<%BANNER%>

Application of Adult Stem/Progenitor Cells in Therapeutic Treatment of Cerebellar Degenerative Diseases

Permanent Link: http://ufdc.ufl.edu/UFE0022894/00001

Material Information

Title: Application of Adult Stem/Progenitor Cells in Therapeutic Treatment of Cerebellar Degenerative Diseases
Physical Description: 1 online resource (97 p.)
Language: english
Creator: Chen, Kwang
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: cerebellum, fusion, sca1, transplantation, weaver
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Trauma/injury or neurodegenerative diseases within the cerebellum can give rise to ataxia, or incoordination of movements, that affects a large population worldwide and currently has no treatments available. Use of adult stem/progenitor cells as a source of transplantable donor cellular agents is a reasonable strategy to replace or repair the degenerated or at-risk neuronal populations to restore homeostasis within the cerebellum. Two stem/progenitor cell types that show the most promise to reconstitute lost neural tissue are neural stem/progenitor cells (NSCs) derived from the CNS and hematopoietic stem cells (HSCs) found within bone marrow. NSCs possess restricted developmental potential and give rise to tissue-specific progeny within the neural lineage while HSCs have been shown to retain broader differentiation potential that extends to atypical lineages outside of the blood system, including Purkinje neurons of the cerebellum, through cell-cell fusion. Experimental paradigms were created that take advantage of the variation within the differentiation potential and mechanisms utilized by NSCs and HSCs to replace or repair the multiple complex cerebellar cell types impacted by trauma/injury or diseases. NSCs were used in homotopic transplantation into weaver mutant mice for replacement of cerebellar neurons. Donor cells were found to survive, migrate, and apparently initiate differentiation but no impressive region-specific identities were adopted by the donor cells despite earlier studies that suggested the potential of these cells to respond to in vivo cues when placed in a permissive/instructive milieu. HSCs, on the other hand, were used as delivery vehicles to transfer neuroprotective genes/factors into the degenerating Purkinje neurons of a transgenic mouse model of Spinocerebellar Ataxia 1 (SCA1). Genetically modified HSCs were transplanted into Sca1 mice and the recipient cerebella were examined for donor-derived heterokaryons and for expression of the neuroprotective genes for proof of principle of using stem cell fusion and gene therapy to treat a neurological disorder. Together, the present study describes a thematic research approach in the establishment of novel therapeutic strategies for ataxia by using adult stem/progenitor cells in rescuing at-risk neuronal populations, with either direct cell replacement or repair through providing new genetic material, in well-characterized animal models of cerebellar ataxia.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kwang Chen.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Steindler, Dennis A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022894:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022894/00001

Material Information

Title: Application of Adult Stem/Progenitor Cells in Therapeutic Treatment of Cerebellar Degenerative Diseases
Physical Description: 1 online resource (97 p.)
Language: english
Creator: Chen, Kwang
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: cerebellum, fusion, sca1, transplantation, weaver
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Trauma/injury or neurodegenerative diseases within the cerebellum can give rise to ataxia, or incoordination of movements, that affects a large population worldwide and currently has no treatments available. Use of adult stem/progenitor cells as a source of transplantable donor cellular agents is a reasonable strategy to replace or repair the degenerated or at-risk neuronal populations to restore homeostasis within the cerebellum. Two stem/progenitor cell types that show the most promise to reconstitute lost neural tissue are neural stem/progenitor cells (NSCs) derived from the CNS and hematopoietic stem cells (HSCs) found within bone marrow. NSCs possess restricted developmental potential and give rise to tissue-specific progeny within the neural lineage while HSCs have been shown to retain broader differentiation potential that extends to atypical lineages outside of the blood system, including Purkinje neurons of the cerebellum, through cell-cell fusion. Experimental paradigms were created that take advantage of the variation within the differentiation potential and mechanisms utilized by NSCs and HSCs to replace or repair the multiple complex cerebellar cell types impacted by trauma/injury or diseases. NSCs were used in homotopic transplantation into weaver mutant mice for replacement of cerebellar neurons. Donor cells were found to survive, migrate, and apparently initiate differentiation but no impressive region-specific identities were adopted by the donor cells despite earlier studies that suggested the potential of these cells to respond to in vivo cues when placed in a permissive/instructive milieu. HSCs, on the other hand, were used as delivery vehicles to transfer neuroprotective genes/factors into the degenerating Purkinje neurons of a transgenic mouse model of Spinocerebellar Ataxia 1 (SCA1). Genetically modified HSCs were transplanted into Sca1 mice and the recipient cerebella were examined for donor-derived heterokaryons and for expression of the neuroprotective genes for proof of principle of using stem cell fusion and gene therapy to treat a neurological disorder. Together, the present study describes a thematic research approach in the establishment of novel therapeutic strategies for ataxia by using adult stem/progenitor cells in rescuing at-risk neuronal populations, with either direct cell replacement or repair through providing new genetic material, in well-characterized animal models of cerebellar ataxia.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kwang Chen.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Steindler, Dennis A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022894:00001


This item has the following downloads:


Full Text

PAGE 1

1 APPLICATION OF ADULT STEM/PR OGENITOR CELLS IN THERAPEUTIC TREATMENT OF CEREBELLAR DEGENERATIVE DISEASES By KWANG-LU AMY CHEN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 by Kwang-Lu Amy Chen

PAGE 3

3 To my Mom and Dad for their unconditional love a nd support that I will forever be thankful for.

PAGE 4

4 ACKNOWLEDGMENTS Many people have influenced and enabled the work contained within the pages of this document, both scientifically and otherwise. First and foremost, I would like to thank my mentor, Dennis Steindler, for gi ving me the opportunity to work on projects that appealed to my interests and prepared me to be a well-rounded scie ntist. His constant encouragement, guidance, and enthusiasm served as reminders to see th e big picture and helped me through periods of frustration during this long jour ney. I would also like to than k Tong Zheng for taking on the duty of overseeing my day-to-day progress, for having immeasurable patience and advice for a nave student, and for becoming a great friend along the way; my committee members (David Borchelt, Edward Scott, Arun Srivastava, and Naohi ro Terada) for their precious time, invaluable knowledge, and engaging discussions; members of my lab, past and present, for their help and camaraderie during the year s. I also want to thank my friends and classmates for all the laughter and potlucks that made these five years fly by and turning them into the most wonderful of memories. Lastly, I would like to thank my pare nts and my brother for their endless support and love that always served as inspira tion for me to continue achieving th e important goals in life.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES................................................................................................................ .........8 LIST OF ABBREVIATIONS..........................................................................................................9 ABSTRACT....................................................................................................................... ............11 CHAPTER 1 INTRODUCTION TO ADULT STEM/PROGENITOR CELLS..........................................13 Adult Stem Cell Diversity a nd Therapeutic Potential............................................................13 Overview of Neural Stem/Progen itor Cells as Donor Population..........................................15 Overview of Bone Marrow Ce lls as a Donor Population.......................................................17 2 MATERIALS AND METHODS...........................................................................................20 Supplier Information........................................................................................................... ....20 Strains of Mice................................................................................................................ ........20 Antibody List.................................................................................................................. ........21 Primary Antibodies..........................................................................................................21 Secondary Antibodies......................................................................................................22 Methods........................................................................................................................ ..........22 Generation of Astrocyte Monolayer, Neurospheres, and tau-Embryonic-Derived Neural Precursors ( ESNPs)........................................................................................22 Transplantation in Weaver Mice.....................................................................................23 Immunohistochemistry of Weaver Transplants...............................................................24 Generation of MASCs and Neurospheres for in Vitro Characterization.........................24 Immunocytochemistry of MASC Monol ayers and Neurospheres in Culture.................25 Chromosome Painting.....................................................................................................26 Qualitative and Quantitative Analysis of Cells...............................................................26 Detection of LacZ expressi on through X-gal Staining....................................................27 Generation of Recombinant scAAV 7 Plasmids......................................................28 Western Blot................................................................................................................... .29 Murine Bone Marrow Isolat ion and Sorting for Sca1+, c-Kit+, LinPopulations...........30 Recombinant AAV7 Transduction of HSCs and Bone Marrow Transplants..................31 Bone Marrow Culture......................................................................................................31 Flow Cytometric Analysis of Transgen e Expression within Peripheral Blood...............32 Immunohistochemical Analysis of BMDCs in Cerebellum Following Bone Marrow Transplants...................................................................................................................32 Fluorescent in Situ Hybridization Analysis of GFP+ Purkinje Heterokaryons................33

PAGE 6

6 3 TRANSPLANTATION OF EMBRYONIC AND ADULT NEURAL STEM CELLS IN THE GRANULOPRIVAL CE REBELLUM OF THE WEAVER MUTANT MOUSE........35 Introduction................................................................................................................... ..........35 Cerebellar-Derived MASCs Show Extensiv e Migration but Lim ited Differentiation Following Intracerebellar Transplant ation in Postnatal Weaver Mice...............................38 Embryonic Stem-Cell Derived Neural Precursors Exhibit Multiple Neuronal Morphologies and Phenotypes upon Transplant ation within the Postnatal Weaver Cerebellum..................................................................................................................... .....39 Embryonic Stem-Cell Derived Neural Precu rsor Transplantation Gives Rise to Neoplasia...................................................................................................................... .......40 4 FUSION OF NEURAL STEM CELLS IN CULTURE.........................................................47 Introduction................................................................................................................... ..........47 Astrocyte Monolayers Contain Cells with Aneuploid Sex Chromosomes.............................49 Analysis of Cell-Cell Fusion Usi ng a Cre/lox Recombination System..................................50 Cells Immunopositive for CD11b Retain a Diploid State......................................................51 Cultures Derived From PU.1 Knock-Ou t Mice Contain Aneuploid Cells.............................51 5 A PROOF OF PRINCIPLE FOR COMBIN ING STEM CELL FUSION AND GENE THERAPY AS TREATMENT FO R SPINOCEREBELLAR ATAXIA 1............................57 Introduction................................................................................................................... ..........57 Adeno-Associated Viral Plasmid Design a nd Expression of the Transgenes in HEK 293T Cells..................................................................................................................... ......59 Donor Labeled Purkinje Heterokaryons ar e Binucleated and Possess Y Chromosomes.......60 Donor Labeled GFP+ Cells Express Modifier Genes in Vivo with Possible Effects on Nuclear Inclusions............................................................................................................. ..62 Bone Marrow Derived Cells Can Fuse to Other Cell Types within the Cerebellum.............63 6 DISCUSSION AND CONCLUSIONS..................................................................................72 Comparative Analysis of Cerebellar-derive d MASCs and ESNPs in Transplantation..........73 Homotypic Cell-Cell Fusion in Vitro .....................................................................................77 Bone Marrow Derived Cells Deliver Potent ially Neuroprotective Genes to Purkinje Neurons through Heterotypic Cell-Cell Fusion..................................................................80 Conclusions.................................................................................................................... .........84 LIST OF REFERENCES............................................................................................................. ..86 BIOGRAPHICAL SKETCH.........................................................................................................97

PAGE 7

7 LIST OF TABLES Table page 5-1. Modifier Genes Packag ed into scAAV7 Vectors..................................................................65 5-2. Bone Marrow Transplant Summary......................................................................................65

PAGE 8

8 LIST OF FIGURES Figure page 3-1. Cerebellar-derived MASCs ha ve the ability to differentia te into neurons, astrocytes, and oligodendrocytes in vitro.............................................................................................42 3-2. Cerebellar-derived MASCs are able to survive, migrate, and differentiate upon transplantation into th e weaver cerebellum.......................................................................43 3-3. Tau-EGFP-ESNP cells expres s neuronal fate in culture.......................................................44 3-4. Grafted ESNPs have the ability to surviv e, migrate, and differentiate into mature phenotypes following transplantation into the weaver mouse model................................44 3-5. Embryonic stem cell-derived neural precu rsors are capable of transforming host tissue and give rise to tumor-like spheres....................................................................................46 4-1. Astrocyte monolayers contain ce lls with polyploid sex chromosomes.................................53 4-2. Cre/lox recombination system shows ne urospheres derived from co-cultures of 2 different mouse lines contain cells positive for -gal expression, indicating occurrence of fusion...........................................................................................................54 4-3. Cells immunopositive for the microglial marker, CD11b, retain diploid states....................55 4-4. Neurospheres derived from PU.1 wildtype and mutant mice were immunolabeled with CD11b and counterstained with DAPI..............................................................................55 5-1. Schematic representation of the experimental paradigm.......................................................66 5-2. Plasmid design and proviral cass ette expression in HEK 293T cells....................................67 5-3. Donor-labeled Purkinje heterokaryons are binucleated and have Y chromosomes in female recipient mice.........................................................................................................68 5-4. Donor labeled cells expr ess c-Myc/his reporter tag..............................................................69 5-5. Nuclear inclusions vary in size a nd are smaller in fused Purkinje neurons..........................70 5-6. Bone marrow cells give rise to multiple neuronal cell types within the cerebellum.............71

PAGE 9

9 LIST OF ABBREVIATIONS AAV Adeno-associated virus bFGF basic fibroblast growth factor -gal -galactosidase BMDCs Bone marrow-derived cells BPE bovine pituitary extract CMV cytomegalovirus CNS Central Nervous System DMEM Dulbeccos Modified Eagle Medium EBs embryoid bodies EGF Epidermal growth factor EGFR-PTK Epidermal growth factor receptor protein tyrosine kinase ES cells embryonic stem cells ESNPs embryonic stem cell-derived neural precursor FACS fluorescent-activated cell sorting FBS Fetal bovine serum FISH fluorescence in situ hybridization Floxed lox-P flanked GFAP glial fibrillary acidic protein GFP Green fluorescent protein GIRK G-protein-coupled, inwa rd rectifying potassium H & E Hematoxylin and eosion HSCs Hematopoietic stem cells LPO laminin-, poly-L-ornithine MASCs Multipotent astrocytic stem cells

PAGE 10

10 MATH 1 mouse atonal homolog 1 NSCs Neural stem cells PBS Phosphate Buffered Saline Pcd Purkinje cell degeneration RMS Rostral migratory stream SCA 1 Spinocerebellar Ataxia 1 SEZ Subependymal zone SSC Sodium Chloride Sodium Citrate SSEA 1 stage-specific embryonic antigen-1 SVZ subventricular zone

PAGE 11

11 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy APPLICATION OF ADULT STEM/PR OGENITOR CELLS IN THERAPEUTIC TREATMENT OF CEREBELLAR DEGENERATIVE DISEASES By Kwang-Lu Amy Chen December 2008 Chair: Dennis A. Steindler Major: Medical Sciences--Neuroscience Trauma/injury or neurodegenerative diseases wi thin the cerebellum can give rise to ataxia, or incoordination of movements, that affects a large population worldwide and currently has no treatments available. Use of adult stem/proge nitor cells as a source of transplantable donor cellular agents is a reasonable strategy to replac e or repair the degenera ted or at-risk neuronal populations to restore homeostasis within the cerebellum. Two st em/progenitor cell types that show the most promise to reconstitute lost neur al tissue are neural stem /progenitor cells (NSCs) derived from the CNS and hematopoietic stem cells (HSCs) found within bone marrow. NSCs possess restricted developmental potential and give rise to tiss ue-specific progeny within the neural lineage while HSCs have been shown to retain broader differe ntiation potential that extends to atypical lineages out side of the blood system, incl uding Purkinje neurons of the cerebellum, through cell-cell fusion. Experimental paradigms were created that take advantage of the variation within the differentiation poten tial and mechanisms utilized by NSCs and HSCs to replace or repair the multiple complex cerebellar cell types impacted by trauma/injury or diseases. NSCs were used in homotopic transplantation into weaver mutant mice for replacement of cerebellar neurons. Donor cells were found to survive, migrate, and apparently initiate

PAGE 12

12 differentiation but no impressive region-specifi c identities were adopted by the donor cells despite earlier studie s that suggested the potential of these ce lls to respond to in vivo cues when placed in a permissive/instructive milieu. HS Cs, on the other hand, were used as delivery vehicles to transfer neuroprotec tive genes/factors into the dege nerating Purkinje neurons of a transgenic mouse model of Spinoc erebellar Ataxia 1 (SCA1). Ge netically modified HSCs were transplanted into Sca1 mice and the recipient cerebella we re examined for donor-derived heterokaryons and for expression of the neuropro tective genes for proof of principle of using stem cell fusion and gene therapy to treat a ne urological disorder. Together, the present study describes a thematic research approach in the establishment of novel therapeutic strategies for ataxia by using adult stem/progenitor cells in re scuing at-risk neuronal populations, with either direct cell replacement or repair through providing new genetic mate rial, in well-characterized animal models of cerebellar ataxia.

PAGE 13

13 CHAPTER 1 INTRODUCTION TO ADULT STEM/PROGENITOR CELLS Adult Stem Cell Diversity and Therapeutic Potential Stem cells can be isolated from many adult ti ssues at various devel opmental stages and be used for cell-based therapies for repair and rest oration of homeostasis. Sites harboring these tissue-specific stem cells include blood, skin, in testine, gonad, brain, breast, liver, muscle, lung, and kidney (Nystul and Spradling, 2006; Vats et al., 2005; Hombach-Kl onisch et al., 2008). Studies show that stem cells possess the ability to differentiate into cel l types found within the tissue of origin, and may be suited for replacem ent of damaged tissue within the same region. Degeneration of neural tissue in the central nervous system (CNS ) can lead to many devastating disorders including Alzheimers disease, Parkin sons disease, Huntingtons disease, and Spinocerebellar Ataxia s, just to name a few. Many of th ese neurodegenerative diseases involve the loss of specific neuronal populations and the challenge lies in the development and the generation of needed cell types in vitro followed by heterologous, or even better, autologous transplant into the damaged area. For neurodege nerative disorders, transplantation of neural stem cells (NSCs) into a damaged CNS region w ould be the most straightforward and plausible approach for generating new neur al tissue. NSCs have alread y demonstrated the ability to develop into lineage appropriate cell types and they can be main tained and expanded in culture for transplantation into transgenic and other an imal models of neurodegenerative disorders. However, they have not been shown to have the ability to generate all the different types of neuronal and glial cells, including Purkinje neurons that selectively undergo degeneration in many movement disorders, and it currently does not seem to be possible to have stem cells treat the entire range of CNS disorder s. Aside from potency, other important factors to consider include accessibility, and th e robustness of the stem cell resource. NSCs reside in brain regions

PAGE 14

14 that are hard to access without disturbing the pare nchyma and they also exist in small numbers, hence stem cells derived from other regions/sourc es should be considered for use in CNS repair in addition to NSCs. Recent studies have show n that some adult stem cells possess broader differentiation potential than prev iously thought, and they have th e ability to generate cell types outside the tissue of origin. Bone marrow deri ved cells (BMDCs), in particular, have been reported to give rise to atypical lineages of liver, intestine, heart, skeletal muscle cells and Purkinje neurons (Ferrari et al., 1998; Gussoni et al., 1999; Jackson et al ., 1999; Petersen et al., 1999; Lagasse et al., 2000; Krause et al., 2001; Orlic et al., 2001; Priller et al., 2001; AlvarezDolado et al., 2003; Weimann et al., 2003), through mechanisms that likely comprise both transdifferentiation and cell-cell fusion. Thus BMDC s represent another possible candidate for replacement or protection therapies in neurodege nerative disorders, especially those involving atrophy of Purkinje neurons sin ce that is the only neuronal p opulation within the CNS that BMDCs have been shown to turn into through cellcell fusion. In contrast to NSCs, BMDCs are better characterized stem cells, are easily acce ssible, and bone marrow transplants are less invasive than intracranial injections for future clinical applications. The complexity of the CNS requires that multiple approaches are needed to repair, replace, or protect damaged neural tissue, so both types of adult stem cells mentioned above should be considered for complimentary therapeutic appr oaches. Moreover, ot her modalities involving gene therapy or drug administrati on might also prove beneficial in conjunction with cell-based therapy, considering that more than one factor often contribute to neurodegeneration. The work presented here possesses an underlying theme that exploits the potential of using two different types of adult stem cells, under different conditions, to replace degenerating neuronal populations. This study also focuses on the repair of the cerebellum because this is a region

PAGE 15

15 affected in numerous movement disorders, but there are currently very little to no effective treatments available to remedy the loss of this im portant CNS structure. In addition, there are well-characterized cerebellar mutant and transgen ic mouse models available for testing new cell and molecular therapies. Methods include dire ct transplantation of NSCs into compromised cerebella for examination of transplant survival and functional integrati on of donor cells, as well as transplantation of BMDCs in combination wi th gene therapy for a less invasive bone marrow transplant approach. The intend ed goal is to derive cell-base d strategies with different donor populations and different delivery systems to achieve novel therapeutic paradigms for the rescue of at-risk neuronal populations with in the degenerating cerebellum. Overview of Neural Stem/Progenitor Cells as Donor Population Most neurons within the CNS of higher vert ebrates are postmitotic and non-proliferative. However, recent studies show that persistent ne urogenesis occurs in restricted and discrete neuropoietic zones throughout postn atal and adult life (Steindler and Pincus, 2002). Specifically, robust and persistent neurogenesis is found with in two regions of the CNS of rodents and humans: the subependymal zone (S EZ) lining the lateral ventricles of the forebrain (Lois and Alvarez-Buylla, 1994; Curtis et al ., 2007) and the subgranular laye r in the dentate gyrus of the hippocampus (Kirschenbaum et al., 1994; Kuhn et al., 1996; Eriksson et al ., 1998; Gould et al., 1999; Kornack and Rakic, 1999). NSCs are mostly concentrated in the SEZ of the forebrain since this is a vestigial remnan t of the embryonic germinal zone that displays constitutive proliferation. Cells within this neurogenic zone continuously generate po pulations of neuroblasts that migrate a long distance from the lateral ve ntricles to the olfact ory bulb via the rostral migratory stream (RMS) to develop into mature interneurons (Luschkin 1993; Lois and AlvarezBuylla, 1994). Studies from Doetsch et al. (199 7) showed that the cytoarchitecture of the SEZ consists of three basic cell types that represent the astrocytes (oft en referred to as B cells) that

PAGE 16

16 give rise to highly proliferativ e precursor cells (Ccells), wh ich then become progressively restricted in developmental potentials before di viding into migrating neuroblasts (A cells). Only the astrocytes showed NSC attributes w ith the characteristic mitotic quiescence and the ability to give rise to progenitors, including ce lls of neuronal phenotype (Doetsch et al., 1999). In addition, these astrotypic NSCs can form multipotent proliferative clones, or neurospheres, that give rise to the three major classes of neur al cells: neurons, astrocytes, and oligodendrocytes in vitro (Kukekov et al., 1999; Kukekov et al., 1997; Reynolds and Weiss, 1992; Richards et al., 1992). Work from our laboratory (Laywell et al ., 2000) further confirmed that astrocytes isolated from the SEZ of the developing brain up to the end of the seco nd postnatal week are multipotent stem cells, which we refer to as multi potent astrocytic stem cells (MASCs) that are capable of forming neurospheres and give rise to both neurons and glia. These MASCs, with attributes of neural stem/progenitor cells, t hus represent potential donor population for cell replacement strategies. Aside from the SEZ, another region with tran sient neurogenesis is the postnatal cerebellar cortex. This is a region of ac tive proliferation duri ng early development with newly generated granule cells forming the transien t external granule cell layer (H atten et al., 1997). However, this has not been a site widely reported as a source of multipotent neurospheres under the standard culture conditions that combine removal of cell-cell/substrate contact with serum-free medium containing growth factors. Under a novel culture paradigm from our laboratory (Laywell, et al., 2005), neurosphere -like cell clusters can be generated from serum-, and growth factor-dependent conditions under higher density and demonstrated to be multipotent with the ability to form all three primary CNS cell types as well. Others were also able to isolate stem cell-like populations from mu rine cerebellum that can form neurospheres under clonogenic

PAGE 17

17 conditions and give rise to region appropriate cerebellar cell types including parvalbuminexpression interneurons, GABA-ergic ne urons, and glutaminergic neurons both in vitro and in vivo (Lee et al., 2004; Klein et al., 2004). In addition, cerebe llar-derived MASCs possess the ability to survive, migrate, and differentiate when transplanted into the SVZ of normal adult mice (Zheng et al., 2006), and represen t another possible candidate for cell replacement strategies. Even though in the study by Zheng and colleague s, only cell types with mostly glial morphology and a small population of olfactory interneurons were generated from the transplant into the SVZ of wildtype mice, it is possible that the cereb ellar MASCs could have enhanced responses to endogenous cues present within the damaged or degenerated cerebellum following homotopic transplantation. In the current study, changes of transplant loca tion from SVZ to cerebellum and the host environment from healthy adult mice into postnatal mutant pups may provide additional guidance and/or foster interactions that result in an increase in the generation of region-specific neuronal populations wi thin the cerebellum. Overview of Bone Marrow Cells as a Donor Population Bone marrow cells that harbor hematopoietic stem cells (HSCs) are pluripotent and highly proliferative, with the ability to generate up to an estimated 1013 mature blood cells in the normal adult lifespan, and capable of self-regeneration that ensures sufficient hematopoiesis over the lifetime (Szilvassy, 2003). In addition to generating and ma intaining all the lymphoid and myeloid cells needed for blood, bone marrow, spl een, and thymus systems, BMDCs have also demonstrated the ability to differentiate into cells of nonhematopoietic tissues including liver, intestine, heart and skeletal mu scle cells (Krause et al., 2001; Or lic et al., 2001; Lagasse et al., 2000; Gussoni et al., 1999; Jackson et al., 1999; Pete rsen et al., 1999; Ferrari et al., 1998). Furthermore, there is evidence, albeit controvers ial, showing that BMDCs have the potential of turning into neuronal cell types both in vitro and in vivo One of the first reports used lethally

PAGE 18

18 irradiated adult mice as recipient of GFP+ bone marrow cells transpla nted through intravascular injection and found GFP+ cells expressing neuron specific genes within the olfactory bulb (Brazelton et al., 2000). Anothe r similar study took the approach of injecting bone marrow cells into neonatal PU.1 knockout mice that normally l acked macrophages, neutrophils, mast cells, osteoclasts, and B and T cells at birth, in orde r to obtain an estimation of the amount of donor derived cells that are present within the CNS. The authors found approximately 2.3 to 4.6% of bone marrow derived cells within the brai n, but only a small popul ation of 0.3 to 2.3 % expressed neuronal marker NeuN (Mezey et al ., 2000). Even though the rodent evidence for trans-differentiation is not so strong (Deng et al., 2006), data showing BMDCs giving rise to neurons and glia following transplants in humans (Cogle et al., 2004) is ra ther provocative. Despite such encouraging results, few of BM DCs bearing neuronal antigenic profile also displayed morphological characteristics of neur ons (Brazelton et al., 2000; Mezey et al., 2000), and it was not clear how long these BMDCs pers isted in the brain or what mechanism was behind the observed plasticity. Following a l ong term bone marrow transp lant into lethally irradiated adult mice, Priller and colleagues (2001) reported neogene sis of functional bone marrow-derived Purkinje neurons within the ce rebellum and believed that trans-differentiation was the driving force behind the observed lineag e switch. However, upon closer examination, in vitro culture of stem cells with different linea ges revealed hybrid ce lls bearing abnormal number of chromosomes that most likely result from cell-cell fusion (Terad a et al., 2002; Ying et al., 2002). In these two reports, co-culture of ES cells with either bone marrow cells or neural stem cells yielded hybrid populations that expr essed both donor cell markers and ES cell-like properties that could have led to the conclusi on that trans-differentia tion was involved if DNA content of the cells was not analyzed. Other in vivo studies have also reached similar

PAGE 19

19 conclusions based on bone marrow transplants using sex mismatched donor cells and close examination of donor-derived Purkinje neurons fo r the presence of extra nuclei (Weimann et al., 2003a; Weimann et al., 2003b). One in-depth study u tilized the Cre/lox recombination system to further show that bone marrow transplants usi ng BMDCs from mice expressing Cre recombinase into transgenic animals with floxed L acZ reporter genes generated cells with -galactosidase activity, which is possible only as a result of ce ll-cell fusion (Alvarez-Dol ado et al., 2003). These findings, together, suggest that controlled cell-cell fusion is a mechanism that can be exploited to expand the developmental scope of adult stem cells. This would be especially beneficial for complex cell types such as Purkin je neurons in the CNS that are vulnerable in many neurodegenerative disorders but lack evidence for de novo genesis after birth. Specifically, induced plasticity may be exploited for novel therapeutic strategies involving the use of cell fusion to deliver modified genomes fo r reconstitution, or better said, neuroprotection, of degenerated or at-risk neur onal populations. One disorder with specific Purkinje neuron atrophy that might benefit from this system is spi nocerebellar ataxia 1 whic h is a gain of function polyglutamine repeat disease that currently has no effective treatments available. The cause underlying the neuronal cell death has not yet been elucidated, but evidence shows that the degeneration of Purkinje cells ma y be due to protein misfolding and impaired protein clearance as a result of the toxic gain of function cau sed by glutamine expansion (Orr and Zoghbi, 2007; Orr and Zoghbi, 2001; Zoghbi and Orr, 2000). The cu rrent study sets out to test the concept of using genetically modified BMDC s as vehicles to deliver poten tially neuroprotective genes or factors into degenerating neurons for restoration of homeostatic balance within the host system as a novel therapeutic treatment.

PAGE 20

20 CHAPTER 2 MATERIALS AND METHODS Supplier Information Abcam (Cambrige, MA), Amersham (Piscataw ay, NJ), Atlanta Biol ogicals (Norcross, Ga), Aves Labs, Inc (Tigard, OR), Becton-Dickin son/BD Biosciences (San Jose, CA), Bio-Rad (Hercules, CA), Carl Zeiss Microimaging Inc (Thornwood, NY), Cemines (Golden, Co), Chemicon (Temecula, CA), Corning Inc (Corning, NY), DAKO (Carpintera, CA), Developmental Studies Hybridoma Bank (Iowa City, IA), Fisher Sc ientific (Pittsburgh, PA), GE Healthcare Life Sciences (Piscataway, NJ), Invitrogen (Carlsbad, CA), Jackson Labs (West Grove, PA), Leica (Bannockburn, IL), Midsci (St. Louis, MO), Millipore (Billerica, MA), New England Biolabs (Ipswich MA), Open Biosyste ms (Huntsville, AL), Promega (Madison, WI), Qiagen (Valencia, CA), R&D Systems (Minnea polis, MN), Santa Cruz Biotechnology (Santa Cruz, CA), Sigma Aldrich (St. Louis, MO), Strata gene (La Jolla, CA), Thermo Fisher Scientific (Huntsville, AL), Vector La boratories (Burlingame, CA). Strains of Mice Beta-Actin-GFP mice: STOCK Tg(CAG-EGFP) D4Nagy/J (stock #003116, The Jackson Laboratory, Bar Harbor, ME) C57/BL6J (stock #000664, The Jackson Laboratory) Cre recombinase mice: STOCK Tg(hCMVcre)140Sau/J (sto ck #002471, The Jackson Laboratory) Floxed ROSA 26 mice: B6.129S4-Gt(ROSA)26Sor tm1Sor/J (stock #003474, The Jackson Laboratory) ROSA 26 mice: B6;129S-Gt(ROSA)26Sor/J (stock #002073, The Jackson Laboratory) Weaver mice: B6CBACaAw-J/A-Kcnj6wv/J (stock #000247, The Jackson Laboratory) UBC-GFP mice: C57B L/6-Tg(UBC-GFP)30Scha/J (stock #004353, The Jackson Laboratory)

PAGE 21

21 Spinocerebellar Ataxia 1 158Q knock-in mice (kind gift from Dr. H.Y. Zoghbi) Antibody List Primary Antibodies Allophycocyanin (APC)-CD117 (c-Kit) (rat monoclonal, 1:200, BD) Ataxin-1 (rabbit, 1:1000, gi ft from H.Y. Zoghbi Lab) -III-tubulin/Tuj1 (mouse monoclonal, 1:1000, Promega) Calbindin (mouse monoclonal, 1:2000, Sigma) CD11b (rabbit polyclonal, 1:10, Abcam; mous e polyclonal, 1:100, BD Biosciences) C-Myc (rabbit polyclonal, 1:100, Santa Cruz Biotechnology; rabbit polyclonal, 1:50, Sigma) CNPase (mouse monoclonal, 1:250, Chemicon) Gamma-aminobutyric acid (A) Receptor alpha 6 subunit (GABAA 6) (rabbit, 1:500, Chemicon) GABA (rabbit, 1:1000, Sigma) Glutamate (rabbit, 1:500, Sigma) Glial fibrillary acidic protei n (GFAP) (rabbit, 1:10, Thermo Fisher; mouse, 1:10, Thermo Fisher; mouse, 1:500, Chemicon; mouse, 1:1000, Dako) Green Fluorescent protein (GFP) (rabbit polyclo nal, 1:1000, Millipore; chicken polyclonal 1:1000, Aves Labs; chicken 1:500, Abcam) Lis1 (N-19) (goat polyclonal 0.5-2ug /ml, Santa Cruz Biotechnology) Mouse Atonal Homolog-1 (MATH-1) (rabbit, 1:10, Developmental Studies Hybridoma Bank) NeuN (mouse monoclonal, 1:1000, Chemicon) O4 (mouse monoclonal IgM, 1:150, Chemicon) PE CD3e (hamster, 1:10, BD) PE CD4 (rat, 1:10, BD)

PAGE 22

22 PE CD8a (rat, 1:10, BD) PE-Cy7 Sca-1 (Ly-6A/E ) (rat 1:200, BD) PE Ly-6G (Gr-1) (rat, 1:10, BD) R-Phycoerythrin (R-PE)-CD5 (Ly-1) (rat monoclonal, 1:10, BD) R-Phycoerythrin (R-PE) CD 11b (rat monoclonal, 1:10, BD) R-Phycoerythrin (R-PE)-B220/CD45 R (rat monoclonal, 1:10, BD) R-Phycoerythrin (R-PE)-TER-119 (L y-76) (rat monoclonal, 1:10, BD) RU49/ZFP-38 (rabbit, 1:1000, CeMines) S-100 (rabbit, 1:400, Sigma) Stage-Specific Embryonic Antigen-1 (SSEA-1) (mouse, 1:200, Abcam) Secondary Antibodies Cy3 goat anti mouse IgG (1:300-1:500, Jackson Labs) Cy3 goat anti mouse IgM (1:300, Jackson Labs) Fluorescein-labeled goat anti ch icken IgY (1:1000, Aves Labs) Horseradish peroxidase-conjugate d anti rabbit IgG (1:500, Sigma) Oregon Green goat anti mouse IgG (1:1000, Invitrogen) Oregon Green goat anti rabbit IgG (1:1000, Invitrogen) Methods Generation of Astrocyte Monolayer, Neur ospheres, and tau-Embryonic-Derived Neural Precursors ( ESNPs) MASCs: Astrocyte monolayers were derive d from cerebella of neonatal (P1-P8) transgenic mice constitutively expressing GFP (strain #003116, Jackson Laboratory, Bar Harbor, MI, USA). Following decapitation, cerebella we re removed for dissociation into single-cell suspensions as previously described (Laywell, 2000; Laywell, 2005). Briefly, cerebellar tissue was isolated and minced with a razor blade be fore incubation in trypsin for 5 minutes in 37o water bath. Cells were triturated serially with 5ml pippets followed by glass Pasteur pippets three times or until single-cell su spension is achieved. After being pelleted and washed several

PAGE 23

23 times in medium, cells were cultured in standard T75 tissue culture flasks with growth medium consisting of Dulbeccos Modified Eagle Medium with F12 supplements (DMEM/F12, Invitrogen) contai ning N-2 supplement (Invitrogen) and 20 g/mL bovine pituitary extract (BPE, Invitrogen), 5% fetal bovine serum (FBS, Atla nta Biologicals), 20ng/mL epidermal growth factor (EGF, Sigma), and 10ng/mL basic fibrobla st growth factor (bFGF, Sigma). Astrocyte monolayers were expanded and pa ssaged up to a maximum of four times before being collected for transplantation. ESNPs : Cells were derived from the J1 ES cell line carrying the EGFP cDNA knock-in at the tau gene and collected at stage IV of a four-s tep culture protocol as previously described (Goetz et al., 2006). Briefly, cells were expanded on mitomysin C-inhibited embryonic fibroblasts and gelatin in step I, followed by induction of embryoid bodies (EBs) in step II, and attachment of the EBs to laminin-, poly-L-orni thine (LPO)-coated surfaces to derive neural precursor cells in step III. Cells were transferred to another LPOcoated surface in stage IV and cultured with bFGF and passaged once before di ssociation into single-cell suspensions for transplantation. Transplantation in Weaver Mice Both populations of donor cells were characteri zed prior to transplantation as previously described (Laywell et al., 2000; Laywell et al ., 2005; Goetz et al., 2006) For transplants, MASCs or ESNPs were collected, triturated into single cell suspensions and resuspended at a concentration of 5x104 or 1x105 cells/ l in serum-free DMEM/N-2 medium as described above. Postnatal day 18 weaver (strain B6CBACaAw-J/A-Kcnj6wv/J, Jackson Laboratory) mouse pups, including homozygous ( wv / wv ), heterozygous ( wv /+), or control wildtype (+/+) littermates, were first cryo-anesthetized befo re unilaterally injected with 1 l of the cell suspension into the

PAGE 24

24 right hemisphere of the cerebellum using a Hamilt on syringe with 25s gauge needle. A total of 23 mice received MASCs and 28 received ESNPs transplants within the cerebellar cortex. Immunohistochemistry of Weaver Transplants Following transplantation of MASCs or ESNPs into the cerebella of weaver mice, animals were sacrificed at one, two, three, four, or five weeks pos t transplantation and transcardially perfused with 4% paraformal dehyde in 0.1M phosphate buffered saline (PBS, pH=7.4). Brains were then removed, postfixed ove rnight in perfusate, and sectioned through the coronal plane at a thickness of 30 m using a vibratome or 20 m on a frozen microtome. Sections were incubated in PBS + 0.1% trit on (PBSt), 10% FBS, and the following primary antibodies overnight at 4oC: rabbit GFP (1:1000, Invitroge n), chicken GFP (1:1000, Aves), mouse -III tubulin (1:1000, Promeg a), mouse NeuN (1:1000, Chemicon), rabbit GFAP (1:10, Thermo Fisher), rabbit glutamate (1:500, Sigm a), rabbit RU49/ZFP-38 (1:1000, CeMines), rabbit gamma-aminobutyric acid(A) Receptor alpha 6 subunit (GABAA 6) (1:500, Chemicon), rabbit MATH-1 (mouse atonal homolog 1) (1:200, Chem icon), and mouse stage-specific embryonic antigen-1 (SSEA-1) (1:200, Abcam). The next da y, sections were washed three times in PBSt and incubated with the a ppropriate secondary fluore scent antibodies at 1:300. Generation of MASCs and Neurospheres for in Vitro Characterization Astrocyte monolayers were derived from both cerebellum and subependymal zone (SEZ) of early postnatal (postnatal day 1-8) C57/BL6 mice, or c onstitutively expressing Green Fluorescent Protein (GFP) +/+ transgenic mice (J ackson Laboratory). Female and male mice were decapitated, and their cerebella and/or S EZ were removed minced with a razor blade and placed into DMEM/F12 medium with N2 supplem ents (N2 media) containing 1X antibiotics (100X, Invitrogen) for 15 min. Following aspira tion of the antibiotic N2 solution, 4 ml of

PAGE 25

25 trypsin (0.25%, Atlanta Bi ologicals) was added to the cells for 5 min in 37oC water bath. Cells were washed off with N2 medi a and trituated with 5ml pippet followed by glass Pasteur pippet until single cell suspension is achieved. Tissue remain ed in chunks were allowed to settled to the bottom and only the portion containing a single ce ll suspension is collected. This process was repeated 2-3 times until homogenous cell suspensi ons were achieved. Cells were cultured in standard T75 tissue culture flasks with growth medium consisting of Dulbeccos Modified Eagle Medium with F12 supplements containing N2 su pplement, 5% fetal bovine serum (FBS, Atlanta Biologicals), 20ng/mL epidermal growth factor (EGF, Sigma), and 10ng/mL basic fibroblast growth factor (bFGF, Sigma). After 1-2 days in culture, cells that did not attach to the culture flasks were collected to gene rate neurospheres. Cells were trypsinized, centrifuged, and triturated into a single-cell suspensions before a secondary culture was initiated. After counting with a hemacytometer, cells were resuspended in growth medium and a liquoted into ultra low attachment polystyrene 6-well plates (Corning) at densities ranging from 1x103 to1x105 cells/cm2. Cultures were supplemented with grow th factors every second day and neurospheres became apparent within 3-5 days. Generation of neurospheres from PU.1 mice differs only in that whole brains were extracted from embr yonic day 15 (E15) of PU.1 +/-, +/+, and -/littermates since the PU.1 knockout mouse is embryonic lethal. Each brain was processed individually to avoid cross-cont amination of cells. Brains were dissociated into single cell suspensions and neurospheres we re generated from the floating cells of primary cultures as described above. Immunocytochemistry of MASC Monol ayers and Neurospheres in Culture Confluent astrocyte monolayers were trypsinized, pelleted, and resuspended in DMEM/F12 containing N2 supplements and 5% FBS. Cells were plated onto glass coverslips that had been sequentially coated with poly-L-ornithine (10 g/ml, Sigma) and laminin (5 g/ml,

PAGE 26

26 Sigma). Neurospheres were induced to differe ntiate by plating the s pheres on coated glass coverslips in a drop of N2 medi um containing 5% FBS. Three to five days after plating, cells were fixed with 4% paraformaldehyde in PBS for 20 min and processed for immunofluorescence. Cells on cove rslips were incubated with 500 l of PBSt containing 10% FBS and primary antibodies against the following an tigens: glial fi brillary acidic protein (GFAP) (1:10 Thermo Fisher); -III tubulin (1:1000 Promega); and CD11b (1:100 BD PharMingen), at 4oC overnight. Following three washes in PBSt, 500 l of PBSt containing 10% FBS and 1:500 of appropriate secondary an tibodies was added for one hour at room temperature. Chromosome Painting Astrocytes and neurospheres were processed for fluorescence in situ hybridization (FISH) following combined GFAP and -III tubulin immunolabeling and DAPI nuclear counterstaining. Mouse X (FITC-conjugated) and Y (cy3-conjug ated) chromosome probes (Open Biosystems) were used as described (Laywell et al., 2005) to analyze cell ploidy. Briefly, after cells were air dried at room temperature overnight, they we re incubated for 15 min in a 3:1 mixture of methanol and acetic acid, digested with pepsin (1mg/ml in 0.01N HCl, Sigma), immersed in formaldehyde (1% in PBS, Sigma), and hybridized overnight with chromosome paints for 5 min at 74oC, followed by 16 hours at 37oC. Following hybridization, cells were washed first in 1:1 formamide:2xSSC (Sodium Chloride Sodium Ci trate), then 2xSSC, and 4xSSC with 0.1% NP40 at 46oC. Cells were mounted with Vectashiel d mounting media containing DAPI (Vector Laboratories) and glass coverslips (Fisher Scientific). Qualitative and Quantitati ve Analysis of Cells Since the chromosome painting protoc ol abolishes the fluorescence signal of immunolabeled cells, the phenotypi c characterization of cells c ontaining abnormal numbers of

PAGE 27

27 sex chromosomes was achieved by matching i mmunolabeled and fluorescence in situ hybridization processed cells on the basis of an extensively photodocumented DAPI nuclear staining pattern. The nu clear pattern of GFAP/ -III tubulin immunolabeled cells was photodocumented with 5X, 10X, 40X and 63X objectives before and after the FISH procedure so individual double labeled cells c ould be aligned with the correct orientation. For quantification, 16 random fields on the coverslips were phot ographed at 40X magnifi cation. The number of diploid and aneuploid cells was recorded and divided by the tota l cell number to calculate the percentage of putatively fused cells. Detection of LacZ expression through X-gal Staining SEZ and cerebellum from transgenic mice expressing Cre recombinase (Jackson Laboratory, stock #002471), gt(Ros a)26Sor tm1Sor/J (Jackson Laboratory, stock #003474) for the floxed stop cassette in front of the LacZ gene, and gt(Rosa)26Sor/J (Jackson Laboratory, stock #002073) as control for ubiquitous expres sion of LacZ, were isolated and cultured separately as astrocyte monolayer s (as described above). First passage female Cre cells were cocultured with first passage male gt(Rosa)26Sor tm1Sor/J cells at a 1:1 ratio. This male/female mix of cells provided an additional control to this study because -gal+ cells should reveal a chromosomal pattern of XXXY w ith fusion between cre recombinase-expressing cells and the cells harboring the LacZ gene. Polyclonal neur ospheres were generate d from both transgenic mice under higher density culture conditions and without methocellulose, and attached onto poly-L-ornithine/laminin coated coverslips. Ce lls were fixed in 4% paraformaldehyde for 10 min, then incubated in prewarmed X-gal stock solution (100ml of 0.1M PBS, 5mM potassium ferricyanide, 5mM potassium ferrocyanide, 40m g magnesium chloride, 20 l NP40 and 10mg sodium deoxycholate supplemented with 1mg/ml x-gal in Dimethyl Sulfoxide (DMSO), Sigma) at 37oC until a blue reaction product became apparent.

PAGE 28

28 Generation of Recombinant scAAV 7 Plasmids Glutathione S-transferase, th eta 2 class (Gstt2), poly(rC) binding protein 3 (Pcbp3), and DnaJ (Hsp40) homolog, subfamily B, member 4 (DNAJ) cDNA clones were obtained from Invitrogen. Lissencephaly 1/Platelet-activati ng factor acetylhydrolase, isoform 1b, beta1 subunit (Pafah1b1) cDNA was obtained by RT-P CR using the following primer set: AATGGTGCTGTCCCAGAG (forward primer) and AATCAACGGCACTCCCAC (reverse primer). All cDNAs were subcloned into the adeno-associated virus (AAV) proviral plasmid. Plasmids were named as follow: pTR2-CB-Gstt2, pTR2-CBPcbp3, pTR2-CB-DNAJ, and pTR2-CBPafah1b1. In order to distinguish the expression of endogenous genes and their corresponding recombinant genes, a c-Myc and polyhi stidine (His) tags were engineered into the C-terminus of the proteins. Plasmid specific forward primer (GCAACGTGCTGGTTATTGTGC) and the following re verse primers were used to remove the stop codons from the cDNAs: Gstt2 (TCAGACTCTAGAAGGAATCCTAGCAATTCG), Pcbp3 (CGTCCAATTATGCTCTAGATAAGATCATTGGGAAT), DNAJ (GCAAGGTTCTTCTCTCTAGAGGAGGCAGGGAG), and Pafah1b1 (ATTCGCCCTTATTCT AGAACGGCACTCCCAC). New plasmids were named as follow: pTR2-CB-Gstt2-cmyc/his, pTR2-CB-Pcbp3-cmyc/his, pTR2-CB-DNAJ-cmyc/his, and pTR2-CBPafah1b1-cmyc/his. Double-stranded AAV (dsAAV) or self-complementary AAV (scAAV) proviral vector cassett es were generously provided by Dr. A. Srivastava since scAAV shows higher transduc tion efficiency when compare to unmodified AAV due to bypass of the single st randed viral transcription (Wang et al., 2003). The dsAAV proviral plasmid was modified throu gh removal of the EGFP sequence by first digesting with AgeI and SacI, and in serted with the following linker:

PAGE 29

29 (CCGGTACGCGTTCTAGAAAGCTTGATAT CCCTGCAGGGCGGCCG CGCTAGCGAGCT) containing multiple cloning sites (MCS) to facilitate the subcl oning of cDNAs. Each of the four proviral plasmids generated contains a cytome galovirus (CMV) immediate early enhancer and chicken -actin promoter upstream of a simian virus 40 (SV40) early splice donor/splice acceptor site, one of the modifier genes (Table 5-1), and the SV40 polyadenylation sequence. All four double-stranded, se lf-complementary AAV7 vectors (scAAV7-DnaJb4-c-Myc, scAAV7-GSTT2-c-Myc, scAAV7-Lis1-c-Myc, a nd scAAV7-Pcbp3-c-Myc) were packaged individually, and a 5th plasmid of scAAV7-GFP for direct an d fluorescent reporter activity was also produced, using the calcium phosphate pr ecipitation method. Briefly, human embryonic kidney (HEK) 293T cells were plated in 15cm-diameter plates and cultured until 70-80% confluent. Cells were cotransfected with 15 g of the proviral plasmid, 45 g of pAdeno-helper plasmid, and 15 g of AAV-helper pRC7 plasmid for supply of the rep and cap genes and other necessary helper functions in trans Following 60-72 hr transfec tion, cells were collected and lysed through three cycles of fr ee-thaw treatments. Vectors we re purified through the Benzonase treatment, iodixanol step grad ient centrifugation, and HiTrap Q HP columns (GE Healthcare Life Sciences). Titers or genome numbers of th e viral vectors were determined through DNA slotblot analysis. Western Blot For determination of transgene expression, a ll four of the plasmids were tested for expression after cloning into the proviral vector plasmid. Four ug of each plasmid was used to transfect 90-95% confluent HEK T cells (in 6-we ll plate) using Lipofectamine 2000 according to protocol and collected after 72hr. For collection of transfected cells, 1ml of dPBS was put into each well and cells were scraped off with cel l scrapers and spun down for 3min. at approx.

PAGE 30

30 3000g. RIPA lysis buffer (250ul, UpState Chemical s/Chemicon) was used to lyse each sample of cells, followed by addition of a mixture of 950ul of lamille buffer combined with 50ul of 2mercaptoethanol into the lysates in 2:1 ratio (i .e. 50ul of cells in lysi s buffer and 100ul of the mixture) for each sample, and boiled in hot wate r for approx. 5 min. Lysates were loaded into the precast Tris-HCl gel (Bio-rad) and ran for 45-1hr in running buffer. The gel was transferred to a nitrocellulose membrane for 30 min in cold transfer buffer and then placed into blocking solution (5% dry milk into 50ml PBSt) for an hour at room temperature followed by primary antibody (anti-cMyc, Sigma) incubation overnight at 4oC. After washing in PBSt two times, the membrane was incubated with horseradish pero xidase-conjugated antirabbit secondary antibody for 30 min at room temperature. Protein was visualized by an enhanced chemiluminescence (ECL) plus kit (GE Healthcare) detection system following the manufacturers instructions. Murine Bone Marrow Isolation and Sorting for Sca1+, c-Kit+, LinPopulations Donor cells were harvested from 8-12 week-old male transgenic GFP+ mice (strain #C57BL/6-Tg(UBC-GFP)30Scha/J, stock #004353) purchased from the Jackson Laboratory. Bone marrow was flushed out of the femurs and tibias of donor GFP+ mice with a 30G needle and a 3cc syringe with PBS and into a dish co ntaining PBS. Bone marrow was dissociated into single cell suspension using a 25G needle. Cells were filtered through a nyl on filter, triturated with 5ml pippets, and counted for a final volume of 2x106 cells/100 l in PBS with 10% FBS. Primary antibodies were added for 30 min at 4oC at 1:200 of APC-conj ugated rat CD117/c-kit, and PE-Cy7-conjugated rat Sca-1/Ly-6 (stem ce ll antigen), 1:10 PE-conjugated Lineage (Lin) cocktail (rat CD4, CD5, CD8a, CD11b, B220, Gr-1, Ter-119, and hamster CD3e) (BD Biosciences). GFP+, Sca-1+, c-kit+, Lin(SKL) cells were sorted into Iscoves modified Dulbeccos medium (IMDM) (Gibco) using a fluorescent-activated cell sorter.

PAGE 31

31 Recombinant AAV7 Transduction of HSCs and Bone Marrow Transplants SKL cells were infected with an rAAV 7 vector at 1 x 105 viral particles/cell for two hours at 37oC in serum-free IMDM and swirled every 15 min for even distribution. Cells were washed with PBS and used directly for transp lantation. Recipient mice were 8-12 week-old female spinocerebellar ataxia 1 mice (Watase et al., 2001; ki nd gift from Dr. H.Y. Zoghbi) lethally irradiated 48 hrs prior to transplant ation with one dose of 950 cGy from a cesium-137 source. 5x103 vector transduced SKL ce lls, along with a 9,000 Sca-1-, c-kit-, Lin+ radioprotective dose suspended in 150 l of total volume in PBS, were injected into the right retroorbital sinus of lethally irradiated mice. Mice were provided with wate r treated with Baytril antibiotics for two weeks post tr ansplantation. Information on th e total number and genotype of the mice that received bone marrow tr ansplant is provided in Table 5-2. Bone Marrow Culture Whole bone marrow from both UBC-GFP and C 57/BL6 mice were isolated as described above and cultured in vitro to test for expression of AAV7 plasmids. Following trituration into single cell suspension, BMDCs were separated into 2x106/ml of culture media and placed into a 6-well flat bottom culture plate (Midsci) containing a total of 2mls/well (4x106of cells/well). The culture media consisted of IMDM with 20ng of IL 3 (R&D Systems), 20ng of IL 6 (R & D Systems), 50ng of stem cell factor (SCF) (R & D Systems), 2mM Glutamax, and 100U of 10,000U/ml, 10mg/ml penicillin-streptomycin (Invitr ogen) in 1ml of media. UBC-GFP BMDCs served as fluorescent control cells while C 57/BL6 cells received 100 MOI of scAAV7-GFP or one of the plasmids containing the modifier ge ne along with the c-Myc/ his reporter tag. Cells were cultured in 37oC incubator during and afte r viral infection. Transduction efficiency was determined by direct visualization of GFP e xpression following 72 hrs in culture or through FACS analysis of GFP and intracellular c-Myc expression.

PAGE 32

32 Flow Cytometric Analysis of Transgen e Expression within Peripheral Blood Peripheral blood obtained by tail vein punc ture was examined at one month post transplantation and at the end of the surv ival period for multilineage and GFP expression analysis. Nucleated cells (buffy coat) were separated through fi coll density gradient centrifugation and examined for expression of GFP along with B220 for presence of B lymphocytes, CD11b for macrophages, or CD4 for T lymphocytes by FACS. Data were evaluated using the CellquestTM software. Immunohistochemical Analysis of BMDCs in Cerebellum Following Bone Marrow Transplants Female heterozygous Sca1 mice were s acrificed between 12 wk and 40 wk post transplantation and perfused tr anscardially with 4% paraform aldehyde in 0.1M PBS. Brains were removed, postfixed overnight in perfusate, and transferred to 30% sucrose for another 24 hrs before sectioning through the sag ittal plane at a thickness of 14 m using a frozen microtome (Leica). Sections were processed as follows for the different antibodies: Calbindin and CD11b : Sections were incubated in PBS supplemented with 10% FBS and 0.1% Triton X-100. Primary antibodies of GFP (chick en polyclonal 1:1000, Aves Labs) and Calbindin (mouse monoclonal 1:2000, Sigma), or G FP and CD11b (mouse polyclonal 1:100, BD Biosciences) were added for overnight at 4oC. After washing the sections three times in PBSt, Cy3 goat anti-mouse (1:500, Jackson Labs) and FITC goat anti-chicken (1:1000, Aves Labs) were applied for 2 hours at room temperature. Ataxin-1 : Procedures were modified from Skinner et al. (1997). Briefly, sections were mounted on plus-charge slides and microwaved in 0.01M urea for antigen re trieval. Series of peroxidase, serum, avidin, and biotin blocks (Vector La boratories) followed according to Vectastain manufacturers instruct ions, and ataxin-1 11NQ (rabbit, ki nd gift from Dr. HY Zoghbi) at a

PAGE 33

33 dilution of 1:1000 was added for 48 hours at 4oC. Biotinylated anti-rabbit (goat, 1:150) was added for 30 min and followed by DAB development using Elite ABC reagent kit (Vector Laboratories) and DAB kit (Vec tor Laboratories). GFP (chick en polyclonal 1:500, Abcam) was added overnight at 4oC for dual staining. Alexa fluor 488 anti-chicken (donkey, 1:500, Invitrogen) was used the next day and in cubated for 45 min at room temperature. c-Myc : Sections were mounted on plus-charge slid es and air dried overnight. Slides were subjected to high heat retrieva l in Dako target retrieval solu tion (pH9, Dako) for 20 min and cooled slowly in room temperature for anothe r 20 min. Primary antibodies of c-Myc (rabbit polyclonal 1:100, Santa Cruz Bi otechnology) and GFP (chicken polyclonal 1:500, Abcam) were added overnight at 4oC. Alexa Fluor 594 anti-rabbit ( donkey, 1:500, Invitrogen) and Alexa Fluor 488 anti-chicken (donkey, 1: 500, Invitrogen) were then applied for 45 min at room temperature the next day. Fluorescent in Situ Hybridization Analysis of GFP+ Purkinje Heterokaryons Sagittal sections of cerebella post bone marrow transplant s were processed for GFP and Calbindin labeling using standard immunohistochemistry procedures as described above. The nuclei were counterstained with DAPI and the staining patterns were extensively photodocumented with 10X, 20X, and 40X objectives to relocate the exac t position of the GFP+ Purkinje neurons following FISH when the fluor escent signals were abolished. Mouse X (FITCconjugated) and Y (cy3-conjugated) chromosome probes (Open Biosystems) were used to detect the presence of donor derived Y chromosome. Briefly, after slides were photodocumented for immunofluorescent expressions, they were air dried at room temp erature overnight. Slides were next incubated for 30 min in 0.2N HCl, retrieved in 1M NaSCN in 85oC for 30 min, followed by digestion in pepsin diluted in prewarmed 0.9% NaCl (pH 2.), and hybridiz ed with chromosome probes for 10 min at 62oC, followed by 48 hours of further hybridization at 37oC. Cells were

PAGE 34

34 washed first in 1:1 formamide:2X SSC (Sodium Ch loride Sodium Citrate) then 2X SSC and 4X SSC with 0.1% NP40 at 46oC following hybridization. Sections were covered with mounting media containing DAPI (Vector Laboratories) an d glass coverslips (Fisher Scientific).

PAGE 35

35 CHAPTER 3 TRANSPLANTATION OF EMBRYONIC AND A DULT NEURAL STEM CELLS IN THE GRANULOPRIVAL CEREBELLUM OF THE WEAVER MUTANT MOUSE Introduction Restoring tissue integrity and function following injury or neurological disease remains challenging due to the limited regenerative potentia l of the central nervous system (CNS). Recent advances in therapeutic strategies include e nhancing recruitment of newly generated endogenous neurons to a lesioned or degenerating area and transplantation of exogenously generated stem/progenitor cells to replace at -risk or lost cells (Daniela et al., 2007; Steindler and Pincus, 2002; Rossi and Cattaneo, 2002). Ne ural stem/progenitor cell tran splantation has been studied extensively with cells isolated and expanded from neurogenic regions within the CNS: the subependymal zone (SEZ) (Loi s and Alvarez-Buylla, 1994) or the dentate gyrus of the hippocampus (Kaplan and Hinds, 1977; Kirschenba um et al., 1994; Kuhn et al., 1996; Kornack and Rakic, 1999). Another region that has not been widely viewed as a source of multipotent cells, but nonetheless retains transiently active cell proliferation, is the postnatal cerebellum. The cerebellar cortex continues to gene rate granule cells and forms the transient external granule cell layer up to postnatal day 15 (Hatten et al., 1997), and we and ot her groups have shown that cells derived from this area are capable of forming multipotent proliferative clones, or neurospheres, with the ability to form all three primar y CNS cell types: neurons, astrocytes, and oligodendrocytes (Laywell et al., 2000; Laywell et al., 2005; Lee et al., 2005; Klein et al., 2005). These cerebellar-derived neurogenic cells are glia l fibrillary acidic protein (GFAP)-expressing astrocytes similar to the stem cells derived from the SEZ areas surrounding the lateral ventricle, and we refer to both the forebrain and cereb ellar clonogenic cells as multipotent astrocytic stem/progenitor cells (MASCs). MASCs re present potential therapeutic candidates for replacement and repair following ce ll loss in the CNS resulting from injury or disease as they

PAGE 36

36 have the ability to respond to intrinsic environm ental cues by anatomically integrating into a host brain and differentiating into neurons and astrocytes when transplant ed into the lateral ventricles of normal adult mice (Zheng et al., 2006). In these previous studies, engraftment in the hindbrain was less robust following in traventricular transplantation, possibly due to the extensive distance and other factors that could hinder the migration and in tegration of the MASCs. Enhanced green fluorescent protein (EGFP )-expressing ESNPs (embryonic stem cellderived neural precursor) have also been well ch aracterized by our lab and others, with previous studies showing the ability of these cells to acquire multiple neuronal phenotypes and to functionally integrate into the developing brain both in vitro and in v i vo (Goetz et al., 2006; Wernig et al, 2004; Benninger et al., 2003; Brstle et al., 1997; Brstle et al., 1999; Okabe et al., 1996). Following transplantation in to the lateral ventricle, a larg e percentage of the ESNPs were found to differentiate into glutamatergic neurons despite the failure to acquire region-specific identities, and they might be predisposed to resp ond to intrinsic cues when placed in an optimal environment. The present study was designed as a comparativ e analysis to examine the potential of somatic tissue-derived MASCs versus embryonic st em cell-derived neurons to potentially thrive within a CNS environment that might be conduciv e for such integration using the neurological mutant mouse model, weaver (gene symbol wv ). Weaver mice have been well characterized for cerebellar development studies due to the histopa thological hallmark of severe granule cell loss, leading to a granuloprival cere bellum, that results in reduced brain size (Sidman et al., 1965; Rakic and Sidman, 1973; Smeyne and Goldowitz, 1989) as well as deficits within the Purkinje cell population (Eisenman et al., 1998; Herrup and Trenk, 1987; Smeyne and Goldowitz, 1990; Bayer et al., 1996), dopaminergic neurons in the s ubstantia nigra (Triarho u et al., 1988; Roffler-

PAGE 37

37 Tarlov et al., 1996), and the deep cerebellar nuc lei (Bayer et al., 1996; Maricich et al., 1997; Mart et al., 2001). Clinical and pathological features are similar to patients suffering from cerebellar ataxia, including instability of gait and tremor of the extremities. These symptoms can be attributed to a single base pair mutation in the gene coding for a Gprotein-coupled, inward rectifying potassium channel of the GIRK2 family (P atil et al., 1995) that is expressed in all cell groups suffering defects in weaver but also expr essed in regions where no damage has occurred or been detected to date (Schein et al., 1998). The severe depletion of the granule interneurons makes weaver mouse an attractive model for st udying and providing comparison of these two different donor populations because it has been shown that the MASC de fault neuron generation program is interneurons (Laywell et al., 2000; Zheng et al., 2006; Scheffler et al., 2005) while the ESNPs have been shown to differentiate largely into glutamatergic neurons (Wernig et al., 2004). There have been many previous transplant ation studies in whic h fetal or embryonic cerebellar cells were transplanted into other neurological mutant mouse models such as the Purkinje cell degeneration ( pcd ) mutant (Triarhou et al., 1996; Tr iarhou et al., 1986; Triarhou et al., 1987; Sotelo and Alvarado-Mallart, 1986, 1987, 1988), including the use of an immortalized neural progenitor cell line (Snyde r et al., 1992) for functional r ecovery or restoration of molecular homeostasis (Snyder et al 1995; Rosario et al., 1997; Li et al., 2006), as well as many other studies (Rossi and Cattaneo; 2002) attempting to replace at-risk neuronal populations, but there has been a paucity of successful cel l integration findings leading up to the in vivo bioassay tested here. That is, here we use a well-charac terized cerebellar neurologi cal mutant mouse with defined cell loss that occurs gradually beginni ng in early postnatal life, as a host for two completely different neural stem/progenitor cell populations. One of the cells studies here, MASCs, represents a potential in digenous source of cerebellar gra nule interneurons (Laywell et

PAGE 38

38 al., 2000; Laywell et al., 2005; Lee et al., 2005; Klein et al., 2005), and the other, ESNPs, is believed to be amongst the most potent of stem cells capable of genera ting numerous types of neural cells (Goetz et al., 2006; Wernig et al, 2004; Benninger et al., 2003; Zh ang et al., 2001; Brstle et al., 1997; Brstle et al., 1999; Okabe et al., 1996). Thus the current study provides insights into the developmental potential, cell fa te choice and differentiation of both MASCs and ESNPs within an injured host CNS environmen t, and for attempting cell replacement following intra-parenchymal transplantation du ring a peak period of cell loss. Cerebellar-Derived MASCs Show Extensive Migration but Limited Differentiation Following Intracerebellar Transpla ntation in Postnatal Weaver Mice Astrocytes derived from postnatal mouse cereb ella have been shown to harbor stem-like characteristics through expression of stem cell mark ers such as nestin, and their ability to give rise to neurons, astrocytes, a nd oligodendrocytes when culture d in neurosphere-like conditions (Fig 3-1, B and C). When cultu red as monolayers, MASCs are pure astrocyte populations that are greater than 95% immunopositive for GFAP with a few CD11b positive microglia mixed in (Fig 3-1A). Cells were collected from astrocyte monolayers and di rectly injected into the right hemisphere of the cerebella of wv/+ wv / wv and +/+ littermates between postnatal day 1-8, with 23 mice injected with MASCs and 28 with ESNPs. Donor cells are distinguished from the host tissue through their expre ssion of GFP, and analysis of cell survival, migration, and integration were done following survival periods ranging from one week to five weeks post transplantation. As early as one week post transplantation, cells ca n be seen to migrate away from the site of injection and to settle in all three primary cerebe llar layers molecular, Pu rkinje, and granule cell layers (Fig 3-2 A, B) -with predilection towards the white matter. No specific migration pattern was observed and the age at which the mice receiv ed the donor cells did not seem to have any major impact based on the range chosen for this study. The majority of cells that survived and

PAGE 39

39 showed active migration seemed to adopt an astrocyte-like morphology with numerous, fine processes, but only some were found to be imm unopositive for the immature glial marker GFAP (Fig 3-2 D). While a small population of MASCs also expressed the neuronal marker -III tubulin (Fig 3-2 C), most cells remained imma ture without antigenic expression for mature neuronal cell markers such as NeuN or for cereb ellar specific markers such as MATH-1, RU49, and GABAA 6. Overall, transplanted cells survived a nd migrated in all three host environments consisting of +/+, wv /+ and wv/wv cerebella, but cells found to e xpress the antigenic profiles mentioned above seemed to be more pr evalent (15 out of 23 animals) in the wv /+ and wv/wv transplants as opposed to the wildtype littermates (8 out of 23). Embryonic Stem-Cell Derived Neural Precursor s Exhibit Multiple Neuronal Morphologies and Phenotypes upon Transplantation wi thin the Postnatal Weaver Cerebellum ESNPs carry the EGFP reporter gene behind th e tau promoter and EGFP fluorescence was shown to be restricted to neuronal progeny through in vitro characterization (Wernig et al., 2004). Specifically, after one day in culture, GFP positive cells were found to be immunopositive for -III tubulin (Fig 3-3 B) but did not colocalize with GFAP-expressing cells (Fig 3-3 A). The same trend was observed after 4 days in culture where greater than 95% of the cells became both GFP and -III tubulin immunopositive (Fig 3-3 C). As seen with the MASCs, ESNPs exhibited the ability to survive, migrate, and differentiate posttransplantation in the weaver mouse model. However, while ESNPs seemed to show a greater affinity towards each other and had the tendency to re -aggregate into clusters and rema ined at the site of injection, cells remained viable and appeared to exhibit the same survival trend as the MASCs. Small groups of cells did have the ability to migrat e and were capable of moving away from the injection site into all three cerebellar layers once out of the cell clusters (Fig 3-4 A). The appearance of these cells were also vastly diffe rent from the MASCs, with more varied cell

PAGE 40

40 morphologies with neuronal char acteristics, including long proce sses and small cell bodies (Fig 3-4 B, C). For example, bipolar cells resemb ling young migratory neurons, and cells with more complex, somatic-neuritic morphologies including ra mified processes that gave rise to thin varicose axons were observed. Immunohistochemi cal analysis showed th at the majority of ESNPs expressed both neuronal cell markers -III tubulin (Fig 3-4 D) and NeuN (Fig 3-4 E), but still seemed to lack region-specific gene/mar ker expression. However, a small population of ESNPs was immunolabeled for the excitatory neur otransmitter glutamate (Fig 3-4 F) which is expressed exclusively by granul e cells within the cerebellum. Donor cells exhibiting the antigenic profile mentioned above were found in 20 wv /+ and wv/wv animals and in only eight +/+ littermates out of 28 succe ssful transplants. Embryonic Stem-Cell Derived Neural Precursor Transplantation Gives Rise to Neoplasia ESNPs were dissociated into single cell susp ensions at the time of transplantation but retained the ability to re-aggregate into small to medium sized cell clusters within the host environment as mentioned above. More often than not, these clusters remained in place and did not seem to invade the host tissue. However, in four out of 51 animals with cells successfully transplanted inside the cere bellum, neoplastic-like formati ons were found four weeks posttransplantation within the injected hemisphere while the contralateral he misphere was unaffected (Fig 3-5 A). This was observed only in animals injected with ESNPs but not with the MASCs transplants, and the EGFP positive cells could be found bordering the transformed host tissue or in the center of the cell mass within the cerebellu m (Fig 3-5 D, E). In one case, a solid tumorlike sphere was formed and believed to have its own source of blood and nutrient supply, being that it was separated from the rest of the underl ying parenchyma. In other cases, the host tissue seemed to undergo the process of transformation which caused the injected hemisphere to swell and appear enlarged when compared to the cont ralateral control side (a rrow, Fig 3-5 A). Many

PAGE 41

41 cells within the tumor-like structures were immunopositive for -III tubulin (Fig 3-5 D, E) and SSEA-1 (inset, Fig 3-5 D) during the early stages of transforma tion. Hematoxylin and eosin (H & E) staining showed at least one tumor to be a teratoma at its end stage, with the presence of cells containing lineages outside of the CNS, such as skeletal muscle fibers (Fig 3-5 B) and hair follicles (Fig 3-5 C). Overall, three wv /+ and one +/+ mice out of 28 transplants had neoplastic formations that appeared to be teratomas. It is noteworthy that these ne oplasias occurred despite what appeared to be homogeneous ESNP starting cu ltures that served as sources for these weaver cerebellar transplants.

PAGE 42

42 Figure 3-1. Cerebellar-derived MASCs have the ab ility to differentiate into neurons, astrocytes, and oligodendrocytes in vitro. A) MASC s derived from neon atal cerebellum and cultured as monolayers contain >95% GFAP-e xpressing astrocytes (green). B) When cultured as neurospheres, MASCs are cap able of differentiating into neurons expressing neuronal markers including -III tubulin (red) and NeuN (green), and in C) oligodendrocytes expressing markers su ch as CNPase (red) in C. (blue=DAPI)

PAGE 43

43 Figure 3-2. Cerebellar-derived MASCs are able to survive, migrate, and differentiate upon transplantation into the weaver cerebellum. A) Confocal images show donor-derived GFP+ cerebellar-derived MASCs have su rvived and migrated away from the injection site (on top of the molecular layer) within the cerebellum. B) Higher magnification micrograph of the same field as in A shows extended arborizations of the grafted cells with astrocyt e-like morphologies within the granule cell layer. C) A small population of the GFP+ donor cells display neuronal phenotypes through expression of the immatu re neuronal marker -III tubulin (red), D) a subpopulation of MASCs also are immunopositive for the astr ocyte marker GFAP (red). (GL=granule layer, ML=molecular layer)

PAGE 44

44 Figure 3-3. Tau-EGFP-ESNP cells express neuronal fate in cultu re. A) Following one day in culture, GFP+ ESNPs are not immunopositive for GFAP (red), B) but do colocolize with neuronal marker -III tubulin (red) showing co mmitment onto the neuronal lineage. C) After four days in culture, ESNP have pr oliferated into dense cell population and more than 95% of the ES NPs are immunolabeled for both GFP and III tubulin (red). Figure 3-4. Grafted ESNPs have the ability to su rvive, migrate, and differentiate into mature phenotypes following transplantation into th e weaver mouse model. A) Confocal microscopy shows that GFP+ ESNPs (green) can re-aggregate into cell clusters but retain the ability to migrate away from the aggregation. B) Higher magnification image show that some of these cells display mature neuronal phenotypes with bifurcated axons (arrow), or C) possess ramified processes with long, thin, and varicosed axon (arrow). D) A small populat ion of the donor cells express the pan neuronal marker -III tubulin (red), E) ESNPs also differentiate into cells immunopositive for the mature neuronal marker NeuN (red), and F) neurotransmitter

PAGE 45

45 glutamate (red) which is expressed exclus ively by the granuel cells within the cerebellum. (GL=granule layer, ML=molecular layer)

PAGE 46

46 Figure 3-5. Embryonic stem cellderived neural precursors are capable of transforming host tissue and give rise to tumor-like spheres. A) Montage of images from H& E staining shows the transplanted hemisphere being disrupted by a protruding cell mass (arrow) within the parenchyma but not on the contrala teral side. B) Nonneural lineages can be found within the teratoma-like neoplasia inside the cerebellum such as hair follicles, and in (C) skeletal muscle fibers. D) GFP+ ESNPs (green) can be seen within the transformed tissue and immunopos itive for the marker SSEA-1 (red, inset). E) Higher magnification of GFP+ ESNPs inside the neoplasia show they also express -III tubulin as with the starting ESNP population used for transplantation.

PAGE 47

47 CHAPTER 4 FUSION OF NEURAL STEM CELLS IN CULTURE Introduction Stem cells have been widely recognized for their therapeutic potenti al as a source of specific cell types needed for tissue, includi ng central nervous system (CNS) reconstitution following injury or disease. Among the various types of stem cells, embryonic stem (ES) cells have been perceived to hold the most promise while adult stem cells are generally thought to be more restricted in terms of de velopmental potential. However, such views were called into question after it was shown that adult hematopoie tic stem cells are capable of crossing lineage boundaries by differentiating in to liver, intestine, h eart and skeletal muscle cells (Ferrari, et al., 1998, Gussoni, et al., 1999, Jackson, et al., 1999, Krause, et al., 2001, Lagasse, et al., 2000, Orlic, et al., 2001, Petersen, et al ., 1999) while neural stem cells might be able to adopt a hematopoietic fate in vivo (Bjornson, et al., 1999) Such unexpected stem cell plasticity generated great excitement in light of the ethica l controversies associated with the study and use of ES cells, but it also raised questions regarding the mechanistic nature of such developmental phenotypic fluidity (Laywell, et al., 2005) Lineage switching was thought to result from the process of trans-differentiation, but it also could involve the recently discovered phenomenon of stem cell fusion, of the type first demonstrated in vitro by Terada et al. a nd Ying et al. (2002). In these two studies, co-culture of ES cells with either bone marro w derived cells or neural stem cells yielded hybrid populations that expressed both the donor cell markers and ES cell-like properties that could have led to the conclu sion that trans-differe ntiation was involved. However, upon closer examination, the hybrid cells were shown to be pol yploid, suggesting that the hybrid phenotype resulted from cell fusion.

PAGE 48

48 In the present study, we examined the possibili ty that cell fusion is a naturally occurring event not only between two different stem cells types, as previously demonstrated, but also between cells of the same lineage includi ng young neurons and astrocytes found within neurosphere cultures of differentiating neural st em cells. We show th at multipotent neurogenic astrocytes derived from either the SVZ or the ce rebellar cortex of postn atal mice can contain abnormal sex chromosome counts when examined using FISH. We employed a method based on Cre/lox recombination, a technique that has b een extensively utilized for conditionally turning on or off gene expression, to detect cell fusion between two mouse lines. Astrocytes harvested from SVZ or cerebellum of mice ubiquitously ex pressing Cre recombinase, under the control of a cytomegalovirus (CMV) promoter, were co-cultured with cells obtained from the conditional Cre reporter mouse line gt(Rosa)26Sor tm1Sor/J. This reporter mouse contains the LacZ reporter gene that is expressed only afte r the Cre-mediated excision of an upstream lox-P flanked (floxed) stop cassette, and cell fusion is de tected through the expression of -galactosidase. The breakdown of physical ba rriers between cells could be attributed to a number of factors, including the presence of highly fus ogenic macrophages that have been known to contribute to the formation of multinucleated gian t cells (Terada, et al., 2002). We therefore looked at the potential role of CNS macrophages, e.g. microglia, in cell fusion. In addition, microglia are derived from the myeloid lineage which has been implicated in recent literature to possess the ability to fuse with CNS neurons (Alv arez-Dolado, et al., 2003). Cultured astrocytes were studied for ploidy using combined imm unocharacterization with CD11b, a surface marker strongly expressed by macrophages, and FISH sex chromosome counts; in order to rule out the downregulation of microglia-associ ated surface proteins after a fusion event, we also examined

PAGE 49

49 microglia-free cultures derived from a transgen ic mouse lacking the tr anscription factor PU.1, which is needed to produce myeloid pr ogenitors (Scott, et al., 1994). In all, the experiments performed here should add considerable insight into the plasticity of CNS stem/progenitor cells. Whether or not fusi on is prevalent in SVZor cerebellar-derived neurosphere cultures, an understa nding of such phenomena is required before exploiting CNS stem/progenitor cells as therapeutic reagents. Astrocyte Monolayers Contain Cells with Aneuploid Sex Chromosomes Astrocyte monolayers derive d from SVZ have been shown to display neural stem cell attributes, as they can give rise to multipoten t neurospheres (Laywell, et al., 2000). A typical astrocyte monolayer derived from the SVZ is shown to be immunolabeled for the astrocytespecific intermediate filament protein, GFAP (Fig. 4-1 A). Similar cultures derived from both male and female mice were processed for FISH using specific, labeled probes against mouse X and Y chromosomes. The X chromosome probe is conjugated to FITC while the Y chromosome probe is conjugated to cy3 which provided red and green signals that can be seen clearly within each nucleus. While most cells display a normal di ploid state, a number of cells harbor extra sex chromosomes (Fig. 4-1 B). To determine whethe r or not cells containi ng abnormal numbers of chromosomes are the same cells with GFAP ex pression, neurospheres were plated onto poly-Lornithine/laminin coated glass c overslips and cells were allowed to differentiate and to migrate out from the spheres for 3-5 days. In Fig. 4-1 C and D, three cells are visible that robustly express GFAP, and the same three cells were r ecognized based on nuclear patterns. While two of the cells are seen to contain the normal nu mber of sex chromosomes with one X and one Y each, the third cell clearly posse sses two X chromosomes and one Y chromosome (Fig. 4-1 D, asterisk). Such examples indicate that the cultured astrocytes may acquire an abnormal number of chromosomes through cell fusion. It is possi ble that cell fusion is induced due to close

PAGE 50

50 proximity of the cells within high density cell cultures, but quantifica tion of the number of aneuploid cells found within both high and low de nsity culture conditions suggest otherwise. Using 40X magnification and 16 random field sa mples for each coverslip, 539 cells out of 3717 total number of cells (14.5%) su rveyed were aneuploid in non-confluent culture conditions while 1621 cells out of 9991 cells counted (16.2%) were aneuploid in confluent conditions. This further indicates that spontaneous cell fusion migh t take place even in the absence of selective pressures such as space limitation using the current culture paradigm. Analysis of Cell-Cell Fusion Usin g a Cre/lox Recombination System To test for cell fusion and to assess the po ssibility of post-fusion chromosomal resolution (Wang, et al., 2003), we utilized a Cre/lox recomb ination system. Cells from sex mismatched Cre-recombinase expressing mice and the gt(Rosa)26Sor tm1Sor/J mouse line with a floxed stop cassette upstream of the LacZ gene, were first cultured as astrocyte monolayers individually for one passage, and then combined together as co-c ultures at a 1:1 ratio. These co-cultured cells, along with individual cultures of gt(Rosa)26Sor/J and Cre-expr essing cells as positive and negative controls respectively, were th en stained for the LacZ gene product, -galactosidase ( gal). -gal expression is detected only if Cre recombinase is pr esent in the nucleus of a gt(Rosa)26Sor tm1Sor/J cell and successfully cleaves the floxed stop cassette, indicating fusion among one or more cells in the culture. A small number of cells that migrated out from neurospheres were found to be -gal positive, as indicated by blue X-gal reaction product (Fig. 4-2). The vast majority of cells, however, do not express detectable -galactosidase, indicating that there is a low rate of cell fusion occurring in this culture paradigm.

PAGE 51

51 Cells Immunopositive for CD 11b Retain a Diploid State Spontaneous cell fusion is a process that c ould be attributed to the involvement of microglia, resident CNS macrophages that are pr evalent within primary cell cultures. Using a combination of antibodies against CD11b-a pa rt of the CD11b/CD18 heterodimer (Mac-1) expressed by macrophages in mice-, -III tubulin, a neuron-specifi c intermediate filament protein, and GFAP (for refere nce to these phenotypic markers, see Laywell, et al, 2000) differentiating spheres generated from astrocyt e monolayers derived fr om SVZ and cerebellum of postnatal day 1-10 C57/BL6 mice can be seen to contain neurons, astrocytes, and microglia (Fig. 4-3 A). It is plausible that cells c ontaining abnormal numbers of sex chromosomes are microglia that have engulfed nearby astr ocytes, so immunolabeling with CD11b and in situ hybridization were needed to find out whether or not cells possessing microglial antigenic profiles are the same cells found to contain aneupl oid nuclei. In Fig. 4-3 B, a group of six cells can be seen that are immunopositive for CD11b, but all were observed to be diploid by FISH with X and Y sex chromosome probes (Fig. 4-3 C) Overall, only 5 out of 65 cells that were identified to be microglia were found to cont ain more than two chromosomes. These data suggest that microglia are not th e instigators of cell fusion leadi ng to aneuploidy in this culture paradigm. Cultures Derived From PU.1 KnockOut Mice Contain Aneuploid Cells To further confirm the lack of a role for microglia in cell fusion, neurospheres were generated from a mouse line that lacks PU.1, a myel oid specific Ets family transcription factor essential for the formation of macrophages and other myeloid progenitors (Scott, et al., 1994, Walton, et al., 2000). As expected, immunolabeli ng with anti-CD11b rev ealed the absence of microglia in spheres derived from the knockout mice (Fig. 4-4 C). In contrast, wildtype littermates revealed a robust microglial presen ce (Fig. 4-4 A). FI SH analysis of sex

PAGE 52

52 chromosomes, however, showed the ratio of ab errant chromosome counts to be comparable between the mutant and wildtype cultures (Fig. 4-4 B, D), st rongly suggesting that microglial participation is not necessary for chromosome aneuploidy to occur.

PAGE 53

53 Figure 4-1. Astrocyte monolayer s contain cells with polyploid sex chromosomes. A) an astrocyte monolayer derived from the SVZ is shown to consist mostly of cells immunopositive for GFAP (green). B) chromosome painting specific for the mouse X-chromosome (green) and Y-chromosome (red) reveals cells with abnormal chromosome counts (arrows) within the astrocyte monolayer culture. C) high magnification photomicrograph shows a gr oup of cells immunopositive for GFAP (green) before chromosome painting, and D) the same group of cells as seen in C are shown after chromosome painting. Aste risks indicate corres ponding cell that is immunolabeled for GFAP (C) and co ntains 3 sex chromosomes (D).

PAGE 54

54 Figure 4-2. Cre/lox recombina tion system shows neurospheres derived from co-cultures of 2 different mouse lines contain cells positive for -gal expression, indicating occurrence of fusion. The neurosphere is blue as a result of presumed X-gal retention due to thickness of the sphere. Asterisk shows an example of -gal positive cell following X-gal staining. The same cell is seen at higher magnification in insert.

PAGE 55

55 Figure 4-3. Cells immunopositive for the microglial marker, CD11b, retain diploid states. A) an example of a cerebellar-derived neuros phere shows the presence of microglia, neurons, and astrocytes within the culture after immunolabeling for CD11b (green), -III tubulin (red), and GFAP (blue). B) a high magnifi cation photomicrograph shows cells immunopositive for CD11b (red) before chromosome painting. C) same group of cells are seen after chromosome painting, and shown to be diploid. Figure 4-4. Neurospheres derive d from PU.1 wildtype and mutant mice were immunolabeled with CD11b and counterstained with DAPI. A) are found within the wildtype culture (green), B) Chromosome painting reveals that the cultures contain cells that are aneuploid (arrows). C) no microglia are found in the PU.1 mutant culture (red), but

PAGE 56

56 in D) chromosome painting reveals that th e culture contained approximately the same percentage of cells that are aneuploid (arro ws) as in wildtype culture seen in B.

PAGE 57

57 CHAPTER 5 A PROOF OF PRINCIPLE FOR COMBINING STEM CELL FUSION AND GENE THERAPY AS TREATMENT FOR SPINOCEREBELLAR ATAXIA 1 Introduction Studies have shown that adult stem/progenito r cells possess broad differentiation potential that can be attributed to cell-cell fusion in addition to the widely accepted process of transdifferentiation (Wang et al., 2003; Terada et al., 2002; Ying et al., 2002 ; Chen et al., 2006). Bone marrow derived cells (BMDCs) in particular show evidence of in vivo fusion with somatic cells to become atypical lineages of liver, intestin e, heart, skeletal muscle and Purkinje neurons (Alvarez-Dolado et al., 2003; Weimann et al., 2003b; Krause et al., 2001; Orlic et al., 2001; Lagasse et al., 2000; Gussoni et al., 1999; Jackson et al., 1999; Pe tersen et al., 1999; Ferrari et al., 1998). These findings s uggest that targeted cell fusion is a mechanism that can be exploited to expand the developmental scope of adult stem cells. Neural stem cells, for instance, have garnered much research interest to be used as donor populations for repl acement of at-risk cell types within many of th e neurodegenerative diseases, but ha ve not shown the capability of differentiating into all th e cell types within the complex centr al nervous system (CNS) as shown in findings from chapter 3 of this study. The lis t of neuronal types that is difficult to generate include specialized Purkinje neurons within the cerebellum that are vulnerable in many movement disorders, and it would be useful to derive neural tissue through different means. Induced plasticity can be exploite d for novel therapeutic strategies such as repair or rescue of dying neurons by providing new genetic materials into the degenerating neuronal populations through heterotypic cell fusion be tween BMDCs and brain cells. One disorder with specific Purkinje neuron atrophy that might benefit from th is system is spinocereb ellar ataxia 1 (SCA1), which is a gain of function polyglutamine rep eat disease that currently has no effective treatments available (Orr and Zoghbi, 2007; Orr and Zoghbi, 2001; Zoghbi and Orr, 2000).

PAGE 58

58 Specifically, SCA1 is an autosomal dominant di sorder caused by expanded glutamine repeats in the ataxin-1 protein. Despite wide expression of the mutant ataxin-1 within the CNS and throughout the rest of the body, selec tive cell death is predominant w ithin the cerebellar Purkinje neurons as well as neurons within the brain stem and the spinal cord, leading to progressive ataxia, dysarthria, dysmetria, nystagmus, and general motor deterioration (Zoghbi and Orr, 1995). The mechanism underlying the pathogenesis has not yet been elucidated, but evidence shows that the degeneration of Purkinje cells ma y be due to protein misf olding and/or impaired protein clearance as a result of the toxic gain of function caused by the glutamine expansion (Cummings et al., 1998; Cummings et al., 1999; Skinner et al ., 2001). Overexpression of chaperones have shown beneficial effects on the disease progression (Cummings et al, 2001), and other genes with the potenti al to modify or suppress SCA1 neuropathology have also been identified through a genetic screen using a Drosophila SCA1 model (Fernandez-Funez et al., 2000). The current study set out to test the c oncept of using BMDCs as non-invasive delivery vehicles to distribute potential neuroprotective or disease-modifying genes and factors, through cellular fusion, into the degene rating Purkinje neurons of a Sca1 knock-in mouse carrying 154 polyglutamine repeats (Watase et al., 2002) as a novel therapeutic treatment (Fig 5-1). The BMDCs are first genetically modified by ad eno-associated virus (AAV) which is a nonpathogenic human parvovirus that has shown great potential for use in ge ne transfer and gene therapy (Srivastava, 2005; Berns et al., 1996; Muzycaka et al. 1992). AAV serotype 2 (AAV2) in particular has the ability to transd uce a wide range of cells and tissues in vitro and in vivo (Snyder et al., 1997; Xiao et al., 199 6; Flotte et al., 1993) and is cu rrently in phase I/II clinical studies for an array of diseases (Snyder et al., 2005; Flot te et al., 2004; Kay et al., 2000; Flotte et al., 1996). Other serotypes with slight variation in structure and function have since been

PAGE 59

59 developed and AAV serotype 7 was found to be capable of transducing Sca-1+, c-kit+, Linbone marrow cells/hematopoietic stem cells (HSCs) most efficiently (Maina et al., 2008). In addition, recent improvement in the vector design has allowed the use of a double stranded vector, or selfcomplementary vector (scAAV), in this study which increases the transduction efficiency through bypassing the need for vira l second-strand DNA synthesis (Mai na et al., 2008; Wu et al., 2007; Wang et al., 2003). We demonstrate that the transgenes carried by the BMDCs/HSCs are stably expressed within the cerebellum and exert potentially atte nuating effects through observations on the nuclear in clusions associated with the disease. This is proof of concept that a combination of cell-cell fusion and gene therap y may be a potential re gimen for restoring the homeostatic balance within neurodegenerative diseases. Adeno-Associated Viral Plasmid Design and Expression of the Transgenes in HEK 293T Cells Recent advances show that the combination of using AAV serotype 7 capsid and a doublestranded recombinant AAV genome gi ve rise to viral vectors with high transduction efficiency on Sca-1+, c-kit+, Lin(SKL) population of bone marrow cells (Maina et al., 2008; Han et al., 2008). Therefore, transgenes of interest were packaged into scAAV7 vectors for maximal transduction of the SKL cells which have been s hown to be hematopoietic stem cells (Krause et al., 2001; Osawa et al, 1996; Spangrude et al., 19 88; Muller-Sieburg et al., 1986). Selection of the transgenes with potential neuroprotective effects was based on a previous study by Fernandez-Funez and colleagues (2000) in whic h four genes with at tenuating effects on the SCA1 manifestations were iden tified in a genetic screen usin g a SCA1 Drosophila model. Murine homologs of the four modifier genes were determined to be DnaJ subfamily B member 4 protein (DnaJb4), Lisencephaly-1 (Lis1), glutathione S-transferas e theta 2 class (Gstt2), and poly(rc)-binding protein 3 (pcbp3), with functions associated with chaperone activity, neuronal

PAGE 60

60 migration, cellular detoxificat ion, and mRNA stabilization re spectively (Table 5-1). Recombinant AAV genomes were constructed th rough the removal of the AAV coding region flanked by two mutated AAV inverted terminal repeats (ITRs) and repl aced with genes of interest along with the c-Myc/hi s reporter sequence for detecti on (Fig 5-2 A). Expression of transgenes following cloning into the proviral expression cassette was tested through western blot probed against the c-Myc/his tag or against the specific Lis1 gene within the plasmid (Fig 52 B). rKiK3 was used as positive control for cMyc specificity since that was the original plasmid in which the cMyc/his reporter sequence was obtained from (Raisl er et al., 2002), and all four genes were expressed and detected with th e correct protein size. For detection of viral transduction, whole bone marrow was cultured in 37oC in vitro and expression of GFP through infection with scAAV7-GFP viral vector can be directly visualized through fluorescent microscopy following 72 hours in culture. Approxima tely 40% of the cells appeared to express GFP. GFP and intracellular c-Myc expression can al so be detected through FACS, but at a much lower percentage of 2-4% as a result of the di fficulty in detecting intracellular signal and the damaging effect of processing cultured bone marrow cells through the cell sorter. Donor Labeled Purkinje Heterokaryons are Binucleated and Possess Y Chromosomes Following isolation of the GFP+, Sca-1+, c-kit+, LinHSCs from wildtype male mice through FACS, bone marrow cells were infected with one of the four recombinant scAAV7 vectors. Genetically modified HSCs were imme diately transplanted, th rough retro-orbital sinus injection, into heterozygous Sca1 females that received whole-body irradiation 48 hrs prior to the procedure (Fig 5-1). FACS analysis for GFP ex pression confirmed that all transplanted mice showed robust peripheral blood re constitution (60%-100% of GFP+ cells) at the end of the varied survival periods. Donor labeled GFP+ Purkinje neurons (Fig 5-3 A), which refers to heterokaryons that resulted from cell-cell fu sion between BMDCs/HSCs and Purkinje neurons

PAGE 61

61 from here on, all expressed the Purkinje cell regi on specific marker Calbindin (Fig 5-3 B). These Purkinje heterokaryons were detected in the cerebellum starting around 24 weeks post transplantation as previously reported (Weimann et al., 2003b; Priller et al., 2001). At the beginning of the bone marrow transplant studies, -Actin-GFP mice (stock #003116, Jackson Laboratory) were used as donor animals in wh ich the bone marrow were derived from. FACs analysis of the BMDCs revealed weak expression of the GFP (<50%) and as a consequence, the number of fused events between BMDCs and Purk inje neurons was low. Therefore, in the second half of the bone marrow experiments, a different donor populat ion was derived from UBC-GFP mice that had approximately 99%-100% robust expression of GFP. The number of fused, GFP+ heterokaryons increased and was more eas ily detected. 12 out of 18 mice receiving UBC-GFP donor HSCs had fused Purkinje neurons within the cerebellum and an average of 10 Purkinje neurons was found in each animal. In comparison, only four out of 24 mice receiving -Actin-GFP bone marrow were found to harbor GFP+ heterokaryons, and less than five GFP+ Purkinje neurons were found in each animal. Table 5-2 documents the total number of animals receiving the bone marrow transplant, their genotype as well as which viral vector was used to transduced the BMDCs. The fusion events occurred between healthy Purk inje cells with full dendritic arbors (Fig 53 A) as well as between degenera ting/atrophied Purkinje cells th at had smaller cell bodies and altered dendritic arborizations. GFP+ Purkinje neurons were further analyzed in serial laser confocal optical sections, and s hown to be binucleated (Fig 5-3 C, arrows) with two nuclei that were distinctively different in size and morphology as expected fr om heterotypic cell fusions. To further confirm that the GFP+ Purkinje neurons resulted from fusion between sex-mismatched donor bone marrow cells and host Purkinje neurons, fluorescent in situ hybridization (FISH)

PAGE 62

62 analysis was carried out to show the presence of a Y chromosome within one of the two nuclei found in the GFP+ Purkinje neurons within cerebella of fe male recipient mice. Nuclear patterns, based on DAPI staining before the FISH procedure (Fig 5-3 D, E; arrow and arrow head), were used to relocate the two nuclei (Fig 5-3 F, arro w and arrow head) within the fused cell after the GFP fluorescence was abolished due to the FI SH procedures. Fluorescence-conjugated chromosome probes identified the X chromosomes in green and the Y chromosomes in red (Fig 5-3 F). In the inset of figure 5-3, F, one of the two nuclei (arrow head) was clearly shown to contain the cy3-labeled Y chromoso me, which indicated that the GFP+ Purkinje neuron was involved in a fusion event with the HSC a nd not a product of trans-differentiation. Donor Labeled GFP+ Cells Express Modifier Genes in Vivo with Possible Effects on Nuclear Inclusions Another prevalent donor derive d cell population observed within the recipient cerebella was GFP +, CD11b+ microglia (Fig 5-4 A, B). A small number, approximately 20-30%, of the GFP+ microglia expressed the reporter gene c-Myc (Fig 5-4 C, D) tethered to the modifier genes, which indicated that the viral genome has stab ly integrated and expressed within the host environment. C-Myc expressions were also found in GFP+ Purkinje heterokaryons (Fig 5-4 E, F) which further validated the concept of using bone marrow cells to deliver genes or factors missing within the at-risk neuronal population in SCA1. As expected, c-Myc expressions were observed in the cytoplasm (Fig 5-4 D, F) of the GFP+ cells, which corresponds with the cellular localizations of the four modifier genes. In addition to th e CNS, c-Myc expressions were also detected in the spleens of the transplanted mice, which further confirmed integration and expression of the viral genomes. The transgenes used in this study were found through examination of retinal phenotypes in the Drosophila model of SCA1 where the pathology was di rected to the eye (Fernandez-Funez et

PAGE 63

63 al., 2000). In the current murine model, nuclear in clusions that have been considered to be one of the hallmark neuropathologies of trinucleotide diseases (Ser vadio et al. 1995) were found in the Purkinje neurons and used as a measurem ent of the potential atte nuating effects of the modifier genes. The nuclear inclusions we re immunopositive for ubiquitin and the SCA1 gene product, ataxin-1. The ataxin-1 positive inclusions varied in size and numb er within the Purkinje neurons (Fig 5-5 A, B). Within the cerebellum of this Sca1 mouse model, some Purkinje cells had a single, large nuclear inclusion (Fig 5-5 A, B; arrow heads) while a smaller number were observed to contain two inclusions (Fig 5-5 B, arrow), or multiple inclusions that were much smaller in size (Fig 5-5 A, aste risk). Similar findings were reported by Skinner and colleagues (1997) in another Sca1 study where mutant atax in-1 carrying long glutamine repeats localized within the nuclei of Purkinje ne urons as a single, large inclusion, in contrast from the wildtype ataxin-1 overexpressed in vitro which appeared as smaller, multiple inclusions. We showed the fused GFP+ Purkinje heterokaryons did not contain the single, dense nucl ear inclusions found most prevalent in the Sca1 cerebellum, but inst ead possessed smaller inclusions (Fig 5-5 C, D; arrows) which suggested possible modifying ef fects of the genes overexpressed through the HSCs. Bone Marrow Derived Cells Can Fuse to Other Cell Types within the Cerebellum Previous reports (Alvarez-D olado et al., 2003; Weimann et al., 2003b; Johansson et al., 2008; Mangrassi et al., 2007) found that only Purkinje neurons and microglia were the only bone marrow-associated, labeled cells found within the CNS following in vivo transplantation. Interestingly, a small number of the cells observed within the current paradi gm did not appear to be either Purkinje neurons or microglia, but instead exhibited morphol ogical characteristics resembling interneurons within the molecular la yer (Fig 5-6 A-C, green ) based on morphological assessments. Another donor-labeled, GFP+ cell type we observed possess ed all of the attributes

PAGE 64

64 of unipolar protoplasmic astrocyt es similar in morphology to Berg mann glial cells (Fig 5-6 D) which are closely associated with Purkinje neurons. These cells had somata located near the cell bodies of the Purkinje neurons, and radial fibers that extend toward the pial surface. In addition, these cells were immunopositive for glial fibrillary acidic protein (GFAP) (Fig 5-6 E, F) as well as S100 and found in the correct spa tial orientation as Bergmann g lia within the cerebellar Purkinje and molecular layers. The interneuron cell types presented in Fig 5-6 (A-C) were found in different transplanted mice and were extremel y rare in occurrence (n=1 in three separate animals). However, more than ten putative Berg mann glial cells (Fig 5-6 D-F) were observed in at least four mice throughout differe nt areas of the cerebellum, and thus are not such rare events.

PAGE 65

65 Table 5-1. Modifier Genes P ackaged into scAAV7 Vectors Gene name Functions DnaJb4 Chaperon protein, Heat s hock protein 40 homolog Lis 1 (Lissencephaly 1 protein) alias Platel et-activating factor acetylhydrolase 1B alpha subunit (pafah1b1), Nuclear migration, neuronal differentiation. Gstt2 (Glutathione Stransferase theta class 2) Glutathione transferase, cellu lar detoxification involvement Pcbp3 (poly(rC) binding protein 3) Nucleic acid binding pr otein involved in mRNA stabilization, translational activation and/or silencing. Four murine homologs to the genes found to ha ve suppressive/modifying effects on the disease progression of a Drosophila SCA1 model. Each gene is inserted into a separate AAV proviral expression cassette for a to tal of four scAAV7 vectors. Table 5-2. Bone Marrow Transplant Summary Donor Mice Modifier Gene # of Recipients Donor Cell Type # of Purkinje Heterokaryons # of non-Purkinje GFP+ Cell types -Actin GFP DnaJb4 15 (+/-) 3 (wt) Whole BMDCs 4 0 Gstt2 3 (+/-) HSCs 2 0 Lis 1 3 (+/-) 1 (wt) HSCs 0 0 Pcbp3 0 N/A N/A N/A UBC-GFP DnaJb4 9 (+/-) 1 (wt) HSCs > 10 >10 Gstt2 0 N/A N/A N/A Lis 1 0 N/A N/A N/A Pcbp3 6 (+/-) 2 (wt) HSCs >10 >10 -Actin GFP No virus 3 (+/-) 1 (wt) Whole BMDCs ND ND

PAGE 66

66 donor GFP mouse isolation of BMDC HSCs Sca-1+, c-kit+, LinscAAV7 virus transduction ROS injection Irradiated Sca1 154Q knock-in mice 6-8 wks Figure 5-1. Schematic representation of the experimental paradigm. GFP+ hematopoietic stem cells (HSCs), immunopositive for Sca-1 and c-kit but negative for lineage cocktail, are isolated from male GFP transgenic mice through FACS. HSCs were next transduced with one of the scAAV7 vectors at an MOI of 100 and transplanted into irradiated female Sca1 heterozygous r ecipients through retro-orbital injection.

PAGE 67

67 A. B. Figure 5-2. Plasmid design and proviral cassette expression in HEK 293T cells. A) Each of the four double stranded AAV7 viral vector contai ns the inverted terminal repeats (ITR) at both ends, the CMV enhancer and chicken -actin promoter (CB promoter), cDNA of the modifier gene tethered to a c-Myc/ his tag, and the SV40 polyadenylation site. B) Western blot analysis of the proviral cassette expression in vitro probed against the reporter tag, c-Myc/his. Th e eGFP construct does not cont ain the c-Myc/his reporter tag and served as the negative control for unspecific bands. rKiK3 is the original construct from which the c-Myc/his tag was obtained and shows a robust band that corresponds with the KiK3 gene. For the pc bp3 construct, the protein was expressed at the correct size of 36 kDa, for Gstt2 was 30 kDa, and for Dnajb4 was 40 kDa. CB promoter c-M y c/his Mut ITR SV40 poly ITR Modifier gene

PAGE 68

68 Figure 5-3. Fused Purkinje hete rokaryons are binucleated and ha ve Y chromosomes in female recipient mice. A) An example of a GFP+ Purkinje neuron (green) derived from GFP+ male HSC. B) The same GFP+ Purkinje neuron also expr ess Purkinje cell marker Calbindin (red). C) DAPI staining (blue) reveals that the fused Purkinje neuron contains morphologically distinct nuclei of different size (arrows). D) Another binucleated GFP+ Purkinje neuron (green, arrow and arrow head) contains one Y chromosome in one of the two nuclei (arr ow head) shown before (E) and after (F) FISH analysis. The cy3-labeled Y chromoso me (F, inset) is detected amongst FITClabeled X chromosomes (green) in the fema le recipient cerebellum. (scale bar=10 m, GL=inner granule layer, PL=Purki nje layer, ML=molecular layer.)

PAGE 69

69 Figure 5-4. Donor labeled cells express c-Myc/his reporter tag. A) Some GFP+ cell type found in recipient cerebella have the morphology of mi croglia (green) and ar e co-localized, as

PAGE 70

70 shown in B), for the surface marker CD11b (re d). C) 20-30% of the microglia (green) are shown in D) to express c-Myc (red) in the cytoplasmi c regions where all four of the modifier genes are localized. E) Fused, GFP+ Purkinje neurons (green) are also immunopositive for c-Myc (red) in F. (scale bar=10 m, GL=inner granule layer, PL=Purkinje layer, ML=molecular layer. DAPI=blue) Figure 5-5. Nuclear inclusions va ry in size and appear to be sm aller in fused Purkinje neurons. A) and B) are examples of the ataxin-1+ nuclear inclusions found in the heterozygous Sca1 mice. Most common are Purkinje neur ons with a single la rge inclusion (arrow heads) but a small number of cells are found to contain two (arrow) or multiple (asterisks) smaller-sized inclusions. C) GFP+ Purkinje neurons (green) also contain axaxin-1+ nuclear inclusions but D) they are the small-sized variety (arrows) and not the typical large single incl usions seen in non-fused Purkinje cells in A) and B). (scale bar=20 m)

PAGE 71

71 Figure 5-6. Bone marrow cells give rise to multiple neuronal cell types within the cerebellum. In addition to fusion involving Purkinje neur ons and differentiation into microglia, GFP+ cells resembling interneurons (A, B, and C, green=GFP, red=Calbindin) were found within the molecular layer. Specifically, cells in A), B) and C) resemble interneurons, possibly stellate neurons of the molecular layers. None of the GFP+ cells (green) resembling interneurons are co-labeled with Calbindin (red). D) Another cell type found in multiple transplant recipients was GFP+ unipolar astrocyte (green) that resembles Bergmann glia that are closely associated with Purkinje neurons, structurally and functionally. E) These cells are immunopositive for glial fibrillary astrocytic protein (GFAP) (red) typical of Bermann glia, and F) shows merged image of GFP and GFAP (yellow). (scale bar=10 m, PL=Purkinje layer, ML=molecular layer. DAPI=blue)

PAGE 72

72 CHAPTER 6 DISCUSSION AND CONCLUSIONS The potential for stem/progenitor cells to beco me a source of transplantable donor cells for cell-based neuroprotective and/or replacement ther apies has been a focus of many recent studies, especially in the CNS where most cells lack inhe rent regenerative capabil ities. A great deal of these studies has focused on the use of embryonic stem (ES) cells and adult neural stem cells derived from SEZ in particular, to directly replace the degenera ted neuronal populations within diseases or trauma/injury. It is a reasonable strategy that has shown great promise, but many challenges remain in terms of finding alternativ e sources of stem cells that would not provoke ethical concerns, retain pluripoten cy, and at the same time can be safely integrated within a host system. Part of the rationale for current study was to determine the potential successful transplantability of anot her source of neural stem/progenitor cells derived from the cerebellum to differentiate into the principle neuronal types lost in cerebellum. However, despite best efforts, many reports have already shown that adult ne ural stem cells do not possess the ability to differentiate into every type of neuronal cell f ound within the complex CN S, including the highly complex cerebellar Purkinje neurons that ar e vulnerable in many movement disorders. Therefore, in conjunction with studies on neural stem cells, adult stem cells derived from other parts of the body, such as the bone marrow, are al so being investigated for their potential to rescue at-risk neuronal populations that complement the first part of this study that looked at both ES and adult brain-derived stem/progenitor cel ls for cell replacement in a cerebellar mutant mouse. Observations that adult stem cells de rived from various developmental periods and body areas are able to give rise to cells of another lineage through tran s-differentiation have been rare. Instead it was found that a primar y mechanism through which cells take on identities outside of their typical lineages is thr ough cell-cell fusion, which was reported by our lab and others to

PAGE 73

73 occur spontaneously in vitro and in vivo between stem cell types and between stem cells and somatic cells. Specifically, bone marrow cells posse ss the ability to fuse with Purkinje neurons, and this fusogenic property could be further deve loped and refined as a therapeutic approach to rescue the dying neurons since direct replacement is not yet a possibility. Thus, this dissertation describes a thematic research approach that expl oits the potential of using adult stem cells in rescuing at-risk neuronal populati ons, with either direct cell replacement or repair through providing new genetic material, in well-characterized ce rebellar transgenic and mutant animal models. Comparative Analysis of Cerebellar-deri ved MASCs and ESNPs in Transplantation In the first part of my studies where ce rebellar-derived MASCs were used as a donor population in a homotopic transplantation paradigm within the weaver mutant mouse cerebellum, their differentiation capabilities were compared to an established embryonic cell line that has been shown to generate multiple types of neurons that can integrate within host CNS environments. Results show that both donor st em/progenitor cell populations, derived from either a postnatal neurogenic zone or an embryonic cell line, have the ability to survive, migrate, and initiate differentiation in to neuronal phenotypes within th e granuloprival weaver mouse cerebellum. However, neither of these donor po pulations adopted impressive region-specific identities, particularly neurons of the granule, Purkinje, or mo lecular layers, despite earlier studies that suggested the potential of these stem/progenitor cells to respond to in vivo cues when placed in a permissive/instructive environment. Specifically, cerebellaror lateral ventricle SEZderived MASCs were previously observed to en ter into the rostral migratory stream after transplantation into the SEZ and lateral ventricles, and found to migrate into the olfactory bulb where a small population differentiated into appropr iate olfactory interneurons (Zheng et al., 2006). This suggests that the spatially and temp orally restricted populat ion of astrocytes, the

PAGE 74

74 MASCs, retain the ab ility to respond to in vivo cues provided by the host system. The low percentage of transplants that generated olfact ory interneurons reporte d by Zheng et al. (2006) was explained by the possibility that cerebellar MASCs were not optimally primed to respond to cues related to olfactory neuroge nesis, hence it was expected th at homotypic transplantation into the mutant cerebella would prompt more impre ssive neural differentiation and engraftment, should the MASCs retain a transc riptional profile capable of re sponding to specific cerebellar neurogensis cues. Klein et al. ( 2005) showed that cerebellar-deriv ed neurospheres gave rise to both GABA-expressing and glutamat e-expressing interneurons resembling Lugaro cells and granule cells, respectively, follo wing transplantation into wildtype P4 cerebella, but they differentiated into glial cells when transplanted into the forebrain, demonstrating that those cerebellar-derived cells were capab le of retaining intrinsic regional attributes in an uninjured CNS environment. Furthermore, it has been shown that in vivo neurogenesis can increase in response to injury or disease (Jin et al., 2001; Jankovski et al., 1998; G ould et al., 1997) in the SEZ and hippocampus, which would suggest that th e weaver mouse should be a suitable model for inducing cellular replacement with its discre te and localized pattern of granule neuron degeneration. However, in the present study, the ma jority of the cells re tained glial-like or undifferentiated stem/progenitor ce ll morphologies, and they lacked expression of region specific transcription factors, with only a small number of cells differentiating into immature neurons or astrocytes. This is in keepi ng with many previous studies that showed engraftment of neural progenitor cells into metabolic disease mode ls (Lee et al., 2007; Snyder et al., 1995) or neurological mutants (Li et al ., 2006; Rosario et al., 1997) which seem to exert corrective, therapeutic effects on the at-risk neuronal popula tion, but did not show th e acquisition of region specific phenotypes through appropria te expression of transcriptio nal factors or morphological

PAGE 75

75 profiles, e.g. parallel fiber axonal arbors typi cal for granule cells or the dense and elaborate dendritic trees characteristic of Purkinje neurons One explanation is that the MASCs studied here were able to survive and home towards th e degenerating areas but they did not undergo appropriate, terminal phenotypic differentiation due to a downr egulation of receptors or transcription or other mor phogenetic factors during the in vitro culturing process prior to transplantation; an alternative explanation could be there is a lack of requisite fate choice and differentiation signals within the abnormal weaver cerebellum which may result from a severe homeostatic imbalance within the injured host environment th at could be non-conducive for complete functional integration. The weaver mutation is widely be lieved to be intrinsic to the affected granule neurons, but earli er reports (Gao et al., 1993; Ga o et al., 1992) have shown that some mutant granule cells transplanted into a wildtype cerebellum are cap able of differentiating and migrating normally which suggests the weav er gene might act non-autonomously and could hinder host-donor cell interactions However, a small population of granule cells does survive and persist normally under the conditions present in the weaver cerebellum and it might be these same cells that were found to be able to diffe rentiate properly within a wildtype cerebellum in the observations reported by Gao and colleagues. Furthermore, data presented here seem to suggest that the cellular deficits present within some of the wv /+ or wv / wv brains may promote a slightly enhanced donor cell response towards ac quisition of neuronal phenotypy. Hence it is likely that a fine balance exists between an impa ired host environment that is amenable to cell replacement versus one that may be too toxic for immediate (and within the timeframes, albeit rather protracted here) and desired repair. Regarding ESNPs, they have been shown to acquire complex morphologies and adopted excitatory neurotransmitter phenotypes both in vivo and in vitro (Goetz et al., 2006; Wernig et al,

PAGE 76

76 2004; Benninger et al., 2003; Brs tle et al., 1999; Brs tle et al., 1997; Okabe et al., 1996), and they were expected to generate more neuronal phenotypes since they have been induced into a dominant neuronal lineage prio r to transplantation. Morphol ogically, these donor cells did appear to be more mature than those derive d from cerebellar MASCs, exhibiting extensive numbers of varicose processes and round somata. Some of them also express mature neuronal markers including NeuN and the neurotransm itter glutamate not seen with the MASC population. This suggests that i nherent differences within diff erentiation potential do exist between these two neural stem/progenitor cell po pulations. Despite the more mature antigenic and morphological profiles, ESNPs still did not appear to significantly commit to regional differentiation identities as indi cated by the lack of cerebellar-sp ecific transcriptional factor expressions for MATH-1, GABAA 6, and RU49. This embryonic cell line-derived donor population was primed for neuronal lineage and expected to be more responsive to the neurogenic cues within the host environment, so a lack of regional commitment suggests that successful engraftment is highly dependent upon the interplay between th e host environment and the donor populations, and that the context of the injury conditions can be specific and crucial for the promotion of prefer ential cell replacement. Another phenomenon observed here was the aggressive nature of the neoplastic formations within a small number of ESNP transpla nts. Previous studies reported that donor cell clusters of varied sizes with teratoma appearances were found when ESNPs were transplanted into the SEZ, but they did not seem to disr upt the parenchyma nor wa s there evidence of infiltration by non-neural donor cells (Wernig et al., 2006). In contrast, our study shows that host tissue surrounding the GFP+ neoplastic formation was tran sformed and adjoined with the neoplasm as confirmed by H & E staining. The di fference could be attributed to particular

PAGE 77

77 locations of the injection sites, but it does not preclude the possi bility of ESNPs giving rise to neoplastic formations. In comparison, previous st udies have shown similar invasive sphere-like structures forming within ventricular walls of animals intraventricularly transplanted with cerebellar MASCs, but in these experiments no ch anges were detected in the surrounding tissues (Zheng et al., 2002). These same don or cells did not give rise to neoplastic formations in any of the current transplants when inject ed directly into the cerebellum. This suggests, once again, that differences exist between the pr oliferation and differentiation potential of the two different stem/progenitor cell populations studied here, and that more st udies are obviously needed to uncover ways to coax stem/progenitor cells into appropriate patterns of cellular differentiation before neural stem/progenitor cells can be c onsidered for therapeutic applications within neurologically compromised patients. This pa rt of the present study presents an important in vivo bioassay, within a presumptive cell-repla cement-supportive neurological mutant mouse brain, that utilizes two of the mo st disparate and plastic neural stem/progenitor cell populations that have always been assumed to be the most promising candidates for neuro-cellular replacement therapies. Homotypic Cell-Cell Fusion in Vitro This next part of the study looked at another mechanism besi des differentiation utilized by stem cells to derive new ident ities, and established th e foundation in which this property can be used to expand the developmental scope of adu lt stem cells. Chapter 4 showed evidence that cells within neural stem/progenitor cell cu ltures harbored excessi ve numbers of sex chromosomes, supporting the noti on that cell-cell fusion can occu r. Cellullar fusion has been known for decades to be a fundamental and im portant phenomenon during the development and functioning of multicellular organisms, but more recently it has been found to be a mechanism potentially responsible for so-cal led trans-differentiation ability a nd plasticity exhibited by adult

PAGE 78

78 stem cells (Terada et al., 2002; Ying et al., 2002; Chen and Olson, 2005). The data presented suggest that spontaneous cell fu sion might be induced under the selective pressure of tissue culture conditions utilized in the current para digm. However, other factors, including the proximity of the cells, space limitation, fusogens (Chen and Olson, 2005; Jahn et al., 2003; Weber et al., 1998), or presence of other known fusion causative agents such as macrophages may also be implicated. In our study, the percen tage of aneuploid cells was comparable between confluent and non-confluent astrocyte monolayers, implying that fusion does not simply result from high cell density conditions. One coul d hypothesize that microglia, due to their demonstrated ability to fuse with osteoclasts, giant cells, and hepatocy tes (Camargo et al., 2003; Willenbring et al., 2004), might be the catalyt ic agents of cell fusion seen in our CNS neurosphere cultures. Indeed, the acquisition of extra chromosomes could be a microgliamediated phenomenon, but the observation that most cells immunopositive for CD11b retained a diploid state suggests that th is interpretation is unlikely. Nevertheless, CD11b antigen expression could be downregulated in microglia after a fusion even t, leading to an undercount of polyploid CD11b cells. However, this is not a fe asible explanation since evidence shows that PU.1 +/+ and PU.1 -/microglial-free cultures contained similar leve ls of aneuploid cells. This suggests that, at least under the present cultur e conditions, cell fusion is not restricted to hematopoietic and embryonic stem cells, and may be a byproduct of conditions within cell culture or endogenous tissue environments. Cells grown under conditions described here thus acquired extra chromosomes through mechanisms i ndependent of microglia l participation. Of course, there are alternative explanations to cell fusion, including the possibility that chromosomes simply failed to separate prope rly and could be the basis for the observed aneuploidy. However, this would only explain those examples with even numbers of excess

PAGE 79

79 chromosomes, but not those with odd numbers su ch as the two X and one Y documented in Fig. 4-1D (asterisk). Results from the Cre/lox recombination studies also support the notion of cell fusion, but the number of -gal+ cells is lower than the proporti on of cells observed to contain abnormal chromosome numbers. This suggests that different scenarios including the failure of chromosomes to separate, or the presence of ac tive cell division at the time of cell attachment, should be taken into considerati on along with cellcell fusion. Occurrence of neural cell fusion in vitro suggests that similar events may occur in vivo Alvarez-Dolado, et al. (2003) presented evidence for in vivo fusion of bone marrow-derived cells with cardiomyocytes, hepatocytes, and Purkinje neurons. There have been questions raised about a lack of plasticity of a dult stem cells (Dor and Melton, 2004; Wagers et al., 2002), but the relatively low rates of cell fusion observed both in vitro and in vivo does not support cell fusion as the only mechanism underlying adult neural st em cell multipotency. Since an understanding of mechanisms underlying cell fusion between st em/progenitor cells and other somatic cells could ultimately provide insights into directed fusion and indu ced plasticity amongst different populations of immature and mature cells, addi tional studies are needed to resolve precise fusogenic factors and events in culture paradigms as exploited here. One could even envision novel therapeutic strategies for human diseases wh ereby targeted cell fusion is used to deliver modified genomes and factors that ultimately rescue at-risk populations of cells following injury or degenerative disease. One possibility woul d be to use bone marrow-derived cells to deliver and release an enzyme, e.g. acid sphingomyelinase, in an animal model of the storage disease Niemann-pick type A to rescue a degenerating Purkinje cell populat ion (Bae et al., 2005), or the use of bone marrow-derived cells to deliv er chaperones or other housekeeping genes compromised within the at-risk Purkinje neurons in a trinucle otide repeat disorder, e.g.

PAGE 80

80 spinocerebellar ataxia 1 as presented in chapter 5. Such an approach would exploit cell fusion to expand the developmental and therapeutic scope of adult stem cells. This would be especially beneficial for specialized cell types such as Purkinje neurons that are at risk in many neurodegenerative disorders and lack the ability to be genera ted after birth (Weimann et al., 2003a; Weimann et al., 2003b), but are nonetheless su sceptible to fusogenic events (AlvarezDolado et al., 2003; new data presented here). Bone Marrow Derived Cells Deliver Potentia lly Neuroprotective Genes to Purkinje Neurons through Heterotypic Cell-Cell Fusion Developmental plasticity within somatic adu lt stem cells appeared more extensive than expected when a series of studies presented data that cells derived from one organ can give rise to cell types of unrelated lineages (Ferrari et al., 1998; Guss oni et al., 1999; Jackson et al., 1999; Petersen et al., 1999; Lagasse et al., 2000; Krause et al., 2001; Orlic et al., 2001). Most believed that the observed phenomenon was due to th e process of trans-differentiation, but in vitro coculture studies between embryonic stem cells and either BMDCs or neural stem cells, and data from our laboratory (discussed in chapter 4), sh owed that donor populati ons took on the identity of the host cells through the met hod of cellular fusion instead. Together, the findings suggest that cell-cell fusion is an additional mechanism th at can be exploited to expand the role of adult stem cells in therapeutic treatments. This last pa rt of my dissertation stud y is a proof of concept that heterotypic cell fusi on can be utilized as a rescue strate gy in which HSCs from bone marrow are used to provide neuroprotective genes/fact ors for injured or degenerating cells, such as specialized Purkinje neurons, that currently do not have other repair mechanisms available. We show that Purkinje neurons possessing two nuclei and donor-derived Y chromosomes are found in the recipient animals approximately six m onths post bone marrow transplant, but that the number of fused cells remains low as previously reported (Priller et al ., 2001; Weimann et al.,

PAGE 81

81 2003b; Alvarez-Dolado et al., 2003). However, th is does not indicate fusion events to be artifactual rare occurrences that are random and sporadic as some have come to believe (Wagers et al. 2002). Recent studies by Johansson et al. (2008) showed that formation of heterokaryons increased 10-100 fold in chronic inflammation conditions, while Nygren et al. (2008) further demonstrated that fusion could be inhibited through treatment with th e anti-inflammation drug prednisolone, suggesting that cell fusions are indeed bi ologically significant events that may provide a protective role in the f ace of trauma or in the case of neurodegenerative diseases that have been associated with components of in flammation (Singec & Snyder, 2008). Given these new findings, it is possible that the rate of fusi on is slowed down in the current experimental paradigm due to the administration of antibiotics to the experimental mice for two weeks after bone marrow transplant which could have reduced both the irradiation-in duced inflammation as well as the general inflammation component that may be associated with neurodegeneration. Future studies should be focused on the search for small molecule compounds that would promote low levels of inflammatory response without overwhelming the immune system, which could ultimately induce higher pe rcentages of cell-cell fusion. We also showed that the expression of neuroprotective genes is detected both in vitro, following culture of the bone marrow cells for 72 hrs, and in vivo 24-32 weeks post bone marrow transplant through the det ection of the reporte r c-Myc; this importantly demonstrates the stable transduction of the BMDCs/HSCs using the novel scAAV7 vectors. The percentage of transduced cells is approximately 20-30% with the use of a large vector-to-cell ratio of 100,000 to 1, which is in agreement with previous repor ts. Low transduction efficiency of AAV vectors can be attributed to the failed intracellular tra fficking from the cytoplas m into the nucleus and the subsequent degradation by the host cell proteasome machinery. Phosphorylation by the

PAGE 82

82 epidermal growth factor receptor protein tyrosine kinase (EGFR-PT K) at the tyrosine residues of the vector capsid was found to sp ecifically impair the nuclear tr ansport of the vectors (Zhong et al., 2007) and generation of vectors containing po int mutations within the tyrosine residue increased transduction efficiency at lower doses (Zhong et al., 2008). The expression of the neuroprotective genes can therefore be increased through the use of the mutated vector for future improvement on the transduction effici ency of the current system. For evaluation of the potentially attenuating eff ects of the transgenes used in this study, ataxin-1+ nuclear inclusions were examined. It has been postulated that these nuclear aggregations found in many neurodegenerative disorders are derived from expanded polyglutamine repeats that confer toxic gain of function effects through alteration of the protein conformation which consequently disrupts normal associ ation with the nuclear matrix or other proteins that accumulate in cell bodies (Skinner et al. 1997; Cummings et al., 1998). It has been shown that overexpression of mutant ataxin-1 in vitro forms large, single inclusions while overexpression of the wildtype ataxin-1 in vitro forms smaller, multiple inclusions, which was also observed in the Purkinje neurons fused with the genetically modified HSCs under the current in vivo model. While general observations on th e behavior of the heterozygous Sca1 mice do not lead to obvious improvements in their physical condition or beha vior for most of the recipient mice, a few of the mice receiving HSCs harboring the pcbp3 gene subjectively seemed more active and in better health than their control littermates (thi s of course could result from a variety of our experimental mani pulation). Histological assessment of their cerebella, however, revealed twice as many fused Purkinje neurons, suggesting that the cellcell fusion and/or this particular modifier gene may impart therapeutic effects. Even though each modifier gene was introduced in vivo one at a time in the current study, it might be possible that a synergistic effect

PAGE 83

83 may be seen if the genes were co-expressed in combination or all at once. This will be an important point for future studies. Aside from the successful proof-of-principle de monstration of a system potentially useful for the repair of at-risk Purkinje neurons through a novel delivery of new genome, another unexpected observation was the fusion seen with other cerebellar cell ty pes not reported in previous studies (Alvarez-Dol ado et al., 2003; Weimann et al ., 2003b; Johansson et al., 2008; Magrassi et al., 2007). Wh ile a few of the molecular layer inte rneurons that we observed may be random occurrences, GFP+ unipolar astrocytes with radial fibers ensheathe Purkinje neuron somata and dendrites, resembling Bergmann glia l cells, were consiste ntly observed throughout the cerebellum in more than one recipient mouse. Bergmann glia have intimate associations with Purkinje neurons both structurally and functi onally (Bellamy, 2006; Yamada et al., 2000), and have been implicated to play a role in neurode generation through impaired glutamate transport in the spinocerebellar ataxias (Custer et al., 2006; Vi g et al., 2006). Previ ous studies have shown that damage within the cerebe llum increased the number of fused cells (Bae et al., 2005; Magrassi et al., 2007) and it is po ssible that selective pressure w ithin the cerebellum, and also potential impairment within the Bergmann glia, pl ay a role in cell-cell fusion mechanism that is not yet completely understood. Another possibility is that Bergmann glia are in fact a putative type of cerebellar stem cell (Alcock et al., 2007; Sottile et al., 2006), and in vitro studies have demonstrated the propensity of different stem cell types to fuse in culture (Terada et al., 2002; Ying et al., 2002; Chen et al., 2006). Another advantage of the current rescue para digm is in the delivery method: bone marrow transplants have been in clinical use for a long time and are less i nvasive as compared to direct injection into the brain, which could cause damage to the parenchyma during the process. Even

PAGE 84

84 though whole-body irradiation was used in the current experimental paradigm to allow reconstitution of the donor blood cells, previous findings in whic h parabiosis was used to create chimaerism between two mice showed that peri pheral blood reconstitu tion was above 50% and that irradiation was unnecessary to induce fusion (Johansson et al., 2008). In addition, Magrassi and colleagues (2007) showed that mice receiving chemical treatments with Treosulfan and Fludarabine, and mice receiving irradiation, achieve d similar levels of circulating fluorescent cells and thus showed that irradiation is not a prerequisite for fusion to occur. Reports of aneuploid Purkinje neurons being found within aged rats and mice also have been around for a long time (Del Monte, 2006; Mann et al., 1978; Mare s et al., 1973; Lapham, 1968) and it is therefore reasonable to propose th at they are the predominant fusogenic-capable cell type within CNS capable of forming heter okaryon with BMDCs. Specific and focused cell fusion offers tremendous therapeutic potential in terms of rescuing highl y specialized Purkinje neurons that are the sole neuronal output within the cerebellar cort ex and they are the target of many neurodegenerative diseases. We show he re that the use of genetically modified BMDCs/HSCs to rescue degenerated Purkinje neurons can provide a non-invasive delivery of therapeutic factors that could not be achieve d using traditional viral gene therapy or cell replacement therapy alone. It also ensures th at the cells receiving tr ansgenes would be the population at-risk instead of globa l cell/tissue exposure to the CNS. Combin ing cell replacement regimes with viral vector directed gene ther apy to achieve a novel therapeutic paradigm can further expand the scope in which adult stem/proge nitor cells may be an efficacious alternative used to rescue at-risk ce llular populations associated with neurological diseases. Conclusions Data presented in this final dissertation reveal the potential of adult stem/progenitor cells to be used in therapeutic treatm ent for movement disorders involving ataxia. Through the

PAGE 85

85 application of different genetic, molecular, a nd cellular approaches, our understanding of the developmental scope of adult stem cells was cons iderably widened. More research is clearly needed to determine better ways of genera ting specific neuronal populations needed for particular CNS deficits, and also to better understand the in terplay between donor populations and the host environment for achieving optimal in tegration. Regarding the use of adult stem cells as a delivery vehicle for neuroprotectiv e agents, more work is needed on the specific mechanisms underlying cell fusion, so it can be bette r controlled and targeted to the particular cell population in need. The present study embarked on novel approaches for the potential treatment of ataxia, and further expands the scope in which adult stem/progenitor cells may be used to rescue at-risk populations within animal models of ne urological disease.

PAGE 86

86 LIST OF REFERENCES Alcock, J., Scotting, P., Sottile, V., 2007. Bergmann glia as putative stem cells of the mature cerebellum. Med Hypotheses 69, 341-345. Alvarez-Dolado, M., Pardal, R., Garcia-Verdugo, J. M., Fike, J. R., Lee, H. O., Pfeffer, K., Lois, C., Morrison, S. J., Alvarez-Buylla, A., 2003. Fusion of bone-marrow-derived cells with Purkinje neurons, cardiomyocytes an d hepatocytes. Nature 425, 968-973. Bae, J. S., Furuya, S., Shinoda, Y., Endo, S., Sc huchman, E. H., Hirabayashi, Y., Jin, H. K., 2005. Neurodegeneration Augments the Ability of Bone Marrow-Derived Mesenchymal Stem Cells to Fuse with Purkinje Neurons in Niemann-Pick Type C Mice. Hum Gene Ther 16, 1006-1011. Bayer S.A., Wills K.V., Wei J., Feng Y., Dlouhy S.R., Hodes M.E., Verina T., Ghetti B., 1996. Phenotypic effects of the weaver gene are ev ident in the embryonic cerebellum but not in the ventral midbrain. Brain Res Dev Brain Res. 96, 130-137. Bellamy, T.C., 2006. Interactions between Purkin je neurons and Bergmann glia. Cerebellum 5, 116-126. Benninger F., Beck H., Wernig M., Tucker K. L., Brstle O., Scheffler B., 2003. Functional integration of embryonic stem cell-derived neurons in hippocampal slice cultures. J Neurosci 23, 7075-7083. Berns, K.I., Giraud, C., 1996. Biology of adeno-a ssociated virus. Curr Top Microbiol immunol 218, 1-23. Bjornson, C. R., Rietze, R. L., Reynolds, B. A., Magli, M. C., Vescovi, A. L., 1999. Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283, 534-537. Brazelton T.R., Rossi F.M., Keshet G.I., Blau H. M., 2000. From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290, 1775-1779. Brstle O., Jones K.N., Learish R.D., Karram K., Choudhary K., Wiestler O.D., Duncan I.D., McKay R.D.., 1999. Embryonic stem cell-de rived glial precur sors: a source of myelinating transplant s. Science 285, 754-756. Brstle O., Spiro A.C., Karram K., Choudhary K., Okabe S., McKay R.D., 1997. In vitrogenerated neural precursors participate in mammalian brain development. Proc Natl Acad Sci U S A. 94, 14809-14814. Camargo, F. D., Green, R., Capetanaki, Y., Jackson, K. A., Goodell, M. A., 2003. Single hematopoietic stem cells generate skelet al muscle through myeloid intermediates. NatMed 9 1520-1527.

PAGE 87

87 Chen, E. H., Olson, E. N., 2005. Unveiling the mechanisms of cell-cell fusion. Science 308, 369373. Chen, K.A., Laywell, E.D., Marshall, G., Walt on, N., Zheng, T., Steindler, D.A., 2006. Fusion of neural stem cells in culture. Exp Neurol 198, 129-135. Cogle, C.R., Yachnis, A.T., Laywell, E.D., Zande r, D.S., Wingard, J.R., St eindler, D.A., Scott, E.W., 2004. Bone marrow transdifferentiation in brain after transplantation: a retrospective study. Lancet 363, 1432-1437. Cummings, C.J., Mancini ,M.A., Antalffy, B., DeFranco, D.B., Orr, H.T., Zoghbi, H.Y.,1998. Chaperone suppression of aggregation and al tered subcellular prot easome localization imply protein misfolding in SCA1. Nat Genet 19, 148-154. Cummings, C.J., Reinstein, E., Sun, Y., Anta lffy, B., Jiang, Y., Ciechanover, A., Orr, H.T.,Beaudet, A.L., Zoghbi, H.Y., 1999. Muta tion of the E6-AP ubiquitin ligase reduces nuclear inclusion frequency while accelerat ing polyglutamine-induc ed pathology inSCA1 mice. Neuron 24, 879-892. Cummings, C.J., Sun, Y., Opal, P ., Antalffy, B., Mestril, R., O rr, H.T., Dillmann, W.H., Zoghbi, H.Y., 2001. Over-expression of inducible H SP70 chaperone suppresses neuropathology and improves motor function in SCA1 mice. Hum Mol Genet 10, 1511-1518. Curtis MA, Kam M, Nannmark U, Anderson MF Axell MZ, Wikkelso C, Holts S, van RoonMom WM, Bjrk-Eriksson T, Nordborg C, Fr isn J, Dragunow M, Faull RL, Eriksson PS., 2007. Human neuroblasts migrate to the olfactory bulb via a lateral ventricular extension. Science 315, 1243-1249. Custer, S.K., Garden, G.A., Gill, N., Rueb, U., Li bby, R.T., Schultz, C., Guyenet, S.J., Deller, T., Westrum, L.E., Sopher, B.L., La Spada, A.R., 2006. Bergmann glia expression of polyglutamine-expanded ataxin-7 produces neurodegeneration by impairing glutamate transport. Nat Neurosci 9, 1302-1311. Daniela F., Vescovi A.L., Bottai D., 2007. The stem cells as a potential treatment for neurodegeneration. Methods Mol Biol 399, 199-213. Del Monte, U., 2006. The puzzle of ploidy of Purkinje neurons. Cerebellum 5, 23-26. Deng, J., Petersen, B.E., Steindler, D.A., Jorg ensen, M.L., Laywell, E.D., 2006. Mesenchymal stem cells spontaneously expr ess neural proteins in cultu re and are neurogenic after transplantation. Stem Cells 24,1054-1064. Dor, Y., Melton, D. A., 2004. How important are a dult stem cells for tissue maintenance? Cell Cycle 3, 1104-1106. Eisenman L.M., Gallagher E., Hawkes R., 1998. Regionalization defects in the weaver mouse cerebellum. J Comp Neurol 394, 431-444.

PAGE 88

88 Fernandez-Funez, P., Nino-Rosales, M.L., de Gouyon, B. She, W.C., Luchak, J.M., Martinez, P.,Turiegano, E., Benito, J., Capovilla, M., Sk inner, P.J., McCall, A., Canal, I., Orr, H.T.,Zoghbi, H.Y., Botas, J., 2000. Identification of genes that modify ataxin-1-induced neurodegeneration. Nature 408, 101-106. Ferrari, G., Cusella-De Angelis, G., Coletta, M ., Paolucci, E., Storna iuolo, A., Cossu, G., Mavilio, F., 1998. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 279, 1528-1530. Flotte, T., Carter, B., Conrad, C., Guggino, W., Reynolds, T., Rosenstein, B., Taylor, G.,Walden, S., and Wetzel, l .R., 1996. A phase I study of an adeno-associated virus-CFTR gene vector in adult CF patients with mild lung disease. Hum Gene Ther 7, 1145-1159. Flotte, T.R., Afione, S.A., Conr ad, C., McGrath, S.A., Solow, R ., Oka, H., Zeitlin, P.L.,Guggino, W.B., Carter, B.J., 1993. Stable in vivo expres sion of the cystic fibrosis transmembrane conductance regulator with an adeno-associated virus vector. Proc Natl Acad Sci U S A 90, 10613-10617. Flotte, T.R., Brantly, M.L., Spencer, L.T., By rne, B.J., Spencer, C.T., Baker, D.J., and Humphries, M., 2004. Phase I trial of intram uscular injection of a recombinant adenoassociated virus alpha 1-antitrypsin (rAAV2 -CB-hAAT) gene vector to AAT-deficient adults. Hum Gene Ther 15, 93-128. Gao W.Q., Hatten M.E., 1993. Neuronal differen tiation rescued by implantation of Weaver granule cell precursors into wild-typ e cerebellar cortex. Science 260, 367-369. Gao W.Q., Liu X.L., Hatten M.E., 1992. The weav er gene encodes a nonautonomous signal for CNS neuronal differen tiation. Cell 68, 841-854. Goetz A K., Scheffler B., Chen H.X., Wang S., Susl ov O., Xiang H., Brstle O., Roper S.N., Steindler D.A., 2006. Temporally restricted substrate interactions direct fate and specification of neural precursors derived from embryonic stem cells. Proc Natl Acad Sci U S A. 103, 11063-11068. Gould E., Tanapat P., 1997. Lesion-induced prolif eration of neuronal progenitors in the dentate gyrus of the adult rat. Neuroscience 80, 427-436. Gussoni, E., Soneoka, Y., Strickland, C. D., Buzney, E. A., Khan, M. K., Flint, A. F., Kunkel, L. M., Mulligan, R. C., 1999. Dystrophin expressi on in the mdx mouse restored by stem cell transplantation. Nature 401 390-394. Han, Z., Zhong, L., Maina, N., Hu, Z., Li, X., C houthai, N.S., Bischof, D., Weigel-Van Aken, K.A., Slayton, W.B., Yoder, M.C., Srivas tava, A., 2008. Stable integration of recombinant adeno-associated virus vector genomes after transduction of murine hematopoietic stem cells. Hum Gene Ther 19, 267-278. Hatten ME, Alder J, Zimmerman K, Heintz N., 1997. Genes involve d in cerebellar cell specification and differentiation. Curr Opin Neurobiol 7, 40-47.

PAGE 89

89 Herrup K., Trenkner E., 1987. Regional differences in cytoarchitecture of the weaver cerebellum suggest a new model for weaver ge ne action. Neuroscience 23, 871-85. Hombach-Klonisch, S., Panigrahi, S ., Rashedi, I., Seifert, A., Alberti, E., Pocar, P., Kurpisz, M., Schulze-Osthoff, K., Mackiewicz, A., Los, M., 2008. Adult stem cells and their transdifferentiation potential-perspectives and th erapeutic applicati ons. J Mol Med 86, 14361440. Jackson, K. A., Mi, T., Goodell, M. A., 1999. Hematopoi etic potential of stem cells isolated from murine skeletal muscle. Proc Natl Acad Sci U S A 96, 14482-14486. Jahn, R., Lang, T., Sudhof, T. C., 2003. Membrane fusion. Cell 112, 519-533. Jankovski A, Garcia C, Soriano E, Sotelo C., 1998. Proliferation, migration and differentiation of neuronal progenitor cells in the adult mouse subventricula r zone surgically separated from its olfactory bulb. Eur J Neurosci 10, 3853-3868. Jin K., Minami M., Lan J.Q., Mao X.O., Ba tteur S., Simon R.P., Greenberg D.A., 2001. Neurogenesis in dentate subgra nular zone and rostral subve ntricular zone after focal cerebral ischemia in the rat. Pr oc Natl Acad Sci U S A 98, 4710-4715. Johansson, C.B., Youssef, S., Koleckar, K., Ho lbrook, C., Doyonnas, R., Corbel, S.Y., Steinman, L., Rossi, F.M., Blau, and H.M., 2008. Extens ive fusion of haematopoietic cells with Purkinje neurons in response to chro nic inflammation. Nat Cell Biol 10, 575-583. Kaplan M.S., Hinds J.W., 1977. Neurogenesis in th e adult rat: electron mi croscopic analysis of light radioautographs Science 197, 1092-1094. Kay, M.A., Manno, C.S., Ragni ,M.V., Larson, P.J., Couto, L.B., McClelland, A., Glader, B., Chew, A.J., Tai, S.J., Herzog, R.W., Arruda V., Johnson, F., Scallan, C., Skarsgard, E., Flake, A.W., High, K.A., 2000. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector. Nat Genet 24, 257-261. Kirschenbaum B, Nedergaard M, Preuss A, Bara mi K, Fraser RA, Goldman SA., 1994. In vitro neuronal production and differentiation by precu rsor cells derived from the adult human forebrain. Cereb Cortex 4, 576-589. Klein C, Butt SJ, Machold RP, Johnson JE, Fish ell G., 2005. Cerebellumand forebrain-derived stem cells possess intrinsic regiona l character. Development 132, 4497-4508. Kornack D.R., Rakic P., 1999. Continuation of neurogenesis in the hippocampus of the adult macaque monkey. Proc Natl Acad Sci U S A 96, 5768-5773. Krause, D. S., Theise, N. D., Collector, M. I ., Henegariu, O., Hwang, S., Gardner, R., Neutzel, S., Sharkis, S. J., 2001. Multi-organ, multi-lin eage engraftment by a single bone marrowderived stem cell. Cell 105, 369-377.

PAGE 90

90 Kuhn H.G., Dickinson-Anson H., Gage F.H., 1996. Neurogenesis in the dentate gyrus of the adult rat: age-related decreas e of neuronal progenitor prolif eration. J Neurosci 16, 20272033. Lagasse, E., Connors, H., Al-Dhalimy, M., Reits ma, M., Dohse, M., Osborne, L., Wang, X., Finegold, M., Weissman, I. L., Grompe, M., 2000. Purified hematopoietic stem cells can differentiate into hepatocyte s in vivo. Nat Med 6, 1229-1234. Lapham, L.W., 1968. Tetraploid DNA content of Purkinje neurons of human cerebellar cortex. Science 159, 310-312. Laywell, E. D., Kearns, S. M., Zheng, T., Chen, K. A., Deng, J., Chen, H. X., Roper, S. N., Steindler, D. A., 2005. Neuron-to-astrocyte transition: Phenotypic fluidity and the formation of hybrid asterons in differen tiating neurospheres. J Comp Neurol 493, 321333. Laywell, E. D., Kukekov, V. G., Suslov, O., Zheng, T., Steindler, D. A., 2002. Production and analysis of neurospheres from acutely dissociated and postmortem CNS specimens. Methods Mol Biol 198, 15-27. Laywell, E. D., Rakic, P., Kukekov, V. G., Ho lland, E. C., Steindler, D. A., 2000. Identification of a multipotent astrocytic stem cell in th e immature and adult mouse brain. Proc Natl Acad Sci U S A 97, 13883-13888. Lee A, Kessler JD, Read TA, Kaiser C, Corbe il D, Huttner WB, Johnson JE, Wechsler-Reya RJ., 2005. Isolation of neural stem cells from th e postnatal cerebellum. Nat Neurosci 8, 723729. Lee J.P., Jeyakumar M., Gonzalez R., Takahashi H ., Lee P.J., Baek R.C., Clark D., Rose H., Fu G., Clarke J., McKercher S., Meerloo J., Mulle r F.J., Park K.I., Butters T.D., Dwek R.A., Schwartz P., Tong G., Wenger D., Lipton S.A ., Seyfried T.N., Platt F.M., Snyder E.Y., 2007. Stem cells act through multiple mechanisms to benefit mice with neurodegenerative metabolic disease. Nat Med 13, 439-447. Li J., Ma Y, Teng Y.D., Zheng K., Vartanian T.K., Snyder E.Y., Sidman R.L., 2006. Purkinje neuron degeneration in nervous (nr) mutant mice is mediated by a metabolic pathway involving excess tissue plasminogen activat or. Proc Natl Acad Sci U S A 103, 78477852. Lois C., Alvarez-Buylla A., 1994. Long-distance neuronal migration in the adult mammalian brain. Science 264, 1145-1148. Magrassi, L., Grimaldi, P., Ibatici, A., Corselli M., Ciardelli, L., Castello, S., Podest, M., Frassoni, F., Rossi, F., 2007. Induction and surv ival of binucleated Purkinje neurons by selective damage and aging. J Neurosci 27, 9885-9892. Maina, N., Han, Z., Li, X., Hu, Z., Zhong, L., Bischof, D., Weigel-Van Aken, K.A., Slayton, W.B., Yoder, M.C., Srivastava, A., 2008. Recombinant self-complementary adeno-

PAGE 91

91 associated virus serotype vector-mediate d hematopoietic stem cell transduction and lineage-restricted, long-term transgene expr ession in a murine serial bone marrow transplantation model. Hum Gene Ther 19, 376-383. Mann, D.M., Yates, P.O., Barton, C.M., 1978. The DNA content of Purkinje cells in mammals. J Comp Neurol 180, 345-347. Mares, V., Lodin, Z., Scha, J., 1971. A cytoch emical and autoradiogr aphic study of nuclear DNA in mouse Purkinje cells. Brain Res 53, 273-289. Maricich S.M., Soha J., Trenkner E., Herrup K., 1997. Failed cell migration and death of purkinje cells and deep nuclear neurons in the weaver cerebellum. J Neurosci 17, 36753683. Mart J., Wills K.V., Ghetti B., Bayer S.A. 2001. Evidence that the loss of Purkinje cells and deep cerebellar nuclei neurons in homozygous weaver is not rela ted to neurogenetic patterns. Int J Dev Neurosci 19, 599-610. Mezey, E., Chandross, K. J., Ha rta, G., Maki, R. A., McKercher, S. R., 2000. Turning blood into brain: cells bearing neuronal antigens generated in vivo from bone marrow. Science 290, 1779-1782. Muller-Sieburg, C.E., Whitlock, C.A., Weissm an, I.L., 1986. Isolation of two early B lymphocyte progenitors from mouse marro w: a committed pre-pre-B cell and a clonogenic Thy-1-lo hematopoietic stem cell. Cell 44, 653-662. Muzyczka, N., 1992. Use of adeno-associated virus as a general tr ansduction vector for mammalian cells. Curr Top Microbiol Immunol 158, 97-129. Nygren, J.M., Liuba, K., Breitbach, M., Stott, S. Thorn, L., Roell, W., Geisen, C., Sasse, P., Bjrklund, A., Nerlov, C., Fleischmann, B.K ., Jovinge, S., and Jacobsen, S.E., 2008. Myeloid and lymphoid contribution to non-haem atopoietic lineages through irradiationinduced heterotypic cell fusi on. Nat Cell Biol 10, 584-592. Nystul, T.G., Spradling, A.C., 2006. Breaking out of the mold: diversity w ithin adult stem cells and their niches. Curr Opin Genet Dev 16, 463-468. Okabe S., Forsberg-Nilsson K., Spiro A.C., Se gal M., McKay R.D., 1996. Development of neuronal precursor cells and functional postm itotic neurons from embryonic stem cells in vitro. Mech Dev 59, 89-102. Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, I., Anderson, S. M., Li, B., Pickel, J., McKay, R., Nadal-Ginard, B., Bodine, D. M., Leri, A., Anversa, P., 2001. Bone marrow cells regenerate infarcted myocardium. Nature 410, 701-705. Orr, H.T., Zoghbi, H.Y., 2007. Trinucleotide rep eat disorders. Annu Rev Neurosci 30, 575621.

PAGE 92

92 Orr,H.T., Zoghbi, H.Y., 2001. SCA1 molecular gene tics: a history of a 13 year collaboration against glutamines. Hum Mol Genet 10, 2307-2311. Osawa, M., Hanada, K., Hamada, H., Nakauc hi, H., 1996. Long-term lymphohematopoietic reconstitution by a single CD34low/negative hematopoietic stem cell. Science 273, 242245. Patil N., Cox D.R., Bhat D., Faham M., Myers R. M., Peterson A.S., 1995. A potassium channel mutation in weaver mice implicates membrane excitability in granul e cell differentiation. Nat Genet 11, 126-129. Petersen, B. E., Bowen, W. C., Patrene, K. D., Mars, W. M., Sullivan, A. K., Murase, N., Boggs, S. S., Greenberger, J. S., Goff, J. P., 1999. B one marrow as a potential source of hepatic oval cells. Science 284, 1168-1170. Priller, J., Persons, D.A., Klett, F.F., Kemper mann, G., Kreutzberg, G.W., Dirnagl, U., 2001. Neogenesis of cerebellar Purkinje neurons fr om gene-marked bone marrow cells in vivo. J Cell Biol 155, 733-738. Rakic P., Sidman R.L., 1973. Sequence of devel opmental abnormalities leading to granule cell deficit in cerebellar cortex of weaver mutant mice. J Comp Neurol 152, 103-132. Raisler, B.J., Berns, K.I., Grant, M.B., Beliae v, D., Hauswirth, W.W., 2002. Adeno-associated virus type-2 expression of pigmented epithe lium-derived factor or Kringles 1-3 of angiostatin reduce retinal neovasculariza tion. Proc Natl Acad Sci U S A 99, 8909-8914. Roffler-Tarlov S., Martin B., Graybiel A.M., Kaue r J.S., 1996. Cell death in the midbrain of the murine mutation weaver J Neurosci 16, 1819-1826. Rosario C.M., Yandava B.D., Kosaras B., Zu rakowski D., Sidman R.L., Snyder E.Y., 1997. Differentiation of engrafted multipotent neur al progenitors towa rds replacement of missing granule neurons in meander tail cer ebellum may help determine the locus of mutant gene action. Development 124, 4213-4224. Rossi F., Cattaneo E., 2002. Opinion: neural st em cell therapy for neurological diseases: dreams and reality. Nat Rev Neurosci 3, 401-409. Scheffler B., Walton N.M., Lin D.D., Goetz A.K ., Enikolopov G., Roper S.N., Steindler D.A., 2005. Phenotypic and functional characterization of adult brain neuropoiesis. Proc Natl Acad Sci U S A 102, 9353-9858. Schein J.C., Hunter D.D., Roffler-Tarlov S., 1998. Girk2 expression in the ventral midbrain, cerebellum, and olfactory bulb and its relatio nship to the murine mutation weaver. Dev Biol 204, 432-450. Scott, E. W., Simon, M. C., Anastasi, J., Si ngh, H., 1994. Requirement of transcription factor PU.1 in the development of multiple he matopoietic lineages. Science 265, 1573-1577.

PAGE 93

93 Servadio, A., Koshy, B., Armstrong, D., Antalffy B., Orr, H.T., Zoghbi, H.Y., 1995. Expression analysis of the ataxin-1 protei n in tissues from normal and spinocerebellar ataxia type 1 individuals. Nat Genet 10, 94-98. Sidman R.L., Appel S.H., Fullier J.F., 1965. Neur ological Mutants of the Mouse. Science 150, 513-516. Singec, I., and Snyder, E.Y., 2008. Inflammation as a matchmaker: revisiting cell fusion. Nat Cell Biol 10, 503-505. Skinner, P.J., Koshy, B.T., Cu mmings, C.J., Klement, I.A., Helin, K., Servadio, A., Zoghbi, H.Y., Orr, H.T., 1997. Ataxin-1 with an expa nded glutamine tract a lters nuclear matrixassociated structures. Nature 389, 971-974. Skinner, P.J., Vierra-Green, C.A., Clark, H.B., Zoghbi, H.Y., Orr, H.T., 2001. Altered trafficking of membrane proteins in purkinje cells of SCA1 transgenic mice. Am J Pathol 159, 905-913. Smeyne R.J., Goldowitz D., 1989. Development and d eath of external granul ar layer cells in the weaver mouse cerebellum: a quantit ative study. J Neurosci 9, 1608-1620. Smeyne R.J., Goldowitz D., 1990. Purkinje cell loss is due to a direct acti on of the weaver gene in Purkinje cells: evidence from chimer ic mice. Brain Res Dev Brain Res 52, 211-218. Snyder E.Y., Deitcher D.L., Walsh C., ArnoldAldea S., Hartwieg E.A., Cepko C.L., 1992. Multipotent neural cell lines can engraft a nd participate in development of mouse cerebellum. Cell 68, 33-51. Snyder E.Y., Taylor R.M., Wolfe J.H., 1995. Neural progenitor cell engraftment corrects lysosomal storage throughout the MP S VII mouse brain. Nature 374, 367-370. Snyder, R.O., Francis, J., 2005. Adeno-associated vi ral vectors for clinical gene transfer studies. Curr Gene Ther 5, 311-321. Snyder, R.O., Miao, C.H., Patijn, G.A., Spratt, S.K., Danos, O., Nagy, D., Gown, A.M., Winther, B., Meuse, L., Cohen, L.K., Thompson, A.R., and Kay, M.A., 1997. Persistent and therapeutic concentrations of human factor IX in mice afte r hepatic gene transfer of recombinant AAV vectors. Nat Genet 16, 270-276. Sotelo C., Alvarado-Mallart R.M., 1986. Growth and differentiation of cerebellar suspensions transplanted into the adult cerebellum of mice with heredodegenerative ataxia. Proc Natl Acad Sci U S A 83, 1135-1139. Sotelo C., Alvarado-Mallart R.M., 1987. Reconstr uction of the defective cerebellar circuitry in adult Purkinje cell degeneration mutant mice by Purkinje cell replacement through transplantation of solid embryonic implants. Neuroscience 20, 1-22.

PAGE 94

94 Sotelo C., Alvarado-Mallart R.M., 1988. Integr ation of grafted Purkin je cell into the host cerebellar circuitry in Purkin je cell degeneration mutant mouse. Prog Brain Res 78, 141154. Sottile, V., Li, M., Scotting, P.J., 2006. Stem ce ll marker expression in the Bergmann glia population of the adult mouse brain. Brain Res 1099, 8-17. Spangrude, G.J., Heimfeld, S., Weissman, I.L., 1 988. Purification and char acterization of mouse hematopoietic stem cells. Science 241, 58-62. Srivastava, A., 2005. Hematopoietic stem cell transduction by recombinant adeno-associated vius vectors: problems and so lutions. Hum Gene Ther 16, 792-798 Steindler D.A., Pincus D.W., 2002. Stem cells and neuropoiesis in the adult human brain. Lancet 359, 1047-1054. Terada, N., Hamazaki, T., Oka, M., Hoki, M., Mastalerz, D. M., Nakano, Y., Meyer, E. M., Morel, L., Petersen, B. E., Scott, E. W ., 2002. Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 416, 542-545. Triarhou L.C., Low W.C., Ghetti B., 1986. Transpla ntation of ventral mesencephalic anlagen to hosts with genetic nigrostriatal dopamine deficiency. Proc Natl Acad Sci U S A 83, 8789-8793. Triarhou L.C., Low W.C., Ghetti B., 1987. Transpla ntation of cerebellar an lagen to hosts with genetic cerebellocortical atrophy. Anat Embryol (Berl) 176, 145-154. Triarhou L.C., Low W.C., Norton J., Ghetti B., 1988. Reinstatement of synaptic connectivity in the striatum of weaver mutant mice followi ng transplantation of ventral mesencephalic anlagen. J Neurocytol 17, 233-243. Triarhou L.C., Zhang W., Lee W.H., 1996. Ame lioration of the behavioral phenotype in genetically ataxic mice through bilateral intrace rebellar grafting of fetal Purkinje cells. Cell Transplant 5, 269-277. Vats, A., Bielby, R.C., Tolley, N.S., Nerem, R. Polak, J.M., 2005. Stem cells. Lancet 366, 592602. Vig, P.J., Lopez, M.E., Wei, J., D'Souza, D.R ., Subramony, S., Henegar, J., Fratkin, J.D., 2006. Glial S100B Positive Vacuoles In Purkinje Cells: Earliest Morphological Abnormality In SCA1 Transgenic Mice. J Neurol Sci Turish 23, 166-174. Wagers, A. J., Sherwood, R. I., Christensen, J. L., Weissman, I. L., 2002. Little evidence for developmental plasticity of adult he matopoietic stem cells. Science 297, 2256-2259. Walton, M. R., Gibbons, H., MacGibbon, G. A., Si rimanne, E., Saura, J., Gluckman, P. D., Dragunow, M., 2000. PU.1 expression in microglia. J Neuroimmunol 104, 109-115.

PAGE 95

95 Wang, Z., Ma, H.I., Li, J., Sun, L., Zhang, J ., Xiao, X., 2003. Rapid and highly efficient transduction by double-stranded ad eno-associated virus vector s in vitro and in vivo. Gene Ther 10, 2105-2111. Wang, X., Willenbring, H., Akkari, Y., Torimar u, Y., Foster, M., Al-Dhalimy, M., Lagasse, E., Finegold, M., Olson, S., Grompe, M., 2003. Cell fusion is the principal source of bonemarrow-derived hepatocytes. Nature 422, 897-901. Watase, K., Weeber, E.J., Xu, B., Antalffy, B., Yuva-Paylor, L., Hashimoto, K., Kano, M., Atkinson, R., Sun, Y., Armstrong, D.L., Sweatt, J.D., Orr, H.T., Paylor, R., Zoghbi, H.Y., 2002. A long CAG repeat in the mouse Sca1 locu s replicates SCA1 features and reveals the impact of protein solubility on se lective neurodegeneration. Neuron 34, 905-919. Weber, T., Zemelman, B. V., McNew, J. A., West ermann, B., Gmachl, M., Parlati, F., Sollner, T. H., Rothman, J. E., 1998. SNAREpins: minimal machinery for membrane fusion. Cell 92, 759-772. Weimann, J. M., Charlton, C. A., Brazelton, T. R., Hackman, R. C., Blau, H. M., 2003a. Contribution of transplanted bone marrow cel ls to Purkinje neurons in human adult brains. Proc Natl Acad Sci U S A 100, 2088-2093. Weimann, J. M., Johansson, C. B., Trejo, A., Blau, H. M., 2003b. Stable reprogrammed heterokaryons form spontaneously in Purkin je neurons after bone marrow transplant. Nat Cell Biol 5, 959-966. Wernig M., Benninger F., Schmandt T., Rade M., Tucker K.L., Bssow H., Beck H., Brstle O., 2004. Functional integration of embryonic stem cell-derived neurons in vivo. J Neurosci 24, 5258-5268. Willenbring, H., Bailey, A. S., Foster, M., A kkari, Y., Dorrell, C., Olson, S., Finegold, M., Fleming, W. H., Grompe, M., 2004. Myelomonocy tic cells are sufficient for therapeutic cell fusion in liver. Nat Med 10, 744-748. Wu, J., Zhao, W., Zhong, L., Han, Z., Li, B., Ma, W., Weigel-Kelley, K.A., Warrington, K.H., Srivastava, A., 2007. Self-complementary reco mbinant adeno-associated viral vectors: packaging capacity and the role of rep protei ns in vector purity. Hum Gene Ther 18, 171182. Xiao, X., Li, J., Samulski, R.J., 1996. Efficient lo ng-term gene transfer into muscle tissue of immunocompetent mice by adeno-associat ed virus vector. J Virol 70, 8098-8108. Yamada, K., Fukaya, M., Shibata, T., Kurihara H., Tanaka, K., Inoue, Y., Watanabe, M., 2000. Dynamic transformation of Bergmann glial fi bers proceeds in corre lation with dendritic outgrowth and synapse formati on of cerebellar Purkinje cel ls. J Comp Neurol 418, 106120. Ying, Q. L., Nichols, J., Evans, E. P., Sm ith, A. G., 2002. Changing potency by spontaneous fusion. Nature 416, 545-548.

PAGE 96

96 Zhang S.C., Wernig M., Duncan I.D., Brstle O ., Thomson J.A., 2001. In vitro differentiation of transplantable neural precursors from hu man embryonic stem cells. Nat Biotechnol 19, 1129-1133. Zheng T., Marshall G.P. 2nd, Laywell E.D., Steindler D.A., 2006. Neurogenic astrocytes transplanted into the adult mouse lateral ve ntricle contribute to ol factory neurogenesis, and reveal a novel intrinsic subepend ymal neuron. Neuroscience 142, 175-185. Zheng T., Steindler D.A., Laywell E.D., 2002. Tran splantation of an indigenous neural stem cell population leading to hyperplasia and atypica l integration. Cloning Stem Cells 4, 3-8. Zhong, L., Li, B., Mah, C.S., Govindasamy, L ., Agbandje-McKenna, M., Cooper, M., Herzog, R.W., Zolotukhin, I., Warrington, K.H. Jr Weigel-Van Aken, K.A., Hobbs, J.A., Zolotukhin, S., Muzyczka, N., Srivastava, A., 2008. Next generation of adeno-associated virus 2 vectors: point mutations in tyrosines lead to high-ef ficiency transduction at lower doses. Proc Natl Acad Sci U S A 105, 7827-7832. Zhong, L., Zhao, W., Wu, J., Li, B., Zolotukhi n, S., Govindasamy, L., Agbandje-McKenna, M., Srivastava, A., 2007. A dual role of EGFR protein tyrosine kinase signaling in ubiquitination of AAV2 capsids and viral second-strand DNA synthesis. Mol Ther 15, 1323-1330. Zoghbi, H.Y., Orr, H.T., 1995. Spinocerebellar ataxia type 1. Semin Cell Biol 6, 29-35. Zoghbi, H.Y., Orr, H.T., 2000. Glutamine repeats and neurodegeneration. Annu Rev Neurosci 23, 217-247.

PAGE 97

BIOGRAPHICAL SKETCH Kwang-Lu Amy Chen was born in 1978 in Taipei Taiwan. She graduated valedictorian from Warren County High School in Front Royal, Virginia in 1996. Following graduation, she attended Duke University in Durham, North Caro lina and obtained a B.S. degree in biology with minors in chemistry and psychology in 2000. Amy th en started working in a small biotech startup company, Cogent Neuroscience Inc., as an as sistant research scientist in Durham, North Carolina. For two years, her work include d the development and optimization of the in vitro rat model of Huntingtons Disease as a platform to screen for therapeutic small molecule compounds for future clinical trials. She also worked six months at a Howard Hughes Medical Institute laboratory under the direction of Dr. Bryan Cullen at the Duke Medical Center before entering the Interdisciplinary Program for Biomed ical Sciences leading to the degree for doctor of philosophy at the University of Florida. Du ring her graduate training, Amy has published first author papers for her contribution to the process of stem cell fusion in vitro and to elucidating the fate of neural stem cells following transplanta tion into mutant and transgenic mouse models. She has also presented work at several international conferences including the 9th International Conference on Neural Transplantation and Repair in 2005, International Society for Stem Cell Research in 2005 and 2007, Annual Conference for the Society for Neuroscience in 2005 and 2008, and the 59th Annual Symposium on Cancer Research: Stem Cells in Cancer and Regenerative Medicine in 2006.