<%BANNER%>

Using Population Genetics of Human Head and Clothing Lice to Elucidate Human Evolution

University of Florida Institutional Repository
Permanent Link: http://ufdc.ufl.edu/UFE0022715/00001

Material Information

Title: Using Population Genetics of Human Head and Clothing Lice to Elucidate Human Evolution
Physical Description: 1 online resource (49 p.)
Language: english
Creator: Toups, Melissa
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: humanus, pediculus
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Parasites are often used as proxies for investigating their host evolution. This is particularly common in the study of human evolution. In this study, I use the genetics of human head and clothing lice to address the origin of clothing use in humans and develop new microsatellite loci to further the study of louse population genetics. Parasitic head and clothing use may be used to address the origin of clothing use because the divergence between these taxa is indicative of a minimum age of clothing use. When humans lost their body hair 1.2 million years ago, lice that once roamed the entire body were isolated on the head, and recolonized the body with the advent of clothing use. Coalescent analyses of multilocus data indicate that head and clothing lice diverged between 650,000 and 700,000 years ago, indicating that clothing was an innovation of archaic hominids, not modern humans as previously thought. This is consistent with several other lines of evidence for an archaic origin of clothing, such as the presence of archaic hominids in high latitudes during this time period and the appearance of tools used to scrape hide 300,000 years ago. Furthermore, our analyses indicate that only a small proportion of head lice initially colonized clothing. Finally, I developed eleven polymorphic microsatellite loci for head and clothing lice. All loci were tested on eighteen head louse individuals, and the number of alleles ranged from three to seven. These loci will be valuable for further study of louse population genetics.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Melissa Toups.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Reed, David L.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022715:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022715/00001

Material Information

Title: Using Population Genetics of Human Head and Clothing Lice to Elucidate Human Evolution
Physical Description: 1 online resource (49 p.)
Language: english
Creator: Toups, Melissa
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: humanus, pediculus
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Parasites are often used as proxies for investigating their host evolution. This is particularly common in the study of human evolution. In this study, I use the genetics of human head and clothing lice to address the origin of clothing use in humans and develop new microsatellite loci to further the study of louse population genetics. Parasitic head and clothing use may be used to address the origin of clothing use because the divergence between these taxa is indicative of a minimum age of clothing use. When humans lost their body hair 1.2 million years ago, lice that once roamed the entire body were isolated on the head, and recolonized the body with the advent of clothing use. Coalescent analyses of multilocus data indicate that head and clothing lice diverged between 650,000 and 700,000 years ago, indicating that clothing was an innovation of archaic hominids, not modern humans as previously thought. This is consistent with several other lines of evidence for an archaic origin of clothing, such as the presence of archaic hominids in high latitudes during this time period and the appearance of tools used to scrape hide 300,000 years ago. Furthermore, our analyses indicate that only a small proportion of head lice initially colonized clothing. Finally, I developed eleven polymorphic microsatellite loci for head and clothing lice. All loci were tested on eighteen head louse individuals, and the number of alleles ranged from three to seven. These loci will be valuable for further study of louse population genetics.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Melissa Toups.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Reed, David L.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022715:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101222_AAAAAY INGEST_TIME 2010-12-22T13:03:40Z PACKAGE UFE0022715_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 40545 DFID F20101222_AAARTS ORIGIN DEPOSITOR PATH toups_m_Page_35.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
dbe77c7fb73417aae1264e4afdef8dd4
SHA-1
1ad0204f93bfe61b49652b0a814d8883c0fd4238
8575 F20101222_AAAROV toups_m_Page_16thm.jpg
e9849ad5115445ddf9f4c12b9b3daef9
e16b632f6cd17b74017fd865a4b610ebb1d53c06
2711 F20101222_AAARYP toups_m_Page_47.txt
3b15268747fe2549165f5ac5b1db4bdf
0324f3cb778f70dc04792e0f4ea229ec78242fc6
39532 F20101222_AAASAQ toups_m_Page_44.QC.jpg
212f0c1d780c3eb893a3b58183e0ffa0
b1e7842fcc553ac85b5d80a2e738a3a265fc8872
116982 F20101222_AAARTT toups_m_Page_37.jpg
a8478447faca9a9e83245601c8b39cb1
0fd7cefc7b533b373d446cd8594aaafec343f140
433 F20101222_AAAROW toups_m_Page_06.txt
14a3fc8cea0925d66bf2dc0c31ee86e8
33556e4427404984748ddfd678fb0b4056bd590e
716 F20101222_AAARYQ toups_m_Page_48.txt
6ed97a9de24d88105ea942d5969104b1
afd61ccd942b0b1e2f7fe4e439ccc1a42cd8a324
9551 F20101222_AAASAR toups_m_Page_44thm.jpg
6a1a956208d3cdb0dc9b8f8c143fe1fb
ea8696efd49f6872defe48dd211bf95a0cfdfe5e
108257 F20101222_AAARTU toups_m_Page_38.jpg
e0f337e43008fb9d3a8f36c3ced0be3a
30e7aad658f8eb17be8ebeb970110dd871eabb14
1051986 F20101222_AAAROX toups_m_Page_27.jp2
38226492f1c970ced088ea49d57ec579
f67a889c88dc3301bdda2655a7221358b38a27bf
597 F20101222_AAARYR toups_m_Page_49.txt
ebe59863919b09ce1c583d3371aa1de3
e38d09a2d9f3d9875f2f20999b1c7e3811152d37
37805 F20101222_AAASAS toups_m_Page_45.QC.jpg
236bb6af18c4f83a8b6f63d015223c1b
1e4c120e6f4c859b3a3a82383a3874aee99308bb
54011 F20101222_AAARTV toups_m_Page_39.jpg
bb9b6ab0940613a6f0bc2940a00285a4
27c68b1349c146ecf787959070960106cc8645f6
5930 F20101222_AAAROY toups_m_Page_40thm.jpg
49ea82b952597789eb7fbd380d07b20e
24b649cf0e971780f9793136ca4638ad3035570c
295694 F20101222_AAARYS toups_m.pdf
281dc503e6e353d33acb46094beaa86f
b7774e099d609cab5083b5c9e798c04963167438
79470 F20101222_AAARTW toups_m_Page_40.jpg
9bb2d6b7953f1dd008158386ed61c60e
cf410671739ad2ba96cf30ba9e8b55eb7fe2657c
4981 F20101222_AAAROZ toups_m_Page_36.pro
6d82b6c255f4e977f568f37d965c48be
4f4aa13b79a83ed862206242c0af4704fb1ddd33
2092 F20101222_AAARYT toups_m_Page_01thm.jpg
0cf21a322351c30d4c48133ba96c4a99
90a45aa157f0f6e84934a1e6ac5738a94106dbf4
9239 F20101222_AAASAT toups_m_Page_45thm.jpg
7f045d290aafbcd451680cb48f456ec7
2e24f355fb34c12bf1b8c4b77fa7a21a5a1c0573
120231 F20101222_AAARTX toups_m_Page_41.jpg
fb104d7a915b4af5d954694ece436783
5ca846c6882b83d5ea87714858d61f5893a32350
8127 F20101222_AAARYU toups_m_Page_01.QC.jpg
dc98ad0cdef3d8f1c4bb01fd056844ae
2e8627ef8daf700275cf23edda58ac3f94fac32e
37594 F20101222_AAASAU toups_m_Page_46.QC.jpg
9aa76d9fc7d6a5bfff1ecc2a2595b9dd
c177efb942c622a83470ea38c3c4e1096ff798a8
109652 F20101222_AAARTY toups_m_Page_42.jpg
a7ed90a644446e44bb8e6280b5a9a8f4
126a6c533fefc90f8f93c0d511e0a81bed8b4a5d
1141 F20101222_AAARYV toups_m_Page_02.QC.jpg
47d86ccf471ca448c69e7a06865d6ebd
737890c51891a6595210e65d639d354ac69f5131
39309 F20101222_AAASAV toups_m_Page_47.QC.jpg
f4a3f726aa84b7c787c460143274c9a4
ccbd8bb6351aa732e57890737483a16a22ef694c
25032 F20101222_AAARRA toups_m_Page_39.pro
441ae1a098bedfd6cf0a2467910130b1
bd3ff94b522b373c21f3d1796d8b634e8048e599
113834 F20101222_AAARTZ toups_m_Page_43.jpg
dea4ae5450c544980dfaf5006dcf7b52
7a7d8f8cf37737ae93a6a37eb2392a66e4a59ff0
589 F20101222_AAARYW toups_m_Page_02thm.jpg
a15117155acd084477429d5081b6c65c
8af519904870a27548461717ac8429a6f6ce6314
9497 F20101222_AAASAW toups_m_Page_47thm.jpg
3c2ccf98af9cd7b5165eac41f1536400
a70b29db20606735e083e52f5d6edfbd42ad6844
52170 F20101222_AAARRB toups_m_Page_22.pro
55b9e5e2685395701f6e436fa0424ba2
2deb553095485f5c7dff0074427421dfccc74fe6
452 F20101222_AAARYX toups_m_Page_03thm.jpg
66744c3adcda46974b840f98bcff8694
92dc1f8ea4be6cd60b5a9d58a3a4049ca20314d7
11123 F20101222_AAASAX toups_m_Page_49.QC.jpg
6993183cb361cef4e18e3540e2c910b7
233858219471dc055f85a37899c2162bf515957e
99997 F20101222_AAARRC toups_m_Page_29.jpg
8744f09e75f3acfac18b7ef160fabf45
48150b9e6d305d36561b800ed282b2a77675f6b4
25271604 F20101222_AAARWA toups_m_Page_27.tif
7b2c304d37afd3b4dcb4cc284b1743f2
2963d480d776e1d240f871ec9847b5664b4a11a8
10543 F20101222_AAARYY toups_m_Page_04.QC.jpg
c57f463d8c40bc1a19bf393e09e8fa62
339397678122f7bee5cadf3bf8346c38f6604be6
59201 F20101222_AAASAY UFE0022715_00001.mets FULL
c210e28d237ad5e3fdcee040abf600f6
8094813e02b02837df8f058f1d5b3a325fdb427b
56101 F20101222_AAARRD toups_m_Page_43.pro
215dcefa15651861698fa840209f7f35
0b5060985bbbab671c5df709fadb997bedd27fab
F20101222_AAARWB toups_m_Page_28.tif
1e8adc00fd919446a59c0d4a45041095
05bbf2ec5ecf4f44c62d7f0f13ebcd978da3cdbd
2576 F20101222_AAARYZ toups_m_Page_04thm.jpg
37d47a3555b424f5a9dd9a7c83bc2f90
bb79faf2271d3753c06c19d7dd632f38a203c215
F20101222_AAARRE toups_m_Page_26.tif
ceaa4373339468ab40cb69cc3dbf9ea7
6491c67b5775c01aa2e1d9a048ad712d4bbf178d
F20101222_AAARWC toups_m_Page_30.tif
0e24f1c009450364166bf2771ba9366a
2e50a825dd495437c96dfd95695642d49a5ed34f
F20101222_AAARWD toups_m_Page_34.tif
517225fdbddaf5e615e02c6d593de68f
80b238c401f0678a574c1eeab36110c978047467
8514 F20101222_AAARRF toups_m_Page_43thm.jpg
4d67ebcb526150078f04609691496550
9fecef86e757adb45766009a326595b746268b70
F20101222_AAARWE toups_m_Page_36.tif
e410fdf36c62d2c4c7301f61bab61111
88d62c54d151770366fe4885710c409760dc0e46
1051985 F20101222_AAARRG toups_m_Page_05.jp2
4067c1d763ffb67a058f16c863fde847
215efa0d86fed70fd52ea0c95810d63ad47020cf
F20101222_AAARWF toups_m_Page_40.tif
eef1260b16cce47d2793892244016d19
25a58bfbd936447fdb0c8514d9a75ce2f0eed095
F20101222_AAARRH toups_m_Page_10.tif
29d2f0a76d86754248ae963829fc98b9
cf75213f4f04d192b1315a5e6942be0560281e0d
F20101222_AAARWG toups_m_Page_41.tif
59928bbf19450180172a86d93c67a94e
f601c8d182fe679e82558626cdb1d2280f20925c
32670 F20101222_AAARRI toups_m_Page_14.QC.jpg
cf1a4cb42ff8b503020c62e90c102250
a9f6ca08bc3c36d5b3914448217fd6a22d992dc0
F20101222_AAARWH toups_m_Page_43.tif
4deaadb8608007fcc963230639062312
17050e2af593546660cfec47c8197d7a51e1d83d
36204 F20101222_AAARRJ toups_m_Page_31.QC.jpg
2e927a99d83539d8aa7372ab639f6169
9662209ba4ce0d16cc5ce166e1f9912b7220e19e
F20101222_AAARWI toups_m_Page_44.tif
df4796d160972475080c87e4ac5bf0f6
16bfbc81be9204fbffe034472f11cac74672dc71
37468 F20101222_AAARRK toups_m_Page_12.QC.jpg
e011b83efb497a5b6f3e90fd7c93c5fd
55ca18a7cbf788ea15cb6bd69ac5ac96a7def20a
F20101222_AAARWJ toups_m_Page_47.tif
de440a7e08bd20d0722a7c50f5bd6113
9fccf044f3682630f5040b6d56faff974578c2b9
856081 F20101222_AAARRL toups_m_Page_40.jp2
5684a22b15176687b3297041b81e5c51
d3352b4ee932bd33b8d20d550eaaa0553f2dd3ac
1045 F20101222_AAARRM toups_m_Page_03.QC.jpg
1e18b98d25ff08fa1c4c684b9d163ec5
2496dbba9d577f665102a90d673f19d7e1f1c532
F20101222_AAARWK toups_m_Page_49.tif
c74f3032a3e9876f61cbcfe53cedabf4
b904f30d6129859536c09bfaee62ae3a90db3225
11954 F20101222_AAARRN toups_m_Page_48.QC.jpg
de11485d606c8732b4dd4db777c61571
35952f6c22ee2fa1bcd5ee60478a0fc1eaa1cc76
8249 F20101222_AAARWL toups_m_Page_01.pro
3da32751ad4f4d4b82cf06896f23adb5
236035e6a44cbf9e1ba867ee07655011aa848517
53960 F20101222_AAARRO toups_m_Page_20.pro
443c7bb8c392ad0e94027d24112a7ee0
f9412a3c16eb495170ede0d3c185e2000346f018
807 F20101222_AAARWM toups_m_Page_02.pro
6ddc718bf1bb7dc91ce219baa26dd679
58b486cd33b2a6800e5f2a3197a2b108d7483502
27116 F20101222_AAARRP toups_m_Page_05.QC.jpg
9543c357fcac0ae5af0b2116970a8ecf
92121a52b2ce20f7f251acbd3907476561e80d43
623 F20101222_AAARWN toups_m_Page_03.pro
5f63e3cd889d4de04a59c935cbaf3b7c
ba41bc44d533795bba6f72b9f50c5028dc3845d5
F20101222_AAARRQ toups_m_Page_39.tif
5130eeed1094ad75d0d8feac8912a805
27379d1d66c7b299f8f7483af29646884ddbc771
79712 F20101222_AAARWO toups_m_Page_05.pro
53b2cbe304d475f3bdebeebcff946934
22880d942bfb88cd8ae3ddc13a64370e0f43c815
14928 F20101222_AAARRR toups_m_Page_24.QC.jpg
fc392becee3533ce3aaa9598121b5fbb
d5280e5f3c0f8c1a27416daee79cec92af61e2fc
9624 F20101222_AAARWP toups_m_Page_06.pro
6ab55cbd85694092e1742fb971ea7935
480a345dee50faebe8afc5dcf6db0010a88f6e2d
6207 F20101222_AAARRS toups_m_Page_06.QC.jpg
97b8600a0d5fcfa9b7af965327bf2c85
7300cd780d71f58b3cff25e193ad33640e1d614b
6640 F20101222_AAARWQ toups_m_Page_07.pro
413afc804883373afe53c8df25921be4
3130f5146b3ecfb183192a8f0584b23805b741a3
F20101222_AAARRT toups_m_Page_38.tif
a3c368f1be1acdc8d075381bfc2383f9
db3b17818cb6bb6bf52458d31f0d0e09c18f6995
7439 F20101222_AAARWR toups_m_Page_09.pro
fb547e9f91182a2ce5debce7eda7257b
8020b29f0d408feb25ffdc589ee31a4795f97632
2168 F20101222_AAARRU toups_m_Page_21.txt
3f8309df321953907f0bde15f0f58bac
83eb2c2ee1410dd17aef29042d87b86b19bdf4df
54748 F20101222_AAARWS toups_m_Page_11.pro
7eee71b32ef6e74ba343cf8e3d8f39c7
837a3ef8b6d746c8de6c8fc4dbf1a1e763ea3ee0
2097 F20101222_AAARRV toups_m_Page_18.txt
2a4dc685ccd2e3d8819d1d3426736dec
fd3990d593fc0ed23267ce0f6419e73630f0db2f
56319 F20101222_AAARWT toups_m_Page_12.pro
59f7d88484d27dfc4d8ef44566276652
36868c1c7e3cd74317b981280c756a2640ca6b81
2175 F20101222_AAARRW toups_m_Page_31.txt
b93fa15827af10f04cab299a03305cf3
0e5babfe2208fcab237deec31b003621ca296931
54840 F20101222_AAARWU toups_m_Page_15.pro
5f4caf667833e9e9e99ee13273bf1cd1
57109daa6b121d297613272cf0c713c21ec752da
F20101222_AAARRX toups_m_Page_35.tif
2ec65e22f750eb3f55d10805ab518f35
0a40aec6bb673fa67ec3b1e040b1f34041604391
51774 F20101222_AAARWV toups_m_Page_16.pro
4b6e2fca808649821c35dd8b23304035
e1c130748bdad523f582010f398dc6a48e0eabe1
48342 F20101222_AAARPA toups_m_Page_28.pro
fa97f47404f6882ed65a0f8bbbe19bbc
2ad0bd943dc76aef628e37ee72610b451e26e6a1
1922 F20101222_AAARRY toups_m_Page_14.txt
6964fde1f52017f0c6bd2515473fdd85
e069472b4b30869267db6c003ccae5b5d263efb5
52491 F20101222_AAARWW toups_m_Page_19.pro
5cf7a918c70e1791d71052573c28584b
1c20491088d2389cc402daf98459d1c8fd81e292
34682 F20101222_AAARPB toups_m_Page_16.QC.jpg
13dd972556f01fb36c18784f25b948c1
c54d14bae7c4a4f6c47af1c334384ef7411076ac
143406 F20101222_AAARRZ toups_m_Page_44.jpg
c0ce8d5c882fe4596107efb05d9b5936
79370f0692e1d110c2f44a701475d2b4858b6b36
55340 F20101222_AAARWX toups_m_Page_21.pro
d7587785a2e22d26e29d071a45d8b1a1
471ebd6d7e703774193d3163ede4be03faac34ca
17702 F20101222_AAARPC toups_m_Page_09.jpg
e1e5142f1053cbd89e6e346c4aaf77a8
77d105e0964d88edd2a8f219f93345f1901dc70e
134251 F20101222_AAARUA toups_m_Page_45.jpg
b339d093c0358437af83ef7c32016ecd
0b32d895741265924a20a971ee6a680c2126a034
56986 F20101222_AAARWY toups_m_Page_23.pro
213f6c196b544b5276c15208f64c4411
b6e9285988441e7a59501f65e1a59e384198f400
2587 F20101222_AAARPD toups_m_Page_45.txt
7184630c92e3e8acac9bd747621837cf
e90775183ee9e1477c142d0d9f91f30d035ab522
128730 F20101222_AAARUB toups_m_Page_46.jpg
ea3ed663b5d5f60cfd23ff4255d391c0
3a1e9dfbbc4f5ae4f0aa1bc5f95bf0b04a075beb
21101 F20101222_AAARWZ toups_m_Page_24.pro
08888fda2f0e2ed016b0e13bc3ff9ae4
14d8f8f10eb01f45b201dbf599aff078fa00cdd1
17503 F20101222_AAARPE toups_m_Page_48.pro
493ba40cf0998bf8b0f6351e9ee6179f
ece7f83d0b190ee2dfba6630a870d9e422c521a5
138325 F20101222_AAARUC toups_m_Page_47.jpg
7fbee178e6aceddc2daafe8cf2c58585
cfc47abe11149c6d427e769fd970f1b543c95acb
F20101222_AAARPF toups_m_Page_04.tif
3463b1a418c688887840d2cb67695151
bc9439b66160a542ef612dfab5e4f60aea85d384
1805 F20101222_AAARZA toups_m_Page_06thm.jpg
d8ab32e8045de9c27595f2a4ef11d62b
3a3dacf1e5685838a4bd7ac17cb805e54b970a51
33937 F20101222_AAARUD toups_m_Page_49.jpg
013fbc32b1abf8e68a390850ae4107e2
e41d3e245e35a78aa44e58f985adaaed0acc2611
2157 F20101222_AAARPG toups_m_Page_26.txt
530a484fba0eadf952595d64130bc77d
ab4bf3613c44495e3eaac7c5388c02a848a11166
1580 F20101222_AAARZB toups_m_Page_07thm.jpg
18e1fcfdfe37efec5205d7d24ce46116
bb132bde0b1b154a89b6321f98085fe302e0ac1e
246575 F20101222_AAARUE toups_m_Page_01.jp2
418dce6c1bf07fd4609a3b3325db3205
2c6a5c50333856ef5ed1e3611a4d20a5c7925c93
1051918 F20101222_AAARPH toups_m_Page_11.jp2
c66a3d254c13be5a9462a99d5696998d
6c4a0ad4ee992cd8586a8905bad7e83b1bdddd30
27905 F20101222_AAARZC toups_m_Page_08.QC.jpg
71d90fd6200850bd50788ca101416c24
868b4e4aaaa3d9ec436201b21157d4f053926658
24309 F20101222_AAARUF toups_m_Page_02.jp2
48c65ffae1006d9928db292a33f181b6
44d19f498e3910d89f28d15a92969f4913068a43
23438 F20101222_AAARPI toups_m_Page_40.QC.jpg
e3aa94ba0c478a8568097e0d8d9eae53
069dfee100790bf4275ffa8aa34e2d4bb6c84d75
6444 F20101222_AAARZD toups_m_Page_09.QC.jpg
f56f1290c9380e5b6743cc8ee0b187c2
3b9ec679a943d7e722d97edc4a31fbc91c9fe399
17866 F20101222_AAARUG toups_m_Page_03.jp2
859355ac57ef31bd1f4b6c194590ded6
9a0f3ff9051cb4fb17f7d59f7f370043e51debb1
37440 F20101222_AAARPJ toups_m_Page_48.jpg
500d724eca27adf67b2e8a3c0d8a2d44
73c07d989de409e63d00ab967a3552c139bf79eb
1738 F20101222_AAARZE toups_m_Page_09thm.jpg
0d937f856045108be412d48e85e8260c
9dfc8b09734c7000ccc4b04b9b7ac89431053229
310545 F20101222_AAARUH toups_m_Page_04.jp2
b2ce48c85213e1c23d7178adcd138897
cca17c8190e2658cd869d882027ee9f6a765f9c7
48507 F20101222_AAARPK toups_m_Page_29.pro
d99d6d357f86d373495f292b8135fd6f
40356eb176fe50d34021b07f43b00a868d6fa02e
36672 F20101222_AAARZF toups_m_Page_10.QC.jpg
da0b324eeab0abae75c49c2b7fd507ef
3d5f3d26bb66889d0b7610592d20bb5def6b87b6
36597 F20101222_AAARZG toups_m_Page_11.QC.jpg
36936437d6550d66663527125135ccd6
9b1f4f6571d5856029c2052e2395a9d6fc2d0eb2
321073 F20101222_AAARUI toups_m_Page_06.jp2
45ef3139e4097c991d2e2607ee3a108c
398cf5064f8637c4120d2bdafa7b2ddd1d6eb5f8
F20101222_AAARPL toups_m_Page_01.tif
cd739fcf8e4a23f2a21fedad750dcc57
42661c006854911f5c9465e76e3f3b58591eb220
8850 F20101222_AAARZH toups_m_Page_11thm.jpg
556dafcfafe8a51b42341e643a514e59
fda5d8f523d2abffd009a75640410affdd550b14
207277 F20101222_AAARUJ toups_m_Page_07.jp2
a1ce4a6a162489fe9c9b09a4f470698b
ff310220d5ecaf98566925376f3ee77a5cab1bf2
F20101222_AAARPM toups_m_Page_18.tif
e9d8d8fe0a85089f1cc5595bc8dd2063
0f3e07bb4f1acae9dda82ac773143b776e73ae36
9100 F20101222_AAARZI toups_m_Page_13thm.jpg
62f5880e60dbbd6c7bebe62ce5d6fe7b
3d27ea24432f649bde2d768866f6676db0ae3722
947990 F20101222_AAARUK toups_m_Page_08.jp2
5029b1435327e35dc6c81d04a690ce31
9312af94d298931cdc7d66f20d0187b633beae62
2514 F20101222_AAARPN toups_m_Page_41.txt
73693b4e55be354c45ff38b3ca9f9e19
0abd309b0bb8ac88369918fe03811a524687b49e
7933 F20101222_AAARZJ toups_m_Page_14thm.jpg
f9205d72d3045d443632e90daf33fa41
f66dbe05ce3cd48d608b14aa7f28ceea65a6adc8
1051958 F20101222_AAARUL toups_m_Page_10.jp2
db2975b68694f2b0b7044a7367e49b99
527aac2a14851626be7250a8730c42fb15c67096
7087 F20101222_AAARPO toups_m_Page_08thm.jpg
bd9483b805546afbbca405562752f441
f7b99ad180f6d895b488454e2a99bec3aef0e7e1
35163 F20101222_AAARZK toups_m_Page_15.QC.jpg
a7cfaaa3f09edd4cccae08585a21235f
cf47dd2063a7ffb5d61533b159c2ac04db90efb6
1051927 F20101222_AAARUM toups_m_Page_12.jp2
80b49e43e53d52f3ce2a934a58f35d25
5e9d9bd849427ec8552154f714a6a2c2e1e25de3
61763 F20101222_AAARPP toups_m_Page_46.pro
86a3655de5b665fe322bc378e87f5d17
a0e311264a0a08406c90a2c966f78bea79cbe122
8581 F20101222_AAARZL toups_m_Page_15thm.jpg
500166a8bf7a97271ddeca758e059cba
31b01a6ec5c34f9de3b7d97c3b2d350a7da59530
1051971 F20101222_AAARUN toups_m_Page_15.jp2
807e22a0cc38bb7512c7c7803f60e1cf
af1347b0605d06af6c870576307504b5e0ade9ab
1051910 F20101222_AAARPQ toups_m_Page_25.jp2
03719d612ec186cfa8703f3b94014308
2e747d11c7e267e01cd2d9d1656ffd7e5d5d9dc1
35559 F20101222_AAARZM toups_m_Page_17.QC.jpg
4c78291eded9dec33893bd843300c4df
d56af11b78121c0628683929c459fa619facab33
1051982 F20101222_AAARUO toups_m_Page_16.jp2
f62ebefec7bdb97afff95666942b2e46
6298a53c0e7959030f0592b2b791a6ae88daa442
1051911 F20101222_AAARPR toups_m_Page_45.jp2
141d1c02cd718031de6fed583a29c984
23f32d4d6540549bc266f403d53f9bc1c8b57870
1051923 F20101222_AAARUP toups_m_Page_17.jp2
36a570ad8badb7dda8e788e5acf37061
c0322cdec9857160c4395452e8c44f7f917c3340
36456 F20101222_AAARPS toups_m_Page_20.QC.jpg
05be5a3978a0c57525f8dcd221956c39
4c17c64d2b366b02b51427f8de9ce19f4a6cda22
36736 F20101222_AAARZN toups_m_Page_18.QC.jpg
88b7b4959047a767de5dd7608e2a87ef
140359a2ef7a75e0e6ecc5ee67a2ca50348dd5e1
1051974 F20101222_AAARUQ toups_m_Page_18.jp2
2d442e94003b5e367cb540e394fc8eb4
60a53253f0b94a0fd36eb27eaf05445b042e3f26
F20101222_AAARPT toups_m_Page_46.tif
5dc716eb73a482be641b0ef1b769dbd8
d03c23f7d1c86bb1482a37c24645f603d0e052c8
34683 F20101222_AAARZO toups_m_Page_19.QC.jpg
28ca789b9917ec4d4d79e1dd9e7c5b10
62969af43f39eb52b6bbda3a646579f819546f70
F20101222_AAARUR toups_m_Page_19.jp2
c8a16d9c8937b07894ddd11ddfe97281
2d747e66fce8fe5e48352ea7ef6c2e8b628de8b2
57042 F20101222_AAARPU toups_m_Page_13.pro
aa71972d9100115e63a82e191d0f5bdb
ff1603559f953df1ea58e5177661cdd1621cc8c7
8698 F20101222_AAARZP toups_m_Page_19thm.jpg
8516a913a35c7fe589927358544abd7d
1e5149f7c56658b1395fe0c2e3ceff87ef02fd72
1051965 F20101222_AAARUS toups_m_Page_21.jp2
169908251f451fa0841206384696e905
05376e36f9b5aab6c367e2f276f7c5289b5d890a
6918 F20101222_AAARPV toups_m_Page_05thm.jpg
7ebae2c4385d0bb247c7be95997fa803
a6211a79e1e6fd500d98fc1876de3c99cda8d15f
8513 F20101222_AAARZQ toups_m_Page_20thm.jpg
6fd5493372b1ee4337ef738b86f53073
6232e4ff7c6328954d0869c3596d852ba8911369
1051977 F20101222_AAARUT toups_m_Page_22.jp2
2247d0259dad2cb925d432739f3fc2f3
6122de33816ec05d82014af58bdad012aaa5feaf
53613 F20101222_AAARPW toups_m_Page_10.pro
f086f0d3ff141da2a2ea1e5a0753ea5d
e9f4f6bd111ce69ab0d00e594c70fd4654ee3738
36457 F20101222_AAARZR toups_m_Page_21.QC.jpg
1a8cd9988cb7a0ccf4396d998e82e020
c87ddbe7cf829413a7b7eacb920f7af99ec5b098
1051979 F20101222_AAARUU toups_m_Page_23.jp2
e2d8fe99cff00accb1d46f0f2a220f10
812f8a4374cd5be903a5939ed7d0aea2345d5c90
3070 F20101222_AAARPX toups_m_Page_48thm.jpg
781a311df6d84cf96b86af9d42423a4e
ba5f43cde2a9c16e564b31cbdbb6474e6df9458b
9065 F20101222_AAARZS toups_m_Page_21thm.jpg
4182176bc207b197850f8ec0f02e742c
9b40fb4a453182d125055b1c15a39178a41c9fd7
484964 F20101222_AAARUV toups_m_Page_24.jp2
15d53cb3784dc908799e1e136728ec89
fa5c6c57a82afffbd1d783211d83b2fc5bbbdef8
34966 F20101222_AAARPY toups_m_Page_22.QC.jpg
461e1cbf3895bcf97d1d8e7b6ff85d40
aae3a26272836cac436bc54217f79ffb7084d89e
9259 F20101222_AAARZT toups_m_Page_23thm.jpg
e8e9380fc465d04748753e69c294bbaf
f372aa7d58eebcbee2138a57d2ca6dd55fb14d80
1051960 F20101222_AAARUW toups_m_Page_29.jp2
20d654b4cb93625ecea01379d348d9da
a36e0e014c9b9bb046fcd324a69b5c0979970a3f
116209 F20101222_AAARPZ toups_m_Page_05.jpg
9c90f427aed8f353379914906a98a3ca
cb1382ec290c0811ed8ad0300fc39244513b8d65
F20101222_AAARUX toups_m_Page_30.jp2
fc583cda020f3cc2385bce0400ef8277
ebfb260034ef892c399d7270d211fdecd0b63e3a
8838 F20101222_AAARZU toups_m_Page_25thm.jpg
11bdb0317b787096bb603d03986629ae
0d3417cae6bb45fbe06aea306adbfe7b7eff5530
F20101222_AAARSA toups_m_Page_42.tif
9d9bee0485cdd0e114feacae0f8749b7
2e18ccc45acd06fcc9b87a8daf975e7fa023a5f9
F20101222_AAARUY toups_m_Page_31.jp2
a2d62f47818252886865f38ad3109253
43b714278a8090fa2a93e7481bd2ac58b92b6474
35831 F20101222_AAARZV toups_m_Page_26.QC.jpg
4e9de40df41ab04a3644d0b4fce84c63
618e8da27f30665e032263176ea9f59ededb94f2
53400 F20101222_AAARSB toups_m_Page_18.pro
fcc5da183569325f37989596030a9177
506a252ce7f60cda4d2873b715e6467af6864184
F20101222_AAARUZ toups_m_Page_32.jp2
c1926035e5f3948394c3095e5bc99833
a180dd06f34fe1624a81e9e66b282d1ee8ab11e3
8852 F20101222_AAARZW toups_m_Page_26thm.jpg
9264e8bb0f15f9ca0e0e9db1601cc612
12d8f5f99d06540ce3c22bedd25ee7298de3d75f
55375 F20101222_AAARSC toups_m_Page_42.pro
856eb33f127982497c7f99ffe32c02c0
d0621b53339e0ab96805823ec9f3afce559b8293
34431 F20101222_AAARZX toups_m_Page_27.QC.jpg
e8558f07c6f7dc81405d404ec6c003bc
507e109a3d820aba77ba4e98ac3c2b0ce1cc067f
1051959 F20101222_AAARSD toups_m_Page_20.jp2
fb4f583549e7601a52b5f30cbd047b7c
1f9993c0d49529b0d4a2955ef08091a0b79a1190
54457 F20101222_AAARXA toups_m_Page_25.pro
f1ab39e6fb6905469e909d91488196b3
19036b7baae1b20634e43d60a1df95ef73fdcbf1
8802 F20101222_AAARZY toups_m_Page_27thm.jpg
9b571444b1e74d3ef22cc8ead05cd2c0
60e69ff9d1d58e967583339a290c98d79ca122e4
34129 F20101222_AAARSE toups_m_Page_43.QC.jpg
20243b399dbabc168b8e873009ffaa1a
dd8db038195e8204b06e4c65d3ae7c931890b2d0
54704 F20101222_AAARXB toups_m_Page_26.pro
083ce81601a607f21eedaa56387978bf
d5ae2b3b315f6d00db84aec74fdfe62cc70229ee
33187 F20101222_AAARZZ toups_m_Page_28.QC.jpg
3b42e4ec955cadde6958fc5ee2b35c1c
86dc6173ad63695e5e0074d7f2189e4c9253224b
4241 F20101222_AAARSF toups_m_Page_07.QC.jpg
8df81b2ca7d42434e88a107f41ca8514
495ad5dcb66516ed8b504cfcee29b287d527960c
53099 F20101222_AAARXC toups_m_Page_30.pro
683355d25b31515f8d0b6e2db8958bd3
7774ffb4ec9b1a2bf40ddb9bd44eda114912454e
55420 F20101222_AAARXD toups_m_Page_31.pro
78dd3e6bbbba7513521ea386329c9951
37c7c3081f94815861c6a83f108111dd02c80679
F20101222_AAARSG toups_m_Page_28.jp2
37de4d5155abecb11750730542dfbbf8
03cc2a983764980a9a95826316bda27663420603
51397 F20101222_AAARXE toups_m_Page_32.pro
d6d5d3addf31fb55e8bc8f01206a6326
c479a26482ae189a40ccc45dec94218225be77f0
53879 F20101222_AAARXF toups_m_Page_33.pro
675a1029c4d8a0da72a15efc1aa90d75
53b729458c990ceefc30c775d7a8a477325f5304
8553 F20101222_AAARSH toups_m_Page_10thm.jpg
87efa8578bf4167ca53caf2810dcc1a8
9fba85fff58221721d68fc0bedefaf69a261d8c5
19905 F20101222_AAARXG toups_m_Page_34.pro
fdc424af261384daa20e9b8f369fb640
198f9e9de7ee746e1102e42e00c94621a9b681aa
9106 F20101222_AAARSI toups_m_Page_12thm.jpg
54f4ec0f971b554ca208e1e56a285a3d
e6e94f21928599e17a6f98cbbf02a2d807179ca9
55732 F20101222_AAARXH toups_m_Page_37.pro
d1ec4e28e46a6c80f1d26b409fd06157
c48b93184a1ede7ba9b6ba8c17ff98c33285b8ac
38996 F20101222_AAARSJ toups_m_Page_40.pro
d13f1e6a67532c8859ea008805547017
fe63860da43948b1f29772698a8ba7716467dea3
50916 F20101222_AAARXI toups_m_Page_38.pro
6b448a4fde49bcdae597ded1808d5103
56470b8e1df51e66bd4a59f3a6998debd5175ec6
13846 F20101222_AAARSK toups_m_Page_34.QC.jpg
52d6c12545afea2b6d3c826e200cf36d
6c8c037a021147062ebef8d5d2fd7d49876d3187
73041 F20101222_AAARXJ toups_m_Page_44.pro
81a72b9e9df750191961b4271547ed06
1affae2b87dd51f0a7b4254a99a116ed8bbcd62b
1051972 F20101222_AAARSL toups_m_Page_13.jp2
460b1c10abe01f45fdd06ee5dc13fc7d
006359c8493af2d02cb51602070c2cb6daedc92b
F20101222_AAARNP toups_m_Page_45.tif
a19edb299720f643fdd8da842678679e
403d4fbceb3949531ce1caa2bcfe9fb90ec1aeb9
64074 F20101222_AAARXK toups_m_Page_45.pro
be0dd1dbfe03ecb0bb787ee87815e749
78f1dc37a176095e12fc97240a16d64a36fe270a
F20101222_AAARSM toups_m_Page_33.tif
0434eee2f82b9d1cb358ee01d875bc3d
8f2b679d93e01c8c4f8bd4411d74a36b0b5ff93c
1051935 F20101222_AAARNQ toups_m_Page_43.jp2
d3d1a5d95171d239dae9c93d034edb82
29733e35a92dc630d3fe2676f4bf406ab12d9b00
F20101222_AAARSN toups_m_Page_31.tif
a8b85d0c813592daa447df619793a9f6
f78f74dec573bf7d6185f7aa40fb5f9ba04ab652
F20101222_AAARNR toups_m_Page_37.tif
15f992e7fe4d8e8b31b386e4f066c41b
76feb967dde14a36476e444592e4d583fbb3a46b
67469 F20101222_AAARXL toups_m_Page_47.pro
bed9fe11689ba4ec526f42d42658ef1c
5affafd300f25d96aa5e3edad58601106e3f74e7
18052 F20101222_AAARSO toups_m_Page_35.pro
50a84105ba36959bdbae13a1521e7e52
6fa156587aeaceebc6a9eb4ed5925dae90dbfe0e
2235 F20101222_AAARNS toups_m_Page_13.txt
54681e877f3d130487146e9d0155da49
c96a168bf21391cd9683a607722ec1e2e5b11455
14051 F20101222_AAARXM toups_m_Page_49.pro
c06c091bc982420fa9588427f2fbeb63
15a74edb322cfe8b94519b6c4bd6bd5236daab03
8775 F20101222_AAARSP toups_m_Page_30thm.jpg
9ef554cc80e70316a2c78c5902bdb39a
c088a86c4f61054e310cf4d15967f4359c208c27
8771 F20101222_AAARNT toups_m_Page_17thm.jpg
059fc94311c9e9fb945e09939464256b
e5bfa215329298a460e225563e167498ae21c257
484 F20101222_AAARXN toups_m_Page_01.txt
f612d7abe85ac981cb9abe45bb7f0d41
a7c69023ffe47a9ac76679e3b18fc0576f74f762
4082 F20101222_AAARSQ toups_m_Page_36.QC.jpg
d1e8d70c3b82d089598de6a1189161f5
08cba88aee4db609a025adc558b5b0d744a843b8
F20101222_AAARNU toups_m_Page_32.tif
35c2a0d0390ad651d2811b656e9a7401
047f3a207488840939668a41065ff2231bf98788
91 F20101222_AAARXO toups_m_Page_02.txt
59e37f8d890238a92e4ea350f8638382
c670fc398138b4a9abdd333116dae274de4f6df1
F20101222_AAARSR toups_m_Page_09.tif
92023eaed777d0ba7ea7f81561c717ab
23ed81797540619c8e093bfbe1a2a336e5408d8e
169206 F20101222_AAARNV toups_m_Page_09.jp2
e83d7b415b9a229eba3fb84a14f70809
e4899c50c3aea452bdfc93627b033bc672f6cf45
68 F20101222_AAARXP toups_m_Page_03.txt
f51f8941391192fefb2df26e1d6fc625
46b88ebe7c675d751b789ab23650de7fd8770e17
76045 F20101222_AAARSS UFE0022715_00001.xml
dcd5ba31dc79401c5e83a362c986be50
343120dc46ba812fdca3fdd0c7d472a2344e1621
108899 F20101222_AAARNW toups_m_Page_15.jpg
2043484cd055124e0258b5dc038fc40d
9c1d2127d13b782d2eab3c8f3d521c78e843ce5f
563 F20101222_AAARXQ toups_m_Page_04.txt
9f18e5dd01c21b5984d1af2390d04c4c
397a586fa782df01f3c40802ba4e48c1cdb4d937
9129 F20101222_AAARNX toups_m_Page_37thm.jpg
98566e0184121473f9b318abcb488423
30d173416c2c36d3da9610aaf44ee3a8aaa2bd4f
3308 F20101222_AAARXR toups_m_Page_05.txt
033b9727fc5643a6284faad2a74cb3eb
f291345dbd47006907e5a876d62d3eedd64265f2
33492 F20101222_AAARNY toups_m_Page_32.QC.jpg
89c3d420d12ebb5000419aaa646a2526
7f1c361c09d2f07642a59880bf73b7c2d4f09b13
280 F20101222_AAARXS toups_m_Page_07.txt
a9dbc3de5a25287c6a9cbd8491cdf801
c087d94a0c5b1a6acdbe4e516b96526d7b7597a5
26456 F20101222_AAARSV toups_m_Page_01.jpg
f2f662c04065e7d9f9e1891d69c9ccba
e526ac3a75311492ea82388818dfbe3415723eed
1051967 F20101222_AAARNZ toups_m_Page_41.jp2
84bdd95b7d588ba900dc5b10e41c6ab2
cff977cdf0ffba70cd6a6ef17beb469170e33e6c
1867 F20101222_AAARXT toups_m_Page_08.txt
129cc6dbf33ea8bb827eb10043020001
35de7534b14a66739e69378dc11cbafc24a760da
3790 F20101222_AAARSW toups_m_Page_02.jpg
b08fba56c2c5d9e6fdc7f7b7635038de
a84c40ca53eca5c03e5cdc541d95b6cbf9b55363
303 F20101222_AAARXU toups_m_Page_09.txt
a1cf9293ddd7cd3268eed2572c2750bc
8717823072619eb091ba394f4bdb41b9aea6923c
3181 F20101222_AAARSX toups_m_Page_03.jpg
0fcfa4e220247ab2f9ee57f25df85819
9c117f8da844c029c8877a84d2bce3a1a0854d0b
2231 F20101222_AAARXV toups_m_Page_10.txt
95d296a8ef69c8aeda86ca065fe5239a
9d3c040c0115dfdbaf1d1bf0179747d523340c1b
62065 F20101222_AAARQA toups_m_Page_41.pro
c97d19a8d89f3b0d2b349ec0a8fe186f
a4fc8c2a584324b67d41699bfc6403f1f814c5f5
31648 F20101222_AAARSY toups_m_Page_04.jpg
3d56570ee8ae407e21c41b6cd4ea9b9f
0ee51c5b26ea271678aa58cc8a1e2bb9b2d909e0
2241 F20101222_AAARXW toups_m_Page_12.txt
02e96d4b49a3b7eeb75cd62438886501
bdd922863407fbd6d2440f0c546141830f909f7a
107456 F20101222_AAARQB toups_m_Page_30.jpg
6fdfe5750ec34db2c7d0aa7833e52420
7ab875f41a1b214c33d02c5cd933eef04d32a424
20306 F20101222_AAARSZ toups_m_Page_06.jpg
ea9d70390f736b24f6669399f71d95f8
8095873e7e6a6be0033218796c2390b57c52f58e
2158 F20101222_AAARXX toups_m_Page_15.txt
5f4b7bac511055e4a01d7e63df9f6eae
fa865fc71729047719a23b571c25fc81b75db53d
37165 F20101222_AAARQC toups_m_Page_13.QC.jpg
e5400c7b40cac2d15a0a0c08aa945790
e41822a94e6ace7cd6abb52ac117063a6dbab592
1051916 F20101222_AAARVA toups_m_Page_33.jp2
d18e75a969de510157a4b1c2e461c822
66284031aeeddf7255550ebb326af5ac466c2f62
2034 F20101222_AAARXY toups_m_Page_16.txt
b618e7b97c0c945236dca6adc890bb9d
2712ae15c53bb43aef327ba8181dfb2d800a860d
F20101222_AAARQD toups_m_Page_29.tif
c86794380b4ebc2991ad2cd09f7ef962
7bc4c82766a42cb40a79fa8282892cc838d7729a
449994 F20101222_AAARVB toups_m_Page_34.jp2
319f5e87cdf5ed1fce0b3cb5108c7a3b
49aebe418a719b2153d0a36f4065f695fc2de85f
2075 F20101222_AAARXZ toups_m_Page_22.txt
4179a521f6b6ee99762f2a2be611b702
c9e96a714cae7de21f1d9aac48115aaecd7c8c8d
105128 F20101222_AAARVC toups_m_Page_36.jp2
84526def080b50fbba3295926dd8e564
0955a25e148182621a664290a0f8e9710f933b56
3896 F20101222_AAARQE toups_m_Page_24thm.jpg
35df2eae53c796f85527afd648a4efa5
32356bef4b18b42484e58b795c69af5fdcb84f23
1051968 F20101222_AAARVD toups_m_Page_37.jp2
1f7cb2d20275bb26319b7bca6a2bb8ef
1b0d5765d999f39d747de0e5aa774bfb1da54e77
2244 F20101222_AAARQF toups_m_Page_25.txt
6b3a5516f8cabc132c342a67043b083e
73298b998194b168c30439e85e9d0896c290c850
798 F20101222_AAARQG toups_m_Page_34.txt
aa64d19e39ac2c3f4005b8762d3fd885
7508ce31828a4d0bcf5b23b989a4e0608fb3aff4
567713 F20101222_AAARVE toups_m_Page_39.jp2
1d25f374670260f966432d0235b05345
b8ff247e34b86e16ec87d7eb13f0960a5aa9896e
47879 F20101222_AAARQH toups_m_Page_14.pro
f067f931f5fa1edcd1d1801cd32f504c
be15ae188fc503cfde8304f131e5e18cdd3d75ec
1051931 F20101222_AAARVF toups_m_Page_44.jp2
068e8bd48f230c0161f83189ef326122
9ce30e73a5a852f37efbd63ce73a75d4c63bd2e5
1051980 F20101222_AAARQI toups_m_Page_38.jp2
a5ad3d6bb52835a5c9f54d05f2b72e20
3b231dff3513190e0f59e9cd2e83d397b1af6cab
F20101222_AAARVG toups_m_Page_46.jp2
e7fc794e2a1bf787c251f809186ff0cc
df9a4add0bfbad5c3fcea5a10b82a52b2371e7ee
8873 F20101222_AAARQJ toups_m_Page_31thm.jpg
29e826e65e5bb6f67ad70b4b2ec02f45
757d257c8c0dc535f8c2aef566e7c1bb20a57662
F20101222_AAARVH toups_m_Page_47.jp2
6a4b5a02b810a6fb65d73c24b7383342
e08892b50ce4f4e7e33a8796da0dca0f87112880
F20101222_AAARQK toups_m_Page_25.tif
806a558dc7ac104a33bf5cbd0e111cbe
2c9df4ee2b7415caed16f86bcc2d5ace3e8c06cb
410148 F20101222_AAARVI toups_m_Page_48.jp2
9950deaaac446f14ec2d4d91bf4c0a8f
3a8917241a3684c0bb0b8348d9b8c50140940535
52051 F20101222_AAARQL toups_m_Page_27.pro
d9ede40202fbe930a5e9365455f7eecd
4d9c884741ad568d238a99f5e603994d30ae4a35
F20101222_AAARQM toups_m_Page_07.tif
2676cc34500d0d5293b7a19b7f4d178c
297f4be61ad44a74bd0d32705a429b6534ec6a38
338742 F20101222_AAARVJ toups_m_Page_49.jp2
8a2e9436c24e2f5545327ea9575b6555
989307be8515adc2db1112bd810a77723a31276d
2248 F20101222_AAARQN toups_m_Page_37.txt
13bfcca92f7eeadfb1415dab0a389320
b7dddc0ac1d45de3b22f36bc22d4a6a77da1f34e
F20101222_AAARVK toups_m_Page_02.tif
e49aa4bfbd93acfbb56827de5846076e
8d976bb8f5d11c414ee645df0338b2673164437f
F20101222_AAARQO toups_m_Page_23.tif
dfc9286248bb2e9e20c2144c937d9097
77d6cde68842600e15280b80e367746d7314b606
F20101222_AAARVL toups_m_Page_03.tif
178d577e89a225308bea1c9e58331b57
1e3a9e8663d9b6beea9ea295cbb69bae5c161e95
4356 F20101222_AAARQP toups_m_Page_35thm.jpg
050d1194c71a6dad8c5bb6b1213bf5f4
d1ae6a068f41e7a9a1c370392f74ff40c075baac
F20101222_AAARVM toups_m_Page_05.tif
4b3a0d6d39a4738a17edc940b5113015
cd8a7f9486ecaf12d8985f4c6a6dd9b5d0d8e01e
2146 F20101222_AAARQQ toups_m_Page_20.txt
9714275a4b735f54880374a2f58a08be
068874f1753b6786d16bc25f4d6086a8990b60dd
F20101222_AAARVN toups_m_Page_06.tif
52e9a9751ee51200e1730e695a6a5ae6
661f66246dd52679e62c588f51f35ff3e4721f18
2123 F20101222_AAARQR toups_m_Page_33.txt
c89801dce26740fb4d24ab2f61a0ba2b
4b34c45b7f44c34a842038b2717bd280e727be90
F20101222_AAARVO toups_m_Page_08.tif
dcab8b1e45ff0ed6c81500225d32db58
e18b6b4e749e7c559a5f9c05a4b19ce668987c24
9645 F20101222_AAARQS toups_m_Page_46thm.jpg
c28448bacdbb6a661eec5e0a512f49f5
f603dcc3550c3687ccef2effed0f01ac0b8b75e4
F20101222_AAARVP toups_m_Page_11.tif
b9f8bd356fc78a936787c58f2867b34b
0b2ac0d419ed3bba91ac324540b20ea5bce2bcde
1051944 F20101222_AAARQT toups_m_Page_42.jp2
e0e5350b3cbb7fd7ecf685339d312e64
6134a11f3404813bfa91fe85f509e4deefe57a3a
F20101222_AAARVQ toups_m_Page_12.tif
11de08c51a6a32e177d9a2c9e5f16002
1373b3ad40c6ec3c52b9ee170f32e22bf9defd08
8710 F20101222_AAARQU toups_m_Page_33thm.jpg
eb50056804574e7cd2b9206a15a673ea
4cfc98ffc6c2162bdbdd7ae3c0c8d8fd410d0d82
F20101222_AAARVR toups_m_Page_13.tif
5b9c2716a09f74988efec89db78c05ea
88f5ff6e7432503cb4527652ab434586cfe7565c
106503 F20101222_AAARQV toups_m_Page_19.jpg
f975f9197902731f3a2dc45f767d9e2f
5eb8fb5524e8ad04d4e8e6b7c11d27b13a9e86b3
F20101222_AAARVS toups_m_Page_14.tif
ea1f03e355bff97736542a48cde439e9
b4e84b4113af05bfcd0740ac08cb509930c3760b
1051938 F20101222_AAARQW toups_m_Page_26.jp2
6e6d69172291a54514bc9870175e10a7
574757a1272d38cecde1dd82f05af4765d24cdce
F20101222_AAARVT toups_m_Page_15.tif
f92911bc6a2f5f5243f7a241880e551b
90b09318a2bce460393c105c5488f20deb6f3d1b
2181 F20101222_AAARQX toups_m_Page_11.txt
c52a723beb7afef4173462f0c51df906
d775525d218e1d2e03c6a65af8bd14a0c4cb6e5a
F20101222_AAARVU toups_m_Page_16.tif
7163c248f3b1d28e645014e58406ba59
33e3f57f157a2a390a85c187384cb83cb49c3bf2
2138 F20101222_AAARQY toups_m_Page_17.txt
cee9197452141ed85fa61abe74b7533d
7c20f47c47a1f6301712fd10a1569ae7d1565b19
F20101222_AAARVV toups_m_Page_19.tif
8957d2fe915eec1fe660af07af06074e
105c689786590cec96534abde3a57f910c826f27
54292 F20101222_AAAROA toups_m_Page_17.pro
b05f8515950a624873b29b6cb512e08d
66b2f09a5dcbfa668e854e3705b1743072f2c46f
109465 F20101222_AAARQZ toups_m_Page_10.jpg
043a33064b4c834319ce22f86d60aebb
e20f2e851ba5c5ce845898a4ed1a61e136e02ccd
F20101222_AAARVW toups_m_Page_20.tif
d4d746a0ec773f2b9c32ae8faaa10331
6a82459e35e77d3402afcb3d157c546f54dc8a51
F20101222_AAAROB toups_m_Page_17.tif
2431cd0446fc0b0d7c9f5f136d22e7f5
3d62dccc24bd1d2c76936563b7c6ed8f63797c85
F20101222_AAARVX toups_m_Page_21.tif
cda033e8783e0c8267bb7e3491396f2b
7cd89765abe0600f9c1e9dec727c1f9bc45e1f4d
15166 F20101222_AAARTA toups_m_Page_07.jpg
2c7c41db54e27c21c4a511f4ee07e8ed
82ee6dde74494369ea70c021c78a10c52122fb0a
F20101222_AAARVY toups_m_Page_22.tif
8fb8ecc29617d31855936e374dd43a03
1cb3aa386e31774062429e3c5197cc41010cf844
37229 F20101222_AAAROC toups_m_Page_23.QC.jpg
d1e379159c3aafe782ec3516b940b84d
57476acf5f3e30b3f373584f89e090e59986ecb6
88725 F20101222_AAARTB toups_m_Page_08.jpg
9aded8dec6ae8a9da3adb7d9ff752fa2
c4c98535b709b1f20515200fcadbe36cd2d72871
F20101222_AAARVZ toups_m_Page_24.tif
d0068b7c971aae75d56d405aca6554f5
8d9df45509690e46e7e3ccd39d16d7d079fa7220
13167 F20101222_AAAROD toups_m_Page_04.pro
ebcdd1d58bead26eae7f5af3e39d14f5
7a40550a8055ac31e25fc60d13b79a62712a1e87
114325 F20101222_AAARTC toups_m_Page_12.jpg
2d2c8f17d7a1fa09fa3d7956af979a03
0244cb59a76829cee8411d6a13d8219771c776ee
111828 F20101222_AAAROE toups_m_Page_11.jpg
f442779bcb6dfb29abb912875489256b
8b203dbe656f344192b7b436c6e5dac21361d575
8207 F20101222_AAASAA toups_m_Page_28thm.jpg
f6675463e7c57c98b6db6a3183fa7360
7b6ea30fc1323863f2aebdcd6896bd6b782412d0
115344 F20101222_AAARTD toups_m_Page_13.jpg
bf54fd7ee8ea5b60dee7d3c7f0f581f5
5e467e3022977742c1b75dde023a43cee2f220cb
111651 F20101222_AAAROF toups_m_Page_25.jpg
78adc5d49da21fa47cb8bf09d121c278
9686515050d25371d4231e2f229ca93768feef6b
2237 F20101222_AAARYA toups_m_Page_23.txt
f1363ad400624ba86c3e06a6dfa1d406
26a66db82cd55edba3c11c0cc27d020ba175679d
31902 F20101222_AAASAB toups_m_Page_29.QC.jpg
4ad528559ea841b904a9f626fb36b35f
cc4f84a6281f8db5b37f18b7457d09c43d5f3d72
98680 F20101222_AAARTE toups_m_Page_14.jpg
2bab8c7ab3f0009968cadefb8f4973d6
b3edfbd91e783c5de57d42a1d3b5420c6b1a2490
8940 F20101222_AAAROG toups_m_Page_22thm.jpg
1c1ec6433c7715e9dac28068c056f312
9193752636b09ffb55486d468a607aefe0cf0a00
844 F20101222_AAARYB toups_m_Page_24.txt
8df6a2cd0f4c5ee3c68c588d99e48bf2
7011b92c74fe6e7f3b1c001cbb3009bc431458b8
8082 F20101222_AAASAC toups_m_Page_29thm.jpg
42439ef024413bcad24c36350aaf27da
175ebfd7a48e8100b4109d299d8a24a7295ff6f4
105637 F20101222_AAARTF toups_m_Page_16.jpg
ceffeeb70995827a66a6aabf1982a1c7
b5ebbb10b62eb5ae9db4b08b2657c5d8b97eec88
41650 F20101222_AAAROH toups_m_Page_08.pro
f5462964bec1abfc0fd0d719efdb9297
173bb898cf5ef9c9a22951282dc7560d447da3b9
2052 F20101222_AAARYC toups_m_Page_27.txt
80ee7d5e8f68beaecb510c6bb86821fb
76dc50545dd71dc49fd6d712b7347281307eb3e8
34871 F20101222_AAASAD toups_m_Page_30.QC.jpg
e663ef647cba3f036feda02865ab2913
00b142633f1862b15b0f8967a0059f0a55028b3a
108656 F20101222_AAARTG toups_m_Page_18.jpg
bcc884d6ecb7ff79b26d92af552c2fb5
6f27e106a5d38b877cd2d708c7367e3375dfb726
2747 F20101222_AAAROI toups_m_Page_49thm.jpg
2f0d99de862d1ac7124b315001cc3e63
fac0edec433f913cf3ab4453bcef6eecfc53fec6
1906 F20101222_AAARYD toups_m_Page_28.txt
1e69745015ee96317eff9a50d2b8c0c4
9ecc211bd194594a3c51c87391edef2e0acbe97a
8667 F20101222_AAASAE toups_m_Page_32thm.jpg
8e2b22435569554c76a41e9684b718cc
4c5bfcc46124031621c314ca69a808cfc2426f82
100250 F20101222_AAAROJ toups_m_Page_28.jpg
8b7b63f3fdc7965450967d07c7861c77
892ffb4cd2958beaec52c1a3ce2fb4a46da7e47e
1961 F20101222_AAARYE toups_m_Page_29.txt
efc14263980df93b2cd803c575f419a3
e08ddff08139f0bafbf4d549192374fd97486cb6
35626 F20101222_AAASAF toups_m_Page_33.QC.jpg
d58ff6e15e4dde51d052a021c5f9b3ce
366c3bf0dc9a978c8edc0014933bddad0f648b31
108726 F20101222_AAARTH toups_m_Page_20.jpg
0c6d10f3a1d430b33ddb4c518887985f
38870524084b2b2aeab174c9d1f0cf3ff359e0a6
2035 F20101222_AAAROK toups_m_Page_32.txt
f391f9ea8864e2963ac3d6bb75a65622
006eb6e0cbbf024e5f8c59d13a96ca6c423c5c23
2135 F20101222_AAARYF toups_m_Page_30.txt
1df4c3f0f04e1575a241bffdb12758cb
5b8a8f6eaa7d388a3cc21385dc546559976d7273
3729 F20101222_AAASAG toups_m_Page_34thm.jpg
1ba89295747df7fa681be6badf2df811
40978c707f46cd438acbc5f0712c4e4206fa45fa
112748 F20101222_AAARTI toups_m_Page_21.jpg
84c1d277f1b9ccfc5c7a7eb2f9f90c01
f1b253dd07a06b86d5e6df72190d4bb0f303e665
109420 F20101222_AAAROL toups_m_Page_17.jpg
b7f9a85e13604c4b5c498408622db523
3a9f7caddd2805be9770d886bcde20fbe28599c5
1272 F20101222_AAARYG toups_m_Page_35.txt
463e0d8ee18528736872471dee9e39ae
8da571bcb43fbdc2e05a76d847d6e5324acbded3
105219 F20101222_AAARTJ toups_m_Page_22.jpg
ac55d4103f57220bdc3aa0219c6af1e0
0439cf504776cb92800398285dd45d4e0492f615
F20101222_AAAROM toups_m_Page_14.jp2
dd087cf3ead9ec364443b7eb19f24756
66ff640e36d342f01285a26fad9d9589d7f19e10
242 F20101222_AAARYH toups_m_Page_36.txt
24a2dbaf60b66c1680649046c6408c7f
b0cd4a14ccb3bd8552428af40678a4f1d042af21
13043 F20101222_AAASAH toups_m_Page_35.QC.jpg
e304c031b417b51e466c3b6facfc1c21
c6999ce47e56c0cdce762b04a894eba1917b646c
114722 F20101222_AAARTK toups_m_Page_23.jpg
ec6d60b2300c405ef2902b3c6a25471a
070ec687eb20eae8365c4e5cb777b6319e35bfc3
17600 F20101222_AAARON toups_m_Page_39.QC.jpg
321799407aed516b5c2acc9b71ed9066
fb231edd84056fd2c93fdaaf0c6023b0e2c8900b
2009 F20101222_AAARYI toups_m_Page_38.txt
786b7f3d3cab85d7e16bb67dee0daf2c
50c4e54e9d109e8723640697c25083daa2f934c6
F20101222_AAASAI toups_m_Page_36thm.jpg
d72d13d189672f1a1fd6c39f61b5ee73
fa0cdb001513ed52a0d55f1b30923fe06f888658
46059 F20101222_AAARTL toups_m_Page_24.jpg
271b7a5c1e1c5936959cd122cc6b7235
44cd4ed0916046dded547e7cecc235a682706d6b
12255 F20101222_AAAROO toups_m_Page_36.jpg
ffd82ddfbb8154c6aaa40e60c22633a4
3bed947febcd35bd4e2fd926217252109b9ef54f
1000 F20101222_AAARYJ toups_m_Page_39.txt
b9c945aab9fbaf9991139ccde0978dde
6be9b2ef5bad735d0ff17528e62ae63304f00df5
34599 F20101222_AAASAJ toups_m_Page_38.QC.jpg
93a8d211e745178db87745a7934e71bc
59f50eb6dfa1cc376a1e3394240416ccab16eeea
109853 F20101222_AAARTM toups_m_Page_26.jpg
607180511df65a1fb94273b73d1b4430
0fda8d48fc8f0bc410675443ea1c4c2ca8385426
F20101222_AAAROP toups_m_Page_48.tif
fcd141e4a97f75bdbd1cace7694480ea
6e6458f4d3ec5fb8f6206ff90ab67420f9653216
1828 F20101222_AAARYK toups_m_Page_40.txt
69da4e26cadf608019a4527c3b00e086
e753aaa34e509e1a4ec124b7fd637568df213c80
8679 F20101222_AAASAK toups_m_Page_38thm.jpg
6ad4bb253b0c4df70ea23cd3ea8e0a2a
420962e158d76ab3e9d02fdc5333a0caaa86ec88
105778 F20101222_AAARTN toups_m_Page_27.jpg
7e1d00fc98e844621f958a7cbbbac88b
515e58e85e82d52b6b9ac5f42c7b90ab258cfd0a
37074 F20101222_AAAROQ toups_m_Page_25.QC.jpg
c08326de190b73b007b6cd352a30a681
d607e60eaac9233318b5721d1ccabecb9f6cf27f
2229 F20101222_AAARYL toups_m_Page_42.txt
6639eaddb2cf6a7ab48d970b9e4072d1
7ebc19b7cd1edf779c5d8f72242df51afee0ca26
4418 F20101222_AAASAL toups_m_Page_39thm.jpg
4409f67f1e7b7de86eb2592afc8cb280
917fc258d888d8406b748642623105800041b49e
112014 F20101222_AAARTO toups_m_Page_31.jpg
38fa4deb09a663d1314d1b5d6c2a9ab2
c322537351f400bb59b56beac8ddac34af9d7dce
2070 F20101222_AAAROR toups_m_Page_19.txt
f935a10c2c8f6f7c49a8d74eeb85a706
a1ecbe001342450166ad20e5d7816ad7e45afe7a
34962 F20101222_AAASAM toups_m_Page_41.QC.jpg
977c4e06f7568ff4f93e761b2ebc8ee0
020ab1936e4370fb4af79f76f5787e744004ffdb
104123 F20101222_AAARTP toups_m_Page_32.jpg
b72df46f64ce97ce39d081bf446c53bc
83c3774e42f7d5905b13a22907a2bf6e03199196
8705 F20101222_AAAROS toups_m_Page_18thm.jpg
6d1c45aa477b11f7167a84a5033bb652
730269489f4df70b4a1a980cc1b20aeb8f9d8ffd
2267 F20101222_AAARYM toups_m_Page_43.txt
0ee43cf2c6bf6e10bd05ce54e3678ca8
8ba69cba806e7164bc2c151861c195866efde589
8650 F20101222_AAASAN toups_m_Page_41thm.jpg
365623548c5491b11a2ecf8cb3094442
f898ea6350d5e32313793455bc6678567fe77cd1
110562 F20101222_AAARTQ toups_m_Page_33.jpg
17e6ca0c9947593dc9b3f8fab53d5558
5bc2f7eda2836614d1c8f273cfeee34f2d2fdc23
481756 F20101222_AAAROT toups_m_Page_35.jp2
d710384e7707de25adb55a4679f635f5
08317f8ab29e3b3992352092d3e46c630890002f
2942 F20101222_AAARYN toups_m_Page_44.txt
bf0d532df320927d45d63c719018bee9
ed9cd42d50443bea0e1d9dff5e0b8bef673d9d12
33760 F20101222_AAASAO toups_m_Page_42.QC.jpg
e7d9ec740df947ac6b78dfcf8839b12d
9f8c3ceb160e2765a35b3ebdccf27a22d6b9270c
43318 F20101222_AAARTR toups_m_Page_34.jpg
0e82febe61c2feb4f2be96e11322eb4d
b2f8e27e3758af78d1d2c142c18fc2c83bfc6e37
38131 F20101222_AAAROU toups_m_Page_37.QC.jpg
fe2c26a59a9944e5d6d3c9ce7566e24a
79d9ffeeb64db16be1f00ec11c8be5ad2d230da3
2484 F20101222_AAARYO toups_m_Page_46.txt
0bae241b13c195bc023e9256c6a35e48
e97eb670eaf0dd5bcee6593a98fa0936858e79fe
8655 F20101222_AAASAP toups_m_Page_42thm.jpg
c1ab9261ede357aef39a8179170f1803
f8d9e9c18f6cee7e9f1cef5d29f5a1931c542d5f







USING POPULATION GENETICS OF HUMAN HEAD AND CLOTHING LICE TO
ELUCIDATE HUMAN EVOLUTION





















By

MELISSA ANNE TOUPS


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2008



































2008 Melissa Toups




























To my family.









ACKNOWLEDGMENTS

I would like to thank my advisor, Dr. David Reed, and my committee members Dr.

Pamela Soltis and Dr. Mike Miyamoto. I would also like to thank the Zoology department

faculty for all their support, particularly Dr. Marta Wayne, Dr. Charlie Baer, and Dr. Colette St.

Mary. I would like to acknowledge my coauthors Dr. Andrew Kitchen and Dr. Jessica Light, as

well as my labmates Angelo Soto and Julie Allen. Finally, I would like to thank my friends Ondi

Crino and Matt Salomon.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

LIST OF TABLES ......... ..... .... ........... ....................................6

LIST OF FIGURES .................................. .. ..... ...................... .7

ABSTRAC T ............................................ ...............................................

CHAPTER

1 THE NATURAL HISTORY OF THE HUMAN HEAD AND CLOTHING LOUSE,
P ediculus hum anus ..................................................................... .................... 10

Introduction ........... ....... ....................................10
Ecology of P hum anus ......... ................ ...... .......... ..................... 11
Taxonomic Debate ................................................ ..................... ......... 12
M medical Im portance of P. hum anus................................................ ............................ 14
L house Transm ission.......... ............ .. ... ............ .. ............ .. .15
Clothing Lice as Vectors of Bacterial Pathogens............. .............................................16
Rickettsia prowazekii ......... .. .......................... ............ .......... .... 16
Borrelia recurrentis ....................................................... .............. .. 18
Bartonella quintana......... ......................._................ .. ........ .. ........ 19
Sequencing of the Clothing Louse Genome................................................................. 20
Lice as Markers of Human Evolutionary History..................................... ...............22

2 POPULATION GENETIC ANALYSIS OF Pediculus humanus PROVIDES INSIGHT
INTO THE ORIGIN OF HUMAN CLOTHING....................................... ............... 25

Intro du action ................... .......................................................... ................ 2 5
M materials and M methods ...................................... .. ......... ......... .....28
M molecular D ata ...........................................................................................28
E volutionaryR ate C alculation .............................................................. .....................28
Isolation w ith M igration A analysis ........................................................ ............... 29
R e su lts ................... ...................2...................9..........
D iscu ssio n ................... ...................3...................0..........

3 CHARACTERIZATION OF ELEVEN POLYMORPHIC MICROSATELLITE LOCI
FROM THE HUMAN HEAD AND CLOTHING LOUSE, Pediculus humanus..................37

R E F E R E N C E S ........................................................ ...................................4 1

B IO G R A PH IC A L SK E T C H .............................................................................. .....................49









LIST OF TABLES


Table page

2-1 Estimates of evolutionary rate (i) in substitutions/locus/year for each locus .................36

3-1 Characteristics of eleven microsatellite loci for the human head and clothing louse,
P. hum anus .................. ................. .......................................40










LIST OF FIGURES


Figure


2-1 Marginal posterior probability distributions for model IM parameters in demographic
u n its ................... ............................................................. ................ 3 5


page









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Master of Science

USING POPULATION GENETICS OF HUMAN HEAD AND CLOTHING LICE TO
ELUCIDATE HUMAN EVOLUTION

By

Melissa Toups

August 2008

Chair: David Reed
Major: Zoology

Parasites are often used as proxies for investigating their host evolution. This is

particularly common in the study of human evolution. In this study, I use the genetics of human

head and clothing lice to address the origin of clothing use in humans and develop new

microsatellite loci to further the study of louse population genetics.

Parasitic head and clothing use may be used to address the origin of clothing use because

the divergence between these taxa is indicative of a minimum age of clothing use. When

humans lost their body hair 1.2 million years ago, lice that once roamed the entire body were

isolated on the head, and recolonized the body with the advent of clothing use. Coalescent

analyses of multilocus data indicate that head and clothing lice diverged between 650,000 and

700,000 years ago, indicating that clothing was an innovation of archaic hominids, not modem

humans as previously thought. This is consistent with several other lines of evidence for an

archaic origin of clothing, such as the presence of archaic hominids in high latitudes during this

time period and the appearance of tools used to scrape hide 300,000 years ago. Furthermore,

our analyses indicate that only a small proportion of head lice initially colonized clothing.









Finally, I developed eleven polymorphic microsatellite loci for head and clothing lice. All

loci were tested on eighteen head louse individuals, and the number of alleles ranged from three

to seven. These loci will be valuable for further study of louse population genetics.









CHAPTER 1
THE NATURAL HISTORY OF THE HUMAN HEAD AND CLOTHING LOUSE, Pediculus
humanus

Introduction

At least half of the organisms that exist today are parasitic (Price 1980). The parasitic

lifestyle has been hypothesized to be a key innovation leading to the diversification of insects

within several different orders (Farrell 1998; Johnson et al. 2004; Whitfield 1998). The insect

order Phthiraptera consists of parasitic lice, which are permanent, obligate ectoparasites of

vertebrates. Phylogenetic analysis of Phthiraptera demonstrates that this order is polyphyletic

and indicates that there are two origins of parasitic lice (Johnson et al. 2004). One origin of

parasitism unites all members of one suborder of chewing lice, Amblycera, and the second origin

of parasitism unites two suborders of chewing lice, Ischnocera and Rhynchophthirina, with the

suborder of sucking lice, Anoplura.

Anoplurans spend their entire life cycle on their mammalian hosts and cannot survive

without their host for more than 24 to 36 hours. Fertilized eggs of sucking lice are referred to as

nits, which subsequently develop through three nymph stages (1st, 2nd, and 3rd instar) before

achieving adulthood. Sucking lice are hematophagous and contain endosymbiotic bacteria in

specialized mycetome cells (Allen et al. 2007; Perotti et al. 2007; Sasaki-Fukatsu et al. 2006) that

supplement the louse's diet with essential vitamins (Buchner 1965). Removal of endosymbionts

from a louse or from louse eggs results in louse and larval mortality (Aschner 1932).

Parasitism of vertebrates requires a variety of adaptations to meet the challenges of

remaining attached to the host, feeding on the host, and escaping the host defenses (Clayton and

Johnson 2003). For example, lice have a single tarsal claw on each leg that clings to host hair.

Anoplurans also have specialized mouthparts to suck blood from their mammalian hosts. Such

morphological, behavioral, and physiological specializations often restrict each species of









parasitic louse to a single host species (Price et al. 2003). This often results in cospeciation

between louse and host, such as the twenty-five million year coevolution between primates and

their sucking lice (Reed et al. 2007; Reed et al. 2004).

Members of two louse families parasitize humans. The family Phthiridae includes the

human pubic louse, Pthiruspubis, and its sister taxon, the gorilla louse, Pthirus gorillae. P.

pubis likely switched from a gorilla-like host to an archaic hominid approximately 3 million

years ago (Reed et al. 2007). The family Pediculidae includes the species Pediculus humanus,

which exists as two morphotypes, the human head louse and human clothing louse, Pediculus

humanus capitis and P. humanus humanus, respectively. Pediculus humanus is thought to have

diverged from chimpanzee lice, Pediculus schaeffi, at the chimp-human divergence 5-7 million

years ago.

Ecology of P. humanus

Human head and clothing lice are found on every continent. Head lice are common

worldwide, infesting millions of school children every year. This resistance is due, in part, to the

evolution of resistance to insecticidal shampoos that are used to treat pediculosis (Burgess 1995).

Clothing lice are less prevalent, but are potentially more harmful because they are known vectors

of at least three bacterial pathogens in humans: Rickettsiaprowazekii (epidemic or louse- borne

typhus; but see Robinson et al. 2003), Borrelia recurrentis (louse-borne relapsing fever) and

Bartonella quintana (trench fever; Buxton 1946; but see Sasaki et al. 2006). The incidence of

clothing lice is determined by weather, humidity, poverty, and a lack of hygienic conditions

(Raoult and Roux 1999). Clothing lice, and consequently their bacterial pathogens, are most

common in areas with cold weather, where people wear multiple layers of clothes, and in areas

stricken by poverty or political and social unrest that prevent inhabitants from having multiple

sets of clothes (Raoult and Roux 1999). They are also becoming increasingly common among









the homeless populations in developed countries in the United States and Western Europe

(Brouqui et al. 1996; Drancourt et al. 1995; Koehler et al. 1997; Raoult and Roux 1999).

As their names imply, head and clothing lice are spatially segregated on their human hosts.

Head lice are found on the head and attach their eggs to the base of hair shafts, most often behind

the ears, whereas clothing lice are found on the body and in clothing and prefer to attach their

eggs to the pleats and seams of clothing, particularly the undergarments, rather than body hair

(Burgess 1995; Buxton 1946; Maunder 1982; Nuttall 1917). In the absence of clothing, clothing

lice will infest beads and necklaces (Buxton 1946; Busvine 1978). Clothing lice are believed to

have evolved from head lice, invading the body region only recently with the advent of clothing

use in modern humans (Burgess 1995; Kittler et al. 2003; Kittler et al. 2004). Head lice require

more frequent blood meals than do clothing lice (Alpatov and Nastjukova 1955). Head and

clothing lice tend to return to their preferred ecological habitat when displaced, and clothing lice

are known to be especially attracted to areas that are occupied by other clothing lice or clothing

louse feces (Wigglesworth 1941; Mumcuoglu et al. 1986). Morphologically, clothing lice (and

their eggs) are generally larger than head lice, most notably in the length of the tibia on the

second pair of legs (Scholl, 1955; Busvine 1978; Reed et al. 2004). However, these

morphological differences are small, and were apparent to Reed et al. (2004) only when assessed

with discriminant function analysis.

Taxonomic Debate

The species status of human Pediculus has been a topic for debate for over a century.

Ferris (1951) and Burgess (1995) provide detailed accounts of this taxonomic confusion. Nuttall

(1917, 1919a, 1919b, 1920) and Ferris (1935) strongly argued that head and clothing lice

represented, at most, subspecies, and that the morphological, behavioral, and ecological

differences between these two louse groups represented natural intraspecific variation. Buxton









(1946) presented an argument that head and clothing lice are probably too similar to be

considered distinct species, but may represent "species in the making." Fahrenholz (1915,

1916), Busvine (1944, 1978), and Schaefer (1978), on the other hand, argued that the differences

observed between head and clothing lice were more than sufficient to recognize these taxa as

distinct species. This taxonomic confusion regarding the species status of head and clothing lice

continues today, primarily because of the ecological differences.

In recent years, the specific status of head and clothing lice has also been addressed in

studies examining louse isozymes (Amevigbe et al. 2000), louse primary endosymbionts (Allen

et al. 2007; Perotti et al. 2007; Sasaki-Fukatsu et al. 2006), and louse bacterial pathogens (Sasaki

et al. 2006; but see Parola et al. 2006). While the results of the endosymbiont and bacteria work

indicate that head and clothing lice are conspecific, the results of the isozyme work indicate that

genetic differentiation may exist between these louse forms. There also has been a series of

DNA-based studies that have directly addressed the specific status of head and clothing lice

(Kittler et al. 2003; Leo and Barker 2005; Leo et al. 2002; Reed et al. 2004; Yong et al. 2003).

The majority of these molecular-based studies have concluded that head and clothing lice are not

distinct species because of the lack of reciprocal monophyly between head and clothing lice.

Reed et al. (2004) found three deeply divergent mitochondrial clades of lice, all of which

contained head lice, whereas only one of which contained clothing lice. Furthermore, all three

clades had unique geographic distributions: 1) one clade was composed of a worldwide

distribution of both head and clothing lice, 2) one clade consisted only of head lice from North

America, Central America, Australia, and Europe, and 3) a second clade that contained only head

lice from Africa and Nepal (further sampling is necessary to determine the geographic range of

lice belonging to this third mitochondrial lineage). These mitochondrial results, the presence of









three deeply divergent clades and the finding that clothing lice arose from only a subset of head

lice, were novel compared to previous studies based on both mitochondrial and nuclear data

(Kittler et al. 2003; Leo et al. 2002; Yong et al. 2003) and resulted in several follow-up studies

examining these results (Leo and Barker 2005; Light et al. 2008).

Light et al. (2008) assessed the taxonomic status of head and clothing lice using both

phylogenetic and population genetic methods and the most diverse geographic and molecular

sampling available. The analyses resulted in reticulated networks, gene flow, and a lack of

reciprocal monophyly, all of which indicate that head and clothing lice do not represent

genetically distinct evolutionary units. Based on these findings, as well as inconsistencies of

morphological, behavioral, and ecological variability between head and clothing lice, Light et al.

(2008) state that no known species concept would recognize head and clothing lice as separate

species.

Medical Importance of P. humanus

Parasitism by lice is a recognized medical condition known as pediculosis. Most patients

are infested by only a few individuals (Raoult and Roux 1999), however, some patients can be

infested with up to hundreds or thousands of lice (Raoult and Roux 1999). When the louse

punctures the host's skin to feed, it injects the host with an anticoagulant and an anesthetic

(Burgess 1995). After three to four weeks of infection, the host begins to have an allergic

reaction, which leads to pruritis. In a clothing louse infestation, areas of the host that are heavily

parasitized may darken, which is referred to as vagabond's disease (Burgess 1995). Heavy

infestation of lice can also cause dull headache, drowsiness, joint pain, rash, and a mild fever

(Buxton 1946).









Louse Transmission

The transmission of head and clothing lice has been studied extensively (Burkhart and

Burkhart 2007; Canyon et al. 2002; Takano-Lee et al. 2005). Though lice can disperse at any

stage, adults are most likely to transfer from one head to another (Takano-Lee et al. 2005).

Canyon et al. (2002) explored the spatial and kinetic factors of direct head-to-head contact in

transmitting head lice. A variety of factors were explored, including the angle of the hairs, the

directionality of hair movement in relation to the louse, and the speed at which the hair moved

relative to the louse. Of the 240 lice that Canyon et al. (2002) tested, zero transferred to hairs

that were placed in a 900 angle to their body. However, when lice were presented with a hair

parallel to their bodies, a small proportion transferred to the new hair. The exact proportion of

lice that transferred was determined by the direction the hair was moving in and the speed at

which the hair was moving. Canyon et al. (2002) demonstrated that lice prefer hair that is

moving laterally (as opposed to dorsal-ventral or reverse) from slow-moving (-4m/min) tail

towards the head (as opposed to head to tail). Canyon et al. (2002) also observed that all lice that

successfully transferred hairs first grasped it with their tarsal claw on their first leg. The precise

kinetics required for lice to transfer from one hair to another indicates that transferring of lice

between hosts through brief head-to-head contact is likely rare (Canyon et al. 2002). The authors

also suggest that because such precise kinetics is necessary, the role of fomites (objects that may

indirectly move louse from one individual to another, such as towels, brushes, etc.) in

transmission may be overestimated (Canyon et al. 2002).

Takano-Lee et al. (2005) investigated the role of fomites in louse transmission. They

demonstrated that air movements, combing, or toweling easily dislodges lice, and lice also

passively transfer to fabric. Both Takano-Lee et al. (2005) and Burkhart and Burkhart (2007)









argue that these findings are evidence for fomite transmission. However, how dislodged lice

reattach to their host is not addressed by these studies. Given the findings of Canyon et al.

(2002), it seems that such specific requirements for louse transmission are unlikely to be met

during the 24-36 hour period that a louse can survive off the host.

Clothing Lice as Vectors of Bacterial Pathogens

The clothing louse vectors three deadly bacterial pathogens. It is generally assumed that

head lice cannot vector diseases (Burgess 2004), though head lice can vector these pathogens in a

laboratory setting (Goldberger and Anderson 1912). Both R. prowazekii, which causes epidemic

typhus, and B. quintana, which causes trench fever, are members of the ac subgroup of

Proteobacteria, and B. recurrentis, which causes relapsing fever, is a spirochete (Raoult and

Roux 1999).

Rickettsia prowazekii

Zinsser (1935) argued that epidemic typhus is likely responsible for more deaths of soldiers

than all wars in history. During the twentieth century alone, typhus outbreaks were associated

with both world wars, and more recently, outbreaks of typhus have occurred in Burundi, Peru,

and Russia in the 1990s (Raoult and Roux 1999). Charles Nicolle demonstrated that the clothing

louse was the typhus vector in 1909 and was awarded the Nobel Prize in 1928 for this pioneering

work (Gross 1996).

There are two competing hypotheses for the origin of epidemic typhus. Some researchers

contend that typhus has an Old World origin (Zinsser 1935) and became established in Spain in

the fifteenth century. Zinsser (1935) speculated that a number of historical epidemics, including

the Athens plague, were possibly caused by typhus. However, given the generality of the

recorded symptoms of these events, it impossible to definitively know if R. prowazekii was the

responsible agent (Raoult et al. 2004). Others argue that typhus has a New World origin,









because the only known nonhuman reservoir, the flying squirrel (Glaucomys volans volans), is

native to Mexico (Bozeman et al. 1975). Historically, this has been challenged by the lack of

evidence that clothing lice successfully accompanied the Amerindians in the migration to the

New World. However, a recent ancient DNA study by Raoult et al. (2008) demonstrated that

head lice belonging to a pre-Columbian Peruvian mummy belonged to the same clade of lice that

contains clothing lice, suggesting that clothing lice likely colonized the New World along with

the Amerindians. This finding weakens the argument that clothing lice did not exist in the pre-

Columbian New World. However, the first definitive evidence of typhus occurred in the

fifteenth century in Spain and sixteenth century in Mexico (Raoult et al. 2004).

Rickettsiaprowazekii is a pathogen to the louse as well as its human host. Clothing lice

contract typhus through feeding on an infected person, though transmission rate is not 100%

(Wolbach et al. 1922). Once ingested, R. prowazekii infects the midgut epithelial cells of the

louse and multiplies (Raoult and Roux 1999). These cells become enlarged and burst, which

releases the bacteria into the gut lumen (Raoult and Roux 1999). R. prowazekii is then excreted

from the louse in large quantities in the feces (Raoult and Roux 1999). Since the ruptured

epithelial cells of the gut are not replaced, infection with R. prowazekii eventually kills the louse

(Raoult and Roux 1999). After the cells rupture, the ingested blood will flow freely through the

intestine and occasionally cause the louse to turn red (Bozeman et al. 1975). Interestingly, R.

prowazekii cannot be transmitted vertically from mother to egg (Buxton 1940; Houhamdi et al.

2002).

The salivary glands of the louse do not contain R. prowazekii (Arkwright and Bacot 1923),

and therefore R. prowazekii is not transmitted to the human host through the louse bite. R.

prowazekii is transmitted to the human host when infective feces are rubbed into open sores









(often caused by louse bites) in the host's skin or into conjunctivae or mucus membranes (Raoult

and Roux 1999). Infective bacteria can persist in the louse excrement for over 100 days (Raoult

and Roux 1999).

Once a person is infected with R. prowazekii, the bacterium spreads throughout the host's

body through the bloodstream and damages the endothelial cells, compromising the host's

vascular system and causing hemorrhages (Raoult and Roux 1999). During this time, the patient

will likely experience fever and headaches, and may also experience a variety of other

symptoms, including cough, nausea, a rash on the trunk of the body, and myalgias (Raoult and

Roux 1999). Many patients develop some abnormalities of the central nervous system (Raoult

and Roux 1999). Without antibiotic treatment, 10-30% of all R. prowazekii infections are fatal

(Raoult and Roux 1999). However, a single dose of 200mg of doxycycline often cures the

patient of epidemic typhus (Raoult and Roux 1999).

Borrelia recurrentis

B. recurrentis, the agent of louse-borne relapsing fever, is closely related to B. duttonii, the

agent of East African tick-borne relapsing fever (Cutler et al. 1997; Raoult and Roux 1999). It is

suspected that the ancestor of B. recurrentis diverged from its tick-borne relatives after it became

associated with clothing lice (Raoult and Roux 1999).

Unlike R. prowazekii, B. recurrentis does not cause illness in its louse host. However,

similar to R. prowazekii, B. recurrentis is not transmitted to the human host through the louse

bite (Raoult and Roux 1999). Until recently, it was thought that B. recurrentis was only to

transmitted to its human host through louse crushing. However, a recent experiment by

Houhamdi and Raoult (2005) showed evidence of B. recurrentis in louse feces, suggesting an

additional route of infection. Like R. prowazekii, B. recurrentis may infect its human host

through infective louse feces rubbed into open sores of the host or into conjunctivae or mucus









membranes (Houhamdi and Raoult 2005).

Humans are the only host of B. recurrentis. Infection of B. recurrentis is characterized by

an initial stage of fever, chills, and headaches, which is often the most severe, followed by a

period of recovery, and a less severe relapse approximately a week later. This cycle continues

and is caused by the cyclic antigenic response of the bacteria. Gene rearrangements within the

bacterium allow new serotypes to be serially expressed. After several relapses, the genetic

variation within the bacterium is often exhausted, and the immune system is able to prevent

further relapses (Raoult and Roux 1999). In the absence of antibiotic treatment, 10-40% of

relapsing fever cases are fatal. However, treatment with antibiotics reduces fatality to 2-4%

(Southern and Sanford 1969).

Bartonella quintana

Members of the genus Bartonella are specialized to infect mammalian hosts and are

transmitted through a variety of arthropod vectors (Raoult and Roux 1999). Infection with B.

quintana is known as trench fever because the first records of infection with B. quintana

occurred in both Allied and German forces during WWI (Raoult and Roux 1999). Currently, the

only identified reservoir host is humans, and the only known vector for B. quintana is the

clothing louse (Raoult and Roux 1999).

Bartonella quintana does not cause illness in the louse host. A louse becomes infected

with B. quintana through feeding on an infected host (Raoult and Roux 1999). B. quintana then

multiples within the louse intestine and is transmitted to the human host through infective louse

feces rubbed into broken skin or conjunctivae or mucus membranes (Raoult and Roux 1999).

Once infected, a person experiences severe fever, headache, shin pain, and dizziness

(Foucault et al. 2006). Infection with B. quintana also occurs in cycles, with the first cycle being

the most severe. A small proportion of infected patients are asymptomatic, though some









experience bacteremia (Foucault et al. 2006). Infection with B. quintana is the least fatal of the

known louse borne diseases, with a mortality rate of <1% (Raoult and Roux 1999). Little is

known about the effectiveness of antibiotic treatment of trench fever, since most data from

infections occurred prior to the use of antibiotics (Raoult and Roux 1999). However, a

combination of doxycyline and gentamicin has been shown to be effective (Raoult and Roux

1999).

Sequencing of the Clothing Louse Genome

The sequencing and annotation of the clothing louse genome was recently completed,

although its final publication has not occurred. The completed genome will provide important

genetic information for the biomedical community. The bacterial genomes for pathogens carried

by clothing lice, R. prowezii, (Anderson et al. 1998), B. quintana (Alsmark et al. 2004), and two

species of Borrelia (Fraser et al. 1997; Glockner et al. 2004) have already been sequenced. The

sequenced genome of P. humanus will provide insights into host-vector-pathogen interactions

(Pittendrigh et al. 2006). The discovery of genes that are involved in vitellogenin production or

olfactory receptors involved in locating potential hosts may provide targets for louse-specific

pesticides (Pittendrigh et al. 2006). The development of oligonucleotide arrays and RNAi may

aid in gene discovery. Further, oligonucleotide arrays may aid in determining which genes are

induced or repressed during changes in louse behavior and environment, such as between head

lice and clothing lice (Pittendrigh et al. 2006). Finally, sequencing of the P. humanus genome

has the potential to determine if head lice are able to serve as vectors for bacterial pathogens

(Pittendrigh et al. 2006).

In addition to the importance of the P. humanus genome to the biomedical community,

the genome will also provide insights to the evolutionary biology community. P. humanus will

be the first genome sequenced of a hemimetabolous insect. Already, the small size (105MB) of









the P. humanus genome relative to other insect genomes, such as Drosophila (175MB) and

Anopheles gambiae (260MB), is raising important evolutionary questions, particularly because

most other hemimetabolous insects are generally estimated to have large genomes (2000MB-

16,300MB) (Pittendrigh et al. 2006). In order to explain such a small genome size, several

questions related to genome composition are raised, such as the number and size of noncoding

regions and the number and types of repetitive elements (Pittendrigh et al. 2006). Further, is the

reduction in genome size a result of human parasitism, and if so, is it a result of selection for

metabolic or replication efficiency or ecological specialization for the human host (Pittendrigh et

al. 2006)? In addition to interesting biological questions raised by the small genome size,

evolutionary biologists can also use the P. humanus genome to search for genes that help resolve

relationships within Phthiraptera. Further, genes involved in parasitism of vertebrate hosts will

be identified (Pittendrigh et al. 2006).

The P. humanus genome project has achieved 8x coverage. Preliminary analyses indicate

that the genome is AT rich, with a GC content of only 27.5%. However, 56% of genes of P.

humanus occur in GC rich regions, indicating a slight bias for genes to occur in GC rich areas.

Currently, 11,214 genes have been identified, and 90% of those (10,187) share sequence

similarity to genes in other insects. Of the 11,214 genes, 9698 contain introns, of which the

average length is 303 base pairs and the average exon length is 238 base pairs. Only 1% of the

P. humanus genome consists of transposable elements, and both class I and class II elements are

present. When compared with other insect genomes, such as Apis mellifera, Drosphila

melanogaster, Anopheles gambiae, and Tribolium castaneum, P. humanus shows a reduction in

gene families associated with detoxification, such as the p450, GST, and esterase gene

superfamilies. The reduction in detoxification mechanisms is consistent with the life-history of









P. humanus. Because P. humanus is so closely ecologically tied to its human host, it is not

exposed to secondary compounds produced by plants. Similarly, the P. humanus genome also

has a reduction of gene families involved in sensory functions, such as opsin and chemoreceptor

genes.

In addition to the clothing louse genome, the primary endosymbiont and mitochondrial

genomes of P. humanus have also been sequenced. The reduced size of the primary

endosymbiont, Candidatus Riesiapediculicola, is consistent with the genome reduction that

occurs when a bacterium is sequestered as an endosymbiont. Phylogenetic analysis of the

Candidates Riesiapediculicola sequence indicates that it is placed among the basal gamma-

proteobacteria.

The mitochondrial genome of P. humanus displays a unique organization. Unlike the

other >1000 bilaterian animals with sequenced mitochondrial genomes, the P. humanus genome

does not consist of a single circular 16kb chromosome. Rather, it consists of 18 minicircular

chromosomes, each of which has a length of 3kb and 1-3 genes. Analysis of the mitochondria of

the pubic louse (Pthiruspubis), chimp louse (Pediculus schaeffi), and the langur louse

(Pedicinus ancoratus) indicates that these also have minicircular mitochondrial genomes, and

that the most recent common ancestor of these lice that parasitize primates likely had a similar

mitochondrial genome organization 22.5 million years ago.

Lice as Markers of Human Evolutionary History

Sucking lice complete their entire life cycle on their mammalian host, which selects for

high host specificity and leads to cospeciation between parasite and host. Primates and their

parasitic sucking lice have been cospeciating for the last 22.5 million years (Reed et al. 2004).

Researchers have exploited this property to learn more about primate evolution (Reed et al. 2004,

Reed et al. 2007). Reed et al. (2004) analyzed molecular data from sucking lice of anthropoid









primates and confirmed the date of the human-chimp divergence to be 5-7 million years ago.

Another study by Reed et al. (2007) dated the divergence between two sister taxa of lice, the

gorilla louse, Pthirus gorillae, and the human pubic louse, Pthiruspubis, to be three million

years. This date is significantly earlier than the human-chimp ancestor and gorilla divergence of

7-8 million years ago (Reed et al. 2007), suggesting a host switch from gorillas to humans.

Sucking lice, particularly P. humanus, has also provided insights into the population

genetics of archaic and modern humans. Reed et al. (2004) confirmed that head and clothing lice

went through a population bottleneck and subsequent expansion out of Africa with modern

humans. Reed et al. (2004) also determined that there are three mitochondrial lineages of P.

humanus, one that contains head and clothing lice and two that contain only head lice. Also,

ancient DNA from P. humanus of a 1000 year-old Peruvian mummy indicates that the clade

containing head and clothing lice was in the New World prior to European colonization (Raoult

et al. 2008). This discovery supports the hypothesis that the bacterial agent of typhus, Rickettsia

prowazekii, may be the result of a New World origin that involves a host switch of the bacterium

from its reservoir host, the flying squirrel, Glaucomys volans volans (Raoult et al. 2008).

Population genetics of P. humanus has the potential to address several other questions

relating to human evolutionary history. In order to address the origin of clothing use, Kittler et

al. (2003, 2004) used unspecified phylogenetic methods to date the age of the clade that

contained both head and clothing lice to 107,000 years ago. Though the phylogenetic methods

used by Kittler et al. (2003, 2004) may have been inappropriate for a population-level question,

lice may provide insight into the origin of the clothing use through coalescent methods to date

the population divergence between head and clothing lice. Also, the taxonomic status of head

and clothing lice may be addressed using molecular techniques. Further, the deep divergences









that occur among three lineages ofP. humanus are potentially informative about the relationships

between archaic hominids and modern humans (Reed et al. 2004).

Currently, evolutionary biologists and anthropologists studying lice rely on three nuclear

markers, EF1-alpha, RPII, and 18S, four mitochondrial markers, COI, CytB, ND4, and control

region, and five microsatellite loci (Leo and Barker 2005) to draw inferences about the

population genetics of head and clothing lice. With the release of the P. humanus genome, a

variety of new molecular tools will soon be available, such as a variety of nuclear genes, SNPs,

microsatellites, and oligonucleotide arrays. These new tools will allow researchers to address

biological and anthropological questions whose answers have been elusive thus far.









CHAPTER 2
POPULATION GENETIC ANALYSIS OF Pediculus humanus PROVIDES INSIGHT INTO
THE ORIGIN OF HUMAN CLOTHING

Introduction

Biologists studying organisms with reduced genetic variation have begun to regularly

exploit host parasites and pathogens to track events in the evolutionary history of the host. This

is particularly true in the fields of conservation (Whiteman and Parker 2005), invasive species

(Meusnier et al. 2001), and human evolution research (reviewed in Wirth et al. 2005), where host

genetic variation is greatly reduced. In such scenarios, the parasite may generate more genetic

diversity than the host due to its generally shorter generation time, which increases its

evolutionary rate. Additionally, parasites often have larger effective population sizes, and

therefore maintain more genetic variation through bottleneck events. The faster evolutionary

rate of the parasite and increased genetic variation may therefore capture evolutionary events that

are not coded in host DNA, allowing biologists to study the evolutionary history of the host

through analysis of parasite DNA. This has been used most often in studies of human history

(reviewed in Wirth et al. 2005), where JC virus, herpes simplex virus 1, human papillomaviruses,

and Helicobacterpylori have been used to track human evolution.

Microparasites (bacteria and viruses) often reproduce clonally, and are thus highly

susceptible to selective sweeps at a few loci producing patterns of genomic diversity that do not

reflect the history of the host (Grenfell et al. 2004; Nieberding et al. 2006; Rich et al. 1998).

Conversely, macroparasites (such as parasitic arthropods) often reproduce sexually and may

therefore track host evolutionary history more accurately because selective sweeps affect only

closely linked loci in their genomes (Grenfell et al. 2004). For this reason, the use of

macroparasites, such as pinworms (Araujo et al. 2008) and lice (Raoult et al. 2008; Reed et al.

2004), has become increasingly common in the study of human evolution.









Sucking lice (Phthiraptera: Anoplura) have cospeciated with their primate hosts for at

least the last 22.5 million years (Reed et al. 2004). These lice are permanent, obligate

ectoparasites that require direct contact between their primate hosts for transmission (Burgess

2004; Canyon et al. 2002). Molecular examination of these lice has confirmed events known

from primate history, such as the human-chimp divergence 5-7 million years ago (Reed et al.

2004). Additionally, the study of human lice (Pediculus humanus) has confirmed events in

human demographic history, such as the population expansion of anatomically modern humans

100,000 years ago (Reed et al. 2004). These findings indicate that human lice have great utility

for the study of human population history.

Two varieties of human lice, head and clothing lice (both P. humanus; see Light et al.

2008), may also provide insights into human evolution not recorded in human genetic data,

specifically the origin of clothing use. Determining the origin of clothing use has been primarily

inferential in anthropological literature as most materials used for clothing (furs, skin, cloth)

degrade rapidly and are thus unknown in the archaeological record of the Late Pleistocene.

Archaeological evidence for the use of tailored clothing, such as needles, first appears -40,000

years ago (Delson et al. 2000). Earlier evidence for tools used to scrape hide appears -300,000

years ago (Toth and Schick 1993); however, there is no definitive evidence that these tools were

used to make even rudimentary clothing. The inability of the archaeological record to answer this

question suggests that an innovative approach is necessary.

The biology of human head and clothing lice makes them potentially useful markers to

infer the origin of clothing use in humans. Molecular data suggest that humans lost their body

hair approximately 1.2 million years ago (Rogers et al. 2004). Prior to body hair loss, lice in the

genus Pediculus likely occurred more uniformly across the body, but upon body hair loss









became restricted to the head. As humans started wearing clothing, a portion of head lice

colonized this new habitat and became the ancestors of clothing lice (Burgess 1995; Kittler et al.

2003; Kittler et al. 2004). These lice then became specialized for the clothing niche, and at

present spend more time in clothing than on the body, only returning to the body to feed once or

twice per day. Of the three mitochondrial lineages of P. humanus (Leo et al. 2002; Raoult et al.

2008; Reed et al. 2004), two lineages contain only head lice and the third contains both head and

clothing lice. Kittler et al. (2003, 2004) used phylogenetic methods to date the age of the lineage

that contained both head and clothing lice and determined the origin of clothing use to be

107,000 years ago.

Kittler et al.'s date of 107,000 years (2003, 2004) suggests a recent origin of human

clothing use. However, phylogenetic methods are inappropriate for answering this population-

level question since several researchers have shown that head and clothing lice do not form

reciprocally monophyletic clades (Leo et al. 2002; Reed et al. 2004; Yong et al. 2003).

Furthermore, a recent study has demonstrated significant gene flow between head and clothing

lice (Light et al. 2008), suggesting that recent head and clothing lice evolution is best understood

as a population genetic process.

In this study, we exploit recent advances in coalescent methodology using multiple loci to

analyze louse genetic data and address the origin of clothing use in humans. We first use a

relaxed clock method (Drummond et al. 2006) to estimate mutation rates for our multilocus

dataset. We then employ an isolation-with-migration coalescent method that jointly estimates

divergence times, population sizes and migration rates from our multilocus dataset (Hey 2005;

Nielsen and Wakeley 2001) to date the divergence of, and migration rates between, human head

and clothing louse populations.









Materials and Methods


Molecular Data

All available DNA sequence data for the following genes were downloaded from

GenBank (see Supplemental Table 1): mitochondrial gene COI (166 sequences) and the nuclear

genes 18S rRNA (22 sequences), EF-la (40 sequences; not including any of the sequences from

(Yong et al. 2003), which were shown by Light et al. (2008) to be contaminants, and RPII (53

sequences). Sequences for the outgroup taxon Pediculus schaeffi (parasitic on chimpanzees)

were downloaded from GenBank for each of the four genes (Supplemental Table 1). All COI,

EF-la and RPII sequences were aligned by hand using MacClade (Maddison and Maddison

2005) and manually edited to maintain proper reading frames using Se-Al v2.01al 1. All 18S

rDNA sequences were aligned manually in reference to secondary structure (Gillespie et al.

2004; Gillespie et al. 2005); alignment available at the jRNA web site) and ambiguously aligned

sites were removed before analysis.

EvolutionaryRate Calculation

Phylogenies and evolutionary rates (ti) for each of the four genes were co-estimated

under a "relaxed" (uncorrelated lognormal distribution) molecular clock using BEAST v.1.4.6

(Drummond et al. 2006; Drummond and Rambaut 2007). Estimates of [t were calibrated under

an assumption of host-louse cospeciation, which has been demonstrated by Reed et al. (2004) for

Hominidae. Specifically, an exponential prior distribution with a lower bound of 5MYA and

mean of 5.5MYA was placed on the divergence of P. humanus and P. schaeffi that reflects

current estimates for the divergence of their human and chimpanzee hosts (Kumar and Hedges

1998), respectively. All analyses were performed with a GTR + I + F nucleotide substitution

model and a Yule birth-death prior on the tree topology. All Markov chains were run for









10,000,000 generations with samples taken every 1,000 generations and the first 1,000,000

generations were discarded as bum-in.

Isolation with Migration Analysis

A Bayesian isolation-with-migration coalescent analysis (Hey and Nielsen 2004; Nielsen

and Wakeley 2001) was performed on the multilocus louse dataset using the program IM (Hey

2005). The isolation-with-migration coalescent model assumes that an ancestral population of

effective size NA diverges at some time t into two daughter populations of initial size sNA and (1-

s)NA, both of which then experience independent exponential growth and migration between

populations (with rates mi and m2). All IM analyses were performed with a Hasegawa-Kishino-

Yano (HKY) nucleotide substitution model for all four loci, and the upper bound of the prior

distribution for the time of divergence was set to 5.5MYA, following best estimates for the

human-chimpanzee divergence (see above). Estimates of i from the evolutionary rate calculation

above were used to convert population mutation parameter estimates (i.e. t) from mutational

units into absolute units. All other priors were conservatively estimated from preliminary runs

with very broad uniform prior distributions to facilitate adequate Markov chain mixing. All

Markov chains were run for 600 million generations and sampled every 600 generations. Ten

replicate runs with unique seed values were performed to ensure Markov chain convergence.

Results

Independent runs of IM analyses converged on similar posterior distributions

(summarized in Figure 1). Peaks in the distribution were taken as point estimates of population

genetic parameters. At the time of completion, all estimates of effective sample size exceeded

400. Estimates of 0 and t were converted to effective population size and absolute time-since-









divergence, respectively, using estimates of [t obtained with BEAST v.1.4.6 (Drummond et al.

2006; Drummond and Rambaut 2007).

The distributions of current effective population sizes of head and clothing lice were

contained within the priors. Point estimates were 2.5 million individuals for head lice and

1.8 million individuals for clothing lice. Estimates of the splitting parameter s indicate that only

a small proportion of the ancestral population (<1%) initially colonized clothing, whereas the

majority (>99%) remained head lice, which is thought to be the ancestral condition. Estimates of

bidirectional migration (m) showed very high migration from head lice to clothing lice (m =

1.16), but virtually no migration in the opposite direction (m = 0.0040).

The posterior distribution for the time of population divergence peaks between 650,000-

700,000 years ago in all IM replicates. The effective population size for the common ancestor of

head and clothing louse peaked at the lowest bin and decreased thereafter. There are two

potential explanations for this. First, the effective population size of the common ancestor was

smaller than our analysis could detect. Alternatively, because head and clothing lice diverged

long ago and have likely been through the same population bottlenecks as their human host, there

may be too little information in the data to effectively estimate this parameter.

Discussion

Pediculus humanus diverged from its sister taxon, the chimpanzee louse P. schaeffi, at

the human-chimp divergence roughly 5.5 million years ago (Reed et al. 2007; Reed et al. 2004).

It is likely that lice in the genus Pediculus parasitized all subsequent hominid lineages given their

history of cospeciation. Because P. schaeffi is found throughout the body of their chimpanzee

hosts it is likely that the human parasite species of Pediculus also utilized much of the human

body prior to the general loss of body hair in humans. At the time humans lost their body hair,









Pediculus likely became restricted to head hair, and only invaded the body niche recently with

the advent of clothing use (Busvine 1978; Burgess 1995; Kittler et al. 2003; Kittler et al. 2004).

This is inferred primarily from the current natural history of clothing lice. At present, clothing

lice spend the majority of their time in clothing, and only return to the body to feed. Clothing lice

prefer to attach their eggs to the pleats and seams of clothing, particularly the undergarments,

rather than body hair (Burgess 1995; Buxton 1946; Nuttall 1917). In the absence of clothing,

clothing lice will infest beads and necklaces (Busvine 1978; Buxton 1946). When displaced,

clothing lice tend to return to the clothing and are particularly attracted to areas that are occupied

by other clothing lice or clothing louse feces (Mumcuoglu et al. 1986; Wigglesworth, 1941).

Our results support the assertion that the head was likely the ancestral habitat for P.

humanus. The splitting parameter s indicates that a large proportion of the ancestral louse

population (>99%) was of the head lice type at the time of divergence, and that only a small

proportion (<1%) moved to the clothing niche as a founder population. Furthermore, our results

indicate a lack of migration from clothing louse to head louse populations, suggesting that

clothing lice are ecologically distinct and possibly unable to survive under head louse conditions.

This finding is consistent with empirical transplantation experiments. When head lice are reared

as clothing lice in the laboratory (in pill boxes worn upon the skin), morphological and

behavioral changes take place such that the head lice gain the morphological and natural history

characteristics of clothing lice within a few generations (Alpatov and Nastjukova 1955; Bacot,

1917; Levene and Dobzhansky 1959; see Busvine, 1948 for a single known exception). Further,

when clothing lice are displaced, they return to clothing, particularly areas occupied by other

clothing lice and clothing louse feces (Mumcuoglu et al. 1986; Wigglesworth 1941). However,









there is no evidence to suggest that clothing lice can successfully colonize the head louse niche,

which provides further support for unidirectional gene flow.

Coalescent methods that use multiple loci for population genetic inference reduce

uncertainty in estimates of divergence time related to genealogical stochasticity (Edwards and

Beerli 2000). This allows us to estimate the divergence of head and clothing lice, as opposed to

dating the origin of the clade of head and clothing lice using phylogenetic methods (Kittler et al.

2003; Kittler et al. 2004). By using population genetic methods to date the divergence, we are

able to obtain a more precise estimate of when populations of P. humanus began to colonize the

clothing niche. Furthermore, our analyses uncovered a high rate of migration (m = 1.16) from

head to clothing lice, further indicating that the divergence between head and clothing lice is a

population genetic process.

Our point estimate of 650,000 years ago (90% HPD 225kya-6mya) indicates that head

and clothing lice diverged significantly earlier than previously thought and suggests that the use

of rudimentary clothing originated with archaic hominids, not anatomically modern humans,

which arose only within the last 120,000 years (Pakendorf and Stoneking 2005). Also, it is

important to note that the divergence of human head and clothing lice provides a minimum date

for the origin of clothing use; it is possible that the clothing niche existed for some time before

parasitic lice successfully colonized clothing.

There are both adaptive and neutral explanations for why and how clothing use arose.

Clothing may have arisen in Africa because it conferred an advantage to archaic hominids living

in high altitudes. Alternatively, clothing use may have arisen for decorative purposes. Though

our study cannot disentangle these alternatives, it can provide some insight as to where clothing

use arose.









The mitochondrial clade of P. humanus that contains both head and clothing lice has the

genetic signature of a population expansion that occurred 100,000 years ago (Reed et al. 2004)

suggesting that these lice accompanied modern humans out of Africa. Because the date of

divergence of head and clothing lice only provides a minimum estimate for the origin of clothing

use, the technology to make clothing may have existed for some time prior to 650,000 years ago.

Anthropologists recognize multiple dispersals of hominid species out of Africa (Anton

and Swisher 2004; Dennell 2003; Finlayson 2005), with the first dispersal ofH. erectus

occurring approximately 2 million years ago (Anton and Swisher 2004; Dennell 2003; Finlayson

2005). Most of the evidence suggests that H. erectus populations outside of Africa were largely

confined to Southeast Asia, though there is some evidence ofH. erectus in northern Asia around

this time (Anton and Swisher 2004; Dennell 2003; Finlayson 2005). The permanence of these

earliest dispersals into northern latitudes has been questioned (Dennell 2003). Interestingly, our

estimate approximately coincides with the first evidence of permanent archaic hominid

settlements into high latitude regions of Europe and Central Asia between 800,000 and 500,000

years ago (Ascenzi et al. 1996; Carbonell et al. 1995; Dennell 2003; Ranov 1995). It is possible

that the archaic hominids that dispersed and successfully colonized colder climates 800,000 to

500,000 years ago may have possessed the knowledge to use furs and skins as rudimentary

clothing, which would have allowed them to survive and persist in the temperate climates of

Europe and Central Asia. Alternatively, it is conceivable that clothing use originated with

archaic hominids in Europe and Central Asia, and spread to archaic hominid populations in

Africa via intermittent contact. However, this is less likely, considering that archaic hominid

populations in Central Asia and Europe were likely spatially and temporally discontinuous









during this time period (Dennell 2003), making transfer of technology between populations

difficult.

The natural history of clothing lice suggests that they are ecologically distinct from head

lice, and therefore it is assumed that clothing lice only arose with the advent of clothing use

(Burgess 1995; Busvine 1978; Kittler et al. 2003; Kittler et al. 2004). Our analyses indicate that

only a small proportion of lice initially colonized clothing, but that migration from head to

clothing has been considerable (m = 1.16) since. Further, our analyses suggest that clothing use

originated with archaic hominids in Africa 650,000 years ago, not modern humans, and may

have played a role in the archaic hominid colonization of Central Asia and Europe.













0.01

0.009

0.008 Head
Clothing
0.007

0.006

0.005 A

0.004

0.003

0.002

0.001

0
0 2 4 6 8
Population Size (millions)




0.035

0.03
head to clothing

0.025 clothing to head

0.02 B

0.015

0.01

0.005



0 2 4 6 8
Migration


0.007

0.006

0.005

0.004
C
0.003

0.002

0.001


0 1 2 3 4 5 6
Time (million years)


Figure 2-1: Marginal posterior probability distributions for model IM parameters in demographic
units. (A) Effective population size. (B) Migration rates (m). (C) Time since
divergence.










Table 2-1: Estimates of evolutionary rate (i) in substitutions/locus/year for each locus.
Locus I
EF1-alpha 0.00000285
COI 0.0000163
18S 0.0000118
RPII 0.000041









CHAPTER 3
CHARACTERIZATION OF ELEVEN POLYMORPHIC MICRO SATELLITE LOCI FROM
THE HUMAN HEAD AND CLOTHING LOUSE, Pediculus humanus

Human head and clothing lice, Pediculus humanus capitis and Pediculus humanus

humanus, respectively, have parasitized humans for thousands of years (Araujo et al. 2000).

Currently, head lice are pandemic, infesting millions of schoolchildren worldwide. Clothing lice,

though less prevalent, are common among areas stricken by poverty or political and social unrest

that prevent inhabitants from having multiple sets of clothes (Raoult and Roux 1999). Clothing

lice (also called body lice) are also becoming increasingly common among the homeless

populations in developed countries such as the United States and Western Europe (Brouqui et al.

1996; Drancourt et al. 1995; Koehler et al. 1997). Clothing lice are more harmful parasites

because they can vector three bacterial pathogens: Rickettsiaprowazekii (epidemic or louse-

borne typhus; but see (Robinson et al. 2003), Borrelia recurrentis (louse-borne relapsing fever)

and Bartonella quintana (trench fever; Buxton 1946; but see Sasaki et al. 2006).

In addition to their importance in the biomedical field, human head and clothing lice are

of interest to evolutionary biologists and anthropologists. Head and clothing lice are part of a

group of anoplurans that have cospeciated with primates for 22.5 million years (Reed et al.

2004), and therefore have been used to provide insights into human evolutionary history (Kittler

et al. 2003; Kittler et al. 2004, Raoult et al. 2008; Reed et al. 2007; Reed et al. 2004). For

example, head and clothing lice have been used to estimate the origin of clothing use in humans

(Kittler et al. 2003; Kittler et al. 2004). The use of population level markers, such as

microsatellites, may provide insights into the epidemiology and evolutionary history of one of

the oldest human parasites.

Microsatellite loci were mined from the Human Body Louse Genome Project (Johnston

et al. 2007) using Tandem Repeat Finder (Benson 1999). Of the initial microsatellite search, loci









were selected that contained a minimum of eight repeats and at least 200 base pair flanking

regions on each side that was free of other repetitive elements. These loci were further screened

when designing primer pairs using PRIMER3 (Rozen and Skaletsky 2000) for formation of

hairpins, self-dimers, hetero-dimers, and optimal primer GC content of 40-60%. Primer pairs

were designed for a total of 48 loci, of which 11 have been assessed for polymorphism using 18

head louse individuals, each from a separate host individual, from West Palm Beach, Florida.

DNA amplifications were carried out in 25[tL reactions containing 11.5[tL of distilled

water, 10[tL of 5Prime HotMaster Mix (Eppendorf), 11tL of 1CtM M13 labeled forward primer,

1ltL of 10M reverse primer, and 1ltL of 10M FAM label, and 0.5 ptL of DNA template.

Thermocycling conditions for all loci were identical and are as follows: 940 for 3 min, followed

by 10 cycles of 940 for 30 s, 520 for 30 s, 650 for 45 s, then 30 cycles of 940 for 30 s, 480 for 30

s, 650 for 45 s, and a final extension of 650 for 10 min. Fragment lengths of PCR products were

detected using ABI 3730 Automated Sequencer and scored using GENEMAPPER 3.0 software

(Applied Biosystems).

Data for loci analyzed are available in Table 1. The number of alleles ranged from 3-7

per locus. Observed and expected heterozygosities were calculated using MICROSATELLITE

ANALYSER 4.05 (Dieringer and Schlotterer 2003) and ranged from 0.056-0.278 and 0.303-

0.820, respectively. Linkage disequilibrium with a Bonferroni correction was tested using

GENEPOP version 3.4 (Raymond and Rousset 1995) and no linkage disequilibrium was

identified. Deviations from Hardy-Weinberg equilibrium were tested using GENEPOP version

3.4 (Raymond and Rousset 1995). Only two loci, M2_19 and M3_9 are in Hardy-Weinberg

equilibrium, and M2_19 is only marginally so (p=0.050). Because 9 of 11 loci are polymorphic









and exhibit heterozygote deficiency,it is likely the population tested that is out of Hardy-

Weinberg equilibrium, and not the loci.

Our results indicate that these microsatellites are clearly polymorphic in this population,

though not in Hardy-Weinberg equilibrium. Several possible explanations exist for why the

population may be out of Hardy-Weinberg equilibrium, such as high population substructure or

nonrandom mating. Additional populations should be screened to determine if this is specific to

the population of head lice in West Palm Beach, Florida, or if it is characteristic of the species in

general. Alternatively, further sampling of the population in West Palm may reveal a high level

of population substructure. The polymorphic microsatellites identified in this study may be

useful in examining differences between head and clothing lice, in examining fine-scale host

migrations, and characterizing local populations worldwide.










Table 3-1. Characteristics of eleven microsatellite loci for the human head and clothing louse, P.
humanus, including locus name, primer sequence, repeat motif, allele size range,
number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (HE),
and probability associated with Hardy-Weinberg equilibrium.
Repeat Allele Size
Locus Primer Sequence Motif (bp) Na Ho HE P
M2 2 F: TCTTGCAGTGTGTCTCTTTGC GA 392-412 4 0.056 0.678 0.000
R: CTATCGGAAATGTGCAGAGC
M2 3 F: TGATATTTTAGGCGCACAACC GA 364-370 4 0.059 0.497 0.000
R: GTCTCAATTCGGCCACTTCT
M2 4 F: TTCAGGATCTTCTGCCCAAC GA 308-316 4 0.056 0.662 0.000
R: GGGTTCGCAAAAAGGTGAC
M2 16 F: TAACGACCGCTTTTCGAGTT GA 242-266 6 0.111 0.697 0.000
R: GGGGTGAACTGGATGTTTCA
M2 17 F: GCCTAGCGAAAGCTCTGAAA TA 235-253 6 0.188 0.714 0.000
R: GAAGTATCATTTCGGCGTGA
M2 19 F: GGTGGCAAAAACCACTAATGA TA 182-198 4 0.278 0.486 0.050
R: TCCGTTAAAAATGGCAAAGG
M3 3 F: TGTTCCTGCTGGTAAACTTGC TAA 238-295 7 0.176 0.820 0.000
R: GAACGATCAATCTGCTTCTGC
M3 9 F: CCCGTAAAATATCCACGCTGT TTA 284-302 3 0.278 0.332 0.507
R: CTGGTCGGCTATGTTTTGCT
M3 11 F: CTCCTAACGGGAGCAAAGAA TTA 299-357 6 0.167 0.749 0.000
R: CCATACATATTAGTCGCCTTCCA
M3 18 F: CGTCGGAGGAATGTATAGGG GAC 275-299 4 0.111 0.303 0.011
R:GACAGTGACGGATCGAACG
M3 19 F: TTAAGAGCTGATGCCACGTC CAT 346-358 4 0.118 0.405 0.000
R: TCTGGAAAAGGACGAAAGGA









REFERENCES


Allen, J. M., D. L. Reed, M. A. Perotti, and H. R. Braig. 2007. Evolutionary relationships of
"Candidatus Riesia spp.," endosymbiotic Enterobacteriaceae living within hematophagous
primate lice. Appl. Environ. Microb. 73:1659-1664.

Alpatov, W. W., and 0. K. Nastjukova, 1955. Transformation of the head form of
Pediculus humanus L. into the body form under the influence of changed living
conditions. Bull. Soc. Nat. Moscow 60:79-92.

Andersson, S. G., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten, U. C. Alsmark, R. M.
Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler, and C. G. Kurland. 1998. The
genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-
140.

Anton, S.C. and C. C. Swisher III. 2004. Early dispersals of Homo from Africa. Annu. Rev.
Anthropol. 33:271-296.

Alsmark, C. M., A. C. Frank, E. O. Karlberg, B. A. Legault, D. H. Ardell, B. Canback, A. S.
Eriksson, A. K. Naslund, S. A. Handley, M. Huvet, B. La Scola, M. Holmberg, and S. G.
E. Andersson. 2004. The louse-borne human pathogen Bartonella quintana is a genomic
derivative of the zoonotic agent Bartonella henselae. Proc. Natl. Acad. Sci. USA
101:9716-9721.

Amevigbe, M. D. D., A. Ferrer, S. Champorie, N. Monteny, J. Deunff, and D. Richard-Lenoble.
2000. Isoenzymes of human lice: Pediculus humanus and P. capitis. Med. Vet. Entomol.
14:419-425.

Araujo, A., L. F. Ferreira, N. Guidon, N. Maues Da Serra Freire, K. J. Reinhard, and K. Dittmar.
2000. Ten thousand years of head lice infection. Parasitol. Today 16:269.

Araujo, A., K. J. Reinhard, L. F. Ferreira, and S. L. Gardner. 2008. Parasites as probes for
prehistoric human migrations? Trends Parasitol. 24:112-115.

Arkwright J. and A. Bacot. 1923. Investigation of the aetiology of typhus fever, especially
undertaken for the Egyptian government in the Public Health Laboratories, Cairo. Br. J.
Exp. Pathol. 4:70-80.

Ascenzi, A., I. Biddittu, P.F. Cassoli, A.G. Segre, and E. Segre-Naldini. 1996. A calvarium of
late Homo erectus from Ceprano, Italy. J. Hum. Evol. 31:409-423.

Aschner, M. 1932. Experimental investigations on the symbiosis of the body louse.
Naturwissenschaften 20:501-505.

Aschner, M. 1934. Studies on the symbiosis of the body louse. I. Elimination of the Symbionts
by centrifugalisation of the eggs. Parasitology 26:309-314.









Bacot, A.W. 1917. A contribution to the bionomics ofPediculus humanus (vestimenti) and
Pediculus capitis. Parasitology 9:228-258.

Benson, G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids
Res. 27:573-80.

Bozeman F.M., S. A. Masiello, M. S. Williams, and B. L. Elisberg. 1975. Epidemic typhus
rickettsiae isolated from flying squirrels. Nature 255:545-547.

Brouqui, P., P. Houpikian, H. T. Dupont, P. Toubiana, Y. Obadia, V. Lafay, and D. Raoult.
1996. Survey of the seroprevalence of Bartonella quintana in homeless people. Clin.
Infect. Dis. 23:756-759.

Buchner, P. 1965. Endosymbiosis of animals with plant microorganisms. Interscience, New
York, NY.

Burgess, I. E. 2004. Human lice and their control. Annu. Rev. Entomol. 49:457-481.

Burgess, I. F. 1995. Human lice and their management. Adv. Parasitol. 36:271-342.

Burkhart, C. N., and C. G. Burkhart. 2007. Fomite transmission in head lice. J. Am. Acad.
Dermatol. 56:1044-1047.

Busvine, J. R., 1944. Simple experiments on the behaviour of body lice. Proc. R. Entomol. Soc.
19: 22-26.

Busvine, J. R., 1948. The 'head' and 'body' races ofPediculus humanus L. Parasitology 39:1-
16.

Busvine, J. R. 1978. Evidence from double infestations for the specific status of human head and
body lice (Anoplura). Syst. Entomol. 3:1-8.

Buxton, P. A. 1940. The biology of the body louse (Pediculus humanus corporis: Anoplura)
under experimental conditions. Parasitology 32:303-312.

Buxton, P. A. 1946. The louse. 1st ed. Williams & Wilkins Co., Baltimore, MD.

Canyon, D. V., R. Speare, and R. Muller. 2002. Spatial and kinetic factors for the transfer of
head lice (Pediculus capitis) between hairs. J. Invest. Dermatol. 119:629-631.

Carbonell, E., J. M. Bermudez de Castro, J. L. Arsuaga, J. C. Diez, A. Rosas, G. Cuenca-Bescos,
R. Sala, M. Mosquera, and X. P. Rodriguez. 1995. Lower Pleistocene hominids and
artifacts from Atapuerca-TD6 (Spain). Science 269:826-830.

Clayton, D. H., and K. P. Johnson. 2003. Linking coevolutionary history to ecological process:
Doves and lice. Evolution 57:2335-2341.









Cutler, S. J., J. Moss, M. Fukunaga, D. J. Wright, D. Fekade, and D. Warrell. 1997. Borrelia
recurrentis characterization and comparison with relapsing-fever, Lyme-associated, and
other Borrelia spp. Int. J. Syst. Bacteriol. 47:958-968.

Delson, E., Tattersall, I., Van Couvering, J., and Brooks, A. (2000). Encyclopedia of Human
Evolution and Prehistory. Garland, New York, NY.

Dennell, R. 2003. Dispersal and colonisation, long and short chronologies: how continuous is
the Early Pleistocene record for hominids outside East Africa? J. Hum. Evol. 45:421-440.

Dieringer, D. and C. Schlotterer. 2003. Microsatellite analyser (MSA): a platform independent
analysis tool for large microsatellite data sets. Mol. Ecol. Notes 3:167-169.

Drancourt, M., J. L. Mainardi, P. Brouqui, F. Vandenesch, a. Carta, F. Lehnert, J. Etienne, F.
Goldstein, J. Acar, and D. Raoult. 1995. Bartonella (Rochalimaea) Quintana
Endocarditis in 3 Homeless Men. New Engl. J. Med. 332:419-423.

Drummond, A. J., S. Y. Ho, M. J. Phillips, and A. Rambaut. 2006. Relaxed phylogenetics and
dating with confidence. PLoS Biol. 4:e88.

Drummond, A. J., and A. Rambaut. 2007. BEAST: Bayesian evolutionary analysis by sampling
trees. BMC Evol. Biol. 7:214.

Edwards, S. V., and P. Beerli. 2000. Perspective: gene divergence, population divergence, and
the variance in coalescence time in phylogeographic studies. Evolution 54:1839-1854.

Fahrenholz, H. 1915. Lause verschiedener Menschenrassen. Z. Morphol. Anthropol. 17:591-
602.

Fahrenholz, H. 1916. Zur Nomenklatur einiger Anopluren-Arten. Zool. Anz. 47:269-272.

Farrell, B. D. 1998. "Inordinate fondness" explained: Why are there so many beetles? Science
281:555-559.

Ferris, G. F. 1951. The sucking lice. Mem. Pacif. Cst. Ent. Soc. 1:1-320.

Ferris, G. F. 1935. Contribution towards a monograph of the sucking lice. Part VIII. Stanford
Univ. Publs. Biol. Sci. 2:527-634.

Finlayson, C. 2005. Biogeography and evolution of the genus Homo. Trends Ecol. Evol.
20:457-463

Foucault, C., P. Brouqui, and D. Raoult. 2006. Bartonella quintana characteristics and clinical
management. Emerg. Infect. Dis. 12:217-223.









Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A.
Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D.
Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg,
M. Hanson, R. vanVugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback,
L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K.
Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a
Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586.

Gillespie, J. J. 2004. Characterizing regions of ambiguous alignment caused by the expansion
and contraction of hairpin-stem loops in ribosomal RNA molecules. Mol. Phylogenet.
Evol. 33:936-943.

Gillespie, J. J., C. H. McKenna, M. J. Yoder, R. R. Gutell, J. S. Johnston, J. Kathirithamby, and
A. I. Cognato. 2005. Assessing the odd secondary structural properties of nuclear small
subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta:
Strepsiptera). Insect. Mol. Biol. 14:625-643.

Glockner, G., R. Lehmann, A. Romualdi, S. Pradella, U. Schulte-Spechtel, M. Schilhabel, B.
Wilske, J. Suhnel, and M. Platzer. 2004. Comparative analysis of the Borrelia garinii
genome. Nucleic Acids Res. 32:6038-6046.

Goldberger, J., and J.F. Anderson. 1912. The transmission of typhus fever, with special reference
to transmission by the head louse (Pediculus capitis). Public Health Rep. Wash.
XXVII:297-307.

Grenfell, B. T., O. G. Pybus, J. R. Gog, J. L. N. Wood, J. M. Daly, J. A. Mumford, and E. C.
Holmes. 2004. Unifying the epidemiological and evolutionary dynamics of pathogens.
Science 303:327-332.

Gross, L. 1996. How Charles Nicolle of the Pasteur Institute discovered that epidemic typhus is
transmitted by lice: reminiscences from my years at the Pasteur Institute in Paris. Proc.
Natl. Acad. Sci. USA 93:10539-10540.

Hey, J. 2005. On the number of New World founders: A population genetic portrait of the
peopling of the Americas. PLoS Biol. 3:965-975.

Hey, J., and R. Nielsen. 2004. Multilocus methods for estimating population sizes, migration
rates and divergence time, with applications to the divergence of Drosophila
pseudoobscura and D. persimilis. Genetics 167:747-760.

Houhamdi, L., P. E. Fournier, R. Fang, H. Lepidi, and D. Raoult. 2002. An experimental model
of human body louse infection with Rickettsia prowazekii. J. Infect. Dis. 186:1639-1646.

Houhamdi, L., and D. Raoult. 2005. Excretion of living Borrelia recurrentis in feces of infected
human body lice. J. Infect. Dis. 191:1898-1906.

Johnson, K. P., K. Yoshizawa, and V. S. Smith. 2004. Multiple origins of parasitism in lice. P.
Roy. Soc. Lond B. Bio. 271:1771-1776.









Johnston, J. S., K. S. Yoon, J. P. Strycharz, B. R. Pittendrigh, and J. M. Clark. 2007. Body lice
and head lice (Anoplura: Pediculidae) have the smallest genomes of any hemimetabolous
insect reported to date. J. Med. Entomol. 44:1009-1012.

Kittler, R., M. Kayser, and M. Stoneking. 2003. Molecular evolution of Pediculus humanus and
the origin of clothing. Curr. Biol. 13:1414-1417.

Kittler, R., M. Kaysar, and M. Stoneking. 2004. Molecular evolution of Pediculus
humanus and the origin of clothing. Curr. Biol. 14: 2309 (vol 13, pg 1414, 2003).

Koehler, J. E., M. A. Sanchez, C. S. Garrido, M. J. Whitfeld, F. M. Chen, T. G. Berger, M. C.
Rodriguez-Barradas, P. E. LeBoit, and J. W. Tappero. 1997. Molecular epidemiology of
Bartonella infections in patients with bacillary angiomatosis-peliosis. New Engl. J. Med.
337:1876-1883.

Kumar, S., and S. B. Hedges. 1998. A molecular timescale for vertebrate evolution. Nature
392:917-920.

Leo, N. P., and S. C. Barker. 2005. Unravelling the evolution of the head lice and body lice of
humans. Parasitol. Res. 98:44-47.

Leo, N. P., N. J. H. Campbell, X. Yang, K. Mumcuoglu, and S. C. Barker. 2002. Evidence from
mitochondrial DNA that head lice and body lice of humans (Phthiraptera: Pediculidae) are
conspecific. J. Med. Entomol. 39:662-666.

Levene, H., and T. Dobzhansky. 1959. Possible genetic difference between the head louse and
the body louse (Pediculus humanus L.). Am. Nat. 93: 347-353.

Light, J. E., M. A. Toups, and D. L. Reed. 2008. What's in a name? The taxonomic status
of human head and clothing lice. Mol. Phyl. Evol. 47: 1203-1216.

Maddison, W. P., and D. R. Maddison. 2005. MacClade: Analysis of phylogeny and character
evolution, version 4.08. Sinauer Associates, Sunderland, MA.

Maunder, J. W. 1982. Pediculosis capitis in a zoological context. R. Soc. Health J. 102:255-
257.

Meusnier, I., J. L. Olsen, W. T. Stam, C. Destombe, and M. Valero. 2001. Phylogenetic
analyses of Caulerpa taxifolia (Chlorophyta) and of its associated bacterial microflora
provide clues to the origin of the Mediterranean introduction. Mol. Ecol. 10:931-946.

Mumcuoglu, K. Y., R. Galun, and R. Ikan. 1986. The aggregation response of human body
louse, Pediculus humanus (Insecta: Anoplura) to its excretory products. Insect Sci. Appl.
7:629-632.

Nieberding, C., and I. Olivieri. 2006. Parasites: proxies for host genealogy and ecology? Trends
Ecol. Evol. 22:156-165.









Nielsen, R., and J. Wakeley. 2001. Distinguishing migration from isolation: A Markov chain
Monte Carlo approach. Genetics 158:885-896.

Nuttall, G. H. F. 1917. The biology of Pediculus humanus. Parasitology 10:80-185.

Nuttall, G. H. F. 1919a. The biology of Pediculus humanus. Supplementary notes. Parasitology
11:201-220.

Nuttall, G. H. F. 1919b. The systematic position, synonymy and iconography of Pediculus
humanus and Phthiruspubis. Parasitology 11:329-346.

Nuttall, G. H. F. 1920. On Fahrenholz's purported new species, sub-species, and varieties of
Pediculus. Parasitology 12:136-153.

Pakendorf, B. and M. Stoneking. 2005. Mitochondrial DNA and Human Evolution. Annu. Rev.
Genom. Hum. G. 6:165-183.

Parola, P., P. E. Fournier, and D. Raoult. 2006. Bartonella quintana, lice, and molecular tools.
J. Med. Entomol. 43:787-787.

Perotti, M. A., J. M. Allen, D. L. Reed, and H. R. Braig. 2007. Host-symbiont interactions of
the primary endosymbiont of human head and body lice. FASEB J. 21:1058-1066.

Pittendrigh, B. R., J. M. Clark, J. S. Johnston, S. H. Lee, J. Romero-Severson, and G. A. Dasch.
2006. Sequencing of a new target genome: the Pediculus humanus humanus (Phthiraptera:
Pediculidae) genome project. J. Med. Entomol. 43:1103-1111.

Price, P.W. 1980. Evolutionary biology of parasites. Princeton University Press, Princeton, NJ.

Price, R. D., R. L. Palma, and D. H. Clayton. 2003. Review of the genus Saemundssonia
Timmermann (Phthiraptera: Philopteridae) from the Alcidae (Aves: Charadriiformes),
including a new species and new host records. P. Entomolog. Soc. Wash. 105:915-924.

Ranov, V. 1995. The 'Loessic Palaeolithic' in SouthTadjikistan, Central Asia: its industries,
chronology and correlation. Quaternary Sci. Rev. 14: 731-745.

Raoult, D., D. L. Reed, K. Dittmar, J. J. Kirchman, J. M. Rolain, S. Guillen, and J. E. Light.
2008. Molecular identification of lice from pre-Columbian mummies. J. Infect. Dis.
197:535-543.

Raoult, D., and V. Roux. 1999. The body louse as a vector of reemerging human diseases. Clin.
Infect. Dis. 29:888-911.

Raoult, D., T. Woodward, and J. S. Dumler. 2004. The history of epidemic typhus. Infect. Dis.
Clin. N. Am. 18:127-+.

Raymond, M. and F. Rousset. 1995. GENEPOP (version 1.2): population genetics
software for exact tests and ecumenicism. J. Hered. 86:248-249.









Reed, D. L., J. E. Light, J. M. Allen, and J. J. Kirchman. 2007. Pair of lice lost or parasites
regained: the evolutionary history of anthropoid primate lice. BMC Biol. 5:-.

Reed, D. L., V. S. Smith, S. L. Hammond, A. R. Rogers, and D. H. Clayton. 2004. Genetic
analysis of lice supports direct contact between modem and archaic humans. PLoS Biol.
2:1972-1983.

Rich, S. M., M. C. Light, R. R. Hudson, and F. J. Ayala. 1998. Malaria's eve: Evidence of a
recent population bottleneck throughout the world populations of Plasmodiumfalciparum.
Proc. Natl. Acad. Sci. USA 95:4425-4430.

Robinson, D., N. Leo, P. Prociv, and S. C. Barker. 2003. Potential role of head lice, Pediculus
humanus capitis, as vectors of Rickettsiaprowazekii. Parasitol. Res. 90:209-211.

Rogers, A. R., D. Iltis and S. Wooding. 2004. Genetic variation at the MC1R locus and the time
since loss of human body hair. Curr. Anthropol. 4: 105-108.

Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods. Mol. Biol. 132:365-386.

Sasaki, T., S. K. S. Poudel, H. Isawa, T. Hayashi, N. Seki, T. Tomita, K. Sawabe, and M.
Kobayashi. 2006. First molecular evidence of Bartonella quintana in Pediculus humanus
capitis (Phthiraptera: Pediculidae) collected from Nepalese children. J. Med. Entomol.
43:788-788.

Sasaki-Fukatsu, K., R. Koga, N. Nikoh, K. Yoshizawa, S. Kasai, M. Mihara, M. Kobayashi, T.
Tomita, and T. Fukatsu. 2006. Symbiotic bacteria associated with stomach discs of
human lice. Appl. Environ. Microbiol. 72:7349-7352.

Schaefer, C.W., 1978. Ecological separation of the human head lice and body lice (Anoplura:
Pediculidae). T. R. Soc. Trop. Med. H. 72:669-670.

Southern, P. M. Jr., and J. P. Sanford. 1969. Relapsing fever. A clinical and
microbiological review. Medicine 48:129-149.

Takano-Lee, M., J. D. Edman, B. A. Mullens, and J. M. Clark. 2005. Transmission potential of
the human head louse, Pediculus capitis (Anoplura: Pediculidae). Int. J. Dermatol. 44:811-
816.

Toth, N., and K. Schick. 1993. Early stone industries and inferences regarding language and
cognition. Pp. 346-362 in K. R. Gibson and T. Ingold eds. Tools, Language and Cognition
in Human Evolution. Cambridge University Press, Cambridge.

Whiteman, N. K., and P. G. Parker. 2005. Using parasites to infer host population history: a
new rationale for parasite conservation. Anim. Conserv. 8:175-181.

Whitfield, J. B. 1998. Phylogeny and evolution ofhost-parasitoid interactions in hymenoptera.
Annu. Rev. Entomol. 43:129-151.









Wigglesworth, V.B. 1941. The sensory physiology of the human louse Pediculus humanus
corpori De Geer (Anoplura). Parasitology 33:67-109.

Wirth, T., A. Meyer, and M. Achtman. 2005. Deciphering host migrations and origins by means
of their microbes. Mol. Ecol. 14:3289-3306.

Wolbach S., J. Todd, and F. Palfrey. 1922. The etiology and pathology of typhus. Harvard Univ.
Press, Cambridge, MA.

Yong, Z., P. E. Fournier, E. Rydkina, and D. Raoult. 2003. The geographical segregation of
human lice preceded that of Pediculus humanus capitis and Pediculus humanus humanus.
C. R. Biol. 326:565-574.

Zinsser, H. 1935. Rats, lice, and history. Broadway House, London.









BIOGRAPHICAL SKETCH

Melissa Toups was born and raised in New Orleans, Louisiana. After graduating from

Archbishop Chapelle High School in 2000, she attended Tulane University and majored in

ecology and evolutionary biology. While at Tulane, she participated in the Junior Year Abroad

program and attended the University of Bristol. She graduated Tulane in the Spring 2004 magna

cum laude. She began her graduate career in August 2005 in the Zoology Department at the

University of Florida and received her M.S. in August 2008.





PAGE 1

1 USING POPULATION GENETICS OF HUMAN HEAD AND CLOTHING LICE TO ELUCIDATE HUMAN EVOLUTION By MELISSA ANNE TOUPS A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Melissa Toups

PAGE 3

3 To my family.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor, Dr. David Reed, and my committee members Dr. Pamela Soltis and Dr. Mike Miyamoto. I woul d also like to thank the Zoology department faculty for all their support, pa rticularly Dr. Marta Wayne, Dr. Ch arlie Baer, and Dr. Colette St. Mary. I would like to acknowledge my coauthor s Dr. Andrew Kitchen and Dr. Jessica Light, as well as my labmates Angelo Soto and Julie Allen. Finally, I would like to thank my friends Ondi Crino and Matt Salomon.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........6 LIST OF FIGURES.........................................................................................................................7 ABSTRACT.....................................................................................................................................8 CHAP TER 1 THE NATURAL HISTORY OF THE HUMAN HEAD AND CLOTHING LOUSE, Pediculus humanus .................................................................................................................10 Introduction................................................................................................................... ..........10 Ecology of P. humanus ...........................................................................................................11 Taxonomic Debate............................................................................................................... ...12 Medical Importance of P. humanus ........................................................................................14 Louse Transmission.........................................................................................................15 Clothing Lice as Vectors of Bacterial Pathogens ............................................................16 Rickettsia prowazekii ................................................................................................16 Borrelia recurrentis ..................................................................................................18 Bartonella quintana ..................................................................................................19 Sequencing of the Cl othing Louse Genom e........................................................................... 20 Lice as Markers of Human Evolutionary History................................................................... 22 2 POPULATION GENETIC ANALYSIS OF Pediculus humanus PROVIDES INSIGHT INTO THE ORIGIN OF HUMAN CLOTHING ...................................................................25 Introduction................................................................................................................... ..........25 Materials and Methods...........................................................................................................28 Molecular Data................................................................................................................ 28 EvolutionaryRate Calculation.........................................................................................28 Isolation with Migration Analysis................................................................................... 29 Results.....................................................................................................................................29 Discussion...............................................................................................................................30 3 CHARACTERIZATION OF ELEVEN POLYM ORPHIC MICROSATELLITE LOCI FROM THE HUMAN HEAD A ND CLOTHING LOUSE, Pediculus humanus ..................37 REFERENCES..............................................................................................................................41 BIOGRAPHICAL SKETCH.........................................................................................................49

PAGE 6

6 LIST OF TABLES Table page 2-1 Estimates of evolutionary rate () in substitutions/locus/year for each locu s................... 36 3-1 Characteristics of eleven microsatellite loci for the hum an head and clothing louse, P. humanus .........................................................................................................................40

PAGE 7

7 LIST OF FIGURES Figure page 2-1 Marginal posterior probability distributi ons for model IM param eters in demographic units.......................................................................................................................... ..........35

PAGE 8

8 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Master of Science USING POPULATION GENETICS OF HUMAN HEAD AND CLOTHING LICE TO ELUCIDATE HUMAN EVOLUTION By Melissa Toups August 2008 Chair: David Reed Major: Zoology Parasites are often used as proxies for i nvestigating their host evolution. This is particularly common in the study of human evolu tion. In this study, I use the genetics of human head and clothing lice to addr ess the origin of clothing use in humans and develop new microsatellite loci to further the study of louse population genetics. Parasitic head and clothing use may be used to address the origin of clothing use because the divergence between these taxa is indicative of a minimum age of clothing use. When humans lost their body hair 1.2 million years ago, lice that once roamed the entire body were isolated on the head, and recolonized the body with the advent of clothing use. Coalescent analyses of multilocus data indicate that head and clothing lice diverged between 650,000 and 700,000 years ago, indicating that clothing was an innovation of archaic hominids, not modern humans as previously thought. This is consiste nt with several other lines of evidence for an archaic origin of clothing, such as the presence of archaic hominids in hi gh latitudes during this time period and the appearance of tools used to scrape hide 300,000 years ago. Furthermore, our analyses indicate that only a small proportion of head lic e initially colonized clothing.

PAGE 9

9 Finally, I developed eleven polym orphic microsatellite loci for head and clothing lice. All loci were tested on eighteen head louse individua ls, and the number of alleles ranged from three to seven. These loci will be valuable for further study of louse population genetics.

PAGE 10

10 CHAPTER 1 THE NATURAL HISTORY OF THE HUMAN HEAD AND CLOTHING LOUSE, Pediculus humanus Introduction At least half of the organisms that exist today are parasitic (Pri ce 1980). The parasitic lifestyle has been hypothesized to be a key innovation leading to the diversification of insects within several different orders (Farrell 1998; Johnson et al. 2004; Whitfield 1998). The insect order Phthiraptera consists of parasitic lice, which are permanent, obligate ectoparasites of vertebrates. Phylogenetic analysis of Phthiraptera demonstrates that this order is polyphyletic and indicates that there are two origins of parasitic lice (Johnson et al. 2004). One origin of parasitism unites all members of one suborder of chewing lice, Amblycera, and the second origin of parasitism unites two suborders of chewing lice, Ischnocera and Rhynchophthirina, with the suborder of sucking lice, Anoplura. Anoplurans spend their entire life cycle on their mammalian hosts and cannot survive without their host for more than 24 to 36 hours. Fe rtilized eggs of sucki ng lice are referred to as nits, which subsequently devel op through three nymph stages (1st, 2nd, and 3rd instar) before achieving adulthood. Sucking lice are hematophagous and contain endosymbiotic bacteria in specialized mycetome cells (Allen et al. 2007; Perotti et al. 2007; Sasaki-Fukatsu et al. 2006) that supplement the louses diet with essential vita mins (Buchner 1965). Removal of endosymbionts from a louse or from louse eggs results in louse and larval mortality (Aschner 1932). Parasitism of vertebrates requires a variety of adaptations to meet the challenges of remaining attached to the host, feeding on the host, and escaping the host defenses (Clayton and Johnson 2003). For example, lice have a single tars al claw on each leg that clings to host hair. Anoplurans also have specialized mouthparts to suck blood from their mammalian hosts. Such morphological, behavioral, and physiological spec ializations often rest rict each species of

PAGE 11

11 parasitic louse to a single host species (Price et al. 2003). This often results in cospeciation between louse and host, such as the twenty-fiv e million year coevolution between primates and their sucking lice (Reed et al. 2007; Reed et al. 2004). Members of two louse families parasitize humans. The family Phthiridae includes the human pubic louse, Pthirus pubis, and its sister taxon, the gorilla louse, Pthirus gorillae P. pubis likely switched from a gorilla-like host to an archaic hominid approximately 3 million years ago (Reed et al. 2007). The fa mily Pediculidae includes the species Pediculus humanus, which exists as two morphotypes, the human head louse and human clothing louse, Pediculus humanus capitis and P. humanus humanus respectively. Pediculus humanus is thought to have diverged from chimpanzee lice, Pediculus schaeffi, at the chimp-human divergence 5-7 million years ago. Ecology of P. humanus Human head and clothing lice are found on every continent. Head lice are common worldwide, infesting millions of school children ever y year. This resistance is due, in part, to the evolution of resistance to insec ticidal shampoos that are used to treat pediculosis (Burgess 1995). Clothing lice are less prevalent, but are potentially more harmful because they are known vectors of at least three bacter ial pathogens in humans: Rickettsia prowazekii (epidemic or louseborne typhus; but see Robins on et al. 2003), Borrelia recurrentis (louse-borne relapsing fever) and Bartonella quintana (trench fever; Buxton 1946; but see Sa saki et al. 2006). The incidence of clothing lice is determined by weather, humid ity, poverty, and a lack of hygienic conditions (Raoult and Roux 1999). Clothing lice, and conse quently their bacterial pathogens, are most common in areas with cold weather, where people wear multiple layers of clothes, and in areas stricken by poverty or political and social unrest that prevent inhabitants from having multiple sets of clothes (Raoult and Roux 1999). They are also becoming increasingly common among

PAGE 12

12 the homeless populations in developed countries in the United States and Western Europe (Brouqui et al. 1996; Drancour t et al. 1995; Koehler et al. 1997; Raoult and Roux 1999). As their names imply, head and clothing lice ar e spatially segregated on their human hosts. Head lice are found on the head and a ttach their eggs to the base of hair shafts, most often behind the ears, whereas clothing lice are found on the body and in clothi ng and prefer to attach their eggs to the pleats and seams of clothing, particularly the undergarments, rather than body hair (Burgess 1995; Buxton 1946; Maun der 1982; Nuttall 1917). In the absence of clothing, clothing lice will infest beads and necklaces (Buxton 1946; Busvine 1978). Clothing lice are believed to have evolved from head lice, invading the body region only recently with the advent of clothing use in modern humans (Burgess 1995; Kittler et al. 2003; Kittler et al. 2004). Head lice require more frequent blood meals than do clothing lice (Alpatov and Nastjukova 1955). Head and clothing lice tend to return to their preferred ecological habitat when displaced, and clothing lice are known to be especially attract ed to areas that are occupied by other clothing lice or clothing louse feces (Wigglesworth 1941; Mumcuoglu et al. 1986). Morphologically, clothing lice (and their eggs) are generally larger th an head lice, most notably in the length of the tibia on the second pair of legs (Schll, 1955; Busvin e 1978; Reed et al. 2004). However, these morphological differences are small, and were apparent to Reed et al. (2004) only when assessed with discriminant function analysis. Taxonomic Debate The species status of human Pediculus has been a topic for debate for over a century. Ferris (1951) and Burgess (1995) provide detailed accounts of this taxonomic confusion. Nuttall (1917, 1919a, 1919b, 1920) and Ferris (1935) strongl y argued that head and clothing lice represented, at most, subspecies, and that th e morphological, behavi oral, and ecological differences between these two louse groups repres ented natural intraspeci fic variation. Buxton

PAGE 13

13 (1946) presented an argument that head and clothing lice are probabl y too similar to be considered distinct species, but may represent species in the making. Fahrenholz (1915, 1916), Busvine (1944, 1978), and Schaefer (1978), on the other hand, argued that the differences observed between head and clothing lice were more than sufficient to recognize these taxa as distinct species. This taxonomi c confusion regarding th e species status of head and clothing lice continues today, primarily because of the ecological differences. In recent years, the specific status of h ead and clothing lice has al so been addressed in studies examining louse isozymes (Amevigbe et al. 2000), louse primary endosymbionts (Allen et al. 2007; Perotti et al. 2007; Sasaki-Fukatsu et al. 2006), and l ouse bacterial pathogens (Sasaki et al. 2006; but see Parola et al 2006). While the results of the endosymbiont and bacteria work indicate that head and clothing lice are conspecifi c, the results of the is ozyme work indicate that genetic differentiation may exist be tween these louse forms. Ther e also has been a series of DNA-based studies that ha ve directly addressed the specific status of head and clothing lice (Kittler et al. 2003; Leo and Bark er 2005; Leo et al. 2002; Reed et al. 2004; Yong et al. 2003). The majority of these molecular-based studies have concluded that head a nd clothing lice are not distinct species becaus e of the lack of reciprocal monophyl y between head and clothing lice. Reed et al. (2004) found three deeply divergen t mitochondrial clades of lice, all of which contained head lice, whereas only one of which c ontained clothing lice. Furthermore, all three clades had unique geographic distributions: 1) one clade was composed of a worldwide distribution of both head and clot hing lice, 2) one clade consisted only of head lice from North America, Central America, Australia, and Europe and 3) a second clade th at contained only head lice from Africa and Nepal (furth er sampling is necessary to de termine the geographic range of lice belonging to this third mitochondrial lineage) These mitochondrial results, the presence of

PAGE 14

14 three deeply divergent clades and the finding that clothing lice arose from only a subset of head lice, were novel compared to previous studies based on both mitochondrial and nuclear data (Kittler et al. 2003; Leo et al. 2002; Yong et al. 2003) and resulted in several follow-up studies examining these results (Leo and Barker 2005; Light et al. 2008). Light et al. (2008) assessed the taxonomic status of head and cl othing lice using both phylogenetic and population genetic methods and the most diverse geographic and molecular sampling available. The analyses resulted in re ticulated networks, gene flow, and a lack of reciprocal monophyly, all of which indicate th at head and clothing lice do not represent genetically distinct evol utionary units. Based on these findings, as well as inconsistencies of morphological, behavioral, and ecological variability between head and clothing lice, Light et al. (2008) state that no known species concept would recognize head and clothing lice as separate species. Medical Importance of P. humanus Parasitism by lice is a recognized medical condi tion known as pediculosis. Most patients are infested by only a few indi viduals (Raoult and Roux 1999), how ever, some patients can be infested with up to hundreds or thousands of lice (Raoult and Roux 1999). When the louse punctures the hosts skin to feed, it injects the host with an anticoagul ant and an anesthetic (Burgess 1995). After three to f our weeks of infection, the host begins to have an allergic reaction, which leads to pruritis. In a clothing louse infestation, ar eas of the host th at are heavily parasitized may darken, which is referred to as vagabonds disease (Burgess 1995). Heavy infestation of lice can also cause dull headache, drowsiness, joint pain, rash, and a mild fever (Buxton 1946).

PAGE 15

15 Louse Transmission The transmission of head and clothing lice has been studied exte nsively (Burkhart and Burkhart 2007; Canyon et al. 2002 ; Takano-Lee et al. 2005). T hough lice can disperse at any stage, adults are most likely to transfer from one head to an other (Takano-Lee et al. 2005). Canyon et al. (2002) explored the sp atial and kinetic factors of di rect head-to-head contact in transmitting head lice. A variety of factors were explored, including the angle of the hairs, the directionality of hair movement in relation to the louse, and the speed at which the hair moved relative to the louse. Of the 240 lice that Canyon et al. (2002) te sted, zero transferred to hairs that were placed in a 90 angle to their body. However, when lice were presented with a hair parallel to their bodies, a sm all proportion transferred to the new hair. The exact proportion of lice that transferred was determined by the dir ection the hair was movi ng in and the speed at which the hair was moving. Canyon et al. (2002) demonstrated that lice prefer hair that is moving laterally (as opposed to dorsal-ventral or reverse) fr om slow-moving (~4m/min) tail towards the head (as opposed to h ead to tail). Canyon et al. (2002) also observed that all lice that successfully transferred hairs first grasped it with their tarsal claw on their first leg. The precise kinetics required for lice to tran sfer from one hair to another i ndicates that transferring of lice between hosts through brief head-to-head contact is likely rare (Canyon et al. 2002). The authors also suggest that because such pr ecise kinetics is necessary, the ro le of fomites (objects that may indirectly move louse from one individual to another, such as towels, brushes, etc.) in transmission may be overest imated (Canyon et al. 2002). Takano-Lee et al. (2005) investigated the ro le of fomites in louse transmission. They demonstrated that air movements, combing, or toweling easily dislodge s lice, and lice also passively transfer to fabric. Both Takano-Lee et al. (2005) and Burkha rt and Burkhart (2007)

PAGE 16

16 argue that these findings are ev idence for fomite transmission. However, how dislodged lice reattach to their host is not addressed by these studies. Give n the findings of Canyon et al. (2002), it seems that such specific requirements for louse transmission are unlikely to be met during the 24-36 hour period that a louse can survive off the host. Clothing Lice as Vectors of Bacterial Pathogens The clothing louse vectors three deadly bact erial pathogens. It is generally assumed that head lice cannot vector diseases (Burgess 2004), though head lice can vector these pathogens in a laboratory setting (Goldberge r and Anderson 1912). Both R. prowazekii which causes epidemic typhus, and B. quintana which causes trench fever, are members of the subgroup of Proteobacteria, and B. recurrentis which causes relapsing fever, is a spirochete (Raoult and Roux 1999). Rickettsia prowazekii Zinsser (1935) argued that epid emic typhus is likely responsible for more deaths of soldiers than all wars in history. During the twentieth century alone, typhus outbreaks were associated with both world wars, and more recently, outbreaks of typhus have occurred in Burundi, Peru, and Russia in the 1990s (Raoult and Roux 1999). Ch arles Nicolle demonstrated that the clothing louse was the typhus vector in 1909 and was awarde d the Nobel Prize in 1 928 for this pioneering work (Gross 1996). There are two competing hypotheses for the orig in of epidemic typhus. Some researchers contend that typhus has an Old World origin (Z insser 1935) and became established in Spain in the fifteenth century. Zinsser (1935) speculated th at a number of historical epidemics, including the Athens plague, were possibly caused by t yphus. However, given the generality of the recorded symptoms of these events, it impossible to definitively know if R. prowazekii was the responsible agent (Raoult et al 2004). Others argue that ty phus has a New World origin,

PAGE 17

17 because the only known nonhuman reservoir, the flying squirrel ( Glaucomys volans volans ), is native to Mexico (Bozeman et al. 1975). Histori cally, this has been challenged by the lack of evidence that clothing lice successfully accompan ied the Amerindians in the migration to the New World. However, a recent ancient DNA st udy by Raoult et al. (2008) demonstrated that head lice belonging to a pre-Columbian Peruvian mummy belonged to the same clade of lice that contains clothing lice, suggesti ng that clothing lice likely colo nized the New World along with the Amerindians. This finding weakens the argume nt that clothing lice did not exist in the preColumbian New World. However, the first de finitive evidence of typhus occurred in the fifteenth century in Spain and sixteenth cen tury in Mexico (Raoult et al. 2004). Rickettsia prowazekii is a pathogen to the louse as we ll as its human host. Clothing lice contract typhus through feedi ng on an infected person, though transmission rate is not 100% (Wolbach et al. 1922). Once ingested, R. prowazekii infects the midgut ep ithelial cells of the louse and multiplies (Raoult and Roux 1999). These cells become enlarged and burst, which releases the bacteria into the gut lumen (Raoult and Roux 1999). R. prowazekii is then excreted from the louse in large quantities in the f eces (Raoult and Roux 1999). Since the ruptured epithelial cells of the gut are not replaced, infection with R. prowazekii eventually kills the louse (Raoult and Roux 1999). After the cells rupture, the ingested blood will flow freely through the intestine and occasionally cause the louse to tu rn red (Bozeman et al. 1975). Interestingly, R. prowazekii cannot be transmitted vertically from mo ther to egg (Buxton 1940; Houhamdi et al. 2002). The salivary glands of the louse do not contain R. prowazekii (Arkwright and Bacot 1923), and therefore R. prowazekii is not transmitted to the human host through the louse bite. R. prowazekii is transmitted to the human host when infective feces are rubbed into open sores

PAGE 18

18 (often caused by louse bites) in the hosts skin or into conjunctivae or mucus membranes (Raoult and Roux 1999). Infective bacteria can persist in the louse excrement for over 100 days (Raoult and Roux 1999). Once a person is infected with R. prowazekii the bacterium spread s throughout the hosts body through the bloodstream and damages the endothelial cells, compromising the hosts vascular system and causing hemorrhages (Raou lt and Roux 1999). During this time, the patient will likely experience fever and headaches, and may also experience a variety of other symptoms, including cough, nausea, a rash on the trunk of the body, and myalgias (Raoult and Roux 1999). Many patients develop some abnorma lities of the central nervous system (Raoult and Roux 1999). Without antibiot ic treatment, 10-30% of all R. prowazekii infections are fatal (Raoult and Roux 1999). However, a single dose of 200mg of doxycycline often cures the patient of epidemic typhus (Raoult and Roux 1999). Borrelia recurrentis B. recurrentis the agent of louse-borne relapsi ng fever, is closely related to B. duttonii, the agent of East African tick-borne relapsing feve r (Cutler et al. 1997; Raoul t and Roux 1999). It is suspected th at the ancestor of B. recurrentis diverged from its tick-borne relatives after it became associated with clothing lice (Raoult and Roux 1999). Unlike R. prowazekii B. recurrentis does not cause illness in its louse host. However, similar to R. prowazekii, B. recurrentis is not transmitted to the human host through the louse bite (Raoult and Roux 1999). Un til recently, it was thought that B. recurrentis was only to transmitted to its human host through louse crushing. However, a recent experiment by Houhamdi and Raoult (2005) showed evidence of B. recurrentis in louse feces, suggesting an additional route of infection. Like R. prowazekii, B. recurrentis may infect its human host through infective louse feces rubbed into open sores of the host or into conjunctivae or mucus

PAGE 19

19 membranes (Houhamdi and Raoult 2005). Humans are the only host of B. recurrentis. Infection of B. recurrentis is characterized by an initial stage of fever, chills, and headaches, which is often the most severe, followed by a period of recovery, and a less seve re relapse approximately a week later. This cycle continues and is caused by the cyclic antigen ic response of the bacteria. Gene rearrangements within the bacterium allow new serotypes to be serially expressed. After severa l relapses, the genetic variation within the bacterium is often exhauste d, and the immune system is able to prevent further relapses (Raoult and Roux 1999). In th e absence of antibiotic treatment, 10-40% of relapsing fever cases are fatal. However, treatm ent with antibiotics redu ces fatality to 2-4% (Southern and Sanford 1969). Bartonella quintana Members of the genus Bartonella are specialized to infect mammalian hosts and are transmitted through a variety of arthropod vect ors (Raoult and Roux 1999). Infection with B. quintana is known as trench fever because th e first records of infection with B. quintana occurred in both Allied and German forces during WWI (Raoult and Ro ux 1999). Currently, the only identified reservoir host is humans, and the only known vector for B. quintana is the clothing louse (Raoult and Roux 1999). Bartonella quintana does not cause illness in the louse host. A louse becomes infected with B. quintana through feeding on an infected host (Raoult and Roux 1999). B. quintana then multiples within the louse intes tine and is transmitted to the human host through infective louse feces rubbed into broken skin or conjunctivae or mucus membranes (Raoult and Roux 1999). Once infected, a person experiences severe fever, headache, shin pain, and dizziness (Foucault et al. 2006). Infection with B. quintana also occurs in cycles, with the first cycle being the most severe. A small proportion of inf ected patients are asymptomatic, though some

PAGE 20

20 experience bacteremia (Foucault et al. 2006). Infection with B. quintana is the least fatal of the known louse borne diseases, with a mortality ra te of <1% (Raoult and Roux 1999). Little is known about the effectiveness of antibiotic treatment of trench fever, since most data from infections occurred prior to the use of antibiotics (Ra oult and Roux 1999). However, a combination of doxycyline and gentamicin has b een shown to be effective (Raoult and Roux 1999). Sequencing of the Clothing Louse Genome The sequencing and ann otation of the clothing louse genome was recently completed, although its final publication has not occurred. The completed genome will provide important genetic information for the biomedical community. The bacterial genomes for pathogens carried by clothing lice, R. prowezii (Anderson et al. 1998), B. quintana (Alsmark et al. 2004), and two species of Borrelia (Fraser et al. 1997; Gloc kner et al. 2004) have alr eady been sequenced. The sequenced genome of P. humanus will provide insights into host -vector-pathogen interactions (Pittendrigh et al. 2006). The di scovery of genes that are involve d in vitellogenin production or olfactory receptors involved in locating potential hosts may provi de targets for louse-specific pesticides (Pittendrigh et al. 2006). The development of oligonuc leotide arrays and RNAi may aid in gene discovery. Further, oligonucleotide arrays may aid in determining which genes are induced or repressed during change s in louse behavior and envir onment, such as between head lice and clothing lice (Pittendrigh et al. 2006). Finally, sequencing of the P. humanus genome has the potential to determine if head lice are ab le to serve as vectors for bacterial pathogens (Pittendrigh et al. 2006). In addition to the importance of the P. humanus genome to the biomedical community, the genome will also provide insights to the evolutionary biology community. P. humanus will be the first genome sequenced of a hemimetabolous insect. Already, the small size (105MB) of

PAGE 21

21 the P. humanus genome relative to other in sect genomes, such as Drosophila (175MB) and Anopheles gambiae (260MB), is raising important evoluti onary questions, particularly because most other hemimetabolous insects are generally estimated to have large genomes (2000MB16,300MB) (Pittendrigh et al. 2006). In order to explain such a small genome size, several questions related to genome composition are ra ised, such as the number and size of noncoding regions and the number and types of repetitive elem ents (Pittendrigh et al. 2006). Further, is the reduction in genome size a result of human parasitism, and if so, is it a result of selection for metabolic or replication efficien cy or ecological specialization for the human host (Pittendrigh et al. 2006)? In addition to inte resting biological questions ra ised by the small genome size, evolutionary biologist s can also use the P. humanus genome to search for genes that help resolve relationships within Phthir aptera. Further, genes involved in pa rasitism of vertebrate hosts will be identified (Pitte ndrigh et al. 2006). The P. humanus genome project has achieved 8x covera ge. Preliminary analyses indicate that the genome is AT rich, with a GC cont ent of only 27.5%. However, 56% of genes of P. humanus occur in GC rich regions, indi cating a slight bias for genes to occur in GC rich areas. Currently, 11,214 genes have b een identified, and 90% of those (10,187) share sequence similarity to genes in other insects. Of the 11,214 genes, 969 8 contain introns, of which the average length is 303 base pairs and the average exon length is 238 base pairs. Only 1% of the P. humanus genome consists of transposable elements, and both class I and class II elements are present. When compared with ot her insect genomes, such as Apis mellifera, Drosphila melanogaster, Anopheles gambiae and Tribolium castaneum, P. humanus shows a reduction in gene families associated with detoxification, such as the p450, GST, and esterase gene superfamilies. The reduction in detoxification mech anisms is consistent with the life-history of

PAGE 22

22 P. humanus Because P. humanus is so closely ecologically tied to its human host, it is not exposed to secondary compounds produced by plants. Similarly, the P. humanus genome also has a reduction of gene families involved in sensory functions, such as opsin and chemoreceptor genes. In addition to the clothing louse genome the primary endosymbiont and mitochondrial genomes of P. humanus have also been sequenced. The reduced size of the primary endosymbiont, Candidatus Riesia pediculicola, is consistent with th e genome reduction that occurs when a bacterium is sequestered as an endosymbiont. Phylogenetic analysis of the Candidatus Riesia pediculicola sequence indicates that it is placed among the basal gammaproteobacteria. The mitochondrial genome of P. humanus displays a unique organization. Unlike the other >1000 bilaterian animals with sequenced mitochondrial genomes, the P. humanus genome does not consist of a single circ ular 16kb chromosome. Rather, it consists of 18 minicircular chromosomes, each of which has a length of 3kb and 1-3 genes. Analysis of the mitochondria of the pubic louse ( Pthirus pubis ), chimp louse (Pediculus schaeffi ), and the langur louse ( Pedicinus ancoratus ) indicates that these also have mi nicircular mitochondrial genomes, and that the most recent common ancestor of these li ce that parasitize primates likely had a similar mitochondrial genome organization 22.5 million years ago. Lice as Markers of Human Evolutionary History Sucking lice complete their entire life cy cle on their mammalian host, which selects for high host specificity and leads to cospeciation be tween parasite and host. Primates and their parasitic sucking lice have been cospeciating fo r the last 22.5 million ye ars (Reed et al. 2004). Researchers have exploited this property to learn more about pr imate evolution (Reed et al. 2004, Reed et al. 2007). Reed et al (2004) analyzed molecular data from sucking lice of anthropoid

PAGE 23

23 primates and confirmed the date of the human-chimp divergence to be 5-7 million years ago. Another study by Reed et al. ( 2007) dated the divergence between two sister taxa of lice, the gorilla louse, Pthirus gorillae and the human pubic louse, Pthirus pubis to be three million years. This date is significantly earlier than the human-chimp ancestor an d gorilla divergence of 7-8 million years ago (Reed et al. 2007), sugges ting a host switch from gorillas to humans. Sucking lice, particularly P. humanus has also provided insights into the population genetics of archaic and modern hum ans. Reed et al. (2004) confir med that head and clothing lice went through a population bottleneck and subse quent expansion out of Africa with modern humans. Reed et al. (2004) also determined that there are three mitochondrial lineages of P. humanus one that contains head and clothing lice and two that c ontain only head lice. Also, ancient DNA from P. humanus of a 1000 year-old Peruvian mu mmy indicates that the clade containing head and clothing lice was in the New World prior to European colonization (Raoult et al. 2008). This discover y supports the hypothesis that th e bacterial agent of typhus, Rickettsia prowazekii may be the result of a New World origin th at involves a host sw itch of the bacterium from its reservoir host, the flying squirrel, Glaucomys volans volans (Raoult et al. 2008). Population genetics of P. humanus has the potential to address several other questions relating to human evolutionary history. In order to address the origin of clothing use, Kittler et al. (2003, 2004) used unspecified phylogenetic me thods to date the age of the clade that contained both head and clothing lice to 107,000 years ago. Though the phylogenetic methods used by Kittler et al. (2003, 2004) may have been inappropriate for a population-level question, lice may provide insight into th e origin of the clothing use through coalescent methods to date the population divergence between head and clothing lice. Also, the taxonomic status of head and clothing lice may be addressed using molecula r techniques. Further, the deep divergences

PAGE 24

24 that occur among three lineages of P. humanus are potentially informative about the relationships between archaic hominids and modern humans (Reed et al. 2004). Currently, evolutionary biologists and anthr opologists studying lice re ly on three nuclear markers, EF1-alpha, RPII, and 18S, four mitochondrial markers, COI, CytB, ND4, and control region, and five microsatellite loci (Leo a nd Barker 2005) to draw inferences about the population genetics of head and clothi ng lice. With th e release of the P. humanus genome, a variety of new molecular tools will soon be available, such as a variety of nuclear genes, SNPs, microsatellites, and oligonucleotide arrays. Th ese new tools will allow researchers to address biological and anthropological questions whose answers have been elusive thus far.

PAGE 25

25 CHAPTER 2 POPULATION GENETIC ANALYSIS OF Pediculus humanus PROVIDES INSIGHT INTO THE ORIGIN OF HUM AN CLOTHING Introduction Biologists studying organisms with reduced genetic variation have begun to regularly exploit host parasites and pathogens to track events in the evolutio nary history of the host. This is particularly true in the fi elds of conservation (Whiteman a nd Parker 2005), invasive species (Meusnier et al. 2001), and human evolution resear ch (reviewed in Wirth et al. 2005), where host genetic variation is greatly reduced. In such scen arios, the parasite may generate more genetic diversity than the host due to its generally shorter generation time, which increases its evolutionary rate. Additionally, parasites often have larger effective population sizes, and therefore maintain more genetic variation through bottleneck even ts. The faster evolutionary rate of the parasite and increased genetic variation may therefore cap ture evolutionary events that are not coded in host DNA, allowing biologists to study the evolutionary history of the host through analysis of parasite DNA. This has been used most often in studies of human history (reviewed in Wirth et al. 2005), where JC virus, herpes simplex virus 1, human papillomaviruses, and Helicobacter pylori have been used to tr ack human evolution. Microparasites (bacteria a nd viruses) often reproduce clonally, and are thus highly susceptible to selective sweeps at a few loci prod ucing patterns of genomi c diversity that do not reflect the history of the host (G renfell et al. 2004; Nieberding et al. 2006; Rich et al. 1998). Conversely, macroparasites (such as parasitic arthropods) often reproduce sexually and may therefore track host evolutionary history more accurately because selective sweeps affect only closely linked loci in their genomes (Grenfe ll et al. 2004). For this reason, the use of macroparasites, such as pinworms (Araujo et al 2008) and lice (Raoult et al. 2008; Reed et al. 2004), has become increasingly common in the study of human evolution.

PAGE 26

26 Sucking lice (Phthiraptera: Anoplura) have cospeciated with their primate hosts for at least the last 22.5 million years (Reed et al. 2004). These lice are permanent, obligate ectoparasites that require direct contact between their primate hosts for transmission (Burgess 2004; Canyon et al. 2002). Molecular examinatio n of these lice has confirmed events known from primate history, such as the human-chim p divergence 5-7 million years ago (Reed et al. 2004). Additionally, the study of human lice ( Pediculus humanus ) has confirmed events in human demographic history, such as the population expansion of anatomically modern humans 100,000 years ago (Reed et al. 2004). These findings indicate that human lice have great utility for the study of human population history. Two varieties of human lice, head and clothing lice (both P. humanus; see Light et al. 2008), may also provide insights into human evol ution not recorded in human genetic data, specifically the origin of clothing use. Determini ng the origin of clothing use has been primarily inferential in anthropological literature as most materials used for clothi ng (furs, skin, cloth) degrade rapidly and are thus unknown in the arch aeological record of the Late Pleistocene. Archaeological evidence for the use of tailored clothing, such as needles, first appears ~40,000 years ago (Delson et al. 2000). Earlier evidence for tools used to scrape hide appears ~300,000 years ago (Toth and Schick 1993); however, there is no definitive evidence that these tools were used to make even rudimentary clothing. The inabil ity of the archaeological record to answer this question suggests that an innovative approach is necessary. The biology of human head and clothing lice makes them potentially useful markers to infer the origin of clothing use in humans. Mol ecular data suggest that humans lost their body hair approximately 1.2 million years ago (Rogers et al. 2004). Prior to body hair loss, lice in the genus Pediculus likely occurred more uniformly across the body, but upon body hair loss

PAGE 27

27 became restricted to the head. As humans st arted wearing clothing, a portion of head lice colonized this new habitat and became the ancesto rs of clothing lice (Burgess 1995; Kittler et al. 2003; Kittler et al. 2004). These lice then became specialized for the clothing niche, and at present spend more time in clothing than on the body, only returning to the body to feed once or twice per day. Of the thr ee mitochondrial lineages of P. humanus (Leo et al. 2002; Raoult et al. 2008; Reed et al. 2004), tw o lineages contain only head lice a nd the third contains both head and clothing lice. Kittler et al. (2003, 2004) used phylogenetic methods to date the age of the lineage that contained both head and clothing lice and determined the origin of clothing use to be 107,000 years ago. Kittler et al.s date of 107,000 years ( 2003, 2004) suggests a recent origin of human clothing use. However, phylogenetic methods are inappropriate for answering this populationlevel question since several researchers have shown that head and clothing lice do not form reciprocally monophyletic clades (Leo et al. 2002; Reed et al. 2004; Yong et al. 2003). Furthermore, a recent study has demonstrated si gnificant gene flow between head and clothing lice (Light et al. 2008), suggesti ng that recent head and clothing lice evolution is best understood as a population genetic process. In this study, we exploit recent advances in coalescent methodology using multiple loci to analyze louse genetic data and address the orig in of clothing use in humans. We first use a relaxed clock method (Drummond et al. 2006) to estimate mutation rates for our multilocus dataset. We then employ an isolation-with-mig ration coalescent method that jointly estimates divergence times, population sizes and migration rates from our multilocus dataset (Hey 2005; Nielsen and Wakeley 2001) to date the divergen ce of, and migration rates between, human head and clothing louse populations.

PAGE 28

28 Materials and Methods Molecular Data All available DNA sequence data for the following genes were downloaded from GenBank (see Supplemental Table 1): mitochondria l gene COI (166 sequences) and the nuclear genes 18S rRNA (22 sequences), EF-1 (40 sequences; not including any of the sequences from (Yong et al. 2003), which were shown by Light et al. (2008) to be contaminants, and RPII (53 sequences). Sequences for the outgroup taxon Pediculus schaeffi (parasitic on chimpanzees) were downloaded from GenBank for each of the four genes (Supplemental Table 1). All COI, EF-1 and RPII sequences were aligned by hand using MacClade (Maddison and Maddison 2005) and manually edited to maintain prope r reading frames using Se-Al v2.01a11. All 18S rDNA sequences were aligned manually in refere nce to secondary structure (Gillespie et al. 2004; Gillespie et al. 20 05); alignment available at the jRNA web site) and ambiguously aligned sites were removed before analysis. EvolutionaryRate Calculation Phylogenies and evolutionary rates () for each of the four genes were co-estimated under a relaxed (uncorrelated lognormal distribution) molecular clock using BEAST v.1.4.6 (Drummond et al. 2006; Drumm ond and Rambaut 2007). Estimates of were calibrated under an assumption of host-louse cosp eciation, which has been demonstr ated by Reed et al. (2004) for Hominidae. Specifically, an exponential prior distribution with a lower bound of 5MYA and mean of 5.5MYA was placed on the divergence of P. humanus and P. schaeffi that reflects current estimates for the divergence of thei r human and chimpanzee hosts (Kumar and Hedges 1998), respectively. All analyses we re performed with a GTR + I + nucleotide substitution model and a Yule birth-death prior on the tree topology. All Markov chains were run for

PAGE 29

29 10,000,000 generations with samples taken ev ery 1,000 generations and the first 1,000,000 generations were discarded as burn-in. Isolation with Migration Analysis A Bayesian isolation-with-migration coales cent analysis (Hey a nd Nielsen 2004; Nielsen and Wakeley 2001) was performed on the multilocus louse dataset using the program IM (Hey 2005). The isolation-with-migration coalescent m odel assumes that an an cestral population of effective size NA diverges at some time t into two daughter populations of initial size s NA and (1s )NA, both of which then experience independent exponential growth and migration between populations (with rates m1 and m2). All IM analyses were perf ormed with a Hasegawa-KishinoYano (HKY) nucleotide substitution model for al l four loci, and the upper bound of the prior distribution for the time of divergence was se t to 5.5MYA, following best estimates for the human-chimpanzee divergence (see above). Estimates of from the evolutionary rate calculation above were used to convert population mutation parameter estimates (i.e. t ) from mutational units into absolute units. All other priors were conservatively estimated from preliminary runs with very broad uniform prior distributions to facilitate adequate Markov chain mixing. All Markov chains were run for 600 million generations and sampled every 600 generations. Ten replicate runs with unique seed values were performed to ensure Markov chain convergence. Results Independent runs of IM an alyses converged on sim ila r posterior distributions (summarized in Figure 1). Peaks in the distribut ion were taken as point estimates of population genetic parameters. At the time of completion, all estimates of effec tive sample size exceeded 400. Estimates of and t were converted to effective populat ion size and absolute time-since-

PAGE 30

30 divergence, respectively, using estimates of obtained with BEAST v.1.4.6 (Drummond et al. 2006; Drummond and Rambaut 2007). The distributions of current effective popul ation sizes of head and clothing lice were contained within the priors. Point estimates were 2.5 million individuals for head lice and 1.8 million individuals for clothing lice. Estimates of the splitting parameter s indicate that only a small proportion of the ancestral population (< 1%) initially colonize d clothing, whereas the majority (>99%) remained head lice, which is th ought to be the ancestral condition. Estimates of bidirectional migration ( m ) showed very high migration from head lice to clothing lice ( m = 1.16), but virtually no migrati on in the opposite direction ( m = 0.0040). The posterior distribution for the time of population divergence peaks between 650,000700,000 years ago in all IM replicates. The eff ective population size for the common ancestor of head and clothing louse peaked at the lowest bin and decreased thereafter. There are two potential explanations for this. First, the e ffective population size of the common ancestor was smaller than our analysis could detect. Altern atively, because head and clothing lice diverged long ago and have likely been through the same population bottlenecks as their human host, there may be too little information in the data to effectively estimate this parameter. Discussion Pediculus humanus diverged from its sister taxon, the chimpanzee louse P. schaeffi at the human-chimp divergence roughly 5.5 million years ago (Reed et al. 2007; Reed et al. 2004). It is likely that lice in the genus Pediculus parasitized all subsequent hominid lineages given their history of cospeciation. Because P. schaeffi is found throughout the body of their chimpanzee hosts it is likely that the human parasite species of Pediculus also utilized much of the human body prior to the general loss of body hair in humans. At the time humans lost their body hair,

PAGE 31

31 Pediculus likely became restricted to head hair, a nd only invaded the body niche recently with the advent of clothing use (Busvine 1978; Burges s 1995; Kittler et al. 2003; Kittler et al. 2004). This is inferred primarily from the current natura l history of clothing lice At present, clothing lice spend the majority of their time in clothing, and only return to the bod y to feed. Clothing lice prefer to attach their eggs to the pleats and seams of clothing, particularly the undergarments, rather than body hair (Burgess 1995; Buxton 1946; Nuttall 1917). In th e absence of clothing, clothing lice will infest beads and necklaces (Busvine 1978; Buxton 1946). When displaced, clothing lice tend to return to th e clothing and are partic ularly attracted to areas that are occupied by other clothing lice or clothing louse feces (Mumcuoglu et al. 1986; Wigglesworth, 1941). Our results support the assert ion that the head was likel y the ancestral habitat for P. humanus The splitting parameter s indicates that a large pro portion of the ancestral louse population (>99%) was of the head lice type at th e time of divergence, and that only a small proportion (<1%) moved to the clothing niche as a founder population. Furthermore, our results indicate a lack of mi gration from clothing louse to head louse populations, suggesting that clothing lice are ecologically distinct and possibl y unable to survive under head louse conditions. This finding is consistent with empirical transpla ntation experiments. When head lice are reared as clothing lice in the laboratory (in pill boxes worn upon the skin), morphological and behavioral changes take place such that the head lice gain the morphological and natural history characteristics of clothing lice within a few generations (Alpatov and Nastjukova 1955; Bacot, 1917; Levene and Dobzhansky 1959; see Busvine, 1948 for a single known exception). Further, when clothing lice are displaced, they return to clothing, particularly areas occupied by other clothing lice and clothing louse feces (Mumcuoglu et al. 1986; Wigglesworth 1941). However,

PAGE 32

32 there is no evidence to suggest th at clothing lice can su ccessfully colonize th e head louse niche, which provides further support for unidirectional gene flow. Coalescent methods that use multiple loci for population genetic inference reduce uncertainty in estimates of divergence time rela ted to genealogical stoc hasticity (Edwards and Beerli 2000). This allows us to estimate the divergence of head and clothing lice, as opposed to dating the origin of the clade of head and clothi ng lice using phylogenetic methods (Kittler et al. 2003; Kittler et al. 2004). By using population gene tic methods to date the divergence, we are able to obtain a more precise estimate of when populations of P. humanus began to colonize the clothing niche. Furthermore, our analyses uncovered a high rate of migration ( m = 1.16) from head to clothing lice, further indicating that th e divergence between head and clothing lice is a population genetic process. Our point estimate of 650,000 years ago (90% HPD 225kya-6mya) indicates that head and clothing lice diverged signi ficantly earlier than pr eviously thought and suggests that the use of rudimentary clothing originated with archai c hominids, not anatomically modern humans, which arose only within the last 120,000 years (Pakendorf and Stoneking 2005). Also, it is important to note that the diverg ence of human head and clothing lice provides a minimum date for the origin of clothing use; it is possible that the clothing ni che existed for some time before parasitic lice successfully colonized clothing. There are both adaptive and neutral explanations for why a nd how clothing use arose. Clothing may have arisen in Africa because it co nferred an advantage to archaic hominids living in high altitudes. A lternatively, clothing use may have ar isen for decorative purposes. Though our study cannot disentangle these alternatives, it can provide some insight as to where clothing use arose.

PAGE 33

33 The mitochondrial clade of P. humanus that contains both head and clothing lice has the genetic signature of a populati on expansion that occurred 100, 000 years ago (Reed et al. 2004) suggesting that these lice accompanied modern humans out of Africa. Because the date of divergence of head and clothing lice only provides a minimum estim ate for the origin of clothing use, the technology to make clothing may have ex isted for some time prior to 650,000 years ago. Anthropologists recognize multiple dispersa ls of hominid species out of Africa (Anton and Swisher 2004; Dennell 2003; Finlayson 2005), with the fi rst dispersal of H. erectus occurring approximately 2 million years ago (Anton and Swisher 2004; Dennell 2003; Finlayson 2005). Most of the evidence suggests that H. erectus populations outside of Africa were largely confined to Southeast Asia, though there is some evidence of H. erectus in northern Asia around this time (Anton and Swisher 2004; Dennell 2003; Finlayson 2005). The permanence of these earliest dispersals into northern latitudes has been questioned (D ennell 2003). Interestingly, our estimate approximately coincides with the fi rst evidence of permanent archaic hominid settlements into high latitude regions of Europe and Central Asia between 800,000 and 500,000 years ago (Ascenzi et al. 1996; Carbonell et al. 1995; Dennell 2003; Ranov 1995). It is possible that the archaic hominids that dispersed and su ccessfully colonized co lder climates 800,000 to 500,000 years ago may have possessed the knowledge to use furs and skins as rudimentary clothing, which would have allowed them to survive and persist in the temperate climates of Europe and Central Asia. Altern atively, it is conceivable that clothing use originated with archaic hominids in Europe and Central Asia, and spread to archaic hominid populations in Africa via intermittent contact. However, this is less likely, considering that archaic hominid populations in Central Asia and Europe were li kely spatially and temporally discontinuous

PAGE 34

34 during this time period (Dennell 2003), making transfer of technol ogy between populations difficult. The natural history of clothi ng lice suggests that they are ecologically distinct from head lice, and therefore it is assume d that clothing lice only arose w ith the advent of clothing use (Burgess 1995; Busvine 1978; Kittler et al. 2003; K ittler et al. 2004). Our analyses indicate that only a small proportion of lice initi ally colonized clothing, but that migration from head to clothing has been considerable (m = 1.16) since. Further, our an alyses suggest that clothing use originated with archaic hominids in Afri ca 650,000 years ago, not modern humans, and may have played a role in the archaic hominid colonization of Central Asia and Europe.

PAGE 35

35 0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 0.008 0.009 0.01 02468 Population Size (millions) Head Clothing 0 0.005 0.01 0.015 0.02 0.025 0.03 0.035 02468 Migration head to clothing clothing to head 0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 0123456 Time (million years) Figure 2-1: Marginal posterior pr obability distributions for model IM parameters in demographic units. (A) Effective population size. (B) Migration rates ( m ). (C) Time since divergence. A B C

PAGE 36

36 Table 2-1: Estimates of evolutionary rate () in substitutions/locus/year for each locus. Locus EF1-alpha 0.00000285 COI 0.0000163 18S 0.0000118 RPII 0.000041

PAGE 37

37 CHAPTER 3 CHARACTERIZATION OF ELEVEN POLY M ORPHIC MICROSATELLITE LOCI FROM THE HUMAN HEAD AND CLOTHING LOUSE, Pediculus humanus Human head and clothing lice, Pediculus humanus capitis and Pediculus humanus humanus, respectively, have parasitized humans for t housands of years (Araujo et al. 2000). Currently, head lice are pandemic, infesting millions of schoolchildren worldwide. Clothing lice, though less prevalent, are common am ong areas stricken by poverty or political and social unrest that prevent inhabitants from having multiple se ts of clothes (Raoult and Roux 1999). Clothing lice (also called body lice) are also becomi ng increasingly common among the homeless populations in developed countries such as the Un ited States and Western Europe (Brouqui et al. 1996; Drancourt et al. 1995; Koehler et al. 1997). Clothing lice are more harmful parasites because they can vector three bacterial pathogens: Rickettsia prowazekii (epidemic or louseborne typhus; but see (Robinson et al. 2003), Borrelia recurrentis (louse-borne relapsing fever) and Bartonella quintana (trench fever; Buxton 1946; but see Sasaki et al. 2006). In addition to their importance in the biom edical field, human head and clothing lice are of interest to evolutionary biol ogists and anthropologists. Head and clothing lice are part of a group of anoplurans that have cospeciated with primates for 22.5 million years (Reed et al. 2004), and therefore have been used to provide in sights into human evolut ionary history (Kittler et al. 2003; Kittler et al. 2004, Ra oult et al. 2008; Reed et al. 2007; Reed et al. 2004). For example, head and clothing lice have been used to estimate the origin of clothing use in humans (Kittler et al. 2003; Kittler et al. 2004). The use of popula tion level markers, such as microsatellites, may provide insights into the ep idemiology and evolutionary history of one of the oldest human parasites. Microsatellite loci were mined from the Human Body L ouse Genome Project (Johnston et al. 2007) using Tandem Repeat Finder (Benson 1999). Of the initial microsat ellite search, loci

PAGE 38

38 were selected that contained a minimum of ei ght repeats and at leas t 200 base pair flanking regions on each side that was free of other repetitive elements. These loci were further screened when designing primer pairs using PRIMER3 (Rozen and Skaletsky 2000) for formation of hairpins, self-dimers, hetero-dimers, and optimal primer GC content of 40-60%. Primer pairs were designed for a total of 48 loci, of whic h 11 have been assessed for polymorphism using 18 head louse individuals, each from a separate hos t individual, from West Palm Beach, Florida. DNA amplifications were carried out in 25 L reactions containing 11.5 L of distilled water, 10 L of 5Prime HotMaster Mix (Eppendorf), 1 L of 1 M M13 labeled forward primer, 1 L of 10 M reverse primer, and 1 L of 10 M FAM label, and 0.5 L of DNA template. Thermocycling conditions for all loci were identical and are as follows: 94 for 3 min, followed by 10 cycles of 94 for 30 s, 52 for 30 s, 65 for 45 s, then 30 cycles of 94 for 30 s, 48 for 30 s, 65 for 45 s, and a final extension of 65 for 10 min. Fragment leng ths of PCR products were detected using ABI 3730 Automated Sequencer and scored using GENE MAPPER 3.0 software (Applied Biosystems). Data for loci analyzed are available in Ta ble 1. The number of alleles ranged from 3-7 per locus. Observed and expected hetero zygosities were calcul ated using MICROSATELLITE ANALYSER 4.05 (Dieringer and Schlotterer 2003) and ranged from 0.056-0.278 and 0.3030.820, respectively. Linkage disequilibrium with a Bonferroni correction was tested using GENEPOP version 3.4 (Raymond and Rousset 1995) and no linkage disequilibrium was identified. Deviations from Ha rdy-Weinberg equilibrium were tested using GENEPOP version 3.4 (Raymond and Rousset 1995). Only two lo ci, M2_19 and M3_9 are in Hardy-Weinberg equilibrium, and M2_19 is only marginally so (p=0.050). Because 9 of 11 loci are polymorphic

PAGE 39

39 and exhibit heterozygote deficien cy,it is likely the population tested that is out of HardyWeinberg equilibrium, and not the loci. Our results indicate that these microsatelli tes are clearly polymor phic in this population, though not in Hardy-Weinberg equilibrium. Seve ral possible explanati ons exist for why the population may be out of Hardy-We inberg equilibrium, such as hi gh population substructure or nonrandom mating. Additional populations should be screened to determine if this is specific to the population of head lice in West Palm Beach, Florid a, or if it is character istic of the species in general. Alternatively, further sampling of the population in West Palm may reveal a high level of population substructure. The polymorphic microsatellites identified in this study may be useful in examining differences between head and clothing lice, in examining fine-scale host migrations, and characterizing local populations worldwide.

PAGE 40

40 Table 3-1. Characteristics of elev en microsatellite loci for the human head and clothing louse, P. humanus including locus name, primer sequence, repeat motif, allele size range, number of alleles (Na), observed heterozygosity (HO), expected heterozygosity (HE), and probability associated with Hardy-Weinberg equilibrium. Locus Primer Sequence Repeat Motif Allele Size (bp) Na HO HE P M2_2 F: TCTTGCAGTGTGTCTCTTTGC GA 392-412 4 0.05 6 0.678 0.000 R: CTATCGGAAATGTG CAGAGC M2_3 F: TGATATTTTAGGCGCACAACC GA 364-370 4 0.059 0.497 0.000 R: GTCTCAATTCGGCCACTTCT M2_4 F: TTCAGGATCTTCTGCCCAAC GA 308-316 4 0.056 0.662 0.000 R: GGGTTCGCAAAAAGGTGAC M2_16 F: TAACGACCGCTTTTCGAGTT GA 242-266 6 0.11 1 0.697 0.000 R: GGGGTGAACTGGATGTTTCA M2_17 F: GCCTAGCGAAAGCTCTGAAA TA 235-253 6 0.188 0.714 0.000 R: GAAGTATCATTTCGGCGTGA M2_19 F: GGTGGCAAAAACCACTAATGA TA 182-198 4 0.278 0.486 0.050 R: TCCGTTAAAAATGGCAAAGG M3_3 F: TGTTCCTGCTGGTAAACTTGC TAA 238-295 7 0.176 0.820 0.000 R: GAACGATCAATCTGCTTCTGC M3_9 F: CCCGTAAAATATCCACGCTGT TTA 284-302 3 0.278 0.332 0.507 R: CTGGTCGGCTATGTTTTGCT M3_11 F: CTCCTAACGGGAGCAAAGAA TTA 299-357 6 0.167 0.749 0.000 R: CCATACATATTAGTCGCCTTCCA M3_18 F: CGTCGGAGGAATGTATAGGG GAC 275-299 4 0.111 0.303 0.011 R: GACAGTGACGGATCGAACG M3_19 F: TTAAGAGCTGATGCCACGTC CAT 346-358 4 0.118 0.405 0.000 R: TCTGGAAAAGGACGAAAGGA

PAGE 41

41 REFERENCES Allen, J. M., D. L. Reed, M. A. Perotti, and H. R. Braig. 2007. Evolu tionary relationships of Candidatus Riesia spp., endosymbiotic Enterobacter iaceae living within hematophagous primate lice. Appl. E nviron. Microb. 73:1659-1664. Alpatov, W. W., and O. K. Nastjukova, 1955. Transformation of the head form of Pediculus humanus L. into the body form under the influence of changed living conditions. Bull. Soc. Nat. Moscow 60:79. Andersson, S. G., A. Zomo rodipour, J. O. Andersson, T. Sicher itz-Ponten, U. C. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133140. Anton, S.C. and C. C. Swisher III. 2004. Early dispersals of Homo from Africa. Annu. Rev. Anthropol. 33:271-296. Alsmark, C. M., A. C. Frank, E. O. Karlberg, B. A. Legault, D. H. Ardell, B. Canback, A. S. Eriksson, A. K. Naslund, S. A. Handley, M. Huve t, B. La Scola, M. Holmberg, and S. G. E. Andersson. 2004. The louse-borne human pathogen Bartonella quintana is a genomic derivative of the zoonotic agent Bartonella henselae. Proc. Natl. Acad. Sci. USA 101:9716-9721. Amevigbe, M. D. D., A. Ferrer, S. Champorie, N. Monteny, J. Deunff, and D. Richard-Lenoble. 2000. Isoenzymes of human lice: Pediculus humanus and P. capitis. Med. Vet. Entomol. 14:419-425. Araujo, A., L. F. Ferreira, N. Guidon, N. Maues Da Serra Freire, K. J. Reinhard, and K. Dittmar. 2000. Ten thousand years of head lice infection. Parasitol. Today 16:269. Araujo, A., K. J. Reinhard, L. F. Ferreira, and S. L. Gardner. 2008. Pa rasites as probes for prehistoric human migrations? Trends Parasitol. 24:112-115. Arkwright J. and A. Bacot. 1923. Investigation of the aetiology of typhus fever, especially undertaken for the Egyptian government in the Public Health Laborat ories, Cairo. Br. J. Exp. Pathol. 4:70. Ascenzi, A., I. Biddittu, P.F. Cassoli, A.G. Segre, and E. Segre-Naldini. 1996. A calvarium of late Homo erectus from Ceprano, Italy. J. Hum. Evol. 31:409. Aschner, M. 1932. Experimental investigatio ns on the symbiosis of the body louse. Naturwissenschaften 20:501-505. Aschner, M. 1934. Studies on the symbiosis of th e body louse. I. Elimination of the Symbionts by centrifugalisation of the eggs. Parasitology 26:309.

PAGE 42

42 Bacot, A.W. 1917. A contribu tion to the bionomics of Pediculus humanus (vestimenti) and Pediculus capitis Parasitology 9:228. Benson, G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27:573-80. Bozeman F.M., S. A. Masiello, M. S. Willia ms, and B. L. Elisberg. 1975. Epidemic typhus rickettsiae isolated from fl ying squirrels. Nature 255:545. Brouqui, P., P. Houpikian, H. T. Dupont, P. Toubi ana, Y. Obadia, V. Lafay, and D. Raoult. 1996. Survey of the seroprevalence of Bartonella quintana in homeless people. Clin. Infect. Dis. 23:756-759. Buchner, P. 1965. Endosymbiosis of animals w ith plant microorganisms. Interscience, New York, NY. Burgess, I. E. 2004. Human lice and th eir control. Annu. Rev. Entomol. 49:457-481. Burgess, I. F. 1995. Human lice and their management. Adv. Parasitol. 36:271-342. Burkhart, C. N., and C. G. Burkhart. 2007. Fo mite transmission in head lice. J. Am. Acad. Dermatol. 56:1044-1047. Busvine, J. R., 1944. Simple experiments on the be haviour of body lice. Proc. R. Entomol. Soc. 19: 22. Busvine, J. R., 1948. The h ead and body races of Pediculus humanus L. Parasitology 39:1 16. Busvine, J. R. 1978. Evidence from double infestati ons for the specific status of human head and body lice (Anoplura). Syst. Entomol. 3:1. Buxton, P. A. 1940. The biology of the body louse ( Pediculus humanus corporis : Anoplura) under experimental conditions. Parasitology 32:303. Buxton, P. A. 1946. The louse. 1st ed. Williams & Wilkins Co., Baltimore, MD. Canyon, D. V., R. Speare, and R. Muller. 2002. Sp atial and kinetic factors for the transfer of head lice (Pediculus capitis ) between hairs. J. In vest. Dermatol. 119:629-631. Carbonell, E., J. M. Bermudez de Castro, J. L. Arsu aga, J. C. Diez, A. Rosas, G. Cuenca-Bescos, R. Sala, M. Mosquera, and X. P. Rodri guez. 1995. Lower Pleistocene hominids and artifacts from Atapuerca-TD 6 (Spain). Science 269:826-830. Clayton, D. H., and K. P. Johnson. 2003. Linking coevolutionary history to ecological process: Doves and lice. Evolution 57:2335-2341.

PAGE 43

43 Cutler, S. J., J. Moss, M. Fukunaga, D. J. Wright, D. Fekade, and D. Warrell. 1997. Borrelia recurrentis characterization and comparison with relapsing-fever, Lyme-associated, and other Borrelia spp. Int. J. Syst. Bacteriol. 47:958-968. Delson, E., Tattersall, I., Van Couvering, J., and Brooks, A. (2000). Encyclopedia of Human Evolution and Prehistor y. Garland, New York, NY. Dennell, R. 2003. Dispersal and colonisation, lo ng and short chronologies: how continuous is the Early Pleistocene record for hominids out side East Africa? J. Hum. Evol. 45:421-440. Dieringer, D. and C. Schlotterer. 2003. Micros atellite analyser (MSA): a platform independent analysis tool for large microsatellite data sets. Mol. Ecol. Notes 3:167-169. Drancourt, M., J. L. Mainardi, P. Brouqui, F. Vandenesch, a. Carta, F. Lehnert, J. Etienne, F. Goldstein, J. Acar, and D. Raoult. 1995. Bartonella (Rochalimaea) Quintana Endocarditis in 3 Homeless Men. New Engl. J. Med. 332:419-423. Drummond, A. J., S. Y. Ho, M. J. Phillips, and A. Rambaut. 2006. Relaxed phylogenetics and dating with confidence. PLoS Biol. 4:e88. Drummond, A. J., and A. Rambaut. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7:214. Edwards, S. V., and P. Beerli. 2000. Perspect ive: gene divergence, population divergence, and the variance in coalescence time in phyloge ographic studies. Evolution 54:1839-1854. Fahrenholz, H. 1915. Luse verschiedener Mens chenrassen. Z. Morphol. Anthropol. 17:591 602. Fahrenholz, H. 1916. Zur Nome nklatur einiger AnoplurenA rten. Zool. Anz. 47:269. Farrell, B. D. 1998. "Inordinate fondness" explai ned: Why are there so many beetles? Science 281:555-559. Ferris, G. F. 1951. The sucking lice. Mem. Pacif. Cst. Ent. Soc. 1:1. Ferris, G. F. 1935. Contribution towards a monograph of the sucking lice. Part VIII. Stanford Univ. Publs. Biol. Sci. 2:527. Finlayson, C. 2005. Biogeography and evolution of the genus Homo Trends Ecol. Evol. 20:457-463 Foucault, C., P. Brouqui, and D. Raoult. 2006. Bartonella quintana characteristics and clinical management. Emerg. Infect. Dis. 12:217-223.

PAGE 44

44 Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. vanVugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi Nature 390:580-586. Gillespie, J. J. 2004. Characterizing regions of ambiguous alignment caused by the expansion and contraction of hairpin-stem loops in ribosomal RNA molecule s. Mol. Phylogenet. Evol. 33:936-943. Gillespie, J. J., C. H. McKenna, M. J. Yoder, R. R. Gutell, J. S. Johnston, J. Kathirithamby, and A. I. Cognato. 2005. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing pa rasites (Insecta: Strepsiptera). Insect. Mol. Biol. 14:625-643. Glockner, G., R. Lehmann, A. Romualdi, S. Pradella, U. Schulte-Spechtel, M. Schilhabel, B. Wilske, J. Suhnel, and M. Platzer. 2004. Comparative analysis of the Borrelia garinii genome. Nucleic Acids Res. 32:6038-6046. Goldberger, J., and J.F. Anderson. 1912. The transmi ssion of typhus fever, with special reference to transmission by the head louse ( Pediculus capitis ). Public Health Rep. Wash. XXVII:297. Grenfell, B. T., O. G. Pybus, J. R. Gog, J. L. N. Wood, J. M. Daly, J. A. Mumford, and E. C. Holmes. 2004. Unifying the epidemiological and evolutionary dynamics of pathogens. Science 303:327-332. Gross, L. 1996. How Charles Nicolle of the Past eur Institute discovered that epidemic typhus is transmitted by lice: reminiscences from my years at the Pasteur Institute in Paris. Proc. Natl. Acad. Sci. USA 93:10539-10540. Hey, J. 2005. On the number of New World fo unders: A population gene tic portrait of the peopling of the Americas. PLoS Biol. 3:965-975. Hey, J., and R. Nielsen. 2004. Multilocus me thods for estimating population sizes, migration rates and divergence time, with app lications to the divergence of Drosophila pseudoobscura and D. persimilis Genetics 167:747-760. Houhamdi, L., P. E. Fournier, R. Fang, H. Lepi di, and D. Raoult. 2002. An experimental model of human body louse infection with Rickettsia prowazekii. J. Infect. Dis. 186:1639-1646. Houhamdi, L., and D. Raoult. 2005. Excretion of living Borrelia recurrentis in feces of infected human body lice. J. Infect. Dis. 191:1898-1906. Johnson, K. P., K. Yoshizawa, and V. S. Smith. 2004. Multiple origins of parasitism in lice. P. Roy. Soc. Lond B. Bio. 271:1771-1776.

PAGE 45

45 Johnston, J. S., K. S. Yoon, J. P. Strycharz, B. R. Pittendrigh, and J. M. Clark. 2007. Body lice and head lice (Anoplura: Pediculidae) have the smallest genomes of any hemimetabolous insect reported to date. J. Med. Entomol. 44:1009-1012. Kittler, R., M. Kayser, and M. Stoneking. 2003. Molecular evolution of Pediculus humanus and the origin of clothing. Curr. Biol. 13:1414-1417. Kittler, R., M. Kaysar, and M. Stoneking. 2004. Molecular evolution of Pediculus humanus and the origin of clothing. Curr. Biol. 14: 2309 (vol 13, pg 1414, 2003). Koehler, J. E., M. A. Sanchez, C. S. Garrido, M. J. Whitfeld, F. M. Chen, T. G. Berger, M. C. Rodriguez-Barradas, P. E. LeBoit, and J. W. Tappero. 1997. Molecular epidemiology of Bartonella infections in patients with bacillary angiomatosis-peliosis. New Engl. J. Med. 337:1876-1883. Kumar, S., and S. B. Hedges. 1998. A molecu lar timescale for vertebra te evolution. Nature 392:917-920. Leo, N. P., and S. C. Barker. 2005. Unravelling the evolution of the he ad lice and body lice of humans. Parasitol. Res. 98:44-47. Leo, N. P., N. J. H. Campbell, X. Yang, K. Mumcuoglu, and S. C. Barker. 2002. Evidence from mitochondrial DNA that head lice and body lice of humans (Phthiraptera: Pediculidae) are conspecific. J. Med. Entomol. 39:662-666. Levene, H., and T. Dobzhansky. 1959. Possible gene tic difference between the head louse and the body louse (Pediculus humanus L .). Am. Nat. 93: 347. Light, J. E., M. A. Toups, and D. L. Ree d. 2008. Whats in a name? The taxonomic status of human head and clothing lice. Mol. Phyl. Evol. 47: 1203-1216. Maddison, W. P., and D. R. Maddison. 2005. MacC lade: Analysis of phylogeny and character evolution, version 4.08. Sinauer Associates, Sunderland, MA. Maunder, J. W. 1982. Pediculosis capitis in a zoological context. R. Soc. Health J. 102:255257. Meusnier, I., J. L. Olsen, W. T. Stam, C. Destombe, and M. Valero. 2001. Phylogenetic analyses of Caulerpa taxifolia (Chlorophyta) and of its asso ciated bacterial microflora provide clues to the origin of the Med iterranean introduction. Mol. Ecol. 10:931-946. Mumcuoglu, K. Y., R. Galun, and R. Ika n. 1986. The aggregation response of human body louse, Pediculus humanus (Insecta: Anoplura) to its excr etory products. Insect Sci. Appl. 7:629. Nieberding, C., and I. Olivieri. 2006. Parasites: proxies for host genealogy and ecology? Trends Ecol. Evol. 22:156-165.

PAGE 46

46 Nielsen, R., and J. Wakeley. 2001. Distinguishi ng migration from isolation: A Markov chain Monte Carlo approac h. Genetics 158:885-896. Nuttall, G. H. F. 1917. The biology of Pediculus humanus Parasitology 10:80. Nuttall, G. H. F. 1919a. The biology of Pediculus humanus. Supplementary notes. Parasitology 11:201. Nuttall, G. H. F. 1919b. The systema tic position, synonymy and iconography of Pediculus humanus and Phthirus pubis. Parasitology 11:329. Nuttall, G. H. F. 1920. On Fahrenholzs purported new species, sub-species, and varieties of Pediculus Parasitology 12:136. Pakendorf, B. and M. Stoneking. 2005. Mitoch ondrial DNA and Human Evolution. Annu. Rev. Genom. Hum. G. 6:165-183. Parola, P., P. E. Fournier, and D. Raoult. 2006. Bartonella quintana lice, and molecular tools. J. Med. Entomol. 43:787-787. Perotti, M. A., J. M. Allen, D. L. Reed, and H. R. Braig. 2007. Host-symbiont interactions of the primary endosymbiont of human head and body lice. FASEB J. 21:1058-1066. Pittendrigh, B. R., J. M. Clark, J. S. Johnston, S. H. Lee, J. Romero-Severson, and G. A. Dasch. 2006. Sequencing of a new target genome: the Pediculus humanus humanus (Phthiraptera: Pediculidae) genome project. J. Med. Entomol. 43:1103-1111. Price, P.W. 1980. Evolutionary biology of parasite s. Princeton University Press, Princeton, NJ. Price, R. D., R. L. Palma, and D. H. Clayton. 2003. Review of the genus Saemundssonia Timmermann (Phthiraptera: Philopteridae) from the Alcidae (Aves: Charadriiformes), including a new species and new host reco rds. P. Entomolog. Soc. Wash. 105:915-924. Ranov, V. 1995. The Loessic Palaeolithic in Sout hTadjikistan, Central Asia: its industries, chronology and correlation. Quat ernary Sci. Rev. 14: 731. Raoult, D., D. L. Reed, K. Dittmar, J. J. Kirchm an, J. M. Rolain, S. Guillen, and J. E. Light. 2008. Molecular identification of lice from pre-Columbian mummies. J. Infect. Dis. 197:535-543. Raoult, D., and V. Roux. 1999. The body louse as a vector of reemerging human diseases. Clin. Infect. Dis. 29:888-911. Raoult, D., T. Woodward, and J. S. Dumler. 2004. The history of epidemic typhus. Infect. Dis. Clin. N. Am. 18:127-+. Raymond, M. and F. Rousset. 1995. GENE POP (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86:248-249.

PAGE 47

47 Reed, D. L., J. E. Light, J. M. Allen, and J. J. Kirchman. 2007. Pair of lice lost or parasites regained: the evolutionary history of anthropoid prim ate lice. BMC Biol. 5:-. Reed, D. L., V. S. Smith, S. L. Hammond, A. R. Rogers, and D. H. Clayton. 2004. Genetic analysis of lice supports direct contact between modern and archaic humans. PLoS Biol. 2:1972-1983. Rich, S. M., M. C. Light, R. R. Hudson, and F. J. Ayala. 1998. Malaria's eve: Evidence of a recent population bottleneck throughout the world populations of Plasmodium falciparum Proc. Natl. Acad. Sci. USA 95:4425-4430. Robinson, D., N. Leo, P. Prociv, and S. C. Ba rker. 2003. Potential role of head lice, Pediculus humanus capitis as vectors of Rickettsia prowazekii Parasitol. Res. 90:209-211. Rogers, A. R., D. Iltis and S. Wooding. 2004. Geneti c variation at the MC1R locus and the time since loss of human body hair. Curr. Anthropol. 4: 105-108. Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general user s and for biologist programmers. Methods. Mol. Biol. 132:365-386. Sasaki, T., S. K. S. Poudel, H. Isawa, T. Ha yashi, N. Seki, T. Tomita, K. Sawabe, and M. Kobayashi. 2006. First molecular evidence of Bartonella quintana in Pediculus humanus capitis (Phthiraptera: Pediculidae) collected from Nepalese children. J. Med. Entomol. 43:788-788. Sasaki-Fukatsu, K., R. Koga, N. Nikoh, K. Yoshizaw a, S. Kasai, M. Mihara, M. Kobayashi, T. Tomita, and T. Fukatsu. 2006. Symbiotic bact eria associated with stomach discs of human lice. Appl. Envi ron. Microbiol. 72:7349-7352. Schaefer, C.W., 1978. Ecological separation of th e human head lice and body lice (Anoplura: Pediculidae). T. R. Soc. Trop. Med. H. 72:669. Southern, P. M. Jr., and J. P. Sanfor d. 1969. Relapsing fever. A clinical and microbiological review. Medicine 48:129. Takano-Lee, M., J. D. Edman, B. A. Mullens, an d J. M. Clark. 2005. Transmission potential of the human head louse, Pediculus capitis (Anoplura: Pediculidae). Int. J. Dermatol. 44:811816. Toth, N., and K. Schick. 1993. Early stone indus tries and inferences regarding language and cognition. Pp. 346-362 in K. R. Gibson and T. Ingold eds. Tools, Language and Cognition in Human Evolution. Cambridge University Press, Cambridge. Whiteman, N. K., and P. G. Parker. 2005. Usi ng parasites to infer hos t population history: a new rationale for parasite conservation. Anim. Conserv. 8:175-181. Whitfield, J. B. 1998. Phylogeny and evolution of host-parasitoid interactions in hymenoptera. Annu. Rev. Entomol. 43:129-151.

PAGE 48

48 Wigglesworth, V.B. 1941. The sensory physiology of the human louse Pediculus humanus corpori De Geer (Anoplura) Parasitology 33:67. Wirth, T., A. Meyer, and M. Achtman. 2005. D eciphering host migrations and origins by means of their microbes. Mol. Ecol. 14:3289-3306. Wolbach S., J. Todd, and F. Palfrey. 1922. The e tiology and pathology of typhus. Harvard Univ. Press, Cambridge, MA. Yong, Z., P. E. Fournier, E. Rydkina, and D. Raoult. 2003. The geograp hical segregation of human lice preceded that of Pediculus humanus capitis and Pediculus humanus humanus C. R. Biol. 326:565-574. Zinsser, H. 1935. Rats, lice, and history. Broadway House, London.

PAGE 49

49 BIOGRAPHICAL SKETCH Melissa Toups was born and raised in New Or leans, Louisian a. After graduating from Archbishop Chapelle High School in 2000, she at tended Tulane University and majored in ecology and evolutionary biology. Wh ile at Tulane, she participated in the Junior Year Abroad program and attended the University of Bristol. She graduated Tulane in the Spring 2004 magna cum laude. She began her graduate career in August 2005 in the Zoology Department at the University of Florida and received her M.S. in August 2008.