<%BANNER%>

Role of LEK1 in Skeletal Myogenesis

Permanent Link: http://ufdc.ufl.edu/UFE0022557/00001

Material Information

Title: Role of LEK1 in Skeletal Myogenesis
Physical Description: 1 online resource (93 p.)
Language: english
Creator: Tsuda, Shigeharu
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Animal Sciences -- Dissertations, Academic -- UF
Genre: Animal Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Satellite cells are skeletal muscle stem cells that play a major role in postnatal muscle growth and repair. In healthy muscles, most satellite cells are in an inactive quiescent state and localized between the sarcolemma and basal lamina of the muscle fibers. Upon stimulation, such as muscle injury or disease, they become activated and muscle regeneration occurs via activation, proliferation, differentiation, and central localization of satellite cells. In spite of their active recruitment during muscle regeneration, the absolute number of quiescent satellite cells remains unchanged, suggesting the maintenance of satellite cell pool by the self-renewal. In mouse, a novel centromere protein LEK1 significantly affects cellular proliferation and differentiation, however, its role depends on the cell type and developmental stage. In C2C12 myoblasts, ectopic expression of dominant inhibitory C-terminus portions of LEK1 protein significantly stimulated proliferation and inhibited differentiation, suggesting the inhibitory and stimulatory roles of LEK1 in myoblast proliferation and differentiation, respectively. On the other hand, the effects of dominant inhibitory LEK1 on myoblast differentiation depend on its size in MyoD-treated C3H10T1/2 cells. Smaller LEK1 mutant (22 kDa) had no effect while larger ones (28 and 47 kDa) significantly inhibited differentiation, implicating that there may be an important domain between 22 and 28 kDa of C-terminus most LEK1 for myoblast differentiation. During muscle regeneration, expression of LEK1 protein was elevated in the most heavily damaged sites during the proliferation phase of muscle regeneration and maximal in the sarcoplasm of regenerated muscle bed during the differentiation phase. This observation supports the notion that LEK1 inhibits myoblast proliferation and stimulates differentiation. Interestingly, virtually all LEK1 proteins translocated to the central nuclei while some of them were found with the myonuclei in the satellite cell niche in the fiber growth phase. These data implicate that LEK1 may play multiple roles during muscle regeneration, including inhibition of proliferation, stimulation of differentiation, central translocation of myonuclei, self-renewal, and maintenance of a quiescence state of satellite cells.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shigeharu Tsuda.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Johnson, Sally.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022557:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022557/00001

Material Information

Title: Role of LEK1 in Skeletal Myogenesis
Physical Description: 1 online resource (93 p.)
Language: english
Creator: Tsuda, Shigeharu
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Animal Sciences -- Dissertations, Academic -- UF
Genre: Animal Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Satellite cells are skeletal muscle stem cells that play a major role in postnatal muscle growth and repair. In healthy muscles, most satellite cells are in an inactive quiescent state and localized between the sarcolemma and basal lamina of the muscle fibers. Upon stimulation, such as muscle injury or disease, they become activated and muscle regeneration occurs via activation, proliferation, differentiation, and central localization of satellite cells. In spite of their active recruitment during muscle regeneration, the absolute number of quiescent satellite cells remains unchanged, suggesting the maintenance of satellite cell pool by the self-renewal. In mouse, a novel centromere protein LEK1 significantly affects cellular proliferation and differentiation, however, its role depends on the cell type and developmental stage. In C2C12 myoblasts, ectopic expression of dominant inhibitory C-terminus portions of LEK1 protein significantly stimulated proliferation and inhibited differentiation, suggesting the inhibitory and stimulatory roles of LEK1 in myoblast proliferation and differentiation, respectively. On the other hand, the effects of dominant inhibitory LEK1 on myoblast differentiation depend on its size in MyoD-treated C3H10T1/2 cells. Smaller LEK1 mutant (22 kDa) had no effect while larger ones (28 and 47 kDa) significantly inhibited differentiation, implicating that there may be an important domain between 22 and 28 kDa of C-terminus most LEK1 for myoblast differentiation. During muscle regeneration, expression of LEK1 protein was elevated in the most heavily damaged sites during the proliferation phase of muscle regeneration and maximal in the sarcoplasm of regenerated muscle bed during the differentiation phase. This observation supports the notion that LEK1 inhibits myoblast proliferation and stimulates differentiation. Interestingly, virtually all LEK1 proteins translocated to the central nuclei while some of them were found with the myonuclei in the satellite cell niche in the fiber growth phase. These data implicate that LEK1 may play multiple roles during muscle regeneration, including inhibition of proliferation, stimulation of differentiation, central translocation of myonuclei, self-renewal, and maintenance of a quiescence state of satellite cells.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shigeharu Tsuda.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Johnson, Sally.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022557:00001


This item has the following downloads:


Full Text

PAGE 1

1 ROLE OF LEK1 IN SKELETAL MYOGENESIS By SHIGEHARU TSUDA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Shigeharu Tsuda

PAGE 3

3 To all scientists who work for world peace and human happiness.

PAGE 4

4 ACKNOWLEDGMENTS First, I thank m y advisor, Dr. Sally Johnson, who gave me the opportunity to work as a molecular biologist. I also thank my committee me mbers (Dr. Alan Ealy and Dwain Johnson) for reviewing my thesis. I could not have completed my research without the help of my laboratory colleagues: Ju Li, Dane Winner, Sara Reed, Sara Ouellette, and Jennelle McQuown. Especially, I could not have even started my research without Ju Li. I will never forget her kindness for the rest of my academic life. However, before anything and anybody, I woul d like to thank my mother Sanae Tsuda who sold her house in 2001 for my American dream: contribution to human happiness via science. Thus, it is now my obligation to work fo r human happiness rather than my own profit as long as I stay in the academia. Whenever I must c hoose either the reality or ideality for the world peace in my academic life, I hereby swear to my mother that I will choose the latter as an educated adult human. Although this thesis is not su fficient as a gift for my father Haruo Tsuda, I want him to read behind the lines of this thes is in the heaven and think why I am his son. I deeply thank Dr. Stager Joel at Indiana Univer sity who has always been honest to me as a human. I also thank my brother Dr. Shinichiro Ts uda who has kept giving me an advice from a professors point of view. Also, my best friend Rebecca Crisp perfectly solved my decade academic problem and gave me the direction in the American academia. Finally, from the bottom of my heart, I thank Naomi Taguchi who loved me the most but gave up the love because of my American dream. In the publication level, I woul d like to promise my everlasting love toward her. Warm-up is well done. I will proceed further for the world peace under everybodys support and love.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF FIGURES .........................................................................................................................7ABSTRACT ...................................................................................................................... ...............8 CHAP TER 1 LITERATURE REVIEW .......................................................................................................10Introduction .................................................................................................................. ...........10Skeletal Muscle Biology .........................................................................................................10Muscle Structure ..............................................................................................................10Muscle Fiber Types .........................................................................................................13Skeletal Muscle Function ................................................................................................13Satellite Cell Biology ..............................................................................................................15Myogenesis .................................................................................................................... ..15Myogenic Regulatory Factors .........................................................................................17Roles and Expression Pattern of Pax7 in Myogenesis ....................................................19Myogenic Capacity of Satellite Cells ..............................................................................21LEK Family Proteins ..............................................................................................................21Centromere Proteins ........................................................................................................ 21LEK Family Proteins .......................................................................................................22CNEP-F/Mitosin ..............................................................................................................23LEK1 Protein Structure ................................................................................................... 23Subcellular Localiz ation of LEK1 ................................................................................... 24LEK1 and Cell Cycle .......................................................................................................25LEK1 and Cellular Differentiation ..................................................................................26LEK1 and pRb .................................................................................................................272 MATERIALS AND METHODS ...........................................................................................29Gene Cloning ..........................................................................................................................29Cell Culture .............................................................................................................................29Transfections of DNA constructs ...........................................................................................30Western Blot Analysis ............................................................................................................30Immunocytochemistry ........................................................................................................... .31Bupivacaine Injection ......................................................................................................... ....32Immunohistochemistry .......................................................................................................... .32Statistics .................................................................................................................... ..............33

PAGE 6

6 3 RESULTS ....................................................................................................................... ........34Expression of LEK1 Mutants .................................................................................................34Objective ..................................................................................................................... .....34Creation of LEK1 Expression Plasmids .......................................................................... 34Expression of GFPLEK1 Mutant Fusion Proteins ........................................................ 35Dominant Inhibitory Effects of LEK1 Mutants on Myoblast Proliferation ........................... 35Objective ..................................................................................................................... .....35The LEK1 Mutants Stimulate Myoblast Proliferation .................................................... 35Dominant Inhibitory Effects of LEK1 Mutants on Myoblast Differentiation ........................ 36Objective ..................................................................................................................... .....36The LEK1 Mutants Suppress M yoblast Differentiation .................................................. 36Establishment of a Muscle Regeneration Model ....................................................................38Objective ..................................................................................................................... .....38Muscle Regeneration Model ............................................................................................38Role of LEK1 in Muscle Regeneration ..................................................................................39Objective ..................................................................................................................... .....39Expression Pattern of LEK1 ............................................................................................ 40Expression Pattern of Pax7 .............................................................................................. 414 DISCUSSION .................................................................................................................... .....65Dominant Inhibitory LEK1 Mutants ......................................................................................65The LEK1 Mutants Promote Myoblast Proliferation ............................................................. 65The LEK1 Mutants Suppress M yoblast Differentiation ......................................................... 70Establishment of a Muscle Regeneration Model ....................................................................73Limited Expression of LEK1 in Healthy Adult Skeletal Muscle ........................................... 75Limited Role of LEK1 in the Degeneration Phase .................................................................75Presence of LEK1 in the Mononuc lear Satellite Position ...................................................... 76Presence of LEK1 in the Sarcoplasm of Regenerated Muscle Fibers .................................... 77The LEK1 Protein Expression Ov erlaps the Pax7 Domain .................................................... 77The LEK1 Protein Translocates to Central Nuclei ................................................................. 785 SUMMARY AND CONCLUSIONS .....................................................................................80LIST OF REFERENCES ...............................................................................................................81BIOGRAPHICAL SKETCH .........................................................................................................93

PAGE 7

7 LIST OF FIGURES Figure page 3-1 Structure of full length of LEK1 protein and its posttranslational cleavage products .......433-2 Westernblot of GFPLEK1 fusion proteins in C2C12 myoblasts ................................... 443-3 Expression of proliferation marker Ki67 in control and transfected C2C12 myoblasts .... 453-4 Expression of proliferation marker Ki67 in transfected C2C12 myoblasts .......................463-5 Summary graph of Expression of prolif eration marker Ki67 in C2C12 myoblasts ..........473-6 Expression of differentiation marker MyHC in control and transfected C2C12 myoblasts ..................................................................................................................... ......483-7 Expression of differentiation marker MyHC in transfected C2C12 myoblasts ................. 493-8 Estimation of myoblast differentiation by the Dual Luciferase Reporter Assay ............... 503-9 Dystrophin and Hoechst staining on Day 1 .......................................................................513-10 Dystrophin and Hoechst staining on Day 3 and 5 .............................................................. 523-11 Dystrophin and Hoechst staining on Day 7 and 10 ............................................................ 533-12 Dystrophin, Hoechst, an d LEK1 staining on Day 1 ...........................................................543-13 Dystrophin, Hoechst, and LEK 1 staining on Day 3 and 5 ................................................. 553-14 Dystrophin, Hoechst, and LEK 1 staining on Day 7 and 10 ............................................... 563-15 Presence of LEK1 in the mononuclear sate llite position in th e cavities of most heavily damaged site on Day 3 .......................................................................................... 573-16 Pax7, Hoechst, and LEK1 staining on Day 1 .....................................................................583-17 Pax7, Hoechst, and LEK1 staining on Day 3 and 5 ...........................................................593-18 Pax7, Hoechst, and LEK1 staining on Day 7 and 10 .........................................................603-19 Presence of LEK1 in the sarcoplasm of regenerated muscle bed on Day 5 ...................... 613-20 Translocation of LEK1 to central nuclei on Day 10 .......................................................... 623-21 Dystrophin, Hoechst, and LEK1 staini ng throughout the experiment (X100) .................. 633-22 Dystrophin, Hoechst, and LEK1 staini ng throughout the experiment (X600) .................. 64

PAGE 8

8 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science ROLE OF LEK1 IN SKELETAL MYOGENESIS By Shigeharu Tsuda August 2008 Chair: Sally E. Johnson Major: Animal Sciences Satellite cells are skeletal muscle stem cells that play a major role in postnatal muscle growth and repair. In healthy muscles, most sate llite cells are in an inactive quiescent state and localized between the sarcolemma and basal lamina of the muscle fibers. Upon stimulation, such as muscle injury or disease, they become activated and muscle regeneration occurs via activation, proliferation, differentiati on, and central localization of satellite cells. In spite of their active recruitment during muscle regeneration, the absolute number of quiescent satellite cells remains unchanged, suggesting the maintenance of satellite cell pool by the self-renewal. In mouse, a novel centromere protein LEK1 signifi cantly affects cellular proliferation and differentiation, however, its role depends on the cell type and developmental stage. In C2C12 myoblasts, ectopic expression of dominant inhi bitory C-terminus portions of LEK1 protein significantly stimulated prolifer ation and inhibited differentiati on, suggesting the inhibitory and stimulatory roles of LEK1 in myoblast proliferation and differentiation, respectively. On the other hand, the effects of domina nt inhibitory LEK1 on myoblast differentiation depend on its size in MyoD -treated C3H10T1/2 cells. Smaller LEK1 mutant (22 kDa) had no effect while larger ones (28 and 47 kDa) signifi cantly inhibited differentiation, implicating that there may be an important domain between 22 and 28 kD a of C-terminus most LEK1 for myoblast

PAGE 9

9 differentiation. During muscle regeneration, expr ession of LEK1 protein was elevated in the most heavily damaged sites duri ng the proliferation phase of mu scle regeneration and maximal in the sarcoplasm of regenerated muscle bed du ring the differentiation phase. This observation supports the notion that LEK1 i nhibits myoblast proliferation and stimulates differentiation. Interestingly, virtually all LEK1 proteins translocated to the ce ntral nuclei while some of them were found with the myonuclei in the satellite ce ll niche in the fiber growth phase. These data implicate that LEK1 may play multiple roles duri ng muscle regeneration, including inhibition of proliferation, stimulation of differentiation, cent ral translocation of myonu clei, self-renewal, and maintenance of a quiescence state of satellite cells.

PAGE 10

10 CHAPTER 1 LITERATURE REVIEW Introduction Human and animal activity requires movement via skeletal muscle contraction. Function of respiratory muscles is necessary to maintain their lives. The major function of skeletal muscle is to cause the movement of limb and organs. Ho wever, skeletal muscle alone cannot achieve this goal. For voluntary contrac tion, signal generated in the brai n is transmitted to skeletal muscle via central nervous system, motor neur on, and excitation-cont raction (EC) coupling. Then, force generated by skeletal muscle is transmitted to the tendon and bone. Skeletal muscle function depends on many physiological factors a nd it is impaired when even one of these factors does not function. Therefor e, it is not surprising that skeletal muscle function highly depends on muscle mass (Reed et al., 1991; Ha rris, 1997; Elkin et al, 2000), bone mass, and bone strength (Schiebl, et al., 1996 ). These variables are deteriorated by aging (Frontea et al, 1991; Jubrias et al., 1997), muscle disuse (Sel sby et al, 2007), disease (Emery, 2002), injury (Dodd et al, 2005), or microgravity exposure (Martin et al, 1988) To maintain the functional muscle mass, muscle growth and repair are necess ary. This role is mainly played by muscle stem cells (i.e., satellite cells ) with help of other molecules. In this section, skeletal muscle structure/function, satellite cell biology, and the role of a novel centomere protein in skeletal myogenesis will be briefly reviewed and discussed. Skeletal Muscle Biology Muscle Structure Skeletal m uscle fibers are attached to the bone via the tendon and transmit force generated by their contraction. A number of fibe rs are innervated by a single motor neuron and the combination is called a motor unit. Most mu scles have hundreds of motor units. Each fiber

PAGE 11

11 consists of a number of myofibrils which are surrounded by sarcoplasmic reticulum (SR). SR releases Ca2+ when stimulated and becomes wider a nd shorter during muscle contraction. The transverse tubule (T-tubule) reside s perpendicular to the longitudina l axis of muscle fibers and encircles myofibrils at regular intervals. In mammalian skeletal muscle cells, it lies at the junction of the Aand I-bands. SR is dilated on both sides of the Ttubule (i.e., terminal cisternae) and a T-tubule and both sides of term inal cisternae form the triad (McComas, 1996). Force generation (measured as the maximal teta nic tension) is directly proportional to the sum of the cross-sectional areas (CSA) of all the muscle fibers within a muscle (i.e., physiological CSA) and also affected by the angle of fiber insertion relative to force generation axis (i.e., pennation angle). The pennation angle varies among muscle types and ranges from 0 to approximately 30 (Lieber, 1992). When the fi ber orientation is parallel to the force generation axis (i.e., fusiform), all the force is transmitte d to the tendon. On the other hand, when fibers are inserted into the tendon with pennation angle, on ly a portion of generated force is transmitted. Two pennation angles are formed when fibers ar e inserted into both sides of the tendon (i.e., bipennate). Some muscles are unipinnate whil e the others are bipinnate. The advantage of pennation angle is that it allows the muscle to increase physiol ogical CSA by packing the greater number of fibers. In a bipennate muscle, the amo unt of tendon movement is greater than that of muscle fiber shortening during muscle contraction (Gans and Gaunt, 1991). Myofibrils are arranged in pa rallel and composed of thousands of sarcomeres. Myofibrils contain thick and thin filaments, also referred to as myosin and actin filaments, respectively. Individual myosin molecules spontaneously aggr egate with each other to form a double-helical rod of myosin filaments. A pair of globular heads are projected from a myosin molecule to form a cross bridge. These heads of the myosin molecule are separated by 60 of rotation from those

PAGE 12

12 projected from the next myosin molecule (McComas, 1996). Two light chains are associated with each myosin head and believed to affect th e action of myosin heads. The pair of myosin heads are called subfragment 1 (S -1) and are linked to the myosin molecule via a neck region called subfragment 2 (S-2). A head portion including S-1 and S-2 is called heavy meromyosin (HMM) and a remaining tail portion is called light meromyosin (LMM). Each myosin filament is surrounded by a hexagonal array of ac tin filaments. Each actin filame nt is composed of a number of actin monomers arranged in a long helical st ructure. This structure creates a long groove along with it into which tropomyosin filaments fit. Each tropomyosin molecule spans approximately seven actin molecules. A complex of three polypeptides (i.e., troponin T, C, and I) is also located on every seven actin monomers. Troponin T attach es the troponin complex to tropomyosin while troponin I indirectly inhibits acto-myosin inte raction by binding to actin in the absence of calcium ion (Lieber, 1992). When cytosolic calcium level is ra ised, troponin C captures four calcium ions and undergoes conformational chan ge to move tropomyosin away from actins, exposing actins to myosin heads and thus promoting muscle contraction (McComas, 1996). These thick and thin filaments are longitudinally arranged and partially overlapped with each other in a resting muscle. In the regions without acto-myosin overlap, actin and myosin filaments exhibit light (i.e., I-band) and dark (i.e., H-zone) appearance, respectively. The overlapped region is the darkest and the sum of this regi on and the H-zones forms the A-band. The central portion of the H-zone is called the M-region wher e myosin filaments are cross-linked and regular spacing between them is maintained. Another filament protein titins longitudinally stabilize myosins by linking them to the Z-disks. Actin filaments are strengthened by nebulins which resides in parallel to actins Finally, intermediate filaments link Z-disks longitudinally and transversely, keeping all the myofib rils in register (McComas, 1996).

PAGE 13

13 Muscle Fiber Types Skeletal m uscle is composed of thousa nds of fibers (McComas, 1996) and most mammalian muscles contain multiple fiber types (L ieber, 1992). Muscle fibers exhibit four different myosin isoforms and can be classified in terms of contractile and metabolic properties as well as their color (Zierath and Hawley, 2004). Slow -contracting fibers are called slow-twitch or type I fibers while fast-contr acting fibers are designated as fast -twitch or type II fibers. Type II fibers are further categorized into type IIa, IIx (or IId), and IIb fibers based on their contractile and metabolic properties (Schiaffino and Reggian i, 1994). Type I fibers are characterized by higher content of mitochondria and myoglobin w ith higher capacity of aerobic metabolism than type II fibers. Therefore, type I fibers can produce energy without lactate accumulation and are less fatigable (Zierath and Hawley, 2004). In contra st, type II fibers utili ze glycolytic pathway for energy production and are more fatigable. Type I and type IIa fibers are more reddish and called red fibers due to the higher content of myoglobin while type IIx an d IIb fibers are more pale and called white fibers (Zierath and Hawl ey, 2004). Interestingly, the fiber type depends on a motor neuron attached. When motor neurons at tached to fastand slow-twitch fibers are surgically exchanged via cross-re innervation, they are converted to slowa nd fast-twitch fibers, respectively (Buller et al., 1960a). Skeletal Muscle Function Skeletal muscle functions via contracti on, which is achieved via intention to move, activation of central nervous sy stem (CNS) and motor neuron, and EC coupling. When a signal in form of action potential (AP) is transmitted to an axon terminal of a motor neuron, voltagedependent calcium channels open and calcium io ns enter into the motor neuron, which causes exocytosis of acetylcholine (ACh)-containing vesicles releasing ACh into the synaptic cleft at the neuromuscular junction (Dodge and Rahamimoff, 1967). ACh diffuses across the synaptic cleft

PAGE 14

14 and binds to the ACh receptor (ACh-R) on th e motor end plate of muscle. When two ACh molecules bind to ACh-R, the receptor opens the ion channel allowing Na+ to enter and K+ to leave the muscle cell. The resulting depolarizatio n of sarcolemma propaga tes in both directions and reaches the deeper portion of the fibe r via T-tubules. This stimulates SR and Ca2+ is released into the cytosol via unkn own mechanisms (Lieber, 1992). It ha s been suggested that the voltage sensitive dihydropyridine (DHP) ch annel in the T-tubule membrane (Fosset et al., 1983) senses the APs propagated through sarcolamma and tran smits the signal to the ryanodine receptor (RYR). Then, the DHP channel unplugs the RYR ch annel (Chandler et al., 1976) or lifts the top of the RYR (Rios and G onzalez, 1991), allowing Ca2+ to be released from SR into the cytosol of muscle cells. Once the cytosolic calcium level is elevated, myosin heads bind to actins and muscle contraction is triggered via the tropon in-tropomyosin interaction. This conversion of electrical stimulus to mechanical respons e is called EC coupling (McComas, 1996). The sliding filament hypothesis has been we ll accepted as the muscle contraction mechanism. According to this theory, the opposing actin filament s slide along myosin filaments and pulled toward each other, shortening the H-zone and I-band (Huxley and Niedergerke, 1954). Furthermore, it has been proposed that the level of force production depends on the amount of cross-bridge interactions caused by th e overlap between myosin and actin filaments. This hypothesis was based on the relationship of sa rcomere length with tens ion in frog muscle fibers. Over a certain range, tension development was proportiona l to the degree of the overlap while extreme shortening caused decreased te nsion. In the latter case, the opposing actin filaments overlap each other and may interfere with the cross-bridge mechanism (Gordon et al, 1966a). On the other hand, several mechanisms have been proposed for the myosin cross-bridge cycle. The common factor among these theories is that adenosine-5'-triphosphate (ATP) on

PAGE 15

15 myosin head is required to de tach an actin from an acto-myosin complex (Lymn and Taylor, 1971; Huxley and Simmons, 1971; Rayment et al., 1993). The action order of one of the well explained mechanisms is 1) ATP binds to the actomyosin complex; 2) the actin dissociates from the myosin-ATP complex; 3) ATP is hydrolyzed on the myosin; 4) the acti n associates with the myosin-ADP-Pi complex; 5) myosin cross bri dge generates force during power stroke (Lymn and Taylor, 1971). Satellite Cell Biology Myogenesis Satellite cells are skeletal m uscle stem cells that are responsible for postnatal muscle growth and repair. They are localized between th e sarcolemma and basal lamina of the muscle fibers (Mauro, 1961). Although other stem cell types, such as bone marrow cells, can give rise to myonuclei of regenerating m yofibers (Gussoni et al., 1999), satell ite cells are the main sources of myonuclei (Moss and Leblond, 1971). Satellite cells are metabolically more active with abundant cytoplasm in young muscles but become inactive as animals get older (Schultz, 1976). In mice, the percentage of satellite cell nuclei in total my onuclei (i.e., the sum of satellite cell nuclei and myonuclei) is approximately 30% at birth but decreased to about 5% after 2 months (Snow, 1977; Bischoff, 1994). Decline of the percentage with age (Campion et al., 1981) indicates fusion of satellite cells for postnatal muscle growth (Gibson and Schultz, 1983). On the other hand, the absolute number of quiescent sate llite cells remains unchanged during muscle regeneration (Gibson and Schultz 1983), suggesting the maintenan ce of satellite cell pool by the self-renewal. The percentage of satellite cell nuclei in total m yonuclei is affected by the species, age, fiber type, disease, and exercise. It is much higher in soleus muscles of rats than those of mice (Snow, 1977; Gibson and Schultz, 1983). In both mouse and rat soleus muscles, it is significantly reduced as they get older (Snow 1977; Gibson and Schultz, 1983). In both humans

PAGE 16

16 and rats, it is higher in slowthan fast-twitch fibers (Sch malbruch and Hellhammer, 1977; Kadi et al., 2006). In human skeletal muscles, Duch enne's muscular dystrophy (DMD) patients have higher satellite cell content than control patien ts (Watkins and Cullen, 1988). Finally, resistance training significantly increases the satellite ce ll number in human skeletal muscles (Kadi and Thornell, 2000). In healthy muscle most satellite cells are in an inactive quies cent state. Upon stimulation, such as muscle injury or disease, they become activated and enter the cell cycle. Muscle repair is a multi-step process includi ng muscle degeneration and regeneration. During degeneration, phagocytes (i.e., neutrophils and macr ophages) invade injured muscle within 6 and 48 hours, respectively. Neutrophils ingest cellular debris while macrophages ingest neutrophils. (Orimo et al., 1991; Fielding et al., 1993; Char ge and Rudnicki, 2004). The muscle degeneration phase is followed by the regeneration phase. Acti vated satellite cells expand in number via cell division (Hawke and Garry, 2001). On ce satellite cells are activated and proliferate, they are often referred to as myogenic precursor cells or MPCs (Charge and Rudnicki, 2004). A majority of MPCs exhibit rapid proliferati on and become fusion-competent myoblasts (Conboy et al., 2003). They may fuse with either existing damaged fibe rs (i.e., hypertrophy) or other MPCs (i.e., hyperplasia). However, skeletal muscle regeneration is achieved mostly by hypertrophy (Hawke and Garry, 2001). It has been suggested that a slowly dividing population of MPCs returns to the quiescent sate, replenishing the satellite cell pool. These cells lose the expression of MyoD but maintain that of pair ed-box transcription fact or, Pax7 (Zammit et al., 2004). Following fusion, nuclei of myobl asts translocate to the centr al portion of myofibers and provide fibers with new myonuclei for muscle fibe r growth. After the fibers grow and obtain the sufficient size, myonuclei move to the periphery of the fibers, which are now indistinguishable from other undamaged fibers (Charge and Rudnicki, 2004).

PAGE 17

17 Myogenic Regulatory Factors Satellite cell m yogenesis requires muscle gene transcription to be activated, which is primarily mediated by the MyoD family transcri ption factors called myog enic regulatory factors (MRFs). Four members of this family (i.e., My oD, Myf5, myogenin, MRF4) play major roles in the regulation of muscle genes. Upon activation of satell ite cells, either MyoD or Myf5 genes are expressed first and then MyoD and Myf5 genes are coexpressed. Subsequently, myogenin gene is expressed as cells proceed along the myogenic lineage toward terminal differentiation (Cornelison and World, 1997). In general, MyoD and Myf5 serve as myogenic specification factors while myogenin mediates terminal differe ntiation by activating late muscle genes (Gerber et al., 1997). MRF4 plays a dual role in specification and diffe rentiation (Penn et al., 2004). However, previous studies using MRF knockout mice suggest that roles of MRFs are both specific and redundant (Penn et al., 2004). MyoD knockout mice are viable and exhibit close to normal phenotype with upregulated Myf5 expression (Rudnicki et al., 1992) while Myf5 knockout mice show perturbed muscle regeneration with moderately impair ed proliferation of satellite cells (Gayraud et al., 2007). In contrast, myogenin knockout mice are devoid of skeletal muscle and die immediately af ter birth (Hasty et al., 1993). MRF4-myogenin double knockout mice are deficient in the fiber size but sufficient in the fiber number compared to those of wild type (WT). Both MyoD-Myf5 (Rudnicki et al., 1993) and MyoD-MRF4 (Rawls et al., 1998) double knockout mice exhibit severe muscle deficiency similar to that of myogenin knockout mice. Finally, MyoD-myogenin-MRF4 triple knockout mice maintain a number of myoblasts but were deficient in skeletal muscle (Valdez et al., 2000). Integrated interpretation of these evidences is very difficult. However, it is likely that MRFs play both specific and compensatory roles in transcription of muscle genes. MRFs possess the basic helix-loop-helix (bHLH) domain in which two -helices are connected by a loop. This structural motif is responsible for

PAGE 18

18 dimerization and DNA binding (Shirakata et al., 1993). Each MRF dimerizes with a E protein (i.e., E12 or E47) and then binds to an Ebox DNA consensus sequence CANNTG, stimulating muscle gene transcription (C hanoine et al, 2004; Heidt et al., 2007). However, the precise mechanisms for recognizing their target genes rema in unclear. Interestingly, MRFs interact with each other. For instance, MyoD binds to the E-box in the myogenin promoter and activates transcription of myogenin (Heidt et al., 2007). Therefore, MyoD is required for proper myogenin expression. In addition to MRFs, a second family of muscle-specific tr anscription factors, myocyte enhancer factor-2 (MEF 2) family also regulate muscle gene expression by associating with MRF-E protein heterodimmers. MEF2 can associate with only MRFs dimerized with E proteins and alanine and threonine in the center of MRFs mediate this interaction (Black and Olson, 1998; Nava and Olson, 1999). MyoD and Myf5 are 10-fold more efficient than myogenin at activating transcriptionally silent genes. F unctional specificity of MRFs may depend on the structural difference in the transactivation domai ns of MRFs to form a muscle gene activator complex (MAC) (Chanoine et al, 2004). A cetylation, phosphoryla tion, and chromatin remodeling regulate the transcriptional activity of MyoD. Histone acetyltransferases (HATs) acetylate MyoD as well as nucleosomal histone s around E-boxes, which promotes DNA binding and transcriptional activity of MyoD (Puri and Sartorelli, 2000; Chanoine et al, 2004). Twist, a bHLH protein, prevents HAT-induced stimulation of transcriptional activity of MyoD by binding to HATs (Hamamori et al., 1999). Histone deacety lases (HDACs) deacetylate MyoD and inhibit expression of MyoD-dependent muscle-specific gene s in undifferentiated skeletal muscle (Mal et al, 2001). Phosphorylation of MyoD by Mos protein (encoded by pr oto-oncogene c-Mos) also stimulates the transcriptional activity of MyoD by promoting binding of MyoD to E12 during proliferation (Pelpel et al., 2000). Furthermore, MyoD can remodel chroma tin at the binding sites

PAGE 19

19 in the muscle gene enhancers to activate transcri ptionally silent loci (Gerber et al., 1997). In contrast, chromatin remodeling enzymes preven t MRFs from accessing DNA (Chanoine et al., 2004). Thus, activation of the muscle transcrip tional program via MRFs is highly regulated by posttranslational mechanisms. Roles and Expression Pattern of Pax7 in Myogenesis Several satellite cell m arkers have been iden tified to study satellite cell biology (Hawke and Garry, 2001). Among them, Pax7, c-Met, an d M-cadherin are expressed both in quiescent and proliferating satellite cells (Cornelison and Wold, 1997; Seal e et al., 2000). The fact that approximately 5% of total myonuclei in adult sk eletal muscle are sate llite cell nuclei (Snow, 1977; Bischoff, 1994) and about 5% of total myonucle i also express transcri ption factor Pax7 in a quiescent state (Seale et al., 2000) indicates Pax7 is an appropriate marker of quiescent satellite cells. In Pax7 knockout mice, skeletal muscles lack satellite cells and animals normally die within 2 weeks after birth with deficiency in mu scle growth (Seale et al, 2000), suggesting the importance of Pax7 in the maintenance of sate llite cell pool (Buckingham, 2006). Pax7 is also thought of as a marker of prolif erating satellite cell since it is expresse d in a majority of mitotically active cells but its expressi on is reduced as the cells transcribe myogenin and differentiate (Halevy et al., 2004). Du ring skeletal muscle regeneration Pax7 is widely expressed in regenerating fibers and even in some centr al nuclei (Luque et al ., 1996; Seale et al., 2000). The number and characteristics of satellite cells in regenerating muscle become comparable to those of WT within 30 days following injury-ind uced skeletal muscle regeneration (Luque et al., 1996). Recent studies have implicated that Pax7 plays a role for myogenic specification, maintenance of quiescence, and survival of sate llite cells (Seale et al ., 2000; Olguin and Olwin, 2004; Oustanina et al., 2004). Most activated satellite cells express Pax7, MyoD, and Myf5 (Zammit et al., 2002; Zammit et al., 2006) wh ile Pax7 is downregulated as myoblasts

PAGE 20

20 differentiate (Seale et al, 2000; Zammit et al., 2004). Indeed, cell s do not differentiate in the presence of Pax7 (Zammit et al., 2006) It has been suggested that Pax7 promotes the entry of myoblasts into the myogenic progra m by stimulating transcription of MyoD (Buckingham, 2007) and regulating Myf 5 (McKinnell et al., 2008). Pax7 can el evate MyoD expre ssion (Zammit et al., 2006) and turns on the myogenic gene program vi a chromatin modifications in satellite cellderived myoblasts. It associates with histone methyltransferase (HMT). The Pax7-HMT complex then binds to Myf5 and tri-methylates histone H3 lysine of surrounding chromatin (McKinnell et al., 2008). Therefore, it is believed that Pax7 is genetically upstream of MyoD and Myf5 (Zammit et al., 2006; Buckingham, 2007) in a majority of activated satellite cells. On the other hand, a minority of activated satellite cells maintain Pax7 but lose MyoD (Zammit et al., 2006). Pax7 is upregulated in cells that lack MyoD (Seale et al, 2000), exit the cell cycle, and escape from differentiation (Olguin and Olwin, 2004). In ad dition, overexpression of Pax7 downregulates MyoD, prevents myogenin induction, promotes cell cycle exit (Olguin and Olwin, 2004), and slows both proliferation and differentiation in m yoblasts (McFarlane et al., 2008). Therefore, it has been suggested that Pax7 helps these cells return to quiescence (Olguin and Olwin, 2004; Zammit et al., 2006). Finally, Pax7 may also play an anti-apoptotic role si nce the expression of dominant negative Pax7 mutant protein destroys satellite cells (Oustanina et al ., 2004; Relaix et al., 2006). In summary, Pax7 may turn on th e myogenic gene program by stimulating transcription of MyoD and associating with Myf 5 in satellite cells. It maintains proliferation, prevents precocious differentiati on, and promotes survival of satelli te cells. On the other hand, in a minority of activated satellite cells, it may promote the self-renewal of satellite cells by inhibiting proliferation and differentiation via downregulation of MyoD and myogenin.

PAGE 21

21 Myogenic Capacity of Satellite Cells One of the best m ethods to estimate th e myogenic capacity of satellite cells is transplantation of cells into re generating host skeletal muscles. The myogenic capacity almost entirely depends on the environment of satellite cells, which has been best shown by single fiber transplantation (Collins et al., 2005 ). Satellite cells reside in the stem cell niche between the sarcolemma and basal lamina in healthy muscles. When this environment is kept in single fiber transplantation, a single satellite cell of the tr ansplanted fiber genera ted 27 myofibers on the average in the host muscle. In contrast, when satellite cells immediatel y after isolation from skeletal muscle were transplanted, each satellite cell produced approximately 1/1,000 of myofibers (Montarras et al., 2005). Furthermore, when isolated satellite cells were expanded with 3 passages, only 1/10,000 of m yofibers were generated (Ikemoto et al., 2007). It is plausible that this is due to a enzymatic treatment of cells since cell expansion without passage did not further deteriorate the myogenic capability of satellite cells (Ikemoto et al., 2007). These studies demonstrate that a quiescent c ondition with an appropr iate environment is extremely important for satellite cells to exert their myogenic cap ability during skeletal muscle regeneration. LEK Family Proteins Centromere Proteins During m itosis, the mitotic spindle attaches to the kinetochore on the centromere and pulls the chromosome apart (i.e., chromosome se gregation). The kinetochore remains assembled from the G2 phase to the end of cell division (Bomont et al., 2005). The kinetochore consists of more than 50 proteins (Hauf and Watanabe, 2004) including centr omere proteins (CENPs). The inner plate of the kinetochore contains CENP-A, -B, -C, -G, -H, and -I and plays a role in kinetochore assembly while the outer plate possesses CENP-E and F and contributes to microtubule attachment and dynamics (Bomont et al., 2005). The kinetochore assembly links the

PAGE 22

22 centromere to the spindle and the onset of anapha se is held until all the chromosomes attach to the microtubules at the kinetochore. Thus, failure to form centromer e-kinetochore-spindle complex results in mitotic arrest (Cleaveland et al., 2003) and kinetoch ore defect results in choromosome missegregation and aneuploidy (i.e ., the abnormal number of chromosomes in daughter cells), suggesting an impor tant role of the kinetochore in separation of sister chromatids (Hauf and Watanabe, 2004). LEK Family Proteins Centromere protein-F (CENP-F) or mitosi n was discovered as a kinetocore-associated protein whose expression is cell cy cle dependent (Ra ttner at al., 1993). CENP-F genes are well conserved among many species and proteins are called CENP-F/mitosin in human, LEK1 in mouse, and cardiomyogenic factor 1 (CMF1) in chicken. Approximately 40% of the amino acids of these proteins are composed of leucine (L), gl utamic acid (E), and lysine (K). Therefore, these proteins are called LEK family proteins (Goodwin et al., 1999) The C-terminus domains of these proteins are well conserved (Zhu et al ., 1995; Hussein and Tayl or, 2002; Redkar et al, 2002; Ashe et al., 2004) and contain an atypical retinoblastom a (Rb)-binding domain, nuclear localization sequence (NLS), bHLH domain, and leucine zippers (G oodwin et al., 1999; Ashe et al., 2004). These LEK family proteins bind to a ce ll cycle inhibitor, protein Rb or pRb (Zhu et al., 1995; Redkar et al., 2002; As h et al., 2004), suggesting a poten tial role of LEK family proteins in cell cycle progression. During develo pment, expression of LEK1 and CMF1 proteins are elevated in the early prolif eration phase while it is reduced in the later differentiation phase (Goowin at al, 1999; Dees et al., 2000). In c ontrast, CENP-F is not well studied during development. CNEP-F is not expressed in the G1 phase of the cell cycle while LEK1 and CMF1 are expressed throughout the cell cycle.

PAGE 23

23 CNEP-F/Mitosin While CENP-F is not expressed in the G1 phase, it is localized in the nucleus during the S-phase. It is assem bled into the kinetochore in the late G2 phase and degraded at the end of mitosis (Liao et al., 1995). CENP -F assembles earlier than ot her known transient kinetochore proteins in the late G2 phase and thus may play a role in the initial steps of kinetochore assembly (Bomont et al., 2005). CNEP-F is required fo r M-phase progression a nd inhibition of its expression causes mitotic arrest (Bomont et al., 2005). CENP-F interacts with mammalian nuclear distribution element (N udE) homologues (i.e., Ndel-1, Nde-1) which bind to Lis 1 and dynein. Cytoplasmic dynein transports cellular cargo by walking along microtubules towards the cell center (i.e., minus end) and plays a role in transportation of chromosome, mitotic spindle, and other organnelles. The inte raction among CENP-F, NudE, Lis 1, and dynein is critical for chromosome alignment and segregation. Disr uption of these components results in malalignment/orientation of choromosome (Vergno lle and Taylor, 2007). Importantly, CENP-F maintains the microtubule-kinetochore tens ion and attachment (Bomont et al., 2005). LEK1 Protein Structure The s tructure of LEK1 i s very similar to that of CENP-F and characterized by the well conserved C-terminus domain containing th e Rb-binding domain, NLS, and bHLH domain (Figure 3-1). Among these, the Rb-binding domain plays an important ro le in regulation of cellular proliferation and differen tiation since pRb inhibits the cell cycle. NLS is responsible for protein targeting to the nucleus. The bHLH domain is a dimeric pr otein structural motif in which two -helices are connected by a loop and one of the helices contai ns a DNA-binding region. Computer analysis has shown that the structure of this protein is mostly -helices with heptad amino acid repeats except the gl obular C-terminus portion. The -helices are separated by turns

PAGE 24

24 and the repeats are composed of hydrophobic and hydrophilic amino acids. Many of these helices are leucine zippers and leucine resides in the 4th position of the heptad. Thus, leucine resides every 7 amino acids and one leucine binds to the other per 2 turn s (Goodwin et al., 1999). The known function of leucine zipper includes protein dimerization and DNA binding. It is predicted that -helices of this protein fold into four coiled coils. LEK1 also possesses a spectrin repeat in the N-termius portion which is three-he lix bundle structure and c oordinates cytoskeletal interactions (Djinovic-Carugo et al., 2002). Subcellular Localization of LEK1 LEK1 protein is posttranslationally cleaved into larger Nand smaller C-terminus portions. The N-terminus portion of LEK1 (nLEK1) has cytoplas mic distribution while the Cterminus portion (cLEK1) is targeted to the nucleus (Ashe et al., 2004; Soukoulis et al., 2005; Pooley et al., 2006). Nuclear cLEK1 is furt her cleaved into approximately 50 and 60 kDa fragments in 23A2 myoblasts when the cell cycle is arrested by stimulation of MAPK signaling. When the MAPK signaling pathway is stimulated in mitotically active myoblasts, cells exit the cell cycle and LEK1 protein translocates from the cytosol to the nucleus (Reed et al., 2007). On the other hand, cytosolic nLEK1 is colocalized with NudE, Lis1, and dynein and disruption of nLEK1 results in abnormal cell shape and microt ubule organization, suggesting a role of nLEK1 in chromosome alignment and segregation (Soukou lis et al., 2005). nLEK also interacts with synaptosomal-associated protein of 25 kDa (SNAP-25) and plays a role in recycling of transport vesicles that mediate trafficking of proteins between plasma memb rane and organelles (Pooley et al., 2006; Sllner et al., 1993).

PAGE 25

25 LEK1 and Cell Cycle The role of LEK1 protein in cellular proliferation ha s been suggested by several in vivo and in vitro studies. However, a significant discre pancy exists among studies due to the difference in the cell type or developmental stag e of the cells. These suggestions were based on the localization of LEK1 protein in certain cond itions, the dominant inhibitory effects of LEK1 mutant proteins on proliferati on, or the effects of LEK1 depletion on cell cycle progression using morpholino oligomers to disrupt translation of LEK1 mR NA in certain cell types. In satellite cells and myoblasts, the eviden ce suggests that LEK1 suppresses cell cycle progression. In the section of mouse tibialis anterior muscle (TA), LEK1 was localized with satellite cell marker Pax7 in the nucleus of quiescent satellite cells as we ll as other myonuclei (Reed et al., 2007). In 23A2 myoblasts and primary culture of satellite cells, LEK1 was cytosolic when the cells were mitotically active. However, it was translocated from the cytosol to the nucleus when these cells were mitotically inactive (Reed et al., 2007). This study indicates that LEK1 suppress proliferation in these cell types. In the dominan t inhibitory studies, DNA constructs containing various sizes of genes encoding cLEK1 were introdu ced into the cells so that the cells express LEK1 mutants which interact with the same elements as endogenous LEK1 protein (e.g., pRb). These mutants can compete with WT LEK1 prot ein and inhibit some of its function (i.e., dominant inhibitory effects). The ectopic expression of cLEK1 (85 kDa) significantly reduced incorporation of 5-bromo-2-deoxyur idine (BrdU) in COS-7 fibroblas ts (Evans et al., 2007). In other words, competitive inhibition of endogenous LEK1 reduced proliferati on in this cell type, suggesting that LEK1 protein prom otes proliferation in COS-7 cells. In other studies supporting this notion, LEK1 was localized in the nuclei in proliferating C2C12 mouse muscle myoblasts (Goodwin et al, 1999) and its expression was el evated in embryonic and neonatal mouse heart during the proliferation phase (D ees et al., 2005; Goodwin et al., 1999). In addition, blockage of

PAGE 26

26 LEK1 expression using morpholino oligomers reduced proliferation in HL 1 cardiac cells (Dees et al., 2005), NIH3T3 mouse em bryonic fibroblasts, and C2C12 myoblasts (Ashe et al., 2004). These in vitro and in vivo studies suggest that LEK1 promotes proliferation in these cell types and the developmental stages of cardiomyocytes In summary, the role of LEK1 protein in cellular proliferation highly depe nds on the cell type and the developmental stage of the cells. LEK1 and Cellular Differentiation The role of LEK1 in cellular differentiati on also depends on the cell type and the developmental stage of cells. In cardiomyocytes differentiated from embryonic stem (ES) cells, deletion of pRb, ectopic expression of dominant inhibitory cLEK1 ( LEK1), or combination of both almost completely blocked differentiation (Papadimou et al., 2005), suggesting that LEK1pRb binding is necessary for differentia tion of embryonic cardiomyocytes. Indeed, overexpression of pRb rescued the differentiation-deficit LEK1expressing Rb knockout cells. This study implicates that the LEK 1-pRb interaction promotes diffe rentiation and the presence of LEK1-pRb complex does not interfere with differentiation when the amount of LEK1-Rb complex is sufficient in this cell type and the developmental stage. In contrast, LEK1 expression was reduced during the differentiation phase (after 7 days of birth) in neonatal mouse heart (Dees et al., 2005) and the ec topic expression of LEK1 (165 kDa) signi ficantly promoted differentiation in C2C12 myoblasts (Goodwin et al, 1999), suggesting that LEK1 negatively regulates differentiation in these cell types. This discrepancy may be due to the difference in the cell type, developmental stage of cells, or the size of LEK expressed in the cells (i.e., 7 kDa vs. 165 kDa).

PAGE 27

27 LEK1 and pRb Like other LEK fa mily proteins, LEK1 protein binds to pRb via the Rb-binding domain (Goodwin et al., 1999). Through this site, exogenous cLEK1 also binds to pRb (Ashe et al., 2004). pRb is a member of the Rb proteins (p107 p130, and pRb) which are also referred to as the pocket proteins (Chen et al., 2008). pRb is a tumor suppressor protein and cell cycle inhibitor (Murphree and Benedict, 1984). Tumorigenesis occurs in Rb -mutant mice and more than onethird of all human tumors are caused by the absence or mutation of pRb (Weinberg, 1992). Deletion of pRb results in the shorter G1 phase and the longer S phase (Classon et al., 2000). Although the precise mechanisms of pRb-mediated cell cycle inhibi tion remain to be elucidated, it has been suggested that it occurs due to inhi bition of cell cycle regulatory gene expression via the interaction of pRb with E2F transcription factors and active re pression of the cell cycle via chromatin modifying factors (Trimarchi and L ees, 2002). E2F transcriptio n factor family can affect cell cycle progression (B lais & Dynlacht, 2004). The family consists of transcriptional activators (i.e., E2F1, E2F2, E2F3a) and repr essors (E2F3b, E2F4, E2F5, E2F6, E2F7, and E2F8). E2Fs become functional when bound to DNA-binding protein part ners (i.e., DP1 and DP2). Although various roles of E2Fs (e.g., role s in proliferation, differentiation, apoptosis, tumor suppression, or development) have been s uggested, elucidation of the precise mechanisms is challenging due to the cr oss-regulation among E2Fs. The E2 F transcriptional activators stimulate expression of cell cycl e regulatory genes by binding to DNA and mutation of E2F1-3 completely blocks proliferation. When a cyclin binds to a cyclin-dependent kinase (cdk), the cdk is activated and phosporylates it s substrate protein, such as pRb (Trimarchi and Lees, 2002). The phosphorylated form of pRb (i.e ., inactive form) does not bind to E2Fs (Classon and Harlow, 2002), allowing free E2Fs to bind DNA and stim ulate E2F-responsive gene expression. In contrast, pRb is hypophosphorylated (i.e., active form) during the G0 (i.e., quiescent) and early

PAGE 28

28 G1 phase of cell cycle. Hypophosphorylated pRb binds to a E2FDP dimer and inhibits E2Fmediated stimulation of cell cycle progression (T rimarchi and Lees, 2002). For active repression by chromatin modifying factors, the pRb-E2FDP complex recruits factors which influence chromatin structure, including HDACs and hist one methyltransferase SUV39H1. Chromatins are not condensed during the interphase of the cell cycle (i.e., G1, S, and G2 phase). However, HDACs bind to pRb-E2FDP complex on chromatin and deacetylate lysine 9 of histone H3, stimulating nucleosome packing and inhibiti ng transcription of E2 F-responsive genes. Subsequently, SUV39H1-heterochromatin pr otein 1 (HP1) complex replaces HDACs and methylates lysine 9 of histone H3, which modifies the histone tail and silences gene expression (Trimarchi and Lees, 2002). As described earlier, the LEK1-pRb interaction is necessary and LEK1 or pRb alone is not sufficient to induce di fferentiation in cardiomyocytes derived from ES cells (Papadimou et al., 2005). The LEK1-mediated blockage of differentiation may have been caused by stimulation or elongation of cell cycle progression. However, this study did not determine the dominant inhibitory effects of LEK1 on cellular proliferation. On the other hand, LEK1 depletion by morpholino antisense oligomer s that disrupt translation of LEK1 mRNA reduced the cell number in NIH3T3 fibroblasts and C2C12 myoblasts and delayed cell cycle progression in NIH 3T3 cells (Ashe et al., 2004). This study suggested that the LEK1-pRb interaction allows free E2Fs to bind DNA, stimulating expression of E2F-responsive genes to promote cell cycle progression or inhibit terminal differe ntiation (Ashe et al., 2004).

PAGE 29

29 CHAPTER 2 MATERIALS AND METHODS Gene Cloning The C-term inus of LEK1 was amplified by polymerase chain reaction (PCR) using mouse CENP-F cDNA (Open Biosystems). The 3 primer (CGGGATCCCCTTCCAGAACCCT GAGTGG) and the 5 primers (CG GGATCC AAAGCTTCAGGCAAGAGGC, CG GGATCC CT CGAGAAAGCCAAGGAGATATTAG, or GC GGATCC CTGCAGAATTCCCACAAGAG) were used to yield cDNA fragments for 597bp, 760bp, and 1273bp, respectively. A BamHI restriction site (bolded italic letters) was in cluded in each primer. Fragments were separated through agarose gel and purified by the gel cl eanup kit (Perfectprep Gel Cleanup, Eppendorf North America). Purified cDNAs we re digested with BamHI at 37 C for 90 minutes, and inserted into BamHI-treated pAcGFP1-C1 vectors (Clonetech) to generate fusion proteins of cLEK1 and green fluorescent protein (GFP). Insert orientation and reading frame fidelity were determined by DNA sequencing. Cell Culture C2C12 m ouse skeletal muscle myoblast cells were cultured in the high glucose Dulbeccos Modified Eagles Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% v/v penicillin/streptomycin (P/S), and 0.2% v/v gnetamycin at 37 C with 5% CO2 and 95% O2. C3H10T1/2 mouse embryo fibroblast cells were cultured in the Basal Medium Eagle (BME) supplemented with 10% FBS, 1% v/ v L-glutamine, 1% v/v P/S, and 0.2% v/v gnetamycin at 37C with 5% CO2 and 95% O2. Differentiation was induced by culture in the low glucose DMEM supplemented with 2% horse serum, 1% v/v P/S, and 0.2% v/v gnetamycin at 37C with 5% CO2 and 95% O2. All culture media, supplements, and sera were purchased from Invitrogen, Carlsbad, CA.

PAGE 30

30 Transfections of DNA constructs C2C12 myoblast and C3H10T1/2 fibroblast cells were transfected by calcium phosphate precipitate (Jordan and Wurm, 2004). C2C12 cel ls received DNA precipitate containing the pAcGFP1-C1 vector (3.3g/ml) and GFP-cLEK 1 DNA constructs (3.3g/ml). Following the incubation for 5 hours at 37 C and 5% CO2 and 95% O2, cells were washed by phosphate buffered saline (PBS) and cultured in the new growth medium for 24 h at 37 C. Then, cells were used for western blot analysis and immunocytochemistry. For the Dual-Luciferase Reporter Assay, C3H10T1/2 cells received pAcGFP1-C1 control vector (158 ng/ml), vector-cLEK DNA constructs (158 ng/ml), pEM MyoD (79 ng/ml), a Renilla luciferase reporter plasmid (pRL-tk, 16 ng/ml), and internal response element of the quail troponin I gene (TnI-luc, 316 ng/ml). Following incubation for 5 hours at 37 C with 5% CO2 and 95% O2, cells were washed with PBS and cultured in the differentiation-pe rmissive medium for 2 days at 37 C with 5% CO2 and 95% O2 prior to cell lysis and meas urement of luciferase and Renilla luciferase activities (DualLuciferase Reporter Assay System E1960, Promega, Madison, WI). Western Blot Analysis C2C12 cells were washed twice with ice-cold Tris-Buffered Saline (TBS) and then lysed in 4X SDS-PAGE sample buffer (250 mM Tris pH 6.8, 8% SDS, 40% glycerol, 0.4% mercaptoethanol) containing 1mM PMSF, 1mM NaF, and 1mM Na4P2O7. Lysates were transferred to 1.5 ml micro centrifuge tubes (Fisher Scientific), heated at 95 C for 5 minutes, cooled on ice for 5 minutes, sonicated, cooled on ice for another 5 minutes, and centrifuged at 13,000 rpm for 20 seconds. Supernatan t was transferred to new micr ocentrifuge tubes and stored at 20C until used. Equal amounts of protein were electrophoretically separated through polyacrylamide gels and transferre d to nitrocellulose membranes. The blots were incubated with

PAGE 31

31 5% nonfat dry milk in Tris-Buffered Saline Tween-20 (TBST: 10mM Tris, pH 8.0, 150 mM NaCl, 0.1% Tween 20) overnight at 4 C to block nonspecific bindi ng sites. Primary antibody (mouse anti-GFP, Santa Cruz Biotechnology) wa s diluted 1 : 500 in blocking solution and incubated with the blots for 60 minutes at room temperature. The blots were washed three times with TBST for 5 minutes each. Then, the bl ots were incubated with donkey peroxidaseconjugated anti-mouse IgG (Vector Laboratoeis, 1: 5,000) in blocking solution for 45 minutes at room temperature and washed three times with TBST. Visualization of protein bands was accomplished by chemiluminescence (ECL, Amersham Biosciences, Piscataway, NJ) and exposure to X-ray f ilms (XAR-5, Kodak). Immunocytochemistry For detection of a proliferation m arker Ki67, C2C12 cells were fixed with 4% paraformaldehyde (PFA) in PBS for 10 min, pe rmeabilized with 0.25% Triton-X 100 in PBS for 20 min, and blocked with 5% horse serum in PBS for 60 minutes. For Ki67 immunostaining, fixed cells were incubated with rabbit anti-Ki67 (Abcam, 1:1000) in 5% horse serum in PBS overnight at 4 C. After three 5-minute washes with PBS, the cells were incubated with Alexa Fluor 568 goat anti-rabbit IgG (Invitrogen, 1: 20 0) for 45 minutes. For detection of myosin heavy chain (MyHC), fixed C2C12 cells were in cubated with mouse monoclonal anti-sarcomeric myosin antibody (MF20, Developmental Studies H ybridoma Bank, 1:5) in 5% horse serum in PBS for 60 minutes at room temperature. After th ree 5-minute washes with PBS, the cells were incubated with Alexa Fluor 568 goat anti-mouse Ig G (Invitrogen, 1:200) in 5% horse serum in PBS for 45 min. For all assays, cells were inc ubated with Hoechst 33245 (1ug/ml) in PBS for 10 min. Representative photomicrographs were cap tured at 200X with a Nikon epifluorescent

PAGE 32

32 microscope equipped with a Nikon DM1200F digi tal camera and NIS-Elements AR2.3 software. Images were adjusted for the intensity and contrast with Adobe Photoshop CS. Bupivacaine Injection All procedures and experim ents were under the approval of the Institutional Animal Care and Use Committee at the University of Florida. Six-week-old male C57BL/6 mice were housed in a 12:12-h light-dark photoperiod in an environmentally controlled room and fed ad libitum throughout the experimental periods Animals were randomly divide d into 6 groups of 2 animals each. Bupivacaine (Marcaine 5mg/ml, 70 L) was injected into the left TA. Control animals received saline (70 L). Inje ction was performed at both the proximal and distal TA. Animals were then housed in cages for appropriate period until sacrificed by CO2 inhalation. For the control group, mice we re sacrificed by CO2 inhalation 24 hours after bupivacaine injection. For the bupivacaine-treated groups, mice were sacrificed at 1, 3, 5, 7, and 10 days post-injection. Right and left TA muscles were embedded in the optimal cutting temperature (Sakura TissueTek OCT Compound, Sakura Finetek USA, Torrance, CA) and frozen in isopentane cooled on dry ice. Immunohistochemistry Ten m icrometer cryosecitons were collected onto glass slides (Fisherbrand Superfrost Microscope Slides, Fisher Scientific). Samples were blocked with 5% goat serum in PBS for 20 min and incubated with primary antibodies in blocking solution for 60 minutes. Primary antibodies used were rabbit polyclonal antiLEK1 (1:200, Cocalico Biologicals, Reamstown, PA), mouse monoclonal antidystrophin (1:500, Abcam), and mouse monoclonal anti-Pax7 (1:50, R & D Systems, Mineapo lis, MN). After extensive wash ing with PBS, tissues were incubated with secondary antibodies in blocki ng solution for 45 minutes. Secondary antibodies included Alexa Fluor 568 donkey anti-rabbit IgG (1:200, Invitrogen) and Alexafluor 594 donkey

PAGE 33

33 anti-mouse IgG (1:200, Invitrogen). Following fi xation with 4% PFA for 10 minutes, Hoechst 33245 (1ug/ml) in blocking solution was applie d for 10 minutes at room temperature. Photomicrographs were captured at 100X, 300X and 600X with a Nikon DMX1200F digital camera and NIS-Elements software. Statistics All the data were compared to appropriate controls and each ot her by One Way ANOVA. Data were presented as Means SEM. Treatments were considered significantly different when P 0.05. The Tukey HSD test was used for a Post-hoc test. For Ki67 immunostaining and the Dual Luciferase Reporter Assay, experiments we re duplicated and triplicated, respectively.

PAGE 34

34 CHAPTER 3 RESULTS Expression of LEK1 Mutants Objective Previous studies have shown that LEK1 protei n plays a role in chrom osome segregation, recycle of transport vesicles, cellular prolif eration, and differentiati on (Goodwin et al., 1999; Papadimou et al., 2005; Soukoulis et al., 2005; Pool ey et al., 2006; Evans et al., 2007). However, the effects of LEK1 protein on cellular proliferat ion and differentiation have been controversy because different cell types and developmental st ages of the cells have been used among these studies. These studies have determined the expression level of LEK1 during development, localization of LEK1 protein, th e effects of LEK1 depletion on cell cycle progression, the dominant inhibitory effects of LEK1 on proliferation and differentiation in certain cell types and developmental stages. To delineate the role of LEK1 protein in proliferation and differentiation in myoblasts, the current study was designed to determine the effects of dominant inhibitory LEK1 containing the Rb-binding domain a nd NLS on myoblast proliferation and differentiation. The objective of the experiments was to express GFPLEK1 fusion proteins in C2C12 myoblasts. Creation of LEK1 Expression Plasmids cDNA fragm ents for 597bp, 760bp, and 1273bp of cLEK1 were amplified from mouse CENP-F cDNA. After separated and purified through agarose gel electrophoresis, the cDNA fragments were ligated into pAcGFP-C1 expression vectors to generate 22, 28, and 47 kDa of LEK1 with 26 kDa of GFP. These sizes were selected because the focus of this study was on the effects of the functional domains in th e C-terminus most portions of endogenous LEK1 protein fragment, including the atypical Rb-binding domain and NLS. LEK1 is

PAGE 35

35 posttranslationally cleaved into th e cytosolic Nand nuclear Cterminus portions and then the latter is further cleaved into approximately 60 and 50 kDa fragments where the 50 kDa fragment is the C-terminus most portion of endogenous LEK1 fragment (Figure 3-1). As expected, DNA sequencing confirmed the appropriate insert or ientation and reading frame fidelity of the plasmids. Expression of GFPLEK1 Mutant Fusion Proteins The plasm ids containing pAcGFP1-C1 vector and LEK1 were transfected into C2C12 myoblasts by calcium phosphate precipitat e formation (Jordan and Wurm, 2004). Following incubation of the cells for 5 hours and culture in the new growth medium for 24 hours, cells were appropriately treated for the Western blot analysis using anti-GFP primary antibody and appropriate secondary antibody. As expected, bands of GFPLEK1 fusion proteins were detected at approximately 48, 54, and 73 kDa (Figur e 3-2). The results were appropriate because GFP is approximately 26 kDa and LEK1 mutants were 22, 28, and 47 kDa. Dominant Inhibitory Effects of LEK1 Mutants on Myoblast Proliferation Objective The role of LEK1 protein in cellula r proliferation highly depends on the cell type and developmental stage of the cells and thus cont roversy. In addition, the dominant inhibitory effects of LEK1 may depend on the size of LEK1 mutant The objective of the experiments was to determine the dominant inhibitory effects of various sizes of GFPLEK1 fusion proteins containing the Rb-binding domain and NL S on proliferation in C2C12 myoblasts. The LEK1 Mutants Stimulate Myoblast Proliferation Following transfection of C2C12 myoblasts wi th the plasm ids cont aining genes encoding GFP (control) and GFPLEK1 fusion proteins, incubation in the growth medium with

PAGE 36

36 precipitate for 5 hours, and cu lture in the new growth medi um for 24 hours, moderately confluent C2C12 myoblasts were fixed, perm eabilized, blocked, and immunostained for a proliferation marker Ki67 us ing rabbit anti-Ki67 primary anti body and appropriate secondary antibody. The percentage of Ki67 positive cells among GFP-positive cells was determined. Surprisingly, nearly 100% of GFP-positive cells were also Ki67 positive in the LEK1-treated groups. In contrast, only half of the of GFP-positive cells in the control group expressed Ki67 (Figure 3-3, 3-4, and 3-5). The results showed th at ectopic expression of dominant inhibitory GFPLEK1 significantly stimulates m yoblast proliferation (P < 0.05). Dominant Inhibitory Effects of LEK1 Mutants on Myoblast Differen tiation Objective The role of LEK1 protein in cellula r differentiation may al so depends on the cell type, developmental stage, or size of dominant negative LEK1. Ectopic expression of the smaller LEK1 (7 kDa) almost completely blocked differentiation in embryonic cardiomyocytes (Papadimou et al., 2005) while expression of the larger LEK1 (165 kDa) accelerated differentiation in C2C12 myoblasts (Goodwin et al., 1999). The objective of the experiments was to determine the effects of GFPLEK1 on differentiation in m yoblasts using immunostaining for MyHC in C2C12 myoblasts and the Dual Luciferase Reporter Assay in MyoD -treated C3H10T1/2 fibroblasts. The latter is a well established experi mental approach. In various fibroblasts including C3H10T1/2 cells, ectopic e xpression of MyoD converts them to myoblasts and induces differentiation (Tapscott et al., 1988). The LEK1 Mutants Suppress Myoblast Differentiation Following transfection of C2C12 myoblasts wi th the plasm ids cont aining genes encoding GFP (control) and GFPLEK1 fusion proteins, incubation in the growth medium with

PAGE 37

37 precipitates for 5 hours, culture in the new growth medium fo r 24 hours, and culture in the differentiation-permissive medium for 48 hours, fixed C2C12 cells were incubated with mouse monoclonal anti-sarcomeric myosin primary antibody and appropriate secondary antibody. In control cells, some GFP-positive cells differen tiated and expressed MyHC (Figure 3-6). In contrast, all GFP-positive cells in the LEK1-treated groups failed to express MyHC (Figure 3-6 and 3-7). Thus, LEK1 completely blocked differe ntiation in C2C12 myoblasts. To further clarify the effects of LEK1 on myoblast diffe rentiation, C3H10T1/2 fibroblasts were treated with MyoD and the Dual Luciferase Reporter Assay was performed. Following transient transfection with pEM MyoD TnI-luc, pRL-tk, pAcGFPLEK1, and pAcGFP1-C1 plasmids (control), in cubation in the growth medium with precipitates for 5 hours, and culture in the differentiation-permissive medium for 48 hours, C3H10T1/2 fibroblasts was lysed and the luciferase activities were determined. The Renilla luciferase activities showed the transfection efficiency was very high in all treatment groups (data not shown). The smallest GFPLEK1 (48 kDa) did not a ffect differentiation of MyoD -treated C3H10T1/2 fibroblasts. In contrast, the larger GFPLEK1 (54 and 73 kDa) significantly inhibited differentiation (P < 0.05). In summary, GFPLEK1 proteins completely bl ocked differentiation in C2C12 myoblasts. However, in MyoD -treated C3H10T1/2 fibrobl asts, only the larger GFPLEK1 (54 and 73 kDa) inhibited differentiation. The size of the smallest GFPLEK1 fusion protein (48 kDa) was not sufficient to suppress differentiation in MyoD -treated C3H10T1/2 fibroblasts.

PAGE 38

38 Establishment of a Muscle Regeneration Model Objective Morphological changes during skeletal m uscle regeneration are best characterized following severe damage of muscle fibers (Charge and Rudnicki, 2004). Following muscle damage, muscle regeneration occu rs via activation, pro liferation, and different iation of satellite cells (Hawke and Garry, 2001; Charge and Rudni cki, 2004). To induce muscle degeneration, various models have been employed, such as crushing, lacerating, mincing, exposing to extreme temperature/strain, or injecting myotoxin (Carlson and Faulkner, 1983; Classon, 1986; Armstrong et al., 1991; Marlow et al., 1996; Menetrey et al., 2000; Plant et al., 2006). Among them, the myotoxin models have been well establ ished. The advantage of using myotoxin is that consistent muscle damage can be obtained, which allows direct comparison among treatment groups (Plant et al., 2006). However, the effects of myotoxin on structural and functional muscle damage can vary among species. For instance, th e effects of bupivacaine injection on skeletal muscle function are much less in mice than thos e in rats (Rosenblatt, 1992; Holmes et al., 2002). In addition, the type and concentration of myotoxin, dosage, muscle type, gender, and age may cause the difference in the level of muscle damage and regenera tion. Therefore, to compare the results to the literature, it is very important to establish a sk eletal muscle regeneration model using a specific method, species, muscle type, ge nder, and age. The objective of the experiments was to establish a skeletal muscle regeneration model following a submaximal dosage of bupivacaine injection into TA of adult male mice. Muscle Regeneration Model Saline (70 L) or 5% bupivaca ine (5 mg/ml, 70 L) was injected into TA of 6 week-old C57BL/6 male mice. Mice were fed ad libitum and housed in an environmentally controlled room throughout the experimental periods. For the control group, mice were sacrificed by CO2

PAGE 39

39 inhalation 1 day after bupivaca ine injection. For th e bupivacaine-treated groups, they were sacrificed at 1, 3, 5, 7, and 10 days post-inje ction. Muscles were removed and cryosectioned. Fixed samples were immunostained for dystrophin and Hoechst to identify myofiber membranes and myonuclei, respectively. In control samples, muscle fiber membranes were intact and Hoechst-staining was observed in the periphery of myofibers (Figure 3-9). In the bupivacainetreated samples, progressive fiber damage was observed for the first 3 days. The muscle membranes began to be degraded and Hoechst st aining was concentrated in the injured areas on Day 1 (Figure 3-9). On Day 3, large cavities were formed in the heavily injured sites. In agreement with the previous study, the fiber damage was maximal 3 days after bupivacaine injection into adult male C57BL mice (Plant et al., 2006). Hoechst-staining was concentrated within the injured cavities on Day 3. From Day 5 to 7, progressive fiber repair was observed. On Day 5, damaged muscle fibers were significantl y repaired and the cavity size was decreased while Hoechst-staining was still concentrated wi thin the injured sites (Figure 3-10). On Day 7, muscle damage was mostly repaired and the cavity size was further reduced (Figure 3-11). Finally, on Day 10, myofibers were almost completely repaired and a single or multiple myonuclei were centrally located in each fiber (F igure 3-11). These results completely agree with the previous studies (C harge and Rudnicki, 2004; Plant et al., 2006; Arsic et al., 2008; Epting et al., 2008). Role of LEK1 in Muscle Regeneration Objective The roles of LEK1 protein in chromosome segregation, recycle of transport vesicles, embryonic development, cellular proliferation, and differentiation have been suggested by several studies. However, no study has shown the role of LEK1 in skeletal muscle regeneration following muscle injury despite th at activation, proliferation, and di fferentiation of satellite cells

PAGE 40

40 are the key factors in myogenesi s (Charge and Rudnicki, 2004). Th e objective of the experiments was to determine the expression pattern of LEK 1 protein during bupivaca ine-induced skeletal muscle regeneration using a well established mode l. Muscle sections were immunostained for LEK1 protein. It is well known that proliferation of activated sate llite cell and macrophage influx occurs during injury-induced skeletal muscle degeneration and regeneration (Charge, 2004; Fielding et al., 1993; Orimo et al., 1991). However, 4, 6-d iamidino-2-phenylindole 2HCl (DAPI) stains macrophage as well as DNA (Browne et al., 2002). In this study, muscle sections were stained with Hoechst which is structurally and functionally virtually identical to DAPI as a fluorescent stain (Buys and van der Veen, 1982; Bernheim and Miglierina, 1989). Therefore, it was expected that myonuclei, nuclei of satellite cells, and macrophages be stained with Hoechst. To distinguish the nuclei of activated satellite cells from other myonuclei and macrophages, samples were immunostained for a satellite cell marker Pax7 which is expressed both by quiescent and by activated satellite cells (Z ammit et al., 2004). Expression Pattern of LEK1 In control samples, LEK1 expression was m ini mal (Figure 3-12). However, as expected, some LEK1 molecules and Hoechst staining were id entified in the satellite positions (Figure 322). On the other hand, progressive expression of LEK1 protein was mainly seen in the heavily degenerating or regenerating sites up to Day 5 in myotoxin-treated samples. On Day 1, LEK1 began to be expressed. Alt hough its expression level was very low (Figure 3-21), LEK1 completely overlapped with Hoechst staining in the degenerating sites (F igure 3-12). On Day 3, muscle damage was maximal and LEK1 expression was significantly elevated and overlapped with Hoechst staining in the caviti es of the most heavily damaged sites (Figure 3-13). On Day 5, muscle damage was significantly repaired and LEK1 expression reached its peak in the sarcoplasm of regenerating myofib ers while Hoechst staining was still concentrated in the

PAGE 41

41 injured sites (Figure 3-13 and 3-21). On Day 7, damaged myofiber s were mostly repaired and LEK1 expression was significantly reduced (F igure 3-14 and 3-21). Finally, on Day 10, LEK1 was localized in the center of myofibers w ith Hoechst staining (Figure 3-14 and 3-20). Importantly, some LEK1 molecules were identif ied with Hoechst staining in the satellite positions on Day 10 (Figure 3-20). Expression Pattern of Pax7 In control sample, Pax7 expression was m ini mal. However, as expected, some Pax7 expression was identified with LEK1 and Hoechst staining (Figure 3-16). In bupivacaine-treated samples, progressive expression of Pax7 was observed up to Day 3. On Day 1, Pax7 was slightly elevated and co-localized with LEK1 although most LEK1 molecules were not co-localized with Pax7 (Figure 3-16). On Day 3, Pax7 expression was maximal (Figure 3-17) when myofibers were most heavily damaged (Figure 3-13). Surprisingly, Pax7 and LEK1 molecules were completely overlapped with each other. On Da y 5, Pax7 expression was dramatically reduced when muscle damage was significantly repaired (Figure 3-17). On Day 7, little Pax7 expression was identified (Figure 3-18). Finally, on Da y 10, Pax7 was undetectable (Figure 3-18). In summary, satellite cell marker Pax7 completely overlapped with LEK1 and Hoechst staining throughout the experiment al period both in intact a nd bupivacaine-treated samples (except Day 10 when Pax7 was undetectable). In intact muscles, al though expression of Pax7 and LEK1 was very limited, Pax7 was detected with LEK1 and Hoechst (Figure 3-16) which were also observed in the satellite position (Fi gure 3-22). In bupivacaine-treated samples, the level of Pax7 expression and Hoechst staining were proportional to that of muscle injury, reaching their peaks on Day 3 (Figure 3-17 and Fi gure 3-21). During this stage, LEK1 and Pax7 completely overlapped with each other (Figure 3-17) When muscle damage began to be repaired on Day 5 (Figure 3-13 and 3-21), Pax7 was dram atically reduced (Figure 3-17) while LEK1

PAGE 42

42 expression reached its peak in regenerating musc le bed (Figure 3-13 and 3-21). As fiber damage was further repaired, LEK1 expression was signi ficantly reduced (Figure 3-14 and 3-21) and Pax7 were hardly detectable (Figure 3-18). When central nuclei were formed on Day 10, a majority of LEK1 translocated from the sarcopl asm to the center of myofibers (Figure 3-20 and 3-22) and Pax7 became completely undetectable (F igure 3-18). On the other hand, a minority of LEK1 were identified with Hoechst staining in the satellite position ag ain (Figure 3-22).

PAGE 43

43 Figure 3-1. Structure of full length of LEK1 protein and its posttranslational cleavage products. LEK1 protein is cleaved into the Nand C-terminus portions. In response to stimulation of MAKP signaling, the C-terminus portion is further cleaved into two fragments. DNA constructs with various length of C-terminus LEK1 gene were created to determine the domina nt inhibitory effects of GFPLEK1 fusion proteins on cellular proliferation and di fferentiation. HLH, NLS, and LEK1 indicate the basic helix-loop-helix domain, nuclear loca lization sequence, and C-terminus LEK1 mutant, respectively.

PAGE 44

44 Figure 3-2. Westernblot of GFPLEK1 fusion proteins in C2C12 myoblasts. As expected, the fusion proteins were detected at appr oximately 48, 54, and 73 kDa. C2C12 myoblats were transfected with DNA precipitates containing pAcGFP1-C1 vector or GFPLEK1 gene constructs to ge nerate 22, 28, and 47 kDa of LEK1 with 26 kDa of GFP. Following incubation with precipitates for 5 hours, culture in the new growth medium for 24 hours, wash with TBS, cell lysis, sonicati on, and centrifugation, supernatant of samples was electrophorectically sepa rated through polyacrylamide gels and transferred to nitrocellulose me mbrane. The blots were blocked with 5% milk in TBST and incubated with antiGFP antibody in blocking solution for 60 minutes and donkey peroxidase-conjugated anti-mouse IgG in blocking solution for 45 minutes. LEK1 indicates C-terminus LEK1 mutant.

PAGE 45

45 Figure 3-3. Expression of pro liferation marker Ki67 in co ntrol and transfected C2C12 myoblasts. A) Cells transfected by the control vector pAcGFP-C1. B) Cells transfected by the DNA construct encoding GFPLEK1 (22 kDa) fusion protein. Ectopic expression of GFPLEK1 (22 kDa) stimulated pr oliferation of myoblasts. Cells were transfected with DNA precipi tates containing pAcGFP1-C1 vector or GFPLEK1 gene construct. Following inc ubation with precipitates for 5 hours, culture in the new growth medium for 24 hours, cells were fixed, permeabilized, blocked, and immunostained for Ki67. LEK1 indicates C-terminus LEK1 mutant. Representative photomicrogr aphs at 200X are shown. A B

PAGE 46

46 Figure 3-4. Expression of prolif eration marker Ki67 in transfected C2C12 myoblasts. A) Cells transfected by the DNA construct encoding GFPLEK1 (28 kDa) fusion protein. B) Cells transfected by the DNA construct encoding GFPLEK1 (47 kDa) fusion protein. Ectopic expression of GFPLEK1 (28 or 47 kDa) fusion proteins stimulated proliferation of myoblasts. Cells were tr ansfected with DNA pr ecipitates containing GFPLEK1 gene constructs. Following inc ubation with precipitates for 5 hours, culture in the new growth medium for 24 hours, cells were fixed, permeabilized, blocked, and immunostained for Ki67. LEK1 indicates C-terminus LEK1 mutant. Representative photomicrogr aphs at 200X are shown. A B

PAGE 47

47 Figure 3-5. Summary graph of Expression of proliferation ma rker Ki67 in C2C12 myoblasts. Ectopic expression of GFPLEK1 (22, 28 or 47 kDa) fusion proteins doubled proliferation of myoblasts. Cells were tr ansfected with DNA pr ecipitates containing pAcGFP-C1 vector or GFPLEK1 gene constructs to generate 22, 28, or 47 kDa LEK1 with GFP. Following incubation with pr ecipitates for 5 hours, culture in the new growth medium for 24 hours, cells were fixed, permeabilized, blocked, and immunostained for Ki67. The percentage of Ki67-positive cells among GFP-positive cells were calculated. LEK1 indicates C-terminus LEK1 mutant (22, 28, or 47 kDa). Experiments were duplicated. The Asterisk indicates a significant difference (P < 0.05).

PAGE 48

48 Figure 3-6. Expression of diffe rentiation marker MyHC in c ontrol and transfected C2C12 myoblasts. A) Cells transfected by the cont rol vector. B) Cells transfected by the DNA construct encoding GFPLEK1 (22 kDa) fusion prot ein. Ectopic expression of GFPLEK1 (22 kDa) fusion proteins inhibited differentiation of myoblasts. Cells were transfected with DNA precipitate s containing pAcGFP-C1 vector or GFPLEK1 gene construct. Following incubation w ith precipitates for 5 hours, culture in the new growth medium for 24 hours, and cu lture in the differentiation-permissive medium for 48 hours, cells were fixed, permeabilized, blocked, and immunostained for MyHC. Representative photom icrographs at 200X are shown. A B

PAGE 49

49 Figure 3-7. Expression of diffe rentiation marker MyHC in tr ansfected C2C12 myoblasts. A) Cells transfected by the DNA construct encoding GFPLEK1 (28 kDa) fusion protein. B) Cells transfected by the DNA construct encoding GFPLEK1 (47 kDa). Ectopic expression of GFPLEK1 (28 kDa or 47 kDa) i nhibited differentiation of myoblasts. Cells were transfected with DNA precipitates containing GFPLEK1 gene constructs. Following incubation with precipitates for 5 hours, culture in the new growth medium for 24 hours, and culture in the differentiation-permissive medium for 48 hours, cells were fixed, permeabilized, blocked, and immunostained for MyHC. Representative photomicrographs at 200X are shown. A B

PAGE 50

50 Figure 3-8. Estimation of myoblast differentiatio n by the Dual Luciferase Reporter Assay. The smallest GFPLEK1 (22 kDa) did not affect differentiation in MyoD -treated C3H10T1/2 fibroblasts. In contrast, the larger GFPLEK1 (28 or 47 kDa) significantly inhibited differe ntiation. In addition to pAcGFP-C1 vector or GFPLEK1 plasmids, 10T1/2 fibroblasts received MyoD TnI-luc, and pRL-tk. Following incubation with precipitates for 5 hours and culture in the differentiation-permissive medium for 48 hours, cells were lysed and th e luciferase activities were measured by the Dual-Luciferase Reporter Assay System. LEK1 indicates C-terminus LEK1 mutant (22, 28, or 47 kDa). As terisk indicates a significant difference (P < 0.05).

PAGE 51

51 Figure 3-9. Dystrophin and Ho echst staining on Day 1. A) Control muscle sections. B) Bupivacaine-treated muscle sections. Bupiv acaine treatment induced skeletal muscle degeneration within a day. Saline or bupivacaine was injected into mouse TA muscles. Animals were sacrificed 24 hours later. Muscles were cryosectioned and immunostained for Hoechst and dystrophin. Representative photomicrographs at 300X are shown. A B

PAGE 52

52 Figure 3-10. Dystrophin and Hoechst staining on Day 3 and 5. A) Bupivacaine-treated muscle sections on Day 3. B) Bupivacaine-treated muscle sections on Day 5. Bupivacaineinduced muscle damage was maximal on Day 3. Damaged myofibers began to be repaired within 5 days. Influx of activated satellite cells and/or macrophages was seen in the injured sites in both Day 3 and 5. Bupivacaine was injected into mouse TA muscles. Animals were sacrificed 3 and 5 days later. Muscles were cryosectioned and immunostained for Hoechst and dystrophin. Representative photomicrographs at 300X are shown. A B

PAGE 53

53 Figure 3-11. Dystrophin and Hoechst staining on Day 7 and 10. A) Bupivacaine-treated muscle sections on Day 7. B) Bupivacaine-treated muscle sections on Day 10. Most fiber damage was repaired within 7 days following the bupivacaine treatment. Hoechst staining was removed from the injured site on Day 7 and translocated to the center of myofiber on Day 10. Bupivacaine was inject ed into mouse TA muscles. Animals were sacrificed 7 and 10 da ys later. Muscles were cr yosectioned and immunostained for Hoechst and dystrophin. Representati ve photomicrographs at 300X are shown. A B

PAGE 54

54 Figure 3-12. Dystrophin, Hoechst, and LEK1 staining on Day 1. A) Control muscle sections. B) Bupivacaine-treated muscle sections. LEK 1 protein was expressed in the damaged area within a day following the bupivacaine treatment. LEK1 expression overlapped with Hoechst staining. Bupivacaine was inje cted into mouse TA muscles. Animals were sacrificed 24 hours later. Muscles we re cryosectioned and immunostained for Hoechst, dystrophin, and LEK1. Representa tive photomicrographs at 300X are shown. B A

PAGE 55

55 Figure 3-13. Dystrophin, Hoechst, and LEK1 staining on Day 3 and 5. A) Bupivacaine-treated muscle sections on Day 3. B) Bupivacaine -treated muscle sections on Day 5. LEK1 was progressively expressed up to Day 5. The LEK1 expression was at its peak on Day 5 and translocated from the injure d cavity to regenera ting muscle bed. Bupivacaine was injected into mouse TA mu scles. Animals were sacrificed 3 and 5 days later. Muscles were cryosectioned and immunostained for Hoechst, dystrophin, and LEK1. Representative photomic rographs at 300X are shown. A B

PAGE 56

56 Figure 3-14. Dystrophin, Hoechst, and LEK1 st aining on Day 7 and 10. A) Bupivacaine-treated muscle sections on Day 7. B) Bupivacai ne-treated muscle sections on Day 10. Damaged myofibers were mostly repaired and LEK1 expression was reduced on Day 7. Myofibers were almost completely repaired and both myonuclei and LEK1 translocated to the center of myofibers on Day 10. Bupivacaine was injected into mouse TA muscles. Animals were sacrific ed 7 and 10 days later. Muscles were cryosectioned and immunostained for Hoech st, dystrophin, and LEK 1. Representative photomicrographs at 300X are shown. A B

PAGE 57

57 Figure 3-15. Presence of LEK1 in the mononuclear satellite position in the cavities of most heavily damaged site on Day 3. LEK1 expression overlapped with Hoechst staining. LEK1 also completely overlapped sate llite cell marker Pa x7 (Figure 3-17). Bupivacaine was injected into mouse TA mu scles. Animals were sacrificed 3 days later. Muscles were cryosectioned and immunostained for Hoechst, dystrophin, and LEK1. Representative photomicrographs at 600X are shown.

PAGE 58

58 Figure 3-16. Pax7, Hoechst, and LEK1 staining on Day 1. A) Control muscle sections. B) Bupivacaine-treated muscle sections. In in tact muscles, expression of Pax7 and LEK1 was very limited. In bupivacaine-treated samp les, Pax7 level was slightly elevated on Day 1. In both control and bupivacaine-tr eated samples, Pax7 overlapped LEK1 and Hoechst staining. Bupivacaine was injected into mouse TA muscles. Animals were sacrificed 24 hours later. Muscles were cryosectioned and immunostained for Pax 7, Hoechst, and LEK1. Representative phot omicrographs at 300X are shown. A B

PAGE 59

59 Figure 3-17. Pax7, Hoechst, and LEK1 staining on Day 3 and 5. A) Bupivacaine-treated muscle sections on Day 3. B) Bupivacaine-treated mu scle sections on Day 5. Pax7 expression was at its peak and completely overlapped with LEK1 on Day 3. As damaged fibers were repaired, Pax7 expression was reduced while LEK1 reached its peak on Day 5 (Figure 3-13 and 3-21). Bupivacaine was in jected into mouse TA muscles. Animals were sacrificed 3 and 5 days later. Muscles were cr yosectioned and immunostained for Pax 7, Hoechst, and LEK1. Representativ e photomicrographs at 300X are shown. B

PAGE 60

60 Figure 3-18. Pax7, Hoechst, and LEK1 staini ng on Day 7 and 10. A) Bupivacaine-treated muscle sections on Day 7. B) Bupivacaine -treated muscle sections on Day 10. Pax7 expression was hardly detectable on Day 7 and completely undetectable on Day 10. Bupivacaine was injected into mouse TA mu scles. Animals were sacrificed 7 and 10 days later. Muscles were cryosectioned and immunostained for Pax 7, Hoechst, and LEK1. Representative photomicrographs at 300X are shown. A B

PAGE 61

61 Figure 3-19. Presence of LEK1 in the sarcoplasm of regenerated muscle bed on Day 5. As damaged fibers began to be repaired, LEK 1 reached its peak (Figure 3-13 and 3-21). Bupivacaine was injected into mouse TA mu scles. Animals were sacrificed 5 days later. TA muscles were cryosectioned a nd immunostained for Hoechst, dystrophin, and LEK1. Representative photomic rographs at 600X are shown.

PAGE 62

62 Figure 3-20. Translocation of LEK1 to central nuclei on Day 10 (see also Figure 3-14 and 3-22). Bupivacaine was injected into mouse TA mu scles. Animals were sacrificed 10 days later. TA muscles were cryosectioned a nd immunostained for Hoechst, dystrophin, and LEK1. Representative photomic rographs at 600X are shown.

PAGE 63

63 Figure 3-21. Dystrophin, Hoechst, and LEK1 st aining throughout the experiment (X100). A) Control and bupivacaine-treated muscle se ctions on Day 1 and 3. B) Bupivacainetreated muscle sections on Day 5, 7, a nd 10. Muscle damage and Hoechst staining reached their peaks on Day 3. In contrast LEK1 expression reached its peak on Day 5. As damaged fibers were further repa ired on Day 7, LEK1 was reduced and then translocated from muscle bed to centr al nuclei on Day 10 (see also Figure 3-22). Saline or bupivacaine was injected into m ouse TA muscles. Animals were sacrificed 1, 3, 5, 7 and 10 days later. Muscles we re cryosectioned and immunostained for dystrophin, Hoechst, and LEK1. Representa tive photomicrographs at 100X are shown. Con Day 1 Day 3 Day 5 Day 7 Day 10 A B

PAGE 64

64 Figure 3-22. Dystrophin, Hoechst, and LEK1 st aining throughout the experiment (X600). A) Control and bupivacaine-treated muscle se ctions on Day 1 and 3. B) Bupivacainetreated muscle sections on Day 5, 7, and 10. LEK1 with Hoechst staining was identified in the satellite position in cont rol and bupivacaine-tr eated muscle on Day 10. Muscle damage and Hoechst staining reached their peaks on Day 3. LEK1 was maximal on Day 5. LEK1 was reduced on Day 7 and translocated from muscle bed to central nuclei on Day 10. Saline or bupivacaine was injected into mouse TA muscles. Animals were sacrificed 1, 3, 5, 7 and 10 days later. Muscles were cryosectioned and immunostained for dystrophin, Hoechst, and LEK1. Representative photomicrographs at 600X are shown. Con Day 1 Day 3 Day 5 Day 7 Day 10 A B

PAGE 65

65 CHAPTER 4 DISCUSSION Dominant Inhibitory LEK1 Mutants LEK1 protein is posttranslationally cleaved into the cytoplasm ic Nand nuclear Cterminus portions (Ashe et al ., 2004; Soukoulis et al., 2005; Pool ey et al., 2006). The latter is further cleaved into approximately 60 and 50 kDa fragments in response to MAPK signaling (Reed et al., 2007). Among these, the C-termi nus most portion of LEK1 (~ 50kDa) contains several well-known functional domains, such as the Rb-binding domain or NLS (Goodwin et al., 1999; Ashe et al., 2004). Therefore, competitiv e inhibition of these domains of endogenous LEK1 would reveal the function of these domains in various biological conditions. A dominant negative protein inhibits the function of wild type protein by intera cting with the same target as the wild type protein. In this study, various sizes of exogenous GFPLEK fusion proteins were expressed in C2C12 myoblasts fo llowing transfection to determine the effects of C-terminus most 22, 28, and 47 kDa of LEK1 proteins on myoblast proliferation and differentiation (Figure 3-1 and 3-2). Theoretically, these LEK1 mutant proteins compete with endogenous LEK1 for binding to pRb and thus inhibit LEK1-pRb inte raction. Since pRb is known as a cell cycle inhibitor and LEK1-pRb interact ion is critical for differentiation in a certain cell type (Papadimou et al., 2005), this experimental appro ach is an ideal to st udy the function of cLEK1 in myoblast proliferation and differentiation. DNA sequencing and the We stern blot analysis showed that ligation and transf ection were successfully performe d and the plasmids were ready to be used for the proliferation and differentiation assays (Figure 3-2). The LEK1 Mutants Promote Myoblast Proliferation The role of LEK1 protein in cel lula r proliferation have been implicated by several studies based on localization, dominant inhibitory effects of LEK, and the level of LEK1 protein in

PAGE 66

66 various cell types and conditions (Goodwin et al., 1999; Ashe et al., 2004; Dees et al., 2005; Reed et al., 2007; Evans et al., 2007). These studie s have shown that its role depends on the cell type and developmental stage. In mouse TA section, LEK1 protein was localiz ed in the nucleus of satellite cells. In primary culture of satellite cells, LEK1 and E2 F5 were found in the nucleus when cells were mitotically inactive. When these cells were ac tivated, LEK1 and E2F5 changed their localization to the cytosol. Furthermore, when 23A2 myoblasts were m itotically arrested by MAPK signaling, LEK1, pRb, and E2F5 translocated from th e cytosol to the nucleus (Reed et al., 2007). pRb is a cell cycle inhibitor (Murphree and Benedict, 1984) and E2F5 is one of the transcriptional repressor E2Fs which are nece ssary for cell cycle exit (Gaubatz et al., 2000). Therefore, via an unknown mech anism, LEK1, pRb, and E2F5 may work in concert to induce the cell cycle arrest. LEK1 binds to all pocke t protein members including pRb (Ashe et al., 2004). Although pRb does not bind to E2F5, it may indirectly in teract with E2F5 via LEK1 (Reed, 2006) or cross-regulation of E2Fs (Trimachi and Lees, 2002). In response to MAPK signaling, phosphorylated extracellular signal-regulated kinases (pERK1/2), LEK1, pRb, and E2F5 may form a complex with ERK1/2 at n LEK1 and then LEK1 is cleaved into nLEK1 and cLEK1, producing pERK1/2-nLEK1 and pRb-c LEK1-E2F5 complexes. Then, a pERK1/2nLEK1 complex stays in the cytosol while a pR b-cLEK1-E2F5 complex is targeted to the nucleus (Reed, 2006; Reed et al., 2007). E2F5 does not possess NLS (Chen et al., 2008) while LEK1 and pRb do (Efthymiadis et al., 1997; Goodw in et al, 1999). Therefore, E2F5 may be shuttled to the nucleus by LEK1 or the LEK1pRb complex when myoblasts are mitotically arrested (Reed, 2006; Reed et al., 2007). LEK1-pRb interaction is necessary for differentiation in embryonic cardiomyocytes (Papadimou et al., 2005). In myoblasts, proliferation and

PAGE 67

67 differentiation are mutually exclusive and cells can differentiate only af ter the cell cycle exit. Thus, LEK1-pRb interaction may directly or indir ectly affect the activity of E2F5 to induce the cell cycle arrest prior to diffe rentiation. This hypothesis is strongly supported by the study using a Rb knockout cell line. (Papadimou et al., 2005). In this study, differe ntiation was almost completely blocked by the absence of pRb, presence of LEK1 (7 kDa), and combination of both. Both endogenous LEK1 and exogenous LEK1 bind to all Rb family pocket proteins (Ashe et al., 2004). In th e presence of exogenous LEK1 and endogenous pocket proteins, LEK1 competes with endogenous LEK1 for binding to p107, p130, and pRb and less LEK1pocket protein complex should be formed. In Rb knockout cells, neither LEK1-pRb nor LEK1pRb complex is formed. This also oc curs in the presence of exogenous LEK1 and absence of pRb. These findings indicate that reduced in teraction of LEK1 with p107, p130 and/or pRb blocked differentiation. However, absence of pR b alone was sufficient to block differentiation. Therefore, simultaneous expression of LEK1 a nd pRb rather than p107 and p130 is required for differentiation in cardiomyocytes differentiated from ES cells. Im portantly, ectopic expression of pRb completely rescued the LEK1-expressing Rb knockout cells and the cells fully differentiated. In this condition, overexpression of pRb should have increased the formation of both LEK1-pRb and LEK1-Rb complexes. Since both LEK1 and LEK1 proteins were expressed in the cells, the expression level of exogenous pRb must have been strong enough so that the sufficient amount of LEK 1-pRb complex was formed to re scue the differentiation-deficit cells. In myoblasts, cells must ex it the cell cycle to terminally di fferentiate. Therefore, the LEK1pRb interaction may induce the cell cycle arrest prior to differentiation. When this is the case, the LEK1-pRb interaction may prom ote proliferation by reducing the amount of LEK1-pRb complex via competitive inhibition. The results of the current study showed that competitive

PAGE 68

68 inhibition of LEK1 by ectopic expression of LEK1 doubled expression of proliferation marker Ki67 in C2C12 myoblasts (Figure 3-3, 3-4, and 3-5), suggesting that LEK1 induces the cell cycle arrest prior to differentiation in myoblasts, possibly via its interaction with pRb and E2F5. On the other hand, it has been repor ted that LEK1 may promote proliferation in C2C12 myoblasts (Goodwin et al., 1999; Ashe et al., 2004), NIH3T3 fibroblasts (Ashe et al., 2004), COS-7 fibroblasts (Evans et al., 2007) and embryonic/neonatal heart (Goodw in et al., 1999; Dees et al., 2005). In embryonic and neonatal cardiomyocytes, LEK1 protein expression was high during the mitotically active developmental stage and low dur ing the differentiation stage (i.e., several days after birth) (Goodwin et al., 1999; Dees et al ., 2005). In proliferati ng C2C12 myoblasts, LEK1 protein was found more in the nucleus than the cytosol (Goodwin et al., 1999). In COS-7 fibroblasts, ectopic expression of LEK1 (85 kDa) significantly reduced BrdU incorporation (Evans et al., 2007). Finally, deletion of LEK1 protein using morpholino antisense oligomers resulted in the significantly lowe r number of cells compared to control in C2C12 myoblasts and NIH3T3 fibroblasts and the redu ced number of phospho-histone H3-positive cells in NIH3T3 fibroblasts (Ashe et al., 2004). It is likely that the disagreement among these studies is due to the different cell types, developmental stages, size of LEK1, and experimental approaches to determine the effects of LEK1 expression on cellular prol iferation. For instance, deletion and competitive inhibition of LEK1 protein are not the same biological phenome na. To determine the effects of the LEK1-pRb interaction on cellular pro liferation or differentiation, the latte r experimental approach is more useful. Cardiomyocytes diffe rentiated from ES cells ( in vitro ) are also biologically different from embryonic/neonatal heart ( in vivo ). Finally, ectopic expressi on of different sizes of LEK1 (7 kDa vs. 85 kDa) may cause different results. A lthough it has been suggested that the LEK1-pRb

PAGE 69

69 interaction allows free activat or E2Fs to bind DNA stimulati ng expression of E2F-responsive genes to promote proliferation or inhibit terminal differentia tion (Ashe et al., 2004), this hypothesis was based on th e study without direct manipulat ion of pRb expression level or competitive inhibition of LEK1-pRb binding. Rb pocket proteins are known as coordinators of cellular proliferat ion and differentiation (Goodrich et al., 1991; Kobayashi et al., 1998). Although the precise mechanism is unclear, it has been suggested that hypophosphorylated pRb binds to E2Fs, repressing and promoting transcription of genes required for proliferation and differentia tion, respectively (Nevins et al., 1992). Therefore, pRb-mediated repression of pr oliferation and promotion of differentiation depends on the phosphorylation status of pRb wh ich is regulated by cdks. However, it also depends on acetylation of pRb by HAT, such as p300 or CBP (Khidr and Chen, 2006). Most pRb are hypophosphorylated in quiescent cel ls and phosphorylated in prol iferating cells (DeCaprio et al., 1989). pRb is activated by dephosphorylation in the G0/1 phase of the cell cycle and inactivated by phosphorylation during the late G1-, S-, G2-, and Mphase (DeCaprio et al., 1989; Buchkovich et al., 1989; Khidr and Chen, 2006). Abundance of growth factors stimulates cyclin D1-3 expression and the cyclin -cdk interaction, which promotes the initial phosphorylation of pRb (Trimarchi and Lees et al., 2002). Accumu lation of cyclin E with cdk2 promotes the subsequent phosphorylation of pRb a llowing free activator-E2Fs to s timulate transcri ption of cell cycle genes, which is necessary to pass through the restriction point (i.e., G1 phase checkpoint) of the G1 phase. Once cells go through the restrict ion point, they enter the S-phase. On the other hand, when cellular conditions are not appropriate to enter the S-phase (e.g., lack of growth factors), proliferation is inhibite d and cells may enter the quiescent G0 phase. Inhibitory role of pRb in cellular proliferat ion depends on availability of active fo rm of pRb before the restriction

PAGE 70

70 point of the G1 phase. Overexpr ession of hypophosphorylated pRb in the early G1 phase inhibits the S-phase entry while that in the late G1 pha se has no effect on proliferation (Goodrich et al., 1991). Thus, pRb-mediated inhibition of cellula r proliferation requires hypophosphorylated pRb before the restriction point. Hypophosphorylated pRb binds to an activator E2F-DP complex, which prevents E2F-mediated tran scriptional activation of cell cycl e genes. One of the suggested mechanisms is that pRb blocks the activation domain of E2F by binding to it (Flemington et al., 1993). The other postulation is that the pRb binds to the E2FDP complex and recruits chromatin modifying factors, such as HDAC and SUV39H1. HDAC binds to the pRb-E2F DP complex and deacetylate histone H3, which promotes formation of tightly packed heterochromatin preventing transcription of E2F-responsive genes. Subse quently, SUV39H1 binds to HP1 and methylates histone H3, which silences gene expression by m odifying the histone tail (Trimarchi and Lees, 2002). It has further been postulated that repr essor E2Fs occupy the E2F response promoters when pRb sequesters activator E2Fs (Frolov and Dyson, 2004). Thus, pRb-mediated cell cycle arrest via these mechanisms requires hypophosphorylated pRb at appropriate timing (i.e., prior to the restriction point). In additi on, acetylation of pRb is required fo r pRb-mediated cell cycle exit and differentiation (Nguyen et al., 2004). In summ ary, current study suggests that LEK1 protein is a potential inhibitor of cell cycle progression when bound to pR b and that pRb-mediated cell cycle arrest requires th e LEK1-pRb interaction. The LEK1 Mutants Suppress Myoblast Differentiation The effects of LEK1 protein on cellular diffe rentiation also depends on the cell types, size of LEK1, and developm ental stages of cells a nd the opposite roles of LEK1 protein have been implicated by previous st udies (Goodwin et al., 1999; Dees et al., 2005; Papadimou et al., 2005). As described earlier the LEK1-pRb interaction is nece ssary for differentiation in

PAGE 71

71 embryonic cardiomyocytes (Papadimou et al., 20 05). On the other hand, ectopic expression of LEK (165 kDa) stimulated differentiation in C2 C12 myoblasts (Goodwin, et al., 1999) and the LEK1 protein level was low during the differentiati on phase (i.e., several days after birth) in neonatal mouse heart (Goodwin, et al., 1999; Dees et al., 2005). The disagreement among these studies may be due to the different size of LEK used (i.e., 7 vs. 165 kDa), cell types, and developmental stages. The role of pRb in cellular differentiation is tissue and cell type speci fic (Khidr and Chen, 2006). During myoblast differentiation, the level of pRb is elevated (C oppola et al., 1990) and MoyD-mediated transcriptional act ivation of myogenic genes is stimulated (Gu et al., 1993). Rb knockout mice die before birth and newborn mice with reduced expression of pRb exhibit high apoptosis rates and skeletal muscle defects (Zacksenhaus et al., 1996). Inactivation of pRb inhibits differentiation of myobl asts and promotes the cell cycle reentry of differentiated myotubes with reduced expression of MyHC and extremely elevated cyclin A/B and cdk2 (Novitch et al., 1996). Thus, active pRb is necessary for myoblast differentiation (Schneider et al., 1994). However, pRb-mediated skeletal muscle differentiation depends on acetylation of pRb by HAT (e.g., p300 or CBP) and activity of a novel protein, E1A-like inhibitor of differentiation 1 (EID1). Acetylation of pRb is necessary for pRb-mediated cell cycle exit and differentiation (Nguyen et al., 2004) and differentia tion inhibitor EID1 need to be degraded prior to muscle differentiation (Krutzfeldt et al., 2005). EID1 is expressed in adult cardia c and skeletal muscle cells (McLellan et al., 2000). EI D1 interacts with pRb via its Rb-binding domain, inhibits the HAT activity of p300/CBP, and suppresses MyoD-d ependent transcription of muscle-specific genes (McLellan et al., 2000; Bavner et al., 2002; Ji et al., 2003; Khidr and Chen, 2006). Furthermore, disruption of the EID1-pRb intera ction potentiates MyoD-dependent muscle gene

PAGE 72

72 transcription (McLellan et al., 2000). Finally, proteasome-dependent degradation of EID1 is required for muscle differentiation (Krutzfeld t et al., 2005), which is promoted by p300/CBPmediated acetylation of pRb (Nguyen et al., 2004) In C2 myoblasts, pRb depletion stimulates proliferation and inhibits differentiation with el evated E2F1 and cyclin D1 and reduced MyoD, myogenin, and MyHC (Kobayashi et al., 1998). Expression of dominant inhibitory pRb also promotes proliferation and prevents differentia tion in C2C12 myoblasts (Li et al., 2000). Thus, pRb is necessary for terminal differentiation in myoblasts. However, without interaction of LEK1, pRb alone is not sufficient to induce differentiation in car diomyocytes (Papadimou et al., 2005), suggesting that the LEK1-pR b interaction as well as acetylation of pRb is required for differentiation. Although both LEK1 and EID1 bind to pRb, they do so in the opposite situations. The LEK1-pRb interaction promotes differentia tion while the EID1-pRb binding inhibits pRb acetylation and differentiation. T hus, LEK1 and EID1 dont have to compete for binding to pRb. Finally, LEK1 and myogenin are coexpressed in one of the daught er cells following satellite cell division while Pax7 and E2F5 are expressed in the other da ughter cell (Q uellette, 2007), suggesting that LEK1 is required for the cell to differentiate following asymmetric cell division. In the current study, the dominant inhibitory LEK1 inhibited cellular differentiation both in C2C12 and in MyoD -treated C3H10T1/2 cells In C2C12 myoblasts, LEK (22, 28, and 47 kDa) completely blocked MyHC expression (Figure 3-6 and 3-7). However, in MyoD -treated C3H10T1/2 cells, only two of the three LEK (28 and 47 kDa) reduced the level of differentiation marker protein, troponin-I (F igure 3-8). These results suggest that LEK reduces the LEK1-pRb interaction by competing with LEK1 for binding to pRb and inhibits differentiation in myoblasts. Since only 28 and 47 kDa of LEK1 inhibited differentiation in MyoD -treated C3H10T1/2 cells, there may be an important domain between 22 and 28 kDa of C-

PAGE 73

73 terminus most LEK1 to inhibit myoblast differe ntiation. In summary, this study suggests that LEK1 is required for pRb-mediated cell cycl e arrest and different iation in myoblasts. Establishment of a Muscle Regeneration Model In response to certain stimuli, satellite cells are activated and skeletal m uscle regeneration occurs via activa tion, proliferation, differentiati on, and central localization of satellite cell nuclei (Hawke a nd Garry, 2001; Charge and Rudnicki, 2004). Since morphological changes during muscle degeneration and regenera tion are best characterized following muscle damage (Charge and Rudnicki, 2004 ), various models such as m yotoxin injection or dystrophinlacking mdx mice have been employed. However, features during muscle damage and repair can differ among models and species. For instance, the effects of bupivacaine on muscle damage vary between rats and mice (Holmes et al., 2002; Rosenblatt, 1992). Injection of different myotoxin results in the different degree of muscle damage and repair (Plant et al, 2006). In the mdx mice model, there is a report that Pax7 can be expressed in some central nuclei of hindlimb muscle (Seale et al., 2000) despite that another study has shown satellite cells cannot differentiate in the presence of Pax7 in the si ngle myofiber model (Za mmit et al., 2006). The damage and regeneration level would also depend on the dosage of myotoxin. Thus, it is important to establish a model which produces a consistent level of muscle degeneration and regeneration in a certain speci es. In this study, a submaximal dosage (70l) of 5% bupivacaine was used to induce consistent muscle damage in sk eletal muscles of adult male mice (Plant et al., 2006). In intact adult skeletal muscles, dystrophi n staining showed that the integrity of myofiber membrane was maintained. In the bupivacai ne-treated samples, fiber necrosis occurred within 24 hours, which was characterized by fuse d dystrophin (Figure 3-9). The level of muscle damage was maximal on Day 3, creating large ca vities (Figure 3-10 and 3-21). Damaged fibers

PAGE 74

74 were significantly repaired on Day 5 (Figure 310 and 3-21) and mostly repaired on Day 7 (Figure 3-11 and 3-21). On Day 10, the integrity of myofiber membrane was almost completely recovered and most fibers were centrally nucleated (Figure 3-11) Interestingly, some myofibers had multiple central nuclei, which agrees with the studies using the freezeand cardiotoxininduced muscle injury models (Sachidanandan et al., 2002; Epting et al., 2008). Considering the role of central nuclei in fiber growth via gene expression (Charge and R udnicki, 2004), it is not surprising that some myofibers possess multiple central nuclei in the fiber growth phase of muscle regeneration. All of these results agree with the literature (Cha rge and Rudnicki, 2004; Plant et al., 2006; Arsic et al ., 2008; Epting et al., 2008) and thus the bupivacaine-induced skeletal muscle regeneration model in male mice was well established in this study. Since Hoechst was used for staining of myonuclei in this study and a similar fluorescent stain DAPI has been used as a mark er of macrophages (Browne et al., 2002), it is important to consider the role of macrophage in muscle regeneration. Although the precise role of macrophage in muscle regeneration is unknown (T idball et al., 1999), it has been believed that macrophages promote muscle regeneration and has been considered as a promising therapeutic tool for muscle diseases. Macrophages and activated satellite cells are re cruited to the damaged sites of skeletal muscle within a few days follo wing muscle injury (Fielding et al., 1993; Orimo et al., 1991). One of the known roles of macrophage is to ingest apoptotic nuclei (Esashi et al., 2003). However, more importantly, macrophage and satellite cell cr oss-stimulate their chemotactic activity and attract each other. Fu rthermore, macrophages ac celerate satellite cell proliferation in a dose-dependent manner in vitro (Chazaud et al., 2003). For convenience in the following discussion, individual expe rimental periods are referred to as the degeneration (Day 1), proliferation (Day 3), differentia tion (Day 5), late diffe rentiation (Day 7), a nd fiber growth (Day

PAGE 75

75 10) phases. This is due to initiation of myofiber degeneration on Day 1, maximal Pax7 expression in injured sites on Day 3, initiation of fiber repair on Day 5, near complete fiber repair on Day 7, and central nuclei on Day 10. Limited Expression of LEK1 in Healthy Adult Skeletal Muscle In the intac t adult skeletal muscles, Hoechst staining was in the periphery and expression of Pax7 was nearly undetectable (Figure 3-12 and 316). LEK1 expression was also minimal in agreement with the previous studi es (Goodwin et al., 1999; Dees et al., 2005). However, some Pax7 and LEK1 expression was obser ved with Hoechst staining in the satellite position (Figure 3-22). Since the inflammatory res ponse does not have to be considered in the intact muscles, Hoechst staini ng indicates the myonuclei. This observation agrees with the evidences in three different conditions (i.e., in quiescen t satellite cells in vivo primary culture of mitotically inactive satellite cel ls, and mitotical ly inactive 23A2 myoblas ts) and supports the notion that LEK1 may play a role in maintenance of a quiescent state of satellite cells (Reed et al., 2007; Quellette, 2007). Limited Role of LEK1 in the Degeneration Phase During the degeneration phase (i.e., Day 1) m yofibers began to be destroyed and Hoechst staining was concentrated in the inju red sites (Figure 3-12). Since Pax7 was hardly detectable (Figure 3-16), Hoech st staining was mostly due to macrophage invasion, indicating that macrophage influx occured prior to satellite cell recruitment to th e injured sites. This observation agrees with the evidences that macr ophage influx occurs within 48 hours following skeletal muscle injury (Orimo et al., 1991; Fi elding et al., 1993; Charge and Rudnicki, 2004). Although the level of LEK1 protein was low (Figure 3-21), it virtually 100% overlapped with Hoechst staining within degenera ting muscle bed (Figure 3-12). Fi nally, rare expression of Pax7

PAGE 76

76 overlapped with that of LEK1 (Figure 3-16). Because of its low expression level, it was concluded that LEK1 does not play much role during the degeneration period. Presence of LEK1 in the Mononuclear Satellite Position In agreement with the literature (Plant et al., 2006), muscle damage was maximal and the large cavities were formed during the prolif eration phase (i.e., Day 3). Hoechst staining and LEK1 expression were significantly elevated (Figure 3-21) and c oncentrated in the cavities (Figure 3-13). Pax7 expression was maximal (Fi gure 3-17), indicating maximal recruitment and proliferation of satellite cells. This observati on agrees with the study in which Pax7 was widely expressed in regenerating muscles of mdx mice (Seale et al, 2000). Importantly, Pax7 and LEK1 completely overlapped with each other, suggesting that LEK1 was present in the mononuclear satellite position in the injured cavities (Figure 3-13 and 3-17). In contrast, approximately half of Hoechst staining was Pax7-positiv e (Figure 3-17). However, the amount of macrophages seemed to be unchanged since Hoechst staining doubled (Figure 3-21), which supports the suggestion that macrophages stimulate satellite cell prol iferation (Chazaud et al., 2003). Although LEK1 protein expression was elevated on Day 3, its maximal expression was observed in the differentiation phase (i.e., Day 5). Throughout the experimental period (i.e., Day 1-10), the level of muscle damage and repair differed among indi vidual myofibers. For instance, central nuclei were observed in some myofibers on Day 5 a nd 7 although most myofibers were centrally nucleated on Day 10 (Figure 3-13 and Figure 3-14 ). These early regene rating myofibers must have already been in the differentiation phase on Day 3. Therefore, it is likely that LEK1 expression was moderately increased for pRb-medi ated cell cycle arrest and differentiation of satellite cells in these myofibers.

PAGE 77

77 Presence of LEK1 in the Sarcoplasm of Regenerated Muscle Fibers During the differentiation phase (i.e., Day 5), dam aged myofibers were significantly repaired with the decrease in the cavity size and even some central nucleated fibers were observed (Figure 3-13). Hoechst staining was re duced by approximately 50% (Figure 3-21) and concentrated in the injured cavity (Figure 313). Pax7 expression was ve ry low (Figure 3-17), which is an indication of satelli te cell differentiation. Following th e cell cycle exit, a majority of satellite cells lose Pax7 (Zammit et al., 2006) and differentiate (Conboy et al., 2003). The cells expressing Pax7 cannot differentiate because it downre gulates MyoD and prevents myogenin induction (Olguin and Olwin, 2004). On the other hand, a minority of satel lite cells lose MyoD, maintain Pax7, and return to th e quiescence (Zammit et al., 2004; Zammit et al., 2006). Thus, the small number of satellite cells expressing Pax7 on Day 5 (Figure 3-17) may have re-obtained a quiescent state in the subsequent phase (Olguin and Olwin, 2004) which should have occurred since the absolute number of quiescent sate llite cells remains unchanged following muscle regeneration (Gibson and Sc hultz, 1983). LEK1 expression was maximal on Day 5. LEK1 was mainly expressed in the sarcoplas m of regenerated muscle bed rath er than the regenerating cavity and the integrity of dystrophin was well recovered in these regions (Figure 3-13), indicating that satellite cells shifted from the proliferation to differentiation phase with maximal LEK1 expression. This observation suggests that LEK1 was maximally expressed to induce cell cycle arrest and differentiation of satellite cells possibly via the pRb-LEK1 interaction, which is supported by the results of Ki67 staining (Figure 3-3, 3-4, and 3-5) differentiation assays (Figure 3-6, 3-7, and 3-8), and the study by Papadimou et al. (2005). The LEK1 Protein Expression Overlaps the P ax7 Domain During the late differentiation phase (i.e., Day 7), the cavity size further decreased and myofibers were mostly repaired (Figure 3-14 and 3-21). Hoechst staining was mostly in the

PAGE 78

78 periphery. Although little Pax7 expression was observed (Figure 3-18), it overlapped LEK1. Indeed, Pax7 overlapped LEK1 throughout the expe riments both in the intact and bupivacainetreated samples (Figure 3-16, 3-17, and 3-18), implic ating the critical role of LEK1 protein in satellite cell proliferation and differentiation during muscle re generation. LEK1 expression was also significantly reduced (Figure 3-14 and 3-21) suggesting that most satellite cells committed to the myogenic lineage had already differentia ted and the role of LEK1 in LEK1-mediated differentiation was reduced. The LEK1 Protein Translocat es to Central Nuclei In the fiber growth phase (i.e., Day 10), myof ibers were almost completely repaired. A single or multiple myonuclei were observed in the center of most my ofibers (Figure 3-14), indicating that most myofibers shifted to the fi ber growth phase. However, some myonuclei were found in the satellite cell niche with LEK1 expression (Figure 3-20 and 3-22). LEK1 expression was further reduced and translocated to central nuclei (Figure 3-20 and 3-22). Finally, Pax7 was undetectable (Figure 3-18). In most muscle rege neration studies, only a si ngle central nucleus per fiber section has been shown following injury-in duced skeletal muscle regeneration (Charg and Rudnicki, 2004; Plant et al., 2006). However, so me studies have shown that multiple central nuclei exist during the fiber grow th phase of muscle regenerati on (Arsic et al., 2008; Epting et al., 2008). Considering the function of central myonuclei, multiple central nuclei per fiber section should be more efficient to induce gene expression for maximal fiber growth. The absence of Pax7 in the fiber growth phase agrees with the evidence that satellite cell-derived myoblasts cannot differentiate in the presence of Pax7 (Zammit et al., 2006). However, in one study, Pax7 was observed in some central nuclei of the hindlimb muscle of mdx mice (Seale et al., 2000). This may be due to the difference in the muscle regeneration model since few other studies have shown the same result. In skeletal muscles lacking dys trophin, degeneration and

PAGE 79

79 regeneration process rep eatedly occur and thus sa tellite cells are continuously recruited. In this condition, replenishment of sate llite cell pool becomes more serious task for muscle cells. Expression of Pax7 in so me central nuclei of mdx mouse skeletal muscle may be related to the repetitive degeneration and regeneration cycle. However, in the other study, endogenous Pax7 was not detected in the central nuclei of mdx mouse TA muscle (Seale et al., 2004). Therefore, expression of endogenous Pa x7 in central nuclei of mdx mouse skeletal muscle must be rare, if any. In contrast, delivery of exogenous Pax7 can generate Pax7-positiv e central nuclei in mdx mice (Seale et al., 2004). The simu ltaneous translocation of myonuclei and LEK1 proteins to the center of myofiber implicates th at LEK1 plays a role in central translocation of the myonuclei and/or maintenance of their ce ntral localization. Finally, LEK1 e xpression with Hoechst staining in the satellite cell niche sugge sts that LEK1 may play a role in the self-renewal and/or the maintenance of a quiescence state of satellite cells.

PAGE 80

80 CHAPTER 5 SUMMARY AND CONCLUSIONS Com petitive inhibition of LEK1 by certain sizes of its C-terminus mutants significantly stimulated proliferation and i nhibited differentiation in myoblas ts. Since these mutants contain the atypical Rb-binding domain, it was postulated that LEK1 protei n inhibits proliferation and stimulates differentiation by interacting with pRb in myoblasts. During skeletal muscle degeneration and regeneration, LEK1 expression was very low in the degeneration phase, suggesting that LEK1 does not play much role during muscle degeneration. Maximal expression of LEK1 in the differentiation phase implicates its role in cell cycle arrest and differentiation of satellite cells possibly via the pRb-LEK1 intera ction. Furthermore, LEK1 may play a role in central translocation of myonuclei and/or its cen tral localization. Finall y, localization of LEK1 protein in the satellite cell niche of intact myofibers and myotoxin-injured fiber following damage repair leaves the possibility that LEK1 is involved in the maintenance of a quiescent state and/or the self-renewal satellite cells Thus, LEK1 may play various roles in the proliferation, differentiation, and fiber growth phase of skeletal muscle regeneration. To my knowledge, this is the first finding that LEK1 is involved in injury-induced skeletal muscle regeneration.

PAGE 81

81 LIST OF REFERENCES Ar mstrong, R. B., G. L. Warren, and J. A. Warren. 1991. Mechanisms of exercise-induced muscle fibre injury. Sports. Med. 12:184-207. Arsic, N., D. Mamaeva, N. J. Lamb, and A. Fernandez. 2008. Muscle-derived stem cells isolated as non-adherent population give rise to cardiac, skeletal mu scle and neural lineages. Exp. Cell. Res. 314:1266-1280. Ashe, M., L. Pabon-Pena, E. Dees, K. L. Price, and D. Bader. 2004. LEK1 is a potential inhibitor of pocket protein-mediated cellular processes. J. Biol. Chem. 279:664-76. Bavner, A., L. Johansson, G. Toresson, J. A. Gu stafsson, and E. Treuter. 2004. A transcriptional inhibitor targeted by the atypical orphan nuclear receptor SHP. EMBO. Rep. 3:478-484. Bernheim, A., and R. Miglie rina. 1989. Different Hoechst 33342 and DAPI fluorescence of the human Y chromosome in bivariate flow karyotypes. Hum. Genet. 83:189-93. Bischoff, R. 1986. Proliferation of muscle satellite cells on intact myofibers in culture. Dev. Biol. 115:129-139. Bischoff, R. 1994. Myogenesis, 1st ed. McGraw-Hill, New York. Black, B. L., and E. N. Olson. 1998. Transcriptio nal control of muscle development by myocyte enhancer factor-2 (MEF2) proteins Annu. Rev. Cell. Dev. Biol. 14: 167-196. Blais A., and B. D. Dynlacht. 2004. Hitting their targets: an emerging picture of E2F and cell cycle control. Curr. Opin. Genet. Dev. 14: 527-532. Bomont, P., P. Maddox, J. V. Shah, A. B. De sai, and D. W. Cleveland. 2005. Unstable microtubule capture at kinetochores depleted of the centromere-associated protein CENPF. EMBO. J. 24: 3927-3939. Browne, S. H., M. L. Lesnick, and D. G. Guiney. 2002. Genetic requirements for salmonellainduced cytopathology in human monocyte-derived macrophages. Infect. Immun. 70: 7126-7135. Buckingham, M. 2006. Myogenic progenitor cells and skeletal myogenesis in vertebrates. Curr. Opin. Genet. Dev. 16: 525-532. Buckingham, M. 2007. Skeletal muscle progenitor cel ls and the role of Pax genes. C. R. Biol. 330:530-533. Buller, A. J., J. C. Eccles, and R. M. Eccles. 1960a. Differentiation of fa st and slow muscles in the cat hind limb. J. Physiol. 150:399-416.

PAGE 82

82 Buys, C. H, and A. Y. van der Veen. 1982. Di fferent effects of 33258 Hoechst and DAPI in fluorescent staining of sister chroma tids differentially substituted with bromodeoxyuridine. Histochemistry. 75:169-177. Campion, D. R., R. L. Richardson, J. O. Reag an, and R. R. Kraeling. 1981. Changes in the satellite cell population during pos tnatal growth of pig skeletal muscle. J. Anim. Sci. 52:1014-1018. Caracciolo, V., K. Reiss, C. Crozier-Fitzgerald, F. De Pascali, M. Macaluso, K. A. Khalili, and A. Giordano. 2007. Interplay between the re tinoblastoma related pRb2/p130 and E2F-4 and -5 in relation to JCV-TAg. J. Cell. Physiol. 212:96-104. Carlson, B. M. 1986. Regeneration of entir e skeletal muscles. Fed. Proc. 45:1456-1460. Carlson, B. M., and J. A. Faulkner. 1983. The regeneration of skeletal muscle fibers following injury: a review. Med. Sci. Sports. Exerc. 15:187-198. Chandler, W. K., R. F. Rakowski, and M. F. Schneider. 1976. Effects of glycerol treatment and maintained depolarization on charge movement in skeletal muscle. J. Physiol. 254: 285316. Chanoine, C., G. B. Della, and F. Charbonnier. 2004. Myogenic regulatory factors: redundant or specific functions? Lessons from Xenopus. Dev. Dyn. 231:662-670. Charg, S. B., and M. A. Rudnicki. Cellular a nd molecular regulation of muscle regeneration. 2004. Physiol. Rev. 84:209-238. Chazaud, B., C. Sonnet, P. Lafuste, G. Bassez, A. C. Rimaniol, F. Poron, F. J. Authier, P. A. Dreyfus, and R. K. Gherardi, 2003. Satellite cells attract monocytes and use macrophages as a support to escape apoptos is and enhance muscle growth. J. Cell. Biol. 163:11331143. Chen, Q., D. Liang, and P. A. Overbeek. 2008. Overexpression of E2F5/p130, but not E2F5 alone, can inhibit E2F-induced cell cycle entry in transgen ic mice. Mol. Vis. 14:602-614. Classon, M., and E. Harlow. 2002. The retinoblasto ma tumour suppressor in development and cancer. Nat. Rev. Cancer. 2: 910-917. Classon, M., S. Salama, C. Gorka, R. Mull oy, P. Braun, and E. Harlow. 2000. Combinatorial roles for pRB, p107, and p130 in E2F-mediated ce ll cycle control. Proc. Natl. Acad. Sci. USA. 97: 10820-10825. Cleveland, D. W., Y. Mao, and K. F. Sulliva n. 2003. Centromeres and kinetochores: from epigenetics to mitotic checkpoi nt signaling. Cell. 112:407-421. Collins, C. A., I. Olsen, P. S. Zammit, L. Heslop A. Petrie, and T. A. Partridge. 2005. Stem cell function, self-renewal, and behavioral heter ogeneity of cells from the adult muscle satellite cell niche. Cell. 122:289-301.

PAGE 83

83 Conboy, I. M., M. J. Conboy, G. M. Smythe, and T. A. Rando. 2003. Notch-mediated restoration of regenerative potential to aged muscle. Science. 302:1575-1577. Conboy, M. J., A. O. Karasov, and T. A. Rando. 2007. High incidence of non-random template strand segregation and asymmetr ic fate determination in di viding stem cells and their progeny. PLoS. Biol. 5:e102. Coppola, J. A., B. A. Lewis and M. D. Cole. 1990. Increased retinoblastoma gene expression is associated with late stages of differentiation in many different cell types. Oncogene.5:1731-1733. Cornelison, D. D. and B. J. Wold. 1997. Single-ce ll analysis of regulator y gene expression in quiescent and activated mouse skeletal muscle satellite cells. Dev. Biol. 191:270-283. DeCaprio, J. A., J. W. Ludlow D. Lynch, Y. Furukawa, J. Gr iffin, H. Piwnica-Worms, C. Huang, and D. M. Livingston. 1989. The product of the retinoblastoma susceptibility gene has properties of a cell cycl e regulatory element. Cell. 58:1085-1095. DeGregori, J., G. Leone, A. Mi ron, L. Jakoi, and J. R. Nevi ns. 1997. Distinct roles for E2F proteins in cell growth control and apopt osis. Proc. Natl. Acad. Sci. USA. 94:7245-7250. Djinovic-Carugo, K., M. Gautel, J. Ylnne, and P. Young. 2002. The spectrin repeat: a structural platform for cytoskeletal protei n assemblies. FEBS. Lett. 513:119-123. Dodd, S.L., J. Selsby, A. Payne, A. Judge, and C. Dott. 2005. Botulinum neurotoxin type A causes shifts in myosin heavy chain composition in muscle. Toxicon. 46:196-203. Dodge, F. A. and R. Rahamimoff. 1967. Co-operativ e action a calcium ions in transmitter release at the neuromuscular junc tion. J. Physiol. 193:419-432. Efthymiadis, A., H. Shao, S. Hbner, and D. A. Jans. 1997. Kinetic characterization of the human retinoblastoma protein bipartite nucle ar localization sequence (NLS) in vivo and in vitro. A comparison with the SV40 larg e T-antigen NLS. J. Biol. Chem. 272:2213422139. Elkin S. L., L. Willams, M. Moore, M. E. H odson, and O. M. Rutherford. 2000. Relationship of skeletal muscle mass, muscle strength and bone mineral density in adults with cystic fibrosis. Clinical. Science. 99:309. Emery, A. E. 2002. The muscular dystrophies. Lancet. 359:687-695. Epting, C. L., J. E. Lpez, A. Pedersen, C. Brown, P. Spitz, P. C. Ursell, and H. S. Bernstein. 2008. Stem cell antigen-1 regulates the tem po of muscle repair through effects on proliferation of alpha7 in tegrin-expressing myoblasts. Exp. Cell. Res. 314:1125-1135. Esashi, E., T. Sekiguchi, H. Ito, S. Koyas u, and A. Miyajima. 2003. Cutting Edge: A possible role for CD4+ thymic macrophages as professi onal scavengers of apoptotic thymocytes. J. Immunol. 171:2773-2277.

PAGE 84

84 Evans, H. J., L. Edwards, and R. L.Goodwi n. 2007. Conserved C-terminal domains of mCenp-F (LEK1) regulate subcellular localization and mitotic checkpoint delay. Exp. Cell. Res. 313:2427-2437. Fielding, R. A., T. J. Manfredi, W. Ding, M. A. Fiatarone, W. J. Evans, and J. G. Cannon. 1993. Acute phase response in exercise. III. Neutr ophil and IL-1 beta accumulation in skeletal muscle. Am. J. Physiol. 265:R166-172. Fosset, M., E. Jaimovich, E. Delpont, and M. La zdunski. 1983. [3H] nitrendipine receptors in skeletal muscle. J. Bi ol. Chem. 25; 258: 6086-6092. Frolov, M. V. and N. J. Dyson. 2004. Molecular mechanisms of E2F-dependent activation and pRB-mediated repression. J. Cell. Sci. 117:2173-2181. Frontera, W. R., V. A. Hughes, K. J. Lutz, a nd W. J. Evans. 1991. A cross-sectional study of muscle strength and mass in 45to 78-y ear-old men and women. J. Appl. Physiol. 71:644. Gans, C., and A. S. Gaunt. 1991. Muscle archit ecture in relation to function. J. Biomech. 24 (Suppl. 1):53-65. Gaubatz, S., G. J. Lindeman, S. Ishida, L. Jakoi J. R. Nevins, D. M. Livingston, and R. E. Rempel. 2000. E2F4 and E2F5 play an essent ial role in pocket protein-mediated G1 control. Mol. Cell. 6: 729-735. Gayraud, M. B., F. Chrtien, P. Flamant, D. Goms, P. S. Zammit, and S. Tajbakhsh. 2007. A role for the myogenic determination gene My f5 in adult regenerative myogenesis. Dev. Biol. 312:13-28. Gerber, A. N., T. R. Klesert, D. A. Bergstrom, and S. J. Tapscott. 1997. Two domains of MyoD mediate transcriptional activation of genes in repressive chromatin: a mechanism for lineage determination in myoge nesis. Genes. Dev. 11:436-50. Gibson, M. C., and E. Schultz. 1983. Age-related di fferences in absolute numbers of skeletal muscle satellite cells. Muscle. Nerve. 6:574-580. Goodrich, D. W., N. P. Wang, Y. W. Qian, E. Y. Lee, and W. H. Lee. 1991. The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell. 67:293302. Goodwin, R. L., L. M. Pabn-Pea, G. C. Foster, and D.Bader. 1999 The cloning and analysis of LEK1 identifies variations in the LEK/centrom ere protein F/mitosin gene family. J. Biol. Chem. 274: 18597-18604. Gordon, A. M., A. F. Huxley, and F. J. Julian. 1966a. Tension development in highly stretched vertebrate muscle fibres J. Physiol. 184:143-169.

PAGE 85

85 Grounds, M. D. 1987. Phagocytosis of necrotic musc le in muscle isografts is influenced by the strain, age, and sex of hos t mice. J. Pathol. 153:71-82. Gu W., J. W. Schneider, G. Condorelli, S. Ka ushal, V. Mahdavi, and B. Nadal-Ginard. 1993. Interaction of myogenic fact ors and the retinoblastoma pr otein mediates muscle cell commitment and differentiation. Cell. 72:309-324. Gussoni, E., Y. Soneoka, C. D. Strickland, E. A. Buzney, M. K. Khan, A. F. Flint, L M. Kunkel, and R. C. Mulligan. 1999. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Na ture. 401: 390-394. Halevy, O., Y. Piestun, M. Z. A llouh, B. W. Rosser, Y. Rinkevic h, R. Reshef, I. Rozenboim, M. Wleklinski-Lee, and Z. Yablonka-Reuveni 2004. Pattern of Pax7 expression during myogenesis in the posthatch ch icken establishes a model for satellite cell differentiation and renewal. Dev. Dyn. 231:489-502. Hamamori, Y., V. Sartorelli, V. Ogryzko, P. L. Pu ri, H. Y. Wu, J. Y. Wang, Y. Nakatani, and L. Kedes. 1999. Regulation of histone acetyl transferases p300 and PCAF by the bHLH protein twist and adenoviral oncoprotein E1A. Cell. 96:405-413. Harris, T. Muscle Mass and Strength: Relati on to Function in Popul ation Studies. 1997. J. Nutr.127: 1004SS. Hasty, P., A. Bradley, J. H. Morris, D. G. Ed mondson, J. M. Venuti, E. N. Olson, and W. H. Klein. 1993. Muscle deficiency and neonatal d eath in mice with a ta rgeted mutation in the myogenin gene. Nature. 364:501. Hauf, S., and Y. Watanabe. 2004. Kinetochore orie ntation in mitosis and meiosis. Cell. 119:317327. Hawke T. J, and D. J. Garry. Myogenic satel lite cells: physiology to mo lecular biology. 2001. J. Appl. Physiol. 91:534-551. Heidt, A. B., A. Rojas, I. S. Harris, and B. L. Black. 2007. Determinants of myogenic specificity within MyoD are required for noncanonical E box binding. Mol. Cell. Biol. 27:59105920. Holmes, A. G., P. Gregorevic, N. Stupka, D. R. Plant, and G. S. Lynch. 2002. Short-term interleukin-15 treatment does not enhance f unctional repair following skeletal muscle injury. Proc Aust. Health. Me dical. Res. Cong. ISSNI:447-4010. Hussein, D., S. S. Taylor. 2002. Farnesylation of Cenp-F is required for G2/M progression and degradation after mitosis. J. Cell. Sci. 115:3403-3414. Huxley, A. F., and R. Niedergerke. 1954. Struct ural changes in muscle during contraction; interference microscopy of living muscle fibres. Nature. 173:971-973.

PAGE 86

86 Huxley, A. F., and R. M. Simmons. 1971. Proposed mechanism of force generation in striated muscle. Nature. 233:533-538. Ikemoto. M., S. Fukada, A. Uezumi, S. Masuda H. Miyoshi, H., Yamamoto, M. R. Wada, N. Masubuchi, Y. Miyagoe-Suzuki, and S. Ta keda. 2007. Autologous Transplantation of SM/C-2.6(+) Satellite Cells Transduced with Micro-dystrophin CS1 cDNA by Lentiviral Vector into mdx Mice. Mol. Ther. 15:2178-2185. Ji, A., D. Dao, J. Chen, and W. R. MacLella n. 2003. EID-2, a novel member of the EID family of p300-binding proteins i nhibits transactivation by MyoD. Gene. 318: 35-43. Jordan, M., and F. Wurm. 2004. Transfection of adherent and suspended cells by calcium phosphate. Methods. 33:136-143. Jubrias S, I. Odderson, P. Esselman, and K. Conl ey. 1997. Decline in isokin etic force with age: muscle cross-sectional ar ea and specific force. Pflu gers Arch 434: 246. Kadi, F., Charifi, N., and J. Henriksson. 2006. The number of satellite cell s in slow and fast fibres from human vastus lateralis mu scle. Histochem. Cell. Biol. 126:83-87. Kadi, F. and L. E. Thornell. 2000. Concomitant in creases in myonuclear a nd satellite cell content in female trapezius muscle following stre ngth training. Histochem Cell. Biol. 113: 99103. Khidr, L. and P. L. Chen. 2006. RB, the c onductor that orchestrates life, death and differentiation. Oncogene. 25: 5210-5219. Kobayashi, M., Y. Yamauchi, and A. Tanaka. 1998. Stable expression of antisense Rb-1 RNA inhibits terminal differentiation of mouse myoblast C2 cells. Exp. Cell. Res. 239: 40-49. Krutzfeldt, M., M. Ellis, D. B. Weekes, J. J. Bull, M. Eilers, M. D. Vivanco, W. R. Sellers, and S. Mittnacht. 2005. Selective ablation of re tinoblastoma protein function by the RET finger protein. Mol. Cell. 18:213-24. Lescaudron, L., E. Peltkian, J. Fontaine-Prus D. Paulin, M. Zampieri, L. Garcia, and E. Parrish. 1999. Blood borne macrophages are es sential for the triggering of muscle regeneration following muscle transplant. Neuromuscul Disord. 9 (2): 72-80. Li, F.Q., A. Coonrod, and M. Horwitz. 2000. Sel ection of a dominant negative retinoblastoma protein (RB) inhibiting satellite myoblast differentiation implies an indirect interaction between MyoD and RB. Mol. Cell. Biol. 20:5129-5139. Liao, H., R. J. Winkfein, G. Mack, J. B. Rattn er, T. J. Yen. 1995. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. J. Cell. Biol. 130:507-518. Lieber, R. L. 1992. Skeletal Musc le Structure and Function: Imp lications for Rehabilitation and Sports Medicine, 1st ed. Williams & Willkins, Baltimore, MD.

PAGE 87

87 Luque, E., J. Pea, P. Salas, I. Jimena, and J. D. Martin. 1996. Changes in satellite cell population associated with regenerating muscle fibers in rats. J. Submicrosc. Cytol. Pathol. 28:305-311. Lymn, R. W., and E. W. Taylor. 1971. Mechan ism of adenosine triphosphate hydrolysis by actomyosin. Biochemistry. 10:4617-4624. MacLellan, W. R., G. Xiao, M. Abdellatif, and M. D. Schneider. 2000. A novel Rband p300binding protein inhibits transactivation by MyoD. Mol. Cell. Biol. 20:8903-8915. Mal, A., M. Sturniolo, R. L. Schiltz, M. K. Ghosh, and M. L. Harter. 2001. A role for histone deacetylase HDAC1 in modulating the transcript ional activity of MyoD: inhibition of the myogenic program. EMBO. J. 20:1739-1753. Marlow, S. A., J. K. McGeachie, M. Tennant, and J. M. Papadimitriou. 1996. A morphometric technique for the histological quantification of skeletal muscle regeneration. J. Anat. 189: 151-158. Martin, T. P., V. R. Edgerton, and R. E. Grindeland. 1988. Influence of spaceflight on rat skeletal muscle. J. Appl. Physiol. 65:2318-2325. Mauro, A. Satellite cells of sk eletal muscle fibers. 1961. J. Bi ophys. Biochem. Cytol. 9:493-496. McComas, A. J. 1996. Skeletal Muscle: Form and Function, 1st ed. Human Kinetics, Champaign, IL. McFarlane, C., A. Hennebry, M. Thomas, E. Pl ummer, N. Ling, M. Sharma, and R. Kambadur. 2008. Myostatin signals through Pax7 to regulate satellite cell self-renewal. Exp. Cell. Res. 314:317-329. McKinnell, I. W., J. Ishibashi, F. Le Grand, V. G. Punch, G. C. Addick, J. F. Greenblatt, F. J. Dilworth, and M. A. Rudnicki. 2008. Pax7 activ ates myogenic genes by recruitment of a histone methyltransferase complex. Nat. Cell. Biol. 10:77-84. Megeney, L. A., B. Kablar, K. Garrett, J. E. Anderson, and M. A. Rudnicki. 1996. MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes. Dev. 10:11731183. Menetrey J, C. Kasemkijwattana, C. C. Day, P. Bosch, M. Vogt, F. H. Fu, M. S. Moreland, and J. Huard. 2000. Growth factors improve muscle healing in vivo. J. Bone. Joint. Surg. Br. 82:131-137. Montarras, D., J. Morgan, C. Collins, F. Rela ix, S. Zaffran, A. Cumano, T. Partridge, and M. Buckingham. 2005. Direct isolation of satellite cells for skeletal muscle regeneration. Science. 309:2064-2067. Morgan, J. E., and T. A. Partridge. 2003. Cells in focus. Muscle satellite cells. Int. J. Biochem. Cell. Biol. 35:1151.

PAGE 88

88 Moss FP and C. P. Leblond. 1971. Satellite cells as the source of nuclei in muscles of growing rats. Anat. Rec. 170:421-435. Murphree, A. L., and W. F. Benedict. 1984. Retinoblastoma: clues to human oncogenesis in Science. 223:1028-1033. Naya, F. J., and E. Olson. 1999. MEF2: a tran scriptional target for signaling pathways controlling skeletal muscle growth and differentiation. Curr. Opin. Cell. Biol. 11:683638. Nevins, J. R. 1992. E2F: a link between the Rb tu mor suppressor protein a nd viral oncoproteins. Science. 258:424-429. Nguyen, D.X., L. A. Baglia, S. M. Huang, C. M. Baker, and D. J. McCance. 2004. Acetylation regulates the differentiation-sp ecific functions of the reti noblastoma protein. EMBO. J. 23:1609-1618. Novitch, B. G., G. J. Mulligan, T. Jacks, and A. B. Lassar. 1996. Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle. J. Cell. Biol. 135:441-456. Olguin, H. C., and B. B. Olwin. 2004. Pax-7 up-re gulation inhibits myoge nesis and cell cycle progression in satellite cells: a potential m echanism for self-renewal. Dev. Biol. 275:375388. Orimo, S., E. Hiyamuta, K. Arahata, and H. S ugita. 1991. Analysis of inflammatory cells and complement C3 in bupivacaine-induced myonecrosis. Muscle. Nerve. 14:515-520. Oustanina, S., G. Hause, and T. Braun. 2004. Pax7 directs postnatal renewal and propagation of myogenic satellite cells but not their specificati on. EMBO. J. 23:3430-3439. Papadimou, E., C. Menard, C. Grey, and M. Pu ceat. 2005. Interplay between the retinoblastoma protein and LEK1 specifies stem cells to ward the cardiac lineage. EMBO. J. 24:17501761. Pelpel, K., M. Leibovitch, A. Fernandez, a nd S. A. Leibovitch. 2000. Mutation of MyoD-Ser237 abolishes its up-regulation by c-Mos. FEBS. Lett. 474:233-237. Penn, B. H., D. A. Bergstrom, F. J. Dilwort h, E. Bengal, and S. J. Tapscott. 2004. A MyoDgenerated feed-forward circu it temporally patterns gene expression during skeletal muscle differentiation. Genes. Dev. 18: 2348-2353. Plant, D. R., F. E. Fiona, Colarossi, and G. S. Lynch. 2006. Notexin causes greater myotoxic damage and slower functional repair in mouse skeletal muscles than bupivacaine. Muscle Nerve. 34:577-585.

PAGE 89

89 Pooley, R. D., S. Reddy, V. Soukoulis, J. T. Roland, J. R. Goldenring, and D. M. Bader. 2006. CytLEK1 is a regulator of plasma membrane recycling through its interaction with SNAP-25. Mol. Biol. Cell. 17:3176-3186. Puri, P. L., and V. Sartorelli. 2000. Regulation of muscle regulatory factors by DNA-binding, interacting proteins, and posttranscriptional modifications. J. Cell. Physiol. 185:155-173. Ouellette, S. E. 2007. Unique lo calization patterns for E2F5 and LEK1 in skeletal muscle. M.S. Thesis, Univ. Florida, Gainesville. Rattner, J. B., A. Rao, M. J. Fr itzler, D. W. Valencia, and T. J. Yen. 1993. CENP-F is a .ca 400 kDa kinetochore protein that exhibits a cell-cycle dependent localization. Cell. Motil. Cytoskeleton.;26:214-226. Rawls, A., M. R. Valdez, W. Zhang, J. Richardson, W. H. Klein, and E. N. Olson. 1998. Overlapping functions of the myogenic bH LH genes MRF4 and MyoD revealed in double mutant mice. Development. 125:2349-2358. Rayment, I., H. M. Holden, M. Whittaker, C. B. Yohn, M. Lorenz, K. C. Holmes, and R. A. Milligan. 1993. Structure of the actin-myosin complex and its implications for muscle contraction. Science. 261:58-65. Redkar, A., J. K. deRiel, Y. S. Xu, M. M ontgomery, V. Patwardha n, and J. Litvin. 2002. Characterization of cardiac muscle factor 1 sequence motifs: retinoblastoma protein binding and nuclear loca lization. Gene. 282:53-64. Reed, S. A. 2006. Identification of differentially expressed proteins as a result of raf kinase activity. M.S. Thesis, Univ. Florida, Gainesville. Reed, S. A., S. E. Ouellette, X. Liu, R. E. Allen, and S. E. Johnson. 2007. E2F5 and LEK1 translocation to the nucleus is an early ev ent demarcating myoblast quiescence. J. Cell. Biochem. 101:1394-1408. Reed, R. L., L. Pearlmutter, K. Yochum, K. E. Meredith, and A. D. Mooradian. 1991. The relationship between muscle mass and muscle st rength in the elderly. J. Am. Geriatr. Soc. 39:555-561. Relaix, F., D. Rocancourt, A. Mansouri, and M. Buckingham. 2004. Divergent functions of murine Pax3 and Pax7 in limb muscle development. Genes. Dev. 18:1088-1105. Ros, E., J. J. Ma, and A. Gonzlez. 1991. The mechanical hypothesis of excitation-contraction (EC) coupling in skeletal muscle. J. Muscle. Res. Cell. Motil. 12:127-135. Rosenblatt, J. D. 1992. A time course study of the is ometric contractile properties of rat extensor digitorum longus muscle injected with bupivacaine. Comp. Biochem. Physiol. Comp. Physiol. 101:361-367.

PAGE 90

90 Rudnicki, M. A., P. N. Schnegelsberg, R. H. Stead, T. Braun, H. H. Arnold, and R. Jaenisch. 1993. MyoD or Myf-5 is required for the fo rmation of skeletal muscle. Cell. 75:13511359. Rudnicki, M. A., T. Braun, S. Hinuma, and R. Jaenisch. 1992. Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH ge ne Myf-5 and results in apparently normal muscle development. Cell. 71:383-390. Sachidanandan, C., R. Sambasivan, and J. Dhawan, 2002. Tristetraprolin and LPS-inducible CXC chemokine are rapidly induced in presumptiv e satellite cells in response to skeletal muscle injury. J. Cell. Sci. 115:2701-2712. Schiaffino, S., and C. Reggiani. 1994. Myosin isof orms in mammalian skeletal muscle. J. Appl. Physiol. 77:493-501. Schiebl H., J. L. Ferretti, G. Tysarczyk-Niem eyer, and J. Willnecker. 1996. Pediatric Osteology. New Developments in Diagnostics and Ther apy Schonau 1st ed. Elsevier, Amsterdam. Schneider, J. W., W. Gu, L. Zhu, V. Mahdavi, an d B. Nadal-Ginard. 1994. Reversal of terminal differentiation mediated by p107 in Rb-/ muscle cells. Science. 264:1467-1471. Schmalbruch, H., and U. Hellhammer. 1977. The num ber of nuclei in adu lt rat muscles with special reference to satellite cells. Anat Rec. 189:169-175. Schultz, E. 1976. Fine structure of satellite cells in growing skeletal muscle. Am. J. Anat. 147:49-70. Seale, P., J. Ishibashi, A. Scim, and M. A. Rudnicki. 2004. Pax7 is necessary and sufficient for the myogenic specification of CD45+:Sca1+ stem cells from injured muscle. PLoS. Biol. 2:E130. Seale, P., L. A. Sabourin, A. Girgis-Gabardo, A. Mansouri, P. Gruss, and M. A. Rudnicki. 2000. Pax7 is required for the specification of myogenic satellite cells. Cell. 102:777-786. Selsby, .J. T., S. Rother, S. Tsuda, O. Pracash, J. Quindry, and S. L. Dodd. 2007. Intermittent hyperthermia enhances skeletal muscle regrowth and attenuates oxidative damage following reloading. J. Appl. Physiol. 102:1702-1707. Sherr, C. J. 1996. Cancer. Cell. Cycles. Science. 274:1672-1677. Shinin, V., B. Gayraud-Morel, D. Goms, and S. Tajbakhsh, 2006. Asymmetric division and cosegregation of template DNA strands in adul t muscle satellite cells. Nat. Cell. Biol. 8:677-687. Shirakata, M., F. K. Friedman, Q. Wei, and B. M. Paterson. 1993. Dime rization specificity of myogenic helix-loop-helix DNA-binding fact ors directed by nonconserved hydrophilic residues. Genes. Dev. 7:2456-2470.

PAGE 91

91 Snow, M. H. 1977. The effects of aging on satellite cells in skeletal muscles of mice and rats. Cell. Tissue. Res. 185:399-408. Sllner, T., S. W. Whiteheart, M. Brunner, H. Erdjument-Bromage, S. Geromanos, P. Tempst, and J. E. Rothman. 1993. SNAP receptors im plicated in vesicle targeting and fusion. Nature. 362:318-324. Soukoulis, V., S. Reddy, R. D. Pooley, Y. Feng, C. A. Walsh, and D. M. Bader. 2005. Cytoplasmic LEK1 is a regulator of microtubul e function through its interaction with the LIS1 pathway. Proc. Natl. Acad. Sci. USA. 102:8549-8554. Tapscott, S. J., R. L. Davis, M. J. Thayer, P. F. Cheng, H. Weintraub, and A. B. Lassar. 1988. MyoD1: a nuclear phosphoprotein requiri ng a Myc homology region to convert fibroblasts to myoblasts Science. 242:405-411. Tidball, J. G., E. Berchenko, and J. Frenette. 19 99. Macrophage invasion doe s not contribute to muscle membrane injury during infl ammation. J. Leukocyt e. Biol. 65:492-498. Trimachi, J. M., and J. A., Lees. Sibling riva lry in the E2F family. 2002. Nat. Rev. Mol. Cell. Biol. 3:11-20. Valdez, M. R., J. A. Richardson, W. H. Klein, and E. N. Olson. 2000. Failure of Myf5 to support myogenic differentiation without myogeni n, MyoD, and MRF4. Dev. Biol. 219:287-298. Vergnolle, M. A., and S. S. Taylor. 2007. Cenp-F links kinetochores to Ndel1/Nde1/Lis1/dynein microtubule motor complexes. Curr. Biol. 17:1173-1179. Watkins, S. C., and M. J. Cullen. 1988. A quant itative study of myonuclear and satellite cell nuclear size in Duchenne's muscular dys trophy, polymyositis and normal human skeletal muscle. Anat. Rec. 222:6-11. Weinberg, R. A. 1992. The retinoblastoma gene and gene product. Cancer. Surv. 12:43-57. Wozniak, A. C., and J. E. Anderson. 2007. Nitric oxide-dependence of satellite stem cell activation and quiescence on nor mal skeletal muscle fi bers. Dev. Dyn. 236:240-250. Zammit, P. S., J. P. Golding, Y. Nagata, V. Hudon, T. A. Partridge, and R. Beauchamp. 2004. Muscle satellite cells adopt divergent fates: a mechanism for self-renewal? J. Cell. Biol. 166:347-357. Zacksenhaus, E., Z. Jiang, D. Chung, J. D. Marth, R. A. Phillips, and B. L. Gallie. 1996. pRb controls proliferation, differe ntiation, and death of skeletal muscle cells and other lineages during embryogenesis. Genes. Dev. 10: 3051-3064. Zammit, P. S., L. Heslop, V. Hudon, J. D. Rosenbl att, S. Tajbakhsh, M. E. Buckingham, J. R. Beauchamp, and T. A. Partridge. 2002. Kine tics of myoblast prolif eration show that resident satellite cells are comp etent to fully regenerate skeletal muscle fibers. Exp. Cell. Res. 281:39-49.

PAGE 92

92 Zammit, P. S., F. Relaix, Y. Nagata, A. P. Ruiz, C. A. Collins, T. A. Partridge, and J. R. Beauchamp. 2006. Pax7 and myogenic progression in skeletal muscle satellite cells. J. Cell. Sci. 119:1824-1832. Zhu, X., K. H. Chang, D. He, M. A. Mancini, W. R. Brinkley, and W. H. Lee. 1995. The C terminus of mitosin is essential for its nuclear localization, centromere/kinetochore targeting, and dimerization. J. Biol. Chem. 270:19545-19550. Zierath, J. R., and J. A. Hawley. 2004. Skeletal muscle fiber type: infl uence on contractile and metabolic properties. PLoS. Biol. 2:e348.

PAGE 93

93 BIOGRAPHICAL SKETCH Shigeharu T suda was born in Osaka, Japan, in 1968. Since he met his uncle Yoshinori Ikeda at the age of 10, he has been thinking about the value/meaning of exis tence of the universe. The concept of universe later en compassed known/unknown physical/nonphysical entities/phenomena, such as galaxy or mind, in h im. As one of the entities on the earth, Shige believed that human lives have priceless value and began to care about the world peace and human happiness, especially after he graduated from Te nri University in 1991. Shige encountered excess greed of human for money in the investment bank, Sanyo Securities Inc. and then learned the beauty of human happiness in the United Sports Club XAX in Japan. The latter experience made him decide to study medicine in the U.S., to contribute to human happiness. Indiana University taught him the ideality in the American academia. University of Florida taught him the reality as well as the ideality as a scientist. Now, Shige is convinced that he can realize the purpose of his life contribution to human happiness via medicine only when both the reality and ideality are synchronized. However, th e ideality is always superior to the reality in him as a human as well as a scientist. Shige obtai ned M.S. in Kinesiology at Indiana University in December, 2003 and is finishing another M.S. in Animal Science at University of Florida in August, 2008.