<%BANNER%>

Uterine and Ovarian Vascular and Architectural Changes in Equids and Bovids; with Emphasis on Effect of the Conceptus.

Permanent Link: http://ufdc.ufl.edu/UFE0022842/00001

Material Information

Title: Uterine and Ovarian Vascular and Architectural Changes in Equids and Bovids; with Emphasis on Effect of the Conceptus.
Physical Description: 1 online resource (282 p.)
Language: english
Creator: Silva, Luciano
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: blood, conceptus, cows, doppler, early, mares, morphological, ovaries, pregnancy, uterus, vascular
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Uterine and Ovarian Vascular and Architectural Changes in Equids and Bovids; with Emphasis on Effect of the Conceptus The mammalian reproductive tract is the only organ system in the body where entire tissue layers and structures are in physiologically dynamic and cyclic changes. Angiogenesis is well known to be critical to assure blood supply for tissue growth and remodeling. Ovarian-produced steroids control reproductive tract remodeling, and cyclic rhythmicity of the hypothalamic-ovarian axis. We proposed that uterine and ovarian remodeling during pregnancy is modulated by the conceptus. Color-Doppler ultrasonography, in situ macroscopy, histology, immunohistochemistry, and real time PCR were the techniques used throughout this work. Special attention was paid to conceptus modulation of the uterine vascular and architectural changes prior to implantation in equids and bovids. In mares, transient changes in endometrial vascularity accompanied conceptus location changes during the mobility phase. Continued presence of the conceptus in the same horn (7-min average) stimulated an increase in vascularity. After fixation, endometrial vascularity was higher in the endometrium surrounding the fixed conceptus, than in other areas of the ipsilateral horn, or in the opposite horn. Differential dorsal thickening of the endometrium preceded embryonic orientation. An early vascular indicator of the future position of the embryo proper was discovered. Orientation of the embryonic vesicle occurred immediately after fixation. Embryonic dysorientation was associated with a flaccid uterus and defective encroachment of the dorsal endometrium. Asymmetric enlargement of the allantoic sac spontaneously corrected dysorientation. The dorsal endometrium at the fixed conceptus site was edematous and richly vascularized, exhibiting a high density of blood vessels and endometrial glands. Adherence points were found between the yolk sac surface and the dorsal endometrium. Location of VEGF and VEGFR-1 did not differ between endometrium of pregnant and cyclic mares, and VEGFR-2 was absent or weak at the luminal epithelium of cyclic mares, but exhibited greater presence on Days 14 and 21 of pregnancy. Proliferation was intense at the luminal epithelium during estrus and practically absent during the luteal phase. During pregnancy, all endometrium presented proliferative cells. VEGF and VEGFR-2 mRNA expression was higher in pregnant mares than in cyclic. Uterine vascularity during early pregnancy in mares was mediated by conceptus presence. In heifers, uterine vascularity increased in nonpregnant animals temporally associated with the preovulatory rise in estradiol. In pregnant heifers, uterine vascularity increased in the horn ipsilateral to the conceptus from Days 19 to 40. Vascularity of the contralateral horn remained low until Day 32, when it began to rise, reaching vascularity approximately similar to the ipsilateral horn around Day 40. The increase in vascularity temporally paralleled allantoic sac development inside of each uterine horn. In mares, greater blood flow to the preovulatory follicle was associated with higher pregnancy rate. In cows, corpus luteum blood flow increased and decreased with individual PGFM pulses during spontaneous luteolysis. Induction of increased CL blood flow by prostaglandin did not assure the occurrence of luteolysis. In summary, these data provided insight into the architectural and molecular changes in the reproductive tract of equids and bovids. These results set the stage for future experiments to understand more completely the role of the conceptus in regulating the uterine environment in favor of its development.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Luciano Silva.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Sharp, Daniel C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0022842:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022842/00001

Material Information

Title: Uterine and Ovarian Vascular and Architectural Changes in Equids and Bovids; with Emphasis on Effect of the Conceptus.
Physical Description: 1 online resource (282 p.)
Language: english
Creator: Silva, Luciano
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: blood, conceptus, cows, doppler, early, mares, morphological, ovaries, pregnancy, uterus, vascular
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Uterine and Ovarian Vascular and Architectural Changes in Equids and Bovids; with Emphasis on Effect of the Conceptus The mammalian reproductive tract is the only organ system in the body where entire tissue layers and structures are in physiologically dynamic and cyclic changes. Angiogenesis is well known to be critical to assure blood supply for tissue growth and remodeling. Ovarian-produced steroids control reproductive tract remodeling, and cyclic rhythmicity of the hypothalamic-ovarian axis. We proposed that uterine and ovarian remodeling during pregnancy is modulated by the conceptus. Color-Doppler ultrasonography, in situ macroscopy, histology, immunohistochemistry, and real time PCR were the techniques used throughout this work. Special attention was paid to conceptus modulation of the uterine vascular and architectural changes prior to implantation in equids and bovids. In mares, transient changes in endometrial vascularity accompanied conceptus location changes during the mobility phase. Continued presence of the conceptus in the same horn (7-min average) stimulated an increase in vascularity. After fixation, endometrial vascularity was higher in the endometrium surrounding the fixed conceptus, than in other areas of the ipsilateral horn, or in the opposite horn. Differential dorsal thickening of the endometrium preceded embryonic orientation. An early vascular indicator of the future position of the embryo proper was discovered. Orientation of the embryonic vesicle occurred immediately after fixation. Embryonic dysorientation was associated with a flaccid uterus and defective encroachment of the dorsal endometrium. Asymmetric enlargement of the allantoic sac spontaneously corrected dysorientation. The dorsal endometrium at the fixed conceptus site was edematous and richly vascularized, exhibiting a high density of blood vessels and endometrial glands. Adherence points were found between the yolk sac surface and the dorsal endometrium. Location of VEGF and VEGFR-1 did not differ between endometrium of pregnant and cyclic mares, and VEGFR-2 was absent or weak at the luminal epithelium of cyclic mares, but exhibited greater presence on Days 14 and 21 of pregnancy. Proliferation was intense at the luminal epithelium during estrus and practically absent during the luteal phase. During pregnancy, all endometrium presented proliferative cells. VEGF and VEGFR-2 mRNA expression was higher in pregnant mares than in cyclic. Uterine vascularity during early pregnancy in mares was mediated by conceptus presence. In heifers, uterine vascularity increased in nonpregnant animals temporally associated with the preovulatory rise in estradiol. In pregnant heifers, uterine vascularity increased in the horn ipsilateral to the conceptus from Days 19 to 40. Vascularity of the contralateral horn remained low until Day 32, when it began to rise, reaching vascularity approximately similar to the ipsilateral horn around Day 40. The increase in vascularity temporally paralleled allantoic sac development inside of each uterine horn. In mares, greater blood flow to the preovulatory follicle was associated with higher pregnancy rate. In cows, corpus luteum blood flow increased and decreased with individual PGFM pulses during spontaneous luteolysis. Induction of increased CL blood flow by prostaglandin did not assure the occurrence of luteolysis. In summary, these data provided insight into the architectural and molecular changes in the reproductive tract of equids and bovids. These results set the stage for future experiments to understand more completely the role of the conceptus in regulating the uterine environment in favor of its development.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Luciano Silva.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Sharp, Daniel C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0022842:00001


This item has the following downloads:


Full Text

PAGE 1

1 UTERINE AND OVARIAN VASCULAR AND ARCHITECTURAL CHANGES IN EQUIDS AND BOVIDS; WITH EMPHASIS ON EFFECT OF THE CONCEPTUS By LUCIANO ANDRADE SILVA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA I N PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Luciano Andrade Silva

PAGE 3

3 Especially to my parents Paulo Andrade Silva and Lucila Maria Andra de Silva To my sister and brothers Patrcia, Lucas and Phelipe To my mentors Dr. Daniel C. Sharp and Dr. Oliver J. Ginther

PAGE 4

4 ACKNOWLEDGMENTS I want to gratefully thank the two most important scientists and human being s that were responsible to introdu ce and teach me science, and who were the foundation for this dissertation and my evolution as a researcher First, Dr. Sharp for accept ing me as his graduate student for his guidance, critical thinking and patience, and for shar ing with me his knowledge and scientific inspiration throughout this dissertation Second, Dr. Ginther for his lessons during my first steps in science sharing his knowledge, patience, and critical thinking during the first research works of this dissertation. I would like to tha nk the members of my graduate committee, Dr. A. Ealy, Dr. P.J. Hansen, an d Dr. C. Wood for their insight and advice. I am thankful to Dr. A. Eal y for provid ing his laboratory for the molecular biolog ical analysis and to Dr. P.J. Hansen for provid ing his la boratory for part of the immunoh i stochemistry assays. I am deeply indebted to the Eutheria Foundation group, coordinated by Dr. O.J. Ginther, for provid ing me the opportunity to move to The United States and for introduc ing me to science. At the Foundation many thanks to Jane Ginther, Dr. M. Beg, Susan, Drs. Eduardo and Melba Gastal, Matt Utt, Andy, Dr. T. Acosta, Celina Checura Jlio Jacob Reno Arajo Bernardo Rodrigues and Lus Felipe Duarte for their friendship, knowledge, enthusiasm, and decisive i nputs in my research projects. I am also very thankful to the people that helped me with the technique s throughout this dissertation. Thank s to Dr. Sally Johnson for her advice and help during my first immunohistochemistry tests in her laboratory and also provid ing me the equipment and software used for the image analysis. Thanks a lot to Shawn Leslie and MaryAnn Dixon from the histology laboratory at the Vet School for the ir crucial help with my immunohistochemistry technique and donation of reagent s Tha nk s to Dr. Lilian Oliveira and Maria P a dua for their help

PAGE 5

5 during my first steps in the laboratory work and to Dr. Claudia Klein for her help with the real time PCR analysis I also want to thank the people from the Horse Research Center, e special ly Chris Cooper and Ann Jocelyn Cooper M y sincere appreciation for their effort, hard work, dedication and patience during my field experiments in Florida Thank s to Michelle Ero h Juliana Rodrigues, and Elizabeth Co ppelman for the ir help with the animal care duri ng my data collection. Also thanks to members of the Equine Program Group in the Department of Animal Science s Joel McQuagge, Dr. Saundra TenBroeck, and Dr. Lori Warren for their unconditional support during my research. I e specially want to thank all of my friends in Gainesville. T he Brazilians, t he re are too many to be all name d here and it is risk y to do so, because I could easily forget someone inadvertently To you all Brazilians, thanks a lot. Thanks to the graduate students from all programs in Anim al Science s Department for the ir friendship and interaction. Thanks to my friends and neighbors at Corry Village. They are from all sides of the word, international graduate students like me with similar challenges and hopes, for sharing their culture wit h me, for the ir friendship and unconditional readiness to help in any situation during this journey in t he United States. Thanks to you all that, despite potential unintentional name omission help ed me in a va riety of different things during my journey he re as a graduate student This help was crucial for this final result, for this dissertation. My sincere appreciation and thank s to you all.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ......................... 10 LIST OF FIGURES ................................ ................................ ................................ ....................... 11 ABSTRACT ................................ ................................ ................................ ................................ ... 15 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .................. 17 2 LITERATURE REVIEW ................................ ................................ ................................ ....... 20 Early Pregnancy ................................ ................................ ................................ ...................... 20 Equids ................................ ................................ ................................ .............................. 20 Bovids ................................ ................................ ................................ .............................. 24 Vascular Development ................................ ................................ ................................ ............ 26 Vasculogenesis and Angiogenesis ................................ ................................ ................... 26 Regulation of Vascular Development ................................ ................................ ............. 27 Vascular Endothelial Growth Factor Receptor System ................................ ................... 30 Fibroblast growth factor family (FGFs) ................................ ................................ .......... 33 Angiopoietins ................................ ................................ ................................ .................. 34 An giogenesis in the Female Reproductive Tract ................................ ............................. 34 Uterus ................................ ................................ ................................ ....................... 35 Ovaries ................................ ................................ ................................ ..................... 35 Pregnancy ................................ ................................ ................................ ................. 36 Doppler Ultrasonography ................................ ................................ ................................ ....... 39 Principles ................................ ................................ ................................ ......................... 39 Blood flow in the Reproductive Tract of Domestic Animals ................................ .......... 41 Blood Flow Assessed by Doppler Ultrasonography ................................ ....................... 43 Uterus during Estrous Cy cle ................................ ................................ .................... 43 Ovaries ................................ ................................ ................................ ..................... 45 Pregnancy ................................ ................................ ................................ ................. 49 3 CHANGES IN VASCULAR PERFUSI ON OF THE ENDOMETRIUM IN ASSOCIATION WITH CHANGES IN LOCATION OF THE EMBRYONIC VESICLE IN MARES ................................ ................................ ................................ ............ 52 Synopsis ................................ ................................ ................................ ................................ .. 52 Introduction ................................ ................................ ................................ ............................. 53 Materials and Methods ................................ ................................ ................................ ........... 55 Animals ................................ ................................ ................................ ............................ 55 Ultrasonography ................................ ................................ ................................ .............. 55

PAGE 7

7 Experiment 1 ................................ ................................ ................................ ................... 57 Experiment 2 ................................ ................................ ................................ ................... 58 Statistical Analyses ................................ ................................ ................................ .......... 60 Results ................................ ................................ ................................ ................................ ..... 60 Experiment 1 ................................ ................................ ................................ ................... 60 Experiment 2 ................................ ................................ ................................ ................... 61 Discussion ................................ ................................ ................................ ............................... 62 4 AN EARLY VASCULAR INDICATOR OF COMPLETED ORIENTATION OF THE EMBRYO AND THE ROLE OF THE DORSAL ENDOMETRIAL ENCROACHMENT IN MARES ................................ ................................ ........................... 76 Synopsis ................................ ................................ ................................ ................................ .. 76 Introduction ................................ ................................ ................................ ............................. 77 Materials and Methods ................................ ................................ ................................ ........... 80 Animals ................................ ................................ ................................ ............................ 80 Anatomy and Ultrasonography ................................ ................................ ........................ 80 End Points ................................ ................................ ................................ ........................ 81 Experiment 1 ................................ ................................ ................................ ................... 82 Experiment 2 ................................ ................................ ................................ ................... 83 Statistical Analyses ................................ ................................ ................................ .......... 85 Results ................................ ................................ ................................ ................................ ..... 86 Experiment 1 ................................ ................................ ................................ ................... 86 Experiment 2 ................................ ................................ ................................ ................... 87 Discussion ................................ ................................ ................................ ............................... 88 5 INCIDENCE AND NATURE OF DYSORIENTATION OF THE EMBRYO PROPER AND SPONTANEOUS CORRECTION IN MARES ................................ ......................... 100 Synopsis ................................ ................................ ................................ ................................ 10 0 Introduction ................................ ................................ ................................ ........................... 101 Materials and Methods ................................ ................................ ................................ ......... 103 Results ................................ ................................ ................................ ................................ ... 105 Discussion ................................ ................................ ................................ ............................. 107 6 CONCEPTUS MEDIATED ENDOMETRIAL VASCULAR CHANGES PRIOR TO IMPLANTATION IN MARES AN ANATOMIC, HISTOMORPHOMETRIC AND VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR SYSTEM IMMUNOLOCALIZATION AND GENE EXPRESSION STUDY ................................ ... 118 Synopsis ................................ ................................ ................................ ................................ 118 Introducti on ................................ ................................ ................................ ........................... 119 Materials and Methods ................................ ................................ ................................ ......... 124 Animals ................................ ................................ ................................ .......................... 124 Endometrial Samples ................................ ................................ ................................ ..... 126 Endometrial Morphometry ................................ ................................ ............................ 127 Immunohistochemistry ................................ ................................ ................................ .. 128

PAGE 8

8 RNA Ex traction and Quantitative RT PCR ................................ ................................ .. 129 Statistical Analyses ................................ ................................ ................................ ........ 130 Results ................................ ................................ ................................ ................................ ... 130 Macroscopy ................................ ................................ ................................ ................... 130 Morphometry ................................ ................................ ................................ ................. 132 Immunohistochemistry ................................ ................................ ................................ .. 134 Real Time PCR ................................ ................................ ................................ .............. 135 Discussion ................................ ................................ ................................ ............................. 136 7 UTERINE VASCULAR PERFUSION CHANGES DURING EARLY PREGNANCY IN CATTLE ASSESSED BY COLOR D OPPLER ULTRASONOGRAPHY ................... 158 Synopsis ................................ ................................ ................................ ................................ 158 Introduction ................................ ................................ ................................ ........................... 159 Materia ls and Methods ................................ ................................ ................................ ......... 164 Animals ................................ ................................ ................................ .......................... 164 Ultrasonography ................................ ................................ ................................ ............ 164 Experiment ................................ ................................ ................................ .................... 167 Blood Samples and Hormone Assays ................................ ................................ ............ 168 Statistical Analyses ................................ ................................ ................................ ........ 169 Results ................................ ................................ ................................ ................................ ... 170 Discussion ................................ ................................ ................................ ............................. 174 8 RELATIONSHIP BETWEEN VASCULARITY OF THE PREOVULATORY FOLLICLE AND ESTABLISHMENT OF PREGNANCY IN MARES ............................ 197 Synopsis ................................ ................................ ................................ ................................ 197 Introduction ................................ ................................ ................................ ........................... 198 Materials and Methods ................................ ................................ ................................ ......... 200 Animals ................................ ................................ ................................ .......................... 200 Doppler Ultrasonography ................................ ................................ .............................. 201 End Points ................................ ................................ ................................ ...................... 202 Blood Samples and Hormone Assays ................................ ................................ ............ 204 Statistical Analyses ................................ ................................ ................................ ........ 204 Results ................................ ................................ ................................ ................................ ... 205 Discussion ................................ ................................ ................................ ............................. 206 9 TEMPORAL ASSOCIATIONS AMONG PULSES OF 13,14 DIHYDRO 15 KETO CATTLE ............................. 213 Synopsis ................................ ................................ ................................ ................................ 213 Introduction ................................ ................................ ................................ ........................... 214 Materials and Methods ................................ ................................ ................................ ......... 217 Experiment 1 Spontaneous Luteolysis ................................ ................................ ....... 218 Experiment 2 Systemically Induced Luteolysis ................................ ......................... 219 Experiment 3 Locally Induced Luteolysis ................................ ................................ .. 219 Experiment 4 PGFM Pulses ................................ ................................ ....................... 220

PAGE 9

9 Blood Samples and Hormone Assays ................................ ................................ ............ 221 Statistical Analyses ................................ ................................ ................................ ........ 223 Results ................................ ................................ ................................ ................................ ... 223 Experime nt 1 Spontaneous Luteolysis ................................ ................................ ....... 223 Experiment 2 Systemically Induced Luteolysis ................................ ......................... 224 Experiment 3 Locally Induced Luteolysis ................................ ................................ .. 224 Experiment 4 PGFM Pulses ................................ ................................ ....................... 226 Discussion ................................ ................................ ................................ ............................. 227 10 GENERAL DI SCUSSION ................................ ................................ ................................ ... 240 LIST OF REFERENCES ................................ ................................ ................................ ............. 249 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 282

PAGE 10

10 LIST OF TABLES Table page 3 1 Means SEM for vascular end points of the endometrium on Day 13 of pregnancy, obtained without knowledge of identity of mare or horn. Experiment 2. .......................... 69 3 2 Means SEM for relationships between the beginning of exposure of a uterine horn to an embryonic vesicle and stimulation of uterine contractions and endometrial vascularity. Experiment 2. ................................ ................................ ................................ 70 4 1 Means ( SEM) for days of fixation and detection of the orientation indicators and clock face positions for each experiment. ................................ ................................ ......... 94 5 1 Means SEM for events associated with normal orientation and dysorientation. .......... 112 6 1 Endometrial histomorphometric study. Analysis of the vascular supply, endometrial glands area, and number of endometrial glands between the uterine horns and among four reproductive statuses in mares. ................................ ................................ ................. 146 6 2 Listing of sense (SE) and antisense (AS) primers used for quantitative RT PCR. .......... 147 7 1 Objective colored pixel analysis (average of three cross sectional images) for validation of the subjective vascular scores of the endometrium and mesometrium on Day 25 of pregnancy. a ................................ ................................ ................................ ...... 186

PAGE 11

11 LIST OF FIGURE S Figure page 3 1 Two images of cross sections o f uterine horns showing minimal and maximal colored areas of the endometrium from the Doppler flow mode. ................................ ...... 71 3 2 S cores for endometrial vascularity and uterine contractility in bred mares in which an embryo was either detected or not detected by Days 9 12. ................................ ............... 72 3 3 Percentage of uterine horns with adequate Doppler signals for spectral analyses of an artery in the mesometrial attachment. ................................ ................................ ................ 73 3 4 T ime averaged maximum velocity and puls atility index in vessels of the mesometrial attachment on Days 10 16 in pregnant mares. ................................ ................................ .. 74 3 5 U terine color Doppler end points and contractility in the middle segment of the uterine horn of f ixation and the opposite horn. ................................ ................................ .. 75 4 1 Diagram of the transrectal placement of a linear array ultrasound transducer, showing the spatial relationships among the uterine horns, transducer, and s onograms. ................................ ................................ ................................ ......................... 95 4 2 structure at the periphery of the embryonic vesicle and B mode sonogram illustrating the meth od for determining th e endometrial encroachment ratio ................................ ..... 96 4 3 Sonograms illustrating early endometrial indicators of the futur e position of the embryo proper and the embryo proper. ................................ ................................ .............. 97 4 4 E ndometrial encroachment ratio (dorsal thickness divided by ventral thickness) and three end points for assessing the extent of vascular perfusion of the endometrium centralized to the day of fixa tion. ................................ ................................ ...................... 98 4 5 E ndometrial encroachment ratio (dorsal thickness divided by ventral thickness) centralized to first day of detection of the early indicator. ................................ ................ 99 5 1 Illustration of the determination of clock face positions relative to the mesometrial ................................ ................................ ................................ 113 5 2 Mean ( SEM) for encroachment ratio and clock face position of the embryonic pole ................................ ................................ ................... 114 5 3 Color Doppler ultrasonograms of the conceptus at Day 19 for normal orientation and dysorientation. ................................ ................................ ................................ .................. 115 5 4 Comparison of the expansion of the allantoic sac for a conceptus with normal orientation and dyso rientation of the embryo proper ................................ ...................... 117

PAGE 12

12 6 1 Uterine transrectal ultrasound scanning positioning diagram of the uterus with the obtained ultrasonograms from scanning of the posterior segment of each uterine horn. ................................ ................................ ................................ ................................ 148 6 2 In s itu morphological study of the endometrium. ................................ ............................ 149 6 3 Endometrial histomorphometric study. ................................ ................................ ............ 150 6 4 Immunolocalization of VEGF (A) and VEGFR 1 (B) in mare endometrium. Similar staining was obtained for all reproductive statuses used in this study. ............................ 151 6 5 Immunolocalization of VEGFR 2 in endometrium from pregnant mares on Day 21 and Day 14, and from cyclic mares during folli cular and luteal phases ......................... 153 6 6 Immunolocalization of Ki 67 in endometrium from pregnant mares on Day 21 and Day 14 and from cyclic mar es during folli cular and luteal phases ................................ 155 6 7 Effect of the reproductive statuses on the relative abundance of VEGF mRNA, VEGFR 2 mRNA, and V EGFR 1 mRNA in mare endometrium ................................ .. 157 7 1 Diagram of the transrectal placement of the linear array ultrasound transducer, showing the spatial relationships among the uterine horns (dorsal view), transducer and sonograms ................................ ................................ ................................ ................ 1 87 7 2 E ndometrial and mesometrial vascularity scores, and resistance index for assessing the extend of vascular perfusion in 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every day from Days 9 to 18 ....... 188 7 3 U terine echotexture and tone scores from 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every da y from Days 9 to 18. ................................ ................................ ................................ ................................ ..... 189 7 4 E stradiol and progesterone serum concentrations from 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every day from Days 9 to 18. ................................ ................................ ................................ ..... 190 7 5 P ercentage of corpus luteum area with blood flow and corpus luteum area from 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every day from Days 9 to 18. ................................ ................................ ......... 191 7 6 E ndometrial and mesometrial vascularity scores, and vascular resistance index for assessing the extend of vascular perfusion in 11 pregnant heifers fro m both uterine horns (horn containing the embryo or fetus and opposite horn) every other day from the day of ovulation until Day 8, every day from Days 9 to 30, and every other from Days 30 to 60. ................................ ................................ ................................ .................. 192

PAGE 13

13 7 7 U terine echotexture and tone scores, and for percentage of corpus luteum area with blood flow and corpus luteum area in 11 pregnant heifers from both uterine horns (horn containing the embryo or fetus and opposite horn) every other day from t he day of ovulation until Day 8, every day from Days 9 to 30, and every other from Day 30 to 60. ................................ ................................ ................................ ........................... 193 7 8 H eart rate during embryonic and fetal stages from in 11 pregnancies in heifers assessed every day from Days 24 to 30 and every other from Days 30 to 60 ................ 194 7 9a Embryo stage in cows assessed by color Doppler ultrasonography from Days 20 to 38 (Flow, Power and Spectral modes). ................................ ................................ ............ 195 7 9b Fetal stage in cows assessed by color Doppler ultrasonography from Days 44 to 90 (Flow, Power and Spectral modes). ................................ ................................ ................. 196 8 1 Color Doppler sonograms illustrating blood flow signals in the wall of preovulatory follicles of a mare that became pregnant and a mare (two images in different planes) that did not become pregnant. ................................ ................................ .......................... 210 8 2 D iameter of the preovulatory follicle, plasma estradiol concentrations, and B mode characteristics of the follicle wall in mares that became pregnant or nonpregnant ........ 211 8 3 E nd points obtained by Doppler ultrasonography for the preovulatory follicle in mares that became pregnant or nonpregnant ................................ ................................ .. 212 9 1 C oncentration of progesterone and percentage of corpus luteum area with blood flow signal s during spontaneous luteolysis ................................ ................................ ............. 232 9 2 V alidation of blood flow estimation by using percentage of maximum value within each heifer for three end points. ................................ ................................ ....................... 233 9 3 P rogesterone concentration and percentage of luteal area with blood flow signals in a prostaglandin treated group and controls. ................................ ................................ ........ 234 9 4 P rogesterone and luteal responses to a systemic (25 mg) or intrauterine (IU; 1 or 2 mg) injection of PGF2 10 days after ovulation. ................................ ............................ 235 9 5 S pectral Doppler responses to systemic (25 mg ) and intrauterine (IU) injection of PGF2 10 days after ovulation ................................ ................................ ....................... 236 9 6 C oncentration of progesterone and PGFM and percentage of corpus luteum with blood flow signals at 12 h intervals in association with spontaneous luteolysis du ring the luteolytic period ................................ ................................ ................................ ........ 237 9 7 C oncentration of PGFM for PGFM pulses and associated changes in percentage of corpus luteum with blood flow signa l s during the luteolytic period .............................. 238

PAGE 14

14 9 8 Four selected individual examples from the luteolytic period for PGFM concentration and percentage of corpus luteum with blood flow signals during sets of sampling every hour for 12 h. ................................ ................................ .......................... 239

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy UTERINE AND OVARIAN VASCULAR AND ARCHITECTURAL CHANGES IN EQUIDS AND BOVIDS; WITH EMPHASIS ON EFFECT OF THE CONCEPTUS By Luciano Andrade Silva May 2009 Chair: Daniel C. Sharp Major: Animal Molecular and Cellular Biology The mammalian reproductive trac t is the only organ system in the body where entire tissue layers and structures are in physiological ly dynamic and cyclic changes A ngiogenesis is well known to be critical to assure blood supply for tissue growth and remodeling Ovarian produced steroids control r eproductive tract remodeling and cyclic rhythmic ity of the hypothalamic ovarian axis. W e proposed that uterine and ovarian remodeling during pregnancy is modulated by the conceptus. Color Doppler ultrasonography, in situ macroscopy, histology, i mmunohistochemistry and real time PCR were the techniques used throughout this work Special attention was paid to conceptus modulation of the uterine vascular and architectural changes prior to implantation in equids and bovids In m ares t ransient chang es in endometrial vascular ity accompanied conceptus location changes during the mobility phase C ontinued presence of the conceptus in the same horn (7 min average ) stimulate d an increase in vascularity. After fixation, endometrial vascularity was higher i n the endometrium surrounding the fixed conceptus, than in other areas of the ipsilateral horn, or in the opposite horn. D ifferential dorsal thickening of the endometrium precede d embryonic orientation An early vascular indicator of the future position of the embryo proper was discovered. Orientation of the embryonic vesicle occu rred immediately after fixation Embryonic d y sorientation was associated with a flaccid

PAGE 16

16 uterus and defective encroachment of the dorsal endometrium. Asymmetric enlargement of the a llantoic sac spontaneous ly corrected dysorientation. T he dorsal endometrium at the fixed conceptus site was edematous and richly vascularized exhibiting a high density of blood vessels and endometrial glands. Adherence points were found between the yolk s ac surface and the dorsal endometrium. Location of VEGF and VEGFR 1 did not differ between endometrium of pregnant and cyclic mares and VEGFR 2 was absent or weak at the luminal epith elium of cyclic mares but exhibited greater presence on Days 14 and 21 of pregnancy P roliferation was intense at the luminal epithelium during estrus and practically absent d uring the luteal phase. During pregnancy, all endometr ium presented proliferative cells. VEGF and VEGFR 2 mRNA expression w as highe r in pregnant mares t han in cyclic Uterine va scularity during early pregnancy in mares was mediated by conceptus presence In heifers u terine vascularity increased in nonpregnant animals temporally associated with the preovulatory rise in estradiol. In pregnant heifers, uter ine vascularity increased in the horn ipsilateral to the conceptus from Days 1 9 to 40. Vascularity of the contralateral horn remained low until Day 32, when it began to rise, reaching vascularity approximately similar to the ipsilateral horn around Day 40 The increase in vascularity temporally paralleled allantoic sac development inside of each uterine horn In m ares g reater blood flow to the preovulatory follicle was associated with higher pregnancy rate. In c ows c orpus luteum blood flow increased and d ecreased with individual PGFM pulses during spontaneous luteolysis. Induction of increased CL blood flow by prostaglandin did not assure the occurrence of luteolysis. In summary these d ata provide d insight into the architectural and molecular changes in t he reproductive tract of equids and bovids These results set the stage for future experiments to understand more completely the role of the conceptus in regulating the uterine environment in favor of its development.

PAGE 17

17 CHAPTER 1 INTRODUCTION In mammals, t he organs of the female reproductive tract are morphologically cyclic throughout reproductive life E ntire tissue layers and structures are in a constant process of apoptosis, renew al and /or remodeling during physiological conditions These capabilities d uring adult life make them unique. C yclic architectural changes are dependent o n the vascular system as a source of nutrients and, in turn vessels need to be constant ly remodeling to parallel tissue changes It is well know n that angiogenesis plays an ess ential role during tissue growth and remodeling H ypoxia is observed in grow ing nonvascularized tissue s after they reach 300 m in size and this leads to production of angiogenic factors to promot e vascular development by ramification of exist ing vessels from the peripher al area U terine ovarian vascular and architectural changes during the reproductive cycle are controlled by the cyclic plasma hormonal changes regulated by the hypothalamic ovarian axis. The main players controlling tissue remodeling in th e reproductive organs are the steroid hormones estrogens and progesterone However, during pregnancy cyclic reproductive tract remodeling is interrupted and changes are now modulated by the conceptus in accordance with its needs E arly pregnancy in all mammalian species is a critical time when a series of important interactive events between the embryo/fetus (conceptus) and the mother should be perfectly coordinated to assure continu ation of pregnancy to term. For the purpose of this study, early pregnan cy is defined as the period from fertilization to development of a functional placenta. Critical times of development during early pregnancy could be categorized as: 1) Intrao viduct al embryonic stage; 2) I ntra uterine embryonic development prior to implanta tion ; 3) M aternal recognition of pregnancy ; 4) I mplantation and; 5) P lacentation. For all of these events, a healthy

PAGE 18

18 conceptus guarantees successful communication and interaction with the mother to avoid early pregnancy termination. In addition to the conc eptu s s genetic profile, the most import aspect for keep ing the conceptus health y is the uterine environment The uterus provides a source of nutrients, is immunologically modulat ed and its epithelial cells surface permit s conceptus maternal cellular inte ractions. V ascular development and remodeling in both maternal and fetal sides are essential for all morphological changes during early pregnancy Blood supply is also important to support the activity of the e ndometrial glands which provide secretory prod ucts critical for nourishment of the conceptus prior to final developmen t of the functional placenta. Th e research presented in this dissertation is divided in to seven chapters. The chapters 3 to 6 present results of studie s of the vascular and architectur al changes during early pregnancy in mares. The c hapter 7 presents of a comprehensive study of the vascular and architectural changes during the two first month s of pregnancy in cows. The c hapter 8 presents a stud y on the effect of the perifollicular blood flow o n fertility of the oocyte in mares. The c hapter 9 presents a study of the relationship between corpus luteum blood flow and the luteolytic process in cows. In this work we demonstrated that endometrial vascular and architectural remodeling is modula ted by the conceptus well before implantation to creat e a uterine environment that will support initial conceptus development, and assure optimal conditions for all interactive events between the embryo/fetus and the mother This includes mobility and fixa tion of the conceptus in equids, conceptus elongation in bovids and maternal recognition of pregnancy, uterine immune modulation, implantation, and placentation in both species Our main hypothes es are: 1) t ransient changes in vascular perfusion of the en dometrium occur in association with changes in location of the conceptus in mares; 2) d ifferential thickening of the uterine wall at the mesometrial attachment begins before the earliest indication that

PAGE 19

19 orientation of the embryonic vesicle has occurred in mares; 3) d orsal endometrial encroachment is the component to define dysorientation or successful orientation in mares; 4) t he conceptus locally modulates endometrial vascular changes and remodeling prio r to implantation in mares; 5) u terine vascular perfu sion changes in cows are mediated by conceptus presence and development, and occur at equivalent time points of pregnancy as reported in mares; 6) h igher pregnancy rate is associated with greater blood flow to the preovulatory follicle in mares, and; 7) t h e increase in c orpus luteum blood flow precedes spontaneous luteolysis in cows.

PAGE 20

20 CHAPTER 2 LITERATURE REVIEW Early Pregnancy Equids Equids are the only common eutherian mammals in which real time images of conceptus (embryo, extraembryonic membranes and f luid) migration, fixation, and orientation and conversion from yolk sac to allantoic sac placentation can be studied sequentially in vivo and detectable without disturbance. This research capability results from the availability of transrectal ultrasonogra phy, the large size of the fluid filled embryonic vesicle (conceptus), and the close proximity of the uterine wall to the rectal wall (Ginther 1995 b ). The equine uterus is Y shaped, and the length of each uterine horn is equivalent to the length of the ute rine body (Ginther 1992). The embryonic vesicle has a spherical shape result ing from its glycoprotei n cover or capsule T h e carbohydrate composition of the capsule apparently undergoes considerable modification during the mobility phase, maternal recogniti on of pregnancy phase, and fixation and orientation phase (Chu et al. 1997). The equine embryonic vesicle enters a uterine horn on Day 6 (ovulation = Day 0; Weber et al. 1991, Battut et al. 1997). The early embryonic vesicle is spherical and mobile. Based on a uterine ligation study (Griffin & Ginther 1993), the conceptus apparently arrives in the uterine body after Day 8 (Day 0 = ovulation). When first detected by transrectal ultrasonography on Days 9 or 10, the vesicle is frequently (60% of time) in the u terine body (Ginther 1983a, Leith & Ginther 1984). Thereafter, the frequency of entries into the uterine horns increases and a phase of maximum mobility begins, involving all parts of the uterus. Maximum mobility extends over Days 12 14 when the vesicle gr ows from about 9 to about 15 mm in diameter. Mobility has been characterized by visualizing nine segments of the uterus in approximately equivalent lengths (three for each horn

PAGE 21

21 and the body) and locating the vesicle in one of the segments every 5 min for 2 h (Ginther 1983a). The propulsive force for embryo mobility is uterine contraction as indicated by similar temporal changes in uterine contractility and vesicle mobility (Griffin & Ginther 1993, Cross & Ginther 1988), reduced mobility after experimental i nhibition of contractions (Leith & Ginther 1985), and reduced contractions in a uterine horn into which vesicle entry is prevented by experimental cornual ligation (Griffin & Ginther 1993). The mobility favors physiologic exchange between the relatively sm all conceptus and large uterus (Ginther 1983a). In this regard, results of confinement of the conceptus to one uterine horn indicate that the conceptus locally stimulates uterine turgidity and edema, as well as contractility (Griffin & Ginther 1993), and t hat movement throughout the uterus is required to prevent the bilaterally active uterine luteolytic mechanism ( McDowell et al. 1988, Griffin & Ginther 1993 ). C essation of mobility is called fixation and occurs on Days 15 17 (Ginther 1983b). The site of fix ation is at a flexure in the caudal segment of one of the uterine horns without regard to the side of ovulation. It has been postulated that fixation occurs at the flexure because it is a physical impediment to continued mobility of the growing vesicle (Gi nther 1983b, Gastal et al. 1996). Increasing uterine turgidity combined with a decrease in uterine diameter due to the influence of the mobile vesicle further contributes to fixation in the most restricted area I n other words, f ixation occurs due to incre asing vesicle growth and a reciprocal relationship between increasing uterine tone and decreasing uterine diameter (Gastal et al. 1996). Orientation of the embryonic vesicle refers to the position of the embryonic disc or embryo proper at the periphery of the vesicle (embryonic pole) relative to the position of the mesometrial attachment. The pattern of orientation (antimesometrial versus mesometrial) is fairly constant within species but differs among species (Mossman 1971, 1987). The direction in

PAGE 22

22 which th e embryonic disk faces relative to the mesometrial attachment after orientation is completed contributes to species differences in the pattern of development of the fetal membranes and the site of attachment of the umbilical cord. When first detected by ul trasound (Days 19 to 22), the equine embryo proper is in the ventral hemisphere of the embryonic vesicle or opposite to the mesometrial attachment (Ginther 1983b). It is unlikely that orientation occurs before embryo mobility ceases. In this regard, simula ted embryonic vesicles rotated or rolled during intrauterine location changes (Ginther 1985). These observations indicate that orientation occurs between the day of fixation (Day 16) and the earliest reported day of ultrasonic identification of the embryo proper (Day 19 ; see Figure 4 1 page 94 ). About 50 to 75% of the wall of the equine embryonic vesicle over Days 16 to 18 is composed of two cell layers the ectoderm and endoderm, and the third layer, the mesoderm is present in and at the periphery of the e mbryonic disc ( Ewart 189 7 Ginther 1998 a ). The mesoderm of the remaining portion develops between the two cell layers and differentiates into connective tissue surrounding the embryonic disc and results in a three layered portion of the vesicle wall at the embryonic pole. Thus, the three layered or embryonic pole of the vesicle can be expected to have greater tensile strength than the opposite pole, although this has not been determined directly. Beginning on approximately Day 17, the embryonic vesicle begi ns to lose its spherical form when imaged in cross section relative to the uterine horn. The ultrasound image of the vesicle becomes oblong, triangular, or irregular in shape (Ginther 1983b). The apex of the triangular shapes tends to be at the dorsal regi on of the horn. However, the shape of the vesicle does not remain static, and its outline changes frequently during periods of continuous ultrasound observations with the scanner (Ginther 1998 a ). These shape changes are attributable to myometrial contracti ons which may exert a kneading or massage like action on the fixed

PAGE 23

23 vesicle. Disproportional thickening of the dorsal uterine wall occurs by Day 17 and accounts for the nonspherical shapes of the vesicle as it begins to encroach upon the two layered membran e (Ginther 1983b). It has been postulated (Ginther 1983b, 1985) that equine embryo orientation results from the interaction of at least three factors: 1) differences in tensile strength between the thin (two cell layers) and thick (three layers) portions o f the vesicle wall; 2) asymmetrical encroachment of the uterine wall on the vesicle, resulting from differential thickening of the upper turgid uterine wall at the mesometrial attachment; and 3) the massaging action of uterine contractions. A distinct, smo oth, and strong capsule encloses the embryonic vesicle until about Day 21 (Betteridge et al. 1982) and is an additional factor that likely favors the orientation process. The surface of the equine embryonic vesicle develops adhesive qualities (Denker 2000) which may aid in anchoring the vesicle after orientation is completed. The beginning of the implantation process in mares starts around Day 40 of pregnancy but the beginning of the functional placenta is not observed until Day 60 with complete formation of microcotyledons about Day 120 ( Allen & Stewart 2001, Sharp 2000). Based on the number of tissues separating maternal from fetal blood, the equine placenta is classified as epitheliochorial a s all six tissue layers (epithelium, stroma, and endothelium) a re present in both maternal and fetal sides (Amoroso 1952) After entering the uterus, the embryo must be detected by the mother and the luteolytic mechanism abrogated so as to maintain progesterone synthesis by the corpus luteum (Roberts et al. 1996). Thi s is the first luteal response to pregnancy, better known as maternal recognition of pregnancy. High embryo loss rates are common at this time in all domestic animals and women, and are higher if the conception resulted from assisted reproductive technique s (Mclean 1987;

PAGE 24

24 Diskin & Morris 2008; Vanderwall 2008). The mobility phase of the equine embryonic vesicle is well established as an important event to maintain luteal function (McDowell et al. 1988). The e arly pregnancy is a critical time for embryo survi val in mares, likely to in others mammals species. Many are the factors involved in early embryo loss and securely the uterine vascular and architectural changes will support an adequate uterine environment for embryo survival and development. High rate of embryo are reported during the two first months of pregnancy ranging from 2.6% to 24.0% (Woods et al. 1987, Carnevale & Ginther 1992, Vanderwall 2008). Bovids In cows, the morula or early blastocyst enters in to the uterus around Day 5 after ovulation and the embryonic cells organize into an inner cell mass and the trophoectoderm which will give origin respectively to the embryo and conceptus membranes (Betteridge & Flchon 1988). Morulae and blastocysts exhibit a spherical shape. Using ultrasound asses sment, Kastelic et al. (1988) reported that on Day 11, 73% of the embryonic vesicles were still spherical and 23% were oblong in cows. However, by about six days of intrauterine existence, the cow spherical embryonic vesicle elongates and begins to take th e tubular shape of the uterine lumen. By Day 17 in cows, the elongated conceptus occupies the entire length of the ipsilateral horn and by Day 20 the conceptus extends throughout the entire lumen of the contralateral horn. Detailed studies about early conc eptus morphogenesis and early placentation in cows are available (Greenstein et al. 1958; King et al. 1980; 1981; 1982). Intimate contact between trophoblast and uterine epithelium is observed first by the trophoblastic cells near the embryonic disc on Da y 19 and one day later by trophoblastic cells near caruncular regions. By Day 20, the allantoic sac begins to develop, vitelline vessels form a rich plexus, and the primitive embryonic heart appears. Microvillous indentations are also

PAGE 25

25 observed in the apica l border of the trophoblast cells in apparent response to maternal cell interactions. Around Days 23 to 25, polynucleate cells are observed and the allantois continues to expand rapidly, becoming increasingly vascularized. By Day 24, almost all caruncles e xhibit microvillous interditations. Placentation is not a uniform process, it begins in the immediate vicinity of the embryo and spread towards each end of the conceptus; characterized by adhesion and interdigitation of microvilli between maternal epitheli um and trophoblast cells. Expansion of the allantois is dramatic between Days 28 and 30. At this time, the allantois fuses with the trophoectoderm originating the chorion. Between Days 31 and 33, the primary chorionic villi with vascularized mesenchymal c ores are observed. They are found as rounded pink patches and represent the future fetal cotyledons. These morphological descriptive works demonstrated that physical cellular interactions between the endometrium and conceptus in cows begin early in pregna ncy, around Day 20. Caruncular areas with early interdigitation are observed around Day 25. Primordial placentomes with microvilli, a tenuous attachment of maternal and fetal epithelia, and a primitive vascular system appear around Day 32 (King et al. 1979 ; Schlafer et al. 2000). Ruminants present a cotyledonary placenta and, based on the morphology and number of tissues separating maternal from fetal blood, the bovine placenta is classified as synepitheliochorial (Amoroso 1952). All cell layers (epithelium stroma, and endothelium in both maternal and fetal sides) are present The trophoblast cells are in direct apposition to the surface epithelial cells of the uterus and the fetal villi (cotyledon) and the caruncle together form the placental units known a s placentomes. After the first month of pregnancy, placentation continues with the caruncles inducing villous hypertrophy and hyperplasia to form the cotyledons, which become larger and more complex placentomes around Day 40 (King et al. 1979; Schlafer et al.

PAGE 26

26 2000). As commented before for mares, the highest rates of embryo loss in cows are also observed during the two first months of pregnancy the time of the intense uterine vascular and architectural changes. Embryo l osses can reach around 50% after embr yo transfer procedure (Drost et al. 1999, Sartori et al. 2003). Between Days 21 to 45, the rate of embryo loss varies from 10% to 21% ( Moreira et al. 2001, Chebel et al. 2003, Chebel et al 200 4 ). Vascular Development Vasculogenesis and Angiogenesis New b lood vessels can be formed by two different mechanisms, vasculogenesis or angiogenesis. Vasculogenesis is the process of de novo formation of blood vessels from mesodermally derived precursor cells, the an gioblasts (Risau & Flamme 1995 Charnock Jones et a l. 2004 ) This process occurs mainly during fetal development. H owever, it has been reported in human th at vasculogenesis in the adult is accomplished by angioblast recruitment from bone marrow in response to ischemic lesions (Takahashi et al. 1999 a ). The first e vidence of blood vessel development appears outside of the embryo proper, i n the yolk sac, as focal aggregations of mesenchymal cells, known as blood islands (Conway et al. 2001). In addition, v asculogenesis is the first step in development of the c ardiovascular system, the first organ system to develop and reach functionality during the embryonic stage (Risau 1997) Angiogenesis in the other hand, is the process by which new blood vessels develop from pre existing blood vessels ( Folkman & Shing 19 92 Charnock Jones et al. 2004 ). E ndothelial cells are the central players of the vascular structure and the ir specialized functions are critical to maintain vascular integrity, transport and barrier substances In the angiogenic process, the endothelium r epresents cellular seeds for the formation of new blood vessel s (Charnock Jones et al. 2004). The vascular network in adult s is in general formed and stable and the angiogenic

PAGE 27

27 process is normally a rare event. However certain organs in special circumst ances are able to stimulate vascular development and/ or remodeling. Angiogenesis is essential in physiological conditions of tissue repair ( wound and fracture healing), corpus luteum formation, endometrial growth, and embryonic implantation and placentatio n (Folkman & Shing, 1992, Reynolds et al. 1992) In addition, the angiogenic process is also observed in such pathological conditions as tumor growth and metastasis, rheumatoid arthritis, retinopathies, chronic inflammation and psoriasis ( Folkman 1995) A multi step sequence of events is required for sprouting angiogenesis and ha s been described (Jain 2003) Initially, vasodilation and increased vascular permeability are observed. In the sequence, proteases leading to degradation of the basement membrane a re activated and endothelial cells begin to proliferate. These cells migrate towards a chemotactic stimulus and they will assembl e to form a tube with a lumen. F inalizing the angiogenic process pericytes are recruited to the external surface of the capill ary conferring stabilization (Jain 2003, Cleaver & Melton 2003). Regulation of Vascular Development The vascular system is responsible for interchange among tissues and organs of nutrients, gases, hormones, growth factors, and also cellular wastes (Faber & Thornburg, 1983). During tissue remodeling, vascular system development is orchestrated by stimulatory and inhibitory signals. Local equilibrium of angiogenic factors and its inhibitors will control the angiogenic process switch. There are many critical growth factors involved in the physiological regulation and maintenance of blood vessel formation, and the actions of these molecular players must be very carefully orchestrated in terms of time, space and dose so as to form a functioning vascular network (Jain 2003; Yancopoulos et al. 2000; Risau 1997; Zygmunt et al. 2003). Cytokines, hormones, growth factors, hypoxia, hypoglycemia, shear stress and stretch, components of the

PAGE 28

28 extracellular matrix and their receptors, matrix metalloproteinases (MMPs) and th eir tissue inhibitors (TIMPs), proteases, fibrin, inflammatory cells and pericytes are all part of the known regulators of angiogenesis (Zygmunt et al. 2003). The correct oxygen concentration in tissues is vital for cellular survival. An e xcess of oxygen c auses oxidative damage and, on the other hand, insufficient oxygen causes metabolic disruption. The cellular or tissue response to adapt to oxygen concentration cha nges could be acute or chronic. In chronic responses, specific mRNA transcript levels are al tered either by transcriptional activation or by alterations in mRNA stability (Charnock Jones et al. 2004). An inadequate vascular supply creates hypoxia limiting tissue growth. T his is a physiological signal able to stimulate the angiogenic process Hypo xia inducible factor (HIF 1 alpha) is normally produced by tissues in hypoxi c states and stimulates transcriptio n of angiogenic factors (Werner 1997; Zygmunt et al. 2003). However, other cellular mechanisms tha n hypoxia are also capable of induc ing accumul ation of this factor. HIF 1 alpha is rapidly ubiquitinated and destroyed when tissues are normoxi c However in low oxygen concentration, HIF 1 alph a is stabilized and its cellular levels increase (Epstein et al. 2001). The VEGF family members are the main players in the formation of new vessels (angiogenesis and vasculogenesis) and are responsible for caus ing mitogenic, angiogenic and survival responses mainly in endothelial cells (Ferrara 2004). However, several studies have reported mitogenic effects cau sed by VEGF family members in nonendothelial cells as well, such as retinal pigment epithelial cells, pancreatic ducts cells, and Schwann cells (Guerrin et al. 1995, Oberg Welsh et al. 1997, Sondell et al. 1999 Fan et al. 2008 ). VEGF A mRNA expression is induced by hypoxia. HIF 1 alpha therefore, is a key mediator of VEGF A expression and in response to hypoxia, it binds to specific enhancer elements, resulting in

PAGE 29

29 increased gene transcription. The VEGF A gene has a promoter region, a hypoxia responsive e lement (HRE) that when b ound to HIF 1 alpha initiates transcription (Roy et al. 2006). Several major growth factors, including epidermal growth factor, TGF alpha, TGF beta, keratinocyte growth factor, IGF 1, FGF, and PDGF, hormones as TSH, ACTH, and gonad otropins, are also described as up regulators of VEGF mRNA expression (see Ferrara 2004 for details). Estrogen is recognized as one of the driving forces for increased uterine blood flow through both rapid and delayed actions, via binding to its receptors in the u terine a rtery wall, especially at the u terine a rtery endothelium (Albrecht et al. 2003; Hery anto & Rogers, 2002; Mendelsohn 2002). In isolated human endometrial epithelial and stromal cell cultures, estrogen upregulates VEGF mRNA and protein levels (Charnock Jones et al. 1993, Shifren et al. 1996) and its effect is completely blocked when an estrogen receptor inhibitor is used (Huang et al. 1998). VEGFR 1 and VEGFR 2 expression is significantly reduced in endometrial vessels in the absence of estrad iol (Nayak & Brenner 2002) suggesting that estradiol is also essential for maintenance of VEGF receptors in the endometrial vasculature. A recent study suggest ed that estradiol may regulate VEGFR 2 expression in endometrial endothelial cells indirectly thr ough the modulation of VEGF that, in a paracrine mechanism stimulates the expression of VEGFR 2 (Herv et al. 2006). Kazi et al. (2005) have shown that expression of VEGF by endometrial epithelial cells in rodents involves the recruitment of both estrogen receptor alpha and HIF 1 to the VEGF promoter. Estrogen also induces endothelial nitric oxide synthase (eNOS) expression in the uterus (Yallampalli & Dong 2000, Han et al. 2005). U p regulation of eNOS and VEGF by estrogens provides the two factors necessa ry for exudation of fluids from the microvasculature generating the endometrial edema.

PAGE 30

30 F actors other than from the VEGF family also have important roles during vascular development and remodeling. The fibroblast growth factor family (FGFs) is important to sti mulate proliferation and modulation of endothelial cells, inhibit i on of apoptosis, and providing a chemotactic effect on endothelial cells (Klagsbrun 1992) The growth factor family of angiopoietins is important to vessel maturation, stabilization, and remodeling (Rowe et al. 2003; Yancopoulos et al. 2000; Wulff et al. 2000). Nitric oxide is another factor involved in tissue vascularization by stimul ating vessel dilation and permeability, and decreasing tone. Recently, a study has shown the effect of pro staglandin E 2 (PGE 2 ) in angiogenesis (Tamura et al. 2006) PGE 2 induced tube like formation of cultured human umbilical vein endothelial cells (HUVECs). The authors suggested, with the use of an inhibitor of the arachidonic acid metabolism and/or an inhibi tor of VEGF receptors, that PGE 2 directly stimulates angiogenesis, apart from VEGF signaling, and also further induces VEGF expression in HUVECs (Tamura et al. 2006). Vascular Endothelial Growth Factor Receptor System The VEGF family consists of five memb ers: VEGF A, B, C, D, and placental growth factor (PlGF). VEGF A is the best characterized member and the most important due its specific and potent mitogenic function in endothelial cells F our different isoforms have been described for VEGF A ; VEGF 1 21 VEGF 165 VEGF 189 and VEGF 206 (subscript numbers indicate the number of amino acids in the protein chain ). They are generated by alternative splicing of a single pre mRNA with an encoding region (14 kb) contain ing eight exons (Cross et al. 2003). Less frequent splice variants were also identified as VEGF 145 and VEGF 183 (Ferrara et al. 2003, Ferrara 2004, Otrock et al. 2007). The isoforms differ in their ability to bind heparin sulfate and extracellular matrix (Cross et al. 2003). VEGF 121 is freely diff usible in tissue whereas the other isoforms are mainly bound to

PAGE 31

31 the extracellular matrix and only become bioavailable after release through proteolysis. VEGF 165 has intermediate bind ing proprieties. VEGF 165 and VEGF 121 are the most abundant isoforms in the endometrium ( Shifren et al. 1996, Torry et al. 1996 Ferrara 2004 ). VEGF A was first discovered as a tumor secreted protein that increased microvascular permeability to plasma protein ( first named as vascular permeability factor ; Senger et al. 1983 ) L ate r it was found to be the primer regulator of both physiological and pathological angiogenesis ( Ferrara & Henzel 1989, Dvorak 20 05, Carmeliet 2005, Ferrara 2009 ). Because of initial discovery and their prop e r ties, VEGF family members are also known as vascu lar promoting factor s (VPF) due to a strong ability to induce vascular leakage (Se nger et al. 1983, Cullinan Bove & Koos 1993, Dvorak 2005). P lacenta l growth factor (PlGF) is predominantly produced by the trophoblast cells and exists as four different kno wn isoforms produced from a single PlGF primary transcript They elicit their f unctions in both autocrine and paracrine manners through the receptors NRP 1, NRP 2 and VEGFR 1 (Roy et al. 2006). PlGF has reduced expression in quiescent vascu lature but is up regulated along with VE GFR 1, in pathological and hypoxic conditions (Carmeliet et al. 2001). O n the other hand, in trophoblast cells the expression of PlGF is reduce d and soluble VEGFR 1 increased during hypoxia (Shore et al. 1997). The VEGF family membe rs act mainly t h rough transmembrane t yrosine kinase receptors, VEGFR 1 (Flt 1), VEGFR 2 (Tlk 1 or KDR) VEGFR 3, and also through the neuropilin receptors (NP 1 and NP 2) selectively expressed on neurons and vascular endothelium (Dvorak 2005) VEGFR 1 and VEGFR 2 are expressed in both endothelial and nonendothelial cells in the endometrium, suggesting a pleiotropic role (Chenna zhi & Nayak 2009). VEGFR 2 appears to be the major receptor responsible for mediating the pro angiogenic effects of VEGF A (Ferrara

PAGE 32

32 2004, Roy et al. 2006). To elicit the actions of VEGF A, the receptors dimerize and undergo i ntracellular autophosphorylation resulting in a cascade of protein activation downstream VEGFR 1 is expressed in endothelial cells, pericytes, placental trophobla st cells, osteoblasts, monocytes/macrophages, renal mesangial cells, and in some hematopoietic stem cells (Zachary & Gliki 2001). VEGFR 1 knockout mice die in early stages of embryogenesis due to disorganization of blood vessels and overgrowth of endotheli al cells (Roy et al. 2006). VEGFR 1 transmits only weak mitogenic signals in endothelial cells, but when dimerized with VEGFR 2, presents strong mitogenic signaling prope r ties (Huang et al. 2001). The functions and signaling properties of VEGFR 1 can be di fferent depending on the developmental stage of the animal and cell type s (Ferrara et al. 2003). However, VEGFR 1 was initially proposed to be a binding to VEGFR 2 (Park et al. 1994). A soluble form of VEGFR 1 was found to be involved in preeclampsia. This soluble receptor contains only the extracellular domain and can bind to the soluble VEGF depleting its circulating levels and causing the symptoms of preeclampsia (Maynard et al. 2003). VEGFR 2 is the primary receptor which signal s the i ntracellular pathways of VEGF A. A ctivation of VEGFR 2 stimulates vasodilatation, endothelial c ell migration proliferation and prosurvival signal s This receptor is expressed in en dothelial cells, circulating endothelial progenitor cells, pancreatic duct cells, retinal progenitor cells, and megakaryocytes (Ferrara et al. 2003, Ferrara 2004). VEGFR 2 undergoes dimerization and ligand dependent tyrosine phosphorylation and, consequent ly, induces phosphorylation of several proteins in endothelial cells such as phospholipase C, PI 3 kinase, Ras GTPase activating protein, and the Src family (Guo et al. 1995, Eliceiri et al. 1999). VEGF induces endothelial cell growth by activating the

PAGE 33

33 Raf Mek Erk pathway, requiring protein kinase C in the place of the usual Ras (Takahashi et al. 1999 b ). V EGFR 3 binds VEGF C and VEGF D but its expression is restrict ed to lymphatic endothelial cells and some fenestrated blood vascular endothelial cells (Kaip ainen et al. 1995). The neuropilins, Nrp 1 and Nrp 2, have roles in immunology and neuronal development but they also have been reported to be involved in angiogenesis ( Klagsbrun et al. 2002). Fibroblast growth factor family (FGFs) There are at least 23 c haracterized FGFs that bind one or more of the four known receptors ( Ornitz & Itoh 2001). The FGF receptor system is critical for normal trophoblast and inner cell mass interactions and development but their role in mediating angiogenesis is less well cha racterized (Rossant & Cross 2001). FGFs stimulate endothelial cell proliferation and migration in vitro and induce sprouting of blood vessels in vivo in the chick choriallantoic membrane and cornea ( Cross & Claesson Welsh 2001). FGF2 was first isolated fr om human placental tissue and is known as a stimulant of endothelial cell mitosis and angiogenesis in vivo Trophoblast cells also produce and release FGF2 in culture ( Moscatelli et al. 1988, Hamai et al. 1998). The t emporal and spatial expression of FGF 4 in animal models suggests that it could be a modulator of placental angiogenesis. FGF4 is expressed in the villi stroma adjacent to fetal blood vessels (Anteby et al. 2004). FGF7 has also been suggested to be involved in placental vascular development (Wo llenhaupt et al. 2005). There is evidence that FGF expression is reg ulated by sex steroid hormones (Fujimoto et al. 1996). FGF2 and FGFR 1 mRNA are significantly higher during the proliferative phase than in the secretory phase of human endometrium suggest ing estrogen mediation (Sangha et al. 1997). In general, the FGF family is pluripotent exerting many actions in reproductive tissues. The

PAGE 34

34 temporal and spatial expression of FGF and its receptors suggest they may be players in angiogenesis during implantati on and early placentation (Torry et al. 2007). Angiopoietins Angiopoietins ( Ang 1 and Ang 2 ) binds to the Tie 2 receptor to activate a signaling system involved in vessel maintenance, growth and stabilization (Carmeliet 2005). Ang 1 and Ang 2 compete for Tie 2 receptor binding and serve as functional antagonists to each other Ang 1 binding to Tie 2 promotes vascular maturation by recruiting periendothelial support cells, while Ang 2 binding promotes destabilization of blood vessels allowing initiation of neovascularization (Eklund & Olsen 2006, Wakui et al. 2006). The Ang 1/Ang 2 proteins determine the angiogenic response ( Sato et al. 1995). Ang 2 mRNA is expressed only at sites of vascular remodeling in adults. Ang 2 antagonizes the Ang 1 action by preven ting excessive sprouting and branching of blood vessels (Maisonpierre et al. 1997). Ang 1 is the most studied angiopoietin and its mRNA is detected during the development of the myocardium in embryos and later in the mesenchyme surrounding blood vessels (D avis et al. 1996). Angiogenesis in the Female Reproductive Tract F emale reproductive organs contain some of the few tissues in the body during adult age that exhibit cyclic periods of growth and regression and the growth these tissue s is extremely rapid As an example, preovulatory follicle tissue in cows weighs around 200 mg and five days after ovulation, the corpus luteum weight s around 6 g (Reynolds et al. 1992 ). The reproductive tract of mammals is in continuous cyclic change and vascular remodeling is essential for tissue growth Angiogenesis is a common feature in the female reproductive tract in physiological conditions during the reproductive cycle and pregnancy (follicular development, corpus luteum

PAGE 35

35 formation, endometrial remodeling ; Reynolds et al. 1992, Jaffe 2000 ) and it is an important component of pathological conditions as well (tumors, follicular cysts, polycystic ovar ies and endometriosis in women; Zygmunt et al. 2003). Uter us E ndometrial vessels are unique because their functions are pr imarily orchestrated by the level of steroid hormones, estrogens and progesterone ( Chennazhi & Nayak 2009 ). The nature of the signals responsible for induction and control of endometrial angiogenesis has been the focus of many studies (Bourlev et al. 2006; Girling & Rogers 2005; Herv et al. 2006). The crucial factors regulating blood vessel formation belong to the endothelial growth factor family and the most important is the VEGF A with its two receptors, VEGFR 1 and VEGFR 2 (Roy et al. 2006; Ferrara et a l. 2003; Ferrara 2004; Yancopoulos et al. 2000). However, VEGF A mRNA and protein are expressed in the luminal epithelium, glands, and stroma but not in endothelium of uterine vessels (Nayak & Brenner 2002, Charnock Jones et al. 1993, Shifren et al. 1996, Torry et al. 1996). VEGF A can be found in the endothelium by immunohistochemistry but it may be a result of de tection of the VEGF A bound to its receptors and therefore it do es not confirm its production by these cells (Chennazhi & Nayak 2009). Ovaries In the ovaries, small primordial follicles do not contain a capillary network, but they are dependent o n proximal stromal vessels (Geva & Jaffe 2000). In primary follicles, one or two arterioles develop and, when the follicle antrum appears, the follicles exhibit a vascular ring in the theca layers A vascular network is established at the periphery of the follicle at the time of rapid follicle growth and differentiation. Shortly before ovulation, these thecal capillaries

PAGE 36

36 develop a fenestrated appearance s prout rapidly and invade the granulosa cell layer. At the time of ovulation, the follicle collapses and the granulosa cells come in contact with the blood vessels and the corpus luteum starts to be formed (Reisinger et al. 2007). The corpus luteum doubles its size and cell number every 60 hours (Reynolds et al. 1994) with 50 85% of the cell proliferation occurring in the microvascular compartment (Reynolds et al. 1994, 2000, Redmer et al. 2001). The role of VEGF in follicle development has been demonstrated Treatment with VEGF antibodies immediately after ovulation totally suppressed corpus luteum vascular development in monkeys (Fraser et al. 2000). In addition, preovulatory follicles injected with sVEGFR 1 which sequestrated VEGF subsequently exhibited im paired ovulation (Hazzard et al. 2002). Administration of a VEGF trap in the early and mid luteal phase showed that VEGF presence is critical for corpus luteum development and function (Fraser et al. 2005). Pregnancy V ascular development and remodeling in both maternal and fetal sides is essential for successful pregnancy in all mammal ian species P articular time points are : 1) prior to implantation, 2) implantation, 3) placentation, and 4) throughout pregnancy accompanying fet al development to term (Reyno lds et al. 2006; Torry et al. 2007). Before and at the time of implantation, the vascularized endometrium provides an appropriate uterine environment, through endometrial gland secretions to support embryo survival and development (Burton et al. 2007). Aft er implantation, development and expansion of the placental villus vasculature serves to supply the initial fetal demands for nutrients and oxygen. Throughout pregnancy materno placental vasculature remodeling is continuous and accounts for the gradual i ncrease in fetal transport of nutrients, respiratory gases, and wastes during its growth (Reynolds et al. 2006; Torry et al. 2007). Use of an angiogenic inhibitor before or right after implantation in mice

PAGE 37

37 resulted in resorption of all embryos (Klauber et al. 1997), and support s the hypothesis that angiogenesis is a critical component of normal implantation/placentation in early stages of pregnancy. The fetal vascular system is initia ted through vasculogenesis. This process begins in the embryo around 21 da ys post conception in humans (Knoth 1968) and at an equivalent stage of development in equine and bovine embryos ( Greenstein et al. 1958, Betteridge et al. 1982, Betteridge & Flchon 1988) but angioblastic cell cords are observed earlier at the time of mes oderm development. Studies have suggested that basic fibroblast growth factor (FGF 2 or bFGF) is involved in recruitment of the vascular progenitor cells during placental vill us development (Ferriani et al. 1994, Shams & Ahmed 1994). However, VEGF A ha s be en described as the main factor responsible for the angioblastic cell cord formation and is highly expressed in the embryo during early pregnancy ( Shore et al. 1997). R egulation of the angiogenic process during early pregnancy development, more specificall y during implantation and placentation, is very similar to the angiogenic process observed during tumor development. In both situations, proliferation, migration and invasion through extracellular matrix are observed and the peripherical vasculature serves as the source for recruitment of the new blood supply (Zygmunt et al. 2003, Charnock Jones et al. 2004, Kaufmann et al. 2004). However, two big differences are also observed between early pregnancy and tumor vascular development. During pregnancy, invasio n and formation of new vessels is self limited compared with vessel formation in tumors but the mechanisms involved i n this during pregnancy remain unknown In addition, the embryo not only access es the maternal vascular system, but also stimulates the for mation of its own vascular system (vasculogenesis and angiogenesis), a fact not observed in tumors (Zygmunt et al. 2003).

PAGE 38

38 The mechanisms involved in early local stimulation of uterine vascularity by the conceptus in domestic animals have not been clarified One consideration is that the early conceptus alters endometrial vascularity through production of vascular stimulants. Estrogen is recognized as one of the driving forces for increased uterine blood flow through both rapid and delayed actions, via bindi ng to its receptors in the uterine artery wall, and especially at the uterine artery endothelium (Albrecht et al. 2003; Heryanto & Rogers 2002; Mendelsohn 2002). For example estrogens stimulate increased uterine blood flow in the sow, cow, and ewe (Ford 1 982). In vitro studies have shown that Day 12 porcine embryos (Ford et al. 1982 a ) and Day 16 bovine embryos (Shemesh et al. 1979; Chenault 1980) produce estrogens. M arked production of estrogen by the equine conceptus occurs as early as Day 12 (Zavy et al. 1984; Raeside et al. 2004). Thus, estrogen has vasostimulatory properties, and production by the conceptus occurs on the days that the concept uses of horses, swine, and cattle are stimulating local uterine vascularity. The blastocysts of many species also secrete a variety of prostaglandins, and it has also been proposed that conceptus prostaglandins stimulate increase d uterine blood flow (Lewis 1989). The nature of signals responsible for induction and control of endometrial angiogenesis has been the focu s of many studies (Bourlev et al. 2006; Girling & Rogers 2005; Herv et al. 2006). Impaired vascularization duri ng pregnancy, more specifically during late stages, is well known to be related to pregnancy failure and suboptimal or abnormal fetal developmen t (Reynolds et al. 2006; Torry et al. 2007). Increased blood flow is an important mechanism to increase transplacental exchange in pregnancy. Measurements of blood flow in the uterine arteries in pregnant cows showed an approximately 4.5 fold increase in t he second half of pregnancy compared with the first half (Reynolds et al. 1986). Maternofetal vascular growth and remodeling have been the focus of many studies during late pregnancy because of their

PAGE 39

39 relationship with compromised fetal growth (Reynolds & R edmer 1995; Reynolds et al. 2005; Reynolds et al. 2006; Torry et al. 2007). Experimental models of compromised pregnancy have been used to study uterine vascular adaptation as the fetal requirements of placental exchange increase during pregnancy (Reynolds et al. 2006) Mayhew et al. (2004) suggested that altered placental vascular development and expression of angiogenic factors are driven by placento fetal hypoxi c conditions. Many studies have shown an association between increased gene expression of the major angiogenic factors, as VEGF and eNOS, with altered placental growth and vascular development (Reynolds & Redmer 2001; Redmer et al. 2005; Reynolds et al. 2005) Doppler Ultrasonography Principles Transrectal B mode (gray scale) ultrasonography revol utionized diagnosing and monitoring of biologic and pathologic reproductive events in cattle and horses. An important advantage of this technique is that a structure can be evaluated in real time while the area is being scanned systematically. B mode is us ed not only to identify and measure structures, but also to assess physiologic status. Moreover, the transvaginal route is used for ultrasound guided entry of specific anatomic targets for recovering or samplin g of fluids and tissues (e.g., oocyte aspirati on, luteal biopsy) and inserting substances (e.g., embryos, semen, follicular factors, hormones, drugs). Doppler technology has had an increasing impact in human medicine and science for more than two decades but is new for theriogenolog y and animal resear ch purposes. Doppler ultrasound adds blood flow information to the B mode image about anatomy and function (Ginther & Utt 2004). Recently, a book reviewing the principles and applied aspects of examination of the reproductive tract of cows and horses using Doppler ultrasonography has been published (Ginther 2007).

PAGE 40

40 Doppler ultrasound involves two modalities (spectral mode and color flow mode) with distinctly different methods for targeting an area of interest. For the spectral mode, the blood flow characteri stics in a focused area of a vessel are assessed by placement of a sample gate cursor into the B mode or color mode image of the lumen of a targeted vessel. The changes in Doppler shift frequencies and signal amplitudes are displayed in the form of a sine wave, and each waveform represents a cardiac cycle. Real velocit y measurements are dependent on knowledge of the insonation angle between the transducer to the vessel. The maximum point in the traced outline represents the peak systolic velocity (PSV). Sim ilarly, the low point just before the next systolic increase represents the end diastolic velocity (EDV), and an average of the maximum values over the time of a cardiac cycle is called the time averaged maximum velocity (TAMV). Blood flow volume (mL/min) can be automatic calculated by the instrument if the ultrasound insonation angle related to the vessel, diameter of the vessel, and mean velocity of the flow ar e known or able to be measured. Doppler indices are alternatives to velocity Doppler measurement s. They are especially useful when sampling small, tortuous vessels in which a straight segment is not available to estimate the angle of insonation and consequently the real Doppler velocities. Indices are ratios of velocity measurements and therefore are independent o n the Doppler angle. Moreover, the indices are interpretable and relatable to the hemodynamics, proximal or downstream to the point of arterial examination. The most frequently used indices are: resistance index (RI) and pulsatility index (PI ). As an example, a progressive decrease in RI and PI is observed in the umbilical artery as pregnancy advances in humans (Reuwer et al. 1984). The interpretation is that placento fetal resistance or vascular impedance decreased as pregnancy advanced, impl ying an increase in blood flow.

PAGE 41

41 Color flow imaging estimates blood velocities and encodes and displays it as colored regions superimposed on the B mode image. The extent of local perfusion or blood flow area within the tissues can be estimated with color f low and quantified dire ctly at the level of the tissue This approach to color Doppler evaluation has appeal for both clinical and research purposes because it focuses directly on the tissue or structure of interest. The approach can consider the entire st ructure or tissue area in real time, rather than being confined to a still image or to focal evaluation from placement of a sample gate within a given vessel. Estimating and recording the extent of perfusion as indicated by the number and size of colored s pots or areas on the image can be done by scoring ( e.g. 0 4 for none to maximal). An important advantage of estimating is that the entire structure, or portion of a structure can be evaluated in real time while the area is being scanned systematically. S coring systems are subjective but s ubjectivity can be converted to objectivity, especially for research, by videotaping the images so that scoring can be done without knowledge of source or scoring can be done by a second operator online or offline who is unaware of the source of the image or even the hypothesis under test. Also, colored spots or pixel aggregates can be selected from the images, extracted, and counted by specific software. Blood flow in the Reproductive Tract of Domestic Animals I nterest in understand ing the physiological control of the blood flow changes in the reprodu ctive tract of domestic animals many experiments were done measur ing blood flow volume or perfusion of the reproductive organs and co rrelating it with the metabolism of gases and nutrients. At that time, blood flow was measured by different invasive and indirect technique s such as the use of surgically implanted catheters placed in the vein of the organ of interest. Using this approach, a substance could be systemic ally injected and

PAGE 42

42 a series of blood samples collected from the catheterized vein. Based on the diffusion equilibrium, the blood flow was estimated. At that time, m any studies using this technique or a nother similar technique w ere used to study the blood flow of the reproductive organs during the different reproductive stat es Also, blood flow was correlat ed with the organ me tabolism of gases and nutrients (Huckabee et al. 1961, 1968, 1970; Caton et al. 1974 Anderson et al. 1977 Greiss & Anderson 1969, 197 0 ). many studies measuring blood flow to reproductive tract of cows, sows and ewes were done using electromagnetic probes. These probes were surgically fixed around main uterine and ovarian arteries. Blood flow was then electronically calculated As with previous approaches to estimate blood flow, this technique is still invasive and need s a surgical procedure to implant and fix the probes but as an advantage, the assessment of blood flow was calculat ed automatically Using this technology, blood flow ha d been studied in cows (Ford et al. 1979 Davis & Collier 1985 Wolfenson et al. 1985, Knickerbocker et al. 1986 ), sows (Ford & Christenson 1979, Ford et al. 1982a 1982b ), and ewes ( Abrams & Sharp 1977 Ford 1982 Roman Ponce et al. 1983, Caton & Kalra 1986 ). Starting from late 80 s, B mode ultrasonography (gray scale) represented a major technological advance for reproductive research and as a clinical tool for reproductive diagnosis in large animals Recently, Doppler ultraso und technology has begun to be used in assess ing blood flow in the reproductive tract of large animals. As commented in the previous topic Doppler technology has been used in human medic al diagnostics and science for more than t hree decades. However, this technology is new for theriogenology and animal research purposes in large animals. Ten years ago, a few papers on Doppler ultrasonography in reproduction of large animals could be found. In the decade since, an expon ential increase in the

PAGE 43

43 number of publications has occurred but the research is still centralized in three main laboratories in the world ; one in Japan, another in Germany and a third in the United States. The majority of the research has been related to b asic reproductive physiology and in the last three years, more applied research h as emerged building the foundations for the use of this technology as a routine to o l for theriogenologists. A brief literature review of the accomplish ments using Doppler ul trasonography to assess uterine and ovarian blood flow during estrous and pregnancy in horses and cows is presented bellow Blood Flow Assessed by Doppler Ultrasonography Uterus during Estrous Cycle C yclic variations in blood flow at the uterine arteries have been studied by electromagnetic probes implanted surgically in cows (Ford et al. 1979 Ford & Chenault 1981 ), sheep (Roman Ponce et al. 1983) and sows (Ford & Christenson 1979 Ford et al. 1982a, b ). These studies mainly demonstrated that the rhythmic changes in blood flow are correlated with the circulating levels of steroids hormones, suggesting its regulation by the cyclic altering levels of estrogens and progesterone. Only a few studies on the uterine vascular perfusion have been done during the es trous cycle using Doppler ultrasonography. Bollwein et al. ( 1998 ) published the first work evaluating uterine blood flow in large animals using Doppler ultrasonography in mares It was a very simple experiment with the objective o f develop ing technique s fo r scanning the uterine arteries and interpret ing blood flow using spectral Doppler data. Further, t he same group evaluated uterine blood flow changes at the uterine arteries during the estrous cycle in mares (Bollwein et al. 2002 a ) and cows (Bollwein et al 2000) and measure ments were made using the spectral mode to calculate resistance index (RI) pulsatility index (PI) and /or time averaged maximal velocity

PAGE 44

44 (TAMV) A ll of these end points are indicators of the organ capability to receive blood. The results were similar to previous works using electromagnetic probes (Ford et al. 1979, Ford & Chenault 1981). The uterine blood flow increase d in parallel to the increased circula ting levels of estrogens during the estrous cycle As commented before, there are tw o main approaches for using Doppler ultrasonography to evaluate blood flow changes ; the color mode and spectral mode. S pectral mode is used to assess blood flow in a main vessel such as the uterine artery or ovarian artery and provides evaluation of the va scular hemodynamic s downstream of the point of measurement, in a sine wave format representing blood flow resistance. C olor mode, in the other hand, provides a two dimensional picture of the organ structure in gray scale with a colored map overlaid, indica ting the degree of organ blood perfusion. Color mode indicates visually the functionality of a specific structure based on the degree of blood perfusion, o n the other hand, spectral Doppler indicates a global picture of the functionality of the entire orga n as it reflects how well or poorly blood perfuses the organ, based on vascular resistance proximal to the organ. Spectral Doppler may not detect small vascular changes observed in specific tissues or structures inside of the organ however Silva et al. (2005) and Silva & Ginther (2006), and Silva et al. (2009) respectively in mares and heifers were the first evaluation of the uterine blood flow changes using color mode Doppler ultrasonography. Blood perfusion was studied at the endometrium and mesometr ium areas during the estrous cycle and pregnancy In mares, transient changes in endometrial vascularity accompany conceptus location changes during the mobility phase and, after fixation, endometrial vascularity is higher in the endometrium surrounding th e fixed conceptus, than in other areas of the ipsilateral horn, or in the opposite horn. In heifers, uterine vascularity increase s

PAGE 45

45 in nonpregnant animals temporally associated with the preovulatory rise in estradiol. In pregnant heifers, uterine vascularit y increase s in the horn ipsilateral to the conceptus from Days 19 to 40. Vascularity o f the contralateral horn remains low until Day 32, when it beg ins to rise, reaching vascularity approximately equal to the ipsilateral horn around Day 40. The increase in vascularity temporally parallel s allantoic sac development inside of each uterine horn. Ovaries The majority of published works using Doppler technology in large animals are directed to evaluating blood flow changes in the ovarian function. This is under standable due to the fact that the ovaries are the controlling center of reproducti on and present cyclic dynamic events like follicular waves, follicular growth dominance, ovulation, corpus luteum formation, and luteolysis. A d escription of ovarian blood f low during the estrous cycle in mares has been published (Bollwein et al. 2002 a ) Authors demonstrated a positive correlation between increased ovarian blood flow and increasing circulating levels of estrogens A more detailed study of corpus luteum perfus ion in mares using color Doppler ultrasonography indicated increased blood flow temporally associated with corpus luteum activity (Bollwein et al. 2002b). Extensive vascular formation (angiogenesis) occurs in the follicular wall during its development unti l ovulation (Geva & Jaffe 2000, Reisinger et al. 2007) and blood flow changes have been correlated with the several different stages of follicular development including first follicular waves in cows (Acosta et al. 2005), preovulatory LH surge in cows (Aco sta et al. 2003), preovulatory follicle in mares (Gastal et al. 2006), cystic follicles in cows (Rauch et al. 2008), transitional follicles in mares (Acosta et al. 2004 a Gastal et al. 2007 ), dominance and selection of follicles in mares (Acosta et

PAGE 46

46 al. 200 4 b ), among many others. The se reports presented aspects of blood flow changes related to the physiological morpholog y and hormonal changes in ovarian follicles. Recently, a couple of studies evaluated the relationship between follicular blood flow and repr oductive efficiency. The extent of the follicular wall with color Doppler detected blood flow has been positively associated with pregnancy rate in women (Chui et al. 1997, Coulam et al. 1999, Bhal et al. 2001, Borini et al. 2001). However, there was no si gnificant relationship between pregnancy rate and uterine artery or intraovarian Doppler pulsatility index (Bhal et al. 2001). A recent in vitro fertilization study in women found that well vascularized follicles early in a follicular wave and on the day o f hCG treatment late in the wave resulted in a higher pregnancy rate s after embryo transfer (Shrestha et al. 2006). Results of another study indicated that examining vascular impedance distal to an intraovarian artery by spectral Doppler indices may be use ful in assessing the quality of an oocyte (Du et al. 2006). These studies set the stage for the following animal studies. In animals, t he first published practical work using color Doppler ultrasonography was done in mares and is presented in the Chapter 8 of this dissertation. We found that high perifollicular blood perfusion after hCG injection is correlated with elevated pregnancy rates. After this first study, a similar study was done in heifers and our findings in mares were confirmed to occur in this specie s (Siddiqui et al. 2008). In a subsequent step, Siddiqui et al. (2009) reported positive correlation between high vascular perfusion of the preovulatory follicle wall and in vitro fertilization rates and blastocyst cleavage rates. As a practical tool Doppler ultrasonography was also tested to differentiate persistent ovarian follicles and luteinized follicles (cysts) from normal follicles (Rauch et al. 2008). It was found that Doppler ultrasonography is more precise than regular B mode ultrasonograph y in characteriz ing follicle

PAGE 47

47 patterns and subsequently select ing an appropriated treatment. Follicles in cows treated with gonadotropins were monitored to evaluate blood flow changes, but no statically significant correlation between gonadotropin treatment and increase of ovarian blood flow was detected (Honnens et al. 2008 a, b ). Utt et al. (2009) evaluated corpus luteum blood flow as an earl y indicator of pregnancy status in cows. They concluded that evaluation of the corpus luteum blood flow is not specif ic and sensitive enough to predict pregnancy D etailed studies of the physiological aspects of blood flow changes during corpus luteum formation and luteolysis in mares and cows have been published and can be reviewed in mares (Ginther et al. 2007 b ) and co ws (Acosta & Miyamoto 2004, Miyamoto et al. 2005). During early corpus luteum development, blood flow increase d paralleled to circulating progesterone levels and was associated with potential of the corpus luteum to produce progesterone (Acosta et al. 2003 ). The foregoing demonstrate the tremendous power of color Doppler ultrasonography as a research tool with which to understand the reproductive tissue responses to blood flow needs. Studies involving placement of transducers on the ovarian artery and insert ion and entrapment of radioactive microspheres of various diameters have shown that blood flow to the corpus luteum (CL) decreases dramatically in association with luteolysis (Niswender et al. 1976). It has been elusive as to whether the decreased luteal b lood flow preceded or accompanied the luteolytic process (Knickerbocker et al. 1988). However, rather than a decrease in luteal blood flow as an initial step in the luteolytic process, recent color Doppler studies in cattle indicated that luteal blood flow initially and transiently increased during or prior to a decrease in plasma progesterone during exogenous PGF induced luteolysis (Acosta et al. 2002) and spontaneous luteolysis (Shirasuna et al. 2004 a, b, c Miyamoto et al. 2005). E pisodic increase in cor pus luteum blood flow during luteolysis in cows paralleled the

PAGE 48

48 individual pulses of prostaglandin F metabolite (PGFM ; Ginther et al. 2007 ). In c ontrast to reports of an association between transient ly increase d blood flow and initiation of luteolysis in ca ttle, recent color Doppler studies in horses failed to find a similar blood flow phenomenon associat ed with either PGF induced (Ginther et al. 2006) or spontaneous (Ginther et al. 200 8 ) luteolysis. Treatment with PGF caused a short term increase in progest erone within 5 min of administration that remained elevated for 10 min before decreas ing A change in luteal blood flow did not occur until a decrease occurred at 24 h. Luteolysis, as indicated by decreasing progesterone, began well before the beginning of a detectable decrease in blood flow. The temporal association between changes in blood flow and progesterone concentrations during spontaneous luteolysis was studied at 24 h intervals. There was no indication that either an acute increase or decrease in l uteal blood flow occurred prior to or at the beginning of the precipitous decrease in progesterone concentration in mares. In the study of induced luteolysis in cows (Acosta et al. 2002), a single injection of a PGF analogue (cloprostenol) was used. The ra tio of colored spots from color Doppler signals of blood flow was used as a quantitative index of blood flow. Progesterone concentration decreased significantly between 0 h and 1 h posttreatment and blood flow transiently increased between 0 h and 0.5 h an d then decreased after 2 h. Thus, blood flow increased while progesterone was decreasing. In the study of spontaneous luteolysis in cows (Shirasuna et al. 2004 c ), blood sampling and blood flow determinations were made every 12 h. Blood flow increased betw een 16 and 17 days postestrus and then decreased A PGF metabolite (13,14 dihydro 15 keto PGF 2 ; PGFM) was elevated at 17 and 18 days, and plasma progesterone began to decrease at 18 days. The authors concluded that luteal blood flow increased before proge sterone decreased

PAGE 49

49 and proposed that the acute increase of intraluteal blood flow is a universal phenomenon prior to spontaneous luteolysis. Pregnancy Uterine blood flow changes during pregnancy have been an object of interest of many studies. Using elect romagnetic probes, it was shown that blood flow increase d in the uterine artery ipsilateral but not contralateral to the conceptus between Days 13 and 15 in sheep (Reynolds et al. 1984) and Days 15 and 17 in cattle (Ford et al. 1979 ). Swine have embryos in both horns and blood flow transiently increases in both uterine arteries 12 and 13 days after insemination, but when embryos are experimentally confined to one horn, the blood flow increases only on that side (Ford & Christenson 1979); furthermore, blood flow to uterine segments containing a conceptus is greater than for segments that do not contain a conceptus (Ford et al. 1982a). Blood flow to the pregnant uterus has been shown to be increased in the uterine artery ipsilateral to the embryo proper on Day s 14 18 and after Day 25 in heifers (Ford et al. 1979). A brief review of the earliest studies on uterine blood flow changes is provided by Ford (1985). Transrectal Doppler ultrasonography was used for noninvasive study of the blood flow in the uterine ar teries during early pregnancy in mares (Bollwein et al. 2003 2004 a ). Time averaged maximum velocity (TAMV) was higher and resistance index (RI) was lower in the arteries of pregnant mares than in nonpregnant mares beginning on Day 11. From Days 15 to 29 o f pregnancy, TAMV was higher and RI lower in the uterine artery ipsilateral to the conceptus than in the opposite artery. The authors indicated that an increase in TAMV represented greater blood flow in the arteries, and a decrease in RI represented reduce d resistance to blood flow in the vasculature distal to site of assessment. It was not determined whether conceptus fixation had

PAGE 50

50 occurred in at least some mares by the day of detection of a difference in blood flow between the ipsilateral and contralateral arteries. Thus, a local effect of the embryonic vesicle on the uterine vasculature in association with mobility of the conceptus was not demonstrated D ata on uterine vascular changes during early pregnancy in mares assessed by color mode Doppler ultrason ography have been published (Silva et al. 2005, Silva & Ginther 2006, Ginther & Silva 2006) The effect of the conceptus mediating uterine perfusion changes during mobility phase and after embryonic vesicle fixation was studied. In addition, the effects of uterine vascular changes on the endometrial ultrasonographic morphology were also investigated. Blood flow changes at the uterine artery (upstream of the uterus) have been studied by Doppler ultrasonography in cows during pregnancy (Bollwein et al. 2002 a Pa na ra ce et al. 2006, Krueger et al. 2008, Honnens et al. 2008 c ). Bollwein et al. (2002 a ) characterized the uterine blood flow changes monthly during pregnancy. The resistance index (RI) was lower and time averaged maximum velocity (TAMV) and blood flow volume higher in the artery ipsilateral to the conceptus. Throughout pregnancy, RI values decreased and TAMV and blood flow volume increased. Increased TAMV represented greater blood flow in the arteries and a decrease in RI represented reduced resistance to blood flow in the vasculature distal to the site of assessment. Panarace et al. (2006) studied once weekly 13 pregnant cows from Days 30 to 270 of pregnancy. The authors found that RI at the uterine arteries continuously decrease d during pregnancy and w as lower at the side ipsilateral to the conceptus. Exactly the opposite was found for TAMV. These findings indicate a decreas e in va scular resistance in the uterus throughout pregnancy Furthermore, the decrease was greater in the pregnant horn. A large in crease in blood volume was observed after week 16 in the pregnant horn side and a slight blood volume increase observed after week 20 in the contralateral horn. Recently, uterine blood flow from cyclic and

PAGE 51

51 pregnant cows during the three first weeks of preg nancy was examined (Honnens et al. 2008 c ). H igh er TAMV was observed at the uterine arteries in cyclic cows on Day 18 than in pregnant cows. I ncreased estrogen and decreased progesterone were correlated with the TAMV changes at this time The authors did no t find differences between the uterine horn ipsilateral to the conceptus and the con tralateral horn. We present in c hapter 7 results of a study of uterine blood flow changes during early pregnancy in cows assessed by color mode Doppler ultrasonography. Our results detected differences in vascular perfusion between the uterine horns after Day 20 of pregnancy. Also, the endometrial vascular changes during pregnancy in cows were intimately associated with the formation of the allantochorion during conceptus de velopment.

PAGE 52

52 CHAPTER 3 CHANGES IN VASCULAR PERFUSIO N OF THE ENDOMETRIUM IN A SSO CIATION WITH CHANGES IN LOCA TION OF THE EMBRYONI C VESICLE IN MARES S ynopsis The equine embryonic vesicle is mobile on Days 12 14 (Day 0 = ovulation), when it is about 9 15 mm in diameter. Movement from one uterine horn to another occurs on average about 0.5 times per hour. Mobility ceases (fixation) on Days 15 17. Transrectal color Doppler ultrasonography was used to study the relationship of embryo mobility (experiment 1) and fix ation (experiment 2) to endometrial vascular perfusion. In experiment 1, mares were bred and examined daily from Days 1 16 and were assigned, retrospectively, to a group in which an embryo was detected (pregnant mares; n=16) or not detected (n=8) by Day 12 Endometrial vascularity (scored 1 4, none to maximal) did not differ on Days 1 8 between groups or between the side with and without the corpus luteum. Endometrial vascularity scores were higher (P < 0.05) on Days 12 16 in both horns of pregnant mares th an in mares with no embryo. In pregnant mares, the scores increased (P < 0.05) between Days 10 12 in the horn with the embryo and were higher (P < 0.05) than in the opposite horn on Days 12 15. In experiment 2, 14 pregnant mares were examined from Day 13 t o 6 d after fixation. Endometrial vascularity scores and number of colored pixels per cross section of endometrium were greater (P < 0.05) in the endometrium surrounding the fixed vesicle than in the middle portion of the horn of fixation. Results supporte d the hypothesis that transient changes in endometrial vascular perfusion accompany the embryonic vesicle as the vesicle changes locations during embryo mobility.

PAGE 53

53 Introduction The equine uterus is Y shaped, and the length of each uterine horn is equival ent to the length of the uterine body (Ginther 1992) The early embryonic vesicle is spherical and mobile. Based on a uterine ligation study (Griffin & Ginther 1993) the conceptus apparently arrives in the uterine body after Day 8 (Day 0 = ovulation). Whe n first detected by transrectal ultrasonography on Days 9 or 10, the vesicle is frequently (60% of time) in the uterine body (Ginther 1983a, Leith & Ginther 1984) Thereafter, the frequency of entries into the uterine horns increases and a phase of maximum mobility begins, involving all parts of the uterus. Maximum mobility extends over Days 12 14 when the vesicle grows from about 9 to about 15 mm in diameter. Mobility has been characterized by visualizing nine segments of the uterus in approximately equiva lent lengths (three for each horn and the body) and locating the vesicle in one of the segments every 5 min for 2 h (Ginther 1983a) The propulsive force for embryo mobility is uterine contraction as indicated by similar temporal changes in uterine contrac tility and vesicle mobility (Griffin & Ginther 1993, Cross & Ginther 1988) reduced mobility after experimental inhibition of contractions (Leith & Ginther 1985) and reduced contractions in a uterine horn into which vesicle entry is prevented by experimen tal cornual ligation (Griffin & Ginther 1993) The mobility favors physiologic exchange between the relatively small conceptus and large uterus (Ginther 1983a) In this regard, results of confinement of the conceptus to one uterine horn indicate that the c onceptus locally stimulates uterine turgidity and edema, as well as contractility (Griffin & Ginther 1993) and that movement throughout the uterus is needed to prevent the bilaterally active uterine luteolytic mechanism (Griffin & Ginther 1993, McDowell e t al. 1988) The cessation of mobility is called fixation and occurs on Days 15 17 (Ginther 1983b) The site of fixation is at a flexure in the caudal segment of one of the uterine horns without

PAGE 54

54 regard to the side of ovulation. It has been postulated that fixation occurs at the flexure because it is the greatest impediment to continued mobility of the growing vesicle (Ginther 1983b, Gastal et al. 1996) A decrease in uterine diameter because of increasing turgidity from the stimulation of the mobile vesicle further contributes to fixati on in the most restricted area. The effects of the mobile equine conceptus on vascular perfusion of the endometrium are unknown. Transrectal Doppler ultrasonography was used recently for noninvasive study of the blood flow in the uterine arteries during early equine pregnancy ( Bollwein et al. 2003 ). Time averaged maximum velocity (TAMV) was higher and resistance index (RI) was lower in the arteries of pregnant mares than in nonpregnant mares beginning on Day 11. From Days 15 to 29 of pregnancy, TAMV was higher and RI lower in the uterine artery ipsilateral to the conceptus than in the opposite artery. The authors indicated that an increase in TAMV represented greater blood flow in the arteries, and a decrease in RI represented r educed resistance to blood flow in the vasculature distal to site of assessment. It was not determined whether conceptus fixation had occurred in at least some mares by the day of detection of a difference in blood flow between the ipsilateral and contrala teral arteries. Thus, a local effect of the embryonic vesicle on the uterine vasculature in association with mobility of the conceptus has not been demonstrated. The purpose of the present study was to test the hypothesis that transient changes in vascular perfusion of the endometrium occur in association with changes in location of the conceptus, as indicated by greater perfusion in the uterine horn containing the conceptus than in the opposite horn during the maximum mobility phase. In addition, compariso ns in vascularity were made between horns ipsilateral and contralateral to the corpus luteum on Days 1 8 in bred mares in which an embryo was later detected versus not detected and between the horn of embryo fixation and the opposite horn. The time of an e ffect of the conceptus on vascularity of

PAGE 55

55 the endometrium and the time of an effect on uterine contractility were compared for a tentative indication of whether a similar conceptus generated stimulus is involved in the two uterine responses. Materials and Methods Animals Animals were handled in accordance with the Guide for Care and Use of Animals in Agricultural Research. Pony mares of mixed breeds, 6 to 15 years of age, weighing 290 430 kg, were used during the last half of the ovulatory season. The mares had free access to grass hay, water, and trace mineralized salt. Mares with docile temperament and no apparent abnormalities of the reproductive tract ( Ginther 1995 b ) were selected. The selected mares were scanned daily by ultrasound and bred naturally wh en a preovulatory follicle reached 35 mm and every other day thereafter until ovulation. Mares with twin embryos were not used. Ultrasonography A pulse wave ultrasound scanner with both B mode (gray scale) and color Doppler functions was used (Aloka SSD 2000; Aloka America, Wallingford, CT). Uterine contractions were assessed in B mode, using a finger mounted 7.5 MHz convex transducer (UST 995 7.5). The transducer was placed transrectally over the middle segment of each uterine horn in a longitudinal plan e. The extent of contractility was scored as described for the uterine body ( Cross & Ginther 1988 ). The scores ranged from 1 4, indicating no, minimal, intermediate, and maximal activity. Vascular perfusion of the endometrium was evaluated, using the colo r Doppler flow mode function and a 7.5 MHz linear array transducer (UST 5821 7.5) with a beam field width of

PAGE 56

56 60 mm. The following settings were used: velocity range limit, 9.96 cm/s; flow filter, 4; and frame rate, 6 Hz. The transducer was placed over a c ross section of the middle segment of each uterine horn. The vascularity or vascular perfusion was estimated subjectively by scoring the extent of colored areas in the endometrium during real time cross sectioning of the middle segment of each horn during a continuous span of 1 min; because of animal and uterine movements, multiple cross sections were viewed. Only the colored areas that appeared to be within the endometrium were considered ( Figure 3 1). The scores ranged from 1 4, indicting no, minimal, int ermediate, and maximal involvement. The 1 min scan was recorded on digital videocassettes (MiniDV). Vascular perfusion of the endometrium was assessed objectively by off line measurement of the number of colored pixels as an indicator of blood flow area. Three still images from cross sections of the middle segment of each horn were used for determination of number of colored pixels, and the average was used in the analyses. The images were captured from the videocassettes using Adobe Premiere Pro 1.5 softw are (TIFF format; Adobe Systems, San Jose, CA). Colored spots or pixel aggregates were selected from the images, extracted, and saved (GIF format) using Adobe Photoshop 5.5 software (Adobe Systems, San Jose, CA). ImageJ 1.31v software (National Institutes of Health, USA) was used for calculation of the total number of colored pixels for each GIF format image. In addition to color Doppler evaluation of the endometrium, spectral Doppler scans were made of the arteries at the mesometrial attachment. These ves sels were outside of the uterine horn but within 1 cm of the uterine surface. For the spectral mode, the velocity range limit was set at 19.9 cm/s and the Doppler filter at 100 Hz. Spectral waveforms were generated three times for three cardiac cycles by p lacement of a 2 mm wide gate over the most intensely colored area

PAGE 57

57 in the color flow/B mode image ( Figure 3 1). One cardiac cycle was arbitrarily chosen from each of the three scans and the average was used for measurement of TAMV and pulsatility index (PI) using preset functions in the ultrasound scanner. The determination, meaning, and interpretation of TAMV and PI are given in a discussion of blood flow velocity in the uterine arteries of women (Sladkevicius et al. 1993) An increase in TAMV and a decrea se in PI are reported to indicate increased vascular perfusion of tissues distal to the point of examination of the artery. Experiment 1 Twenty four naturally bred mares were examined daily beginning between Hours 1300 1800 with the duplex B mode/color mo de scanner from Day 1 (Day 0 = ovulation) until Day 16. Examination procedures and data analyses were divided into Days 1 8 and Days 9 16; Day 9 was the earliest day of detection of an embryonic vesicle. On Days 1 8, comparisons were made between the uter ine horns that were ipsilateral and contralateral to the corpus luteum. Comparisons were then made between mares in which an embryo was not detected by Day 12 or thereafter (n = 8) and pregnant (n = 16) mares, using the average between horns for each mare. On Days 9 16, comparisons were made similarly, except that the uterine horn containing the embryonic vesicle and the opposite horn were used. Assignment to the pregnant group could not be made until an embryonic vesicle was detected. Therefore, the number of pregnant mares per day increased over Days 9 ( 3 mares), 10 (11 mares), 11 (15 mares), and 12 16 (16 mares/day). On each day, the mobility of the embryonic vesicle was monitored every 5 min, as described (Leith & Ginther 1984) until the vesicle remaine d in the same uterine horn for five consecutive examinations (20 min). Uterine contractility was scored in B mode, and the 1 min continuous scanning of the middle segment of each uterine horn was done in color mode for endometrial

PAGE 58

58 vascularity scoring. The color Doppler was set on spectral mode for measuring TAMV and PI at the mesometrial attachment. Experiment 2 Fourteen mares, differen t from those used in experiment 1, with an embryonic vesicle on Day 11 or 12 were used. A 2 h mobility trial was done on D ay 13, beginning between Hours 1730 2400. The location of the vesicle in one of nine uterine segments of similar length (three for each horn and the body) was recorded every 5 min (Leith & Ginther 1984) Seven of the 14 mares were used to objectively evalu ate the reliability of the subjective scoring system that had been used by the operator 1 in experiment 1 to estimate the extent of vascular perfusion of the endometrium. In these seven mares, the embryonic vesicle was not in the middle segment of the horn at the time of scoring, so that bias associated with the presence of a vesicle was avoided. Operator 2 isolated on videocassette the 1 min continuous scanning of the middle segment of each uterine horn and assigned an identification number to each of the 14 segments. The segments were randomized by operator 2, and an endometrial color Doppler score was made by operator 1 without knowledge of embryo location and mare identity. In addition, operator 1 selected three images from each segment that seemed repre sentative of the extent of colored Doppler areas within the endometrium. These three images of each uterine segment (total, n = 42 images) were given an identification and randomized by operator 2. Each randomized endometrial image was evaluated by operato r 1 for number of discrete colored spots or pixel aggregates and total number of colored pixels. Initial information on the exposure time needed by the embryonic vesicle to stimulate endometrial vascular perfusion and uterine contractility was obtained by scoring the middle segment of each horn for vascularity and contractility on Day 13 in all 14 mares. A scoring

PAGE 59

59 session was done every 20 min for 2 h for a total of eight examinations per mare. In the same mares over the same 2 h, the location of the embry onic vesicle in one of the nine uterine segments had been recorded every 5 min, as described above. Therefore, retrospective examination of these records made it possible to select mares in which the vesicle entered a horn and remained there for a prolonge d period, encompassing at least two scoring sessions (20 min). Endometrial vascularity and uterine contractil ity scores for the uterine horn containing the embryo in these mares were taken from three consecutive scoring sessions: session 1 (before the embr yo entered the horn), session 2 (after the embryo had entered), and session 3 (with the embry o still in the horn). Complete data involving all three scoring sessions were available for 10 mares. Comparison of scores from sessions 2 and 3 with those of sess ion 1 thus provided some indication of how vascularity and contractility had been affected by the presence of the embryo for various time intervals. After Day 13, mobility trials were done each day in all 14 mares and continued until the day no changes oc curred among segments during 2 h. The absence of a location change in 2 h was defined as fixation, as previously reported (Ginther 1983b) Fixation was positively confirmed in all mares during another mobility trial on the following day. Daily determinatio ns for the uterine contractions and color Doppler end points (vascularity score, TAMV, PI) were done from Day 13 until 6 d after fixation for all 14 mares. Data were centralized to the day of fixation including the horn of the future fixation, extending fr om 3 d before fixation to 6 d after fixation. In addition to the vascularity assessments of the middle segment of the uterine horns, the vascularity of the endometrium around the vesicle after fixation was assessed by including the vesicle in the continuou s 1 min cross sectioning of the endometrium. End points for the middle segment of each uterine horn were compared between the horn of fixation (or future

PAGE 60

60 fixation) and the opposite horn. In addition, endometrial vascularity comparisons included the group w ith data from around the vesicle beginning on the day of fixation. Data were analyzed for 3 d before fixation and separately from the day of fixation to 6 d after fixation. Statistical Analyses Data were examined for normality with Kolmogorov Smirnov test When the normality test was significant (P < 0.05), data were transformed to natural logarithms. The scores for Doppler vascularity and uterine contractility were considered nonparametric and were analyzed by a ranking procedure (Kruskal Wallis test). Th e ranked scores for contractility and vascularity and the other Doppler end points were analyzed by the mixed procedure of SAS (version 8.2; SAS Institute Inc., Cary, NC) to determine the main effects and the interaction, using a repeated statement to acco unt for autocorrelation between sequential measurements. Paired and unpaired t test were used to locate the differences within and between horns and between pregnant and nonpregnant mares when significant main effects or an interaction were obtained. Discr ete data were analyzed by t tests. The proportion of mares for each day in experiment 1 with adequate Doppler color signals for measurement of TAMV and PI were compared between days with chi square ifference and probabilities between P > 0.05 and P < 0.1 indicated approaching significance. Results Experiment 1 The endometrial vascularity scores and contractility scores on Days 1 8 and 9 16 and the results of statistical analyses are shown ( Figure 3 2). On Days 1 8, there were no significant differences for endometrial vascularity. However, contractility progressively increased between

PAGE 61

61 Days 2 or 3 and Day 8. On Days 9 16, endometrial vascularity increased after Day 11 in the pregnant group with a more pronounced increase in the horn with the embryo than in the opposite horn; vascularity did not change in the group in which an embryo was not detected. Uterine contractility in the pregnant group increased similarly in both uterine horns between Days 10 a nd 12. The color Doppler signals within the endometrium were inadequate for the production of spectral waveforms in both groups of mares throughout the experiment. Color Doppler signals for vessels in the mesometrial attachment were adequate for spectral analyses in both horns of some mares in each group during Days 1 8; the frequency of an adequate signal initially increased and then decreased, as shown ( Figure 3 3). During Days 9 16, the frequency of adequate signals increased in both uterine horns but o nly in the pregnant mares. Spectral analyses for TAMV and PI were done for the two horns in pregnant mares with adequate signals on Days 10 16; a significant day effect for both end points reflected an increase over days for TAMV and a decrease for PI ( Fig ure 3 4). Experiment 2 During the 2 h mobility trials on Day 13, the embryonic vesicle moved from one horn to the other 1.0 0.2 times per trial and between a horn and the body or vice versa 3.9 0.5 times. The mean day of fixation was Day 15.8 0.2 (r ange, Days 15 17). The objective vascularity scores from the real time video clips were greater (2.1 0.2 versus 1.7 0.2; P < 0.02) and the subjective vascularity scores were greater (1.9 0.2 versus 1.5 0.1; P < 0.02) in the horn with the embryo ver sus the opposite horn. The number of colored spots in images of endometrial cross sections in the objective evaluations were greater (P < 0.04) in the horn with the embryo

PAGE 62

62 than in the opposite horn and approached significance (P < 0.1) for the total numbe r of colored pixels per endometrial image (Table 3 1). The continued presence of the vesicle in the same horn for an average of 7 min stimulated an increase (P < 0.004) in vascularity or perfusion of the endometrium of the middle segment of the horn (Table 3 2); a corresponding increase in contractility approached significance (P < 0.1). The endometrial vascularity scores and number of colored pixels in the endometrium, TAMV and PI of the mesometrial attachment, and uterine contractility scores before and after fixation are shown ( Figure 3 5). During 1 to 3 days before fixation, the day effect was significant (P < 0.05) for all end points, except contractility. The group effect and interaction were not significant for any end point before fixation. The stat istical results are shown for the days of and after fixation. Endometrial vascularity and number of colored endometrial pixels were progressively higher in the following sequence: horn without the vesicle, horn with the vesicle, and the area of endometrium surrounding the fixed vesicle. The TAMV was higher and the PI was lower in the horn with the vesicle on most days after fixation. Discussion Embryo mobility or the movement of the spherical equine embryonic vesicle between portions of the uterus during maximum mobility over Days 12 14 with fixation ranging between Days 15 17 in the present study was similar to previous reports (Leith & Ginther 1984, Ginther 1983a, Ginther 1983b, Gastal et al. 1996) Results for Day 13 indicated that the embryonic vesicle moved from one horn to another an average of 0.5 times/h. Therefore, the ability to detect differences between the horn containing the embryonic vesicle and the opposite horn required that local uterine responses to the conceptus developed and abated in l ess than 0.5 h on the average after the vesicle entered and departed the horn, respectively. Results of experiment 2

PAGE 63

63 indicated that an increase in endometrial vascularity scores occurred within an average of 7 min after the vesicle entered a horn and did n ot increase further during the ensuing 20 min. This estimate can be considered unrefined, however, and future studies will be needed with a shorter interval between measurements of the uterine responses and consideration of vascular development both before and after the horn is exposed to the vesicle. The results strongly supported the hypothesis that changes in vascular perfusion of the endometrium occur locally in association with location changes of the embryonic vesicle during the mobility phase. Highe r vascularity scores were found for the horn with the embryo at the time of examination than in the opposite horn throughout Days 12 15. The scores in the embryo containing horn increased between Days 10 and 12. Although the scores were higher in the embry o containing horn than in the opposite horn, scores were higher in both horns of pregnant mares than in mares in which an embryo was not detected by Day 12 or thereafter. Local and transient vascular perfusion of the endometrium as the mobile equine embryo nic vesicle traverses the uterus is a novel finding. At a comparable stage of pregnancy in cattle and sheep, the conceptus expands along the length of the horn on the side of ovulation and does not involve the opposite horn. These species differences appea r to be associated with a unilateral utero luteolytic pathway in cattle and sheep and a systemic pathway in horses (Ginther 1998 b ) Blood flow increases in the uterine artery ipsilateral but not contralateral to the conceptus between Days 13 and 15 in shee p (Reynolds et al. 1984) and Days 15 and 17 in cattle (Ford et al. 1979a) Swine have embryos in both horns and blood flow transiently increases in both uterine arteries 12 and 13 days after insemination, but when embryos are experimentally confined to one horn, the blood flow increases only on that side (Ford et al. 1979b) ; furthermore, blood flow to uterine segments containing a conceptus is greater than for segments that do not contain a conceptus

PAGE 64

64 (Ford et al. 1982a) The stimulation of the local uterine vascular system by the embryos that has been reported for cattle, sheep, and swine and for ponies in the present study occurs approximately at the time the embryos are involved in luteal maintenance. The present study in mares demonstrated the rapid local ly sensitive nature of the phenomenon. The mechanism involved in local stimulation of uterine vascularity by the conceptus in these species has not been clarified. One consideration is that the early conceptus alters endometrial vascularity by the product ion of vascular stimulants. In this regard, estrogens stimulate increased uterine blood flow in the sow, cow, and ewe (Ford 1982) In vitro studies have shown that Day 12 porcine embryos (Ford et al. 1982 b ) and day 16 bovine embryos (Shemesh et al. 1979, Chenault et al. 1980) produce estrogens. The trophoblast of the equine embryonic vesicle is involved in steroid conversion as early as Day 8 (Paulo et al. 1985) and Day 13 (Flood & Marrable 1973) A marked in vitro production of estrogen by the equine conc eptus occurs as early as Day 12 (Zavy et al. 1979, Raeside et al. 2004) Thus, estrogen has vasostimulatory properties and production by the conceptus occurs on the days the conceptus of horses, swine, and cattle is stimulating local uterine vascularity. In this regard, a recent study in mares found that PI values were higher for the uterine artery during both estrus and diestrus in estrogen treated mares than in nontreated mares (Bollwein et al. 2004 b ) The blastocysts of many species secrete a variety of prostaglandins, and it has been proposed that conceptus prostaglandins stimulate increases in uterine blood flow (Lewis 1989) Equine embryos secrete PGF 2 and PGE 2 (Watson et al. 1989, Stout & Allen 2002, Sharp 2000) However, it is not known whether prostaglandins, steroids, or other factors account for the increased endometrial vascular perfusion described in the present studies. Furthermore, physical st imulation unrelated to direct production of a vasoactive substance by the conceptus cannot be ruled out.

PAGE 65

65 After completion of experiment 1, there was concern that the scoring of endometrial vascularity may have been biased because the operator was aware o f the location of the embryonic vesicle. Therefore, an objective reliability trial was incorporated into experiment 2 on Day 13, wherein the operator scored the endometrial vascularity without knowledge of embryo location or animal identity. Vascularity sc ores were higher in the horn that contained the embryo for both the objective and subjective scoring systems, indicating that the subjective scoring system used in experiment 1 was useful. Another indication of the reliability of the scoring system was the similar conclusions between scoring vascularity and counting the number of colored spots or pixels in images of endometrial cross sections in the reliability trial and in the comparisons of the horn of fixation and the opposite horn. It is concluded that the subjective scoring of endometrial vascularity was a useful and convenient approach. For the spectral Doppler assessments of the arteries of the mesometrial attachment, the TAMV and PI increased and decreased, respectively, over Days 10 16 of pregnancy ; there was no difference between horns, as indicated by the absence of a group effect and a day by group interaction. Results for both of these end points indicate increased vascular perfusion of the uterus distal to the site of assessment. Even though th e highest Doppler shift was assessed, based on selection of the brightest colored area, true blood velocities likely were not expressed by the TAMV values. The angle of insonation was unknown. However, the relative TAMV values are taken as meaningful expre ssions of vascular perfusion distal to the assessment. It is unlikely that the angle of artery insonation would have been different between the horns with and without the embryo. In addition, volume of blood flow delivered by the arteries was not determina ble because the diameters of arteries were unknown.

PAGE 66

66 The TAMV and PI end points may have been less sensitive than the scoring of the vascular perfusion of the endometrium and therefore did not detect the localized difference between horns during the mobil ity phase. In this regard, a previous spectral analysis color Doppler study in mares was done for the main uterine arteries (Bollwein et al. 2003) ; greater increases in blood flow were found in pregnant mares than in nonpregnant mares after Day 11, but the re was no difference between the embryo containing horn and the opposite horn until Day 15. The frequency of the occurrence of fixation by Day 15 was not determined. In the present study, post fixation endometrial vascularity and number of colored pixels w ere greatest in the endometrium surrounding the fixed embryonic vesicle and were greater in the middle segment of the horn of fixation than in the opposite horn. There were no differences before fixation between the horn of future fixation and the opposite horn, indicating that the extent of prefixation vascular perfusion did not play a role in the selection of the horn of fixation. The post fixation results for the arteries in the mesometrial attachment and the greater TAMV on the side of fixation are cons istent with the previously reported TAMV results for the uterine artery of the horn containing the embryo beginning on Day 15 (Bollwein et al. 2003). The similarity between mares in which an embryo was not detected and pregnant mares in endometrial vascul arity until the increases in both horns in pregnant mares after Day 11 is consistent with the previous studies of blood flow in the uterine arteries (Bollwein et al. 2003) Furthermore, there were no differences between horns ipsilateral and contralateral to the corpus luteum in the mares in which an embryo was not detected, as previously reported for nonbred mares (Sharp 2000 Allen & Stewart 2001 ) A unimodal increase and decrease in the frequency of adequate Doppler signals for spectral analyses of arter ies in the mesometrial attachment of mares with no embryo detected occurred between Days 1 11; maximum values occurred on

PAGE 67

67 approximately Days 4 6. This result likely reflects the transient lower pulsatility index reported for the uterine artery on Days 4 6 (Bollwein et al. 2002) In the present study, pregnant mares showed a similar unimodal profile, except that number of mesometrial attachments with adequate spectral signals increased again after Day 8, resulting in a significant difference by Day 11 betwee n pregnant mares and mares with no detected embryo. The reason for the transient increased incidence of Doppler spectral displays on Days 4 6 in both groups of mares is not known. In this regard, the presence or absence of an embryo on Days 1 8 cannot be c onsidered because embryonic loss could have occurred in the group with no embryo detection by Day 12. A transient increase in estradiol on Days 4 6 has not been reported. However, some interovulatory intervals have increased follicular activity at this tim e (Ginther et al. 2004) Furthermore, early short term increases in uterine tone (Griffin et al. 1992) and in estrus like uterine echotexture (Hayes et al. 1985) have been reported during early diestrus. Further study will be needed to determine if the app arent transient changes in endometrial perfusion, uterine tone, and endometrial echotexture in early diestrus are interrelated and whether estrogens or other factors are involved. Uterine contractions are active in mares during diestrus, whereas the uteru s of other farm species is quiescent (Ginther 1992) An increase in contractions in the uterine horns during approximately Days 3 8 in pregnant mares as well as in the mares with no embryo detection was shown in the present study. The further and more prof ound increase in contractility concomitantly with increased mobility of the conceptus confirms previous findings (Cross & Ginther 1984, Gastal et al. 1996) A noteworthy difference in contractility and endometrial perfusion in the present study was the abs ence of a detected difference between the embryo containing horn and the opposite horn for contractions versus the greater vascular perfusion in

PAGE 68

68 the embryo containing horn. This result suggests that different factors may be involved in the two phenomena or that endometrial perfusion abates more rapidly than uterine contractions after the conceptus departs from a horn. In summary, color Doppler ultrasonography was used to study the relationships of endometrial vascular perfusion and uterine blood flow to th e mobility of the embryonic vesicle during early pregnancy in mares. Endometrial vascularity scores were similar between mares with no embryo detected and pregnant mares until an increase in scores occurred in both horns of pregnant mares by Day 12. In the pregnant mares, the scores were higher in the embryo containing horn than in the opposite horn from Day 12 to 6 d after fixation. Spectral analyses of arteries in the mesometrial attachment indicated a gradual increase in time averaged maximum velocity in both horns during the mobility phase and a greater velocity in the horn of fixation than in the opposite horn, beginning on the day of fixation.

PAGE 69

69 Table 3 1. Means SEM for vascular end points of the endometrium on Day 13 of pregnancy, obtained without knowledge of identity of mare or horn. Experiment 2. Uterine horn End points With embryo Without embryo Endometrial vascularity (score*) 2.1 0.2 a 1.7 0.2 b 4.7 0.9 a 3.6 0.6 b Colored pixels (No.) 316 67 243 46 Scored from 1 4 for none, minimal, intermediate, and maximal. Separate aggregates of colored pixels within the endometrium; average of three cross sectional images of the endometrium. ab Within an end point, means with a different superscript are differe nt (P < 0.05). The difference between groups for number of pixels approached significance (P < 0.1).

PAGE 70

70 Table 3 2. Means SEM for relationships between the beginning of exposure of a uterine horn to an embryonic vesicle and stimulation of uterine contract ions and endometrial vascularity. Experiment 2. Scoring sessions at 20 min intervals Session 1 Session 2 Session 3 End points (embryo absent) (embryo present) (embryo present) Interval (min) 12.0 1.9* 7.0 1.7** 27.0 1.9# Contractility (score 2.6 0.1 2.8 0.1 2.8 0.2 Endometrial vascularity 1.8 0.2 a 2.6 0.2 b 2.3 0.2 b Between session 1 and beginning of a prolonged period with the embryonic vesicle in the same uterine horn. ** Between beginning of the prolonged pe riod and session 2. # Between beginning of the prolonged period and session 3. Scored from 1 to 4, none to maximum. ab Means with a different superscript are different (P < 0.05).

PAGE 71

71 Figure 3 1.Two images of cross sections of uterine horns showing m inimal (left panel) and maximal (right panel) colored areas of the endometrium from the Doppler flow mode. The sample gate (sg, left panel) indicates the area sampled in the mesometrial attachment (mm=mesometrium) for generating the spectrum used by the sc anner in calculating time averaged maximum velocity and pulsatility index. The arrows for each panel delineate the endometrium.

PAGE 72

72 Figure 3 2. Means SEM scores for endometrial vascularity and uterine contractility in bred mares in which an embryo was e ither detected or not detected by Days 9 12. Number of mares was 16 and 8 for the mares with and without an embryo, respectively, except that only 3, 11, and 15 mares with a detected embryo were available on Days 9, 10, and 11, respectively. The day effect was significant (P < 0.0001) for contractility on Days 1 8, and the day by group interaction on Days 9 16 was significant for contractility (P < 0.02) and vascularity (P < 0.0001). An asterisk (*) indicates a day of a difference (P < 0.05) between horns w ithin the pregnant group and between days within a group. The pound mark (#) indicates the days of a difference (P < 0.05) between pregnant and nonpregnant groups. CL = corpus luteum. Contra = contralateral. Ipsi = ipsilateral. Experiment 1.

PAGE 73

73 Figure 3 3. Percentage of uterine horns with adequate Doppler signals for spectral analyses of an artery in the mesometrial attachment. The proportion of horns with adequate signals increased (P < 0.05) between Days 2 5 or 1 4 and decreased (P < 0.05) between Days 5 8 or 4 9 in bred mares in which an embryo was detected and not detected, respectively. There was no significant difference between horns within a group on Day 1 8. A pound mark (#) indicates a day with a difference (P < 0.05) between groups on Days 11 16. Experiment 1.

PAGE 74

74 Figure 3 4. Means SEM for time averaged maximum velocity and pulsatility index in vessels of the mesometrial attachment on Days 10 16 in pregnant mares. D = main effect of day. Experiment 1.

PAGE 75

75 Figure 3 5. Means SEM for uterin e color Doppler end points and contractility in the middle segment of the uterine horn of fixation and the opposite horn. The upper two panels include data for the area of endometrium at the location of the fixed vesicle. The scores for vascularity and con tractility were from 1 4 for none, minimal, intermediate, and maximal. Significant main effects (G, group; D, day) and the interaction (GD) are shown for the days of and after fixation. An asterisk (*) indicates a day with a difference (P < 0.05) between t he group above and the group below the asterisk within a day. Experiment 2.

PAGE 76

76 CHAPTER 4 AN EARLY VASCULAR INDICATOR OF COMPLETED ORIENTATION OF THE EMBRYO AND THE ROLE OF THE DORSAL ENDOMETRIAL ENCROACHMENT IN MARES Synopsis The spherical equine embryoni c vesicle is mobile throughout the uterine lumen for several days before becoming fixed in the caudal segment of a uterine horn on Day 16 (ovulation = Day 0). Orientation refers to the position of the embryo proper at the periphery of the vesicle relative to the position of the mesometrial attachment. In mares, the embryonic pole of the vesicle is antimesometrial after completion of orientation. Day of vesicle fixation, differential thickening of the endometrium near the mesometrial attachment, and orientat ion of the embryonic vesicle were studied in 30 ponies, using B mode and color Doppler transrectal ultrasonography. The thickness of the endometrium at the mesometrial aspect of the vesicle divided by the thickness at the antimesometrial aspect was termed the encroachment ratio. At the future site of fixation, the first increase ( P < 0.05) in the encroachment ratio occurred between 4 and 1 days before fixation. An early vascular indicator of the future position of the embryo proper was discovered by color D oppler imaging and consisted of a colored spot in the image of the endometrium close to the wall of the embryonic pole. The early indicator was detected in each mare 0.5 0.1 days after fixation and 2.5 0.2 days before first detection of the embryo prop er. The position of the early indicator when first detected at the periphery of the embryonic vesicle was not different significantly from the position of the embryo proper when first detected. Results supported the hypothesis that differential thickening of the endometrium precedes orientation and indicated that orientation occurs immediately after fixation.

PAGE 77

77 Introduction Species of the genus Equus apparently are the only common Eutherian mammals in which embryo uterine interactions (migration, fixation, a nd orientation) can be observed in real time and apparently without disturbance. This research capability results from the availability of transrectal ultrasonography, the large size of the fluid filled embryonic vesicle (conceptus), and the close proximit y of the uterine wall to the rectal wall (Ginther 1995 a ) The equine embryonic vesicle enters a uterine horn on Day 6 (ovulation = Day 0; Weber et al. 1991, Battut et al. 1997 ). Based on a uterine ligation experiment (Griffin et al. 1993) the vesicle ente rs the uterine body on about Day 8. When first detected by ultrasound (Days 9 to 10), the vesicle is a distinctly spherical 3 to 4 mm structure and is usually (60% of time) found in the uterine body (Leith & Ginther 1984) Thereafter, mobility of the vesic le increases and reaches extensive mobility on Day 11. During the extensive mobility phase, the vesicle traverses the full length of the uterus many times per day (Ginther 1983a) Each of the uterine horns and the uterine body are similar in length, and th e mobile vesicle spends a similar amount of time in each part. Embryo mobility is associated with uterine contractions (Leith & Ginther 1985) A recent study indicated that transient changes in endometrial vascular perfusion accompany the location changes of the embryonic vesicle (Silva et al. 2005) Fixation (cessation of mobility) occurs at a flexure in the caudal segment of a uterine horn under the influence of increasing growth of the vesicle and a reciprocal relationship between increasing uterine tone and decreasing uterine diameter (Gastal et al. 1996) Vascular perfusion is greater in the endometrium surrounding the fixed vesicle than in the opposite horn or in the middle of the horn of fixation (Silva et al. 2005) Orientation of the embryonic vesi cle refers to the position of the embryonic disc or embryo proper at the periphery of the vesicle (embryonic pole) relative to the position of the mesometrial attachment. The pattern of orientation (antimesometrial versus mesometrial) is

PAGE 78

78 fairly constant wi thin species but differs among species (Mossman 1971, 1987) The direction in which the embryonic disk faces relative to the mesometrial attachment after orientation is completed contributes to species differences in the pattern of development of the fetal membranes and the site of attachment of the umbilical cord. When first detected by ultrasound (Days 19 to 22), the equine embryo proper is in the ventral hemisphere of the embryonic vesicle or opposite to the mesometrial attachment (Ginther 1983b) It is unlikely that orientation occurs before embryo mobility ceases. In this regard, simulated embryonic vesicles rotated or rolled during intrauterine location changes (Ginther 1985) These observations indicate that orientation occurs between the day of fixat ion (Day 16) and the earliest reported day of ultrasonic identification of the embryo proper (Day 19). About 50 to 75% of the wall of equine embryonic vesicle over Days 16 to 18 is composed of two cell layers without mesoderm (Ginther 1998 a ) The mesoderm of the remaining portion develops between the two cell layers and differentiates into connective tissue surrounding the embryonic disc and results in a three layered portion of the vesicle wall at the embryonic pole. Thus, the three layered or embryonic po le of the vesicle can be expected to have greater tensile strength than the opposite pole, although this has not been determined directly. Beginning on approximately Day 17, the embryonic vesicle begins to lose its spherical form when imaged in cross secti on relative to the uterine horn. The ultrasound image of the vesicle becomes oblong, triangular, or irregular in shape ( Ginther 1983b) The apex of the triangular shapes tends to be at the dorsal region of the horn. However, the shape of the vesicle does n ot remain static, and its outline changes frequently during periods of continuous ultrasound observations with the scanner (Ginther 1998 a ) These shape changes are attributable to myometrial contractions which may exert a kneading or massage like action on the fixed vesicle.

PAGE 79

79 Disproportional thickening of the dorsal uterine wall versus the ventral wall occurs by Day 17 and accounts for the nonspherical shapes of the vesicle (Ginther 1983b) It has been postulated (Ginther 1983b, 1985) that equine embryo orie ntation results from the interaction of at least three factors: 1) differences in tensile strength between the thin (two cell layers) and thick (three layers) portions of the vesicle wall; 2) asymmetrical encroachment of the uterine wall on the vesicle, re sulting from differential thickening of the upper turgid uterine wall at the mesometrial attachment; and 3) the massaging action of uterine contractions. A distinct, smooth, and strong capsule encloses the embryonic vesicle until about Day 21 (Betteridge e t al. 1982) and is an additional factor that likely favors the orientation process. The surface of the equine embryonic vesicle develops adhesive qualities (Denker 2000) which may aid in anchoring the vesicle after orientation is completed. The overall pur pose of this experiment was to examine the hypothesis that differential thickening of the uterine wall at the mesometrial attachment begins before the earliest indication that orientation has occurred. Initially, a search was made for early indicators of t he position of the embryonic disc at the periphery of the vesicle, using color Doppler assessment of the endometrium and vesicle (Experiment 1). The time of the occurrence of differential thickening of the dorsal uterine wall at the site of fixation was th en examined (Experiment 2). Findings were considered supportive of the hypothesis if differential thickening occurred before the earliest indication of completed orientation.

PAGE 80

80 Materials and Methods Animals Animals were handled in accordance with the Uni ted States Department of Agriculture Guide for the Care and Use of Animals in Agricultural Research. Pony mares of mixed breeds were used (age, 3 18 yr; 260 410 kg). The mares had free access to grass hay, water, and trace mineralized salt. Mares were sele cted that had docile temperament and had no apparent ultrasonically detected abnormalities of the reproductive tract (Ginther 1995 b ) The selected mares were scanned daily by ultrasound and bred naturally when a preovulatory follicle reached 35 mm and ever y other day thereafter until ovulation Anatomy and Ultrasonography The transrectal ultrasound transducer was held close to the upper surface of the uterus. In this regard, the equine uterus assumes a T or Y shape as it rests upon other abdominal organ s (Ginther 1992) The stem of the T or Y represents the uterine body, and the arms represent the two uterine horns ( Figure 4 1). The mesometrium and its accompanying blood vessels attach to the dorsal surface of the horns, as seen in a suspended tract; how ever, because the uterus usually rests upon other viscera, the attachment to the uterine horns is dorso caudal with respect to the cranially, and rotated on its v ertical axis to obtain a cross sectional view of the vesicle and uterine horn by using a symmetrical image of the horn ( Figure 4 1). The left aspect of the ultrasound image represented the tissues on the cranial aspect of the transducer. Therefore, the mes ometrial attachment was in the upper right corner of the image, even through the anatomical attachment was to the dorsal aspect of the horn. Large branches of blood vessels formed a network along the upper surface of the horns, as seen on the ultrasound im age ( Figure 4 1).

PAGE 81

81 Pulse wave ultrasound scanners with both B mode (gray scale) and color Doppler functions equipped with 7.5 MHz transducers were used (Aloka SSD 2000 and Aloka SSD 3500; Aloka America, Wallingford, CT, USA). One transducer was a convex ar ray with a beam field width at the transducer face of 20 mm (UST 995 7.5). The other was a linear array with a beam field width of 60 mm (UST 5821 7.5). Settings for B mode and color Doppler mode controls were kept constant, except for the controls for mag nification and delineation of color Doppler area. The color Doppler settings for velocity range and flow filter were 10 cm/sec and 4, respectively. The principles and techniques of Doppler ultrasound in equine reproduction have been reported (Ginther & Utt 2004) End Points The day of ovulation in these experiments was the day the ovulatory follicle was no longer present at a daily examination and was designated Day 0. Embryo mobility was assessed by assigning vesicle location to one of nine uterine segme nts ( Figure 4 1) every 5 min for 2 h, as described (Ginther 1984 a ) A mobility trial was done each day until the vesicle did not move between uterine segments during 2 h, and the absence of movements was defined as fixation. Fixation was confirmed in all m ares on the subsequent days by the continued presence of the vesicle in the same uterine segment. For the study of orientation, sites at the periphery of the cross sectional image of the embryonic vesicle were assigned positions, according to the face of a clock ( Figure 4 2), as described (Ginther 1995 b ). determining the position of the embryo proper at the periphery of the vesi cle (Experiments 1 and 2) and for measuring endometrial thickness at various positions (Experiment 2). The position

PAGE 82

82 was recorded in an individual to the nearest hour and the average for a group of mares was expressed by hour and tenth of an hour (e.g., 6.5 During a preliminary color Doppler study, it was noted that a colored spot on the ultrasound image indicating blood flow developed consistently after fixation in the endometrium at the ventral aspect of the vesicle opposite to the mesom etrial attachment and adjacent to the wall of the vesicle. The localized colored area was distinguishable from other endometrial colored spots by closer proximity to the vesicle and greater stability in location and appearance between frequent examinations at a given session ( Figure 4 3). After completion of Experiment 1, it was clear that these spots indicated the position of the embryonic disc before the embryo proper with heart beats was identified by B mode and color mode scanning. The spots were theref ore defined as an early indicator of the future position of the embryo proper. The center of the early indicator was used to record its position relative to the periphery of the vesicle. End points common to both experiments were days of fixation and first detection of the early indicator and the embryo proper, length of intervals between end points, and clock face positions and day to day position changes of the early indicator and embryo proper. Experiment 1 Twenty four mares with an embryonic vesicle w ere used. Embryo mobility trials began on Day 13 and continued daily until the day of fixation. Orientation of the early indicator and the embryo proper were compared among first and last days of detection of the indicator, first day of detection of the em bryo proper, and Day 21 (last day of examinations).

PAGE 83

83 Experiment 2 Eleven mares with an embryonic vesicle were examined daily from Day 12 until Day 19. A 2 hour mobility trial was performed until the vesicle remained in the same uterine segment for 2 hours (fixation). Detection of the early indicator was attempted daily during the mobility phase beginning on Day 14. Endometrial thickness (distance between the myometrium and embryonic vesicle) was measured in B mode in the caudal segment of the uterine horns daily during the mobility phase and after fixation. During the mobile phase, measurements were made after the vesicle remained the segment. Beginning on the day of fixation, measurements were done each day at the site of the embryonic vesicle. Measurements w ere made from a frozen image of the embryonic vesicle in cross section relative to the uterine horn at maximum diameter of the vesicle. Thickness site of the meso Figure 4 the dorsal aspect (mesometrial) of the cross section of endometrium and 4:00 and 7:30 as the ventral aspect (antimesometrial). Thickness was measured with the calipers of the ultrasound scanner between the internal surface of the wall of the embryonic vesicle and the apparent junction between endometrium and myometrium. The interna l wall of the vesicle was used because the surface between the endometrium and vesicle wall often was indistinct. The junction between endometrium and myometrium was based on the characteristic echotexture of the endometrium (Ginther 1995 b ). Dorsal endomet rial encroachment upon the vesicle from greater endometrial thickness dorsally than ventrally was assessed by dividing the dorsal thickness measurements by the

PAGE 84

84 ventral measurements, and the result was defined as an encroachment ratio ( Figure 4 2). A ratio of 1 indicated that the dorsal and ventral endometrial walls encompassing the vesicle were similar in thickness, and a ratio of 2 indicated that the dorsal wall was twice as thick as the ventral wall. To reduce the error associated with the irregular shape of the vesicle, the mean of the quotients between 1:30 and 7:30 and between 10:30 and 4:30 was used for each daily value. The encroachment ratio was not different ( P > 0.05) among the measurements that were made at 5 min intervals, and the mean for the 5 min intervals was used for each mare and day in further analyses. Endometrial perfusion or vascularity was evaluated in color Doppler mode in the caudal segment containing the vesicle during endometrial thickness measurements. During the mobility phase, th e estimates were made when the vesicle was temporarily in the caudal segment of either uterine horn. Perfusion was estimated subjectively by scoring the extent of colored areas in the endometrium during real time cross sectioning in a continuous span of 1 min. Because of animal and uterine movements, multiple cross sections were viewed until an adequate uninterrupted 1 min series was obtained. Only the colored areas that appeared to be within the endometrium were considered. The scores were 1, 2, 3, and 4, indicating nil, minimal, intermediate, and maximal perfusion, respectively. The scoring system was validated previously (Silva et al. 2005) The selected 1 min scan was recorded on a digital videocassette. Vascular perfusion of the endometrium also was as sessed objectively by off line measurement of the number of colored pixels and the number of colored spots as an indicator of blood flow area, as described (Silva et al. 2005) A selected still frame (image) with the estimated maximum flow area from each 1 min recorded scan was used. The images were captured from the videocassettes using Adobe Premiere Pro 1.5 software (TIFF format; Adobe

PAGE 85

85 Systems, San Jose, CA, USA). Colored spots or pixel aggregates were selected from the images, extracted, and saved (GIF format) using Adobe PhotoShop 5.5 software (Adobe Systems). The number of colored spots was extracted directly from the GIF format images. ImajeJ 1.31v software (National Institutes of Health, Bethesda, MD, USA) was used for calculation of the total number of colored pixels for each GIF format image. The subjective and objective perfusion end points were not different ( P > 0.05) among the measurements at 5 min intervals, and the mean for the 5 min intervals was used in the analyses for each approach. Sequen tial endometrial encroachment and perfusion data were centralized to fixation and extended from 4 days before to 3 days after fixation. Before fixation, daily comparisons of endometrial thickness and vascular perfusion surrounding the vesicle when in a cau dal segment were made between the horn of future fixation and the opposite horn. The two horns were compared for 4, 3, and 2 days before fixation; data were not included for the opposite horn on the day before fixation, owing to the absence of a vesicle in the opposite horn during the mobility trial in seven of nine mares. Endometrial encroachment was also centralized to first detection of the early indicator Statistical Analyses Data were examined for normality with the Kolmogorov Smirnov test. Data tha t were not normally distributed were transformed to natural logarithms. The scores for Doppler vascularity were considered to be nonparametric and were analyzed by a ranking procedure (Conover 1999) The ranked scores and the parametric end points were ana lyzed by the mixed procedure of SAS (version 8.2; SAS Institute, Inc., Cary, NC) to determine the main effects and the interaction, using a repeated statement to account for autocorrelation between sequential measurements. Paired and unpaired Student t tes ts were used to locate differences within and between horns,

PAGE 86

86 respectively, when significant main effects or an interaction were obtained. Discrete data were analyzed by Student t tests. The proportion of mares with the embryonic vesicle located in the futu re horn of fixation versus the opposite horn 1 day before fixation was compared with a chi square test. A probability of P indicated a significant difference. All values, unless otherwise stated, are the mean SEM. Results Five mares were not used, because of embryonic loss during the experimental periods (n=3) and fixation in the uterine body (n=2), resulting in 21 mares for Experiment 1 and 9 mares for Experiment 2. The mean day of fixation, day of first detection of the early indicator of the future position of the embryo proper, day of first detection of the embryo proper, intervals between these three events, and clock face position and day to day changes in position of the early indicator and embryo proper are shown for each experiment and combined for the two experiments (Table 4 1). Data from last day of examination in Experiment 2 are not given in the table, o wing to early termination of the experiment (Day 19). The early indicator was first detected on the day of fixation (17/30 mares; 57%) or 1 day (40%) or 2 days (3%) after fixation, resulting in the interval of 0.5 0.1 days between the two events. In all mares in both experiments, the early indicator was detected before detection of the embryo proper (range of intervals, 1 to 5 days). The days of first detection of the embryo proper with heart beats (number of mares) were as follows: Day 17 (1), Day 18 (11 ), Day 19 (13), and Day 20 (5). Experiment 1 The early indicator served to mark the future position of the embryo proper and was detected in all mares. The early indicator consisted of colored spots in close apposition to or

PAGE 87

87 impinging upon the wall of th e vesicle ( Figure 4 3). One to six processes of the colored spots appeared to involve the vesicle wall. The indicator persisted in approximately similar form from first detection until the embryo proper stage in individual mares. An echoic spot without a c olor Doppler signal arose from the internal wall of vesicle and protruded into the fluid area of the vesicle at the site of the early indicator in 9/21 mares (43%) on the day before an embryonic heart beat was detected. The position (clock face hours) of the early indicator at the first detection did not differ from the position at last detection (day before detection of embryo proper) or from the position of the embryo proper at first detection and at last detection on Day 21 (Table 4 1). The change in po sition between first detection of the early indicator and embryo proper did not differ between mares with an interval from indicator to embryo proper of 1 or 2 days (change in position, 1.1 Experiment 2 The diameter (cross sectional relative to the uterine horn) of the embryonic vesicle increased progressively (significant increase each day) from 4 days before fixation (9.8 mm) until the day of fixation (24.1 mm). Growth rate of the vesicle during this ti me was 3.6 mm/day. Significant vesicle diameter changes were not detected for the 3 days after fixation. During the 2 h mobility trials at 4 days to 2 days before fixation, the percentage of mares in which the vesicle appeared in both horns (39%), only in the future horn of fixation (26%), or only in the opposite horn (35%) was not different among these three groups. However, 1 day before fixation, the vesicle was in only the future horn of fixation or the adjacent cranial end of the uterine body during the mobility trial in 7 of 9 mares, compared to 2 of 9 in only the opposite horn and 0 of 9

PAGE 88

88 in both horns ( P < 0.05). An early indicator of the future position of the embryo proper was not identified during the mobility phase in any mare. The endometrial encr oachment ratios, vascularity scores, number of colored spots, and number of colored pixels for 4 days before to 3 days after fixation are shown ( Figure 4 4). There were no significant effects of horn (horn of future fixation and opposite horn), day, or an interaction of day and horn for the encroachment ratio over 4, 3, and 2 days before fixation. However, for 4, 3, and 2 days before fixation, the main effect of day was significant for vascularity score ( P < 0.0001), number of colored spots ( P < 0.001), and number of colored pixels ( P < 0.005). There was no horn effect. The days of significant differences are shown ( Figure 4 4). Analyses of data for the horn of fixation from 4 days before to 3 days after fixation were significant ( P < 0.003) for each of the four end points. The first significant increase occurred between 4 and 1 days before fixation for the encroachment ratio ( P < 0.02), between 4 and 2 days before fixation for vascularity score ( P < 0.05) and number of colored pixels ( P < 0.05), and between 4 and 1 days before fixation for number of colored spots ( P < 0.05). The endometrial encroachment ratio in the horn of fixation differed (P<0.0001) over days centralized to the first day of detection of the early indicator. The ratio first increased ( P < 0 .04) between 4 and 2 days before first detection of the indicator ( Figure 4 5). Discussion The diameter growth rate of the embryonic vesicle (3.6 mm/day) during the mobility phase and the day of fixation are similar to reported values (Ginther 1995 b ) The absence of an increase in cross sectional expansion of the vesicle relative to the uterine horn after fixation is consistent with previous studies (Ginther 1995 b ) ; expansion occurs longitudinally along the uterine lumen, owing to turgidity of the uteri ne wall. Fixation occurred in the caudal segment of

PAGE 89

89 a uterine horn in 30 of 32 mares. The remaining fixations (6%) occurred in the uterine body, which is similar to the 7% incidence of fixation in the body in a previous study (Gastal et al. 1996) One of t he two mares was bred in two earlier studies and fixation during each of the three pregnancies occurred in the middle of the uterine body, indicating repeatability. During the last day of the mobility phase, the vesicle was mobile within the future horn of fixation but did not enter the opposite horn in a significant number of mares (7 of 9). This is a novel finding, and the underlying mechanism is not known. However, the vesicle may have entered the cranial most aspect of the uterine body before returning to the caudal segment of the horn of fixation; this could not be determined, critically. The slight, but significant, increase in differential dorsal endometrial thickening (encroachment ratio) in the caudal segment of the future horn of fixation between 4 and 1 days before fixation and the reported increased uterine turgidity (Gastal et al. 1996) may have contributed to the fixation process. The degree of dorsal thickening in the nonfixation horn could not be evaluated in the seven mares with apparent con finement of the mobile vesicle in or near the horn of future fixation on the day before fixation; the absence of the vesicle in the caudal segment of the opposite horn precluded measurement of thickening. Further study with a different approach will be nee ded. Moreover, study is needed on the extent of differential dorsal endometrial thickening in other parts of the horn of fixation and throughout the opposite horn. In a recent study (Silva et al. 2005) the extent of vascular perfusion was assessed in the middle segment of each horn during the mobility phase. Perfusion increased in both horns during Days 11 to 14, but was greater in the horn that contained the embryo at the time of assessment. An increase in vascularity occurred within 7 min after the vesi cle entered a horn. In the present study, vascular perfusion during the mobility phase was assessed in the caudal segment of each

PAGE 90

90 horn after the vesicle was present in the caudal segment for at least 5 min; the results were similar to those of the previous study (Silva et al. 2005) The increase in vascularity began before the increase in the encroachment ratio in the endometrium at the site of future fixation. The post fixation 2 day increase in vascularity score at the site of fixation was also similar fo r the present and previous studies. However, the increase in the encroachment ratio between 1 and 3 days after fixation in the present study was more rapid than during 4 to 0 days before fixation, whereas a continued increase in vascularity did not occur 1 to 3 days after fixation. The nonsynchronous occurrence of endometrial perfusion and encroachment suggested, although tenuously, that the two events were from different stimulating factors, presumably from the embryonic vesicle. The rapid increase in the encroachment ratio after fixation may have reflected the continued presence of the vesicle, assuming that the vesicle produced a factor that stimulated thickening of the endometrium. It seems reasonable that the differential thickening would occur closest to the mesometrial attachment or the point of entry of blood vessels into the uterine horns. In this regard, the dorsal thickening may be considered preparatory to the attachment of the umbilical cord adjacent to the mesometrial attachment during the fetal stage (Ginther 1998 a ) Morphology of the fixation site (implantation chamber) has been examined with histologically prepared specimens (Enders & Liu 1991) As the vesicle expanded, the ventral endometrium at the embryonic pole dilated and formed the cham ber. The endometrial folds were distinct dorsally and flattened ventrally. The chamber assumed an oval shape, indicating that the turgid horn allowed expansion only in the direction of the uterine lumen. Endometrial folds at each end of the chamber were cl osely apposed. These descriptions from excised tracts are consistent with earlier descriptions based on ultrasonography (Ginther 1983b) However, morphologic description of the tissue architecture of the profound hypertrophy at the dorsal

PAGE 91

91 aspect of the cha mber apparently has not been reported. The echotexture of the endometrial encroachment was not considered or compared to the echotexture of the endometrium in other parts of the uterus in the present study. Comparison of the dorsal and ventral aspects of t he endometrium by ultrasound in the present study was not productive, primarily because enhancement artifacts obscured the endometrium beneath the fluid filled vesicle; enhancement artifacts result from relative over saturation by echoes from the ventral w all because of limited attenuation of the ultrasound beams while passing through the yolk sac fluid (Ginther 1995 a ) The morphology and underlying mechanisms involving the endometrial enlargement near the mesometrial attachment will need investigation. The discovery of an early color Doppler indicator in the endometrium marking the future position of the embryo proper at the periphery of the vesicle in all 30 mares was an asset in the study of the orientation phenomenon. Results supported the hypothesis tha t dorsal endometrial encroachment begins before the earliest indication that orientation had occurred and, in addition, indicated that encroachment began even before fixation. The range of intervals from first detection of the early indicator to the first detection of the embryo proper (1 to 5 days) indicated the extent of variation in the interval. Nevertheless, the mean clock face position of the early indicator and the embryo proper remained approximately constant and were not different from one another The day to day change in position of the early indicator and embryo proper in individuals throughout the experiments was minimal (means of 0.4 and 0.2 clock face hours). That is, there was little position orientation change from day to day or between fir st detection of the early indicator and the last examination of the embryo. The anatomical origin of the color Doppler signals that were used as early indicators of the future position of the embryo proper and especially the colored processes that appeare d to

PAGE 92

92 permeate the vesicle wall are unknown. The major portion of the colored area likely represented blood flow in endometrial vessels that were stimulated or dilated as a result of the close apposition to the embryonic disc. The color processes that appea red to reach the yolk sac fluid may have represented movement of blood in rudimentary embryonic vessels and contractions of the primitive heart. In this regard, a detailed study of embryonic angiogenesis at this stage is lacking. It has been reported that an anastomotic network of blood vessels in the yolk sac wall adjacent to the embryo proper and a heart chamber were present on Day 18, but the crucial Days of 15 to 17 were not included in the study (Enders et al. 1993) The color responses at the edge of the colored spots also may have represented blooming artifacts or the extension of the color signals beyond the lumens of blood vessels (Zwiebel & Pellerito 2005) Our current technology and knowledge were not adequate for determining whether portions of t he colored early indicator involved embryonic as well as endometrial vessels, and further study is needed. First detection of the embryo proper with heart beats ( on Days 17 to 20 was about 2 days earlier than for previous reports (Days 19 to 22 ; Ginther 1 995 b ). The earlier detection represented an improvement in the resolution of the B mode ultrasound technology combined with confirmation of heart beats with the color Doppler function. The detection of a small echoic spot on the internal surface of the ves icle at the position of the early indicator in 43% of mares on the day before detection of the embryo proper can be attributed to an embryo proper before the detection of heart beats. In conclusion, the embryonic vesicle entered and was mobile in the uteri ne horn of future fixation on the day before fixation more frequently than for the opposite horn. Differential dorsal thickening of the endometrium that surrounds the embryonic vesicle began during the later days of the mobility phase. After fixation, the differential dorsal thickening or endometrial

PAGE 93

93 encroachment upon the vesicle increased rapidly and was more than 4 times thicker than ventrally by three days after fixation. Color Doppler imaged blood vessels formed in the endometrium close to the ventral w all of the embryonic pole of the vesicle an average of 0.5 days after fixation and 2.5 days before detection of the embryo proper with heart beats. These distinct color spots were designated as early indicators of the future position of the embryo proper a t the periphery of the vesicle. An early indicator was detected in all mares opposite to the dorsal endometrial thickening and mesometrial attachment, and its position did not differ significantly from the position of the later detected embryo proper with heart beats. Based on the position of the early indicator, orientation of the embryonic vesicle occurred immediately after fixation and on a temporal basis supported the hypothesis that dorsal endometrial encroachment begins before the earliest indication that orientation has occurred.

PAGE 94

94 Table 4 1. Means ( SEM) for days of fixation and detection of the orientation indicators and clock face positions for each experiment. Experiment 1 (n = 21) Experiment 2 (n = 9) Combined (n = 30) Day after ovulatio n Fixation 15.9 0.1 15.9 0.2 15.9 0.1 First detection of early indicator a 16.4 0.2 16.3 0.1 16.4 0.1 First detection of embryo proper 19.1 0.1 18.4 0.1 18.8 0.1 Intervals (days) Fixation to early indicat or 0.5 0.1 0.4 0.2 0.5 0.1 Early indicator to embryo proper 2.6 0.2 2.1 0.2 2.5 0.2 Fixation to embryo proper 3.1 0.2 2.6 0.2 3.0 0.1 Position (clock face hours) b Early indicator First detection 6. 1 0.2 6.0 0.2 6.1 0.2 Last detection 6.3 0.1 6.3 0.4 6.3 0.1 Embryo proper First detection 6.4 0.3 6.1 0.6 6.3 0.2 On Day 21 6.5 0.3 ----Position change/day (clock face hours) Early indicator 0.4 0.2 0.2 0.1 0.3 0.1 Embryo proper 0.2 0.1 ----a Localized colored area in endometrium that indicated the future clock face position of the embryo proper with heart beats. b Clock lock at the center of the mesometrial attachment. No significant differences in means between experiments.

PAGE 95

95 Figure 4 1. Diagram of the transrectal placement of a linear array ultrasound transducer, showing the spatial relationships among the uterine horns, transducer, and sonograms. The colored spots are color Doppler indicators of blood flow. The arrows in the image on the left indicate the outer limits of the endometrium. The nine uterine segments used in the mobility trials are shown. ma=mesometri al attachment.

PAGE 96

96 Figure 4 structure at the periphery of the embryonic vesicle (A) and B mode sonogram illustrating the method for determining the endometrial encroach ment ratio (EER; B). 10:30 was divided by the thickness at 4:30 (green arrows) and the thi ckness at 1:30 was divided by the thickness at 7:30 (yellow arrows). The average endometrial encroachment ratio in this illustration is 2.7.

PAGE 97

97 Figure 4 3. Sonograms illustrating (arrows) early endometrial indicators of the future position of the embry o proper (A, B) and the embryo proper (C, D). The arrows (A, B) indicate sites where the color of the early indicator appears to permeate the vesicle wall, a small embryo proper (note the small color spot; C), and a more developed embryo proper (D). The co lor Doppler assessment was confined to the area delineated by the dotted lines (A) to improve the color flow resolution.

PAGE 98

98 Figure 4 4. Means (SEM) for endometrial encroachment ratio (dorsal thickness divided by ventral thickness) and three end points f or assessing the extent of vascular perfusion of the endometrium centralized to the day of fixation (n=9 mares). Horn of fixation before Day 0 refers to the future horn of fixation as determined retroactively. The opposite horn refers to the horn in which fixation did not occur. An asterisk indicates a significant difference ( P < 0.05) between days combined for the two horns. For each panel, lower case letters above the day axis indicate days of differences between means within the horn of fixation; any two days without a common lower case letter are different ( P < 0.05).

PAGE 99

99 Figure 4 5 Means (SEM) for endometrial encroachment ratio (dorsal thickness divided by ventral thickness) centralized to first day of detection of the early indicator (n=9). Lower c ase letters above the day axis indicate days of differences between means; any two days without a common lower case letter are different ( P < 0.05)

PAGE 100

100 CHAPTER 5 INCIDENCE AND NATURE OF DYSORIENTATION OF THE EMBRYO PROPER AND SPONTANEOUS CORRECTION IN MARES Synopsis Orientation of the embryo proper at the periphery of the equine embryonic vesicle is rly ultrasonographically detectable vascular endometrial indicator of the future position of the embryo proper has been reported previously and was first detected in a mean 2.5 days before detection of the embryo proper. In the present study, four occurren ces of dysorientation of the embryo proper were found in a group of 30 mares (incidence, 13%). When first detected, the early indicator of the clock face position of the embryonic pole for the dysorientation and normal orientation group, respectively, was 1.3 increased progressively over Days 16 to 19, so that the embryo proper was at 3, 9, 9, or 10 defective encroachment of the dorsal endometrium upon the vesicle in three of the four mares. In a second study, dysorientation of the embryo proper occurred in two mares with apparently normal uterine tone and endometrial encroachment. When first detecte asymmetric enlargement of the allantoic sac spontaneously corrected the dysorientation, so that orientation of the umbilical

PAGE 101

101 Introduction The large size of the fluid filled embryonic vesicle (conceptus) and the close proximity of the uterine wall to the rectal wall in the mare provide an exquisite model for study of embryo uterine interactions, using transrectal ultrasonography (Ginther 1983a, 1983b) Equids are the only common eutherian mammals in which real time images of conceptus migration, fixation, and orientation and conversion from yolk sac to allantoic sac placentation can be studied sequentially in vivo and apparently without disturban ce. The spherical embryonic vesicle reaches the uterine body on about Day 8 (ovulation = Day 0 ; Griffin et al. 1993) and over Days 9 to 15 (diameter, 3 to 20 mm) traverses the full length of the uterine horns and body many times per day (Ginther 1983a, Lei th & Ginther 1985) The vesicle becomes fixed on Day 16 in the caudal portion of a uterine horn. Fixation is attributable to an impediment to continued mobility from a bend in the horns, increasing uterine turgidity, and increasing vesicle growth and occur s despite the continuation of uterine contractions (Ginther 1983b, Leith & Ginther 1985, Gastal et al. 1996). Orientation of the embryo proper refers to its position at the periphery of the embryonic vesicle relative to the mesometrial attachment. In the equine species, the embryonic pole is antimesometrial (opposite to the mesometrial attachment) or on the ventral aspect of the vesicle after orientation is completed (Ginther 1998 a ) The pattern of orientation (mesometrial, antimesometrial, intermediate) i s constant within species but differs among species (Mossmam 1971, 1987) Because of the advantages of the horse model, the mechanisms of the orientation process have been studied in detail, in contrast to the absence or dearth of information in other spec ies. The orientation process in mares has been attributed (Ginther 1983b, 1985, 1998) to physical or mechanical characteristics of the uterus and conceptus as follows: 1) differences in tensile strength between the thin (two cell layers) and thick (three l ayers) portions of the wall of

PAGE 102

102 the embryonic vesicle; 2) asymmetric encroachment of the turgid uterine wall upon the vesicle, resulting from differential thickening of the dorsal endometrium at the mesometrial attachment; 3) the massaging action of uterine contractions; and 4) a distinct, smooth, and strong capsule enclosing the embryonic vesicle until about Day 21 (Betteridge et al. 1982) The surfaces of the equine embryonic vesicle and endometrium develop adhesive qualities (Denker 2000, Enders & Liu 199 1, Al Ramadan et al. 2002) which may aid in anchoring the vesicle after orientation is completed. In a recent study (Silva et al. 2005) the extent of endometrial vascular perfusion was assessed by color Doppler ultrasonography in the middle segment of e ach horn during the mobility phase. Perfusion increased in both horns during Days 11 to 14 but was greater in the horn that contained the mobile embryo at the time of assessment. An increase in vascularity occurred within 7 minutes after the vesicle entere d a horn. In another study (Silva & Ginther 2006) the endometrium began to thicken dorsally (endometrial encroachment) during the later days of the mobility phase. After fixation, dorsal thickening increased more rapidly and was more than four times great er than ventrally by 3 days after fixation. Color Doppler imaged blood vessels formed in the endometrium opposite to the mesometrial attachment and close to the ventral wall or embryonic pole of the vesicle an average of 0.5 days after fixation on mean Day 15.9 and 2.5 days before detection of the embryo proper with heart beats on mean Day 18.8. These distinct color spots were designated as early indicators of the future position of the embryo proper at the periphery of the vesicle. An early indicator was d etected in all of 30 mares in an antimesometrial position opposite to the dorsal endometrial encroachment and mesometrial attachment, and its position did not differ significantly from the position of the later detected embryo proper with heart beats. Base d on the position of the early indicator, orientation of the

PAGE 103

103 embryonic vesicle occurred immediately after fixation and on a temporal basis supported the hypothesis that differential endometrial thickening encroaches upon the fixed vesicle before the earlie st indication that orientation has occurred. In the present study a search was made for indications of malpositioning or dysorientation of the embryonic pole in the records obtained from the previous study (Silva & Ginther 2006) The physical nature of t he progressive development of dysorientation was characterized. Orientation and defined dysorientation were compared to further test the hypothesis that dorsal endometrial encroachment was a component of successful orientation. In addition, spontaneous cor rection of the dysorientation process was described. Materials and Methods Animal management, B mode (gray scale) and color Doppler ultrasound equipment and techniques, and data collection procedures have been reported (Silva & Ginther 2006) The present study is a reassessment of reported data (Silva & Ginther 2006) after grouping the mares into those with normal orientation and those with dysorientation. The position of the embryo on Day 19 was used to assign mares to the normal orientation group (early embryo proper antimesometrial or at the ventral aspect of vesicle) or dysorientation group (embryo proper mesometrial or at the dorsal aspect) based on a previous report (Ginther 1985) Sites at the periphery of the cross sectional image of the embryonic vesicle were assigned positions, according to the face of a clock ( Figure 5 determining the position of the embryonic pol e at the periphery of the vesicle in all 30 mares.

PAGE 104

104 were defi ned as being in the ventral aspect (antimesometrial). Two structural markers of orientation of the embryonic pole were used: 1) presence of a color Doppler early endometrial indicator of the future position of the embryo proper and 2) presence of the embr yo proper with heart beats. The localized early endometrial vascular indicator of completed orientation was distinguishable from other endometrial color Doppler signals for blood flow by closer proximity to the embryonic vesicle and greater stability in lo cation and appearance during frequent examinations at a given session (Silva & Ginther 2006) Termination of the study was on Day 19. The end points were days of fixations, first detection of the early indicator, and first detection of the embryo proper. T he clock face position of the early counterclockwise) was used to compare groups and days rather than the actual clock face position, owing to the canceling effect when direction of change was not considered. The change orientation. Stabili ty of the position was assessed by changes over Days 16 to 19. Endometrial thickness (distance between the apparent endometrial/myometrial interface and embryonic vesicle) was assessed in four available mares with dysorientation of the embryo proper and s even randomly selected mares with normal orientation. Thickness was measured in B mode on the days of first detection of the early indicator and embryo proper and on Days 15 to 19. Measurements were made from a frozen image of the embryonic vesicle in cros s section relative to the uterine horn in two directions at maximum diameter of the vesicle. Thickness

PAGE 105

105 7:30, and 10:30 relative to the site of the mesometrial attach positions of 1:30 and 10:30 were defined as representing the dorsal aspect (mesometrial) of the cross section of endometrium and 4:30 and 7:30 as the ventral aspect (antimesometrial). Dorsal endometrial encroachment upon the vesicle from greater endometrial thickness dorsally than ventrally was assessed by dividing the dorsal thickness measurements by the ventral measurements, and the result was defined as an encroachment ratio (Silva & Ginther 2006) The encroachment ratio a t first detection of the early indicator and at first detection of the embryo proper was used for comparison of the normal orientation and dysorientation groups. In addition, the encroachment ratios for Days 15 to 19 were compared between groups. The posi and the encroachment ratio for Days 15 to 19 were studied by a factorial ANOVA to determine main effects of group and day and the interaction of group by day. When an interaction was obtained, comparisons between the orientation and dysorientation groups were made by unpaired t tests. In a second study, dysorientation was observed in two mares with apparently normal uterine tone and endometrial encroachment. The dysorie ntation in these two mares was monitored daily until Day 45. Results Dysorientation of the embryo proper, defined by a position in the dorsal aspect of the uterine horn or in the mesometrial area, occurred in four of 30 mares (13%). There were no differe nces between the normal orientation and dysorientation groups in day of fixation, day of first detection of the early indicator, or day of first detection of the embryo proper (Table 5 1). For the early indicator and for the embryo proper, the number of ho

PAGE 106

106 detection was significantly greater for the dysorientation group than for the normal orientation group (Table 5 1). The effect of group and day and the interaction of group by day was different (P < 0.0001) for number of hours f Figure 5 2). The interaction resulted from a greater increase over days and a greater mean within each day in the dysorientation group. The dorsal encroachment ratio for the difference in endometrial thickness between the dorsal and ventral aspects of the uterine horn was less for the dysorientation group than for the normal orientation group on the first day of detection of the embryo proper (Table 1). The increase in the encroachment ratio over Days 15 to 19 also was les s in the dysorientation group, as indicated by a day by group interaction (P < 0.03; Figure 5 2), similar to the results for On Day 19, the conceptus had primarily a guitar in the no rmal orientation group, as previously reported (Ginther 1983b) whereas the conceptus was oblong in three of four mares in the dysorientation group ( Figure 5 3). Specifically, the maximum linear dimension of the conceptus averaged over the four mares was g reater (P < 0.002) and the opposite dimension was smaller (P < 0.03) in the dysorientation group (34.8 1.6 and 16.8 2.2 mm, respectively) than in the normal orientation group (27.0 0.4 and 24.0 2.3 mm, respectively). In the second study in which dysorientation was observed upon first detection of the embryo proper in two mares, spontaneous correction of the dysorientation occurred in each mare. The correction involved asymmetric expansion of the allantoic sac, so that the umbilical cord of the fet us attached in a normal position in the area of the mesometrial attachment ( Figure 5 4).

PAGE 107

107 Discussion Orientation of the embryo proper was defined as positioning of the embryonic pole at 6 proper. Assigning mares to normal orientation and dysorientation groups was made on Day 19, the last day with data from all 30 mares. Detection of the embryo proper with heart beat on mean Day 18.8 was about 2 days earlier than for previous reports, owing to improved ultrasound technology (Silva & Ginther 2006) Dysorientation of the embryo proper in 4 of 30 (13%) mares is the first info rmation on incidence of dysorientation in any species. On Day 19, the embryonic ported mean for Silva & Ginther 2006 ). The reliability of using the early indicator to determine the future position of the embryo proper with heart beats has been reported for this group of 30 mares (Silva & Ginther 2006 ) ; there were no differences in clock face position of the embryonic pole between the early indicator and embryo dysorientation group, compared to the normal group, on the first day of the de tection of the early indicator. However, a gradual change in position from the antimesometrial area to the intermediate area occurred consistently in a given direction (clockwise or counterclockwise ) within each of the four mares with embryo dysorientation The findings of progressive position changes over Days 16 to 19 demonstrated position instability in the dysorientation group. These findings on the nature of the dysorientation process have not been previously described for any species.

PAGE 108

108 An increase in the endometrial encroachment ratio in the horn of fixation began before fixation with a more profound increase after fixation (Silva & Ginther 2006) In the present study, an increase in the encroachment ratio similar to the encroachment in the normal gro up did not occur in the dysorientation group, as indicated by the day by group interaction. The defective development of dorsal endometrial encroachment in association with dysorientation supported the hypothesis that differential dorsal thickening is at l east part of the normal process for orientation of the embryo proper. On the day of detection of the early indicator in the dysorientation group, the embryonic pole was in the antimesometrial area, and its position over subsequent days was less stable than in the normal orientation group. Therefore, our interpretation is that the dorsal endometrial thickening that began before fixation was adequate initially for placing the embryonic pole in the antimesometrial area in both groups, but the increase in encro achment was not adequate to maintain the antimesometrial orientation in the dysorientation group. Therefore, under this assumption, the embryonic pole gradually moved to an abnormal position as the embryonic vesicle increased in diameter. The measurements of the embryonic vesicle in two planes with the uterus in cross section indicated that the vesicle was more oblong or flattened in the dysorientation group averaged over the four mares. It was also noted that the uterus was more flaccid upon digital compr ession, similar to the uterus during diestrus, but unlike the turgid uterus at this stage of pregnancy (Gastal et al. 1996) Lack of development of uterine turgidity and underdeveloped endometrial encroachment accounts for the distortion in the shape of th e conceptus. In individual mares, dysorientation was associated with a flaccid uterus and poor endometrial encroachment (three mares), but uterine tone, endometrial encroachment, and resulting shape of the conceptus seemed normal in the remaining mare. Dys orientation has been described previously in a mare that did

PAGE 109

109 not develop the uterine tone characteristic of pregnancy (Ginther 1985) ; in addition to the conceptus being upside down, the conceptus at Day 33 extended into the middle of the uterine horn. This earlier description is consistent with the present finding that the embryonic vesicles in the dysorientation group were more oblong in three of four mares. A report (Ginther 1984 b ) of dysorientation of the umbilical cord involved four fetuses that remaine d after embryo reduction in unilateral twin sets. The umbilical cord of the survivor was attached in the ventral hemisphere of the vesicle. Dysorientation of the umbilical cord attachment was associated with embryo reduction after Day 20. When the reductio n occurred before Day 20, orientation of the umbilical cord of the survivor was similar to orientation for a singleton, apparently because there was time for orientation of the embryo proper to occur after reduction was completed. There were no twin embryo s in the present study. In the second study, two cases of dysorientation of the embryo proper were observed upon first detection of the embryo proper; uterine tone and endometrial encroachment seemed normal, as for the one of four mares with dysorientati on in the primary study. However, these two mares were monitored daily until Day 45, whereas information was not available beyond Day 19 for the four mares in the primary study. The final position or orientation of the attachment of the umbilical cord was determined in the two mares in the second study. In both mares, the cord was attached in a normal position at the dorsal or mesometrial aspect of the is, spontaneous correction of the dysorientation of embryo proper occurred during expansion of the allantoic sac, as shown ( Figure 5 4). As the allantoic sac expanded, the embryo proper and the apposing vascularized membranes between the yolk sac and alla ntoic sac moved toward a site opposite to the initial clock face position of the embryo proper. However, owing to

PAGE 110

11 0 dysorientation of the embryo proper, one end of the joint membrane of the yolk sac and allantoic sac was first to reach the area of endometria l encroachment at the dorsal aspect of the conceptus or the area of mesometrial attachment. The first end of the membrane to reach the mesometrial area apparently became adhered, as indicated by the failure to detect further movement; the adhesive qualitie s of the endometrial/vesicle interface have been described (Enders & Liu 1991) The other end of the joint membranes continued to move as the allantoic sac expanded until it also reached the mesometrial area. Thereby, the initial dysorientation of the embr yo proper was corrected, so that orientation of the umbilical cord was in the mesometrial area. Presumably, spontaneous correction of dysorientation of the embryo proper would not have occurred in the three of four mares with a flaccid uterus and minimal e ndometrial encroachment in the primary study; however, this was not ascertained because of termination of the study at Day 19. In retrospect, it appears that the equine conceptus undergoes two forms of orientation. The first, orientation of the embryo pr oper, occurs soon after the end of the mobility phase. As a mesometrial attachment. The second, orientation of the umbilical cord attachment, occurs during expansion of juxtaposition to the attachment of the mesometrium. Thus, the mechanism for orientation of the umbilical cord attachment maintains correct positioning and corrects malpositioning of the embryo proper. The outcome of the pregnancies with dysorientation of the embryo proper was not determined. In this regard, the blood vessels of the embryonic placental membranes come together mesometrially and become part of the umbilical cord wh en the fetus approaches the mesometrial area. Thus, the orientation processes assure that the attachment of the placental

PAGE 111

111 vessels will be in juxtaposition to the mesometrial attachment of the maternal vessels. Proper orientation of the umbilical cord attac hment may have efficiency or survival value for the fetus, but this has not been studied. In the five reported (Ginther 1984 b ) cases of dysorientation of the embryo proper, the conceptus reached the fetal stage (Day 40) with no indication of an affect on s ize (Ginther 1984 b 1985) Apparently, therefore, dysorientation is not detrimental to the conceptus during the embryo stage. Information is available on dysorientation of the umbilical cord attachment during the fetal stage only in the reported mare with a flaccid uterus (Ginther 1984 b ) The foal seemed unaffected. Speculatively, dysorientation during the fetal stage could be detrimental because the fetal body and limbs may compromise the malpositioned umbilical cord attachment, but the incidence of this h ypothetical outcome is not known. In conclusion, normal orientation of the embryonic pole in the antimesometrial area occurred in 26 mares and dysorientation in four mares (13%). Dysorientation was present when the embryonic pole was first identified on Da y 16; an early indicator of the future position of the group. Position of the embryonic pole changed progressively over days so that the position of the embryo proper embryo proper in three of the four mares was temporally associated with a flaccid uterus and defective encroachment of the dorsal endometrium upon the vesicle. In a second s tudy, spontaneous correction of dysorientation of the embryo proper occurred in two mares with apparently normal uterine tone and endometrial encroachment. Correction occurred during asymmetric expansion of the allantoic sac, so that the orientation of the umbilical cord

PAGE 112

112 Table 5 1. Mean s SEM for events associated with normal orientation and dysorientation Normal End point orientation Dysorientation a Probability Number of mares 26 4 Fixation (Day) 15.8 0.1 16.0 0.4 NS First detection (Day) Early indicator b 16.3 0.2 16.3 0.2 NS Embryo proper 18.8 0.2 18.8 0.3 NS Position c (No. hours from 6:00) Early indicator d 0.4 0.1 1.3 0.3 P<0.008 Embryo pro per d 0.7 0.1 3.3 0.3 P<0.00001 Endometrial encroachment (ratio) e Early indicator d 2.5 0.3 2.0 0.3 NS Embryo proper d 4.5 0.5 2.8 0.5 P<0.03 a Embryo proper in dorsal aspect of embryonic vesicle on Day 19. b Endometrial vascular indicator o f the future position of the embryo proper. c Clock face position of the indicated structure relative t attachment. d At first detection e Thickness of the endometrium at 1:30 and 10:30 divided by the thickness at 4:30 and 7:30. Data available for seven mares in the normal group and four mares in the dysorientation group. NS Not significant

PAGE 113

113 Figure 5 1. Illustration of the determination of clock face positions relative to the mesometrial graduation marks is 10 mm.

PAGE 114

114 Figure 5 2. Mean ( SEM) for encroachment ratio and clock face position of the embryonic pole ientation and dysorientation) and day was significant for both end points. Difference between groups was significant (P < 0.05) for Days 18 and 19 for endometrium and for each day for embryonic pole.

PAGE 115

115 Figure 5 3. Color Doppler ultrasonograms of the c onceptus at Day 19 for normal orientation and dysorientation. Encroachment or thickening of the endometrium between the mesometrial attachment (upper right) and the embryonic vesicle is prominent for normal orientation but is not apparent for dysorientatio n. Arrows indicate the periphery of the endometrium. E = embryo proper.

PAGE 116

116

PAGE 117

117 Figure 5 4. Comparison of the expansion of the allantoic sac for a conceptus with normal orientation and dysorientation of the embryo proper (E). Correction of the dysorientation of the embryo proper occurred by asymmetric expansion of the allantoic sac, so that the orientation of the umbilical cord attachment of the fetus (F) was in a normal position in the mesometrial area. In the correction of dysorientation of the embryo proper one end of the apposing membranes of the yolk and allantoic sacs was first to reach the mesometrial area and apparently became adhered. The continued to expand.

PAGE 118

118 CHAPTER 6 CONC EPTUS MEDIATED ENDOMETRIAL VASCULAR CHANGES PRIOR TO IMPLANTATION IN MARES AN ANATOMIC, HISTOMORPHOMETRIC AND VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR SYSTEM IMMUNOLOCALIZATION AND GENE EXPRESSION STUDY Synopsis Implantation in Equids begins around D ay 40 of pregnancy culminating with the developed early placenta around Day 60. Before implantation, the spherical conceptus is mobile until around Day 16 (day of fixation). Fixation occurs in the posterior segment of one of the uterine horns. Studies in m ares by color Doppler ultrasonography detected endometrial vascular changes, prior implantation, as early as Day 12. During mobility phase, rapid endometrial vascular accompanied the conceptus changes of location. After fixation, rampant increase in vascul arity and thickness was observed in the dorsal endometrium of the fixation site. We hypothesized that the conceptus locally modulates the intense endometrial vascular changes and remodeling observed prior to implantation in mares. In situ morphology on Day 21 of pregnancy revealed a more edematous and vascular area at the dorsal endometrium in the ipsilateral horn to the conceptus. Adherence points were localized between the yolk sac surface and the dorsal endometrium suggesting specific points of interacti on between the embryonic glycoproteic capsule and uterine epithelial cells. Histomorphology showed that the dorsal endometrial area around the conceptus presents a large area occupied by blood vessels and endometrial glands. Immunolocalization pattern of V EGF and VEGFR 1 did not differ between pregnant and cyclic mares. VEGFR 2 stained all endometrial layers of pregnant mares but did not or was very weak at the luminal epithelium of cyclic mares. Intense proliferation was observed by Ki 67 staining at the l uminal epithelium of mares during oestrus. During luteal phase, the proliferative state was practically reduced to zero. During pregnancy, all endometrial layers presented proliferative cells

PAGE 119

119 and more positive cells were observed on Day 21 than on Day 14. Expression of VEGF mRNA was higher in pregnant mares than cyclic mares. mRNA expression for VEGFR 2 was higher on Day 21 of pregnancy compared with cyclic mares and was numerically higher but did not differ from pregnant mares on Day 14. Our main hypothesi s was supported. Data suggest paracrine stimulation of the endometrial vascular system by the conceptus. However, results indicate that endometrial architecture is being modulated by paracrine and systemic stimulus during pregnancy. Data provide insights i nto the architectural and molecular changes in the endometrium that occur during early pregnancy in the presence of the conceptus. These results set the stage for future experiments to understand more completely the role of the conceptus in regulating the uterine environment in favor to its own nutritional supply, development, and to the uterine immunological modulation. Introduction Vascular development and remodeling in both maternal and fetal sides are essential during pregnancy in all mammal species; particular time points are prior to implantation, implantation, placentation, and throughout pregnancy accompanying fetal development until term (Reynolds et al. 2006; Torry et al. 2007). Before and at the time of implantation, the vascularized endometrium provides an appropriate uterine environment, throughout endometrial glands secretions to support embryo survival and development (Burton et al. 2007). After implantation, development and expansion of the placental villous vasculature (placentation) serves to supply the initial fetal demands for nutrients and oxygen culminating in the full developed placenta. Throughout pregnancy materno placental vasculature remodeling parallels the gradual increase in fetal transport of nutrients, respiratory gases, and w astes (Faber & Thornburg 1983; Reynolds et al. 2006; Torry et al. 2007).

PAGE 120

120 In this work, we studied involvement of the conceptus in endometrial vascular and architectural changes before implantation in mares. The large size of Equids permits experimental mon itoring through transvaginal or transrectal interventions in the reproductive tract for frequent sample or data collection. In addition, they present particularities during the early pregnancy that favors their use as an in vivo experimental model. The emb ryonic vesicle enters the uterus around Day 6 after fertilization and is detectable by ultrasound examination starting as early as Day 9 (Betteridge et al. 1982; Ginther 1995 b ). The embryonic vesicle has a spherical shape resulting of its glycoprotein caps ule in which is in dynamic composition changing in the uterus ( Oriol et al. 1993, Chu et al. 1997). After entering the uterus, the spherical embryonic vesicle starts a phase of mobility traveling throughout the uterine horns and body, many times daily. Thi s movement is easily monitored by ultrasound (Leith & Ginther 1984). The activity of the embryonic vesicle mobility increases on Day 13 reaching maximal movement on Days 14 and 15 followed by a decrease that culminates in fixation (cessation of mobility) o f the embryonic vesicle around Day 16 in the posterior segment, of one of the uterine horns (Ginther 1983). In this fixed position, the conceptus continues its spherical growth but spreads rostrally and caudally due to relatively low resistance at these ar eas of the uterus. The beginning of the implantation process in mares starts around Day 40 of pregnancy and the functional placenta is observed around Day 60 (Sharp 2000). Based on the number of tissues separating maternal from fetal blood, the equine plac enta is classified as epitheliochorial and all cell layers are present in from both maternal and fetal sides (epithelium, stroma, and endothelium; Amoroso 1952). After entering into the uterus, the presence of the embryo must be detected by the mother and the luteolytic mechanism abrogated so as to maintain progesterone synthesis by the corpus luteum (Roberts et al. 1996). This is the first luteal response to pregnancy, better known as

PAGE 121

121 maternal recognition of pregnancy. High embryo loss rates are common at this time in all domestic animals and women, and are higher if the conception resulted from assisted reproductive techniques (Mclean 1987; Diskin & Morris 2008; Vanderwall 2008). The mobility phase of the equine embryonic vesicle is well established as an important event to maintain luteal function (McDowell et al. 1988). Studies using Doppler ultrasonography have described significant uterine and embryonic vascular changes during early pregnancy in mares (Silva et al. 2005; Silva & Ginther 2006; Ginther & Silva 2006) and cows (Silva et al. 2009). In mares, during the mobility phase of early pregnancy, an increase in endometrial blood flow was associated with conceptus presence. Transient changes in endometrial vascular perfusion accompanied the embryonic v esicle as the vesicle changed location during embryo mobility. On Day 13, the continued presence of the vesicle in the same horn for an average of 7 min stimulated an increase in vascularity of the endometrium of the middle segment of the horn. Fixation of the conceptus in the base of one uterine horn promoted a rampant increase in blood flow and dorsal endometrial encroachment at the fixation uterine segment. Endometrial vascular development and increased endometrial thickness have been associated with suc cessful implantation in women (Torry et al. 2007). T he endometrial glands have also been suggested as a source of nutrients, growth factors and cytokines during the entire first trimester of pregnancy in women (Burton et al. 2002; 2007). In addition, the u terine glands and its secretions are essential for embryo development (elongation) and implantation in sheep (Gray et al. 2001). We suggest that the endometrial vascular remodeling in mares is modulated by the conceptus well before implantation, creating a uterine environment that will support initial conceptus development, and assure optimal conditions for the dynamic events of mobility,

PAGE 122

122 fixation, maternal recognition of pregnancy, uterine immune modulation, implantation, and placentation. The mechanisms i nvolved in the early local stimulation of uterine vascularity by the conceptus in mares and other domestic animals species have not been clarified. One consideration is that the early conceptus alters endometrial vascularity by the production of vascular s timulants. In this regard, estrogens stimulate increased uterine blood flow in the sow, cow, and ewe (Ford 1982 c ). In vitro studies have shown that Day 12 porcine embryos (Ford et al. 198 2a ) and Day 16 bovine embryos (Shemesh et al. 1979; Chenault 1980) pr oduce estrogens. A marked production of estrogen by the equine conceptus occurs as early as Day 12 (Zavy et al. 1984; Raeside et al. 2004). Thus, estrogen has vasostimulatory properties, and estrogen production by the conceptus is temporally associated wit h stimulation of uterine vascularity in cattle, pigs and horses. Estrogen is recognized as one of the driving forces for increased uterine blood flow through both rapid and delayed actions, via binding to its receptors in the uterine artery wall, and espec ially at the uterine artery endothelium (Albrecht et al. 2003; Heryanto & Rogers 2002; Mendelsohn 2002). The blastocysts of many species also secrete a variety of prostaglandins, and it has been also proposed that conceptus prostaglandins stimulate increas es in uterine blood flow and uterine dynamic (Lewis 1989). During tissue remodeling, vascular development is orchestrated by stimulatory and inhibitory signals. Use of an angiogenic inhibitor before or right after implantation in mice resulted in resorptio n of all embryos (Klauber et al. 1997), which supports the hypothesis that angiogenesis is a critical component of normal implantation/placentation in early stages of pregnancy. The nature of the signals responsible for induction and control of endometrial angiogenesis has been the focus of many studies (Bourlev et al. 2006; Girling & Rogers 2005;

PAGE 123

123 Herv et al. 2006). There are many critical growth factors involved in the physiological regulation of blood vessel formation and maintenance, and the actions of these molecular players must be very carefully orchestrated in terms of time, space and dose so as to form a functioning vascular network (Jain 2003; Yancopoulos et al. 2000; Risau 1997; Zygmunt et al. 2003). The crucial factors regulating angiogenesis and vasculogenesis belong to the endothelial growth factor family. VEGF and its receptor system, VEGFR 1 and VEGFR 2, are well recognized as the initiators and regulators of angiogenic and vasculogenic processes (Roy et al. 2006; Ferrara et al. 2003; Ferrara 2004; Yancopoulos et al. 2000). VEGFR 2, also known as KDR or Flk 1, is the major mediator of mitogenic, angiogenic and permeability enhancing effects of VEGF, while VEGFR 1, also known as Flt 1, is considered to be a regulator of the VEGF system by seques tering VEGF and rendering this factor less available to VEGFR 2 (Ferrara 2004, Holmes et al. 2007). Work done with rodents demonstrated that the immune blocking of VEGF in the uterus blocked the uterine edema induced by estrogens and also blocked implantat ion (Rabbani & Rogers 2001; Rockwell et al. 2002). The immunolocalization of VEGF receptors in different endometrial cell types than not only endothelial cells may indicate that the VEGF system: 1) plays a cellular survival role in these cells; 2) induces these cells to proliferate, and/or; 3) stimulates these cells to produce others important factors of the angiogenic cascade that, by a paracrine faction, reach the endothelium to act. A diagram showing a spatial view of the Doppler scanning of the pregnant uterus on Day 20 in mares is presented in Figure 6 1 (modified with permission from Silva & Ginther 2006). The uterus is divided into nine segments and the two ultrasonograms were taken from the posterior segment of both uterine horns. The authors describ ed higher vascular perfusion presented by the side ipsilateral to the fixed embryonic vesicle or conceptus at the dorsal

PAGE 124

124 endometrium and also at the mesometrial attachment area compared with the opposite horn. The colored spots indicate blood flow. Another important observation was the greater thickness of the dorsal endometrium compared with the ventral endometrium around the conceptus. At this stage, the dorsal endometrium is around five fold thicker than the ventral endometrium. These findings raised the question of the mechanisms and importance of these changes. Our main hypothesis in this study is that the conceptus locally modulates intense endometrial vascular changes and remodeling prior to implantation in mares. Two different days during early preg nancy in mares were selected. On Day 14, the embryonic vesicle is still mobile within the uterus and the potential production of angiogenic factors would be expected to be distributed throughout the entire uterine lumen. However, on Day 21 the embryonic ve sicle is fixed and potential conceptus produced angiogenic factors would be expected to be concentrated in the same segment of the uterine lumen. Cyclic mares during follicular or luteal phases of the reproductive cycle were used as controls. The endometri um from the posterior segment of both uterine horns was studied for differential in situ morphology, histomorphometry, immunolocalization of VEGF, its receptors and Ki 67 marker, and gene expression quantification of VEGF and its receptors. Materials and Methods Animals Animals were handled in accordanc e and with the approval of the U niversity of Florida Institutional Animal Care and Use Committee. Pony mares (total of 25) aged 4 to 16 years were housed at the University of Florida Horse Research Unit in O cala, FL and maintained on pasture with free access to grass, water, and trace mineralized salt and fed supplemental grass hay

PAGE 125

125 (Coastal Bermudagrass) as needed to maintain body condition around 5 throughout the experiments (range from 1 9; Henneke et al. 1 983). Four studies were performed as follow: 1) In situ macroscopic evaluation; 2) Histomorphometry; 3) Immunolocalization of VEFG, VEGFR 1, VEGFR 2, and Ki 67; 4) Relative gene expression of VEFG, VEGFR 1, VEGFR 2. For studies two to four listed above, endometrial samples from pregnant mares on Day 14 and Day 21 and from cyclic mares during follicular and luteal phases were collected by biopsy. Pony mares were assigned to be either bred (Day 14 or Day 21) or cyclic (follicular or luteal phases of the re productive cycle) and scanned daily by ultrasound to monitor the size of the largest follicle and uterine characteristics (Ginther 1995 b ). Mares assigned to the two pregnant groups were either inseminated artificially with raw semen collected from a donor pony stallion with known fertility or bred naturally to the same stallion every day after first detection of a dominant follicle (>35mm) until ovulation was confirmed. Pregnancy diagnoses were done on Days 10 12 after ovulation. Mares that did become pregn ant were used for endometrial biopsies on Days 14 and 21 and mares that did not become pregnant received a ( ) injection on Day 12 (5 mg IM of dinoprost tromethamine; Lutalyse, Pfizer, USA) and were randomly reassigned into one of the four groups after a complete reproductive cycle interval. Two groups were formed with cyclic mares for endometrial biopsies; one during follicular phase and another during the luteal phase of the reproductive cycle. Follicular phase was characterized by p resence of a follicle equal to or greater than 30 35 mm of diameter, uterine echotexture equal or larger than 3.5 (1 to 4; Ginther 1995 b ) or when a change of 1.5 points in echotexture occurred after the day of PGF2a injection, estrus behavior presence, abs ence or presence of a corpus luteum smaller than 15 mm of diameter, and no uterine

PAGE 126

126 abnormalities (Ginther 1992). The luteal phase was defined as nonbred mares on Day 10 after ovulation, presence of the corpus luteum, no estrus behavior, and no uterine abno rmalities (Ginther 1992). For the first study ( in situ macroscopic evaluation), four pregnant ponies on Day 21 were euthanized for collection of the entire reproductive tract. These four animals were used to visualize the conceptus endometrial interaction in vivo Tissues derived from these studies were harvested and preserved for future studies of angiogenic and proliferative factors published elsewhere. The mares were bred using the same protocol previously described. For the euthanasia, an injection a tranquilizer drug (xylazine, 0.5 mg/lb IV) was performed. After pre sedation, an overdose of an anesthesic drug from the barbiturate class was injected (390 mg pentobarbital sodium and 50 mg phenytoin sodium per 1 ml; dose, 1 ml/10 lbs bw IV; Beuthanasia D Special, Schering Plough Animal Health, USA). After 5 minutes of the barbiturate injection, a veterinary exam was conducted to confirm death (abs ence of breathing, heartbeat, and corneal reflex ) The reproductive tract was immediately removed surgically a nd the in situ macroscopic exam and tissue collection performed. Endometrial Samples Endometrial tissue biopsies were taken from the dorsal area of the posterior segment of each uterine horn from all mares. The uterus of mares has a T or Y shape resting upon the abdominal organs (Ginther 1992) which easily permits evaluating the uterus, by p alpation or ultrasound scanning. This represents a distinct advantage over species with curved bicornuated uterus (Ginther 1984 a ; see Figure 6 1). All mares were seda ted (200 300 mg of xylazine hydrochloride; IV) and a basket type equine uterine biopsy forceps was used transvaginally for sampling the endometrium. The sampled endometrial tissue was section in two parts. One of the

PAGE 127

127 sections was fixed by immersion in 10% ( v:v ) buffered formal saline for 24 hours at 4 0 C before processing for histology. The second section was placed in a plastic tube and snap frozen in liquid nitrogen and stored at 80C for subsequent RNA extraction. After the 24 h fixation period, the end ometrial samples were trimmed, dehydrated and embedded in paraffin wax. The paraffin blocks were then cut in sections of 4 m and the sections placed onto poly L lysine coated glass slides. Before to start the de wax process, the wax excess was removed by leaving the slides in an oven at 40 0 C during 30 minutes. Tissue samples were then de waxed in xylene and rehydrated through an alcohol gradient to water and used for morphometry or immunohistochemistry Endometrial Morphometry Luminal and glandular ep ithelium cells and endothelial cells stained positively for VEGFR 2 and permitted the acquisition of all end points used in the morphometric study. Therefore, e ndometrial sections stained with anti VEGFR 2 serum in the immunohistochemistry study (see tech nique described below) were used. Eleven pregnant mares on Day 21, five on Day 14 and twelve cyclic mares, six during follicular and six during the luteal phase were used. For data acquisition, the endometrium from the dorsal area of the posterior segment of both uterine horns in each animal was subdivided into two layers; the stratum spongiosum (including the stratum compactum) and the stratum basalis. Three pictures were randomly taken in each stratum from each endometrial sample at 200 X magnification u sing a Nikon TE2000 microscope and captured using a Nikon DM1200F digital camera T he NIS Elements AR 2.3 software (Nikon) was used to calculate i n each picture, and at both stratum, the t otal endometrial area, glandular are, stromal area, blood vessels area, and number of uterine glands The measurement values from the three pictures were averaged and the p ercentage of stromal

PAGE 128

128 area occupied by blood vessels, percentage of endometrial are a occupied by glands and stroma were calculated and used for the ana lysis Immunohistochemistry After deparaffinization and rehydratation, endometrial samples were submitted to an antigen retrieval treatment to unmask antigenic sites by use of programmed heat and pressure. The slides were placed inside of a coplin jar c ontaining a solution of 10 mM sodium citrate buffer (pH 6.0). The coplin jar was placed inside a pressure chamber (Biocare Medical Decloaking Chamber, DC2002 CE) and exposed to 125 0 C for 30 seconds 90 0 C for 10 seconds, and then cool ed to room temperatur e. S lides were washed in tap water followed by TBS Tween solution ( 0.01 M Tris buffered saline, 0.15 M NaCl, 0.05 % (v:v) Tween 20, pH 7.4) Endogenous peroxidase was blocked by treating the slides by immersion in a solution of 3% hydrogen peroxidase in TBS for 15 minutes at room temperature followed by washing in TBS Tween. Nonspecific antigen sites were blocked by incubation of the slides in a 10% (v:v) goat serum in TBS Tween solution for 30 minutes at room temperature. After blocking, the slides were inc ubated with the primary antibody. Four antisera were used and diluted as follows: an anti VEGF(147) polyclonal rabbit serum at 1:200 (v:v) (sc 507; Santa Cruz Biotechnology, Inc., CA, USA); an anti VEGFR 1 polyclonal rabbit serum at 1:200 (v:v) (Flt 1 C 17 : s c 316; Santa Cruz Biotechnology ); a anti VEGFR 2 monoclonal mouse serum at 1:200 (v:v) (Flk 1 A 3: sc 6251; Santa Cruz Biotechnology ); and, anti Ki 67 polyclonal rabbit serum at 1:1500 (v:v) (NCL Ki67p; Novocastra Laboratories Ltd, Newcastle, UK). Slide s were incubated with the primary antibodies for 45 minutes at room temperature and then washed with TBS Tween. A universal probe capable of detecting rabbit and mouse antibodies followed by a polymer horseradish peroxidase was used to labeling the primary antibodies. For this step, the slides were incubated

PAGE 129

129 for 10 minutes at room temperature with the universal probe (Mach 4 universal AP polymer; M4U536G; Biocare Medical, CA, USA) and then for 10 more minutes with the HRP polymer (Mach 4 universal HRP polym er; M4U534G; Biocare Medical, CA, USA). The slides were washed with TBS Tween and, for visualization of the binding sites, incubated with DAB (diaminobenzidine; K 047; Diagnostic BioSystems, CA, USA) as substrate/chromogen for four minutes at room temperat ure, followed by TBS washing. Counterstaining was performed using hematoxylin for three minutes at room temperature followed by TBS and tap water washing. The endometrium sections were then labeled, dehydrated, and mounted in DPX resin. Two n egative and on e positive control slides were done for each run using the same described protocol. For negative controls, the primary antibody was replaced with Ig G or only TBS Tween solution in endometrium sections. For positive controls, horse kidney sections were used with the anti VEGF and VEGF receptors sera and horse lymph node sections with the anti Ki67 serum. RNA Extraction and Quantitative RT PCR Total RNA was extracted from endometrial biopsies using the TRIZOL Plus RNA Purification Kit (Invitrogen Corp). RNA samples (200 ng/reaction) were treated with RNase free DNase (Applied Biosystems Inc.) for 15 min at 37C, heat denatured (75C for 10 min), then reverse transcribed using High Capacity cDNA Reverse Transcriptase Kit and random hexamers (Applied Biosystem s). Real time PCR was completed using SYBR Green PCR Master Mix (Applied Biosystems) and primers (Table 6 2) specific for equine VEGF (GenBank GeneID: DX010658), VEGFR 1 (GenBank GeneID: AJ319908), VEGFR 2 (GenBank GeneID: XM 001493036), or 18S GenBank Ac cession#AJ311673) (95C for 10 min; 40 cycles of 95C for 15 sec, 55C for 1 min, 72C for 1 min; 55 to 95C Dissociation Event). Specificity of amplification was monitored by including non reverse transcribed RNA reactions for each sample and by

PAGE 130

130 completin g a dissociation analysis at the end of each real time run to verify the amplification of a single product. Changes in relative abundance of spec ific transcripts were examined using the T ) method with 18S as internal control gene ( Welter et al 2004 Livak & Schmittgen 2001 ) Statistical Analyses Data were examined for normality with the Kolmogorov Smirnov test. When t he normality test was significant (P < 0.05), data were transformed to natural logarithms or square root to minimize heterogeneity of variance. Individual end points were analyzed for time effects (day), and comparisons involving groups were analyzed for m ain effects (group, time) and the interaction by least squares analysis of variance (LS ANOVA) using the G eneral L inear M odel (GLM) procedure of SAS (version 9.2; SAS Institute, Inc). Paired and unpaired Student t tests were used to detect differences betw een individual means within an end point and among groups within the same end point, when individual effects or an interaction was obtained. A probability Resul ts Macroscopy Differential gross and vascular morphology between the two uterine segments, visualized by color Doppler ultrasonography, has been described in mares in a previous work (Silva & Ginther, 2006; Figure 6 1). The in situ macroscopic evaluation of the uterus from four pregnant mares on D ay 21 revealed remarkable new findings and, by visual examination, confirmed the vascular and anatomic differences found by the previous color Doppler ultrasonography studies between the posterior segments of the uterine horns; the horns ipsilateral and contralateral to the

PAGE 131

131 conceptus. Figure 6 2 shows representative pictures from our macroscopic findings. The two photographs on the right were taken from the posterior segment of the ipsilateral uterine horn. On the top photograph the conceptus with its membranes and primordial vascular system is visualized and, on the bottom, the same area is presented without the conceptus (dashed circles indicate similar positions). The incision was made through the dorsal aspect of the uterus. The confluence of the incision edges coincides with the area of the endometrium in intimate contact with the conceptus yolk sac membrane. The endometrium at this region (dorsal endometrium relative to the mesometrial attachment area) exhibit ed more edematous appearance (thicker) and more intense red coloration (black arrows), indicating more vascularization when compared with the endometrium from the dorsal area of the contralateral uterine horn. The posterior segment of the contralateral ute rine horn is shown in the upper picture on the left (Figure 6 2). The differential endometrial morphology observed at the dorsal area of the posterior segment of the ipsilateral horn was observed only in the segment containing the conceptus, not at the ven tral area or other segments of the uterus. The changes observed were strictly localized at the fixation site of the conceptus. Moreover, these changes were observed only in the dorsal area of the endometrium. The conceptus on Day 21 of pregnancy is shown on the bottom left photograph (Figure 6 2). The embryo proper, with intensely vascularized allantoic sac, and the yolk sac are indicated. The yellow arrow indicates small points on the yolk sac surface, like small sand grains. These points were likely patc hes of adherence between the yolk sac and the endometrium, easily observed during conceptus removal from the uterus with surgical dissection. These adherence points were only observed at the yolk sac surface

PAGE 132

132 Morphometry Analysis of the vascular supply, endometrial gland area, and the number of endometrial glands between uterine horns and among the four studied reproductive statuses are presented in purposes of this p aper. The amount of stromal area occupied by blood vessels was markedly larger in the endometrium of pregnant mares than cyclic mares. When all endometrial data were compared among reproductive statuses, no differences were found between pregnant mares on Day 14 and Day 21 of pregnancy. However, the ipsilateral horn of pregnant mares on Day 21 presented more blood vessel area than the contralateral horn and the ipsilateral horn of pregnant mares on Day 14. The contralateral horn of both pregnant groups did not differ. Blood vessel area was not different between cyclic mares in follicular and luteal phases and also no difference was found when the ipsilateral horn was compared with the contralateral horn in either follicular or luteal phases ( P values in Tabl e 1). The area of the endometrium occupied by uterine glands was similar between pregnant mares on Day 21 and cyclic mares during the luteal phase, but larger than in pregnant mares on Day 14 and cyclic mares during the follicular phase. Area of the endom etrium occupied by uterine glands in pregnant mares on Day 14 and cyclic mares during the follicular phase did not differ (Table 1). The number of uterine glands per endometrial area was larger in the pregnant groups compared with the cyclic groups, and in all reproductive statuses the number of glands did not differ between uterine horns (see Table 1 for P values). Similar analyses presented in Table 1 were done for the data presented in Figure 6 3, but compared the two endometrial strata; the stratum spon giosum (stratum compactum included) and the stratum basalis. The results for blood vessel area and percent endometrium occupied by glands are presented in Figure 6 3 (see legend for P values). In the stratum spongiosum, the

PAGE 133

133 superficial area of the endometr ium, the area of blood vessels did not differ among reproductive statuses in the contralateral uterine horn. However, the blood vessel area was larger in the ipsilateral horn of pregnant mares than in cyclic mares. In addition, blood vessel area in the ips ilateral horn was larger than in the contralateral horn only in pregnant mares on Day 21. In the stratum basalis, the area occupied by blood vessels is in general 2 fold larger when compared with the stratum spongiosum in any of the horns or pregnancy sta tuses. Both uterine horns in pregnant mares on Day 21 exhibited more blood vessels than in cyclic mares. The pregnant mares on Day 14 appeared to be transitional between the cyclic state and advanced pregnant state (Day 21) relative to increased blood vess els. Similar to that observed in the stratum spongiosum, the blood vessel area in the ipsilateral horn was larger than in the contralateral horn only in the pregnant mares on Day 21. The area occupied by endometrial glands in the stratum spongiosum was lar ger only in the ipsilateral horn of pregnant mares on Day 21 when compared with the ipsilateral horn of the other groups or with the contralateral horn in the same group (Figure 6 3, bottom multicolored graphs). Interestingly, in the stratum basalis, the a rea occupied by endometrial glands was larger in the contralateral horn of pregnant mares on Day 21 than in the pregnant mares on Day 14 or during follicular phase but similar to during luteal phase. No differences were observed either between statuses in the blood vessel area in the ipsilateral horn or between horns within statuses. Pregnant mares on Day 21 were analyzed separately to compare the two uterine horns and the two strata (Figure 6 3; see legend for P values). The blood vessel area was larger in the ipsilateral horn in the stratum basalis compared with any other location. When the uterine horns were compared within strata, the area with blood vessels was larger in the ipsilateral horn in both strata. The area occupied by endometrial glands was la rger in the ipsilateral horn in the

PAGE 134

134 spongiosum stratum when compared with the contralateral horn in this stratum or with the stratum basalis in the ipsilateral horn. However, the area occupied by endometrial glands in the stratum basalis was not different in the ipsilateral and contralateral horns Immunohistochemistry Immunohistochemistry No difference in staining pattern was found for VEGF and VEGFR 1 antigens among the studied reproductive statuses (Figure 6 4). However, differential staining patterns were found for VEGFR 2 (Figure 6 5) and Ki 67 (Figure 6 6) antigens. Ipsilateral refers to the uterine horn on the side of the conceptus on Day 21 or to the side of the ovary with the preovulatory follicle or corpus luteum. No difference in staining patte rns was found when the ipsilateral and contralateral horns were compared in each of the studied reproductive statuses. Negative and positive controls are presented for each antigen studied (Figures 6 4, 6 5, and 6 6). The staining was totally abolished whe n the three primary antibodies were absent and replaced by IgG or TBS Tween and the positive controls presented similar stained patterns described in kidney of rats using the same antibodies used in this study (Kanellis et al. 2000). The anti VEGF serum st ained the luminal epithelium intensely. Glandular epithelial cells and endothelial cells were also stained but not as strong as the luminal epithelium. Some stromal cells were also stained although they were dispersed in the stroma with less intense staini ng when compared with the other endometrial cell layers (Figure 6 4). For the anti VEGFR 1 serum, a similar pattern of staining described for anti VEGF serum was observed, although, no difference in the intensity of staining was observed among the endometr ial cell layers (Figure 6 4). No differences in staining patterns were found among reproductive statuses for both anti sera.

PAGE 135

135 The anti VEGFR 2 serum stained the luminal and glandular epithelial cells, endothelium, and, less intensely, some of the stromal ce lls in pregnant mares. However, in cyclic mares, the luminal epithelium did not stain at all or presented only a few cells with weak staining during the luteal phase. The absence of staining was more pronounced during the follicular phase. Staining of stro mal cells was observed although with lower intensity than in the glandular epithelial cells. The anti Ki 67 serum staining was rarely observed in stromal and glandular epithelial cells during the luteal phase. However, it exhibited prominent staining in th e majority of the luminal epithelial cells and in a few stromal cells during follicular phase (Figure 6 6). In pregnant mares, the staining was present in all endometrial cell layers as luminal epithelium, glandular epithelium, stroma, and endothelium. Pre gnant mares on Day 21, exhibited a staining pattern similar to pregnant mares on Day 14, however, there appeared to be a larger number of positive cells in all endometrial layers at Day 21 (Figure 6 6). Real Time PCR The relative abundance of VEGF mRNA, V EGFR 1 mRNA, and VEGFR 2 mRNA in the endometrium of pregnant mares on Day 21 and Day 14 and in cyclic mares during follicular and luteal phases is presented in Figure 6 7. Endometrial biopsies were collected from the ipsilateral horn to the conceptus or to the preovulatory follicle or corpus luteum in pregnant and cyclic ponies, respectively. No difference in abundance was found among the four studied reproductive statuses for VEGFR 1 mRNA ( P >0.05) and its expression relative to either VEGF or VEGFR 2 was e xtremely low. The abundance of VEGF mRNA and VEGFR 2 mRNA were significantly different among the reproductive statuses ( P =0.0271 and P =0.0047, respectively). Pregnant mares exhibited higher VEGF mRNA compared with cyclic mares ( P <0.05). Comparisons between the two pregnant groups or between the two cyclic groups showed no difference in

PAGE 136

136 VEGF mRNA abundance ( P >0.05). For VEGFR 2 mRNA abundance, pregnant mares on Day 21 exhibited the highest level but did not differ statistically from pregnant mares on Day 14 ( P >0.05). However, VEGFR2 in pregnant mares on Day 21 was significantly different from mares in the two cyclic groups ( P <0.05). Pregnant mares on Day 14 exhibited mathematically greater abundance of VEGFR 2 mRNA than mares in the cyclic groups but no stati stical differences were found ( P >0.05). In addition, the abundance of VEGFR 2 mRNA did not differ between the two cyclic groups ( P >0.05). Discussion The in situ morphological study of equine pregnancy on Day 21 revealed important new findings. By Day 21, the spherical embryonic vesicle has been fixed in the posterior segment of one of the uterine horns for at least 5 to 6 days (Ginther 1983), and exhibits dramatic endometrial vascularity and morphology differences between uterine horns observed with color Doppler ultrasonography (Silva et al. 2005; Silva & Ginther 2006). These latter authors reported greater vascularity in the horn ipsilateral to the conceptus at both endometrial and mesometrial levels. The area presenting the greatest vascularization was l ocalized in the endometrium dorsally, bordering the mesometrial attachment and in immediate contact with the fixed conceptus. Substantial growth (encroachment; around five fold thicker than the ventral area) of the endometrium in the dorsal area of the fix ation site was observed, (see Figure 6 1). The present in situ morphological study confirmed by visual inspection the previous color Doppler ultrasonographic findings. The dorsal endometrium at the fixation site was more edematous (thicker) and hyperemic t han any other area of the endometrium. Lefranc & Allen (2007 a ) have described by endoscopy approach a discrete hyperemia at the endometrium in contact with the conceptus on Day 20 of pregnancy. However, our findings precisely demarcated

PAGE 137

137 the endometrial ede matous and hyperemic area. This area was dorsal, bordering the mesometrial attachment region, and coincided with the surface of the yolk sac and endometrial contact. It had been postulated that, between the day of fixation and first detection of the embryo proper, the equine embryonic vesicle rotates orienting so that the embryo proper stays in contraposition to and the yolk sac in apposition to the dorsal endometrium (Ginther 1983). This orientation is important for the correct positioning of the umbilical cord at the area of the mesometrial attachment around Day 40 of pregnancy (Silva & Ginther, 2006; Ginther & Silva 2006). Using color Doppler ultrasonography, it has been shown that this process of orientation occurs immediately after fixation and no furth er changes in embryonic vesicle positioning (rotation) occur (Silva & Ginther 2006). In addition, it has been shown that dysorientated embryonic vesicles are frequently associated with lack of dorsal endometrial encroachment, poor endometrial vascularity, and embryonic loss (Ginther & Silva 2006). These studies provide support for the notion that the correct positioning of the embryonic vesicle is crucial for its survival and development. On Day 21 the embryonic vesicle exhibits two distinct cellular layers of the yolk sac, endoderm and ectoderm (bilaminar layer). On Day 16, the mesoderm layer intercedes between endoderm and ectoderm, forming blood islands and primitive vessels, originating the trilaminar layer (yolk sac placenta; Ginther 1992). Functional d ifferences between the bilaminar and trilaminar layers, as in steroid transport and metabolism, have been described (Betteridge 2007). On Day 21 approximately half of the yolk sac surface is covered by the trilaminar layer at its periphery and half at the dorsal area, covered by the bilaminar layer. We propose that conceptus nourishment before umbilical cord formation is provided predominately by uterine glands at the dorsal endometrial area. The increased number of blood vessels and uterine glands at this area of the endometrium in intimate contact with the thinner

PAGE 138

138 bilaminar layer favors delivery of nutrients and potentially other embryonic maternal communications. We also suggest that the disproportionate growth of the dorsal endometrium (increased vascula r and glandular development) is modulated by factors from the conceptus. During surgical dissection of the uterus for this study, the conceptus exhibited some adherence to the endometrium, localized between the surfaces of the yolk sac and the dorsal endom etrium. There appeared to be multiple small patches of contact between the yolk sac surface and the endometrium. Such conceptus adherence was also noticed in an intrauterine endoscopy procedure in which the conceptus was visualized fixed at the dorsal uter ine wall while the perfusate (0.9% saline) filled all the spaces between the endometrium and conceptus, except the dorsal area The adherence was strong enough to permit passage of the endoscope below the conceptus without damage, or loosening the conceptus (personal unpublished observation). In reality, the endometrial epithelium does not directly interact with the trophoblast cells on Day 21. The equine embryonic vesicle is covered by an acellular mucin like glycoprotein capsule (Betteridge et al. 1982; B etteridge 2007). This capsule has been implicated in keeping the vesicle spherical during the mobility phase and in selectively binding to uterine substances and controlling their delivery to the conceptus (Betteridge & Waelchli 2005; Quinn et al. 2005, 20 06). Arar et al. (2007) suggested that molecular rearrangement in the structure of capsule glycans, primarily desialylation, after fixation, contributes to increased permeability and promotes the interaction between capsule and endometrial epithelium. Base d on the present findings, we speculate that changes in the glycan structure may occur in the areas of the yolk sac surface where adherence was observed. ent source for embryonic nourishment before placentation. However, the

PAGE 139

139 uterine gland secretory activity in mares is observed not only before placentation (Zavy et al. 1982) but throughout pregnancy and the secretion content varies from proteinaceous in th e beginning to a holocrine type, with more cellular debris, in the end (Samuel et al. 1977; Ginther 1992). It has been proposed that nutrients, growth factors, and cytokines are delivered by uterine gland secretions, during the first trimester of pregnancy even in humans (hemochorial placenta; Burton et al. 2002; 2007; Hempstock et al. 2004). Our findings showed a greater number of endometrial glands in pregnant mares (Days 14 and 21) when compared with cyclic mares suggesting glandular hypertrophy and/or c ellular proliferation. Lefranc & Allen (2007a) found that uterine glands in the endometrium ipsilateral to the conceptus were more tortuous but less dense when compared with the contralateral side on Day 16 of pregnancy. We did not find differences in numb er glands or glandular area when the ipsilateral and the contralateral sides were compared either on Day 14 or on Day 21. However, the percent of endometrial area occupied by the uterine glands was larger in pregnant mares on Day 21 and in cyclic mares dur ing the luteal phase when compared with pregnant mares on Day 14 and cyclic mares in the follicular phase. More extensive branching and coiling of the endometrial glands has been described with the advance of the luteal phase in cyclic mares and suggested to be caused by temporal exposure to proges terone (Lefranc & Allen 2007b). Interestingly, in Day 14 pregnant mares, in spite of the relatively long exposure to progesterone, the area occupied by glands were not similar to pregnant mares on Day 21 or to cyc lic mares during the luteal phase. One possible explanation could be the effects of estrogens produced by the conceptus at this time, as reported by Zavy et al. (1984). During the follicular phase, the endometrium exhibited small number and small area with glands. Endometrial edema

PAGE 140

140 likely due to elevated estradiol levels was easily observed by ultrasonography and is the likely cause of stromal area increase in this group In summary, these results suggested elevated glandular secretory activity for histotro phic nutrition of the conceptus during equine early pregnancy. Analysis of endometrial glandular area in the two pregnant groups indicated an increase in the number of glands earlier (Day 14) and an increase in gland size later in pregnancy (Day 21). This increase in gland size and number could explain part or all of the endometrial encroachment observed ultrasonically, and grossly. Previous work assessing endometrial blood perfusion by color Doppler ultrasonography has shown that endometrial perfusion incr eased daily during the mobility phase and a localized and rampant increase at the dorsal endometrium was observed around the conceptus post fixation (Silva et al. 2005; Silva & Ginther 2006). The increase in blood flow may also partially explain dorsal end ometrial encroachment, as the area occupied by blood vessels was 2 to 3.5 fold higher in the stratum basalis and 4 to 8 fold higher in the stratum spongiosum in pregnant mares compared with cyclic mares. Furthermore, blood vessel area in pregnant mares on Day 21 is greater in the uterine segment occupied by the conceptus suggesting intense localized endometrial stimulation. The involvement of estrogens in the induction of VEGF expression and uterine endothelial permeability has been demonstrated (Kazy & Koo s 2007) and it is known that the equine conceptus produces estrogens during early pregnancy (Zavy et al. 1984). In addition, the equine conceptus produces prostaglandins F and E 2 at this time (Stout & Allen 2002). Specifically, prostaglandin E 2 has been reported to increase the expression of VEGF mRNA in human umbilical vein endothelial cells (Tamura et al. 2006) and it is produced by the equine conceptus throughout the m obility phase, increasing after Day 16 (approximate day of fixation; Stout & Allen 2002). No differences in blood vessel area between uterine horns was detected in

PAGE 141

141 pregnant mares on Day 14 but was detected on Day 21. We suggest that during the mobility pha se, angiogenic and vasodilatory factors produced by the conceptus are equally distributed in the uterine lumen. However, after fixation, these factors are concentrated in the uterine segment where the conceptus fixates. Furthermore, changes in the dorsal e ndometrium may reflect orientation of the conceptus with the bilaminar layer permitting greater diffusion of stimulatory factors to this area. Additionally, proximity to the mesometrial attachment likely favors growth of blood vessels in the dorsal endomet rium. VEGF and its two main receptors revealed their presence via immunolocalization in almost all cellular layers of the endometrium in all four reproductive statuses studied. VEGF receptors were initially described to be localized in endothelial cells f rom the vascular and lymphatic system but were later reported in a wide variety of non vascular cells (Ferrara et al. 2003; Roy et al. 2006; Holmes et al. 2007). Recent studies in domestic animals have localized the VEGF receptor system in a variety of cel lular types of endometrium and placenta in mares (Allen et al. 2007), cows (Pfarrer et al. 2006), and sows (Winther et al. 1999, Charnock Jones et al. 2001, Kaczmarek et al. 2008). We found a similar cellular location pattern for VEGF and VEGFR 1 in the en dometrium of all four reproductive statuses. In the stroma, there were scattered stained cells, but the cellular type was not identified in this study. This differential stromal cells staining suggests specificity of the immunolabelling. Our results for VE GF and VEGFR 1 staining differ from a recent immunohistochemistry work done in mares (Allen et al. 2007). During oestrus, Allen et al. ( 2007) did not see staining for VEGF and only weak staining for VEGFR 1 at the luminal epithelium and stroma of mares. Du ring diestrus, no staining was found for VEGF in the stroma nor for VEGFR 1 at stroma and luminal epithelium. In endothelium, VEGF staining was weak

PAGE 142

142 and VEGFR 1 staining essentially absent during oestrus while the opposite was observed during dioestrus. Th e staining pattern presented by VEGFR 2 in our study differed between pregnant and cyclic mares. VEGFR 2 staining was absent or weak at the luminal epithelial cells in cyclic mares. We found VEGFR 2 in the endothelium, luminal and glandular epithelium, and in some of the stromal cells. This stromal cell labeling pattern, as observed for VEGF and VEGFR 1, suggests specificity of our VEGFR 2 labeling system, as opposed to nonspecific staining of all cell types. Allen et al. (2007) did not find VEGFR 2 stainin g in the luminal epithelium of mares during dioestrus or early pregnancy, but a weak stain during oestrus. In our study, during oestrus the luminal epithelial cells did not stain positive for VEGFR 2. Kaczmarek et al. (2008) in an immunostaining study in s ows reported a staining pattern similar to our findings for VEFG and it receptors system during the oestrous cycle and early pregnancy. Up regulation of VEGFR 2 expression has been correlated with increased levels of estrogens and VEGF (Herv et al. 2006) and the early equine conceptus produces prodigious amounts of estrogens at the luminal epithelium surface (Zavy et al. 1984). The link between estrogens and VEGF production has been demonstrated (Cullivan Bove & Koos 1993, Bausero et al. 1998). Rockwell et al. (2002) showed that immunoneutralization of VEGF reduced the uterine edema induced by estrogens and blocked implantation. VEGF acts primarily through binding to VEGFR 2 (Ferrara et al. 2003, Ferrara 2004), however, estrogens also indirectly induce VEGF R 2 expression as VEGF upregulates the expression of VEGFR 2 (Herv et al. 2006). This suggests that the strong VEGFR 2 expression found at the luminal epithelium in pregnant mares could reflect conceptus produced estrogens. The strong staining of VEGFR 2, at the luminal epithelium of pregnant

PAGE 143

143 mares, but not found in the luminal epithelium of cyclic mares, likely indicates a pivotal event in the endometrial vascular changes prior to implantation. A large number of luminal epithelial cells stained positive for Ki 67 during oestrus but a much smaller number of cells from the glandular epithelium and stroma were positive. During diestrus, the number of positive staining cells in all endometrial layers was reduced. In contrast, during pregnancy, positive staini ng cells were found in all endometrial layers and were in greatest number on Day 21 of pregnancy. This differential activity of the luminal and glandular epithelium has been reported to be due to hormone changes during the estrous cycle (Gilbert 1992). Sim ilar findings for Ki 67 marker immunostaining had been reported in mares during the estrous cycle and pregnancy (Gerstenberg et al. 1999a, 1999b). Gerstenberg et al. (1999a) suggested that the high proliferative rate of the luminal epithelium during estrus is related to the high plasma levels of estradiol. Estrogens are well known to stimulate proliferation promoting uterine remodeling (Martin et al. 1973; Bigsby 2002). However, our findings suggest that estrogens do not stimulate endometrial cells in areas below the endometrium surface. During diestrus (Day 10), the cellular proliferative rate was almost absent in all endometrium layers in our study. Only a few scattered positive cells were found. Gerstenberg et al. (1999a) also found that the proliferative rate decreased as the plasma progesterone levels increased. Progesterone is well known to switch the endometrium function from proliferative to secretory phase (Bazer & Slayden 2008). During pregnancy, proliferative cells were found in all endometrial la yers. However, the greatest number of proliferative cells was found on Day 21 of pregnancy compared with Day 14. Gerstenberg et al. (1999b) found a reduced number of proliferative cells on Day 14 similar to late diestrus patterns. On Day 21, their findings were similar to our findings. On Days 14 and 21

PAGE 144

144 of pregnancy in mares, the plasma progesterone levels are high and the low proliferative rate of the endometrial cells could reflect the effects of progesterone on estrogen receptors (Okulicz et al. 1990). I n further support of that idea, decreased levels of estrogen receptor mRNA in the endometrium of mares on Day 14 of pregnancy have been reported (McDowell et al. 1999). However, the low proliferative rate seen in diestrus was not observed in pregnant mares Expression of progesterone receptors at the endometrial luminal epithelium and glandular epithelium decreased in sheep after around 10 days exposure to progesterone which reportedly allows repopulation of estrogen receptors (McCracken et al. 1984, Spence r et al. 1995, Spencer & Bazer 2004). Therefore, it is likely that the re establishment of estrogen receptors combined with the high concentration of conceptus produced estrogens renews a proliferative state for endometrial remodeling. The results present ed in this study for mRNA quantification of VEGF and its receptors are preliminary to a more comprehensive study currently underway. However, these preliminary results support the results obtained using other methodologies in this report. VEGF and VEGFR 2 mRNA expression were elevated in pregnant mares when compared with cyclic mares, likely reflecting conceptus estrogens (Cullivan Bove & Koos 1993, Bausero et al. 1998, Rockwell et al. 2002) and the consequent VEGF induced expression of VEGFR 2 (Herv et al 2006). The expression of VEGFR 2 in pregnant mares on Day 21 was larger ( P = 0.06) than on Day 14. Based on immunolocalization staining, this receptor was more intense at the luminal and glandular epithelium when compared with the stroma. This could refl ect VEGF release from the conceptus and/or repopulation of the estrogen receptors in the endometrium. The levels of VEGFR 1 mRNA did not differ among the reproductive statuses and its detection was only

PAGE 145

145 possible after more than 30 cycles of amplification s uggesting very low expression in all reproductive status studied. Our main hypothesis that endometrial angiogenesis and architecture changes are mediated by the presence of the conceptus was supported. The events of early pregnancy in mares, such as concep tus mobility phase, fixation, orientation, and dorsal encroachment of the endometrium on the conceptus side are temporally orchestrated to remodel the maternal uterine vascular system for the ultimate purpose of providing hematrophic nutrition. Our finding s suggest local stimulation of the endometrial vascular system by the conceptus. However, these results also indicate that endometrial architecture is modulated by local and systemic forces during pregnancy. A notable finding is that production and localiz ation of VEGFR 2 and proliferative cells (Ki 67) are diametrically differentially regulated. Preliminary real time PCR results suggest that the high level of expression of VEGF and VEGFR 2 in the pregnant mares could account for the observed increase in va scular architecture during pregnancy. Data provide insights into the architectural and molecular changes in the endometrium that occur during early pregnancy in the presence of the conceptus. These results set the stage for future experiments to understand more completely the role of the conceptus in regulating the uterine environment in favor to its own nutritional supply, development, and to the uterine immunological modulation

PAGE 146

146 Table 6 1. Endometrial histomorphometric study. Analysis of the vascular s upply, endometrial glands area, and number of endometrial glands between the uterine horns and among four reproductive statuses in mares End Point 1 Pregnant Day 21 Pregnant Day 14 Estrus Diestrus P value Blood vessels (% of stroma area) Ipsilateral horn 5.97 0.66 a 4.07 1.35 b 1.03 0.25 c 1.25 0.55 c 0.0001 Contralateral horn 2.89 0.56 a 2.44 0.48 a 1.68 0.26 ab 0.52 0.29 bc 0.0023 P value 0.0001 0.1220 0.0583 0.0950 All endometrium 4.43 0.55 a 3.48 0.68 a 1.29 0.19 b 0.93 0.22 b 0.0001 Glands (% of total area) Ipsilateral horn 48.6 1.7 a 40.0 2.3 ab 36.1 1.2 b 44.9 3.2 ab 0.0015 Contralateral horn 49.0 1.5 a 35.5 2.1 b 38.4 3.0 b 45.8 1.2 a 0.0001 P value 0.438 6 0.1351 0.2194 0.3721 All endometrium 48.8 1.3 a 38.2 1.7 b 37.1 1.2 b 45.4 1.2 a 0.0001 Number of uterine glands Ipsilateral horn 70.4 8.7 ab 90.4 13.8 a 47.2 4.7 b 60.6 4.0 ab 0.0367 Contralateral horn 72. 6 4.7 83.3 13.1 53.6 7.4 57.8 4.1 0.1052 P value 0.4145 0.3801 0.2338 0.3236 All endometrium 71.5 3.9 ab 89.7 6.6 a 50.1 3.4 c 59.2 3.0 bc 0.0004 1 Values presented are averages calculated based on measurements randomly taken fro m three microscopic fields at 200X magnification in each endometrial stratum and both uterine horns. Values for all endometrium are the average of all measurements. Superscripts letters indicates statistics differences (P<0.05) among reproductive statuses. Differences between uterine horns are indicated by the respective P values. Bold characters indicate end points with high values in pregnant status.

PAGE 147

147 Table 6 2 Listing of sense (SE) and antisense (AS) primers used for quantitative RT PCR Primer s Sequ ence (5' 3') VEGF SE GCGGACATCTTCCAGGAGTA VEGF AS GATGTTGAACTCCGCAGTGG VEGFR 1 AS TCAGATCATGCTGGACTGCT VEGFR 1 SE TGGCATTGAGTGGGATGTAG VEGFR 2 AS GCATGGTCTTCTGTGAAGCA VEGFR 2 SE TCAGGTCCCGATTTACAAGC 18S SE AACGACACTCTGGCATGCTAACTA 18S AS CGCCACTTGT CCCTCTAAGAA

PAGE 148

148 Figure 6 1. Uterine transrectal ultrasound scanning positioning diagram of the uterus with the obtained ultrasonograms from scanning of the posterior segment of each uterine horn. The uterine horn on the right contains the fixed conce ptus. The dorsal endometrium, in which borders the mesometrial attachment area, presents a disproportional growth (dorsal encroachment) when compared with the ventral endometrium. More intense blood flow (colored spots) is also observed at this dorsal area endometrium and mesometrium) when compared with the opposite uterine horn. The uterus shape in mares permits a subjective segmentation (nine segments; dashed lines) to precisely determine the locations for data and tissue collection. ma, Mesometrial attac hment (modified from Silva & Ginther, 2006).

PAGE 149

149 Figure 6 2. In situ morphological study of the endometrium. The posterior segment of both uterine horns and the conceptus from a mare on Day 21 of pregnancy is presented. In the posterior segment of the ips ilateral horn to the conceptus, the dorsal area of the endometrium (around the conceptus and adjacent to the mesometrial attachment) presented more roseo and edematous (black arrows) than either in the same area in the opposite horn or in any other area of the endometrium. A more close view showed intense presence of capillaries. The embryo proper, allantoic sac and yolk sac are indicated on the conceptus picture. Note the intense vascular development at the surface of the allantoic sac and around the embry o. The yellow arrow indicat es the small patches found at the yolk sac surface (dorsal conceptus region) which presented as adherence points to the dorsal endometrium (evident during the surgical removing of the conceptus from the uterine wall).

PAGE 150

150 Figure 6 3. Endometrial histomorphometric study. Multicolored graphs are showing the percentage of stromal area occupied by blood vessels (top) and the percentage of the total endometrial area occupied by uterine glands (bottom) in the stratum spongiosum (left g raphs) and in the stratum basalis (right graphs). Value of each bar represents the average of three measurements at 200X magnification. For the colored graphs, comparisons were done among four reproductive statuses and between uterine horns. When an effect of pregnancy status, uterine horn or an interaction was obtained, differences between pregnancy statuses (indicated by letters) and/or within a pregnancy status and among horn location (indicated by stars) were located. The green graphs on the right side are showing only data from pregnant mares on Day 21 by combination of the green bars from the colored bars graph set. Comparisons were done between uterine horns and locations. When an effect of pregnancy status, uterine horn or an interaction was obtained differences between pregnancy statuses and/or within a pregnancy status and among horn location (indicated by letters) were located. For multicolored graphs, the P values for the effects of reproductive status (R), horn (H), and interaction (RH) are: Top graphs = R: 0.0017, H: 0.4530, RH: 0.0397, and R: 0.0002, H: 0.0860, RH: 0.1384; Bottom graphs = R: 0.0001, H: 0.6714, RH: 0.0766, and R: 0.0067, H: 0.5659, RH: 0.1008. For the green graphs, the P values for the horn (H), stratum (S), and interaction (HS) are: H: 0.0080, S: 0.0001, HS: 0.4277, and H: 0.0770, S: 0.8647, HS: 0.0033

PAGE 151

151 Figure 6 4. Immunolocalization of VEGF (A) and VEGFR 1 (B) in mare endometrium. Similar staining was obtained for all reproductive statuses used in this study. A representat ive sample from one animal is presented. Sections were stained with a 1:200 dilution for anti VEGF serum or anti VEGFR 1 serum. A5, A6, B5, and B6 are representative pictures of n egative controls using either IgG or TBS Tween Kidney sections were used as positive control for anti VEGF serum and anti VEGFR 1 serum ( A 7 A8, B7, and B 8). Similar patterns of staining were

PAGE 152

152 observed for VEGF and VEGFR 1. Strong staining was observed at the luminal epithelium, glandular epithelium, and endothelium. Random stromal cells also stained positively. Pictures indicated by number 1 show low magnification, by number 2, intermediate magnification, and by numbers 3 and 4, high magnification at the epithelial and deep areas of the endometrium, respectively.

PAGE 153

153 Figure 6 5. I mmunolocalization of VEGFR 2 in endometrium from pregnant mares on Day 21 (A) and Day 14 (B), and from cyclic mares during follicular (C) and luteal (D)

PAGE 154

154 phases. Sections were stained with a 1:200 dilution of anti VEGFR 2 serum. N egative control (E) either for IgG or TBS Tween and kidney sections for positive control (F) are presented. Strong staining was observed at the luminal epithelium and endothelium in all reproductive statuses and the stromal cells were randomly positively stained. Luminal epithelial cells presented strongly VEGFR 2 stained on pregnant mares. However, luminal epithelial cells stained is practically absent during follicular and luteal phases of the cyclic mares. In addition, isolated luminal epithelial positive cells were found with mor e frequency in mares during luteal than follicular phase Pictures indicated by number 1 show low magnification, by number 2, intermediate magnification, and by numbers 3 and 4, high magnification at the epithelial and deep areas of the endometrium, respec tively.

PAGE 155

155 Figure 6 6. Immunolocalization of Ki 67 in endometrium from pregnant mares on Day 21 (A) and Day 14 (B), and from cyclic mares during follicular (C) and luteal (D) phases.

PAGE 156

156 Sections were stained with a 1:200 dilution of anti VEGFR 2 serum. N ega tive control (E) either for IgG or TBS Tween and kidney sections for positive control (F) are presented. Positive cells were abundant in the endometrium of pregnant mares on Day 21. Positive cells were found at the glandular epithelium, stroma and in large number at luminal epithelium and endothelium. Similar pattern of staining was observed on pregnant mares on Day 14 but in small number of cells. Cyclic mares during follicular phase presented very high number of positive cells at the luminal epithelium an d almost no positive cells in any other kind of endometrial cell. Cyclic mares during luteal phase presented isolated positive cells and in very small number in all areas of the endometrium. Pictures indicated by number 1 show low magnification, by number 2, intermediate magnification, and by numbers 3 and 4, high magnification at the epithelial and deep areas of the endometrium, respectively.

PAGE 157

157 Figure 6 7. Effect of the reproductive statuses on the relative abundance of VEGF mRNA, VEGFR 2 mRNA, and VEGF R 1 mRNA in mare endometrium. Endometrial biopsies were done in the posterior segment of the uterine horn ipsilateral to the conceptus or to the side of the largest follicle or of the corpus luteum in cyclic mares. Abundance of mRNA of the three studied ge nes relative to an internal control (18S) are presented normalized based on its relative expression during luteal phase. P values for the effect of reproductive status are the following: VEGF: 0.0271; VEGFR 2: 0.0047; VEGFR 1: 0.1282. Differences among pre gnancy statuses are indicated by letters ( P <0.05).

PAGE 158

158 CHAPTER 7 UTERINE VASCULAR PERFUSION CHANGES DURING EARLY PREGNANCY IN CATTLE ASSESSED BY COLOR DOPPLER ULTRASONOGRAPHY Synopsis Vascular perfusion of the uterus of heifers was studied during early ges tation by transrectal color Doppler ultrasound. Heifers were inseminated and data collected until Day 60 (Day 0 = ovulation) in pregnant heifers or until the second ovulation in nonpregnant heifers. Heifers were retrospectively assigned to pregnant (n = 11 ) or nonpregnant (n = 6) groups after pregnancy diagnosis. Data for Days 0 18 were analyzed comparing pregnant heifers and nonpregnant heifers and for Days 0 60 comparing the uterine horn ipsilateral to the corpus luteum (CL) or conceptus and the opposite horn. Blood flow from endometrium, mesometrium and CL was estimated by subjective scores based on color Doppler signals in real time. Uterine resistance index was measured at the mesometrial arteries. Uterine echotexture and tone were estimated subjectivel y. Plasma estradiol and progesterone were measured on all heifers on Days 0 18. There was an increase ( P >0.001) in endometrial and mesometrial perfusion scores in nonpregnant heifers between Days 14 to 18 that was temporally associated with the preovulato ry rise in estradiol. Plasma P4 decreased sharply between Day 15 and 18 and plasma E2 increased sharply between Day 14 and 17. There was no evidence for a similar increase in endometrial perfusion scores in pregnant heifers at this time. In the pregnant he ifers, increased perfusion scores in the ipsilateral horn were detected between Days 18 and 20, and continued to increase until Day 40. Perfusion scores of the contralateral horn remained low until Day 32, when they began to rise, reaching perfusion scores approximately similar to the ipsilateral horn around Day 40, then slightly declining until Day 60. The increase in vascularity temporally paralleled allantoic sac development inside of each uterine horn. In summary, c olor Doppler

PAGE 159

159 ultrasonography assessme nt of blood flow for detailed evaluation of endometrial and mesometrial perfusion in pregnant cows proved to be a very effective approach. A n increase in uterine vascular perfusion in nonpregnant heifers was temporally associated with decreased P4 concentr ations and increased E2 concentrations. In contrast, increased uterine perfusion scores were detected later, around Day 20, in pregnant heifers only in the horn ipsilateral to the conceptus. The beginning of vascular perfusion increase between ipsilateral and contralateral uterine horns was disynchronous; vascularity in the ipsilateral horn started earlier than in the contralateral horn. In addition, it paralleled the allantoic sac development in each uterine horn. Fold difference in perfusion between ipsil ateral and contralateral uterine horns was much higher at the endometrium than mesometrium suggesting, respectively, elevated angiogenesis:vasodilation and vasodilation:angiogenesis ratios in each of the tissues. Antimesometrial orientation of the embryo p roper before umbilical cord formation and attachment at the mesometrial area, and encroachment of the dorsal endometrium at the embryo proper area is suggested to occur in cows. Results supported the hypothesis that uterine blood perfusion during early pre gnancy is mediated by conceptus presence, development, and its interactions with the endometrium. These findings suggest different pathways of endometrial vascular perfusion stimulation in pregnant and nonpregnant heifers. Introduction Early gestation is a critical time in pregnancy with rapid embryonic differentiation and growth. In cows, the morula or early blastocyst enters in the uterus around Day 5 after fertilization and the embryonic cells organize into an inner cell mass and the trophoectoderm whi ch will give origin respectively to the embryo and conceptus membranes (Betteridge & Flchon 1988). Vascular development and remodeling in both maternal and fetal sides are very

PAGE 160

160 important during early pregnancy, especially, but also throughout gestation. T he well vascularized endometrium around the time of implantation helps provide an adequate uterine environment to support embryo survival and development. During early gestation, embryonic nutrition is completely dependent on histotroph from uterine gland secretions (Amoroso 1952; Hempstock et al. 2004; Burton et al. 2007). The placenta is formed between confluence of the conceptus membranes with the maternal tissues during early gestation. After implantation, development and expansion of the placental vill us vasculature serves to supply the initial fetal demands for nutrients and oxygen ; the materno placental vasculature remodeling will be a continuous process throughout pregnancy paralleling the gradual increase in fetal transport of nutrients, respiratory gases, and wastes during its growth (Reynolds et al. 2006; Torry et al. 2007). Morulae and blastocysts exhibit spherical shape. Using ultrasound assessment, Kastelic et al. (1988) reported that on Day 11, 73% of the embryonic vesicles were still spherical and 23% were oblong in cows. However, by about six days of intrauterine existence around day eleven of pregnancy the cow spherical embryonic vesicle elongates and begins to take the tubular shape of the uterine lumen. By Day 17 in cows, the elongated co nceptus occupies the entire length of the ipsilateral horn and by Day 20 the conceptus extends throughout the lumen of the entire length of the contralateral horn. Detailed studies about early conceptus morphogenesis and early placentation in cows are avai lable (Greenstein et al. 1958; King et al. 1980; 1981; 1982). Intimate contact between trophoblast and uterine epithelium is observed first by the trophoblastic cells near the embryonic disc on Day 19 and one day later by trophoblastic cells near caruncula r regions. By Day 20, the allantoic sac begins to develop, vitelline vessels form a rich plexus, and the primitive embryonic heart appears. Microvillous indentations are also observed in the apical

PAGE 161

161 border of the trophoblast cells in apparent response to ma ternal cell interactions. Around Days 23 to 25, polynucleate cells are observed and the allantois continues to expand rapidly, becoming increasingly vascularized. By Day 24, almost all caruncles present microvillous interditations. Placentation is not a un iform process, it begins in the immediate vicinity of the embryo and spread towards each end of the conceptus; characterized by adhesion and interdigitation of microvilli between maternal epithelium and trophoblast cells. Expansion of the allantois is dram atic between Days 28 and 30. At this time, the allantois fuses with the trophectoderm, originating the chorion. Between Days 31 and 33, the primary chorionic villi with vascularized mesenchymal cores are observed. They are found as rounded pink patches and represent the future fetal cotyledons. These morphological descriptive works demonstrated that physical cellular interactions between the endometrium and conceptus begin early in pregnancy, around Day 20. Caruncular areas with early interdigitation are ob served around Day 25. Primordial placentomes with microvilli, a tenuous attachment of maternal and fetal epithelia, and a primitive vascular system appear around Day 32 (King et al. 1979; Schlafer et al. 2000). Ruminants present a cotyledonary placenta and based on the morphology and number of tissues separating maternal from fetal blood, the bovine placenta is classified as synepitheliochorial (Amoroso 1952). All cell layers are present (epithelium, stroma, and endothelium in both maternal and fetal sides ). The trophoblast cells are in direct apposition to the surface epithelial cells of the uterus and the fetal villi (cotyledon) and the caruncle together form the placental units known as placentomes. After the first month of pregnancy, placentation contin ues with the caruncles inducing villous hypertrophy and hyperplasia to form the cotyledons, which become larger and more complex placentomes around Day 40 (King et al. 1979; Schlafer et al. 2000).

PAGE 162

162 The extent of local perfusion or blood flow area within the tissues can be estimated using the color flow mode and can be quantified directly at the level of the tissue by estimation of the percent of a given tissue exhibiting colored pixels. An important advantage of this technique is that the structure can be ev aluated in real time while the area is being scanned systematically (Ginther 2008). Blood flow to the pregnant uterus, assessed by electromagnetic flow probe, has been shown to be increased in the uterine artery ipsilateral to the embryo proper on Days 14 18 and after Day 25 in heifers (Ford et al. 1979) and in uterine arteries of pregnant sows on Days 12 13 (Ford & Christenson 1979). A brief review of the earliest studies on uterine blood flow changes is provided by Ford (1985). Blood flow chang es at the uterine artery (upstream of the uterus) have been studied by Doppler ultrasonography in cows during pregnancy (Bollwein et al. 2002). This study characterized blood flow changes monthly during pregnancy. The resistance index (RI) was lower and ti me averaged maximum velocity (TAMV) and blood flow volume higher in the artery ipsilateral to the conceptus. Throughout pregnancy, RI values decreased and TAMV and blood flow volume increased. Increased TAMV represented greater blood flow in the arteries and a decrease in RI represented reduced resistance to blood flow in the vasculature distal to the site of assessment. More detailed s tudies of blood perfusion changes at endometrial and mesometrial levels using color Doppler ultrasonography to subjectivel y assess blood flow have been done during early pregnancy of mares (Silva et al. 2005; Silva & Ginther 2006; Ginther & Silva 2006). The authors found that transient changes in endometrial vascular perfusion accompany the embryonic vesicle as the vesicle ch anges location during embryo mobility. On Day 13, the continued presence of the vesicle in the same horn for an average of 7 min stimulated an increase in vascularity of the endometrium of the middle segment of the horn.

PAGE 163

163 After fixation, endometrial vascula rity was progressively higher in the following sequence: horn without the vesicle, horn with the vesicle, and area of endometrium surrounding the fixed vesicle. Recently, uterine blood flow from cyclic and pregnant cows during the three first weeks of preg nancy was examined (Honnens et al. 2008). The authors found higher TAMV at the uterine arteries in cyclic cows on Day 18 than in pregnant cows. Also, estrogen and progesterone were correlated with TAMV changes. Vascular stimulants may be produced and rele ased into the uterus by the conceptus during early pregnancy. It has been shown that estrogens stimulate blood flow increase in the uterine arte ries of sow, cow, and ewe (Ford 1982). In addition, production of estrogens by early embryos of swine, bovine, a nd equine have been reported (Ford et al. 1982b; Shemesh et al. 1979; Chenault 1980; Zavy et al. 1979; Raeside et al. 2004). Prostaglandins are also produced by early embryos and have been suggested as another possible stimulator of the uterine blood flow (Lewis 1989). The mechanisms involved in stimulation and control of endometrial angiogenesis have also been the focus on intense research (Bourlev et al. 2006; Girling & Rogers 2005; Herv et al. 2006). The purpose of the present study was to test the hypo thesis that vascular perfusion changes in the endometrium and mesometrium are mediated by conceptus presence and development, and occur at equivalent time points of pregnancy as reported in mares (Silva et al. 2005; Silva & Ginther 2006). Comparisons of ut erine vascularity between pregnant and nonpregnant heifers were done on Days 0 18 after ovulation. In addition, comparisons between the ipsilateral and contralateral uterine horns of pregnant heifers were done on Days 0 60 of pregnancy. The general objecti ve was to provide a detailed and comprehensive description of uterine, embryonic, and fetal vascular changes during the two first months of pregnancy in cattle.

PAGE 164

164 Materials and Methods Animals Animals were handled in accordance with the Guide for Care and Use of Animals in Agricultural Research. Fourteen Holstein heifers, aged 17 to 20 months were used. Body condition for each heifer was around 3.0 throughout the experiment (range from 1 5; Lowman et al. 1976). Heifers were selected with docile temperament from a commercial dairy herd and no apparent abnormalities of the reproductive tract, as determined by ultrasound examinations (Ginther 1998 b ). All heifers were acclimated to the handling procedures for a minimum of two weeks prior to experimentation and t hey had free access to grass hay, water, and trace mineralized salt. Heifers were scanned daily by ultrasound during the acclimation period and the size of the largest follicle was monitored. After acclimation, estrus detection was performed by visual insp ection of the herd for approximately one hour twice daily, early in the morning and late in the evening. Heifers exhibinting estrus behavior were artificially inseminated 12 hours later, using proven fertile Holstein bull frozen semen. Estrous behavior was characterized by standing to be ridden. Also, records of presence of a follicle equal or larger than 8 mm in diameter, nervous and restless behavior, moist, red, and slightly swollen vulva, and clear mucous discharge were evaluated as additional informati on to estrus characterization Ultrasonography A duplex B mode (gray scale) and pulsed wave color Doppler ultrasound instrument (Aloka SSD 3500; Aloka America, Wallingford, CT) was used for transrectal scanning. Vascular perfusion of the endometrium and mesometrium were evaluated, using the color Doppler flow mode function and a 7.5 MHz linear array transducer (UST 5821 7.5) with a beam field width of

PAGE 165

165 60 mm. In color Doppler mode, the extent and direction of blood flow in the vessels are indicated by col or signals (red or blue with its degrees of brightness; Ginther 2007) and was used to display signals for blood flow in vessels of the uterus. All color Doppler scans were performed at a constant gain and filter settings, and constant velocity range (relat ive to pulse repetition frequency PRF) of 10 cm/sec. Real time B mode/color Doppler images of the continuous scans were captured with an online digital video taping system and stored for potential validation and confirmation purposes. The transducer was placed over a cross section of the middle segment of each uterine horn ( Figure 7 1). The vascularity or vascular perfusion was estimated subjectively by scoring the extent of colored areas in the endometrium and mesometrium during real time cross sectionin g of each horn during a continuous span of 1 min; because of animal and uterine movements, multiple cross sections were viewed. Only the colored areas that appeared to be within the endometrium or within in the mesometrium were considered ( Figure 7 1). Sig nals for blood flow were estimated from the blood flow color displays of the real time sequential two dimensional planes of area, as described for mares (Silva et al. 2005). The scores ranged from 1 4, indicting no, minimal, intermediate, and maximal invol vement. The 1 min scan was recorded on digital videocassettes (MiniDV). Similar color Doppler scanning was done from the corpus luteum (CL). Percentage of CL with color Doppler signals for blood flow was estimated from the blood flow color displays of the real time sequential two dimensional planes of the entire CL, as described (Acosta et al. 2003). The color flow signals at the periphery of the CL and within the CL were included in the percentage estimate. Also, the area (cm 2 ) of a cross section of the CL for each examination was determined in B mode from maximum area averaged from two

PAGE 166

166 Vascular perfusion of the endometrium was assessed objectively by off line measurement of the total number of colored pi xels, total pixel intensity, and average of pixel intensity as indicator of blood flow. Three still images from cross sections of the middle segment of each horn were used for determination of the pixel related end points, and the average was used in the a nalyses. The images were captured from the videocassettes using Adobe Premiere Pro 2.0 software (TIFF format; Adobe Systems, San Jose, CA). Colored spots or pixel aggregates were selected from the images (endometrial and mesometrial areas), extracted, and saved (TIFF format) using Adobe Photoshop CS2 software (Adobe Systems, San Jose, CA). ImageJ 1.40g software (National Institutes of Health, USA) was used for calculation of the total number of colored pixels, total pixel intensity, and average of pixel int ensity for each TIFF format image. In addition to color Doppler evaluation of the uterus, spectral Doppler scans were made of the arteries at the mesometrial attachment. These vessels were outside of the uterine horn but within the mesometrial area ( Figure 7 9a; ultrasonogram on Day 22). For spectral Doppler scans, the velocity range setting and the size of the spectral gate were variable during each scan and adjusted to obtain a good spectral Doppler graph. A good spectral graph can be defined as a sequenc e of symmetrical cardiac cycles in which the size permits an easy identification of the systolic and diastolic peak and end, and absence of aliasing. Aliasing is a Doppler artifact generated when the blood flow velocity is higher than the velocity of the u ltrasound beams. Technical explanation and examples are provided by Ginther (2008). Settings of gain and filters were kept the same for all scanning. Spectral waveforms were generated three times for three cardiac cycles by placement of the spectral Dopple r gate over the most intensely colored area in the color flow/B mode image. One cardiac cycle was arbitrarily chosen from each of the three scans and the average was used for measurement of resistance index (RI), using preset functions

PAGE 167

167 in the ultrasound sc anner. Decreased RI values indicate increased vascular perfusion of tissues distal to the point of examination of the artery. In addition to the spectral measurements at the mesometrial arteries, heart rate of the embryo or fetus was measured by placement of the spectral Doppler gate over the heart starting on day of first visualization of heart beats by color Doppler mode in all embryos until Day 60 of pregnancy. Preset function in the ultrasound scanner was used for automatic calculations of the heart rat e using the acquired cardiac cycle spectrum. Uterine echotexture was evaluated in B mode by scanning the entire uterus where the pattern of the endometrial morphology, defined by the presence of defined endometrial folds and anechoic areas inside of the fo lds, was subjectively scored as described (1 = no edema or diestrus like; to 4 = maximal edema or estrus like; Ginther 1998 b ). In addition to the ultrasound related measurements, uterine tone was the last end point to be evaluated during data collection by delicate transrectal digital compression of both uterine horns and scored subjectively as described (1 = minimal or diestrus like; 2 = intermediate; 3 = maximal or estrus like; Ginther 1998 b ). Experiment Fourteen heifers were artificially inseminated and examined daily beginning between Hours 0700 1200 with the duplex B mode/color mode scanner from Day 0 (Day of ovulation) until Day 60 if pregnancy was confirmed, or until the next ovulation in nonpregnant heifers. Examination procedures were done every ot her day from Days 0 8, and daily from Days 9 30 in pregnant heifers or until the day of ovulation in nonpregnant heifers. For the pregnant group, examination procedures were continued every other day from Days 30 60. After Day 60, exams were done with rand omly daily intervals until Day 90 with the objective of collection of pregnancy images. The sequence of data collection was: 1 min scanning of each uterine horn for

PAGE 168

168 vascularity evaluation in color Doppler mode, followed by acquisition of the spectral graph for resistance index (RI) calculation, and uterine echotexture evaluation in B mode, and finally digital evaluation of the uterine tone. The rationale for this described sequence was to avoid or minimize any kind of external interference in the physiologi cal patterns of blood flow during data collection. Data analyses were divided into Days 0 18 for data comparisons between pregnant and nonpregnant heifers and Days 0 60 for data comparisons between uterine horns that were ipsilateral and contralateral to the corpus luteum (or to the embryo or fetus) in the pregnant heifer group. Pregnancy diagnosis was done between Days 20 and 25 for heifers that had not presented a second ovulation in the experimental period. Nonpregnant heifers were examined daily after the second ovulation and artificially inseminated before the third ovulation, as previously described in this paper. Retrospectively, groups were assigned and data comparisons on Days 0 18 were then made among uterine horns (ipsilateral and contralateral) from heifers in which a second ovulation occurred (n = 6) and heifers in which the conceptus was detected by Days 20 25 (n = 11). In the pregnant group (n = 11), comparisons were made from Days 0 60 between uterine horns. Blood Samples and Hormone Assays Progesterone and estradiol concentrations were determined from Days 0 18 in all heifers. Blood samples were collected into heparinized tubes and centrifuged (2000 x g for 10 min), and plasma was decanted and stored ( 20 C) until assay. Plasma progesterone concentrations were measured using a solid phase radioimmunoassay kit containing antibody coated tubes and 125 I labeled progesterone (Coat A Count Progesterone, Diagnostic Products Corporation, Los Angeles, CA). The procedure has been described in detail for mare plasma in our laboratory

PAGE 169

169 (Ginther et al. 2005 a ) and was validated for assaying plasma concentrations of progesterone in bovine plasma. Serial volumes of a pool of diestrus bovine plasma (50 300 l) were processed as for experimental samples and re sulted in a displacement curve that was similar to the standard curve. The intraassay CV and sensitivity were 3.04% and 0.03 ng/ml, respectively. Plasma concentrations of estradiol were determined using modifications of a commercially available radioimmun oassay kit (Second Antibody Estradiol; Diagnostic Products Corp., Los Angeles, CA), which has been validated for use in cattle (Bergfelt et al. 2000). Details of the methodology as used in this laboratory have been reported elsewhere (Kulick et al. 1999). The intraassay CV and sensitivity were 6.2% and 0.09 p g/ml, respectively. Statistical Analyses Parametric data were examined for normality with the Kolmogorov Smirnov test. When the normality test was significant (P < 0.05), data were transformed to natu ral logarithms. Individual end points were analyzed for time effects (day), and comparisons involving groups were analyzed for main effects (group, time) and the interaction. The mixed procedure of SAS (version 9.2; SAS Institute, Inc) was used with a repe ated statement to account for autocorrelation between sequential measurements. The scores for Doppler vascularity, uterine echotexture, and uterine tone were considered as nonparametric data and were analyzed by the potential differences in the Glimmix pro cedure of SAS (version 9.2; SAS Institute Inc., Cary, NC) to determine the main effects and the interaction. A histogram of the data was made to observe the best distribution presented by the subjective scores. The inverse Gaussian distribution was selecte d as the best fit and used in Glimmix. Paired and unpaired Student t tests were used to locate differences between times within an end point and among groups within a

PAGE 170

170 time, respectively, when an effect of time or an interaction was obtained. A probability of P 0.05 indicated that a difference was significant and a probability between P > 0.05 and P indicated that significance was approached. Data are presented as the mean S.E.M. Results Representative still frames of differential vascularity sco res are presented in Figure 7 1. The ultrasonograms on the top refer to the ipsilateral uterine horn to the conceptus (A) and the contralateral uterine horn (B) from the same pregnant heifer on Day 25. Intense endometrial vascularity is observed in the ips ilateral horn and is completely absent in the endometrium of the contralateral horn. In addition, by visual inspection of the presented ultrasonograms, the mesometrial area at the ipsilateral horn presents higher vascularity compared with the contralateral horn. It is important to be aware that subjective vascularity scores are given after 1 min scan (real time) instead of a simple view of still frames as presented. The ultrasonogram C shows one of the uterine horns from a cyclic heifer one day before ovula tion for comparison. Intense uterine edema characterized by elevated ultrasonic echotexture pattern formed by the anechoic areas in the endometrial folds is observed. Vascularity of the endometrium decreases one day before ovulation. However, vascularity o f the mesometrial area and endometrial echotexture is still high. Initial analyses for the period of Days 0 18 considering the reproductive status (pregnant and nonpregnant), uterine horns (ipsilateral and contralateral), and days as fixed variables were performed. Effect of uterine horn and all possible combinations of interactions of effects with the variable horn were not significant ( P points studied. Based on these results,

PAGE 171

171 daily individual data from both uterine horns were averaged and new statistical analyses were performed considering only the reproductive status and day as fixed variables. The endometrial and me sometrial vascularity scores and vascular resistance index at the mesometrial area on Days 0 18 are shown ( Figure 7 2). On Days 0 18, there were significant differences in endometrial vascularity. Effects of reproductive status, day, and interaction of rep roductive status by day were detected ( P = 0.0058, P = 0.0002, and P = 0.0001, respectively). Endometrial vascularity starts to increase on Day 14 on cyclic heifers and is higher than in pregnant heifers on Day 16 ( P = 0.0244). At the mesometrium, an effec t of interaction of reproductive status by day was detected ( P = 0.0001). Similar vascular changes found at the endometrium were observed at the mesometrium. The vascular resistance index (RI) increased slightly on Days 0 18 and only the effect of day was significant ( P = 0.0073). The uterine echotexture and tone on Days 0 18 in pregnant and cyclic heifers are shown in Figure 7 3. Effects of pregnancy status and day were not significant ( P the interaction between pregnancy status by day was significant for uterine echotexture and tone ( P = 0.0495, and P = 0.0424, respectively). A dramatic decrease in uterine echotexture and tone was observed immediately after ovulation Uterine echotexture remained low in pregnant and cyclic heifers until Day 15 when a rampant increase was observed in the cyclic heifers. A slight increase in uterine tone was observed after Day 4 in both pregnant and cyclic heifers and a plateau was reac hed on Day 8 similarly in pregnant and cyclic animals but increased in cyclic animals after Day 14. Blood concentrations of estradiol and progesterone on Days 0 18 are presented in Figure 7 4. Effects of reproductive status, day, and the reproductive stat us by day interaction were detected ( P = 0.0153, P = 0.0001, and P = 0.0001, respectively). Estradiol concentrations were

PAGE 172

172 low and similar in pregnant and cyclic heifers until Days 14 when a rapid increase in this hormone was observed in cyclic heifers. Pro gesterone was low, but detectable on Day 0 in both pregnant and cyclic heifers and progressively increased daily in both groups until Day 12 when the concentrations were maintained at high concentrations in pregnant heifers and began to decrease after Day 15 in cyclic heifers. Effects of reproductive status, day, and reproductive status by day interaction were detected ( P = 0.0151, P = 0.0001, and P = 0.0001, respectively). The percentage of the area of the corpus luteum occupied with blood flow and the t otal area of the corpus luteum on Days 0 18 are presented in Figure 7 5. Effect of day and the pregnancy status by day interaction were significant for both end points ( P = 0.0001 and P = 0.0001 for % area with blood flow, and P = 0.0001 and P = 0.0016 for corpus luteum area). A progressive increase in both end points was observed after Day 0, reaching a plateau which decreased abruptly only in cyclic heifers, on Day 15 for blood flow and on Day 14 for area. In pregnant heifers, data from both uterine horn s (ipsilateral and contralateral to the embryo or fetus) were compared on Days 0 60. In Figure 7 6, endometrial and mesometrial vascularity scores and vascular resistance index assessed at the mesometrial arteries are shown. Effects of uterine horn side, d ay, and the horn by day interaction were highly significant for endometrial and mesometrial vascularity scores ( P = 0.0001 for all effects in both end points). Patterns of vascular changes were similar in the endometrium and mesometrium. Vascularity of the uterine horn ipsilateral to the embryo started to increase on Day 18 reaching a plateau around Day 36. The increase in vascular perfusion coincided with the beginning of the allantoic sac development at the ipsilateral horn. In the contralateral uterine h orn, vascular perfusion started to increase on Day 32 reaching maximal values which were to values in the ipsilateral horn on Day 42. Likely, vascular perfusion of the contralateral horn started to increase when the allantoic sac

PAGE 173

173 started its development in this horn, similar to changes seen in the ipsilateral horn. Key features related to the placentation process in cows are chronologically indicated on the bottom of Figure 7 6. For vascular resistance index, effects of day and the interaction between horn and day were significant ( P = 0.0001 and P = 0.0007, respectively). A slight decrease in vascular resistance was observed in both uterine horns temporally associated with the increase of the vascular perfusion in each uterine horn. Objective assessment of uterine vascularity is presented in Table 1 for validation of the subjective vascularity scores. For endometrium, the vascularity scores, total number of colored pixels, total pixel intensity, and mean pixel intensity were higher ( P < 0.05) in the uterine horn containing the embryo than in the opposite horn on Day 25 of pregnancy. At the mesometrium, the vascularity scores, total number of colored pixels, and total pixel intensity were higher ( P < 0.05) in the uterine horn containing the embryo than in the opposite horn, but the mean pixel intensity did not differ between uterine horns ( P of ipsilateral:contralateral horns are presented for all end points. Uterine echotexture and tone (top) and the percentage of corpus luteum area with blood flow and its total area (bottom) are shown on Figure 7 7. Effect of day was hi ghly significant ( P = 0.0001) for all four end points. A rapid decrease in uterine echotexture and tone was observed right after ovulation (Days 0 4). After Day 4, echotexture stabilized in a plateau and started progressively to decrease between Days 20 50 For uterine tonus, after the decrease until Day 4 the tonus slightly increased with observed oscillations and assumed a constant plateau after Day 32. The percentage of corpus luteum area with blood flow and its total area increased from Day 0 to around Day10 and was maintained in a constant plateau until Day 60 ( P = 0.0001).

PAGE 174

174 Embryonic and fetal heart rates on Days 24 60 are presented in Figure 7 8. A significant day effect was detected ( P = 0.0001). The heart rate increased logarithmically on Days 24 40 and stabilized at a constant rate of around 180 beats per minute by Day 60. The earliest detection of heart beats visualized by color Doppler was on Day 21 in one heifer (1/11; average = 23.5 0.4 days). For the embryo proper, the first day of detection was on Day 20 in seven heifers (7/11; average = 20.6 0.3 days). A short collection of Doppler ultrasonograms during the first three months of pregnancy is presented on Figure s 7 9a and 7 9b. Examples of color power and spectral mode and its combinat ions are shown. Age of pregnancy is indicated on the right bottom of each ultrasonogram and represents days after ovulation (Day 0 = ovulation). Extra key features on the images are also indicated by arrows and a legend is presented. Embryonic and fetal s tages were split apart ( Figure 7 9a and Figure 7 9b, respectively). Discussion Color Doppler ultrasonography assessment of blood flow for detailed evaluation of endometrial and mesometrial perfusion in pregnant cows proved to be a very effective approach. Differences in number and intensity of colored spots were easily observed even in still frames, or static images, as can be seen in Figure 7 1. The still frames shown were selected at a time point of strong vascular perfusion discrepancies between uterine horns to better illustrate the distinct pattern of perfusion that can occur. One minute real time scanning is recommended for this kind of evaluation because it provides a better dynamic idea of the blood flow patterns to the ultrasound operator (Ginther & Utt 2004, Ginther 2008). Many studies using subjective evaluation of blood flow perfusion have shown that this approach is reliable and consistent with the observed physiological changes in uterus of mares (Silva et al. 2005; Silva & Ginther 2006,

PAGE 175

175 Ginthe r & Silva 2006), corpus luteum of mares (Ginther et al. 2007 a, b ) and cows (Ginther et al. 2007 c ), preovulatory follicle of mares (Silva et al. 2006) and cows (Siddiqui et al. 2008). The results obtained using subjective scores were similar to the pixel an alysis indicating accuracy and reliability of using the subjective methodology. At the endometrium, all objective end points were different between horns as with results for subjective scores. At the mesometrium, the total number of colored pixels and the total intensity of the pixels were different between horns. However, the mean intensity of the colored pixels was not different. Intensity is represented by the degree of brightness of red or blue in the color Doppler image and codifies blood velocities. I t is calculated multiplying each colored pixel by its level of brightness of the machine brightness range (normally from 0 to 256). The colors red and blue indicate the direction of the flow in relation to the ultrasound beams direction or to the probe (Gi nther 2008). At the endometrium, the larger area occupied by colored spots and the higher average velocity based on pixel intensity analysis, indicated that the blood perfusion was higher in the uterine horn containing the conceptus than in the opposite ho rn. At the mesometrium, the area occupied by colored spots was similar to the endometrium, indicating higher blood perfusion in the uterine horn containing the conceptus than in the opposite horn. However, the average pixel intensity was similar between ut erine horns at the mesometrium. In other words, the amount of blood was different but the average of the blood flow velocities was similar between horns at the mesometrium. At the endometrium, the area with colored spots was 18 fold larger in the horn cont aining the conceptus than in the contralateral horn. In addition, the total intensity of the colored pixels was 16 fold larger and the average pixel intensity 50% higher in the ipsilateral horn. These findings suggest that different degrees of angiogenesis and vasodilation may be responsible for the observed vascular changes at the endometrium and mesometrium of heifers

PAGE 176

176 on Day 25 of pregnancy. These large differences likely indicate an increased number of capillary branches at the endometrium of the ipsilat eral uterine horn, more a result of angiogenesis than vasodilation. In the other hand, at the mesometrium the colored pixel area and the total intensity of pixels were 2 fold larger in the horn containing the conceptus than in the contralateral horn, but t he average pixel intensity did not differ. These findings may indicate a more intense vasodilation process than angiogenesis at the mesometrium area. Both, angiogenesis and vasodilation may be present at the two areas but the ratio of angiogenesis/vasodila tion is suggested to be higher at the endometrium than at the mesometrium during the early pregnancy in cows. A more detailed study looking at these end points in the endometrium and mesometrium on different days of pregnancy associated with detailed histo morphology of the uterine tissues is necessary to achieve the final conclusions suggested by this preliminary study. Systemic variations in estradiol and progesterone concentration and the effects on uterine vascular changes during the estrous cycle of dom estic animals have been studied and blood flow increase has been correlated with a high estrogen:progesterone ratio (Ford 1982). However, the increase in uterine blood flow during early pregnancy in cows was not correlated with the systemic increase in est radiol levels suggesting local control of uterine blood flow by the conceptus (Ford et al. 1979). Variations in time average maximum velocities (TAMV), measured by spectral Doppler ultrasonography during the three first weeks after ovulation of dairy cows, were correlated with estrogen and progesterone concentrations in cycling cows, but not in pregnant cows (Bollwein et al. 2000; Honnes et al. 2008). Our results confirmed these findings. In nonpregnant heifers, both endometrium and mesometrium exhibited in creased blood flow starting at the time of luteolysis, around Day 14, which was correlated with rising estradiol and decreasing progesterone. These events were also correlated with the daily and progressive

PAGE 177

177 decrease in corpus luteum (CL) size and, with one day of delay, the abrupt decrease in CL blood flow that reached very low levels in a two day time frame. The systemic blood levels of progesterone decreased similar to the decrease in CL blood flow starting on Day 15 and estradiol started to rise one day before, on Day 14, progressively increasing during the experimental period or until Day 18. Pregnant heifers exhibited constant high progesterone levels, low detectable levels of estradiol, and no reduction in corpus luteum size and elevated blood flow as would be expected. In addition, no uterine blood flow changes were detected until Day 18 either at the endometrium or mesometrium. In pregnant heifers, the area of corpus luteum occupied by blood vessels, e.g. vascularity, increased parallel to the increas e in size of the corpus luteum, and the highest values, attained after the first ten days of pregnancy, were maintained until the end of this experiment. These first ten days corresponded to the time of corpus luteum formation and development. Our results strongly supported the hypothesis that vascular perfusion changes in the endometrium and mesometrium during early pregnancy in cows occur locally and are mediated by conceptus presence and development. Vascularity of the horn ipsilateral to the embryo was higher than in the opposite horn throughout Days 20 40. Blood flow increased in the uterine artery ipsilateral but not contralateral to the conceptus between Days 13 and 15 in sheep (Reynolds et al. 1984) and Days 15 and 17 in cattle (Ford et al. 1979). D uring the first three weeks of pregnancy in dairy cows, TAMV was higher and pulsatility index (PI) lower in the uterine arteries of pregnant cows than in cycling cows on Day 18 indicating decreased uterine vascular resistance in pregnant cows (Honnens et a l. 2008). However, no differences were detected between the reproductive statuses during any previous or post scanning days (Honnens et al. 2008). The authors reported great variability in the measurements among animals from the

PAGE 178

178 same experimental group whi ch could be the cause of the detected difference on Day 18. Bollwein et al. (2002) studied uterine blood at the uterine arteries of pregnant cows once monthly and they found a difference between uterine horns in resistance index (RI) only in the second mon th and in TAMV in the 5 th 7 th months of pregnancy. The results obtained by the assessment of blood flow at the uterine arteries may be not sensitive enough to obtain blood flow changes as is color Doppler assessment of blood flow perfusion directed at the tissues of interest. In the study done by Ford et al. (1979), the authors used a small number of animals and the individual measurements exhibited high variability. In addition, the positioning of the electromagnetic Doppler probe around the uterine arteri es could account for variability of the measurements. Vascular perfusion changes in the uterus and its relationship with the conceptus have been studied in many species. In our previous works in pregnant mares (Silva et al. 2005; Silva & Ginther 2006), we found that transient changes in endometrial vascular perfusion accompany the embryonic vesicle as the vesicle changes location during embryo mobility (Days 11 16). In addition, after embryonic vesicle fixation (Day 16), endometrial vascularity and the numb er of colored endometrial pixels were progressively higher in the following sequence: horn without the vesicle, horn with the vesicle, and endometrium adjacent to the fixed vesicle. Swine have embryos in both horns and blood flow transiently increases in b oth uterine arteries 12 and 13 days after insemination, but when embryos are experimentally confined to one horn, the blood flow increases only on that side (Ford & Christenson 1979); furthermore, blood flow to uterine segments containing a conceptus is gr eater than for segments that do not contain a conceptus (Ford et al. 1982). In this present study, the scores in the embryo containing horn increased between Days 20 and 36. The vascularity of the ipsilateral horn started to increase at the time

PAGE 179

179 when the a llantoic sac developed and filled with fluid. A chronological pattern of allantoic sac development similar to that observed in this study was described by Kastelic et al. (1988) using B mode ultrasonography. In the present study, vascularity increased thro ughout Days 32 40 in the uterine horn contralateral to the conceptus. Similar to the changes in the ipsilateral horn, the increase in vascularity of the opposite horn paralleled the timing of allantoic sac development inside of the horn. The relationship b etween allantoic sac development and the local increase in vascularity may be explained by two possible mechanisms. First, intense vasculogenesis and angiogenesis are present in the developing embryo and the allantoic fluid may facilitate dispersion of the angiogenic factors produced by the developing embryonic vascular system producing the observed uterine vascular changes. Second, as the allantoic sac develops, the allantoic membrane fuses with the trophoectoderm forming the chorion and the placental vess els start to develop (King et al. 1979; 1980). Angiogenic factors could be produced by the chorionic cells to stimulate placental angiogenesis and, by diffusion, stimulate the uterine vascular changes. The two proposed mechanisms could be present at the sa me time to cause the observed uterine vascular changes. Vascular development and remodeling in both maternal and fetal sides are essential for implantation and placentation throughout pregnancy until term. A vascularized endometrium is necessary before and at the time of implantation to provide an appropriate uterine environment to support embryo survival and development. After implantation, development and expansion of the placental villus vasculature serves to supply the initial fetal demands for nutrient s and oxygen. During pregnancy until term, materno placental vasculature remodeling is a continuous process related to the gradual increase in fetal transport of nutrients, respiratory gases, and waste during its growth (Reynolds et al. 2006; Torry et al. 2007). Use of an angiogenic inhibitor before

PAGE 180

180 or right after implantation in mice resulted in resorption of all embryos (Klauber et al. 1997), and supported the hypothesis that angiogenesis is a critical component of normal implantation/placentation in earl y stages of preg nancy. The mechanisms involved in the early local stimulation of uterine vascularity by the conceptus have not been clarified. One consideration is that the early conceptus alters endometrial vascularity by the production of vascular stimul ants. In this regard, estrogens stimulate increased uterine blood flow in the sow, cow, and ewe (Ford 1982a). In vitro studies have shown that Day 12 porcine embryos (Ford et al. 1982b) and Day 16 bovine embryos (Shemesh et al. 1979; Chenault, 1980) produc e estrogens. Marked in vitro production of estrogen by the equine conceptus occurs as early as Day 12 (Zavy et al. 1979; Raeside et al. 2004). The blastocysts of many species also secrete a variety of prostaglandins, and it has been proposed that conceptus prostaglandins stimulate increases in uterine blood flow (Lewis 1989). Furthermore, physical stimulation unrelated to direct production of a vasoactive substance by the conceptus cannot be ruled out. During tissue remodeling, vascular development is orche strated by stimulatory and inhibitory signals. An inadequate vascular supply creates hypoxia and limits tissue growth. On the other hand, hypoxia is the physiological signal to stimulate angiogenesis during growth. Hypoxia inducible factor (HIF 1) is produ ced by tissues in hypoxia states and stimulates transcription of angiogenic factors (Werner, 1997; Zygmunt et al. 2003). The nature of the signals that are responsible for induction and control of endometrial angiogenesis has been the focus of many studies (Bourlev et al. 2006; Girling & Rogers 2005; Herv et al. 2006). Estrogen is recognized as one of the driving forces for increased uterine blood flow through both rapid and delayed actions, via binding to its receptors in the uterine artery wall, and espe cially at the uterine artery endothelium (Albrecht et al. 2003; Heryanto &

PAGE 181

181 Rogers, 2002; Mendelsohn, 2002). There are many critical growth factors involved in the physiological regulation of blood vessel formation and maintenance, and the actions of these molecular players must be very carefully orchestrated in terms of time, space and dose so as to form a functioning vascular network (Jain 2003; Yancopoulos et al. 2000; Risau 1997; Zygmunt et al. 2003). The crucial factors regulating angiogenesis and vascu logenesis belong to the endothelial growth factor family. The most important are VEGF A and its receptors VEGFR 1, VEGFR 2, and VEGFR 3 (Roy et al. 2006; Ferrara et al. 2003; Ferrara 2004; Yancopoulos et al. 2000). The growth factor family of angiopoietins and ephrins are important to vessel maturation, stabilization, and remodeling (Rowe et al. 2003; Yancopoulos et al. 2000; Wulff et al. 2000). Nitric oxide is another factor involved in tissue vascularization by stimulus of vessel dilatation and permeabili ty, and decreasing tone (Magness et al. 1997 Kroll & Waltenberger 1999 ). Any or all of these above angiogenic factors could play a role in the changes observed in this study, and further work is underway to better define their roles. Uterine echotexture d ecreased to basal levels during the first 4 days after ovulation in both pregnant and nonpregnant heifers and increased progressively one day after the beginning of the estradiol rise in nonpregnant heifers. This initial accentuated drop could be correlate d to the low systemic levels of estrogen and progesterone (Ginther et al. 1996; Ginther 1998 b ). The changes in uterine ultrasonic characteristics during the estrous cycle of cows have been described and it is suggested as a biological indicator of the syst emic estrogen progesterone ratio (Ginther 1993). The uterine tone decreased similarly to uterine echotexture until Day 4. However, a slight increase in uterine tone occurred after Day 4, reaching a plateau on Day 8 in both pregnant and nonpregnant heifers. This increase in uterine tone could be an effect of the transition of a period of non uterine exposure to steroids right after ovulation followed by a period of slight estradiol

PAGE 182

182 level variations due to secondary waves of follicular growth and, more import ant, to the increase in systemic levels of progesterone during corpus luteum formation and development. Increased uterine echotexture and edema is caused by translocation of fluids from blood to the interstitial area, as a transudate. Uterine microvascular permeability increases after treatment with estrogen (Hechter et al. 1941) and VEGF was first identified as a vascular permeability factor (Senger et al. 1993). Estrogen and VEGF actions are linked and it have been demonstrated that inhibition of the VEGF action system blocks estrogen induced uterine edema (Rabbani & Rogers 2001; Rockwell et al. 2002). In pregnant heifers, after the first week of pregnancy, uterine echotexture maintained in a plateau until Day 22, approximately the day of beginning of alla ntoic sac formation and vascularity increase in the ipsilateral horn. After Day 22, the uterine echotexture started a constant and slight decrease reaching the lowest values during the three last days of this experiment. The uterine tone increased slightly after the first week of pregnancy and presented many daily oscillations until Day 30 when it reached a plateau until the end of the experiment (Day 60). The first report on embryonic and early stage fetal heart rate in cattle used B and M modes from vid eotaped scanning to estimate the heart beats (Ginther 1998 b ). The earliest detection of heart beats was done on Day 23 of pregnancy. Heart rate ranged from an average of 135 bpm to 185 bpm from Days 23 60 (Ginther 1998 b ). Our results were similar. However, the spectral Doppler assessment permits the operator to get the heart rate estimations easily by automatic calculation preset in the ultrasound machine. During the first 40 days of pregnancy, embryonic heart rate increased from around 125 bpm to 180 bpm i n a logarithmic faction. After Day 40, fetal heart rate remained constant until Day 60. Our earliest detection of embryonic heart rate was on Day 21 of pregnancy. We were not able to distinguish whether blood is flowing into

PAGE 183

183 the heart at the early fetal st ages. Color Doppler ultrasonography image formation is based on movement and without doubt this methodology is reliable to detect the cardiac muscle contractions starting on the third week of pregnancy. The fact that the heart rate stabilized in a plateau after Day 40 is temporally associated with timing of synepitheliochorial placenta development (King et al. 1979; 1980), and a stabilized continuous blood flow may be important for the beginning of the maternal placental exchanges. In the embryonic stage p age, shown in Figure 7 9a, on Day 20 the embryo proper was identified (arrow) and the visualized membrane (thin white line) suggests the beginning of the allantoic sac formation. On Day 21 the heart beats were detected. The first spectral graph image shows the assessment of blood flow at the mesometrial area on Day 21. The Doppler cursor was placed on a prominent colored spot at this area. Real velocities were not able to be measured due to the impossibility of precisely measuring the Doppler insonation ang le in the convoluted branches of the uterine artery at this area. However, Doppler indexes, as RI and PI, are independent of the insonation angle and are good indications of the vascular bed resistance downstream to the point of measurement. Spectral Doppl er graphs from the mesometrial attachment vessels can be collected during the entire estrous cycle and pregnancy. Power Doppler mode is one more option for subjective perfusion analysis of blood flow instead of the routinely used color Doppler mode. The po wer Doppler adds the amplitude of the echo with the velocities in the processing for image representation. Direction of the flow (red and blue) is abolished in power Doppler. Two ultrasonograms using this mode are presented ( Figure s 7 9a and 7 9b; Day 22 a nd Day 54). The advantage of power Doppler mode is the more detailed representation of the blood flow and it helps the operator in the analysis of slow motion flow.

PAGE 184

184 However, the increase in the computational processing slows the screen frame rate, making r eal time imaging difficult in large animals. A differential growth of the dorsal area of the endometrium around embryonic vesicle has been described in mares (Silva & Ginther 2006). A similar pattern was observed during early pregnancy in cows. The images on Days 20, 21, and 22 ( Figure 7 9a) presented in this paper clearly show the larger area of the dorsal endometrium, close to the mesometrial attachment in the uterus, compared to the ventral endometrium. The allantoic development is difficult to be monito red daily as it is in mares due the elongated conceptus and flexed uterine horn shapes in cattle. However, the ultrasonogram shown on Day 27 ( Figure 7 9a) indicates that the embryo proper migrated to the dorsal endometrial area and the umbilical cord forme d at the most vascularized area as observed in the ultrasonogram on Day 38 ( Figure 7 9a) of pregnancy. Similar orientation of the embryo proper is observed during placentation of humans and mice (Theiler 1989; Jaffe et al. 1997). These are new findings in cows and indicate that, as with other species, the embryo position in the uterus is orientated in apposition to the mesometrial attachment for eventual development of the umbilical cord at the most vascularized area of the uterus. This process was describe d in mares due to the spherical shape and localized positioning of the embryonic vesicle into the uterus (Silva & Ginther 2006; Ginther & Silva 2006). In summary, color Doppler ultrasonography was used to study the relationships of uterine vascular perfusi on during early pregnancy in heifers. Uterine vascularity was similar between nonpregnant and pregnant heifers until the beginning of luteolysis in nonpregnant heifers. Uterine perfusion in nonpregnant heifers increased between Days 14 to 18 and was tempor ally associated with the preovulatory rise in estradiol. There was no evidence for a similar increase in endometrial perfusion scores in pregnant heifers at this time. In pregnant heifers, endometrial

PAGE 185

185 perfusion scores were compared between ipsilateral and contralateral horns from Days 0 to 60. Increased endometrial perfusion scores in the ipsilateral horn were detected between Days 18 and 20, and continued to increase until Day 40. Perfusion scores of the contralateral horn remained low until Day 32, when t hey began to rise, reaching perfusion scores approximately similar to the ipsilateral horn around Day 40, then declining until Day 60. The u terine vascularity increase in pregnant heifers paralleled the timing of development of the allantoic sac. An incre ase in endometrial vascular perfusion in nonpregnant heifers was temporally associated with decreased P4 concentrations and increased E2 concentrations. In contrast, increased endometrial perfusion scores were detected later, around Day 20, in pregnant hei fers only in the horn ipsilateral to the corpus luteum and conceptus, and without temporal association with increased estradiol or decreased P4. Results supported the hypothesis that uterine blood perfusion is mediated by conceptus presence, development, a nd its interactions with the endometrium. These findings suggest different pathways of endometrial vascular perfusion stimulation in pregnant and nonpregnant heifers.

PAGE 186

186 Table 7 1. Objective colored pixel analysis (average of three cross sectional images ) for validation of the subjective vascular scores of the endometrium and mesometrium on Day 25 of pregnancy a End Points Uterine horn Endometrium With embryo (A) Without embryo (B) Ratio (A/B) Endometrial vascularity (score) b 2.6 0.2 c 1.2 0.1 d 2.2 Colored pixels (total number) 1643 215 c 91 32 d 18.1 Intensity of pixels (total) 201191 26655 c 12259 4548 d 16.4 Intensity of pixels (mean) 125.4 1.8 c 79.2 16.1 d 1.6 Mesometrium Endometrial vascularity (score) b 3.3 0.1 c 2.1 0.1 d 1.6 Colored pixels (total number) 7828 659 c 3493 572 d 2.2 Intensity of pixels (total) 939889 78512 c 421960 66865 d 2.2 Intensity of pixels (mean) 120.2 0.5 121.7 0.9 1.0 a Values are presented as the mean SEM. b Scored from 1 to 4 for none, minimal, intermediate, and maximal, respectively. cd Within an end point, means with a different superscript are significantly different (P < 0.05).

PAGE 187

187 Figure 7 1. Diagram of the transrectal placement of the linear array ultrasound transdu cer, showing the spatial relationships among the uterine horns (dorsal view), transducer and sonograms. Colored spots are color Doppler indicators of blood flow. Blue and red indicates opposite blood flow directions related to the transducer insonation bea ms plan. Sonograms A and B are from the uterine horn contain the conceptus and opposite horn from the same animal on Day 25 of pregnancy, respectively. Sonogram C shows one of the uterine horns from a cyclic animal on estrus one day before ovulation for c omparison. On sonogram A, note the intense colored spots at the endometrium (ed) around the fluid filled area (black area conceptus) and at the mesometrium (mm). On sonogram B, endometrial blood flow is absent and at the mesometrium blood flow is smaller compared to the uterine horn containing the conceptus. Sonogram C shows intense endometrial edema indicated by the anechoic areas (black) inside and individualizing the endometrial folds. Intense blood flow is observed at the mesometrium and occasional co lored spots at the endometrium and subendometrial areas.

PAGE 188

188 Figure 7 2. Means (SEM) for endometrial and mesometrial vascularity scores, and resistance index for assessing the extend of vascular perfusion in 11 pregnant and 6 nonpregnant heifers every othe r day from the day of ovulation until Day 8 and every day from Days 9 to 18. No differences were detected between uterine horns from both reproductive statuses for all three end points and the presented data were obtained by the average of combined uterine horns data in each animal and time. Effects of pregnancy status, day and interaction pregnancy status by day were significant for endometrial vascularity scores ( P = 0.0058, P = 0.0002, and P = 0.0001, respectively). For mesometrial vascularity scores, ef fects of day and interaction pregnancy status by day were significant ( P = 0.0767 and P = 0.0001, respectively). Only the effect of day was significant for resistance index ( P = 0.0073).

PAGE 189

189 Figure 7 3. Means (SEM) for uterine echotexture and tone scores f rom 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every day from Days 9 to 18. No differences were detected between uterine horns from both reproductive statuses for the two end points and the presented dat a were obtained by the average of combined uterine horns data in each animal and time. The interaction of pregnancy status by day was significant for uterine echotexture and tone ( P = 0.0495 and P = 0.0424, respectively).

PAGE 190

190 Figure 7 4. Means (SEM) for estradiol and progesterone serum concentrations from 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every day from Days 9 to 18. No differences were detected between uterine horns from both reproductive stat uses for the two end points and the presented data were obtained by the average of combined uterine horns data in each animal and time. Effects of pregnancy status, day and interaction pregnancy status by day were significant for estradiol and progesterone ( P = 0.0153, P = 0.0001, and P = 0.0001, respectively for estradiol and P = 0.0151, P = 0.0001, and P = 0.0001, respectively for progesterone).

PAGE 191

191 Figure 7 5. Means (SEM) for percentage of corpus luteum area with blood flow and corpus luteum area from 11 pregnant and 6 nonpregnant heifers every other day from the day of ovulation until Day 8 and every day from Days 9 to 18. Effects of day and interaction pregnancy status by day were significant for both end points ( P = 0.0001 and P = 0.0001, respectivel y for % area with blood flow and P = 0.0001, and P = 0.0016, respectively for corpus luteum area).

PAGE 192

192 Figure 7 6. Means (SEM) for endometrial and mesometrial vascularity scores, and vascular resistance index for assessing the extend of vascular perfusio n in 11 pregnant heifers from both uterine horns (horn containing the embryo or fetus and opposite horn) every other day from the day of ovulation until Day 8, every day from Days 9 to 30, and every other from Days 30 to 60. Colored backgrounds indicate pe riods of distinct uterine location of allantoic sac development. Key developmental features are indicated on the timeline axe. Effects of horn side, day and interaction horn side by day were significant and similar for endometrial and mesometrial vasculari ty scores ( P = 0.0001, P = 0. 0001, and P = 0.0001, respectively for the effects). For vascular resistance index, effects of day and interaction horn side by day were significant ( P = 0.0001 and P = 0.0007, respectively).

PAGE 193

193 Figure 7 7. Means (SEM) for ut erine echotexture and tone scores, and for percentage of corpus luteum area with blood flow and corpus luteum area in 11 pregnant heifers from both uterine horns (horn containing the embryo or fetus and opposite horn) every other day from the day of ovulat ion until Day 8, every day from Days 9 to 30, and every other from Day 30 to 60. Colored backgrounds indicate periods of distinct uterine location of allantoic sac development. Effect of day was significant and similar for all four end points ( P = 0.0001).

PAGE 194

194 Figure 7 8. Means (SEM) for heart rate during embryonic and fetal stages from in 11 pregnancies in heifers assessed every day from Days 24 to 30 and every other from Days 30 to 60. The effect of day was significant ( P = 0.0001).

PAGE 195

195 Figure 7 9a. Embryo stage in cows assessed by color Doppler ultrasonography from Days 20 to 38 (Flow, Power and Spectral modes). Age based on number of days after day of ovulation (Day 0) is indicated on the right bottom corner of each image. Key features are indicated by arrows. Detailed description and comments are provided in the Results and Discussion sections (modified from Ginther 2008).

PAGE 196

196 Figure 7 9b. Fetal stage in cows assessed by color Doppler ultrasonography from Days 44 to 90 (Flow, Power and Spectral mode s). Age based on number of days after day of ovulation (Day 0) is indicated on the right bottom corner of each image. Key features are indicated by arrows. Detailed description and comments are provided in the Results and Discussion sections (modified from Ginther 2008)

PAGE 197

197 CHAPTER 8 RELATIONSHIP BETWEEN VASCULARITY OF THE PRE OVULATORY FOLLICLE AND ESTABLIS HMENT OF PREGNANCY IN MARES Synopsis The relationship between follicle vascularity and establishment of pregnancy was studied in 21 mares. An ovulation in ducing injection of hCG was given when the preovulatory follicle was 34.0 to 37.0 mm (Hour 0). Mares that had not ovulated by 30 h after treatment were bred once (Hour 30). Each mare ovulated by 48 h after treatment, and 14 mares became pregnant and 7 were nonpregnant. The preovulatory follicle was evaluated by B mode and Doppler ultrasonography at Hour 0 (before treatment) and Hour 30 (before breeding). B mode echogenicity and thickness of the stratum granulosum and prominence of the anechoic band beneath the granulosum increased in both pregnant and nonpregnant groups (hour effect, P < 0.001) with no group effect or interaction. An increase in follicle diameter and percentage of follicle circumference with color Doppler signals was greater between Hours 0 and 30 in the pregnant group than in the nonpregnant group (interactions, P<0.001). Spectral Doppler measurements were made at the most prominent intraovarian color signal. Decreases in resistance and pulsatility indices were greater between Hours 0 and 30 in the pregnant group than in the nonpregnant group (interactions, P < 0.05), indicating increased vascular perfusion downstream from the spectral measurement in the pregnant group. Relative peak systolic velocity and time averaged maximum velocity of blo od flow at the point of spectral assessment showed a group effect (P < 0.05; greater in pregnant group) without an hour effect or interaction. Results supported the hypothesis that greater blood flow to the preovulatory follicle is associated with higher p regnancy rate.

PAGE 198

198 Introduction Limited information is available in farm species on the effect of the characteristics of the preovulatory follicle on subsequent pregnancy rate. In cattle, GnRH induced ovulation of ncy rates in association with decreased circulating estradiol on the day of insemination and lower rate of progesterone increase after insemination (Perry et al. 2005).These results indicated that induction of ovulation before the follicle is physiological ly mature has a negative impact on establishment of pregnancy. Diameter of the preovulatory follicle did not affect pregnancy rate when ovulation occurred spontaneously. Induction of ovulation is common in mares, especially with hCG (reviewed in Ginther 19 92). The use of hCG does not have an adverse effect on pregnancy rate, indicating that only physiologically mature follicles respond to hCG stimulation. The effect of characteristics of the preovulatory follicle on the pregnancy producing capacity of the o ocyte has been studied in women, owing to the popularity of assisted reproduction programs. The extent of the follicular wall with color Doppler detected blood flow was positively associated with pregnancy rate (Chui et al. 1997, Bhal et al. 2001, Borini e t al. 2001). There was no significant relationship between pregnancy rate and uterine artery or intraovarian Doppler pulsatility index (Bhal et al. 2001). A recent in vitro fertilization study in women found that well vascularized follicles early in a foll icular wave and on the day of hCG treatment late in the wave resulted in a higher pregnancy rate after embryo transfer (Shrestha et al. 2006). Results of another study indicated that examining vascular impedance distal to an intraovarian artery by spectral Doppler indices may be useful in assessing the quality of an oocyte (Du et al. 2006). Despite the increasing and productive use of the transvaginal Doppler technology for assessing the quality of oocytes by the blood flow characteristics of the follicle in assisted reproduction programs in women, similar studies apparently have not been done in association

PAGE 199

199 with spontaneous ovulation. In farm species, oocyte and embryo collection have becom e common techniques (Betteridge 2006), but the relationship between follicle vascularity and oocyte competence in establishment of pregnancy, with or without oocyte or embryo collection, has not been reported. Transrectal Doppler ultrasonography is beginning to be used in mares for studying other reproductive mechanisms (Bollwein et al. 2002, Acosta et al. 2004, Silva & Ginther 2006). Changes in echotexture and color Doppler signals of the follicle wall as ovulation approaches in mares with and without hCG treatment have also been studied (Gastal et al. 2006). An increase in granulosa thickness and echogenicity and a decrease in circulating estradiol during the 36 h post treatment was greater in the hCG group than in the controls. Percentage of follicle wall with color flow signals and prominence of the signals increased i n both groups during the 36 h. During the 4 h before ovulation, the two groups showed similar decreases in prominence and percentage of wall with an anechoic band and prominence and percentage of wall with color flow signals. The anechoic band is located i n the area of the thecal layers and its characteristics have been described (Gastal et al. 1998, 1999). The morphology accounting for the changes in the anechoic band and the increasing echogenicity of the granulosa layer as ovulation approaches have been discussed (Gastal et al. 2006). Luteal progesterone is essential for various mechanisms associated with early pregnancy, but it is not clear whether a deficiency in luteal development or progesterone production can result in a natural reduced pregnancy rat e (reviewed in Ginther, 1992, Sevinga et al. 1999). Conflicting results on primary luteal insufficiency as a cause of failure of pregnancy establishment have been obtained in horses. An effect of defective vascularization of the corpus luteum on reduced pr egnancy rate apparently has not been considered in any species.

PAGE 200

200 The Doppler technology generates many end points concerning blood flow velocities and patterns, but the ovarian artery of mares usually does not accommodate the placement of an angle cursor fo r the determination of velocities (Ginther & Utt 2004). However, relative, as apposed to actual, velocities between experimental groups or side of body during an arterial pulse can be obtained without the angle cursor. Indices of vascular impedance in the tissues beyond the point of velocity assessment in the ovarian artery or its branches are especially useful end points because the indices are independent of angle of insonation (angle at intersection between direction of blood flow and direction of the ul trasound beam; Ginther & Utt 2004, Zwiebel & Pellerito 2005). These end points may substantiate the results of direct assessment of the extent of blood flow signals but were not used in the reported study of hCG induced changes in equine preovulatory folli cles (Gastal et al. 2006). The hypothesis for the present study in mares was that a higher pregnancy rate is associated with greater blood flow to the preovulatory follicle. Materials and Methods Animals Animals were handled in accordance with the United States Department of Agriculture Guide for the Care and Use of Animals in Agricultural Research. Nonlactating pony mares (n=26) of mixed breeds, 5 to 20 yr of age, and weighing 260 to 450 kg were used. The experiment was done from June 15 to September 15 in the Northern Hemisphere, and all mares ovulated after the experiment was completed. Mares were kept under natural light in an open shelter and outdoor paddock and were maintained on alfalfa/grass hay with access to water and trace mineralized salt; body condition for all mares was high throughout the experiment. Mares with docile temperament and no apparent abnormalities of the reproductive tract as determined

PAGE 201

201 by ultrasound examinations (Ginther 1995 b ) were selected 15 d after ovulation. Mares were not u natural breeding, or developed uterine fluid (> 3 mm in height) 48 h after breeding. Gray scale ultrasonographic examinations were done daily, beginning 15 d afte r the previous ovulation. When the largest follicle was 34.0 to 37.0 mm, all selected mares were given a single i.v. injection of 2500 IU of hCG (Hour 0). Scanning was done for ovulation detection 30 h after hCG treatment (Hour 30). Mares that had not ovul ated by Hour 30 were scanned by Doppler ultrasound and then were bred. Mares were scanned at 18 h after breeding to check for ovulation and at 48 h to check for uterine fluid; even small collections of uterine fluid are associated with uterine inflammation and reduced pregnancy rate (Ginther et al. 1985, Adams et al. 1987, Cadario et al. 1 999). The next scanning was done 7 and 13 d after ovulation for evaluation of the corpus luteum and for pregnancy diagnosis, respectively. Blood samples for hormone assay were collected at Hours 0 and 30 and 7 d after ovulation. Natural breeding 30 h after hCG treatment was done once by one of two stallions, designated Stallions A and B. The assignment of a stallion to a mare was done by randomization for every replicate o f two mares, and only the assigned stallion was used. Successful breeding was based on intromission with tail flagging and confirmed by digital detection of ejaculatory pulses. Doppler Ultrasonography To generate optimal ultrasound images, mares were sed ated during scanning with a subdose of detomidine hydrochloride (1 mg per animal, i.v.; Dormosedan, Pfizer Animal Health, Philadelphia, PA, USA). A duplex B mode and pulsed wave color Doppler ultrasound instrument (Aloka SSD 2000; Aloka America, Wallingfor d, CT, USA) equipped with a finger

PAGE 202

202 mounted 7.5 MHz convex array transducer (UST 995 7.5) was used for transrectal scanning. For B mode, the brightness and contrast controls of the monitor and the gain controls of the scanner were standardized to constant s ettings (Gastal et al. 1998). The color mode was used to display signals of blood flow in vessels of the follicle wall. For maximal flow velocity detection by color signals without aliasing, the velocity range was set at 10 cm/s. The color gain setting was kept constant. The B mode and color Doppler end points were evaluated while the entire follicle was being scanned in a slow continuous motion several times. For the spectral Doppler mode, the setting for the range of flow velocity detection was adjusted in each scanning to obtain the optimal spectral graph. The sample cursor or gate was set at a width of 1 mm. The angle of insonation was unknown, and therefore the velocities were not absolute but were considered relative in the comparisons for hours and g roups (Zwiebel & Pellerito 2005). The gate was placed at an intraovarian location with the most prominent color signal. A Doppler spectrum with three cardiac cycles was generated, and one of the cycles was used for spectral measurements. This also was done a second time, and the mean of the two measurements was used in the statistical analyses. End Points Follicle diameter was obtained from the average of height and width of the antrum at the apparent maximal area from two frozen images. Percentage of circ umference of the follicle wall with an anechoic band ( Figure 8 1) was estimated from B mode real time images of the sequential two dimensional planes during scanning of the entire follicle. Therefore, the term circumference refers to the periphery of a thr ee dimensional follicle. Other B mode end points (prominence of anechoic band, echogenicity and thickness of granulosa) also were evaluated during real time scanning and were scored from 1 to 3 (minimal to maximal) as described

PAGE 203

203 (Gastal et al. 2006). Scores were assigned without reference to the score from the previous examination. The scores were made from the real time images encompassing the entire follicle to minimize the impact of localized areas of the follicle wall that were obscured by ultrasound art ifacts. Only Operator A scanned for the B mode end points but Operators A and B independently estimated values from the monitor. These two operators were experienced and used these end points for a previous study (Gastal et al. 2006). The validity of the s coring approach for mares has been demonstrated (Ginther 1995 b ). For color Doppler mode, the percentage of circumference of the follicle wall with an apparent network of arterioles was estimated from the blood flow color displays ( Figure 8 1) of the real t ime sequential two dimensional planes of the entire follicle. The transducer was held at various angles to display the maximum overall color signals throughout the three dimensional circumference of the follicular wall. Estimations of the proportion of the follicle circumference with blood flow signals also have been used in women (Chui et al. 1997, Bhal et al. 1999, Coulam et al. 1999). The percentage approach for the equine preovulatory follicle has produced similar results by two operators working indepe ndently (Gastal et al. 2006). Prominence of the color displays was based on intensity of color and extent of coverage and was scored from 1 to 4 (minimal to maximal). Values for the two color signal end points were estimated independently by two experience d operators during scanning by one of the operators. The spectral evaluations were done separately by a third operator. The end points for the gated intraovarian color signals were resistance index (RI), pulsatility index (PI), peak systolic velocity (PSV) and time averaged maximum velocity (TAMV). The meaning and formulas for these spectral end points are well est ablished (Zwiebel & Pellerito 2005).

PAGE 204

204 The corpus luteum 7 d after ovulation was compared between pregnant and nonpregnant groups for cross secti onal area (cm 2 ), estimated percentage of the entire gland with blood flow signals, and the four spectral end points (RI, PI, PSV, TAMV) from the most prominent intraovarian color signal. The validity of using the estimated percentage of the structure with blood flow signals for evaluation of the equine corpus luteum has been documented by comparison to the number of colored spots and pixels in frozen images (Ginther et al. 2006). Blood Samples and Hormone Assays Blood samples were collected into hepariniz ed tubes and centrifuged (1500 x g for 20 min), and the plasma was decanted and stored ( 20 C) until assay. Plasma samples were assayed for estradiol and progesterone. The estradiol assay concentrations used a double antibody radioimmunoassay kit (Double Antibody Estradiol, Diagnostic Products Corporation, Los Angeles, USA), as described and validated in our laboratory for mare plasma (Ginther et al. 2005a). The intra assay CV and sensitivity were 2.4% and 0.2 pg/ml, respectively. Plasma progesterone conce ntrations were measured using a solid phase radioimmunoassay kit containing antibody coated tubes and 125 I labeled progesterone (Coat A Count Progesterone, Diagnostic Products Corporation, Los Angeles, CA, USA), as described and validated in our laboratory for mare plasma (Ginther et al. 2005b ). The intra assay CV and sensitivity, respectively, were 13.2% and 0.03 ng/ml. Statistical Analyses The values for the end points in B mode and color mode obtained independently by two operators did not show a stati stical main effect of operator or an operator by group interaction, and the mean value for the two operators was used in the analyses. Quantitative data were

PAGE 205

205 analyzed by the SAS MIXED procedure to determine the main effects of group (pregnant and nonpregna nt) and hour (Hours 0 and 30) and their interactions, using a repeated statement to account for the autocorrelation between measurements (version 8.2; SAS Institute Inc., Cary, NC). Measurements for the corpus luteum 7 d after ovulation were analyzed by a one way ANOVA. A probability of P < 0.05 indicated that a difference was significant and a probability mean SEM, unless otherwise indicated. Results The nu mber of mares that were removed from the experiment after having been 30 h after hCG treatment, 2 mares; nonreceptive to breeding, 1 mare; and uterine fluid 48 h after breeding, 2 mares. The number of mares remaining for the experiment was 21; 10 were bred by Stallion A and 11 were bred by Stallion B; only one mare was available for the last replicate. All of the 21 mares ovulated between 30 and 48 h after hCG tre atment, and breeding by the designated stallion was successful for each mare. The pregnancy rate was greater (P < 0.03) for Stallion A (9 of 10) than for Stallion B (5 of 11). Age of mare and the interval between use of a stallion for breeding were not dif ferent between the pregnant group (9.0 1.1 yr; 5.6 0.8 d) and the nonpregnant group (10.2 1.6 yr; 4.4 0.9 d). Data for B mode ( Figure 8 2) and color flow mode for the preovulatory follicle and spectral mode for the most prominent color flow signal ( Figure 8 2) in the ovary at Hour 0 (hCG treatment) and Hour 30 (breeding) and significant main effects and interactions are shown. A mean increase between Hour 0 and Hour 30 averaged over the two groups (hour effect), without a group by hour interaction, was obtained for granulosa echogenicity and thickness and for

PAGE 206

206 prominence of the anechoic band and prominence of color flow signals. A group by hour interaction was obtained for follicle diameter and percentage of circumference with color flow signals; the interaction reflected primarily greater values at Hour 30 in the pregnant group. When the Doppler sample gate was placed on an intraovarian color flow signal, an interaction was obtained for RI and PI reflecting lower values in the pregnant group at Hour 30. A significant group effect from higher values in the pregnant group, but without an interaction, was obtained for PSV and TAMV. Plasma estradiol concentration decreased in both groups after treatment with hCG ( Figure 8 3), but there were no significant differences for progesterone (not shown). There were no significant differences 7 d after ovulation between the pregnant group and nonpregnant group for area of the corpus luteum (7.7 1.0 vs 6.3 0.9 cm 2 ), percentage of corpus luteum with blood flow si gnals (56.1 4.1 vs. 58.8 5.9 %) or prominence of signals (3.2 0.1 vs. 3.1 0.1 score), RI (0.51 0.03 vs. 0.44 0.3), PI (0.79 0.08 vs. 0.62 0.06), PSV (20.7 1.6 vs. 21.8 2.0 cm/s), TAMV (14.1 1.3 vs. 15.7 1.7 cm/s), and plasma progest erone concentration (12.8 1.2 vs. 10.2 1.2 ng/ml). The differences approached significance for the following end points: RI (P < 0.07), PI (P < 0.07), and progesterone concentrations (P < 0.09). Discussion Results supported the hypothesis that a high er pregnancy rate is associated with greater blood flow to the preovulatory follicle. Support was indicated by the vascular changes between Hour 0 (hCG treatment) and Hour 30 (breeding), including a greater percentage of the follicle wall with blood flow D oppler signals and a greater reduction in RI and PI of an intraovarian vessel in mares that became pregnant than in mares that did not. The RI and PI are indices from the spectral mode that are inversely related to the extent of vascular perfusion in the t issue

PAGE 207

207 downstream from the point of ves sel assessment (Ginther & Utt 2004, Zwiebel & Pellerito 2005). The relative blood flow velocities (PSV and TAMV) did not increase differentially in the pregnant group between Hours 0 and 30 but were higher in the pregn ant group at both hours. That is, blood velocity was already higher in the intraovarian vessel of the pregnant group by the time the follicle reached 34 to 37 mm (Hour 0) and remained elevated until just before breeding (Hour 30). Apparently, increased blo od velocity in the ovary with the preovulatory follicle preceded the increased vascular perfusion of the follicle or tissue distal to the spectral evaluation. The positive association between establishment of pregnancy and the extent of vascularization of the preovulatory follicle is a novel finding, except for reports for women in oocyte and embryo transfer or assisted reproduction programs (cited in Introduction). An unexpected result was the differential increased diameter of the follicle between Hours 0 and 30 in the mares that became pregnant. Previous reports have indicated that the follicle does not increase in diameter during about 2 d before ovulation in both control and hCG treated mares (Koskinen et al. 1989, Gastal et al. 2006). Previous studies however, did not separate the mares into future pregnant and nonpregnant groups. The increased diameter in the present study in the pregnant group, therefore, does not contradict the previous findings. The diameter increase was < 1.0 mm in each of the se ven mares in the nonpregnant group and > 1.0 mm in 57% of the 14 mares in the pregnant group. Further study will be needed to determine the practicality of using diameter increase as an indicator of the likelihood of future pregnancy in individual mares. The B mode echotextural characteristics averaged over Hours 0 and 30 were not different between the pregnant and nonpregnant groups. The main effect of hour indicated an increase in values between Hours 0 and 30 in both groups for echogenicity and thicknes s of the granulosa

PAGE 208

208 and prominence of the anechoic band. These results confirm those of the previous characterization study (Gastal et al. 2006). The estradiol decrease following hCG treatment occurred in both groups and also confirms the previous results. Results for the two stallions were combined and used in the statistical analyses, even though the pregnancy rate for Stallion A was higher than for Stallion B. Mares bred by Stallion A had a significantly lower RI and PI and greater follicle diameter 30 h after hCG treatment (before breeding) than for mares bred by Stallion B. Thus, despite the strict randomization of mares between stallions, Stallion A was assigned to a greater proportion of mares with prebreeding follicle characteristics that were shown in this experiment to be associated with establishment of pregnancy. When only Stallion B was considered, the significant differences between the pregnant and nonpregnant groups involved the same end points as for the combined stallions. Of the 10 mares as signed to Stallion A, the one mare that did not become pregnant had the lowest follicle blood flow percentage, the highest RI and PI, and the lowest TAMV just before breeding. These considerations indicate that the stallion effect was not a confounding fac tor in the test of the hypothesis. The mechanism associated with the detrimental effect of inadequate blood flow to the preovulatory follicle on oocyte competence or pregnancy rate is not known. Given that the vascular system delivers nutrients to tissues the relationship between oocyte quality and blood flow may be similar, at least in part, to the relationship between oocyte maturation and nutrition. Dietary intake affects follicular fluid concentrations of steroids and insulin like growth factors and o ocyte morphology (Callaghan et al. 2000), but a direct relationship between follicle blood flow and these factors apparently has not been considered.

PAGE 209

209 None of the luteal end points 7 d after ovulation indicated a difference in luteal morphology, vascularit y, or function between pregnant and nonpregnant mares. The decrease in progesterone and increase in RI and PI in the nonpregnant group were equivocal in that the differences only approached significance, indicating a need for further study. In this regard, the literature also seems conflicting (Sevinga et al. 1999), and a need for further study with greater number of subjects is indicated. In conclusion, diameter of the preovulatory follicle increased in the pregnant group but not in the nonpregnant group between the time of hCG treatment and breeding 30 h later. Doppler ultrasonographic characteristics of the preovulatory follicle 30 h after hCG injection indicated that follicle blood flow was greater in mares that became pregnant than in mares that did no t. Characteristics that supported this conclusion were percentage of circumference of the follicular wall with blood flow signals and resistance and pulsatility indices taken at the most prominent intraovarian color signal.

PAGE 210

210 Figure 8 1. Color Doppler sonograms illustrating blood flow signals in the wall of preovulatory follicles of a mare (A) that became pregnant and a mare (two images in different planes; B,C) that did not become pregnant. Images were taken 30 hours after hCG treatment and show high ( A) and low (B,C) percentages of follicular wall with blood flow signals. A portion of an anechoic band is shown (arrows, C). Distance between graduation marks is 10 mm (left margin).

PAGE 211

211 Figure 8 2. Values (mean SEM) for diameter of the preovulatory foll icle, plasma estradiol concentrations, and B mode characteristics of the follicle wall in mares that became pregnant (n = 14) or nonpregnant (n = 7). A single injection of hCG was given when the follicle was 34.0 to 37.0 mm (Hour 0), and mares were bred 30 h later (Hour 30). Scores are for minimal (1) to maximal (3) for echogenicity and thickness of the granulosa and prominence of the anechoic band. The asterisks indicate a significant main effect (H, hour) and significant interaction (GH, group by hour) as follows: *** P < 0.001.

PAGE 212

212 Figure 8 3. Values (mean SEM) end points obtained by Doppler ultrasonography for the preovulatory follicle in mares that became pregnant (n = 14) or nonpregnant (n = 7). A single injection of hCG was given when the follicle w as 34.0 to 37.0 mm (Hour 0), and mares were bred 30 h later (Hour 30). Scores are for minimal (1) to maximal (4) for prominence of the color Doppler signals. The indices (RI, PI) are inversely related to the extent of tissue vascular perfusion downstream f rom the point of assessment at the most prominent intraovarian color signal. RI = resistance index; PI = pulsatility index; PSV = peak systolic velocity; TAMV = time averaged maximum velocity. The asterisks indicate significant main effects (G, group; H, h our) and significant interacti ons (GH) as follows: P < 0.05; P < 0.01; *** P < 0.001.

PAGE 213

213 CHAPTER 9 TEMPORAL ASSOCIATIONS AMONG PULSES OF 13,14 DIHYDRO 15 KETO LUTEAL BLOOD FLOW, AND LUTEOLYSIS IN CATTLE Synopsis Luteal blood flow was studied in heifers by transrectal color Doppler ultrasound. Data were normalized to the decrease in plasma proges terone to < 1 ng/ml (Day 0 or Hour 0). Blood flow in the corpus luteum (CL) was estimated by the percentage of CL area with color flow signals. Systemic PGF treatment (25 mg; n = 4) resulted in a transient increase in CL blood flow during the initial porti on of the induced decrease in progesterone. Intrauterine treatment (1 or 2 mg) was done to preclude hypothetical secondary effects of systemic treatment. Heifers were grouped into responders (luteolysis; n = 3) and nonresponders (n = 5). Blood flow increas ed transiently in both groups; induction of increased blood flow did not assure the occurrence of luteolysis. A transient increase in CL blood flow was not detected in association with spontaneous luteolysis when examinations were done every 12 h (n = 6) o r 24 h (n = 10). The role of PGF pulses was studied by examinations every hour during a 12 h window each day during expected spontaneous luteolysis. At least one pulse of 13,14 dihydro 15 keto PGF 2 (PGFM) was identified in each of six heifers during the luteolytic period (Hours 48 to 1). Blood flow increased (P < 0.02) during the 3 h ascending portion of the PGFM pulse, remained elevated for 2 h after the PGFM peak, and then decreased (P < 0.03) to baseline. Results supported the hypothesis that CL blood flow increased and decreased with individual PGFM pulses during spontaneous luteolysis.

PAGE 214

214 Introduction Secretion of prostaglandin F 2 (PGF) by the uterus, augmented by intraluteal PGF production, terminates the luteal phase in cattle as in many other species (Arosh et al. 2004, Wiltbank & Ottobre 2003) Studies involving placement of transducers on the ovarian artery and insertion and entrapment of radioactive microspheres of various diameters hav e shown that blood flow to the corpus luteum (CL) decreases dramatically in association with luteolysis (Niswender et al. 1976) It has been elusive as to whether the decreased luteal blood flow preceded or accompanied the luteolytic process (Knickerbocker et al. 1988) However, rather than a decrease in luteal blood flow as an initial step in the luteolytic process, recent color Doppler studies in cattle indicated that luteal blood flow initially and transiently increased during or prior to a decrease in p lasma progesterone during exogenous PGF induced luteolysis ( Acosta et al. 200 2 ) and spontaneous luteolysis ( Shirasuna et al. 2004, Miyamoto et al. 2005 ) In the study with induced luteolysis (Acosta et al. 2002) a single injection of a PGF analogue (clo prostenol) was used. The ratio of colored area from color Doppler signals of blood flow on an image of the CL was used as a quantitative index of blood flow. Progesterone concentration decreased significantly between 0 h and 1 h posttreatment and blood flo w transiently increased between 0 h and 0.5 h and then decreased after 2 h. Thus, blood flow increased while progesterone was decreasing. In the study with spontaneous luteolysis ( Shirasuna et al. 2004 ) blood sampling and blood flow determinations were ma de every 12 h. Blood flow increased between 16 and 17 days postestrus and then decreased, a PGF metabolite (13,14 dihydro 15 keto PGF 2 ; PGFM) was elevated at 17 and 18 days, and plasma progesterone began to decrease at 18 days. The authors concluded that luteal blood flow increased before progesterone decreased and proposed that the acute increase of intraluteal blood flow is a universal phenomenon prior to spontaneous luteolysis.

PAGE 215

215 Contrasting with the reports of an association between a transient increas e in blood flow and the initiation of luteolysis in cattle, recent color Doppler studies in horses did not find a similar blood flow phenomenon in association with either PGF induced (Ginther et al. 2006) or spontaneous ( Ginther et al. 200 7 b ) luteolysis. T reatment with PGF caused a progesterone increase within 5 min that remained elevated until 10 min and then decreased. A change in luteal blood flow did not occur until a decrease occurred at 24 h. Luteolysis, as indicated by decreasing progesterone, began well before the beginning of a detectable decrease in blood flow. The temporal association between changes in blood flow and progesterone concentrations during spontaneous luteolysis was studied at 24 h intervals. There was no indication that either an acu te increase or decrease in luteal blood flow occurred prior to or at the beginning of the precipitous decrease in progesterone concentration in mares. Intrauterine administration of PGF is effective in cattle for inducing luteolysis ( Louis et al. 1974 ) ; t he minimal effective dose (1 or 2 mg ; Inskeep 1973 ) is about 1/10 of the systemic dose (15 mg ; Lauderdale & Fokolowsky 1979 ) when given into the uterine horn ipsilateral to the CL. The intrauterine effectiveness results from a unilateral uteroovarian luteo lytic pathway in cattle (Ginther et al. 1966, 1967) ; the PGF is transferred into the ovarian artery after intrauterine administration ( Hixon & Hansel 1974 ) through a local venoarterial pathway between the uteroovarian vein and the ovarian artery ( Ginther 1 981 ) The main plasma metabolite of PGF is PGFM, and assay of PGFM is an indicator of PGF release into the circulation ( Kindahl et al. 1976a ) The half life of PGFM is only about 8 min but is much longer than for PGF. A sampling interval of 1 h has been r ecommended for detection of PGFM pulses ( Kindahl et al. 1976a ) A series of PGFM pulses occurred during luteolysis, and the first pulse was followed immediately by a decrease in progesterone ( Kindahl et al. 1976b )

PAGE 216

216 The series of PGFM pulses occurred over 2 to 3 d with a mean of 5 pulses, and each pulse had a duration of 1 to 5 h or a mean of 4 h ( Kindahl et al. 1976b, Mann & Lamming 2006) The pulsatile release of PGF from the CL as well as from the uterus during spontaneous luteolysis in the cow has been r eported ( Shirasuna et al. 2004 ) The hormonal regulation accounting for the stimulation of PGF pulses and the interval between pulses is complex and has been reviewed ( Schams & Berisha 2004, Silvia et al. 1991 ) In this regard, treatment with oxytocin on D ay 17 in cows stimulates a surge of PGFM with characteristics that seem similar to a spontaneous PGFM pulse, except for a more rapid increase ( Meyer et al. 1995 ) The rationale, objective, and sequence for the experiments in the present series were as fol lows: 1) The process of an increase in luteal blood flow prior to the progesterone decrease during spontaneous luteolysis that has been reported in cattle ( Miyamoto et al. 2005 ) was not detected in horses (Ginther et al. 200 7 b) ; the objective of Experiment 1 was to confirm the occurrence of the process in cattle. 2) The existence of the reported process during spontaneous luteolysis in cattle was not confirmed in Experiment 1; the objective of Experiment 2 was to confirm its reported (Acosta et al. 2002) ex istence during induced luteolysis. 3) The process during induced luteolysis was confirmed in Experiment 2, but the induced regression involved systemic treatment that may have produced increased blood flow by a secondary systemic effect; the objective of E xperiment 3 was to determine if local intrauterine administration of a low dose of PGF would induce the process of an early blood flow increase in association with luteolysis. 4) Local intrauterine treatment also stimulated the process in Experiment 3. The refore hourly sampling was done in Experiment 4 to test the hypothesis that CL blood flow increased and decreased in close association with each individual PGFM pulse during spontaneous luteolysis.

PAGE 217

217 Materials and Methods Animals were handled in accordance with the United States Department of Agriculture guide for Care and Use of Agricultural Animals in Research. Holstein heifers, aged 17 to 20 months, were used in the four experiments. Body condition for each heifer was high throughout the experiments. Hei fers were selected with docile temperament and no apparent abnormalities of the reproductive tract, as determined by ultrasound examinations (Ginther 1998 b ) The heifers were acclimated to the handling procedures for two weeks prior to experimentation. Hei fers were sedated with a low dose of xylazine (14 mg) in Experiment 1 but not in Experiments 2, 3, and 4. In Experiments 2 and 3, treatment was done 10 days after ovulation, which is well before expected luteolysis and conforms with the recently reported e xperiment (Acosta et al. 2002) A duplex B mode (gray scale) and pulsed wave color Doppler ultrasound instrument (Aloka SSD 3500; Aloka America, Wallingford, CT) equipped with a linear array 7.5 MHz transducer was used for transrectal scanning. In color D oppler mode, the extent and direction of blood flow in the vessels are indicated by color signals ( Ginther & Utt 2005) and was used to display signals for blood flow in vessels of the CL. All Doppler scans were performed at a constant gain setting for colo r. A velocity setting of 10 cm/sec was used for Experiments 1, 2, and 3, and a setting of 6 cm/sec was used for Experiment 4. The lowest velocity setting available on the instrument was 6 cm/sec. The effectiveness of the settings on minimizing detection of venous flow in the CL in these studies is unknown. Real time B mode/color Doppler images of the continuous scans were captured with an online digital video taping system and stored for potential validation and confirmation purposes. Percentage of CL with color Doppler signals for blood flow was estimated from the blood flow color displays of the real time sequential two dimensional planes of the entire CL, as described for mares (Ginther et al. 2006) The color flow signals at the periphery of the CL and w ithin the CL were included in the percentage estimate.

PAGE 218

218 Blood flow was normalized to the examination in each heifer when the decreasing plasma progesterone concentrations reached < 1 ng/ml (Day 0 or Hour 0). Experiment 1 Spontaneous Luteolysis Progester one concentrations and percentage of CL with blood flow were determined daily in 10 heifers. Normalized data were evaluated from Days 7 to +2. In addition, the ovulation that preceded the experiment was also used as a reference and data were evaluated fro m 8 to 18 days after ovulation; 18 days was the earliest day of the next ovulation. Ovulation was used as an additional reference in this experiment so that comparisons could be made to the reported results ( Shirasuna et al. 2004, Miyamoto et al. 2005 ) Validation of the procedure for estimating the percentage of CL with blood flow signals was done for the first five heifers in the experiment and Days 5 to +2 were used. Selection of a still image from the film clips for pixel assessment was done without prior knowledge by the operator selecting the images of source or the results of the real time evaluations. An image was selected that appeared to represent the largest cross section of the CL with distinctive colored areas. The number of colored pixels in the captured image of the CL was determined as described ( Ginther & Utt 2005) by an operator without knowledge of source or the real time percentage estimates until the pixel evaluations for all images were completed. The percentage of colored pixels was calculated by using the sum of number of colored and noncolored pixels as the denominator. For comparison of day effects among end points, the actual values for progesterone concentration, percentage of CL with blood flow, and percentage of the selected CL image with colored pixels for each day were converted to the percentage of the maximum value for each heifer within each end point, as described (Louis et al. 1974)

PAGE 219

219 Experiment 2 Systemically Induced Luteolysis Heifers were treated with either physiol ogic saline or a PGF analogue (500 g; cloprostenol, Estrumate, Schering Plough Animal Health Corp., Union, NJ). Treatment was given i.m. 10 days after ovulation (n = 4/group). The operator did not know the treatment group. The treatment product, day, and route were patt erned after the reported study (Acosta et al. 2002) Blood flow examinations and blood sampling were done at 24 h before treatment; just before treatment; and at 0.5, 1, 2, 3, 4, 6, 8, 12, 24, and 48 h after treatment. Experiment 3 Local ly Induced Luteolysis Natural PGF 2 (Dinoprost tromethamine, Lutalyse, Pharmacia & Upjohn Company, Kalamazoo, MI) was used in a single systemic or intrauterine treatment. Four groups of heifers (4 heifers/group) were used for systemic administration of 25 mg i.m. or intrauterine administra tion of 0, 1, or 2 mg. The operator did not know the treatment group. The intrauterine treatments were given in a volume of 0.4 ml physiologic saline inserted by the transcervical route into the middle of the horn ipsilateral to the CL. Blood samples and b lood flow data were collected at 0, 2, 24, and 48 h after treatment. The area (cm 2 ) of a cross section of the CL for each examination was determined in B mode from maximum area averaged from two still e change from the hour of treatment was used for progesterone, owing to significant differences among groups just before treatment. In addition to obtaining color flow images, spectral Doppler examinations were done at 0, 2, and 24 h. For this purpose, a sample cursor or gate 1 mm wide was placed on the most prominent intraovarian color flow signal in the CL containing ovary. The setting for the range of detection of flow velocity was adjusted for each examination to obtain the optimal spectral graph. A Do ppler spectrum with three cardiac cycles was generated, and one of the cycles was

PAGE 220

220 used for spectral measurements of vascular indices and flow velocities. This was done a second time, and the mean of the two measurements was used in the statistical analyses The angle of insonation between the ultrasound beams and direction of blood flow was unknown. However, the vascular indices of pulsatility index (PI) and resistance index (RI) are independent of angle of insonation ( Zwiebel & Pellerito 200 5 ) True veloci ties cannot be determined without adjusting for angle of insonation, but relative peak systolic velocity (PSV) and time averaged maximum velocity (TAMV) are useful for comparative purposes ( Zwiebel & Pellerito 2005 ) The formulas and meanings for the spect ral end points are well established and are discussed ( Ginther & Utt 2004, Zwiebel & Pellerito 2005 ) Experiment 4 PGFM P ulses The experimental period extended from 14 days after ovulation until the day that CL blood flow decreased to < 20% of CL area. Six heifers were used. A blood sample was collected and estimation of the percentage of CL area with blood flow was determined at 0800 and 2000 hours. Data obtained every 12 h were normalized to the period when progesterone first decreased to < 1 ng/ml, r egardless of whether < 1 ng/ml occurred at 0800 or 2000 hours. Beginning at 15 days postovulation, blood samples and blood flow estimates were taken every hour for 12 h. The set of hourly examinations began at 0800 hours and ended at 2000 hours, yielding 1 3 hourly examinations. The set of hourly examinations was obtained each day; the last set was obtained on the day before blood flow first decreased to < 20% of CL area at the 0800 hour examination. PGFM data from each set of 13 hourly samples were evaluat ed for the presence of complete PGFM pulses. A pulse in PGFM was differentiated from variation resulting from extraneous factors, as described for detection of FSH pulses ( Donadeu & Ginther 2002 ) The coefficient of variation (CV) of the values composing t he ascending and descending portions of

PAGE 221

221 the suspected pulse had to be at least three times higher than the mean intra assay CV. In addition, a pulse had to include values from at least 4 hours. Values for blood flow and progesterone concentration were norm alized to the peak of each identified PGFM pulse. PGFM pulses were assigned to a preluteolytic period (Hours 72 to 49), a luteolytic period (Hours 48 to 1), and a post luteolytic period (Hours 0 to 23). The luteolytic period was based, retrospectively on the mean period of a progressive decrease in progesterone concentration before reaching <1 ng/ml. The PGFM pulse was assigned to the period containing the peak. When more than one pulse was identified for a set of hourly samples, the first pulse was u sed in the analyses. Blood Samples and Hormone Assays Blood samples were collected into heparinized tubes and centrifuged (2000 x g for 10 min), and plasma was decanted and stored ( 20 C) until assay. Plasma progesterone concentrations were measured usin g a solid phase radioimmunoassay kit containing antibody coated tubes and 125 I labeled progesterone (Coat A Count Progesterone, Diagnostic Products Corporation, Los Angeles, CA). The procedure has been described in detail for mare plasma in our laboratory ( Ginther et al. 200 5 a ) and was validated for assaying plasma concentrations of progesterone in bovine plasma. Serial volumes of a pool of diestrus bovine plasma ( 50 300 l) were processed as for experimental samples and resulted in a displacement curve tha t was similar to the standard curve. The samples from Experiment 1 and 2 were analyzed in one assay. The intraassay CV and sensitivity were 3.04% and 0.03 ng/ml, respectively. The intraassay CV and sensitivity for Experiment 3 were 4.06% and 0.05 ng/ml, r espectively, and for Experiment 4 were 5.39% and 0.04 ng/ml, respectively.

PAGE 222

222 Blood samples for PGFM assay (Experiment 4) were collected and immediately placed in ice cold water for 10 minutes before centrifuging and storing at 20 C. The plasma samples were assayed for PGFM by a modification of a radioimmunoassay procedure ( Meyer et al. 1995, Mattos et al. 2004) that was adapted and validated in our laboratory. The PGFM (catalog # D4143; Sigma Chemical Co., St Louis, MO ) standard solutions were made by seria l dilution in assay buffer (0.05 M Tris HCL, sodium azide, 1 g/L; pH 7.5). Standards (100 l) were run in duplicate in concentrations of 10000, 5000, 2500, 1000, 500, 250, 100, 50, and 25 pg/ml. The standard curve included 300 l of prostaglandin free plas ma, which was obtained from a heifer treated at a 12 h interval with two intramuscular injections of a prostaglandin synthetase inhibitor (flunixin meglumine, Flumeglumine, Phoenix Pharmaceuticals Inc., St Joseph, MO; 1 g/injection). Blood was collected 4 h after the second injection. Assay buffer (100 l) was added to duplicates of the experimental plasma samples (300 l), as done for the standard curve. Rabbit anti PGFM (J57) antiserum (100 l; dilution 1:4000) was added and the mixture was incubated for 30 min at room temperature. Tracer (tritiated PGFM; catalog # TRK517, Batch 99; Amersham GE Healthcare, UK) was diluted in assay buffer (40 l in 10 ml) to contain approximately 20000 CPM/100 l. The tracer (100l) was added and the tubes were vortexed and incubated at room temperature for 1 h and then at 4 C overnight. Cold polyethylene glycol (40% in distilled water; 750 l) was added to each tube. The tubes were vortexed and centrifuged for 30 min at 1700 x g in a refrigerated centrifuge and decanted. Th e precipitate was resuspended in 750 l of assay buffer, and the vortexing, centrifuging, and decanting were repeated. The precipitate was resuspended in 1 ml of assay buffer and vortexed vigorously for 3 min. The suspension was poured into polyethylene sc intillation vials. Scintillation fluid (4 ml) was added to each vial and mixed before counting in a beta counter. Serial volumes of pools of diestrus and

PAGE 223

223 estrus bovine plasma (500 to 100 l) were processed as for the experimental samples and resulted in di splacement curves that were similar to the standard curve. Serial concentrations of PGFM (5000 pg to 78 pg) prepared in prostaglandin free bovine plasma also gave a dose dependent response similar to the standard curve. The intra and interassay CV values and sensitivity for PGFM were 7.1%, 6.3%, and 33.5 pg/ml. Statistical Analyses Data were examined for normality with the Kolmogorov Smirnov test. Data that were not normally distributed were transformed to natural logarithms. Individual end points were a nalyzed for time effects (day or hour), and comparisons involving groups were analyzed for main effects (group, time) and the interaction. The mixed procedure of SAS (version 8.2; SAS Institute, Inc) was used with a repeated statement to account for autoco rrelation between sequential measurements. Paired and unpaired Student t tests were used to locate differences between times within an end point and among groups within a time, respectively, when an effect of time or an interaction was obtained. A probabil ity of P and a probability between P > 0.05 and P are presented as the mean S.E.M. Results Experiment 1 Spontaneous Luteolysis The day effect wa s significant (P < 0.005) for both progesterone concentration and percentage of blood flow in the CL when the normalization was to either the day of ovulation or to the first decrease in progesterone to < 1 ng/ml ( Figure 9 1). The first decrease for the la tter

PAGE 224

224 normalization occurred between Days 2 and 1 for both progesterone (P < 0.004) and percentage of blood flow (P < 0.01). In the validation study, the percentage of maximum value showed an interaction (P < 0.003) between day and the three end points (progesterone concentration, estimated percentage of blood flow, and percentage of colored pixels; Figure 9 2). The interaction was primarily the result of lower (P < 0.05) percentage of maximum for progesterone on Days 1 and 0 than for the two types of b lood flow measurements. There were no significant differences between estimated percentage of blood flow and percentage of colored pixels. Experiment 2 Systemically Induced Luteolysis The interaction of group (treated and control) and hour was signific ant for both progesterone (P < 0.0001) and percentage of CL blood flow (P < 0.001; Figure 9 3). Within the control group, the differences for hour were not significant for either end point but within the treatment group were different (P < 0.0001) for each end point. Progesterone decreased (P < 0.01) within 1 h after treatment with the PGF analogue and percentage blood flow increased (P < 0.005) within 0.5 h. An increase in progesterone between 2 and 3 h posttreatment did not approach significance. Experim ent 3 Locally Induced Luteolysis Progesterone decreased to < 1 ng/ml in all four heifers in the systemic group, but in only one and two heifers treated with 1 mg and 2 mg, respectively, of PGF by the intrauterine route. The intrauterine treated heifers were reassigned into a group with (n = 3) and without (n = 5) CL regression to < 1 ng/ml (responsive and nonresponsive groups, respectively). In the nonresponsive group, progesterone reduction was nil or partial (0 to 37%) between 0 h and 48 h.

PAGE 225

225 In this reg ard, the length of the interovulatory interval was shortened (P < 0.0002) in the systemic group (14 0.6 d) and the intrauterine responsive group (15 0.9 d), but not in the nonresponsive group (22 1.3 d; controls, 20 0.8 d). The group by hour inter action was significant (P < 0.0001) for percentage change in progesterone, percentage of CL with blood flow, and CL area ( Figure 9 4). The negative percentage change in concentrations of progesterone at 24 h and 48 h posttreatment was greater (P < 0.05) in the systemic and intrauterine responsive groups than in the other two groups. Percentage of CL with blood flow signals increased (P < 0.02) between 0 h and 2 h in all PGF treated groups but not in the controls. For percentage of CL with blood flow and for CL area, the values at 24 h and 48 h posttreatment were less (P < 0.05) in the systemic and intrauterine responsive groups than in the controls. Spectral data were missing for one heifer in the intrauterine responsive group, leaving only two heifers in t he group. This group was included in the statistical evaluation of spectral data for the four groups, but was not considered further in the assessments of individual groups. The effect of hour (P < 0.008) and the group by hour interaction (P < 0.05) was si gnificant for the vascular indices (PI, RI), but only the main effects of group (P < 0.007) and hour (P < 0.02) were significant for the relative velocity end points (PSV, TAMV; Figure 9 5). Within groups, excluding the intrauterine responsive group, a pos ttreatment decrease (P < 0.04) in PI and RI occurred between 0 h and 2 h for the nonresponsive group and approached significance (P < 0.1) for the systemic group. The increase between 0 h and 2 h for PSV and TAMV was significant (P < 0.02) for the systemic and intrauterine nonresponsive groups. None of the end points changed significantly between 0 h and 2 h in the control group. At 24 h, RI was higher (P < 0.05) and

PAGE 226

226 PSV and TAMV were lower (P < 0.05) in the systemic group than in the intrauterine nonrespon sive and control groups. Experiment 4 PGFM P ulses Progesterone concentration (P < 0.0001), percentage of CL area with blood flow signals (P < 0.0002), and PGFM concentration (P < 0.01) normalized to progesterone < 1 ng/ml and evaluated at 12 h interval s all showed significant differences among hours ( Figure 9 6). Progesterone concentrations first decreased (P < 0.0007) between Hours 48 and 24 and continued to decrease to Hour 0. Percentage of CL with blood flow signals first decreased (P < 0.01) betwe en Hours 24 and 12. Mean PGFM concentrations increased between Hours 60 and 24, reached maximum at Hour 12, and then decreased. The total number of sets (12 h windows) of samples at hourly intervals obtained from the six heifers during the preluteol ytic, luteolytic, and post luteolytic periods, respectively, was 3, 9, and 1, and number of statistically identified PGFM pulses during the three periods, respectively, was 2, 9, and 0. At least one pulse was obtained in each of the six heifers during the luteolytic period, and the first detected pulse for each heifer was used in the analysis. The remaining three pulses during the luteolytic period and the four pulses for the other periods were handled individually. During the luteolytic period, the percent age of CL area with blood flow normalized to the PGFM peak was different (P < 0.04) among hours. Blood flow increased (P < 0.02) during the 4 h ending at the peak, remained elevated for 2 h, and decreased (P < 0.03) to baseline between 2 h and 3 h after th e peak ( Figure 9 7). Progesterone did not differ significantly during the 7 h associated with the PGFM pulses (not shown). Individual examples of the close relationship of PGFM to blood flow during a 12 h window are shown ( Figure 9 8), including an example in which an apparent nadir rather than a complete pulse was detected.

PAGE 227

227 Discussion The estimation of percentage of CL area with blood flow signals during real time scanning of the entire CL was a useful and convenient end point. The information was obtain ed in about 1 min of intrarectal manipulations of the transducer compared to about 5 min for the spectral based end points (PI, RI, PSV, TAMV). Owing to the shorter time, estimation of percentage of area with blood flow signals was presumably less stressfu l to the animal. The blood flow estimates were validated in the first five heifers by the close agreement with the counting of pixels in a still image. The comparisons of results between color flow and spectral end points in Experiment 3 provided further c onfidence in the use of the percentage estimate of blood flow. The percentage technique has been validated for the equine CL as done in Experiment 1 for bovine CL and also by close agreement between two operators working independently (Ginther et al. 2006 200 7 b) It was reported in an abstract ( Shirasuna et al. 2004 ) that progesterone reduction during spontaneous luteolysis in cattle was associated initially with an increase in luteal blood flow, based on sampling and examining every 12 h. A subsequent st udy in mares did not find a similar phenomenon ( Ginther et al. 2007 b ) and therefore Experiment 1 was done to confirm the cattle results. The present study used heifers and the reported study used cows, but other protocol aspects were similar. Neither 24 h intervals between examinations at a blood velocity setting of 10 cm/sec (Experiment 1) nor a 12 h interval at a setting of 6 cm/sec (Experiment 4) confirmed the reported results. As expected, normalization to the time progesterone decreased to < 1 ng/ml p rovided a more concise mean pattern of luteolysis than for the ovulation reference point; a significant decrease occurred in 1 d versus 2 d for the two approaches, respectively. That is, mean concentration decreased more gradually and more variably when ov ulation and presumably

PAGE 228

228 the previous estrus, as used in the reported study, were the reference points. However, neither normalization to ovulation nor to progesterone < 1 ng/ml in Experiment 1 confirmed that an initial increase in blood flow was associated with luteolysis in cattle. Because of the conflicting results between the reported and present data for spontaneous luteolysis, Experiment 2 was done to confirm the report (Acosta et al. 2002) that systemic administration of cloprostenol, a PGF analog, ca used an increase in CL blood flow in association with the initiation of luteolysis in cattle; a subsequent study did not find a similar posttreatment event in mares (Ginther et al. 2006 ) The reported results in cattle were well confirmed. The two species differ in that uterine induced luteolysis involves direct or local delivery of the luteolysin from the uterus to the ovary in cattle and apparent systemic delivery in horses ( Ginther 1998 b ) Therefore, it seemed likely that cattle may be more influenced by presumptive secondary effects of a systemic injection of PGF, which could explain the species difference of an increase in luteal blood flow after a systemic injection of PGF in cattle but not in horses. In Experiment 3, PGF was given locally by intrauter ine administration of a low dose ( Inskeep 1973 ) in an attempt to preclude the hypothetical secondary effect of systemic treatment. However, the intrauterine route resulted in an increase in CL blood flow at the first posttreatment examination (2 h) that wa s not significantly different from the response to the systemic route. Furthermore, the intrauterine route was effective in inducing increased CL blood flow regardless of whether the treatment induced luteolysis. That is, blood flow increased even in the 5 of 8 intrauterine treated heifers with no or only a partial decrease in progesterone. It appears that a PGF induced increase in luteal blood flow did not assure the initiation of a cascade of events leading to a progesterone decrease to < 1 ng/ml (luteoly sis). That is, blood flow regulation in the CL seemed more sensitive than regression of the CL to the stimulation of exogenous PGF.

PAGE 229

229 The finding of an initial stimulatory effect of intrauterine administration of PGF on estimated percentage of CL area with blood flow was also supported by the spectral Doppler end points. Significant changes in values for the spectral end points did not occur in the controls. The vascular indices of PI and RI were altered as effectively by the intrauterine route as by the sy stemic route. The decrease in the indices indicated more vascular perfusion or decreased resistance to blood flow in the tissues downstream from the point of assessment ( Ginther & Utt 2004, Zwiebel & Pellerito 2005) Between 2 h and 24 h, the vascular indi ces increased in the systemic group and apparently in the intrauterine group that responded with luteolysis. This result is attributable to luteal regression as indicated by the decrease in CL area. The relative blood velocities (PSV, TAMV) increased betwe en 0 h and 2 h in heifers treated by either the systemic or intrauterine routes, a result that is compatible with the increase in percentage blood flow in the CL. The continuation of the elevation in relative velocities in the intrauterine groups at 24 h, despite the associated increase in vascular resistance, was not expected and will require confirmation and specific study of the underlying mechanism. The apparent enigma of increased CL blood flow from border line luteolytic doses of PGF into the uterus and failure to find an increase during spontaneous luteolysis was studied by hourly blood sampling during 12 h windows each day, encompassing the expected luteolytic period. The hypothesis was supported that elevated blood flow during spontaneous luteolys is increases and decreases in close association with individual PGFM pulses. For the six identified and analyzed pulses during the luteolytic period, blood flow was elevated only for an average of about 4 h during PGFM pulses that occurred about every 12 h Therefore, elevated blood flow involved only about one third of a 12 h interval and would not likely be detected statistically

PAGE 230

230 and reported ( Shirasuna et al. 200 4 ) studies. Luteal blood flow increased during the ascending arm of the PGFM pulse, remained elevated for 2 h after the peak of the pulse, and then decreased. Extensive studies ( Miyamoto et al. 2005, Hayashi et al. 2002, Shirasuna et al. 2004, Ohtani et al. 2004, Acosta & Miyamoto 2004) have indicated that an acute increase in luteal blood flow occurs together with increases in expression of endothelial nitric oxide synthase (eNOS) and secretion of endothelin 1 (ET 1) and angiotensin II (AngII) in the CL during the early stage of luteolysis in cattle. The eNOS synthesizes nitric oxide (NO), a vasodilator; ET 1 and AngII are vaso constrictors. The acute increase in blood flow apparently is induced by NO, and the increased blood flow is a proposed trigger for the luteolytic cascade. The present studies concerned only the temporal relationships among PGFM, CL blood flow, and luteolys is. Cause and effect relationships were not studied, but the temporal results are compatible with a proposed role for NO in increasing luteal blood flow and a resultant triggering of luteolysis. However, the role of vasodilators in initiating the luteolyti c process needs to be further studied with consideration of the present finding that increases in CL blood flow during the luteolytic period are temporally associated with individual PGFM pulses, including a decrease in flow after the PGFM peak. Inspection of blood flow results in individual heifers indicated that the increase and decrease in flow occurred in temporal association with each successive pulse; however, data were restricted by the 12 h windows and were too limited for studying the apparent repe atability for successive pulses, critically. A decrease in blood flow after a PGFM peak and an apparent increase again during the ascending arm of a subsequent pulse was noted within two of three sets of hourly examinations with adequate information. The f inding that some animals responded to intrauterine PGF treatment

PAGE 231

231 with an increase in luteal blood flow, but not a decrease in progesterone, could be related to a requirement of sequential PGF pulses and the associated blood flow responses before progestero ne decreases. The pulse flow relationship during the preluteolytic period was not characterized. Another aspect that will require specific study with larger number of animals and pulses is the immediate temporal relationship between a pulse and hypothetica l progesterone fluctuations. In conclusion, an initial increase in CL blood flow occurred during luteolysis induced by systemic or intrauterine administration of PGF. However, a previous report that increased CL blood flow is an initial component of spont aneous luteolysis was not confirmed when blood sampling and Doppler examinations were done every 12 h or 24 h. The novel finding in the present study was an increase in CL blood flow area during the ascending portion of a PGFM pulse, followed by a return t o basal blood flow beginning 2 h af ter the peak of the PGFM pulse.

PAGE 232

232 Figure 9 1. Mean ( SEM) concentration of progesterone and percentage of corpus luteum area with blood flow signals during spontaneous luteolysis (n=10). Data were normalized to the ov ulation preceding luteolysis (upper panel) and to the first day progesterone decreased to < 1 ng/ml (lower panel). The day effect was significant for each end point in each panel. yz = first days of a decrease (P<0.05) between means within an end point. Ex periment 1.

PAGE 233

233 Figure 9 2. Means ( SEM) for validation of blood flow estimation by using percentage of maximum value within each heifer for three end points (n=5). Estimated percentage of the area of the corpus luteum with color signals was compared to number of colored pixels for a still image. There were no significant differences in the comparison of the two blood flow evaluation methods. ab = means within a day that are different (P<0.05). Experiment 1.

PAGE 234

234 Figure 9 3. Mean ( SEM) progesterone conc entration and percentage of luteal area with blood flow signals in a prostaglandin treated group and controls (n=4). Cloprostenol, a PGF 2 analogue, was given in a single systemic (i.m.) injection 10 days after ovulation. Progesterone and percentage of blood flow each differed significantly among hours in the treated group but not in the controls. wx = increase (P<0.05) between means in blo od flow. yz = decrease (P<0.05) between means in progesterone. Experiment 2.

PAGE 235

235 Figure 9 4. Means ( SEM) for progesterone and luteal responses to a systemic (25 mg; n=4) or intrauterine (IU; 1 or 2 mg) injection of PGF 2 10 days after ovulation. The IU treated heifers were divided into a luteal responsive group (n=3) and a nonresponsive group (n=5). Blood flow increased (P<0.05) between 0 and 2 h post treatment in all PGF 2 treated groups. There were no significant blood flow changes in the controls. abc = differences (P<0.05) between groups within an hour. Experiment 3.

PAGE 236

236 Figure 9 5. Means ( SEM) for spectral Doppler responses to systemic (25 mg; n=4) and intrauterine (IU; 1 or 2 mg) injection of PGF 2 10 days after ovulation. The IU treated heifers w ere divided into a luteal responsive group (progesterone decrease to < 1 ng/ml; n=2) and a nonresponsive group (n=5). Between 0 and 2 h, vascular indices (RI, PI) decreased (P<0.05) and relative blood velocities (PSV, TAMV) increased (P<0.05) in the system ic and IU nonresponsive groups; the responsive group was not analyzed because only two heifers were available. The changes in controls were not significant. ab = differences (P<0.05) between groups at 24 h within an end point. Experiment 3.

PAGE 237

237 Figure 9 6 Mean ( SEM) concentration of progesterone and PGFM and percentage of corpus luteum with blood flow signals at 12 h intervals in association with spontaneous luteolysis during the luteolytic period (n=6). wx = increase (P<0.05) between means for PGFM. yz = decrease (P<0.05) between means for progesterone and blood flow. Experiment 4.

PAGE 238

238 Figure 9 7. Mean ( SEM) concentration of PGFM for PGFM pulses and associated changes in percentage of corpus luteum with blood flow signals during the luteolytic period (n=6). wx = increase (P<0.05) between means in blood flow. yz = decrease (P<0.05) between means in blood flow. Experiment 4.

PAGE 239

239 Figure 9 8. Four selected individual examples from the luteolytic period for PGFM concentration and percentage of corpus lut eum with blood flow signals during sets of sampling every hour for 12 h. The statistically defined peak of a PGFM pulse is indicated by an asterisk (A,B,C). The examples were selected to illustrate the following: A) a concomitant increase in blood flow and PGFM concentrations during the ascending portion of a PGFM pulse; B) a relatively small PGFM pulse; C) the descending portion of an apparent indefinable PGFM pulse at the beginning of a set of samples followed by a decrease in blood flow; D) a distinct bl ood flow nadir between an indefinable PGFM pulse at each end of the set of samples. Experiment 4.

PAGE 240

240 CHAPTER 10 GENERAL DISCUSSION This dissertation focused o n the vascular and architectural changes in the reproductive tract of mares and cows. A noninvasiv e technique, ultrasonography, was utilized to assess organ and gross tissue morphology and blood flow respectively by regular mode (B mode) or Doppler mode in a temporal series of experiments in cows and horses In addition, tissue samples from the endom etrium were collected from mares for more detailed studies of architectural and vascular changes of the estrous cycle and early pregnancy using histological techniques and also for molecular analysis of protein location and gene expression of the vascular endothelial growth factor system. The reproductive tract of mammals undergoes very active cyclic tissue remodeling throughout reproductive life. Th ese dynami c changes reflect rhythmic events occurring within the hypothalamic pituitary ovarian axis with ac tions on the reproductive tract controlled t he ovarian produced steroids During these dynamic changes, e ntire structures or tissue layers are form ed reach functional maturity and, after a short lifespan (days) gradually decline in functionality and in some cases, disappear ing completely. However, during pregnancy, this cyclic control of remodeling is interrupted and a new prolonged remodeling process favoring pregnancy start s During pregnancy, the conceptus has a central role in modulati on of the re productive tract morphological and vascular changes. A ngiogenesis is well known to be critical to assure blood supply to any kind of tissue growth and remodeling. In pregnancy, the angiogenic process transcends its primary role of local blood suppl y during tissue development t o another very important function ; that is to form a complex vascular system in the placenta

PAGE 241

241 The experimental models used in this dissertation were carried out in large animals in mares and cows. Specifically in mares, the conceptus is a spherical vesicle in a mobile intrauterine phase followed by a localized and fixed positioning. This specie permits easily injection of substances in the uterine lumen, or injection and aspiration of microaliquots of yolk sac fluid, and permits easil y collection of endometrial biopsies. The option of transrectal route for reproductive exams and the size of the organs in these large animal species facilitate an intimate contact between the ultrasound probe with any part of the reproductive tract favori ng the acquisition of detailed images. Another advantage of large animal experimental models compared with laboratory animal models is the ability to collect data from the reproductive tract in a noninvasive way and in temporal sequential series. In this d issertation Doppler ultrasonography was used to study early pregnancy in mares in Chapters 3 to 5, early pregnancy in cows in Chapter 7, preovulatory follicles of mares in Chapter 8, and the luteoly tic process in cows in Chapter 9. Our studies were the fir st in the literature to use the color mode of Doppler ultrasonography to assess blood flow in the uterus of mares and cows In spite of the subjectivity of the color Doppler evaluation during score d system evaluations we have demonstrated in all of our ex periments with the use of objective validation methods that this technique is reliable and precise in detecti ng small variations in blood flow. This early indicator which consists of a colored spot in the endometrium close to the wall of the embryonic pol e and its detection is a good example of the sensitivity of the technique Based on the early indicator, it was possible to map the position of the embryonic disc from the day of fixation of the embryonic vesicle until visualization of the embryo proper. T he embryonic disc is a very active developmental area and the vascular system is the first organ system to be formed during embryogenesis. More detailed studies should be done to identify the exact origin

PAGE 242

242 of th is early indicator or Doppler signals observed in our study It could reflect endometrial blood flow stimulated by embryonic factors which stimul ate vessels in this area of intimate contact through a paracrine action Another possibility is that the early indicator is formed by contractions of the car diac muscle cells at the embryonic disc area even before their organization as a heart. Doppler ultrasonography detects signals produced by structures in movement. C ontraction of the embryonic cardiac cells interacti ng with tissues in the immediate area ma y be sufficiently strong to create tissue movement produci ng the observed Doppler echoes. In mares, transient changes in endometrial vascularity accompanied conceptus location changes during the mobility phase and c ontinued presence of the conceptus in the same horn (7 min average) stimulated an increase in vascularity (Chapter 3) After fixation, endometrial vascularity was higher in the endometrium surrounding the fixed conceptus, than in other areas of the ipsilateral horn, or in the opposite horn. Diffe rential dorsal thickening of the endometrium preceded embryonic orientation (Chapters 3 and 4) Based on our studies assessing uterine blood flow during early pregnancy of mares and cows with color Doppler and in the previous studies which other authors us ed others techniques to assess uterine blood flow in cows, sows and ewes, Equids exhibited the most precocious increase in uterine perfusion during early pregnancy. Uterine blood flow changes started to be detected on Day 12 of pregnancy. Two distinct mech anisms could be collaborating to stimulate the increase in uterine vascular perfusion during early pregnancy in mares and these two mechanisms are probably related to two distinct phases of early pregnancy in E quids; the mobility phase and post fixation ph ase of the embryonic vesicle. We suggest that the embryonic vesicle could stimulate v asod ilation and angiogenesis in the endometrium. These two processes are probably combined. However, during mobility phase transient rapid changes in uterine blood flow w ere shown to be related to location of the

PAGE 243

243 embryonic vesicle in the uterus. Slight e ncroachment of the dorsal endometrial was detected during the final days of mobility phase. These results suggest that the rapid transient changes in uterine blood flow ref lect vasodilation of blood vessels in the endometrium. More research is necessary to determine which factors provoke th is kind of stimulation. The vesicle produc e large amounts of estrogens and prostaglandins at this time and these hormones could be involv ed in vasodilatory mechanisms. In addition, physic ochemical interaction of the embryonic vesicle capsule with the endometri al luminal epithelium during conceptus movement may be also considered as a possible factor of stimulation Angiogenesis is also like ly present toward the end of the mobility phase based on the initial dorsal endo metrial encroachment and slight increase in endometrial perfusion observed at this time. This idea is further supported by results of the morphometric study (Chapter 6) which d emonstrated increased growth of blood vessels, as well as increased angiogenic factors, in the endometrium adjacent to the fixated conceptus. After fixation, the increase in blood flow and encroachment of the dorsal endometrium is dramatic. Presumably, mos t of the vascular stimulant factors produced by the embryonic vesicle are highly localized at the site of fixation. Our findings suggest that while presumptive vasodilation occurs during the mobility phase, the predominan t angiogenic stimulus occur s post fixation. In Chapter 6 of this dissertation morphology of the endometrium at the site of fixation as well as involvement of the VEGF receptors system in the tissue remodeling required to stimulate encroachment of the dorsal endometrium onto the conceptus w ere studied The dorsal endometrium at the site of conceptus fixation was edematous and richly vascularized, exhibiting a high density of blood vessels and endometrial glands. A more detailed study is necessary to identify the specific signals produced and released by the conceptus to stimulate angiogenesis.

PAGE 244

244 Orientation of the embryonic vesicle occurred immediately after fixation (Chapter 4). Embryonic dysorientation was associated with a flaccid uterus and defective encroachment of the dorsal endometrium. Asymmetric enlargement of the allantoic sac spontaneously corrected dysorientation (Chapter 5 ). Adherence points were found between the yolk sac surface and the dorsal endometrium (Chapter 6 ). These are new findings showing step by step the dynamic interac tion s between the embryonic vesicle and the uter ine wall for the express purpose of aligning the future site of umbilical cord formation to the richest vascular area, the dorsal endometrium and mesometrium O rientation of the embryonic disc in the ventral endometrial area permits direct contact of the bilaminar layer of the yolk sac at the abembryonic pole with the richest glandular and vascularized area of the endometrium This positioning favor s embryo matern al ex change guarant eeing survival and developme nt of the early conceptus. It is interesting to observe in Equids that the embryo proper forms ventrally but during development of the allantois is translocate d to the dorsal area, the richest endometrial area. At this position, the umbilical cord develops We have observed that abnormal orientation normally terminates the pregnancy but, in two specific cases when the uterus present ed slight tone, the embryonic vesicle s were able to correct their orientation by continuing to expand the yolk sac allantois bo undary until it impinged on the dorsal endometrium, permitting formation of the umbilical cord in the correct position. A dherence points on the surface of the conceptus, specifically the bilaminar layer of the yolk sac, are important to maintain conceptus orientation. S tudies of the composition of the equine capsule have demonstrated carbohydrate changes during early pregnancy. However, visualization of the adherence points o n the yolk sac surface offers a more specific area with which to study biochemical interactions between the surface of the capsule and the endometri al luminal epithelium.

PAGE 245

245 U terine vascularity in pregnant heifers increased in the horn ipsilateral to the conceptus from Days 19 to 40. Vascularity of the contralateral horn remained low until Day 32, when it began to rise, reaching vascularity approximately similar to the ipsilateral horn around Day 40. The increase in vascularity occurred temporally with allantoic sac development in each uterine horn ( Chapter 7) The conceptus of ruminants doe s not have a mobility phase as in E quids but instead undergoes elongat ion into the uterine lumen during early gestation E longation of ruminant conceptuses is an important developmental process for maternal recognition of pregnancy and may serve to provid e nutrient availability as well. E arly uterine vascular changes in mares and cows were distinct. Des pite the delay in stimulation of the uterine perfusion in cows compared with mares an intimate temporal association between the increase in endometrial vas cular perfusion and the development of the allantoic sac was observed As the allantoic sac membrane forms, it fuses with the chorion forming the allantochorion placenta. Our results indicate that the increase in endometrial perfusion coincides with presum ptive physicochemical interactions between the conceptus and the endometrium. More detailed morphological and molecular studies are necessary to correlate endometrial vascular development with the process of placentation in cows. In cows, corpus luteum blo od flow increased and decreased with the individual PGFM pulses during spontaneous luteolysis. Induction of increased CL blood flow by prostaglandin did not assur e the occurrence of luteolysis (Chapter 9) This work demonstrated that : 1) exogenous and endo genous prostaglandin is associated with acute increase in blood flow of the corpus luteum 2) that the increase do es not guarantee complete luteo lys i s and 3) that a series of pulses of prostaglandins is associated with complete luteolysis The experiments presented in this chapter confirmed the suggestions from previous works that the increase in blood flow in the

PAGE 246

246 corpus luteum precedes the initial stages of luteolysis and also confirm the reliability of this technique as potential tool in the monitoring o f this process. Increase in blood flow in many different tissues has been correlated with increase in prostaglandin secretion and estrogens. These experiments provided the technical foundation for more detailed studies about the physiological mechanisms in volved in the luteolysis. The first field applied study in the literature about the use of Doppler ultrasound technology in reproduction of large animals is presented in Chapter 8. It was shown that g reater blood flow to the preovulatory follicle is associ ated with higher pregnancy rate i n mares This study is the first to help in the popularization of the use of this technology among large animal veterinarians working with reproducti on One big limitation to the spread of this technology is the inverse rel ationship between size and technical capabilities of the Doppler machine. P owerful portable machines are now available in the market and will help bring this technology to practical application. However, price is still a limitation Based on the presented results in Chapter 8, it was not possible to determine if high perifollicular blood flow direct ly a ffects oocyte quality or whether it a ffects the overall intrafollicular environment This study was very simple and set the stage for future studies. Recentl y, a similar study was done in cows confirming the results found in this study in mares (Siddiqui et al. 2008 ) In addition, the same group of researchers used this technique in cows before follicle aspiration for in vitro maturation and fertilization and they obtained better results of embryonic development with the oocytes from preovulatory follicles presenting high blood perfusion at the time of the aspiration (Siddiqui et al. 2009 ) M odulation of the uterine vascular system by the conceptus includes two very distinct and balanced events. The first event consists of stimulation of the uterine architectural and

PAGE 247

247 vascular system changes. From the earliest stages of pregnancy to its culmination, the conceptus presumably releases factors driving t issue changes in the uterus including vascular remodeling, to favor survival and development. However, equally important is the need to limit these uterine changes to prevent overdevelopment. Such may be the case with large offspring syndrome, for example, in which ab normalities in placental vascularization are observed. This dissertation ha s focused o n the understanding of certain cellular and molecular aspects involved in uterine changes during early pregnancy Many questions arise, such as whether tissue and vascula r remodeling during pregnancy is self limited or whether this process is mediated by conceptus produced factor s The processes involved in tissue remodeling of the pregnant uterus and in abnormal conditions of tissue growth, as cancer are similar in appear ance However, during pregnancy tissue growth is limited or controlled in contrast to pathological conditions such as cancer These thoughts set the stage for a more comple te future of investigation. K nowledge of the mechanism s which regulate angiogenic an d tissue remodeling of pregnancy would represent an enormous advance in science Understanding the mechanisms regulating angiogenesis and tissue remodeling in the pregnant reproductive tract will help in t he development of therapies for pathological condit ions which exhibit abnormal tissue growth. In summary, the data from this dissertation provided insight into the architectural and molecular change s in the reproductive tract of Equids and B ovids. These results set the stage for future experiments to under stand more completely : 1) t he role of the conceptus in regulating the uterine environment to favor its development includ ing understanding the balance in stimulating and limiting uterine architectural and vascular changes, 2) t he role of vascular changes in the regulation of physiological processes in the reproductive tract during cyclicity and pregnancy,

PAGE 248

248 and 3) t he role of blo od flow changes as a practical diagnostic measurer of normal organ and tissue functionality

PAGE 249

249 LIST OF REFERENCES Abrams RM, Sharp DC 1977 Heat flow technique for estimating uterine blood flow. Biol Reprod 16 281 285. Acosta TJ, Beg MA, Ginther OJ 2004a Aberrant blood flow area and plasma gonadotropin concentrations during the development of dominant sized transitional anovulatory fo llicles in mares. Biol Reprod 71 637 642. Acosta TJ, Gastal EL, Gastal MO, Beg MA, Ginther OJ 2004b Differential blood flow changes between the future dominant and subordinate follicles precede diameter changes during follicle selection in mares. Biol Repr od 71 502 507. Acosta TJ, Hayashi KG, Matsui M, Miyamoto A 2005 Changes in follicular vascularity during the first follicular wave in lactating cows. J Reprod Dev 51 273 280. Acosta TJ, Hayashi KG, Ohtani M, Miyamoto A 2003 Local changes in blood flow with in the preovulatory follicle wall and early corpus luteum in cows. Reproduction 125 759 767. Acosta TJ, Miyamoto A 2004 Vascular control of ovarian function: ovulation, corpus luteum formation and regression. Anim Reprod Sci 82 83 127 140. Acosta TJ, Yoshi zawa N, Ohtani M, Miyamoto 2002 Local changes in blood flow within the early and midcycle corpus luteum after prostaglandin F2 injection in the cow. Biol Reprod 66 651 658. Adams GP, Kastelic JP, Bergfelt DR, Ginther OJ 1987 Effect of uterine inflammation and ultrasonically detected uterine pathology on fertility in the mare. J Reprod Fertil Suppl 35 445 454.

PAGE 250

250 Albrecht ED, Aberdeen GW, Niklaus AL, Babischkin JS, Suresch DL, Pepe G 2003 Acute temporal regulation of vascular endothelial growth/permeability f actor expression and endothelial morphology in the baboon endometrium by ovarian steroids. J Clin Endo Metabol 88 2844 2852. Allen WR, Gower S, Wilsher S 2007 Immunohistochemical localization of vascular endothelial growth factor (VEGF) and its two recepto rs (Flt I and KDR) in the endometrium and placenta of the mare during the oestrous cycle and pregnancy. Reprod Domest Anim 42 516 526. Allen WR, Stewart F 2001 Equine placentation. Reprod Fertil Dev 13 623 634. Al Ramadan SY, Johnson GA, Jaeger LA, Brinsko SP, Burghardt RC 2002 Distribution of integrin subunits, MUC 1, and osteopontin in equine uterine epithelium and conceptuses during early pregnancy. Biol Reprod 66 Suppl;Abstract 555; 323. Amoroso EC tion Volume 2. 3 rd edition. pp 127 311. Edited by: Parkes AS. London: Logmans Green and Co. Anderson SG, Hackshaw BT, Still JG, Greiss FC Jr 1977 Uterine blood flow and its distribution after chronic estrogen and progesterone administration. Am J Obstet Gy necol 127 138 142. Anteby EY, Greenfield C, Natanson Yaron S, Goldman Wohl D, Hamani Y, Khudyak V, Ariel I, Yagel S 2004 Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor 4 and 10 stimulate trophoblast plasminogen ac tivator system and metalloproteinase 9. Mol Hum Reprod 10 229 235. Arar S, Chan KH, Quinn BA, Waelchli RO, Hayes MA, Betteridge KJ, Monteiro MA 2007 Desialylation of core type 1 O glycan in the equine embryonic capsule coincides with immobilization of the conceptus in the uterus. Carbohydrate Res 342 1110 1115.

PAGE 251

251 Arosh JA, Banu SK, Chapdelaine P, Madore E, Sirois J, Fortier MA 2004 Prostaglandin biosynthesis, transport, and signaling in corpus luteum: a basis for autoregulation of luteal function. Endocrino logy 145 2551 2560. Battut I, Colchen S, Fieni F, Tainturier D, Bruyas JF 1997 Success rates when attempting to nonsurgically collect equine embryos at 144, 156 or 168 hours after ovulation. Equine Vet J Suppl 25 60 62. Bausero P, Cavaill F, Mduri G, Fre itas S, Perrot Applanat M 1998 Paracrine action of vascular endothelial growth factor in the human endometrium: production and target sites, and hormonal regulation. Angiogenesis 2 167 182. Bazer FW, Slayden OD 2008 Progesterone induced gene expression in uterine epithelia: a myth perpetuated by conventional wisdom. Biol Reprod 79 1008 1009. Bergfelt DR, Kulick LJ, Kot K, Ginther OJ 2000 Follicular and hormonal response to experimental suppression of FSH during follicle deviation in cattle. Theriogenology 5 4 1191 1206. Betteridge KJ 2006 Farm animal embryo technologies: Achievements and perspectives. Theriogenology 65 905 913. Betteridge KJ, Eaglesome MD, Mitchell D, Flood PF, Beriault R 1982 Development of horse embryos up to twenty two days after ovulation : observations on fresh specimens. J Anat 135 191 209. Betteridge KJ, Flchon J E 1988 The anatomy and physiology of pre attachment bovine embryos. Theriogenology 29 155 187. Betteridge KJ, Waelchli RO 2005 Equine embryo encapsulation; ephemeral, essentia l and enigmatic. In Proceedings of the Third Havemeyer Workshop on Maternal Recognition of Pregnancy in the Mare. R&W Communications: Newmarket 59 61.

PAGE 252

252 Bhal PS, Pugh ND, Chui DK, Gregory L, Walker SM, Shaw RW 1999 The use of transvaginal power Doppler ultr asonography to evaluate the relationship between perifollicular vascularity and outcome in in vitro fertilization treatment cycles. Hum Reprod 14 939 945. 2001 Perifollicular vascularity as a potential variab le affecting outcome in stimulated intrauterine insemination treatment cycles: a study using transvaginal power Doppler. Hum Reprod 16 1682 1689. Bigsby RM 2002 Control of growth and differentiation of the endometrium: the role of tissue interactions. Ann New York Acad Sci 955 110 117. Bollwein H, Baumgartner U, Stolla R 2002a Transrectal Doppler sonography of uterine blood flow in cows during pregnancy. Theriogenology 57 2053 2061. Bollwein H, Kolberg B, Stolla R 2004b The effect of exogenous estradiol ben zoate and altrenogest on uterine and ovarian blood flow during the estrous cycle in mares. Theriogenology 61 1137 1146. Bollwein H, Maierl J, Mayer R, Stolla R 1998 Transrectal color Doppler sonography of the A. uterina in cyclic mares. Theriogenology 49 1 483 1488. Bollwein H, Mayer R, Stolla R 2003 Transrectal Doppler sonography of uterine blood flow during early pregnancy in mares. Theriogenology 60 597 605. Bollwein H, Mayer R, Weber F, Stolla R 2002b Luteal blood flow during the estrous cycle in mares. Theriogenology 57 2043 2051. Bollwein H, Meyer HH, Maierl J, Weber F, Baumgartner U, Stolla R 2000 Transrectal Doppler sonography of uterine blood flow in cows during the estrous cycle. Theriogenology 53 1541 1552. Bollwein H, Weber F, Kolberg B, Stolla R 2002a Uterine and ovarian blood flow during the estrous cycle in mares. Theriogenology 57 2129 2138.

PAGE 253

253 Bollwein H, Weber F, Wosche I, Stolla R 2004a Transrectal Doppler sonography of uterine and umbilical blood flow during pregnancy in mares. Theriogenology 61 499 509. Borini A, Maccolini A, Tallarini A, Bonu MA, Sciajno R, Flamigni C 2001 Perifollicular vascularity and its relationship with oocyte maturity and IVF outcome. Ann N Y Acad Sci 943 64 67. Bourlev V, Volkov N, Pavlovitch S, Lets N, Larsson A, Olo vsson M 2006 The relationship between microvessel density, proliferative activity and expression of vascular endothelial growth factor A and its receptors in eutopic endometrium and endometriotic lesions. Reproduction 132 501 509. Burton GJ, Jauniaux E, C harnock Jones DS 2007 Human early placental development: potential roles of the endometrial glands. Placenta 28 Suppl A S64 S69. Burton GJ, Watson AL, Hempstock J, Skepper JN, Jauniaux E 2002 Uterine glands provide histiotrophic nutrition for the human fet us during the first trimester of pregnancy. J Clin Endocrinol Metab 87 2954 2959. Cadario ME, Thatcher WW, Klapstein E, Merrit AM, Archbald LF, Thatcher MJ, LeBlanc MM 1999 Dynamics of prostaglandin secretion, intrauterine fluid and uterine clearance in r eproductively normal mares and mares with delayed uterine clearance. Theriogenology 52 1181 1192. Callaghan DO, Yaakub H, Hyttel P, Spicer LJ, Boland MP 2000 Effect of nutrition and superovulation on oocyte morphology, follicular fluid composition and syst emic hormone concentrations in ewes. J Reprod Fertil 118 303 313. Carmeliet P 2005 Angiogenesis in life, disease and medicine. Nature 438 932 936.

PAGE 254

254 Carmeliet P, Moons L, Luttun A, Vincenti V, Compernolle V, De Mol M, Wu Y, Bono F, Devy L, Beck H, Scholz D, Acker T, DiPalma T, Dewerchin M, Noel A, Stalmans I, Barra A, Blacher S, Vandendriessche T, Ponten A, Eriksson U, Plate KH, Foidart JM, Schaper W, Charnock Jones DS, Hicklin DJ, Herbert JM, Collen D, Persico MG 2001 Synergism between vascular endothelia l growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions. Nat Med 7 575 583. Carnevale EM, Ginther OJ 1992 Relationships of age to uterine function and reproductive efficiency i n mares. The riogenology 37 1101 1115. Caton D, Abrams RM, Clapp JF, Barron DH 1974 The effect of exogenous progesterone on the rate of blood flow of the uterus of ovariectomized sheep. Q J Exp Physiol Cogn Med Sci 59 225 231 Caton D, Kalra PS 1986 Endogenous hormones and regulation of uterine blood flow during pregnancy. Am J Physiol 250 R365 369. Charnock Jones DS, Clark DE, Licence D, Day K, Wooding FB, Smith SK 2001 Distribution of vascular endothelial growth factor (VEGF) and its binding sites at the maternal fetal interface during gestation in pigs. Reproduction 122 753 60. Charnock Jones DS, Kaufmann P, Mayhew TM 2004 Aspects of human fetoplacental vasculogenesis and angiogenesis. I. Molecular regulation. Placenta 25 103 113. Charnock Jones DS, Sharkey AM, Rajput Williams J, Burch D, Schofield JP, Fountain SA, Boocock CA, Smith SK 1993 Identification and localization of alternately spliced mRNAs for vascular endothelial growth factor in human uterus and estrogen regulation in endometrial carcinoma cell lines. Biol Reprod 48 1120 1128. Chebel RC, Santos JE, Reynolds JP, Cerri RL, Juchem SO, Overton M 2004 Factors affecting conception rate after artificial insemination and pregnancy loss in lactating dairy cows Anim Reprod Sci 84 239 2 55

PAGE 255

255 Chebel RC, Santos JEP, Cerri RLA, Galvao KN, Juchem SO, Thatcher WW 2003 Effect of resynchronization with GnRH on day 21 after artificial insemination on pregnancy rate and pregnancy loss in lactating dairy cows. Theriogenology 60 1389 1399. Chenault JR 1980 Steroid metabolism by the earl y bovine conceptus reduction of neutral C19 steroids. J Steroid Biochem 13 499 506. Chennazhi KP, Nayak NR 2009 Regulation of angiogenesis in the primate endometrium: vascular endothelial growth factor. Semin Reprod Med 27 80 98. Chu JW, Sharom FJ, Oriol JG, Betteridge KJ, Cleaver BD, Sharp DC 1997 Biochemical changes in the equine capsule following prostaglandin induced pregnancy failure. Mol Reprod Dev 46 286 295. Chui DKC, Pugh ND, Walker SM, Gregory L, Shaw RW 1997 Follicular vascularity the p redictive value of transvaginal power Doppler ultrasonography in an in vitro fertilization programme: a preliminary study. Hum Reprod 12 196 196. Cleaver O, Melton DA 2003 Endothelial signaling during development. Nat Med 9 661 668. Conover WJ 1999 Practic al nonparametric statistics. 3rd edition, New York, NY: John Wiley & Sons, Inc. Conway EM, Collen D, Carmeliet P 2001 Molecular mechanisms of blood vessel growth. Cardiovasc Res 49 507 521. Coulam CB, Goodman C, Rinehart JS 1999 Colour Doppler indices of f ollicular blood flow as predictors of pregnancy after in vitro fertilization and embryo transfer. Hum Reprod 14 1979 1982. Cross DT, Ginther OJ 1988 Uterine contractions in nonpregnant and early pregnant mares and jennies as determined by ultrasonography. J Anim Sci 66 250 254. Cross MJ, Claesson Welsh L 2001 FGF and VEGF function in angiogenesis: signalling pathways, biological responses and therapeutic inhibition. Trends Pharmacol Sci 22 201 207.

PAGE 256

256 Cross MJ, Dixelius J, Matsumoto T, Claesson Welsh L 2003 VE GF receptor signal transduction. Trends Biochem Sci 28 488 494. Cullinan Bove K, Koos RD 1993 Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen induced incre ases in uterine capillary permeability and growth. Endocrinology 133 829 37. Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V, Ryan TE, Bruno J, Radziejewski C, Maisonpierre PC, Yancopoulos GD 1996 Isolation of angiopoietin 1, a ligand for the TIE2 receptor, by secretion trap expression cloning. Cell 87 1161 1169. Davis SR, Collier RJ 1985 Mammary blood flow and regulation of substrate supply for milk synthesis. J Dairy Sci 68 1041 1058. Denker HW 2000 Structural dynamics and function of early e mbryonic coats. Cells Tissues Organs 166 180 207. Diskin MG, Morris DG 2008 Embryonic and early foetal losses in cattle and other ruminants. Reprod Domest Anim 43 Suppl 2 260 267. Donadeu FX, Ginther OJ 2002 Follicular waves and circulating concentrations of gonadotrophins, inhibin and oestradiol during the anovulatory season in mares. Reproduction 124 875 885. Drost M, Ambrose JD, Thatcher MJ, Cantrell CK, Wolfsdorf KE, Hasler JF, Thatcher WW 1999 Conception rates after artificial insemination or embryo tr ansfer in lactating dairy cows during summer in Florida. Theriogenology 52 1161 1167. Du B, Takahashi K, Ishida GM, Nakahara K, Saito H, Kurachi H 2006 Usefulness of intraovarian artery pulsatility and resistance indices measurements on the day of follicle aspiration for the assessment of oocyte quality. Fertil Steril 85 366 370. Dvorak HF 2005 Angiogenesis: update 2005. J Thromb Haemost 3 1835 1842.

PAGE 257

257 Eklund L, Olsen BR 2006 Tie receptors and their angiopoietin ligands are context dependent regulators of v ascular remodeling. Exp Cell Res 312 630 641. Eliceiri BP, Paul R, Schwartzberg PL, Hood JD, Leng J, Cheresh DA 1999 Selective requirement for Src kinases during VEGF induced angiogenesis and vascular permeability. Mol Cell 4 915 924. Enders AC, Liu IKM 19 91 Lodgement of the equine blastocyst in the uterus from fixation through endometrial cup formation. J Reprod Fertil Suppl 44 427 438. Enders AC, Schlafke S, Lantz KC, Liu IKM 1993 Endoderm cells of the equine yolk sac from Day 7 until formation of the de finitive yolk sac placenta. Equine Vet J Suppl 15 3 9. Epstein AC, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, Mukherji M, Metzen E, Wilson MI, Dhanda A, Tian YM, Masson N, Hamilton DL, Jaakkola P, Barstead R, Hodgkin J, Maxwell PH, Pugh CW, Schofield CJ, Ratcliffe PJ 2001 C. elegans EGL 9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 107 43 54. Ewart JC 1897 A critical period in the development of the horse. Ed. Adam and Charles Black, London. Faber JJ, Thornburg KL 1983 Placental physiology. Structure and function of fetomaternal exchange. New York: Raven. Fan X, Krieg S, Kuo CJ, Wiegand SJ, Rabinovitch M, Druzin ML, Brenner RM, Giudice LC, Nayak NR 2008 VEGF blockade inhibits angiogen esis and reepithelialization of endometrium. FASEB J 22 3571 3580. Ferrara N 2004 Vascular endothelial growth factor: basic science and clinical progress. Endocrine Reviews 25 581 611. Ferrara N 2009 History of discovery: vascular endothelial growth facto r. Arterioscler Thromb Vasc Biol DOI: 10.1161/ATVBAHA.108.179663.

PAGE 258

258 Ferrara N, Gerber H, LeCouter J 2003 The biology of VEGF and its receptors. Nature Medicine 9 669 676. Ferrara N, Henzel WJ 1989 Pituitary follicular cells secrete a novel heparin binding gr owth factor specific for vascular endothelial cells. Biochem Biophys Res Commun 161 851 858. Ferriani RA, Ahmed A, Sharkey A, Smith SK 1994 Colocalization of acidic and basic fibroblast growth factor (FGF) in human placenta and the cellular effects of bFGF in trophoblast cell line JEG 3. Growth Factors 10 259 268. Flood PF, Marrable AW 1973 Steroid metabolism in the feto placental unit of the mare: a histochemical study during midgestation. J Reprod Fertil 35 617 618. Folkman J. 1995 Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 1 27 31. Folkman J. Shing Y 1992 Angiogenesis. J Biol Chem 267 10931 10934. Ford SP 1982c Control of uterine and ovarian blood flow throughout the estrous cycle and pregnancy of the ewe, sow and cow. J Anim Sci 55 Suppl II:32 42. Ford SP 1985 Maternal recognition of pregnancy in the ewe, cow and sow: Vascular and immunological aspects. Theriogenology 23 145 159. Ford SP, Chenault JR 1981 Blood flow to the corpus luteum bearing ovary and ipsilateral horn of co ws during the oestrous cycle and early pregnancy J Reprod Fertil 62 555 562. Ford SP, Chenault JR, Echternkamp SE 1979 Uterine blood flow of cows during the oestrous cycle and early pregnancy: effect of the conceptus on the uterine blood supply J Reprod Fertil 56 53 62. Ford SP, Christenson RK 1979 Blood flow to uteri of sows during the estrous cycle and early pregnancy: local effect of the conceptus on the uterine blood supply. Biol Reprod 21 617 624.

PAGE 259

259 Ford SP, Christenson RK, Ford JJ 1982a Uterine blood flow and uterine arterial venous and luminal concentrations of estrogens on days 11, 13, and 15 after estrus in pregnant and nonpregnant sows. J Reprod Fertil 64 185 190. Ford SP, Reynolds LP, Magness RR 1982b Blood flow to the uterine and ovarian vascular beds of gilts during the estrous cycle or early pregnancy. Biol Reprod 27 878 885. Fraser HM, Dickson SE, Lunn SF, Wulff C, Morris KD, Carroll VA, Bicknell R 2000 Suppression of luteal angiogenesis in the primate after neutralization of vascular endotheli al growth factor. Endocrinology 141 995 1000. Fraser HM, Wilson H, Morris KD, Swanston I, Wiegand SJ 2005 Vascular endothelial growth factor Trap suppresses ovarian function at all stages of the luteal phase in the macaque. J Clin Endocrinol Metab 90 5811 5818. Fujimoto J, Hori M, Ichigo S, Tamaya T 1996 Sex steroids regulate the expression of plasminogen activator inhibitor 1 and its mRNA in fibroblasts derived from uterine endometrium. Ann Clin Biochem 33 545 550. Gastal EL, Donadeu FX, Gastal MO, Ginther OJ 1999 Echotextural changes in the follicular wall during follicle deviation in mares. Theriogenology 52 803 14. Gastal EL, Gastal MO, Donadeu FX, Acosta TJ, Beg MA, Ginther OJ 2007 Temporal relationships among LH, estradiol, and follicle vascularization preceding the first compared with later ovulations during the year in mares. Anim Reprod Sci 102 314 321 Gastal EL, Gastal MO, Ginther OJ 1998 The suitability of echotexture characteristics of the follicular wall for identifying the optimal breeding day i n mares. Theriogenology 50 1025 1038. Gastal EL, Gastal MO, Ginther OJ 2006 Relationships of changes in B mode echotexture and colour Doppler signals in the wall of the preovulatory follicle to changes in systemic oestradiol concentrations and the effects of human chorionic gonadotrophin in mares. Reproduction 131 699 709.

PAGE 260

260 Gastal MO, Gastal EL, Kot K, Ginther OJ 1996 Factors related to the time of fixation of the conceptus in mares. Theriogenology 46 1171 1180. Gerstenberg C, Allen WR, Stewart F 1999a Cell proliferation patterns in the equine endometrium throughout the non pregnant reproductive cycle. J Reprod Fertil 116 167 175. Gerstenberg C, Allen WR, Stewart F 1999b Cell proliferation patterns during development of the equine placenta. J Reprod Fertil 11 7 143 152. Geva E, Jaffe RB 2000 Role of vascular endothelial growth factor in ovarian physiology and pathology. Fertil Steril 74 429 438. Gilbert RO 1992 Cyclical changes in equine endometrial histology. Proc 12th Inter Conf Anim Reprod: The Hague 1867 18 69 (Abstract). Ginther OJ 1981 Local versus systemic uteroovarian relationships in farm animals. Acta Vet Scand Suppl 77 103 115. Ginther OJ 1983a Mobility of the early equine conceptus. Theriogenology 19 603 611. Ginther OJ 1983b Fixation and orientation of the early equine conceptus. Theriogenology 19 613 623. Ginther OJ 1984a Intrauterine movement of the early conceptus in barren and postpartum mares. Theriogenology 21 633 644. Ginther OJ 1984b Postfixation embryo reduction in unilateral and bilateral t wins in mares. Theriogenology 22 213 223. Ginther OJ 1985 Dynamic physical interactions between the equine embryo and uterus. Equine Vet J Suppl 3 41 47. Ginther OJ 1992 Reproductive biology of the mare, basic and applied aspects. 2nd edition, Cross Plai ns, WI, USA: Equiservices Publishing. 1 40, 173 290.

PAGE 261

261 Ginther OJ 1995a Ultrasonic Imaging and Animal Reproduction: Fundamentals. Book 1. Cross Plains, WI: Equiservices Publishing. Ginther OJ 1995b Ultrasonic Imaging and Animal Reproduction: Horses. Book 2. Cross Plains, WI: Equiservices Publishing. Ginther OJ 1998a Equine pregnancy: physical interactions between the uterus and conceptus. Proc Amer Assoc Equine Pract 44 73 104. Ginther OJ 1998b Ultrasonic Imaging and Animal Reproduction: Book 3, Cattle. Cros s Plains, WI, USA: Equiservices Publishing. Ginther OJ 2007 Ultrasonic Imaging and Animal Reproduction: Color Doppler Ultrasonography Book 4. Cross Plains (WI): Equiservices Publishing. Ginther OJ, Beg MA, Gastal EL, Gastal MO, Baerwald AR, Pierson RA 20 05 Systemic concentrations of hormones during development of follicular waves in mares and women: a comparative study. Reproduction 130 : 379 388. Ginther OJ, Garcia MC, Bergfelt DR, Leith GS, Scraba ST 1985 Embryonic loss in mares: Pregnancy rate, length o f interovulatory intervals, and progesterone concentrations associated with loss during days 11 to 15. Theriogenology 24 409 417. Ginther OJ, Gastal EL, Gastal MO, Beg MA 2005b Regulation of circulating gonadotropins by the negative effects of ovarian horm ones in mares. Biol Reprod 73 315 323. Ginther OJ, Gastal EL, Gastal MO, Beg MA 2006 Effect of prostaglandin F2 on ovarian, adrenal, and pituitary hormones and on luteal blood flow in mares. Dom Anim Endocrinol doi:10.1016/j.domaniend.2006.04.006. Ginther OJ, Gastal EL, Gastal MO, Beg MA 2007a Effect of prostaglandin F2alpha on ovarian, adrenal, and pituitary horm ones and on luteal blood flow in mares. Domest Anim Endocrinol 32 315 328

PAGE 262

262 Ginther OJ, Gastal EL, Gastal MO, Bergfelt DR, Baerwald AR, Pierson RA 2004 Comparative study of the dynamics of follicular waves in mares and women. Biol Reprod 71 1105 1201. Gint her OJ, Gastal EL, Gastal MO, Utt MD, Beg MA 2007b Luteal blood flow and progesterone production in mares. Anim Reprod Sci 99 213 220. Ginther OJ, Rodrigues BL, Ferreira JC, Araujo RR, Beg MA 2008 Characterization of pulses of 13,14 dihydro 15 keto PGF2alp ha (PGFM) and relationships between PGFM pulses and luteal blood flow before, during, and after luteolysis in mares. Reprod Fertil Dev 20 684 693. Ginther OJ, Silva LA 2006 Incidence and nature of disorientation of the embryo proper and spontaneous correct ion in mares. J Equi Vet Sci 26 249 256. Ginther OJ, Silva LA, Araujo RR, Beg MA 2007c Temporal associations among pulses of 13,14 dihydro 15 keto PGF2alpha, luteal blood flow, and luteolysis in cattle. Biol Reprod 76 506 513 Ginther OJ, Utt MD 2004 Doppl er ultrasound in equine reproduction: principles, techniques, and potential. J Equine Vet Sci 24 516 526. Ginther OJ, Wiltbank MC, Fricke PM, Gibbons JR, Kot K 1996 Selection of the dominant follicle in cattle. Biol Reprod 55 1187 1194 Ginther OJ, Woody CO, Janakiraman K, Casida LE 1966 Effect of an intrauterine plastic coil on the oestrous cycle of the heifer. J Reprod Fertil 12 193 198. Ginther OJ, Woody CO, Mahajan S, Janakiraman K, Casida LE 1967 Effect of oxytocin administration on the oestrous cycle of unilaterally hysterectomized heifers. J Reprod Fertil 14 225 229. Girling JE, Rogers PAW 2005 Recent advances in endometrial angiogenesis research. Angiogenesis 8 89 99.

PAGE 263

263 Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE 2001 Endom etrial glands are required for preimplantation conceptus elongation and survival Biol Reprod 64 1608 16 13 Greenstein JS, Murray RW, Foley RC 1958 Observations on the morphogenesis and histochemistry of the bovine pre attachment placenta between 16 and 33 days of gestation. Anatomical Rec 132 321 341. Greiss FC Jr, Anderson SG 1969 Uterine vascular changes during the ovarian cycle. Am J Obstet Gynecol 103 629 640. Greiss FC Jr, Anderson SG 1970 Uterine blood flow during early ovine pregnancy. Am J Obstet G ynecol 106 30 38. Griffin PG, Carnevale EM, Ginther OJ 1993 Effects of the embryo on uterine morphology and function in mares. Anim Reprod Sci 31 311 329. Griffin PG, Ginther OJ 1993 Effects of the embryo on uterine morphology and function in mares. Anim R eprod Sci 31 311 329. Griffin PG, Hermenet MJ, Ginther OJ 1992 A transient increase in uterine tone during early diestrus in mares. Theriogenology 37 1185 1190. Guerrin M, Moukadiri H, Chollet P, Moro F, Dutt K, Malecaze F, Plout J 1995 Vasculotropin/vasc ular endothelial growth factor is an autocrine growth factor for human retinal pigment epithelial cells cultured in vitro. J Cell Physiol 164 385 394. Guo D, Jia Q, Song HY, Warren RS, Donner DB 1995 Vascular endothelial cell growth factor promotes tyrosin e phosphorylation of mediators of signal transduction that contain SH2 domains. Association with endothelial cell proliferation. J Biol Chem 270 6729 6733. Hamai Y, Fujii T, Yamashita T, Kozuma S, Okai T, Taketani Y 1995 Evidence for basic fibroblast growt h factor as a crucial angiogenic growth factor, released from human trophoblasts during early gestation. Placenta 19 149 155.

PAGE 264

264 Han G, Magee T, Khorram O 2005 Regulation of nitric oxide synthase isoforms by estrogen in the human endometrium. Fertil Steril 84 Suppl 2 1220 1227. Hayashi K, Tanaka J, Hayashi G, Hayashi M, Ohtani M, Miyamoto A 2002 The cooperative action of angiotensin II with subluteolytic administration of PGF2 in inducing luteolysis and oestrus in the cow. Soc Reprod Fertil 124 311 315. Hayes KEN, Pierson RA, Scraba ST, Ginther OJ 1985 Effects of estrous cycle and season on ultrasonic uterine anatomy in mares. Theriogenology 24 465 477. Hazzard TM, Xu F, Stouffer RL 2002 Injection of soluble vascular endothelial growth factor receptor 1 into the preovulatory follicle disrupts ovulation and subsequent luteal function in rhesus monkeys. Biol Reprod 67 1305 1312. Hechter O, Krohn L, Harris J 1941 The effect of estrogen on the permeability of the uterine capillaries. Endocrinology 29 386 392. Hemp stock J, Cindrova Davies T, Jauniaux E, Burton GJ 2004 Endometrial glands as a source of nutrients, growth factors and cytokines during the first trimester of human pregnancy: a morphological and immunohistochemical study. Reprod Biol Endocrino 2 58(1 14). Henneke DR, Potter GD, Kreider JL, Yeates BF 1983 Relationship between condition score, physical measurements and body fat percentage in mares. Equine Vet J 15 371 372. Herv MA, Meduri G, Petit FG, Domet TS, Lazennec G, Mourah S, Perrot Applanat M 2006 R egulation of the vascular endothelial growth factor (VEGF) receptor Flk 1/KDR by estradiol through VEGF in uterus. J Endocrinol 188 91 99. Heryanto B, Rogers PAW 2002 Regulation of endometrial endothelial cell proliferation by oestrogen and progesterone in the ovariectomized mouse. Reproduction 123 107 113. Hixon JE, Hansel W 1974 Evidence for preferential transfer of prostaglandin F2alpha to the ovarian artery following intrauterine administration in cattle. Biol Reprod 11 543 552.

PAGE 265

265 Holmes K, Roberts OL, Th omas AM, Cross MJ 2007 Vascular endothelial growth factor receptor 2: structure, function, intracellular signalling and therapeutic inhibition. Cell Signal 19 2003 2012. Honnens A, Niemann H, Herzog K, Paul V, Meyer HH, Bollwein H 2008a Relationships betwe en ovarian blood flow and ovarian response to eCG treatment of dairy cows. Anim Reprod Sci [Epub ahead of print]. Honnens A, Niemann H, Paul V, Meyer HH, Bollwein H 2008b Doppler sonography of the uterine arteries during a superovulatory regime in cattle. Uterine blood flow in superovulated cattle. Theriogenology 70 859 867. Honnens A, Voss C, Herzog K, Niemann H, Rath D, Bollwein H 2008c Uterine blood flow during the first 3 weeks of pregnancy in dairy cows. Theriogenology 70 1048 1056. Huang JC, Liu DY, D awood MY 1998 The expression of vascular endothelial growth factor isoforms in cultured human endometrial stromal cells and its regulation by 17beta oestradiol. Mol Hum Reprod 4 603 607. Huang K, Andersson C, Roomans GM, Ito N, Claesson Welsh L 2001 Signal ing properties of VEGF receptor 1 and 2 homo and heterodimers. Int J Biochem Cell Biol 33 315 324. Huckabee WE, Crenshaw C, Curet LB, Barron DH 1968 Blood flow and oxygen consumption of the uterus of the nonpregnant ewe. Q J Exp Physiol 53 349 355. Hucka bee WE, Crenshaw C, Curet LB, Barron DH 1970 The effect of exogenous oestrogen on the blood flow and oxygen consumption of the nonpregnant ewe. Q J Exp Physiol 55 16 24. Huckabee WE, Metcalf J, Prystowsky H, Barron DH 1961 Blood flow and oxygen consumption of the pregnant uterus. Amer J Physiol 200 274 278. Inskeep EK 1973 Potential uses of prostaglandins in control of reproductive cycles in domestic animals. J Anim Sci 36 1149.

PAGE 266

266 Jaffe R Jauniaux E, Hustin J 1997 Maternal circulation in the first trimester human placenta Myth or reality? Amer J Obstet Gynecol 176 695 705. Jain RK 2003 Molecular regulation of vessel maturation. Nat Med 9 685 693. Kaczmarek MM, Waclawik A, Blitek A, Kowalczyk AE, Schams D, Ziecik AJ 2008 Expression of the vascular endotheli al growth factor receptor system in the porcine endometrium throughout the estrous cycle and early pregnancy. Mol Reprod Dev 75 1558 66. Kaipainen A, Korhonen J, Mustonen T, van Hinsbergh VW, Fang GH, Dumont D, Breitman M, Alitalo K 1995 Expression of the fms like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development. Proc Natl Acad Sci U S A 92 3566 3570. Kanellis J, Fraser S, Katerelos M, Power DA 2000 Vascular endothelial growth factor is a survival factor for renal tubula r epithelial cells. Am J Physiol Renal Physiol 278 F905 F915. Kastelic JP, Curran S, Pierson RA, Ginther OJ 1988 Ultrasonic evaluation of the bovine conceptus. Theriogenology 29 39 54. Kaufmann P, Mayhew TM, Charnock Jones DS 2004 Aspects of human fetoplac ental vasculogenesis and angiogenesis. II. Changes during normal pregnancy. Placenta 25 114 126. Kazi AA, Jones JM, Koos RD 2005 Chromatin immunoprecipitation analysis of gene expression in the rat uterus in vivo: estrogen induced recruitment of both estro gen receptor alpha and hypoxia inducible factor 1 to the vascular endothelial growth factor promoter. Mol Endocrinol 19 2006 2019. Kindahl H, Edqvist L E, Bane A, Granstrom E 1976a Blood levels of progesterone and 15 keto 13, 14 dihydroprostaglandin F2 du ring the normal oestrous cycle and early pregnancy in heifers. Acta Endocrinol 82 134 149.

PAGE 267

267 Kindahl H, Edqvist L E, Granstrom E, Bane A 1976b The release of prostaglandin F2 as reflected by 15 keto 13, 14 dihydroprostaglandin F2 in the peripheral circula tion during normal luteolysis in heifers. Prostaglandins 11 871 876. King GJ, Atkinson BA, Robertson HA 1979 Development of the bovine placentome during the second month of gestation. J Reprod Fertil 55 173 180. King GJ, Atkinson BA, Robertson HA 1980 Deve lopment of the bovine placentome from Days 20 to 29 of gestation. J Reprod Fertil 59 95 100. King GJ, Atkinson BA, Robertson HA 1981 Development of the intercaruncular areas during early gestation and establishment of the bovine placenta. J Reprod Fertil 6 1 469 474. King GJ, Atkinson BA, Robertson HA 1982 Implantation and early placentation in domestic ungulates. J Reprod Fertil 31( Suppl) 17 30. Klagsbrun M 1992 Mediators of angiogenesis: the biological significance of basic fibroblast growth factor (bFGF) heparin and heparan sulfate interactions. Semin Cancer Biol 3 81 87. Klagsbrun M, Takashima S, Mamluk R 2002 The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol 515 33 48. K lauber N, Rohan RM, Flynn E, D'amato RJ 1997 Critical components of the female reproductive pathway are suppressed by the angiogenesis inhibitor AGM 1470. Nature Medicine 3 443 446. Knickerbocker JJ, Thatcher WW, Foster DB, Wolfenson D, Bartol FF, Caton D 1986 Uterine prostaglandin and blood flow responses to estradiol 17 beta in cyclic cattle. Prostaglandins 31 757 776. Knickerbocker JJ, Wiltbank MC, Niswender GD 1988 Mechanisms of luteolysis in domestic livestock. Dom Anim Endocrinol 5 91 107. Knoth M 1968 Ultrastructure of chorionic villi from a four somite human emb ryo. J Ultrastruct Res 25 423 440.

PAGE 268

268 Koskinen E, Kuntsi H, Lindeberg H, Katila, T 1989 Predicting ovulation in the mare on the basis of follicular growth and serum oestrone sulphate and progesterone levels. J Vet Med 36 299 304. Kroll J, Waltenberger J 1999 A novel function of VEGF receptor 2 (KDR): rapid release of nitric oxide in response to VEGF A stimulation in endothelial cells. Biochem Biophys Res Commun 265 636 639. Krueger L, Koerte J, Tsousis G, Herzog K, Flachowsky G, Bollwein H 2008 Transrectal Dop pler sonography of uterine blood flow during the first 12 weeks after parturition in healthy dairy cows. Anim Reprod Sci [Epub ahead of print] Kulick LJ, Kot K, Wiltbank MC, Ginther OJ 1999 Follicular and hormonal dynamics during the first follicular waves in heifers. Theriogenology 52 913 921. Lauderdale JW, Fokolowsky JH 1979 Efficacy of Lutalyse sterile solution. In: Proc Lutalyse Symp; Brook Lodge, Augusta, MI. 26 27. Lefranc AC, Allen WR 2007a Endometrial gland surface density and hyperaemia of the end ometrium during early pregnancy in the mare. Equine Vet J 39 511 515. Lefranc AC, Allen WR 2007b Influence of breed and oestrous cycle on endometrial gland density in the mare. Equine Vet J 39 506 510. Leith GS, Ginther OJ 1984 Characterization of intraute rine mobility of the early conceptus. Theriogenology 22 401 408. Leith GS, Ginther OJ 1985 Mobility of the conceptus and uterine contractions in the mare. Theriogenology 24 701 711. Lewis GS 1989 Prostaglandin secretion by the blastocyst. J Reprod Fertil Suppl 37 261 267. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real time quantitative PCR and the 2( Delta Delta C(T)) Method. Methods 25 402 408.

PAGE 269

269 Louis TM, Hafs HD, Morrow DA 1974 Intrauterine administration of prostaglandi n F2 in cows: progesterone, estrogen, LH, estrus and ovulation. J Anim Sci 38 347 353. Lowman BG, Scott N, Somerville S 1976 Condition Scoring of Cattle. East of Scotland College of Agriculture, rev. ed. Bulletin. No. 6. Magness RR, Shaw CE, Phernetton TM, Zh eng J, Bird IM 1997 Endothelial vasodilator production by uterine and systemic arteries. II. Pregnancy effects on NO synthase expression. Amer J Physiol 272 1730 1740. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, Yancopoulos GD 1997 Angiopoietin 2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277 55 60. Mann GE, Lamming GE 2006 Timing of prostaglandin F2 release episodes and oxytocin receptor devleopment during luteolysis in the cow. Anim Reprod Sci 93 328 336. Martin L, Finn CA, Trinder G 1973 Hypertrophy and hyperplasia in the mouse uterus after oestrogen treatment: an autoradiographic study. Journal o f Endocrinology 56 133 144. Mattos R, Staples CR, Arteche A, Wiltbank MC, Diaz FJ, Jenkins TC, Thatcher WW 2004 The effect of feeding fish oil on uterine secretion of PGF2 milk composition, and metabolic status of periparturient Holstein cows. J Dairy Sc i 87 921 932. Mayhew TM, Charnock Jones DS, Kaufmann P 2004 Aspects of human fetoplacental vasculogenesis and angiogenesis. III. Changes in complicated pregnancies. Placenta 25 127 139. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann TA, M organ JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA 2003 Excess placental soluble fms like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest 111 649 658.

PAGE 270

270 M cCracken J, Schramm W, Okulicz WC 1984 Hormone receptor control of pulsatile secretion of PGF 2Alpha from the ovine uterus during luteolysis and its abrogation in early pregnancy. Anim Reprod Sci 7 31 55. McDowell KJ, Adams MH, Adam CY, Simpson KS 1999 Cha nges in equine endometrial oestrogen receptor and progesterone receptor mRNAs during the oestrous cycle, early pregnancy and after treatment with exogenous steroids. J Reprod Fertil 117 135 142 McDowell KJ, Sharp DC, Grubaugh W, Thatcher WW, Wilcox CJ 1988 Restricted conceptus mobility results in failure of pregnancy maintenance in mares. Biol Reprod 39 340 348. Mclean JM 1987 Early embryo loss. The Lancet 329 1033 1034. Mendelsohn ME 2002 Genomic and nongenomic effects of estrogen in the vasculature. Amer J Cardiol 90 (Suppl) 3F 6F. Meyer MD, Hansen PJ, Thatcher WW, Drost M, Badinga L, Roberts RM, Li J, Ott TL, Bazer FW 1995 Extension of corpus luteum lifespan and reduction of uterine secretion of prostaglandin F2 of cows in response to recombinant interfe ron J Dairy Sci 78 1921 1931. Miyamoto A, Shirasuna K, Wijayagunawardane MPB, Watanabe S, Hayashi M, Yamamoto D, Matsui M, Acosta TJ 2005 Blood flow: a key regulatory component of corpus luteum function in the cow. Dom Anim Endocrinol 29 329 339. Moreir a F, Orlandi C, Risco CA, Mattos R, Lopes F, Thatcher WW 2001. Effects of presynchronization and bovine somatotropin on pregnancy rates to a time artificial insemination protocol in lactating dairy cows. J Dairy Sci 84 1646 1659. Moscatelli D, Joseph Silve rstein J, Presta M, Rifkin DB 1988 Multiple forms of an angiogenesis factor: basic fibroblast growth factor. Biochimie 70 83 87.

PAGE 271

271 Mossman HW 1971 Orientation and site of attachment of the blastocyst: A comparative study. In: The Biology of the Blastocyst. C hicago, IL: Ed. RJ Blandau University of Chicago Press. 27 48. Mossman HW 1987 In: Vertebrate Fetal Membranes. New Brunswick, NJ: Rutgers University Press. pp. 79 83. Nayak NR, Brenner RM 2002 Vascular proliferation and vascular endothelial growth factor e xpression in the rhesus macaque endometrium. J Clin Endocrinol Metab 87 1845 1855. Niswender GD, Reimers TJ, Diekman MA, Nett TM 1976 Blood flow: a mediator of ovarian function. Biol Reprod 14 64 81. Oberg Welsh C, Sandler S, Andersson A, Welsh M 1997 Effe cts of vascular endothelial growth factor on pancreatic duct cell replication and the insulin production of fetal islet like cell clusters in vitro. Mol Cell Endocrinol 126 125 132. Ohtani M, Takase S, Wijayagunawardane MPB, Tetsuka M, Miyamoto A 2004 Loca l interaction of prostaglandin F2 with endothelin 1 and tumor necrosis factor on the release of progesterone and oxytocin in ovine corpora lutea in vivo: a possible implication for a luteolytic cascade. Reproduction 127 117 124. Okulicz WC, Savasta AM, Hoberg LM, Longcope C 1990 Biochemical and immunohistochemical analyses of estrogen and progesterone receptors in the rhesus monkey uterus during the proliferative and secretory phases of artificial menstrual cycles. Fertil Steril 53 913 920. Oriol JG, Bet teridge KJ, Clarke AJ, Sharom FJ 1993 Mucin like glycoproteins in the equine embryonic capsule. Mol Reprod Dev 34 255 265. Ornitz DM, Itoh N 2001 Fibroblast growth factors. Genome Biol 2 REVIEWS3005. Otrock ZK, Mahfouz RA, Makarem JA, Shamseddine AI 2007 U nderstanding the biology of angiogenesis: review of the most important molecular mechanisms. Blood Cells Mol Dis 39 212 20.

PAGE 272

272 Panarace M, Garnil C, Marfil M, Jauregui G, Lagioia J, Luther E, Medina M 2006 Transrectal Doppler sonography for evaluation of uter ine blood flow throughout pregnancy in 13 cows. Theriogenology 66 2113 2119. Park JE, Chen HH, Winer J, Houck KA, Ferrara N 1994 Placenta growth factor. Potentiation of vascular endothelial growth factor bioactivity, in vitro and in vivo, and high affinity binding to Flt 1 but not to Flk 1/KDR. J Biol Chem 269 25646 25654. Paulo E, Tischner M 1985 Activity of delta(5)3beta hydroxysteroid dehydrogenase and steroid hormones content in early preimplantation horse embryos. Folia Histochem Cytobiol 23 81 84. Per ry GA, Smith MF, Lucy MC, Green JA, Parks TE, MacNeil MD, Roberts AJ, Geary TW 2005 Relationship between follicle size at insemination and pregnancy success. Proc Natl Acad Sci USA 102 5268 5273. Pfarrer CD, Ruziwa SD, Winther H, Callesen H, Leiser R, Scha ms D, Dantzer V 2006 Localization of vascular endothelial growth factor (VEGF) and its receptors VEGFR 1 and VEGFR 2 in bovine placentomes from implantation until term. Placenta 27 889 898 Quinn BA, Caswell DE, Lillie BN, Waelchli RO, Betteridge KJ, Hayes MA 2006 The GM2 activator protein is a major protein expressed by the encapsulated equine trophoblast. Anim Reprod Sci 94 391 394. Quinn BA, Hayes MA, Waelchli RO, Betteridge KJ 2005 Major proteins in the embryonic capsule, and in yolk sac and uterine flui ds, during the second to fourth weeks of pregnancy in the mare. in: Maternal Recognition of Pregnancy in the Mare III, Havemeyer Foundation Monograph Series 16 47 49. Rabbani ML, Rogers PA 2001 Role of vascular endothelial growth factor in endometrial vasc ular events before implantation in rats. Reproduction 122 85 90.

PAGE 273

273 Raeside JI, Christie HL, Renaud RL, Waelchli RO, Betteridge KJ 2004 Estrogen metabolism in the equine conceptus and endometrium during early pregnancy in relation to estrogen concentrations in yolk sac fluid. Biol Reprod 71 1120 1127. Rauch A, Krger L, Miyamoto A, Bollwein H 2008 Colour Doppler sonography of cystic ovarian follicles in cows. J Reprod Dev 54 447 453. Redmer DA, Aitken RP, Milne JS, Reynolds LP, Wallace JM 2005 Influence of m aternal nutrition on messenger RNA expression of placental angiogenic factors and their receptors at midgestation in adolescent sheep. Biol Reprod 72 1004 1009. Redmer DA, Doraiswamy V, Bortnem BJ, Fisher K, Jablonka Shariff A, Grazul Bilska AT, Reynolds L P 2001 Evidence for a role of capillary pericytes in vascular growth of the developing ovine corpus luteum. Biol Reprod 65 879 889. Reisinger K, Baal N, McKinnon T, Mnstedt K, Zygmunt M 2007 The gonadotropins: tissue specific angiogenic factors? Mol Cell Endocrinol 269 65 80. Reuwer PJ, Nuyen WC, Beijer HJ, Heethaar RM, Bruinse HW, Stoutenbeek P, Haspels AA 1984 Characteristics of flow velocities in the umbilical arteries assessed by Doppler ultrasound. Eur J Obstet Gynecol Reprod Biol 17 397 408. Reynolds LP, Borowicz PP, Vonnahme KA, Johnson ML, Grazul Bilska AT, Redmer DA, Caton JS 2005 Placental angiogenesis in sheep models of compromised pregnancy. J Physiol 565 43 58. Reynolds LP, Caton JS, Redmer DA, Grazul Bilska AT, Vonnahme KA, Borowicz PP, Luther JC, Wallace JM, Wu G, Spencer TE 2006 Evidence for altered placental blood flow and vascularity in compromised pregnancies. J Physiol 572 51 58. Reynolds LP, Ferrel CL, Robertson DA, Ford SP 1986 Metabolism of the gravid uterus, foetus and uteroplacenta a t several stages of gestation in cows. J Agric Sci 106 437 444. Reynolds LP, Grazul Bilska AT, Killilea SD, Redmer DA 1994 Mitogenic factors of corpora lutea. Prog Growth Factor Res 5 159 175.

PAGE 274

274 Reynolds LP, Grazul Bilska AT, Redmer DA 2000 Angiogenesis in t he corpus luteum. Endocrine 12 1 9. Reynolds LP, Killilea SD, Redmer DA 1992 Angiogenesis in the female reproductive system. FASEB J 6 886 892. Reynolds LP, Magness RR, Ford SP 1984 Uterine blood flow during early pregnancy in ewes: interaction between the conceptus and the ovary bearing the corpus luteum. J Anim Sci 58 423 429. Reynolds LP, Redmer DA 1995 Utero placental vascular development and placental function. J Anim Sci 73 1839 1851. Reynolds LP, Redmer DA 2001 Angiogenesis in the Placenta. Biol Repr od 64 1033 1040. Risau W 1997 Mechanisms of angiogenesis. Nature 386 671 674. Risau W, Flamme I 1995 Vasculogenesis. Annu Rev Cell Dev Biol 11 73 91. Roberts RM, Xie S, Mathialagan N 1996 Maternal recognition of pregnancy. Biol Reprod 54 294 302. Rockwell LC, Pillai S, Olson CE, Koos RD 2002 Inhibition of vascular endothelial growth factor/vascular permeability factor action blocks estrogen induced uterine edema and implantation in rodents. Biol Reprod 67 1804 1810. Roman Ponce H, Caton D, Thatcher WW, Leh rer R 1983 Uterine blood flow in relation to endogenous hormones during estrous cycle and early pregnancy. Am J Physiol 245 R843 849. Rossant J, Cross JC 2001 Placental development: lessons from mouse mutants. Nat Rev Genet 2 538 548.

PAGE 275

275 Rowe AJ, Wulff C, Fraser HM 2003 Localization of mRNA for vascular endothelial growth factor (VEGF), angiopoietins and their receptors during the peri implantation period and early pregnancy in marmosets ( Callithrix jacchus ). Reproduction 126 227 238. Roy H, Bhardwaj S, Yl Herttuala S 2006 Biology of vascular endothelial growth factors. FEBS Letters 580 2879 2887. Samuel CA, Allen WR, Steven DH 1977 Studies on the equine placenta. III. Ultrastructure of the uterine glands and the overlaying trophoblast. J Reprod Fertil 51 433 437. Sangha RK, Li XF, Shams M, Ahmed A 1997 Fibroblast growth factor receptor 1 is a critical component for endometrial remodeling: localization and expression of basic fibroblast growth factor and FGF R1 in human endometrium during t he menstrual cycle and decreased FGF R1 expression in menorrhagia. Lab Invest 77 389 402. Sartori R, Gumen A, Guenther J N, Souza AH, Wiltbank MC 2003 Comparison of artificial insemination (AI) versus embryo transfer (ET) in lactatin g dairy cows. J Dairy Sc i 86 Suppl 1 238. Sato TN, Tozawa Y, Deutsch U, Wolburg Buchholz K, Fujiwara Y, Gendron Maguire M, Gridley T, Wolburg H, Risau W, Qin Y 1995 Distinct roles of the receptor tyrosine kinases Tie 1 and Tie 2 in blood vessel formation. Nature 376 70 74. Schams D, Berisha B 2004 Regulation of corpus luteum function in cattle an overview. Reprod Dom Anim 39 241 251. Schlafer DH, Fisher PJ, Davies CJ 2000 The bovine placenta before and after birth: placental development and function in health and disease. Anim R eprod Sci 60 61 145 160. Senger DR, Asch BB, Smith BD, Perruzzi CA, Dvorak HF 1983 A secreted phosphoprotein marker for neoplastic transformation of both epithelial and fibroblastic cells. Nature 302 714 715.

PAGE 276

276 Senger DR, Van De Water L, Brown LF, Nagy JA, Yeo K T, Yeo T K, Berse B, Jackman RW, Dvorak AM, Dvorak HF 1993 Vascular permeability factor (VPF, VEGF) in tumor biology. Cancer Metastasis Rev 12 303 324. Sevinga M, Schukken YH, Hesselink JW, Jonker FH 1999 Relationship between ultrasonic characteristi cs of the corpus luteum, plasma progesterone concentration and early pregnancy diagnosis in Friesan mares. Theriogenology 52 585 592. Shams M, Ahmed A 1994 Localization of mRNA for basic fibroblast growth factor in human placenta. Growth Factors 11 105 111 Sharp DC 2000 The early fetal life of the equine conceptus. Anim Reprod Sci 60 61 679 689. Shemesh H, Milaguir F, Ayalon N, Hansel W 1979 Steroidogenesis and prostaglandin synthesis by cultured bovine blastocysts. J Reprod Fertil 56 181 185. Shifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, Jaffe RB, Taylor RN 1996 Ovarian steroid regulation of vascular endothelial growth factor in the human endometrium: implications for angiogenesis during the menstrual cycle and in the pathogenesis of endo metriosis. J Clin Endocrinol Metab 81 3112 3118. Shirasuna K, Asaoka H, Acosta TJ, Wijayagunawardane MPB, Ohtani M, Hayashi K G, Matsui M, Miyamoto A 2004a Real time dynamics of prostaglandin F2 release from uterus and corpus luteum during spontaneous luteolysis in the cow. Reproduction 128 189 195. Shirasuna K, Asaoka H, Acosta TJ, Wijayagunawardane MPB, Ohtani M, Hayashi M, Miyamoto A 2004b Real time relationships in intraluteal release among prostaglandin F2 endothelin 1, and angiotensin II during spontaneous luteolysis in the cow. Biol Reprod 71 1706 1711.

PAGE 277

277 Shirasuna K, Wijayagunawardane MPB, Watanabe S, Yamamoto D, Matsui M, Ohtani M, Miyamoto A 2004c A blood flow in the corpus luteum acu tely increase together with endothelin 1 mRNA expression at early stage of regression during spontaneous luteolysis in the cow. Proc Soc Study Reprod 37th Ann Meet; Vancouver, BC, Canada, Abstract 194. Shore VH, Wang TH, Wang CL, Torry RJ, Caudle MR, Torr y DS 1997 Vascular endothelial growth factor, placenta growth factor and their receptors in isolated human trophoblast. Placenta 18 657 665. Shrestha SM, Costello MF, Sjoblom P, McNally G, Bennett M, Steigrad SJ, Hughes GJ 2006 Power Doppler ultrasound ass essment of follicular vascularity in the early follicular phase and its relationship with outcome of in vitro fertilization. J Assist Rep Gen 23 161 169. Siddiqui MA, Almamun M, Ginther OJ 2008 Blood flow in the wall of the preovulatory follicle and its re lationship to pregnancy establishment in heifers. Anim Reprod Sci doi:10.1016/j.anireprosci.2008.07.008 (in press). Siddiqui MA, Gastal EL, Gastal MO, Almamun M, Beg MA, Ginther OJ 2009 Relationship of vascular perfusion of the wall of the preovulatory fo llicle to in vitro fertilization and embryo development in heifers. Reproduction [Epub ahead of print]. Silva LA, Gastal EL, Beg MA, Ginther OJ 2005 Changes in vascular perfusion of the endometrium in association with changes in location of the embryonic v esicle in mares. Biol Reprod 72 755 761. Silva LA, Gastal EL, Gastal MO, Ginther OJ 2006 Relationship between vascularity of the preovulatory follicle and establishment of pregnancy in mares. Anim Reprod 3 339 346. Silva LA, Ginther OJ 2006 An early endome trial vascular indicator of completed orientation of the embryo and the role of dorsal endometrial encroachment in mares. Biol Reprod 74 337 343. Silva LA, Sharp DS, Ginther OJ 2009 Uterine vascular perfusion changes during early pregnancy in Cattle assess ed by color Doppler ultrasonography. Reproduction (submitted).

PAGE 278

278 Silvia WJ, Lewis GS, McCracken JA, Thatcher WW, Wilson L 1991 Hormonal regulation of uterine secretion of prostaglandin F2 during luteolysis in ruminants. Biol Reprod 45 655 663. Sladkevicius P, Valentin L, Marsal K 1993 Blood flow velocity in the uterine and ovarian arteries during the normal menstrual cycle. Ultrasound Obstet Gynec 3 199 208. Sondell M, Lundborg G, Kanje M 1999 Vascular endothelial growth factor stimulates Schwann cell invasion and neovascularization of acellular nerve grafts. Brain Res 846 219 228. Spencer TE, Bazer FW 2004 Conceptus signals for establishment and maintenance of pregnancy. Reprod Biol Endoc rinol 2 49 (1 15). Spencer TE, Becker WC, George P, Mirando MA, Ogle TF, Bazer FW 1995 Ovine interferon tau regulates expression of endometrial receptors for estrogen and oxytocin but not progesterone. Biol Reprod 53 732 745. Stout TA, Allen WR 2002 Prosta glandin E(2) and F(2 alpha) production by equine conceptuses and concentrations in conceptus fluids and uterine flushings recovered from early pregnant and dioestrous mares. Reproduction 123 261 268. Takahashi T, Kalka C, Masuda H, Chen D, Silver M, Kearne y M, Magner M, Isner JM, Asahara T 1999a Ischemia and cytokine induced mobilization of bone marrow derived endothelial progenitor cells for neovascularization. Nat Med 5 434 438. Takahashi T, Ueno H, Shibuya M 1999b VEGF activates protein kinase C depende nt, but Ras independent Raf MEK MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene 18 2221 2230. Tamura K, Sakurai T, Kogo H 2006 Relationship between prostaglandin E2 and vascular endothelial growth factor (VEGF) in angiogenesis i n human vascular endothelial cells. Vascul Pharmacol 44 411 416.

PAGE 279

279 Theiler K 1989 The House Mouse Atlas of Embryonic Development. New York Berlin Heidelberger London Paris Tokyo: Springer Verlag. Torry DS, Holt VJ, Keenan JA, Harris G, Caudle MR, Torry R J 1996 Vascular endothelial growth factor expression in cycling human endometrium. Fertil Steril 66 72 80. Torry DS, Leavenworth J, Chang M, Maheshwari V, Groesch K, Ball ER, Torry RJ 2007 Angiogenesis in implantation. J Assist Reprod Genet 24 303 3 15. Utt MD, Johnson GL 3rd, Beal WE 2009 The evaluation of corpus luteum blood flow using color flow Doppler ultrasound for early pregnancy diagnosis in bovine embryo recipients. Theriogenology 71 707 715. Vanderwall DK 2008 Early Embryonic Loss in the Mar e. J Equine Vet Sci 28 691 702. Wakui S, Yokoo K, Muto T, Suzuki Y, Takahashi H, Furusato M, Hano H, Endou H, Kanai Y 2006 Localization of Ang 1, 2, Tie 2, and VEGF expression at endothelial pericyte interdigitation in rat angiogenesis. Lab Invest 86 1172 1184. Watson ED, Sertich PL 1989 Prostaglandin production by horse embryos and the effect of co culture of embryos with endometrium from pregnant mares. J Reprod Fertil 87 331 336. Weber JA, Freeman DA, Vanderwall DK, Woods GL 1991 Prostraglandin E 2 secre tion by oviductal transport stage equine embryos. Biol Reprod 45 540 543. Welter H, Bollwein H, Weber F, Rohr S, Einspanier R 2004 Expression of endothelial and inducible nitric oxide synthases is modulated in the endometrium of cyclic and early pregnant mares. Reprod Fertil Dev 16 689 698. Werner R 1997 Mechanisms of angiogenesis. Nature 386 671 674. Wiltbank MC, Ottobre JS 2003 Regulation of intraluteal production of prostaglandins. Reprod Biol Endocrinol 1 91 102.

PAGE 280

280 Winther H, Ahmed A, Dantzer V 1999 Imm unohistochemical localization of vascular endothelial growth factor (VEGF) and its two specific receptors, Flt 1 and KDR, in the porcine placenta and non pregnant uterus. Placenta 20 35 43. Wolfenson D, Thatcher WW, Drost M, Caton D, Foster DB, LeBlanc MM 1985 Characteristics of prostaglandin F measurements in the ovarian circulation during the oestrous cycle and early pregnancy in the cow. J Reprod Fertil 75 491 499. Wollenhaupt K, Welter H, Brssow KP, Einspanier R 2005 Regulation of endometrial fibroblas t growth factor 7 (FGF 7) and its receptor FGFR2IIIb in gilts after sex steroid replacements, and during the estrous cycle and early gestation. J Reprod Dev 51 509 519. Woods GL, Baker CB, Baldwin JL, Ball BA, Bilinski J, Cooper WL, Ley WB, Mank EC, Erb HN 1987 Early pregnancy loss in brood mares. J Reprod Fertil 35 Suppl 455 459. Wulff C, Wilson H, Largue P, Duncan WC, Armstrong DG, Fraser HM 2000 Angiogenesis in the human corpus luteum: localization and changes in angiopoietins, tie 2, and vascular endoth elial growth factor messenger ribonucleic acid. J Clin Endocrinol Metabol 85 4302 4309. Yallampalli C, Dong YL 2000 Estradiol 17beta inhibits nitric oxide synthase (NOS) II and stimulates NOS III gene expression in the rat uterus. Biol Reprod 63 34 41. Yan copoulos GD, Davis S, Gale NW, Rudge JS, Wiegand AJ, Holash J 2000 Vascular specific growth factors and blood vessel formation. Nature 407 242 248. Zachary I, Gliki G 2001 Signaling transduction mechanisms mediating biological actions of the vascular endot helial growth factor family. Cardiovasc Res 49 568 581. Zavy MT, Mayer R, Vernon MW, Bazer FW, Sharp DC 1979 An investigation of the uterine luminal environment of non pregnant and pregnant pony mares. J Reprod Fertil Suppl 27 403 411.

PAGE 281

2 81 Zavy MT, Vernon MW, Sharp DC, Bazer FW 1984 Endocrine aspects of early pregnancy in pony mares: a comparison of uterine luminal and peripheral plasma levels of steroids during the estrous cycle and early pregnancy. Endocrinology 115 214 219. Zwiebel WJ, Pellerito JS 2005 Intr oduction to vascular ultrasonography. 5th edition. Philadelphia, PA: Elsevier Saunders. 19 89. Zygmunt M, Herr F, Mnstedt K, Lang U, Liang OD 2003 Angiogenesis and vasculogenesis in pregnancy. Eur J Obstet Gynecol Reprod Biol 110 Suppl 1:S10 1 8.

PAGE 282

282 BIOGRAP HICAL SKETCH Luciano Andrade Silva was born in Bom Repouso, Minas Gerais, Brazil, to Paulo Andrade da Silva and Lucila Maria Andrade Silva in November of 1975. Luciano received his veterinary medical degree from Universidade Federal de Vios a Viosa, Min as Gerais, in 1999. After receiving his degree, he worked as a veterinar y practitioner for two and half year s At that time he worked with clinic al medicine and surgery of large and small animals, inspect ed dairy products in a dairy plant, and served as a nutrition consulta nt in dairy and beef cattle farms in the south of Minas Gerais State. In 2001, Luciano returned to academia enrolling in the M aster of Science P rogram in the Department of Veterinary Medicine at the Universidade Federal d e Viosa He received his Master of Science d egree in veterinary m edicine in 2003 In 2003, Luciano moved to the United States to a research position in a combined program between the Eutheria Foundation, Cross Plains, WI, and University of Wisconsin Madison, unde r the supervision of Dr. O.J. Ginther. In 2005, he applie d to the University of Florida to pursue his Doctor of Philosophy in animal molecular and cellular b iology at the Department of Animal Sciences under the supervision of Dr. Daniel C. Sharp. He gradua te d in May 200 9 and will continue his career as a scientist in the area of animal reproduction.