<%BANNER%>

Blue-Light Regulation of Light-Harvesting Chlorophyll A/B Binding Transcript Stability

Permanent Link: http://ufdc.ufl.edu/UFE0023731/00001

Material Information

Title: Blue-Light Regulation of Light-Harvesting Chlorophyll A/B Binding Transcript Stability
Physical Description: 1 online resource (143 p.)
Language: english
Creator: Madzima, Thelma
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: During early plant development environmental signals direct rapid changes in gene expression to establish growth patterns that conform to the immediate surroundings. Changes in gene expression affect morphology; physiology and biochemistry to best optimize the plant's ability to grow as an autotroph. One way to regulate gene expression is at the transcript level. RNA degradation regulates accumulation of Light-harvesting chlorophyll a/b binding (Lhcb; formerly cab) transcripts. This has been demonstrated in etiolated seedlings, where Lhcb transcript levels increase in response to a short, single low fluence pulse of blue light (10^4 ?mol m^-2), but decrease following a pulse of blue-high-fluence light (10^5 ?mol m^-2). The decrease in steady-state accumulation is due to transcript destabilization. The 65 base 5'-UTR is necessary and sufficient to confer BHF-mediated destabilization and this response requires the phototropin1 (phot1) photoreceptor and the NPH3 scaffolding protein. In this study, the blue-light mediated regulation of Lhcb transcript stability is examined in the model plant Arabidopsis thaliana. A series of experiments were performed progressing from the phot1 photoreceptor to new proteins participating in transcript destabilization and coalescing in showing the effect of this system in transcript maintenance during diurnal cycles. The study implements phot1 LOV domain mutants to identify the role of the individual chromophore binding domains in the BHF-mediated destabilization process. To identify potential regulatory proteins, a yeast-three-hybrid screen was performed using the Lhcb 5'-UTR as an interaction target. Several bona fide interactors were obtained. One of these proteins is a novel F-box protein designated as KFR1 for Kelch domain, F-box RNA-associated protein. Genetic tests using T-DNA insertion mutants and pharmacological tests using a proteasome inhibitor (MG132) indicate that Kfr1 is required for BHF-induced Lhcb transcript destabilization. To study this destabilization effect in an important biological process outside of de-etiolation, the decay kinetics of Lhcb transcripts under diurnal conditions is studied, and shows a discrete effect of the phot1-KFR1 system on transcript stability. This study advances previous understanding of the blue-light mediated regulation of transcript stability significantly and identifies new components that mediate this response. It addresses the relationship between signal input and changes in physiology to better our understanding in the mechanisms that direct light-regulation of transcript stability.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Thelma Madzima.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Folta, Kevin M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0023731:00001

Permanent Link: http://ufdc.ufl.edu/UFE0023731/00001

Material Information

Title: Blue-Light Regulation of Light-Harvesting Chlorophyll A/B Binding Transcript Stability
Physical Description: 1 online resource (143 p.)
Language: english
Creator: Madzima, Thelma
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: During early plant development environmental signals direct rapid changes in gene expression to establish growth patterns that conform to the immediate surroundings. Changes in gene expression affect morphology; physiology and biochemistry to best optimize the plant's ability to grow as an autotroph. One way to regulate gene expression is at the transcript level. RNA degradation regulates accumulation of Light-harvesting chlorophyll a/b binding (Lhcb; formerly cab) transcripts. This has been demonstrated in etiolated seedlings, where Lhcb transcript levels increase in response to a short, single low fluence pulse of blue light (10^4 ?mol m^-2), but decrease following a pulse of blue-high-fluence light (10^5 ?mol m^-2). The decrease in steady-state accumulation is due to transcript destabilization. The 65 base 5'-UTR is necessary and sufficient to confer BHF-mediated destabilization and this response requires the phototropin1 (phot1) photoreceptor and the NPH3 scaffolding protein. In this study, the blue-light mediated regulation of Lhcb transcript stability is examined in the model plant Arabidopsis thaliana. A series of experiments were performed progressing from the phot1 photoreceptor to new proteins participating in transcript destabilization and coalescing in showing the effect of this system in transcript maintenance during diurnal cycles. The study implements phot1 LOV domain mutants to identify the role of the individual chromophore binding domains in the BHF-mediated destabilization process. To identify potential regulatory proteins, a yeast-three-hybrid screen was performed using the Lhcb 5'-UTR as an interaction target. Several bona fide interactors were obtained. One of these proteins is a novel F-box protein designated as KFR1 for Kelch domain, F-box RNA-associated protein. Genetic tests using T-DNA insertion mutants and pharmacological tests using a proteasome inhibitor (MG132) indicate that Kfr1 is required for BHF-induced Lhcb transcript destabilization. To study this destabilization effect in an important biological process outside of de-etiolation, the decay kinetics of Lhcb transcripts under diurnal conditions is studied, and shows a discrete effect of the phot1-KFR1 system on transcript stability. This study advances previous understanding of the blue-light mediated regulation of transcript stability significantly and identifies new components that mediate this response. It addresses the relationship between signal input and changes in physiology to better our understanding in the mechanisms that direct light-regulation of transcript stability.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Thelma Madzima.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Folta, Kevin M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0023731:00001


This item has the following downloads:


Full Text

PAGE 1

1 BLUE LIGHT REGULATION OF LIGHT -HARVESTING CHLOROPHYLL A/B BINDING TRANSCRIPT STABILITY By THELMA FARAI MADZIMA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQ UIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Thelma Farai Madzima

PAGE 3

3 To my grandfather (Dr. Alec Mathias Chibanguza) for dedicating his life to make sure that the girl child receives equal educational opportunities. To my parents (Dr. Welbourne Ndabaningi Madzima and Mrs. Rufaro Charity Madzima) for teaching me the value of hard work and perseverance, and for their endless love and support.

PAGE 4

4 ACKNOWLEDGMENTS I wou ld like to thank parents, Welbourne and Rufaro, for being perfect role models and examples of the benefits of hard work, for all their prayers, for the love and support they have shown me over the years, for all their sacrifices that I might have the best opportunities and for the values they taught me as a child; values by which I aim to live daily. I have been more than blessed to have them as my parents. I would also like to thank those who mentored me along the way. I thank Dr. Kevin Folta for his mentorship and having such high hopes for me. I appreciate his genuine passion for science, bench -work and mentoring students. My thanks also go to Dr. Sarwan Dhir, for introducing me, and others, to research and the many opportunities that arose from this (I d ream of one day influencing young lives in such a positive way); and to Dr. Harry Klee for challenging me as an undergraduate student to pursue a career in research. Thanks also go to my supervisory committee (Dr. Kevin Folta; Dr. Harry Klee; Dr. Mark Sett les and Dr. Valrie de Crcy Lagard) for all their suggestions and input. Last but not least, my deepest thanks go to those who were there for me daily, who unknowingly committed themselves to years of challenges and hard work as they supported and encoura ged me. I thank my husband (Clyde Arthur Graham, Jr.) for his love and support, for waiting patiently as I pursued my goals, for always being encouraging, and for lending an ear when I needed someone to listen and a hand when I needed help. My thanks go to my brother (Takudzwa Arthur Madzima) and my long -time friend (Tafadzwa Chorwira), for always raising the bar and challenging me to reach it. My thanks also go out to all the members of the Folta lab, past and present, with whom I worked daily. They made t he time spent in the lab enjoyable.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 7 LIST OF FIGURES .............................................................................................................................. 8 LIST OF ABBREVIATIONS ............................................................................................................ 10 ABSTRACT ........................................................................................................................................ 11 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW ................................................................. 13 Arabidopsis Light Responses ..................................................................................................... 13 Arabidopsis Photoreceptors ........................................................................................................ 14 Phot1 and Blue Light Regulate Light -harvesting, chlorophyll -binding (Lhcb ) Transcript Abundance ............................................................................................................................... 21 Regulation of RNA Stability in Plants ....................................................................................... 22 Summary ...................................................................................................................................... 26 2 ROLE OF LOV DOMAINS IN PHOTOTROPIN1 MEDIATED RESPONSES .................. 32 Introduction ................................................................................................................................. 32 Results .......................................................................................................................................... 36 Discussion .................................................................................................................................... 37 Materials and Methods ................................................................................................................ 42 3 IDENTIFICATION OF PROTEINS THAT BIND THE LHCB 5UTR. ............................... 50 Introduction ................................................................................................................................. 50 Results .......................................................................................................................................... 55 Discussion .................................................................................................................................... 63 Materials and Methods ................................................................................................................ 78 4 5 -UTR MEDIATED LHCB TRANSCRIPT DESTABILIZATION DURING DIURNAL CYCLES ................................................................................................................ 104 Introduction ............................................................................................................................... 104 Results ........................................................................................................................................ 107 Discussion .................................................................................................................................. 110 Materials and Methods .............................................................................................................. 113

PAGE 6

6 REFERENCES ................................................................................................................................. 121 BIOGRAPHICAL SKETCH ........................................................................................................... 143

PAGE 7

7 LIST OF TABLES Table page 1 1 Plant nuclear and plastid cis acting RNA (in)stability elements. ........................................ 28 3 1 Proteins identified in a yeast three -hybrid screen using Lhcb 5 -UTR as bait. .................. 88 3 2 Summary of results of yeast three -hybrid screen. ................................................................ 89

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Arabidopsis dark and light growth phenotypes. ................................................................... 29 1 2 V isible spectrum and the Arabidopsis light responses. ....................................................... 30 1 3 Schematic overview of components related to this study. ................................................... 31 2 1 Constructs used to assess the role of the individual LOV domains. ................................... 45 2 2 Phototropin signaling branchpoints. ..................................................................................... 46 2 3 Blue high fluence mediated Lhcb transcript destabilization. ............................................... 47 2 4 Rapid inhibition of hypocotyl elongation. ............................................................................ 48 2 5 Ra pid inhibition of hypocotyl elongation. ............................................................................ 49 3 1 S chematic illustration of the yeast three -hybrid assay. ........................................................ 90 3 2 Strength of inte raction assay using 3 -Amino 1, 2, 4 Triazole (3 -AT). .............................. 91 3 3 Strength of interaction using X -gal.. ..................................................................................... 92 3 4 Strength of interacti on assay using ONPG. .......................................................................... 93 3 5 The RNA plasmid is required for interaction. ...................................................................... 94 3 6 Specificity of RNA. Specificity of RNA was con ducted using IRE as bait. ...................... 95 3 7 Identification of homozygous mutant lines for the At1g80440 gene. ................................ 96 3 8 E ffect of the kfr1 m utation on BHF mediated Lhcb transcript stability. ............................ 98 3 9 The kfr1 mutation can be phenocopied with a proteasome inhibitor. ................................. 99 3 1 0 Phototropic curvature towards unilateral blue light. .......................................................... 100 3 11 Measurement of inhibition of hypocotyl growth. ............................................................... 101 3 12 Me asurement of end-point hypocotyl lengths under blue light. ........................................ 102 3 13 Possible model for KFR1s mode of action........................................................................ 103 4 1 UTR media ted diurnal transcript levels.. ............................................................................ 116 4 2 phot1 mediated diurnal transcript levels. ............................................................................ 117

PAGE 9

9 4 3 Lhcb transcript levels in wild type vs. phot1. .................................................................... 119 4 4 Is the destabilization response under the control of the circadian oscillator?. ................. 120

PAGE 10

10 LIST OF ABBREVIATION S BHF Blue High Fluence BL Blue L ight BLF Blue Low Fluence C Celsius Col Columbia d days FR Far Red FMN Flavin mononucleotide h hours Lhcb Light -harvesting chlorophyll a/b binding LOV Light, Oxygen and Voltage min minutes MS Murashige and Skoog nucleotide nt PCR Polymerase Chain Reactio n phot phototropin R Red s seconds UTR Untranslated Region

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BLUE LIGH T REGULATION OF LIGHT -HARVESTING CHLORPHYLL A/B BINDING TRANSCRIPT STABILITY By Thelma Farai Madzima May 2009 Chair: Kevin M. Folta Major: Plant Molecular and Cellular Biology During early plant development environmental signals direct rapid changes in gene expression to establish growth patterns that conform to the immediate surroundings. Changes in gene expression affect morphology; physiology and biochemistry to best optimize the plants ability to grow as an autotroph. One way to regulate gene expre ssion is at the transcript level. RNA degradation regulates accumulation of Light -harvesting chlorophyll a/b binding (Lhcb ; formerly cab ) transcripts. This has been demonstrated in etiolated seedlings, where Lhcb transcript levels increase in response to a short, single low fluence pulse of blue light (104 mol m2), but decrease following a pulse of blue -high -fluence light (105 mol m2). The decrease in steady -state accumulation is due to transcript destabilization. The 65 base 5 -UTR is necessary and suf ficient to confer BHF -mediated destabilization and this response requires the phototropin1 (phot1) photoreceptor and the NPH3 scaffolding protein. In this study, the blue light mediated regulation of Lhcb transcript stability is examined in the model plant Arabidopsis thaliana. A series of experiments were performed progressing from the phot1 photoreceptor to new proteins participating in transcript destabilization and coalescing in showing the effect of this system in transcript maintenance during diurnal cycles. The study implements phot1 LOV domain mutants to identify the role of the individual chromophore binding domains in the BHF -

PAGE 12

12 mediated destabilization process. To identify potential regulatory proteins, a yeast three hybrid screen was performed usin g the Lhcb 5 -UTR as an interaction target. Several bona fide interactors were obtained. One of these proteins is a novel F box protein designated as KFR1 for K elch domain, F -box R NA associated protein. Genetic tests using T DNA insertion mutants and pharm acological tests using a proteasome inhibitor (MG132) indicate that Kfr1 is required for BHF induced Lhcb transcript destabilization. To study this destabilization effect in an important biological process outside of de -etiolation, the decay kinetics of Lh cb transcripts under diurnal conditions is studied, and shows a discrete effect of the phot1 -KFR1 system on transcript stability. This study advances previous understanding of the blue -light mediated regulation of transcript stability significantly and ide ntifies new components that mediate this response. It addresses the relationship between signal input and changes in physiology to better our understanding in the mechanisms that direct light regulation of transcript stability.

PAGE 13

13 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Arabidopsis Light Responses Plants are sessile, a characteristic that separates them from many other organisms. As a result of this limitation they have to be capable of responding to environmental cues rapidly yet appropriately. One ke y environmental signal is light. In plants, variation in light quality and/or quantity can have a considerable influence on physiology and gene expression (Nemhauser and Chory, 2002). Over the last century a significant amount of research has been performe d to understand the physiological changes that occur in plants in response to various wavelengths of light and will be reviewed later in this chapter. Most studies of plant light responses have been conducted in the model system Arabidopsis thaliana. This model plant represents a system where changes in physiological responses between dark grown and light grown seedlings are rapid and conspicuous (Figure 1 1). Dark grown Arabidopsis seedlings exhibit etiolated/ skotomorphogenic development characterized by a rapid hypocotyl elongation rate, a tightly closed apical hook and unexpanded cotyledons. Upon exposure to light, Arabidopsis seedlings undergo photomorphorgenic development (de -etiolation), defined by a slowing of hypocotyl growth rate, opening of cotyl edons and the onset of chlorophyll accumulation (Kendrick and Kronenberg, 1994; Figure 1 1). Transition from darkness to light is an example of how a plants environment can change rapidly. The physiological differences between a dark grown seedling and a seedling grown in light demonstrate how plants are dependent on their environment for proper growth and development. These developmental changes best optimize the plants content and morphology to function as an autotroph. An etiolated seedling serves as a n excellent tool in studying regulation of light regulated gene expression, as it is extremely sensitive to light and poised to respond rapidly. Transitioning a dark grown seedling into light allows for the study of

PAGE 14

14 the regulation of gene expression in res ponse to a particular quality, quantity (measured as 2) or duration of light. Arabidopsis Photoreceptors Plants have evolved sensitive systems that allow them to respond accordingly to compete effectively with neighbors and optimally exploi t the light environment (Mullen et al., 2006). The capacity to distinguish between and respond to varying light environments starts with photoreceptors (Butler et al., 1959; Briggs and Olney, 2001). These light -sensitive pigments are activated by light, ge nerating an intracellular signal that ends in changes in gene expression that allow for adaptation to the new light environment. Over the last two decades the photoreceptors and attendant pathways that mediate most of these physiological changes have been well characterized. The known photoreceptors (the phytochromes, cryptochromes and LOV -domain blue light sensors) are sensitive to light energy at different wavelengths and intensities. Alone and in combination, these light sensors oversee discrete events in gene expression and ultimately growth and development (Figure 1 2) A comprehensive understanding of light -mediated plant physiology and the systems that regulate it sets the stage for careful analysis of how light signals are integrated in controlling discrete molecular events. For the purposes of this thesis photoreceptor nomenclature and notation will follow the precedent formally established b y Quail et al. (1994). Examples are as follows: EXAMPLE represents the gene or transcript example is the mutant form of the gene, EXAMPLE represents the protein. As applied to a plant photoreceptor specifically phytochrome A (phyA), PHYA represents the gene, phyA is the mutant, PHYA is the apoprotein and phyA is the chromoproteinthe apoprotein bound to it s chromophore.

PAGE 15

15 Phytochromes Phytochromes ( phytochromeA to E; phyA E ) are the red (R; ~660nm) and farred (FR; ~730nm) photoreceptors, yet they also absorb well in the blue and UV -A spectrum (Kendrick and Kronenberg, 1994). In Arabidopsis, the phytochrom es are encoded by a family of five genes, PHY A -E (Sharrock and Quail, 1989; Clack et al., 1994; Briggs and Olney, 2001) and in most plant species are encoded by similar small multigene families (Clack et al., 1994; Mathews et al., 1995; Mathews and Sharroc k, 1997; Schneider -Poetsch et al., 1998). Phytochromes exist in two interconvertible forms: an inactive Pr form and an active Pfr form that absorb red and far red light, respectively (Huq and Quail, 2002). There are two classes of phytochromes. Type I phytochromes (phyA) are the photolabile class that accumulate in etiolated seedlings and degrade rapidly upon light exposure (Chen et al, 2004). Type II phytochromes (p hyB -E) are the photo -stable phytochromes (Wagner et al., 1996). Variation in light -mediat ed receptor stability serves as a means of inhibiting light input and places specific receptors into functions within specific tissues, developmental states or environmental contexts. The mechanism of phytochrome action relies on coordination of protein s tability, re localization, and interaction with downstream interaction partners. In darkness, the Arabidopsis phytochromes are located in the cytoplasm. Upon light exposure, the phytochromes are translocated to the nucleus (Kircher et al., 2002; Sakamoto and Nagatani, 1996; Yamaguchi et al., 1999). This nuclear import is dependent on the Pfr form of the protein (Kircher et al., 1999), and in the case of phyA, with the aid of FAR RED ELONGATED HYPOCOTYL1 (FHY1) or FHY1 -LIKE (FHL) (Hiltbrunner et al., 2006). In the nucleus, Pfr::Pfr dimerization occurs (Sharrock and Clack, 2004) and the phytochromes bind to the nuclear localized basic HelixLoop -Helix (bHLH) transcription factors PHYTOCHROME INTERACTING FACTOR3 (PIF3) and PIF3 -LIKE5 (PIL5) (Ni, et al., 1998; Oh et al., 2004). PIF3 binds to the G -box DNA

PAGE 16

16 sequence of the promoters of light regulated genes (Martinez Garcia et al, 2000). Interaction between phytochrome and PIF3 results in PIF3 phosphorylation and subsequent degradation via the proteasome (Bauer et al., 2004; Al -Sady et al., 2006). Absorption of R and FR light by the phytochromes and their inhibition of PIF3, results in regulation of specific processes such as seed germination, shade avoidance, gene expression, entrainment of the circadian oscillator and many other developmental processes. Cryptochromes The cry ptochromes, cryptochrome1 (cry1) ( Ahmad and Cashmore, 1993) and cryptochrome2 (cry2) (Guo et al., 1998) absorb light in the blue/UVA portion of the electromagnetic spectrum (Cashmore et al, 199 9). Cryptochromes have important roles during de -etiolation including the inhibition of hypocotyl growth, cotyledon expansion and chlorophyll production (Lin et al., 1995; Folta and Spalding 2001). They modulate developmental events in mature plants such as the transition to flowering (Shaitlin et al., 2002; Valverde et al., 2004). Regulation of cryptochrome dependent processes depends on photoreceptor interaction with the systems that mediate ubiquitination of proteins affecting signal flux. The cryptoc hromes have been shown to interact with CONSTITUTIVELY PHOTOMORPHORGENIC1 (COP1), an E3 ubiquitin ligase (Wang et al., 2001; Yang et al., 2001). COP1 acts as a negative regulator of specific transcription factors that are required for transcriptional activation of genes involved in photomorphogenesis (Chen et al., 2004). These transcription factors include ELONGATED HYPOCOTYL5 (HY5), HY5 HOMOLOGUE (HYH), and LONG HYPTOCOTYL IN FR LIGHT (HFR1) (Ulm et al., 2002; Holm et al., 2002; Duek and Fankhauser 2003). In darkness the nuclear localized COP1 acts to repress the accumulation of these transcription factors, thereby inhibiting photomorphogenic development. Upon light exposure, cry1 binds COP1 and

PAGE 17

17 they are translocated to the cytoplasm, allowing for the upre gulation of photomorphogenic genes (Holm et al., 2000; Osterlund et al., 2000; Lin and Shalitin, 2003). Phototropins The phototropin 1 (phot1) receptor was originally defined genetically as nph1 (nonphototropic hypocotyl 1 ) based on discovery of mutants that did not respond to unilateral blue light (Liscum and Briggs, 1995). Cloning and characterization of the NPH1 locus revealed a 996 amino acid, membrane associated protein with flavin binding domains and potential serine threonine kinase activity (Huala e t al., 1997). Later, the phot2 receptor would be characterized based on a screen for mutants defective in light dependent chloroplast movement (Kagawa et al., 2001). The phot1 and phot2 receptors are flavin mononucleotide -binding, autophosphorylating, bl ue light activated serine/threonine kinases (Christie et al., 1998; Christie et al., 1999; Christie and Briggs, 2001). They contain two LOV (Light, Oxygen, and Voltage) domains (which will be reviewed later in this chapter) that serve as a site for flavin binding and photon reception. Phototropin based light responses Phototropins mediate processes such as chloroplast movement in response to varying blue light intensities (Jarillo et al 2001, Kawaga et al 2001, Sakai et al 2001), stomatal opening (Kinos hita et al., 2001), the first phase of blue light -mediated inhibition of hypocotyl growth (Folta and Spalding, 2001), and phototropic curvature (Liscum et al., 2003). The phot1 mutants are deficient in phototropic responses (Christie et al., 1999; Liscum a nd Briggs, 1995). Studies of phot1phot2 double mutants demonstrate that phot1 and phot2 are partially redundant in function (Kinoshita et al., 2001). However, phot2 is required for responses to high intensity blue light (Takemiya et al., 2005, Sakai et al. 2001) and light is required for the expression of PHOT2 (Jarillo et al., 2001; Kawaga et at al., 2004). In summary, the phot -based responses appear to tailor many physiological processes with a common theme of adjusting morphology, content and

PAGE 18

18 position t o optimize photosynthesis (Spalding and Folta, 2005). This same theme is evident at the molecular level as phot1 influences the stability of discrete transcripts following blue light illumination. The phot1 receptor is required for the BHF mediated destab ilization of the Light harvesting chlorophyll a/b binding (Lhcb) and the large subunit of ribulose -bisphosphate carboxylase (rbc L) transcripts (Folta and Kaufman, 2003). This phototropin-mediated response is the stepping off point for this dissertation, as the experiments herein attempt to dissect the response at the biochemical, molecular and physiological levels. Phototropin signaling mechanisms Although much work has been invested into characterizing the phototropins as blue light receptors as well as un derstanding the physiological and developmental processes mediated by these receptors, relatively little is known about the steps downstream of phototropin activation. Three Arabidopsis thaliana proteins have been shown to interact with phot1: NON PHOTOTR OPIC HYPOCOTYL 3 (NPH3), ROOT PHOTOTROPISM2 (RPT2), and PHYTOCHROME KINASE SUBSTRATE1 (PKS1) (Liscum and Briggs, 1995; Liscum and Briggs, 1996; Motchoulski and Liscum, 1999; Christie and Briggs, 2001) NPH3 has been reported to function as an adaptor or sca ffolding protein that gathers components associated with phototropic signalling (Motchoulski and Liscum, 1999). NPH3 is required for only a subset of phot1 activities (Folta and Spalding, 2001; Motchoulski and Liscum, 1999). The coiledcoil region of NPH3 is necessary for its interaction with phot1 (Pedmale and Liscum, 2007; Motchoulski and Liscum, 1999) and NPH3 activation is dependent on phot1s absorption of blue light (Pedmale and Liscum, 2007). RPT2 is a member of the NPH3 family of interacting protei ns (Motchoulski and Liscum, 1999) that is required for phot -mediated root phototropism. It may play a role in phot2 mediated responses (Liscum et al., 2003) and acts with phot1 in regulation of stomatal opening (Inada et al., 2004). Like NPH3, RPT2 is onl y necessary for a

PAGE 19

19 subset of phot1 -mediated processes (Inada et al, 2004). More recently, PKS1 has been shown to interact with phot1 and NPH3 in a phyA dependent manner and may provide insight into a possible link between phytochrome and phototropin signali ng (Lariguet et al, 2006). Phot receptors also mediate a change in calcium flux, a process shown to be required for various aspects of blue light response (Baum et al., 1999; Babournia et al., 2002; Stoelzle et al., 2003; Folta et al. 2003). Exactly how s ignals initiated with these photoreceptors reach the nucleus to alter gene exrpression programs to alter physiological or molecular events is yet to be determined. Pho totropin LOV domains PHOT1 and PHOT2 both contain two LOV (for Light, Oxygen, and Voltag e) domains (LOV1 and LOV2) in their N -terminal regions. Experiments using phot1 protein expressed in insect cells reveal that the phot LOV domains bind flavin mononucleotide (FMN), and that FMN is the preferred chromophore for the receptor (Christie et al. 1999). The phot LOV domains feature a conserved cysteine residue at the amino acid position 39 (Cys39) that has been shown to be essential for photochemical activity. Substitution of this residue with an alanine results in loss of LOV -domain / photoreceptor activity (Salomon et al., 2000; Swartz et al., 2001; Kashara et al., 2002; Christie et al., 2002). It has been shown that the activation of the LOV2 domain alone is both necessary and sufficient for initiating phototropic responses (Christie et al., 20 02). LOV1s role remains to be determined. The putative roles of the LOV1 domain will be explored in Chapter 2. Other LOV -domain photosensors in higher plants Although LOV domains were initially associated with phototropins, they exist in other proteins as well. Based on this motif, a family of LOV domain proteins has been identified. Members of this group include ZEITLUPE/ADAGIO (ZTL/ADO) a protein that conditions the

PAGE 20

20 progression of the central circadian ocscillator (Somers et al., 2000; Jarillo et al., 20 01); LOV KELCH PROTEIN2 (LKP2), a protein that strongly influences the progression of the floral transition (Schultz et al., 2001) and FLAVIN BINDING KELCH REPEAT F BOX1 (FKF1) (Nelson et al., 2000), a protein later shown to play a central role in regulati ng flowering time (Nelson et al., 2000; Imaizumi et al., 2003; Imaizumi et al., 2005) They share common features in that they all contain an N -terminal LOV domain, as well as F box domains, six C terminal Kelch repeats. F -box domains belong to the SCF clas s of ubiquitin E3 ligases that are more commonly known for their role in proteasome -mediated protein degradation. Kelch motifs are thought to mediate specific protein protein interactions. As stated previously, ZTL, LKP2 and FKF1 are essential for the tim ely progression of critical plant processes such as the circadian clock and for the proper transition to flowering (Jarillo et al., 2001; Kiyosue and Wada, 2000; Nelson et al., 2000; Schultz et al., 2001; Somers et al., 2000; Kiba et al., 2007; Kim et al., 2007). Other than Arabidopsis LOV domain proteins have been identified across the plant kingdom, such as well -characterized examples from fern ( Adiantum ; phytochrome 3, phy3) and oat ( Avena sativa ; nph1), as well as in a wide array of bacterial and fung al proteins (Christie et al., 1999; Briggs et al., 2007). In fact, LOV domains are found in 16% of bacterial species (Kennis and Crosson, 2007) and regulate specific processes, such as the invasion of macrophages by Brucella abortus (Swartz et al., 2007). The LOV domains of these proteins contain the conserved residues that are necessary for binding flavin (Crosson et al., 2003; Briggs et al., 2007) and expression of ZTL, LKP2 and FKF1 LOV domains in E. coli display photochemical properties similar to the properties of the LOV domains of phototropin, however unlike phototropin, they fail to revert back to their dark state (Imizumi et al., 2003; Nakasako et al., 2005). One other difference between phototropins and

PAGE 21

21 other LOV domain proteins is that phototrop ins contain two LOV domains while the other proteins contain only one (Crosson et al., 2003). Again this raises the question of the evolutionary role of phototropins two LOVs, an area that will be investigated in Chapter 2. Phot1 and Blue Light Regulate Lightharvesting chlorophyll a/b binding (Lhcb ) Transcript Abundance The Light -harvesting complex (LHC) is composed of Light -harvesting chlorophyll a/b binding proteins that function to link chlorophyll and carotenoids to the thylakoid membrane, transferri ng light energy to the reaction center of photosystems I and II (PSI and PSII, respectively). Consistent with the nomenclature proposed by Jansson et al. ( 1992), genes encoding proteins of PSI have been designated Lhca 1 through Lhca 4 and those associated w ith PSII have been designated Lhcb1 through Lhcb 6 .(Jansson et al., 1992; Jansson et al., 1999) Specific members of the gene family encoding the LHCB proteins (formerly cab ) are differentially regulated by light. These nuclear genes are important because t hey encode proteins that are essential for photosynthesis. The members of the family are regulated in different ways; some by red light through phytochrome (Karlin Neumann et al., 1991) and some by blue light (Gao and Kaufman, 1994) through a mechanism th at involves the G -protein G alpha subunit (GPA1) and the G -protein coupled receptor 1 (GCR1) (Warpeha et al., 2006). Specific family members are regulated by output from the circadian oscillator (Millar and Kay, 1991). Herein, members of the pea ( Pisum s ativum ) and Arabidopsis Lhcb gene family that are regulated by BL only will be discussed. In pea, two members are regulated by BL ( PsLhcb1*1 and PsLhcb1*4) and only one member in Arabidopsis ( AtLhcb1*3) is regulated by BL (Sun and Tobin., 1990; Gao and Kau fman., 1994; White et al., 1995; Tilghman et al., 1997; Folta and Kaufman., 1999). The regulation of Lhcb gene regulation is best studied in the etiolated seedling. Etiolated seedlings provide a suitable system to study Lhcb induction as light -mediated gen e expression is

PAGE 22

22 rapid and robust. The effect can be directly tied to a discrete quantity and quality of light as the system is free from other developmental influences that can obfuscate the response. In etiolated seedlings a brief single pulse of blue li ght regulates accumulation of the pea and Arabidopsis Lhcb transcripts in a fluencedependent manner via two antagonistic systems. In the first system Blue Low Fluence (BLF, <104 2, 1 s of full moonlight) light increases transcript abundance by increasing the rate of transcription of specific members of the Lhcb gene family. This BLF system is sensitive over several orders of magnitude of photons delivered, and activation r esults in a linear increase in Lhcb transcript levels. However, after surpassing a threshold, the Blue High Fluence (BHF; 4 2; 1 s of full sunlight) system destabilizes the resulting transcript (Anderson et al., 1999). Nuclear run on assays confi rmed that the BHF mediated destabilization is a result of an unstable transcript as transcription rates continued to increase when seedlings were irradiated with BHF light (Anderson et al., 1999). Sequences in the pea Lhcb 5 untranslated region (UTR) have been shown to be both necessary and sufficient for this destabilization process (Anderson et al., 1999), and the response requires the phot1 photoreceptor and the NPH3 scaffolding protein (Folta and Kaufman, 2003). While the receptor and first downstream signaling entity are known from genetic analyses, it remains unclear how the downstream events confer destabilization onto the transcript. This mechanism will be i nvestigated further in Chapter 3 Regulation of RNA Stability in Plants To aid in elucidatin g a mechanism that may confer stability to Lhcb transcripts under BLF light and instability of the same transcript under BHF light, it is necessary to review the literature to understand mechanisms that affect the stability of other plant transcripts and t ranscripts in other organisms. Regulation of RNA stability can be defined as the relationship between the transcription rate and the steady state accumulation of a given transcript (Monde, et al, 2000).

PAGE 23

23 Regulation of transcript abundance is a key step in c ontrolling gene expression across kingdoms. To date, relatively little is known concerning the exact mechanisms by which transcript stability of nuclear encoded genes is regulated in plants although through advances made in Chlamydamonas and Saccharomyces cerevisae we can begin to understand how transcripts are regulated (Suay et al., 2005). Cis -Acting RNA Stability Elements The central dogma of molecular biology describes the sequence of events that take place starting from transcription and leading to protein production via translation. It has also become very clear that checkpoints exist in all organisms that aim to reduce errors that may have severe consequences on to the survival of an organism as a whole. More importantly, each step is an opportunit y to optimize or tailor the process. Post transcriptional events in RNA processing that stabilize transcripts are well documented: addition of a 3 poly -A tail, splicing of introns in its open reading frame, and formation of a 5 7 -methyl guanosine cap. Ea ch of these processes offers an opportunity for regulation of expression, as a given transcript may use these systems to be stabilized or possibly targeted for degradation. What needs to be further understood are the processes involved in conferring RNA de cay/destabilization. Cis acting sequences and secondary structures have been demonstrated to be involved in regulation of transcript stability (Bhat et al., 2004; Suay et al., 2005). These cis acting transcript stability elements include 3 and 5 -UTR sec ondary structures and specific 5 and 3 sequences that may function as binding sites for RNA binding proteins (Nishimura et al., 2004; Suay et al., 2005). Most eukaryotic stability elements have been identified in the 3 -UTR whereas bacterial and organell e stability elements are located mainly in the 5 -UTR (Salvador et al., 1993; GrunbergManago et al., 1999; Suay et al., 2005). A summary of some of the known plant 5 and 3 -UTR stability elements is listed in Table 1.

PAGE 24

24 RNA TransActing Factors RNA -binding proteins can function in synthesizing, processing, transporting, translating and/or degrading RNA (Lorkovic and Barta, 2002). These proteins can be classified by, although not limited to, their identifiable domains. RNA binding domains include the RNA rec ognition motif (RRM) (Maris et al, 2005), the double -stranded RNA binding domain (dsRBD) and the K homology (KH) domain (Gibson et al., 1993; Siomi et al., 1993). These proteins may bind to RNA alone or form a complex that confers (in )stability to a transc ript. Although the Arabidopsis thaliana genome has over 200 possible RNA -binding proteins (Lorkovic and Barta, 2002; Nickelsen, 2003), few have undergone experimental validation. Knowledge can be gained from Chlamydamonas where several RNA -binding proteins have been well studied and have been demonstrated to confer stability as well as being required for translation. Among some of the best characterized RNA binding proteins that may mediate stability include the RB47 protein in C. reinhardtii and tobacco ch loroplast cells that binds to the psbA mRNA 5 -UTR. Stability and efficient translation of the transcript is dependent on the binding of RB47 to the UTR in addition to the formation of a protein complex with other proteins (RB60, RB55 and RB38) (Yohn et al ., 1998; Kim and Mayfield, 2002; Zou et al., 2003). RNA binding proteins may also protect a transcript from degradation by ribonucleases. For example, In C. reinhardtii the stability of psbD is mediated by a protein complex which includes Nac2 and RB40 w ith the 5 -UTR. This complex protects psbD mRNA from exonucleotic degradation (Nickelsen et al., 1999; Boudreau et al., 2000; Ossenbuhl and Nickelsen, 2000). RNA Decay Mechanisms In yeast, several RNA destabilizing mechanisms have been identified and some of these pathways have been well understood for many years. Information from yeast can be used to advance our understanding of the mechanisms that may be present in plants. The main decay

PAGE 25

25 pathway in yeast is known as the deadenylation-dependent decapping decay pathway (Gutierrez et al., 1999; Wilusz et al., 2001; Parker and Song, 2004; Newbury, 2006). As the name suggests, RNA is first deadenylated (Decker and Parker 1993) that leads to 5 decapping by the decapping enzymes (DCP1 and DCP2; Beelman et al. 1996; LaGrandeur and Parker, 1998; Dunckley and Parker, 1999) and consequently degraded by a 5to 3 exonuclease (XRN1, Larimer and Stevens, 1990; Brown et al., 2000). Another pathway involves 3 to 5 degradation (Muhrad and Parker, 1994; Muhlrad et al ., 1995). This pathway involves the exosome, a protein complex comprised of several 3 to 5 exomucleases (Mitchell et al., 1997; Jacobs Anderson and Parker, 1998; Mitchell and Tollervey, 2000). Yet another pathway is known as the deadenylationindepende nt pathway (or Non-sense mediated decay pathway, NMD) (Peltz et al., 1993; Muhlrad and Parker, 1994; Hagan et al., 1995). Here, decay of transcripts containing premature stop codons and endonucleotic cleavage that subsequently requires a 5 to 3 exonuclea se and the exosome to cleave 3 to 5(Muhlrad and Parker, 1994; Gatifield and Izaurralde, 2004, Newbury 2006). Although the main decay pathway in plants is still not clear (Goeres et al., 2007; Iwasaki et al., 2007), there are some similarities and dif ferences between components of decay pathways found in yeast and those found in Arabidopsis and many of these have emerged in recent years. In Arabidopsis there is a 5 to 3 decay pathway. XRN4/EIN5 encodes a 5to 3 ribonuclease of decapped transcripts (Kastenmeyer and Green 2000; Olmedo et al., 2006; Potuschak et al., 2006). Arabidopsis also has two decapping proteins that were identified as orthologues of the yeast decapping enzymes, AtDCP1 and AtDCP2/TDT Although of the two, AtDCP2 has been demonstr ated to function as a decapping enzyme (Goeres et al., 2007; Iwasaki et al., 2007; Gunawardana et al., 2008). To date, the proteins involved in this decapping complex in

PAGE 26

26 Arabidopsis include DCP1, DCP2 and VARICOSE. (Xu et al., 2006) The NMD pathway in Ara bidopsis is still largely uncharacterized however ortholoques of the yeast UPF genes have been identified in Arabidopsis, UPF1 and UPF3 (Hori and Watanabe, 2005; Arciga Reyes et al., 2006). One other decay pathway that is absent in yeast but has been ident ified in animals and plants involves an endonuclease has been well studied in recent years is RNA interference (RNAi) (Hamilton and Baulcombe, 1999; Zamore et al, 2000; Carrington and Ambros, 2003). In this pathway the enodonuclease DICER, cleaves double -s tranded RNA (dsRNA) into 2122nt small interfering RNAs (siRNAs) or hairpin structures into the 19 25 nucleotide (nt) microRNAs (miRNAs) (Hammond et al., 2000; Bernstein et al., 2001; Elbashir et al., 2001; Hamilton et al., 2002; Martinez et al., 2002; Rei nhart et al., 2002; Souret et al., 2004). The resultant siRNAs and miRNAs are incorporated into an RNA induced silencing complex (RISC) (Hammond et al., 2001). The RISC complex identifies and cleaves transcripts at sites complementary to the si/miRNAs. Sub sequent to cleavage the transcript is degraded by an exonuclease and the exosome (Orban and Izaurralde, 2005; Souret et al., 2004; Newbury, 2006). The RNAi pathway has also received significant attention in recent years. Summary Light regulates gene expre ssion at different stages. Until recently work in understanding light regulation of gene expression has focused mainly on transcriptional and post translational mechanisms. It has become clear that across kingdoms that different mechanisms exist to control the efficiency of gene expression and that post transcriptional regulation in plants still needs to be further explored. The above information illustrates that sequences in the 5 and 3 UTR are both necessary for the stabilization/destabilization of tr anscripts. In higher plants, most work to date has been done on 3 stability elements. Relatively little work has focused on 5 UTR

PAGE 27

27 stability elements, although this is not totally impractical as few examples of this mechanism exist. In the case of the L hcb mRNA, the effects of the BHF system and the early genetic elements required for the response on certain Lhcb transcripts have been well characterized. However, the exact mechanism of how BHF light regulates its stability has not yet been elucidated. To aid in the understanding of this possible mechanism, it is also important to identify the proteins that bind to/associate with the 5 -UTR of the Lhcb transcripts. This study begins to illuminate the mechanism that underlies this phenomenon. A simplified overview of the components related to this study are shown in Figure 1 3. This study starts with the signal of blue light, progresses through the receptor to RNA interacting proteins, and eventually shows the effect in an important biological process outsi de of de -etiolation. The work advances previous understanding of this process significantly and identifies new components that mediate light regulated RNA stability.

PAGE 28

28 Table 1 1. Plant nuclear and plastid cis acting RNA (in)stability elements Position S equence Examples Reference(s) Nuclear cis acting elements Aldenylate/ Uridylate rich elements (AREs) 3 UTR AUUA repeats P. vulgaris (Pv)PRP1;O. sativa Amylase3 Cleveland and Yen, 1989; Shyu et al., 1989, Chen and Shyu, 1994 Chan and Yu, 1998 Downstream (DST) element 3 UTR ATAGAT; GTA A. thaliana SAUR AC1 McClure et al., 1989; Newman et al., 1993 Premature stop codons 3 UTR Premature stop codon in itiates non sense mediated decay pathway (NMD) G. maz KTi; P. vulgaris PHA Jofuku et al,, 1989; Voelke et al., 1986; van Hoof and Green, 1996; 1997 Light regulated element (LRE) 5 UTR CAUU P. sativum Fed 1 Dickey et al., 1992; 1998 Blue High Fluence re gulation of transcripts 5 UTR ~64bp of UTR P. sativum Lhcb1*4; A.thaliana Lhcb1*3 Anderson et al., 1999; Folta and Kaufman, 2003 Other 5 UTR 50bp 5 sequence Wheat Em A. thaliana P5R Marcotte et al., 1989Hua et al., 2001 Chloroplast cis acting elemen ts 5 UTR AUUUCCGGAC AUAAGCGUUAGU 12 nucleotides of leader region +UGAGUUG N. tabacum rbcL, atpB and petD Amaranth rbcL C. reinhardtii psbA and rbcL C. reinhardtii atpB C. reinhardtii petD C. reinhardtii psbB C. reinhardtii psbD Shiina et al., 1998; Drager et al., 1998, 1999 McCormac et al., 2001 Salvador et al., 1993; 2004; Anthonisen et al., 2001; Suay et al., 2005 Anthonisen et al., 2001 Sakamoto et al., 1993; 1994; Drager et al., 1998 Vastij et al., 2000 Nickelsen et al., 1999 3 UTR 3 inverted repeats (IR) C. reinhardtii atpB; psaB; petD; rbcL Stern et al., 1991; Drager et al., 1996; Chen et al., 1995; Eibl et al., 1999

PAGE 29

29 Figure 1 1. Arabidopsis dark and light growth phenotypes. Dark-grown Arabidopsis seedlings exhibit etiolated/ skotomorphogenic development characterized by a rapid hypocotyl elongation rate, a tightly closed apical hook and unexpanded cotyledons. Upon exposure to light, Arabidopsis seedlings undergo photomorphorgenic growth/ de etiolat ion, defined by a slowing of hypocotyl growth rate, opening of cotyledons and the onset of chlorophyll accumulation.

PAGE 30

30 Figure 1 2. V isible spectrum and the Arabidopsis light responses. Plants have evolved photoreceptors that allow them to distinguish betw een and respond to varying light environments. The photoreceptors are activated by light generating an intracellular signal that allows for adaptation to the new light environment. The known photoreceptors : the phytochromes, cryptochromes and phototropins are sensitive to light energy at different wavelengths and intensities. Alone and in combination, these light sensors oversee discrete events in gene expression and ultimately growth and development. Figure adapted from Lin (2002).

PAGE 31

31 Figure 1 3. Schemat ic overview of components related to this study. A) The BL system can be separated into the BLF and the BHF systems. B). The phot1 receptor is activated by varying fluences of BL resulting in autophosphorylation of the receptor that may further phosphoryla te an unidentified substrate resulting in various phot1 mediated responses C). One of the phot1 mediated responses is regulation of Lhcb transcript stability. The exact mechanism of how BHF light regulates its stability has not yet been elucidated. To aid in the understanding of this possible mechanism, it is important to identify the proteins that bind to/associate with the 5 -UTR of the Lhcb transcripts. This study starts with the signal of blue light, progresses through the receptor (phot1) to RNA -inter acting proteins, and eventually shows the effect in an important biological process outside of de -etiolation.

PAGE 32

32 CHAPTER 2 ROLE OF LOV DOMAINS IN PHOTOTROPIN1 MEDI ATED RESPONSES Introduction The phototropins (phot1 and phot2) are flavin mononucleotide (FM N) binding, autophosphorylating, blue light activated serine/threonine kinase receptors (Christie et al., 1999; Christie and Briggs, 2001). The responses mediated by phototropins generally may be thought of as aiding in optimizing photosynthesis (Spalding and Folta, 2005). These activities include chloroplast accumulation and avoidance in response to varying light intensities (Jarillo et al, 2001, Kawaga et al. 2001, Sakai et al. 2001), adjustment of stomatal opening (Kinoshita et al., 2001), the first pha se of the rapid inhibition of hypocotyl growth (Folta and Spalding, 2001), phototropic curvature (Liscum et al., 2003) and the blue high fluence mediated destabilization of Lhcb transcripts (Folta and Kaufman, 2003). The roles of phot1 and phot2 partially overlap, but do not completely compensate for each other. For instance, phot1 activities in the etiolated seedling are not affected by phot2, as phot2 is not expressed in the dark-grown seedling (Jarillo et al., 2001; Kawaga et al., 2001; Sakai et al., 2001). The phototropins possess two LOV (for Light, Oxygen, and Voltage) domains, LOV1 and LOV2, in their N terminal region. These LOV domains serve as their site for binding flavin and photon reception. Phototropins also contain a serine/threonine kinase d omain located in the C terminus of the protein, necessary for autophosphorylation. The LOV domains are so named due to similarity to prokaryotic protein domains that serve as sensors of light, periplasmic redox states or voltage (Huala et al., 1997). Thes e proteins are members of the large and diverse Per, ARNT, Sim (PAS) -domain superfamily of proteins that function in sensing changes in light, redox potential, small ligands and overall cell energy (Taylor and Zhulin, 1999 for a detailed review of this superfamily; Swartz et al., 2005). Three

PAGE 33

33 other proteins, FKF1, LKP2 and ZTL, also contain LOV domains. These proteins are essential for the timely progression of the circadian clock and for the proper transition to flowering (Jarillo et al., 2001; Kiyosue an d Wada, 2000; Nelson et al., 2000; Schultz et al., 2001; Somers et al., 2000; Kiba et al., 2007; Kim et al., 2007). Interestingly enough, to date, of all the LOV containing proteins identified, only the phototropins contain two similar LOVs that both bind FMN. LOV Domain Structure and Mode of Action LOV domains are approximately 110 amino acids in length and they all contain the conserved GXNCRFLQ sequence (Cho et al., 2007). Each of these domains has a conserved cysteine residue at the amino acid positio n 39 (Cys39) that has been shown to be essential for photochemical activity. Substitution of this residue with an alanine (Ala) (C39A) or a serine (Ser) (C39S) results in loss of photoreceptor activity (Solomon et al., 2000; Swartz et al., 2001; Kashara et al., 2002; Christie et al., 2002). Under dark conditions FMN is bound to the LOV domains noncovalently. This complex has a maximal absorption at 447nm (LOV447) (Christie et al., 1999) and upon light irradiation has an absorption at 390nm (LOV390) (Salom on et al., 2000). The phototropin LOV domains revert back to their non -covalently bound form (LOV447) upon return to dark conditions (Salomon et al., 2000; Swartz et al., 2001; Kashara et al., 2002). ZTL, LKP2 and FKF1 LOV domains expressed in E. coli disp lay photochemical properties similar to the properties of the LOV domains of phototropin, however unlike phototropin, they fail to revert back to their dark state (Imizumi et al., 2003; Nakasako et al., 2005). Downstream of the LOV2 domain is an helix (J 2003; 2004).

PAGE 34

34 Possible Roles for the Phototropin1 LOV1 Domain Using C39A point mutations, Christie et al. (2002) demonstrated that the activation of the LOV2 domain alone is both necessary and sufficient for phototropic responses (Christie et al., 2002). This study however, was conducted using low fluence rates of unilateral b lue light in a phot1-5 single -mutant background and the role of the LOV domains under high fluence rates of blue light could not be distinguished from those of phot2 (Christie et al., 2002; Cho et al., 2007). To address this limitation Cho et al. (2007) utilized the same C39A point mutation method (Figure 2 1) to install the mutation in phot2, adding all of these LOV -mutagenized receptors back into a phot1phot2 double mutant background (Cho et al., 2007). Use of the phot1phot2 double mutant background all owed them to study the roles of the phot1 LOV domains even under blue high-fluence conditions without activation of phot2. In this study, the authors tested the physiological roles of the phototropin1 and 2 LOV domains in relation to phototropic curvature and leaf expansion. The authors demonstrated that LOV2, and not LOV1, is sufficient for hypocotyl phototropism in response to unilateral BLF light and plays a key role in phototropism and leaf expansion (Cho et al., 2007). Researchers in this field can now use these same genetic tools to identify the necessary LOV domain in other phototropin-mediated responses. With recent findings indicating that the LOV2 domain is necessary for phototropin responses, at least in relation to phototropic curvature and lea f expansion, the evolutionary significance of the two adjacent LOV domains remains unanswered. To date, the role of the LOV1 domain is still unknown (Briggs, 2007). Several roles have been suggested. Kawaga et al., 2004 proposed that the LOV1 might function as a tool for prolonging phototropin receptor activation. Salomon et al., 2004 suggested that the LOV1 domain might function as a site for phot1 dimerization.

PAGE 35

35 Division of Mechanisms The phot1 and phot2 receptors are different in many ways. They are dif ferentially expressed, have remarkably different downstream intracellular responses, and regulate different physiological activities with only partial overlap. The two receptors also have different interaction partners, as phot1, but not phot2, depends on the activity of NPH3, a protein of elusive function. Furthermore, various responses are NPH3 dependent (Figure 2 2). Phototropism requires NPH3 activity (Motchulski and Liscum, 1999) whereas early stem growth inhibition does not (Folta and Spalding, 200 1). These findings all indicate that phototropin signaling branchpoints may be many (Figure 2 2) en route to generating relevant physiological outcomes. What about intramolecular regulatory mechanisms? The phototropin receptor is not just toggled on or o ff. Instead, phototropin responses respond to light at thresholds spanning eight orders of magnitude, with first positive phototropic curvature initiated after 104 2 (Iino, 1988; Kunzelmann et al., 1988; Konjevic et al., 1989; Janoudi and Poff., 1990) and blue high fluence destabilization requiring >1042. The presence of the second LOV domain, existing without functional definition, presents the compe lling hypothesis that LOV2 is a switch, and LOV1 is a modulator. Analyzing a series of phototropin -mediated responses in LOV domain mutants can test this hypothesis. Aim of This Study Given the lack in our knowledge about the role of the phototropin1 LOV 1 domain, in this chapter we use the LOV genotypes described by Cho et al (2007) (Figure 2 -1) to study the roles of each LOV domain in relation to the rapid inhibition of early stem elongation (Folta and Spalding, 2001). Phototropin1 also mediates the Blu e high -fluence mediated destabilization of

PAGE 36

36 Lhcb transcripts (Folta and Kaufman, 2003) and this response will be tested in the various phot1 LOV domain seedlings. Results Blue High -Fluence Mediated Lhcb Transcript Destabilization Blue light regulates the a ccumulation of Lhcb transcript levels in a fluence dependent manner, with the BHF system destabilizing these transcripts (Anderson et al., 1999). The phototropin1 receptor and its associated scaffolding protein NPH3 are required for this response, while ot her loci required for phototropism are dispensable (Folta and Kaufman, 2003). Other findings have shown that a series of phot -mediated responses are NPH3 independent. When considered together the sum of phot responses only share a common receptor and the impetus of blue light. The downstream actions of the system diverge quickly and manifest in distinct ways. Is it possible that signal bifurcation begins at the level of the receptor itself? The BHF regulated destabilization and the rapid primary stem g rowth inhibition response are excellent opportunities to test this possibility. In both cases, the dependence on specific phot1 LOV domains has not yet been determined. To test the role of the individual LOV domains in mediating this response a set of se edlings with constructs representing wild type phot1, phot1 without the LOV1 domain ( -LOV1), without the LOV2 domain ( -LOV2) and without both LOV domains ( -LOV1 LOV2) were used (Figure 2 1, Cho et al., 2007). Six-day -old etiolated phot1 wild type, LOV1, LOV2 and LOV1 LOV2 mutant seedlings were given no light treatment, BLF or BHF light. LOV1 mutant seedlings failed to destabilize Lhcb transcripts under BHF irradiation (Figure 2 3). These results indicate that the phototropin LOV1 domain is necessary fo r the BHF mediated destabilization of Lhcb transcripts. When the phototropin LOV1 domain is mutated, Lhcb transcripts continue to increase even after irradiation with BHF light. The wild type response to BHF light was observed when the full -length phototr opin1 protein was

PAGE 37

37 complemented into the double mutant background. This wild type response was also observed when the LOV2 domain was mutated. These results indicate that the LOV2 domain alone is not sufficient to impart the BHF mediated transcript destabi lization; however the LOV1 domain is (Figure 2 3). Blue -Light Mediated Rapid Inhibition of Hypocotyl Elongation Phototropins are responsible for mediating the first phase of light -mediated inhibition of hypocotyl growth (Folta and Spalding, 2001). In aim of further attributing this response to a specific LOV domain, LOV domain mutant seedlings ( LOV, -LOV2, LOV1 LOV2) were assayed against wild type and phot1phot2 mutant seedlings for their growth kinetics as they transitioned from growth in dark (D) to g rowth in blue light (BL). The rapid inhibition response demonstrated in wild type seedlings and the lack of this response as seen in phot1phot2 mutants, are similar to those characterized and published by Folta and Spalding, 2001 (Figure 2 4). The results of the individual LOV domains shown in Figure 2 5 indicate that neither of these mutants was able to complement the wild type response of inhibition of growth rate upon blue -light irradition. Discussion The phototropins (phot1 and phot2) act in concert t o mediate processes such as chloroplast accumulation in response to varying light intensities (Jarillo et al, 2001, Kawaga et al. 2001, Sakai et al. 2001), stomatal opening (Kinoshita et al., 2001), and phototropic curvature (Liscum et al., 2003). However, phototropin1 alone mediates the BHF destabilization of Lhcb transcripts (Folta and Kaufman, 2003) and the first phase of light -mediated inhibition of hypocotyl growth (Folta and Spalding, 2001). The sole requirement for phototropin1 is observed in etiola ted seedling development where phot2 is not detectable. Furthermore, phot receptors are the first step in complicated strings of signal integration that diverge quickly after the receptor. The goal

PAGE 38

38 of this study was to test if the infrastructure of the p hot1 receptor influenced downstream events. To date, there is no described role for the LOV1 domain, a portion of the receptor with topological similarity to LOV2, the domain required for phototropic responses (Christie et al., 2002). With the aid of genetic tools, the phototropin -mediated responses have been well characterized; however it remained unclear as to the roles of the individual LOV domains in mediating these responses. A conserved cysteine residue at amino acid position 39 has been identified in all known Arabidopsis LOV domain -containing proteins. This cysteine is necessary for binding the chromophore FMN. Mutation of this cysteine residue to a serine (C39S) or alanine (C39A) results in failure of the protein to bind FMN and a loss of photot ropic responses. (Solomon et al., 2000; Swartz et al., 2001; Kashara et al., 2002; Christie et al., 2002). To begin to understand the role of the individual LOV domains, Christie et al. ( 2002) utilized C39A mutations in the individual LOV domains of phot1 and demonstrated that the phot1 LOV2 domain alone was required for phototropic curvature. These studies were conducted using phot1 single mutants. It has been demonstrated through phot1phot2 double mutants that phot1 and phot2 exhibit partially redundant f unction (Kinoshita et al., 2001), and phot2 is frequently sufficient to mediate responses to high intensity blue light (Takemiya et al., 2005, Sakai et al., 2001). With this in mind, the work done by Christie et al. ( 2002) fell short of discerning the phot 1 LOV specific roles under blue high fluence conditions, as the phot2 protein was still functional. Recently, Cho et al. ( 2007) expanded on the work reported by Christie et al. ( 2002) and studied the phototropic curvature and leaf expansion responses using the same idea of LOV domain C39A point mutation, however, experiments conducted by Cho et al., were done in a phot1phot2 double mutant background, eliminating any responses that may be a result of

PAGE 39

39 overlapping phototropin responses. Using these genetic tools they were able to confirm the results published in 2002, by demonstrating that LOV2 domain is required for phototropic curvature. In addition to this, they were also able to show that LOV2 was required for leaf expansion. At this point, the roles of the LOV domains in other phototropin-mediated responses were still unknown. In the present study the suite of tools developed by Cho et al (2007) were applied to two other phot -mediated responses BHF transcript destabilization and primary hypocotyl growth inhibition. These phot -mediated responses are important to study for several reasons. First, they both occur in etiolated seedlings rapidly and after a short light treatment. Therefore these are early and immediate responses that are free from other simu ltaneous developmental influences. These responses also are independent of the influence of phot2, making their interpretations much more meaningful. The results suggest that the LOV1 domain is required for this response. This is the first time that a ro le has been identified for the LOV1 domain in higher plants. One explanation may be that phot1 LOV1 is required for high fluence responses and hence may only be activated under such conditions. The phot1 LOV2 domain is activated upon light activation (even at low fluences), thereby acting as a switch that turns on phototropin autophosphorylation via the kinase domain. Consistent with the data presented here as in the wild type phot1 construct, both LOV domains are intact and the BHF mediated destabilization of Lhcb response is observed. When the LOV1 domain alone is mutated, LOV2 alone fails to destabilize Lhcb transcripts; however transcripts accumulate normally under BLF light. When the LOV2 domain alone is mutated, LOV1 is still able to show the wild type response of transcript destabilization. Kawaga et al. ( 2004) hypothesized that the LOV1 domain may be necessary for prolonging the lifetime of phototropin receptor activation. From the results shown here, this hypothesis can be

PAGE 40

40 amended slightly in that t he LOV1 domain may function in modulating phot1 responses to accommodate and increase in photons under high fluence conditions. It is possible that a photochemical threshold must be met over a short time frame before LOV1 is capable of forming the intra or intermolecular interactions that permit BHF -mediated transcript destabilization. To our knowledge this is the only report where a relatively large amount of blue photons are delivered to an etiolated seedling, and perhaps these conditions unveil the ac tivity of the LOV1 domain. An alternative interpretation is that the LOV1 domain facilitates interactions with downstream effectors specific to the BHF response (like KFR1; Chapter 3). However, this viewpoint is not likely because LOV1 must be performing some light -sensing function in the absence of LOV2. When the phot1 mediated rapid inhibition of hypocotyl elongation response was addressed in these mutants, the results were unclear. In all cases these constructs were unable to complement the wild type phototropin response in the phot1phot2 double mutant background. Figure 2 5 shows that in all cases the introduced constructs behave roughly as phot mutants, and cannot drive this immediate and easily detectable response. The same constructs clearly func tion well in controlling leaf expansion and phototropic curvature (Cho et al, 2007). However, when Cho et al. assayed the protein levels, they found that the expression of phot1 from a 35S promoter was consistently lower than that present from its native promoter. The reason for this is unclear. Specific constructs were especially affected. For example, those expressing LOV1 alone were low, and so involvement of the LOV1 domain in this response is still possible, and may indicate the need for adequate amo unts of the receptor protein to initiate the response. An observation made by Cho et al., that the LOV1 domain of phot2 could partially show the

PAGE 41

41 phototropic response and elicits a low level of autophosphorylation (Christie et al., 2002; Cho et al., 2007). Studies in phot2 are typically conducted under higher fluence rates of light; characteristic of what is needed for phot2 activation. With this in mind, it again shows that the LOV1 domain is required for high fluence responses at a threshold higher than th at needed to activate LOV2. The discrepancy in phot1 LOV protein accumulation may also underlie the lack of the BHF response in a LOV1 mutant. It is possible that the protein is expressed at an exceedingly low level and cannot generate sufficient signal to initiate the BHF -mediated transcript destabilization. This more mundane possibility is not testable with the current suite of tools and indicates that additional constructs using the native phot promoters may be useful. Although no clear result was ob tained from the studies of the rapid inhibition of stem elongation, studies done here have identified a role for the phot1 LOV1 domain in mediating the BHF regulation of Lhcb transcript stability. In comparing the two results together it is apparent that p rimary growth inhibition likely has a mandate for a specific amount of receptor, whereas BHF mediated transcript destabilization does not. Again, these two examples demonstrate the bifurcations that permit a single receptor to mediate a wide set of photophysiolgical responses to light intensities delivered over eight orders of magnitude. The results also indicate a role for LOV1 that is not easily reconciled, as LOV1 is functioning in the absence of LOV2. The function of LOV1 has not been observed, and phot function, both biologically and spectroscopically, has been shown to require LOV2 and LOV2 alone. These results indicate that there is more to learn about the phot receptor and that specific biological context and environmental interactions may present new modalities of light sensing and transduction via this well established light sensing system.

PAGE 42

42 Materials and Methods Plant Constructs The seeds used in these experiments were gifts from Winslow Briggs (Carnegie Institution of Washington, Stanford, CA). Th e constructs are as described by Cho et al., 2007. Briefly, 35S:: PHOT1 and 35S:: PHOT2 constructs were transformed into the phot1-5phot2-1 (nph15cav1 1 ) double mutant background with Agrobacterium (strain GV3101) using floral dipping. Transformants were se 1 of kanamyacin. Homozygous T3 and T4 seeds were used in these experiments. Measurement of Hypocotyl Growth Hypocotyl growth measurement was conducted as described by Folta and Spalding, 2001. Seeds were placed on media c ontaining 1mM potassium chloride (KCl), 1mM calcium chloride (CaCl2); 1% Difco agar and placed in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given 1 2 h white light to stimulate germination and transferred to dark co nditions in a 23C chamber for 3650 h. Individual seedlings with hypocotyls measuring approximately 2 3 mm were transferred a separate 1% phytoagar plate oriented vertically and perpendicular to the lens of a CCD camera (EDC1000N; Electrim Corp., Princeton, NJ, USA) using a close focus lens (K52 274; Edmund Scientific, Barrington, NJ, USA). As described by Parks and Spalding, 1999, a non-photomorphogenic infrared light source was placed behind the seedlings to allow visualization of seedlings during the da rk period. Digital images were obtained at 5 min intervals for 1 h in the dark, and at 5 min intervals for 2 h with BL illumination at a fluence rate of 75mol m2 s1. A custom software application written in the LabView environment (National Instruments, Austin, TX, USA) calculated growth rate data from the series of digital images.

PAGE 43

43 Blue Light Mediated Regulation of Transcript Stability Experiments Sterilization of seeds was performed as described by Folta and Kaufmann, 1999. For each sample, 100l of A. thaliana seeds were used. Seeds were surface sterilized with 50% (v/v) commercial bleach for 15 min and rinsed 5 times with sterile water. Surface sterilized seeds were then resuspended in 0.5x Murashige and Skoog (MS) media (0.5x MS, 1.75g/LMES, pH 5.8) w ith 0.8% phytoagar. This suspension was then plated onto 0.5x MS media with 1% phytoagar and placed in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given a treatment of white light for 2 h to stimulate germination, and transferred to dark conditions in a 23C chamber for 6 d. Six-day -old, dark grown Arabidopsis thaliana seedlings were given no light (Dark; D), or a pulse of Blue Low Fluence (BLF; <104 mol m2) or Blue High Fluence (BHF; >105 mol m2) light. Tissue was harvested 2 h later in liquid nitrogen and RNA was isolated and analyzed via northern blotting. RNA Extraction and Northern Analysis Total RNA extractions were performed using the RNeasy kit (Qiagen). The concentration of the samples was determined using spectrophotometry. RNA samples were denatured in a formamide buffer (66% v/v Formamide, 8% v/v Formaldehyde, 1x MOPS at 65C for 15 min) and were loaded onto an agarose gel containing formaldehyde (1x MOPS, 6% formaldehyde, 1.75 % agarose). Even loading wa s confirmed on the gel by ethidium staining. RNA was then transferred onto GeneScreen Plus Hybridization Transfer Membrane (PelkinElmer) using standard blotting procedures with standard sodium citrate buffers (10x SSC; 1.5M NaCl, 0.15M sodium citrate). RNA was linked to the membrane via UV crosslinking. Lhcb probes were generated by PCR using the following primers: 5 -ATGGCCGCCTCAACAATGGC 3 and 5 CCGGGAACAAAGTTGGTGGC 3 against Arabidopsis genomic DNA. 18S was used as a probe for normalization; generated by a Hin dIII digestion of the pHA2 plasmid. pHA2 is a

PAGE 44

44 derivative of the pHA1 plasmid inserted into pBR322. pHA1 that contains a fragment of pea nuclear DNA including genes for 18S and 25S rRNA (Spiller et al., 1987; Glick et al., 1986; Jorgensen et al., 1 982). Hybridization was performed at 62C overnight in Church Buffer (10% (w/v) bovine serum albumin, 1mM EDTA, 0.5M phosphate buffer; 7% (w/v) SDS; Church and Gilbert, 1984). Blots were washed sequentially in 1x SSC, 0.1% SDS twice (once at room tempera ture and once at 65C) and 0.1x SSC, 0.1% SDS once at 65C. Signals were then visualized by autoradiography.

PAGE 45

45 Figure 2 1. Constructs used to assess the role of the individual LOV domains. Each construct was in a phot1phot2 double mutant background. pho t1 WT contains the wild type phot1; LOV1 is a C39A mutation in the LOV1 domain; LOV2 is a C39A mutation in the LOV2 domain; LOV1 LOV2 contains C39A mutations in both the LOV1 and LOV2 domains. Ser/Thr Kinase, the Serine of Threonine kinase domain. Figure adapted from Cho et al., 2007.

PAGE 46

46 Figure 2 2. Phototropin signaling branchpoints The phototropin1 and 2 mediated responses can be divided based on the fluence rates of blue light. Phot1 mediated responses can further be divided into two categories: NP H3 independent and NPH3 -dependent. The role of the individual LOV domains is currently unknown for the phot -mediated responses.

PAGE 47

47 Figure 2 3. Blue high f luence mediated Lhcb transcript destabilization. Northern blot probed with Lhcb Graph represents relative transcript levels normalized to rRNA. Six -d -old dark grown seedlings were irradiated with BLF or BHF light, or a control with no light (dark).

PAGE 48

48 Figure 2 4. Rapid inhibition of hypocotyl elongation. Seedling growth rate w as monitored in dark for 1 h before a blue light source was turned on (time 0, blue arrow) and growth rate was measured for 2 h after. (A) Wild type and phot1phot2 seedling growth was measured as an experimental control of Figure 2 5. Results in (A) are si milar to those reported by Folta and Spalding (2001). (B) Figure from Folta and Spalding (2001), used with permission.

PAGE 49

49 Figure 2 5. Rapid inhibition of hypocotyl elongation. Seedling growth rate was monitored in dark for 1 h before a blue light source w as turned on (time 0, blue arrow) and growth rate was measured for 2 h after. Results were compared to Wild type and phot1phot2 seedling growth. (A) phot1 WT; (B) LOV2; (C) LOV1; and (D) NO LOV domain.

PAGE 50

50 CHAPTER 3 IDENTIFICATION OF PROTEINS THAT BIND THE L HCB 5UTR. Introduction Blue light uses two separate and antagonistic signal transduction systems that regulate the steady -state accumulation of Lhcb transcripts. The BLF system induces Lhcb transcript level accumulation and the BHF system destabilizes the se transcripts (Anderson et al., 1999). Certain members of pea and Arabidopsis Lhcb transcripts are regulated by BL (White et al., 1995, Tilghman et al., 1997; Gao and Kaufman, 1994). In pea, PsLhcb1*1 and PsLhcb1*4 are BL regulated (White et al., 1995, Ti lghman et al., 1997) and in Arabidopsis only AtLhcb1*3 is BL regulated (Gao and Kaufman, 1994). Sequences in the pea Lhcb 5 -UTR have been shown to be both necessary and sufficient for the Lhcb BHF destabilization process (Anderson et al., 1999). Tilghman et al. ( 1997) demonstrated that the pea Lhcb1*3 promoter could be faithfully expressed in Arabidopsis using the PsLhcb1*4 promoter and through deletions in the promoter, Folta and Kaufman (1999) were able to identify sequences necessary for the BLF inducti on (between 95 and 75 plus the TATA motif). There are limited examples in the plant and animal literature where stability elements reside in the 5 -UTR. Therefore, analysis of the transcript destabilization mechanism would describe the regulation of an L hcb family member and at the same time enrich the understanding of sequence elements and associated mechanisms that regulate transcript stability. To further understand the mechanism that regulates Lhcb transcript stability via the BHF system, an in vivo screen designed to detect protein -mRNA interaction was utilized. This assay, the yeast three -hybrid system, is used to screen libraries for proteins that interact directly with RNA, using reporters identical to those used in the yeast two-hybrid system t hat detect protein protein interactions (SenGupta et al., 1996). The general assay is diagrammed in Figure 3 1.

PAGE 51

51 Like the yeast two -hybrid system, the three hybrid system uses a DNA binding domain to anchor a bait protein adjacent to regulatory regions u pstream of a reporter gene. The reporter usually is a biosynthetic enzyme that can complement a deficient yeast genotype on media supplementing amino acids required for auxotropic growth, except the one of interest (dropout media), permitting growth. The difference is that in the three -hybrid system this DNA binding domain is fused to an RNA binding domain from the MS2 virus (RNA binding domain 1). This bait construct is present as a stable chromosomal integration in the yeast background. A second hybrid protein is introduced on a plasmid, either as a candidate for RNA interaction or as a plasmid from a library that is being screened for interacting proteins. This protein is a fusion between the introduced protein and a transcriptional activation domain. A third plasmid harboring the RNA target is transformed into the yeast. The RNA target is a fusion between the putative interacting RNA and viral MS2 RNA. The MS2 RNA will interact with the MS2 protein -DNA binding domain, presenting an RNA target for int eraction with candidate proteins. Interaction between a candidate protein and the target RNA binding domains induces an auxotropic marker that allows growth on dropout media (Figure 3 1; SenGupta et al., 1996). Using this system, discrete interactions between a target RNA and specific protein interactors may be identified. Yeast three hybrid-based screens have been has led to the identification of a suite of RNA -binding proteins (Bernstein et al., 2002). For example, the RNA -protein interaction between the C. elegans sex determination regulatory protein GLD 1 that regulated the tra -2 RNA via TGE ( tra -2 and Gli element) sequences in its 3 -UTR (Jan et al., 1999). This screen has also been used to identify RNAs that bind a bait protein, by identifying specifi c RNA sequences that bind PUF. PUF proteins are important RNA regulatory proteins found in Drosophila and C. elegans (Stumpf et al., 2008). In the screen of Arabidopsis cDNA libraries conducted in this

PAGE 52

52 study, one of the proteins identified is a novel F -b ox protein that has been designated KFR1 for K elch domain, F -box R NA associated1. A brief introduction of F box proteins is described below. SCF Complex and the UbiquitinProteosome Pathway The ubiquitinproteasome pathway is a well studied proteolytic sy stem present in all eukaryotic organisms in which ubiquitin (Ub), a 76 amino acid peptide, is used as a means to label target proteins destined for degradation via the 26S proteasome (Smalle and Vierstra, 2004; Chen et al., 2006). The 26S ubiquitinprotea some pathaway is a highly conserved and regulated pathway (Pickart, 2001; Smalle and Vierstra, 2004; Chen et al, 2006) that recognizes and tags proteins to be degraded via the 26S proteasome. This ubiquitin tagging machinery consists of three enzymes: th e ubiquitin activating enzyme (E1), the ubiquitin-conjugating enzyme (E2) and the ubiquitin -protein ligase (E3) (Chen et al., 2006; Gagne et al., 2002; Hellmann and Estelle, 2002). E3s are necessary for substrate recognition and specificity. The family of E3 ubiquitin ligases can be divided into those containing HECT domains or a RING/U -box domain and are reviewed in detail by Moon et al. ( 2004). Among the RING/U -box domain E3s is the multisubunit SKP1 CUL1 -F box (SCF) complex. The SCF complex consists of SUPPRESSOR OF KINETICHORE PROTEIN 1 ( S KP1/ASK), Cullin 1 ( C UL1), RING -BOX 1 (RBX1)/REGULATOR OF CULLINS 1 (ROC1) and an F -box protein, and represent the best characterized family of E3s in plants (Moon et al., 2004; Petroski and Deshaies, 2005; Lechner et al., 2006). The SCF complex has been shown to be a central regulator of many cellular processes including but certainly not limited to responses to auxin (Gray et al., 2001; Kepinski and Leyser, 2005), gibberellins (McGinnis et al., 2003; Dill et al., 2004; Strader et al., 2004), brassinolides (He et al., 2002), pathogens (Aronson 2000, Pazhouhandeh et al., 2006) and cold (Calderon -Villalobos et al., 2006).

PAGE 53

53 F -box Proteins As part of the SCF complex, the F -box proteins (Bai et al., 1996) define the specifi city of the regulated covalent tagging machinery. F -box proteins contain a degenerate ~60 amino acid N terminus, called the F -box (Gagne et al., 2002), and this N terminus interacts with the SKP component of the complex. The F box C -terminus contains the protein -protein interaction domain necessary for recognition of its specific target protein. The Arabidopsis genome is estimated to have approximately 700 F -box proteins (Gagne et al, 2002), out of an estimated total of ~1300 E3 ligases (Smalle and Vierstr a, 2004). Regulation of Plant Development by F -box Proteins As stated previously, F -box proteins and their associated SCF complexes have important roles in plant growth and development and a number of these proteins have been identified and are associated with a diverse set of responses which include hormone signaling, self incompatibility (Sijacic et al., 2004; Qiao et al., 2004) floral development (Samach et al., 1999; Ni et al., 2004) flowering time and circadian rhythms (Somers et al., 2000; Imaizumi et al., 2003; Mas et al., 2003; Somers et al., 2004; Imaizumi et al., 2005) and light signaling (Dieterle et al., 2001; Harmon and Kay, 2003; Marrocco et al., 2006) A few examples are mentioned here. F -box proteins involved in hormone signaling. The F box p rotein TIR1 (TRANSPORT INHIBITOR RESPONSE 1) is the auxin receptor that upon binding auxin signals the degradation of the AUX/IAA proteins, negative regulators of auxin induced gene expression (Gray et al., 2001; Dharmasiri et al., 2005; Kepinski and Leyse r, 2005). The F -box protein COI1 (CORONATINE INSENSITIVE1) has a role in directing degradation of factors relevant to jasmonate signaling (Xie et a., 1998; Xu et al., 2002). In ethylene sensing EBF1/EBF2 (EIN3 BINDING F BOX PROTEIN 1 and 2, respectively) target the transcriptional activator EIN3 (ETHYLENE INSENSITIVE 3) for degradation upon

PAGE 54

54 perception of ethylene (Guo and Ecker, 2003; Potuschak et al., 2003; Gagne et al., 2004). In gibberrellin (GA) signaling several F -box proteins have been identified. S LY1 (SLEEPY1), SNE (SNEEZY) (McGinnis et al., 2003; Dill et al., 2004; Strader et al., 2004) and GID2 (GIBBERRELLIN INSENSITIVE DWARF 2) (Sasaki et al., 2003) target DELLA proteins that are negative regulators of the GA response (Lechner et al., 2006). In all of these cases specific negative or positive regulators of hormone response are recognized via the F -box component of the SCF complex leading to their regulated degradation. F -box proteins involved in light responses F box proteins have also been ide ntified in controlling flowering time and circadian rhythms. These are ZEITLUPE/ADAGIO (ZTL/ADO) (Somers et al., 2000; Jarillo et al., 2001); LOV KELCH PROTEIN2 (LKP2) (Schultz et al., 2001) and FLAVIN BINDING KELCH REPEAT F BOX1 (FKF1) (Nelson et al., 2000). ZTL mediates ubiquitination and proteasomal degradation of TOC1 (TIMING OF CAB EXPRESSION 1), a component of the circadian oscillator (Somers et al., 2000; Mas et al., 2003; Somers et al., 2004; Han et al., 2004). FKF1 mediates the degradation of, CDF1 (CYCLING DOF FACTOR 1) a CONSTANS (CO) repressor (Imaizumi et al., 2005). Two F -box proteins have been associated with phytochrome A light signaling: EID1 (EMPFINDLICHER IM DUNKELROTEN LICHT), a negative regulator of phytochrome A signaling (Dieterle et a l., 2001; Marrocco et al., 2006) and AFR (ATTENUATED FAR -RED RESPONSE) (Harmon and Kay, 2003). AFR is thought to target a repressor of phytochrome A signaling (Harmon and Kay, 2003). Here also, the F box proteins serve as the adaptor between the target pr otein and the ubiquitination machinery, serving to control the abundance of critical regulatory proteins.

PAGE 55

55 Results To identify Lhcb 5 -UTR binding proteins, the yeast three -hybrid assay was utilized (SenGupta et al., 1996). Using the pea Lhcb 5 -UTR as bait proteins were identified that specifically recognize a sequence element or a secondary structure in the PsLhcb 5 -UTR. These proteins could also recognize potentially present protein complexes that interact/form on the 5 UTR that are resident to yeast. Over 100 putative candidates were identified in similar screens and eliminated from consideration due to self or RNA -independent activation (K. Folta, unpublished). A set of candidates that passed initial analysis is listed in Table 3 1. The list compri ses an assorted set of proteins, some with known biological functions and others uncharacterized (or loosely characterized based on homology and not experimental validation). Since this three -hybrid system is based on physical interactions of proteins to the RNA in yeast, it becomes necessary to carefully validate candidate interactors to ensure bona fide protein -RNA associations. To direct the interpretation of the results obtained from these experiments, a well characterized RNA -protein interaction was us ed as a positive control. This interaction is the binding of the iron regulatory protein 1 (IRP1, also known as the IRE binding protein, IRE BP) to the iron response element (IRE) found in the 5 -UTR of ferritin mRNA. Interaction between the IRE and IRP1 has been well documented in relation to iron metabolism, with the IRE being a stem loop UTR structure that binds to IRP1 (Klausner et al., 1993; Hentze and Kuhn 1996; SenGupta et al., 1996; and recently reviewed by Muckenthaler et al., 2008). In addition t o the IRE IRP positive control, a yeast strain containing only the bait RNA L40coat MS2 2 -UTR (PsLhcb 5UTR alone) and/or YBZ 1 IRE (IRE alone) was used to determine if the RNA bait was capable of self activating the reporter genes, indicating a false -posi tive response.

PAGE 56

56 Strength of interactions assays In the yeast three hybrid system, analysis of the HIS3 and LacZ reporter gene activity can be used as a quantitative means to assess the strength of interaction between the bait RNA and the interacting protei n. Several assays exist that utilize the biochemistry of these reporter genes and allow for easy detection. In this study, HIS3 reporter gene activity was studied using varying concentrations of 3 -Amino 1, 2, 4 triazole (3 -AT). LacZ reporter gene activity was assayed by galactosidase activity. Here, these assays are described in more detail and the results of these assays are reported. Strength of interaction assay using 3 Amino -1, 2, 4-triazole (3 AT) 3 -Amino 1, 2, 4 triazole (3 -AT) is a competitive inhibitor of His3p, the HIS3 gene product. Therefore, stronger RNA -protein interactions (yielding higher levels of His3p) are able to survive on higher concentrations of 3 -A T (Bernstein et al., 2002; Hook et al., 2005). The more compelling candidates are those that associate strongly and specifically with the Lhcb transcript, so this test is important in the assessment of putative positive interactors. The results from this screen are illustrated in Figure 3 2. One of the proteins, annotated as a putative Arabidopsis PREFOLDIN (At1g29990), was unable to grow on media containing low levels of 3 -AT (1mM). Several proteins survived on extremely high levels of 3 -AT (100mM), indi cating strong interactions. These include Arabidopsis P450 Reductase 2 (ATR2) protein (At4g30210); Tonoplast intrinsic protein (TIP1) (At2g36830), and the Threonine Aldolase (THA1) protein (At1g08630). The IRE IRP positive control was used as a compleme ntary reference in comparing strengths of interaction to a known interaction and the UTR alone negative control

PAGE 57

57 was used to demonstrate that the RNA plasmid alone was not sufficient to confer resistance to 3 AT. -g -gal) activity To confirm and complement the 3 -AT assays, strength of interaction assays were also -gal, encoded by the LacZ reporter gene is an enzyme that cleaves lactos e into glucose and galactose. In molecular biology, -gal activity in vitro Two lactose analogues were used in this assay. The first is the X -gal filter assay that uses 5 -bromo 4 -chloro indolyl -D galactoside (X -gal, X -gal is cleaved to yielding a blue product. Therefore using this substrate, colonies representing RNA -protein interactions expressing the LacZ reporter gene will turn blue (Figure 3 3). The other assay u sed is the liquid assay that utilizes another lactose analog, Ortho Nitrophenyl gal producing orthonitrophenol and galactose. It is the yellow color of orthonitrophenol that is measured spectrometrically and is a -gal activity than blue staining from X -gal, which represents only positive or no interaction. The X -gal filter assay is more sensitive than the ONPG liquid assay; however the former gives only qualitative results and the l atter more quantitative results. Therefore, together they provide useful, complementary information. In both assays, THA1, the RNA recognition motif protein (RRM), TIP1, and ATR2 were the strongest interactions, yielding a deep blue color (within 30 min) i n the filter assays (Figure 3 3) and exhibiting high activity in the liquid assays (Figure 3 4). These interactions were yielded results comparable to the positive IRE -IRP control.

PAGE 58

58 RNA Specificity Two types of additional false positives could occur. The first type would be RNA dependent false positive, classified as proteins that bind any RNA sequence, as designated by binding to the IRE control as well as the Lhcb UTR. The second type of false positives would be RNA -independent false positives, prote ins that activate the reporter gene in the absence of the RNA. Both of these possibilities are addressed here. Is RNA necessary for activation of the reporter gene? Because a variety of proteins were recovered in this yeast three hybrid assay, it is impor tant to determine if the proteins were self activating or if the Lhcb 5 -UTR RNA was necessary for activation of the reporter gene. This is accomplished using the drug 5 -fluoroorotic acid (5 FOA). In yeast cells expressing the URA3 gene, 5 -FOA is toxic. Th e hybrid RNA in the yeast three hybrid screen is on a plasmid that contains the URA3 plasmid, so it is possible to counterselect for colonies cured of the target RNA using negative selection on media containing uracil and 5 -FOA. 5 FOA is toxic to cells con taining the URA3 gene product however they can grow since uracil is provided through the media. These colonies (cured of the RNA plasmid) are then patched on media lacking uracil to confirm loss of the RNA -containing vector. Cured colonies are then grown on HIS media to assess activation of the HIS reporter in the absence of the RNA. Colonies that grow are considered to be RNA -independent, not requiring the URA3 plasmid (or the encoded RNA) to activate the HIS3 reporter gene. These are eliminated from co nsideration. After treatment with 5 -FOA, the results show that all of the candidates in Table 3 1 require the RNA plasmid activate the HIS3 reporter gene. After growing on media containing 5 -FOA with uracil supplemented, colonies were streaked on media la cking uracil and failed to grow

PAGE 59

59 (Figure 3 5). As controls, yeast representing each RNA protein interaction containing the RNA plasmid was grown alongside each cured one, to further demonstrate that the inability of the cured yeast to grow was due to the RN A plasmid. Specificity of RNA: Do these proteins bind RNA indiscriminently? Given that all the proteins identified require the RNA plasmid in order to grow on selective media, a test to ascertain the specificity of RNA interaction was performed. Some of the candidates would likely bind any RNA target, and while still potentially good candidates; these are not as inherently interesting as those that associated exclusively with the Lhcb UTR. In the aim of differentiating proteins that bind the PsLhcb 5 -UTR specifically from those proteins that bind RNA promiscuously, YBZ 1 IRE yeast cells were transformed with plasmids encoding the candidates shown in Table 3 1. Results from this assay are shown in Figure 36. These results show that three proteins, TIP1, BSD2 -familiy related and LHCB4 interact with the IRE. Interaction was confirmed using the X -gal filter assay. Three independent colonies were assayed, producing identical results. Because their interaction with IRE indicates that these proteins may not di scriminate on which RNA to bind, these proteins could be excluded from the list of specific Lhcb 5 -UTR interacting proteins. KFR1, Kelch domain, F -box RNA associated1. One of the proteins identified in this screen is a novel F box protein, that has been designated KFR1 for K elch -domain, F box R NA associated1. The closest identical F box protein is another novel Kelchrepeat containing F -box protein (At1g15670) that is similar in sequence to KFR1 (72% identical) and has been designated KFR2 It is clear that F -box proteins play a key role in many processes involved in the regulation of plant development. The central hypothesis to be tested for the remainder of this chapter is that KFR1, an uncharacterized F -box,

PAGE 60

60 Kelch domain protein, regulates blue light m ediated changes in Lhcb transcript stability. To test this hypothesis, a series of genetic, biochemical and pharmacological tools will be utilized to better understand the role of KFR1. Identification of kfr1 mutants from T -DNA insertion pools T DNA inser tion lines for the AT1g80440 gene were identified in the Salk SIGNAL collection and obtained via the ABRC. Two independent alleles of this gene (Salk_008497; kfr 1 1 and Salk_129095; kfr1 -2 ) were brought to homozygosity using standard PCR -based techniques (Figure 3 7). Briefly, primers are designed against the KFR1 gene flanking the T DNA insertion site. These are used to identify the non-disrupted wild type condition or used in concert with T -DNA resident primers to amplify a product indicative of gene dis ruption. Assays with either set of primers allow homozygous mutant, heterozygous, and homozygous wildtype plants to be accurately genotyped. T he novel gene was designated Kfr1: K elch repeats, F -box R NA associated 1. Testing the kfr1 mutants for the BHF d estabilization response Blue light regulates the Lhcb transcripts in a fluence dependent manner, where these transcripts accumulate after a BLF pulse and are rapidly destabilized by a short single pulse of BHF light. To determine if this uncharacterized F -box protein, KFR1, is required for this response, the BHF mediated destabilization of Lhcb transcripts was examined in kfr1 mutants. To test the hypothesis that KFR1 is required for BHF mediated destabilization response, six -day -old etiolated wild type, kf r1 -1 and kfr1 -2 mutant seedlings were either given no light treatment, or were treated with a BLF or BHF light pulse. RNA was analyzed by RNA gel blots and hybridization to radiolabeled Lhcb probes. Both alleles of kfr1 mutant seedlings accumulate Lhcb t ranscripts normally in response to the BLF pulse, but failed to destabilize Lhcb transcripts

PAGE 61

61 following BHF irradiation (Figure 3 8). These results, confirmed in at least two experimental replications in two independent mutant alleles (Figure 3 8), phenocopy the lack of BHF mediated destabilization observed in phot1 mutants (Folta and Kaufman, 2003). These results indicate that KFR1 is required for the BHF mediated destabilization of Lhcb transcripts. Is the ubiquitin-mediated protein destabilization proces s part of KFR1s mechanism? The F box architecture of KFR1 suggests that KFR1 is likely functioning as a recognition moiety of an SCF complex, ubiquitinating a target protein and tagging it for subsequent proteolysis. To test the hypothesis that ubiquitination and proteolysis is affecting the accumulation of a protein modulating transcript stability, the proteasome inhibitor MG 132 was applied to seedlings shortly before light treatment. If treatment with MG 132 would negate BHF -mediated destabilization, it would support a model where KFR1 is functioning to ubiquitinate a substrate affecting transcript stability. Six day -old, dark grown Arabidopsis thaliana seedlings were treated with 50M MG 132 or a mock treatment (5% dimethyl sulfoxide [DMSO]) for 30 minutes. MG -132 is dissolved in DMSO. DMSO is used because of its ability to permeate membranes and permit the delivery of the MG 132 compound. When it is used as a control treatment, differences between control and MG 132 treatments should reveal the effe cts of the proteasome inhibitor alone. Seedlings were treated with a pulse of BLF or BHF light, or a mock pulse (light source unplugged). Tissue was harvested 2 h later and RNA was isolated and analyzed via northern blotting using a probe directed against the Lhcb transcript. Seedlings treated with MG 132 showed comparable accumulation of Lhcb transcript in darkness and after a BLF pulse, indicating that BLF -induced transcript accumulation was functioning correctly and that seedlings were capable of responding to the light stimulus. However, seedlings treated with MG 132 failed to destabilize Lhcb

PAGE 62

62 transcripts following treatment with a BHF light pulse (Figure 3 9). The result of this experiment demonstrates that treatment of wild type seedlings with a prote asome inhibitor phenocopies the lack of BHF transcript destabilization observed in the kfr1 and phot1 mutant lines. This data is consistent with an interpretation where the F -box protein, KFR1, targets a protein that stabilizes Lhcb RNA. Assessment of Oth er Phot1 Mediated Responses: Hypocotyl Elongation; Rapid Inhibition of Stem Elongation and Phototropic Curvature Phototropins are BL receptors that play a role in mediating various phototropic responses that include BHF mediated destabilization of Lhcb tra nscripts (Folta and Kaufman, 2003), early inhibition of stem elongation (Folta and Spalding, 2001), and phototropic curvature (Liscum et al., 2003). Because both phot1 and KFR1 are required for destabilization of Lhcb transcripts, it is possible that KFR1 may have a role in other phot1 -mediated processes. An evaluation of KFR1 function in these other processes will inform placement of KFR1 relative to the signaling schemes regulating these other phot -mediated responses. To determine if KFR1 is required fo r other phot1 mediated responses, wild type and kfr1 mutants were evaluated for phototropic curvature response. Two -d -old, dark grown seedlings were placed adjacent to a unilateral blue light point source directed perpendicular to seedling hypocotyls. Th e seedlings were imaged in 30 min intervals for 12 h and the degree of phototropic curvature was evaluated using the Image Tool measurement suite. The results shown in Figure 3 10 indicate that there is no difference in the kinetics of phototropic curvature of seedlings, indicating that KFR1 is not participating in this response, at least at the range of fluence rates tested.

PAGE 63

63 During acclimation to the light environment dark-grown seedlings exhibit a rapid and immediate decrease of stem growth rate. The various phases of light induced growth inhibition can be separated genetically, and the primary phase (0 15 min) of blue light induced growth rate inhibition is phot1 mediated (Folta and Spalding, 2001). To test if KFR1 is required for the phot mediated first phase of growth inhibition dark grown wild type and kfr1 seedlings were monitored in darkness and during blue light illumination. The results indicate that kfr1 seedlings respond in a manner identical to wild type seedlings (Figure 311). Discussio n A specific light treatment affects the accumulation of Lhcb transcripts. The beginning and end of this mechanism are well established, starting with blue photons exciting the phot1 receptor and culminating in 5 -UTR mediated transcript destabilization. The transduction mechanism that bridges the two processes is unknown, and may be approached in several ways. First, two -hybrid assays may define interactors with the receptor, and may provide a first glimpse at the proteins that bridge the gap to transcri pt destabilization. However, the phot1 receptor participates in many separate and unrelated processes, some likely sharing only a common receptor. It would be best if the specificity inherent in the necessary and sufficient 5 -UTR could be used as bait in this system, as interactors with the downstream target would have a higher likelihood of being specific for the response. The yeast three hybrid assay described by SenGupta et al. ( 1996) provides an excellent tool for identifying RNA -binding proteins in v ivo RNA -binding proteins play key roles in regulating RNA stability, processing, transport, synthesis and translation (Lorkovic and Barta, 2002). It has previously been shown that BL regulation of Lhcb transcript levels is dependent of sequences in the 5 -UTR. To date, proteins that might regulate Lhcb transcript stability have yet to be identified. With the aim of identifying proteins that interact with the Lhcb 5 UTR, the

PAGE 64

64 yeast three -hybrid was used, utilizing the Lhcb 5UTR as bait. Several proteins we re identified, some that have been characterized in various biological processes and others that have not. To determine the strength of interactions, assays were used that utilize the reporter gene activity. The first assay used, utilizes 3 -Amino 1, 2, 4 t riazole (3 -AT) a competitive inhibitor of His3p, the HIS3 gene product. Therefore, stronger RNA -protein interactions (yielding higher levels of His3p) will be able to survive on higher concentrations of 3 -AT. The putative Prefoldin (At1g29990) protein was unable to grow on media containing 3 -AT (1mM). Several proteins survived on very high levels of 3 -AT (100mM), these being. Arabidopsis P450 Reductase 2 (ATR2) protein, Tonoplast intrinsic protein (TIP1), and the Threonine Aldolase (THA1) protein. Although most protein -protein and protein -RNA interactions are abolished with concentrations of 3 -AT above 50mM, concentrations up to 225mM have been used, for example in the identification of the interaction between the histone 3 -UTR and the HBP protein (Martin e t al., 2000). Persistent growth in the presence of high 3 -AT levels indicates strong interaction between the candidate protein and the RNA bait. -gal, encoded by the LacZ cleaves lactose into glucose and galactose. Two lactose analogues were used in this study, the X gal liquid assay that utilizes ONPG. Using both assays allows for qualitative and quan titative results. In both assays, the THA1, the RNA -recognition motif protein (RRM), TIP1, ATR2 proved to be the strongest interactors, (Figures 3 3 and 34). PSAB, a protein encoded by the chloroplast, functions as a component of the photosystem I (PSI). PSAB can be classified as a false positive because it did not produce a positive result in the X -gal filter assay and its activity in the B -gal assay units was low. Another protein that may

PAGE 65

65 have been a false positive as well is the putative Prefoldin. Pr efoldin (PFD) is a protein chaperone that binds nascent actin and tubulin and other proteins prior to transporting them to the chaperone -containing TCP 1 (CCT) for folding into their proper structure (Vainberg et al., 1998; Hill and Hemmingsen, 2001; Gu et al., 2008). PFDs are not known for RNA binding The poor interaction strength confirms categorization as a false positive. It is also important to determine if the proteins identified in this study require the bait RNA to activate the reporter gene of if they alone may bind the sequences in the promoter and self activate the HIS3 gene. To determine this, the RNA plasmid was cured from the yeast cells using the drug 5 -fluoroorotic acid (5 -FOA). 5 -FOA is toxic in yeast cells expressing the URA3 gene, which is the plasmid containing the hybrid RNA. When uracil is provided in the media, the cells can still grown even in the presence of 5 FOA. Colonies cured of the RNA plasmid were further streaked on media lacking uracil. Following treatment with 5 FOA, the re sults confirm that all of these proteins require the RNA plasmid activate the HIS3 reporter gene (Figure 3 5). Yeast representing each RNA -protein interaction containing the RNA plasmid were grown alongside each cured one, demonstrating that the incapabili ty of the cured yeast to grow was due to the RNA plasmid. In yeast three hybrid assays, it is necessary to determine if the interactions observed are specific for the bait RNA or if the identified proteins bind any RNA in an indiscriminate manner. Proteins identified in the yeast three -hybrid screen were tested for their interaction with a different RNA; here the Iron Response Element (IRE) was used. Results from this assay are shown in Figure 3 TIP, BSD2 -family related protein and LHCB 4 interacted with IRE and are classified as RNA independent interactions as they interacted with the IRE element in this assay. TIP/TIP1) an internal membrane protein.

PAGE 66

66 TIPs function as aquaporins and regulate vacuolar water transport (Johanson et al., 2001; Kim et al., 2006). Kim et al. ( 2006) found that TIP1 (and TIP2) interacts and co-localizes with the CMV 1a protein. They hypothesized that TIP proteins may have a role in moving RNA from site of synthesis on tonoplasts (K im et al., 2001) however; this possible role has not been elucidated. TIP1 may play this role in moving a variety of RNAs, hence it is interacting with Lhcb 5 -UTR and IRE is not without precedent. The Bundle -sheath defective protein 2 family (BSD2 -family) is a chloroplast targeted chaperone that assists in the assembly of the Rubisco subunits (Roth et al., 1996; Brutnell et al., 1999; Wostrikoff and Stern, 2007). Roth et al. ( 1996) observed a hyper accumulation of rbcL transcripts in bsd2 mutants and sugge sted that the Bsd2 gene may play a role a role in destabilizing rbcL transcripts in bundlesheath and mesophyll cells (Roth et al., 1996). If this is true, BSD2 may bind and regulate the stability of more than one transcript. It is interesting to note that phot1 confers destabilization to rbcL transcripts via a blue light and phot1 -dependent mechanism despite their separate compartmentation (Folta and Kaufman, 2003), so this candidate is a compelling target for further analysis. Interestingly, the LHCB and RBCL protein levels are abnormally high in phot mutants when grown under high fluence rates of light (Weston et al, 2000), consistent with the higher gene expression under these conditions. The Light -Harvesting Chlorophyll a/b Binding 4 (LHCB4) protein i s a chloroplast localized protein that functions in photosynthesis aiding in harvesting and transferring light energy to the reaction centers of PSII. This protein was shown to interact with both the Lhcb 5 UTR and the IRE, so again, it was considered pro miscuous and not a target for further analysis. However, this is the only Lhcb gene found in these interaction studies, and Lhcb comprises a set of genes in a multigene family. It could be possible that this specific gene encodes a protein capable of int eracting with its own transcript, maybe providing a means of regulation between

PAGE 67

67 family members. This interpretation is highly speculative, but helps reconcile the identification of this clone as a bona fide RNA interacting protein. With the aim of underst anding the mechanisms that regulate Lhcb transcript stability specifically these proteins were removed from initial consideration due to their ability to promiscuously bind RNA in general. Table 3 2 lists the proteins identified in the yeast three hybrid a ssay and summarizes the reasons for considering some of them as non-specific interactors. The proteins that are considered possible bona-fide interactions include ATR2, RCE1, THA1, PATL1, a novel RNA recognition motif (RRM) protein, AtRSH3 and a novel Kelc h repeat -containing F -box family protein. ATR2 encodes an NADPH -cytochrome P450 reductase that are found to work in concert with P450s. P450s require a P450 reductase for electron transfer from NADPH to its substrate (Mizutani and Ohta, 1998). P450s are involved in a variety of secondary metabolic pathways such as catalyzing the first oxidative step of the phenylpropanoid general pathway (Urban et al., 1997) and the first step of tryptophandependent indole 3 acetic acid biosynthesis (Hull and Celenza, 2000a). ATR2 that is predicted to be localized in the chloroplast (Urban et al., 1997, Hull and Celenza, 2000b) has been demonstrated to aid CYP79B2 (a chloroplast targeted P450) in the conversion of tryptophan to indole 3 acetaldoxime (Hull and Celenza, 2000b). ATR2 is a member of a family of P450 reducatases with FMN, FAD and NADPH binding domains (Urban et al., 1997). It is not clear how this protein interacts with RNA, however would be an interesting candidate for further analysis in planta. Threonine Al dolase 1 (Tha1) encodes a metabolic enzyme involved in the conversion of threonine to glycine and acetaldehyde. Its cellular location is unknown however it is mainly

PAGE 68

68 expressed in seeds and seedlings. It is also expressed in vasculature in Arabidopsis leav es. One phenotype observed in tha1 mutants is a lack of chlorophyll (Joshi et al., 2006). Its association with Lhcb RNA is not easily reconciled, but interactions are strong and specific. It is also worth noting that THA1 homologs do exist in yeast (Joshi et al., 2006). Patellin1 (PATL1) is a membrane localized cell plate associated protein that is related in sequence to protein involved in membrane trafficking. Arabidopsis PATL1 is related to Sec14p that is found in Saccharomyces cerevisae (Peterman et al. 2004). PATL1 has been implicated in the brassinosteroid (BR) response where BR induces PATL1 and PATL2 (Deng et al., 2007). Sec14 proteins play a role in controlling interfaces between lipid metabolism and membrane trafficking (Deng et al., 2007). Again, there is no clear RNA -binding motif or demonstrated role of these proteins in RNA binding in the literature. However, the interactions herein have been carefully confirmed and possibly represent an un described capacity of this protein. The novel RNA re cognition motif protein (annotated here as RRM) is classified as being similar in sequence to FPA in RRM domain sequence (At2g43410). FPA is an RNA binding, nuclear localized gene that regulates flowering in Arabidopsis via the autonomous pathway (Schombur g et al., 2001). This was the only protein identified in this screen for RNA -binding proteins that actually has a predicted RNA -binding domain. Perhaps this protein is interacting with Lhcb RNA directly. Analysis of Lhcb transcript stability in seedlings lacking this gene might reveal a role for this protein in plants. AtRSH3 encodes an Arabidopsis RELA/SPOT HOMOLOG3 (van der Briezen et al., 2000) with catalytic activity in the guanosine tetraphosphate metabolic process. Bacterial relA and spoT genes encod e enzymes that make the Guanosine 3,5 bis(pyrophosphate) (ppGpp) nucleotide (Givens et al., 2004, Mizusawa et al., 2008). ppGpp is classified as a secondary

PAGE 69

69 messenger in response to stress and starvation (Toulokhonov et al., 2001, Givens et al., 2004). A rabidopsis RSHs are expressed in photosynthetic tissue (Mizusawa et al., 2008) and are plastid targeted (Givens et al., 2004, Masuda et al., 2008; Mizusawa et al., 2008) and are diurnally regulated with ppGpp levels following the same trend Mizusawa et al ., 2008). Characterization of higher plant RSHs has begun to receive more attention in recent years, however the exact mode of action still needs to be identified. It is thought that these proteins may function in maintenance of functional chloroplasts (M izusawa et al., 2008). How AtRSH3 interacts with the UTR of Lhcb is unclear, however as a positive candidate, analysis in plants using genetic mutants may reveal an uncharacterized role for this gene. Kelch repeat containing F -box family protein (At1g804 40; designated KFR1 in Chapter 3) is a novel protein whose biological process, cellular localization and molecular function has yet to be defined. In an expression analysis of Arabidopsis F -Box containing genes, Kuroda et al. (2002) reported that the gene At1g80440, a Kelch domain containing F box protein was highly expressed in rosette leaves and cauline leaves (Kuroda et al., 2002). This was later confirmed by Sun et al. ( 2007), in a genome -wide analysis of Kelch repeat containing F -box proteins, that the At1g80440 (designated AtKFB20) is highly expressed in leaves. In a genome -wide expression analysis of Arabidopsis genes in response to high irradiance light, Kleine et al, (2007) found that 23 genes in Arabidopsis were mis -regulated (at least 2 -fold expr ession change) in both cry1 and hy5 mutants when compared to wild type in response to high -irradiance light (HL) and high intensity blue light (BL). One of the mis regulated genes identified was At1g80440 (Kleine et al., 2007). These findings make this novel F box protein a good candidate for proteins involved in the regulation of Lhcb mRNA stability. At1g80440 is mis regulated in cry1 and hy5 mutants in response to high irradiance light and also blue -light

PAGE 70

70 (Kleine et al., 2007). Cryptochromes are another c lass of blue light receptors involved in de etiolation, inhibition of hypocotyl growth, cotyledon exapansion, flowering and chlorophyll production (Lin et al., 1995, Valverde et al., 2004). HY5 is a transcription factor involved in the activation of photom orphogenic genes (Chen et al., 2004). The cry1 receptor has also been demonstrated to bind COP1 (an E3 ubiquitin ligase and a negative regulator of photomorphogenic genes) (Holm et al., 2000; Osterlund et al., 2000, Lin and Shalitin, 2003). Since Lhcb tran scripts are destabilized by BHF light in a phot1 dependent manner, this novel F box protein may be functioning downstream of phot1 and cry1 to regulate genes involved in photomorphogenic responses. This interpretation is also supported by the tissue expres sion results reported by Kuroda et al. ( 2002) and Sun et al. ( 2007), that show that At1g80440 is highly expressed in leaves, which is typically tissue of high photosynthetic activity. F box proteins are known for targeting other proteins for degradation vi a the ubiquitinproteasome pathway (Gagne et al., 2003). F -box proteins contain an N -terminal F box motif and C-terminal protein -protein interaction domains. Of the F -box proteins identified to date, none have been shown to bind RNA. In fact, F -box protei n RNAs themselves are frequent targets for catabolism that changes the presentation of hormone or developmental processes. This is evident in ethylene signaling. The transcripts of the F -box proteins EIN3 BINDING F BOX PROTEIN1 and 2 (EBF1 and EBF2) are re gulated by the exoribonclease EIN5/XRN4, however the direct target of EIN5 is still unknown (Olmedo et al., 2006; Potuschak et al., 2006) RUB conjugating enzyme 1 (RCE1) is a component of the ubiquitin-protein conjugation pathway. It functions in conjugati ng CUL1 and is involved in auxin responses, where mutation in RCE1 results in auxin resistance (Dharmasiri et al., 2003). There is no direct evidence of interaction of RUB with RNA, it is central to the regulation of SCF activity. The presence of an

PAGE 71

71 F box containing gene and RCE1 places both of these proteins into the context of a potential regulatory mechanism that is centered on the Lhcb transcript as a scaffold. While speculative, both of these proteins have confirmed UTR interaction, thus suggesting a putative common biological function that can be ascertained in further experimentation. Aside from the RRM protein, it is not obvious how these proteins are interacting with the 5 -UTR of Lhcb in this yeast three -hybrid assay. The biological relevance o f these interactions needs to be explored further. One disadvantage with yeast hybrid assays is that the physical interaction identified in these assays does not necessarily mean biological interactions in the natural environment of the protein. In other words, the proteins are expressed from a constitutive yeast promoter in a sea of yeast proteins that may affect their accumulation, localization, processing and degradation. It is possible that these proteins are not RNA interactors per se but instead ar e RNA associated. The difference is that some may interact directly with RNA, others may be binding yeast gal) activation circuit, signaling positive interaction. The yeast three hybri d assay is a useful tool to indentify proteins that may interact with RNA in yeast. This assay provides information of interactions that occur outside of the proteins natural environment. To determine the biological relevance of these associations, it is necessary to study them in planta. The BHF -mediated destabilization of Lhcb transcripts is well characterized in Arabidopsis thaliana etiolated seedlings (Anderson et al., 1999; Folta and Kaufman, 2003). In the Arabidopsis community, a T DNA insertion data base exists at the Arabidopsis Biological Resource Center (ABRC). T DNA insertion mutants of these genes can be identified and their responses in Lhcb transcript levels after exposure to BHF light can be

PAGE 72

72 studied. Such studies could provide further informat ion on association with the Lhcb 5 -UTR in planta. Whether the Lhcb associating proteins identified here bind to each other can be tested using a protein -protein interaction assay such as the yeast two hybrid assay. Such an assay could shed light on a pos sible complex of proteins that may form at the UTR or provide insight to a series of regulatory events that may lead to an unstable transcript after irradiation with BHF light. In an assay to identify proteins that interact with the PsLhcb 5 -UTR, a novel F -box protein was identified (Chapter 2). The cDNA encoding the interactor corresponds to the gene At1g80440 in the Arabidopsis genome. Two T DNA insertion alleles of this gene were identified from the Salk SIGNAL collection. The T DNA insertion mutants w ere brought to homozygosity and this novel gene was designated Kfr1 for K elch -repeat, F -Box, R NA associated 1 (Figure 3 7) In dark -grown seedlings, blue light regulates the accumulation of Lhcb transcripts in a fluence dependent manner. Lhcb transcripts accumulate under BLF and are destabilized by a short single pulse of BHF light (Anderson et al., 1999). To determine if KFR1 is required for the BHF mediated destabilization of Lhcb transcripts, Lhcb transcript levels were studied in kfr1 mutant lines in r esponse to various pulses of blue light. The results of this experiment are shown in Figure 3 8 and demonstrate that while mutants accumulate transcripts normally in darkness and in response a BLF pulse, KFR1 is absolutely required for the BHF destabilizat ion event, as mutants fail to destabilize the Lhcb transcript. These results are consistent with the lack of Lhcb mRNA destabilization seen for phot1 and nph3, but not nph4, mutants (Folta and Kaufman, 2003). From these results it is possible to place KFR1 in a signal transduction pathway

PAGE 73

73 downstream of the phot1 photoreceptor and upstream of the Lhcb transcript. Associations between the transcript and KFR1 in yeast suggest that this protein is functioning close terminal end of the response. The kfr1 mutan ts fail to destabilize the transcript in response to a BHF pulse, and KFR1s predicted function as an F -box protein suggests that it is likely functioning by destabilizing a regulatory protein in the phot receptor to Lhcb transcript signaling chain. Thi s regulatory protein, and thus KFR1s target, could be the receptor itself. In tomato ( L. esculentum) the LeETR4 and LeETR6 ethylene receptors are degraded in a 26S proteasome dependent manner (Kevany et al., 2007). The regulatory protein could also be a protein associated with the transcript, conferring stability. In C. reinhardtii and tobacco chloroplast cells, the RB47 protein binds to the psbA mRNA 5 -UTR in a manner that is required for efficient translation (Yohn et al., 1998; Kim and Mayfield, 2002). The psbA 5 -UTR was later found to be essential not only for translation efficiency but also for mRNA stability (Zou et al., 2003. This is an example of an RNA -binding protein that (RB47) binds to the 5 -UTR of a transcript and along with other proteins (RB60, RB55 and RB38) confers stability to the RNA. One way to test the hypothesis that KFR1 is targeting a regulatory protein for degradation via the proteasome is to examine the response following treatment with a proteosome inhibitor. To determine if KFR1 is functioning via tagging of a target protein for proteolysis, the proteasome inhibitor MG 132 was used. MG 132s mode of action involves blocking the activity of the proteasome. Without a functional proteasome, proteins that would normally be degraded via this pathway will remain stable. The results shown in Figure 39 are consistent with the hypothesis that KFR1 is likely functioning as part of an SCF complex, targeting a stabilizing protein for degradation. Wild type seedlings treated with MG 132 w ere then assayed for BL

PAGE 74

74 mediated Lhcb transcript levels and results indicate that while BLF responses were intact, BHF mediated destabilization of Lhcb transcripts was not observed. The failure to destabilize Lhcb transcripts after a pulse of BHF light is identical to that observed in phot1 and kfr1 mutants. This is consistent with the designation of KFR1 as an ubiquitin-protein ligase. Through analysis of kfr1 and phot1 mutants it has been demonstrated that both phot1 and KFR1 are required for BHF mediate d destabilization of Lhcb transcripts. Using the proteasome inhibitor MG 132, it has also been demonstrated that an active proteosome is required for BHF mediated destabilization. This result is consistent with a role for KFR1 as an F -box protein, ubiquiti nating a protein participating in transcript stability. It is not likely that KFR1s target is the phot1 receptor. If KFR1s target was the phot1 receptor, then in kfr1 mutants, the phot1 receptor would be stable and Lhcb transcript levels after a pulse of BHF light would be similar to the wild type response evidenced by a destabilized Lhcb transcript. Therefore phot1 is not the substrate of KFR1. It is necessary to establish placement of KFR1 in the phot1 signal transduction pathway. Mechanistically, KFR1 could either be functioning more upstream near the phot1 receptor to regulate a suite of phot1 mediated responses, or KFR1 may be functioning more downstream of the phot1 response pathway specifically in mediating Lhcb transcript stability. The fact that K FR1 was isolated as an RNA associated protein suggests association with the transcript. Careful analysis of other rapid and robust phot -mediated responses can aid in placement. These responses both are apparent within minutes to hours in etiolated seedli ngs, meaning that they are not likely influenced by other developmental cues. They can therefore be thought of as relatively untainted reporters of the phot1 signaling system. They are also extremely sensitive, responding to small amounts of light. To de termine KFR1s possible position in the phot1 signal transduction pathway, kfr1 mutant responses were examined in a

PAGE 75

75 subset of phot1 mediated responses, specifically hypocotyl elongation under different fluence rates of BL, rapid inhibition of stem elongati on of dark grown seedlings transferred to BL, and phototropic curvature to unilateral BL. The results of these experiments are shown in Figures 3 10, 311 and 3 12. These results show that KFR1 is not required for these phot1 -mediated responses indicating an exclusive role to transcript stability versus being required for a general suite of phot1 responses. It should be noted that the mutants were not tested over a large range of fluence rates, and if there was a partial desensitization to blue light the e ffects may not be observed. However, because these responses are early and rapid, and their progression was monitored kinetically with no significant deviation, a conservative interpretation places KFR1 outside of other phot responses. The evidence from this chapter supports an interpretation that KFR1 is required specifically for the phot1 -mediated destabilization of Lhcb transcripts in response to BHF light. It is not required for the other responses under the conditions studied here. This is consisten t with the role of F -box proteins in targeting specific proteins for degradation (Smalle and Vierstra, 2004; Binder et al, 2007), indicating that KFR1 is targeting a specific Lhcb associating protein for degradation via the proteasome. The KFR1 gene was i dentified because of its encoded proteins ability to associate with the Lhcb transcript in yeast. It is not clear how an F -box protein with no identifiable RNA -binding domains could be mediating the regulation of transcript stability. However, F box prot eins are known for targeting other proteins for proteasomal degradation. One possible model (Figure 3 13) for KFR1s mode of action suggests that KFR1 may be targeting a yet unidentified hypothetical RNA stabilizing protein for degradation via the proteasome. This protein may be one of the other proteins identified in the yeast three -hybrid screen or may be a yeast protein that

PAGE 76

76 is orthologous to an Arabidopsis protein that associates with the PsLhcb 5 -UTR. In this model, the hypothetical protection protein may bind the Lhcb 5 -UTR. In darkness and BLF light conditions, the protection protein may be stable because the dark or low fluence light conditions may not reach a threshold necessary to activate the phot1, and subsequently KFR1, signal transduction pat hway. In this model, BHF light activates phot1 that in turn activates KFR1. Active KFR1 then targets the hypothetical protection protein for degradation via the proteasome. Without this protection protein, the Lhcb mRNA is susceptible for degradation. In C reinhardtii the stability of psbD is mediated by a protein complex which includes Nac2 and RB40 with the 5 -UTR. This complex protects psbD mRNA from exonucleotic degradation (Nickelsen et al., 1999; Boudreau et al., 2000; Ossenbuhl and Nickelsen, 2000) The model proposed here is deemed accurate due to several reasons. One reason is that blocking the activity of the proteasome results in a stable transcript. In addition, mutating either phot1 or KFR1, or removing the UTR also results in a stable transc ript. To date, no F -box protein has been demonstrated to bind RNA. Because of this it is necessary to identify KFR1 interacting proteins/probable targets. A yeast two -hybrid assay for protein -protein interaction could be used to see if KFR1 binds any of t he other proteins identified in the yeast three -hybrid screen The hypothetical RNA -binding protein could be one of the proteins identified in the yeast three -hybrid assay. Another possibility is that this associating protein is a yeast protein that bound to the PsLhcb UTR in this screen and was also able to bind to KFR1. The RRM containing protein is a good candidate because its predicted sequence maintains conserved RNA binding motifs. The fact that one of the proteins identified contains an RRM domain m akes it reasonable to test its interaction with KFR1 with the possibility that it is the hypothetical binding protein. The majority of studies involving UTR mediated stability have been done in C. reinhardtii chloroplasts. We can begin by using the

PAGE 77

77 current knowledge from other model organisms to expand out knowledge of the regulation of transcript stability in higher plants. In some examples from Chlamydamonas a protein complex, with one of the proteins binding a sequence in the UTR, confers stability. Thi s is observed with psaA and psbD transcript stability (Nickelsen et al., 1999; Boudreau et al., 2000; Ossenbuhl and Nickelsen, 2000) Arabidopsis thaliana has several known 5 3exonucleases; cytoplasmic localized EIN5/XRN4; and nuclear localized XRN2 and XRN3 (Kastenmayer and Green, 2000; Potuschak et al., 2006). EIN5/XRN4 is known to regulate two F -box proteins (EBF1 and EBF2) in the ethylene signaling pathway, however, it does not act by degrading EBF1/2 transcripts and its exact target(s) are still unkn own (Potuschak et al., 2006; Olmedo et al., 2006; Kendrick and Chang, 2008). It is possible that one of these exonucleases is responsible for degrading Lhcb transcripts in the absence of the stabilizing protein. These mutants are available and may be test ed in the future. It is exciting to speculate that a set of promiscuous RNA degradation proteins exist and their activity is modulated by environmental signals that expose the transcript(s) to their effects. Taken together, the data presented here demons trate that KFR1, a novel F -Box protein, is required for destabilization of Lhcb transcripts under BHF light as imparted by sequences in the 5 -UTR. The data here support the model that KFR1 is closely associated with the 5 -UTR and genetic and pharmacological tests suggest that it is modulating transcript abundance through a mechanism that involves ubiquitination and proteolysis of a target protein. However specific KFR1 targets are yet to be identified.

PAGE 78

78 Materials and Methods Yeast Three -Hybrid Strains and Plasmids To identify interacting proteins that may mediate transcript destabilization a protein -RNA interaction assay was performed. The assay tests for target RNA -protein interactions in yeast, using an assay much like the yeast two-hybrid assay used to characterize protein -protein interactions. Briefly, yeast strains contain a chromosomally integrated DNA -binding domainMS 2 viral coat protein fusion. A hybrid RNA is introduced on a URA3 -bearing vector. This hybrid RNA contains an MS2 RNA and the ta rget RNA, in this case the pea Lhcb 5 -UTR. Together the coat protein and RNA interact and present the target RNA to potential interacting proteins. Interaction is evidenced by growth on knockout media lacking histidine or beta galactosidase activity. Yeas t strains and plasmids are as described by SenGupta et al., 1996 and were gifts from Marvin Wickens (University of Wisconsin, Madison, WI). The yeast strains used in this study were L40coat ( MATa, ura3-52, leu2-3,112, his3200, trp1-1, ade2, LYS2::(LexAop) lacZ, LexA MS2 coat (TRP1) (SenGupta et al., 1999) and YBZ 1, a derivative of L40coat (MAT a, ura3-52, leu2-3,112, his3-200, trp1-1, ade2, LYS2::(LexAop) -lacZ, LexA -MS2 MS2 coat (N55K)) The 64bp pea Lhcb 5 -UTR was cloned into a unique SmaI site in the y east shuttle vector pIIIA/MS2 2 resulting in pIIIA/MS2 2 -Lhcb 5UTR hybrid RNA. This vector carries the ADE2 gene in addition to the URA3 marker. Interacting proteins were identified by screening an Arabidopsis cDNA library cloned into the pACTII/pACT2 p lasmid (Steve Elledge) which carries the GAL4 Activation Domain followed by an HA epitope tag. The pACTII plasmid carries the LEU2 marker. As a positive control, the iron responsive element (IRE) RNA construct was placed into the RNA -generating vector pII IA/IRE -MS2. This plasmid is carries a URA3 marker. The Iron

PAGE 79

79 Regulatory Protein (IRP) is fused to the GAL4 Activation Domain forming the plasmid pAD IRP. This plasmid is based off the pACTII plasmid and carries a LEU2 marker. Together these constitute a me ans to validate the response of the system to protein -RNA interactions. Yeast Transformation Yeast transformations were conducted as described in the Yeast Protocols Handbook (Clonetech Laboratories, Inc; protocol No. PT30241; Version No. PR742227) using variations in selective media where necessary as required for L40coat and YBZ 1 strains. To make competent yeast cells, colonies were grown overnight in 5ml YPAD (Yeast -Peptone -Adenine Dextrose) media or selective Synthetic Dextrose (SD) media. Overnight cultures were diluted to an OD600 of 0.20.3 and the culture was incubated at 30C for 3 h with shaking to a final OD600 of 0.4 0.6. Cultures were pelleted and washed three times with sterile water and centrifuged at 1,000x g for 5 min at room temperature after each wash. Cells were then resuspended in 1x TE/1x LiAc (0.01M Tris HCl, 1mM EDTA, pH 7.5/0.1 M LiAc) and used immediately for transformation. For transformat Cells were incubated at 30C for 30 min with shaking. Seventy microliters of DMSO was added prior to h eat shocking the cells at 42C for 15 min. Yeast cells were then pelleted at 10,000 x g (14,000rpm)for 5 s and resuspended in 0.5ml 1x TE and plated on selective media. Plates were incubated at 30C for 2 3 d, and then inspected for evidence of colony grow th. Yeast Growth Media Yeast cells were grown on synthetic dextrose media (SD, 0.67% Yeast Nitrogen base without amino acids; 2% Dextrose; 1x Dropout synthetic media, 2% Agar) supplemented with 1x

PAGE 80

80 each of amino acids (Tryptophan (W), Histidine (H), Uracil (U) and Leucine (L)) depending on selection required. 3 -Amino -1, 2, 4-Triazole (3 AT) The competitive inhibitor 3 -AT was used to test the interaction strength between candidate proteins and the target RNA. Yeast cells demonstrating evidence of protein-RNA interaction were the grown on SD minus LUHW media (for L40coat strain) and SD minus LUH (for YBZ 1 strain) containing 0mM, 1mM, 10mM, 25mM, 50mM or 100mM 3-AT. Growth after two days was scored. 5 -Fluorootic Acid (5 -FOA) To verify that observed activa tion was indeed RNA dependent, yeast cleared of the RNA containing vector were counterselected against using 5 -FOA. Yeast cells containing the hybrid RNA and the hybrid protein were grown on synthetic dextrose media lacking leucine, histidine and tryprophan (SD LHW) containing 0.1% 5 -FOA and incubated at 30C for 2 d. This was done to cure cells of the Ura plasmid. After this, colonies were streaked on minimal media (SD LUHW), cells that grew after being cured of the Ura plasmid are considered RNA -independ ent false positives. Galactosidase Assays To verify interaction as indicated by growth on galactosidase assays were Galactosidase liquid assays using O nitrophenyl -D galactosidase (ONPG) were conducted as described in th e Yeast Protocols Handbook, Clonetech Laboratories, Inc. (Protocol No. PT30241; Version No. PR742227). Overnight cultures were grown in selective Synthetic Dextrose (SD) medium. Two milliliters of the overnight culture was transferred into 8ml of YPD and incubated at 30C for 3 5 h with shaking until cells were in a mid-log phase (OD600 of 1ml = 0.5 0.8). Cells were washed and resuspended in Z Buffer, after which they

PAGE 81

81 underwent three freeze/thaw cycles in liquid nitrogen and a 37C water bath respectively. After this freeze/thaw cycle, a Z -mercaptoethanol solution and a Z -buffer + 4mg/ml ONPG solution were added to each reaction tube and placed in a 30C water bath and timed until a yellow color developed. Reactions were saturated using 1M Na2CO3. At this point the OD420 -Galactosidase is defined as the amount which hydrolyzes 1 mol of ONPG to o nitrophenol and D galactose per galactosidase units = 1,000 x OD420 / (t x V x OD600); where t = elapsed time of incubation (in min); V = 0.1 ml x concentration factor and OD600 = A600 of 1 ml of culture. Colony -lift Filter Assay The colony lift filter assay was conducted as described in the Yeast Protocols Handbook (Clonetech Laboratories, Inc; protocol No. PT30241; Version No. PR742227). Yeast cells were patched onto SD agar media and grown at 30C for 2 d. Filter paper (Geneq, Grade 237, catalog # 23784657) to be used was soaked in Z -buffer/X -gal solution (Z -buffer: sodium phosphate dibasic heptahydrate (Na2HPO4 7H20), sodium phosphate monobasic anhydrous (NaH2 PO4 H20), potassium chloride (KCl), magnesium sulfate heptahydrate (MgSO47H2 ME; X -gal solution (5 bromo4 chloro 3 indolyl D -galactopyranoside dissolved in N,N dimethylformamide, DMF)). Another filter paper was placed over yeast colonies and cells were permealized by placing the filter paper in liquid nitrogen for 10 15 sec, until filter was completely froze n, then thawed at room temperature. Filter paper with yeast colonies was incubated with another filter paper pre -soaked in Z -Buffer. Both filter papers were placed in 30C and incubated for a maximum of 8 h, checking hourly for the appearance of blue patches.

PAGE 82

82 Identification of Yeast 3 -hybrid Proteins Yeast plasmids were isolated using the Zymoprep II Yeast Plasmid Miniprep kit (Zymo Research). Plasmid from the yeast miniprep were chemically transformed into E. coli XL1 Blue competent cells and positive tran sformants were selected on Luria Bertani (LB; 1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar) agar plates containing carbenicillin at a concentration of 100mg/ml. Interacting proteins were sequenced using primers for the 3 end of the GAL4 Activation Domain (5 AATACCACTACAATGGAT 3) and the Matchmaker 3 sequence (5 GTGAACTTGCGGGGTTTTTCAGTATCTACGT 3) present in the pACT2 vector. Identification of Homozygous T -DNA Insertion Mutant Lines To assess the role of the KFR1 protein in blue light mediated R NA stability T DNA insertion mutants were identified in Arabidopsis. Two independent lines were identified. Salk_008497 ( kfr -1 -1 ) and Salk_129095 ( kfr1 -2 ) seed was obtained from the Arabidopsis Biological Resource Center (ABRC) that contained T DNA insert ions in the gene At1g80440. Arabidopsis thaliana plants were screened via PCR for homozygous lines using the primers 5 TCCCCAATCTTCCCGACGA 3 and 5 TTAGACCTCCAAGAAGCAGCCAGC 3. Conducting a PCR reaction with these primers will result in a 1064 bp PCR product in wild type (WT) and heterozygous plants, homozygous mutants will lack this product. Loci containing a T DNA insertion are identified by amplification of the Left border (Lba1) primer against the 5primer. Salk_00312C was obtained from ABRC. It represents a homozygous mutant line of the At1g15670 gene (designated KFR2). Cloning KFR1 and Over -expression Constructs. The At1g80440 (1065bp) gene was amplified by PCR from an Arabidopsis cDNA template using Gateway Technology (InvitrogenTM) adapter pri mers along with gene specific

PAGE 83

83 primers : 5 GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGGAACTTATCCCCAATCTTC 3 and 5GGGGACCACTTTGTACAAGAAAGCTGGGT TTAGACCTCCAAGAAGCAGCCAGC 3. Amplified PCR products were transferred into the Gateway entry vector pDONR222 using the Gateway BP Clonase II recombination reaction. Inserts were verified via restriction digests and sequencing. Positive entry clones were further transferred into pH7WG2D (Karimi et al., 2002) using the Gateway LR Clonase II recombination reactions to generate the over -expression construct using standard reaction conditions. Proper insertion into this vector was confirmed via sequencing before transformation into Agrobacterium strain GV3101 (Koncz et al., 1986) and then subsequent transformation into Arabidopsis thaliana plants via the floral dip method (Bent and Clough, 1998). Briefly, wild-type plants were submerged in a solution containing 0.1 OD transformed agrobacterium, 5% sucrose and 0.02% silwet. After plants dried the transformed seedlings were selected on MS media containing 35mg/ml hygromycin as described by Harrison et al. ( 2006). Blue -Light Mediated Destabilization Experiments Sterilization of seeds was performed as described by Folta and Kaufman, (1999). For each sample, 100l of WT, kfr1 -1 and kfr1 -2 Arabidopsis thaliana seeds were used. Seeds were surface sterilized with 50% (v/v) commercial bleach, 0.01% Tween 20 for 15 min and rinsed 5 times with sterile water. Surface sterilized seeds were then resuspended in 0.5x Murashige and Skoog (MS) media (0. 5x MS, 1.75g/L MES, pH 5.8) with 0.8% phytoagar. This suspension was then plated onto 0.5x MS media with 1% phytoagar and placed in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given a treatment of white light for 2 h t o stimulate germination, and transferred to dark conditions in a 23C chamber for 6 d. Six-day old, dark grown Arabidopsis thaliana seedlings were given no light (Dark; D), or a pulse of Blue

PAGE 84

84 Low Fluence (BLF; <104 mol m2) or Blue High Fluence (BHF; >105 mol m2) light. Tissue was harvested 2 h later in liquid nitrogen and RNA was isolated and analyzed via northern blotting. Proteasome Inhibitor Experiments Sterilization of seeds was performed as described by Folta and Kaufmann, 1999. For each sample, 100l of WT Arabidopsis thaliana seeds ecotype Columbia (Col O) were used. Seeds were surface sterilized with 50% (v/v) commercial bleach, 0.01% Tween 20 for 15 min and rinsed 5 times with sterile water. Surface sterilized seeds were then resuspended in 0.5x Murashige and Skoog MS media with 0.8% (w/v) agarose. This suspension was then plated onto 0.5x MS media and placed in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given a treatment of white light for 2 h to stimulate germination, and transferred to dark conditions in a 23C chamber for 6 d. Six day-old, dark grown Arabidopsis thaliana seedlings were treated with 50M MG 132 (Carbobenzoxyl -L leucyl -L leucyl L -leucinal) (Calbiochem) or a mock treatment (5% dimethyl sulfo xide [DMSO]) for 30 min in dark. DMSO was used as a control because MG 132 is dissolved in DMSO. Seedlings were given no light (Dark, D), or a pulse of Blue Low Fluence (BLF; <104 mol m2) or Blue High Fluence (BHF; >105 mol m2) light. Tissue was harvested 2 h later in liquid nitrogen and RNA was isolated and analyzed via northern blotting. RNA Extraction and Northern Analysis Total RNA extractions were performed using the RNeasy kit (Qiagen). The concentration of the samples was determined using spectro photometry. RNA samples were denatured in a formamide buffer (66% v/v formamide, 8% v/v formaldehyde, 1x MOPS at 65C for 15 min) and were loaded onto an agarose gel containing formaldehyde (1x MOPS, 6% formaldehyde, 1.75% agarose). Even loading was confi rmed on the gel by ethidium staining. RNA was then

PAGE 85

85 transferred onto GeneScreen Plus Hybridization Transfer Membrane (PelkinElmer) using standard blotting procedures with standard sodium citrate buffers (10x SSC; 1.5M NaCl, 0.15M sodium citrate). RNA was li nked to the membrane via UV crosslinking. Lhcb probes were generated by PCR using the following primers: 5 -ATGGCCGCCTCAACAATGGC 3 and 5 CCGGGAACAAAGTTGGTGGC 3 against Arabidopsis genomic DNA. 18S was used as a probe for normalization, generated by a Hi n dIII digestion of the pHA2 plasmid. pHA2 is a derivative of the pHA1 plasmid inserted into pBR322. pHA1 that contains a fragment of pea nuclear DNA including genes for 18S and 25S rRNA (Spiller et al., 1987; Glick et al., 1986; Jorgensen et al., 1982). Hybridization was performed at 62C overnight in Church Buffer (10% (w/v) bovine serum albumin, 1mM EDTA, 0.5M phosphate buffer; 7% (w/v) SDS; Church and Gilbert, 1984). Blots were washed sequentially in 1x SSC, 0.1%SDS twice (once at room temperature and once at 65C) and 0.1x SSC, 0.1%SDS once at 65C. Signals were then visualized by autoradiography. Measurement of Inhibition of Hypocotyl Growth The blue high fluence mediated RNA destabilization event requires the phot1 photoreceptor (Folta and Kaufman, 2003). The phot1 receptor mediates a series of well described blue light responses, and these responses can be monitored in kfr1 mutants to determine the approximate placement of KFR1 in the signal transduction scheme. Blue light controls early events in hypocotyl growth inhibition via phot1. Hypocotyl growth measurements were conducted in kfr1 mutants as described by Folta and Spalding, 2001. Wild type and kfr1 -2 seeds were placed on media containing 1mM potassium chloride (KCl), 1mM calcium chloride (Ca Cl2); 1% Difco agar and placed in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given 1 2 h white light to stimulate germination and transferred to dark conditions in a 23C chamber for 3650 h. Individual seedlings wit h hypocotyls measuring

PAGE 86

86 approximately 2 3 mm were transferred a separate 1% phytoagar plate oriented vertically and perpendicular to the lens of a CCD camera (EDC1000N; Electrim Corp., Princeton, NJ, USA) using a close focus lens (K52 274; Edmund Scientific Barrington, NJ, USA). As described by Parks and Spalding, 1999, a non-photomorphogenic infrared light source was placed behind the seedlings to allow visualization of seedlings during the dark period. Digital images were obtained at 5 min intervals for 1 h in the dark, and at 5 min intervals for 2 h with BL illumination at a fluence rate of 75 mol m2 s1. A custom software application, written in the LabView environment (National Instruments, Austin, TX, USA) calculated growth rate data from the series of digital images Phototropic Curvature towards Unilateral Blue Light Phototropic curvature is a blue light response mediated primarily by the phot1 receptor. The effect, if any, of the kfr1 gene was assessed. Wild type and kfr1 -1 and kfr1 -2 seeds were pla ced on media containing 1mM KCl, 1mM CaCl2; 1% Difco agar and placed in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given 1 -2 h white light to stimulate germination and transferred to dark conditions in a 23C chamber for 2.5 d. Images of seedling curvature towards unilateral blue light were captured every 30 min for 12 h. The kinetics of phototropic curvature was derived by measuring the angle of curvature from the plants starting position throughout the time cours e of the experiment using the UTHSCSA ImageTool software package. Measurement of End -Point Hypocotyl Lengths under Blue Light Wild type and kfr1 -1 and kfr1 -2 seeds were lined up with ~1mm spacing on media containing 1mM KCl, 1mM CaCl2; 1% Difco agar and pl aced in 4C for 2 d in dark conditions to synchronize germination. After this, seeds were given 1 h white light to stimulate germination. Seeds were placed in darkness or under different fluence rates of blue-light (101,

PAGE 87

87 100, 101, and 102 2 s1). After 96 h seedling hypocotyl lengths were measured using the UTHSCSA Image Tool Version 3.0 Software.

PAGE 88

88 Table 3 1. Proteins identified in a yeast three hybrid screen using Lhcb 5 -UTR as b ait Protein name and d escription E value AtCg00340 PSAB: encodes the D1 subunit of photosystem I and II reaction centers 8e 119 At4g30210 ATR2: Arabidopsis P450 Reductase 2 7e 89 At4g36800 RCE1: RUB1 conjugating enzyme 1e 101 At2g36830 TIP1: Tonoplast intrinsic Protein 1 1e 69 At1g29990 Prefoldin 5e 53 At1g08630 TH A1: Threonine Aldolase 1 4e 103 At3g47650 Bundle sheath defective protein 2 family 6e 76 At1g72150 PAT1: Patellin1/SEC14 like 9e 146 At4g12640 RNA recognition motif (RRM) containing protein 5e 158 At1g54130 AT RSH3: (RELA/SPOT homolog) 2e 137 At3g0894 0 LHCB4: Light harvesting chlorophyll binding complex PSII 3e 106 At1g80440 Kelch repeat containing, F box family 3e 74

PAGE 89

89 Table 3 2. Summary of results of yeast three hybrid screen Protein annotation Possible b ona fide Lhcb UTR specific i nteraction? Reason for e limination AtCg00340; PSAB No Negative X gal filter with Lhcb 5 UTR At4g30210; ATR2 Yes N/A At4g36800; RCE1 Yes N/A At2g36830; TIP No Binds IRE At1g29990; putative PREFOLDIN No Negative X gal filter with Lhcb 5 UTR; No resi stance to 3 AT At1g08630; THA1 Yes N/A At3g47650; BSD2 like No Binds IRE At1g72150; PATL1 Yes N/A At4g12640; RRM Yes N/A At1g54130; RSH3 Yes N/A At3g08940; LHCB4 No Binds IRE At1g80440; F Box Yes N/A

PAGE 90

90 Figure 3 1. S chematic illustration of the ye ast t hree -h ybrid a ssay. Figure adapted from SenGupta et al., 1996.A DNA binding domain (LexA) is used to anchor a bait protein adjacent to a reporter gene (HIS3). This DNA binding domain is fused to an RNA binding domain from the MS2 virus (MS2 coat prot ein). A second hybrid protein is introduced on a plasmid as a candidate for RNA interaction or as a plasmid from a library that is being screened for interacting proteins (Arabidopsis Protein). This protein is a fusion between the introduced protein sequence and a transcriptional activation domain (Gal4 activation domain). A third plasmid harboring the RNA target is transformed into the yeast. The RNA target is a fusion between the putative interacting RNA ( Lhcb 5 -UTR) and viral MS2 RNA. The MS2 RNA will i nteract with the MS2 proteinDNA binding domain, presenting an RNA target for interaction with candidate proteins. Interaction between a candidate protein and the target RNA binding domains induces an auxotropic marker that allows growth on dropout media.

PAGE 91

91 Figure 3 2. Strength of interaction assay using 3 -Amino 1, 2, 4 Triazole (3 -AT). The competitive inhibitor 3 -AT was used to test the interaction strength between candidate proteins and the target RNA. Yeast cells demonstrating evidence of protein -RNA interaction were the grown on SD minus LUHW media (for L40coat strain) and SD minus LUH (for IRE -IRP in YBZ 1 strain) containing 0mM, 1mM, 10mM, 25mM, 50mM or 100mM 3 -AT. Growth after two days was scored.

PAGE 92

92 Figure 3 3. Strength of interaction using X gal. The colony lift filter assay was conducted as described in Materials and Methods. Filter paper with yeast colonies was incubated with the pre -soaked filter paper in 30C and incubated for a maximum of 8 h, checking hourly for the appearance of blue patches. Blue patches represent a positive interaction. IRE IRP positive control (blue box) were assayed simultaneously but required a different medium. Results were confirmed in triplicate.

PAGE 93

93 Figure 3 4. Strength of interaction assay using ONPG. The Galactosidase liquid assays using O -nitrophenyl D -galactosidase (ONPG) were conducted as described in Materials Galactosidase is defined as the amount which hydrolyzes 1 mol of ONP G to o -nitrophenol and D galactosidase units = 1,000 x OD420 / (t x V x OD600); where t = elapsed time of incubation (in min); V = 0.1 ml x concentration factor and OD600 = A600 of 1 ml of culture

PAGE 94

94 Figure 3 5. The RNA plasmid is required for interaction. Yeast cleared of the RNA containing vector were counterselected against using 5 -FOA. Yeast cells containing the hybrid RNA and the hybrid protein were grown on SD -LHW containing 0.1% 5 FOA an d incubated at 30C for 2 d. This was done to cure cells of the Ura plasmid. After this, colonies were streaked on SD -LUHW; cells that grew after being cured of the Ura plasmid are considered RNA independent false positives.

PAGE 95

95 Figure 3 6. Specificity o f RNA. Specificity of RNA was conducted using IRE as bait. YBZ 1 IRE yeast cells were transformed with plasmids encoding the protein candidates. The colonylift filter assay using X -gal as a substrate was conducted as described in Materials and Methods. Fi lter paper with yeast colonies was incubated with the pre soaked filter paper in 30C and incubated for a maximum of 8 h, Blue patches present positive interactions. Results were confirmed using three independent colonies for each RNA -protein interaction, yielding identical results.

PAGE 96

96 Figure 3 7. Identification of homozygous mutant lines for the At1g80440 gene. T DNA insertion mutants were identified in Arabidopsis A) and B) Schematic representation of sites of T DNA insertions in th e F Box domains. Two independent lines were identified. Salk_008497 ( kfr -1 -1 ) and Salk_129095 ( kfr1 -2 ). C) Arabidopsis thaliana plants were screened via PCR for homozygous lines using gene specific primers flanking the insertion sites. Conducting a PCR rea ction with these primers will result in a1064bp PCR product in wild type (WT) and heterozygous plants, homozygous mutants will lack this product. Loci containing a T DNA insertion are identified by amplification of the Left border (Lba1) primer against the 5primer.

PAGE 97

97 Figure 3 7. Continued

PAGE 98

98 Figure 3 8. E ffect of the kfr1 mutation on BHF mediated Lhcb transcript stability. Northern blots probed with Lhcb Six d old dark grown seedlings were given a pulse of no light/dark (D), blue low -fluence light (BLF) or blue high -fluence light (BHF). Tissue was harvested after 2 h. Results were confirmed in at least two independent experiments for each allele with similar results. A) Northern blot of one replicate for each allele and wild type. B) Normalized data from three independent replicates for each allele.

PAGE 99

99 Figure 3 9. The kfr1 mutation can be phenocopied with a proteasome inhibitor. Northern blots probed with Lhcb and 18S. Six d old dark grown seedlings were treated with a mock treatment (DMSO) or proteasome i nhibitor (MG132). Seedlings were given a pulse of no light/dark (D), blue low -fluence light (BLF) or blue high-fluence light (BHF). Tissue was harvested after 2 h. Results were confirmed in three experimental replicates with similar results. A) Northern b lot of one replicate. B) Normalized data of four independent replicates.

PAGE 100

100 Figure 3 10. Phototropic curvature towards unilateral blue l ight. Wild type and kfr1 -1 and kfr1 -2 seeds were assayed. Images of seedling curvature towards unilateral blu e light were captured every 30 min for 12 h. The kinetics of phototropic curvature was derived by measuring the angle of curvature from the plants starting position throughout the time course of the experiment using the UTHSCSA ImageTool software package

PAGE 101

101 F igure 3 11. Measurement of inhibition of hypocotyl growth. Hypocotyl growth measurements were conducted in Wild type and kfr1 mutants as described by Folta and Spalding, 2001. Individual d-grown seedlings with hypocotyls measuring approximately 2 3 m m were oriented vertically and perpendicular to the lens of a CCD camera (EDC1000N; Electrim Corp., Princeton, NJ, USA) using a close focus lens (K52274; Edmund Scientific, Barrington, NJ, USA). Digital images were obtained at 5 min intervals for 1 h in t he dark, and at 5 min intervals for 2 h with BL illumination at a fluence rate of 75 mol m2 s1. A custom software application, written in the LabView environment (National Instruments, Austin, TX, USA) calculated growth rate data from the series of digi tal images

PAGE 102

102 Figure 3 12. Measurement of end-point h ypocotyl lengths under b lue l ight. Wild type and kfr1 -1 and kfr1 -2 seeds were lined up and placed in darkness (D) or under different fluence rates of blue light (101, 100, 1012 s1). After 96 h seedling hypocotyl lengths were measured using the UTHSCSA Image Tool Version 3.0 Software.

PAGE 103

103 Figure 3 13. Possible model for KFR1s mode of a ction. KFR1 may be targeting a yet unidentified hypothetical RNA stabilizing protein (green oval) for degrada tion via the proteasome. This hypothetical protection protein may be one of the other proteins identified in the yeast three -hybrid screen or may be a yeast protein that is orthologous to an Arabidopsis protein that recognizes the PsLhcb 5 -UTR. In this mo del, the hypothetical protection protein may bind the Lhcb 5 -UTR. A) In darkness and BLF light conditions, the protection protein may be stable because the dark or low fluence light conditions may not reach a threshold necessary to activate the phot1, and subsequently KFR1, signal transduction pathway. B) BHF light activates phot1 that in turn activates KFR1. Active KFR1 then targets the hypothetical protection protein for degradation via the proteasome. Without this protection protein, the Lhcb mRNA is su sceptible for degradation resulting in an unstable transcript. .

PAGE 104

104 CHAPTER 4 5 -UTR MEDIATED LHCB TRANSCRIPT DESTABILI ZATION DURING DIURNA L CYCLES Introduction Organisms on earth have evolved under a continuous series of highly repetitive and regular light and dark intervals. These predictable light -dark periods give an organism an important sense of time, whereas the duration of these cycles provides a sense of season. Such daily cues condition an internal oscillator that synchronizes molecular, biochemical and physiological events to cycles of night and day. In plants, this pacemaker allows the organism to anticipate daybreak and optimize organ position, metabolism and gene expression for the imminent onset of light. The existence of this predictive mechan ism serves as an advantage to organisms, as they can tailor metabolic processes, gene expression and physiology in anticipation of likely conditions. (Green et al., 2002; Woelfle et al., 2004; Dodd et al., 2005; Hotta et al., 2007). In most studies, circad ian free run cycles are observed under constant light and temperature. However, in nature this is not true as on a day to day basis environmental cues are constantly changing. Nozue et al. ( 2007) showed that Arabidopsis thaliana hypocotyls show significant ly different growth patterns when grown in diurnal (short -day) versus continuous light conditions (Nozue et al., 2007), indicating the importance of further studies under diurnal light conditions. Circadian Oscillator In plants, light entrains an interna l oscillator via a transduction system that starts with the phytochrome and the cryptochrome photosensors (Somers et al., 1999; Chen et al., 2002; Salome and McClung, 2004; Spalding and Folta, 2005). These receptors transmit a signal to synchronize an inte rnal oscillator that cycles at a regular interval that is approximately 24 hours. The progress of the circuit is influenced by at least three central factors: the two Myb transcription factors

PAGE 105

105 CIRCADIAN AND CLOCK ASSOCIATED 1 (CCA1) and LATE ELONGATED HYPO COTYL (LHY); and the pseudoresponse protein TIMING OF CAB EXPRESSION1 (TOC1) (Carre and Kim, 2002; Green and Tobin, 2002; Hayama and Coupland, 2003) that induce and repress each other transcriptionally in an auto regulatory, negative -feedback loop (Alabad i et al., 2001). Other proteins that modulate the progression of the oscillator have been identified. These proteins are members of the ZEITELUPE gene family: ZTL (Somers et al., 2000; Jarillo et al., 2001); FKF1 (Nelson et al., 2000); and LKP2 (Schultz et al., 2001). TOC1 activity is modulated by ZEITLUPE (ZTL), a photomorphogenic PAS -domain, Kelch repeat, F -box protein that mediates ubiquitination and proteasomal degradation of TOC1 (Somers et al., 2000; Mas et al., 2003; Somers et al., 2004; Han et al., 2004). From these findings, it is apparent that the components of the plant oscillator are not only subject to light and temperature entrainment, but are also regulated at many other levels, ranging from transcription through protein degradation. Posttra nscriptional regulation of transcript stability In Arabidopsis, differences in the peaks of transcription and the steady-state transcript levels arising from the Light -harvesting, chlorophyll -binding (Lhcb ; formally Cab ) genes suggested clock regulated cha nges in transcript stability (Millar and Kay, 1991). In tomato seedlings, Lhcb maximal transcription rates and transcript accumulation levels closely correlate in dark free run conditions, yet the peaks of these two processes occur out of phase under diurn al conditions (Guiliano et al., 1998), suggesting a component affecting RNA stability. In Arabidopsis, the NIA2 transcript exhibits robust circadian fluctuation with only a minor contribution from changes in transcription rates (Pilgrim et al., 1993). Genomic studies of RNA stability also indicate that the oscillation of the clock regulated genes is likely to be dependent on changes in transcript stability (Guiterrez et al., 2002). It was not until recently that a relationship

PAGE 106

106 between the circadian clock an d a sequence -specific transcript decay pathway was identified (Lidder et al., 2005). In this study, Lidder et al., demonstrated that the stability of CCR LIKE (CCL ) is regulated by the clock and that this regulation of transcript stability was mediated by the downstream (DST) elements, sequences resident in the 3 -UTR that confer instability to small auxin up RNAs (SAURs) (Newman et al., 1993). Yakir et al. ( 2007) showed that a combination of light regulated CCA1 transcription and its transcript degradation are necessary for clock entrainment (Yakir et al., 2007). All these findings have elegantly demonstrated that plants, like animals, possess clock regulated systems to monitor and regulate the steady -state levels of specific transcripts. The Lhcb 5 -UTR Me diated Decay Pathway In etiolated seedling Lhcb transcript levels are acutely increased or destabilized by blue light in a fluence dependent manner. A single pulse of blue light (BL) with a fluence rate greater than 104 mol m2 results in the destabilizat ion of transcripts arising from specific members of the Lhcb family in Pism sativum L. (Ps) and Arabidopsis thaliana (At) (Anderson et al., 1999; Marrs and Kaufman, 1989). The 5 -UTR of either the Ps Lhcb 1*4 or the At Lhcb1*3 gene is necessary and suffici ent to confer BL regulated destabilization onto the typically stable GUS transcript (Anderson et al., 1999). Destabilization is dependent upon the developmental state of the chloroplast and does not require phytochrome excitation (Anderson et al., 1999). T his destabilization response is absent in phototropin1 (phot1) and nph3 mutants, indicating the participation of the phot1 phototransduction pathway in the response (Folta and Kaufman, 2003). Aim of This Study The role of the Lhcb 5 -UTR in the control of transcript stability has been well demonstrated in published work and in this dissertation. However, the actions observed have been confined to young developing seedlings and it is not known if this mechanism is relevant to

PAGE 107

107 long -term biological processes and daily plant growth and development. In this chapter, the role of the 5 -UTR on regulation of transcript stability will be extended to the broader question of regulated mRNA stability during diurnal cycles. Herein the accumulation and decay kinetics of a stable GUS construct are monitored under diurnal and circadian conditions, in the presence and absence of the destabilizing 5 -UTR. Diurnal transcript stability is also studied in the phot1 mutant background. The results unveil a discrete role for this l ight regulated degradation process that genetically and mechanistically parallels that observed during early seedling development. Results UTR Mediated Diurnal Transcript Levels In etiolated seedlings, a short, single pulse of high fluence blue light dest abilizes Lhcb transcripts via a 5 -UTR -centered mechanism (Anderson et al., 1999). This BHF response requires the phot1 photoreceptor and its scaffolding protein NPH3, as phot1 and nph3 mutants fail to destabilize Lhcb transcripts under BHF conditions (Fol ta and Kaufman, 2003). Evidence presented in this document has identified specific RNA associated proteins that are required for transcript stability (Chapters 1 3). The effect of blue light regulated, phot -dependent, 5 -UTR mediated transcript destabili zation was explored in another biological context. Many studies have used members of the Lhcb gene family as the basis for analyzing diurnal and circadian fluctuations of transcript accumulation, as their robust cycling is highly dependent on the internal oscillator (Millar and Kay, 1991). The tools amassed during this study permit the analysis of 5 -UTR dependent transcript destabilization during diurnal cycling and test the phot -dependent component. The trials herein measured steady state GUS transcrip t accumulation under transcriptional control of the pea Lhcb promoter with or without the Lhcb UTR (+/ UTR:GUS constructs). Figure 4 1 illustrates that in UTR:GUS constructs, transcripts decay at a slower rate than when

PAGE 108

108 the UTR is present, evidenced by m ore GUS transcript levels at ZT12 in the UTR construct when compared to the +UTR construct. This indicates a possible role of the UTR mediated destabilization under diurnal conditions. Arabidopsis Lhcb transcripts exhibit a symmetrical waveform of accumu lation and decay with a peak of transcript levels at midday. This oscillation is extended on the decay side in the UTR context. P hototropin1 Mediated Diurnal Transcript Decay In etiolated seedlings, the phot1 sensor is required for acute down regulation of Lhcb transcripts in response to BHF light (Folta and Kaufman, 2003). It was hypothesized that the same mechanism may also guide transcript destabilization on the descending side of daily diurnal accumulation. It is important to note that the transcription rates were similar between both wild type and phot mutant plants during diurnal cycles (K. Folta, unpublished), so destabilization imparted through the UTR or photosensor can be reliably estimated. To test this hypothesis, a +UTR:GUS transgene was cro ssed into the phot1-5 (nph1-5 ) mutant, and the rate of transcript decay was monitored at 4 h intervals within a 24 h diurnal cycle (16h L/8 h D). If phot1 is required, then the response would phenocopy that of the UTR transcripts, if the phot1 system is n ot required, then the transcript levels should approximate those of the +UTR levels. The results shown in Figure 4 2 demonstrate that the decay kinetics of the +UTR transcripts in the phot1 background are most similar to the UTR transcripts in wild type, indicating that the phot1 sensor is required for this response (Figure 4 -2). It was also observed that on a per -microgram RNA basis Lhcb transcript levels were higher in a phot1 mutant background at all points during transcript accumulation and decay in li ght (Figure 4 2 and 4 3)

PAGE 109

109 Is Response Under the Control of the Circadian Oscillator? Lidder et al. ( 2005) demonstrated a correlation between the circadian oscillator and sequence specific mRNA decay pathway by showing that the oscillator mediated the stability of certain transcripts with downstream stability (DST) elements. To determine if the variations in stability of the +UTR and UTR transcripts observed in diurnal growth conditions are under the control of a circadian oscillator, plants were grown for three weeks in 16 h light/ 8 h dark cycles and then transferred into continuous dark (DD) or continuous light (LL) conditions. Figure 4 4 presents that the enhanced destabilization of the +UTR transcript persists for one complete cycle in continuous dark ness. Subsequent cycles are not detected due to damping of the light activated transcriptional response. Similar results were obtained in three experimental replicates. It is worthy to note that transcript levels are persistently higher in UTR lines after transfer to darkness, again owing to the higher stability of the UTR transcript. Figure 4 4B represents the quantitative data of three independent experimental replicates of the +UTR and UTR Lhcb transcript accumulation under constant light conditions. Here transcription and transcript destabilization persist for at least two complete cycles under continuous light conditions. The enhanced decay of the +UTR line becomes apparent when the peak of transcription (ZT4) is set to 1 in both lines. In this scena rio, the UTR transcript accumulation kinetics become asymmetrical, demonstrated by a lengthened phase and greater accumulation in the trough (ZT12). Subsequent cycles continue to reflect this trend. The persistence of 5 -UTR mediated transcript destabili zation in free run conditions strongly implies the influence of a circadian oscillator in both the transcriptional and post transcriptional regulation of Lhcb transcript accumulation.

PAGE 110

110 Discussion This study expands the role of the well -characterized Lhcb 5 -UTR and its ability to confer light regulated instability to normally stable GUS transcripts (Anderson et al., 1999). Here experiments are taken out of the realm of etiolated seedling and extended to tests in daily diurnal and circadian oscillator -mediate d transcript accumulation. Comparison of the accumulation of +UTR::GUS transcripts to UTR::GUS transcripts driven by the same promoter during light/dark cycles reveals sequence specific differences in the transcript accumulation profiles. These difference s are most conspicuous after the peak of accumulation, as transcription rates decrease, and transcripts decay in an active (+UTR) or inactive ( -UTR) fashion. The transcript accumulation profiles for endogenous and +UTR Lhcb accumulation in this study are consistent with those previously described (Miller and Kay, 1991). The typical pattern includes a pre -dawn increase of transcript in anticipation of daybreak. This phase of accumulation is due to an increased rate of transcription, mediated by phytochromes as well as cryptochromes (Miller et al., 1995; Somers et al., 1998; Yanovsky et al., 2001). Signals from the photoreceptors manifest as the coordinated promoter activation from various transcription factors including CCA1 and LHY (Alabadi et al., 2002; Gr een and Tobin, 2002; Mizoguchi et al., 2002). Transcript levels peak at mid -day (approximately ZT6) and then begin to decrease and transcription rates decrease, returning to low levels during darkness. The kinetics of transcript accumulation and decay produce a symmetrical curve, implying the presence of an active mRNA destabilization system that mirrors the active transcriptional induction system that is active early in the subjective day. It is demonstrated in this study that the circadian oscillator not only affects the accumulation of Lhcb mRNA through a transcriptional mechanism, but also influences steady -state mRNA levels through 5 -UTR mediated destabilization. This is consistent with the

PAGE 111

111 work published by Lidder et al. ( 2005), where it was demonstra ted that the circadian oscillator mediated CCL transcript levels via the downstream element (DST) mediated decay pathway (Lidder et al., 2005). Figure 4 1 shows that the presence of the 5 -UTR affects transcription as well as transcript stability in a diur nal fashion. It has been previously shown that the 5 -UTR contains sequences that positively influence the rate of the Lhcb transcription (Folta and Kaufman, 1999) this enhancer activity is observed here under white light conditions. This finding accounts for the slower accumulation of Lhcb mRNA prior to ZT6. After the peak in accumulation, transcript levels decrease at a slower rate in the UTR lines. Although it may be unlikely, this could be attributed to an increase in late -day transcription of the UTR construct. Results from nuclear run ons show that this is not the case (K. Folta, unpublished data). Although the Lhcb : GUS transcription rates in the +UTR and -UTR transgenic line are approximately equal at ZT4, at ZT12 the rate of transcription is higher in +UTR lines, again likely due to the action of transcription enhancers in the 5 -UTR (Folta and Kaufman, 1999; K. Folta, unpublished). This finding makes the higher observed differences in steady-state accumulation more significant, as +UTR transcript l evels are lower than UTR transcript levels, even though +UTR is being transcribed at a higher rate. The integration of results from the diurnal transcript level (Figure 4 1) and the rate of transcription (K. Folta, unpublished data) indicate the presence of a robust system of 5 -UTR -mediated transcript destabilization that is most prevalent after peak daily accumulation of transcript. It is likely that the phot1 receptor is required for this response. It was observed (Figure 4 3) that on a per microgram ba sis, Lhcb transcript levels were higher in phot1 mutants. Although findings to date point to the phytochromes and the crytptochromes as the receptors mediating diurnal and circadian responses, here we present findings that phot1 may be

PAGE 112

112 required for diurnal -mediated decay of Lhcb transcripts. The phot1 receptor is required for destabilization of these transcripts after a short single pulse of BHF light (Folta and Kaufman., 2003) and it is possible that its role extends beyond etiolated seedlings. Daily oscil lations of Lhcb mRNA persist for at least one cycle when plants are transferred to constant dark or constant light conditions (Figure 4 4A and 4 4B), indicating the response is directed by the circadian oscillator. In darkness, +UTR transcripts maintain symmetrical patterns of accumulation and decay. However, the UTR transcripts accumulate and decay more slowly, resulting in an extended phase and higher transcript levels during subjective night. The signal damps after a single dark oscillation because the increase in transcription requires light input. In light free run conditions (Figure 4 4B), transcript levels increase in subsequent cycles, building on higher basal levels of transcript. In the etiolated seedling, Folta and Kaufman (2003) showed that the phot1 photoreceptor is required for BHF mediated destabilization of AtLhcb transcripts. Mutants lacking phot1 or its interacting protein, NPH3, maintain transcript levels that are most similar to UTR transcripts following a single pulse of BHF light (Fol ta and Kaufman, 2003). From these studies is can be concluded that phot1 is the receptor mediating the blue high-fluence transcript destabilization response. These experiments extend the findings to the diurnal fluctuations of Lhcb transcripts. The resul ts are significant because maintenance of diurnal Lhcb cycling (or any other diurnal or circadian entrainment) has been ascribed to the phytochrome and cryptochrome receptors (Somers et al., 1998; Devlin and Kay, 2000). Here is a case where this third cla ss of photosensor contributes to the process by targeting specific transcripts for destabilization, adding a separate point of control of Lhcb steady -state transcript levels.

PAGE 113

113 Materials and Methods Plant Constructs and Growth Conditions Arabidopsis thal iana plants were grown under long -day diurnal conditions (16h light; 8h dark) for 21 d. Plant lines contained one of two transgenes, designed to assess the influence of the 5 -UTR resident sequences on Lhcb gene expression. The first transgene, referred to as +UTR, consisted of a transcriptional fusion of the Ps Lhcb1*4 promoter ( 281 to +1) and the 5 UTR (+1 to +64) places upstream of the uidA (GUS) coding sequence. The second construct, referred to as UTR, is an identical construct without the 5 -UTR. T he same construct was also introduced into the phot1 (nph1-5 allele) mutant background via standard crossing techniques. Histochemical detection of beta -glucuronisdase activity of detached tissue confirmed the prescence of the GUS transgene. Diurnal Trans cript Decay Experiments For diurnal transcript decay experiments wild type (ecotype columbia) + or UTR and phot1 + or UTR Arabidopsis thaliana leaf material was harvested at 4 h intervals beginning at ZT0 for 24h. Leaves from at least six independent plants grown in various locations of the flat were removed from individual rosettes. At each time point, tissue was harvested in liquid nitrogen. RNA Extraction and Northern Analysis Total RNA extractions were performed as described by Folta et al. (2005) using a modified version of the protocol described by Chang et al. (1993). Leaf tissue was ground in liquid nitrogen and extracted in a CTAB extraction buffer (2% CTAB, 2%PVP, 100mM Tris HCl; ME). Equal volumes of chloroform:isoamyl were added to each sample and homogenized with a polytron at 75% of full speed. Aqueous and organic phases were separated at room temperature for 10 min at 8,000x g.

PAGE 114

114 RNA was precipitated overnight at 4C using 2M LiCl. RNA was pellete d at 4C, 10,000x g for extracted once with chloroform/isoamyl. The supernatant was precipitated with two volumes of 100% ethanol at 20C for two hours. RNA was pelleted a s before and washed in 76% ethanol, 0.3M sodium acetate. The pellet was dried and resuspended in 50 l TE (10mM Tris, 2.5mM EDTA). The concentration of the samples was determined using spectrophotometry. RNA samples were denatured in a formamide buffer (66 % v/v formamide, 8% v/v formaldehyde, 1x MOPS at 65C for 15 min) and were loaded onto an agarose gel containing formaldehyde (1x MOPS, 6% formaldehyde, 1.75% agarose). Even loading was confirmed on the gel by ethidium staining. RNA was then transferred o nto GeneScreen Plus Hybridization Transfer Membrane (PelkinElmer) using standard blotting procedures with standard sodium citrate buffers (10x SSC; 1.5M NaCl, 0.15M sodium citrate). RNA was linked to the membrane via UV crosslinking. Lhcb probes were gener ated by PCR using the following primers: 5 ATGGCCGCCTCAACAATGGC 3 and 5 CCGGGAACAAAGTTGGTGGC 3 against Arabidopsis genomic DNA. GUS probes were generated by a Bam HI/ Eco RI digestion of the pBSK101.3 plasmid (Folta and Kaufman, 1999) that contains the GU S ( uidA ) coding region. 18S was used as a probe for normalization; generated by a Hin dIII digestion of the pHA2 plasmid. pHA2 is a derivative of the pHA1 plasmid inserted into pBR322. pHA1 that contains a fragment of pea nuclear DNA including genes for 18S and 25S rRNA (Spiller et al., 1987; Glick et al., 1986; Jorgensen et al., 1982). Hybridization was performed at 62C overnight in Church Buffer (10% (w/v) bovine serum albumin, 1mM EDTA, 0.5M phosphate buffer; 7% (w/v) SDS; Church and Gilbert, 1984). B lots were washed sequentially in 1x SSC, 0.1% SDS twice (once at room

PAGE 115

115 temperature and once at 65C) and 0.1x SSC, 0.1% SDS once at 65C. Signals were then visualized by autoradiography.

PAGE 116

116 Figure 4 1.UTR mediated diurnal transcript levels. Northern blot o f Lhcb transcript levels probed with Arabidopsis Lhcb or GUS Lhcb transcript stability was assayed from 21 dold wild type Arabidopsis ; or Arabidopsis plants with a GUS transgene with the Lhcb UTR (+ UTR) or without the UTR ( -UTR). Time shown in zeitgeber (ZT) h.

PAGE 117

117 Figure 4 2. phot1 mediated diurnal transcript levels. A +UTR::GUS transgene was crossed into the phot1-5 (nph1-5 ) mutant, and the rate of transcript decay was monitored at 4 h intervals within a 24 h diurnal cycle. A) Endog enous Lhcb transcript levels are not affected by the presence of the transgene. Lhcb levels in the phot1 mutant background are similar to the levels in UTR contructs in wild type. B) In the phot1 background, the GUS decay kinetics are most similar to the Lhcb UTR transcripts in wild type, indicating that the phot1 receptor is required for this response. C) 18S ribosomal loading control. D) At different decay timepoints, GUS transcript levels are always more stable in UTR wild type construct and in the phot1 mutant background, again showing that the UTR and the phot1 receptor are required for normal decay.

PAGE 118

118 Figure 4 2. Conti nued D

PAGE 119

119 Figure 4 3 Lhcb transcript levels in wild type vs. phot1. Northern blot probed with Lhcb probe. Arabidopsis plants were grown in a long day (LD) light dark cycle (16 h L/8 h D) for 21 days. Leaf tissue was harvested every 4 h for 24 h. Lhcb transcript levels were higher in phot1 mutants compared to wild type plants.

PAGE 120

120 Figure 4 4. Is the d estabilization response under the control of the circadian oscillator? Arabidopsis plants were grown for 21 d in a long day (LD) cycle and then transferred to constant dark (DD) (A) or constant light (LL) conditions (B). (A) Tissue was harvested every 4 h for 44 h. Lhcb and GUS transcript levels were monitored over the various time points in wild type; or GUS transgene plants with the UTR (+) or without the UTR ( -). (B) Tissue was harvested every 4 h for 60 h. Graph shows GUS transcript levels with the UTR (solid line) or without the UTR (dashed line).

PAGE 121

121 REFERENCES Ahmed M, Cashmore AR (1993) Hy4 gene of A. thaliana encodes a protein with characterisctics of a blue -light photoreceptor. Nature 366: 162166 Alabad D Oyama T Yanovsky MJ Harmon FG Ms P Kay SA (2001 ) Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock Science 293:880 883 Alexander C, Faber N, Klaff P (1998) Characterization of proteinbinding to the spinach chloroplast psbA mRNA 5 untranslated regio n. Nucleic Acid. Res. 26: 22652272 Al Sady B, Ni W, Kircher S, Schfer E, Quail PH (2006) Photoactivated phytochrome induces rapid PIF3 phosphorylation prior to proteasome -mediated degradation.Mol Cell. 4: 439446 Anderson MB, Folta K, Warpeha KM, Gibbons J, Gao J, Kaufman LS (1999) Blue Light Directed Destabilization of the Pea Lhcb1*4 Transcript Depends on Sequences within the 5 Untranslated Region. The Plant Cell 11: 15791589 Anthonisen IL, Salvador ML, Klein U (2001) Specific sequence elements in t he 5' untranslated regions of rbcL and atpB gene mRNAs stabilize transcripts in the chloroplast of Chlamydomonas reinhardtii. RNA 7: 1024 1033 Arciga -Reyes L, Wootton L, Kieffer M, Davies B (2006) UPF1 is required for nonsense mediated mRNA decay (NMD) and RNAi in Arabidopsis. Plant J 47: 480489 Aronson MN Meyer AD Gyrgyey J, Katul L Vetten HJ Gronenborn B Timchenko T (2000) Clink, a nanovirus -encoded protein, binds both pRB and SKP1. J Virol. 74: 29672972 Babourina O, Newman I, Shabala S (2002) Blue light induced kinetics of H+ and Ca2+ fluxes in etiolated wild type and phototropin mutant Arabidopsis seedlings. Proc. Natl. Acad. Sci. 99: 24332438 Bai C, Sen P, Hofmann K, Ma L, Goebl M, Harper JW, Elledge SJ (1996) S KP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F -box. Cell 86: 263274 Banerjee R Batschauer A (2005) Plant blue light receptors. Planta 220: 498502 Barker GF, Beemon K (1991) Nonsense codons within the Rous sarcoma virus gag gene decrease the stability of unspliced viral RNA. Mol. Cell. Biol. 11: 2760 2768 Bauer D, Viczin A, Kircher S, Nobis T, Nitschke R, Kunkel T, Panigrahi KC, Adm E, Fejes E, Schfer E, Nagy F (2004) Constitutive photomorphogenesis 1 and multiple photoreceptors control degradation of phytochrome interacting factor 3, a transcription factor required for light signaling in Arabidopsis.Plant Cell. 6 : 14331445

PAGE 122

122 Baum G, Long JC, Jenkins GI, Trewavas AJ (1999) Stimulation of the blue light phototropic receptor NPH1 cause a transient increase in cytoplasmic Ca2+. Proc. Natl. Acad. Sci 96: 554559. Beelman CA, Stevens A, Caponigro G, LaGrandeur TE, Hatfield L, Fortner DM, Parker R (1996) An essential component of the decapping enzyme required for normal rates of mRNA turnover. Nature 382: 642646 Bernstein DS, But er N, Stumpf C, Wickens M (2002) Analyzing mRNA -protein complexes using a yeast three -hybrid system. Methods 26:12341 Bernstein E, Caudy AA, Hammond SM, Hannon GJ (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409: 363366 Bhat S, Tang L, Krueger AD, Smith CL, Ford SR, Dickey LF, Petracek ME (2004) The Fed 1 (CAUU)4 element is a 5' UTR dark responsive mRNA instability element that functions independently of dark induced polyribosome dissociation.Plant Mol B iol. 56:761 773 Binder BM, Walker JM, Gagne JM, Emborg TJ, Hemmann G, Bleecker AB, Vierstra RD (2007) The Arabidopsis EIN3 binding F Box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling. Plant Cell 19: 509523 Boudreau E, N ickelsen J, Lemaire SD, Ossenbhl F, Rochaix JD (2000) The Nac2 gene of Chlamydomonas encodes a chloroplast TPR like protein involved in psbD mRNA stability. EMBO J 19: 33663376 Briggs WR, Olney MA (2001) Photoreceptors in Plant Photomorphogenesis to Date Five Phytochromes, Two Cryptochromes, One Phototropin and a Superchrome. Plant Physiol. 125: 8288 Briggs WR (2007) The LOV domain: a chromophore module servicing multiple photoreceptors. J Biomed Sci. 14: 499504 Brown JT, Bai X, Johnson AW (2000) The yeast antiviral proteins Ski2p, Ski3p, and Ski8p exist as a complex in vivo. RNA 6: 449457 Brutnell TP Sawers RJ Mant A Langdale JA ( 1999) BUNDLE SHEATH DEFECTIVE2, a Novel Protein Required for Post Translational Regulation of the rbcL Gene of Maize. Plant Cell 11: 849 864 Burd CG, Dreyfuss G (1994) Conserved structures and diversity of functions of RNA -binding proteins. Science. 285: 615621 Butler WL, Norris KH, Siegelman HA, Hendricks SB (1959) Detection, assay and preliminary purification of the pigment controlling photoresponsive development of plants. Proc Natl Acad Sci USA 45: 1703 1708

PAGE 123

123 Caldern -Villalobos LI, Nill C, Marrocco K, Kretsch T, Schwechheimer C (2007) The evolutionarily conserved Arabidopsis thaliana F -box protein AtFBP7 is required for efficient translation during temperature stress.Gene 392:106116 Caponigro G, Parker R (1996) Mechanisms and control of mRNA turnover in Saccharomyces cerevisiae. M icrobiol Rev. 60: 233 249 Carr IA Kim JY (2002) MYB transcription factors in the Arabidopsis circadian clock. J Exp Bot 53:15511557 Carrington JC, Ambros V (2003) Role of microRNAs in plant and animal development. S cienc e 301: 336338 Cashmore AR, Jarillo JA, Wu YJ, Liu D (1999). Cryptochromes: blue light receptors for plants and animals. Science 284: 760765 Chan MT, Yu SM (1998) The 3' untranslated region of a rice alpha amylase gene mediates sugar -dependent abundance of mRNA.Plant J. 15: 685695 Chang S; Puryear J; Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11: 113 116 Chen CY, Shyu AB (1994) Selective degradation of early-response -gene mRNAs: functional a nalyses of sequence features of the AU rich elements. Mol Cell Biol. 14: 84718482 Che n H, Shen Y, Tang X, Yu L, Wang J, Guo L, Zhang Y, Zhang H, Feng S, Strickland E, Zheng N, Deng XW (2006) Arabidopsis CULLIN4 Forms an E3 Ubiquitin Ligase with RBX1 and the CDD Complex in Mediating Light Control of Development. Plant Cell. 18:19912004 Chen M, Chory J, Fankhauser C (2004). Light Signaling in Plants. Annu. Rev. Genet. 38: 87117 Chen X, Kindle KL, Stern DB (1995) The initiation codon determines the efficiency but not the site of translation initiation in Chlamydomonas chloroplasts. Pla nt Cell 7 : 12951305 Cho HY, Tseng TS, Kaiserli E, Sullivan S, Christie JM, Briggs WR (2007) Physiological roles of the light, oxygen, or voltage domains of phototropin 1 and phototropin 2 in Arabidopsis. Plant Physiol. 143: 51729 Christie JM, Briggs WR (2001) Blue Light Sensing in Higher Plants. J. Biol. Chem. 276: 1145711460 Christie JM, Reymond P, Powell GK, Bernasconi P, Raibekas AA, Liscum E, Briggs WR (1998) Arabidopsis NPH1: a flavoprotein with the properties of a photoreceptor for phototropism. Science. 282: 16981701

PAGE 124

124 Christie JM, Solomon M, Nozue K, Wada M, Briggs WR (1999) LOV (light, oxygen or voltage) domains of the blue -light photoreceptor phototropin (nph1): Bindingsites for the chromophore flavin mononucleotide. Proc. Natl. Acad. Sci. USA. 96: 87798783 Christie JM, Swartz TE, Bogomolni RA, Briggs WR (2002) Phototropin LOV domains exhibit distinct roles in regulating photoreceptor function. Plant J. 3 2 : 205219 Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci U S A 1984 81: 19911995 Clack T, Mathews S, Sharrock RA (1994) The phytochrome apoprotein family in Arabidopsis is encoded by five genes: the sequences and expression of PHYD a nd PHYE. Plant Mol. Biol. 3: 413427 Cleveland DW Yen TJ (1989) Multiple determinants of eukaryotic mRNA stability. New Biol. 1: 121126 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium -mediated transformation of Arabidopsis t haliana. Plant J 16: 735743 Coller J, Parker AR (2004). Eukaryotic mRNA Decapping. Annu. Rev. Biochem 73: 861890 Crosson S, Rajagopal S, Moffat K (2003) The LOV domain family: photoresponsive signaling modules coupled to diverse output domains. Biochemi stry 42: 2 10 Danon A, Mayfield SP (1999). Light regulated translational activators: identification of chloroplast gene specific mRNA binding proteins. EMBO J. 10: 39934001 Decker CJ, Parker R (1993) A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev. 7: 1632 1643 Decker CJ, Parker R (1994) Mechanisms of mRNA degradation in eukaryotes.Trends Biochem Sci. 19: 336340 Deng Z, Zhang X, Tang W, Oses Prieto JA, Suzuki N, Gendron JM, Chen H, G uan S, Chalkley RJ, Peterman TK, Burlingame AL, Wang ZY (2007) A proteomics study of brassinosteroid response in Arabidopsis. Mol Cell Proteomics 12: 20582071 Dharmasiri N, Dharmasiri S, Estelle M (2005) The F box protein TIR1 is an auxin receptor. Natur e 435: 441 445 Dharmasiri S, Dharmasiri N, Hellmann H, Estelle M (2003) The RUB/Nedd8 conjugation pathway is required for early development in Arabidopsis. EMBO J 8: 1762 1770 Dickey LF Gallo -Meagher M Thompson WF (1992) Light regulatory sequences are lo cated within the 5' portion of the Fed 1 message sequence EMBO J 11: 2311 2317

PAGE 125

125 Dickey LF, Patracek ME, Nguyen TT, Hansen ER, Thompson WF (1998) Light regulation of Fed 1 mRNA requires an element in the 5 untranslated region and correlates with differ ential polyribosome association. Plant Cell 10: 475484 Dieterle M, Zhou YC, Schafer E, Funk M, Kretsch T (2001) EID1, an F box protein involved in phytochrome A -specific light signaling. Genes Dev 15: 939 944 Dill A, Thomas SG, Hu J, Steber CM, Sun TP (2 004)The Arabidopsis F -box protein SLEEPY1 targets gibberellin signaling repressors for gibberellin induced degradation. P lant Cell 16: 1392 1405 Dodd AN Salathia N Hall A Kvei E, Toth R Nagy F Hibberd JM Millar AJ Webb AA (2005) Plant circadia n clocks increase photosynthesis, growth, survival, and competitive advantage Science 309: 630 633 Drager RG Girard -Bascou J Choquet Y Kindle KL Stern DB (1998) In vivo evidence for 5' > 3' exoribonuclease degradation of an unstable chloroplast mR NA. Plant J. 13: 8596 Drager RG, Higgs DC, Kindle KL, Stern DB (1999) 5' to 3' exoribonucleolytic activity is a normal component of chloroplast mRNA decay pathways.Plant J. 19: 521531 Drager RG, Zeidler M, Simpson CL, Stern DB (1996) A chloroplast trans cript lacking the 3' inverted repeat is degraded by 3' ->5' exoribonuclease activity.RNA 2 : 652-663 Duek PD, Fankhauser C (2003) HFR1, a putative bHLH transcription factor, mediates both phytochrome A and cryptochrome signaling. Plant J 34: 827836 Dunckley T, Parker R (1999) The DCP2 protein is required for mRNA decapping in Saccharomyces cerevisiae and contains a functional MutT motif. EMBO J 18: 54115422 Eibl C, Zou Z, Beck a, Kim M, Mullet J, Koop HU (1999) In vivo analysis of plastid psbA, rbcL an d rpl32 UTR elements by chloroplast transformation: tobacco plastid gene expression is controlled by modulation of transcript levels and translation efficiency. Plant J. 19: 333345 Elbashir SM, Lendeckel W, Tuschl T (2001) RNA interference is mediated b y 21and 22nucleotide RNAs. Genes & Dev. 15: 188 200 Federoff N (2002) RNA -binding proteins in plants: the tip of an iceberg. Trends Plant Biol. 5: 452459 Folta KM, Kaufman LS (1999) Regions of the Pea Lhcb1*4 Promoter Necessary for the Blue Light Reg ulation in Transgenic Arabidopsis. Plant Physiol. 120: 747755 Folta KM, Kaufman LS (2003) Phototropin 1 is required for high fluence blue -light mediated mRNA destabilization. Plant Mol. Biol. 51: 609618

PAGE 126

126 Folta KM, Lieg EJ, Durham T, Spalding EP (2003) Primary inhibition of hypocotyl growth and phototropism depend differently on phototrop in -mediated increases in cytoplasmic calcium induced by blue light. Plant Physiol. 133:14641470 Folta KM, Spalding EP (2001) Unexpected roles of cryptochrome 2 and phototropin revealed by high resolution analysis of blue light -mediated hypocotyl growth inhibition. Plant J. 26: 471478 Folta KM, Staton M, Stewart PJ, Jung S, Bies DH, Jesdurai C, Main D (2005) Expressed sequence tags (ESTs) and simple sequence repeat (SSR) markers from octoploid strawberry (Fragaria x ananassa). BMC Plant Biol 5: 12 Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD (2002) The F -box subunitof the SCF E3 complex is encoded by a diverse superfamily of genes in Arabidopsis. Proc. Natl. Acad. Sci. USA 99: 1151911524 Gagne JM, Smalle J, Gingerich DJ, Walker JM, Yoo SD, Yana gisawa S, Vierstra RD (2004) Arabidopsis EIN3 -binding F box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation, Proc. Natl. Acad. Sci. USA 101: 6803 6808 Gao J, Kaufman LS (1994) Blue Lig ht Regulation of the Arabidopsis thaliana Cab1 Gene. Plant Physiol. 104: 12511257 Gatfield D, Izaurralde E (2004) Nonsense -mediated messenger RNA decay is initiated by endonucleolytic cleavage in Drosophila Nature 429: 575 578 Gibson TJ, Thompson JD, He ringa J (1993) The KH domain occurs in a diverse set of RNA binding proteins that include the antiterminator NusA and is probably involved in binding to nucleic acid. FEBS Lett. 324: 361 366 Giuliano G, Hoffmann NE, Ko K, Scolnik PA, Cashmore AR (1988) A li ght entrained circadian clock controls transcription of several plant genes. EMBO J 7: 36353642 Givens RM, Lin M, Taylor DJ, Mechold U, Berry JO, Hernandez VJ (2004) Inducible expression, enzymatic activity, and origin of higher plant homologues of bacte rial RelA/SpoT stress proteins in Nicotiana tabacum. J Biol Chem 279: 7495 7504 Glick BR, Zeisler J, Banaszuk AM, Friesen JD, Martin WG (1981) The identification and partial characterization of a plasmid containing the gene for the membraneassociated hydrogenase from E. coli. Gene 15: 201206 Goeres DC, Van Norman JM, Zhang W, Fauver NA, Spencer ML, Sieburth LE (2007) Components of the Arabidopsis mRNA decapping complex are required for early seedling development. Plant Cell 19: 15491564 Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M (2001) Auxin Regulates SCFTIR1Dependent Degradation of the AUX/IAA Proteins. Nature 414: 271276

PAGE 127

127 Green PJ (1993). Control of mRNA stability in Higheer Plants. Plant Phys. 102: 10651070 Green RM, Tingay S, Wang ZY, Tobin EM (2002) Circadian rhythms confer a higher level of fitness to Arabidopsis plants. Plant Physiol. 2002 129: 576 84 Green RM, Tobin EM (2002) The role of CCA1 and LHY in the plant circadian clock. Dev Cell. 2 : 516518 Grunberg -Manago M (1999) Messenger RNA stability and its role in control of gene expression in bacteria and phages. Annu Rev Genet. 33: 193227 Gu Y, Deng Z, Paredez AR, DeBolt S, Wang ZY, Somerville C (2008)Prefoldin 6 is required for normal microtubule dynamics and organization in Arabidopsis. Proc Natl Acad Sci U S A 46: 1806418069 Gunawardana D, Cheng HC, Gayler KR (2008) Identification of functional domains in Arabidopsis thaliana mRNA decapping enzyme (AtDcp2). Nucleic Acids Res 36: 203216 Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2) dependent proteolysis of EIN3 transcription factor. Cell 115: 667 677 Guo H, Yang H, Mockler TC, Lin C (1998) Regulation of fl owering time by Arabidopsis photoreceptors.Science 279: 13601363 Gutirrez RA, Ewing RM, Cherry JM, Green PJ (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: Rapid decay isassociated with a group of touch and s pecific clock -controlled genes. Proc. Natl. Acad. Sci. 99: 1151311518 Gutierrez RA, MacIntosh FC, Green PJ (1999) Current prospectives on mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant Sci 4: 429 -438 Hagan KW, Ruiz Echevarria MJ, Quan Y, Peltz SW (1995) Characterization of cis acting sequences and decay intermediates involved in nonsense -mediated mRNA turnover. Mol. Cell. Biol. 15: 809 823 Hamilton A, Voinnet O, Chappell L, Baulcombe D (2002) Two classes of short inter fering RNA in RNA silencing. EMBO J 21: 46714679 Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286: 950952 Hammond SM, Bernstein E, Beach D, Hannon GJ (2000) An RNA -directed nuclease mediates post -transcriptional gene silencing in Drosophila cells. Nature 404: 293296 Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ (2001) Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293: 1146 1150

PAGE 128

128 Han M, Mason EP, Risseeuw WL, Crosby, Somers DE (2004) Formation of an SCF(ZTL) complex is required for proper regulation of circadian timing Plant J 40: 291 301 Harmon FG, Kay SA (2003) The F -box protein AFR is a positive regulator of phytochrome A mediat ed light signaling. Curr. Biol. 13: 20912096 Harper SM, Christie JM, Gardner KH (2004) Disruption of the LOV/J helix interaction activates phototropin kinase activity. Bi ochemistry 43: 16184 16192 Harper SM, Neil LC, Gardner KH (2003) Structural basis of a phototropin light switch. Science 301: 1541 1544 Harrison SJ, Mott EK, Parsley K, Aspinall S, Gray JC, Cottage A (2006) A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods 2: 19 Hayama R, Coupland G (2003) Shedding light on the circadian clock and the photoperiodic control of flowering. Curr Opin Plant Biol. 6 : 13 19 He Q Cheng P Yang Y Wang L Gardner KH Liu Y (2002) White Collar 1, a DNA binding transcription factor and a light sensor Sci ence 297: 840 843 Hellmann H, Estelle M (2002) Plant Development: Regulation by protein degradation. Science 287: 793797 Hentze MW and Khn LC (1996) Molecular control of vertebrate iron metabolism: mRNA based regulatory circuits operated by iron, ni tric oxide, and oxidative stress. Proc. Natl. Acad. Sci. USA 93: 8175 8182 Higgs DC, Colbert JT (1994) Oat phytochrome A mRNA degradation appears to occur via two distinct pathways.Plant Cell 6 : 10071019 Hill JE, Hemmingsen SM (2001) Arabidopsis thaliana type I and II chaperonins. Cell Stress Chaperone 6: 190200 Hiltbrunner A, Tscheuschler A, Viczin A, Kunkel T, Kircher S, Schfer E. (2006) FHY1 and FHL act together to mediate nuclear accumulation of the phytochrome A photoreceptor. Plant Cell Physiol. 47:10231034 Holm M, Ma LG, Qu LJ, Deng XW (2002) Two interacting bZIP proteins are direct targets of COP1 -mediated control of light -dependent gene expression in Arabidopsis. Genes Dev. 16: 12471259 Hook B, Bernstein D, Zhang B, Wickens M (2005) RNA -pro tein interactions in the yeast three hybrid system: affinity, sensitivity, and enhanced library screening. RNA 2: 227233

PAGE 129

129 Hori H and Watanabe Y (2005) UPF3 suppresses aberrant spliced mRNA in Arabidopsis Plant J. 43: 530 540 Hotta CT, Gardner MJ, Hubbard KE, Baek SJ, Dalchau N, Suhita D, Dodd AN, Webb AA (2007) Modulation of environmental responses of plants by circadian clocks. Plant Cell Environ. 30:33349 Hsu CL, Stevens A (1993) Yeast cells lacking 59 to 39 exoribonuclease 1 contain mRNA species that are poly(A) deficient and partially lack the 59 cap structure. Mol. Cell. Biol. 1 3: 4826 4835 Hua XJ, Van de Cotte B, Van Montagu M, Verbruggen N (2001) The 5' untranslated region of the At -P5R gene is involved in both transcriptional and post transcriptional regulation. Plant J. 26: 157169 Huala E, Oeller PW, Liscum E, Han IS, Larse n E, Briggs WR (1997) Arabidopsis NPH1: A protein kinase with a putative redox -sensing domain. Science 278: 21202123 Hull AK, Celenza JL (2000) Bacterial expression and purification of the Arabidopsis NADPH cytochrome P450 reductase ATR2. Protein Expr Pur if 18: 310315 Hull AK, Vij R, Celenza JL (2000) Arabidopsis cytochrome P450s that catalyze the first step of tryptophan -dependent indole 3 acetic acid biosynthesis. Proc Natl Acad Sci U S A 97: 23792384 Huq E, Quail PH (2002) PIF4, a phytochrome -interacti ng bHLH factor, functions as a negative regulator of phytochrome B signaling in Arabidopsis EMBO J. 21: 24412450 Iino M (1988) Pulse induced phototropisms in oat and maize coleoptiles. Plant Physiol 88: 823828 Imaizumi T, Schultz TF, Harmon FG, Ho LA, Kay SA (2005) FKF1 F -box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis Science 309: 293 297 Imaizumi T, Tran HG, Swartz TE, Briggs WR, Kay SA (2003) FKF1 is essential for photoperiodic specific light signaling in Arabidopsis Nature 426: 302 306 Inada S Ohgishi M Mayama T Okada K Sakai T (2004) RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin 1 in Arabidopsis thaliana. Plant Cell 16: 887 896 Iwasaki S, Takeda A, Motose H, Watanabe Y (2007) Characterization of Arabidopsis decapping proteins AtDCP1 and AtDCP2, which are e ssential for post -embryonic development. FEBS Lett 581: 24552459

PAGE 130

130 Jacobs Anderson JS Parker R (1998) Computational identification of cis -acting elements affecting post -transcriptional control of gene expression in Saccharomyces cerevisiae. Nucleic Aci ds Res. 28: 16041617 Janoudi A, Poff KL (1990) A common fluence threshold for first positive and second positive phototropism in Arabidopsis thaliana. Plant Physiol 94: 16051608 Jansson S (1999) A guide to the Lhc genes and their relatives in Arabidops is. Trends Plant Sci 4: 236240 Jansson S, Pichersky E, Bassi R, Green BR, Ikeuchi M, Melis A, Simpson DJ, Spangfort M, Staehelin LA and Thornber JP (1992) A nomenclature for the genes encoding the chlorophyll a/b binding proteins of higher plants. Plant Mol Biol Reptr 10: 242 253 Jarillo JA, Gabrys H, Capel J, Tang RH, Yang HQ, Alonso JM, Ecker JR, Cashmore AR (2001) Phototropinrelated NPL1 controls chloroplast relocation induced by blue light. Nature 410: 952954 Jofuku KD, Schipper RD, Goldberg RB (1989) A frameshift mutation prevents Kunitz trypsin inhibitor mRNA accumulation in soybean embryos. Plant Cell 1 :427435 Johanson U, Karlsson M, Johansson I, Gustavsson S, Sjovall S, Fraysse L, Weig A R, and Kjellbom P (2001) The complete set of genes encoding major intrinsic proteins in Arabidopsis provides a framework for a new nomenclature for major intrinsic proteins in plants. Plant Physiol. 126: 1358 1369 Jorgensen RA, Cuellar RE, Thompson WF, Kavanaugh TA (1987) Structure and variation in ribosomal RNA genes in pea. Characterization of a cloned rDNA repeat and chromosomal rDNA variants. Plant Mol Biol 8: 3 12 Joshi V, Laubengayer KM, Schauer N, Fernie AR, Jander G (2008) Two Arabidopsis threonine aldolases are nonredundant and compete with threonine deaminase for a common substrate pool. Plant Cell. 18: 35643575 Karlin -Neumann GA, Brus slan JA, Tobin EM (1991) Phytochrome control of the tms2 gene in transgenic Arabidopsis: a strategy for selecting mutants in the signal transduction pathway.Plant Cell 3 : 57382 Kasahara M, Swartz TE, Olney MA, Onodera A, Mochizuki N, Fukuzawa H, Asami zu E, Tabata S, Kanegae H, Takana M, Christie JM, Nagatani A, Briggs WR (2002) Photochemical properties of the FMN -binding domains of the phototropins from Arabidopsis rice and Chlamydamonas Plant Physiol. 129: 762773 Kastenmayer JP, Green PJ (2000) Novel features of the XRN -family in Arabidopsis: evidence that AtXRN4, one of several orthologs of nuclear Xrn2p/Rat1p, functions in the cytoplasm. Proc Natl Acad Sci U S A 97: 1398513990

PAGE 131

131 Kawaga T, Sakai T, Suetsugu N, Oikawa K, Ishiguro S, Kato T, Taba ta S, Okada K, Wada M (2001) Arabidopsis NPL1 a phototropin homolog controlling the chloroplast high light avoidance response. Science 291: 21382141 Kawaguchi R, BaileySerres J (2005) mRNA sequence features responsible for translational regulation in Arabidopsis. Nucleic Acids Res. 33: 955965 Kendrick MD, Chang C (2008) Ethylene signaling: new levels of complexity and regulation. Curr Opin Plant Biol 11: 479485 Kendrick RE Kronenberg GHM (1994) Photomorphogenesis in Plants. Kluwer Academic Publishe rs, Dordrecht, The Netherlands Kennis JT, Crosson S (2007) Microbiology. A bacterial pathogen sees the light. Science 317: 10411042 Kepinski S, Leyser O (2005) The Arabidopsis F box protein TIR1 is an auxin receptor, Nature 435: 446 451 Kevany BM, Tiema n DM, Taylor MG, Cin VD, Klee HJ (2007) Ethylene receptor degradation controls the timing of ripening in tomato fruit. Plant J 51: 458467 Kiba T, Henriques R, Sakakibara H, Chua NH (2007) Targeted degradation of PSEUDO RESPONSE REGULATOR5 by an SCFZTL co mplex regulates clock function and photomorphogenesis in Arabidopsis thaliana. Plant Cell 1 9 : 25162530. Kim J, Mayfield SP (2002) The active site of the thioredoxinlike domain of chloroplast protein disulfide isomerase, RB60, catalyzes the redoxregula ted binding of chloroplast poly(A) binding protein, RB47, to the 5' untranslated region of psbA mRNA. Plant Cell Physiol. 43: 12381243 Kim L, Kircher S, Toth R, Adam E, Schfer E, Nagy F (2000) Light -induced nuclear import of phytochrome -A:GFP fusion prot eins is differentially regulated in transgenic tobacco and Arabidopsis. Plant J. 22:125133 Kim MJ, Kim HR, Paek KH (2006) Arabidopsis tonoplast proteins TIP1 and TIP2 interact with the cucumber mosaic virus 1a replication protein. J Gen Virol 87: 34253431 Kim WY, Fujiwara S, Suh SS, Kim J, Kim Y, Han L, David K, Putterill J, Nam HG, Somers DE (2007) ZEITLUPE is a circadian photoreceptor stabilized by GIGANTEA in blue light. Nature 449:3563 60 Kinoshita T, Doi M, Suetsugu N, Kagawa T, Wada M, Shimazak i K (2001) phot1and phot2 mediate blue light regulation of stomatal opening. Nature 414: 656 660 Kircher S, Kozma Bognar L, Kim L, Adam E, Harter K, Schafer E, Nagy F (1999) Light quality dependent nuclear import of the plant photoreceptors phytochrome A and B Plant Cell. 11:14451456

PAGE 132

132 Kiyosue T, Wada M (2000) LKP1 (LOV kelch protein 1): a factor involved in the regulation of flowering time in arabidopsis. Plant J. 23: 807815 Klausner RD, Rouault TA, Harford JB (1993) Regulating the fate of mRNA: the c ontrol of cellular iron metabolism. Cell. 72: 1928 Kleine T, Kindgren P, Benedict C, Hendrickson L, Strand A (2007) Genome -Wide Gene Expression Analysis Reveals a Critical Role for CRYPTOCHROME1 in the Response of Arabidopsis to High Irradiance Plant Physiol. 144: 1391 1406 Koncz C and Schell J (1986) The promoter of the TLDNA gene 5 controls the tissue -specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204: 383 396 Ko (1989) Dependence of the phototropic response of Arabidopsis thaliana on fluence rate and wavelength. Proc Natl Acad Sci U S A 86: 98769880 Kunzelmann P, Iino M, Schifer E (1988) Phototropism of maize coleoptiles: influences of light gradients. Planta 176: 212220 Kuroda H, Takahashi N, Shimada H, Seki M, Shinozaki K, Matsui M (2002) Classification and expression analysis of Arabidopsis F -box -containing protein genes. Plant Cell Physiol 43: 10731085 LaGrandeur TE, Parker R (1998) Isolation and characterization of Dcp1p, the yeast mRNA decapping enzyme. EMBO J 17: 14871496 Lariguet P, Schepens I, Hodgson D, Pedmale UV, Trevisan M, Kami C, de Carbonnel M, Alonso JM, Ecker JR, Liscum E, Fankhauser C (2006) PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism.Proc Natl Acad Sci U S A. 103:1013410139 Larimer FW, Stevens A (1990) Disruption of the gene XRN1, coding for a 5' ---3' exoribonuclease, restricts yeast cell growth. Gene 95: 85 90 Lechner E Achard P Vansiri A Potuschak T Genschik P (2006) F box proteins everywhere. Curr Opin Plant Biol. 9 : 631638 Lidder P, Gutierrez RA, Salome PA, McClung CR, Green PJ (2005) Circadian control of mRNA s tability. Association with a sequence -specific mRNA decay pathway. Plant Physiol 138: 23742385 Lin C (2002) Blue light receptors and signal transduction. Plant Cell. 14: S207 225 Lin C, Ahmed M, Gordon D, Cashmore AR (1995) Expressing an Arabidopsis cryp tochrome gene in transgenic tobacco results in hypersensitivity to blue, UV -A, and green light. Proc. Natl. Acad. Sci. 92: 84238427

PAGE 133

133 Lin C, Shalitin D (2003) Cryptochrome structure and signal transduction. Annu Rev Plant Biol. 54: 469496 Liscum E, Brig gs W (1995) Mutations in the NPH1 locus of Arabidopsis disrupt the perception of phototropic stimuli. Plant Cell 7: 473485 Liscum E, Briggs W (1996) Mutations of Arabidopsis in potential transduction and response components of the phototropic signaling pa thway. Plant Physiol. 112: 291296 Liscum E, Hodgson DW, Campbell TJ (2003) Light Signaling through the Cryptochromes and Phototropins. So Thats What the Blue is All About. Plant Physiol. 133: 14291436 Lorkovic ZJ, Barta A (2002) Genome analysis: RNA R ecognition Motif (RRM) and K homology (KH) domain RNA -binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30: 623635 Marcotte WR Jr Russell SH Quatrano RS (1989) Abscisic acid responsive sequences from the Em gene of wheat Plant Cell 1 : 969 976 Maris C Dominguez C Allain FH (2005) The RNA recognition motif, a plastic RNA binding platform to regulate post transcriptional gene expression. Febs J. 272: 2118 2131 Marrocco K, Zhou Y, Bury E, Dieterle M, Funk M, Genschik P, Krenz M, Stolpe T, Kretsch T (2006) Functional analysis of EID1, an F -box protein involved in phytochrome A -dependent light signal transduction. Plant J 45: 423 438 Marrs KA, Kaufman LS (1989) Blue -light regulation of transcription for nuclear genes in pea. Proc Natl Acad Sci U S A. 86: 44924495 Martin F, Michel F, Zenklusen D, Mll er B, Schmperli D (2000) Positive and negative mutant selection in the human histone hairpin -binding protein using the yeast three -hybrid system. Nucleic Acids Res 28: 15941603 Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T (2002) Single -stra nded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110: 563 574 Martnez Garca JF, Huq E, Quail PH (2000) Direct targeting of light signals to a promoter element -bound transcription factor.Science 288: 859863 Mas P, Kim WY, Somers DE, Kay SA (2003) Targeted degradation of TOC1 by ZTL modulates circadian function in Arabidopsis thaliana. Nature 426: 567 570 Mathews S Lavin M, Sharrock RA (1995) Evolution of the phytochrome gene family and its utility for phylogenetic analyses of angiosperms Annals of the Missouri Botanical Garden 82: 296 321 Mathews S, Sharrock RA (1997) Phytochrome gene diversity. Plant Cell Environ 20: 666671

PAGE 134

1 34 McClure BA, Guilfoyle TJ (1989). Rapid distribution of Auxinregulated RNAs during gravitropism. Science. 243: 9193 McCormac DJ, Litz H, Wang J, Gollnick PD, Berry JO (2001) Light associated and processing dependent protein binding to 5' regions of rbcL mRNA in the chloroplasts of a C4 plant.J Biol Chem. 276: 34763483 McGinnis KM, Thomas SG, Soule JD, Strader LC, Zale JM, Sun TP, Steber CM (2003) The Arabidopsis SLEEPY1 gene encodes a putative F box subunit of an SCF E3 ubiquitin ligase. Plant Cell 15: 1120 1130 Millar AJ, Carre IA, Strayer CA, Chua NH, Kay SA (1995) Circadian clock mutants in Arabidopsis ide ntified by luciferase imaging. Science 267: 1161 1163 Miller AJ, Kay SA (1991) Circadian Control of CAB gene transcription and mRNA accumulation in Arabidopsis. Plant Cell 3: 541550 Mizoguchi T, Wheatley K, Hanzawa Y, Wright L, Mizoguchi M, Song HR, Carr IA, Coupland G (2002) LHY and CCA1 are partially redundant genes required to maintain circadian rhythms in Arabidopsis. Dev Cell 2: 629641 Mizusawa K, Masuda S, Ohta H (2008) Expression profiling of four RelA/SpoT like proteins, homologues of bacterial stringent factors, in Arabidopsis thaliana. Planta 228: 553562 Mizutani M, Ohta D (1998) Two isoforms of NADPH:cytochrome P450 reductase in Arabidopsis thaliana. Gene structure, heterologous expression in insect cells, and differential regulation. Plant P hysiol 116: 357367 Monde RA, Schuster G, Stern DB (2000) Processing and degradation of chloroplast mRNA. Biochemie 82: 573582 Moon J, Parry G, Estelle M (2004) The ubiquitinproteasome pathway and plant development. Plant Cell. 1 6 : 31813195 Motochoul ski A, Liscum E (1999) Arabidopsis NPH3: A NPH1 photoreceptor interacting protein essential for phototropis. Science 286: 961964 Muckenthaler MU, Galy B, Hentze MW (2008) Systemic iron homeostasis and the ironresponsive element/iron regulatory protein ( IRE/IRP) regulatory network. Annu Rev Nutr 28: 197213 Muhlrad D, Decker CJ, Parker R (1994) Deadenylation of the unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5' ->3' digestion of the transcript. Genes Dev 8: 855866 Muhlrad D Decker CJ, Parker R (1995) Turnover mechanisms of the stable yeast PGK1 mRNA. Mol. Cell. Biol. 15: 2145 2156

PAGE 135

135 Muhlrad D, Parker R (1994) Premature translational termination triggers mRNA decapping. Nature 370: 578581 Mullen JL, Weinig C, Hangarter RP (2006). Shade avoidance and the regulation of leaf inclination in Arabidopsis. Plant Cell Environ 29: 10991106 Nakasako M, Matsuoka D, Zikihara K, Tokutomi S (2005) Quaternary structure of LOV domain containing polypeptide of Arabidopsis FKF1 protein. FEBS Lett. 14: 10671071. Nelson DC, Lasswell J Rogg LE, Cohen MA, Bartel B (2000) FKF1, a clock -controlled gene that regulates the transition to flowering in Arabidopsis Cell 101: 331 340 Nemhauser J, Chory J (2002) Photomorphogenesis. In CR Somerville, EM Meyerwitz, eds, The Arabidopsis Book. American Society of Plant Biologists, Rockville, MD Newbury SF (2006) Control of mRNA stability in eukaryotes. Biochem Soc Trans 34: 3034 Newman TC Ohme Takagi M Taylor CB Green PJ (1993). DST sequences, highly conserved among plant SAUR genes, target reporter transcripts for rapid decay in tobacco. Plant Cel l 5: 701714 Ni M, Tepperman JM, Quail PH (1998) PIF3, a phytochrome interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix -loophelix protein.Cell. 25: 657667 Ni W, Xie D, Hobbie L, Feng B, Zhao D, Akkara J, Ma H (2004) Regulation of flower development in Arabidopsis by SCF complexes, Plant Physiol 134: 1574 1585 Nickelsen J (2000) Mutations at three different nuclear loci of Chlamydomonas suppress a defect in chloroplast psbD mRNA accumulation. Curr Genet 37: 136 142 Nickelsen, J, Fleischmann M, Boudreau E, Rahire M, Rochaix JD (1999) Identification of cis acting RNA leader elements required for chloroplast psbD gene expression in Chlamydomonas Plant Cell 11: 957 970 Nishimura Y, Kikis EA, Zimmer SL, Komin e Y, Stern DB (2004) Antisense transcript and RNA processing alterations suppress instability of polyadenylated mRNA in chlamydomonas chloroplasts.Plant Cell 16: 28492869 Nozue K, Covington MF, Duek PD, Lorrain S, Fankhauser C, Harmer SL, Maloof JN (20 07) Rhythmic growth explained by coincidence between internal and external cues. Nature. 19: 358361 Oh E, Kim J, Park E, Kim JI, Kang C, Choi G (2004) PIL5, a phytochrome interacting basic helix loop -helix protein, is a key negative regulator of seed ge rmination in Arabidopsis thaliana.Plant Cell. 16: 30453058

PAGE 136

136 Olmedo G, Guo H, Gregory BD, Nourizadeh SD, Aguilar -Henonin L, Li H, An F, Guzman P, Ecker JR (2006) ETHYLENE INSENSITIVE5 encodes a 5' ->3' exoribonuclease required for regulation of the EIN3 -tar geting F -box proteins EBF1/2. Proc Natl Acad Sci U S A 103: 1328613293 Orban TI, Izaurralde E (2005) Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA. 11: 459469 Ossenbhl F, Nickelsen J (2000) cis and trans -Acting d eterminants for translation of psbD mRNA in Chlamydomonas reinhardtii. Mol Cell Biol. 20: 81348142 Osterlund MT, Wei N, Deng XW (2000) The roles of photoreceptor systems and the COP1targeted destabilization of HY5 in light control of Arabidopsis seedling development.Plant Physiol. 124:15201524 Parker R, Song H (2004) The enzymes and control of eukaryotic mRNA turnover. Nat. Struct.& Mol. Biol. 11: 121 127 Pazhouhandeh M, Dieterle M, Marrocco K, Lechner E, Berry B, Brault V, Hemmer O, Kretsch T, Richar ds KE, Genschik P, Ziegler -Graff V (2006) F boxlike domain in the polerovirus protein P0 is required for silencing suppressor function. Proc Natl Acad Sci USA 103: 1994 1999 Pedmale UV, Liscum E (2007) Regulation of phototropic signaling in Arabidopsis via phosphorylation state changes in the phototropin 1 interacting protein NPH3. J Biol Chem. 282:1999220001 Peltz SW, Brown AH, Jacobson A (1993) mRNA destabilization triggered by premature translational termination depends on three mRNA sequence eleme nts and at least one trans acting factor. Genes Dev. 7: 1737 1754 Perron K, Goldschmidt -Clermont M, Rochaix JD (1999) A factor related to pseudouridine synthases is required for chloroplast group II intron trans -splicing in Chlamydomonas reinhardtii. EMBO J. 1 8 : 64816490 Petroski MD, Deshaies RJ (2005) Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol 6 : 9 20 Pickart CM (2001) Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70: 503533 Pilgrim ML, Caspar T, Quail PH, McClung CR (2003) Circadian and light regulated expression of nitrate reductase in Arabidopsis. Plant Mol Biol. 23: 349364 Potuschak T, Lechner E, Parmentier Y, Yanagisawa S, Grava S, Koncz C, Genschik P (2003) EIN3dependent regulation of plant eth ylene hormone signaling by two Arabidopsis F box proteins: EBF1 and EBF2. Cell 115: 679 689

PAGE 137

137 Potuschak T, Vansiri A, Binder BM, Lechner E, Vierstra RD, Genschik P (2006) The exoribonuclease XRN4 is a component of the ethylene response pathway in Arabidopsi s. Plant Cell 18: 30473057 Qiao H, Wang F, Zhao L, Zhou J, Lai Z, Zhang Y, Robbins TP, Xue Y (2004) The F -box protein AhSLF -S2 controls the pollen function of S RNase -based self -incompatibility. Plant Cell 16: 2307 2322 Quail PH, Briggs WR, Chory J, Hangar ter RP, Harberd NP, Kendrick RE, Koornneef M, Parks B, Sharrock RA, Schafer E, Thompson WF, Whitelam GC (1994) Spotlight on Phytochrome Nomenclature. Plant Cell. 6: 468471 Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP (2002) MicroRNAs in plan ts. Genes Dev. 16: 1616 1626 Roth R, Hall LN, Brutnell TP, Langdale JA (1996) bundle sheath defective2, a Mutation That Disrupts the Coordinated Development of Bundle Sheath and Mesophyll Cells in the Maize Leaf. Plant Cell. 8: 915927 Sachs AB (1993) Messe nger RNA degradation in eukaryotes. Cell 74: 413-421 Sakai T, Kagawa T, Kasahara H, Swartz TE, Christie JM, Briggs WR, Wada M, Okada K (2001) Arabidposis nphi and npl1: Blue light receptors that mediate both phototropism and chloroplast relocation. Proc. Natl. Acad. Sci. USA 98: 69696974 Sakamoto K, Nagatani A (1996) Nuclear localization activity of phytochrome B. Plant J. 1 0 :859868 Sakamoto W, Kindle KL, Stern DB (1993) In vivo analysis of Chlamydomonas chloroplast petD gene expression using stable t ransformation of beta -glucuronidase translational fusions.Proc Natl Acad Sci U S A 90: 497501 Sakamoto W, Sturm NR, Kindle KL, Stern DB (1994) petD mRNA maturation in Chlamydomonas reinhardtii chloroplasts: role of 5' endonucleolytic processing. Mol Cel l Biol. 14: 61806186 Salom PA, McClung, CR (2005) PSEUDORESPONSE REGULATOR 7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian clock. Plant Cell 17: 791 803 Salomon M, Christie JM, Knieb E, Lempert U, Briggs WR (2000) Photochemical and mutational analysis of the FMN -binding domain of the plant photoreceptor, phototropin. Biochemistry 39: 9401 9410 Salomon M, Lempert U, Rdiger W (2004) Dimerization of the plant photoreceptor phototropin is probably mediated by the LOV1 domain. FEBS Lett 572: 8 10

PAGE 138

138 Salvador ML, Klein U, Bogorad L (1993) Light regulated and endogenous fluctuations of chloroplast transcript levels in Chlamydomonas. Regulation by transcription and RNA degradation.Plant J. 3 : 213219 Salvador ML, Suay L, Anthonisen IL, Klein U (2004) Changes in the 5' untranslated region of the rbcL gene accelerate transcript degradation more than 50 -fold in the chloroplast of Chlamydomonas reinhardtii.Curr Genet. 45:176182 Samach A, Klenz JE, Kohalmi SE, Risseeuw E, Haughn GW, Crosby WL (1999) The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F -box protein required for normal patterning and growth in the floral meristem, Plant J 20: 433 445 Sambrook ML, Fritsch EF, Maniatis T (19 89) Molecular cloning: a laboratory manual (2nd edn). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Sasaki A, Itoh H, Gomi K, Ueguchi -Tanaka M, Ishiyama K, Kobayashi M, Jeong DH, An G, Kitano H, Ashikari M, Matsuoka M (2003) Accumulation of phosphorylated repressor for gibberellin signaling in an F -box mutant. Science 299: 1896 1898 Schneider -Poetsch HAW, Kolukisaoglu Clapham DH, Hughes J, Lamparter T (1998) Non angiosperm phytochromes and the evolution of vascular plants. Physiol. P lant. 102: 612 622 Schomburg FM, Patton DA, Meinke DW, Amasino RM (2001) FPA, a gene involved in floral induction in Arabidopsis, encod es a protein containing RNA recognition motifs. Plant Cell 13: 14271436 Schultz TF, Kiyosue T, Yanovsky M, Wada M, Kay SA (2001) A role for LKP2 in the circadian clock of Arabidopsis Plant Cell 13: 2659 2670 Schwartz DC, Parker R (2000) mRNA decapping in yeast requires dissociation of the cap binding protein, eukaryotic translation initiation factor 4E. Mol Cell Biol 20: 79337942 SenGupta DJ, Zhang B, Kraemer B, Pochart P, Fields S, Wickens M (1996) A three hybrid system to detect RNA -protein interac tions in vivo. Proc. Natl. Acad. Sci. 93: 84968501 Sharrock RA, Clack T (2004) Heterodimerization of type II phytochromes in Arabidopsis. Proc Natl Acad Sci U S A 101: 1150011555 Sharrock RA, Quail PH (1989) Novel phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family. Genes Dev. 11: 17451757 Shen Y, Danon A, Christopher DA (2001) RNA bindingproteins interact specifically with the Arabidopsis chloroplast mRNA 5 unt ranslated region in a redox dependent manner. Plant Cell Physiol. 42: 10711078

PAGE 139

139 Shiina T Allison L, Maliga P (1998) rbcL Transcript levels in tobacco plastids are independent of light: reduced dark transcription rate is compensated by increased mRNA stab ility. Plant Cell 10: 1713 1722 Shyu AB, Greenberg ME, Belasco JG (1989) The c -fos transcript is targeted for rapid decay by two distinct mRNA degradation pathways. Genes Dev. 3 : 60 72 Sijacic P, Wang X, Skirpan AL, Wang Y, Dowd, McCubbin AG, Huang S, Ka o TH (2004) Identification of the pollen determinant of S RNase -mediated self -incompatibility, Nature 429: 302 305 Siomi H, Matunis MJ, Michael WM, Dreyfuss G (1993) The pre -mRNA binding K protein contains a novel evolutionarily conserved motif. Nucleic A cids Res. 21: 1193 1198 Smalle J, Vierstra RD (2004) The ubiquitin 26S Proeosome proteolytic pathway. Annu. Rev. of Plant Biol. 55: 555590 Somers D, Webb A, Pearson M, Kay S (1998) The short period mutant, toc1 -1 alters circadian clock regulation of mu ltiple outputs throughout development in Arabidopsis thaliana. Development 125: 485 494 Somers DE (1999) The physiology and molecular bases of the plant circadian clock. Plant Physiol. 121: 9 20 Somers DE, Kim WY, Geng R (2004) The F box Protein ZEITLU PE Confers Dosage Dependent Control of Circadian Clock, Photomorphogenesis and Flowering Time. Plant Cell 16: 769782 Somers DE, Schultz TF, Milnamow M, Kay SA (2000) ZEITLUPE encodes a novel clock associated PAS protein from Arabidopsis Cell 101: 319 329 Souret FF, Kastenmayer JP, Green PJ (2004) AtXRN4 degrades mRNA in Arabidopsis and its substrates include selected miRNA targets. Mol Cell 15: 173183 Spalding EP, Folta KM (2005) Illuminating topics in plant photobiology. Plant Cell Environ. 28: 3953 Spiller SC, Kaufman LS, Thompson WF, Briggs WR (1987) Specific mRNA and rRNA Levels in Greening Pea Leaves during Recovery from Iron Stress' Plant Physiol. 84: 409414 Stern DB, Radwanski ER, Kindle KL (1991) A 3' stem/loop structure of the Chlamydomona s chloroplast atpB gene regulates mRNA accumulation in vivo. Plant Cell 3 : 285297 Stoelzle S, Kawaga T, Wada M, Hendrich R, Dietrich P (2003) Blue light activates calcium permeable channels in Arabidopsis mesophyll cells via the phototropin signaling p athway. Proc. Natl. Acad. Sci. 100: 14561461

PAGE 140

140 Strader LC, Ritchie S, Soule JD, McGinnis KM, Steber CM (2004) Recessive interfering mutations in the gibberellin signaling gene SLEEPY1 are rescued by overexpression of its homologue, SNEEZY Proc Natl Acad Sci USA 101: 12771 12776 Suay L, Salvador ML, Abesha E, Klein U (2005) Specific roles of 5' RNA secondary structures in stabilizing transcripts in chloroplasts. Nucleic Acids Res. 33: 47544761 Sun L, Tobin EM (1990) Phytochrome -regulated expression of genes encoding light harvesting chlorophyll a / b protein in two long hypocotyl mutations and wild type plants of Arabidopsis thaliana Photochem Photobiol. 52: 51 56 Sun Y Zhou X, Ma H (2007) Genome -wide Analysis of Kelch Repeat -containing F -box Fam ily Journal of Integrative Plant Biol. 49: 940952 Swartz TE, Corchnoy SB, Christie JM, Lewis JW, Szundi I, Briggs WR, Bogomolni RA (2001) The photocycle of a flavin -binding domain of the blue light photoreceptor phototropin. J Biol Chem. 28: 36493500 Swartz TE, Tseng TS, Frederickson MA, Paris G, Comerci DJ, Rajashekara G, Kim JG, Mudgett MB, Splitter GA, Ugalde RA, Goldbaum FA, Briggs WR, Bogomolni RA (2007) Blue light activated histidine kinases: two -component sensors in bacteria. Science 317: 10901093 Takemiya A, Inoue S, Doi M, Kinoshita T, Shimazak K (2005) Phototropins Pomote Plant Growth in Response to Blue Light in Low Light Environments. Plant Cell. 17: 11201127 Taylor BL, Zhulin IB (1999) PAS domains: internal sensors of oxygen, redox pot ential, and light. Microbiol Mol Biol Rev. 63: 479506 Tilghman JA, Gao J, Anderson MB, Kaufman LS (1997) Correct blue light regulation of pea Lhcb genes in and Arabidopsis background. Plant Mol. Biol. 35: 293-302 Toulokhonov II, Shulgina I, Hernandez VJ (2001) Binding of the transcription effector ppGpp to Escherichia coli RNA polymerase is allosteric, modular, and occurs near the N terminus of the beta' -subunit. J Biol Chem 276: 12201225 Trebitsh T, Danon A (2001) Translation of chloroplast psbA mRNA is regulated by signals initiated by both photosystems II and I. Proc. Natl. Acad. Sci. 98: 1228912294 Ulm R, Baumann A, Oravecz A, Mt Z, Adm E, Oakeley EJ, Schfer E, Nagy F (2005) Genome -wide analysis of gene expression reveals function of the bZI P transcription factor HY5 in the UV-B response of Arabidopsis. Proc Natl Acad Sci U S A. 101:13971402 Urban P, Mignotte C, Kazmaier M, Delorme F, Pompon D (1997) Cloning, yeast expression, and characterization of the coupling of two distantly related A rabidopsis thaliana NADPH cytochrome P450 reductases with P450 CYP73A5. J Biol Chem 272: 19176 19186

PAGE 141

141 Vainberg IE, Lewis SA, Rommelaere H, Ampe C, Vandekerckhove J, Klein HL, Cowan NJ (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93: 863 873 Vaistij FE, Boudreau E, Lemaire SD, Goldschmidt -Clermont M, Rochaix JD (2000) Characterization of Mbb1, a nucleus -encoded tetratricopeptide like repeat protein required for expression of the chloroplast psbB / psbT / psbH gene cluster in Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 97: 14813 14818 Valverde F Mouradov A Soppe W Ravenscroft D Samach A Coupland G (2004) Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 13:10031006 van der Biezen EA, Sun J, Coleman MJ, Bibb MJ, Jones JD (2000) Arabidopsis RelA/SpoT homologs implicate (p)ppGpp in plant signaling. Proc Natl Acad Sci USA 97: 3747 3752 van Hoof A, Green PJ (1996) Premature nonsense codons decrease the stability of phytohemagglutinin mRNA in a position-dependent manner. Plant J. 10: 415424 van Hoof A, Green PJ (1997) Rare codons are not sufficient to destabilize a reporter gene transcript in tobacco. Plant Mol Biol. 35: 383387 Vaucheret H, Bclin C, Fagard M (2001) Post transcriptional gene silencing in plants.J Cell Sci. 114: 30833091 Voelker TA, Staswick P Chrispeels MJ (1986) Molecular analysis of two phytohemagglutinin genes and their expression in Phaseolus vulgaris cv. Pinto, a lectin -deficient cultivar of the bean. EMBO J. 5 : 30753082 Wagner D, Fairchild CD, Kuhn RM, Quail PH (1996) Chromophore -bea ring NH2 terminal domains of phytochromes A and B determine their photosensory specificity and differential light lability. Proc Natl Acad Sci U S A 93: 40114015 Wang H, Ma LG, Li JM, Zhao HY, Deng XW (2001) Direct interacting with Arabipsosis cryptochro mes with COP1 in light control development. Science 294: 154158 Warpeha KM, Lateef SS, Lapik Y, Anderson M, Lee BS, Kaufman LS (2006) G protein coupled receptor 1, G protein Galpha -subunit 1, and prephenate dehydratase 1 are required for blue light -indu ced production of phenylalanine in etiolated Arabidopsis. Plant Physiol 140: 8 44855 Weston E, Thorogood K, Vinti G, Lpez -Juez E (2000) Light quantity controls leaf -cell and chloroplast development in Arabidopsis thaliana wild type and blue light percept ion mutants. Planta 211: 807815 White MJ, Kaufman LS, Horwitz BA, Briggs WR, Thompson WF (1995) Individual Members of the Cab Gene Family Differ Widely in Fluence Response. Plant Physiol. 107: 161165

PAGE 142

142 Wilusz CJ, Gao M, Jones CL, Wilusz J, Peltz SW (2001) Poly(A) binding proteins regulate both mRNA deadenylation and decapping in yeast cytoplasmic extracts. RNA 7: 14161424 Woelfle MA, Ouyang Y, Phanvijhitsiri K, Johnson CH (2004) The adaptive value of circadian clocks: an experimental assessment in cya nobacteria Curr. Biol. 14: 1481 1486 Wostrikoff K, Stern D (2007) Rubisco large -subunit translation is autoregulated in response to its assembly state in tobacco chloroplasts. Proc Natl Acad Sci U S A 104: 64666471 Xie DX, Feys BF, James S, Nieto -Rostro M, Turner JG (1998) COI1 : an Arabidopsis gene required for jasmonate regulated defense and fertility. Science 280: 1091 1094 Xu D, Wang Y, Willecke R, Chen Z, Ding T, Bergmann A (2006) The effector caspases drICE and dcp 1 have partially overlapping fu nctions in the apoptotic pathway in Drosophila. Cell Death Differ 13: 16971706 Xu L, Liu F, Lechner E, Genschik P, Crosby WL, Ma H, Peng W, Huang D, Xie D (2002) The SCF(COI1) ubiquitin -ligase complexes are required for jasmonate response in Arabidops is Plant Cell 14: 1919 1935 Yakir E, Hilman D, Hassidim M, Green RM (2007) CIRCADIAN CLOCK ASSOCIATED1 transcript stability and the entrainment of the circadian clock in Arabidopsis. Plant Physiol. 145: 92532 Yamaguchi R, Nakamura M, Mochizuki N, Kay S A, Nagatani A (1999) Light -dependent translocation of a phytochrome B GFP fusion protein to the nucleus in transgenic Arabidopsis. J Cell Biol. 145: 437445 Yang HQ, Tang RH, Cashmore AR (2001) The signaling mechanism of Arabidopsis CRY1 involves direct interaction with COP1.Plant Cell. 13:25732587 Yanovsky MJ, Mazzella MA, Whitelam GC, Casal JJ (2001) Resetting of the circadian clock by phytochromes and cryptochromes in Arabidopsis. J Biol Rhythms 165: 523 530 Yohn CB, Cohen A, Rosch C, Kuchka MR, Mayfie ld SP (1998) Translation of the chloroplast psbA mRNA requires the nuclear -encoded poly(A) -binding protein, RB47. J Cell Biol. 142: 435 442 Zamore PD, Tuschl T, Sharp PA, Bartel DP (2000) RNAi: double -stranded RNA directs the ATP -dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell. 101: 2533 Zou Z, Eibl C, Koop HU (2003) The stem loop region of the tobacco psbA 5'UTR is an important determinant of mRNA stability and translation efficiency. Mol Genet Genomics 269: 340 349

PAGE 143

143 BIOGRAPHICAL SKETCH Thelma Farai Madzima was born in 1983 in Harare, Zimbabwe. In fall 2000 she moved to Georgia, USA. In May 2004, she earned her B.S. in agriculture from Fort Valley State University, majoring in plant science/biotechnology, under the mentorship of Dr. Sarwa n Dhir. During her years as an undergraduate student, she took advantage of summer apprenticeship programs available to her and spent summer 2002 interning at the California Institute of Technology working with Dr. Toshiro Ito in the lab of Dr. Elliot Meye rowitz. In summer 2003, she interned at the University of Florida (UF) working with Dr. Denise Tiemen in the lab of Dr. Harry Klee, who introduced her to the Plant Molecular and Cellular Biology Program at UF, which she joined as a graduate student in fall 2004. After a series of laboratory rotations, she became a member the lab of Kevin Folta in summer 2005. In August 2008 she married Clyde Arthur Graham, Jr. Upon completion, she will join the lab of Dr. Karen McGinnis at Florida State Univerisity as a po stdoctoral fellow.