<%BANNER%>

Role of the E6 Gene in Vaccinia Virus Morphogenesis

Permanent Link: http://ufdc.ufl.edu/UFE0022806/00001

Material Information

Title: Role of the E6 Gene in Vaccinia Virus Morphogenesis
Physical Description: 1 online resource (52 p.)
Language: english
Creator: Boyd, Olga
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: assembly, poxvirus, structure, vaccinia
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The E6R gene of vaccinia virus is an essential structural gene as suggested by preliminary experiments; however the function of E6 is unknown. To investigate the role of the E6R gene during vaccinia virus infection, two mutants, the temperature sensitive mutant Cts52 and the inducible mutant vE6i, each defective in synthesis of normal E6 protein under non-permissive conditions, have been analyzed. The results show that growth of both mutants is inhibited under non-permissive conditions; however both mutants are normal for DNA replication and virus gene expression. Protein processing of the major precursor proteins required for formation of mature virions is normal in the Cts52 mutant and absent in the vE6i mutant. Electron microscopy of Cts52 showed production of mature virions under non-permissive conditions which are indistinguishable from wild type mature virions in appearance, but vE6i formed empty immature virions under non-permissive conditions, and failed to make mature virions suggesting block in morphogenesis. In addition, dense (crystalloid) viroplasm was observed in cytoplasm of vE6i infected cells; crystalloids probably represent deposits of unpackaged viral DNA. Analysis of infected cells for viral DNA concatemer resolution showed DNA resolution occurs normally. The vE6i infection blocked in morphogenesis was analyzed for the ability to package the existing DNA and complete morphogenesis when permissive conditions were introduced. Thus, permissive conditions with DNA replication inhibitor introduced at 24 hours post-infection to cells infected under non-permissive conditions and which therefore had presumably formed crystalloids; the induction of E6 expression resulted in increased virus yield, suggesting formation of mature virions via processing of existing viral DNA. Finally, purified Cts52 viral particles grown under non-permissive conditions are defective in core transcription in vitro. A dual role of E6 gene in infection suggested the following: 1) in the virion core E6 may have a subtle direct or indirect role in viral transcription; 2) E6 is essential for association of viroplasm and crescents to encapsidate DNA into immature virions. Understanding E6R gene function will advance our knowledge of vaccinia virus structure and assembly.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Olga Boyd.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Condit, Richard C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022806:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022806/00001

Material Information

Title: Role of the E6 Gene in Vaccinia Virus Morphogenesis
Physical Description: 1 online resource (52 p.)
Language: english
Creator: Boyd, Olga
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: assembly, poxvirus, structure, vaccinia
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The E6R gene of vaccinia virus is an essential structural gene as suggested by preliminary experiments; however the function of E6 is unknown. To investigate the role of the E6R gene during vaccinia virus infection, two mutants, the temperature sensitive mutant Cts52 and the inducible mutant vE6i, each defective in synthesis of normal E6 protein under non-permissive conditions, have been analyzed. The results show that growth of both mutants is inhibited under non-permissive conditions; however both mutants are normal for DNA replication and virus gene expression. Protein processing of the major precursor proteins required for formation of mature virions is normal in the Cts52 mutant and absent in the vE6i mutant. Electron microscopy of Cts52 showed production of mature virions under non-permissive conditions which are indistinguishable from wild type mature virions in appearance, but vE6i formed empty immature virions under non-permissive conditions, and failed to make mature virions suggesting block in morphogenesis. In addition, dense (crystalloid) viroplasm was observed in cytoplasm of vE6i infected cells; crystalloids probably represent deposits of unpackaged viral DNA. Analysis of infected cells for viral DNA concatemer resolution showed DNA resolution occurs normally. The vE6i infection blocked in morphogenesis was analyzed for the ability to package the existing DNA and complete morphogenesis when permissive conditions were introduced. Thus, permissive conditions with DNA replication inhibitor introduced at 24 hours post-infection to cells infected under non-permissive conditions and which therefore had presumably formed crystalloids; the induction of E6 expression resulted in increased virus yield, suggesting formation of mature virions via processing of existing viral DNA. Finally, purified Cts52 viral particles grown under non-permissive conditions are defective in core transcription in vitro. A dual role of E6 gene in infection suggested the following: 1) in the virion core E6 may have a subtle direct or indirect role in viral transcription; 2) E6 is essential for association of viroplasm and crescents to encapsidate DNA into immature virions. Understanding E6R gene function will advance our knowledge of vaccinia virus structure and assembly.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Olga Boyd.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Condit, Richard C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022806:00001


This item has the following downloads:


Full Text

PAGE 1

1 ROLE OF THE E6 GENE IN VA CCINIA VIRUS MORPHOGENESIS By OLGA BOYD A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Olga Boyd

PAGE 3

3 To Deanna Boyd

PAGE 4

4 ACKNOWLEDGMENTS I thank m y mentors Dr. Rich Condit and Dr Nissin Moussatch for their enormous empowerment and inspiration. They are incredible role models in the scientific world. I would like to thank Dr. Susan DCosta, Ms. Apar na Manoharan, Ms.Amber Shatzer, Mr. Travis Bainbridge, Ms. Nicole Kay, and Mr. Carson Rodeffer for all their help and support. I give special thanks to my committee members (Dr. Thomas Rowe and Dr. David Bloom) for their guidance and advice. I also th ank Ms. Joyce Connors for keeping me on track with classes and deadlines. All of these people gave me a chance to achieve my goals and become a credible independent researcher.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4LIST OF FIGURES.........................................................................................................................7ABSTRACT.....................................................................................................................................8CHAPTER 1 INTRODUCTION..................................................................................................................10Vaccinia Virus Overview.......................................................................................................10Virus Structure........................................................................................................................10Vaccinia Life Cycle............................................................................................................ ....11Virus Assembly......................................................................................................................12Genetic Analysis of Vaccinia Virus.......................................................................................13The E6R Gene................................................................................................................... ......15Aim of Study...........................................................................................................................162 MATERIALS AND METHODS........................................................................................... 22Cells........................................................................................................................................22Viruses and Plasmids........................................................................................................... ...22Plaque Assay...........................................................................................................................22One-Step Growth Assay.........................................................................................................23Slot-Blot DNA Analysis.........................................................................................................23Metabolic Protein Labeling.................................................................................................... 24Electron Microscopy...............................................................................................................24Southern Blot..........................................................................................................................253 RESULTS...............................................................................................................................26The vE6i Construct.................................................................................................................26The vE6i mutant Confirms its Inducible Phenotype............................................................... 27The E6 Protein is Essent ial in Virus Biogenesis.................................................................... 28The vE6i mutant is Normal in DNA Replication................................................................... 29The vE6i mutant is Normal in Protein S ynthesis; but Defective in Proteolysis..................... 29The vE6i mutant Fails to Form Mature Virions..................................................................... 30Genomic Concatemers are Resolved in vE6i Infected Cells.................................................. 32Mature Virions Formed after Inducer Added in Blocked Morphogenesis............................. 324 DISCUSSION.........................................................................................................................43

PAGE 6

6 REFERENCE LIST.......................................................................................................................50BIOGRAPHICAL SKETCH.........................................................................................................52

PAGE 7

7 LIST OF FIGURES Figure page 1-1 Vaccinia virus structure................................................................................................... ..181-2 Model of vaccinia virus structure...................................................................................... 181-3 Vaccinia virus life cycle.................................................................................................. ...191-4 The E6 gene phylogeny tree.............................................................................................. 201-5 The E6R gene sequence.....................................................................................................213-1 The vE6i construct.............................................................................................................343-2 Plaque assay............................................................................................................... ........353-3 Comparison of plaque morphology................................................................................... 353-4 One-step growth assay...................................................................................................... .363-5 The DNA replication..........................................................................................................373-6 Protein synthesis a nd protein processing...........................................................................383-7 Electron microscopy of the wild type and the Cts52 mutant............................................. 393-8 Electron microscopy of the vE6i mutant........................................................................... 403-9 Scheme for DNA replication............................................................................................. 413-10 Vaccinia concat emer junctions.......................................................................................... 413-11 Concatemer resolution.......................................................................................................423-12 The vE6i block in assembly is reversible in absence de novo DNA synthesis.................. 42

PAGE 8

8 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science ROLE OF THE E6 GENE IN VA CCINIA VIRUS MORPHOGENESIS By Olga Boyd December 2008 Chair: Richard C. Condit Major: Medical Sciences The E6R gene of vaccinia virus is an essential structural gene as suggested by preliminary experiments; however the function of E6 is unknown. To investigate the role of the E6R gene during vaccinia virus infection, two mutants, th e temperature sensitive mutant Cts52 and the inducible mutant vE6i, each de fective in synthesis of normal E6 protein under non-permissive conditions, have been analyzed. The results show that growth of both mutants is inhibited under non-permissive conditions; however both mutants are normal for DNA replication and virus gene expression. Protein proce ssing of the major precursor proteins required for formation of mature virions is normal in the Cts52 mutant and abse nt in the vE6i mutant. Electron microscopy of Cts52 showed production of mature virions under non-permissive conditions which are indistinguishable from wild type mature virions in appearance, but vE6i formed empty immature virions under non-permissive conditions, and failed to make mature virions suggesting block in morphogenesis. In addition, dense crystalloid viroplasm was observed in cytoplasm of vE6i infected cells; crystalloids proba bly represent deposits of unpackaged viral DNA. Analysis of infected cells for viral DNA concatemer reso lution showed DNA resolution occurs normally. vE6i infection blocked in morphogenesis was anal yzed for the ability to package the existing DNA and complete morphogenesis when permissi ve conditions were introduced. Thus,

PAGE 9

9 permissive conditions with DNA replication inhi bitor introduced at 24 hou rs post-infection to cells infected under non-permissive conditions and which therefore had presumably formed crystalloids; the induc tion of E6 expression resulted in increased virus yield, suggesting formation of mature virions via processing of existing viral DNA. Finally, purified Cts52 viral particles grown under non-permissive conditions are defective in core transcription in vitro. A dual role of E6 gene in infection suggested the following: 1) in the virion core E6 may have a subtle direct or indirect role in viral transcripti on; 2) E6 is essential for association of viroplasm and crescents to encapsidate DNA into immature virions. Understanding E6R gene function will advance our knowledge of vaccinia virus structure and assembly.

PAGE 10

10 CHAPTER 1 INTRODUCTION Vaccinia Virus Overview The poxvirus fa mily has had an enormous im pact on world history and medicine. One member of the poxvirus family, the variola virus, caused smallpox, the disease that devastated humanity for centuries and wiped out millions of lives; those who survived were left scarred for life. To conquer this deadly disease, another member of the same family, vaccinia virus, was used as the live vaccine to eradicate smallpox entirely worldwide by 1977 and gave roots to the general practice of vaccination wh ich has saved millions of lives. Nowadays, smallpox is extinct as disease, but important lessons can be learned by dissecting the virus st ructure and the function of each viral gene. The unique structure of poxvi rus has attracted many scientists and led to extensive research in the past few decades a nd because poxviruses are conserved throughout the entire family, vaccinia has become the prototype virus used to study poxviruses. The vaccinia virus belongs to the Orthopoxvirus genus of Poxviriridae family. Vaccinia is truly a unique virus with no parall el among other viruses in its shap e, structure, replication and assembly of new viral particles. The brick shap ed virus contains a larg e double-stranded (ds) DNA genome that encodes all of the factors for th e virus exclusively cytoplasmic replication. The assembly of new virus occurs in subseque nt stages that involve assembly of viral membranes into spheres, encapsidation of the genome and morphogenesis into a mature viral particle. The ultimate goal of our study is to ex pand and deepen our knowledge of all aspects of vaccinia virus assembly. Virus Structure Vaccinia is unparalleled in its shape and stru cture compared to any other known viruses. Knowledge about the virus surface and the internal structure is gained from electron microscopy

PAGE 11

11 (EM). Figure 1-1 shows electron micrographs of vaccinia virion that exemplifies virus surface and viral internal structure. In contrast to icos ahedral and helical shaped viruses, vaccinia virus has a brick-shaped form (Figure 1-1A) with pa rticle dimensions of 310 x 240 x 140 nm (Griffiths et al., 2001; Roos et al., 1996; Sode ik and Krijnse-Locker, 2002). The virus structure is complex and unusual among viruses. Cryo-section of the vi ral particle, shown on Figure 1-1B, reveals an outer lipid bilayer membrane th at surrounds a dense biconcave co re flanked by lateral bodies. Based on EM pictures, a virus model was construc ted (Figure 1-2). The model is highlights the major elements of the virion structure as a bric k shape, a core with lateral bodies and a genome arranged in tubules. The core contains a la rge double-stranded DNA genome approximately 200 kb in length that comprises 200 intronless gene s, each gene controlled by its own promoter (Moss, 2007). The genome is organized into a li near molecule that contains inverted terminal repeats (ITR) with hairpin loops on both ends th at are essential in vira l DNA replication. The virion core also contains numerous viral enzy mes including a multi-subunit RNA polymerase, an mRNA capping enzyme, a poly (A) polymerase, and other enzymes required for the synthesis of mRNA during the early stages of infection. Presumably, the unus ual shape and structure of the vaccinia virion is the key to its extraordinary biogenesis. Vaccinia Life Cycle The vaccinia life cycle, including DNA replicat ion and viral transcri ption, takes place solely in the cytoplasm of the infected host cell (reviewed in Moss, 2007). Whereas other ds DNA viruses enter the host cell nucleus and use th e host machinery in orde r to replicate, the large genome of vaccinia virus encodes all of th e enzymes and factors to carry out its entire replication and transcription in the cytoplasm of the infected ce lls; this is exceptional for a DNA virus. The vaccinia virus genome comprises three cl asses of genes: early, intermediate and late, each controlled by its class specific promoters. Viral transcription proceeds in a cascade reaction

PAGE 12

12 where each class of genes codes for factors require d for the next class to transcribe. Figure 1-3 demonstrates the major steps of the vaccinia life cy cle. The viral particle infects the host cell by fusion of the outer viral membrane with the host cell plasma membrane and releases the core and lateral bodies into the host cell cytoplasm. The viral early transcription factors (VETF) and compliment enzymes that are packaged in the vira l core are activated after entry into the host cell and early mRNAs are synthesized and released into the cytoplasm. Early mRNAs code for proteins that are required to dissolve the viral core releasing viral DNA into the cytoplasm, and for replication factors such as DNA polymer ase that are required for subsequent DNA replication. DNA replicates in head-to-head and tail-to-tail concatemers, large multimeric genomic molecules. Later during infection, th e concatemers resolve into single unit length genomes using the viral resolvase, a late gene product. Besides enzymes for DNA replication, early viral mRNA codes for viral intermediate tran scription factors (VITF) that are required for transcription of intermediate genes that in turn code for viral late transcription factors (VLTF). VLTF and viral RNA polymerase transcribe late genes that code for structural proteins required for assembly of a new virus and for VETF and R NA polymerase that is packaged into new viral particles for the next round of infection. Virus Assembly Virtually all steps of virus assem bly were uncovered using electron microscopy images of cells infected with vaccinia virus. Vaccini a assembly was recently reviewed (Condit et al., 2006). In early times after inf ection, areas clear of any cellu lar organelles and sometimes bound by ER appear in the host cell cyt oplasm. These cytoplasmic sites are DNA factories, where final assembly of structural proteins and replicated DNA into viral partic les take place. Basic steps of vaccinia assembly are shown in Figure 1-3. The first evidence of virus morphogenesis is the appearance of crescents (C), th e curved viral membranes contai ning a lipid bilayer and a D13

PAGE 13

13 scaffold protein. Further, growing crescents mo rph into three dimensional spheres that ingest surrounding viroplasm, which presumably is gene tic material intercalat ed with protein and evident throughout factories, resu lting in immature virions (IV). Simultaneously, IVs with electron dense nucleoids appear, called immature vi rions with nucleoid (IVN). Serial sections of infected cells suggest that possibly all IVs ar e contain nucleoids (Morgan et al., 1955). IVN morphs into the mature virion (MV) in a rapid series of events that involve proteolysis of precursor structural proteins, loss of the D13 s caffold protein, internal protein rearrangement, metamorphosis into a brick shape virus with a de nse biconcave core, and simultaneous exit of the virion from the factory. Most MVs stay cluste red outside of the factories, whereas a small number of MVs continue thei r morphogenesis by acquiring tw o additional Golgi derived membranes, becoming wrapped virions (WV) that are ready for exocytosis. WV exits the cell by fusing its outer membrane with the host cell pl asma membrane and loosing its outer membrane in order to release the extracellular virion (EV) outside of the cell before spreading within the organism. The vaccinia virus exists in two infect ious forms, MV and EV. EV contains two lipid bilayer membranes in contrast to MV, which cont ains one membrane. MV is a tough form of the virus that can exit only by lysing infected cells and is able to spread efficiently between hosts and survive in the outside environment. The a dditional membrane of EV makes it more sensitive to drying; EV is thought to be important fo r cell to cell spread within the organism. Genetic Analysis of Vaccinia Virus A classic forward genetic approach was applie d to study the biology of the vaccin ia virus. A collection of temperature sensitive (ts) mutants was generated in a classic genetic manner and to this day, serves as a valuable tool to investigate the genetic makeup of vaccinia (reviewed in Condit and Niles, 1990; Kato et al., 2008). The ts mutants are defined as viruses with mutations in essential genes and which grow at a low temperature, 31 C (permissive condition),

PAGE 14

14 but do not grow at a high temperature, 39.7C (non-permissive condition). The mutants were created by chemical mutagenesis, followed by random screening for temperature sensitivity, complementation analysis and marker rescue anal ysis that placed them into 38 genes (Condit and Motyczka, 1981; Condit et al., 1983 ; Dales et al., 1978; Kato et al., 2008; Lackner et al., 2003). Further, mutants in each affected gene were subj ected to detailed phenotypic characterization for DNA replication, protein synthesis and assembly of viral particles using electron microscopy. Based on their phenotypes the mutants were placed into three categories: 1) mutants defective in DNA replication; 2) mutants defective in gene expression; and 3) muta nts defective in virus morphogenesis. Preliminary data by Condit and co-workers in itially mapped the mutant Cts52 to a region containing genes E2L through E8R (Lackner et al., 2003). The mutant displayed a normal phenotype at both at 31C and 39.7C that was indi stinguishable from the wild type virus, therefore, the Cts52 was classified in the ca tegory of mutants that a play role in virus morphogenesis. Subsequently, the Cts52 mu tant was subjected to a more detailed characterization and was mapped to the E6R ge ne by marker rescue (N. Moussatch, in preparation). The E6R gene function is unknown and mutants in this gene had never characterized. The analysis of Cts52 under non-permissive conditions revealed normal DNA replication and gene expression, a nd formation of mature virions that were identical to the wild type virion in appearance. However, the mutant virions purified from non-permissive infections were defective in an in vitro virion core transcrip tion reaction, affirming the initial hypothesis that Cts52 was defective in morphogenesis. To continue investigation of the E6R gene, an inducible (ind) mutant vE6i, provided by P. Turner and R. Moyer, was characterized. The pr incipal difference between ts and ind mutants is

PAGE 15

15 in state of the mutant gene product under the non-permissive condition. Under the permissive condition, both mutants behave the same as th e wild type, whereas under the non-permissive condition, a ts mutant may produce a stable but non-functional protein while the ind mutant protein is absent, thus providing an opportunity to examine the vaccinia life cycle in the absence of the E6R gene product. Historically, ts and ind mutants in the same gene may produce radically different phenotypes. Therefore, char acterization of the vE6i mutant was genuinely intriguing and further study promises to uncover the E6R gene function. The E6R Gene In a m ass spectrometry analysis of whole virions, the E6 protein was identified and ranked 13th in abundance among the other seventy proteins that comprise the mature virion (Chung et al., 2006; Yoder et al., 2006). This suggests that the E6 protein is a structural protein of the mature virion, but its exact function is unknown. On a physical gene map of vaccinia, the E6R gene is the sixth gene from the left end of the HindIII E fragment, the R indicating right, which is the direction that the gene is tran scribed. The E6R gene maps to a cluster of housekeeping genes on the vaccinia genome, sugg esting that the E6R gene itself is also conserved. Figure 1-4 shows a phylogeny tree of the alignments of E6R genes throughout the entire Poxviridae family, confirming that the E6 gene is highly conserved; moreover this analysis suggests that E6 is an essentia l protein. E6 has no homology to any other known proteins outside of the poxvirus family. The E6R coding sequence is 1704 nucleotides in length and translates into a 567 amino acid protein with a molecular we ight of 66.6 kilodalton (kDa). Significant insight into E6R gene expressi on can be gained from examining the E6R gene sequence. Figure 1-5 presents the E6 gene sequence with fla nking sequences of adjacent partial E5R and E7R genes on the left and right end respectively. Analysis of the sequence rev eals two signatures that suggest that E6R is a post-repl icative gene. First, the seque nce TAAAA, which is located

PAGE 16

16 immediately upstream of the translation start co don ATG, is a site th at is recognized by RNA polymerase and known as a promoter for intermedia te and late genes. Second, the T5NT motifs embedded throughout the E6R coding sequence are known as termination transcription signals for early genes, therefore the E6 protein can be expressed only la te during infection. To summarize, E6R is a conser ved gene that encodes a late structural prot ein, which is essential in the formation of a mature virion. The precise function of E6R is still unknown and further investigation is needed. Aim of Study Seventy gene products m ake up a mature viral particle and the mutants in fifty of these genes are available for study. Many of these mu tants have been characterized and a gene function revealed. Recent proteomic analysis of the purified vaccinia virion identified E6 protein as a structural protein(Chung et al., 2006; Yoder et al., 2006). Mutants in the E6R gene are available but have not been characterized to da te. The aim of this study is to characterize mutants in the E6R gene in order to determine th e role of E6 in vaccinia virion structure or assembly. To understand the role of the E6 gene in vi ral morphogenesis, two mutants, temperature sensitive mutant Cts52 and induc ible mutant vE6i, have been phenotypically characterized. The Cts52 mutant was investigated by A. Strahl and N. Moussatch (N Moussatch, in preparation). To summarize, Cts52 is a conditi onally lethal mutant with a missense mutation in the E6R gene that results in substitution of the 226th amino acid from proline (P) to leucine (L). The mutant grows at 31C (permissive condition) producing normal E6 protein and lacks growth at 39.7C (non-permissive condition) producing a nonfunctional E6 protein. The ts mutant displays normal patterns of DNA replication and gene expressio n, and electron microscopy indicates normal viral morphogenesis at both temperatures. Mutant viral particles puri fied from infection at the non-

PAGE 17

17 permissive temperature apparently containe d the normal complement of virion proteins, including E6, but were non-infectio us. The isolated mutant viral core was unable to direct viral mRNA synthesis in vitro. The phenotype of Cts52 suggests that the E6 gene may play a subtle role in virus transcription. The vE6i mutant is an inducible mutant constructed in the vaccinia vT7lacOI viral expression vector in which the E6 gene is controlled by a lac operator and T7 promoter. In vE6i, synthesis of the E6 protein occurs only in presence of inducer, IPTG; without IPTG no E6 protein is produced. Phenotypic analysis of the vE6i mutant will provide a unique opportunity to investigate viral morphogenesis in the absence of E6 protein.

PAGE 18

18 Figure 1-1. Vaccinia virus structure. A) Freeze-etch electron micr ograph of virion surface. B) Cryo-section of the virion internal structur e. (Reprinted with permission from Condit et al., 2006; figure 1, page 44). Figure 1-2. Model of vaccinia viru s structure. A) The whole viri on. B) The virion core. C) The sectioned view displays th e virion surface with a lipid bilayer and the internal structure including core with indentations residing latera l bodies and genomic tubules in the center. D-F) The virion sections disp lay internal structure in different planes. G-I) The electron micrographs of viral particle are corresponding to the virion model D-F (Reprinted with permission from Condit et al., 2006; figure 2, page 46; figure 4, page 53).

PAGE 19

19 Figure 1-3. Vaccinia virus life cy cle. IVN-immature virion with nucleoid; MV-mature virion; WV-wrapped virion; EV-extrace llular virion; VITF-viral intermediate transcription factors; VLTF-viral late transcription factor s; VETF-viral early tr anscription factors. See text for additional detail s. (Courtesy of R. Condit).

PAGE 20

20 Figure 1-4. The E6 gene phylogeny tree. Neighb or-Joining with pair wise deletion, Kimura 2 model, boot strapped with 1000 replications.

PAGE 21

21 GGCATTTCATCTTTCTCCAATACTAATTCAAATTGTTAAATTAATAATGGATAGTATAAATAGT TATTAGTGATAAAATAGTAAAAATAATTATTAGAATAAGAGTGTAGTATCATAGATAACTCTCT TCTATAAAA ATGGATTTTATTCGTAGAAAGTATCTTATATACACAGTAGAAAATAATATAGATT TTTTAAAGGATGATACATTAAGTAAAGTAAACAATTTTACCCTCAATCATGTACTAGCTCTCAA GTATCTAGTTAGCAATTTTCCTCAACATGTTATTACTAAGGATGTATTAGCTAATACCAA TTTT TTTGTTTTCATACATATGGTACGATGTTGTAAAGTGTACGAAGCGGTTTTACGACACGCATTTG ATGCACCCACGTTGTACGTTAAAGCATTGACTAAGAATTATTTATCGTTTAGTAACACAATACA ATCGTACAAGGAAACCGTGCATAAACTAACACAAGATGAAAAATTTTTAGAGGTTGCCAAATAC ATGGACGAATTAGGAGAACTTATAGGCGTAAATTATGACTTAGTTCTTAATCCATTATTTCACG GAGGGGAACCCATCAAAGATATGGAAATCA TTTTTTT AAAACTGTTTAAGAAAACAGACTTCAA AGTTGTTAAAAAATTAAGTGTTATAAGATTACTTATTTGGGCTTACCTAAGCAAGAAAGATACA GGCATAGAGTTTGCGGATAATGATAGACAAGATATATATACTCTATTTCAACAAACTGGTAGAA TCGTCCATAGCAATCTAACAGAAACGTTTAGAGATTATATCTTTCCCGGAGATAAGACTAGCTA TTGGGTGTGGTTAAACGAAAGTATAGCTAATGATGCGGATATTGTTCTTAATAGACACGCCATT ACCATGTATGATAAAATTCTTAGTTATATATACTCTGAGATAAAACAGGGACGCGTTAATAAAA ACATGCTTAAGTTAGTTTATATCTTTGAGCCTGAAAAAGATATCAGAGAACTTCTGCTAGAAAT CATATATGATATTCCTGGAGATATCCTATCTATTATTGATGCAAAAAACGACGATTGGAAAAAA TATTTTATTAG TTTTTAT AAAGCTAATTTTATTAACGGTAATACATTTATTAGTGATAGAACGT TTAACGAGGACTTATTCAGAGTTGTTGTTCAAATAGATCCCGAATATTTCGATAATGAACGAAT TATGTCTTTATTCTCTACGAGTGCTGCGGACATTAAACGATTTGATGAGTTAGATATTAATAAC AGTTATATATCTAATATAATTTATGAGGTGAACGATATCACATTAGATACAATGGATGATATGA AGAAGTGTCAAATCTTTAACGAGGATACGTCGTATTATGTTAAGGAATACAATACATACCTGTT TTTGCACGAGTCGGATCCCATGGTCATAGAGAACGGAATACTAAAGAAACTGTCATCTATAAAA TCCAAGAGTAGACGGCTGAACTTGTTTAGCAAAAACATTTTAAAATATTATTTAGACGGACAAT TGGCTCGTCTAGGTCTTGTGTTAGATGATTATAAAGGAGACTTGTTAGTTAAAATGATAAACCA TCTTAAGTCTGTGGAGGATGTATCCGCATTCGTTCGATTTTCTACAGATAAAAACCCTAGTATT CTTCCATCGCTAATCAAAACTATTTTAGCTAGTTATAATATTTCCATCATCGTCTTATTTCAAA GGTTTTTAAGAGATAATCTATATCATGTAGAAGAATTCTTGGATAAAAGCATCCATCTAACCAA GACGGATAAGAAATATATACTTCAATTGATAAGACACGGTAGATCA TAG AACAGACCAAATATA TTATTAATAATTTGTATATACATAGATATAATTATCACATATTAAAAATTCACACATTTTTGAT AA Figure 1-5. The E6R gene sequence. The E6R coding region is underlined. Partial flanking sequences of the E5R and E7R genes on the left and right, respectively, are shown. Translation initiation and termination codons of the E6 gene are shown in blue. The TAAAA sequence (shown in red) located just upstream of the ATG start codon is a promoter for intermediate and late genes. T5NT early transcription termination motifs within the E6 coding region are shown in red.

PAGE 22

22 CHAPTER 2 MATERIALS AND METHODS Cells All experiments were perform ed using conflu ent monolayers of BSC40 cells, a continuous cell line from African green monkey kidney. Cells were maintained in Dulbecco modified Eagle medium (DME) supplemented with 10% fetal bovine serum (FBS, Hyclone) at 37C in a 5% CO2 incubator. Viruses and Plasmids Stocks of the wild type (wt) vacc inia virus (strain WR) and the temperature-sensitive (ts) mutant virus Cts53 were used in infections as controls; conditi ons for virus growth, infections, and virus cultures were previously described (Condit and Motyczka, 1981; Condit et al., 1983). The permissive temperature for the ts mutant is 31C and the non-permissive temperature is 39.7C. The inducible (ind) mutant vE6i was constructed by P. Turner and R. Moyer and generously provided to us for our investigati on. vE6i uses the vT7lacOI vaccinia expression vector (Alexander et al., 1992) with the E6R gene expression under control of the T7 RNA polymerase promoter and Escherichia coli ( E. coli ) lactose ( lac ) repressor and lac operator, described in more detail in th e results section. The vE6i muta nt growth and infections were carried in the presence of 50 M isopropyl -D-1-thiogalactopyranosid e (IPTG). pBD6 is a recombinant plasmid containing 2.6 kb Bst EII concatemer junction of vaccinia virus cloned in the pUC13 bacterial expression plasmid and provided by M. Merchlinsky (Merchlinsky and Moss, 1989). Plaque Assay Confluent 60mm dishes of BSC40 monolayers we re infected with wt and vE6i in 10-fold serial dilutions in PBS-AM (PBS + 1% Albumin +10 mM MgCl2). Following 30 min of

PAGE 23

23 absorption, cells were overlaid with plaque assay media (1 volume 2 X DME + 10%FBS + 1 volume 2% methyl cellulose or + IPTG). Afte r 4 days of incubation at 37C, dishes were stained with crystal violet ( 0.26% crystal violet; 10% ethanol; ~22% formaldehyde) to quantify plaques. One-Step Growth Assay Confluent 35 mm dishes of BSC40 cells were inf ected with wild type and vE6i viruses at a multiplicity of infection (moi) of 10 plaque-formi ng units per cell (pfu/cell) and incubated for 30 minutes at 37C. After absorption, the cells were washed twice with PBS-AM, then DME containing or lacking IPTG was a dded, and the infected cells were incubated at 37C. At 0, 3, 6, 9, 12, 24 hours post infection (hpi), the cells were harvested and viral titers measured by plaque assay. Slot-Blot DNA Analysis 35mm dishes of confluent BSC40 cells were in fected at a moi of 10 pfu/cell as described above. At different times after infection, the inf ected cells were harveste d in loading buffer (10 X SSC; 1 M NH4OAc) and the samples were prepared as described (Damaso et al., 2002). The cell samples were applied in triplicate on an uncharged nylon membrane (GeneScreen), which was assembled in a Slot Blot Minifold II apparatus (Schleiche r and Schuell, Inc.). The DNA samples were denatured in situ with a denaturation solution (1.5 M NaCl /0.5 N NaOH; 10 X SSC) and neutralized with 10 X SSC solution. Th e membrane was then removed from the slot blot apparatus and hybridized with a linea rized vaccinia HindIII E fragment probe [32P]-labeled using a DECAprime II-Random Primed DNA Labeling Kit (Ambion) following the manufacturers protocol. Hybr idization was done in a solution containing 6 X SSC, 50 % formamide, 0.5 % SDS, 5 X Denhardts, 100 g/ml denatured salmon sperm DNA at 42C overnight. The blot was washed once for 20 mi nutes at room temperature and twice for 20

PAGE 24

24 minutes at 50C with wash buffer (6 X SSC, 0.1% SDS, 0.05% Na4P2O7). The blot was analyzed using a phosphor-imager (Storm 860, GE-Healthcare). Metabolic Protein Labeling For pulse-labeling, the cells were inf ected at moi of 10 pfu/cell as described above. At time intervals 0,3,6,9 hpi, [35S]-labeled methionine (Perkin Elme r) in methionine free medium 50 Ci/dish was added, followed by 30 minutes of incubation. After in cubation, the medium was removed and cells were lysed in a Laemml i sample buffer (50 mM Tris-HCl, pH6.8; 1% SDS; 1% glycerol; 100 mM -mercaptoethanol; 0.1% bromophenol blue) and stored at -80C. For pulse-chase, at 9 hpi, [35S]-labeled methionine in meth ionine free media was added for a 30 minute incubation as described above, and then replaced with media supplemented 1 mM unlabelled methionine. Cells were harvested in Laemmli buffer at 12 and 24 hpi. Metabolically labeled proteins for pulse-labeling and pulse-c hase were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by autoradiography (Kato et al., 2004). Electron Microscopy For transm ission electron microscopy (TEM), 60 mm dishes of BSC40 cell monolayers infected with 10 pfu/cell of wild type and vE6i mutant for 24 hr and 48 hr in the presence of absence of IPTG. At the designated times, cell monolayers were rinsed with 0.1 M sodium cacodylate buffer, pH 7.4 and fixed with 2 % glutaraldehyde in 0.1 M cacodylate buffer containing 2 mM MgCl2, 1 mM CaCl2 and 0.25 % NaCl, pH 7.24 (provided by ICBR). Prepared samples were submitted for TEM analysis to th e ICBR Electron Microsco py Core Laboratory of University of Florida.

PAGE 25

25 Southern Blot Confluent 100 mm dishes of BSC40 cells were infected with wild type virus and mutants Cts53 and vE6i as previously described. At 6, 12, and 24 hpi, cells were scraped from the dishes and DNA isolated using a DNeasy tissue kit (Qiagen) following th e manufacturers protocol. Isolated DNA was digested with Bst EII (Promega) for 20 hours at 37C, as described (Damaso et al., 2002). Digested DNA fragme nts were separated on a 1 % agarose gel in TAE buffer, denatured in1.5 M NaCl/0.5 M NaOH, neutralize d in 1.5 M NaCl/0.5 M Tris-Cl, pH 7.0 and transfered to an uncharged nylon membrane (G eneScreen) by Southern blotting using 20 X SSC transfer buffer. The membrane was hybr idized as described above with a [32P]-labeled pBD6 probe and analyzed using a phosphor-imager (Storm 860, GE-Healthcare).

PAGE 26

26 CHAPTER 3 RESULTS The vE6i Construct To investigate the role of the E6R gene in vaccinia morphogenesis, the inducible mutant vE6i constructed by P. Turner and R. Moye r was provided for phenot ypic characterization. Previous published work indicated that a differe nce in the phenotype sometimes exists between ts and ind mutants (Mercer and Traktman, 2005). This difference theoreti cally results from the difference in mechanism of conditional lethal ity of the mutants under the non-permissive condition. In the ts mutant, the target protei n may be stably expressed but nevertheless be nonfunctional, whereas in the ind muta nt the target protein is not expressed at all. Therefore, the analysis of the inducible mutant phenotype provides an opport unity to evaluate how the absence of the E6 protein affects vaccinia biogenesis. The recombinant virus vE6i was constructed us ing the vT7lacOI vaccinia virus vector with expression of the E6 protein controlled by a lac operator/repressor ( lacO/I ) system and regulated by the inducer IPTG. As shown in Figure 3-1, the construct comprises two parts: 1) prokaryotic lac operon transcriptional regulatory elements pos itioned in the thymidine kinase (TK) locus of vaccinia and 2) replacement of the native E6R promoter with lac operator-regulated prokaryotic transcriptional elements. In detail, the TK locu s of the construct contai ns the gene encoding T7 RNA polymerase, which is under control of the vaccinia late promoter P11with a lacO positioned in between. This is followed with the lacI gene placed under control of the constitutively active vaccinia early/late promot er P7.5. Within the endogenous E6R locus, E6R gene is placed under control of the bacteriopha ge T7 RNA polymerase transcriptional promoter and a lacO positioned in between. Also, the construct includes the dominant selectable marker

PAGE 27

27 E. coli guanine phosphoribosyltransferase (gpt) unde r control of the early /late P7.5 vaccinia transcriptional promoter, crucial only dur ing selection of a correct construct. The construct is highly efficient by achieving 99% in suppression of the E6 protein synthesis. The effectiveness build in the vE6i mode of action is as follows : in absence of inducer IPTG (non-permissive condition), the constitutively expressed lacI gene encodes repressors that bind to the lacO and prevents transcription of the gene encoding T7 RNA polymerase and simultaneously suppresses expression of the E6 protein. In the presence of an inducer (permissive condition), IPTG binds to active repressors and indu ces their conformational change, which disable binding of repressors to the lacO The transcriptional complex can assemble and the T7 gene encodes T7 RNA pol ymerase, which binds to the T7 promoter and transcribes the E6 gene, thereby synthe sizing the E6 protein. The vE6i mutant Confirms its Inducible Phenotype The initial step in phenotypic characterization of the vE6i m utant was to evaluate the mutants basic growth properties by plaque assa y. This analysis answers the fundamental questions of: 1) whether the vE6i mutant was able to grow and form plaques and 2) whether the mutant was repressible, so that morphogenesis could be studied in the absence of the E6 protein. Accordingly, confluent monolayers of BSC40 cells were infected with vE6i in 10-fold serial dilutions, overlayed with plaque medium in the pr esence or absence of IPTG. After 4 days of incubation, the plaques were visual ized (Figure 3-2). In the pres ence of the IPTG, vE6i formed plaques throughout the 10-7 dilution, which demonstrates the mutants ability to produce infectious viral particles in a fash ion equivalent to wild type virus. In the absense of inducer, the plaques were evident only at the 10-3 dilution proving that the mutant is inducible. Wild type virus formed plaques with equal efficiency in th e presence and absence of IPTG (Figure 3-3). The plaques formed by vE6i at low dilution in th e absence of IPTG are presumably revertants.

PAGE 28

28 Spontaneous reversion could involve mutational inac tivation of the lacI which thus allows expression of the E6R gene in the absence of inducer. The reversion rate is 1 in 30,000, which is not sufficiently significant to distort the results of the phenotypic characterization of the mutant. It is noteworthy that under the permissive condi tion vE6i produces plaques that are smaller in size compare to wild type (Figure 3-3). In an attempt to increase the plaque size of vE6i, we tested IPTG at a variety of concentrations: 25, 50, 75, and 100 M. The results showed that at 25 M IPTG there was a 50 % decrease in plaques si ze (Figure 3-3) and c ount (data not shown) compared to 50 M; there is no difference in the pl aque size or quantity using IPTG concentrations above 50 M. Thus, the use of the 50 M concentration was continued. Noteworthy mentioning that many inducible constr ucts are form significantly smaller plaques compare to wild type that could be due to redu ced virus spread to nearby cells. Based on the plaque assay, it was concluded that the vE 6i mutant has a tightly inducible phenotype; consequently it is a reliable mutant candidate for study of the E6R gene. The E6 Protein is Essential in Virus Biogenesis To quantitatively evaluate whet her the E6 protein is essentia l in the vaccinia viral cycle, the vE6i m utant was analyzed using a one-step growth assay. The ultimate goal of this assay is to investigate the time course of virus replication in the absence of the E6 protein. Confluent cell monolayers were infected with w ild type virus or the vE6i mutant at a moi of 10 pfu/cell and grown in the presence of absence of IPTG. At various times, the cells were harvested and viral titers measured by plaque assay. Figure 3-4 displa ys graphs of viral growth curves for each virus under the permissive and non-permissive conditions Wild type infection under the permissive and non-permissive condition has the same pattern : in the first hours afte r infection the virus attaches to the cells, follow by eclipse in the gr owth curve by 3 hpi, where the virus enters the cells, uncoats, and viral infectivity is lost, followed by rapid virus growth where the virus

PAGE 29

29 replicates, producing by 24 hpi, 34 and 38 particles per cell respectively. On the graph for the vE6i mutant, the growth pattern in the presence of IPTG is sim ilar to the wild type overall, though lagging in virus growth up to 6 hpi, it then catches up by 24 hpi producing 50 particles per cell. In the absence of IPTG replication of the vE6i mutant is significantly reduced forming approximately 0.2 infectious particles per cell. The fact that the vE6i mutant failed to replicate at the non-permissive condition, confirms that the E6 protein is vital for the virus life cycle. The vE6i mutant is Normal in DNA Replication To uncover which step of viral growth is affected by the E6R gene, DNA synthesis was m easured in a vE6i infection done under permi ssive and non-permissive conditions. Cells were infected with wild type and vE6i in the presen ce and absence of IPTG. At designated times, cells were harvested, DNA isolated and accumulati on of DNA measured in a slot blot protocol by hybridization to a radioactivel y labeled vaccinia DNA probe (Mat erials and Methods). A plot of DNA replication during wt and vE6i infections in the presence or absence of IPTG is shown in Figure 3-5. The curves of a ll four infections e xhibit identical DNA synthesis pattern with steep growth launched at early hours after inf ection reaching a maximum at 12 hpi and followed by a plateau. Therefore the vE6i mutant is not defective in DNA synthesis showing that the E6R gene is not essential fo r vaccinia DNA replication. The vE6i mutant is Normal in Protein Synthesis; but Defective in Proteolysis Since the vE6i m utant is not defective in DNA replication, th e next step was to examine vE6i in protein synthesis and proteolysis of the major virion structural precursor proteins, p4a and p4b, which is required for the transition during virus assembly from immature to mature virions. Accordingly, cells were infected with wt and vE6i viruses under permissive and nonpermissive conditions. At designated times, the infected cells were pulsed with radioactively labeled methionine, the cells were harveste d, and cell extracts we re separated by gel

PAGE 30

30 electrophoresis and visualized by autoradiography (Figure 3-6). At early hours, host cell protein synthesis is apparent, then it shuts off by 3 hpi a nd early viral protein synt hesis takes place. By 6 hpi, late proteins were synthesized and pe rsisted throughout infection including precursor proteins p4a and p4b. Analysis of metabolically labeled proteins in wt and vE6i infections suggested that protein synthesis during vE6i infection is equivale nt to the wild type infection. Further, vE6i was examined for proteolytic pr ocessing of precursor proteins p4a and p4b. Proteolysis in vaccinia virus is represented by a cleavage of precursor proteins p4a (102 kDa) and p4b (73 kDa) into the final pr oduct proteins 4a (62 kDa) and 4b (60 kDa) respectively (Kato et al., 2004). Proteolytic processing serves as a major indicator of the transition from immature to mature virions. Cells infected with wt and vE6i under permissive and non-permissive conditions were metabolically la beled at 9 hpi, chased, and th en harvested at 12 and 24 hpi. Proteins were separated by ge l electrophoresis and visualized by autoradiography. The same pattern was evident in the wild type infection in the presence or absence of the inducer and in the vE6i infection in presence of inducer. At 9 hpi the precursor proteins p4a and p4b appeared on the gel as bands of 102 and 73 kDa. At 12 a nd 24 hpi, a reduction in the intensity of the precursor bands at 102 kDa and 73 kDa was observed and at the same time, additional bands 62 kDa and 60 kDa appeared that were the cleaved 4a and 4b products respectively. In the vE6i infection without IPTG, the intensity of the bands of precursor proteins was unchanged at 12 and 24 hpi and no additional bands were detectible. Thus proteolysis of virion struct ural precursor proteins is defective in the vE6i infection under non-permissive conditions. Failure in the proteolysis of the major precursor proteins indicates that vE6i is defective in morphogenesis. The vE6i mutant Fails to Form Mature Virions Late during infection, all steps of virus m or phogenesis in the host cell cytoplasm can be observed using electron microscopy. The fact that the vE6i mutant is defective in proteolysis

PAGE 31

31 theoretically predicts incomplete viral morphogenesis duri ng vE6i infection. In contrast, analysis of the temperature se nsitive mutant Cts52 confirmed that proteolysis took place and mature virions were assembled (A. Strahl and N. Moussatche, personal communication). Therefore, examining EMs and visually comparing the morphogenesis of Cts52 and vE6i mutants could provide insight into E6R gene functi on. Thus, cells infected with the vE6i mutant under permissive and non-permissive conditions were fixed at 24 hpi and 48 hpi and submitted to ICBR for EM analysis. Electron micrographs of cells infected with wild type virus or with Cts52 at 31C and 40C were available for examina tion as controls. Figure 3-7A is an electron micrograph of the wild type infection at 40C (non-permissive for Cts52 infection) fixed at 24 hpi and serves as a control for EMs with both mutants. All stages of vaccinia virus morphogenesis were observed in infection with wild type virus including crescents (C), immature virions (IV), immature virion with nuc leoid (IVN) and mature virions (MV). EMs with the Cts52 mutant at the pe rmissive temperature at 24 hpi (Figure 3-7B and D) and the nonpermissive temperature at 24 hpi (Figure 3-7E) displayed viral assembly indistinguishable from the wild type. In Figure 3-8A and B, infection with vE6i under permissi ve conditions exhibited normal viral morphogenesis with mature virions clustered in the host cell cytoplasm. By contrast, the infection with vE6i under non-perm issive conditions (F igure 3-8C, D and F) revealed aberrant morphogenesis: only empty IVs were present; filled IVs, IVNs and MVs were absent. In addition, large dense crystalloids localized in the pe riphery of the DNA factories were observed in the cytoplasm. These findings sugg ested that morphogenesis is arrested prior to formation of normal IV and are consistent with vE6i defective proteolysis, which is critical in the formation of mature virions.

PAGE 32

32 Genomic Concatemers are Resolved in vE6i Infected Cells The crystalloids and em pty IVs observed in the cytoplasm of vE6i infected cells under non-permissive condition were a sign that repl icated DNA was accumulated in large aggregates instead of packaged into IVs. Vaccinia DNA replicates in multi-genome concatemers in the early stages of vaccinia morphogene sis (Moyer and Graves, 1981). In the late stage of infection, concatemers are resolved into single genomes that can be packaged into viral particles (Merchlinsky and Moss, 1989) (Figur e 3-9). Therefore, the occurrence of crystallo ids could be due to accumulation of unresolved DNA. To test th is hypothesis, vE6i was subjected to analysis for concatemer resolution. DNA was isolated from cells infected with the wild type, Cts53, and vE6i mutant under permissive and non-permissive conditions. Cts53 is a temperature sensitive mutant defective in the concatemer resolution at 40C and served as a control (Merchlinsky and Moss, 1989). Isolated DNA was digested with the Bst EII restriction enzy me, separated by gel electrophoresis and transferred to a membrane by Southern blotting. The blot was hybridized with a DNA probe containing the 2.6 kb vaccinia concatemer junction and then was visualized by autoradiography. If concatemers are resolv ed, monomeric genome ends will yield a 1.3 kb fragment whereas unresolved junctions will yield 2.6 kb fragments (Figure 3-10). The analysis of the vE6i infection showed that prominent bands of 1.3 kb are evident in permissive and nonpermissive conditions confirming that concatemer s were resolved analogous to the wild type infection (Figure 3-11). Mature Virions Formed after Inducer Added in Blocked Morphogenesis Electron m icroscopy revealed that in the ab sence of IPTG, vE6i failed to form MVs; instead empty IVs and large dense crystalloids were observed in the cytoplasm of infected cells. To understand the nature of the crystalloids, two questions were asked: 1) if permissive conditions are introduced to infections which we re initiated under non-permissive conditions and

PAGE 33

33 therefore blocked in morphogenesis, can the viral assembly complete and form mature virions?; 2) if crystalloids are composed of replicated DNA, can this nucleic acid be packaged to assemble new virus? To address these questions, cells we re infected with vE6i under the non-permissive condition for 24 hours to induce formation of crysta lloids. Subsequently, one set of cells was incubated in the presence of IPTG, another set of cells was inc ubated in the presence of IPTG and the DNA replication inhibitor cytosine arab inoside (CAR), and anot her set of cells was incubated in the absence of IPTG as a control. Infected cells were harvested at designated times and viral titers were measured by plaque assay. The results show that when inducer alone or inducer plus CAR were added to infections whic h had been blocked in morphogenesis, new virus was synthesized producing 0.36 and 0.32 particles per cell respectively. The vE6i control infection in the absence of the inducer showed no change with 0.07 part icles per cell produced (Figure 3-12). The synthesis of new virus af ter addition of IPTG indicates that arrested morphogenesis is reversible. The fact that synt hesis of the same amount of new viral particles was produced in the presence of absence of CA R suggests that new virus formed exclusively from existing DNA since CAR inhibits de novo DNA replication. This pr eliminary data provide stronger evidence in support of th e hypothesis that formed crystall oids consist of replicated DNA which under permissive conditions ca n be processed and packaged into new viral particles. To further assess the crystalloids as a source of DNA for new virus synthe sis, the experiment described here should be repeated simultaneously with electron microscopy of crystalloids in absence of IPTG and after addition of IPTG and IPTG plus CAR. The EMs will provide visual evidence for processing of crystalloids after addition of IPTG in order to make new virus and completely reverse blocked morphogenesis.

PAGE 34

34 Figure 3-1. The vE6i construct. Scheme of th e functional mechanism of the vE6i construct. Under the non-permissive condition (-IPTG), the lac repressor (lacI) synthesizes active repressors that bind to the lac operator ( lacO ) inhibiting both T7 RNA polymerase and E6R gene transcription. Under the permissive condition (+IPTG), the inducer binds to repressors and inactiv ates them. The T7 RNA polymerase gene transcribed from the vaccinia late promoter P11, synthesizes T7 RNA polymerase that binds to the T7 promoter and transcribes the E6R gene.

PAGE 35

35 Figure 3-2. Plaque assay of vE6i in presence or absence of IPTG. BSC4 0 cells infected with vE6i in 10-fold dilutions as indicated and grown in presence or absence of IPTG for 4 days, followed by crystal violet staining. Figure 3-3. Comparison of plaque morphology for cells infected w ith wild type vaccinia and the vE6i mutant. BSC40 cells were infected with wild type WR and vE6i in 10-fold dilutions and grown in presence or absence of IPTG for 4 days, followed by crystal violet staining. The wild type forms normal size plaques in presence or absence of IPTG, while the small plaque size was obser ved in vE6i infection with or without IPTG.

PAGE 36

36 Figure 3-4. One-step growth assay of the wild type and vE6i viruses. BSC40 cells infected with 10 pfu/cell of wt and vE6i viruses in the pr esence or absence of IPTG, harvested at 0, 3, 6, 9, 12, 24 hour post infection (hpi) and virus titers measured by plaque assay. The X-axis presents hours post infection at which virus was harvested and the Y-axis displays the number of vi ral particles per cell produ ced at the designated time.

PAGE 37

37 Figure 3-5. The DNA replication. BSC40 cells were infected with 10 pfu/cell of wild type WR and vE6i viruses, harvested at designated times, and hybridized with a radiolabeled vaccinia DNA probe (Materials and Methods). On the left is a phosphorimage of the hybridized slot-blot. The thre e columns are replicate samples. The last two rows are samples of uninfected cells used as a negative control. On the right is a graph of the phosphorimage data. The X-axis and Y-ax is represent hours post infection and arbitrary units from the phosphor-imager, respectively.

PAGE 38

38 Figure 3-6. Protein synthesis and protein processing in infections with wild type WR and vE6i mutant in the presence and absence of IPTG PL, pulse-labeling; PC, pulse-chase; *, host proteins. Red lines indicate proteins p4a and p4b before pr oteolytic processing with MW of 102 kDa and 73 kDa respectivel y; proteins 4a and 4b after processing have MW of 62 and 60 kDa respectively. Above each autoradiogram the hours of post infection are indicated. At the left of each autoradiogram are indicated the migration of protein standards with molecu lar weights in kDa. For protein labeling (PL), infected cells were pulsed with [35S]-methionine for 30 min and harvested. For pulse-chase (PC), at 9 hpi [35S]-methionine was added for 30 min then removed, replaced with unlabeled methionine supplem ented media, and cells were harvested at 12 and 24 hpi. In PL and PC, the cells lysates were examined by SDS-PAGE and autoradiography.

PAGE 39

39 Figure 3-7. Electron microscopy of the wild ty pe and the Cts52 mutant infections. F, DNA factories; C, crescents; IV, immature viri ons; IVN, immature virions with nucleoids; MV, mature virions. A) EM of wt virus inf ection for 24 hr at 40C used as a control. All stages of virus morphogenesis were obser ved. (EM courtesy of Dr. Sayuri Kato.) B-D) Infection with Cts52 grown at 31C 24 hr. E) Cts52 at 40C, 24 hr. (EM courtesy of Audra Strahl.).

PAGE 40

40 Figure 3-8. Electron microscopy of the vE6i mutant. A) and B) cells infected with vE6i in the presence of 50 M IPTG, 24 hr. Infected cells are indistinguishable from wt virus infection. C-F) vE6i-IPTG infected cells 24 hr. Empty IVs and crystalloids are evident. The arrowheads in D and F point to crystalloids.

PAGE 41

41 Figure 3-9. Scheme for DNA replica tion. A) In the vaccinia viru s infection DNA replicates in a head-to-head, tail-to-tail fashion resulting in a large multi-genome molecule. B) The multi-genome molecule resolves into single genomes, catalyzed by a viral resolvase enzyme late during infection. Figure 3-10. Vaccinia concatemer junctions. Digestion with Bst EII enzyme releases either A) 2.6 kb fragment is represent a concatemer junction, B) 1.3 kb fragments are signify mature hairpins.

PAGE 42

42 Figure 3-11. Concatemer resolution in infections with wild type WR, Cts53, vE6i viruses. BSC40 cells were infected with 10 pfu/cell in presence or absence of IPTG for vE6i, 31C and 40C for the wild type WR and the Cts53 mutant. Cells were harvested at designated times and hybridized with a [32P] labeled vaccinia DNA probe. The 1.3 kb and 2.6 kb bands are represent in reso lved and not resolved concatemers respectively. The 11.2 kb band hybridized with the DNA probe was derived from repeat sequences in the vaccinia genome also present in the probe. Figure 3-12. The vE6i block in a ssembly is reversible in absence de novo DNA synthesis. BSC40 cells were infected with 10 pfu/cell of vE6i in absence of IPTG for 24 hours, follow by addition of IPTG, or IPTG+CAR, or no IPTG. At various times, the cells were harvested and viral titers were meas ured by plaque assay. The X-and Y-axis indicate hours after in fection at which cells were harves ted and the infectious particle count, respectively.

PAGE 43

43 CHAPTER 4 DISCUSSION Poxviruses have left deep footprints in hist ory as the causative agent for a disease with high m ortality and as the base for vaccination, which began new era in medicine. The unique structure of poxviruses has attracte d many scientists and led to extensive research in the past few decades. Substantial knowledge about poxviruses has been gained from the study of the vaccinia virus, which is used as a model to understand the biology of the poxvirus family. Approximately seventy gene products comprise the vaccinia virion; the functional impact of mutations in fifty genes which affect a virion morphogenesis has been characterized and the gene function revealed. The E6R gene product was identified among virions structural proteins; however the E6R function is unknown. Understanding role of the E6R gene will advance our knowledge of poxvirus structure and assembly. Two mutants Cts52 and vE6i were availabl e to investigate the E6R gene function. Experimental data of the Cts52 phenotype was an alyzed and the phenotype of the vE6i mutant was experimentally determined and examined in this study. Cts52 and vE6i displayed a normal phenotype in DNA and protein synthesis, that is, indistinguishable from wild type virus. However, whereas Cts52 showed normal protein processing and formation of MVs, vE6i revealed defective proteolysis and morphogenesis th at arrested before IV formation. Particles purified from Cts52 infections done under non-permissive conditions were non-infectious and failed transcribe in vitro even though they pack aged the normal complement of enzymes. In summary, the analysis of both mutants revealed th at E6R is an essential gene expressed late during infection and plays a dual role in vacc inia morphogenesis: 1) transcription; 2) encapsidation of DNA into IVs.

PAGE 44

44 Examination of the vE6i construct where the E6 protein is absent under a non-permissive condition showed that E6 is essential in the vacci nia life cycle. In the absence of an inducer, assembly of new infectious viral particles failed, suggesting an e ssential role of E6 in replication. This is consistent with the physical position of E6R in the vaccinia genome among the housekeeping genes, which are conserved throughout entire poxvirus family and historically have proven to be vital in virus li fe cycle. Also, it is consiste nt with alignments of every E6R gene in all poxviruses, which confirmed the E6R gene is conserved throughout entire poxvirus family and therefore essential. To determine in what class in the temporal gene expression cascade the E6R gene belongs, the coding sequence of the E6 gene was examined. Both, the presence of a post-replicative gene transcription promoter signature sequence, TAAA A, just upstream of the E6R translation start codon, and the presence of T5NT early gene transcription termination sequences, suggests that E6R is a post-replicative gene. Post-replicative genes are defined as intermediate and late genes that are only transcribed after viral DNA replication. Furthermore, an antibody was raised against the E6 polypeptide and test ed in the wild type and the Cts52 mutant infections by western blot. The kinetic analysis of E6 protein accumulation in viral infection showed that the E6R gene was expressed exclusively la te during infection, thus assigni ng E6R to late temporal gene class (N. Moussatch, in preparation). In the recent mass spectrometry of the purif ied virion particle, the E6 protein was identified (Chung et al., 2006; Yoder et al., 2006). To further investigate the E6 protein, vaccinia virions from wild type and Cts52 infection under permissive and non-permissive conditions were purified, treated with the neutral detergent NP40, and fractionated by centrifugation into a soluble fraction containing membra ne proteins and insoluble fract ion containing core proteins,

PAGE 45

45 then tested with E6 antibody. Th e results showed that E6 is localized exclusively in a core fraction and is not found in the solubilized membra ne fraction (N. Moussatc h, in preparation). Based on an algorithm of the TransMem method (Sonnhammer et al., 1998), an alignment amino acid sequences with known transmembrane heli ces, predicted that th e E6 protein has no transmembrane domains. The published experime ntal data demonstrate that most vaccinia membrane proteins possess transmembrane domains. Absence of transmembrane domain in E6 protein is consistent with finding of E6 in a co re fraction of purified vi rion; therefore E6 is positively a core protein. Transmission electron microscopy of the vE 6i mutant under non-permissive conditions showed an arrested morphogenesis; only empty IVs were evident and dense crystalloids were observed in periphery of DNA factories. This ph enotype correlates with the observation that the vE6i mutant is defective in the proteolysis of the precursor proteins p4a and p4b, which is essential for the formation of mature virions By contrast, the Cts52 mutant under nonpermissive condition was displayed a normal phenot ype in proteolysis and assembly of mature virions. It seems that synthesi s even nonfunctional E6 protein is enough to proceed to the next step in morphogenesis and the absence of E6 completely disrupts the assembly of new particles just before IV formation. A similar phenot ype as the vE6i mutant under non-permissive conditions is observed with mutants in a seven protein complex, containi ng the viral structural proteins F10, A30, G7, J1, D2, D3, A15(Szajner et al., 2001; Szajner et al ., 2004a; Szajner et al., 2004b). Studies with seven protein complex muta nts revealed a physical connection of these proteins with each other that forms complex essen tial for the association of viroplasm with IVs. Mutations in any gene in this complex resulted in the same phenotype as vE6i, specifically, the accumulation of empty IVs and formation of crystalloid aggregates. Also, a similar phenotype

PAGE 46

46 described as DNA paracrystals and aberrant membranes was obs erved by Dales in temperature sensitive mutants in E6R gene, Dts41 and Dt s80 that were characterized using electron microscopy (Dales et al., 1978), then later gene tically analyzed and phe notypically characterized by Condit and co-workers (Lackner et al., 2003). As a result of phenotypic similarities of the seven protein complex and E6R gene, the role of E6R in the encapsidation of viroplasm into IVs is proposed. A search in the Poxvirus Bioinf ormatics Resource Center showed a computerpredicted DNA binding affinity of E6 protein that supports the hypothesis of the E6 plays role in physical association by binding of growing viral membranes with the viroplasmic DNA that results in formation of complete IVs. Similar to the E6 protein, the poxvirus database predicts a DNA binding affinity for the G7 protein. Also as E6 was found to be a core protein, previous studies with seven protein complex showed that a ll proteins except J1 found to be core proteins (Szajner et al., 2001; Szajner et al., 2004b). Even though E6 protei n is apparently absent from the seven protein complex, the existence of anot her protein sub-complex that includes E6 is suggested. The absence of E6 might prevent prot ein-protein interaction within the sub-complex and disrupt its assembly that is essential to association of viroplasm and crescents to form immature virions. Therefore, E6 protei n is crucial in the formation of MVs. The fact that the absence of the E6 protein results in formation cr ystalloids and empty IVs suggested that the E6R gene may play a role in DNA resolution. In vaccinia virus, DNA replicates at early times during infection resu lting in large multi-genome concatemers. The resolution of a multi-subunit DNA molecule in to single genomes takes place late during infection and is a required even t in order to package the genome and complete morphogenesis. The unresolved DNA is not able to package into IVs but instead is force to condense and form crystalloids that lead to arrested morphogenesis. The fact that the crys talloids contain DNA was

PAGE 47

47 experimentally proven by antiDNA labeling in infection with muta nt in A10L gene (Heljasvaara et al., 2001). The A10L gene encodes precursor p4a core prot ein, proteolytic processing of which is critical to formation mature virions The inducible mutant in A10L gene under nonpermissive condition displayed a phenotype similar to vE6i, notably empty IVs and crystalloids. Even though the A10 mutant was normal in con catemer resolution, the replicated DNA was not able to package but instead condensed in large dense aggregates. The vE6i infection under nonpermissive conditions was also normal for concatemer resolutions. Therefore, we conclude that formation of crystalloids is not a result of unresolved DNA concatemers. To further understand the nature of crysta lloids, we assessed whether the block to morphogenesis is reversible and whether the cond ensed DNA is viable for packaging in order to produce MVs. The infection was initiated under a non-permissive cond ition that normally results in blocked morphogenesis; later followed by incubation under permissive condition or under permissive condition in presence of a DNA repl ication inhibitor in order to assess the fate of existing DNA. In both cases, an equal amount of new infectious vira l particles was formed indicating that blocked morphogene sis is reversible in presence of E6 protein. These findings suggest that mature virions can be formed from existing DNA, presumably from crystalloids. Although virus synthesis in a sing le round of wild type and vE6i infections at permissive conditions after 24 hours produced 38 pfu/cell and 50 pfu/cell respectively; in blocked morphogenesis after incubation for 24 hours at permissive conditions only 0.32 pfu/cell was produce. Considering this 100-fold difference, we assumed that in blocked morphogenesis some replicated DNA is scattered in viroplasm and not yet condensed into crystalloids could contribute to synthesis of new virus instea d of DNA from crystalloids. Th e experimental data confirmed that in vE6i infection under non-permissive conditions, DNA replication was indistinguishable

PAGE 48

48 from wild type. Therefore, the infection initiate d even under non-permissive condition should contain enough DNA to form new virus. Ther efore, if condensed DNA from crystalloids processed in order to make new virus, we should observed higher quantity of new virus synthesis. This finding suggests that crysta lloids are possibly terminal even though the blocked morphogenesis is reversible to certain extent. To verify the source of DNA in formation of new virus, reversible morphoge nesis should be repeated in parallel with electron microscopy to visualize if crystalloids are processed wh en permissive conditions are introduced. Also, construction of epitope-tagged E6 virus could se rve as an effective tool to examine the E6 protein using electron microscopy an d to determine if newly synthesi zed E6 protein is targeted to empty IVs or to crystalloids in order to trigger the condensed DNA to disaggregate and package to form MVs. The epitope-tagged E6 construc t could also be used to immunopurify proteins associated with the E6 protein, which would reve aled whether E6 is part of a protein complex involved in encapsidation of viropl asm. Also, the proteins of E6 complex could reveal more information about mechanism of viroplasm encapsidation. We suggest that newly synthe sized E6 protein functions as follows: a DNA binding subcomplex containing the E6 protein binds to replicated DNA forming a tubule-shaped nucleoprotein complex. Then the nucleoprotein containing the E6 sub-complex associates with the seven-protein complex, followed by genome encapsidation and formation of immature virions filled with viroplasm. The similar phe notype in mutants of seven-protein complex and the E6 protein suggests their possible association. To verify that E6 becomes the part of nucleoprotein complex, we could use the tagged E6 construct proposed above to localize E6 protein using electron microscopy.

PAGE 49

49 In conclusion, based on experimental data, the E6R gene was shown to be essential in virus morphogenesis and play dual role as suggested by the vE6i muta nt where E6 is essential in packaging the vaccinia genome into IVs; the Cts52 s uggests that E6 is essential in transcription. The exact role of E6 protein is still unknown a nd further characterization of Cts52 and vE6i will provide more information about the E6R ge ne and extend our knowledge of poxviruses.

PAGE 50

50 REFERENCE LIST Alexander, W. A., Moss B., Fuerst, T. R., 1992. Regulated expression of foreign genes in vaccinia virus under the control of bacteriophage T7 RNA polymerase and the Escherichia coli lac repressor. J.Virol. 66, 2934-2942. Chung, C. S., Chen, C. H., Ho, M. Y., Huang, C. Y., Liao, C. L., Chang, W., 2006. Vaccinia virus proteome: identification of proteins in vaccinia virus intracellular mature virion particles. J.Virol. 80, 2127-2140. Condit, R. C., Motyczka, A., 1981. Isolation and preliminary characterization of temperaturesensitive mutants of vaccinia virus. Virology 113, 224-241. Condit, R. C., Motyczka, A., Spizz, G., 1983. Is olation, characterization, and physical mapping of temperature-sensitive mutants of vaccinia virus. Virology 128, 429-443. Condit, R. C., Moussatche, N., Traktman, P., 2006. In a nutshell: structure and assembly of the vaccinia virion. Adv.Virus Res. 66, 31-124. Condit, R. C., Niles, E. G., 1990. Orthopoxvirus genetics. Curr.Top.Microbiol.Immunol. 163, 139. Dales, S., Milovanovitch, V., Pogo, B. G., Weintraub, S. B., Huima, T., Wilton, S., McFadden, G., 1978. Biogenesis of vaccinia: isolation of conditional lethal mutants and electron microscopic characterization of their phenot ypically expressed defects. Virology 84, 403428. Damaso, C. R., Oliveira, M. F., Massarani, S. M., Moussatche, N., 2002. Azathioprine inhibits vaccinia virus replication in both BSC-40 and RAG cell lines acting on different stages of virus cycle. Virology 300, 79-91. Griffiths, G., Wepf, R., Wendt, T., Locker, J. K., Cyrklaff, M., Roos, N., 2001. Structure and assembly of intracellular matu re vaccinia virus: isolated-p article analysis. J.Virol. 75, 11034-11055. Heljasvaara, R., Rodriguez, D., Risco, C., Carrasc osa, J. L., Esteban, M., Rodriguez, J. R., 2001. The major core protein P4a (A10L gene) of vacc inia virus is essential for correct assembly of viral DNA into the nucleoprotein complex to form immature viral particles 17. J.Virol. 75, 5778-5795. Kato, S. E., Moussatche, N., D'Costa, S. M., Bai nbridge, T. W., Prins, C., Strahl, A. L., Shatzer, A. N., Brinker, A. J., Kay, N. E., Condit, R. C., 2008. Marker rescue mapping of the combined Condit/Dales collection of temperatur e-sensitive vaccinia virus mutants. Virology 375, 213-222. Kato, S. E., Strahl, A. L., Moussatche, N., Condit, R. C., 2004. Temperature-sensitive mutants in the vaccinia virus 4b virion structural protein assemble malformed, transcriptionally inactive intracellular mature virions. Virology 330, 127-146.

PAGE 51

51 Lackner, C. A., D'Costa, S. M., Buck, C., Condit, R. C., 2003. Complementation analysis of the dales collection of vaccinia virus temperature-sensitive mutants. Virology 305, 240-259. Mercer, J., Traktman, P., 2005. Gene tic and cell biological characte rization of the vaccinia virus A30 and G7 phosphoproteins. J.Virol. 79, 7146-7161. Merchlinsky, M., Moss, B., 1989. Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression. J.Virol. 63, 1595-1603. Morgan, C., Ellison, S. A., Rose, H. M., Moore, D. H., 1955. Serial sections of vaccinia virus examined at one stage of development in th e electron microscope. Exp.Cell Res. 9, 572-578. Moss, B., 2007. Poxviridae: The Viruses and Their Re plication. In: D. M. Knipe, P. M. Howley (Eds.), Fields Virology. Wolters Kluwer-Lippincott Williams & Wilkins, Philadelphia, pp. 2906-2945. Moyer, R. W., Graves, R. L., 1981. The m echanism of cytoplasmic orthopoxvirus DNA replication. Cell 27, 391-401. Roos, N., Cyrklaff, M., Cudmore, S., Blasco, R ., Krijnse-Locker, J., Griffiths, G., 1996. A novel immunogold cryoelectron microsco pic approach to investigate the structure of the intracellular and extracellu lar forms of vaccinia virus. EMBO J. 15, 2343-2355. Sodeik, B., Krijnse-Locker, J., 2002. Assembly of vaccinia virus revisited: de novo membrane synthesis or acquisition from th e host? Trends Microbiol. 10, 15-24. Sonnhammer, E. L., von, H. G., Krogh, A., 1998. A hidden Markov model for predicting transmembrane helices in protein sequences. Proc.Int.Conf.Intell.Syst.Mol.Biol. 6, 175-182. Szajner, P., Jaffe, H., Weisberg, A. S., Moss, B., 2004a. A complex of seven vaccinia virus proteins conserved in all chor dopoxviruses is required for the association of membranes and viroplasm to form immature virions. Virology 330, 447-459. Szajner, P., Weisberg, A. S., Moss, B., 2004b. P hysical and functional interactions between vaccinia virus F10 protein kinase and virion assembly proteins A30 and G7. J.Virol. 78, 266-274. Szajner, P., Weisberg, A. S., Wolffe, E. J ., Moss, B., 2001. Vaccinia virus A30L protein is required for association of vira l membranes with dense viroplasm to form immature virions. J.Virol. 75, 5752-5761. Yoder, J. D., Chen, T. S., Gagnier, C. R., Vemulapalli, S., Maier, C. S., Hruby, D. E., 2006. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins. Virol.J. 3, 10.

PAGE 52

52 BIOGRAPHICAL SKETCH Olga Boyd graduated with BS and MS in m ech anical engineering fr om Tomsk University, Russia. After moving to USA, she followed he r life-long passion for biology. After completing her masters degree in molecular genetics and microbiology, she plans to pursue a career in biological sciences.