<%BANNER%>

Molecular Engineering of Multifunctional Nucleic Acid Probes for Bioanalytical and Biomedical Applications

Permanent Link: http://ufdc.ufl.edu/UFE0023647/00001

Material Information

Title: Molecular Engineering of Multifunctional Nucleic Acid Probes for Bioanalytical and Biomedical Applications
Physical Description: 1 online resource (161 p.)
Language: english
Creator: Sohn Kim, Young
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Over the past few decades, the role of nucleic acids including deoxyribonucleic acids and ribonucleic acids in purely biological systems has been defined, and these versatile compounds have also been integrated into nanoscience. As a result, many different types of DNA probes and architectures have been proposed to detect a wide range of targets, such as ions, small molecules, nucleic acids, proteins, and even living organisms. These developments have been accelerated by advanced technologies for modifying the nucleic acid-based probes with different signaling mechanisms and bases of nucleic acids with organic functional groups. The overall goal of this doctoral research is dedicated to engineering these biomolecular components with the objective of building novel molecular tools and devices for biological studies, biomedical research and therapeutic applications. In cell biology, alteration of the expression levels of nucleic acids or spatial localization often reflects important cellular events. Tracking such alterations in the native cellular environment can be one of the most effective ways to advance biology, drug discovery and therapeutic treatment of injury and infection. Because this requires robust probes for reliable intracellular studies, we have been designing molecular probes using nonstandard nucleic acids, such as L-DNAs, locked nucleic acids, 2?-OMe RNAs, to extend probe lifetimes and enhance the sensitivity and selectivity. The second phase of this research has involved the molecular assembly of artificially selected functional ssDNA sequences called aptamers. To amplify the inhibitory functions of aptamer, the multivalent interaction concept has been applied to engineer aptamers with high affinity and specificity for a given target. The process involves assembly of multiple ligands and target binding via multiple sites. The binding of the resulting assembly is much stronger than that of the individual ligands, resulting in excellent inhibition of target proteins. The third phase of this research has involved the development of photo-regulating nucleic acid probes, in which photochromic compounds are incorporated into the DNA chains to alter the hybridization characteristics. We have utilized these compounds to design nucleic acid inhibitors which can regulate functions with photons, and we have developed a nanoarchitecture made of DNA and photochromic compounds. The final project was development of an ultra-sensitive heavy metal sensor. Since metal ion detection is of great importance in human health and environmental monitoring, better sensing technology for heavy metal ions is sorely needed. With this aim, we developed lead-specific ultrasensitive nucleic acid sensor with subnanomolar detection limits, superior sensitivity, and excellent selectivity. In summary, this research has focused on the design, synthesis and investigation of multifunctional and advanced nucleic acid probes, with the ultimate goal of increasing the understanding of biological processes and the development of advanced molecules for nucleic acid-based detection and therapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Young Sohn Kim.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0023647:00001

Permanent Link: http://ufdc.ufl.edu/UFE0023647/00001

Material Information

Title: Molecular Engineering of Multifunctional Nucleic Acid Probes for Bioanalytical and Biomedical Applications
Physical Description: 1 online resource (161 p.)
Language: english
Creator: Sohn Kim, Young
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Over the past few decades, the role of nucleic acids including deoxyribonucleic acids and ribonucleic acids in purely biological systems has been defined, and these versatile compounds have also been integrated into nanoscience. As a result, many different types of DNA probes and architectures have been proposed to detect a wide range of targets, such as ions, small molecules, nucleic acids, proteins, and even living organisms. These developments have been accelerated by advanced technologies for modifying the nucleic acid-based probes with different signaling mechanisms and bases of nucleic acids with organic functional groups. The overall goal of this doctoral research is dedicated to engineering these biomolecular components with the objective of building novel molecular tools and devices for biological studies, biomedical research and therapeutic applications. In cell biology, alteration of the expression levels of nucleic acids or spatial localization often reflects important cellular events. Tracking such alterations in the native cellular environment can be one of the most effective ways to advance biology, drug discovery and therapeutic treatment of injury and infection. Because this requires robust probes for reliable intracellular studies, we have been designing molecular probes using nonstandard nucleic acids, such as L-DNAs, locked nucleic acids, 2?-OMe RNAs, to extend probe lifetimes and enhance the sensitivity and selectivity. The second phase of this research has involved the molecular assembly of artificially selected functional ssDNA sequences called aptamers. To amplify the inhibitory functions of aptamer, the multivalent interaction concept has been applied to engineer aptamers with high affinity and specificity for a given target. The process involves assembly of multiple ligands and target binding via multiple sites. The binding of the resulting assembly is much stronger than that of the individual ligands, resulting in excellent inhibition of target proteins. The third phase of this research has involved the development of photo-regulating nucleic acid probes, in which photochromic compounds are incorporated into the DNA chains to alter the hybridization characteristics. We have utilized these compounds to design nucleic acid inhibitors which can regulate functions with photons, and we have developed a nanoarchitecture made of DNA and photochromic compounds. The final project was development of an ultra-sensitive heavy metal sensor. Since metal ion detection is of great importance in human health and environmental monitoring, better sensing technology for heavy metal ions is sorely needed. With this aim, we developed lead-specific ultrasensitive nucleic acid sensor with subnanomolar detection limits, superior sensitivity, and excellent selectivity. In summary, this research has focused on the design, synthesis and investigation of multifunctional and advanced nucleic acid probes, with the ultimate goal of increasing the understanding of biological processes and the development of advanced molecules for nucleic acid-based detection and therapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Young Sohn Kim.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0023647:00001


This item has the following downloads:


Full Text

PAGE 1

1 MOLECULAR ENGINEERING OF MULTIFUNCTIONAL NUCLEIC ACID PROBES FOR BIOANALYTICAL AND BIOMEDICAL APPLICATIONS By YOUNGMI KIM A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Youngmi Kim

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS I am deeply indebted to a long list of people who made this dissertation possible. First, I wish to express my gratitude to my adviso r, Dr. Weihong Tan. His a dvice, suggestions, and encouragement were greatly helpful for advancin g and progressing projects and were the driving sources that kept me challengi ng to be a better scientist ev ery day. In addition, I thank Dr. Charles Martin, Dr. Nicole Horestein, Dr David Powell and Dr. Powell Holloway on my graduate committee. The advice, assistance, a nd encouragement from my committee are highly appreciated. This dissertation is a re sult of successful collaborations with scientists in different areas. I would like to thank Dr Chaoyong James Yang for guiding me when I started the very first research project. I greatly appr eciate Dr. Zeihui Charles Cao for initiating the molecular assembly project and thought me fluorescence spectroscopy. I appreciate Dr. Haipeng Liu and Joeshep Philips for the critical comments and help in development of azobenzene-modified nucleic acid probes. I appreciate Dr. Donn Dennis in department of anesthesiology for initiating selection project using bivalir udine. I am very thankful for Hui Wangs hard working on the unimolecular nucleic acid sensor project. I also would like to thank Colin Medley and Joshua Smith for their special friendship. The Tan research group is a sp ecial place to work. The help and friendship from former and current group members make my memory of Gainesville enjoyabl e and unforgettable. I would like to thank Dr. Ronghua Yang, Dr. Char les Lofton, Dr. Dihua Shangguan, Dr. Zhiwen Tang, Dr. Lin Wang, Dr. Alina Munteanu Dr Pr abodhika Mallikaratchy, Dr. Carmen Maria Estevez Dr. Yufen Huang, Dr. Liu Yang, Dr. Xiaoling Zhang, Karen Martinez, Hui Chen, Kwame Sefah, Parag Parekh, Eunjung Lee, Ya nrong Wu, Huaizhi Kang, Yan Chen, Meng Ling, Megan ODonoghue, Dalia Lopez-Colon, Jennifer Martin, Suwussa Bamrungsap, Zhi Zhu, Xu

PAGE 5

5 Ye, Xiaolan Chen, Sewon Bae, Dimitri Simaey s Van Basri Gulbakan, Elizabeth Jimenez, Xiangling Xiong for their friendship, encouragement, and help. I am deeply indebted to my mother for he r unconditional love, support, and guidance and strong spirit. I thank my brothers for their l ove. I am grateful to my husband, Dosung Sohn for being a wonderful friend, helpful colleague, a nd supportive spouse who enable me to succeed. I thank my lovely daughter, Mia Sohn, for being su ch a great daughter and bringing every kind of joy to my life every moment.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES .........................................................................................................................10LIST OF FIGURES .......................................................................................................................11ABSTRACT ...................................................................................................................... .............14 CHAP TER 1 INTRODUCTION .................................................................................................................. 16Review of Nucleic Acid Structures ........................................................................................ 16Chemical Synthesis of Nucleic Acids ..................................................................................... 18Fluorescence Methods for Signal Transduction ..................................................................... 22Fluorescence Mechanism ................................................................................................22Fluorescence Quenching Mechanism ..............................................................................24Fluorescence Resonance Energy Transfer (FRET) ......................................................... 25Nucleic Acid in Biology .........................................................................................................27Using MBs for RNA Monitoring in Living Cells ........................................................... 30Engineering MBs for Intracellular Analysis ....................................................................33Systematic Evolution of Ligands by Exponential Enrichment (SELEX) ............................... 35Polyvalent Interactions ...........................................................................................................38Thermodynamic Model to Describe Cooperativity ......................................................... 39Kinetics and Enhanced Affinity ...................................................................................... 41DNAzymes ...................................................................................................................... .......41Blood Coagulation and Thrombin .......................................................................................... 43Coagulation ................................................................................................................... ...43Thrombin Structure .........................................................................................................44Photochromic Switches ..........................................................................................................45Photochromism ................................................................................................................ 45Azobenzene .................................................................................................................... .482 SUPERIOR STRUCTURAL STABILIT Y AND SELECTIVITY OF HAIRPIN NUCLEIC ACID PROBES W ITH AN L-DNA STEM ......................................................... 50Introduction .................................................................................................................. ...........50Experimental Section ..............................................................................................................54Synthesis of MBs and Their Targets ............................................................................... 54Hybridization Experiments ..............................................................................................55Melting Temperature (Tm) Measurement of MBs .......................................................... 56Protein Sensitivity Tests .................................................................................................. 56Results and Discussion ........................................................................................................ ...57

PAGE 7

7 Stability and Sensitivity of L-DNA Stem MBs (LS MBs) .............................................. 57Improved Structural Stability. .........................................................................................59Elimination of Intramolecular Interaction ....................................................................... 60Elimination of False Positive Signal ............................................................................... 63Biostablility of LS MBs ...................................................................................................65Conclusions .............................................................................................................................693 MOLECULAR ASSEMBLY FOR HIGH PERFORMANCE BIVALENT NUCLEIC ACID INHI BITOR .................................................................................................................70Introduction .................................................................................................................. ...........70Experimental Section ..............................................................................................................73Chemicals and Reagents: ................................................................................................. 73Synthesis and Purification of Monoand Bivalent NA Ligands and Their Targets ....... 73Clotting Time Tests ......................................................................................................... 75Real-Time Monitoring of the Clotting Reaction .............................................................75Monitoring of Apparent kon and koff .................................................................................76Reversible Binding Reacti on Using Target DNAs .......................................................... 76Human Plasma Tests ....................................................................................................... 77Results and Discussion ........................................................................................................ ...77Thrombin Aptamers and Their Properties ....................................................................... 77Design of Bivalent NA Inhibitors ....................................................................................79Monitoring Inhibitory Functions Using Light Scattering ................................................ 81Binding Kinetics Studies .................................................................................................83Antidote Effect of Binding Aptamers ..............................................................................88Antithrombin Potency of Bi-8S ....................................................................................... 89Conclusions .............................................................................................................................914 DEVELOPMENT OF DENDRITIC APTAMER ASSEMBLIES AS SUPERIOR INHIBITORS .................................................................................................................... ......93Introduction .................................................................................................................. ...........93Experimental Section ..............................................................................................................94Synthesis of Multim eric Assemblies ............................................................................... 94Real-Time Monitoring of Coagulation Process ............................................................... 94PT Measurement ..............................................................................................................94Results and Discussion ........................................................................................................ ...95Design of Multimeric Assemblies ................................................................................... 95Validation of Products .....................................................................................................97Superior Anticoagulation Potency ................................................................................... 97Real-Time Monitoring of Clotting Reaction ................................................................... 99Conclusions ...........................................................................................................................100

PAGE 8

8 5 USING PHOTONS TO MANIPULATE ENZYME INHIBITION BY AN AZOBENZENE-MODI FIED NUCLEIC ACID PROBE ....................................................102Introduction .................................................................................................................. .........102Experimental Section ............................................................................................................104Chemicals and Reagents ................................................................................................104Synthesis of Azobenzene Phosphoramidite ................................................................... 105Synthesis and Purification of Photoc hromic Self-regulating Inhibitor .........................106Real-Time Monitoring of Clotting Reaction ................................................................. 106Human Plasma Tests ..................................................................................................... 108Monitoring Site-Specific Ac tivation of Enzymatic Reaction in Microfluidic Channel ...................................................................................................................... 109Results and Discussion ........................................................................................................ .110Optimization of Probe Designs .....................................................................................110Function as Photo-Switching Anticoagulant ................................................................. 114Dynamic Photoconversion to Restore Coagulation Process ......................................... 116Spatially Controllable Activation of Coagul ation Reaction in Microfluidic Channel .. 118Conclusions ...........................................................................................................................1226 UNIMOLECULAR CATALYTIC-DNA SE NS OR FOR ULTRASENSITIVE DETECTION ..................................................................................................................... ...124Introduction .................................................................................................................. .........124Experimental Section ............................................................................................................127Chemicals and Reagents ................................................................................................127Synthesis and Purification of Fluorescently Labeled Oligonucleotides ........................128Determination of Melting Temperature ......................................................................... 128Hybridization Assay ......................................................................................................129Single Molecular Reaction ............................................................................................130Gel-Based Activity Assay ............................................................................................. 131Results and Discussion ........................................................................................................ .131Optimization of the Hairpin Structure Sensor Design ................................................... 132Excellent Se nsitivity ...................................................................................................... 134Superior Selectivity .......................................................................................................136Single Ion Reaction ....................................................................................................... 137Conclusions ...........................................................................................................................1407 SUMMARY AND FUTURE DIRECTIONS ....................................................................... 141Molecular Engineering of Multifunctional Nucleic Acid Probes for Bioanalytical and Biomedical Applications ................................................................................................... 141Future Directions ..................................................................................................................143Developing High Throughput Me tal-Screening Chip ................................................... 143Pharmaceutical Application of Multifunctional Drugs .................................................145

PAGE 9

9 LIST OF REFERENCES .............................................................................................................147BIOGRAPHICAL SKETCH .......................................................................................................161

PAGE 10

10 LIST OF TABLES Table page 1-1 Comparisons between aptamer and antibody .................................................................... 381-2 Thermodynamic parameters to describe cooperativity. ..................................................... 412-1 Copy number of each sequence in biological nucleic acid sequences ............................... 512-2 Sequences of hairpin pr obes and their targets .................................................................... 552-3 Signal to background (S/B) of each MB was calculated and compared. ........................... 582-4 Comparisons of stem me lting temperatures of MBs .......................................................... 602-5 MB 1-1 and its target sequences ........................................................................................622-6 Calculated melting temperature of each target with its complementary sequence. ........... 643-1 DNA sequences. S means one unit of spacer phosphoramidite (hexaet hylene glycol). .... 744-1 Sequences of multim eric assemblies. ................................................................................ 965-1 Sequences of probes. A in red refers to azobenzene. ....................................................... 1075-2 Characterized properties of each probe ............................................................................ 1126-1 Names and sequences of DNA. ....................................................................................... 1286-2 Comparison of melting temperature and fluorescence enhancement among different design sequences. .............................................................................................................133

PAGE 11

11 LIST OF FIGURES Figure page 1-1 Components of nucleic acids ............................................................................................. 161-2 Nucleotide structure and linkage via phosphate groups. ................................................... 171-3 Base pairing of DNA. ........................................................................................................171-4 Structure of cytosine phosphoramidite (top) and four monomers of nucleic acid phosphoramidite (bottom). ................................................................................................. 191-5 Nucleic acid synthesis. .......................................................................................................201-6 Jablonski diagram for fluorescence mechanism. ............................................................... 231-7 Spectral overlap between donors emi ssion and acceptors excitation (left) and description of fluorescence resona nce energy transf er (right). .......................................... 261-8 Working principle of molecular beacons. .......................................................................... 291-9 Intracellular imaging of single cells using MB probes ...................................................... 321-10 Molecular structures of 2-OMe RNA, locked nucleic acid (LNA), and peptide nucleic acid (PNA). ........................................................................................................... .331-11 Background signal of LNA-MB and DNA-MB as a function of time after being injected into cells. .......................................................................................................... ....351-12 Systematic Evolution of Ligands by Exponential Enrichment (SELEX). ......................... 371-13 Multivalent interactions. ................................................................................................ ....391-14 Structure of thrombin. ................................................................................................... .....441-15 Light induced hydrogen transfer tautomerization .............................................................. 461-16 Photocyclization. ................................................................................................................471-17 Cis-trans isomerization .................................................................................................. ....481-18 Molecular structure of az obenzene and energy diagram. ..................................................492-1 Molecular beacon design and interactions .........................................................................512-2 Responses of LS MBs and DS MBs to the targets.............................................................582-3 Melting temperature profiles of DS and LS MB 1 ............................................................ 60

PAGE 12

12 2-4 Elimination of stem and loop interaction using a L-DNA stem ........................................ 622-5 Comparison of selectivity of LS MB 1 and DS MB 1 ....................................................... 642-6 Nuclease resistance of LS and DS MB. ............................................................................. 662-7 Characterization of biostability of LS OMe MBs(green) compared to DS MBs(blue) ..... 672-8 Characterization of biostability of LS LNA MBs (red) compared to DS MBs(blue) ........683-1 Working principles of monova lent and bivalent NA ligands. ........................................... 783-2 Comparison of the normalized clotting times of thrombin bound to different NA inhibitors .................................................................................................................... ........793-3 Real-time monitoring of s cattered light generated by the coagulation process in the presence of different monovalent or bivalent NA ligands (Bix Ss) ................................... 823-4 Comparison of koff. Real-time fluorescence signal change of koff measurement ............. 843-5 Investigation of concentration eff ect of T-15Apt in binding comparison ......................... 853-6 Comparison of kon ............................................................................................................. 863-7 Investigation of the di ssociation of T-15Apt ....................................................................873-8 Reversible inhibitory function ...........................................................................................893-9 Comparison of anticoagulant potency of Bi-8S and 15Apt using human plasma and aPTT .......................................................................................................................... .........903-10 Comparison of anticoagulant potency of Bi-8S and 15Apt using human plasma and PT measurements ............................................................................................................... 914-1 The sequences and schematic of dendritic aptamer assemblies ......................................... 964-2 Agarose gel image with ethi dium bromide (EB) staining. ................................................ 974-3 Dose-dependent prothrombin time (PT) ............................................................................ 984-4 Real-time monitoring of thrombin activity ...................................................................... 1005-1 Photoisomerization of azobenzene in nucle ic acid chain (a) and working principle of Xc-Yazo probes (b) ..........................................................................................................1035-2 Synthesis of azobenzene phosphoramidite. ..................................................................... 1065-3 Insertion of azobenzene phosphoramidite to DNA chains. ............................................. 107

PAGE 13

13 5-4 Relationship between melting temperat ure and the num ber of base pairs and azobenzene insertions (a) a nd (b) and the photo-regulating inhibitory f unction (c) of probes. ....................................................................................................................... .......1135-5 PT measurement using each probecis and trans (a), (b), (c), and (d) and IC200 of each probes state (e) .......................................................................................................1155-6 Dynamic alteration of thrombin s activity by switching 9c-8azo-cis to trans ..............1175-7 Imaging clotting reaction in a microfluidic device .......................................................... 1205-8 Fluorescence intensity alteration of different zones in real-time. .................................... 1215-9 Site-specific activation of thrombins activity using a laser pointer in a microfluidic device ...............................................................................................................................1226-1 The hairpin structure DNAzyme-based Pb2+ sensor and the working principle .............. 1276-2 Fluorescence signal in the ab sence and presence of 10uM Pb2+ after 10 min. ................ 1336-3 PAGE-gel image of probes in th e absence and presence of 10uM Pb2+ after 10 min ..... 1346-4 Fluorescence increase over background at varying Pb2+ concentrations .........................1356-5 Kinetics of fluorescence increase for D10 in 5uM Pb2+ ..................................................1356-6 Selectivity of D10 Pb2+ sensor .........................................................................................1376-7 Single ion reaction ki netics inside polycaborna te membrane vials ................................. 1397-1 Surface-immobilized Pb2+ chip. (a) microarray and anticip ated results. (b) shows the cartoon to describe working princi ple of the metal sensor chip. ..................................... 1447-2 Mouse model to show photo-co ntrollable anticoagulation. ............................................. 146

PAGE 14

14 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR ENGINEERING OF MULTIFUNCTIONAL NUCLEIC ACID PROBES FOR BIOANALYTICAL AND BIOMED ICAL APPLICATIONS By Youngmi Kim December 2008 Chair: Weihong Tan Major: Chemistry Over the past few decades, the role of nucle ic acids including deoxyribonucleic acids and ribonucleic acids in purely biolog ical systems has been define d, and these versatile compounds have also been integrated into nanoscience. As a result, many different types of DNA probes and architectures have been proposed to detect a wide range of targets, such as ions, small molecules, nucleic acids, proteins, and even living organisms. These developments have been accelerated by advanced technologies for modifying the nucleic acid-based probes with different signaling mechanisms and bases of nucleic acids with organic functional groups. The overall goal of this doctoral research is dedicated to engineering these biomolecula r components with the objective of building novel molecular tools and devices for biological studi es, biomedical research and therapeutic applications. In cell biology, alteration of the expression le vels of nucleic acids or spatial localization often reflects important cellular events. Track ing such alterations in the native cellular environment can be one of the most effectiv e ways to advance biology, drug discovery and therapeutic treatment of injury and infection. Because this re quires robust probes for reliable intracellular studies, we have been designing mol ecular probes using nonstandard nucleic acids,

PAGE 15

15 such as L-DNAs, locked nucleic acids, 2-OMe RNAs, to extend probe lifetimes and enhance the sensitivity and selectivity. The second phase of this research has invol ved the molecular assembly of artificially selected functional ssDNA sequences called aptamers. To amplify the inhi bitory functions of aptamer, the multivalent interaction concept has been applied to engineer aptamers with high affinity and specificity for a given target. The process involves assembly of multiple ligands and target binding via multiple sites. The binding of the resulting assembly is much stronger than that of the individual ligands, resulting in ex cellent inhibition of target proteins. The third phase of this research has involve d the development of photo-regulating nucleic acid probes, in which photochromic compounds ar e incorporated into the DNA chains to alter the hybridization characte ristics. We have utilized thes e compounds to design nucleic acid inhibitors which can regulate functions with photons, and we have developed a nanoarchitecture made of DNA and photochromic compounds. The final project was development of an ultra-sensitive heavy metal sensor. Since metal ion detection is of great importance in huma n health and environmental monitoring, better sensing technology for heavy metal ions is sorely needed. With this aim, we developed leadspecific ultrasensitive nucleic acid sensor w ith subnanomolar detection limits, superior sensitivity, and excellent selectivity. In summary, this research has focused on the design, synthesis and investigation of multifunctional and advanced nucleic acid probes, with the ultimate goal of increasing the understanding of biological processes and the de velopment of advanced molecules for nucleic acid-based detection and therapy.

PAGE 16

16 CHAPTER 1 INTRODUCTION Nucleic acids carry genetic inform ation from parent cell to daughter cell and from individuals to their offspring. Th ese universal cellular componen ts also regulate many biological reactions. Nucleic acids are largely divided into two groups: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Since thei r functions were elucidated in the mid-twentieth century, nucleic acids have been transformed and diversif ied into many research areas, from basic biology to computational and materials science engineeri ng. For readers unfamiliar w ith this subject, the first section of this dissertati on gives a brief overview of nucleic acid structure and function. Review of Nucleic Acid Structures The m olecular building blocks for DNA and RNA polymers are shown in Figures 1-1 and 1-2. The monomer units, called nucleotides, whic h contain a sugar (2-d eoxyribose in DNA and ribose in RNA) are esterified to a phosphate. Th e sugar is also linked to a cyclic base via a -Nglycosidic bond. The nucleotides are bonded by phosphate linkages between the 3 and 5 carbons of the sugars. Figure 1-1.Components of nucleic acids

PAGE 17

17 O OH O H H H H P O O OO OH O H H H H P O O OO OH O H H H H P O OO OBase Base Base O H O H H H H P O O OO H O H H H H P O O OO H O H H H H P O OO OBase Base BaseDeoxyribonucleicacid(DNA) Ribonucleicacid(RNA) Figure 1-2. Nucleotide structure and linkage via phosphate groups Figure 1-3. Base pairing of DNA The secondary structure of DNA was formulat ed in the 1950s by Rosalind Franklin, James Watson and Francis Crick (Figure 1-3).1 X-ray data obtained by Rosalind Franklin showed that DNA has a double helix formation. In 1953, Wats on and Crick proposed an ingenious double

PAGE 18

18 helix model for DNAs, in which complementary bases (C and G; A and T) on each strand are linked by hydrogen bonds (3 H-bonds for C-G; 2 H-bonds for A-T). The two strands align antiparallel to each other in the co il, leading to a double helix struct ure. This high molecular weight nucleic acid (109 Daltons or grea ter) is found primarily in the nuc lei of complex cells, known as eukaryotic cells, or in the nucleotide regions of prokaryot ic cells, such as bacteria. Biological information is encoded in the DNA polymers via successive groups of three nucleotides. Each 3-base code corresponds to a certain amino acid in the coded protein. To access this information the pattern is transcribe d to RNA templates, a lower molecular weight, but much more abundant nucleic acids. Three kinds of RNAs have been identified. The largest subgroup (85 to 90%) is ribosomal RNAs (rRNA s), the major component of ribosomes. The sizes of rRNA molecules vary, but they are ge nerally smaller than DNAs. The other forms of RNAs are messenger RNAs (mRNAs), which carry the transcribed code to the ribosomes, and transfer RNAs (tRNAs), which carry the correct amino acid corresponding to the 3-base code to the growing polypeptide chain. Both mRNAs and tRNAs have transient lifetimes. Recently, regulatory RNAs, such as microRNAs and siRNAs, were newly discovered. Chemical Synthesis of Nucleic Acids After com plete structures of nucleic acids were clearly elucidated, the phosphoramidite method was developed to synthesi ze artificial nucleic acids by an automated system. Thus, nucleic acids have become popular building blocks for designing molecular probes due not only to their capability for selective recognition agains t a wide range of targets but also automated DNA synthesis technology for highly efficient and reproducible synthesis with a variety of modifications for numerous applications in biological studies. The basis of the synthetic chemistry is solid-support synthesis of o ligonucleotide via phosphoramidite chemistry.2,3

PAGE 19

19 Phosphoramidites are composed of different functional groups (Figure 1-4). To eliminate side reactions during the synthe sis of nucleic acids, primary amines of bases are blocked by appropriate protecting groups that are vulnerable to basic condition, such that they can be effectively removed by strong bases. 5-O is capped by dimethoxytrityl (DMT) group to selectively activate 5OH under strong acidic condition. The phosphate is also protected by diisopropylamino and 2-cyanoethyl groups for se lective activation under appropriate condition. Any modifiers, such as fluorophore, biotin, amine, and polyethylene glycol linker, share the same strategy to design functional phosphoramidites. Figure 1-4. Structure of cytosine phosphoramidit e (top) and four monomers of nucleic acid phosphoramidite (bottom) The synthesis is carried out in a column c ontaining a solid contro lled-pore glass (CPG) support, where the 3'-hydroxyl of the first nucleotide or modified functional group is attached

PAGE 20

20 through a long spacer arm. This support allows ex cess reagents to be removed by washing and eliminates the need for tedious purification st eps during the synthesis process. The synthesis requires four chemical reaction steps: 1) detr itylation, 2) coupling, 3) capping and 4) oxidation (Figure 1-5). In the first step, detritylation, the trityl pr otecting group on the 5 oxygen is removed to activate the 5' hydroxyl on the growi ng oligonucleotide attached to CPG, by passing strong acidic reagents, such as 3% of dichloroac etic acid (DCA) or trichl oroacetic acid (TCA) in dichloromethane (DCM) through th e column. After deprotection a nd removal of excess acid with acetonitrile, coupling takes plac e (step 2) by adding a phosphoramid ite derivative of the next Figure 1-5. Nucleic acid synthesis

PAGE 21

21 nucleotide in the presence of tetrazole, a weak ac id. The tetrazole plays two important roles in conjugating the monomers. It pr otonates the nitrogen of the diisopropylamine group on the 3'phosphorous of the incoming nucleotide to pr oduce a tetrazolyl phosphoramidite, which is susceptible to nucleophilic attack by the activat ed 5 hydroxyl group to form a phosphite linkage. After coupling, the column is washed to remove any extra tetrazole followed by the capping step. Since the coupling yield cannot reach 100%, there are always a small percentage of failure sequences, which must be capped to prevent fu rther coupling and the need to remove DNAs having one or more sequences missing. Capping (step 3) is accomplished by adding acetic anhydride and N-methylimidazole in tetrahydrofuran to the reaction column. Only residual bare 5-hydroxyl groups are acetylate d, but not the DMT-protected 5 hydroxyl groups. Capping is followed by oxidation (step 4), in which the less stable phosphite is oxidized to the stable pentavalent phosphate tri-ester using iodine as the oxidizing agent and water as the oxygen donor. After completion of these four steps, one nucleotide has been added to the chain, which is now ready for the next round of conjugation. Following the complete synthesis, post-tre atment cleaves the product from the solid support and deprotects the ni trogen bases by reaction with ammonium hydroxide at high temperature, normally above 50oC. However, if fragile modifiers are present, this procedure is changed to avoid such a harsh condition. For example, 1-[3-(4-mono methoxytrityloxy)propyl]1'-[3-[(2-cyanoethyl)-(N,N-diisopr opyl phosphoramidityl]propyl]-3,3,3',3'tetramethylindodicarbocyanine chlori de (Cy5 phosphoramidite) and 6-(4monomethoxytritylamino) hexyl-(2-cyanoethyl )-(N,N-diisopropyl)-phos phoramidite (MMT-NH2 modifier) are vulnerable to strong basic conditions and often decompose or lose the 5-protecting group. After the completion of cleavage and ba se deprotection, the oligonucleotide is

PAGE 22

22 precipitated in ethanol/NaCl. After incubation at -20oC for 30 minutes, the precipitated solid is obtained with high speed centrifugation. The solid is re-dissolved in 0.1 M triethylam monium acetate (TEAA), pH 7, for the further high-performance liquid chromatography (HPLC) purification. HPLC purifi cation strongly relies on the hydrophobic protecting group (generally DMT) remains on the 5 position after successful synthesis of the desired oligonucleotide. Th e typical mobile phase for oligonucleotide purification for HPLC is 0.1 M TEAA, pH 7, and acetonitrile. After the purified oligonucleotide is dried, the DMT group is removed by incubati on with 80% acetic ac id. The reaction is quenched with ethanol followed by vacuum dryi ng. The pure oligonucleotide is then quantified by UV measuring absorption at 260nm. Fluorescence Methods for Signal Transduction Fluorescence m easurement has been the most popular and convenient analytical method for a variety of investigations in bioanalytical, biochemical, and chemical research due to its high sensitivity, nondestructive nature, and multiplexi ng capabilities. Fluorescence can be easily incorporated into other signaling mechanisms, such as fluorescence quenching, fluorescence resonance energy transfer (FRET), fluorescence lifetime and fluorescence anisotropy to monitor a molecular recognition event. Thus, modificatio n of nucleic acid pr obes with fluorescent molecules and incorporation of various signaling transductions have been the most popular approaches in the design of nucleic acid probes. Fluorescence Mechanism Fluorescence is one of the relaxation m ech anisms for electronically excited molecules.4,5 There are a number of pathways by which the excited molecules ca n return to ground state, and Figure 1-6, termed a Jablonski diagram, shows a fe w of these processes. The singlet (no unpaired electrons) ground state is labeled S 0, with S1 and S2 as singlet excited states. The labels T1 and

PAGE 23

23 T2 refer to triplet excited states (2 unpaired electrons). When exposed to electromagnetic radiation (EMR), the chromophore is excited to an upper vibrational level in S1 (or in S2). Then, the excited molecule drops to the ground vibrat ional level of the S1 state via vibrational relaxation. If conditions are favorable, the molecule returns to an upper vibrational level in S0 by emission of visible EMR. This process, called fluorescence, occurs in the 109 to 105 seconds of the time range. The energy lost through vibra tional relaxation causes the red shift (longer wavelength), which allows the clear differentia tion of the emission signal from the excitation signal. Besides this fluorescence emission, there are several other pathways for returning to the ground state from the excited singlet state, including non-radiative decays (generally thermal relaxation) and intersystem crossing to a triplet excited stat e (phosphorescence). Figure 1-6. Jablonski diagra m for fluorescence mechanism

PAGE 24

24 Fluorescence Quenching Mechanism Am ong the various non-radiative processes for releasing energy, fluorescence quenching is one of the most popular signaling mechanisms for studying molecular interactions between nucleic acid probes and their targ ets. Fluorescence quenching occu rs via two major mechanisms: collisional quenching and static quenching. In collisional (or dynamic) quenching, the excited molecule collides with other molecules or ions in the solution, including solvent molecules, resulting in energy loss by the fluorophore. As a result, the fluorophore returns to the ground state without generating photons. The decay of fluorescence intensity caused by collisional quenching can be described usi ng the Stern-Volmer equation: ]Q[k1]Q[K1 F F0q 0 (1-1) in which F0 = Initial fluorescence in tensity without quencher F = Fluorescence intensity with quencher K = Stern-Volmer quenching constant (M1) kq = Bimolecular quenching rate constant (M1s1) 0 = Fluorescence lifetime in the absence of the quencher (s) [Q] = quencher concentration (M) In aqueous solutions at room temper ature, a fluorophore with a lifetime, 0, of 1 ns generally has a Stern-Volmer quenching constant of about 10 M1 for a typical quencher. This estimation suggests that, for quencher concentrations in the millimolar range, the effect of quenching is not significant. However, when the fluorophore and the quencher are covalently linked to each other, the collision rate can be dramatically elevat ed due to the close proximity, and not thereby depending on diffusion, which results in significant quenching.

PAGE 25

25 In static quenching, the quencher forms a non-fluorescent complex (dark complex), FQ, with the fluorophore in the ground state. The rela tionship between the fluorescence decrease and the quencher concentration is given by: ]F[ ]FQ[ 1]Q[K1 F Ff 0 (1-2) in which Kf = Formation constant for FQ [FQ] = Concentration of the dark complex [F]: Concentration of fluorophore [Q]: Concentration of quencher. Unlike dynamic quenching, fluorescence lifetime does not change in static quenching, because the only observed fluorescence is from the free fluorophore, which possesses the same lifetime as before quenching. In contrast, dynamic quenc hing causes the lifetime to decrease by the same factor as the fluorescence intensity In addition, the effect of temp erature is different for the two types of quenching. In static quenching, elevated temperature causes the quenching efficiency to decrease due to dissociation of the weakly bound FQ complex. On the other hand, accelerated diffusion rate at elevated temperature increase s the collisional quenching rate, resulting in a significant decrease of fluorescence. Static quenc hing can be incorporated into the design of molecular probes for studying molecular recognition. The typical example is the molecular beacon, which is described later in this chapter. Fluorescence Resonance Energy Transfer (FRET) In FRET, the excitation energy is transferred from an initially excited donor (D) molecule to an acceptor (A) molecule via a long range dipole-d ipole interaction.5 FRET generally requires spectral overlap between the em ission of the donor and the abso rption of the acceptor and close proximity of D and A (less than 10nm) to allo w coupling by dipole-dipole interaction (Figure 1-

PAGE 26

26 7). FRET often results a decrease of the donors fluorescence and an increase of the acceptors fluorescence. The rate of energy transfer depe nds upon several factors, such as the spectral overlap between the emission spectrum of the donor and the absorption spectrum of the acceptor, the quantum yield of the donor and acceptor, an d the relative orientation of the donor and acceptor transition dipoles. The FRET efficiency, E, also depends strongly on the distance between the two molecules, as described in the following equation: 66 0 6 0rR R E (1-3) In which R0 = Frster radius where ener gy transfer is 50% efficient r = distance between the donor and the acceptor Figure 1-7. Spectral overlap between donors emission and accep tors excitation (left) and description of fluorescence resonance energy transfer (right)

PAGE 27

27 The strong distance dependency of FRET efficiency has been widely exploited in molecular structure and dynamics studies, intermolecular association detection, intermolecular binding assays, as well as molecular probe design. Nucleic Acid in Biology One of the largest fields in which nucleic acids are utilized is biology. As described above, the cells genetic informa tion is stored in the DNAs, and RNAs play critical roles in processing the genetic code and regulation of protein synthesi s. Of the two types of nucleic acids, RNAs are often used as biological targets, since their e xpression levels directly reflect the status of biological reactions. In addition, appropriate regulation of RNA concentration can be used to manipulate living systems for various purposes, such as disease treatments or biological studies. Of all areas where genomics has the poten tial for huge impact, nothing will be more meaningful than its affect on health research. By revealing the secrets of the genome, scientists will be one step closer to learning the origins of certain diseases. In living systems, genomic information and disease are tightly correlated with each other; one is the cause, and the other is the consequence. For example, many diseases, su ch as autism, mental disorders, cancer, stroke, and diabetes,6 can be explained by a single gene mutation, called a Single Nucleotide Polymorphism (SNP). In addition, any diseas e process can ultimately be explained in biochemical terms which reflect gene function a nd expression. Genetic va riations also provide the blueprint to understand individuals susceptibility to certain environmental factors.7 There are now four major emerging technologies which ma ke use of genomic information: diagnostics, bioinformatics, proteomics and drug de velopment, and antisense therapy. Gene expression is the process by which a ge nes DNA sequence is converted into cells functional proteins. Thus, a blueprint for unders tanding cellular processe s can be obtained by gene expression profiling, which is the simultane ous measurement of the cellular concentrations

PAGE 28

28 of different messenger RNAs, often representing t housands of genes in biological samples. This process often utilizes DNA microarrays, which c ontain representative seque nces of all the genes to be measured at one time and provide the re lative abundance information. Recently, the use of gene expression profiling has expanded to the later stages in the dr ug discovery pipeline, including pharmacogenomics-based assessment of the efficacy and safety of novel compounds. The use of gene expression for clinical appl ications, such as patient classification and diagnostics, is also growing. Many groups are work ing on the classification of different types of cancer and on the development of gene expression-based diagnostic tool s to select the best treatment. Although the most common way to study gene expression is via us e of DNA microarrays to collect massive amounts of data, this technique often gives false results due to the complexity of ex vivo samples composed of different cell types, making it difficult to interpret the data. Thus, analysis of single-cell gene expression can provide a more precise understanding of human disease pathogenesis and can l ead to important diagnostic ap plications. Applications of functional genomics to crucial biological processes, such as response to stimuli or drugs and the determination of cellular destiny, would be grea tly facilitated by direct monitoring of gene expression in a single cell. However, monitoring gene function and activit y in single living cells has long been a problem of great interest and diffi culty in clinical and ba sic life science research and development. Molecular Beacons Molecular beacons (MBs) shown in Figure 18 are single-stranded DNA probes composed of three different functional domains: stem, loop, and fluorophore/quencher pair.8 The stem sequences (4-7 base pairs) are complementary to each other, and the loop is complementary to the target. The fluorophore/quencher (F/Q) signa ling element, switches between the on and off

PAGE 29

29 states, depending on the conformatio nal state of the MBs. In the absence of targets, the energy absorbed by F is transferred via FRET to Q, whic h is spatially very close to F due to stem hybridization, and fluorescence is not observed (off state). When th e target is present, the loop and target hybridize (generally 15 to 25 base pairs), and the distance between F and Q greatly increases (approximately longer than 10nm). Thus, FRET no longer occurs, and strong fluorescence is obser ved (on state). Figure 1-8. Working princi ple of molecular beacon The unique hairpin structure and on/off signaling mechanism endow the MBs with several advantages. First of all, the light-up signaling mechanism allows it to perform highly sensitive detections for nucleic acid monitoring in re al time. Because the unbound MBs stay in the off state, fluorescence is produced only when target is added, and the intensit y is proportional to the target concentration. Such a detection-without-sep aration property is par ticularly useful for the MBs in situations where it is ei ther impossible or undesirable to extract the probe/target hybrids from an excess of the unbound probes. Another a dvantage of the MBs is their relatively high signal-to-background ratio (S/B), which provides high sensitivity. Upon hybridization of its target, a well designed MB can generate a fluorescence enhancement as high as 200-fold under

PAGE 30

30 optimal conditions.9 This provides the MBs with a significa nt advantage over other fluorescent probes in ultra-sensitive analys is. In addition to its sensitiv ity, the MBs offer excellent selectivity. They are extraordinarily target-specifi c and are able to differentiate changes as small as single-mismatched sequences. The selectivity of the MBs is a direct result of its hairpin conformation because the stem hybrid acts as an activation energy barrier to the loop-target hybrid. The remarkable selectivity has been demonstrated in a variety of biological environments where a large number of different non-target nucleic acid sequences are present. Since they were first created in 1996, the MBs ha ve been utilized in many res earch fields and applications, including intracellular monitoring, biosenso r development and clinical diagnosis. Using MBs for RNA Monitoring in Living Cells As described above, one of the primary advantag es of the MBs is thei r inherent capability of detection without separation. This property is especially important in intracellular applications, where any type of separation is unlikely to be applicable without damaging the living system. For this reason, the MBs are able not only to detect RNAs in their native environment, but also to visualize and track th eir sub-cellular localization in real time. To accomplish such a goal, design of hi gh-performance MBs is critical. The major concern in design of the MBs for intr acellular applications is the selection of an appropriate target region, because most of regions of RNA targets are present in double strands. The selection of target sites st arts with the prediction of possible RNA secondary structures. The target sites are chosen around the regions that are likely to be single-stranded, in order to assure that the native mRNA structure competes minimally with the proposed MB. In addition, the site should be unique to represent the specific target. For the chosen regions, high affinity oligonucleotides of different lengt hs that are complementary to th e regions are used as the loop sequences of the MBs. Each loop sequence is then flanked with two complementary arm

PAGE 31

31 sequences for the stem, which is usually four to seven base pairs long a nd has a very high G and C content (higher than 65 percent), to ensure that the hairpin conformation is stable in the living environment. However, the stem interaction canno t be too strong since it can prevent the binding of the MB to its target sequence, resulting in low signal enhancement. Currently, the application of the MBs for intracellular an alysis is a rather young field. Initial studies of the MBs concentrated on detection of the MB hybridization to RNA10-12 In 2003, Tyagi et al demonstrated that MBs could be used to visualize the distribution and transport of oskar mRNA in Drosophila melanogastar oocytes.13 To eliminate background exhibited from the MBs, a binary MB approach was developed, which utilized two MBs that targeted adjacent positions on the mRNA. Only when both MBs we re hybridized to the mRNA sequence, the donor and acceptor fluorophore were brought into cl ose proximity. This allowed FRET to take place to generate a new signal (at the emis sion wavelength of the acceptor), indicating hybridization of the MBs with the mRNA. In additi on to visualizing the mRNA distribution, they were also able to track the migr ation of the mRNA inside of the cell and even into adjacent cells in the oocyte. Other studies have imaged MBs on viral mRNA inside of hos t cells to investigate the localization of the mRNA inside of cells. The study also utilized photobleaching of the fluorophore on the MB in order to study the diffu sion of the MB-mRNA hybrids. In 2005, Bao et al expanded on mRNA visualization by showing the co-localization of mRNA and intracellular organelles in human dermal fibroblasts.14 Their observation was conf irmed by several control experiments, including the use of negative c ontrol MBs and fluorescent in situ hybridization (FISH), as well as detection of colocalization of 28S ribosomal RNA with the rough endoplasmic reticulum. The authors suggested that th e observation of subc ellular associations of mRNA with

PAGE 32

32 organelles such as mitochondria may provide new insight into the transport, dynamics, and functions of mRNA and mRNA-protein interactions. Instead of focusing on localizati on and distribution, expression levels of mRNA have also been studied inside of living cells using MBs. The binary MB approach was explored to determine relative expression levels of K-ras and surviving mRNA in human dermal fibroblasts.12 According to the report, the expression level of K-ras mRNA is 2.25 time higher than normal, a result comparable to the ratio of 1.95 using RT-PCR. Recently, the stochasticity of manganese superoxide dismutase (MnSOD) mRNA expression in human breast carcinoma cells was studied using MBs with an internal standard reference probe to allow ratiometric analysis (Figure 1-9).15 By using this method, many of experi mental and instrumental variations Figure 1-9. Intracellular imaging of single cells using MB prob es. A ratiometric approach was used to minimize experimental variations and to enable more reliable data collection. The top row shows the cellular response for closed MBs. The bottom row shows the cellular responses for open MBs. (a) and (d) are the fluorescence emission images of a reference probe; (b) a nd (e) correspond to fluorescence emission images of the MB probe; (c) and (f) are representative ratiometric images of the MB response, obtained by dividing the image from the MB by the image of the reference probe.

PAGE 33

33 were compensated, making direct comparisons of different cells possible. The study showed that the stochasticity of gene expression for MnS OD was different for the basal, lipopolysaccharide (LPS)-treated, and the transfected cells, wh ile there was little or no difference in -actin mRNA in the three groups. This represen ts a novel means for direct examination of the stochasticity of transcription of MnSOD and other genes im plicated in cellular phenotype regulation. Engineering MBs for Intracellular Analysis B a s e B a s e B a s e Figure 1-10. Molecular structur es of 2-OMe RNA, locked nucleic acid (LNA), and peptide nucleic acid (PNA) While the researches cited above demonstrate that the MBs are usef ul in intracellular monitoring, problems have occurred, mostly due to the complexity of the living environment or the inherent properties of the MBs. For exam ple, the MBs are vulnerable to intracellular enzymatic reactions, such as digestion by nucl ease, RNase cleavage of MB-bound RNA targets nucleases, and non-specific opening by si ngle-strand binding pr oteins (SSBs),15 causing falsepositive or false-negative signals. For example, it has been reported that unmodified

PAGE 34

34 phosphodiester oligonucleotides may possess a half-life as short as 15-20 min in living cells.16 In addition, the high background signal from autofluorescence and the MBs th emselves decrease the resolution. To solve the stability problem, nonstandard nucleic acids ha ve been explored to design MBs with improved resistance to enzyma tic activity. These include 2-OMe-modified RNAs,17-21 peptide nucleic acids (PNAs),22-25 and locked nucleic acids (LNAs).26,27 The 2-OMemodified MBs show good nuclease resi stance, higher target affinity, increased specificity, faster hybridization kinetics, and protection of bound RNA target s from RNase H cleavages.28 However, 2-OMe-modified MBs open non-specifi cally in cells, possibly due to protein binding.13,20 The peptide backbones of PNAs are not de graded by nucleases, they have a neutral charge, and hybrids with RNA are thermally more stable compared with DNA-RNA and RNARNA duplexes. Xi et al27 reported that the use of PNA-MBs instead of traditional fluorescent in situ hybridization probes or DNA-MBs can be be tter under a wide range of environmental conditions. However, PNAs have not been wide ly used, mainly because limited solubility causing aggregation in biological environment. Recently, Tan et al investigated a locked nucleic acid molecular beacon (LNA-MB) and demonstrat ed the great potential of these probes.26,28 LNAs are conformationally restricted nucleic aci d analogues, in which the ribose ring is locked into a rigid C3'-endo (or Northern-type) c onformation by a simple 2'-O, 4'-C methylene bridge.29,29-31 These compounds, as well as LNA-MBs, have many attractive properties,29,31 such as high binding affinity, excellent mismatch -discrimination capability, and decreased susceptibility to nuclease diges tion (Figure 1-11). The high stru ctural stability of LNA-MBs results in a significantly lower background comp ared to DNA-MBs delivered into the cancer cells. In the living environment, the LNA-MB showed no fluorescence increase over a period of one hour in the absence of target, while the DNAMB exhibited a dramatic increase in signal

PAGE 35

35 after thirty minutes due to structural degrad ation. The completely open conformation of each beacon generated similar levels of fluorescence insi de of the cells after bi nding to the synthetic complement. The longer lifetime and high structur al stability of the LNA-MBs suggest that LNA-MBs can be useful probes for intracellular analysis. Figure 1-11. Background signal of LNA-MB and DNA-MB as a function of time after being injected into cells Systematic Evolution of Ligands by Exponential Enrichment (SELEX) The applications of nucleic acids discussed so far, have involved a hybridization reaction with a target polynucleotide segment. However, nucleic acids can also be used for selective targeting to a variety of species with high binding affinities and selectivities comparable to those of antibodies. 32-34 These probes, called aptamers, are si ngle-stranded oligo nucleotides which interact specifically with a wide range of target compounds, including ions, small organic and inorganic molecules, peptides, proteins, and even whole live cells. Aptamers are selected from a large pool of oligonucleotides by the process called Systema tic Evolution of Ligands by Exponential Enrichment (SELEX) whic h was first described by three independent laboratories in

PAGE 36

36 1990.32-34 It is based on the concept that the uniq ue configuration of small oligonucleotides, typically 80-100mers, can be suitab le for recognition of a specific target with high selectivity. To maximize the number of potential binding se quences, the oligonucleot ide pool contains a tremendously large number of various sequences, normally 1015 to 1016, flanked by defined primer binding sites for amplificatio n by polymerase chain reaction. As shown in Figure 1-12, in each round of SELE X, the first step is incubation of library sequences with the target molecule in the desired buffer condition. During this step, some sequences of the library bind to target molecu les tightly, while other sequences are weakly bound or do not interact. The second step is the pur ification to remove both unbound and weakly bound sequences from the few high affinity sequences. This is the most critical step of SELEX, because narrowing the pool to high affinity sequences will allow rapid enrichment. Otherwise, if a few nonbinding sequences remain, they will subsequently be amplified during the later PCR reaction and will need to be removed in the next rounds of SELEX. For this reason, there are many strategies established to improve the purification efficiency at st ep 2, including nitrocellulose filtration, affinity chromatography, i mmunoprecipitation using magnetic beads, gel electrophoresis and capillary electrophoresis (CE). After the undesired sequen ces are removed, the bound sequences are eluted using denaturing conditions. For example, heating or adding a high pH solution (0.1M NaOH) causes the oligonucleotides to lose their binding potency by destroying the proper configurations for the interaction with target. The collected oligonucleotides are then amplified via the polymerase chain reaction (PCR) process for the next round of SELEX. During the incubating and washing step, the stringency of the binding condition is generally increased in later rounds to obtain high affinity sequences with fewer total rounds. In ge neral, 20-30 rounds of SELEX are sufficient to

PAGE 37

37 enrich the pool. Once the pool is enriched, the sequences are iden tified by a sequencing process and screened to verify their binding potencies. Figure 1-12. Systematic Evolution of Ligands by Exponential Enrichment (SELEX) The selected aptamers can be applied in many s cenarios. First of all, their high selectivity and affinity are easily incorporated into the de sign of bioanalytical tools with an appropriate signal transduction mechanism, such as fluores cence or radioactive decay. Fluorophores can be covalently linked to either the ends of nucleic acids or in the middle of sequences based on phosphoramidite chemistry, and isotope (P32) labels can be also be added using enzymatic reactions. With fluorescence as the signal mechanism, fluor escence anisotropy, fluorescence lifetime, fluorescence quenching, fluorescence re sonance energy transfer (FRET), and excimer formation can be used to monitor the binding of aptamers to targets. Another common application of aptamers is in therapeutics. Compared to antibodies, aptamers possess many benefits as future ther apeutic agents, as summarized in Table 1-1.35 Aptamers can be selected in a timeframe of two months due to the automated in vitro SELEX

PAGE 38

38 procedure. On the other hand, antibodies can only be selected via a more time-consuming in vivo process. Although aptamer and antibody affinities are comparable, aptamers show superior advantages in terms of high inhibitory pot ential, low molecular weight, and low to no immunogenicity or toxicity. Unlike antibodies, an aptamer target can be any extraand intracellular protein. In addition to the highe r physciochemical stability, the easy chemical modification of aptamers allows further engin eering to improve their targeting potency and in vivo lifetimes. Thus, many aptamers are undergoing clinical trials for dr ug commercialization. Table 1-1. Comparisons between aptamer and antibody35 Polyvalent Interactions In the field of biochemistry, multivalent interactions are ubiquitous and of high interest.36,37 Multivalency refers to the binding of tw o (or more) entities via the simultaneous interaction of multiple and complementary ligands (Figure 1-13). The valency of a substance is the number of individual ligand/receptor interactions. The positive outcome of the multivalent interaction is enhanced binding avidity. Multival ent binding governs many interactions between proteins and small molecules, between protei ns or antibodies and cell membranes, between Feature Aptamer Antibody Production < 8 weeks (automated, in vitro) >10 weeks (in vivo) Specificity and affinity High, Kd: pico to low nanomolar High, Kd : pico to low nanomolar Inhibitory potential High Low, 1 out of 200 Molecular weight 5-25 kDa ~150 kDa Immunogenicity and toxicity Not observed Immune reaction observed Target space Extraand intracellular proteins Extracellular proteins only Chemical modification Easy Difficult Physicochemical stability Stable Labile

PAGE 39

39 viruses and cells.36 In particular, protei ncarbohydrate interactions are being intensively investigated, because of their pivotal roles in the binding of the influenza virus to cell membranes and in membrane recognition even ts mediated by carbohydr ate-binding proteins (lectins).38 Figure 1-13. Multivalent interactions The concept of cooperativity is frequently used to describe pol yvalent interactions. Cooperativity refers to the binding of multiple single-dentate ligands to a polydentate target, such that an early binding event increases the affinity of later binding interactions.39,40 The enhanced binding potency often plays a criti cal role in protein-protein inte ractions, such as those between an antibody and an antigen or between a virus and its host.39 The enhanced binding potency may result from secondary ligand interactions or fr om allosteric effects. A common example is the binding of oxygen to hemoglobin; the binding of the first O2 molecule to one subunit of the hemoglobin tetramer enhances the affi nity of the remaining subunits for O2. To understand cooperativity in detail, a ther modynamic model is introduced. Thermodynamic Model to Describe Cooperativity The binding reaction takes place between two t ypes of molecules and is described by the lock and key model. In the case of a polyvale nt interaction, N ligands and N receptors are involved, as shown in Figure 1-13. Thus, if N is e qual to 1, 2, or 3, the interactions are termed monovalent, bivalent, or trivalent, respectively. Table 1-2 summarizes the nomenclature of the thermodynamic parameters which rela te the free energies of binding ( G) to the affinity

PAGE 40

40 constants (Ki) for both monovalent and polyvalent system s. Considering the contribution of a single ligand to a polyvalent interaction, the average free energy of interaction, Gpoly average is equal to Gpoly/N. A monovalent ligand-receptor interaction occurs with a free energy change of Gmono, and N independent (no cooperativity) monovale nt ligands interact with N receptors to give a free energy change of N Gmono. The relation between Gpoly average and Gmono can be described by Gpoly average = N Gmono. Depending on the value of parameter there is three types of cooperativity: greater than, equal to, or less than th e free energy in the analogous monovalent interaction for greater than, equal to, or less than 1, respectively. These classes of cooperativity are termed positively cooperative (synergistic), non-cooperative (additive), or negatively cooperative (interfering), respectively. Positive cooperativity, in which initial binding makes the later binding events more favorable, is not commonly observed. The well studied example of four O2 molecules binding to tetrameric hemoglobin is really the result of an allosteric effect. A possible example of a pos itively cooperativity derived from polyvalent interaction (a>1) is the association of pentamer ic cholera toxin with GM 1, an oligosaccharide portion of the GM1 ganglioside.41 On the contrary, negative co operativity, in which initial binding makes binding of the second ligand to be less favorable, is common in the binding of a polyvalent antibody to ligands that are densel y packed on a biological surface, such as a mammalian cell or a virus, or a solid support for an enzyme-linked immunosorbent assay (ELISA) or a polymeric matrix.42 Lee et al. studied the binding of di and trivalent galactosecontaining ligands, which bind C-type lectins on the surface of hepatocyte s. Although the density of these receptors is unknown, the observation that Kbi 2 = 3x107/M < (Kmono = 7x104/M)2 and Ktri 3 = 2x108/M < (Kmono)3 clearly indicates that these diand trivalent liga nds show negative cooperativity.43

PAGE 41

41 Table 1-2. Thermodynamic parameters to describe cooperativity. Type Gtotal Ktotal Gaverage Ki Monovalent Gmono Kmono Gmono Kmono Bivalentt Gbi 2 Kbi 2 Gbi average Kbi average Trivalent Gtri 3 Ktri 3 Gtri average Ktri average N-valent Gpoly N Kpoly N Gpoly average Kpoly average Gpoly n = N Gpoly average = N Gmono (1-3) Kpoly N = (Kpoly average)N = (Kmono) N (1-4) Kinetics and Enha nced Affinity Kinetics studies on systems exhibiting positive cooperativity have shown that the high interaction affinity arises from a d ecrease in the rate of dissociation (koff) of the two polyvalent entities, rather than an increase in the rate of association. F. Karush et al. reported the binding kinetics of antidinitrophenylated (anti-DNP ) antibodies to DNP-lys and surface-immobilized DNP. According to their results, the value of kon of anti-DNP antibody to surface-immobilized DNP is reduced by only a factor of two relative to DNP-lys (kon (surface) = 3.7x107 M1s1; kon (DNP-lys) = 8x107 M1s1) while the values of koff differed by a factor of 33 (koff (surface) = 3.3x10 s1; koff (DNP-lys) = 1.0 s1).44 This result can be explained by the reason that the first ligand/receptor interaction is approximately th e same as the analogous monovalent interaction since it strongly depends on the diffusion rates of molecules (108 to 109 M-1s-1 under typical biological conditions), which do not vary much. However, dissociation of species interacting polyvalently requires breaking N liga nd/receptor interactions, and the rate is likely to be very slow compared to breaking a single ligand/receptor interaction. DNAzymes DNA enzymes, also called DNAzymes or deoxyribozymes, are catalytic DNAs functioning as sequence-specific mol ecular scissors derived by an in vitro selection process

PAGE 42

42 similar to SELEX. The best characterized DNAzy me is probably the -23 subtype, which contains a catalytic loop that is the interac tion site for cations and two flanking arms that specifically recognize their target RNA.45 After a cation binds to the catalytic loop, hydrolysis of the target RNA proceeds via a de-esterificati on reaction, to produce a 2,3-cyclic phosphate terminus and a 5-hydroxyl terminus. For catal ytic activity, the core sequence of the DNAzyme should be conserved, but the arm sequences can be any sequences complementary to the intended RNAs. This unique hydrolysis function has been of great interest for developing biomedical and analytical tools. Numerous investigations have invol ved inhibition of gene expression using this DNAzyme with a number of structural modificat ions to enhance the stability and to improve the potency. As a convenient and rapid analytical met hod, DNAzymes have been coupled with a signaling mechanism for the design of heavy metal sensors. One of the successful examples is the 8-17 DNAzyme-based lead sensor.46,47 Yi, Lu at al prepared many different types of Pb2+ sensors using gold nanopart icle aggregation, lateral flow st rip, and FRET mechanism. All of these techniques have been successful fo r convenient and rapid analysis of Pb2+ in environmental samples. The selectivity for Pb2+ arises from the two-step hyd rolysis mechanism of the 8-17 DNAzyme.48 According to MALDI-MS analysis, the 8-17 DNAzyme produces a 2',3'-cyclic phosphate by an internal transesterification mechanism, in which the 2'-OH group at the cleavage site undergoes in-line attack on the scissile phosphorus, fo rming a penta-coordinated phosphate intermediate, followed by loss of the 5'-oxygen.49,50 Then, Pb2+ further catalyzes a second step, hydrolysis of the 2',3'-cyclic phosphate. This r eaction is observed by presenting the presences of Pb2+ but not other divale nt cations including Mg2+ or Zn2+.

PAGE 43

43 Blood Coagulation and Thrombin Coagulation Alpha-thrombin (EC3 .4.21.5), a trypsin-like se rine proteinase, plays a vital role in blood coagulation and other physiological processe s involving catalytic f unctions and enzymatic intermolecular interactions.51,52 Thrombin cleaves or intera cts with many different blood components, including fibrinogen, fibrin, platel ets, coagulation factors V, VIII, and XIII, thrombomodulin, and protein C. Blood coagulat ion is a part of an important host defense mechanism termed hemostasis. Coagulation is a complex process by which the blood forms clots to cover a damaged blood vessel by a platelet an d fibrin, such that bleeding stops from the damaged vessel to begin repairing. Disorders of coagulation may cause severe bleeding or strokes. Coagulation is highly conserved thr oughout biology. There are two major cascades of coagulation: the intrinsic cascad e (contact activation) and the extrinsic cascade (tissue factor pathway) both of which lead to fibrin formation. Each pathway involves a series of protein activations, in which a zymogen (inactive enzyme precursor) of a serine protease and its glycoprotein co-factor are activat ed to becom e active components. They then catalyze the next reaction in the cascade, ultimately resulting in form ation of cross-linked fibrin. The major role of tissue factor pathway (extrins ic) is to generate a "throm bin burst", a process by which pro thrombin is instantaneously activated to thrombin It is in itiated by release of tissue factor (a specific cellular lipoprotein), and the efficiency of its pathway can be measured by the prothrombin time (PT) test.53 The contact activation pathway (int rinsic) begins with formation of the primary complex of high-molecular-weight kininogen (HMWK), prekallikrein, and FXII (hagem an factor) on collagen. The efficiency of this pathway can be determined by the activated partial thromboplastin time (aPTT).54 After the clotting is initiated by either or both pathway(s), thrombin finally plays a key role in forming blood clots. Its primary role is the hydrolysis

PAGE 44

44 of fibrinogen to fibrin, the buildi ng block of a hem ostatic plug. In addition, it activates other proteins, such as Factor XIII cross-linki ng fibrin monomers to form polymers. Thrombin Structure Alpha-Thrombin contains two polypeptide domai ns that are covale ntly linked with a disulfide bond (Figure 1-14): the A chain, wh ich is non-essential fo r proteolytic activity, composed of 36 residues, and the B chain composed of 259 residues .55,56 The B chain, which is derived from the carboxyl terminal sequence of prothrombin, carries th e functional epitopes of the enzyme with the typical fold of serine proteases.57 The active site has three functional amino acids, His57, Asp102, and Ser195, which are respons ible for thrombins trypsin-like behavior of cleaving its substrates after argi nine residues. The catalytic site polarizes the side chain of Ser195 for nucleophilic attack on the C atom in the sc issile bond of the substrate. This results in Figure 1-14. Structure of thrombin

PAGE 45

45 the C atoms forming a tetrahedral intermedia te stabilized by hydrogen bonds with surrounding amino acids. The substrate is then acylated by the O atom of Ser195, and finally, its C-terminal fragment is released. There are tw o known positively charged loops on -thrombin: exosite I, a Ca2+ binding loop and exosite II, a Na+ binding loop. The positively charged loops eventually provide electrostatic interactions for recognition. Exosite I is the binding site of fibrinogen, 51,58 thrombomodulin,59,60 hirudin,58,61,62 and the thrombin receptors.63-66 Exosite II, which is on the opposite side of the molecule from exosite I, is the binding site for polyanionic ligands, for instance heparin and the chondroitin sulfate moiety of thrombomodulin.67-69 Binding of the molecules to exosite II may influence the cataly tic activity of the enzyme allosterically. Photochromic Switches Photochromism Recently, a number of reports have appeared on the inclusion of photochromic molecules into DNA chains to incorporat e photo-regulation into nucleic acid probes. Compounds which undergo reversible photochemical reactions are said to be photochromic. Examples of photochromic equilibria ar e: pericyclic reactions, cis-trans isomerizations, intramolecular hydrogen transfers, intramolecular group transfers, dissociation processes and electron transfers (oxidation-reduction).70 Photochromic compounds have two molecular states that are interchangeable by irradiation. When the gr ound-state molecule is excited by UV light, it undergoes a conformational change, resulting in formation of an unstabl e configuration. The excited molecule can return to the ground state by thermally releasing the energy or by emitting visible radiation. The two molecu lar states are very different fr om each other in terms of both their physical and chemical properties; for exampl e, their absorption spectr a, refractive indices, dielectric constants, geometrical structures, ox idation/ reduction potentials, etc... Photochromic

PAGE 46

46 molecules can be divided into several classes depending on their transformation mechanisms; for example, phototautomerizations, cis-trans isomerizations, and photocyclizations. In photo-tautomerization, the structural is omers of an organic compound are reversibly interconverted by absorption of UV/Vis li ght. Figure 1-15 shows a hydrogen-transfer photochromic tautomerism. The best known examples is the salicyliden e-aniline tautomerism.71 After irradiation with UV light, the hydrogen on the oxyge n is transferred to nitrogen. The enolform is pale yellow, and the keto-form appears in reddish or brown. This tautomer can further exist in two forms: an intramolecular hydrogen bonded cis-keto form and a rotated trans-keto form. Figure 1-15. Light induced hydroge n transfer tautomerization Photocyclization involves an electrocyclic reaction. Typical examples involving derivatives of 1,3,5-hexatriene, fulgides, diarylethenes or spir opyran, are shown in Figure 1-16. These photochromic compounds have been incorporated to design molecules with photocontrolled magnetism, liquid crystalline phase switching, gated reactivity, fluorescence, and/or reversible surface morphology for th e development of photomodulating devices. The most well known examples of cis-trans isomerization involve the stilbenes Figure 117. After the trans compound is excited to the singlet excite d state, the excess energy is released via either fluorescence or photocyclization to the cis form. The isomerization in n-pentane is highly efficient, when the sample is irradiated at = 313 nm. Since cis-stilbenes are not

PAGE 47

47 thermally stable, they return to the trans-form in the dark. For most of stilbene derivatives, the thermal activation barrier lays around 154 kJ/mol. Figure 1-16. Photocyclization.

PAGE 48

48 Figure 1-17. Cis-trans isomerization Azobenzene Among stilbene derivatives, azobenzene and its analogues have shown the most desirable photoconversion properties for many applications. As shown in Figure 1-18, azobenzene is composed of two phenyl rings linked by an azo (N N) group. The cis and trans isomers are reversibly interconverted by UV and visible light. The conversi on is highly efficient; 91% of cisisomer can be obtained with 365 nm excitation of the trans isomer. Return to the trans form occurs by either thermally or by emission of visible light. Electr on donating groups on the benzene ring cause a red-shift of the excitation radiation into the visible region. The quantum yield is 0.20 for transtocis conversion and 0.70 for cis-totrans conversion. Even though there are many applications of azobenzenes, the detailed mechanism of the isomerization is somewhat unclear. The trans isomer has a planar structure with two absorption bands: a strongly allowed transition to S2 ( *, 317 = 16 980 M-1 cm-1, t-c= 0.10) and a weakly allowed transition to S1 (n*, 449= 405 M-1 cm-1, t-c=0.25). The ground state of cis-azobenzene is twisted with an angle of 10 and has two absorption bands: a moderately allowed transition to S2 ( 290 = 4980 M-1 cm-1, c-t= 0.27) and a weak transition to S1 (434 =1295 M-1 cm-1, c-t = 0.56)72. In the recent report, C. Stuart et al. made use of Resonance Raman analysis to reveal the detailed mechanism of the photoisomerizaion.72 According to their results, the trans-to-cis conversion can be explained via inversion m echanism, because upon UV irradiation, the CN

PAGE 49

49 bond is shortened, and the N N bond is elongated. However, th e large change of the CNNC torsion angle suggests that tors ional motion cont ributes to the cis-to-trans conversion. This is attributed to the twisted nature of the cis-azobenzene ground state, which is therefore susceptible to rotation. Figure 1-18. Molecular structure of azobenzene and energy diagram

PAGE 50

50 CHAPTER 2 SUPERIOR STRUCTURAL STABILITY AND SELECTIVITY OF HAIRPIN NUCLEIC ACID PR OBES WITH AN L-DNA STEM Introduction Molecular beacons (MBs) are single-stranded nucleic acid probes composed of three different functional domains: stem, loop, a nd fluorophore/quencher pair (Figure 2-1d).8 A stem functions as a lock that maintain s the closed hairpin structure when there is no hybridization with a complementary target, so that the fluorescen ce is quenched with high quenching efficiency. Upon hybridization between the loop and its complementary target, the MB undergoes a conformational change from hairpin to linear st ructure, resulting in an increased fluorescence due to the increased physi cal separation of the fluorophore and quencher. Various fluorophore/quencher pairs can be incorporated into experimental designs so that multiple targets can be monitored simultaneously. MBs have been used for real time monitoring of polymerase chain reaction (RT-PCR)73,74 and mRNA expression inside living cells.11,12,75 Unlike traditional mRNA analyses, MBs do not require preor post -treatment of cells because, theoretically, MBs will not give any fluorescence signal unless hybridized with their complementary targets. Indeed, MBs are selective enough to distinguish single-mismatched targ ets, since the principle of MBs target recognition is based on Watson-Crick base pairing. Although initial MB applications demonstrat ed wide feasibility and great potential, challenges in probe design and applications still re main. Since stems are critical for maintaining a stable hairpin structure, major difficulties often arise from the interruption of the stem structure. There are two common causes of stem disruption which severely affect MBs sensitivity and selectivity. On e problem is the undesired intermo lecular interac tions between stems that will hybridize with their complement ary sequences called stem invasion (Figure 21b). This stem invasion by non-target sequences should not be underest imated in real biological

PAGE 51

51 Figure 2-1. Molecular beacon desi gn and interactions. (a) MB bi nding to target mRNA ; (b) MB opened by non-specific mRNA that binds to MB stem; (c) MB mis-folds into nonhairpin structure through the hybridization of loop sequen ce with stem sequence. (d) A newly designed MB using L-DNA for the stem (red) to enforce a hairpin structure, and D-DNA for the loop (blue) for nuclei c acid recognition eff ectively avoids the situations depicted in (b) and (c). Table 2-1. Copy number of each sequence in biological nucleic acid sequences samples since there could be high copy numbers of short sequences complementary to part of the MB stems. In theory, the expressed frequency of occurrence of any part icular stretch of RNA or DNA sequence with n bases is 4-n.76 The average number of occurrences of each particular sequence in human genome is 5x109 x4-n.76 Table 2-1 summarizes the occurrence of a nucleic Sequence Length Number of Occurrence in DNA (5 Billion Bp) Number of Occurrence in RNA (~0.3 Billion Bp) 10 4768 286 11 1192 72 12 298 18 13 74 4 14 18 1 15 4 1 16 1 1

PAGE 52

52 acid sequence with n base pairs. This theoretical calculation indicates that if the base parings between the short sequences can take place, MB s can be vulnerable to false positive signals arising from stem-involved recognition, even th ough each MB is designed to target only one complementary nucleic acid sequence. Another problem arising from the stems is the thermodynamic conformational switch between hairpin and non-hairpin structures. This is a result of the unwanted intramolecular hybridization between the stem and part of the loop (Figure 2-1c). In the case of MBs, this can cause a significant fluorescence background due to incomplete quenching. This problem increases the amount of effort required in desi gning and testing MBs for new target sequences with acceptable performance (Figure 2-1c). Sometimes the stem invasion cannot be avoided at all, resulting in low performance hairpin structures in nucleic acid monitoring. There have been developments aimed at minimizing the aforementioned problems. For example, strengthening stem stability by increa sing stem length or the G and C content can increase the dominance of the hairpin structure, so that th e background signal of MBs remains low.77 Unfortunately, a strong stem leads to slow hybridization kinetics and a high tendency of forming sticky-end pairing, reducing the fl uorescence signal e nhancement upon target hybridization.78 The typical example is the locked nucliec acid (LNA), or LNA MB.26 LNA is known as an extraordinarily strong nucleic acid binder and LNA MBs show ultra-high thermal stability, resulting in a low background signal. Ho wever, LNA MBs tend to have extremely slow hybridization kinetics, which limits their usefulness. In order to minimize unnecessary intermolecula r interactions, MBs have been created in which the stems have structural features that inhibit stem-loop hybridization. In one study, the sense of the stem DNA was inverted to the loop, i.e. 3-stem-5-5-loop-3-3-stem-5, to ensure

PAGE 53

53 that any stem/loop hybridization would be di srupted at the 5 and 3 junctions.79 Unfortunately, the usefulness of these MBs is limited because they require longer stems causing increased sticky-end-pairing problems. These ex amples showcase the under lying complexity of designing MBs and other DNA hairpin probes. There has yet to be a MB design that solves the problem of stem invasion without causi ng other performance-limiting effects. Ideally, the MB stem should not interact with the loop or a ny other complementary nucleic acid sequences. If the stem can be immune to naturally occurring nucleic acids either within the probe or in the sample matrix, there will be no st em invasion, resulting in highly stable hairpin nucleic acid probes. This thought has led us to consider non-standard bases like L-DNA which do not hybridize with natural nucleic acids. Our hypothesis is that st ems made of such bases will hybridize with each other and not to the loop or a ny other natural nucleic aci ds in the sample. In this way, a stable hairpin stru cture can be formed in which the stem and loop have no innate ability to form a stable structure. This id ea has been explored using homo DNA( oligo(2,3dideoxy--D-glucopyranosyl)nucleotides)-stem MBs.80 Unfortunately, the synthesis of such MBs is not easy and requires optimization of the st em design. Here we propose to use non-natural enantiomeric DNA, termed L-DNA, in the stem, a nd natural D-DNA in the loop (Figure 2-1d) as a model system for MB design. Since L-DNA is th e mirror-image form of the naturally occurring D-DNA, its duplexes have the same physical characteris tics in terms of solubility and stability as D-DNA hybrids, except for form ing a left-handed double-helix.81-84 L-DNA was examined as a potential antisense reagent, but it failed to pe rform adequately because there is no interaction between L-DNA and D-DNA due to the chiral difference.85 By taking advantage of these features of L-DNA to build stems we can preven t intramolecular and inte rmolecular nonspecific interactions in any hairpin-stru ctured DNA probes. In addition, the easy incorporation of L-DNA

PAGE 54

54 stems to other non-standard bases, such as 2-OMe-modified RNA and LNA, can be attractive to design bio-compatible MBs. In th e present report, we have desi gned, prepared, and studied MBs based on this strategy, and will show that this design can effectively minimize stem-related problems in MBs. Experimental Section Synthesis of MBs and Their Targets The three oligonucleotide sequences shown in Table 2-2 were synthesized. The MB1 sequence, which does not have any biological ta rgets, was randomly designed with high signal enhancement and moderate hybridization kineti cs. MB2 and MB3 were specially designed to target -actin mRNA (GenBank Accession No. BC014861) and MnSOD mRNA (Gen-Bank Accession No. NM-000636), respectively.86 The L-deoxyphosphoramidites were obtained from ChemGenes Corporation (Wilmington, MA). The other synthesis reagents, such as 3-dabcyl (quencher) CPG, 6-fluorescein phosphoramid ite (fluorophore), 2OMe-modified RNA phosphoramidite, and D-deoxyphosphoramidites, we re from Glen Research Corporation (Sterling, VA). All MBs and their target s were synthesized using an ABI 3400 DNA/RNA synthesizer (Applied Biosyste ms, Foster City, CA) at 1mol scale with the standard synthesis protocol. Dabcyl was placed at the 3 end to ensure that every DNA strand contains a quencher. For high coupling yield, the coupling reaction time of 6-fluorescein phosphoramidite to the 5 end of each molecular beacon was extended to 15 min. For the complete cleavage and deprotection, overnight incubation with ammoni a was used. After ethanol precipitation, the precipitates were then dissolved in 0.5ml of 0.1 M triethylammoni um acetate (TEAA, pH7.0) for further purification with highperformance liquid chromatography (HPLC) using a ProStar HPLC Station (Varian, CA) equipped with a fluo rescence detector, a phot odiode array detector and C-18 reverse phase column (Alltech, C18, 5 M, 250x4.6mm).

PAGE 55

55 Table 2-2. Sequences of hairpi n probes and their targets. Bl ack letters indicate natural DNA bases; red letters are L-DNA ba ses; light blue letters are lock nucleic acids; and green letters are 2-O-Me-modified bases. Underlined regions are stems. Name Sequence LS MB 1 5-FAMCCTAGC TCTAAATCACTATGGTCGCGCTAGG -Dab-3 LS MB 2 5-FAMCCGAGC CAGTTACATTCTCCCAGTTGATT GCTCGG -Dab-3 LS MB 3 5-FAMCCGTCG AGGAAGGAAGGCTGGAAGAG CGACGG -Dab-3 LS OMe MB 1 5-FAMCCTAGC TCTAAATCACTATGGTCGCGCTAGG -Dab-3 LS OMe MB 2 5-FAMCCGAGC CAGTTACATTCTCCCAGTTGATT GCTCGG -Dab-3 LS OMe MB 3 5-FAMCCGTCG AGGAAGGAAGGCTGGAAGAG CGACGG -Dab-3 DS MB 1 5-FAM-CCTAGC TCTAAATCACTATGGTCGCGCTAGG -Dab-3 LS LNA MB 5-FAMCCTAGC T C T A A A T C A C T A T G G T C G C GCTAGG -Dab-3 DS MB 2 5-FAM-CCGAGC CAGTTACATTCTCCCAGTTGATTGCTCGG -Dab-3 DS MB 3 5-FAM-CCGTCG AGGAAGGAAGGCTG GAAGAGCGACGG -Dab-3 MB 1 target (LCD) 5-GCGACCATAGTGATTTAGA-3 MB 2 target 5'CCGAGC AATCAACTGGGAGAATGTAACTG-3' MB 3 target 5'CCGTCG CTCTTCCAGCCTTCCTTCCT -3' Hybridization Experiments Fluorescence measurements were performed with a Fluorolog-3 Model FL3-22 spectrofluorometer (JOBIN YVON -SPEX Industries, Edison, NJ) using a quartz cuvette. All hybridizations were performed at room temper ature. First, the background fluorescence from 200 L of the buffer containing 20mM of Tris-H Cl (pH7.5), 50mM NaCl and 5mM MgCl2, designated as MB buffer, was monitored for abou t 1 minute, and then each stock MB solution (20 M) was added to the hybridization buffer to reach final concentration of 65nM and the fluorescence was monitored. After a stable fl uorescence signal was obtained from the MB, an excess of target oligonucleotid e (650nM) was added. The leve l of fluorescence intensity was recorded until the signal reached plateau. The excitation and emission wavelengths were set to

PAGE 56

56 488nm and 520nm, respectively. Signal enha ncement was calculated using the following equation: )F(F )F(F B Sbuffer closed buffer open (2-1) In which Fopen: fluorescence signals from MBs with target Fclosed : fluorescence signals from MBs without target Fbuffer: fluorescence signal of buffer Melting Temperature (Tm) Measurement of MBs Thermal denaturing profiles of each MB were recorded to evaluate the stability of the stems using by a BioRad RT-PCR thermal cycler. The solution was prepared with 100nM final concentration of each MB in MB buffer. The fluorescence intensity of each MB in buffer at temperatures ranging from 10C to 95 C in 1C intervals was measured and plotted as a function of the temperature to generate the melting temperature curve. Protein Sensitivity Tests To test the nuclease digestion of MBs, de oxynuclease I (DNase I) from Sigma-Aldrich, Inc. (St. Louis, MO) was chosen as a standard nuclease. The fluorescence of 65 nM MBs in MB buffer was measured as a function of time at r oom temperature. Once the fluorescence stabilized, two units of ribonuclease-free DNase I was added, and the fluorescence change was monitored until it reached to plateau. To test the vulnerability of MB-RNA duplexes to ribonuc lease H digestion (SigmaAldrich, Inc., St. Louis, MO), 65 nM MBs and RNA targets were incubated in the MB buffer while the fluorescence intensity was monitored. Af ter the hybridization reached equilibrium, two

PAGE 57

57 units of ribonuclease H were added, and the chan ge in fluorescence was recorded as a function of time. Cell lysate was prepared using CCRF-CEM (C CL-119, T cell line, human ALL) obtained from American Type Culture Collection (Manassa s, VA) and cell culture lysis buffer containing 25mM Tris (pH 7.8 with H3PO4), 2mM 1,2-Cyclohexylenedi nitr ilo-tetraacetic Acid (CDTA), 2mM dithiothreitol (DTT), 10%glycerol and 1% TritonX-100 purchased from Promega (Madison, WI) with the protocol recomm ended by manufacturer. CCRF-CEM cells were cultured in RPMI medium 1640 (American Type Culture Collection) supplemented with 10% fetal bovine serum (FBS, heat-inactivated; GI BCO) and 100 units/ml penicillinstreptomycin (Cellgro). Briefly, approximately 6 million cells were centrifuged to remove cell culture media and then washed twice with 500 L of 5mM MgCl2 in Dulbeccos PBS with calcium chloride and magnesium chloride purchased from Sigma-Aldric h, Inc. (St. Louis, MO). All these steps performed at 4C. After the buffer was re moved, the cells were incubated with 200 L of cell lysis buffer for 3 minutes at room temperature. Finally, the mixture was centrifuged to remove any cell debris. To determine biostability of each MB, 2 L of cell lysate was applied to the MBcontaining solution. Results and Discussion Stability and Sensitivity of L-DNA Stem MBs (LS MBs) To show the feasibility of an L-DNA stem we synthesized three L-DNA stem MBs using the sequence MB1, MB2 and MB3 as shown in Table 2-2. The same sequences were used to prepare control MBs, called DS MBs, entirely made of D-DNA bases. Hybridization of each MB to its corresponding natural DNA target was perfo rmed under the same conditions. In order to ensure all MBs opened, we used a 10 fold excess of the target DNA. The signal enhancement was calculated using the equation 3-1. As s hown in Figure 2-2a, the L-DNA stem duplex was

PAGE 58

58 able to maintain the hairpin conformation and de hybridize when the loop bound to its target with moderate hybridization kinetics. More interestingly, compared to DS MB 1, LS MB 1 produced a lower fluorescence signal in the absence of its target, which leads to a signal enhancement ratio of more than twice that of the DS MB 1, 46 compared to 21, respectively (Table 2-3). High signal enhancements were consistently observed fr om all three LS MBs as shown in Table 2-3. Figure 2-2. Responses of LS MBs and DS MBs to the targets. The hybridization of LS MB1 and DS MB1 took place with 10 fold excess of the target DNA, and their fluorescence change was recorded. Table 2-3. Signal to background (S/B) of each MB was calculated and compared S/B LS MB1 46 21 DS MB1 LS MB2 18 9 DS MB2 LS MB3 30 18 DS MB3

PAGE 59

59 LS MB 2 and LS MB 3 had 18 and 30 times e nhancement compared to their counterparts MB 2 and MB 3, which had 9 and 18 times, respectively (Table 2-3). Thus, the better S/B of LDNA stem MBs over regular MBs can be genera lized regardless of oligo sequences. The improved sensitivity is believed to be a result of the enhanced stability of the hairpin conformation in L-DNA MBs due to the lack of stem-loop interactions which could otherwise contribute to a significant bac kground. The better structural stability causing higher S/B was supported by the higher melting temperature of stems (Tm) for LS MBs compared to those of DS MBs. Improved Structural Stability To evaluate the stem stability of MBs, the melting temperatures (Tm) of all probes were determined and compared. For all MB sequenc es prepared, LS MBs showed higher melting temperatures than their DS counterparts. Typi cal melting temperatures are shown in Table 2-4 for LS and DS MBs. Tms of LS MBs exceeded those of th e corresponding DS MBs by at least 4oC. This difference is well above the uncertainty in Tm measurement in our instrument (<0.5 C). Because L-DNA:L-DNA base pairs have stabilit ies comparable to those D-DNA counterparts, such an increase in Tm is more likely due to a more stable hairpin conformation in the LS MB rather than stronger base pairing between L-DNA bases.87 The improved stability of the L-DNA stem is coherent with the enhanced sensitivity of the probes observed in our hybridization experiments. In an earlier re port, the partial repl acement of D-DNA bases with L-DNA bases in DNA duplexes caused lower melting temperatures.87 Our results do not contradict this work since the double-stranded stem of the LS MBs is made entirely of L-DNA and therefore does not have to accommodate both helicities simultaneously. Thus, the L-DNA stems are strong enough

PAGE 60

60 to maintain the stable hairpin structure, and actually show better stab ility than the pure D-DNA stems. Table 2-4. Comparisons of stem melting temperatures of MBs. LS MBs generally showed much higher melting temperature, about 5 to 10 C than their counterparts. Tm LS MB1 62.0 C 58.0 C DS MB1 LS MB2 71.6 C 60.0C DS MB2 LS MB3 67.5 C 62.3 C DS MB3 Figure 2-3. Melting temperature profiles of DS and LS MB 1 Elimination of Intramolecular Interaction As discussed above, intramolecular interactio ns between stem and loop domains can cause a high background due to thermal fluctuations between the hairpin structure and other conformations. In the case of FRET-based linear nucleic acid probes, conformational changes

PAGE 61

61 due to thermal fluctuations are not critical, since linear probes do not require any proper conformation to minimize FRET background prior to target binding. However, in the case of hairpin structures like MBs, the minor contribution of non-hairpi n conformations can affect S/B more dramatically due to incomplete quenching. Thus, the addition of an L-DNA stem eliminates unwanted intramolecular interactions between the stem and loop, favoring the hairpin conformation and therefore improving sensitivity of MBs, as well as easing restrictions in stem design. This situation can be understood thermodynamically in the following way. Free of target, the unwanted intramolecula r interactions give th e DS MB higher entropy than the LS MB while the entropies of the MBs hybridized to targets are similar. This causes the difference in the free energy between open or random coil states and closed states to be more negative for the LS MB. This argument correlates well with the higher Tms. Conversely, the DS MB requires less energy input to open since the hairpin structure is not as dominant an d the less stable intramolecular configurations melt at lower temperatures. To prove the hypothesis that the low affinity of L-DNA to D-DNA can eliminate the stemloop interaction and stabilize ha irpin structure more efficiently a specific MB, called MB 1-1 (Table 2-5), was designed such that the non-hair pin structure is dominant for DS MB 1-1, as shown in Figure 2-4. Thus, DS MB 1-1 can ha ve two dominant conformations, hairpin and nonhairpin structures, and their dist ributions are dependent on thermodynamic stability. On the other hand, replacing the MB stem with an L-DNA stem can ensure a hairpin structure as a dominant structure as shown in Figure 2-4, since the L-DNA cannot hybridize with D-DNA. The major difference between the two MBs is observed in the kinetics of hybridization with their targets. The DS MB 1-1 shows a noticeably slow hybridization rate (Figure 2-4). We believed that there are two major reasons for the kinetic effect. One is the reduction of exposed loop sequences of

PAGE 62

62 the DS MB 1-1to its target, causing minimized ch ance of interactions between a probe and its target. The other is the extra energy required fo r dehybridization of the partially hybridized loop region in the DS MB 1-1 prior to binding to targets. In contrast, the LS MB 1-1 hybridizes with Table 2-5. MB 1-1 and its target sequences. Th e underlines at the end for sequences represent stems and the middle of the loop is the complementary to the 5 stem. Name Sequence LS MB 1-1 5-FAM-CCTAGCTCTAAAT CAGCTAGGTCGCGCTAGG-Dabcyl-3 DS MB 1-1 5-FAM-CCTAGCTCTAAAT CAGCTAGGTCGCGCTAGG-Dabcyl-3 MB 1-1 target 5-GCGAC CTAGCTGATTTAGAGCTAGG-3 Figure 2-4. Elimination of stem and l oop interaction using a L-DNA stem. Possible conformations of MB1-1 sequence as predicted by DNA/RNA folding program mfold. DS MB 1-1 folds into non-hairpi n structure because of the stem-loop interaction. Use of L-DNA in the stem of LS MB 1-1 removes stem-loop interaction, forcing the probe to form a hairpin struct ure. Hybridization curves showing faster hybridization kinetics for LS MB 1-1 compared to DS MB 1-1.

PAGE 63

63 the target much faster. This is because the fully open loop region can be easily accessed for interaction with its targ et, resulting in a rapid dynamic respons e. These results confirm that using L-DNA stem in designing MBs can effectively eliminate undesired stem-loop interactions in hairpin structured nucleic acid probes. Elimination of False Positive Signal The other major advantage of using an L-DNA st em in MB construction is elimination of false reports coming from the stem and non-target se quence interactions (Figure 2-1b). This is an intrinsic problem of all DS MBs. Presumably, a short sequence with only 5 to 6 base pairs might not contribute significan tly to the stem invasion, but the ex tended sequences par tially matched to the loop can have high probability of non-selectiv e opening of MB and false positive signals. In order to evaluate the extent of such non-specific interactions, we designed oligo-D-DNA targets with different lengths that had 6 bases complement ary to the stem of the MB while the remaining sequence matched the loop region: 5-CCTAGC -3, 5-CCTAGC GC-3, 5-CCTAGC GCGA-3, and 5-CCTAGC GCGACC-3 (underline is complementary to the 3 stem sequence of the MBs in Table 2-2). Using the mfold software, the cal culated thermodynamic stab ilities of each target with its complementary sequence are shown in Table 2-6. The loop complementary DNA target, 5-GCGACCATAGTGATTTAGA-3 was also prepared as a refere nce. These sequences were separately incubated with either LS MB 1or DS MB 1 for 1 hr. The responses of the MBs were recorded and the fluorescence signal of each samp le was compared to the fluorescence signal of MB with loop-target DNA mixture (Figure 2-5). For DS MB 1, incubation with a 10-fold excess of the 6mer DNA target failed to open the hair pin structure. This is expected since the intramolecular binding constant between the stem sequences is far greater than the intermolecular interaction between one arm of the stem and the 6mer DNA target. Similar results were obtained for the 8mer sequence. On the co ntrary, in the presence of the 10mer DNA, which

PAGE 64

64 was complementary to one arm of the stem and 4 adjacent bases in the loop, approximately 55% of the DS MB 1 opened. The 12mer sequence, in a 10-fold excess, was able to fully open the DS MB 1 (Figure 2-5). This result clearly demons trates how severely the stem invasion sequence can compromise the MBs function and its selectivity in biological applications. There are tremendously diversified se quences in a real sample matrix, and the copy number of this type of short complementary sequences could be very high. The chance of such a Table 2-6. Calculated melting temperature of each target with its complementary sequence Targets Tm 6mer target (5-CCTAGC-3) <10 C 8mer target (5-CCTAGCGC-3) 17.5 C 10mer target (5-CCTAGCGCGA-3) 25.1 C 12mer target (5-CCTAGCGCGACC-3) 31 C Figure 2-5. Comparison of selectivity of LS MB 1 and DS MB 1. A final concentration of 100nM MB was incubated with 1 M of each target for 1hr and the fluorescence signal was measured. The experiment was re peated 5 times and the average value and standard deviations were calculated. stem invasion is thus equally high and this is one of the reasons that limit the usage of MBs in quantitative analysis. In contra st, an L-DNA MB does not have such a problem. None of the

PAGE 65

65 mock target sequences except the full length target sequence was able to open LS MB 1, indicating superior selectivity and stability. This excellent se lectivity coming from the L-DNA stem will be useful when performing quantitativ e analysis on raw biological samples as well as for intracellular studies. Biostablility of LS MBs In general, degradation of D-DNA MBs is one of the most significant problems in intracellular applications.88 This problem cannot be avoided with LS MBs since the loop is still made of standard nucleic acids (Figure2 -6). In order to solve this problem, non-standard nucleic acid bases have been explored to design MBs, such as peptide nucleic acids (PNAs),22-24 locked nucleic acids (LNAs),26,31,89,90 and 2-OMe-modified RNAs.18-20,25,91 Most of these bases show greatly improved biostability. In addition, they fo rm stronger duplexes with their targets, leading to more stable signal production. The 2-OMe -modified RNAs have methoxyl groups at the 2 carbon of the ribose sugar. They can recognize natural nucleic acid targets but are not biodegradable. As a result, these advantageous feat ures of 2-OMe-modified RNAs as well as their well characterized properties have often been used as MB building blocks. In order to demonstrate the feasibility of MBs composed of L-DNA stems and 2-OMe-modified RNA loops, called LS OMe MBs, in intracellular m easurement, we investigated the biostability, sensitivity, and selectivity of these probes. We prepared three different sequences of LS OMe MBs (Table 2-2) and the characterization was performed as described previously. As shown in Figure 2-7a, b, and c, such a repl acement of the loops did not affect structural stability and selectivity regardless of sequen ces. LS OMe MBs still showed higher S/B and Tm compared to DS MBs. In addition, when DNase I was added, LS OMe MBs did not show any fluorescence increase which means much better re sistance to nuclease digestion (Figure 2-7a).

PAGE 66

66 DS MBs showed immediate signal increase with the addition of DNase I, whereas the LS OMe MBs did not show such an increase with DNa se I (Figure 2-7a). The nuclease resistance Figure 2-6. Nuclease resistance of LS and DS MB of LS OMe MBs can be more be neficial to detect low copy nu mber of mRNAs since the falsepositive signal coming from MB degradation will not be the case for LS-OMe MBs. Next, the stability of DS and LS OMe MB/RNA target d uplexes were inspected using RNase H, an enzyme that selectively cleaves RNA/DNA duplexes In the case of DS MBs, dramatic signal decrease was observed after RNase H was added to the duplexes, indicating that that the DS MB/RNA target duplexes are extremely vulnerable to RNase H digestion, resulting in signal fluctuation for intracellular measurements. On th e contrary, LS OMe MBs/RNA target duplexes

PAGE 67

67 Figure 2-7. Characterization of bi ostability of LS OMe MBs(green ) compared to DS MBs(blue). (a) The response of LS OMe MB1 to its targ et and DNase I. (b) Selectivity of LS OMe MB1. (c) Signal enhancement and stem melting temperature of each LS OMe MB. (d-e) RNase H sensitivity of LS OMe MB1 (d) and DS MB1 (e). DNA target was added to ensure the DS MB1 had conf ormational change after the RNA targets were digested. (f) Cell lysate sensitivity of LS OMe MB 1 (green) and DS MB 1 (blue) were tested.

PAGE 68

68 Figure 2-8. Characterization of biostability of LS L NA MBs (red) compared to DS MBs(blue). The response of LS LNA MB to its target (a), DNase I (b), and Cell lysate(c) was tested. RNase H sensitivity of LS LNA MB (d) was experimented. are stable and resistan t to RNase H activity due to the 2OMe RNA loops. Even though LS OMe MBs are resistant to DNase I and RN ase H digestion, this does not mean that they are stable in true cellular environments. Thus, we tested LS OMe MBs in cell lysates, and the results are shown in Figure 2-7f. The stability of LS OMe MBs in the cell lysa te clearly proves that the LS OMe MB design eliminate many sources of false positive or negative signals in intracellular

PAGE 69

69 measurements. The same investigation was applie d to LS MBs containing LNAs of the loops as well (Figure 2-8). As shown, LS LNA MB can also resist the nuclease di gestion and protect the RNA targets from RNase H digestion. Thus, we can conclude that the incorporation of L-DNA stems in MBs with loops composed of other non-standard nucleic acid s does not alter the stability of the hairpin structure and takes full advantage of the biostability features of each component. Conclusions In summary, we have established that the use of an L-DNA stem in a hairpin structured DNA probes, like MBs, eliminates unwanted in traand intermolecula r interactions. The exclusion of stem-loop interac tion in an L-DNA stem MB ensu res that the designed hairpin structure is dominant thereby improving the sensitivity and stabi lity of hairpin DNA probes. The use of an L-DNA stem prevents the probe fr om being opened by non-specific D-DNA sequences that contain short sequences complementary to the stem. Thus, stem invasion causing false positive signals is eliminated. In addition, L-DNA stems can be used to improve any known MB design because L-DNA stems can universally stabilize hairpin conformations of nucleic acid probes, as long as D-type nucle ic acids are used the loop. Mo reover, the combination of a nuclease resistant loop with L-DNA stems is a powerful molecular beacon design since it removes the possibility of false positive a nd negative reports coming from intracellular enzymatic activities and non-specifi c interactions of MBs and targets. While there are other approaches to design stable hairpin DNA probes, the L-DNA stem st rategy is the simplest, most direct, and most effective way to develop hairpin structured DNA probes with desired properties. Our results also suggest that enantiomeric DN A (L-DNA) is useful fo r designing structured functional nucleic acid probes for a variety of biological and biotechnolo gical applications.

PAGE 70

70 CHAPTER 3 MOLECULAR ASSEMBLY FOR HIGH PERFORMANCE BIVALENT NUCLEIC ACID INHIBITOR Introduction In contrast to monovalent interactions, multiv alent (polyvalent) interactions involve the binding of multiple ligands, such as small molecules, oligosaccharides, proteins, nucleic acids, lipids, or aggregates of these molecules, to multi ple binding pockets or receptors of a target, e.g., a protein, virus, bacterium or cell.36 Polyvalency is ubiquitous in biology and has a number of benefits over monovalent interactions. For instance, polyvalent interactions collectively possess higher binding affinity than the corresponding m onovalent interactions. That is, polyvalency results in a cooperative configuration in which the probability of re-binding of a dissociated monomer to the target is increa sed by the presence of other m onomers bound to the same target. A classical example of this is demonstrated by the binding of Gal-terminat ed oligosaccharides to C-type mammalian hepatic lectins.43 In addition to increased binding affinity, polyval ent interactions also stand a better chance of providing higher selectivity in target re cognition. A multivalent binder, despite being composed of weak homoor heterogeneous ligands can still have stronger binding property due to multiple binding events.92 A well known example of this phenomenon is taken from the biology of gene regulation by oligomeric transcription factors. Speci fically, the retinoid X receptor (RXR) functions as a transcripti on factor in the presence of its ligand.93 Each RXRligand complex (RXR-L) binds to single strand DNA called the cellular retinol-binding protein II element (CRBP-II element). Interestingly, while the intrinsic affinity of one or more units of RXR-L for one CRBP-II element (i.e., di-, trior tetr avalent interaction) is insufficient to initiate transcription, more than five of these comp lexes adjacent to CRBP-II elements can, in fact, initiate the transcription. As a result, transcriptive response is well regulated depending on the

PAGE 71

71 concentration of the transcription factor. Furthermore, this activity demonstrates the cooperative configuration, as noted above, which gives polyvalent interac tions the potential for considerably increased binding affinity. A number of recent studies have systema tically reported the unique properties of multivalent interactions. Investig ators have attempted to mimic the mechanisms underlying such interactions in order to design new therapeutic entities, particularly those using repetitive epitopes of antibodies.36 By designing more efficient targetin g reagents with potentially viable therapeutic applications, all of these attempts have clearly shown promising results. A typical example is the single chain variable fragment (scFv) constructed by linking the antigen binding VH and VL domains of an antibody with a flexible polypeptide linker.94 The combinatory configurations of scFvs can be designed and i nvestigated to optimize the functionality. Another successful therapeutic design, which takes advantag e of polyvalent interactions, is the bi-specific T-cell engager molecule (BiTE).95 A BiTE molecule is a bi-specifi c antibody that is constructed by linking the binding domains of tw o antibodies with different specificities via short, flexible peptides and is, therefore, expressed as a single polypeptide chain. The typical working principle is that BiTEs bind with one arm to a target ce ll and the other arm to a T cell, consequently activating the T cell. This unique mode of action results in incr easing the cytotoxic potency of BiTE molecules by at least 10,000-fold higher than that of conventional human IgG1 antibodies.96 These two achievements demonstrate how biomolecular engineers have exploited the potential of multivalent binding motifs. However, the genetic engineering required to mimic the mechanisms underlying multivalent interacti ons is time consuming and prone to many technical difficulties. For instance, expressed prot eins may not fold into the expected tertiary structures, leading to non-functional products. Also, the heavy mo lecular weight of the final

PAGE 72

72 product can be a limitation for future therapeuti c applications. For thes e reasons, alternative ligands that have functionalitie s similar to those of antibodies but without the limitations, are clearly attractive. In the pres ent study, we demonstrate how the nucleic acid aptamer (NA aptamer) is a strong candidate for such multivalent applications. Aptamers are nucleic acid sequences select ed by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method.32-34 They specifically recognize targets ranging from ions, and small organic or inorganic molecu les, to proteins and living cells, with binding affinities and selectivities to targets comparab le to those of antibodies. NA aptamers have markedly lower molecular weights (usually belo w 20 kDa) than antibodies, and their secondary structures are easily predictable. In addition, aptamers are not prone to the irreversible denaturation that affects antibodies. Moreover, th ey can be synthesized efficiently and reliably using established phosphoramidite chemistry. Thus far, many aptamers have been identified, and some of them are very close to becoming marketable drugs.97-101 Nevertheless, engineering these aptamers for enhanced performance or ne w functions remains virtually unexplored. Here, we demonstrate that rationally designed aptamer assemblies can combine the functionality and binding affinity of different aptamers to achieve greatly enhanced enzymatic inhibition with potential medical significance. Using fluoresce nce resonance energy transfer (FRET)-based molecular probes,102 we have also revealed the ki netic properties of the aptamer assembly-protein interaction that underlie this improved inhibition. A molecular assembly of two separate aptamers is expected to have even mo re advantages: stronger binding affinity, enhanced inhibitory function, high intrin sic selectivity, minimal host immune response, and low to no cytotoxicity.103 In addition, a unique feat ure of DNA-based therapy is that the antidotes of aptamer drugs are readily available from their target DNAs.104 We have demonstrated the use of

PAGE 73

73 these antidotes to effectively reverse the activit y of the aptamer assembly because of the strong and fast aptamer/DNA hybridization. With this set of investigations, we have proved that the careful and rational design of aptamer assemblie s can exploit multivalent interactions with the protein target to produce enhanced enzymatic inhibition in a simple, effective, and practical way. Experimental Section Chemicals and Reagents: All DNA synthesis reagents, including 6-fluorescein phosphoramidite, 5'-dabcyl phosphoramidite, spacer phosphoramidite 18 (hexaethylene glycol linker) and Ddeoxyphosphoramidite, were purchased from Glen Research. All reagents for buffer preparation and HPLC purification were from Fisher Scientific Company L.L.C. (Pittsburgh, PA). The buffer resembling physiological conditions used for the buffer experiment contained 25 mM Tris-HCl at pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1mM CaCl2, and 5% (V/V) glycerol. Human -thrombin was purchased from Haematologic Technologies, Inc. (Essex Junction, VT). Fibrinogen and the sulfated hirudin fragment were obtained from Sigma-Aldrich, Inc. (St. Louis, MO). Universal Coagulation Reference Plas ma (UCRP) and thromboplastin-DL for human sample testing were purchased from Pacific Hemostasis (Cape Town, South Africa). The activated partial thromboplastin time (aPTT) as say and prothrombin time (PT) assay reagent was from Trinity Biotech USA (Berkeley Heights, NJ). The bivalirudin was obtained from The Medicines Company (Parsippany, NJ). Synthesis and Purification of Monoand Bivalent NA Ligands and Their Targets To optimize the length of two different aptame rs for the best binding affinity toward the target protein, we designed multiple bivalent nuc leic acid ligands having different linker lengths, for example, 4, 6, 8, and 10 spacer phosphoramidite 18. All sequences of nucleic acid ligands are presented in Table 3-1. All of them were s ynthesized using an ABI 3400 DNA/RNA synthesizer

PAGE 74

74 Table 3-1. DNA sequences. S means one unit of spacer phosphoramidite (hexaethylene glycol). Dabcyl is a quencher and FAM is a fluorophore. Name Sequence (5-3) 15Apt GGTTGGTGTGGTTGG 27Apt GTCCGTGGTAGGGCAGGTTGGGGTGAC Bi-4S GTCCGTGGTAGGGCAGGTTGGGGTGACT-(S)4TGGTTGGTGTGGTTGG Bi-6S GTCCGTGGTAGGGCAGGTTGGGGTGACT-(S)6TGGTTGGTGTGGTTGG Bi-8S GTCCGTGGTAGGGCAGGTTGGGGTGACT-(S)8TGGTTGGTGTGGTTGG Bi-10S GTCCGTGGTAGGGCAGGTTGGGGTGACT-(S)10TGGTTGGTGTGGTTGG Bi-8S AGGCGTGGTACCGTAGGATGGGGTGGTT-(S)8TGGTTGGTGTGGTTGG 15Apt MBA Dabcyl-GGTTGGTGTGGTTGG-FAM Bi-8S MBA1 Dabcyl-GGTTGGTGTGGTTGGT-FAM-(S)8TGTCCGTGGTAGGGCAGGTTGGGGTGACT T-15Apt CCAACCACACCAACC T-27Apt GTCACCCCAACCTGCCCTACCACGGAC T-15Apt CACACCAACC F-T-15Apt FAM--CACACCAACC Short 15Apt-Q GGTTGGTGT-Dabcyl (Applied Biosystems, Foster City, CA) at 1mol scale with the standard synthesis protocol. For high coupling yield, the coup ling time of special modifier s, including 6-fluorescein phosphoramidite, 5'-dabcyl phosphoramidite and spacer phosphoramidite 18, was extended to 15 min. For complete cleavage and deprotection, overnight incubation wi th ammonia was used. After ethanol precipitation, the precipitate s were then dissolved in 0.5ml of 0.1 M triethylammonium acetate (TEAA, pH7.0) for fu rther purification with high-performance liquid chromatography (HPLC) performed on a ProStar HP LC Station (Varian Medical Systems, Palo Alto, CA) equipped with a fluorescence detector and a photodiode array de tector. A C-18 reverse phase column (Alltech, C18, 5 M, 250x4.6mm) was used.

PAGE 75

75 Clotting Time Tests To perform the clotting time comparison for th e optimization of linker length, we designed a simple buffer experiment that contained only thrombin, each nucleic acid ligand, and fibrinogen substrate in physiological buffer. The th eory behind the experiment is that the mixture of sample becomes non-fluidic when the fibrinog en is digested by thrombin. As a result, the different time points of this transition can be used as an indicator. Briefly, 1 L of 10 M thrombin and 1 L of 100 M monovalent or bivalent nucleic acid ligand were added to a disposable transparent plastic cuvette (Fishe r Scientific Company L.L.C., Pittsburgh, PA) containing 200 L physiological buffer and then incubated for 15 minutes. In the case of nonlinked 15Apt and 27Apt mixture, 1 L of 100 M of each probe was applied. Following that, 4 L of 20 mg/mL fibrinogen was added, and samples in the c uvette were carefully examined by tilting the cuvette to reco rd the time when the sample become s non-fluidic. Each experiment was performed in tandem. A reaction mixture contai ning only thrombin and fibrinogen was always tested together with other samples as an inte rnal standard. All clotti ng times were normalized based on the internal standard and compared to it. Real-Time Monitoring of the Clotting Reaction To monitor the clotting event in real time, we utilized scattering light. When fibrinogen is digested by thrombin, the mixture of sample becomes not only non-fluidic, but also cloudy. Turbidity of samples can be measured using either absorption or scattering light. To monitor the clot formation, we chose scattering light. Briefly, reaction mixtures were prepared in the same way as the clotting tests described above, except that the reacti on took place in a 100 L quartz fluorescence cuvette (Starna Cells, Inc., Atascadero, CA), and the scattering light was monitored on a Fluorolog-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). For scattering monitoring, the excitation and emission wavelengths were bot h set at 580 nm, and the emission was detected

PAGE 76

76 at the right angle relative to the light excitation, so that the excitation light did not interfere with the light scattering signal. The initial rate of scattering increase represented the relative thrombin-inhibition strength of the tested sample Initial rates were calculated from the linear range of the early slopes of the scattering profiles. Monitoring of Apparent kon and koff Monitoring the binding kinetics (kon) was accomplished by modifying each inhibitor with fluorescein and dabcyl. The sequence of each pr obe is shown in Table 1. To compare the kon of each inhibitor with thrombin, we pre-incubate d 100 nM of each inhibitor with 100 nM of T15Apt. Then, a 5 times excess of thrombin (500nM) was added, and the fluorescence decay was monitored on a Fluorolog-3 spectrofluorometer. Obta ined data were used to calculate the kinetic parameters in the following way: )F (F )F (F kThrombin MBA AptTMBA Thrombin MBA pointtimeeach on / 15'/ /' (3-1) To monitor the koff of each inhibitor, 500nM of T-15Apt was added to the pre-incubated mixture of thrombin (500nM) and each liga nd (100nM). To generate the values of koff, the following equation was applied: )F (F )F (F kMBAfree AptTMBA MBAfree pointtimeeach off 15'/' (3-2) Reversible Binding Reac tion Using Target DNAs To test the reversible binding of Bi-8S, we tr eated the sample mixture with target DNAs of 27Apt or 15Apt. The mixture of sample, including fibrinogen, was prepared in the same way as indicated for the clotting time. About 500 seconds after fibrinogen was added to the reaction mixture, the appropriate target of either 15Apt or 27Apt, was adde d to reach a final concentration of about 5 times that of Bi-8S while the intensity of scatter light was monitored.

PAGE 77

77 Human Plasma Tests To evaluate the feasibility of the bivalent nucleic acid ligand as a potential anticoagulant reagent, we determined aPTT and PT for each ligand using human plasma samples. Procedures applied were those recommended by the manufact urer. For aPTT determination, 50L of UCRP was pre-incubated at 37C with a different amount of each ligand for 2 minutes; then 50L of aPTT-L was added and incubated for another 200 seconds. Next, 50L of pre-warmed CaCl2 was added to initiate the intrinsic clotting cascad e. Finally, the scatte ring signal was monitored until the signal was stabilized at the maximum. For PT determination, 50L of UCRP was preincubated at 37C with a different amount of each ligand for 2 minutes; then 50L of thromboplastin-L was added to in itiate the extrinsic clotting ca scade. Finally, the scattering signal was monitored until the signal was stabilized at the maximum. For the calculation of aPTT and PT, the end time was determined to be th e point where scattering signal reached half maximum between lowest and maximum points. Each measurement was repeated twice, and each set of experiments was performed with a single batch of plasma. Results and Discussion Thrombin Aptamers and Their Properties Thrombin is a multifunctional protease involved in homeostasis. As an initiator of blood clot formation, thrombin hydrolyzes fibri nogen and activates plat elets and some blood coagulation factors that have pr ocoagulant activity. Disorders in blood clotting are tightly linked to many serious health issues, in cluding heart attack and stroke. Th erefore, thrombin is typically the target in anticoagulation therapy for these di seases. However, anticoagulant drugs currently on the market often suffer from indirect inhibi tion and sub-optimum selectivity, which can lead to side effects including bleeding.105,106

PAGE 78

78 There are two known thrombin NA aptamers. On e is 15 bases long (15Apt) and binds to exosite 1, while the other, called 27Apt, is 27 bases long and interacts with exosite 299,107 as shown in Figure 3-1. The dissociation constant Kd of 15Apt tends to be very high (up to 450 nM), depending on measurement methods,108-110 and Kd of 27Apt is approximately 0.7 nM.107 As a potential anticoagulant, only 15Apt should have the enzymatic in hibitory functions required for thrombin-mediated coagulation, since it occupies the fibrinogen -binding exosite 1. However, efforts to explore the anticoagulant effect of this aptamer have shown only limited progress due to the lack of sufficient binding strength to th e exosite 1 on the target protein. Modifications on the existing aptamer itself have also been explored in order to generate an enhanced functional NA ligand of thrombin. However, this type of construct is likely to be even more Figure 3-1. Working principles of monovalent and bivalent NA ligands. (a) 15Apt, monovalent ligand, has constant ON and OFF and diffu ses into bulk solution immediately after dissociation from thrombin. Thus, thrombin can be readily reactivated to cleave fibrinogen. (b) In contrast, when linked to 27Apt to form a bivalent ligand, 15Apt can rapidly return to the binding site afte r dissociation due to confined molecular diffusion by 27Apt that is still bound to thro mbin. As a result, the equilibrium of the reaction is shifted to the left.

PAGE 79

79 unpredictable, as its unique confor mational structure can be disrupt ed, resulting in the loss of its binding property.111 Therefore, instead of modifying th e aptamer sequence itself, we have linearly assembled two existing NA aptamers of thrombin to form a molecular assembly of thrombin aptamers (Figure 3-1b). This assembly specifically improves the inhibitory function of thrombin due to the multivalen t interaction mentioned above. Design of Bivalent NA Inhibitors We hypothesized that a linear molecular asse mbly of two monovalent NA aptamers would be a superior functional NA inhibitor of enzymatic reactions with multiv alent binding properties. However, first we needed to find out whether we could achieve enhanced inhibition even in the absence of multivalent interactio ns, by simply mixing these two aptamers without a covalent linkage. The second important question would be whet her these two aptamers could interact with Figure 3-2. Comparison of the normalized clotting times of thrombin bound to different NA inhibitors. Clotting time of thrombin alone was defined as 1, and the relative values are based on it. 15Apt alone showed a thre efold increase of the clotting time, but no delay was observed from the 27Apt-treat ed sample. Among bivalent NA candidates (Bi-xS), Bi-8S is the best inhibitor with the longest clotting time. The replacement of 27Apt by a random sequence, as in Bi-8 S, causes almost complete loss of anticoagulant function, mainly due to the la ck of bivalency and interaction between the scrambled sequence and 15Apt.

PAGE 80

80 each other and subsequently lose their inhibito ry properties. To address these issues, we performed typical clotting tests using no aptamer, 15Apt alone, 27Apt alone, and a mixture of 15Apt and 27Apt. As shown in Figure 3-2, 15Apt alone delayed the coagulation time by nearly three-fold, while 27Apt had no significant observed inhibition. This result was expected since 27Apt does not target the critic al exosite 1. The non-linked 15Apt/27Apt mixture showed an inhibitory effect similar to the 15Apt alone. These findings indicate that 15Apt and 27Apt act independently from each other and thus do not prom ote or interfere with each others activities. Next, several candidate bivalent NA ligands were designed and evaluated with the purpose of optimizing the distance between the two different NA aptamers. This step is particularly critical in designing bivalent ligands, and we initially assumed that a shorter distance between the two aptamers would result in disruption of their simultaneous binding and lead to less effective binding and inhibition. Therefore, we designed several potential bivalent NA ligands with linkers of different lengths composed of 4, 6, 8, or 10 spacer phosphoramidites and designated Bi-xSs in Table 1. Considering that one space r is about 2.1 nm long and that the inner diameter of thrombin is several nanometers, this represents a sufficiently ample range of lengths; i.e., from 8.4 to 21.0 nm. Then, a clotting test wa s carried out to evaluate the effect of linker length on thrombin inhibition, and the results were then compared with the clotting times of the monovalent 15Apt. In this test, th e thrombin converts soluble fibri nogen into insoluble strands of fibrin, resulting in increasing turbidity and decreasing fluidity. The recorded time when it became completely non-fluidic was normalized a nd compared among the series of potential bivalent ligands. The results in Figure 3-2 show that the numbe r of spacers increased, the inhibition activity first increased and then maximized with 8 sp acers. After that, a decline of inhibition was

PAGE 81

81 observed. Interestingly, the Bi-4S displayed a wo rse anticoagulation efficiency than free 15Apt. Competition between the two aptamers readily explains this phenomenon. If the distance between 15Apt and 27Apt is not sufficiently long, the binding of 27Apt will surpass that of 15Apt due to its stronger affinity to thrombin. Th is, in turn, will prevent 15Apt from reaching the binding pocket of thrombin and lead to a dr astically reduced anticoagulation capability. However, with a sufficient linker length, Bi-8S inhibited thrombin nine times better than 15Apt alone. Contrary to our initial assumption, and cons idering that the size of thrombin is about 3-4 nm in diameter, it was unexpected to see that a linker as long as ~16 nm (8 spacers) was needed for the best inhibition. Based on these findings, we therefore hypothesized that some extra linker length was required for both aptamers to wrap around thrombin and assume the optimum 3dimensional position and orientation to interact with thrombin. This extra linker is most likely needed to minimize interference originating fr om thrombin/linker contact. In spite of these results, an even longer linker length, such as in Bi-10S, was not as efficient as Bi-8S or Bi-6S as shown in Figure 3-2. Taken together, these results support the fact that simultaneous binding through bivalent interaction does take place and does result in improved inhibitory effect. Additional evidence was obtained from the clottin g test using Bi-8S in which 15Apt was linked to a scrambled DNA sequence with 8 spacers. The results showed very limited thrombin inhibition. Therefore, the nine -fold increase of cl otting inhibition by Bi -8S over 15Apt alone must be a direct result of bivalent interaction realized by molecula r assembly. This indicates that aptamers are ideal for the design of multivalent ligands through molecular assembly. Monitoring Inhibitory Functi ons Using Light Scattering To obtain real-time kinetics of coagulation, we designed a more quantitative experiment based on the nephelometric measurements of the turbidity caused by gel. The intensity of the scattered radiation during coagul ation was monitored by a spectrofl uorometer, and the results are

PAGE 82

82 Figure 3-3. Real-time monitoring of scattered light generated by the coagulation process in the presence of different monovalent or bivalent NA ligands (Bi-xSs). After the coagulation was initiated by adding fibrinogen to each sample, the reaction kinetics varied depending on the ligands. The initia l reaction rate of each sample was calculated (slope of the initial linear part of the curve is in cps/s) and then plotted in the inset. These results are consistent with those of the clotting test. As the number of spacers increased, the reaction rate went down and then up (inset). Results show that the Bi-8S is the best design fo r a bivalent NA inhibitor. shown in Figure 3-3. The background scattering of the thrombin-inhibitor mixture was stable until the addition of fibrinogen. The increased intens ity of scattering light re flected the net rate of the coagulation reaction, as this was the direct result of fibrinogen cleavage. The relative inhibition strengths of the monovalent and bivale nt NA ligands were estimated from the initial reaction rates, with higher rate s representing weaker inhibition a nd the reverse for lower rates. As expected, Bi-4S produced an initial rate of 2903 cps per sec ond calculated from the part of the slope of the scattering profile. This result, which 2.8 times faster th an that of 15Apt alone, 1049 cps per second indicates that 27Apt interferes with 15Apt bi nding when the linker is only

PAGE 83

83 8.4nm long. In contrast, the ini tial reaction rates of Bi-8S and Bi-6S were much slower than the others, at 63 and 97 cps per sec ond, respectively. Since Bi-8S dem onstrates an initial rate close to 16.6 times slower than free 15Apt, it also represents a considerable improvement of antithrombin efficacy. The anticoagulation trends among the tested inhibitors correlate very well with the results from the clotting tests. As show n in the clotting test, Bi-10S did not function as well as Bi-8S, resulting in an increased initial reaction rate. Likewise, Bi-8S, with a scrambled sequence in the 27Apt domain showed no impr ovement in inhibiting the clotting process. Therefore, based on the evidence gathered from both clotting tests and turbidity measurements, we conclude that Bi-8S is the best de sign for improved thrombin inhibition. Binding Kinetics Studies Because the bivalent interact ion of the aptamer assembly with thrombin increases the overall binding affinity, it is proposed that enhanced affinities of NA inhibitors caused the stronger inhibition. Since the binding affinity is directly related to kine tic parameters, such as kon and koff, of the thrombin/inhibitor interaction, we carried out experiments to investigate the impact of the molecular assembling on kon and koff to determine what actually causes the improved inhibition. One important feature of apta mers is their binding to the target is often accompanied by changes in tertiary structures. Th is allows researchers to build various signal transduction mechanisms, such as fluorescence res onance energy transfer (FRET), into aptamers for sensitive target detection. In fact, 15Apt was among the first aptamers to be built into a molecular beacon aptamer (MBA) fo r protein detection based on FRET.112 In the present work, we labeled 15Apt and the 15Apt domain of Bi -8S with a fluorophore and quencher pair to form15Apt MBA and Bi-8S MBA 1 (Table 3-1). The compact structure of the 15Apt bound to thrombin was expected to differ considerably from the random coil structure in solution, thus

PAGE 84

84 giving different fluorescence intensities. We then used these modified aptamers to study the kinetics of interactions with thrombin under different conditions. To compare koff of the 15Apt MBA and the 15Apt domain of Bi-8S MBA 1, the full complementary target DNA of 15Apt (T-15Apt) wa s added to the sample solution to make the 15Apt, when released from thrombin, inactive by forming a duplex with it (Figure 3-4). At the same time, opening of the MBA should give in tensive fluorescence. 100nM of each MBA probe and 500nM of thrombin were pre-incubated for ha lf an hour to complete the binding reaction. Then, T-15Apt was added to the mixture while the fluorescence signal was monitored. To normalize the fluorescence signal, MBAs fully opene d by T-15Apt were used as the reference. Figure 3-4. Comparison of koff. Real-time fluorescence signal change of koff measurement. Free 15Apt MBA (green line) showed very rapi d hybridization kinetics with its target DNA. Thrombin-bound 15Apt MBA (blue) sh owed slower hybridization kinetics compared to the free form. One might question whether T-15Apt could i nduce the release of 15Apt from the binding pocket. Our investigation of con centration effects of T-15Apt (Fi gure 3-5) shows that this was

PAGE 85

85 not the case. In our tests, regardless of the concentration of T-15Apt, the reaction kinetics was consistent, which means that T-15Apt does not induce the release, bu t rather captures the released 15Apt as a separate step. Finally, the initial rate of each reaction was calculated using the linear part of the slope. Even though va lues calculated this way are not the absolute koff rates, they can still be useful for comparing kinetic parameters among different thrombin ligands. Figure 3-5. Investigation of concentration effect of T-15Apt in binding comparison. 15Apt/thrombin complex was treated with different amounts of T-15Apt (left). MA MB1/thrombin complex was treated with different amounts of T-15Apt (right). As shown in the figure, there was no noticeable kinetics change. Determination of kon for each MBA was done in a similar way (Figure 3-6)). Competition between thrombin and a short target DNA of 15Ap t, called T-15Apt, was studied. Briefly, each MBA was incubated with T-15Apt, and then th rombin was added while the fluorescence signal was monitored. Due to the weak binding affin ity between T-15Apt and 15Apt, thrombin would compete with T-15Apt for binding to 15Apt or the 15Apt domain of the bivalent ligands. This study was based on three assumptions: 1) that T15Apt only interacted w ith 15Apt, 2) that the binding affinity of the T-15Apt is identical fo r both MBAs, and 3) that binding of 15Apt to

PAGE 86

86 thrombin is more favorable than to T-15Apt. Optimization of the T-15Apt sequence revealed that 10 complementary bases gave the best result s in terms of binding to 15Apt and detectability Figure 3-6. Comparison of kon. Each inhibitor MBA was incubated with T-15Apt, and then thrombin was added to the hybrid mixtur e while fluorescence signal was recorded. The florescence was decreased after each MBA was bound to thrombin. Real-time fluorescence signal change of kon measurement. After thrombin was added, each sample mixture showed fluorescence decay. The decreasing rate was comparable in both cases. According to the calculation of the initial reaction rate, Bi-8S exhibited a 1.2 times faster kon than 15Apt did. of the kinetic parameters. The reason that we concluded that T-15Apt works the best is the disassociation between 15Apt and T-15Apt is not the rate limiting step but the association between 15Apt and thrombin target so that what we observed is the association rate between 15Apt and thrombin (Figure 3-7). The experiment result showed that such dissociation was very fast (few tens seconds to the competition). Specifically, 100nM of each MBA and the 10-base long T-15Apt were pre-incubated to complete the hybridization. Then, 5 times excess of

PAGE 87

87 thrombin was added to the mixture while th e fluorescence was monitored. Immediately following that, there was sharp fluorescence signa l decay. The obtained plot was normalized, and the data points for the first 100 sec were us ed to calculate rela tive reaction rates. Figure 3-7. Investigation of th e dissociation of T-15Apt. The pre-incubated mixture of F-T15Apt and short 15Apt-Q(Dabcyl) for 30 mins was treated with 15Apt. The increased fluorescence signal of the sample was obtained from the dissociation of T-15Apt, which is very rapid reaction. Since this dissociation between 15Apt and T-15Apt is much faster than the association of 15A pt to thrombin, it does not interfere the measurement of kon. The relative koff values obtained for monovalent and bivalent 15Apts were 1.5 and 0.029 %/sec, respectively (Figure 3-4) (all meas ured by percentage of changes in fluorescence intensity). This means that koff of monovalent 15Apt is 51.7 times faster than that of bivalent 15Apt. 15Apt MBA and Bi-8S MBA 1 have relative ko n values of approximately negative 0.00424 and 0.00498 %/sec, respectively (Figure 3-6). In other words, the kon of bivalent 15Apt is about similar to that of monovalent 15Apt. Finally, we obtained the relative Ka values by dividing kon by koff, which revealed that binding affinity of bivalent 15Apt to thrombin is about 62.5 or more times higher than that of monovale nt 15Apt. These results agree with the binding

PAGE 88

88 properties of other reported multivalent ligands. It is believed that, while multivalent interaction does not affect kon significantly, it does alter koff considerably. By using the FRET strategy, we were able to measure the changes in kinetics of a single domain rather than the whole molecule, observing about 50 times higher binding affinity fo r the 15Apt domain. This confirms that the increased thrombin inhibition potency of the aptamer assembly originated from the kinetic changes caused by cooperative bind ing. As a byproduct of the study, we have also demonstrated that aptamer-based multivalent ligands make the study of kinetics using FRET quite convenient compared to antibody or small molecule based ligands. Antidote Effect of Binding Aptamers One of the unique properties of NA aptamers is that the binding can be readily regulated using complementary sequences.104 Strong binding affinity of a targ et is critical, but reversibility of binding is equally, if not more, important. Reversibility of binding directly impacts the pharmacology of drug treatments, in the sense that the side effects of drugs may be quenched by antidotes. Based on their binding affinity as m easured by the Watson-Crick base pairing of complementary sequences, NA ligands and their complementary NAs can be very effective drug/antidote pairs. To demonstrate this, the anti dote effects of two aptamers target sequences, T-15Apt and T-27Apt, were investigated. Clotti ng mixtures, including th rombin and fibrinogen with Bi-8S, were treated with excess T-15Apt and T-27Apt separately while the scattering was monitored (Figure 3-8). With the treatment of T-15Apt, immediate scattering increase was seen, and the extent of final scattering intensity was co mparable to that observe d without any thrombin inhibitors (Figure 3-8), indicating that the activity of thrombin is readily recovered by inactivation of 15Apt, and the res ponse is rapid. On the contra ry, the clotting mixture treated with target DNA of 27Apt showed slower chan ge in the scattering si gnal (data not shown), suggesting that its effectiveness in reversing the inhibition of thromb in is limited. We later used

PAGE 89

89 molecular beacon assay to confirm that the hybridi zation of 27Apt to its target was much slower than that of 15Apt and its target. It is clear that the secondary structure of 27Apt is quite stable, leading to slower duplex formation. The second r eason is that 15Apt domain was still active even when 27Apt was hybridized to its target. In conclusion, the target DNA of 15Apt is an effective antidote, even for aptamer assembly-based therapy. Figure 3-8. Reversible inhibito ry function. Red: T-15Apt was added at around 200 seconds to the incubation of Bi-8S, thrombin and fibri nogen. Black: fibrinogen was added to thrombin at 0 seconds in the absence of any inhibitors. Blue: Bi-8S incubated with thrombin and fibrinogen (no T-15Apt). Antithrombin Potency of Bi-8S Recent studies related to its biological functions have shown th at thrombin is critical in blood clotting disorders and influences a tumor angiogenesis.111 Thus, after we demonstrated that Bi-8S is the best inhibitor of thrombin in buffer system, we tested Bi-8S in human plasma

PAGE 90

90 samples to further demonstrate the potency of the anticoagulant. Standard activated partial thromboplastin time (aPTT)113 and prothrombin time (PT)53 tests were utilized as described in Materials and Methods. The aPTT and PT are performance indicators, which measure the efficacy of the contact activation pathway and extrinsic pathway of coagulation, respectively, as well as the common coagulation path ways. In each test, a different amount of each inhibitor was treated, and the obtained result s were plotted using a sigmoid fit. The dosage dependence is shown in Figure 3-9 and 3-10. Enhancements in the delay of coagulation triggered by both contact activation and extrinsic pa thway were consistently observed. The results show that the plasma samples treated with Bi-8S showed appr oximately five to six times longer PT and aPTT than those without any treatments, while the de lay by 15Apt alone was only two to three times longer. Even though the enhancement obtained using human plasma samples was not as great as Figure 3-9. Comparison of anticoa gulant potency of Bi-8S and 15Apt using human plasma and aPTT. It shows dosage-dependent aPTT plotted for each NA inhibitor, and the maximal aPTT is shown inside the figure.

PAGE 91

91 the delay in a buffer system, it proved that th e bivalent NA ligand can still function well in human biological fluid and give enhanced anticoagulation efficacy. Figure 3-10. Comparison of anticoagulant potency of Bi-8S and 15Apt using human plasma and PT measurements. It shows dosage-dependent PT, and the maximal PT recorded appears inside the figure. Conclusions In summary, by assembling two thrombin-binding aptamers with optimized linker and linker length, we have develope d an NA-based high-performance bi valent ligand, which can be applied as a potential anticoagulant. This new design has the combined advantages of both ligands and has achieved enhanced thrombin i nhibition capability, indicating its potential in biomedical applications for treating various diseases related to bl ood clotting disorders. Moreover, the molecular assembly approach offe rs a simple and noninvasive way to accomplish higher performance with a known protein inhibitor. It is worth noting th at aptamers are ideal

PAGE 92

92 candidates for constructions of such assemblies b ecause they can be easily linked in a predictable way using reliable synthetic chemistry mechanisms. In addition, binding of aptamers to different epitopes of one protein is quite common, and ap tamers can theoretically be obtained using a variety of suitable selection st rategies for targets ranging from small molecules to complex organisms.32-34,114

PAGE 93

93 CHAPTER 4 DEVELOPMENT OF DENDRITIC APTAMER A SSEM BLIES AS SUPERIOR INHIBITORS Introduction The concept of molecular assembly is found in nature.36 Standard examples include amino acids, nucleic acids and carbohydrates, which assemble in different sequences or geometries, resulting in the creation of unique functions. In bioengineerin g, assembling molecules with distinctive functions into a new structure is highly advantageous in creating new properties or amplyfying existing ones. An important exampl e is the enhancement of binding properties, which was discussed in the previous chap ters, by the phenomenon of multivalency (or polyvalency).36 Multivalency is defined as the simulta neous multiple interactions between two molecules, creating a cooperative effect am ong multiple binding domains, which is the key source of a dramatic increase of binding affinities. For this reason alone, much effort has recently focused on taking advantage of polyvalency in th e design of inhibitors by linearly assembling capture molecules, such as repetitive epitopes of anti bodies, sugars or small molecules, that recognize specific ce ll receptors. These efforts have all shown progress.115 However, demand remains high for better molecular recognition elements and strategi es. This chapter reports the assemblies of various aptamers for improved inhibitory efficacy to protein activity. The advantages of using DNA aptamers are th e binding units and have been described in previous chapters, such as relatively small molecular weight (making multiple-molecule assembly feasible) and have high binding affi nity. Structurally, DNA-aptamers are easily modifiable with robust structural restoration under ambient conditions.116 As a model, we use thrombin and its two binding aptamers, 15Apt binding to exosite 1 and 27Apt recognizing exosite 2.97,107 Their binding specificities ar e respectively very high, but their affinities are rather different, sub-nanomolar Kd for 27Apt and sub-micromolar Kd for 15Apt.108,109 Although a series

PAGE 94

94 of trials demonstrated the efficacy of 15Apt as a potential anticoagulant, its insufficient binding affinity has often been a significant drawback. To solve this problem, recent studies reported the engineering of a molecular assembly to link 15 Apt and 27 Apt.117 However, the final results did not reach what we would consider to be the lim its of inhibitory potency for aptamer assemblies. Therefore, we took a dendritic approach to the design of an eff ective multi-ligand assembly and tested its inhibitory efficacy against thrombin. Experimental Section Synthesis of Multimeric Assemblies All DNA synthesis reagents were from Glen Research. All DNA probes (Table 1) were synthesized with an ABI3400 DNA/RNA synthesizer using the standard procedure descried in the previous chapter. Real-Time Monitoring of Coagulation Process A well known mechanism during the clotting proce ss is the turbidity of sample, which is dramatically increased due to the cleavage of fibrinogen to fibrin. Thus UV-VIS measurement is used to conduct real-time monitoring of the clotting process. A Cary 100 Bio UV-VIS spectrophotometer (Varian Inc. Palo Alto, CA) was used. Briefly, a mixture of 200 microliters of physiological buffer (25 mM Tris-HCl at pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1mM CaCl2, and 5% (V/V) glycerol) containing 1nM thrombin and 1nM each inhibitor was incubated for a half hour. Fibrinogen was then added to the sample mixture while the absorption was recorded at 500nm. PT Measurement To evaluate anticoagulation efficacy, we determined PT for each ligand using human plasma sample, following the manufacturers inst ructions. For PT determination, 50L of UCRP was pre-incubated at 37C with different amounts of each ligand for 2minutes, and then 50L of

PAGE 95

95 thromboplastin-L was added to in itiate the extrinsic clotting ca scade. Finally, the scattering signal was monitored until the signal reached a plateau. For the calculation of aPTT and PT, the end time was determined at the point where sc attering signal reached half maximum between lowest and maximum points. It was repeated tw ice, and each set of experiments was conducted with a single batch of plasma. Results and Discussion Design of Multimeric Assemblies To improve the anticoagulation potency of DNA-based molecules, we designed a unique assembly composed of two different functional domains: an anchor and a dendrimer-like inhibitor, in this case, 27Apt a nd 15Apt, respectively (Table 4-1). The schematic structure of this assembly is shown in Figure 4-1. as shown in Ch apter 3, an anchoring molecule, 27Apt in this case, is highly beneficial in overcom ing the low binding affinity of 15Apt.117 The dendrimer-like configuration of 15Apt functions as a highly branched inhibitory domain that is composed of two or three 15Apts.118 Recalling that 15Apt binds to exosite 1, the engineering of this heterogeneous ligand assembly activates the cooperative effect described previously. That is, because the process results in the gain of extra ligands, the concentration of inhibitors around exosite 1 is artificially, but effectively, increased. The anc hor domain (27Apt) ensures that the dendrimerlike assembly of 15Apts stays around the thrombin so that the e ffective local concentration is extremely high compared to the same non-linked 15Apts.119 Each assembly contains an anchor domain, which is 27Apt. In the middle of the linke r region, a dendritic modifier is introduced to covalently link the inhibitory aptamer (15Apt). In the absence of a dendr itic modifier, only one 15Apt is linked to 27Apt, which we term mono15Apt assembly. In contrast, doubler or trebler dendritic modifiers allow two and three 15Apts to be linked to 27Apt at the identical distance from the anchor. These are called dual15Apt and triple-15A pt, respectively.

PAGE 96

96 Figure 4-1. The sequences and schema tic of dendritic aptamer assemblies. Each assembly contains an anchor domain, which is 27A pt. In the middle of the linker region, a dendritic modifier is introduced to covalently link the inhibitory aptamer (15Apt). In the absence of a dendritic modifier, only one 15Apt is linked to 27Apt, which called the mono-15Apt assembly. In contrast, doubler or trebler dendritic modifiers allow two and three 15apts to be linked to 27Apt with the identical distance. These are called dual-15Apt and trip le-15Apt, respectively. Table 4-1. Sequences of multimeric assemblies To design the assemblies, we applied two di fferent dendritic modifi ers, a doubler and a trebler (Figure 4-1). These are the functional gr oups that provide the branched assemblies of 15Apts. New assemblies were then based on th e optimal design of the Mono-15Apt assembly Name Sequence (5-3) 15Apt GGTTGGTGTGGTTGG 27Apt GTCCGTGGTAGGGCAGGTTGGGGTGAC Mono-15Apt Assembly Dabcyl-TGGTTGGTGTGGTTGG-(S)8GTCCGTGGTAGGGCAGGTTGGGGTGACT Dual-15Apt Assembly Dabcyl-TGGTTGGTGTGGTTGG-(S)5-(doubler)-(S)3GTCCGTGGTAGGGCAGGTTGGGGTGACT Dual-15Apt Assembly 2 Dabcyl-TGGTTGGTGTGGTTGG-(S)3-(doubler)-(S)5GTCCGTGGTAGGGCAGGTTGGGGTGACT Triple-15Apt Assembly Dabcyl-TGGTTGGTGTGGTTGG-(S)5-(trebler)-(S)3GTCCGTGGTAGGGCAGGTTGGGGTGACT

PAGE 97

97 controls, with each dendritic modifier inserted be tween the third and fourth hexaethylene glycol (HEG). This site was randomly chosen because th e inhibitory efficiency of the assemblies is not dependent on the position of the dendritic m odifiers since the molecules are quite small compared to the hexaethylene linker, but ra ther the number of assembled 15Apts data not shown). Validation of Products To verify the final products after HPLC purification, the length of each DNA probe was estimated using agarose gel el ectrophoresis because HPLC ca nnot completely purify the dendritic products due to the highly branch ed structures. Thus, each peak from HPLC purification was collected a nd analyzed by gel electrophores is since the new assemblies contained either two or three 15Apts and were named Dual-15Apt or Triple-15Apt Assembly, respectively, which means that the length are different. The results ar e shown in Figure 4-2. According to the gel image, we were able to obser ve that the molecular weight of each assembly is increased by the number of 15Apts. Thus, we concluded that the desired assemblies of DNA aptamer probes were observed. In addition, the length of each product was as expected. Figure 4-2. Agarose gel image with ethidium bromide (EB) staining Superior Anticoagulation Potency The target protein, thrombin, is a serine pr otease (EC 3.4.21.5) that hydrolyzes soluble fibrinogen into insoluble strands of fibrin, as well as catalyzes many other coagulation-related

PAGE 98

98 reactions. To evaluate the inhibitory potency of the newly designed probes, prothrombin time (PT) was determined by using a human plasma sample.53 PT is the clotting time when the extrinsic pathway is activated. Thus, determining PTs with varying concentrations of each probe can provide an effective way of comparing inhibitory potency (F igure 4-3). The results showed that the Mono-15Apt Assembly could prolong PT two-fold over the 15Apt alone. The Dual15Apt Assembly showed about 260% and 130% l onger PT compared to 15Apt and Mono-15Apt Assembly, respectively. Actually, the IC200, the concentration needed to delay clot ting by a factor of two, is a more accurate measure of inhibition in the blood clotting test. The IC200 of Dual-15Apt Assembly is Figure 4-3. Dose-dependent prothrombin time (PT). Real human plasma sample was used to determine the anticoagulant efficacy of each assembly. The Dual-15Apt and Triple15Apt Assemblies show the best anticoagulant efficacy, although Triple-15Apt did not show much improvement when compared to that of Dual-15Apt assembly. The inset box summarizes PT maxima and IC200, which is the concen tration to prolong the clotting time twice longer.

PAGE 99

99 0.2 M, which is five times lower than that of Mono-15Apt Assembly at 1 uM. This dramatic improvement of anticoagulation is quite surprisi ng because even when the concentration of 15Apt or Mono-15Apt Assembly is doubled, their inhibition of thrombin activity cannot be as efficient as the Dual-15Apt assembly. Thus, th e results partially suppo rt the success of the dendrimeric approach in assemb ling highly efficient functional aptamers. However, triple-15Apt assembly did not demonstrate any significant im provement over Dual-15Apt Assembly. This can be explained by the steric hindran ce and heavy molecular weight of such an assembly. Possibly, the high molecular weight may increase the diffusion time, which is one of the main factors affecting kon in aptamer binding with thrombin, likely re sulting in lower inhibition than expected. Moreover, the dense configuration of three or more 15Apts hampers each other from freely reaching the binding site. According to the anticoagulation comparisons, dual-15Apt Assembly is the optimal design for maximizing anticoagul ation and minimizing structural complexity. Real-Time Monitoring of Clotting Reaction In the case of Dualand Triple-15Apt Asse mblies, it may be argued that the enhanced anticoagulation effect arises simply from the doubl ed or tripled concentr ation of 15Apt in the mixture of samples, rather than significant in crease of 15Apts loca l concentration around thrombin. To investigate such a possibility, we used a simplified testing system that contained physiologically conditioned buffer, thrombin, and substrate (fibrinogen). The clotting process was monitored by a change in optical density. To minimize the tri-molecular interactions involving two thrombin proteins and a single Dual -15Apt assembly, we chose a concentration of 1 nM for each component, far below the Kd of 15Apt. Thus, the observed result should reflect only the bi-molecular interaction. The results, as shown in Figure 4-4, indicate limited inhibition by 1 nM, 2 nM and 3 nM 15Apt-treated samples. Th e reaction rate of each sample was compared to the rate of the blank sample (VB). As the concentration of 15Apt is increased, the initial rate is

PAGE 100

100 slowed to 72, 68, and 44% of VB. At the same time, the rates are 5.2% and 0.92% of VB for the Mono-15Apt and Dual-15Apt assemblies, respectivel y, clearly demonstrated that the assemblies produce greatly increased inhibiti on. Interestingly, Dual-15Apt Assembly has about a 6-fold slower reaction rate than M ono-15Apt. We believe that this observation results from the enhanced local concentration of 15Apts and not from the doubled or trip led actual concentration of 15Apt in the mixture of the samples. Assembly improves this because there is one extra 15Apt nearby. Therefore, the significant improvement of anticoagulation by Dual-15Apt Assembly mainly results from the increased effectiv e concentration of 15Apts around thrombin. Figure 4-4. Real-time monitoring of thrombin activity. When trea ted with each inhibitor, the reaction rate is compared. Thrombin activity pre-incubated with each inhibitor, was monitored after the substrate was added. Left: 15 Apt alone at various concentrations; Right: Mono-15Apt and Dual-15Apt assemblies at 1 nM concentration. Conclusions In conclusion, we have demonstrated that the dendritic approach for molecular assembly shows significantly enhanced molecular function. By designing a series of assemblies and testing

PAGE 101

101 them relative to each other in real human plas ma samples, we have shown that Dual-15Apt Assembly is the best inhibitor for thrombin because it possesses; 1) a higher effective local concentration, and 2) a more flexible steric sp ace for inhibition. Aside from the proof-of-concept demonstrated by this antithrombin model, the actual experimental re sults demonstrate the efficacy of the molecular assembly as a novel treatment modality for many diseases involving abnormal coagulation. In addition, recent st udies reported positive anticoagulation therapy outcomes in patients whose tumor growth and hematosis were linked to thrombosis.121 Therefore, the dendritic molecular assembly of aptamers can be one of the most effective approaches for use in aptamer-based drug development.

PAGE 102

102 CHAPTER 5 USING PHOTONS TO MANIPULATE ENZY ME INHIBITION BY AN AZOBENZENEMODIFIED NUCL EIC ACID PROBE Introduction Over the last decade, extensive research has been devoted to the study of phototransformable molecules based on photochromism ch emistry. This science has been applied to photo-optical technology and photo-modulated devices, such as eyeglasses called Transitions.119-122 A photochromic compound has two molecu lar states: stable and relatively unstable. The two states are interchangeable by the effect of irradi ation using different wavelengths and differ from one another in term s of both physical and chemical properties. The photoconversion mechanism can largely be di vided into three transformation types: photochromic tautomerism, cis-trans isomerization, and photocycli zation. Since isomerization causes a conformational change that can ch ange the overall structure of a molecule, cis-trans isomerization is an intriguing mechanism that can be used to regulate mechanical devices and biological reactions.70,123,124 As the most popular photo-transformable mo lecules in use today, azobenzene and its derivatives belong to the cis-trans isomerization category and are composed of two phenyl rings linked by a N=N double bond (Figure 5-1a).125 The two isomers can be switched with particular wavelengths of light: u ltraviolet light at 365nm corresponding to the trans-to-cis conversion, and visible light at 465nm, corresponding to the cis-to-trans isomerization. There are many reports that demonstrate the po ssible applications of such a feature in the development of sensors,126 nanomotors,127-129 and even pep tide engineering.130 In this chapter, we incorporated azobenzene molecules into DNA sequences131,132 in order of the conformational switch, as described above, to regulate th e function of aptamers particularly recognizing aptamers.

PAGE 103

103 Figure 5-1. Photoisomerization of azobenzene in nucleic acid chain (a) and working principle of Xc-Yazo probes (b). X and Y indicate th e number of bases and azobenzene in the regulatory-domain sequences. The transand cisconformation is reversibly regulated by different input of enectroma gnetic radiation of the energy (a). When probes are treated with visible light, the regulatory domain is hybridized and the probe is released from its target, resulti ng in activation of th e enzyme (thrombin). When treated with ultraviolet light, probes form the open conformation, and the inhibitory domain can bind to the targ et, causing low enzymatic activity (b). The many describable features if aptamers are described in the previous chapters. Particularly, the properties of aptamers targeted to thrombin are described in Chapter 3 and 4. Due to the many advantages of thrombin binding aptamers and the importance of thrombin in the regulation of homeostasis and relation to many types of cancers, engine ering probes targeting thrombin whose function can be precisely regulated by photonic energy can advance anticoagulation therapy for many diseases.99,111 Our photon-controllable inhibitor design has three domains based upon function: inhibitory, linking, and regulator y (Figure 5-1b). The inhibitory domain is a 15Apt sequence.

PAGE 104

104 The regulatory domain is composed of the complementary sequence to 15Apt with azobenzene molecules inserted into the phosphate backbone of the DNA sequence using an automated DNA synthesizer (Figure 1-5 and 5-3).133 The linking domain ties the other two domains together. Since the regulatory domain is composed of photochromic mol ecules, the affinity of the inhibitory domain can be altere d by different light treatments, as discussed above. Briefly, UV light induces trans-to-cis isomerization, resulting in a low binding affinity of the regulatory domain to 15Apt. This alteration frees 15Apt for binding to exosite 1 of thrombin. Conversely, visible light reverses the conf ormation of the regulatory domai n allowing it to hybridize 15Apt. This results in the low affinity of 15Apt fo r thrombin, thus enabling thrombin to hydrolyze fibrinogen for coagulation. To optimize the photon-controllable inhibitor, we designed and charac terized a series of candidate molecules with different lengths of cDNA and different amounts of azobenzene in the inhibitory domain. The inhibitory potency of these probes in bot h the ground and excited states was measured using prothrombin time (PT) measurement in human plasma. The results demonstrate that the real-time ability of the cis-form of these probes to switch-on thrombins activity under visible illumination. Spatial control of thrombin i nhibition can be achieved using a microscopic fluorescence-based PT assay, which allows sequential site-specific activation of coagulation within a microfluidic channel. Experimental Section Chemicals and Reagents Most DNA synthesis reagents, such as 6-fluorescein phosphoramidite, 5'-dabcyl phosphoramidite, spacer phosphoramidite 18 and D-deoxyphosphoramidite, were purchased from Glen Research. All chemical reagents fo r buffer preparation, post-treatment for oligo preparation and HPLC purification were from Fi sher Scientific Company, L.L.C. (Pittsburgh,

PAGE 105

105 PA). A physiological buffer that resembles physio logical conditions contained 25 mM Tris-HCl at pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1mM CaCl2, and 5% (V/V) glycerol for the buffer experiment. Human -thrombin was obtained from Haematologic Technologies, Inc. (Essex Junction, VT). Fibrinogen was obtained fr om Sigma-Aldrich, Inc. (St. Louis, MO). Universal coagulation reference plasma (UCRP ) and thromboplastin-DL for human sample testing were purchased from Pacific He mostasis (Cape Town, South Africa). Synthesis of Azobenzene Phosphoramidite The azobenzene phosphoramidite monomer is sy nthesized in three st eps from D-threoninol by following the procedure described previously. Briefly, D-threon inol (0.91 g, 9.0 mmol) and 4(phenylazo) benzoic acid (2. 25 g, 10.0 mmol) were mixed in dimethylformamide (DMF) and coupled in the presence of N,N'-dicyclohexyl carbodiimide (DCC) (2.05 g, 10.0 mmol) and Nhydroxybenzotriazole (HOBt) (1.32 g, 10.0 mmol). The intermediate was purified by column chromatography (ethyl acetate/methanol 20/1), yi eld 83% (2.34 g, 7.48 mmole). The first step intermediate (0.8 g, 2.4 mmol) was then mixe d with 4-dimethylaminopyridine (DMAP) (0.015 g, 0.12 mmol) in pyridine. To this mixture was ad ded 4,4'-dimethoxytrityl chloride (DMT-Cl) (1.0 g, 3.0 mmol) in dichloromethane (4 mL). Af ter 2 hours the solvent was evaporated, and the residue was purified by column chromatography (ethyl acetate/hexane/triethylamine 50:50:3) and dried to afford the second step intermed iate compound (0.76 g, 1.24 mmol, 52%) as an orange-red solid. The monomer was synthe sized by adding 2-cyanoethyl diisopropyl chlorophosphoramidite (290 uL, 1.3 mmol) in the presence of N, N'-diisopropylethylamine (DIPEA) (0.39 g, 3.0 mmol) and dichloromethan e (20 mL). The final compound was isolated by column chromatography (ethyl acetate/hexane/ triethylamine 40:60:3), yiel d: 0.52 g, 0.64 mmol, 64%. The monomer purity was confirmed by 1H and 31P NMR.

PAGE 106

106 Figure 5-2. Synthesis of azobenzene phosphoramidite Synthesis and Purification of Photochromic Self-regulating Inhibitor To optimize the number of complementary base pairs and azobenzenes incorporated into the complementary sequences of 15Apt, we designe d, prepared, and characterized a series of molecular probes. These sequences are shown in Table 5-1. The candidates were synthesized and post-treated as described in the previous chap ters. Azobenzene phosphoramidite was inserted to DNA chains using the standard oligo synthesis protocol as well (Figure 1-5 and 5-3). Real-Time Monitoring of Clotting Reaction To monitor the clotting time alteration in response to different light treatments, we designed a simple buffer experiment that containe d only thrombin, one of nucleic acid inhibitors, and fibrinogen substrate in physiological buffer. The underlying principle of the experiment is based on the mixture of sample which becomes nonfluidic and tends to s catter light by fibrin

PAGE 107

107 Table 5-1. Sequences of probes. A in red refers to azobenzene Probe Sequence 16c-15azo 5-Dabcyl-AACACAAAAACACAAACAAACACAAAAACAC-(S)5GGTTGGTGTGGTTGGT-Fam-3 16c-14azo 5-Dabcyl-ACACAAAAACACAAACAAACACAAAAACAC-(S)5GGTTGGTGTGGTTGGT-Fam-3 14c-13azo 5-Dabcyl-AACACAAAAACACAAACAAACACAAAA-(S)5GGTTGGTGTGGTTGGT-Fam-3 12c-11azo 5-Dabcyl-AACACAAAAACACAAACAAACAC-(S)5GGTTGGTGTGGTTGGT-Fam-3 10c-9azo 5-Dabcyl-AACACAAAAACACAAACAA-(S)5GGTTGGTGTGGTTGGT-Fam-3 10c-4azo 5-Dabcyl-ACACAAACACAACA-(S)5-GGTTGGTGTGGTTGGT-Fam3 9c-8azo 5-Dabcyl-AACACAAAAACACAAAC-(S)5-GGTTGGTGTGGTTGGTFam-3 9c-7azo 5-Dabcyl-ACACAAAAACACAAACAA-(S)5GGTTGGTGTGGTTGGT-Fam-3 8c-4azo 5-Dabcyl-AACACAAACACA-(S)5-GGTTGGTGTGGTTGGT-Fam-3 7c-6azo 5-Dabcyl-AACACAAAAACAC-(S)5-GGTTGGTGTGGTTGGT-Fam-3 7c-4azo 5-Dabcyl-AACACAAAACC-(S)5-GGTTGGTGTGGTTGGT-Fam-3 7c-3azo 5-Dabcyl-AACCAAAACC-(S)5-GGTTGGTGTGGTTGGT-Fam-3 6c-5azo 5-Dabcyl-AACACAAAA-(S)5-GGTTGGTGTGGTTGGT-Fam-3 6c-4azo 5-Dabcyl-AACACAAAAC-(S)5-GGTTGGTGTGGTTGGT-Fam-3 6c-3azo 5-Dabcyl-ACACAAAAC-(S)5-GGTTGGTGTGGTTGGT-Fam-3 Figure 5-3. Insertion of azobenzene phosphoramidite to DNA chains

PAGE 108

108 aggregation, the product of thromb ins catalytic reaction. As a re sult, the clotting process can be measured by the decrease of light penetration through the sample cell. To compare the efficacy of inhibition, each probe was pre-treated with UV (365nm) or Vis (white light). The mixture containing 1 L of 10 M thrombin and 1 L of 100 M each inhibitor in 200 L physiological buffer was then incubated for 10 minutes under ei ther UV (365nm) or Vis (500nm) light in the spectrometer. In sequence, 4 L of 20 mg/mL fibrinogen was quickly added and mixed while the UV spectrometer was monitoring either the UV or the Vis wavelength as a function of time. Reaction mixtures containing only thrombin and fibrinogen with or without 15Apt were always tested together with other samples as internal standards. All clotting times were normalized based on the internal standard and compared to it. Human Plasma Tests To evaluate the feasibility of the inhibito r as a potential anticoagulant reagent, we determined PT for each ligand using human plasma samples. Reaction mixtures were prepared in a manner similar to the clotting tests described a bove, except that the initia lly scattered light at 90oC was monitored on a Fluorolog -3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ) equipped with the circulating temperature cont roller (Portsmouth, NH) to maintain a 37C reaction temperature. A 100 L quartz fluorescence cuvette (Starna Cells, Inc., Atascadero, CA) was used as a sample container, and the exc itation and emission wavelengths were both set at 500nm for Vis-treated sample and 365nm for UV-treated sample to minimize unwanted isomerization. Procedures applied were t hose recommended by the manufacturer. For PT determination, 50L of UCRP wa s pre-incubated at 37C with a different amount of each ligand for 2 minutes; then 50L of thromb oplastin-L was added to initiate the extrinsic clotting cascade, and the scattering intensity was monitored until the signal reached plateau. For the calculation of PT, the end time was determined to be the point where scattering sign al was the half way

PAGE 109

109 between the lowest and maximum values. Each sample was repeated twice, and each set of experiments was performed with a single batch of plasma. Monitoring Site-Specific Activation of En zymatic Reaction in Microfluidic Channel To demonstrate site-specific activation of th rombins activity, we used a microfluidic channel to create a two-dimensiona l model of the clotting process using fluorescent fibrinogen to visualize fibrin networks. Fibrinogen was labe led with Alexa Flour 488. Fibrinogen (10mg) was dissolved in 1ml of 0.1 M sodium bicarbonate buffer. Then, 0.5mg of Alexa Flour 488 in dimethylsulfoxide (DMSO) was added to the protein followed by stirring for one hour. The conjugated protein was separa ted from unreacted Alexa Flour 488 using a Nap-25 column (GE Healthcare Bio-Sciences Corp., Piscataway, NJ ). The purified protein had about a single fluorophore on each protein. Microfluidic channels were prepared by the following procedure. Microscope slides and 18 mm square No. 1 cover glasses (Fis her) were rinsed with deionized-H2O and dried under nitrogen. Strips of double-sided tape (3M) were placed 4 mm apart on a microscope slide, and the cover glass was placed on top. Devices were filled by capillary action. Solution exchange was performed by simultaneously pipetting soluti on at one end and withdrawing fluid from the other end with P8 filter paper (Fisher). An Ol ympus FV500-IX81 confocal microscope was used to both illuminate and image specific regions of the channel using a 10x objective and the 494 nm laser line. The length scale of the 10x field of view was calibrated using a micrometer and the image was 1.286 x 1.286 mm. A Human plasma sample (10L) was prepared for activated partial thromboplastin time (aPTT) measurement containing 10M of cis-probes and Alexa-488labeled fibrinogen, and the mixture was loaded into the channel a nd incubated at room temperature. The aPTT is a performance indicat or for measuring the efficacy of both the "intrinsic" (now referre d to as the contact activation pa thway) and the common coagulation

PAGE 110

110 pathways. The fluorescent time-lapse images were obtained every fifteen seconds until the reaction was completed. Results and Discussion Optimization of Probe Designs To design effective photon-controllable inhib itors, the complementary sequences to 15Apt was modified with azobenzenes, and the inhib itory and regulatory domains was linked using a polyethylene glycol linker (PEG) composed of five units of he xa-ethylene glycols conjugated using phosphoramidite chemistry. The decision to incorporate azobenzene to the complementary sequences of 15Apt, rather than the 15Apt se quence itself, was based on the fact that the complementary sequence of 15Apt can function as an excellent antidote for 15Apt, as a result of its high binding affinity vi a Watson-Crick base pairing.104,134 In addition, minor modifications to 15Apt can result in significant disrup tion of interacti ng configurations,110 which are generally unpredictable without computationa l simulation or experimental i nvestigation. Thus, modifying the complimentary 15Apt sequence with azobenzene is a more feas ible approach. Five units of hexa-ethylene glycol (approximately 10nm) were used to ensure close proximity of the inhibitory and regulatory domains.117 Unimolecular reaction was allowed to occur between the regulatory and inhibitory domains in a manner of maximized the efficiency of dissociation and association between them with azobenzene insertions. This was expected since small alterations are enough to disrupt intramolecular interactions, while more significant alterations are required to break intermolecular interactions. Furthermore, the unimolecular nature of our design allows the molecule to switch between active and inactive inhibitory states without the addition of another strand of DNA. Optimization of probe design also depends on maximizing the efficacy of photoisomerization, which involves both the number and position of azobenzene molecules and

PAGE 111

111 base pairs in the regulatory domain. Previous reports have shown that the insertion of azobenzene molecules (trans conformation) to the DNA chain can destabilize or stabilize duplexes of DNAs depending on their positions The most common method of regulating DNA duplex conformations is to alternate every tw o bases with a single azobenzene phosphoramidite. Although this strategy works well at high temperatures, a maximum of 7 azobenzene molecule insertions did not result in a kinetically favorab le duplex transition within the 15 base-pair stem under the reaction conditions necessa ry to perform the PT assay ( 37C and physiological salt). Therefore, we investigated the feasibility of alternating azobezen e moieties between every other nucleotide. Using this protocol we could potentially have a probe with 15 or 16 azobenzene incorporations within the regulatory domain. To investigate the ability of azobenzenes to destabilize our probe design, a series of molecular probes having different numbers of azobenzene and base pairings were created (Table 5-1). Each probe contained a FRET pair (fluores cein and dabcyl) as a signaling element to monitor the hybridization and de hybridization between the regulatory and inhibitory domains.135 The working principle is that dissociation and association of the two domains report high and quenched fluorescence signal, respectively. Th e probes are named Xc-Yazo where X is the number of complementary sequences, and Y is the number of azobenzenes. These probes were characterized by melting temperature measurement as described in Chapter 2, binding to thrombin, and clotting assay (Table 5-1) Depending on the number of azobenzene incorporations, these molecular pr obes had significantly different properties, as summarized in Table 5-1. Probes with 40% azobenzenes per nucleotide (10c-4azo, 8c-4azo, 7c3azo, and 6c3azo) showed higher melting temperatures than non-azobenzene incorporated probes as shown in Figure 4. It is a well-known phe nomenon that the insertion of az obenzenes between at least two

PAGE 112

112 Table 5-2. Characterized properties of each pr obe. Each probe was named Xc-Yazo; X is the number of complementary sequences, and Y means the number of azobenzenes in the regulatory domain. Name Azobenzenes per target (%) Tm average (C) Response 16c-15azo 48 71+/0 O 16c-14azo 47 69+/-1 O 14c-13azo 48 63+/-1.5 O 12c-11azo 48 65+/-0.71 O 10c-9azo 47 62+/-0.71 O 10c-4azo 29 76+/-0 X 9c-8azo 47 51+/-0 O 9c-7azo 44 52+/-0.71 O 8c-4azo 33 75+/-0.71 X 7c-6azo 46 48+/-2.9 O 7c-4azo 36 55+/-0 X 7c-3azo 30 66+/-1.2 X 6c-5azo 45 43+/-2.5 O 6c-4azo 40 51+/-1.7 6c-3azo 33 66+/-1.7 X nucleotides can enhance duplex stability by enhanced stacking interaction. The continued insertion of azobenzenes, however, causes significantly reduced stability. The reduced thermal stability is clearly shown by comparing the Tms of probes with the same number of base pairs, but different percentages of azobenzene incorpor ations: e.g., 7c-6azo< 7c-4azo< 7c-3azo and 6c5azo < 6c-4azo < 6c-3azo (Figure 5-4b). Molecu lar probes containing a low percentage of azobenzenes did not respond differentially to UV or Vis light in the fluorescent assay, indicating that the duplex had not dissociated. On the contrary, probes possessing th e maximum number of azobenzenes per regulatory domains (16c-15 azo, 14c-13azo, 12c-11azo, 10c-9azo, 9c-8azo, 7c6azo, and 6c-5azo) showed dramatic decreases in duplex stability after illumination with UV

PAGE 113

113 Figure 5-4. Relationship between melting temp erature and the number of base pairs and azobenzene insertions (a) and (b) and the photo-regulating inhibitory f unction (c) of probes. light (Figure 5-4c). In addition, they showed sufficient convers ion of binding to non-binding to thrombin. Thus, it was concluded that to desi gn photoconvertable probes that work as room temperature, the regulatory domain should contai n an azobenzene between two nucleic acids at least. Depending on the number of base pairings, the probes also demonstrate different ranges of photoalteration.

PAGE 114

114 Function as Photo-Switching Anticoagulant The results showed that the duplex structur e of specific probe desi gns can be regulated with ultraviolet and visible light under physiolo gical conditions. To de monstrate that these probes are also capable of regulating human blood clotting reaction, the pr othrombin time (PT) of each probe was measured in the cisor trans-conformations.136 PT measures how long it takes for blood to clot, and measuring PT is used as a method by which the efficacy of the extrinsic pathway (common coagulation pathway) is defined. Thus, PT testing is frequently used as a standard method to check bleeding problems and the efficiency of anticoagulants. The results obtained from the PT tests are plotted verse concentration and are fitted to a sigmoidal curve. Then, the concentration effective in doubling the plasma clotting time, the IC200, for each probe is calculated. It was expected that probes in the trans state would show shorter PTs and higher IC200, whereas probes in the cis state would have relatively longer PTs with lower IC200 under identical sample preparation. T ypical results are shown in Figure 5-5a and b. As expected the PTs of trans probe samples are much shorter than those of cis probe samples. A general trend of increased clotting time correlated with increase d number of base pair s as can be seen by comparing probes 6c-5-azo to 10c-9azo (Figure 5-5a and d). However, probes 12c-11azo through 16c-15azo showed only negligible difference in PT (Figure 5-3c and d. The difference in probes is more obvious when comparing IC200 values (Figure 5-5e). As expected, the IC200 values of both states of the 6c-5azo probe samples were the lowest and IC200 values for the cis forms increased with an increasing nu mber of base pairs. The difference between IC200-cis and IC200-trans was maximized with the 10c-9azo and 9c-8azo probe (Figure 5-5e). On the other hand, probes with more th an 10 base pairs were too stable to have a detectable difference in IC200-between the trans and cis states. We concluded that the 10c-9azo and 9c-8azo probes were the optim al probe designs since they showed the highest differential

PAGE 115

115 Figure 5-5. PT measurement using each probecis and -trans (a), (b), (c), and (d) and IC200 of each probes state (e). Dose-re sponse of 6c-5azo or 7c-6azo -cis and -trans was plotted in each graph (a) or (b), respec tively. Dose-responses of 10c-9azo, 12c-11azo, 14c-13azo and 16c-14azo -cis or -trans are compared (c) or (d), respectively. We the obtained dose-response curve; IC200s of each -cis and -trans are summarized in the table (e).

PAGE 116

116 IC200, thereby showing the larges t difference in anticoagulati on response upon treatment with UV or Vis light. In subsequent experiments on real-time and sub-millimeter control of clotting activity, we chose probe 9c-8azo over 10c-9azo because probe 9c-8azo had a lower melting temperature and faster overall ki netics than 10c-9azo probe (51 oC and 60 oC, respectively). Dynamic Photoconversion to Restore Coagulation Process In most cases, it is difficult to reverse an enzymes activity once a drug molecule has bound, but this conversion can be useful in many re spects, especially in c linical applications. For instance, immediate deactivation of drugs can limit side effects in medical treatment and potentially save lives. In some cases, there are antidotes that disrupt inhibitor-enzyme interactions, but there is still no general way of finding molecules that can perform this function. In this sense, aptamers can be advantageous compared to other small moleculeor antibodybased enzyme inhibitors since aptamers co mplementary sequences naturally function as effective antidotes. One potential drawback of this approach is that a la rge quantity of antidote sequences must be administered to overcome the slow reaction time of diffusion and hybridization in the case of in vivo applications. Anothe r attempt that used the caged thrombin aptamers to deactivate thrombin by photons does not fit to the concept of antidote since this mechanism is opposite to rest oring the proteins function.137 With this in mind, the covalent linkage of the inhibitor to its antidote, which corresponds to the regulatory domain and inhibitory domain in our design, is highly beneficial in maximizing the hybrid ization efficiency between an aptamer and its complementary sequence. Therefore, we tested whether the inhibitory nature of our probes could be controlled in real-time, a cap ability that would be necessary to realize the clinical inhibitor-antidote applications. To show the dynamic transition of aptamers function from active to nonactive, the following experiment was designed. First, the 9c-8azo -cis probe was incubated with thrombin

PAGE 117

117 for five minutes under 365 nm excitation in the UV spectrometer. To initiate the clotting reaction, fibrinogen substrate was added, and the reaction was monitored by measuring the decrease in light intensity due to scattering (Figure 5-6). After 100 seconds, visible light (553 nm) using a regular laser pointer was directed onto the sample in the UV spectrometer for 30 seconds. Then, the clotting reaction was continuous ly monitored until a plateau was reached. The Figure 5-6. Dynamic alteration of thro mbins activity by switching 9c-8azo-cis to -trans samples that did not contain probes, 9c-8azo-trans and 9c-8azo-cis without light treatment, were used as references. As shown in Figure 5-6, the blank sample showed fast reaction kinetics. The sample containing cis-form probes showed greatly inhibite d reaction kinetics and took much longer time to reach plateau compared to the sample containing trans-form probes. Especially, during the first 100 seconds, the reac tion rate is very slow. Thus, this time point was chosen to show the dramatic alteration of a reaction rate. As shown, the 30-second treatment with visible

PAGE 118

118 light after 100sec, makes the clotting reaction ac celerated considerably. The reaction after light treatment had the same slope as the trans probe; thus we can see that the cis-state and thrombin inhibition can be efficiently contro lled in real time. This experi ment clearly demonstrated that such a molecular probe can quickly response to th e light so that deactivated coagulation process can be restored in a short amount of time. Spatially Controllable Activation of Coagula tion Reaction in Microfluidic Channel The regulation of reactions using photons in the UV/Vis region, instead of other mechanisms such as heat, is advantageous because light of these wavelengths allows high spatial resolution, measuring the ability to activate a mo lecules function in a spatially confined area. This can be therapeutically beneficial as si de effects and unnecessary drug activation in undesired areas can be eliminated. For example, the activity of a specific enzyme that causes cell death could be up-regulated wi thin a tumor, but not changed within healthy tissue. In the case of thrombin, when the -cis/probes are introduced into the body, local visible light treatment can activate the clotting reacti on, resulting in selective clot ting of blood vessels, while nontargeted sites (no visible light) are not prone to the clot formation. In general, the spatial resolution of this method is limited to the resoluti on of the wavelength of light and optics used to deliver the visible light. For example, near fi eld optics allow spatial re solution by photons in the nanometer range.138 This means that sub-micron spatial resolution should be achievable, a limit that confocal microscopes can easily achieve. To investigate if our probes were capable of sp atially controlled clotti ng, we made use of a microfluidic system to model two-dimensional clot formation. First, we demonstrated that the clotting reaction could be visualized w ith fluorescent fibrinogen (Figure 5-7a).139 Fluorescent fibrinogen and the 10c-9azo-cis probe were mixed with the standard aPTT136 assay solutions and injected into a microfluidic cha nnel. After the serine protease hydrolyzed soluble fibrinogen, the

PAGE 119

119 insoluble strands of fibrin could be visualized as a fluorescent protein ne twork, Figure 5-7a. The time required to form this network is an indi cation of the clotting reaction. Figure 5 depicts fluorescent time-lapse images of clotting assays which clearly show the difference in clotting times from solutions with no probe, 10c-9azo-trans, and 10c-9azo-cis probes. Figure 5-7b shows the results using a blank sample without probe s. In the beginning, there was homogeneous fluorescence because fibrinogen is a highly water soluble protein. Thir ty seconds after the reaction was initiated, the fluorescence signal be came heterogeneous as a result of fibrin aggregation. This result is consistent with th e data obtained using UV absorption measurement. Figure 5-7c shows the same time-lapse using the 10c-9azo-trans sample. The clotting reaction was started at around 105 seconds. Figure 5-7d shows the results for the 10c-9azo-cis sample. As shown, the heterogeneous fluorescence took plac e around 135 seconds. Interestingly, we noted that there was an observable asymmetry in the time-lapse corres ponding to the 9c-8azo-cis probes. Figure 5-8 shows the real-time fluorescen ce signal change of the left (a blue box in Figure 5-7d) and right ( a red box in Figure 5-7d) sides of the images, with a longer aPTT on the right side of about 40 sec more th an the left side. We speculated th at this difference arose from a problem intrinsic to the device and measurement method. Specifically, the residual fluid flow allows a small volume of solution to pass from left to right during the time-lapse recording. Thus, once cis-probes enter the field of view from the left flow, they undergo conformation switch from opened to closed hairpin structur e during the time-lapse, causing an asymmetric clotting pattern. After observing the asymmetry noted above, we designed experiments to test whether we could initiate clotting in multiple regions of the channel in a temporally and spatially resolved manner. To accomplish this, the first region of the channel was imaged until fibrin fibers were

PAGE 120

120 Figure 5-7. Imaging clotting re action in a microfluidic device. The cartoon describes the experiment (a), the obtained image using no, 10c-9azo-trans, 10c-9azo-cis-containing human plasma sample (b), (c ), and (d), respectively. 135sec

PAGE 121

121 Figure 5-8. Fluorescence intensity altera tion of different zones in real-time observed. The stage was then moved manually to a different region of the channel in order to image a second zone that had not been illuminate d by visible light during the time-lapse of the first region. In the first region, the clot formed within 117 seconds, and the second region did not show signs of clotting (Figure 5-9b). Af ter observing the second region for over 30 seconds, a clot finally formed at 153 seconds. These expe riments were repeated several times, and other experiments that used the confocal microscope so ftware to illuminate a small region of the field of view before time-lapse also showed spat ial resolution of clot formation. With this investigation, we were able to regulate the cl otting reaction in a site-s pecific manner with submillimeter resolution using visible light.

PAGE 122

122 Figure 5-9. Site-specific activation of thrombins activity using a laser pointer in a microfluidic device. The cartoon to describe the experi ment (a) and the obtained image (b). Conclusions We have engineered photo-switchable nucle ic acid probes modified with azobenzene using photon-controllable energy. Taking advantage of the principles of photoisomerization, we optimized our aptamer probes to inhibit and restore clotting reaction re versibly, depending on photon energy, by a self-regulating property. In fact, the conversion of cis to trans was so noticeably rapid that the activity of thrombin coul d be instantly restored by visible light. This quick restoration of activity allowed us to demonstrate that the clotting reaction within a microfluidic channel could be temporally and spatially regulated by photons in a site-specific manner. We anticipate that such high resolutio ns potentially allow fabricating small scale architectures. Furthermore, in terms of ther apeutic point of view, manipulating the clotting reaction with light can provide a sophisticated ti ssue-specific clotting activation and inhibition. In detail, when cis-probes/thrombin complexes are introdu ced to body, the local visible light

PAGE 123

123 treatment can activate the clotti ng reaction, resulting in selectively blocking the blood vessels while non-targeting sites (no visible light) are not prone to the clot fo rmation. If this technique is applied to tumor site, we can virtually disconnect the delivery of nutrition to the tumor site. As a new class of cancer treatment, regulating angi ogenesis has been highlighted to minimize the nutrition delivery to tumor site The possible problems, for exam ple, ultraviolet light is not biocomparable, and low conversion efficiency can be easily solved with modification of azobenzene to tune the absorption spectrum and extinction coefficient140-142. Thus, we believe that this novel strategy can be a useful tool for developing multifunctional drugs.

PAGE 124

124 CHAPTER 6 UNIMOLECULAR CATALYTIC-DNA SENSOR FOR ULTRAS ENSITIVE DETECTION Introduction Nucleic acid sensor is a new class of detection tools with unique features.143-145 First, targets of the nucleic acids can be anything ranging from ions to small organic and inorganic molecules, nucleic acids, peptides, proteins and even whole living cells selected by in vitro selection process.32-34,112 Second, the selected sequences ar e generally very specific with the excellent binding affinity to targets. Finally, th e capability of easy chemical modifications to nucleic acids via highly advanced phosphoramidite chemistry allows them to be coupled to various signal transduction mechanisms, for example, fluorescence, anisotropy, lifetime measurement, fluorescence resonance energy transfer, surface plasmon resonance, and radiolabeling, to de velop better sensors.8,135,146-148 Thus, there are many reports that demonstrate the great potentials of nucleic acid sensors over others, includi ng peptide, protein, and small organic molecules. Among them, catalytic DNAs called DNAzymes especially possess interesting properties.149 A DNAzyme is defined as a deoxyribonucleic acid sequence as described in Chapter 1 and like protein enzymes, it catalyzes chemical reac tions, for example, cleavage of ribonucleic acid targets. DNAzyme is composed of two functiona l domains: the catalytic loop, which recognizes specific ions used as coenzymes, and the bind ing arm that targets its complementary sequence (the substrate). When the DNAzyme is hybridized w ith its target and desired cation binds to the catalytic loop, it is active now to accelerate the hydrolysis of the target sequences. Due to the low affinity of the cleaved substrat e, the DNAzyme can bind to another substrate so that it can be recycled for hydrolysis of multiple substrates This unique enzyme-like feature has been highlighted by researchers, who try to develop DNAzymes as a new class of therapeutic agents

PAGE 125

125 for selective down-regulation of target mRNAs translation.45,150,151 Another interesting application is the developm ent of 8-17 DNAzyme-based sensors for metal detection.152-156 Design of fluorescent metal sensors has recently become one of the most active research areas because the sensors can provide in situ and real-time information for a number of applications including environment monitori ng, industrial proce ss control, metalloneurochemistry, and biomedical diagnostics. DNAzymes have been show n to catalyze many of the same reactions as RNA or protein enzymes.157 In addition, DNAzymes are relative ly less expensive to produce and more stable to hydrolysis th an RNA and protein enzymes.158,159 Unlike proteins, most DNAzymes can be denatured and renatured many times without losing binding ability or activity. Among those metal ion sensors, the development of a lead ion sensor using 8-17 DNAzyme is an attractive area. Lead is a comm on environmental contaminant, and low-level lead exposure can lead to a num ber of adverse health effects.160-162 When exposed to lead, infants and children may have delayed physical or mental development; children can show deficits in attention span and learning abil ities; adults may have kidney problems and high blood pressure. Announced by the EPA, the lead level in the blood is considered toxic when it is 480 nM, and the drinking water lead action level is 72nM.163 This avenue of research demonstrated that Pb2+ specific 8-17 DNAzyme can be coupled to many di fferent signaling mechanisms to improve the sensitivity, and the outcomes seem reasonably acceptable to function as metal sensor. The working principle is that th e hybridization of the DNAzyme a nd target DNA strand equilibrated in buffer brings Q and F close together, and the fluorescence intensity is low. Pb2+ binds to the catalytic loop activates the hydrolys is reaction, and then the cleaved product is rele ased, resulting in restoration of fluorescence. The sensor s hown in Fig 6-1(a) has high selectivity for Pb2+, but

PAGE 126

126 the detect limits are poor due to th e low affinity of 8-17 for target.164 It is obvious that developing a sensitive sensor without complicat ed modifications to 8-17 DNAzyme is somewhat difficult concept to be realized.149,152 We analyze the problem of such a less attractive feature of 8-17 DNAzyme as a Pb2+ sensor in terms of the intrinsic property. As shown, the poor hybridization efficiency leads to incomplete quenching and a high background signal because of the low affinity arising from the loop struct ure, which causes a bubble in the middle of the DNAzyme chain. Thus, the simple quenching mechanism was not good enough to detect the low concentrations of Pb2+ although the selectivity is superior. To address this problem, we proposed to covalently link the DNAzyme and substrate strand to make a use of a strong unimolecula r interaction (Figure 6-1). Compared to intermolecular hybridization, intramolecular interaction of nucl eic acids tends to be much stronger. This allows the hybridization of shor t base-paired sequences that cannot form strong duplexes at room temperature via bimolecular in teraction. The new type of probe has four functional domains: catalytic DNAzyme sequence, linker that ties ca talytic and substrate sequences, substrate sequence that is hybridized with binding arms of the DNAzyme sequence, and signaling domain composed of fluor ophore and quencher. When there is no Pb2+, the probe forms stable hairpin structure such that the fluore scence is quenched. U pon the presence of Pb2+ ion, the substrate sequence is cleaved, and the pi ece containing fluorophore is released due to the lack of sufficient binding affin ity that is required to mainta in the duplex. The strong quenching and high hydrolysis efficiency allows the better sensitivity to detect Pb2+. This probe design utilizes intramolecular hybridizat ion/dehybridization, and doesnt ch ange the catalytic core of the DNAzyme, which maintains the ribonucleotide cleavage efficiency and simplifies probe optimization. Theoretically, the intramolecula r design can be used for any two-pieces

PAGE 127

127 DNAzyme/substrate probe design. To accomplish th e goal, we have optimized the probe design in terms of the length of substr ate and linker, investigated and characterized performances as Pb2+ sensor, and finally challenged the limit of detection to single Pb2+ ion. Figure 6-1. The hairpin st ructure DNAzyme-based Pb2+ sensor and the working principle. Upper left to right: the enzyme strand 8-17 DNAzym e labeled with a quencher and substrate labeled with a fluorophore hybridized together in Tris-Acetate buffer. Addition of Pb2+ activates the cleavage reaction, resul ting in releasing 10-mer ssDNAs labeled with a fluorophore. Lower left to right: The original substrate and enzyme were linked together as a hairpin structure by a poly-T linker. Th e hairpin structure tends to maximize the hybridization efficiency. Experimental Section Chemicals and Reagents All DNA synthesis reagents, in cluding 6-fam phosphoramidite, 5 -dabcyl phosphoramidite, and 2-O-triisopropylsilyloxymethyl-preotected RNA monomers, were pu rchased from Glen Research. All reagents for buffer preparation and HPLC purification were from Fisher Scientific. The buffer used for the experiments contains 50 mM Tris-Acetate at pH 7.2, 100 mM NaCl. The lead acetate was purchased from Fisher Scientific. (a) (b)

PAGE 128

128 Synthesis and Purification of Fluo rescently Labeled Oligonucleotides To optimize the design of the hairpin probe, multiple candidates were designed and prepared as shown in Table 6-1. All were synthe sized and post-treated as described in Chapter 2 using an ABI 3400 DNA/RNA synthesi zer (Applied Biosystems) at 1mol scale with the standard phosphoramidite chemistry. To deprotec t a RNA base, the precipitates were dissolved in 0.5 ml tetrabutylammonium fluoride solution, with shaking for 6 hours at 35C after the complete cleavage and deprotection and ethanol precipitation. Then the desalting was performed with the 0.1 M triethylammonium acetate (TEAA, pH 7.0) as elution buffer. The HPLC was performed on a ProStar HPLC Station (Varian Medical Systems) equipped with a fluorescence detector and a photodiode arra y detector. A C18 reverse-phase column (Alltech, C18, 5 m, 250 4.6 mm) was used. Table 6-1. Names and sequences of DNA Name Sequences D10 5-/Dabcyl/-TATCTCTT CTCCGAGCCGGTCGAAATAGTGAG(T)10ACTCACTAT rA GGAAGAGATA-/FAM/-3 D7 5-/Dabcyl/-ATCTTCCGAGCCGGTCGAAATAGTGAG-(T)10ACTCACTATrA GGAAGAT-/FAM/-3 D5 5-/Dabcyl/-ATTCCCCGAGCCGGTCGAAATAGTGAG-(T)10ACTCACTATrA GGAAT-/FAM/-3 Determination of Melting Temperature Using a BioRad RTPCR thermal cycler, ther mal denaturizing profiles of each probe were measured to study their thermostabilities. D10, D7 and D5 sequences were dissolved to the final concentration 50 nM each in 50 mM Tris-acetate buffer, pH 7.2, with 50 mM NaCl. The mixture was annealed by heating to 90 C for 5 min and subsequently cooled to 4 C in the 1 oC intervals after each change equilibrated at the new temp erature for at least 1 min. Upon melting, the substrate strand was dissociated from the enzy me strand as the temperature was decreased,

PAGE 129

129 resulting in an increased fluorescence signal. The fluorescence intensity of each probe was measured and plotted against the temperature to generate the melting temperature curve. Hybridization Assay D10 sequence was annealed to final con centration 200nM using the same procedure performed in the melting temperature determination. The annealed sample was then taken to room temperature for subsequent assays. A 90-L aliquot of the 100 nM hybridized DNAzyme/substrate solution was loaded in each well of a 96-well plate. A 10-L aliquot of concentrated metal ions stock solution was then added to th e DNA solution to initiate the cleavage reaction. The fluorescence intensity was recorded for 100 l buffer containing 50 mM TrisAcetate (pH7.2), 100 mM NaCl, the 200nM DNAzyme/substrat e solution without lead, and the 100 nM DNAzyme/substrate solu tion with 100X concentrated lead contamination. The excitation and emission wavelengths were se t to 473 nm and 520 nm, respectively. Signal enhancement was calculated us ing the following equation; )F (F )F (Fbuffer II withoutead buffer IIleadwith )( )(t enahncemen Signal (6-1) In which F with lead (II): fluorescence signal containi ng both a probe and Pb2+ F without lead(II): fluorescence intensity with a probe only Fbuffer: fluorescence intensity of buffer The substrate fluorescence detection was performe d with a Tecan Safire microplate reader with 96 well plates. The excitation laser wa velength was set at 473 nm, and the emission wavelength was set at 520 nm, respectively, to monitor the fluorescence of FAM. Data quantification was performed using XFluor software. For each experiment 90 L of the D10 solution was placed in the well and the fluorescen ce of the sample was measured immediately as

PAGE 130

130 Fannealed. Then 10uL concentrated Pb2+ was added, followed by 10 minutes incubation at room temperature. The fluorescence was measured, and th en the solution in the well was collected and heating up to 90oC for 5 minutes. The fluorescence will be measured again as Fcleaved. The RNase free water was used as the internal standard to minimize the differences between each scan. Other metal salts used included the following: MgCl2, CaCl2, SrCl2, BaCl2, Mn(OAc)2, Fe(NH4)2(SO4)2, CoCl2, NiCl2, CuCl2, ZnCl2, Cd(ClO4)2, and Hg(ClO4)2. Single Molecular Reaction We used the Nuclepore polycarbonate membrane s (Fisher Scientific) to form reactors of femtoliter volumes, which are used in filtration. We used membranes with pore diameters of 5um. These pore sizes are uniform, and the material is confirmed in bulk studies to be chemically inactive in the enzymatic reacti on in this work. The thickness is ~6 um, producing volumes between 110 and 200 fL for each vial. Liquid fil ling of nanoscopic volumes has been a difficult technological problem in many fields, including biological st udies where micromanipulators coupled with microinjection have been employed. Since we are studying more than 100 vials simultaneously, it is impossible to fill the vial s one by one. The techniques applied here combine ultrasonic vibration with vacuum degassing.165 We used rhodamine 6G dye solution to test this procedure. From the fluorescence image, we conclude that this procedure ensured that this surface was filled with the desired solution. Th e membrane was placed onto a glass slide, and then a small drop of the D10/Pb2+ solution was added onto the top of the membrane. A very thin quartz coverslip (0.08 mm) was put on the top to cover the liquid-filled vials. The polycarbonate was sandwiched between two quartz plates to create the vials. A tight seal is expected to form between the glass slides and the quartz coverslip. The quartz cove rslip prevented any evaporation from these small vials and mixing among the vials during the monito ring of the enzyme reactions.

PAGE 131

131 Gel-Based Activity Assay 2 M D10 solution was annealed in 50 mM Tr is-acetate buffer, c ontaining 100 mM NaCl (pH 7.2). After taking a 5l aliquot out as a zero time point, Pb2+ was added to a final concentration of 200 nM to the remaining solution, and aliquots were taken out at 10 minute intervals. The D10 only sample was also loaded on the gel to measure the e ffect in the absence of Pb2+. The cleaved and uncleaved substrates were separated using 20% PAGE, and the gel was analyzed by a fluorescence imager (FLA-3000G; Fuji, Tokyo, Japan) using an excitation wavelength of 473 nm. Gels containing 20% polyacrylamide were run on a FB-VE10-1 electrophoresis unit (Fishe rBiotech) at room temperature (200 V, constant voltage). The running buffer was TAE/Mg2+ buffer. Results and Discussion Lead-dependent, site-specific cleavage of RNA has been the focus of many research endeavors.166,167 The results may lead to a better understanding of lead toxicity in environmental and biological systems and provide a model system for studying the role of metal ions in DNA/RNAzymes.168 The demonstration of a lead-depende nt DNAzyme as a highly sensitive and selective lead sensor may stimulate further study in this field, as insight ga ined from the structure and mechanism of the DNAzyme may allo w better design of metal biosensors. For this purpose, we analyzed 8-17 DNAzyme profile and designed the hairpin structural D10 Pb2+ probe. This 8-17 DNAzyme preformed the catalytic cleavage r eaction by two-step mechanism.48 Product analysis by MALDI-MS demonstrated that Pb2+ catalyzes the cleavage reaction of the 8-17 DNAzyme by the formation of a product containing a 2',3'-cyclic phosphate. Then, Pb2+ catalyzes a second step of further hydrolysis of the 2',3'-cyclic phosphate. To increase the cleavage reaction efficiency, the hairpin struct ure lead sensor probe was designed, in which

PAGE 132

132 the substrate is held close to DNAzyme, ensuri ng high hybridization effici ency. In addition, the lead binding pocket is pre-organized, thus increasing the apparent cleavage efficiency. Optimization of the Hairpin Structure Sensor Design In order to maximize the performance of the probes, the effects of several design parameters were studied; the le ngth of linker between the cataly tic and substrate domain and the substrate fragment design. The latt er consideration is particularly critical because the substrate fragment must be not only long enough to form a stable duplex with catalytic domain but also short enough to be dissociated well after the hyd rolysis reaction. Thus, we investigated the leaving substrate design by varying the substrate sequence (Table 6-1). The background fluorescence and melting temperatures of the hairpi n structures were compared to evaluate the hybridization efficiencies, and the gel electr ophoresis was used to compare the hydrolysis efficiencies (Table 6-2, Figure 6-2, and Figure 6-3, re spectively)). We designed probes containing 5, 7, and 10 base-paired l eaving sequence called D5, D7 and D10 (Table 6-1). Probes containing longer substrates were not considered, because the dissociation may not be favorable for more than 10 base pairs. As shown in Figure 6-2, the fluorescence background of probes without lead ion was significan tly reduced by increasing the number of base pairings. Probe s can have quenched fluorescence signal only when they form stable hairpin structures, which means that the probes are in the active state to catalyze the hydrolysis reaction in the presence of Pb2+. Thus, D10 with the lowest fluorescence background and the highest signal enhancement achieved the maximum efficiency in the catalytic reaction, giving approximately 16-fold signal enhancement when the lead ion was added. This improvement is outstanding, considering that the previous work reported that the single quencher design showed only 4-fold enhancement,46 and the dual quencher probe slightly improved the enhancement to 6-fold.164

PAGE 133

133 The reduced background is easily explained by the enhanced duplex stability indicated by thermal denaturing profiles which correlated well with quenching efficiency because the quencher/fluorophore pairs must be in close prox imity. As shown in Table 6-2, the melting Figure 6-2. Fluorescence signal in th e absence and presence of 10uM Pb2+ after 10 min Table 6-2. Comparison of melting temperature and fluorescence enhancement among different design sequences Hairpin sequence Tm (C) S/B ratio D5 45 4 D7 48 7 D10 54 16 temperature of D5 was only 45 C, and that of D10 increased to 54C. This enhanced duplex stability is quite phenomenal because the Tm of unlinked DNAzyme and its substrate is 34C which is only slightly above room temperature.

PAGE 134

134 This enhanced duplex stability also resulted in the better performa nce in the hydrolysis reaction. According to the result obtained from naturing PAGE-gel electrophoresis, only D10 showed the efficient cleavage reaction (Figure 63). Each set of the samples was composed of probe only, probe with lead i on, and probe with target DNA. The D5 probe only showed a smeared band unlike D10 and D7. This was caused by the incomplete hybridization of substrate with the catalytic domain, which resulted in the heterogeneous distri bution of nucleic acid conformations. Likewise, the hydrol ysis yield was not favorable, wh ich contains mostly intact targets. Similarly, noticeable cleavage was not observed for D7 (lane 4 and 5) even though D7 sample did not show a smeared band. In contrast, D10 in the absence of Pb2+ (lane 7) showed a clear single band. U pon the addition of Pb2+ (2 M), the fluorescence of an intact probe band decreased while a clear increas e of cleaved piece carrying fl uorophore was observed. This experiment shows that the increased fluores cence was indeed due to DNAzyme-catalyzed cleavage with Pb2+ as a cofactor. Figure 6-3. PAGE-gel image of probes in the absence and presence of 10uM Pb2+ after 10 min. Lanes 1, 4,7: DNAzyme alone; lanes 2, 5, 8: time 10 min after adding Pb2+, to the DNAzyme. The upper and lower bands ar e uncleaved and cleaved product, respectively. Lanes 3, 6, 9: 10 min after adding cDNA. Excellent Sensitivity To obtain the full profile of D10 perform ance, we determined the dose response, calibration curve including the limit of detection, and reaction kinetics (Figure 6-4 and 6-5,

PAGE 135

135 Figure 6-4. Fluorescence increase over background at varying Pb2+ concentrations. The DNAzyme sensor concentration was 200 nM. (Inset) Sensor response to low concentrations of Pb2+. Figure 6-5. Kinetics of fluoresce nce increase for D10 in 5uM Pb2+. The background-corrected intensity in each sample has been normalized.

PAGE 136

136 respectively). Figure 6-4 shows the full profil e of fluorescence signal enhancement verse Pb2+ concentration and the linear response in the presence of low concentration of Pb2+. According to the full profile, D10 can have up to 20 times si gnal enhancement. This large signal enhancement allows us to detect lead ion in large dynamic range in nanomolar concentration with surprisingly low detection limits, approximately 3nM (3 /slope), which is about 167 times lower than the previously reported result. When we consider that U.S. Enviro nmental Protection Agency (EPA) defined higher than 15 ppb Pb2+ level in drinking water consider ed to be toxic, D10 can function well to monitor environmental samples, since the minimum toxicity level to be toxic is well within the sensor dynamic range. In addition to the excellent sensit ivity of D10, the kinetics of D10 is also rapid. As shown in Figure 6-5, the signal reached a plateau after about 15 min. the time required for bimolecular sensors is more than 30 minute (data not shown). The superior performance of D10 is attributable to severa l factors associated with the intramolecular interaction-based sensing strategy. First, the DNAzyme itself binds Pb2+ very strongly and rapidly since most of D10 is in the active st ate. Second, the sensor design has very low background fluorescence or background variati on, which allows higher signal-to-background ratio. Finally, and probably most unique, the signal can be amplified thro ugh fast turnovers of Pb2+ to cleave multiple fluorescent target strands. This increases the sensitivity while still maintaining a very rapid response. Superior Selectivity Probably, one of the most unique features of DNAzyme-based metal sensors is the absolute selectivity. This excellent selectivity of artificial nucleic acid sequences to their targets originates from the unique secondary configurati ons, which can discriminate against non-targets. Likewise, 8-17 DNAzyme also shows excellent selectivity for Pb2+ compared to all other divalent ions. To demonstrate the excellent se lectivity of D10, the fluorescence signal changes

PAGE 137

137 upon 9 competing divalent metals at concentrations of 10 M, 5 M, and 1 M were obtained (Figure 6-5). As expected, they induced little to no fluorescence change. Slight decreases of Figure 6-6. Selectivity of D10 Pb2+ sensor. Sensor responses to pot ential competing metal ions at four concentrations (10 M, 5 M, 2 M and 0.5 M) with 10 min reaction time. fluorescence from some ions were observed probably due to metals-induced quenching to fluorophores. This result indicate s that the selectivity of 8-17 DNAzyme was not affected by construction of D10 probe. Single Ion Reaction According to the preliminary investigation, D 10 is a highly sensitive and selective probe for Pb2+. To further challenge the limit of D10s de tection capability, we thus designed a singlePb2+ detection using a micro-well reactor. Each well contains a membrane well with 5 m diameter and approximate volume of ~120 femto liter. When a well contains a single ion, the concentration is about 14 pM, which is well belo w the limit of detection of D10. We employed a

PAGE 138

138 Pb2+ concentration corresponding to st atistically filling of only 25% of the wells to minimize the chance of having more than 2 ions in a single well. The fluorescence signal was recorded using D10 only (200nM) and D10 with Pb2+, and the obtained results is summarized in Figure 6-7. The single-molecule reaction was monitored every 10s for 1400s. Since each image contained about 30 to 60 wells in most of the experiments, fluorescence signal of each vial was analyzed, and a reaction rate curve was constructed. When the membrane vials were filled with only the D10 solution, we did not observe any signifi cant fluorescence intensity change during the monitoring. This means that the D10 can form a stable hairpin structure without significant surface interaction. After the fluorescence signal had somewhat stabilized, we added the desired amount of Pb2+ and the fluorescence monitoring was contin ued. In contrast to the blank sample containing only D10, we could observe three typical patterns of fluorescen ce increase: negligible, slight, and large fluorescence change (blue, red, and green, respectivel y in Figure 6-7 (a)). Interestingly the greatest fl uorescence enhancement was achieved for the lowest number of membrane pores while most of the fluorescent pores showed limited fluorescence enhancement (Figure 6-7 (b)). Thus, we speculated that th e difference in rate of signal production was originated from the different number of Pb2+ ions in the wells. The negligible increase of fluorescence came from fluctuations of D10 itself probably due to surface interacti ons or local heating by the laser rather than interaction with Pb2+. The slight increase of fluorescence with time was from wells containing a single Pb2+. Likewise, the wells show ing the fastest increasing rate contained several Pb2+s. Despite of the low concentration of Pb2+ ion, D10 was able to bind the single target at a concentration of 14pM and generate a detectible fluorescence signal under the microscope. In addition, the fluorescence sign al reached to a plateau in a relatively short amount of time (less than 15min). Thus, we concl ude that the optimized probe was able to detect

PAGE 139

139 as low as a single Pb2+ within 15 minutes. Figure 6-7. Single ion re action kinetics inside polycabornate membrane vials. Individual Pb2+ ions were trapped inside membrane holes with the D10 solution. The fluorescence enhancement was monitored over time. Th e background-corrected intensity in each well has been normalized to the signal prior to adding to Pb2+. (a) (b)

PAGE 140

140 Conclusions To conclude, we have employed a Pb2+-specific DNAzyme to design a highly sensitive and selective Pb2+ sensor. With a detection limit (3 nM) approaching those of the most sensitive instruments, and with higher sel ectivity over other metal ions (bet ter than instruments such as ICP-AES), the sensor can be a simple portable al ternative to instrumental methods. This results show that the DNAzyme sensing platform has an enormous potential for detection and quantification of many metal ions. With wide availability of portable fluorometers, such a highly sensitive and selective Pb2+ sensor will find widespread application in on-site and real-time environmental monitoring.

PAGE 141

141 CHAPTER 7 SUMMARY AND FUTURE DIRECTIONS Molecular Engineering of Multifunctional Nu cleic Acid Probes for Bioanalytical and Biomedical Applications Last decades, many different types of nucleic acid probes and architectures have been proposed and developed in recent years. Among them, DNA probes have served as a novel class of recognition elements to detect a wide variety of targets; for example, ions, small molecules, nucleic acids, proteins, and even living cells. These developments have been accelerated by advanced technologies for modifying DNA-based probes with different signaling mechanisms. The overall direction of this doctoral research has been de dicated to engineering such biomolecular components with the goal of building novel molecular tools and devices for biological science, biomedical research and ther apeutic applications. This work has encompassed three main avenues of research: development of molecular probes for improved detection, engineering nucleic acid binders to enhance inhibitory functions, and incorporation of light sensitive molecules into DNA sequences to deve lop molecular tools for light regulation. The first phase of this research was development of multifunctional molecular tools for bioanalytical applications. In cell biology, altera tion of nucleic acid expression levels or spatial localization often reflects important cellular ev ents, and tracking such alterations in native cellular environments can be one of the most ef fective ways to advance biological science, drug discovery, and therapeutic treatment of injury an d infection. However, the complexity of living cells often challenges the measurements due to degradation of nucleic acid probes by nuclease digestion. Thus, it requires the development of r obust probes for reliable intracellular studies. To meet this goal, we designed robust molecular probes using nonstandard nucleic acids, such as locked nucleic acid, 2-O-methyl modified R NAs, and L-DNA. One of such innovations is the development of chimeric nucleic acid probes usin g locked nucleic acids (LNA) or 2-O-methyl

PAGE 142

142 modified RNAs and L-DNA. This probe design showed superior biostability and the least tendency for false-positive or false-negative reporting. Heavy metal contamination in the human body or environment is a significant problem, and there is a clear demand for ultrasensitive de tection methods to monitor such a contamination for high throughput and rapid screening. To meet the goal, we have developed a Pb2+-specific unimolecular ultrasensitive nucleic acid sensor using catalytic DNAzyme. The optimized sensor demonstrated detection limits in the nanomolar range (3nM) with superior sensitivity and excellent selectivity when used with a routine fluorospectrometer. Use of a confocal microscope and microwell array provided a clear positive report with only 14pM of Pb2+, ie, a single Pb2+ ion. Another research project involved the molecu lar assembly of functional ssDNA sequences called aptamers, selected by a method known as cell-based SELEX ("Systematic Evolution of Ligands by Exponential Enrichment"). Although th is selection strate gy produces molecular probes with high affinity for and specific binding to a given target we have discovered a process to further increase binding cap acity several-fold over conve ntional aptamers: multivalent interaction. The process involves the assembly of multiple ligands fo r multiple binding with target(s). The overall binding of the assembly becomes much stronge r than that of the individual ligand. Using this as the working principle, we assembled two aptamers targeted to thrombin to create a bivalent ligand. As an anticoagulant, the bivalent ligand showed a 30-fold increase in clotting time compared to individual aptamers In addition, the multimeric assemblies showed increased clotting times 2-fold when human plasma sample was applied. This concept was generalized using PDGF and its ap tamer. We believe that this concept can be effectively applied to the design of nucleic acid probe-bas ed drugs for pharmaceutical applications.

PAGE 143

143 The third phase of this research was the de velopment of a photo-regulating nucleic acid inhibitor. Photochromic compounds can be succe ssfully incorporated into the DNA chains to alter the hybridization of DNA duplexes. Thus, we utilized these compounds to design nucleic acid inhibitors regulated by UV and visible photons. We used th rombin and its aptamer to engineer such a probe and tested the photo-conve rting inhibitory functions. The results showed that inhibition of thrombins pr otease activity can be effectively switched on and off depending on the photon excitation energy. In addition, the e xperiment using a microfluidic device revealed that such photocontrolling enzyma tic reactions can be spatially re gulated. We expect that this strategy can be highly useful in mani pulating biological reactions by light. In summary, this research has focused on the design, synthesis and investigation of multifunctional and advanced nucleic acid probes for the biological sciences, biomedical research, and therapeutic and clinical applicatio ns. The successful outcome to these studies will lead to a better understanding of biological processes and th e development of advanced molecules for nucleic acid-based detections and medicines. Future Directions Developing High Throughput Metal-Screening Chip To screen multiple heavy metal contamination, it is also possible to develop unimolecular sensors for other targets. So far, there ar e many DNAzymes already known, including those targeting Cu2+, UO2+, Cu2+ and Zn2+, and there is no doubt that more DNAzymes will be selected, since the selection of target-specific DNAzyme is a very active research area. Thus, we can use the same manner of ultrasensitive Pb2+ sensor to develop sensitive sensors targeting different ions. As a high throughput screening method, the Pb2+ (or other metals) sensor can be immobilized on the surface of a microarray chip via the strept avidine/biotin method. After

PAGE 144

144 coating the surface with spreptavidine, biotinylat ed sensor probes can be incubated and captured. After careful washing, the chip will be ready fo r detection. Since the sensor molecules contain fluorophore and quencher, but no target, each spot will produce a fluorescence signal. When the sample is applied to each spot, depending on the concentration of the targ et, the spots will show different fluorescence signals. Thus, multiple sample s can be tested at once in a short amount of time. In addition, we expect that the array may be able to show concentration dependent response due to the probes high signal enhancement ratio. Figure 7-1. Surface-immobilized Pb2+ chip. (a) microarray and anticipated results. (b) shows the cartoon to describe working princi ple of the metal sensor chip. There will be major advantages to the proposed design. First, detection without sample washing can save time and effort. Second, multip le samples and ions can be screened using a small device. Finally, the chips can be used for quantitative analysis. Ther efore, this approach will be an interesting future project to make general us e of DNAzyme-based sensors. (a)

PAGE 145

145 Pharmaceutical Application of Multifunctional Drugs According to our in vitro investigation, ss DNA assemblies show dramatic improvements in the inhibition of enzymatic functions. Thus, in vivo investigation of su ch pharmaceutical potency can be another promising area. First, the anticoagulant potency of each assemb ly of thrombin aptamers can be investigated using a mouse model. Coagulation is highly cons erved biological process from one species to another species. Thus, these aptamers should also be able to bind to mouse thrombin protein. Dose response, cytotoxicity and other pharmaceutical parameters can be investigated using mouse model experiments. Second, the ability of the antithrombin approach to cure cancer by c ontrolling angiogenesis will be demonstrated. According to recent reports, thrombin functions as an important factor to regulate the tumor growth. Thus, we speculate that antithrombin can be a general approach to regulate the growth of tumors. To do so, we need to adopt the tumor m odel and investigate the tumor growth. As a selective delivery method, we can attach cancer-specific aptamers to the assemblies or nanoparticles. Then, we may be able to improve the efficiency of regulating tumor growth. Third, it will demonstrate that the photo-controllable inhibitors can selectively regulate coagulation reactions in living system. There will be two types of samples: one is injected with UVtreated probes; and another mouse is injected with Vis-treated probes. When both mice are bleeding, we expect that the one injected with UVtreated probes will bleed for a longer time than the one injected with Vis-treated probes, du e to the better anticoagulation potency of UVtreated probes. In addition, we can also demonstrate that the mouse injected with UVtreated probes can show different clotting ti mes with post-light treatments.

PAGE 146

146 Figure 7-2. Mouse model to show p hoto-controllable anticoagulation

PAGE 147

147 LIST OF REFERENCES 1. Watson, J. D. & Crick, F. H. C. Molecular Structure of Nucleic Acids: A structure for deoxyribose nucleic acid. Nature 171, 737-738 (1953). 2. Beaucage, S. L. & Iyer, R. P. The synthesis of modified oligonucleotides by the phosphoramidite approach and their applications. Tetrahedron 49, 6123-6194 (1993). 3. Beaucage, S. L. & Iyer, R. P. Advan ces in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron 48, 2223-2311 (1992). 4. Ingle, J. D. & Crouch, S. R. Spectrochemical analysis. (1988). 5. Lakowicz, J. R. Principles of fluorescent spectroscopy. Kluwer Academic /Plenum Publishers, New York. (1999). 6. Chakravarti, A. Single nucleotide poly morphisms to a future of genetic medicine. Nature 409, 822-823 (2001). 7. Altmuller, J., Palmer, L. J., Fischer, G., Scherb, H. & Wjst, M. Genomewide scans of complex human diseases: True linkage is hard to find. American Journal of Human Genetics 69, 936-950 (2001). 8. Tyagi, S. & Kramer, F. R. Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14, 303-308 (1996). 9. Tyagi, S., Bratu, D. P. & Kramer, F. R. Multicolor molecular beacons for allele discrimination. Nat. Biotech. 16, 49-53 (1998). 10. Perlette, J. & Tan, W. H. Real-time monitoring of intracellul ar mRNA hybridization inside single living cells. Anal. Chem. 73, 5544-5550 (2001). 11. Sokol, D. L., Zhang, X. L., Lu, P. Z. & Gewitz, A. M. Real time detection of DNA RNA hybridization in living cells. Proceedings of the National Academy of Sciences 95, 11538-11543 (1998). 12. Santangelo, P. J., Nix, B., Tsourkas, A. & Bao, G. Dual FRET molecular beacons for mRNA detection in living cells. Nucl. Acids Res. 32, (2004). 13. Bratu, D. P., Cha, B. J., Mhlanga, M. M., Kramer, F. R. & Tyagi, S. Visualizing the distribution and transport of mRNAs in living cells. Proceedings of the National Academy of Sciences 100, 13308-13313 (2003).

PAGE 148

148 14. Santangel, P. J., Nitin, N. & Bao, G. Direct visualization of mRNA colocalization with mitochondria in living cells using molecular beacons. Journal of Biomedical Optics 10, (2005). 15. Drake, T. J., Medley, C. D., Sen, A., Rogers, R. J. & Tan, W. H. Stochasticity of manganese superoxide dismutase mRNA expression in breast carcinoma cells by molecular beacon imaging. Chembiochem 6, 2041-2047 (2005). 16. Fang, X. H., Li, J. J. & Tan, W. H. Using molecular beacons to probe molecular interactions between la ctate dehydrogenase and single-stranded DNA. Anal. Chem. 72, 3280-3285 (2000). 17. Uchiyama, H., Hirano, K., KashiwasakeJibu, M. & Taira, K. Detection of undegraded oligonucleotides in vivo by fluores cence resonance energy transfer. Journal of Biological Chemistry 271, 380-384 (1996). 18. Kehlenbach, R. H. In vitro analysis of nuclear mRNA export using molecular beacons for target detection. Nucl. Acids Res. 31, e64 (2003). 19. Mhlanga, M. M., Vargas, D. Y., Fung, C. W., Kramer, F. R. & Tyagi, S. tRNA-linked molecular beacons for imaging mRNAs in the cytoplasm of living cells. Nucl. Acids Res. 33, 1902-1912 (2005). 20. Molenaar, C., Marras, S. A., Slats, J. C., Truffert, J. C., Lematre, M., Raap, A. K., Dirks, R. W. Tanke, H. J., Linear 2 O-Methyl RNA pr obes for the visualization of RNA in living cells. Nucl. Acids Res. 29, art-e89 (2001). 21. Marras, S. A. E., Gold, B., Kramer, F. R., Smith, I. & Tyagi, S. Real-time measurement of in vitro transcription. Nuc. Acids Res. 32, e72 (2004). 22. Kuhn, H., Demidov, V.V, Gildea, B. D., Fiandaca, M. J., Coull, J. C., & FrankKa menetskii, M. D. PNA beacons for duplex DNA. Antisense & Nucleic Acid Drug Development 11, 265-270 (2001). 23. Petersen, K., Vogel, U., Rockenbauer, E., Nielsen, K. V., Klvraa, S., Bolund, L., Nex, B. Short PNA m olecular beacons for real-t ime PCR allelic discrimination of single nucleotide polymorphisms. Molecular and Cellular Probes 18, 117-122 (2004). 24. Seitz, O. Solid-phase synt hesis of doubly labeled peptide nucleic acids as probes for the real-time detection of hybridization. Angewandte Chemie-International Edition 39, 3249-3252 (2000).

PAGE 149

149 25. Tsourkas, A., Behlke, M. A. & Bao, G. Hybridization of 2 '-O-methyl and 2 '-deoxy molecular beacons to RNA and DNA targets. Nucl. Acids Res. 30, 5168-5174 (2002). 26. Wang, L., Yang, C. Y. J., Medley, C. D ., Benner, S. A. & Tan, W. H. Locked nucleic acid molecular beacons. J. Am. Chem. Soc. 127, 15664-15665 (2005). 27. Xi, C. W., Balberg, M., Boppart, S. A. & Raskin, L. Use of DNA and peptide nucleic acid molecular beacons for detection and qua ntification of rRNA in solution and in whole cells. Applied and Environmental Microbiology 69, 5673-5678 (2003). 28. Yang, C. J., Wang, L., Wu, Y., Kim, Y., Medley, C. D., Lin, H. & Tan, W. Synthesis and investigation of deoxyr ibonucleic acid/locked nucleic acid chim eric molecular beacons. Nucl. Acids Res. 35, 4030-4041 (2007). 29. Orum, H. & Wengel, J. Locked nucleic acids: A promising molecular family for genefunction analysis and antisense drug development. Current Opinion in Molecular Therapeutics 3, 239-243 (2001). 30. Vissing, H. et al. High throughput multiplex genotyping using chimeric LNA (Locked Nucleic Acids)/DNA oligos immobilized polymer microchip. American Journal of Human Genetics 69, 470 (2001). 31. Vester, B. & Wengel, J. LNA (Locked nucleic acid): High-affinity targeting of complementary RNA and DNA. Biochemistry 43, 13233-13241 (2004). 32. Ellington, A. D. & Szostak, J. W. Invitro Selection of RNA Molecules That Bind Specific Ligands. Nature 346, 818-822 (1990). 33. Robertson, D. L. & Joyce, G. F. Selec tion Invitro of An RNA Enzyme that specifically cleaves single-stranded-DNA. Nature 344, 467-468 (1990). 34. Tuerk, C. & Gold, L. Systematic E volution of ligands by exponential enrichment RNA ligands to bacteriophage-T4 DNA-polymerase. Science 249, 505-510 (1990). 35. Mayor, G., Grattinger, M. & Blind, M. Aptamers: multifunctional tools for target validation and drug discovery. Drug Plus Int. 2, 6-10 (2003). 36. Mammen, M., Choi, S. K. & Whitesides, G. M. Polyvalent inte ractions in biological systems: Implications for design and use of multivalent ligan ds and inhibitors. Angewandte Chemie-International Edition 37, 2755-2794 (1998). 37. Mulder, A., Huskens, J. & Reinhoudt, D. N. Multivalency in supramolecular chemistry and nanofabrication. Organic & Biomolecular Chemistry 2, 3409-3424 (2004).

PAGE 150

150 38. Varki, A. Biological Roles of Oligos accharides All of the theories are correct. Glycobiology 3, 97-130 (1993). 39. Kohli, P. Ligand-receptor energetics. John Wiley & Sons, New York (1997). 40. Hammes, G. G. Thermodynamics and kine tics for the biological sciences. John Wiley & Sons, New York (2000) 41. Schon, A. & Freire, E. Thermodynamics of intersubunit interactio ns in cholera-toxin upon binding to the oligosaccharide portion of its cell-surface receptor, gangliosideGm1. Biochemistry 28, 5019-5024 (1989). 42. Tanaka, T., Suzuno, R., Nakamura, K., Kuwahara, A. & Takeo, K. Thermodynamic analysis of the interactions of a mouse dinitrophenyl-speci fic myeloma protein, mopc315, with immobilized dinitrophenyl and trinitrophenyl ligands by affinity electrophoresis. Electrophoresis 7, 204-209 (1986). 43. Lee, Y. C. & Lee, R. T. Carbohydratepotein interactions basis of glycobiology. Acc. Chem. Res. 28, 321-327 (1995). 44. Karush, F., Chua, M. M. & Rodwell, J. D. Interaction of a bi valent ligand with Igm anti-lactose antibody. Federation Proceedings 37, 1279 (1978). 45. Santoro, S. W. & Joyce, G. F. A general purpose RNA-cleaving DNA enzyme. Proceedings of the National Academy of Sciences 94, 4262-4266 (1997). 46. Li, J. & Lu, Y. A highl y sensitive and selec tive catalytic DNA biosen sor for lead ions. J. Am. Chem. Soc. 122, 10466-10467 (2000). 47. Breaker, R. R. & Joyce, G. F. A DNA enzyme that cleaves RNA. Chemistry & Biology 1, 223-229 (1994). 48. Brown, A. K., Li, J., Pavot, C. M. B. & Lu, Y. A lead-dependent DNAzyme with a two-step mechanism. Biochemistry 42, 7152-7161 (2003). 49. Zhou, D. M. & Taira, K. The Hydrolysis of RNA: From theoretical calculations to the hammerhead ribozyme-mediated cleavage of RNA. Chem. Rev. 98, 991-1026 (1998). 50. Kuimelis, R. G. & McLaughlin, L. W. Mechanisms of ribozyme-mediated RNA cleavage. Chem. Rev. 98, 1027-1044 (1998). 51. Berliner, L. J. Struct ure-function-relationships in hu man alpha-thrombins and gammathrombins. Molecular and Cellular Biochemistry 61, 159-172 (1984).

PAGE 151

151 52. Mann, K. G. & Lundblad, R. L. Hemostasis and thrombosis: basic principles and clinical practice. J. B. Lippi ncott Co., Philadelphia (1987). 53. Quick, A. J., Stanley-Browne, M. & Banc roft, F. W. A study of the coagulation defect in hemophilia and in jaundice. American Journal of the Medical Sciences 190, 501-511 (1935). 54. Mischke, R. Activated partial thromboplas tin time as a screening test of minor or moderate coagulation factor deficiencies for canine plasma: sensitivity of different commercial reagents. Journal of Veterinary Di agnostic Investigation 12, 433-437 (2000). 55. DiCera, E., Dang, Q. D. & Ayala, Y. M. Molecular mechanisms of thrombin function. Cellular and Molecular Life Sciences 53, 701-730 (1997). 56. Bode, W., Turk, D. & Karshikov, A. The refined 1.9-angstrom X -ray crystal-structure of D-Phe-Pro-Arg chloromethylketone-inh ibited human alpha-t hrombin structureanalysis, Protein Science 1, 426-471 (1992). 57. Lesk, A. M. & Fordham, W. D. Conservati on and variability in the structures of serine proteinases of the chymotrypsin family. Journal of Molecular Biology 258, 501-537 (1996). 58. Rydel, T. J., Ravichandran, K. G., Tulinsky, A., Bode, W., Huber, R., Roitsch, C. & Fenton, J. W. 2nd. The Stru cture of A Complex of reco m binant hirudin and human alpha-thrombin. Science 249, 277-280 (1990). 59. Mathews, I. I., Padmanabhan, K. P., Tulinsky, A. & Sadler, J. E. Structure of a nonadecapeptide of the 5th EGF domain of th rombomodulin complexed with thrombin. Biochemistry 33, 13547-13552 (1994). 60. Srinivasan, J., Hu, S., Hrabal, R., Zhu, Y., Komives, E. A. & Ni, F. Thrombin-bound structure of an Egf subdom a in from human thrombomodulin determined by tansferred nuclear overhauser effects. Biochemistry 33, 13553-13560 (1994). 61. Rydel, T. J., Tulinsky, A., Bode, W. & Huber, R. Refined structure of the hirudinthrombin complex. Journal of Molecular Biology 221, 583-601 (1991). 62. Vijayalakshmi, J., Padmanabhan, K. P., Mann, K. G. & Tulinsky, A. The isomorphous structures of pre-thrombin2, hirugenthrombin, and pack-thrombin changes accompanying activation and exosite binding to thrombin. Protein Science 3, 22542271 (1994).

PAGE 152

152 63. Lerner, D. J., Chen, M., Tram, T. & C oughlin, S. R. Agonist r ecognition by proteinaseactivated receptor 2 and thrombin recep tor Importance of extracellular loop interactions for receptor function. J. Biol. Chem. 271, 13943-13947 (1996). 64. Ishihara, H., Connolly, A. J., Zeng, D., Kahn, M. L., Zheng, Y. W., Timmons, C., Tram, T. & Coughlin, S. R. Protease-activated receptor 3 is a second thrombin receptor in humans. Nature 386, 502-506 (1997). 65. Ni, F., Ripoll, D. R., Martin, P. D. & Edwards, B. F. P. Solution structure of a platelet receptor peptide bound to bovine alpha-thrombin. Biochemistry 31, 11551-11557 (1992). 66. Mathews, I. I., Padmanabhan, K. P., Ganesh, V., Tulinsky, A., Ishiim, M., Chen, J., Turck, C. W., Coughlin, S. R. & Fenton, J. W. Crystallographic structures of thrombin complexed with thrombin receptor peptides existence of expect ed and novel binding modes. Biochemistry 33, 3266-3279 (1994). 67. Vindigni, A., White, C. E., Komives, E. A. & DiCera, E. Energetics of thrombinthrombomodulin interaction. Biochemistry 36, 6674-6681 (1997). 68. Ye, J., Esmon, C. T. & Johnson, A. E. The chondroitin sulfate moiety of thrombomodulin binds A 2nd molecule of thrombin. J. Biol. Chem. 268, 2373-2379 (1993). 69. Ye, J., Rezaie, A. R. & Esmon, C. T. Glycosaminoglycan contributions to both proteinC activation and thrombin inhibition involve a common arginine-rich site in thrombin that includes residues arginine-93, arginine-97, and arginine-101. J. Biol. Chem. 269, 17965-17970 (1994). 70. Katsonis, N., Lubomska, M., Pollard, M. M., Feringa, B. L. & Rudolf, P. Synthetic light-activated molecular sw itches and motors on surfaces. Progress in Surface Science 82, 407-434 (2007). 71. Horspool, W. M. CRC Handbook of orga nic photochemistry and photobiology. CRC press, Boca Raton (1995). 72. Stuart, C. M., Frontiera, R. R. & Mathies, R. A. Excited-state st ructure and dynamics of cisand trans-azobenzene from resonance Raman intensity analysis. Journal of Physical Chemistry A 111, 12072-12080 (2007). 73. Giesendorf, B.A., Vet, J.A., Tyagi, S., Mensink, E.J., Trijbels, F.J. & Blom, H.J. Molecu lar beacons: a new approach for semiautomated mutation analysis. Clinical Chemistry 44, 482-486 (1998).

PAGE 153

153 74. Kostrikis, L. G., Tyagi, S., Mhlanga, M. M., Ho, D. D. & Kramer, F. R. Molecular beacons Spectral genotyping of human alleles. Science 279, 1228-1229 (1998). 75. Matsuo, T. In situ visualization of messenger RNA for basic fibroblast growth factor in living cells. Biochimica et Biophysica Acta-General Subjects 1379, 178-184 (1998). 76. Leal, N. A., Sukeda, M. & Benner, S. A. Dynamic assembly of primers on nucleic acid templates. Nucl. Acids Res. 34, 4702-4710 (2006). 77. Tsourkas, A., Behlke, M. A., Rose, S. D. & Bao, G. Hybridization kinetics and thermodynamics of molecular beacons. Nucl. Acids Res. 31, 1319-1330 (2003). 78. Li, J. W. J. & Tan, W. H. A real-time assay for DNA s ticky-end pairing using molecular beacons. Analytical Biochemistry 312, 251-254 (2003). 79. Browne, K. A. Sequence-specific, self-reporting hairpin inversion probes. J. Am. Chem. Soc. 127, 1989-1994 (2005). 80. Crey-Desbiolles, C., Ahn, D. R. & Le umann, C. J. Molecular beacons with a homoDNA stem: improving target selectivity. Nucl. Acids Res. 33, e77 (2005). 81. Urata, H., Shinohara, K., Ogura, E., Ueda, Y. & Akagi, M. Mirror-image DNA. J. Am. Chem. Soc. 113, 8174-8175 (1991). 82. Ashley, G. W. Modeling, Synthesis, and hybridization properties of (L)-ribonucleic acid. J. Am. Chem. Soc. 114, 9731-9736 (1992). 83. Damha, M. J., Giannaris, P. A., Marfey, P. & Reid, L. S. Oligodeoxynucleotides containing unnatural L-2'-deoxyribose. Tetrahedron Letters 32, 2573-2576 (1991). 84. Urata, H., Ogura, E., Shinohara, K., Ueda Y. & Akagi, M. Synthesis and properties of mirror-image DNA. Nucl. Acids Res. 20, 3325-3332 (1992). 85. Garbesi, A., Capobianco, M. L., Colonna F. P., Tondelli, L., Arcamone, F., Manzini, G., Hilbers, C. W., Aelen, J. M., & Blommers, M. J. L-DNAs as potenital antimessenger oligonucleotides: a reassessment. Nucl. Acids Res. 21, 4159-4165 (1993). 86. Medley, C. D., Drake, T. J., Tomasini, J. M., Rogers, R. J. & Tan, W. Simultaneous monitoring of the expression of multiple gene s inside of single breast carcinoma cells. Anal. Chem. 77, 4713-4718 (2005). 87. Hauser, N. C., Martinez, R., Jacob, A., Rupp, S., Hoheisel, J. D. & Matysiak, S. Utilising the left-helical conformation of L-DNA for analysing different marker types on a single universal microarray platform. Nucl. Acids Res. 34, 5101-5111 (2006).

PAGE 154

154 88. Li, J. J., Geyer, R. & Tan, W. Usi ng molecular beacons as a sensitive fluorescence assay for enzymatic cleavage of single-stranded DNA. Nucl. Acids Res. 28, e52 (2000). 89. Koshkin, A. A., Rajwanshi, V. K. & Wengel, J. Novel convenient syntheses of LNA [2.2.1]bicyclo nucleosides. Tetrahedron Letters 39, 4381-4384 (1998). 90. Wengel, J. Synthesis of 3 '-Cand 4 '-C-branched oligodeoxynucleotides and the development of locked nucleic acid (LNA). Acc. Chem. Res. 32, 301-310 (1999). 91. Marras, S. A. E., Gold, B., Kramer, F. R., Smith, I. & Tyagi, S. Real-time measurement of in vitro transcription. Nucl. Acids Res. 32, e72 (2004). 92. Rao, J., Lahiri, J., Isaacs, L., Weis, R. M. & Whitesides, G. M. A trivalent system from vancomycin D-Ala-D-Ala with higher affinity than avidin/biotin. Science 280, 708-711 (1998). 93. Chen, H. W. & Privalsky, M. L. C ooperative Formation of high-order oligomers by retinoid-X receptors an unexpected mode of DNA Rrecognition. Proceedings of the National Academy of Sciences 92, 422-426 (1995). 94. Kortt, A. A., Dolezal, O., Power, B. E. & Hudson, P. J. Dimeric and trimeric antibodies: high avidity scFvs for cancer targeting. Biomolecular Engineering 18, 95108 (2001). 95. Wolf, E., Hofmeister, R., Kufer, P., Schlereth, B. & Baeuerle, P. A. BiTEs: bispecific antibody constructs with unique anti-tumor activity. Drug Discovery Today 10, 12371244 (2005). 96. Wolf, E. & Baeuerle, P. A. Mi cromet: engaging immune cells for life. Drug Discovery Today 7, S25-S27 (2002). 97. Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H. & Toole, J. J. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-566 (1992). 98. DeAnda, A., Coutre, S. E., Moon, M .R., Vial, C. M., Griffin, L. C ., Law, V. S., Komeda, M., Leung, L. L., & Miller, D. C. Pilot study of the efficacy of a thrombin inhibitor for use during cardiopulmonary bypass. Ann Thorac Surg 58, 344-350 (1994). 99. Griffin, L. C., Tidmarsh, G. F., Bock, L. C., Toole, J. J. & Leung, L. L. In vivo anticoagulant properties of a novel nucle otide-based thrombin inhibitor and demonstration of regional anticoagul ation in extracorporeal circuits. Blood 81, 32713276 (1993).

PAGE 155

155 100. Huang, J. et al. Highly specific antiangiogenic ther apy is effective in suppressing growth of experimental Wilms tumors. Journal of Pediatric Surgery 36, 357-361 (2001). 101. Ruckman, J., Green, L. S., Beeson, J., Waugh, S., Gillette, W. L., Henninger, D. D., Claesson-Welsh, L. & Janjic, N. 2'-Fluoropyrimidine RNA-based aptamers to the 165amino acid Form of vascular endot helial growth factor (VEGF165). J. Biol. Chem. 273, 20556-20567 (1998). 102. Li, J. W. J., Fang, X. H. & Tan, W. H. Molecular aptamer beacons for real-time protein recognition. Biochemical and Biophysical Research Communications 292, 31-40 (2002). 103. Nimjee, S. M., Rusconi, C. P., Harrington, R. A. & Sullenger, B. A. The potential of aptamers as anticoagulants. Trends in Cardiovascular Medicine 15, 41-45 (2005). 104. Rusconi, C. P., Scardino, E., Layzer, J ., Pitoc, G. A., Ortel, T. L., Monroe, D. & Sullenger, B. A.RNA aptamers as reversible antagonists of coagulation factor IXa. Nature 419, 90-94 (2002). 105. Di Nisio, M., Middeldorp, S. & Bu ller, H. R. Direct thrombin inhibitors. N Engl J Med 353, 1028-1040 (2005). 106. Hirsh, J. Current anticoagulan t therapy--unmet clinical needs. Thrombosis Research 109, S1-S8 (2003). 107. Tasset, D. M., Kubik, M. F. & Stei ner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of Molecular Biology 272, 688-698 (1997). 108. Berezovski, M., Nutiu, R., Li, Y. & Krylov, S. N. Affinity analysis of a protein-aptamer complex using nonequilibrium capillary elect rophoresis of equilibrium mixtures. Anal. Chem. 75, 1382-1386 (2003). 109. German, I., Buchanan, D. D. & Kennedy, R. T. Aptamers as ligands in affinity probe capillary electrophoresis. Anal. Chem. 70, 4540-4545 (1998). 110. Ikebukuro, K., Okumura, Y., Sumikura, K. & Karube, I. A novel method of screening thrombin-inhibiting DNA aptamers using an evolution-mimicking algorithm. Nucl. Acids Res. 33, e108 (2005). 111. Rickles, F. R., Patierno, S. & Fernand ez, P. M. Tissue factor, thrombin, and cancer. Chest 124, 58S-68S (2003).

PAGE 156

156 112. Nimjee, S. M., Rusconi, C. P. & Sullenger, B. A. Aptamers: An emerging class of therapeutics. Annual Review of Medicine 56, 555-583 (2005). 113. Langdell, R. D., Wagner, R. H. & Brinkhous K. M. Effect of antihemophilic factor on one-stage clotting tests A presumptive test for hemophilia and a simple one-stage Aantihemophilic factor assay procedure. Journal of Laboratory and Clinical Medicine 41, 637-647 (1953). 114. Shangguan, D., Li, Y., Tang, Z., Cao, Z. C., Chen, H. W., Mallikaratchy, P., Sefah, K., Yang, C. J. & Tan, W. Aptamers evolved fr om live cells as effective molecular probes for cancer study. Proceedings of the National Academy of Sciences 103, 11838-11843 (2006). 115. Filpula, D. Antibody engineering and modification technologies. Biomolecular Engineering 24, 201-215 (2007). 116. Bunka, D. H. J. & Stockley, P. G. Aptamers come of age at last. Nature Reviews Microbiology 4, 588-596 (2006). 117. Kim, Y., Cao, Z. & Tan, W. Molecula r assembly for high-performance bivalent nucleic acid inhibitor. Proceedings of the National Academy of Sciences 105, 5664-5669 (2008). 118. Yang, C. J., Lin, H. & Tan, W. Mol ecular assembly of superquenchers in signaling molecular interactions. J. Am. Chem. Soc. 127, 12772-12773 (2005). 119. New Research on Optical materials. 119-156. Nova Science Publishers, Inc., Hauppauge, N. Y 120. Heinz D. & Henri B.-L.. Photochromism: Molecules and systems. Elsevier Science & Technology (Netherlands) (2003). 121. Pala, R. A., Shimizu, K. T., Melosh, N. A. & Brongersma, M. L. A nonvolatile plasmonic switch employing photochromic molecules. Nano Letters 8, 1506-1510 (2008). 122. Raymo, F. M. & Tomasulo, M. Opti cal processing with photochromic switches. Chemistry-A European Journal 12, 3186-3193 (2006). 123. Ando, R., Mizuno, H. & Miyawaki, A. Regulated fast nucleocytoplasmic shuttling observed by reversible protein highlighting. Science 306, 1370-1373 (2004).

PAGE 157

157 124. Habuchi, S., Ando, R., Dedecker, P., Verheijen, W., Mizuno, H., Miyawaki, A. & Hofkens, J. Reversible single-molecule photoswitching in the GFP-like fluorescent protein Dronpa. Proceedings of the National Academy of Sciences 102, 9511-9516 (2005). 125. Yager, K. G. & Barrett, C. J. N ovel photo-switching using azobenzene functional materials. Journal of Photochemistry and Photobiology A-Chemistry 182, 250-261 (2006). 126. Mohr, G. J. A tricyanovinyl azobenzene dye used for the optical detection of amines via a chemical reaction in polymer layers. Dyes and Pigments 62, 77-81 (2004). 127. Browne, W. R. & Feringa, B. L. Making molecular machines work. Nat. Nano. 1, 2535 (2006). 128. Liang, X. G., Nishioka, H., Takenaka, N. & Asanuma, H. A DNA nanomachine powered by light irradiation. Chembiochem 9, 702-705 (2008). 129. Yamada, M., Kondo, M., Mamiya, J. I., Yu, Y. L., Kinoshita, M., Barrett, C. J. & Ikeda, T. Photomobile polymer materials: Towards light-driven plastic motors. Angewandte Chemie-International Edition 47, 4986-4988 (2008). 130. Christophe Dugave. Cis-trans isomeriz ation in biochemistry. Wiley-VCH (2006). 131. Matsunaga, D., Asanuma, H. & Komiyama M. Photoregulation of RNA digestion by RNase H with azobenzene-tethered DNA. J. Am. Chem. Soc. 126, 11452-11453 (2004). 132. Yamada, M. D., Nakajima, Y., Maeda, H. & Maruta, S. Photocontrol of kinesin ATPase activity using an azobenzene derivative. J. Biochem 142, 691-698 (2007). 133. Asanuma, H., Liang, X., Nishioka, H., Matsunaga, D., Liu, M. & Komiyama, M.Synthesis of azobenzene-tethered DNA for reversible photo-regulation of DNA functions: hybridizati on and transcription. Nature Protocols 2, 203-212 (2007). 134. Tuddenham, E. Medicine: RNA as drug and antidote. Nature 419, 23-24 (2002). 135. Fang, X. H., Sen, A., Vicens, M. & Ta n, W. H. Synthetic DNA aptamers to detect protein molecular variants in a hi gh-throughput fluorescen ce quenching assay. Chembiochem 4, 829-834 (2003). 136. Proctor, R. R. & Rapaport, S. I. Partia l thromboplastin time with k aolin A simple screening test for first stage plasma clotting factor deficiencies. American Journal of Clinical Pathology 36, 212-& (1961).

PAGE 158

158 137. Heckel, A. & Mayer, G. Light regulati on of aptamer activity: An anti-thrombin aptamer with caged thymidine nucleobases. J. Am. Chem. Soc. 127, 822-823 (2005). 138. Tan, W., Shi, Z. Y., Smith, S., Birnbaum, D. & Kopelman, R. Submicrometer intracellular chemical optical fiber sensors. Science 258, 778-781 (1992). 139. Guthold, M., Liu, W., Stephens, B., Lord, S. T., Hantgan, R. R., Erie, D. A., Taylor, R. M. & Superfine, R. Visualization and mech anical manipulations of individual fibrin fibers suggest that fiber cross se ction has fractal dimension 1.3. Biophysical Journal 87, 4226-4236 (2004). 140. Nishioka, H., Liang, X. G., Kashida, H. & Asanuma, H. 2 ',6 '-Dimethylazobenzene as an efficient and thermo-stable photo-re gulator for the photoregulation of DNA hybridization. Chemical Communications 4354-4356 (2007). 141. Zhang, F. Z., Sadovski, O. & Woolley, G. A. Synthesis and char acterization of a long, rigid photoswitchable cross-linker for prom oting peptide and protein conformational change. Chembiochem 9, 2147-2154 (2008). 142. Beharry, A. A., Sadovski, O. & Woolley, G. A. Photo-control of peptide conformation on a timescale of seconds with a conformati onally constrained, blue-absorbing, photoswitchable linker. Organic & Biomolecular Chemistry. 10.1039/b810533b (2008) 143. Jenison, R., Yang, S., Haeberli, A. & Polisky, B. Interference-based detection of nucleic acid targets on optically coated silicon. Nat. Biotech. 19, 62-65 (2001). 144. Song, S., Wang, L., Li, J., Fan, C. & Zhao, J. Aptamer-based biosensors. TrAC Trends in Analytical Chemistry 27, 108-117 (2008). 145. Potyrailo, R. A., Conrad, R. C., Ellington, A. D. & Hieftje, G. M. Adapting selected nucleic acid ligands (aptamers) to biosensors. Anal. Chem. 70, 3419-3425 (1998). 146. Han, M. S., Lytton-Jean, A. K. R., Oh, B. K., Heo, J. & Mirkin, C. A. Colorimetric screening of DNA-binding molecules with gold nanoparticle probes. Angewandte Chemie-International Edition 45, 1807-1810 (2006). 147. Cao, Y. W. C., Jin, R. C. & Mirkin C. A. Nanoparticles with raman spectroscopic fingerprints for DNA and RNA detection. Science 297, 1536-1540 (2002). 148. Gokulrangan, G., Unruh, J. R., Holub, D. F., Ingram, B., Johnson, C. K. & Wilson, G. S. DNA aptamer-based bioanalysis of IgE by fluorescence anisotropy. Anal. Chem. 77, 1963-1970 (2005).

PAGE 159

159 149. Lu, Y. & Liu, J. Functional DNA nanotechnology: emerging applications of DNAzymes and aptamers. Current Opinion in Biotechnology 17, 580-588 (2006). 150. Santoro, S. W. & Joyce, G. F. Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry 37, 13330-13342 (1998). 151. Cairns, M. J., King, A. & Sun, L. Q. Nucleic acid mutation an alysis using catalytic DNA. Nucl. Acids Res. 28, e9 (2000). 152. Liu, J. & Lu, Y. Colorimetric Biosensors Based on DNAzyme-assembled gold nanoparticles. Journal of Fluorescence 14, 343-354 (2004). 153. Liu, J. & Lu, Y. A Ccolorimetric lead biosensor using DNAzyme-directed assembly of gold nanoparticles. J. Am. Chem. Soc. 125, 6642-6643 (2003). 154. Liu, J. & Lu, Y. Optimization of a Pb2+-directed gold nanoparticle/DNAzyme assembly and Its application as a colorimetric biosensor for Pb2+. Chem. Mater. 16, 3231-3238 (2004). 155. Liu, J. & Lu, Y. Accelerated color change of gold nanoparticles assembled by DNAzymes for simple and fast colorimetric Pb2+ detection. J. Am. Chem. Soc. 126, 12298-12305 (2004). 156. Liu, J. & Lu, Y. Stimuli-responsive disa ssembly of nanoparticle aggregates for light-up colorimetric sensing. J. Am. Chem. Soc. 127, 12677-12683 (2005). 157. Lu, Y. New transitionmetal-dependent DNAzymes as e fficient endonucleases and as selective metal biosensors. Chemistry 8, 4588-4596 (2002). 158. Pan, T. & Uhlenbeck, O. C. A small metalloribozyme with a two-step mechanism. Nature 358, 560-563 (1992). 159. Li, J. & Lu, Y. A highly sensitive and se lective catalytic DNA bi osensor for lead ions. Journal of the American Chemical Society 122, 10466-10467 (2000). 160. Needleman, H. Lead poisoning. Annual Review of Medicine 55, 209-222 (2004). 161. Gidlow, D. A. Lead toxicity. Occupational Medicine-Oxford 54, 76-81 (2004). 162. He, Q., Miller, E. W., Wong, A. P. & Ch ang, C. J. A selective fluorescent sensor for detecting lead in living cells. J. Am. Chem. Soc. 128, 9316-9317 (2006). 163. Drinking water contaminants. EPA ( http://www.epa.gov/ogwdw/contaminants/index.html) (2003).

PAGE 160

160 164. Liu, J. W. & Lu, Y. Improving fluorescent DNAzyme biosensors by combining interand intramolecular quenchers. Anal. Chem. 75, 6666-6672 (2003). 165. Tan, W. H. & Yeung, E. S. Monitoring the reactions of single enzyme molecules and single metal ions. Anal. Chem. 69, 4242-4248 (1997). 166. David, L., Lambert, D., Gendron, P. & Major, F. Leadzyme. Ribonucleases, Pt A 341, 518-540 (2001). 167. Westhof, E. & Hermann, T. Leadzyme RNA catalysis. Nature Structural Biology 6, 208-209 (1999). 168. Brown, R. S., Hingerty, B. E., Dewan, J. C. & Klug, A. Pb(II)-catalysed cleavage of the sugar-phosphate backbone of yeast transfer rn aphe implications for lead toxicity and self-splicing RNA. Nature 303, 543-546 (1983).

PAGE 161

161 BIOGRAPHICAL SKETCH Youngm i Kim was born in South Korea in 1979. She was graduated in 1998 from Myoungduck High School. While in high school, she was inspired to become a chemist and thus entered Inha University to study chemistry. Af ter earning her B.S degree in chemistry at Inha University, South Korea, she began her docto rate study under the supervision of Dr. Weihong Tan at the University of Flor ida in 2004. Youngmi Kim completed her Doctor of Philosophy in analytical chemistry in 2008.