.F. Lee, and R.K. Yokomi, eds (Riverside, CA), pp. 5056. Van Vuuren, S.P., Collins, R.P., and Da Graca, J.V. (1993). Evaluation of citrus tristeza virus isolates for cross protection of grap efruit in South Africa. Plant Disease 77, 24-28. Varga, A., and James, D. (2005). Detection and differentiati on of plum pox virus using realtime multiplex PCR with SYBR green and melting curve analysis: a rapid method for strain typing. Journal of Virological Methods 123, 213220. Varga, A., and James, D. (2006). Real-time RT-PCR and SYBR green I melting curve analysis for the identification of plum pox virus strain s C, EA, andW: effect of amplicon size, melt rate, and dye translocation. J ournal of Virological Methods 132, 146-153. Vela, C., Cambra, M., Sanz, A., and Moreno, P. (1988). Use of the specific monoclonal antibodies for diagnosis of citrus tristeza virus In Proceedings of the 10th Conference of the International Organization of C itrus Virologists (IOCV), L.W. Timmer, S.M. Garnsey, and L. Navarro, eds (Riverside, CA), pp. 55-61. Viggiani, G. (1988). Citrus pests in mediterrane an basin. In Proceedings of the 6th Conference of the International Organization of Citrus Virologists (IOCV) (Riverside, CA), pp. 1067-1073. Vives, M.C., Rubio, L., Lopez, C., Navas-Cas tillo, J., Albiach-Marti, M.R., Dawson, W.O., Guerri, J., Flores, R., and Moreno, P. (1999). The complete genome sequence of the major component of a mild citrus tristeza virus isolate. Journal of General Virology 80, 811816. Von Broembsen, L.A., and Lee, A.T.C. (1988). South Africas Citrus Improvement Program. In Proceedings of the 10th Conference of the International Or ganization of Citrus Virologists (IOCV), L.W. Timmer, S.M. Garnsey, and L. Navarro, eds ( Riverside, CA), pp. 407-416. Wallace, J.M. (1956). Tristeza disease of ci trus, with special referen ce to its situation in the United States. FAO Plant Protection Bulletin 4, 77-94. Wallace, J.M., and Drake, R.J. (1955). The trsiteza virus in Meyer lemon. Citrus Leaves 35, 89. Webber, H.J. (1925). A comparative study of citrus i ndustry in South Africa. Union South Africa: Department of Agriculture 6 106. Webber, H.J. (1943). The 'Tristeza' disease of sour-orange rootstock. Proceeding of the American Society for Horticultural Science Journal 43 360-364. Wheaton, T.A., Castle, W.S., Whitny, J.D., and Tucker, D.P.A. (1991). Performance of citrus scion cultivars and rootstocks in a high density planting. HortScience 26, 837-840. 181

PAGE 182

182 Wutscher, H.K., and Bowman, K.D. (1999). Performance of Valencia orange in 21 rootstocks in central Florida. HortScience 33, 622-624. XinZhong, H., ChangHe, Z., and HongLong, L. (2005). Study on the techniques of topworking methods for P ears. South China Fruits 45-47. Yang, G., Mawassi, M., Gofman, R., Gafny, R., and Bar-Joseph, M. (1997). Involvement of a subgenomic mRNA in the generation of a variable population of defective citrus tristeza virus molecules. Journal of Virology 71, 9800-9802. Yang, G., Che, X., Gofman, R., Ben-Shalom, Y., Piestun, D., Gafny, R., Mawassi, M., and Bar-Joseph, M. (1999). D-RNA molecules associated with subisolates of the VT strain of citrus tristeza virus which induce different seedling-yellows reactions. Virus Genes 19, 5-13. Yang, Z.N., Ingelbrecht, I.L., Louzada, E., Skaria, M., and Mirkov, T.E. (2000). Agrobacterium -mediated transformation of the commerci ally important grapefruit cultivar Rio Red ( Citrus paradisi Macf.). Plant Cell Reports 19, 1203-1211. Yang, Z.N., Ye, X.R., Molina, J., Roose, M.L., and Mirkov, T.E. (2003). Sequence analysis of a 282-kilobase region surrounding the citrus tristeza virus resistance gene (CTV) locus in Poncirus trifoliata L. Raf. Plant physiology 131, 482-492. Yang, Z.N., Ye, X.R., Choi, S.D., Molina, J., Moonan, F., Wing, R.A., Roose, M.L., and Mirkov, T.E. (2001). Construction of a 1.2Mb contig including the citrus tristeza virus resistance gene locus using a bacterial artificial chromosome library of Poncirus trifoliata (L.) Raf. Genome 44, 382-393. Yokomi, R.K., Lastra, R., Stoetzel, M.B., Amgs teet, V.D., Lee, R.F., Garnsey, S.M., RochaPena, M.A., and Niblett, C.L. (1994). Establismnet of br own citrus aphid Toxoptera citricida (Kirkaldy) (Homopter a: Aphididae) in Central Am erica and the Caribbien Basin, and its transmission of citrus tristeza virus Journal of Economic Entomology 87, 10781085. Zaitlin, M., Anderson, J.M., Perry, K. L., Zhang, L., and Palukaitis, P. (1994). Specificity of replicase-mediated resistance to cucumber mosaic virus. Virology 201, 200-205.

PAGE 183

BIOGRAPHICAL SKETCH Azza Hosni Ibrahim Mohamed was born in Al tahera, Sharkia, Egypt, in 1971. She earned a Bachelor of Science degree in agriculture chemistry in June 1993 from the Biochemistry Department, Zagazig University, Egypt. Azza was a ppointed to a position as a research assistant at the Biochemistry Department, Mansoura Univer sity, Egypt, where she received the Master of Science in biochemistry in 1999. She is married to Ahmad Omar who also recently completed his Ph.D. from the University of Florida. Th ey have one daughter, Aala. Azza is getting her degree from the Horticultural Science Department under the supervision of Dr Jude W. Grosser, professor of plant cell genetics at the University of Florida. After Azza graduation, she will return to Egypt to resume her position as an as sistant professor in the Biochemistry Department, Faculty of Agriculture, Mansoura University, Egypt. Her work will include teaching several biochemistry and molecular biology courses and re search that will feature techniques she has learned during her Ph.D. program. 183