<%BANNER%>

Mechanisms by which Overexposure to Cortisol Causes Fetal Heart Enlargement in Late Gestation

Permanent Link: http://ufdc.ufl.edu/UFE0022551/00001

Material Information

Title: Mechanisms by which Overexposure to Cortisol Causes Fetal Heart Enlargement in Late Gestation
Physical Description: 1 online resource (149 p.)
Language: english
Creator: Reini, Seth
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: cortisol, fetal, glucocorticoid, heart, mineralocorticoid
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Elevated cortisol levels during late gestation can lead to fetal heart enlargement. However, the mechanism by which cortisol increases fetal heart size has not been fully identified. These experiments were designed to 1) investigate left ventricle (LV) expression of genes potentially responsible for increasing heart size, 2) determine the ontogenetic expression of those genes in the LV and right ventricle (RV), 3) elucidate whether the mineralocorticoid receptor (MR) or glucocorticoid receptor (GR) mediate the cortisol-induced cardiac enlargement, and determine if cardiac fibrosis accompanies the enlargement, and 4) investigate the role of cell proliferation in causing the cardiac enlargement. I found that mRNA expression of 11?-hydroxysteroid dehydrogenase 2 (11?HSD2), the insulin-like growth factor receptor type 1 (IGF1R), and the angiotensin type 1 receptor (AT1R) to angiotensin type 2 receptor (AT2R) mRNA ratio decreased in response to elevated cortisol in the LV. The decrease in IGF1R mRNA expression and the AT1R to AT2R ratio may have been an attempt by the heart to limit growth whereas the decrease in 11?HSD2 expression indicates cortisol is able to increase its action at MR and GR. Ontogeny analysis revealed that MR and GR mRNA expression are high at all points and 11?-hydroxysteroid dehydrogenase 1 mRNA expression is significantly higher than 11?HSD2 at all times, implying cortisol action at MR and GR is important for heart growth throughout late gestation. I also found that angiotensin converting enzyme 1 mRNA dramatically increases in both ventricles in late gestation implicating angiotensin II production is important in maturing the heart for life after birth. This study also showed that a reduction in mRNA of growth promoting IGF family members towards term within both ventricles may contribute to the decrease in myocyte proliferation that occurs during the last third of gestation. In vivo experiments demonstrated that cardiac specific blockade of MR negated cortisol-induced heart enlargement and that GR blockade lessened it, suggesting corticosteroid receptors mediate the enlargement. Picrosirius red staining of the hearts revealed that fetal heart enlargement in response to elevated cortisol is not accompanied by an increase in cardiac collagen deposition, but KI67 staining of the hearts revealed that enlargement may be due to an increase in myocyte proliferation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Seth Reini.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Keller-Wood, Maureen.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022551:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022551/00001

Material Information

Title: Mechanisms by which Overexposure to Cortisol Causes Fetal Heart Enlargement in Late Gestation
Physical Description: 1 online resource (149 p.)
Language: english
Creator: Reini, Seth
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: cortisol, fetal, glucocorticoid, heart, mineralocorticoid
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Elevated cortisol levels during late gestation can lead to fetal heart enlargement. However, the mechanism by which cortisol increases fetal heart size has not been fully identified. These experiments were designed to 1) investigate left ventricle (LV) expression of genes potentially responsible for increasing heart size, 2) determine the ontogenetic expression of those genes in the LV and right ventricle (RV), 3) elucidate whether the mineralocorticoid receptor (MR) or glucocorticoid receptor (GR) mediate the cortisol-induced cardiac enlargement, and determine if cardiac fibrosis accompanies the enlargement, and 4) investigate the role of cell proliferation in causing the cardiac enlargement. I found that mRNA expression of 11?-hydroxysteroid dehydrogenase 2 (11?HSD2), the insulin-like growth factor receptor type 1 (IGF1R), and the angiotensin type 1 receptor (AT1R) to angiotensin type 2 receptor (AT2R) mRNA ratio decreased in response to elevated cortisol in the LV. The decrease in IGF1R mRNA expression and the AT1R to AT2R ratio may have been an attempt by the heart to limit growth whereas the decrease in 11?HSD2 expression indicates cortisol is able to increase its action at MR and GR. Ontogeny analysis revealed that MR and GR mRNA expression are high at all points and 11?-hydroxysteroid dehydrogenase 1 mRNA expression is significantly higher than 11?HSD2 at all times, implying cortisol action at MR and GR is important for heart growth throughout late gestation. I also found that angiotensin converting enzyme 1 mRNA dramatically increases in both ventricles in late gestation implicating angiotensin II production is important in maturing the heart for life after birth. This study also showed that a reduction in mRNA of growth promoting IGF family members towards term within both ventricles may contribute to the decrease in myocyte proliferation that occurs during the last third of gestation. In vivo experiments demonstrated that cardiac specific blockade of MR negated cortisol-induced heart enlargement and that GR blockade lessened it, suggesting corticosteroid receptors mediate the enlargement. Picrosirius red staining of the hearts revealed that fetal heart enlargement in response to elevated cortisol is not accompanied by an increase in cardiac collagen deposition, but KI67 staining of the hearts revealed that enlargement may be due to an increase in myocyte proliferation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Seth Reini.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Keller-Wood, Maureen.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022551:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101107_AAAACA INGEST_TIME 2010-11-07T19:33:20Z PACKAGE UFE0022551_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 38116 DFID F20101107_AABJKF ORIGIN DEPOSITOR PATH reini_s_Page_062.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
3f2756bb97a0da9d6107f3801dd78ade
SHA-1
52999a52bb43900fbc93481114b611f40571dbf9
22857 F20101107_AABKNH reini_s_Page_059.jpg
aaa3f6cf437a65c3c483fd0e57034725
30145c94982c29457087bed148d67175bfd4c1d6
108836 F20101107_AABKMS reini_s_Page_023.jpg
3f96417f82b6f80abf69e92ff0b5a2c9
953ab54c927cd8fbbc63aa9a8fbeb6ab7184dece
54461 F20101107_AABJKG reini_s_Page_069.pro
db2e3cb8ce4c4b7468149f32f5a0c92b
37ddeabb3498127bcd0b33dfafe92466cba26ef8
107750 F20101107_AABKNI reini_s_Page_061.jpg
c232835ed45c89f079c86ee44a7f215b
e86271045b0d8e0922e0261368a57a57ededa716
15736 F20101107_AABKMT reini_s_Page_030.jpg
2eba7d644b00c8c99bd6b0eb4c5b0414
215e8d8cfafcbd8f238d87cada61cfcf9686f465
9150 F20101107_AABJKH reini_s_Page_122thm.jpg
b062c951cdede69d729f034a58fdef55
370a84034b5975d2df1aeb1861a3efa55da4a83f
112097 F20101107_AABKNJ reini_s_Page_068.jpg
7e96717acae2e2acd0429a36e4ccbea9
0801d26d22b6f308f0fcdb392d5e818e04fc4757
114682 F20101107_AABKMU reini_s_Page_034.jpg
a512363ea1b2fd7ecd0eeaa9f883883a
ad08b24bc0ac88c5cf3370bf07cce27e16fe3e32
110882 F20101107_AABJKI reini_s_Page_078.jpg
42591d6d60e6fc0a066ef48ec7fb9346
cc7c8786525e540b6c204cff0171af53258a9da4
115281 F20101107_AABKNK reini_s_Page_070.jpg
7a8a65a70ed2721fb2311a38065c8d5e
7aea08dc3a062f532a84c847bb67ed5ebb9f0912
113857 F20101107_AABKMV reini_s_Page_035.jpg
d175738c8fab907a0689e57f74ecf779
294592f01b90b9090c31368aac4b010692ece70b
10267 F20101107_AABJKJ reini_s_Page_058.QC.jpg
e9aa12d399d1f943c514afed82447192
3fb4b2456271dcad33567cfeae2645642fc60bbf
72486 F20101107_AABKNL reini_s_Page_071.jpg
d803b5b59f8635500beb9dd1840f838f
b2af64f9dfd339b8c637a0955840e2c0ae1a3533
115537 F20101107_AABKMW reini_s_Page_036.jpg
bf4f0fa034c52d093dd140310418523a
9f8de2c8417ea796d3ed63fbb84322d07504af23
36465 F20101107_AABJKK reini_s_Page_141.QC.jpg
49198a13140375c57448b84e62ca57cb
8867ad5f8ff0bb84566846a86d30ec40832fb4b8
54782 F20101107_AABKNM reini_s_Page_073.jpg
547bf9ebc67774630bcf7e0a1fe967ed
1cb689f0db3745187c019a6c96be0c402cc1a968
106075 F20101107_AABKMX reini_s_Page_042.jpg
87fa108caf6eec5fcb2122ab88ee912e
476be9bce996d572b97a211ad16353f0dd59a6c2
109913 F20101107_AABKOA reini_s_Page_128.jpg
bd636dffd9d06f602e5de1745059b3c1
9fa6697e441d4105cd2f56057496b1a622c78658
25271604 F20101107_AABJKL reini_s_Page_082.tif
8541bb5809e22767dc9df486ed23b3ee
a1e1ebde4dc0e31ccc3a8d2e6c184206594142d6
108901 F20101107_AABKNN reini_s_Page_076.jpg
93419182f7598f9aa72239891c9604cb
83c14b43f7e48dc156913581c62f147dcef9b9b2
109092 F20101107_AABKMY reini_s_Page_045.jpg
203b7da76fc9791beceb606d1db5cb84
65f4808cb1895321b86c9ae3143d9727722fc8f9
136975 F20101107_AABKOB reini_s_Page_131.jpg
0834e4fd005b737cb52ebdf7751b2692
c17c3865257db754d1a5481dea99342c29849fce
36350 F20101107_AABJKM reini_s_Page_112.QC.jpg
24534e4bf3d779525b1738fc73238dd7
d14e09329371cf966eee1f116190215e841f8fe3
111936 F20101107_AABKNO reini_s_Page_077.jpg
44cbb80ad4dd0b23dbe2a6419dfc5089
4065f56d987f87796320e2fce978c215427fde2e
110831 F20101107_AABKMZ reini_s_Page_046.jpg
b4e69ab7bc56a6ccf0c9cc21b7b0c339
fe19ce512c75d53198894267b64bcbdfc197e285
2132 F20101107_AABJLA reini_s_Page_069.txt
bbc03de3df5caebdf0116a25ca55eec5
59bbf9c564461feb6d4e653b762d72ee29019c33
137136 F20101107_AABKOC reini_s_Page_135.jpg
88c6c5c12c5c672e6be9cedd68fb93dd
16ea743f396a387e4f482048a729070be06b1886
F20101107_AABJLB reini_s_Page_020.tif
f0ace11b292f689fb5a5389cdab10c0c
3e6b25e04b8504e581a69013ac76fffa4cf5c951
124314 F20101107_AABKOD reini_s_Page_145.jpg
e376807547bc8119e6fbedd1876087a3
51af6c2a6866806800f63fa4d1508274b417d50c
5303 F20101107_AABJKN reini_s_Page_074thm.jpg
d4d908649ed6971eeee1c5ffe12b4b02
a12c916bd32ad3d86d996f3314c5ad91d4499f3a
111454 F20101107_AABKNP reini_s_Page_086.jpg
7791b080df63e2ab6b9cb5ef2b639929
ee9a918d2aa462879a5c059e8d974a13714fea23
1051734 F20101107_AABJJZ reini_s_Page_092.jp2
1f3bd5ecb1d70ead366be8d2a9e6c58a
8a07c7f5453fd85266ef9405c2d6e60cb228a1a8
2713 F20101107_AABJLC reini_s_Page_146.txt
7f19146d17df79cab280bad02c11a216
13efc30d85c3bf6872998ea50bf8e054d9b64dba
133511 F20101107_AABKOE reini_s_Page_147.jpg
5b450adadbf4478d81c62cb04864dc26
2c77070b6022d909e25d08a4900b3fcf4f9bf21e
27748 F20101107_AABKOF reini_s_Page_002.jp2
0e8cfaa8aafac17ab556b1f86fb3e508
b6c443add5588e47ee734d42a3855b2eec42ad0f
250 F20101107_AABJKO reini_s_Page_003.txt
275a2f31e0b0fe046f496b68918a056e
67e6552dc6e429f2757bc3c075789cc31516a3c4
109519 F20101107_AABKNQ reini_s_Page_089.jpg
4f230606cf5cb4f384979bcf842d65c0
cd83a258047121254733bacda42a635d717dd49c
2202 F20101107_AABJLD reini_s_Page_066.txt
f05e79f89e2f6d8e4ac66decf4f999bb
670bd4f3375726c990ddce9159e36d6a8ee44538
1051985 F20101107_AABKOG reini_s_Page_007.jp2
65757c05c763c0d68eebd0b32b154c77
8e5f1360a862217c5cea4b8949ba8d29d2f7ef92
54634 F20101107_AABJKP reini_s_Page_060.pro
bab6c6d747b95a027e9b269d02dcb727
a08741ca7906d75ab1c06c91e3a4cfa007d97bd7
110909 F20101107_AABKNR reini_s_Page_090.jpg
f1a24df0f0018bfe576b51441223c8ad
cf27c18c7f9d6918aa43bee77f3fe9a599d4137f
126842 F20101107_AABJLE reini_s_Page_141.jpg
eb0de8ab217534f9c9678de76856b577
d4a841bfdf88e5ccdb655fd992af62a89930068d
1051968 F20101107_AABKOH reini_s_Page_008.jp2
1f3e9ff0b4bc882e1ce739fcd44c301b
aa365cd3a49465787ca6f8772916fbe69b6a66be
53989 F20101107_AABJKQ reini_s_Page_023.pro
7fad60c79ee6f3e62759413c68e63da4
24b304e77f2d8eed4faffbbed6fa3542b7fc978e
81676 F20101107_AABKNS reini_s_Page_092.jpg
d6e64217a0daf668d7529111fbab746d
d2daba8e67192c7053ab073f9f6d9549eba9966a
8536 F20101107_AABJLF reini_s_Page_047thm.jpg
5cc83ba016e87c71ab4bbf44d9b0a868
c2240006b8a0edd325628153d90f20ba21126b60
1051920 F20101107_AABKOI reini_s_Page_020.jp2
150070032da3e751b27422f0ca5794be
62638aa4e493627f6cbac2693688a484eabc9224
1978 F20101107_AABJKR reini_s_Page_101.txt
8d854f6c8fc565311ae6ad961e16f6cb
2723f43a47b8fd71da90c333b2f8a0d418bb0fbe
47939 F20101107_AABKNT reini_s_Page_094.jpg
9556af7f3a35a4d6048f3f0639a5c60e
34a16d30648869ed4aa132a630931b0a3b1d531d
157330 F20101107_AABJLG reini_s_Page_006.jpg
a9c05b25fdd85c2d9d90c404d59bfea5
733c2a01ac8eea7b07c3f2c84fe62850ed647360
1051956 F20101107_AABKOJ reini_s_Page_027.jp2
599e7aa0a0d0fe1fafb085d4a4727e57
28c7bc539ac9a4b91424d9f944d17593d7aa976a
8180 F20101107_AABJKS reini_s_Page_085thm.jpg
b49888ef031ad3045a55881054afe0cd
80bafd53f720eb7bfd200b36fbeb10e09aad8633
111197 F20101107_AABKNU reini_s_Page_102.jpg
cbab2e4664f77b40fa80facdcf7c2a62
fb4e129fddd12907c3ee1a5c6da60a1b56ccd79e
67910 F20101107_AABJLH reini_s_Page_008.jpg
94aafeb6c9ad39c1c1b20ba69a6a2204
5e5f57983b3732cec965f939975499a936891435
1051969 F20101107_AABKOK reini_s_Page_028.jp2
5e62226f9dbb0980ffb02eb22d27334c
1dce87539ae99eeeb7068f72e30bc619023220b3
8140 F20101107_AABJKT reini_s_Page_098.QC.jpg
c3a3ed03df2df61c314c62dd4e499dfa
8621e650403456b5a268b9babea8450e3d5d85b0
101965 F20101107_AABKNV reini_s_Page_104.jpg
ce5d7ad14daf71abbba549a3b930d6ce
e38398bcff37030e4d68fefeca25a5a14889873f
1051959 F20101107_AABJLI reini_s_Page_012.jp2
99b986faff1a9742129b22c6e223d3d7
ff77d6eb07a28894b9009210917c9fbeb080290d
187270 F20101107_AABKOL reini_s_Page_031.jp2
e6133922f4cc6f8b93323695b3e33b5a
5e7f9d227d92de37ab7d7834ac8c32e7292c1303
4064 F20101107_AABJKU reini_s_Page_002.jpg
46ae3c6093667f75c36b8d3ee76925e6
d0116a25381952dab771ddd983b5d383d5c97536
12015 F20101107_AABKNW reini_s_Page_113.jpg
b9bbedc41235f8c5dbb964caa122ba92
163f75c6bcee0b22700070be58f84a1461a95519
2630 F20101107_AABJLJ reini_s_Page_134.txt
1488f496500e1280594b4d5bda886a7c
537cf7b06113946a43c03a3f89d885f29a75ada2
1051983 F20101107_AABKPA reini_s_Page_078.jp2
2c10f46929888a054b3a5f682e29b7e4
050fc3c71453498d1ecf66334228987e722eee14
1051951 F20101107_AABKOM reini_s_Page_034.jp2
94d2615e115001f96a702a39fcb2e77e
6c9b9ca578973f5317c389f21a311f0927881d53
9045 F20101107_AABJKV reini_s_Page_014thm.jpg
555bfe2fecf7149e05baea3ee315c8d2
4a3498a6444972da23e2a71099b23e1abb2a9bf5
23126 F20101107_AABKNX reini_s_Page_119.jpg
877dfc0547c67317fe8ecb1b12f83b76
832a9322fa676e972ad73a55483dc82e0361d5aa
111075 F20101107_AABJLK reini_s_Page_120.jpg
2918d9cc64786644c9c758a09f12b68f
4432019b33baad41b6cf13b375fab741165a3bd7
1051974 F20101107_AABKPB reini_s_Page_080.jp2
aba3dbc75fa42407b4a789abeda97034
399b4286479866f68da979fe47711e52d78eb74c
F20101107_AABKON reini_s_Page_037.jp2
b112b07cedc9342c1cf4a229f1b62f9f
03e82b20260850d5878396367693ca66fdff406f
9010 F20101107_AABJKW reini_s_Page_069thm.jpg
a1106c023a990d57795c78a1f148daf7
6ee55f60094cdff4adc850373b3aceb423ed7358
113645 F20101107_AABKNY reini_s_Page_122.jpg
9e320db58e4ad3ecd81f3215d40b31bf
f42852afbb8a9278479e96139e46ac2d8a1338f9
53082 F20101107_AABJLL reini_s_Page_016.pro
873ac5a732bc2b19c5dcd490844c3a1f
d28ba5ff27ecf68aad3a52a43afc5336b6d1e8b6
F20101107_AABKPC reini_s_Page_082.jp2
ec7be97147c3e904f810d6575b6cf75a
1268b981d7dbc2b2ad6c423e91bbea74f7f2a49f
1051940 F20101107_AABKOO reini_s_Page_038.jp2
1e495c3d9377adff1bcd4882995ef215
ee2b112c6d26f3d860bc0ba90985e7420a975244
4877 F20101107_AABJKX reini_s_Page_003.pro
8f18a17361dc04a28ed4668ff39bf75b
e449bc21b77bb8a5bb373dc6f9e9b339afc0acd0
112378 F20101107_AABKNZ reini_s_Page_123.jpg
f3909f91ccb845e3b923e36361905a07
63dad256a82d9f4aa46ea7bec0ec54093c71e8b6
56213 F20101107_AABJMA reini_s_Page_021.pro
aeb9b9862f4b3448ebb1693590304215
e9e3e7f3e039d92b1348fd8ee9b2a9f5939ef4c9
F20101107_AABJLM reini_s_Page_147.jp2
4cf122ecc0a212fcae35260ef6c35671
db4aa1ccbcb985e27f1224588a9d55f117abb651
F20101107_AABKPD reini_s_Page_088.jp2
b697eff014dbea16f878f75dd2982dfa
2f2bf614ba9cd221568bb3bebf2c50b15540bb3c
1051934 F20101107_AABKOP reini_s_Page_042.jp2
72428eb651dcce7c5b078f55931a4dbf
1b1f07dd8497ae16e262c07f0019890425dc1031
2095 F20101107_AABJKY reini_s_Page_087.txt
ac58e9137777d03e4fa6d10feb8a2290
5054a05a9763b9628c2b727c0dce14914b52ccab
109116 F20101107_AABJMB reini_s_Page_067.jpg
2519d14587e5c81ead88203d3f92ab69
a5aece7726d62dc58d533457b9eb28dff3589e13
37522 F20101107_AABJLN reini_s_Page_146.QC.jpg
382f26ebea8258ae405fcd212ae82730
2eddc80471f9c6730106c501ac40d885c6add858
1051953 F20101107_AABKPE reini_s_Page_089.jp2
f3f85cf27b638fa976e04907d345273d
ba81b500affabf7b81456d24d0cce38bb090642c
21462 F20101107_AABJKZ reini_s_Page_031.jpg
aeb4f678a66f2dbf3384c4a99be4cfd3
e4cabf6f46060d5fc211649c39fb9f68bcbe6518
8364 F20101107_AABJMC reini_s_Page_012thm.jpg
33070602241c8e3105d3631f0cb9822f
f353ffef2860bf92e3b720ffa88fe16daed33cf6
612605 F20101107_AABKPF reini_s_Page_093.jp2
da58709a2e437a784002b1e9d8d204bf
f1c8cd15e9f298d230651bcb82db20e9928b5cae
1051965 F20101107_AABKOQ reini_s_Page_045.jp2
e012d792812fbbd407fb1ba384a78a25
9e9b3f720da11b827bd327e5b7686b3f9a0888c3
9261 F20101107_AABJMD reini_s_Page_068thm.jpg
5752fbfd2f35325a241c466a54fdee55
5f87d73e0c25837d12d50113a1decfac7bf16385
104446 F20101107_AABJLO reini_s_Page_012.jpg
0e63072bcdd58a400a5fdb91fc7f95e7
76f2d89d49cc732c3ea0f7666f3e7a3821cf2c90
274243 F20101107_AABKPG reini_s_Page_095.jp2
cd48eed7936ae929fefda7d12c4fced4
d3cf76cbaa90a3c5af0d95455bb30e29a7485efd
888301 F20101107_AABKOR reini_s_Page_050.jp2
005fe883f1b96d45cfbbe1896aade549
af84f125594cbaacf6325fb91b1ba5ed642a58ea
F20101107_AABJME reini_s_Page_136.tif
a250cf780b734f3bf564fbd962cec4f6
2e269ea5c497153e837e4340b3c64f81546688c6
12212 F20101107_AABJLP reini_s_Page_052.pro
0c07d592865b2010f930efb63b73b697
d918c5449eea54158284bc3d104dfdf89654ea55
251241 F20101107_AABKPH reini_s_Page_096.jp2
d09faa53cb7baf57869808f597cab4bf
88b3428a4e21471bb25e61a7af54f3b5902ca06e
363452 F20101107_AABKOS reini_s_Page_051.jp2
7ab37b0dbf4c4cf7755e3294a252fb92
dc7ef813677b2fe0c9080b12edeba99503c46eec
66143 F20101107_AABJMF reini_s_Page_138.pro
1c251a0594301d4825ccb559ef9abf5c
01661400389b763def9d52f737e02c117e607005
27101 F20101107_AABJLQ reini_s_Page_096.jpg
1e635250ee431fb7d8216032a77b0be5
7311d64ff606d36f69b062310a3dd2cb485a49c7
1051967 F20101107_AABKPI reini_s_Page_103.jp2
b74be73246d0682f7f91ebe536915724
5d16a2ee21bb2489e029b2a8c696e3c31ba9979b
387057 F20101107_AABKOT reini_s_Page_054.jp2
bf7d82185bc217768bd6c696309ce297
1bf21a2983fd6b221bb7c2d9d4c3340b880d6e9d
1051946 F20101107_AABJMG reini_s_Page_016.jp2
f43a83fa7d7446ff757bb9c5bdf8520d
0f2fc98eed5549f50fd4ff26041e70c7c4fa9565
F20101107_AABJLR reini_s_Page_084.tif
f12bbdba2e29c7165bc592ea89f51bc9
c898a16ee268dbc6223bce6e09f4b9d991c490f7
1051921 F20101107_AABKPJ reini_s_Page_107.jp2
f7038704632b77e961c18b7f91baef1b
723474b26c6f386e94195592027a502e233b004e
651030 F20101107_AABKOU reini_s_Page_055.jp2
daa8067333c843243304c04e285a3e6e
041c602bc2ff6262748a914461df797b04e5bb3e
2258 F20101107_AABJMH reini_s_Page_027.txt
00df5fa48facd349492081811921b918
3fa3ed5a9335be3c0be541282f5887edffd2e3db
F20101107_AABJLS reini_s_Page_141.tif
23c814d2a305c0846923a064afe87bd5
4fbfd6326196682fa2b973f4e10e9556023a068d
1051941 F20101107_AABKPK reini_s_Page_108.jp2
e34099db6608137e3f0b782de0cab8d9
fa0852b85f67b13c7858a40b10534c390e1cfbea
1051945 F20101107_AABKOV reini_s_Page_062.jp2
5e70f82f7a166b5c2ece39158b2b274e
1aefa3478bb227e41a768662bd3ff7d47477dfb7
1051947 F20101107_AABJMI reini_s_Page_101.jp2
461d8bc77188efa2bc9de9770abbb1d4
ea129f9fbd75f94d8846edf6eaf30acaf6425452
321 F20101107_AABJLT reini_s_Page_029.txt
da8e0d0ca8aa4fe4d88c4bf815ef6f5f
be822f455e56abfcd680f35bf53b0d7940e5593e
1051986 F20101107_AABKPL reini_s_Page_111.jp2
22980d3683be1440e626759e23b32441
0b75d97e266968001de9acfd868f73b0752c0f23
1051981 F20101107_AABKOW reini_s_Page_064.jp2
2073ff474d2d2969010f0953f7ad1c09
4b9a9697fd85c6ecd361bc9eedbbaa8eed09d908
F20101107_AABJMJ reini_s_Page_121.tif
0842c9de934053ce6e744937b9b91ebc
ef913857fce243c438dd3384ff2c8baf72a6e77c
F20101107_AABJLU reini_s_Page_110.jp2
12ba478adcacf3711ff66ce3957dec80
4ecf4a5cd27277d32642473f487f6f1411b0b82d
1051949 F20101107_AABKQA reini_s_Page_139.jp2
82d21121961f5d43cc602fa407bd5153
e5fb1adc268e88cdb20a2f542184975cfe27a771
103023 F20101107_AABKPM reini_s_Page_113.jp2
aae329a3c89132a825a663784fe043b4
65a82c0bf8e4b785aa1834ed53e1dd4d26163563
1051962 F20101107_AABKOX reini_s_Page_067.jp2
e24917a1fd43876c3d021ed7ca7cb6c3
9eb99bec6b53e6da10af206a919d202fdd2b23bd
F20101107_AABJMK reini_s_Page_145.jp2
8bfc4f907b4dd97e4e2748dba4601ac1
22fa4334a18c419735427e900d8b1c66312bc93f
111889 F20101107_AABJLV reini_s_Page_062.jpg
fd2971503f29b553e904f3c8471231fe
1f3f1798bf075da64986a78ca91c53f36bf2082f
1051943 F20101107_AABKQB reini_s_Page_144.jp2
12d0efd211092ed232757965fe45c5ed
45287e5cc85472b795a7f070da836f7e1d6b4534
547737 F20101107_AABKPN reini_s_Page_115.jp2
8419ae28d2bfb42142922a4a2dfacd0f
074cd530bd488ad497d90a88941b2a93c06e32ab
1051898 F20101107_AABKOY reini_s_Page_068.jp2
c871461ce6f4bf08e42d55334206f6fd
cf3b83d0e08de3b8a9c97a80628040fac114a71d
723 F20101107_AABJML reini_s_Page_054.txt
905f2637803d08f416d646c610f89e1a
2583d2a13f5efb3621cf8ddcdb8c915caec4c5fa
36824 F20101107_AABJLW reini_s_Page_108.QC.jpg
9ad18efc01329afd77b2ae979ee8016b
eab438b2e7ffdc2d5004174d2d76250736229263
1051933 F20101107_AABKQC reini_s_Page_146.jp2
27d24aea0bc7ad2089a37e70858fafaa
64843e8ab8fd08d0898f4eaedb30bf649fb96015
403168 F20101107_AABKPO reini_s_Page_117.jp2
d4341bfb711d974c043914023eb837a7
f427c41982a6940901e9c7141ea005024bf75691
1051942 F20101107_AABKOZ reini_s_Page_069.jp2
53e37ebe1258911be22342cc6d8b14c9
fcfee382625daebff61cf7f9d2332d1885ab2f7c
19075 F20101107_AABJNA reini_s_Page_008.QC.jpg
adb8074ccf34fbfc9c490caec9c8da97
660002955e88f73a9be66dc06ed646fcc336da47
F20101107_AABJMM reini_s_Page_049.jp2
4059d24d13b963230a7e6c86e3581dde
026b53d8594c30b83012bff9b44474bb9640a381
112656 F20101107_AABJLX reini_s_Page_003.jp2
30b2eb584ed802c931b60c8798b2efd9
cb38ee919f64c8c9e939b7090b33a9621767df53
F20101107_AABKQD reini_s_Page_001.tif
40e387f2c60dd8a4637a2105ede7247c
1715effd84b0a0c795947081f4421217694a7cdd
461950 F20101107_AABKPP reini_s_Page_118.jp2
8cbbdbd44491615ad898f6fb43b2c8db
904f8167b17f39116313cf0738dc6b6b5b6d74de
1196 F20101107_AABJNB reini_s_Page_002.QC.jpg
ab2811f5d9efd07e5295f54bc9c8cbe4
617f69edfcfe7f91b32813172ee01340b03ae6d6
1004 F20101107_AABJMN reini_s_Page_073.txt
f9e3a5d1500da0e86e9c7f970aaeeffd
a1c3f542c5190943ffeb2d7cc05a79dca607d28a
1864 F20101107_AABJLY reini_s_Page_010.txt
28ffb2ecaa1bab2d6edf14c8a1ead6d0
1edf3b0df7c5d90ebd95491775bcab046cd30862
F20101107_AABKQE reini_s_Page_003.tif
ba18b8ebf7227a4c5525bab1ff259fc7
e60cef042627c03d22c7b31d10ef9c36a24af8d2
1051976 F20101107_AABKPQ reini_s_Page_120.jp2
463bbe9fc5721d34e991b8ed8faf443d
f9cf50b0d5d99c7a7e11d0320a818d839e84bfb9
116481 F20101107_AABJNC reini_s_Page_014.jpg
6d464904b120af773b377a9a6e544b97
e0f4f7c9e9acbe08b37d549729429ab9521f8176
47329 F20101107_AABJMO reini_s_Page_104.pro
4977164db35ad77b8f64250d532c310c
38a9078fefd23f05c0aee6e23d5bcba4c7d7dda1
13452 F20101107_AABJLZ reini_s_Page_130.pro
6d8445cd0e6759632836b40efd9fa8c0
4bb2213b643efb410f564253d12d1ec10e5c0fa9
F20101107_AABKQF reini_s_Page_004.tif
4c7b4d33f1f54e250f951630782b4996
e8c5fd9f6438f25ef28ec435326805dc70d804a0
19880 F20101107_AABJND reini_s_Page_029.jpg
64a16aa1ba874ec51a64000105a82866
5a91110a280a3033317d042ba0d7f40a253c75b5
F20101107_AABKQG reini_s_Page_008.tif
fe0ec69ab5400f25a01ff6a3b91b38ba
d20e2180c064d2941bd4ccec5ec4e880624d9e23
1051973 F20101107_AABKPR reini_s_Page_121.jp2
9b00d28b98ebf1e426eb9f0086f03a8f
537c5f11f7b1e632e2fbc134f3111c7b576a6f52
50226 F20101107_AABJNE reini_s_Page_101.pro
92b61ce839522c4529e7b66b808a2edb
4e73c6d80824ef57e991ceafd4f79472e9512235
12472 F20101107_AABJMP reini_s_Page_056.pro
7e73703d57d7a203fbc9b549e58f7c4d
1cb5ca9512a746960e9d73b0899193fbc67031c4
F20101107_AABKQH reini_s_Page_011.tif
70eab188fad3a4775b9686b840ac7072
7cd1df5bf88f44c4d8a8b6750fc96a68fe861691
F20101107_AABKPS reini_s_Page_126.jp2
c08063ec8d68015bb408e3a1307049d9
fcf7623aaa8dd66c35e5552bf55e9c7fe81651d0
42006 F20101107_AABJNF reini_s_Page_054.jpg
3651e84f0344e34221e41577b3f27e83
61c65a528780a89f3c0ce244b9958041bb475bc0
2184 F20101107_AABJMQ reini_s_Page_068.txt
e9b031a66c1fc9c8bde994ad47b42b2e
64780d1690c2703fdc7679e9d7cbe13b9addc903
F20101107_AABKQI reini_s_Page_014.tif
006d6dde7f3e9941716f51a36fdf46a9
bb7b49e2f685eaf09a58f1ec1c4db2f468078be2
1051939 F20101107_AABKPT reini_s_Page_127.jp2
d2445d68a7461d71b0b0b66ac11734d6
162b46b5e7e2dbf821696658943b8d840769a618
F20101107_AABJNG reini_s_Page_002.tif
b7656411501eadb80465c67c1ea41a5d
1d3d2f7888c77d3cedc39606640bc9a9aa9bf985
207936 F20101107_AABJMR reini_s_Page_059.jp2
5eb64517cb6654e17bf1b68ea9f09ece
631a551a9bab172670c8d05f8f2f7b3dd338fd39
F20101107_AABKQJ reini_s_Page_015.tif
065fceb8944587a226f96ece1acded10
4b9488dd620d8c5559264dc7b7ec351db61a778a
F20101107_AABKPU reini_s_Page_129.jp2
b2425a97da99e2078d8e3db7d9b0a758
ea06b9eb798f89a73acf3a4e4aa99e9050b5c132
12424 F20101107_AABJNH reini_s_Page_130.QC.jpg
52ae3e42546efc8c6468a2c5d3f5a2e2
e9a576fe43bd3d27ed846b77aee048e520ba9b78
9144 F20101107_AABJMS reini_s_Page_015thm.jpg
a071245ecaebf96e0fe21007bd25d042
7e09a1a8d8bc169da85820d5b64a0b8449b78760
F20101107_AABKQK reini_s_Page_019.tif
b3fa5c25d3b8cde6e5e2d3b34ff7d015
02a5cd92adb735fd36ad0c6e14ad948fd8de118c
357746 F20101107_AABKPV reini_s_Page_130.jp2
5a1eb5d1f564a43531f3eb1140fd23e0
ad77895320888acdf6a1291a8aba2b40f186e2d4
6446 F20101107_AABJMT reini_s_Page_030.QC.jpg
2cff68abbf58461bfb5e62075cc0f858
1d48a6ad34debe5e54df93d96b40629272df2120
38062 F20101107_AABJNI reini_s_Page_020.QC.jpg
b6db17d47c8e392ccd58a38c6e11dc0a
8728e6ff3491131d4384dc5747e1a80e40924a01
F20101107_AABKQL reini_s_Page_023.tif
c782c69b59d8a54aa743bf88a1dabf47
e148cb805499c331ebbed61e33f5de7c5d1fa286
1051884 F20101107_AABKPW reini_s_Page_131.jp2
7a6d8801e12a06cd54d5bc96d507f02e
1fc97a1f122ce565ddfe1524f1796b570c1c590d
110525 F20101107_AABJMU reini_s_Page_048.jpg
b084ef1b4158bddb6fc2daf24b5aa2de
c244148e9d1aafdc47d13ec4a07c87d01cee66a1
8826 F20101107_AABJNJ reini_s_Page_023thm.jpg
b021b49ca07ed264199736f90b89d6d1
a061e8ed11e049b22fb7de8b7b82770c8e4b706c
F20101107_AABKRA reini_s_Page_088.tif
1be3064c14b4cb347ea76306f4210831
fbf8a665e6f33eb5145120604d4ccf41165fac02
F20101107_AABKQM reini_s_Page_025.tif
a500aaa33b8dc8207fd32b1ce2c51a3c
7ef5e959cd451750d997fa9fbee9d63e4050135c
F20101107_AABKPX reini_s_Page_132.jp2
d04632cb7f9d3f853cd271e61b25207c
9adb81dda35f3a58d1d077634734793a111d0dbf
8534 F20101107_AABJMV reini_s_Page_001.QC.jpg
a627f8c197a00117145354d2490b2601
54fae0a9275734cf1f1fa5df5d37570033abd102
1351827 F20101107_AABJNK reini_s.pdf
83b21b03d7f00b7d8fd2090dd81d0e01
bdd98384e2b3a0ea0242a391bbc52b4e307b90c6
F20101107_AABKRB reini_s_Page_093.tif
e2927dc87d5ceb1f5917007329a4faf8
35be920c2ac9fdd1f726f5828a5f24b3da02246d
F20101107_AABKQN reini_s_Page_034.tif
219f44496db11c2bd7811c1aa4c2d040
dfb33ac05c15a2b934f7cb1b70bc421e515c3624
1051980 F20101107_AABKPY reini_s_Page_133.jp2
e4f12b3e1a14c75723b5e23869300cf7
2974579e02546cc72b0130341a32242cfc4a2421
4593 F20101107_AABJMW reini_s_Page_118thm.jpg
f627ab6ee480445f4a421b616a67e216
3a72d23bf81ffe86ccf36efa448063adbf3d7c93
1181 F20101107_AABJNL reini_s_Page_149.txt
bba5c0e8d8cbccc39b746e5b892d1a91
a2255e0055355be6935f9f934ee1bf5f6faf6ab3
F20101107_AABKRC reini_s_Page_094.tif
2378187cc55dcffc5679c7ca7e9f3b16
97da42143ce52a5829c7a42b108bea8b844a464b
F20101107_AABKQO reini_s_Page_038.tif
fb73fabb07cc61cfadc16547c2a80342
0ce4343bc4e4015adea922b129a5aa444ace6117
1051944 F20101107_AABKPZ reini_s_Page_134.jp2
2dd6b7717151c07ab8e4deffe9e4c772
09445ccc75025a1dddd0d3b42d47863a9b7615c3
985060 F20101107_AABJMX reini_s_Page_010.jp2
5466c4c8cd413a96cb468c27b95a5751
5e2b4e512553131d011a05e9d855c1d9970d501a
37090 F20101107_AABJOA reini_s_Page_080.QC.jpg
4d0941554e77365ed3dbe500d07f4baf
9ffd0c2d96aea365362b33c4e8d08d3f5090c2b6
2165 F20101107_AABJNM reini_s_Page_129.txt
5b00e0b3de4cc5c9f3a11a63fd331101
e15e737d9fc0c3fdd8789c3dae814b938c65a562
F20101107_AABKRD reini_s_Page_097.tif
f3b3f85b0d2c02e0f99a5d1e45731609
70fd3a9d66329c3769c7c76d962cabf6f7d4ff56
F20101107_AABKQP reini_s_Page_039.tif
920ad6896df0ffba96128f55a830426c
3222accb2073ee715efa0357b515d7ee4e8fae7c
53945 F20101107_AABJMY reini_s_Page_128.pro
323ec1f148f82f2812f291783237d710
736e2becc5b68cf1a4182dade13f406af113a9ef
F20101107_AABJOB reini_s_Page_095.tif
9972a368475f9f0dafeb1a25e2d47c7a
a19a57d031b7ab842b8379d2ea387bcfa9b4a2fa
36776 F20101107_AABJNN reini_s_Page_025.QC.jpg
ee3867203dc8cd954d69e62301356db8
d6b1f31d384444201a26bc2d28f9ea4cf7ee6567
F20101107_AABKRE reini_s_Page_098.tif
423313f5658fa4822832e6c7236216c9
0cda94c035d994ede0e9d7cbf591fa05d71e9b55
F20101107_AABKQQ reini_s_Page_040.tif
509a415c556aa2dcf91712c406647088
7f9508046858518c7d1f9f69973d9d0ec2bf4b83
2210 F20101107_AABJMZ reini_s_Page_100.txt
23e1083152c2a1b0d38ae68e25b967bd
ddefb2fd236f2f265934e2c1f470c28d2ddd1195
F20101107_AABJOC reini_s_Page_043.tif
81bd246dc65da5120552ed77b9a5b8d5
ff2c0e3ae830175ec73db3ae4598d7a4d238d451
767 F20101107_AABJNO reini_s_Page_118.txt
f257543d5ebf0e3b69683627f8ec028a
0f754653ed05c7a87bd7cff559fe71628777d9b5
F20101107_AABKRF reini_s_Page_100.tif
2506d6d74b0d5e9a0dbe6a89ed5abf8a
db05ad31aad091024d47af54e4f8d592b338c33b
F20101107_AABKQR reini_s_Page_044.tif
25b0aff03dceb2f91749d05d857e4dc9
659d730858ef5c5ab508e171bcbb0ed30a9507e8
2163 F20101107_AABJOD reini_s_Page_108.txt
360afcfeb2b0900c61d7f597438f5926
5fec74d06e168466e4b4ee34f1f8951ca7cb3ac4
F20101107_AABJNP reini_s_Page_032.tif
750121ad5b16ed2844ea0e255e1543e0
35a5109171ef7711965ef13f0d92fd39ff1813eb
F20101107_AABKRG reini_s_Page_102.tif
2bf8b212bb470d8ba253eddea92e5fab
4e4abc44175f00e0e1408200c9a378e531aad048
8834 F20101107_AABJOE reini_s_Page_124thm.jpg
f7f4abfe333ffb3e7ecc308b284bc34c
8fa124d2a2e1a1fc1e6276d83c29fe98a823aa25
F20101107_AABKRH reini_s_Page_104.tif
c960643765d0ff3314281a563a75e5d7
06d8bcc685b7ebb704e14cb7591516a79b78d98c
F20101107_AABKQS reini_s_Page_056.tif
0a9ae5a97280a94d772e04f9701a5359
c4bbe15459a6a41d0120188841242a304604d13b
F20101107_AABJOF reini_s_Page_113.tif
1a5b80d8393bcbdef3adb35cb48475d0
94495201eec70de40db41b121df9dc62ff1a1911
42219 F20101107_AABJNQ reini_s_Page_117.jpg
d6a422c8d41081f482c946424e681ce6
39988e64c5d44f7943306b6677d564a15984e501
F20101107_AABKRI reini_s_Page_105.tif
39ca8fc2c9c3f8d4b59e2c5ddcafc104
98fc17ccb6df1d09933820ea5503052175ebbb2e
F20101107_AABKQT reini_s_Page_057.tif
fd9a8fb824965a464dbb2e2499d042db
1c0b5d45e3d088d3ce2efd535c85f2653e26c751
2130 F20101107_AABJOG reini_s_Page_023.txt
c1253bffb161b1e43ecb3b18e35e1ff3
5390c395899c476271036e78a8f8dcd59522e0aa
2068 F20101107_AABJNR reini_s_Page_079.txt
4d8d6061613c1a7e3a48c9bbc1e2a485
2a80fe4043af9d8379d7d9a1cefc93a7ffc1915a
F20101107_AABKRJ reini_s_Page_108.tif
2f3165ba4fdcce3c83c69dfdbe6efe8c
e6930b69a9a777fabac60d605cc4788debe4db2b
F20101107_AABKQU reini_s_Page_060.tif
efcbfa64fe846bac6a683703b169f895
3a57a350c10d0767cec9baa2e25c38c8968dba30
2244 F20101107_AABJOH reini_s_Page_077.txt
80a052c369a0a96fc03071024692e4fe
e3240b1833f430a457cc453c398623aa0c1a0b2c
495 F20101107_AABJNS reini_s_Page_001.txt
00083ff1d1b1c496dc9880a38c6f1e40
1ca4d40343a2633b38bd7bc1f44dae80e0593a58
F20101107_AABKRK reini_s_Page_109.tif
a5a3f5bf4405a29bc623828be2429b2d
856f5f842754e4b0a32cb113d2de31e80ecab667
F20101107_AABKQV reini_s_Page_069.tif
f23568f26df53f3edbb9f2a4d70579a1
dffb5a1ad0d38c4fc98d0d3803f0d9f6bf458e27
135923 F20101107_AABJOI reini_s_Page_030.jp2
db3fdff49e13ebd9f56c006750b1c4ef
afd2d50a3339b3b4361db9c930f3f3266d1e50b2
1051975 F20101107_AABJNT reini_s_Page_006.jp2
0dd0004ad7b18ae56dc6aab29ed7f104
839154c54843050bf626f3aca193b01510736f69
F20101107_AABKRL reini_s_Page_122.tif
461e42254cf6c1eadd349e098fd62b80
57da5ffb236f0ffed54f8a0379396f0de6923dbe
F20101107_AABKQW reini_s_Page_073.tif
e0c31025b676a75301ae5abcfafdf911
031075aa2ebbbf982d3e5303d58e42fdfaae1aa5
3463 F20101107_AABJOJ reini_s_Page_130thm.jpg
c7a7406169dbe5b9c2e559027aaa6927
3ea6d96be6a3b9adfcae28f20f553d1f9d5dfb5a
8917 F20101107_AABJNU reini_s_Page_121thm.jpg
6a12c94171182b0c52dc32bdbf0d42b2
26c58b3016263b4ab090dfa7b5ea7c39e3eec3f8
52463 F20101107_AABKSA reini_s_Page_033.pro
a1f3dd49328e4641d606b572b8d1dbce
005382802c89832f21b8087a6ef64dd2892b4d92
F20101107_AABKRM reini_s_Page_124.tif
3e09ea5e5f463e3d3ef8b2f5bec0d802
c41b103e7526e38db347331585c28aec1901029c
F20101107_AABKQX reini_s_Page_075.tif
6deb42d160091932c16ccece1dbaaedf
f67c6356355c93fe6925e923c3e40e2ccea63512
140538 F20101107_AABJOK reini_s_Page_144.jpg
b013097a4036056966da3fd78a49ea11
6a3e628e0d97a4ddf65c6988f237918fb92338f5
37027 F20101107_AABJNV reini_s_Page_132.QC.jpg
958f4c9a766f4cc2b414fe94f30a025e
789f5ec63b54d85ae1a322cd3eb4c48f425b3f6d
50721 F20101107_AABKSB reini_s_Page_037.pro
3485f1f8f3b7206024c506cb93579c55
e5bf29130c7f9c3fd5ade7b9a0b3dfc6bf6f5fe1
F20101107_AABKRN reini_s_Page_125.tif
5c73bc53c72aa7170638cc7098d22ffd
598783b84ae2edc4f2ce866166c2bae095a96f76
F20101107_AABKQY reini_s_Page_083.tif
2772e190ffe5013119cc1bc2af2e9a40
e5a1751657eb74fd0c1e9d64d1f69373b071bedf
171885 F20101107_AABJOL reini_s_Page_029.jp2
ad3b4b246e389acd2acff42534a66ffd
555bb0355dbfd956236fafa662a84abdfa931e66
53367 F20101107_AABJNW reini_s_Page_087.pro
402377f0af53d6fe0b633f2104ba5cce
0411037f8205470044386311c4bc51ed63b0bd75
40695 F20101107_AABKSC reini_s_Page_039.pro
979c7895fe975cdd9536c0afad6cce85
c4487d5a2c8a69918afc9d8309cd705fcbaf2f25
F20101107_AABKRO reini_s_Page_137.tif
ffc0c829942979398775cd0b5053b513
c5d880764d50157f81bd5df7b920a09dcd4fa29a
F20101107_AABKQZ reini_s_Page_086.tif
a6b11e9f4cb7de8af36a282fcca40896
06b3ed8ea6db5af93f1328f1364209f8831085e5
39954 F20101107_AABJPA reini_s_Page_058.jpg
0672c87cf73bc5aa8d1a261dab04c6a6
a4988c57bb980879ea72424a650ec1b511ca2785
13450 F20101107_AABJOM reini_s_Page_054.QC.jpg
3997b06dc34dbdb0f7a8d37b488f7bee
40eae73c1ef7e10e0528d90f582ffad63a62dcf2
35873 F20101107_AABJNX reini_s_Page_067.QC.jpg
4f9f5191d978ff6ef53233e6cd920803
ea744933166993575ad8495e4cc714cc375cb476
50981 F20101107_AABKSD reini_s_Page_042.pro
fc5987ef356f8ea58ff356f19eb4dc4b
172393b9755c33193ccf61d48e3b2a1da7a0f5c6
F20101107_AABKRP reini_s_Page_140.tif
178c858030ef38c3ea6459bec40afd7d
c1e122a41281d801fad7087b2951c2d3b680141a
F20101107_AABJPB reini_s_Page_028.tif
9c52ae6063961f067a92b3f8da889eee
0eff86d11bb715d8f7b54c53521369a19262a156
458893 F20101107_AABJON reini_s_Page_073.jp2
4c95eb5aae15591e80efd0e74073b989
57f553739272737e9b630805826ad34586b2dc64
2089 F20101107_AABJNY reini_s_Page_001thm.jpg
ca1989d3366658bb15c5824d89646e25
21ad90a9a187be0d6908fa25539295d7ea26a378
54453 F20101107_AABKSE reini_s_Page_046.pro
590dfb9c82bf25042ff6024b48a7fc4e
fa1beee0cd190f2878bffb04e2fdc30414933793
F20101107_AABKRQ reini_s_Page_144.tif
9bf1e2709956bd097b5f1b3b4cedc686
651540c974e3de8058626c36c77fcb238d82c0a6
61144 F20101107_AABJPC reini_s_Page_145.pro
171a5a95af33f27556f4c63821125a1a
cd1725b4ae4fc1920c05eed87ffb75cab4cae85a
8659 F20101107_AABJOO reini_s_Page_016thm.jpg
f51eb3fe60677f9f9f11a18f7a2af717
4936059b16542101087f56e889b0166b0c272e60
9002 F20101107_AABJNZ reini_s_Page_077thm.jpg
50a3083dbd3e0faf78869c05b3a2945e
464b7350a1079eccaae5380421e02db844cbc8cb
55379 F20101107_AABKSF reini_s_Page_047.pro
264561bbb42617d06b6fd4ceab8279dd
372a78f866b503318291b0c4c730c1057f5fc508
F20101107_AABKRR reini_s_Page_146.tif
9ba623ba16d9e9f6099e4f7fc1f66a8e
55244a8486f33610ac00fd8424e6c8ede761b515
F20101107_AABJPD reini_s_Page_078.tif
7475e8b313ea1cfee32564e61b1a8993
e30e702192bc4c1f21186483496029027e4eefe3
95701 F20101107_AABJOP reini_s_Page_040.jpg
5d4a22af0f04da095e36748a37b26905
df5b38a23cd3f19be347490a14d3e47795bd3d84
22316 F20101107_AABKSG reini_s_Page_057.pro
c89bcdd571e8590d0b399f4a521e7b12
30300fcd1c97fb41c8470b40d8ed3ff415ddcee7
F20101107_AABKRS reini_s_Page_149.tif
84bdfc7c88ab23b8e4bb3cd059918397
f4e9082b8e6b0164d70d9c05a0060b3ac8a5a292
411138 F20101107_AABJPE reini_s_Page_074.jp2
091957e9818fc5e3f8cb0b2ef801d7f3
4446a61b8411dcc7ac1feae7cc8d656ee68e4387
F20101107_AABJOQ reini_s_Page_115.tif
b2bca57db77704de0e485f2315070023
5f7144f8d69ed75434c9240f2a06b62a63339bb7
10396 F20101107_AABKSH reini_s_Page_059.pro
d98c126cdeb339d11dc912ecfe0f82a1
a93c93298c5096da145f1cfb9dbbec6f259105a1
108941 F20101107_AABJPF reini_s_Page_124.jpg
6ebfd4ca7efd7eaf2b8cdae87924d2e0
bc97916539d5496791be2a4dcd161a0a9042d7f5
33751 F20101107_AABKSI reini_s_Page_071.pro
ca6c6dbe79bd5d173310b9bd5655f8a7
6ea6ad00fcf5bdd03699eea31ae69049faa60746
36812 F20101107_AABKRT reini_s_Page_008.pro
bbfa2376b4a6adb559ff9f6511804d64
828e3fec1b36ace4e7ecf96fe3c66efe9f4638cd
53569 F20101107_AABJPG reini_s_Page_124.pro
3fa068ba84d7d62b21cfb634444b8d34
8161d3945b4b7d1e618684edf4301755196c9ed0
55096 F20101107_AABJOR reini_s_Page_048.pro
26cee57e16fcebee3e7c89d6e551d2da
65f3af5f6e8de81dcdcfb41e0d9fa13330fd9246
17859 F20101107_AABKSJ reini_s_Page_073.pro
97073476b8fec9d8a14b8fb9fb6599e8
3fd2414349d1a61d1c920d69932530a9af0b7300
42250 F20101107_AABKRU reini_s_Page_010.pro
365347a14f98d96ab4bc6c2eb6125f29
3509d84b00fc95f9d0e06a59d16a1600bf29571a
657 F20101107_AABJPH reini_s_Page_052.txt
cae234cad049ef472e4ecca239fbb6bc
45f3ed146043700d9902d536c90c7565d3a98c51
35908 F20101107_AABJOS reini_s_Page_037.QC.jpg
69b23453c1f9c6e89906c989b6fe4bdf
b9ace5b90b807b905db5a55c443c469fc59459a4
26329 F20101107_AABKSK reini_s_Page_074.pro
06bc0455d340b44523e99595b70f0419
aa2d1e68ee3e13d1c65a8e4acef0b8b824fb6963
50985 F20101107_AABKRV reini_s_Page_012.pro
08ab09675b028f661efb8b486779f85d
bf052afdc1ce19f4e292234bb46ceb69b3d506cf
2533 F20101107_AABJPI reini_s_Page_147.txt
bb24040bed66fc022f47f84b1b9662e8
055698726c48770efa3d5782682d06304446b6d2
8811 F20101107_AABJOT reini_s_Page_017thm.jpg
a2f879fb71957d071677d062b49b5227
a4a856067e5087a0641ca6eb0bdb19b8acc1cf30
56414 F20101107_AABKSL reini_s_Page_077.pro
3551234db9bfbada10aa2ecae2a2a94b
17f153643745ca52f458916f712ea07936602b40
55610 F20101107_AABKRW reini_s_Page_015.pro
44a86378ba2dcd4f0e2af957d26f5d9d
f856dfbca2a820d9d61043ee85ab614fed4e5337
36757 F20101107_AABJPJ reini_s_Page_121.QC.jpg
f32e7a8c905131043d5594b9eca7737c
8edb7933bc16ffb92a3472c0d8de15b770534d8f
1701 F20101107_AABJOU reini_s_Page_105.txt
01677eae08420d76c33030b1feecc91c
b8cc066c6465661ed1f517f1ed6985f90f3511d7
16226 F20101107_AABKTA reini_s_Page_118.pro
7538d1bce61157045e8643dc3f15252c
1373e27bd9ff14ba1d736ca74c4733c10e3b25ac
51036 F20101107_AABKSM reini_s_Page_081.pro
145965ae255d023c7e9037da884fe5c7
0015517dc43e531d8a3334c7a2cc4b8a680ad249
55053 F20101107_AABKRX reini_s_Page_019.pro
896eaac2cb3e0f56bc87f3bfbae41ed1
a9d5c52f35b26c88d35aab2c18184f6d25913b33
9387 F20101107_AABJPK reini_s_Page_144thm.jpg
6ba3661ee147f5a79db1872a82025754
5597e6c89e8fcb5d2fc8cf5d8efcd5ec93cf680a
37087 F20101107_AABJOV reini_s_Page_147.QC.jpg
85cd237ef319223ba98cc8fd0ea8b846
4a32757d1e7a7c4059d27fee87f367672c4e3f2a
55213 F20101107_AABKTB reini_s_Page_120.pro
6673b94169665d6ba5794e0b5903b98b
e9bb4a0984052023cb9c6b1b2862189de680996b
54384 F20101107_AABKSN reini_s_Page_086.pro
dc4a19f05d19a8ad9f9b8ee9987c85f5
3785beabe2e8f5b9ed6ecf05244d0a3864a375a2
53345 F20101107_AABKRY reini_s_Page_026.pro
8d3fb50efe66d672965395ba18efd7f7
4660dc6a80059b2a637301078e7c6411c341d2d5
F20101107_AABJPL reini_s_Page_087.jp2
b675abe3ac540df0c5af131563fa5efb
5792fa9882fe71498d37f20fc0aa90fa141b3e0b
F20101107_AABJOW reini_s_Page_139.tif
87f92c11194ade7fe7724a1ab8f0fce7
4f4f7192ba241926c2a0ce36622cfe9c43260f89
53820 F20101107_AABKTC reini_s_Page_123.pro
f78f6c1178edceee86797bb630b10a3c
7ec98aaef71013b340f02748092926a3cf713a4c
58756 F20101107_AABKSO reini_s_Page_088.pro
016bcd043166f795e5f3dfe1c6cbdbc0
f7f27bb6c44a59ee56a05efa0ca31d1bbc83455b
55944 F20101107_AABKRZ reini_s_Page_028.pro
ecf48ef7699d2e604e8688daf3bab159
45addd9dbb53fedeacc24e298c4b1c7ea7259793
127874 F20101107_AABJPM reini_s_Page_133.jpg
60d041e14f1b2e78f2393c754eea678d
3ce95e87ae662d8d59ffd65d204e57b83308f58a
F20101107_AABJOX reini_s_Page_047.jp2
beaa679ffe8450e3dc99a2c7f53bca8a
864cc43ca33b45e96ad9a345d27d3f9b44bed32a
5195 F20101107_AABJQA reini_s_Page_030.pro
f8fc729d0084f7d32bb77728ef3844f3
4ba86e187a1bbaf7caf13eb19256e0751babd0b5
51817 F20101107_AABKTD reini_s_Page_127.pro
caf8405b1db1d701e155a256ef7ef7e3
58878327c8ffbb9e60a019b6a36c56f676c89609
54935 F20101107_AABKSP reini_s_Page_089.pro
88af405fb0afd76c7c95183def96e5d4
3dbd81f6636b9a1359436229dadd1e988e4c78c4
F20101107_AABJPN reini_s_Page_090.jp2
588803523bf76763073286d41552d64c
ca5efc0c5ee10f5b807817e9b949ff578950ecaa
9200 F20101107_AABJOY reini_s_Page_049thm.jpg
076d7546aa825dffe78287aa6fa4e69e
87c2e128c3e71702a8e587c4f5d6add918053f91
109070 F20101107_AABJQB reini_s_Page_103.jpg
a8a59407c9da0ca39b510abe9aba4674
e660d9f6c82add893d9f210721bdf5f3cddb39b1
63040 F20101107_AABKTE reini_s_Page_133.pro
7b27f0f1c251df543cf992a47fab70c2
411291a090418d6ee24fe6c778946df34985de79
23145 F20101107_AABKSQ reini_s_Page_093.pro
7ab574491503de28f8889573fa4324ff
8d1a28d1d4e4152d301b53b7569b34a57693074c
37266 F20101107_AABJPO reini_s_Page_024.QC.jpg
ca3f6a5ab6a0d8c0ba3d3507b79352e5
06dec68b38c4e85c753888c017dde8d66e8838ab
4772 F20101107_AABJOZ reini_s_Page_116thm.jpg
a1d78cc7cc8f6da14bd4fb3866ee5c8d
3de34bd1ecba63ceedccda0d6d77fc79731838cc
2057 F20101107_AABJQC reini_s_Page_111.txt
15eea5283c6d07ef4a049bfddd7447a7
454b28c6fb3e6833bed809fde597737b9f7ff7f9
65757 F20101107_AABKTF reini_s_Page_134.pro
0b89df034538a01e66b86f72d8ab134d
2b950008c3016521df7da8174275599b489aa764
12289 F20101107_AABKSR reini_s_Page_094.pro
ad71f5c4a47445eace9a4a5b1685db72
7597fb6f97e6544547a7471dc636d0b92384b95c
1051918 F20101107_AABJPP reini_s_Page_021.jp2
6a40d86ca986083d103adb3088aa3de3
aa5e921d07e3ffd0f03597fd8a4419341f994eff
35306 F20101107_AABJQD reini_s_Page_145.QC.jpg
0ff65818380d4e5f3d269856be5c1a6c
d2f578ca865cef3a9689348f0f9530d4b8e8d7fd
71974 F20101107_AABKTG reini_s_Page_139.pro
97d6c68bf7450ac5c1e99500b9a981aa
7232728cec0259d5f8071e0a98bec503b10657b9
12165 F20101107_AABKSS reini_s_Page_098.pro
b944ec5895f5bd31d39974f48c6c2648
1b1a40af3ab98447b190c2775b889ded1a66bbfe
106018 F20101107_AABJPQ reini_s_Page_081.jpg
765415bc2d6a7d984b43ac2cf0fafe61
88dcc6fe01731bc3e846e5b9efcd6deecebf3919
54024 F20101107_AABJQE reini_s_Page_080.pro
92f604273dcdb4d9e71b3ae21fc3857f
72b98fc5384fd7ea0293bbde24ad196a132804de
63898 F20101107_AABKTH reini_s_Page_141.pro
b2ccae562e614df764182465caec7679
5b28c4f2481e047ce80db99ea16b6cf227807449
42935 F20101107_AABKST reini_s_Page_106.pro
4b4ac3c164bf67776018b18c542a30ca
089d20cfa1375d34190d048356a3e85788889ee5
55057 F20101107_AABJPR reini_s_Page_129.pro
2ca675559909652c572a59755ce4cccd
6177c18d7c9692779006880876f69cd3d5660ea5
284525 F20101107_AABJQF reini_s_Page_053.jp2
93fe7d1a49abc4ca47b63ee3e48d2088
84b56d1ae2b13f96e5fe5de095c3cfba0afd85a6
68239 F20101107_AABKTI reini_s_Page_143.pro
f3d7f201b4faf80b2d84717edb7d7ea2
b43d38ce2a29991108e664dca1efdcf70eb9bd0e
143779 F20101107_AABJQG reini_s_Page_139.jpg
94e2583e5f42a31fc45a30a5fa8f05a3
9a16f7fdb1003eb9ae312ee542f4045dc5ce70b9
67828 F20101107_AABKTJ reini_s_Page_146.pro
bb9cdc23438d6711aa5152d9b603119d
e461b08d3b5d7436640fe01eeb55f5bac57cfeb3
56626 F20101107_AABKSU reini_s_Page_107.pro
99b527c9d5abb81eee9b02d86f91bc38
2407319d2d2f5411837a961c7a703c366e26ba5a
54969 F20101107_AABJPS reini_s_Page_115.jpg
3154b2436c3b5d92c293594471b715a7
c1f17732d7722f4ec73ba072c5db998d304c2be9
56899 F20101107_AABJQH reini_s_Page_070.pro
a3f8ad746e2271181e341b3f3aeff7df
7e3cabc388799560b59b0f23b33f7cc49391d2c5
28807 F20101107_AABKTK reini_s_Page_149.pro
92dfe79ed3ef5021b61858035ea49c51
e63493180184b6b12050f2b3918cd5094f3fd8b5
54112 F20101107_AABKSV reini_s_Page_109.pro
6096d059931dda5c6656d4823fa42616
1154bfb2a0737f823d2ff11ea05d316df67fb858
989 F20101107_AABJPT reini_s_Page_116.txt
9daa8bd265f93fa0bcc84d3d70b9f3b5
1d1fa6a77b46cd2d5ab347c2a368217464bb06ba
4654 F20101107_AABJQI reini_s_Page_115thm.jpg
c902d8ac1edbfc375ad9daf0c122dd47
d73ba81536e86ec24f877f010ac621de5e0bf12c
2836 F20101107_AABKTL reini_s_Page_007.txt
d6fb5f4a6b67f0859880a0bd16699f06
62502330955b489aedd6707d08315f1bcf79c4ce
53760 F20101107_AABKSW reini_s_Page_110.pro
711f3c60ecdaf04cc31f26bacedd8ad6
20f68cd27ae8ec35f511e6080f294985b4531fdf
2175 F20101107_AABJPU reini_s_Page_015.txt
84af6fee51ccb8c0856651168d3ad6b4
b01be921c8f86406b1c89d221af3179034ab9a2b
4046 F20101107_AABJQJ reini_s_Page_005.txt
995485d69c556a1754b2d3ac1116fd1b
e4919612038f754cde07de7c5f04d69a2e7acda0
521 F20101107_AABKUA reini_s_Page_059.txt
56ebc28c5edf98baaecb83f6b9057fa8
006f1b4e75df5d41038b4a72db9cc5d62275a15a
2620 F20101107_AABKTM reini_s_Page_009.txt
49b6d11a4c66a0810f4bd28adc2c1a93
2503be4040e63530fc93058bafbba91b499cc284
11389 F20101107_AABKSX reini_s_Page_114.pro
93538732671e4a0441ba108b4587695c
d7c3b2e6e625ee8a0e42a2e6f7e1a646f2b4948f
56012 F20101107_AABJPV reini_s_Page_066.pro
c5ae891eb7bc1ae0388bfc08d9a3aaf7
415a5ac3cf64ef4e6b68a153f22b173ae821c52b
8912 F20101107_AABJQK reini_s_Page_108thm.jpg
1de4f2715b247b86485241db7aec290d
0ef453154917d3a7f7a67b2593b873ae23f0b2e3
2127 F20101107_AABKUB reini_s_Page_061.txt
2cbe72d29760d317e8fc888297ec4c53
58db543481421748f41ef97741c045b27c054b5c
1284 F20101107_AABKTN reini_s_Page_011.txt
39e61b549d9d4182a8a7c2b636c1faa4
7b82291d38adb46f9e12b83a7cd414e2b35ef2f2
16308 F20101107_AABKSY reini_s_Page_115.pro
599f3a06a4db828267a54ffa1feab040
f24c1a2a7524e02c2d820223e343f954974fabe6
978 F20101107_AABJPW reini_s_Page_114.txt
4149160c55b37e324261a3475d4a7d8a
898de630896fe856192e52a043e26225eff06adf
336 F20101107_AABJQL reini_s_Page_031.txt
f8171505d1a052d3d82c44bb7e2dac5c
3e6c44a7f5469378e43652f979d9fb08433878b0
2232 F20101107_AABKUC reini_s_Page_070.txt
4d42e5c702016d8817eb10d69649c3ee
3fbeb5fa69f39a911ae5bfd4dc93450a5a14e41a
2149 F20101107_AABKTO reini_s_Page_012.txt
d79cb51cc87336209be9d418377a50ae
501253a313c025ccfb0c0668ff9c75ef9d2ecb2f
10876 F20101107_AABKSZ reini_s_Page_117.pro
c1ad7b89e430998f40f9a8ff7df66d00
74b18bdd586f8252a1e4754c3cd157f7cdca2d77
116272 F20101107_AABJPX reini_s_Page_049.jpg
fa2cd252f2456c65efa68f55e40efa5a
dc2cc6a63476302623d09a2ef32eeb94cb5cddd2
F20101107_AABJRA reini_s_Page_077.tif
9a48ad08b2cbb4a770dc931366244898
de22992b2af2ae9c9ed58477537b5ccf1dd99e2a
37829 F20101107_AABJQM reini_s_Page_049.QC.jpg
b8f7307d633081fdc1dee041ffceee33
bba2774f762cf512773c30b52967471417ad8f80
2115 F20101107_AABKUD reini_s_Page_085.txt
71fc9d794f2287d637d65511a553b7ff
6dc005d8f4d82ac99714a7a53f37e9f5918e9f19
2150 F20101107_AABKTP reini_s_Page_013.txt
e59493063f8d560098a6f28ca790aca8
55442ecf2431fbbeac1e354a772e82b596cc1e05
9391 F20101107_AABJPY reini_s_Page_139thm.jpg
541a9d92d29a23813c39d7512132cd60
d7a0ed102a4f685e04387008f11d3c1971c88993
35320 F20101107_AABJRB reini_s_Page_087.QC.jpg
d1f1da9df913aa4f8a2e71a6d3606697
7207d7725e8c626be00d8f8ec82a3d5c4fcdd4fd
115649 F20101107_AABJQN reini_s_Page_032.jpg
a62c1384bc923eb780b802255ccedd7c
120273af2e411089b2e9cb25dd86a0a2fb236086
1542 F20101107_AABKUE reini_s_Page_091.txt
1096e47e52b7aae34138dfb140c6c954
c791e08b46cd54265224e87dc4cd5b5b608bd630
2168 F20101107_AABKTQ reini_s_Page_019.txt
19f8b93694905e843d1f4f19caa05874
dc1e9e4d456367151126b94e23aea80c70fb069e
F20101107_AABJPZ reini_s_Page_010.tif
a9a55bbd4bfd5f8890c22b0e1a9f0757
dfd60309b7b05246f5d00a98dc7b28245aa881b8
9201 F20101107_AABJRC reini_s_Page_088thm.jpg
2a6302c9e231a1a301ceebdefdb2eb84
c97876e27eb373067ff82e1ead5445c4d9390675
132578 F20101107_AABJQO reini_s_Page_136.jpg
c4109cf39181ea746629761d3cc41a72
8635f382c111620de78f95c7034e39e27a9be823
444 F20101107_AABKUF reini_s_Page_092.txt
c070392793faddcd9be247b21621f96a
39bf268eec17f9ad561792e09436827cfbc3197b
2198 F20101107_AABKTR reini_s_Page_025.txt
4ee208fa87b728522bc6082efa8cff93
d1578a4a0581ef93715ecf97d0cedfd6727ece20
F20101107_AABJRD reini_s_Page_107.tif
f3fe92c9f087cb6f460b0fd9de240a99
9ca43f86e435daeadf1672a5362d9500c97dcbd0
13652 F20101107_AABJQP reini_s_Page_051.pro
e3199974970bcb7a1faf8d0c91cc0587
94c16aba26d2dc14e044439ed8d9ab5d50091b2b
1286 F20101107_AABKUG reini_s_Page_093.txt
a0d34b70c09d292b539120fb88b03956
ec9fca15c8aa5eb821f9e728767e77a699031bd2
259 F20101107_AABKTS reini_s_Page_030.txt
d1fade2eed1d7ee803c7b0dabbe8d4d6
1c0b21e735a9f013081260227268139f89a6da8f
34909 F20101107_AABJRE reini_s_Page_126.QC.jpg
42c079b23d4b6c833f6f61dec275a33b
4361cae0dad99810d3620191fb329e0f7ffbd5ef
35724 F20101107_AABJQQ reini_s_Page_124.QC.jpg
4343daacbff7bf1e1fd264c61250f7d3
1d7c404d35092117ceea17db5eb947ded869e534
586 F20101107_AABKUH reini_s_Page_096.txt
974a60b1e7ed2f4a18cbd438f87e21f2
8bb35a7f09bac1936a019310336f302e5db07776
2001 F20101107_AABKTT reini_s_Page_037.txt
39f11d326dc194c6a34e7664a06d1906
955947f619bee19b78fbc479f97071aca327a1cc
52702 F20101107_AABJRF reini_s_Page_085.pro
b16aebb3bee15d263d33105fddb3d5c0
33b494986292a162527fc27c5e3ab52099bbdb32
F20101107_AABJQR reini_s_Page_081.tif
27a16d556e5c56b644e1690920189544
d52a27de0cbe448132427f06f614b644869fe10d
1966 F20101107_AABKUI reini_s_Page_103.txt
5516b99993e1bab1ba1dcbd858f97b26
d4612050ee01b98521067427361923289608806a
2067 F20101107_AABKTU reini_s_Page_038.txt
6156aa1593f58c1afd73ec4f9530196a
95cdb8041727c78683aa2e14f9a32d7938039d26
54297 F20101107_AABJRG reini_s_Page_045.pro
74a5a874315ebbdfb33b51392fbca944
282c1ef5d45d4f3095232e2a15e7b64c42c75403
111769 F20101107_AABJQS reini_s_Page_028.jpg
3ac31ea3690e39196a31e17300e1964f
05135382752f53a4e2c3a6712dd06c8e2617ea9c
1873 F20101107_AABKUJ reini_s_Page_104.txt
e12f1e93ffe791fa63b79f3234d3bd29
0a6723c3dc4731787fb9311fcf9a7e1af9a92ef0
F20101107_AABJRH reini_s_Page_103.tif
32a87139f129de5571c5971a6f6562fc
5cfb4ee74928cb2d0c586d396874d3cbb119eb3a
2125 F20101107_AABKUK reini_s_Page_109.txt
45b63fb1ef0e2b4364233de3980a8bb6
d9b310905abf20e1970eb9f841344d722df68dc3
2060 F20101107_AABKTV reini_s_Page_042.txt
4d15e4f9aa57990b730e5927980939f7
99386111848638f7c9fb2a4271091d25b0334a63
5079 F20101107_AABJRI reini_s_Page_008thm.jpg
07704bc8d47ca9d7940e5e2d40421f2f
c208078103432da53b630aafd00fc673713028eb
1749 F20101107_AABJQT reini_s_Page_119thm.jpg
e05d6bc5953f7d0ff9829f0795e7025b
106dff2fdf74774c50deea16d9502276e87d695c
F20101107_AABKUL reini_s_Page_112.txt
baea783605116e53d4e13f0594b2d2ea
0942955a9055e0126545680d8cba9c566d465574
2173 F20101107_AABKTW reini_s_Page_047.txt
4abeeff66ab81e6b182a256b88bf3924
c6e58a2c953c0f12a5a12ab23cef5169226c5742
195080 F20101107_AABJRJ reini_s_Page_097.jp2
8e372d4f386beff21fe9a4111d7fe3f0
15934484c214040af57090d739a437ed725b0ef7
255849 F20101107_AABJQU reini_s_Page_001.jp2
c8b7313a3fc3fcd03b2f69ffc6b4a24a
e2b9b87fea33f57d711c8ff863f504e6f230bdb9
36950 F20101107_AABKVA reini_s_Page_123.QC.jpg
799f6563a68bc3ffd23cbd8b5f3e03cd
22c9123a4798ace179266c24b1b3af055f798344
483 F20101107_AABKUM reini_s_Page_117.txt
db05a5026841f12567a717b7f4dbf94a
0f7c16cd55a1efad996fab32033396e88174d412
1602 F20101107_AABKTX reini_s_Page_050.txt
455be8b683e77600483f1f96e0d31062
b1097a0475c7c629147d4dc2cf725996cc5deb5f
F20101107_AABJRK reini_s_Page_131.tif
90cdfa9df9bf1b405c58b6085a48b056
40790356839ffb8fb73db535524f821814c2d1a4
F20101107_AABJQV reini_s_Page_029.tif
819811455520bcf883c6985e55289abb
3e5eef4f8a40542bce460d9f7625edaf6f093a5d
35462 F20101107_AABKVB reini_s_Page_023.QC.jpg
20b219821068d003b09f1aa922d5dadc
a0784783dd4e8ad58e6883e00835b01bdccfd3ca
470 F20101107_AABKUN reini_s_Page_119.txt
544b7848bd6bf01078545ca5011a4d7c
351b221ad02e36c13d1a8e081b855d1d2452803c
625 F20101107_AABKTY reini_s_Page_051.txt
4ebf19f6dc625f9df336ca83ec371bfc
2a7699bf41536c214fbb1c3bbe794a9d2adaafa9
113974 F20101107_AABJRL reini_s_Page_100.jpg
233a80eca1bf9f8574085c78970965cd
012992160f8304bfddf5c709869ed39917b5cff5
F20101107_AABJQW reini_s_Page_127.tif
c67ed32daa888c48966a455464b7396d
35e69d4381709e3874ad8e3405fe232b182726cc
38883 F20101107_AABKVC reini_s_Page_043.QC.jpg
044685f89305dd1d3595f7f126fca2fe
e4ba94c5a895791383d22b2ab6ee510367327dee
2135 F20101107_AABKUO reini_s_Page_126.txt
8a3627fc4922a672aa02817341aba030
773ad074ed208ad36788af20cc9c243ef64901fd
616 F20101107_AABKTZ reini_s_Page_056.txt
5111abec05a7acacc62e5b0faf3397e3
8e1323642b3b5e7ef79fb0d45fa654d64483b682
F20101107_AABJSA reini_s_Page_045.tif
d6721683988692c7eca87c9f37b803a5
9b492e935130d8e1a549d8e3683583985558753b
5386 F20101107_AABJRM reini_s_Page_011thm.jpg
5333cecfc025c6f6d34e44a37f819b19
6d74225792839103f366dcf6c3cb2ab7247177c2
111834 F20101107_AABJQX reini_s_Page_069.jpg
bebbea5b4aa7ffb96a704d3edbda62e0
b020ee6962b7f9a2e53b43f6503bf9b884f29be6
7166 F20101107_AABKVD reini_s_Page_039thm.jpg
37ad0d3d2955320828d4f13c6dc6c6d2
1085400570d49c230797a713c22711a4dc4b89c0
2124 F20101107_AABKUP reini_s_Page_128.txt
f445952ab60445037a0e2b99918cd9de
8681d6b3448300b9c614d40db06d98e53debfd38
F20101107_AABJSB reini_s_Page_070.jp2
036c72c6734b33bb1e6cca61f8109ec3
ff72c20a1907fc4046abe4458322b9eb08d566de
136573 F20101107_AABJRN reini_s_Page_142.jpg
cc492738c4b250ff21396443d3da420b
d2cb9821b7739d7423ea4f46336b4d175f502e29
36033 F20101107_AABJQY reini_s_Page_102.QC.jpg
115c7503f6c1003378fd486212a527e9
d7be962adbe39af4f1475a0eac8448eee581a7f2
34998 F20101107_AABKVE reini_s_Page_016.QC.jpg
56569b032faf03fd59e7e591909f6563
1939af656c0ea87568b58010e282fa18dc1ff6cb
2757 F20101107_AABKUQ reini_s_Page_137.txt
460331bbefc91938517b64c706fd0a0c
db007b390bdf860a560403e4558968abf1d34bae
135551 F20101107_AABJSC reini_s_Page_143.jpg
c019c1e5dd40a4d1485d5465fe77a011
9771c2909e8d015f3961dfeab0fcfa1d15c4833e
2638 F20101107_AABJRO reini_s_Page_132.txt
8df07c2f7742892a9a73440af133a42d
e7cbf9aec9f03b1f14797cc44141124badc7d884
F20101107_AABJQZ reini_s_Page_068.tif
5bd37d040f4b104b8e834dd69ca1c35f
fcf3de2bc11b7355d018674ee9866d0e6d78a7f1
35285 F20101107_AABKVF reini_s_Page_019.QC.jpg
2be92c4b6ccbecb1f5c1e7b217c94718
7b254a286b70fa12a02d3eb490050bfeb35096f1
2643 F20101107_AABKUR reini_s_Page_138.txt
eb872fb1bf6e720b312b630e6d9d1670
32f999675f25e9c51e6d419089bd608d0d4b6cae
F20101107_AABJSD reini_s_Page_134.tif
db173d41873148aba3d458ac9ea9aa01
98c40da45b2a3b327df1c20bd52e58713e859408
34776 F20101107_AABJRP reini_s_Page_065.QC.jpg
538a66e6f5c2399903f35c4e141e9df4
97369ec228e1d3ef725b4c50ed90bc4732a8d4a8
27435 F20101107_AABKVG reini_s_Page_050.QC.jpg
a974d4274734a4e077d4a897672d6ab6
354676470d95622869c3d63c35dbf24e86824ba1
2522 F20101107_AABKUS reini_s_Page_140.txt
a15a84a9f4272838d3c09280040655a0
7982da9e36a79cd64ea2eda48f2110f307cd389c
F20101107_AABJSE reini_s_Page_054.tif
2766018c95fa9e0a44abd55e1a8b0982
a054266e18e6e3cfa1c7e0189366b571971a9aef
60632 F20101107_AABJRQ reini_s_Page_072.jpg
bef07d9defea1433e8e80109a91a7d47
3faddc315b18ba745b78100ac2d29b40ab2017dc
8412 F20101107_AABKVH reini_s_Page_076thm.jpg
c51e299112c50898e444e3776081840c
48d77d1ad36ef78f2a585c9c2df9ac814e78c18b
2553 F20101107_AABKUT reini_s_Page_141.txt
23c7233b340e2f5b1457b6c4d33fd18c
425efa7acd18688aa27ac13624d99e78192ec2ad
89987 F20101107_AABJRR reini_s_Page_106.jpg
1245daef30440f8d2814c624c408ed47
51d150f0f8dc8add4d7a0944ce9811946e3ec61c
105172 F20101107_AABJSF reini_s_Page_085.jpg
0a16d15c6ab0cd985273b2811b4752c8
4e484bb899fe0d472e4d3c7667389cf227290b15
F20101107_AABKVI reini_s_Page_038thm.jpg
5e733bdfabc5d3e33c72408225b10317
c74b8ceec8587a5830edf21253f24f6f82a696ba
2644 F20101107_AABKUU reini_s_Page_142.txt
64ea8b2d135a0cb230cae8d5301a40a8
c166bf0161fc836a899cfa77b75db0d42fe87d88
F20101107_AABJRS reini_s_Page_052.tif
ab06ca94ba15462596633d83975700c2
65cd24655e7c8b8837d7ab65b6ec54f3e6576186
35520 F20101107_AABJSG reini_s_Page_045.QC.jpg
6b7aafdc66dfe6b07f4af47b1ec6b844
00ebf2ced54a07e103ec2c8a26ee89827874e388
3102 F20101107_AABKVJ reini_s_Page_056thm.jpg
2d054de7542a28cd78608d778622084e
3c41cf1d2561f44524168e3e363f21ef50e11deb
38193 F20101107_AABKUV reini_s_Page_035.QC.jpg
4591af357aa167c32c454304f6af324e
56ed2c53103947e71df54131f82eec521d022cbf
52995 F20101107_AABJRT reini_s_Page_116.jpg
7e3250d13967e5cdaf84fb29017e0097
f4d07750453b74d6c3143918a4c8a1b1baf0d29b
F20101107_AABJSH reini_s_Page_083.jp2
1b829eb4213d1741ccc3c78339886cb5
afcf975d48714d7d3fae1141fd5f82ebd00fb8ed
8673 F20101107_AABKVK reini_s_Page_081thm.jpg
dd8c79ed041bed5515a39e81d636277c
4b2a29f77b18105523dcabc5eaaeb9b6a6de1ab7
26613 F20101107_AABJSI reini_s_Page_075.pro
20374c89deee06dcb7fb8de3a6b94b45
c46aef736dab97f8952ebbd0803dd7dcca8811be
2333 F20101107_AABKVL reini_s_Page_058thm.jpg
7c552990d29840704158cd688e731b35
cc57d53bd6d4ebae1cb2c65eba8c86fbdebc7c13
8838 F20101107_AABKUW reini_s_Page_126thm.jpg
dd594111f95b766cf496b4d40484d652
01faf9dd6d0ef0ca63fb07071cd7cc2a6efdacfb
54262 F20101107_AABJRU reini_s_Page_102.pro
31c98bc6540fb51d24dbbbee440b2aea
810be40e700829bdbc88734217cfcc7df13209f9
F20101107_AABJSJ reini_s_Page_135.tif
c935330b1b8d1cd78309ab5b31273225
10fa4a0e87ca2e549b76ee6354a77a3bece91a4e
35621 F20101107_AABKWA reini_s_Page_063.QC.jpg
9f2e0a04a05c7e715421d921874c0811
67c94bce2b1e4f46a78cf921d82fb54192e0ffd8
34563 F20101107_AABKVM reini_s_Page_006.QC.jpg
1790d0dfe5f9f8514eaab7f7b7575f2b
966b18a52278696c4afd673b2bba1cf16195d30b
9178 F20101107_AABKUX reini_s_Page_140thm.jpg
d77a4c6072e8d91e6fc460afe5585b4a
eb00e7af65ef733d359716f986e49d51930f3057
F20101107_AABJRV reini_s_Page_138.tif
7c99b7ce21b77934a975b6bf72835c95
b3e72ca4d279bc79cd350f040c8fbe827f4260e6
F20101107_AABJSK reini_s_Page_061.tif
f0b709b8c0a6642d3934adc04b3fc697
51d0c8c9248abb79259277d2d2fc6ce113571f7c
37172 F20101107_AABKWB reini_s_Page_017.QC.jpg
cf402ebd54a70c9ff56f047623b38e80
5528b282b470e4fc93afeccb24d41b3b9d6f3873
9173 F20101107_AABKVN reini_s_Page_131thm.jpg
febeb63f5a43e741b6b6e051bf0aaaa4
305f5905c48d58afd4f1cd1e08a9dcb3d1d6c48e
37471 F20101107_AABKUY reini_s_Page_122.QC.jpg
f9d406bc43630268c87a100a7f1675fb
a2e60716d47d8ed4a2e76cfc60de1cb8e571d10a
F20101107_AABJRW reini_s_Page_047.tif
f6d7e4e16b73c3fc2bb2a5bd5b59b557
b22662c14aedaaee3b66dfe34ec36f1638c9b3a4
F20101107_AABJSL reini_s_Page_046.jp2
cffd00d908ef1859e1d552d5f81e0be3
04d65783dce1bd77bf469e80a0cd5a554896e7af
962 F20101107_AABKWC reini_s_Page_003thm.jpg
e794620c63dff5baf37f8cda315d1a26
33ccfe2805a1d1c2312e93e6e2028b7ddd2dd7e3
8983 F20101107_AABKVO reini_s_Page_110thm.jpg
ff6e1e033bb4cc7106f6e3de1c644f31
1c6b7cd3c648345dd02c2b87054eea26877b4b63
35002 F20101107_AABKUZ reini_s_Page_081.QC.jpg
650018d445791160838411ae2ac6dc2d
a2f21839430787599da2cb758188a2ddd35205e2
14489 F20101107_AABJRX reini_s_Page_054.pro
31dc1962877259964118d0c3cd5b96d0
a3e6f40ed7626d261c40ea90b5466cbf3936b7df
108472 F20101107_AABJTA reini_s_Page_064.jpg
937f282e0d870fb7a339e351840ee30c
5dd58749c30d9ab89857597e542583559e704699
69269 F20101107_AABJSM reini_s_Page_137.pro
e5fa1431b626dd35e0ab8937c31b1900
3272da06659be479e5354caf625a5953b8688131
9069 F20101107_AABKWD reini_s_Page_024thm.jpg
ecb92fa3f5c1bd0b2ab94014c9f78c78
577cfab331f5e649eecd6e7e2a08ca7fd4e0da51
8602 F20101107_AABKVP reini_s_Page_063thm.jpg
9bdd3ec63564fcf2406eb2802fc95e66
2e0884c36c362012e94a43838f13455600e2c5fa
F20101107_AABJRY reini_s_Page_132.tif
aa3550bf66718fbc27f0773ff19beb44
97c168114715100808a4426b181e2c9acfad2f9f
128245 F20101107_AABJTB reini_s_Page_005.jpg
16713b1e75c8e20d5c51b5866f786658
d8d2d9541912e6c8ece8aceab5a7d6650163345c
37726 F20101107_AABJSN reini_s_Page_135.QC.jpg
69e65754cd3427a58da77cd18de61980
cdbd16c8d636faf1f9a143e5c430f7c1546f5592
8674 F20101107_AABKWE reini_s_Page_078thm.jpg
a6476d2259636c28c27728f41b5e525a
6dd40c746e10ba0272bc2f4cb029c281f073bf07
8403 F20101107_AABKVQ reini_s_Page_101thm.jpg
f9f1f262c06cd42dfd95c901666de027
57a48b5e6c57a4b3e7d6bd5527df27987fb5f25e
37711 F20101107_AABJRZ reini_s_Page_077.QC.jpg
c70ebc4eca7dfd5ee852fc41d59bc57f
34537320966f9d72192d8602c593587dd47eb178
37339 F20101107_AABJTC reini_s_Page_138.QC.jpg
3131d6473bfbac9045e8af1b52140b2b
9ad89df52425753538f22d213e3c550a12c64c53
57483 F20101107_AABJSO reini_s_Page_043.pro
0363f62f93b77921d1553a71e7991d10
7d34bfeaced7db858cd28263ddd9c81e38eeea61
16764 F20101107_AABKWF reini_s_Page_116.QC.jpg
44b57363684ccd059c3b6478f93f1d82
fed00686917d0c31758d308761ff541f3c1be593
8971 F20101107_AABKVR reini_s_Page_107thm.jpg
9302ae03055f6ddad71c4499b54656dd
84d2c03e52e75747ef61155a98c3c5d078f820a1
2180 F20101107_AABJTD reini_s_Page_018.txt
a18958b98c2dfbf379966115da6cf72d
76f62a77dacf2f761f1b7ffe896d1eb25b2cbe33
36123 F20101107_AABJSP reini_s_Page_061.QC.jpg
0edb149dee3e145ccdc459df2b3447bb
af1cf896de637760a36928a9a337ffc32177d998
33303 F20101107_AABKWG reini_s_Page_085.QC.jpg
151a1d88961bac070a06c947cb63d86d
5eb3ad563e11e681118c334584a2104dc694f0d1
20597 F20101107_AABKVS reini_s_Page_007.QC.jpg
9589063bff2876770c09ba2698687b31
245af0b4ef4b387fca023986f9f9193e83c3f301
8943 F20101107_AABJTE reini_s_Page_060thm.jpg
04d23702a32ae3e35765423f28fe0f09
9d8c1009e128bdc905462503bb111f8d404c66de
F20101107_AABJSQ reini_s_Page_072.tif
b5102d788b8e7d234ddd715056d72450
bb9cca06e45628616107d64d1a6f12fa034260fb
3051 F20101107_AABKWH reini_s_Page_053thm.jpg
107c7a39477630db520f810608ba315b
c971d00c997ec94bd62f4696a9b9d1c82aa529b0
8799 F20101107_AABKVT reini_s_Page_128thm.jpg
d015f68da9690f399abc06291a1e051a
f209bcef81b294581a4e2d3486d6735dc82c0739
134448 F20101107_AABJTF reini_s_Page_138.jpg
dcde9b2a6b39c4dbb3c01e5e2cf45fb6
b5991a1550146aed11e0838e8310ab9cffffc1e3
8495 F20101107_AABJSR reini_s_Page_102thm.jpg
047944bac498a77645af01117ea43924
788b455de21b204d58dd8919a0cedd7bf4d93508
8894 F20101107_AABKWI reini_s_Page_138thm.jpg
cbbfa5fd7e5adb64b648429ed491770f
a74d2d8e2f29e6afce11475a2b7367a92b2a07ff
5114 F20101107_AABKVU reini_s_Page_149thm.jpg
c7cc60e188417f3ba4c579f45df16b30
d3230e2bddebc9245b7029901d2c1564fd772a32
36930 F20101107_AABJTG reini_s_Page_100.QC.jpg
650b1e663a60ae38b5a4d9a544cc881a
56ef346d9f990ba9dd184682148bef3318b9b014
2160 F20101107_AABJSS reini_s_Page_089.txt
6545781d5bbafde7bf6f255733dba0f2
9c84785f273f1dd11a1edafa0659faffc3b5fd39
9177 F20101107_AABKWJ reini_s_Page_086thm.jpg
c3ab5d9dd72778d6609293d15c5ecdc0
365a15b3f321592fa674123f93bde34af9b29582
8593 F20101107_AABKVV reini_s_Page_022thm.jpg
23f0e2d7df049fa454a89dfc48e68362
5d73a9125fa967fd4f156b0cc99b7ba00e81ebaa
68416 F20101107_AABJTH reini_s_Page_144.pro
711eacacc28e25f159e21d06ff844be9
e88683086eba646c6659552d441ed8402951477e
108104 F20101107_AABJST reini_s_Page_026.jpg
ff2827b57ccc7c8f6ccd4cd43ca36b75
8ada958125f0cb78428eff40a489d9b5297e28bc
8793 F20101107_AABKWK reini_s_Page_027thm.jpg
195ac02b8ae676efff092b050173d674
d075fcc325ef7d9b95b9ac4ae71331c92737918f
7976 F20101107_AABKVW reini_s_Page_096.QC.jpg
de9d290b23f0e9faa29f20ee5aba5fa8
be8eb3642b71c6d6d5023cc93a3eb58fb22c7713
F20101107_AABJTI reini_s_Page_142.jp2
f8b7a96d69d3a3e789449d2592bfaf82
92fb95735d451d580274fd6bb48b1a9787aa81ce
62830 F20101107_AABJSU reini_s_Page_140.pro
9214ac732ae3424620d823807bcf62d2
66f4aca10420942919aa19b5aa10870538f04fc4
8876 F20101107_AABKWL reini_s_Page_133thm.jpg
0ebeb16f3094dd485d1d80c2678f2ab7
9dcea1243b65a0c1d35ec31ea8992b8c23903dce
4273 F20101107_AABJTJ reini_s_Page_057thm.jpg
4839be9ef3b82e5b38ea539182299092
65502c4533112313b1ec8855897d3e1a86b67312
6699 F20101107_AABKXA reini_s_Page_059.QC.jpg
aa307e41845c3d8c8e64cb164d159b66
92296bcb97b8baca6f1dd0f870d1fd6ef8195af9
8809 F20101107_AABKWM reini_s_Page_018thm.jpg
f923d23bcfb095332371afc11bdfa048
39d2116b9d7158c49cb672e282c5a2687e302071
36734 F20101107_AABKVX reini_s_Page_018.QC.jpg
84501c04ee9dddc14d47e9110ae14e3d
b97381cb85102552f738f0a29e53283582d2b8c1
107510 F20101107_AABJTK reini_s_Page_079.jpg
f5e1b6891e9736cf07cf6318872bddfb
d213fb2f171e18d6646ef809eaa2b4313b665145
111331 F20101107_AABJSV reini_s_Page_044.jpg
a3f9db7aafada1f431ad08f2f01763b7
d03444964264af1532e5aa9bf1c6d31ee5dee1bb
9181 F20101107_AABKXB reini_s_Page_036thm.jpg
7c5913f9bbd8ded8268cf99bc2f664ad
5525d790c69fdc2d2bc9308fdc98bf95c881182e
F20101107_AABKWN reini_s_Page_033.QC.jpg
d39eb016d5ed49d04e89a2cad2628e2a
4ca73e8fb68b6dc4de3e55dd8750e99c4cde4a1e
8666 F20101107_AABKVY reini_s_Page_061thm.jpg
d400e547015cae92b157c44aab91c43d
9281cd0519b3dca13e627d69cf46d32cc044fc71
54672 F20101107_AABJTL reini_s_Page_078.pro
04b9dd9dda6d436a1e4c9855c85985d1
f8780a75c614714c5312555d8349dc7085855b5a
8260 F20101107_AABJSW reini_s_Page_055.pro
6214a0f0d88cbfba04e57445c1943545
2a6af8be55619d26ec04d95c75ecae4d3afbab8c
5540 F20101107_AABKXC reini_s_Page_073thm.jpg
2911a109a868810ec605b88d2645ec81
72ce1e14e9709dfc3addc7d20283d5c299af4ea7
35374 F20101107_AABKWO reini_s_Page_042.QC.jpg
a0f8bb93bbdfb81e25e4156cdd611e4c
045e08c9138d89222196cd78854e86d021a0c4fa
34960 F20101107_AABKVZ reini_s_Page_009.QC.jpg
3d1bbe3620e09f83d7d0278d91c3e516
272ecfa5a7ca436283aeba1d4671baacf688fbf7
51506 F20101107_AABJUA reini_s_Page_065.pro
c991e56ea8f29630731ac1cc8e3ac4c7
dd6d388980865fa646c2296015a84094bf0b3b2e
F20101107_AABJTM reini_s_Page_109.jp2
10d29ffe506a0f69875b8c835152e770
12122f1121bf9de57fd7908ccd49234bfad66de6
F20101107_AABJSX reini_s_Page_051.tif
8e9c4449f595f58c1135009c08d1ff83
40ac08ff3fc3cd573797ba953757f8072e0153fd
34564 F20101107_AABKXD reini_s_Page_041.QC.jpg
69ff419a5510e50aef1ed0fbca9115d5
e85316a515ca25bef28848c92b264ffa1b6d3d74
8855 F20101107_AABKWP reini_s_Page_082thm.jpg
5f990041b6cf6eba49fa46912667427c
14056d96bbe0dda2ad115a9b3fc15ab88a72c95f
F20101107_AABJUB reini_s_Page_026.tif
9df6ba05ed4ebb6e77451aa622d59587
9b5c5c71b47c4a3d2435a06c4bff48c44846803f
33972 F20101107_AABJTN reini_s_Page_012.QC.jpg
792863da0de5679916ba7230b7baf266
23828a50f54a4ef9f2205d66f7427d7518fa5d45
F20101107_AABJSY reini_s_Page_031.tif
a7d34b2c36b9da2f3087b6ba497f6275
a29c8501c6ed0efe67f67f7f0225d49fbe9e3829
23430 F20101107_AABKXE reini_s_Page_092.QC.jpg
4d7b2cd7e731e53b64e73779c1b08f9b
8cc7da9c4866c1d5b53af9408a39281c1722314f
37386 F20101107_AABKWQ reini_s_Page_142.QC.jpg
90fe4348360b91ce9ee9f3deffd31a85
f9d801cf4b88c41ba3e917492b9fa1e7c170a559
F20101107_AABJUC reini_s_Page_036.jp2
ab8c97f4f4b849bda64947ce6f2a4261
0f78217b039d42971c0d3193ce3ed1c360b16858
110409 F20101107_AABJTO reini_s_Page_110.jpg
e9fbe7b00858639af802a824c4df3f5b
ccc483aa908607c723af2dfa9601148a0ac0afae
2277 F20101107_AABJSZ reini_s_Page_125.txt
995e53da0541c4c04bcd145417b3068f
04e62534fa267088d1d2e7605493a0f5f2a39395
35851 F20101107_AABKXF reini_s_Page_120.QC.jpg
19d670c735934089aa1eafee46328924
71aba28b121eedb37fe38e14e0b9b6b72aee91c6
28597 F20101107_AABKWR reini_s_Page_105.QC.jpg
d27fc7d40d5ee5b7a9513e41783b6368
5b29bc005b8c159aae2e1f2fa5f58c63b8e498b8
32046 F20101107_AABJUD reini_s_Page_011.pro
11eb0f6a7fd400b88e2447885fcee55c
61e412b2703e77918a993b8974c5edfb1d03c70d
1051952 F20101107_AABJTP reini_s_Page_033.jp2
89d34f763a4d944484158ab23e73013d
972b5136abcbb046835064be84377e058282f415
39500 F20101107_AABKXG reini_s_Page_144.QC.jpg
369c8f30250bcfccede547ec91d973be
200c314060f3a3a606005026709fc9a2381b0d95
19073 F20101107_AABKWS reini_s_Page_114.QC.jpg
66420e27c37a234a97b456140ba15a82
43055aac69964432f6f8016c4a564d7f883e06d2
32890 F20101107_AABJUE reini_s_Page_028.QC.jpg
bbaacf0a3c1b2d36b6b5c7b5e7cddd58
489c7cf4379a51f9feced98603caedb3c7d15fa3
111107 F20101107_AABJTQ reini_s_Page_017.jpg
a0adba1c6abcd520388fede08bfc9b74
d5f45c116a8fc4d641ab7e3203875af9b2d5cff0
36682 F20101107_AABKXH reini_s_Page_134.QC.jpg
2e99a4bf422e5140d7dab51821b03703
0c499acc8767b6a6e8d66bfec995968feebd8bd5
2846 F20101107_AABKWT reini_s_Page_052thm.jpg
5391efdf28a8ceeada97271ccb2aca1a
e66c4beacc6e4534ace1b2ce4463bb8ffec697ed
6587 F20101107_AABJUF reini_s_Page_091thm.jpg
f7002860c66a634eb45d1f2dfd6fa786
43ead31be1eb16a8b295febf88a66311e43b6eca
F20101107_AABJTR reini_s_Page_079.tif
a2faa7b1e6b63a1394f381c699cb3ea1
9e6b8aaffcdef4e11762a7ff371475b24732fc65
2753 F20101107_AABKAA reini_s_Page_143.txt
d08c12e6dc05b2cde3f2717794371620
ca158f746de2775238fa6ac849e22f36617879de
9014 F20101107_AABKXI reini_s_Page_021thm.jpg
c2dbe7d1556257021fb3ae141e00dd15
685f8774b19dcbfa96cffcfdb838922c98303d90
8425 F20101107_AABKWU reini_s_Page_084thm.jpg
d11f076029ff2934cc466db5bd305270
7e438233b73b6a743ff462f61d1da64a78827851
19099 F20101107_AABJUG reini_s_Page_072.QC.jpg
adcda4b4c9e91ecb37eb8add2567edb8
af6f59366a012d70e80a28fc65251d106bf7b9a5
12178 F20101107_AABJTS reini_s_Page_096.pro
1c3ed11b187261c901a2d6da38735deb
1eba23c748b7ab1413791e51cac2792c6a4c512e
F20101107_AABKAB reini_s_Page_080.txt
1404c6d8df2139014cbdf93291e2e2ac
3a9a460d57847d9f824f37f7f5298ce5cb3c1632
8818 F20101107_AABKXJ reini_s_Page_129thm.jpg
2770bb9eaf537333bd0d93237900ad7d
53767e7680f1bc5c1b0b966fdf06b6f3a06cc2cb
8752 F20101107_AABKWV reini_s_Page_045thm.jpg
eaff57a074a044b9800d3686582177e7
118aa0278d63926175b4758fcae20e8982fe2935
1530 F20101107_AABJUH reini_s_Page_008.txt
47fe64df39fb8d21e26489c073bf33b3
d9d3efc499c5bb4f5d41eac58621259443919cf1
F20101107_AABJTT reini_s_Page_016.tif
0fd1088e57f66051cd9338fd7d63ac7c
c592831b1ca5ce29984127aa1a75c1919e2574bc
8252 F20101107_AABKXK reini_s_Page_104thm.jpg
eca65c07c17f53245982799db26744b0
c7c5c44e2a9acb4fa996ad59d78c52e581ecb881
14858 F20101107_AABKWW reini_s_Page_118.QC.jpg
7f07c4402d40e2f02b5b7846adb12a2a
fc20023e9db529e363d4ffd754c6bd2dcf130194
111115 F20101107_AABJUI reini_s_Page_129.jpg
f83f7bb1db4c43ad661ab42a1e332e56
14b96ce0d4de27b4f80126440b2a7f28f7b576ba
52505 F20101107_AABJTU reini_s_Page_079.pro
c46a3f7bf2026c9e1d4f93d341058582
3bdd5c59e9f84b10a4702e03ddac86e46283efd6
9225 F20101107_AABKAC reini_s_Page_044thm.jpg
e37ac3f1e6c9a776b94ba7b656ffdccf
4c9deb33015414396b333bfbb1677c07a05a2612
34635 F20101107_AABKXL reini_s_Page_076.QC.jpg
73c99a0601a567dd50b4504648910c27
5114d5c4583d1225dc66c9580b902563fda29ce6
4711 F20101107_AABKWX reini_s_Page_075thm.jpg
cf7ad6665f708e8d38dc70b3041b61aa
23271c98543f29bdaece594e7073ba56114e59d9
8998 F20101107_AABJUJ reini_s_Page_123thm.jpg
bfc1158013c9d2fc7d794d6a7a6afaf0
8c7544967b4ed617fe91f49e472ffa9a529fb94d
111671 F20101107_AABJTV reini_s_Page_107.jpg
93c3a6ffc9f4ba7155090e00a7fc73a0
efc84a89e06130c1c4d931bca2dc9e1a4d4e9951
66081 F20101107_AABKAD reini_s_Page_142.pro
82bbd8fe2f4a0cc5f1ef4b163434f617
e0aa56185fb1f4bbd75629a783e0f827dc10e76f
5502 F20101107_AABKYA reini_s_Page_093thm.jpg
39aff60a930c27064d7a3088f2e6c7a4
8b55f2c928ac61e57e15951706c18b334b203856
6453 F20101107_AABKXM reini_s_Page_092thm.jpg
614e13df5ae4022073e1bafc699fa4c2
d53cdcaf0fd543e18b5cd6b4f28648dd8252bca6
F20101107_AABJUK reini_s_Page_048.jp2
e1ce128ba5260f02355b79b6d03631d9
677fccaabe54491616b791a2d7afc787fdc5485e
399854 F20101107_AABKAE reini_s_Page_058.jp2
5523804033f15c14b621f8ae559ddaab
70b918177f17620e229d47a5f4360cba5d5f4d26
35061 F20101107_AABKYB reini_s_Page_026.QC.jpg
552ec71e44c511ba34f6034884264d11
a9285f46c5e1fef3c62976d29d88d8512af1554d
6849 F20101107_AABKXN reini_s_Page_029.QC.jpg
fb82bae9d783acce5ca90e81e3406afe
6283a7b9e16686bce41782b1f84cb49c9ecee116
4578 F20101107_AABKWY reini_s_Page_113.QC.jpg
19571c930b43c8abd6393ba42e3144e1
e28e991b43b3ebed2dd25cb7d506b155df535777
18245 F20101107_AABJUL reini_s_Page_093.QC.jpg
2876a7dc2db7983c7be62629f92b632a
0cf2c4770ec041051e4baadb9f8cc735d34d6bc0
108224 F20101107_AABJTW reini_s_Page_082.jpg
aaee94b1ff3f7d2fce66599a80dff3f6
ae26134560166f425be3a464172355987c8267d9
139822 F20101107_AABKAF reini_s_Page_137.jpg
532f7f4584aa51ddb65585545e8b0db0
2efa35664eea2d34cf662e76b1e9878537d25b1f
222031 F20101107_AABKYC UFE0022551_00001.xml FULL
be3cc4160bcebd54354ca118d4797c3a
002aef67dc987bd8f6e1729b052101262fca7283
4200 F20101107_AABKXO reini_s_Page_117thm.jpg
71a9f109b517eb75d5f5ec4316c1df4d
18bd9ae567edf0d277f2b5a2d72fbe132fba4af5
8508 F20101107_AABKWZ reini_s_Page_080thm.jpg
218f45d6bfbc1922b6aefd15660fdf33
76819d362c68541cc820bdc3b75876127223ed2f
53863 F20101107_AABJUM reini_s_Page_036.pro
f66ea04b56f3095a175dd7fa53fa533e
f80f443cd80b271796d65567c66edb5a33e9b9b1
F20101107_AABJTX reini_s_Page_013.jp2
4fa7219273b0ee2643b56bfee493cd75
363fdd8d1bd5e795b516d4195729abde68db24dd
36300 F20101107_AABKAG reini_s_Page_021.QC.jpg
cc14ed4e2a8b60832790b13430cba42e
ce3134adebb1b0a0e27cb90c28609495eb608a02
9184 F20101107_AABJVA reini_s_Page_070thm.jpg
abc4ef703e21b5f43ca848bc4068b519
275598306b6be863501cf7e543ec6d45d824a3a7
8047 F20101107_AABKYD reini_s_Page_040thm.jpg
45514b736f4ddf02f3efed35d070b7f1
08e184240d826760eeae13a90712544750491d94
36937 F20101107_AABKXP reini_s_Page_047.QC.jpg
843a2d0f74db0219d2c8137e85cbe156
78192e6d2d69292625c14a7ac9eefbd5be4d4da0
F20101107_AABJUN reini_s_Page_046.tif
3402234f3618e047a5169e9365cf6f7d
cd133021e7403cfc5362bdb75aa458991122f389
12083 F20101107_AABJTY reini_s_Page_051.QC.jpg
98c3287d045155c32397660618eb9f50
c9775b3a2cc2e075b70cae4abccf9f328fd515ee
493 F20101107_AABKAH reini_s_Page_053.txt
4d79a42d378b700294c0d5d57b095d46
c1c7fc3b09f84145acfd5b5e783910073421db7c
105293 F20101107_AABJVB reini_s_Page_033.jpg
c3a2a93045ce786ef160aff4b792af59
16a4bd215b5ee4d27b56e6554bbc57bb1717b1c7
5518 F20101107_AABKYE reini_s_Page_072thm.jpg
7b90e12a183fd4ca1e88c4f493138c7d
9a789ba6260bd920c3fd9ac64c513afd5c8bcd8d
35825 F20101107_AABKXQ reini_s_Page_103.QC.jpg
3c00cd0673feeec78d54bd3c57068dcb
2382ae5671cee3cecb666f080b797981d8134ad7
105808 F20101107_AABJUO reini_s_Page_127.jpg
215b71b4e333dcb378dd5dc340d4f24c
0a28da26b2562c2920ca32633eb253c15a135257
8235 F20101107_AABJTZ reini_s_Page_033thm.jpg
d155efa6cb879a302b6a53970e0dd67c
5021ae40411ac0c3e159e1e6feb162ee55d0e34f
4910 F20101107_AABKAI reini_s_Page_006.txt
96b6d13252f26466692b268e3e8d0fb5
cfc06cb584d732c3390a3443dcc222d1b5664e6f
F20101107_AABJVC reini_s_Page_128.tif
1b906ba4a4c6dcf07e46f30cf868456a
37ea3daaf6172c8edab94f77d981b3b1effc2af9
35148 F20101107_AABKYF reini_s_Page_079.QC.jpg
f5f4e61e51166a052fa4a4e9d916f4e4
9597b92978dcc2be60914509906916f571773247
16494 F20101107_AABKXR reini_s_Page_115.QC.jpg
c9fb2acc87786388c9bbfc886f7d9809
69b34bffe3308f13783f1e360c56f412671a1298
28888 F20101107_AABJUP reini_s_Page_095.jpg
fcc50f5cbe8a1014763e58e479b1a45d
cd295b43b8327009659049a18d4c8fa29d2bc199
F20101107_AABKAJ reini_s_Page_035.tif
c04f1c4ef25a757e6c24272614bf2233
ebb40b200a187b6a96ea974b6bebc59dec15ec5b
2035 F20101107_AABJVD reini_s_Page_127.txt
e3c79fdd9f7e7a97cd5f053f92472b1f
e577c084c31b94a8b89613b8573670dcae159604
35706 F20101107_AABKYG reini_s_Page_111.QC.jpg
aa5ad2132c7c34543df40ae2b4901285
174194b9f9c5a86787aed9a7735f216fd9ae9220
36550 F20101107_AABKXS reini_s_Page_032.QC.jpg
0e9da14d353f8e8f4e3f452f11590326
5bd0eaafa94975e2fab3cce7f55ce5a64937ee09
F20101107_AABJUQ reini_s_Page_130.tif
386d57f0a3728e8b480edc8697a01f65
fe4259e210f619bd6ab0244ab81abe0f06eec00c
1139 F20101107_AABKAK reini_s_Page_004.txt
b5973f8fbf41400f059a0a7a4e05f307
d47ba768149acb70ce6b1513d25d5e41fc364999
35884 F20101107_AABJVE reini_s_Page_128.QC.jpg
fffc2162fbf49a2d1f9ba1f5b1a7e56e
79cebb50f694a13559561f31979a04a9f6204aeb
8691 F20101107_AABKXT reini_s_Page_109thm.jpg
b47077cf8e80a52fc7ac5b2c20622d94
2fa09e16aa321b0a45a12b9315c623cfd5027e6f
955253 F20101107_AABJUR reini_s_Page_039.jp2
2b6839f27075ecb1c158d78b82c6c5b6
b51e8ed3b8d2ad31e29418d02f171708c5f23ef9
53963 F20101107_AABKBA reini_s_Page_035.pro
473125f959911095bb362c387e20ef9b
ae5a3c10237bb35cab7c35e0dd6a2a714425489a
F20101107_AABKAL reini_s_Page_022.tif
8aa670c9f4596685d4dc118bf0278eb1
6f9a89440d1860034161c05c1b4af496b293b8c4
37178 F20101107_AABJVF reini_s_Page_046.QC.jpg
f0969804a286600c6a6117a8cc6f431c
60255518bb093c4407cc7eeaa4666456ddb59242
1829 F20101107_AABKXU reini_s_Page_097thm.jpg
0bb41e6642f9fbc7568a4cc3899fba05
4f5304724bcb194ab019c984b25bf72d85cf8ec9
F20101107_AABJUS reini_s_Page_087.tif
d55c5140ad912e058dbf66c7635bbcc8
e2bc8c2184dee5dc7701e8b191ecf8de36ca3432
56304 F20101107_AABKBB reini_s_Page_100.pro
53a54712172edc0cdfafd017f37a59a5
25cf18bd776f1aa702e3c6c8522dc9108b459d3e
F20101107_AABKAM reini_s_Page_090.tif
ffeb81b4649f5108e182c51cfb83b399
dd2da330f2439ead97e846b36c46d7aac0fe3424
99581 F20101107_AABJVG reini_s_Page_084.jpg
ebde157f5383f368164c11c2ca7f3269
39c34cd88bfd6d8f150da1b144004786fda0dcd6
8216 F20101107_AABKXV reini_s_Page_041thm.jpg
0d48d1a5d1afab6ae6e1190294f88ed4
a91f29583e113a39dd72453ba630096c623a7ef6
133302 F20101107_AABJUT reini_s_Page_132.jpg
8ca8779b4411a138f2b64dd391ff1d19
aa907b0039e0a33b3222075733429399b6c37fb0
2454 F20101107_AABKBC reini_s_Page_145.txt
badc26845d203a11ebb8e847658e4065
747d47439ee0531d0319c0b03e5d4a2d72045d4d
8903 F20101107_AABKAN reini_s_Page_145thm.jpg
3bfcf607dac81d5dc94367e28be3b10d
f89f480f6230b12d49fd1ae90046de3e7aa3a5eb
35838 F20101107_AABJVH reini_s_Page_136.QC.jpg
e47e7d6aa51b21fdba33bce852e8dc41
532bce79e4530608041732bc9990410de9b8a7c1
33041 F20101107_AABKXW reini_s_Page_083.QC.jpg
e5e901a312897603c4e6dd2609a5908c
e990ea57bb4583a2cb3d7cdbc2ccfc7972fa726e
53510 F20101107_AABJUU reini_s_Page_082.pro
32a4d1a2d1ffce269b09f9255b7a0aec
2f18550ef456e4d5eb8578a4b0d82605c705d68f
7132 F20101107_AABKAO reini_s_Page_010thm.jpg
4e5d4b777dee7184e59ae8d09fec96f7
1671105a48c0a279beedf39c79665f42e6518296
6105 F20101107_AABJVI reini_s_Page_029.pro
36cd7b5bfd5dc9c085d9ac527cab594e
bb143c0f597509143c1629625f1b31f8243b0ff2
37445 F20101107_AABKXX reini_s_Page_070.QC.jpg
bf7109d51c298a12223b6ffd7e9be228
ab25eefd2a369598f33f83e6ff5074738512c29e
2868 F20101107_AABJUV reini_s_Page_139.txt
2c1c36a983ccdd69482ffc73a14ff318
4f27e2edeb562ea6688130211bed4184009efa5c
F20101107_AABKBD reini_s_Page_135.jp2
622e6b99008e6556b4b5e28b17aa6e78
9dfa86525da7126b8c9fdc9d2301736488411d6d
100387 F20101107_AABKAP reini_s_Page_083.jpg
2ab46c886d23429952463c1c5bee9aec
1ab2c85b667a84127ff8532458b45c5ef8177133
F20101107_AABJVJ reini_s_Page_033.tif
23e73d19b975395a3d73db7d73ca95b0
624470d0077b46f72b7a2eae39cc187ca6ac70ce
9003 F20101107_AABKXY reini_s_Page_062thm.jpg
3dc8ea73b53c585274c7d875273698e4
f7fedcf65b315a0bad5cded5ea800ead7927d905
3775 F20101107_AABJUW reini_s_Page_094thm.jpg
a748ea56eb98dc19692f71e12270898b
653cab654eead5809c0ca7ea74760a9306001ac9
F20101107_AABKBE reini_s_Page_111.tif
5c14e69ed28e3f9e1111a48008927a69
96afa693814b9eff8078f4054d1f64e9ed1edce4
F20101107_AABKAQ reini_s_Page_024.tif
896a59a418b6108fe0f4408ec1ea67cc
f00d48d9d111eec92af19e83b7ae93beb149f209
9028 F20101107_AABJVK reini_s_Page_090thm.jpg
f8f42d9c85ab9db63f3c0bf327202fd1
85d0414dd35e4764157f0fadc70b6a22f5c75308
F20101107_AABKBF reini_s_Page_136.jp2
5555dc0b6c018eecd9651d46f1ae0b58
ed503bcdeb8f231990de907386a9f5571b92027d
22177 F20101107_AABKAR reini_s_Page_011.QC.jpg
88e1641f0f2b258c913dcdbdd4b45bd2
3892a4460b4d7358770864deb1e895e7cad6543f
677780 F20101107_AABJVL reini_s_Page_094.jp2
5de2fde0d4191aa67e7e2afa52a10a2c
febeb5ed75d424b2d59ad69a2df0646b4457d78d
8320 F20101107_AABKXZ reini_s_Page_009thm.jpg
f18cc2c35431c553535391b4c0f93d0a
ac260cbc59a9ba1b06d7f497de649cc6966b1325
F20101107_AABJUX reini_s_Page_128.jp2
10dabec6cf55baec0aa6672f8744a987
8857b75ddb7571f4fd275b61aa7c96f518ed9b80
2113 F20101107_AABKBG reini_s_Page_110.txt
584d32fc9e9493a96ee02763b0d55281
aeddc7372424b27ffc9125e931b8356b237b94db
116589 F20101107_AABJWA reini_s_Page_043.jpg
a7ed5db01e2f2491dcba583f36dd9a5e
43ffde7a24332c57ad55d2ade5a1bcbf7590cdef
1051960 F20101107_AABKAS reini_s_Page_017.jp2
38feb28f249b723dd07563e85a74fb86
ac486b5ca93827114a4c9557c12c43e0b21a0d36
55895 F20101107_AABJVM reini_s_Page_090.pro
eb0d0f5432bb8d6f8bce21c453e6ac98
73262ac5c4605e8ae4576a93a00685a86b84a6f4
2774 F20101107_AABJUY reini_s_Page_135.txt
a443fb9d39cfb8a11cd4179e91d2372d
3e463a1be27e7ccd1f84bc8b127baea557b663a1
112212 F20101107_AABKBH reini_s_Page_108.jpg
b77da2ced50c9e755795b8920103d2ed
12114f38d09878d2b888aa8362ada56ea0bb70bc
102895 F20101107_AABJWB reini_s_Page_101.jpg
ad5c36b7ff492cb5e161187e6c56992b
fb0ee3b507042324d7b83107562cc3b70b6375a5
35716 F20101107_AABKAT reini_s_Page_064.QC.jpg
8e9922565f3b62ed61ef9dbca8cfc5f0
12bad8c108b146a83519d1f509e35e285b3ee03c
F20101107_AABJVN reini_s_Page_007.tif
b15cfae0462f9c0c54182694c02ec995
e46a3379176f99123d5a4e7f53d7ac335abde123
113553 F20101107_AABJUZ reini_s_Page_066.jpg
e27ed0ce08ab65084ead5821057149c3
e6fa0aef0ef091ac1eb16f6211c1b3fc07e15573
8875 F20101107_AABKBI reini_s_Page_046thm.jpg
5f9a6c07b0dabd32de214547b899a97f
971eeccb73248074413ac23a9f1925d8bd3ea084
86927 F20101107_AABJWC reini_s_Page_039.jpg
05cb0c2fdb699fc6b8ade0cdac58b6ab
5c979705deee1c32add59a4337576e62389d9936
F20101107_AABKAU reini_s_Page_063.tif
75599120b34f97a7dc5009e2c2acfcdd
0939a87f86f2b4c52bc6db05440733a46c9b06ca
F20101107_AABJVO reini_s_Page_064.tif
797d9b25e45efc9f4e2ebc30afdebf89
fa370f161c2f024cfc7852d179cec7154bd4cc92
39787 F20101107_AABKBJ reini_s_Page_139.QC.jpg
bb9a22826f3ca79993f88c681bdb5225
e86fdb3184974228c46f9aee3baa9d9e2793b954
41548 F20101107_AABJWD reini_s_Page_105.pro
4a201d44334d431ad7db1314a48a5e56
b273885165a8f51fa46e0868d1ee929f28c65046
11679 F20101107_AABKAV reini_s_Page_148.QC.jpg
d577bb8c9e8686d791219af56f053abc
bb10d0652573df0d828021fae2f1674476cda5bd
F20101107_AABJVP reini_s_Page_015.jp2
d25a2561e90dbe011e77bd855c1590cb
415ba44943601fd77f9e1fbd321f481ec7403c82
4660 F20101107_AABKBK reini_s_Page_007thm.jpg
6a513a654b183577407f4d83b4c7819d
8ab460821ecd69eaed3e28d5656471089a735430
2031 F20101107_AABJWE reini_s_Page_062.txt
1abf31f62ed9ed255bb22d628ba17d98
e6c6953c5934aeae98bb6d3109fb47a8a22d4b6a
F20101107_AABKAW reini_s_Page_059.tif
37659e03bdfc1659d31396a9a5377bf2
6a07e9a1d772fb09edfa150275a6024ba35f94f2
38773 F20101107_AABJVQ reini_s_Page_091.pro
9db9de45f21819422830881e638cd43b
24279b308bb98ba9b78efb1c4d84367760e010b8
28150 F20101107_AABKBL reini_s_Page_098.jpg
1409eece98b90185c3cbfbc41a755a3e
75c77f354f4591ff35720db404c7f4f38b257a37
772302 F20101107_AABJWF reini_s_Page_071.jp2
defaacb6692b88b0635d26a8bdc5d8fe
b7dae0c98020ea605c18b6f7c4a28336d205491c
51490 F20101107_AABKAX reini_s_Page_062.pro
2d6211101cc35d51a52acce79f1ccd7c
7449349ea9a8351bed8f4105fec24b1fd6f8fbc9
16646 F20101107_AABJVR reini_s_Page_116.pro
04d31c994669b847195cc73f8e870882
e4d2ecb8342f545f47a7a1657c4e4cb0a12298c4
F20101107_AABKCA reini_s_Page_018.tif
5d5f4f2b36c0de19f20177b8c93fe4c4
78e01eb233788b500eb24ba52b7850cdbb4c50c3
527731 F20101107_AABKBM reini_s_Page_116.jp2
f373224da791152506709cb0fdd87f45
f7ab30b7b131b38ab378e6f3639bc50562fea0ca
F20101107_AABJWG reini_s_Page_005.tif
2d35413f32e4d655c70c6e6a83f9d74b
e731409e6cd6c598d2fa1f43897a791ddcabe0a0
98240 F20101107_AABKAY reini_s_Page_005.pro
f6def6d871811602a0d261949d9059bf
6b82e6c26a50bc9ac304f42df469ed875f28e797
36266 F20101107_AABJVS reini_s_Page_048.QC.jpg
f5ae50f7cb4b427f3674de93275e1f3d
b5e5236be2ddad2a9d672140ab883793b174c03b
21641 F20101107_AABKCB reini_s_Page_097.jpg
0df8822b36bc43b2151f8d7d014f43d0
c69cf276acb80e99e596f98f7a2d277d86a0aebb
1904 F20101107_AABKBN reini_s_Page_030thm.jpg
224050651030cf289ebad38b1fe05708
75bad54f4d14da18c523ed2103db5d9054fb3e7c
8751 F20101107_AABJWH reini_s_Page_032thm.jpg
bd9a5f927725a9e5903edcf45593b6dd
d80e7d3bada34701d6a5828817cfe98f5dbd7838
55532 F20101107_AABKAZ reini_s_Page_068.pro
473a26cb12137e36d7012f54a5be2b88
6be03274f11a7970cde15039550e7e346256591f
2646 F20101107_AABJVT reini_s_Page_055thm.jpg
2d53f13d64797659249bc0745d4a9453
9e179dfa4670cda968f7a13dae77073c9547740d
2221 F20101107_AABKCC reini_s_Page_107.txt
4dc33c661e87ae9a22eb03f6da300c2a
73dae05fb12e4af86d0f734b362ef74de0257dc5
9795 F20101107_AABKBO reini_s_Page_053.pro
d498c8b8490c2d4e08173ecc9f6362aa
96cc2306dce4c617d74baa3b7e8bffa2bff254ae
31378 F20101107_AABJWI reini_s_Page_106.QC.jpg
1b1179839c2504ea3088da478bd7416c
8647e7ea68522b5020a2640506c5487aa706b48a
395 F20101107_AABJVU reini_s_Page_055.txt
4ea7ade19977a00b8a186be7935926b2
6eb6c03171f3751259f563fd17f2f5d431d8faf3
8870 F20101107_AABKCD reini_s_Page_066thm.jpg
8a2c4428f7fca6fdd3c0d48410233d60
36e7baff14fee1d92b3ba1029beec2c593b75007
697 F20101107_AABKBP reini_s_Page_148.txt
b61bc0913473259f0763a79e89996dc3
fd0887ad490d98fe858af254456d458e0ef70df0
108390 F20101107_AABJWJ reini_s_Page_109.jpg
55742cfeb53235f5c418b7e8d58a65b7
8880602d8b76a067beb617333bd1e5b9cc2f17a9
54436 F20101107_AABJVV reini_s_Page_017.pro
1c58aab0238f1327e9cfd9434ef01448
143f5cf61ffeb8adb1afeb9386246994acb704c6
108399 F20101107_AABKBQ reini_s_Page_080.jpg
b2619bac296b53fe7c7717c56f8aa598
7f577d4bbd4d0a3cad66c67b59f2b2901d8ae524
F20101107_AABJWK reini_s_Page_086.txt
dd2f942a7ad6510138722b514699578c
619318abd282b444d40f5d21e061cd1381094a92
32705 F20101107_AABJVW reini_s_Page_084.QC.jpg
b856c28a6316c326e5bd8aee68874b7d
fb0c35c4663a83ae2535cbaba07b355f34c4e5e9
F20101107_AABKCE reini_s_Page_137.jp2
2aa0ca0b2a7e30b87bde4fb9f60360ab
536b1280a5eca0a61c690b109f037029083428b8
38552 F20101107_AABKBR reini_s_Page_130.jpg
bcd53233aa1f10cfd953b3ba6f0ef782
23f64d7821750dc84ed49dc69ab657df69972240
114049 F20101107_AABJWL reini_s_Page_112.jpg
845909ae767fb011113d216343ddf48f
e9e4be5023ccf9374cbbd6c7d2c55ebc3b683fde
3272 F20101107_AABJVX reini_s_Page_003.QC.jpg
3140d4d19b14584b5ec1a1ec08ad65f5
613ca2b5c37fbf676a99b3819470fe4cabeee744
8271 F20101107_AABKCF reini_s_Page_037thm.jpg
da5bff2dd5f848e2a962d9b406b75e58
5e1df1b57789b71921f219591a971e15138c1a96
46052 F20101107_AABJXA reini_s_Page_118.jpg
11b8224ee528862f4b7b6561b9a6ae25
e90c30ca017bfb1ad6b97fc8ab87837cfcaa435c
52551 F20101107_AABKBS reini_s_Page_038.pro
1bfe506d5a29250d7637c2253667cec5
cf85f0b51e8116cd94ea2e661eef4a5c7d18d67b
1597 F20101107_AABJWM reini_s_Page_074.txt
3d471c220838e8a7f59b15d11a8701ca
63bb64176881e7aa9025bc5dd4c73434dbdd53a4
91744 F20101107_AABKCG reini_s_Page_010.jpg
d71836ef8c601156290a50756ee96c4d
f44cea8d70acc4b98efb7f0041ae3bd2cdb042fa
8626 F20101107_AABJXB reini_s_Page_013thm.jpg
d3b383321296d596b75990751111e6fa
c573cbf8c24c19dec81e3ec814265fca1783872a
2019 F20101107_AABKBT reini_s_Page_064.txt
2476d3d436f4801a1507c5bf470144b9
e49d131433a20cd40db11bc3f9e57bfcdcca0860
F20101107_AABJWN reini_s_Page_148.tif
eb575239c8a9ed6cdbaf96e684db0862
cca67904e3c1eb3d72784a4009afdf73793b4e06
1973 F20101107_AABJVY reini_s_Page_084.txt
3d461b83de06dccb2e92508401c983a1
37a26afad23263dde384fdfdbe9c53c7f898da9e
36835 F20101107_AABKCH reini_s_Page_078.QC.jpg
b13873ce9688ebdf3f421fff37e20928
959e7411f551d628ac4ec714e0dffa551c1315d9
5008 F20101107_AABKBU reini_s_Page_114thm.jpg
9b80f4f64149f01503464c37ae6cffe8
2e20d842f6236c93987e1e6488aa80fb2f1c9bd4
7015 F20101107_AABJWO reini_s_Page_119.QC.jpg
9118414773758e650db7d3b39dda9379
8a840ea3114910c2c53434332097427e1a1ec735
F20101107_AABJVZ reini_s_Page_099.jp2
084e9c5e4aef48cc728c5486a2cbcc01
658c05b2f0e607e1110644d65841fec2b38664a0
F20101107_AABKCI reini_s_Page_118.tif
e1a0d07d47a5485a51f19013efd3157a
2ba9cc11e05d5a657138b19b71236d9f74b51584
57344 F20101107_AABJXC reini_s_Page_020.pro
4d6a4e5ab4a227c0a65be75e6805a125
43d82906cfffaa66f6d38ae9a6ab34827de5c6c8
8418 F20101107_AABKBV reini_s_Page_028thm.jpg
b1fa12fc4d0822db8592dbbf75aec2b9
1b85f2e74a173b6f00b367bd748636125d8a4e26
F20101107_AABJWP reini_s_Page_129.tif
a19e71f35c45b4ac6522c2e94d411ca3
ca61f1079740405b56682198ef241200a4ee5a8a
36383 F20101107_AABKCJ reini_s_Page_143.QC.jpg
304d5347a22d475f8e35fb7aeb9e9710
ace47214b31cc1a45b4183e0d88bc087f2544eb2
2867 F20101107_AABJXD reini_s_Page_148thm.jpg
059d661ba60c337d896f7c34eeeda572
c0c1965b8d2537897fb209a2e807031702b7c7d4
130399 F20101107_AABKBW reini_s_Page_134.jpg
8a21631f85d6778a3bb451a5da1855a0
cc3f5abe74e5f25750d6bcae83e1b62f08dd7326
F20101107_AABJWQ reini_s_Page_123.tif
fadb3031daf23ce8854c1c1dbe0140cc
9d0c53dc45cb02cbe5e246f3f3cac0143b9c8a3f
127270 F20101107_AABKCK reini_s_Page_140.jpg
2ad66bce43daf2a466aae100875b8564
368f9a6f0a9864f974ac8bc44fc6c63dcaff5879
39459 F20101107_AABJXE reini_s_Page_148.jpg
08c4d043b8666ef619366e645d2ab7a7
efb19bc6e8fb8ca7e48685455581ebe141a25a73
F20101107_AABKBX reini_s_Page_119.tif
cbadfadabc16597956f78306e3834a0b
042aa45d068e69717fe0440ce1e7e6d548adbe9c
53750 F20101107_AABJWR reini_s_Page_075.jpg
73cc1f886788e7401fb7e708a85ca86f
94cc48735a7e4a4bc05eb9bd4bb3e45a1104daf2
69688 F20101107_AABKDA reini_s_Page_114.jpg
0a8a893f1f4c4a46de0e464ab86bc47e
3b579a16ce35994c52958cf1cebd86c206fc1775
49792 F20101107_AABKCL reini_s_Page_063.pro
2e3617772f1e647fc01ba179bbde8a80
2f04c9500e2fef975c0c7b857d956ca89ba531d2
8948 F20101107_AABJXF reini_s_Page_147thm.jpg
b435955c4e7cdcd8579221172ea7215f
186f774a73a8e2baecd6c3a66c2a9702f658b836
35932 F20101107_AABKBY reini_s_Page_110.QC.jpg
61a74e10591cce494e05a43a09320f68
ffc4b9da7d77461a0c30c0dc327df1ea2b4f712d
56625 F20101107_AABJWS reini_s_Page_027.pro
7b09bcc28723e35941aa6cdf6c74fef6
9d8752a542ce122051fd53cae8c84e28617f0376
66888 F20101107_AABKDB reini_s_Page_007.pro
96aed1c3c0d291b5ad02005d0b1f5579
9ada43bd5737face9c7f13123e5783fac186bea9
8867 F20101107_AABKCM reini_s_Page_019thm.jpg
12acdb22582da379cf4d7d7d82339734
96f84049a253c4ee3c5dffb103afeed1e15e3887
2133 F20101107_AABJXG reini_s_Page_046.txt
66dc2bdb950356c7df7b46dc02de4af4
d7404b9f7412197b07769a472b29a742f1a55a19
F20101107_AABKBZ reini_s_Page_100.jp2
42aad88e90e3254e87529df7140d6052
519886d36e985fd06320661de8da64fe4d9a5a97
F20101107_AABJWT reini_s_Page_099.tif
a0c636d83d4ad85d7873e6585a305ab2
8dc2df8ec6f095175f2ced767658a7a2ff7d95c6
38454 F20101107_AABKDC reini_s_Page_088.QC.jpg
387e0eb7c2246025985ee8bb59814fe6
74bcbd6b2e26e81b62cfdc607d845cd90b765df7
105855 F20101107_AABKCN reini_s_Page_037.jpg
ac2ad6da309d3a711f8573e96d7fd6a7
7bf70c4e9644caf0ec018b9fcec6cf85c7d87df2
35245 F20101107_AABJXH reini_s_Page_022.QC.jpg
429c8e4bdb99f7cce66bedd38b136719
21114c77b858ca1d60a7648f1c17e6ed991505b6
F20101107_AABJWU reini_s_Page_041.jp2
d1b9acc5f34898ccfcfb3c6443a5cfb4
bd8e643eb744b93d46b6e25fde6f61cf7ed42ea4
864119 F20101107_AABKDD reini_s_Page_091.jp2
344a29b07258d57632b81968699ca8da
4d30b0df0d16e9b5b478abb16b914f294aa3e3e6
69461 F20101107_AABKCO reini_s_Page_131.pro
b8109f554e40eb9e97d4dbfb9a0a6de0
ef73872d2c3d4bb835ccc72a3fc4a621dd1265f8
F20101107_AABJXI reini_s_Page_096thm.jpg
31a64aa2f57fb532912e89044e8a4721
bb5a36bd21090507428306e6a35ee4b3f2dce77d
105081 F20101107_AABJWV reini_s_Page_065.jpg
f78805c2e142874499927a69040ff298
9a24e160c5251807591de006c8f909e9ce96e390
81461 F20101107_AABKDE reini_s_Page_091.jpg
d635fb8ba16081c965caa76fa7f34f83
5dae788144528f035167ea51eae1ea9478c2c23e
8871 F20101107_AABKCP reini_s_Page_020thm.jpg
4fef7193d67b80f3e08b67572f8bbf80
395c41dd31d1fa5764919e72d720d4c94eec0387
6786 F20101107_AABJXJ reini_s_Page_097.QC.jpg
6952b02cd247fdb09560a2a0c94b2213
76b3b6ce6e10e055c05392ee3aa6b0a7a2a70073
53159 F20101107_AABJWW reini_s_Page_076.pro
a133cb7331b098f8a5a47441b50bc11d
ca70ae66ec3c12ecfd09a9c3a75538922c7298f0
F20101107_AABKCQ reini_s_Page_048.tif
fad2afe521a4e62ecb5899ee4d99a32a
3c6bf67fb82e839a0d739805a0ffb8bbeb382dcf
90941 F20101107_AABJXK reini_s_Page_007.jpg
b0dd88cb288613181ac33bfaefb0b44e
4d838ff1f368466a3ad3282c2a2667de60d449c4
10815 F20101107_AABJWX reini_s_Page_056.QC.jpg
62f225c84ed40eeb049a1b3eebe80a8d
fb1f17f14450fd03ff0a6d7dd40eaeaf495ef79e
36870 F20101107_AABKDF reini_s_Page_060.QC.jpg
f2ebcdf5f4e3ecf7121536664ea401af
faa1865eb1e246e8e5472a88035520ac3aa80571
35417 F20101107_AABKCR reini_s_Page_013.QC.jpg
26b03ad3487d20bfc85f9bd10894ce62
3d84d5cae06d9d16209a6cb15ed14a4e202fd096
34951 F20101107_AABJXL reini_s_Page_127.QC.jpg
46f0f264e710a088f3642157829b0add
aa9e61729ed146c97a7ec76120a99fb135623615
9133 F20101107_AABJWY reini_s_Page_141thm.jpg
fdc658ee9cfa872aab30ca548d7fc625
96c50330be5d3ddfc89080551965cf35aa77aaa4
551 F20101107_AABKDG reini_s_Page_098.txt
97f86e0c7c2e2368235d10c04d230c1c
7d66d0705d2a79cd6732c4d07163e936548fa4bc
20272 F20101107_AABJYA reini_s_Page_149.QC.jpg
a8eda2ac0b37c0dec335786a235af688
bb20abfdc6f02d5f47544fcfcec806523169b6e9
35329 F20101107_AABKCS reini_s_Page_140.QC.jpg
073de1cc0f7cd618c37b7cfd4cebbb06
dfe4a258da181673b790fe29c20ed88ebb391105
105429 F20101107_AABJXM reini_s_Page_041.jpg
e82e6457655f360ba2e0c4560a6d318f
8e9d3562a4164b5a28c767d29edbf94387e5ee68
F20101107_AABKDH reini_s_Page_120.tif
86bd02b39f43438299277c5338e5452c
9d800fff5059f767e90c1f756267f3fce3b49973
175 F20101107_AABJYB reini_s_Page_113.txt
eebc2d940df505e045bdfc5e2f1b328d
804f46a8c766a4d25173dc0a30e46937c706e174
F20101107_AABKCT reini_s_Page_006.tif
18adcb5bd32e04fb339f4ed8ccee0751
09ff3cb4d70b6b8f8fbc652a0d50c960d9e0c284
36493 F20101107_AABJXN reini_s_Page_069.QC.jpg
164f1e1c8b7259a35995f2d3f94b67df
ed7df5a357ba673a63fe1a9771e14fb7fa0e2f4f
2192 F20101107_AABJWZ reini_s_Page_090.txt
3c728168a90275dfbe7d9951a386cee5
25c755898b672693693bda28169f980262642b6c
32579 F20101107_AABKDI reini_s_Page_072.pro
acfbe59b9c0bdc8d624327604d656bdd
1b42d8f872d569d7f7f7fca080a5d33f1ae06b4e
19107 F20101107_AABJYC reini_s_Page_004.QC.jpg
7bbbd4f84049a062e907abe648ee345a
f609c218534d87e77a70f3791166707671897a87
34596 F20101107_AABKCU reini_s_Page_055.jpg
8f2cae1ce4b58f22d4c1f385ab12a09e
e98a3d2cf46a7e972640172ce03c0620bc7ef4c6
2249 F20101107_AABJXO reini_s_Page_120.txt
6738a6b4c91cd6c9a61bbdd683d01e89
999abbee0b73443b26305b8ff0d49a4d1e5291f4
18201 F20101107_AABKDJ reini_s_Page_057.QC.jpg
77e8c00209954658c9a4f662b39a8f49
e39837900f48075c714e67163d71c07113ffc36d
34310 F20101107_AABJYD reini_s_Page_104.QC.jpg
00cd5a7439fc8dd42bd7f3967d051dbe
efd0bf8b5a9577359627937f6cd86c0cee3b6362
F20101107_AABKCV reini_s_Page_141.jp2
460afb599c526e8214a534949e7cfdc0
ea9a560d610f09b61f054b8ff966b563615a6814
8680 F20101107_AABJXP reini_s_Page_099thm.jpg
18d4f4be00221eb18a47146f3a66e791
37034958947e51ef8e22641c93076e91c1376aba
2114 F20101107_AABKDK reini_s_Page_035.txt
6f7b823023710af51b9bb324b3966546
972bfa7474d7609fd6e9c1ecf3d8e525ba90c605
1051954 F20101107_AABJYE reini_s_Page_014.jp2
2d5ee4599e15d8903f5bcd4856a7038c
ae6b1a7bedfec18941eb9f7c4a3c440ff89b5704
5591 F20101107_AABKCW reini_s_Page_031.pro
0ea4a2bcc68aaa8d222e9d20179319ba
a40c8252c30e97c6ea692ed932022067db6633d1
8756 F20101107_AABJXQ reini_s_Page_087thm.jpg
cde5b7314eacce00f798cff77a8e5f4f
7e1fe3007fff6222635667c0ea960727d1baa7bb
35262 F20101107_AABKDL reini_s_Page_109.QC.jpg
b9b7c3e7f2b8eaaaabb0c7a072eb9a6b
fd17b8ba156eac1971341490c4875b3682e64060
10480 F20101107_AABJYF reini_s_Page_053.QC.jpg
a7f67ab79d9323054b8b1710c65d816a
8c9bb24041e3dcdb34062f21ba13534f627d577e
2177 F20101107_AABKCX reini_s_Page_121.txt
28dd1e4c3a5d3b7eebf6575475b09e6b
c253babac3b6bdae5a7034f7429239ccf08aa947
F20101107_AABJXR reini_s_Page_026.jp2
3af435da8a09f6eccf853f146dc4020a
c10130898d893299adf772d906e43cd810a6d4e2
F20101107_AABKEA reini_s_Page_012.tif
331f2a72184cec974635d4ec04c1238c
09349d4f853af8bf42afde633ff164c1b858e1a0
55651 F20101107_AABKDM reini_s_Page_121.pro
9ebdd871bf845dfd58de9dc777401957
a76badb6d355939d7682e99ea516e16f580a75cc
F20101107_AABJYG reini_s_Page_037.tif
654477d049ff3ae479b8a159594da5eb
d1a53621734a37413976115a417646c3554dadd0
55056 F20101107_AABKCY reini_s_Page_108.pro
b09f9c199bc39cc18fb7c9452a033852
2089b243458706ad2d7461c6d2029ce9da441d26
9253 F20101107_AABJXS reini_s_Page_043thm.jpg
f6031ea48668fa9519c890f724624d7f
da511883384e427a95b41273cc33212a0eab145c
F20101107_AABKEB reini_s_Page_017.tif
fa55bc944202a88afef6ddcea4e95b2e
d4545928be05182f62b9aee9bd3c3284bc135315
55243 F20101107_AABKDN reini_s_Page_122.pro
931bfe5ad960304c11614839d2e1ba8c
9565d6563cffdad0c75ffefd569bcd05ced27050
13567 F20101107_AABJYH reini_s_Page_094.QC.jpg
852ea4e601e827c9ec053dbfd383db64
3ede16bb74abf32c97ff1e3ee609154a46bf8408
109897 F20101107_AABKCZ reini_s_Page_099.jpg
dd5badb7f39957c062bc8f9abbb980d0
01adedb835d8cd61a4eb5dff81b993595aaf04ec
7588 F20101107_AABJXT reini_s_Page_106thm.jpg
e432af2265b9f779d7158f106227b265
6b8cf8ad6cc246778e4b47e785f349d0dee19bd4
2240 F20101107_AABKEC reini_s_Page_060.txt
fef07b00312cc2bef987a3ea09f0f089
a0dab37f945952326b82dbe0f9d204afd576f6b0
116401 F20101107_AABKDO reini_s_Page_088.jpg
3aca130de0d5b2f76cd2abebeca174ba
71a8378ddfc54415c20e63d7b14a1c770196c65d
58013 F20101107_AABJYI reini_s_Page_014.pro
0aa34964cbcf17d6625043cc3bc211f4
0fcdb744510efda93810e48a895525ebf9722ff9
F20101107_AABJXU reini_s_Page_043.txt
6c58deb79b3dc2b33491e192871a5a61
15291c8fadbca5c39134400da5fbe2bd69169c68
2492 F20101107_AABKED reini_s_Page_028.txt
dd4460abdfa90cd07dc49b089b664757
1a0a5808deeacfe75f00da49d8623dafbcf5d3f9
F20101107_AABKDP reini_s_Page_123.jp2
88e575a1c4823e2dad5edb390bf88daa
43ac842e30e4cb15db245d5af3d3aaaf16867b11
2106 F20101107_AABJYJ reini_s_Page_082.txt
ccae516812afdbb6bc5c6f8779a031c9
a138fb3ddae444f95f9010181db6a0aa931048a8
F20101107_AABJXV reini_s_Page_058.tif
7fe34c4222c709980e717e8f8c6c05ca
01fc971898ea37ecd3771df816be8630495023c9
F20101107_AABKEE reini_s_Page_050.tif
66633e4c2e05800c419347321b3fec5b
6986b00e3d3af27a43def578167ee63d87053ccd
2080 F20101107_AABKDQ reini_s_Page_029thm.jpg
26eb75b59f47838be56df3bf8ab8bb13
5c5b4e215ce18ef9ba556e6210f07f2318cad146
510542 F20101107_AABJYK reini_s_Page_075.jp2
ce7aeeec5b5e29779f6cc77bc94d6871
6c079055ecb6f05cf47ffb4f63f0ae491291c340
813 F20101107_AABJXW reini_s_Page_115.txt
8ef5f44b9d87d6cd44c0348c2e1b21fb
36d7d80d975ce9ae8841e34162383f8461c8a600
F20101107_AABKEF reini_s_Page_066.tif
b996378d5d21df453d6db52e9ef28f7f
6845e473c0d1ee81999bfb8b4a674ba2bafcecbb
2153 F20101107_AABKDR reini_s_Page_078.txt
b08f44918b875ebc6072a653b74929c6
a2b097b2befd0db60ef36800819562aa8f7a0e6e
56199 F20101107_AABJYL reini_s_Page_025.pro
aec656d55c9ddda058c3b9acf3d826f3
b4ce670da4d070877efe650f72e41ce17578d931
F20101107_AABJXX reini_s_Page_023.jp2
db2ff88704c3084e74987a60f98ddd39
bdab210902af24d6491b02d31c35353eaad0b4f5
3712 F20101107_AABJZA reini_s_Page_054thm.jpg
35e273a0966e91df660d7fb6effb6034
cafc21178f29da1913d67e6f523cdba7ce808ce6
F20101107_AABKDS reini_s_Page_025.jp2
09e23c78067e21351b3a7db681e44cdd
a26f5d92b96a275dcb77b0f42827800f4c2bcad2
31446 F20101107_AABJYM reini_s_Page_040.QC.jpg
00805676d0ac05a045fa8541b2c77504
7f11589393eb66ceb0643a6cab26576bddd3bb3f
2417 F20101107_AABJXY reini_s_Page_095thm.jpg
4a786aba7b928c883760011ac4574750
209bda4aa86bb716905ded7111acea300d3637ee
1051979 F20101107_AABKEG reini_s_Page_076.jp2
8de18803bbc57d1056a66ca32589fcb2
e65d2cbb5d74e400a93e030dc5a1df262e6f69b4
9105 F20101107_AABJZB reini_s_Page_142thm.jpg
c26bf5d132299ffe8e87b8e6a260358b
fdab0eb49e3dc382b69210a4f5e4dcab9fc6441c
35922 F20101107_AABKDT reini_s_Page_044.QC.jpg
e67a63107b2ae5b61cb42c12b37193ff
516624db2077453aaa9b551610ba68f908ec3598
8822 F20101107_AABJYN reini_s_Page_111thm.jpg
6ae068f1cad76758fcc97bc2a7382e50
70bd1e5cf03ac44171c08c93c7d65c3f0431091a
56011 F20101107_AABJXZ reini_s_Page_032.pro
f11dfe9232aff8690ee97d24cc7bd68d
4d93c9de6a2faf6a0b47cc7dcd4d6baa48c964eb
F20101107_AABKEH reini_s_Page_060.jp2
8866e19ebfeb235ce01865f0f0b0e0ef
e4961bdf0133d096410b1d813dcd2ab305fd1293
48902 F20101107_AABJZC reini_s_Page_083.pro
17fdb70dff3e292a9bf5d6943b4cb321
146b8c82a3d58ce3809bf35a608e100f2e347a0f
37065 F20101107_AABKDU reini_s_Page_034.QC.jpg
718532844e58419d18ac78d579abc97e
798871b1f90e421a9147b56e0fa984481d93f90f
54253 F20101107_AABJYO reini_s_Page_126.pro
489b668489fb8da4362569fd5d1744f2
359b6438f364af853beea5db4c6ec4935239ccb0
1051950 F20101107_AABKEI reini_s_Page_085.jp2
fbe86cfc8593bcec4c5d5f672e54e388
d56de53a069187ed45d71752d63d8cb32d68952c
F20101107_AABJZD reini_s_Page_066.jp2
e45787888d0b485622ad862735a5da9b
b0f1891b58ab371d3c5f426011b7910b6a0e0c1c
1438 F20101107_AABKDV reini_s_Page_075.txt
07bfa75cea3b66b257797e42216fbe41
7736b748906acbc0767b7abafbc5da9f2ff2c571
1051932 F20101107_AABJYP reini_s_Page_086.jp2
352b8c9c8dbf19248a6f939c929ccc86
ff9df49fc70c603630b6269e1840fe072253a692
89257 F20101107_AABKEJ reini_s_Page_105.jpg
aed5a1fc782a326139c61bc9e8d927d4
09bb4f0e4a20a9c5071c57767b86ae15310de846
8569 F20101107_AABJZE reini_s_Page_065thm.jpg
a36b62c52f3107e04326de4c1d952180
8a31bf15fc35eb651deec88fb4090058d25ab1df
8783 F20101107_AABKDW reini_s_Page_120thm.jpg
4d8fce93d1d8325e9ed3ae047ea892ca
12ed37dfd8636e9e5cdaa4746276fd43ac72343f
F20101107_AABJYQ reini_s_Page_145.tif
7a942b6e9808e5e125beb1d4bdab1570
3fd6d865e82de7770a1d3c77b4401e4174b57270
1751 F20101107_AABKEK reini_s_Page_106.txt
37835aea34c071e48c38628cde1ae086
556d4c153ddc401c4d16e44e4b4428f24604a9d6
2003 F20101107_AABJZF reini_s_Page_063.txt
8dd190899d82805b32b73dbe765b50d5
7fc1d268365930dbcd1629ea88257d046cb9c616
2141 F20101107_AABKDX reini_s_Page_033.txt
9271f69f789b82205281a7c622d8a533
433dd92863da6118ba9dc8d670ee4febf0e8415c
120283 F20101107_AABJYR reini_s_Page_006.pro
06d1ba601cf9fd790f0edad51ecc1ab3
55c911b36693f92e15224f0a5d9a65f6468517d2
2008 F20101107_AABKFA reini_s_Page_081.txt
dd4659b60e1e369aa66ccb14e39880d8
28c9e88c43e2cbd5b89f7316f1c92945eb39b27a
9081 F20101107_AABKEL reini_s_Page_095.QC.jpg
3530f8956181f405dcd8edf8066002d1
cd3e62f9a2e2209093ec05b9af7da41da8291e66
667260 F20101107_AABJZG reini_s_Page_149.jp2
08c9d4dd58655915a84e8554880ac4ce
426486a5ac16902274e8149dacf4b4bee94516a6
F20101107_AABKDY reini_s_Page_114.tif
744b3a911ea22282ee792b9c1ac7e68c
ed66f81c234ce7888ded216341f0e3ab3a01cd3d
1784 F20101107_AABJYS reini_s_Page_072.txt
b05596b9a944d52fc490cfad77c6bb88
147f0deb71c788292b88756055ee0f946941a963
113166 F20101107_AABKFB reini_s_Page_121.jpg
1b24d38ce8f39de5497c9490bb1ba72c
7423f19deaa918fa483b44b882be1098d701909e
432 F20101107_AABKEM reini_s_Page_058.txt
d48c7a5b89e40a8e4f291d73c7435f4a
70bc1f9f132d5ee1121edff0a0bfc8770137c0d4
2166 F20101107_AABJZH reini_s_Page_048.txt
efaf5dd715fbbe4e49d472f9f05925b4
fd3b0abf64c720f2d91f64c6ec6ae20669d65cf0
9220 F20101107_AABKDZ reini_s_Page_134thm.jpg
3e9379d3e56b643d1d31ddd30b6959d0
d182ebbcaf1d6dee70eaa0796383b3581411e461
F20101107_AABJYT reini_s_Page_021.tif
b06c357713d6c2d11f17df71c3dae019
3e91146b3793868615a1f2a9b6252c1ae55799c5
37942 F20101107_AABKFC reini_s_Page_066.QC.jpg
6bd90f602a404ef23d6c379ac40d7fed
3dfe35ac81345f3e3ab09bee550890bf32a669a1
1051970 F20101107_AABKEN reini_s_Page_140.jp2
c3c1dfb282e59e4f1659858af7ccb9c5
de473eee2fcba91b205aaab7e3aa0f89c18c930a
9368 F20101107_AABJZI reini_s_Page_146thm.jpg
dbe06da2ea5a3b314855322539d0be22
219dd89dcce3176e86e70f97d6536fd6ed844569
18241 F20101107_AABJYU reini_s_Page_075.QC.jpg
148e4d2ab0556ed9cc9db04423534398
f9fa9416a107a026e8c816b32bac13775ed62d02
4816 F20101107_AABKFD reini_s_Page_004thm.jpg
e5dc5adc28f2f7b32eec85cf9e8def41
c1433ab84e5a79c5606b56247bd4317cbbd6322e
49786 F20101107_AABKEO reini_s_Page_103.pro
435b962e252d6d6a37e2b7b353dd0dd5
9695844909e1acdaea120f12f4d0f597fc432d2a
17273 F20101107_AABJZJ reini_s_Page_074.QC.jpg
2883dc5001acb3be1ae2306522cb820e
d38fce7c5bb24437ea2f2434f4cf3bb749468c3b
F20101107_AABJYV reini_s_Page_106.tif
f9fa1ddd7c07fd9f5a1efcb74d755c0b
ca13cd4b32262dd7e5adb9104d0dbeb5b956c8df
112123 F20101107_AABKFE reini_s_Page_060.jpg
8f468a2818ef45e8ecccc721678f4986
80f885a12a7f66998362c4d9c879bac8f1aa88d0
65999 F20101107_AABKEP reini_s_Page_132.pro
6925dcca118657786936a3e5a6b57ee3
ae3f258600ecec7f8e65cb2d2f9c504aced4d70c
F20101107_AABJZK reini_s_Page_143.tif
285e03ddf58e8cf75395ee7f158154c6
290f12f5e283d91d4098d5eb802f16be96eaf57e
1051966 F20101107_AABJYW reini_s_Page_005.jp2
519de97bb44bd46c23b169c423faa07e
e2206e6149ecc3198606fff2ad9928abcbebb1a3
8776 F20101107_AABKFF reini_s_Page_136thm.jpg
a3d364ec93343f87de47fad705130002
2902b3f2ad0b9829250317c647cbe1a06500ea08
2679 F20101107_AABKEQ reini_s_Page_031thm.jpg
e90f5766ea8392f96d84c2ef8bd69f30
9f5f6ddfef4f21a49f3ac5330accbf7f66add620
3317 F20101107_AABJZL reini_s_Page_051thm.jpg
87f05360c699778da456db174dfda79f
84a45749f22508a9d68c40c9252403e862209afc
108221 F20101107_AABJYX reini_s_Page_126.jpg
983928baaa665100694f3f6a50f5030f
375e2b1aa8c26e2a0fe04a69ee92d2b0407b57c8
2718 F20101107_AABKFG reini_s_Page_144.txt
b381f9443349b920d1294cfb927c7a4b
0909f9f66214e3e4dd0ac0950a56abd1f2391f34
2103 F20101107_AABKER reini_s_Page_124.txt
fa9d2086797560dc00c2907ced12dfe5
20ece975478bc307677d62a413bd90a14908badd
2101 F20101107_AABJZM reini_s_Page_026.txt
5f0f0507e22bba1d516835d1f3a5bab9
90bb033abc0003b42bd116ecbfc132d5350ea235
1985 F20101107_AABJYY reini_s_Page_041.txt
7147e3eea9ac64889ebb0ab38b6f2c5c
af55b64b6f27c7246cf3df18691ef43d4960ee84
F20101107_AABKES reini_s_Page_042.tif
d1b0cf870744c04c0d94affa31aee022
3278d49cb5c016f3e2e4c3e150c8c639a4257cde
F20101107_AABJZN reini_s_Page_065.tif
b7927b22703162f9da772c4df9ac8d03
c8f28baa004d83d9da1c03ce2f18199e09e5eb8b
F20101107_AABJYZ reini_s_Page_110.tif
5ae1af0a60121849a3f52dc5d7c4e451
610fdddd59827645eabc4762931e3eb121f81433
10998 F20101107_AABKFH reini_s_Page_058.pro
c55135658170df087788ddcf524fc2c8
f4baa1809540f8b4e8fc8153257f0f4058814942
9480 F20101107_AABKET reini_s_Page_137thm.jpg
54f50af02c1252d806c5e097bb279d09
b61b3271639caa054c13a8ce52e3432ef3645adc
115340 F20101107_AABJZO reini_s_Page_027.jpg
6902e6b57b9041d8c4ca821fa407e87f
329b2c53d372bf88c567a50dc7f090f553a81d7d
F20101107_AABKFI reini_s_Page_124.jp2
5bbd9af3f7a94cca72f17d863d36c679
f94a6e5312e134113ff1b9cffad499053a61925d
F20101107_AABKEU reini_s_Page_013.tif
2eb2a3d11266eebfbfd73a98ec5c4eab
0f3fd38335e9f8dfbe33a8b213a5762151c695e7
9298 F20101107_AABJZP reini_s_Page_125thm.jpg
1ffb0f22bddc6db708645773ad6da9f8
aea708ab374fcc52070d66a1dbb2a6ca62ef1fbc
F20101107_AABKFJ reini_s_Page_085.tif
43b1495729b5175e02e421292b68be8f
c861d1d500dc24a10fa28d3577563f4285977918
2169 F20101107_AABKEV reini_s_Page_122.txt
0172fc8c973909f173c7ee49aecfcfb0
cae00a23a5948f19d5cb52c3e001a6f6ff54fcc6
2070 F20101107_AABJZQ reini_s_Page_065.txt
e816467653c11e6a54dd475481ac4ec2
89b178ee2aab53dd447e2fdb7ff9d7baf9430c3d
37722 F20101107_AABKFK reini_s_Page_125.QC.jpg
efc6289c01f33e98460449774f0fd349
016e86b8341db9789391bee9374164733b697a33
13524 F20101107_AABKEW reini_s_Page_095.pro
eb8b2d840484d8f8cef9194feae68481
12b2fa5ee6315c0bbe4e7eb0d5f56d77aa5a84ad
1051958 F20101107_AABJZR reini_s_Page_063.jp2
bd36f8d0a6a1ea4426950533a99a89b8
77f6a90fd5ca17a6339c3a0b357ea465de9782d9
36758 F20101107_AABKGA reini_s_Page_068.QC.jpg
71d51d7b30e3fe87875f3137525c09ac
3e5053610f4fe9779527138ec6006df9193a4576
F20101107_AABKFL reini_s_Page_022.jp2
2c61317a8b9e112987d5078d89a6061f
e45ac58203c2cf361ff51f66b5568df639c4468c
45918 F20101107_AABKEX reini_s_Page_040.pro
369c2adb59412b3e4dc89ff5aab361e3
55825d76a1f4fcd98de8cd1c8237f30cd92c13f3
F20101107_AABJZS reini_s_Page_041.tif
912f1443bfd9201a6c33afbaa23bb20a
4769754cb241db19ff43a1f9bab2e3f876e8d69f
1051971 F20101107_AABKGB reini_s_Page_009.jp2
92262bdb63df19baf02a752dab2bdf7d
774001e5fe7cacb79b01f782b21f7567858a5ed8
7615 F20101107_AABKFM reini_s_Page_105thm.jpg
80b809e8461f094dae4d5dd8f9a6627f
71b3f4c3a3c1b72dddf377ab84c492df4a70680a
28576 F20101107_AABKEY reini_s_Page_010.QC.jpg
353c180619dc227079a6065fc24cabe1
c46273e7422b01981f18c9d9773684480070b398
941 F20101107_AABJZT reini_s_Page_057.txt
2b6ee6390c349d0bb23ea8b6f4fd1e90
628b69d10af2606dbfd8b4e8f8b81045431b81df
221952 F20101107_AABKGC reini_s_Page_119.jp2
38f0912340f11c668e74976e888788ad
7f8537b37abb14e1c0ace536c09b5756f52a6974
9352 F20101107_AABKFN reini_s_Page_135thm.jpg
b8b00fc89daa7de41161a7b9a835ba30
2a9eeb7e3bbd7852494102e3f85c50c368d29e29
1051927 F20101107_AABKEZ reini_s_Page_065.jp2
5fe676950281f764931d2692a5b6e64e
8d5153b7e908e9bb43c09095b89916dec6a43ef9
2111 F20101107_AABJZU reini_s_Page_036.txt
b6e99868107485bf1dc2c131ae13008e
e1d089347c9b5071c413445de278b1335c2cc660
8831 F20101107_AABKGD reini_s_Page_048thm.jpg
167fb0a67a05b7c4f14669cad1a8f956
7a9a3f267331ddf7c8bfbdf0a676e314e1727b29
534 F20101107_AABKFO reini_s_Page_002thm.jpg
8e1ab3183d922a49c8a18cc022a0b9dd
f98b148b5b24c99a0424d201fc0ec2cce7d53c45
10040 F20101107_AABJZV reini_s_Page_052.QC.jpg
fb4ef5377c215fa060b3e4b604bd9f0c
95a101e12a68550221e5d24d5a68efc2d0b3974f
7886 F20101107_AABKGE reini_s_Page_006thm.jpg
196e4d5366043c11327b10a8607c2181
323c496bf8edc6c0aa6374d641c4d1b4d8dceb4a
38776 F20101107_AABKFP reini_s_Page_014.QC.jpg
e41a13525bd88df6cbc4b080f504fea0
fdaa675556b11218a56eac6c0d62ea56899018be
57558 F20101107_AABJZW reini_s_Page_034.pro
0d0277816c22da637f1dc732e0e7bcd4
1b03f060e91c65fd507ca01905d8764ccc7095a2
8557 F20101107_AABKGF reini_s_Page_079thm.jpg
576001b87b803512970a85104b88e358
bb5e7eb86b23678539a5b9b6727c339c5eaaf2a9
110888 F20101107_AABKFQ reini_s_Page_038.jpg
2aaf80f4d00955a0b419eebc484b2cc7
4eca398e95025eaa12694c73ebf423aaf98651ff
26457 F20101107_AABJZX reini_s_Page_001.jpg
adc213911af567d3a609e3f5d68e8f1f
5bbd50fd791ba21fd0afcbb145f38e0532818f01
262164 F20101107_AABKGG reini_s_Page_098.jp2
68ecee60b66c5bc9bcc92b3dd90904e3
73ace49affdf7cc28f9d646a3ecdca798e63c979
2768 F20101107_AABKFR reini_s_Page_131.txt
149837f6b7810b87be7ceeb0eebb1cf4
94eb632f4cc7169b23af2430cd32959ec5d96967
F20101107_AABJZY reini_s_Page_055.tif
3501a9b4bd01a32be18c6346f8c74d1f
cd09be8f4fdeb242493f751b176068375bd8f3d1
1051937 F20101107_AABKGH reini_s_Page_079.jp2
0b93a9808a6f436283ee3d179be9ce14
5fb03a73bcb3fa3395fc597add66a752585aaaf7
9096 F20101107_AABKFS reini_s_Page_034thm.jpg
8783d9dfb7c495b79f5282b581050df9
f2d2579f2b85cb6bdc0db8df0b54bc57ff73ac07
401880 F20101107_AABJZZ reini_s_Page_148.jp2
1b1684e02ae5da4dc61c07cf5afa401c
a5fa36076ab15b728454df5e3be3ddbbf3686357
29909 F20101107_AABKFT reini_s_Page_039.QC.jpg
8ffe7b866d6c5f09c283ea704cb80ea5
efb7018591af4eef46c3e774476f57b2739f973b
F20101107_AABKGI reini_s_Page_080.tif
083bb085eeb87d7674a29925f97de7d5
37ee8d286a6de3977917842d7adf0710557e791e
2275 F20101107_AABKFU reini_s_Page_049.txt
ebd20e650e2effc3aab82449b15eb287
72c4007f57dd401174cadde33d11c4b6ca961b68
109155 F20101107_AABKGJ reini_s_Page_111.jpg
3d1ad80c87c4c5eed332eed76b2a3637
04d18cc1763a1d689cc53138b002099ccbadb6e6
6611 F20101107_AABKFV reini_s_Page_050thm.jpg
2babfba23c6ac054ade43d42ca75a5f5
248c56b40226bfe2a56a9ce7f43273779e350476
2188 F20101107_AABKGK reini_s_Page_024.txt
b47c59299151c5931aa745ecdeaef1ff
1a71a1c839c4cedd72bc5da2979bec723821cf0f
49526 F20101107_AABKFW reini_s_Page_084.pro
d0159750c81d6a638a39706889fb09bb
69bf3346fd1c4f5aa334e37eaf4d3173561ffe20
63686 F20101107_AABKGL reini_s_Page_136.pro
41c30f55850326de5dbac27bbca505a5
7c75f0d94c200cdbd12654b7fe09554f2f46ecb7
F20101107_AABKFX reini_s_Page_043.jp2
59bc1153a71265f6e65f89b96bef9f12
fb44c204790cd637e501e5a631782b2d3165f808
F20101107_AABKHA reini_s_Page_104.jp2
cdf6fe7580f58e7f6a0eb2bc2735b767
4a254bfec3686c9e9c905d6e60efa47a6434b356
54844 F20101107_AABKGM reini_s_Page_018.pro
4ff8ad690eef4dcb56f26b5c31d48d96
1ee84e92976734fcaa971a1ce4d51dfaee1e8791
2304 F20101107_AABKFY reini_s_Page_032.txt
422420459687e16b13819063dbef4c08
90aee75f1fb1d88fb6344ee2e4fb76820176745a
8658 F20101107_AABKHB reini_s_Page_001.pro
e288e6687a0df8765cd1683afb583a2e
9eedcde795ba78664556f25bd0c6cba61baaa8ca
2260 F20101107_AABKGN reini_s_Page_020.txt
1891bb5c1d1d0c914d41d0ed64d2d8c0
8a1985a49c622dfc8fd37a009558e8bf684fcb68
110400 F20101107_AABKFZ reini_s_Page_018.jpg
72ff16a9b90bea75b2dd08e6dd27206d
610dc35fda50609a5e8d208e28c2e169d4990b16
1051964 F20101107_AABKHC reini_s_Page_138.jp2
2da97a06e239f3eee8d7e83814f7ddd7
0eb8803e827f255173ff8799ee6772321586ef9c
1981 F20101107_AABKGO reini_s_Page_083.txt
72f401ee9b5aa9110a9a7ae87dea45b3
96e1072904021ffe6be1c62df4ae3365052b1a9f
962140 F20101107_AABKHD reini_s_Page_105.jp2
9ebb767f2727e9d91890381e4b9dc721
d7a4940d7ed239f9a5ba11cc29f478ec11046352
1051977 F20101107_AABKGP reini_s_Page_018.jp2
5d85223fba0d1fe1caa0be997bc930cc
7b8ce6c01079530f334050941931b7be0efc3fbd
36324 F20101107_AABKHE reini_s_Page_089.QC.jpg
9f52c76eafe2e31207139f33c3143b48
e7c97ea72726012134f463f08af1dab60cfd7d01
2556 F20101107_AABKGQ reini_s_Page_136.txt
c4ea15f7e51148e65e4cca2405e8802b
606acb087ae28e0e8a86f40dbe6b90900a9a70d1
F20101107_AABKHF reini_s_Page_036.tif
83730f44584a9672dd1ccfd2b49d7640
044d34daf529465288f350a032dddab3c6f4df96
35842 F20101107_AABKGR reini_s_Page_038.QC.jpg
ec18602c0592ec0a41964cadefd48022
08f48174e09c1af874f6a0fcd2e21e45368a3303
38456 F20101107_AABKHG reini_s_Page_137.QC.jpg
8343080c90226f594d7252382adcba8f
49c7090be84238b0eb806fa60c1591f5fff67da7
33523 F20101107_AABKGS reini_s_Page_101.QC.jpg
cdfb96a1691abd75dc9247522a305e12
9ea70c1cfed87618af2edb357d0eebd04cdb1a0d
8864 F20101107_AABKHH reini_s_Page_143thm.jpg
9e9f31472498344e2e000e94de657a42
d712d72510a135eec67405cdd6732f3847f105cf
65345 F20101107_AABKGT reini_s_Page_009.pro
8cf5c1bf1701d8b699cceb7e588a5555
b28e90c2a2e424f648dd295a8b7985a706858166
2109 F20101107_AABKHI reini_s_Page_123.txt
6488e9be7837b7e6ea0b09b0ff213234
2aa7730a4fb81aa60c523b12f43d9d99516d3007
37885 F20101107_AABKGU reini_s_Page_036.QC.jpg
3eefb1d117795a22646de79469f52613
9d4d65489fa116cb9ff1f7e10bb7ba5c8a392418
40396 F20101107_AABKGV reini_s_Page_050.pro
fe00c362cad27ee250aff36986bb5f8d
e9bb7bde44d21f515e093854d4d2dd1d00cca654
53830 F20101107_AABKHJ reini_s_Page_022.pro
64ec409b4be3f14fa9bb948e25e521e3
6a9f72ef0baa4a316afac1394c640642ce0c7042
53259 F20101107_AABKGW reini_s_Page_061.pro
37d800aa2b85f072c9596e534b4e3142
8594353aa26a221bef01d92a459072cd519abbf7
685643 F20101107_AABKHK reini_s_Page_057.jp2
99ecefee224b5ac2c4c1c5f5b4a69d1b
aa56ebb5563f336c8a5b386e507452bbcda30de3
107068 F20101107_AABKGX reini_s_Page_063.jpg
20f5af253748a38cccd306441dc455bb
ee44b017de1a946be8038ed0a2c05bdc2a918686
27040 F20101107_AABKIA reini_s_Page_091.QC.jpg
4884bba87668b16a840861bb06364ee9
93d8ed47c9bda06e5103267eadafb0fc2b06a6f6
F20101107_AABKHL reini_s_Page_084.jp2
443ec76123d99dc38617a1987da076b9
30d8fdaf7ad828778fd38bfef5c44349c793cbb8
8427 F20101107_AABKIB reini_s_Page_103thm.jpg
53802b6105e9b72af1bda0fedb248ad8
5cc901ddc561e0d2dd99a0366c4f533a4dfaec6e
F20101107_AABKHM reini_s_Page_089.tif
c427123be4b33294482a12a68e08cdd0
04c1d6c43a7032de4b7449748be5ef0a1ef10287
F20101107_AABKGY reini_s_Page_074.tif
a591661db2cc52fd44935b978e1c037c
1800ff69518f7dba8e5282c4f52545a1bd37a8c0
36530 F20101107_AABKIC reini_s_Page_086.QC.jpg
4d77327a4678a34926bb2238676f0778
21d2fd47d357cfef1fa76c6dd00ca05e937c99fb
52524 F20101107_AABKHN reini_s_Page_111.pro
83c972771c46c4b865ecd3c1226dc4af
e3c180354fc648ca533f713744014106e5b580d3
54537 F20101107_AABKGZ reini_s_Page_013.pro
5f8735b0ab1aa4a4a576411c66a9d673
c7ffad98650fedc3d273409c90456b965c148049
982023 F20101107_AABKID reini_s_Page_106.jp2
bd220f8ef5352400ded816acf485d9e4
edd506d42a30bf90cf5d2ca0442c774baf6af8dd
108161 F20101107_AABKHO reini_s_Page_087.jpg
a656036998d01a18de20fc8c23c14e89
7d6b7b94e62924f72ef222bbf1913ad7180e3b7a
58809 F20101107_AABKIE reini_s_Page_093.jpg
fe2fd0e71f613158c76a0c3591f8c223
d6654f9db6e0b64dea47ec0bdff94e0890025fab
F20101107_AABKHP reini_s_Page_126.tif
fefbed01bff4a3a4e0c841012862d51c
efc48fcb5009206a132533bdff7ea2ecdb425627
F20101107_AABKIF reini_s_Page_091.tif
b567bbd52845e8dbd7e955861989d5cb
1b680f37a4de35cf3c3931036300e7ee4e25a217
9990 F20101107_AABKHQ reini_s_Page_055.QC.jpg
dcc4e84defcc4fad32edb32daacefdd6
69530f018294d07a03a099c8775eac8c65913781
29123 F20101107_AABKIG reini_s_Page_005.QC.jpg
3b3f9dbf18de2370865ff62f2e8fd875
dfe3b1ccacf3ae2f2cd2a74c3e9ff914477aeb39
2128 F20101107_AABKHR reini_s_Page_102.txt
f9973a53d9517d7ec162a47566c660ce
f832a488dd0bae0d122a2971317b20e7d123fd5e
8409 F20101107_AABKIH reini_s_Page_042thm.jpg
6497db552c4cbe4e0bf43be62a8f843b
5ab5765cbf869680c1fd8d1a628e8235a61474bb
F20101107_AABKHS reini_s_Page_070.tif
2dd75127a1667ae69601bfc89b5a0295
d79d939d9fadb6aafb135dae4885f4950fdc7d2c
1630 F20101107_AABKII reini_s_Page_039.txt
7e2254e70bcc255ae40af6a4885497e4
1c258fb24f9e97142b6db3f23f67daabfa069414
F20101107_AABKHT reini_s_Page_076.tif
ed965f3f631eebcc02615bac8b1f5372
e337d44edc6dc1994c2f5e1653f983d633ff8165
576 F20101107_AABKIJ reini_s_Page_094.txt
5639ae144ff91fc32d01fb7e087ffd30
59172f68ed291a7eb653481078b19832286523ed
8681 F20101107_AABKHU reini_s_Page_127thm.jpg
4314cfae1d83abd3996ffe6d46f4eb5f
c0a1768e644984ff72a261b8ea87c0feaa44e1be
1830 F20101107_AABKHV reini_s_Page_040.txt
a1d6ed8a87cc14f2afc38c41afbca9eb
519e670aa970b7f08e5e0fdab364f03a4a7a4f5e
1044792 F20101107_AABKIK reini_s_Page_040.jp2
5f33e7f95b7c711e2ba9723a315524f7
b14104b09b8b9540dc03383726da881f77b49c5b
326928 F20101107_AABKHW reini_s_Page_056.jp2
b036212436c91cb7e4aa3bac76b70a5b
45642ecdf2ef5f06057ecb18a340e468dc1a3542
18324 F20101107_AABKIL reini_s_Page_073.QC.jpg
11fdd0c1ff72d0e3341ef2c6ff931142
59e7b6aff064931094843812ae771d7e93b7e0a3
F20101107_AABKHX reini_s_Page_096.tif
4b2bdaced208464808bd499dcd62b933
20b17ab5e43b2a3c1acd50d2a9fa3d2c0fc2c0d3
2118 F20101107_AABKJA reini_s_Page_022.txt
05f0430f48d9a4482a3ac1dcd5c128ea
dba68f83f91ca91a9eb4edb8b3696032390e2001
36479 F20101107_AABKIM reini_s_Page_107.QC.jpg
a44c8a7dbec78926d74dd2dfc9ab3c52
86c79e20104ab8e354ad015173fad20559f696c1
F20101107_AABKHY reini_s_Page_035thm.jpg
a5a74b115ba25e688e229bf75a4c76b9
d14481359c07ab82a4080eb1d0fa4471b32f214c
F20101107_AABKJB reini_s_Page_112.tif
0e0cb2b32c2ffadd058ea09fd584539b
6086a9270843c6f628b3bca34b2a8da2b9bcd19d
F20101107_AABKIN reini_s_Page_142.tif
42c356f83ce5724235d2cd0c08d88849
46f1ce92505ca6651c1f08c62ee697cb3eacf143
7478 F20101107_AABKHZ reini_s_Page_092.pro
fea7ac299d7756776aeef750e0f23570
634f3abcad1c285d19894b5f2038bee5a759beeb
55564 F20101107_AABKJC reini_s_Page_112.pro
ac320ccd7bc43ca73e1dec30b53d61ab
b17fbb407bf533435ba39e9fafa6118aafac97ab
733681 F20101107_AABKIO reini_s_Page_011.jp2
0c60a3f1fba128fbb0ba10cff28c5c15
c83c5f46f1a92990e151ab895929efdd3add54d6
7328 F20101107_AABKJD reini_s_Page_031.QC.jpg
b3d6ba67c835973b45c19dc77186a1d6
a4d73b0b4aeefa08e3dc64894c64be8f7f574822
F20101107_AABKIP reini_s_Page_099.txt
ccd5a2be2618a392fd52c3b0287e080b
1145ba0db34d90b8a7bec62b88812f9971e68434
1863 F20101107_AABKJE reini_s_Page_059thm.jpg
e512885628b8e46d0ac2b64ff8607cee
93a54880d3d489b17c1b85b180d7672590d7f557
69311 F20101107_AABKIQ reini_s_Page_135.pro
f019679e643c04e4a06cabb876c53062
abde6ccdbbc698f547abc43bfbc406dbcb83d590
709 F20101107_AABKJF reini_s_Page_095.txt
0843552f6ebc0297de3cfebeb0bea1a0
2c40a624c61f669d116b92e1aab0548a950602eb
35899 F20101107_AABKIR reini_s_Page_090.QC.jpg
15931f965708e2b5090754e35af56d3d
a1d021425b25d1f21ed5fb5dcaa027c6d9b9bc74
F20101107_AABKJG reini_s_Page_067.tif
38f25adb29cd458f35040b28d99360b9
451a65ef3f3c84b4e00203311b2f3380e658aa4f
109550 F20101107_AABKIS reini_s_Page_019.jpg
7bfbd1d797af4425ebd2a7966d975e70
3b2954c5f6b7a483df8f0ad73dd2665453fab988
55183 F20101107_AABKJH reini_s_Page_044.pro
25a7c1bdcb5889efa83f289e8c9ac1dd
d0d623588c204b1d2d1494ed3b332ebda5d73c1b
7100 F20101107_AABKIT reini_s_Page_005thm.jpg
710b681c3db44a382f9810437342058c
c46f3a5832be9ba99e116f4011dac5f569ee637b
F20101107_AABKJI reini_s_Page_017.txt
a770ac41e61fa9b23f32da4e6ad7729c
0069dc4090fb837a1644824e2c8fe419d6a4f825
1051972 F20101107_AABKIU reini_s_Page_061.jp2
9ce94845ba112e69def770d42bf3648e
e162615890e2bc76ba7a1f53aa3fa0bd04062135
58353 F20101107_AABKJJ reini_s_Page_049.pro
c6dc00b7ef25141bbb07451d6ebfbd83
3b25453b9014734ca17d0eec9746aa866cf2d222
F20101107_AABKIV reini_s_Page_027.tif
b19a81b92f62338f8729b7223bef2a82
c4509cd08ec0c481694a088522c5e9148dd21f9a
9099 F20101107_AABKJK reini_s_Page_100thm.jpg
eaaf653cc5b789cf8ce01d5dc1360c3a
2980b07edc0b06fa3328b110b5c78c9895ae1c0c
F20101107_AABKIW reini_s_Page_009.tif
469fca1bc5a9435ad351c42e69ee6aa3
1363e0d0f4e1af7d2dd0455d33c301bdbc52c2b7
535830 F20101107_AABKIX reini_s_Page_072.jp2
f81d59eabac0b758e7b9d2bfe8b322f0
22fe8eac910f1ac07ce0e54d0d233428ac584d2d
2100 F20101107_AABKKA reini_s_Page_098thm.jpg
8164c10010643ffa70037ad84afcb844
db9260a30743441bd5f90f9e1600148e7888937b
F20101107_AABKJL reini_s_Page_062.tif
40fb428bc7a995070f92fd7fe3550669
d82fcb555c148f040e4fb67094e8670b482598f8
F20101107_AABKIY reini_s_Page_077.jp2
ae14c24fceb01fe806c4c7ae3fc28d87
34d60415df16f8cac538879713a8c3e1035c1d10
F20101107_AABKKB reini_s_Page_044.txt
be9f9ee77d496914d194f11dd383dc1c
88d920e64984c8a524482020e441f1dd90b32c02
F20101107_AABKJM reini_s_Page_019.jp2
61c614aa645b22938a4e936ba8a1fc3b
622ed3ff1fed7c20fc3ff922fe89fa184f2a0acc
9372 F20101107_AABKIZ reini_s_Page_097.pro
8063ac2221046ed1948e1ae3daa41750
f4f04f5f120629842cb86bb691967077f0bc4ac0
52944 F20101107_AABKKC reini_s_Page_067.pro
5da94f314bfb0f62eb3049f258406266
666d6b24fe965702b17e07f262359e22cab7c887
F20101107_AABKJN reini_s_Page_024.jp2
66982ccd44e2a5076f94697520adc48f
eb059eb33eb81f5da5fe9f240d3eff36ec395ada
63231 F20101107_AABKKD reini_s_Page_149.jpg
bc154445b477ee8a811549ad353e4ab1
29025f3c8b2f16cf7081c33b6a276b0fe12c32de
9375 F20101107_AABKJO reini_s_Page_132thm.jpg
16ffc58dc4ec52f883bcffa1d9278328
49be670fe08c3ab9118b1faa717da1dd21601ab9
55424 F20101107_AABKKE reini_s_Page_024.pro
fd725cc8610dbcf64bb3a1fed87ddeb6
d7a51883c8d5a9bbb986faf1a20e1fb5b7470506
F20101107_AABKJP reini_s_Page_117.tif
b9de2ff4ab7123545da4a2a1c3e175c3
ed4d37352c4ae79cf4e8b377aa28b664e55f8df2
49753 F20101107_AABKKF reini_s_Page_074.jpg
b719164987fd4435fba7a3caab802351
4ac4c3d7d768d872ec562c09ad7169a1da0e7677
F20101107_AABKJQ reini_s_Page_053.tif
5cd1b6291b4258309123eb5abae62c98
c4e9f7a7aed510e4ec28d436c395c7ec9d7d2d41
51161 F20101107_AABKKG reini_s_Page_064.pro
6933b2d44788cb1e753b2ba789106c0b
5a92e017086e79bafb5cb4c8f757cc1bfc9faa2d
524 F20101107_AABKJR reini_s_Page_097.txt
9b3221342bd26bb90ff0d468a8b35960
4a7a2e77dbd7f82d031e2847b2aaa34b04b52901
112445 F20101107_AABKKH reini_s_Page_025.jpg
a738a54556ba6f48f96a0ae4bb47452f
1cf0562943ba60e7149a2f75aef7ae445a3c19f1
F20101107_AABKJS reini_s_Page_112.jp2
f08c9f8b9e08d7cfbf08f5fe86be383f
808b04e1f04a4e22ce70c4c6f12854e1f27f409b
F20101107_AABKKI reini_s_Page_045.txt
211f951e920946e69f9d790711a2a8cb
44a7f4c2eb79f1b7acc5b14938f4b4e03a86fe60
35799 F20101107_AABKJT reini_s_Page_129.QC.jpg
ee50f0601e960ff1cf6f3dd0c129b6fc
1759f41edb3bc2a2c7edd98243f5e0775630bc10
50205 F20101107_AABKKJ reini_s_Page_041.pro
cbdf13c66e58420dcbf92d1e478ea94d
92fde2b4223acddd64bc7b8f2fc2e1890e75e520
24310 F20101107_AABKJU reini_s_Page_071.QC.jpg
85fa8854f36e3932039f7846bb34f846
dd8c3ee0cee344e7b9c38b57d557e0774f7604ea
113354 F20101107_AABKKK reini_s_Page_024.jpg
5685bbbc084b1b3cd631bbc8849b3c7f
b6b676b41fd583b0b238324f53675365e4bfd540
63425 F20101107_AABKJV reini_s_Page_147.pro
b3c6aa8151e9097554b0fb3022c0a16f
35ffc1d7a28e694b3e98f327bd05b766e750f49c
293779 F20101107_AABKKL reini_s_Page_052.jp2
53bbc8bab01ea277259af84d810a452b
9647715fbbee924dbd881a24234d795c49dfedfe
F20101107_AABKJW reini_s_Page_076.txt
af227aa5481a5b9956cdd77d98f8552d
4ec9100cc14250f326887a84526c9cab0f5d66eb
F20101107_AABKLA reini_s_Page_081.jp2
d521be371339835dc64bad288be315c4
827436c91ed37d32475f2d818eb6b18a278048bd
37138 F20101107_AABKJX reini_s_Page_015.QC.jpg
27d9d5914dcce40c700d90aab5e8170b
4f6e56d7433f8249cfa408c900770b4c4d38833b
F20101107_AABKLB reini_s_Page_143.jp2
10149c67b5c6dcfd66df5fedde43ef1f
89d58738a634a97175621e42672c6da04bd34db7
F20101107_AABKKM reini_s_Page_064thm.jpg
18c270acc5056e0e8dc81b62afed4ae0
c86c3a71bb558baac9060b69be27bc93273db84c
5887 F20101107_AABKJY reini_s_Page_071thm.jpg
c029c99989ac49c18ef80dad164a1866
06178122547b30614c6da483cee547ea55cd8715
F20101107_AABKLC reini_s_Page_032.jp2
195625ef55f422b32aa3ac2aa41beb92
015a55951863bbe9880706e4af41ca4b147dfb1b
8622 F20101107_AABKKN reini_s_Page_089thm.jpg
4fca64b176789ec0af9b948e6d5e3187
b6e95405e0b04d13ebc50bb585207c70b340e95c
1205 F20101107_AABKJZ reini_s_Page_113thm.jpg
b5131ef398443d13f46697f8b33ec710
5f6734c1d9b0b4081e412de89e61c65bc8e8ec16
633437 F20101107_AABKLD reini_s_Page_004.jp2
a0ee12609b2711340dd9a32f51aa1d72
f2651cc5f8d3533f5835a63e1d1c12ab47013d10
F20101107_AABKKO reini_s_Page_016.txt
03c2bca03a98cbb5fe55e0e7507458e0
0b4ab92b25979432dbf53d9e90fcceb77eb60c1c
F20101107_AABKLE reini_s_Page_030.tif
c51020e409e4c7fb859b4bf849501033
e8dd68dd7b2471cfbf241fd8130bc7e9d8935138
658 F20101107_AABKKP reini_s_Page_130.txt
35b22d6af5bca59979c94117a3ad6934
569b83e32d020918c469a2ca3493bc33c01795dd
F20101107_AABKLF reini_s_Page_071.tif
03eb68bc5574e13a8ee6024b493a946c
3927972d048eebb9a50a5ca6057ca043f5028be7
8947 F20101107_AABKKQ reini_s_Page_025thm.jpg
a7e2dcdf35456d15acfadf8063993b38
7211dd3ea6811cf37969ad98a9a3e9a35b06e52e
F20101107_AABKLG reini_s_Page_147.tif
0f28fad636877c5788525ea6decf04ba
3b52ee9eb8673d507f146981acb81effcb174ad5
F20101107_AABKKR reini_s_Page_133.tif
deca24bc88c0f0e49f48f6ed8c9558fa
59afa0dc67d1dfb08497b6fe5b9b46c45dcc07cf
8755 F20101107_AABKLH reini_s_Page_067thm.jpg
ac5cb1c1adabfcb6b08f2eb5a8f3e125
e8398f8924d2697becc5a29bbc6140c98acaaf8c
27533 F20101107_AABKKS reini_s_Page_004.pro
bbd022845323c4ad11737f5c268d1a7e
e6995afa3552ceb93e2f230878684eed0b5a2736
F20101107_AABKLI reini_s_Page_049.tif
6a88d90cb98ef9520de5ce24db4f81fd
abc461b8af6e0e702e1cee8ead377d9836b05b57
1051963 F20101107_AABKKT reini_s_Page_044.jp2
de736ecf0e98a00484f66331079d2cf9
c4dec30bdc53905df44926326fa7b1435938af22
2523 F20101107_AABKLJ reini_s_Page_133.txt
227dba7b3450b12856d6ace43125cdbe
9f0fba3cee46abcd4a88eadbeb826172a2b3b005
F20101107_AABKKU reini_s_Page_101.tif
4b14d1c5cd3a747b3d9e13daf0fba30f
0d14b1cae784417f304dd0b2000f855c9423424e
37941 F20101107_AABKLK reini_s_Page_027.QC.jpg
7fae51a7cf565a45dc2fd1d45a33c4aa
d9822ab2ca8a152f98ffa13b6af981a16530f72a
8717 F20101107_AABKKV reini_s_Page_026thm.jpg
b17cbd77a93af307a4b29e755909fbb7
89d97bbafe3559414f01d2d4f8beb47117eff460
F20101107_AABKLL reini_s_Page_122.jp2
2bfe208d1eecd3c033ce94123ec4f490
e5633b0f9d2b38c284bfe0e966f213a9ff6e6b1a
17202 F20101107_AABKKW reini_s_Page_148.pro
cdab3d748173ebacc4b9b0dadf7ca6d4
0d200bfce8892bf685e8d71f1fdc1d46260d36e9
37534 F20101107_AABKLM reini_s_Page_131.QC.jpg
79b12b4367c8d886490741485bc78e3e
b73fb12f1c1586ccb90202fc646824e7f66b1e33
53296 F20101107_AABKKX reini_s_Page_099.pro
2843b983ce441a32c7c8b6dae72f554f
98d801149f321d0656e76c78c86c246c7bf1a8b1
F20101107_AABKMA reini_s_Page_116.tif
da6a36abcbc9336ecd07f9c68c66eda7
c5cc12e7fad51e0ee1631c455499da0a2550735b
2328 F20101107_AABKKY reini_s_Page_014.txt
eb06c76a6d72d884fa4173a550716899
79515d7223e5ead86cd5a3d8cc7778917cf0cc15
4331 F20101107_AABKMB reini_s_Page_113.pro
c30baae48ebd439f2e7bcc11f3276d97
0ea513c3a1821c97c582bf304d9bf66e4d489b14
93 F20101107_AABKLN reini_s_Page_002.txt
aedebb4c8384744840ace6a34d7a1bfe
b93a98196ce5c42b9151ad61cfe45e8a6d68a382
F20101107_AABKKZ reini_s_Page_125.jp2
a6aab5cb182eeb9c52f81a14ac30b30f
e10c450b65c3a96dc5a2cb26cb2b27da5dfb23ba
10305 F20101107_AABKMC reini_s_Page_119.pro
a1eafc4edf3a26febcf8e228e799abfa
3a741c03b8d1adb42f97a1541a256d8f5334735d
115747 F20101107_AABKLO reini_s_Page_125.jpg
fbb7d5c10cb4bb31f9f5221ea2ea7a73
622598b8d1f81f36ad54a6d9bced6d0a7dfff191
F20101107_AABKMD reini_s_Page_067.txt
246fb8cc1f38b71f6c077087069b5e4b
245332e2f0cb2d0043dc1ee80c01e4ad66000d7c
36145 F20101107_AABKLP reini_s_Page_133.QC.jpg
909f521426365edd868ee303de44d2d8
1d928c343803648294412b37dd48841e9f6945d5
1344 F20101107_AABKME reini_s_Page_071.txt
6ddb0c9cd8c1907effa20f3eea63e721
aa730eeb08d7a535bc110db0f69cc18efb5a39b2
F20101107_AABKLQ reini_s_Page_035.jp2
4b802393159376d889ed44871a417a49
fb39234885fe0e1fab8a0ae262619ae9f07dca41
171597 F20101107_AABKMF UFE0022551_00001.mets
ae782d88a5838fd53c08553a9e95ed13
f1dec3ea54a6e8463c45aeb0423b68c42779ff01
36308 F20101107_AABKLR reini_s_Page_099.QC.jpg
3674f314d628b0380e995c0644bac209
4919f0f54eb9fee6bb79f369723ffd9320af9a1d
8195 F20101107_AABKLS reini_s_Page_083thm.jpg
b66b96fb05ae9d1504149b9e1d308253
bd9c026157aa1cdc1ccb5b73103b72f4e8efa7a7
58278 F20101107_AABKLT reini_s_Page_125.pro
75d6a5a4bf17dff36fd7f3a7b6532d44
414e07937fe2808a659ac71c4e65c26533b815e5
13330 F20101107_AABKMI reini_s_Page_003.jpg
f20e81eb829be6c646fcee06e069d158
600e5b828664a811d4eadc9c455b151531717102
2252 F20101107_AABKLU reini_s_Page_034.txt
05091e5be9b2d8afd90a53cd668e8de5
0c75ed5195f14956ec7364fcc444a22f89ae6340
59914 F20101107_AABKMJ reini_s_Page_004.jpg
fe17f86b54e33ac3ac71df8145e9dc65
a54942e8beac7125400377188307dedd8c48be21
120322 F20101107_AABKMK reini_s_Page_009.jpg
3563e28be5b6f1346d8e79eaf72d09f3
1eb14d97e8d8ddbb892517349ca13d3f58f20245
F20101107_AABKLV reini_s_Page_092.tif
0e6f117fd978444815110322b3ae8dcc
8f79e5273e589ef38b9819529a68ee2092eaa3a2
67463 F20101107_AABKML reini_s_Page_011.jpg
61285115ec4069621939fef8eae74773
ad53ed7346d3925780a407e90d4563480fdf4a18
136655 F20101107_AABKLW reini_s_Page_146.jpg
5c9d915f4227ddea967f220fe448a5b0
9547ab66b3abdf3f64c302d8b68c07bee4f1c22d
110478 F20101107_AABKNA reini_s_Page_047.jpg
211d8ac308f86aa8abe5783476a130f1
4e106de04a7b395199d1f584750afb77814440be
108976 F20101107_AABKMM reini_s_Page_013.jpg
b1a2f7cb20d44a585c4acb867f6897eb
71da60c362c2bfc508d1a0a0a85a429e5454295b
36038 F20101107_AABKLX reini_s_Page_082.QC.jpg
152a5d5612d7a00fecc17af960cc3ba6
1c4e8bba2ded2a9e565490e432f4bec0ece946f4
80886 F20101107_AABKNB reini_s_Page_050.jpg
dba79c21a51c852f16401ead2d50bd1a
4fee5a23f00dc0fce284114aec1a7a4aca37a993
111534 F20101107_AABKMN reini_s_Page_015.jpg
5dfc8e2d94aa67a06a839ddb6b238501
12b54eab4c1c1599ec1163b1ecfe087bdbad3c1d
13421 F20101107_AABKLY reini_s_Page_117.QC.jpg
2835d17cd313502d236e7dcff4f2bf65
580f5805d40451a541dd30cc8b81eb7b7dde29b1
9038 F20101107_AABJKA reini_s_Page_112thm.jpg
58ec54c6303c309f95251087da5cfc86
727144889ba0ba4ff2e96c2b37a0acc41862b91e
40284 F20101107_AABKNC reini_s_Page_051.jpg
af8001af0c679aa590c4701eb9f7ddb8
ca5007d35e0d02f1297c51c6f8eb85d837853a50
F20101107_AABKLZ reini_s_Page_102.jp2
72628b46aa18a67d9a914c1f1c85e330
30aa1119e865bd90090e044be5df922d0e6c93d0
2294 F20101107_AABJKB reini_s_Page_088.txt
63bea1b18583b64303620c7217d99e62
06a7db5170555a7b83cb28314b5d174c6882f937
32809 F20101107_AABKND reini_s_Page_052.jpg
766bb5adec57275cb40146b211cb9605
ce9683b56970980e685531b84269a4dc21f35e18
107120 F20101107_AABKMO reini_s_Page_016.jpg
bba61746fc3cf9670ccc609eab2f021f
8b9d869e81d49df810c81d96b6c3d92e0f6fc96c
1051790 F20101107_AABJKC reini_s_Page_114.jp2
3a9d06291f153211bc7982ecd5bea5a9
ba996d32ec1e1707346bea1e39703d476b256011
33103 F20101107_AABKNE reini_s_Page_053.jpg
ebd010f5e92dd10695bf01117f5159e1
5230ffa0dfb4dc67e3706102a5bce0a7dd6ebe68
114129 F20101107_AABKMP reini_s_Page_020.jpg
898007a969a0c3cbba5ae33b77ff5196
cb925c6c75d766638556c91a89f68e1e7ccd08bf
912 F20101107_AABJKD reini_s_Page_002.pro
bc1cdad7b5fd6f1e357667c603f310a7
9dcca229a3c8dd6ce363d0684b939aca491db8b9
33492 F20101107_AABKNF reini_s_Page_056.jpg
ca0c45bc805f67e053166f51c35dc43a
dfa395100f49f2c6bc79bf33ff72b1e2dfa7cf07
112174 F20101107_AABKMQ reini_s_Page_021.jpg
cdbbfb5292cf7a5ff1233c9a94e2d609
9a2183e90cade95a7b110796ae37545065bff619
2227 F20101107_AABJKE reini_s_Page_021.txt
580fa300d8e4495d02a53c7302d63852
1a83c23cb40d2b435f014b5b32464ce0a946d0c5
66063 F20101107_AABKNG reini_s_Page_057.jpg
8139c28604d97afb6ce88867dd9b1622
7a31e8f24c5305f4a8f81e18f88b57900512cb8e
108739 F20101107_AABKMR reini_s_Page_022.jpg
df9d1411b786bf884540998f56aaa7e1
0daab59751404322f7d4a2e5f7e405c130a3ed37







MECHANISMS BY WHICH OVEREXPOSURE TO CORTISOL CAUSES FETAL HEART
ENLARGEMENT IN LATE GESTATION


















By

SETH ANDREW REINI


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008


































2008 Seth Andrew Reini


































To my mother, Janet, whose tireless work ethic and strong moral character are an inspiration to
me. Also to my Father, George, who has always challenged me to think critically.









ACKNOWLEDGEMENTS

I thank my committee chair, Dr. Maureen Keller-Wood, for giving me the opportunity to

learn under her tutelage. She has been a tremendous mentor. I appreciate her patience (she

needed a lot sometimes!) in teaching me, and have enjoyed witnessing her enthusiasm for her

work and her excitement for educating all with a will to learn.

I would also like to thank Dr. Charles E. Wood whose skillful hands performed all of the

surgeries necessary for this dissertation work to be completed. His enthusiasm for his work has

also been an inspiration to me. Thanks also go to my other committee members (Drs. Peter

Sayeski, Paul Oh, and Michael Kilberg) for their guidance and support. Finally, thanks go to

every member of the Wood and Keller-Wood labs, past and present, who have helped me along

the way. Jarret McCartney deserves special mention for helping care for the sheep before and

after surgery and Elaine Sumners also deserves special recognition for all of the advice she has

given, both science- and nonscience-related.









TABLE OF CONTENTS

page

A C K N O W L ED G E M EN T S ......... .. ............ ........................................................................4

L IS T O F T A B L E S .............................................................................. ............... 8

LIST OF FIGU RE S ................................................................. 9

A B ST R A C T ....... .. ......... ................................................................................ 10

CHAPTER

1 INTRODUCTION ............... .......................................................... 12

B background and Significance ..................................................... ...................................... 12
R ole of C ortisol in Pregnancy ................ ...... .... ............ ........ ....... ............................ 12
Importance of Maintaining Proper Cortisol Levels in Pregnancy ............... ..................13
Corticosteroid Receptors and 11 Beta-Hydroxysteroid Dehydrogenases ...........................14
Consequences of Elevated Cortisol on Fetal Heart Growth................................................ 16
R ole of M R in th e H eart .............................................................................. ..................... 17
C cardiac C ollagen D position ......................................................................... ................... 18
Hyperplasia vs. Hypertrophy in the Fetal Heart ........... ............................... ...............20
Role of the Renin-Angiotensin System in the Heart ..... .............................................21
Role of the Insulin-Like Growth Factors in the Heart ........................................ .............24
S u m m a ry ................... ............................................................ ................ 2 7
S p ecific A im s........................................................................... 2 8

2 INCREASED MATERNAL CORTISOL IN LATE GESTATION EWES
DECREASES FETAL CARDIAC EXPRESSION OF 113-HSD2 mRNA AND THE
RATIO OF AT1 TO AT2 RECEPTOR mRNA..................................................................32

Intro du action ................... .......................................................... ................ 32
M materials an d M eth o d s ..................................................................................................... 3 3
Experimental Design ....................................... ..... .. ...... ....... ..... 33
Real-Time PCR .................................... .... ............ ........ ..... 35
Radioim m unoassay.......................................... .... ....... .. .............. 37
Immunohistochemistry and Collagen Staining .................................... ............... 37
D ata A n aly sis...................................................... ................ 3 9
R e su lts ........... .... ........... ............................................................................................ 4 0
R eal-T im e P C R A naly sis ........................................................................ .................. 40
Expression of MR and GR .............. ... ................................. 40
Expression of 11 P-H SD 1 and 2....................... .............................. ............... 40
Expression of myotrophin, NOS-3, and VEGF................................ ... ..................40
Expression of IGF-I and II, IGF-1R and 2R ................................. ..................40
Expression of angiotensinogen, AT1R, AT2R, ACE1, and ACE2 ..........................41









Immunohistochemistry and Collagen Staining .................................... ............... 41
Plasm a Angiotensin II .................................... ..... .......... .............. .. 41
R egression A analysis ............................................ .. .. ........... .... ..... .. 42
D iscu ssio n ............................. ... ............. ... ..................................................................... 4 2
Role of Corticosteroids Acting at M R or GR ...............4.. ..... ....... ...........4....... 43
Role of Growth-Related Genes: VEGF, eNOS, Myotrophin and IGFs ..........................46
R ole of the R enin-A ngiotensin System ..........................................................................47

3 ONTOGENY OF GENES RELATED TO OVINE FETAL HEART GROWTH:
IMPLICATIONS FOR GROWTH SECONDARY TO INCREASED CORTISOL............62

In tro d u ctio n ......................... .............................................................................................. 6 2
M materials an d M eth o d s ..................................................................................................... 6 3
R e al-T im e P C R ............................................................................................................... 6 3
D ata A n a ly sis ............................................................................................................. 6 4
Results ................... .................. .... .. .. ................ .. ........................... 65
Expression of MR, GR, and 113 -HSD1 and 2 mRNA................ ...................65
Expression of IGF1, IGF-1R, IGF2, IGF-2R, and IGFBP2 ...................................65
Expression of Angiotensinogen, AT1R, AT2R, ACE1, and ACE2 mRNA ...................66
D isc u ssio n .................. ..................................................................................................... 6 7
R ole of C orticosteroids in the H eart.................................................................... ...... 68
Insulin-Like G row th Factors ................................................ ............................... 68
R enin-A ngiotensin Sy stem ................................................................... .....................7 1

4 CARDIAC CORTICOSTEROID RECEPTORS MEDIATE THE ENLARGEMENT
OF THE OVINE FETAL HEART INDUCED BY CHRONIC INCREASES IN
M A T E R N A L C O R T ISO L ........................................................................... .....................78

In tro d u ctio n ................... ...................7...................8..........
M materials and M methods ...................................... .. .......... ....... ...... 79
Experim mental Design ................................... ..... .. ...... ....... ..... 79
Surgical Procedures ................................................................ .... ........80
E xperim mental P protocol ...................................................................... .........................82
A naly sis ................. ......... ................................................ 83
Immunohistochemical Localization of MR and GR ............................ .....................83
C ollag en Staining ................................................................84
D ata A n a ly sis ............................................................................................................. 8 4
R e su lts ......... ..... ................. ................. ........................... ............8 5
M maternal P hysiology ............................. ............ .................................. ... 85
Fetal Physiology ........................ ................................. ....86
Fetal H heart M easurem ents ......... ................. ................. ..................... ............... 86
C ollag en Staining ................................................................87
D discussion ......... ....... ..... ... ....................................87
Role of M R and GR in the H eart...................... ......... ........................... ............... 87
Role of MR in Hypertrophy in the Adult Heart ...........................................................90
Mechanisms of Enlargement of the Fetal Heart........... ...................................... 91
C o n c lu sio n s ..............................................................................9 3


6









5 ANALYSIS OF PROLIFERATION MARKERS AND EXPRESSION LEVELS OF
POTENTIAL GROWTH PROMOTERS WITHIN THE FETAL HEART .........................101

In tro d u ctio n ................... ...................1.............................1
M materials an d M eth od s .............................................................................. ..................... 103
Experim mental D design ................................. .. ... .......... .............. .. 103
Im m unohistochem istry ............................................................... ... ........................ 104
R eal-Tim e PC R ................................................................ 105
W western Blotting............ ... ....... ............................. .. 105
D ata A n a ly sis ........................................................................................................... 1 0 6
R e su lts ................................................................................................1 0 7
Im m unohistochem istry .............................................................. ................ 07
R eal-T im e P C R an aly sis................................ ..................................... ..................... 107
Expression ofMR, GR, 110-HSD1, and 113-HSD2..............................107
Expression of IGF1R, AT1R, AT2R, and GLUT1 ................... ... .............108
E expression of P C N A ....................................................................................... 108
Expresssion of A T1R and A T2R ......... ......... ........................... ..... ............. 108
D discussion .................. .................... ....................................... ............... 108
Cortisol Stim ulation of M yocyte Proliferation.............................................................109
Expression of IGF1R, AT1R, and AT2R................................. ...............110
Expression of MR, GR, 113 HSD1, and 11 HSD2 .............................. ..................112
Expression of GLU T1 ................ ....................... .... .......... .......... ........ .. 113

6 SUM M ARY .......... ....................... .......... ............. ............ ..................122

L IST O F R E FE R E N C E S ...................................................... ............................................. 133

B IO G R A PH IC A L SK E T C H ................................................ ............................. .................... 151
























7









LIST OF TABLES


Table page

2-1 Primers and Probes used in real-time PCR assays.................................. ............... 57

2-2 Partial sequence of ovine m yotrophin........................................ ............................ 60

2-3 Fetal plasma angiotensin II levels (pg/ml) in fetuses in the high, control, and low
maternal cortisol groups at 120, 125, and 130 days gestation.......................................61

3-1 Expression ratio of 111-HSD1 to 111-HSD2, IGF2 to IGF1, AT1R to AT2R,
andACEl to ACE2 in LV and RV mRNA ............................................. ............... 77

4-1 Fetal and Maternal Cortisol concentrations (average of days 5 and 10) and ACTH
concentration on day 10 ...................... ........ .............. ................... ........ 97

4-2 Fetal blood gas and packed cell volum e ........................................ ........................ 98

4-3 Fetal arterial pressure and fetal heart rate on day 10 ............................... ............... .99

4-4 Collagen content determined by picrosirius red staining (fraction of total area) in left
ventricle (LV), right ventricle (RV), and septum .................................... ............... 100

5-1 Percentage of nuclei positively stained for KI67 in the LV and RV ..............................121









LIST OF FIGURES


Figure pe

1-1 Components of the HPA axis and how it interacts ............................... ..................29

1-2 Different actions of 113HSD1 and 2 and how they interact with cortisol.........................30

1-3 Components of the renin-angiotensin system ........................................ ...............31

2-1 Gene expression of corticosteroid receptors and 110-HSDs in the LV...........................51

2-2 Gene expression of Myotrophin and vasculogenesis related genes in the LV ..................52

2-3 Gene expression of IGFs and IGF receptors in the LV ................................................53

2-4 Gene expression of the RAS in the LV ................................... ............... 54

2-5 Localization of corticosteroid receptors and 110-HSDs in the LV...............................55

2-6 Linear regression correlation of 110-HSD2 mRNA and left ventricular wall thickness...56

3-1 Ontogenetic expression of corticosteroid receptors and 1 10-HSDs in the LV and RV.....74

3-2 Ontogenetic expression of IGFs, IGF receptors, and binding proteins in the LV and
R V ... ............................. .....................................................................7 5

3-3 Ontogenetic expression of the RAS in the LV and RV ...............................................76

4-1 Immunohistochemical localization of MR and GR in representative hearts.................94

4-2 Fetal heart measurements in response to manipulations..............................................95

4-3 C ollagen staining of fetal hearts .................................................................................. 96

5-1 Immunohistochemical localization of Ki67 in representative hearts.............................1116

5-2 Gene expression of corticosteroid receptors and 110-HSDs in the LV.........................117

5-3 Gene expression of angiotensin receptors, IGF1R, and GLUT1 in the LV.....................118

5-4 Protein expression of PCNA (A; 36 kDa) in control, cortisol, cortisol + MRa, and
cortisol + G R a groups in L V ......... ................. ................... ................... ............... 119

5-5 Protein expression of AT1R (67 kDa; A) and AT2R (68 kDa; B) ............................. 120

6-1 Effects of elevated cortisol on fetal heart growth ................................. ..................... 132









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

MECHANISMS BY WHICH OVERVEXPOSURE TO CORTISOL CAUSES FETAL HEART
ENLARGEMENT IN LATE GESTATION

By

Seth Andrew Reini

August 2008

Chair: Maureen Keller-Wood
Major: Medical Sciences--Physiology and Pharmacology

Elevated cortisol levels during late gestation can lead to fetal heart enlargement.

However, the mechanism by which cortisol increases fetal heart size has not been fully

identified. These experiments were designed to 1) investigate left ventricle (LV) expression of

genes potentially responsible for increasing heart size, 2) determine the ontogenetic expression

of those genes in the LV and right ventricle (RV), 3) elucidate whether the mineralocorticoid

receptor (MR) or glucocorticoid receptor (GR) mediate the cortisol-induced cardiac enlargement,

and determine if cardiac fibrosis accompanies the enlargement, and 4) investigate the role of cell

proliferation in causing the cardiac enlargement. I found that mRNA expression of 110-

hydroxysteroid dehydrogenase 2 (11PHSD2), the insulin-like growth factor receptor type 1

(IGF1R), and the angiotensin type 1 receptor (AT1R) to angiotensin type 2 receptor (AT2R)

mRNA ratio decreased in response to elevated cortisol in the LV. The decrease in IGF1R

mRNA expression and the AT1R to AT2R ratio may have been an attempt by the heart to limit

growth whereas the decrease in 113HSD2 expression indicates cortisol is able to increase its

action at MR and GR.









Ontogeny analysis revealed that MR and GR mRNA expression are high at all points and

1 10-hydroxysteroid dehydrogenase 1 mRNA expression is significantly higher than 113HSD2 at

all times, implying cortisol action at MR and GR is important for heart growth throughout late

gestation. I also found that angiotensin converting enzyme 1 mRNA dramatically increases in

both ventricles in late gestation implicating angiotensin II production is important in maturing

the heart for life after birth. This study also showed that a reduction in mRNA of growth

promoting IGF family members towards term within both ventricles may contribute to the

decrease in myocyte proliferation that occurs during the last third of gestation.

In vivo experiments demonstrated that cardiac specific blockade of MR negated cortisol-

induced heart enlargement and that GR blockade lessened it, suggesting corticosteroid receptors

mediate the enlargement. Picrosirius red staining of the hearts revealed that fetal heart

enlargement in response to elevated cortisol is not accompanied by an increase in cardiac

collagen deposition, but KI67 staining of the hearts revealed that enlargement may be due to an

increase in myocyte proliferation.









CHAPTER 1
INTRODUCTION

Background and Significance

Proper fetal development is important for good health not only before birth, but also for

after parturition and into adult life. One example of fetal development potentially affecting adult

health is in the development of cardiovascular disease (CVD). For instance, we now know from

studies conducted on adults who were conceived during the Dutch famine of 1944-1945 and born

with low birth weights due to undernutrition that they carry higher risks for cardiovascular

disease and diabetes in their adult years (Roseboom et al. 2001). There is also evidence in both

animals (aghajafari et al. 2002, Newnham et al. 2001) and humans (Walfisch et al 2001, Banks

et al. 1999, French et al. 1999) that overexposure of the fetus to corticosteroids can cause fetal

growth restriction, potentially increasing the risk for development of disease later in life.

Currently, CVD is one of the biggest health concerns facing the world, and it appears risk for this

disease may be partially determined by fetal health.

Role of Cortisol in Pregnancy

Cortisol is a stress-response hormone, released from the adrenal cortex, which binds either

mineralocorticoid receptors (MR) or glucocorticoid receptors (GR). Release of cortisol by the

adrenal gland is controlled by the pituitary gland secretion of adrenocorticotropin (ACTH),

which is controlled by the hypothalamus secretion of corticotropin releasing hormone (CRH).

When cortisol levels increase beyond the set-point, the pituitary gland and hypothalamus sense

the high cortisol levels and release of ACTH and CRH are inhibited (Figure 1-1).

Cortisol can be chronically elevated during chronic stress, but is also normally increased

during pregnancy. In fact, maternal plasma levels of cortisol are elevated during human

pregnancy (Carr et al. 1981), and doubled during late gestation in ewes (Bell et al. 1991, Keller-









Wood 1998). Cortisol plays an important role in fetal development including inducing

maturation of the intestinal tract (Arsenault et al. 1985; Galand G et al. 1989) and inducing

maturation of surfactant production in the lung (Ballard et al. 1996; Liggins et al. 1972).

Highlighting the importance of glucocorticoids in fetal organ development is the fact that

corticosteroids have been used to mature fetal lungs and prevent respiratory distress syndrome

since 1972 (Liggins et al. 1972).

Importance of Maintaining Proper Cortisol Levels in Pregnancy

Whereas a single course of antenatal corticosteroids for fetal maturation in preterm birth

instances appears to be safe (Crowley et al. 2002, NIH 2001), repeated treatments to women with

recurring risk of preterm birth has become the norm (Quinlivan et al. 1998). Recently, it has

been shown in animals (aghajafari et al. 2002, Newnham et al. 2001), and humans (Walfisch et

al. 2001, Banks et al. 1999, French et al. 1999), that repeated antenatal corticosteroid treatments

can cause fetal growth restriction, a symptom of pre-programming for cardiovascular disease or

diabetes later in life (Law et al. 1996, Phillips et al. 1998). It has been suggested that this

programming may be due to excess exposure of the fetus to glucocorticoids (Benediktsson et al.

1993, Clark etal. 1998, Roghair et al. 2005, Seckl et al. 1998, Seckl et al. 1997). Short-term

glucocorticoid exposure to the fetus in the third trimester has been demonstrated to have adult-

life programming effects in rats (Levitt et al. 1996). Amazingly, it has been demonstrated in rats

that excessive corticosteroid exposure induced pre-programming of the fetus to adult

cardiovascular disease can cause the same effects in the next generation, even when the next

generation were not themselves exposed to excess corticosteroids during fetal life (Drake et al.

2005). Also, postnatal hypertension has been observed in sheep following glucocorticoid

treatment in early or mid-gestation (Figueroa et al. 2005, Wintour et al. 2003).









Direct effects on the fetus have also been observed in response to improperly regulated

glucocorticoid levels during pregnancy. It has been shown previously that consequences of a

reduction of cortisol levels in late gestation ewes are a reduction in fetal growth, a reduction in

maternal plasma volume and uteroplacental flow, an altered placental morphology, and a greater

likelihood for fetuses to become hypoxic (Jensen et al. 2002, Jensen et al. 2002, Jensen et al.

2005). On the other hand, modest elevations in ovine maternal cortisol levels between -120 and

-130 days gestation (term = -145 days) have been shown to cause an increase in heart growth

while reducing overall fetal growth (Jensen et al. 2005).

Corticosteroid Receptors and 11 Beta-Hydroxysteroid Dehydrogenases

MR and GR are the two main receptors cortisol acts on within the body. The selectivity of

MR and GR for the endogenous steroid ligands differs among species. For instance, in the rat

MR binds its primary glucocorticoid, corticosterone, and aldosterone with high affinity, but

binds cortisol with slightly lower affinity (Sutano et al. 1987). Conversely, in the hamster

corticosterone and cortisol bind MR with high affinity while aldosterone binds with lower

affinity (Sutano et al. 1987). Interestingly, dogs secrete both cortisol and corticosterone

(Westphal et al. 1971, Keller-Wood et al. 1983) with MR having greater affinity for

corticosterone than cortisol and aldosterone, which have similar affinity for MR (Reul et al.

1990). On the other hand, human MR has similar affinities for cortisol and aldosterone and

corticosterone (Arriza et al. 1987). In sheep, corticosterone is not secreted in appreciable

amounts while cortisol and aldosterone are the major corticosteroids of action (Westphal et al.

1971). Additionally, both the human and the ovine GR have greater affinity for cortisol than for

aldosterone. However, whereas MR has been shown to be the higher affinity receptor for

cortisol (Kd = 0.52 0.09 nM) in ovine hippocampal cells, GR is the lower affinity (Kd = 1.48 +

0.11 nM) but more abundant and higher capacity receptor (Richards et al. 2003). This study also

14









showed that aldosterone affinity for MR is similar to that of cortisol. However, unless local

levels of 11 beta-hydroxysteroid dehydrogenase 2 (11 3HSD2) are high (i.e. kidney), cortisol

would be expected to occupy MR in vivo rather than aldosterone because of the higher relative

concentration of cortisol in the plasma (<0.1 nM aldosterone as compared to 1-10 nM cortisol).

Furthermore, in sheep it is estimated that approximately 20% of circulating is free and not bound

to cortisol binding globulin. This means that in the sheep fetus, where average the average

cortisol concentration is -1.5 ng/ml, free cortisol concentrations would be -0.8 nM. It also

means that based on the study of Richards et al. (Richards et al. 2003), we would predict that

these free concentrations would result in approximately 65% occupancy of MR and 35%

occupancy of GR in the sheep fetus. Thus, at basal levels we would expect cortisol to exert more

effects via MR than via GR activation.

Locally, the actions of cortisol are primarily dependent on the expression levels of

1 13HSD1 and 2. 11 HSD2 is responsible for converting cortisol (active at MR and GR) into

cortisone (inactive at MR and GR) (Figure 1-2). The counterpart of 11 HSD2 is 11 HSD1,

which has a primary role that is opposite to 11 HSD2 by converting cortisone into active

cortisol, although it has the ability do the same as 11 HSD2 also (Figure 2; Seckl et al. 2001).

When large amounts of cortisol are converted into inactive cortisone by 1 13HSD2, aldosterone is

then free to bind MR receptors. Organs containing high amounts of epithelial tissue such as the

kidney tend to highly express 11J3HSD2 in order to prevent glucocorticoid action at MR, which

is also highly expressed, and allow aldosterone binding (Young et al. 2007). This maintenance

of proper 113HSD2 levels in the kidney is critical as inactivation of this enzyme results in

hypertension, potassium wasting, and sodium retention as a result of glucocorticoid activation of

MR (Stewart et al. 1988, Edwards et al. 1989). On the other hand, while MR expression in the









hippocampus is similar to that found in the kidney, 113HSD2 exhibits substantially less

expression making the hippocampus primarily a site of glucocorticoid action at MR (Kim et al.

1995). Similarly, 1 13HSD2 expression in the adult human heart is less than 1% of that found in

the kidney (Lombes et al. 1995), suggesting that the myocardium is more operationally similar to

the hippocampus than it is to the kidney. MR, GR, and 113HSD1 and 2 expression levels within

the fetal heart have not been fully elucidated, but would be helpful in determining the role of

cortisol in fetal heart growth and maturation.

Consequences of Elevated Cortisol on Fetal Heart Growth

As previously mentioned, modest elevations in ovine maternal cortisol levels between

-120 and -130 days gestation have been demonstrated to cause an increase in heart growth

(Jensen et al. 2005). Interestingly, in this study the enlargement was observed without a chronic

rise in blood pressure, suggesting cortisol may be acting directly on receptors in the fetal heart to

cause increased growth. Additionally, Giraud et al. have shown that cortisol infusion directly

into the ovine fetal coronary artery increases heart mass due to an increase cell cycle activity,

and this was without an increase fetal blood pressure also (Giraud et al. 2006). Furthermore,

dexamethasone (GR agonist) administration into the maternal rat (48 pg/d from E17) resulted in

increased myocyte proliferation and relative heart size in the fetal and newborn rat (Torres et al.

1997).

It has also been shown that acute infusion (-129 through 132 days gestation) of non-

physiologically high amounts of cortisol (resulting in -100 times higher plasma concentrations

than controls) directly into the ovine fetus also leads to cardiac enlargement, but this was

accompanied by a significant increase in mean arterial pressure (46.7 + 1.5 vs. 59.7 2.0)

(Lumbers et al. 2005). Hearts from this study exhibited increased left ventricular cell volume









and higher expression of angiotensinogen mRNA in both ventricles, suggesting the increase in

blood pressure was a major force in driving the increase in cardiac enlargement. Whether MR,

GR, or both receptors within the heart are directly mediating the cardiac enlargement has not

been studied. However, whereas the mechanism by which elevated cortisol levels cause

enlargement of the fetal heart is not well understood, these studies suggest that the mechanism of

enlargement may differ based on delivery method, amount, and duration.

Role of MR in the Heart

Whereas little has been done to elucidate expression of MR in fetal hearts, MR has long

been known to be expressed in adult hearts, as Lombes et al. showed in rabbits (Lombes et al.

1992). MR appears to have a major role in hearts that have experienced ischemic injury or are

experiencing heart failure. In rats MR blockade has been shown to improve modulate the

inflammatory response improve vasomotor dysfunction and vascular oxidative stress after

myocardial infarction (Fraccarollo et al. 2008 and Sartorio et al. 2007). In dogs with chronic

heart failure, it was shown that eplerenone (MR antagonist) administration reduced LV filling

pressure and end-diastolic wall stress and stiffness, and improved LV relaxation (Suzuki et al.

2002).

Promising studies have also recently been done in humans looking at the role of MR in

heart failure. The Randomized Aldactone Evaluation Study (RALES) trial demonstrated that

patients from various backgrounds and countries, who had severe heart failure, were dramatically

helped upon daily administration (25mg/day) of spironolactone, an MR antagonist.

Improvement in survival at 3 years was 30% while improvement in hospitalization was at 35%,

causing the trial to be halted just over the halfway point of the projected time-course for lack of a

need to continue the trial (Bertram et al. 1999). Similar benefits have been seen with eplerenone,

a more specific MR antagonist, in the Eplerenone Post-Acute Myocardial Infarction Heart









Failure Efficacy and Survival Study (EPHESUS) (Bertram et al. 2001). Most think that the

improvement seen in the patients of the RALES trial was due to blocking the effect of

aldosterone (Bertram et al. 1999). This is reasonable because, although not much is known

about aldosterone signaling (Fiebeler et al. 2003), aldosterone is known to promote harmful

events in the heart such as endothelial dysfunction, water and sodium retention, and hypertrophy

(Fraccarollo et al. 2004). It has been suggested, however, that many heart failure patients without

elevated plasma aldosterone levels still receive the same benefits from MR blockade, indicating

aldosterone may not be the only ligand (Young et al. 2007). Additionally, while it has long been

known that MR and 1 1HSD2 are co-expressed in hearts of many animals, including humans

(Lombes et al. 1995), it has also been proposed that reductions in 11 HSD2 expression in adult

human hearts can lead to cardiac damage via cortisol binding, and not necessarily aldosterone

(glorioso et al. 2005, founder et al. 2005).

In cultures of neonatal myocytes, it is presumed that MR mediates aldosterone actions in

directly stimulating myocyte surface area (Okoshi et al. 2004) and remodeling of the myocyte

membrane (Kliche et al. 2006). Additional evidence of intracardiac action at MR is cortisol

increases expression of atrial natriuretic peptide in cultured neonatal myocytes, and both cortisol

and aldosterone potentiate the effect of phenylephrine on hypertrophy in these cultures (Lister et

al. 2006).

Cardiac Collagen Deposition

Collagen plays a crucial role in the heart in maintaining ventricular function by regulating

its shape and size (Baicu et al. 2003). Within the heart, collagen serves as connective tissue

found between myocytes, nerves, and blood vessels. The two main types of collagen found

within the heart are types I and III with I being the predominant type. Type I collagen is often

associated with tissue that is more stiff and rigid than tissue containing predominantly type III









collagen (Pearlman et al. 1982). Interestingly, multiple studies have correlated increases in LV

collagen concentrations and wall stiffness (Janicki et al. 1993, Jugdutt et al. 2005).

Elevations in stress from increased ventricular pressure or volume, or from injury, leads to

remodeling of the ventricular wall until the wall stress in normalized resulting in near normal

systolic and diastolic function. Once wall stress exceeds the compensatory ability of the

ventricle, heart failure will eventually occur (Brower et al. 2006).

An increase in collagen concentration in hypertrophied hearts was first reported by

Pearlman et al. upon examining postmortem hearts of patients with and without heart failure

(Pearlman et al. 1982). Also, Pauschinger et al. reported an increase in the collagen I/III ratio in

myocardium from patients suffering from dilated cardiomyopathy (Pauschinger et al. 1999).

Whereas many studies have shown increases in collagen concentrations in response to chronic

elevations in pressure and myocyte hypertrophy, it has also been shown that increases in

collagen can occur without an increase in cardiac hypertrophy (Narayan et al. 1989), and that

cardiac hypertrophy caused by increased pressures is not always accompanied by an increase in

fibrosis (Gelpi et al. 1991, Douglas et al. 1991). This is also observed in the hearts of human

athletes (MacFarlene et al. 1991, Nixon et al. 1991).

There is increasing evidence that the MR receptor may play a role in increasing wall

stiffness following injury as blockade of MR can prevent collagen concentration increases and

ventricular remodeling following injury. It has been shown in rats that MR antagonism provides

additional benefit to angiotensin II type 1 receptor (AT1R) blockade in preventing increases in

fibrosis in myocardial infracted hearts (Fraccarollo et al. 2004), possibly explaining the benefits

seen during the RALES trial in humans. Similarly, Takeda et al. demonstrated in rats that

spironalactone (MR antagonist) administration greatly improved collagen accumulation and









reduced apoptosis in infarcted hearts (Takeda et al. 2007). Furthermore, Nagata et al. observed

that MR blockade attenuated LV hypertrophy and heart failure in rats with low-aldosterone

hypertension, indicating glucocorticoid action at MR may have been mediating the harmful

events within the heart (Nagata et al. 2006). Collagen concentrations within fetal hearts enlarged

from excess glucocorticoid exposure has not been studied but it is not outside the realm of

possibility that enlargement of the fetal heart is accompanied by an increase in fibrosis as is often

seen in the adult.

Hyperplasia vs. Hypertrophy in the Fetal Heart

Cardiac growth occurs through proliferation of myocytes throughout most of gestation

(Smolich et al. 1989). The ability of myocytes to proliferate ceases sometime within the

perinatal period through entering a final round of DNA replication followed by a lack of cell

division (Oparil et al. 1984). This results in binucleation, or terminal differentiation, of the

myocytes (Barbera et al. 2000). The progression of the heart from proliferation to terminal

differentiation is gradual, however, leaving two different populations of myocytes in latter

gestation and early perinatal life. One group contains mononucleated myocytes which contain

the ability to grow the heart through proliferation and increasing cell size while the other group

contains binucleated myocytes which grow strictly through hypertophic means starting at the

point of terminal differentiation. This idea has been confirmed in sheep (Burrell et al. 2003,

Jonker et al. 2007) and humans (Adler et al. 1975, Garcia et al. 2002, Huttenbach et al. 2001)

where it was shown that the heart experiences myocyte proliferation and terminal differentiation

simultaneously throughout the last third of gestation. It is also known that myocyte volumes

increase during the last third of gestation in fetal sheep (Burrell et al. 2003), indicating that an

increase in cell size, along with an increase in cell number, contributes to cardiac growth at this

time. Jonker et al. observed in fetal sheep that binucleation became the more frequent out of the









myocyte cycle at -115 days gestation, at which time cardiac growth through increase in cell size

became much more considerable than before that point (Jonker et al. 2007).

It is not fully understood whether heart enlargement in response to elevated cortisol is

from an increase in cell size, cell number, or both. As mentioned previously, there is evidence to

suggest cortisol increases myocyte cell cycle activity in both rats (Torres et al. 1997) and sheep

(Giraud et al. 2006). However, Rudolph et al. observed a decrease in the LV DNA concentration

in response to cortisone infusion for 72-80 hours into the left coronary artery of fetal sheep (125-

133 days) (Rudolph et al. 1999). The decrease in DNA concentration caused by cortisol was

interpreted as being a result of a decrease in replication, suggesting cortisol may inhibit myocyte

proliferation. Additionally, evidence exists that extreme increases in cortisol can lead to an

increase in myocyte volume in fetal sheep (Lumbers et al. 2005). While there is conflicting

evidence as to the method of growth observed in the heart in response to elevated cortisol, the

magnitude of cortisol increase along with whether the increase was accompanied by an increase

in blood pressure may be important factors in determining the type of growth that occurs.

Role of the Renin-Angiotensin System in the Heart

Angiotensin II is a peptide hormone important in maintaining cardiovascular homeostasis.

Angiotensin II is synthesized from the cleaving of angiotensinogen (Aogen) into angiotensin I

and the further cleaving of angiotensin I into angiotensin II. Aogen is a 118 amino acid protein

primarily made in and released from the liver, but is also made for local activity in other tissues.

Renin, which is released from the juxtaglomerular apparatus of the kidney, then acts to cleave 4

amino acids from aogen resulting in the decapeptide angiotensin I. Angiotensin I is then

converted to Angiotensin II, an octapeptide, by angiotensin converting enzyme I. Angiotensin II

then acts on Angiotensin II type 1 and 2 receptors (AT1R and AT2R) throughout the body.









Additionally, angiotensin converting enzyme 2 (ACE2) converts angiotensin I into angiotensin

1-9 and angiotensin II into angiotensin 1-7 (Figure 1-3).

The renin-angiotensin system (RAS) has been implicated as playing a major role in cardiac

hypertrophy and fibrosis. It has been discovered in mice that local over-production of

angiotensin II within the heart, without involvement of the systemic RAS, acted locally to cause

interstitial fibrosis within the heart and also accelerated the deterioration of hearts that were post

myocardial infarction (Xu et al. 2007). Furthermore, there is well established evidence for

benefits of administration of ACE inhibitors and AT1R antagonists following myocardial

infarction in humans and these classes of drugs are both recommended as treatments for patients

who have suffered a myocardial infarction (Mancia et al. 2007, Rosendorff et al. 2007).

The RAS has been implicated in playing a role in cortisol-induced heart enlargement in

fetal sheep. Acute administration of high doses of cortisol directly into the sheep fetus in late

gestation affects components of the RAS system and may contribute in cortisol-induced heart

enlargement. A study by Lumbers et al. showed that aogen mRNA expression increased in the

treated group as compared to the control group (Lumbers et al. 2005). A problem in that study is

that the dose of cortisol caused premature labor and elevated fetal blood pressure. It is, however,

possible that the increased cortisol levels are directly stimulating an increase in aogen.

Interestingly, Sundgren et al. showed that AT2 stimulates hyperplasia, but not hypertrophy, in

fetal cardiomyocytes (Sundgren et al. 2003). Also, infusion of angiotensin II into fetal sheep has

also been shown to stimulate left ventricular growth (Segar et al. 2001). Furthermore, growth-

retarded fetuses of nutrient-restricted ewes show protected heart growth but also a decrease in

AT1R and AT2R protein expression in mid-gestation, indicating the angiotensin II receptors play









a distinct role under nutrient restricted conditions compared to normal cardiac development

(Gilbert et al. 2005).

Schneider and Lorell have suggested that Angiotensin II action is actually reflective of the

AT1R to AT2R receptor expression ratio (Schneider et al. 2001). Cardiac hypertrophy caused

by angiotensin II in adults is thought to be mediated by the AT1R (Zhu et al. 2003), however, the

role of the AT2R in the heart has been thought to inhibit the growth in response to cardiac

hypertrophy (Carey et al. 2005, Booz et al. 2004). Most evidence points to angiotensin II acting

at AT1R primarily to constrict blood vessels, whereas AT2R actions promote vasodilation in the

coronary microcirculation, in small resistance arterioles, and larger vessels such as the aorta

(Carey et al. 2005). It has also been observed in human heart failure that AT1R expression

decreases whereas AT2R expression increases or stays the same (Suzuki et al. 2004). Disruption

of AT2 receptors in mice does not result in any histologic changes within the heart (Hein et al.

1995) and myocytes do not express AT2 receptors at any age in rats (Shanmugam et al. 1996).

Most of these studies were performed in adult hearts. The roles of AT1R and AT2R within

the heart are much more defined in adults than in fetal life, so the AT2R may or may not perform

the same functions in the fetal heart. It is known that the AT2R tends to be more highly

expressed in many fetal and neonatal tissues relative to adult levels. For instance, Cox and

Rosenfeld demonstrated in sheep that fetal vascular smooth muscle (VSM) expressed only AT2R

systemically and AT1R did not start to express systemically in the VSM until two weeks after

birth (Cox et al. 1999). This suggests it is possible that the AT2R performs different roles in

prenatal and neonatal life than it does in adult life.

The primary job of ACE1 is to convert angiotensin I into angiotensin II, after

angiotensinogen has been converted into angiotensin I by renin. Cardiac hypertrophy is known to









be augmented by over-expression of ACE1 in rat hearts (Tian et al. 2004). ACE1 over-

expression in mouse hearts has also been shown to induce cardiac arrhythmia, enlargement of the

atria, and sudden death (Xiao et al. 2004). ACE2, on the other hand, converts angiotensin I into

angiotensin 1-9 and angiotensin II into angiotensin 1-7. ACE2 therefore limits the amount of

angiotensin II that is produced and potentially plays a role in protecting the heart from negative

consequences observed from increased aniotensin II action (Danilczyk et al. 2006).

Role of the Insulin-Like Growth Factors in the Heart

The insulin growth factors (IGFs) 1 and 2 can act in both an endocrine and paracrine

manner (LeRoith et al. 1995) and have been shown to be potentially important in fetal heart

development and maturation (Cecilia et al. 1996, Sundgren et al. 2003). Whereas most of the

pro-growth actions of IGF and IGF2 occur through binding of the IGF-1R, IGF2 has the ability

to also bind IGF-2R which is thought to act to eliminate excess IGF2 and be anti-mitogenic

(Randhawa et al. 2005). Ontogeny studies suggest IGF-2 may be more important in early fetal

heart development whereas IGF-1 appears to be more important to the fetal heart in late gestation

and into adulthood (Cheung et al. 1996). Multiple studies have shown the importance of IGFs in

regulating growth in the fetal heart. IGF-1R and IGF-2R protein has been shown to be increased

in enlarged hearts of fetuses of undernourished ewes, implying IGFs may play a role in the

process of cardiac growth during restricted circumstances (Dong et al. 2005). However, a

decrease in IGF2 mRNA abundance in preterm (111-116 days gestation) ovine hearts was

observed in response to umbilical cord occlusion, but no change was observed in near-term (132-

138 days gestation) fetuses (Green et al. 2000). Also, Sundgren et al. have shown in cultured

fetal cardiomyocytes that IGF-1 stimulates proliferation of the myocytes and that this is mediated

by ERK and PI3K (Sundgren et al. 2003). Moreover, over-expression of IGF1 in transgenic









mice leads to a 50% increase heart weight and a 20-50% increase in total number of myocytes,

with no increase in myocyte hypertophy (Reiss et al. 1996).

IGF1 has been shown to have cardiac specific benefits in injured hearts. For instance,

IGF 1 has been demonstrated to decrease myocyte apoptosis in rats suffering from ischemia-

reperfusion injury (Buerke et al. 1995), and in mice following myocardial infarction (Li et al.

1999). In dogs with induced heart failure, IGF1 reduced myocyte apoptosis and increased

contractile function of the heart (Lee et al. 1999). It is also known that in IGF1 levels are low in

patients with heart failure and that there is a correlation between the severity of ventricular

systolic dysfunction and IGF1 levels (Niebauer et al. 2001, Anker et al. 2001). It was also

observed in the Framingham Heart Study that there is an inverse relationship between plasma

IGF 1 levels risk for congestive heart failure in elderly people who have not previously

experienced a myocardial infarction (Vasan et al. 2003), whereas a positive correlation between

blood pressure and circulating IGF1 levels has also been observed (Andronico et al. 1993,

Valensise et al. 1996). It has also been shown that both IGF1 mRNA and protein increase in the

heart with the development of hypertension (Donohue et al. 1994, Guron et al. 1996).

Furthermore, IGF 1 mRNA expression increases in myocardium of hearts exposed to pressure

overload from aortic banding or renal hypertension (Hanson et al. 1993, Wahlander et al. 1992).

Moreover, chronic infusion of IGF 1 into rats has been shown to lead to cardiac hypertrophy and

enhance hypertrophy of viable myocardium after infarction (Duerr et al. 1995). The observed

increase in cardiac hypertrophy in this study, however, led to improved systolic and diastolic

function without an increase in fibrosis. In humans, there is evidence from those with the disease

acromegaly, in which growth hormone (the primary stimulator of IGF 1 expression) secretion is

increased, that natural over-production of IGF 1 leads to an increase in LV wall thickness (Fazio









et al. 1993, Fazio et al. 1994), whereas humans with growth hormone deficiency exhibit reduced

cardiac mass (Cittadini et al. 1994, Cuocolo et al. 1996, Amato et al. 1993) that is restored upon

growth hormone replacement therapy (Amato et al. 1993, Fazio et al. 1997). These findings

suggest a direct role for IGF1 in maintenance of adult cardiac morphology.

Whereas IGF 1 is thought to be more important in extrauterine life, a -40% reduction in

birth weight has been observed in mice with an inactivated IGF2 gene suggesting IGF2 is

important in fetal growth (Dechiara et al. 1990). The mice from that study were fertile and

appeared normal aside from the reduced growth, but it has also been observed that IGF2 null

mice exhibit delayed lung development at the end of gestation most likely due to decreasing the

plasma corticosterone levels, indicating IGF2 plays an important role fetal lung development

Silvaa et al. 2006). Chronic hypoxia has been shown to increase IGF2 mRNA levels of term

human placentas, implicating the importance of IGF2 in maintenance of nutrient exchange of the

mother and fetus during pregnancy (Trollman et al. 2007). In addition, evidence suggests IGF2

expression is increased in the ovine cotyledon in response to intrauterine growth restriction at 55

days gestation (De Vrijer et al. 2006).

Cortisol is thought to be a potentially key regulator of IGF 1 production within the

developing fetus. In support of this, IGF1 in ovine fetal skeletal muscle appears to be regulated

by plasma cortisol concentrations as IGF1 mRNA expression decreases at the same time as the

prepartum rise in ovine plasma cortisol levels, and this decrease in IGF1 expression is abolished

when fetuses were adrenalectomized while premature increase in circulating cortisol

concentrations in the fetus leads to a premature decrease in IGF 1 mRNA expression in fetal

skeletal muscle (Li et al. 2002). Furthermore, the same thing was found to be true in the

developing ovine liver (Li et al. 1996).









IGF binding proteins 1-6 function to prolong the half life of IGFs in plasma and act to

regulate the biological actions of IGFs vivo. IGFBPs have the ability to modulate the actions of

IGF through regulating transport, turnover, and tissue distribution (Jones et al. 1995). IGFBPs 4

and 6 seem to primarily inhibit IGF actions whereas IGFBPs 1, 2, 3, and 5 have been shown to

both inhibit and potentiate IGF actions (Yin et al. 2004). Previous studies have shown IGFBP2

and IGFBP3 play roles in fetal development. It has been reported that over-expression of

IGFBP2 (Hoeflich et al. 1999) and IGFBP3 (Modric et al. 2001) in mice leads to a -10%

decrease body weight. Maternal nutrient restriction leads to an increase in plasma IGFBP2

levels within the fetus between 90 and 135 days gestation (Ogersby et al. 2004), but did not alter

fetal heart weights. In contrast, Green and coworkers found that umbilical cord occlusion for

four days (107-108 d fetuses) led to no change in plasma IGFBP2 or IGFBP3, but did lead to an

increase in RV mRNA expression of IGFBP2 (Green et al. 2000); there was no change in either

body weight or heart weight with this 4 days of manipulation.

Summary

It has been shown in multiple studies that elevated fetal exposure to cortisol leads to

cardiac enlargement; however, the exact methodology involved has yet to be elucidated. The

objectives of this dissertation were to determine if the heart enlargement is mediated by

corticosteroid receptors within the heart, determine whether the enlargement is due to increased

myocyte proliferation or accompanied by fibrosis, and investigate which genes may be important

in aiding/causing the enlargement. Maintaining proper cortisol levels during pregnancy appears

to be important to proper heart development of the fetus and may have long lasting implications

pertaining to maintenance of heart health and regulating risk for cardiovascular disease

throughout life. This research addressed the mechanisms by which elevated cortisol increases

fetal heart size. In order to answer the specific aims outlined in this dissertation, I used in vivo









chronic catheterization of fetal sheep, immunohistochemistry, radioimmunoassay (RIA),

enzyme-linked immunosorbent assay (ELISA), quantitative real-time polymerase chain reaction,

and western blot analysis.

Specific Aims

* Specific Aim 1: To look for changes in expression of genes potentially important in
cortisol-induced enlargement of the ovine fetal heart.

o The mRNA expression of MR, GR, 1 13HSD1, andl 1PHSD2 along with the IGFs
and IGF receptors and major components of the RAS was studied in LVs from
fetal hearts enlarged from elevated maternal cortisol and control hearts.

o Immunohistochemical analysis was performed to look for location of MR, GR,
1 13HSD1, andl lPHSD2 within the heart.

* Specific Aim 2: To establish the ontogeny of genes in Aim 1 within the ovine fetal LV
and RV.

o The mRNA expression of MR, GR, 1 13HSD1, andl 1PHSD2 along with the IGFs
and IGF receptors and major components of the RAS was studied at various
gestational ages within the LV and RV.

* Specific Aim 3: To determine if the increase in fetal heart weight and wall thickness in
response to increased maternal cortisol is mediated by cardiac corticosteroid receptors, MR
and/or GR, and to determine if cardiac fibrosis accompanies the cardiac enlargement in
response to cortisol.

o Fetal heart mass and wall thicknesses from 4 groups were examined including one
control group with no manipulation. The three other groups were exposed to
elevated maternal cortisol but one group received cardiac blockade of MR,
another one received cardiac blockade of GR, and the other group did not receive
either.

o Picrosirius red staining was utilized to quantify the amount of collagen deposition
that had occurred in each heart.

* Specific Aim 4: To determine if the observed cardiac enlargement from elevated cortisol is
due to an increase in cell proliferation.

o Immunohistochemical analysis was performed to see if there was any difference
in the number of myocytes expressing Ki67 between the four groups.

o PCNA protein was quantified to check for differences in expression between the
groups.










Stress

Hypothalamus

CRH

i


(-) inhibits


(-) inhibits


Cortisol
Figure 1-1. Components of the HPA axis and how it interacts. CRH corticotrophin releasing
hormone, ACTH adrenocorticotropin stimulating hormone.









Cortisone



Cortisol


11IHSD1
.................... Cortisol


119HSD2
SCortisone


(MR protective)
Figure 1-2. Different actions of 11 HSD1 and 2 and how they interact with cortisol.







Angiotensinogen (Liver)

Renin (Kidney)


Angiotensin I

ACE \ ACE2



Angiotensin II Angiotensin 1-9

ACE2

Angiotensin 1-7

Figure 1-3. Components of the renin-angiotensin system.









CHAPTER 2
INCREASED MATERNAL CORTISOL IN LATE GESTATION EWES DECREASES
FETAL CARDIAC EXPRESSION OF 11B-HSD2 MRNA AND THE RATIO OF AT1 TO AT2
RECEPTOR MRNA

Introduction

Regulation of maternal cortisol levels during pregnancy is important for maintenance of

fetal cardiovascular homeostasis and normal fetal growth. Previous studies in this laboratory

have demonstrated that reduction of maternal cortisol levels in late gestation ewes results in

reduced maternal plasma volume and uteroplacental blood flow, altered placental morphology

and reduced fetal growth (Jensen et al. 2002, Jensen et al. 2005). The fetal consequences are

similar to those observed with maternal hypovolemia (Daniel et al. 1989), suggesting that one of

the effects of reduced maternal cortisol is mediated by reduced placental perfusion.

Elevations in maternal cortisol levels in late gestation also have an adverse effect on the

fetus. Studies have indicated that maternal, but not fetal, glucocorticoid infusions reduce the

rate of fetal growth (Newnham et al. 1999, Sloboda et al. 2000). Even modest chronic increases

in maternal cortisol levels increase fetal heart growth while causing a reduction in overall fetal

growth rates (Jensen et al. 2002). This finding is particularly interesting because it has been

suggested that exposure of the fetus to glucocorticoids may have an adverse effect on postnatal

cardiovascular health by preprogramming for hypertension or diabetes later in life (Clark et al.

1998, Roghair et al. 2005, Seckl et al. 1998). In rats, short-term prenatal treatment resulted in

programming effects, including increased postnatal plasma corticosterone levels and blood

pressure (Levitt et al. 1996). In sheep, postnatal hypertension results after glucocorticoid


Reproduced with permission from Reini SA, Wood CE, Jensen E, & Keller-Wood M 2006.
Increased maternal cortisol In late gestation ewes decreases fetal cardiac expression of 11 {beta}-
HSD2 mRNA and the ratio of AT to AT2 receptor mRNA. American Journal of Physiology.
Regulatory, Integrative and Comparative Physiology 291 1708-1716.









treatment only when it is administered in early or mid gestation, and does not occur after

synthetic glucocorticoid treatment in late gestation (Figueroa et al. 2005, Wintour et al. 2003).

Acute glucocorticoid treatment in the late gestation ewe also does not appear to increase fetal

heart weight (Newnham et al. 1999). The mechanisms) by which chronically elevated maternal

cortisol levels cause fetal heart enlargement is not known, but may require chronic corticosteroid

exposure rather than acute glucocorticoid treatment, or may require the presence of agonists of

the mineralocorticoid receptor (MR) rather than, or as well as, agonists of the glucocorticoid

receptor (GR).

The purpose of this study was to investigate gene expression in the fetal hearts in which

ventricular enlargement was measured in response to chronically elevated maternal cortisol

concentrations in a previously published study (Jensen et al. 2005). I hypothesized that cortisol

acts on mineralocorticoid receptors (MR) or glucocorticoid receptors (GR) in the fetal heart to

induce genes involved in cardiac growth. In this study I used quantitative real-time PCR to test

for changes in genes mediating cortisol action, MR and GR, as well as the 110 hydroxysteroid

dehydrogenases (110-HSD1 and 110-HSD2), and genes suspected to be involved in growth:

insulin-like growth factors (IGFs and their receptors), nitric oxide synthase (NOS-3), vascular

endothelial growth factor (VEGF), myotrophin, angiotensin receptors, angiotensinogen, and

angiotensin converting enzymes.

Materials and Methods

Experimental Design

RNA was extracted from the left ventricles taken from three groups of sheep fetuses from a

previous study (Jensen et al. 2005). In that study one group of ewes was treated with cortisol (1

mg/kg/day) between 115-130 days of gestation ("high cortisol" group), a second group of ewes

was adrenalectomized and treated with cortisol (0.5 mg/kg/day) between 115-130 days of

33









gestation ("low cortisol" group), and a third group of normal ewes had no alterations of cortisol

between 115-130 days of gestation ("control group"). The "high cortisol" treatment regime

produces circulating cortisol levels that are chronically elevated, but are within the range of

maternal cortisol levels measured with mild maternal stress. The treatment regime in the "low

cortisol" group produces maternal cortisol concentrations similar to those in nonpregnant ewes.

Plasma hormone concentrations, organ weights and fetal growth rates for these studies have been

previously published (Jensen et al. 2005). Fetal arterial and venous catheters were placed at the

time of surgery; fetal and maternal plasma ACTH and cortisol concentrations were measured in

samples collected on approximately days 120, 125 and 130 of gestation and blood pressure was

measured on days 120 and 130 of gestation. Although there was no overall effect of maternal

cortisol manipulation on maternal cortisol concentrations (maternal plasma cortisol

concentrations, as previously reported (23) at 130d were 7.0 + 1.0 ng/ml in controls, 10 1

ng/ml in the high cortisol and 7.1 0.3 in the low cortisol groups), maternal ACTH

concentrations were increased ten-fold in the low cortisol group and were decreased by

approximately 75% in the high cortisol group. The fetal cortisol concentrations at 130 days

gestation were 5.7 0.9 ng/ml in the control group, 7.4 + 1.0 ng/ml in the high cortisol group,

and 11 3 ng/ml in the low cortisol group. Fetal ACTH levels were increased in the low cortisol

group and decreased in the high cortisol group. These changes in ACTH indicate that the average

cortisol levels over the day must be significantly altered in both ewes and fetuses. Further it is

likely that the increase in plasma cortisol by 130d in fetuses in the low cortisol group result from

the premature increase in plasma ACTH in these fetuses. We reported significant increases in

fetal heart weight and left ventricular wall diameter in the fetuses from the high cortisol group

compared to those in the control group; heart weight was increased by 25% and left ventricular









wall diameter was increased by 38%. There was no significant effect of increased maternal

cortisol manipulation on fetal body weight, crown to rump or whole sternal girth measurements

at necropsy, although there was a reduced rate of fetal sternal girth growth in the last 7 days of

study (Jensen et al. 2005).

Real-Time PCR

Total RNA was extracted (Trizol; Invitrogen, Carlsbad, CA) from 0.2 0.3g of left

ventricular free wall of fetal sheep in the control (n=6), low cortisol (n=4), and high cortisol

group (n=5). All sheep were euthanized and tissues were collected at -130 (129-132) days of

gestation. Total RNA, as well as the RNA to DNA ratio, was measured spectrophotometrically

to identify quantity and quality of RNA. RNA was checked for genomic DNA contamination

using real-time PCR with the RNA as a template in place of cDNA and using probes and primers

for GR (which produces a product within exon 2). RNA was then reverse transcribed into cDNA

using a High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA).

Gene expression was measured using quantitative real-time PCR. The genes analyzed in

this study were MR, GR, 110-HSD1 and 2, IGF-I and II, IGF-1R and 2R, NOS-3, VEGF,

myotrophin, angiotensinogen, ATR1 and ATR2, and ACE1 and ACE2. For measurement of

mRNA for MR and GR (Keller-Wood et al. 2005), IGF-I (Meinel et al. 2003), NOS-3 (Wood et

al. 2005), angiotensinogen (Burrell et al. 2003), 110-HSD2, AT1R and AT2R (Dodic et al. 2002,

Jensen et al. 2005), we used previously published sequences for ovine probes and primers. The

primers for MR and GR were designed in the 3' untranslated region of the MR gene and in exon

2 of the GR gene and therefore detect a and 0 isoforms of MR and GR respectively (Kwak et al.

2003, Lu et al. 2006). Probes and primers used for IGF-1R, IGF-II, IGF-2R, ACE 1 and 2, and

110-HSD1 were designed using Primer Express 2.0 (Applied Biosystems, Table 2-1) based on

ovine sequences in the NCBI database or previously published by others. For the IGF-1R









probe/primer design, the ovis aries IGF-1R sequence (accession number AY162434) was used;

the amplified sequence corresponds to base pairs 319-380. The IGF-II ovine sequence

(accession number M89788) was used for IGF-II probe/primer design (base pairs 385-463) while

the IGF-2R ovine sequence (accession number AF327649) was used for IGF-2R probe/primer

design (base pairs 163-223 of published sequence). For ACE1, primers were designed using the

ovine sequence (accession number AJ920032) between the base pairs of 662-726, while ACE2

primers were designed using an ACE2 bovine sequence (accession number BT021667) between

the base pairs of 1245-1327. For both ACE1 and ACE2 SYBR Green (Bio-Rad, Hercules,

California) was used instead of probes. The primers and probe for 1 10-HSD1 were designed

using the ovine sequence published by Yang et al. (base pairs 664-737 of published sequence)

(Yang et al. 1992). The VEGF probe and primers were designed from the sequence published by

Cheung and Brace (Cheung et al. 1998); the primers will detect the portion of the VEGF gene

that encodes for the splice variants VEGF 120, VEGF 164, VEGF 188, and VEGF 205.

Because there were no published sequences for ovine myotrophin, we used PCR to

amplify a portion of ovine myotrophin from adult heart RNA using primers designed from the

published bovine sequence (accession number NM 203362; forward primer 221-240, reverse

555-574). PCR reactions were then carried out in an UNO II thermocycler (Biometra,

Goettingen, Germany) using a PCR amplification kit (ABI, Foster City, CA). The PCR product

was purified using a DNA purification kit (Promega, Madison, WI) and cloned into a TOPO

vector (Invitrogen, Carlsbad, CA). The size of the product was confirmed on an ethidium

bromide gel, and sequenced at The University of Florida MCBI DNA Sequencing Core

Laboratory. The resulting ovine myotrophin partial gene sequence is shown in Table 2-2. The

sequence obtained was 94% homologous to the corresponding bovine sequence (accession NM









203362.2; bp 321-674) and 90% homologous to the corresponding human sequence (accession

NM 145808.1; bp 286-639). Probe and primers were then designed using Primer Express 2.0

(Applied Biosystems, Table 1).

Real time PCR reactions were performed using an ABI PRISM 7000 Sequence Detection

System (Applied Biosystems). 25 pl reaction volume was used and contained 20 or 100 ng of

cDNA for all genes except 18S, for which 1 ng was used. All probe and primer sets were

checked for efficiency and for linearity of the relation between increasing concentrations of

cDNA and Ct. Samples from all groups were analyzed in triplicate in the same 96 well plate.

18S expression was unchanged between the groups and all genes were normalized to 18S gene

expression by calculating ACt. ACt is calculated as the difference between mean Ct of the gene

of interest and mean Ct of 18S for the same cDNA sample; Ct is the cycle number at which the

threshold amplitude is achieved.

Radioimmunoassay

Fetal plasma angiotensin II levels were measured by radioimmunoassay after extraction

of the peptide from plasma using previously described methods (Pecins-Thompson et al. 1997).

The lower limit of this assay is 1.9 pg/mL, as previously described. Fetal angiotensin II levels

were measured in plasma collected at 120, 125, and 130 days of gestation from fetuses in the

high maternal cortisol group (n=4), fetuses in the control maternal cortisol group (n=7), and

fetuses in the low maternal cortisol group (n=5).

Immunohistochemistry and Collagen Staining

To determine localization of MR, GR, and 11 -HSD1 and 11 -HSD2 in fetal heart,

untreated fetal sheep hearts of 126-128 days gestation were sacrificed, and the left ventricles

were removed and fixed with 4% buffered paraformaldehyde. The tissues were dehydrated with

increasing concentrations of reagent alcohol followed by xylene, and embedded in paraffin wax.









Five pm sections were cut by a Zeiss rotary microtome and placed onto poly-l-lysine coated

slides. Deparaffinization and rehydration were performed using standard methods; following

rehydration endogenous peroxide was quenched using incubation in hydrogen peroxide (0.3%;

Fisher Scientific, Fair Lawn, NJ). Antigen retrieval was then performed by immersion into

sodium citrate buffer at 95 degrees for 30 minutes.

The anti-MR monoclonal antibody G1-18 (provided courtesy of Dr. Elise Gomez-

Sanchez, University of Mississippi Medical Center) and polyclonal antibodies GR M-20, 113-

HSD1 H-100, and 113-HSD2 H-145 (Santa Cruz Biotechnologies, Inc., Santa Cruz, CA) were

used to localize MR, GR, 110-HSD1 (Schmidt et al. 2005), and 110-HSD2 (Kadereit et al. 2005)

in the sections. Immunohistochemistry for MR was performed following the methods described

by Gomez-Sanchez (Gomez-Sanchez et al. 2006) except for the use of biotinylated goat anti-

mouse secondary antibody (Zymed, San Francisco, CA). For immunohistochemical localization

of GR, 110-HSD1 and 110-HSD2, tissue sections were blocked for one hour with 0.05M Tris

pH 7.6, 5% milk, 5% goat serum, and 0.2% SDS, followed by incubation with primary antibody

in blocking solution for one hour, and incubation with biotinylated secondary antibody (goat

anti-rabbit; Zymed) for one hour. As a tertiary agent, streptavidin-peroxidase (Zymed, San

Francisco, CA) was used. Metal enhanced diaminobenzidine (DAB; Pierce) was used as the

chromogen. Control sections were similarly treated, but were incubated in blocking solution

without primary antibody.

Some sections were stained with picrosirius red (Electron Microscopy Sciences, Hatfield,

PA) which stains for collagen. Sections were hydrated as mentioned before and treated with

0.2% phosphomolybdic acid. The sections were immersed in sirius red (0.1% in saturated picric

acid). Finally, the sections were washed with 0.01 N hydrochloric acid, rinsed in 70% alcohol,









dehydrated, and mounted in permount. All images were visualized using a Zeiss Axioplan 2

microscope and a SPOT Advanced digital imaging system (McKnight Brain Institute, University

of Florida).

Data Analysis

Changes in gene expression among groups were analyzed by one way analysis of variance

(ANOVA) using the ACt values. For graphical purposes, fold changes of the genes were

calculated using the expression 2A-AAct in which AACt is the difference between ACt for the

sample and mean ACt for the same gene in the control group (Livak et al. 2001). Comparisons

of MR, GR 11HSD1, and 11 PHSD2 gene expression were made by comparison of the ACt

values for each gene relative to the 18S value; statistical analysis used paired t-test for

comparison of two genes within the same tissue sample and t-test for comparison of the same

gene in heart vs kidney.

Values for plasma angiotensin II concentration were compared by two-way ANOVA to

determine significance across the cortisol treatment groups and gestational ages.

Linear regression analyses were performed to assess the relation between left ventricular

wall thickness and fetal plasma angiotensin II concentrations levels, fetal plasma cortisol

concentrations levels, AT1R mRNA, AT2R mRNA, IGF mRNA, IGF-R mRNA, 110-HSD1

mRNA, 11 P-HSD2 mRNA, angiotensinogen mRNA, MR mRNA and blood pressure.

Backward stepwise multiple linear regression was also performed to identify significant

relationships between a series of possible independent variables and left ventricle wall

thicknesses.









Results


Real-Time PCR Analysis

Expression of MR and GR

Real-time PCR analysis demonstrated expression of both MR and GR in the ovine fetal

heart at 130 days. There was no significant difference in MR or GR gene expression between the

high, low, and control maternal cortisol groups (Figure 2-1). GR expression relative to 18S was

significantly greater than that of MR relative to 18S in the control fetal hearts (by 13 fold).

However MR expression relative to 18S was significantly greater in fetal heart relative to that in

fetal kidneys from the same fetuses (mean 2.6 fold difference).

Expression of 11P-HSD1 and 2

Real-time PCR analysis demonstrated expression of both 110-HSD1 and 110-HSD2 in

fetal hearts. 110-HSD2 expression relative to 18S in control hearts was significantly lower (by

5.5 fold) than 11-HSD1 expression relative to 18S in the same hearts. 11-HSD2 expression

relative to 18S in heart was significantly lower than 110-HSD2 in kidney (by 750 fold). No

significant change in 11-HSD1 expression was demonstrated in response to high or low

maternal cortisol levels. 110-HSD2 expression, however, was significantly lower in the high

cortisol as compared to the control and low cortisol groups (Figure 2-1).

Expression of myotrophin, NOS-3, and VEGF

Expression of myotrophin, NOS-3, and VEGF mRNA in left ventricle were all

unchanged in response to high or low maternal cortisol levels (Figure 2-2).

Expression of IGF-I and II, IGF-1R and 2R

No significant change in expression of IGF-I, IGF-II, or IGF-2R was found among the

cortisol groups. IGF-1R expression significantly decreased in response to high maternal cortisol

levels as compared to control and low maternal cortisol levels (Figure 2-3).









Expression of angiotensinogen, AT1R, AT2R, ACE1, and ACE2

I found that there were no significant differences in angiotensinogen, AT1R, AT2R,

ACE1, or ACE2 gene expression in the fetal left ventricle among the maternal cortisol groups

(Figure 2-4). However, I found that AT1R mRNA tended to decrease, whereas AT2R mRNA

tended to increase, in fetuses of ewes with increased cortisol as compared to controls. There was

a statistically significant increase in the ratio of AT2 to AT1 receptor expression in the high

cortisol group (Figure 2-4, C).

Immunohistochemistry and Collagen Staining

MR, GR, and 1 10-HSD1 staining was found in both cardiac blood vessels and myocytes

in normal fetal hearts, while 110-HSD2 showed very limited staining in myocytes and slightly

more in blood vessels (Figure 2-5). GR positive cells were found in all layers of the blood

vessel; MR, 110-HSD1, and 110-HSD2 appeared to be localized in both endothelial cells and the

underlying smooth muscle cells. MR and 110-HSD1 staining was more marked in the

endothelial cells than in the underlying layers, and 110-HSD2 staining was more marked in the

vascular smooth muscle layer than in endothelial cells. MR, 110-HSD1 and 110-HSD2 positive

cells did not appear to co-localize with picrosirius red staining regions (collagen containing

regions surrounding the blood vessels), whereas there were some GR-positive cells apposing the

collagen-rich regions, suggesting GR expression in fibroblasts.

Plasma Angiotensin II

Fetal plasma concentrations of angiotensin II tended to increase from day 120 to day 130

in response to the high cortisol as compared to the angiotensin II levels in the control group,

which appear to remain relatively constant between days 120-130 (Table 2-3). The rise in fetal

plasma angiotensin II levels in the high maternal cortisol group, however, was not statistically

significant.









Regression Analysis

Linear regression analysis revealed a significant negative relationship between 110-

HSD2 mRNA in the heart and left ventricular wall thickness (r=0.624, P<0.02; Figure 2-6).

There was no correlation between left ventricular wall thickness and either fetal blood pressure

(r=0.015, p=0.96) or fetal plasma cortisol on day 130 (r=0.214, p=0.48), however fetal cortisol

was elevated in the low cortisol as well as the high cortisol group by 130d. There were also no

correlations between left ventricular wall thickness and either MR (r=0.113, p=0.71) or GR

expression (r=.065, p=0.83) in the hearts. Negative relationships of left ventricular wall

thickness with 1 13-HSD1, AT1R and IGF-1R which did not reach statistical significance were

also noted (110-HSD1: r =-0.544, p=0.054; AT1R: r=-0.458, p=0.058; IGF-1R: r=-.0541, p=

0.056). A weak positive relation between left ventricular wall thickness and plasma angiotensin

II concentration on day 130 (r=0.468, p=0.063) was also found.

Backward stepwise multiple regression was used to assess the correlation between left

ventricle wall thickness (dependent variable) to a series of independent variables: left ventricular

AT1R and AT2R mRNA expression, 11-HSD1 and 11-HSD2 mRNA expression,

angiotensinogen mRNA expression, MR mRNA expression, IGF-I and II mRNA expression, and

IGF-1R and IGF-2R mRNA expression, as well as fetal plasma angiotensin II levels at 130 days,

and blood pressure on day 130. Backward stepwise multiple regression using left ventricle

thickness as the dependent variable identified a significant relationship (overall r = 0.897,

p<0.01) between left ventricular wall thickness and AT2 to AT1 mRNA ratio, 110-HSD1

mRNA, and 11-HSD2 mRNA.

Discussion

In this study I found that both MR and GR are expressed in the fetal heart, as in adult

myocytes in many species, including humans (Lombes et al. 1999). I found that MR and









1 1pHSD1 gene expression are relatively abundant in ovine fetal heart. The results suggest that

small increases in cortisol could influence fetal heart size via action at the MR or GR receptors in

the fetal heart. These results further suggest that changes in the ratio of angiotensin receptors

(AT1 and AT2) may be a downstream mechanism for the effect of cortisol.

Role of Corticosteroids Acting at MR or GR

Action of cortisol in tissues depends on the expression of MR and/or GR and activity of

1 13HSD1 and 11 HSD2. Whereas 11 -HSD1 primarily converts cortisone into cortisol in most

tissues (Seckl et al. 2001), 110-HSD2 converts cortisol into cortisone, which is inactive at MR

and GR (Mihailidou et al. 2005). Further, action of 11 -HSD2 alters intracellular redox state,

which may reduce the ability of cortisol to activate MR after binding. Thus in epithelial tissues

such as kidney, high levels of 110-HSD2 co-expressed with MR results in a "MR protective"

effect which reduces basal MR activation by cortisol or corticosterone, but permits aldosterone

action at the MR receptors (Mihailidou et al. 2005). However in normal hearts, MR are

expressed during fetal life (by E13.5 in murine heart), but there is relatively little expression of

110-HSD2 in prenatal mouse hearts nor isl 13-HSD2 appreciably expressed in cardiomyocytes

postnatally (Brown et al. 1996, Thompson et al. 2004)

It has also been suggested that low 110-HSD2 activity in adult hearts allows cortisol as

well as aldosterone to have detrimental effects on the heart (Funder et al. 2005, Glorioso et al.

2005). Evidence for both MR-mediated and GR-mediated effects on the heart have been found.

In adult animals, aldosterone action at MR is thought to cause cardiac hypertrophy and fibrosis

after ischemia (Fiebeler et al. 2003, Fraccarollo et al. 2004). In humans with severe heart

failure, there is a reduction in severity of cardiac hypertrophy after blockade of the MR receptor

(Pitt et al. 1999). On the other hand activation of either MR or GR alone have little effect on

hypertrophy in cultures of neonatal myocytes, but GR have been shown to potentiate the effect of









phenylephrine on hypertrophy in neonatal myocytes (Lister et al. 2006). Interestingly, in 11 -

HSD2 knockout mice postnatal mortality is high, but surviving mice have enlarged hearts

without evidence of cardiac fibrosis (Kotelevtsev et al. 1999), suggesting that fibrosis only

occurs in adult hearts, or when hearts have been subjected to ischemic damage. Overexpression

of 11 P-HSD2 in murine cardiomyocytes, however, results in cardiac hypertrophy, interstitial

fibrosis, and heart failure (Qin et al. 2003). This effect is markedly reduced by treatment with

the MR blocker eplerenone; the effect is thought to be mediated by an increased access of

aldosterone to MR in the myocytes with high levels of 113HSD2, and suggests that MR binding

with aldosterone produces a greater hypertrophic effect than does corticosterone binding at MR

and GR.

Recently it was shown that cortisol stimulates cell cycle activity in cardiomyocytes of near

term fetal sheep infused with cortisol into the circumflex artery. These results suggest that

cortisol can act directly on the fetal heart to stimulate hyperplastic, but not hypertrophic, growth

(Giraud et al. 2006). This suggests that the effects seen in our study, with even lower levels of

circulating cortisol in the fetus, may be due to hyperplasia rather than hypertrophy.

Although I cannot determine from these studies whether MR or GR are responsible for the

observed effects, the relative levels of MR and of 1 13HSDs suggest that action at MR as well as

at GR could be involved. In ovine fetal heart both MR and GR were expressed in myocytes, and

11 HSD1 appears to predominate over 11 HSD2 expression, particularly in the myocytes. In

sheep as in other species, MR has greater affinity for cortisol than does GR (Richards et al.

2003), and MR affinity for cortisol and aldosterone is similar. In fetal sheep plasma aldosterone

concentrations are relatively low, so that basal occupancy of MR by either cortisol or aldosterone

is expected to be much less than 100%. However the increase in fetal plasma cortisol occurring









with maternal cortisol infusion in this study would be expected to cause a substantially greater

change in MR occupancy than in GR occupancy because of the difference in affinity of cortisol

for these two receptor subtypes. Left ventricular wall thickness was negatively correlated to

abundance of 1 10-HSD2 mRNA (Figure 5), suggesting that decreased inactivation of cortisol in

the fetuses of the ewes treated with cortisol might play a role in chronic stimulation of cardiac

growth.

Additionally, my data show that while MR, GR, and 11 -HSD1 appear to be localized to

blood vessels and myocytes in the fetal heart, 110-HSD2 seems to be more highly expressed in

blood vessels than in myocytes, and in vascular smooth muscle than in endothelial cells. In the

vasculature, 110-HSD2 is thought to modulate vascular reactivity and may limit cortisol

activation of MR (38). I do not have any data regarding distribution of 113HSD2 in tissues from

the treated fetuses, and so I cannot speculate on whether the decrease in 11 HSD2 with maternal

cortisol infusion altered myocyte or vascular expression of the protein.

These data suggest that the heart enlargement is not an indirect effect of cortisol via

changes in fetal blood pressure. In the previous publication from this study it was reported that

fetal blood pressure was not significantly elevated by the chronic maternal infusion of cortisol

(Jensen et al. 2005); fetal mean arterial pressure at 130d was 50.4 + 1.5 mmHg in the high

cortisol group, and 47.8 + 2.1 mmHg in the control group. Neither linear regression nor

backward stepwise multiple regression analysis showed a significant relationship between

change in blood pressure from day 120-130 and left ventricle wall thickness. Studies in several

animal models of hypertrophy, including hypertrophy induced by deoxycorticosterone (DOC) or

carbenoxelone (an 110-HSD inhibitor), have shown that the MR blocker eplenerone inhibits the

effect on cardiac hypertrophy and inflammatory markers without altering blood pressure (Young









et al. 2003). These data suggest that the increase in left ventricular wall thickness was not

secondary to increases in fetal arterial pressure, but by other steroid receptor mediated

mechanisms.

Role of Growth-Related Genes: VEGF, eNOS, Myotrophin and IGFs

Several genes that might be expected to be related to growth were not found to be

increased. I reasoned that since the fetal hearts were enlarged in the high cortisol group, perhaps

angiogenesis was being stimulated by VEGF and NOS-3 in these hearts; however neither of

these genes was significantly increased in fetal left ventricle among the maternal cortisol

treatment groups (Figure 2). Myotrophin was also not increased in the enlarged hearts (Figure

2). Myotrophin has been suggested as a causal agent in cardiac hypertrophy in both humans

and in rodents (Anderson et al. 1999, Sarkar et al. 2004, Shanmugam et al. 1996). In mice,

over-expression of myotrophin causes cardiac hypertrophy, and pressure overload causes a

ventricle-specific increase in myotrophin as well as wall thickness. Treatment of cultures of

neonatal myoctes with myotrophin increased the size of the myocytes and stimulated protein

synthesis without increasing DNA synthesis. The absence of a change in myotrophin mRNA in

our study suggests, therefore, that the increased size of the fetal heart may result from

hyperplasia rather than hypertrophy.

IGF-I stimulates proliferation of cardiomyocytes in cultures from fetal sheep hearts

(Sundgren et al. 2003), and increased IGF protein has been implicated in the increase in heart

size in fetuses of undernourished ewes (Dong et al. 2005). However, our findings suggest that

the insulin-like growth factors may not be important in the cortisol-induced heart enlargement

effect, as high cortisol levels appear to have a negative influence on IGF-1R mRNA expression

in the heart. This should not be surprising as increases in cortisol at term have been shown

previously to be responsible for IGF-I and IGF-II down-regulation in skeletal muscle in fetal









sheep (Li et al. 2002, Li et al. 1993); glucocorticoids have also been shown to decrease IGF-2R

in fetal rat osteoblasts in culture (Rydziel et al. 1995). However, IGFs may play a role in the

enlargement through differential regulation of the IGF actions by the IGF binding proteins; more

studies regarding the IGF and IGF binding proteins concentrations in fetal plasma and fetal heart

in this model are needed before it can be concluded that IGFs do not play any role in the

enlargement.

Role of the Renin-Angiotensin System

The observation regarding the relative mRNA expression of AT2 to AT1 receptors in the

fetal hearts suggest that the renin-angiotensin system could play a role in cortisol-induced fetal

heart enlargement. In adult hearts, angiotensin appears to cause fibrosis and hypertrophy (Zhu et

al. 2003); whereas infusion of angiotensin II in fetal sheep stimulates left ventricular growth

(Segar et al. 2001), in cultures of ovine fetal cardiomyocytes, angotensin II stimulates

hyperplastic growth (Sundgren et al. 2003). Although these results indicate that fetal plasma

angiotensin II concentrations tend to increase in response to the chronic cortisol infusion when

compared to the saline infused control group, it is not likely that the increase in plasma

angiotensinper se stimulates the increase in wall thickness. Fetal plasma angiotensin II levels

also tend to increase in the low maternal cortisol group; this increase in the fetuses of the ewes

with reduced cortisol probably results from the dramatic increase in fetal ACTH and cortisol

levels by 130d (Jensen et al. 2005). I found no correlation between plasma angiotensin II levels

and the increase in left ventricular wall thickness, also suggesting circulating angiotensin is not

the direct mediator of this effect.

Local production of angiotensin has been implicated in a previous study of cortisol-

induced fetal heart growth in fetal sheep. A recent study (Lumbers et al. 2005) demonstrated that

a more acute treatment with much larger doses of cortisol (approximately 72 mg/d for 2-3 days)









directly into the fetus late in gestation caused left ventricular hypertrophy and increased

angiotensinogen gene expression in the heart. However the mechanism for the effect of these

much larger doses of cortisol is likely to be different than the mechanism in our study. In the

present studies we found that expression of angiotensinogen in the left ventricle tended to

decrease. The differences between these studies could be related to the cortisol levels produced

(> 300 ng/ml) which would maximally activate both MR and GR, or secondary to the larger

increase in blood pressure produced by the greater dose of cortisol (46.7 + 1.5 control mean

arterial pressure increased to 59.7 2.0 in cortisol treated). As dexamethasone treatment results

in increased expression of angiotensinogen in cultured neonatal myocytes (Dostal et al. 2000),

the effect on angiotensinogen may require higher concentrations of cortisol exerting effects via

the GR. Nevertheless, it is possible that there was an initial transient rise in cardiac

angiotensinogen in our chronic model.

The enzymes ACE1 and ACE2 can also regulate local levels of angiotensin II in the heart.

ACE1 is an enzyme that converts angiotensin I into angiotensin II and has been found to

augment cardiac hypertrophy when over-expressed in rat hearts (Tian et al. 2004) and induce

cardiac arrhythmia, enlargement of the atria, and sudden death when over-expressed in mouse

hearts (Xiao et al. 2004). ACE2, however, is thought to be cardio-protective because it converts

angiotensin I into angiotensin 1-9 and angiotensin II into angiotensin 1-7, thereby limiting the

amount of angiotensin II that is produced (Danilczyk et al. 2006). I observed no significant

change in ACE1 or ACE2 mRNA expression between the cortisol groups, again suggesting local

production of angiotensin II is not playing a major role in the enlargement.

In my study the magnitude of the increase in ventricular wall thickness was related to the

relative expression of AT2 and AT1 receptors. My finding that the ratio of AT2 to AT1 receptor









mRNA ratio increases also differs from that of Lumbers; they found no significant change in

expression in either of the receptors (Lumbers et al. 2005). In adult hearts, the hypertrophy

caused by angiotensin II is thought to be mediated by AT1 receptors (Zhu et al. 2003). It has

been observed in human hearts that are failing, AT2 receptor expression increases or remains

constant while AT1 receptor expression decreases (Segar et al. 1997). The AT2 receptor is

traditionally believed to have anti-AT1 receptor-mediated effects, whereas the AT1 receptor is

known to be pro-growth (Dostal et al. 2000). Other studies in adult hearts have indicated that an

increase in AT2 to AT1 receptor ratio in the heart is associated with an anti-growth effect in

response to cardiac hypertrophy (Booz et al. 2004). It is therefore possible that the rise in the

AT2R to AT1R ratio is simply a chronic response which limits cardiac growth. However it is

also intriguing to hypothesize that the AT2 receptor has a different role prenatally and performs

different actions in the period of normal heart growth in fetal life than in the response to

hypertrophy in adult life. In support of this hypothesis is the observation that AT2 receptors are

more highly expressed in many tissues in fetal or neonatal life relative to adult life. The role of

AT2 receptors in fetal heart is not clear; in mice disruption of AT2 receptors does not result in

histologic changes in the heart (Hein et al. 1995), and in rats there is no expression of AT2

receptors in myocytes at any age (Shanmugam et al. 1996). In the fetal sheep, AT2 receptors are

more abundant in the heart than in other tissues and are much more abundant than in adult heart;

in fact AT2 receptors rapidly decrease in expression at birth (Burrell et al. 2003). Although AT2

receptors do not appear to be involved in right ventricular hypertrophy after pulmonary artery

banding, or to be involved in basal growth of the left or right heart (Segar et al. 1997), more

studies are needed regarding the balance between actions mediated by AT1 and AT2 receptors

on the late gestation myocyte and their role in cortisol-mediated heart growth in late gestation.









In conclusion, these data suggest the possibility that enlargement of the fetal heart can be

induced by direct actions of cortisol on MR and/or GR in fetal cardiac myocytes. An action of

cortisol in the fetal heart is supported by the relatively low expression of 110-HSD2, which

would allow the relatively low circulating concentrations of cortisol in fetal plasma to activate

MR, and to a lesser extent, GR. Furthermore, our data suggests that genes related to cardiac

hypertrophy are not stimulated and that the growth is independent of changes in blood pressure,

but that local changes in myocyte and/or coronary vasculature activation by cortisol are involved.

My data also suggest that changes in the renin-angiotensin system may play a role in the

ventricular growth through changes in relative expression of AT 1 to AT2 receptors. Further

studies will be required to test these hypotheses. It is important to note that the observed changes

in cardiac size and in gene expression occur with relatively small increases in maternal cortisol,

well within the range measured in response to rather modest stress in the ewe, and with fetal

cortisol levels within the range which will be produced later in gestation as the fetus matures.

Although the increase in size of the fetal heart may reflect premature activation of left venticular

growth, the maternal cortisol infusion also reduces thoracic girth of the fetus. Thus the elevation

of maternal cortisol produces cardiac growth which is disproportionate to overall fetal growth.








MR A






GR B

T T


Figure 2-1. Gene expression of corticosteroid receptors and 1 10-HSDs in the LV. Expression of
mRNA for MR (A), GR (B), 110-HSD1 (C), and 110-HSD2 (D) in left ventricles
from fetuses of the control (open bars), high (gray bars), and low maternal cortisol
(black bars) groups. Fold changes of the genes were calculated using the expression
2A-AACt with respect to the control group and are expressed as mean fold change +
SEM.. *p<0.05 vs control


11PHSD1 C





11HSD2 D
11PHSD2 D

I T












2.5
Myotrophin
2.0
A
1.5 -

1.0

0.5

0.0

2.5
eNOS
2.0 B
1.5
o
1.0

L. 0.5
0.0

2.5
VEGF
2.0

1.5

1.0

0.5
0.0



Figure 2-2. Gene expression of Myotrophin and vasculogenesis related genes in the LV.
Expression of mRNA for myotrophin (A), eNOS (NOS-3; B), and VEGF (C) in left
ventricles from fetuses of the control (open bars), high (gray bars), and low maternal
cortisol (black bars) groups. Data are expressed as in Figure 2-1. *p<0.05 vs control










IGF-I
A






IGF-II
C


IGF-1R
B






IGF-2R
D


Figure 2-3. Gene expression of IGFs and IGF receptors in the LV. Expression of mRNA for
IGF-I (A), IGF-1R (B), IGF-II (C), and IGF-2R (D) in left ventricles from fetuses of
the control (open bars), high (gray bars), and low maternal cortisol (black bars)
groups. Data are expressed as in Figure 2-1. *p<0.05 vs control








AT1
A




ACE1

D D


AT2


AT2R to AT1R
*


L 3:


I 2


ACE2
E


Angiotensinogen
F


Ir Iii


Figure 2-4. Gene expression of the RAS in the LV. Expression of mRNA for AT1R (A), AT2R
(B), ACE1 (D), ACE2 (E) and angiotensinogen (F) in left ventricles from fetuses of
the control (open bars), high (gray bars), and low maternal cortisol (black bars)
groups. Data are expressed as fold changes as in Figure 2-1. The ratio of AT1R to
AT2R mRNAs in left ventricles from each group are shown in Panel C. *p<0.05 vs
control









A B C D










Figure 2-5. Localization of corticosteroid receptors and 1 10-HSDs in the LV.
Immunohistochemical localization of MR (A), GR (B), 1 1 P-HSD1(C) and 1 10-
HSD2 (D) in hearts of untreated fetal sheep; 40x power. Arrow indicates location of
blood vessel with positive staining.





























5--
17.5


18.0 18.5 19.0 19.5 20.0








18.0 18.5 19.0 19.5 20.0


ACt 11 HSD2
Figure 2-6. Linear regression correlation of 11 -HSD2 mRNA and left ventricular wall
thickness. There was a significant negative relationship between the expression of
11P-HSD2 mRNA and left ventricular wall thickness (r=0.624, P<0.02). 11P-HSD2
mRNA levels are expressed as ACt using ribosomal RNA as the reference; higher
ACt indicates relatively lower expression of 113-HSD2.









Table 2-1. Primers and Probes used in real-time PCR assays.
GENE Forward Primer Reverse Primer
Nucleotide Sequence (5'-3') Nucleotide Sequence (5'-3')
IGF-II CTGCCTCTACGACCGTGCTT TGCTTCCAGGTGTCAGATTGG
IGF-1R AACTACACAGCCCGGATCCA ACACAGGCTCCGTCCATGAC
IGF-2R CTCACGGACGAGCAGCTGTAC CGGGTCACCTTGAAGGTGTT
VEGF GCTCTCTTGGGTGCATTGGA TGCAGCCTGGGACCACTT
Myotrophin GGCGCCGATAAGACTGTGA CCTGGTTGTCAGTGGCTTCA
110-HSD1 GGAATATGAGGCGACCAAGGT TGGCTGTGTCTGTGTCGATGA
ACE1 CCAAATATGTGGAGCTCACCAA GGAGTCCCCGCCATCC
ACE2 GCAGCCACACCTCACTATTTGA AGGAAGTTTATTTCTGTTTCATTGTCTTC
Probe
Nucleotide Sequence (5'-3')
IGF-II TCACAGCATACCCCGTGGGCAAG
IGF-1R CCACCTCTCTCTCTGGG
IGF-2R TTCAACCTGTCCAGCCTCTCCAA
VEGF CCTTGCCTTGCTGCTCTACCTTCACCA
Myotrophin CCCCGATGGGCTGACTGCCC
110-HSD1 ATGTGTCAATCACCCTCTGTATTCT
ACE1 (SYBR)
ACE2 (SYBR)









Table 2-2. Partial sequence of ovine myotrophin.
GACTATGTGGCCAAGGGAGAAGATGTCAACCGGACACTAGAAGGTGGAAGAAAGC
CTCTTCATTATGCAGCAGATTGTGGACAGCTTGAAATCCTGGAATTTCTGCTGCTGA
AAGGAGCAGATATTAATGCTCCAGATAAACATCATATCACACCTCTTCTGTCTGCCG
TCTATGAAGGTCATGTTTCCTGCGTGAAATTGCTTCTGTCAAAGGGCGCCGATAAGA
CTGTGAAAGGCCCCGATGGGCTGACTGCCCTTGAAGCCACTGACAACCAGGCGATC
AGAGCCCTCCTTCAGTGACGGACGGCGGGCTGACGGCTCTGGAAGGGTGGCTCTCC
TGTGCCTTCACACTG









Table 2-3. Fetal plasma angiotensin II levels (pg/ml) in fetuses in the high, control, and
low maternal cortisol groups at 120, 125, and 130 days gestation.
120 Days 125 Days 130 Days
Control (n=7) 88 19 95 18 95 10
High (n=4) 71 + 17 87 + 13 131 28
Low (n=5) 70 7 112 17 117 15
Data are expressed as mean SEM.









CHAPTER 3
ONTOGENY OF GENES RELATED TO OVINE FETAL HEART GROWTH:
IMPLICATIONS FOR GROWTH SECONDARY TO INCREASED CORTISOL

Introduction

There is a pronounced increase in fetal heart growth in the last third of gestation,

paralleling a similar exponential growth of the fetus (Burrell et al. 2003, Jonker et al. 2007) At

the same time as the heart is increasing in both total weight and left and right ventricle wall

mass, an increasing number of myocytes terminally differentiate. This process results in

binucleate or multinucleate myocytes which are unable to undergo further cell division (Burrell

et al. 2003, Jonker et al. 2007). A similar pattern of decreasing proliferative activity near term

has also been described for the human fetus (Huttenbach et al. 2001). Several factors have been

identified as regulators of proliferation in the fetal heart in late gestation, these include cortisol

(Giraud et al. 2006),IGFs (Liu et al. 1996, Sundgren et al. 2003), and angiotensin (Sundgren et

al. 2003). My laboratory has found that small increases in fetal cortisol increase fetal heart

weight and wall thickness (Jensen et al. 2005) and that this effect can be blocked by intracardiac

administration of corticosteroid receptor antagonist (Reini et al. 2008).

Fetal secretion of cortisol increases exponentially before birth in humans and in sheep

(Liggins et al. 1974), and induces maturation of intestine (Arsenault et al. 1985, Galand et al.

1989), lung (Ballard et al. 1996, Liggins et al. 1972) and liver (Fowden et al. 1995, Fowden et al.

1993). The role of cortisol in the fetal heart, however, remains unclear. In a previous study, I

investigated the expression levels of a series of genes thought to be potential influential factors in

cortisol-induced fetal heart enlargement (Reini et al. 2006). mRNA Expression of the 11 beta

hydroxysteroid dehydrogenase, 110-HSD2, was decreased in the fetuses of cortisol-treated,

whereas the ratio of angiotensin type 2 receptor mRNA was increased relative to that of the

angiotensin type 1 receptor.









The objective of this study was to determine the expression levels of the genes relating to

actions of corticosteroids, angiotensin and IGFs in fetal left (LV) and right ventricles (RV)

during normal development in late gestation and into early postnatal life. For this I used

quantitative real-time (qrt) PCR to quantify gene expression levels of MR, GR, 110-HSD1, 113-

HSD2, the IGFs, their receptors and binding proteins, and the components of the angiotensin

system (angiotensin type 1 receptor, AT1R, and the angiotensin type 2 receptor, AT2R,

angiotensin converting enzyme 1 and 2, and angiotensinogen) during late gestation and early

extra-uterine life. Jonker and coworkers, have demonstrated that the development of the left

and right ventricle in fetal sheep differs slightly during the last third of gestation in that the right

ventricle contains myocytes with a larger volume, and a higher percentage of myocytes in the

cell cycle compared to the left ventricle (Jonker et al. 2007). These ventricle specific differences

in development observed within the heart led us to also hypothesize that the changes in gene

expression may differ in the LV compared to the RV, reflecting differences in myocytes

proliferation or perhaps in anticipation of the greater work load after parturition. We

hypothesized that MR, GR, 110-HSD2, IGF2, IGF-2R, and AT2R (mRNA and protein) would

decrease as pregnancy progressed while IGF1, IGF-1R, and AT1R would increase as pregnancy

progressed, particularly in the right ventricle.

Materials and Methods

Real-Time PCR

RNA was extracted from left ventricles (LV) and right ventricles (RV) from time-dated

pregnant ewes at 80 (n=4), 100 (n=4), 120 (n=4), 130 (n=4), and 145 (143-146) (n=5) days of

gestation and from newborn lambs (days 1, 2 and 7) (n=8 for LV, n=4 for RV). RV was not

extracted from the 130 day heart. RNA was extracted using Trizol according to the

manufacturer's directions. LV RNA samples were checked for genomic DNA contamination









using real-time PCR with the RNA as a template in place of cDNA and using probes and primers

for GR (which produces a product within exon 2). LV samples did not contain genomic DNA

contamination. Genomic DNA was removed from RV samples using RNeasy Plus Mini Kit

(Qiagen Inc., Valencia Ca). Total RNA was measured spectrophotometrically to measure the

quantity and quality of RNA. Reverse transcription of the RNA into cDNA was then performed

using a high capacity cDNA archive kit (Applied Biosystems; Foster City, CA) and aliquots for

cDNA were stored at -200C until used.

Qrt PCR was utilized to measured gene expression. The genes analyzed in this study for

the LV were MR, GR, 11 -HSD1 and 2, IGF-I and II, IGF-1R and 2R, IGF binding proteins 2

and 3 (IGFBP2 and, IGFBP3), angiotensinogen, ATR1 and 2, and angiotensin converting

enzymes (ACE1 and ACE2). The same genes were studied in RNA from RV except for

IGFBP3. Probe and primer sequences were based on previously published sequences: MR and

GR (Keller-Wood et al. 2005), IGF-I (Meinel et al. 2003), angiotensinogen (Burrell et al. 2003),

11 HSD2, AT1R and AT2R (Dodic et al. 2002), IGFBP2 and IGFBP3 (Bloomfield et al. 2006),

and for 11 HSD1, IGF-II, IGF-1R, IGF-2R, ACE1 and ACE2 (35). For ACE1 and ACE2,

SYBR Green (Bio-Rad) was used instead of probes. An ABI PRISM 7000 Sequence Detection

System (Applied Biosystems) was used to carry out the qrt PCR reactions. Reactions were

carried out using 20 or 100 ng of template cDNA, except in the case of ribosomal RNA, for

which 1 ng of template was used. All genes were normalized to 18s ribosomal RNA, and data

was analyzed using the ACt method (Livak et al. 2001). 18s expression was unchanged between

all the groups within each tissue.

Data Analysis

Changes in gene and expression among groups were analyzed by one way analysis of

variance (ANOVA) using the ACt values. When data was not normally distributed, the Kruskal-









Wallis one way analysis of variance on ranks was utilized. Duncan's test or Dunn's test were

used as appropriate for comparing differences between ages, and p<0.05 was used as the

standard for significance in all statistical tests. For graphical purposes, fold changes of the genes

in the heart ontogeny study were calculated using the expression 2A-AACt with respect to the mean

value of delta Ct in the 80d fetal group.

Results

Expression of MR, GR, and 11P-HSD1 and 2 mRNA

There were significant ontogenetic changes in MR, GR, and 1 13-HSD1 mRNAs in fetal

left ventricles (Figure 3-1) ; MR and 1 10-HSD1 and 2 mRNAs also changed ontogenetically in

the right ventricle, but GR did not significantly change as a function of age in the right ventricle

(Figure 3-1). MR mRNA expression was greatest in fetal LV at 80d and is significantly

decreased at 130 days of gestation and in newborns. GR mRNA was also greatest at 80d, and

decreased at 120, 130 d and in the newborn LV. This pattern differed from that in RV; MR

mRNA in RV was significantly decreased at 100d compared to all other ages. In LV 1 10-HSD1

mRNA expression was significantly decreased at 120 days gestation compared to 80 days and

145 days gestation. 11P-HSD2 mRNA expression in LV did not change throughout gestation.

In RV, 1 10-HSD1 and 110-HSD2 mRNA expressions were highest in the newborns. The ratio

of mRNA expression of 11 0-HSD 1 to 110-HSD2 was unchanged throughout the ages studied in

LV, but was significantly decreased in the RV at 145 days compared to 100 days gestation

(Table 3-1).

Expression of IGF1, IGF-1R, IGF2, IGF-2R, and IGFBP2

There were ontogenetic changes in expression of IGF2, IGF1R, IGF2R, and IGFBP-2

mRNAs in the LV and IGF2, IGF2R, and IGFBP2 mRNAs in the RV (Figure 3-2). IGF1

mRNA expression did not change in either RV or LV over the ages studied. In contrast, IGF2









mRNA expression was greatest at 80-100 days in both LV and RV, and significantly decreased

in the LV and RV from older animals; IGF-2 mRNA expression was lowest in the newborn LV

or RV. The mRNA for IGF type 1 receptor was also decreased in LV after 120days, but did not

change in RV. The mRNA for IGF type 2 receptor was also decreased after 120d in LV, but was

significantly decreased only after 130d in RV. As a result of these changes in IGF2 mRNA, the

ratio of expression of IGF 1 to IGF2in the LV and RV were increased in late gestation (Table 3-

1). In the LV the ratio was increased on day 120 compared to day 100 and on day 145 compared

to 80 and 120 days, and was markedly increased in postnatal hearts compared to all gestational

ages. In the RV the ratio of the expression ofIGF1 to IGF2 was increased at 130 and 145 days

gestation compared to the earlier gestational ages and the ratio in the postnatal RV was elevated

compared to all gestational ages except for 145 days.

The ontogenetic pattern of IGFBP2 mRNA in both LV and RV were decreased after 100d

with more dramatic decreases at 145d and in newborns. IGFBP3 mRNA expression in LV on

the other hand, is not significantly changed over time, although the level at 100d was

significantly lower at 120d than at 80d or 145d (Figure 3-2).

Expression of Angiotensinogen, AT1R, AT2R, ACE1, and ACE2 mRNA

Although expression of angiotensinogen mRNA did not change significantly in LV,

angiotensinogen expression in RV is significantly decreased at 100 days compared to 80, 130,

and 145 days gestation (Figure 3-3). Expression of ACE1 mRNA was dramatically increased in

LV and RV at 145 days gestation and in the newborn. In contrast, expression of ACE2 mRNA

in both LV and RV was greatest at 80 days and decreased at later ages (Figure 3-3). Therefore

the ratio of ACE1 mRNA to ACE2 mRNA was increased in LV from 120d on, and in RV from

100d onward (Table 3-1).









AT1R mRNA expression was significantly decreased in LV at 120 and 130 days gestation

and at 1 day postnatally. AT1R mRNA expression in RV at day 100 was significantly less than

expression at day 80. Expression of AT2R mRNA did not significantly change in LV throughout

the study, although AT2R expression was significantly higher at 130 days gestation than in

newborn hearts in the RV. There was little change in the ratio of AT1R to AT2R mRNAs in LV,

although the ratio in LV was significantly higher at 120 days when compared to postnatal lambs

(Table 3-1). In the RV, the ratio was greater at 80d and in the newborn than in 100 or 130

fetuses, and at 145d was greater than 130d (Table 3-1).

Discussion

This study revealed ontogenetic patterns of expression of several genes implicated in

growth or hypertrophy in neonatal and adult hearts. Previous studies of the ovine fetal heart

have found that the number of mononuclear myocytes declines over the time period we studied

(80 days to the early postnatal period), and the number of binucleate myocytes increases over

this period (Burrell et al. 2003, Jonker et al. 2007). However, the number of proliferating

myocytes in the left ventricle is approximately 50% at 100 days and decreases to 15% by 145d,

whereas only 15-25% of right ventricular myocytes are proliferating over this time period

(Jonker et al. 2007). In contrast, the number of myocytes that are enlarged due to terminal

differentiation is greater in the right ventricle than in the left ventricle, particularly from day 130

to term, and right ventricular myocytes are on average greater in volume than are those in the left

ventricle. Results from this study suggest that decreases in IGF2 and IGF-2R are associated with

fetal cardiac maturation in both left and right ventricle, and are consistent with roles of the

angiotensin and IGF 1 in the transition of the left and right ventricle from fetal to postnatal life.









Role of Corticosteroids in the Heart

Previous studies suggest that even small increases in fetal cortisol can alter heart mass

(Jensen et al. 2005, Jensen et al. 2002), suggesting an action of cortisol at MR and/or GR in fetal

myocytes. Both MR and GR are abundantly expressed in the fetal heart (Reini et al. 2006), as is

the case in many adult species, including humans (Lombes et al. 1995). While GR is relatively

abundant in the fetal heart, in sheep as in other species MR binds cortisol with greater affinity

than GR (Richards et al. 2003). The ability of cortisol to bind at MR and/or GR, however,

depends in large part on the activity of 1 10-HSD1 relative to that of the cortisol inactivating

enzyme 110- HSD2 (Mihailidou et al. 2005, Seckl et al. 2001). MR and GR follow a similar

pattern of expression in the LV throughout late gestation with significant decreases from the

expression levels at 80 days gestation occurring by 130 days gestation and postnatally in both

MR and GR. There was no significant overall ontogenetic change in expression of MR or GR in

the RV, although the MR levels at 100 days were lower than at other times. 110-HSD1 and 1ll-

HSD2 both show relatively consistent expression levels in the LV throughout late gestation and

early extrauterine life, while both 1 10-HSD1 and 110-HSD2 increase -2-3 fold in expression in

the RV after birth compared to earlier points in fetal life. While there are no major changes in

the ratio of expression, 110-HSD1 maintains a higher level of expression than 110-HSD2 within

both ventricles of the heart throughout all of late gestation, indicating the potential role of

cortisol within the heart in the late gestation fetus, but suggesting that proliferative effects of

cortisol are reduced in left ventricle as the heart matures.

Insulin-Like Growth Factors

In the current study, LV IGF 1 mRNA expression did not significantly change throughout

late gestation or neonatally, while IGF1R levels decrease in left ventricle by 120 days gestation

and maintain that lower level of expression through birth. IGF2 mRNA and IGF2R mRNA are









decreased in both LV and RV after 120 days and remained low postnatally. In contrast, neither

IGF1 nor IGF1R significantly changed in RV. The IGF2 results agree with previous

observations of decreased IGF2 mRNA expression in at 133 days gestation as compared to 75d

(Delhanty et al. 1993) by northern blot, and a decrease in IGF2 mRNA from 60d to 141d

(Cheung et al. 1996) by in situ hybridization. However in these studies, investigators also found

a decrease in IGF 1 expression in the left ventricle from 100 days gestation toward term, whereas

we did not observe a significant decrease in expression.

The pattern of decreased IGF1R in LV parallels the reduced number of LV myocytes

entering the cell cycle in late gestation in LV, whereas the dramatic decrease in IGF2 from day

120 of gestation to parturition in both LV and RV parallels the reduction in mononuclear

myocytes in both ventricles (Jonker et al. 2007). IGF2 and IGF 1 both appear to stimulate

myocyte proliferation in vitro. Liu et al. found that IGF2 stimulated an increase in proliferation

of prenatal rat myocyte cultures, but did not stimulate proliferation in neonatal myocytes (Liu et

al. 1996). Sundgren et al. have shown that infusion of an IGF1 analog to 124 day fetal sheep

results in decreased numbers of binucleated cells, but increased percentages of monucleated

myocytes; IGF1 administration in cultured fetal cardiomyocytes stimulated proliferation of the

myocytes mediated by ERK and PI3K (Sundgren et al. 2003). Because in vivo both IGF1 and

IGF2 act can act via binding at IGF1R, the decrease in IGF1R expression may limit the

proliferative effects of both IGFs as the heart matures. Alternatively, the decrease in expression

of IGF2 or IGF1R may reflect the decrease in mononuclear myocytes as terminal differentiation

proceeds.

As a result of the decrease in IGF2 mRNA, the ratio of IGF1 to IGF2 mRNAs increased

near term and postnatally (Table 1). This change in ratio of IGF1 to IGF2 mRNA expression is









consistent with the hypothesis that IGF2 is less important to postnatal growth than to prenatal

growth. It is interesting to speculate that IGF2 may play a role in mononuclear myocyte

proliferation, accounting for the gradual decrease in proliferation observed throughout the last

third of gestation as IGF2 expression within the heart decreases.

One of the possible key regulators of both systemic and local IGF concentrations in

fetuses is thought to be cortisol. Fetal skeletal muscle IGF1 mRNA expression decreases at the

same time as the prepartum rise in ovine plasma cortisol levels, and appears to be cortisol-

dependent (Li et al. 2002). This laboratory has found that moderately elevated cortisol levels

late in gestation reduce IGF-1R mRNA levels in the heart, but did not alter IGF-1 mRNA (Reini

et al. 2006). Increases in fetal cortisol decrease circulating IGF1 at the same time as increasing

fetal heart weight (Jensen et al. 2002); the decrease in cardiac IGF 1 expression in the late

gestation fetal heart also occurs at a time of increased circulating cortisol. Although in previous

studies we did not find a decrease in cardiac IGF1 mRNA with small increase in cortisol in the

130d fetus, we did find a reduction in IGF1R mRNA, similar to the finding in this study that

IGF1R deceases at a time that the fetal adrenal begins to secrete low concentrations of cortisol,

and at a time of relative abundance of MR expression in LV.

The biological actions of IGFs are in part regulated by IGF binding proteins 1-6 in vivo,

which function to prolong the half life of IGFs in plasma. IGFBPs have the ability to modulate

the actions of IGF through regulating transport, turnover, and tissue distribution (Jones et al.

1995). The ontogenetic pattern of IGFBP2 mRNA in both LV and RV were decreased after

100d with more dramatic decreases at 145d and in newborns. IGFBP3 mRNA expression in LV

on the other hand, is not significantly changed over time, although the level at 100d was

significantly lower at 120d than at 80d or 145d (Figure 2). Previous studies have shown IGFBP2









and IGFBP3 play roles in fetal development. It has been reported that over-expression of

IGFBP2 (Hoeflich et al. 1999) and IGFBP3 (Modric et al. 2001) in mice leads to a -10%

decrease body weight, although there is no change in heart weight with over-expresssion of

either binding protein. Maternal nutrient restriction leads to an increase in plasma IGFBP2

levels within the fetus between 90 and 135 days gestation (Osgerby et al. 2004), but did not alter

fetal heart weights.. In contrast, Greenand coworkers found that umbilical cord occlusion for

four days (107-108 d fetuses) led to no change in plasma IGFBP2 or IGFBP3, but did lead to an

increase in RV mRNA expression of IGFBP2 (Green et al. 2000); there was no change in either

body weight or heart weight with this 4 days of manipulation. This study reveals a progressive

decrease in IGFBP2 mRNA expression in the LV and RV starting at 120 days gestation and

continuing on until postnatal life; IGFBP3 mRNA expression did not change in LV. Although

the role of IGFBPs in mediating IGF effects in the fetal heart are not known, these results

suggest that the decrease in IGFBP2 mRNA within the fetal heart as gestation progresses may

reduce IGF1 mediated proliferative effects in both LV and RV.

Renin-Angiotensin System

Infusion of angiotensin II into fetal sheep stimulates left ventricular growth (Segar et al.

2001), and in cultures of ovine fetal cardiomyocytes, angiotensin II has been shown to stimulate

hyperplastic growth (Sundgren et al. 2003). I previously found that the elevated cortisol levels in

sheep during late gestation produced enlarged hearts with AT2 to AT1 mRNA ratios (Reini et al.

2006), although this infusion does not appear to increase genes associated with hypertrophy.

Infusion of very high doses of cortisol in the sheep fetus causes hypertension, left ventricular

(LV) hypertrophy and increased cardiac expression of angiotensinogen mRNA (Lumbers et al.

2005), and in the adult heart the local RAS has been implicated in playing a major role in cardiac









hypertrophy and fibrosis. In murine hearts local over-production of angiotensin II, without

involvement of the systemic RAS, causes interstitial fibrosis within the heart (Xu et al. 2007).

This study indicates that changes in the expression of mRNAs for RAS components

correspond to changes in proliferative activity and differentiation in the maturing heart. ACE1,

which converts angiotensin I to angiotensin II, increased -5-fold in the LV and RV at term.

ACE1 is known to augment cardiac hypertrophy in rat hearts when over-expressed (Tian et al.

2004), and the pattern of expression in late gestation is consistent with expression in terminally

differentiated myocytes. ACE2, which converts angiotensin I into angiotensin 1-9 and

angiotensin II into angiotensin 1-7, limits the amount of angiotensin II that is thought to be

cardio-protective (Danilczyk et al. 2006). In this study, ACE2 mRNA expression significantly

decreased in the LV by 120 days gestation and remained low, while expression in RV did not

significantly change. Interestingly, the ACE1 to ACE2 mRNA ratio increases -15-fold by 145

days gestation compared to 80 days in both the LV and RV. This increase in the ratio suggests

that local angiotensin II production may be associated with the terminal maturation of the

myocytes. Although high doses of cortisol stimulates angiotensinogen expression in the fetal

sheep heart (Lumbers et al. 2005), the physiologic increase in cortisol that occurs at term in fetal

sheep did not increase angiotensinogen mRNA expression, suggesting that changes in cardiac

angiotensin II production are related to a decrease in ACE2 expression and increase in ACE 1

expression, rather than by a local increase in transcription of the gene for the precursor protein.

In this study, AT2R mRNA expression remained relatively constant throughout gestation

in both the LV and RV, while AT1R mRNA expression significantly decreased at 120-130 days

gestation and in the newborn compared to expression at 80 days in the LV. These results are in

contrast to the increase in AT2R protein in the heart in late gestation observed by others (Burrell









et al. 2001). This decrease in expression of AT2R mRNA in the LV at 120 days coincides with

the decrease in ACE2 mRNA expression, whereas the drop in expression in the postnatal LV of

AT1R mRNA coincides with the increase in ACE1 mRNA expression, suggesting that the

decreased expression of the AT1R mRNA may be in response to an increase in local angiotensin

II production. In the adult heart, the AT1Rs are thought to be responsible for hypertrophic

effects, while actions at AT2R are hypothesized to counteract the AT1R (Booz et al. 2004, Zhu

et al. 2003). Thus the relative increase in AT1R to AT2R may be consistent with increased

capacity for myocyte hypertrophy in differentiated myocytes. In the RV the daily increase in

ventricular mass is primarily due to enlargement with terminal differentiation (Jonker et al.

2007); the greater increase in AT1R to AT2R ratio in RV appears to correlate to this, suggesting

a greater stimulation of myocyte volume is associated with greater relative AT1R expression in

RV.

In conclusion, our results suggest that changes in gene expression in the RV and LV is

associated with the changes in proliferative activity of mononuclear myocytes, and with terminal

differentiation of binucleate myocytes, which increase in number near birth.











MR


2 2

1 1a a J adef




3 3
GR GR
2- 2

o 1 a a a 1

I_ [ --IH n l l n

3o
11 4
D : 3 -------------I
11pHSD1 113HSD1 abd
C 3
_ 2
O 2
o
EL 1
S1 ae 1

o r--I o 0

3 6
11pHSD 6 11pHSD2 abd
ab
2 4

1- 2


80 100 120 130 145 pn 80 100 130 145 pn


Left Ventricle Right Ventricle
Figure 3-1. Ontogenetic expression of corticosteroid receptors and 1 10-HSDs in the LV and
RV. Expression of mRNA for MR, GR, 1 1 P-HSD1, and 1 13-HSD2 in left ventricles
of 80, 100, 120, 130, and 145 day fetuses and postnatal lambs (pn) and in right
ventricles of 80, 100, 130, 145 and postnatal lambs. Data are depicted as mRNA fold
changes relative to 80d calculated using the expression 2A-AACt and expressed as a
mean fold change + SEM. Letters indicate significant differences (p<,0.05) a: 80d, b:
100d, c:120d, d: 130d, f: 145d, g: newborn.


MR















IGF1


IGF2




ab ab abcd
T abcde



IGF1R




1 a a a a




IGF2R




ab a ab abcde



IGFBP-2




a ab abc abcd




IGFBP-3





80 100 120 130 145 pn
80 100 120 130 145 pn


IGF2




a ab ab




IGF1R









IGF2R


a
T ab ab




IGFBP-2



T a
S ab ab



80 100 130 145 pn


Left Ventricle Right Ventricle

Figure 3-2. Ontogenetic expression of IGFs, IGF receptors, and binding proteins in the LV and

RV. Expression of mRNA for IGF1, IGF2, IGF1R, IGF2R and IGFBP2 from left and

right ventricles of fetal and newborn lambs. IGFBP3 were measured in left ventricle

only. Ages and significance are as indicated in legend to Figure 3-1.












3-
An iotensinogen Angiotensinogen

2 2
Sade






3 3
AT1R AT1R

2 2

1 a a 1 a


0- 0

3 3
S AT2R AT2R

S2 2


2-
o 1 1





6 A abcd 8 A1 a abd
ACE1 ACE1 abd
5 T abd
4 6 T

1 2 1 4

3 4




3 3
ACE2 ACE2

2 2

1 a-T a a a 1


0 0-L L
80 100 120 130 145 pn 80 100 130 145 pn


Left Ventricle Right Ventricle
Figure 3-3. Ontogenetic expression of the RAS in the LV and RV. Expression of mRNA for
Angiotensinogen, AT1R, AT2R, ACE1 and ACE2 in left and right ventricles of fetal
and newborn lambs. Ages and significance are as indicated in legend to Figure 3-1.









Table 3-1. Expression ratio of 110-HSD1 to 110-HSD2, IGF2 to IGF1, AT1R to AT2R, and
ACE1 to ACE2 in LV and RV mRNA
Age 113HSD1/ 11HSD2 IGF2/IGF1 AT1R/AT2R ACE1/ACE2
(days
gestation)
LV RV LV RV LV RV LV RV
80 62 21 13 3 241 62 978 276 1.4 0.4 4.8 1.6 14 4 2.5 0.2

100 36 11 16 4 433 949 265 1.7 0.4 1.5 0.3 23 2.8 6.0 +0.7
*f 116 *ag *a
120 25 6.4 nm 151 +11 nm 0.9 0.1 nm 64 6.0 nm
*b *a
130 33 4.5 6.1+ 1.8 176 25 268 37 1.8 0.4 1.3 0.5 78 31 9.6 1.6
*ab *afg *a *a
145 45 5.0 5.7 2.1 88 10 146 48 2.1 0.5 3.3 1.1 212 66 31 6
*ab *ab *abd *abd
postnatal 31 9.0 6.7 0.5 41 7 105 4 1.4 0.2 3.8 0.3 133 41 37 6
*abcdf *abd *ab *abd
Letters indicate significant differences (p<,0.05) a: vs 80d, b: vs lOOd, c: vsl20d, d: vs 130d, f:
vs 145d, g: vs postnatal lambs; nm, not measured.









CHAPTER 4
CARDIAC CORTICOSTEROID RECEPTORS MEDIATE THE ENLARGEMENT OF THE
OVINE FETAL HEART INDUCED BY CHRONIC INCREASES IN MATERNAL
CORTISOL

Introduction

In late gestation, normal fetal growth and fetal cardiovascular homeostasis is dependent

on the proper regulation of maternal cortisol levels. Although reductions in maternal cortisol

prevent the normal increases in maternal plasma volume and uteroplacental blood flow and

reduce fetal growth (Jensen et al. 2002a; Jensen et al. 2005), increases in maternal cortisol also

alter fetal growth. Chronically increased maternal cortisol levels, within the range that occurs

with maternal stress, reduce fetal growth rates while increasing heart growth in fetal sheep

(Jensen et al. 2002b; Jensen et al. 2005).

The mechanisms by which chronically elevated maternal cortisol levels increase the size of

the fetal heart are not known. Giraud et al. have shown that cortisol chronically infused directly

into the coronary artery increased cell cycle activity in myocytes of late gestation sheep fetuses,

suggesting a direct induction by cortisol of hyperplastic growth rather than hypertrophic growth

(Giraud et al. 2006). Conversely, it has been demonstrated that large doses of cortisol infused

directly into the fetus in late gestation causes left ventricular (LV) hypertrophy along with an

increase in fetal arterial pressure and cardiac expression of angiotensinogen mRNA (Lumbers et

al. 2005). This laboratory has shown that maternal cortisol infusion in sheep during late

gestation caused an increase in fetal heart size and wall thickness without increasing fetal arterial

pressure or cardiac angiotensinogen; we found an increase in the ratio of angiotensin type 2


2 Reproduced with permission from Reini S, Dutta G, Wood C, & Keller-Wood M 2008 Cardiac
corticosteroid receptors receptors mediate the enlargement of the ovine fetal heart induced
by chronic increases in maternal cortisol. The Journal of Endocrinology Epub May 21,
2008.









receptor (AT2 receptor) to angiotensin type 1 receptor (AT1 receptor) mRNA in the fetal heart,

suggesting that the renin-angiotensin system (RAS) may play a key role in the enlargement

process. Furthermore, in the same study it was observed that left ventricular expression of 113-

HSD2 mRNA, the enzyme that converts cortisol into cortisone, decreased in the fetal hearts in

response to the elevated cortisol, suggesting that cortisol can act directly on mineralocorticoid

(MR) or glucocorticoid (GR) receptors to induce the cardiac enlargement (Reini et al. 2006).

In adult hearts, both MR and the RAS have been implicated in cardiac fibrosis and

hypertrophy after injury (Fraccarollo et al. 2003; Fraccarollo et al. 2005; Xiao et al. 2004). I

propose that corticosteroid receptors also play a role in cardiac enlargement in the fetal heart,

although by mechanisms independent of cardiac injury and fibrosis. The purpose of this study

was to test the hypothesis that increase in fetal heart weight and wall thickness in response to

increased maternal cortisol is mediated by cardiac corticosteroid receptors, MR and/or GR, and

to determine if cardiac fibrosis accompanies the cardiac enlargement in response to cortisol. I

hypothesized that cortisol acts within the myocardium on MR receptors, and to a lesser degree

GR receptors, to induce enlargement of the fetal heart. I also hypothesized that cardiac fibrosis

is not involved in the enlargement of the heart observed in the fetuses of cortisol-infused ewes.

Materials and Methods

Experimental Design

Ewes (Ovis aries) pregnant with single fetuses were studied. All animal use was approved

by the University of Florida Institutional Animal Care and Use Committee and conformed to the

National Institutes of Health Guide for the Care and Use of Laboratory Animals. Ewes and their

fetuses were operated on between 118 and 123 days of gestation (term approximately 148 days).

Animals were randomly assigned to one of four groups at the time of surgery. The first group

consisted of six control animals; the second group consisted of five ewes to which cortisol









(hydrocortisone hemisuccinate; Sigma, St Louis, MO) was administered by continuous

intravenous infusion (1 mg kg-1 day-'; cortisol); the third group consisted of six ewes to which

cortisol was infused, with infusion of the MR antagonist potassium canrenoate (Sigma; 600 [g

day-1; cortisol + MRa) directly into the pericardial space of the fetus; and the fourth group

consisted of four ewes to which cortisol was infused, with infusion of the GR antagonist

mifipristone (Sigma; 50 [tg day-'; cortisol + GRa) directly into the pericardial space of the fetus.

For the control and cortisol groups, there were no infusions into the pericardial space. The

intrapericardial infusions were performed by use of Alzet minipumps (2ML2; 5 tl-hour-1;

Cupertino CA) in order to achieve continuous infusion of the antagonists into the pericardial

space without any appreciable increase in pericardial fluid volume (0.12 ml/day). The doses of

MR and GR antagonists were calculated based on their effective systemic doses, and scaled to

reflect the smaller distribution volume of the fetal heart (20g). Because these drugs are steroid

(mifepristone) or lactone (canrenoate) derivatives, they are able to distribute throughout tissue

over the 10 days of study after mixing in the pericardial fluid. Effects of the MR and GR

antagonists were confirmed using immunohistochemistry to confirm the expected cellular

redistribution of receptors with antagonist administration (see below)

The cortisol dose and the duration of cortisol infusion (10 days) were determined based on

a previous study in this laboratory (Jensen et al. 2005) showing that infusion at this rate and

duration produces levels similar to mild maternal stressors and results in enlargement of the fetal

heart .

Surgical Procedures

Halothane (1.5-2.5%) in oxygen was used to anesthetize ewes during surgery. Fetal

femoral tibial artery catheters and an amniotic fluid catheter were placed as previously described

(Jensen et al. 2002a; Wood & Rudolph 1983). Catheters were also placed in the fetal pericardial









space for the delivery of drug as previously described (Wood 2002). In each case, an incision

was made in the uterus over the left side of the fetal chest and an incison was made between the

third and fourth fetal ribs. The fetal skin was marsupialized to the uterus to prevent leakage of

amniotic fluid. The fetal heart was exposed and a small incision was made in the pericardium,

through which a silastic catheter (0.76 mm id, 1.65 od; Dow Corning, Midland, Michigan) was

placed and held in place with use of a purse-string suture (4-0 Tevdek; Teleflex Medical,

Mansfield, MA). For infusion of potassium canrenoate, the silastic catheter was connected to a

Tygon tubing connector (1.27 mm od; St Gobain Performance plastics; Akron, OH) which was

connected at its other end to the the Alzet pump containing the drug (50 mg ml-1 in 0.9% saline).

Because mifepristone is not soluble in aqueous solution and therefore cannot be directly loaded

into the pump reservoir, mifepristone was dissolved in 47.5% ethanol in saline (0.42 mg ml-1

ethanol-saline); this solution was placed in a polyethylene tubing (1.40 mm id, 1.90 mm od)

which was then connected to the silastic pericardial catheter on one end and to the Alzet

minipump on the other end using smaller gauge polyethylene tubing. The Alzet pump, filled

with saline, provided the flow to pump the mifepristone solution from the tubing into the

pericardium. The pump was placed under the skin of the fetus near the scapula. In the control

group, 5 of the 6 fetuses also had pericardial catheters placed, but no infusion was delivered; in

the cortisol group, 3 of 5 fetuses had pericardial catheters placed, but no infusion was delivered.

After closure of the uterus, catheters were placed in the maternal femoral artery and vein

and routed to the maternal flank. All ewes were treated with flunixamine (1 mg kg-1 im; Fort

Dodge Animal Health, Fort Dodge, IA) at the end of the surgical procedure, before recovery

from anesthesia.









Ewes were returned to their pen after recovery from anesthesia. At this time, the

intravenous infusion of cortisol (Img kg1 day-1 cortisol as cortisol hemisuccinate in normal

saline; Sigma) or infusion of saline to the ewe was initiated. Maternal infusions were delivered

through a 0.22 [pm filter (Fisher Scientific) via a syringe pump at the rate of 1.17 ml hour-1.

Animals were housed in individual pens with access to water, food, and salt blocks ad libitum.

Ampicillin (500mg im bid; Webster Veterinary) was administered for 3 days postoperatively.

Flunixamine was administered on the morning after surgery.

Experimental Protocol

Fetuses were studied from the day of surgery until death on 129-132 days gestation. All

cortisol infused ewes and their fetuses were sacrificed on day 10 of infusion. Fetal and maternal

blood samples were withdrawn on day 5 (124-126 days gestation) and day 10 (129-132 days

gestation) after the start of the infusion for determination of blood gases, plasma cortisol and

plasma ACTH concentrations. All blood samples were taken immediately after entering the

room in which the ewes were housed in order to minimize the effect of handling on plasma

ACTH and cortisol. On day 10 of infusion, maternal and fetal blood pressure and heart rate were

recorded over a 40 minute interval using LabView software (National Instruments, Austin, TX)

and disposable pressure transducers (Transpac; Hospira, Lake Forest, IL). Amniotic fluid

pressures were subtracted from fetal intra-arterial pressures in order to calculate fetal arterial

pressure. In two animals, one in the cortisol group and one in the cortisol+MRa group, we were

unable to reliably measure fetal heart rate; data from those two fetuses are excluded from

analysis.

The ewe was euthanized on day 10 using an overdose of euthanasia solution containing

pentobarbital, and the fetus was removed and weighed. The fetal heart was also immediately

dissected, blotted to remove blood from the chambers, and weighed. Ventricular and septal wall









thicknesses were measured using a micrometer at a standardized site on the heart, taking care to

exclude measurement at the level of the papillary muscles or valves.

Analysis

Blood gases and pH were measured with a blood gas/electrolyte analyzer (ABL77;

Radiometer America, Westlake, OH). Electrolytes (sodium and potassium) were measured using

an electrolyte analyzer (Roche 9180, Basel, Switzerland). For measurement of packed cell

volume (PCV), blood was spun in microcapillary tubes for 3 minutes at 12,000 rpm (Damon

Division, International Equipment, Needham Heights, MA). Plasma protein was determined

using a refractometer.

Plasma ACTH was measured by radioimmunoassay, using an antibody to 1-39 ACTH

(Bell et al. 1991) and plasma cortisol concentration was measured using a commercially

available enzyme immunoassay kit (EA 65, Oxford Biomedical, Oxford, MI) which has minimal

cross-reactivity with cortisone (2.08%).

Immunohistochemical Localization of MR and GR

At the time of sacrifice, a section of the fetal heart was fixed in 4% buffered

paraformaldehyde overnight. Hearts were dehydrated with increasing concentrations of reagent

alcohol followed by xylene, embedded in paraffin wax, cut into 10-[tm-thick sections on a Zeiss

rotary microtome, and placed on poly-l-lysine coated slides. The sections were stained with anti-

GR (Santa Cruz Bioreagents, M-20, ) or anti-MR ( M1-18, 6G1, gift of E. Gomez-Sanchez;

(Gomez-Sanchez et al. 2006)) as previously described (Reini et al. 2006) This analysis was

performed to assess the ability of the drugs to act in the heart and cause the expected changes in

cytonuclear localization of the receptors. The MR antagonist canrenoate acts in a similar manner

to spironolactone and would therefore be expected to prevent nuclear localization of MR (Fejes-

Toth et al. 1998; Lombes et al. 1994); conversely the GR antagonist mifepristone (also known as









RU486) causes nuclear localization even in the absence of agonist (Jewell et al. 1995; Scheuer et

al. 2004). The localization observed (Figure 4-1) is consistent with these effects. In the control

fetuses GR were primarily located in the cytosol, whereas MR were apparent in cytosol and

nucleus. A dramatic increase in MR localization to the nucleus was apparent in the cortisol-

treated fetuses, indicating cortisol activation of MR. We did not find as dramatic an increase in

nuclear GR with cortisol, indicating fewer GR are activated. In the case of MR antagonist

administration, fewer MR were apparent in the nucleus than with cortisol alone, whereas with

GR antagonist, equivalent MR localization to the nucleus occurred as with cortisol alone.

Consistent with the known effect of mefipristone, in GR antagonist -treated ewes, there was

more nuclear GR than in the case of cortisol alone or cortisol+ MRa.

Collagen Staining

Sections from each group (n = 4-6) were stained with picrosirius red (Sigma) in order to

determine collagen content. Sections were hydrated and immersed in sirius red (0.1% in

saturated picric acid). The sections were then washed in acidified water (0.5% glacial acetic

acid), dehydrated, and mounted in permount. All images were visualized using an Olympus

DP71 microscope and Olympus software. Ten pictures of LV, five of RV, and five of septum

were taken from each heart in areas without large blood vessels so that primarily interstititial,

rather than perivascular, collagen deposition could be quantified. Picrosirius red staining was

quantified using Image J software (NIH, Bethesda, MD) by three different people who were

blinded as to the experimental group. The average value of the percentage of the image that

stained red from these three observations was calculated.

Data Analysis

Fetal heart weight was normalized to body weight. The heart weight to body weight ratio,

LV, RV and septal thickness, fetal and maternal blood pressure and heart rate, as well as fetal









and maternal plasma ACTH and cortisol, sodium and potassium, and PCVs were analyzed by

one way analysis of variance (ANOVA) with multiple comparison's using Duncan's method

(Zar 1984). Plasma hormone (cortisol and ACTH) and protein concentrations were also

analyzed by one-tailed t-test, comparing the data from all 3 groups of cortisol- treated ewes to

the data from the control group (Zar 1984). Average cortisol values were calculated from the 5

day and 10 day values and were log transformed before analysis. The Mann-Whitney Rank Sum

Test was used for maternal plasma protein analysis at 10d (Zar 1984).

Values for the picrosirius red staining were analyzed by two-way ANOVA in order to

determine significance across the cortisol treatment groups and areas of the heart (LV, RV, and

septum); the percent stained area data was transformed using arc sine prior to analysis to correct

for heterscedascity (Winer 1971).

For all analyses, p< 0.05 was used as the criterion for statistical significance.

Results

Maternal Physiology

Maternal cortisol concentrations were significantly increased in the ewes treated with

cortisol when compared to the non-treated ewes (5d and 10d day average, 9.0 + 0.9 vs. 5.9 + 1.4

ng ml-1). When the four groups were compared individually, there was a trend for each cortisol

treated group to have increased cortisol concentrations as compared to the control ewes (Table 4-

1), but there were no differences among groups. ACTH levels were not significantly altered in

response to cortisol treatment, although there was a trend for cortisol treated ewes to have lower

ACTH concentrations than the control group (Table 4-1).

Maternal sodium, potassium, and packed cell volume values were not different between

the groups at day 5 or at day 10 (data not shown). Maternal plasma protein concentrations were









significantly elevated in the cortisol treated ewes on days 5 (8.2 0.2 vs. 7.6 0.2 g 100ml-1)

and 10 (7.9 + 0.1 vs. 7.4 0.lg 100ml-1) days as compared to the control ewes.

Maternal arterial pressures and heart rates were not different between the four groups (data

not shown).

Fetal Physiology

The average plasma cortisol concentrations (5 and 10 days) were significantly elevated in

the fetuses whose mothers were infused with cortisol compared to control (3.4 0.6 vs. 1.5 0.6

ng ml-1). There was a trend for each cortisol treated group to have increased cortisol

concentrations as compared to the control fetuses when the four groups were compared

individually (Table 4-1). ACTH levels were not significantly altered in response to cortisol

treatment (Table 4-1).

There were no significant differences among the groups in the blood gas values or packed

cell volume (Table 4-2), nor were there effects on fetal electrolytes (data not shown). There

were also no effects of treatment on fetal heart rate and blood pressures (Table 4-3).

Fetal Heart Measurements

Heart weight was significantly greater in the cortisol group compared to the control group

and cortisol + MRa group, but not the cortisol + GRa group (Figure 4-2). Left ventricular and

right ventricular free wall thicknesses were significantly greater in the fetal hearts of the cortisol

treated group as compared to the control group. Left and right ventricular free wall, as well as

septum, thicknesses were greater in the fetal hearts of the cortisol group as compared to the

cortisol + MRa group (Figure 4-2). Left ventricular free wall thickness and septum thickness

were not different in the cortisol group as compared to the cortisol + GRa group (Figure 4-2).

However, right ventricular wall thickness was greater in the cortisol group as compared to the

cortisol+ GRa group.









Collagen Staining

Fetal heart sections were stained with picrosirius red in order to measure the amount of

interstitial collagen deposition (Figure 4-3). The percentage of collagen staining in the left

ventricle, right ventricle, septum, and whole heart was not significantly altered among the groups

(Table 4-4, Figure 4-3).

Discussion

I conclude that blockade of corticosteroid receptors in the fetal heart prevents the

enlargement of the heart observed when maternal cortisol concentrations are chronically

increased. I found that blockade of the mineralocorticoid receptors blocked the increase in heart

weight, as well as in wall thickness. Blockade of glucocorticoid receptors significantly reduced

right ventricular enlargement, and produced smaller, insignificant effects on thickness of the left

ventricular free wall and septum and on heart weight. Neither administration of MR or GR

blocker into the pericardium resulted in increases in fetal ACTH or fetal blood pressure,

suggesting that the infusions of antagonist did not produce systemic effects. The results indicate

that small increases in cortisol increase fetal heart size via an intracardiac action at the MR and,

to a lesser extent, GR receptors within the fetal heart. I also conclude that the increase in fetal

heart weight in response to elevated cortisol occurs without an increase in collagen deposition.

Role of MR and GR in the Heart

This laboratory has previously shown that both MR and GR are abundantly expressed in

the heart in the late gestation ovine fetus (Reini et al. 2006), suggesting a role for these receptors

in fetal heart development in vivo. Other investigators have found that aldosterone directly

stimulates myocyte surface area (Okoshi et al. 2004) and remodeling of myocyte membrane

(Kliche et al. 2006) in cultures of neonatal myocytes, and effect presumed to be mediated by MR

in the myocytes. Cortisol also increases expression of atrial natriuretic peptide in cultured









neonatal myocytes, and both cortisol and aldosterone potentiate the effect of phenylephrine on

hypertrophy in these cultures (Lister et al. 2006), also indicating an intracardiac action at MR in

these cultures.

One of the major factors influencing the ability of cortisol to activate MR and/or GR is the

local activity of the 1 hydroxysteroid dehydrogenase enzymes, 11 3-HSD1 and 11P-HSD2. 113-

HSD1 primarily converts cortisone into cortisol, while 11P-HSD2 converts cortisol into

cortisone, which is inactive at MR and GR (Krozowski et al. 1999). This laboratory has

previously shown that mRNA expression of 11 -HSD2 mRNA is relatively low compared to

1 10-HSD1 within the fetal heart (Reini et al. 2006). Using immunohistochemistry, I also found

that although MR, GR, and 11 -HSD1 are abundantly expressed in both myocytes and blood

vessels within the fetal heart, 110-HSD2 seemed to be localized in blood vessels more

abundantly than in myocytes. This suggested that cortisol has access to both MR and GR within

the fetal heart, and that when plasma cortisol levels are increased, as in the present study, action

of cortisol at MR and GR in the heart would also increase. My present study demonstrates that

the effect of cortisol is blocked by antagonists of the MR and/or GR, suggesting a role of

intracardiac corticosteroid receptors. This is consistent with the ability of cortisol to alter

myocyte growth in cultured myocytes. I also hypothesized that blockade of MR would have a

greater effect in inhibiting the effect of cortisol than would blockade of GR, because MR has

been shown to have greater affinity for cortisol than GR (Reul & DeKloet 1985; Richards et al.

2003). Indeed this is what I observed in the present study: in the cortisol group, there was a 14%

increase in heart weight relative to body weight as compared to the control group; this

enlargement was completely blocked when MR antagonist was administered to the heart,

whereas there was only 44% blockade of the increase in weight after administration of the GR









antagonist. Similarly, in the cortisol group, LV, RV, and septum thicknesses were approximately

20% thicker than control fetuses and the MR antagonist produced a 95%, 149%, and 114%

reduction of this increase in thickness of the LV, RV, and septum respectively, whereas the GR

antagonist group produced 63%, 110%, and 65% reductions of thickness. Overall, GR blockade

was approximately half as effective as MR blockade in inhibiting the increase in heart weight or

wall thickness.

The relative differences in effectiveness of MR and GR blockade are consistent with the

expected relative binding of fetal cortisol at these receptors. The MR are higher affinity

receptors with greater occupancy at low cortisol concentrations (Reul & DeKloet 1985), and

therefore a greater effect would be expected after blockade of these receptors. Based on the

expected free fraction of cortisol in the fetuses, I calculate that the free cortisol concentrations

would be approximately 0.8 nM in the control fetuses and 1.9 nM in the fetuses of the cortisol-

infused ewes. Based on previous studies of cortisol binding at ovine MR and GR (Richards et al.

2003), I would predict that these free concentrations would result in approximately 65%

occupancy of MR and 35% occupancy of GR in the control fetuses, and 85% occupancy of MR

and 60% occupancy of GR in the cortisol-infused fetuses. Thus, these levels would be expected

to exert more effects via MR than via GR activation if both act at GRE to induce genes

responsible for cardiac growth.

It should be noted that mifipristone is also an antagonist of the progesterone receptor (PR).

In this study, circulating progesterone levels were not measured, however, an increase in

circulating progesterone levels would not be expected in response to cortisol manipulation,

suggesting mifipristone infusion most likely resulted in blockade of baseline progesterone action

in the fetal heart. While the relative expression levels of PR have not been elucidated in the fetal









heart, I would not expect PR antagonism to greatly affect heart growth since growth of the heart

appears to be primarily stimulated by an increase in plasma cortisol concentrations. It is

possible, however, that blockade of PRs within the heart contributed to the reduction in heart

mass observed with mifipristone infusion in the cortisol + GRa group.

Role of MR in Hypertrophy in the Adult Heart

In adult rats the mineralocorticoid receptor is thought to induce cardiac hypertrophy and

fibrosis occurring in response to ischemia; systemic administration of MR blockers have been

shown to reduce markers of inflammation and fibrosis in hearts of adult rats (Brilla et al. 1993;

Fraccarollo et al. 2005; Sun et al. 2002). It has been established that in adult humans with severe

heart failure, there is a reduction in the severity of cardiac hypertrophy and an increase in

survival rate after treatment with the MR receptor antagonists eplenerone or spironolactone (Pitt

et al. 1999; Pitt et al. 2001). The effect of MR blockers on survival rate appears to be the result

of a decrease in cardiac fibrosis (Fraccarollo et al. 2004); increases in interstitial collagen

content are a feature of adult cardiac hypertrophy (Pearlman et al. 1981), particularly in the case

of hypertension or myocardial infarction (Young et al. 2007). The mechanism for the in vivo

effect of MR in contributing to inflammation and subsequent fibrosis is not clear. It has been

suggested that the effect is through a nongenomic action, and that the effect in ischemic tissue is

predominately on vascular cells expressing MR, rather than on fibroblasts or on myocytes

(Young et al. 2007; Mihailidou & Funder 2005). It is generally assumed that the protective

effect of the MR antagonists results from blocking the action of aldosterone at MR. It has been

suggested, however, that many heart failure patients without elevated plasma aldosterone levels

still benefit from MR blockade, indicating aldosterone may not be the only relevant MR ligand

(Young et al. 2007). Since plasma cortisol concentrations are much higher than aldosterone,

and since there is not a significant amount of 110-HSD2 expressed within the heart, it is









reasonable to propose that cortisol may be playing a role in the fibrosis that is observed in heart

failure patients.

In this study the effects of cortisol do not appear to involve increase in fibrosis, as there

was no increase in collagen content with maternal infusion of cortisol, nor were there any effects

of either MR or GR blockade. This suggests that the mechanism of the enlargement of the fetal

heart in the current study may be fundamentally different from what is observed in adult rat

models or human pathology, in which ischemia is a contributing component.

Mechanisms of Enlargement of the Fetal Heart

Due to the unique ability of the fetal heart to grow through both hyperplasia and

hypertrophy, either mechanism could account for the cortisol-induced increases in fetal heart

weight and wall thickness in our model. In early gestation, cardiac growth is mostly a result of

the production of new myocytes originating through cell division and proliferation (Smolich

1995). After approximately day 115 of gestation in sheep, however, cardiac growth results

primarily from increases in myocyte size (Jonker et al. 2007). Myocytes lose their ability to

divide and proliferate shortly after birth in an event in which there is nuclear division without

subsequent cell division (Oparil et al. 1984). In fetal sheep the number of terminally

differentiated or binucleate myocytes increases from -115 days of gestation through term, and

heart growth during this period is due to both increases in myocyte size and myocyte

proliferation (Jonker et al. 2007). Theoretically, cortisol could be stimulating growth through

either hypertrophy or hyperplasia, or possibly even both.

Rudolph et al. showed that cortisol (1.2 [tg min-) infusion for 72-80 hours directly into the

left coronary artery of the ovine fetus (124-13 Id) decreased left ventricular DNA content

(Rudolph et al. 1999). This was interpreted as cortisol-induced inhibition of myocyte

proliferation in preparation for life after birth. The fetal blood pressures from that study were not









reported. In a study by Lumbers et al., high dose infusion of cortisol (72. Img d-1 for -60h)

increased left ventricular myocyte size and increase cardiac angiotensinogen mRNA (Lumbers

et al. 2005), suggesting an induction of hypertrophy. However, there was also a significant

increase in blood pressure in these fetuses, suggesting that the cardiac hypertrophy may have

resulted from elevated blood pressure.

Conversely, maternal dexamethasone administration (48 utg d-1 from E17) increased

relative heart weight and increased myocyte proliferation in the fetal and newborn rat heart

(Torres et al. 1997). In agreement with this, Giraud et al. (Giraud et al. 2006) showed that

subpressor doses of cortisol (0.5 tg kg-min-1 for 7 days) infused directly into the circumflex

coronary artery of the fetus led to an increase in Ki-67 stained myocytes in both the left and right

ventricles; as Ki-67 is expressed only in cells in the proliferative phase, this suggested that

cortisol stimulated proliferation in these hearts. Hearts infused with cortisol weighed more than

control hearts in this study, but there were no changes in myocyte size or percent binucleation.

Interestingly, there were also no differences in aortic, right atrial, systolic, and diastolic pressures

between the groups. These studies suggest that elevated fetal cortisol concentrations directly

stimulate cardiomyocyte proliferation in the late-term fetus.

The current study does not provide direct evidence for cardiomyocyte proliferation as a

means of cardiac enlargement in response to cortisol. It is important to note that in this study a

subpressor dose of cortisol was used, as in the study by Giraud et al.(Giraud et al. 2006). I did

not observe an increase arterial pressure in response to the moderately elevated cortisol levels

indicating that the fetal hearts in this study were not subjected to chronically increased systolic

load, a possible trigger to myocyte hypertrophy seen in some other studies. Although in the

present study blood pressure was only measured at 10 days of cortisol infusion, a previous study









in this laboratory (Jensen et al. 2005) showed fetal arterial blood pressure was not elevated at

either 5 or 10 days of maternal cortisol infusion. The doses of cortisol administered in the present

study resulted in relatively small increases in fetal cortisol, well below those that have been

shown to increase fetal blood pressure in other studies (Unno et al. 1999; Tangalakis et al. 1992;

Wood et al. 1987). Furthermore, in this study I observed no evidence within the fetal heart in

support of interstitial collagen deposition, a symptom of cardiac hypertrophy in response to

hypertension within the adult human heart (Diez 2007).

Conclusions

The data suggest that the enlargement of the fetal heart in response to a modest and chronic

rise in maternal cortisol levels is mediated by MR receptors, and to a lesser extent, GR receptors

within the fetal heart. Intrapericardial infusion of an MR antagonist completely prevented the

increase in wall thickness and heart weight. GR blockade was less effective, although GR

blockade prevented the increase in RV free wall thickness, and tended to attenuate the increase in

left ventricular wall thickness and whole heart weight. The cortisol-induced enlargement is not

accompanied by an increase in interstitial collagen deposition within the fetal heart. This

indicates the possibility of a different mechanism for the enlargement observed in the fetal heart

than that observed in adult cardiac hypertrophy and fibrosis.











GR IHC


MR IHC


control








Cortisol.








Cortisol
+ MRa







Cortisol
+ GRa


I-





Figure 4-1. Immunohistochemical localization of MR and GR in representative hearts from
fetuses of control cortisol cortisol +MRa and cortisol+GRa groups. All photos at
40x power.












A B
E 7 E6





4 4
5 E2


4 8.



8 8
C D
S6 E 6


4 4- CK4
f]f
!i e X I .'

>// 2 > 2- *


a a


Figure 4-2. Fetal heart measurements in response to manipulations. Mean fetal heart
measurements from control (open bars), cortisol (solid bars), cortisol+MRa (diagonal
striped bars) or cortisol+GRa (cross-hatched bars) groups taken at time of sacrifice:
heart to body mass ratio (A), left ventricular (LV) septal wall thickness, (B)wall
thickness (C), and right ventricular (D) wall thickness (lower left). Data are
expressed as mean SEM. Horizontal lines between groups indicate differences are
statistically significant, p< 0.05.



















I L


Control


Cortisol
+ MRa ".,-


,\.


Mjj I.m


Cortisol


Cortisol
+ GRa


' ,


Figure 4-3. Collagen staining of fetal hearts. Representative pictures showing picrosirus red
staining of collagen in left ventricular wall of fetal hearts from the (A) control, (B)
cortisol, (C) cortisol + MRa, and (D) cortisol + GRa groups; 40x power. Bar
indicates 200um. Arrows indicate the dark staining corresponding to positive Sirius
red staining.









Table 4-1. Fetal and Maternal Cortisol concentrations (average of days 5 and 10) and
ACTH concentration on day 10.
Maternal Fetal Maternal Fetal
Cortisol Cortisol ACTH ACTH
(ng/ml) (ng/ml) (pg/ml) (pg/ml)
Control 5.9 1.4 1.5 0.6 37 8 36 8
Cortisol 9.6 2.3 2.7 + 0.5 20 1 27 5
Cortisol + MR antagonist 8.7 0.4 3.6 1.0 31 + 11 38 6
Cortisol +GR antagonist 8.3 + 1.5 3.9 1.9 21 + 1 57 + 33
Data are expressed as mean SEM.









Table 4-2. Fetal blood gas and packed cell volume.
Fetal Fetal
P02 PCO2
(mmHg) (mmHg)
Control 21.7 + 1.0 56 1
Cortisol 21.5 1.0 53 2
Cortisol + MR antagonist 20.7 1.1 54 2
Cortisol +GR antagonist 21.9 0.4 55 1
Data are expressed as mean SEM.


Fetal
pH


7.34 + 0.01
7.35 0.01
7.30 + 0.03
7.32 + 0.02


Fetal
Packed cell
Volume (%)
0.313 + 0.007
0.326 + 0.013
0.348 + 0.007
0.325 + 0.009









Table 4-3. Fetal arterial pressure and fetal heart rate on day 10.
Fetal Fetal
Arterial Heart Rate
pressure (beats per
(mmHg) minute)
Control 47.5 2.7 170 6
Cortisol 46.9 + 2.7 168 11
Cortisol+MR antagonist 43.0.+ 0.9 172 4
Cortisol+GR antagonist 46.0 1.0 164 7
Data are expressed as mean SEM









Table 4-4. Collagen content determined by picrosirius red staining (fraction of total area) in
left ventricle (LV), right ventricle (RV), and septum.
LV RV Septum
Control .037 + 0.005 .039 + 0.004 .037 + 0.006
Cortisol .050 + 0.009 .057 0.009 .052 + 0.010
Cortisol + MR antagonist .049 + 0.011 .037 + 0.007 .043 0.008
Cortisol +GR antagonist .060 + 0.012 .058 + 0.013 .059 + 0.013


Data are expressed as mean SEM.









CHAPTER 5
ANALYSIS OF PROLIFERATION MARKERS AND EXPRESSION LEVELS OF
POTENTIAL GROWTH PROMOTERS WITHIN THE FETAL HEART

Introduction

Evidence from multiple studies has supported the idea that elevations in cortisol levels

late in gestation induces cardiac enlargement of the ovine fetus (Reini et al. 2008, Giraud et al.

2007, Lumbers et al. 2005, Jensen et al. 2005). Whereas cardiac growth in early gestation is

mostly a result of the production of new myocytes originating through cell division and

proliferation (Smolich et al. 1995), it has been demonstrated in sheep that hearts can grow by

both cell hypertrophy and cell proliferation throughout the last third of gestation (Jonker et al.

2007). The ability of myocytes to divide and proliferate, however, comes to an end shortly after

birth in an event in which there is nuclear division without subsequent cell division (Oparil et al.

1984). This means that cortisol could theoretically be stimulating growth through either

hypertrophy or hyperplasia, or possibly even both.

Lumbers et al. performed a study in which high dose infusion of cortisol (72.1mg d-1 for

-60h) increased cardiac angiotensinogen mRNA and increased left ventricular myocyte size

(Lumbers et al. 2005), suggesting an induction of hypertrophy. However, there was also a

significant increase in blood pressure in these fetuses, implying the cardiac hypertrophy may

have resulted from elevated blood pressure. Additionally, Rudolph et al. showed that left

ventricular DNA content was decreased following cortisol (1.2 [tg min-) infusion for 72-80

hours directly into the left coronary artery of the ovine fetus (124-13 Id; Rudolph et al. 1999).

The interpretation of this study was that cortisol functioned to induce inhibition of myocyte

proliferation in preparation for life after birth.

Conversely, maternal dexamethasone administration (48 tg d-1 from E17) increased

relative heart weight and increased myocyte proliferation in the fetal and newborn rat (Torres et









al. 1997). Furthermore, Giraud et al. showed that physiologically relevant doses of cortisol (0.5

[tg kg- min- for 7 days) infused directly into the circumflex coronary artery of the fetus led to an

increase in heart mass without an increase in blood pressure; it also led to an increase in Ki-67

stained myocytes in both the left and right ventricles (LV and RV) indicating cortisol stimulated

proliferation in these hearts (Giraud et al. 2006).

Previously in this laboratory, it was shown that fetal cardiac enlargement in response to

chronically elevated maternal cortisol levels can be prevented by mineralocorticoid receptor

(MR) blockade, and diminished by glucocorticoid receptor (GR) blockade (Reini et al. 2008).

No change in blood pressure or cardiac collagen deposition was observed in the hearts exposed

to elevated cortisol in that study, however, no direct evidence for cell proliferation was obtained

either. It has also been previously shown in this laboratory that hearts enlarged from increased

cortisol exposure exhibited a decrease in 110- hydroxysteroid dehydrogenase 2 (110-HSD2) and

insulin-like growth factor type 1 receptor (IGF1R) mRNA expression and also an increase the

angiotensin type 2 receptor (AT2R) to angiotensin type 1 receptor (AT1R) ratio of mRNA

expression within the left ventricle (LV; Reini et al. 2006). However, whether these alterations

in gene expression are negated with MR or GR blockade has yet to be determined.

The purpose of this study was to investigate if fetal cardiac growth in response to elevated

cortisol levels is due to increased cell proliferation, and to also determine if expression levels of

genes that are changed within the enlarged heart are still altered when cortisol action at MR or

GR is blocked. I hypothesized that heart enlargement primarily occurred through an increase in

cell proliferation and that the changes in LV gene expression observed in the enlarged hearts

exposed to elevated cortisol levels would be prevented in hearts where cortisol action at MR was

blocked, and lessened in hearts where cortisol binding at GR was prevented.









Materials and Methods


Experimental Design

At the time of sacrifice during a previous study (Reini et al. 2008), fetal hearts were fixed

with 4% buffered paraformaldehyde for future immunohistochemical analysis and chunks of the

LV were frozen in liquid nitrogen and then stored at -800C for RNA and protein analysis at a

later time. In that study one group of ewes was treated with cortisol (1 mg/kg/day) between

-120-130 days of gestation ("cortisol" group), a second group of ewes was treated with the same

amount of cortisol but fetal cardiac MR was chronically antagonized in this group ("cortisol +

MRa" group), a third group contained ewes administered cortisol but fetal cardiac GR was

chronically blocked in this group ("cortisol + GRa" group), and a fourth group of ewes in which

no maternal or fetal manipulations occurred ("control group"). Treatment with cortisol in the

manner done in that study produces circulating cortisol levels that are within the range measured

with mild maternal stress, but are also known to induce fetal heart enlargement (Jensen et al.

2005). Fetal arterial and venous catheters were placed at the time of surgery; blood pressure and

heart rate was measured on day 130 of gestation and maternal plasma ACTH and cortisol

concentrations were measured in samples collected at -125 and -130 of gestation. Significant

increases in fetal heart weight along with LV and RV increases in the fetuses from the cortisol

group compared to those in the control group were reported in that study, but it was also

observed that MR blockade prevented the increase in relative heart mass and hearts in that group

contained significantly thinner LVs, RVs, and septums compared to the cortisol group (Reini et

al. 2008). GR blockade lessened the increase in relative heart mass along with LV and septal

thickening, and completely prevented the increase in RV thickness.









Immunohistochemistry

To determine percentage of myocytes, Ki67 staining of heart sections from each animal

was performed, as Ki67 is a protein only expressed by cells in the S-phase of the cell cycle.

Hearts were taken at the time of sacrifice (-130 days gestation) and fixed with 4% buffered

paraformaldehyde. The hearts were dehydrated with increasing concentrations of reagent

alcohol followed by xylene. The hearts were then embedded in paraffin wax. Ten [tm sections

were cut by a Zeiss rotary microtome and placed onto poly-l-lysine coated slides. Standard

methods were used for deparaffinization and rehydration. Endogenous peroxide was then

quenched using incubation in hydrogen peroxide (0.3%; Fisher Scientific, Fair Lawn, NJ).

Antigen retrieval was performed by immersion into sodium citrate buffer at 95 degrees for 30

minutes. The section was blocked for one hour with 5% non-fat dry milk in phosphate buffered

saline (PBS), followed by anti-Ki67 monoclonal antibody (dilluted 1:100 in blocking solution;

Dako, Glostrup, Denmark) addition for overnight incubation at 40C, and incubation with

biotinylated goat anti-mouse secondary antibody (Zymed, San Francisco, CA) for one hour. As

a tertiary agent, streptavidin-peroxidase (Zymed, San Francisco, CA) was used and metal

enhanced diaminobenzidine (DAB; Pierce) was used as the chromogen. Lastly, hematoxylin

(Fisher Scientific) staining of the nuclei for 45 seconds was utilized in order to co-localize with

the Ki67 staining. The stained sections were then dehydrated and a cover-slip was mounted onto

the section.

All images were visualized using an Olympus DP71 microscope and Olympus software,

and pictures were taken at 40x for analysis. For each heart sample, six pictures were taken of

each ventrcle; 3 in the middle of the ventricle, and 3 in the inner area of the ventricle. The nuclei

from each picture were then counted along with the number of Ki67 positively stained nuclei.

For each ventricle the percentage of Ki67 stained nuclei was then calculated.









Real-Time PCR

RNA was extracted from left ventricles (LV) of each heart using RNeasy Plus Mini Kit

(Qiagen Inc., Valencia Ca). Total RNA was measured spectrophotometrically to measure the

quantity and quality of RNA. RNA was reverse transcribed into cDNA using a high capacity

cDNA archive kit (Applied Biosystems; Foster City, CA) and aliquots for cDNA were stored at -

20C until used.

Qrt PCR was utilized to measured gene expression. The genes analyzed in this study

were MR, GR, 113-HSD1 and 2, IGF-1R, ATR1 and 2, glucose transporter 1 (GLUT1). All

probe and primer sequences except for GLUT1 were based on previously published sequences:

MR and GR (Keller-Wood et al. 2005), 113HSD2, AT1R and AT2R (Dodic et al. 2002), and

1 1PHSD1 and IGF-1R (Reini et al. 2006). GLUT1 primers and probe were designed using

Primer Express 2.0 (Applied Biosystems) based on an ovine sequence in the NCBI database

(accession number U89029; base pairs 334-396). The forward primer, reverse primer, and probe

used for GLUT1 were CTGCTCATTAACCGCAACGA, GGTCCCACGCAGCTTCTTC, and

AGAACCGGGCCAAGAGCGTGC respectively. An ABI PRISM 7000 Sequence Detection

System (Applied Biosystems) was used to carry out the qrt PCR reactions. Reactions were

carried out using 20 or 100 ng of template cDNA. All genes were normalized to p-actin mRNA.

Western Blotting

Immunoblot detection with antibodies to AT1R (sc-579; Santa Cruz, Sant Cruz, CA),

AT2R (a generous gift from Dr. Ian Bird, University of Wisconsin, Madison, WI), and

proliferating cell nuclear antigen (PCNA; Santa Cruz; sc-7907) was performed on protein

isolated from LVs of each of the hearts. Protein was isolated using the DC Protein Assay

(BioRad, Hercules, CA) and each sample was measured spectrophotometrically to identify the

quantity of protein present. For AT1R and AT2R, 105 utg of protein was loaded into each well









and separated by size using a 10% Tris-HCL gel (BioRad) by SDS-PAGE. The proteins were

electrophoretically transferred to 0.45-tlm nitrocellulose membranes for 1 hour at 100 V. The

same was done for PCNA except only 30 |tg of protein was added to each well. Following

protein separation, the membranes were washed once with tris-buffered saline with 0.5% Tween-

20 (TBST) and then stained with Ponceau S (Fisher Scientific) for normalization purposes. They

were then washed again with TBST and left to dry until wetted with TBST the day of staining.

On the day of staining, membranes were blocked with 5% non-fat dried milk in TBST for

two hours. Primary antibodies were then dilluted in blocking solution (1:750 for AT1R, 1:2,000

for AT2R, and 1:500 for PCNA) and incubated with the blot overnight at 40C. After washing

twice for 5 minutes in TBST, the membranes were incubated with peroxidase-linked secondary

antibody (1:16,000; Sigma, St. Louis, MO; A0545) for one hour at room temperature. The blots

were then washed with TBST and the bands were visualized with a chemiluminescence kit (GE

Healthcare, Buckinghamshire, UK) according to the manufacturer's directions. Films (Kodak

Biomax XAR Film, Sigma) were developed and bands were quantified using image analysis

software (BioRad ChemiDoc XRS). Probing for the AT2R followed stripping of the developed

AT1R blot using stripping solution (2% SDS, 62.5 mM Tris pH 6.8, and 100 mM 3-

mercaptoethanol) at 500C for 30 minutes. The membrane was then probed for AT2R using the

same method as AT1R and PCNA.

Data Analysis

Changes in the percentage of Ki67 positive nuclei were calculated using two way analysis

of variance in order to look for differences between the groups and between the middle and inner

areas of the ventricle.









Changes in gene expression among groups were analyzed by one-way analysis of variance

(ANOVA) using the ACt values. For graphical purposes, fold changes of the genes were

calculated using the expression 2A-AACt in which AACt is the difference between ACt for the

sample and mean ACt for the same gene in the control group (Livak et al. 2001). For ratio

comparisons of 1 13HSD1 and 11 PHSD2, and AT1R and AT2R, Ct values were compared

directly to the Ct values of the other gene without P-actin normalization.

Differences in protein expression were calculated by dividing the band density value by the

total protein for that lane as measured by Ponceau S staining. Calculation of the AT1R to AT2R

ratio was carried out by directly comparing band densities of each sample without normalizing to

total protein.

Results

Immunohistochemistry

The percentage of nuclei positively stained for Ki67 was increased in the cortisol group

and cortisol + GRa group compared to the other groups in the LV (Table 5-1; Figure 5-1). In the

RV, only the cortisol group had significantly more Ki67 stained nuclei than the control and

cortisol + MRa groups (Table 5-1).

Real-Time PCR analysis

Expression of MR, GR, 11P-HSD1, and 11P-HSD2

MR LV mRNA expression decreased in the cortisol + GRa group compared to control

hearts while GR mRNA expression tended to the same. 113HSD1 mRNA expression did not

change between the groups whereas 11 3HSD2 mRNA expression tended to go down in response

to elevated cortisol, but this tendency was blocked with MR and GR antagonism. Also, the









11 HSD1 to 113HSD2 mRNA ratio tended to increase in the cortisol group compared to the

other groups (Figure 5-2).

Expression of IGF1R, AT1R, AT2R, and GLUT1

No differences in mRNA expression were observed between the groups in IGF1R, AT1R,

or AT2R. The AT1R to AT2R mRNA ratio also did not change. GLUT1 mRNA expression

was similar in the control and cortisol groups but was significantly increased in the cortisol +

MRa and cortisol + GRa groups (Figure 5-3).

Western Blot Analysis

Expression of PCNA

PCNA protein expression in the LV did not change between the groups although there

was a tendency for expression to be decreased in both the cortisol + MRa and cortisol + GRa

groups (Figure 5-4).

Expresssion of AT1R and AT2R

AT1R protein expression in the LV was relatively consistent between the groups whereas

AT2R expression tended to decrease in the cortiol group compared to the other groups. The

AT1R to AT2R protein ratio tended to increase in the cortisol group (Figure 5-5).

Discussion

This study provides potential evidence that fetal heart enlargement in response to

moderately elevated cortisol levels late in gestation may be due to an increase in myocyte

proliferation, although the results are conflicting. Additionally, these results provide further

confirmation that local RAS activity and decreasing 11 -HSD2 expression levels may be

involved in the cardiac enlargement. This study also shows that GLUT1 expression in the LV is

unchanged by moderate increases in cortisol, but also indicates that basal cortisol activity at MR

and at GR are required for proper GLUT1 expression.









Cortisol Stimulation of Myocyte Proliferation

Previously, this laboratory has shown that fetal cardiac enlargement results from

chronically elevated cortisol levels (Jensen et al. 2005, Reini et al. 2008), but the method of

enlargement has not been elucidated. At this point in gestation (-130d), the fetal heart has the

unique ability to grow through both hyperplasia and hypertrophy (Jonker et al. 2007), so cortisol

could be stimulating growth through either hypertrophy or hyperplasia, or possibly even both.

The current study provides evidence for cardiomyocyte proliferation as a means of cardiac

enlargement in response to cortisol. Ki67 is a protein only expressed by cells in the S-phase of

the cell cycle and is therefore a marker of cell proliferation. Similar to what Giraud et al found

(Giraud et al. 2006), I observed an increase in Ki67 staining in both the right and left ventricles

of fetuses with cortisol infused mothers compared to the control and cortisol + MRa groups. I

also observed an increase in Ki67 staining in LVs of the cortisol + GRa group. Interestingly, this

Ki67 pattern of expression closely resembles the pattern of increases in ventricular wall

thicknesses within these hearts with the LV exhibiting a significant increase in thickness in the

cortisol group only when compared to the control and cortisol + MRa groups, whereas the RV

exhibited a thickness increase in the cortisol group compared to all other groups.

It is also important to point out that the hearts in this study were merely exposed to a

subpressor dose of cortisol and were not subjected to an increase arterial pressure or an increase

in cardiac fibrosis, suggesting hypertrophy may not be involved. This is similar to the findings

of Giraud et al. in which hearts infused with cortisol weighed more than control hearts due to an

increase in myocyte proliferation, but no differences in aortic, right atrial, systolic, and diastolic

pressures were observed between the groups. The studies that implicate hypertrophy as the

method of enlargement seem to involve larger, more acute doses of cortisol (Rudolph et al. 1999,









Lumbers et al. 2005). With this in mind, it is interesting to speculate that the mechanism of

enlargement may differ based on delivery method, amount, and duration.

In contrast to the Ki67 staining results, quantification of PCNA protein in the LV was not

suggestive of an increase in proliferation accounting for the increase in ventricular thickness in

response to elevated cortisol. No significant difference was observed in PCNA expression

between the groups, but expression did tend to decrease in both the cortisol + MRa group and the

cortisol + GRa group. One explanation for the contradiction is that Ki67 staining may be a more

dependable marker of proliferation than quantification of PCNA expression. It has been reported

that PCNA is more abundant and potentially less specific to the cell cycle when compared to

KI67 in the same tissue (Ekramullah et al. 1996, Aoyagi et al. 1995, Dierendonck et al. 1991). It

is also possible that western blot may not be sensitive enough to elucidate differences in

expression when only -1-2% of the total number of cells are in the cell cycle.

Expression of IGF1R, AT1R, and AT2R

Both IGF2 and IGF 1 have been shown to stimulate myocyte proliferation in vitro. Liu et

al. found that IGF2 stimulated an increase in proliferation of prenatal rat myocyte cultures, but

did not stimulate proliferation in neonatal myocytes (Liu et al. 1996). Similarly, it was shown in

a previous study that infusion of an IGF 1 analog into fetal sheep at 124d gestation results in

decreased numbers of binucleated cells, but increased percentages of monucleated myocytes; and

it was also demonstrated that IGF1 administration in cultured fetal cardiomyocytes stimulated

proliferation of the myocytes mediated by ERK and PI3K (Sundgren et al. 2003). Previously in

this laboratory it was shown that IGF1R mRNA expression decreased in response to elevated

maternal cortisol late in gestation (Reini et al. 2006). Because both IGF1 and IGF2 act via

binding at IGF1R in vivo, we interpreted the decrease in IGF1R mRNA expression in response to









elevated cortisol as a mechanism to limit growth following cardiac enlargement. However,

IGF1R mRNA expression was not decreased in the LV in this study.

We also observed an increase in the AT2R to AT1R mRNA ratio in a previous study

(Reini et al. 2006). In the ovine fetus, angiotensin II has been implicated in stimulating growth

of the heart. Segar et al. showed that infusion of angiotensin II into fetal sheep stimulates left

ventricular growth (Segar et al. 2001), and Sundgren et al. demonstrated in cultures of ovine

fetal cardiomyocytes that angiotensin II stimulates hyperplastic growth (Sundgren et al. 2003).

Furthermore, Lumbers et al. demonstrated that high-dose infusion of cortisol into the ovine fetus

(72.1mg d-1 for -60h) increased cardiac angiotensinogen mRNA (Lumbers et al. 2005). In the

adult heart, the AT1Rs are thought to be responsible for hypertrophic effects, while actions at

AT2R are hypothesized to counteract the AT1R (Booz et al. 2004, Zhu et al. 2003). We

therefore reasoned that the increase in the AT2R to AT1R ratio observed previously was a

response to slow growth in the hearts exposed to elevated cortisol (Reini et al. 2006). However,

we did not observe a change in receptor mRNA ratio in this study. A possible explanation for

the lack of change in the AT1R to AT2R ratio, along with the lack of change in IGF1R

expression, is that the cortisol hearts experienced a greater increase in mass in the previous study

(-25%; Jensen et al. 2005) than did the cortisol hearts from this study (-13%; Reini et al. 2008),

making it possible that the greater increase in mass is necessary for changes in expression of

these genes.

Interestingly, western blot revealed a tendency for AT2R protein to be decreased in the

cortisol group while the AT1R to AT2R protein ratio tended to increase in the cortisol group.

The pattern of protein expression is opposite of the observation regarding mRNA expression of

the angiotensin receptors from an earlier study in this laboratory (Reini et al. 2006). The









discrepancy between mRNA and protein could possibly be due to an attempt by the myocytes to

slow heart enlargement by transcribing genes that discourage growth when expression of pro-

growth proteins are elevated. Analysis of western blot results suggest cortisol may be increasing

the pro-growth action of the RAS within the heart by changing the receptor ratio in order to favor

growth.

Expression of MR, GR, 11pHSD1, and 11PHSD2

Cortisosteroid receptors have been implicated in both fetal and adult forms of cardiac

enlargement. It has been shown previously that MRs, and to a lesser extent GRs, in the heart

may play a primary role in cortisol-induced fetal cardiac enlargement (Reini et al. 2008).

Similarly, it has been established that treatment with the MR receptor antagonists eplenerone or

spironolactone leads to a reduction in the severity of cardiac hypertrophy and an increase in

survival rate in adult humans with severe heart failure (Pitt et al. 1999, Pitt et al. 2001). Whereas

MR has been shown to mediate an increase inflammation markers and cardiac fibrosis in the

adult hypertrophied hearts (Fraccarollo et al. 2004, Brilla et al. 1993, Fraccarollo et al. 2005,

Sun et al. 2002), MR and GR-mediated fetal cardiac enlargement caused by elevated cortisol is

not accompanied by an increase in fibrosis (Reini et al. 2008). This suggests the mechanism of

enlargement in the fetal heart may be fundamentally different from what is observed in adults.

Interestingly, this study provides further evidence that sub-pressor elevations in cortisol

may lead to increased exposure of MR and GR to cortisol. I found that hearts exposed to

elevated cortisol exhibited a tendency for reduction in 113HSD2 mRNA expression in the LV,

but this tendency is blocked with MR and GR antagonism. This is important because one of the

major factors influencing the ability of cortisol to activate MR and/or GR is the local activity of

the 1 hydroxysteroid dehydrogenase enzymes, 113-HSD1 and 113-HSD2. 113-HSD1 primarily









converts cortisone into cortisol, while 110-HSD2 converts cortisol into cortisone, which is

inactive at MR and GR (Krozowski et al. 1999). Additionally, I found that the 11 HSD1 to

113HSD2 mRNA ratio tended to increase in the cortisol group compared to the other groups. I

also observed that elevated cortisol had no effect on MR or GR expression, but I did find that

MR mRNA expression decreased in the cortisol + GRa group compared to control hearts while

GR mRNA expression tended to the same. This suggests that inhibition of cortisol binding at MR

or GR in the heart reduces transcription of GRs in fetal myocytes. These findings agree with a

previous study in which it was observed that elevated maternal cortisol levels did not alter LV

mRNA expression of MR, GR, and 1 13 HSD1, but caused a decrease in 1 13HSD2 expression

(Reini, 2006).

Expression of GLUT1

GLUT1 is thought to be responsible for basal glucose uptake in cardiac myocytes. In rats,

it was determined that the embryonic heart is rich in GLUT1 mRNA whereas the adult heart

contains predominantly GLUT4 mRNA, making it appear as though the major type of glucose

transporter in rat heart switches from GLUT1 to GLUT4 during development (Wang et al. 1991).

In adult rat myocytes, it was discovered via immunogold labelling that GLUT1 is predominantly

(76%) localized in the capillary endothelial cells, with only 24% of total cardiac GLUT1 present

in myocytes, suggesting a potential role in transporting glucose across the capillary wall before

myocyte uptake via GLUT1 (Davey et al. 2007). Glucose metabolism is thought to be very

important in hearts that have suffered an ischemic event. In rats with a large myocardial

infarction, progression from compensated remodeling to overt heart failure is associated with

upregulation of GLUT1 (Rosenblatt-Velin et al. 2001). Interestingly, there is evidence to

support glucocorticoid regulation of GLUT 1 expression in both skeletal and cardiac muscle in









the ovine fetus. Maternal antenatal dexamethasone (GR agonist) treatment given as a single

course (4 doses), or multiple courses (20 doses), increased GLUT 1 protein concentrations in

fetal skeletal muscle at 106 or 107 days gestation (Gray et al. 2006). Conversely, infusion of

high doses of cortisol directly into the ovine fetus in late gestation decreased levels of GLUT1

mRNA in the fetal LV (Lumbers et al. 2005). The present study found that mRNA expression of

GLUT1 did not change in the cortisol hearts compared to controls, but did increase significantly

in both the cortisol + MRa group and the cortisol + GRa group. These results imply that modest

increases in cortisol have no effect on GLUT1 expression within the fetal heart, but also that

basal amounts of cortisol action at both MR and GR are required for proper GLUT1 expression

within the fetal heart. An interesting observation is that dramatic increases in cortisol action at

MRs and GRs in the fetal heart, such as in the study by Lumbers et al. (Lumbers et al. 2005),

leads to decreased GLUT 1 mRNA expression in the LV whereas complete blockade of cortisol

action at MR or GR results in increased GLUT1 mRNA expression in the LV according to this

study, suggesting cortisol action at MRs and GRs in the fetal myocytes directly regulates GLUT1

mRNA expression in the LV.

In conclusion, I observed an increase in the percentage of myocytes positively stained for

Ki67 in the LV and RV of hearts from the cortisol group, suggesting myocyte proliferation is at

least partially accountable for the cardiac enlargement in response to elevated cortisol.

Quantification of PCNA via western blot, however, did not support this conclusion. I found that

the ratio of AT1R to AT2R protein expression tended to increase in the LV with elevated

cortisol, indicating a relative increase in angiotensin II action at the AT1R, which is thought to

be the more growth-friendly receptor. I also observed a trend for 113HSD2 mRNA expression

to decrease in the LVs of the cortisol group, but this decrease does not occur with MR or GR









blockade in the heart. Lastly, I found that basal cortisol action at MRs and GRs may be required

for proper maintenance of GLUT 1 expression within the LV.













A -I
Si v ..-~r
~~L~ 14Ci.: t
A,".'?~dJY
; ~i "". *,.. ..~i
V~


/ ~ t A






~-S





I I aN


r. .


'I
B ,
A-I-



:a

I- FA -







1. -. -.


Ct:





";'1
IL",
A..,1-
p-li'-
'.9'
I .$


-I".. ~ ..-


Figure 5-1. Immunohistochemical localization of Ki67 in representative hearts from fetuses of
control (A), cortisol (B), cortisol +MRa (C) and cortisol+GRa (D) groups. All photos
at 10x power.




































116















Mil


Cortisol Control Cort+ MRa Cort + GRa


E





Cortisol Control Cort+ MRa Cort + GRa

Figure 5-2. Gene expression of corticosteroid receptors and 1 10-HSDs in the LV. Expression of
mRNA for MR (A), GR (B), 1 10-HSD1 (C), and 110-HSD2 (D) in left ventricles
from fetuses of the control, cortisol, cortisol + MRa, and cortisol + GRa groups. The
ratio of 11 -HSD1 to 11 -HSD2 mRNAs in left ventricles from each group are
shown in panel E. Fold changes of the genes were calculated using the expression
2A-AACt with respect to the control group and are expressed as mean fold change +
SEM. *p<0.05 vs control


D
















. A Ao D
5
s /20











B *E
o *








Control Cortisol Cort+MRa Cort + GRa



C









Control Cortisol Cort+MRa Cort + GRa



Figure 5-3. Gene expression of angiotensin receptors, IGF1R, and GLUT1 in the LV.
Expression of mRNA for AT1R (A), AT2R (B), IGF1R (D), and GLUT1 (E) in left
ventricles from fetuses of the control, cortisol, cortisol + MRa, and cortisol + GRa
groups. Data are expressed as fold changes as in Figure 5-2. The ratio of AT1R to
AT2R mRNAs in left ventricles from each group are shown in panel C. *p<0.05 vs
control
control












0.008


0.006




0.004




0.002


0.000


Control Cortisol Cort + MRa Cort + GRa


Cont Cont Cont Cort Cort MRa MRa MRa GRa GRa


Spleen (+ control)


Figure 5-4. Protein expression ofPCNA (A; 36 kDa) in control, cortisol, cortisol + MRa, and
cortisol + GRa groups in LV. Representative bands are shown in panel B. Band
density is normalized to total protein. Values are represented as mean SEM.
















006 A


004










0 15 B


010 t

0 05 -

n nn.


D

Cont Cort MRa GRa Cont Cort MRa GRa Cont Cort MRa










E


cont court MRa GRa Cont Cort MRa GRa Cont MRa


c


F-= -7 r1vri


Control Cortisol Cort+ MRa Cort + GRa

Figure 5-5. Protein expression of AT1R (67 kDa; A) and AT2R (68 kDa; B) in control, cortisol,
cortisol + MRa, and cortisol + GRa groups. Band density is normalized to total
protein. The ratio of AT1R to AT2R protein expression in each group is shown in the
panel C. Representative bands are shown for AT1R (D) and AT2R (E). Values are
represented as mean SEM.









Table 5-1. Percentage of nuclei positively stained for Ki67 in the LV and RV.
Control Cortisol Cortisol + MRa Cortisol + GRa
LV 0.9 0.10 1.6 0.19*# 0.9 0.09 1.5 0.4*#
RV 1.0 +0.08 1.5 0.18*# 1.0 +0.12 1.3 0.23
Data are expressed as mean SEM. indicates significance compared to control, # indicates
significance compared to cortisol + MRa.









CHAPTER 6
SUMMARY

Cardiovascular disease is one of the most challenging health concerns in the modem era.

Mortality data from the year 2005 indicates cardiovascular disease contributes to 1 of every 2.8

deaths, and 1 death every 37 seconds, within the United States (Rosamond et al. 2008). There

are many factors contributing to these staggering statistic including obesity, blood pressure,

glucose tolerance, and lipid profile. Many of these factors can be attributed lifestyle and genetic

predisposition; however we now know fetal growth and nutrition can also be a strong predictor

of many of these risk factors for CVD (Roseboom et al. 2001). It is interesting that recent

evidence has implicated overexposure of the fetus to glucocorticoids as having similar effects in

predisposing the offspring to increased CVD risk later in life, a situation often referred to as

"programming" (aghajafari et al. 2002, Newnham et al. 2001, Walfisch et al. 2001, Banks et al.

1999, French et al. 1999). Increased cortisol exposure to the fetus can happen in several ways

including increased maternal stress, a natural over-production as seen in Cushing's disease, and

administration of synthetic glucocorticoids during premature labor. While we are beginning to

understand the initial causes of "programming" and its consequences, very little is understood

about the direct effects of cortisol overexposure on organ development. Understanding the role

of cortisol in organ maturation could give valuable insight into the mechanisms behind

programming and lead to future prevention and treatments. Since different organs go through

different developmental stages at different times, timing and duration of the increased exposure

probably affects each organ differently. This dissertation focused on the importance maintaining

proper cortisol levels late in gestation has on fetal heart development.

Fetal secretion of cortisol increases exponentially before birth in humans and in sheep

(Liggins et al. 1974), and induces maturation of intestine (Galand et al. 1989, Arsenalt et al.









1985), lung (Ballard et al. 1996, Liggins et al. 1972) and liver (Fowden et al. 1993, Fowden et

al. 1995). Studies conducted previous to the studies here suggested that heart mass can be altered

by small increases in fetal cortisol (Jensen et al. 2002, Jensen et al. 2005), indicating possible

action of cortisol at MR and/or GR in fetal myocytes. The experiments outlined in chapter 2

were designed quantify expression of genes in the LV, from a previous study in the laboratory

(Jensen et al. 2005), potentially involved in stimulating growth of the heart in response to

moderately elevated maternal cortisol late in gestation (1mg/kg/day infusion between -120-130

days). I found an increase in the AT2R to AT1R mRNA ratio, indicating the RAS as an

important contributor in the heart enlargement. I also observed a decrease in IGF1R mRNA

expression in enlarged hearts. Since IGF1R is the primary ligand responsible for pro-growth

effects of both IGF1 and IGF2, this indicated cortisol may regulate IGF action within the heart in

a negative matter as is seen within skeletal muscle (Li et al. 2002). The most interesting

observation from that study is that while MR, GR, and 110-HSD1 were all found to be very

abundant in mRNA expression within the heart, 11 -HSD2 mRNA decreased in its already very

low expression within the LV in response to the elevated cortisol. This suggested cortisol is able

exert direct actions on MR and GR within the developing heart in late gestation and that cortisol

action increases in the heart in an elevated cortisol environment not only due to extra circulating

cortisol, but also due to a decrease in conversion of cortisol into inactive cortisone within the

heart. Furthermore, immunohistochemical staining showed that MR, GR, and 110-HSD1 are all

abundantly expressed in both myocytes and blood vessels within the fetal heart at 128 days

gestation while 11 -HSD2 is primarily only expressed in blood vessels within the heart at this

time, further indicating the ability of cortisol to act directly on corticosteroid receptors within

myocytes at this time.









Since I found MR, GR, 110-HSD 1 and 2, along with components of the RAS and IGF

family to be important factors in determining proper heart growth in the study conducted in

chapter 2, my next study outlined in chapter 3 focused on determining the ontogeny of each of

these genes throughout late gestation and early postnatal life in both the LV and RV. This

allowed me to look at ventricle specific alterations in gene expression. Interestingly, I found

evidence for the RAS being an important influence of heart growth in late gestation. While

there were no significant overall patterns of change in expression of angiotensinogen mRNA in

LV or RV, ACE1 mRNA increased 5-fold in the LV and RV at term. ACE2 mRNA

expression, on the other hand, significantly decreased in the LV by 120 days gestation and

remained low, while expression in RV did not significantly change. The ACE1 to ACE2 mRNA

ratio increased ~15-fold by 145 days gestation compared to 80 days in both the LV and RV,

suggesting that local angiotensin II production may be associated with the terminal maturation of

the myocytes in preparation for life outside of the womb. The local mRNA expression of the

receptors of angiotensin II did not change dramatically in either ventricle, but AT1R mRNA

expression did decrease slightly in the LV in conjunction with the rise of ACE1 mRNA around

the time of parturition, suggesting a possible response to increased local angiotensin II levels.

These findings also suggest that the enzymes responsible for angiotensin II production may be

the primary modulators of the RAS in late gestation and early postnatal life rather than the

precursor protein, angiotensinogen, or the receptors for angiotensin II.

The IGF family members also exhibit an expression pattern consistent with modulating

growth of the heart in late gestation. LV IGF 1 mRNA expression did not significantly change

throughout late gestation or neonatally in either ventricle. IGF2 mRNA and IGF2R mRNA were

decreased in both the LV and RV after 120-130 days and remained low postnatally. As a result









of the decrease in IGF2 mRNA, the ratio of IGF2 to IGF1 mRNA decreases near term and

postnatally in both ventricles. This is interesting because IGF2 and IGF1 both appear to

stimulate myocyte proliferation (Liu et al. 1996, Sundgren et al. 2003). The dramatic decrease

in IGF2 mRNA from day 120 of gestation to parturition in both LV and RV parallels the

reduction in mononuclear myocytes in both ventricles (Jonker et al. 2007). It is interesting to

speculate that IGF2 may play a role in mononuclear myocyte proliferation, accounting for the

gradual decrease in proliferation observed throughout the last third of gestation as IGF2 mRNA

expression within the heart decreases. IGF1R mRNA levels are also decreased in the left

ventricle by 120 days gestation and maintained that lower level of expression through birth.

Because in vivo pro-growth actions of IGF1 and IGF2 are primarily mediated by IGF1R, the

decrease in IGF1R mRNA expression may limit the proliferative effects of both IGFs as the

heart matures.

Strong evidence for cortisol influencing heart growth throughout all of late gestation was

also observed in the studies outlined in chapter 3. I found that MR mRNA was highly expressed

at all points in both ventricles but expression is greatest in fetal LV at 80d and is significantly

decreased at 130 days of gestation and in newborns. GR mRNA was also highly expressed at all

points in both ventricles but is highest in the LV at 80d and decreased at 120, 130 d and in the

newborn LV. I found 110-HSD1 mRNA expression in the LV was significantly decreased at

120 days gestation compared to 80 days and 145 days gestation while 110-HSD2 mRNA

expression in LV did not change throughout gestation. However, in the RV 11 -HSD1 and 11P-

HSD2 mRNA expressions were highest in the newborns. The ratio of 110-HSD1 to 110-HSD2

expression was unchanged throughout the ages studied in LV and was significantly decreased in

the RV at 145 days compared to 100 days gestation, but at all points 11 -HSD1 expression was









far more abundant to 1 13-HSD2. It is important to note that the ability of cortisol to bind at MR

and/or GR depends in large part on the activity of 110-HSD1 relative to 110- HSD2 (Mihailidou

2005; Seckl 2001). The maintenance of high 11 -HSD1 mRNA expression relative to 113-

HSD2 mRNA expression within both ventricles of the heart throughout all of late gestation

indicates a significant role for cortisol within the heart in the late gestation fetus. However, the

decrease in MR and GR mRNA expression as plasma cortisol concentrations are increasing in

vivo suggests that proliferative effects of cortisol may be reduced in left ventricle as the heart

matures.

With evidence that cortisol has access to both MR and GR within the fetal heart, it was

reasonable to hypothesize that when plasma cortisol levels are increased, action of cortisol at MR

and GR in the heart would also increase. The purpose the experiments outlined in chapter 4 were

designed to elucidate whether corticosteroid receptors mediate the enlargement of the fetal heart

in response to elevated cortisol levels late in gestation. I also know, however, that MR is a

higher affinity receptors with greater occupancy at low cortisol concentrations (Reul et al. 1985).

I therefore reasoned that a greater effect may be expected with blockade of the MRs as compared

to blockade of GRs.

In order to elucidate if the cardiac enlargement is mediated by either MRs or GRs, I

designed an experiment in which we were able to block MRs and GRs within the fetal heart

through administration of specific antagonists into the pericardial space while maternally

infusing sub-presser doses of cortisol (Img/kg/day). This study also involved examination of

fetal hearts not administered corticosteroid blockers from maternal ewes that were either infused

with cortisol (Img/kg/day) or not infused with cortisol. As expected from findings in a previous

study in this laboratory relative fetal heart mass, LV wall thickness, and RV wall thickness were









all increased in the high cortisol group as compared to controls despite no differences between

any of the four groups in mean arterial pressure or heart rate. Interestingly, blockade of the MR

within the heart resulted in complete negation of the increase in relative heart mass while GR

blockade tended to decrease the enlargement. Furthermore, LV, RV, and septal thicknesses were

significantly decreased in the group receiving cardiac MR antagonism compared with the cortisol

group. GR blockade resulted in a significant reduction in RV wall thickness along with a

tendency for reduction in LV wall thickness and septal thickness compared to the cortisol group.

These results are consistent with our hypothesis that suggests cortisol acts directly on MRs, and

to a lesser extent GRs, within the fetal heart to stimulate growth.

Within the studies in chapter 4, I also wanted to examine whether fetal cardiac enlargement

stimulated by increased cortisol levels is accompanied by an increase in cardiac fibrosis. This is

interesting because cardiac MRs have been implicated as playing a role in remodeling of the

heart after injury or during heart failure in adult animals and humans. For instance, in adult rats

evidence exists that the mineralocorticoid receptor induces cardiac hypertrophy and fibrosis

occurring in response to ischemia while systemic administration of MR blockers reduce markers

of inflammation and cardiac fibrosis (Brilla et al. 1993, Fraccarollo et al. 2005, Sun et al. 2002).

It has been established in adult humans with severe heart failure that treatment with the MR

receptor antagonists eplenerone or spironolactone reduces the severity of cardiac hypertrophy

and increases the survival rate (Pitt et al. 1999, Pitt et al. 2001). While increases in interstitial

collagen content are a feature of adult cardiac hypertrophy (Pearlman et al. 1981), particularly in

the case of hypertension or myocardial infarction (Young et al. 2007), the effect of MR blockers

on survival rate appears to be the result of a decrease in cardiac fibrosis (Fraccarollo et al. 2004).

This suggests the possibility that cortisol-induced enlargement of the fetal heart may be similar









to that seen in adult cardiac injury. My studies indicate, however, that there was no increase in

collagen content with maternal infusion of cortisol, nor were there any effects of either MR or

GR blockade. This suggests that the mechanism of the enlargement of the fetal heart may be

fundamentally different from what is observed in adult rat models or human pathology, in which

ischemia is a contributing component.

In the last set of studies detailed in chapter 5, I wanted to further elucidate the mechanism

by which cortisol induces fetal heart enlargement. In early gestation, cell proliferation is the

main stimulus of cardiac growth (Smolich et al. 1995). It is known, however, that there is a

pronounced increase in fetal heart growth in the last third of gestation, paralleling a similar

exponential growth of the fetus. At the same time as the heart is increasing in both total weight

and left and right ventricle wall mass, an increasing number of myocytes terminally differentiate.

Binucleate or multinucleate myocytes are a result of this process and cells experiencing this are

unable to undergo further cell division (Burrell et al. 2003, Jonker et al. 2007). In fetal sheep

the number of binucleate myocytes increases from -115 days of gestation through term, and

heart growth during this period is due to both increases in myocyte proliferation and cell size

(Jonker et al. 2007). This means that cortisol-induced fetal heart enlargement occurring

between -120 and -130 days gestation could be accounted for by either hypertrophy or

hyperplasia, or possibly even both. Since no difference in blood pressure or fibrosis staining

between the groups had been observed, I hypothesized that cardiac growth was primarily due to

cell proliferation.

In order to investigate this I decided to stain for Ki67 (only expressed in the nuclei of

proliferating cells) in heart sections from each of the experimental groups. I found a higher

percentage of positively stained nuclei in both the LV and the RV of the cortisol group compared









to control and cortisol + MRa hearts. I also observed a higher percentage of cells stained in the

LV of the cortisol + GRa hearts compared to controls and cortisol + MRa hearts. These results

indicate cell proliferation as a mode of cardiac enlargement in response to elevated cortisol.

However, I found no change between the groups in protein expression of PCNA, another marker

of cell proliferation, via western blot. One possible explanation for this contradicting result is

that western blot may not be sensitive enough to elucidate differences in expression when only

-1-2% of the total number of cells are in the cell cycle. Another explanation is that PCNA has

been observed to be generally more abundant and less specific to the cell cycle when compared

to Ki67 in the same tissue, suggesting Ki67 staining may be more dependable when the

percentage of cells in the cell cycle is low (Ekramullah et al. 2005, Aoyagi et al. 1995,

Dierendonck et al. 1991).

In this study, I also wanted to examine the expression of genes and proteins known to be

potentially important in fetal cardiac enlargement. MR mRNA expression decreased in the

cortisol + GRa group compared to control hearts while GR mRNA expression tended to the

same. This suggests that cardiac-specific inhibition of cortisol binding at MR or GR reduces the

synthesis of GR transcripts being manufactured in fetal myocytes. 11J3HSD2 mRNA expression

tended to go down in the LV in response to elevated cortisol, but this tendency was blocked with

MR and GR antagonism. This result agrees with what was observed in Chapter 2 where

11PHSD2 decreased in the LV in the high cortisol group. Also, the 11pHSD1 to 113HSD2

mRNA ratio tends to increase in the cortisol group compared to the other groups. This further

indicates that exposure of MR and GR to cortisol may increase in response to sub-pressor

increases in cortisol, but this increase appears to be negated with MR or GR blockade.









IGF1R mRNA expression did not decrease nor did the AT2R to AT1R mRNA ratio

increase in the LV of the elevated cortisol group in this study as they did in Chapter 2. The

reason for examining these genes was to see if the decrease in IGF1R mRNA and increase in the

AT2R to AT1R mRNA ratio seen in the Chapter 2 study was negated by MR and GR blockade,

and so I was not anticipating observing no change between control LV expression and cortisol

LV expression of these genes. This could be due to the fact that the cortisol hearts from the

study in Chapter 2 experienced a greater increase in mass (-25%; Jensen et al. 2005) than did the

cortisol hearts from this study (-13%; Reini et al. 2008), making it possible that the greater

increase in mass is necessary for changes in expression of these genes.

Interestingly, the AT1R to AT2R protein ratio tended to increase in the cortisol group.

While this does not match with the mRNA expression of the same study, and is the opposite

trend of what was observed in the mRNA expression study in Chapter 2, this indicates that

cortisol may be increasing the pro-growth action of the RAS within the heart by changing the

receptor ratio in order to favor growth. Previously, the AT1R has been implicated in mediating

proliferation of vascular smooth muscle cells (Kohno et al. 2000), so it is possible that the AT1R

is mediating hyperplastic growth of the fetal heart is situations of elevated elevated cortisol. This

study also underscores the importance of interpreting the physiologic consequences of mRNA

expression increases and decreases with caution because it is not always reflective of protein

expression. Whereas AT1 and AT2 receptor mRNA increases are often indicative of similar

increases in protein expression in the heart, such as in cases of hypothyroidism in rats (Carneiro-

Ramos et al. 2008), this study shows this is not always the case and that post-transcriptional

modifications and protein turnover rates are also a major factor in determining physiologic

outcomes.









Lastly, I found that mRNA expression of GLUT 1 did not change in the cortisol hearts

compared to controls, but did increase significantly in both the cortisol + MRa group and the

cortisol + GRa group. This implies that moderate increases in cortisol have no effect on GLUT1

expression within the fetal heart, but it also implies that basal amounts of cortisol action at both

MR and GR are required for proper GLUT1 expression.

The studies within this dissertation have added important insights to the field of fetal heart

development and they have specifically investigated and provided potential mechanisms for fetal

heart enlargement as a consequence of elevated cortisol exposure. Specifically, these studies

have provided evidence that cardiac enlargement in response to elevated cortisol levels is

corticosteroid mediated, leads to increased activity of the RAS and decreased activity of the IGF

family, and is in part due to an increase in cell proliferation (Figure 6-1). These insights,

however, have larger implications and lead to some important questions. Questions like: if

cortisol-induced fetal cardiac enlargement is due to an increase in cell proliferation as the Ki67

staining evidence suggests, is the heart enlargement necessarily a negative consequence? Or

could obtaining an increased number of myocytes be beneficial? And since evidence here

indicates the heart enlargement is corticosteroid mediated, should better, more lung-specific,

methods of administration of synthetic glucocorticoids be considered for cases of pre-term labor?

Also, does fetal heart enlargement induced by elevated cortisol levels contribute to programming

for cardiovascular disease later in life, or are the negative consequences of programming limited

to other organs and not related to heart development? These are all important questions for

scientists studying fetal heart development to keep in mind, and answering these questions could

go a long ways towards reducing the risk for cardiovascular disease in individuals before even

the first breath of life is taken.








SCortisol action in the fetal
heart


11pHSD2 andt cortisol
action at MR and GR


IGF-mediated
growth


(+)


Angiotensin II
action at AT1 R


Z (+?)


(No effect)


Cardiac hypertrophy
and angiogenesis


Cardiac growth
by cell
proliferation

Figure 6-1. Effects of elevated cortisol on fetal heart growth. Cortisol acts directly on MR and
GR in the heart to stimulate cardiac growth by cell proliferation, which may be
mediated by local increases in angiotensin II action at AT1R.









LIST OF REFERENCES


Adler CP 1975 Relationship between deoxyribonucleic acid content and nucleoli in human heart
muscle cells and estimation of cell number during cardiac growth and hyperfunction. Recent
Advances in Studies on Cardiac Structure and Metabolism 8 373-386.

Aghajafari F, Murphy K, Matthews S, Olson A, Amankwah K, and Hammah M 2002 Repeated
doses of antenatal corticosteroids in animals: A systematic review. American Journal of
Obstetrics Gynecology 186 843-849.

Amato, G., Carella, C., Fazio, S. & La Montagna, G., Cittadini, A., Sabatini, D.,
Marciano-Mone, C., Sacca, L. & Bellastella, A 1993 Body composition, bone metabolism,
and heart structure and function in growth hormone (GH) deficient adults before and after
GH replacement therapy at low dose Journal of Clinical Endocrinology and Metabolism 77
1671-1676.

Anderson KM, Berrebi-Bertrand I, Kirkpatrick RB, McQueney MS, Underwood DC, Rouanet S
1999 cDNA sequence and characterization of the gene that encodes human myotrophin/V-1
protein, a mediator of cardiac hypertrophy. Journal of Molecular and Cellular Cardiology 31
705-719.

Andronico G, Mangano MT, Nardi B, Mule G, Piazza G, Censola G 1993 Insulin-like growth
factor I and soduim-lithium countertransoprt in essential hypertension and in hypertensive
left ventricular hypertrophy. Journal of Hypertension 11 1097-1101.

Anker SD, Volterrani M, Pflaum CD 2001 Acquired growth hormone resistance in patients with
chronic heart failure: implications for therapy with growth hormone, Journal of the
American College of Cardiology 38 443-452.

Aoyagi M, Yamamoto M, Wakimoto H, Azuma H, Hirakawa K, Yamamoto K 1995
Immunohistochemical detection of Ki-67 in replicative smooth muscle cells of rabbit carotid
arteries after balloon denudation. Stroke 26 2328-31.

Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, Evans RM 1987
Cloning of human mineralocorticoid receptor complementary DNA: Structural and
functional kinship with the glucocorticoid receptor. Science 237 268-275.

Arsenault P, & Menard D 1985 Influence of hydrocortisone on human fetal small intestine in
organ culture. Journal of Pediatric Gastroenterology and Nutrition 4 893-901.

Baicu CF, Stroud JD, Livesay VA, Hapke E, Holder J, Spinale FG, Zile MR. 2003
Changes in extracellular collagen matrix alter myocardial systolic performance.
American Journal of Physiology Heart and Circulatory Physiology 284 H122-32.

Ballard PL, Ertsey R, Gonzales LW, & Gonzales J 1996 Transcriptional regulation of human
pulmonary surfactant proteins SP-B and SP-C by glucocorticoids. American Journal of









Respiratory Cell and Molecular Biology : An Official Journal of the American Thoracic
Society, Medical Section of the American Lung Association 14 599-607.

Banks BA, Cnaan A, Morgan MA, Parer JT, Merrill JD, Ballard PL, Ballard RA1999 Multiple
courses of antenatal corticosteroids and outcome of premature neonates. American Journal
of Obstetrics and Gynecology 181 709-717.

Barbera A, Giraud GD, Reller MD, Maylie J, Morton MJ, Thornburg KL 2000 Right ventricular
systolic pressure load alters myocyte maturation in fetal sheep. American Journal of
Physiology Regulative, Integrative and Comparative Physiology 279 R1157-64.

Bell ME, Wood CE, & Keller WM 1991 Influence of reproductive state on pituitary-adrenal
activity in the ewe. Domestic Animal Endocrinology 8 245-254.

Benediktsson R, Lindsay RS, Noble J, Seckl JR, Edwards CR 1993 Glucocorticoid exposure in
utero: new model for adult hypertension. Lancet 341 339-341.

Bloomfield FH, van Zijl PL, Bauer MK, Phua HH, & Harding JE 2006 Effect of pulsatile growth
hormone administration to the growth-restricted fetal sheep on somatotrophic axis gene
expression in fetal and placental tissues. American Journal of Physiology. Endocrinology
and Metabolism 291 E333-E339.

Booz, GW 2004 Cardiac angiotensin AT2 receptor: What exactly does it do? Hypertension 43
1162-1163.

Brilla CG, Matsubara LS, & Weber KT 1993 Antifibrotic effects of spironolactone in preventing
myocardial fibrosis in systemic arterial hypertension. The American Journal of Cardiology
71 12A-16A.

Brower GL, Gardner JD, Forman MF, Murray DB, Voloshenyuk T, Levick SP, Janicki
JS 2006 The relationship between myocardial extracellular matrix remodeling and
ventricular function. European Journal of Cardiothoracic Surgery 30 604-10.

Brown RW, Diaz R, Robson AC, Kotelevtsev YV, Mullins JJ, Kaufman MH 1996 The ontogeny
of 11 beta-hydroxysteroid dehydrogenase type 2 and mineralocorticoid receptor gene
expression reveal intricate control of glucocorticoid action in development. Endocrinology
137 794-797.

Buerke M, Murohara T, Skurk C, Nuss C, Tomaselli K, Lefer AM 1995 Cardioprotective
effect of insulin-like growth factor I in myocardial ischemia followed by reperfusion.
Proceedings for the National Academy of Sciences USA 15 8031-5.

Burrell JH, Boyn AM, Kumarasamy V, Hsieh A, Head SI, & Lumbers ER 2003 Growth and
maturation of cardiac myocytes in fetal sheep in the second half of gestation. Anat.Rec.A
Discov.Mol.Cell Evol.Biol. 274 952-961.









Burrell JH, Hegarty BD, McMullen JR, & Lumbers ER 2001 Effects of gestation on ovine fetal
and maternal angiotensin receptor subtypes in the heart and major blood vessels.
Experimental Physiology 86 71-82.

Carey RM 2005 Angiotensin type-2 receptors and cardiovascular function: are angiotensin type-
2 receptors protective? Current Opinions in Cardioliology 20 264-9.

Cameiro-Ramos MS, Diniz GP, Almeida J, Vieira RL, Pinheiro SV, Santos RA, Barreto-Chaves
ML 2008 Cardiac angiotensin II type I and type II receptors are increased in rats submitted
to experimental hypothyroidism. Journal of Physiology 583 213-223.

Carr BR, Parker CR, Madden JD, MacDonald PC, and Porter JC 1981 Maternal
adrenocorticotropin and cortisol relationships throughout human pregnancy. American
Journal Obstetrics Gynecology 139 416-422.

Cheung CY, & Brace RA 1998. Ovine vascular endothelial growth factor: Nucleotide sequence
and expression in fetal tissues. Growth Factors (Chur, Switzerland), 16 11-22.

Cheung CY, Johnson DD, & Reyes V 1996 Ontogeny of insulin-like growth factor-I and -II gene
expression in ovine fetal heart. Journal of the Society for Gynecologic Investigation 3 309-
315.

Cittadini A, Cuocolo A, Merola B, Fazio S, Sabatini D, Nicolai E, Colao A,
Longobardi S, Lombardi G, Sacca L 1994 Impaired cardiac performance in GH-deficient
adults and its improvement after GH replacement. American Journal of Physiology 267
E219-25.

Clark PM 1998 Programming of the hypothalamo-pituitary-adrenal axis and the fetal origins of
adult disease hypothesis. European Journal of Pediatrics 157 Suppl 1 S7-10.

Cox BE, Rosenfeld CR 1999 Ontogeny of vascular angiotensin II receptor subtype expression in
ovine development. Pediatric Research 1999 45 414-24.

Crowley P 2002 Prophylactic corticosteroids for preterm birth. Cochrane Database of Systematic
Reviews 1.

Cuocolo A, Nicolai E, Colao A, Longobardi S, Cardei S, Fazio S, Merola B, Lombardi G,
Sacca L, Salvatore M 1996 Improved left ventricular function after growth hormone
replacement in patients with hypopituitarism: assessment with radionuclide
angiography.European Journal of Nuclear Medicine and Molecular Imaging 4 390-4.

Daniel SS, James LS, Stark RI, & Tropper, PJ 1989 Prevention of the normal expansion of
maternal plasma volume: A model for chronic fetal hypoxemia. Journal of Developmental
Physiology 11 225-233.









Danilczyk U & Penninger, JM 2006. Angiotensin-converting enzyme II in the heart and the
kidney. Circulation Research 98 463-471.

Davey KA, Garlick PB, Warley A, Southworth R 2007 Immunogold labeling study of the
distribution of GLUT-1 and GLUT-4 in cardiac tissue following stimulation by insulin or
ischemia. American Journal of Physiology Heart and Circulatory Physiology 292 2009-19.

DeChiara TM, Efstratiadis A, Robertson EJ 1990 A growth-deficiency phenotype in
heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting.
Nature 3 78-80.

Delhanty PJ, & Han VK 1993 The expression of insulin-like growth factor (IGF)-binding
protein-2 and IGF-II genes in the tissues of the developing ovine fetus. Endocrinology 132
41-52.

De Vrijer B, Davidsen ML, Wilkening RB, Anthony RV, Regnault TR 2006 Altered
Placental and Fetal Expression of IGFs and IGF-Binding Proteins Associated With
Intrauterine Growth Restriction in Fetal Sheep During Early and Mid-Pregnancy. Pediatric
Research 60 507-512.

Diez J 2007 Mechanisms of cardiac fibrosis in hypertension. Journal of Clinical Hypertension
(Greenwich, Conn.) 9 546-550.

Dodic M, Abouantoun T, O'Connor A, Wintour EM, & Moritz KM 2002 Programming effects of
short prenatal exposure to dexamethasone in sheep. Hypertension 40 729-734.

Donohue TJ, Dworkin LD, Lango MN, Fliegner K, Lango RP, Benstein JA, Slater WR, Catanese
VM 1994 Induction of myocardial insulin-like growth factor-I gene expression in left
ventricular hypertrophy. Circulation 89 799-809.

Dong, F, Ford P, Fang CX, Nijland MJ, Nathanielsz PW, & Ren J 2005 Maternal nutrient
restriction during early to mid gestation up-regulates cardiac insulin-like growth factor
(IGF) receptors associated with enlarged ventricular size in fetal sheep. Growth Hormone &
IGF Research : Official Journal of the Growth Hormone Research Society and the
International IGF Research Society 15 291-299.

Dostal DE 2000 The cardiac renin-angiotensin system: Novel signaling mechanisms related to
cardiac growth and function. Regulatory Peptides 91 1-11.

Dostal DE, Booz GW, & Baker KM 2000 Regulation of angiotensinogen gene expression and
protein in neonatal rat cardiac fibroblasts by glucocorticoid and beta-adrenergic stimulation.
Basic Research in Cardiology 95 485-490.

Douglas PS, Tallant B 1991 Hypertrophy, fibrosis and diastolic dysfunction in early canine
experimental hypertension. Journal of the American College of Cardiology 17 530-6.









Drake AJ, Walker BR, and Seckl JR. 2005 Intergenerational consequences of fetal programming
by in utero exposure to glucocorticoids in rats. American Journal of Physiology Regulatory,
Integretative and Comparative Physioliology 288 R34-R38.

Duerr RL, Huang S, Miraliakbar HR, Clark R, Chien KR, Ross J Jr 1995 Insulin-like growth
factor-1 enhances ventricular hypertrophy and function during the onset of experimental
cardiac failure. Journal of Clinical Investigation 95 619-27.

Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA, Sutanto WS de Kloet ER,
Monder C 1988 Localisation of 11 beta-hydroxysteroid dehydrogenase--tissue
specificprotector of the mineralocorticoid receptor. Lancet 29 986-9.

Ekramullah SM, Saitoh Y, Arita N, Ohnishi T, Hayakawa T 1996 The correlation of Ki-
67 staining indices with tumour doubling times in regrowing non-functioning pituitary
adenomas. Acta Neurochirurgica 138 1449-55.

Fazio S, Cittadini A, Sabatini D, Merola B, Colao AM, Biondi B, Lombardi G, Sacca L
1993 Evidence for biventricular involvement in acromegaly: a Doppler echocardiographic
study. European Heart Journal 14 26-33.

Fazio S, Cittadini A, Cuocolo A, Merola B, Sabatini D, Colao A, Biondi B, Lombardi G,
Sacca L 1994 Impaired cardiac performance is a distinct feature of uncomplicated
acromegaly. Journal of Clinical Endocrinology and Metabolism 79 441-6.

Fazio S, Cittadini A, Sabatini D, Merola B, Colao A, Biondi B, Longobardi S,
Lombardi G, Sacca L 1997 Growth hormone and heart performance. A novel mechanism of
cardiac wall stress regulation in humans. European Heart Journal 18 340-7.

Fejes-Toth G, Pearce D, & Naray-Fejes-Toth A 1998 Subcellular localization of
mineralocorticoid receptors in living cells: Effects of receptor agonists and antagonists.
Proceedings of the National Academy of Sciences of the United States of America 95 2973-
2978.

Fiebeler A, & Haller H 2003 Participation of the mineralocorticoid receptor in cardiac and
vascular remodeling Nephron Physiology 94 47-50.

Figueroa JP, Rose JC, Massmann GA, Zhang J, & Acuna G 2005 Alterations in fetal kidney
development and elevations in arterial blood pressure in young adult sheep after clinical
doses of antenatal glucocorticoids. Pediatric Research 58 510-515.

Fowden AL, Apatu RS, & Silver M 1995 The glucogenic capacity of the fetal pig:
Developmental regulation by cortisol. Experimental Physiology 80 457-467.

Fowden AL, Mijovic J, & Silver M 1993 The effects of cortisol on hepatic and renal
gluconeogenic enzyme activities in the sheep fetus during late gestation. The Journal of
Endocrinology 137 213-222.









Fraccarollo D, Galuppo P, & Bauersachs J 2004 Mineralocorticoid receptor antagonism and
cardiac remodeling in ischemic heart failure. Curr. Med. Chem. Cardiovasc. Hematol.
Agents 2 287-294.

Fraccarollo D, Galuppo P, Hildemann S, Christ M, Ertl G, & Bauersachs J 2003 Additive
improvement of left ventricular remodeling and neurohormonal activation by aldosterone
receptor blockade with eplerenone and ACE inhibition in rats with myocardial infarction.
Journal of the American College of Cardiology 42 1666-1673.

Fraccarollo D, Galuppo P, Schmidt I, Ertl G, & Bauersachs J 2005 Additive amelioration of left
ventricular remodeling and molecular alterations by combined aldosterone and angiotensin
receptor blockade after myocardial infarction. Cardiovascular Research 67 97-105.

Fraccarollo D, Galuppo P, Schraut S, Kneitz S, van Rooijen N, Ertl G, Bauersachs J 2008
Immediate mineralocorticoid receptor blockade improves myocardial infarct healing by
modulation of the inflammatory response. Hypertension 51 905-14.

French NP, Hagan R Evans SF Godfrey M, and Newnham JP 1999 Repeated antenatal
corticosteroids: Size at birth and subsequent development. American Journal Obstetrics
Gynecology 180 114-121.

Funder JW 2005. Mineralocorticoid receptors: Distribution and activation. Heart Failure
Reviews 10 15-22.

Galand G 1989 Brush border membrane sucrase-isomaltase, maltase-glucoamylase and trehalase
in mammals. comparative development, effects of glucocorticoids, molecular mechanisms,
and phylogenetic implications. Comparative Biochemistry and Physiology. B: Comparative
Biochemistry 94 1-11.

Garcia RH, Cabeza MP, Gallo A, Palacios L, Laguens RP 2002 DNA content and expression of
cell cycle proteins in caterpillar nuclei from fetal human cardiac myocytes. Virchows Archiv
440 45-49.

Gelpi RJ, Pasipoularides A, Lader AS, Patrick TA, Chase N, Hittinger L, Shannon RP,
Bishop SP, Vatner SF 1999 Changes in diastolic cardiac function in developing and stable
perinephritic hypertension in conscious dogs. Circulation Research 68 555-67.

Gilbert JS, Lang AL, Nijland MJ 2005 Maternal nutrient restriction and the fetal left
ventricle: decreased angiotensin receptor expression. Reproductive Biology and
Endocrinolology 14 3:27.

Giraud GD, Louey S, Jonker S, Schultz J, & Thornburg KL 2006 Cortisol stimulates cell cycle
activity in the cardiomyocyte of the sheep fetus. Endocrinology 147 3643-9.









Glorioso N, Filigheddu F, Parpaglia PP, Soro A, Troffa C, Argiolas G 2005 1 Ibeta-
hydroxysteroid dehydrogenase type 2 activity is associated with left ventricular mass in
essential hypertension. European Heart Journal 26 498-504.

Gomez-Sanchez CE, de Rodriguez AF, Romero DG, Estess J, Warden MP, Gomez-Sanchez MT
2006 Development of a panel of monoclonal antibodies against the mineralocorticoid
receptor. Endocrinology 147 1343-1348.

Gray S, Stonestreet BS, Thamotharan S, Sadowska GB, Daood M, Watchko J,
Devaskar SU 2006 Skeletal muscle glucose transporter protein responses to antenatal
glucocorticoids in the ovine fetus. The Journal of Endocrinology 189 219-29.

Green LR, Kawagoe Y, Hill DJ, Richardson BS, & Han VK 2000. The effect of intermittent
umbilical cord occlusion on insulin-like growth factors and their binding proteins in preterm
and near-term ovine fetuses. The Journal of Endocrinology 166 565-577.

Guron G, Friberg P, Wickman A, Brantsing C, Gabrielsson B, Isgaard J 1996 Cardiac
insulin-like growth factor I and growth hormone receptor expression in renal hypertension.
Hypertension 3 636-42.

Hanson MC, Kenneth AF, Alexander RW, DeLafontaine P 1993 Induction of cardiac
insulin-like growth factor I gene expression in pressure overload hypertrophy. American
Journal of the Medical Sciences 306 69-74.

Hein L, Barsh G S, Pratt R E, Dzau VJ, & Kobilka BK 1995 Behavioural and cardiovascular
effects of disrupting the angiotensin II type-2 receptor in mice. Nature 377 744-747.

Hoeflich A, Wu M, Mohan S, Foll J, Wanke R, Froehlich T 1999 Overexpression of insulin-like
growth factor-binding protein-2 in transgenic mice reduces postnatal body weight gain.
Endocrinology 140 5488-5496.

Huttenbach Y, Ostrowski ML, Thaller D, & Kim HS 2001 Cell proliferation in the growing
human heart: MIB-1 immunostaining in preterm and term infants at autopsy. Cardiovascular
Pathology : The Official Journal of the Society for Cardiovascular Pathology 10 119-123.

Janicki JS, Matsubara BB, Kabour A 1993 Myocardial collagen and its functional role.
Advances in Experimental Medicine and Biology 346 291-8.

Jensen E, Wood C, & Keller-Wood M 2002 The normal increase in adrenal secretion during
pregnancy contributes to maternal volume expansion and fetal homeostasis. Journal of the
Society for Gynecologic Investigation 9 362-371.

Jensen E, Wood CE, & Keller-Wood M 2005 Chronic alterations in ovine maternal
corticosteroid levels influence uterine blood flow and placental and fetal growth. American
Journal of Physiology. Regulatory, Integrative and Comparative Physiology 288 R54-R61.









Jensen EC, Gallaher BW, Breier BH, & Harding JE 2002. The effect of a chronic maternal
cortisol infusion on the late-gestation fetal sheep The Journal of Endocrinology 174 27-36.

Jewell CM, Webster JC, Burnstein KL, Sar M, Bodwell JE, & Cidlowski JA 1995
Immunocytochemical analysis of hormone mediated nuclear translocation of wild type and
mutant glucocorticoid receptors. The Journal of Steroid Biochemistry and Molecular
Biology 55 135-146.

Jones JI & Clemmons DR 1995 Insulin-like growth factors and their binding proteins: Biological
actions. Endocrine Reviews 16 3-34.

Jonker SS, Zhang L, Loue, S, Giraud GD, Thornburg KL, & Faber JJ 2007 Myocyte
enlargement, differentiation, and proliferation kinetics in the fetal sheep heart. Journal of
Applied Physiology: Respiratory, Environmental and Exercise Physiology 102 1130-1142.

Jugdutt BI, Idikio HA 2005 Apoptosis and oncosis in acute coronary syndromes:
assessment and implications.Molecular and Cellular Biochemistry 270 177-200.

Kadereit B, Fustier P, Shojaati K, Frey BM, Frey FJ, & Mohaupt MG 2005 Extracellular ATP
determines 1 Ibeta-hydroxysteroid dehydrogenase type 2 activity via purinergic receptors.
Journal of the American Society of Nephrology 16 3507-3516.

Keller-Wood M 1998 Evidence for reset of regulated cortisol in pregnancy: studies in
adrenalectomized ewes. American Journal of Physiology Regulatory, Integrative and
Comparative Physiology 274 R145-R151.

Keller-Wood M, Wood CE, Hua Y, & Zhang D 2005 Mineralocorticoid receptor expression in
late-gestation ovine fetal lung. Journal of the Society for Gynecologic Investigation 12 84-
91.

Keller-Wood ME, Shinsako J, Dallman MF 1983 Integral as well as proportional adrenal
responses to ACTH. Ameican Journal of Physiology 245 R53-R59.

Kim EK, Wood CE, Keller-Wood M 1995 Characterization of 11 beta-hydroxysteroid
dehydrogenase activity in fetal and adult ovine tissues. Reproduction Fertility and
Development 7 377-83.

Kliche K, Kuhn M, Hillebrand U, Ludwig Y, Stock C, & Oberleithner H 2006 Direct aldosterone
action on mouse cardiomyocytes detected with atomic force microscopy. Cellular
Physiology and Biochemistry : International Journal of Experimental Cellular Physiology,
Biochemistry, and Pharmacology 18 265-274.

Kohno M, Ohmori K, Nozaki S, Mizushige K, Yasunari K, Kano H, Minami M, and Yoshikawa
J 2000 Effects of valsartan on angiotensinll-induced migration of human coronary artery
smooth muscle cells. Hypertension Research 23 677-681.









Kotelevtsev Y, Brown RW, Fleming S, Kenyon C, Edwards CR, Seckl JR 1999 Hypertension in
mice lacking 1 Ibeta-hydroxysteroid dehydrogenase type 2. The Journal of Clinical
Investigation 103 683-689.

Krozowski Z, Li KX, Koyama K, Smith RE, Obeyesekere VR, Stein-Oakley A 1999 The type I
and type II 1 beta-hydroxysteroid dehydrogenase enzymes. The Journal of Steroid
Biochemistry and Molecular Biology 69 391-401.

Kwak SP, Patel PD, Thompson RC, Akil H, & Watson SJ 1993 5'-heterogeneity of the
mineralocorticoid receptor messenger ribonucleic acid: Differential expression and
regulation of splice variants within the rat hippocampus. Endocrinology 133 2344-2350.

Law CM, and Shiell A W 1996 Is blood pressure inversely related to birth weight? The strength
of evidence from a systematic review of the literature. Journal of Hypertension 14 935-941.

Lee WL, Chen JW, Ting CT, Ishiwata T, Lin SJ, Korc M, Wang PH 1999 Insulin-like
growth factor I improves cardiovascular function and suppresses apoptosis of
cardiomyocytes in dilated cardiomyopathy. Endocrinology 140 4831-40.

Levitt NS, Lindsay RS, Holmes MC, & Seck, JR 1996 Dexamethasone in the last week of
pregnancy attenuates hippocampal glucocorticoid receptor gene expression and elevates
blood pressure in the adult offspring in the rat. Neuroendocrinology 64 412-418.

Li B, Setoguchi M, Wang X, Andreoli AM, Leri A, Malhotra A, Kaj stura J, Anversa P
1999 Insulin-like growth factor-1 attenuates the detrimental impact of nonocclusive
coronary artery constriction on the heart. Circulation Research 14 1007-19.

Li J, Forhead AJ, Dauncey MJ, Gilmour RS and Fowden AL 2002 Control of growth hormone
receptor and insulin-like growth factor-I expression by cortisol in ovine fetal skeletal
muscle. Journal of Physiology 541 581-589.

Li J, Owens JA, Owens PC, Saunders JC, Fowden AL, Gilmour RS 1996 The ontogeny
of hepatic growth hormone receptor and insulin-like growth factor I gene expression in the
sheep fetus during late gestation: developmental regulation by cortisol. Endocrinology 137
1650-7.

Li J, Saunders JC, Fowden AL, Dauncey MJ, & Gilmour RS 1998 Transcriptional regulation of
insulin-like growth factor-II gene expression by cortisol in fetal sheep during late gestation.
Journal of Biological Chemistry 273 10586-10593.

Li J, Saunders JC, Gilmour RS, Silver M, & Fowden AL 1993 Insulin-like growth factor-II
messenger ribonucleic acid expression in fetal tissues of the sheep during late gestation:
Effects of cortisol. Endocrinology 132 2083-2089.

Liggins GC and Howie RN 1972 A controlled trial of antepartum glucocorticoid treatment for
prevention of the respiratory distress syndrome in premature infants. Pediatrics 50 515-525.









Liggins GC 1974 Parturition in the Sheep and the Human Physiology and Genetics of.
Reproduction., edited by Coutinho EM and Fuchs F. New York: Plenum Press 423-443


Lister K, Autelitano DJ, Jenkins A, Hannan RD, & Sheppard KE 2006 Cross talk between
corticosteroids and alpha-adrenergic signalling augments cardiomyocyte hypertrophy: A
possible role for SGK1. Cardiovascular Research 70 555-565.


Liu Q, Yan H, Dawes NJ, Mottino GA, Frank JS, & Zhu H 1996 Insulin-like growth factor II
induces DNA synthesis in fetal ventricular myocytes in vitro. Circulation Research 79 716-
726.

Livak KJ, & Schmittgen TD 2001 Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-delta delta C(T)) method. Methods (San Diego, Calif.) 25 402-
408.

Lombes M, Alfaidy N, Eugene E, Lessana A, Farman N, & Bonvalet JP 1995 Prerequisite for
cardiac aldosterone action. mineralocorticoid receptor and 11 beta-hydroxysteroid
dehydrogenase in the human heart. Circulation 92 175-182.

Lombes M, Binart N, Delahaye F, Baulieu EE, & Rafestin-Oblin ME 1994 Differential
intracellular localization of human mineralocorticosteroid receptor on binding of agonists
and antagonists. Biochemical Journal 302 191-197.

Lombes M, Oblin ME, Gasc JM, Baulieu EE, Farman M, and Bonvalet JP 1992
Immunohistochemical and biochemical evidence for a cardiovascular mineralocorticoid
receptor. Circulation Research 71 503-510.

Lu NZ, & Cidlowski JA 2006 Glucocorticoid receptor isoforms generate transcription
specificity. Trends in Cell Biology 16 301-307.

Lumbers ER, Boyce AC, Joulianos G, Kumarasamy, V, Barner E, Segar JL, 2005 Effects of
cortisol on cardiac myocytes and on expression of cardiac genes in fetal sheep. American
Journal of Physiology. Regulatory, Integrative and Comparative Physiology 288 R567-
R574.

MacFarlane N, Northridge DB, Wright AR, Grant S, Dargie HJ 1991 A comparative
study of left ventricular structure and function in elite athletes. British Journal of Sports
Medicine 25 45-8.

Huttenbach Y, Ostrowski ML, Thaller D, Kim HS 2001 Cell proliferation in the growing
human heart: MIB-1 immunostaining in preterm and term infants at autopsy. Cardiovascular
Pathology 10 119-123.

Meinel L, Zoidis E, Zapf J, Hassa P, Hottiger MO, Auer JA 2003 Localized insulin-like growth
factor I delivery to enhance new bone formation. Bone 33 660-672.









Mihailidou AS, & Funder JW 2005 Nongenomic effects of mineralocorticoid receptor activation
in the cardiovascular system. Steroids 70 347-351.

Modric T, Silha, JV, Shi Z, Gui Y. Suwanichkul A, Durham SK 2001 Phenotypic manifestations
of insulin-like growth factor-binding protein-3 overexpression in transgenic mice.
Endocrinology 142 1958-1967.

Nagata K, Obata K, Xu J, Ichihara S, Noda A, Kimata H, Kato T, Izawa H, Murohara T,
Yokota M 2006 Mineralocorticoid receptor antagonism attenuates cardiac hypertrophy and
failure in low-aldosterone hypertensive rats. Hypertension. 47 656-64.

Narayan S, Janicki JS, Shroff SG, Pick R, Weber KT 1989 Myocardial collagen and
mechanics after preventing hypertrophy in hypertensive rats. American Journal of
Hypertension 2 675-82.

National Institutes of Health Consensus Development Panel 2001 Antenatal corticosteroids
revisited: Repeat courses-National Institutes of Health Consensus Development
Conference Statement, August 17-18, 2000. Obstetrics and Gynecology 98 144-150.

Newnham J, Evans SF, Godfrey M, Huang W, Ikegami M, & Jobe A 1999 Maternal, but not
fetal, administration of corticosteroids restricts fetal growth. The Journal of Maternal-Fetal
Medicine 8 81-87.

Newnham JP, & Moss TJ 2001 Antenatal glucocorticoids and growth: Single versus multiple
doses in animal and human studies. Seminars in Neonatology 6 285-292.

Niebauer J, Pflaum CD, Clark AL 1998 Deficient insulin-like growth factor I in chronic heart
failure predicts altered body composition, anabolic deficiency, cytokine and neurohormonal
activation, Journal of the American College of Cardiology 32 393-397.

Nixon JV, Wright AR, Porter TR, Roy V, Arrowood JA 1991 Effects of exercise on left
ventricular diastolic performance in trained athletes. American Journal of Cardiology 1 945-
9.

Okoshi MP, Yan X, Okoshi K, Nakayama M, Schuldt AJ, O'Connell TD 2004 Aldosterone
directly stimulates cardiac myocyte hypertrophy. Journal of Cardiac Failure 10 511-518.

Oparil S, Bishop SP, & Clubb FJ, Jr. 1984 Myocardial cell hypertrophy or hyperplasia.
Hypertension 6 III38-III43.

Osgerby JC, Wathes D, Howard D, & Gadd TS 2004 The effect of maternal undernutrition on
the placental growth trajectory and the uterine insulin-like growth factor axis in the pregnant
ewe. The Journal of Endocrinology 182 89-103.

Pauschinger M, Knopf D, Petschauer S, Doerner A, Poller W, Schwimmbeck PL, Kuihl









U, Schultheiss HP 1999 Dilated cardiomyopathy is associated with significant changes in
collagen type I/III ratio. Circulation 99 2750-6.

Pearlman ES, Weber KT, & Janicki, JS 1981 Quantitative histology of the hypertrophied human
heart. Federation Proceedings 40 2042-2047.

Pearlman ES, Weber KT, Janicki JS, Pietra GG, Fishman AP 1982 Muscle fiber
orientation and connective tissue content in the hypertrophied human heart. Lab
Investigations 46 158-64.

Pecins-Thompson M, & Keller-Wood M 1997 Effects of progesterone on blood pressure, plasma
volume, and responses to hypotension. The American Journal of Physiology 272 R377-
R385.

Phillips, DI 1998 Birth weight and the future development of diabetes. A review of the evidence.
Diabetes Care 21 B150-B155.

Pitt B, Williams G, Remme W, Martinez F, Lopez-Sendon, J, Zannad F 2001 The EPHESUS
trial: Eplerenone in patients with heart failure due to systolic dysfunction complicating acute
myocardial infarction. eplerenone post-AMI heart failure efficacy and survival study.
Cardiovascular Drugs and Therapy / Sponsored by the International Society of
Cardiovascular Pharmacotherapy 15 79-87.

Pitt B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, 1999 The effect of spironolactone
on morbidity and mortality in patients with severe heart failure. randomized aldactone
evaluation study investigators. The New England Journal of Medicine 341 709-717.

Qin W, Rudolph AE, Bond BR, Rocha R, Blomme EA, Goellner JJ 2003 Transgenic model of
aldosterone-driven cardiac hypertrophy and heart failure. Circulation Research 93 69-76.

Quinlivan JA, Evans SF, Dunlop SA, Beazley LD, and Newnham JP. Use of corticosteroids by
Australian obstetricians A survey of clinical practice. The Australian and New Zealand
Journal of Obstetrics and Gynaecology 38 1-7.

Randhawa R, Cohen P 2005 The role of the insulin-like growth factor system in prenatal
growth. Molecular Genetics and Metabolism 86 84-90.

Reini S, Dutta G, Wood C, & Keller-Wood M 2008 Cardiac corticosteroid receptors receptors
mediate the enlargement of the ovine fetal heart induced by chronic increases in maternal
cortisol. The Journal of Endocrinology Epub May 21, 2008.

Reini SA, Wood CE, Jensen E, & Keller-Wood M 2006. Increased maternal cortisol
In late gestation ewes decreases fetal cardiac expression of 11 {beta}-HSD2 mRNA and the
ratio of AT to AT2 receptor mRNA. American Journal of Physiology. Regulatory,
Integrative and Comparative Physiology 291 1708-1716.









Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Homey CJ, Baserga R,
Anversa P 1996 Overexpression of insulin-like growth factor-1 in the heart is coupled with
myocyte proliferation in transgenic mice. Proceedings of the National Academy of Sciences
USA 93 8630-5.

Reul JMH, & DeKloet ER 1985 Two receptor system for corticosterone in rat brain:
Microdistribution and differential occupation. Endocrinology 117 2505-2511.

Reul JM, de Kloet ER, van Sluijs FJ, Rijnberk A, Rothuizen J 1990 Binding characteristics of
mineralocorticoid and glucocorticoid receptors in dog brain and pituitary. Endocrinology
127 907-915.

Richards EM, Hua Y, & Keller-Wood M 2003 Pharmacology and physiology of ovine
corticosteroid receptors. Neuroendocrinology 77 2-14.

Roghair RD, Lamb FS, Miller FJ, Jr, Scholz TD, & Segar JL 2005 Early gestation
dexamethasone programs enhanced postnatal ovine coronary artery vascular reactivity.
American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 288
R46-R53.

Rosamond W, Flegal K, Furie K, Go A, Greenlund K, Haase N, Hailpern SM, Ho M,
Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol
G, O'Donnell C, Roger V, Sorlie P, Steinberger J, Thom T, Wilson M, Hong Y 2008
American Heart Association Statistics Committee and Stroke Statistics Subcommittee.
Heart disease and stroke statistics--2008 update: a report from the American Heart
Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 117 e25-
146.

Roseboom TJ, van der Meulen JH, Ravelli AC, Osmond C, Barker DJ, Bleker OP 2001
Effects of prenatal exposure to the Dutch famine on adult disease in later life: an overview.
Twin Research 4 293-298.

Rosenblatt-Velin N, Montessuit C, Papageorgiou I, Terrand J, Lerch R 2001
Postinfarction heart failure in rats is associated with upregulation of GLUT-1 and
downregulation of genes of fatty acid metabolism. Cardiovascular Research 52 407-16.

Rosendorff C, Black HR, Cannon CP, Gersh BJ, Gore J, Izzo JL Jr, Kaplan NM,
O'Connor CM, O'Gara PT, Oparil S, American Heart Association Council for High Blood
Pressure Research; American Heart Association Council on Clinical Cardiology; American
Heart Association Council on Epidemiology and Prevention 2007 Treatment of
hypertension in the prevention and management ofischemic heart disease: a scientific
statement from the American Heart Association Council for High Blood Pressure Research
and the Councils on Clinical Cardiology and Epidemiology and Prevention. Circulation
115 2761-88.









Rudolph AM, Roman C, & Gournay V 1999 Perinatal myocardial DNA and protein changes in
the lamb: Effect of cortisol in the fetus. Pediatric Research 46 141-146.

Rydziel S, & Canalis E 1995 Cortisol represses insulin-like growth factor II receptor
transcription in skeletal cell cultures. Endocrinology 136 4254-4260.

Sarkar S, Leaman DW, Gupta S, Sil P, Young D, Morehead A 2004 Cardiac overexpression of
myotrophin triggers myocardial hypertrophy and heart failure in transgenic mice. Journal of
Biological Chemistry 279 20422-20434.

Sart6rio CL, Fraccarollo D, Galuppo P, Leutke M, Ertl G, Stefanon I, Bauersachs J 2007
Mineralocorticoid receptor blockade improves vasomotor dysfunction and vascular
oxidative stress early after myocardial infarction. Hypertension 50 919-25.

Scheuer DA Bechtold AG, Shank SS, & Akana SF 2004 Glucocorticoids act in the dorsal
hindbrain to increase arterial pressure. American Journal of Physiology. Heart and
Circulatory Physiology 286 H458-H467.

Schmidt M, Weidler C, Naumann H, Anders S, Scholmerich J, & Straub RH 2005 Reduced
capacity for the reactivation of glucocorticoids in rheumatoid arthritis synovial cells:
Possible role of the sympathetic nervous system? Arthritis and Rheumatism 52 1711-1720.

Schneider MD, Lorell BH 2001 AT(2), judgment day: which angiotensin receptor is the culprit
in cardiac hypertrophy. Circulation 104 247-248.

Seckl, JR 1997 Glucocorticoids, feto-placental 11 beta-hydroxysteroid dehydrogenase type
2, and the early life origins of adult disease. Steroids 62 89-94.

Seckl JR 1998 Physiologic programming of the fetus. Clinical Perinatology 25 939-62, vii.

Seckl JR, & Walker BR 2001 Minireview: 1 Ibeta-hydroxysteroid dehydrogenase type 1- a
tissue-specific amplifier of glucocorticoid action. Endocrinology 142 1371-1376.

Segar JL, Dalshaug GB, Bedell KA, Smith OM, & Scholz TD 2001 Angiotensin II in cardiac
pressure-overload hypertrophy in fetal sheep. American Journal of Physiology. Regulatory,
Integrative and Comparative Physiology 281 R2037-R2047.

Segar JL, Scholz TD, Bedell KA, Smith OM, Huss DJ, & Guillery EN 1997 Angiotensin ATI
receptor blockade fails to attenuate pressure-overload cardiac hypertrophy in fetal sheep.
The American Journal of Physiology 273 R1501-R1508.

Shanmugam S, Corvol P, & Gasc JM 1996 Angiotensin II type 2 receptor mRNA expression in
the developing cardiopulmonary system of the rat. Hypertension 28 91-97.

Sil P, Gupta S, Young D, & Sen S 2004 Regulation of myotrophin gene by pressure overload and
stretch. Molecular and Cellular Biochemistry 262 79-89.









Silva D, Venihaki M, Guo WH, Lopez MF.Endocrinology 2006 Igf2 deficiency results in
delayed lung development at the end of gestation. 147 5584-91.

Sloboda DM, Newnham JP, & Challis JR 2000 Effects of repeated maternal betamethasone
administration on growth and hypothalamic-pituitary-adrenal function of the ovine fetus at
term. The Journal of Endocrinology 165 79-91.

Smolich JJ 1995 Ultrastructural and functional features of the developing mammalian heart: A
brief overview. Reproduction, Fertilility and Development 7 451-461.

Smolich JJ, Walker AM, Campbell GR, Adamson TM 1989 Left and right ventricular
myocardial morphometry in fetal, neonatal, and adult sheep. American Journal of
Physiology 257 H1-9.

Stewart PM, Corrie JE, Shackleton CH, Edwards CR 1988 Syndrome of apparent
mineralocorticoid excess. A defect in the cortisol-cortisone shuttle. Journal of Clinical
Investigation 82 340-9.

Sun Y, Zhang J, Lu L, Chen SS, Quinn MT, & Weber KT 2002 Aldosterone-induced
inflammation in the rat heart : Role of oxidative stress. American Journal of Pathology 161
1773-1781.

Sundgren NC, Giraud GD, Schultz JM, Lasarev MR, Stork PJ, & Thornburg KL 2003
Extracellular signal-regulated kinase and phosphoinositol-3 kinase mediate IGF-1 induced
proliferation of fetal sheep cardiomyocytes. American Journal of Physiology. Regulatory,
Integrative and Comparative Physiology 285 R1481-R1489.

Sundgren NC, Giraud GD, Stork PJ, Maylie JG, & Thornburg KL 2003 Angiotensin II stimulates
hyperplasia but not hypertrophy in immature ovine cardiomyocytes. The Journal of
Physiology 548 881-891.

Sutano W, de Kloet ER 1987 Species-specificity of corticosteroid receptors in hamster and rat
brains. Endocrinology 1211405-1411.

Suzuki G, Morita H, Mishima T, Sharov VG, Todor A, Tanhehco EJ, Rudolph AE,
McMahon EG, Goldstein S, Sabbah HN 2002 Effects of long-term monotherapy with
eplerenone, a novel aldosterone blocker, on progression of left ventricular dysfunction and
remodeling in dogs with heart failure.Circulation 106 2967-72.

Suzuki J, Kanazawa T, Iwai M, Horiuch M 2004 Angiotensin II AT2 receptors and
cardiac function. In: De Mello WC, ed. Renin Angiotensin System and the Heart. West
Sussex, UK: John Wiley & Sons 85-99.

Takeda Y, Zhu A, Yoneda T, Usukura M, Takata H, Yamagishi M 2007 Effects of









aldosterone and angiotensin II receptor blockade on cardiac angiotensinogen and
angiotensin-converting enzyme 2 expression in Dahl salt-sensitive hypertensive
rats.American Journal of Hypertension 20 1119-24.

Tangalakis K, Lumbers ER, Moritz KM, Towstoless MK, & Wintour EM 1992 Effect of cortisol
on blood pressure and vascular reactivity in the ovine fetus. Experimental Physiology 77
709-717.

Thompson A, Han VK, & Yang K 2004 Differential expression of 1 Ibeta-hydroxysteroid
dehydrogenase types 1 and 2 mRNA and glucocorticoid receptor protein during mouse
embryonic development. The Journal of Steroid Biochemistry and Molecular Biology 88
367-375.

Tian XL, Pinto YM, Costerousse O, Franz WM, Lippoldt A, Hoffmann S 2004 Over-expression
of angiotensin converting enzyme-1 augments cardiac hypertrophy in transgenic rats.
Human Molecular Genetics 13 1441-1450.

Torres A, Belser WW, III, Umeda PK, & Tucker D 1997 Indicators of delayed maturation of rat
heart treated prenatally with dexamethasone. Pediatric Research 42 139-144.

Trollmann R, Klingmuiller K, Schild RL, Rascher W, Dotsch J 2007 Differential gene expression
of somatotrophic and growth factors in response to in vivo hypoxia in human placenta.
American Journal of Obstetrics and Gynecology 197 601-603.

Unno N, Wong CH, Jenkins SL, Wentworth RA, Ding XY, Li C 1999 Blood pressure and heart
rate in the ovine fetus: Ontogenic changes and effects of fetal adrenalectomy. The American
Journal of Physiology 276 H248-H256.

Valensise H, Liu YY, Federici M, Lauro D, Dell>>anna D, Romanini C, Sesti G 1996 Increased
expression of low-affinity insulin receptor isoform and insulin-like growth factor-I hybrid
receptors in term placenta from insulin-resistant women with gestational hypertension.
Diabetologia 39 952-960.

Van Dierendonck JH, Wijsman JH, Keijzer R, van de Velde CJ, Comelisse CJ 1991
Cell-cycle-related staining patterns of anti-proliferating cell nuclear antigen monoclonal
antibodies. Comparison with BrdUrd labeling and Ki-67 staining. American Journal of
Pathology 138 1165-72.

Vasan RS, Sullivan LM, D'Agostino RB 2003 Serum insulin-like growth factor I and risk for
heart failure in elderly individuals without a previous myocardial infarction: the
Framingham Heart Study, Annals of Internal Medicine 139 642-648.

Wahlander H, Isgaard J, Jennische E, Friberg P 1992 Left ventricular insulin-like growth factor I
increases in early renal hypertension. Hypertension 19 25-32.

Winer BJ 1971 Statistical principles in experimental design. New York: McGraw-Hill.









Wintour EM, Johnson K, Koukoulas I, Moritz K, Tersteeg M, & Dodic M 2003 Programming
the cardiovascular system, kidney and the brain--a review. Placenta 24 S65-S71.

Wood CE 2002 The ovine fetal endocrine reflex responses to haemorrhage are not mediated by
cardiac nerves. The Journal of Physiology 541 613-622.

Wood CE, Chen GF, & Keller-Wood M 2005 Expression of nitric oxide synthase isoforms is
reduced in late-gestation ovine fetal brainstem. American Journal of Physiology.
Regulatory, Integrative and Comparative Physiology 289 R613-R619.

Wood CE, Cheung CY, & Brace RA 1987 Fetal heart rate, arterial pressure, and blood volume
responses to cortisol infusion. American Journal of Physiology 253 R904-R909.

Wood CE, & Rudolph AM 1983 Negative feedback regulation of adrenocorticotropin secretion
by cortisol. Endocrinology 112 1930-1936.

Walfisch A, Hallak M, and Mazor M 2001 Multiple courses of antenatal steroids: Risks and
benefits. Obsterics Gynecology 98 491-497.

Wang C, Hu SM 1991 Developmental regulation in the expression of rat heart glucose
transporters. Biochemical and Biophysical Research Communications 177 1095-100.

Westphal U 1971 Steroid-Protein Interactions. New York, Springer.

Xiao HD, Fuchs S, Campbell DJ, Lewis W, Dudley SC, Jr, Kasi VS 2004 Mice with cardiac-
restricted angiotensin-converting enzyme (ACE) have atrial enlargement, cardiac
arrhythmia, and sudden death. American Journal of Pathology 165 1019-1032.

Xu J, Carretero OA, Lin CX, Cavasin MA, Shesely EG, Yang JJ 2007 Role of cardiac
overexpression of ANG II in the regulation of cardiac function and remodeling
postmyocardial infarction. American Journal of Physiology. Heart and Circulatory
Physiology 293 H1900-H1907.

Xu J, Carretero OA, Liu YH, Shesely EG, Yang F, Kapke A 2002 Role of AT2 receptors in the
cardioprotective effect of AT1 antagonists in mice. Hypertension 40 244-250.

Yang K, Smith CL, Dales D, Hammond GL, & Challis JRG 1992 Cloning of an ovine 11 beta-
hydroxysteroid dehydrogenase complementary deoxyribonucleic acid: Tissue and temporal
distribution of its messenger ribonucleic acid during fetal and neonatal development.
Endocronology 131 2120-2126.

Yin P, Xu Q and Duan C 2004 Paradoxical actions of endogenous and exogenous insulin-like
growth factor binding protein (IGFBP)-5 revealed by RNA interference analysis Journal of
Biological Chemistry 279 32660-32666.









Young MJ, Lam EY, & Rickard AJ 2007 Mineralocorticoid receptor activation and cardiac
fibrosis. Clinical Science (London, England : 1979) 112 467-475.

Young MJ, Moussa L, Dilley R, & Funder JW 2003 Early inflammatory responses in
experimental cardiac hypertrophy and fibrosis: Effects of 11 beta-hydroxysteroid
dehydrogenase inactivation. Endocrinology 144 1121-1125.

Zar JH 1984 Biostatistical analysis. Englewood Cliffs, NJ: Prentice-Hall.

Zhu YC, Zhu YZ, Lu N, Wang MJ, Wang YX, Yao T 2003 Role of angiotensin AT1 and AT2
receptors in cardiac hypertrophy and cardiac remodelling. Clinical and Experimental
Pharmacology & Physiology 30 911-918.









BIOGRAPHICAL SKETCH

Seth Andrew Reini was born in 1981, and lived in Lewiston, New York, until the age of

7. At this time his family relocated to Ohio, where he developed a strong interest in science

during his junior high years. He graduated high school as valedictorian of his class in 1999. He

graduated summa cum laude with a degree in biology, along with minors in chemistry and

religious studies, from The University of Findlay in 2003. He also received the "Senior Science

Award" from The University of Findlay in 2003. Seth began his graduate studies at the

University of Florida College of Medicine in August 2003. His dissertation work was completed

with Dr. Maureen Keller-Wood in the Department of Physiology, where he studied the

mechanisms by which elevated cortisol levels enlarge the fetal heart. Seth was supported in his

graduate studies by an American Heart Association pre-doctoral fellowship and by a scholarship

through the Health Services Collegiate Program with the U.S. Navy. Seth has accepted a

position to do stress-response physiology research for the U.S. Navy.





PAGE 1

1 MECHANISMS BY WHICH OVEREXPOSURE TO CORTISOL CAUS ES FETAL HEART ENLARGEMENT IN LATE GESTATION By SETH ANDREW REINI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Seth Andrew Reini

PAGE 3

3 To my mother, Janet, whose tire less work ethic and strong moral ch aracter are an inspiration to me. Also to my Father, George, who has always challenged me to think critically.

PAGE 4

4 ACKNOWLEDGEMENTS I thank my committee chair, Dr. Maureen Keller-Wood, for giving me the opportunity to learn under her tutelage. She has been a tremendous mentor. I appreciate her patience (she needed a lot sometimes!) in teaching me, and ha ve enjoyed witnessing her enthusiasm for her work and her excitement for educatin g all with a will to learn. I would also like to thank Dr. Charles E. Wood whose skillful hands performed all of the surgeries necessary for this dissertation work to be completed. His enthusiasm for his work has also been an inspiration to me. Thanks al so go to my other comm ittee members (Drs. Peter Sayeski, Paul Oh, and Michael Kilberg) for th eir guidance and support. Finally, thanks go to every member of the Wood and Keller-Wood labs, past and present, who have helped me along the way. Jarret McCartney deserves special men tion for helping care for the sheep before and after surgery and Elaine Sumners also deserves special recognition for all of the advice she has given, both sciencean d nonscience-related.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGEMENTS.............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 ABSTRACT...................................................................................................................................10 CHAP TER 1 INTRODUCTION..................................................................................................................12 Background and Significance.................................................................................................12 Role of Cortisol in Pregnancy................................................................................................. 12 Importance of Maintaining Proper Cortisol Levels in Pregnancy.......................................... 13 Corticosteroid Receptors and 11 Beta-Hydroxysteroid Dehydrogenases ..............................14 Consequences of Elevated Cortisol on Fetal Heart Growth ...................................................16 Role of MR in the Heart........................................................................................................ .17 Cardiac Collagen Deposition..................................................................................................18 Hyperplasia vs. Hypertrophy in the Fetal Heart..................................................................... 20 Role of the Renin-Angiotensin System in the Heart.............................................................. 21 Role of the Insulin-Like Grow th Factors in the Heart ............................................................ 24 Summary.................................................................................................................................27 Specific Aims..........................................................................................................................28 2 INCREASED MATERNAL CORTISOL IN LATE GESTATION EWES DECREASES FETAL CARDIAC EXPRESSION OF 11 -HSD2 mRNA AND THE RATIO OF AT1 TO AT2 RECEPTOR mRNA ..................................................................... 32 Introduction................................................................................................................... ..........32 Materials and Methods...........................................................................................................33 Experimental Design....................................................................................................... 33 Real-Time PCR............................................................................................................... 35 Radioimmunoassay.......................................................................................................... 37 Immunohistochemistry and Collagen Staining............................................................... 37 Data Analysis...................................................................................................................39 Results.....................................................................................................................................40 Real-Time PCR Analysis................................................................................................ 40 Expression of MR and GR.......................................................................................40 Expression of 11 -HSD1 and 2 ................................................................................40 Expression of myotrophin, NOS-3, and VEGF........................................................ 40 Expression of IGF-I and II, IGF-1R and 2R............................................................ 40 Expression of angiotensinogen, AT1R, AT2R, ACE1, and ACE2 ..........................41

PAGE 6

6 Immunohistochemistry and Collagen Staining............................................................... 41 Plasma Angiotensin II.....................................................................................................41 Regression Analysis........................................................................................................ 42 Discussion...............................................................................................................................42 Role of Corticosteroid s Acting at MR or GR .................................................................. 43 Role of Growth-Related Genes: VEGF, eNOS, Myotrophin and IGFs .......................... 46 Role of the Renin-Angiotensin System...........................................................................47 3 ONTOGENY OF GENES RELATED TO OVINE FETAL HEART GROWTH: IMPLICATIONS FOR GROWTH SECO NDARY TO INCREASED CORTISOL ............. 62 Introduction................................................................................................................... ..........62 Materials and Methods...........................................................................................................63 Real-Time PCR............................................................................................................... 63 Data Analysis...................................................................................................................64 Results.....................................................................................................................................65 Expression of MR, GR, and 11 -HSD1 and 2 mRNA .................................................... 65 Expression of IGF1, IGF-1R, IGF2, IGF-2R, and IGFBP2 ............................................ 65 Expression of Angiotensinogen, AT1R AT2R, ACE1, and ACE2 mRNA ................... 66 Discussion...............................................................................................................................67 Role of Corticosteroids in the Heart................................................................................68 Insulin-Like Growth Factors...........................................................................................68 Renin-Angiotensin System..............................................................................................71 4 CARDIAC CORTICOSTEROID RECEPT ORS MEDIATE THE ENLARGEMENT OF THE OVINE FET AL HEART INDUCED BY CHRONIC INCREASES IN MATERNAL CORTISOL......................................................................................................78 Introduction................................................................................................................... ..........78 Materials and Methods...........................................................................................................79 Experimental Design....................................................................................................... 79 Surgical Procedures.........................................................................................................80 Experimental Protocol.....................................................................................................82 Analysis....................................................................................................................... ....83 Immunohistochemical Locali zation of MR and GR ....................................................... 83 Collagen Staining............................................................................................................ 84 Data Analysis...................................................................................................................84 Results.....................................................................................................................................85 Maternal Physiology........................................................................................................85 Fetal Physiology..............................................................................................................86 Fetal Heart Measurements............................................................................................... 86 Collagen Staining............................................................................................................ 87 Discussion...............................................................................................................................87 Role of MR and GR in the Heart..................................................................................... 87 Role of MR in Hypertro phy in the A dult Heart.............................................................. 90 Mechanisms of Enlargement of the Fetal Heart.............................................................. 91 Conclusions.....................................................................................................................93

PAGE 7

7 5 ANALYSIS OF PROLIFERATION MARKERS AND EXPRESSION LEVELS OF POTENTIAL GROWTH PROM OTERS WITHIN THE FETAL HEART.........................101 Introduction................................................................................................................... ........101 Materials and Methods.........................................................................................................103 Experimental Design..................................................................................................... 103 Immunohistochemistry.................................................................................................. 104 Real-Time PCR............................................................................................................. 105 Western Blotting............................................................................................................ 105 Data Analysis.................................................................................................................106 Results...................................................................................................................................107 Immunohistochemistry.................................................................................................. 107 Real-Time PCR analysis................................................................................................ 107 Expression of MR, GR, 11 -HSD1, and 11 -HSD2............................................. 107 Expression of IGF1R, AT1R, AT2R, and GLUT1................................................ 108 Expression of PCNA.............................................................................................. 108 Expresssion of AT1R and AT2R........................................................................... 108 Discussion.............................................................................................................................108 Cortisol Stimulation of Myocyte Proliferation.............................................................. 109 Expression of IGF1R, AT1R, and AT2R...................................................................... 110 Expression of MR, GR, 11 HSD1, a nd 11 HSD2.......................................................112 Expression of GLUT1................................................................................................... 113 6 SUMMARY..........................................................................................................................122 LIST OF REFERENCES.............................................................................................................133 BIOGRAPHICAL SKETCH.......................................................................................................151

PAGE 8

8 LIST OF TABLES Table page 2-1 Primers and Probes used in real-time PCR assays............................................................. 57 2-2 Partial sequence of ovine m yotrophin................................................................................ 60 2-3 Fetal plasma angiotensin II levels (pg/ m l) in fetuses in the high, control, and low m aternal cortisol groups at 120, 125, and 130 days gestation...........................................61 3-1 Expression ratio of 11 -HSD1 to 11 -HSD2, IGF2 to IGF1, AT1R to AT2R, and ACE1 to ACE2 in LV and RV mRNA........................................................................ 77 4-1 Fetal and Maternal Cortisol concentr ations (average of days 5 and 10) and ACTH concentration on day 10 .....................................................................................................97 4-2 Fetal blood gas and packed cell volume............................................................................ 98 4-3 Fetal arterial pressure an d fetal heart rate on day 10 ......................................................... 99 4-4 Collagen content determined by picrosiriu s red staining (fracti on of total area) in left ventricle (L V), right vent ricle (RV), and septum............................................................ 100 5-1 Percentage of nuclei positively stained for KI67 in the LV and RV............................... 121

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Components of the HPA axis and how it interacts............................................................ 29 1-2 Different actions of 11 HSD1 and 2 and how they interact with cortisol ......................... 30 1-3 Components of the re nin-angiotensin system ....................................................................31 2-1 Gene expression of cor ticosteroid receptors and 11 -HSDs in the LV ............................. 51 2-2 Gene expression of M yotrophin and vasculogenesis related genes in the LV .................. 52 2-3 Gene expression of IGFs and IGF receptors in the LV ..................................................... 53 2-4 Gene expression of the RAS in the LV.............................................................................. 54 2-5 Localization of corticosteroid receptors and 11 -HSDs in the LV....................................55 2-6 Linear regression correlation of 11 -HSD2 mRNA and left ve ntr icular wall thickness... 56 3-1 Ontogenetic expression of corticos teroid receptors and 11 -HSDs in the LV and RV.....74 3-2 Ontogenetic expression of IGFs, IGF recep to rs, and binding proteins in the LV and RV......................................................................................................................................75 3-3 Ontogenetic expression of the RAS in the LV and RV..................................................... 76 4-1 Immunohistochemical localization of MR and GR in representative hearts ..................... 94 4-2 Fetal heart measurements in response to m anipulations.................................................... 95 4-3 Collagen staining of fetal hearts........................................................................................ 96 5-1 Immunohistochemical localization of Ki67 in representative hearts ............................... 116 5-2 Gene expression of cor ticosteroid receptors and 11 -HSDs in the LV ........................... 117 5-3 Gene expression of angiotensin rece ptors, IGF1R, and GLUT1 in the L V..................... 118 5-4 Protein expression of PCNA (A; 36 kDa) in control, cortisol, cortisol + MRa, and cortisol + G Ra groups in LV............................................................................................ 119 5-5 Protein expression of AT1R (67 kDa; A) and AT2R (68 kDa; B) .................................. 120 6-1 Effects of elevated cort isol on fetal heart growth ............................................................ 132

PAGE 10

10 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MECHANISMS BY WHICH OVERVEXPOSURE TO CORTISOL CAUSES FETAL HEART ENLARGEMENT IN LATE GESTATION By Seth Andrew Reini August 2008 Chair: Maureen Keller-Wood Major: Medical Sciences--Physiology and Pharmacology Elevated cortisol levels du ring late gestation can lead to fetal heart enlargement. However, the mechanism by which cortisol increases fetal heart size has not been fully identified. These experiments we re designed to 1) investigate le ft ventricle (LV) expression of genes potentially responsible for increasing heart size, 2) dete rmine the ontogenetic expression of those genes in the LV and ri ght ventricle (RV), 3) elucidate whether the mineralocorticoid receptor (MR) or glucocorticoid receptor (GR) mediate the cortisol-induced cardiac enlargement, and determine if cardiac fibrosis accompanies the en largement, and 4) investigate the role of cell proliferation in causing the cardiac enlargem ent. I found that mRNA expression of 11 hydroxysteroid dehydrogenase 2 (11 HSD2), the insulin-like growth factor receptor type 1 (IGF1R), and the angiotensin type 1 receptor (A T1R) to angiotensin type 2 receptor (AT2R) mRNA ratio decreased in response to elevated cortisol in the LV. The decrease in IGF1R mRNA expression and the AT1R to AT2R ratio ma y have been an attempt by the heart to limit growth whereas the decrease in 11 HSD2 expression indicates cortisol is able to increase its action at MR and GR.

PAGE 11

11 Ontogeny analysis revealed that MR and GR mRNA expression are high at all points and 11 -hydroxysteroid dehydrogena se 1 mRNA expression is significantly higher than 11 HSD2 at all times, implying cortisol action at MR and GR is important for heart growth throughout late gestation. I also found that a ngiotensin converting enzyme 1 mR NA dramatically increases in both ventricles in late gestation implicating a ngiotensin II production is important in maturing the heart for life after birth. This study also showed that a reduction in mRNA of growth promoting IGF family members towards term w ithin both ventricles may contribute to the decrease in myocyte prolifer ation that occurs during th e last third of gestation. In vivo experiments demonstrated th at cardiac specific blockade of MR negated cortisolinduced heart enlargement and that GR blockade lessened it, suggesting corticosteroid receptors mediate the enlargement. Picrosirius red staini ng of the hearts reve aled that fetal heart enlargement in response to elevated cortisol is not accompanied by an increase in cardiac collagen deposition, but KI67 staining of the hearts revealed that enlargement may be due to an increase in myocyte proliferation.

PAGE 12

12 CHAPTER 1 INTRODUCTION Background and Significance Proper fetal developm ent is important for good health not only before birth, but also for after parturition and into adult life. One example of fetal deve lopment potentially affecting adult health is in the development of cardiovascular disease (CVD). For instance, we now know from studies conducted on adults w ho were conceived during the Dutch famine of 1944-1945 and born with low birth weights due to undernutrition th at they carry higher risks for cardiovascular disease and diabetes in th eir adult years (Roseboom et al. 2001). There is also evidence in both animals (aghajafari et al. 2002, Newnham et al. 2001) and humans (Walfisch et al 2001, Banks et al. 1999, French et al. 1999) that overexposure of the fetus to corticosteroid s can cause fetal growth restriction, potentially in creasing the risk for development of disease later in life. Currently, CVD is one of the biggest health concer ns facing the world, and it appears risk for this disease may be partially determined by fetal health. Role of Cortisol in Pregnancy Cortisol is a stress-response horm one, released from the adrenal cortex, which binds either mineralocorticoid receptors (MR) or glucocorticoi d receptors (GR). Release of cortisol by the adrenal gland is controlled by the pituitary gl and secretion of adre nocorticotropin (ACTH), which is controlled by the hypothalamus secretion of corticotropin releasing hormone (CRH). When cortisol levels increase beyond the set-point, the pituita ry gland and hypothalamus sense the high cortisol levels and release of ACTH and CRH are inhibited (Figure 1-1). Cortisol can be chronically elevated during ch ronic stress, but is al so normally increased during pregnancy. In fact, maternal plasma le vels of cortisol are elevated during human pregnancy (Carr et al. 1981), and doubled during late gestation in ewes (Bell et al. 1991, Keller-

PAGE 13

13 Wood 1998). Cortisol plays an important role in fetal developmen t including inducing maturation of the intestinal tract (Arsenault et al. 1985; Galand G et al. 1989) and inducing maturation of surfactant production in the lung (Ballard et al. 1996; Liggins et al. 1972). Highlighting the importance of glucocorticoids in fetal organ development is the fact that corticosteroids have been used to mature fetal lungs and prevent respiratory distress syndrome since 1972 (Liggins et al. 1972). Importance of Maintaining Proper Cortisol L evels in Pregnancy Whereas a single course of ante natal corticosteroids for fetal maturation in preterm birth instances appears to be safe (Crowley et al. 2002, NIH 2001), repeated treatments to women with recurring risk of preterm birt h has become the norm (Quinlivan et al. 1998). Recently, it has been shown in animals (aghajafari et al. 2002, Newnham et al. 2001), and humans (Walfisch et al. 2001, Banks et al. 1999, French et al. 1999), that repeated antenata l corticosteroid treatments can cause fetal growth restriction, a symptom of pre-programming for cardi ovascular disease or diabetes later in life (Law et al. 1996, Phillips et al. 1998). It has been suggested that this programming may be due to ex cess exposure of the fetus to glucocorticoids (Benediktsson et al. 1993, Clark et al. 1998, Roghair et al. 2005, Seckl et al. 1998, Seckl et al. 1997). Short-term glucocorticoid exposure to the fetus in the third trimester has been demonstrated to have adultlife programming effect s in rats (Levitt et al. 1996). Amazingly, it has been demonstrated in rats that excessive corticosteroid exposure induced pre-programming of the fetus to adult cardiovascular disease can cause the same effect s in the next generation, even when the next generation were not themselves exposed to ex cess corticosteroids dur ing fetal life (Drake et al. 2005). Also, postnatal hypertension has been observed in sheep following glucocorticoid treatment in early or mid-gestation (Figueroa et al. 2005, Wintour et al. 2003).

PAGE 14

14 Direct effects on the fetus have also been observed in response to improperly regulated glucocorticoid levels during pregnancy. It has be en shown previously that consequences of a reduction of cortisol levels in la te gestation ewes are a reduction in fetal growth, a reduction in maternal plasma volume and uteroplacental flow an altered placental morphology, and a greater likelihood for fetuses to become hypoxic (Jensen et al. 2002, Jensen et al. 2002, Jensen et al. 2005). On the other hand, modest el evations in ovine maternal co rtisol levels between ~120 and ~130 days gestation (term = ~145 days) have been shown to cause an in crease in heart growth while reducing overall fetal growth (Jensen et al. 2005). Corticosteroid Receptors and 11 Beta-Hydroxysteroid Dehydrogenases MR and GR are th e two main receptors cortis ol acts on within the body. The selectivity of MR and GR for the endogenous steroid ligands di ffers among species. For instance, in the rat MR binds its primary glucocorticoid, corticoste rone, and aldosterone with high affinity, but binds cortisol with slightly lower affinity (Sutano et al. 1987). Conversely, in the hamster corticosterone and cortisol bind MR with high affinity while aldosterone binds with lower affinity (Sutano et al. 1987). Interestingly, dogs secrete both cortisol and corticosterone (Westphal et al. 1971, Keller-Wood et al. 1983) with MR having greater affinity for corticosterone than cortisol and aldosterone, which have similar affinity for MR (Reul et al. 1990). On the other hand, human MR has similar affinities for cortisol and aldosterone and corticosterone (Arriza et al. 1987). In sheep, corticosterone is not secreted in appreciable amounts while cortisol and aldos terone are the major corticos teroids of action (Westphal et al. 1971). Additionally, both the human a nd the ovine GR have greater affinity for cortisol than for aldosterone. However, whereas MR has been shown to be the higher affinity receptor for cortisol (Kd = 0.52 0.09 nM) in ovine hippocampal cel ls, GR is the lower affinity (Kd = 1.48 0.11 nM) but more abundant and higher capacity receptor (Richards et al. 2003). This study also

PAGE 15

15 showed that aldosterone affinity for MR is similar to that of cortisol. However, unless local levels of 11 beta-hydroxysteroid dehydrogenase 2 (11 HSD2) are high (i.e. kidney), cortisol would be expected to occupy MR in vivo rather than aldosterone because of the higher relative concentration of cortisol in the plasma (<0.1 nM aldosterone as compared to 1-10 nM cortisol). Furthermore, in sheep it is estimated that appr oximately 20% of circulating is free and not bound to cortisol binding globulin. This means that in the sheep fetus, where average the average cortisol concentration is ~1.5 ng/ml, free cortisol concentrations would be ~0.8 nM. It also means that based on the study of Richards et al. (Richards et al. 2003), we would predict that these free concentrations would result in approximately 65% occupancy of MR and 35% occupancy of GR in the sheep fetus. Thus, at basa l levels we would expect cortisol to exert more effects via MR than via GR activation. Locally, the actions of cortisol are primar ily dependent on the expression levels of 11 HSD1 and 2. 11 HSD2 is responsible for converting co rtisol (active at MR and GR) into cortisone (inactive at MR and GR) (F igure 1-2). The counterpart of 11 HSD2 is 11 HSD1, which has a primary role that is opposite to 11 HSD2 by converting cortisone into active cortisol, although it has the ab ility do the same as 11 HSD2 also (Figure 2; Seckl et al. 2001). When large amounts of cortisol are c onverted into inac tive cortisone by 11 HSD2, aldosterone is then free to bind MR receptors. Organs containing high amounts of epithelial tissue such as the kidney tend to highly express 11 HSD2 in order to prevent gluc ocorticoid action at MR, which is also highly expressed, and allow aldosterone binding (Young et al. 2007). This maintenance of proper 11 HSD2 levels in the kidney is critical as inactivation of this enzyme results in hypertension, potassium wasting, and sodium retenti on as a result of glucocorticoid activation of MR (Stewart et al. 1988, Edwards et al. 1989). On the other hand, while MR expression in the

PAGE 16

16 hippocampus is similar to that found in the kidney, 11 HSD2 exhibits substantially less expression making the hippocampus primarily a s ite of glucocorticoid action at MR (Kim et al. 1995). Similarly, 11 HSD2 expression in the adult human hear t is less than 1% of that found in the kidney (Lombes et al.1995), suggesting that the myocardium is more operationally similar to the hippocampus than it is to the kidney. MR, GR, and 11 HSD1 and 2 expression levels within the fetal heart have not been fully elucidated, but would be helpful in determining the role of cortisol in fetal heart growth and maturation. Consequences of Elevated Cortisol on Fetal Heart Growth As previously m entioned, modest elevations in ovine maternal cortisol levels between ~120 and ~130 days gestation have been demonstr ated to cause an increase in heart growth (Jensen et al. 2005). Interestingly, in this study the enlargement was observed without a chronic rise in blood pressure, suggesting cortisol may be acting directly on receptors in the fetal heart to cause increased growt h. Additionally, Giraud et al. have shown that cortisol infusion directly into the ovine fetal coronary artery increases heart mass due to an in crease cell cycle activity, and this was without an increase fetal blood pressure also (Giraud et al. 2006). Furthermore, dexamethasone (GR agonist) administ ration into the maternal rat (48 g/d from E17) resulted in increased myocyte proliferation and relative heart size in the fetal and newborn rat (Torres et al. 1997). It has also been shown that acute infu sion (~129 through 132 days gestation) of nonphysiologically high amounts of cortisol (resultin g in ~100 times higher plasma concentrations than controls) directly into the ovine fetus al so leads to cardiac enlargement, but this was accompanied by a significant increase in mean arterial pressure (46.7 1.5 vs. 59.7 2.0) (Lumbers et al. 2005). Hearts from this study exhibite d increased left ventricular cell volume

PAGE 17

17 and higher expression of angiot ensinogen mRNA in both ventricles, suggesting the increase in blood pressure was a major force in driving the increase in cardiac enla rgement. Whether MR, GR, or both receptors within the heart are dire ctly mediating the cardiac enlargement has not been studied. However, whereas the mechan ism by which elevated co rtisol levels cause enlargement of the fetal heart is not well understood, these studies suggest that the mechanism of enlargement may differ based on deli very method, amount, and duration. Role of MR in the Heart Whereas little has been done to elucidate expression of MR in fetal hearts, MR has long been known to be expressed in adult hearts, as Lombes et al showed in rabbits (Lom bes et al. 1992). MR appears to have a major role in hearts that have experienced ischemic injury or are experiencing heart failure. In rats MR bl ockade has been shown to improve modulate the inflammatory response improve vasomotor dysf unction and vascular oxidative stress after myocardial infarction (Fraccarollo et al. 2008 and Sartorio et al. 2007). In dogs with chronic heart failure, it was shown that eplerenone (MR antagonist) administration reduced LV filling pressure and end-diastolic wall stress and s tiffness, and improved LV relaxation (Suzuki et al. 2002). Promising studies have also re cently been done in humans l ooking at the role of MR in heart failure. The Randomized Aldactone Eval uation Study (RALES) trial demonstrated that patients from various backgrounds and countries, who had severe he art failure, were dramatically helped upon daily administration (25mg/day) of spironolactone, an MR antagonist. Improvement in survival at 3 years was 30% wh ile improvement in hospitalization was at 35%, causing the trial to be halted just over the halfway point of the projected time-course for lack of a need to continue the trial (Bertram et al. 1999). Similar benefits have been seen with eplerenone, a more specific MR antagonist, in the Eplere none Post-Acute Myocardial Infarction Heart

PAGE 18

18 Failure Efficacy and Survival Study (EPHESUS) (Bertram et al. 2001). Most think that the improvement seen in the patients of the RALES trial was due to blocking the effect of aldosterone (Bertram et al. 1999). This is reasonable because, although not much is known about aldosterone signaling (Fiebeler et al. 2003), aldosterone is known to promote harmful events in the heart such as endothelial dysfunc tion, water and sodium retention, and hypertrophy (Fraccarollo et al. 2004). It has been suggested, however, that many heart failu re patients without elevated plasma aldosterone levels still receive the same benefits from MR blockade, indicating aldosterone may not be the only ligand (Young et al. 2007). Additionally, while it has long been known that MR and 11 HSD2 are co-expressed in hearts of many animals, including humans (Lombes et al. 1995), it has also been propos ed that reductions in 11 HSD2 expression in adult human hearts can lead to cardiac damage via co rtisol binding, and not necessarily aldosterone (glorioso et al. 2005, funder et al. 2005). In cultures of neonatal myocytes, it is presumed that MR mediates aldosterone actions in directly stimulating my ocyte surface area (Okoshi et al. 2004) and remodeling of the myocyte membrane (Kliche et al. 2006). Additional evidence of intr acardiac action at MR is cortisol increases expression of atrial na triuretic peptide in cultured neonatal myocytes, and both cortisol and aldosterone potentiate the effect of phenyl ephrine on hypertrophy in these cultures (Lister et al. 2006). Cardiac Collagen Deposition Collagen plays a crucial role in the heart in maintaining ventricular function by regulating its shape and size (Baicu et al. 2003). Within the heart, collagen serves as connective tissue found between myocytes, nerves, and blood vesse ls. The two main types of collagen found within the heart are types I and III with I being the predominant type. Type I collagen is often associated with tissue that is more stiff and ri gid than tissue containing predominantly type III

PAGE 19

19 collagen (Pearlman et al. 1982). Interestingly, multiple studies have correlated increases in LV collagen concentrations and wall stiffness (Janicki et al. 1993, Jugdutt et al. 2005). Elevations in stress from incr eased ventricular pressure or volume, or from injury, leads to remodeling of the ventricular wall until the wall stress in normalized resulting in near normal systolic and diastolic function. Once wall st ress exceeds the compensatory ability of the ventricle, heart failure will eventually occur (Brower et al. 2006). An increase in collagen concentration in hypertrophied hearts was first reported by Pearlman et al. upon examining postmortem hearts of patie nts with and without heart failure (Pearlman et al. 1982). Also, Pauschinger et al. reported an increase in the collagen I/III ratio in myocardium from patients suffering fr om dilated cardiomyopathy (Pauschinger et al. 1999). Whereas many studies have shown increases in co llagen concentrations in response to chronic elevations in pressure and myocyte hypertrophy, it has also b een shown that increases in collagen can occur without an increase in cardiac hype rtrophy (Narayan et al. 1989), and that cardiac hypertrophy caused by increa sed pressures is not always accompanied by an increase in fibrosis (Gelpi et al. 1991, Douglas et al. 1991). This is also observe d in the hearts of human athletes (MacFarlene et al. 1991, Nixon et al. 1991). There is increasing evidence that the MR r eceptor may play a role in increasing wall stiffness following injury as blockade of MR can prevent collagen concentration increases and ventricular remodeling following injury. It has b een shown in rats that MR antagonism provides additional benefit to angiotensin II type 1 recep tor (AT1R) blockade in preventing increases in fibrosis in myocardial infracted hearts (Fraccarollo et al. 2004), possibly explaining the benefits seen during the RALES trial in humans. Similarly, Takeda et al. demonstrated in rats that spironalactone (MR antagonist) administration greatly improved collagen accumulation and

PAGE 20

20 reduced apoptosis in infarcted hearts (Takeda et al. 2007). Furthermore, Nagata et al. observed that MR blockade attenuated LV hypertrophy and heart failure in rats with low-aldosterone hypertension, indicating glucocorticoid action at MR may have been mediating the harmful events within the heart (Nagata et al. 2006). Collagen concentrations within fetal hearts enlarged from excess glucocorticoid exposure has not been studied but it is not outside the realm of possibility that enlargement of the fetal heart is accompanied by an increase in fibrosis as is often seen in the adult. Hyperplasia vs. Hypertrophy in the Fetal Heart Cardiac growth occurs through proliferati on of myocytes throughout most of gestation (Smolich et al. 1989). The ability of myocytes to pr oliferate ceases so metime within the perinatal period through entering a final round of DNA replication followed by a lack of cell division (Oparil et al. 1984). This results in binucleation, or terminal differentiation, of the myocytes (Barbera et al. 2000). The progression of the hear t from proliferation to terminal differentiation is gradual, however, leaving two different populations of myocytes in latter gestation and early perinatal life. One group c ontains mononucleated myocytes which contain the ability to grow the heart through proliferation and increasi ng cell size while the other group contains binucleated myocytes which grow stri ctly through hypertophic means starting at the point of terminal differentiation. This id ea has been confirmed in sheep (Burrell et al. 2003, Jonker et al. 2007) and humans (Adler et al. 1975, Garcia et al. 2002, Huttenbach et al. 2001) where it was shown that the heart experiences m yocyte proliferation and terminal differentiation simultaneously throughout the last third of gestation. It is also known that myocyte volumes increase during the last third of gestation in fetal sheep (Burrell et al. 2003), indicating that an increase in cell size, along with an increase in ce ll number, contributes to cardiac growth at this time. Jonker et al. observed in fetal sheep that binucleati on became the more frequent out of the

PAGE 21

21 myocyte cycle at ~115 days gestation, at which ti me cardiac growth through increase in cell size became much more considerable than before that point (Jonker et al. 2007). It is not fully understood wh ether heart enlargement in res ponse to elevated cortisol is from an increase in cell size, ce ll number, or both. As mentioned previously, there is evidence to suggest cortisol increases myocyte cel l cycle activity in both rats (Torres et al. 1997) and sheep (Giraud et al. 2006). However, Rudolph et al. observed a decrease in the LV DNA concentration in response to cortisone infusion for 72-80 hours into the left coronary arte ry of fetal sheep (125133 days) (Rudolph et al. 1999). The decrease in DNA concen tration caused by cortisol was interpreted as being a result of a decrease in replication, suggesti ng cortisol may inhibit myocyte proliferation. Additionally, evidence exists that extreme increases in cortisol can lead to an increase in myocyte volum e in fetal sheep (Lumbers et al. 2005). While there is conflicting evidence as to the method of growth observed in the heart in response to elevated cortisol, the magnitude of cortisol increase along with whethe r the increase was accompanied by an increase in blood pressure may be important factors in de termining the type of growth that occurs. Role of the Renin-Angioten sin System in the Heart Angiotensin II is a peptide horm one important in maintaining cardiovascular homeostasis. Angiotensin II is synthesized fr om the cleaving of angiotensinoge n (Aogen) into angiotensin I and the further cleaving of angiotensin I into an giotensin II. Aogen is a 118 amino acid protein primarily made in and released fr om the liver, but is also made fo r local activity in other tissues. Renin, which is released from th e juxtaglomerular apparatus of th e kidney, then acts to cleave 4 amino acids from aogen resulting in the decapep tide angiotensin I. Angiotensin I is then converted to Angiotensin II, an octapeptide, by angiotensin convert ing enzyme I. Angiotensin II then acts on Angiotensin II type 1 and 2 receptors (AT1R and AT2R) throughout the body.

PAGE 22

22 Additionally, angiotensin converti ng enzyme 2 (ACE2) converts an giotensin I into angiotensin 1-9 and angiotensin II into a ngiotensin 1-7 (Figure 1-3). The renin-angiotensin system (R AS) has been implicated as play ing a major role in cardiac hypertrophy and fibrosis. It has been discovered in mice that local over-production of angiotensin II within the heart, without involvement of the system ic RAS, acted locally to cause interstitial fibrosis within the heart and also acce lerated the deterioration of hearts that were post myocardial infarction (Xu et al. 2007). Furthermore, there is well established evidence for benefits of administration of ACE inhibitors and AT1R an tagonists following myocardial infarction in humans and these classes of drugs are both recommended as treatments for patients who have suffered a myocar dial infarction (Mancia et al. 2007, Rosendorff et al. 2007). The RAS has been implicated in playing a ro le in cortisol-induced heart enlargement in fetal sheep. Acute administration of high doses of cortisol directly into the sheep fetus in late gestation affects components of the RAS system and may contribute in cortisol-induced heart enlargement. A study by Lumbers et al. showed that aogen mRNA expression increased in the treated group as compared to the control group (Lumbers et al. 2005). A problem in that study is that the dose of cortisol caused premature labor and elevated feta l blood pressure. It is, however, possible that the increased cortis ol levels are directly stimulat ing an increase in aogen. Interestingly, Sundgren et al. showed that AT2 stimulates hyp erplasia, but not hypertrophy, in fetal cardiomyocytes (Sundgren et al. 2003). Also, infusion of angiot ensin II into fetal sheep has also been shown to stimulate left ventricular growth (Segar et al. 2001). Furthermore, growthretarded fetuses of nutrient-rest ricted ewes show protected hear t growth but also a decrease in AT1R and AT2R protein expression in mid-gesta tion, indicating the angiot ensin II receptors play

PAGE 23

23 a distinct role under nutrient restricted conditions compared to normal cardiac development (Gilbert et al. 2005). Schneider and Lorell have suggest ed that Angiotensin II action is actually reflective of the AT1R to AT2R receptor expression ratio (Schneider et al. 2001). Cardiac hypertrophy caused by angiotensin II in adults is though t to be mediated by the AT1R (Zhu et al. 2003), however, the role of the AT2R in the heart has been thought to inhibit the growth in response to cardiac hypertrophy (Carey et al. 2005, Booz et al. 2004). Most evidence points to angiot ensin II acting at AT1R primarily to constrict blood vessels, whereas AT2R actions promote vasodilation in the coronary microcirculation, in small resistance arte rioles, and larger vessels such as the aorta (Carey et al. 2005). It has also been observed in hu man heart failure that AT1R expression decreases whereas AT2R expression in creases or stays the same (Suzuki et al. 2004). Disruption of AT2 receptors in mice does not result in a ny histologic changes within the heart (Hein et al. 1995) and myocytes do not express AT2 recep tors at any age in rats (Shanmugam et al. 1996). Most of these studies were performed in adult hearts. The roles of AT1R and AT2R within the heart are much more defined in adults than in fetal life, so the AT2R may or may not perform the same functions in the fetal heart. It is known that the AT2R tends to be more highly expressed in many fetal and neonatal tissues rela tive to adult levels. For instance, Cox and Rosenfeld demonstrated in sheep that fetal va scular smooth muscle (V SM) expressed only AT2R systemically and AT1R did not start to expres s systemically in the VSM until two weeks after birth (Cox et al. 1999). This suggests it is possible that the AT2R performs different roles in prenatal and neonatal life than it does in adult life. The primary job of ACE1 is to convert angiotensin I into angiotensin II, after angiotensinogen has been converted into angiot ensin I by renin. Cardiac hypertrophy is known to

PAGE 24

24 be augmented by over-expression of ACE1 in rat hearts (Tian et al. 2004). ACE1 overexpression in mouse hearts has also been shown to induce cardiac arrhythm ia, enlargement of the atria, and sudden death (Xiao et al. 2004). ACE2, on the other hand, converts angiotensin I into angiotensin 1-9 and angiotensin II into angiotensin 1-7. ACE2 therefore limits the amount of angiotensin II that is produced and potentially plays a role in protecting the hear t from negative consequences observed from increased aniotensin II action ( Danilczyk et al. 2006). Role of the Insulin-Like Gr ow th Factors in the Heart The insulin growth factors (IG Fs) 1 and 2 can act in both an endocrine and paracrine manner (LeRoith et al. 1995) and have been shown to be pot entially important in fetal heart development and maturation (Cecilia et al. 1996, Sundgren et al. 2003). Whereas most of the pro-growth actions of IGF1 and IGF2 occur thr ough binding of the IGF-1R IGF2 has the ability to also bind IGF-2R which is thought to act to eliminate excess IGF2 and be anti-mitogenic (Randhawa et al. 2005). Ontogeny studies suggest IGF-2 may be more important in early fetal heart development whereas IGF-1 appears to be more important to the fetal heart in late gestation and into adulthood (Cheung et al. 1996). Multiple studies have shown the importance of IGFs in regulating growth in the fetal hear t. IGF-1R and IGF-2R protein has been shown to be increased in enlarged hearts of fetuses of undernourishe d ewes, implying IGFs may play a role in the process of cardiac growth duri ng restricted circumstances (Dong et al. 2005). However, a decrease in IGF2 mRNA abundance in preter m (111-116 days gestati on) ovine hearts was observed in response to umbilical cord occlusio n, but no change was observed in near-term (132138 days gestation) fetuses (Green et al. 2000). Also, Sundgren et al. have shown in cultured fetal cardiomyocytes that IGF-1 s timulates proliferation of the myocyt es and that this is mediated by ERK and PI3K (Sundgren et al. 2003). Moreover, over-expression of IGF1 in transgenic

PAGE 25

25 mice leads to a 50% increase heart weight and a 20-50% increase in total number of myocytes, with no increase in myocyte hypertophy (Reiss et al. 1996). IGF1 has been shown to have cardiac specific benefits in injured hearts. For instance, IGF1 has been demonstrated to decrease myocyt e apoptosis in rats suffering from ischemiareperfusion injury (Buerke et al. 1995), and in mice following myocardial infarction (Li et al. 1999). In dogs with induced heart failure, IGF1 reduced myocyte apoptosis and increased contractile function of the heart (Lee et al. 1999). It is also known that in IGF1 levels are low in patients with heart failure and that there is a correlation between the se verity of ventricular systolic dysfunction and IGF1 levels (Niebauer et al. 2001, Anker et al. 2001). It was also observed in the Framingham Heart Study that ther e is an inverse relati onship between plasma IGF1 levels risk for congestive heart failure in elderly people who have not previously experienced a myocardial infarction (Vasan et al. 2003), whereas a positiv e correlation between blood pressure and circulating IGF1 levels has also been observed (Andronico et al. 1993, Valensise et al. 1996). It has also been shown that both IGF1 mRNA and protein increase in the heart with the developmen t of hypertension (Donohue et al. 1994, Guron et al. 1996). Furthermore, IGF1 mRNA expression increases in myocardium of hearts exposed to pressure overload from aortic banding or renal hypertension (Hanson et al. 1993, Wahlander et al. 1992). Moreover, chronic infusion of IGF1 into rats has been shown to lead to cardiac hypertrophy and enhance hypertrophy of viable myo cardium after infarction (Duerr et al. 1995). The observed increase in cardiac hypertrophy in this study, however, led to imp roved systolic and diastolic function without an increase in fibrosis. In human s, there is evidence from those with the disease acromegaly, in which growth hormone (the primary stimulator of IGF1 e xpression) secretion is increased, that natural over-produ ction of IGF1 leads to an in crease in LV wall thickness (Fazio

PAGE 26

26 et al. 1993, Fazio et al. 1994), whereas humans with growth hor mone deficiency exhibit reduced cardiac mass (Cittadini et al. 1994, Cuocolo et al. 1996, Amato et al. 1993) that is restored upon growth hormone replacement therapy (Amato et al. 1993, Fazio et al. 1997). These findings suggest a direct role for IGF1 in maintenance of adu lt cardiac morphology. Whereas IGF1 is thought to be more important in extrauterine life, a ~40% reduction in birth weight has been observed in mice with an inactivated IGF2 gene suggesting IGF2 is important in fetal growth (Dechiara et al. 1990). The mice from that study were fertile and appeared normal aside from the reduced growth, but it has also been observed that IGF2 null mice exhibit delayed lung development at the end of gestation most likely due to decreasing the plasma corticosterone levels, indicating IGF2 plays an important role fetal lung development (silva et al. 2006) Chronic hypoxia has been shown to increase IGF2 mRNA levels of term human placentas, implicating the im portance of IGF2 in maintenan ce of nutrient exchange of the mother and fetus during pregnancy (Trollman et al. 2007). In addition, evidence suggests IGF2 expression is increased in the ovi ne cotyledon in response to intrau terine growth restriction at 55 days gestation (De Vrijer et al. 2006). Cortisol is thought to be a potentially key regulator of IGF1 production within the developing fetus. In support of this, IGF1 in ovi ne fetal skeletal muscle appears to be regulated by plasma cortisol concentrations as IGF1 mRNA expression decr eases at the same time as the prepartum rise in ovine plasma cortisol levels, an d this decrease in IGF1 expression is abolished when fetuses were adrenalectomized while pr emature increase in circulating cortisol concentrations in the fetus leads to a premature decrease in IGF1 mRNA expression in fetal skeletal muscle (Li et al. 2002). Furthermore, the same thing was found to be true in the developing ovine liver (Li et al. 1996).

PAGE 27

27 IGF binding proteins 1-6 f unction to prolong the half life of IGFs in plasma and act to regulate the biological actions of IGFs vivo IGFBPs have the ability to modulate the actions of IGF through regulating transport, tur nover, and tissue distribution (Jones et al. 1995). IGFBPs 4 and 6 seem to primarily inhibit IGF actions wh ereas IGFBPs 1, 2, 3, and 5 have been shown to both inhibit and potenti ate IGF actions (Yin et al. 2004). Previous studies have shown IGFBP2 and IGFBP3 play roles in fetal development. It has been reported that over-expression of IGFBP2 (Hoeflich et al. 1999) and IGFBP3 (Modric et al. 2001) in mice leads to a ~10% decrease body weight. Maternal nutrient restriction leads to an increase in plasma IGFBP2 levels within the fetus between 90 and 135 days gestation (Ogersby et al. 2004), but did not alter fetal heart weights. In contrast, Green and co workers found that umbilical cord occlusion for four days (107-108 d fetuses) led to no change in plasma IGFBP2 or IGFBP3, but did lead to an increase in RV mRNA e xpression of IGFBP2 (Green et al. 2000); there was no change in either body weight or heart weight with th is 4 days of manipulation. Summary It has been shown in multiple studies that elevated fetal exposure to cortisol leads to cardiac enlargement; however, the exact methodol ogy involved has yet to be elucidated. The objectives of this dissertation were to determ ine if the heart enlargement is mediated by corticosteroid receptors within the heart, determine whether the enlargement is due to increased myocyte proliferation or accompanied by fibrosis, and investigate which genes may be important in aiding/causing the enlargement. Maintaining proper cortisol levels during pregnancy appears to be important to proper heart development of the fetus and may have long lasting implications pertaining to maintenance of heart health and regulating ri sk for cardiovascular disease throughout life. This research addressed the m echanisms by which elevated cortisol increases fetal heart size. In order to answer the speci fic aims outlined in this dissertation, I used in vivo

PAGE 28

28 chronic catheterization of fetal sheep, i mmunohistochemistry, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), qua ntitative real-time polymerase chain reaction, and western blot analysis. Specific Aims Specific Aim 1: To look for changes in expression of genes potentially important in cortisol-indu ced enlargement of the ovine fetal heart. o The mRNA expression of MR, GR, 11 HSD1, and11 HSD2 along with the IGFs and IGF receptors and major components of the RAS was studied in LVs from fetal hearts enlarged from elevated maternal cortisol and control hearts. o Immunohistochemical analysis was perfor med to look for location of MR, GR, 11 HSD1, and11 HSD2 within the heart. Specific Aim 2: To establish the ontogeny of genes in Aim 1 within the ovine fetal LV and RV. o The mRNA expression of MR, GR, 11 HSD1, and11 HSD2 along with the IGFs and IGF receptors and major components of the RAS was studied at various gestational ages within the LV and RV. Specific Aim 3: To determine if the increase in fetal heart weight and wall thickness in response to increased maternal cortisol is medi ated by cardiac corticos teroid receptors, MR and/or GR, and to determine if cardiac fibrosis accompanies the cardiac enlargement in response to cortisol. o Fetal heart mass and wall thicknesses from 4 groups were examined including one control group with no mani pulation. The three other groups were exposed to elevated maternal cortisol but one gr oup received cardiac blockade of MR, another one received cardiac blockade of GR, and the other group did not receive either. o Picrosirius red staining was utilized to quantify the am ount of collagen deposition that had occurred in each heart. Specific Aim 4: To determine if the observed cardiac enlargement from elevated cortisol is due to an increase in cell proliferation. o Immunohistochemical analysis was performed to see if there was any difference in the number of myocytes expres sing Ki67 between the four groups. o PCNA protein was quantified to check for differences in expression between the groups.

PAGE 29

29 Figure 1-1. Components of the HP A axis and how it interacts. CRH corticotrophin releasing hormone, ACTH adrenocorticotropin stimulating hormone. Hypothalamus CRH Anterior Pituitary ACTH Adrenal Cortex Cortisol (-) inhibits (-) inhibits Stress

PAGE 30

30 11HSD1 Cortisone Cortisol Figure 1-2. Different actions of 11 HSD1 and 2 and how they interact with cortisol. Cortisol Cortisone11HSD2(MR protective)

PAGE 31

31 Figure 1-3. Components of the reni n-angiotensin system. Angiotensinogen (Liver) Renin (Kidney) Angiotensin I ACE1 ACE2 Angiotensin II Angiotensin 1-7 ACE2 Angiotensin 1-9

PAGE 32

32 CHAPTER 2 1INCREASED MATERNAL CORTISOL IN LATE GESTATION EWES DECREASES FETAL CARDIAC EXPRESSION OF 11 -HSD2 MRNA AND THE RATIO OF AT1 TO AT2 RECEPTOR MRNA Introduction Regulation of maternal cortisol levels duri ng pregnancy is important for maintenance of fetal cardiovascular homeostasis and normal fetal growth. Previous studies in this laboratory have demonstrated that reduction of maternal cor tisol levels in late gestation ewes results in reduced maternal plasma volume and uteroplacental blood flow, altered placental morphology and reduced fetal growth (Jensen et al. 2002, Jensen et al. 2005). The fetal consequences are similar to those observed with maternal hypovolemia (Daniel et al. 1989), suggesting that one of the effects of reduced maternal cortisol is mediated by reduced placental perfusion. Elevations in maternal cortisol levels in late gestation also have an adverse effect on the fetus. Studies have indicated that maternal, but not fetal, glucocorti coid infusions reduce the rate of fetal growth (Newnham et al. 1999, Sloboda et al. 2000). Even modest chronic increases in maternal cortisol levels increase fetal hear t growth while causing a reduction in overall fetal growth rates (Jensen et al. 2002). This finding is particularly interesting because it has been suggested that exposure of the fetus to glucocor ticoids may have an adverse effect on postnatal cardiovascular health by prepr ogramming for hypertension or diab etes later in life (Clark et al. 1998, Roghair et al. 2005, Seckl et al. 1998). In rats, short-term pr enatal treatment resulted in programming effects, including increased postnatal plasma co rticosterone levels and blood pressure (Levitt et al. 1996). In sheep, postnatal hypertensi on results after glucocorticoid 1Reproduced with permission from Reini SA, Wood CE, Jensen E, & Keller-Wood M 2006. Increased maternal cortisol In late gestation ewes decreases fetal car diac expression of 11{beta}HSD2 mRNA and the ratio of AT1 to AT2 r eceptor mRNA. American Journal of Physiology. Regulatory, Integrative a nd Comparative Physiology 291 1708-1716.

PAGE 33

33 treatment only when it is administered in ear ly or mid gestation, a nd does not occur after synthetic glucocorticoid treatmen t in late gestation (Figueroa et al. 2005, Wintour et al. 2003). Acute glucocorticoid treatment in the late gesta tion ewe also does not appe ar to increase fetal heart weight (Newnham et al. 1999). The mechanism(s) by whic h chronically elevated maternal cortisol levels cause fetal hear t enlargement is not known, but may require chronic corticosteroid exposure rather than acute glucoc orticoid treatment, or may require the presence of agonists of the mineralocorticoid receptor (MR) rather tha n, or as well as, agonists of the glucocorticoid receptor (GR). The purpose of this study was to investigate gene expression in the fetal hearts in which ventricular enlargement was measured in response to chronically elevated maternal cortisol concentrations in a previ ously published study (Jensen et al. 2005). I hypothesized that cortisol acts on mineralocorticoid receptors (MR) or glucoc orticoid receptors (GR) in the fetal heart to induce genes involved in cardiac growth. In this study I used quantitative real-time PCR to test for changes in genes mediating cortisol action, MR and GR, as well as the 11 hydroxysteroid dehydrogenases (11 -HSD1 and 11 -HSD2), and genes suspected to be involved in growth: insulin-like growth factors (IGFs and their receptors), nitric oxid e synthase (NOS-3), vascular endothelial growth factor (VEGF), myotrophi n, angiotensin receptors, angiotensinogen, and angiotensin converting enzymes. Materials and Methods Experimental Design RNA was extracted from the left ventricles taken from three groups of sheep fetuses from a previous study (Jensen et al. 2005). In that study one group of ewes was treated with cortisol (1 mg/kg/day) between 115-130 days of gestation (high cortisol group), a second group of ewes was adrenalectomized and treated with cortisol (0.5 mg/kg/day) between 115-130 days of

PAGE 34

34 gestation (low cortisol group), a nd a third group of normal ewes had no alterations of cortisol between 115-130 days of gestation (control group). The hi gh cortisol treatment regime produces circulating cortisol levels that are ch ronically elevated, but are within the range of maternal cortisol levels measured with mild ma ternal stress. The treatment regime in the low cortisol group produces maternal cortisol concen trations similar to those in nonpregnant ewes. Plasma hormone concentrations, organ weights and fetal growth rate s for these studies have been previously published (Jensen et al. 2005). Fetal arterial and venous catheters were placed at the time of surgery; fetal and matern al plasma ACTH and cortisol concentrations were measured in samples collected on approximately days 120, 125 and 130 of gestation and blood pressure was measured on days 120 and 130 of gestation. Altho ugh there was no overall effect of maternal cortisol manipulation on maternal cortisol concentrations (maternal plasma cortisol concentrations, as previously reported (23) at 130d were 7.0 1.0 ng/ml in controls, 10 1 ng/ml in the high cortisol and 7.1 0.3 in the low cortisol groups), maternal ACTH concentrations were increased ten-fold in th e low cortisol group and were decreased by approximately 75% in the high cortisol group. Th e fetal cortisol concen trations at 130 days gestation were 5.7 0.9 ng/ml in the control group, 7.4 1.0 ng/ml in the high cortisol group, and 11 3 ng/ml in the low cortisol group. Fetal AC TH levels were increased in the low cortisol group and decreased in the high cortisol group. Thes e changes in ACTH indicate that the average cortisol levels over the day must be significantly altered in both ewes and fetuses. Further it is likely that the increase in plasma cortisol by 130d in fetuses in the low cortisol group result from the premature increase in plasma ACTH in these fetuses. We reported significant increases in fetal heart weight and left ventricular wall diam eter in the fetuses from the high cortisol group compared to those in the contro l group; heart weight was increas ed by 25% and left ventricular

PAGE 35

35 wall diameter was increased by 38%. There was no significant effect of increased maternal cortisol manipulation on fetal body weight, crown to rump or whole sternal girth measurements at necropsy, although there was a redu ced rate of fetal sternal girth growth in the last 7 days of study (Jensen et al. 2005). Real-Time PCR Total RNA was extracted (Tri zol; Invitrogen, Carlsbad, CA) from 0.2 0.3g of left ventricular free wall of fetal sh eep in the control (n=6), low co rtisol (n=4), and high cortisol group (n=5). All sheep were euth anized and tissues were collected at ~130 (129-132) days of gestation. Total RNA, as well as the RNA to DNA ratio, was measured spectrophotometrically to identify quantity and quality of RNA. RNA was checked for genomic DNA contamination using real-time PCR with the RNA as a template in place of cDNA and using probes and primers for GR (which produces a product within exon 2). RNA was then reverse transcribed into cDNA using a High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA). Gene expression was measured using quantitativ e real-time PCR. The genes analyzed in this study were MR, GR, 11 -HSD1 and 2, IGF-I and II, IGF-1R and 2R, NOS-3, VEGF, myotrophin, angiotensinogen, AT R1 and ATR2, and ACE1 and ACE2. For measurement of mRNA for MR and GR (Keller-Wood et al. 2005), IGF-I (Meinel et al. 2003), NOS-3 (Wood et al. 2005), angiotensinogen (Burrell et al. 2003), 11 -HSD2, AT1R and AT2R (Dodic et al. 2002, Jensen et al. 2005), we used previously published seque nces for ovine probes and primers. The primers for MR and GR were designed in the 3 untranslated region of the MR gene and in exon 2 of the GR gene and therefore detect and isoforms of MR and GR respectively (Kwak et al. 2003, Lu et al. 2006). Probes and primers used for IG F-1R, IGF-II, IGF-2R, ACE 1 and 2, and 11 -HSD1 were designed using Primer Express 2.0 (Applied Biosystems, Table 2-1) based on ovine sequences in the NCBI database or previously published by others. For the IGF-1R

PAGE 36

36 probe/primer design, the ovis aries IGF-1R sequence (accession number AY162434) was used; the amplified sequence corresponds to base pairs 319-380. The IGF-II ovine sequence (accession number M89788) was used for IGF-II probe/primer design (base pairs 385-463) while the IGF-2R ovine sequence (accession number AF327649) was used for IGF-2R probe/primer design (base pairs 163-223 of published sequence). For ACE1, primers were designed using the ovine sequence (accession number AJ920032) betw een the base pairs of 662-726, while ACE2 primers were designed using an ACE2 bovine sequence (accession number BT021667) between the base pairs of 1245-1327. For both ACE1 an d ACE2 SYBR Green (Bio-Rad, Hercules, California) was used instead of pr obes. The primers and probe for 11 -HSD1 were designed using the ovine sequence published by Yang et al. (base pairs 664-737 of published sequence) (Yang et al. 1992). The VEGF probe and primers were designed from the sequence published by Cheung and Brace (Cheung et al. 1998); the primers will detect the portion of the VEGF gene that encodes for the splice variants VEGF 120, VEGF 164, VEGF 188, and VEGF 205. Because there were no published sequences for ovine myotrophin, we used PCR to amplify a portion of ovine myotrophin from adult heart RNA using primers designed from the published bovine sequence (accession number NM 203362; forward primer 221-240, reverse 555-574). PCR reactions were then carried out in an UNO II thermocycler (Biometra, Goettingen, Germany) using a PCR amplification kit (ABI, Foster City, CA). The PCR product was purified using a DNA purification kit (Promega, Madison, WI) and cloned into a TOPO vector (Invitrogen, Carlsbad, CA). The size of the product was confirmed on an ethidium bromide gel, and sequenced at The Universi ty of Florida MCBI DNA Sequencing Core Laboratory. The resulting ovine myotrophin partial gene sequence is shown in Table 2-2. The sequence obtained was 94% homologous to th e corresponding bovine se quence (accession NM

PAGE 37

37 203362.2; bp 321-674) and 90% homologous to the corresponding human sequence (accession NM 145808.1; bp 286-639). Probe and primers were then designed using Primer Express 2.0 (Applied Biosystems, Table 1). Real time PCR reactions were performed using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems). 25 l reaction volume was used and contained 20 or 100 ng of cDNA for all genes except 18S, for which 1 ng wa s used. All probe and primer sets were checked for efficiency and for linearity of the relation betwee n increasing concentrations of cDNA and Ct. Samples from all groups were anal yzed in triplicate in the same 96 well plate. 18S expression was unchanged between the groups and all genes were normalized to 18S gene expression by calculating Ct. Ct is calculated as the differen ce between mean Ct of the gene of interest and mean Ct of 18S for the same cD NA sample; Ct is the cycle number at which the threshold amplitude is achieved. Radioimmunoassay Fetal plasm a angiotensin II levels were measured by radioimmunoassay after extraction of the peptide from plasma using previ ously described methods (Pecins-Thompson et al. 1997). The lower limit of this assay is 1.9 pg/mL, as pr eviously described. Feta l angiotensin II levels were measured in plasma collected at 120, 125, and 130 days of gestation from fetuses in the high maternal cortisol group (n=4), fetuses in the control maternal cortisol group (n=7), and fetuses in the low maternal cortisol group (n=5). Immunohistochemistry and Collagen Staining To determine localiza tion of MR, GR, and 11 -HSD1 and 11 -HSD2 in fetal heart, untreated fetal sheep hearts of 126-128 days gest ation were sacrificed, an d the left ventricles were removed and fixed with 4% buffered parafo rmaldehyde. The tissues were dehydrated with increasing concentrations of reagent alcohol fo llowed by xylene, and embedded in paraffin wax.

PAGE 38

38 Five m sections were cut by a Zeiss rotary micr otome and placed onto poly-l-lysine coated slides. Deparaffinization and rehydration were performed using standard methods; following rehydration endogenous peroxide was quenched using incubation in hydrogen peroxide (0.3%; Fisher Scientific, Fair Lawn, NJ). Antigen retrieval was then perf ormed by immersion into sodium citrate buffer at 95 degrees for 30 minutes. The anti-MR monoclonal antibody G1-18 (provided courtesy of Dr. Elise GomezSanchez, University of Mississippi Medical Center) and po lyclonal antibodies GR M-20, 11 HSD1 H-100, and 11 -HSD2 H-145 (Santa Cruz Biotechnol ogies, Inc., Santa Cruz, CA) were used to localize MR, GR, 11 -HSD1 (Schmidt et al. 2005), and 11 -HSD2 (Kadereit et al. 2005) in the sections. Immunohistochemistry for MR was performed following the methods described by Gomez-Sanchez (Gomez-Sanchez et al. 2006) except for the use of biotinylated goat antimouse secondary antibody (Zymed, San Francisc o, CA). For immunohistochemical localization of GR, 11 -HSD1 and 11 -HSD2, tissue sections were blocked for one hour with 0.05M Tris pH 7.6, 5% milk, 5% goat serum, and 0.2% SDS, followed by incubation with primary antibody in blocking solution for one hour, and incubation with biotinylated secondary antibody (goat anti-rabbit; Zymed) for one hour. As a tertiary agent, streptavidin-peroxidase (Zymed, San Francisco, CA) was used. Metal enhanced diam inobenzidine (DAB; Pierce) was used as the chromogen. Control sections were similarly tr eated, but were incubated in blocking solution without primary antibody. Some sections were stained with picrosiriu s red (Electron Microscopy Sciences, Hatfield, PA) which stains for collagen. Sections were hydrated as mentioned be fore and treated with 0.2% phosphomolybdic acid. The sections were immersed in sirius red (0.1% in saturated picric acid). Finally, the sections were washed with 0.01 N hydrochloric acid, rinsed in 70% alcohol,

PAGE 39

39 dehydrated, and mounted in permount. All images were visualized using a Zeiss Axioplan 2 microscope and a SPOT Advanced digital imaging system (McKnight Brain Institute, University of Florida). Data Analysis Changes in gene expression am ong groups were analyzed by one way analysis of variance (ANOVA) using the Ct values. For graphical purposes, fold changes of the genes were calculated using the expression 2^Ct in which Ct is the difference between Ct for the sample and mean Ct for the same gene in the control group (Livak et al. 2001). Comparisons of MR, GR 11 HSD1, and 11 HSD2 gene expression were made by comparison of the Ct values for each gene relative to the 18S value; statistical analysis used paired t-test for comparison of two genes within the same tissue sample and t-test for comparison of the same gene in heart vs kidney. Values for plasma angiotensin II concen tration were compared by two-way ANOVA to determine significance across the cortisol treatment groups and gestational ages. Linear regression analyses were performed to assess the relation between left ventricular wall thickness and fetal plasma angiotensin II co ncentrations levels, fetal plasma cortisol concentrations levels, AT1R mRNA, AT2R mRNA, IGF mRNA, IGFR mRNA, 11 -HSD1 mRNA 11 -HSD2 mRNA, angiotensinogen mRNA, MR mRNA and blood pressure. Backward stepwise multiple linear regression was also performed to identify significant relationships between a series of possible i ndependent variables and left ventricle wall thicknesses.

PAGE 40

40 Results Real-Time PCR Analysis Expression of MR and GR Real-time PCR analysis demonstrated expres sion of both MR and GR in the ovine fetal heart at 130 days. There was no si gnificant difference in MR or GR gene expression between the high, low, and control maternal co rtisol groups (Figure 2-1). GR expression relative to 18S was significantly greater than that of MR relative to 18S in the control fetal hearts (by 13 fold). However MR expression relative to 18S was significantly greater in fetal heart relative to that in fetal kidneys from the same fetuses (mean 2.6 fold difference). Expression of 11 -HSD1 and 2 Real-time PCR analysis demons trated expression of both 11 -HSD1 and 11 -HSD2 in fetal hearts. 11 -HSD2 expression relative to 18S in control hearts was significantly lower (by 5.5 fold) than 11 -HSD1 expression relative to 18S in the same hearts. 11 -HSD2 expression relative to 18S in heart was significantly lower than 11 -HSD2 in kidney (by 750 fold). No significant change in 11 -HSD1 expression was demonstrated in response to high or low maternal cortisol levels. 11 -HSD2 expression, however, was significantly lower in the high cortisol as compared to the control a nd low cortisol groups (Figure 2-1). Expression of myotrophin, NOS-3, and VEGF Expression of m yotrophin, NOS-3, and VEGF mRNA in left ventricle were all unchanged in response to high or low mate rnal cortisol levels (Figure 2-2). Expression of IGF-I and II, IGF-1R and 2R No significant change in expression of IGF-I, IGF-II, or IGF2R was found among the cortisol groups. IGF-1R expres sion significantly decreased in res ponse to high maternal cortisol levels as compared to control and low ma ternal cortisol levels (Figure 2-3).

PAGE 41

41 Expression of angiotensinoge n, AT1R, AT2R, ACE1, and ACE2 I found that there were no significant di fferences in angiotensinogen, AT1R, AT2R, ACE1, or ACE2 gene expression in the fetal left ventricle among the ma ternal cortisol groups (Figure 2-4). However, I found that AT1R mRNA tended to decrease, whereas AT2R mRNA tended to increase, in fetuses of ewes with increas ed cortisol as compared to controls. There was a statistically significant increase in the rati o of AT2 to AT1 receptor expression in the high cortisol group (Figure 2-4, C). Immunohistochemistry and Collagen Staining MR, GR, and 11 -HSD1 staining was found in both cardiac blood vessels and myocytes in normal fetal hearts, while 11 -HSD2 showed very limited stai ning in myocytes and slightly more in blood vessels (Figure 2-5). GR positiv e cells were found in all layers of the blood vessel; MR, 11 -HSD1, and 11 -HSD2 appeared to be localized in both endothelial cells and the underlying smooth muscle cells. MR and 11 -HSD1 staining was more marked in the endothelial cells than in the underlying layers, and 11 -HSD2 staining was more marked in the vascular smooth muscle layer than in endothelial cells. MR, 11 -HSD1 and 11 -HSD2 positive cells did not appear to co-loc alize with picrosirius red stai ning regions (collagen containing regions surrounding the blood vessels), whereas th ere were some GR-positive cells apposing the collagen-rich regions, suggesting GR expression in fibroblasts. Plasma Angiotensin II Fetal plasm a concentrations of angiotensin II tended to increase from day 120 to day 130 in response to the high cortisol as compared to the angiotensin II leve ls in the control group, which appear to remain relatively constant betw een days 120-130 (Table 2-3). The rise in fetal plasma angiotensin II levels in the high maternal cortisol group, however, was not statistically significant.

PAGE 42

42 Regression Analysis Linear regression analysis revealed a significant nega tive relationship between 11 HSD2 mRNA in the heart and left ventricu lar wall thickness (r= 0.624, P<0.02; Figure 2-6). There was no correlation between lef t ventricu lar wall thickness and eith er fetal blood pressure (r=0.015, p=0.96) or fetal plasma cortisol on da y 130 (r=0.214, p=0.48), however fetal cortisol was elevated in the low cortisol as well as the high cortisol group by 130d. There were also no correlations between left vent ricular wall thickness and either MR (r=0.113, p=0.71) or GR expression (r=.065, p=0.83) in the hearts. Nega tive relationships of left ventricular wall thickness with 11 -HSD1, AT1R and IGF-1R which did not reach statistical significance were also noted (11 -HSD1: r =-0.544, p=0.054; AT1R: r=0.458, p=0.058; IGF-1R: r=-.0541, p= 0.056). A weak positive relation be tween left ventricular wall thickness and plasma angiotensin II concentration on day 130 (r= 0.468, p=0.063) was also found. Backward stepwise multiple regression was us ed to assess the correlation between left ventricle wall thickness (dependent variable) to a series of independe nt variables: left ventricular AT1R and AT2R mR NA expression, 11 -HSD1 and 11 -HSD2 mRNA expression, angiotensinogen mRNA expres sion, MR mRNA expression, IGF-I and II mRNA expression, and IGF-1R and IGF-2R mRNA expression, as well as fe tal plasma angiotensin II levels at 130 days, and blood pressure on day 130. Backward stepwi se multiple regression using left ventricle thickness as the dependent variable identifie d a significant relations hip (overall r = 0.897, p<0.01) between left ventricular wall thickness and AT2 to AT1 mRNA ratio, 11 -HSD1 mRNA, and 11 -HSD2 mRNA. Discussion In this study I found that both MR and GR are expressed in th e fetal heart, as in adult myocytes in m any species, including humans (Lombes et al. 1999). I found that MR and

PAGE 43

43 11 HSD1 gene expression are relatively abundant in ovine fetal heart. The results suggest that small increases in cortisol could influence fetal h eart size via action at the MR or GR receptors in the fetal heart. These results further suggest th at changes in the ratio of angiotensin receptors (AT1 and AT2) may be a downstream mech anism for the effect of cortisol. Role of Corticosteroids Acting at MR or GR Action of cortisol in tissues depends on the expression of MR and/or GR and activity of 11 HSD1 and 11 HSD2. Whereas 11 -HSD1 primarily converts cortis one into cortisol in most tissues (Seckl et al. 2001), 11 -HSD2 converts cortisol into cort isone, which is inactive at MR and GR (Mihailidou et al. 2005). Further, action of 11 -HSD2 alters intracellular redox state, which may reduce the ability of co rtisol to activate MR after binding. Thus in epithelial tissues such as kidney, high levels of 11 -HSD2 co-expressed with MR results in a MR protective effect which reduces basal MR act ivation by cortisol or corticosterone, but permits aldosterone action at the MR receptors (Mihailidou et al. 2005). However in normal hearts, MR are expressed during fetal life (by E13.5 in murine heart), but there is relativel y little expression of 11 -HSD2 in prenatal mouse hearts nor is11 -HSD2 appreciably expressed in cardiomyocytes postnatally (Brown et al. 1996, Thompson et al. 2004) It has also been suggested that low 11 -HSD2 activity in adult hearts allows cortisol as well as aldosterone to have detrim ental effects on the heart (Funder et al. 2005, Glorioso et al. 2005). Evidence for both MR-mediated and GRmed iated effects on the h eart have been found. In adult animals, aldosterone action at MR is thought to cause cardiac hypertrophy and fibrosis after ischemia (Fiebeler et al. 2003, Fraccarollo et al. 2004). In humans with severe heart failure, there is a reduction in severity of cardi ac hypertrophy after blockade of the MR receptor (Pitt et al. 1999). On the other hand activation of eith er MR or GR alone have little effect on hypertrophy in cultures of neonata l myocytes, but GR have been s hown to potentiate the effect of

PAGE 44

44 phenylephrine on hypertrophy in neonatal myocytes (Lister et al. 2006). Interestingly, in 11 HSD2 knockout mice postnatal mortality is high but surviving mice have enlarged hearts without evidence of cardiac fibrosis (Kotelevtsev et al. 1999), suggesting th at fibrosis only occurs in adult hearts, or when hearts have been subjected to ischemic damage. Overexpression of 11 -HSD2 in murine cardiomyocytes, however, results in cardiac hy pertrophy, interstitial fibrosis, and heart failure (Qin et al. 2003). This effect is marked ly reduced by treatment with the MR blocker eplerenone; the effect is thought to be mediated by an increased access of aldosterone to MR in the myoc ytes with high levels of 11 HSD2, and suggests that MR binding with aldosterone produces a greate r hypertrophic effect than does corticosterone binding at MR and GR. Recently it was shown that cortisol stimulates ce ll cycle activity in cardiomyocytes of near term fetal sheep infused with co rtisol into the circum flex artery. These results suggest that cortisol can act directly on the fetal heart to stimulate hyperplas tic, but not hypertrophic, growth (Giraud et al. 2006). This suggests that the effects seen in our study, with even lower levels of circulating cortisol in the fetus, may be due to hyperplasia rather than hypertrophy. Although I cannot determine from these studies whether MR or GR are responsible for the observed effects, the relativ e levels of MR and of 11 HSDs suggest that action at MR as well as at GR could be involved. In ovine fetal heart both MR and GR were expressed in myocytes, and 11 HSD1 appears to predominate over 11 HSD2 expression, particularly in the myocytes. In sheep as in other species, MR has greater a ffinity for cortisol than does GR (Richards et al. 2003), and MR affinity for cortisol and aldosterone is similar. In fetal sheep plasma aldosterone concentrations are relatively low, so that basal occupancy of MR by either cortisol or aldosterone is expected to be much less than 100%. However the increase in fetal plasma cortisol occurring

PAGE 45

45 with maternal cortisol infusion in this study woul d be expected to cause a substantially greater change in MR occupancy than in GR occupancy because of the difference in affinity of cortisol for these two receptor subtypes. Left ventricu lar wall thickness was negatively correlated to abundance of 11 -HSD2 mRNA (Figure 5), sugg esting that decreased inactivation of cortisol in the fetuses of the ewes treated with cortisol mi ght play a role in chro nic stimulation of cardiac growth. Additionally, my data show that while MR, GR, and 11 -HSD1 appear to be localized to blood vessels and myocytes in the fetal heart, 11 -HSD2 seems to be more highly expressed in blood vessels than in myocytes, and in vascular smooth muscle than in endothelial cells. In the vasculature, 11 -HSD2 is thought to modulate vascular reactivity and may limit cortisol activation of MR (38). I do not have any data regarding distribution of 11 HSD2 in tissues from the treated fetuses, and so I cannot speculate on whether th e decrease in 11 HSD2 with maternal cortisol infusion altered myocyte or vascular expression of the protein. These data suggest that the heart enlargement is not an indirect effect of cortisol via changes in fetal blood pressure. In the previous publication from this stud y it was reported that fetal blood pressure was not signifi cantly elevated by the chronic maternal infusion of cortisol (Jensen et al. 2005); fetal mean arterial pressure at 130d was 50.4 1.5 mmHg in the high cortisol group, and 47.8 2.1 mmHg in the cont rol group. Neither linear regression nor backward stepwise multiple regression analysis showed a significant relationship between change in blood pressure from day 120-130 and left ventricle wall thickness. Studies in several animal models of hypertrophy, including hypert rophy induced by deoxycorticosterone (DOC) or carbenoxelone (an 11 -HSD inhibitor), have shown that the MR blocker eplenerone inhibits the effect on cardiac hypertrophy and inflammatory ma rkers without altering blood pressure (Young

PAGE 46

46 et al. 2003). These data suggest that the increase in left vent ricular wall thickness was not secondary to increases in fetal arterial pr essure, but by other steroid receptor mediated mechanisms. Role of Growth-Related Genes: VEGF, eNOS, Myotrophin and IGFs Several genes that m ight be expected to be related to growth were not found to be increased. I reasoned that since th e fetal hearts were enlarged in the high cortisol group, perhaps angiogenesis was being stimulated by VEGF an d NOS-3 in these hearts; however neither of these genes was significantly in creased in fetal left ventricl e among the maternal cortisol treatment groups (Figure 2). Myotrophin was also not increased in the enlarged hearts (Figure 2). Myotrophin has been suggested as a cau sal agent in cardiac hypertrophy in both humans and in rodents (Anderson et al. 1999, Sarkar et al. 2004, Shanmugam et al. 1996). In mice, over-expression of myotrophin causes cardiac hypertrophy, and pressure overload causes a ventricle-specific increase in myot rophin as well as wall thickne ss. Treatment of cultures of neonatal myoctes with myotrophin increased the size of the myoc ytes and stimulated protein synthesis without increasing DNA synthesis. The absence of a change in myotrophin mRNA in our study suggests, therefore, th at the increased size of the fetal heart may result from hyperplasia rather than hypertrophy. IGF-I stimulates proliferati on of cardiomyocytes in cultures from fetal sheep hearts (Sundgren et al. 2003), and increased IGF protein has been implicated in the increase in heart size in fetuses of undernourished ewes (Dong et al. 2005). However, our findings suggest that the insulin-like growth factors may not be impor tant in the cortisol-induced heart enlargement effect, as high cortisol levels appear to have a negative in fluence on IGF-1R mRNA expression in the heart. This should not be surprising as increases in cortisol at term have been shown previously to be responsible for IGF-I and IGFII down-regulation in skeletal muscle in fetal

PAGE 47

47 sheep (Li et al. 2002, Li et al. 1993); glucocorticoids have also been shown to decrease IGF-2R in fetal rat osteoblasts in culture (Rydziel et al. 1995). However, IGFs may play a role in the enlargement through differential re gulation of the IGF actions by the IGF binding proteins; more studies regarding the IGF and IGF binding proteins concentrations in fetal plasma and fetal heart in this model are needed before it can be conc luded that IGFs do not play any role in the enlargement. Role of the Renin-Angiotensin System The observation regard ing the relative mRNA e xpression of AT2 to AT1 receptors in the fetal hearts suggest that the reni n-angiotensin system could play a role in cortisol-induced fetal heart enlargement. In adult hearts, angiotensin appears to cause fibrosis and hypertrophy (Zhu et al. 2003); whereas infusion of angiotensin II in fe tal sheep stimulates le ft ventricular growth (Segar et al. 2001), in cultures of ovine fetal ca rdiomyocytes, angotensin II stimulates hyperplastic growth (Sundgren et al. 2003). Although these results i ndicate that fetal plasma angiotensin II concentrations tend to increase in response to the chronic cortisol infusion when compared to the saline infused control group, it is not likely th at the increase in plasma angiotensin per se stimulates the increase in wall thickness. Fetal plasma angiotensin II levels also tend to increase in the low maternal cortisol group; this increase in the fetuses of the ewes with reduced cortisol probably results from the dramatic increase in fetal ACTH and cortisol levels by 130d (Jensen et al. 2005). I found no correlation between plasma angiotensin II levels and the increase in left ventricu lar wall thickness, also suggesting circulati ng angiotensin is not the direct mediator of this effect. Local production of angiotensin has been im plicated in a previous study of cortisolinduced fetal heart growth in fetal sheep. A recent study (Lumbers et al. 2005) demonstrated that a more acute treatment with much larger doses of cortisol (approximately 72 mg/d for 2-3 days)

PAGE 48

48 directly into the fetus late in gestation cau sed left ventricular h ypertrophy and increased angiotensinogen gene expression in the heart. However the mech anism for the effect of these much larger doses of cortisol is likely to be different than the mechanism in our study. In the present studies we found that expression of angi otensinogen in the left ventricle tended to decrease. The differences between these studies c ould be related to the cortisol levels produced (> 300 ng/ml) which would maximally activate both MR and GR, or secondary to the larger increase in blood pressure produced by the grea ter dose of cortisol (46.7 1.5 control mean arterial pressure increased to 59.7 2.0 in cortisol treat ed). As dexamethasone treatment results in increased expression of angiotensinogen in cultured neonatal myocytes (Dostal et al. 2000), the effect on angiotensinogen may require higher concentrations of cortisol exerting effects via the GR. Nevertheless, it is possible that th ere was an initial transient rise in cardiac angiotensinogen in our chronic model. The enzymes ACE1 and ACE2 can also regulate lo cal levels of angiotensin II in the heart. ACE1 is an enzyme that converts angiotensi n I into angiotensin II and has been found to augment cardiac hypertrophy when over-e xpressed in rat hearts (Tian et al. 2004) and induce cardiac arrhythmia, enlargement of the atria, and sudden death when over-expressed in mouse hearts (Xiao et al. 2004). ACE2, however, is thought to be cardio-protective because it converts angiotensin I into angiotensin 1-9 and angiotensin II into angi otensin 1-7, thereby limiting the amount of angiotensin II that is produced (Danilczyk et al. 2006). I observed no significant change in ACE1 or ACE2 mRNA expression betw een the cortisol groups, again suggesting local production of angiotensin II is not playi ng a major role in the enlargement. In my study the magnitude of the increase in ventricular wall thic kness was related to the relative expression of AT2 and AT1 receptors. My finding that the ratio of AT2 to AT1 receptor

PAGE 49

49 mRNA ratio increases also differs from that of Lumbers; they found no significant change in expression in either of the receptors (Lumbers et al. 2005). In adult hearts, the hypertrophy caused by angiotensin II is thought to be mediated by AT1 receptors (Zhu et al. 2003). It has been observed in human hearts that are faili ng, AT2 receptor expression increases or remains constant while AT1 receptor expression decreases (Segar et al. 1997). The AT2 receptor is traditionally believed to have anti-AT1 receptormediated effects, whereas the AT1 receptor is known to be pro-growth (Dostal et al. 2000). Other studies in adult hearts have indicated that an increase in AT2 to AT1 receptor ratio in the hear t is associated with an anti-growth effect in response to cardiac hypertrophy (Booz et al. 2004). It is therefore po ssible that the rise in the AT2R to AT1R ratio is simply a chronic res ponse which limits cardiac growth. However it is also intriguing to hypothesize that the AT2 receptor has a different role prenatally and performs different actions in the period of normal heart growth in fetal life than in the response to hypertrophy in adult life. In s upport of this hypothesis is the obs ervation that AT2 receptors are more highly expressed in many tissues in fetal or neonatal life relative to adult life. The role of AT2 receptors in fetal heart is not clear; in mice disruption of AT2 receptors does not result in histologic changes in the heart (Hein et al. 1995), and in rats there is no expression of AT2 receptors in myocytes at any age (Shanmugam et al. 1996). In the fetal sheep, AT2 receptors are more abundant in the heart than in other tissues and are much more abundant than in adult heart; in fact AT2 receptors rapidly decrea se in expression at birth (Burrell et al. 2003). Although AT2 receptors do not appear to be involved in righ t ventricular hypertrophy after pulmonary artery banding, or to be involved in basal growth of the left or right heart (Segar et al. 1997), more studies are needed regarding the balance betw een actions mediated by AT1 and AT2 receptors on the late gestation myocyte and their role in cortisol-mediated heart growth in late gestation.

PAGE 50

50 In conclusion, these data suggest the possibility that enlargem ent of the fetal heart can be induced by direct actions of cor tisol on MR and/or GR in fetal cardiac myocytes. An action of cortisol in the fetal heart is supporte d by the relatively low expression of 11 -HSD2, which would allow the relatively low circulating concentrations of cortisol in fetal plasma to activate MR, and to a lesser extent, GR. Furthermore, our data suggests that ge nes related to cardiac hypertrophy are not stimulated and that the growth is independent of changes in blood pressure, but that local changes in myocyt e and/or coronary vasculature act ivation by cortisol are involved. My data also suggest that changes in the reni n-angiotensin system may play a role in the ventricular growth through changes in relative expression of AT1 to AT2 receptors. Further studies will be required to test these hypotheses. It is important to note that the observed changes in cardiac size and in gene expression occur with relatively small increases in maternal cortisol, well within the range measured in response to rather modest stress in the ewe, and with fetal cortisol levels within the range which will be produced later in gestation as the fetus matures. Although the increase in size of the fetal heart may reflect pr emature activation of left venticular growth, the maternal cortisol infu sion also reduces thoracic girth of the fetus. Thus the elevation of maternal cortisol produ ces cardiac growth which is disproportionate to overall fetal gr owth.

PAGE 51

51 Figure 2-1. Gene expression of corticosteroid receptors and 11 -HSDs in the LV. Expression of mRNA for MR (A), GR (B), 11 -HSD1 (C), and 11 -HSD2 (D) in left ventricles from fetuses of the control (open bars), hi gh (gray bars), and low maternal cortisol (black bars) groups. Fold changes of the genes were calculated using the expression 2^Ct with respect to the control group and are expressed as mean fold change SEM.. *p<0.05 vs control 0.0 0.5 1.0 1.5 2.0 Fold Change 0.0 0.5 1.0 1.5 2.0 MR GR 11 HSD1 11HSD2* D C A B

PAGE 52

52 Figure 2-2. Gene expression of Myotrophin and vasculogenesis related genes in the LV. Expression of mRNA for myotr ophin (A), eNOS (NOS-3; B), and VEGF (C) in left ventricles from fetuses of the control (ope n bars), high (gray bars ), and low maternal cortisol (black bars) groups Data are expressed as in Figure 2-1. *p<0.05 vs control eNOS Fold Change 0.0 0.5 1.0 1.5 2.0 2.5 VEGF 0.0 0.5 1.0 1.5 2.0 2.5 B C Myotrophin 0.0 0.5 1.0 1.5 2.0 2.5 A

PAGE 53

53 11 -HSD1 (B) C Figure 2-3. Gene expression of IGFs and IGF receptors in the LV. Expression of mRNA for IGF-I (A), IGF-1R (B), IGF-II (C), and IGF-2R (D) in left ventricles from fetuses of the control (open bars), high (gray bars), and low maternal cortisol (black bars) groups. Data are expressed as in Figure 2-1. *p<0.05 vs control 0.0 0.5 1.0 1.5 2.0 2.5 Fold Change 0.0 0.5 1.0 1.5 2.0 2.5 IGF-I IGF-II IGF-1R IGF-2R* C A B D

PAGE 54

54 B IGF-1R (B), D Figure 2-4. Gene expression of the RAS in the LV. Expression of mRNA for AT1R (A), AT2R (B), ACE1 (D), ACE2 (E) and angiotensinogen (F) in left ventricles from fetuses of the control (open bars), high (gray bars), and low maternal cortisol (black bars) groups. Data are expressed as fold changes as in Figure 2-1. The ratio of AT1R to AT2R mRNAs in left ventricles from each group are shown in Panel C. *p<0.05 vs control Angiotensinogen AT1 Fold Change 0.0 0.5 1.0 1.5 2.0 2.5 AT2 ACE1 0.0 0.5 1.0 1.5 2.0 2.5 ACE2 AT2R to AT1R mRNA ratio 0 1 2 3 4 B D A E C F

PAGE 55

55 Figure 2-5. Localization of co rticosteroid receptors and 11 -HSDs in the LV. Immunohistochemical localizati on of MR (A), GR (B), 11 -HSD1(C) and 11 HSD2 (D) in hearts of untreated fetal sheep; 40x power. Arrow indicates location of blood vessel with positive staining.

PAGE 56

56 Figure 2-6. Linear regr ession correlation of 11 -HSD2 mRNA and left ventricular wall thickness. There was a significant negative relationship between the expression of 11 -HSD2 mRNA and left ventricular wall thickness (r=0.624, P<0.02). 11 -HSD2 mRNA levels are expressed as Ct using ribosomal RNA as the reference; higher Ct indicates relatively lower expression of 11 -HSD2. Ct 11 HSD2 17.518.018.519.019.520.020.5 Left Ventricular wall thickness 5 6 7 8 9 10 11 12

PAGE 57

57 Table 2-1. Primers and Probes used in real-time PCR assays. GENE Forward Primer Nucleotide Sequence (5-3) Reverse Primer Nucleotide Sequence (5-3) IGF-II CTGCCTCTACGACCGTGC TT TGCTTCCAGGTGTCAGATTGG IGF-1R AACTACACAGCCCGGATCCA ACACAGGCTCCGTCCATGAC IGF-2R CTCACGGACGAGCAGCTGT AC CGGGTCACCTTGAAGGTGTT VEGF GCTCTCTTGGGTGCATTGGA TGCAGCCTGGGACCACTT Myotrophin GGCGCCGAT AAGACTGTGA CCTGGTTGTCAGTGGCTTCA 11 -HSD1 GGAATATGAGGCGACCAAGGT TGGCTGTGTCTGTGTCGATGA ACE1 CCAAATATGTGGAGCTCA CCAA GGAGTCCCCGCCATCC ACE2 GCAGCCACACCTCACTATTTGA AGGAAGTTTATTTCT GTTTCATTGTCTTC Probe Nucleotide Sequence (5-3) IGF-II TCACAGCATACCCCGTGGGCAAG IGF-1R CCACCTCTCTCTCTGGG IGF-2R TTCAACCTGTCCAGCCTCTCCAA VEGF CCTTGCCTTGCTGCTCTACCTTCACCA Myotrophin CCCCG ATGGGCTGACTGCCC 11 -HSD1 ATGTGTCAATCACCCTCTGTATTCT ACE1 (SYBR) ACE2 (SYBR)

PAGE 58

60 Table 2-2. Partial sequ ence of ovine myotrophin. GACTATGTGGCCAAGGGAGAAGATGTCA ACCGGACACTAGAAGGTGGAAGAAAGC CTCTTCATTATGCAGCAGATTGTGGACA GCTTGAAATCCTGGAATTTCTGCTGCTGA AAGGAGCAGATATTAATGCTCCAGATAAACATCATATCACACCTCTTCTGTCTGCCG TCTATGAAGGTCATGTTTCCTGCGTGAAATTGCTTCTGTCAAAGGGCGCCGATAAGA CTGTGAAAGGCCCCGATGGGCTGACTGCCCTTGAAGCCACTGACAACCAGGCGATC AGAGCCCTCCTTCAGTGACGGACGGCGGGCTGACGGCTCTGGAAGGGTGGCTCTCC TGTGCCTTCACACTG

PAGE 59

61 Table 2-3. Fetal plasma angioten sin II levels (pg/ml) in fetuse s in the high, control, and low maternal cortisol groups at 120, 125, and 130 days gestation. 120 Days 125 Days 130 Days Control (n=7) 88 19 95 18 95 10 High (n=4) 71 17 87 13 131 28 Low (n=5) 70 7 112 17 117 15 Data are expressed as mean SEM.

PAGE 60

62 CHAPTER 3 ONTOGENY OF GENES RELATED TO OVINE FETAL HEART GROWTH: IMPLICATIONS F OR GROWTH SECO NDARY TO INCREASED CORTISOL Introduction There is a pronounced increase in fetal heart growth in the last third of gestation, paralleling a sim ilar exponential growth of the fetus (Burrell et al. 2003, Jonker et al. 2007) At the same time as the heart is increasing in bot h total weight and left and right ventricle wall mass, an increasing number of myocytes termin ally differentiate. This process results in binucleate or multinucleate myocytes which are unabl e to undergo further cell division (Burrell et al. 2003, Jonker et al. 2007) A similar pattern of decreasi ng proliferative activity near term has also been described for the human fetus (Hut tenbach et al. 2001). Seve ral factors have been identified as regulators of proliferation in the fe tal heart in late gestation, these include cortisol (Giraud et al. 2006),IGFs (Liu et al. 1996, Sundgr en et al. 2003), and an giotensin (Sundgren et al. 2003). My laboratory has found that small incr eases in fetal cortisol increase fetal heart weight and wall thickness (Jensen et al. 2005) and that this effect can be blocked by intracardiac administration of corticosteroid rece ptor antagonist (Reini et al. 2008). Fetal secretion of cortisol increases exponentially before birth in humans and in sheep (Liggins et al. 1974), and induces maturation of intestine (Arsen ault et al. 1985, Galand et al. 1989), lung (Ballard et al. 1996, Ligg ins et al. 1972) and liver (Fow den et al. 1995, Fowden et al. 1993). The role of cortisol in the fetal heart, however, remain s unclear. In a previous study, I investigated the expression levels of a series of genes thought to be potential influential factors in cortisol-induced fetal heart enlargement (Reini et al. 2006). mRNA Expression of the 11 beta hydroxysteroid dehydrogenase, 11 -HSD2, was decreased in the fe tuses of cortisol-treated, whereas the ratio of angiotensin type 2 recepto r mRNA was increased relative to that of the angiotensin type 1 receptor.

PAGE 61

63 The objective of this study was to determine th e expression levels of the genes relating to actions of corticosteroids, angiotensin and IGFs in fetal left (LV) and right ventricles (RV) during normal development in late gestation and into early postnatal life. For this I used quantitative real-time (qrt) PCR to quantif y gene expression levels of MR, GR, 11 -HSD1, 11 HSD2, the IGFs, their receptors and binding prot eins, and the components of the angiotensin system (angiotensin type 1 receptor, AT1R, and the angiotensin type 2 receptor, AT2R, angiotensin converting enzyme 1 and 2, and angi otensinogen) during late gestation and early extra-uterine life. Jonker and coworkers, have demonstrated that the development of the left and right ventricle in fetal sheep di ffers slightly during the last thir d of gestation in that the right ventricle contains myocytes with a larger volume, and a higher percentage of myocytes in the cell cycle compared to the left ventricle (Jonker et al. 2007). Thes e ventricle specific differences in development observed within the heart led us to also hypothesize that the changes in gene expression may differ in the LV compared to the RV, reflecting differences in myocytes proliferation or perhaps in an ticipation of the greater work load after parturition. We hypothesized that MR, GR, 11 -HSD2, IGF2, IGF-2R, and AT2R (mRNA and protein) would decrease as pregnancy progresse d while IGF1, IGF-1R, and AT1R would increase as pregnancy progressed, particularly in the right ventricle. Materials and Methods Real-Time PCR RNA was extracted from left ve ntricles (LV) and right vent ricles (RV) from tim e-dated pregnant ewes at 80 (n=4), 100 (n=4), 120 (n=4 ), 130 (n=4), and 145 (143-146) (n=5) days of gestation and from newborn lambs (days 1, 2 and 7) (n=8 for LV, n=4 for RV). RV was not extracted from the 130 day heart. RNA wa s extracted using Trizol according to the manufacturers directions. LV RNA samples were checked for genomic DNA contamination

PAGE 62

64 using real-time PCR with the RNA as a template in place of cDNA and using probes and primers for GR (which produces a product within exon 2). LV samples did not contain genomic DNA contamination. Genomic DNA was removed from RV samples using RNeasy Plus Mini Kit (Qiagen Inc., Valencia Ca). Total RNA was measured spectrophotometrically to measure the quantity and quality of RNA. Reverse transcri ption of the RNA into cDNA was then performed using a high capacity cDNA archiv e kit (Applied Biosystems; Fost er City, CA) and aliquots for cDNA were stored at -20oC until used. Qrt PCR was utilized to measured gene expr ession. The genes analyzed in this study for the LV were MR, GR, 11 -HSD1 and 2, IGF-I and II, IGF-1R and 2R, IGF binding proteins 2 and 3 (IGFBP2 and, IGFBP3), angiotensinogen, ATR1 and 2, and angiotensin converting enzymes (ACE1 and ACE2). The same genes were studied in RNA from RV except for IGFBP3. Probe and primer sequences were ba sed on previously published sequences: MR and GR (Keller-Wood et al. 2005), IGF-I (Meinel et al. 2003), angiotensinogen (Burrell et al. 2003), 11 HSD2, AT1R and AT2R (Dodic et al. 2002), IGFBP2 and IGFBP3 (Bloomfield et al. 2006), and for 11 HSD1, IGF-II, IGF-1R, IGF-2R, ACE1 a nd ACE2 (35). For ACE1 and ACE2, SYBR Green (Bio-Rad) was used instead of pr obes. An ABI PRISM 7000 Sequence Detection System (Applied Biosystems) was used to carry out the qrt PCR reactions. Reactions were carried out using 20 or 100 ng of template c DNA, except in the case of ribosomal RNA, for which 1 ng of template was used. All genes we re normalized to 18s ribosomal RNA, and data was analyzed using the Ct method (Livak et al. 2001). 18s expression was unchanged between all the groups within each tissue. Data Analysis Changes in gene and expression among groups were analyzed by one way analysis of variance (A NOVA) using the Ct values. When data was not normally distributed, the Kruskal-

PAGE 63

65 Wallis one way analysis of variance on ranks was utilized. Duncans test or Dunns test were used as appropriate for comparing differen ces between ages, and p<0.05 was used as the standard for significance in all sta tistical tests. For graphical purposes, fold changes of the genes in the heart ontogeny study were cal culated using the expression 2^Ct with respect to the mean value of delta Ct in the 80d fetal group. Results Expression of MR, GR, and 11 -HSD1 and 2 mRNA There were significant ontogene tic changes in MR, GR, and 11 -HSD1 mRNAs in fetal left ventricles (Figure 3-1) ; MR and 11 -HSD1 and 2 m RNAs also changed ontogenetically in the right ventricle, but GR did not significantly change as a functi on of age in the right ventricle (Figure 3-1). MR mRNA expression was greatest in fetal LV at 80d and is significantly decreased at 130 days of gestation and in new borns. GR mRNA was also greatest at 80d, and decreased at 120, 130 d and in the newborn LV. This pattern differed from that in RV; MR mRNA in RV was significantly decreased at 100d compared to all other ages. In LV 11 -HSD1 mRNA expression was significantly decreased at 120 days gestation compared to 80 days and 145 days gestation. 11 -HSD2 mRNA expression in LV did not change throughout gestation. In RV, 11 -HSD1 and 11 -HSD2 mRNA expressions were highest in the newborns. The ratio of mRNA expression of 11 -HSD1 to 11 -HSD2 was unchanged throughout the ages studied in LV, but was significantly decrease d in the RV at 145 days comp ared to 100 days gestation (Table 3-1). Expression of IGF1, IGF-1R, IGF2, IGF-2R, and IGFBP2 There were ontogenetic changes in expressi on of IGF2, IGF1R, IGF2R, and IGFBP-2 mRNAs in the LV and IGF2, IGF2R, and IGFBP2 mRNAs in the RV (Figure 3-2). IGF1 mRNA expression did not change in either RV or LV over the ages studie d. In contrast, IGF2

PAGE 64

66 mRNA expression was greatest at 80-100 days in both LV and RV, and significantly decreased in the LV and RV from older animals; IGF-2 mRNA expression was lowest in the newborn LV or RV. The mRNA for IGF type 1 receptor was also decreased in LV after 120days, but did not change in RV. The mRNA for IGF type 2 recepto r was also decreased af ter 120d in LV, but was significantly decreased only after 130d in RV. As a result of these changes in IGF2 mRNA, the ratio of expression of IGF1 to IGF2in the LV a nd RV were increased in late gestation (Table 31). In the LV the ratio was increased on day 120 compared to day 100 and on day 145 compared to 80 and 120 days, and was markedly increased in postnatal hearts compar ed to all gestational ages. In the RV the ra tio of the expression of IGF1 to IG F2 was increased at 130 and 145 days gestation compared to the earlier gestational ages and the ratio in the postnatal RV was elevated compared to all gestational ages except for 145 days. The ontogenetic pattern of IG FBP2 mRNA in both LV and RV were decreased after 100d with more dramatic decreases at 145d and in newborns. IGFBP3 mRNA expression in LV on the other hand, is not significantly cha nged over time, although the level at 100d was significantly lower at 120d than at 80d or 145d (Figure 3-2). Expression of Angiotensinogen, AT1R, AT2R, ACE1, and ACE2 mRNA Although expression of angiotensinogen mR NA did not change significantly in LV, angiotensinogen expression in RV is significan tly decreased at 100 days compared to 80, 130, and 145 days gestation (Figure 33). Expression of ACE1 mRNA wa s dramatically increased in LV and RV at 145 days gestation and in the ne wborn. In contrast, expression of ACE2 mRNA in both LV and RV was greatest at 80 days and de creased at later ages (Figure 3-3). Therefore the ratio of ACE1 mRNA to AC E2 mRNA was increased in LV from 120d on, and in RV from 100d onward (Table 3-1).

PAGE 65

67 AT1R mRNA expression was significantly decreas ed in LV at 120 and 130 days gestation and at 1 day postnatally. AT1R mRNA expression in RV at da y 100 was significantly less than expression at day 80. Expression of AT2R mRNA did not signifi cantly change in LV throughout the study, although AT2R expression was significan tly higher at 130 days gestation than in newborn hearts in the RV. There was little chan ge in the ratio of AT1R to AT2R mRNAs in LV, although the ratio in LV was signi ficantly higher at 120 days when compared to postnatal lambs (Table 3-1). In the RV, the ratio was greater at 80d and in the newborn than in 100 or 130 fetuses, and at 145d was great er than 130d (Table 3-1). Discussion This study revealed ontogenetic patterns of expression of several genes implicated in growth or hypertrophy in neonatal and adult hearts. Previous studies of the ovine fetal heart have found that the number of mononuclear myocyt es declines over the time period we studied (80 days to the early postnatal period), and the number of binucleate myocytes increases over this period (Burrell et al. 2003, Jonker et al. 2007). However, the number of proliferating myocytes in the left ventricl e is approximately 50% at 100 da ys and decreases to 15% by 145d, whereas only 15-25% of right ventricular myocyt es are proliferating over this time period (Jonker et al. 2007). In contrast, the number of myocyt es that are enlarged due to terminal differentiation is greater in the ri ght ventricle than in the left ve ntricle, particularly from day 130 to term, and right ventricular myocytes are on aver age greater in volume than are those in the left ventricle. Results from this study suggest that de creases in IGF2 and IGF2R are associated with fetal cardiac maturation in both le ft and right ventricle, and are consistent with roles of the angiotensin and IGF1 in the transi tion of the left and ri ght ventricle from feta l to postnatal life.

PAGE 66

68 Role of Corticosteroids in the Heart Previous studies suggest that even small increases in fetal cortisol can alter heart m ass (Jensen et al. 2005, Jensen et al. 2002), suggesting an act ion of cortisol at MR and/or GR in fetal myocytes. Both MR and GR are abundantly expressed in the fetal heart (Reini et al. 2006), as is the case in many adult species, including humans (Lombes et al. 1995). While GR is relatively abundant in the fetal heart, in sheep as in other species MR binds cortisol with greater affinity than GR (Richards et al. 2003). The ability of cortisol to bind at MR and/or GR, however, depends in large part on the activity of 11 -HSD1 relative to that of the cortisol inactivating enzyme 11 HSD2 (Mihailidou et al. 2005, Seckl et al. 2001). MR and GR follow a similar pattern of expression in the LV throughout late gestation with significant decreases from the expression levels at 80 days gestation occurri ng by 130 days gestation and postnatally in both MR and GR. There was no significant overall ontoge netic change in expression of MR or GR in the RV, although the MR levels at 100 days were lower than at other times. 11 -HSD1 and 11 HSD2 both show relatively consis tent expression levels in the LV throughout late gestation and early extrauterine life, while both 11 -HSD1 and 11 -HSD2 increase ~2-3 fold in expression in the RV after birth compared to earlier points in fetal life. While there are no major changes in the ratio of expression, 11 -HSD1 maintains a higher level of expression than 11 -HSD2 within both ventricles of the heart throughout all of late gestation, in dicating the potential role of cortisol within the heart in the late gestation fetus, but sugge sting that proliferative effects of cortisol are reduced in left ve ntricle as the heart matures. Insulin-Like Growth Factors In the current study, LV IGF1 mRNA expres sion did not significantly change throughout late gestation or neonatally, while IG F1R levels d ecrease in left ventricl e by 120 days gestation and maintain that lower level of expression through birth. IGF2 mRNA and IGF2R mRNA are

PAGE 67

69 decreased in both LV and RV after 120 days and remained low postnatally. In contrast, neither IGF1 nor IGF1R significantly changed in RV The IGF2 results agree with previous observations of decreased IGF2 mRNA expression in at 133 days gestation as compared to 75d (Delhanty et al. 1993) by northern blot, and a decr ease in IGF2 mRNA from 60d to 141d (Cheung et al. 1996) by in situ hybridization. However in these studies, inve stigators also found a decrease in IGF1 expression in the left ventri cle from 100 days gestati on toward term, whereas we did not observe a significant decrease in expression. The pattern of decreased IG F1R in LV parallels the reduced number of LV myocytes entering the cell cycle in late gestation in LV, wh ereas the dramatic decrease in IGF2 from day 120 of gestation to parturition in both LV and RV parallels the reduction in mononuclear myocytes in both ventricles (Jonker et al. 2007). IGF2 and IGF1 both appear to stimulate myocyte prolifera tion in vitro. Liu et al. found that IGF2 stimulated an increase in proliferation of prenatal rat myocyte cultures, but did not stimulate proliferat ion in neonatal myocytes (Liu et al. 1996). Sundgren et al. have s hown that infusion of an IGF1 analog to 124 day fetal sheep results in decreased numbers of binucleated cells, but increased percentages of monucleated myocytes; IGF1 administration in cultured fetal cardiomyocytes stimulated proliferation of the myocytes mediated by ERK and PI3K (Sundgren et al. 2003). Because in vivo both IGF1 and IGF2 act can act via binding at IGF1R, the decrease in IGF1R expression may limit the proliferative effects of both IGFs as the heart matures. Alterna tively, the decrease in expression of IGF2 or IGF1R may reflect the decrease in mononuclear myocyt es as terminal differentiation proceeds. As a result of the decrease in IGF2 mRNA the ratio of IGF1 to IGF2 mRNAs increased near term and postnatally (Table 1). This change in ratio of IGF1 to IGF2 mRNA expression is

PAGE 68

70 consistent with the hypothesis that IGF2 is less important to post natal growth than to prenatal growth. It is interesting to speculate that IGF2 may play a role in mononuclear myocyte proliferation, accounting for the gradual decreas e in proliferation obser ved throughout the last third of gestation as IGF2 expressi on within the heart decreases. One of the possible key regulators of both systemic and local IGF concentrations in fetuses is thought to be cortisol Fetal skeletal muscle IGF1 mRNA expression decreases at the same time as the prepartum rise in ovine plasma cortisol levels, and a ppears to be cortisoldependent (Li et al. 2002). This laboratory has found that moderately elevated cortisol levels late in gestation reduce IGF-1R mRNA levels in the heart, but did not alter IGF-1 mRNA (Reini et al. 2006). Increases in fetal cortisol decrease circulating IGF1 at the same time as increasing fetal heart weight (Jensen et al. 2002); the decrease in cardiac IGF1 expression in the late gestation fetal heart also occurs at a time of in creased circulating cortis ol. Although in previous studies we did not find a decrease in cardiac IGF1 mRNA with sma ll increase in cortisol in the 130d fetus, we did find a reduction in IGF1R mRNA, similar to the finding in this study that IGF1R deceases at a time that the fetal adrenal be gins to secrete low concentrations of cortisol, and at a time of relative abunda nce of MR expression in LV. The biological actions of IGFs are in part regulated by IGF binding proteins 1-6 in vivo which function to prolong the half life of IGFs in plasma. IGFBPs have the ability to modulate the actions of IGF through regulating transpor t, turnover, and tissue distribution (Jones et al. 1995). The ontogenetic pattern of IGFBP2 mRNA in both LV and RV we re decreased after 100d with more dramatic decreases at 145d and in newborns. IGFBP3 mRNA expression in LV on the other hand, is not signi ficantly changed over time, although the level at 100d was significantly lower at 120d than at 80d or 145d (Figure 2). Previous studies have shown IGFBP2

PAGE 69

71 and IGFBP3 play roles in fetal development. It has been reported that over-expression of IGFBP2 (Hoeflich et al. 1999) and IGFBP3 (Modric et al. 2001) in mice leads to a ~10% decrease body weight, although th ere is no change in heart we ight with over-expresssion of either binding protein. Maternal nutrient restriction leads to an increase in plasma IGFBP2 levels within the fetus between 90 and 135 days gestation (Osgerby et al. 2004), but did not alter fetal heart weights.. In contrast, Greenand co workers found that umbilical cord occlusion for four days (107-108 d fetuses) led to no change in plasma IGFBP2 or IGFBP3, but did lead to an increase in RV mRNA expr ession of IGFBP2 (Green et al. 2000); there was no change in either body weight or heart weight with this 4 days of manipulation. This st udy reveals a progressive decrease in IGFBP2 mRNA expression in the LV and RV starting at 120 days gestation and continuing on until postnatal life; IGFBP3 mRNA expression di d not change in LV. Although the role of IGFBPs in mediat ing IGF effects in the fetal heart are not known, these results suggest that the decrease in IGFBP2 mRNA within the fetal heart as ge station progresses may reduce IGF1 mediated prolifera tive effects in both LV and RV. Renin-Angiotensin System Infusion of angiotensin II into fetal sheep stim ulates left ventricular growth (Segar et al. 2001), and in cultures of ovine fetal cardiomyocytes, angiotensin II has been shown to stimulate hyperplastic growth (Sundgren et al. 2003). I previously found that the el evated cortisol levels in sheep during late gestation produced enlarged hearts with AT2 to AT1 mRNA ratios (Reini et al. 2006), although this infusion does not appear to increase genes associated with hypertrophy. Infusion of very high doses of cortisol in th e sheep fetus causes hypertension, left ventricular (LV) hypertrophy and increased cardiac expr ession of angiotensinogen mRNA (Lumbers et al. 2005), and in the adult heart the lo cal RAS has been implicated in playing a major role in cardiac

PAGE 70

72 hypertrophy and fibrosis. In murine hearts lo cal over-production of a ngiotensin II, without involvement of the systemic RAS, causes interstitial fibrosis within the heart (Xu et al. 2007). This study indicates that changes in the expression of mRNAs for RAS components correspond to changes in prolifer ative activity and diffe rentiation in the maturing heart. ACE1, which converts angiotensin I to a ngiotensin II, increased ~5-fold in the LV and RV at term. ACE1 is known to augment cardiac hypertrophy in rat hearts when over-expressed (Tian et al. 2004), and the pattern of expression in late gestati on is consistent with expression in terminally differentiated myocytes. ACE2, which converts angiotensin I into angiotensin 1-9 and angiotensin II into angiotensin 1-7, limits the am ount of angiotensin II th at is thought to be cardio-protective (Danilczyk et al. 2006). In this study, ACE2 mRNA expression significantly decreased in the LV by 120 days gestation and remained low, wh ile expression in RV did not significantly change. Interesti ngly, the ACE1 to ACE2 mRNA ratio increases ~15-fold by 145 days gestation compared to 80 days in both the LV and RV. This increase in the ratio suggests that local angiotensin II produc tion may be associated with th e terminal maturation of the myocytes. Although high doses of cortisol stimulates angioten sinogen expression in the fetal sheep heart (Lumbers et al. 2005), the physiologic increas e in cortisol that occu rs at term in fetal sheep did not increase angioten sinogen mRNA expression, sugges ting that changes in cardiac angiotensin II production ar e related to a decrease in ACE2 expression and increase in ACE 1 expression, rather than by a local increase in tran scription of the gene for the precursor protein. In this study, AT2R mRNA expression remain ed relatively constant throughout gestation in both the LV and RV, while AT1R mRNA expre ssion significantly decr eased at 120-130 days gestation and in the newborn compared to expressi on at 80 days in the LV. These results are in contrast to the increase in AT2R protein in the heart in late gestation observed by others (Burrell

PAGE 71

73 et al. 2001). This decrease in e xpression of AT2R mRNA in the LV at 120 days coincides with the decrease in ACE2 mRNA expression, whereas th e drop in expression in the postnatal LV of AT1R mRNA coincides with th e increase in ACE1 mRNA ex pression, suggesting that the decreased expression of the AT1R mRNA may be in response to an increase in local angiotensin II production. In the adult heart, the AT1Rs are thought to be responsible for hypertrophic effects, while actions at AT2R are hypot hesized to counteract the AT1R (Booz et al. 2004, Zhu et al. 2003). Thus the relative incr ease in AT1R to AT2R may be consistent with increased capacity for myocyte hypertrophy in differentiated myocytes. In the RV the daily increase in ventricular mass is primarily due to enlarg ement with terminal differentiation (Jonker et al. 2007); the greater increase in AT1R to AT2R ratio in RV appears to correlate to this, suggesting a greater stimulation of myocyte volume is associat ed with greater relative AT1R expression in RV. In conclusion, our results suggest that change s in gene expression in the RV and LV is associated with the changes in proliferative activ ity of mononuclear myocytes, and with terminal differentiation of binucleate myocytes, which increase in number near birth.

PAGE 72

74 Left Ventricle Right Ventricle Figure 3-1. Ontogenetic expression of corticosteroid receptors and 11 -HSDs in the LV and RV. Expression of mRNA for MR, GR, 11 -HSD1, and 11 -HSD2 in left ventricles of 80, 100, 120, 130, and 145 day fetuses and postnatal lambs (pn) and in right ventricles of 80, 100, 130, 145 and postnatal lamb s. Data are depicted as mRNA fold changes relative to 80d calculat ed using the expression 2^Ct and expressed as a mean fold change SEM. Letters indicate significant differences (p<,0.05) a: 80d, b: 100d, c:120d, d: 130d, f: 145d, g: newborn. 0 1 2 3 Fold Change Relative to 80 Days 0 1 2 3 MR 0 1 2 3 GR 11 HSD1 80100120130145pn 0 1 2 3 11 HSD2 a a a a a ae 0 1 2 3 GR 0 1 2 3 4 11 HSD1 80100130145pn 0 2 4 6 11 HSD2 abd ab abd MR 0 1 2 3 adef

PAGE 73

75 Left Ventricle Right Ventricle Figure 3-2. Ontogenetic expression of IGFs, IGF receptors, and binding pr oteins in the LV and RV. Expression of mRNA for IGF1, IGF2, IG F1R, IGF2R and IGFBP2 from left and right ventricles of fetal and newborn lambs. IGFBP3 were measured in left ventricle only. Ages and significance are as indicated in legend to Figure 3-1. 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 Fold Change Relative to 80 Days 0 1 2 3 IGF1 IGF1RIGF2 IGF2R IGFBP-2abcde abcd ab ab a a a a abcde ab ab ab abcd abc ab a 80100120130145pn 0 1 2 3 IGFBP-3ae IGF1 0 1 2 3 0 1 2 3 0 1 2 3 IGF1R IGF2 0 1 2 3 IGF2R ab a ab ab ab a IGFBP-2 80100130145pn 0 1 2 3 a ab ab

PAGE 74

76 Left Ventricle Right Ventricle Figure 3-3. Ontogenetic expres sion of the RAS in the LV an d RV. Expression of mRNA for Angiotensinogen, AT1R, AT2R, ACE1 and ACE2 in left and right ventricles of fetal and newborn lambs. Ages and significance ar e as indicated in legend to Figure 3-1. 80100120130145pn 0 1 2 3 2D Graph 4 0 1 2 3 4 5 6 2D Graph 2 0 1 2 3 Fold change Relative to 80 Days 0 1 2 3 AngiotensinogenAT1R 0 1 2 3 AT2R ACE1 ACE2 a a a abcd abd a a a a Angiotensinogen 0 1 2 3 0 1 2 3 AT1R 0 1 2 3 AT2R 0 2 4 6 8 80100130145pn 0 1 2 3 ACE1 ACE2 ade a f abd abd

PAGE 75

77 Table 3-1. Expression ratio of 11 -HSD1 to 11 -HSD2, IGF2 to IGF1, AT1R to AT2R, and ACE1 to ACE2 in LV and RV mRNA Age (days gestation) 11 HSD1/ 11 HSD2 IGF2/ IGF1 AT1R/ AT2R ACE1/ ACE2 LV RV LV RV LV RV LV RV 80 62 21 13 3 241 62 978 276 1.4 0.4 4.8 1.6 14 4 2.5 0.2 100 36 11 16 4 *f 433 116 949 265 1.7 0.4 1.5 0.3 *ag 23 2.8 6.0 0.7 *a 120 25 6.4 nm 151 11 *b nm 0.9 0.1 nm 64 6.0 *a nm 130 33 4.5 6.1 1.8 176 25 268 37 *ab 1.8 0.4 1.3 0.5 *afg 78 31 *a 9.6 1.6 *a 145 45 5.0 5.7 2.1 88 10 *ab 146 48 *ab 2.1 0.5 3.3 1.1 212 66 *abd 31 6 *abd postnatal 31 9.0 6.7 0.5 41 7 *abcdf 105 4 *abd 1.4 0.2 3.8 0.3 133 41 *ab 37 6 *abd Letters indicate significant di fferences (p<,0.05) a: vs 80d, b: vs 100d, c: vs120d, d: vs 130d, f: vs 145d, g: vs postnatal lambs; nm, not measured.

PAGE 76

78 CHAPTER 4 2CARDIAC CORTICOSTEROID RECEPTORS MEDIATE THE ENLARGEMENT OF THE OVINE FETAL HEART INDUCED BY CHRONIC INCREASES IN MATERNAL CORTISOL Introduction In late gestation, norm al fetal growth and fe tal cardiovascular home ostasis is dependent on the proper regulation of maternal cortisol levels. Although reductions in maternal cortisol prevent the normal increases in maternal plas ma volume and uteroplacental blood flow and reduce fetal growth (Jensen et al. 2002a; Jensen et al. 2005), increases in maternal cortisol also alter fetal growth. Chronically increased maternal cortisol levels, within the range that occurs with maternal stress, reduce fetal growth rate s while increasing heart growth in fetal sheep (Jensen et al. 2002b; Jensen et al. 2005). The mechanisms by which chronically elevated ma ternal cortisol levels increase the size of the fetal heart are not known. Giraud et al. have shown that cortisol chronically infused directly into the coronary artery increased cell cycle activity in myocytes of late gestation sheep fetuses, suggesting a direct induction by cort isol of hyperplastic growth rather than hypertrophic growth (Giraud et al. 2006). Conversely, it has been demonstrated that large doses of cortisol infused directly into the fetus in late gestation cause s left ventricular (LV) hypertrophy along with an increase in fetal arterial pressure and cardi ac expression of angiotensinogen mRNA (Lumbers et al. 2005). This laboratory has shown that mate rnal cortisol infusion in sheep during late gestation caused an increase in fetal heart size and wall thickness without increasing fetal arterial pressure or cardiac angiotensinog en; we found an increase in th e ratio of angiotensin type 2 2 Reproduced with permission from Reini S, Dutta G, Wood C, & Keller-Wood M 2008 Cardiac corticosteroid receptors receptors mediate the enlargement of the ovine fetal heart induced by chronic increases in maternal cortisol The Journal of E ndocrinology Epub May 21, 2008.

PAGE 77

79 receptor (AT2 receptor) to angiotensin type 1 re ceptor (AT1 receptor) mRNA in the fetal heart, suggesting that the renin-angiotensin system (RAS) may play a key role in the enlargement process. Furthermore, in the same study it was observed that left ventricular expression of 11 HSD2 mRNA, the enzyme that conve rts cortisol into cortisone, d ecreased in the fetal hearts in response to the elevated cortisol, suggesting that cortisol can act direc tly on mineralocorticoid (MR) or glucocorticoid (GR) receptors to induce the cardiac enlargement (Reini et al. 2006). In adult hearts, both MR and the RAS have been implicated in cardiac fibrosis and hypertrophy after in jury (Fraccarollo et al. 2003; Fraccarollo et al. 2005; Xiao et al. 2004). I propose that corticosteroid receptor s also play a role in cardiac enlargement in the fetal heart, although by mechanisms independent of cardiac in jury and fibrosis. The purpose of this study was to test the hypothesis that increase in feta l heart weight and wall thickness in response to increased maternal cortisol is mediated by cardiac corticosteroid receptors, MR and/or GR, and to determine if cardiac fibrosis accompanies th e cardiac enlargement in response to cortisol. I hypothesized that cortisol acts w ithin the myocardium on MR receptors, and to a lesser degree GR receptors, to induce enlargemen t of the fetal heart. I also hypothesized that cardiac fibrosis is not involved in the enlargement of the heart observed in the fetuses of cortisol-infused ewes. Materials and Methods Experimental Design Ewes ( Ovis aries) p regnant with single fetuses were studied. All animal use was approved by the University of Florida Institutional Animal Care and Use Committee and conformed to the National Institutes of Health Guide for the Care a nd Use of Laboratory Animals. Ewes and their fetuses were operated on between 118 and 123 days of gestation (term approximately 148 days). Animals were randomly assigned to one of four groups at the time of surgery. The first group consisted of six control animals; the second group consisted of five ewes to which cortisol

PAGE 78

80 (hydrocortisone hemisuccinate; Sigma, St L ouis, MO) was administered by continuous intravenous infusion (1 mg kg-1 day-1; cortisol); the third group consisted of six ewes to which cortisol was infused, with infusion of the MR antagonist potassium canrenoate (Sigma; 600 g day-1; cortisol + MRa) directly into the pericardial space of the fetus; and the fourth group consisted of four ewes to which cortisol wa s infused, with infusion of the GR antagonist mifipristone (Sigma; 50 g day-1; cortisol + GRa) directly into the pericardial space of the fetus. For the control and cortisol groups, there were no infusions into the pericardial space. The intrapericardial infusions were perfor med by use of Alzet minipumps (2ML2; 5 lhour-1; Cupertino CA) in order to achieve continuous in fusion of the antagonists into the pericardial space without any appreciable increase in pericard ial fluid volume (0.12 ml/day). The doses of MR and GR antagonists were calcu lated based on their effective systemic doses, and scaled to reflect the smaller distribution volume of the feta l heart (20g). Because these drugs are steroid (mifepristone) or lactone (canrenoate) derivatives, they are able to di stribute th roughout tissue over the 10 days of study after mixing in the pe ricardial fluid. Effects of the MR and GR antagonists were confirmed using immunohistoche mistry to confirm the expected cellular redistribution of receptors with anta gonist administration (see below) The cortisol dose and the duration of cortisol infusion (10 days) were determined based on a previous study in this laboratory (Jensen et al. 2005) showing that infu sion at this rate and duration produces levels similar to mild maternal stressors and results in enlargement of the fetal heart Surgical Procedures Halothane (1.5-2.5%) in oxygen was used to anesthetize ewes during surgery. Fetal f emoral tibial artery catheters and an amniotic flui d catheter were placed as previously described (Jensen et al. 2002a; Wood & Rudolph 1983). Catheters were also placed in the fetal pericardial

PAGE 79

81 space for the delivery of drug as previously de scribed (Wood 2002). In each case, an incision was made in the uterus over the left side of th e fetal chest and an incison was made between the third and fourth fetal ribs. The fetal skin was ma rsupialized to the uterus to prevent leakage of amniotic fluid. The fetal heart was exposed a nd a small incision was made in the pericardium, through which a silastic catheter (0.76 mm id, 1.65 od; Dow Corning, Midland, Michigan) was placed and held in place with use of a purse-str ing suture (4-0 Tevdek; Teleflex Medical, Mansfield, MA). For infusion of potassium canrenoate, the silastic catheter was connected to a Tygon tubing connector (1.27 mm od ; St Gobain Performance plastics; Akron, OH) which was connected at its other end to the the Alzet pump containing the drug (50 mg ml-1 in 0.9% saline). Because mifepristone is not soluble in aqueous solution and therefore cannot be directly loaded into the pump reservoir, mifepristone was di ssolved in 47.5% ethanol in saline (0.42 mg ml-1 ethanol-saline); this solution was placed in a polyethylene tubing (1.40 mm id, 1.90 mm od) which was then connected to the silastic peri cardial catheter on one end and to the Alzet minipump on the other end using smaller ga uge polyethylene tubing. The Alzet pump, filled with saline, provided the flow to pump the mi fepristone solution from the tubing into the pericardium. The pump was placed under the skin of the fetus near the scapula. In the control group, 5 of the 6 fetuses also had pericardial ca theters placed, but no infusion was delivered; in the cortisol group, 3 of 5 fetuses had pericardial catheters placed, but no infusion was delivered. After closure of the uterus, cathe ters were placed in the maternal femoral artery and vein and routed to the maternal flank. All ewes were treated with flunixamine (1 mg kg-1 im; Fort Dodge Animal Health, Fort Dodge, IA) at the end of th e surgical procedure, before recovery from anesthesia.

PAGE 80

82 Ewes were returned to their pen after rec overy from anesthesia. At this time, the intravenous infusion of cortisol (1mg kg-1 day-1 cortisol as cortisol hemisuccinate in normal saline; Sigma) or infusion of saline to the ewe was initiated. Maternal infusions were delivered through a 0.22 m filter (Fisher Scie ntific) via a syringe pump at the rate of 1.17 ml hour-1. Animals were housed in individual pens with a ccess to water, food, and salt blocks ad libitum. Ampicillin (500mg im bid; Webster Veterinary) was administered for 3 days postoperatively. Flunixamine was administered on the morning after surgery. Experimental Protocol Fetuses were studied from the day of surg ery until death on 129132 days gestation. A ll cortisol infused ewes and their fetuses were sacrificed on day 10 of infusi on. Fetal and maternal blood samples were withdrawn on day 5 (124-126 days gestation) and day 10 (129-132 days gestation) after the star t of the infusion for determination of blood gases, plasma cortisol and plasma ACTH concentrations. All blood sample s were taken immediately after entering the room in which the ewes were housed in order to minimize the effect of handling on plasma ACTH and cortisol. On day 10 of infusion, matern al and fetal blood pressure and heart rate were recorded over a 40 minute interval using LabVie w software (National Instruments, Austin, TX) and disposable pressure transduc ers (Transpac; Hospira, Lake Forest, IL). Amniotic fluid pressures were subtracted from fetal intra-arterial pressures in order to calculate fetal arterial pressure. In two animals, one in the cortisol group and one in the cortisol+MRa group, we were unable to reliably measure fetal heart rate; data from those two fetuses are excluded from analysis. The ewe was euthanized on day 10 using an ove rdose of euthanasia solution containing pentobarbital, and the fetus was removed and we ighed. The fetal heart was also immediately dissected, blotted to remove blood from the chambe rs, and weighed. Ventricular and septal wall

PAGE 81

83 thicknesses were measured using a micrometer at a standardized site on the heart, taking care to exclude measurement at the level of the papillary muscles or valves. Analysis Blood gases and pH were m easured with a blood gas/electrolyte analyzer (ABL77; Radiometer America, Westlake, OH). Electrolytes (sodium and potassium) were measured using an electrolyte analyzer (Roche 9180, Basel, Sw itzerland). For measurement of packed cell volume (PCV), blood was spun in microcapilla ry tubes for 3 minutes at 12,000 rpm (Damon Division, International Equipment, Needham Hei ghts, MA). Plasma protein was determined using a refractometer. Plasma ACTH was measured by radioimm unoassay, using an antibody to 1-39 ACTH (Bell et al. 1991) and plasma cortisol concentrat ion was measured using a commercially available enzyme immunoassay kit (EA 65, Oxford Biomedical, Oxford, MI) which has minimal cross-reactivity with cortisone (2.08%). Immunohistochemical Localization of MR and GR At the time of sacrifice, a section of the fetal heart was fixed in 4% buffered paraformaldehyde overnight. Hear ts were dehydrated with increas ing concentrations of reagent alcohol followed by xylene, embedded in paraffin wax, cut into 10m-thick sections on a Zeiss rotary microtome, and placed on poly-l-lysine coated slides. The sections were stained with antiGR (Santa Cruz Bioreagents, M-20, ) or anti-MR ( M1-18, 6G1, gift of E. Gomez-Sanchez; (Gomez-Sanchez et al. 2006)) as previously described (Reini et al. 2006) This analysis was performed to assess the ability of the drugs to act in the heart a nd cause the expected changes in cytonuclear localization of the receptors. The MR antagonist canrenoate acts in a similar manner to spironolactone and would therefore be expected to prevent nuclear localization of MR (FejesToth et al. 1998; Lombes et al. 1994); conversely the GR antagoni st mifepristone (also known as

PAGE 82

84 RU486) causes nuclear localization even in the absence of agonist (Jewell et al. 1995; Scheuer et al. 2004). The localization observed (F igure 4-1) is consistent with these effects. In the control fetuses GR were primarily located in the cytoso l, whereas MR were apparent in cytosol and nucleus. A dramatic increase in MR localization to the nucleus was apparent in the cortisoltreated fetuses, indicating cortisol activation of MR. We did not fi nd as dramatic an increase in nuclear GR with cortisol, indicating fewer GR are activated. In the case of MR antagonist administration, fewer MR were apparent in the nu cleus than with cortis ol alone, whereas with GR antagonist, equivalent MR lo calization to the nucleus occurre d as with cortisol alone. Consistent with the known effect of mefipristone, in GR anta gonist -treated ewes, there was more nuclear GR than in the case of cortisol alone or cortisol+ MRa. Collagen Staining Sections fro m each group (n = 4-6) were stai ned with picrosirius red (Sigma) in order to determine collagen content. Sections were hydr ated and immersed in sirius red (0.1% in saturated picric acid). The sections were then washed in acidified water (0.5% glacial acetic acid), dehydrated, and mounted in permount. All images were visualized using an Olympus DP71 microscope and Olympus softwa re. Ten pictures of LV, five of RV, and five of septum were taken from each heart in areas without larg e blood vessels so that primarily interstititial, rather than perivascular, colla gen deposition could be quantifie d. Picrosirius red staining was quantified using Image J software (NIH, Beth esda, MD) by three different people who were blinded as to the experimental group. The averag e value of the percenta ge of the image that stained red from these three observations was calculated. Data Analysis Fetal heart weight was norm ali zed to body weight. The heart weight to body weight ratio, LV, RV and septal thickness, fetal and maternal blood pressure and heart rate, as well as fetal

PAGE 83

85 and maternal plasma ACTH and cortisol, sodi um and potassium, and PCVs were analyzed by one way analysis of variance (ANOVA) with mu ltiple comparisons us ing Duncans method (Zar 1984). Plasma hormone (cortisol and AC TH) and protein concentrations were also analyzed by one-tailed t-test, comparing the data from all 3 groups of cortisoltreated ewes to the data from the control group (Zar 1984). Aver age cortisol values we re calculated from the 5 day and 10 day values and were log transforme d before analysis. The Mann-Whitney Rank Sum Test was used for maternal plasma protein analysis at 10d (Zar 1984). Values for the picrosirius red staining we re analyzed by two-way ANOVA in order to determine significance across the co rtisol treatment groups and areas of the heart (LV, RV, and septum); the percent stained area data was transfor med using arc sine prior to analysis to correct for heterscedascity (Winer 1971). For all analyses, p< 0.05 was used as th e criterion for statis tical significance. Results Maternal Physiology Matern al cortisol concentrations were significantly increased in the ewes treated with cortisol when compared to the non-treated ewes (5d and 10d day average, 9.0 0.9 vs. 5.9 1.4 ng ml-1). When the four groups were compared individually, there was a trend for each cortisol treated group to have increased co rtisol concentrations as compared to the control ewes (Table 41), but there were no differences among groups. ACTH levels were not significantly altered in response to cortisol treatment, although there was a trend for cortisol treated ewes to have lower ACTH concentrations than the control group (Table 4-1). Maternal sodium, potassium, and packed cel l volume values were not different between the groups at day 5 or at day 10 (data not shown). Maternal plas ma protein concentrations were

PAGE 84

86 significantly elevated in the cortisol treat ed ewes on days 5 (8.2 0.2 vs. 7.6 0.2 g 100ml-1) and 10 (7.9 0.1 vs. 7.4 0.1g 100ml-1) days as compared to the control ewes. Maternal arterial pressures a nd heart rates were not different between the four groups (data not shown). Fetal Physiology The average plasm a cortisol concentrations (5 and 10 days) were significantly elevated in the fetuses whose mothers were infused with co rtisol compared to control (3.4 0.6 vs.1.5 0.6 ng ml-1). There was a trend for each cortisol treated group to have increased cortisol concentrations as compared to the control fetuses when the four groups were compared individually (Table 4-1). ACTH levels were not significantly a ltered in response to cortisol treatment (Table 4-1). There were no significant diffe rences among the groups in the blood gas values or packed cell volume (Table 4-2), nor were there effects on fetal electroly tes (data not shown). There were also no effects of treatment on fetal heart rate and blood pressures (Table 4-3). Fetal Heart Measurements Heart weight was significantly greater in the cortisol group com pared to the control group and cortisol + MRa group, but not the cortisol + GRa group (Figur e 4-2). Left ventricular and right ventricular free wall thicknesse s were significantly greater in the fetal hearts of the cortisol treated group as compared to th e control group. Left and right ve ntricular free wall, as well as septum, thicknesses were greater in the fetal hearts of the cortisol group as compared to the cortisol + MRa group (Figure 4-2). Left vent ricular free wall thickness and septum thickness were not different in the cortisol group as comp ared to the cortisol + GRa group (Figure 4-2). However, right ventricular wall thickness was grea ter in the cortisol group as compared to the cortisol+ GRa group.

PAGE 85

87 Collagen Staining Fetal heart sections were stai ned with picrosirius red in or der to m easure the amount of interstitial collagen deposition (F igure 4-3). The percentage of collagen staining in the left ventricle, right ventricle, sept um, and whole heart was not sign ificantly altered among the groups (Table 4-4, Figure 4-3). Discussion I conclud e that blockade of corticosteroid receptors in the fetal heart prevents the enlargement of the heart observed when matern al cortisol concentra tions are chronically increased. I found that blockade of the mineraloco rticoid receptors blocked the increase in heart weight, as well as in wall thickness. Blockade of glucocorticoid receptors significantly reduced right ventricular enlargement, and produced smaller, insignificant effects on thickness of the left ventricular free wall and septum and on heart weight. Neither administration of MR or GR blocker into the pericardium resulted in incr eases in fetal ACTH or fetal blood pressure, suggesting that the infusions of antagonist did not produce systemic effects. The results indicate that small increases in cortisol increase fetal heart size via an intracardiac action at the MR and, to a lesser extent, GR receptors within the fetal hear t. I also conclude that the increase in fetal heart weight in response to elevated cortisol occurs without an increase in collagen deposition. Role of MR and GR in the Heart This laboratory has previously show n that both MR and GR are a bundantly expressed in the heart in the late gestation ovine fetus (Reini et al. 2006), suggesting a role for these receptors in fetal heart development in vivo Other investigator s have found that aldosterone directly stimulates myocyte surface area (Okoshi et al. 2004) and remodeling of myocyte membrane (Kliche et al. 2006) in cultures of neonatal myocytes, and effect presumed to be mediated by MR in the myocytes. Cortisol also increases expres sion of atrial natriuretic peptide in cultured

PAGE 86

88 neonatal myocytes, and both cortisol and aldosterone potentiate the effect of phenylephrine on hypertrophy in these cultures (Lister et al. 2006), also indicating an in tracardiac action at MR in these cultures. One of the major factors influencing the ability of cortisol to activate MR and/or GR is the local activity of the 11hydroxysteroid dehydrogenase enzymes, 11 -HSD1 and 11 -HSD2. 11 HSD1 primarily converts cortis one into cortisol, while 11 -HSD2 converts cortisol into cortisone, which is inactive at MR and GR (Krozowski et al. 1999). This laboratory has previously shown that mRNA expression of 11 -HSD2 mRNA is relatively low compared to 11 -HSD1 within the fetal heart (Reini et al. 2006). Using immunohistochemistry, I also found that although MR, GR, and 11 -HSD1 are abundantly expresse d in both myocytes and blood vessels within the fetal heart, 11 -HSD2 seemed to be localized in blood vessels more abundantly than in myocytes. This suggested that cortisol has access to both MR and GR within the fetal heart, and that when pl asma cortisol levels are increas ed, as in the present study, action of cortisol at MR and GR in the heart would also increase. My presen t study demonstrates that the effect of cortisol is blocked by antagonist s of the MR and/or GR suggesting a role of intracardiac corticosteroid receptors. This is consistent with the ability of cortisol to alter myocyte growth in cultured myocytes. I also hypothesized that blockade of MR would have a greater effect in inhibiting the effect of cortisol than would blockade of GR, because MR has been shown to have greater affinity for co rtisol than GR (Reul & DeKloet 1985; Richards et al. 2003). Indeed this is what I observed in the pr esent study: in the cortis ol group, there was a 14% increase in heart weight relative to body we ight as compared to the control group; this enlargement was completely blocked when MR antagonist was administered to the heart, whereas there was only 44% blockade of the increase in weight after administration of the GR

PAGE 87

89 antagonist. Similarly, in the co rtisol group, LV, RV, and septum thicknesses were approximately 20% thicker than control fetuses and the MR antagonist produced a 95%, 149%, and 114% reduction of this increase in thickness of the LV, RV, and septum respectively, whereas the GR antagonist group produced 63%, 110%, and 65% reductions of thickne ss. Overall, GR blockade was approximately half as effective as MR blocka de in inhibiting the increase in heart weight or wall thickness. The relative differences in effectiveness of MR and GR blockade are consistent with the expected relative binding of fetal cortisol at these receptors. The MR are higher affinity receptors with greater occupancy at low cor tisol concentrations (Reul & DeKloet 1985), and therefore a greater effect woul d be expected after blockade of these receptors. Based on the expected free fraction of cortisol in the fetuses, I calculate that the free cortisol concentrations would be approximately 0.8 nM in the control fetu ses and 1.9 nM in the fetuses of the cortisolinfused ewes. Based on previous studies of co rtisol binding at ovine MR and GR (Richards et al. 2003), I would predict that these free concen trations would result in approximately 65% occupancy of MR and 35% occupancy of GR in the control fetuses, and 85% occupancy of MR and 60% occupancy of GR in the cortisol-infused fe tuses. Thus, these levels would be expected to exert more effects via MR than via GR activation if both act at GRE to induce genes responsible for cardiac growth. It should be noted that mifipris tone is also an antagonist of the progesterone receptor (PR). In this study, circulating proge sterone levels were not measured, however, an increase in circulating progesterone levels would not be expected in response to cortisol manipulation, suggesting mifipristone infusion mo st likely resulted in blockade of baseline progesterone action in the fetal heart. While the relative expression le vels of PR have not been elucidated in the fetal

PAGE 88

90 heart, I would not expect PR antagonism to greatly affect heart growth si nce growth of the heart appears to be primarily stimulated by an increas e in plasma cortisol c oncentrations. It is possible, however, that blockade of PRs within the heart contri buted to the reduction in heart mass observed with mifipristone infusion in the cortisol + GRa group. Role of MR in Hypertrophy in the Adult Heart In adult rats the m ineralocort icoid receptor is thought to induce cardiac hypertrophy and fibrosis occurring in response to ischemia; system ic administration of MR blockers have been shown to reduce markers of inflammation and fi brosis in hearts of adult rats (Brilla et al. 1993; Fraccarollo et al. 2005; Sun et al. 2002). It has been established that in adult humans with severe heart failure, there is a reduc tion in the severity of cardi ac hypertrophy and an increase in survival rate after treatment w ith the MR receptor antagonists ep lenerone or spironolactone (Pitt et al. 1999; Pitt et al. 2001). The effect of MR blockers on survival rate appears to be the result of a decrease in cardiac fibrosis (Fraccarollo et al. 2004); increases in interstitial collagen content are a feature of adu lt cardiac hypert rophy (Pearlman et al. 1981), particularly in the case of hypertension or myocardial infarction (Young et al. 2007). The mechanism for the in vivo effect of MR in contributing to inflammation and subsequent fibrosis is not clear. It has been suggested that the effect is th rough a nongenomic action, and that the effect in ischemic tissue is predominately on vascular cells expressing MR, rather than on fibroblasts or on myocytes (Young et al. 2007; Mihailidou & Funder 2005). It is generally assumed that the protective effect of the MR antagonists resu lts from blocking the action of al dosterone at MR. It has been suggested, however, that many heart failure patient s without elevated plasma aldosterone levels still benefit from MR blockade, indicating aldoste rone may not be the only relevant MR ligand (Young et al. 2007). Since plasma cortisol concentr ations are much higher than aldosterone, and since there is not a significant amount of 11 -HSD2 expressed within the heart, it is

PAGE 89

91 reasonable to propose that cortisol may be playing a role in the fibrosis th at is observed in heart failure patients. In this study the effects of cor tisol do not appear to involve increase in fibrosis, as there was no increase in collagen content with maternal infusion of cortisol, nor were there any effects of either MR or GR blockade. This suggests that the mechanism of the enlargement of the fetal heart in the current study may be fundamentally different from what is observed in adult rat models or human pathology, in which is chemia is a contributing component. Mechanisms of Enlargement of the Fetal Heart Due to the unique ability of the fetal heart to grow through both hyperplasia and hypertrophy either mechanism could account for th e cortisol-induced increases in fetal heart weight and wall thickness in our model. In early gestation, cardiac growth is mostly a result of the production of new myocytes originating through cell divisi on and proliferation (Smolich 1995). After approximately day 115 of gestatio n in sheep, however, cardiac growth results primarily from increases in myocyte size (Jonker et al. 2007). Myocytes lose their ability to divide and proliferate shortly af ter birth in an event in which there is nuclear division without subsequent cell division (Oparil et al. 1984). In fetal sheep the number of terminally differentiated or binucleate myocytes increases from ~115 days of gestation through term, and heart growth during this peri od is due to both increases in myocyte size and myocyte proliferation (Jonker et al. 2007). Theoretically, cortisol could be stimulating growth through either hypertrophy or hyperplasia, or possibly even both. Rudolph et al. showed that cortisol (1.2 g min-1) infusion for 72-80 hours directly into the left coronary artery of the ovine fetus (124-131d) decreased left ventricular DNA content (Rudolph et al. 1999). This was interpreted as cortisol-induced inhi bition of myocyte proliferation in preparation for life after birth. The fetal blood pressures from that study were not

PAGE 90

92 reported. In a study by Lumbers et al high dose infusion of cortisol (72.1mg d-1 for ~60h) increased left ventricular myoc yte size and increase cardiac angiotensinogen mRNA (Lumbers et al. 2005), suggesting an inducti on of hypertrophy. However, there was also a significant increase in blood pressure in these fetuses, suggesting that the car diac hypertrophy may have resulted from elevated blood pressure. Conversely, maternal dexamethasone administration (48 g d-1 from E17) increased relative heart weight and increased myocyte prol iferation in the fetal and newborn rat heart (Torres et al. 1997). In agreement with this, Giraud et al. (Giraud et al. 2006) showed that subpressor doses of cortisol (0.5 g kg-1min-1 for 7 days) infused direct ly into the circumflex coronary artery of the fetus led to an increase in Ki-67 stained myocytes in both the left and right ventricles; as Ki-67 is expressed only in cells in the proliferative phase, this suggested that cortisol stimulated proliferation in these hearts. Hearts infused with cortisol weighed more than control hearts in this study, but there were no changes in myocyte size or percent binucleation. Interestingly, there were also no differences in aortic, right atrial systolic, and diastolic pressures between the groups. These studies suggest that elevated fetal cortisol con centrations directly stimulate cardiomyocyte proliferation in the late-term fetus. The current study does not provide direct evidence for cardi omyocyte proliferation as a means of cardiac enlargement in response to cortisol. It is important to note that in this study a subpressor dose of cortisol was used, as in the study by Giraud et al. (Giraud et al. 2006). I did not observe an increase arterial pr essure in response to the moderately elevated cortisol levels indicating that the fetal hearts in this study were not subjecte d to chronically increased systolic load, a possible trigger to myocyte hypertrophy s een in some other studies. Although in the present study blood pressure was only measured at 10 days of co rtisol infusion, a previous study

PAGE 91

93 in this laboratory (Jensen et al. 2005) showed fetal arterial blood pressure was not elevated at either 5 or 10 days of maternal cortisol infusion. The doses of cor tisol administered in the present study resulted in relatively small increases in fetal cortisol, well below those that have been shown to increase fetal blood pressure in other studies (Unno et al. 1999; Tangalakis et al. 1992; Wood et al. 1987). Furthermore, in this study I obser ved no evidence within the fetal heart in support of interstitial collagen deposition, a sy mptom of cardiac hypertrophy in response to hypertension within the adu lt human heart (Diez 2007). Conclusions The data sug gest that the enlargement of the fe tal heart in response to a modest and chronic rise in maternal cortisol levels is mediated by MR receptors, and to a lesser extent, GR receptors within the fetal heart. Intrapericardial infusion of an MR an tagonist completely prevented the increase in wall thickness and h eart weight. GR blockade wa s less effective, although GR blockade prevented the increase in RV free wall thickness, and tended to attenuate the increase in left ventricular wall thic kness and whole heart weight The cortisol-induced enlargement is not accompanied by an increase in inte rstitial collagen deposition with in the fetal heart. This indicates the possibility of a di fferent mechanism for the enlargement observed in the fetal heart than that observed in adult ca rdiac hypertrophy and fibrosis.

PAGE 92

94 Figure 4-1. Immunohistochemical localization of MR a nd GR in representative hearts from fetuses of control cortisol cortisol +MRa and cortis ol+GRa groups. All photos at 40x power.

PAGE 93

95 Figure 4-2. Fetal heart measur ements in response to manipulations. Mean fetal heart measurements from control (open bars), cort isol (solid bars), cortisol+MRa (diagonal striped bars) or cortisol+GRa (cross-hatched bars) groups taken at time of sacrifice: heart to body mass ratio (A), left ventri cular (LV) septal wall thickness, (B)wall thickness (C), and right vent ricular (D) wall thickness (lower left). Data are expressed as mean SEM. Horizontal lines between gr oups indicate differences are statistically significant, p< 0.05. D B A C

PAGE 94

96 Figure 4-3. Collagen staini ng of fetal hearts. Representative pictures showi ng picrosirus red staining of collagen in left ve ntricular wall of fetal hearts from the (A) control, (B) cortisol, (C) cortisol + MRa, and (D) cortisol + GRa groups; 40x power. Bar indicates 200um. Arrows indicate the dark staining corresponding to positive Sirius red staining.

PAGE 95

97 Table 4-1. Fetal and Maternal Cortisol concentrations (avera ge of days 5 and 10) and ACTH concentration on day 10. Maternal Cortisol (ng/ml) Fetal Cortisol (ng/ml) Maternal ACTH (pg/ml) Fetal ACTH (pg/ml) Control 5.9 1.4 1.5 0.6 37 8 36 8 Cortisol 9.6 2.3 2.7 0.5 20 1 27 5 Cortisol + MR antagonist 8.7 0.4 3.6 1.0 31 11 38 6 Cortisol +GR antagonist 8.3 1.5 3.9 1.9 21 1 57 33 Data are expressed as mean SEM.

PAGE 96

98 Table 4-2. Fetal blood gas and packed cell volume. Fetal PO2 (mmHg) Fetal PCO2 (mmHg) Fetal pH Fetal Packed cell Volume (%) Control 21.7 1.0 56 1 7.34 0.01 0.313 0.007 Cortisol 21.5 1.0 53 2 7.35 0.01 0.326 0.013 Cortisol + MR antagonist 20.7 1.1 54 2 7.30 0.03 0.348 0.007 Cortisol +GR antagonist 21.9 0.4 55 1 7.32 0.02 0.325 0.009 Data are expressed as mean SEM.

PAGE 97

99 Table 4-3. Fetal arterial pressu re and fetal heart rate on day 10. Fetal Arterial pressure (mmHg) Fetal Heart Rate (beats per minute) Control 47.5 2.7 170 6 Cortisol 46.9 2.7 168 11 Cortisol+MR antagonist 43.0. 0.9 172 4 Cortisol+GR antagonist 46.0 1.0 164 7 Data are expressed as mean SEM

PAGE 98

100 Table 4-4. Collagen content determined by picrosir ius red staining (fracti on of total area) in left ventricle (LV), righ t ventricle (RV), and septum. LV RV Septum Control .037 0.005 .039 0.004 .037 0.006 Cortisol .050 0.009 .057 0.009 .052 0.010 Cortisol + MR antagonist .049 0.011 .037 0.007 .043 0.008 Cortisol +GR antagonist .060 0.012 .058 0.013 .059 0.013 Data are expressed as mean SEM.

PAGE 99

101 CHAPTER 5 ANALYSIS OF PROLIFERATION MARKERS AND EXPRESSION LEVELS OF POTENTIAL GROWTH PROM OTER S WITHIN THE FETAL HEART Introduction Evidence from multiple studies has supported the idea that elevations in cortisol levels late in gestation induces cardiac enlargement of the ovine fetus (Reini et al. 2008, Giraud et al. 2007, Lumbers et al. 2005, Jensen et al. 2005). Whereas cardiac growth in early gestation is mostly a result of the production of new m yocytes originating th rough cell division and proliferation (Smolich et al. 1995), it has been demonstrated in sheep that hearts can grow by both cell hypertrophy and cell prol iferation throughout the last third of gestation (Jonker et al. 2007). The ability of myocytes to divide and proliferate, however, comes to an end shortly after birth in an event in which ther e is nuclear division without su bsequent cell division (Oparil et al. 1984). This means that cortisol could theore tically be stimulating growth through either hypertrophy or hyperplasia, or possibly even both. Lumbers et al. performed a study in which high dos e infusion of cortisol (72.1mg d-1 for ~60h) increased cardiac angioten sinogen mRNA and increased le ft ventricular myocyte size (Lumbers et al. 2005), suggesting an induction of hypert rophy. However, there was also a significant increase in blood pre ssure in these fetuses, impl ying the cardiac hypertrophy may have resulted from elevated blood pressure. Additionally, Rudolph et al. showed that left ventricular DNA content was decrea sed following cortisol (1.2 g min-1) infusion for 72-80 hours directly into the left coronary ar tery of the ovine fetus (124-131d; Rudolph et al. 1999). The interpretation of this study was that cortis ol functioned to induce inhibition of myocyte proliferation in preparation for life after birth. Conversely, maternal dexamethasone administration (48 g d-1 from E17) increased relative heart weight and increased myocyte prol iferation in the fetal and newborn rat (Torres et

PAGE 100

102 al. 1997). Furthermore, Giraud et al. showed that physiologically re levant doses of cortisol (0.5 g kg-1min-1 for 7 days) infused directly into the circumflex coronary artery of the fetus led to an increase in heart mass without an increase in bloo d pressure; it also led to an increase in Ki-67 stained myocytes in both the left and right ventricles (LV and RV) indicating cortisol stimulated proliferation in these hearts (Giraud et al. 2006). Previously in this laboratory, it was shown that fetal cardiac enlargement in response to chronically elevated maternal cortisol levels can be prevented by mine ralocorticoid receptor (MR) blockade, and diminished by glucocor ticoid receptor (GR) blockade (Reini et al. 2008). No change in blood pressure or cardiac collagen deposition was observed in the hearts exposed to elevated cortisol in that study, however, no di rect evidence for cell pr oliferation was obtained either. It has also been previously shown in th is laboratory that hearts enlarged from increased cortisol exposure exhibited a decrease in 11 hydroxysteroid dehydrogenase 2 (11 -HSD2) and insulin-like growth factor type 1 receptor (IGF1R) mRNA expression and also an increase the angiotensin type 2 recep tor (AT2R) to angiotensin type 1 receptor (AT1R) ratio of mRNA expression within the left ventricle (LV; Reini et al. 2006). However, whether these alterations in gene expression are negated with MR or GR blockade has yet to be determined. The purpose of this study was to investigate if fetal cardiac gr owth in response to elevated cortisol levels is due to increased cell proliferation, and to also de termine if expression levels of genes that are changed within the enlarged heart are still altered when co rtisol action at MR or GR is blocked. I hypothesized th at heart enlargement primarily occurred through an increase in cell proliferation and that the ch anges in LV gene expression observed in the enlarged hearts exposed to elevated cortisol levels would be prev ented in hearts where cortisol action at MR was blocked, and lessened in hearts where co rtisol binding at GR was prevented.

PAGE 101

103 Materials and Methods Experimental Design At the tim e of sacrifice dur ing a previous study (Reini et al. 2008), fetal hearts were fixed with 4% buffered paraformaldehyde for future immunohistochemical analyis and chunks of the LV were frozen in liquid nitrogen and then stor ed at -80C for RNA and protein analysis at a later time. In that study one group of ewes was treated with cortisol (1 mg/kg/day) between ~120-130 days of gestation (cortisol group), a s econd group of ewes was treated with the same amount of cortisol but fetal cardiac MR was ch ronically antagonized in this group (cortisol + MRa group), a third group contai ned ewes administered cortisol but fetal cardiac GR was chronically blocked in this gr oup (cortisol + GRa group), and a fourth group of ewes in which no maternal or fetal manipulations occured (cont rol group). Treatment with cortisol in the manner done in that study produces circulating cortisol levels that are within the range measured with mild maternal stress, but are also know n to induce fetal hear t enlargement (Jensen et al. 2005). Fetal arterial and venous catheters were pl aced at the time of surgery; blood pressure and heart rate was measured on day 130 of gestati on and maternal plasma ACTH and cortisol concentrations were measured in samples collected at ~125 and ~130 of gestation. Significant increases in fetal heart weight along with LV and RV increases in the fetuses from the cortisol group compared to those in the control group were reported in that study, but it was also observed that MR blockade preven ted the increase in relative hear t mass and hearts in that group contained significantly thinner LV s, RVs, and septums compared to the cortisol group (Reini et al. 2008). GR blockade lessened the increase in relative heart mass along with LV and septal thickening, and completely prevente d the increase in RV thickness.

PAGE 102

104 Immunohistochemistry To determ ine percentage of myocytes, Ki67 staining of heart sections from each animal was performed, as Ki67 is a protein only expresse d by cells in the S-phase of the cell cycle. Hearts were taken at the time of sacrifice (~ 130 days gestation) and fixed with 4% buffered paraformaldehyde. The hearts were dehydrated with increasing concentrations of reagent alcohol followed by xylene. The hearts we re then embedded in paraffin wax. Ten m sections were cut by a Zeiss rotary microtome and placed onto poly-l-lysine coated slides. Standard methods were used for deparaffinization a nd rehydration. Endogenous peroxide was then quenched using incubation in hydrogen peroxide (0.3%; Fisher Scientific, Fair Lawn, NJ). Antigen retrieval was performed by immersion in to sodium citrate buffer at 95 degrees for 30 minutes. The section was blocked for one hour w ith 5% non-fat dry milk in phosphate buffered saline (PBS), followed by anti-K i67 monoclonal antibody (dillute d 1:100 in blocking solution; Dako, Glostrup, Denmark) addition for overnight incubation at 4C, and incubation with biotinylated goat anti-mouse secondary antibody (Z ymed, San Francisco, CA) for one hour. As a tertiary agent, streptavidin-peroxidase (Z ymed, San Francisco, CA) was used and metal enhanced diaminobenzidine (DAB; Pierce) was us ed as the chromogen. Lastly, hematoxylin (Fisher Scientific) staini ng of the nuclei for 45 seconds was util ized in order to co-localize with the Ki67 staining. The stained sections were th en dehydrated and a cover-slip was mounted onto the section. All images were visualized using an Olym pus DP71 microscope and Olympus software, and pictures were taken at 40x for analysis. For each heart sample, six pictures were taken of each ventrcle; 3 in the middle of th e ventricle, and 3 in the inner ar ea of the ventricle. The nuclei from each picture were then counted along with the number of Ki67 positively stained nuclei. For each ventricle the percentage of Ki 67 stained nuclei was then calculated.

PAGE 103

105 Real-Time PCR RNA was extracted from left ventricles (LV) of each heart using RNeasy Plus Mini Kit (Qiagen Inc., Valencia Ca). Total RNA was measured spectrophotometrically to measure the quantity and quality of RNA. RNA was revers e transcribed into cDNA using a high capacity cDNA archive kit (Applied Biosystems; Foster Cit y, CA) and aliquots for cDNA were stored at 20oC until used. Qrt PCR was utilized to measured gene e xpression. The genes analyzed in this study were MR, GR, 11 -HSD1 and 2, IGF-1R, ATR1 and 2, gl ucose transporter 1 (GLUT1). All probe and primer sequences except for GLUT1 were based on previously published sequences: MR and GR (Keller-Wood et al. 2005), 11 HSD2, AT1R and AT2R (Dodic et al. 2002), and 11 HSD1 and IGF-1R (Reini et al. 2006). GLUT1 primers and pr obe were designed using Primer Express 2.0 (Applied Biosystems) based on an ovine sequence in the NCBI database (accession number U89029; base pairs 334-396). The forward primer, reverse primer, and probe used for GLUT1 were CTGCTCATTAACCGCAACGA, GGTCCCACGCAGCTTCTTC, and AGAACCGGGCCAAGAGCGTGC resp ectively. An ABI PRISM 7000 Sequence Detection System (Applied Biosystems) was used to carry out the qrt PCR reactions. Reactions were carried out using 20 or 100 ng of template cDNA. All genes were normalized to -actin mRNA. Western Blotting Immunoblot detection with antibodies to AT 1R (sc-579; Santa Cruz, Sant Cruz, CA), AT2R (a generous gift from Dr. Ian Bird, University of Wisconsin, Madison, WI), and proliferating cell nuclear antig en (PCNA; Santa Cruz; sc-7907) was performed on protein isolated from LVs of each of the hearts. Pr otein was isolated usi ng the DC Protein Assay (BioRad, Hercules, CA) and each sample was m easured spectrophotometrically to identify the quantity of protein present. For AT1R and AT2R, 105 g of protein was loaded into each well

PAGE 104

106 and separated by size using a 10% Tris-HCL gel (BioRad) by SDS-PAGE. The proteins were electrophoretically tr ansferred to 0.45-m nitrocellulose membranes for 1 hour at 100 V. The same was done for PCNA except only 30 g of protein was added to each well. Following protein separation, the membranes were washed on ce with tris-buffered saline with 0.5% Tween20 (TBST) and then stained with Ponceau S (Fisher Scientific) for normalization purposes. They were then washed again with TBST and left to dry until wetted with TBST the day of staining. On the day of staining, membranes were blocke d with 5% non-fat dried milk in TBST for two hours. Primary antibodies were then dillu ted in blocking solution (1:750 for AT1R, 1:2,000 for AT2R, and 1:500 for PCNA) and incubated with the blot overnight at 4C. After washing twice for 5 minutes in TBST, the membranes were incubated with peroxidase-linked secondary antibody (1:16,000; Sigma, St. Louis, MO; A0545) fo r one hour at room temperature. The blots were then washed with TBST and the bands we re visualized with a chemiluminescence kit (GE Healthcare, Buckinghamshire, UK) according to the manufacturer's directions. Films (Kodak Biomax XAR Film, Sigma) were developed an d bands were quantified using image analysis software (BioRad ChemiDoc XRS). Probing for th e AT2R followed stripping of the developed AT1R blot using stripping solution (2 % SDS, 62.5 mM Tris pH 6.8, and 100 mM mercaptoethanol) at 50C for 30 minutes. The membrane was then probed for AT2R using the same method as AT1R and PCNA. Data Analysis Changes in the percen tage of Ki67 positive nuc lei were calculated using two way analysis of variance in order to look for differences be tween the groups and between the middle and inner areas of the ventricle.

PAGE 105

107 Changes in gene expression among groups were analyzed by one-way analysis of variance (ANOVA) using the Ct values. For graphical purposes, fold changes of the genes were calculated using the expression 2^Ct in which Ct is the difference between Ct for the sample and mean Ct for the same gene in the control group (Livak et al. 2001). For ratio comparisons of 11 HSD1 and 11 HSD2, and AT1R and AT2R, Ct values were compared directly to the Ct values of the other gene without -actin normalization. Differences in protein expression were calcula ted by dividing the band density value by the total protein for that lane as measured by Ponceau S staining. Calculation of the AT1R to AT2R ratio was carried out by directly comparing band de nsities of each sample without normalizing to total protein. Results Immunohistochemistry The percentage of nuclei positively stained fo r Ki67 was increased in the cortisol group and cortisol + GRa group com pared to the other groups in the LV (Table 5-1; Figure 5-1). In the RV, only the cortisol group had significantly mo re Ki67 stained nuclei than the control and cortisol + MRa groups (Table 5-1). Real-Time PCR analysis Expression of MR, GR, 11 -HSD1, and 11 -HSD2 MR LV mRNA expression decreased in the cortisol + GRa group compared to control hearts while GR mRNA expres sion tended to the same. 11HSD1 mRNA expression did not change between the groups whereas 11HSD2 mRNA expression tended to go down in response to elevated cortisol, but this tendency was blocked with MR and GR antagonism. Also, the

PAGE 106

108 11HSD1 to 11HSD2 mRNA ratio tended to increase in the cortisol group compared to the other groups (Figure 5-2). Expression of IGF1R, AT1R, AT2R, and GLUT1 No differences in mRNA expression were observed between the groups in IGF1R, AT1R, or AT2R. The AT1R to AT2R mRNA ratio al so did not change. GLUT1 mRNA expression was similar in the control and cortisol groups but was significantly increa sed in the cortisol + MRa and cortisol + GRa groups (Figure 5-3). Western Blot Analysis Expression of PCNA PCNA protein expression in the LV did not change between the groups although there was a tendency for expression to be decreased in both the cortisol + MR a and cortisol + GRa groups (Figure 5-4). Expresssion of AT1R and AT2R AT1R protein expression in the LV was rela tively consistent between the groups whereas AT2R expression tended to decr ease in the cortiol group compared to the other groups. The AT1R to AT2R protein ratio tended to incr ease in the cortisol group (Figure 5-5). Discussion This study provides potential evidence that fetal heart enlargem ent in response to moderately eleva ted cortisol levels late in gestation may be due to an increase in myocyte proliferation, although the results are conflicti ng. Additionally, these results provide further confirmation that local RAS activity and decreasing 11 -HSD2 expression levels may be involved in the cardiac enlargement. This study al so shows that GLUT1 expression in the LV is unchanged by moderate increases in cortisol, but also indicates that basal cortisol activity at MR and at GR are required for proper GLUT1 expression.

PAGE 107

109 Cortisol Stimulation of Myocyte P roliferation Previously, this laboratory has shown that fetal cardiac enlarg ement results from chronically elevated cortisol levels (Jensen et al. 2005, Reini et al. 2008), but the method of enlargement has not been elucidated. At this point in gestation (~130d), the fetal heart has the unique ability to grow through both hyperplasia and hypertrophy (Jonker et al. 2007), so cortisol could be stimulating growth through either hyp ertrophy or hyperplasia, or possibly even both. The current study provides evidence for cardiomyocyte proliferation as a means of cardiac enlargement in response to cortisol. Ki67 is a protein only expressed by cells in the S-phase of the cell cycle and is therefore a marker of cell prolifera tion. Similar to what Giraud et al found (Giraud et al. 2006), I observed an increase in Ki67 staining in both the right and left ventricles of fetuses with cortisol infused mothers compared to the control and cortisol + MRa groups. I also observed an increase in Ki67 staining in LVs of the cortisol + GRa gr oup. Interestingly, this Ki67 pattern of expression closely resembles th e pattern of increases in ventricular wall thicknesses within these hearts with the LV exhibiting a significant increase in thickness in the cortisol group only when compared to the cont rol and cortisol + MRa groups, whereas the RV exhibited a thickness increase in the cortisol group compared to all other groups. It is also important to point out that the hearts in this study were merely exposed to a subpressor dose of cortisol and were not subjected to an increase ar terial pressure or an increase in cardiac fibrosis, suggesting hypertrophy may not be involved. This is similar to the findings of Giraud et al. in which hearts infused with cortisol weighed more than control hearts due to an increase in myocyte proliferation, but no differences in aortic, righ t atrial, systolic and diastolic pressures were observed between the groups. Th e studies that implic ate hypertrophy as the method of enlargement seem to involve larg er, more acute doses of cortisol (Rudolph et al. 1999,

PAGE 108

110 Lumbers et al. 2005). With this in mind, it is interes ting to speculate that the mechanism of enlargement may differ based on deli very method, amount, and duration. In contrast to the Ki67 staini ng results, quantification of PC NA protein in the LV was not suggestive of an increase in proliferation accoun ting for the increase in ventricular thickness in response to elevated cortisol. No significant difference was obser ved in PCNA expression between the groups, but expression did tend to decrease in both the cortisol + MRa group and the cortisol + GRa group. One explanation for the cont radiction is that Ki67 staining may be a more dependable marker of proliferation than quantifi cation of PCNA expression. It has been reported that PCNA is more abundant and potentially less specific to the cell cycle when compared to KI67 in the same tissue (Ekramullah et al. 1996, Aoyagi et al. 1995, Dierendonck et al. 1991). It is also possible that western blot may not be sensitive enough to eluc idate differences in expression when only ~1-2% of the total num ber of cells are in the cell cycle. Expression of IGF1R, AT1R, and AT2R Both IGF2 and IGF1 have been shown to stim ulate myocyte proliferation in vitro. Liu et al. found that IGF2 stimulated an increase in pro liferation of prenatal ra t myocyte cultures, but did not stimulate proliferation in neonatal myocytes (Liu et al. 1996). Similarly, it was shown in a previous study that infusion of an IGF1 anal og into fetal sheep at 124d gestation results in decreased numbers of binucleated cells, but increased percentage s of monucleated myocytes; and it was also demonstrated that IG F1 administration in cultured fetal cardiomyocytes stimulated proliferation of the myocytes mediated by ERK and PI3K (Sundgren et al. 2003). Previously in this laboratory it was shown that IGF1R mRNA e xpression decreased in response to elevated maternal cortisol late in gestation (Reini et al. 2006). Because both IGF1 and IGF2 act via binding at IGF1R in vivo we interpreted the decrease in IG F1R mRNA expression in response to

PAGE 109

111 elevated cortisol as a mechanism to limit grow th following cardiac enlargement. However, IGF1R mRNA expression was not decrea sed in the LV in this study. We also observed an increase in the AT2R to AT1R mRNA ratio in a previous study (Reini et al. 2006). In the ovine fetus, angiotensin II ha s been implicated in stimulating growth of the heart. Segar et al. showed that infusion of angioten sin II into fetal sheep stimulates left ventricular growth (Segar et al. 2001), and Sundgren et al. demonstrated in cultures of ovine fetal cardiomyocytes that angiotensin II stimulates hyperplastic growth (Sundgren et al. 2003). Furthermore, Lumbers et al. demonstrated that high-dose infusion of cortisol into the ovine fetus (72.1mg d-1 for ~60h) increased cardiac angiotensinogen mRNA (Lumbers et al. 2005). In the adult heart, the AT1Rs are thought to be responsible for hypertr ophic effects, while actions at AT2R are hypothesized to counteract the AT1R (Booz et al. 2004, Zhu et al. 2003). We therefore reasoned that the increase in the AT 2R to AT1R ratio observed previously was a response to slow growth in the hearts exposed to elevated cortisol (Reini et al. 2006). However, we did not observe a change in receptor mRNA ra tio in this study. A possible explanation for the lack of change in the AT1R to AT2R ratio, along with the lack of change in IGF1R expression, is that the cortisol hearts experienced a greater incr ease in mass in the previous study (~25%; Jensen et al. 2005) than did the cortisol h earts from this study (~13%; Reini et al. 2008), making it possible that the greater increase in ma ss is necessary for changes in expression of these genes. Interestingly, western blot revealed a tendenc y for AT2R protein to be decreased in the cortisol group while the AT1R to AT2R protein ratio tended to increase in the cortisol group. The pattern of protein expressi on is opposite of the observation regarding mRNA expression of the angiotensin receptors from an earlier study in this laboratory (Reini et al. 2006). The

PAGE 110

112 discrepancy between mRNA and prot ein could possibly be due to an attempt by the myocytes to slow heart enlargement by transcribing genes that discourage growth wh en expression of progrowth proteins are elevated. Analysis of wester n blot results suggest cortisol may be increasing the pro-growth action of the RAS within the hear t by changing the receptor ratio in order to favor growth. Expression of MR, GR, 11 HSD1, and 11 HSD2 Cortisosteroid receptors have been implicat ed in both fetal and adult forms of cardiac enlargement. It has been shown previously that MRs, and to a lesser extent GRs, in the heart may play a primary role in cortisol-induced fetal cardiac enlargement (Reini et al. 2008). Similarly, it has been established that treatment with the MR receptor antagonists eplenerone or spironolactone leads to a reduction in the severi ty of cardiac hypertrophy and an increase in survival rate in adult humans with severe heart failure (Pitt et al. 1999, Pitt et al. 2001). Whereas MR has been shown to mediate an increase infl ammation markers and cardiac fibrosis in the adult hypertrophied he arts (Fraccarollo et al. 2004, Brilla et al. 1993, Fraccarollo et al. 2005, Sun et al. 2002), MR and GR-mediated fetal cardiac en largement caused by elevated cortisol is not accompanied by an increase in fibrosis (Reini et al. 2008). This suggests the mechanism of enlargement in the fetal heart may be fundamentally di fferent from what is observed in adults. Interestingly, this study provides further eviden ce that sub-pressor el evations in cortisol may lead to increased exposure of MR and GR to cortisol. I found th at hearts exposed to elevated cortisol exhibited a tendency for reduction in 11HSD2 mRNA expression in the LV, but this tendency is blocked with MR and GR antagonism. This is important because one of the major factors influencing the ability of cortisol to activate MR and/or GR is the local activity of the 11hydroxysteroid dehydr ogenase enzymes, 11 -HSD1 and 11 -HSD2. 11 -HSD1 primarily

PAGE 111

113 converts cortisone into cortisol, while 11 -HSD2 converts cortisol in to cortisone, which is inactive at MR and GR (Krozowski et al. 1999). Additionally, I found that the 11HSD1 to 11HSD2 mRNA ratio tended to increase in the cort isol group compared to the other groups. I also observed that elevated cortisol had no eff ect on MR or GR expression, but I did find that MR mRNA expression decreased in the cortisol + GRa group compared to control hearts while GR mRNA expression tended to the same. This sugge sts that inhibition of cortisol binding at MR or GR in the heart reduces tran scription of GRs in fetal myocyt es. These findings agree with a previous study in which it was obs erved that elevated maternal co rtisol levels did not alter LV mRNA expression of MR, GR, and 11 HSD1, but caused a decrease in 11 HSD2 expression (Reini, 2006). Expression of GLUT1 GLUT1 is thought to be responsible for ba sal glucose uptake in cardiac myocytes. In rats, it was determ ined that the embryonic heart is rich in GLUT1 mRNA wh ereas the adult heart contains predominantly GLUT4 mRNA, making it appear as though the major type of glucose transporter in rat heart switches from GLUT1 to GLUT4 during development (Wang et al. 1991). In adult rat myocytes, it was discovered via immunogold labelling that GLUT1 is predominantly (76%) localized in the capillary endothelial cells with only 24% of tota l cardiac GLUT1 present in myocytes, suggesting a potential role in transporting glucose across the capillary wall before myocyte uptake via GLUT1 (Davey et al. 2007). Glucose metabolism is thought to be very important in hearts that have suffered an ischem ic event. In rats with a large myocardial infarction, progression from compensated remodeling to overt heart failure is associated with upregulation of GLUT1 (Rosenblatt-Velin et al. 2001). Interestingly, there is evidence to support glucocorticoid regulation of GLUT1 expre ssion in both skeletal and cardiac muscle in

PAGE 112

114 the ovine fetus. Maternal antenatal dexameth asone (GR agonist) treatment given as a single course (4 doses), or multiple courses (20 doses), increased GLUT 1 protein concentrations in fetal skeletal muscle at 1 06 or 107 days gestation (Gray et al. 2006). Conversely, infusion of high doses of cortisol directly in to the ovine fetus in late gest ation decreased levels of GLUT1 mRNA in the fetal LV (Lumbers et al. 2005). The present study found that mRNA expression of GLUT1 did not change in the cortisol hearts compared to controls, but did increase significantly in both the cortisol + MRa group and the cortisol + GRa group. These results imply that modest increases in cortisol have no effect on GLUT1 ex pression within the fetal heart, but also that basal amounts of cortisol action at both MR and GR are requir ed for proper GLUT1 expression within the fetal heart. An interesting observation is that dramatic increases in cortisol action at MRs and GRs in the fetal heart, such as in the study by Lumbers et al. (Lumbers et al. 2005), leads to decreased GLUT1 mRNA e xpression in the LV whereas comp lete blockade of cortisol action at MR or GR results in increased GLUT 1 mRNA expression in the LV according to this study, suggesting cortisol action at MRs and GRs in the fetal myoc ytes directly regulates GLUT1 mRNA expression in the LV. In conclusion, I observed an increase in the pe rcentage of myocytes positively stained for Ki67 in the LV and RV of hearts from the cortisol group, suggesting myocyt e proliferation is at least partially accountable for the cardiac enlargement in response to elevated cortisol. Quantification of PCNA via western blot, however, did not support this conc lusion. I found that the ratio of AT1R to AT2R pr otein expression tended to increas e in the LV with elevated cortisol, indicating a rela tive increase in angiotensin II action at the AT1R, which is thought to be the more growth-friendly recept or. I also observed a trend for 11HSD2 mRNA expression to decrease in the LVs of the cortisol group, but this decrease does not occur with MR or GR

PAGE 113

115 blockade in the heart. Lastl y, I found that basal cortisol acti on at MRs and GRs may be required for proper maintenance of GLUT1 expression within the LV.

PAGE 114

116 Figure 5-1. Immunohistochemical localization of Ki67 in representative hearts from fetuses of control (A), cortisol (B), cortisol +MRa (C) and cortisol+GRa (D) groups. All photos at 10x power. D B A C

PAGE 115

117 Figure 5-2. Gene expression of co rticosteroid receptors and 11 -HSDs in the LV. Expression of mRNA for MR (A), GR (B), 11 -HSD1 (C), and 11 -HSD2 (D) in left ventricles from fetuses of the control, cortisol, cort isol + MRa, and cortisol + GRa groups. The ratio of 11 -HSD1 to 11 -HSD2 mRNAs in left ventricles from each group are shown in panel E. Fold changes of the genes were calculated using the expression 2^Ct with respect to the control group and are expressed as mean fold change SEM. *p<0.05 vs control Fold Change Relative to Control 0 1 2 3 4 5 6 Fold Change Relative to Control 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Fold Change Relative to Control 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 Fold Change Relative to Control 0 1 2 3 4 5 6 7 8 Fold Change Relative to Control 0.0 0.5 1.0 1.5 2.0 2.5 Cortisol Control Cort+ MRa Cort + GRa Cortisol Control Cort+ MRa Cort + GRa A B C D E

PAGE 116

118 Figure 5-3. Gene expression of angiotensin receptors, IGF1 R, and GLUT1 in the LV. Expression of mRNA for AT1R (A), AT2R (B), IGF1R (D), and GLUT1 (E) in left ventricles from fetuses of the control, cortisol, cortisol + MRa, and cortisol + GRa groups. Data are expressed as fold changes as in Figure 5-2. The ratio of AT1R to AT2R mRNAs in left ventricles from each group are shown in panel C. *p<0.05 vs control Fold Change Relatvive to Control 0.0 0.5 1.0 1.5 2.0 2.5 Fold Change Relative to Control 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Fold Change Relative to Control 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Fold Change Relative to Control 0 1 2 3 4 Fold Change Relative to Control 0.0 0.5 1.0 1.5 2.0 2.5 B Control Cortisol Cort+ MRa Cort + GRa Control Cortisol Cort+ MRa Cort + GRa A C D E *

PAGE 117

119 Protein Band Density/Total Protein 0.000 0.002 0.004 0.006 0.008 B Cont Cont Cont Cort Cort MRa MRa MRa GRa GRa Spleen (+ control) Figure 5-4. Protein expression of PCNA (A; 36 kDa) in control, cortisol, cortisol + MRa, and cortisol + GRa groups in LV. Representative bands are shown in panel B. Band density is normalized to total protein. Values are represented as mean SEM. Control Cortisol Cort + MRa Cort + GRa A

PAGE 118

120 D Cont Cort MRa GRa Cont Cort MRa GRa Cont Cort MRa E cont cort MRa GRa Cont Cort MRa GRa Cont MRa Control Cortisol Cort+ MRa Cort + GRa Figure 5-5. Protein expre ssion of AT1R (67 kDa; A) and AT2R (68 kDa; B) in control, cortisol, cortisol + MRa, and cortisol + GRa groups Band density is normalized to total protein. The ratio of AT1R to AT2R protei n expression in each group is shown in the panel C. Representative bands are shown for AT1R (D) and AT2R (E). Values are represented as mean SEM. Protein Density/Total Protein 0.00 0.02 0.04 0.06 0.08 Band Density/Total Protein 0.00 0.05 0.10 0.15 0.20 Band Density Ratio 0 2 4 6 8 10 12 14 16 18 20 C B A

PAGE 119

121 Table 5-1. Percentage of nuclei positivel y stained for Ki67 in the LV and RV. Control Cortisol Cortisol + MRa Cortisol + GRa LV 0.9 0.10 1.6 0.19*# 0.9 0.09 1.5 0.4*# RV 1.0 0.08 1.5 0.18*# 1.0 0.12 1.3 0.23 Data are expressed as mean SEM. indicates significance compared to control, # indicates significance compared to cortisol + MRa.

PAGE 120

122 CHAPTER 6 SUMMARY Cardiovascular disease is one of the most chal lenging health concerns in the modern era. Mortality data from the year 2005 indicates cardiovascular disease contributes to 1 of every 2.8 deaths, and 1 death every 37 seconds, within the United States (Rosamond et al. 2008). There are many factors contributing to these stagge ring statistic including obesity, blood pressure, glucose tolerance, and lipid profile Many of these factors can be attributed lifestyle and genetic predisposition; however we now know fetal growth and nutrition can also be a strong predictor of many of these risk factors for CVD (Roseboom et al. 2001). It is interesting that recent evidence has implicated overexposure of the fetus to glucocorticoids as having similar effects in predisposing the offspring to increased CVD risk later in life, a situation often referred to as programming (aghajafari et al. 2002, Newnham et al. 2001, Walfisch et al. 2001, Banks et al. 1999, French et al. 1999). Increased cortisol exposure to the fetus can happen in several ways including increased maternal stress, a natural ove r-production as seen in Cushings disease, and administration of synthetic glucocorticoids duri ng premature labor. While we are beginning to understand the initial causes of programming and its consequen ces, very little is understood about the direct effects of cortisol overexposur e on organ development. Understanding the role of cortisol in organ maturation could give valuable insight into the mechanisms behind programming and lead to future prevention and treatments. Since different organs go through different developmental stages at different time s, timing and duration of the increased exposure probably affects each organ differently. This dissertation focused on the importance maintaining proper cortisol levels late in gestation has on fetal heart development. Fetal secretion of cortisol increases exponentially before birth in humans and in sheep (Liggins et al. 1974), and induces maturation of intestine (Galand et al. 1989, Arsenalt et al.

PAGE 121

123 1985), lung (Ballard et al. 1996, Liggins et al. 1972) and liver (Fowden et al. 1993, Fowden et al. 1995). Studies conducted previous to the studies here suggested that he art mass can be altered by small increases in fetal cortisol (Jensen et al. 2002, Jensen et al. 2005), indicating possible action of cortisol at MR and/or GR in fetal myocytes. The experiments outlined in chapter 2 were designed quantify expression of genes in the LV, from a previous study in the laboratory (Jensen et al. 2005), potentially involved in stimulati ng growth of the heart in response to moderately elevated maternal cortisol late in gestation (1mg/kg/day infusion between ~120-130 days). I found an increase in the AT2R to AT1R mRNA ra tio, indicating the RAS as an important contributor in the heart enlargement. I also observed a de crease in IGF1R mRNA expression in enlarged hearts. Since IGF1R is the primary ligand responsible for pro-growth effects of both IGF1 and IGF2, this indicated cort isol may regulate IGF action within the heart in a negative matter as is seen within skeletal muscle (Li et al. 2002). The most interesting observation from that study is that while MR, GR, and 11 -HSD1 were all found to be very abundant in mRNA expressi on within the heart, 11 -HSD2 mRNA decreased in its already very low expression within the LV in response to the elev ated cortisol. This suggested cortisol is able exert direct actions on MR and GR within the developing heart in late gest ation and that cortisol action increases in the heart in an elevated cortisol environment not only due to extra circulating cortisol, but also due to a decrease in conversion of cortisol into inactive cortisone within the heart. Furthermore, immunohistochemical staining showed that MR, GR, and 11 -HSD1 are all abundantly expressed in both myocytes and bloo d vessels within the fetal heart at 128 days gestation while 11 -HSD2 is primarily only expressed in bl ood vessels within the heart at this time, further indicating the ability of cortisol to act directly on corticosteroid receptors within myocytes at this time.

PAGE 122

124 Since I found MR, GR, 11 -HSD 1 and 2, along with comp onents of the RAS and IGF family to be important factors in determini ng proper heart growth in the study conducted in chapter 2, my next study outlined in chapter 3 focused on determining the ontogeny of each of these genes throughout late gestation and early po stnatal life in both the LV and RV. This allowed me to look at ventricl e specific alterations in gene expression. Interestingly, I found evidence for the RAS being an important influencer of heart growth in late gestation. While there were no significant overall patterns of change in expression of a ngiotensinogen mRNA in LV or RV, ACE1 mRNA increas ed ~ 5-fold in the LV and RV at term. ACE2 mRNA expression, on the other hand, si gnificantly decreased in the LV by 120 days gestation and remained low, while expression in RV did not significantly change. The ACE1 to ACE2 mRNA ratio increased ~15-fold by 145 days gestation co mpared to 80 days in both the LV and RV, suggesting that local angiotensin II production may be associated w ith the terminal maturation of the myocytes in preparation for life outside of the womb. The local mRNA expression of the receptors of angiotensin II did not change dram atically in either ventricle, but AT1R mRNA expression did decrease slightly in the LV in conjunction with the rise of ACE1 mRNA around the time of parturition, suggesti ng a possible response to increased local angiotensin II levels. These findings also suggest that the enzymes responsible for angiotensin II production may be the primary modulators of the RAS in late gestation and early postnatal life rather than the precursor protein, angiotensinogen, or the receptors for angiotensin II. The IGF family members also exhibit an ex pression pattern consis tent with modulating growth of the heart in late gestation. LV IGF1 mRNA expressi on did not significantly change throughout late gestation or neonatally in either ventricle. IGF2 mR NA and IGF2R mRNA were decreased in both the LV and RV after 120-130 days and remained low postnatally. As a result

PAGE 123

125 of the decrease in IGF2 mRNA, the ratio of IGF2 to IGF1 mRNA decreases near term and postnatally in both ventricles. This is inte resting because IGF2 and IGF1 both appear to stimulate myocyte proliferation (Liu et al. 1996, Sundgren et al. 2003). The dramatic decrease in IGF2 mRNA from day 120 of gestation to parturition in both LV and RV parallels the reduction in mononuclear myocytes in both ventricles (Jonker et al. 2007). It is interesting to speculate that IGF2 may play a role in m ononuclear myocyte proliferation, accounting for the gradual decrease in proliferation observed throughout the last third of gestation as IGF2 mRNA expression within the heart decreases. IGF1R mRNA levels are also decreased in the left ventricle by 120 days gestation a nd maintained that lower level of expression through birth. Because in vivo pro-growth actions of IGF1 and IGF2 are primarily mediated by IGF1R, the decrease in IGF1R mRNA expression may limit th e proliferative effects of both IGFs as the heart matures. Strong evidence for cortisol influencing heart growth throughout all of late gestation was also observed in the studies outlined in chapter 3. I found that MR mRNA was highly expressed at all points in both ventricles but expression is greatest in feta l LV at 80d and is significantly decreased at 130 days of gestati on and in newborns. GR mRNA wa s also highly expressed at all points in both ventricles but is highest in the LV at 80d a nd decreased at 120, 130 d and in the newborn LV. I found 11 -HSD1 mRNA expression in the LV was significantly decreased at 120 days gestation compared to 80 days and 145 days gestation while 11 -HSD2 mRNA expression in LV did not change throughout gestation. However, in the RV 11 -HSD1 and 11 HSD2 mRNA expressions were highes t in the newborns. The ratio of 11 -HSD1 to 11 -HSD2 expression was unchanged throughout the ages studied in LV and was significantly decreased in the RV at 145 days compared to 100 days gestation, but at all points 11 -HSD1 expression was

PAGE 124

126 far more abundant to 11 -HSD2. It is important to note that th e ability of cortis ol to bind at MR and/or GR depends in large part on the activity of 11 -HSD1 relative to 11 HSD2 (Mihailidou 2005; Seckl 2001). The maintenance of high 11 -HSD1 mRNA expression relative to 11 HSD2 mRNA expression within both ventricles of the heart throughout al l of late gestation indicates a significant role for cortisol within the heart in the late gestation fetus. However, the decrease in MR and GR mRNA ex pression as plasma cortisol c oncentrations are increasing in vivo suggests that proliferative eff ects of cortisol may be reduced in left ventricle as the heart matures. With evidence that cortisol has access to both MR and GR within the fetal heart, it was reasonable to hypothesize that when plasma cortisol levels are incr eased, action of cortisol at MR and GR in the heart would also increase. The pu rpose the experiments outlined in chapter 4 were designed to elucidate whether cort icosteroid receptors mediate the enlargement of the fetal heart in response to elevated cortisol levels late in gestation. I also know, however, that MR is a higher affinity receptors with greater occupancy at low cortisol concentrations (Reul et al. 1985). I therefore reasoned that a greater effect may be expected with blockade of the MRs as compared to blockade of GRs. In order to elucidate if the cardiac enlarg ement is mediated by either MRs or GRs, I designed an experiment in which we were able to block MRs and GRs within the fetal heart through administration of specific antagonists into the pericardial space while maternally infusing sub-presser doses of cortisol (1mg/kg/da y). This study also involved examination of fetal hearts not administered corticosteroid blockers from maternal ewes that were either infused with cortisol (1mg/kg/day) or not infused with co rtisol. As expected from findings in a previous study in this laboratory relative fetal heart mass, LV wall thickne ss, and RV wall thickness were

PAGE 125

127 all increased in the high cortisol group as comp ared to controls despite no differences between any of the four groups in mean arterial pressure or heart rate. Interestingly, blockade of the MR within the heart resulted in complete negation of the increase in relative heart mass while GR blockade tended to decrease the enlargement. Furthermore, LV, RV, and septal thicknesses were significantly decreased in the gr oup receiving cardiac MR antagonism compared with the cortisol group. GR blockade resulted in a significant reduction in RV wall thickness along with a tendency for reduction in LV wall thickness and sept al thickness compared to the cortisol group. These results are consistent with our hypothesis that suggests cortis ol acts directly on MRs, and to a lesser extent GRs, within the fetal heart to stimulate growth. Within the studies in chapter 4, I also wanted to examine whether fetal cardiac enlargement stimulated by increased cortisol levels is accomp anied by an increase in cardiac fibrosis. This is interesting because cardiac MRs have been implicated as playing a role in remodeling of the heart after injury or during heart failure in adu lt animals and humans. For instance, in adult rats evidence exists that the mineralocorticoid r eceptor induces cardiac hypertrophy and fibrosis occurring in response to ischemia while systemic administration of MR blockers reduce markers of inflammation and cardiac fibrosis (Brilla et al. 1993, Fraccarollo et al. 2005, Sun et al. 2002). It has been established in adu lt humans with severe heart failure that treatment with the MR receptor antagonists eplenerone or spironolacton e reduces the severity of cardiac hypertrophy and increases the survival rate (Pitt et al. 1999, Pitt et al. 2001). While increases in interstitial collagen content are a feature of adult cardiac hypertrophy (Pearlman et al. 1981), particularly in the case of hypertension or myocardial infarction (Young et al. 2007), the effect of MR blockers on survival rate appears to be the result of a decrease in cardiac fibrosis (Fraccarollo et al. 2004). This suggests the possibility that cortisol-induced enlargement of the fetal heart may be similar

PAGE 126

128 to that seen in adult cardiac injury. My studi es indicate, however, that there was no increase in collagen content with maternal infusion of cortisol nor were there any effects of either MR or GR blockade. This suggests that the mechanism of the enlargem ent of the fetal heart may be fundamentally different from what is observed in adult rat models or human pathology, in which ischemia is a contributing component. In the last set of studies detailed in chapte r 5, I wanted to further elucidate the mechanism by which cortisol induces fetal he art enlargement. In early gestation, cell proliferation is the main stimulus of cardiac growth (Smolich et al. 1995). It is known, how ever, that there is a pronounced increase in fetal hear t growth in the last third of gestation, paralleling a similar exponential growth of the fetus. At the same time as the heart is increasi ng in both total weight and left and right ventricle wall mass, an increasi ng number of myocytes terminally differentiate. Binucleate or multinucleate myocytes are a result of this process and cells experiencing this are unable to undergo further cell division (Burrell et al. 2003, Jonker et al. 2007). In fetal sheep the number of binucleate myocytes increases fr om ~115 days of gestation through term, and heart growth during this period is due to both increases in myoc yte proliferation and cell size (Jonker et al. 2007). This means that cortisol-in duced fetal heart en largement occurring between ~120 and ~130 days gestation could be accounted for by either hypertrophy or hyperplasia, or possibly even bot h. Since no difference in blood pressure or fi brosis staining between the groups had been observed, I hypothesized that cardiac growth was primarily due to cell proliferation. In order to investig ate this I decided to stain for Ki 67 (only expressed in the nuclei of proliferating cells) in heart sections from each of the experimental groups. I found a higher percentage of positively stained nuclei in both the LV and the RV of the cortisol group compared

PAGE 127

129 to control and cortisol + MRa hearts. I also observed a higher percentage of cells stained in the LV of the cortisol + GRa hearts compared to c ontrols and cortisol + MRa hearts. These results indicate cell proliferation as a mode of cardiac enlargement in re sponse to elevated cortisol. However, I found no change between the groups in protein expression of PCNA, another marker of cell proliferation, via western blot. One possible explanation fo r this contradicting result is that western blot may not be sensitive enough to elucidate differences in expression when only ~1-2% of the total number of cells are in the cell cycl e. Another explanation is that PCNA has been observed to be generally more abundant and less specific to the cell cycle when compared to Ki67 in the same tissue, suggesting Ki67 staining may be more dependable when the percentage of cells in the cell cycle is low (Ekramullah et al. 2005, Aoyagi et al. 1995, Dierendonck et al. 1991). In this study, I also wanted to examine the expression of genes and proteins known to be potentially important in fetal cardiac enlargem ent. MR mRNA expression decreased in the cortisol + GRa group compared to control hear ts while GR mRNA expression tended to the same. This suggests that cardiac -specific inhibition of cortisol binding at MR or GR reduces the synthesis of GR transcripts being manufactured in fetal myocytes. 11HSD2 mRNA expression tended to go down in the LV in response to elevat ed cortisol, but this te ndency was blocked with MR and GR antagonism. This result agrees with what was observed in Chapter 2 where 11HSD2 decreased in the LV in th e high cortisol group. Also, the 11HSD1 to 11HSD2 mRNA ratio tends to increase in the cortisol group compared to the other groups. This further indicates that exposure of MR and GR to cort isol may increase in re sponse to sub-pressor increases in cortisol, but this increase appears to be negated with MR or GR blockade.

PAGE 128

130 IGF1R mRNA expression did not decrease nor did the AT 2R to AT1R mRNA ratio increase in the LV of the elevated cortisol gr oup in this study as they did in Chapter 2. The reason for examining these genes was to see if the decrease in IGF1R mRNA and increase in the AT2R to AT1R mRNA ratio seen in the Chapte r 2 study was negated by MR and GR blockade, and so I was not anticipating observing no change between control LV e xpression and cortisol LV expression of these genes. This could be due to the fact that the cortisol hearts from the study in Chapter 2 experienced a grea ter increase in mass (~25%; Jensen et al. 2005) than did the cortisol hearts from this study (~13%; Reini et al. 2008), making it possibl e that the greater increase in mass is necessary for changes in expression of these genes. Interestingly, the AT1R to AT2R protein ratio tended to increase in the cortisol group. While this does not match with the mRNA expression of the same study, and is the opposite trend of what was observed in the mRNA expre ssion study in Chapter 2, this indicates that cortisol may be increasing the pro-growth action of the RAS within th e heart by changing the receptor ratio in order to favor growth. Previous ly, the AT1R has been implicated in mediating proliferation of vascular smooth muscle cells (Kohno et al. 2000), so it is possi ble that the AT1R is mediating hyperplastic growth of the fetal heart is situations of elevated elevated cortisol. This study also underscores the importance of interp reting the physiologic consequences of mRNA expression increases and decreases with caution b ecause it is not always reflective of protein expression. Whereas AT1 and AT2 receptor mRNA increases are often indicative of similar increases in protein expression in the heart, such as in cases of hypothyroidism in rats (CarneiroRamos et al. 2008), this study shows this is not always the case and that post-transcriptional modifications and protein turnover rates are also a major fact or in determining physiologic outcomes.

PAGE 129

131 Lastly, I found that mRNA expre ssion of GLUT1 did not change in the cortisol hearts compared to controls, but did increase significantly in both the cortisol + MRa group and the cortisol + GRa group. This implies that moderate increases in cortisol have no effect on GLUT1 expression within the fetal heart, but it also implies that basal amounts of cortisol action at both MR and GR are required fo r proper GLUT1 expression. The studies within this disserta tion have added important insight s to the field of fetal heart development and they have specif ically investigated and provided potential mechanisms for fetal heart enlargement as a consequence of elevated cortisol exposure. Specifically, these studies have provided evidence that cardiac enlargement in response to elevated cortisol levels is corticosteroid mediated, leads to increased activity of the RAS a nd decreased activity of the IGF family, and is in part due to an increase in cell proliferation (Figure 6-1). These insights, however, have larger implications and lead to some important questions. Questions like: if cortisol-induced fetal cardiac enlargement is due to an increase in cell proliferation as the Ki67 staining evidence suggests, is th e heart enlargement n ecessarily a negative consequence? Or could obtaining an increased number of myocytes be beneficial? And since evidence here indicates the heart enlargement is corticosteroid mediated, should better, more lung-specific, methods of administration of synthetic glucocorticoid s be considered for cases of pre-term labor? Also, does fetal heart enlargement induced by elevat ed cortisol levels co ntribute to programming for cardiovascular disease later in life, or are the negative consequences of programming limited to other organs and not related to heart devel opment? These are all important questions for scientists studying fetal heart development to keep in mind, and answering these questions could go a long ways towards reducing the risk for cardi ovascular disease in in dividuals before even the first breath of life is taken.

PAGE 130

132 Figure 6-1. Effects of elevated co rtisol on fetal heart growth. Co rtisol acts directly on MR and GR in the heart to stimulate cardiac gr owth by cell proliferation, which may be mediated by local increases in angiotensin II action at AT1R. Cortisol action in the fetal heart 11HSD2 and cortisol action at MR and GR (-) IGF-mediated growth (+) Angiotensin II action at AT1R (+) Cardiac growth by cell proliferation (No effect) Cardiac hypertrophy and angiogenesis (+?)

PAGE 131

133 LIST OF REFERENCES Adler CP 1975 Relationship between deoxyribonuclei c acid content and nucl eoli in hum an heart muscle cells and estimation of cell number during cardiac growth and hyperfunction. Recent Advances in Studies on Cardiac Structure and Metabolism 8 373. Aghajafari F, Murphy K, Matthews S, Olson A, Amankwah K, and Hammah M 2002 Repeated doses of antenatal corticosteroids in animals: A systematic review. American Journal of Obstetrics Gynecology 186 843. Amato, G., Carella, C., Fazio, S. & La Montagna, G., Cittadini, A., Sabatini, D., Marciano-Mone, C., Sacc, L. & Bellastella, A 1993 Body composition, bone metabolism, and heart structure and function in growth hormone (GH) deficient adults before and after GH replacement therapy at low dose Journal of Clinical Endocrinology and Metabolism 77 1671. Anderson KM, Berrebi-Bertrand I, Kirkpatric k RB, McQueney MS, Underwood DC, Rouanet S 1999 cDNA sequence and characterization of the gene that encodes human myotrophin/V-1 protein, a mediator of cardiac hypertrophy. Jour nal of Molecular and Cellular Cardiology 31 705-719. Andronico G, Mangano MT, Nardi B, Mule G, Piazza G, Censola G 1993 Insulin-like growth factior I and soduim-lithium countertransoprt in essential hypertension and in hypertensive left ventricular hypertrophy. Journal of Hypertension 11 1097. Anker SD, Volterrani M, Pflaum CD 2001 Acquired growth hormone resistance in patients with chronic heart failure: implications for ther apy with growth hormone, Journal of the American College of Cardiology 38 443. Aoyagi M, Yamamoto M, Wakimoto H, Azuma H, Hirakawa K, Yamamoto K 1995 Immunohistochem ical detection of Ki-67 in replic ative smooth muscle ce lls of rabbit carotid arteries after balloon denudation. Stroke 26 2328-31. Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, Evans RM 1987 Cloning of human mineralocorticoid receptor complementary DNA: Structural and functional kinship with the glucocorticoid receptor. Science 237 268-275. Arsenault P, & Menard D 1985 Influence of hydroc ortisone on human fetal small intestine in organ culture. Journal of Pediat ric Gastroenterology and Nutrition 4 893-901. Baicu CF, Stroud JD, Livesay VA, Hapke E, Holder J, Spinale FG, Zile MR. 2003 Changes in extra cellular collagen matrix alter myocardial systolic performance. American Journal of Physiology Heart and Circulatory Physiology 284 H122-32. Ballard PL, Ertsey R, Gonzales LW, & Gonzal es J 1996 Transcriptiona l regulation of human pulmonary surfactant proteins SP-B and SP-C by glucocorticoids. American Journal of

PAGE 132

134 Respiratory Cell and Molecular Biology : An Of ficial Journal of the American Thoracic Society, Medical Section of th e American Lung Association 14 599-607. Banks BA, Cnaan A, Morgan MA, Parer JT, Merrill JD, Ballard PL, Ballard RA1999 Multiple courses of antenatal corticosteroids and outcome of prematur e neonates. American Journal of Obstetrics and Gynecology 181 709. Barbera A, Giraud GD, Reller MD, Maylie J, Morton MJ, Thornburg KL 2000 Right ventricular systolic pressure load alters myocyte matu ration in fetal sheep. American Journal of Physiology Regulative, Integrative and Comparative Physiology 279 R1157-64. Bell ME, Wood CE, & Keller WM 1991 Influence of reproductive state on pituitary-adrenal activity in the ewe. Dome stic Animal Endocrinology 8 245-254. Benediktsson R, Lindsay RS, Noble J, Seckl JR, Edwards CR 1993 Glucocorticoid exposure in utero: new model for adult hypertension. Lancet 341 339-341. Bloom field FH, van Zijl PL, Bauer MK, Phua HH & Harding JE 2006 Effect of pulsatile growth hormone administration to the growth-restricted fetal sheep on somatotrophic axis gene expression in fetal and placental tissues. Am erican Journal of Physiology. Endocrinology and Metabolism 291 E333-E339. Booz, GW 2004 Cardiac angiotensin AT2 recep tor: What exactly does it do? Hypertension 43 1162-1163. Brilla CG, Matsubara LS, & Weber KT 1993 Antifibro tic effects of spironolactone in preventing myocardial fibrosis in systemic arterial hypertension. The American Journal of Cardiology 71 12A-16A. Brower GL, Gardner JD, Forman MF, Murray DB, Voloshenyuk T, Levick SP, Janicki JS 2006 The relationsh ip between myocardi al extracellular matrix remodeling and ventricular function. European J ournal of Cardiothoracic Surgery 30 604-10. Brown RW, Diaz R, Robson AC, Kotelevtsev YV, Mullins JJ, Kaufman MH 1996 The ontogeny of 11 beta-hydroxysteroid dehydrogenase type 2 and mineralocorticoid receptor gene expression reveal intricate control of glucoc orticoid action in development. Endocrinology 137 794-797. Buerke M, Murohara T, Skurk C, Nuss C, Tomaselli K, Lefer AM 1995 Cardioprotective effect of insulin-like growth factor I in m yocardial ischemia followed by reperfusion. Proceedings for the National Academy of Sciences USA 15 8031-5. Burrell JH, Boyn AM, Kum arasamy V, Hsieh A, Head SI, & Lumbers ER 2003 Growth and maturation of cardiac myocytes in fetal sheep in the second half of gestation. Anat.Rec.A Discov.Mol.Cell Evol.Biol. 274 952-961.

PAGE 133

135 Burrell JH, Hegarty BD, McMullen JR, & Lumbers ER 2001 Effects of gestation on ovine fetal and maternal angiotensin receptor subtypes in the heart and major blood vessels. Experimental Physiology 86 71-82. Carey RM 2005 Angiotensin type-2 receptors and cardiovascular function: are angiotensin type2 receptors protective? Current Opinions in Cardioliology 20 264-9. Carneiro-Ramos MS, Diniz GP, Almeida J, Viei ra RL, Pinheiro SV, Santos RA, Barreto-Chaves ML 2008 Cardiac angiotensin II type I and type II receptors are increas ed in rats submitted to experimental hypothyroidism. Journal of Physiology 583 213-223. Carr BR, Parker CR, Madden JD, MacDonald PC, and Porter JC 1981 Maternal adrenocorticotropin and cortisol relations hips throughout human pregnancy. American Journal Obstetrics Gynecology 139 416. Cheung CY, & Brace RA 1998. Ovine vascular endot helial growth factor: Nucleotide sequence and expression in fetal tissues. Gr owth Factors (Chur, Switzerland), 16 11-22. Cheung CY, Johnson DD, & Reyes V 1996 Ontogeny of insulin-like growth factor-I and -II gene expression in ovine fetal heart. Journal of the Society for Gynecologic Investigation 3 309315. Cittadini A, Cuocolo A, Merola B, Fazio S, Sabatini D, Nicolai E, Colao A, Longobardi S, Lombardi G, Sacc L 1994 Impaired cardiac performance in GH-deficient adults and its im provement after GH replacement. American Journal of Physiology 267 E219-25. Clark PM 1998 Programming of th e hypothalamo-pituitary-adrenal axis and the fetal origins of adult disease hypothesis. European Journal of Pediatrics 157 Suppl 1 S7-10. Cox BE, Rosenfeld CR 1999 Ontogeny of vascular angiotensin II receptor subtype expression in ovine developm ent. Pediatric Research 1999 45 414-24. Crowley P 2002 Prophylactic corticosteroids for pret erm birth. Cochrane Data base of Systematic Reviews 1. Cuocolo A, Nicolai E, Colao A, Longobardi S, Cardei S, Fazio S, Merola B, Lombardi G, Sacc L, Salvatore M 1996 Improved left ventricular function after growth hormone replacem ent in patients with hypopitu itarism: assessment with radionuclide angiography.European Journal of Nuclear Me dicine and Molecular Im aging 4 390-4. Daniel SS, James LS, Stark RI, & Tropper, PJ 1989 Prevention of the normal expansion of maternal plasma volume: A model for chronic fetal hypoxemia. Journal of Developmental Physiology 11 225-233.

PAGE 134

136 Danilczyk U & Penninger, JM 2006. Angiotensin-c onverting enzyme II in the heart and the kidney. Circulation Research 98 463-471. Davey KA, Garlick PB, Warley A, Southworth R 2007 Immunogold labeling study of the distribution of GLUT-1 and GL UT4 in cardiac tissue followi ng stimulation by insulin or ischemia. American Journal of Physio logy Heart and Circulatory Physiology 292 2009-19. DeChiara TM, Efstratiadis A, Robertson EJ 1990 A growth-deficiency phenotype in heterozygous m ice carrying an in sulin-like growth factor II gene disrupted by targeting. Nature 3 78-80. Delhanty PJ, & Han VK 1993 The expression of insulin-like growth factor (IGF)-binding protein-2 an d IGF-II genes in the tissues of the developing ovine fetus. Endocrinology 132 41-52. De Vrijer B, Davidsen ML, Wilkening RB, Anthony RV, Regnault TR 2006 Altered Placental an d Fetal Expression of IGFs and IGF-Binding Proteins Associated With Intrauterine Growth Restriction in Fetal Sh eep During Early and Mid-Pregnancy. Pediatric Research 60 507-512. Diez J 2007 Mechanisms of cardiac fibrosis in hy pertension. Journal of Clinical Hypertension (Greenwich, Conn.) 9 546-550. Dodic M, Abouantoun T, O'Connor A, Wintour EM & Moritz KM 2002 Programming effects of short prenatal exposure to dexamethasone in sheep. Hypertension 40 729-734. Donohue TJ, Dworkin LD, Lango MN, Fliegner K, Lango RP, Benstein JA, Sl ater WR, Catanese VM 1994 Induction of myocardial insulin-like growth factor -I gene expression in left ventricular hypertrophy. Circulation 89 799-809. Dong, F, Ford P, Fang CX, Nijland MJ, Nathanielsz PW, & Ren J 2005 Maternal nutrient restriction during early to mi d gestation up-regulates cardi ac insulin-like growth factor (IGF) receptors associated with enlarged ventricular size in fetal sheep. Growth Hormone & IGF Research : Official Journal of the Growth Hormone Research Society and the International IGF Research Society 15 291-299. Dostal DE 2000 The cardiac renin-angiotensin system: Novel signaling mechanisms related to cardiac growth and functi on. Regulatory Peptides 91 1-11. Dostal DE, Booz GW, & Baker KM 2000 Regulat ion of angiotensinogen gene expression and protein in neonatal rat cardiac fibroblasts by glucocorticoid a nd beta-adrenergic stimulation. Basic Research in Cardiology 95 485-490. Douglas PS, Tallant B 1991 Hypertrophy, fibrosis and diastolic dysfunction in early canine experimental hypertension. Journal of the American College of Cardiology 17 530-6.

PAGE 135

137 Drake AJ, Walker BR, and Seckl JR. 2005 Intergenerational consequences of fetal programming by in utero exposure to glucocorticoids in ra ts. American Journal of Physiology Regulatory, Integretative and Comparative Physioliology 288 R34-R38. Duerr RL, Huang S, Miraliakbar HR, Clark R, Chien KR, Ross J Jr 1995 Insulin-like growth factor-1 enhances ventricular hypertrophy and function during the onset of experim ental cardiac failure. Journal of Clinical Investigation 95 619-27. Edwards CR, Stewart P M, Burt D, Brett L, McIntyre MA, Sutanto WS de Kloet ER, Monder C 1988 Localisation of 11 beta-hydroxysteroid dehy drogenase--tissue specificprotector of the mineralocorticoid receptor. Lancet 29 986-9. Ekramullah SM, Saitoh Y, Arita N, Ohnishi T, Hayakawa T 1996 The correlation of Ki67 staining indices with tum our doubling times in regrowing non-functioning pituitary adenomas. Acta Neurochirurgica 138 1449-55. Fazio S, Cittadini A, Sabatini D, Merola B, Colao AM, Biondi B, Lombardi G, Sacc L 1993 Evidence for biventricular involvem ent in acromegaly: a Doppler echocardiographic study. European Heart Journal 14 26-33. Fazio S, Cittadini A, Cuocolo A, Merola B, Sabatini D, Colao A, Biondi B, Lombardi G, Sacc L 1994 Impaired cardiac performance is a distin ct feature of uncomplicated acromegaly. Journal of Clinical Endo crinology and Metabolism 79 441-6. Fazio S, Cittadini A, Sabatini D, Merola B, Colao A, Biondi B, Longobardi S, Lombardi G, Sacc L 1997 Growth hormone and heart p erformance. A novel mechanism of cardiac wall stress regulation in humans. European Heart Journal 18 340-7. Fejes-Toth G, Pearce D, & Naray-FejesToth A 1998 Subcellula r localization of mineralocorticoid receptors in living cells: Effects of receptor agonists and antagonists. Proceedings of the National Academy of Scie nces of the United States of America 95 29732978. Fiebeler A, & Haller H 2003 Participation of th e mineralocorticoid rece ptor in cardiac and vascular remodeling Nephron Physiology 94 47-50. Figueroa JP, Rose JC, Massmann GA, Zhang J, & Acuna G 2005 Alterations in fetal kidney development and elevations in arterial blood pressure in young adult sheep after clinical doses of antenatal glucocorticoids. Pediatric Research 58 510-515. Fowden AL, Apatu RS, & Silver M 1995 The glucogenic capacity of the fetal pig: Developmental regulation by cort isol. Experimental Physiology 80 457-467. Fowden AL, Mijovic J, & Silver M 1993 The effects of cortisol on hepatic and renal gluconeogenic enzyme activities in the sheep fetus during late gestation. The Journal of Endocrinology 137 213-222.

PAGE 136

138 Fraccarollo D, Galuppo P, & Bauersachs J 2004 Mi neralocorticoid receptor antagonism and cardiac remodeling in ischemic heart failure Curr. Med. Chem. Cardiovasc. Hematol. Agents 2 287-294. Fraccarollo D, Galuppo P, Hildemann S, Chri st M, Ertl G, & Bauersachs J 2003 Additive improvement of left ventricular remodeli ng and neurohormonal activation by aldosterone receptor blockade with eplerenone and ACE inhi bition in rats with myocardial infarction. Journal of the American College of Cardiology 42 1666-1673. Fraccarollo D, Galuppo P, Schmidt I, Ertl G, & Bauersachs J 2005 Additive amelioration of left ventricular remodeling and mol ecular alterations by combined aldosterone and angiotensin receptor blockade after myocardial infarction. Cardiovascular Research 67 97-105. Fraccarollo D, Galuppo P, Schraut S, Kneitz S, v an Rooijen N, Ertl G, Bauersachs J 2008 Immediate mineralocorticoid receptor blocka de improves myocardial infarct healing by modulation of the inflammato ry response. Hypertension 51 905-14. French NP, Hagan R Evans SF Godfrey M, and Newnham JP 1999 Repeated antenatal corticosteroids: Size at birth and subsequent development. American Journal Obstetrics Gynecology 180 114. Funder JW 2005. Mineralocorticoid receptors: Distribution and activation. Heart Failure Reviews 10 15-22. Galand G 1989 Brush border membrane sucrase-isomaltase, maltase-glucoamylase and trehalase in mammals. comparative development, effect s of glucocorticoids, molecular mechanisms, and phylogenetic implications. Comparative Biochemistry and Physiology. B: Comparative Biochemistry 94 1-11. Garcia RH, Cabeza MP, Gallo A, Palacios L, Laguens RP 2002 DNA content and expression of cell cycle proteins in caterpi llar nuclei from fetal human car diac myocytes. Virchows Archiv 440 45. Gelpi RJ, Pasipoularides A, Lader AS, Patr ick TA, Chase N, Hitting er L, Shannon RP, Bishop SP, Vatner SF 1999 Changes in diastoli c cardiac function in de veloping and stable perinephritic hypertension in conscious dogs. Circulation Research 68 555-67. Gilbert JS, Lang AL, Nijland MJ 2005 Maternal nutrient restri ction and the fetal left ventricle: decreased angi otensin receptor expressi on. Reproductive Biology and Endocrinolology 14 3:27. Giraud GD, Louey S, Jonker S, Schultz J, & T hornburg KL 2006 Cortisol stim ulates cell cycle activity in the cardiomyocyte of the sheep fetus. Endocrinology 147 3643-9.

PAGE 137

139 Glorioso N, Filigheddu F, Parpaglia PP, So ro A, Troffa C, Argiolas G 2005 11betahydroxysteroid dehydrogenase type 2 activity is associated with left ventricular mass in essential hypertension. Eu ropean Heart Journal 26 498-504. Gomez-Sanchez CE, de Rodrigu ez AF, Romero DG, Estess J, Wa rden MP, Gomez-Sanchez MT 2006 Development of a panel of monoclonal antibodies against the mineralocorticoid receptor. Endocrinology 147 1343-1348. Gray S Stonestreet BS, Thamotharan S Sadowska GB Daood M Watchko J, Devaskar SU 2006 Skeletal muscle glucose tr ansporter protein res ponses to antenatal glucocorticoids in the ovine fetus. The Journal of Endocrinology 189 219-29. Green LR, Kawagoe Y, Hill DJ, Richardson BS & Han VK 2000. The effect of interm ittent umbilical cord occlusion on insulin-like growth factors and their binding proteins in preterm and near-term ovine fetuses. The Journal of Endocrinology 166 565-577. Guron G, Friberg P, Wickman A, Brantsing C, Gabrielsson B, Isgaard J 1996 Cardiac insulin -like growth factor I and growth hor mone receptor expression in renal hypertension. Hypertension 3 636-42. Hanson MC, Kenneth AF, Alexander RW De Lafontaine P 1993 Induction of cardiac insulin-like growth factor I gene expression in pressure overload hypertrophy. American Journal of the Medical Sciences 306 69. Hein L, Barsh G S, Pratt R E, Dzau VJ, & Kobilka BK 1995 Behaviour al and cardiovascular effects of disrupting the angiotensin II type-2 receptor in mice. Nature 377 744-747. Hoeflich A, Wu M, Mohan S, Foll J, Wanke R, Froehlich T 1999 Overexpression of insulin-like growth factor-binding protein-2 in transgen ic mice reduces postnatal body weight gain. Endocrinology 140 5488-5496. Huttenbach Y, Ostrowski ML, Thaller D, & Kim HS 2001 Cell proliferation in the growing human heart: MIB-1 immunostaining in preterm and term infants at autopsy. Cardiovascular Pathology : The Official Journal of th e Society for Cardiovascular Pathology 10 119-123. Janicki JS, Matsubara BB, Kabour A 1993 Myo cardial collagen and its functional role. Advances in Experim ental Medicine and Biology 346 291-8. Jensen E, Wood C, & Keller-Wood M 2002 The nor mal increase in adrenal secretion during pregnancy contributes to maternal volume expansion and fetal homeostasis. Journal of the Society for Gynecologic Investigation 9 362-371. Jensen E, Wood CE, & Keller-Wood M 2005 Ch ronic alterations in ovine maternal corticosteroid levels influence uterine blood flow and placental and fetal growth. American Journal of Physiology. Regulatory, Inte grative and Compar ative Physiology 288 R54-R61.

PAGE 138

140 Jensen EC, Gallaher BW, Breier BH, & Hardin g JE 2002. The effect of a chronic maternal cortisol infusion on the late-gestation fetal sheep The Journal of Endocrinology 174 27-36. Jewell CM, Webster JC, Burnstein KL, Sa r M, Bodwell JE, & Cidlowski JA 1995 Immunocytochemical analysis of hormone mediat ed nuclear translocation of wild type and mutant glucocorticoid receptors. The Journa l of Steroid Biochemistry and Molecular Biology 55 135-146. Jones JI & Clemmons DR 1995 Insulin-like growth factors and their bindi ng proteins: Biological actions. Endocrine Reviews 16 3-34. Jonker SS, Zhang L, Loue, S, Giraud GD, Thornburg KL, & Faber JJ 2007 Myocyte enlargement, differentiation, and proliferation ki netics in the fetal sheep heart. Journal of Applied Physiology: Respiratory, Envi ronmental and Exercise Physiology 102 1130-1142. Jugdutt BI, Idikio HA 2005 Apoptosis and oncosis in acute coronary syndrom es: assessment and implications.Molecular and Cellular Biochemistry 270 177-200. Kadereit B, Fustier P, Shojaati K, Frey BM, Frey FJ, & Mohaupt MG 2005 Extracellular ATP determines 11beta-hydroxysteroid dehydrogenase type 2 activity via purinergic receptors. Journal of the American Society of Nephrology 16 3507-3516. Keller-Wood M 1998 Evidence for reset of regula ted cortisol in pregnancy: studies in adrenalectomized ewes. American Journal of Physiology Regulatory, Integrative and Comparative Physiology 274 R145R151. Keller-Wood M, Wood CE, Hua Y, & Zhang D 2005 Mineralocorticoid receptor expression in late-gestation ovine fetal lung. Journal of the Society for Gynecologic Investigation 12 8491. Keller-Wood ME, Shinsako J, Dallman MF 1983 Integral as well as proportional adrenal responses to ACTH. Ameican Journal of Physiology 245 R53-R59. Kim EK, Wood CE, Keller-Wood M 1995 Characterization of 11 beta-hydroxysteroid dehydrogenase activity in fetal and adult ovine tissues. Reproduction Fertility and Developm ent 7 377-83. Kliche K, Kuhn M, Hillebrand U, Ludwig Y, St ock C, & Oberleithner H 2006 Direct aldosterone action on mouse cardiomyocytes detected with atomic force microscopy. Cellular Physiology and Biochemistry : International Journal of Experiment al Cellular Physiology, Biochemistry, and Pharmacology 18 265-274. Kohno M, Ohmori K, Nozaki S, Mizushige K, Yasunari K, Kano H, Minami M, and Yoshikawa J 2000 Effects of valsartan on angiotensinII-i nduced migration of human coronary artery smooth muscle cells. Hypertension Research 23 677.

PAGE 139

141 Kotelevtsev Y, Brown RW, Fleming S, Kenyon C, Edwards CR, Seckl JR 1999 Hypertension in mice lacking 11beta-hydroxysteroid dehydrogena se type 2. The Journal of Clinical Investigation 103 683-689. Krozowski Z, Li KX, Koyama K, Smith RE, Ob eyesekere VR, Stein-Oakley A 1999 The type I and type II 11beta-hydroxysteroid dehydrogenase enzymes. The Journal of Steroid Biochemistry and Molecular Biology 69 391-401. Kwak SP, Patel PD, Thompson RC, Akil H, & Watson SJ 1993 5'-heterogeneity of the mineralocorticoid receptor messenger ribonuc leic acid: Differential expression and regulation of splice variants within the rat hippocampus. Endocrinology 133 2344-2350. Law CM, and Shiell A W 1996 Is blood pressure inve rsely related to birth weight? The strength of evidence from a systematic review of the literature. Journal of Hypertension 14 935-941. Lee WL, Chen JW, Ting CT, Ishiwata T, Li n SJ, Korc M, W ang PH 1999 Insulin-like growth factor I improves cardiovascula r function and suppresses apoptosis of cardiomyocytes in dilated cardiomyopathy. Endocrinology 140 4831-40. Levitt NS, Lindsay RS, Holmes MC, & Seck, JR 1996 Dexamethasone in the last week of pregnancy attenuates hippocampal glucocorticoid receptor gene expression and elevates blood pressure in the adult offspr ing in the rat. Neuroendocrinology 64 412-418. Li B, Setoguchi M, Wang X, Andreoli AM, Leri A, Malhotra A, Kajstura J, Anversa P 1999 Insulin-like growth factor-1 attenuates the detr imental impact of nonocclusive coronary artery constriction on th e heart. Circulation Research 14 1007-19. Li J, Forhead AJ, Dauncey MJ, Gilmour RS a nd Fowden AL 2002 Control of growth hormone receptor and insulin-like growth factor-I expression by cortisol in ovine fetal skeletal muscle. Journal of Physiology 541 581-589. Li J, Owens JA, Owens PC, Saunders JC, Fowden AL, Gil mour RS 1996 The ontogeny of hepatic growth hormone receptor and insulinlike growth factor I gene expression in the sheep fetus during late gesta tion: developmental regulati on by cortisol. Endocrinology 137 1650-7. Li J, Saunders JC, Fowden AL, Dauncey MJ, & Gilmour RS 1998 Transcri ptional regulation of insulin-like growth fact or-II gene expression by cortisol in fetal sheep during late gestation. Journal of Biological Chemistry 273 10586-10593. Li J, Saunders JC, Gilmour RS, Silver M, & Fowden AL 1993 Insulin-like growth factor-II messenger ribonucleic acid expression in fetal tissues of the sheep dur ing late gestation: Effects of cortisol. Endocrinology 132 2083-2089. Liggins GC and Howie RN 1972 A controlled trial of antepartum glucocorticoid treatment for prevention of the respiratory distress syndr ome in premature infants. Pediatrics 50 515-525.

PAGE 140

142 Liggins GC 1974 Parturition in the Sheep and the Human Physiology and Genetics of. Reproduction., edited by Coutinho EM and Fuchs F. New York: Plenum Press 423-443 Lister K, Autelitano DJ, Jenki ns A, Hannan RD, & Sheppard KE 2006 Cross talk between corticosteroids and alpha-adrenergic signa lling augments cardiomyocyte hypertrophy: A possible role for SGK1. Ca rdiovascular Research 70 555-565. Liu Q, Yan H, Dawes NJ, Mottino GA, Frank JS & Zhu H 1996 Insulin-like growth factor II induces DNA synthesis in fetal ventricular m yocytes in vitro. Circulation Research 79 716726. Livak KJ, & Schmittgen TD 2001 Analysis of re lative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods (San Diego, Calif.) 25 402408. Lombes M, Alfaidy N, Eugene E, Lessana A, Farman N, & Bonvalet JP 1995 Prerequisite for cardiac aldosterone action. mi neralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase in the human heart. Circulation 92 175-182. Lombes M, Binart N, Delahaye F, Baulie u EE, & Rafestin-Oblin ME 1994 Differential intracellular localization of human mineralocorticosteroid receptor on binding of agonists and antagonists. Biochemical Journal 302 191-197. Lombes M, Oblin ME, Gasc JM, Baulieu EE, Farman M, and Bonvalet JP 1992 Immunohistochemical and biochemical evidence for a cardiovascular mineralocorticoid receptor. Circulation Research 71 503-510. Lu NZ, & Cidlowski JA 2006 Glucocorticoid re ceptor isoforms generate transcription specificity. Trends in Cell Biology 16 301-307. Lumbers ER, Boyce AC, Joulianos G, Kumarasa my, V, Barner E, Segar JL, 2005 Effects of cortisol on cardiac myocytes and on expressi on of cardiac genes in fetal sheep. American Journal of Physiology. Regulatory, Inte grative and Compar ative Physiology 288 R567R574. MacFarlane N, Northridge DB, Wright AR Grant S, Dargie HJ 1991 A com parative study of left ventricular struct ure and function in elite athlet es. British Journal of Sports Medicine 25 45-8. Huttenbach Y, Ostrowski ML, Thaller D, Kim HS 2001 Cell proliferation in the growing human heart: MIB-1 immunostaining in preterm and term infants at autopsy. Cardiovascular Pathology 10 119. Meinel L, Zoidis E, Zapf J, Hassa P, Hottiger MO, Auer JA 2003 Localized insulin-like growth factor I delivery to enhan ce new bone formation. Bone 33 660-672.

PAGE 141

143 Mihailidou AS, & Funder JW 2005 Nongenomic effect s of mineralocorticoid receptor activation in the cardiovascular system. Steroids 70 347-351. Modric T, Silha, JV, Shi Z, Gui Y. Suwanic hkul A, Durham SK 2001 Ph enotypic manifestations of insulin-like growth facto r-binding protein-3 overexpression in transgenic mice. Endocrinology 142 1958-1967. Nagata K, Obata K, Xu J, Ichihara S, Noda A, Ki mata H, Kato T, Izawa H, Murohara T, Yokota M 2006 Mineralocorticoid receptor antagonism attenua tes cardiac hypertrophy and failure in low-aldosterone hype rtensive rats. Hypertension. 47 656-64. Narayan S, Janicki JS, Shroff SG, Pick R, W eber KT 1989 Myocardial collagen and mechanics after preventing hypertrophy in hype rtensive rats. American Journal of Hypertension 2 675-82. National Institutes of Health Consensus Deve lopment Panel 2001 Antenatal corticosteroids revisited: Repeat coursesNational Institutes of Health Consensus Development Conference Statement, August 17, 2000. Obstetrics and Gynecology 98 144. Newnham J, Evans SF, Godfrey M, Huang W, Ikegami M, & Jobe A 1999 Maternal, but not fetal, administration of corticosteroids restrict s fetal growth. The Journal of Maternal-Fetal Medicine 8 81-87. Newnham JP, & Moss TJ 2001 Antenatal glucocorticoids and growth: Single versus multiple doses in animal and human studies. Seminars in Neonatology 6 285-292. Niebauer J, Pflaum CD, Clark AL 1998 Deficient insulin-like growth fact or I in chronic heart failure predicts altered body composition, ana bolic deficiency, cytokine and neurohormonal activation, Journal of the Amer ican College of Cardiology 32 393. Nixon JV, Wright AR, Porter TR, Roy V, Arrow ood JA 1991 Effects of exercise on left ventricular diastolic perform ance in traine d athletes. American Journal of Cardiology 1 9459. Okoshi MP, Yan X, Okoshi K, Nakayama M, Schuldt AJ, O'Connell TD 2004 Aldosterone directly stimulates cardiac myocyte hypertrophy. Journal of Cardiac Failure 10 511-518. Oparil S, Bishop SP, & Clubb FJ, Jr. 1984 Myo cardial cell hypertrophy or hyperplasia. Hypertension 6 III38-III43. Osgerby JC, Wathes D, Howard D, & Gadd TS 2004 The effect of maternal undernutrition on the placental growth trajectory and the uterine insulin-like growth factor axis in the pregnant ewe. The Journal of Endocrinology 182 89-103. Pauschinger M, Knopf D, Petschauer S, Doerner A, Poller W, Schwi mmbeck PL, Khl

PAGE 142

144 U, Schultheiss HP 1999 Dilated cardiomyopathy is associated with significant changes in collagen type I/III ratio. Circulation 99 2750-6. Pearlman ES, Weber KT, & Janicki, JS 1981 Quan titative histology of the hypertrophied human heart. Federation Proceedings 40 2042-2047. Pearlman ES, Weber KT, Janicki JS, Pietra GG, Fishman AP 1982 Muscle fiber orientation and connective tissue content in the hypertrophied hum an heart. Lab Investigations 46 158-64. Pecins-Thompson M, & Keller-Wood M 1997 Effect s of progesterone on blood pressure, plasma volume, and responses to hypotension. Th e American Journal of Physiology 272 R377R385. Phillips, DI 1998 Birth weight and the future development of diabet es. A review of the evidence. Diabetes Care 21 B150-B155. Pitt B, Williams G, Remme W, Martinez F, Lopez-Sendon, J, Zannad F 2001 The EPHESUS trial: Eplerenone in patients with heart failure due to systolic dysfunction complicating acute myocardial infarction. eplere none post-AMI heart failure e fficacy and survival study. Cardiovascular Drugs and Therapy / Spons ored by the International Society of Cardiovascular Pharmacotherapy 15 79-87. Pitt B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, 1999 The effect of spironolactone on morbidity and mortality in patients with severe heart failure. randomized aldactone evaluation study investigators. The New England Journal of Medicine 341 709-717. Qin W, Rudolph AE, Bond BR, Rocha R, Blomme EA, Goellner JJ 2003 Transgenic model of aldosterone-driven cardiac hypertrophy a nd heart failure. Circulation Research 93 69-76. Quinlivan JA, Evans SF, Dunlop SA, Beazley LD and Newnham JP. Use of corticosteroids by Australian obstetricians A survey of clin ical practice. The Australian and New Zealand Journal of Obstetrics and Gynaecology 38 1. Randhawa R, Cohen P 2005 The role of the insulin -like growth factor system in prenatal growth. Molecular Genetics and Metabolism 86 84-90. Reini S, Dutta G, Wood C, & Keller-Wood M 2008 Cardiac corticosteroid receptors receptors mediate the enlargement of the ovine fetal he art induced by chronic increases in maternal cortisol. The Journal of Endocrinology Epub May 21, 2008. Reini SA, Wood CE, Jensen E, & Keller-Wo od M 2006. Increased maternal cortisol In late gestation ewes decreases fetal cardiac expression of 11{beta}-HSD2 mRNA and the ratio of AT1 to AT2 receptor mRNA. Am erican Journal of Physiology. Regulatory, Integrative and Comparative Physiology 291 1708-1716.

PAGE 143

145 Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Hom cy CJ, Baserga R, Anversa P 1996 Overexpression of insulin-like grow th factor-1 in the heart is coupled with myocyte proliferation in transg enic mice. Proceedings of the National Academy of Sciences USA 93 8630-5. Reul JMH, & DeKloet ER 1985 Two receptor syst em for corticosterone in rat brain: Microdistribution and differe ntial occupation. Endocrinology 117 2505-2511. Reul JM, de Kloet ER, van Sluijs FJ, Rijnberk A, Rothuizen J 1990 Binding characteristics of mineralocorticoid and glucocorticoid recepto rs in dog brain and pituitary. Endocrinology 127 907-915. Richards EM, Hua Y, & Keller-Wood M 2003 Pharmacology and physiology of ovine corticosteroid receptors. Neuroendocrinology 77 2-14. Roghair RD, Lamb FS, Miller FJ, Jr, Sc holz TD, & Segar JL 2005 Early gestation dexamethasone programs enhanced postnatal ov ine coronary artery vascular reactivity. American Journal of Physiology. Regulator y, Integrative and Comparative Physiology 288 R46-R53. Rosamond W, Flegal K, Furie K, Go A, Greenlund K, Haase N, Hailpern SM, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C, Roger V, Sorlie P, Steinberger J, Thom T, Wilson M, Hong Y 2008 American Heart Association Statistics Comm ittee and Stroke Statis tics Subcommittee. Heart disease and stroke st atistics--2008 update: a report from the American Heart Association Statistics Committee an d Stroke Statistics Subcommittee. Circulation 117 e25146. Roseboom TJ, van der Meulen JH, Ravelli AC, Osmond C, Barker DJ, Bleker OP 2001 Effects of prenatal exposure to the Dutch fam ine on adult disease in late r life: an overview. Twin Research 4 293-298. Rosenblatt-Velin N, Montessuit C, Papageorgiou I, Terrand J, Lerch R 2001 Postinf arction heart failure in rats is a ssociated with upregulation of GLUT-1 and downregulation of genes of fatty acid metabolism. Cardiovascular Research 52 407-16. Rosendorff C, Black HR, Cannon CP, Gersh BJ Gore J, Izzo JL Jr, Kaplan NM, O'Connor CM, O'Gara PT, Oparil S, Am eri can Heart Association Council for High Blood Pressure Research; American Heart Associat ion Council on Clinical Cardiology; American Heart Association Council on Epidemio logy and Prevention 2007 Treatment of hypertension in the prevention and management of ischemic heart disease: a scientific statement from the American Heart Associat ion Council for High Blood Pressure Research and the Councils on Clinical Cardiology a nd Epidemiology and Prevention. Circulation 115 2761-88.

PAGE 144

146 Rudolph AM, Roman C, & Gournay V 1999 Perinata l myocardial DNA and protein changes in the lamb: Effect of cortisol in the fetus. Pediatric Research 46 141-146. Rydziel S, & Canalis E 1995 Cortisol repre sses insulin-like growth factor II receptor transcription in skeletal cell cultures. Endocrinology 136 4254-4260. Sarkar S, Leaman DW, Gupta S, Sil P, Y oung D, Morehead A 2004 Cardiac overexpression of myotrophin triggers myocardial hypertrophy and heart failure in transgenic mice. Journal of Biological Chemistry 279 20422-20434. Sartrio CL, Fraccarollo D, Galuppo P, Leutke M, Ertl G, Stef anon I, Bauersachs J 2007 Mineralocorticoid receptor blockade improves vasomoto r dysfunction and vascular oxidative stress early after myocardial infarction. Hypertension 50 919-25. Scheuer DA Bechtold AG, Shank SS, & Akana SF 2004 Glucocorticoids act in the dorsal hindbrain to increase arteri al pressure. American Jour nal of Physiology. Heart and Circulatory Physiology 286 H458-H467. Schmidt M, Weidler C, Naumann H, Anders S, Scholmerich J, & Straub RH 2005 Reduced capacity for the reactivat ion of glucocorticoids in rheuma toid arthritis synovial cells: Possible role of the sympathetic ner vous system? Arthritis and Rheumatism 52 1711-1720. Schneider MD, Lorell BH 2001 AT(2), judgment day: which angiot ensin receptor is the culprit in cardiac hypertrophy. Circulation 104 247-248. Seckl, JR 1997 Glucocorticoids, feto-placental 11 beta-hydroxysteroid dehydrogenase type 2, and the early life origins of adult disease. Steroids 62 89-94. Seckl JR 1998 Physiologic programming of the fetus. Clinical Perinatology 25 939-62, vii. Seckl JR, & Walker BR 2001 Minireview: 11beta -hydroxysteroid dehydrogenase type 1a tissue-specific amplifier of gl ucocorticoid action. Endocrinology 142 1371-1376. Segar JL, Dalshaug GB, Bedell KA, Smith OM, & Scholz TD 2001 Angiotensin II in cardiac pressure-overload hypertrophy in fetal sheep. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 281 R2037-R2047. Segar JL, Scholz TD, Bedell KA, Smith OM, Huss DJ, & Guillery EN 1997 Angiotensin AT1 receptor blockade fails to attenuate pressure-overload cardiac hypertrophy in fetal sheep. The American Journal of Physiology 273 R1501-R1508. Shanmugam S, Corvol P, & Gasc JM 1996 Angiot ensin II type 2 receptor mRNA expression in the developing cardiopulmonary syst em of the rat. Hypertension 28 91-97. Sil P, Gupta S, Young D, & Sen S 2004 Regulation of myotrophin gene by pressure overload and stretch. Molecular and Cellular Biochemistry 262 79-89.

PAGE 145

147 Silva D, Venihaki M, Guo WH, Lopez MF. Endocrinology 2006 Igf2 deficiency results in delayed lung development at the end of gestation. 147 5584-91. Sloboda DM, Newnham JP, & Challis JR 2000 Effects of repeated m aternal betamethasone administration on growth and hypothalamic-pituita ry-adrenal function of the ovine fetus at term. The Journal of Endocrinology 165 79-91. Smolich JJ 1995 Ultrastructural and functional features of the developing mammalian heart: A brief overview. Reproduction, Fe rtilility and Development 7 451-461. Smolich JJ, Walker AM, Campbell GR, Adamson TM 1989 Left and right ventricular myocardial morphom etry in feta l, neonatal, and adult sheep. American Journal of Physiology 257 H1-9. Stewart PM, Corrie JE, Shackleton CH, Edwards CR 1988 Syndrom e of apparent mineralocorticoid excess. A defect in the cor tisol-cortisone shuttle. Journal of Clinical Investigation 82 340-9. Sun Y, Zhang J, Lu L, Chen SS, Quinn MT, & Weber KT 2002 Aldosterone-induced inflammation in the rat heart : Role of oxidative stress. Am erican Journal of Pathology 161 1773-1781. Sundgren NC, Giraud GD, Schultz JM, Lasa rev MR, Stork PJ, & Thornburg KL 2003 Extracellular signal-regu lated kinase and phosphoinositol-3 kinase mediate IGF-1 induced proliferation of fetal sheep cardiomyocytes. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 285 R1481-R1489. Sundgren NC, Giraud GD, Stork PJ, Maylie JG, & Thornburg KL 2003 Angiotensin II stimulates hyperplasia but not hypertrophy in immature ovine cardiomyocytes. The Journal of Physiology 548 881-891. Sutano W, de Kloet ER 1987 Species-specificity of corticosteroid receptors in hamster and rat brains. Endocrinology 121 1405-1411. Suzuki G, Morita H, Mishima T, Sharov VG, Todor A, Tanhehco EJ, Rudolph AE, McMahon E G, Goldstein S, Sabbah HN 2002 Ef fects of long-term monotherapy with eplerenone, a novel aldosterone blocker, on prog ression of left ventri cular dysfunction and remodeling in dogs with h eart failure.Circulation 106 2967-72. Suzuki J, Kanazawa T, Iwai M, Horiuch M 2004 Angiotensin II AT2 receptors and cardiac function. In: De Mello WC, ed. Renin Angiotensin System and the Heart. West Sussex, UK: John Wiley & Sons 85-99. Takeda Y, Zhu A, Yoneda T, Usukura M, Takata H, Ya magishi M 2007 Effects of

PAGE 146

148 aldosterone and angiotensin II receptor blockade on car diac angiotensinogen and angiotensin-converting enzyme 2 expre ssion in Dahl salt-sensitive hypertensive rats.American Journal of Hypertension 20 1119-24. Tangalakis K, Lumbers ER, Moritz KM, Towstole ss MK, & Wintour EM 1992 Effect of cortisol on blood pressure and vascular reactivity in the ovine fetus. Experimental Physiology 77 709-717. Thompson A, Han VK, & Yang K 2004 Differen tial expression of 11beta-hydroxysteroid dehydrogenase types 1 and 2 mRNA and glucocorticoid receptor protein during mouse embryonic development. The Journal of Ster oid Biochemistry and Molecular Biology 88 367-375. Tian XL, Pinto YM, Costerousse O, Franz WM, Lippoldt A, Hoffmann S 2004 Over-expression of angiotensin converting enzyme-1 augmen ts cardiac hypertrophy in transgenic rats. Human Molecular Genetics 13 1441-1450. Torres A, Belser WW, III, Umeda PK, & Tucker D 1997 Indicators of delayed maturation of rat heart treated prenatally with de xamethasone. Pediatric Research 42 139-144. Trollmann R, Klingmller K, Schild RL, Rascher W, Dtsch J 2007 Differential gene expression of somatotrophic and growth factors in response to in vivo hypoxia in human placenta. American Journal of Ob stetrics and Gynecology 197 601-603. Unno N, Wong CH, Jenkins SL, Wentworth RA, Ding XY, Li C 1999 Blood pressure and heart rate in the ovine fetus: Ontogenic changes a nd effects of fetal adre nalectomy. The American Journal of Physiology 276 H248-H256. Valensise H, Liu YY, Federici M, Lauro D, De llanna D, Romanini C, Sesti G 1996 Increased expression of low-affinity insu lin receptor isoform and insuli n-like growth factor-I hybrid receptors in term placenta from insulin-re sistant women with ge stational hypertension. Diabetologia 39 952. Van Dierendonck JH Wijsman JH, Keijzer R, van de Velde CJ, Cornelisse CJ 1991 Cell-cycle-related staining patte rns of anti-proliferating ce ll nuclear antigen m onoclonal antibodies. Comparison with BrdUrd labeli ng and Ki-67 staining. Am erican Journal of Pathology 138 1165-72. Vasan RS, Sullivan LM, DAgostino RB 2003 Serum in sulin-like growth factor I and risk for heart failure in elderly indi viduals without a previous myocardial infarction: the Framingham Heart Study, Annals of Internal Medicine 139 642. Wahlander H, Isgaard J, Jennische E, Friberg P 1 992 Left ventricular insuli n-like growth factor I increases in early renal hypertension. Hypertension 19 25. Winer BJ 1971 Statistical principles in e xperimental design. New York: McGraw-Hill.

PAGE 147

149 Wintour EM, Johnson K, Koukoulas I, Moritz K, Tersteeg M, & Dodic M 2003 Programming the cardiovascular system, kidney and the brain--a review. Placenta 24 S65-S71. Wood CE 2002 The ovine fetal endocrine reflex responses to haemorrhage are not mediated by cardiac nerves. The Journal of Physiology 541 613-622. Wood CE, Chen GF, & Keller-Wood M 2005 Expressi on of nitric oxide synthase isoforms is reduced in late-gestation ovine fetal brai nstem. American Jo urnal of Physiology. Regulatory, Integrative a nd Comparative Physiology 289 R613-R619. Wood CE, Cheung CY, & Brace RA 1987 Fetal heart rate, arterial pressure, and blood volume responses to cortisol infusion. American Journal of Physiology 253 R904-R909. Wood CE, & Rudolph AM 1983 Negative feedback regulation of ad renocorticotropin secretion by cortisol. Endocrinology 112 1930-1936. Walfisch A, Hallak M, and Mazor M 2001 Multiple courses of antenatal steroids: Risks and benefits. Obsterics Gynecology 98 491. Wang C, Hu SM 1991 Developmental regulation in the expression of rat heart glucose transporters. Biochem ical and Bioph ysical Research Communications 177 1095-100. Westphal U 1971 Steroid-Protein Inte ractions. New York, Springer. Xiao HD, Fuchs S, Campbell DJ, Lewis W, D udley SC, Jr, Kasi VS 2004 Mice with cardiacrestricted angiotensin-conve rting enzyme (ACE) have atrial enlargement, cardiac arrhythmia, and sudden death. Am erican Journal of Pathology 165 1019-1032. Xu J, Carretero OA, Lin CX, Cavasin MA Shesely EG, Yang JJ 2007 Role of cardiac overexpression of ANG II in the regula tion of cardiac function and remodeling postmyocardial infarction. American Journa l of Physiology. Heart and Circulatory Physiology 293 H1900-H1907. Xu J, Carretero OA, Liu YH, Shesely EG, Yang F, Kapke A 2002 Role of AT2 receptors in the cardioprotective effect of AT1 antagonists in mice. Hypertension 40 244-250. Yang K, Smith CL, Dales D, Hammond GL, & Ch allis JRG 1992 Cloning of an ovine 11 betahydroxysteroid dehydrogenase complementary deoxyribonucleic acid: Tissue and temporal distribution of its messenger ribonucleic aci d during fetal and neonatal development. Endocronology 131 2120-2126. Yin P, Xu Q and Duan C 2004 Paradoxical actions of endogenous and exogenous insulin-like growth factor binding protein (IGFBP)-5 revealed by RNA inte rference analysis Journal of Biological Chemistry 279 32660.

PAGE 148

150 Young MJ, Lam EY, & Rickard AJ 2007 Mineralo corticoid receptor ac tivation and cardiac fibrosis. Clinical Science (London, England : 1979) 112 467-475. Young MJ, Moussa L, Dilley R, & Funder JW 2003 Early inflammatory responses in experimental cardiac hypert rophy and fibrosis: Effects of 11 beta-hydroxysteroid dehydrogenase inactivation. Endocrinology 144 1121-1125. Zar JH 1984 Biostatistical analysis. E nglewood Cliffs, NJ: Prentice-Hall. Zhu YC, Zhu YZ, Lu N, Wang MJ, Wang YX, Ya o T 2003 Role of angiotensin AT1 and AT2 receptors in cardiac hypertr ophy and cardiac remodelling. Clinical and Experimental Pharmacology & Physiology 30 911-918.

PAGE 149

151 BIOGRAPHICAL SKETCH Seth Andrew Reini was born in 1981, and liv ed in Lewiston, New York, until the age of 7. At this time his family relocated to Ohio, where he developed a str ong interest in science during his junior high years. He graduated high school as valedi ctorian of his class in 1999. He graduated summa cum laude with a degree in biology, along with minors in chemistry and religious studies, from The University of Findlay in 2003. He also received the Senior Science Award from The University of Findlay in 2003 Seth began his graduate studies at the University of Florida College of Medicine in August 2003. His dissertation work was completed with Dr. Maureen Keller-Wood in the Depart ment of Physiology, where he studied the mechanisms by which elevated cort isol levels enlarge th e fetal heart. Seth was supported in his graduate studies by an American Heart Associat ion pre-doctoral fellowship and by a scholarship through the Health Services Co llegiate Program with the U.S. Navy. Seth has accepted a position to do stress-response physio logy research for the U.S. Navy.