<%BANNER%>

Cigarette Smoke Condensate-Induced Transcriptional Regulation of Bcl-Xl in Spontaneously Immortalized Human Breast Epith...

Permanent Link: http://ufdc.ufl.edu/UFE0022566/00001

Material Information

Title: Cigarette Smoke Condensate-Induced Transcriptional Regulation of Bcl-Xl in Spontaneously Immortalized Human Breast Epithelial Cells
Physical Description: 1 online resource (131 p.)
Language: english
Creator: Connors, Shahnjayla
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: bclxl, breast, cancer, cebpbeta, cigarette, condensate, smoke, transcription
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Breast cancer is the second leading cause of cancer deaths in women. It is unclear whether there is a link between cigarette smoking and increased breast cancer risk. Cigarette smoke contains over 4,000 compounds, over 80 of which have been identified as carcinogens. There is evidence to support the fact that smokers metabolize mammary carcinogens and human studies show that tobacco constituents can reach breast tissue where they produce their harmful effects. In previous studies, it has been demonstrated that cigarette smoke condensate (CSC), which has a similar chemical composition as cigarette smoke, is capable of transforming the spontaneously immortalized human breast epithelial cell line, MCF10A, possibly through the upregulation of the anti-apoptotic gene, bcl-xl. Upregulation of this gene impedes the apoptotic pathway and allows the accumulation of DNA damage that can lead to cell transformation and carcinogenesis. In the present study, the mechanism of CSC-mediated transcriptional upregulation of bcl-xl gene expression in MCF10A cells has been determined. The human bcl-xl promoter (pBcl-xLP) was cloned and putative transcription factor binding sites were identified. Deletion constructs that removed the putative cis-elements were transfected into MCF10A cells to determine which element or elements were responsive to CSC treatment. The promoter activity was significantly decreased in constructs lacking C/EBP-binding sites. Site-directed mutagenesis of C/EBP-binding sites on the pBcl-xLP attenuated the CSC-induced increase in promoter activity. Western blot, gel-shift, and super-shift analysis confirmed that C/EBPbeta bound to a C/EBP-binding site on the pBcl-xLP. Additionally, overexpression of C/EBPbeta isoforms, particularly, LAP2, stimulated pBcl-xLP activity and Bcl-xL protein levels in the absence of CSC treatment. Site-directed mutagenesis of the C/EBP sites on the pBcl-xLP also altered the promoter response to the C/EBP beta overexpression constructs. These results indicate that C/EBPbeta-LAP2 regulates bcl-xl gene expression in response to CSC treatment. Understanding the mechanism of transcriptional regulation of bcl-xl can be used to identify chemotherapeutic targets for the prevention and treatment of breast carcinogenesis, especially that induced by cigarette smoke carcinogens.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shahnjayla Connors.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Narayan, Satya.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022566:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022566/00001

Material Information

Title: Cigarette Smoke Condensate-Induced Transcriptional Regulation of Bcl-Xl in Spontaneously Immortalized Human Breast Epithelial Cells
Physical Description: 1 online resource (131 p.)
Language: english
Creator: Connors, Shahnjayla
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: bclxl, breast, cancer, cebpbeta, cigarette, condensate, smoke, transcription
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Breast cancer is the second leading cause of cancer deaths in women. It is unclear whether there is a link between cigarette smoking and increased breast cancer risk. Cigarette smoke contains over 4,000 compounds, over 80 of which have been identified as carcinogens. There is evidence to support the fact that smokers metabolize mammary carcinogens and human studies show that tobacco constituents can reach breast tissue where they produce their harmful effects. In previous studies, it has been demonstrated that cigarette smoke condensate (CSC), which has a similar chemical composition as cigarette smoke, is capable of transforming the spontaneously immortalized human breast epithelial cell line, MCF10A, possibly through the upregulation of the anti-apoptotic gene, bcl-xl. Upregulation of this gene impedes the apoptotic pathway and allows the accumulation of DNA damage that can lead to cell transformation and carcinogenesis. In the present study, the mechanism of CSC-mediated transcriptional upregulation of bcl-xl gene expression in MCF10A cells has been determined. The human bcl-xl promoter (pBcl-xLP) was cloned and putative transcription factor binding sites were identified. Deletion constructs that removed the putative cis-elements were transfected into MCF10A cells to determine which element or elements were responsive to CSC treatment. The promoter activity was significantly decreased in constructs lacking C/EBP-binding sites. Site-directed mutagenesis of C/EBP-binding sites on the pBcl-xLP attenuated the CSC-induced increase in promoter activity. Western blot, gel-shift, and super-shift analysis confirmed that C/EBPbeta bound to a C/EBP-binding site on the pBcl-xLP. Additionally, overexpression of C/EBPbeta isoforms, particularly, LAP2, stimulated pBcl-xLP activity and Bcl-xL protein levels in the absence of CSC treatment. Site-directed mutagenesis of the C/EBP sites on the pBcl-xLP also altered the promoter response to the C/EBP beta overexpression constructs. These results indicate that C/EBPbeta-LAP2 regulates bcl-xl gene expression in response to CSC treatment. Understanding the mechanism of transcriptional regulation of bcl-xl can be used to identify chemotherapeutic targets for the prevention and treatment of breast carcinogenesis, especially that induced by cigarette smoke carcinogens.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shahnjayla Connors.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Narayan, Satya.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022566:00001


This item has the following downloads:


Full Text





CIGARETTE SMOKE CONDENSATE-INDUCED TRANSCRIPTIONAL REGULATION OF
BCL-XL IN SPONTANEOUSLY IMMORTALIZED HUJMAN BREAST EPITHELIAL
CELLS




















By

SHAHNJAYLA KHRISHIDA CONNORS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008

































O 2008 Shahnj ayla Khrishida Connors




































To my parents, who never doubted that I could do it--for your continuous love and support, I
dedicated this dissertation to you.









ACKNOWLEDGMENTS

I thank God for blessing me and surrounding me with all those who have made it possible

for me to finish this dissertation. I thank my parents, extended family, church family, and friends

for their prayers, spiritual, and emotional support. I thank Dr. Satya Narayan, my supervisory

chair for the opportunity to complete my proj ect in his laboratory, the members of my

supervisory committee, and Dr. Aruna Jaiswal for all his technical assistance and support. I

thank those whose work was the foundation for my proj ect and those who provided special

reagents and supplies. Lastly, I thank all those who were involved in me successfully

completing this process including the Interdisciplinary Program in Biomedical Sciences (IDP),

the Office of Graduate Minority Programs (OGMP), Department of Anatomy and Cell Biology,

and all the faculty and staff, too numerous to name, who offered academic, administrative, and

clerical support.












TABLE OF CONTENTS


page

ACKNOWLEDGMENT S .............. ...............4.....


LI ST OF T ABLE S ............ .......__ ...............7..


LIST OF FIGURES .............. ...............8.....


AB S TRAC T ......_ ................. ............_........9


CHAPTER


1 INTRODUCTION ................. ...............11.......... ......


Breast Cancer ................. ...............11.................

Cigarette Smoke Carcinogens............... ..............1
Smoking and Breast Cancer Risk ................ ...............14........... ...
Epidemiological Studies ................. ...............15.................
Biological Studies................ ... .... .. ...............1
The Mechanism of CSC-induced Breast Carcinogenesis ........................... ........18
Chemical Transformation of Human Breast Epithelial Cells ................ ........... ...........20
Apoptosi s .............. ...............22....
Intrinsic Pathway .............. ...............22....
Extrinsic Pathway ................. ...............23.......... ......
Apoptosis and Cancer................ .. .. .... ...........2
The B cell leukemia-2 (Bcl-2) Protein Family .............. ...............24....
Bcl-x Gene and Promoter Structure ........................_. ...............25.....
Bcl-xL Protein ................ ... ........... ..........2
Bcl-xL functions as an anti-apoptotic protein ................. ................ ......... .29
Bcl-xL and breast cancer ................... ....... .... .. ...............33.....
The CCAAT/Enhancer Binding Protein (C/EBP) Family ................. .......... ...............38
C/E BP P protein................. ...............3
C/EBP P protein function ............_...... ._ ...............39...
C/EBPP protein isoforms .............. ...............40....
C/EBPP and Breast Cancer............... ...............43.

2 MATERIALS AND METHODS .............. ...............50....


Preparation of CSC ............... ... ...... ..__ ......... ...............5
Cloning of the Human Bcl-xl Promoter (pB cl-xLP) ................. ....._.._............... ....5
Cloning of pBcl-xLP Deletion Constructs ...._. ......_._._ .......__. ...........5
Promoter Activity Assays ........._..... ........._._ ......_. ............5
Electrophoretic Mobility Shift Assay (EMSA) .............. ...............56....
Chromatin Immunoprecipitation (ChIP) As say ....._ .....___ .........__ ............5












Site-directed M utagenesis............... ..............5
Overexpression of C/EBPP ............_ ..... ..__ ...............59...
Statistical Analysis............... ...............59

3 CSC TREATMENT RESULTS INT THE TRANSCRIPTIONAL UPREGULATION OF
BCL-XL INT MCF 10A CELLS ................. ...............60...............

Introducti on ................. ...............60.................
R e sults................ ........ ... ..... ................. .. ......... .. ...... ...... ........6
CSC Treatment Induces Bcl-xl mRNA and Protein Levels in MCF 10A Cells.............. .60
CSC Induces pBcl-xLP Promoter Activity in MCF 10A cells ................. ................ ...61
C/EBP-binding Sites on the pBcl-xLP are CSC-responsive Elements ...........................62


4 C/EBPP REGULATES BCL-XL INT CSC-TREATED MCF10A CELLS ................... .........71

Introducti on ............ ..... .._ ...............71...
R esults.......... .. ..........._ .. ............ ..__... ...... ...............7
C/EBPP is Induced by CSC Treatment in MCF 10A Cells ............... ........ ................71
C/EBPP Site-II of the pBcl-xLP is Specific for the CSC Response in MCF 10A
C ells ............... .. .. ...... ...... .... ....... .......7
C/EBPP Binds the Endogenous Bcl-xl Promoter in Response to CSC Treatment ..........73
Overexpression of C/EBPP Protein LAP2 Increases pBcl-xLP Promoter and Protein
Level s in MCF 10A Cell s .........._.... ...............73.._.__. ....


5 SUMMARY AND DISCUSSION .............. ...............80....


C/EBPP-induced Upregulation of Bcl-xL in CSC-treated MCF 10A Cells............._.._.. .........83
Induction of C/EBPP by CSC Treatment. .............. .. .. .___ ...............88..
The Potential Role of C/EBPP in CSC-induced Breast Carcinogenesis............... .............9
The Relationship between C/EBPP, Bcl-xL, and Breast Carcinogenesis............... .............9
Future and Directions .............. ...............94....

LIST OF REFERENCES ................. ...............98........... ....


BIOGRAPHICAL SKETCH ................. ...............130......... ......










LIST OF TABLES


Table


page


1-1 Carcinogens Present in Cigarette Smoke ................. ...............46...............










LIST OF FIGURES


FiMr page

1-1 Mechanism of cigarette smoke-induced cancer ....._._._ .... ... .... ......_._.........4

1-2 Human bcl-x gene structure and proteins............... ...............48

1-3 Human C/EBPP mRNA structure and protein isoforms. ................. .................4

3-1 Bcl-xl mRNA and protein levels are induced in MCF 10A cells treated with CSC......_....65

3-2 Sequence of the cloned human bcl-xl promoter, pBcl-xLP. ................ ......................66

3-3 CSC treatment induces pBcl-xLP promoter activity in vitro ................. ............. .......67

3-4 The pBcl-xLP promoter contains CSC-responsive cis-elements ................. ........._.......68

3-5 C/EBP mutations introduced on the pBcl-xLP. ............. ...............69.....

3-6 Site-directed mutagenesis of C/EBP sites on the pBcl-xLP attenuates CSC-induced
promoter activity.. ............. ...............70.....

4-1 C/EBPP protein levels are induced in MCF10A cells treated with CSC. .........._.............75

4-2 C/EBPP binds the bcl-xl promoter in vitro. ............. ...............76.....

4-3 C/EBPP is present on the bcl-xl promoter of MCF 10A cells in vivo................ .... ........._..77

4-4 Overexpression of C/EBPP induces pBcl-xLP promoter activity and Bcl-xL protein
levels in M CF 10A cells ................. ...............78..._._._....

4-5 Site-directed mutagenesis of C/EBP sites on the pBcl-xLP attenuates the C/EBPP-
induced activation of the pBcl-xLP promoter. ....._._._ .... ... .__ ......_. .........7

5-1 Model of CSC-Induced C/EBPP upregulation of Bcl-xL in MCF 10A cells. ................... .97









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CIGARETTE SMOKE CONDENSATE-INDUCED TRANSCRIPTIONAL REGULATION OF
BCL-XL IN SPONTANEOUSLY IMMORTALIZED HUMAN BREAST EPITHELIAL
CELLS

By

Shahnj ayla Khrishida Connors

August 2008

Chair: Satya Narayan
Major: Medical Sciences-Molecular Cell Biology

Breast cancer is the second leading cause of cancer deaths in women. It is unclear

whether there is a link between cigarette smoking and increased breast cancer risk. Cigarette

smoke contains over 4,000 compounds, over 80 of which have been identified as carcinogens.

There is evidence to support the fact that smokers metabolize mammary carcinogens and human

studies show that tobacco constituents can reach breast tissue where they produce their harmful

effects. In previous studies, it has been demonstrated that cigarette smoke condensate (CSC),

which has a similar chemical composition as cigarette smoke, is capable of transforming the

spontaneously immortalized human breast epithelial cell line, MCF 10A, possibly through the

upregulation of the anti-apoptotic gene, bcl-xl. Upregulation of this gene impedes the apoptotic

pathway and allows the accumulation of DNA damage that can lead to cell transformation and

carcinogenesis. In the present study, the mechanism of CSC-mediated transcriptional

upregulation of bcl-xl gene expression in MCF 10A cells has been determined. The human bcl-xl

promoter (pBcl-xLP) was cloned and putative transcription factor binding sites were identified.

Deletion constructs that removed the putative cis-elements were transfected into MCF 10A cells

to determine which element or elements were responsive to CSC treatment. The promoter









activity was significantly decreased in constructs lacking C/EBP-binding sites. Site-directed

mutagenesis of C/EBP-binding sites on the pBcl-xLP attenuated the CSC-induced increase in

promoter activity. Western blot, gel-shift, and super-shift analysis confirmed that C/EBPP bound

to a C/EBP-binding site on the pBcl-xLP. Additionally, overexpression of C/EBPP isoforms,

particularly, LAP2, stimulated pBcl-xLP activity and Bcl-xL protein levels in the absence of

CSC treatment. Site-directed mutagenesis of the C/EBP sites on the pBcl-xLP also altered the

promoter response to the C/EBPP overexpression constructs. These results indicate that

C/EBPP-LAP2 regulates bcl-xl gene expression in response to CSC treatment. Understanding

the mechanism of transcriptional regulation of bcl-xl can be used to identify chemotherapeutic

targets for the prevention and treatment of breast carcinogenesis, especially that induced by

cigarette smoke carcinogens.









CHAPTER 1
INTTRODUCTION

Breast Cancer

Breast cancer is the most common cancer and is second only to lung cancer as the

leading cause of cancer death in women. The American Cancer Society estimates that in 2008,

67,770 new cases of carcinoma in situ, the noninvasive, earliest form of breast cancer, will be

diagnosed. In addition, 182,460 new cases of invasive breast cancer will also be diagnosed in

the United States (American Cancer Society, 2008). Although breast cancer is 100-times more

common in females, 1,990 men will be diagnosed with the disease this year (American Cancer

Society, 2008). In 2008, 40,480 women and 450 men will succumb to this disease (American

Cancer Society, 2008). Breast cancer death rates have decreased since 1990. This decrease is

believed to be the result of early detection, increased awareness, and improved treatment. While

breast cancer survival rates have improved about 14% since the 1970, this progress has not

impacted all populations equally. When controlled for age and stage at diagnosis, mortality rates

vary among racial and ethnic groups (National Cancer Institute, 2007). While minorities have

generally have lower incidence rates, they have higher mortality and develop more aggressive

forms of breast cancer (American Cancer Society, 2008).

Ordered mammary epithelial architecture is critical to maintaining a differentiated state

and control of cell proliferation (Bissell et al., 2003). Disruptions of this ordered architecture can

lead to breast carcinogenesis. While the progression of colon cancer has been extensively

described in a linear model (Fearon and Vogelstein, 1990; Polyak et al., 1996; Vogelstein et al.,

1988), the progression of breast carcinogenesis is less understood. Breast cancer is considered a

heterogeneous disease that develops along a continuum; the multi-step process begins at ductal

or lobular atypical hyperplasia and progresses to invasive carcinoma and metastasis (Beckmann









et al., 1997; Russo and Russo, 2001). Accumulation of genetic errors in growth control and

DNA repair genes occur at each step (Beckmann et al., 1997). Two classes of genes are affected

during this progression: oncogenes and tumor suppressors. Oncogenes and tumor suppressor

genes regulate epidermal growth factor receptors and genes involved in cell cycle progression,

proliferation, and apoptosis. Oncogenes act to increase cell replication and decrease

differentiation. The activation of oncogenes, such as ra~s and c-myc, by mutation, amplification,

or rearrangements are associated with tumorigenesis. Alternatively, tumor suppressor genes

such as TP53 and retinoblastoma (Rb) are associated with cell cycle regulation, differentiation,

and apoptosis. By definition, these genes act to prevent tumorigenesis. The loss of tumor

suppressor function makes cells more susceptible to tumorigenesis and results from a mechanism

known as the Knudson's "two-hit" hypothesis. In this model, the loss of function results from

two occurrences: the first "hit" is a germline mutation in one copy of the gene and the second

"hit", a somatic mutation or deletion in the second copy of the gene, results in the loss of gene

function (Knudson, 1971).

Cigarette Smoke Carcinogens

Epidemiological evidence has shown that not only cigarette smoke, but also unburned

tobacco is carcinogenic to man (Hoffmann and Wynder, 1968). Cigarette smoke condensate

(CSC), because of its similar composition, is used as a surrogate for cigarette smoke in

experimental studies. Studies have been aimed at identifying and classifying the carcinogenic

constituents in CSC (Table 1-1). Animal bioassays and advances in analytical chemistry

techniques have brought the number of proven carcinogens in cigarette smoke to approximately

80 (Hecht, 2002; Hoffmann et al., 2001; Smith et al., 2003). The International Agency for

Research on Cancer (IARC) and the Registry of Toxic effect of Chemical Substances (RTEC)

have classified the components of cigarette smoke by potential carcinogenicity and bioactivity,










respectively. The IARC classifies mainstream cigarette smoke as a Group 1 (known human)

carcinogen (International Agency for Research on Cancer, 1985). Other categories include:

Group 2A, probably carcinogenic to humans, Group 2B, possibly carcinogenic to humans, and

Group 3, not classifiable as to their carcinogenicity to humans (International Agency for

Research on Cancer 1972-2000). Studies have reviewed the IARC carcinogen groups found in

cigarette smoke from Group 1 (Smith et al., 1997), Group 2A (Smith et al., 2000), and Group 2B

(Smith et al., 2000a; Smith et al., 2001). These compounds have also been ranked by potential

toxicity using IARC and RTECS data. The purpose of this study was to use concentration,

metabolism, bioactivity, and lipophilicity to develop "effective toxicities" as a means to compare

compounds and to identify the most toxic for further study (Smith and Hansch, 2000). Effective

toxicity was used to group the cigarette smoke components into six categories, I: rodent

carcinogens and reproductive effectors, II: rodent carcinogens, III: reproductive effectors, IV:

benign tumorigens, V: in vitro mutagens, and VI: compounds that have insufficient evidence of

biological activity (Smith and Hansch, 2000).

Polycyclic aromatic hydrocarbons (PAHs) were the first pure compounds shown

experimentally to be carcinogenic and are complete (Hoffmann and Wynder, 1971; Whitehead

and Rothwell, 1969; Wynder and Wright, 1957). PAHs are ubiquitous environmental pollutants

produced by the incomplete combustion of fossil fuels (Trombino et al., 2000) and during the

burning of tobacco (Hoffmann and Wynder, 1968; Wynder, 1967). Benzo[a]pyrene (B[a]P),

which was first isolated from coal tar in the 1930s, is one PAH found in cigarette smoke. B[a]P

is a mammary carcinogen (el-Bayoumy et al., 1995) and was classified in the most bioactive

category I by Smith and Hansch because it is a rodent carcinogen that causes reproductive effects

(2000). The PAH, 7, 12-dimethylbenzanthracene (DIVBA), is another well-known mammary









carcinogen present in cigarette smoke (Kumar et al., 1990). The strongest PAH carcinogen,

dibenzo[alpha,1]pyrene (DB[a,1]P), is a very active mammary carcinogen that has a greater

potency than DIVBA (Cavalieri et al., 1991). Other carcinogenic compounds in cigarette smoke

include N-nitrosamines such as tobacco-specific, 4-(methylnitrosamino)-1l-(3-pyridyl)-1-

butanone (NNK) and N-nitrosonornicotine (NNN). Both of these compounds are rodent

carcinogens and classified in category II (Smith and Hansch, 2000). Aromatic amine and metals

are also present in CSC (Hoffmann et al., 2001). Strong carcinogens such as PAHs,

nitrosamines, and aromatic amines occur in smaller amounts (1-200 ng per cigarette). Weaker

carcinogens, such as acetaldehyde, are present at larger concentrations (1 mg cigarette). The

total amount of carcinogens in cigarette smoke is about 1-3 mg per cigarette, and is similar to the

amount of nicotine (Hecht, 2003).

Smoking and Breast Cancer Risk

One of the most prevalent negative effects cigarette smoking has on human health is

cancer (American Cancer Society, 2008). Currently, smoking accounts for approximately 30%

of all cancer cases in developed countries (Doll, 1981; Peto et al., 1996; U.S. Department of

Human and Health Services, 1989). Smoking causes about 90% of lung cancer cases worldwide.

Therefore it the overwhelming cause of lung cancer, which is the leading cause of cancer death

worldwide (International Agency for Research on Cancer, 2004). Tobacco is the most extreme

example of a systemic carcinogen (DeMarini, 2004) and causes cancer in more organ sites than

any other human carcinogen identified thus far. In addition to causing cancers of the lung,

mouth, and esophagus, cigarette smoke has been linked to some leukemias and cancers of distant

organs such as the pancreas, cervix, kidney, and stomach (U. S. Department of Human and

Health Services, 2004). Smoking is also proposed to be an initiator of colorectal carcinogenesis










(Giovannucci et al., 1994a; Giovannucci and Martinez, 1996; Giovannucci et al., 1994b;

Services, 1994).

Epidemiological Studies

Environmental carcinogens have long been suspected to contribute to human breast

cancer. However, no specific agents have been fully implicated except radiation (John and

Kelsey, 1993). One such environmental factor is cigarette smoking. Although lung cancer has

been concretely linked to cigarette smoking, its relationship to other cancers such as those of the

breast is more difficult to establish.

Epidemiological studies reflect conflicting associations between cigarette smoking and

increased breast cancer risk. Most studies indicate that cigarette smoking has no effect on breast

cancer risk (MacMahon, 1990; Palmer and Rosenberg, 1993). A large population based study

found no increased risk even with heavy smokers and those who started to smoke at an early age

(Baron et al., 1996). Other studies recorded that cigarette smoking has little or no independent

affect on breast cancer risk (Hamajima et al., 2002) and there was no association found with

active smoking (Lash and Aschengrau, 2002). Another study suggested that there is no increased

risk of breast cancer in women who smoked during pregnancy (Fink and Lash, 2003).

Conversely, studies have also concluded that cigarette smoke is an etiologic factor for

breast cancer (Bennett et al., 1999; Wells, 2000). Early exposure to cigarette smoke and

increased years since smoking commencement was found to play a role in increased breast

cancer risk (Egan et al., 2002; Johnson et al., 2000; Terry et al., 2002). Smoking prior to a first

full-term pregnancy may also have a role in breast cancer development (Band et al., 2002;

Johnson et al., 2000). In a large California Teachers Study Cohort breast cancer risk was

associated with active cigarette smoking (Reynolds et al., 2004). Smoking has also been linked

to increased breast cancer risk in women with mutations in carcinogen metabolizing genes.









Women with N-Acetyltransferase 2 (NAT2) slow acetylation phenotypes have increased risk for

breast cancer (Ambrosone et al., 1996; Ambrosone et al., 2008). NAT2 is involved in the

metabolism of aromatic amines, a maj or class of cigarette smoke carcinogens. Variants slow the

clearance of aromatic amines. Other polymorphic metabolism genes include CYPlAl and

glutathione S-transferase Ml (GSTM1). Polymorphisms in these genes affect the amount of

DNA adducts in women with breast cancer, especially in smokers (Firozi et al., 2002). In

individuals that favor the metabolism of tobacco carcinogens (due to polymorphisms or

mutations) smoking as a cause of breast cancer becomes more plausible (Hecht, 2002).

The link between passive cigarette smoking (second hand smoke) and breast cancer risk

has also been considered. Passive smoking has been identified as a breast cancer risk factor in

case-controlled studies (Johnson et al., 2000; Morabia et al., 1996). A prospective study from

the Nurse's Health Study and others reported that passive smoking is unrelated to breast cancer

(Egan et al., 2002; Lash and Aschengrau, 2002). A report from the US Surgeon General

concluded that the evidence linking secondhand smoke and breast cancer is suggestive, but not

sufficient to infer a causal relationship (U.S. Department of Health and Human Services, 2006).

However, the American Society recommends that women should be aware of the possible link

and limit their exposure to active as well as passive cigarette smoke (American Cancer Society,

2008).

Studies have probed the reason for conflicting epidemiological results. The effects of

smoking on breast cancer risk may differ by menopausal status (Band et al., 2002; Johnson et al.,

2000). Additionally, tobacco may also have anti-estrogenic effects that reduce breast cancer risk

(Baron et al., 1990; Bremnes et al., 2007; Tanko and Christiansen, 2004). In some studies

cigarette smoking was found to have an inverse relationship to breast cancer (Baron et al., 1990)









and to protect rats from mammary tumor formation (Davis et al., 1975). This opposing effect

may explain why epidemiological studies reflect inconsistent results on the association between

breast cancer risk and cigarette smoking (Bremnes et al., 2007). Additionally, study methods can

be skewed by biases in control selection, chance variation, type of stratification, or small sample

size (Baron et al., 1996). Other possibilities include the association with risk is too small to

detect or that for some women there is increased risk, while others are afforded protection from

cigarette smoking (Phillips and Garte, 2008). It is plausible that smoking can cause breast cancer

in humans, but this relationship is difficult to establish because of low carcinogen doses (Hecht,

2002).

Biological Studies

Despite conflicting epidemiological results, biological studies support the hypothesis that

cigarette smoke can play a role in breast carcinogenesis. The anatomy of the breast makes it a

susceptible target for chemical carcinogens. Carcinogens in tobacco smoke can pass though

alveolar membranes in the lung, enter the blood stream, and be transported to the breast tissue by

plasma lipoproteins (Shu and Bymun, 1983), and can be readily stored and concentrated in the

breast adipose tissue (Obana et al., 198 1). Since many of these compounds are lipophilic in

nature, their concentration in breast adipose tissue increases exposure to adj acent epithelial cells

(Perera et al., 1995). Human mammary epithelial cells have a high capacity to metabolize

carcinogens into DNA-binding substances and are therefore the ultimate targets for

carcinogenesis (MacNicoll et al., 1980; Pruess-Schwartz et al., 1986; Stampfer et al., 1981).

Cigarette smoke components have been found in the breast milk (Catz and Giacoia, 1972;

O'Brien, 1974) and the presence of smoking products in nipple aspirates resulted in positive

Ames Salmonella mutagenesis tests (Ames et al., 1975). The concentration of compounds in

breast ducts may provide a means by which cancer-initiating and promoting substances reach the









breast epithelium (Petrakis, 1977a, b). Additionally, evidence suggests smokers metabolize

cigarette constituents in their breast tissue. Nicotine and its metabolite, cotinine, have been

found in the breast secretions of non-lactating, women smokers (Petrakis et al., 1978). These

studies support the hypothesis that mutagenic substances reach the breast epithelia and may have

implications in the pathogenesis of benign breast disease and cancer (Petrakis et al., 1980).

The Mechanism of CSC-induced Breast Carcinogenesis

Tobacco is a significant human mutagen. DNA damage is the primary effect from

exposure to cigarette smoke carcinogens. Studies indicate that CSC can induce DNA strand

breaks (DSBs) in rodents, mammalian cells in culture, and DNA in vitro (DeMarini, 2004). CSC

also causes DSBs in human cells in vitro (Luo et al., 2004; Nakayama et al., 1985). In animal

models the potency of carcinogens is strongly correlated with the ability to form covalent

adducts with DNA (Bartsch et al., 1983; Pelkonen et al., 1980). Therefore, DNA adducts, the

covalent binding products of a carcinogen, its metabolite, or related substances to DNA, are

central to the carcinogenic properties of tobacco products, including cigarette smoke (Hecht,

1999). Cigarette smoking has been associated with increased DNA damage in the lungs of

smokers (Cuzick et al., 1990; Routledge et al., 1992) and studies suggest that similar damage

may occur in the tobacco-induced neoplasms of other tissues (Cuzick et al., 1990). DNA adducts

known to be associated with exposure to PAHs and tobacco smoke have been found in breast

tissue. DNA adducts related to tobacco exposure were found in the breast tissue of women with

breast cancer. All of the positive samples were from smokers as compared to no adducts found

in nonsmoker tissue (Perera et al., 1995). Increased levels of aromatic DNA adducts were even

found in the adjacent normal tissue of breast cancer patients (Li et al., 1996a). These and other

studies indicate that exposure to environmental carcinogens, such as those found in cigarette

smoke may be associated with the etiology of human breast cancer (Li et al., 1996a).









CSC also causes cytogenetic damage to cells, including chromosomal deletions, in rat

cells and murine models in vivo (Dertinger et al., 2001; Rithidech et al., 1989). It also causes

anaphase bridges in normal human fibroblast cells (Luo et al., 2004). Anaphase bridges are

chromosomal segregation defects first described in maize (McClintock, 1942). These bridges

probably originate from DNA DSB repair (Luo et al., 2004; Zhu et al., 2002) and are linked to

chromosomal instability (CIN) in cancer cells (Gisselsson et al., 2000; Montgomery et al., 2003)

and to tumorigenesis in mice (Artandi et al., 2000). Anaphase bridges break during anaphase,

exposing telomerase-free ends that can fuse with other broken strands or sister chromatids

resulting in fused chromosomes. These fused chromosomes can repeatedly undergo breakage-

fusion-bridge cycles during subsequent mitoses (Gisselsson, 2003). Additionally, CSC

transformed MCF 10A-CSC3 cells (Narayan et al., 2004), in contrast to parental MCF 10A cells,

display polyploidy (Jaiswal, 2008).

Hecht offers a model linking cigarette-induced DNA damage to lung carcinogenesis that

can also be applied to other tobacco-induced cancers including breast carcinogenesis (Hecht,

1999, 2003, 2006) (Figure 1-1). Nicotine addition causes continual cigarette smoking and

chronic exposure to cigarette smoke carcinogens. Most of these carcinogens must be

metabolically modified. Glutathione-S-transferases and UDP-glucuronosyl transferases convert

carcinogen metabolites into less harmful forms (Armstrong, 1997; Burchell, 1997) and the

detoxified components are excreted out of the body. Conversely, cytochrome P450 enzymes

(P450s) convert the carcinogens to electrophilic compounds that can bind DNA and form

adducts (Guengerich, 2001; Jalas et al., 2005). P450 enzymes, are part of mammalian system

that responds to foreign matter in the body (Guengerich, 2001). P450s, CYPlAl and CYPlB1,

are inducible by the aryl hydrocarbon receptor which is important in the activation of PAHs










(Nebert et al., 2004). The balance between activation and detoxification enzymes varies among

individuals and affects cancer susceptibility (Vineis et al., 2003). Cellular repair systems can

remove DNA adducts and return the DNA structure to its original state (Goode et al., 2002). If

the adducts are not repaired (overwhelming of repair system or polymorphisms in repair

enzymes) and persist during DNA replication, miscoding and permanent mutations can occur in

the DNA. DNA adducts lead to genotoxic damage including CIN, DNA strand breaks,

chromosomal/gene mutations, and cytogenetic changes (DeMarini, 2004). Damaged cells may

be removed by apoptosis and the balance between mechanisms leading to and opposing

apoptosis has a significant effect on tumor formation (Bode and Dong, 2005). Mutations that

cause loss of function in pro-apoptotic genes or the upregulation of anti-apoptotic genes allows

DNA damage to persist and may result in abnormal gene expression. The chronic DNA damage

from cigarette smoke exposure is consistent with the genetic changes that occur as normal tissues

progress from hyperplasia to invasive cancer (Osada and Takahashi, 2002; Park et al., 1999;

Wistuba et al., 2002). Mutations that occur in oncogenes or tumor suppressors can also

contribute to the loss of normal cell growth control (Hecht, 1999) resulting in cell transformation

and eventually tumorigenesis.

Chemical Transformation of Human Breast Epithelial Cells

Chemicals contribute to carcinogenesis by inducing cellular transformation: the

conversation of normal cells into cells with cancerous properties (Rudin, 1997). Transformation

primarily results from carcinogen-induced DNA damage. The most significant characteristic of

chemical transformation is increased proliferation. Proliferating cells can readily metabolize

carcinogens and harbor the resulting genetic mutations into subsequent generations (Russo and

Russo, 1980, 1987; Russo et al., 1982). Other characteristics of transformation are clonal growth

(McCormick and Maher, 1989) and anchorage-independent growth, which is a relatively late









marker and can be correlated with tumorigenecity (DiPaolo, 1983; Shin et al., 1975). Neoplastic

cells display invasiveness (Ochieng et al., 1991) and locomotion (Albini et al., 1987; Repesh,

1989) and malignant transformation is manifested by the ability to form tumors in mice (Change,

1966; DiPaolo, 1983; McCormick and Maher, 1989). These characteristics contribute to the six

hallmarks of cancer: self-sufficiency in growth signals, insensitivity to anti-growth signals,

evasion of apoptosis, limitless replicative potential, sustained angiogenesis, tissue invasion and

metastasis, that are acquired by a cell as it becomes cancerous (Hanahan and Weinberg, 2000).

The transformation of human breast epithelial cells with cigarette smoke carcinogens has

been observed repeatedly. Spontaneously immortalized human breast epithelial cells, MCF 10F

(Soule et al., 1990; Tait et al., 1990), displayed transformed characteristics after treatment with

B[a]P and DMBA. The cells had increased proliferation, anchorage-independent growth, and

altered patterns when grown in collagen matrix when compared to control cells, but were not

tumorigenic in vivo. These cells also displayed greater chemoinvasive and chemotactic abilities

when compared to control cells (Calaf and Russo, 1993). Being chemoinvasive and chemotactic

are characteristics enhanced in transformed cells that correlate with malignant characteristics in

vivo (Bonfil et al., 1989; Liotta, 1984; MacCarthy, 1988; Mensing et al., 1984; Ochieng et al.,

1991; Zimmermann and Keller, 1987). MCF10A, the counterpart of MCF 10F cells that grow

attached in vitro (Soule et al., 1990; Tait et al., 1990), can be transformed with a single treatment

of CSC. These cells displayed increased growth and anchorage-independent growth that were

stable in re-established cell lines (Narayan et al., 2004).(Chen et al., 1997; Martin and Leder,

2001) NNK transformed MCF 10A cells in a study that utilized low doses over a period of time

to mimic long-term exposure to the carcinogen (Mei et al., 2003). The transformed cells

exhibited increased anchorage-independent growth, cell motility, and tumorigenecity in nude









mice (Mei et al., 2003), meaning the cells had become malignant. These studies provide

evidence that cigarette smoke components play a role in the multi-step oncogenesis of the breast.

Apoptosis

Programmed cell death (PCD), also known as apoptosis, was first described in 1972

(Kerr et al., 1972). It is an evolutionary conserved process that regulates cell proliferation and

turnover and maintains genomic integrity by selectively removing highly mutated cells from a

population (Cherbonnel-Lasserre et al., 1996). In healthy cells, apoptosis is tightly regulated; too

much cell death can lead to degenerative conditions, while too little can lead to autoimmune

disorders and cancers (Thompson, 1995).

Apoptosis is a process of death in which the cell takes an active role in its own demise.

Characteristics of apoptosis include cell shrinkage, chromatin condensation, and disintegration of

the cell, before it is removed by phagocytosis (Kerr et al., 1972). Other forms of apoptosis

include anoikis and amorphosis. The survival of epithelial cells requires continual attachment to

the extracellular matrix (ECM) (Streuli and Gilmore, 1999). Anoikis occurs upon the

detachment of epithelial cells from the extracellular matrix (Frisch and Francis, 1994). The

maintenance of cellular morphology is also necessary for the survival of epithelial cells (Chen et

al., 1997; Martin and Leder, 2001). Amorphosis is triggered by the alteration of cell shape

(Martin and Vuori, 2004). Classical apoptosis can occur through two maj or pathways.

Intrinsic Pathway

The intrinsic pathway eliminates cells in response to ionizing radiation, chemotherapy,

mitochondrial damage, and certain developmental cues (Kuribayashi et al., 2006). The

mitochondrion is the central response unit to this pathway. Mitochondrial swelling and outer

mitochondrial membrane rupture results from a wide variety of apoptotic stimuli (Vander Heiden

et al., 1997). DNA damage or cell stress causes stabilization of p53 and subsequent activation of









Bcl-2 pro-apoptotic proteins such as Bax and Bak that induce the mitochondrial release of

cytochrome c. Bax mediates cell death (Chittenden et al., 1995) by homodimerizing to itself

(Zha et al., 1996) and promoting the release of cytochrome c from the mitochondria (Reed,

1997). In the presence of liberated cytochrome c and ATP, the adaptor protein, Apaf-1, recruits

pro-caspase-9. It is believed that the presence of cytochrome c changes the conformation of the

Apaf-1 negative regulatory domain of WD40 repeats, and allows for its association with pro-

caspase-9 (Li et al., 1997). Apaf-1, cytochrome c, and procaspase-9 form the apoptosome

complex that activates procaspase-9 (Li et al., 1997; O'Connor and Strasser, 1999). Activated

caspase-9 cleaves and activates downstream effector caspases such as caspase-3, -7, which

execute apoptosis (Li et al., 1997). Smac/DIABLO is also released from the mitochondria.

These compounds inhibit inhibitor of apoptosis proteins (IAPs) and further promoting the

activation of caspases (Du et al., 2000; Verhagen et al., 2000).

Extrinsic Pathway

The extrinsic pathway eliminates unwanted cells during development, immune system

maturation, and during the immunosurveillance removal of tumor cells (Kuribayashi et al.,

2006). This pathway bypasses the steps that are regulated by Bcl-2 family members. It is

triggered by receptors of the tumor necrosis factor (TNF) receptor type I family, TRAIL

receptors, or Fas (CD-95/APO-1) receptors and their ligands. The Fas-induced death pathway is

the maj or pathway that occurs in the lymphoid system (Newton et al., 1998; Strasser et al., 1995)

and has become the paradigm for the extrinsic pathway (Kuribayashi et al., 2006). Ligand

binding results in receptor trimerization and formation of the death-inducing signaling complex

(DISC). The adaptor molecule, Fas-associated protein with death domain (FADD), is then

recruited to the receptor' s cytosolic tail by its death domain (Chinnaiyan et al., 1995; Green and

Kroemer, 2004). Procaspase-8 or -10 are recruited to FADD by an interaction of the N-terminal









death effector domain (DED) of both proteins (Chittenden et al., 1995). The DISC allows for the

auto-activation and maturation of caspase-8, -10 (Boatright et al., 2003; Donepudi et al., 2003).

The activation of these caspases initiates the death signaling cascade by cleaving and activating

the downstream effector caspase-3, -7. The intrinsic and extrinsic apoptotic pathways are

interconnected. Activated caspase-8 cleaves the BH3-only protein, tBID, which in turn

facilitates the release of cytochrome c from the mitochondria (Li et al., 1998).

Apoptosis and Cancer

Studies support the hypothesis that apoptosis selectively removes the most damaged cells

from the population (Cherbonnel-Lasserre et al., 1996). Apoptosis is a critical defense against

radiation-induced mutations, malignant transformation, and neoplastic progression. Damaged

cells that escape this pathway are more likely to have increased levels of mutations due to

heavily damaged DNA. DNA damage-induced mutations that occur can contribute to a

proliferative advantage that might drive the cell towards malignancy (Cherbonnel-Lasserre et al.,

1996). From this and other studies, the concept emerged that an increased threshold for

apoptosis represents a central step in tumorigenesis. The surviving damaged cells are the most

likely to develop into neoplastic clones (Adams and Cory, 1998; Cherbonnel-Lasserre et al.,

1996). Anti- and pro-apoptotic proteins therefore play opposing roles in the prevention or

progression of tumorigenesis, respectively. Since many chemotherapeutic drugs kill cancer cells

by triggering apoptosis, the modulation of cell apoptosis threshold is of critical therapeutic

potential (Chinnaiyan, 1999).

The B cell leukemia-2 (Bel-2) Protein Family

The B cell leukemia-2 (Bcl-2) protein family is involved in the regulation of apoptosis.

The founding member, Bcl-2, was identified as a translocation found in human follicular

lymphoma cells (Tsujimoto et al., 1984) and has anti-apoptotic activity (Vaux et al., 1988). At









least twenty other Bcl-2 members have been identified in mammalian cells (Adams and Cory,

1998; Cory et al., 2003; Gross et al., 1999). All members contain at least one of the four Bcl-2

homology (BH) domains which influence the dimerization required for the function of some

members (Kelekar and Thompson, 1998; Yin et al., 1994). The anti-apoptotic members: Bcl-2

(Tsujimoto et al., 1984), Bcl-xL (Boise et al., 1993), Bcl-w (Gibson et al., 1996), Mcl-1

(Kozopas et al., 1993), and Al (Lin et al., 1996) contain all four BH domains. Anti-apoptotic

proteins function by directly or indirectly binding and inhibiting the activity of pro-apoptotic

proteins that activate effector caspases (Cory and Adams, 2002; Opferman and Korsmeyer,

2003). Pro-apoptotic members fall into two categories. Bax is the founding member of the first

category (Hsu et al., 1997; Hsu and Youle, 1998). Bax and the remaining proteins in this group,

Bak and Bok, have domains BH1, BH2, and BH3 and directly induce the release of cytochrome

c from the mitochondria. BH3 only proteins (Bad, Bim, Bid), as the name implies, possess only

the the BH3 domain (Chittenden et al., 1995; Kelekar and Thompson, 1998). These proteins

bind anti-apoptotic proteins and prevent them from sequestering the first group of pro-apoptotic

proteins (Letai et al., 2002). BH3-only proteins function upstream of, and are dependent on Bax

and Bak and can not kill cells that lack the two proteins (Zong et al., 2001). The dimerization of

Bcl-2 proteins can titrate each others functions, suggesting that relative concentrations and ratios

of Bcl-2 family proteins act as a rheostat controlling the apoptosis program and cell survival

(Farrow and Brown, 1996; Lohmann et al., 2000; Oltvai et al., 1993).

Bcl-x Gene and Promoter Structure

The human bcl-x gene was identified by the cross-hybridization of gene libraries with a

bcl-2 probe (Boise et al., 1993). The gene structure is similar to that of bcl-2 (Seto et al., 1988).

Bcl-x is composed of three exons (Figure 1-2A); the first exon is untranslated, while exons II and

III code for bcl-x mRNAs. Exon II contains translation initiation codons, while exon III contains









the translation termination codons. The exons are separated by a 283 bp intron between exons I

and II and a large 9 kb intron between exons II and III. The 5' untranslated region (UTR) spans

from exon I to the beginning of exon II (Grillot et al., 1997).

The initial promoter studies occurred in mice. Two bcl-x murine promoters were cloned

and described (Grillot et al., 1997). The first promoter was 57 bp upstream of the second exon

and most active in FL5.12 and K542 cell lines by primer extension. A maj or transcriptional

initiation site was mapped to this region. This promoter lacked a TATA box and instead

contained a consensus initiator (Inr) element (YYANT/AYY) at -149 to -142 (Grillot et al.,

1997). Inr sites are involved in transcription initiation at TATA-less promoters and the

transcription start site usually overlaps the Inr consensus sequence (Smale and Baltimore, 1989).

However, the Inr here is probably not involved in transcription initiation because the maj or start

site mapped outside the Inr sequence (Grillot et al., 1997). The second promoter was further 5',

upstream of exon I. This promoter was utilized mostly in the brain and thymus. This GC-rich

region had Sp protein binding motifs and two maj or transcription start sites: in the brain the

position was -727 and in the thymus the site was mapped to -655 before the initiation codon in

exon II (Grillot et al., 1997). Later, studies indicated that the mouse bcl-x promoter was active in

many tissues and three additional tissue specific murine bcl-x promoters were been identified

(Pecci et al., 2001).

Human and murine bcl-x open reading frames have 93% nucleotide identity (Gonzalez-

Garcia et al., 1994). Bcl-x mRNAs are transcribed from the human bcl-x gene as the result of

alternative mRNA splicing, each coding for a single protein isoform (Figure 1-2B). Three bcl-x

mRNAs and proteins have been reported in humans: Bcl-xLong (Bcl-xL) (Boise et al., 1993),

Bcl-xShort (Bcl-xS) (Boise et al., 1993), and Bcl-xBeta (Bcl-xp) (Ban et al., 1998). Bcl-xl










results from the splicing together of the two coding exons (II and III). Bcl-xs results from the use

of an alternative 5' splice site in exon II and lacks the 3' terminal 63 amino acids that comprise

BH1 and BH2 which are needed to inhibit apoptosis. It codes for a 178 amino acid protein

(Boise et al., 1993) that is approximately 18 kDa (Gonzalez-Garcia et al., 1994) and functions as

a pro-apoptotic protein by antagonizing Bcl-2 and Bcl-xL to promote apoptosis. Bcl-xS is

expressed in cells with high turnover rates (Boise et al., 1993). Bcl-xa results from the unspliced

bcl-x transcript of Exon II that introduces a new stop codon before the third exon. Therefore, it

lacks the carboxy-terminal hydrophobic 19 amino acid domain and has a unique stretch of 21

amino acids at the carboxy terminus (Gonzalez-Garcia et al., 1995). In vitro studies show that

Bcl-xp interacts with the pro-apoptotic protein Bax (Ban et al., 1998). Whether the protein has

anti- or pro-apoptotic effects remains unclear.

Bcl-xL Protein

Bcl-xl is the maj or, most abundant bcl-x mRNA and protein expressed in murine and

human tissues (Boise et al., 1993; Gonzalez-Garcia et al., 1995; Gonzalez-Garcia et al., 1994;

Rouayrenc et al., 1995). The human bcl-xl promoter is upstream (5') to exon I and codes for the

maj ority of bcl-x transcripts in humans. Bcl-xl mRNA originates from the 5' untranslated region

(UTR) of the promoter (Grillot et al., 1997; Sevilla et al., 1999). A novel bcl-x promoter and

exon located upstream of exon I has been identified in human lymphoma cells (MacCarthy-

Morrogh et al., 2000).

Bcl-xL is a 241 amino acid protein (Boise et al., 1993) of 29-30 kDa (Yin et al., 1994).

The structure of human Bcl-xL has been crystallized and characterized (Muchmore et al., 1996).

The protein is composed of a total of seven a-helices. The two central anti-parallel hydrophobic

helices, a5 and a6, are flanked by helices a3 and a4 on one side and al, a2, and a7 on the other

side. The a-helices 5 and 6 form a hairpin that shares homology with the hairpin structure found









in the translocation domain of diphtheria toxin (Muchmore et al., 1996) and the carboxy-terminal

end contains a hydrophobic segment (Huang et al., 1998; Yin et al., 1994). The a5-a6 hairpin

and the carboxy-terminal end of Bcl-xL are involved in anchoring the protein to mitochondrial

membranes.

A large non-conserved flexible loop connects al and a2 (Muchmore et al., 1996) and has

been shown to negatively regulate the activity of the protein (Chang et al., 1997). This loop

domain comprises about one quarter of the protein and contains all the phosphorylation sites of

Bcl-xL between amino acids 32 and 83 (Chang et al., 1997). Similar to Bcl-2, the

phosphorylation of Bcl-xL decreases its anti-apoptotic function (Biswas et al., 2001;

Poruchynsky et al., 1998). Bcl-xL lacking the flexible loop renders the protein unable to be

phosphorylated thus causing the protein to block apoptosis more efficiently than wild-type

Bcl-xL (Muchmore et al., 1996). Bcl-xL is also deaminated on this the flexible loop.

Deamination is a modification in which an asparagine is converted into an aspartate (Takehara

and Takahashi, 2003). Bcl-xL is deaminated at two asparagines in response to anti-neoplastic

agents. Deamination negatively modulates the pro-survival activity of Bcl-xL and the inhibition

of this modification increases the cells' resistance to these agents (Deverman et al., 2002).

Proteins with such long regions of random coil do not normally have long half-lives because the

region is vulnerable to cellular proteases (Ciechanover, 1994). It is likely that the loop region of

Bcl-xL and other similar proteins are protected by associations with other proteins. A similar

loop has been found on Bcl-2 (Chang et al., 1997). Bcl-xL binds to itself with the weakest

affinity, indicating that is monomeric in nature (Muchmore et al., 1996) and is localized to the

nuclear envelope, extra-nuclear membranes, the mitochondria, and is also present in the cytosol

(Gonzalez-Garcia et al., 1994; Hsu et al., 1997).









Bel-xL functions as an anti-apoptotic protein

Bcl-xL is an anti-apoptotic member of the Bcl-2 protein family and is most closely

related to Bcl-2 (Boise et al., 1993; Grillot et al., 1997). The two proteins display 43% amino

acid identity (Muchmore et al., 1996; Petros et al., 2001). Bcl-xL and Bcl-2 are in the group of

oncogenes that function as repressors of apoptosis and do not affect proliferation rates

(Korsmeyer, 1992; Miyashita et al., 1994). The role of Bcl-xL in apoptosis is evident; disruption

of bcl-x gene leads to death in E12-E13 mouse embryos due to massive apoptosis of neuronal

and hematopoietic progenitors (Motoyama et al., 1995). It is therefore essential for neurogenesis

(Gonzalez-Garcia et al., 1994; Motoyama et al., 1995) and is a key protein during cytokine-

regulated myelopoiesis (Packham et al., 1998). Bcl-xL inhibits staurosporine-induced cell death,

caspase-3 and caspase-7 activation, and PARP cleavage (Chinnaiyan and Dixit, 1996) and is

capable of suppressing apoptosis of IL-3 dependent cells upon growth factor withdrawal (Boise

et al., 1993; Gonzalez-Garcia et al., 1994). It also inhibits anoikis in breast cancer cells

(Fernandez et al., 2002).

Dimerization with pro-apoptotic proteins. Bcl-xL prevents the intrinsic apoptosis

pathway (Chinnaiyan and Dixit, 1996; Gonzalez-Garcia et al., 1994) by localizing to

mitochondrial membranes, inhibiting the release of cytochrome c, and preventing the

downstream activation of apoptotic signal transduction cascades (Boise et al., 1993; Fang et al.,

1994; Gonzalez-Garcia et al., 1994). Bcl-xL does so by heterodimerizing with pro-apoptotic

proteins (Boise et al., 1993; Oltvai et al., 1993; Yin et al., 1994). Bax monomers must

oligomerize to permeate membranes and lead to apoptosis (Annis et al., 2005). The

overexpression of Bcl-xL prevents the oligermization of Bax (Finucane et al., 1999; He et al.,

2003). Bcl-xL can also bind to and inhibit the BH3-only protein Bad. Normally Bad is

phosphorylated and sequestered by the scaffold protein, 14-3-3. Apoptotic signaling results in









the dephosphorylation of Bad, that then binds to Bcl-xL and counteracts its pro-survival activity

(Zha et al., 1996). The overexpression of Bcl-xL can sequester Bad to the mitochondria (Cheng

et al., 2001; Jeong et al., 2004), leaving excess Bcl-xL to continue its pro-survival functions.

The BH1 and BH2 domains have been shown to be important for Bcl-xL to antagonize Bax

(Minn et al., 1999; Yin et al., 1994). Later studies determined that BH1-BH4 and the carboxy-

terminal domains are required for the sequestering of Bax. Alternatively, BH1, BH3, and the

carboxy-terminal tail are necessary for Bcl-xL to sequester Bad to the mitochondria (Zhou et al.,

2005).

Mitochondrial stability. Studies indicate that Bcl-xL acts in dimerizati on-independent

mechanisms to inhibit apoptosis (Chang et al., 1997; Cheng et al., 1996; Fiebig et al., 2006) in

the absence of Bax and Bak. (Chang et al., 1997). Bcl-xL physically inhibits the release of

mitochondrial contents such as cytochrome c. It can prevent apoptosis by maintaining

mitochondrial membrane potential and volume homeostasis (Boise and Thompson, 1997; Vander

Heiden et al., 1997). The loss of F1Fo-ATPase activity, that occurs through the permeability

transition pore complex (Zoratti and Szabo, 1995), terminates mitochondrial respiration and

triggers the release of cytochrome c (Cai et al., 1998). The three-dimensional structure of the

Bcl-xL pore-forming domain (Muchmore et al., 1996) has been implicated in the regulation of

membrane permeability (Cramer et al., 1995; London, 1992). Bcl-xL has been shown to

function like bacterial toxins that have similar pore domains. It can insert into synthetic lipid

vesicles or planar lipid bilayers and form ion-conducting channels (Minn et al., 1997). It is

possible that the channels formed by Bcl-xL serve to prevent the release of proteins, such as

cytochrome c. Pores formed by Bcl-xL may also serve to stabilize mitochondrial volume

potential. The ability of Bcl-xL to prevent apoptosis, however, is probably not solely dependent









on it pore-forming capability (Minn et al., 1997). Bcl-2 and Bax can also form ion channels in

synthetic membranes (Antonsson et al., 1997; Schendel et al., 1997).

Interactions with the apoptosome. Bcl-xL has been found to form a ternary complex

with the apoptotic effector caspase, pro-caspase-9, and Apaf-1. The first indication of this

characteristic was discovered when the nematode, Caenorhabditis elegan2s protein, CED-9, and

its mammalian homologue, Bcl-xL, bound to and inhibited the function of CED-4, the

mammalian counterpart to Apaf-1. This interaction suggested that Bcl-xL may block cell death

by a similar mechanism in mammalian cells (Chinnaiyan and Dixit, 1997). Subsequent studies

found that in 293 human embryonic kidney cells, caspase-9 and Bcl-xL bound distinct regions of

Apaf-1 and formed a ternary complex (Pan et al., 1998). This interaction inhibited the activation

of caspase-9 in human embryonic kidney cells with SV40 large T antigen, 293T (Hu et al.,

1998). These studies offer an alternative model to the anti-apoptotic mechanism of Bcl-xL in

which the protein directly prevents the release of cytochrome c, and also inhibits the activation of

pro-caspase-9 through direct interaction with Apaf-1. The mechanism by which Bcl-xL inhibits

apoptosis while bound to Apaf-1 may be cell-type dependent. In prostate epithelial cells, Bcl-xL

interacts with Apaf-1 but it inhibits apoptosis by preventing the release of cytochrome c from the

mitochondria (Chipuk et al., 2001). Caspase-9 and -3 are still activated because the addition of

cytochrome c results in their cleavage. It is possible that the interaction between Bcl-xL and

Apaf-1 may also depend on experimental conditions or an unidentified protein (Chipuk et al.,

2001).

Bcl-xL and the extrinsic apoptotic pathway. Bcl-xL also inhibits extrinsic apoptotic

pathways. Tumor necrosis factor (TNF)-induced apoptosis was inhibited in the human myeloid

leukemia cell line HL-60, by overexpressing Bcl-xL which was thought to block an early step









in TNF signaling. Bcl-xL may have blocked TNF-induced apoptosis in these cells by reducing

the expression of a downstream target of TNF, AP-1 and JNK and MAPK kinases, which

regulate AP-1 (Manna et al., 2000). Bcl-xL also inhibited TNF-induced apoptosis in MCF-7

breast carcinoma cells (Jaattela et al., 1995; Srinivasan et al., 1998).

Bcl-xL inhibits Fas-induced cell death by several mechanisms. It protected primary B

cells from Fas-mediated apoptosis (Schneider et al., 1997). Bcl-xL inhibited Fas-induced

apoptosis in Bcl-xL-tranfected Jurkat cells treated with Fas antibodies not by blocking caspase

activation, but by inhibiting the subsequent loss of A'Pm (Boise and Thompson, 1997). In Jurkat

T lymphocytes and breast carcinoma cells, Bcl-xL inhibited apoptosis induced by microtubule

damaging drugs such as paclitaxel and vincristine. In these cells, overexpression of Bcl-xL

inhibited the Fas pathway by binding calcineurin and interfering with the nuclear translocation of

NFAT proteins that transcriptionally activate the Fas ligand (Biswas et al., 2001).

Mechanism by which Bel-xL inhibits caspase-8-dependent apoptosis. It was

discovered in early studies that Bcl-xL and Bcl-2 could block caspase-8 activation (Chinnaiyan

and Dixit, 1996). It was hypothesized that Bcl-xL might act upstream of the CED-3 homologue,

caspase-8 (Chinnaiyan and Dixit, 1997), by inhibiting its interaction with the DISC or that the

protein acted downstream of caspase-8, by preventing its action on target proteins. In peripheral

human T cells resistance to CD95-induced apoptosis is characterized by lack of caspase-8

recruitment to the DISC and increased Bcl-xL levels (Peter et al., 1997). However, most studies

support the latter theory. The overexpression of Bcl-xL did not affect caspase-8 activation in

MCF-7 cells expressing high levels of CD95 (MCF-7-Fas), but the cells still become resistant to

CD-95-induced apoptosis (Jaattela et al., 1995). In MCF-7-Fas cells there were no associations

found between Bcl-xL and pro-caspase-8 or active caspase-8 subunits, however, PARP cleavage









was completely blocked. Therefore, Bcl-xL seemed to inhibit Fas-induced apoptosis

downstream of caspase-8, but upstream of PARP cleavage. Bcl-xL probably inhibited the

activity of another caspase-3-like protein that cleaved PARP in these cells but the mechanism

remained unclear (Medema et al., 1998). In the next issue of the same publication, it was

reported that Bcl-xL inhibited not only Fas-induced apoptosis, but also TNF receptor induced

apoptosis in MCF-7 cells transfected with Fas and Bcl-xL cDNAs (MCF-7/FB) (Srinivasan et

al., 1998). Bcl-xL was capable of inhibiting apoptosis, despite the full activation of caspase-8.

This inhibition manifested as changes in cytochrome c localization and cell morphology. Bcl-xL

could even inhibit apoptosis when the cell was microinjected with active caspase-8. However,

the activity of caspase-7, a downstream target of caspase-8, was attenuated after treatment with

Fas antibody or TNF, and was totally blocked in cells treated with UV. The inhibition of

apoptosis by Bcl-xL was therefore, also found to occur downstream of caspase-8 but upstream of

one of the caspase-8 targets. Bcl-xL may have inhibited caspase-8 activity by translocating the

protein from the plasma membrane, sequestering caspase-8 targets, or by regulating the

availability of cofactors necessary for caspase-8 to cleave its targets (Srinivasan et al., 1998).

The property of Bcl-xL to inhibit apoptosis downstream of initiator caspases but upstream of

their targets (possibly effector caspases) have been previously observed (Boise and Thompson,

1997; Medema et al., 1998), however the mechanism by which Bcl-xL inhibits extrinsic pathway

of apoptosis seems to be cell-type dependent.

Bel-xL and breast cancer

Bcl-x proteins are involved in normal mammary involution and development. In humans,

the expression of Bcl-2 and related proteins such as Bcl-xL is not well studied in the mammary

gland. Studies focused on the expression of Bcl-2 family members in rodents have been

extrapolated for the analysis of human samples. Bcl-x isoform expression changes in alveolar










cells during involution, a period of mammary cell apoptosis and remodeling, compared to

lactation (Heermeier et al., 1996). Bcl-xl and bcl-xs expression were analyzed with RT-PCR and

differential hybridization. In virgin mice, during lactation, and pregnancy, bcl-xl mRNA was

ten-fold higher than bcl-xs expression. During involution, bcl-xs levels increased up to six-fold

compared to bcl-xl levels and bax is also upregulated during this time (Heermeier et al., 1996; Li

et al., 1996b, c). Transfection experiments showed that cells expressing Bcl-xL had higher cell

viability (27% died) after DNA damage. Co-expression of Bcl-xS and Bcl-xL proteins resulted

in the inhibition of the Bcl-xL protective effect (80% cells died). This study further supports the

theory that the ratio of pro-apoptotic and anti-apoptotic species in a single cell can determine cell

fate.

Bcl-xL is up-regulated in some cancers (Packham et al., 1998) and is implicated in

having a role in colorectal carcinogenesis (Krajewska et al., 1996; Maurer et al., 1998). In many

cases, Bcl-xL expression occurs at the adenoma to carcinoma transition, continuing through

metastasis (Krajewska et al., 1996; Liu and Stein, 1997). Reduction of apoptosis is associated

with the development to fibrocystic changes in the breast and increased cancer risk (Allan et al.,

1992). However, Bcl-xL has not been fully implicated in human breast tumorigenesis. The

effects Bcl-xL has on breast carcinogenesis primarily hinge on the protein's ability to prevent

apoptosis and promote survival. The role of Bcl-xL in breast carcinogenesis is evident from

biological studies. Bcl-xL has roles in breast carcinogenesis on the levels of primary tumor

growth, metastasis, and chemotherapy resistance.

Bel-xL and primary tumor growth. Bcl-xL is overexpressed in some primary human

breast carcinomas and the breast cancer cell line, T47D (Olopade et al., 1997; Schott et al., 1995)

and is a marker for increased tumor grade and nodal metastasis (Olopade et al., 1997). It is also









increased cancerous, but not normal breast epithelium and may serve as an indicator or patient

prognosis (Krajewski et al., 1999). Although Bcl-xL overexpression in mouse tumors, it does

not increase the number of mitotic figures (Liu et al., 1999) is therefore does not affect cell

proliferation or cell cycle progression.

Bel-xL and metastasis. Bcl-xL has a more important role in metastasis than in primary

tumor development. The overexpression of Bcl-xL does not induce primary tumor formation but

enhances MEK-induced tumorigenesis in the mammary gland environment (Martin et al., 2004).

Metastasis is the primary cause of treatment failure in cancer patients (Chambers et al., 2001).

Overexpression of Bcl-xL in MDA-MB-43 5 breast cancer cells increased cell metastatic activity.

Resistance to cytokine-induced apoptosis, increased cell survival in circulation, and increased

anchorage-independent growth were all characteristics of these cells (Fernandez et al., 2002).

MDA-MB-43 5 cells transfected with Bcl-xL metastasized to the lung, lymph nodes, and bone

when inoculated into the mammary fat pads of nude mice (Rubio et al., 2001). Bcl-xL increased

tumor cell survival in the bloodstream (Fernandez et al., 2000) and the metastatic properties of

breast cancer cells that had already lost extracellular matrix dependence by improving cell

survival under conditions with no cellular adhesion, enhancing anchorage-independent growth.

Surprisingly, Bcl-xL did not increase metastatic activity in cells that had not escaped the

extracellular matrix. MDA-MB-43 5 cells transfected with the bcl-xl gene and inoculated into

nude/SCID mice resulted in increased lymph node metastasis (Fernandez et al., 2002).

The mechanisms by which Bcl-xL increases metastasis have been investigated. It has

been suggested that the key event in breast cancer metastatic progression is the deregulation of

cell death (Fernandez et al., 2002). Therefore, apoptosis resistance has a role in metastasis

(Fernandez et al., 2000; McConkey et al., 1996). Additionally, Bcl-xL overexpression could









functionally associate with genes that control the events that result in the acquisition of

metastatic phenotypes and shorten the dormancy of metastatic cells in several organs (Mendez et

al., 2006). Tumor dormancy is the prolonged quiescent period in which the metastatic

progression is not clinically detected (Yefenof et al., 1993). Studies suggested that Bcl-xL

shortens the dormancy of metastatic cells. Experiments with mice inj ected with cells

overexpressing Bcl-xL indicated that Bcl-xL has role in dormancy by promoting the survival of

cells in metastatic foci (Rubio et al., 2001). Pro-survival proteins, such as Bcl-xL, displace the

offset the balance between death and proliferation, shortening the period between dissemination

and the appearance of clinical metastasis (Karrison et al., 1999). Bcl-xL does not appear to

affect the actual movement of metastatic cells to foci because, breast cancer cells overexpressing

Bcl-xL reach target organs in similar numbers as the vector controls. Since the Bcl-xL tumors

developed more metastases than control cells, Bcl-xL may promote the survival of and harbor

metastatic cells at metastatic foci (Rubio et al., 2001) allowing the metastatic cells to adapt to

changes in their cellular environment (Fernandez et al., 2002; Li et al., 2002).

The loss of apoptosis is also instrumental in accumulating genomic damage. The

extended lifespan of cells overexpressing Bcl-xL allows for more genetic mutations. This is

evident in that the loss of apoptosis in breast carcinoma is more frequent in tumors with

microsatellite instability (MSI) (Mendez et al., 2001) and leads to the appearance of variants with

malignant potential such as survival at metastatic foci (Zhivotovsky and Kroemer, 2004). It has

been proposed that genetic instability correlates with anti-apoptotic proteins, such as Bcl-xL, that

are involved in the selection of highly metastatic cells during tumorigenesis. Therefore the

accumulation of genetic alternations caused by the deregulation of Bcl-xL in breast cancer are

essential to metastasis (Mendez et al., 2005). These studies suggests that the primary role of









Bcl-xL in the breast cancer metastasis is allowing for the accumulation of genetic mutations and

alterations, decreasing tumor cell dormancy, and providing a mechanism for which metastatic

cells can adapt to new microenvironments (Fernandez et al., 2002).

Bcl-xL and chemotherapy resistance. The molecular mechanisms responsible for

chemoresistance are unclear. One mechanism involves altering the expression of anti-apoptotic

proteins such as Bcl-xL because many chemotherapy drugs kill tumor cells by inducing

apoptosis (Barry et al., 1990; Kaufmann, 1989). Cells expressing Bcl-xL are more likely to be

chemo-and radiotherapy-resi stant (Cherbonnel-Lasserre et al., 1996; Simonian et al., 1997). The

role of Bcl-xL in chemotherapy resistance overlaps it role in metastatsis and is primarily the

survival and therefore subsequent adaptation of cancer cells to their new environments (Gu et al.,

2004). It has been suggested that chemotherapy treatment selects for tumor clones that

overexpress Bcl-xL. This is evident because the staining intensity of such proteins increased

after chemotherapy of primary tumors (Campos et al., 1993; Castle et al., 1993; Maung et al.,

1994; Weller et al., 1995). Cancer cells overexpressing Bcl-xL are more easily selected for

resistance after drug treatment because of their lack of apoptosis (Fernandez et al., 2000).

Additionally, Bcl-xL increases genetic instability in cells that can result in phenotypes that are

more adaptive than others (Gu et al., 2004). Resistant to chemotherapy in SCC 25 squamous

carcinoma cells in vitro is associated with Bcl-xL expression (Datta et al., 1995). Animal studies

indicated that Bcl-xL promoted chemotherapy resistance in mouse models. The tumors caused

by SCK mammary cells transfected with Bcl-xL are resistant to apoptosis induced by

chemotherapeutic agents, methotrexate and 5-fluorouracil. The protein may function in a similar

fashion in human cells the overexpress Bcl-xL (Liu et al., 1999). The role of Bcl-xL in organ









specificity and overcoming dormancy (Rubio et al., 2001) indicates that it may be a hallmark of

metastasis and contributes to therapy resistance in doing so (Gu et al., 2004).

The CCAAT/Enhancer Binding Protein (C/EBP) Family

The CCAAT/enhancer-binding protein (C/EBP) family is a group of leucine zipper

transcription factors that plays roles in the differentiation of adipocytes, myeloid, and other cells,

metabolism, inflammation, proliferation, and other cellular functions (Ramji and Foka, 2002).

Each family member is composed of divergent (<20% homology) amino-terminal region, and a

conserved carboxy-terminal domain. This carboxy-terminal region consists of a basic DNA-

binding domain followed by a-helical leucine zipper region which is involved in dimerization

(Lekstrom-Himes and Xanthopoulos, 1998; Ramji and Foka, 2002). The specificity ofDNA-

binding is dictated by the amino acids in the basic region (Johnson, 1993) and dimerization is

required for DNA-binding (Landschulz et al., 1989). Dimers bind DNA at the sequence

A/G TTGCG C/T AA C/T (Johnson, 1993; Osada et al., 1996; Vinson et al., 1989), as an

inverted Y, each arm a single a-helix that binds one half of the palindromic sequence in the DNA

maj or groove like a pair of scissors (Tahirov et al., 2001; Tahirov et al., 2002).

Three C/EBP proteins are expressed in mammary tissue: C/EBPa, C/EBPP, and C/EBPS

(Gigliotti and DeWille, 1998; Sabatakos et al., 1998) and have been studied extensively (Osada

et al., 1996). C/EBPa is expressed in but is not required for the normal development of the

mammary gland (Seagroves et al., 1998). The expression of C/EBPa causes growth Go-G1 cell

cycle arrest and inhibits mammary cell proliferation (Gery et al., 2005). In fact, the protein is

downregulated in and has been considered a potential tumor suppressor gene for breast cancer

(Gery et al., 2005). C/EBPS functions in the maintenance of mammary epithelial cells (Gigliotti

et al., 2003). The protein functions in cell cycle exit/Go entry and it inhibits mammary cell

growth in vitro (Gigliotti et al., 2003; O'Rourke et al., 1997; O'Rourke et al., 1999; Sivko and









DeWille, 2004). C/EBPS is tightly regulated during Go growth arrest of human mammary

epithelial cells which allows cells to quickly re-enter cell cycle and proliferate upon growth

factor stimulation (Sivko and DeWille, 2004). C/EBPS is also down-regulated in breast cancer;

with the progression from normal mammary epithelium to breast carcinoma (Porter et al., 2003).

Both C/EBPa and C/EBPS are correlated with cell-cycle inhibitory proteins, Rb, p27, and pl6

(Milde-Langosch et al., 2003).

C/EBPP protein

Human C/EBPP (NF-16G) was identified as a protein with high DNA-binding homology

to rat C/EBP[a] (Landschulz et al., 1988a; Landschulz et al., 1988b) that mediated IL-6 signaling

by binding to IL-6 responsive elements on the tumor necrosis factor (TNF), interleukin-8 (IL-8),

and granulocyte colony-stimulating factor (G-CSF) promoters (Akira et al., 1990; Poli et al.,

1990). Homologues have been found in other species including: IL6-DBP (Poli et al., 1990),

LAP (Descombes et al., 1990), AGP/EBP (Chang et al., 1990), CRP2 (Williams et al., 1991),

and NF-M (Kowenz-Leutz et al., 1994). Later, a Greek letter notation was coined for each

C/EBP protein (a, P, y, 6, E, Q) (Cao et al., 1991).

C/EBPP protein function

C/EBPP differs from other C/EBP members in that it promotes the proliferation and

represses the differentiation of many cell types (Lekstrom-Himes and Xanthopoulos, 1998).

Knockout mice have been used to determine the biological functions of the protein. The primary

defects occur in several different categories: the immune system (Screpanti et al., 1995; Tanaka

et al., 1995), adipocyte differentiation (Tanaka et al., 1997), liver function (Croniger et al., 1997;

Greenbaum et al., 1998), and female fertility (Sterneck et al., 1997). C/EBPP knockout mice

also displayed defects in mammary development (Milde-Langosch et al., 2003). Glandular

development was impaired in virgin, pregnant, and lactating C/EBP-deficient mice (Robinson et









al., 1998). Functional markers of murine mammary gland differentiation, where low or absent in

these mice and they displayed dysfunctional differentiation of secretary epithelium, even in

response to lactation specific hormones (Seagroves et al., 1998). Impaired mammary glands had

delayed growth, enlarged ducts, and decreased branching. The defects seen in these mice were

intrinsic to the epithelial cells because the lack of C/EBPP in the stroma did not affect ductal

elongation and branching during puberty or alveolar development during pregnancy (Grimm and

Rosen, 2003). The protein acts as the mediator of mammary cell fate by influencing hormonal

receptors such as progesterone receptor (PR) (Seagroves et al., 2000). Additionally, C/EBPP is

required for ductal morphogenesis, lobuloalveolar development, and functional differentiation of

murine mammary epithelial cells and for the proper proliferation and morphogenic responses

during mammary gland maturation and for differentiation of milk-producing secretary cells

during pregnancy (Robinson et al., 1998). These studies emerge C/EBPP as a critical component

in the control of mammary epithelial cell proliferation and differentiation and the in hormonal

signaling cascades responsible for the healthy, fully developed, and lactating mammary gland

(Robinson et al., 1998).

C/EBPP protein isoforms

The cebpb gene consists of single exon gene with no introns and the transcription of the

gene results in a single 1.4 kb mRNA (Zahnow, 2002). Three C/EBPP protein isoforms are

generated post-transcriptitionally : LAP1, LAP2, and LIP (Figure 1-3) through a leaky ribosome

scanning mechanism that uses alternative translation initiation start sites (Descombes and

Schibler, 1991; Ossipow et al., 1993). LIP has also been hypothesized to result from the

proteolytic cleavage of other C/EBPP isoforms (Baer and Johnson, 2000; Dearth et al., 2001;

Welm et al., 1999)









LAPI (liver-enriched activation protein 1), also called LAP*, is the full-length isoform.

The protein is 38 kDa in mice (Calkhoven et al., 2000; Williams et al., 1995) and 45 kDa in

humans (Eaton et al., 2001). Human LAPI represses the cyclin Dl promoter and is proposed to

regulate transcription of genes in non-proliferating or differentiating cells (Eaton et al., 2001).

LAPI1 is detected in the normal mammary glands of mice (Dearth et al., 2001; Eaton et al.,

2001). In humans, the protein is detectable in normal, mostly non-dividing human breast tissue

and in secretary mammary epithelial cells exfoliated in human breast milk (Eaton et al., 2001;

Milde-Langosch et al., 2003).

Human LAP2 (liver-enriched activation protein 2), also called LAP, differs from human

LAPI by 23 amino acids in humans, and 21 amino acids in mouse, rat, and chicken (Kowenz-

Leutz et al., 1994; Williams et al., 1995). The protein is 32 kDa-35 kDa in rodents (Calkhoven et

al., 2000; Descombes et al., 1990) and 42 kDa in humans (Eaton et al., 2001). It is the most

transcriptionally active form of C/EBP (Williams et al., 1995) and promotes cell proliferation,

motility, and invasion (Bundy and Sealy, 2003). The growth-promoting functions of C/EBPP are

carried out in large by LAP2. Human LAP2 activates cyclin Dl promoter and has been proposed

to promote epithelial cell growth (Eaton et al., 2001). LAP2 is expressed throughout rodent

mammary development; two-three fold during pregnancy, decreases at parturition, but is still

readily detectable through lactation and involution and modestly decreased at lactation (Raught

et al., 1995; Seagroves et al., 1998). In humans, LAP2 is expressed in normal and malignant

breast tissue (Eaton et al., 2001; Milde-Langosch et al., 2003).

LIP (liver-enriched inhibitory protein) lacks a 49 amino acid portion of its amino-

terminal transactivation domain but retains the dimerization and DNA-binding domains.

Therefore it can antagonize the transcriptional activation of the LAP isoforms, C/EBP proteins,









and other leucine zipper proteins. It does so by forming heterodimers with target proteins,

resulting in C/EBP protein dimers unable to transactivate target promoters, or it binds C/EBP

sites on target promoters with a greater affinity, competing with functional C/EBP dimers

(Descombes and Schibler, 1991). LIP is 20 kDa in rodents (Calkhoven et al., 2000; Descombes

and Schibler, 1991) and humans (Eaton et al., 2001). Its expression is associated with rapid

mammary epithelial cell proliferation and it inhibits cell differentiation (Raught et al., 1995).

LIP isn't detectable in virgin rat mammary gland (Seagroves et al., 1998) but it increases 100

times during pregnancy which coincides with increased alveolar cell proliferation during this

time. LIP expression is nearly undetectable at parturition and remains low throughout lactation

and involution (Dearth et al., 2001; Raught et al., 1995; Seagroves et al., 1998).

The ratios of LAP/LIP are an important determinant of C/EBPP function (Seagroves et

al., 1998) and critical in mediating the expression of C/EBPP target genes (Descombes and

Schibler, 1991). These ratios rather than the absolute amounts of each isoform are an important

indication of transcriptionally activity of C/EBPP (Zahnow et al., 2001) and have a dramatic

effect on mammary gland development. Several lines of evidence indicate that C/EBPP-

expressing cells exhibit unique LAP/LIP ratios, depending on cell type and that C/EBP does not

always function in a positive manner when the expression of LIP exceeds negligible levels

(Shimizu et al., 2007).

Several mechanisms have been described for the differential expression of C/EBPP

isoforms. It is hypothesized that the LAPI and LAP2 translation start sites and a small uORF are

embedded within a stem loop structure on the C/EBPP mRNA and that both play an important

roles in the regulation of AUG recognition and isoform translation (Raught et al., 1996; Xiong et

al., 2001). The mRNA binding protein, CUG repeat binding protein (CUG-BPl) (Baldwin et al.,









2004; Timchenko et al., 1999), calreticulin (Timchenko et al., 2002), and eukaryotic translation

initiation factors, elF-2a and elF-4E (Calkhoven et al., 2000) bind cebpb mRNA and direct

isoform translation. elF2 plays a role in translation start site recognition (Donahue et al., 1988)

and catalyzes the binding of Met-tRNA to the 40S ribosomal subunit (Schreier and Stachelin,

1973) while elF4E recognizes the 5' mRNA cap as the first step in ribosomal scanning (Pause et

al., 1994).

C/EBPP and Breast Cancer

C/EBPP mRNA is present in murine virgin mammary glands. It increases during

pregnancy, declines at mid-lactation, and increases again within 48 hours of involution (Gigliotti

and DeWille, 1998). In situ localization studies in the mouse mammary gland have identified the

localization of C/EBPP mRNA in vivo. In humans, C/EBPP mRNA is present in low levels in

virgin mammary gland, increases during pregnancy, declines slightly during lactation, and is

induced 24-28 hours after the onset of involution (Gigliotti and DeWille, 1998; Robinson et al.,

1998; Sabatakos et al., 1998).

C/EBPP plays a role in rodent breast carcinogenesis (Zahnow, 2002). Mice

overexpressing the gene in the mammary gland develop hyperplasia and carcinoma (Wang et al.,

1994). C/EBPP probably contributes to tumorigenesis by increases in mRNA and protein levels

rather than somatic mutations (Grimm and Rosen, 2003). Studies indicate that C/EBP proteins

may also be involved in the etiology or progression of human mammary carcinomas, however,

sparse information has been acquired so far (Milde-Langosch et al., 2003; Zahnow, 2002).

Studies have indicated that the protein has a role in human breast carcinogenesis (Raught et al.,

1996; Zahnow et al., 1997). C/EBPP mRNA was two-five fold higher in MMTV/c-neu

mammary tumors than the levels normally expressed during lactation or involution (Dearth et al.,

2001).









Since all C/EBPP isoforms originate from a single mRNA, protein levels of each isoform

provide a more accurate depiction of the role of C/EBPP in breast carcinogenesis. Changes in

the ratios of C/EBPP isoforms LAP/LIP have been observed in breast cancer (Eaton et al., 2001;

Zahnow et al., 1997). Each C/EBPP isoform can contribute to breast carcinogenesis separately.

LAPI1 is expressed in normal breast epithelial cells and tissue from rodents and humans (Dearth

et al., 2001; Eaton et al., 2001), so it plays few if any roles in breast carcinogenesis. LAP2 is

expressed in infiltrating ductal carcinoma extracts (Zahnow et al., 1997), is acquired in primary

human breast tumors, and is present in cultured breast cancer cell lines (Eaton et al., 2001). It

was expressed at high levels of invasive primary breast tumor samples and was the only

transactivator isoform expressed in breast cancer cell lines (Eaton et al., 2001). LAP2 was also

associated with advanced stages and increased proliferation in human breast tumors (Milde-

Langosch et al., 2003). LAPI and LAP2 functions differ and the altering of the ratio between the

two isoforms may contribute to the transformation of human breast epithelial cells (Bundy and

Sealy, 2003).

The expression of LIP is tightly regulated during mouse mammary gland development

and breast cancer progression (Raught et al., 1996; Zahnow et al., 1997). The LIP isoform was

detected in 10 different rat tumor lines and its expression was restricted to mammary tumors and

not detectable in pre-neoplastic lesions or other primary tumors (Raught et al., 1996; Sundfeldt et

al., 1999). Generally, LIP is increased in more proliferative tumors or developmental time points

and is highly expressed in the most aggressive, poorly differentiated human cancers (Raught et

al., 1996; Zahnow et al., 1997). Overexpression of LIP in mouse mammary epithelial cells

increased proliferation, foci formation, and loss of contact inhibition. It has been suggested that

LIP overexpression stimulates a growth cascade that makes cells susceptible to additional










oncogenic hits, resulting in tumorigenesis (Zahnow et al., 2001). LIP was correlated with ER-

negative phenotypes and increased proliferation (Milde-Langosch et al., 2003). In fact, one

study suggested that LIP expression should be evaluated further as a prognostic marker for

human breast cancer (Zahnow et al., 1997).

The role of LIP in breast carcinogenesis is controversial. There was no significant level

of LIP detected in high grade infiltrating mammary carcinomas (Eaton et al., 2001) and LIP

overexpression in the non-transformed mouse mammary epithelial cell line, HC11, did not

significantly affect cell proliferation or cell cycle progression (Dearth et al., 2001).

The overexpression of LIP in NIH3T3 cells lead to cell death (Eaton et al., 2001) and strongly

inhibited growth in MCF 10A cells (Bundy et al., 2005). Its role may also be concentration

dependent. Moderate LIP expression in mouse mammary epithelial cells (SCp2) promoted

luminal morphogenesis, while increased LIP expression induced apoptosis (Hirai et al., 2001).

The fact that LIP may result from cleavage in addition to de novo translation (Baer and Johnson,

2000; Dearth et al., 2001; Welm et al., 1999), also makes it difficult to determine its role in

carcinogenesis (Welm et al., 1999). Together, these studies indicate that more research is needed

to determine the role of the LIP isoform in breast tumorigenesis.









Table 1-1. Carcinogens Present in Cigarette Smoke. A partial list of these carcinogens is below.
The IARC group reflects the likelihood of human carcinogenicity: (1) human
carcinogen; (2A) probably carcinogenic to humans; (2B) possibly carcinogenic to
humans; (3) not classifiable as to their carcinogenicity to humans. Classifications
reflect data up to 2004 (International Agency for Research on Cancer, 2004). Table is
adapted with permission from Macmillian Publishers for Hecht, 2003. (*) Adapted
with permission from The American Chemical Society for Hoffman et al., 2001. (**)
Adapted with permission from Springer Science and Business Media for Hecht, 2006.
IARC
group*
Chemical class Examples* *
Aldehydes Formaldehyde 1
Acetadehyde 2B
Aromatic amines 4-Aminobiphenyl 1
2-Naphthylamine 1
Inorganic compounds Arsenic 1
Lead 2B
Polycyclic hydrocarbons
(PAHs) Benzo(a)pyrene (B[a]P) 1
Dib enzo(a,h)anthracene 2A
Phenols Caffeic acid 2B
Catechol 2B
4(methylnitrosamine)-1l-(3-pyridyl)-1 -butanone
Nitroamines (NNK) 1
N-nitrosonornicotine (NNN) 1
Volatile hydrocarbons Benzene 1
Styrene 2B











Continuous Metabolic Persistant Loss of growth
cigarette smokm civto msomg Mtton naopttctrol mechanisms
Nlrcome Addmon II Carcinogens a NAdducts genes, oncogenes, aCne


Metabolic* DNA*
detoxif ication reptrr



Excretion Normal DNA Apoptosis*


Figure 1-1. Mechanism of cigarette smoke-induced cancer. Nicotine addition causes continual
cigarette smoking and chronic exposure to cigarette related carcinogens. Most of
these carcinogens are either metabolically detoxified and excreted out of the body or
activated. The carcinogens that are metabolically activated form intermediates that
bind to DNA and cause adducts. If the adducts are not repaired and persist during
DNA replication, miscoding and permanent mutations can occur in the DNA.
Damaged cells may be removed by apoptosis. However, if a mutation occurs in an
oncogene or tumor suppressor, there could be a loss of normal cell growth control.
Inactivation of apoptosis genes or upregulation of anti-apoptotic genes allows the
DNA damage to persist and may result in abnormal gene expression. Loss of cell
cycle control, cell transformation, and eventually tumorigenesis can result. Asterisks
(*) represent the body's endogenous defense systems. Adapted with permission from
Oxford University Press for Hecht, 1999.
















r+


I I BH I TM

I E I TM I I


I I BH I


bd -xl splicmg







I Bcl-xL, bcl-xs splicing


Exon I


Exon II


set-xs

Bcl-xp


Figure 1-2. Human bcl-x gene structure and proteins. (A) Bcl-x gene structure is composed of
three exons. Exon I is non-coding, while exon II and exon III code for bcl-x mRNAs.
The bcl-xl promoter is located 5' of Exon I. (B) Human bcl-x mRNAs. Bcl-x pre-
mRNA is alternatively spliced into three different mRNAs, each coding for a single
protein. Bcl-xL is anti-apoptotic, while Bcl-xS is pro-apoptotic and lacks the BH
domain (BH) due to an alternative splicing site in Exon II. Bcl-xp results from
unspliced mRNA and lacks the transmembrane domain. Its role in apoptosis remains
unclear. The isoforms share several domains. The BH Domain (BH) is the 63 amino
acid region containing BH1 and BH2 domains, having the most homology to Bcl-2.
The transmembrane domain (TM) is responsible for mitochondrial localization.
Adapted with permission from the American Society for Biochemistry and Molecular
Biology for Pecci et al., 2001.















LAPI
AUG


LAP2
AUG


5' 3'


Tra~nsactivtion DNA Zipper LAPI

Transactavation DNdA Zipper I M~

| |_DINA_|Zipper LUp


Figure 1-3. Human C/EBPP mRNA structure and protein isoforms. (A) C/EBPP mRNA
contains three translation initiation sites (AUGs) from which isoforms are translated.
The 5' end contains a RNA hairpin region. Between the LAPI and LAP2 AUGs,
there is an AUG associated with a small open reading frame (sORF), which are
important for the translational control of C/EBPP isoforms. (B) The mRNA is
alternatively translated into three different isoforms by a leaky ribosome scanning
mechanism. LAPI and LAP2 differ by only 21 amino acids. LIP is considerably
shorter and lacks the transactivation domain. It retains the dimerization and leucine
zipper domains, therefore it acts as a dominant negative to LAPI and LAP2 protein
function. LIP also results from the proteolytic cleavage of the other LAP isoforms.
Adapted from Zahnow, 2002.









CHAPTER 2
MATERIALS AND METHODS

Preparation of CSC

CSC was prepared from the University of Kentucky Reference Cigarette IR4F (Davis,

1984; Sullivan, 1984) which contains 9 mg tar and 0.8 mg nicotine per cigarette and

approximates the average full flavor, low-tar cigarette available on the American market

(Chepiga et al., 2000). The CSC was prepared by a procedure previously described (Hsu et al.,

1991). In short, the particulate phase (tar) was collected on a Cambridge filter pad from

cigarettes smoked under standard Federal Trade Commission conditions (3 5 mL puff volume of

a 2 sec duration) on a specialized machine (Griffith and Hancock, 1985). The particulate matter

was dissolved in dimethyl sulfoxide (DMSO) to a stock concentration of 40 mg/mL, aliquoted

into vials, and stored at -800C. For treatment, the stock solutions were diluted to the appropriate

concentrations in complete medium.

Culturing of MCF10A Cells

MCF 10A cells were maintained in lX Dulbecco' s modification of Eagle's

medium/Ham' s Fl2 (DMEM/Fl2) 50/50 Mix with L-glutamine and 15 mM Hepes (MediaTech,

Inc., Manassas, VA). This medium was supplemented with 5% horse serum, 100U/mL

penicillin/streptomycin, 0.5 Clg/mL hydrocortisone, 100 ng/mL cholera toxin, 10 Clg/mL insulin,

and 10 ng/mL epidermal growth factor. The cells were incubated in a 5% CO2 incubator at

370C.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

RNA was isolated with TRIzol reagent (Invitrogen Corp., Carlsbad, CA) as per

manufacturer instructions. Cells were seeded on 60 mm tissue culture plates and treated at 50-

60% confluency. At the appropriate times, the plates were rinsed with cold lX Dulbecco's









phosphate buffered saline (DPBS) (MediaTech, Inc., Manassas, VA), three milliliters of TRlzol

were added directly into each plate and the plates were rotated for 15-20 min until the cells

detached. The TRlzol-cell solution was pipetted from each plate into a round bottom Falcon

tube (BD Biosciences Pharmingen, Mississauga, ON), 700 Cll of chloroform was added, and the

tubes were incubated for 15 min, shaking every 2 min. The tubes were centrifuged at 10,000

rpm at 40C for 20 min. The upper aqueous phase was removed into a fresh tube, 1.8 mL

isopropanol was added, and the tubes were incubated at room temperature for 10 min with

intermittent mixing. After centrifugation at 10,000 rpm for 20 min at 40C, the supernatant was

carefully removed, leaving the pellet. The pellet was washed with 700 Cll of 75% ethanol in

diethylpyrocarbonate (DEPC) water; after a final centrifugation, the alcohol was removed, and

the pellet was resuspended in 10-20 Cll DEPC water. The samples were incubated at 650C for 10

min, allowed to cool, quantitated, and stored at 800C until use. All procedures were performed

with RNAse free tubes and equipment.

The isolated RNA (0.5 Cpg) was used to make cDNA with the Super Script First Strand

Synthesis System for RT-PCR (Invitrogen Corp., Carlsbad, CA) as per manufacturer

instructions. Two microliters of cDNA was then used for PCR with primers specific for Bcl-xL

(800 bp) or GAPDH (320 bp). The primers used were Bcl-xL sense: 5'- TTGGACAATGGAC

TGGTTGA-3', Bcl-xL antisense: 5' -GTAGAGTGGATGGTCAGTG-3 and GAPDH sense: 5'-

GGGAAGCCACTGGCATGGCCTTCC-3 ', GAPDH antisense: 5'- CATGTGGGCCATGAG

GTCCACCAC-3'. The PCR cycles were: 1 cycle of 940C for 2 min; 35 cycles of 940C for 20

sec, 580C for 30 sec, 720C for 1 min; and a 40C hold.









Western Blot Analysis

MCF 10A cells were plated on 150 mm plates and treated at 50-60% confluency with

CSC as described in the figure legends. After treatment the cells were processed into whole cell

extract. Cells were scraped into 50 mL conical tubes and pelleted at 1,500 rpm for 5 minutes at

40C. Pellets were rinsed with lX DPBS (Mediatech, Herndon, VA) and resuspended in 100-500

Cll lysis buffer (20 mM Tris pH 7.4, 100 mM NaC1, 1 mM PMSF, 0.5% deosycholate, 1% NP 40,

1% SDS, 1.2 mM EDTA, 1 mM EGTA, 2 mM DTT, 1 mM sodium methavandate, 50 mM NaFl,

1 Clg each of aproptin, leupeptin, pepstatin). The cells were rotated for 20 min at 40C and then

centrifuged at 13,200 for 10 min at 40C. The supernatant was removed into a fresh tube and used

for Western analysis. Lysates were prepared for electrophoresis with lysis buffer and 6X

Western dye to a final concentration of lX dye, and then boiled for 5 min. After cooling and a

brief centrifugation, proteins were separated on a 10% SDS-PAGE gel and electroblotted onto a

Hybond-P PVDF membrane (Amersham Biosciences, Piscataway, NJ). The blots were blocked

with 5% milk in Tris buffered saline -1% Tween (TBS-T). The blots were then probed with the

appropriate antibodies diluted in 2.5% milk in TBS-T. The blots were incubated, rocking, at

room temperature for 2 h for primary antibodies and 1 h for secondary antibodies. The

antibodies used were: anti-Bcl-xL (sc-1041), and anti-C/EBPP (sc-150), both from Santa Cruz

Biotechnology, Inc. (Santa Cruz, CA). Blots were rinsed between antibodies with three washes

of TBS-T, 10 min each. ECL Plus Western Blotting Detection System (Ambersham

Biosciences, Piscataway, NJ) and autoradiography were used to detect protein levels. Blots were

stripped at 650C for 30 min to 1 h, shaking every 10-15 min. The stripped blots were rinsed with

TBS-T, blocked again, and re-probed with the anti-Actin (sc-1616) antibody (Santa Cruz

Biotechnology, Inc., Santa Cruz, CA) for the loading control









Cloning of the Human Bcl-xl Promoter (pBcl-xLP)

The human bcl-xl promoter was previously cloned and sequenced in my lab. Using

primers modelled from Sevilla et al., (1999), nucleotides 226-915 from the published human

bcl-xl promoter (Gene Bank Accession No. D30746) were cloned into a PGL-3 Basic Luciferase

Vector (Promega Corp., Madison, WI) at XSbol and HindlII restriction enzyme sites. The

promoter cis-elements were determined with the TRANSFEC v4.0 Program (TESS:

Transcription Element Search System, University of Pennsylvania) and two transcription

initiation sites were identified.

Cloning of pBcl-xLP Deletion Constructs

PCR was used to make nine sequential deletion pBcl-xLP constructs. The full-length

pBcl-xLP (-54,+647) was used as template for PCR with specific primers that amplified the

appropriate regions resulting in the deletion constructs. The primers were pBcl-xLP (-28,+707)

sense: 5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3', pBcl-xLP (-28,+707) anti-sense:

5'-CCCAAGCTTGTCCAAAACACCTGCTCA-3'; pBcl-xLP (-28,+542) sense: 5'-CCGCTCG

AGCCACCTCCGGGAGAGTACTC-3', pBcl-xLP (-28,+542) anti-sense: 5'-CCCAAGCTTCC

AGAACTGGTTTCTTTGTGG-3'; pBcl-xLP (-28,+462): sense 5'-CCGCTCGAGCCACCTCC

GGGAGAGTACTC-3', pBcl-xLP (-28,+462) anti-sense: 5'-CCCAAGCTTCCAGTGGACTC

TGAATCTCCC-3'; pBcl-xLP (-28,+375) sense: 5'-CCGCTCGAGCCACCTCCGGGAGAGT

ACTC-3', pBcl-xLP (-28,+375) anti-sense: 5'-CCCAAGCTTCCCCCGCCCCCACTCCCGCT

C-3'; pBcl-xLP (-28,+342): sense 5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3',

pBcl-xLP (-28,+342) anti-sense: 5'-CCCAAGCTTTACATTCAAATCCGCCTTAG-3';

pBcl-xLP (-28,+282) sense: 5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3', pBcl-xLP

(-28,+282) anti-sense: 5'-CCCAAGCTTTCACAGGTCGGAGAGGAGG-3'; pBcl-xLP

(-28,+222) sense: 5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3', pBcl-xLP (-28,+222)









anti-sense: 5'-CCCAAGCTTGCTGGCAAAAAAACCAGCTC-3'; pBcl-xLP (-28,+132) sense:

5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3', pBcl-xLP (-28,+132) anti-sense: 5'-CC

AAGCTTAACCAGCCCCCTCGTTGCT-3 '; pBcl-xLP (-28,+42): sense: 5'-CCGCTCGAGCC

ACCTCCGGGAGAGTACTC-3', pBcl-xLP (-28,+42) anti-sense: 5'-CCCAAGCTTCCCCTCT

CTTGCACGCCC-3'. The PCR cycles were: 1 cycle of 940C for 3 min; 32 cycles of 940C for 1

min, 550C for 1 min, 720C for 3 min; 1 cycle of 720C for 10 min; and 40C hold. The PCR

products were gel extracted with the QIAXEXII Gel Extraction Kit (Qiagen, Inc., Valencia, CA)

as per manufacturer instructions. Samples and empty PGL-3 vector were digested with )A~ol and

HindlII for 4 h. Digested products were ligated into the digested vector overnight at 160C using

T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA). The ligation products were

transformed into Max Efficiency DH~a Chemically Competent cells (Invitrogen Life

Technologies, Carlsbad, CA) according to package instructions and spread on Ampicillin-Luria

Broth (LB) plates. Colonies were screened for the correct insert with the QIAprep Spin

Miniprep Kit (Qiagen, Inc., Valencia, CA) as per manufacturer instructions. The isolated DNA

was digested with Xhol and HindlII to confirm the presence of the correct insert. The constructs

were sent for sequencing and upon confirmation, were further amplified with the QIAGEN

Plasmid Maxi Kit (Qiagen, Inc., Valencia, CA). The resulting DNA was used in transfection

assays.

Promoter Activity Assays

Approximately 0.5 million cells were seeded on 60 mm tissue culture plates. Bcl-xl

promoter constructs (pBcl-xLPs) were transfected into cells with FuGENE 6 Transfection

Reagent (Roche Applied Bioscience, Indianapolis, IN) as per manufacturer instructions. Nine

microliters of FuGENE 6.0, 2 Cll of the appropriate promoter construct, 0.5 Clg pCMV

P-galactosidase plasmid, and 100 Cll serum free medium (SFM) were mixed for each plate. The









solution was incubated for 30 min at room temperature. During this time, the plates to be

transfected were rinsed with SFM. After incubation, an additional 1.9 mL SFM was added to the

DNA solution for each plate. The DNA-lipid solution was mixed well and 2 mL was added to

each transfection plate (after SFM rinse was removed). Five hours later, the DNA-lipid solution

was removed from the cells and 4 mL of fresh medium was added. Sixteen hours later, the cells

were treated and harvested at the appropriate time points.

At the appropriate time points, cells were scraped into 15 mL conical tubes and pelleted

at 1,500 rpm for 5 min at 40C. Pellets were rinsed with lX DPBS (Mediatech, Herndon, VA)

and resuspended in 50-100 Cll lX reporter lysis buffer, depending on the size of the pellet. The

lX reporter lysis buffer was diluted from 5X Reporter Lysis Buffer (Promega Corp., Madison,

WI). The samples were lysed with five freeze-thaw cycles of alternating liquid nitrogen and

370C water bath incubations for 5 min at a time. After each water bath incubation, the samples

were vortexed to ensure proper lysing. The samples were then centrifuged at 13,200 rpm for 10

min at 40C. The supernatant was removed to a fresh tube and used for promoter activity

analysis.

The pBcl-xLP promoter activity was measured with luciferase assays. Luciferase assay

reagent (20 mM tricine, 1.07 mM magnesium carbonate hydroxide, 2.67 mM magnesium sulfate,

0.1 mM EDTA) was used to prepare luciferase assay buffer (4 mL luciferase assay reagent, 470

CLM luciferin, 270 CLM coenzyme A, 530 CLM ATP, 33.3 mM DTT). All of the reagents for the

luciferase assay buffer were purchased from Sigma-Aldrich (St. Louis, MO). The assay was

performed with a Monolight 3010 Luminometer (BD Biosciences Pharmingen, Mississauga,

ON). Ten milliliters of lysate were put into a Luminometer cuvette (BD Biosciences









Pharmingen, Mississauga, ON) and it was placed into the luminometer. The machine injected

100 Cll luciferase assay buffer and recorded the resulting luciferase activity.

P-galactosidase assays were performed in 96-well flat bottom tissue culture plates. In

each well, 10 Cll of lysate was incubated with 50 Cll double distilled water (DDW), 15 Cll 5X

Reporter Lysis Buffer (Promega Corp., Madison, WI), and 75 Cll 2X assay buffer (200 mM

sodium phosphate buffer pH 7.2, 2 mM MgCl2, 100 mM P-mercaptoethanol, 1.33 mg/mL

o-Nitrophenyl -B -D-gal actopyranosi de (ONPG)). Wells were mixed and incub ated at room

temperature for 5 min to 1 h to allow the yellow color to develop. The reactions were stopped

with 75 Cll IM sodium carbonate and the plates were read for absorbance with 490 nm

wavelength on a Vmax Kinetic Microplate Reader (Molecular Devices, Sunnyvale, CA). These

readings were divided into luciferase values to normalize for transfection efficiency.

Electrophoretic Mobility Shift Assay (EMSA)

Single-stranded oligonucleotides were annealed to produce double-stranded

oligonucleotides for EMSA analysis. For annealing, 25 Cpg of each oligonucleotide and its

compliment were combined with 10 Cl1 lM KCl to a total of 50 Cl~ DDW. The mixture was

heated at 900C for 10 min and then allowed to slowly cool to 250C. Double-stranded

oligonucleotides were diluted to 100 ng/Cl1. The oligonucleotides used were C/EBP site-I wild-

type sense: 5'-AAAAACAAACAACTAAA-3' C/EBP site-I wild-type anti-sense: 5'-

TTTAGTTGGTTTTTGTTT TT-3'; C/EBP site-I mutant sense: 5'-AAAAGGCCAAAC

TAAA-3'; C/EBP site-I mutant anti-sense 5' -TTTTAGTTTGGGCCCTTTTT-3 '; C/EBP site-II

wild-type sense: 5'-CCTGAGCTTCGCAATTCCTG-3 ', C/EBP site-II wild-type anti-sense: 5'-

CAGGAATTGCGAAGCTCAGG-3 '; C/EBP site-II mutant sense: 5'-CCTAGCCACAGC

ATTCCTG-3', C/EBP site-II mutant anti-sense 5' -CAGGAATGCTGAGGCTCAGG-3 '. The









underlined nucleotides are the core of the C/EBP consensus sequence and the bold nucleotides

were mutated.

Double-stranded oligonucleotides were end-labelled in reactions of 200 ng of

oligonucleotide, 4 Cll 10X T4 Polynucleotide Buffer (New England BioLabs, Inc., Ipswich, MA),

1 Cl~ T4 Polynucleotide Kinase (New England BioLabs, Inc., Ipswich, MA), and 5 Cl1 32P y-ATP

to a Einal volume of 40 CIl. The mixture was incubated at 370C for 30 min and purified through a

Sephadex G-50 DNA grade Nick Column (Amersham Biosciences, Piscataway, NJ). The

amount of radioactivity was measured with a LS 6500 Multipurpose Scintillation Counter

(Beckman Coulter, Fullerton, CA).

EMSA and super-shift analysis was performed with nuclear extracts prepared as

described in Shapiro et al. (1988). DNA-protein binding reactions were assembled to a Einal

volume of 20 Cll with 20 mM Hepes pH 7.9, 1 mM DTT, 5 mM MgCl2, 80 mM KC1, 10%

glycerol, 0.025% NP-40 and 0.5 Clg poly(dl.dC). After 10 min incubation at room temperature, 2

Cpg of nuclear extract was added. Three microliters of the appropriate 32P-labelled double-

stranded probe were added and incubated for another 20 min at room temperature. For

competition experiments, appropriate amounts of unlabelled probe were added after the addition

of poly(dl.dC) and incubated at room temperature for 10 min before the addition of the 32P-

labelled probe. To perform super-shift analysis the master mix consisted of 20 mM Hepes pH

7.9, 1 mM DTT, 5 mM MgCl2, 37.5 M KC1, 7.5% glycerol, and 1 Clg poly(dl.dC). Five

micrograms of nuclear extract and 4.5 Cl1 of 32P-labelled probe were added. Antibodies specific

to C/EBPa (sc-9314X), P (sc-150X), and 8(sc-636X) (Santa Cruz Biotechnology, Santa Cruz,

CA) proteins and formulated for use in EMSA and ChlP analysis were added to the reaction

mixture prior to the addition of 32P-labelled probe and incubated for 30 min. The reactions were









loaded on a nondenaturing 4% polyacrylamide gel Tris-borate-EDTA (TBE) which was pre-run

at 100 volt for at least 30 min. The samples were loaded (without dye) and run at 100 volts for

the first 15 min and 150 volts for a total of 1.5 hours with 0.5X TBE used as running buffer.

After the run was completed, the gel was transferred to filter paper and dried for 1.5 h at 800C.

The DNA-protein complexes were then visualized by autoradiography. Exposure times varied

from 2 h to 24 h.

Chromatin Immunoprecipitation (ChIP) Assay

ChlP analysis was carried out with the ChlP Assay Kit (Upstate Biotechnology, Lake

Placid, NY) as per manufacturer instructions. One million cells were seeded onto 100 mm tissue

culture plates and treated at appropriate times. The cells were fixed by adding 270 Cll of 37%

formaldehyde per 10 mL of cell media, and incubating for 10 min at 370C. The medium was

removed, the plates were rinsed with ice-cold lX DPB S (Mediatech, Herndon, VA) containing

protease inhibitors, scraped into fresh tubes, and lysed with SDS lysis buffer containing protease

inhibitors. The lysate was sonicated on ice for 4 cycles of 30 sec with 20 intervals using a

Branson Sonicator 450 (Branson Power Company, Danbury, CT) at a 5% duty cycle, 20%

constant maximal power, and with a control output of 5. The lysate was clarified, diluted, pre-

cleared, and immunoprecipitated with 2 Cpg antibody overnight at 40C. The antibody used was

anti-C/EBPP (sc-150X) (Santa Cruz Biotechnology, Santa Cruz, CA). The resulting complexes

were then rinsed, eluted, and heated to reverse the cross-linkages. DNA was isolated by

phenol/chloroform extraction and ethanol precipitation.

The isolated DNA was used in PCR reactions using primers specific to C/EBP site-II on

the pBcl-xLP. The primers were C/EBP site-II sense: 5'-CGGGTGGCAGGAGGCCGCGGC-3 '

and C/EB P site -II anti -sen se: 5'-AAC TCAGC CGGC CTC GCGGT G- 3', re sulti ng i n a 1 90 b p

product.









Site-directed Mutagenesis

The QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to

mutate two C/EBP sites on the pBcl-xLP construct, via manufacturer instructions. Primers

specific for the cis-element mutations were used to perform PCR. The primers were C/EBP site-

I sense: 5'-TGGTGCTTAAATAGAAAAAAGGGCCCAAAACTAAATCCT CA CC

C T-3', C/EBP site-I anti-sense: 5'-GGTGGCTGGTATGGATTTAGTTTTGGGCCCTTTTTCT

TTTTTCTATCTATTTAAGCACCA; C/EBP site-II sense: 5 '-AGCAAGCGAGGGGGCTGGT

TCCTGAGCCACAGCATTCCTGTGTCGCCTTCT -3', C/EBP site-II anti-sense: 5'-AGAAG

GCGACACAGGAATGCTGTGGCTCAGGAACCAGCCCCCTCGCT T-' The PCR

products were digested with DpnI to degrade template DNA. Digested products were

transformed into XL-1 Blue Supercompetent Cells (Strategene, La Jolla, CA) and spread onto

Ampicillin-LB agarose plates. The presence of the correct mutation was confirmed and

construct amplification was carried out as described earlier in this section.

Overexpression of C/EBPP

MCF 10A cells were plated at the density of 0.6 million cells per 60 mm plate and

allowed to attach overnight. The next day, 2 Cpg empty pCDNA3.1 vector, or either C/EBPP

overexpression construct was transfected into the cells with FuGENE 6.0 Transfection Reagent

(Roche Applied Bioscience, Indianapolis, IN) as previously described in this section. At the

scheduled times, plates were harvested for luciferase assays or whole cell extract as described

above.

Statistical Analysis

Experiments were averaged and appropriate statistics were performed. Significance was

calculated with T-tests and p-values below 0.05 were considered significant. Statistics were

performed with SigmaPlot 10.0 Software (SPSS Inc, Chicago, IL).









CHAPTER 3
CSC TREATMENT RESULTS INT THE TRANSCRIPTIONAL UPREGULATION OF
BCL-XL INT MCF 10A CELLS

Introduction

CSC is capable of transforming the spontaneously immortalized breast epithelial cell line,

MCF 10A in culture (Narayan et al., 2004). A single dose of CSC resulted in characteristics such

as anchorage-independent growth, colony formation, and increased expression ofNRP-1, a

marker of neoplastic progression (Stephenson et al., 2002). Additionally, these characteristics

remained stable in cell lines established from the treated cells, with no further CSC treatment.

These transformed cells were found to have elevated mRNA and protein levels of Bcl-xL versus

the control cells. Even though, most treated cells die, the transformed cells escaped cell cycle

arrest and survived due to the overexpression of anti-apoptotic genes such as bcl-xl (Narayan et

al., 2004). The anti-apoptotic role of Bcl-xL and its implication in cancer, lead to the

investigation of how the gene was regulated in response to CSC treatment in MCF 10A cells.

The hypothesis of this study is that the CSC-induced upregulation of Bcl-xL occurs by a

transcriptional mechanism. After CSC treatment, a transcription factors) binds the bcl-xl

promoter, induces its transcriptional activity, and results in the increase of Bcl-xL protein levels.

Results

CSC Treatment Induces Bcl-xl mRNA and Protein Levels in MCF10A Cells

The previous study suggested that CSC-induced Bcl-xL expression in MCF 10A cells was

mediated by an increase in bcl-xl mRNA (Narayan et al., 2004). To confirm this finding,

MCF 10A cells were treated with increasing amounts of CSC for 24 h and bcl-xl mRNA levels

were analyzed with RT-PCR (Figure 3-1A). It is interesting to note the initial decrease in bcl-xl

mRNA levels at 2.5 Cpg/mL of CSC treatment; then the levels continued to increase in a

concentration-dependent manner. At 50 Cpg/mL of CSC treatment, the bcl-xl mRNA level was










higher than the level in the control cells. To confirm the subsequent induction of Bcl-xL protein

levels, cells were treated with 25 Cpg/mL of CSC for a time course and with increasing

concentrations of CSC for 24 h for a concentration curve. Western analysis was used to

determine the protein levels in these cells. The time course and concentration curve confirmed

the upregulation of Bcl-xL protein levels in a time and concentration-dependent manner (Figure

1-3B). These results confirmed that CSC induced bcl-xl mRNA and protein levels in treated

MCF 10A cells and that the mechanism of Bcl-xL upregulation in these cells was on the level of

transcription.

CSC Induces pBel-xLP Promoter Activity in MCF10A cells

One of the most important mechanisms of gene regulation is transcriptional (Weis and

Reinberg, 1992). To determine the how bcl-xl was induced by CSC, the human bcl-xl gene

promoter (Grillot et al., 1997; Sevilla et al., 1999) was cloned into a pGL-3 Basic Luciferase

vector as described in Materials and Methods and was named pBcl-xLP. In the first step, it was

determined which transcription factors) were responsible for the upregulation of bcl-xl in CSC-

treated MCF 10A cells. Transcription initiation sites were identified at +1 and +78 and putative

cis-regulatory elements on the pBcl-xLP were identified (Figure 3-2). The pBcl-xLP promoter

had consensus sites for several transcription factors that were reported in earlier studies, such as

NF-KB, Octl, Sp proteins, GATA, STAT, and others (Grillot et al., 1997; Sevilla et al., 1999).

The first promoter cloned was pBcl-xLP (-54,+647) according to its length, but further studies

indicated that cis-elements were located upstream of this first construct. At this point, the second

promoter construct, pBcl-xLP (-145,+707), was made.

To determine whether bcl-xl promoter activity was induced by CSC treatment in

MCF 10A cells, the two promoter constructs were separately transfected into MCF 10A cells and

treated with CSC for time course and concentration curve experiments. The pBcl-xLP










(-145,+707) had no significant promoter activity (data not shown). Alternatively, pBcl-xLP

(-54,+647) showed a time dependent and concentration dependent increase in activity after CSC

treatment (Figure 3-3). Therefore pBcl-xLP (-54,+647) construct was identified as the basal

promoter sequence and became our full-length promoter. It will be referred to as pBcl-xLP from

this point forward. This experiment indicated the optimum treatment conditions for the

induction of pBcl-xLP in these cells. During the concentration curve the promoter activity

peaked at 24 h of treatment (Figure 3-3A). The highest level of promoter activity induced in the

concentration curve after treatment with 50 Cpg/mL of CSC (Figure 3-3B). However, at such a

high concentration most of the cells have died. A concentration of 25 Cpg/mL of CSC was used

for the rest of the experiments because it represented a more common treatment concentration

and resulted in less cell toxicity and death. Other studies found similar results (Nagaraj et al.,

2006). These studies confirmed that pBcl-xLP promoter activity was induced in MCF 10A cells

by CSC treatment in a time and concentration-dependent manner.

C/EBP-binding Sites on the pBel-xLP are CSC-responsive Elements

Next, the cis-elements on the pBcl-xLP responsible for this upregulation were identified.

Eukaryotic gene expression is regulated in part by transcriptional mechanisms including

transcriptional initiation, which involves site specific protein to DNA and protein to protein

interactions at the initiation site (Van Dyke et al., 1988). Transcription factors are essential for

the recruitment of RNA polymerase II (RNAP II) and other members of the pre-initiation

complex (PIC) to the transcription initiation site. Transcription initiation is the rate-limiting step

in the gene transcription and the role of general transcription factors is therefore critical to the

transcription of genes.

Putative cis-elements on the bcl-xl promoter represent possible binding sites for

transcription factors that can activate or repress the transcription of the gene. To determine










which transcription factor was increasing pBcl-xLP expression in treated cells, PCR was used to

clone nine promoter deletion constructs from the pBcl-xLP promoter. These constructs were

designed to sequentially delete potential regulatory elements on the pBcl-xLP (Figure 3-4A).

The pBcl-xLP and deletion constructs were individually transfected into MCF 10A cells, treated

with CSC, and promoter activity was measured (Figure 3-4B). As expected, the pBcl-xLP

(-145, +707) showed no significant promoter activity or induction. Conversely, pBcl-xLP (-

54,+647) activity was significantly induced by CSC as shown in Figure 3-3. Basal promoter

activity was reduced with pBcl-xLP (-28,+707), which reflected the loss of the C/EBP-I site, but

the CSC response was maintained, suggesting that C/EBP-I was important for the basal bcl-xl

promoter activity and that it may or may not have been responsive to CSC treatment. The bcl-xl

promoter activity continued to decrease as other elements were deleted. However, the CSC

response was maintained up to pBcl-xLP (-28,+222). The promoter activity decreased at the

next construct, pBcl-xLP (-28,+132), which represented the loss of the site C/EBP-II. Loss of

this site resulted in an unrecoverable decrease in promoter activity. These results suggested that

the C/EBP-II on the pBcl-xLP may have been the primary CSC-responsive site on the pBcl-xLP

promoter.

Site-directed mutagenesis was used to examine whether C/EBP sites were necessary for

CSC-induced promoter activity. Site-directed mutagenesis was performed separately on the

C/EBP site-I and site-II of the pBcl-xLP promoter (Figure 3-5). The mutant constructs were then

transfected into MCF 10A cells that were subsequently treated with CSC. While the wild-type

promoter showed a significant induction of activity in response to CSC treatment, neither mutant

promoter construct showed a significant induction in response to treatment (Figure 3-6). These










results indicate that C/EBP site-I and site-II elements on the pBcl-xLP respond to CSC treatment

in MCF 10A cells.








A. RT-POR
Concentration curve


*-


Bd xL ...


0 12 24 36 48
Time (h)
Concentration curve


0 5 10 25 50
CSC (Ftg/mL)


Figure 3-1. Bcl-xl mRNA and protein levels are induced in MCF 10A cells treated with CSC.
(A) RNA was isolated from cells treated with increasing concentrations of CSC for
24 h. RT-PCR was performed with primers specific to the bcl-xl cDNA sequence.
GAPDH primers were used on the same samples as a loading control. (B) Treated
cells were processed for whole cell extract. For the time course, cells were treated
with 25 Clg/mL of CSC for various time points. For the concentration curve, cells
were treated with increasing amounts of CSC for 24 hours. Blots were stripped and
probed for P-Actin as a loading control. Data is representative of three separate
experiments.


GAPDH osW J
0 2.5 5 10 25 50
CSC (Ftg/mL)
B. Western blot
Time course

Bd-xL

p-Actin-p epl I%


Bcl-xL

p-Actin














5`-ct ccctgagtcec teactgaan


tcactttagg gtttcggacg catccacctc


tagaaaaaag aaaaacanan anomiaataan
HNF C/E~BP

gagagtactc ctggetecca gtaggaggcg
+1

gagagagggg getgggatoo aqqqtggeag
AP-2

gacqucate atecgggagaE~tggaggagga
Spl GATA
cctgapietto go-aa~tctac tgtcgacttc
C/EBEP

togcatgate cctacggeog gagctggttt


ccggetaq tacrogqqate acogcagcea
APF-1 GATA ASP--2

tacana;agat attacgggggg otguanatqc


cattgaacco cattgqagang -119


acent~qqqct ggtgettaaa -6~9
ALP2

tecataccag ccacetecgg --19


gagagccaag ggquqtgcaa +32
Oct1

gaggac~q~Lqic g e 82
AP-2 L+-78

agcaagEg.~a~q qqq ctggtt +132
AP--2

tgggetecca gcctgccggg +182


ttttgacage caccgagagg +232


catcatate anctgtga +282
ALP--2

ctgcqcatttg ataqug 332
C/E~BP Spl


USF


IGATA


tttgaatgta ggtggtgagg gggaqcqqqa qtggqqgqqu gg qqgggactguL +382
p300O Spl ~NF-KB
ac~gtggat actttacgag gaaggcattt eqqagangac gggggtagna +432
p300 NF-KRB STAT~
aaggetggt~g qqagattaa agtccactgg tgctttagat ttgacttaaq +482
GATA C/HBP

tgaaqtatat tggaacctag acccagnant toqtangace~c cacaaagaan +532
GATA C/(EBP

ccagttetgg tacetggagg gggaalt~ggan tttttag!~~ggt anatggcatg +582
NF--KB

catattaatt attttttttt tactgaatet atttatatc c ttcaqnate +632
GATA GATA
ttatcttggc tttggatett agaagagaat cactaaccag agacgagact +6;82


cagtgagtga gcaggtgttt tggac-3' +707



Figure 3-2. Sequence of the cloned human bcl-xl promoter, pBcl-xLP. Nucleotides 226 to 915
from the human bcl-xl promoter were cloned into a pGL-3 Basic Luciferase Vector
and was named pBcl-xLP. The pBcl-xLP contains binding sites for several common
transcription factors and the transcription initiation sites are located at +1 and +78.











A. Time course


B. Concentration curve


600 100


S5;00 *
S80







100 -0



0 20

0 6 12 24 48 0 5 10 25 50
Time (h) CSC (pg/mL)

Figure 3-3. CSC treatment induces pBcl-xLP promoter activity in vitro. The pBcl-xLP construct
was transfected into MCF 10A cells, which were subsequently treated with CSC.
Cells were harvested for the (A) time course and (B) concentration curve and
promoter activity was measured with luciferase assays normalized with
P-galactosidase activity. Data is the average of three replicates + SE and
representative of three independent experiments. Asterisks (*) indicate a significant
difference compared to the promoter activity of the untreated cells.








































I (-C/EBP site-II)


_ _


I II





I I I I I


A. Structure


Bl. CSC-induced promoter activity


CI
CI
CI
d.
EP
ILW
(n~P
~urn
ftf


Luciferase activity
(arbitrary units x 103)


app
rtlrg
w
~L ~m
uzl
++L


r
(-145,$767)~

(-54,~647)


ill PD
rrI
LL U.C
I? tin
't*tf


EL


I

I
=1


(-28,+707)



(-28,+354)

(-28,+342)



(-28,+282)

(-28,+222)

(-28,+ 132)

(-28,+42)
*Concensus site


Figure 3-4. The pBcl-xLP promoter contains CSC-responsive cis-elements. (A) The basal
promoter construct was identified as pBcl-xLP (-54,+647). Nine pBcl-xLP deletion
constructs (labelled according to their lengths) were designed to sequentially delete
putative cis-elements. Arrows indicate the transcription initiation sites. (B) For the
determination of the CSC-responsive cis-elements on the pBcl-xLP, luciferase assays
normalized with P-galactosidase activity were used to measure pBcl-xLP promoter
activity in MCF10A cells separately transfected with each construct and then treated
with CSC. Data is the avera e of three re licates + SE and re resentative of three
independent experiments.


of pBdl-xLP
+1


+7 w


S(-C/EBP site-I)


g~01
-~














5`-ct- coatgagtc c tcactgaan


tcectttagg gtttaggacg catacacete


C/EBP site-1i mutant

gggce canamet
tagaaaaaag amanan-a:aannca anonatan
KNF C/EBP 1

gagagtact c tggotocc~a gtaggaggag
+~1

gagagagggg gctgggotae eqqqtggcag
AP--2

gacqucate atcogggoga tgqgaggaga
spl GAT.A
C/EBP site--2 mutanrt

gonac agent

actgaqutta goaattactgcct tgtegactte
C/E~IBP 2

tcqcatgate catcaggacg gagatggttt


ccgl~~t_~:cetgqt atccqu oanguagaca
APL-1 GAT.A AP-2


acttgaacco cattgagang --119
H--K;B

acantggqct ggtgcttaan --69
~AP2




tecataccag coacctacgg --19


gagagccaag qggogtgaan +32
Ouctl

gaggaccgcqcqq 0 cg +-82
AP--2 +~78

agemagogaq qqggotggt~t +1312
AP--2


+182


+c232


+t282


+332


tgggotocca gactgacggg


ttttgacage caccgagagg


cctanttanagactgtga
AP--2


C/EBP Spl


USF


GATA

tttgaatgta ggtggtgagg


ccngagt actttogag
p300 NF--KB

maggetggtg ggaatoq
GALTA

tgangqt~atut tggaacetag
GA9TA

coagttetgg tacctggagg


catattaatt attttttt~tt


thatcttgge tttggatett


cagtgagtga gcaggtgttt


gggaqcqqqa qtqqqqqagg qggggqalctu +382
p300 spl NFP-KCB
gaaggcattt qqagagac gggggtagan +432
STAT

agtecactgg tgctttcga-t ttganttaaq +t482


acccagaact taqtangcce cacaaagaan +532
C/EEBP

gggaatggan tttttggt aaatggcatg +582
HPl-KB;L

tactgaatet atttetatc c ttcaaanto +632
GAA AT

agaagagant cactaaccag agacgagact +682


tggac--3' +707


Figure 3-5. C/EBP mutations introduced on the pBcl-xLP. Site-directed mutagenesis was used
to introduce two separate mutations in the pBcl-xLP construct. The resulting

constructs were named C/EBP site-I mutant and C/EBP site-II mutant, respectively.

The mutations (in red) mirror the mutations used for subsequent EMSA experiments.


taaagtatacggggg atqcacctqe ctgentttgo etanqqugga









120

r. 100









S20



CSC (25 pg/mL) +e +-

pBdl-xLP pBcI-xLP pBcI-xLP
(Site-I-mut) (Site-II-mut)


Figure 3-6. Site-directed mutagenesis of C/EBP sites on the pBcl-xLP attenuates CSC-induced
promoter activity. Wild-type pBcl-xLP, C/EBP site-I mutant, or C/EBP site-II mutant
were separately transfected into MCF10A cells. The transfected cells were then
treated with CSC and promoter activity was analyzed with luciferase assays
normalized with P-galactosidase activity. Data is the average of three replicates + SE
and representative of three independent experiments. Asterisks (*) indicate a
significant difference compared to the promoter activity of the untreated cells.









CHAPTER 4
C/EBuP REGULATES BCL-XL INT CSC-TREATED MCF10A CELLS

Introduction

The loss of C/EBP site-I and -II reduced CSC-induced pBcl-xLP activity (Figure 3-6).

C/EBuP is one of the six C/EBP proteins and evidence suggests its role in human breast

carcinogenesis, however, this role is not completely understood (Milde-Langosch et al., 2003;

Zahnow, 2002). Its putative role in human breast carcinogenesis made C/EBuP an appropriate

C/EBP target protein responsible for the upregulation in bcl-xl in CSC-treated MCF 10A cells.

Results

C/EBPP is Induced by CSC Treatment in MCF10A Cells

Western analysis was used to confirm that C/EBPP was induced by CSC treatment. The

antibody used in this Western analysis was raised against the carboxy-terminal of C/EBPP, and

therefore had the ability to detect all three isoforms. Two C/EBPP isoforms LAPI (45 kDa) and

LAP2 (42 kDa) were detected in whole cell extracts from CSC-treated MCF 10A cells; however,

LIP was not detected in these cells (Figure 1-4). Only LAP2 levels were significantly increased

in a time and concentration-dependent manner. These experiments confirmed that C/EBuP

protein levels are induced by CSC treatment.

C/EBPP Site-II of the pBel-xLP is Specific for the CSC Response in MCF10A Cells

In previous experiments, two putative C/EBP sites on the pBcl-xLP were identified as

being inducible by CSC. EMSA was used to characterize these C/EBP sites as CSC-responsive

sites on the pBcl-xLP. To do this, 32P-labelled double-stranded probes, identical to C/EBP site-I

and site-II sequences were incubated with MCF10A nuclear extract. Two DNA-protein

complexes (shifted bands I and II) were visualized with autoradiography (Figure 4-2). These

bands represent nuclear proteins binding to C/EBP regulatory elements on the bcl-xl promoter.









For competition experiments, the appropriate unlabelled wild-type or mutant oligos were added

at increasing fold excess (Figure 4-2A). For C/EBP site-I and C/EBP site-II, the unlabelled

wild-type probe competed out the 32P-labelled probe, in a concentration dependent manner, as

expected. However, the unlabelled C/EBP site-I mutant oligo also competed out the 32P-labelled

probe at that site. This indicated one of the two scenarios: 1) the mutant is not sufficient enough

to decrease binding, or 2) the binding at this site is non-specific. Specificity was tested by

adding increasing concentrations of a non-specific, unlabelled GAGA probe to the reactions as

indicated. The unlabelled probe also competed with the 32P-labelled wild-type probe for C/EBP

site-I, confirming the second possibility that the binding at C/EBP site-I was non-specific.

Conversely, the reactions with C/EBP site-II were not competed out by either the unlabelled

mutant or the unlabelled non-specific GAGA probe, suggesting that MCF 10A nuclear extract

contained a protein that specially bound to C/EBP site-II.

The protein binding to the pBcl-xLP C/EBP site-II was identified with super-shift

analysis. The three C/EBP proteins (C/EBPa, P, and 8) are expressed in mammary tissue

(Gigliotti and DeWille, 1998; Sabatakos et al., 1998). To determine whether the binding was

specific to either protein, antibodies specific to each were added to the reaction mixtures as

indicated. No shifted bands are observed in reactions with the 32P-C/EBP site-I. 32P-C/EBP site-

II reactions showed a shifted band only with the addition of anti-C/EBPP antibody (Figure 4-2B).

It was also determined whether CSC induced C/EBPP protein to show increased binding

to the pBcl-xLP promoter in the gel-shift and super-shift assays. 32P-labelled C/EBP site-II

probe was incubated with nuclear extracts isolated from untreated and CSC-treated MCF 10A

cells. Results showed a drastic increase in the shifted band II with extract from CSC-treated

cells as compared to untreated cells (Figure 4-2C). In the reactions with untreated nuclear









extract, the addition of anti-C/EBPP antibody resulted in a super-shift as seen in Figure 4-2B. In

the reaction with CSC-treated nuclear extract, there was a shift of band I and increased binding at

band II. The addition of anti-C/EBPP antibody resulted in an additional shift of shifted band in

lane 3 (without antibody) and increased binding at band II. These results indicated that CSC

treatment increased the binding of C/EBPP proteins to the pBcl-xLP in vitro.

C/EBPP Binds the Endogenous Bcl-xl Promoter in Response to CSC Treatment

To confirm that C/EBPP binds the bcl-xl promoter in vivo, ChlP analysis was performed.

MCF 10A cells were treated with increasing concentrations of CSC for 24h. The ChlP analysis

was performed as described in Materials and Methods. PCR of the resulting DNA was

performed with primers specific to the pBcl-xLP C/EBP site-II. In the untreated cells there was

an initial binding of C/EBPP to the bcl-xl promoter. This binding slightly decreased at 10 Clg/mL

of CSC treatment, increased to a level higher than that in the untreated cells at 25 Cpg/mL, and

was sustained at 50 Clg/mL of CSC treatment (Figure 4-3). This experiment mirrored the bcl-xl

mRNA expression in Figure 3-1A. The results from the EMSA and ChlP analysis suggested that

C/EBPP binds and regulates bcl-xl gene expression in MC10A cells in response to CSC

treatment.

Overexpression of C/EBPP Protein LAP2 Increases pBcl-xLP Promoter and Protein Levels
in MCF10A Cells

To demonstrate that CSC treatment increased C/EBPP levels which bound to the bcl-xl

promoter and regulated it expression, this condition was recapitulated by overexpression of

C/EBPP protein in MCF 10A cells. To do this, each C/EBPP isoform: hLAP1, hLAP2, and hLIP

were transfected into MCF 10A cells and the effect on pBcl-xLP promoter activity was measured

with luciferase activity. Each C/EBPP construct induced promoter activity. However, only

hLAP2 had a significant induction when compared to the empty pCDNA3.1 vector (Figure 4-










4A). To determine the effect of these constructs on Bcl-xL protein levels, each construct was

separately transfected into MC 10A cells and after 48 h, the cells were harvested and processed

for whole cell extract. The protein was used for Western analysis of C/EBPP and Bcl-xL protein

levels. C/EBPP protein levels confirmed that the appropriate isoforms were overexpressed.

Bcl-xL protein levels were similar in control cells and cells transfected with the empty

pCDNA3.1 vector (Figure 4-4B). The overexpression of hLAPI1 slightly increased Bcl-xL

protein levels, while LAP2 showed the most significant increase ofBcl-xL. Conversely, hLIP

expression caused a decrease in Bcl-xL protein. These results suggest that C/EBPP, specifically

LAP2, has a role in the regulation of pBcl-xLP promoter activity and protein levels in the

absence of CSC treatment.

Co-transfection of C/EBPP overexpression constructs with pBcl-xLP mutant constructs

indicated that the loss of C/EBP sites on the promoter disrupted the promoter activity compared

to the results from Figure 4-4 with the wild-type promoter (Figure 4-5). The presence of C/EBP

site-II was required for the CSC-induced and C/EBPP-induced upregulation of bcl-xl promoter

activity in MCF10A cells and together, these data indicated that C/EBPP was necessary for the

upregulation of bcl-xl in CSC-treated MCF 10A cells.








A. Time course


C/EBPP


.


P-Actin


0 12 24 36 48
Time (h)
B. Concentration curve


+- LAP1
+- LAP2



+- LIP


C/EBPP





p-Actin


0 5 10 25 50
CSC (clg/mL)

Figure 4-1. C/EBPP protein levels are induced in MCF10A cells treated with CSC. MCF10A
cells were treated with 25 Clg/mL of CSC for various time points. For the
concentration curve, cells were treated with increasing amounts of CSC for 24 hours.
The protein was used for Western blot analysis of C/EBPP protein. Blots were
stripped and probed for P-Actin as a loading control. Data is representative of three
independent experiments.


LAP1
SLAP2



+~ LIP











A. Gel-shift
C/EBP site-I


CIEBP site-II


-~~~~~ A ------
-~ ~ ~ ~~~1 ------



- - A -
- - - A -
- --,- -


C/EBP-Iwt
C/EBP-Imut
C/EBP-I~wt
C/EBP-IImut
GAGAwt


B. Super-shift


C. Super-shift
with CSC-NE


C/EBP site-I C/EBP site-II
Super-shifted
band s













C/EBP antibody pa 6- pa 8
CSC-NE -- ------


(U
tl!
LL


- P- P
- -+ +


Figure 4-2. C/EBPP binds the bcl-xl promoter in vitro. 32P-labelled C/EBP site-I or 32P-labelled
C/EBP site-II oligonucleotides were incubated with MCF 10A nuclear extract. (A)
For competition experiments, 2.5, 5, and 10 fold excess of the appropriate unlabelled
wild-type or mutant C/EBP site were added to the indicated lanes. Unlabelled GATA
oligonucleotides were added to the lanes indicated to determine binding specificity.
(B) Super-shift analysis of C/EBP site-II was carried out by adding antibodies
specific to C/EBPP, a, or 6 to the reaction mixtures as the lanes indicate. (C) The
effects of CSC treatment on super-shift analysis were analyzed by adding anti-
C/EBPP antibody to reaction mixtures using MCF 10A nuclear extract from untreated
or CSC-treated cells. Data is representative of three independent experiments.


C/EB sit-IISuper-
C/EB sit-IIshifted

iibadsB~bands









C/EBPP
190 bp

CSC (C1g/mIL) 10 25 50-

pBdl-xLP template + -
C/EBPP antibody -+ + + +
IgG - +

Figure 4-3. C/EBPP is present on the bcl-xl promoter of MCF 10A cells in vivo. ChlP was
performed on MCF 10A cells treated with increasing concentrations of CSC for 24h.
An anti-C/EBPP antibody was used to immunoprecipitate the DNA-protein
complexes. PCR was performed on the isolated DNA with primers specific for
C/EBP site-II on the pBcl-xLP promoter. Data is representative of three independent
experiments.









A. Promoter activity
Mh 40








B. e str bo


4 LAP1
C/EBPP +- LAP2






+e LIP

p-Actin


Bdl-xL II II

p-Actin

Figure 4-4. Overexpression of C/EBPP induces pBcl-xLP promoter activity and Bcl-xL protein
levels in MCF 10A cells. Human C/EBPP overexpression constructs, LAP1, LAP2,
and LIP were co-transfected with the pBcl-xLP promoter into MCF 10A cells. (A)
Promoter activity was analyzed with luciferase assays and normalized with P-
Balactosidase activity Data is the avera e of three re licates + SE and re resentative
of three independent experiments. Asterisks (*) indicate a significant difference from
the promoter activity of the empty pCDNA3.1 vector. (B) Western analysis of
C/EBPP was used to confirm the overexpression of the appropriate construct and
changes in Bcl-xL expression were assessed. The same whole cell extract was used to
detect protein (C/EBPP or Bcl-xL) on two blots. The blots were stripped and probed
for P-Actin as a loading control. Data is representative of three independent
experiments.

























d


A. pBdl-xLP (C/EBP site-I-mut)


h
M
~I
>X
'E
uB
C
~Y=l
VI




3n
IP
u


h
M
rl


~a
W .I
r:
O
3
VI

Qlg
~jlf!
IIIL
(P
u


gC1


*Lp~9S ~tp.92


Figure 4-5. Site-directed mutagenesis of C/EBP sites on the pBcl-xLP attenuates the C/EBPP-
induced activation of the pBcl-xLP promoter. C/EBPP overexpression constructs
were co-transfected with each C/EBP mutant construct. Promoter activity was
analyzed with luciferase assays and normalized with B-galactosidase activity. Data is
the aver ge of three re licates + SE and re resentative of three inde endent
experiments. Asterisks (*) indicate a significant difference from the promoter activity
of the empty pCDNA3.1 vector.


B. pBdl-xLP (C/EBP site-II-mut)









CHAPTER 5
SUMMARY AND DISCUSSION

Breast cancer is the most common cancer women. In light of this and other studies,

cigarette smoking may play a role in breast cancer development. Approximately 45 million

Americans currently smoke. Even though the numbers of women smokers have decreased in the

past, prevalence declined little from 1992-1998. Smoking prevalence continues to increase in

women with less education and/or those below the poverty level (Centers for Disease Control

and Prevention, 2007; National Center for Health Statistics, 2006). These growing groups of

women are of particular interest because when they develop cancer, their accessibility to

healthcare is limited. Breast cancer can arise 30-40 years from the onset of smoking and

smoking for a long duration may be associated with increased breast cancer risk (Terry and

Rohan, 2002). Additionally, females beginning to smoke at younger ages, increase their risk of

smoking-related diseases including cancers (U. S. Department of Health and Human Services,

1994). This trend may be linked to the growing number of breast cancer cases diagnosed in the

United States.

Prevention of breast cancer has been obstructed by the lack of knowledge about the

etiology of the disease (Li et al., 1996a). There are two categories of breast cancer risk factors:

biological risk factors and life-style risks. The primary biological risk factor is gender and

increasing age. Other biological factors include, but aren't limited to genetic mutations in certain

genes (BRCA1, BRCA2) and family, or personal history of breast cancer. Reproductive risk

factors include menstrual periods that start early or end late in life, not having children, and

childbirth after the age of 30. Behavioral factors include postmenopausal hormone replacement

therapy (slight increased risk), alcohol use, obesity/high-fat diets, and lack of physical activity

(American Cancer Society, 2008). Known risk factors (family history and reproductive factors)










only account for 30% of breast cancer cases (John and Kelsey, 1993). Understanding other risk

factors, such as the role of smoking, is essential to developing prevention strategies and

therapeutic interventions to breast carcinogenesis.

In this study, the MCF 10A cell line was utilized to determine the mechanism by which

cigarette smoking might be linked to breast carcinogenesis. The MCF 10 series of cell lines are

human breast epithelial cells that have been extensively characterized (Soule et al., 1990; Tait et

al., 1990). The founding cells, MCF10M, were derived from a 36-year old parous pre-

menopausal woman with extensive fibrocystic disease, but no family history or histological

evidence of breast malignancy. These mortal diploid cells had finite growth in culture and were

described as estrogen receptor negative (ER-). MCF 10A (attached) cells are a spontaneously

immortalized derivative that resulted from the culturing of MCF 10M cells in medium containing

low calcium. Although this cell line is immortalized, MCF10A cells have characteristics of

normal cells including: the lack of tumorigenecity in nude mice (Miller et al., 1993), growth

factor-dependency, and anchorage-dependent growth (Soule et al., 1990; Tait et al., 1990).

MCF 10A cells are considered a model for normal epithelial cells and therefore provide the

opportunity to study the earliest stages of transformation and tumorigenesis (Soule et al., 1990;

Tait et al., 1990). However, MCF10A cells have characteristics of luminal and basal

myoepithelial cells and may represent multipotent progenitor cells (Gordon et al., 2003; Neve et

al., 2006). Inner luminal secretaryy) and outer basal myoepithelial cells, are the two cell types

that compose the acinus (Ronnov-Jessen et al., 1996; Taylor-Papadimitriou et al., 1989) the

smallest functional unit of the mammary duct (Bissell et al., 2003; Smith et al., 1984). These cell

types can be distinguished by gene expression profiling and with immunohistochemi stry; luminal

cells express keratins 8/18 and E-cadherin, while myoepithelial cells express keratins 5/6,










integrin-P4, and laminin (Perou et al., 2000; Ronnov-Jessen et al., 1996; Sorlie et al., 2001;

Sorlie et al., 2003). Recently, studies have reported that MCF 10A cells have basal-like cell

characteristics (Charafe-Jauffret et al., 2006; Neve et al., 2006). Cells with basal phenotypes are

more likely to undergo EMT and express more aggressive, metastatic phenotypes in vivo (Sarrio

et al., 2008). In fact, MCF 10A transiently express characteristics of EMT when cultured in low

densities (Sarrio et al., 2008). Despite these characteristics, MCF 10A cells cluster with other

cells derived from normal mammary tissue (Lombaerts et al., 2006), display normal morphology

when grown on basement membrane, and do not display a fully mesenchymal phenotype

(Zajchowski et al., 2001). Using primary mammary cells as an experimental model is difficult

and usually does not allow for long-term observations. The in vitro and in vivo characteristics of

the MCF 10A cell line indicate that these cells, as originally hypothesized (Soule et al., 1990; Tait

et al., 1990), serve as the most appropriate model for normal epithelial cells in experimental

studies.

MCF 10A cells also provide a model to study estrogen receptor negative (ER-) cells.

Approximately one-third of breast cancer patients respond to endocrine therapy, most of these

have ER+ tumors (Jordan, 1993). Many breast cancers are ER-, making them refractory to anti-

hormone therapy and aromatase inhibitors. These tumors are more aggressive (increased

invasion and distant metastasis) than ER+ tumors (Gago et al., 1998). A significant portion of

patients with ER+ cancers are initially not responsive to treatments with selective estrogen

receptor modulators (SERMs) such as tamoxifen (Kumar et al., 1996). Additionally, initially

responsive patients can develop resistance to anti-hormone therapy. Understanding the

mechanisms by which ER- cells are transformed can also give insights to treating the patients not

eligible for traditional hormone therapy.









In a previous study, CSC-mediated transformation of MCF 10A cells has been described

(Narayan et al., 2004). CSC has also been found to transform endocervical cells (Yang et al.,

1998; Yang et al., 1997). In both cases, the expression of anti-apoptotic proteins was increased

in the transformed cells (Narayan et al., 2004; Yang et al., 1998). In order to understand the

mechanisms of cigarette-induced breast carcinogenesis, this study determined the transcription

factor that upregulated bcl-xl expression in MCF 10A cells after CSC treatment. Determining the

role of transcription factors in CSC-mediated regulation of bcl-xl gene expression may give

insight to this and other risk factors involved in breast carcinogenesis.

C/EBPjl-induced Upregulation of Bel-xL in CSC-treated MCF10A Cells

The treatment of MCF 10A cells with CSC caused the upregulation of bcl-xl mRNA and

protein levels and the induction of Bcl-xL protein occurred at the level of transcription (Narayan

et al., 2004; Figure 3-1). This observation is supported by other studies that found the induction

of bcl-xl generally resulted from an increase in bcl-x promoter activity and de novo protein

synthesis is required for the activation of bcl-xl transcription (Sevilla et al., 1999). This is

mainly because the bcl-xl transcript has a short half life of about four hours (Bachelor and

Bowden, 2004; Pardo et al., 2002; Sevilla et al., 1999). The increase in bcl-xl mRNA levels

occurs through a biphasic mechanism. The base-line levels of bcl-xl in untreated cells ensure the

survival of the cells in culture. CSC causes DNA damage in MCF 10A cells (Kundu et al., 2007).

After treatment with CSC, the amount of DNA damage causes the cells to respond by triggering

DNA repair pathways. This is evident in the increased levels of PCNA and GADD45 protein

levels previously reported. Increases in these proteins indicated active DNA repair and synthesis

presumably resulting from the CSC-induced DNA damage (Narayan et al., 2004). If the DNA

damage overloads the repair mechanisms, the cells undergo apoptosis, resulting in the decrease

in bcl-xl mRNA levels after the first treatment. This decrease in bcl-xl levels indicated that most










treated cells die, as observed by Narayan et al. (2004). The few surviving cells were responsible

for the remaining low levels of bcl-xl expression after the initial treatment. Cells expressing

higher levels of bcl-xl were not removed by apoptosis. Subsequent treatments produced more

DNA damage and eventually persistent mutations, possibly in tumor suppressors or oncogenes in

the remaining cells. As the result of these mutations, important cell regulatory mechanisms may

not have been working and bcl-xl expression continued to increase in these cells. Additionally,

each treatment also selected for the survival of cells expressing higher levels of bcl-xl. As the

surviving cells divided, their progeny shared the increased expression of bcl-xl, resulting in the

time and concentration-dependent increase of bcl-xl mRNA levels. The survival of a few cells is

all that was needed to sustain increased Bcl-xL expression because such genetic defects are

clonal in nature (Tomlinson, 2001). While the time course Western blot had a biphasic response

to CSC treatment, the concentration curve blot did not show this pattern. One possible

explanation is that RT-PCR is more sensitive assay that can detect smaller differences in

expression levels. It is also possible that there was differential regulation of bcl-xl mRNA and

protein levels.

The cloned human bcl-xl promoter (pBcl-xLP) was responsive to CSC treatment when

transfected into MCF 10A cells (Figure 3-3). Two pBcl-xLP promoter constructs were cloned.

The lack of promoter activity when the longest construct, pBcl-xLP (-145,+707), was transfected

into MCF 10A cells indicated that uncharacterized repressive cis-elements might have been

present which were absent on the pBcl-xLP (-54,+647) construct (Figure 3-4B). Reductions in

promoter activity also resulted from the removal of uncharacterized repressive cis-elements on

pBcl-xLP (-28,+282). Promoter deletion studies suggested that two C/EBP cis-elements were

responsible for the CSC-induced increase in bcl-xl promoter activity (Figure 3-4). C/EBPP was









investigated as the target C/EBP protein family member. C/EBPP is critical for mammary

gland development (Robinson et al., 1998; Seagroves et al., 1998) and is increased in rodent and

human breast cancer (Dearth et al., 2001; Eaton et al., 2001; Milde-Langosch et al., 2003;

Zahnow et al., 1997). Studies indicate that C/EBPP can induce a survival phenotype in

intravascular cells, possibly by its anti-apoptotic activity (Shimizu et al., 2007). In subsequent

experiments, protein levels of C/EBPP were also induced by CSC treatment (Figure 4-1).

Site-directed mutagenesis confirmed that CSC-induced pBcl-xLP activity was attenuated

in the absence of either C/EBP site (Figure 3-6). However, EMSA confirmed that C/EBPP

bound only to the bcl-xl promoter at C/EBP site-II in vitro. The presence of protein binding at

C/EBP site-I suggested that a protein bound to the bcl-xl promoter at that site, but this binding

was not specific to a C/EBP protein (Figure 4-2A, B). This is not surprising because C/EBP site-

I is not a true C/EBP consensus site on the pBcl-xLP promoter and C/EBP site-II is 100%

identical to the core C/EBP consensus sequence. The use of MCF 10A nuclear extract in this

assay meant that many proteins were available to bind the C/EBP site-I. The data suggested that

an unidentified transcription factor bound to the pBcl-xLP at C/EBP site-I in response to CSC

treatment. In parallel, C/EBPP bound the bcl-xl promoter at C/EBP site-II in vivo, as shown by

ChlP assay (Figure 4-3). This binding had a biphasic pattern similar to that seen in the mRNA

analysis (Figure 3-1A), indicating that bcl-xl mRNA levels correspond with C/EBPP-binding to

and regulating the bcl-xl promoter. Overexpression studies confirmed that C/EBPP-induced

pBcl-xLP promoter and Bcl-xL protein levels (Figure 4-4) and site-directed mutagenesis showed

that C/EBP-binding sites on the pBcl-xLP were necessary for C/EBPP to properly regulate pBcl-

xLP activity (Figure 4-5).










Only C/EBPP-LAP2 protein levels were induced in time and concentrate on-dependent

manner following CSC treatment (Figure 4-1). Additionally, only LAP2 significantly induced

pBcl-xLP activity and Bcl-xL protein levels (Figure 4-4). Site-directed mutagenesis of C/EBP

site-II on the pBcl-xLP results in the lowest promoter activity when LAP2 was co-transfected

with the mutant construct (Figure 4-5B), supporting the hypothesis that C/EBPB-LAP2 binds to

the pBcl-xLP at C/EBP site-II. Although C/EBPP-LAP2 has not been fully implicated in human

breast carcinogenesis, studies support its role in the disease. LAP2 is the most prevalent form of

C/EBPP in human breast cancer cells (Eaton et al., 2001). Increased levels of C/EBPP-LAP2

have also been implicated in the transformation human breast epithelial cells. MCF 10A cells

infected with a LAP2-expressing virus became anchorage independent, expressed markers of

epithelial-mesenchymal transition (EMT), and acquired invasive phenotypes (Bundy and Sealy,

2003). EMT is a mechanism that is necessary for developmental processes such as gastrulation

and neural crest formation (Thiery, 2003). During EMT, cells of epithelial origin loss their

characteristics and acquire mesenchymal phenotypes with increased migratory behavior and

display loss of intercellular adhesion (E-cadherins), downregulation of epithelial markers

(cytokeratins), and upregulation of mesenchymal markers (vimentin). Therefore, aberrant EMT

plays a role in tumor invasion and metastasis (Gupta and Massague, 2006; Savagner, 2001;

Thiery, 2002; Thiery and Sleeman, 2006; Thompson et al., 2005).

Additional studies found that MCF 10A cells transfected with the same LAP2 virus

gained epidermal growth factor (EGF)-independent growth and had disruption of normal acinar

structure when grown on basement membrane (Bundy et al., 2005). Many of the characteristics

displayed by MCF 10A cells overexpressing LAP2 are considered hallmarks of cancer cells

(Hanahan and Weinberg, 2000). The LAP-2-induced disruption of the polarized architecture in









MCF 10A cells is similar to that induced by the activation of Erb2 (HER2) receptor expression in

these cells. HER2 is a transmemb-rane receptor tyrosine kinase (Stern et al., 1986) that is

overexpressed in breast cancer (Slamon et al., 1984), has roles in tamoxifen resistance (Benz et

al., 1992; Leitzel et al., 1995; Wright et al., 1992), and is associated with poor clinical prognosis

(Slamon et al., 1989). In MCF 10A cells, activation of HER2 signaling in acini reinitiated

proliferation and induced complex multi-acinar structures with filled lumen (Debnath et al.,

2002; Muthuswamy et al., 2001), a process considered to be carcinogenic (Muthuswamy et al.,

2001). Interestingly, the overexpression of HER2 is correlated with the upregulation of Bcl-xL

protein in MCF-7 breast cancer cells and breast ductal carcinoma in situ tissues (Kumar et al.,

1996; Siziopikou and Khan, 2005), indicating a link between LAP-2, HER2, and Bcl-xL

expression. This and other studies suggest that aberrant expression of C/EBPP isoforms,

especially LAP2, contributes to breast carcinogenesis (Grimm and Rosen, 2003).

The expression and role of LIP varies by cell type. Although MCF 10A cells did not

express the LIP isoform (Figure 3-1), the overexpression of LIP has differential effects on bcl-xl

promoter and protein activity. LIP expression slightly induces pBcl-xLP activity (Figure 4-4A).

LIP heterodimers can act as dominant negative transcriptional regulators (Descombes and

Schibler, 1991). However, LIP has also been shown to increase transcriptional activation of

some genes (Hsieh et al., 1998). In MCF10A cells, LIP overexpression could have activated the

transcription of pBcl-xLP into the cells. Possible mechanisms include the inhibition of genes

that repress bcl-xl or activation of genes that increase bcl-xl transcription (Dearth et al., 2001).

This study indicates that when in excess, LIP may bind the pBcl-xLP at C/EBP site-I. In Figure

5-4A (disruption of C/EBP site-I), when LIP is overexpressed, the pBcl-xLP activity is at its

lowest level compared to the other overexpression constructs. This binding was not detected in









EMSA experiments (Figure 4-2) because LIP is not endogenously expressed in MCF 10A cells

(Figure 3-1). Conversely, LIP overexpression decreases Bcl-xL protein levels in MCF10A cells,

by decreasing protein levels of LAP2 (Figure 4-4B). This and other studies have shown that LIP

decreases LAPI and LAP2 protein expression in MCF 10A cells (Bundy et al., 2005) but the

mechanism by which LIP decreases LAP2 expression remains unclear.

Induction of C/EBPP by CSC Treatment

The mechanism by which C/EBPP is induced by CSC continues to be unclear. It is

possible that the protein undergoes post-translational modifications in response to CSC

treatment. C/EBPP is highly modified in breast cancer cells (Eaton et al., 2001). Gel-shift

analysis with nuclear extract from CSC-treated cells showed a slower migrating band before the

addition of antibody, when compared to analysis with untreated nuclear extract (Figure 4-2C).

This higher band could be the result of a modification that slows band migration. Post-

translational modifications are required for the activation of C/EBPP and phosphorylation readily

occurs on the C/EBPP protein. Phosphorylation functions to increase C/EBPP transcriptional

activity and efficiency (Nakajima et al., 1993; Trautwein et al., 1993). Dual phosphorylation at

Thrl88 by MAP kinase and then at Serl84 or Thrl79 by glycogen synthase kinase P (GSK3 P)

causes a change in confirmation that renders the leucine zipper of the monomeric protein

available for the dimerization that is required for DNA-binding activity (Tang et al., 2005) and

renders the basic region accessible to bind regulatory elements (Kim et al., 2007). The protein is

also phosphorylated by mitogen-activated protein (MAP) kinase (Nakajima et al., 1993;

Trautwein et al., 1993) and by protein kinase C (PKC) on Serl05 in the transactivation domain

(Trautwein et al., 1993). Differential phosphorylation of C/EBPP may account for its

participation in a wide variety of biological effects (Piwien-Pilipuk et al., 2002). It has been

speculated that C/EBPP has negative regulatory regions that can also be phosphorylated.









Therefore, the protein may be present in cells as a repressed transcription factor that becomes

activated upon phosphorylation (Kowenz-Leutz et al., 1994; Williams et al., 1995).

C/EBPP can also be acetylated (Cesena et al., 2007; Duong et al., 2002; Joo et al., 2004).

The acetylation of proteins was first detected in histones and is considered a mechanism allowing

DNA to become accessible to transcription regulatory machinery (Allfrey et al., 1964; Roth et

al., 2001). C/EBPP has been shown to interact with the coactivator, p300 (Mink et al., 1997),

that has acetyltransferase activity (Ogryzko et al., 1996) and with the acetyltransferase, cyclic

AMP (cAMP) response-element-binding protein (Duong et al., 2002; Kovacs et al., 2003).

Recently, a novel acetylation site at Lys-39, which is activated by growth hormone (GH), was

identified. Mutations in this site decreased the ability of the protein to mediate transcriptional

activation of target genes, c-fos and c/ebpa (Cesena et al., 2007). The effect acetylation has on

C/EBPP activity is context specific. The association of Stat5 with histone deacetylase (HDAC)

deacetylated C/EBPP and promoted transcription of the target gene Id-1 (Xu et al., 2003).

CSC treatment could also affect the localization of C/EBPP protein in MCF 10A cells by

post-translational modifications. The localization of the protein probably contributes to its

function (Eaton et al., 2001). C/EBPP is localized primarily in the cytoplasm in primary human

mammary epithelial cells, but shifts to the nucleus where it can more readily act on target genes,

in breast cancer cell lines (Eaton et al., 2001). Phosphorylation has also been shown to affect the

subcellular distribution of C/EBPP. Relocalization of C/EBP proteins to an active, nuclear state

is mediated by cAMP or Ca2+-dependent protein kinases (Metz and Ziff, 1991). The nuclear

import of C/EBPP allowed for the transcriptional activation of p-casein in mouse primary

mammary epithelial cells (Kim et al., 2002). CSC treatment may activate signal transduction

pathways that affect the translation of C/EBPP isoforms. PKR and mTOR affect the translation









of C/EBPP isoforms and aberrant translational control of these kinases inhibited differentiation

and induced mammary epithelial cell transformation (Calkhoven et al., 2000). Ras and PI3K

signaling also targets C/EBPP (Bundy and Sealy, 2003).

The Potential Role of C/EBPP in CSC-induced Breast Carcinogenesis

C/EBPP expression is a critical component in the control of mammary epithelial cell

proliferation and differentiation in the functional mammary gland (Robinson et al., 1998;

Seagroves et al., 1998). It stands to reason that overexpression of the protein could lead to hyper

proliferation of mammary epithelial cells and eventually breast carcinogenesis. However, the

mechanisms by which C/EBPP influences breast carcinogenesis in general, are not well

established. The acquired metastatic properties of C/EBPP may be partially regulated by

enhanced survival of cells. The overexpression of C/EBPP in rat pancreatic tumor cells resulted

in increased levels of Bcl-xL (Shimizu et al., 2007). The current study indicates that the anti-

apoptotic activity of C/EBPP may occur through the upregulation of Bcl-xL. The involvement of

C/EBPP in breast carcinogenesis probably involves interactions with other proteins. The role of

C/EBPP in cell cycle progression is dependent on its interactions with Rb and cyclin D1. Rb

interacts with C/EBPP, however, the implications of these interactions are not fully understood

(Charles et al., 2001; Chen et al., 1996a; Chen et al., 1996b). LAP2 selectively activates the

cyclin Dl promoter (Eaton et al., 2001). The cyclin Dl gene, plays a role in cell cycle

progression, is amplified in 15-20% of breast cancers, and the protein or mRNA is overexpressed

in about 50% of breast cancers (Bartkova et al., 1994; Buckley et al., 1993). It has been

suggested that the inability of LAPI to activate the cyclin Dl promoter is due to the lack of the

required protein-protein interactions (Eaton et al., 2001).









C/EBPP protein interacts with proteins to open chromatin for access to transcription

factors and RNAPII. LAPI recruits SWI/SNF complexes to activate gene promoters (Kowenz-

Leutz and Leutz, 1999). SWI/SNF is a chromatin remodeling complex that opens chromatin for

RNA polymerase II loading and is required for eukaryotic transcription (Narlikar et al., 2002).

C/EBPP along with Runx2 recruits SWI/SNF to the bone-specific osteocalcin gene to recruit

RnAP II (Villagra et al., 2006). The oncogenic transcription factor, myb, and C/EBPP work

together to open chromatin at the (myb-inducible myelomoncytic-1) mim-1 promoter. C/EBPP

alone partially activated promoter activity, but Myb was required for full transcriptional

activation. This study was the first to identify C/EBPP in the initial steps of localized chromatin

opening at a relevant target region (Plachetka et al., 2008). From these studies it is reasonable to

hypothesize that increased levels of C/EBPP play a role in carcinogenesis by interacting with

other proteins to open chromatin and induce transcription of oncogenic genes.

The Relationship between C/EBPP, Bel-xL, and Breast Carcinogenesis

The results of this study indicate that C/EBPP is at least one of the transcription factors

that regulates the induction of bcl-xl mRNA and protein levels in CSC-treated MCF 10A cells.

This discovery places the bcl-xl promoter as a novel target gene of transcription factor, C/EBPP.

The following model is proposed as a starting point to uncovering the role of C/EBPP in the

upregulation of bcl-xl in MCF 10A cells treated with CSC (Figure 5-1). When human breast

epithelial cells are exposed to CSC, cells are damaged and most undergo apoptosis. In the few

surviving cells the C/EBPP protein levels are activated by an unknown mechanism. This

activation triggers the dimerization of two C/EBPP LAP2 monomers. LAP2 homodimers then

bind C/EBP site-II on the bcl-xl promoter and transcriptionally activate the mRNA and

subsequent protein expression levels ofBcl-xL. Since Bcl-xL is by definition an anti-apoptotic

protein (Boise et al., 1993) it is expected that increased levels of Bcl-xL impede the apoptotic










pathway, allowing for the accumulation of DNA damage (Mendez et al., 2005; Mendez et al.,

2001). When genes involved in DNA repair or the apoptotic pathway are also altered, the

accumulation of DNA damage can lead to cell cycle deregulation. Disruption of apoptotic

pathways, may also allow for damaged cells to survive and acquire the characteristics of

transformed cells. Bcl-xL expression has roles in breast carcinogenesis. Tumor cells

overexpressing Bcl-xL can adapt to new microenvironments (Espana et al., 2004; Fernandez et

al., 2002; Mendez et al., 2006; Rubio et al., 2001), have increased potential to metastasize

(Fernandez et al., 2002; Rubio et al., 2001), and are also more prone to be resistant to

chemotherapy and radiation therapy (Cherbonnel-Lasserre et al., 1996; Datta et al., 1995;

Fernandez et al., 2002; Simonian et al., 1997). All of these factors contribute to the initiation and

promotion of breast carcinogenesis.

The relationship between the C/EBPP and Bcl-xL is supported by several lines of

evidence. This study indicates that C/EBPP is required for CSC-induced regulation of bcl-xl in

MCF 10A cells. The proteins are required for proper mammary gland development (Robinson et

al., 1998; Seagroves et al., 1998; Seagroves et al., 2000; Walton et al., 2001). Bcl-xL and

C/EBPP are both expressed in stages of mammary gland development characterized by rapidly

proliferating cells such as lactation and pregnancy and are decreased during the apoptotic

involution phase (Gigliotti and DeWille, 1998; Heermeier et al., 1996; Robinson et al., 1998;

Sabatakos et al., 1998). Additionally, both are overexpressed in human breast cancer (Eaton et

al., 2001; Kraj ewski et al., 1999) and are associated with cancer progression, and more invasive

tumors that display higher histological grades (Eaton and Sealy, 2003; Milde-Langosch et al.,

2003; Olopade et al., 1997). This data suggests that it is likely that Bcl-xL and C/EBPP

cooperate during human breast tumorigenesis. The role of C/EBPP in inducing Bcl-xL










expression, along with other studies, also indicates that LAP2 is the primary C/EBPP isoform

involved in breast carcinogenesis. The current study not only provides insight to the mechanism

of cigarette smoke-induced breast epithelial cell transformation and carcinogenesis, it adds to the

literature that supports the link between cigarette smoking and increased breast cancer risk. The

results of the present study can therefore be used to determine chemotherapeutic targets to

decrease aberrant bcl-xl expression during breast carcinogenesis especially that which is induced

by exposure to cigarette smoke.

As with other proteins, there are a many factors that can regulate bcl-xl activity and other

transcription factors may still have a role in bcl-xl regulation. Studies have identified four maj or

classes of transcription factors that regulate the bcl-xl gene: Ets, Rel/ Nuclear factor kappa B

(NF-KB), STAT, and API (Grad et al., 2000; Sevilla et al., 2001). One of the first studies aimed

at identifying transcription factors regulating the bcl-xl promoter identified Ets2. Ets2, a member

of the Ets transcription factor family, is a nuclear proto-oncogene with sequence identity to the v-

ETS protein of the gag-Myb-Ets fusion protein of the E26 avian retrovirus (Boulukos et al.,

1988; Ghysdael et al., 1986; Watson et al., 1985; Watson et al., 1988). Ets inhibits colony-

stimulating factor 1 (CSF-1)-induced apoptosis macrophages by upregulating bcl-xl transcription

(Sevilla et al., 1999). Ets proteins are deregulated in a number of cancers (Boyd and Farnham,

1999) and are implicated in the regulation of matrix metalloproteinase expression, which offers a

potential connection to control of cell survival and metastasis (Westermarck and Kahari, 1999).

The NFxB family of transcription factors is involved in the regulation of inflammation, stress

and apoptosis (Beg et al., 1995; Sonenshein, 1997). NF-KB has been repeatedly shown to

regulation bcl-xl expression (Chen et al., 2000; Chen et al., 1999; Glasgow et al., 2001; Glasgow

et al., 2000; Tsukahara et al., 1999). The two proteins may form a positive feedback loop,









because Bcl-xL can affect upstream NF-KB activation (Badrichani et al., 1999). The relationship

between NF-KB and bcl-xl raise the possibility that activity of pro-survival genes may contribute

to oncogenesis when NF-KB is aberrantly expressed (Chen et al., 2000). Signal transducer and

activators of transcription (STATs) play roles in growth factor, cytokine, or hormone-mediated

cellular signal transduction (Darnell, 1997). Members of this protein family have been shown to

regulate bcl-xl (Grad et al., 2000) and evidence suggests that STATs contribute to oncogenesis

by modulating Bcl-xL levels (Bromberg et al., 1999; Grandis et al., 2000; Karni et al., 1999).

API complexes have roles in proliferation and differentiation pathways (Bannister, 1997). API

complexes consist of the oncogenes, Fos and Jun heterodimers or Jun homodimers, that bind to

the API DNA binding sites and have been shown to regulate Bcl-xL expression (Jacobs-Helber

et al., 1998; Sevilla et al., 1999).

Despite these transcription factors, it is important to note that when MCF 10A cells are

treated with CSC, C/EBPP is the primary transcription factor responsible for increased Bcl-xL

expression. Similar to the other transcription factors that regulate Bcl-xL, C/EBPP seems to have

a role in carcinogenesis. The regulation of the bcl-xl gene is most likely dependent on cell type

and stimuli (Grad et al., 2000).

Future and Directions

As with most scientific investigations, this study leads to other questions and experiments

that will provide a complete picture of the CSC-induced transformation of MCF 10A cells. The

present study focused specifically on the CSC-induced upregulation of bcl-xl in MCF 10A cells

and more studies are needed to confirm this mechanism in other cell types and situations.

Determining the protein that binds to C/EBP site-I on the pBcl-xLP will shed light on the

transformation of MCF 10A cells treated with CSC, and identify another protein that may be used

as a therapeutic target. The determination of the mechanism by which CSC induces C/EBPP is









also of up most importance. The present study suggests C/EBPP may be post-translationally

upregulated by CSC treatment. It is also possible that C/EBPP can be regulated on the

transcriptional level. Future experiments should focus on which, if any modifications are

induced by CSC treatment. Determining the types and sites of modifications can give a clearer

picture of CSC-induced C/EBPP and subsequent increased Bcl-xL expression in MCF 10A cells.

Although the C/EBPP hLIP overexpression construct allowed for an endogenous

knockdown system, siRNA can be used to more efficiently rid cells of C/EBPP expression and

determine whether Bcl-xL levels are still responsive to CSC treatment. Whether C/EBPP is

directly involved in the CSC-induced transformation of MCF 10A cells can also be determined

with a siRNA knockdown system. Characteristics of transformation can be compared between

MCF 10A cells treated with CSC in the presence or absence of C/EBPP siRNA. An important

question left unanswered by C/EBPP-LAP2 overexpression studies (Bundy et al., 2005; Bundy

and Sealy, 2003) is if LAP2 can cause MCF 10A cells to become tumorigenic in a mouse model

system. Establishing this relationship will indicate that C/EBPP, especially LAP2 has a role in

breast carcinogenesis.

Bcl-xL is associated with decreased apoptosis in tumors, resistance to chemotherapy, and

poor clinical outcome (Taylor et al., 1999). Several strategies to decrease Bcl-xL expression

have been developed. One example is the use of bcl-xl antisense oligonucleotides (Ackermann

et al., 1999; Dibbert et al., 1998; Espana et al., 2004; Pollman et al., 1998). Newer

oligonucleotides have been developed that are specific to bcl-xl and do not target bcl-x pre-

mRNA or bcl-xs (Simoes-Wust et al., 2000). Bcl-xS expression has also been used as

therapeutic agent against Bcl-xL (Ealovega et al., 1996). A pharmacological intervention that

simultaneously decreases Bcl-xL and increases Bcl-xS is also an important anti-tumor treatment










(Reed, 1995; Yang and Korsmeyer, 1996). Studies have also developed probes that bind to the

5' of bcl-x mRNA and force the translation of Bcl-xS protein instead of Bcl-xL (Mercatante et

al., 2001; Taylor et al., 1999). Strategies that keep Bcl-xL deaminated also have therapeutic

potential (Weintraub et al., 2004) because suppression of deamination occurs during

carcinogenesis (Takehara and Takahashi, 2003; Zhao et al., 2004). More recently, ABT-737, a

small molecule inhibitor of Bcl-xL as well as Bcl-2 and Bcl-w was discovered. It binds to the

BH3 binding groove of these anti-apoptotic proteins, enhancing the death signal by keeping them

from interacting with endogenous BH3-only proteins. The molecule regressed established

tumors and improved survival and cure rates in mouse models (Oltersdorf et al., 2005).

However, interventions targeting C/EBPP expression are limited. The implications of this study

include identifying C/EBPP as a potential oncogene and sparking research into therapeutics

aimed at decreasing its expression in cancer cells or tumors. C/EBPP may also become a

valuable molecular tool used to determine patient response to therapy and prognosis (Milde-

Langosch et al., 2003; Zahnow et al., 1997). Studies focusing on the regulation of the protein

will no doubt be critical to developing such therapeutic interventions.











:F10A cells

Inrese B Increased
C/EBPp -+ p BcI-xt
levels levels


CCT GAG C~TT CGC AAT TCC TG
Bdl-xt promoter

Apoptosis


MC


Cigarette
smoke 4
condensate


Accumulation
) ofgenetic
alterations






Transformation
of breast
epithrelial cells


Metastasis
Chemotherapy
resistance






Tumor
progression


Figure 5-1. Model of CSC-Induced C/EBPP upregulation of Bcl-xL in MCF10A cells.
Exposure of CSC to MCF 10A cells causes DNA damage and most cells die. The
surviving cells display increased levels of C/EBPP by an unknown mechanism.
C/EBPP-LAP2 homodimers form and bind to C/EBP site-II on the bcl-xl promoter,
positively activating its transcription. Increased levels of Bcl-xL protein prevents
damaged cells from being removed by apoptosis. Persistent DNA damage in these
cells leads genetic alterations, transformation of normal epithelial cells, and
eventually breast carcinogenesis. During carcinogenesis, Bcl-xL expression is linked
to metastasis and resistance to chemotherapy which affect tumor progression.


Tumorigenesis










LIST OF REFERENCES


Ackermann, E.J., Taylor, J.K., Narayana, R., and Bennett, C.F. (1999). The role of antiapoptotic
Bcl-2 family members in endothelial apoptosis elucidated with antisense oligonucleotides. J Biol
Chem 274, 11245-11252.

Adams, J.M., and Cory, S. (1998). The Bcl-2 protein family: arbiters of cell survival. Science
281, 1322-1326.

Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T.,
and Kishimoto, T. (1990). A nuclear factor for IL-6 expression (NF-IL6) is a member of a
C/EBP family. EMBO J 9, 1897-1906.

Albini, A., Iwamoto, Y., Kleinman, H.K., Martin, G.R., Aaronson, S.A., Kozlowski, J.M., and
McEwan, R.N. (1987). A rapid in vitro assay for quantitating the invasive potential of tumor
cells. Cancer Res 47, 3239-3245.

Allan, D.J., Howell, A., Roberts, S.A., Williams, G.T., Watson, R.J., Coyne, J.D., Clarke, R.B.,
Laidlaw, I.J., and Potten, C.S. (1992). Reduction in apoptosis relative to mitosis in histologically
normal epithelium accompanies fibrocystic change and carcinoma of the premenopausal human
breast. J Pathol 167, 25-32.

Allfrey, V.G., Faulkner, R., and Mirsky, A.E. (1964). Acetylation and Methylation of Histones
and Their Possible Role in the Regulation of Rna Synthesis. Proc Natl Acad Sci U SA 51, 786-
794.

Ambrosone, C.B., Freudenheim, J.L., Graham, S., Marshall, J.R., Vena, J.E., Brasure, J.R.,
Michalek, A.M., Laughlin, R., Nemoto, T., Gillenwater, K.A., and Shields, P.G. (1996).
Cigarette smoking, N-acetyltransferase 2 genetic polymorphisms, and breast cancer risk. JAMA
276, 1494-1501.

Ambrosone, C.B., Kropp, S., Yang, J., Yao, S., Shields, P.G., and Chang-Claude, J. (2008).
Cigarette smoking, N-acetyltransferase 2 genotypes, and breast cancer risk: pooled analysis and
meta-analysis. Cancer Epidemiol Biomarkers Prev 17, 15-26.

American Cancer Society (2008). Cancer Facts & Figures 2008. (Atlanta, American Cancer
Society).

Ames, B.N., McCann, J., and Yamasaki, E. (1975). Methods for detecting carcinogens and
mutagens with the Salmonella/mammali an-microsome mutagenicity test. Mutat Res 31, 3 47-3 64.

Annis, M.G., Soucie, E.L., Dlugosz, P.J., Cruz-Aguado, J.A., Penn, L.Z., Leber, B., and
Andrews, D.W. (2005). Bax forms multispanning monomers that oligomerize to permeabilize
membranes during apoptosis. EMBO J 24, 2096-2103.










Antonsson, B., Conti, F., Ciavatta, A., Montessuit, S., Lewis, S., Martinou, I., Bernasconi, L.,
Bernard, A., Mermod, J.J., Mazzei, G., et al. (1997). Inhibition of Bax channel-forming activity
by Bcl-2. Science 277, 370-372.

Armstrong, R. (1997). Glutathione-S-transferases, Vol 3 (New York, NY: Elsevier Science).

Artandi, S.E., Chang, S., Lee, S.L., Alson, S., Gottlieb, G.J., Chin, L., and DePinho, R.A. (2000).
Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice.
Nature 406, 641-645.

Bachelor, M.A., and Bowden, G.T. (2004). Ultraviolet A-induced modulation of Bcl-XL by p38
MAPK in human keratinocytes: post-transcriptional regulation through the 3'-untranslated
region. J Biol Chem 279, 42658-42668.

Badrichani, A.Z., Stroka, D.M., Bilbao, G., Curiel, D.T., Bach, F.H., and Ferran, C. (1999). Bcl-
2 and Bcl-XL serve an anti-inflammatory function in endothelial cells through inhibition of NF-
kappaB. J Clin Invest 103, 543-553.

Baer, M., and Johnson, P.F. (2000). Generation of truncated C/EBPbeta isoforms by in vitro
proteolysis. J Biol Chem 275, 26582-26590.

Baldwin, B.R., Timchenko, N.A., and Zahnow, C.A. (2004). Epidermal growth factor receptor
stimulation activates the RNA binding protein CUG-BP1 and increases expression of
C/EBPbeta-LIP in mammary epithelial cells. Mol Cell Biol 24, 3682-3691.

Ban, J., Eckhart, L., Weninger, W., Mildner, M., and Tschachler, E. (1998). Identification of a
human cDNA encoding a novel Bcl-x isoform. Biochem Biophys Res Commun 248, 147-152.

Band, P.R., Le, N.D., Fang, R., and Deschamps, M. (2002). Carcinogenic and endocrine
disrupting effects of cigarette smoke and risk of breast cancer. Lancet 360, 1044-1049.

Baron, J.A., La Vecchia, C., and Levi, F. (1990). The antiestrogenic effect of cigarette smoking
in women. Am J Obstet Gynecol 162, 502-514.

Baron, J.A., Newcomb, P.A., Longnecker, M.P., Mittendorf, R., Storer, B.E., Clapp, R.W.,
Bogdan, G., and Yuen, J. (1996). Cigarette smoking and breast cancer. Cancer Epidemiol
Biomarkers Prey 5, 399-403.

Bartkova, J., Lukas, J., Muller, H., Lutzhoft, D., Strauss, M., and Bartek, J. (1994). Cyclin Dl
protein expression and function in human breast cancer. Int J Cancer 57, 353-361.

Bartsch, H., Terracini, B., Malaveille, C., Tomatis, L., Wahrendorf, J., Brun, G., and Dodet, B.
(1983). Quantitative comparison of carcinogenicity, mutagenicity and electrophilicity of 10
direct-acting alkylating agents and of the initial 06:7-alkylguanine ratio in DNA with
carcinogenic potency in rodents. Mutat Res 110, 181-219.










Bannister, A., Kouzarides, T. (1997). Structure/function and oncogenic conversion of Fos and
Jun (Birkhauser. Basel [from 118]).

Baron, J.A., La Vecchia, C., and Levi, F. (1990). The antiestrogenic effect of cigarette smoking
in women. Am J Obstet Gynecol 162, 502-514.

Barry, M.A., Behnke, C.A., and Eastman, A. (1990). Activation of programmed cell death
(apoptosis) by cisplatin, other anticancer drugs, toxins and hyperthermia. Biochem Pharmacol
40, 2353-2362.

Beckmann, M.W., Niederacher, D., Schnurch, H.G., Gusterson, B.A., and Bender, H.G. (1997).
Multistep carcinogenesis of breast cancer and tumour heterogeneity. J Mol Med 75, 429-439.

Beg, A.A., Sha, W.C., Bronson, R.T., Ghosh, S., and Baltimore, D. (1995). Embryonic lethality
and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 3 76, 167-
170.

Bennett, W.P., Alavanja, M.C., Blomeke, B., Vahakangas, K.H., Castren, K., Welsh, J.A.,
Bowman, E.D., Khan, M.A., Flieder, D.B., and Harris, C.C. (1999). Environmental tobacco
smoke, genetic susceptibility, and risk of lung cancer in never-smoking women. J Natl Cancer
Inst 91, 2009-2014.

Benz, C.C., Scott, G.K., Sarup, J.C., Johnson, R.M., Tripathy, D., Coronado, E., Shepard, H.M.,
and Osborne, C.K. (1992). Estrogen-dependent, tamoxifen-resistant tumorigenic growth of
MCF-7 cells transfected with HER2/neu. Breast Cancer Res Treat 24, 85-95.

Bissell, M.J., Rizki, A., and Mian, I.S. (2003). Tissue architecture: the ultimate regulator of
breast epithelial function. Curr Opin Cell Biol 15, 753-762.

Biswas, R.S., Cha, H.J., Hardwick, J.M., and Srivastava, R.K. (2001). Inhibition of drug-induced
Fas ligand transcription and apoptosis by Bcl-XL. Mol Cell Biochem 225, 7-20.

Boatright, K.M., Renatus, M., Scott, F.L., Sperandio, S., Shin, H., Pedersen, I.M., Ricci, J.E.,
Edris, W.A., Sutherlin, D.P., Green, D.R., and Salvesen, G.S. (2003). A unified model for apical
caspase activation. Mol Cell 11, 529-541.

Bode, A.M., and Dong, Z. (2005). Signal transduction pathways in cancer development and as
targets for cancer prevention. Prog Nucleic Acid Res Mol Biol 79, 237-297.

Boise, L.H., Gonzalez-Garcia, M., Postema, C.E., Ding, L., Lindsten, T., Turka, L.A., Mao, X.,
Nunez, G., and Thompson, C.B. (1993). bcl-x, a bcl-2-related gene that functions as a dominant
regulator of apoptotic cell death. Cell 74, 597-608.

Boise, L.H., and Thompson, C.B. (1997). Bcl-x(L) can inhibit apoptosis in cells that have
undergone Fas-induced protease activation. Proc Natl Acad Sci U SA 94, 3759-3764.










Bonfil, R.D., Reddel, R.R., Ura, H., Reich, R., Fridman, R., Harris, C.C., and Klein-Szanto, J.P.
(1989). Invasive and metastatic potential of a v-Ha-ras-transformed human bronchial epithelial
cell line. J Natl Cancer Inst 81, 587-594.

Boulukos, K.E., Pognonec, P., Begue, A., Galibert, F., Gesquiere, J.C., Stehelin, D., and
Ghysdael, J. (1988). Identification in chickens of an evolutionarily conserved cellular ets-2 gene
(c-ets-2) encoding nuclear proteins related to the products of the c-ets proto-oncogene. EMBO J
7, 697-705.

Boyd, K.E., and Farnham, P.J. (1999). Identification of target genes of oncogenic transcription
factors. Proc Soc Exp Biol Med 222, 9-28.

Bremnes, Y., Ursin, G., Bjurstam, N., and Gram, I.T. (2007). Different measures of smoking
exposure and mammographic density in postmenopausal Norwegian women: a cross-sectional
study. Breast Cancer Res 9, R73.

Bromberg, J.F., Wrzeszczynska, M.H., Devgan, G., Zhao, Y., Pestell, R.G., Albanese, C., and
Darnell, J.E., Jr. (1999). Stat3 as an oncogene. Cell 98, 295-303.

Buckley, M.F., Sweeney, K.J., Hamilton, J.A., Sini, R.L., Manning, D.L., Nicholson, R.I.,
deFazio, A., Watts, C.K., Musgrove, E.A., and Sutherland, R.L. (1993). Expression and
amplification of cyclin genes in human breast cancer. Oncogene 8, 2127-2133.

Bundy, L., Wells, S., and Sealy, L. (2005). C/EBPbeta-2 confers EGF-independent growth and
disrupts the normal acinar architecture of human mammary epithelial cells. Mol Cancer 4, 43.

Bundy, L.M., and Sealy, L. (2003). CCAAT/enhancer binding protein beta (C/EBPbeta)-2
transforms normal mammary epithelial cells and induces epithelial to mesenchymal transition in
culture. Oncogene 22, 869-883.

Burchell, B., McGurk, K, Brierley, CH, Clarke, DJ (1997). UDPglucuronosyltransferases, Vol 3
(New York, NY: Elsevier Science).

Cai, J., Yang, J., and Jones, D.P. (1998). Mitochondrial control of apoptosis: the role of
cytochrome c. Biochim Biophys Acta 1366, 139-149.

Calaf, G., and Russo, J. (1993). Transformation of human breast epithelial cells by chemical
carcinogens. Carcinogenesis 14, 483-492.

Calkhoven, C.F., Muller, C., and Leutz, A. (2000). Translational control of C/EBPalpha and
C/EBPbeta isoform expression. Genes Dev 14, 1920-1932.

Campos, L., Rouault, J.P., Sabido, O., Oriol, P., Roubi, N., Vasselon, C., Archimbaud, E.,
Magaud, J.P., and Guyotat, D. (1993). High expression of bcl-2 protein in acute myeloid
leukemia cells is associated with poor response to chemotherapy. Blood 81, 3091-3096.

Cao, Z., Umek, R.M., and McKnight, S.L. (1991). Regulated expression of three C/EBP
isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5, 1538-1552.










Castle, V.P., Heidelberger, K.P., Bromberg, J., Ou, X., Dole, M., and Nunez, G. (1993).
Expression of the apoptosis-suppressing protein bcl-2, in neuroblastoma is associated with
unfavorable histology and N-myc amplification. Am J Pathol 143, 1543-1550.

Cavalieri, E.L., Higginbotham, S., RamaKrishna, N.V., Devanesan, P.D., Todorovic, R., Rogan,
E.G., and Salmasi, S. (1991). Comparative dose-response tumorigenicity studies of
dibenzo[alpha,1]pyrene versus 7, 12-dimethylbenz[alpha]anthracene, benzo[alpha]pyrene and two
dibenzo[alpha,1]pyrene dihydrodiols in mouse skin and rat mammary gland. Carcinogenesis 12,
1939-1944.

Centers for Disease Control and Prevention (2007). Cigarette Smoking Among Adults United
States, 2004. In MMWR Morb Mortal Wkly Rep, pp. 1157-1161.Chambers, A.F., Naumov,
G.N., Varghese, H.J., Nadkarni, K.V., MacDonald, I.C., and Groom, A.C. (2001). Critical steps
in hematogenous metastasis: an overview. Surg Oncol Clin N Am 10, 243-255, vii.

Cesena, T.I., Cardinaux, J.R., Kwok, R., and Schwartz, J. (2007). CCAAT/enhancer-binding
protein (C/EBP) beta is acetylated at multiple lysines: acetylation of C/EBPbeta at lysine 39
modulates its ability to activate transcription. J Biol Chem 282, 956-967.

Chambers, A.F., Naumov, G.N., Varghese, H.J., Nadkarni, K.V., MacDonald, I.C., and Groom,
A.C. (2001). Critical steps in hematogenous metastasis: an overview. Surg Oncol Clin N Am 10,
243-255, vii.

Chang, B.S., Minn, A.J., Muchmore, S.W., Fesik, S.W., and Thompson, C.B. (1997).
Identification of a novel regulatory domain in Bcl-X(L) and Bcl-2. EMBO J 16, 968-977.

Change, S. (1966). In vitro transformation of human epithelial cells. Biochem Biophys Acta 823,
161-194.

Charafe-Jauffret, E., Ginestier, C., Monville, F., Finetti, P., Adelaide, J., Cervera, N., Fekairi, S.,
Xerri, L., Jacquemier, J., Birnbaum, D., and Bertucci, F. (2006). Gene expression profiling of
breast cell lines identifies potential new basal markers. Oncogene 25, 2273-2284.

Charles, A., Tang, X., Crouch, E., Brody, J.S., and Xiao, Z.X. (2001). Retinoblastoma protein
complexes with C/EBP proteins and activates C/EBP-mediated transcription. J Cell Biochem 83,
414-425.

Chen, C., Edelstein, L.C., and Gelinas, C. (2000). The Rel/NF-kappaB family directly activates
expression of the apoptosis inhibitor Bcl-x(L). Mol Cell Biol 20, 2687-2695.

Chen, P.L., Riley, D.J., Chen, Y., and Lee, W.H. (1996). Retinoblastoma protein positively
regulates terminal adipocyte differentiation through direct interaction with C/EBPs. Genes Dev
10, 2794-2804.

Chen, P.L., Riley, D.J., Chen-Kiang, S., and Lee, W.H. (1996). Retinoblastoma protein directly
interacts with and activates the transcription factor NF-IL6. Proc Natl Acad Sci U SA 93, 465-
469.










Chen, C.S., Mrksich, M., Huang, S., Whitesides, G.M., and Ingber, D.E. (1997). Geometric
control of cell life and death. Science 276, 1425-1428.

Cheng, E.H., Levine, B., Boise, L.H., Thompson, C.B., and Hardwick, J.M. (1996). Bax-
independent inhibition of apoptosis by Bcl-XL. Nature 379, 554-556.

Cheng, E.H., Wei, M.C., Weiler, S., Flavell, R.A., Mak, T.W., Lindsten, T., and Korsmeyer, S.J.
(2001). BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-
mediated mitochondrial apoptosis. Mol Cell 8, 705-711.

Chepiga, T.A., Morton, M.J., Murphy, P.A., Avalos, J.T., Bombick, B.R., Doolittle, D.J.,
Borgerding, M.F., and Swauger, J.E. (2000). A comparison of the mainstream smoke chemistry
and mutagenicity of a representative sample of the US cigarette market with two Kentucky
reference cigarettes (KlR4F and KlR5F). Food Chem Toxicol 38, 949-962.

Cherbonnel-Lasserre, C., Gauny, S., and Kronenberg, A. (1996). Suppression of apoptosis by
Bcl-2 or Bcl-xL promotes susceptibility to mutagenesis. Oncogene 13, 1489-1497.

Chinnaiyan, A.M. (1999). The apoptosome: heart and soul of the cell death machine. Neoplasia
1, 5-15.

Chinnaiyan, A.M., and Dixit, V.M. (1996). The cell-death machine. Curr Biol 6, 555-562.

Chinnaiyan, A.M., and Dixit, V.M. (1997). Portrait of an executioner: the molecular mechanism
of FAS/APO-1-induced apoptosis. Semin Immunol 9, 69-76.

Chinnaiyan, A.M., O'Rourke, K., Tewari, M., and Dixit, V.M. (1995). FADD, a novel death
domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell
81, 505-512.

Chipuk, J.E., Bhat, M., Hsing, A.Y., Ma, J., and Danielpour, D. (2001). Bcl-xL blocks
transforming growth factor-beta 1-induced apoptosis by inhibiting cytochrome c release and not
by directly antagonizing Apaf-1-dependent caspase activation in prostate epithelial cells. J Biol
Chem 276, 26614-26621.

Chittenden, T., Flemington, C., Houghton, A.B., Ebb, R.G., Gallo, G.J., Elangovan, B.,
Chinnadurai, G., and Lutz, R.J. (1995). A conserved domain in Bak, distinct from BH1 and BH2,
mediates cell death and protein binding functions. EMBO J 14, 5589-5596.

Ciechanover, A. (1994). The ubiquitin-proteasome proteolytic pathway. Cell 79, 13-21.

Cory, S., and Adams, J.M. (2002). The Bcl2 family: regulators of the cellular life-or-death
switch. Nat Rev Cancer 2, 647-656.

Cory, S., Huang, D.C., and Adams, J.M. (2003). The Bcl-2 family: roles in cell survival and
oncogenesis. Oncogene 22, 8590-8607.










Cramer, W.A., Heymann, J.B., Schendel, S.L., Deriy, B.N., Cohen, F.S., Elkins, P.A., and
Stauffacher, C.V. (1995). Structure-function of the channel-forming colicins. Annu Rev Biophys
Biomol Struct 24, 611-641.

Croniger, C., Trus, M., Lysek-Stupp, K., Cohen, H., Liu, Y., Darlington, G.J., Poli, V., Hanson,
R.W., and Reshef, L. (1997). Role of the isoforms of CCAAT/enhancer-binding protein in the
initiation of phosphoenolpyruvate carboxykinase (GTP) gene transcription at birth. J Biol Chem
272, 26306-26312.

Cuzick, J., Routledge, M.N., Jenkins, D., and Garner, R.C. (1990). DNA adducts in different
tissues of smokers and non-smokers. Int J Cancer 45, 673-678.

Darnell, J.E., Jr. (1997). STATs and gene regulation. Science 277, 1630-1635.

Datta, R., Manome, Y., Taneja, N., Boise, L.H., Weichselbaum, R., Thompson, C.B., Slapak,
C.A., and Kufe, D. (1995). Overexpression of Bcl-XL by cytotoxic drug exposure confers
resistance to ionizing radiation-induced internucleosomal DNA fragmentation. Cell Growth
Differ 6, 363-370.

Davis, B.R., Whitehead, J.K., Gill, M.E., Lee, P.N., Butterworth, A.D., and Roe, F.J. (1975).
Response of rat lung to inhaled tobacco smoke with or without prior exposure to 3,4-benzpyrene
(BP) given by intratracheal instillation. Br J Cancer 31, 469-484.

Davis, D., Vaught, A, Tso,TC, Bush, LP (1984). Analysis of a new low yield research cigarette
(Lexington, KY: Tobacco and Health Institute).

Dearth, L.R., Hutt, J., Sattler, A., Gigliotti, A., and DeWille, J. (2001). Expression and function
of CCAAT/enhancer binding proteinbeta (C/EBPbeta) LAP and LIP isoforms in mouse
mammary gland, tumors and cultured mammary epithelial cells. J Cell Biochem 82, 357-370.

Debnath, J., Mills, K.R., Collins, N.L., Reginato, M.J., Muthuswamy, S.K., and Brugge, J.S.
(2002). The role of apoptosis in creating and maintaining luminal space within normal and
oncogene-expressing mammary acini. Cell 111, 29-40.

DeMarini, D.M. (2004). Genotoxicity of tobacco smoke and tobacco smoke condensate: a
review. Mutat Res 567, 447-474.

Dertinger, S.D., Nazarenko, D.A., Silverstone, A.E., and Gasiewicz, T.A. (2001). Aryl
hydrocarbon receptor signaling plays a significant role in mediating benzo[a]pyrene- and
cigarette smoke condensate-induced cytogenetic damage in vivo. Carcinogenesis 22, 171-177.

Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and Schibler, U. (1990). LAP, a novel
member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein.
Genes Dev 4, 1541-1551.










Descombes, P., and Schibler, U. (1991). A liver-enriched transcriptional activator protein, LAP,
and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67, 569-
579.

Deverman, B.E., Cook, B.L., Manson, S.R., Niederhoff, R.A., Langer, E.M., Rosova, I., Kulans,
L.A., Fu, X., Weinberg, J.S., Heinecke, J.W., et al. (2002). Bcl-xL deamidation is a critical
switch in the regulation of the response to DNA damage. Cell 111, 5 1-62.

Dibbert, B., Daigle, I., Braun, D., Schranz, C., Weber, M., Blaser, K., Zangemeister-Wittke, U.,
Akbar, A.N., and Simon, H.U. (1998). Role for Bcl-xL in delayed eosinophil apoptosis mediated
by granulocyte-macrophage colony-stimulating factor and interleukin-5. Blood 92, 778-783.

DiPaolo, J.A. (1983). Relative difficulties in transforming human and animal cells in vitro. J Natl
Cancer Inst 70, 3-8.

Doll, R., Peto, R (1981). The Causes of Cancer (New York, NY: Oxford Press).

Donahue, T.F., Cigan, A.M., Pabich, E.K., and Valavicius, B.C. (1988). Mutations at a Zn(II)
finger motif in the yeast elF-2 beta gene alter ribosomal start-site selection during the scanning
process. Cell 54, 621-632.

Donepudi, M., Mac Sweeney, A., Briand, C., and Grutter, M.G. (2003). Insights into the
regulatory mechanism for caspase-8 activation. Mol Cell 11, 543-549.

Du, C., Fang, M., Li, Y., Li, L., and Wang, X. (2000). Smac, a mitochondrial protein that
promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102,
33-42.

Duong, D.T., Waltner-Law, M.E., Sears, R., Sealy, L., and Granner, D.K. (2002). Insulin inhibits
hepatocellular glucose production by utilizing liver-enriched transcriptional inhibitory protein to
disrupt the association of CREB-binding protein and RNA polymerase II with the
phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 277, 32234-32242.

Egan, K.M., Stampfer, M.J., Hunter, D., Hankinson, S., Rosner, B.A., Holmes, M., Willett,
W.C., and Colditz, G.A. (2002). Active and passive smoking in breast cancer: prospective results
from the Nurses' Health Study. Epidemiology 13, 138-145.

Ealovega, M.W., McGinnis, P.K., Sumantran, V.N., Clarke, M.F., and Wicha, M.S. (1996). bcl-
xs gene therapy induces apoptosis of human mammary tumors in nude mice. Cancer Res 56,
1965-1969.

Espana, L., Fernandez, Y., Rubio, N., Torregrosa, A., Blanco, J., and Sierra, A. (2004).
Overexpression of Bcl-xL in human breast cancer cells enhances organ-selective lymph node
metastasis. Breast Cancer Res Treat 87, 33-44.

Eaton, E.M., Hanlon, M., Bundy, L., and Sealy, L. (2001). Characterization of C/EBPbeta
isoforms in normal versus neoplastic mammary epithelial cells. J Cell Physiol 189, 91-105.










el-Bayoumy, K., Chae, Y.H., Upadhyaya, P., Rivenson, A., Kurtzke, C., Reddy, B., and Hecht,
S.S. (1995). Comparative tumorigenicity of benzo[a]pyrene, 1-nitropyrene and 2-amino-1-
methyl-6-phenylimidazo[4,5-b]pyridine administered by gavage to female CD rats.
Carcinogenesis 16, 431-434.

Fang, W., Rivard, J.J., Mueller, D.L., and Behrens, T.W. (1994). Cloning and molecular
characterization of mouse bcl-x in B and T lymphocytes. J Immunol 153, 4388-4398.

Farrow, S.N., and Brown, R. (1996). New members of the Bcl-2 family and their protein
partners. Curr Opin Genet Dev 6, 45-49.

Fearon, E. R. and Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell 61,
759-767.

Fernandez, Y., Gu, B., Martinez, A., Torregrosa, A., and Sierra, A. (2002). Inhibition of
apoptosis in human breast cancer cells: role in tumor progression to the metastatic state. Int J
Cancer 101, 317-326.

Fernandez, Y., Espana, L., Manas, S., Fabra, A., and Sierra, A. (2000). Bcl-xL promotes
metastasis of breast cancer cells by induction of cytokines resistance. Cell Death Differ 7, 3 50-
359.

Fiebig, A.A., Zhu, W., Hollerbach, C., Leber, B., and Andrews, D.W. (2006). Bcl-XL is
qualitatively different from and ten times more effective than Bcl-2 when expressed in a breast
cancer cell line. BMC Cancer 6, 213.

Fink, A.K., and Lash, T.L. (2003). A null association between smoking during pregnancy and
breast cancer using Massachusetts registry data (United States). Cancer Causes Control 14, 497-
503.

Firozi, P.F., Bondy, M.L., Sahin, A.A., Chang, P., Lukmanji, F., Singletary, E.S., Hassan, M.M.,
and Li, D. (2002). Aromatic DNA adducts and polymorphisms of CYP1lA, NAT2, and GSTM1
in breast cancer. Carcinogenesis 23, 301-306.

Finucane, D.M., Bossy-Wetzel, E., Waterhouse, N.J., Cotter, T.G., and Green, D.R. (1999). Bax-
induced caspase activation and apoptosis via cytochrome c release from mitochondria is
inhibitable by Bcl-xL. J Biol Chem 2 74, 2225-2233.

Frisch, S.M., and Francis, H. (1994). Disruption of epithelial cell-matrix interactions induces
apoptosis. J Cell Biol 124, 619-626.

Gago, F.E., Tello, O.M., Diblasi, A.M., and Ciocca, D.R. (1998). Integration of estrogen and
progesterone receptors with pathological and molecular prognostic factors in breast cancer
patients. J Steroid Biochem Mol Biol 67, 431-437.

Gery, S., Tanosaki, S., Bose, S., Bose, N., Vadgama, J., and Koeffler, H.P. (2005). Down-
regulation and growth inhibitory role of C/EBPalpha in breast cancer. Clin Cancer Res 11, 3184-
3190.











Ghysdael, J., Gegonne, A., Pognonec, P., Boulukos, K., Leprince, D., Dernis, D., Lagrou, C., and
Stehelin, D. (1986). Identification in chicken macrophages of a set of proteins related to, but
distinct from, the chicken cellular c-ets-encoded protein p54c-ets. EMBO J 5, 2251-2256.

Gibson, L., Holmgreen, S.P., Huang, D.C., Bernard, O., Copeland, N.G., Jenkins, N.A.,
Sutherland, G.R., Baker, E., Adams, J.M., and Cory, S. (1996). bcl-w, a novel member of the
bcl-2 family, promotes cell survival. Oncogene 13, 665-675.

Gigliotti, A.P., and DeWille, J.W. (1998). Lactation status influences expression of
CCAAT/enhancer binding protein isoform mRNA in the mouse mammary gland. J Cell Physiol
1 74, 232-239.

Gigliotti, A.P., Johnson, P.F., Sterneck, E., and DeWille, J.W. (2003). Nulliparous
CCAAT/enhancer binding proteindelta (C/EBPdelta) knockout mice exhibit mammary gland
ductal hyperlasia. Exp Biol Med (Maywood) 228, 278-285.

Giovannucci, E., Colditz, G.A., Stampfer, M.J., Hunter, D., Rosner, B.A., Willett, W.C., and
Speizer, F.E. (1994). A prospective study of cigarette smoking and risk of colorectal adenoma
and colorectal cancer in U. S. women. J Natl Cancer Inst 86, 192-199.

Giovannucci, E., Rimm, E.B., Stampfer, M.J., Colditz, G.A., Ascherio, A., Kearney, J., and
Willett, W.C. (1994). A prospective study of cigarette smoking and risk of colorectal adenoma
and colorectal cancer in U.S. men. J Natl Cancer Inst 86, 183-191.

Giovannucci, E., and Martinez, M.E. (1996). Tobacco, colorectal cancer, and adenomas: a
review of the evidence. J Natl Cancer Inst 88, 1717-1730.

Gisselsson, D. (2003). Chromosome instability in cancer: how, when, and why? Adv Cancer Res
87, 1-29.

Glasgow, J.N., Qiu, J., Rassin, D., Grafe, M., Wood, T., and Perez-Pol, J.R. (2001).
Transcriptional regulation of the BCL-X gene by NF-kappaB is an element of hypoxic responses
in the rat brain. Neurochem Res 26, 647-659.

Glasgow, J.N., Wood, T., and Perez-Polo, J.R. (2000). Identification and characterization of
nuclear factor kappaB binding sites in the murine bcl-x promoter. J Neurochem 75, 1377-1389.

Gonzalez-Garcia, M., Garcia, I., Ding, L., O'Shea, S., Boise, L.H., Thompson, C.B., and Nunez,
G. (1995). bcl-x is expressed in embryonic and postnatal neural tissues and functions to prevent
neuronal cell death. Proc Natl Acad Sci U SA 92, 4304-4308.

Gonzalez-Garcia, M., Perez-Ballestero, R., Ding, L., Duan, L., Boise, L.H., Thompson, C.B., and
Nunez, G. (1994). bcl-XL is the maj or bcl-x mRNA form expressed during murine development
and its product localizes to mitochondria. Development 120, 3033-3042.










Goode, E.L., Ulrich, C.M., and Potter, J.D. (2002). Polymorphisms in DNA repair genes and
associations with cancer risk. Cancer Epidemiol Biomarkers Prev 11, 1513-1530.

Gordon, L.A., Mulligan, K.T., Maxwell-Jones, H., Adams, M., Walker, R.A., and Jones, J.L.
(2003). Breast cell invasive potential relates to the myoepithelial phenotype. Int J Cancer 106, 8-
16.

Grad, J.M., Zeng, X.R., and Boise, L.H. (2000). Regulation of Bcl-xL: a little bit of this and a
little bit of STAT. Curr Opin Oncol 12, 543-549.

Grandis, J.R., Drenning, S.D., Zeng, Q., Watkins, S.C., Melhem, M.F., Endo, S., Johnson, D.E.,
Huang, L., He, Y., and Kim, J.D. (2000). Constitutive activation of Stat3 signaling abrogates
apoptosis in squamous cell carcinogenesis in vivo. Proc Natl Acad Sci U SA 97, 4227-4232.

Green, D.R., and Kroemer, G. (2004). The pathophysiology of mitochondrial cell death. Science
305, 626-629.

Griffith, R.B., and Hancock, R. (1985). Simultaneous mainstream-sidestream smoke exposure
systems I. Equipment and procedures. Toxicology 34, 123-138.

Grillot, D.A., Gonzalez-Garcia, M., Ekhterae, D., Duan, L., Inohara, N., Ohta, S., Seldin, M.F.,
and Nunez, G. (1997). Genomic organization, promoter region analysis, and chromosome
localization of the mouse bcl-x gene. J Immunol 158, 4750-4757.

Grimm, S.L., and Rosen, J.M. (2003). The role of C/EBPbeta in mammary gland development
and breast cancer. J Mammary Gland Biol Neoplasia 8, 191-204.

Gross, A., McDonnell, J.M., and Korsmeyer, S.J. (1999). BCL-2 family members and the
mitochondria in apoptosis. Genes Dev 13, 1899-1911.

Gu, B., Espana, L., Mendez, O., Torregrosa, A., and Sierra, A. (2004). Organ-selective
chemoresistance in metastasis from human breast cancer cells: inhibition of apoptosis, genetic
variability and microenvironment at the metastatic focus. Carcinogenesis 25, 2293-2301.

Guengerich, F.P. (2001). Common and uncommon cytochrome P450 reactions related to
metabolism and chemical toxicity. Chem Res Toxicol 14, 611-650.

Hamajima, N., Hirose, K., Tajima, K., Rohan, T., Calle, E.E., Heath, C.W., Jr., Coates, R.J., Liff,
J.M., Talamini, R., Chantarakul, N., et al. (2002). Alcohol, tobacco and breast cancer--
collaborative reanalysis of individual data from 53 epidemiological studies, including 58,515
women with breast cancer and 95,067 women without the disease. Br J Cancer 87, 1234-1245.

Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100, 57-70.

He, L., Perkins, G.A., Poblenz, A.T., Harris, J.B., Hung, M., Ellisman, M.H., and Fox, D.A.
(2003). Bcl-xL overexpression blocks bax-mediated mitochondrial contact site formation and
apoptosis in rod photoreceptors of lead-exposed mice. Proc Natl Acad Sci U SA 100, 1022-
1027.










Hecht, S.S. (1999). Tobacco smoke carcinogens and lung cancer. J Natl Cancer Inst 91, 1194-
1210.

Hecht, S.S. (2002). Tobacco smoke carcinogens and breast cancer. Environ Mol Mutagen 39,
119-126.

Hecht, S.S. (2003). Tobacco carcinogens, their biomarkers and tobacco-induced cancer. Nat Rev
Cancer 3, 733-744.

Heermeier, K., Benedict, M., Li, M., Furth, P., Nunez, G., and Hennighausen, L. (1996). Bax and
Bcl-xs are induced at the onset of apoptosis in involuting mammary epithelial cells. Mech Dev
56, 197-207.

Hirai, Y., Radisky, D., Boudreau, R., Simian, M., Stevens, M.E., Oka, Y., Takebe, K., Niwa, S.,
and Bissell, M.J. (2001). Epimorphin mediates mammary luminal morphogenesis through
control of C/EBPbeta. J Cell Biol 153, 785-794.

Hoffmann, D., Hoffmann, I., and El-Bayoumy, K. (2001). The less harmful cigarette: a
controversial issue. a tribute to Ernst L. Wynder. Chem Res Toxicol 14, 767-790.

Hoffmann, D., and Wynder, E.L. (1971). A study of tobacco carcinogenesis. XI. Tumor
initiators, tumor accelerators, and tumor promoting activity of condensate fractions. Cancer 2 7,
848-864.

Hoffmann, D., and Wynder, E.L. (1968). Selective reduction of the tumorigenicity of tobacco
smoke. Experimental approaches. Natl Cancer Inst Monogr 28, 151-172.

Hsieh, C.C., Xiong, W., Xie, Q., Rabek, J.P., Scott, S.G., An, M.R., Reisner, P.D., Kuninger,
D.T., and Papaconstantinou, J. (1998). Effects of age on the posttranscriptional regulation of
CCAAT/enhancer binding protein alpha and CCAAT/enhancer binding protein beta isoform
synthesis in control and LPS-treated livers. Mol Biol Cell 9, 1479-1494.

Hsu, S.Y., Kaipia, A., McGee, E., Lomeli, M., and Hsueh, A.J. (1997). Bok is a pro-apoptotic
Bcl-2 protein with restricted expression in reproductive tissues and heterodimerizes with
selective anti-apoptotic Bcl-2 family members. Proc Natl Acad Sci U SA 94, 12401-12406.

Hsu, T.C., Cherry, L.M., Bucana, C., Shirley, L.R., and Gairola, C.G. (1991). Mitosis-arresting
effects of cigarette smoke condensate on human lymphoid cell lines. Mutat Res 259, 67-78.

Hsu, Y.T., and Youle, R.J. (1998). Bax in murine thymus is a soluble monomeric protein that
displays differential detergent-induced conformations. J Biol Chem 273, 10777-10783.

Hu, Y., Benedict, M.A., Wu, D., Inohara, N., and Nunez, G. (1998). Bcl-XL interacts with Apaf-
1 and inhibits Apaf-1-dependent caspase-9 activation. Proc Natl Acad Sci U SA 95, 4386-4391.

Huang, D.C., Adams, J.M., and Cory, S. (1998). The conserved N-terminal BH4 domain of Bcl-
2 homologues is essential for inhibition of apoptosis and interaction with CED-4. EMBO J 17,
1029-1039.










International Agency for Research on Cancer (1972-2000). IARC Monographs on the Evaluation
of Carcinogenic Risks of Chemicals to Humans.

International Agency for Research on Cancer (1985). IARC monographs on the Evaluation of
Carcinogenic Risks to Humans (Lyon, France, International Agency for Cancer Research), p. 15.

International Agency for Research on Cancer (2004). Tobacco smoking and tobacco smoke. In
IARC Monographs on the Evaluation of the Carcinogenic Risks of Chemicals to Humans (Lyon,
France) .

Jaattela, M., Benedict, M., Tewari, M., Shayman, J.A., and Dixit, V.M. (1995). Bcl-x and Bcl-2
inhibit TNF and Fas-induced apoptosis and activation of phospholipase A2 in breast carcinoma
cells. Oncogene 10, 2297-2305.

Jacobs-Helber, S.M., Wickrema, A., Birrer, M.J., and Sawyer, S.T. (1998). API regulation of
proliferation and initiation of apoptosis in erythropoietin-dependent erythroid cells. Mol Cell
Biol 18, 3699-3707.

Jaiswal, A.S., Aneja, R., Connors, S.K., Joshi, H.C., Multani, A.S., Pathak, S., Narayan, S.
(2008). Increased mitotic arrest and apoptosis of cigarette smoke condensate-transformed versus
normal human breast epithelial cells in response to 9-Br-Noscapine. In unpublished data.

Jalas, J.R., Hecht, S.S., and Murphy, S.E. (2005). Cytochrome P450 enzymes as catalysts of
metabolism of 4-(methylnitrosamino)- 1-(3-pyridyl)-1 -butanone, a tobacco specific carcinogen.
Chem Res Toxicol 18, 95-110.

Jeong, S.Y., Gaume, B., Lee, Y.J., Hsu, Y.T., Ryu, S.W., Yoon, S.H., and Youle, R.J. (2004).
Bcl-x(L) sequesters its C-terminal membrane anchor in soluble, cytosolic homodimers. EMBO J
23, 2146-2155.

John, E.M., and Kelsey, J.L. (1993). Radiation and other environmental exposures and breast
cancer. Epidemiol Rev 15, 157-162.

Johnson, K.C., Hu, J., and Mao, Y. (2000). Passive and active smoking and breast cancer risk in
Canada, 1994-97. Cancer Causes Control 11, 211-221.

Johnson, P.F. (1993). Identification of C/EBP basic region residues involved in DNA sequence
recognition and half-site spacing preference. Mol Cell Biol 13, 6919-6930.

Joo, M., Park, G.Y., Wright, J.G., Blackwell, T.S., Atchison, M.L., and Christman, J.W. (2004).
Transcriptional regulation of the cyclooxygenase-2 gene in macrophages by PU. 1. J Biol Chem
279, 6658-6665.

Jordan, V.C. (1993). Fourteenth Gaddum Memorial Lecture. A current view of tamoxifen for the
treatment and prevention of breast cancer. Br J Pharmacol 110, 507-517.

Karrison, T.G., Ferguson, D.J., and Meier, P. (1999). Dormancy of mammary carcinoma after
mastectomy. J Natl Cancer Inst 91, 80-85.










Kaufmann, S.H. (1989). Induction of endonucleolytic DNA cleavage in human acute
myelogenous leukemia cells by etoposide, camptothecin, and other cytotoxic anticancer drugs: a
cautionary note. Cancer Res 49, 5870-5878.

Kelekar, A., and Thompson, C.B. (1998). Bcl-2-family proteins: the role of the BH3 domain in
apoptosis. Trends Cell Biol 8, 324-330.

Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon
with wide-ranging implications in tissue kinetics. Br J Cancer 26, 239-257.

Kim, J.W., Tang, Q.Q., Li, X., and Lane, M.D. (2007). Effect of phosphorylation and S-S bond-
induced dimerization on DNA binding and transcriptional activation by C/EBPbeta. Proc Natl
Acad Sci U SA 104, 1800-1804.

Knudson, A.G., Jr. (1971). Mutation and cancer: statistical study of retinoblastoma. Proc Natl
Acad Sci U SA 68, 820-823.

Korsmeyer, S.J. (1992). Bcl-2 initiates a new category of oncogenes: regulators of cell death.
Blood 80, 879-886.

Kowenz-Leutz, E., Twamley, G., Ansicau, S., and Leutz, A. (1994). Novel mechanism of C/EBP
beta (NF-M) transcriptional control: activation through derepression. Genes Dev 8, 2781-2791.

Kovacs, K.A., Steinmann, M., Magistretti, P.J., Halfon, O., and Cardinaux, J.R. (2003).
CCAAT/enhancer-binding protein family members recruit the coactivator CREB-binding protein
and trigger its phosphorylation. J Biol Chem 278, 36959-36965.

Kozopas, K.M., Yang, T., Buchan, H.L., Zhou, P., and Craig, R.W. (1993). MCL1, a gene
expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2. Proc
Natl Acad Sci U SA 90, 3516-3520.

Krajewska, M., Moss, S.F., Krajewski, S., Song, K., Holt, P.R., and Reed, J.C. (1996). Elevated
expression of Bcl-X and reduced Bak in primary colorectal adenocarcinomas. Cancer Res 56,
2422-2427.

Krajewski, S., Krajewska, M., Turner, B.C., Pratt, C., Howard, B., Zapata, J.M., Frenkel, V.,
Robertson, S., lonov, Y., Yamamoto, H., et al. (1999). Prognostic significance of apoptosis
regulators in breast cancer. Endocr Relat Cancer 6, 29-40.

Kumar, R., Mandal, M., Lipton, A., Harvey, H., and Thompson, C.B. (1996). Overexpression of
HER2 modulates bcl-2, bcl-XL, and tamoxifen-induced apoptosis in human MCF-7 breast
cancer cells. Clin Cancer Res 2, 1215-1219.

Kumar, R., Medina, D., and Sukumar, S. (1990). Activation of H-ras oncogenes in preneoplastic
mouse mammary tissues. Oncogene 5, 1271-1277.










Kundu, C.N., Balusu, R., Jaiswal, A.S., Gairola, C.G., and Narayan, S. (2007). Cigarette smoke
condensate-induced level of adenomatous polyposis coli blocks long-patch base excision repair
in breast epithelial cells. Oncogene 26, 1428-1438.

Kuribayashi, K., Mayes, P.A., and El-Deiry, W.S. (2006). What are caspases 3 and 7 doing
upstream of the mitochondria? Cancer Biol Ther 5, 763-765.

Landschulz, W.H., Johnson, P.F., and McKnight, S.L. (1989). The DNA binding domain of the
rat liver nuclear protein C/EBP is bipartite. Science 243, 1681-1688.

Landschulz, W.H., Johnson, P.F., Adashi, E.Y., Graves, B.J., and McKnight, S.L. (1988).
Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev 2, 786-800.

Landschulz, W.H., Johnson, P.F., and McKnight, S.L. (1988). The leucine zipper: a hypothetical
structure common to a new class of DNA binding proteins. Science 240, 1759-1764.

Lash, T.L., and Aschengrau, A. (2002). A null association between active or passive cigarette
smoking and breast cancer risk. Breast Cancer Res Treat 75, 181-184.

Lekstrom-Himes, J., and Xanthopoulos, K.G. (1998). Biological role of the CCAAT/enhancer-
binding protein family of transcription factors. J Biol Chem 2 73, 28545-28548.

Letai, A., Bassik, M.C., Walensky, L.D., Sorcinelli, M.D., Weiler, S., and Korsmeyer, S.J.
(2002). Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as
prototype cancer therapeutics. Cancer Cell 2, 183-192.

Li, C., Fox, C.J., Master, S.R., Bindokas, V.P., Chodosh, L.A., and Thompson, C.B. (2002). Bcl-
X(L) affects Ca(2+) homeostasis by altering expression of inositol 1,4,5-trisphosphate receptors.
Proc Natl Acad Sci U SA 99, 9830-9835.

Li, D., Wang, M., Dhingra, K., and Hittelman, W.N. (1996a). Aromatic DNA adducts in adjacent
tissues of breast cancer patients: clues to breast cancer etiology. Cancer Res 56, 287-293.

Li, H., Zhu, H., Xu, C.J., and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates the
mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501.

Li, M., Hu, J., Heermeier, K., Hennighausen, L., and Furth, P.A. (1996b). Apoptosis and
remodeling of mammary gland tissue during involution proceeds through p53-independent
pathways. Cell Growth Differ 7, 13-20.

Li, M., Hu, J., Heermeier, K., Hennighausen, L., and Furth, P.A. (1996c). Expression of a viral
oncoprotein during mammary gland development alters cell fate and function: induction of p53-
independent apoptosis is followed by impaired milk protein production in surviving cells. Cell
Growth Differ 7, 3-11.

Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., and Wang, X.
(1997). Cytochrome c and dATP-dependent formation of Apaf- 1/caspase-9 complex initiates an
apoptotic protease cascade. Cell 91, 479-489.










Lin, E.Y., Orlofsky, A., Wang, H.G., Reed, J.C., and Prystowsky, M.B. (1996). Al, a Bcl-2
family member, prolongs cell survival and permits myeloid differentiation. Blood 87, 983-992.

Liotta, L.A. (1984). Tumor invasion and metastases: role of the basement membrane. Warner-
Lambert Parke-Davis Award lecture. Am J Pathol 117, 339-348.

Liu, Q.Y., and Stein, C.A. (1997). Taxol and estramustine-induced modulation of human prostate
cancer cell apoptosis via alteration in bcl-xL and bak expression. Clin Cancer Res 3, 2039-2046.

Liu, R., Page, C., Beidler, D.R., Wicha, M. S., and Nunez, G. (1999). Overexpression of Bcl-x(L)
promotes chemotherapy resistance of mammary tumors in a syngeneic mouse model. Am J
Pathol 155, 1861-1867.

Lohmann, C.M., League, A.A., Clark, W.S., Lawson, D., DeRose, P.B., and Cohen, C. (2000).
Bcl-2: bax and bcl-2: Bcl-x ratios by image cytometric quantitation of immunohistochemical
expression in ovarian carcinoma: correlation with prognosis. Cytometry 42, 61-66.

London, E. (1992). Diphtheria toxin: membrane interaction and membrane translocation.
Biochim Biophys Acta 1113, 25-51.

Luo, L.Z., Werner, K.M., Gollin, S.M., and Saunders, W.S. (2004). Cigarette smoke induces
anaphase bridges and genomic imbalances in normal cells. Mutat Res 554, 375-385.

MacCarthy-Morrogh, L., Wood, L., Brimmell, M., Johnson, P.W., and Packham, G. (2000).
Identification of a novel human BCL-X promoter and exon. Oncogene 19, 5534-5538.

MacCarthy, J., Basara, MI, Palon, DF, Funcht, LT (1988). The role of cell adhesion proteins,
laminum and fibronectiv in the movement of malignant and metastatic cells. Cancer Metastases
Rev 4, 12-152.

MacMahon, B. (1990). Cigarette smoking and cancer of the breast (Oxford, United Kingdom:
Oxford University Press).

Manna, S.K., Haridas, V., and Aggarwal, B.B. (2000). Bcl-x(L) suppresses TNF-mediated
apoptosis and activation of nuclear factor-kappaB, activation protein-1, and c-Jun N-terminal
kinase. J Interferon Cytokine Res 20, 725-735.

Martin, S.S., and Leder, P. (2001). Human MCF10A mammary epithelial cells undergo
apoptosis following actin depolymerization that is independent of attachment and rescued by
Bcl-2. Mol Cell Biol 21, 6529-6536.

Martin, S.S., and Vuori, K. (2004). Regulation of Bcl-2 proteins during anoikis and amorphosis.
Biochim Biophys Acta 1692, 145-157.

Maung, Z.T., MacLean, F.R., Reid, M.M., Pearson, A.D., Proctor, S.J., Hamilton, P.J., and Hall,
A.G. (1994). The relationship between bcl-2 expression and response to chemotherapy in acute
leukaemia. Br J Haematol 88, 105-109.










Maurer, C.A., Friess, H., Buhler, S.S., Wahl, B.R., Graber, H., Zimmermann, A., and Buchler,
M.W. (1998). Apoptosis inhibiting factor Bcl-xL might be the crucial member of the Bcl-2 gene
family in colorectal cancer. Dig Dis Sci 43, 2641-2648.

McClintock, B. (1942). The Fusion of Broken Ends of Chromosomes Following Nuclear Fusion.
Proc Natl Acad Sci U SA 28, 458-463.

McConkey, D.J., Greene, G., and Pettaway, C.A. (1996). Apoptosis resistance increases with
metastatic potential in cells of the human LNCaP prostate carcinoma line. Cancer Res 56, 5594-
5599.

McCormick, J.J., and Maher, V.M. (1989). Malignant transformation of mammalian cells in
culture, including human cells. Environ Mol Mutagen 14 Suppl 16, 105-113.

Medema, J.P., Scaffidi, C., Krammer, P.H., and Peter, M.E. (1998). Bcl-xL acts downstream of
caspase-8 activation by the CD95 death-inducing signaling complex. J Biol Chem 273, 3388-
3393.

Mei, J., Hu, H., McEntee, M., Plummer, H., 3rd, Song, P., and Wang, H.C. (2003).
Transformation of non-cancerous human breast epithelial cell line MCF 10A by the tobacco-
specific carcinogen NNK. Breast Cancer Res Treat 79, 95-105.

Mendez, O., Fernandez, Y., Peinado, M.A., Moreno, V., and Sierra, A. (2005). Anti-apoptotic
proteins induce non-random genetic alterations that result in selecting breast cancer metastatic
cells. Clin Exp Metastasis 22, 297-307.

Mendez, O., Martin, B., Sanz, R., Aragues, R., Moreno, V., Oliva, B., Stresing, V., and Sierra,
A. (2006). Underexpression of transcriptional regulators is common in metastatic breast cancer
cells overexpressing Bcl-xL. Carcinogenesis 27, 1169-1179.

Mensing, H., Albini, A., Krieg, T., Pontz, B.F., and Muller, P.K. (1984). Enhanced chemotaxis
of tumor-derived and virus-transformed cells to fibronectin and fibroblast-conditioned medium.
Int J Cancer 33, 43-48.

Metz, R., and Ziff, E. (1991). cAMP stimulates the C/EBP-related transcription factor rNFIL-6
to trans-locate to the nucleus and induce c-fos transcription. Genes Dev 5, 1754-1766.

Milde-Langosch, K., Loning, T., and Bamberger, A.M. (2003). Expression of the
CCAAT/enhancer-binding proteins C/EBPalpha, C/EBPbeta and C/EBPdelta in breast cancer:
correlations with clinicopathologic parameters and cell-cycle regulatory proteins. Breast Cancer
Res Treat 79, 175-185.

Miller, F.R., Soule, H.D., Tait, L., Pauley, R.J., Wolman, S.R., Dawson, P.J., and Heppner, G.H.
(1993). Xenograft model of progressive human proliferative breast disease. J Natl Cancer Inst
85, 1725-1732.

Mink, S., Haenig, B., and Klempnauer, K.H. (1997). Interaction and functional collaboration of
p300 and C/EBPbeta. Mol Cell Biol 1 7, 6609-6617.










Minn, A.J., Velez, P., Schendel, S.L., Liang, H., Muchmore, S.W., Fesik, S.W., Fill, M., and
Thompson, C.B. (1997). Bcl-x(L) forms an ion channel in synthetic lipid membranes. Nature
385, 353-357.

Miyashita, T., Krajewski, S., Krajewska, M., Wang, H.G., Lin, H.K., Liebermann, D.A.,
Hoffman, B., and Reed, J.C. (1994). Tumor suppressor p53 is a regulator of bcl-2 and bax gene
expression in vitro and in vivo. Oncogene 9, 1799-1805.

Montgomery, E., Wilentz, R.E., Argani, P., Fisher, C., Hruban, R.H., Kern, S.E., and Lengauer,
C. (2003). Analysis of anaphase figures in routine histologic sections distinguishes
chromosomally unstable from chromosomally stable malignancies. Cancer Biol Ther 2, 248-252.

Motoyama, N., Wang, F., Roth, K.A., Sawa, H., Nakayama, K., Negishi, I., Senju, S., Zhang, Q.,
Fujii, S., and et al. (1995). Massive cell death of immature hematopoietic cells and neurons in
Bcl-x-deficient mice. Science 267, 1506-1510.

Muchmore, S.W., Sattler, M., Liang, H., Meadows, R.P., Harlan, J.E., Yoon, H.S., Nettesheim,
D., Chang, B.S., Thompson, C.B., Wong, S.L., et al. (1996). X-ray and NMR structure of human
Bcl-xL, an inhibitor of programmed cell death. Nature 381, 335-341.

Muthuswamy, S.K., Li, D., Lelievre, S., Bissell, M.J., and Brugge, J.S. (2001). ErbB2, but not
ErbB 1, reinitiates proliferation and induces luminal repopulation in epithelial acini. Nat Cell Biol
3, 785-792.

Nagaraj, N.S., Beckers, S., Mensah, J.K., Waigel, S., Vigneswaran, N., and Zacharias, W.
(2006). Cigarette smoke condensate induces cytochromes P450 and aldo-keto reductases in oral
cancer cells. Toxicol Lett 165, 182-194.

Nakajima, T., Kinoshita, S., Sasagawa, T., Sasaki, K., Naruto, M., Kishimoto, T., and Akira, S.
(1993). Phosphorylation at threonine-23 5 by a ras-dependent mitogen-activated protein kinase
cascade is essential for transcription factor NF-IL6. Proc Natl Acad Sci U SA 90, 2207-2211.
Nakayama, T., Kaneko, M., Kodama, M., and Nagata, C. (1985). Cigarette smoke induces DNA
single-strand breaks in human cells. Nature 314, 462-464.

Narayan, S., Jaiswal, A.S., Kang, D., Srivastava, P., Das, G.M., and Gairola, C.G. (2004).
Cigarette smoke condensate-induced transformation of normal human breast epithelial cells in
vitro. Oncogene 23, 5880-5889.

Narlikar, G.J., Fan, H.Y., and Kingston, R.E. (2002). Cooperation between complexes that
regulate chromatin structure and transcription. Cell 108, 475-487.

National Cancer Institute (2007). Women's Health Report, Fiscal Years 2005-2006.

National Center for Health Statistics (2006). Health, United States, 2006 with Chartbook on
Trends in the Health of Americans. (Hyattsville, MD, Public Health Service).










Nebert, D.W., Dalton, T.P., Okey, A.B., and Gonzalez, F.J. (2004). Role of aryl hydrocarbon
receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J Biol
Chem 279, 23847-23850.

Newton, K., Harris, A.W., Bath, M.L., Smith, K.G., and Strasser, A. (1998). A dominant
interfering mutant of FADD/MORT1 enhances deletion of autoreactive thymocytes and inhibits
proliferation of mature T lymphocytes. EMBO J 1 7, 706-718.

Neve, R.M., Chin, K., Fridlyand, J., Yeh, J., Bachner, F.L., Fevr, T., Clark, L., Bayani, N.,
Coppe, J.P., Tong, F., et al. (2006). A collection of breast cancer cell lines for the study of
functionally distinct cancer subtypes. Cancer Cell 10, 515-527.

O'Connor, L., and Strasser, A. (1999). The Bcl-2 protein family. Results Probl Cell Differ 23,
173-207.

Obana, H., Hori, S., Kashimoto, T., and Kunita, N. (1981). Polycyclic aromatic hydrocarbons in
human fat and liver. Bull Environ Contam Toxicol 27, 23-27.

Ochieng, J., Basolo, F., Albini, A., Melchiori, A., Watanabe, H., Elliott, J., Raz, A., Parodi, S.,
and Russo, J. (1991). Increased invasive, chemotactic and locomotive abilities of c-Ha-ras-
transformed human breast epithelial cells. Invasion Metastasis 11, 38-47.

Ogryzko, V.V., Schiltz, R.L., Russanova, V., Howard, B.H., and Nakatani, Y. (1996). The
transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87, 953-959.

Olopade, O.I., Adeyanju, M.O., Safa, A.R., Hagos, F., Mick, R., Thompson, C.B., and Recant,
W.M. (1997). Overexpression of BCL-x protein in primary breast cancer is associated with high
tumor grade and nodal metastases. Cancer J Sci Am 3, 230-237.

Oltersdorf, T., Elmore, S.W., Shoemaker, A.R., Armstrong, R.C., Augeri, D.J., Belli, B.A.,
Bruncko, M., Deckwerth, T.L., Dinges, J., Hajduk, P.J., et al. (2005). An inhibitor of Bcl-2
family proteins induces regression of solid tumours. Nature 435, 677-681.

Oltvai, Z.N., Milliman, C.L., and Korsmeyer, S.J. (1993). Bcl-2 heterodimerizes in vivo with a
conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609-619.

Opferman, J.T., and Korsmeyer, S.J. (2003). Apoptosis in the development and maintenance of
the immune system. Nat Immunol 4, 410-415.

O'Rourke, J., Yuan, R., and DeWille, J. (1997). CCAAT/enhancer-binding protein-delta (C/EBP-
delta) is induced in growth-arrested mouse mammary epithelial cells. J Biol Chem 272, 6291-
6296.

O'Rourke, J.P., Newbound, G.C., Hutt, J.A., and DeWille, J. (1999). CCAAT/enhancer-binding
protein delta regulates mammary epithelial cell GO growth arrest and apoptosis. J Biol Chem
274, 16582-16589.










Osada, S., Yamamoto, H., Nishihara, T., and Imagawa, M. (1996). DNA binding specificity of
the CCAAT/enhancer-binding protein transcription factor family. J Biol Chem 271, 3891-3896.

Osada, H., and Takahashi, T. (2002). Genetic alterations of multiple tumor suppressors and
oncogenes in the carcinogenesis and progression of lung cancer. Oncogene 21, 7421-7434.

Ossipow, V., Descombes, P., and Schibler, U. (1993). CCAAT/enhancer-binding protein mRNA
is translated into multiple proteins with different transcription activation potentials. Proc Natl
Acad Sci U SA 90, 8219-8223.

Packham, G., White, E.L., Eischen, C.M., Yang, H., Parganas, E., Ihle, J.N., Grillot, D.A.,
Zambetti, G.P., Nunez, G., and Cleveland, J.L. (1998). Selective regulation of Bcl-XL by a Jak
kinase-dependent pathway is bypassed in murine hematopoietic malignancies. Genes Dev 12,
2475-2487.

Palmer, J.R., and Rosenberg, L. (1993). Cigarette smoking and the risk of breast cancer.
Epidemiol Rev 15, 145-156.

Pan, G., O'Rourke, K., and Dixit, V.M. (1998). Caspase-9, Bcl-XL, and Apaf-1 form a ternary
complex. J Biol Chem 273, 5841-5845.

Pardo, O.E., Arcaro, A., Salerno, G., Raguz, S., Downward, J., and Seckl, M.J. (2002).
Fibroblast growth factor-2 induces translational regulation of Bcl-XL and Bcl-2 via a MEK-
dependent pathway: correlation with resistance to etoposide-induced apoptosis. J Biol Chem 277,
12040-12046.

Park, I.W., Wistuba, II, Maitra, A., Milchgrub, S., Virmani, A.K., Minna, J.D., and Gazdar, A.F.
(1999). Multiple clonal abnormalities in the bronchial epithelium of patients with lung cancer. J
Natl Cancer Inst 91, 1863-1868.

Pause, A., Belsham, G.J., Gingras, A.C., Donze, O., Lin, T.A., Lawrence, J.C., Jr., and
Sonenberg, N. (1994). Insulin-dependent stimulation of protein synthesis by phosphorylation of a
regulator of 5'-cap function. Nature 371, 762-767.

Pecci, A., Viegas, L.R., Baranao, J.L., and Beato, M. (2001). Promoter choice influences
alternative splicing and determines the balance of isoforms expressed from the mouse bcl-X
gene. J Biol Chem 276, 21062-21069.

Pelkonen, O., Vahakangas, K., and Nebert, D.W. (1980). Binding of polycyclic aromatic
hydrocarbons to DNA: comparison with mutagenesis and tumorigenesis. J Toxicol Environ
Health 6, 1009-1020.

Perera, F.P., Estabrook, A., Hewer, A., Channing, K., Rundle, A., Mooney, L.A., Whyatt, R.,
and Phillips, D.H. (1995). Carcinogen-DNA adducts in human breast tissue. Cancer Epidemiol
Biomarkers Prey 4, 233-23 8.










Peter, M.E., Kischkel, F.C., Scheuerpflug, C.G., Medema, J.P., Debatin, K.M., and Krammer,
P.H. (1997). Resistance of cultured peripheral T cells towards activation-induced cell death
involves a lack of recruitment of FLICE (MACH/caspase 8) to the CD95 death-inducing
signaling complex. Eur J Immunol 27, 1207-1212.

Pollman, M.J., Hall, J.L., Mann, M.J., Zhang, L., and Gibbons, G.H. (1998). Inhibition of
neointimal cell bcl-x expression induces apoptosis and regression of vascular disease. Nat Med
4, 222-227.

Seto, R., Lopez, A.D., Boreham, J., Thun, M., Heath, C., Jr., and Doll, R. (1996). Mortality from
smoking worldwide. Br Med Bull 52, 12-21.

Perou, C.M., Sorlie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Rees, C.A., Pollack, J.R.,
Ross, D.T., Johnsen, H., Akslen, L.A., et al. (2000). Molecular portraits of human breast
tumours. Nature 406, 747-752.

Petrakis, N.L. (1977). Breast secretary activity in nonlactating women, postpartum breast
involution, and the epidemiology of breast cancer. Natl Cancer Inst Monogr 47, 161-164.

Petrakis, N.L. (1977). Genetic factors in the etiology of breast cancer. Cancer 39, 2709-2715.

Petrakis, N.L., Gruenke, L.D., Beelen, T.C., Castagnoli, N., Jr., and Craig, J.C. (1978). Nicotine
in breast fluid of nonlactating women. Science 199, 303-305.

Petrakis, N.L., Maack, C.A., Lee, R.E., and Lyon, M. (1980). Mutagenic activity in nipple
aspirates of human breast fluid. Cancer Res 40, 188-189.

Petrakis, N.L., Mason, L., Lee, R., Sugimoto, B., Pawson, S., and Catchpool, F. (1975).
Association of race, age, menopausal status, and cerumen type with breast fluid secretion in
nonlactating women, as determined by nepple aspiration. J Natl Cancer Inst 54, 829-834.

Petros, A.M., Medek, A., Nettesheim, D.G., Kim, D.H., Yoon, H.S., Swift, K., Matayoshi, E.D.,
Oltersdorf, T., and Fesik, S.W. (2001). Solution structure of the antiapoptotic protein bcl-2. Proc
Natl Acad Sci U SA 98, 3012-3017.

Phillips, D.H., and Garte, S. (2008). Smoking and breast cancer: is there really a link? Cancer
Epidemiol Biomarkers Prev 17, 1-2.

Piwien-Pilipuk, G., MacDougald, O., and Schwartz, J. (2002). Dual regulation of
phosphorylation and dephosphorylation of C/EBPbeta modulate its transcriptional activation and
DNA binding in response to growth hormone. J Biol Chem 277, 44557-44565.

Plachetka, A., Chayka, O., Wilczek, C., Melnik, S., Bonifer, C., and Klempnauer, K.H. (2008).
C/EBPbeta induces chromatin opening at a cell-type-specific enhancer. Mol Cell Biol 28, 2102-
2112.










Poli, V., Mancini, F.P., and Cortese, R. (1990). IL-6DBP, a nuclear protein involved in
interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to
C/EBP. Cell 63, 643-653.

Porter, D., Lahti-Domenici, J., Keshaviah, A., Bae, Y.K., Argani, P., Marks, J., Richardson, A.,
Cooper, A., Strausberg, R., Riggins, G.J., et al. (2003). Molecular markers in ductal carcinoma in
situ of the breast. Mol Cancer Res 1, 362-375.

Poruchynsky, M.S., Wang, E.E., Rudin, C.M., Blagosklonny, M.V., and Fojo, T. (1998). Bcl-xL
is phosphorylated in malignant cells following microtubule disruption. Cancer Res 58, 3331-
3338.

Polyak, K., Hamilton, S.R., Vogelstein, B., and Kinzler, K.W. (1996). Early alteration of cell-
cycle-regulated gene expression in colorectal neoplasia. Am J Pathol 149, 381-387.

Ramji, D.P., and Foka, P. (2002). CCAAT/enhancer-binding proteins: structure, function and
regulation. Biochem J 365, 561-575.

Raught, B., Gingras, A.C., James, A., Medina, D., Sonenberg, N., and Rosen, J.M. (1996).
Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein
beta isoform and up-regulation of the eukaryotic translation initiation factor 2alpha are correlated
with neoplastic transformation of mammary epithelial cells. Cancer Res 56, 43 82-43 86.

Raught, B., Liao, W.S., and Rosen, J.M. (1995). Developmentally and hormonally regulated
CCAAT/enhancer-binding protein isoforms influence beta-casein gene expression. Mol
Endocrinol 9, 1223-1232.

Reed, J.C. (1997). Double identity for proteins of the Bcl-2 family. Nature 387, 773-776.

Repesh, L.A. (1989). A new in vitro assay for quantitating tumor cell invasion. Invasion
Metastasis 9, 192-208.

Reynolds, P., Hurley, S., Goldberg, D.E., Anton-Culver, H., Bernstein, L., Deapen, D., Horn-
Ross, P.L., Peel, D., Pinder, R., Ross, R.K., et al. (2004). Active smoking, household passive
smoking, and breast cancer: evidence from the California Teachers Study. J Natl Cancer Inst 96,
29-37.

Rithidech, K., Chen, B.T., Mauderly, J.L., Whorton, E.B., Jr., and Brooks, A.L. (1989).
Cytogenetic effects of cigarette smoke on pulmonary alveolar macrophages of the rat. Environ
Mol Mutagen 14, 27-33.

Robinson, G.W., Johnson, P.F., Hennighausen, L., and Sterneck, E. (1998). The C/EBPbeta
transcription factor regulates epithelial cell proliferation and differentiation in the mammary
gland. Genes Dev 12, 1907-1916.










Ronnov-Jessen, L., Petersen, O.W., and Bissell, M.J. (1996). Cellular changes involved in
conversion of normal to malignant breast: importance of the stromal reaction. Physiol Rev 76,
69-125.

Roth, S.Y., Denu, J.M., and Allis, C.D. (2001). Histone acetyltransferases. Annu Rev Biochem
70, 81-120.

Rouayrenc, J.F., Boise, L.H., Thompson, C.B., Privat, A., and Patey, G. (1995). Presence of the
long and the short forms of Bcl-X in several human and murine tissues. C R Acad Sci III 318,
537-540.

Routledge, M.N., Garner, R.C., Jenkins, D., and Cuzick, J. (1992). 32P-postlabelling analysis of
DNA from human tissues. Mutat Res 282, 139-145.

Rubio, N., Espana, L., Fernandez, Y., Blanco, J., and Sierra, A. (2001). Metastatic behavior of
human breast carcinomas overexpressing the Bcl-x(L) gene: a role in dormancy and
organospecificity. Lab Invest 81, 725-734.

Rudin, N. (1997). Transformation. In Dictionary of Modern Biology (Hauppauge, NY, Barron' s
Educational Series, Inc.), p. 371.

Russo, J., and Russo, I.H. (1980). Influence of differentiation and cell kinetics on the
susceptibility of the rat mammary gland to carcinogenesis. Cancer Res 40, 2677-2687.

Russo, J., and Russo, I.H. (1987). Biological and molecular bases of mammary carcinogenesis.
Lab Invest 57, 112-137.

Russo, J., and Russo, I.H. (2001). The pathway of neoplastic transformation of human breast
epithelial cells. Radiat Res 155, 151-154.

Russo, J., Tay, L.K., and Russo, I.H. (1982). Differentiation of the mammary gland and
susceptibility to carcinogenesis. Breast Cancer Res Treat 2, 5-73.

Sarrio, D., Rodriguez-Pinilla, S.M., Hardisson, D., Cano, A., Moreno-Bueno, G., and Palacios, J.
(2008). Epithelial-mesenchymal transition in breast cancer relates to the basal-like phenotype.
Cancer Res 68, 989-997.

Sabatakos, G., Davies, G.E., Grosse, M., Cryer, A., and Ramji, D.P. (1998). Expression of the
genes encoding CCAAT-enhancer binding protein isoforms in the mouse mammary gland during
lactation and involution. Biochem J 334 (Pt 1), 205-210.

Schendel, S.L., Xie, Z., Montal, M.O., Matsuyama, S., Montal, M., and Reed, J.C. (1997).
Channel formation by antiapoptotic protein Bcl-2. Proc Natl Acad Sci U SA 94, 5113-5118.

Schneider, T.J., Grillot, D., Foote, L.C., Nunez, G.E., and Rothstein, T.L. (1997). Bcl-x protects
primary B cells against Fas-mediated apoptosis. J Immunol 159, 4834-4839.










Schott, A.F., Apel, I.J., Nunez, G., and Clarke, M.F. (1995). Bcl-XL protects cancer cells from
p53-mediated apoptosis. Oncogene 11, 1389-1394.

Schreier, M.H., and Stachelin, T. (1973). Initiation of eukaryotic protein synthesis: (Met-tRNA f
-40S ribosome) initiation complex catalysed by purified initiation factors in the absence of
mRNA. Nat New Biol 242, 35-38.

Screpanti, I., Romani, L., Musiani, P., Modesti, A., Fattori, E., Lazzaro, D., Sellitto, C., Scarpa,
S., Bellavia, D., Lattanzio, G., and et al. (1995). Lymphoproliferative disorder and imbalanced
T-helper response in C/EBP beta-deficient mice. EMBO J 14, 1932-1941.

Seagroves, T.N., Krnacik, S., Raught, B., Gay, J., Burgess-Beusse, B., Darlington, G.J., and
Rosen, J.M. (1998). C/EBPbeta, but not C/EBPalpha, is essential for ductal morphogenesis,
lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes
Dev 12, 1917-1928.

Seagroves, T.N., Lydon, J.P., Hovey, R.C., Vonderhaar, B.K., and Rosen, J.M. (2000).
C/EBPbeta (CCAAT/enhancer binding protein) controls cell fate determination during mammary
gland development. Mol Endocrinol 14, 359-368.

Seto, M., Jaeger, U., Hockett, R.D., Graninger, W., Bennett, S., Goldman, P., and Korsmeyer,
S.J. (1988). Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig
fusion gene in lymphoma. EMBO J 7, 123-131.

Sevilla, L., Aperlo, C., Dulic, V., Chambard, J.C., Boutonnet, C., Pasquier, O., Pognonec, P., and
Boulukos, K.E. (1999). The Ets2 transcription factor inhibits apoptosis induced by colony-
stimulating factor 1 deprivation of macrophages through a Bcl-xL-dependent mechanism. Mol
Cell Biol 19, 2624-2634.

Shapiro, D.J., Sharp, P.A., Wahli, W.W., and Keller, M.J. (1988). A high-efficiency HeLa cell
nuclear transcription extract. DNA 7, 47-55.

Sheridan, C., Kishimoto, H., Fuchs, R.K., Mehrotra, S., Bhat-Nakshatri, P., Turner, C.H., Goulet,
R., Jr., Badve, S., and Nakshatri, H. (2006). CD44+/CD24- breast cancer cells exhibit enhanced
invasive properties: an early step necessary for metastasis. Breast Cancer Res 8, R59.

Shimizu, Y., Kishimoto, T., Ohtsuka, M., Kimura, F., Shimizu, H., Yoshidome, H., and
Miyazaki, M. (2007). CCAAT/enhancer binding protein-beta promotes the survival of
intravascular rat pancreatic tumor cells via antiapoptotic effects. Cancer Sci 98, 1706-1713.

Shin, S.I., Freedman, V.H., Risser, R., and Pollack, R. (1975). Tumorigenicity of virus-
transformed cells in nude mice is correlated specifically with anchorage independent growth in
vitro. Proc Natl Acad Sci U SA 72, 4435-4439.

Shu, H.P., and Bymun, E.N. (1983). Systemic excretion of benzo(a)pyrene in the control and
microsomally induced rat: the influence of plasma lipoproteins and albumin as carrier molecules.
Cancer Res 43, 485-490.










Simoes-Wust, A.P., Olie, R.A., Gautschi, O., Leech, S.H., Haner, R., Hall, J., Fabbro, D., Stahel,
R.A., and Zangemeister-Wittke, U. (2000). Bcl-xl antisense treatment induces apoptosis in breast
carcinoma cells. Int J Cancer 87, 582-590.

Simonian, P.L., Grillot, D.A., and Nunez, G. (1997). Bcl-2 and Bcl-XL can differentially block
chemotherapy-induced cell death. Blood 90, 1208-1216.
Sivko, G.S., and DeWille, J.W. (2004). CCAAT/Enhancer binding protein delta (c/EBPdelta)
regulation and expression in human mammary epithelial cells: I. "Loss of function" alterations in
the c/EBPdelta growth inhibitory pathway in breast cancer cell lines. J Cell Biochem 93, 830-
843.

Siziopikou, K.P., and Khan, S. (2005). Correlation ofHER2 gene amplification with expression
of the apoptosis-suppressing genes bcl-2 and bcl-x-L in ductal carcinoma in situ of the breast.
Appl Immunohistochem Mol Morphol 13, 14-18.

Slamon, D.J., deKernion, J.B., Verma, I.M., and Cline, M.J. (1984). Expression of cellular
oncogenes in human malignancies. Science 224, 256-262.

Slamon, D.J., Godolphin, W., Jones, L.A., Holt, J.A., Wong, S.G., Keith, D.E., Levin, W.J.,
Stuart, S.G., Udove, J., Ullrich, A., and et al. (1989). Studies of the HER-2/neu proto-oncogene
in human breast and ovarian cancer. Science 244, 707-712.

Smale, S.T., and Baltimore, D. (1989). The "initiator" as a transcription control element. Cell 57,
103-113.

Smith, C.J., and Hansch, C. (2000). The relative toxicity of compounds in mainstream cigarette
smoke condensate. Food Chem Toxicol 38, 637-646.

Smith, C.J., Livingston, S.D., and Doolittle, D.J. (1997). An international literature survey of
"IARC Group I carcinogens" reported in mainstream cigarette smoke. Food Chem Toxicol 35,
1107-1130.

Smith, C.J., Perfetti, T.A., Garg, R., and Hansch, C. (2003). IARC carcinogens reported in
cigarette mainstream smoke and their calculated log P values. Food Chem Toxicol 41, 807-817.

Smith, C.J., Perfetti, T.A., Rumple, M.A., Rodgman, A., and Doolittle, D.J. (2000). "IARC
group 2A Carcinogens" reported in cigarette mainstream smoke. Food Chem Toxicol 38, 371-
383.

Smith, C.J., Perfetti, T.A., Rumple, M.A., Rodgman, A., and Doolittle, D.J. (2001). "IARC
Group 2B carcinogens" reported in cigarette mainstream smoke. Food Chem Toxicol 39, 183-
205.

Smith, H.S., Wolman, S.R., and Hackett, A.J. (1984). The biology of breast cancer at the cellular
level. Biochim Biophys Acta 738, 103-123.










Sorlie, T., Perou, C.M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., Hastie, T., Eisen, M.B.,
van de Rijn, M., Jeffrey, S.S., et al. (2001). Gene expression patterns of breast carcinomas
distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U SA 98, 10869-
10874.

Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H.,
Pesich, R., Geisler, S., et al. (2003). Repeated observation of breast tumor subtypes in
independent gene expression data sets. Proc Natl Acad Sci U SA 100, 8418-8423.

Soule, H.D., Maloney, T.M., Wolman, S.R., Peterson, W.D., Jr., Brenz, R., McGrath, C.M.,
Russo, J., Pauley, R.J., Jones, R.F., and Brooks, S.C. (1990). Isolation and characterization of a
spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res 50, 6075-
6086.

Srinivasan, A., Li, F., Wong, A., Kodandapani, L., Smidt, R., Jr., Krebs, J.F., Fritz, L.C., Wu,
J.C., and Tomaselli, K.J. (1998). Bcl-xL functions downstream of caspase-8 to inhibit Fas- and
tumor necrosis factor receptor 1-induced apoptosis of MCF7 breast carcinoma cells. J Biol Chem
273, 4523-4529.

Stern, D.F., Heffernan, P.A., and Weinberg, R.A. (1986). pl85, a product of the neu proto-
oncogene, is a receptorlike protein associated with tyrosine kinase activity. Mol Cell Biol 6,
1729-1740.

Sterneck, E., Tessarollo, L., and Johnson, P.F. (1997). An essential role for C/EBPbeta in female
reproduction. Genes Dev 11, 2153-2162.

Stingl, J., and Caldas, C. (2007). Molecular heterogeneity of breast carcinomas and the cancer
stem cell hypothesis. Nat Rev Cancer 7, 791-799.

Strasser, A., Harris, A.W., Huang, D.C., Krammer, P.H., and Cory, S. (1995). Bcl-2 and
Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J 14, 6136-6147.

Streuli, C.H., and Gilmore, A.P. (1999). Adhesion-mediated signaling in the regulation of
mammary epithelial cell survival. J Mammary Gland Biol Neoplasia 4, 183-191.

Sullivan, S. (1984). The Reference and Research Cigarette Series (Lexington, KY: University of
Kentucky Printing Services).

Sundfeldt, K., Ivarsson, K., Carlsson, M., Enerback, S., Janson, P.O., Brannstrom, M., and
Hedin, L. (1999). The expression of CCAAT/enhancer binding protein (C/EBP) in the human
ovary in vivo: specific increase in C/EBPbeta during epithelial tumour progression. Br J Cancer
79, 1240-1248.

Tait, L., Soule, H.D., and Russo, J. (1990). Ultrastructural and immunocytochemical
characterization of an immortalized human breast epithelial cell line, MCF-10. Cancer Res 50,
6087-6094.










Tahirov, T.H., Inoue-Bungo, T., Morii, H., Fujikawa, A., Sasaki, M., Kimura, K., Shiina, M.,
Sato, K., Kumasaka, T., Yamamoto, M., et al. (2001). Structural analyses of DNA recognition by
the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell 104, 755-767.

Tahirov, T.H., Sato, K., Ichikawa-Iwata, E., Sasaki, M., Inoue-Bungo, T., Shiina, M., Kimura,
K., Takata, S., Fujikawa, A., Morii, H., et al. (2002). Mechanism of c-Myb-C/EBP beta
cooperation from separated sites on a promoter. Cell 108, 57-70.

Takehara, T., and Takahashi, H. (2003). Suppression of Bcl-xL deamidation in human
hepatocellular carcinomas. Cancer Res 63, 3054-3057.

Tanaka, T., Akira, S., Yoshida, K., Umemoto, M., Yoneda, Y., Shirafuji, N., Fujiwara, H.,
Suematsu, S., Yoshida, N., and Kishimoto, T. (1995). Targeted disruption of the NF-16G gene
discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages. Cell 80,
353-361.

Tanaka, T., Yoshida, N., Kishimoto, T., and Akira, S. (1997). Defective adipocyte differentiation
in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J 16, 7432-7443.

Tang, Q.Q., Gronborg, M., Huang, H., Kim, J.W., Otto, T.C., Pandey, A., and Lane, M.D.
(2005). Sequential phosphorylation of CCAAT enhancer-binding protein beta by MAPK and
glycogen synthase kinase 3beta is required for adipogenesis. Proc Natl Acad Sci U SA 102,
9766-9771.

Tanko, L.B., and Christiansen, C. (2004). An update on the antiestrogenic effect of smoking: a
literature review with implications for researchers and practitioners. Menopause 11, 104-109.

Taylor, J.K., Zhang, Q.Q., Wyatt, J.R., and Dean, N.M. (1999). Induction of endogenous Bcl-xS
through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat Biotechnol
17, 1097-1100.

Taylor-Papadimitriou, J., Stampfer, M., Bartek, J., Lewis, A., Boshell, M., Lane, E.B., and
Leigh, I.M. (1989). Keratin expression in human mammary epithelial cells cultured from normal
and malignant tissue: relation to in vivo phenotypes and influence of medium. J Cell Sci 94 (Pt
3), 403-413.

Terry, P.D., Miller, A.B., and Rohan, T.E. (2002). Cigarette smoking and breast cancer risk: a
long latency period? Int J Cancer 100, 723-728.

Terry, P.D., and Rohan, T.E. (2002). Cigarette smoking and the risk of breast cancer in women: a
review of the literature. Cancer Epidemiol Biomarkers Prev 11, 953-971.

Thiery, J.P. (2003). Epithelial-mesenchymal transitions in development and pathologies. Curr
Opin Cell Biol 15, 740-746.

Thompson, C.B. (1995). Apoptosis in the pathogenesis and treatment of disease. Science 267,
1456-1462.










Timchenko, L.T., lakova, P., Welm, A.L., Cai, Z.J., and Timchenko, N.A. (2002). Calreticulin
interacts with C/EBPalpha and C/EBPbeta mRNAs and represses translation of C/EBP proteins.
Mol Cell Biol 22, 7242-7257.

Tomlinson, I.P. (2001). Mutations in normal breast tissue and breast tumours. Breast Cancer Res
3, 299-303.

Trautwein, C., Caelles, C., van der Geer, P., Hunter, T., Karin, M., and Chojkier, M. (1993).
Transactivation by NF-16G/LAP is enhanced by phosphorylation of its activation domain. Nature
364, 544-547.

Tsujimoto, Y., Finger, L.R., Yunis, J., Nowell, P.C., and Croce, C.M. (1984). Cloning of the
chromosome breakpoint of neoplastic B cells with the t(14; 18) chromosome translocation.
Science 226, 1097-1099.

Tsukahara, T., Kannagi, M., Ohashi, T., Kato, H., Arai, M., Nunez, G., Iwanaga, Y., Yamamoto,
N., Ohtani, K., Nakamura, M., and Fujii, M. (1999). Induction of Bcl-x(L) expression by human
T-cell leukemia virus type 1 Tax through NF-kappaB in apoptosis-resistant T-cell transfectants
with Tax. J Virol 73, 7981-7987

U.S. Department of Human and Health Services (1994). Preventing Tobacco use among yound
people: A report of hte surgeon general.

U.S. Department of Human and Health Services (2004). The Health Consequences of Smoking
- A Report of the Surgeon General. (Rockville, MD, Public Health Service, Centers for Disease
Control and Prevention, Center for Chronic Disease Prevention and Health Promotion, Office on
Smoking and Health).

U.S. Department of Human and Health Services (2006). The Health Consequences of
Involuntary Exposure to Tobacco Smoke: A Report of the Surgeon General. (Rockville, MD,
U. S. Department of Health and Human Services, Public Health Service, Centers for Disease
Control and Prevention, National Center for Chronic Disease Prevention and Health Promotion,
Office on Smoking and Health).

Vander Heiden, M.G., Chandel, N.S., Schumacker, P.T., and Thompson, C.B. (1999). Bcl-xL
prevents cell death following growth factor withdrawal by facilitating mitochondrial ATP/ADP
exchange. Mol Cell 3, 159-167.

Vander Heiden, M.G., Chandel, N.S., Williamson, E.K., Schumacker, P.T., and Thompson, C.B.
(1997). Bcl-xL regulates the membrane potential and volume homeostasis of mitochondria. Cell
91, 627-637.

Van Dyke, M.W., Roeder, R.G., and Sawadogo, M. (1988). Physical analysis of transcription
preinitiation complex assembly on a class II gene promoter. Science 241, 1335-1338.

Vaux, D.L., Cory, S., and Adams, J.M. (1988). Bcl-2 gene promotes haemopoietic cell survival
and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442.










Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid, G.E., Moritz, R.L.,
Simpson, R.J., and Vaux, D.L. (2000). Identification of DIABLO, a mammalian protein that
promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43-53.

Villagra, A., Cruzat, F., Carvallo, L., Paredes, R., Olate, J., van Wijnen, A.J., Stein, G.S., Lian,
J.B., Stein, J.L., Imbalzano, A.N., and Montecino, M. (2006). Chromatin remodeling and
transcriptional activity of the bone-specific osteocalcin gene require CCAAT/enhancer-binding
protein beta-dependent recruitment of SWI/SNF activity. J Biol Chem 281, 22695-22706.

Vineis, P., Veglia, F., Benhamou, S., Butkiewicz, D., Cascorbi, I., Clapper, M.L., Dolzan, V.,
Haugen, A., Hirvonen, A., Ingelman-Sundberg, M., et al. (2003). CYPlAl T3801 C
polymorphism and lung cancer: a pooled analysis of 2451 cases and 3358 controls. Int J Cancer
104, 650-657.

Vinson, C.R., Hai, T., and Boyd, S.M. (1993). Dimerization specificity of the leucine zipper-
containing bZIP motif on DNA binding: prediction and rational design. Genes Dev 7, 1047-
1058.

Vinson, C.R., Sigler, P.B., and McKnight, S.L. (1989). Scissors-grip model for DNA recognition
by a family of leucine zipper proteins. Science 246, 911-916.

Vogelstein, B., Fearon, E.R., Hamilton, S.R., Kern, S.E., Preisinger, A.C., Leppert, M.,
Nakamura, Y., White, R., Smits, A.M., and Bos, J.L. (1988). Genetic alterations during
colorectal-tumor development. N Engl J Med 319, 525-532.

Wang, T.C., Cardiff, R.D., Zukerberg, L., Lees, E., Arnold, A., and Schmidt, E.V. (1994).
Mammary hyperplasia and carcinoma in MMTV-cyclin Dl transgenic mice. Nature 369, 669-
671.

Watson, D.K., McWilliams, M.J., Lapis, P., Lautenberger, J.A., Schweinfest, C.W., and Papas,
T.S. (1988). Mammalian ets-1 and ets-2 genes encode highly conserved proteins. Proc Natl Acad
Sci U SA 85, 7862-7866.

Watson, D.K., McWilliams-Smith, M.J., Nunn, M.F., Duesberg, P.H., O'Brien, S.J., and Papas,
T.S. (1985). The ets sequence from the transforming gene of avian erythroblastosis virus, E26,
has unique domains on human chromosomes 11 and 21: both loci are transcriptionally active.
Proc Natl Acad Sci U SA 82, 7294-7298.

Weintraub, S.J., Manson, S.R., and Deverman, B.E. (2004). Resistance to antineoplastic therapy.
The oncogenic tyrosine kinase-Bcl-x(L) axis. Cancer Cell 5, 3-4.

Weis, L., and Reinberg, D. (1992). Transcription by RNA polymerase II: initiator-directed
formation of transcription-competent complexes. FASEB J 6, 3300-3309.

Wells, A. (2000). Smoking and cancer in Women. Journal of Women's Cancer 2, 55-66.










Welm, A.L., Timchenko, N.A., and Darlington, G.J. (1999). C/EBPalpha regulates generation of
C/EBPbeta isoforms through activation of specific proteolytic cleavage. Mol Cell Biol 19, 1695-
1704.

Westermarck, J., and Kahari, V.M. (1999). Regulation of matrix metalloproteinase expression in
tumor invasion. FASEB J 13, 781-792.

Whitehead, J.K., and Rothwell, K. (1969). The mouse skin carcinogenicity of cigarette smoke
condensate: fractionated by solvent partition methods. Br J Cancer 23, 840-857.

Williams, S.C., Baer, M., Dillner, A.J., and Johnson, P.F. (1995). CRP2 (C/EBP beta) contains a
bipartite regulatory domain that controls transcriptional activation, DNA binding and cell
specificity. EMBO J 14, 3170-3183.

Williams, S.C., Cantwell, C.A., and Johnson, P.F. (1991). A family of C/EBP-related proteins
capable of forming covalently linked leucine zipper dimers in vitro. Genes Dev 5, 1553-1567.

Wistuba, II, Mao, L., and Gazdar, A.F. (2002). Smoking molecular damage in bronchial
epithelium. Oncogene 21, 7298-7306.

Wright, C., Nicholson, S., Angus, B., Sainsbury, J.R., Farndon, J., Cairns, J., Harris, A.L., and
Horne, C.H. (1992). Relationship between c-erbB-2 protein product expression and response to
endocrine therapy in advanced breast cancer. Br J Cancer 65, 118-121.

Wynder, E., Hoffman, D (1967). Tobacco and Tobacco Smoke (New York, NY: Academic
Press).

Wynder, E.L., and Wright, G. (1957). A study of tobacco carcinogenesis. I. The primary
fractions. Cancer 10, 255-271.

Xiong, W., Hsieh, C.C., Kurtz, A.J., Rabek, J.P., and Papaconstantinou, J. (2001). Regulation of
CCAAT/enhancer-binding protein-beta isoform synthesis by alternative translational initiation at
multiple AUG start sites. Nucleic Acids Res 29, 3087-3098.

Xu, M., Nie, L., Kim, S.H., and Sun, X.H. (2003). STAT5-induced Id-1 transcription involves
recruitment of HDAC 1 and deacetylation of C/EBPbeta. EMBO J 22, 893-904.

Yang, X., Hao, Y., Pater, M.M., Tang, S.C., and Pater, A. (1998). Enhanced expression of anti-
apoptotic proteins in human papillomavirus-immortalized and cigarette smoke condensate-
transformed human endocervical cells: correlation with resistance to apoptosis induced by DNA
damage. Mol Carcinog 22, 95-101.

Yang, X., Nakao, Y., Pater, M.M., Tang, S.C., and Pater, A. (1997). Expression of cellular genes
in HPV16-immortalized and cigarette smoke condensate-transformed human endocervical cells.
J Cell Biochem 66, 309-321.










Yefenof, E., Picker, L.J., Scheuermann, R.H., Tucker, T.F., Vitetta, E.S., and Uhr, J.W. (1993).
Cancer dormancy: isolation and characterization of dormant lymphoma cells. Proc Natl Acad Sci
U SA 90, 1829-1833.

Yin, X.M., Oltvai, Z.N., and Korsmeyer, S.J. (1994). BH1 and BH2 domains of Bcl-2 are
required for inhibition of apoptosis and heterodimerization with Bax. Nature 369, 321-323.

Zahnow, C.A. (2002). CCAAT/enhancer binding proteins in normal mammary development and
breast cancer. Breast Cancer Res 4, 113-121.

Zahnow, C.A., Cardiff, R.D., Laucirica, R., Medina, D., and Rosen, J.M. (2001). A role for
CCAAT/enhancer binding protein beta-liver-enriched inhibitory protein in mammary epithelial
cell proliferation. Cancer Res 61, 261-269.

Zahnow, C.A., Younes, P., Laucirica, R., and Rosen, J.M. (1997). Overexpression of C/EBPbeta-
LIP, a naturally occurring, dominant-negative transcription factor, in human breast cancer. J Natl
Cancer Inst 89, 1887-1891.

Zajchowski, D.A., Bartholdi, M.F., Gong, Y., Webster, L., Liu, H.L., Munishkin, A., Beauheim,
C., Harvey, S., Ethier, S.P., and Johnson, P.H. (2001). Identification of gene expression profiles
that predict the aggressive behavior of breast cancer cells. Cancer Res 61, 5 168-5 178.

Zha, J., Harada, H., Yang, E., Jockel, J., and Korsmeyer, S.J. (1996). Serine phosphorylation of
death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell
87, 619-628.

Zhao, R., Yang, F.T., and Alexander, D.R. (2004). An oncogenic tyrosine kinase inhibits DNA
repair and DNA-damage-induced Bcl-xL deamidation in T cell transformation. Cancer Cell 5,
37-49.

Zhivotovsky, B., and Kroemer, G. (2004). Apoptosis and genomic instability. Nat Rev Mol Cell
Biol 5, 752-762.

Zhou, H., Hou, Q., Chai, Y., and Hsu, Y.T. (2005). Distinct domains of Bcl-XL are involved in
Bax and Bad antagonism and in apoptosis inhibition. Exp Cell Res 309, 316-328.

Zhu, C., Mills, K.D., Ferguson, D.O., Lee, C., Manis, J., Fleming, J., Gao, Y., Morton, C.C., and
Alt, F.W. (2002). Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene
amplification subsequent to translocations. Cell 109, 811-821.

Zimmermann, A., and Keller, H.U. (1987). Locomotion of tumor cells as an element of invasion
and metastasis. Biomed Pharmacother 41, 337-344.

Zong, W.X., Lindsten, T., Ross, A.J., MacGregor, G.R., and Thompson, C.B. (2001). BH3-only
proteins that bind pro-survival Bcl-2 family members fail to induce apoptosis in the absence of
Bax and Bak. Genes Dev 15, 1481-1486.










Zoratti, M., and Szabo, I. (1995). The mitochondrial permeability transition. Biochim Biophys
Acta 1241, 139-176.









BIOGRAPHICAL SKETCH

The product of a military family, Shahnj ayla Connors was bomn in Siegen, (West)

Germany. She is the only daughter of Rodney and Sharon Connors. While attending Warner

Robins High School, Shahnj ayla was an active member in Mu Alpha Theta Math Club and the

Beta Club. She was also active in Girl Scouting and earned her Girl Scout Silver Award and

Gold Award.

After graduating from high school in 1999, Shahnj ayla pursued a B.S. in biology from

Georgia Southemn University, where she was a member of the University Honors Program. The

end of her sophomore year, Shahnj ayla was named a Ronald E. McNair Postbaccalaureate

Achievement Program Scholar and was exposed to her first research experience. She completed

a summer proj ect on the population genetics of Ixodes scapularis, the tick vector of Lyme

disease. This research proj ect confirmed her love of biological research and she participated in

several other research proj ects during her undergraduate studies. Shahnj ayla continued her study

of Ixodes scapularis and identified spiroplasma bacteria from the gut of horseflies as

independent study proj ects. She also traveled to lowa and participated in a proj ect characterizing

programmed cell death in the neurons of the nematode, Caenorhabditis elegans. She was able to

present her work two national McNair conferences and several research symposiums at her

college.

After graduating from Georgia Southemn in May of 2003, Shahnj ayla entered the

Interdisciplinary Program in Biomedical Sciences (IDP) at the University of Florida and

completed her doctoral research on the upregulation of bcl-xl in human breast epithelial cells

treated with cigarette smoke condensate in the laboratory of Satya Narayan, Ph.D. She has

presented her doctoral research at several departmental and national meetings. During her

doctoral studies, she also served as a McNair Peer Advisor for the University of Florida.










Shahnj ayla received her Ph.D. in Medical Sciences in August 2008. She is currently a

postdoctoral associate working in the area of cancer disparities and pursuing a Master in Public

Health.





PAGE 1

CIGARETTE SMOKE CONDENSATE-INDUCED TRANSCRIPTIONAL REGULATION OF BCL-XL IN SPONTANEOUSLY IMMORTALIZED HUMAN BREAST EPITHELIAL CELLS By SHAHNJAYLA KHRISHIDA CONNORS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Shahnjayla Khrishida Connors 2

PAGE 3

To my parents, who never doubted that I could do itfor your continuous love and support, I dedicated this dissertation to you. 3

PAGE 4

ACKNOWLEDGMENTS I thank God for blessing me and surrounding me with all those who have made it possible for me to finish this dissertation. I thank my parents, extended family, church family, and friends for their prayers, spiritual, and emotional support. I thank Dr. Satya Narayan, my supervisory chair for the opportunity to complete my proj ect in his laboratory, the members of my supervisory committee, and Dr. Aruna Jaiswal fo r all his technical assi stance and support. I thank those whose work was the foundation for my project and those who provided special reagents and supplies. Lastly, I thank all those who were involved in me successfully completing this process including the Interdiscip linary Program in Biomedical Sciences (IDP), the Office of Graduate Minority Programs ( OGMP), Department of Anatomy and Cell Biology, and all the faculty and staff, too numerous to name, who offered academic, administrative, and clerical support. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT ...................................................................................................................... ...............9 CHAPTER 1 INTRODUCTION ................................................................................................................ ..11 Breast Cancer ..........................................................................................................................11 Cigarette Smoke Carcinogens .................................................................................................12 Smoking and Breast Cancer Risk ...........................................................................................14 Epidemiological Studies ..................................................................................................15 Biological Studies ............................................................................................................17 The Mechanism of CSC-induced Breast Carcinogenesis .......................................................18 Chemical Transformation of Hu man Breast Epithelial Cells .................................................20 Apoptosis ..................................................................................................................... ...........22 Intrinsic Pathway .............................................................................................................22 Extrinsic Pathway ............................................................................................................23 Apoptosis and Cancer ......................................................................................................24 The B cell leukemia-2 (Bcl-2) Protein Family .......................................................................24 Bcl-x Gene and Promoter Structure .................................................................................25 Bcl-xL Protein .................................................................................................................27 Bcl-xL functions as an anti-apoptotic protein ..........................................................29 Bcl-xL and breast cancer ..........................................................................................33 The CCAAT/Enhancer Binding Pr otein (C/EBP) Family ......................................................38 C/EBP protein ................................................................................................................39 C/EBP protein function ..........................................................................................39 C/EBP protein isoforms .........................................................................................40 C/EBP and Breast Cancer ..............................................................................................43 2 MATERIALS AND METHODS ...........................................................................................50 Preparation of CSC ............................................................................................................ .....50 Cloning of the Human Bcl-xl Promoter (pBcl-xLP) ...............................................................53 Cloning of pBcl-xLP Deletion Constructs ..............................................................................53 Promoter Activity Assays ...................................................................................................... .54 Electrophoretic Mobility Shift Assay (EMSA) ......................................................................56 Chromatin Immunoprecipitation (ChIP) Assay ......................................................................58 5

PAGE 6

Site-directed Mutagenesis .......................................................................................................59 Overexpression of C/EBP .....................................................................................................59 Statistical Analysis .......................................................................................................... ........59 3 CSC TREATMENT RESULTS IN THE TRANS CRIPTIONAL UPREGULATION OF BCL-XL IN MCF10A CELLS ...............................................................................................60 Introduction .................................................................................................................. ...........60 Results .....................................................................................................................................60 CSC Treatment Induces Bcl-xl mRNA and Protein Levels in MCF10A Cells ...............60 CSC Induces pBcl-xLP Promoter Activity in MCF10A cells .........................................61 C/EBP-binding Sites on the pBcl-xLP are CSC-responsive Elements ...........................62 4 C/EBP REGULATES BCL-XL IN CSC-TREATED MCF10A CELLS ............................71 Introduction .................................................................................................................. ...........71 Results .....................................................................................................................................71 C/EBP is Induced by CSC Treatment in MCF10A Cells ..............................................71 C/EBP Site-II of the pBcl-xLP is Specific for the CSC Response in MCF10A Cells ......................................................................................................................... ....71 C/EBP Binds the Endogenous Bcl-xl Promoter in Response to CSC Treatment ..........73 Overexpression of C/EBP Protein LAP2 Increases pBcl-xLP Promoter and Protein Levels in MCF10A Cells .............................................................................................73 5 SUMMARY AND DISCUSSION .........................................................................................80 C/EBP -induced Upregulation of Bcl-xL in CSC-treated MCF10A Cells ............................83 Induction of C/EBP by CSC Treatment ................................................................................88 The Potential Role of C/EBP in CSC-induced Breast Carcinogenesis.................................90 The Relationship between C/EBP Bcl-xL, and Breast Carcinogenesis ...............................91 Future and Directions ......................................................................................................... ....94 LIST OF REFERENCES ...............................................................................................................98 BIOGRAPHICAL SKETCH .......................................................................................................130 6

PAGE 7

LIST OF TABLES Table page 1-1 Carcinogens Present in Cigarette Smoke ...........................................................................46 7

PAGE 8

LIST OF FIGURES Figure page 1-1 Mechanism of cigarette smoke-induced cancer .................................................................47 1-2 Human bcl-x gene structure and proteins ...........................................................................48 1-3 Human C/EBP mRNA structure and protein isoforms. ...................................................49 3-1 Bcl-xl mRNA and protein levels are induced in MCF10A cells treated with CSC ...........65 3-2 Sequence of the cloned human bcl-xl promoter, pBcl-xLP. ..............................................66 3-3 CSC treatment induces pB cl-xLP promoter activity in vitro .............................................67 3-4 The pBcl-xLP promoter contains CSC-responsive cis -elements .......................................68 3-5 C/EBP mutations introduced on the pBcl-xLP. .................................................................69 3-6 Site-directed mutagenesis of C/EBP s ites on the pBcl-xLP attenuates CSC-induced promoter activity.. ........................................................................................................... ...70 4-1 C/EBP protein levels are induced in MC F10A cells treated with CSC.. .........................75 4-2 C/EBP binds the bcl-xl promoter in vitro. .......................................................................76 4-3 C/EBP is present on the bcl-xl promoter of MCF10A cells in vivo ................................77 4-4 Overexpression of C/EBP induces pBcl-xLP promoter activity and Bcl-xL protein levels in MCF10A cells .....................................................................................................78 4-5 Site-directed mutagenesis of C/EBP s ites on the pBcl-xLP attenuates the C/EBP induced activation of the pBcl-xLP promoter ....................................................................79 5-1 Model of CSC-Induced C/EBP upregulation of Bcl-xL in MCF10A cells. ....................97 8

PAGE 9

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CIGARETTE SMOKE CONDENSATE-INDUCED TRANSCRIPTIONAL REGULATION OF BCL-XL IN SPONTANEOUSLY IMMORTALIZED HUMAN BREAST EPITHELIAL CELLS By Shahnjayla Khrishida Connors August 2008 Chair: Satya Narayan Major: Medical Sciences -Molecular Cell Biology Breast cancer is the second leading cause of cancer deaths in women. It is unclear whether there is a link between cigarette smoking and increased breast cancer risk. Cigarette smoke contains over 4,000 compounds, over 80 of wh ich have been identified as carcinogens. There is evidence to support the fact that sm okers metabolize mammary carcinogens and human studies show that tobacco constituents can reac h breast tissue where th ey produce their harmful effects. In previous studies, it has been de monstrated that cigarette smoke condensate (CSC), which has a similar chemical composition as ci garette smoke, is capable of transforming the spontaneously immortalized human breast epit helial cell line, MCF10A, possibly through the upregulation of the anti-apoptotic gene, bcl-xl. Upregulation of this gene impedes the apoptotic pathway and allows the accumulation of DNA dama ge that can lead to cell transformation and carcinogenesis. In the present study, the m echanism of CSC-mediated transcriptional upregulation of bcl-xl gene expression in MCF10A cells has been determined. The human bcl-xl promoter (pBcl-xLP) was cloned and putative transc ription factor binding sites were identified. Deletion constructs that removed the putative cis -elements were transfected into MCF10A cells to determine which element or elements were responsive to CSC treatment. The promoter 9

PAGE 10

10 activity was significantly decrease d in constructs lacking C/EBPbinding sites. Site-directed mutagenesis of C/EBP-binding sites on the pBcl -xLP attenuated the CSC-induced increase in promoter activity. Western blot, gel-shift, and super-shift analysis confirmed that C/EBP bound to a C/EBP-binding site on the pBcl-xLP Additionally, overexpression of C/EBP isoforms, particularly, LAP2, stimulated pB cl-xLP activity and Bcl-xL prot ein levels in the absence of CSC treatment. Site-directed mutagenesis of th e C/EBP sites on the pBcl-xLP also altered the promoter response to the C/EBP overexpression constructs. Th ese results indicate that C/EBP -LAP2 regulates bcl-xl gene expression in response to CSC treatment. Understanding the mechanism of transcriptional regulation of bcl-xl can be used to identify chemotherapeutic targets for the prevention and treatment of br east carcinogenesis, especi ally that induced by cigarette smoke carcinogens.

PAGE 11

CHAPTER 1 INTRODUCTION Breast Cancer Breast cancer is the most common cancer and is second only to lung cancer as the leading cause of cancer death in women. The Am erican Cancer Society estimates that in 2008, 67,770 new cases of carcinoma in situ the noninvasive, earliest fo rm of breast cancer, will be diagnosed. In addition, 182,460 new cas es of invasive breast cancer will also be diagnosed in the United States (American Cancer Society, 2008). Although breast cance r is 100-times more common in females, 1,990 men will be diagnosed w ith the disease this year (American Cancer Society, 2008). In 2008, 40,480 women and 450 me n will succumb to this disease (American Cancer Society, 2008). Breast canc er death rates have decreased since 1990. This decrease is believed to be the result of early detection, incr eased awareness, and improved treatment. While breast cancer survival rates have improved a bout 14% since the 1970, this progress has not impacted all populations equally. When controlled for age and stage at diagnosis, mortality rates vary among racial and ethnic groups (National Ca ncer Institute, 2007). While minorities have generally have lower incidence ra tes, they have higher mortality and develop more aggressive forms of breast cancer (Ameri can Cancer Society, 2008). Ordered mammary epithelial architecture is critical to maintaining a differentiated state and control of cell prolif eration (Bissell et al., 2003). Disrupti ons of this ordered architecture can lead to breast carcinogenesis. While the progr ession of colon cancer has been extensively described in a linear model (Fear on and Vogelstein, 1990; Polyak et al., 1996; Vogelstein et al., 1988), the progression of breast carcinogenesis is less understood. Breast can cer is considered a heterogeneous disease that develops along a continuum; the multi-step process begins at ductal or lobular atypical hyperplasia and progresses to invasive carc inoma and metastasis (Beckmann 11

PAGE 12

et al., 1997; Russo and Russo, 2001). Accumulation of genetic errors in growth control and DNA repair genes occur at each st ep (Beckmann et al., 1997). Two classes of genes are affected during this progression: oncogenes and tumor su ppressors. Oncogenes and tumor suppressor genes regulate epidermal growth factor receptors and genes in volved in cell cycle progression, proliferation, and apoptosis. Oncogenes act to increase cell replication and decrease differentiation. The activation of oncogenes, such as ras and c-myc, by mutation, amplification, or rearrangements are associated with tumorigenesis. Alternatively, tumor suppressor genes such as TP53 and retinoblastoma ( Rb ) are associated with cell cy cle regulation, differentiation, and apoptosis. By definition, these genes act to prevent tumorigenesis. The loss of tumor suppressor function makes cells more susceptible to tumorigenesis and results from a mechanism known as the Knudsons two-hit hypothesis. In this model, the loss of function results from two occurrences: the first hit is a germline mutation in one c opy of the gene and the second hit, a somatic mutation or deletion in the second copy of the gene, results in the loss of gene function (Knudson, 1971). Cigarette Smoke Carcinogens Epidemiological evidence has shown that no t only cigarette smoke, but also unburned tobacco is carcinogenic to man (Hoffmann and Wynder, 1968). Cigarette smoke condensate (CSC), because of its similar composition, is used as a surrogate for cigarette smoke in experimental studies. Studies have been aimed at identifying and classifying the carcinogenic constituents in CSC (Table 1-1). Animal bi oassays and advances in analytical chemistry techniques have brought the number of proven carc inogens in cigarette smoke to approximately 80 (Hecht, 2002; Hoffmann et al., 2001; Smith et al., 2003). The International Agency for Research on Cancer (IARC) and the Registry of Toxic effect of Chem ical Substances (RTEC) have classified the components of cigarette sm oke by potential carcinog enicity and bioactivity, 12

PAGE 13

respectively. The IARC classifies mainstream cigarette smoke as a Group 1 (known human) carcinogen (International Agency for Research on Cancer, 1985). Ot her categories include: Group 2A, probably carcinogenic to humans, Group 2B, possibly carcinogenic to humans, and Group 3, not classifiable as to their carcinogenicity to hum ans (International Agency for Research on Cancer 1972-2000). Studies have reviewed the IARC car cinogen groups found in cigarette smoke from Group 1 (Smith et al., 199 7), Group 2A (Smith et al., 2000), and Group 2B (Smith et al., 2000a; Smith et al., 2001). Thes e compounds have also be en ranked by potential toxicity using IARC and RTECS data. The purpose of this study was to use concentration, metabolism, bioactivity, and lipophilicity to devel op effective toxicities as a means to compare compounds and to identify the most toxic for fu rther study (Smith and Hansch, 2000). Effective toxicity was used to group the cigarette smoke components into six categories, I: rodent carcinogens and reproductive effect ors, II: rodent carcinogens, III : reproductive effectors, IV: benign tumorigens, V: in vitro mutagens, and VI: compounds that have insufficient evidence of biological activity (Smith and Hansch, 2000). Polycyclic aromatic hydrocarbons (PAHs ) were the first pure compounds shown experimentally to be carcinogenic and are co mplete (Hoffmann and Wynder, 1971; Whitehead and Rothwell, 1969; Wynder and Wright, 1957). P AHs are ubiquitous environmental pollutants produced by the incomplete combustion of foss il fuels (Trombino et al., 2000) and during the burning of tobacco (Hoffmann and Wynder, 1968; Wynder, 1967). Benzo[ ]pyrene (B[ ]P), which was first isolated from coal tar in th e 1930s, is one PAH found in cigarette smoke. B[ ]P is a mammary carcinogen (el-Bayoumy et al., 1995) and was classified in the most bioactive category I by Smith and Hansch because it is a ro dent carcinogen that causes reproductive effects (2000). The PAH, 7, 12-dimethylbenzanthracene (DMBA), is another well-known mammary 13

PAGE 14

carcinogen present in cigarette smoke (Kumar et al., 1990). The strongest PAH carcinogen, dibenzo[alpha,l]pyrene (DB[ ,l]P), is a very active mamma ry carcinogen that has a greater potency than DMBA (Cavalieri et al., 1991). Other carcinogenic compounds in cigarette smoke include N -nitrosamines such as tobacco-specific 4-(methylnitrosamino)-1-(3-pyridyl)-1butanone (NNK) and N -nitrosonornicotine (NNN). Both of these compounds are rodent carcinogens and classified in category II (Smith and Hansch, 2000). Aromatic amine and metals are also present in CSC (Hoffmann et al ., 2001). Strong carcinogens such as PAHs, nitrosamines, and aromatic amines occur in sm aller amounts (1-200 ng per cigarette). Weaker carcinogens, such as acetaldehyde, ar e present at larger concentra tions (1 mg cigarette). The total amount of carcinogens in cigare tte smoke is about 1-3 mg per cigarette, and is similar to the amount of nicotine (Hecht, 2003). Smoking and Breast Cancer Risk One of the most prevalent negative effects cigarette smoking has on human health is cancer (American Cancer Society, 2008). Cu rrently, smoking accounts for approximately 30% of all cancer cases in developed countries (Doll, 1981; Peto et al., 1996; U.S. Department of Human and Health Services, 1989). Smoking causes about 90% of lung cancer cases worldwide. Therefore it the overwhelming cause of lung cancer, which is the leading cause of cancer death worldwide (International Agency for Research on Cancer, 2004). Tobacco is the most extreme example of a systemic carcinogen (DeMarini, 2 004) and causes cancer in more organ sites than any other human carcinogen identified thus far. In addition to causi ng cancers of the lung, mouth, and esophagus, cigarette smoke has been li nked to some leukemias and cancers of distant organs such as the pancreas, cervix, kidney, and stomach (U.S. Department of Human and Health Services, 2004). Smoking is also proposed to be an initiator of co lorectal carcinogenesis 14

PAGE 15

(Giovannucci et al., 1994a; Gi ovannucci and Martinez, 1996; Giovannucci et al., 1994b; Services, 1994). Epidemiological Studies Environmental carcinogens have long been suspected to contribute to human breast cancer. However, no specific agents have been fully implicated excep t radiation (John and Kelsey, 1993). One such environmental factor is cigarette smoking. Although lung cancer has been concretely linked to cigarette smoking, its rela tionship to other cancers such as those of the breast is more difficult to establish. Epidemiological studies reflect conflicting associations between cigarette smoking and increased breast cancer risk. Mo st studies indicate that cigare tte smoking has no effect on breast cancer risk (MacMahon, 1990; Palmer and Rose nberg, 1993). A large population based study found no increased risk even with heavy smokers a nd those who started to smoke at an early age (Baron et al., 1996). Other studie s recorded that cigarette smoki ng has little or no independent affect on breast cancer risk (Hamajima et al ., 2002) and there was no association found with active smoking (Lash and Aschengrau, 2002). Anothe r study suggested that there is no increased risk of breast cancer in women who smoked during pregnancy (Fink and Lash, 2003). Conversely, studies have also concluded that cigarette smoke is an etiologic factor for breast cancer (Bennett et al., 1999; Wells, 2000). Early exposu re to cigarette smoke and increased years since smoking commencement was found to play a role in increased breast cancer risk (Egan et al., 2002; J ohnson et al., 2000; Terry et al., 2002). Smoking prior to a first full-term pregnancy may also have a role in breast cancer development (Band et al., 2002; Johnson et al., 2000). In a large California Teachers Study Cohort breast cancer risk was associated with active cigarette smoking (Reynold s et al., 2004). Smoking has also been linked to increased breast cancer risk in women with mutations in carcinogen metabolizing genes. 15

PAGE 16

Women with N-Acetyltransferase 2 (NAT2) slow acetylation phenotypes have increased risk for breast cancer (Ambrosone et al., 1996; Ambros one et al., 2008). NAT2 is involved in the metabolism of aromatic amines, a major class of cigarette smoke carcinogens. Variants slow the clearance of aromatic amines. Other polym orphic metabolism genes include CYP1A1 and glutathione S-transferase M1 (GSTM1). Polymo rphisms in these genes affect the amount of DNA adducts in women with breast cancer, especi ally in smokers (Firoz i et al., 2002). In individuals that favor the metabolism of t obacco carcinogens (due to polymorphisms or mutations) smoking as a cause of breast cancer b ecomes more plausible (Hecht, 2002). The link between passive cigarette smoking (second hand smoke) and breast cancer risk has also been considered. Passive smoking has b een identified as a breast cancer risk factor in case-controlled studies (Johnson et al., 2000; Mo rabia et al., 1996). A prospective study from the Nurses Health Study and others reported that passive smoking is unrelated to breast cancer (Egan et al., 2002; Lash and Aschengrau, 2002). A report fr om the US Surgeon General concluded that the evidence linking secondhand smoke and breast cancer is suggestive, but not sufficient to infer a causal relationship (U.S. Department of Health and Human Services, 2006). However, the American Society recommends that women should be aware of the possible link and limit their exposure to active as well as pass ive cigarette smoke (Ame rican Cancer Society, 2008). Studies have probed the r eason for conflicting epidemiologi cal results. The effects of smoking on breast cancer risk may differ by menopaus al status (Band et al., 2002; Johnson et al., 2000). Additionally, tobacco may also have anti-est rogenic effects that redu ce breast cancer risk (Baron et al., 1990; Bremnes et al., 2007; Tanko and Christiansen, 2004). In some studies cigarette smoking was found to have an inverse relationship to breast can cer (Baron et al., 1990) 16

PAGE 17

and to protect rats from mammary tumor forma tion (Davis et al., 1975). This opposing effect may explain why epidemiological studies reflect inconsistent results on the association between breast cancer risk and cigarette smoking (Bremnes et al., 2007). Additionally, study methods can be skewed by biases in control selection, chance variati on, type of stratification, or small sample size (Baron et al., 1996). Other po ssibilities include the associati on with risk is too small to detect or that for some women there is increase d risk, while others are afforded protection from cigarette smoking (Phillips and Garte, 2008). It is plausible that smoking can cause breast cancer in humans, but this relationship is difficult to establish because of low carcinogen doses (Hecht, 2002). Biological Studies Despite conflicting epidemiological results, bi ological studies suppor t the hypothesis that cigarette smoke can play a role in breast carcinogenesis. The anatomy of the breast makes it a susceptible target for chemical carcinogens. Carcinogens in tobacco smoke can pass though alveolar membranes in the lung, enter the blood str eam, and be transported to the breast tissue by plasma lipoproteins (Shu and Bymun, 1983), and can be readily stored and concentrated in the breast adipose tissue (Obana et al., 1981). Si nce many of these compounds are lipophilic in nature, their concentration in br east adipose tissue increases expos ure to adjacent epithelial cells (Perera et al., 1995). Human mammary epithelial cells have a high capacity to metabolize carcinogens into DNA-binding substances and are therefore the ultimate targets for carcinogenesis (MacNicoll et al., 1980; Pruess-Schwartz et al ., 1986; Stampfer et al., 1981). Cigarette smoke components have been found in the breast milk (Catz and Giacoia, 1972; O'Brien, 1974) and the presence of smoking produc ts in nipple aspirates resulted in positive Ames Salmonella mutagenesis tests (Ames et al ., 1975). The concentration of compounds in breast ducts may provide a means by which cancer-i nitiating and promoting substances reach the 17

PAGE 18

breast epithelium (Petrakis, 1977a, b). Add itionally, evidence suggests smokers metabolize cigarette constituents in their breast tissue. Nicotine and its metabolite, cotinine, have been found in the breast secretions of non-lactating, women smokers (P etrakis et al., 1978). These studies support the hypothesi s that mutagenic substances reach the breast epithelia and may have implications in the pathogenesis of benign brea st disease and cancer (Pet rakis et al., 1980). The Mechanism of CSC-induced Breast Carcinogenesis Tobacco is a significant human mutagen. DNA damage is the primary effect from exposure to cigarette smoke carcinogens. St udies indicate that CSC can induce DNA strand breaks (DSBs) in rodents, mammalian cells in culture, and DNA in vitro (DeMarini, 2004). CSC also causes DSBs in human cells in vitro (Luo et al., 2004; Nakayama et al., 1985). In animal models the potency of carcinogens is strongly correlated with the ability to form covalent adducts with DNA (Bartsch et al., 1983; Pelkone n et al., 1980). Therefore, DNA adducts, the covalent binding products of a carcinogen, its metabolite, or related substances to DNA, are central to the carcinogenic properties of tob acco products, including cigarette smoke (Hecht, 1999). Cigarette smoking has been associated with increased DNA damage in the lungs of smokers (Cuzick et al., 1990; Routledge et al., 1992) and studies suggest that similar damage may occur in the tobacco-induced neoplasms of other tissues (Cuzick et al., 1990). DNA adducts known to be associated with exposure to PAHs and tobacco smoke have been found in breast tissue. DNA adducts related to tobacco exposure were found in the breast tissue of women with breast cancer. All of the positiv e samples were from smokers as compared to no adducts found in nonsmoker tissue (Perera et al., 1995). Increa sed levels of aromatic DNA adducts were even found in the adjacent normal tissue of breast cancer patients (Li et al., 1996a). These and other studies indicate that exposure to environmenta l carcinogens, such as those found in cigarette smoke may be associated with the etiology of human breast cancer (Li et al., 1996a). 18

PAGE 19

CSC also causes cytogenetic damage to cells including chromosomal deletions, in rat cells and murine models in vivo (Dertinger et al., 2001; Rithidech et al., 1989). It also causes anaphase bridges in normal human fibroblast ce lls (Luo et al., 2004). Anaphase bridges are chromosomal segregation defects first described in maize (McC lintock, 1942). These bridges probably originate from DNA DSB repair (Luo et al., 2004; Zhu et al., 2002) and are linked to chromosomal instability (CIN) in cancer cells (Gisselsson et al., 2000; Montgomery et al., 2003) and to tumorigenesis in mice (Artandi et al., 2000). Anaphase bridge s break during anaphase, exposing telomerase-free ends that can fuse w ith other broken strands or sister chromatids resulting in fused chromosomes. These fused chromosomes can repeatedly undergo breakagefusion-bridge cycles during subsequent m itoses (Gisselsson, 2003). Additionally, CSC transformed MCF10A-CSC3 cells (Narayan et al., 2004), in contrast to parental MCF10A cells, display polyploidy (Jai swal, 2008). Hecht offers a model linking cigarette-induced DNA damage to lung carcinogenesis that can also be applied to other tobacco-induced cancers including breas t carcinogenesis (Hecht, 1999, 2003, 2006) (Figure 1-1). Nicotine addition causes continual cigarette smoking and chronic exposure to cigarette smoke carcinoge ns. Most of these carcinogens must be metabolically modified. Glutat hione-S-transferases and UDP-glucu ronosyl transferases convert carcinogen metabolites into less harmful forms (Armstrong, 1997; Burchell, 1997) and the detoxified components are excr eted out of the body. Conversely, cytochrome P450 enzymes (P450s) convert the carcinogens to electrophilic compounds that can bind DNA and form adducts (Guengerich, 2001; Jalas et al., 2005). P450 enzymes, are part of mammalian system that responds to foreign matter in the body (G uengerich, 2001). P450s, CYP1A1 and CYP1B1, are inducible by the aryl hydrocarbon receptor wh ich is important in the activation of PAHs 19

PAGE 20

(Nebert et al., 2004). The bala nce between activation and det oxification enzymes varies among individuals and affects cancer su sceptibility (Vineis et al., 2003). Cellular repair systems can remove DNA adducts and return the DNA structure to its original state (Goode et al., 2002). If the adducts are not repaired ( overwhelming of repair system or polymorphisms in repair enzymes) and persist during DNA replication, mi scoding and permanent mutations can occur in the DNA. DNA adducts lead to genotoxic damage including CIN, DNA strand breaks, chromosomal/gene mutations, and cytogenetic ch anges (DeMarini, 2004). Damaged cells may be removed by apoptosis and the balance be tween mechanisms l eading to and opposing apoptosis has a significant effect on tumor fo rmation (Bode and Dong, 2005). Mutations that cause loss of function in pro-a poptotic genes or the upregulation of anti-apoptotic genes allows DNA damage to persist and may result in abnor mal gene expression. The chronic DNA damage from cigarette smoke exposure is consistent with the genetic changes that occur as normal tissues progress from hyperplasia to invasive cancer (O sada and Takahashi, 2002; Park et al., 1999; Wistuba et al., 2002). Mutations that occur in oncogenes or tumor suppressors can also contribute to the loss of normal cell growth control (Hecht, 1999) resulting in cell transformation and eventually tumorigenesis. Chemical Transformation of Hu man Breast Epithelial Cells Chemicals contribute to carcinogenesis by inducing ce llular transformation: the conversation of normal cells into cells with cancerous properties (Rudin, 1997). Transformation primarily results from carcinogen -induced DNA damage. The most significant characteristic of chemical transformation is increased proliferatio n. Proliferating cells can readily metabolize carcinogens and harbor the resul ting genetic mutations into subs equent generations (Russo and Russo, 1980, 1987; Russo et al., 1982). Other characte ristics of transformati on are clonal growth (McCormick and Maher, 1989) and anchorage-inde pendent growth, which is a relatively late 20

PAGE 21

marker and can be correlated with tumorigenec ity (DiPaolo, 1983; Shin et al., 1975). Neoplastic cells display invasiveness (O chieng et al., 1991) and locomoti on (Albini et al., 1987; Repesh, 1989) and malignant transformation is manifested by the ability to form tumors in mice (Change, 1966; DiPaolo, 1983; McCormick and Maher, 1989). These characteristics contribute to the six hallmarks of cancer: self-sufficiency in growth signals, insensitivity to anti-growth signals, evasion of apoptosis, limitless re plicative potential, sustained a ngiogenesis, tissue invasion and metastasis, that are acquired by a cell as it b ecomes cancerous (Hanahan and Weinberg, 2000). The transformation of human breast epithelial cells with cigarette smoke carcinogens has been observed repeatedly. Spontaneously immortalized human breast epithelial cells, MCF10F (Soule et al., 1990; Tait et al., 1990 ), displayed transformed charac teristics after treatment with B[ ]P and DMBA. The cells had increased prol iferation, anchorage-independent growth, and altered patterns when grown in collagen matrix when compared to control cells, but were not tumorigenic in vivo These cells also displayed greater chemoinvasive and chemotactic abilities when compared to control cells (Calaf and Ru sso, 1993). Being chemoinvasive and chemotactic are characteristics enhanced in transformed cells that correlate with malignant characteristics in vivo (Bonfil et al., 1989; Liotta, 1984 ; MacCarthy, 1988; Mensing et al., 1984; Ochieng et al., 1991; Zimmermann and Keller, 1987). MCF10A, th e counterpart of MCF10F cells that grow attached in vitro (Soule et al., 1990; Tait et al., 1990), can be transforme d with a single treatment of CSC. These cells displayed increased growth and anchorage-independ ent growth that were stable in re-established cell lines (Narayan et al., 2004).(Chen et al., 1997; Martin and Leder, 2001) NNK transformed MCF10A cells in a study that utilized low doses over a period of time to mimic long-term exposure to the carcinogen (Mei et al., 2003). The transformed cells exhibited increased anchorageindependent growth, cell motilit y, and tumorigenecity in nude 21

PAGE 22

mice (Mei et al., 2003), meaning the cells had become malignant. These studies provide evidence that cigarette smoke components play a role in the multi-step oncogenesis of the breast. Apoptosis Programmed cell death (PCD), also known as apoptosis, was first described in 1972 (Kerr et al., 1972). It is an e volutionary conserved process that regulates cell proliferation and turnover and maintains genomic integrity by sele ctively removing highly mutated cells from a population (Cherbonnel-Lasserre et al ., 1996). In healthy cells, apoptosis is tightly regulated; too much cell death can lead to degenerative condi tions, while too little can lead to autoimmune disorders and cancers (Thompson, 1995). Apoptosis is a process of death in which the cel l takes an active role in its own demise. Characteristics of apoptosis include cell shrinka ge, chromatin condensation, and disintegration of the cell, before it is removed by phagocytosis (Kerr et al., 1972). Other forms of apoptosis include anoikis and amorphosis. The survival of epithelial cells requires c ontinual attachment to the extracellular matrix (ECM) (Streuli a nd Gilmore, 1999). Anoikis occurs upon the detachment of epithelial cells from the extracel lular matrix (Frisch and Francis, 1994). The maintenance of cellular morphology is also necessary for the survival of epithelial cells (Chen et al., 1997; Martin and Leder, 2001). Amorphosis is triggered by the alte ration of cell shape (Martin and Vuori, 2004). Classical apoptosis can occur through two major pathways. Intrinsic Pathway The intrinsic pathway eliminates cells in response to ionizing radiation, chemotherapy, mitochondrial damage, and certain developmental cues (Kuribayashi et al., 2006). The mitochondrion is the central response unit to this pathway. Mitochondrial swelling and outer mitochondrial membrane rupture results from a wide variety of apoptotic stimuli (Vander Heiden et al., 1997). DNA damage or cell stress causes stabilization of p53 and subsequent activation of 22

PAGE 23

Bcl-2 pro-apoptotic proteins su ch as Bax and Bak that induc e the mitochondrial release of cytochrome c. Bax mediates cell death (Chittenden et al., 1995) by homodimerizing to itself (Zha et al., 1996) and promoting the release of cytochrome c from the mitochondria (Reed, 1997). In the presence of liberated cytochrome c and ATP, the adaptor protein, Apaf-1, recruits pro-caspase-9. It is believed th at the presence of cytochrome c changes the conformation of the Apaf-1 negative regulatory domain of WD40 repeat s, and allows for its association with procaspase-9 (Li et al., 1997). Apaf-1, cytochro me c, and procaspase-9 form the apoptosome complex that activates procaspase-9 (Li et al ., 1997; O'Connor and Strasser, 1999). Activated caspase-9 cleaves and activates downstream effe ctor caspases such as caspase-3, -7, which execute apoptosis (Li et al., 1997). Smac/DIABLO is also released from the mitochondria. These compounds inhibit inhibitor of apoptosis proteins (IAPs) and further promoting the activation of caspases (Du et al., 2000; Verhagen et al., 2000). Extrinsic Pathway The extrinsic pathway eliminates unwanted cells during development, immune system maturation, and during the immunosurveillance re moval of tumor cells (Kuribayashi et al., 2006). This pathway bypasses the steps that are re gulated by Bcl-2 family members. It is triggered by receptors of the tumor necrosis factor (TNF) receptor type I family, TRAIL receptors, or Fas (CD-95/APO-1) receptors and their ligands. Th e Fas-induced death pathway is the major pathway that occurs in the lymphoid sy stem (Newton et al., 1998; Strasser et al., 1995) and has become the paradigm for the extrinsi c pathway (Kuribayashi et al., 2006). Ligand binding results in receptor trim erization and formation of the death-inducing signaling complex (DISC). The adaptor molecule, Fas-associated protein with death domain (FADD), is then recruited to the receptors cytosolic tail by its death domain (Chinnaiyan et al., 1995; Green and Kroemer, 2004). Procaspase-8 or -10 are recruited to FADD by an interaction of the N-terminal 23

PAGE 24

death effector domain (DED) of both proteins (Ch ittenden et al., 1995). The DISC allows for the auto-activation and maturation of caspase-8, -10 (Boatright et al., 2003; Donepudi et al., 2003). The activation of these caspases initiates the death signaling cascade by cleaving and activating the downstream effector caspase-3, -7. The in trinsic and extrinsic a poptotic pathways are interconnected. Activated caspase-8 cleaves the BH3-only protein, tBID, which in turn facilitates the releas e of cytochrome c from the mitochondria (Li et al., 1998). Apoptosis and Cancer Studies support the hypothesis that apoptosis selectively re moves the most damaged cells from the population (Cherbonnel-La sserre et al., 1996). Apoptosis is a critical defense against radiation-induced mutations, malignant transf ormation, and neoplastic progression. Damaged cells that escape this pathway are more likely to have increased levels of mutations due to heavily damaged DNA. DNA damage-induced muta tions that occur can contribute to a proliferative advantage that mi ght drive the cell towards maligna ncy (Cherbonnel-Lasserre et al., 1996). From this and other studies, the concep t emerged that an increased threshold for apoptosis represents a central st ep in tumorigenesis. The surv iving damaged cells are the most likely to develop into neoplastic clones (Ada ms and Cory, 1998; Cherbonnel-Lasserre et al., 1996). Antiand pro-apoptotic proteins theref ore play opposing roles in the prevention or progression of tumorigenesis, re spectively. Since many chemothera peutic drugs kill cancer cells by triggering apoptosis, the modulation of cell ap optosis threshold is of critical therapeutic potential (Chinnaiyan, 1999). The B cell leukemia-2 (Bcl-2) Protein Family The B cell leukemia-2 (Bcl-2) protein family is involved in the regulation of apoptosis. The founding member, Bcl-2, was identified as a translocation found in human follicular lymphoma cells (Tsujimoto et al., 1984) and has anti-apoptotic activity (Vaux et al., 1988). At 24

PAGE 25

least twenty other Bcl-2 members have been identified in mammalian cells (Adams and Cory, 1998; Cory et al., 2003; Gross et al., 1999). All members contain at least one of the four Bcl-2 homology (BH) domains which influence the di merization required for the function of some members (Kelekar and Thompson, 1998; Yin et al., 1994). The anti-apoptotic members: Bcl-2 (Tsujimoto et al., 1984), Bcl-xL (Boise et al., 1993), Bcl-w (Gibs on et al., 1996), Mcl-1 (Kozopas et al., 1993), and A1 (Lin et al., 1996) contain all four BH domains. Anti-apoptotic proteins function by directly or indirectly binding and inhibiti ng the activity of pro-apoptotic proteins that activate effector caspases (Cory and Adams, 200 2; Opferman and Korsmeyer, 2003). Pro-apoptotic members fall into two categor ies. Bax is the founding member of the first category (Hsu et al., 1997; Hsu and Youle, 1998). Bax and the remaining proteins in this group, Bak and Bok, have domains BH1, BH2, and BH3 and directly induce the release of cytochrome c from the mitochondria. BH3 only proteins (Ba d, Bim, Bid), as the name implies, possess only the the BH3 domain (Chittenden et al., 1995; Kelekar and Thompson, 1998). These proteins bind anti-apoptotic proteins and prevent them fr om sequestering the firs t group of pro-apoptotic proteins (Letai et al., 2002). BH3-only proteins function upstr eam of, and are dependent on Bax and Bak and can not kill cells that lack the two pr oteins (Zong et al., 2001). The dimerization of Bcl-2 proteins can titrate each othe rs functions, suggesting that rela tive concentrations and ratios of Bcl-2 family proteins act as a rheostat controlling the apopt osis program and cell survival (Farrow and Brown, 1996; Lohmann et al., 2000; Oltvai et al., 1993). Bcl-x Gene and Promoter Structure The human bcl-x gene was identified by the cross-hybrid ization of gene libraries with a bcl-2 probe (Boise et al., 1993). The gene structure is similar to that of bcl-2 (Seto et al., 1988). Bcl-x is composed of three exons (F igure 1-2A); the first exon is untranslated, while exons II and III code for bcl-x mRNAs. Exon II contains translation initiation codons, while exon III contains 25

PAGE 26

the translation termination codons. The exons are separated by a 283 bp intron between exons I and II and a large 9 kb intron betw een exons II and III. The 5 untranslated region (UTR) spans from exon I to the beginning of exon II (Grillot et al., 1997). The initial promoter studie s occurred in mice. Two bcl-x murine promoters were cloned and described (Grillot et al., 1997). The first promoter was 57 bp upstream of the second exon and most active in FL5.12 and K542 cell lines by primer extension. A major transcriptional initiation site was mapped to this region. This promoter lacked a TATA box and instead contained a consensus initiator (Inr) element (YYANT/AYY) at 149 to -142 (Grillot et al., 1997). Inr sites are involved in transcription initiation at TATA-less promoters and the transcription start site usually overlaps the Inr consensus sequen ce (Smale and Baltimore, 1989). However, the Inr here is probabl y not involved in transcription in itiation because the major start site mapped outside the Inr seque nce (Grillot et al., 1997). The second promoter was further 5, upstream of exon I. This promot er was utilized mostly in the brain and thymus. This GC-rich region had Sp protein binding motifs and two majo r transcription start sites: in the brain the position was -727 and in the thymus the site wa s mapped to -655 before the initiation codon in exon II (Grillot et al., 1997). Later, studies indicated that the mouse bcl-x promoter was active in many tissues and three additional tissue specific murine bcl-x promoters were been identified (Pecci et al., 2001). Human and murine bcl-x open reading frames have 93% nucleotide identity (GonzalezGarcia et al., 1994). Bcl-x mRNAs are transcribed from the human bcl-x gene as the result of alternative mRNA splicing, each coding for a si ngle protein isoform (Figure 1-2B). Three bcl-x mRNAs and proteins have been reported in hum ans: Bcl-xLong (Bcl-xL) (Boise et al., 1993), Bcl-xShort (Bcl-xS) (Boise et al., 1993), and Bcl-xBeta (Bcl-x ) (Ban et al., 1998). Bcl-xl 26

PAGE 27

results from the splicing together of the two coding exons (II and III). Bcl-xs results from the use of an alternative 5 splice site in exon II and lacks the 3 terminal 63 amino acids that comprise BH1 and BH2 which are needed to inhibit apopt osis. It codes for a 178 amino acid protein (Boise et al., 1993) that is approximately 18 kD a (Gonzalez-Garcia et al., 1994) and functions as a pro-apoptotic protein by antagonizing Bcl-2 an d Bcl-xL to promote apoptosis. Bcl-xS is expressed in cells with high turnov er rates (Boise et al., 1993). Bcl-x results from the unspliced bcl-x transcript of Exon II that introduces a new stop codon before the third exon. Therefore, it lacks the carboxy-terminal hydrophobic 19 amino acid domain and has a unique stretch of 21 amino acids at the carboxy terminus (Gonzalez-Garcia et al., 1995). In vitro studies show that Bcl-x interacts with the pro-apoptotic protein Ba x (Ban et al., 1998). Whether the protein has antior pro-apoptotic e ffects remains unclear. Bcl-xL Protein Bcl-xl is the major, most abundant bcl-x mRNA and protein expr essed in murine and human tissues (Boise et al., 1993; Gonzalez-Garcia et al., 1995; Gonzalez-Garcia et al., 1994; Rouayrenc et al., 1995). The human bcl-xl promoter is upstream (5) to exon I and codes for the majority of bcl-x transcripts in humans. Bcl-xl mRNA originates from the 5 untranslated region (UTR) of the promoter (Grillot et al ., 1997; Sevilla et al., 1999). A novel bcl-x promoter and exon located upstream of exon I has been iden tified in human lymphoma cells (MacCarthyMorrogh et al., 2000). Bcl-xL is a 241 amino acid protein (Boise et al., 1993) of 29-30 kDa (Yin et al., 1994). The structure of human Bcl-xL ha s been crystallized and character ized (Muchmore et al., 1996). The protein is composed of a total of seven -helices. The two central anti-parallel hydrophobic helices, 5 and 6, are flanked by helices 3 and 4 on one side and 1, 2, and 7 on the other side. The -helices 5 and 6 form a hairpin that shares homology with the hairpin structure found 27

PAGE 28

in the translocation domain of diphtheria toxin (Muchmore et al ., 1996) and the carboxy-terminal end contains a hydrophobic segment (Huang et al., 1998; Yin et al., 1994). The 56 hairpin and the carboxy-terminal end of Bcl-xL are involved in anchoring the protein to mitochondrial membranes. A large non-conserved flexible loop connects 1 and 2 (Muchmore et al., 1996) and has been shown to negatively regulate the activity of the protein (Chang et al., 1997). This loop domain comprises about one quarter of the protein and contains all the phosphoryl ation sites of Bcl-xL between amino acids 32 and 83 (Cha ng et al., 1997). Similar to Bcl-2, the phosphorylation of Bcl-xL decreases its an ti-apoptotic function (Biswas et al., 2001; Poruchynsky et al., 1998). Bcl-xL lacking the flexible loop renders th e protein unable to be phosphorylated thus causing the protei n to block apoptosis more effi ciently than wild-type Bcl-xL (Muchmore et al., 1996). Bcl-xL is al so deaminated on this the flexible loop. Deamination is a modification in which an aspara gine is converted into an aspartate (Takehara and Takahashi, 2003). Bcl-xL is deaminated at two asparagines in response to anti-neoplastic agents. Deamination negatively modulates the prosurvival activity of Bc l-xL and the inhibition of this modification increases the cells resist ance to these agents (Deverman et al., 2002). Proteins with such long regions of random coil do not normally have long half-lives because the region is vulnerable to cellular pr oteases (Ciechanover, 1994). It is likely th at the loop region of Bcl-xL and other similar proteins are protected by associations with other proteins. A similar loop has been found on Bcl-2 (Chang et al., 1997). Bcl-xL binds to itself with the weakest affinity, indicating that is mono meric in nature (Muchmore et al ., 1996) and is localized to the nuclear envelope, extra-nuclear membranes, the m itochondria, and is also present in the cytosol (Gonzalez-Garcia et al., 1994; Hsu et al., 1997). 28

PAGE 29

Bcl-xL functions as an an ti-apoptotic protein Bcl-xL is an anti-apoptotic member of the Bcl-2 protein family and is most closely related to Bcl-2 (Boise et al., 1993; Grillot et al., 1997). The two proteins display 43% amino acid identity (Muchmore et al., 1996; Petros et al ., 2001). Bcl-xL and Bcl-2 are in the group of oncogenes that function as repressors of apopt osis and do not affect proliferation rates (Korsmeyer, 1992; Miyashita et al., 1994). The role of Bcl-xL in apoptosis is evident; disruption of bcl-x gene leads to death in E12-E13 mouse em bryos due to massive apoptosis of neuronal and hematopoietic progenitors (Motoyama et al., 1995) It is therefore es sential for neurogenesis (Gonzalez-Garcia et al., 1994; Motoyama et al ., 1995) and is a key protein during cytokineregulated myelopoiesis (Packham et al., 1998). Bcl-xL inhibits st aurosporine-induced cell death, caspase-3 and caspase-7 activation, and PARP cleavage (Chi nnaiyan and Dixit, 1996) and is capable of suppressing apoptosis of IL-3 dependent cells upon grow th factor withdrawal (Boise et al., 1993; Gonzalez-Garcia et al., 1994). It also inhibits an oikis in breast cancer cells (Fernandez et al., 2002). Dimerization with pro-apoptotic proteins Bcl-xL prevents th e intrinsic apoptosis pathway (Chinnaiyan and Dixit, 1996; Gon zalez-Garcia et al., 1994) by localizing to mitochondrial membranes, inhibiting the rel ease of cytochrome c, and preventing the downstream activation of apoptotic signal transduction cascades (B oise et al., 1993; Fang et al., 1994; Gonzalez-Garcia et al., 1994 ). Bcl-xL does so by heter odimerizing with pro-apoptotic proteins (Boise et al., 1993; Oltvai et al ., 1993; Yin et al., 1994). Bax monomers must oligomerize to permeate membranes and lead to apoptosis (Annis et al., 2005). The overexpression of Bcl-xL prevents the oligermization of Bax (Finucane et al., 1999; He et al., 2003). Bcl-xL can also bind to and inhibit the BH3-only protein Bad. Normally Bad is phosphorylated and sequestered by the scaffold pr otein, 14-3-3. Apoptotic signaling results in 29

PAGE 30

the dephosphorylation of Bad, that then binds to Bcl-xL and counteracts it s pro-survival activity (Zha et al., 1996). The overexpression of BclxL can sequester Bad to the mitochondria (Cheng et al., 2001; Jeong et al., 2004), leav ing excess Bcl-xL to continue its pro-survival functions. The BH1 and BH2 domains have been shown to be important for Bcl-xL to antagonize Bax (Minn et al., 1999; Yin et al., 1994). Later studies determined that BH1-BH4 and the carboxyterminal domains are required for the sequestering of Bax. Alternatively, BH1, BH3, and the carboxy-terminal tail are necessary for Bcl-xL to sequester Bad to the mitochondria (Zhou et al., 2005). Mitochondrial stability Studies indicate that Bcl-xL acts in dimerization-independent mechanisms to inhibit apoptosis (Chang et al., 19 97; Cheng et al., 1996; Fiebig et al., 2006) in the absence of Bax and Bak. (C hang et al., 1997). Bcl-xL physic ally inhibits the release of mitochondrial contents such as cytochrome c. It can prevent apopt osis by maintaining mitochondrial membrane potential and volume homeostasis (Boise and Thompson, 1997; Vander Heiden et al., 1997). The loss of F1F0-ATPase activity, that occurs through the permeability transition pore complex (Zoratti and Szabo, 1995), terminates mitoc hondrial respiration and triggers the release of cytochrome c (Cai et al., 1998). The three-dimensional structure of the Bcl-xL pore-forming domain (Muc hmore et al., 1996) has been imp licated in the regulation of membrane permeability (Cramer et al., 1995; London, 1992). Bcl-xL has been shown to function like bacterial toxins that have similar por e domains. It can insert into synthetic lipid vesicles or planar lipid bilaye rs and form ion-conducting channels (Minn et al., 1997). It is possible that the channels formed by Bcl-xL serv e to prevent the release of proteins, such as cytochrome c. Pores formed by Bcl-xL ma y also serve to stabilize mitochondrial volume potential. The ability of Bcl-xL to prevent apop tosis, however, is probably not solely dependent 30

PAGE 31

on it pore-forming capability (Minn et al., 1997). Bcl-2 and Bax can also form ion channels in synthetic membranes (Antonsson et al., 1997; Schendel et al., 1997). Interactions with the apoptosome Bcl-xL has been found to form a ternary complex with the apoptotic effector cas pase, pro-caspase-9, and Apaf-1. The first indication of this characteristic was discovered when the nematode, Caenorhabditis elegans protein, CED-9, and its mammalian homologue, Bcl-xL, bound to an d inhibited the function of CED-4, the mammalian counterpart to Apaf-1. This interact ion suggested that Bcl-xL may block cell death by a similar mechanism in mammalian cells (Chi nnaiyan and Dixit, 1997). Subsequent studies found that in 293 human embryonic kidney cells, caspa se-9 and Bcl-xL bound distinct regions of Apaf-1 and formed a ternary complex (Pan et al ., 1998). This interaction inhibited the activation of caspase-9 in human embryonic kidney cells with SV40 large T antigen, 293T (Hu et al., 1998). These studies offer an alternative model to the anti-apopt otic mechanism of Bcl-xL in which the protein directly prevents the release of cytochrome c, and also inhibits the activation of pro-caspase-9 through direct interaction with Ap af-1. The mechanism by which Bcl-xL inhibits apoptosis while bound to Apaf-1 may be cell-type de pendent. In prostate epithelial cells, Bcl-xL interacts with Apaf-1 but it inhibits apoptosis by preventing the release of cytochrome c from the mitochondria (Chipuk et al., 2001). Caspase-9 and -3 are still activated because the addition of cytochrome c results in their cleavage. It is possible that the interaction between Bcl-xL and Apaf-1 may also depend on experi mental conditions or an unide ntified protein (Chipuk et al., 2001). Bcl-xL and the extrinsic apoptotic pathway Bcl-xL also inhibits extrinsic apoptotic pathways. Tumor necrosis fact or (TNF)-induced apoptosis was i nhibited in the human myeloid leukemia cell line HL-60, by overexpressing Bcl-xL which was thought to block an early step 31

PAGE 32

in TNF signaling. Bcl-xL may have blocked TNFinduced apoptosis in these cells by reducing the expression of a downstream target of TN F, AP-1 and JNK and MAPK kinases, which regulate AP-1 (Manna et al., 2000) Bcl-xL also inhibited TN F-induced apoptosis in MCF-7 breast carcinoma cells (Jaat tela et al., 1995; Srin ivasan et al., 1998). Bcl-xL inhibits Fas-induced cell death by seve ral mechanisms. It protected primary B cells from Fas-mediated apoptos is (Schneider et al., 1997). Bcl-xL inhibited Fas-induced apoptosis in Bcl-xL-tranfected Jurkat cells treated with Fas antibodies not by blocking caspase activation, but by inhibiting the subsequent loss of m (Boise and Thompson, 1997). In Jurkat T lymphocytes and breast carcinoma cells, BclxL inhibited apoptosis induced by microtubule damaging drugs such as paclitax el and vincristine. In thes e cells, overexpression of Bcl-xL inhibited the Fas pathway by binding calcineurin and interfering with the nuclear translocation of NFAT proteins that transcriptionally activ ate the Fas ligand (Bis was et al., 2001). Mechanism by which Bcl-xL inhibits caspase-8-dependent apoptosis It was discovered in early studies that Bcl-xL and Bcl-2 could block caspase-8 activation (Chinnaiyan and Dixit, 1996). It was hypothesized that BclxL might act upstream of the CED-3 homologue, caspase-8 (Chinnaiyan and Dixit, 1997), by inhibiti ng its interaction with the DISC or that the protein acted downstream of caspase-8, by preventi ng its action on target pr oteins. In peripheral human T cells resistance to CD95-induced apoptos is is characterized by lack of caspase-8 recruitment to the DISC and increased Bcl-xL leve ls (Peter et al., 1997). However, most studies support the latter theory. The ove rexpression of Bcl-xL did not a ffect caspase-8 activation in MCF-7 cells expressing high levels of CD95 (MCF-7-Fas), but the cells still become resistant to CD-95-induced apoptosis (Jaattela et al., 1995). In MCF-7-Fas cells there were no associations found between Bcl-xL and pro-caspase-8 or activ e caspase-8 subunits, however, PARP cleavage 32

PAGE 33

was completely blocked. Therefore, Bcl-xL seemed to inhibit Fas-induced apoptosis downstream of caspase-8, but ups tream of PARP cleavage. Bc l-xL probably inhibited the activity of another caspase-3-lik e protein that cleaved PARP in these cells but the mechanism remained unclear (Medema et al., 1998). In th e next issue of the same publication, it was reported that Bcl-xL inhibited not only Fas-i nduced apoptosis, but also TNF receptor induced apoptosis in MCF-7 cells transf ected with Fas and Bcl-xL cDNAs (MCF-7/FB) (Srinivasan et al., 1998). Bcl-xL was capable of inhibiting apopt osis, despite the full ac tivation of caspase-8. This inhibition manifested as changes in cyto chrome c localization and cell morphology. Bcl-xL could even inhibit apoptosis when the cell was microinjected with active caspase-8. However, the activity of caspase-7, a downs tream target of caspase-8, was attenuated after treatment with Fas antibody or TNF, and was totally blocked in cells treated with UV. The inhibition of apoptosis by Bcl-xL was therefore, also found to occur downstream of caspase-8 but upstream of one of the caspase-8 targets. Bcl-xL may have inhibited caspase-8 activ ity by translocating the protein from the plasma memb rane, sequestering caspase-8 ta rgets, or by regulating the availability of cofactors necessa ry for caspase-8 to cleave its ta rgets (Srinivasan et al., 1998). The property of Bcl-xL to inhibit apoptosis dow nstream of initiator caspases but upstream of their targets (possibly effector caspases) have been previous ly observed (Boise and Thompson, 1997; Medema et al., 1998), however the mechanism by which Bcl-xL inhibits extrinsic pathway of apoptosis seems to be cell-type dependent. Bcl-xL and breast cancer Bcl-x proteins are involved in normal mammary involution and development. In humans, the expression of Bcl-2 and related proteins such as Bcl-xL is not well studied in the mammary gland. Studies focused on the expression of Bcl-2 family members in rodents have been extrapolated for the analysis of human samples. Bcl-x isoform expression changes in alveolar 33

PAGE 34

cells during involution, a peri od of mammary cell apoptosis and remodeling, compared to lactation (Heermeier et al., 1996). Bcl-xl and bcl-xs expression were anal yzed with RT-PCR and differential hybridization. In virgin mice, during lactation, and pregnancy, bcl-xl mRNA was ten-fold higher than bcl-xs expression. During involution, bcl-xs levels increased up to six-fold compared to bcl-xl levels and bax is also upregulated during this time (Heermeier et al., 1996; Li et al., 1996b, c). Transfection experiments showed that cells expressing Bcl-xL had higher cell viability (27% died) after DNA da mage. Co-expression of Bcl-xS and Bcl-xL proteins resulted in the inhibition of the Bcl-xL protective effect (8 0% cells died). This study further supports the theory that the ratio of pro-apopt otic and anti-apoptotic species in a single cell can determine cell fate. Bcl-xL is up-regulated in some cancers (Packham et al., 1998) and is implicated in having a role in colorectal carc inogenesis (Krajewska et al., 1996; Maurer et al., 1998). In many cases, Bcl-xL expression occurs at the ad enoma to carcinoma transition, continuing through metastasis (Krajewska et al., 1996; Liu and Stei n, 1997). Reduction of apopt osis is associated with the development to fibrocystic changes in th e breast and increased cancer risk (Allan et al., 1992). However, Bcl-xL has not been fully imp licated in human breast tumorigenesis. The effects Bcl-xL has on breast carcinogenesis primar ily hinge on the protei ns ability to prevent apoptosis and promote survival. The role of Bc l-xL in breast carcinogenesis is evident from biological studies. Bcl-xL has roles in breast carcinogenesis on the levels of primary tumor growth, metastasis, and chemotherapy resistance. Bcl-xL and primary tumor growth. Bcl-xL is overexpressed in some primary human breast carcinomas and the breast can cer cell line, T47D (O lopade et al., 1997; Schott et al., 1995) and is a marker for increased tumor grade and nodal metastasis (Olopade et al., 1997). It is also 34

PAGE 35

increased cancerous, but not normal breast epitheliu m and may serve as an indicator or patient prognosis (Krajewski et al., 1999). Although Bcl-xL overexpressi on in mouse tumors, it does not increase the number of mitotic figures (Liu et al., 1999) is therefor e does not affect cell proliferation or cel l cycle progression. Bcl-xL and metastasis. Bcl-xL has a more important role in metastasis than in primary tumor development. The overexpression of BclxL does not induce primary tumor formation but enhances MEK-induced tumorigenesis in the ma mmary gland environment (Martin et al., 2004). Metastasis is the primary cause of treatment fail ure in cancer patients (Chambers et al., 2001). Overexpression of Bcl-xL in M DA-MB-435 breast cancer cells incr eased cell metastatic activity. Resistance to cytokine-induced a poptosis, increased cel l survival in circulation, and increased anchorage-independent growth were all characteristics of these cells (Fernandez et al., 2002). MDA-MB-435 cells transfected with Bcl-xL me tastasized to the lung, lymph nodes, and bone when inoculated into the mammary fat pads of nude mice (Rubio et al., 2001). Bcl-xL increased tumor cell survival in the bloodstream (Fernandez et al., 2000) and the metastatic properties of breast cancer cells that had already lost ex tracellular matrix dependence by improving cell survival under conditions with no cellular adhesion, enhancing anchorage-independent growth. Surprisingly, Bcl-xL did not in crease metastatic activity in cells that had not escaped the extracellular matrix. MDA-MB-435 cells transfected with the bcl-xl gene and inoculated into nude/SCID mice resulted in increased lymph node metastasis (Fer nandez et al., 2002). The mechanisms by which Bcl-xL increases meta stasis have been investigated. It has been suggested that the key event in breast cance r metastatic progression is the deregulation of cell death (Fernandez et al., 2002). Therefore, apoptosis resistan ce has a role in metastasis (Fernandez et al., 2000; McConkey et al., 1996). Additionally, Bcl-xL overexpression could 35

PAGE 36

functionally associate with gene s that control the events that result in the acquisition of metastatic phenotypes and shorten the dormancy of metastatic cells in several organs (Mendez et al., 2006). Tumor dormancy is the prolonged quiescent period in which the metastatic progression is not clinically de tected (Yefenof et al., 1993). Studies suggested that Bcl-xL shortens the dormancy of metastatic cells. Experiments with mice injected with cells overexpressing Bcl-xL indicated that Bcl-xL has ro le in dormancy by promoting the survival of cells in metastatic foci (Rubio et al., 2001). Pro-survival proteins, such as Bcl-xL, displace the offset the balance between death and prolifera tion, shortening the period between dissemination and the appearance of clinical metastasis (Karri son et al., 1999). Bcl-xL does not appear to affect the actual movement of metastatic cells to foci because, breast ca ncer cells overexpressing Bcl-xL reach target organs in similar numbers as the vector controls. Since the Bcl-xL tumors developed more metastases than control cells, Bc l-xL may promote the survival of and harbor metastatic cells at metastatic fo ci (Rubio et al., 2001) allowing th e metastatic cells to adapt to changes in their cellular environment (Fer nandez et al., 2002; Li et al., 2002). The loss of apoptosis is also instrument al in accumulating genomic damage. The extended lifespan of cells overexpressing Bcl-xL allows for more genetic mutations. This is evident in that the loss of apopt osis in breast carcinoma is mo re frequent in tumors with microsatellite instability (MSI) (Mendez et al., 2001) and leads to the appear ance of variants with malignant potential such as surv ival at metastatic foci (Zhivot ovsky and Kroemer, 2004). It has been proposed that genetic instability correlates w ith anti-apoptotic proteins such as Bcl-xL, that are involved in the selection of highly metastatic cells during tumorigenesis. Therefore the accumulation of genetic alternati ons caused by the deregulation of Bcl-xL in breast cancer are essential to metastasis (Mendez et al., 2005). Th ese studies suggests that the primary role of 36

PAGE 37

Bcl-xL in the breast cancer metastasis is allowi ng for the accumulation of genetic mutations and alterations, decreasing tumor cell dormancy, a nd providing a mechanism for which metastatic cells can adapt to new microenvironments (Fernandez et al., 2002). Bcl-xL and chemotherapy resistance The molecular mechanisms responsible for chemoresistance are unclear. One mechanism i nvolves altering the expre ssion of anti-apoptotic proteins such as Bcl-xL because many ch emotherapy drugs kill tumor cells by inducing apoptosis (Barry et al., 1990; Kaufmann, 1989). Cells expressing Bc l-xL are more likely to be chemo-and radiotherapy-resistant (Cherbonnel-Lasse rre et al., 1996; Simonian et al., 1997). The role of Bcl-xL in chemotherapy resistance overl aps it role in metastatsis and is primarily the survival and therefore subsequent adaptation of cancer cells to their new environments (Gu et al., 2004). It has been suggested that chemothe rapy treatment selects for tumor clones that overexpress Bcl-xL. This is evident because the staining intensity of such proteins increased after chemotherapy of primary tumors (Campos et al., 1993; Castle et al ., 1993; Maung et al., 1994; Weller et al., 1995). Cancer cells overexpressing Bcl-xL are more easily selected for resistance after drug treatment because of their lack of apoptosis (Fernandez et al., 2000). Additionally, Bcl-xL increases genetic instability in cells that can result in phenotypes that are more adaptive than others (Gu et al., 2004). Resistant to chemotherapy in SCC 25 squamous carcinoma cells in vitro is associated with Bcl-xL expressi on (Datta et al., 1995). Animal studies indicated that Bcl-xL promoted chemotherapy re sistance in mouse models. The tumors caused by SCK mammary cells transfec ted with Bcl-xL are resist ant to apoptosis induced by chemotherapeutic agents, methotrexate and 5-fluor ouracil. The protein may function in a similar fashion in human cells the overexp ress Bcl-xL (Liu et al., 1999). The role of Bcl-xL in organ 37

PAGE 38

specificity and overcoming dormancy (Rubio et al., 2001) indicates that it may be a hallmark of metastasis and contributes to therapy resi stance in doing so (Gu et al., 2004). The CCAAT/Enhancer Binding Protein (C/EBP) Family The CCAAT/enhancer-binding protein (C/EBP ) family is a group of leucine zipper transcription factors that plays roles in the diffe rentiation of adipocytes, myeloid, and other cells, metabolism, inflammation, proliferation, and other cellular functions (Ramji and Foka, 2002). Each family member is composed of diverg ent (<20% homology) amino-terminal region, and a conserved carboxy-terminal domain. This carbo xy-terminal region consists of a basic DNAbinding domain followed by -helical leucine zipper region wh ich is involved in dimerization (Lekstrom-Himes and Xanthopoulos, 1998; Ramji and Foka, 2002). The specificity of DNAbinding is dictated by the amino acids in the basic region (Johnson, 1993) and dimerization is required for DNA-binding (Landschulz et al., 1989). Dimers bind DNA at the sequence A/G TTGCG C/T AA C/T (Johnson, 1993; Osada et al., 1996; Vinson et al., 1989), as an inverted Y, each arm a single -helix that binds one half of the palindromic sequence in the DNA major groove like a pair of scissors (Tah irov et al., 2001; Tahirov et al., 2002). Three C/EBP proteins are expres sed in mammary tissue: C/EBP C/EBP and C/EBP (Gigliotti and DeWille, 1998; Sabatakos et al., 1998) and have been studied extensively (Osada et al., 1996). C/EBP is expressed in but is not require d for the normal development of the mammary gland (Seagroves et al., 1998). The expression of C/EBP causes growth G0-G1 cell cycle arrest and inhibits mammary cell proliferation (Gery et al., 2005). In fact, the protein is downregulated in and has been considered a potential tumor suppressor gene for breast cancer (Gery et al., 2005). C/EBP functions in the maintenance of mammary epithelial cells (Gigliotti et al., 2003). The protein f unctions in cell cycle exit/G0 entry and it inhibits mammary cell growth in vitro (Gigliotti et al., 2003; O'Rourke et al., 1997; O'Rourke et al., 1999; Sivko and 38

PAGE 39

DeWille, 2004). C/EBP is tightly regulated during G0 growth arrest of human mammary epithelial cells which allows ce lls to quickly re-enter cell cy cle and proliferate upon growth factor stimulation (Sivko and DeWille, 2004). C/EBP is also down-regulated in breast cancer; with the progression from normal mammary epitheliu m to breast carcinoma (Porter et al., 2003). Both C/EBP and C/EBP are correlated with cell-cycle inhibitory proteins, Rb, p27, and p16 (Milde-Langosch et al., 2003). C/EBP protein Human C/EBP (NF-IL6) was identified as a protein with high DNA-binding homology to rat C/EBP[ ] (Landschulz et al., 1988a; Landschulz et al., 1988b) that mediated IL-6 signaling by binding to IL-6 responsive elements on the tumo r necrosis factor (TNF), interleukin-8 (IL-8), and granulocyte colony-stimulati ng factor (G-CSF) promoters (Aki ra et al., 1990; Poli et al., 1990). Homologues have been found in other speci es including: IL6-DBP (Poli et al., 1990), LAP (Descombes et al., 1990), AGP/EBP (Chang et al., 1990), CRP2 (Williams et al., 1991), and NF-M (Kowenz-Leutz et al., 1994). Later, a Greek letter notation was coined for each C/EBP protein ( , ) (Cao et al., 1991). C/EBP protein function C/EBP differs from other C/EBP members in th at it promotes the proliferation and represses the differentiation of many cell types (Lekstrom-Himes and Xanthopoulos, 1998). Knockout mice have been used to determine the biological functions of the protein. The primary defects occur in several different categories: the immune syst em (Screpanti et al., 1995; Tanaka et al., 1995), adipocyte differen tiation (Tanaka et al., 1997), liver function (Croniger et al., 1997; Greenbaum et al., 1998), and female fe rtility (Sterneck et al., 1997). C/EBP knockout mice also displayed defects in mammary developmen t (Milde-Langosch et al., 2003). Glandular development was impaired in virgin, pregnant, and lactating C/EBP-deficient mice (Robinson et 39

PAGE 40

al., 1998). Functional markers of murine mammary gland differentiation, where low or absent in these mice and they displayed dysfunctional differentiation of secretory epithelium, even in response to lactation specific hormones (Seagroves et al., 1998). Impaired mammary glands had delayed growth, enlarged ducts, and decreased br anching. The defects seen in these mice were intrinsic to the epithelial cells because the lack of C/EBP in the stroma did not affect ductal elongation and branching during pub erty or alveolar developmen t during pregnancy (Grimm and Rosen, 2003). The protein acts as the mediator of mammary cell fate by influencing hormonal receptors such as progesterone receptor (PR) (Seagroves et al., 2000). Additionally, C/EBP is required for ductal morphogenesis, lobuloalveolar development, and functional differentiation of murine mammary epithelial cells and for the pr oper proliferation and morphogenic responses during mammary gland maturation and for differe ntiation of milk-produc ing secretory cells during pregnancy (Robinson et al., 1 998). These studies emerge C/EBP as a critical component in the control of mammary epithelial cell prol iferation and differentiation and the in hormonal signaling cascades responsible for the healthy, fully developed, and lactating mammary gland (Robinson et al., 1998). C/EBP protein isoforms The cebpb gene consists of single exon gene with no introns a nd the transcription of the gene results in a single 1.4 kb mRNA (Zahnow, 2002). Three C/EBP protein isoforms are generated post-transcriptitionally: LAP1, LAP2 and LIP (Figure 1-3) through a leaky ribosome scanning mechanism that uses alternative tran slation initiation start sites (Descombes and Schibler, 1991; Ossipow et al., 1993). LIP has also been hypothesized to result from the proteolytic cleavage of other C/EBP isoforms (Baer and Johns on, 2000; Dearth et al., 2001; Welm et al., 1999) 40

PAGE 41

LAP1 (liver-enriched activation protein 1), also called LAP*, is the full-length isoform. The protein is 38 kDa in mice (Calkhoven et al., 2000; Williams et al., 1995) and 45 kDa in humans (Eaton et al., 2001). Human LAP1 represses the cyclin D1 promoter and is proposed to regulate transcription of genes in non-proliferating or differentia ting cells (Eaton et al., 2001). LAP1 is detected in the normal mammary glands of mice (Dearth et al., 2001; Eaton et al., 2001). In humans, the protein is detectable in normal, mostly non-divi ding human breast tissue and in secretory mammary epithe lial cells exfoliated in human breast milk (Eaton et al., 2001; Milde-Langosch et al., 2003). Human LAP2 (liver-enriched act ivation protein 2), also call ed LAP, differs from human LAP1 by 23 amino acids in humans, and 21 amin o acids in mouse, rat, and chicken (KowenzLeutz et al., 1994; Williams et al., 1995). The prot ein is 32 kDa-35 kDa in rodents (Calkhoven et al., 2000; Descombes et al., 1990) and 42 kDa in hu mans (Eaton et al., 2001). It is the most transcriptionally active form of C/EBP (Williams et al., 1995) and promotes cell proliferation, motility, and invasion (Bundy and Sealy, 2003). The growth-promoting functions of C/EBP are carried out in large by LAP2. Human LAP2 activat es cyclin D1 promoter and has been proposed to promote epithelial cell grow th (Eaton et al., 2001). LAP2 is expressed throughout rodent mammary development; twothree fold during pregna ncy, decreases at parturition, but is still readily detectable through lacta tion and involution and modestly decreased at lactation (Raught et al., 1995; Seagroves et al., 1998). In humans, LAP2 is expressed in normal and malignant breast tissue (Eaton et al., 2001; Milde-Langosch et al., 2003). LIP (liver-enriched inhibito ry protein) lacks a 49 am ino acid portion of its aminoterminal transactivation domain but reta ins the dimerization and DNA-binding domains. Therefore it can antagonize the transcriptional activation of th e LAP isoforms, C/EBP proteins, 41

PAGE 42

and other leucine zipper proteins It does so by forming heter odimers with target proteins, resulting in C/EBP protein dimers unable to transactivate target promoters, or it binds C/EBP sites on target promoters with a greater affi nity, competing with functional C/EBP dimers (Descombes and Schibler, 1991). LIP is 20 kD a in rodents (Calkhoven et al., 2000; Descombes and Schibler, 1991) and humans (E aton et al., 2001). Its expressi on is associated with rapid mammary epithelial cell prolifer ation and it inhibits cell differe ntiation (Raught et al., 1995). LIP isnt detectable in virgin rat mammary gl and (Seagroves et al., 1998) but it increases 100 times during pregnancy which coincides with incr eased alveolar cell pro liferation during this time. LIP expression is nearly undetectable at part urition and remains low throughout lactation and involution (Dearth et al ., 2001; Raught et al., 1995; Seagroves et al., 1998). The ratios of LAP/LIP are an important determinant of C/EBP function (Seagroves et al., 1998) and critical in media ting the expression of C/EBP target genes (Descombes and Schibler, 1991). These ratios rather than the absolute amounts of each isoform are an important indication of transcriptio nally activity of C/EBP (Zahnow et al., 2001) and have a dramatic effect on mammary gland development. Seve ral lines of evidence indicate that C/EBP expressing cells exhibit unique LA P/LIP ratios, depending on cell type and that C/EBP does not always function in a positive manner when the expression of LIP exceeds negligible levels (Shimizu et al., 2007). Several mechanisms have been described for the differential expression of C/EBP isoforms. It is hypothesized that the LAP1 and LA P2 translation start sites and a small uORF are embedded within a stem loop structure on the C/EBP mRNA and that both play an important roles in the regulation of AUG r ecognition and isoform translation (Raught et al., 1996; Xiong et al., 2001). The mRNA binding prot ein, CUG repeat binding protei n (CUG-BP1) (Baldwin et al., 42

PAGE 43

2004; Timchenko et al., 1999), calreticulin (Timchenko et al., 2002) and eukaryotic translation initiation factors, eIF-2 and eIF-4E (Calkhove n et al., 2000) bind cebpb mRNA and direct isoform translation. eIF2 plays a role in tran slation start site recogni tion (Donahue et al., 1988) and catalyzes the binding of Met-tRNA to the 40S ribosomal subunit (Schreier and Staehelin, 1973) while eIF4E recognizes the 5 mRNA cap as the first step in ribosomal scanning (Pause et al., 1994). C/EBP and Breast Cancer C/EBP mRNA is present in murine virgin mammary glands. It increases during pregnancy, declines at mid-lactation, and increases again within 48 hours of involution (Gigliotti and DeWille, 1998). In situ localization studies in the mouse mammary gland have identified the localization of C/EBP mRNA in vivo In humans, C/EBP mRNA is present in low levels in virgin mammary gland, increases during pregnancy, declines slightly duri ng lactation, and is induced 24-28 hours after the onset of involutio n (Gigliotti and DeWille, 1998; Robinson et al., 1998; Sabatakos et al., 1998). C/EBP plays a role in rodent breast carcinogenesis (Zahnow, 2002). Mice overexpressing the gene in the mammary gland de velop hyperplasia and carcinoma (Wang et al., 1994). C/EBP probably contributes to tumorigenesis by increases in mRNA and protein levels rather than somatic mutations (Grimm and Rosen, 2003). Studies in dicate that C/EBP proteins may also be involved in the etiology or progr ession of human mammary carcinomas, however, sparse information has been acquired so fa r (Milde-Langosch et al., 2003; Zahnow, 2002). Studies have indicated that the protein has a role in human breast carcinog enesis (Raught et al., 1996; Zahnow et al., 1997). C/EBP mRNA was two-five fo ld higher in MMTV/c-neu mammary tumors than the levels normally expresse d during lactation or invol ution (Dearth et al., 2001). 43

PAGE 44

Since all C/EBP isoforms originate from a single mR NA, protein levels of each isoform provide a more accurate depiction of the role of C/EBP in breast carcinogenesis. Changes in the ratios of C/EBP isoforms LAP/LIP have been observe d in breast cancer (Eaton et al., 2001; Zahnow et al., 1997). Each C/EBP isoform can contribute to br east carcinogenesis separately. LAP1 is expressed in normal breast epithelial ce lls and tissue from rodents and humans (Dearth et al., 2001; Eaton et al., 2001), so it plays few if any roles in br east carcinogenesis. LAP2 is expressed in infiltrating ductal car cinoma extracts (Zahnow et al ., 1997), is acquired in primary human breast tumors, and is presen t in cultured breast cancer cell lines (Eaton et al., 2001). It was expressed at high levels of invasive primary breast tumor samples and was the only transactivator isoform expressed in breast cancer cell lines (Eaton et al., 2001). LAP2 was also associated with advanced stages and increased proliferation in huma n breast tumors (MildeLangosch et al., 2003). LAP1 and LAP2 functions differ and the al tering of the ratio between the two isoforms may contribute to the transforma tion of human breast epit helial cells (Bundy and Sealy, 2003). The expression of LIP is tightly regulate d during mouse mammary gland development and breast cancer progression (Raught et al., 199 6; Zahnow et al., 1997). The LIP isoform was detected in 10 different rat tumor lines and its expression was restricted to mammary tumors and not detectable in pre-neoplastic lesions or othe r primary tumors (Raught et al., 1996; Sundfeldt et al., 1999). Generally, LIP is increased in more pr oliferative tumors or developmental time points and is highly expressed in the most aggressive, poorly differentiated human cancers (Raught et al., 1996; Zahnow et al., 1997). Ov erexpression of LIP in mous e mammary epithelial cells increased proliferation, foci formation, and loss of contact inhibition. It ha s been suggested that LIP overexpression stimulates a growth cascade that makes cells susceptible to additional 44

PAGE 45

oncogenic hits, resulting in tumorigenesis (Zahno w et al., 2001). LIP wa s correlated with ERnegative phenotypes and increased proliferation (Milde-Langosch et al., 2003). In fact, one study suggested that LIP expression should be evaluated furthe r as a prognostic marker for human breast cancer (Za hnow et al., 1997). The role of LIP in breast carcinogenesis is controversial. There was no significant level of LIP detected in high grade infiltrating mammary carcinomas (Eaton et al., 2001) and LIP overexpression in the non-tran sformed mouse mammary epithe lial cell line, HC11, did not significantly affect cell prolif eration or cell cycle progressi on (Dearth et al., 2001). The overexpression of LIP in NIH3T3 cells lead to cell death (Eaton et al., 2001) and strongly inhibited growth in MCF10A cells (Bundy et al., 2005). Its role may also be concentration dependent. Moderate LIP expression in mous e mammary epithelial ce lls (SCp2) promoted luminal morphogenesis, while increased LIP expre ssion induced apoptosis (H irai et al., 2001). The fact that LIP may result from cleavage in addition to de novo translation (Baer and Johnson, 2000; Dearth et al., 2001; Welm et al., 1999), also makes it difficult to determine its role in carcinogenesis (Welm et al., 1999). T ogether, these studies indicate that more research is needed to determine the role of the LIP is oform in breast tumorigenesis. 45

PAGE 46

Table 1-1. Carcinogens Present in Cigarette Smoke. A partial list of these carcinogens is below. The IARC group reflects the likelihood of human carcinogenicity: (1) human carcinogen; (2A) probably car cinogenic to humans; (2B) possibly carcinogenic to humans; (3) not classifiable as to their carcinogenicity to humans. Classifications reflect data up to 2004 (Interna tional Agency for Research on Cancer, 2004). Table is adapted with permission from Macmillian Publishers for Hecht, 2003. (*) Adapted with permission from The American Chemi cal Society for Hoffman et al., 2001. (**) Adapted with permission from Springer Scien ce and Business Media for Hecht, 2006. Chemical class Examples* IARC group* Aldehydes Formaldehyde 1 Acetadehyde 2B Aromatic amines 4-Aminobiphenyl 1 2-Naphthylamine 1 Inorganic compounds Arsenic 1 Lead 2B Polycyclic hydrocarbons (PAHs) Benzo( )pyrene (B[ ]P) 1 Dibenzo(a,h)anthracene 2A Phenols Caffeic acid 2B Catechol 2B Nitroamines 4(methylnitrosamine)-1-(3-pyridyl)-1-butanone (NNK) 1 N-nitrosonornicotine (NNN) 1 Volatile hydrocarbons Benzene 1 Styrene 2B 46

PAGE 47

Figure 1-1. Mechanism of cigarette smoke-induced cancer. Nicotine ad dition causes continual cigarette smoking and chronic exposure to cigarette related carcinogens. Most of these carcinogens are either metabolically detoxified and excreted out of the body or activated. The carcinogens that are metaboli cally activated form intermediates that bind to DNA and cause adducts. If the adduc ts are not repaired and persist during DNA replication, miscoding and permanent mutations can occur in the DNA. Damaged cells may be removed by apoptosis. However, if a mutation occurs in an oncogene or tumor suppressor, there could be a loss of normal cell growth control. Inactivation of apoptosis genes or upregul ation of anti-apoptotic genes allows the DNA damage to persist and may result in abnormal gene expression. Loss of cell cycle control, cell transformation, and eventu ally tumorigenesis can result. Asterisks (*) represent the bodys endogenous defense sy stems. Adapted with permission from Oxford University Press for Hecht, 1999. 47

PAGE 48

Figure 1-2. Human bcl-x gene structure and proteins. (A) Bcl-x gene structure is composed of three exons. Exon I is non-coding, while exon II and exon III code for bcl-x mRNAs. The bcl-xl promoter is located 5 of Exon I. (B) Human bcl-x mRNAs. Bcl-x premRNA is alternatively spliced into thr ee different mRNAs, each coding for a single protein. Bcl-xL is anti-apoptotic, while Bc l-xS is pro-apoptotic and lacks the BH domain (BH) due to an alternativ e splicing site in Exon II. Bcl-x results from unspliced mRNA and lacks the transmembrane domain. Its role in apoptosis remains unclear. The isoforms share several domain s. The BH Domain (BH) is the 63 amino acid region containing BH1 and BH2 domains, having the mo st homology to Bcl-2. The transmembrane domain (TM) is res ponsible for mitochondr ial localization. Adapted with permission from the American Society for Biochemistry and Molecular Biology for Pecci et al., 2001. 48

PAGE 49

Figure 1-3. Human C/EBP mRNA structure and prot ein isoforms. (A) C/EBP mRNA contains three translation in itiation sites (AUGs) from whic h isoforms are translated. The 5 end contains a RNA hairpin re gion. Between the LAP1 and LAP2 AUGs, there is an AUG associated with a small open reading frame (sORF), which are important for the translational control of C/EBP isoforms. (B) The mRNA is alternatively translated into three diff erent isoforms by a leaky ribosome scanning mechanism. LAP1 and LAP2 differ by onl y 21 amino acids. LIP is considerably shorter and lacks the transact ivation domain. It retains the dimerization and leucine zipper domains, therefore it acts as a domi nant negative to LAP1 and LAP2 protein function. LIP also results from the proteo lytic cleavage of the other LAP isoforms. Adapted from Zahnow, 2002. 49

PAGE 50

CHAPTER 2 MATERIALS AND METHODS Preparation of CSC CSC was prepared from the University of Kentucky Reference Cigarette IR4F (Davis, 1984; Sullivan, 1984) which contains 9 mg tar and 0.8 mg nicotine per cigarette and approximates the average full flavor, low-tar cigarette available on the American market (Chepiga et al., 2000). Th e CSC was prepared by a procedure previously described (Hsu et al., 1991). In short, the particulat e phase (tar) was collected on a Cambridge filter pad from cigarettes smoked under standard Federal Trade Commission conditions (35 mL puff volume of a 2 sec duration) on a specialized machine (Gri ffith and Hancock, 1985). The particulate matter was dissolved in dimethyl sulfoxide (DMSO) to a stock concentration of 40 mg/mL, aliquoted into vials, and stored at -80C. For treatment, the stock solutions were di luted to the appropriate concentrations in complete medium. Culturing of MCF10A Cells MCF10A cells were maintained in 1X Dulbeccos modification of Eagles medium/Hams F12 (DMEM/F12) 50/50 Mix with L-glutamine and 15 mM Hepes (MediaTech, Inc., Manassas, VA). This medium was s upplemented with 5% horse serum, 100U/mL penicillin/streptomycin, 0.5 g/mL hydrocortiso ne, 100 ng/mL cholera toxin, 10 g/mL insulin, and 10 ng/mL epidermal growth factor. The cells were incubated in a 5% CO2 incubator at 37C. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) RNA was isolated with TRIzol reagent (Invitrogen Corp., Carlsbad, CA) as per manufacturer instructions. Cells were seeded on 60 mm tissue culture pl ates and treated at 5060% confluency. At the appropriate times, the plates were rinsed with cold 1X Dulbeccos 50

PAGE 51

phosphate buffered saline (DPBS) (MediaTech, Inc ., Manassas, VA), three milliliters of TRIzol were added directly into each plate and the plates were rotated for 15-20 min until the cells detached. The TRIzol-cell solution was pipett ed from each plate into a round bottom Falcon tube (BD Biosciences Pharmingen, Mississauga, ON) 700 l of chloroform was added, and the tubes were incubated for 15 min, shaking ever y 2 min. The tubes were centrifuged at 10,000 rpm at 4C for 20 min. The upper aqueous phase was removed into a fresh tube, 1.8 mL isopropanol was added, and the tubes were incu bated at room temperature for 10 min with intermittent mixing. After centr ifugation at 10,000 rpm for 20 min at 4C, the supernatant was carefully removed, leaving the pe llet. The pellet was washed with 700 l of 75% ethanol in diethylpyrocarbonate (DEPC) water; after a fi nal centrifugation, the al cohol was removed, and the pellet was resuspended in 10-20 l DEPC wate r. The samples were incubated at 65C for 10 min, allowed to cool, quantitated, and stored at 80C until use. All procedures were performed with RNAse free tubes and equipment. The isolated RNA (0.5 g) was used to make cDNA with the SuperScript First Strand Synthesis System for RT-PCR (Invitrogen Corp ., Carlsbad, CA) as per manufacturer instructions. Two microliters of cDNA was then used for PCR with primers specific for Bcl-xL (800 bp) or GAPDH (320 bp). The primers used were Bcl-xL sense: 5TTGGACAATGGAC TGGTTGA-3, Bcl-xL antisense: 5-GTAG AGTGGATGGTCAGTG-3 and GAPDH sense: 5GGGAAGCCACTGGCATGGCCTT CC-3, GAPDH antisense: 5CATGTGGGCCATGAG GTCCACCAC-3. The PCR cycles were: 1 cycle of 94C for 2 min; 35 cycles of 94C for 20 sec, 58C for 30 sec, 72C for 1 min; and a 4C hold. 51

PAGE 52

Western Blot Analysis MCF10A cells were plated on 150 mm plates and treated at 50-60% confluency with CSC as described in the figure legends. After treatment the cells were processed into whole cell extract. Cells were scraped into 50 mL conical tubes and pelleted at 1,500 rpm for 5 minutes at 4C. Pellets were rinsed with 1X DPBS (Mediatech, Herndon, VA) and resuspended in 100-500 l lysis buffer (20 mM Tris pH 7.4, 100 mM Na Cl, 1 mM PMSF, 0.5% deosycholate, 1% NP 40, 1% SDS, 1.2 mM EDTA, 1 mM EG TA, 2 mM DTT, 1 mM sodium methavandate, 50 mM NaFl, 1 g each of aproptin, leupeptin, pepstatin). The cells were rotated for 20 min at 4C and then centrifuged at 13,200 for 10 min at 4C. The supernatant was removed into a fresh tube and used for Western analysis. Lysates were prepared for electrophoresis with lysis buffer and 6X Western dye to a final concentra tion of 1X dye, and then boiled for 5 min. After cooling and a brief centrifugation, proteins were separated on a 10% SDS-PAGE gel and electroblotted onto a Hybond-P PVDF membrane (Amersham Biosciences, Piscataway, NJ). The blots were blocked with 5% milk in Tris buffered saline % Tween (TBS-T). The blots were then probed with the appropriate antibodies diluted in 2.5% milk in TBS-T. The bl ots were incubated, rocking, at room temperature for 2 h for primary antibod ies and 1 h for secondary antibodies. The antibodies used were: anti-Bc l-xL (sc-1041), and anti-C/EBP (sc-150), both from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Blots were rinsed between antibodies with three washes of TBS-T, 10 min each. ECL Plus Wester n Blotting Detection System (Ambersham Biosciences, Piscataway, NJ) and autoradiography we re used to detect prot ein levels. Blots were stripped at 65C for 30 min to 1 h, shaking every 10-15 mi n. The stripped blots were rinsed with TBS-T, blocked again, and re-probed with th e anti-Actin (sc-1616) antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for the loading control 52

PAGE 53

Cloning of the Human Bcl-xl Promoter (pBcl-xLP) The human bcl-xl promoter was previously cloned and sequenced in my lab. Using primers modelled from Sevilla et al ., (1999), nucleotides 226-915 fr om the published human bcl-xl promoter (Gene Bank Accession No. D30746) we re cloned into a PGL3 Basic Luciferase Vector (Promega Corp., Madison, WI) at XhoI and HindIII restriction enzyme sites. The promoter cis -elements were determined with the TRANSFEC v4.0 Program (TESS: Transcription Element Search System, Universi ty of Pennsylvania) and two transcription initiation sites were identified. Cloning of pBcl-xLP Deletion Constructs PCR was used to make nine sequential de letion pBcl-xLP constr ucts. The full-length pBcl-xLP (-54,+647) was used as template for PCR with specific primers that amplified the appropriate regions resulting in the deletion constructs. The pr imers were pBcl-xLP (-28,+707) sense: 5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3', pBcl-x LP (-28,+707) anti-sense: 5'-CCCAAGCTTGTCCAAAACACCTGCTCA-3'; pBcl -xLP (-28,+542) sense: 5'-CCGCTCG AGCCACCTCCGGGAGAGTACTC-3', pBcl-xLP (28,+542) anti-sense: 5'-CCCAAGCTTCC AGAACTGGTTTCTTTGTGG-3'; pBcl-xLP (-28,+462): sense 5'-CCGCTCGAGCCACCTCC GGGAGAGTACTC-3', pBcl-xLP (-28,+462) anti-sense: 5'-CCCAAGCTTC CAGTGGACTC TGAATCTCCC-3'; pBcl-xLP (-28,+375) se nse: 5'-CCGCTCGAGCCACCTCCGGGAGAGT ACTC-3', pBcl-xLP (-28,+375) anti-se nse: 5'-CCCAAGCTTCCC CCGCCCCCACTCCCGCT C-3'; pBcl-xLP (-28,+342): sense 5'-CCGCTCGAGCCACCTCCG GGAGAGTACTC-3', pBcl-xLP (-28,+342) anti-sense: 5'-CCCAAGCTTTACATTCAAATCCGCCTTAG3'; pBcl-xLP (-28,+282) sense: 5'-CCGCTCGAGCC ACCTCCGGGAGAGTACTC-3' pBcl-xLP (-28,+282) anti-sense: 5'CCCAAGCTTTCACAGGTCGGAGAGGA GG-3'; pBcl-xLP (-28,+222) sense: 5'-CCGCT CGAGCCACCTCCGGGAGAGTACTC-3 ', pBcl-xLP (-28,+222) 53

PAGE 54

anti-sense: 5'-CCCAAGCTTGCTGGCAAAAAAACCA GCTC-3'; pBcl-xLP (-28,+132) sense: 5'-CCGCTCGAGCCACCTCCGGGAGAGTACTC-3', pB cl-xLP (-28,+132) anti-sense: 5'-CC AAGCTTAACCAGCCCCCTCGTTGCT-3'; pBcl-xLP (-28,+42): sense: 5'-CCGCTCGAGCC ACCTCCGGGAGAGTACTC-3', pBcl-xLP (-28,+42) anti-sense: 5'-CCCAAGCTTCCCCTCT CTTGCACGCCC-3'. The PCR cycles were: 1 cycle of 94C for 3 min; 32 cycles of 94C for 1 min, 55C for 1 min, 72C for 3 min; 1 cycle of 72C for 10 min; and 4C hold. The PCR products were gel extracted with the QIAXEXII Gel Extraction K it (Qiagen, Inc., Valencia, CA) as per manufacturer instructions. Samples a nd empty PGL-3 vector were digested with XhoI and HindIII for 4 h. Digested products were ligated into the digested vector overnight at 16C using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA). The ligation products were transformed into Max Efficiency DH5 Chemically Competent cells (Invitrogen Life Technologies, Carlsbad, CA) according to package instructions and spread on Ampicillin-Luria Broth (LB) plates. Colonies were screened for the correct insert with the QIAprep Spin Miniprep Kit (Qiagen, Inc., Valencia, CA) as pe r manufacturer instructions. The isolated DNA was digested with XhoI and HindIII to confirm the presence of the correct insert. The constructs were sent for sequencing and upon confirmati on, were further amplified with the QIAGEN Plasmid Maxi Kit (Qiagen, Inc., Valencia, CA). The resulting DNA was used in transfection assays. Promoter Activity Assays Approximately 0.5 million cells were seeded on 60 mm tissue culture plates. Bcl-xl promoter constructs (pBcl-xLPs) were transf ected into cells with FuGENE 6 Transfection Reagent (Roche Applied Bioscience Indianapolis, IN) as per manu facturer instructions. Nine microliters of FuGENE 6.0, 2 l of the appropriate promoter construct, 0.5 g pCMV -galactosidase plasmid, and 100 l serum free medium (SFM) were mixed for each plate. The 54

PAGE 55

solution was incubated for 30 min at room temper ature. During this time, the plates to be transfected were rinsed with SFM. After incubation, an additional 1.9 mL SFM was added to the DNA solution for each plate. The DNA-lipid solu tion was mixed well and 2 mL was added to each transfection plate (after SFM rinse was removed). Five hour s later, the DNA-lipid solution was removed from the cells and 4 mL of fresh medium was added. Sixteen hours later, the cells were treated and harvested at the appropriate time points. At the appropriate time points, cells were scraped into 15 mL conical tubes and pelleted at 1,500 rpm for 5 min at 4C. Pellets were ri nsed with 1X DPBS (Mediatech, Herndon, VA) and resuspended in 50-100 l 1X reporter lysis buffer, depending on the size of the pellet. The 1X reporter lysis buffer was dilu ted from 5X Reporter Lysis Buff er (Promega Corp., Madison, WI). The samples were lysed with five freeze-thaw cycles of alternating liquid nitrogen and 37C water bath incubations for 5 min at a time. After each water bath incubation, the samples were vortexed to ensure proper lysing. The sa mples were then centrifuged at 13,200 rpm for 10 min at 4C. The supernatant was removed to a fresh tube and used for promoter activity analysis. The pBcl-xLP promoter activity was measured with luciferase assays. Luciferase assay reagent (20 mM tricine, 1.07 mM magnesium carbonate hydroxide, 2.67 mM magnesium sulfate, 0.1 mM EDTA) was used to prepare luciferase assay buffer (4 mL luciferase assay reagent, 470 M luciferin, 270 M coenzyme A, 530 M ATP, 33.3 mM DTT). All of the reagents for the luciferase assay buffer were purchased from Si gma-Aldrich (St. Louis, MO). The assay was performed with a Monolight 3010 Luminomete r (BD Biosciences Pharmingen, Mississauga, ON). Ten milliliters of lysate were put into a Luminometer cuvette (BD Biosciences 55

PAGE 56

Pharmingen, Mississauga, ON) and it was placed into the luminometer. The machine injected 100 l luciferase assay buffer and recorded the resulting luciferase activity. -galactosidase assays were performed in 96-well flat bottom tissue culture plates. In each well, 10 l of lysate was incubated with 50 l double distilled water (DDW), 15 l 5X Reporter Lysis Buffer (Promega Corp., Madison, WI), and 75 l 2X assay buffer (200 mM sodium phosphate buffer pH 7.2, 2 mM MgCl2, 100 mM mercaptoethanol, 1.33 mg/mL -Nitrophenyl-B-D-galact opyranoside (ONPG)). Wells were mixed and incubated at room temperature for 5 min to 1 h to allow the yellow color to develop. The reactions were stopped with 75 l 1M sodium carbonate and the plat es were read for ab sorbance with 490 nm wavelength on a Vmax Kinetic Mi croplate Reader (Molecular Devi ces, Sunnyvale, CA). These readings were divided into luciferase values to normalize for transfection efficiency. Electrophoretic Mobility Shift Assay (EMSA) Single-stranded oligonucleotides were annealed to produce double-stranded oligonucleotides for EMSA analysis. For annealing, 25 g of each oligonucleotide and its compliment were combined with 10 l 1M KCl to a total of 50 l DDW. The mixture was heated at 90 C for 10 min and then allowed to slowly cool to 25 C. Double-stranded oligonucleotides were diluted to 100 ng/ l. The oligonucleotides used were C/EBP site-I wildtype sense: 5-AAAAACAAAAACC AACTAAA-3, C/EBP site-I wild-type anti-sense: 5TTTAGTTGGTTTTTGTTT TT-3; C/EBP site-I mutant sense: 5-AAAA GGGCCCAA AAC TAAA-3; C/EBP site-I mutant anti-sense 5-TTTTAGTTTGGGCCCTTTTT-3; C/EBP site-II wild-type sense: 5-CCTGAGCTTCGCA ATTCCTG-3, C/EBP site-II wild-type anti-sense: 5CAGGAATTGCGAAGCTCAGG-3; C/EBP site-II mutant sense: 5-CCTAGC CACAGC ATTCCTG-3, C/EBP site-II mutant anti-sense 5-CAGGAATGCTGAGGCTCAGG-3. The 56

PAGE 57

underlined nucleotides are the core of the C/ EBP consensus sequence and the bold nucleotides were mutated. Double-stranded oligonucleotides were end-labelled in reactions of 200 ng of oligonucleotide, 4 l 10X T4 Polynucleotide Buffe r (New England BioLabs, Inc., Ipswich, MA), 1 l T4 Polynucleotide Kinase (New Engla nd BioLabs, Inc., Ipswich, MA), and 5 l 32P -ATP to a final volume of 40 l. The mixture was incubated at 37 C for 30 min and purified through a Sephadex G-50 DNA grade Nick Column (Amers ham Biosciences, Piscataway, NJ). The amount of radioactivity was measured with a LS 6500 Multipurpose Scintillation Counter (Beckman Coulter, Fullerton, CA). EMSA and super-shift analysis was performed with nuclear extracts prepared as described in Shapiro et al. ( 1988). DNA-protein binding reactions were assembled to a final volume of 20 l with 20 mM He pes pH 7.9, 1 mM DTT, 5 mM MgCl2, 80 mM KCl, 10% glycerol, 0.025% NP-40 and 0.5 g poly(dI.dC). After 10 min incubation at room temperature, 2 g of nuclear extract was added. Th ree microliters of the appropriate 32P-labelled doublestranded probe were added and incubated for another 20 min at room temperature. For competition experiments, appropriate amounts of unlabelled probe were added after the addition of poly(dI.dC) and incubated at room temper ature for 10 min before the addition of the 32Plabelled probe. To perform super-shift analys is the master mix consisted of 20 mM Hepes pH 7.9, 1 mM DTT, 5 mM MgCl2, 37.5 M KCl, 7.5% glycerol, a nd 1 g poly(dI.dC). Five micrograms of nuclear extract and 4.5 l of 32P-labelled probe were added. Antibodies specific to C/EBP (sc-9314X), (sc-150X), and (sc-636X) (Santa Cruz Biotechnology, Santa Cruz, CA) proteins and formulated for use in EMSA and ChIP analysis were added to the reaction mixture prior to the addition of 32P-labelled probe and incubated fo r 30 min. The reactions were 57

PAGE 58

loaded on a nondenaturing 4% polyacrylamide gel Tris-borate-EDTA (TBE) which was pre-run at 100 volt for at least 30 min. The samples were loaded (without dye) a nd run at 100 volts for the first 15 min and 150 volts for a total of 1.5 h ours with 0.5X TBE used as running buffer. After the run was completed, the ge l was transferred to filter pape r and dried for 1.5 h at 80C. The DNA-protein complexes were then visualiz ed by autoradiography. Exposure times varied from 2 h to 24 h. Chromatin Immunoprecipitation (ChIP) Assay ChIP analysis was carried out with the ChIP Assay Kit (Upstate Biotechnology, Lake Placid, NY) as per manufacturer in structions. One million cells were seeded onto 100 mm tissue culture plates and treated at a ppropriate times. The cells we re fixed by adding 270 l of 37% formaldehyde per 10 mL of cell media, and incu bating for 10 min at 37C. The medium was removed, the plates were rinsed with ice-co ld 1X DPBS (Mediatech, Herndon, VA) containing protease inhibitors, scraped into fresh tubes, and lysed with SDS lysis buffer containing protease inhibitors. The lysate was s onicated on ice for 4 cycles of 30 sec with 20 intervals using a Branson Sonicator 450 (Branson Power Compa ny, Danbury, CT) at a 5% duty cycle, 20% constant maximal power, and with a control outpu t of 5. The lysate was clarified, diluted, precleared, and immunoprecipitated with 2 g antibody overnight at 4C. The antibody used was anti-C/EBP (sc-150X) (Santa Cruz Biotechnology, Sant a Cruz, CA). The resulting complexes were then rinsed, eluted, and heated to reverse the crosslinkages. DNA was isolated by phenol/chloroform extraction and ethanol precipitation. The isolated DNA was used in PCR reactions using primers specific to C/EBP site-II on the pBcl-xLP. The primers were C/EBP s ite-II sense: 5-CGGGTGGCAGGAGGCCGCGGC-3 and C/EBP site-II anti-sense: 5-AACTCAGCCGGCCTCGCGGTG3, resulting in a 190 bp product. 58

PAGE 59

59 Site-directed Mutagenesis The QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to mutate two C/EBP sites on the pBcl-xLP constr uct, via manufacturer instructions. Primers specific for the cis -element mutations were used to perform PCR. The primers were C/EBP siteI sense: 5-TGGTGCTTAAATAGAAAAAA GGGCCCAAAACTAAATCCATACCAGCCAC C T-3, C/EBP site-I anti-sense: 5 -GGTGGCTGGTATGGATTTA GTTTTGGGCCCTTTTTCT TTTTTCTATCTATTTAAGCACCA; C/EBP site-II sense: 5-AGCAAGCGAGGGGGCTGGT TCCTGAGCCACAGCATTCCTGTGTCGCCTTCT -3, C/EBP site-II anti-sense: 5-AGAAG GCGACACAGGAATGCTGTGGCTCAGGAACCAGCCCCCTCGCTTGCT-3. The PCR products were digested with Dpn I to degrade template DNA. Digested products were transformed into XL-1 Blue Supercompetent Cell s (Strategene, La Jolla, CA) and spread onto Ampicillin-LB agarose plates. The presence of the correct mutation was confirmed and construct amplification was carried out as described earlier in this section. Overexpression of C/EBP MCF10A cells were plated at the density of 0.6 million cells per 60 mm plate and allowed to attach over night. The next day, 2 g empty pCDNA3.1 vector, or either C/EBP overexpression construct was transfected into th e cells with FuGENE 6.0 Transfection Reagent (Roche Applied Bioscience, Indian apolis, IN) as previ ously described in this section. At the scheduled times, plates were harvested for lucife rase assays or whole ce ll extract as described above. Statistical Analysis Experiments were averaged and appropriate statistics were performed. Significance was calculated with T-tests and p-valu es below 0.05 were considered si gnificant. St atistics were performed with SigmaPlot 10.0 Soft ware (SPSS Inc, Chicago, IL).

PAGE 60

CHAPTER 3 CSC TREATMENT RESULTS IN THE TRANSCRIPTIONAL UPREGULATION OF BCL-XL IN MCF10A CELLS Introduction CSC is capable of transforming the spontaneous ly immortalized breast epithelial cell line, MCF10A in culture (Narayan et al., 2004). A sing le dose of CSC resulted in characteristics such as anchorage-independent growth, colony form ation, and increased e xpression of NRP-1, a marker of neoplastic progression (Stephenson et al., 2002). Additionally, these characteristics remained stable in cell lines established from th e treated cells, with no further CSC treatment. These transformed cells were found to have elevat ed mRNA and protein levels of Bcl-xL versus the control cells. Even though, mo st treated cells die, the tran sformed cells escaped cell cycle arrest and survived due to the overexp ression of anti-apoptotic genes such as bcl-xl (Narayan et al., 2004). The anti-apoptotic role of Bcl-xL and its implication in cancer, lead to the investigation of how the gene was regulated in response to CS C treatment in MCF10A cells. The hypothesis of this study is that the CSC-i nduced upregulation of Bcl-xL occurs by a transcriptional mechanism. After CSC treat ment, a transcription factor(s) binds the bcl-xl promoter, induces its transcriptional activity, and results in the increase of Bcl-xL protein levels. Results CSC Treatment Induces Bcl-xl mRNA and Protein Levels in MCF10A Cells The previous study suggested that CSC-induced Bcl-xL expression in MCF10A cells was mediated by an increase in bcl-xl mRNA (Narayan et al., 2004). To confirm this finding, MCF10A cells were trea ted with increasing amounts of CSC for 24 h and bcl-xl mRNA levels were analyzed with RT-PCR (Figure 3-1A). It is interesting to note the initial decrease in bcl-xl mRNA levels at 2.5 g/mL of CSC treatment; then the levels continued to increase in a concentration-dependent manner. At 50 g/mL of CSC treatment, the bcl-xl mRNA level was 60

PAGE 61

higher than the level in the control cells. To co nfirm the subsequent indu ction of Bcl-xL protein levels, cells were treated with 25 g/mL of CSC for a time course and with increasing concentrations of CSC for 24 h for a concentra tion curve. Western analysis was used to determine the protein levels in these cells. Th e time course and concen tration curve confirmed the upregulation of Bcl-xL protein levels in a time and concentration-dependent manner (Figure 1-3B). These results confirmed that CSC induced bcl-xl mRNA and protein levels in treated MCF10A cells and that the mechanism of Bcl-xL upregulation in these ce lls was on the level of transcription. CSC Induces pBcl-xLP Promoter Activity in MCF10A cells One of the most important mechanisms of ge ne regulation is tran scriptional (Weis and Reinberg, 1992). To determine the how bcl-xl was induced by CSC, the human bcl-xl gene promoter (Grillot et al., 1997; Sevilla et al., 1999) was cloned into a pGL-3 Basic Luciferase vector as described in Material s and Methods and was named pBcl-x LP. In the first step, it was determined which transcription factor(s) were responsible for the upregulation of bcl-xl in CSCtreated MCF10A cells. Transcription initiation s ites were identified at +1 and +78 and putative cis -regulatory elements on the pBcl-xLP were identified (Figure 3-2). The pBcl-xLP promoter had consensus sites for several tran scription factors that were repor ted in earlier studies, such as NFB, Oct1, Sp proteins, GATA, STAT, and others (Grillot et al., 1997; Sevilla et al., 1999). The first promoter cloned was pBcl-xLP (-54,+647) according to its length, but further studies indicated that cis -elements were located upstream of this firs t construct. At this point, the second promoter construct, pBcl -xLP (-145,+707), was made. To determine whether bcl-xl promoter activity was induced by CSC treatment in MCF10A cells, the two promoter c onstructs were separately tran sfected into MCF10A cells and treated with CSC for time cour se and concentration curve experiments. The pBcl-xLP 61

PAGE 62

(-145,+707) had no significant promoter activity (data not show n). Alternatively, pBcl-xLP (-54,+647) showed a time dependent and concentrat ion dependent increase in activity after CSC treatment (Figure 3-3). Therefore pBcl-xLP (-54,+647) construct was identified as the basal promoter sequence and became our full-length promoter It will be referred to as pBcl-xLP from this point forward. This experiment indicat ed the optimum treatment conditions for the induction of pBcl-xLP in these cells. During the concentration curve the promoter activity peaked at 24 h of treatment (Figure 3-3A). The highest level of promoter activity induced in the concentration curve after treatment with 50 g/mL of CSC (Figure 3-3B). However, at such a high concentration most of the cells have died. A concentration of 25 g/mL of CSC was used for the rest of the experiments because it repr esented a more common treatment concentration and resulted in less cell toxicity and death. Other studies found si milar results (Nagaraj et al., 2006). These studies confirmed that pBcl-xLP pr omoter activity was induced in MCF10A cells by CSC treatment in a time and concentration-dependent manner. C/EBP-binding Sites on the pBcl-xLP are CSC-responsive Elements Next, the cis -elements on the pBcl-xLP responsible for this upregulation were identified. Eukaryotic gene expression is regulated in part by transc riptional mechanisms including transcriptional initi ation, which involves site specific pr otein to DNA and protein to protein interactions at the ini tiation site (Van Dyke et al., 1988). Tr anscription factors are essential for the recruitment of RNA polymer ase II (RNAP II) and other me mbers of the pre-initiation complex (PIC) to the transcription initiation site. Transcription initiation is the rate-limiting step in the gene transcription and the role of general transc ription factors is ther efore critical to the transcription of genes. Putative cis -elements on the bcl-xl promoter represent po ssible binding sites for transcription factors that can act ivate or repress the transcripti on of the gene. To determine 62

PAGE 63

which transcription factor was in creasing pBcl-xLP expression in treated cells, PCR was used to clone nine promoter deletion constructs from th e pBcl-xLP promoter. These constructs were designed to sequentially delete potential regulatory elements on the pBcl-xLP (Figure 3-4A). The pBcl-xLP and deletion constructs were indi vidually transfected into MCF10A cells, treated with CSC, and promoter activity was measured (Figure 3-4B). As expected, the pBcl-xLP (-145, +707) showed no significant promoter act ivity or induction. Conversely, pBcl-xLP (54,+647) activity was significantly induced by CS C as shown in Figure 3-3. Basal promoter activity was reduced with pBcl-xLP (-28,+707), which reflected the loss of the C/EBP-I site, but the CSC response was maintained, suggesting that C/EBP-I was important for the basal bcl-xl promoter activity and that it may or may not ha ve been responsive to CSC treatment. The bcl-xl promoter activity continued to decrease as ot her elements were deleted. However, the CSC response was maintained up to pBcl-xLP (-28,+2 22). The promoter activity decreased at the next construct, pBcl-xLP (-28,+132), which represented the loss of the site C/EBP-II. Loss of this site resulted in an unrecoverable decrease in promoter activity. These results suggested that the C/EBP-II on the pBcl-xLP may have been th e primary CSC-responsive site on the pBcl-xLP promoter. Site-directed mutagenesis was used to examine whether C/EBP sites were necessary for CSC-induced promoter activity. Site-directed mutagenesis was performed separately on the C/EBP site-I and site-II of the pB cl-xLP promoter (Figure 3-5). Th e mutant constructs were then transfected into MCF10A cells that were subseq uently treated with CSC. While the wild-type promoter showed a significant induc tion of activity in response to CSC treatment, neither mutant promoter construct showed a sign ificant induction in response to treatment (Figure 3-6). These 63

PAGE 64

results indicate that C/EBP site-I and site-II el ements on the pBcl-xLP respond to CSC treatment in MCF10A cells. 64

PAGE 65

Figure 3-1. Bcl-xl mRNA and protein levels are induced in MCF10A cells treated with CSC. (A) RNA was isolated from cells treated w ith increasing concentrations of CSC for 24 h. RT-PCR was performed with primers specific to the bcl-xl cDNA sequence. GAPDH primers were used on the same sample s as a loading control. (B) Treated cells were processed for whole cell extract. For the time course, cells were treated with 25 g/mL of CSC for various time point s. For the concentration curve, cells were treated with increasing amounts of CSC for 24 hours. Blots were stripped and probed for -Actin as a loading control. Data is representative of three separate experiments. 65

PAGE 66

Figure 3-2. Sequence of the cloned human bcl-xl promoter, pBcl-xLP. Nucleotides 226 to 915 from the human bcl-xl promoter were cloned into a pGL-3 Basic Luciferase Vector and was named pBcl-xLP. The pBcl-xLP contains binding sites for several common transcription factors and the tr anscription initiation sites are located at +1 and +78. 66

PAGE 67

Figure 3-3. CSC treatment induces pBcl-xLP promot er activity in vitro. The pBcl-xLP construct was transfected into MCF10A cells, which were subsequently treated with CSC. Cells were harvested for the (A) time course and (B) concentration curve and promoter activity was measured with luciferase assays normalized with -galactosidase activity. Data is the av erage of three replicates + SE and representative of three inde pendent experiments. Asteri sks (*) indicate a significant difference compared to the promoter activ ity of the untreated cells. 67

PAGE 68

Figure 3-4. The pBcl-xLP prom oter contains CSC-responsive cis -elements. (A) The basal promoter construct was identified as pBcl-xLP (-54,+647). Nine pBcl-xLP deletion constructs (labelled according to their leng ths) were designed to sequentially delete putative cis -elements. Arrows indicate the transc ription initiation sites. (B) For the determination of the CSC-responsive cis -elements on the pBcl-xLP, luciferase assays normalized with -galactosidase activity were used to measure pBcl-xLP promoter activity in MCF10A cells separately transfected with each construct and then treated with CSC. Data is the average of three replicates + SE and representative of three independent experiments. 68

PAGE 69

Figure 3-5. C/EBP mutations introduced on the pB cl-xLP. Site-directed mutagenesis was used to introduce two separate mutations in th e pBcl-xLP construct. The resulting constructs were named C/EBP site-I mutant and C/EBP site-II mutant, respectively. The mutations (in red) mirror the mutations us ed for subsequent EMSA experiments. 69

PAGE 70

Figure 3-6. Site-directed mutage nesis of C/EBP sites on the pB cl-xLP attenuates CSC-induced promoter activity. Wild-type pBcl-xLP, C/EB P site-I mutant, or C/EBP site-II mutant were separately transfected into MCF10A cells. The transfected cells were then treated with CSC and promoter activity was analyzed with luciferase assays normalized with -galactosidase activity. Data is the average of three replicates + SE and representative of three independent experiments. Asterisks (*) indicate a significant difference compared to the promoter activity of the untreated cells. 70

PAGE 71

CHAPTER 4 C/EBP REGULATES BCL-XL IN CSCTREATED MCF10A CELLS Introduction The loss of C/EBP site-I and -II reduced CSCinduced pBcl-xLP activity (Figure 3-6). C/EBP is one of the six C/EBP proteins and evidence suggests its role in human breast carcinogenesis, however, this ro le is not completely understo od (Milde-Langosch et al., 2003; Zahnow, 2002). Its putative role in hu man breast carcinogenesis made C/EBP an appropriate C/EBP target protein responsib le for the upregulation in bcl-xl in CSC-treated MCF10A cells. Results C/EBP is Induced by CSC Treatment in MCF10A Cells Western analysis was used to confirm that C/EBP was induced by CSC treatment. The antibody used in this Western analysis was ra ised against the carboxy-terminal of C/EBP and therefore had the ability to detect all three isofor ms. Two C/EBP isoforms LAP1 (45 kDa) and LAP2 (42 kDa) were detected in whole cell extracts from CSCtreated MCF10A cells; however, LIP was not detected in these ce lls (Figure 1-4). Only LAP2 le vels were significantly increased in a time and concentration-dependent manner. These experiments confirmed that C/EBP protein levels are induced by CSC treatment. C/EBP Site-II of the pBcl-xLP is Specific for the CSC Respon se in MCF10A Cells In previous experiments, two putative C/EB P sites on the pBcl-xLP were identified as being inducible by CSC. EMSA was used to ch aracterize these C/EBP s ites as CSC-responsive sites on the pBcl-xLP. To do this, 32P-labelled double-stranded probes, identical to C/EBP site-I and site-II sequences were incubated with MCF10A nuclear extract. Two DNA-protein complexes (shifted bands I and II) were visual ized with autoradiogra phy (Figure 4-2). These bands represent nuclear proteins bindi ng to C/EBP regulatory elements on the bcl-xl promoter. 71

PAGE 72

For competition experiments, the appropriate unlabelled wild-type or mutant oligos were added at increasing fold excess (Figure 4-2A). For C/EBP site-I and C/EBP site-II, the unlabelled wild-type probe competed out the 32P-labelled probe, in a concentration dependent manner, as expected. However, the unlabelled C/EBP s ite-I mutant oligo also competed out the 32P-labelled probe at that site. This indicat ed one of the two scenarios: 1) the mutant is not sufficient enough to decrease binding, or 2) the bindi ng at this site is non-specif ic. Specificity was tested by adding increasing concentrations of a non-specif ic, unlabelled GAGA probe to the reactions as indicated. The unlabelled probe also competed with the 32P-labelled wild-type probe for C/EBP site-I, confirming the second possibility that the binding at C/EBP site-I was non-specific. Conversely, the reactions with C/EBP site-II were not competed out by either the unlabelled mutant or the unlabelled non-sp ecific GAGA probe, suggesting that MCF10A nuclear extract contained a protein th at specially bound to C/EBP site-II. The protein binding to the pB cl-xLP C/EBP site-II was identified with super-shift analysis. The three C/EBP proteins (C/EBP and ) are expressed in mammary tissue (Gigliotti and DeWille, 1998; Sabatakos et al., 1 998). To determine whether the binding was specific to either protein, antibodies specific to each were added to the reaction mixtures as indicated. No shifted bands are observed in reactions with the 32P-C/EBP site-I. 32P-C/EBP siteII reactions showed a shifted band on ly with the addition of anti-C/EBP antibody (Figure 4-2B). It was also determined whether CSC induced C/EBP protein to show increased binding to the pBcl-xLP promoter in the gel-shift and super-shift assays. 32P-labelled C/EBP site-II probe was incubated with nuclear extracts isol ated from untreated and CSC-treated MCF10A cells. Results showed a drastic increase in th e shifted band II with extract from CSC-treated cells as compared to untreated cells (Figure 4-2C). In the reactions with untreated nuclear 72

PAGE 73

extract, the addition of anti-C/EBP antibody resulted in a super-shift as seen in Figure 4-2B. In the reaction with CSC-treat ed nuclear extract, there was a shif t of band I and increased binding at band II. The addition of anti-C/EBP antibody resulted in an additi onal shift of shifted band in lane 3 (without antibody) and increased binding at band II. These results indicated that CSC treatment increased the binding of C/EBP proteins to the pBcl-xLP in vitro. C/EBP Binds the Endogenous Bcl-xl Promoter in Response to CSC Treatment To confirm that C/EBP binds the bcl-xl promoter in vivo ChIP analysis was performed. MCF10A cells were treated with increasing concentrations of CSC for 24h. The ChIP analysis was performed as described in Materials and Methods. PCR of the resulting DNA was performed with primers specific to the pBcl-xLP C/ EBP site-II. In the untreated cells there was an initial binding of C/EBP to the bcl-xl promoter. This binding slightly decreased at 10 g/mL of CSC treatment, increased to a level higher than that in the untreated cells at 25 g/mL, and was sustained at 50 g/mL of CSC treatment (F igure 4-3). This experiment mirrored the bcl-xl mRNA expression in Figure 3-1A. The results fro m the EMSA and ChIP analysis suggested that C/EBP binds and regulates bcl-xl gene expression in MC10A cells in response to CSC treatment. Overexpression of C/EBP Protein LAP2 Increases pBcl-xLP Promoter and Protein Levels in MCF10A Cells To demonstrate that CSC treatment increased C/EBP levels which bound to the bcl-xl promoter and regulated it expression, this condition was recapitula ted by overexpression of C/EBP protein in MCF10A cells. To do this, each C/EBP isoform: hLAP1, hLAP2, and hLIP were transfected into MCF10A cells and the eff ect on pBcl-xLP promoter activity was measured with luciferase activity. Each C/EBP construct induced promoter activity. However, only hLAP2 had a significant induction when compar ed to the empty pCDNA3.1 vector (Figure 473

PAGE 74

4A). To determine the effect of these constr ucts on Bcl-xL protein levels, each construct was separately transfected into MC 10A cells and after 48 h, the cells were harvested and processed for whole cell extract. The protein wa s used for Western analysis of C/EBP and Bcl-xL protein levels. C/EBP protein levels confirmed that the appr opriate isoforms were overexpressed. Bcl-xL protein levels were similar in contro l cells and cells transfected with the empty pCDNA3.1 vector (Figure 4-4B). The overexpression of hLAP1 slightly increased Bcl-xL protein levels, while LAP2 showed the most significant increase of Bcl-xL. Conversely, hLIP expression caused a decrease in Bcl-xL pr otein. These results suggest that C/EBP specifically LAP2, has a role in the regulat ion of pBcl-xLP promoter activ ity and protein levels in the absence of CSC treatment. Co-transfection of C/EBP overexpression constructs with pBcl-xLP mutant constructs indicated that the loss of C/EBP sites on the prom oter disrupted the promoter activity compared to the results from Figure 4-4 with the wild-typ e promoter (Figure 4-5). The presence of C/EBP site-II was required for the CSC-induced and C/EBP -induced upregulation of bcl-xl promoter activity in MCF10A cells and together these data indicated that C/EBP was necessary for the upregulation of bcl-xl in CSC-treated MCF10A cells. 74

PAGE 75

Figure 4-1. C/EBP protein levels are induced in MCF10A cells treated with CSC. MCF10A cells were treated with 25 g/mL of CSC for various time points. For the concentration curve, cells were treated w ith increasing amounts of CSC for 24 hours. The protein was used for West ern blot analysis of C/EBP protein. Blots were stripped and probed for -Actin as a loading control. Da ta is representative of three independent experiments. 75

PAGE 76

Figure 4-2. C/EBP binds the bcl-xl promoter in vitro. 32P-labelled C/EBP site-I or 32P-labelled C/EBP site-II oligonucleotides were incubated with MCF10A nuclear extract. (A) For competition experiments, 2.5, 5, and 10 fo ld excess of the appropriate unlabelled wild-type or mutant C/EBP s ite were added to the indi cated lanes. Unlabelled GATA oligonucleotides were added to the lanes indicated to de termine binding specificity. (B) Super-shift analysis of C/EBP site -II was carried out by adding antibodies specific to C/EBP or to the reaction mixtures as the lanes indicate. (C) The effects of CSC treatment on super-shift an alysis were analyzed by adding antiC/EBP antibody to reaction mixtures using MC F10A nuclear extract from untreated or CSC-treated cells. Data is representa tive of three independent experiments. 76

PAGE 77

Figure 4-3. C/EBP is present on the bcl-xl promoter of MCF10A cells in vivo ChIP was performed on MCF10A cells treated with increasing conc entrations of CSC for 24h. An anti-C/EBP antibody was used to imm unoprecipitate the DNA-protein complexes. PCR was performed on the isolated DNA with primers specific for C/EBP site-II on the pBcl-xLP promoter. Data is representative of three independent experiments. 77

PAGE 78

Figure 4-4. Overe xpression of C/EBP induces pBcl-xLP promoter activity and Bcl-xL protein levels in MCF10A cells. Human C/EBP overexpression constructs, LAP1, LAP2, and LIP were co-transfected with the pBcl -xLP promoter into MCF10A cells. (A) Promoter activity was analyzed with lu ciferase assays and normalized with galactosidase activity. Data is the average of three replicates + SE and representative of three independent experiments. Asterisk s (*) indicate a significant difference from the promoter activity of the empty pCDN A3.1 vector. (B) Western analysis of C/EBP was used to confirm the overexpression of the appropriate construct and changes in Bcl-xL expression were assessed. The same whole cell extract was used to detect protein (C/EBP or Bcl-xL) on two blots. Th e blots were stripped and probed for -Actin as a loading contro l. Data is representati ve of three independent experiments. 78

PAGE 79

Figure 4-5. Site-directed muta genesis of C/EBP sites on the pBcl-xLP attenuates the C/EBP induced activation of the pBcl-xLP promoter. C/EBP overexpression constructs were co-transfected with each C/EBP muta nt construct. Promoter activity was analyzed with luciferase assays and normali zed with B-galactosidase activity. Data is the average of three replicates + SE and representative of three independent experiments. Asterisks (*) indicate a signi ficant difference from the promoter activity of the empty pCDNA3.1 vector. 79

PAGE 80

CHAPTER 5 SUMMARY AND DISCUSSION Breast cancer is the most common cancer women. In light of this and other studies, cigarette smoking may play a ro le in breast cancer development. Approximately 45 million Americans currently smoke. Even though the numb ers of women smokers have decreased in the past, prevalence declined little from 1992-1998. Smoking prevalence con tinues to increase in women with less education and/or those below the poverty level (Centers for Disease Control and Prevention, 2007; National Center for Health Statistics, 2006). These growing groups of women are of particular interest because wh en they develop cancer, their accessibility to healthcare is limited. Breast cancer can aris e 30-40 years from the onset of smoking and smoking for a long duration may be associated with increased breast cancer risk (Terry and Rohan, 2002). Additionally, females beginning to sm oke at younger ages, increase their risk of smoking-related diseases including cancers (U.S. Department of Health and Human Services, 1994). This trend may be linked to the growing number of breast cancer cases diagnosed in the United States. Prevention of breast cancer has been obstruc ted by the lack of knowledge about the etiology of the disease (Li et al., 1996a). There are two categories of breast cancer risk factors: biological risk factors an d life-style risks. The primary bi ological risk fact or is gender and increasing age. Other biological factors include, but arent limited to genetic mutations in certain genes (BRCA1, BRCA2) and family, or personal hi story of breast cancer. Reproductive risk factors include menstrual periods that start earl y or end late in life, not having children, and childbirth after the age of 30. Behavioral f actors include postmenopausal hormone replacement therapy (slight increased risk), alcohol use, obesity/high-fat diet s, and lack of physical activity (American Cancer Society, 2008). Known risk factors (family hist ory and reproductive factors) 80

PAGE 81

only account for 30% of breast can cer cases (John and Kelsey, 1993) Understanding other risk factors, such as the role of smoking, is essential to developing prev ention strategies and therapeutic interventions to breast carcinogenesis. In this study, the MCF10A cell line was u tilized to determine the mechanism by which cigarette smoking might be linked to breast carcinogenesis. The MCF10 series of cell lines are human breast epithelial cells that have been extensively characte rized (Soule et al., 1990; Tait et al., 1990). The founding cells, MCF10M, were derived from a 36-y ear old parous premenopausal woman with extensive fibrocystic dis ease, but no family hist ory or histological evidence of breast malignancy. Thes e mortal diploid cells had finite growth in culture and were described as estrogen receptor negative (ER-). MCF10A (attached) ce lls are a spontaneously immortalized derivative that resulted from the culturing of MCF10M cells in medium containing low calcium. Although this cell line is immortal ized, MCF10A cells have characteristics of normal cells including: the lack of tumorigen ecity in nude mice (Miller et al., 1993), growth factor-dependency, and anchorage-dependent growth (Soule et al., 1990; Tait et al., 1990). MCF10A cells are considered a model for norma l epithelial cells and therefore provide the opportunity to study the earliest st ages of transformation and tumorigenesis (Soule et al., 1990; Tait et al., 1990). However, MCF10A cells have characteristics of luminal and basal myoepithelial cells and may represent multipotent progenitor cells (Gordon et al., 2003; Neve et al., 2006). Inner luminal (secretor y) and outer basal myoepithelia l cells, are the two cell types that compose the acinus (Ronnov-Jessen et al., 1996; Taylor-Papadimitriou et al., 1989) the smallest functional unit of the ma mmary duct (Bissell et al., 2003; Smith et al., 1984). These cell types can be distinguished by gene expression pr ofiling and with immunohistochemistry; luminal cells express keratins 8/18 and E-cadherin, while myoepithe lial cells express keratins 5/6, 81

PAGE 82

integrin4, and laminin (Perou et al., 2000; Ronnov-Je ssen et al., 1996; Sorl ie et al., 2001; Sorlie et al., 2003). Recently, st udies have reported that MCF1 0A cells have basal-like cell characteristics (Charafe-Jauffret et al., 2006; Neve et al., 2006). Cells with basal phenotypes are more likely to undergo EMT and express more aggressive, metastatic phenotypes in vivo (Sarrio et al., 2008). In fact, MCF10A transiently expr ess characteristics of EMT when cultured in low densities (Sarrio et al., 2008). Despite these ch aracteristics, MCF10A ce lls cluster with other cells derived from normal mammary tissue (Lom baerts et al., 2006), display normal morphology when grown on basement membrane, and do not display a fully mesenchymal phenotype (Zajchowski et al., 2001). Using primary mammary cells as an experimental model is difficult and usually does not allow for long-term observations. The in vitro and in vivo characteristics of the MCF10A cell line indicate that these cells, as originally hypot hesized (Soule et al., 1990; Tait et al., 1990), serve as the most appropriate model for normal ep ithelial cells in experimental studies. MCF10A cells also provide a model to study estrogen receptor negative (ER-) cells. Approximately one-third of breast cancer patient s respond to endocrine therapy, most of these have ER+ tumors (Jordan, 1993). Many breast can cers are ER-, making them refractory to antihormone therapy and aromatase inhibitors. These tumors are more aggressive (increased invasion and distant metastasis) than ER+ tumors (Gago et al., 1998). A significant portion of patients with ER+ cancers are initially not res ponsive to treatments with selective estrogen receptor modulators (SERMs) such as tamoxifen (Kumar et al., 1996). Additionally, initially responsive patients can develop resistance to anti-hormone therapy. Understanding the mechanisms by which ERcells are transformed can also give insights to treating the patients not eligible for traditional hormone therapy. 82

PAGE 83

In a previous study, CSC-mediated transfor mation of MCF10A cells has been described (Narayan et al., 2004). CSC has also been found to transform endocervical cells (Yang et al., 1998; Yang et al., 1997). In both cases, the expression of anti-apoptotic proteins was increased in the transformed cells (Narayan et al., 2004; Yang et al., 1998). In order to understand the mechanisms of cigarette-induced breast carcinog enesis, this study determined the transcription factor that upregulated bcl-xl expression in MCF10A cells after CSC treatment. Determining the role of transcription factors in CSC-mediated regulation of bcl-xl gene expression may give insight to this and other ri sk factors involved in breas t carcinogenesis. C/EBP -induced Upregulation of Bcl-xL in CSC-treated MCF10A Cells The treatment of MCF10A cells with CSC caused the upregulation of bcl-xl mRNA and protein levels and the induction of Bcl-xL protein occurred at the level of transcri ption (Narayan et al., 2004; Figure 3-1). This observation is supported by other studies that found the induction of bcl-xl generally resulted from an increase in bcl-x promoter activity and de novo protein synthesis is required for the activation of bcl-xl transcription (Sevilla et al., 1999). This is mainly because the bcl-xl transcript has a short half life of about four hour s (Bachelor and Bowden, 2004; Pardo et al., 2002; Sevilla et al., 1999). The increase in bcl-xl mRNA levels occurs through a biphasic mechanis m. The base-line levels of bcl-xl in untreated cells ensure the survival of the cells in culture. CSC causes DNA damage in MCF10A ce lls (Kundu et al., 2007). After treatment with CSC, the amount of DNA damage causes the cells to respond by triggering DNA repair pathways. This is evident in th e increased levels of PCNA and GADD45 protein levels previously reported. Incr eases in these proteins indicated active DNA repair and synthesis presumably resulting from the CSC-induced DNA damage (Narayan et al., 2004). If the DNA damage overloads the repair mechanisms, the cel ls undergo apoptosis, resulting in the decrease in bcl-xl mRNA levels after the first treatment. This decrease in bcl-xl levels indicated that most 83

PAGE 84

treated cells die, as observed by Narayan et al. (2004). The few surviving cells were responsible for the remaining low levels of bcl-xl expression after the initial treatment. Cells expressing higher levels of bcl-xl were not removed by apoptosis. S ubsequent treatments produced more DNA damage and eventually persistent mutations, possibly in tumor suppressors or oncogenes in the remaining cells. As the result of these mu tations, important cell regulatory mechanisms may not have been working and bcl-xl expression continued to increas e in these cells. Additionally, each treatment also selected for the survival of cells expressing higher levels of bcl-xl. As the surviving cells divided, their progeny shared the increased expression of bcl-xl resulting in the time and concentration-dependent increase of bcl-xl mRNA levels. The survival of a few cells is all that was needed to sustain increased BclxL expression because such genetic defects are clonal in nature (Tomlinson, 2001). While the time course Western blot had a biphasic response to CSC treatment, the concentration curve blot did not show this pattern. One possible explanation is that RT-PCR is more sensitive assay that can detect smaller differences in expression levels. It is al so possible that there was differential regulation of bcl-xl mRNA and protein levels. The cloned human bcl-xl promoter (pBcl-xLP) was res ponsive to CSC treatment when transfected into MCF10A cells (F igure 3-3). Two pBcl-xLP promoter constructs were cloned. The lack of promoter activity when the longest construct, pBcl-xLP (-1 45,+707), was transfected into MCF10A cells indicated th at uncharacterized repressive cis -elements might have been present which were absent on the pBcl-xLP (-54, +647) construct (Figure 3-4B). Reductions in promoter activity also resulted from the removal of uncharacterized repressive cis -elements on pBcl-xLP (-28,+282). Promoter deleti on studies suggested that two C/EBP cis -elements were responsible for the CSC-induced increase in bcl-xl promoter activity (Figure 3-4). C/EBP was 84

PAGE 85

investigated as the target C/EBP protein family member. C/EBP is critical for mammary gland development (Robinson et al., 1998; Seagroves et al., 1998) a nd is increased in rodent and human breast cancer (Dearth et al., 2001; Eat on et al., 2001; Milde-Langosch et al., 2003; Zahnow et al., 1997). Studies indicate that C/EBP can induce a survival phenotype in intravascular cells, possibly by its anti-apoptotic activity (Shimizu et al., 2007). In subsequent experiments, protein levels of C/EBP were also induced by CSC treatment (Figure 4-1). Site-directed mutagenesis confirmed that CS C-induced pBcl-xLP activity was attenuated in the absence of either C/EBP site (Figure 3-6). However, EMSA confirmed that C/EBP bound only to the bcl-xl promoter at C/EBP site-II in vitro. The presence of protein binding at C/EBP site-I suggested th at a protein bound to the bcl-xl promoter at that site, but this binding was not specific to a C/EBP protein (Figure 4-2A, B). This is not surprising because C/EBP siteI is not a true C/EBP consensus site on the pB cl-xLP promoter and C/EBP site-II is 100% identical to the core C/EBP consensus sequence. The use of MCF10A nuclear extract in this assay meant that many proteins we re available to bind the C/EBP s ite-I. The data suggested that an unidentified transcription factor bound to the pBcl-xLP at C/EBP site -I in response to CSC treatment. In parallel, C/EBP bound the bcl-xl promoter at C/EBP site-II in vivo as shown by ChIP assay (Figure 4-3). This bi nding had a biphasic pattern sim ilar to that seen in the mRNA analysis (Figure 3-1A ), indicating that bcl-xl mRNA levels correspond with C/EBP -binding to and regulating the bcl-xl promoter. Overexpression st udies confirmed that C/EBP -induced pBcl-xLP promoter and Bcl-xL protein levels (F igure 4-4) and site-directed mutagenesis showed that C/EBP-binding sites on the pBcl-xLP were necessary for C/EBP to properly regulate pBclxLP activity (Figure 4-5). 85

PAGE 86

Only C/EBP -LAP2 protein levels were induced in time and concentration-dependent manner following CSC treatment (Figure 4-1). Additionally, only LAP2 significantly induced pBcl-xLP activity and Bcl-xL protein levels (Fig ure 4-4). Site-directed mutagenesis of C/EBP site-II on the pBcl-xLP results in the lowest pr omoter activity when LAP2 was co-transfected with the mutant construct (Figure 4-5B), s upporting the hypothesis that C/EBPB-LAP2 binds to the pBcl-xLP at C/EBP site-II. Although C/EBP -LAP2 has not been fully implicated in human breast carcinogenesis, studies support its role in the disease. LAP2 is the most prevalent form of C/EBP in human breast cancer cells (Eaton et al., 2001). Increased levels of C/EBP -LAP2 have also been implicated in the transforma tion human breast epithelial cells. MCF10A cells infected with a LAP2-expressing virus became anchorage independent, expressed markers of epithelial-mesenchymal transition (EMT), and acquired invasive phenotypes (Bundy and Sealy, 2003). EMT is a mechanism that is necessary for developmental processes such as gastrulation and neural crest formation (Thiery, 2003). During EMT, cells of epithelial origin loss their characteristics and acquire mesenchymal phenotype s with increased migratory behavior and display loss of intercellular adhesion (E-cadhe rins), downregulation of epithelial markers (cytokeratins), and upregulation of mesenchymal markers (vimentin). Therefore, aberrant EMT plays a role in tumor invasion and metastas is (Gupta and Massague, 2006; Savagner, 2001; Thiery, 2002; Thiery and Sleema n, 2006; Thompson et al., 2005). Additional studies found that MCF10A cells transfected with the same LAP2 virus gained epidermal growth factor (EGF)-independent growth and had disrup tion of normal acinar structure when grown on basement membrane (B undy et al., 2005). Many of the characteristics displayed by MCF10A cells overexpressing LAP2 are considered hallmarks of cancer cells (Hanahan and Weinberg, 2000). The LAP-2-induced disruption of the polar ized architecture in 86

PAGE 87

MCF10A cells is similar to that induced by the activation of Erb2 (HER2) receptor expression in these cells. HER2 is a transmembrane receptor tyrosine kinase (Stern et al., 1986) that is overexpressed in breast cancer (Sla mon et al., 1984), has roles in tamoxifen resistance (Benz et al., 1992; Leitzel et al., 1995; Wright et al., 1992), and is associated with poor clinical prognosis (Slamon et al., 1989). In MCF10A cells, activation of HER2 signaling in acini reinitiated proliferation and induced complex multi-acinar structures with filled lumen (Debnath et al., 2002; Muthuswamy et al., 2001), a process consid ered to be carcinogeni c (Muthuswamy et al., 2001). Interestingly, the overexpression of HER2 is correlated with the upregulation of Bcl-xL protein in MCF-7 breast cancer cel ls and breast ductal carcinoma in situ tissues (Kumar et al., 1996; Siziopikou and Khan, 2005), indicating a link between LAP-2, HER2, and Bcl-xL expression. This and other studies sugge st that aberrant expression of C/EBP isoforms, especially LAP2, contributes to breas t carcinogenesis (Grimm and Rosen, 2003). The expression and role of LIP varies by cell type. Although MCF10A cells did not express the LIP isoform (Figur e 3-1), the overexpression of LI P has differential effects on bcl-xl promoter and protein activity. LI P expression slightly induces pBcl-xLP activ ity (Figure 4-4A). LIP heterodimers can act as dominant negativ e transcriptional regulators (Descombes and Schibler, 1991). However, LIP has also been shown to increase transc riptional activation of some genes (Hsieh et al., 1998) In MCF10A cells, LIP overexpr ession could have activated the transcription of pBcl-xLP into the cells. Poss ible mechanisms include the inhibition of genes that repress bcl-xl or activation of genes that increase bcl-xl transcription (Dearth et al., 2001). This study indicates that when in excess, LIP ma y bind the pBcl-xLP at C/EBP site-I. In Figure 5-4A (disruption of C/EBP site-I), when LIP is overexpressed, the pBcl-xLP activity is at its lowest level compared to the other overexpression constructs. This bindi ng was not detected in 87

PAGE 88

EMSA experiments (Figure 4-2) because LIP is not endogenously expressed in MCF10A cells (Figure 3-1). Conversely, LIP overexpression decreases Bcl-xL pr otein levels in MCF10A cells, by decreasing protein levels of LA P2 (Figure 4-4B). This and ot her studies have shown that LIP decreases LAP1 and LAP2 protein expression in MCF10A cells (Bundy et al., 2005) but the mechanism by which LIP decreases LAP2 expression remains unclear. Induction of C/EBP by CSC Treatment The mechanism by which C/EBP is induced by CSC continues to be unclear. It is possible that the protein under goes post-translational modifi cations in response to CSC treatment. C/EBP is highly modified in breast cancer cells (Eaton et al., 2001). Gel-shift analysis with nuclear extract from CSC-treated ce lls showed a slower migrating band before the addition of antibody, when compared to analysis with untreated nuclear extract (Figure 4-2C). This higher band could be the result of a m odification that slows band migration. Posttranslational modifications are re quired for the activation of C/EBP and phosphorylation readily occurs on the C/EBP protein. Phosphorylation functions to increase C/EBP transcriptional activity and efficiency (Nakajima et al., 1993; Trautwein et al., 1993). Dual phosphorylation at Thr188 by MAP kinase and then at Ser184 or Thr179 by glycogen synthase kinase (GSK3 ) causes a change in confirmation that renders the leucine zipper of the monomeric protein available for the dimerization th at is required for DNA-binding ac tivity (Tang et al., 2005) and renders the basic region accessible to bind regulatory elements (Kim et al., 2007). The protein is also phosphorylated by mitogen-activated pr otein (MAP) kinase (Nakajima et al., 1993; Trautwein et al., 1993) and by protein kinase C (PKC) on Ser105 in the tr ansactivation domain (Trautwein et al., 1993). Diffe rential phosphorylation of C/EBP may account for its participation in a wide variety of biological effects (Piwien-Pi lipuk et al., 2002). It has been speculated that C/EBP has negative regulatory regions th at can also be phosphorylated. 88

PAGE 89

Therefore, the protein may be pr esent in cells as a repressed transcription factor that becomes activated upon phosphorylation (Kowenz-Leut z et al., 1994; Williams et al., 1995). C/EBP can also be acetylated (Cesena et al., 2007; Duong et al., 2002; Joo et al., 2004). The acetylation of proteins was first detected in histones and is considered a mechanism allowing DNA to become accessible to transcription regulato ry machinery (Allfrey et al., 1964; Roth et al., 2001). C/EBP has been shown to interact with the coactivator, p300 (Mink et al., 1997), that has acetyltransferas e activity (Ogryzko et al ., 1996) and with the acety ltransferase, cyclic AMP (cAMP) response-element-binding protei n (Duong et al., 2002; Kov acs et al., 2003). Recently, a novel acetylation site at Lys-39, which is activated by growth hormone (GH), was identified. Mutations in this site decreased the ability of the protein to mediate transcriptional activation of target genes, c-fos and c/ebp (Cesena et al., 2007). Th e effect acetylation has on C/EBP activity is context specific. The association of Stat5 with hist one deacetylase (HDAC) deacetylated C/EBP and promoted transcript ion of the target gene Id-1 (Xu et al., 2003). CSC treatment could also affect the localization of C/EBP protein in MCF10A cells by post-translational modifications. The localizatio n of the protein probabl y contributes to its function (Eaton et al., 2001). C/EBP is localized primarily in the cytoplasm in primary human mammary epithelial cells, but shifts to the nucleus where it can more readily act on target genes, in breast cancer cell lines (Eaton et al., 2001). Phosphorylatio n has also been shown to affect the subcellular distribution of C/EBP Relocalization of C/EBP protei ns to an active, nuclear state is mediated by cAMP or Ca2+-dependent prot ein kinases (Metz and Ziff, 1991). The nuclear import of C/EBP allowed for the transcriptional activation of -casein in mouse primary mammary epithelial cells (Kim et al., 2002). CSC treatment may activate signal transduction pathways that affect the translation of C/EBP isoforms. PKR and mTOR affect the translation 89

PAGE 90

of C/EBP isoforms and aberrant translational contro l of these kinases in hibited differentiation and induced mammary epithelial cell transformation (Calkhoven et al., 2000). Ras and PI3K signaling also targets C/EBP (Bundy and Sealy, 2003). The Potential Role of C/EBP in CSC-induced Breast Carcinogenesis C/EBP expression is a critical component in the control of mamma ry epithelial cell proliferation and differentiation in the func tional mammary gland (Robinson et al., 1998; Seagroves et al., 1998). It stands to reason that overexpression of the protein could lead to hyper proliferation of mammary epithelial cells and even tually breast carcinogenesis. However, the mechanisms by which C/EBP influences breast carcinogenesi s in general, are not well established. The acquired meta static properties of C/EBP may be partially regulated by enhanced survival of cells. The overexpression of C/EBP in rat pancreatic tumor cells resulted in increased levels of Bcl-xL (Shimizu et al., 2007). The current study indicates that the antiapoptotic activity of C/EBP may occur through the upregulation of Bcl-xL. The involvement of C/EBP in breast carcinogenesis probably involves interactions with other proteins. The role of C/EBP in cell cycle progression is dependent on its interactions with Rb and cyclin D1. Rb interacts with C/EBP however, the implications of these interactions are not fully understood (Charles et al., 2001; Chen et al., 1996a; Chen et al., 1996b). LA P2 selectively activates the cyclin D1 promoter (Eaton et al., 2001). The cyclin D1 gene, plays a role in cell cycle progression, is amplified in 15-20% of breast can cers, and the protein or mRNA is overexpressed in about 50% of breast cancers (Bartkova et al., 1994; Buckley et al., 1993). It has been suggested that the inability of LA P1 to activate the cyclin D1 prom oter is due to the lack of the required protein-protein interact ions (Eaton et al., 2001). 90

PAGE 91

C/EBP protein interacts with pr oteins to open chromatin for access to transcription factors and RNAPII. LAP1 recr uits SWI/SNF complexes to ac tivate gene promoters (KowenzLeutz and Leutz, 1999). SWI/SNF is a chromatin remodeling complex that opens chromatin for RNA polymerase II loading and is required for eukaryotic transcri ption (Narlikar et al., 2002). C/EBP along with Runx2 recruits SWI/SNF to the bone-specific osteocalci n gene to recruit RnAP II (Villagra et al., 2006). The oncogenic transcription factor, myb, and C/EBP work together to open chromatin at the (myb-inducible myelomoncytic-1) mim-1 promoter. C/EBP alone partially activated promoter activity, but Myb was required for full transcriptional activation. This study was th e first to identify C/EBP in the initial steps of localized chromatin opening at a relevant targ et region (Plachetka et al., 2008). From these studies it is reasonable to hypothesize that increased levels of C/EBP play a role in carcinoge nesis by interacting with other proteins to open chromatin and indu ce transcription of oncogenic genes. The Relationship between C/EBP Bcl-xL, and Breast Carcinogenesis The results of this study indicate that C/EBP is at least one of th e transcription factors that regulates the induction of bcl-xl mRNA and protein levels in CSC-treated MCF10A cells. This discovery places the bcl-xl promoter as a novel target gene of transcription factor, C/EBP The following model is proposed as a starti ng point to uncovering the role of C/EBP in the upregulation of bcl-xl in MCF10A cells treated with CS C (Figure 5-1). When human breast epithelial cells are exposed to CSC, cells are damaged and most undergo apoptosis. In the few surviving cells the C/EBP protein levels are activated by an unknown mechanism. This activation triggers the di merization of two C/EBP LAP2 monomers. LAP2 homodimers then bind C/EBP site-II on the bcl-xl promoter and transcriptionally activate the mRNA and subsequent protein expression leve ls of Bcl-xL. Since Bcl-xL is by definition an anti-apoptotic protein (Boise et al., 1993) it is expe cted that increased levels of Bcl-xL impede the apoptotic 91

PAGE 92

pathway, allowing for the accumulation of DNA da mage (Mendez et al., 2005; Mendez et al., 2001). When genes involved in DNA repair or the apoptotic pathway are also altered, the accumulation of DNA damage can lead to cell cycle deregulation. Disruption of apoptotic pathways, may also allow for damaged cells to survive and acquire the characteristics of transformed cells. Bcl-xL expression has roles in breast carcinogenesis. Tumor cells overexpressing Bcl-xL can adapt to new microenvi ronments (Espana et al., 2004; Fernandez et al., 2002; Mendez et al., 2006; Rubi o et al., 2001), have increased potential to metastasize (Fernandez et al., 2002; Rubio et al., 2001), and are also more prone to be resistant to chemotherapy and radiation therapy (Cherbonne l-Lasserre et al., 1996; Datta et al., 1995; Fernandez et al., 2002; Simonian et al., 1997). All of these factors contribute to the initiation and promotion of breast carcinogenesis. The relationship between the C/EBP and Bcl-xL is supported by several lines of evidence. This study indicates that C/EBP is required for CSC-induced regulation of bcl-xl in MCF10A cells. The proteins are required for proper mammary gland development (Robinson et al., 1998; Seagroves et al., 1998; Seagroves et al., 2000; Walton et al., 2001). Bcl-xL and C/EBP are both expressed in stages of mammary gland development characterized by rapidly proliferating cells such as lactation and pr egnancy and are decreased during the apoptotic involution phase (Gigliotti and DeWille, 1998; Heermeier et al., 1996; Robinson et al., 1998; Sabatakos et al., 1998). Additionally, both are ov erexpressed in human breast cancer (Eaton et al., 2001; Krajewski et al., 1999) a nd are associated with cancer pr ogression, and more invasive tumors that display higher hi stological grades (Eaton and Se aly, 2003; Milde-Langosch et al., 2003; Olopade et al., 1997). This data suggest s that it is likely that Bcl-xL and C/EBP cooperate during human breast tumorigenesis. The role of C/EBP in inducing Bcl-xL 92

PAGE 93

expression, along with other st udies, also indicates that LAP2 is the primary C/EBP isoform involved in breast carcinogenesis. The current study not only provi des insight to the mechanism of cigarette smoke-induced breast epithelial cell transformation and carcinogenesis, it adds to the literature that supports the link between cigarette smoking and incr eased breast cancer risk. The results of the present study can therefore be used to determin e chemotherapeutic targets to decrease aberrant bcl-xl expression during breast carcinogenesis especially that which is induced by exposure to cigarette smoke. As with other proteins, there are a many factors that can regulate bcl-xl activity and other transcription factors may still have a role in bcl-xl regulation. Studies have identified four major classes of transcription factors that regulate the bcl-xl gene: Ets, Rel/ Nuclear factor kappa B (NFB), STAT, and AP1 (Grad et al., 2000; Sevilla et al., 2001). One of the first studies aimed at identifying transcript ion factors regulating the bcl-xl promoter identified Ets2. Ets2, a member of the Ets transcription factor family, is a nucl ear proto-oncogene with se quence identity to the vETS protein of the gag-Myb-Ets fusion protein of the E26 avia n retrovirus (Boulukos et al., 1988; Ghysdael et al., 1986; Watson et al., 1985 ; Watson et al., 1988). Ets inhibits colonystimulating factor 1 (CSF-1)-induced apoptosis macrophages by upregulating bcl-xl transcription (Sevilla et al., 1999). Ets proteins are deregul ated in a number of cancers (Boyd and Farnham, 1999) and are implicated in the re gulation of matrix metalloprotei nase expression, which offers a potential connection to control of cell survival and metastasis (Westermarck and Kahari, 1999). The NF B family of transcription fact ors is involved in the regul ation of inflammation, stress and apoptosis (Beg et al., 1995; Sonenshein, 1997). NFB has been repeatedly shown to regulation bcl-xl expression (Chen et al., 2000; Chen et al ., 1999; Glasgow et al., 2001; Glasgow et al., 2000; Tsukahara et al., 1999). The tw o proteins may form a positive feedback loop, 93

PAGE 94

because Bcl-xL can affect upstream NFB activation (Badrichani et al., 1999). The relationship between NFB and bcl-xl raise the possibility that activity of pro-survival genes may contribute to oncogenesis when NFB is aberrantly expressed (Chen et al., 2000). Signal transducer and activators of transcription (STATs) play roles in growth factor, cytoki ne, or hormone-mediated cellular signal transducti on (Darnell, 1997). Members of this pr otein family have been shown to regulate bcl-xl (Grad et al., 2000) and evidence suggests that STATs contribute to oncogenesis by modulating Bcl-xL levels (Bromberg et al., 1999; Grandis et al., 2000 ; Karni et al., 1999). AP1 complexes have roles in proliferation and differentiation pathways (Bannister, 1997). AP1 complexes consist of the oncogenes, Fos and Jun heterodimers or Jun homodimers, that bind to the AP1 DNA binding sites and have been shown to regulate Bcl-xL e xpression (Jacobs-Helber et al., 1998; Sevilla et al., 1999). Despite these transcription factors, it is im portant to note that wh en MCF10A cells are treated with CSC, C/EBP is the primary transcription factor responsible for increased Bcl-xL expression. Similar to the ot her transcription f actors that regulate Bcl-xL, C/EBP seems to have a role in carcinogenesis. The regulation of the bcl-xl gene is most likely dependent on cell type and stimuli (Grad et al., 2000). Future and Directions As with most scientific investigations, this study leads to other que stions and experiments that will provide a complete picture of the CS C-induced transformation of MCF10A cells. The present study focused specifically on the CSC-induced upregulation of bcl-xl in MCF10A cells and more studies are needed to confirm this mechanism in other cell types and situations. Determining the protein that binds to C/EBP site-I on the pBcl-xLP will shed light on the transformation of MCF10A cells tr eated with CSC, and identify another protein that may be used as a therapeutic target. The determination of the mechanism by which CSC induces C/EBP is 94

PAGE 95

also of up most importance. The present study suggests C/EBP may be post-translationally upregulated by CSC treatment. It is also possible that C/EBP can be regulated on the transcriptional level. Future experiments should focus on which, if any modifications are induced by CSC treatment. Determining the types and sites of modifications can give a clearer picture of CSC-induced C/EBP and subsequent increased Bcl-xL expression in MCF10A cells. Although the C/EBP hLIP overexpression construc t allowed for an endogenous knockdown system, siRNA can be used to more efficiently rid cells of C/EBP expression and determine whether Bcl-xL levels are still responsive to CSC treatment. Whether C/EBP is directly involved in the CSC-induced transforma tion of MCF10A cells can also be determined with a siRNA knockdown system. Characteristics of transformation can be compared between MCF10A cells treated with CSC in the presence or absence of C/EBP siRNA. An important question left unanswered by C/EBP -LAP2 overexpression studies (Bundy et al., 2005; Bundy and Sealy, 2003) is if LAP2 can cause MCF10A cells to become tumorigenic in a mouse model system. Establishing this relationship will indicate that C/EBP especially LAP2 has a role in breast carcinogenesis. Bcl-xL is associated with decreased apoptosis in tumors, resistance to chemotherapy, and poor clinical outcome (Taylor et al., 1999). Seve ral strategies to decr ease Bcl-xL expression have been developed. One example is the use of bcl-xl antisense oligonucleotides (Ackermann et al., 1999; Dibbert et al., 1998; Espana et al., 2004; Pollman et al., 1998). Newer oligonucleotides have been de veloped that are specific to bcl-xl and do not target bcl-x premRNA or bcl-xs (Simoes-Wust et al., 2000). Bcl-xS expression has also been used as therapeutic agent against Bcl-xL (Ealovega et al., 1996). A pha rmacological intervention that simultaneously decreases Bcl-xL and increases Bcl-xS is also an important anti-tumor treatment 95

PAGE 96

(Reed, 1995; Yang and Korsmeyer, 1996). Studies ha ve also developed probes that bind to the 5 of bcl-x mRNA and force the translation of Bcl-xS protein instead of Bcl-xL (Mercatante et al., 2001; Taylor et al., 1999). St rategies that keep Bcl-xL deaminated also have therapeutic potential (Weintraub et al., 2004) because suppression of deamination occurs during carcinogenesis (Takehara and Takahashi, 2003; Zhao et al., 2004). More recently, ABT-737, a small molecule inhibitor of Bcl-xL as well as Bcl-2 and Bcl-w was discovered. It binds to the BH3 binding groove of these anti-a poptotic proteins, enhancing th e death signal by keeping them from interacting with endogenous BH3-only prot eins. The molecule regressed established tumors and improved survival and cure rates in mouse models (Oltersdorf et al., 2005). However, interventions targeting C/EBP expression are limited. The implications of this study include identifying C/EBP as a potential oncogene and spar king research into therapeutics aimed at decreasing its expression in cancer cells or tumors. C/EBP may also become a valuable molecular tool used to determine patient response to therapy and prognosis (MildeLangosch et al., 2003; Zahnow et al., 1997). Studies focusing on th e regulation of the protein will no doubt be critical to developing such therapeutic interventions. 96

PAGE 97

Figure 5-1. Model of CSC-Induced C/EBP upregulation of Bcl-xL in MCF10A cells. Exposure of CSC to MCF10A cells causes DNA damage and most cells die. The surviving cells display in creased levels of C/EBP by an unknown mechanism. C/EBP -LAP2 homodimers form and bind to C/EBP site-II on the bcl-xl promoter, positively activating its transcription. Increased levels of Bcl-xL protein prevents damaged cells from being removed by apoptosis. Persistent DNA damage in these cells leads genetic alterations, transf ormation of normal epithelial cells, and eventually breast carcinogenesis. During ca rcinogenesis, Bcl-xL expression is linked to metastasis and resistance to chemot herapy which affect tumor progression. 97

PAGE 98

LIST OF REFERENCES Ackermann, E.J., Taylor, J.K., Narayana, R., a nd Bennett, C.F. (1999). The role of antiapoptotic Bcl-2 family members in endotheli al apoptosis elucidated with an tisense oligonucleotides. J Biol Chem 274, 11245-11252. Adams, J.M., and Cory, S. (1998). The Bcl-2 prot ein family: arbiters of cell survival. Science 281, 1322-1326. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990). A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 9, 1897-1906. Albini, A., Iwamoto, Y., Kleinm an, H.K., Martin, G.R., Aaronson, S.A., Kozlowski, J.M., and McEwan, R.N. (1987). A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res 47, 3239-3245. Allan, D.J., Howell, A., Roberts, S.A., Williams G.T., Watson, R.J., Coyne, J.D., Clarke, R.B., Laidlaw, I.J., and Potten, C.S. (1992). Reduction in apoptosis relative to m itosis in histologically normal epithelium accompanies fibrocystic change and carcinoma of the premenopausal human breast. J Pathol 167, 25-32. Allfrey, V.G., Faulkner, R., and Mirsky, A.E. ( 1964). Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. Proc Natl Acad Sci U S A 51, 786794. Ambrosone, C.B., Freudenheim, J.L., Graham, S., Marshall, J.R., Vena, J.E., Brasure, J.R., Michalek, A.M., Laughlin, R., Nemoto, T., G illenwater, K.A., and Shields, P.G. (1996). Cigarette smoking, N-acetyltransferase 2 geneti c polymorphisms, and breast cancer risk. JAMA 276, 1494-1501. Ambrosone, C.B., Kropp, S., Yang, J., Yao, S., Sh ields, P.G., and Chang-Claude, J. (2008). Cigarette smoking, N-acetyltransferase 2 genotypes and breast cancer risk: pooled analysis and meta-analysis. Cancer Epidemiol Biomarkers Prev 17, 15-26. American Cancer Society (2008). Cancer Facts & Figures 2008. (Atlanta, American Cancer Society). Ames, B.N., McCann, J., and Yamasaki, E. ( 1975). Methods for det ecting carcinogens and mutagens with the Salmonella/mammalian-microsome mutagenicity test. Mutat Res 31 347-364. Annis, M.G., Soucie, E.L., Dlugosz, P.J., Cruz-Aguado, J.A., Penn, L.Z., Leber, B., and Andrews, D.W. (2005). Bax forms multispanning monomers that oligomerize to permeabilize membranes during apoptosis. EMBO J 24, 2096-2103. 98

PAGE 99

Antonsson, B., Conti, F., Ciavatta, A., Montessuit S., Lewis, S., Martinou, I., Bernasconi, L., Bernard, A., Mermod, J.J., Mazzei, G., et al. (1997). Inhibition of Bax channel-forming activity by Bcl-2. Science 277, 370-372. Armstrong, R. (1997). Glutathione-S-transferases, Vol 3 (New Yo rk, NY: Elsevier Science). Artandi, S.E., Chang, S., Lee, S.L., Alson, S., Gottlieb, G.J., Chin, L., and DePinho, R.A. (2000). Telomere dysfunction promotes non-reciprocal tr anslocations and epithel ial cancers in mice. Nature 406, 641-645. Bachelor, M.A., and Bowden, G.T. (2004). Ultr aviolet A-induced modulation of Bcl-XL by p38 MAPK in human keratinocytes: post-transcriptional regulati on through the 3'-untranslated region. J Biol Chem 279, 42658-42668. Badrichani, A.Z., Stroka, D.M., Bilbao, G., Curiel, D.T., Bach, F.H., and Ferran, C. (1999). Bcl2 and Bcl-XL serve an anti-inflammatory functi on in endothelial cells th rough inhibition of NFkappaB. J Clin Invest 103, 543-553. Baer, M., and Johnson, P.F. (2000) Generation of truncated C/EB Pbeta isoforms by in vitro proteolysis. J Biol Chem 275, 26582-26590. Baldwin, B.R., Timchenko, N.A., and Zahnow, C.A. (2004). Epidermal growth factor receptor stimulation activates the R NA binding protein CUG-BP1 an d increases expression of C/EBPbeta-LIP in mammary epithelial cells. Mol Cell Biol 24 3682-3691. Ban, J., Eckhart, L., Weninger, W., Mildner, M., and Tschachler, E. (1998). Identification of a human cDNA encoding a novel Bcl-x is oform. Biochem Biophys Res Commun 248, 147-152. Band, P.R., Le, N.D., Fang, R., and Deschamp s, M. (2002). Carcinogenic and endocrine disrupting effects of cigarette smoke and risk of breast cancer. Lancet 360, 1044-1049. Baron, J.A., La Vecchia, C., and Levi, F. (1990). The antiestrogenic effect of cigarette smoking in women. Am J Obstet Gynecol 162, 502-514. Baron, J.A., Newcomb, P.A., Longnecker, M.P., Mittendorf, R., Storer B.E., Clapp, R.W., Bogdan, G., and Yuen, J. (1996). Cigarette sm oking and breast cancer. Cancer Epidemiol Biomarkers Prev 5, 399-403. Bartkova, J., Lukas, J., Muller, H., Lutzhoft, D., Strauss, M., and Bartek, J. (1994). Cyclin D1 protein expression and function in human breast cancer. Int J Cancer 57, 353-361. Bartsch, H., Terracini, B., Malave ille, C., Tomatis, L., Wahrendorf, J., Brun, G., and Dodet, B. (1983). Quantitative comparison of carcinogenicity, mutagenicity and electrophilicity of 10 direct-acting alkylating agents and of the initial O6:7-alkylguanine ratio in DNA with carcinogenic potency in rodents. Mutat Res 110, 181-219. 99

PAGE 100

Bannister, A., Kouzarides, T. (1997). Structure/func tion and oncogenic conversion of Fos and Jun (Birkhauser. Basel [from 118]). Baron, J.A., La Vecchia, C., and Levi, F. (1990). The antiestrogenic effect of cigarette smoking in women. Am J Obstet Gynecol 162, 502-514. Barry, M.A., Behnke, C.A., and Eastman, A. (1990). Activation of programmed cell death (apoptosis) by cisplatin, other anticancer drugs, toxins and hyperthermia. Biochem Pharmacol 40, 2353-2362. Beckmann, M.W., Niederacher, D., Schnurch, H.G ., Gusterson, B.A., and Bender, H.G. (1997). Multistep carcinogenesis of breast cancer and tumour hetero geneity. J Mol Med 75, 429-439. Beg, A.A., Sha, W.C., Bronson, R.T., Ghosh, S., and Baltimore, D. (1995). Embryonic lethality and liver degeneration in mi ce lacking the RelA component of NF-kappa B. Nature 376, 167170. Bennett, W.P., Alavanja, M.C., Blomeke, B., Vahakangas, K.H., Castren, K., Welsh, J.A., Bowman, E.D., Khan, M.A., Flieder, D.B., a nd Harris, C.C. (1999). Environmental tobacco smoke, genetic susceptibility, and risk of l ung cancer in never-smoking women. J Natl Cancer Inst 91, 2009-2014. Benz, C.C., Scott, G.K., Sarup, J.C., Johnson, R. M., Tripathy, D., Coronado, E., Shepard, H.M., and Osborne, C.K. (1992). Estrogen-dependent, tamoxifen-resistant tumorigenic growth of MCF-7 cells transfected with HE R2/neu. Breast Cancer Res Treat 24, 85-95. Bissell, M.J., Rizki, A., and Mian, I.S. (2003). Ti ssue architecture: the ultimate regulator of breast epithelial function. Curr Opin Cell Biol 15 753-762. Biswas, R.S., Cha, H.J., Hardwick, J.M., and Sr ivastava, R.K. (2001). Inhibition of drug-induced Fas ligand transcription and apoptosis by Bcl-XL. Mol Cell Biochem 225, 7-20. Boatright, K.M., Renatus, M., Scott, F.L., Sper andio, S., Shin, H., Pedersen, I.M., Ricci, J.E., Edris, W.A., Sutherlin, D.P., Green, D.R., and Sa lvesen, G.S. (2003). A unified model for apical caspase activation. Mol Cell 11, 529-541. Bode, A.M., and Dong, Z. (2005). Signal transduc tion pathways in cancer development and as targets for cancer prevention. Prog Nucleic Acid Res Mol Biol 79, 237-297. Boise, L.H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L.A., Mao, X., Nunez, G., and Thompson, C.B. (1993). bcl-x, a bcl2-related gene that f unctions as a dominant regulator of apoptotic cell death. Cell 74, 597-608. Boise, L.H., and Thompson, C.B. (1997). Bcl-x(L) can inhibit apoptosis in cells that have undergone Fas-induced protease activ ation. Proc Natl Acad Sci U S A 94, 3759-3764. 100

PAGE 101

Bonfil, R.D., Reddel, R.R., Ura, H., Reich, R., Fr idman, R., Harris, C.C., and Klein-Szanto, J.P. (1989). Invasive and metastatic potential of a v-Ha-ras-transfor med human bronchial epithelial cell line. J Natl Cancer Inst 81, 587-594. Boulukos, K.E., Pognonec, P., Begue, A., Galibert, F., Gesquiere, J.C., Stehelin, D., and Ghysdael, J. (1988). Identification in chickens of an evolutionarily conserved cellular ets-2 gene (c-ets-2) encoding nuclear proteins related to the products of the c-ets proto-oncogene. EMBO J 7, 697-705. Boyd, K.E., and Farnham, P.J. (1999). Identificati on of target genes of oncogenic transcription factors. Proc Soc Exp Biol Med 222, 9-28. Bremnes, Y., Ursin, G., Bjurstam, N., and Gram I.T. (2007). Different measures of smoking exposure and mammographic density in postmenopa usal Norwegian women: a cross-sectional study. Breast Cancer Res 9, R73. Bromberg, J.F., Wrzeszczynska, M.H., Devgan, G., Zhao, Y., Pestell, R.G., Albanese, C., and Darnell, J.E., Jr. (1999). St at3 as an oncogene. Cell 98, 295-303. Buckley, M.F., Sweeney, K.J., Hamilton, J.A., Sini, R.L., Manning, D.L., Nicholson, R.I., deFazio, A., Watts, C.K., Musgrove, E.A., and Sutherland, R.L. (1993). Expression and amplification of cyclin genes in human breast cancer. Oncogene 8, 2127-2133. Bundy, L., Wells, S., and Sealy, L. (2005). C/EBPbeta-2 confers EGF-independent growth and disrupts the normal acinar architecture of hu man mammary epithelial cells. Mol Cancer 4, 43. Bundy, L.M., and Sealy, L. (2003). CCAAT/enhancer binding protein beta (C/EBPbeta)-2 transforms normal mammary epithelial cells and i nduces epithelial to mesenchymal transition in culture. Oncogene 22, 869-883. Burchell, B., McGurk, K, Brierley, CH, Clarke DJ (1997). UDPglucuronosyltransferases, Vol 3 (New York, NY: Elsevier Science). Cai, J., Yang, J., and Jones, D.P. (1998). Mitochondrial control of a poptosis: the role of cytochrome c. Biochim Biophys Acta 1366, 139-149. Calaf, G., and Russo, J. (1993). Transformation of human breast epitheli al cells by chemical carcinogens. Carcinogenesis 14, 483-492. Calkhoven, C.F., Muller, C., and Leutz, A. (200 0). Translational control of C/EBPalpha and C/EBPbeta isoform expression. Genes Dev 14, 1920-1932. Campos, L., Rouault, J.P., Sabido, O., Oriol, P., Roubi, N., Vasselon, C., Archimbaud, E., Magaud, J.P., and Guyotat, D. (1993). High expr ession of bcl-2 protein in acute myeloid leukemia cells is associated with poor response to chemotherapy. Blood 81, 3091-3096. Cao, Z., Umek, R.M., and McKnight, S.L. ( 1991). Regulated expression of three C/EBP isoforms during adipose conversi on of 3T3-L1 cells. Genes Dev 5, 1538-1552. 101

PAGE 102

Castle, V.P., Heidelberger, K.P., Bromberg, J., Ou, X., Dole, M., and Nunez, G. (1993). Expression of the apoptosis-suppressing protein bcl-2, in neuroblastoma is associated with unfavorable histology and N-my c amplification. Am J Pathol 143, 1543-1550. Cavalieri, E.L., Higginbotham, S., RamaKrishna, N.V., Devanesan, P.D., Todorovic, R., Rogan, E.G., and Salmasi, S. (1991). Comparative dose-response tumorigenicity studies of dibenzo[alpha,l]pyrene versus 7,12-dimethylbenz [alpha]anthracene, benzo[alpha]pyrene and two dibenzo[alpha,l]pyrene dihydrodiols in mouse skin and rat mammary gland. Carcinogenesis 12, 1939-1944. Centers for Disease Control and Prevention ( 2007). Cigarette Smoking Among Adults United States, 2004. In MMWR Morb Mortal Wkly Rep, pp. 1157-1161.Chambers, A.F., Naumov, G.N., Varghese, H.J., Nadkarni, K.V., MacDonald, I.C., and Groom, A.C. (2001). Critical steps in hematogenous metastasis: an overview. Surg Oncol Clin N Am 10, 243-255, vii. Cesena, T.I., Cardinaux, J.R., Kwok, R., and Schwartz, J. (2007). CCAAT/enhancer-binding protein (C/EBP) beta is acetylated at multiple lysines: acetylation of C/EBPbeta at lysine 39 modulates its ability to activ ate transcription. J Biol Chem 282, 956-967. Chambers, A.F., Naumov, G.N., Varghese, H.J., Nadkarni, K.V., MacDonald, I.C., and Groom, A.C. (2001). Critical steps in hematogenous meta stasis: an overview. Surg Oncol Clin N Am 10, 243-255, vii. Chang, B.S., Minn, A.J., Muchmore, S.W., Fesik, S.W., and Thompson, C.B. (1997). Identification of a novel regulatory doma in in Bcl-X(L) and Bcl-2. EMBO J 16, 968-977. Change, S. (1966). In vitro transformation of human epithelial cells. Biochem Biophys Acta 823, 161-194. Charafe-Jauffret, E., Ginestier, C., Monville, F., Fi netti, P., Adelaide, J., Cervera, N., Fekairi, S., Xerri, L., Jacquemier, J., Birnbaum, D., and Bertucci, F. (2006). Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene 25, 2273-2284. Charles, A., Tang, X., Crouch, E., Brody, J.S., a nd Xiao, Z.X. (2001). Retinoblastoma protein complexes with C/EBP proteins and activates C/EBP-mediated transcription. J Cell Biochem 83, 414-425. Chen, C., Edelstein, L.C., and Gelinas, C. (2000). The Rel/NF-kappaB family directly activates expression of the apoptosis in hibitor Bcl-x(L). Mol Cell Biol 20 2687-2695. Chen, P.L., Riley, D.J., Chen, Y., and Lee, W.H. (1996). Retinoblasto ma protein positively regulates terminal adipocyte di fferentiation through direct interaction with C/EBPs. Genes Dev 10, 2794-2804. Chen, P.L., Riley, D.J., Chen-Kiang, S., and Lee, W.H. (1996). Retinoblastoma protein directly interacts with and activates the transcription factor NF-IL6. Proc Natl Acad Sci U S A 93 465469. 102

PAGE 103

Chen, C.S., Mrksich, M., Huang, S., Whitesides, G.M., and Ingber, D.E. (1997). Geometric control of cell life and death. Science 276 1425-1428. Cheng, E.H., Levine, B., Boise, L.H., Thom pson, C.B., and Hardwick, J.M. (1996). Baxindependent inhibition of a poptosis by Bcl-XL. Nature 379, 554-556. Cheng, E.H., Wei, M.C., Weiler, S., Flavell, R.A., Mak, T.W., Lindsten, T., and Korsmeyer, S.J. (2001). BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAXand BAKmediated mitochondrial apoptosis. Mol Cell 8, 705-711. Chepiga, T.A., Morton, M.J., Murphy, P.A., Avalos, J.T., Bombick, B.R., Doolittle, D.J., Borgerding, M.F., and Swauger, J.E. (2000). A co mparison of the mainstream smoke chemistry and mutagenicity of a representative sample of the US cigarette market with two Kentucky reference cigarettes (K1R4F and K1R5F). Food Chem Toxicol 38, 949-962. Cherbonnel-Lasserre, C., Gauny, S., and Kronenberg, A. (1996). Suppression of apoptosis by Bcl-2 or Bcl-xL promotes susceptibility to mutagenesis. Oncogene 13, 1489-1497. Chinnaiyan, A.M. (1999). The apoptosome: heart a nd soul of the cell death machine. Neoplasia 1, 5-15. Chinnaiyan, A.M., and Dixit, V.M. (1 996). The cell-death machine. Curr Biol 6, 555-562. Chinnaiyan, A.M., and Dixit, V.M. (1997). Portrait of an executioner: the molecular mechanism of FAS/APO-1-induced apoptosis. Semin Immunol 9, 69-76. Chinnaiyan, A.M., O'Rourke, K., Tewari, M., and Dixit, V.M. (1995). FADD, a novel death domain-containing protein, interact s with the death domain of Fas and initiates apoptosis. Cell 81, 505-512. Chipuk, J.E., Bhat, M., Hsing, A.Y., Ma, J., and Danielpour, D. ( 2001). Bcl-xL blocks transforming growth factor-beta 1-induced apoptos is by inhibiting cytochrome c release and not by directly antagonizing Apaf-1-dependent caspase act ivation in prostate ep ithelial cells. J Biol Chem 276, 26614-26621. Chittenden, T., Flemington, C., Houghton, A.B ., Ebb, R.G., Gallo, G.J., Elangovan, B., Chinnadurai, G., and Lutz, R.J. (1995). A conser ved domain in Bak, distinct from BH1 and BH2, mediates cell death and protei n binding functions. EMBO J 14, 5589-5596. Ciechanover, A. (1994). The ubiquitin-p roteasome proteolytic pathway. Cell 79, 13-21. Cory, S., and Adams, J.M. (2002). The Bcl2 fa mily: regulators of the cellular life-or-death switch. Nat Rev Cancer 2 647-656. Cory, S., Huang, D.C., and Adams, J.M. (2003). The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22, 8590-8607. 103

PAGE 104

Cramer, W.A., Heymann, J.B., Schendel, S.L., Deriy, B.N., Cohen, F.S., Elkins, P.A., and Stauffacher, C.V. (1995). Structure-function of the channel-forming colicins. Annu Rev Biophys Biomol Struct 24, 611-641. Croniger, C., Trus, M., Lysek-Stupp, K., Cohen, H., Liu, Y., Darlington, G.J., Poli, V., Hanson, R.W., and Reshef, L. (1997). Role of the isof orms of CCAAT/enhancer-binding protein in the initiation of phosphoenolpyruvate car boxykinase (GTP) gene transcri ption at birth. J Biol Chem 272, 26306-26312. Cuzick, J., Routledge, M.N., Jenkins, D., and Garner, R.C. (1990). DNA adducts in different tissues of smokers and non-smokers. Int J Cancer 45, 673-678. Darnell, J.E., Jr. (1997). STATs and gene regulation. Science 277, 1630-1635. Datta, R., Manome, Y., Taneja, N., Boise, L. H., Weichselbaum, R., Thompson, C.B., Slapak, C.A., and Kufe, D. (1995). Overexpression of Bcl-XL by cytotoxic drug exposure confers resistance to ionizing radiati on-induced internucleosomal DN A fragmentation. Cell Growth Differ 6, 363-370. Davis, B.R., Whitehead, J.K., Gill, M.E., Lee, P.N., Butterworth, A.D., and Roe, F.J. (1975). Response of rat lung to inhaled tobacco smoke wi th or without prior e xposure to 3,4-benzpyrene (BP) given by intratracheal instillation. Br J Cancer 31, 469-484. Davis, D., Vaught, A, Tso,TC, Bush, LP (1984). An alysis of a new low yi eld research cigarette (Lexington, KY: Tobacco and Health Institute). Dearth, L.R., Hutt, J., Sattler, A., Gigliotti, A., and DeWille, J. (2001). Expression and function of CCAAT/enhancer binding proteinbeta (C/E BPbeta) LAP and LIP isoforms in mouse mammary gland, tumors and cultured mamm ary epithelial cells. J Cell Biochem 82, 357-370. Debnath, J., Mills, K.R., Collins, N.L., Regina to, M.J., Muthuswamy, S.K., and Brugge, J.S. (2002). The role of apoptosis in creating and maintaining luminal space within normal and oncogene-expressing mammary acini. Cell 111, 29-40. DeMarini, D.M. (2004). Genotoxi city of tobacco smoke and tobacco smoke condensate: a review. Mutat Res 567, 447-474. Dertinger, S.D., Nazarenko, D.A., Silverstone A.E., and Gasiewicz, T.A. (2001). Aryl hydrocarbon receptor signaling plays a significant role in mediating benzo[a]pyreneand cigarette smoke condensate-induced cytogenetic damage in vivo. Carcinogenesis 22, 171-177. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and Schibler, U. (1990). LAP, a novel member of the C/EBP gene family, encodes a li ver-enriched transcriptio nal activator protein. Genes Dev 4, 1541-1551. 104

PAGE 105

Descombes, P., and Schibler, U. (1991). A liver-e nriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67, 569579. Deverman, B.E., Cook, B.L., Manson, S.R., Niederho ff, R.A., Langer, E.M., Rosova, I., Kulans, L.A., Fu, X., Weinberg, J.S., Heinecke, J.W. et al. (2002). Bcl-xL deamidation is a critical switch in the regulation of the response to DNA damage. Cell 111, 51-62. Dibbert, B., Daigle, I., Braun, D., Schranz, C., Weber, M., Blaser, K., Zangemeister-Wittke, U., Akbar, A.N., and Simon, H.U. (1998). Role for Bc l-xL in delayed eosinop hil apoptosis mediated by granulocyte-macrophage colony-stimul ating factor and interleukin-5. Blood 92, 778-783. DiPaolo, J.A. (1983). Relative diffi culties in transforming human a nd animal cells in vitro. J Natl Cancer Inst 70 3-8. Doll, R., Peto, R (1981). The Causes of Cancer (New York, NY: Oxford Press). Donahue, T.F., Cigan, A.M., Pabich, E.K., and Va lavicius, B.C. (1988). Mutations at a Zn(II) finger motif in the yeast eIF-2 beta gene alter ribosomal start-site sel ection during the scanning process. Cell 54, 621-632. Donepudi, M., Mac Sweeney, A., Briand, C., and Grutter, M.G. (2003). Insights into the regulatory mechanism for caspase-8 activation. Mol Cell 11 543-549. Du, C., Fang, M., Li, Y., Li, L., and Wang, X. (2000). Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase ac tivation by eliminating IAP inhibition. Cell 102, 33-42. Duong, D.T., Waltner-Law, M.E., Sears, R., Sealy, L ., and Granner, D.K. (2002). Insulin inhibits hepatocellular glucose production by utilizing liver-enriched transcri ptional inhibitory protein to disrupt the association of CREB-binding pr otein and RNA polymerase II with the phosphoenolpyruvate carboxykinase ge ne promoter. J Biol Chem 277, 32234-32242. Egan, K.M., Stampfer, M.J., Hunter, D., Hanki nson, S., Rosner, B.A., Holmes, M., Willett, W.C., and Colditz, G.A. (2002). Active and passi ve smoking in breast cancer : prospective results from the Nurses' Health Study. Epidemiology 13, 138-145. Ealovega, M.W., McGinnis, P.K., Sumantran, V.N., Clarke, M.F ., and Wicha, M.S. (1996). bclxs gene therapy induces apopt osis of human mammary tumors in nude mice. Cancer Res 56, 1965-1969. Espana, L., Fernandez, Y., Rubio, N., Torregros a, A., Blanco, J., and Sierra, A. (2004). Overexpression of Bcl-xL in human breast cance r cells enhances organ-selective lymph node metastasis. Breast Cancer Res Treat 87, 33-44. Eaton, E.M., Hanlon, M., Bundy, L., and Sealy, L. (2001). Characterization of C/EBPbeta isoforms in normal versus neoplastic ma mmary epithelial cells. J Cell Physiol 189, 91-105. 105

PAGE 106

el-Bayoumy, K., Chae, Y.H., Upadhyaya, P., Ri venson, A., Kurtzke, C., Reddy, B., and Hecht, S.S. (1995). Comparative tumorigenicity of benzo[a]pyrene, 1-nitropyrene and 2-amino-1methyl-6-phenylimidazo[4,5-b]pyridine admini stered by gavage to female CD rats. Carcinogenesis 16, 431-434. Fang, W., Rivard, J.J., Mueller, D.L., and Be hrens, T.W. (1994). Cloning and molecular characterization of mouse bcl-x in B and T lymphocytes. J Immunol 153, 4388-4398. Farrow, S.N., and Brown, R. (1996). New member s of the Bcl-2 family and their protein partners. Curr Opin Genet Dev 6, 45-49. Fearon, E. R. and Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell 61, 759-767. Fernandez, Y., Gu, B., Martinez, A., Torregrosa, A., and Sierra, A. (2002). Inhibition of apoptosis in human breast cancer ce lls: role in tumor progression to the metastatic state. Int J Cancer 101, 317-326. Fernandez, Y., Espana, L., Manas, S., Fabra, A., and Sierra, A. (2000). Bcl-xL promotes metastasis of breast cancer ce lls by induction of cytokines re sistance. Cell Death Differ 7, 350359. Fiebig, A.A., Zhu, W., Hollerbach, C., Leber, B., and Andrews, D.W. (2006). Bcl-XL is qualitatively different from and ten times more effective than Bc l-2 when expressed in a breast cancer cell line. BMC Cancer 6, 213. Fink, A.K., and Lash, T.L. (2003). A null asso ciation between smoking during pregnancy and breast cancer using Massachusetts registry data (United Stat es). Cancer Causes Control 14, 497503. Firozi, P.F., Bondy, M.L., Sahin, A.A., Chang, P ., Lukmanji, F., Singletary, E.S., Hassan, M.M., and Li, D. (2002). Aromatic DNA adducts a nd polymorphisms of CYP1A1, NAT2, and GSTM1 in breast cancer. Carcinogenesis 23, 301-306. Finucane, D.M., Bossy-Wetzel, E., Waterhouse, N. J., Cotter, T.G., and Green, D.R. (1999). Baxinduced caspase activation and apoptosis via cytochrome c release from mitochondria is inhibitable by Bcl-xL. J Biol Chem 274, 2225-2233. Frisch, S.M., and Francis, H. (1994). Disruption of epithelial cell-matrix interactions induces apoptosis. J Cell Biol 124, 619-626. Gago, F.E., Tello, O.M., Diblasi, A.M., and Cio cca, D.R. (1998). Integration of estrogen and progesterone receptors with pathological and molecular prognostic factors in breast cancer patients. J Steroid Biochem Mol Biol 67, 431-437. Gery, S., Tanosaki, S., Bose, S., Bose, N., Vadgama, J., and Koeffl er, H.P. (2005). Downregulation and growth in hibitory role of C/EBPalpha in breast cancer. Clin Cancer Res 11 31843190. 106

PAGE 107

Ghysdael, J., Gegonne, A., Pognonec, P., Boulukos, K., Leprince, D., Dernis, D., Lagrou, C., and Stehelin, D. (1986). Identification in chicken macrophages of a se t of proteins related to, but distinct from, the chicken cellular cets-encoded protein p54c-ets. EMBO J 5, 2251-2256. Gibson, L., Holmgreen, S.P., Huang, D.C., Bernard, O., Copeland, N.G., Jenkins, N.A., Sutherland, G.R., Baker, E., Adams, J.M., and Co ry, S. (1996). bcl-w, a novel member of the bcl-2 family, promotes cell survival. Oncogene 13, 665-675. Gigliotti, A.P., and DeWille, J.W. (1998). Lactation status infl uences expression of CCAAT/enhancer binding protei n isoform mRNA in the mouse mammary gland. J Cell Physiol 174, 232-239. Gigliotti, A.P., Johnson, P.F., Sterneck, E., and DeWille, J.W. (2003). Nulliparous CCAAT/enhancer binding protei ndelta (C/EBPdelta) knockout mi ce exhibit mammary gland ductal hyperlasia. Exp Biol Med (Maywood) 228, 278-285. Giovannucci, E., Colditz, G.A., Stampfer, M.J., Hunter, D., Rosner, B.A., Willett, W.C., and Speizer, F.E. (1994). A prospective study of ciga rette smoking and risk of colorectal adenoma and colorectal cancer in U.S. women. J Natl Cancer Inst 86, 192-199. Giovannucci, E., Rimm, E.B., Stampfer, M.J., Co lditz, G.A., Ascherio, A., Kearney, J., and Willett, W.C. (1994). A prospective study of cigarette smoking and risk of colorectal adenoma and colorectal cancer in U. S. men. J Natl Cancer Inst 86, 183-191. Giovannucci, E., and Martinez, M.E. (1996). To bacco, colorectal cance r, and adenomas: a review of the evidence. J Natl Cancer Inst 88, 1717-1730. Gisselsson, D. (2003). Chromosome instability in cancer: how, when, and why? Adv Cancer Res 87, 1-29. Glasgow, J.N., Qiu, J., Rassin, D., Grafe, M ., Wood, T., and Perez-Pol, J.R. (2001). Transcriptional regulation of the BCL-X gene by NF-kappaB is an element of hypoxic responses in the rat brain. Neurochem Res 26, 647-659. Glasgow, J.N., Wood, T., and Perez-Polo, J.R. (2000). Identification and characterization of nuclear factor kappaB binding sites in th e murine bcl-x promoter. J Neurochem 75, 1377-1389. Gonzalez-Garcia, M., Garcia, I., Ding, L., O'Shea S., Boise, L.H., Thompson, C.B., and Nunez, G. (1995). bcl-x is expressed in embryonic and post natal neural tissues a nd functions to prevent neuronal cell death. Proc Natl Acad Sci U S A 92 4304-4308. Gonzalez-Garcia, M., Perez-Ballestero, R., Ding, L ., Duan, L., Boise, L.H., Thompson, C.B., and Nunez, G. (1994). bcl-XL is the major bcl-x mRNA form expressed during murine development and its product localizes to mitochondria. Development 120, 3033-3042. 107

PAGE 108

Goode, E.L., Ulrich, C.M., and Potter, J.D. (2002). Polymorphisms in DNA repair genes and associations with cancer risk. Cancer Epidemiol Biomarkers Prev 11, 1513-1530. Gordon, L.A., Mulligan, K.T., Maxwell-Jones, H., Adams, M., Walker, R.A., and Jones, J.L. (2003). Breast cell invasive pot ential relates to the myoep ithelial phenotype. Int J Cancer 106, 816. Grad, J.M., Zeng, X.R., and Boise, L.H. (2000). Re gulation of Bcl-xL: a lit tle bit of this and a little bit of STAT. Curr Opin Oncol 12, 543-549. Grandis, J.R., Drenning, S.D., Zeng, Q., Watkin s, S.C., Melhem, M.F., Endo, S., Johnson, D.E., Huang, L., He, Y., and Kim, J.D. (2000). Consti tutive activation of St at3 signaling abrogates apoptosis in squamous cell carcinogenes is in vivo. Proc Natl Acad Sci U S A 97, 4227-4232. Green, D.R., and Kroemer, G. (2004). The path ophysiology of mitochondria l cell death. Science 305, 626-629. Griffith, R.B., and Hancock, R. (1985). Simulta neous mainstream-sidestream smoke exposure systems I. Equipment and procedures. Toxicology 34, 123-138. Grillot, D.A., Gonzalez-Garcia, M., Ekhterae, D., Duan, L., Inohara, N., Ohta, S., Seldin, M.F., and Nunez, G. (1997). Genomic organization, pr omoter region analysis, and chromosome localization of the mous e bcl-x gene. J Immunol 158, 4750-4757. Grimm, S.L., and Rosen, J.M. (2003). The role of C/EBPbeta in mammary gland development and breast cancer. J Mammary Gland Biol Neoplasia 8, 191-204. Gross, A., McDonnell, J.M., and Korsmeyer, S.J. (1999). BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13, 1899-1911. Gu, B., Espana, L., Mendez, O., Torregrosa, A., and Sierra, A. ( 2004). Organ-selective chemoresistance in metastasis from human breas t cancer cells: inhibition of apoptosis, genetic variability and micr oenvironment at the metastatic focus. Carcinogenesis 25 2293-2301. Guengerich, F.P. (2001). Common and uncomm on cytochrome P450 reactions related to metabolism and chemical toxicity. Chem Res Toxicol 14, 611-650. Hamajima, N., Hirose, K., Tajima, K., Rohan, T., Calle, E.E., Heat h, C.W., Jr., Coates, R.J., Liff, J.M., Talamini, R., Chantarakul, N. et al. (2002). Alcohol, tobacco and breast cancer-collaborative reanalysis of i ndividual data from 53 epidemio logical studies, including 58,515 women with breast cancer and 95,067 wome n without the disease. Br J Cancer 87, 1234-1245. Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100, 57-70. He, L., Perkins, G.A., Poblenz, A.T., Harris, J.B., Hung, M., Ellisman, M.H., and Fox, D.A. (2003). Bcl-xL overexpression blocks bax-mediated mitochondrial contact site formation and apoptosis in rod photorecept ors of lead-exposed mice. Proc Natl Acad Sci U S A 100, 10221027. 108

PAGE 109

Hecht, S.S. (1999). Tobacco smoke carcinogens and lung cancer. J Natl Cancer Inst 91, 11941210. Hecht, S.S. (2002). Tobacco smoke carcinogen s and breast cancer. Environ Mol Mutagen 39, 119-126. Hecht, S.S. (2003). Tobacco carcinogens, their bi omarkers and tobacco-induced cancer. Nat Rev Cancer 3, 733-744. Heermeier, K., Benedict, M., Li, M., Furth, P., Nunez, G., and Hennighausen, L. (1996). Bax and Bcl-xs are induced at the onset of apoptosis in involuting mammary epithelial cells. Mech Dev 56, 197-207. Hirai, Y., Radisky, D., Boudreau, R., Simian, M., Stevens, M.E., Oka, Y., Takebe, K., Niwa, S., and Bissell, M.J. (2001). Epimorphin mediat es mammary luminal morphogenesis through control of C/EBPbeta. J Cell Biol 153, 785-794. Hoffmann, D., Hoffmann, I., and El-Bayoumy, K. (2001). The less harmful cigarette: a controversial issue. a tribute to Ernst L. Wynder. Chem Res Toxicol 14, 767-790. Hoffmann, D., and Wynder, E.L. (1971). A st udy of tobacco carcinogenesis. XI. Tumor initiators, tumor accelerators, and tumor promoting activity of condensate fractions. Cancer 27, 848-864. Hoffmann, D., and Wynder, E.L. (1 968). Selective reduc tion of the tumorigenicity of tobacco smoke. Experimental approaches. Natl Cancer Inst Monogr 28 151-172. Hsieh, C.C., Xiong, W., Xie, Q., Rabek, J.P., Sco tt, S.G., An, M.R., Reisner, P.D., Kuninger, D.T., and Papaconstantinou, J. (1998). Effects of age on the posttranscri ptional regulation of CCAAT/enhancer binding protei n alpha and CCAAT/enhancer bi nding protein beta isoform synthesis in control and LPStreated livers. Mol Biol Cell 9, 1479-1494. Hsu, S.Y., Kaipia, A., McGee, E., Lomeli, M., and Hsueh, A.J. (1997). Bok is a pro-apoptotic Bcl-2 protein with restricted expression in reproductive tissues and heterodimerizes with selective anti-apoptotic Bcl-2 family members. Proc Natl Acad Sci U S A 94 12401-12406. Hsu, T.C., Cherry, L.M., Bucana, C., Shirley, L.R ., and Gairola, C.G. (1991). Mitosis-arresting effects of cigarette smoke condensate on human lymphoid cell lines. Mutat Res 259, 67-78. Hsu, Y.T., and Youle, R.J. (1998). Bax in murine thymus is a soluble monomeric protein that displays differential detergent-i nduced conformations. J Biol Chem 273, 10777-10783. Hu, Y., Benedict, M.A., Wu, D., In ohara, N., and Nunez, G. (1998). Bcl-XL interacts with Apaf1 and inhibits Apaf-1-dependent caspas e-9 activation. Proc Natl Acad Sci U S A 95, 4386-4391. Huang, D.C., Adams, J.M., and Cory, S. (1998). The conserved N-terminal BH4 domain of Bcl2 homologues is essential for inhibition of a poptosis and interacti on with CED-4. EMBO J 17, 1029-1039. 109

PAGE 110

International Agency for Research on Cancer (1972-2000). IARC Monogra phs on the Evaluation of Carcinogenic Risks of Chemicals to Humans. International Agency for Research on Cancer (1985). IARC monographs on the Evaluation of Carcinogenic Risks to Humans (Lyon, France, Intern ational Agency for Canc er Research), p. 15. International Agency for Research on Cancer (2004). Tobacco smoking and tobacco smoke. In IARC Monographs on the Evaluation of the Carc inogenic Risks of Chemicals to Humans (Lyon, France). Jaattela, M., Benedict, M., Tewa ri, M., Shayman, J.A., and Dixit, V.M. (1995). Bcl-x and Bcl-2 inhibit TNF and Fas-induced apoptosis and activ ation of phospholipase A2 in breast carcinoma cells. Oncogene 10, 2297-2305. Jacobs-Helber, S.M., Wickrema, A., Birrer, M. J., and Sawyer, S.T. (1998). AP1 regulation of proliferation and initiation of apoptosis in er ythropoietin-dependent erythroid cells. Mol Cell Biol 18, 3699-3707. Jaiswal, A.S., Aneja, R., Connors, S.K., Joshi, H.C., Multani, A.S., Pathak, S., Narayan, S. (2008). Increased mitotic arrest and apoptosis of cigarette smoke condens ate-transformed versus normal human breast epithelial cells in res ponse to 9-Br-Noscapine. In unpublished data. Jalas, J.R., Hecht, S.S., and Murphy, S.E. (2005). Cytochrome P450 enzymes as catalysts of metabolism of 4-(methylnitrosamino)-1-(3-pyridyl )-1-butanone, a tobacc o specific carcinogen. Chem Res Toxicol 18, 95-110. Jeong, S.Y., Gaume, B., Lee, Y.J., Hsu, Y.T., Ryu, S.W., Yoon, S.H., a nd Youle, R.J. (2004). Bcl-x(L) sequesters its C-terminal membrane an chor in soluble, cytosolic homodimers. EMBO J 23, 2146-2155. John, E.M., and Kelsey, J.L. (1993). Radiation and other environmental exposures and breast cancer. Epidemiol Rev 15 157-162. Johnson, K.C., Hu, J., and Mao, Y. (2000). Passive and active smoking and breast cancer risk in Canada, 1994-97. Cancer Causes Control 11, 211-221. Johnson, P.F. (1993). Identification of C/EBP basic region residue s involved in DNA sequence recognition and half-site spaci ng preference. Mol Cell Biol 13 6919-6930. Joo, M., Park, G.Y., Wright, J.G., Blackwell, T.S., Atchison, M.L., and Christman, J.W. (2004). Transcriptional regulation of the cyclooxygena se-2 gene in macrophages by PU.1. J Biol Chem 279, 6658-6665. Jordan, V.C. (1993). Fourteenth Gaddum Memorial Lecture. A current view of tamoxifen for the treatment and prevention of breast cancer. Br J Pharmacol 110, 507-517. Karrison, T.G., Ferguson, D.J., and Meier, P. (1999). Dormancy of mammary carcinoma after mastectomy. J Natl Cancer Inst 91, 80-85. 110

PAGE 111

Kaufmann, S.H. (1989). Induction of endonuc leolytic DNA cleavage in human acute myelogenous leukemia cells by etoposide, camptoth ecin, and other cytotoxi c anticancer drugs: a cautionary note. Cancer Res 49, 5870-5878. Kelekar, A., and Thompson, C.B. (1998). Bcl-2-fam ily proteins: the role of the BH3 domain in apoptosis. Trends Cell Biol 8, 324-330. Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26 239-257. Kim, J.W., Tang, Q.Q., Li, X., and Lane, M.D. (2007). Effect of phosphorylation and S-S bondinduced dimerization on DNA binding and transcri ptional activation by C/EBPbeta. Proc Natl Acad Sci U S A 104, 1800-1804. Knudson, A.G., Jr. (1971). Mutati on and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 68, 820-823. Korsmeyer, S.J. (1992). Bcl-2 initiates a new cat egory of oncogenes: regulators of cell death. Blood 80, 879-886. Kowenz-Leutz, E., Twamley, G., Ansieau, S., and Leutz, A. (1994). Novel mechanism of C/EBP beta (NF-M) transcriptio nal control: activation th rough derepression. Genes Dev 8, 2781-2791. Kovacs, K.A., Steinmann, M., Magistretti, P.J., Halfon, O., and Cardinaux, J.R. (2003). CCAAT/enhancer-binding protein family member s recruit the coactivator CREB-binding protein and trigger its phosphorylation. J Biol Chem 278, 36959-36965. Kozopas, K.M., Yang, T., Buchan, H.L., Zhou, P., and Craig, R.W. (1993). MCL1, a gene expressed in programmed myeloi d cell differentiation, has sequence similarity to BCL2. Proc Natl Acad Sci U S A 90, 3516-3520. Krajewska, M., Moss, S.F., Krajewski, S., Song, K., Holt, P.R., and Reed, J.C. (1996). Elevated expression of Bcl-X and reduced Bak in primar y colorectal adenocarcinomas. Cancer Res 56, 2422-2427. Krajewski, S., Krajewska, M., Turner, B.C., Pra tt, C., Howard, B., Zapata, J.M., Frenkel, V., Robertson, S., Ionov, Y., Yamamoto, H. et al. (1999). Prognostic significance of apoptosis regulators in breast cancer. Endocr Relat Cancer 6 29-40. Kumar, R., Mandal, M., Lipton, A., Harvey, H ., and Thompson, C.B. (1996). Overexpression of HER2 modulates bcl-2, bcl-XL and tamoxifen-induced apop tosis in human MCF-7 breast cancer cells. Clin Cancer Res 2, 1215-1219. Kumar, R., Medina, D., and Suku mar, S. (1990). Activation of H -ras oncogenes in preneoplastic mouse mammary tissues. Oncogene 5, 1271-1277. 111

PAGE 112

Kundu, C.N., Balusu, R., Jaiswal, A.S., Gairola, C.G., and Narayan, S. (2007). Cigarette smoke condensate-induced level of adenomatous polyposis coli blocks long-patch base excision repair in breast epithelial cells. Oncogene 26, 1428-1438. Kuribayashi, K., Mayes, P.A., and El-Deiry, W.S. (2006). What are caspases 3 and 7 doing upstream of the mitochondria? Cancer Biol Ther 5, 763-765. Landschulz, W.H., Johnson, P.F., and McKnight S.L. (1989). The DNA binding domain of the rat liver nuclear protein C/ EBP is bipartite. Science 243, 1681-1688. Landschulz, W.H., Johnson, P.F., Adashi, E.Y ., Graves, B.J., and McKnight, S.L. (1988). Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev 2, 786-800. Landschulz, W.H., Johnson, P.F., and McKnight, S.L. (1988). The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240, 1759-1764. Lash, T.L., and Aschengrau, A. (2002). A null as sociation between active or passive cigarette smoking and breast cancer risk. Breast Cancer Res Treat 75, 181-184. Lekstrom-Himes, J., and Xanthopoulos, K.G. (1998). Biological role of the CCAAT/enhancerbinding protein family of transc ription factors. J Biol Chem 273, 28545-28548. Letai, A., Bassik, M.C., Walensky, L.D., Sorcinel li, M.D., Weiler, S., and Korsmeyer, S.J. (2002). Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2, 183-192. Li, C., Fox, C.J., Master, S.R., Bindokas, V. P., Chodosh, L.A., and Thompson, C.B. (2002). BclX(L) affects Ca(2+) homeostasis by altering expr ession of inositol 1,4,5-t risphosphate receptors. Proc Natl Acad Sci U S A 99, 9830-9835. Li, D., Wang, M., Dhingra, K., and Hittelman, W.N. (1996a). Aromatic DNA adducts in adjacent tissues of breast cancer pa tients: clues to breast cancer etiology. Cancer Res 56, 287-293. Li, H., Zhu, H., Xu, C.J., and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94 491-501. Li, M., Hu, J., Heermeier, K., Hennighause n, L., and Furth, P.A. (1996b). Apoptosis and remodeling of mammary gland tissue during involution proceeds through p53-independent pathways. Cell Growth Differ 7, 13-20. Li, M., Hu, J., Heermeier, K., Hennighausen, L., and Furth, P.A. (1996c). Expression of a viral oncoprotein during mammary gland development al ters cell fate and f unction: induction of p53independent apoptosis is followed by impaired mi lk protein production in surviving cells. Cell Growth Differ 7, 3-11. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., and Wang, X. (1997). Cytochrome c and dATP-dependent formati on of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479-489. 112

PAGE 113

Lin, E.Y., Orlofsky, A., Wang, H.G., Reed, J.C., and Prystowsky, M.B. (1996). A1, a Bcl-2 family member, prolongs cel l survival and permits my eloid differentiation. Blood 87, 983-992. Liotta, L.A. (1984). Tumor invasi on and metastases: role of the basement membrane. WarnerLambert Parke-Davis Award lecture. Am J Pathol 117, 339-348. Liu, Q.Y., and Stein, C.A. (1997). Taxol and estr amustine-induced modulation of human prostate cancer cell apoptosis via alteration in bclxL and bak expression. Clin Cancer Res 3, 2039-2046. Liu, R., Page, C., Beidler, D.R., Wicha, M.S., a nd Nunez, G. (1999). Over expression of Bcl-x(L) promotes chemotherapy resistance of mammary tumors in a syngeneic mouse model. Am J Pathol 155, 1861-1867. Lohmann, C.M., League, A.A., Clark, W.S., Lawson, D., DeRose, P.B., and Cohen, C. (2000). Bcl-2: bax and bcl-2: Bcl-x ratios by image cytometric quant itation of immunohistochemical expression in ovarian carcinoma: co rrelation with prognosis. Cytometry 42 61-66. London, E. (1992). Diphtheria toxin: membrane interaction a nd membrane translocation. Biochim Biophys Acta 1113 25-51. Luo, L.Z., Werner, K.M., Gollin, S.M., and Sa unders, W.S. (2004). Cigarette smoke induces anaphase bridges and genomic imbalances in normal cells. Mutat Res 554 375-385. MacCarthy-Morrogh, L., Wood, L., Brimmell, M., Johnson, P.W ., and Packham, G. (2000). Identification of a novel human BCL-X promoter and exon. Oncogene 19, 5534-5538. MacCarthy, J., Basara, MI, Palon, DF, Funcht, LT (1988). The role of cell adhesion proteins, laminum and fibronectiv in the movement of mali gnant and metastatic ce lls. Cancer Metastases Rev 4, 12-152. MacMahon, B. (1990). Cigarette smoking and cancer of the breast (Oxford, United Kingdom: Oxford University Press). Manna, S.K., Haridas, V., and Aggarwal, B.B. (2000). Bcl-x(L) suppresses TNF-mediated apoptosis and activation of nucl ear factor-kappaB, activation pr otein-1, and c-Jun N-terminal kinase. J Interferon Cytokine Res 20, 725-735. Martin, S.S., and Leder, P. (2001). Huma n MCF10A mammary ep ithelial cells undergo apoptosis following actin depolymerization that is independent of attachment and rescued by Bcl-2. Mol Cell Biol 21 6529-6536. Martin, S.S., and Vuori, K. (2004). Regulation of Bcl-2 proteins during anoikis and amorphosis. Biochim Biophys Acta 1692 145-157. Maung, Z.T., MacLean, F.R., Reid, M.M., Pearson, A.D., Proctor, S.J., Hamilton, P.J., and Hall, A.G. (1994). The relationship between bcl-2 expr ession and response to chemotherapy in acute leukaemia. Br J Haematol 88, 105-109. 113

PAGE 114

Maurer, C.A., Friess, H., Buhler, S.S., Wahl, B.R., Graber, H., Zimmermann, A., and Buchler, M.W. (1998). Apoptosis inhibiting f actor Bcl-xL might be the cruc ial member of the Bcl-2 gene family in colorectal cancer. Dig Dis Sci 43, 2641-2648. McClintock, B. (1942). The Fusion of Broken E nds of Chromosomes Following Nuclear Fusion. Proc Natl Acad Sci U S A 28, 458-463. McConkey, D.J., Greene, G., and Pettaway, C.A. (1996). Apoptosis resistance increases with metastatic potential in cells of the human LNCaP prostate carcinoma line. Cancer Res 56, 55945599. McCormick, J.J., and Maher, V.M. (1989). Mali gnant transformation of mammalian cells in culture, including human cells. Environ Mol Mutagen 14 Suppl 16 105-113. Medema, J.P., Scaffidi, C., Krammer, P.H., and Peter, M.E. (1998). Bcl-xL acts downstream of caspase-8 activation by the CD95 deathinducing signaling complex. J Biol Chem 273, 33883393. Mei, J., Hu, H., McEntee, M., Plummer, H., 3rd, Song, P., and Wang, H.C. (2003). Transformation of non-cancerous human breast ep ithelial cell line MC F10A by the tobaccospecific carcinogen NNK. Breast Cancer Res Treat 79, 95-105. Mendez, O., Fernandez, Y., Peinado, M.A., Mo reno, V., and Sierra, A. (2005). Anti-apoptotic proteins induce non-random genetic alterations that result in selecting br east cancer metastatic cells. Clin Exp Metastasis 22, 297-307. Mendez, O., Martin, B., Sanz, R., Aragues, R., Moreno, V., Oliva, B., Stresing, V., and Sierra, A. (2006). Underexpression of transcriptional regulators is common in metastatic breast cancer cells overexpressing Bcl-xL. Carcinogenesis 27, 1169-1179. Mensing, H., Albini, A., Krieg, T., Pontz, B.F., and Muller, P.K. (1984). Enhanced chemotaxis of tumor-derived and virus-tran sformed cells to fibronectin an d fibroblast-conditioned medium. Int J Cancer 33 43-48. Metz, R., and Ziff, E. (1991). cAMP stimulates the C/EBP-related transc ription factor rNFIL-6 to trans-locate to the nucleus and induce c-fos transcription. Genes Dev 5, 1754-1766. Milde-Langosch, K., Loning, T., and Bamber ger, A.M. (2003). Expression of the CCAAT/enhancer-binding proteins C/EBPalpha, C/EBPbeta and C/ EBPdelta in breast cancer: correlations with clinicopathologic parameters an d cell-cycle regulatory pr oteins. Breast Cancer Res Treat 79 175-185. Miller, F.R., Soule, H.D., Tait, L., Pauley, R.J ., Wolman, S.R., Dawson, P.J., and Heppner, G.H. (1993). Xenograft model of progressive human pr oliferative breast diseas e. J Natl Cancer Inst 85, 1725-1732. Mink, S., Haenig, B., and Klempnauer, K.H. (1997). Interaction and functi onal collaboration of p300 and C/EBPbeta. Mol Cell Biol 17 6609-6617. 114

PAGE 115

Minn, A.J., Velez, P., Schendel, S.L., Liang, H ., Muchmore, S.W., Fesik, S.W., Fill, M., and Thompson, C.B. (1997). Bcl-x(L) forms an ion ch annel in synthetic lipid membranes. Nature 385, 353-357. Miyashita, T., Krajewski, S., Krajewska, M., Wang, H.G., Lin, H.K., Liebermann, D.A., Hoffman, B., and Reed, J.C. (1994) Tumor suppressor p53 is a regul ator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 9, 1799-1805. Montgomery, E., Wilentz, R.E., Argani, P., Fish er, C., Hruban, R.H., Kern, S.E., and Lengauer, C. (2003). Analysis of anaphase figures in routine histologic sections distinguishes chromosomally unstable from chromosomally stable malignancies. Cancer Biol Ther 2 248-252. Motoyama, N., Wang, F., Roth, K.A ., Sawa, H., Nakayama, K., Negi shi, I., Senju, S., Zhang, Q., Fujii, S., and et al. (1995). Massive cell death of immature hematopoietic cells and neurons in Bcl-x-deficient mice. Science 267, 1506-1510. Muchmore, S.W., Sattler, M., Liang, H., Meadows, R.P., Harlan, J.E., Yoon, H.S., Nettesheim, D., Chang, B.S., Thompson, C.B., Wong, S.L. et al. (1996). X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature 381, 335-341. Muthuswamy, S.K., Li, D., Lelievre, S., Bissell, M.J., and Brugge, J.S. (2001). ErbB2, but not ErbB1, reinitiates prolifer ation and induces luminal repopulation in epithelial acini. Nat Cell Biol 3, 785-792. Nagaraj, N.S., Beckers, S., Mensah, J.K., Wa igel, S., Vigneswaran, N., and Zacharias, W. (2006). Cigarette smoke condensate induces cytochromes P450 and aldo-keto reductases in oral cancer cells. Toxicol Lett 165, 182-194. Nakajima, T., Kinoshita, S., Sasagawa, T., Sasaki, K., Naruto, M., Kishimoto, T., and Akira, S. (1993). Phosphorylation at threoni ne-235 by a ras-dependent mitoge n-activated protein kinase cascade is essential for transcription f actor NF-IL6. Proc Natl Acad Sci U S A 90, 2207-2211. Nakayama, T., Kaneko, M., Kodama, M., and Nagata, C. (1985). Cigarette smoke induces DNA single-strand breaks in human cells. Nature 314, 462-464. Narayan, S., Jaiswal, A.S., Kang, D., Srivastava P., Das, G.M., and Gairola, C.G. (2004). Cigarette smoke condensate-induced transformati on of normal human breast epithelial cells in vitro. Oncogene 23, 5880-5889. Narlikar, G.J., Fan, H.Y., and Kingston, R.E. (2002). Cooperation between complexes that regulate chromatin structur e and transcription. Cell 108, 475-487. National Cancer Institute (2007). Women' s Health Report, Fiscal Years 2005-2006. National Center for Health Statistics (2006) Health, United States, 2006 with Chartbook on Trends in the Health of Americans. (H yattsville, MD, Public Health Service). 115

PAGE 116

Nebert, D.W., Dalton, T.P., Okey, A.B., and G onzalez, F.J. (2004). Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J Biol Chem 279, 23847-23850. Newton, K., Harris, A.W., Bath, M.L., Smith, K.G., and Strasser, A. (1998). A dominant interfering mutant of FADD/MORT 1 enhances deletion of autoreact ive thymocytes and inhibits proliferation of mature T lymphocytes. EMBO J 17, 706-718. Neve, R.M., Chin, K., Fridlyand, J., Yeh, J., B aehner, F.L., Fevr, T., Clark, L., Bayani, N., Coppe, J.P., Tong, F. et al. (2006). A collection of breast ca ncer cell lines for the study of functionally distinct canc er subtypes. Cancer Cell 10 515-527. O'Connor, L., and Strasser, A. (1999). The Bcl2 protein family. Resu lts Probl Cell Differ 23, 173-207. Obana, H., Hori, S., Kashimoto, T., and Kunita, N. (1981). Polycyclic aromatic hydrocarbons in human fat and liver. Bull Environ Contam Toxicol 27, 23-27. Ochieng, J., Basolo, F., Albini, A., Melchiori, A., Watanabe, H., Elliott, J., Raz, A., Parodi, S., and Russo, J. (1991). Increased invasive, chemot actic and locomotive abilities of c-Ha-rastransformed human breast epitheli al cells. Invasion Metastasis 11, 38-47. Ogryzko, V.V., Schiltz, R.L., Russanova, V., Ho ward, B.H., and Nakatani, Y. (1996). The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87, 953-959. Olopade, O.I., Adeyanju, M.O., Safa, A.R., Hago s, F., Mick, R., Thompson, C.B., and Recant, W.M. (1997). Overexpression of BC L-x protein in primary breast cancer is associated with high tumor grade and nodal metastases. Cancer J Sci Am 3, 230-237. Oltersdorf, T., Elmore, S.W., Shoemaker, A. R., Armstrong, R.C., Augeri, D.J., Belli, B.A., Bruncko, M., Deckwerth, T.L., Dinges, J., Hajduk, P.J. et al. (2005). An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature 435, 677-681. Oltvai, Z.N., Milliman, C.L., and Korsmeyer, S.J. (1993). Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accel erates programmed cell death. Cell 74 609-619. Opferman, J.T., and Korsmeyer, S.J. (2003). Apopt osis in the development and maintenance of the immune system. Nat Immunol 4, 410-415. O'Rourke, J., Yuan, R., and DeWille, J. (1997). CCAAT/enhancer-binding protein-delta (C/EBPdelta) is induced in growth-arrested mous e mammary epithelial cells. J Biol Chem 272, 62916296. O'Rourke, J.P., Newbound, G.C., Hutt, J.A., and DeWille, J. (1999). CCAAT/enhancer-binding protein delta regulates mammary epithelial cell G0 growth arrest and a poptosis. J Biol Chem 274, 16582-16589. 116

PAGE 117

Osada, S., Yamamoto, H., Nishihara, T., and Imagawa, M. (1996). DNA binding specificity of the CCAAT/enhancer-binding protein transc ription factor family. J Biol Chem 271, 3891-3896. Osada, H., and Takahashi, T. (2002). Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer. Oncogene 21, 7421-7434. Ossipow, V., Descombes, P., and Schibler, U. (1993). CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with differe nt transcription activation potentials. Proc Natl Acad Sci U S A 90, 8219-8223. Packham, G., White, E.L., Eischen, C.M., Yang, H., Parganas, E., Ihle, J.N., Grillot, D.A., Zambetti, G.P., Nunez, G., and Cleveland, J.L. (1998). Selective regulation of Bcl-XL by a Jak kinase-dependent pathway is bypassed in mu rine hematopoietic malignancies. Genes Dev 12, 2475-2487. Palmer, J.R., and Rosenberg, L. (1993). Cigare tte smoking and the risk of breast cancer. Epidemiol Rev 15, 145-156. Pan, G., O'Rourke, K., and Dixit, V.M. (1998). Caspase-9, Bcl-XL, and Apaf-1 form a ternary complex. J Biol Chem 273, 5841-5845. Pardo, O.E., Arcaro, A., Salerno, G., Raguz, S ., Downward, J., and Seckl, M.J. (2002). Fibroblast growth factor-2 indu ces translational regulation of Bcl-XL and Bcl-2 via a MEKdependent pathway: correlation with resistance to etoposide-i nduced apoptosis. J Biol Chem 277, 12040-12046. Park, I.W., Wistuba, II, Maitra, A., Milchgrub, S., Virmani, A.K., Minna, J.D., and Gazdar, A.F. (1999). Multiple clonal abnormalities in the bronchial epithelium of patients with lung cancer. J Natl Cancer Inst 91, 1863-1868. Pause, A., Belsham, G.J., Gingras, A.C., D onze, O., Lin, T.A., Lawrence, J.C., Jr., and Sonenberg, N. (1994). Insulin-dependent stimula tion of protein synthesis by phosphorylation of a regulator of 5'-cap function. Nature 371, 762-767. Pecci, A., Viegas, L.R., Baranao, J.L., and B eato, M. (2001). Promoter choice influences alternative splicing and determines the balance of isoforms expressed from the mouse bcl-X gene. J Biol Chem 276, 21062-21069. Pelkonen, O., Vahakangas, K., and Nebert, D. W. (1980). Binding of polycyclic aromatic hydrocarbons to DNA: comparison with mutagenesis and tumorigenesis. J Toxicol Environ Health 6, 1009-1020. Perera, F.P., Estabrook, A., Hewer, A., Channi ng, K., Rundle, A., Mooney, L.A., Whyatt, R., and Phillips, D.H. (1995). Carcinogen-DNA adduct s in human breast tissue. Cancer Epidemiol Biomarkers Prev 4, 233-238. 117

PAGE 118

Peter, M.E., Kischkel, F.C., Scheuerpflug, C.G ., Medema, J.P., Debatin, K.M., and Krammer, P.H. (1997). Resistance of cultured peripheral T cells towards activation-induced cell death involves a lack of recruitment of FLICE (M ACH/caspase 8) to the CD95 death-inducing signaling complex. Eur J Immunol 27, 1207-1212. Pollman, M.J., Hall, J.L., Mann, M.J., Zhang, L., and Gibbons, G.H. (1998). Inhibition of neointimal cell bcl-x expression induces apoptosis and regression of vascular disease. Nat Med 4, 222-227. Seto, R., Lopez, A.D., Boreham, J., Thun, M., H eath, C., Jr., and Doll, R. (1996). Mortality from smoking worldwide. Br Med Bull 52 12-21. Perou, C.M., Sorlie, T., Eisen, M.B., van de Rijn M., Jeffrey, S.S., Rees, C.A., Pollack, J.R., Ross, D.T., Johnsen, H., Akslen, L.A. et al. (2000). Molecular portr aits of human breast tumours. Nature 406, 747-752. Petrakis, N.L. (1977). Breast secretory activ ity in nonlactating women, postpartum breast involution, and the epidemiology of br east cancer. Natl Cancer Inst Monogr 47, 161-164. Petrakis, N.L. (1977). Genetic factors in the etiology of br east cancer. Cancer 39, 2709-2715. Petrakis, N.L., Gruenke, L.D., Beelen, T.C., Cast agnoli, N., Jr., and Craig, J.C. (1978). Nicotine in breast fluid of nonlactating women. Science 199, 303-305. Petrakis, N.L., Maack, C.A., Lee, R.E., and Lyon, M. (1980). Mutagenic activity in nipple aspirates of human br east fluid. Cancer Res 40, 188-189. Petrakis, N.L., Mason, L., Lee, R., Sugimoto, B., Pawson, S., and Catchpool, F. (1975). Association of race, age, menopaus al status, and cerumen type with breast fluid secretion in nonlactating women, as determined by nepple aspiration. J Natl Cancer Inst 54, 829-834. Petros, A.M., Medek, A., Nettesheim, D.G., Kim, D.H., Yoon, H.S., Swift, K., Matayoshi, E.D., Oltersdorf, T., and Fesik, S.W. ( 2001). Solution structure of the an tiapoptotic protein bcl-2. Proc Natl Acad Sci U S A 98, 3012-3017. Phillips, D.H., and Garte, S. (2008). Smoking and breast cancer: is there r eally a link? Cancer Epidemiol Biomarkers Prev 17, 1-2. Piwien-Pilipuk, G., MacDougald, O., and Schwartz, J. (2002). Dual regulation of phosphorylation and dephosphorylation of C/EBPbet a modulate its transcriptional activation and DNA binding in response to growth hormone. J Biol Chem 277, 44557-44565. Plachetka, A., Chayka, O., Wilczek, C., Melnik, S., Bonifer, C., and Klempnauer, K.H. (2008). C/EBPbeta induces chromatin opening at a cell-type-specific enhancer. Mol Cell Biol 28, 21022112. 118

PAGE 119

Poli, V., Mancini, F.P., and Cortese, R. ( 1990). IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucin e zipper proteins related to C/EBP. Cell 63, 643-653. Porter, D., Lahti-Domenici, J., Keshaviah, A., Bae, Y.K., Argani, P., Marks, J., Richardson, A., Cooper, A., Strausberg, R., Riggins, G.J. et al. (2003). Molecular markers in ductal carcinoma in situ of the breast. Mol Cancer Res 1, 362-375. Poruchynsky, M.S., Wang, E.E., Rudin, C.M., Bla gosklonny, M.V., and Fojo, T. (1998). Bcl-xL is phosphorylated in malignant cells fo llowing microtubule disruption. Cancer Res 58, 33313338. Polyak, K., Hamilton, S.R., Vogelstein, B., and Kinzler, K.W. (1996). Early alteration of cellcycle-regulated gene expression in colorectal neoplasia. Am J Pathol 149, 381-387. Ramji, D.P., and Foka, P. (2002). CCAAT/enhan cer-binding proteins: st ructure, function and regulation. Biochem J 365, 561-575. Raught, B., Gingras, A.C., James, A., Medina D., Sonenberg, N., and Rosen, J.M. (1996). Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein beta isoform and up-regulation of the eukaryotic translation initia tion factor 2alpha are correlated with neoplastic transformation of mammary epithelial cells. Cancer Res 56 4382-4386. Raught, B., Liao, W.S., and Rosen, J.M. (1995) Developmentally and hormonally regulated CCAAT/enhancer-binding protein isoforms in fluence beta-casein gene expression. Mol Endocrinol 9 1223-1232. Reed, J.C. (1997). Double identity for proteins of the Bcl-2 family. Nature 387, 773-776. Repesh, L.A. (1989). A new in vitro assay for quantitating tumor cell invasion. Invasion Metastasis 9 192-208. Reynolds, P., Hurley, S., Goldberg, D.E., Anton-Culver, H., Bernstein, L., Deapen, D., HornRoss, P.L., Peel, D., Pinder, R., Ross, R.K. et al. (2004). Active smoking, household passive smoking, and breast cancer: evidence from the California Teachers Study. J Natl Cancer Inst 96, 29-37. Rithidech, K., Chen, B.T., Mauderly, J.L., Whorton, E.B., Jr., and Brooks, A.L. (1989). Cytogenetic effects of cigarette smoke on pulmona ry alveolar macrophages of the rat. Environ Mol Mutagen 14, 27-33. Robinson, G.W., Johnson, P.F., Hennighausen, L ., and Sterneck, E. (1998). The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland. Genes Dev 12, 1907-1916. 119

PAGE 120

Ronnov-Jessen, L., Petersen, O.W., and Bissell M.J. (1996). Cellular changes involved in conversion of normal to malignant breast: im portance of the stromal reaction. Physiol Rev 76, 69-125. Roth, S.Y., Denu, J.M., and Allis, C.D. (2001). Histone acetyltransferases. Annu Rev Biochem 70, 81-120. Rouayrenc, J.F., Boise, L.H., Thompson, C.B., Pr ivat, A., and Patey, G. (1995). Presence of the long and the short forms of Bcl-X in severa l human and murine tissues. C R Acad Sci III 318, 537-540. Routledge, M.N., Garner, R.C., Jenkins, D., and Cuzick, J. (1992). 32P-postla belling analysis of DNA from human tissues. Mutat Res 282, 139-145. Rubio, N., Espana, L., Fernandez, Y., Blanco, J., and Sierra, A. (2001). Metastatic behavior of human breast carcinomas overexpressing the Bc l-x(L) gene: a role in dormancy and organospecificity. Lab Invest 81, 725-734. Rudin, N. (1997). Transformation. In Dictionary of Modern Biology (Hauppauge, NY, Barrons Educational Series, Inc.), p. 371. Russo, J., and Russo, I.H. (1980). Influence of differentiation and cell kinetics on the susceptibility of the rat mammary gl and to carcinogenesis. Cancer Res 40 2677-2687. Russo, J., and Russo, I.H. (1987). Biological and molecular bases of mammary carcinogenesis. Lab Invest 57 112-137. Russo, J., and Russo, I.H. (2001). The pathway of neoplastic transformation of human breast epithelial cells. Radiat Res 155, 151-154. Russo, J., Tay, L.K., and Russo, I.H. (1982). Differentiation of the mammary gland and susceptibility to carcinogenesi s. Breast Cancer Res Treat 2, 5-73. Sarrio, D., Rodriguez-Pinilla, S.M., Hardisson, D., Cano, A., Moreno-Bueno, G., and Palacios, J. (2008). Epithelial-mesenchymal transition in brea st cancer relates to the basal-like phenotype. Cancer Res 68 989-997. Sabatakos, G., Davies, G.E., Grosse, M., Cryer, A., and Ramji, D.P. (1998). Expression of the genes encoding CCAAT-enhancer binding protein is oforms in the mouse mammary gland during lactation and invol ution. Biochem J 334 ( Pt 1) 205-210. Schendel, S.L., Xie, Z., Montal, M.O., Mats uyama, S., Montal, M., and Reed, J.C. (1997). Channel formation by antiapoptotic prot ein Bcl-2. Proc Natl Acad Sci U S A 94, 5113-5118. Schneider, T.J., Grillot, D., Foote, L.C., Nunez, G.E., and Rothstein, T.L. (1997). Bcl-x protects primary B cells against Fasmediated apoptosis. J Immunol 159, 4834-4839. 120

PAGE 121

Schott, A.F., Apel, I.J., Nunez, G., and Clarke, M.F. (1995). Bcl-XL prot ects cancer cells from p53-mediated apoptosis. Oncogene 11, 1389-1394. Schreier, M.H., and Staehelin, T. (1973). Initiation of eukaryotic protein s ynthesis: (Met-tRNA f -40S ribosome) initiation complex catalysed by purified initiation factors in the absence of mRNA. Nat New Biol 242, 35-38. Screpanti, I., Romani, L., Musiani, P., Modesti, A., Fattori, E., Lazzaro, D., Sellitto, C., Scarpa, S., Bellavia, D., Lattanzio, G., and et al. (1995) Lymphoproliferative disorder and imbalanced T-helper response in C/EBP beta-deficient mice. EMBO J 14 1932-1941. Seagroves, T.N., Krnacik, S., Raught, B., Gay, J., Burgess-Beusse, B., Darlington, G.J., and Rosen, J.M. (1998). C/EBPbeta, but not C/EBPa lpha, is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional diffe rentiation in the mouse mammary gland. Genes Dev 12, 1917-1928. Seagroves, T.N., Lydon, J.P., Hovey, R.C., Vonderhaar, B.K., and Rosen, J.M. (2000). C/EBPbeta (CCAAT/enhancer binding protein) controls cell fate determination during mammary gland development. Mol Endocrinol 14, 359-368. Seto, M., Jaeger, U., Hockett, R.D., Graninger, W., Bennett, S., Goldman, P., and Korsmeyer, S.J. (1988). Alternative promoter s and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J 7, 123-131. Sevilla, L., Aperlo, C., Dulic, V., Chambard, J. C., Boutonnet, C., Pasquier, O., Pognonec, P., and Boulukos, K.E. (1999). The Ets2 transcription factor inhibits apopt osis induced by colonystimulating factor 1 deprivation of macrophage s through a Bcl-xL-dependent mechanism. Mol Cell Biol 19 2624-2634. Shapiro, D.J., Sharp, P.A., Wahli, W.W., and Kelle r, M.J. (1988). A high-efficiency HeLa cell nuclear transcription extract. DNA 7, 47-55. Sheridan, C., Kishimoto, H., Fuchs, R.K., Mehrotra S., Bhat-Nakshatri, P., Turner, C.H., Goulet, R., Jr., Badve, S., and Nakshatri, H. (2006). CD44+/CD24breast cancer cel ls exhibit enhanced invasive properties: an early step necessary for meta stasis. Breast Cancer Res 8, R59. Shimizu, Y., Kishimoto, T., Ohtsuka, M., Kimura, F., Shimizu, H., Yoshidome, H., and Miyazaki, M. (2007). CCAAT/enhancer binding protein-beta promotes the survival of intravascular rat pancreatic tumor cells via antiapoptotic effects. Cancer Sci 98, 1706-1713. Shin, S.I., Freedman, V.H., Risser, R., and Po llack, R. (1975). Tumorigenicity of virustransformed cells in nude mice is correlated specifical ly with anchorage independent growth in vitro. Proc Natl Acad Sci U S A 72, 4435-4439. Shu, H.P., and Bymun, E.N. (1983). Systemic excr etion of benzo(a)pyrene in the control and microsomally induced rat: the infl uence of plasma lipoproteins and albumin as carrier molecules. Cancer Res 43 485-490. 121

PAGE 122

Simoes-Wust, A.P., Olie, R.A., Gautschi, O., Leec h, S.H., Haner, R., Hall, J., Fabbro, D., Stahel, R.A., and Zangemeister-Wittke, U. (2000). Bcl-xl antisense treatment induces apoptosis in breast carcinoma cells. Int J Cancer 87, 582-590. Simonian, P.L., Grillot, D.A., and Nunez, G. ( 1997). Bcl-2 and Bcl-XL can differentially block chemotherapy-induced cell death. Blood 90, 1208-1216. Sivko, G.S., and DeWille, J.W. (2004). CCAAT/Enha ncer binding protein delta (c/EBPdelta) regulation and expression in human mammary epithelia l cells: I. "Loss of f unction" alterations in the c/EBPdelta growth inhibitory pathway in breast cancer cell lines. J Cell Biochem 93, 830843. Siziopikou, K.P., and Khan, S. (2005). Correlation of HER2 gene amplification with expression of the apoptosis-suppressing genes bcl-2 and bcl-x-L in ductal carcinoma in situ of the breast. Appl Immunohistochem Mol Morphol 13, 14-18. Slamon, D.J., deKernion, J.B., Verma, I.M., a nd Cline, M.J. (1984). Expression of cellular oncogenes in human malignancies. Science 224, 256-262. Slamon, D.J., Godolphin, W., Jones, L.A., Holt, J.A., Wong, S.G., Keith, D.E., Levin, W.J., Stuart, S.G., Udove, J., Ullrich, A., and et al. (1989). Studies of the HE R-2/neu proto-oncogene in human breast and ovarian cancer. Science 244, 707-712. Smale, S.T., and Baltimore, D. (1989). The "initi ator" as a transcription control element. Cell 57, 103-113. Smith, C.J., and Hansch, C. (2000). The relative t oxicity of compounds in mainstream cigarette smoke condensate. Food Chem Toxicol 38, 637-646. Smith, C.J., Livingston, S.D., and Doolittle, D.J. (1997). An international literature survey of "IARC Group I carcinogens" reported in main stream cigarette smoke. Food Chem Toxicol 35, 1107-1130. Smith, C.J., Perfetti, T.A., Garg, R., and Hansch, C. (2003). IARC carcinogens reported in cigarette mainstream smoke and their cal culated log P values. Food Chem Toxicol 41, 807-817. Smith, C.J., Perfetti, T.A., Rumple, M.A., R odgman, A., and Doolittle D.J. (2000). "IARC group 2A Carcinogens" reported in cigarette mainstream smoke. Food Chem Toxicol 38, 371383. Smith, C.J., Perfetti, T.A., Rumple, M.A., R odgman, A., and Doolittle D.J. (2001). "IARC Group 2B carcinogens" reported in cigarette mainstream smoke. Food Chem Toxicol 39, 183205. Smith, H.S., Wolman, S.R., and Hackett, A.J. (1 984). The biology of breast cancer at the cellular level. Biochim Biophys Acta 738, 103-123. 122

PAGE 123

Sorlie, T., Perou, C.M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., Hastie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S. et al. (2001). Gene expression patterns of breas t carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 98, 1086910874. Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H., Pesich, R., Geisler, S. et al. (2003). Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 100, 8418-8423. Soule, H.D., Maloney, T.M., Wolman, S.R., Pe terson, W.D., Jr., Brenz, R., McGrath, C.M., Russo, J., Pauley, R.J., Jones, R.F., and Brooks, S.C. (1990). Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res 50, 60756086. Srinivasan, A., Li, F., Wong, A., Kodandapani, L., Smidt, R., Jr., Krebs, J.F., Fritz, L.C., Wu, J.C., and Tomaselli, K.J. (1998). Bcl-xL functions downstream of caspase-8 to inhibit Fasand tumor necrosis factor receptor 1-induced apoptos is of MCF7 breast carcinoma cells. J Biol Chem 273, 4523-4529. Stern, D.F., Heffernan, P.A., and Weinberg, R.A. (1986). p185, a product of the neu protooncogene, is a receptorlike protein associated with tyrosine kinase activity. Mol Cell Biol 6, 1729-1740. Sterneck, E., Tessarollo, L., and Johnson, P.F. (1997) An essential role for C/EBPbeta in female reproduction. Genes Dev 11, 2153-2162. Stingl, J., and Caldas, C. (2007). Molecular hete rogeneity of breast carci nomas and the cancer stem cell hypothesis. Nat Rev Cancer 7, 791-799. Strasser, A., Harris, A.W., Huang, D.C., Kram mer, P.H., and Cory, S. (1995). Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J 14, 6136-6147. Streuli, C.H., and Gilmore, A.P. (1999). Adhe sion-mediated signaling in the regulation of mammary epithelial cell survival J Mammary Gla nd Biol Neoplasia 4, 183-191. Sullivan, S. (1984). The Reference and Research Ci garette Series (Lexington, KY: University of Kentucky Printing Services). Sundfeldt, K., Ivarsson, K., Carlsson, M., Ener back, S., Janson, P.O., Brannstrom, M., and Hedin, L. (1999). The expression of CCAAT/enhancer binding pr otein (C/EBP) in the human ovary in vivo: specific increase in C/EBPbeta during epithelial tumour progression. Br J Cancer 79, 1240-1248. Tait, L., Soule, H.D., and Russo, J. (1990) Ultrastructural and immunocytochemical characterization of an immortalized human breast epithelial cell li ne, MCF-10. Cancer Res 50, 6087-6094. 123

PAGE 124

Tahirov, T.H., Inoue-Bungo, T., Morii, H., Fujikaw a, A., Sasaki, M., Kimura, K., Shiina, M., Sato, K., Kumasaka, T., Yamamoto, M., et al. (2001). Structural analys es of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell 104, 755-767. Tahirov, T.H., Sato, K., Ichikawa-Iwata, E., Sasaki, M., Inoue-Bungo, T., Shiina, M., Kimura, K., Takata, S., Fujikawa, A., Morii, H. et al. (2002). Mechanism of c-Myb-C/EBP beta cooperation from separated sites on a promoter. Cell 108, 57-70. Takehara, T., and Takahashi, H. (2003). Suppression of Bcl-xL deamidation in human hepatocellular carcinomas. Cancer Res 63, 3054-3057. Tanaka, T., Akira, S., Yoshida, K., Umemoto, M., Yoneda, Y., Shirafuji, N., Fujiwara, H., Suematsu, S., Yoshida, N., and Kishimoto, T. (1995). Targeted disruption of the NF-IL6 gene discloses its essential role in bacteria kill ing and tumor cytotoxicity by macrophages. Cell 80, 353-361. Tanaka, T., Yoshida, N., Kishimoto, T., and Akira, S. (1997). Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J 16, 7432-7443. Tang, Q.Q., Gronborg, M., Huang, H., Kim, J.W ., Otto, T.C., Pandey, A., and Lane, M.D. (2005). Sequential phosphorylation of CCAAT enhancer-binding protein beta by MAPK and glycogen synthase kinase 3beta is required for adipogenesis. Proc Natl Acad Sci U S A 102, 9766-9771. Tanko, L.B., and Christiansen, C. (2004). An update on the antiestrogenic effect of smoking: a literature review with implications fo r researchers and practitioners. Menopause 11, 104-109. Taylor, J.K., Zhang, Q.Q., Wyatt, J.R., and D ean, N.M. (1999). Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat Biotechnol 17, 1097-1100. Taylor-Papadimitriou, J., Stampfer, M., Bartek, J., Lewis, A., Boshell, M., Lane, E.B., and Leigh, I.M. (1989). Keratin expression in human mammary epithelial ce lls cultured from normal and malignant tissue: relation to in vivo phe notypes and influence of medium. J Cell Sci 94 ( Pt 3) 403-413. Terry, P.D., Miller, A.B., and Rohan, T.E. ( 2002). Cigarette smoking and breast cancer risk: a long latency period? Int J Cancer 100, 723-728. Terry, P.D., and Rohan, T.E. (2002). Cigarette smoking and the risk of breast cancer in women: a review of the literature. Cancer Epidemiol Biomarkers Prev 11 953-971. Thiery, J.P. (2003). Epithelial-mesenchymal tran sitions in development and pathologies. Curr Opin Cell Biol 15, 740-746. Thompson, C.B. (1995). Apoptosis in the pathog enesis and treatment of disease. Science 267, 1456-1462. 124

PAGE 125

Timchenko, L.T., Iakova, P., Welm, A.L., Cai, Z. J., and Timchenko, N.A. (2002). Calreticulin interacts with C/EBPalpha and C/EBPbeta mRNAs and represses translation of C/EBP proteins. Mol Cell Biol 22, 7242-7257. Tomlinson, I.P. (2001). Mutations in normal breas t tissue and breast tumours. Breast Cancer Res 3, 299-303. Trautwein, C., Caelles, C., van der Geer, P., Hunter, T., Kari n, M., and Chojkier, M. (1993). Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364, 544-547. Tsujimoto, Y., Finger, L.R., Yunis, J., Nowell, P.C., and Croce, C.M. (1984). Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science 226, 1097-1099. Tsukahara, T., Kannagi, M., Ohashi T., Kato, H., Arai, M., Nunez, G., Iwanaga, Y., Yamamoto, N., Ohtani, K., Nakamura, M., and Fujii, M. (19 99). Induction of Bcl-x(L) expression by human T-cell leukemia virus type 1 Tax through NF-kappa B in apoptosis-resistan t T-cell transfectants with Tax. J Virol 73, 7981-7987 U.S. Department of Human and Health Se rvices (1994). Preventing Tobacco use among yound people: A report of hte surgeon general. U.S. Department of Human and Health Servic es (2004). The Health Consequences of Smoking A Report of the Surgeon General. (Rockville, MD, Public Health Service, Centers for Disease Control and Prevention, Center fo r Chronic Disease Prevention a nd Health Promotion, Office on Smoking and Health). U.S. Department of Human and Health Se rvices (2006). The Health Consequences of Involuntary Exposure to Tobacco Smoke: A Repor t of the Surgeon General. (Rockville, MD, U.S. Department of Health and Human Services Public Health Service, Centers for Disease Control and Prevention, National Center for Chronic Disease Pr evention and Health Promotion, Office on Smoking and Health). Vander Heiden, M.G., Chandel, N.S., Schumack er, P.T., and Thompson, C.B. (1999). Bcl-xL prevents cell death following growth factor w ithdrawal by facilitating mitochondrial ATP/ADP exchange. Mol Cell 3, 159-167. Vander Heiden, M.G., Chandel, N.S., Williamson, E.K., Schumacker, P.T., and Thompson, C.B. (1997). Bcl-xL regulates the membrane potential and volume homeostasi s of mitochondria. Cell 91, 627-637. Van Dyke, M.W., Roeder, R.G., and Sawadogo, M. (1988). Physical analysis of transcription preinitiation complex assembly on a class II gene promoter. Science 241, 1335-1338. Vaux, D.L., Cory, S., and Adams, J.M. (1988). Bc l-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442. 125

PAGE 126

Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid, G.E., Moritz, R.L., Simpson, R.J., and Vaux, D.L. (2000). Identification of DIABLO a mammalian protein that promotes apoptosis by binding to an d antagonizing IAP proteins. Cell 102, 43-53. Villagra, A., Cruzat, F., Carvallo, L., Paredes, R. Olate, J., van Wijnen, A.J., Stein, G.S., Lian, J.B., Stein, J.L., Imbalzano, A.N., and Mont ecino, M. (2006). Chromatin remodeling and transcriptional activity of th e bone-specific osteocalcin gene require CCAAT/enhancer-binding protein beta-dependent recruitmen t of SWI/SNF activity. J Biol Chem 281, 22695-22706. Vineis, P., Veglia, F., Benhamou, S., Butkiewicz, D., Cascorbi, I., Clapper, M.L., Dolzan, V., Haugen, A., Hirvonen, A., Ingelman-Sundberg, M. et al. (2003). CYP1A1 T3801 C polymorphism and lung cancer: a pooled analysis of 2451 cases and 3358 controls. Int J Cancer 104, 650-657. Vinson, C.R., Hai, T., and Boyd, S.M. (1993). Dimerization specificity of the leucine zippercontaining bZIP motif on DNA binding: pr ediction and rational design. Genes Dev 7, 10471058. Vinson, C.R., Sigler, P.B., and McKnight, S.L. (1989). Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science 246, 911-916. Vogelstein, B., Fearon, E.R., Hamilton, S.R., Kern, S.E., Preisinger, A.C., Leppert, M., Nakamura, Y., White, R., Smits, A.M., and Bos, J.L. (1988). Genetic alterations during colorectal-tumor development. N Engl J Med 319, 525-532. Wang, T.C., Cardiff, R.D., Zukerberg, L., Lees E., Arnold, A., and Schmidt, E.V. (1994). Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 369, 669671. Watson, D.K., McWilliams, M.J., Lapis, P., Lautenberger, J.A., Schweinfest, C.W., and Papas, T.S. (1988). Mammalian ets-1 and ets-2 genes encode highly conser ved proteins. Proc Natl Acad Sci U S A 85 7862-7866. Watson, D.K., McWilliams-Smith, M.J., Nunn, M.F., Duesberg, P.H., O'Brien, S.J., and Papas, T.S. (1985). The ets sequence from the transformi ng gene of avian erythroblastosis virus, E26, has unique domains on human chromosomes 11 and 21: both loci are tran scriptionally active. Proc Natl Acad Sci U S A 82, 7294-7298. Weintraub, S.J., Manson, S.R., and Deverman, B.E. (2004). Resistance to antineoplastic therapy. The oncogenic tyrosine kinase -Bcl-x(L) axis. Cancer Cell 5, 3-4. Weis, L., and Reinberg, D. ( 1992). Transcription by RNA polym erase II: initiator-directed formation of transcription-co mpetent complexes. FASEB J 6, 3300-3309. Wells, A. (2000). Smoking and cancer in Women. Journal of Women's Cancer 2, 55-66. 126

PAGE 127

Welm, A.L., Timchenko, N.A., and Darlington, G.J. (1999). C/EBPalpha regulates generation of C/EBPbeta isoforms through activation of sp ecific proteolytic cleavage. Mol Cell Biol 19, 16951704. Westermarck, J., and Kahari, V.M. (1999). Regulati on of matrix metalloproteinase expression in tumor invasion. FASEB J 13, 781-792. Whitehead, J.K., and Rothwell, K. (1969). The m ouse skin carcinogenicity of cigarette smoke condensate: fractionated by solven t partition methods. Br J Cancer 23, 840-857. Williams, S.C., Baer, M., Dillner, A.J., and Johns on, P.F. (1995). CRP2 (C/EBP beta) contains a bipartite regulatory domain that controls transcriptional activa tion, DNA binding and cell specificity. EMBO J 14, 3170-3183. Williams, S.C., Cantwell, C.A., and Johnson, P.F. (1991). A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro. Genes Dev 5, 1553-1567. Wistuba, II, Mao, L., and Gazdar, A.F. (2002) Smoking molecular damage in bronchial epithelium. Oncogene 21, 7298-7306. Wright, C., Nicholson, S., Angus, B., Sainsbury, J.R., Farndon, J., Cairns, J., Harris, A.L., and Horne, C.H. (1992). Relationshi p between c-erbB-2 protein product expression and response to endocrine therapy in advanced breast cancer. Br J Cancer 65, 118-121. Wynder, E., Hoffman, D (1967). Tobacco and Tobacco Smoke (New York, NY: Academic Press). Wynder, E.L., and Wright, G. (1957). A study of tobacco carcinogenesis. I. The primary fractions. Cancer 10, 255-271. Xiong, W., Hsieh, C.C., Kurtz, A.J., Rabek, J.P., and Papaconstantinou, J. (2001). Regulation of CCAAT/enhancer-binding protein-be ta isoform synthesis by alternative translational initiation at multiple AUG start sites. Nucleic Acids Res 29, 3087-3098. Xu, M., Nie, L., Kim, S.H., and Sun, X.H. ( 2003). STAT5-induced Id-1 transcription involves recruitment of HDAC1 and deacetylation of C/EBPbeta. EMBO J 22, 893-904. Yang, X., Hao, Y., Pater, M.M., Tang, S.C., and Pater, A. (1998). Enhanced expression of antiapoptotic proteins in human papillomavirus-i mmortalized and cigarette smoke condensatetransformed human endocervical cells: correlatio n with resistance to apoptosis induced by DNA damage. Mol Carcinog 22 95-101. Yang, X., Nakao, Y., Pater, M.M., Tang, S.C., and Pater, A. (1997). Expression of cellular genes in HPV16-immortalized and cigarette smoke co ndensate-transformed human endocervical cells. J Cell Biochem 66, 309-321. 127

PAGE 128

Yefenof, E., Picker, L.J., Scheuermann, R.H., Tuck er, T.F., Vitetta, E.S., and Uhr, J.W. (1993). Cancer dormancy: isolation and characterization of dormant lymphoma cells. Proc Natl Acad Sci U S A 90, 1829-1833. Yin, X.M., Oltvai, Z.N., and Korsmeyer, S.J. (1994). BH1 and BH2 domains of Bcl-2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature 369, 321-323. Zahnow, C.A. (2002). CCAAT/enhancer binding pr oteins in normal mammary development and breast cancer. Breast Cancer Res 4, 113-121. Zahnow, C.A., Cardiff, R.D., Laucirica, R., Me dina, D., and Rosen, J.M. (2001). A role for CCAAT/enhancer binding protein be ta-liver-enriched i nhibitory protein in mammary epithelial cell proliferation. Cancer Res 61, 261-269. Zahnow, C.A., Younes, P., Laucirica, R., and Ro sen, J.M. (1997). Overexpression of C/EBPbetaLIP, a naturally occurring, domina nt-negative transcription factor, in human breast cancer. J Natl Cancer Inst 89 1887-1891. Zajchowski, D.A., Bartholdi, M.F., Gong, Y., Webs ter, L., Liu, H.L., Munishkin, A., Beauheim, C., Harvey, S., Ethier, S.P., and Johnson, P.H. (2001). Identification of gene expression profiles that predict the aggressive behavior of breast cancer cells. Cancer Res 61, 5168-5178. Zha, J., Harada, H., Yang, E., Jockel, J., and Korsmeyer, S.J. (1996). Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell 87, 619-628. Zhao, R., Yang, F.T., and Alexander, D.R. (2004) An oncogenic tyrosine kinase inhibits DNA repair and DNA-damage-induced Bcl-xL deamid ation in T cell transformation. Cancer Cell 5, 37-49. Zhivotovsky, B., and Kroemer, G. (2004). Apoptos is and genomic instability. Nat Rev Mol Cell Biol 5, 752-762. Zhou, H., Hou, Q., Chai, Y., and Hsu, Y.T. (2005). Distinct domains of Bc l-XL are involved in Bax and Bad antagonism and in a poptosis inhibition. Exp Cell Res 309, 316-328. Zhu, C., Mills, K.D., Ferguson, D.O., Lee, C., Ma nis, J., Fleming, J., Gao, Y., Morton, C.C., and Alt, F.W. (2002). Unrepaired DNA breaks in p5 3-deficient cells lead to oncogenic gene amplification subsequent to translocations. Cell 109 811-821. Zimmermann, A., and Keller, H.U. (1987). Locomotion of tumor cells as an element of invasion and metastasis. Biomed Pharmacother 41, 337-344. Zong, W.X., Lindsten, T., Ross, A.J., MacGregor G.R., and Thompson, C.B. (2001). BH3-only proteins that bind pro-survival Bcl-2 family members fail to indu ce apoptosis in the absence of Bax and Bak. Genes Dev 15, 1481-1486. 128

PAGE 129

Zoratti, M., and Szabo, I. (1995). The mitochondrial permeability transition. Biochim Biophys Acta 1241, 139-176. 129

PAGE 130

BIOGRAPHICAL SKETCH The product of a military family, Shahnjay la Connors was born in Siegen, (West) Germany. She is the only daughter of Rodney and Sharon Connors. While attending Warner Robins High School, Shahnjayla was an active me mber in Mu Alpha Theta Math Club and the Beta Club. She was also active in Girl Scouting and earned her Girl Scout Silver Award and Gold Award. After graduating from high school in 1999, Sha hnjayla pursued a B.S. in biology from Georgia Southern University, where she was a member of the University Honors Program. The end of her sophomore year, Shahnjayla was named a Ronald E. McNair Postbaccalaureate Achievement Program Scholar and was exposed to her first resear ch experience. She completed a summer project on the population genetics of Ixodes scapularis the tick vector of Lyme disease. This research project confirmed her love of biological research and she participated in several other research projects during her undergraduate studies. Shahnjayla continued her study of Ixodes scapularis and identified spiroplasma bacter ia from the gut of horseflies as independent study projects. She also traveled to Io wa and participated in a project characterizing programmed cell death in the neurons of the nematode, Caenorhabditis elegans She was able to present her work two national McNair conferen ces and several research symposiums at her college. After graduating from Georgia Southern in May of 2003, Shahnjayla entered the Interdisciplinary Program in Biomedical Scienc es (IDP) at the University of Florida and completed her doctoral resear ch on the upregulation of bcl-xl in human breast epithelial cells treated with cigarette smoke c ondensate in the laboratory of Satya Narayan, Ph.D. She has presented her doctoral research at several de partmental and national meetings. During her doctoral studies, she also served as a McNair Peer Advisor for the University of Florida. 130

PAGE 131

131 Shahnjayla received her Ph.D. in Medical Sc iences in August 2008. She is currently a postdoctoral associate working in the area of cancer disparities and pursuing a Master in Public Health.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101220_AAAAJG INGEST_TIME 2010-12-21T03:02:25Z PACKAGE UFE0022566_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 360752 DFID F20101220_AACPUJ ORIGIN DEPOSITOR PATH connors_s_Page_077.jp2 GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
7f940fa9c667a196ca0526131de70f9b
SHA-1
26a31b65e5e1dbf2378ebb043d589509d0226477
1051986 F20101220_AACPTU connors_s_Page_052.jp2
746a0d477dc8a8584d5b0701cc0a99da
79fe6b319022a5019dac9c372ff7927741738c07
14830 F20101220_AACQAD connors_s_Page_077.pro
b79f019b041e8a824391cb921a6496df
b6ed9b1ebffe4c2957c03c870e8727b1a129868c
1051972 F20101220_AACPTV connors_s_Page_053.jp2
d71c21abef66cd99855d774e3df5d798
9072041d3cd8d505cd3dfdc121acbd9083db18ba
19492 F20101220_AACQAE connors_s_Page_079.pro
7d251d617e287a73feab1362382c319a
8a02389a637e07286fb76924bef8ba4f267583de
547432 F20101220_AACPUK connors_s_Page_079.jp2
731a3dcfe1e752cffb5fbd833b847079
39a66e1300c519739aa707ed7cdd49073a5cef8e
1051969 F20101220_AACPTW connors_s_Page_054.jp2
6d0e8dc80457a1c44e73192d238fffc0
043d17420d3f1baac9f0c44da6ddf7ba13da7740
55995 F20101220_AACQAF connors_s_Page_081.pro
a84b09db8a1cb45729c82d40b2012efe
2b85a1b7971d9c0f7a2f47457e03f72365f62889
1051968 F20101220_AACPVA connors_s_Page_109.jp2
a8b4a6ef927aa7208b29c74278cc735f
41631f508596e004af2c2e2d46209189469eb0b8
1051985 F20101220_AACPUL connors_s_Page_082.jp2
dd3f0bdfd19fade5a52251d79163c9ce
fe16f92b9239e030406ffc19b40d28dbcde77152
1051949 F20101220_AACPTX connors_s_Page_057.jp2
8e270e700b3c1f97e023237f477bcaf4
4fa5a0513bb0d261b29e89cf3a6d17600b380fd5
58807 F20101220_AACQAG connors_s_Page_083.pro
098a7e471505a58362ce56a6e18f45bc
fada7217b3a73fc93c4bb89116af5e4026ba76cf
1051959 F20101220_AACPVB connors_s_Page_113.jp2
5191c7ca7b9d188733772d1990a85bb3
fe058545eb36ce6b6d5cf7a923188f5b8a84b0df
1051966 F20101220_AACPUM connors_s_Page_085.jp2
6fa03ce0f36c66fbbd8db29fdeeeda95
d108e1d35c2d4a25ed4058661e74514b3f286b3d
F20101220_AACPTY connors_s_Page_058.jp2
35ca4a77de76865845e5de3af52ecf15
8e29268e4a0bb6b9c7f4de267727da7a600cdb16
54886 F20101220_AACQAH connors_s_Page_086.pro
3b76cb49778796e6bf17fd26b9ebd9ca
a197b6885de68aaf140bd4d059e21cd91c0f093f
1051958 F20101220_AACPVC connors_s_Page_115.jp2
90cb24310f8696fc52e535b55e461978
57289a18094056e273ff6de04977397ffcea434c
F20101220_AACPUN connors_s_Page_087.jp2
cb4de82dfac40a4b053d3f03ac0d73c7
a894a5055e41b5e11699bf24e720a70c6007eaf0
1051983 F20101220_AACPTZ connors_s_Page_060.jp2
b672c1dcd10faab63a1198a0fc871931
6bdbc5c88e75584f2e5ea71561ed81097a201cb5
56862 F20101220_AACQAI connors_s_Page_087.pro
06ac6ca59447a8770ce1681c691c119a
02b47d2529a39818d853dc4a11ef6cd6e6e0d109
1051962 F20101220_AACPVD connors_s_Page_116.jp2
680126c6b905472c09ce37ccf4a35870
a0e3457b189382a6441c95a77b063d24eb321866
F20101220_AACPUO connors_s_Page_090.jp2
16356d391da825d5aa827713f35d845f
19d3bd408fafa9664486f3be47f70653dd87ec2d
57178 F20101220_AACQAJ connors_s_Page_089.pro
45ca5db3f8ce73f044353a7f995d2805
a1ead7dd30771c32e2afb927a699dbeed6e02dfb
1051944 F20101220_AACPVE connors_s_Page_118.jp2
ffe82716e161875091b7b510ae48961c
86da16993fe3ba9a55499c2598d9ca208e366472
1051950 F20101220_AACPUP connors_s_Page_093.jp2
ddda85216a93fc96a5ca1b514ec1629a
f28ded78df5cbcac8d63f01e43c285e91dd3f7c3
51627 F20101220_AACQAK connors_s_Page_090.pro
07a3467d664d0224e63edffc876b8cbb
49a4b993d632808a79e322d9f684a211555b7e7f
1051952 F20101220_AACPVF connors_s_Page_119.jp2
ac782a5941301af7bdb9be4bb286187d
e3b5071ef4c15060fabcd03ec50289b86633ec90
1051923 F20101220_AACPUQ connors_s_Page_095.jp2
8bf3c7aec0b2a2f3785a092b10ff2d46
132afc16a9a757ce189cd7b203d5e2083d9298e5
54158 F20101220_AACQAL connors_s_Page_092.pro
9d68ddc2cc69455c9323383bb3331e96
579142154dc131a115afd6f9ebeeff0e70e3ffd0
1051984 F20101220_AACPVG connors_s_Page_120.jp2
ac99e1634d252fb3c474c6bad962fb63
05d4d0b2f4a4108eda42286ebd7c1a11d8b2ff44
816766 F20101220_AACPUR connors_s_Page_096.jp2
e6ace45aacb0acb6a79126647347843c
7bff4ac3bb274ea27623538cc74febc0da6baa47
68189 F20101220_AACQBA connors_s_Page_113.pro
e193e03e3b2ea349b5054038aee1f7a3
037cc620365f07095159cd6aad688a927fd2b9d5
55063 F20101220_AACQAM connors_s_Page_094.pro
5deaced236aac6e369157bdd779d8409
7ad17de431ce0e5f60ea376cf6ad2b36c0b0b705
F20101220_AACPVH connors_s_Page_121.jp2
54001f66dd454905c456bda507b104a6
b4874d53b2ac02f5b33aabce6d4ae432182199d6
630777 F20101220_AACPUS connors_s_Page_097.jp2
a597a0c28dfc40f52e4e17c326089090
fb1fc8e20f21b9541b9a1b6aace8761aedaa515f
70723 F20101220_AACQBB connors_s_Page_114.pro
b9c38d5dcadf101b2218014c6645cf73
2bb6d2b972770e76e30fa08f7ef25023052b5f75
53350 F20101220_AACQAN connors_s_Page_095.pro
cb315661923363a62bcbea9621689522
91da3140bdffbb1aea491fbfc25f40ecb7caf8d0
1051982 F20101220_AACPVI connors_s_Page_122.jp2
fd017fe43fbca7273dedcf23c93f2c8e
e9aace64831100faf2ef8f59fe3abf6c824819eb
1051909 F20101220_AACPUT connors_s_Page_099.jp2
8b0ca619b83bc27bb7522953fd131e3e
8fe3bd8e001ee2170d5cb07cc0637a5b579d4a6b
71037 F20101220_AACQBC connors_s_Page_115.pro
3a25fc88d4e62ad0f0b823a58c4e61d7
093794d8a174c969dd336985f37d8edb6f501fc5
35615 F20101220_AACQAO connors_s_Page_096.pro
76060468cb7bdf8a291ce6dabd96918e
98bf704d3a843aab71da56761e235a9f9548cbb6
1051941 F20101220_AACPVJ connors_s_Page_124.jp2
e2d489017fdb3452e8a50cce2e22b43c
e8cc5814dac1e03e10f38b4b6da0f05500004b94
1051960 F20101220_AACPUU connors_s_Page_100.jp2
def241fda209ba0a7c5b77d17ec687de
6e047717c86467d7d688db922a3d46d731ea6175
74802 F20101220_AACQBD connors_s_Page_121.pro
bf66c6acd27959ce7e866c023a679a1e
37dd491f8b991ec9214776d742f7bd45c381afb2
27805 F20101220_AACQAP connors_s_Page_097.pro
beacffcc520dc6260ef61f950d61fad4
da7b21428c2fb65cb9a24005e38e31805d6ecc06
1051963 F20101220_AACPVK connors_s_Page_126.jp2
ffb7da67ad09e64b275fde01bd59cdc1
0d333b2468c2b1934e968d092426984d5d35691d
1051973 F20101220_AACPUV connors_s_Page_101.jp2
5e172d8ae2ef08b31c759fde8b116b67
76294647e3e94f0d23dd2ab325158f889907b835
68310 F20101220_AACQBE connors_s_Page_123.pro
008b371a08b8ad11179e908996769e4e
45de85172fc3721ccc40b23ee22a29efcbbd80ce
68367 F20101220_AACQAQ connors_s_Page_099.pro
aabf4dccbc2e42f157a09d83a837dee5
6baa1df92f18609c4e63e46a004c65713ef70cd2
1051955 F20101220_AACPUW connors_s_Page_102.jp2
0beae58d4de45aeb1dd98e1f3f69d1d9
a33e0cb907a2c4688a635da3adeb0eb66d4884a6
69489 F20101220_AACQBF connors_s_Page_124.pro
93633cb63df42b501f8521f3ae119869
c7f1203e7083be5c849b909080fb9423a2302de7
71048 F20101220_AACQAR connors_s_Page_101.pro
970f08390b8922a2f0deb4d361121823
dba3a7d0596b4639e9ebe320b112ecfc2241c608
1051977 F20101220_AACPVL connors_s_Page_130.jp2
eeb6777da2b08c6bd6352e3f39b6dbf7
314084f42b63d1b87d8811fb7a477b169f795edb
1051967 F20101220_AACPUX connors_s_Page_103.jp2
ea1efcbaf2ae9b044b1091c8425ded1c
fb6ec6dfeda70a48397bcb3fb11c711a887e0458
69370 F20101220_AACQBG connors_s_Page_125.pro
09418ba45e75c1d4003082a5ed18fd61
e5d360c905233d668ae1d366bd417f8ef6a91786
25271604 F20101220_AACPWA connors_s_Page_035.tif
7fb166ddce9c61d0f5b18987a27d09f0
2337f956638ade65947245362018874e8645b3c0
67018 F20101220_AACQAS connors_s_Page_104.pro
c3e9793cd64fdf47bd8b213300aa67df
fe870ccdbc9b61aa83e6a82db4742ea6ac07de67
F20101220_AACPVM connors_s_Page_002.tif
ca226052a41d1cc9d5f3df160bbf3591
3437883f5dfa28d4f1785d3ad126d6bf47759b14
F20101220_AACPUY connors_s_Page_106.jp2
5157f074f14ab3748ba32ba9770b0577
0ceac234239a5de42fc683d1588d0f441bcb3612
64977 F20101220_AACQBH connors_s_Page_127.pro
ba9e5ed6aa5cbb00968179f55ba99559
e4baf7d071a24ec473e2b51284d147903f07ab6c
F20101220_AACPWB connors_s_Page_037.tif
2fff6f7ab12c9981493d5cdc21d73622
7103357f2db020b911bcb1074b6248b6265cb768
71718 F20101220_AACQAT connors_s_Page_105.pro
ff4e4ae93760d96aadf7384e5c4bb0c3
005da6af87d9f9556620b93140aa7e5122298238
F20101220_AACPVN connors_s_Page_004.tif
051f83d92acd694e72cd5c0256abaf65
2adddf0a1048a94c4244c24165fe21341c47d26a
1051946 F20101220_AACPUZ connors_s_Page_107.jp2
315369a4c964868637ec99f3d4418a2c
5d9a9b5ea882976c12beab334e86ec39db99d7fe
3238 F20101220_AACQBI connors_s_Page_129.pro
e0d44873597004f950dbd82fe7d99de7
969b0f574bc76f9e2dbd6b26d409cc03e33bd8b5
F20101220_AACPWC connors_s_Page_041.tif
b53699ccf829b089a7e412ce0d48a10b
884fded9458e86686dc79f1aa98a559b5f8e411d
69465 F20101220_AACQAU connors_s_Page_107.pro
e7f10fdc35eb304f1fd3d687df81422c
5ad49c843a607820def85a19c9c3db9a390b4837
F20101220_AACPVO connors_s_Page_006.tif
dc3ff796fde21f949c91ee76556ec145
c009d7d193a93bcf4dcd5109362ad02c3cc41d43
5255 F20101220_AACQBJ connors_s_Page_131.pro
3820ae09790df79ccab974775b5eca31
6e04d2c0d56fc972a41050b796280f2326a1a69e
F20101220_AACPWD connors_s_Page_042.tif
24cb4d5d6d42266c614fe778dbb04cb4
b4bdbe25ff97c69a55a070614adcb8cda42d3051
F20101220_AACPVP connors_s_Page_007.tif
f71cd3aa5f9526e6ceabf12164d0f869
366f17fc8e2a275a2149c2a2502b01b432f61bc7
1038 F20101220_AACQBK connors_s_Page_004.txt
49f8b220814827e224ebd1432cce2e1a
256186f075587695163ddd8fafa85756f63dd76f
F20101220_AACPWE connors_s_Page_047.tif
e7b92b61497e35e47623ffe45a90c012
107b74b174a7f76c97c9430bfad69b10734112a2
72716 F20101220_AACQAV connors_s_Page_108.pro
890eecba2925b20711fba1356ce33773
e31ab6ee188fc821fb1ba6106b750366764ff217
F20101220_AACPVQ connors_s_Page_008.tif
529c9920eff8060fc58ecda213878218
619df8c4ac1d8b81daf272384ccf6e292a04338d
2542 F20101220_AACQBL connors_s_Page_006.txt
ef600ecefb7a66833c553ab88cbec139
346cf09ad3cc7a5c91eb167dd8058a4cdad1d3f4
F20101220_AACPWF connors_s_Page_048.tif
ec28c8b12ccedfb6085f1680d4f762b4
3d55ac29a44ad55f7024e77c22e1ec9846f37124
69979 F20101220_AACQAW connors_s_Page_109.pro
241089b320a35c452a9690aa80cbccb7
6b6a6127d6056560a2793085701589b3c01b249f
2132 F20101220_AACQCA connors_s_Page_030.txt
2f57c10892f380006fa8f37866368102
c233e1b8cbb6a75ec969e15eb7248b600e606be8
1905 F20101220_AACQBM connors_s_Page_008.txt
7b9d801abe2460c6ab8e5ad40d5d28d0
8899c516ebede1bfe3f4194244d86c9fa6105adb
F20101220_AACPWG connors_s_Page_049.tif
0f41f888e739733363f4c316cbea238a
6d59d99db08df371647ff94527e5f5fb0931371c
68718 F20101220_AACQAX connors_s_Page_110.pro
580fd60e24e5f5b252c61182cd850482
3361f5de2aba8d0716b28e87620c7cba35aa976d
F20101220_AACPVR connors_s_Page_010.tif
8101f22c9e4fe9658bd8597accd6411f
2f190a190df7d4841d68a1fe3dbb5f78f4c51af9
2183 F20101220_AACQCB connors_s_Page_032.txt
19bdb74b89cfe69d8841079fffc2cef8
907ed961c9ef78d2482313994c364a264380c97b
997 F20101220_AACQBN connors_s_Page_010.txt
6b3a0ca6910cb17a01cba203d12e396d
ef291b77470a9810fcda3aee95303810e9f74362
F20101220_AACPWH connors_s_Page_051.tif
76100728fed77351255f567aa650f9e4
20a137ee7980f3e2b5e44a51d014d488f7532c83
64077 F20101220_AACQAY connors_s_Page_111.pro
f5d5804c66d9dd345526113cacbeb4ea
7ec09834664e4f188db5f2386d723d784ada21f7
F20101220_AACPVS connors_s_Page_011.tif
f98f3f6ba514a89a8e11724c2189e4e5
a0c4365c17fee0b20eaff613a5b63d5f010e8d99
2185 F20101220_AACQCC connors_s_Page_033.txt
a71a8e60aeae3040077affa6b25c2bf0
86a07a48027a6337f00a292589a89bf2d71c6e18
2199 F20101220_AACQBO connors_s_Page_012.txt
5be41709d26fc65bc68340f768dbdac7
cad66f637afb03f4c012bfbb074e106b25460c86
F20101220_AACPWI connors_s_Page_053.tif
c418f859d14d2ffbec2e10f0c4f76879
f246b1b732afc7493eab52c14ae9887ec54476e6
74728 F20101220_AACQAZ connors_s_Page_112.pro
b9e1793c14d151aa6db289db6cf955c9
14917bbc0904b09306505609d4989e89343d3f9f
F20101220_AACPVT connors_s_Page_013.tif
0519e9f04e637d6fcb6f74dce875310c
0a97791e6d746892800c21e2ef0c951e74c2faec
2128 F20101220_AACQCD connors_s_Page_034.txt
d92b85c8fb4ed75a3da1a1d171568674
1f067d06ba82047a65b4616a4683408ba3571c06
2098 F20101220_AACQBP connors_s_Page_014.txt
fc8b4e6e80eaa529c97497976a8c2e38
8fe517338332ddcffce30e5f2cf99b8ebca01ba7
F20101220_AACPWJ connors_s_Page_056.tif
0b3734432c94894d83de048f35b05b17
bc96085b14b527aaa50824421170670dd22db2df
F20101220_AACPVU connors_s_Page_016.tif
605a9b4a0ce662a28149915cf9a3f9bf
365a20aa5a30068d62490870d1b89ef365a07738
2229 F20101220_AACQCE connors_s_Page_036.txt
79e47dcbffcd7c50ec36a122658e9185
0906e835615c17eb7109b07a8a64b92cb32b4ffb
2105 F20101220_AACQBQ connors_s_Page_015.txt
e3f5514a8a980f8993d9540b56459cfe
b14f31caba7484f42a5d9b1adaa9dd39d7c49cb3
F20101220_AACPWK connors_s_Page_057.tif
e3026e19dc99a44f85f033b4e8ed0d26
e64ba2fe5fec235eb78e8319cb41faf8aa738845
F20101220_AACPVV connors_s_Page_019.tif
b26a096a2e69c5f8383372d68e307d2f
1ee898c27f45b338f4bcbff8b7b5c66781b3f7f9
2256 F20101220_AACQCF connors_s_Page_038.txt
b1e5cc06fb693e2b34be746c5be8a1a1
03e606f54404dbb6641b41d486da84cb7c38e4d2
2196 F20101220_AACQBR connors_s_Page_017.txt
d7212beedab3602ef9e3a3dec07828fc
a4aef19bfa35eacae66c2aec3a1d672598820386
F20101220_AACPWL connors_s_Page_058.tif
790183e408d5f8f46b9d6b35afef8c44
44b54e2116046ab51f29ed280c2952a0a535111d
F20101220_AACPVW connors_s_Page_023.tif
c48d32ed784e753cec50a0886a42fb86
16219fba67a51904ab1ef74bd92a73f5761d540c
2012 F20101220_AACQCG connors_s_Page_040.txt
a2ed2e4c66b40c357cb61238a6ff0a6a
5d8d831343bdf318a2ba6de55a0851ce2bf4bd2c
F20101220_AACPXA connors_s_Page_082.tif
6fa8defacf4d341ed22842bccdc58e8d
57e2b3392c1acd2060331975f2fc2f0a7edfd2ff
2119 F20101220_AACQBS connors_s_Page_019.txt
838cb5699543196147aabf2033efbf49
3d83289974f399e80e47cdbfebcc77da5e356103
F20101220_AACPVX connors_s_Page_031.tif
087551561bce76f0f58ceae84d264270
ea702a22110aae06c269ef868eefd9886403a860
1470 F20101220_AACQCH connors_s_Page_045.txt
1bf9d4080040c81b30713aa0611f29a3
8f42202d6bc209c214b3d989dc3ea7018f1a4c43
F20101220_AACPXB connors_s_Page_083.tif
e9ae0417d2e24fddecfcb6b6964dd7ce
ddb623dd078cadbfe25a4bd81ea62bcced87d8ba
2251 F20101220_AACQBT connors_s_Page_021.txt
26bfedc65c9cea35c6e89c4692a3714f
6fd58de1b985c8eabcbf25297e262370c06af825
F20101220_AACPWM connors_s_Page_060.tif
baef00dd33ef05a550a3c5ab9ca450bd
ceb670ba941fa45e44e00c48387d682eafe4c360
F20101220_AACPVY connors_s_Page_033.tif
c678c06f3b4a6401716a6142f5b1661c
a5d173a6c9054c9ebbdfb57f97b54f0358de2a15
1627 F20101220_AACQCI connors_s_Page_047.txt
e774629cce0b3043319a249787d2c6f7
8581f1b84fad88fb564619caa86c20a64eaba799
F20101220_AACPXC connors_s_Page_084.tif
bcc77cf1fd87fe0bdcf1322c30d4f1be
3fa950405c62bca74ef7911a945a4fd38f41cc32
2159 F20101220_AACQBU connors_s_Page_022.txt
2755bdaed336448d10c5429fe8ce9fc9
f69cce774466045221c705096d874a4bfd5598f5
F20101220_AACPWN connors_s_Page_061.tif
84b58aa9c083c4399ae1c8f4ac7c2c8a
b72136178ccad9fe7ada007ff22e3b32139f79d5
F20101220_AACPVZ connors_s_Page_034.tif
4adab32493edd83f4fbf225f6a408ffa
f6a233d6795ee4e2985f57cb0fdbb9c9e63c76ee
1258 F20101220_AACQCJ connors_s_Page_048.txt
fdfeb48857f261c94740875fe50d006e
1c773314408b614793ca2336b7eb455d589d0c6f
F20101220_AACPXD connors_s_Page_085.tif
e00eef532cc79888d8ca5e9e37535af2
a753b64d32210cb3ce030e04360757d9f9ec1fa3
2189 F20101220_AACQBV connors_s_Page_023.txt
58fb67bdd382abfff98980183461395b
ec0bfa82ec7a8ee1d8e365d2363d088389b5570d
F20101220_AACPWO connors_s_Page_062.tif
16f8315bd5ed595b5194397aa873522a
37d685e69d00e5a93a6ef3e8dc51c8aebabb005d
1232 F20101220_AACQCK connors_s_Page_049.txt
0ff910e43e5b0e370ab38caea15b0c92
b94bf8734f7b4c69c019e5419964aa7bd8fb042f
F20101220_AACPXE connors_s_Page_087.tif
44ca913b092b24eb6e667585468df436
61c3c42ae23d593a57dca9100fa94c9836577b1d
F20101220_AACPWP connors_s_Page_066.tif
043dbbb039451394b7727fdbce5cd868
1e873733573edb77c69e628e1af9c145542c3af8
1922 F20101220_AACQCL connors_s_Page_050.txt
70ba9587fcc948e1dfa0b5d9a24f9ba5
1f4e0a706cdc3c30af93facc704be6197c3275ae
F20101220_AACPXF connors_s_Page_089.tif
61af4344cca5a57258f3121cacc6c952
14958f3d0f357f01173d1468c17a4b5675224cf4
2139 F20101220_AACQBW connors_s_Page_026.txt
80a6dc1262fe118516165e46ac2acb1d
2fed6b925970a1094a9b12d7f55e5a3f4f1ed7fe
F20101220_AACPWQ connors_s_Page_068.tif
baa472cb12814244326c039d658414fa
a10c3f868281d74508bc7aa6e436de3c1e4c2083
1852 F20101220_AACQCM connors_s_Page_051.txt
dcbc13e9651aeed4f792542de9c2e71a
be1ea3214828ca097c9c9127871547fc28cb34bb
F20101220_AACPXG connors_s_Page_091.tif
004729a2f5118c69cbb28500bc5f377a
3c53af6f2840d3726fb2d773bed2f1d8278e9e45
2172 F20101220_AACQBX connors_s_Page_027.txt
5087b665b251080780359a2a4a8fa697
fdac42e360914b0caa5c3eadd09cde62fcacb146
F20101220_AACPWR connors_s_Page_069.tif
c0fe5ebbe29853a3ec5f0de4cb88e9ee
cb3e1015508fc96de503d7e68cc2b7546fb66f1a
929 F20101220_AACQDA connors_s_Page_070.txt
81aa7778834d97d0b2d2463f582e4682
243a88cc2158958d52b702d452ff1ad476f06e09
2062 F20101220_AACQCN connors_s_Page_054.txt
551c1c6ae87f6a63de7a8bd5e686bdac
ce4a5b7de5f65a9dfdc4d4bf41114defbb3632ae
F20101220_AACPXH connors_s_Page_092.tif
4d0bc719b338f0520cec55a3c7672124
9a407dc786084887da86d7d812ca6fea12b9efbe
2100 F20101220_AACQBY connors_s_Page_028.txt
0c57818c0ca5203098b032f8f6797b56
4e90eba515b1d5d99b7ed8d9644ba4bf59f314e2
F20101220_AACPWS connors_s_Page_070.tif
193a3556ae988b8791dabf50a929a198
338e5237e10e02fd26467b46b98c883c2768a2eb
2022 F20101220_AACQDB connors_s_Page_071.txt
c5847b14013dae7edfc3c52a67e291d9
d3f5f96a8bd69172b986e78c90e0ef9a4f58e067
1975 F20101220_AACQCO connors_s_Page_055.txt
7be5814f956a040af7406ffc30a2364b
500a7dcb19b4c8261223b6aafea095102e226a97
F20101220_AACPXI connors_s_Page_095.tif
debd78ad5bb0a0c2219b974b162acdcb
1fe79c46c3064cf5de6341923b09c80472796984
2173 F20101220_AACQBZ connors_s_Page_029.txt
4d431b10199445f5f69fcfb7ac09892f
806b8a08e8dbf40a29c237e04fa91272d5ce7546
F20101220_AACPWT connors_s_Page_072.tif
01bc149d4c0edc18d834e106e1932228
6ce6afb54c7aaa06cfe4aa1990de6c745ff21418
F20101220_AACQDC connors_s_Page_072.txt
c08d96ca9dceb67428e42a62b016083f
dc7ee2720722a18eb1644de95c9babd5aedea11b
F20101220_AACPXJ connors_s_Page_096.tif
2f0907a9bd9e4c7821e460de7ec336cf
7aea33172eac09f6c3fc1eb306dd6113a001c488
F20101220_AACPWU connors_s_Page_073.tif
162bd7fd962a44cef337bc32247c4a5a
c099ba5de8394a8033d7e0bdcc2e24ba36fd03b1
1438 F20101220_AACQDD connors_s_Page_074.txt
5de76f494f996b772237217872e18097
ae8a27a24987ab0e1bdb06a3fc57107d264b30f6
2015 F20101220_AACQCP connors_s_Page_056.txt
aeacc7655907ae980cd898930539eab9
010c8431d0f510a9502154e45d8ae6323867107d
F20101220_AACPXK connors_s_Page_099.tif
6ee8b9d49a93cec44bf844fe92cb19b9
bd123343300025b9adc824937a96959b81a5e1e9
F20101220_AACPWV connors_s_Page_074.tif
fc81a3e5f8be8e54d9af77673653d2ac
d2db75b09785a8f0522510de2a9f8e3fbf134685
826 F20101220_AACQDE connors_s_Page_075.txt
2691e1784aeb0f3ee58059b833ab5ddf
b25ce98808450d05939fa44c58ec12973cdfa893
2068 F20101220_AACQCQ connors_s_Page_058.txt
432a896d445ac37a1601fa731baddfe4
de161de7429b6a2309ec4ce4ddf526fc53ef6018
F20101220_AACPXL connors_s_Page_100.tif
664744157e0f61119ae5097f5b384cc7
1e1d7c3860f57531e0112fddf89792175115e4e5
F20101220_AACPWW connors_s_Page_076.tif
33194658356079d9b1fda3ae10b5a331
d688b7c7f1f3e4be698af8eeaaf1816e5ef9186b
1539 F20101220_AACQDF connors_s_Page_076.txt
897e9fa83bcf9fa4817d16f89897a25d
50fe042b3ea9c673cc66b3cc3302b872d39edb0f
1945 F20101220_AACQCR connors_s_Page_059.txt
77878515752b3793fa982202c764c0f8
a77311273b04ac4ce79a0ca7f87e6ef964d611f5
F20101220_AACPXM connors_s_Page_101.tif
9366b0f1baee2a6c6eca2fb4a237b90a
5742c4012589d5a958a933307f7e08f5335f6fa3
F20101220_AACPWX connors_s_Page_079.tif
5c705a0513c4f3b0904da83c845aec35
feb12d13f93765432137c4254e43ba783f8bb456
920 F20101220_AACQDG connors_s_Page_079.txt
a48f18b505e08478b6461c4850ea5d92
3f0d1049407d57a3b8f85b7ba7caa1059080355e
F20101220_AACPYA connors_s_Page_121.tif
839b66f02d25ebcdb56ce182562c8550
d2412c546608bb7b6b9529be1bc2da12c552ef79
2182 F20101220_AACQCS connors_s_Page_060.txt
f85dc63ffe0ec6a97b5ee34833e9b4e3
243ec99b43ae01e1a341c4fc5a6530b86d5bc836
F20101220_AACPWY connors_s_Page_080.tif
a46bab4a65970e138166440713ae4201
ec4ffceab37235bb505c374898686905b185a57a
2154 F20101220_AACQDH connors_s_Page_080.txt
95fcedf97ab6985b21132dd2ff9aa59a
5a7b1f15dfec749dabf7e1c09c244d6201bee477
F20101220_AACPYB connors_s_Page_123.tif
9d7e198c6885ada086c1a49efd59f300
089dc106f1c9f599df08b77565176743422a3092
2164 F20101220_AACQCT connors_s_Page_061.txt
2ee8b9f404a1fbf3ddb3580344bad825
77165aaec8f1cac430fe4b3df4d9906a179b7942
F20101220_AACPXN connors_s_Page_103.tif
0e7f0405cacff112884d2794f94bf792
74c11c483568878d1d3e689b775a918748c5456d
F20101220_AACPWZ connors_s_Page_081.tif
24d071bfbb7f8520ca2c9d93d9ca40aa
f4a90969141499fc25bd9c2b0fcab3b487573b5c
2101 F20101220_AACQDI connors_s_Page_082.txt
fecf628f27d80a268973d866f562db9d
93641d5908d0194d2013a0593d450655104c1de9
F20101220_AACPYC connors_s_Page_126.tif
28794af58045a2e2778cea46a0a6653d
8f31044e508d2df0a4609dc3ba5bf6106ec5d374
2040 F20101220_AACQCU connors_s_Page_063.txt
6a63d857e99ab092457a224ac6b91ec4
05a9ee41aa173e5972e75a06060eecec2b63689e
F20101220_AACPXO connors_s_Page_104.tif
60830c87f244f8173a05277162f98da0
72acda575b89b440b115a178def0e9cc529065d6
2315 F20101220_AACQDJ connors_s_Page_083.txt
6b80b796b2062c73714b0165b8ccd410
3f4101e64dcfbd958b532d4f75bd006867c4b73b
F20101220_AACPYD connors_s_Page_128.tif
cf3e7e381f7426c666b177c9c31d215c
257dadecd9a398df10de5d658b5b101cdd3536d5
1122 F20101220_AACQCV connors_s_Page_065.txt
2112aa0177af303f39c33fda051bc7e1
dcaa130b84250f4e073e44257e251a5863c4b044
F20101220_AACPXP connors_s_Page_107.tif
2022900a5f639de36f150b8a6f0b9419
51ef96cca93de8f47470f542651f2101cd2e1bdc
2226 F20101220_AACQDK connors_s_Page_087.txt
7a0384c90ee9216cbcd14e4961ee5180
02efd8c484d7e4625fa276b6f6c4ba45124dc8ea
F20101220_AACPYE connors_s_Page_129.tif
7ee8f4a86f0b8e32dfef456b8fc98d67
e40788a1c009f028337cda892021792b9d5ad154
2116 F20101220_AACQCW connors_s_Page_066.txt
10a91d2e9d250a0aa233896a018110bd
d811d59ac895e2947c47f53d40f1efa19bc9472f
F20101220_AACPXQ connors_s_Page_108.tif
ab74f8c37b19448474aebbb75eb397f5
2323e18a6bc302e288f8308938fdce04ae0db73c
2246 F20101220_AACQDL connors_s_Page_089.txt
f576075f43ffe15f25f49947ba6f2005
5f511859dcdeb1ec8368ac20b876a0d5e10ab7ff
F20101220_AACPYF connors_s_Page_131.tif
290940abe7cd129379db03da3b8006cd
ad9c9b83b11f27e2ce8d57eca6e7f95d9b54140f
F20101220_AACPXR connors_s_Page_109.tif
e8408fed052b482d93ad251e01ad7df4
ba267be55923551456b1e5fe8d306c835938d88b
2642 F20101220_AACQEA connors_s_Page_113.txt
6ad1c9482ed13560971fc90806c53af5
4f4966745136064dc3f7a4b7d0db6edf9137e2e3
2039 F20101220_AACQDM connors_s_Page_090.txt
87fb4cb16b7704bd7db1157970c0e724
0dddc0388f67cd22cba35ef06da790f477266cff
3628 F20101220_AACPYG connors_s_Page_003.pro
9835c2fb206720d13f1f07c8f9a27577
b4ad1e7c474e6938cb54831c5121812e1c5e31d7
921 F20101220_AACQCX connors_s_Page_067.txt
ce25a5c269ac50639fdb0c0080a53f11
a1f9b17c8e3c168541a951d04226c9a2d8f19178
F20101220_AACPXS connors_s_Page_110.tif
f3a86d15a51032d69c56eb21f1ed0ceb
4b9ecd81306bc1d44b8e0f3c92c8c417339e0d97
2594 F20101220_AACQEB connors_s_Page_118.txt
6ad8a5a938251b0393153a2912a8c6be
f2210b186203fc6f1d0492c9340d2be5e8ade2f3
2278 F20101220_AACQDN connors_s_Page_091.txt
c81a25cb5d691799a6d1ae53963ea11d
bf4d2265ba96b879a7e86e31d618c97012b01df5
25124 F20101220_AACPYH connors_s_Page_004.pro
19731cfc6c45f6c9801afb0f45f1d366
06714b67852f274d26ff29e7cbfaf50fb37ff2d6
1479 F20101220_AACQCY connors_s_Page_068.txt
4554cb047edac18fd2064777c17e8232
fa5fb0d172990b10ead244f867b8a3739f10d2c8
F20101220_AACPXT connors_s_Page_111.tif
58b53c457b8d71fa1635430397868611
dfe9eed81eafa60b828cc2d0e146929899dcf47e
146134 F20101220_AACPBA connors_s_Page_102.jpg
dc5d37f10b30cb1dd5700f2d6baf1033
8fe83ffd617b7270964bc56b088a095205f90321
2498 F20101220_AACQEC connors_s_Page_119.txt
568261364757233d52374816a137ec29
aa63315ff08343d2e23414e59e686359535723d9
2231 F20101220_AACQDO connors_s_Page_093.txt
0b881970199f090cc51638d4782ece67
e90d1085929706f87fa19e24e42d9a14dc4774fc
60203 F20101220_AACPYI connors_s_Page_006.pro
8b9b652fd73089017e4dba6228b7bda6
9c9385b7303cba560c5a18d2d5f37f0f5fe77bd6
2195 F20101220_AACQCZ connors_s_Page_069.txt
a3423106fff6598ed87914aee68b992a
3c08da7e92c4d894fe637eba599fc0b29c53869c
F20101220_AACPXU connors_s_Page_113.tif
6ce3f1af560ead720c5c305ae056e823
9cd7c1acfa9f911a18eac228396277fb90a0c66b
109357 F20101220_AACPBB connors_s_Page_014.jpg
d2098b3e73a00cff58d0e5d0d2f5631a
2fa78569b9fb50379a804a6cb6096f1b0fdd27ad
2451 F20101220_AACQED connors_s_Page_120.txt
1435b815429cd1cc70d2fc347d3a02d1
1404f24827e2e713d5c57463f878e077de9b2b05
F20101220_AACQDP connors_s_Page_094.txt
deb6d4a08312ebce70519812c86af14c
b23ae0392f9c12ef7ac94627ac00a22226aad569
3649 F20101220_AACPYJ connors_s_Page_007.pro
b461cb1de2f1d35a63587fd54a87f088
661d8cd09a5bbeb9e9b914e86d40ba0391182356
F20101220_AACPXV connors_s_Page_114.tif
3eb2cc580999e41bf9c0b71a777ecd43
02c8b285ecb5d9c3a3a0f91910e785229c0de39e
38307 F20101220_AACPBC connors_s_Page_118.QC.jpg
196190876da1438c6efeaff89f835008
c799489ee72f13d8edcf975d6c5917816df2eb3a
F20101220_AACQEE connors_s_Page_123.txt
6c842b524c7b076ecfb7a5e6af4af26d
853b0ee1a3be3ac1a14765a23e925b7651650d13
2099 F20101220_AACQDQ connors_s_Page_095.txt
27252d8a44cd7ef96542838bbc9e1c21
6e5f6e2daadeac0219e48d9b18420fa908d74480
45798 F20101220_AACPYK connors_s_Page_008.pro
4502281a317844ab7de57f2dd3821927
6384bf4400cee362639857e6c531593af80c310f
F20101220_AACPXW connors_s_Page_115.tif
b657fcd07964a1c6d7a201c6f1a11701
fa248ae5206b176855b53530720bf6388b93a7cc
629758 F20101220_AACPBD connors_s_Page_048.jp2
df1a8edc64e4a7c1e1d97d9d7353a13d
aee3c495d0728d57e5b3aebd7c6a8d9c741f54d0
2689 F20101220_AACQEF connors_s_Page_124.txt
c792530bc7cd14e0a2a43b567ce2fbf3
89988b7945c2a868041f0f94ed80360e683e39a0
2639 F20101220_AACQDR connors_s_Page_099.txt
571d2cda04e18fa39efdc357a24d546a
493baa229db82ef8cd4d6b772d28d8fae7e2ceb3
47939 F20101220_AACPYL connors_s_Page_009.pro
0293a1a52bf5bb3a19284a4cfe08868e
0dce55262ef96452fcc6fd4ba36d5f8312dca5c4
F20101220_AACPXX connors_s_Page_116.tif
8bad6d2664407636661dd0cf39e98a6c
d0bcc445716bcedb33e0700d7b029719df734cbe
18325 F20101220_AACPBE connors_s_Page_067.pro
899a4de4dbec0130b816a87c8f89aa24
c6a325246c60f86325da9780ff344f859ab07f7d
2678 F20101220_AACQEG connors_s_Page_125.txt
654a83549db476d684da8b0fdba112bc
8dbc20b0d41e48bd5dd24d454eefe67a6c6a23f6
53984 F20101220_AACPZA connors_s_Page_034.pro
891e21e6f4a8e3c0d72997a7a7f29719
5acffe8e3be8bba646da621b60499dbd646dcce6
2822 F20101220_AACQDS connors_s_Page_102.txt
d6a7fd91a9b1dff1e3583eebc193333b
fc29e18ea9bedaeeec3fff06851955b6446477ea
52760 F20101220_AACPYM connors_s_Page_014.pro
00de934ef0943765b223b1887e9458d0
c66799338ead037434954aaeed2dda347560330d
F20101220_AACPXY connors_s_Page_117.tif
e28c54a694ea368fba7b6eae49b20ff1
c98fdbe53be709c8aa97677f4a1dca465c4eb958
73034 F20101220_AACPBF connors_s_Page_005.pro
c94c6a02f2eb36708087d590d67c80fd
368fa27e0ee2eaab425fff87fca8850013a96e32
2515 F20101220_AACQEH connors_s_Page_127.txt
7983029df9adab16425d4c6ed942d865
e96a57870432786810f47c3eb355f911bca2ef87
56947 F20101220_AACPZB connors_s_Page_036.pro
417e142bb944554a4a1069385b41f4ef
61d5bd3f3852fc9c5a93e5bf234ac3ab7f074401
2557 F20101220_AACQDT connors_s_Page_103.txt
cafe5a2eee7df0b0dcf898eb7248d4d3
445e5b149f2eb58d1a682cd1eb03078c857fdad1
55964 F20101220_AACPYN connors_s_Page_017.pro
4a5a11b4ec5ba911b909972bc2117c22
a4bee75e79c52ae632baea9d0420e9108b4f0f7d
F20101220_AACPXZ connors_s_Page_118.tif
bd094866fcf2d8705dab7007d8be5a2e
85f362f2ce6040a3075d8ae0325b7e2c60ee3305
51685 F20101220_AACPBG connors_s_Page_130.pro
d92b91eb6d1988e4a8cf48c02165c4bf
cfb40ae59d23ee709d27944d17ec9795c9de06f4
2070 F20101220_AACQEI connors_s_Page_130.txt
455fd0bc97357e591b214ddc1e818528
39cd5920b6e080251942c53497c6e14f234ed40d
53279 F20101220_AACPZC connors_s_Page_037.pro
b328bc1ef0b7f965a3bb65e3744a9f23
758fdb2b59acce230e85c9021e195370b46df541
2773 F20101220_AACQDU connors_s_Page_105.txt
46059623774d76962e6dc5c2d68fc638
55501d6315fe21dfb66563595d98fa8eb0cf58a1
F20101220_AACPBH connors_s_Page_037.jp2
f479c577678b3a6c9100fdb336ef1554
bec79ee945d794fbaf936138e8b8b8f11bdeee22
215 F20101220_AACQEJ connors_s_Page_131.txt
c17ada64a7c83a214cb90a26a4abb247
85e133b08843830f4a9e7c497f65757c543fa067
57111 F20101220_AACPZD connors_s_Page_038.pro
6b5b3267a8092ec75af7bbfd588d07cb
e4d6b5da0bb94575fd5e6124914c245537e4b330
2597 F20101220_AACQDV connors_s_Page_106.txt
5c6ae08a00335dd9f04073a42d4d5a74
8a86700b9f3563f2ef9d496d273f901682a72adf
57870 F20101220_AACPYO connors_s_Page_018.pro
7b15b2befd75bede82297f399dcd7df9
862241dbce69773666c5a03bfdfa966c1d5bc74c
227 F20101220_AACPBI connors_s_Page_003.txt
532970f6d8d0f876dcc8562750b12190
3d08ab4d0573c902e1ad3f706a6123ef65a4f6a7
2263 F20101220_AACQEK connors_s_Page_001thm.jpg
4e49cfe6637960f2d5e2be3aaf13a4ee
6f3778fa0db0ae7f4c3d026a4cd3bb4fe916cb9e
52521 F20101220_AACPZE connors_s_Page_039.pro
3b7460085044d7ba0aa1dac2afef91bc
0873327830e6cb627b20176c2c06392618748c39
2700 F20101220_AACQDW connors_s_Page_109.txt
1d56468dc5781165918c653d3dd3aa08
8afb7d743ae3b484cde9d9bdaabaebe470687fda
53870 F20101220_AACPYP connors_s_Page_019.pro
18c86787f821175b303eb96f395fc673
cb009aab9d284ab30f14aace5f96af38524876b7
113947 F20101220_AACPBJ connors_s_Page_062.jpg
0612a5859b15e47cf810da0c5f4bda57
73af9fee1561342d981d98b57167383f6d8c89e5
9352 F20101220_AACQEL connors_s_Page_001.QC.jpg
a92abd0b903a0f7fb879a2b978d66a97
0f4ccaba07183222c104ad24f578d9f1af320303
51087 F20101220_AACPZF connors_s_Page_040.pro
e27c0e4812fad8ff74e6ebd6bdac044f
daf8553c4915034c364e37d950936daa5983378e
2653 F20101220_AACQDX connors_s_Page_110.txt
e0a90edf44af42c16d4636e649a30112
ed290206c449b500cc67bdc7a81945c773cddb66
56132 F20101220_AACPYQ connors_s_Page_020.pro
8358f4b7f9d5ce1a50920c18be1d34e0
971908de7fa6297c12df6a502d21fbbd929eb25e
F20101220_AACPBK connors_s_Page_029.tif
79c099e4e8b8f6d34d3463e0970a314d
657fe3e968c4af097a3438d0098e93b38454acbb
593 F20101220_AACQEM connors_s_Page_002thm.jpg
8278172d192797e1d0c964c0937f10f3
05a1a2cb5113eb1c60171a5976ecb1605d682e88
54159 F20101220_AACPZG connors_s_Page_041.pro
c953f621b1b794e7a3fa4ab6979a9c74
ef8727c8be67f3b94aa8c5fc44643c4b3bde6e0e
57498 F20101220_AACPYR connors_s_Page_021.pro
b77247b2eaccb5b3ff9b64619d59eab7
e507a8439a3c1b7e2c3aeb44f40d714deafbd2f2
8960 F20101220_AACQFA connors_s_Page_013thm.jpg
c2bace951cd5e028313ebbe74b0915c1
19d6ca77fe33f41762b1551d3530447624d167fb
1366 F20101220_AACPBL connors_s_Page_097.txt
87e7ba9aad28c7cf8fecc30d536ff1c5
fd3bbfda7bcdd01e56e1586077ddd38028788783
2629 F20101220_AACQEN connors_s_Page_003.QC.jpg
1353d6b8c65a822a19b1ba05b74d399e
718777dca2955c176d05dac11d228ebc7bd0c8e7
2233 F20101220_AACPAW connors_s_Page_088.txt
0d50907c05329891352b0528b13076e0
5789ef835a7008ace70bb79b4f71280af7753f5b
50695 F20101220_AACPZH connors_s_Page_043.pro
c9c1917d35e9a1685f1028c827403e5e
4d46c647db43cd8072a2c5e9118de280e2697bcb
2485 F20101220_AACQDY connors_s_Page_111.txt
61f46b5fefd8564c386acb19819678b6
87e5f380be66ea3f9515a79d69ba26e3c7c53f7f
55977 F20101220_AACPYS connors_s_Page_023.pro
cb3994d08698f0dcaaa8d937e69b767a
9f7061426f67f2cdc7a6faa3d1bb910db635fcc9
35622 F20101220_AACQFB connors_s_Page_014.QC.jpg
d9e73549253e3ca7bcf4c422b7e87e7a
dee40926376448bcd88a75e3364ddd664f5f1d92
8841 F20101220_AACQFC connors_s_Page_014thm.jpg
c3f730517a5aa93304d6fe25d411cb55
e788dc99df3a443c225d1b034aca8447c4a3bde0
8693 F20101220_AACPBM connors_s_Page_098thm.jpg
52785b34a9ca499e7154f0537045bd82
a20633323c473f6faee612cbc51f2de6ef9bbbcb
915 F20101220_AACQEO connors_s_Page_003thm.jpg
99ff27cee31cbdd1016878790d6f9cd2
8122da00c4829ab56dadbbff09f57bff21f89686
38092 F20101220_AACPAX connors_s_Page_107.QC.jpg
dc876785d5042894e3f3f65314a1e540
e8f9b99225706d62596bccdc5a0099beca10ed2c
55483 F20101220_AACPZI connors_s_Page_044.pro
d49580a528a8a2a0c61113e2e9133502
ec3128314781d1fb00759875894a7e705ea755dd
2881 F20101220_AACQDZ connors_s_Page_112.txt
42f69b9afaab2b0bfd7053a4e43058bb
d6f035603f63c69b172f17ebd325032e1e7d43ab
53846 F20101220_AACPYT connors_s_Page_024.pro
edabfb5cfabfa49b299f999c2c024571
e53ffc094ace0114095f5abc6b6e8f6f743049b4
2051 F20101220_AACPCA connors_s_Page_085.txt
0221cb194b1332c920c411d4a8ca918e
29bf31ef1f2c888e47dbdd55d8437967519c49cc
36177 F20101220_AACQFD connors_s_Page_015.QC.jpg
60bf3a798891637527dc72d093673af0
12d726b52ff05874672f63e22ac65d5901cff369
6981 F20101220_AACPBN connors_s_Page_068thm.jpg
cb8c1180ff2ceb27d73655f89d509f5e
cd63afa9d81cbcba7cc5f20aa32d427dec007f2f
17940 F20101220_AACQEP connors_s_Page_004.QC.jpg
b3ef7bd7ea72aaaf6f328539db9706e9
0a0a038a7cdc30cc03953ea34f69409bf438caf5
6018 F20101220_AACPAY connors_s_Page_065thm.jpg
b178c0e648540501c8d9c2768c0d058c
aa211e192e110c29d5e659ed8947d1ea584dc34f
36880 F20101220_AACPZJ connors_s_Page_045.pro
fed7dc9d8fc8e287b5411c23557d4cc7
c8ca3adba00263d40857e31c9880ca720eb4745b
58028 F20101220_AACPYU connors_s_Page_025.pro
11971920b9d1f81ad5414ad99955be07
a24dc3f252fc71f647de7a2d7d353ff3ac9e7ef3
1051980 F20101220_AACPCB connors_s_Page_104.jp2
29d2456bab56b8b795f77622f7034825
1a03b96d9e79a99985afe92be29ba2342fe0b625
36135 F20101220_AACQFE connors_s_Page_016.QC.jpg
c4841e72847fc1293cd99e1e03eb24ec
d7a8a5a5f4bb45ce4037f55e52c8f024a824d14f
40114 F20101220_AACPBO connors_s_Page_110.QC.jpg
421ccbe2546c6e7f96b144157df3d4cd
779de33dc05bee01e8b483b13e9f2f63e0cb8b65
26768 F20101220_AACQEQ connors_s_Page_005.QC.jpg
e91031f8640cedbef28cbeec42e2377e
ce22baa9795ed3409361e8df7714c731888aa7fe
584496 F20101220_AACPAZ connors_s_Page_049.jp2
7777ba04ef3ad129fcc60c711b7f0cea
d3191a2644a47774aaefeb4293d2abf02d327484
33935 F20101220_AACPZK connors_s_Page_047.pro
905afad5a66a7b64fe7792befa3bd737
29faba629c7db87bdc250776ba070aa0c804ce32
54395 F20101220_AACPYV connors_s_Page_026.pro
9195540450f22f83548cbc4cfe706593
a55c8067efc64b07dc380b54c5ee31918b731c86
F20101220_AACPCC connors_s_Page_127.jp2
af33a769f69e8cb3a40d62497f0e6175
20eac132d9254dff9dc6a968078b139457d91108
9048 F20101220_AACQFF connors_s_Page_016thm.jpg
a3bbc5520301ee59628f13fd6d8c42a8
2aff0113a8881b5af61314c41f6104d08367f061
38364 F20101220_AACPBP connors_s_Page_099.QC.jpg
5a770e6b5992e1c28ee9e3cf8bbeeeef
05555b9f8dc702d52a65077f3a1145cb980c66d8
26309 F20101220_AACQER connors_s_Page_006.QC.jpg
4624587f6786607aa10d4858d21ea7e1
fe24f3b3dec5d19dab3df3dfd196e30314fb2cd7
27905 F20101220_AACPZL connors_s_Page_048.pro
21308e82a5d287fb611e2e245b04cc83
1001dae1acc6f3ac40613d344482609e83e4d25f
55298 F20101220_AACPYW connors_s_Page_027.pro
063fbfb4fd7193c96265df33903abccc
67b3d50c52a216b6d608e661c471a2978acb7091
32133 F20101220_AACPCD connors_s_Page_009.QC.jpg
482c80193a4b7ca3e5bfb6a51614a1b8
ce6274f8156032c213b478bcdde3d20969768a94
8916 F20101220_AACQFG connors_s_Page_017thm.jpg
f69607420eaa87ec29df8a925b4eb482
5332a7185c152b1beaaee51fec488ea346cd04b7
118077 F20101220_AACPBQ connors_s_Page_038.jpg
e73c68b4041d5474e289785bc5a5ad12
294cb01ea552c5bc98860d865d08808ed4d2860e
6781 F20101220_AACQES connors_s_Page_006thm.jpg
813df40af767b9b5b986ac43cd034f3b
d646a30d8bbb5a679f3df24882842c40d308b74b
25164 F20101220_AACPZM connors_s_Page_049.pro
be262802d19284bd477542be5761eb82
42a7be862f70243aef08f382803be607a9ff9398
53487 F20101220_AACPYX connors_s_Page_028.pro
8ba3c42a6cb39e45d5d114057f674895
224ae6c3016ce3f7e5b1a109e66e92dad4a0c493
120043 F20101220_AACPCE connors_s_Page_083.jpg
005fa86461e4391a91a38261cfd5186c
5857c70eb35ec2dadfcfe2a771e17f66c5891060
8897 F20101220_AACQFH connors_s_Page_019thm.jpg
67f6130f6aadf82dd39be1b1ab18b3f2
ea001cb722dbc27917d4c6b5fa8b3b24559980db
1051914 F20101220_AACPBR connors_s_Page_029.jp2
2862d0809f998c3b0a33626b1966abf9
6025894cd6e508a886da6486f5e010eb79e1ca03
1330 F20101220_AACQET connors_s_Page_007thm.jpg
8e8b1ab10ac28775e939934d7fec5e22
c444af730f48fbbe5c30f1d9355c509c25db596c
44733 F20101220_AACPZN connors_s_Page_050.pro
ed98192d5e6bd08281adae352dd4be5b
c57c1ec73f0327c4870f98c0952fdb487ec1cf8c
54397 F20101220_AACPYY connors_s_Page_030.pro
a1b05e3aeb6664790f344bf1f53f9e1f
d73ad3b21159d4920763bda2e9c310d94efd9861
39155 F20101220_AACPCF connors_s_Page_038.QC.jpg
b9375f88d9b99ba008a1b7b978920b3d
0b6d189ebf841cd977db97ef9f34346e781b94c0
9183 F20101220_AACQFI connors_s_Page_020thm.jpg
0d95ff8357d30792ebb3bfc2c739bdf7
e2b226d97e59ac03b5878a196b7e3ec4d5c2d693
1051979 F20101220_AACPBS connors_s_Page_128.jp2
bd40062b2c7c9a96ab9bf4257d9e1c97
ca79e34a1f3197e073959382a52e7ed5fad48cb5
6787 F20101220_AACQEU connors_s_Page_008thm.jpg
2fd0536fe7029747ffbda09822aa861c
da7796726cb4c76540fd4d1224ebe1f88769cf2c
46778 F20101220_AACPZO connors_s_Page_051.pro
6858d83dcea17a95bcdc251dff263a2b
2b08e053362a4ffab56913d08fe29995597d86e5
55556 F20101220_AACPYZ connors_s_Page_032.pro
b2b7c8d4b4301d509233ff1ef2901cc4
241090bb76eeb28f3e5945e09adda1ef43453451
728540 F20101220_AACPCG connors_s_Page_047.jp2
f22f0b3fce52030d78ae6a002f178ea0
48dbdc081e0bf74a5e3f54633ae431e31a88d85d
9192 F20101220_AACQFJ connors_s_Page_021thm.jpg
100e6e7088b1a4b77db16c8fba2bfc6b
7cff541fe42cb33f877c74287d250cfefc86e521
36599 F20101220_AACPBT connors_s_Page_030.QC.jpg
70d4670a0e1d05474a8132f3a1d0a0dd
5675d17aa8d03940e2c23a826784c20df0ab88e3
4494 F20101220_AACQEV connors_s_Page_010thm.jpg
edd61026029f2fa588920d7b2b467f86
8ff44ff8826f87dfb690063b539e31fd4b948106
75908 F20101220_AACPCH connors_s_Page_096.jpg
fb4a5eb649e7c5889296ec9dfcdc0eac
77fd6501d7e58fcd681c0c2e4c4608a91e7e2bfc
35794 F20101220_AACQFK connors_s_Page_022.QC.jpg
7876544a0ddabfcb0fb0c7e1869f5a13
449cbb2cff030cb1ff032c7e48076e7a33ecd731
111834 F20101220_AACPBU connors_s_Page_035.jpg
46d0fc7c9fed0cd494c435cc79af6f0f
cb9bce8fddca183cae94b329cbb205a320ef5be8
35315 F20101220_AACQEW connors_s_Page_011.QC.jpg
35273a58368af222e52afe635066b757
fa7e36d42d993e188b764600a3eef3ad70d3891c
52874 F20101220_AACPZP connors_s_Page_052.pro
c64b2dc171c9f78665f9e9a850169fd6
5116cc312e6582b3c126dfb148ed286c14d522b5
F20101220_AACPCI connors_s_Page_064.tif
0f317bc8e861ee6817b0ac86212e45cf
527413883887e5be3cda2b29df416932cbacf2df
8723 F20101220_AACQFL connors_s_Page_022thm.jpg
3d3a81cf942224bdb4298c3e3cc09528
f1828155a8ae0c1014a652ee977f995b6fbdcf71
1051920 F20101220_AACPBV connors_s_Page_094.jp2
db68e97c94383b7aa419dbc2d71b0118
97f7069ed5774ff6e9e69d1ba7585687834e5ff8
8422 F20101220_AACQEX connors_s_Page_011thm.jpg
be9c0b7a7a15b727c7204bea081de0af
9289a148047b5394899ce62b6d5dde37af890579
47220 F20101220_AACPZQ connors_s_Page_053.pro
c978b7bed959593b5ab254363b409fc6
6f0fb1613d564925beaf4e5bfbc8d155a7d4016d
120441 F20101220_AACPCJ connors_s_Page_117.jpg
5cbd2d26d6f5e51b8bb00dd9af1534bd
f09f6e49577399101ee350d6d25b5eebe62b5be9
36474 F20101220_AACQGA connors_s_Page_035.QC.jpg
b38ddec702e00f864967f2ca90b90989
ca7537ceeb2a82f4700e42b117373a7d8a8964d0
38638 F20101220_AACQFM connors_s_Page_023.QC.jpg
db414e1aefcbc8326bd7b5e36ea4653a
85a09f7fe242ffddda6756bcf5a177152ba06dc1
9345 F20101220_AACPBW connors_s_Page_083thm.jpg
511bd6e4e06138ea66862ba4a29f8547
88e7c4b743c654876865e59f5f8e7c791dcfa9a5
36875 F20101220_AACQEY connors_s_Page_012.QC.jpg
52643460c9f7d2460e75c731fd030072
040174466628973b01da86418e4ec38fb48b2071
51860 F20101220_AACPZR connors_s_Page_054.pro
d09a439d4a319ab7ebbf0b50c1fc1acf
93efd6121087dadecede9f710ba82b2332c6266a
36826 F20101220_AACPCK connors_s_Page_027.QC.jpg
665c032f13cd6ca3ebcf69435227ef7d
9da85f70ad7ed1d35bf165dfa2eb27c291901428
36790 F20101220_AACQGB connors_s_Page_036.QC.jpg
796770d598f66867503601f202cd6ffc
2de7162c87b1591ba1b9b5ae25da92b4699e0005
8796 F20101220_AACQFN connors_s_Page_023thm.jpg
ad013ea06de995248f542a602e58f515
76dfa3d7b60c37e714c1a3166967a78bf3fd906f
51147 F20101220_AACPZS connors_s_Page_057.pro
1359489ef8a2cfcc61abfca0b813b94f
f012a2aad8c6ef2ab1ba82617e98750d29dc7018
F20101220_AACPCL connors_s_Page_092.jp2
25c8318800be8beafa21b1e5bfc3d787
611c04e00359a67e395133e03e34413a19ad6cbb
8943 F20101220_AACQGC connors_s_Page_036thm.jpg
b3967837f02c638f3287d9829dc1ee6d
db8caca2f56c9212b3f72440056b6dcad1853a35
36743 F20101220_AACQFO connors_s_Page_024.QC.jpg
78c831aee684e75422300a313e2f694b
4f9b2538e7ba570a00b3ccaeb98729f016b2ed98
35946 F20101220_AACPBX connors_s_Page_084.QC.jpg
6f21c25fc82419ed3ddc1ec4beed99b9
7124af38212e8bf97041557e8de04fbe89a2d736
8798 F20101220_AACQEZ connors_s_Page_012thm.jpg
1bcfdd12cfc0c893a479d4572359696f
054a063347ca70ded5583e9f7d8ee245cc761a68
51848 F20101220_AACPZT connors_s_Page_058.pro
97ef5a74eeccd08572d6ac84f919ba00
e0413d656780e8d752912c84a9289bc5f1c9d1b7
62264 F20101220_AACPDA connors_s_Page_098.pro
d66e3de966178998bafe25365635df2c
2f02fcaa248acf5beb1ef5c1c8f2430229fb748e
1051976 F20101220_AACPCM connors_s_Page_114.jp2
7874d9b290934ac03d5db9db59b91797
776f3434494986b2401c12a871edad84aaa10985
35041 F20101220_AACQGD connors_s_Page_037.QC.jpg
ce26926b46eabdc9eb91490a69741419
3361caa8e0eeaf8145ec7c605d55701c37626762
8555 F20101220_AACQFP connors_s_Page_024thm.jpg
12778eeae03f415ffb0a103753d82fb7
9c17377506bc2f76f5945459587a1fab34f0e10b
40751 F20101220_AACPBY connors_s_Page_101.QC.jpg
077540d39d2964a331ad90bbae2dfb17
ea9dcc79b5aa7278a04da2c51bd958418041f322
46792 F20101220_AACPZU connors_s_Page_059.pro
e115fb7875f540667e88fe8b501541f7
7281c754bef217a5c68c784bd21328292d15c242
3477 F20101220_AACPDB connors_s_Page_077thm.jpg
4eaef016262fb682341edca2dcf4885b
a05c3dbad6302d8ec1b23bbb68a65f43d5fdad5a
134032 F20101220_AACPCN connors_s_Page_107.jpg
c2a092b8b86fef936fc3aa28da9aacd9
41731af1792d47806a3b02b3c32950ab96270c41
36443 F20101220_AACQGE connors_s_Page_039.QC.jpg
76d7e11d4a3ae04c9c1066e94f73279c
d3238860cfe0c4c0e59a8730937650ee887c6613
9145 F20101220_AACQFQ connors_s_Page_025thm.jpg
a1e22544f473b755f701ea6f2426832f
ab5706ca8060368568b4123c690279c603ec3756
104399 F20101220_AACPBZ connors_s_Page_040.jpg
a820498219c033e84db494c5c0cb218e
d42d3d0d20ffee6728c9ebb0899c2349eae273ff
54948 F20101220_AACPZV connors_s_Page_061.pro
47a8e52f42dc93da53d62678a57d5d1c
9a58b4f751d9353330e86b984211c3e1781f42ea
9130 F20101220_AACPDC connors_s_Page_087thm.jpg
47fbf32ace264f0ec711683f844c9d11
7ecf361ef05b274f07f14a543f22a7bc1951034c
55647 F20101220_AACPCO connors_s_Page_072.pro
0e5a23d3ea5e24e791ec7b86b51c2573
956ec192adacb076d896cf5fc148aaabd364623d
8557 F20101220_AACQGF connors_s_Page_039thm.jpg
e40a305325088e986546c6a7acc29407
247318ee303332b884df5de2ea96ca2c3c18ea04
36292 F20101220_AACQFR connors_s_Page_026.QC.jpg
ac99d130b9135721a906d8a1cebbb165
5b9df37f523d8eef746511eaf7b241aa4de5e31e
51834 F20101220_AACPZW connors_s_Page_063.pro
f282843451b4508666eda4380045b679
cc921b503d63c3aa901affc1ff093310d9da7ca8
55337 F20101220_AACPDD connors_s_Page_029.pro
cf85dfdb8870deb4b1450a2eda14983b
9f7b3a07c5ea4ecfe24166524d4fc8564976f5cc
64885 F20101220_AACPCP connors_s_Page_122.pro
e170c5dfd70b66990b2e87796bab297a
e58b85d28ba4a1319d2c35ca86ece91a9fb0ea21
8781 F20101220_AACQGG connors_s_Page_041thm.jpg
3dd2634c2b7cbbc71ae17af7c8f497c8
577abc88924b2421f50abe093d12cfcb8119e4fb
9015 F20101220_AACQFS connors_s_Page_026thm.jpg
6147bedadd690c2a5cb9f3010f00e17e
4d028925cb487107ee26eef338aa497fac79e1a3
41668 F20101220_AACPZX connors_s_Page_066.pro
013ec9bcb5cbb8d71e141dc4b73508aa
ed5fbd880b7069bb3a8ad3b3662d128c071719da
F20101220_AACPDE connors_s_Page_105.jp2
790d21490d564e9c19a045785a0b8eb7
c45c9eaa296f038a1421f6b0fee40146d7d534cb
109411 F20101220_AACPCQ connors_s_Page_016.jpg
12e27dc8ca02667c09bff8e732aaa479
fcc07fe4603ea38d95e0871750bd507af4371872
36575 F20101220_AACQGH connors_s_Page_042.QC.jpg
dd979d26915e27e5687dd7c1ba510dfa
4b54bf45a0e23fc54898f16c194803b0ad149049
8924 F20101220_AACQFT connors_s_Page_028thm.jpg
0c5c41c99e7d1127c127340af06afbd8
dd7f5cbe0369d7c78cf5d062955e251e59276da9
30745 F20101220_AACPZY connors_s_Page_068.pro
ec1672ffe6d35f2e941f62112ad07554
c1a7c73b1d8e505094a8e5a1468b71dcffa67680
3263 F20101220_AACPDF connors_s_Page_064.pro
a8bdf209d9b989730a358ecc45a8ad53
69648643aecc8343bd8764a744d8587796edb4ec
2180 F20101220_AACPCR connors_s_Page_044.txt
767068c9c9584f3f4e79ce2effb1dfae
7f1a0ace50770f4756289614dfd542f8b9710ba5
9074 F20101220_AACQGI connors_s_Page_042thm.jpg
1ccc8b724e968412ea076e7aefe71ff0
0700a066995b71d299c0efbf29abba8a8a063f9d
8708 F20101220_AACQFU connors_s_Page_029thm.jpg
514c6f3f5323f8ffc1cb62deaafd3980
3816929d1db3fe1bccd92c85ee5135e9976d654b
17860 F20101220_AACPZZ connors_s_Page_070.pro
bf6a8549eb5fbdd3c1868ed9a17ac3fc
c4222d94561619eb8ecb6805cdb8d5317c5c6230
54559 F20101220_AACPDG connors_s_Page_013.pro
132e0a2a332672fb541f5bb83e8e4cf1
4c07daeb7757e547353d24db966dde2489bdc441
F20101220_AACPCS connors_s_Page_021.tif
d1202a4ca364882318e2c5ae7d74f3b9
0d62a1e17d5c0c722c83801039ab8df63021e72a
34105 F20101220_AACQGJ connors_s_Page_043.QC.jpg
6cde7e01661e109e2117bbebda4e086b
49db38b8f790610f6280376d849b3782f7f853fd
8828 F20101220_AACQFV connors_s_Page_030thm.jpg
85778e09c692d21d83275366741497f5
a8c1d4137bc62ce6e1cef078cc3727e7e94a1248
38140 F20101220_AACPDH connors_s_Page_077.jpg
57131554c23f72b21dc487d9c3b37b49
03e47f717b537b788b832c3fb96dd69a512aa94a
F20101220_AACPCT connors_s_Page_097.tif
a87473cda539ec18052303e00836eb72
cd66d069809e4243eb175a1079cb064edde2e220
8362 F20101220_AACQGK connors_s_Page_043thm.jpg
d46b530840b1d5bbec5747fde30c46e1
dada2a3ce844913f3e2e3f76cd3fce8e0984fcea
35567 F20101220_AACQFW connors_s_Page_031.QC.jpg
92e0b3ce6e663600f6cc9ae7895ecfd0
86744a890fcae2deffc67be97603f215e6bc2c7c
156 F20101220_AACPDI connors_s_Page_007.txt
9e13c88c7369f8127218aec890913b83
b5375bf9d4ca5c24e34865c7d5a0dad9b01047b5
37118 F20101220_AACPCU connors_s_Page_017.QC.jpg
e0e13d7a82a8466163cfa1e16bedc165
28c008f0bd0971a7d31aa2708a4e3166448ead93
36101 F20101220_AACQGL connors_s_Page_044.QC.jpg
fdfe5d4f1d4b9cba0f9c746cb931e531
f3e13fb5f4add4c0bfcc1d464ac71d662f6c860f
8782 F20101220_AACQFX connors_s_Page_033thm.jpg
51fa328674adfd794ebc2d30314938f5
7a6b5c82479c4a93c3038f0d9d48263858358a64
69457 F20101220_AACPDJ connors_s_Page_116.pro
c10ca99021cb181e511b7c2e339fe8e7
a2546dc7a4b0631471220e61a715dddbb04e9ef8
F20101220_AACPCV connors_s_Page_030.tif
157c1c39fd7a94f3a26edc0da91d248a
aab632722fa21da24c4a2c3d9e5eaa69db6efb0e
38096 F20101220_AACQHA connors_s_Page_061.QC.jpg
e4f5bfe9b4a27af2daedd4f6b7f90f44
bb62ee51add11b39e64ef8b5cb89ff56c562afee
6340 F20101220_AACQGM connors_s_Page_045thm.jpg
9e3e0f9bc40e1de015b857714eae1e80
c902e126408b9069123af59463796d933b8684fc
35182 F20101220_AACQFY connors_s_Page_034.QC.jpg
564c064c2bc33a2509d08fe4451230a7
30a08400e155ca38473428550f829a92a805aabc
1051897 F20101220_AACPDK connors_s_Page_108.jp2
3796c6f78063fd89beade07d40fbe6be
d714d7c6ab616ebd497ba2fc507e3cb53cca5df7
2107 F20101220_AACPCW connors_s_Page_073.txt
c87719dbe5a829ce196394320a9aa292
71cc1f7b69a3d7f7140cc0028519464ec09ffc44
3623 F20101220_AACQHB connors_s_Page_064.QC.jpg
5b958168ec54ff96751a0c164b3e6b0a
c864cd4df49e366717de665ec13c3d534beb379c
4706 F20101220_AACQGN connors_s_Page_046thm.jpg
688d43b8b3483b540c1f8d263afac07a
b51d464043e135bda167979a3854b34917fcece6
9018 F20101220_AACQFZ connors_s_Page_034thm.jpg
bdd73e7107c0e9e7373214e41aff66a4
a97ff551fad1ce827d07d5e87f5b3b15f7f02e6d
64385 F20101220_AACPDL connors_s_Page_119.pro
676d9343b9e6c5dc7f2d727f2cc888f3
906ec4649f878ce81d844187f2c311607646b502
F20101220_AACPCX connors_s_Page_006.jp2
6e7f5a2568fd515b3a37d9afba3eb661
b120c8da662690cda8fbad82fa4162b1b91d29a3
982 F20101220_AACQHC connors_s_Page_064thm.jpg
d0f127a0758277d4aab7d453efb4b04e
ef73a1527b61ef8744571e1e60b4ecb244d0f87a
17129 F20101220_AACQGO connors_s_Page_048.QC.jpg
be2abc90236509b5ea1a8b8402ee82ba
82733de5181805900b36c56c4a34e8e523761f22
112297 F20101220_AACPEA connors_s_Page_012.jpg
ea5e4e5582d6f4c82f4369aaca7a3530
60f0d506d0c6719abd72da8267f3a6a54fb50a35
105163 F20101220_AACPDM connors_s_Page_043.jpg
d8d3f3af3f2d20ff9e7d1755a3464865
ae71dc2dc3bf5d3d62e4bf5c135f71484332e054
21425 F20101220_AACQHD connors_s_Page_065.QC.jpg
0c8487519cb9554c9efa2793fa21a7d8
162f77c8fc2ebb58ab5f4e06de42d9802d8ce26e
8238 F20101220_AACQGP connors_s_Page_050thm.jpg
3a5f357f14ac5e98f0ea8fff86a967ac
d91743df28551d9698f13ef869f05c7e122717ee
9173 F20101220_AACPDN connors_s_Page_038thm.jpg
2d3dfb915b16059750344d9bc6dd564f
66eb4674f38b76bbba84d377fb810f1309feba05
2807 F20101220_AACPCY connors_s_Page_108.txt
dfea2fb0027542de247f39136d134a69
52a02a58f3bb8ae60396cba0eb3230f5d97e6f31
1051971 F20101220_AACPEB connors_s_Page_098.jp2
9725cef8398d66ebe5b401f2d6922227
0d0ae65ebf404dfc746a55ae4d9109c9f8c3793e
6970 F20101220_AACQHE connors_s_Page_066thm.jpg
76b61abd4a0e27ba41275e0f8ece1942
79e2fed919c02e292e9de1d11b12a318835ea4a7
36584 F20101220_AACQGQ connors_s_Page_052.QC.jpg
a40b2c9c8cd5dc1ebc8d859eee378cff
dbe3baba57ab573eb2fca849645966638f2534e8
F20101220_AACPDO connors_s_Page_084.jp2
b80401413f89e535290152e330f160c8
126a9e14b39681446f276b7003b498341ed4c184
43677 F20101220_AACPCZ connors_s_Page_069.pro
663183527a8a449c8a67968707a1c2ea
ec07665078d1c6221f7d63f2c9ddd6ba966cd675
8880 F20101220_AACPEC connors_s_Page_031thm.jpg
6a2c0211bf966372b60a98092ae4a6ad
4a83895d511fb5d7e9f5ecb94460c50fee8f307a
18869 F20101220_AACQHF connors_s_Page_067.QC.jpg
c06a2e2004fc88b4815e4e5fae79f9ec
dd3da4d6fc7dbf514a1b1c9e451306f4f1173ce4
9073 F20101220_AACQGR connors_s_Page_052thm.jpg
f3886125d47130d29a2fbf0e79c68b9a
b9c8531b0ff889e8b05d28f0c9c75244123c6b4f
52045 F20101220_AACPDP connors_s_Page_085.pro
53f16e5c45539ec7df01a2e6da6f1c53
e203962f0d6c2109d459b57ec897bce27c57282b
F20101220_AACPED connors_s_Page_012.tif
ae09bfa9e4b338fbc902329bda19cbba
4d3852f876577dab2d2cfa5a7221156852d7bf7e
26295 F20101220_AACQHG connors_s_Page_069.QC.jpg
b1049193314c5b52b33b0e925bf56b87
35fd12752c02a8397de905251db295530cf1761d
38284 F20101220_AACQGS connors_s_Page_053.QC.jpg
2308e0a5b16aab507405df22896e84d6
747b680b8355d92bf9351808417f5f52a4815cca
F20101220_AACPDQ connors_s_Page_112.tif
f8c196d76d33a27d6ee2432a1a31d0cc
8f4b673ee548d1b1e036afbea208024ed371cf91
62699 F20101220_AACPEE connors_s_Page_048.jpg
8c922d87dda19edbbd12d0272ff172a3
c939240aa12c652fc1825852f2b1d55cc86f5b3d
6575 F20101220_AACQHH connors_s_Page_069thm.jpg
adcbde90586edab21c79ba3d9ea436f2
24f7700051ad8846c9f4073be0a2e036b3e0998e
8935 F20101220_AACQGT connors_s_Page_053thm.jpg
ee17984cc8da94eed05e06e8bd38dbf9
affe278640d9b0dc1251f47baf0f6d3b022343ce
37634 F20101220_AACPDR connors_s_Page_032.QC.jpg
4b968c7a6ebd6c1e087e16b40196100a
fc733314cf159364236f7ae96d2c782c63c1dcb2
2094 F20101220_AACPEF connors_s_Page_037.txt
50bceccd554db399b64316591f6dd59e
0573e0386cdcc1340d6eb968401442f842d68d7c
15230 F20101220_AACQHI connors_s_Page_070.QC.jpg
cec643730694c8f59450c969a664828d
1cf570a75c84cd8f45605485e864fbd8f74c9538
38099 F20101220_AACQGU connors_s_Page_054.QC.jpg
8f77c05c7359fa462d0c37d1e99c76f3
8bf986dff626b680ab6fc5f0b90ca32e9fdf17a7
F20101220_AACPDS connors_s_Page_055.jp2
527420c704580192adae9d52cb068bf1
af2ed4855738bf403a1e9277c1f5b37d7e342cd7
66982 F20101220_AACPEG connors_s_Page_118.pro
b1788bfab6bb0750dcfbb6896bc42394
aec99b6faefed5cbe885e1fe5d927efff102c910
8244 F20101220_AACQHJ connors_s_Page_071thm.jpg
c1c13d9f37e6959b89f5dd07fce5cb13
a61a0624ac4dc8b1221e2efa81856cef51e06ac8
9094 F20101220_AACQGV connors_s_Page_054thm.jpg
72a4dd19c695e64c8a4ac8e1a75ef872
0866357af2551663a8dedd970a16c11b93f94ed4
110105 F20101220_AACPDT connors_s_Page_026.jpg
06cd3a0978f2e8096ec4de946edb3cd3
4985978cffc6fa37b5eb02989e1417d6143664cf
38012 F20101220_AACPEH connors_s_Page_021.QC.jpg
b5664a336c02fa83cc108822584249a7
52df192fddd74e974c27fd93fc8a99e9b23ef305
37010 F20101220_AACQHK connors_s_Page_072.QC.jpg
474bf9ce4ae2e80d029249c5b72d4bfe
5d70356c381cf1e7a81de7dc3145911199dc1052
F20101220_AACQGW connors_s_Page_056thm.jpg
d27364450f9d1cae940f628826eb4182
f80241082a974bfa11fc0a0e71b6024eb658f9db
F20101220_AACPDU connors_s_Page_106.tif
a9d6d07990aa80f947df74ddec797b3f
626a5b4171337da5db91b17a3023d5919a421821
25126 F20101220_AACPEI connors_s_Page_010.pro
2b58775510d72d751941d8c8f05929f8
db59969624c49a3b2b3bcd3273234ddab5a9205a
9077 F20101220_AACQHL connors_s_Page_072thm.jpg
feeaae49cc1f7a89c2b08ec87e1f11bc
48fb1f6723dbcff8a376e4f4b838e60a2d7d3301
8891 F20101220_AACQGX connors_s_Page_057thm.jpg
d7625cd6b976c0e03531ccacf180983e
031d1645dd335796ff696c9873c336abb8e08fee
F20101220_AACPDV connors_s_Page_015.tif
bee2014529d49f1805183fc7bc053f4f
af4f4a0f2c918d32edd8196c46d6f8aceedbf7de
112493 F20101220_AACPEJ connors_s_Page_061.jpg
7c7d5c9aac6cf539cf5049b1637bf06f
b1d6601ed54c02e096b5dbc73dc13691cc53e5d3
38732 F20101220_AACQIA connors_s_Page_088.QC.jpg
a6b019670f01841207ffbedb353c90bd
6eefb74469de0d23967c24e36cadc2c2da2cbf55
37451 F20101220_AACQHM connors_s_Page_073.QC.jpg
543451f86a8e1c42e8b7fe9285f4430e
dc5e5dcc5eb1f4e9647679908ee45a222e1239b0
35404 F20101220_AACQGY connors_s_Page_058.QC.jpg
db44077dabf3253eaa3829d60ff2afc7
f16d7ec510fefabdb6c9b616abf7dc248556f533
26846 F20101220_AACPDW connors_s_Page_008.QC.jpg
4d9026e2e831421763afcbbd67b87dfe
e2fdbd01acbe8f05fbab0ba8b41cf8774b9e0bca
23000 F20101220_AACPEK connors_s_Page_078.QC.jpg
4b5aef4afb52642798e024c06cf96b36
a636334b4e21d38d271533f43f2efeabbdca4136
9071 F20101220_AACQIB connors_s_Page_088thm.jpg
86f8cd2d1c5a71f43d8f8ce0e12bf283
e75871cbd071ccf7b6462e3b1d396569f6913270
6418 F20101220_AACQHN connors_s_Page_074thm.jpg
9f26728fd554067fb88ccba026833915
6327ac71836d88d8c0f534c355f823446dfab058
8926 F20101220_AACQGZ connors_s_Page_060thm.jpg
4d941b864ee8e31172b432c9c04a08d7
5fb4bd6754922809bf4dfc3393f3bcc0d719439a
F20101220_AACPDX connors_s_Page_117.jp2
3421fab0b21d78691f91d4026890d64a
a05b113d2c2e907545bc1bf030caedddfe906659
3244 F20101220_AACPEL connors_s_Page_005.txt
37aeb4ecfd8a0d719b0b171037de26dd
c0d31dd6607ba0729b8668e2399154a4dfeb12a6
9176 F20101220_AACQIC connors_s_Page_089thm.jpg
265b73f8583afd5292d05054bfd3db45
00f64904e92cbbae63835d44cc1738d29d60479b
16636 F20101220_AACQHO connors_s_Page_075.QC.jpg
091bce87ca30b55fac4b66b7d99e1106
ff114c882342691edf29ecf37dd806a27ce8018b
2680 F20101220_AACPDY connors_s_Page_126.txt
1c57f7ae8e0c3c99959df14797943d0d
db673f78bf2591f7972fda655eeb3ed0fff39c89
39410 F20101220_AACPFA connors_s_Page_109.QC.jpg
95415ae836c9b5a2e0c98b1734370740
c78091d0ba67e0b6bae1a3989a6c10465edcae88
F20101220_AACPEM connors_s_Page_091.jp2
983d63131fa2b302ad22ffc8c7af9444
f5cbb9246d7e3f8c640359df349416c75c43fc54
34917 F20101220_AACQID connors_s_Page_090.QC.jpg
6d4553ec1807d5995a7cb1af4111aad1
11e047cb9b6917152461408ebae8637f990b4d7a
5038 F20101220_AACQHP connors_s_Page_075thm.jpg
15ebdbeee56352475431a8fde7efd0b5
797943d9d7c520b27a17b2e72e5f1dc8d9ffae4a
57814 F20101220_AACPFB connors_s_Page_091.pro
705c939c942a8e1d8965ad910d7c72fa
a89f4d14de993d7bba08a2217ee1951f4405380b
67425 F20101220_AACPEN connors_s_Page_100.pro
4719168760df9ceef5df20bba4d4b814
0eac0416016c9ece883bf38e9b4ae163fd29b8f4
39776 F20101220_AACQIE connors_s_Page_091.QC.jpg
787441b9f6a2e43b86b171f59e00b06e
70f4c75df614ec54d384adaad4d442e67f95dc76
6603 F20101220_AACQHQ connors_s_Page_076thm.jpg
7e8de48ec8c971da2ba6c97cc30f3365
efb1f7e6f48fab2c4b04ae497a090b0174824b5c
9344 F20101220_AACPDZ connors_s_Page_032thm.jpg
b91b0e4196c6dffaecbd6ce57549666c
375fc8226798764fcb0bdc37b4d45d1b2a17a8ac
31012 F20101220_AACPFC connors_s_Page_001.jpg
6560e1c2018e36c28f0133081c90d386
323825cb4b57fbbe7b5c818c0383d7784e8b1ebf
8579 F20101220_AACPEO connors_s_Page_090thm.jpg
686eba230001c0fe9167f1b5999cbcf8
e9f8aab109e31a834f81bc2aad7f4bda70042387
36073 F20101220_AACQIF connors_s_Page_092.QC.jpg
d18bc9b11fec9fb3f5f0bcf9105b1a0a
872a324e845b73421bd08466afc0869e84c451e5
12472 F20101220_AACQHR connors_s_Page_077.QC.jpg
4a48cc6d2ac22df2bf266c1407a7b90e
b0467ceddfd5eebd7df05150bf7f1fadaa49d247
34143 F20101220_AACPFD connors_s_Page_051.QC.jpg
f7635b6990daff2d2df71e855e8196cb
ec72191476cb70aaa606baf22890bda063dc1bd2
2211 F20101220_AACPEP connors_s_Page_062.txt
5fd0009f49201d783cb7bb394660c2d5
9f10dbcfa3490ee1c86bbdba1c08862ba607e57e
9032 F20101220_AACQIG connors_s_Page_092thm.jpg
ed252fc67d88a338018e3476ca1c7853
13727b0200b2275245f32955c6b2f0dc4f56c4b1
6277 F20101220_AACQHS connors_s_Page_078thm.jpg
fcfb547c001df513fa50f086cb01c004
02b3f1fdea75f290c679658dda8fe0f680ab060d
73072 F20101220_AACPFE connors_s_Page_102.pro
58c5e8cd3f6abd874393775210010800
2ba4523a73cd3b7b6ad555a6ca15bd4ec3476748
36049 F20101220_AACPEQ connors_s_Page_060.QC.jpg
77d7c0348afce70dbd40a297bad87b78
cff3b9947f34596ad7b402ff8b0dfec5cf546671
37117 F20101220_AACQIH connors_s_Page_093.QC.jpg
32f7f744ede0bb077ed07d171ba245a9
3d2372ff4671366a1a7826ac1d9e2a2361303ebb
19835 F20101220_AACQHT connors_s_Page_079.QC.jpg
8e5af1f6441de7495bf16d05a615f3c0
0545e3b7bda1c319a1a510010b039f51d9403c7b
F20101220_AACPFF connors_s_Page_093.tif
5beb874ed3bdf8097cb24ad6ea0c0ade
0362098588283c1f078cf055481cc59d570059bb
2731 F20101220_AACPER connors_s_Page_114.txt
dbdadc7eb0519afc47061916c72d6104
918c09303a11aa4f880bf924825c5fb3e7e4c35d
8985 F20101220_AACQII connors_s_Page_093thm.jpg
4cb60444713d2c5a671a4e52df28c2e4
aff10421db21fd3641920b6c9dc1384f9f37206c
34859 F20101220_AACQHU connors_s_Page_080.QC.jpg
90d38bca8fc9168d094301518b6ea9b7
5d82f077b4a4b79b4825139584cd7c30df7d8f2e
2752 F20101220_AACPFG connors_s_Page_115.txt
e22bb9bf6f2740b6591d33afd49067ce
fb9caa5b62c29d6fd433d2f615d0c6cdc56ea53f
135760 F20101220_AACPES connors_s_Page_099.jpg
2d2ff7198bbe8401a11b33829caa842c
0c92dbad2cc7134a6b325735ab28edc73370ef81
37540 F20101220_AACQIJ connors_s_Page_094.QC.jpg
fbabbf5f91bf0549d35d76d4fea288ee
2f307c7552fa1de8d4f1d650056ad03990cbfe03
8804 F20101220_AACQHV connors_s_Page_080thm.jpg
40a0a2f39a17bfb2198bee9b61cdede3
b5c6f3d8834f52c5edfb56f8533907c42dc7cc52
2161 F20101220_AACPFH connors_s_Page_084.txt
77ff7003569c61d5fe811dba9d4efdf9
d8cabeb0819422d1a935ed8e409490fe3f5f831e
65843 F20101220_AACPET connors_s_Page_103.pro
f255103590945c1bf7459d495a5f471b
ae68c12e8b8705bd07aa41346ce30d2cadec86c6
9271 F20101220_AACQIK connors_s_Page_094thm.jpg
66fce25a7ff751b7d7db71c126937697
97ba784a8c6a3dd99113ee19ff628dbca14d873d
36722 F20101220_AACQHW connors_s_Page_081.QC.jpg
00b3a64b581d48227ae52a6a7b00ec11
3c60de15da2ff99b501a224131332e03e0f00630
4832 F20101220_AACPFI connors_s_Page_048thm.jpg
dce8f74b26d293cdcb9035e5db62643e
cb1ab77a2bd4e68408bca899c6ef61a8b2b54c1b
36691 F20101220_AACPEU connors_s_Page_019.QC.jpg
f9b76e85d0d8450d8fd6183affaf0297
70fe9767f575260ea7613ab2b79f405d1d8e69e0
8869 F20101220_AACQIL connors_s_Page_095thm.jpg
2eb568b15f465ce08326f661806f5a05
a979679d159fc2469b036399aa41ff147a206fb1
8978 F20101220_AACQHX connors_s_Page_084thm.jpg
3fc574fc4e2e48ca3eb99d8c83a50cda
37c6922112c6940d4119559e508786493f470bcd
2063 F20101220_AACPFJ connors_s_Page_039.txt
a33c0f03efe6e5d4395be017d646a495
b3acbbf71e4bb51f3d190239540ccb94d6d9cd80
2144 F20101220_AACPEV connors_s_Page_024.txt
d7a9f43943e010eb738500f46be847ab
52bad79ac150b693a9fa4cca9f14e9a58f0d09cd
9350 F20101220_AACQJA connors_s_Page_106thm.jpg
fa9296acfe5868db652a2a5a62f9a249
2c492dc7c082e333d09020a419268acf837f1cb4
6076 F20101220_AACQIM connors_s_Page_096thm.jpg
055d1b60990dc6ddc49a2aec2757b3c7
6c57f683ab6cfc2111dd79c3c9376a9b40476f61
35528 F20101220_AACQHY connors_s_Page_085.QC.jpg
c7143f100aa0a50b0cb8b6d258abe503
485dd6ab2c97d1001beffe5c208a3d8e9644dbe6
55764 F20101220_AACPFK connors_s_Page_033.pro
878c7b3928060e31fc7f670bfc7268ba
c25c20dd0d21e91ff3bdfb0bfe2f8b3ca96ca19d
F20101220_AACPEW connors_s_Page_078.tif
a1be23ccaac05b40ae5e46570f353b6d
f4be4e0fe28d2b3525c01f43e28497059a022302
9136 F20101220_AACQJB connors_s_Page_107thm.jpg
00add7c24b1aa38a466edacfea4dd599
69f8170ab2dc16d0b962cfc20b20c76f490e9d1f
17332 F20101220_AACQIN connors_s_Page_097.QC.jpg
48993fab45f2c81bb9ca48d020f30736
8a9e45cc77ad62b4788d731b0418fac8c148a63b
37659 F20101220_AACQHZ connors_s_Page_087.QC.jpg
00cb23a23722cf4ef743bbb28e70ea67
877af94480db449f5096d24cccb6e5798d5c1928
49986 F20101220_AACPFL connors_s_Page_055.pro
f9e2a213b076c386e080921484099601
42cd247deb5a33d9741fbfea86cf31284c9fb366
54356 F20101220_AACPEX connors_s_Page_042.pro
15b26be5d7fe38211da8864a078a62cc
a1e5bbf562612ceaa677d87261658685f36c44f8
40105 F20101220_AACQJC connors_s_Page_108.QC.jpg
389e621aca3f512d121ae4b3129f30da
f82255d7f5454abc6fb8c93647c13e2b421d47a9
4982 F20101220_AACQIO connors_s_Page_097thm.jpg
ac682a1163f4247a092af03adca0013c
a40200daa99829cc27004064e024dd2bc0a901e9
8627 F20101220_AACPGA connors_s_Page_058thm.jpg
fbcf2f576b4af549eb5bb6859319e19b
a4a19054857fec0d721635b3d320a15fff5050ac
9614 F20101220_AACPFM connors_s_Page_109thm.jpg
0c593694c47b2462c51f7110c2ff6a8a
bd024d894956c1823bf8c326fb297ad540ccb705
114392 F20101220_AACPEY connors_s_Page_033.jpg
0728ae21b756eccbd405aa7c294b1854
78a12e38a83ec7baa1211b88bff27c08a0923bd8
9669 F20101220_AACQJD connors_s_Page_108thm.jpg
201c41ac5dafdbf0e29707c6f6889dfc
c542c023369d741461dd6c5a8370c01ec5d2f770
9164 F20101220_AACQIP connors_s_Page_099thm.jpg
dd4a9f24b04d9569dcd4abcd17221e52
5b5c2e88826eb747a93d952f47f6dbd2bce455a8
2115 F20101220_AACPGB connors_s_Page_016.txt
66b2f3c7dd5fd7150aac3b1fdf2898a3
8d646213afacd0b473118d60d09cab2e380c1ae5
84903 F20101220_AACPFN connors_s_Page_076.jpg
ca7d427b38243ded8ab793129e4d7b93
8f011c86aad8cb097cac1ddcab82997b9eb2e616
1051918 F20101220_AACPEZ connors_s_Page_088.jp2
b3fc436c4e934de52d5daf949e50e13c
3ba53f9685b7170769c4a9d9d96a65a59b5a8cd5
36417 F20101220_AACQJE connors_s_Page_111.QC.jpg
3ae8d98cae2f59a1d730727c74cb0ce6
388a022897b76fe9c0e1d73257fdd87c91ad59df
37493 F20101220_AACQIQ connors_s_Page_100.QC.jpg
0d0a8651a5ab5912804e6e485d82bb93
e73c93d44c0343c323f540992d4f9136f74dabb3
F20101220_AACPGC connors_s_Page_055.tif
2bb8d9cb6ae1fb802e38f5c34f3883a4
8535d8a474e035ed485e002df36c5c9736cec454
F20101220_AACPFO connors_s_Page_043.tif
9d8870d69d9a376f3e3a88ceae7625e7
5684160c144351b391240c1314e74e782663a384
9070 F20101220_AACQJF connors_s_Page_111thm.jpg
63a8abc0ba165b249e7e8fd4f5755b44
8efeff9078c807f1a110700550ca369cde327f78
9452 F20101220_AACQIR connors_s_Page_100thm.jpg
c6467bd34168befbdeecfc38b522a320
fb25bce2b7c39c02c69290030dad65fb3e96399a
F20101220_AACPGD connors_s_Page_036.jp2
b824d82ec5e7986901d0bf9871c6fadb
e29efb3ce165777dcccf4405e410ca1116aded5a
1051956 F20101220_AACPFP connors_s_Page_089.jp2
dbda9312ee637c3d509f5866cad079f3
67ac8459257b3375c9e4e0094a33b3d1dde19bd7
42132 F20101220_AACQJG connors_s_Page_112.QC.jpg
d437f307c58b46f66192f1c4568132be
c3b6a835788715d8f3a857b7e681d2d42e2e120d
40398 F20101220_AACQIS connors_s_Page_102.QC.jpg
591d40348da46e8da1dca63ca37b1ffe
783181953a42b3d1d9bf9f12f7f0246bd18ff89d
F20101220_AACPGE connors_s_Page_025.tif
a9bd3e1255d01b081cf7120441c3da2f
81e1ea1ae4b677b57c35cfb8950792362e7ab4fe
8576 F20101220_AACPFQ connors_s_Page_040thm.jpg
38b876935cab0bffa3af723a9be8d5fc
c2b73e32b5e2c20ef3c34de26ed7e8c98fd91f2f
9792 F20101220_AACQJH connors_s_Page_112thm.jpg
0ab7ceacab5ab99f0e5f5bf609af01fe
46bb114060c2b5757073c5aca357bcdc6394c227
9665 F20101220_AACQIT connors_s_Page_102thm.jpg
f66651238624768402899a9df660e1bd
fec8e70167eb20302f493d2e6897b44c01ed990d
F20101220_AACPGF connors_s_Page_043.jp2
1a92936ededa2b48d05ce2fe110b3b39
eb247447d6b74a5a3d42fa3555ee2977f6dda1fa
133 F20101220_AACPFR connors_s_Page_129.txt
94719ca7a1c135ea9496999c67ca18b3
6db84cc741b40a80e41bbaff2434a69b9643d2be
38345 F20101220_AACQJI connors_s_Page_113.QC.jpg
46ca4dd463dca981ce917243c20932fe
256f151ca9d718acc2ade09b0ff7eb0819a776e4
38521 F20101220_AACQIU connors_s_Page_103.QC.jpg
642e195fc974cd719a4fdf9ec88a3e1d
79d7c91c54bd6f009056567a9e319559af8edaaa
1051961 F20101220_AACPGG connors_s_Page_086.jp2
33e95e403e1aba3265e40d53807ac25b
b36467282fc6c919e5c8ce8a06ce55c64ccc896f
8955 F20101220_AACPFS connors_s_Page_061thm.jpg
90ff02da07f184297981130cb460a390
5d205a8423d551c490a381704e74cd578cdc6954
9357 F20101220_AACQJJ connors_s_Page_113thm.jpg
7c9c223f54c995f8653a8f3968233252
3207424b39acf1eeb8e863a920defcb5649719d6
9321 F20101220_AACQIV connors_s_Page_103thm.jpg
db1a3c346846cc2e8c176e82e90e34b0
2bf6df6961513a1e967cfab1934625b84c732e5d
137159 F20101220_AACPGH connors_s_Page_105.jpg
8c068447576f6e3150b670fef5725a4c
6aa47e5b00c00937f5d9edda3669b6cbd09d2d1b
105990 F20101220_AACPFT connors_s_Page_090.jpg
66b8503f4490dd57ec28bc7c3b47dcae
1d06f0144681fa552842f0bd4891434872328449
9168 F20101220_AACQJK connors_s_Page_115thm.jpg
5c0ed5abc0b140a4067480432138abb3
efd5a3a300f29c1e60f6beb0e0aa49c5669a6cda
38302 F20101220_AACQIW connors_s_Page_104.QC.jpg
5521ec839f1969479a4225d3a63523fe
0731790c84898f6d45928f606f90c9710b6704b5
1051947 F20101220_AACPGI connors_s_Page_080.jp2
cea9da946faff15a38e48759d28e71b7
d82b53be187cbf96d481d8cebe372a2a8f4e9e9d
7844 F20101220_AACPFU connors_s_Page_009thm.jpg
112a2f405798979e0fdd667b586825e7
e750243ced9df94ce7c48c2c3d003cafd75973ae
9106 F20101220_AACQJL connors_s_Page_117thm.jpg
6dfdf510ed9526e7547ef53dc9d116f5
a539b3de54d2cc771ddad716aa5d5384e7263c59
8603 F20101220_AACQIX connors_s_Page_104thm.jpg
964bc83c93baf50b32a25046390bfafa
1d1ca485afd2cc1002a16ae23d1c14ab8adcd643
824548 F20101220_AACPGJ connors_s_Page_074.jp2
b6bedee925bf05bd5a3fc428e97c2821
93bfb72718f03908ee9b1d9e3d9bce6d981de145
25363 F20101220_AACPFV connors_s_Page_096.QC.jpg
796c9c811497b2c17f654aba7b8bdc65
862964ef80e0ec85aabf51f108c73db7ebbeeef3
39743 F20101220_AACQKA connors_s_Page_128.QC.jpg
ab3ce1f1ad1ab3273a4b387dbcb42e6c
9733fb9ef5389e9e93f64cf1a9514b150b9d6997
8994 F20101220_AACQJM connors_s_Page_118thm.jpg
eef687406cb22e2cc1271c8220c0e00b
aa5523e3ca9d1c094d07f4d4eca56677b09a351e
39260 F20101220_AACQIY connors_s_Page_105.QC.jpg
6c8152ea17783eeb0b29f24ea9d67117
522a2cc914a1f3d09b16caab0f8f23961a2d5410
36070 F20101220_AACPGK connors_s_Page_041.QC.jpg
3179263526644fab4d4756786d9eeddf
b30f04881df5177fa34f27ac262ad9884b85a787
113643 F20101220_AACPFW connors_s_Page_036.jpg
10da6b52d1da79b136a10e3d0e6bb300
de96973b7b1770c752c2fc2a3582b465d7ddea95
9252 F20101220_AACQKB connors_s_Page_128thm.jpg
e99c50744e3c71603b8fd298b92ad7cb
8a64fc175ffebfc22810001e816ef1655fcfdf3a
36648 F20101220_AACQJN connors_s_Page_119.QC.jpg
8935ce94c6d9f80784228f0c4036a12a
e1be5915fca9bd4943a1101da2a3bbaf3affe7bb
9517 F20101220_AACQIZ connors_s_Page_105thm.jpg
6aa5ae936f9da21d576ea24964a5ac8f
e119d3d87c4b844664f126ee12b8b47c79b7005c
9119 F20101220_AACPGL connors_s_Page_018thm.jpg
2166cf15d8c53241a6bf4d3e56edfea5
d7ec930221bb8f2b91b034452e1eeadccea9a237
114210 F20101220_AACPFX connors_s_Page_013.jpg
2df6bad60e1e79c60be8ebebe25337da
6155d5aac196f2f8cdf18fc75626e5b65acee17a
3397 F20101220_AACQKC connors_s_Page_129.QC.jpg
4c8eee90a9b18b1c23e5d6cedda2131a
2fdd65a1db9926d2bdc27df9e9a65c5147794884
36258 F20101220_AACQJO connors_s_Page_120.QC.jpg
5a31adb77f57a7fcc3b99d1704df9e00
45bb2d246091cd56f1c97b371a81a0b6a8c1c220
2740 F20101220_AACPGM connors_s_Page_101.txt
1b163d51380a09a1253571cf4cfc2ce4
c59ce779288b00096597263825b2d3b2fc3fa0bd
F20101220_AACPFY connors_s_Page_122.tif
9675177b902fd68b50cae82699e466ca
32a152d51e16800e56a81e79e250be2c508325f9
1051945 F20101220_AACPHA connors_s_Page_125.jp2
c7fb6fe169b65f3e1cfba085a253748f
2feeeece46b7b14dda38bb75ad771fd57b767036
903 F20101220_AACQKD connors_s_Page_129thm.jpg
69d2288f1c54b8e9a2687d5388151569
3c7acf5289a898cb93917c43ea83ea894f3b3c11
9144 F20101220_AACQJP connors_s_Page_120thm.jpg
1d3d8b1e5e8e111dd3bcc8d83871acc6
28d8a529d5eb9dfffb109fbc473d7c550b7bc377
6538 F20101220_AACPGN connors_s_Page_005thm.jpg
a806638ab7ccbb200d772b62ffc3e41a
277220e1f23a1545fd3a975665d28b7285296264
F20101220_AACPFZ connors_s_Page_045.tif
4cfa00d73fb130209031b06aee1dd250
7f394ababd56f8fd3f1fe2b4b322d32315237379
F20101220_AACPHB connors_s_Page_050.tif
8c5902dec052efeaecf006bdbe8fff54
db38826d1c0d05c4a13d7a14ec29b59770bba288
34657 F20101220_AACQKE connors_s_Page_130.QC.jpg
85b05f86b8f0c71db4bb0e82902cd034
0c86a57625bf5140dfff8e9da7cbe8eb9de2aef1
40944 F20101220_AACQJQ connors_s_Page_121.QC.jpg
13584d205f13f25c37c2c5866b652543
9b829081da1643dfc82310e7029b5a805d4db40f
96789 F20101220_AACPGO connors_s_Page_050.jpg
955a03847c7ac2391433673b212917d7
9916b6db327c46190253a8c87aff2ab5b0d26455
1051981 F20101220_AACPHC connors_s_Page_018.jp2
8e5f5021901b7c3c3eb1aaeca36788a2
7f5f2e3d06c1370deb7cf50f5c5373460adaebba
8383 F20101220_AACQKF connors_s_Page_130thm.jpg
d5137dd2858f846783bcef4212dd5531
ca912464afad9971d12feb5dbf1c6d95748886fe
9781 F20101220_AACQJR connors_s_Page_121thm.jpg
c70fffc86ddb69bb846b2b28ee277d7d
2b49c322daa26ba7effb451a224dc0fe40f19338
108491 F20101220_AACPGP connors_s_Page_085.jpg
062c6d0238aac2b4af00b64152d13542
4f660be63b29e7f5a1ba7d47288d0d8e6d831062
1051975 F20101220_AACPHD connors_s_Page_111.jp2
e5e7ee79af011b57aecad4acdddc14d0
5d60b749146d1a33ab363618ac0ac2d047f5652a
1380 F20101220_AACQKG connors_s_Page_131thm.jpg
f560605de9837fc8447338c1a47d4604
a53ba9c3b20d67da60b9225acaf8f3a8e39f2f60
36887 F20101220_AACQJS connors_s_Page_122.QC.jpg
7f09622619432ca99ffc329f267d881c
5f2e321ecc75831d315b27306e34dca5e9129054
26118 F20101220_AACPGQ connors_s_Page_045.QC.jpg
3d588201cd36b02b13255e3ec24598e6
6d7e390483af944bac481a905d73199c68fb7395
36551 F20101220_AACPHE connors_s_Page_117.QC.jpg
9102850649d7bf1b1f5b077db414bf0e
255bf38db0779bb51f2724da971f7e11ccd00d43
152719 F20101220_AACQKH UFE0022566_00001.mets FULL
7107738230dea57549d571ab11ca71cd
b607e4299748c70c960fdeaacd692eaeeda1ff4d
9229 F20101220_AACQJT connors_s_Page_123thm.jpg
43be1a0aa22da6c166c47605d0a514e7
e6c25f3e67ceffeca80adc674a5c41307dea8beb
F20101220_AACPGR connors_s_Page_112.jp2
27c12d741952ff515ef3ec1149512d5f
8fcc3acba4c7f584c5112b1bfec1527335320901
5627 F20101220_AACPHF connors_s_Page_079thm.jpg
fa11474b2c98803cd484fc20df2170e7
e464f00c0c5e189591d8ee531bd31cbc32514070
39030 F20101220_AACQJU connors_s_Page_124.QC.jpg
98adf8e3aa8b17f660ca2a3fdf67a646
26c97bf9808f7831f78c0dc0940297bc716d83f6
127816 F20101220_AACPGS connors_s_Page_100.jpg
dace6899414470d182eef29604fd45ca
f360d9641221ee9686bd15931af14ee1369b840f
8885 F20101220_AACPHG connors_s_Page_044thm.jpg
db77942533d124fd044465c307a145c1
795fc50ed53190952e1913c8f887b2de2f5114e8
9440 F20101220_AACQJV connors_s_Page_124thm.jpg
da7ae6d67ce29db1d5c1d83fd30be97c
e383bc8cfdf01c44a021afc45971fd4e978b1156
32078 F20101220_AACPGT connors_s_Page_050.QC.jpg
061163e0f1aa27df412c7288ae741f34
25dcd814e3c00ebf73579096e33a92d1f0d9cbde
F20101220_AACPHH connors_s_Page_125.tif
c06d7dbd500c81218227bf07b354e0f7
e5a445bb62d9dc414393292d01f27dcfc378364b
38543 F20101220_AACQJW connors_s_Page_125.QC.jpg
db02863876a0cc5e038ecf3d91eb85a5
5e40f8bc5b26c228c51bdef5c43e4e9a3d4f9f32
35166 F20101220_AACPGU connors_s_Page_063.QC.jpg
1a8b07aa1fc1eb20b081216b2e5d4b24
970a4d195c62d52bd5aa76665ec8b071c5266f40
18493 F20101220_AACPHI connors_s_Page_010.QC.jpg
0abbcce457de09a0dd1dd0fba75191b2
3b5be11ff354aac290463d49f76ac76a6c4f6026
39486 F20101220_AACQJX connors_s_Page_126.QC.jpg
f8ccf81e95c93567263b09f3b57462ce
e744ca1aabd6c99f251bf89d345063aeff432155
557 F20101220_AACPGV connors_s_Page_001.txt
c186670bc19881a0297738157b9efea8
ca7156fe08ca3b60561b6eb5aeffec1917a21332
4062 F20101220_AACPHJ connors_s_Page_070thm.jpg
60bdc8c4faabbe0298ca828af8c57ccc
33492ab3ecd768a9e8a440fc70a66ab80e7db3d2
9347 F20101220_AACQJY connors_s_Page_126thm.jpg
9d639c79a3e7b2c7328cbe3921aa8805
52017ccddf87483440489baaef146fe43b96554b
F20101220_AACPGW connors_s_Page_071.jp2
b9666fbb8a27def31ad022c971390e11
5f22efee6ce48c8abe0afba0e0f28f33f814bf8e
8967 F20101220_AACPHK connors_s_Page_122thm.jpg
44b98b4356a675b5cda124c324e07e00
08a2e95c89fe3ab6d9081d6acfefa3e380a4102b
8969 F20101220_AACQJZ connors_s_Page_127thm.jpg
76956834070cba4f396ef48e655b4663
f710efc640e93dfeec41c8b04c9ad3c9549ca0a3
9538 F20101220_AACPGX connors_s_Page_125thm.jpg
ed3b93f2b3791bdc20dfc5039f2300f5
419827b753d8d19f9680ec64893bc791962b1651
38344 F20101220_AACPHL connors_s_Page_116.QC.jpg
bbc983642240bc8e573b7ded90883066
0f3e90bbb10c467237fbcbfbf2c161b5b71a0911
F20101220_AACPGY connors_s_Page_119thm.jpg
0da5d2fd2a648d20fb79dfd77da1c9f9
ef5e02087dcac3174e664c5e5d4a952ce4742337
F20101220_AACPIA connors_s_Page_028.tif
54014dac6975e9f37b6c88181124f8fa
a3a5d3b20ed2a34ef83c759fda2cd321736e7a8a
1903 F20101220_AACPHM connors_s_Page_053.txt
d74ab0fd4944a0b76a8c4e4a5e5fcbd9
465eb65a4ca38348437a78d4ab5b53bffc1d3ff3
2410 F20101220_AACPGZ connors_s_Page_098.txt
b33fd8c2c85ba4e00cf715535d35a762
07ec71b43657b08c97a35105613a88012f81c569
40724 F20101220_AACPIB connors_s_Page_114.QC.jpg
82ad1559c8e8ef0219a182bc5b5ac1ce
81b406f82a9bb996e56608f41fc6c7542a455580
F20101220_AACPHN connors_s_Page_044.tif
017f8b74c5198b08fd5544a50333ec17
a7f05d5b5a2a913f4b9d1601a5c77202bb143658
F20101220_AACPIC connors_s_Page_127.tif
7abe795319fd72f3949781bf3d1921c4
580da89286d7e5f19063a8bf6e62f4995232458d
84323 F20101220_AACPHO connors_s_Page_003.jp2
e3f368b12f493eab772d6a8278af82b7
94fd87a41955ddb22728d2af7ead1c31378e484a
38154 F20101220_AACPID connors_s_Page_123.QC.jpg
ee955623ac52145332a7266989905b8f
f64922aeb0b88926629667bc30d825a3ccc83211
4821 F20101220_AACPHP connors_s_Page_047thm.jpg
eec34097642251968e118323a6c975fd
0de377cc1a5f9d911ae6985714545a4b361055d5
F20101220_AACPIE connors_s_Page_035.jp2
1b44daddcd37a9f023ebc54b65298427
a11f81f46d6c83d8dc5308742583774156b93e23
F20101220_AACPHQ connors_s_Page_083.jp2
96d67a34a3a704e3283c46d0fa6cfdc1
6161b674258f6fe912e9ffab6de510faa4ed87ad
9041 F20101220_AACPIF connors_s_Page_116thm.jpg
a661b83fd8f2c9924328c6e3207618a4
2ea42109a20523665b47e8914d53071ccd71f9b2
67574 F20101220_AACPHR connors_s_Page_128.pro
a3456f0d373d552b0f89fe6eada13868
2507e0dfad21bbc50753e734a2f722e1eea227c6
F20101220_AACPIG connors_s_Page_040.tif
bc140d3c57073c2d85f41880b4cca8c4
7f2abad931b3c16bed5c8aa356bdddf49f69737f
2170 F20101220_AACPHS connors_s_Page_011.txt
722eb69cba429e809fdf943cb21c710a
a0d6cb1a6fd9fc3b031b3ec05ff71c4fe9a5810a
F20101220_AACPIH connors_s_Page_027.tif
b929f5dfdafc5b7da1693002f6d0e6a6
691ad885cd276a3abb377582255c1bdd7ac6ee3b
F20101220_AACPHT connors_s_Page_024.tif
f74c731d068edde1049e52b9563f3596
d72fae3ab4110574f4849bd5543352c8c8794bac
F20101220_AACPII connors_s_Page_036.tif
e8cf9ba3c00453be0efd80db4f1a050f
fd5a2e21fffa23003ed2737770c57c7b99eae700
F20101220_AACPHU connors_s_Page_054.tif
d1e993950c1cad28beee7df06c4d74c7
635050c0e9c1ae1bdbc274a8a40ac44fdfd61848
2122 F20101220_AACPIJ connors_s_Page_031.txt
48e4e8b167a9dd7a7d80a9cb7ecf4be0
7342bd43abef762a2697da969e058e7dcb721a0a
140403 F20101220_AACPHV connors_s_Page_126.jpg
e9aaef2ed78d948154e7981f8a1ed7ed
2b4744096e6521d51f1a5d60dc8ea1628bf8f276
9157 F20101220_AACPIK connors_s_Page_091thm.jpg
cab374aa7a426cf47e643884d036952b
68c6bffd68fca4dce9138ee4c6a62d4d681cdcde
2617 F20101220_AACPHW connors_s_Page_128.txt
3105fca87978243e412d863bb9e7e544
f9ba20854613e652b414ad8b99af9b15aeba7c8e
1051978 F20101220_AACPIL connors_s_Page_063.jp2
631e81e04f4014f8bd22a94e32b167ae
e9b95ca938974128eed2ff48249a99a2f798523f
1051935 F20101220_AACPHX connors_s_Page_123.jp2
72c7dd76ae0394de55db77209362cb50
6af5289d28ab60547dd6a81438f9a5ce6248afce
4453 F20101220_AACPIM connors_s_Page_049thm.jpg
8badf5822ca69e8eb1cc5988a54140b8
edf62387e4823c4e763311b8870922464570fafb
2016 F20101220_AACPHY connors_s_Page_057.txt
7734601dd97c5f3f4beb57f9d48feb2c
80f21a68017c4dfabdd47208340d68392832d4be
F20101220_AACPJA connors_s_Page_019.jp2
9b7d832e117f737ee76a86586ccd7d91
8519bd1909073f797666567487456a5367fd3e28
F20101220_AACPIN connors_s_Page_119.tif
c9ef75340b1396627aaf8fd2318abdfa
f3f71d42ab274c1b531456414ba811c387c765c7
F20101220_AACPHZ connors_s_Page_124.tif
12dec988494f3374b2d3fcfb22cbd2a5
8a6246affc2dec2b2708a4e8ecd0acc77da36cf9
34109 F20101220_AACPJB connors_s_Page_071.QC.jpg
3f868f842cebb073f13de85232d4154c
946255608e524811d6f5c170563718d2bf14ce29
F20101220_AACPIO connors_s_Page_120.tif
8b06d1653ca4caec3d2798c542f2a2b1
5aedbf3c25027edd077a96fb2f6c2b3238a3c99c
112917 F20101220_AACPJC connors_s_Page_056.jpg
89878d19252927d2ac5fd59ff088ddbb
4d28a6cf80ca68c4286d4211507fc58539ad8a26
F20101220_AACPIP connors_s_Page_022.tif
4ef504c179aa3885af0018693da14f29
8561b0bfa63f37c79114ee994e2180b5d215acfa
108981 F20101220_AACPJD connors_s_Page_022.jpg
72a0585d98357d0a0c2a3015f5f3a517
ccb0391eca1cf0727a34b41dcc5b5f698a5f3e03
2137 F20101220_AACPIQ connors_s_Page_042.txt
4a759b5685e698ae7cbd6348dd4c7397
ada20874f23460a58095a0d92ae676c989c1a4ad
108443 F20101220_AACPJE connors_s_Page_037.jpg
76f87c8fc133730653ceef4942696ac2
8e62a2618f37e5dd0b4924f8aee14a81fe963543
F20101220_AACPIR connors_s_Page_014.tif
39f5e8a9f906d82ecb7266ea08b16a4f
8d9f8fe380708768a4e92b5f0d05214397b57eb0
F20101220_AACPJF connors_s_Page_005.tif
f7fdd499faa8681ecfd34d632bafdf09
d5b0967ac5c86daddaf552ad54d8a2f57952ef9e
2598 F20101220_AACPIS connors_s_Page_104.txt
a16e16871684aa6f511ecd4ad096a613
b5202caaf886875310f4a87a4157d954f10273f0
56146 F20101220_AACPJG connors_s_Page_062.pro
71ba72a5a2a56b007a0b60603efc3c22
5d2f9f0c8d7f1bd6bda9473e6f58b9814b7a912a
F20101220_AACPIT connors_s_Page_017.tif
94cb0249d4576334d0589ffcf8747d1e
0a387614d56eff4c6c695efaec419dc18c7d70d0
F20101220_AACPJH connors_s_Page_065.tif
eeaec6eabda5f4566c43e108212ba98e
716b9f5ab70de7b3760b170e2aa2b08537e5a0d1
124724 F20101220_AACPIU connors_s_Page_131.jp2
51019cf25f552fd88ca5bae4343f5d03
995dc6c5127c41e12027352907ded87284ff70c4
55437 F20101220_AACPJI connors_s_Page_012.pro
3c64b72984129c0521c6d32e7ef317a1
b7b6c456c0e888f154cf61269625d348be7302da
24377 F20101220_AACPIV connors_s_Page_076.QC.jpg
187cfb36269f4199fd4d37e39c72ca1f
8fedf8ee33d760f01e5a822330b1e2a2773be9b2
F20101220_AACPJJ connors_s_Page_020.tif
38cdd43268df1f0fb7d8ecf43c66e3a5
0d63ff90c847f4bcd5329ede17aa1b567f7b0399
1051951 F20101220_AACPIW connors_s_Page_059.jp2
f5feaba2ccaffff9b21cfe2bdda13b4b
6bb5446b00b35f8953f32b3f01e2f02f59ef5b44
28377 F20101220_AACPJK connors_s_Page_078.pro
f1a95d50d0f98652e95d2e5024c1355e
25cdfa07f4a53320c611182eab59dcdb24a590e5
53797 F20101220_AACPIX connors_s_Page_031.pro
6313af1c877ef95ce894ed7dae560001
07e3a00b0d1d53e9990c1cfba5a9cf1b0b0b8bf5
56923 F20101220_AACPJL connors_s_Page_093.pro
41a328570b921a52bf812343b1484c88
0475a2f9ec43a9257b2cce6bf5ee47ea8ffc51b1
138768 F20101220_AACPIY connors_s_Page_123.jpg
4c7894291aca0e9e24c7abb57fd3ff12
dfe11f8a9baf259a137e1ec87b9d2b6453e80736
2140 F20101220_AACPKA connors_s_Page_013.txt
b449943fa15680b4381c0e4aa8a47bb0
fa0faf44d9ac202d45cca6ba6b8383c7f963da20
8558 F20101220_AACPJM connors_s_Page_082thm.jpg
e2b21dc24a336e70af8f601da545f560
f10832fd40a9067b83189a4f39523d0e53bdb295
33391 F20101220_AACPIZ connors_s_Page_055.QC.jpg
3dbee123f6378dc1afb517f1a9d1f2c5
012b684f19a4dbc7317d9557fe82e1398f66d79b
2280 F20101220_AACPKB connors_s_Page_018.txt
526803a27b12280c41b949aa67b09305
46006828c790758f9bacb1814492c38c8b005bf8
85624 F20101220_AACPJN connors_s_Page_066.jpg
ea7f30b18353762e8b43c35fc75d2564
e8c087dddfed0faba2b5106f99e5e95a1989b47a
50487 F20101220_AACPKC connors_s_Page_056.pro
fa9b9cf86075577d6dcc5e4d6f646f36
b72dff1d5ede5bc3faa41c644af8b255688361e1
38766 F20101220_AACPJO connors_s_Page_018.QC.jpg
1cf025172de8eaa3217cdcd340608f04
d4113437a181b7f38ad45616d2d69bd0ba8713fc
F20101220_AACPKD connors_s_Page_059.tif
2883a4a965819662bba3ad5e0892f580
943cc38f174193402b077254553c0e0aa8b49411
53378 F20101220_AACPJP connors_s_Page_015.pro
a3dba478c4c0a1c165ae261b866321f9
f0e39e60032c4a35b2316ad118aef3ea89663aa8
25580 F20101220_AACPKE connors_s_Page_074.QC.jpg
e51441269b681c2322b37744ec571ca6
7addc20db2630eaf298e4aa494672824adadc728
2269 F20101220_AACPJQ connors_s_Page_025.txt
c8b985818c99ae2640ea772f710924cc
09d4482b7ab4e5d77ee5b9e23dc276f32e5b1718
148013 F20101220_AACPKF connors_s_Page_121.jpg
e0ba2b0c2e112b039f71ecc4e54aa4ec
198fb685fcbf4681076833a746ec3091f0da5ded
2087 F20101220_AACPJR connors_s_Page_009.txt
0b8780619037c3a0e7884ff05772802d
91294d827277a758478a03f66ef002c9517b476f
1618 F20101220_AACPKG connors_s_Page_046.txt
b1b0f778258a90c73b834bda30529079
512d1a3296089e955095f713f2a0690fb72f97f8
63255 F20101220_AACPJS connors_s_Page_120.pro
1677cb32c72cd618992cfddd824c6df1
4b2492cc8a3bf0c2256dea3f9ad499ca2cc87083
F20101220_AACPKH connors_s_Page_098.tif
683afef71260f5da1468437fee39c259
ba401f5ba6972f1591f3aaa745deb5be14138822
F20101220_AACPJT connors_s_Page_067.tif
9bc2dffe84d0932f4bc7025f56daaf36
ea45ec37c0436bcd92659f89417a2c68b4751c1e
110052 F20101220_AACPKI connors_s_Page_041.jpg
91d72e035fbb4b9c55b851094273019c
95cbef08dddff3636d979ab05128b1bf5f511be1
8184 F20101220_AACPJU connors_s_Page_059thm.jpg
43f19ac5ac8b5625fa110593606011e7
075bb4d5671b4162ed0f1a39463a77eb238bcbdd
F20101220_AACPKJ connors_s_Page_110.jp2
28958aa2974460f4a932f19bb93f5f63
3f2481ba2827025d07839a53ef27ead72617411c
55093 F20101220_AACPJV connors_s_Page_084.pro
5b2d75aaf783efb33a0bd04e48b37c4b
a7182d19a69a5e9bd04ecc3b1406b689749df3c4
1051942 F20101220_AACPKK connors_s_Page_013.jp2
5aecc4cb4857b8065b613929155641ee
a044541ece8eeecc0cfdc2e7ce419d489023ec0b
9563 F20101220_AACPJW connors_s_Page_114thm.jpg
caed96603d69fb0b59f8ff8678117ef5
4eed023628f5dce33a1a1a572e6d9952bfe8d75a
F20101220_AACPLA connors_s_Page_038.jp2
b6a8439a1ef19d145a29f66d92384e69
c02b153d6a0e0aa9e3b6bf80261f2eb52cca75c6
112764 F20101220_AACPKL connors_s_Page_029.jpg
8d11e1b23f344c82d6b3c568d2177411
2facc4c5d7f7770f10dd00b5266200159a5312cd
F20101220_AACPJX connors_s_Page_090.tif
70a0449fa0fd1b3be7199563709989d9
c81a319e98328fab3303781573498cca68c86d74
2000 F20101220_AACPKM connors_s_Page_043.txt
4cccf0db288d651748ffccbc2966be2b
ac3f109856b8a0fc1affdd187a940ccab09cff09
114426 F20101220_AACPJY connors_s_Page_087.jpg
2a16c37631e087d890bea691bf768d5f
dd3169322a0d24a7f1370e315bfdf0a6048696be
114851 F20101220_AACPLB connors_s_Page_032.jpg
495a66118281ff862320bbf729733913
8fe96caab5ffc1ac2bb02dfdf05d5a5ef9b3a58e
8551 F20101220_AACPKN connors_s_Page_085thm.jpg
aa1220b6acea80ff1a7f475a7d87d47d
5d71041770693826cc0e287461fa3057b681be88
3309 F20101220_AACPJZ connors_s_Page_007.QC.jpg
6d83790f14b9e0c48b3e6e9e2d1da2d6
bde5f3bcd9d6241c0e2e4c3d3a5f7b0426cb5908
138584 F20101220_AACPLC connors_s_Page_106.jpg
70b4ffd9a229b33791bc6940be0e2cfb
26922dea833ec2282332ccc33bdd977d05cb3271
771 F20101220_AACPKO connors_s_Page_077.txt
3bcf9c7ee815f3b7c52f82d3aa25dce7
4fa5ee159eb7eecf1efd3be6255f2abc4968901a
F20101220_AACPLD connors_s_Page_130.tif
b0ba7c6868b864cff278a97c01e86723
58e94b48d29d0ee40e373326a4e71161fbbc7bc6
F20101220_AACPKP connors_s_Page_071.tif
253185ae0c9f205af490e0ae11b85d98
16edda69020e153772ce71ab590c54ad23c360a8
107715 F20101220_AACPLE connors_s_Page_057.jpg
ce8ee6be0cfb06a1c35b76b54d82adcd
59e7c351d231a0923b33349fab27f15cc36eec78
695682 F20101220_AACPKQ connors_s_Page_065.jp2
5459dce6b793e7165c4172db495b1472
c8054fe09f3333220785f3344e66a07d1a3f0485
F20101220_AACPLF connors_s_Page_052.tif
40beb4e000b67fa89af8e27710b62355
48adf7ea715f551a2326caa703398a2657ba5dea
109325 F20101220_AACPKR connors_s_Page_034.jpg
b9f9969c26b90073ee4d26ce0f9f093d
e570909287caf3992d1659495959d5dc2b88e183
5365 F20101220_AACPLG connors_s_Page_067thm.jpg
1ef0cb3d93acf90576a3e4f167069358
e68bcbb23f260f27a2e685a9b072b7a44ecfcb73
8814 F20101220_AACPKS connors_s_Page_063thm.jpg
c84b41d768ffe83ad6de8ec59e1b9d20
3a1549e5a31cc40241539f09889021998cf3b56c
2682 F20101220_AACPLH connors_s_Page_107.txt
9ac6017871f65be2d69b208aa0a90df6
78870ecec8ad8ed41c8f7ad8490a8a17f5f156ad
2555 F20101220_AACPKT connors_s_Page_117.txt
06a58ae41f75390a350382332557f93b
a966597a603430565d818b576c3ac597e06ed154
109002 F20101220_AACPLI connors_s_Page_039.jpg
36ad965a49b903176628b69253154ef4
28d433fbd287f1a5867f22eaaa5f3205ae6de755
66167 F20101220_AACPKU connors_s_Page_046.jpg
df4d1c303cd191ab9d624114c201609f
786ef22ec819f8ee9a1336d1ebd33e811411dc49
26443 F20101220_AACPLJ connors_s_Page_068.QC.jpg
51e44552b8e6baeb96c58b4be58b141b
890250d2e27183b27728f43ec04ed0410f911f18
F20101220_AACPKV connors_s_Page_122.txt
79b4f6d9e780f984727c2992c33a88c5
afcc5f52886a273502eaca569b591071a37df260
1051926 F20101220_AACPLK connors_s_Page_081.jp2
0db48fa2ff66c9468ebd9e1291498c8b
1eeab69b5f3dbf1dafe75b522f7e8ce2c9e784cf
F20101220_AACPKW connors_s_Page_005.jp2
02c1aaaef06b14a3c9e8e781c6ad6acc
a9271c5e571acdd9f3d46b1980d7428fe53bcbd9
106928 F20101220_AACPLL connors_s_Page_011.jpg
2ea8c899ee9f0ff0393a72e10df9acdb
1c6eec8923fecb96858c7b32fc1088ef40d5bd2c
37807 F20101220_AACPKX connors_s_Page_062.QC.jpg
8d2b0c6bfe96b633f6883ec977a3d55a
001e60459ccbfa1eab3b1cd25ec41762a60c3af6
F20101220_AACPMA connors_s_Page_094.tif
e0ea6c6d47d791d8d3be8c19015e9adf
835da7aea2c35299cd9883bdcaa0841fc62dae15
2607 F20101220_AACPLM connors_s_Page_100.txt
fb137751927004142140b993f6ec6ae2
51cfde9b722c5531636505d93e57b5e6b4f90b34
9382 F20101220_AACPKY connors_s_Page_073thm.jpg
931c4c67ed61cfa9a0ab021c9eaad0b8
76a8be96de0a0aec368b729ff0926ffb1861dcda
F20101220_AACPMB connors_s_Page_016.jp2
d8cea3495bd716957091ca49b57a3231
75209543f3d17a75aafb465aa79d7558e2fb26c1
1051974 F20101220_AACPLN connors_s_Page_023.jp2
2f1f927feea36a1b150767dc58bd8654
f5e5c79395cb748709bc8f74fc542b240106ff26
F20101220_AACPKZ connors_s_Page_009.tif
4488641c14d1ead4c52ac0f072876d85
c230ff36f27d12e44215e74d02e6f4fa7158986a
F20101220_AACPLO connors_s_Page_044.jp2
34844f0ec4c8b9397fbd032a6ab2d6d6
38cf7a20994900e0f3cfba9e6be3e2225839990e
4581 F20101220_AACPMC connors_s_Page_002.jpg
c2fb1dfa0de4ea2852ae8101558ab7db
989898f7265c2c7b6b094de35bdba4dbaa32a5bb
35609 F20101220_AACPLP connors_s_Page_082.QC.jpg
7eaea3de3de8ed81f9f334ab8aeee86d
54386ebe048f914bb5cc66d5d9f8dff90a3e019e
815034 F20101220_AACPMD connors_s_Page_078.jp2
0f0e2d900488820739bcb57ff8910405
40921522571b27b23dced5ed6e0df2cba1695820
8385 F20101220_AACPLQ connors_s_Page_055thm.jpg
bac02477efa76f232532ec226f81b9bc
94008dec3092ba56a95af806348f64a8868c41bb
65939 F20101220_AACPME connors_s_Page_117.pro
c0fb92b98ae9cf15e122f885a3ed4c3f
42a859a02bd2630af4148f428cb220f6b920329d
2888 F20101220_AACPLR connors_s_Page_121.txt
af76bf7a191323a4cb3a4a4fb0af5ac8
319ff0e3152a1576d63f847791c60f813a3286ee
F20101220_AACPMF connors_s_Page_086.txt
fdca5d9ca3e51cbe768aa52106040126
357d1e6c5fde4a75734ca3153c2f29dbe517d3b8
9922 F20101220_AACPLS connors_s_Page_001.pro
8ddb10a187b8fcf1146f250362d2d92f
d5125e4605084c156053c62aecb0e9e600c533b5
51837 F20101220_AACPMG connors_s_Page_060.pro
98bbeeb2ee7a5ec54ecdf41ed4717a68
ca108558b4fde6e72968865a432fe9b4cdc26ddf
F20101220_AACPLT connors_s_Page_041.txt
915ba28b04d7a95c6e748fdf5b2fb510
c8d50996f43153d6b3eb05a88c2907d8b637cc30
2193 F20101220_AACPMH connors_s_Page_081.txt
ac54e62cdf3abe712bc6655dc892cbdb
fca01c97636b2e73656b929a6ef93e73bb11e7a6
F20101220_AACPLU connors_s_Page_063.tif
380be18bfb7875c1615157e75e975bca
5d856a9b45246583b7e44608d86eb6c41f375e2c
35565 F20101220_AACPMI connors_s_Page_028.QC.jpg
cbd6471f46001c511b17fe2b0a80ecf7
be1da4947bdf39bd97d6c2f412119aec09b202eb
61845 F20101220_AACPLV connors_s_Page_097.jpg
6988076831c16714ff392fb7509518b4
accf0459b926d142cf6980b0966c9dc4de2d1eff
25090 F20101220_AACPMJ connors_s_Page_065.pro
ab2f8b45315ebde9f4e9aead8307f7a0
31c45eca8a2f5f7d9bf609c8324e28192b70b34d
151402 F20101220_AACPLW connors_s_Page_112.jpg
3c472f43b4480327b2bdd4cf4c5bf3da
c9195d821d9c8b5be84dc0b26cf4989e93bfbd32
35761 F20101220_AACPMK connors_s_Page_095.QC.jpg
7dd4e8dcaf4b653b5f0a587f18151f1f
69cb81d1a612fda09d130e2dd173099c4b782412
38775 F20101220_AACPNA connors_s_Page_106.QC.jpg
e555c0ec505fb12f585aedd8dfe756da
fad0b87b5d5d5034e4f9c06a4e9a9c5392bd5048
56436 F20101220_AACPML connors_s_Page_088.pro
b27d9cef5fe4732eb2e465a064b4d94f
15e363252e6477dda9737b8ad95c61dee32653ca
F20101220_AACPLX connors_s_Page_056.jp2
3bcd6cf50fb1f34482c735d2b81dffad
a1a15c91d391f591e33740d323f18d9d3e6a2fe2
8734 F20101220_AACPNB connors_s_Page_037thm.jpg
68c42823005207b5c55b96ce83e1ef0b
9423cca4d73ada6d046e574be7474d9614728b9c
8952 F20101220_AACPMM connors_s_Page_062thm.jpg
0f11fb1a40ff704f7f7f2347bece0b04
4dfbcfd13cb09188b6355e6a6c83bd70fb2d8772
37563 F20101220_AACPLY connors_s_Page_086.QC.jpg
7a37e534bde0fd20df9865c69fb70ca8
65b787d2042901b7931064c94a5cee69f733782f
55303 F20101220_AACPNC connors_s_Page_035.pro
66a69154b2aca6d70460b8dfd97bb490
2548248e140f119e0d1164f49e8412aac3628826
39657 F20101220_AACPMN connors_s_Page_083.QC.jpg
366268f7fb7bc3f369f876a6c20c3c17
197daacce6d926adf70c71ae15fcfe54451845b8
35210 F20101220_AACPLZ connors_s_Page_076.pro
653d3d3a63914c40eb3fbc079a901811
4a48abc9e89f9209ce065fcb0cd6b41afa39e2d4
146804 F20101220_AACPMO connors_s_Page_114.jpg
6d93d8c284baaed09853d51023f2e0cb
815cd616daa3f9844d3442920c1275ea75c50f0b
F20101220_AACPND connors_s_Page_001.tif
68ef5542bf6b022d2f361ac9b5e4f28a
9e34f2ab85643b3b38f865fbaed8d1ab6b1d2989
35138 F20101220_AACPMP connors_s_Page_002.jp2
5c45ba1727228cdcaf3b634c0a0dc50e
66226ae26d3e6867ec4ec1f2dd991a0f832f7d23
37213 F20101220_AACPNE connors_s_Page_033.QC.jpg
b91fe4e7d34c85ad88f37bbd2805193c
85328710b90f3111d8a534880d619275bfa1793e
2213 F20101220_AACPMQ connors_s_Page_020.txt
9fcfe9c6444885528ee5934a74a6dbbb
0804449feb0d8acf78aa5f5dca113250ca196463
53115 F20101220_AACPNF connors_s_Page_080.pro
9aa2ced47ab5d3c3d322e473d4f5526b
92a55ec6e0312c5782412d37cccbeaacee1de1d3
136 F20101220_AACPMR connors_s_Page_064.txt
5f6d362112f21cd3eba77a5df981bdba
ecc2a85b12ee3e3bb6e32789f8fe90bc743f0408
1768260 F20101220_AACPNG connors_s.pdf
b42e87f3b46973b9b4baf468239873ab
4f69aaa3b0700937423e6b7341291b6cac814a1b
2174 F20101220_AACPMS connors_s_Page_035.txt
0fd605af96f7bd672be339dd766f6bfa
ba226529499edb582b4dbd63af393cdd37b8a230
37253 F20101220_AACPNH connors_s_Page_056.QC.jpg
efad9896508f72112c0b4768e62db353
9a7accc0058e63f040c5769b834d45f6b280fe5b
2125 F20101220_AACPMT connors_s_Page_092.txt
7a243999b6aaa3e698a4ffe59b51a8ee
d5ffc02e590e98da99600197e8c05824351454f7
F20101220_AACPNI connors_s_Page_018.tif
50dee840cf802a54ffdf2b3a83e28903
3d12b9ddc597778effa1ee080f87ab9fb14fa9c1
1412 F20101220_AACPMU connors_s_Page_096.txt
6642f39b789d31b6f13b190624ce89b1
3a5355b1387b9647d9798001689ecf54b456dd6e
67226 F20101220_AACPNJ connors_s_Page_106.pro
44bffd14fb6d54f4de66ccdeeda8b670
dac776dc7f01355927c67c1a0b8ea4f8fd8e8b42
F20101220_AACPMV connors_s_Page_088.tif
341b41353eefd1e29961e25b02217e0c
46e36ef560f3e831c641342edb69eb9f8ae57916
F20101220_AACPNK connors_s_Page_075.tif
896b07e90aef3dc0db741dc12c23322d
f728dfcec3af13ce1fc41814ce019673bc619992
112931 F20101220_AACPMW connors_s_Page_081.jpg
5f71d0b0639bd8e3e8a328c0947f05e2
c60ca9bc6fcd35ec87038e0a6128c2f131aa8945
36661 F20101220_AACPNL connors_s_Page_029.QC.jpg
81c3f73c51729349b4674c3bb22bf2f3
1934e0bd11248f8d6b05738fed51e23d86066da3
36038 F20101220_AACPMX connors_s_Page_074.pro
d087b2a939fcd014c4361ab3ed300fd8
5ad288575adfe7b443f61ff50b5c5e6b1cc028cc
5283 F20101220_AACPOA connors_s_Page_131.QC.jpg
13d36fe7b2266e012c6c417297302d00
05cbd99339a0191644d1c763e2f83265aac0f4a6
101 F20101220_AACPNM connors_s_Page_002.txt
1e44b46f31fef33bc443734d4aa291ef
0daf9222a16c9a5282309a8aa118d82414627cf4
53494 F20101220_AACPMY connors_s_Page_082.pro
81c9e38cd21e93b8ea831f760bfbf3e8
ebb31bf1615dca2226450b0581c1f272f0957d74
467090 F20101220_AACPOB connors_s_Page_070.jp2
1f8e350943ffde32562e468e773c2393
614c4fddcb74af2a8de04a9f68f046f9a2bcfb39
37204 F20101220_AACPNN connors_s_Page_013.QC.jpg
23c897b5d0df49362c61ba5a5f7938ce
1e560b7aa90bacd51f9f92b3b1b6de35731b10a2
29093 F20101220_AACPMZ connors_s_Page_046.pro
aa46db0938a22e833bf4c5d979efd388
5bf1a6cd04ebb36d54bed558601ec2f747073d91
9531 F20101220_AACPOC connors_s_Page_101thm.jpg
cc953ad1ec40ffc9389d35ed3b4d3d20
7c0d0f3b550ef964ba8fd6fa76bab05e07775c5a
F20101220_AACPNO connors_s_Page_102.tif
e66df94ba71d26eadcf4ad81c0a1aa0d
1c69ecbe7c21225529d28486b0bc66199e702c66
9520 F20101220_AACPOD connors_s_Page_110thm.jpg
b059803fd35bba03d56731429479fa6b
d55193e9592752f9e782408967e59dd132c8a9d7
1038055 F20101220_AACPNP connors_s_Page_050.jp2
3c47193ba0a5f19fc6a8ebb243c7f7c8
d163a3640ca7467451c49afb0f446a7df7c5f2f5
F20101220_AACPNQ connors_s_Page_026.tif
30f620d0682f837997d867ae0978b9a8
e45a7e42c7e2ccbb9f3924aa7c0b018fe8e16cb6
F20101220_AACPOE connors_s_Page_086.tif
c75c66d4feac8397ac5750f8e49d52a9
fa14be6dab4120953ffb896a354fb4ba47fc705a
F20101220_AACPNR connors_s_Page_003.tif
6d306093b1827477098beab899101921
3a3289c7cdc1d4d6db0f367d712a046cba5b6ae9
8082 F20101220_AACPOF connors_s_Page_051thm.jpg
f1c825269ca399f3dbe2b8da434aa2f1
0a159aef9d7c13b752d5c3278a07ba5c09ee9f27
F20101220_AACPNS connors_s_Page_086thm.jpg
cbcfda4136c8911c9acd116e5194609a
45acc00959bac745101fb91c0a66fc343f6e7de3
4290 F20101220_AACPOG connors_s_Page_004thm.jpg
39fbf61955d13a12de5864ed54271a4e
7203bf2516ddd8f4f81fa75430fb3fc37c954490
53772 F20101220_AACPNT connors_s_Page_022.pro
134d076b4fb9e569c9249c650e92757d
a49b802533242d0d8336e2b25ec4b0e6a756c611
113955 F20101220_AACPOH connors_s_Page_020.jpg
55c2408849181a73415a77bf3de4f6f5
79a37d8931f01bac92dc05ec5c7eb2f375811ffc
8766 F20101220_AACPNU connors_s_Page_027thm.jpg
b2f51e58381b84f9b6dc5aeca901d554
7779586d5cf0c7a16e86f410b24379ee52ecfcb7
38394 F20101220_AACPOI connors_s_Page_127.QC.jpg
7ff4f335d3d37d419b37a30c0309d123
03e187e8436a995cdb5936eef4fd04c181cbae13
F20101220_AACPNV connors_s_Page_077.tif
113271d1eb5f9b9edeeceb2abc029ac0
8e735657c9e5adb590ae53999d8c789845e990d4
34048 F20101220_AACPOJ connors_s_Page_040.QC.jpg
54857c88244ef985b00dd0600222fba6
50670c8ec5176c5a69b90ef3dd3a16c4a31b0dcf
111599 F20101220_AACPNW connors_s_Page_052.jpg
ae05cc9f5bf4291b0b07eaf1eb1e9fc7
7ba0c50853adff6a122a27967710c2cf76404c08
52387 F20101220_AACPOK connors_s_Page_011.pro
cd880e15b13c84360e5f6cba95765446
d682fd40af27641fe81d9917ddab31f4e2b05759
116760 F20101220_AACPNX connors_s_Page_021.jpg
9dd2597200af747c4cb8f5d6aa9654a0
ad9e3c58c41c60eea7b820cbe059443709a3b8d9
F20101220_AACPPA connors_s_Page_039.tif
465f8f39ccfef92a2034d1cc51663f48
86100981610524d6d8cde81d8db37d92adf212de
35319 F20101220_AACPOL connors_s_Page_057.QC.jpg
e432488d6c0c3a376b6715ce3e39cc9d
06e95e279cdc9e6c08b9b48d882169de139ad056
8989 F20101220_AACPNY connors_s_Page_035thm.jpg
fe553851bec946343d85809fbac07204
9c6ca2c0deb609d64ef4bdd6496abf7a9c5a6731
9086 F20101220_AACPPB connors_s_Page_081thm.jpg
14e9482c208d3bfd26e0c39597f1db33
98d4e803b8c8cc325c4ffe925461631acd79a21e
1221 F20101220_AACPOM connors_s_Page_002.pro
4b744b5a5c569d0e5945a4ebaebd6b84
073b9b4a733f0e50a6ccba6bf6a2f741d007461a
38468 F20101220_AACPNZ connors_s_Page_115.QC.jpg
b1918f5269bb1b39e3de591f4e6c7d8c
bdf9460faa539ffdab7308cc4393956976489424
F20101220_AACPPC connors_s_Page_002.QC.jpg
71feaffaea786e1818206a6a69f01092
9f1e2d010b3b6ff667192c80f35a3163631087a8
113072 F20101220_AACPON connors_s_Page_072.jpg
4c87d2e78fd67f5b57cedd2d347203da
e43c57690b9839bd313a1be24c39c7710fa486ed
53822 F20101220_AACPPD connors_s_Page_016.pro
e8d75a338c54746ff1d5dd8091cc5e7d
93da20299ee81f6b9fc5dd3618ba25fb8ef846fd
8677 F20101220_AACPOO connors_s_Page_015thm.jpg
35f7d205739039b90d49ea367af40d29
dfafff114fd8fab359af2624447251b6174df245
F20101220_AACPPE connors_s_Page_038.tif
9e9237b846ef3ee48d875b9aead68990
7a7de5a324b0106f9146ea427a6faa1228c3f86e
F20101220_AACPOP connors_s_Page_105.tif
d0006d20a4bc627044f7cfa6b7f17309
bdc5671879c02a765918e79b3ed81a9a3b902e02
2690 F20101220_AACPOQ connors_s_Page_116.txt
66ec60f05e388e26d8d18b38fbac8e83
51dde762334d61df2dd3dd6d22dc11595c2d7ae7
18579 F20101220_AACPPF connors_s_Page_047.QC.jpg
f87717d30c8199c27622063bcf31cfa7
4b85f5e54a5d605b6bb8b2ffdb6c30092212e38c
305465 F20101220_AACPOR connors_s_Page_001.jp2
bd116670923fdc17be334dbc6e942a27
f67eeb2405695f52ae29163dc3bc90e4fa12990a
34811 F20101220_AACPPG connors_s_Page_059.QC.jpg
60b6379900195b2234c0d21a3adf325c
6d6e49eafabe94e0fc7172b1beddb5535349dfad
39059 F20101220_AACPOS connors_s_Page_025.QC.jpg
af3511ea36f0ed176aa1acaa36f9ac4b
27849fcd14188a1d531f98bbfff5c43d3d59fd09
2108 F20101220_AACPPH connors_s_Page_052.txt
5afa3adc2084d4950ee586802444c067
24d20c9824daffe818ee6d95d121d68ef1eaef05
26878 F20101220_AACPOT connors_s_Page_066.QC.jpg
e2e597bf0d5e5b0f50e1bdae9a59281c
59ad3c0bcac7ae649ca291eb079da2739bba6b1e
79729 F20101220_AACPPI connors_s_Page_129.jp2
e28a9c435fd7cb10a735bdf1461200ed
12a21078d52286699575c59f2e5fc87ecf742e86
F20101220_AACPOU connors_s_Page_032.tif
a218b52995def40ad26db9f18dc00891
a0918f578cb3b5d30e636184a48f84526b0756da
69254 F20101220_AACPPJ connors_s_Page_126.pro
da40831ef29c6ad2f441a98077677e76
479ad3b55cf15340507a131821266f342b67a3e9
1482 F20101220_AACPOV connors_s_Page_078.txt
cdc4ab498d24a86b64ffbadf52b962f2
b0baacc3c478479123abaa00c80d6285a6e8b8c2
18955 F20101220_AACPPK connors_s_Page_046.QC.jpg
c95745f5de3398455902c5d6a762774b
769102e5ba22789e720c72acbab4feffa03555a3
37991 F20101220_AACPOW connors_s_Page_089.QC.jpg
3da74108d72630c3a42cb116ce158c24
06c821ef2b5732df5623dacb7cec493789cbafe8
113718 F20101220_AACPQA connors_s_Page_017.jpg
7fea83b76a3ff959681010a00ae1af7a
beda11c3644ded33ac9f77e92c7a2c4007307038
34236 F20101220_AACPPL connors_s_Page_098.QC.jpg
32263b7d89dc7f7c61c851dc25d1954b
edeaf674a023124053b13b5a7c2496ecdd6c7018
38171 F20101220_AACPOX connors_s_Page_020.QC.jpg
0ec3a3f070780232565753e15198f7b8
2fe91f5f62a846b9c6b61a0adaa23a6bba4efa31
117425 F20101220_AACPQB connors_s_Page_018.jpg
ad0e88aecd3b075d407e5fcc666e6b2f
c95f77be042c556a147a15ebb1ca07e2dbbe05b3
F20101220_AACPPM connors_s_Page_046.tif
54fd8784f384dbeeee8f6f6f0d83149f
bf270f50df4f842a22130b771975512b2c6443dd
F20101220_AACPOY connors_s_Page_061.jp2
1cc0c678fb3f3578f219e7f1e73dc93b
c9cd2345b4aeced590d97b5d3673dedb01960bd1
111919 F20101220_AACPQC connors_s_Page_019.jpg
8297f76e0c514d45ea7b56fc4f32c202
1a43eac400bca430a85350e69d6f6c1f5dc5d429
1051953 F20101220_AACPPN connors_s_Page_062.jp2
db5cec78efbfa9bfce244b8497b8233f
556206ee1789191b9d846f5ebc139f2a6f3accc8
15853 F20101220_AACPOZ connors_s_Page_049.QC.jpg
1ec37896ae98ac1f937c0921adf9aa5e
fc294da476e9cf017f1accfb1eaab6a0c5e4055b
115339 F20101220_AACPQD connors_s_Page_023.jpg
74b599f223e87be7c06f8d1978687a61
04c78a6c8723dd642506e739dfe20170e17541f0
197650 F20101220_AACPPO UFE0022566_00001.xml
6d6be20dea34edc55bbeb8b63844eaeb
67863a2327017d2ae3274d50ed8b6c4db6c3f558
108938 F20101220_AACPQE connors_s_Page_024.jpg
f40e7e3b867450697b895e21afa278d0
51dcd5915a933b8145289ec8ccb2793e67a2d369
119075 F20101220_AACPQF connors_s_Page_025.jpg
a50e76e9df0d971d677df7d286d2effd
c09aba018200d148685e0dd67780a652d204a6bf
10289 F20101220_AACPPR connors_s_Page_003.jpg
101d69e1486b4da2e77117b005281cd6
38b2cbc0d737a20c4590e0fdd6ad579886b4bbf6
112070 F20101220_AACPQG connors_s_Page_027.jpg
330bd8526f2fc254271f6126e5cb7d2b
135d1772835be638a32627c480dac43a05c3f37c
54168 F20101220_AACPPS connors_s_Page_004.jpg
f2b3c26d0db17562521748f040603c69
e40ee8e4efb17c5b6205feb1694d68cc79063e4e
108097 F20101220_AACPQH connors_s_Page_028.jpg
b4202198e00f03012b75afafd62f643e
2503210e05c675ffc9c93f676552d8b82505fc7c
120420 F20101220_AACPPT connors_s_Page_005.jpg
37723c29fbcb1bcf139d5639fc86a655
31b367fc060a99409fecc8e318f5bd2347794261
110337 F20101220_AACPQI connors_s_Page_030.jpg
6397be3a9fc8ee4469951dbbe01cf4d7
a0becb80e4b069aacf0c5355dc7407086eea6614
110537 F20101220_AACPPU connors_s_Page_006.jpg
64323d293c0114ad2803dd933fed0924
50bc2c9031f3767037b7ae6e81c3f1871f1e1686
109591 F20101220_AACPQJ connors_s_Page_031.jpg
e65ce1acf8ef63fb628147db8ed0f633
f6698f800370cbab5c28093d77cc0986b5a20731
10205 F20101220_AACPPV connors_s_Page_007.jpg
73b37d257bdd9f5e18d00bca1780acc1
98a302bef8218588db3f97e03bb4f9f45a8ac5f9
111386 F20101220_AACPQK connors_s_Page_042.jpg
93e170e9795ad4f52e6ac7e260fa5c51
5bec5605ef7c45df29ad4e8f1bf35d8fdfb70197
93677 F20101220_AACPPW connors_s_Page_008.jpg
4fffef0f78de2f5121949a68c781776d
22424f47e7a1c280f4cdc82368a908ceb3359c8a
112655 F20101220_AACPQL connors_s_Page_044.jpg
ba4a0f75e9b3f1857bf7e88e86352dfc
04a5d157a09325b9803f63f883de2c6921f2e49b
103216 F20101220_AACPPX connors_s_Page_009.jpg
32d89bfbd8c8879fe100bb395b1541b4
6d90243b2efe600e13148af2245a5cc76ae85108
81603 F20101220_AACPRA connors_s_Page_068.jpg
abb203feaa2c48bd5aadf2f1cd4d10a2
ff7d728de8dd458be9a7364cf905ba81790b886e
75863 F20101220_AACPQM connors_s_Page_045.jpg
0057569c2756038dedff6ba411a75d4e
5dc8a1276771f0aba5af8bfd4d6c3eec6fc42eea
55513 F20101220_AACPPY connors_s_Page_010.jpg
ce0667c6d1c730935078518a2ca71072
7c595a0a3ebacc008b63b12b862a75a0f19483ba
85187 F20101220_AACPRB connors_s_Page_069.jpg
2937615a9e995e0c18b9da6e9f583ca5
4f7663523b49058da12b02806a2b3cddd65d3e03
69603 F20101220_AACPQN connors_s_Page_047.jpg
bb2e08dbb0811d8bb3ad4e2f32cde2fe
3f75afa3a7ee0c6d33b38a75afba3229a425d2e5
109356 F20101220_AACPPZ connors_s_Page_015.jpg
bf372292bb6cdc8a938255f7f519bd5d
9b4d1103f619373b4d2d13fcb6bc534322de50a4
50361 F20101220_AACPRC connors_s_Page_070.jpg
c152f340d586d7de9d89ac4980b4813a
1375ba4329e16226b5ee561e93c59aacc7fc5473
59256 F20101220_AACPQO connors_s_Page_049.jpg
d8a9ad36a45fa9726c6b9be623f59266
2353c5b3d555addc17306424f63a0b3c563be53b
104702 F20101220_AACPRD connors_s_Page_071.jpg
14590c4c4a913e7bb85dc25518734446
859de9626b0567f59523d71260b8278b808ef20f
100929 F20101220_AACPQP connors_s_Page_051.jpg
733d82834f106bc1e51bc6cb69192a76
8bc5c7ffe507fad4a13f7993095b2f38f05f73ff
112433 F20101220_AACPRE connors_s_Page_073.jpg
aadd9eb986eab5505a74f16c6f5bfc4c
691e7e08ef6dab7d883a9a0240e4588de2c29022
115781 F20101220_AACPQQ connors_s_Page_053.jpg
6237cffce7359254681cf9eaaa7f5ca0
acef66e1ee54b3c487c26624d5b9d6bab6e3859d
76064 F20101220_AACPRF connors_s_Page_074.jpg
8eb4ef7d08e4976f143ce7284c840cc1
9310190d8bcd4e80a41bc97e4d3520504436e87d
113850 F20101220_AACPQR connors_s_Page_054.jpg
d2de493db488909c1aa2abcecf302cbf
7c42e6bd60fe28b7182d8eab987b45e583b81fee
50680 F20101220_AACPRG connors_s_Page_075.jpg
59f7036610ce2779b40d67245e6a251d
8fe4981967c1241e36ba4c2bd94bbd5db0aa014e
103564 F20101220_AACPQS connors_s_Page_055.jpg
bce6363842f0bf231262bcd38810040d
11067e0e4599756cbfe79ef3ba0b1b3890133bcc
108246 F20101220_AACPQT connors_s_Page_058.jpg
fe9ae2ba14ef540d6bb3ef00a575e5cb
3eccd5ca41bedef6745a4707af57e0a277e3aca0
76992 F20101220_AACPRH connors_s_Page_078.jpg
24d95d9b2fe10bfd4d40e51d26dcef7b
c941528b5a2df9577396325cb6bc82208efc3cec
59258 F20101220_AACPRI connors_s_Page_079.jpg
6e4db54af93ad75a3928509aed7d9c05
13899c17abc6abb8c95b33961327b565505c8b2f
106299 F20101220_AACPQU connors_s_Page_059.jpg
465d2565fdb2abda659d2b3a4ea7dbc9
0f4769ea0d2d92ec7addaa3ff265c07fd6ce54ff
108428 F20101220_AACPRJ connors_s_Page_080.jpg
4a0b3de7fcf2af57599b8890dcaa3e4f
94c747781618802d923924e00a1af47c0b7acc79
107671 F20101220_AACPQV connors_s_Page_060.jpg
fd4e961138d29ef9033f1cf55b7ad7be
9d2284404e24150f206ef2dd86e46a6c38e6726c
108290 F20101220_AACPRK connors_s_Page_082.jpg
87e4e11333f1ff7ba7befe2844ed74c6
55b780d22379894d09882d84e87166fe88175fce
108833 F20101220_AACPQW connors_s_Page_063.jpg
e128bc2eecede6ae146b97969388b47c
4df633fa7c22a6a3a3c41874c86948bda8c62ee8
140890 F20101220_AACPSA connors_s_Page_110.jpg
8096c7734fc5ab94483063a9664ce3be
1d7ea77f163bfc663687edfb33bf9240c972109f
111389 F20101220_AACPRL connors_s_Page_084.jpg
bfa62c7f1c3db567d49bb15c6ee271c0
ca88183d7f842b9be31c19e1a20bc1f3e0cf2df7
9286 F20101220_AACPQX connors_s_Page_064.jpg
8e7bb082c6bee3f7a5aae72d964e53fb
3eb11687176379a0c1a11b2da6a53619b093734b
123246 F20101220_AACPSB connors_s_Page_111.jpg
50893bca8701f2a9b2c191daf7c90261
7c5757f5d6a8fd17ef6aab5bde89684a3afef9d9
114651 F20101220_AACPRM connors_s_Page_086.jpg
1f5a2bfea69ea58e54cc30a70f1bf16d
3a2e94622781b9e5af2d1bb65e94ecab6c920f05
68314 F20101220_AACPQY connors_s_Page_065.jpg
aff45c6f9065daaa24c276f29505b499
ec91127f2af1a18bf4785369328bde248e328e97
130461 F20101220_AACPSC connors_s_Page_113.jpg
8adefd9069cc8700a92360854511be23
7be267c3ba2924443f0c64d7f8064fd7884a5e2a
117330 F20101220_AACPRN connors_s_Page_088.jpg
5f0b7c160a84cb8f51f8fd121d17d1db
e5ba8615ef3ac4f3f0d7fd9dd5d3996e14695948
59613 F20101220_AACPQZ connors_s_Page_067.jpg
d4e51a795680deee25addb97411e30fa
163f23b4ebb84daef21f5007fd7e60f1572bc0dd
139444 F20101220_AACPSD connors_s_Page_115.jpg
fe7b8efe8472454928afb3c6eff2c41f
d3aaaf4c9a8c41043297b650522bf712029ad02e
116983 F20101220_AACPRO connors_s_Page_089.jpg
744343929d4e51aba17159a3d8cb28a3
b01850b6bd4cc4a35f64e581f309e94fefb2804b
132102 F20101220_AACPSE connors_s_Page_116.jpg
e519b80ad3382e5e30b57aa077e5bf6b
1675a0eda73aafbc4f7d57f7b98245716aa99d4e
119301 F20101220_AACPRP connors_s_Page_091.jpg
ac6fb22308d70b792d0ed3256ffeddb1
57e27fde6fee3684445973fbda48a29e94339aec
136749 F20101220_AACPSF connors_s_Page_118.jpg
8b6e30a623c46e9aa720f47732f14a0b
37becc0ee3cd3e72b585797df54ebdb3787a04ab
110117 F20101220_AACPRQ connors_s_Page_092.jpg
cf2479b3726bc9874b6f803addc9c101
84ae6437dee0574515a34bc4e2778efaed9803c8
130952 F20101220_AACPSG connors_s_Page_119.jpg
2936731a260bbf6eeeb7e258deecfdd9
8d9445fb12dae010b30f609916ab1efa4c3dba96
114258 F20101220_AACPRR connors_s_Page_093.jpg
3497cb52d589cf7f3e95c827fc548b78
fbc3ee2330cf457ca6ba2bb915849ce1693a6b26
124637 F20101220_AACPSH connors_s_Page_120.jpg
4514b2b2b3322a63f2f37ab18dd2f84a
0c87990d95ba71b93c57f37a4b7d73d9512c883e
111715 F20101220_AACPRS connors_s_Page_094.jpg
e9ff98872a6d1bb70604a2b0090f271d
b4782be798d296c2fd93372d97184186968dd3df
110556 F20101220_AACPRT connors_s_Page_095.jpg
d6752c2b5a3a099d90b6af2e02fe4af0
5e5f92d7d5bedba9248aa319aea814ec23e1b6e9
132036 F20101220_AACPSI connors_s_Page_122.jpg
4d420b20926d860410e8636ffa6bd115
306c14e49d5c9014dadaf5cbd8ce2d027f8257b5
117401 F20101220_AACPRU connors_s_Page_098.jpg
84e31ad5f4bf6c086faf3b846af2b8dd
9cbcf10ea23cb756271206c9fbda7b0c4b94b35e
134885 F20101220_AACPSJ connors_s_Page_124.jpg
1c01cfdd502babf4d26c53d62839a105
69d20b986a32fc074b74e53089cc65c1df4e5577
141134 F20101220_AACPRV connors_s_Page_101.jpg
8f8e3da9549dbb2751f8dd0e8b715507
42fb7010c564b30e9b0d91fe2e5bd055ef7031b5
137368 F20101220_AACPSK connors_s_Page_125.jpg
fd8a9b6e36318428676c7b987d4fc5f8
7bec8fb0afaf1840c711f4d29b22144c6981018d
134699 F20101220_AACPRW connors_s_Page_103.jpg
1f56d28fb22fad8f454d8bd8c69fd8c1
5f5c833ada3b5438612e973c17e3b2dab7b039bb
132857 F20101220_AACPSL connors_s_Page_127.jpg
9c4420469e24a0f4b721654c2f352352
e244b0cc6293e35da1b4096328a63d4fb33bc029
138780 F20101220_AACPRX connors_s_Page_104.jpg
5769b25e39d0e68051d60f387f571331
c4a703e6689f1114286a6eb1bf14b21f632cd097
1051943 F20101220_AACPTA connors_s_Page_020.jp2
b2eca3aae64760e6f932e91a1365dde7
320e7f41d265c5b9565190df1e5e10ac4fbe131f
142811 F20101220_AACPSM connors_s_Page_128.jpg
d8fa1244ed389184d04ad1db54d93be0
1bb3909d6ce709f98ba9f91b04a2be230d5467f6
141783 F20101220_AACPRY connors_s_Page_108.jpg
2ec3c7a00d03caec20eca34662eb59ac
cfe0fa51b9ebb13f5fc4a2c80afb29cf994bfcf4
F20101220_AACPTB connors_s_Page_021.jp2
261e2827f8d42361140e43077127a643
9fb1a83e3af9aab431823f094a187f10661cb900
9343 F20101220_AACPSN connors_s_Page_129.jpg
e801d519b964ff193650497a1ea2eac4
abed59e0a2060fbdd8a20f998979fff478057601
134984 F20101220_AACPRZ connors_s_Page_109.jpg
475bfb3ecb27803c4e75cbf681734594
90561f88ae5366ba425769c9b806f5cd71fb20b2
F20101220_AACPTC connors_s_Page_022.jp2
8f4ceeb3c31975ef3ba942f14552b43e
e58b61a935f1195717a1bda8da57225fc60fc461
108040 F20101220_AACPSO connors_s_Page_130.jpg
86f5d3e43ad16a8eae0007a778f76403
28f5f878526d21ad03c3099232a23d2f3f2d31bc
F20101220_AACPTD connors_s_Page_024.jp2
22f48d61052fc80245076e58dc85e3fe
6047ca59e898a09ed828f88b2996aac4876d3c74
14175 F20101220_AACPSP connors_s_Page_131.jpg
ce052e07f37e8e22d26c20817094daba
978989dcf8781533d122168261e72bd7a90fb98e
F20101220_AACPTE connors_s_Page_025.jp2
9662ab67e51f5408ae62afab1726f628
63a3a8175840c9400d3c8dbe57fc728067e43e15
577229 F20101220_AACPSQ connors_s_Page_004.jp2
79962f0ca4c68ea77fe484cf253dc1f7
390f0aafd339cc218077214edb659652e2f2d371
F20101220_AACPTF connors_s_Page_026.jp2
133123dbbe4162d9d5e7088a62251a9b
fa23f95904873f703f14592a08bb28f36e653279
121688 F20101220_AACPSR connors_s_Page_007.jp2
181f1316415720384e882ec4e3e26a55
49983991ff3e73f16de16263ea96962d474bb73d
F20101220_AACPTG connors_s_Page_027.jp2
2cb7cae5aa6a3b2ebaef581b8658f70f
9492cbcaac1cb47ff246f25388dbe08afa45e0bd
1051964 F20101220_AACPSS connors_s_Page_008.jp2
c77456bfc6b84b4ed985789a78327639
6be031956b55ba2a76ed1be8ee0c8fd5da8e2a6c
F20101220_AACPTH connors_s_Page_028.jp2
0c077233c52d8c78b084355fe6144d07
d878dae2bf0182d3e3af867740e01d4fc712f6da
F20101220_AACPST connors_s_Page_009.jp2
1bbe169f7d0814c87d07840d46e4ad47
630f6467c6f1d3bd360fd08edf9a1ad22f2e00e9
F20101220_AACPTI connors_s_Page_030.jp2
1773288ad2ba7ecad5ceaeebbb9e2bab
898db4ee38b1af71e2462e90e0f952e28ab5c230
585017 F20101220_AACPSU connors_s_Page_010.jp2
10ace02c4da1ad81e7ad8aa7015cf7d2
e1590ed8b507100d30798da7bb0c4f29ddcd2be4
F20101220_AACPSV connors_s_Page_011.jp2
7b6c1e5bae8a5e50a72dde1ed011d8bc
30cc490a7894556612a83a3ab8e8d982d8de4c38
1051911 F20101220_AACPTJ connors_s_Page_031.jp2
b12237be33021f73569f005af103095b
af1610d770f92f0fc2532bcf72839e3e67d63fcb
F20101220_AACPSW connors_s_Page_012.jp2
b5cfefb70fce04584458c0df5d2e0a48
3b90a009a99215ebc42fc1b9c86420c835ab219c
F20101220_AACPTK connors_s_Page_032.jp2
bf47c569bf8b9232abcbdb0a27401be3
0fdd43d1a7852e84aa55b4f857bbe6a6bb5ee88f
1051970 F20101220_AACPSX connors_s_Page_014.jp2
f7168365af1796b93f7a8df9e0e45353
1431ad6862a5948614d36aa904d6bd2fa303424b
79159 F20101220_AACPUA connors_s_Page_064.jp2
463320684b1b19215966676d36042c44
c6749820b59de6aee2127ca6a312ce26a107d3aa
F20101220_AACPTL connors_s_Page_033.jp2
70f9a0864f44e28deb8572f22b3a9424
a64432d5bc3ef2635f6ca9002cf5ef811c271872
1051931 F20101220_AACPSY connors_s_Page_015.jp2
3a232e43aeaa0c88f8053735c9c41bdd
da25a6346c16e23e6b119e224fe29798a08690dd
850575 F20101220_AACPUB connors_s_Page_066.jp2
e084d2e251f54589ba308cb6ee4ef3df
5efbed1c7725a7b3085ee21775b286de6ce8fdf3
F20101220_AACPTM connors_s_Page_034.jp2
39d443761d19187f40dfb6a086c02b53
80ab3d65bc3b03d185e6a03f05537edc7a577b87
F20101220_AACPSZ connors_s_Page_017.jp2
9583b99cb80efebd52f25510a699c711
8bd8a69fc680450603b617fbedfb2a82b51b348c
548527 F20101220_AACPUC connors_s_Page_067.jp2
345a3353341aa68c57ec3e2274742af8
8c681457d68749ca0521a2fef5bac017a01fd49d
F20101220_AACPTN connors_s_Page_039.jp2
df022d60685714bf09fc63e43c9ace53
14a1b6c6488af72eb04797c2f01358955ac59be8
784229 F20101220_AACPUD connors_s_Page_068.jp2
a719073e71dfd34b47566627f5b37301
e03e4d16d736d45b20d34e119ca8cec91473f993
F20101220_AACPTO connors_s_Page_040.jp2
e4622004e9e51b91f3cfc93ac76f8af4
724dc78ed111094668301a8b05d7b6d2e2ae66b0
855673 F20101220_AACPUE connors_s_Page_069.jp2
d5ca87582e4efb122498f6dc798eaa3b
d3dbf2c8adcaadcceaa298267e7746d0532f2e75
F20101220_AACPTP connors_s_Page_041.jp2
e6caae8457875aa6948962f7080398dd
f5b27deb50b47a7bffd1a0f6f05e548999525b25
F20101220_AACPUF connors_s_Page_072.jp2
fd058892611ab7220a7ae4ce623688d9
52e83618d74659f33b4b628c6225c2ebc10fe66a
1051917 F20101220_AACPTQ connors_s_Page_042.jp2
985865a4762f7e75a1c7235bc3b8861c
8e7c37965db2a7829b49fbbd40d2e62560fd088a
F20101220_AACPUG connors_s_Page_073.jp2
8754bbf29ba91bfb783a56c24bd17da4
6b9d01cdc5b3b5278ac3924b07504945a4524118
826017 F20101220_AACPTR connors_s_Page_045.jp2
33024c635b5fd2601190d09c15bdf1f4
773e9f1643325c70c0706a214b04e597ec41d5e6
48045 F20101220_AACQAA connors_s_Page_071.pro
fb4cdc0ec8058eee8ea23e739e56e167
19f2ac428481823b99a42e6c468614cd015aac59
526291 F20101220_AACPUH connors_s_Page_075.jp2
2f67f1542b23bb504f972fa7dbfd229d
7691d1be6b1cef526750e1511b211d6cfaecaa35
684569 F20101220_AACPTS connors_s_Page_046.jp2
7e29bff48cd1c160b1096771164e6c84
8f235a68c00f0227d000bcc8196d63cdb1dc90ed
53516 F20101220_AACQAB connors_s_Page_073.pro
cfe21c93fb22de33aff0d7b464e4291d
cbf78343653cc57ccb4804460427a97bfa4c4ea2
1017102 F20101220_AACPUI connors_s_Page_076.jp2
8028026ffa0fd5305047c7275c25efa4
aefcf87ba43298eee3c3e13177c9a26804a2b191
F20101220_AACPTT connors_s_Page_051.jp2
ce1a09d6bd259beb604edd7067d6f6e3
0fd79e980289a51f2933952756202f37db9b6088
16518 F20101220_AACQAC connors_s_Page_075.pro
ec2fe89bcca887926ab75620be22c4bd
aae7e7fc4335876731691eaf60560056779acc3a