<%BANNER%>

Metabolic Engineering of Escherichia coli to Efficiently Produce Succinate in Mineral Salts Media

University of Florida Institutional Repository
Permanent Link: http://ufdc.ufl.edu/UFE0022504/00001

Material Information

Title: Metabolic Engineering of Escherichia coli to Efficiently Produce Succinate in Mineral Salts Media
Physical Description: 1 online resource (139 p.)
Language: english
Creator: Jantama, Kaemwich
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: escherichia, malate, metabolic, mineral, succinate
Chemical Engineering -- Dissertations, Academic -- UF
Genre: Chemical Engineering thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Succinic acid, which is one of the building block chemicals, is currently produced by the hydrogenation of petroleum-derived maleic anhydride. The increase in price of oil and petroleum derivatives has made the microbial production of succinate an economically attractive option for succinate as a renewable commodity chemical. In this dissertation, I accomplished the construction of Escherichia coli ATCC 8739 derivatives to produce succinate in mineral salts medium under anaerobic conditions. This work was done by a combination of metabolic engineering and metabolic evolution. Both strategies allowed us to engineer the central metabolism of E. coli to direct the carbon flow to succinate and to select the strains that produce succinate with high titer, productivity, and yield. Strain KJ073 (delta-ldhA delta-adhE delta-ackA delta-(focA-pflB) delta-mgsA delta-poxB) produced succinate with yield of 1.2 per mole of glucose used. This strain was further engineered for improvements in succinate production by eliminating acetate, malate, and pyruvate as significant side products. Strain KJ122 (delta-ldhA delta-adhE delta-ackA delta-(focA-pflB) delta-mgsA delta-poxB delta-tdcDE delta-citF delta-aspC delta-sfcA) significantly increased succinate yield (1.46 mol/mol glucose), succinate titer (680-700 mM), and average volumetric productivity (0.9 g/l-h). Strain KJ134 (delta-ldhA delta-adhE delta-(focA-pflB) delta-mgsA delta-poxB delta-tdcDE delta-citF delta-aspC delta-sfcA delta-(pta-ackA)) produced less pyruvate and acetate with the succinate yield, titer, and average productivity of 1.53 mol/mol glucose used, 600 mM, and 0.8 g/l-h, respectively. Strains KJ122 and KJ134 produced near theoretical yields of succinate during simple, anaerobic, batch fermentations using mineral salts medium without the addition of plasmid or foreign gene, and any complex nutrient. Both may be useful as biocatalysts for the commercial production of succinate. Batch experiments were conducted with a wild type of E. coli and four succinate-producing strains in order to establish how metabolic fluxes changed as a result of gene deletions and metabolic evolution. The flux through pyruvate dehydrogenase (PDH) complex was added to the classical anaerobic fermentation pathways, and mutants lacking pyruvate formate-lyase (PFLB) increased the flux through this pathway to produce NADH required for succinate production. Also, the mutants utilized phosphoenolpyruvate synthase (PPS) to convert pyruvate produced during glucose phosphorylation back to phosphoenolpyruvate (PEP). This provided additional PEP utilized for producing succinate. Three mutants had pflB deleted, and these exhibited considerably higher flux to oxaloacetate (OAA). Increased glucose concentration did not affect the fluxes significantly, other than decreasing lactate production for the wild type from low to lower levels and decreasing the flux to biomass for the mutant strains. ATP generation was also studied. The wild type and a pflB+ mutant had ATP yield close to the maximum theoretical values. However, the pflB- mutants had very low ATP yield. Correspondingly, the cells yields (YATP) were somewhat below the maximum literature value for the wild type and pflB+ mutant, and were considerably above that maximum for the pflB- mutants. It is hypothesized that the strains may activate some unknown ATP generating pathways.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kaemwich Jantama.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Svoronos, Spyros.
Local: Co-adviser: Ingram, Lonnie O.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022504:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022504/00001

Material Information

Title: Metabolic Engineering of Escherichia coli to Efficiently Produce Succinate in Mineral Salts Media
Physical Description: 1 online resource (139 p.)
Language: english
Creator: Jantama, Kaemwich
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: escherichia, malate, metabolic, mineral, succinate
Chemical Engineering -- Dissertations, Academic -- UF
Genre: Chemical Engineering thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Succinic acid, which is one of the building block chemicals, is currently produced by the hydrogenation of petroleum-derived maleic anhydride. The increase in price of oil and petroleum derivatives has made the microbial production of succinate an economically attractive option for succinate as a renewable commodity chemical. In this dissertation, I accomplished the construction of Escherichia coli ATCC 8739 derivatives to produce succinate in mineral salts medium under anaerobic conditions. This work was done by a combination of metabolic engineering and metabolic evolution. Both strategies allowed us to engineer the central metabolism of E. coli to direct the carbon flow to succinate and to select the strains that produce succinate with high titer, productivity, and yield. Strain KJ073 (delta-ldhA delta-adhE delta-ackA delta-(focA-pflB) delta-mgsA delta-poxB) produced succinate with yield of 1.2 per mole of glucose used. This strain was further engineered for improvements in succinate production by eliminating acetate, malate, and pyruvate as significant side products. Strain KJ122 (delta-ldhA delta-adhE delta-ackA delta-(focA-pflB) delta-mgsA delta-poxB delta-tdcDE delta-citF delta-aspC delta-sfcA) significantly increased succinate yield (1.46 mol/mol glucose), succinate titer (680-700 mM), and average volumetric productivity (0.9 g/l-h). Strain KJ134 (delta-ldhA delta-adhE delta-(focA-pflB) delta-mgsA delta-poxB delta-tdcDE delta-citF delta-aspC delta-sfcA delta-(pta-ackA)) produced less pyruvate and acetate with the succinate yield, titer, and average productivity of 1.53 mol/mol glucose used, 600 mM, and 0.8 g/l-h, respectively. Strains KJ122 and KJ134 produced near theoretical yields of succinate during simple, anaerobic, batch fermentations using mineral salts medium without the addition of plasmid or foreign gene, and any complex nutrient. Both may be useful as biocatalysts for the commercial production of succinate. Batch experiments were conducted with a wild type of E. coli and four succinate-producing strains in order to establish how metabolic fluxes changed as a result of gene deletions and metabolic evolution. The flux through pyruvate dehydrogenase (PDH) complex was added to the classical anaerobic fermentation pathways, and mutants lacking pyruvate formate-lyase (PFLB) increased the flux through this pathway to produce NADH required for succinate production. Also, the mutants utilized phosphoenolpyruvate synthase (PPS) to convert pyruvate produced during glucose phosphorylation back to phosphoenolpyruvate (PEP). This provided additional PEP utilized for producing succinate. Three mutants had pflB deleted, and these exhibited considerably higher flux to oxaloacetate (OAA). Increased glucose concentration did not affect the fluxes significantly, other than decreasing lactate production for the wild type from low to lower levels and decreasing the flux to biomass for the mutant strains. ATP generation was also studied. The wild type and a pflB+ mutant had ATP yield close to the maximum theoretical values. However, the pflB- mutants had very low ATP yield. Correspondingly, the cells yields (YATP) were somewhat below the maximum literature value for the wild type and pflB+ mutant, and were considerably above that maximum for the pflB- mutants. It is hypothesized that the strains may activate some unknown ATP generating pathways.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kaemwich Jantama.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Svoronos, Spyros.
Local: Co-adviser: Ingram, Lonnie O.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022504:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101212_AAAAAT INGEST_TIME 2010-12-12T12:13:02Z PACKAGE UFE0022504_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 25265604 DFID F20101212_AAARIY ORIGIN DEPOSITOR PATH jantama_k_Page_058.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
e2c08a30e363e9b71bab3d7dbbc37584
SHA-1
af0f37128a5dc83fc7a815cc7e90a5ce8c32d22f
6758 F20101212_AAARKA jantama_k_Page_020thm.jpg
e76fcbe518d488c58459d40d2be9c38a
450ad450ab038372249c6398d132694e37958ac1
29569 F20101212_AAARJM jantama_k_Page_091.QC.jpg
5294420d2c8985cdd44c092227e48d66
54d14e58b4768049bfdffe050eb1c0ce4b699b1e
25271604 F20101212_AAARIZ jantama_k_Page_068.tif
d0686c5d0678c331242e4586739efac1
e7ffea717ecaf08612286be3857cfa551344b940
29200 F20101212_AAARKB jantama_k_Page_037.QC.jpg
ea34577153c20b3bf3b11fa61bf250d5
0d122ce74a01b507936ed062f47c777dc44ae4c3
22441 F20101212_AAARJN jantama_k_Page_085.QC.jpg
ab0f4b3e739d74328062ca03defdc88c
be83ffb74aacf3ed8004dc9dc8ba12d9c5fa537a
26300 F20101212_AAARKC jantama_k_Page_063.QC.jpg
1e348d2f6c070fc961703cf0c10c3ee5
92eca3e74b8c9a820da0457baf4eb82e882e0fa3
30464 F20101212_AAARJO jantama_k_Page_084.QC.jpg
ad9ecfe7b786b38c7a4ea2e7e4a144a3
a4da984a4eecd01fbf3af0100b244df15e477769
6671 F20101212_AAARKD jantama_k_Page_064thm.jpg
ef5b7abb50121d9a01ebc94401e368f2
ea18956d87d4a0053130f14568f48e5642a42498
25648 F20101212_AAARJP jantama_k_Page_041.QC.jpg
869044792b4e160d7b37da73196da7ec
0e7c126724e6d7b80c2cb84b6c47be8698e7da25
6670 F20101212_AAARKE jantama_k_Page_065thm.jpg
4209a0163b8174b8fb06dd77cff24388
4f9c6e09c4d965e083ee78bc33bf24e480a8aa6c
6622 F20101212_AAARJQ jantama_k_Page_108thm.jpg
e064fc3c46d016b54e5a4e54cfa8061f
e8ebefd27fcf9c723b9899b17db850078db7f4c5
22447 F20101212_AAARKF jantama_k_Page_068.QC.jpg
6b1456bca07b13e2352858c6111534f5
2eee87eb925e93e6392cd3053af22183a97cbd27
19477 F20101212_AAARJR jantama_k_Page_005.QC.jpg
94a1465ba8e0c4cdd8b728bdcd8dcd95
0c143bdcfb1c3f080046d4d417984a98b0856788
6901 F20101212_AAARKG jantama_k_Page_078thm.jpg
410ef6916d0cc14a9e7ad22c5e2d8a78
3fde8405f007af825b460ef0577436c707eade4e
28320 F20101212_AAARJS jantama_k_Page_019.QC.jpg
94d1695edff8d047e69f0d23cbbb5629
2d7525f0839d305b1a6c886c0858c9626518dcb1
6907 F20101212_AAARKH jantama_k_Page_081thm.jpg
491686f3059b49a352db47b715033df1
acd619b7066be02684b548346eab80dedd376f19
7485 F20101212_AAARJT jantama_k_Page_033thm.jpg
8a6a7f93ebbf02c404e6423e3589b8c7
c673f91a1ef204c3d156fd5a638773a38978300b
4000 F20101212_AAARKI jantama_k_Page_099thm.jpg
2661142e6f6b04f690d49f8ca24e3003
cae2fc9b6b0d17f2988224db8e1339a83a5d463d
30189 F20101212_AAARJU jantama_k_Page_137.QC.jpg
170da89ff20e2c06aac0e89d8e1c709f
c3b94985b18a8c254c8bb7541fe16ef6b495f150
6396 F20101212_AAARKJ jantama_k_Page_104thm.jpg
f6b0e76ddcb343e61df6fafce8c815a8
14bf6b707b605c8b68a2b99067ee32737bcef207
11567 F20101212_AAARJV jantama_k_Page_057.QC.jpg
21daf65aa7e2834a8b8b878e3dcc2921
1e65623656d70f2933d9ac29edae17f3aead0d60
23232 F20101212_AAARKK jantama_k_Page_111.QC.jpg
79ef5c6f2053d36da7675d8dc29c7d56
bbaba343d23a93c30c985673022eaf7a2deb6b0b
10998 F20101212_AAARJW jantama_k_Page_098.QC.jpg
d3fa96a27e14eaee26a5803f19eba6f7
25edf1bd0e602ad918cb02a801ed9019d197db6b
14676 F20101212_AAARKL jantama_k_Page_114.QC.jpg
409797a164a9cf9b8255b87cc28cc10a
1a9fa3fd60950a65f6e609b0f1577d64cf2505d7
151350 F20101212_AAARJX UFE0022504_00001.xml FULL
6c8eccd0abf45d8cc483f80aaafcaa48
4bea5571410c4c4187eaf3348e9cd183e6dded93
30337 F20101212_AAARKM jantama_k_Page_115.QC.jpg
8857365048ab790d9c1513c18ea3152a
40d1d657964e50e87942698a357564075bf4ec8d
5543 F20101212_AAARJY jantama_k_Page_004thm.jpg
bd25f116be5b74ceb0fd12f24015b880
cf195da948ed0c6660008599e2757c60655275ef
6109 F20101212_AAARKN jantama_k_Page_120thm.jpg
78a848f52cd6c1057fe16b2adcdbed5c
c71b5b692248cf17f93a6956c1d66a510a2fb9cc
23089 F20101212_AAARJZ jantama_k_Page_004.QC.jpg
6431454b325bbac94b749d74e3ac01cc
2d1199d4e052ffc708185a7398e710dc7f66a7a3
28882 F20101212_AAARKO jantama_k_Page_121.QC.jpg
292706c8e6c00899394966d41d65ce9c
16e09ddfb4bb2a90c391a8c730d355b3dc62dd3b
6851 F20101212_AAARKP jantama_k_Page_125thm.jpg
20b26515fadf03d1be7c06d075da9bda
57cce69dcbcbd0171e1bfa34c039e27d0d6b19c9
6658 F20101212_AAARKQ jantama_k_Page_135thm.jpg
ef2eee33725961e79c28af674c2f098b
4dd2ef8a4e1ab4dbdfec00f72d72e99163aa7305
27330 F20101212_AAAQKA jantama_k_Page_087.QC.jpg
6fc644b5b4d7b0e9c078aa057cd6bca3
f485c451ce2094365311c1ee790915dda87be230
74899 F20101212_AAAQKB jantama_k_Page_055.jpg
c04ad51793060f1f1870e405ce69620f
52d398fcda1b840097c05ad259f765fd498db0d5
58436 F20101212_AAAQKC jantama_k_Page_073.jpg
1ad6e9eef42c470ba5937a60c2a6b8f3
83caae681d68d88997c30895e8037b426dd017b6
F20101212_AAAQKD jantama_k_Page_049.tif
fe46e88508d8c26599c1e473e6a2d62a
527ffc70b48940c177954d64d8ca3d7d63be23c8
105292 F20101212_AAAQKE jantama_k_Page_136.jpg
ffcdd4ed17af5029f6a67fc5d3751f0c
9264d39a6698498cc43b9795d4e103f3df82afab
F20101212_AAAQKF jantama_k_Page_069.tif
57c813735a206f94668c41d4528e7392
efb573916eab5880f2378e5f3e1e2daf2ce12e68
F20101212_AAAQKG jantama_k_Page_018.tif
c0357a455029535930c3ed719680e0e1
46e9983248609467c86beb52d629758a64fc387d
27094 F20101212_AAAQKH jantama_k_Page_046.QC.jpg
73624ef0e4e44334a0748a745c222480
c713da2b1f79c76b9bd5fdc2742d8b9b359c8fb3
6545 F20101212_AAAQJT jantama_k_Page_129thm.jpg
0c23738c542255cff5e21d69243cf115
63ff8339cf2ab00309faa1bd0ea95bf3a5b9847f
27377 F20101212_AAAQKI jantama_k_Page_135.QC.jpg
e6a4716b50ffadea8b6c54d8d0c42b4b
c7d8393a3d017e2a7a7cff00a32339c812959aaf
62790 F20101212_AAAQJU jantama_k_Page_090.jpg
2885cfd414ad2fa4da2629e4ffbcc46e
c071ccd1e0a5836c0d60dabcb3dc2440a0fd07a3
19900 F20101212_AAAQKJ jantama_k_Page_047.QC.jpg
1a1d03251a88edeebfdc8ab0203a3f3e
23ee8bc49badf1bdf4e9292ccf83839806a2aba0
6899 F20101212_AAAQJV jantama_k_Page_091thm.jpg
7fa2d21bb417373cd727235b49e24219
48e6b831bc4b4fa69abf20fecc02f7f70de26d95
1051984 F20101212_AAAQKK jantama_k_Page_031.jp2
c6770b54774d09567f89e0242a343c69
7aa69963c92b460eb112499521427a8c6743c1fe
F20101212_AAAQJW jantama_k_Page_114.tif
9807487a04ee01a4843c9d96e69e7d97
817813443135161f2b2d965ce14df8e72297bcd6
3980 F20101212_AAAQKL jantama_k_Page_016.QC.jpg
934ac433676e707f5cbf238753c604ff
3332accc9f8ca9ebc0af085f1249665b349873ed
29649 F20101212_AAAQJX jantama_k_Page_131.QC.jpg
d30da4315f3848d182585bc7ebc4fc27
ab12d2c8f9b44879abbbf6bc94057591fb7f8c3e
90768 F20101212_AAAQLA jantama_k_Page_123.jpg
cb52c6facb034d460411277008c99106
9832863eef7053e2da41b43b6dfaf94e8337f94c
752723 F20101212_AAAQKM jantama_k_Page_098.jp2
f7c720146eef41bba0dfaab86356a8a3
469d157c0ad34b45a35413cb8c6e0f264a39f41e
1051923 F20101212_AAAQJY jantama_k_Page_073.jp2
8d9000646264722716288dd2ff3cd6bb
bfce8ec0b74ab1d769f60ae8a47905262aa6681c
85993 F20101212_AAAQKN jantama_k_Page_063.jpg
091f5f1c849fb8eb52fb3c89ecccfe70
9ee20e0acf6c388eab19fc1805c7b5ac1954d967
28183 F20101212_AAAQJZ jantama_k_Page_076.QC.jpg
2c51a6df535ab33782bfac18e341792b
7db65a6be1e427dd7d0ac58c561e4d98c2c37ca1
4465 F20101212_AAAQLB jantama_k_Page_008thm.jpg
547a02e9c437a1f92f2e8aeb8c3a10c0
1474ded32f93c57342eecfa0bfe0746d739d8f10
27862 F20101212_AAAQKO jantama_k_Page_049.QC.jpg
4be2b82f584f8e6ed0942be375735c5f
2cc98a96a85510f5f0302020f42a26631611c27f
5040 F20101212_AAAQLC jantama_k_Page_047thm.jpg
009c23b2eed3cfe849c2a7c8f7419d6b
2bc5950c934c0a76b863f6685422a3254af49310
7241 F20101212_AAAQKP jantama_k_Page_137thm.jpg
e0cc2dd0e74ce10319a78ea29d55c8ee
5aae259c7fa705b6879f5a159937222dbbb873cb
1072 F20101212_AAAQLD jantama_k_Page_002.QC.jpg
2177045fe7c7afc794955b0e9db705b8
87ba14ea1e20edf3ef6b26b3429faa38a072b833
89640 F20101212_AAAQKQ jantama_k_Page_108.jpg
a46a056c7219117b93644570fb7caa1e
63a2fc9db2a06b22a9f1e1e8500a6ceda4217cc6
92605 F20101212_AAAQLE jantama_k_Page_092.jpg
9990e2a9f60200def19b7c1029bc309e
4e0ef283263a5129b6bec7a6bb31fade0681d989
31139 F20101212_AAAQKR jantama_k_Page_083.QC.jpg
da62ebeaa0d951f3a1c39cb36820e0dd
30f0770798b67882c49e48316bc9a098cd37268e
1051969 F20101212_AAAQLF jantama_k_Page_122.jp2
d5e4b8a8c0ae33d53b81e662086759bf
250ed93254b2684d32cdb25fc09eceb0bc55a4b9
1051981 F20101212_AAAQKS jantama_k_Page_010.jp2
e48ea1993810d1e75eedfe58b7c6a769
1d59e9a211137d7530b20ae0b074800e54037b76
F20101212_AAAQLG jantama_k_Page_106.tif
703bc6a159a2eab0940096f8a60f3537
5355d898323897aadef23a5ff183b75169a65768
23490 F20101212_AAAQKT jantama_k_Page_107.QC.jpg
f3c276a394b12ac4efc7dda7955608e9
d2132bf0977470f0ea4829c1a0c1bd62b7920707
F20101212_AAAQLH jantama_k_Page_007.tif
29be7295032c6acf4cc3480cf83069e0
e2df700e7009b35a9daefa94b8dd99c527074870
14467 F20101212_AAAQKU jantama_k_Page_074.jpg
747d3e4b06ae6d32df97374aa90da526
257c87826b2ec5369678b14d7830bf24b7380491
F20101212_AAAQLI jantama_k_Page_037.tif
f3477ef8a4452f1b2ecb6dd2974d64e2
598024fc0b857701834f1900100172fd09a7ca53
6230 F20101212_AAAQKV jantama_k_Page_056thm.jpg
85c87d2d927b27a6c6f97b370c161298
47f75620bfee38942ede4705d8888a21c7c2f247
90990 F20101212_AAAQLJ jantama_k_Page_094.jpg
42e45bd3960dd611d26d4808df7c7f39
bbc96511c0965e618c64f8e6968607738bccbd69
6842 F20101212_AAAQKW jantama_k_Page_049thm.jpg
be3e65419b5a384ceabf026afa9223ba
3a2127b55d283773c16b714db512561e86a1066b
6185 F20101212_AAAQLK jantama_k_Page_106thm.jpg
c9aace476161976f02852a64487ee974
f1dcc2cb5c7428d151f20a4cb42865f3bdc7a5a6
1051976 F20101212_AAAQKX jantama_k_Page_062.jp2
23a68fb7c7bce28a6460535762d669c1
b7c80100e6589e35a1c640fbd3446f7e3e880552
1051972 F20101212_AAAQMA jantama_k_Page_091.jp2
0c7fa42bf7b5aff4fd8a54a9f0eb4913
10843a30716d50197924bbe3fc9bc4d8fd525817
89808 F20101212_AAAQLL jantama_k_Page_020.jpg
2f17739fb26219779c0f3807aa0e5020
e4ffea18d544796231007c76ac4309d83d01f910
6855 F20101212_AAAQKY jantama_k_Page_132thm.jpg
30956793bfbbf9e49e10bc5de8a65bd9
c51c4d588cc1167070c05d0d6ae1a331aaf70948
26190 F20101212_AAAQMB jantama_k_Page_113.QC.jpg
154607c3b9de49ae84ea02058eed8eaa
7b8145967e1f46935afba73e738a178029b47472
1301 F20101212_AAAQLM jantama_k_Page_045thm.jpg
7bc7a99517713ac50713819564f2ad01
d33599b1b092a6cdf1816406c3b7b9b8e98496ca
F20101212_AAAQKZ jantama_k_Page_082.jp2
267a8e93375bde57e50ab1bbb5ba264b
0bd8776674fa507af48294f13bfc30bb486a49b5
70813 F20101212_AAAQLN jantama_k_Page_068.jpg
673bc98042df739762f518c4e04de4c1
0072af22c8576df966aa1c4e63e315f82971870b
80433 F20101212_AAAQMC jantama_k_Page_096.jpg
c8f2007dc7ac7ec00c00f065fa76662b
5603827ac79fc778a88127d9275d2cd7859d527a
14915 F20101212_AAAQLO jantama_k_Page_045.jpg
8dface080fb9b59157f32936c4d6de5c
52cafce8490329c378676dfce968a2ebe08fa988
F20101212_AAAQMD jantama_k_Page_133.tif
2153213fa489fb1001c8ccf99b6c0d2b
40ce82e8bdeef00b5bafe6681136385a3a642d2f
F20101212_AAAQLP jantama_k_Page_136.tif
b96d11c19877123c470759c97576b52a
140f06d1aaa122dc0bb6cbb9da76f706c8dc5d12
F20101212_AAAQME jantama_k_Page_086.tif
8b643033090d7bea7eb9d277377e3c76
a77417611056fe471d894fca6c14d31b3975d99f
1051947 F20101212_AAAQLQ jantama_k_Page_037.jp2
c2d380dea845cb129c1e54c9abe33eee
213ee00a23f1fd58e0daf6768919c4ad2d87fd14
29038 F20101212_AAAQMF jantama_k_Page_092.QC.jpg
8092a3516a696816a3505bdaf56bef99
3d788fa65dbf59aec0d10f533cd78bb47d8111bc
54738 F20101212_AAAQLR jantama_k_Page_114.jpg
b3215e5bd7232b71ad17c68e5a2d9358
569927cbbcad028eb4950fc709837115629f38d2
70560 F20101212_AAAQMG jantama_k_Page_107.jpg
2269fac292efb120668ae89408274886
61a46aec5fa2022d1763fd637cc13e9c082ed668
25076 F20101212_AAAQLS jantama_k_Page_067.QC.jpg
a71fe6ac3dd71602f6058f4c9683158c
b33d02dc66bb3411087dc172a39dea7ef900aeab
62777 F20101212_AAAQMH jantama_k_Page_099.jpg
8931e893af1d10db5c84d5639e82adf9
a432c8a873b56763c3db1607c2fb976aa160572d
3773 F20101212_AAAQLT jantama_k_Page_073thm.jpg
7642aea8e1b01f54e7f321ce9e0401ec
9c720aa7afa443489ed004645bf8d7e28b41202a
28374 F20101212_AAAQMI jantama_k_Page_128.QC.jpg
626a0454e2b0469e0241ce1c5a5714b7
4ccec61e5b35e60772a963b79806ce7550b68310
43266 F20101212_AAAQLU jantama_k_Page_119.jpg
d3a91fd0d7a42464c08a28cdc520ed8e
8b439d8702a34a9f51c77a75d4e897eb6cc60cff
8322 F20101212_AAAQMJ jantama_k_Page_102.jpg
da6645ab385e58e7a5e7509634032d17
75e72b307c1a4ec8884391102f3143b2e2c61fd5
1051959 F20101212_AAAQLV jantama_k_Page_117.jp2
03b6cd46c576b644d73400fff1aaeaf8
834282fcb54da64ccb849197cdc1be5328e8fd07
30233 F20101212_AAAQMK jantama_k_Page_077.QC.jpg
dd60eef6162103a125118ee3188c3434
f45bc68a6e8bbf11f6790413a43e3fda684aa03c
26950 F20101212_AAAQLW jantama_k_Page_054.QC.jpg
84aa61e1b8f64dc419a5256d46d0a372
cef348f27b0e43a5c87607c071ccb7e3eda4d094
253477 F20101212_AAAQNA jantama_k_Page_074.jp2
1db0126d966b369dda32e955f7cf4bec
cff1de4e0943a2ce6c130afc9184c157ec934e85
5895 F20101212_AAAQML jantama_k_Page_085thm.jpg
85adb0d338aaadd7ff83144939a8cdef
e4e7f77a522a22f6761ab8d674ac9d3057991d5e
261271 F20101212_AAAQLX jantama_k_Page_001.jp2
dac8b7578c14de78aba78500db1762a6
f003e53835556a9dd1a5e7106dcd72ba76a09da7
1051978 F20101212_AAAQNB jantama_k_Page_007.jp2
696524113fd5c5e2d084428751c52467
d20a9e29ab746725d036b572ea0c8b3bef8d43b3
82462 F20101212_AAAQMM jantama_k_Page_113.jpg
b958df67e21c281cbbe13beee444e7e7
abc43d2864d3b91c773eeeb77782fe9c9e5abe26
26464 F20101212_AAAQLY jantama_k_Page_018.QC.jpg
4fb4423c5d40ba98e4edd331ee0e99e6
e32165b6e715070b49f8410cc3e5bddbe52c81b8
F20101212_AAAQNC jantama_k_Page_087.tif
797a66b0c500c1b0ab53dc6bb45e93d9
6af05c9c9afee3c55ebf2149df905034651fbd23
F20101212_AAAQMN jantama_k_Page_062thm.jpg
ea9ec196f1953f24014bd628eac81864
1de082d98680c504204365dd6709c5797077b2e2
7025 F20101212_AAAQLZ jantama_k_Page_029thm.jpg
33e8fcc735d7d379de2470cc0da52b3e
0731778183f48c72c7281e1357cf4c02865a47ac
91438 F20101212_AAAQMO jantama_k_Page_040.jpg
cd66f9495d02966ba2377126107e35b1
c004e2128731befeb46cacaf4d5429ed289dd3e6
3640 F20101212_AAAQND jantama_k_Page_058thm.jpg
6c1f1b23988a124da7d25324211e2d85
8340fa01cb6fe990698829dd0e99ccd4751a4e7f
28094 F20101212_AAAQMP jantama_k_Page_071.QC.jpg
8f199439e78124c15270d1c67e314205
7c6bd42dab56fc102abb2925bc9be15167eec4d1
5957 F20101212_AAAQNE jantama_k_Page_009thm.jpg
d5120af9eac96fa7ca7836e3557120df
7872615442b5f384077f2924171d80b9e5b7fe60
106300 F20101212_AAAQMQ jantama_k_Page_060.jpg
29d234c7333dccf0d2bb15fbf57c2974
ff9b78cd7ddc8c401e2925a91adfc618a3dc4ff5
1038197 F20101212_AAAQNF jantama_k_Page_097.jp2
3bdda0b7563270277f6c6c341af8927d
45ba07e917e7225fa6c587dd5b24f522dfe18059
96167 F20101212_AAAQMR jantama_k_Page_034.jpg
39a5c6b4dbb9c5d2e62244ca64fb897f
072b3314b01f0937c138e603ffe9397c29427372
F20101212_AAAQNG jantama_k_Page_031.tif
cf085babf22380064dd19783e47f43ae
4519f580660952f1d40366214f5be24bd57b1f54
1011753 F20101212_AAAQMS jantama_k_Page_043.jp2
aba36faf8ff399b147a1b674b881eb06
55d2d5c395f4daeb283550610d3813bdef877b5d
78066 F20101212_AAAQNH jantama_k_Page_139.jpg
b7db4c680e3bbc7227a543f2aa3b5e98
063c4decc4f21fb3c2861c4f564002bca8d69309
85690 F20101212_AAAQMT jantama_k_Page_111.jpg
52dbfaefc9259c3ed783c1e65a1690f5
2a4c7807ff9b95f61fc3e705c01ae7cf290a90a6
F20101212_AAAQNI jantama_k_Page_047.tif
3f3cebd552ac96bb634b32c062a9a7ce
f5486fda260529e2fb17121e7b42d279d52acaba
84605 F20101212_AAAQMU jantama_k_Page_044.jpg
dbb5e963dfea9319e9f15c9be823c61e
54515df494eb936283d97312866d03c77e1399f1
F20101212_AAAQNJ jantama_k_Page_061.tif
854b5a8da4024c61c3c277b7bb2fcf26
e28bcda63121314620f4859bc3c0b17dd6a683b8
24998 F20101212_AAAQMV jantama_k_Page_009.QC.jpg
6c6f194ffd8e01bb19fee4189700af7a
bf8cd1e3cae2809c960079515bdfcdd9aa92e9a4
F20101212_AAAQNK jantama_k_Page_117.tif
2158b82ec92e8da85ac10d5e9b5d2193
9754b77165d0aa553fa624482da56da3faeb9fa3
6503 F20101212_AAAQMW jantama_k_Page_007thm.jpg
9da001193fd1c1e95118f8cd9df86783
f16c7112ddd2a2655bd1c192a1b83c31d8c21f67
F20101212_AAAQNL jantama_k_Page_019.jp2
33d62ef92f53b9319b44e395944739ce
35f66623db098c5fe22eb1bf299b1fdec544efd8
1051963 F20101212_AAAQMX jantama_k_Page_103.jp2
8dbab3855cf39e09525321785c8a99ef
ef0f1f48ed06dc3314765855cc3bbfe6ccfc56d6
F20101212_AAAQOA jantama_k_Page_054.tif
611f4fea578d237869ed9530149f07ca
f65e67b429ec37a089ec861476517ca7df250a39
F20101212_AAAQNM jantama_k_Page_085.tif
2aa4ce3c95477d0d062b4d25ea39b3e5
dcf8c905b72700d79bd79f3fd286f533cc0da503
95651 F20101212_AAAQMY jantama_k_Page_115.jpg
a801480630117c59572f811b7795c20e
8fd05ee6146b4045dd3584de3f601bb326268a56
F20101212_AAAQOB jantama_k_Page_057.tif
c7f98d2ab96c6eaf64ae37e5d5295fe1
100cdc36f79c7add9cbc9d297d1288660cbcdac3
F20101212_AAAQNN jantama_k_Page_099.tif
d3dda5288a816917d4da4ef9e672aaa9
dcd17823c1b4737fdd08a1a903740112c33fee30
27815 F20101212_AAAQMZ jantama_k_Page_110.QC.jpg
64d7d7cccdcdbbe91840942c611071c8
34acf0e4f534071b5b31266c24b5693cc024a198
F20101212_AAAQOC jantama_k_Page_053.tif
fc313e374df571a8362cee38d576cc8b
5ef9d8fbc55899a21164a8822d45e773d9cef67e
107949 F20101212_AAAQNO jantama_k_Page_133.jpg
e2a7a628fd36d64d65c89392b0c29e53
440f04f960723cf2d96b1eae3e043e944b27b8f2
F20101212_AAAQOD jantama_k_Page_002.tif
7c138b0f27d51f896f8090100d661524
329315c907fc1d1734f6feee8eff83c0ced0dd3f
5435 F20101212_AAAQNP jantama_k_Page_107thm.jpg
333c47c0fa5308b16ba110a247603310
9b0009e157e501e8410639f6b1985142ebf32d4c
F20101212_AAAQNQ jantama_k_Page_089.tif
37848919e8a17ebab4578ce24de6572e
8f62927d39c9ea4ac5c9b7d611946b8112efd2eb
62673 F20101212_AAAQOE jantama_k_Page_100.jpg
9834b5335c0f1392468da5f49c4b9f4b
6edd5c2f2e0b028344d7904dfed1b45d33b03eac
1051977 F20101212_AAAQNR jantama_k_Page_115.jp2
adf435d62d7b76b50136f98b03f1f848
42e15b543929a1e7d8cf2feb779fd4cf0fa7090e
6817 F20101212_AAAQOF jantama_k_Page_093thm.jpg
64873fbb10a4f4247cb7c683bbb21958
7add1e3a885b519e35611568b11435b5028a4103
94735 F20101212_AAAQNS jantama_k_Page_030.jpg
d714be8d8427cb172f31a1ec6757521a
6472dd52eaf886793d0056aa34ca4829313db285
507494 F20101212_AAAQOG jantama_k_Page_012.jp2
bfb5df0af00c0bb6d406563f8c6e15a3
9b437b618f3a45471af194710c9092836ccf1a73
F20101212_AAAQNT jantama_k_Page_113.tif
878a7ea070a1a3abd3fa2e905cacd71f
10287b88d577b948c716a19b1672d8550b837985
82178 F20101212_AAAQOH jantama_k_Page_017.jpg
2ec3ec6ab7b7bed96ae58147625a66d7
fdf06d8bb9c95d2f81d0a26f1f0a82e0b25611d1
1022031 F20101212_AAAQOI jantama_k_Page_069.jp2
51d2d788e3c1155a3ae1976472cd79c8
a1e78a8eda7b461b53dc133eef2ac4257570a88e
92000 F20101212_AAAQNU jantama_k_Page_065.jpg
a772cc8ea0a88d8cafec1b9430612708
e355bed3af0c37b2e02e812ed89473ea3bc1b6a7
28262 F20101212_AAAQOJ jantama_k_Page_134.QC.jpg
2a21951eeb54aabf960297209a074ba2
383cefe239c2fe4d8d119dd0feb6534a57b5a651
F20101212_AAAQNV jantama_k_Page_056.tif
681818830eb3cdfa8581cd6a097a2181
7522653933b002326956adb1b69832e113cde804
30643 F20101212_AAAQOK jantama_k_Page_011.jpg
e2a0a575c504b691a74650f5e1627bca
eb70b4d47251f59053f192260f31f131a822d4fa
1051410 F20101212_AAAQNW jantama_k_Page_058.jp2
77526f071984b6621750e4c2007c119b
244c2feb9af1c03d90af9893611d4f749cef513f
F20101212_AAAQPA jantama_k_Page_078.jp2
78e95c93d6afa8ccdcb83431629a2ced
bb1baa17de339a8e8c9d201b184e84dd4ce913c5
F20101212_AAAQOL jantama_k_Page_073.tif
fe6534c5793303130299208078ee9b86
16144e332aae8de5a640937d073f730121c0421a
F20101212_AAAQNX jantama_k_Page_017.tif
90960e6e2412998dd12a6d4124a0d71c
2fb6bdcd70a76e93732c904e908ef86f9b5139d7
166880 F20101212_AAAQPB jantama_k_Page_045.jp2
a2cd4d63ffd96ebf9de8462001279bb0
3584fa5e1fbf424b6be07357bd4db357f01ff310
2715 F20101212_AAAQOM jantama_k_Page_015thm.jpg
c0d50e13fd5193a05bb4cdfed40c6145
b0a5f9504ccbb92605346c6b63db0fc5f5138667
F20101212_AAAQNY jantama_k_Page_070.tif
4eb97f973ec29649f93627c3dbdbf399
8e9ca807d6fc0d6de38bd5ba58cc1f718baa2584
459 F20101212_AAAQPC jantama_k_Page_002thm.jpg
29ac687b6bc136c7ee032c5828c4c533
f3730bf14af2dbcd9fead9281c9c69e52ab57492
28394 F20101212_AAAQON jantama_k_Page_053.QC.jpg
dae5c224d71c9615fc24fd534575a5e8
d5d6f486f8b34190b39d057cf95e595e68a14615
F20101212_AAAQNZ jantama_k_Page_045.tif
3b1843355bb7de22402a65073fedc9b7
0e11dc6d6c1e3827c61c8fb887f97df0a4cdaf36
102911 F20101212_AAAQPD jantama_k_Page_029.jpg
a7934d285dc3cdb99678f9d6b673b1b5
fb0a08f01d3fdc6744dcba214d28d763d1cfd8b6
9834 F20101212_AAAQOO jantama_k_Page_015.QC.jpg
b5ee6c118a5466e5676b217e5a38449d
c8df3ba61f382dabca0195e6cb8b1ba40243a39a
6092 F20101212_AAAQPE jantama_k_Page_043thm.jpg
55a9ccd995b9a8e5c716a2af76ec903b
bbd0f2c34d916fd6ee79db527f70f652f58375f6
90235 F20101212_AAAQOP jantama_k_Page_019.jpg
9e9696cfa54cabd5d49ff348cd7616b4
75307d45feccee2f324635df0c2df79a95f7e6f1
94794 F20101212_AAAQOQ jantama_k_Page_081.jpg
a64597eda097f2f08e87da34f832a2d1
282e21e6bad905cc351c3219f60734682c4a4bb3
6881 F20101212_AAAQPF jantama_k_Page_030thm.jpg
900c87964f278e94d7b159028229e6c7
35ef14088de2a7734336ac2ca02df4f5a2941906
6501 F20101212_AAAQOR jantama_k_Page_075thm.jpg
739c5b018a0924576e095a6b8e8b5070
211c65a4df0f441f7902a5c01845e1b01e487e3c
12658 F20101212_AAAQPG jantama_k_Page_101.QC.jpg
08e84ff24af3f6ecb2e7e25254404d3a
4c83cf513cc37f1f1f65bc082ec14931bb32a06a
F20101212_AAAQOS jantama_k_Page_035.tif
38bb032ee5e09926677ef259d349f3a1
9345115d8a0e81d51548a8938fa04deecf9e7751
F20101212_AAAQPH jantama_k_Page_048.tif
2f643304e2451b260b6933d5d3e2356e
5f032e67597745cf59b7486f51da83bbcf10768d
83388 F20101212_AAAQOT jantama_k_Page_056.jpg
bde9a9ad5ad3886bfb94642735a3083f
deada5d5729265b16c5df98e424ec4f7ed5ae833
27947 F20101212_AAAQPI jantama_k_Page_002.jp2
9ca9b14d10786780c61545e66fa8aa74
52e1258d5e229ba936c716d7a2d5b8170d91f6cc
1051934 F20101212_AAAQOU jantama_k_Page_106.jp2
4c180742942c01d5036068d7035865fc
98a2f95c3d21e674d55d0e7ef351ff0b85d4621a
28196 F20101212_AAAQPJ jantama_k_Page_064.QC.jpg
6dbecba004f0a44f5ab44a78a24f6d17
8b95ba44fcc622af1c2bd08f940c4c8bb3956c6f
114162 F20101212_AAAQOV jantama_k_Page_016.jp2
689e676c4ad758546c681e7905fa5938
af68c2995efdbecef3e27eaaa34b42132a8d9c3a
F20101212_AAAQPK jantama_k_Page_009.tif
6602921a3cb82cc5a9ca3fdd6072e97a
6dd2b915d2aae8490382ba0a62d7d8c74d22b8b7
4523 F20101212_AAAQOW jantama_k_Page_038thm.jpg
603d435d4ff79e2f94da8421f798593c
fa2a7c03cb4a4015bbf6919edf93462411731e04
6402 F20101212_AAAQPL jantama_k_Page_022thm.jpg
13a14a36eba5abf922cea00b8ffd0868
def8cb4296cb2549bc03239920331ae63d702e5d
F20101212_AAAQOX jantama_k_Page_036.tif
835c697fde034b9a01b7ecbd171df571
06951ca1f6c1893e32946d1acfdb29866ec2451d
F20101212_AAAQQA jantama_k_Page_014.tif
58a4af73ce890ebae080c8b8a679fe0a
d76695fd28995efcfea64dae2879cebadab866ac
F20101212_AAAQPM jantama_k_Page_113.jp2
f25d342e7228866ed5d0cdb52deb4403
d7e518b3d2895007394ee829f92d32fe269c799f
F20101212_AAAQOY jantama_k_Page_076.tif
babd7776a46c90f95f9d4fe0fe9929b9
ef53762374e62ff515cbc21ca43296dc57daf16f
92093 F20101212_AAAQQB jantama_k_Page_049.jpg
3d1484696737e3377329b5bc6c95efc1
5ab9f44ae3f9a86453bfb193d2fad6233188ebdf
5832 F20101212_AAAQPN jantama_k_Page_068thm.jpg
4b27815d8438c0300c4764ecf68dbf02
ca9bd8e30b21f732b5171ccccd1b4ec481ab6c8c
5790 F20101212_AAAQOZ jantama_k_Page_070thm.jpg
bc4f1c4d4b0eeff981056955e73e1750
3d73a9ddf0ca9cb44697a654bf332eff21264fa3
1051962 F20101212_AAAQQC jantama_k_Page_125.jp2
bb1d875b40fd68c487f690a01af6e936
bf00bdd4704b289ead6a04159ce07a1853241b66
1040985 F20101212_AAAQPO jantama_k_Page_139.jp2
2d5350246d6dc1d86a9fcccebd5b9553
691445deb2168579575b5994c67947c603f78109
F20101212_AAAQQD jantama_k_Page_129.tif
33b012847ac887b138de2ae77f957a05
08d8ffd5238e8412313381ae77284a285a9be292
6531 F20101212_AAAQPP jantama_k_Page_048thm.jpg
4ac77f1688bb05c43bf0bae1c0ede1e9
1da972a1774e3a9b7576aa1b52241c957d82ea78
5023 F20101212_AAAQQE jantama_k_Page_010thm.jpg
77e7e81c0eaa79f09cc8ffdbfdfcc09b
1c4bf613e8245fd44f594c3403553712103d0d3a
F20101212_AAAQPQ jantama_k_Page_123.tif
4088ecb2cb7e9d6bdfb3c36ad30e5df1
0580035a64129ed6cf7c8bebef5246607d948869
108725 F20101212_AAAQQF jantama_k_Page_131.jpg
7ee9af6ffa06aedfcbcaa2022cad28da
565ea68c6d5b3838404be42d6a6366152ccff82a
67821 F20101212_AAAQPR jantama_k_Page_070.jpg
ec5fab786561fbbee6c415afe2775044
52f92aabdb678b1a3f2bb3728c6f1a04b0168131
1051973 F20101212_AAAQPS jantama_k_Page_022.jp2
a6668d2e3de5dd92bc7d94bb15b334ef
e070af61f65d5e7e041456427d87d0d6c3836b99
96183 F20101212_AAAQQG jantama_k_Page_054.jpg
669043d41effb36fa1459a6cdc34a79a
20402f18bd508812fa2a8fdbf285b5c21c14e5c1
1051979 F20101212_AAAQPT jantama_k_Page_009.jp2
65d76b0b3af4d5048a1a78a0e0133196
877db779f5331c6048f82658524d76d5c67217e3
381766 F20101212_AAAQQH jantama_k_Page_011.jp2
367a15d2565ac1dcab44fecee149cf84
43c619e8c7285cea16439a97bd1b456b5cff5183
86803 F20101212_AAAQPU jantama_k_Page_026.jpg
a1e6c27ea7e83842a43ba81a570f9054
1450aa953e8ab28ba7c91393f6a005df5bf90b90
782822 F20101212_AAAQQI jantama_k_Page_038.jp2
80a6c38ede196e03e6446310fa87e9e5
e1c115a63e7fb0030a687668a65a239401be84b1
F20101212_AAAQPV jantama_k_Page_050.tif
b6ba088cf33b8f0fe6160d811a10d95d
fedc4ebee4bb5366f3560ed500222d296eacf166
F20101212_AAAQQJ jantama_k_Page_005.tif
32b07f68e1b539353bab749b29378e0d
aa979f2e062c7d04a1c747e5560d3e471d7cc3d3
476275 F20101212_AAAQPW jantama_k_Page_138.jp2
bcd945f5573b9f84dedd88c226486475
065173ddf2960f4ef14d7df8e1e81320da85451e
F20101212_AAAQQK jantama_k_Page_081.tif
f68892c3bc79d833726312b7ae506e3f
a412fc5421e0c5cb63792f837d56b858bab6b605
F20101212_AAAQPX jantama_k_Page_043.tif
57ca57f5512844510f2b9270530a7924
33ce7c1687ef7c2e519855331402ffc10bd52a3c
86931 F20101212_AAAQRA jantama_k_Page_048.jpg
fbcd50b780f57fa4bc57545185e3820d
96ef562528b00b146ae99200d694502d18e7e481
5580 F20101212_AAAQQL jantama_k_Page_059thm.jpg
482a86a2f9981db5dbb27c6420d7c529
768dce6a3a6ed932f63815e96e6171a7b25810b0
15970 F20101212_AAAQPY jantama_k_Page_090.QC.jpg
093bfd1d7ae39cc85e8ccde80f977922
7efde0f182e36c5dc9c0bf099ca9192b88162b56
F20101212_AAAQRB jantama_k_Page_063.tif
d9127643639b4ad8f086c25069163a64
5d8ea49d23834c7620b1b3016cc9965a57a3f973
88270 F20101212_AAAQQM jantama_k_Page_118.jpg
6af833f01274406a14b6554953232022
8fc3b44eeb931d21b29fdea3972cb453848352c1
88545 F20101212_AAAQPZ jantama_k_Page_051.jpg
fd5c1895dc1d11d6593b402b6bffe052
0a94f8e3654d0f9ce0110e8223a8e722959d77e5
27941 F20101212_AAAQRC jantama_k_Page_123.QC.jpg
e4b0ad2aa6003482f0e08e4fac94e0b8
2effc67c394dd9c1ca03920540f812e825ea1727
1051985 F20101212_AAAQQN jantama_k_Page_030.jp2
1b86bc6d249224ec2f8c6a8bcbd5da05
2e51ffc40f652f61b4897ec6b07bcad2df7d0b5d
780226 F20101212_AAAQRD jantama_k_Page_005.jp2
34c1f2ecccfb1a043af6fffb1398a262
0416309831165b1f9c41a01575614776c79732d1
28008 F20101212_AAAQQO jantama_k_Page_013.jpg
13604bc73caba8d4f581e5076fb8653c
735020cf823e7c06bb8ff364f2d98ff5e9ab2f9b
6546 F20101212_AAAQRE jantama_k_Page_035thm.jpg
3a23d624c7ec2d3f7c18cc001e220bb9
9732085ecebbfc16144a845158a5383c20e4c182
347529 F20101212_AAAQQP jantama_k_Page_015.jp2
f9855bc26249cd40d816ae0fac54633e
584e57d48d4deaca04205e3edabbdab37110f079
1051974 F20101212_AAAQRF jantama_k_Page_023.jp2
f5a4e368095109e550351b57f0d36185
5ff7583806238e5540aa6ff94b2512e10db6def3
F20101212_AAAQQQ jantama_k_Page_124.tif
aa86a901a49579b2b069b4cdcd7f8dcf
06a32128fc79488f46bcee6a1487093b44c3fdd7
19583 F20101212_AAAQRG jantama_k_Page_008.QC.jpg
5c8ca86e2658a41fde3ab0370c77c095
fe774beaf915e7e94161eb59f49fc2a77f70c1c4
28585 F20101212_AAAQQR jantama_k_Page_062.QC.jpg
2d958c712ea3b88d6fc5f8fbe1255651
48e4959066ef9dc1efff1f952e0dff2d11726c4a
F20101212_AAAQQS jantama_k_Page_071.jp2
9c47c844a6068b5ed2c9d29afddddd77
52dacb9ad28a8548a14bbedbde988df4d31d244d
79905 F20101212_AAAQRH jantama_k_Page_067.jpg
3e54d146d972c4e37ca3a582c35ccd12
5ace607ee4776c24b5405ab8ef5d9806593fa8e0
F20101212_AAAQQT jantama_k_Page_121.jp2
4124316a00ac3fb1c8969d8a5fa56b8a
0829b9d1852098f3344ff3811e80ffd7154f9908
905982 F20101212_AAAQRI jantama_k_Page_095.jp2
dcc10ffe278e5b48c942d070cff8e75c
d0040e19e39cc468173f29637e4cf0a65185ba1f
5294 F20101212_AAAQQU jantama_k_Page_045.QC.jpg
a09c98857ab9de746d7e74da973e6dbb
515770a98575856b50d79209141cc07bf18b4fa5
F20101212_AAAQRJ jantama_k_Page_013.tif
5ca8764f7e8cfe5637fbd239848e619b
74d071d54a56426c7813ac38ebc5ec91d14395aa
1051960 F20101212_AAAQQV jantama_k_Page_087.jp2
a8ef5b34387fef9120741df6a5c540ca
452a8a79e69b86145d0cdb850cff298240cad754
6612 F20101212_AAAQRK jantama_k_Page_031thm.jpg
5200389eb67fc9551cad692f7489d819
9fc982e5be2fa3028abee3c8468ef7a0a77d94e8
1051939 F20101212_AAAQQW jantama_k_Page_018.jp2
9c652cb17ac8f4403a695f0ced299679
9b3eae7ec82076b8681e5c30dd4d4c07472d2ad3
F20101212_AAAQSA jantama_k_Page_020.tif
a1386f44c8eaba264dde0f79d9615000
9438890313c1432f0a0b3dfc9812f042340b6374
F20101212_AAAQRL jantama_k_Page_096.tif
04c8e571056784b308442fa910259a53
458640321fa4d1a94f6e71d024347f9a4b39c677
123426 F20101212_AAAQQX jantama_k_Page_003.jp2
5af3ec631ea33d74d6059076c8d9a9f6
5beaab5ff814b49ef2074f99647bc3c2273d59d7
6705 F20101212_AAAQSB jantama_k_Page_122thm.jpg
e3ae3021506df48c1e568e4d39236254
2e982411aac624d3bb2a24bf72277d0d4c83fe56
6550 F20101212_AAAQRM jantama_k_Page_023thm.jpg
993040a5cc4afba8aebaa864db8e8b8f
52068d0ba5df320a7b6bbbb68dffff611ec03165
6948 F20101212_AAAQQY jantama_k_Page_094thm.jpg
e3a7203146fd03531bb6867740c1398d
77dbab94009ad3fd275d670ba8ea48216c19bb7f
88562 F20101212_AAAQSC jantama_k_Page_064.jpg
76f0e3f9f72626da70d4fb82184b25f6
476f14cd23376faaf22efc4c60b4176a02362c34
1051924 F20101212_AAAQRN jantama_k_Page_054.jp2
d15d87c9cfad4886ba9ba95379beb6fc
876d27a81ae896e736277fe875657f1c3c4caf48
25985 F20101212_AAAQQZ jantama_k_Page_120.QC.jpg
b227de985b489ffad84f72a968cbaeb6
7a7c4f4af1d53848351e6d4958ce1f0ac5c442fb
F20101212_AAAQSD jantama_k_Page_120.tif
3b9e3fcc45dfbcb28ca2897c5c6c7a7d
68aaf7ba6fea0fc8f281133974cca327ed662a95
F20101212_AAAQRO jantama_k_Page_071.tif
873597d0f330eb4296c96ea7eb930bcd
b75c8d5b06038102e34f26e5f303857c38ed1414
29730 F20101212_AAAQSE jantama_k_Page_081.QC.jpg
554c389eb97585caef047582d1df213b
a9236ecc2e916e2bf737f46ef8702e7106bc8187
101549 F20101212_AAAQRP jantama_k_Page_128.jpg
e23d5cb20798bcbbd9bbd772ecb04aec
4a0a352d500c97f59009cf100ba4006fbb21219d
103724 F20101212_AAAQSF jantama_k_Page_134.jpg
4d75e68459405c21371494f1ae6e2613
51e468222cfc355425f5f9429ac51a5fae0beb68
28619 F20101212_AAAQRQ jantama_k_Page_050.QC.jpg
9475964c9f0f40373936c96abf07d250
465524df5124674a73725cf7c91092406e003a62
1051945 F20101212_AAAQSG jantama_k_Page_088.jp2
7d9e80d0a0cd47363b5c4d6e11bf379e
b3229b4fda149707292e9cf332b2cf62e1a56b64
F20101212_AAAQRR jantama_k_Page_001.tif
e81454ac972f250692321594cc90bffe
bc11da93ef8cf595d10768f47ca2201eafd17eb1
22602 F20101212_AAAQSH jantama_k_Page_021.QC.jpg
b1fd7a9b70c3a457da161d8bbc87c3a6
d07822b54fe524472046a391b047cad4b0c566a9
120380 F20101212_AAAQRS jantama_k_Page_102.jp2
e259e6d3a5021b0d03296fcfbfc967b4
350f1aac0108877cecfcff07e3d7f6ef90ceeaac
F20101212_AAAQRT jantama_k_Page_052.jp2
abaddb8d4e8fe8ebdc504e8d5caab47b
75f3f44443c73788d05db81c788ceff3a4685d6b
F20101212_AAAQSI jantama_k_Page_110.tif
675da09822acbb0ac2448ba253fb68c3
0be81a42b8b4fed90e8b538ba9350e8707ca3e4c
5920 F20101212_AAAQRU jantama_k_Page_072thm.jpg
f96ca62684650d0f885fa2dc281b05cf
cc4d35c0c0fd6851b10e2e836611d1b76635e235
1051968 F20101212_AAAQSJ jantama_k_Page_072.jp2
cefebb64053d923123c18db4147ae732
3bc6087c94d26476b349981d9dd7851b86237023
F20101212_AAAQRV jantama_k_Page_026.tif
4a2db1728c48fca42c1f7eff93369808
fe0748291ee83843e5dcc05bee62bb2d5f77e4af
5641 F20101212_AAAQSK jantama_k_Page_039thm.jpg
9a60eda7b2649eeec4814d5d3470aa41
8788a2f3d7f70c0808738d62613c04a1d82c21f4
5921 F20101212_AAAQRW jantama_k_Page_096thm.jpg
a907e0863d621174a52f26a5e658e40a
fa27216598ae84a3823e4b1b0a82c9f6a6e64643
F20101212_AAAQSL jantama_k_Page_074.tif
35433c371f6ca3a82afc0fee24f41c9c
e64da64cbc587ea7ed89b246dd54b3ef5166ccab
6931 F20101212_AAAQRX jantama_k_Page_040thm.jpg
c505fc34f9591cdf349a9bfbde06f7e0
c567e1f9e01c3abe00620873d46dbd06c984c0d2
85554 F20101212_AAAQTA jantama_k_Page_018.jpg
b68c39c7865d46bca8d87c084498e1fb
a80ccfdebe1e74f33822df5c5a6525f99a7f5475
1051815 F20101212_AAAQSM jantama_k_Page_059.jp2
701d2d3d8a6afff682c428ead85049bb
f24adcf5ac5dd13bf4ae4da225738dbc51ee194d
1051967 F20101212_AAAQRY jantama_k_Page_046.jp2
a933699d170cf7458d4d5762d146afe8
853a4805b873f826f3f64869e4e22a65f79c7281
5673 F20101212_AAAQTB jantama_k_Page_024thm.jpg
cd9b95cb1d0cbddd06624c0fe94ccb8b
bf99883a10e4ea78a52314d23e420d8dadd9ecef
F20101212_AAAQSN jantama_k_Page_040.tif
9b805bcd776b83ae51f4dce48ef71f5a
0ee251f3c8eb7c0edfe9b5051d5cd0319554e830
F20101212_AAAQRZ jantama_k_Page_098.tif
f9a3039e9a7f7ce6bd3ff028e2bd11d8
03a3ee22711c11add3a0bde6045deb7f350dd194
1016072 F20101212_AAAQTC jantama_k.pdf
fdfe32b1224639ccf8c59068dd49b679
616a52b57462155366e0515df8bc6716de9235ca
1051966 F20101212_AAAQSO jantama_k_Page_049.jp2
d20faca15927241bf16836e31adb751b
0c267e5478140580680cc911e8d1c9b872882116
F20101212_AAAQTD jantama_k_Page_016.tif
19874b55b211b18b42dcaeb9cd0039f1
954e147974c29213510a3bbfa9603be60df1d7c8
3800 F20101212_AAAQSP jantama_k_Page_002.jpg
5a4f05d499f398307b84784994b7854f
73b54f648eddeba856fc9954035d2f6f853e060c
6572 F20101212_AAAQTE jantama_k_Page_117thm.jpg
d50e8e763a3c53c26ba504bcc733df40
9cad942656c5198fb19b220471de3b0df15ad541
28025 F20101212_AAAQSQ jantama_k_Page_093.QC.jpg
8843b54c82fa7881cd55f461ed228fa4
e8a4fc1a2d351c5e3240a526a9f6e00898cf5c71
22844 F20101212_AAAQTF jantama_k_Page_024.QC.jpg
677aceb9eb5a48fd8bb5e2745ba979fe
e5dd59455710db619ecaaf75df4c1011ebdaec93
F20101212_AAAQTG jantama_k_Page_111.tif
6dc4aa52ef87b82d2e4f14c51bb56b73
9494e02aa431a1050ec82b83b54fd5046bdb6f8b
77950 F20101212_AAAQSR jantama_k_Page_085.jpg
281822354e2591cce4fa2884c2439545
4d92ab9957435b3d69c53d9f62874e21258506f4
F20101212_AAAQTH jantama_k_Page_024.tif
7f0b0afa9792f0912a822e4ae71abaab
e2b21d2b8b08a9ae8f9e6c294f779dcbe0a2ba8e
F20101212_AAAQSS jantama_k_Page_084.tif
21028e67ed0362582464076c16208eab
41a0fddac87834998be840f58590cb3059f386e7
4391 F20101212_AAAQTI jantama_k_Page_074.QC.jpg
d947d686b3d85312fd7662ddc38a0022
a15fc44b448a2615c4ddcea3dd6a82d5e65bc9ad
1051896 F20101212_AAAQST jantama_k_Page_123.jp2
3082a47bf43af9029e992386652c6660
02f79cb79e30d93d97fa7024fc6c9eb71913f401
F20101212_AAAQSU jantama_k_Page_027.jp2
ec78eee43f3ca607105cc0e735b2a7e6
7d4776ff57e93752d87958e89a939d8864de6694
F20101212_AAAQTJ jantama_k_Page_033.jp2
dcc9bab3155db950def41e3d83137d63
e86a3f081e099e8dd70533331458dd5feb3dd149
952907 F20101212_AAAQSV jantama_k_Page_107.jp2
3c084eec871294ceb2bc606bd847d92c
6466de08da00f06a0fd8f1157a53d79bad4b0e11
27523 F20101212_AAAQTK jantama_k_Page_034.QC.jpg
c62f7a1383f02ebb7c8b230ee0369274
c9c36abd757466ad1274ddb36e17df4053d43627
6239 F20101212_AAAQSW jantama_k_Page_018thm.jpg
41366a66795a6610ccb40d1b8540e4b5
dad95080f4cf29dfd477f06826b0ee4e849bba6b
14165 F20101212_AAAQUA jantama_k_Page_058.QC.jpg
046de15aa83f0a88957baa820e6a6d83
7fb09f20f51fe3b7a1ff4d89bc69da331a11c0e2
1051964 F20101212_AAAQTL jantama_k_Page_129.jp2
52fc783d1654089f512df0bd56da25b1
e3631a9178c0f8fd29438e72a9ca389fa3f7a668
1051980 F20101212_AAAQSX jantama_k_Page_137.jp2
e28f732a37828c00ea21fbabb3772ea8
b8791ef8a146316de880df39b2b575d035aaaa78
F20101212_AAAQUB jantama_k_Page_046.tif
b02cd64417bc0f9129535084f9acfbdd
de4af9ac169aaffdb676012e19c56be49fc8d7df
F20101212_AAAQTM jantama_k_Page_134.jp2
ba6446cfa43f31a48a4625e81aa7cb10
2b11733321c92ee048e3f8e445784c0e89f9ade2
6757 F20101212_AAAQSY jantama_k_Page_080thm.jpg
8130cebe4f51209e91c32da628aa3b02
5b850cc8af114ec169aa9d4c252b4129326a8ba5
F20101212_AAAQUC jantama_k_Page_041.tif
7f58d23e4f61e78e36e84f8fedd4801c
e60d2e8d91524dc1714edbfaac2f1280d0a14647
867810 F20101212_AAAQTN jantama_k_Page_070.jp2
bdf2d0a6371b37b12d4a2e07925ec0d2
57d2ecd2f08a80b299fc79069b049d100c6d5357
F20101212_AAAQSZ jantama_k_Page_006thm.jpg
0c08c870183cdd38696c77daac31ac45
0fdc507919ac4e003dad4c345bb87d03357f7114
22594 F20101212_AAAQUD jantama_k_Page_055.QC.jpg
6a294792a3df031090108f87015339d9
3b8e45df904cc6f85c6d518b46dc4b2f8006eb22
F20101212_AAAQTO jantama_k_Page_091.tif
25d73733e9631cada4c031e81e835c0a
57cc6b8c9bb962183c2a874a5bc4d27847805e97
F20101212_AAAQUE jantama_k_Page_092.jp2
a3301127a2c6e3e855939bc1a022e740
1d534d0f9d724c85f3edd724373d9842a303d663
6409 F20101212_AAAQTP jantama_k_Page_052thm.jpg
079eaad7bd24c81c7f90f0118fde000e
fc53e9b5cf0124394e26280d9528e90466058cac
1051138 F20101212_AAAQUF jantama_k_Page_024.jp2
b201a2942557d1134c3e4b79678c0464
146764da396ef92b12a69adf380810fcebcdb134
77483 F20101212_AAAQTQ jantama_k_Page_072.jpg
9e7990fe6910e9ff282303f1c11b7ab0
d16394214a694ccc52368c680e537155ce40b38b
5891 F20101212_AAAQUG jantama_k_Page_082thm.jpg
c48d40ddcb3944eea635a497d9a21355
95672c9dfbc07621082b4c8dbed8f3070fa91f51
26398 F20101212_AAAQTR jantama_k_Page_106.QC.jpg
622c369960a2756857b088c8d6b00b04
f1c1d7ba59bcde6594f1d48411d4bcb924451abe
5548 F20101212_AAARAA jantama_k_Page_109thm.jpg
1db3464ed37f717399f7551a395797d4
91fcc3e60cf07e1189c6064fe24ea69d9ff41d1b
1051921 F20101212_AAAQUH jantama_k_Page_076.jp2
d5df08d978c1a51c3f66b74119054e31
0977491dd38971e02fc4cfc47dcc76f57764259d
F20101212_AAAQTS jantama_k_Page_078.tif
c62a1af7a567149e0d4f252ed113e45f
4b06539ecb94bf37b9d151e49ca159e6996d89f4
84131 F20101212_AAARAB jantama_k_Page_106.jpg
f0b9b905c903b93771e1e1a0b26d3530
3af664c95ede6aca1cb9cabd0fc4d50eea67e9ee
90871 F20101212_AAAQUI jantama_k_Page_086.jpg
8141788c272636ee394545491d3add57
ec691ff630d4308548a0d57d9a586c45ae0427f6
48915 F20101212_AAAQTT jantama_k_Page_101.jpg
7b46f32b796e829be05391b5c93c2848
1ab3c4bf3162dda723bc6cfbe38ef3595b67c69f
86852 F20101212_AAARAC jantama_k_Page_046.jpg
aecb89b9ed2913cbbfa6c13776b71a5c
2abc4cafee28841116b8cfe98cf3d7d9c48b226b
F20101212_AAAQUJ jantama_k_Page_121.tif
5d188fa1308e7b8329c4ec323c4e0d72
334a7f865687686bef0a5ab72b2317ceac47def2
2040 F20101212_AAAQTU jantama_k_Page_066thm.jpg
fe6250b49a49a5de0b0f61405a47635d
f156cd741e1d9952bf79eb578dcaa9de3cb5fad7
13577 F20101212_AAARAD jantama_k_Page_119.QC.jpg
a0d5cdd57a116340d4111f8fce3af5d4
e4574afd35210a63c4f65ccbd62612e0a50f3a07
5878 F20101212_AAAQTV jantama_k_Page_017thm.jpg
0098761a708b2c7bb3e02a5f8d8e2d12
09dbefa40e98abe540d706b6a2b72e98d5010d42
27675 F20101212_AAARAE jantama_k_Page_061.QC.jpg
5de3475b452d1f8636050da6b69863bc
ed9a04a9c3d6eeb1c6d4bc1590ed42e387f4e8e1
F20101212_AAAQUK jantama_k_Page_008.tif
cec9be9d22d8a94489e2bacf7af285e9
56b527a3a53e0615578b224a9a19b365e78cfbf6
94521 F20101212_AAAQTW jantama_k_Page_079.jpg
a931e02c0b910262d5705e0d634a5725
e667e065dd37adc9ddb1299c464e9e51f179b780
23200 F20101212_AAARAF jantama_k_Page_043.QC.jpg
def2536a3e30616472b052620cf42e70
b6670889885cc50b75236fe854d3c47372b08356
29621 F20101212_AAAQUL jantama_k_Page_007.QC.jpg
c0e8001f2361611ca8c324de9604d21e
3129146d64a0bc30b5ae88d07508be9da9a8eebc
3289 F20101212_AAAQTX jantama_k_Page_014thm.jpg
e3b6ebfc16e2bcdfd43408faad6ab194
e82fa94aa48ee9bf0a1dfef8ad748f59d118bf96
F20101212_AAARAG jantama_k_Page_059.tif
6e89925469cd47e9fac91aee2da868fa
d9c33366a3995c83c45109cd0b4deabe89faf88d
27247 F20101212_AAAQVA jantama_k_Page_036.QC.jpg
d77ad933f705404f38df9933b7ae3aa8
803d1e223b7945d4d7e5f43f4f249ade69d9bf66
F20101212_AAAQUM jantama_k_Page_136.QC.jpg
d0f86560e7fd900745daf73b37877232
b1499d5b58d7e1204637033107c5fa775b7811db
6870 F20101212_AAAQTY jantama_k_Page_086thm.jpg
0c382912ec24f43f1fe04dbf9f832776
296544d358e55128e2665e04d435a468d6adff1f
27039 F20101212_AAARAH jantama_k_Page_051.QC.jpg
e18559559ff480f6dbd459ba505ce761
f397baa31e588240a9b375ddf4ad51303edbaced
1051950 F20101212_AAAQVB jantama_k_Page_111.jp2
591446101e2ab408209258a05a7ad385
2b40c23f42781ff9b4d44e0c8da98d40c815ffb2
29574 F20101212_AAAQUN jantama_k_Page_086.QC.jpg
0fb671beb00ef605dd005fa9de5b7116
bbff20c51dd4d609ff6c8de6f83cb1e2798c1df6
F20101212_AAAQTZ jantama_k_Page_025.jp2
c8569bc3f2ff72bd75b7934fc958658f
2356d53f886f7ff69f5be28c2c2551be7165007f
7276 F20101212_AAARAI jantama_k_Page_126thm.jpg
a02928fb8c8dca8ddda889a0b9797215
0dee1766ec5967614259a39bebdbd2b1270fb2ba
6340 F20101212_AAAQVC jantama_k_Page_113thm.jpg
54f3938a5633b26d0c1debf433a591bf
140ca045937be02bd0f3a1de17e47357ce4850b7
6472 F20101212_AAAQUO jantama_k_Page_027thm.jpg
5375ac2d6e486a1f42e2dd352e1dc87b
351679214942b9d7ef5056ee620c0ead68c53e14
1172 F20101212_AAARAJ jantama_k_Page_074thm.jpg
5fc45ede27f8a40d922abc2a7decede1
2109f102e66cde5d1eb407253bc459dfe4387c79
26905 F20101212_AAAQVD jantama_k_Page_125.QC.jpg
e928c82b6c9add83f6975a5dad3e503f
4ed5449f74d0e74b52108bd0e37609c3aee04eb5
F20101212_AAAQUP jantama_k_Page_108.jp2
dd048a2d47ec8020f7f3c8229017f2e7
44ab08bc473c696ef97725ccefc6d6c956756e6d
2685 F20101212_AAARAK jantama_k_Page_101thm.jpg
d83f4668f6a7593dcf9618e944736828
5b0330392d87bb466b5c0fbddabcb6aed4a11f50
F20101212_AAAQVE jantama_k_Page_127.tif
331c0db59e34717d8dbb0538ab3147ce
ccce8f794a23243c512cd99c3aba6b50ac9c8efc
6445 F20101212_AAAQUQ jantama_k_Page_110thm.jpg
45a37c2da4e75595af132bbff1a50307
d85e3703da4717c19407398974e6cbae09064ec8
78644 F20101212_AAARAL jantama_k_Page_024.jpg
2737bcdb4bd6dfa40bca39ef01e1227f
5604d4181b5a69fd75d5f60192f9961ba0792a60
F20101212_AAAQVF jantama_k_Page_131.tif
edf8faeb4861a82f6c97aad866616c57
fece1fea34c61b5b56e08e1a6471f01a7d69fea7
27730 F20101212_AAAQUR jantama_k_Page_033.QC.jpg
22a1dd9b52c3a3bf3f5f0aa993243ca2
5e7a3549fb25268ca8a15d8bfbcfcb748cd795af
24205 F20101212_AAARBA jantama_k_Page_139.QC.jpg
8e6a37f5f4a2893d33c7df9ab51796ae
c9daca51741f5c2581b5e844da73f60edc9bc4b4
73558 F20101212_AAARAM jantama_k_Page_021.jpg
f291796a833baaeda0791d3ce1ccc2f9
367088b03324ed1061819b7da081330a8b73ae9c
27500 F20101212_AAAQVG jantama_k_Page_130.QC.jpg
da0294ae799b03baee30a1c9262e6bf7
9433dfe65162ea993f169b9f2e2feec7bc0ff7ff
F20101212_AAAQUS jantama_k_Page_114.jp2
8612efb6c38966e9a8a333a33ca8632f
264a721157753a3453437fbb708dc9fb7b68b1b4
7033 F20101212_AAARBB jantama_k_Page_134thm.jpg
4607d289d53b4bcb8bfe3d482c14cd53
daf085c10b84671dbd1664377778637b37a299de
91129 F20101212_AAARAN jantama_k_Page_025.jpg
75b6ae0061984a8ffe607ecc6c57e43c
4e381498d6581212836787256d75d34304b44756
1051975 F20101212_AAAQVH jantama_k_Page_042.jp2
36cf83f9e00d33d8e2e04cbcaea0b238
5c5b2e6d877d79e788db6f7eb86a2ffabe017d12
489185 F20101212_AAAQUT jantama_k_Page_014.jp2
fdcd2bc1e42ee7d222285349bc8f5beb
3c3d06c897582be685bbf0a07347d74cd5f6ff91
F20101212_AAARBC jantama_k_Page_075.tif
b8a18d56011549f494a64c250537570e
538d21010ace13f2310336ed6cdf8e98c86a8b4e
24127 F20101212_AAARAO jantama_k_Page_097.QC.jpg
6ab52ca3f15ac071aabe4adfd27c01d4
c53ac63ecb75fbd232dc17ed658d80fbb998facd
92857 F20101212_AAAQVI jantama_k_Page_116.jpg
3e0e0f7127bb0c7e455ebe22b81a992d
02c2e8c385a4403c1949686f1ddb7ba1fde2d636
F20101212_AAAQUU jantama_k_Page_048.jp2
8f198581c128ae5b55dc10062e8b6efc
7d84bc6232a52956509852b28c3b7723fa1b4a64
F20101212_AAARBD jantama_k_Page_067thm.jpg
eadaaaa2ea90e1b1ef695e17fd3d9c31
b28c982bfab67e3d57abfa496f3a2e965e093348
1051983 F20101212_AAARAP jantama_k_Page_040.jp2
778197aa1b9936c73ecd52625054a1d4
02e74f2d00d04e4cde672f46d2466bb31ab023bd
F20101212_AAAQVJ jantama_k_Page_056.jp2
a75ee8fed0c16082e66542a4a6b0a404
1d36de7980de4355bc6a386cd833b84a1a5a017c
7352 F20101212_AAAQUV jantama_k_Page_133thm.jpg
764830c34b53008de0cf92fa529d730b
3c2dfad7d35093c8ab9d7d370483132561ad9013
13340 F20101212_AAARBE jantama_k_Page_012.QC.jpg
8f0dec484f27b16b6438beeb331b557f
71832e6b6d74119094a21c12ba2736c11496f3a3
1051970 F20101212_AAARAQ jantama_k_Page_084.jp2
9f0c09311a197b9f2040ff9ce37f3817
a5818bc2ecc741e6c7a4e00a42f0cb31990db81b
F20101212_AAAQVK jantama_k_Page_041.jp2
283dd06745b431d0f94010f08aa4b644
9c86feb9f555a7fa8dce0061bb95935ff40952d2
F20101212_AAAQUW jantama_k_Page_044.tif
993ee858f52ac94fa82aa86529e14436
b82ff74e180c04e3df244b7b24074933bde7a229
87883 F20101212_AAARBF jantama_k_Page_075.jpg
2386ef45ecd3334c070c5ab53f70faa7
6ffe954c4e689c39116497c758a6a09dbe301e29
F20101212_AAARAR jantama_k_Page_038.tif
568b1422313477fbb4ea43db365e8412
c8baaf7c6b3d8ab48f04cf4339b531103618885e
F20101212_AAAQUX jantama_k_Page_079.tif
37caf1995a4dcf32b1c09b8f954eec4d
c6623f1f9c4fdb8ce50a95843bbafeb43f4351c0
F20101212_AAARBG jantama_k_Page_083.jp2
ad484736aafe1ed47529818ee1aabbd1
23e321dda7472364dfff3c0883c9a28929a554ba
6889 F20101212_AAAQWA jantama_k_Page_092thm.jpg
ea179313e7a12a3b4d34c19e92634bd6
205dcdec11e6494e591b3beca8fa423d660cfd41
6727 F20101212_AAARAS jantama_k_Page_034thm.jpg
b19dd9b876975f6ccfdec25fede6b630
764aef8d078b7f48846f70bc955cddba9b4dcb0b
F20101212_AAAQVL jantama_k_Page_077.jp2
3ff64c284baa40e1717b0d45618adca5
0090ede3755deb209c0f1f459f12655c00c40ad8
7078 F20101212_AAAQUY jantama_k_Page_083thm.jpg
7c0a1278dbfd45c9525f24e661924335
8bccaad1311c63d093ab30269ea4af627f050637
28635 F20101212_AAARBH jantama_k_Page_117.QC.jpg
a3514525d9cc6372854fdf92382a1bed
b0fe8cbf95c495ddac1cf3be7c20e9fcf6f5bd9c
1012431 F20101212_AAAQWB jantama_k_Page_109.jp2
c6b1f172eb83a2721c0c6206d14b7f04
bbbdd3926ff022ae64357bd6481eb8fc545c5d25
88123 F20101212_AAARAT jantama_k_Page_103.jpg
e6ed790fa8807e77d811a4894c4cb2fe
2f4a80451e9434b268140f879dd1c3dab936f7b6
27608 F20101212_AAAQVM jantama_k_Page_032.QC.jpg
32ad829a93035cf7e6ee45eb74477048
fdd84d5c94f92c26f812ad5771e62e4b33258512
6590 F20101212_AAAQUZ jantama_k_Page_019thm.jpg
7d5208bad7c60953ab5a704d5d432ba1
a4ac4ec4d6a1b36a8499242fd752953611e04466
F20101212_AAARBI jantama_k_Page_035.jp2
87eb0764d77a601ff6b9195631851cbb
cfd68272f69b494f6685d81b6fea869788a74271
F20101212_AAAQWC jantama_k_Page_104.tif
7680e70c6f232dca5afdc5ffa2c3b014
cb3f7a092d98cd26846e9661838b833fdc2359d3
26665 F20101212_AAARAU jantama_k_Page_022.QC.jpg
66ef6d3c4951ba3850794c18274084ef
60ae88396c742199f88130a15ce310b1fa0f0d0a
5890 F20101212_AAAQVN jantama_k_Page_111thm.jpg
086cdf0bd29fcb06b6548853fe89558c
3ec4b8030c064e0e86f8a1ba5c62dfdf124a94cc
1051955 F20101212_AAARBJ jantama_k_Page_029.jp2
28d463d34d8c14c95a41dfe09ea5520f
d2e0b76c6b9310768e71d7fef8771264f0e0b40d
81056 F20101212_AAAQWD jantama_k_Page_059.jpg
dee7c14b29a2b3e6c2a58f803be7b129
3132de864ef065bb149fe96d498de8d7b04985a3
2830 F20101212_AAAQVO jantama_k_Page_098thm.jpg
7a50fa32e41a66af95a751bf0189c640
12b9cefc49186e604cd6abc932f205fdc5738bc5
90973 F20101212_AAARBK jantama_k_Page_076.jpg
85c426c64b8a32647c5dd86543306007
e5322f3f1d20b1f1da6f10f51f2ce2fa9c735b2a
6972 F20101212_AAAQWE jantama_k_Page_084thm.jpg
8e709de1a7acd02ee5223b3722f8e43e
59992b52b7981f6f4cf7bc7f567fa1e23e319872
12419 F20101212_AAARAV jantama_k_Page_003.jpg
110c76a9eb2cea1bfec3a147739e0023
a8eb570530ff3a47586fe5b114da61d520c831ee
F20101212_AAAQVP jantama_k_Page_030.tif
2de0b6b65759a770e2660c8b508c6421
42bb32d8287fd658a19f35d2fa8a05a1a00a4ad9
F20101212_AAARBL jantama_k_Page_028.jp2
014114f8fef54d40c86c0de08e1b55d3
e7ac03e66c68a1a928eb6b3427cd1ef65b30344f
100414 F20101212_AAAQWF jantama_k_Page_130.jpg
077116d9cf14236579c05bac7235f8cd
7679ef15c8718adf8716ef4b0fe595a0958bd3f0
84287 F20101212_AAARAW jantama_k_Page_104.jpg
44a0d77948e572056dc9a12552e1ec2b
202c14e9c9c9f3e27db77ad95f7da33f3204e578
89042 F20101212_AAAQVQ jantama_k_Page_027.jpg
f482356c50f64507ab432ac51ada5055
9806c863e5725ada67918d837198ed5e1dd19f29
6618 F20101212_AAARBM jantama_k_Page_076thm.jpg
2b1aea768e4d13ca6133bb8a24a6e27b
f340c0cff452a9650f9f924790b7dfbed792146e
84139 F20101212_AAAQWG jantama_k_Page_087.jpg
4de71ef5387224723dc52cea0acbef11
20b0ebc67c66464be14d7e1aa642a51a63d449f3
30354 F20101212_AAARAX jantama_k_Page_112.QC.jpg
d216123fe449b630c5b3caa59b171787
6d901ca804bc2211eefbec78d58a36113a97bd30
F20101212_AAAQVR jantama_k_Page_022.tif
5c9639e1435ffe4f4a22e03b6076e36d
1ee7c711710d008e95001b37a3fe23c7e6671c60
F20101212_AAARCA jantama_k_Page_118.tif
a6b16a5284fe6cf05248025e7df90749
7db31d9c911074b5b375cda712c5e8281bc96f38
6486 F20101212_AAARBN jantama_k_Page_123thm.jpg
a50c28d7566e47581497f5939e88c8a0
25a49a0265e4aee70897b2e591cb840493eac492
84000 F20101212_AAAQWH jantama_k_Page_041.jpg
54aa30b1677aab26934d85ece728df00
4c1eced047275ac1e19a1377b8c6b8edd28d323f
F20101212_AAARAY jantama_k_Page_062.tif
f3fc0d197d66a62290fcf8f65d44a843
8690eb93fb4b3fec803afaa32692d066a9a379f6
28293 F20101212_AAAQVS jantama_k_Page_029.QC.jpg
a5b2e9897d6b3ac66c926c8dc87d6e8c
515572d0abb6363429b15b5687f80d124a6582d2
17198 F20101212_AAARCB jantama_k_Page_099.QC.jpg
72608a28ee1255c4ac1c3af1f33b4662
8d836ef1f2ca4c1bd6475510f8460d25fad9154a
97130 F20101212_AAARBO jantama_k_Page_135.jpg
4811d26523a794888282f6d5ec185802
90861b7a178596605ad9b6b221e5767d7f2455bd
28345 F20101212_AAAQWI jantama_k_Page_020.QC.jpg
20ee166c40f762ae50442f45f528d16f
4b59571bc943a98f892b480fc2ca26d0c1792c43
28820 F20101212_AAARAZ jantama_k_Page_040.QC.jpg
4e62e92a6ffec8c6771e7b312fed8eeb
e25777fedf500e5ba9af7062c7dcaec37609dd19
28421 F20101212_AAAQVT jantama_k_Page_105.QC.jpg
0872546010244113142c7531473414ef
975e7eb1d42298a0c2d00f14e7f716c39a653e72
6417 F20101212_AAARCC jantama_k_Page_026thm.jpg
b5659afe616ffaa68b507278da540d89
04f745dcf9079e5725ef2fe0fb0cf7a50ba1abb2
88614 F20101212_AAARBP jantama_k_Page_032.jpg
270bcdd14641da5b2d508efb352a4913
d9801d5393b926817d1f2f25b64150de34a87f6d
37914 F20101212_AAAQWJ jantama_k_Page_057.jpg
6b193602e519b8ef85fa6b2abc866c77
eb8ecb5188168e53d6f4af2584df8b9aebb54065
26236 F20101212_AAAQVU jantama_k_Page_044.QC.jpg
e5238973872c0707240f0a616ec68e94
c055646b547472741dbc1b2f704227e4a31d4af8
4599 F20101212_AAARCD jantama_k_Page_005thm.jpg
0e6694f3536e970f7567ef6b6efbfa2d
4e9857fa22bae3d1d66c2326b7ae4dc7230db577
F20101212_AAARBQ jantama_k_Page_102.tif
9f4538466cbd0d41b54ce4cb7a03ea1b
a5404a90fa0d86ceb69c32dbb4ed426ef4a4fd30
F20101212_AAAQWK jantama_k_Page_115.tif
5dc6f86488d9bb62247b669abcff343b
75c321f04151109d45365a972c082fe789f1cd5b
F20101212_AAAQVV jantama_k_Page_033.tif
07e545d55a63322baea4d3ba3e7a59e3
9ed4f70f953dc6595d35c271f3325914dcda7d5f
F20101212_AAARCE jantama_k_Page_080.jp2
2f3503b8e2abd4d24a794de3366e421e
0c13950bdbebd2ef8f55a7e140e2d9f118e20ecd
1051926 F20101212_AAARBR jantama_k_Page_090.jp2
113370ea7064320f916905186ca9bf03
a9556e080f96a531aa5850b156457cbc8b44435b
F20101212_AAAQWL jantama_k_Page_133.jp2
926bf274889d51cd9c97f9d7fa2e99ac
4a1a07ad32f7f1565827a5064bac7dc64098b40a
6037 F20101212_AAAQVW jantama_k_Page_069thm.jpg
0df9d4435cb35ad59b6717935c52207b
e25c6143b3074d5936824d5212eafae2870fe984
F20101212_AAARCF jantama_k_Page_011.tif
aa9e5f67532907a69b9a0c3671bed815
cbde6d6b2b5eae502665a6bb5e24f9d66eef3ef7
75660 F20101212_AAAQXA jantama_k_Page_043.jpg
1510c24036b303d41d4cec4f80241176
6f7f51c6de6e89410f2480cc4e882fcef13dea81
3070 F20101212_AAARBS jantama_k_Page_003.QC.jpg
2d5b801fa1c2d0391e8f42f3169070e2
8d35a14940293037e1899a3025862aca60314b7f
F20101212_AAAQVX jantama_k_Page_064.tif
8bce3dc7abf14416b58ecfa4dbbbdfe0
02630ad14cfd52baebfebfa1e789e9f197614efe
37952 F20101212_AAARCG jantama_k_Page_014.jpg
4c0fc126f46a48b6418003e37e5ae0e1
2d0c1e0c9b268ba32f5ecdc57ad159ca4fa06d1f
F20101212_AAAQXB jantama_k_Page_112.tif
874e4bfc050586baaaaf5c64c0ba1cf4
34b58a9f4897956f5ff2f2b65d5ea3a2c882b789
F20101212_AAARBT jantama_k_Page_083.tif
8d17d1456cd919e535d1a7db79faa2f1
8586d26e07adcd815f7cf29c07f186bc89703dbb
94384 F20101212_AAAQWM jantama_k_Page_121.jpg
4943d312c802ba89681f523f154ebe4c
4691cc574d43cd0c605dbd771f27bb96b37740f4
87431 F20101212_AAAQVY jantama_k_Page_042.jpg
4f6c09129aef5b38d88b472cdeedc7c6
116fc71165a5b9e43e4ef1321e5eb98ae838af39
27953 F20101212_AAARCH jantama_k_Page_015.jpg
700a17f16730bc44764c7412ad297852
f52dbe42923f6b8277cd985d77f3b0195165d582
F20101212_AAAQXC jantama_k_Page_036.jp2
0fb32a162da94efec3be4814a41c9c09
190e60b098d2a7bacecbe5fb79228072f58526e2
6690 F20101212_AAARBU jantama_k_Page_054thm.jpg
cdc640ecf5a2c698089c5119aad7ee14
10e876fa756593a431538be6a5e79f309ae48f42
F20101212_AAAQWN jantama_k_Page_039.tif
bcdd15943e62c9b90d8826f502c7d327
2483166b436ec07d6b9d8b783496e0aa69b1cdd4
27303 F20101212_AAAQVZ jantama_k_Page_075.QC.jpg
1ad141872debe5fbda113f75b9bc50c6
9f16712c5c1fac5740796e68dcd5be1e1905eb06
2749 F20101212_AAARCI jantama_k_Page_013thm.jpg
6f7f9b24397b71b08ca45d45f074758f
44845fd6e30dea209d5dee737a632e707567c609
3406 F20101212_AAAQXD jantama_k_Page_090thm.jpg
8fbabc473fd9b8ce798f7e997a75ceaa
3cd83da9a08218a02e6922754db746d7af25e8fc
F20101212_AAARBV jantama_k_Page_097.tif
11f7f689dabc1b4e7217414175746858
5b4a1097f836bab2a77d8990897873c7f5e6fc52
2508 F20101212_AAAQWO jantama_k_Page_102.QC.jpg
ace9b7dcfe55e7aeaaa5a81d9247bd3d
fb76adf35ed53da1f215fbaf72af0ba33027af8c
F20101212_AAARCJ jantama_k_Page_132.jp2
d3f032c2019d6ef8fa4c7bf255086eb8
315b08e0e12adeea7d7b151b0270ef9360a332f5
1017043 F20101212_AAAQXE jantama_k_Page_004.jp2
ec7a9fb10f0fa172ca9721c4dc4fb3d5
8bcdf999ee14e9ca410ddf03c8ff68928ad50394
F20101212_AAAQWP jantama_k_Page_003.tif
0863f2c835f1a08b78ba267d971078d7
f9498327f99398704c0d9cb7a1c57f5111272e1a
66133 F20101212_AAARCK jantama_k_Page_047.jpg
b0ea26539485cc25c3b0dc37f810a9ec
f0afc4abc700e5399c4b936ca0e1dd60800e238b
77812 F20101212_AAAQXF jantama_k_Page_097.jpg
787ea7e580229306caf211a9589bc8e0
bb5f92e6299d64f7c5e9da974f1dafae45139d25
26329 F20101212_AAARBW jantama_k_Page_066.jpg
fc31bce9bb4682e273766036155c32f4
d38ae614b7c576883e853a27ec70787ad2c27dfe
1051982 F20101212_AAAQWQ jantama_k_Page_065.jp2
53cbc5ee2de83019aab966fc586629e0
a66922c629894f30691a90f088df6670ad93720d
89161 F20101212_AAARCL jantama_k_Page_093.jpg
250b4af1a3be4bfc86855537ffe7ce39
585cc9c9e66c1a5f240565761750b54ba343b434
F20101212_AAAQXG jantama_k_Page_104.jp2
a30e3812aa6783bd12c4fa644a629d61
c1a56c9606e605aaa3cc6e01261d87cdd96ec047
8556 F20101212_AAARBX jantama_k_Page_066.QC.jpg
484d1737da6101ae9ea9d1792267dccd
1c5cb21632413eadf7b502e7f229214a5a79f463
6350 F20101212_AAAQWR jantama_k_Page_103thm.jpg
fd9ba9cd46ca9aada59c47f684d515e8
34f0307923b614c46003d6caa8a6be7980a756f1
F20101212_AAARDA jantama_k_Page_107.tif
9c453153752d0ed98ae2bcb215e057e1
b86a75b25723beb05f2537fcd7fe2090a7e16a26
6834 F20101212_AAARCM jantama_k_Page_053thm.jpg
efb5494923f84c7c597df6d568ee8991
b645138054e1d6f20e9996f1a52c8f41244f834d
107964 F20101212_AAAQXH jantama_k_Page_126.jpg
a609b72c3b995521a5deb3be8f54d513
14f68c368d825c9c0dc80fc4a83fd279f3b2726e
6476 F20101212_AAARBY jantama_k_Page_046thm.jpg
ce15e8f4053bf64c3971c4955da86c35
c538f82d25161fc3834999e980b37608eeecdaad
6458 F20101212_AAAQWS jantama_k_Page_071thm.jpg
f5fb25e508beadc144f03a0ceedc954a
502de251db8f8b8eb0b240e2ad9a898c1b3c1e47
22694 F20101212_AAARDB jantama_k_Page_072.QC.jpg
512e64a7e571386bec177891edb08716
59256a37318a0db2fb34f2385774edfe101401ca
28519 F20101212_AAARCN jantama_k_Page_094.QC.jpg
bb5131b099a84d6da6ab2453ce21fbd3
6d2c8bb8e5cc9ae207ebe288b8fe7a1d101632d2
F20101212_AAAQXI jantama_k_Page_122.tif
7a0c97f10b3ffbabced4707d48b37e7d
476a0c2d4367b19d31f8f9fe968dca313ad46b42
F20101212_AAARBZ jantama_k_Page_021.tif
26c9fea7885d2286be3c6be8381d1c72
dd451f4527f1672dcde5c7a604556cc33d8ffa52
28239 F20101212_AAAQWT jantama_k_Page_031.QC.jpg
abfc2cd0bed45c8c9c3bae9c406e99f6
a5db70cdf6eb8bc9e7f01a30c8d618348725a56f
28983 F20101212_AAARDC jantama_k_Page_078.QC.jpg
a45ac39d225ec0b9f042e89c9a048e35
ebbc3872dc38296d164d59f1e393aeb0a2fa0b62
27851 F20101212_AAARCO jantama_k_Page_035.QC.jpg
07f415ed64968fbec09c8be0994d6179
01d4d26a63598f087c3b9619a17d24457fbb869a
12597 F20101212_AAAQXJ jantama_k_Page_014.QC.jpg
e62f3d610deab243b5c27066da46acec
edf65281fc0c59e4ad4ae1c5060db8b162dba1fa
F20101212_AAAQWU jantama_k_Page_112.jp2
9048157d4cfb917ac419407ce1398d4e
0e07f47a1331ceb618ba935925a7dc19a143498d
76853 F20101212_AAARDD jantama_k_Page_039.jpg
de2864e523ae27b2363bf65239cdb745
ce16a7b11769ef23921b2500e6c0981f8d79d049
831 F20101212_AAARCP jantama_k_Page_102thm.jpg
6d0efbb7a49c69b619b3f0630e430135
1c0d9a999ae33116e1d8f84618a16c47a6a0e846
1051944 F20101212_AAAQXK jantama_k_Page_116.jp2
cbc50208058b5ad3295c68f3ad9f229e
eff0675c3aabe2927002a912d211c761747391f2
76876 F20101212_AAAQWV jantama_k_Page_069.jpg
83a85dfd7d6b8659b3eabf9639706820
1dcc0d20a35a17e60bc6c5e302d511d6286eef70
1675 F20101212_AAARDE jantama_k_Page_001thm.jpg
23040dceab7e191e8a33cc1171c9389e
1e6fbfc13950ce98892dd8d0d65dd6a1fe32e9c1
F20101212_AAARCQ jantama_k_Page_081.jp2
3452502491538ea653981ed52052561b
579bd63d9dfe9604bfe1d208a45c97d98ba67693
F20101212_AAAQXL jantama_k_Page_090.tif
eaa331ab395bafc8df704aa3a63ac7b9
01f8a0eddc8df146eef0396bae52b63b3a9f6ac8
F20101212_AAAQWW jantama_k_Page_019.tif
b34c5570c54b206ae7a68990e106fa54
4932203ba8d3534bc551e975eb8c74c15feb6385
28102 F20101212_AAARDF jantama_k_Page_027.QC.jpg
d5baf7539de7df2b6c1571a3b4448bca
9c83a32f88748391de5ba06c87a1c01ded447891
F20101212_AAARCR jantama_k_Page_094.jp2
bf2470fec14e7b0f957f356de7d953cc
852cf89a235c0ede5ce1dcc91467b74974c4f025
F20101212_AAAQXM jantama_k_Page_086.jp2
379a7937a7079ad554e51f3c518ca8c6
41d4ca6cb920c0bd9ee9011d5855320a24428645
30166 F20101212_AAAQWX jantama_k_Page_030.QC.jpg
3f25af9db08897236e8ddcdd602352e9
489322b09ed0e0f2432e890abe47aac5b40a76d7
1051971 F20101212_AAARDG jantama_k_Page_128.jp2
5aa9921c1a3566fa25f76f5a71cde0da
9c17c778b9b3cf390df10f8dab5c733f0a2602b9
F20101212_AAAQYA jantama_k_Page_017.jp2
477de7f489b4244783e78b0a14ae5ed9
cb4c5cdb4df4e8ded83a8bef3c9bb0c53116c3ad
27783 F20101212_AAARCS jantama_k_Page_103.QC.jpg
94cf508b0b897430e3fa270af5fae36e
8874e36b6439464207e94ced27baea1aa30c2cf8
103427 F20101212_AAAQWY jantama_k_Page_088.jpg
8592f57e75e02ba909ee5c384e6ca746
7a5bffebb6f7c4980437c07d6a81f1e563a59376
26400 F20101212_AAARDH jantama_k_Page_052.QC.jpg
02c517692f6c5f24c010042fb6450191
0455d18f7b7266e443bbf3db36a94954fb6f7a64
1051965 F20101212_AAAQYB jantama_k_Page_136.jp2
3b4d6ec087a78af677bc5f648c033175
b92beacc4885787312ad008b074618e670d90cdc
1051917 F20101212_AAARCT jantama_k_Page_067.jp2
ac4247fd23a19ddf184490f843136782
ae68e15f986a46b3b4dc9f1ff8a3e8c4aa9f5317
F20101212_AAAQXN jantama_k_Page_105.tif
61431a20bf8871379520bc4978dda2ae
ea779c6b8ae6ac3c19fbded7669e44b3052b7bdd
48980 F20101212_AAAQWZ jantama_k_Page_058.jpg
071e6a2313ed662d29addcbe05c36f56
9215c99e3d46b9a677a27f85abb5311377921715
3873 F20101212_AAARDI jantama_k_Page_100thm.jpg
7fac706ce54e1b1ec447445c7189be0f
f2b94ca2c9f7e5387cc2556926450480715b0286
27717 F20101212_AAAQYC jantama_k_Page_118.QC.jpg
6aa9a22f88f868f18e2bc1e17b46a318
4658c8926753fe33fcd4412d0ab3bad891fd01ab
6599 F20101212_AAARCU jantama_k_Page_116thm.jpg
3716d5746c49ee8bf6527cb32fd9fb73
deac5bcd7d23a4cc8d34a975535c5e4b6cc1120b
28329 F20101212_AAARDJ jantama_k_Page_025.QC.jpg
bd4a5ba30d25a658b504c50fdc89345b
c0262e03de0ad45ebab43921c31ca5bc229f1c15
28996 F20101212_AAAQYD jantama_k_Page_129.QC.jpg
5f1a2c2346bf4a3ea2e45cff84d570b7
224b1cc27ce8cc1b5676b21262702757cbe1044f
926632 F20101212_AAARCV jantama_k_Page_068.jp2
421b8428cf701d7a5463f721f8802274
aaf770ade318fe07f25ac05741ef80b160c6c220
F20101212_AAAQXO jantama_k_Page_060.jp2
d64cacea4453e909eb416f2469140775
256148da1e4ee0c2794285091cb6319ae64d5cf8
106142 F20101212_AAARDK jantama_k_Page_132.jpg
f450388b68420f745753f78c231a39ed
5aeb2d4d7ae0c4d86f56291b211f4fb50eba15e1
30091 F20101212_AAAQYE jantama_k_Page_126.QC.jpg
fccc0089da6a89826dd4f6d5d0a8c774
a5e62baa1583344177c8a0e182806fe4a05f5b93
F20101212_AAARCW jantama_k_Page_109.tif
2ce4789c58bee20a826382a9339c5175
5bdd1304eeab5d158e090a476b607b765f6e187c
6941 F20101212_AAAQXP jantama_k_Page_136thm.jpg
311ed7e46130ab2b4d76712ac8613dd9
4cf29ff26f90b670dd4bbd145b4670ed40eafa9e
6602 F20101212_AAARDL jantama_k_Page_028thm.jpg
b5402b21ccfc0b87da67b19cdd65e90a
946dbfc014d3a6eb1b8ac560e6b2feed33e7df0c
F20101212_AAAQYF jantama_k_Page_080.QC.jpg
13dbc80ba00094275fd578ea116138b8
ec7c5a26cdf2dd077aa54456a341e1e6b1332147
F20101212_AAAQXQ jantama_k_Page_006.tif
594790b593be18f775c1131fab2f50cd
042f2ebb91662e888fb761a19decf44891500650
20246 F20101212_AAAREA jantama_k_Page_010.QC.jpg
5af76acc408c33473eb22437601a56bc
3e4dd944d335b6e79de89115c7aec8c895e5db87
92602 F20101212_AAARDM jantama_k_Page_080.jpg
4b6e3601c07a053f4552a93119ec4fc7
52487a4623fa5062209a43abbac4e7df0ace5221
27983 F20101212_AAAQYG jantama_k_Page_089.QC.jpg
da0628ee1596c102137a705b9c496005
5f27d5fbab504f23e1a6648b8dde03d4ef74dce9
25539 F20101212_AAARCX jantama_k_Page_082.QC.jpg
d6724fbca6adc787ebfbfaa69ad6ff01
d41028c36459bba3e761bdb615c1dcb825e541a4
1051986 F20101212_AAAQXR jantama_k_Page_100.jp2
28bb930ae6338a501040d1de5c110d56
643ba4f6a8bb9159f48b4bc8d0069aca58c9cc95
3236 F20101212_AAAREB jantama_k_Page_119thm.jpg
b38b8aa87b5773dc5f9047307a94176e
152c39932c125f30401456f26812904656c3e3cb
F20101212_AAARDN jantama_k_Page_027.tif
b981507e28cb078f22f02f7ca331ee57
8b0be477d5106471d40ceaad78b218b35b18b140
755425 F20101212_AAAQYH jantama_k_Page_057.jp2
b7bc2b9dc6d150799e6610c6783e6848
17ead4ac6691ee6d12c0540c20fe6fd56afdbc71
F20101212_AAARCY jantama_k_Page_126.tif
47bab67e280db919f6aa70c8bea8c2d5
a234e225d87f653fcc5c2c543a837ddeca632890
6659 F20101212_AAAQXS jantama_k_Page_025thm.jpg
98cdb6716c3e451a427acb6b073b3f96
2a06f34fa1cdc9a0e041ef70d7c4f2b8e0be4b89
5720 F20101212_AAAREC jantama_k_Page_021thm.jpg
3c105398ded51846a8908bfc1696b7fe
a603813033266d16ca6f2ff759ee484c47c5bb2f
29386 F20101212_AAARDO jantama_k_Page_122.QC.jpg
0bbb3a6271ee2ad5b5de99b4afac4421
2b8dfa975a76762d0ee37da03effa86285a129bb
92600 F20101212_AAAQYI jantama_k_Page_122.jpg
4fea31b86de3dcceb4cf02d10b1bc59a
3b8cd3b2cad7ee502787dc07f82e552b4254b963
F20101212_AAARCZ jantama_k_Page_026.jp2
727d7ad1dd0c6b1e70fb528f49261d8a
42bc86b9d118d2d16e82e4b314c4c222d701bb0a
F20101212_AAAQXT jantama_k_Page_060.tif
de255c3150cddf53ba81e42fa094cc6e
e3164c63cadc53d408e5cc7969e4117f4f05a9c1
28684 F20101212_AAARED jantama_k_Page_127.QC.jpg
5baa7a96e91cf297acd554a652d95679
a1626bb659afec911bc501c2a6bbe150196fa767
59722 F20101212_AAARDP jantama_k_Page_038.jpg
d386d061460f6232a79fe933893027f7
f2c8707a7f810b38780f80a419a54ab0ad96b1f3
10722 F20101212_AAAQYJ jantama_k_Page_138.QC.jpg
a21c2fe29b095f5c29d3eb5fddd99790
5cb7812bb9f636a6b3c30112f6784eebe07cfa21
5747 F20101212_AAAQXU jantama_k_Page_055thm.jpg
e94abe395744ffcd98f46b7b7947915c
4fb73661bcf5611068c25d77ba0230cbd0ce0c28
5714 F20101212_AAAREE jantama_k_Page_139thm.jpg
9086029fcab7cef5ecec420513fd3a71
399f58825b9d43c1bf958302073e8152db821e5a
102076 F20101212_AAARDQ jantama_k_Page_033.jpg
00cbb1fa2e44b302696aff5557a6e615
ae6fb72627a809af9b492ff348ada309769222c0
85036 F20101212_AAAQYK jantama_k_Page_008.jpg
09a758ba2f572a6e344d45028bb9c6fc
34e28dba96ee2ed2d1ff271d0d937f7c677e293b
F20101212_AAAQXV jantama_k_Page_004.tif
66fdae2e5f2cf405aa34d3fa6f9e0c15
b8798b4ea617451168fcc6af24921c469794608b
10967 F20101212_AAAREF jantama_k_Page_016.jpg
8362a5f33ca390986dc3bc12cc7e2570
d01cc5ed2737487504e6dad9f90e92c3f5108ada
27219 F20101212_AAARDR jantama_k_Page_042.QC.jpg
97fec0fe9683467e7d9dc0030ecc1f2a
01bd6b84a77af196c6601e337f4df9f807258f5b
F20101212_AAAQYL jantama_k_Page_131.jp2
5817b388af6196e125c5b9c2f327492c
2cc8e4385261ba1673abe8d960120847fee02c90
4434 F20101212_AAAQXW jantama_k_Page_124thm.jpg
9e67421bcd9984eacaca768528451e35
747f50da14c9655fdb9e96d1fc1d4a1f9765afed
F20101212_AAAREG jantama_k_Page_061.jp2
6582b166afa6371cc6f90a233a24ad26
393f3533cd2e5165ffe73cf94c1cab14ec5121d4
F20101212_AAAQZA jantama_k_Page_077thm.jpg
b9acc8420a0bb62b7793f826d54bc4d3
3478b92e1bf4e03f3701d95eaf84f480557764d4
91843 F20101212_AAARDS jantama_k_Page_009.jpg
294a095e59bf2448829e68aba689441a
8e86f3b4feb8ac0f9054d11054a9aebedc032e18
95292 F20101212_AAAQYM jantama_k_Page_112.jpg
43ccc9e4852e8f0ecfd05ed946709a79
e7c03024cb3240fb7fc80a09425dbfdb70c93f78
F20101212_AAAQXX jantama_k_Page_006.jp2
ac1b80a125ec4da28b19a81d98ee493e
9793d9737c17e61aca23650246ed3db173ed27f4
90863 F20101212_AAAREH jantama_k_Page_117.jpg
20179af89dd31ded8e028fed9eeaf3e2
68f09204639d5f5f538eed0514a281274d75e29b
88656 F20101212_AAAQZB jantama_k_Page_028.jpg
6c3e3b17fc80154fbe8a34e2f6b499ab
452f5d6282bd4a781e36a0339ac71218d7ada532
6351 F20101212_AAARDT jantama_k_Page_063thm.jpg
8b2e601082eb95c4560adb83ba8bf847
3c72f2e669f7cb0ead98219b2b35a816dbf2c505
87697 F20101212_AAAQYN jantama_k_Page_023.jpg
54bb31e4878019ce283cdd185b034149
04d8aa7c7e3136464b8dc282caf73e3a4a0b5984
21528 F20101212_AAAQXY jantama_k_Page_095.QC.jpg
202e30bc9e99628d8d5acc09da1f811b
1b8c6c8394939dd6c1148205a871bacf97aae802
F20101212_AAAREI jantama_k_Page_032.tif
4950ef02a4a756767e9f0a3247c5b7d5
204294b885a5f1075e909262265a9607851d54f7
6494 F20101212_AAAQZC jantama_k_Page_037thm.jpg
e72a17e8a974eb5a8511a3b5c527d49a
45e0e2ec6d80943dc6aa4816a22a1cfd88415cf1
5178 F20101212_AAARDU jantama_k_Page_095thm.jpg
ddf262f70ce388d0e420666bcb698aa9
fdf750f45f27b462c2662dc4a8e59f9695976a7c
F20101212_AAAQXZ jantama_k_Page_080.tif
37a74a841f0b2e010e888f384d98f51d
36989b55908d3d5cea0eb5da5bda0203aa0bcfd8
F20101212_AAAREJ jantama_k_Page_028.tif
fef8d5b097e4f1943a93328478fb1525
a15607f834fc722014f6ad6388986a79a1f9077a
88572 F20101212_AAAQZD jantama_k_Page_061.jpg
5f8a9d6ff5678bf090d350ae0e371fbf
41d454d1a1ef83641d8a5c8c92a46eb53952dd96
103959 F20101212_AAARDV jantama_k_Page_127.jpg
32cbde35527eacda43f5adf09e422377
ea137009df437f5ff37ced4380d37d7cb6eaadc0
134461 F20101212_AAAQYO jantama_k_Page_007.jpg
3e989aff0849c8352213cb5d574de25c
c2fda36d77f2e0424a8d64a6fa8a63883dc7aa56
F20101212_AAAREK jantama_k_Page_075.jp2
1fa021ba257c2669b72c9dda54dfaf73
d7abbac5808d29bff70a02dc67fe4368124c13a2
6980 F20101212_AAAQZE jantama_k_Page_042thm.jpg
a83b060943070b0cacd98571da54b4f9
2b377edffba4cbbcb95f071b8a4e702e7d9ff485
F20101212_AAARDW jantama_k_Page_012.tif
43fc3cec6160374d3dff1d087bab8e0d
b7c5399a3678b2738eb9634c0886912202f19253
1205 F20101212_AAAQYP jantama_k_Page_016thm.jpg
3cef79550e23fab6056836dfdef6819b
b1ef82b8dee6e15522c49a169a10d395da2e057c
22683 F20101212_AAAREL jantama_k_Page_006.QC.jpg
c49cc5c17d8d20c46f865d4b8bd32013
b7f0afbf493f7cf164db134ea80871bf6c3fbde5
F20101212_AAAQZF jantama_k_Page_082.tif
4ec5a86adfaa631cd520c8aa60b5d309
38b7102c27979f9818c2cf891ffffd8495b63c75
F20101212_AAARDX jantama_k_Page_051.jp2
13e56ef9b4577a5be7f5976fa39e4444
ecc89121b253cb46d4c4d4bee7e0b66f8d49b447
74688 F20101212_AAAQYQ jantama_k_Page_010.jpg
e738336f3504b4058c7fcf26e01084d8
57439808a942ba8e7b09bf0b8860bbac70b6bede
28252 F20101212_AAAQZG jantama_k_Page_108.QC.jpg
38bc88959ed857f98eaf386865ab8efd
bde35a533d6317e6cbb3d02034837e7a22f9ce90
F20101212_AAAQYR jantama_k_Page_118.jp2
298b589187716b694cbc456ebd402461
98260e8222c13e7da346b9c679d5fbf046779dd2
6732 F20101212_AAARFA jantama_k_Page_115thm.jpg
35260759362876cfedc4e27e82e0928f
9c1d7f2777c3a10eff7266f6376dce6ff5d641c9
6466 F20101212_AAAREM jantama_k_Page_087thm.jpg
df5a224e65f2ee53f5cc011944c07d0a
5bd6ceb38890c8dca40f00852595f195b2d1b2e1
F20101212_AAAQZH jantama_k_Page_101.jp2
264210677beabefae97aa4fa2fb8f5bc
55dcd63e959b26554081af680592718fbea0d73b
24860 F20101212_AAARDY jantama_k_Page_017.QC.jpg
72965c03d60078c19cf7d72d31aaffbc
e529c7a3863ad2fd7e38be0b54b840b36f35213a
6363 F20101212_AAAQYS jantama_k_Page_044thm.jpg
0e886df0b58ed516b2d9f75ff08c6803
283b71c295c014f714aa679c9d96a79b11cff862
7003 F20101212_AAARFB jantama_k_Page_127thm.jpg
2c9fa7feba6f57687a777269078fcbe2
218bb99035cded96713e0df9a4c516acafff31cb
111692 F20101212_AAAREN jantama_k_Page_137.jpg
4ba99068fe29b70cdf59f5ac9173f980
81ebdf1bf42ab1f27e2a2f957220a6f47077b0c5
28688 F20101212_AAAQZI jantama_k_Page_132.QC.jpg
82df2a80d799f62b36d9d81830aba001
71ec8d71c33335a5e18e26792c89a385fdc9f688
22524 F20101212_AAARDZ jantama_k_Page_059.QC.jpg
d867610eee4a0530f59cb697696bbe91
908c8ed9e36619f424986c3da7f6e2bbe3578e94
969707 F20101212_AAAQYT jantama_k_Page_055.jp2
a8f3f8a78eccddc08fc256c5a1f6db44
c6e54cfe5dafd0e160e0c8be83afd1da23573744
2499 F20101212_AAARFC jantama_k_Page_138thm.jpg
7c91241d7fab6de56752d3fa5166efd2
a16814cb7187706e667b1257417bb60f86330fd8
16858 F20101212_AAAREO jantama_k_Page_100.QC.jpg
cef8e670fe891bc85435032e31addbf2
c656967f0c5cdb59d97a3894fada5420d82f1eba
82748 F20101212_AAAQZJ jantama_k_Page_052.jpg
fb631471cff5c22662ddcd6012008117
794f526f417bfb99b78e9bfe37d5e977ad5965ad
90314 F20101212_AAAQYU jantama_k_Page_071.jpg
8f33164db0d52a1523f80143d78b9206
672aa5cced1bed577d9c1489dd3e48e08adf3926
6788 F20101212_AAARFD jantama_k_Page_105thm.jpg
00b57786f51293a2c9b3f9989ae4f2a5
ec496e12f28915097fd9374539bfa9f1d1ac74ac
F20101212_AAAREP jantama_k_Page_116.tif
9e3ce9fcb4fd739f4de1bf70614ba78c
e4fd6c60c1fab4856fc1b2d42873f2722942321f
F20101212_AAAQZK jantama_k_Page_050.jp2
a604edd4e4932b2e1e2398aec2174dc7
f4e2ea9afe895c9a3902bd1f0e87f562ec98bf6f
3506 F20101212_AAAQYV jantama_k_Page_012thm.jpg
c42ed7cb87088f516ffce6a38a5a6fae
9300d11a8f1268b0964182c9c4c20bdf22b6a95a
F20101212_AAARFE jantama_k_Page_034.jp2
d8f80c05e75d8306c85f09af45eab0a8
1fb7cc78f989434c894397a43e1deffcc0f66f52
19141 F20101212_AAAREQ jantama_k_Page_038.QC.jpg
bc71976821a532fba8373bd121ce7e11
1324b9bc8a74547b0daf59a62d04f434713746c1
2836 F20101212_AAAQZL jantama_k_Page_011thm.jpg
3677d35bff1d8a9d024be9ec317cb82f
f78fcafabc079e6877e6a883e6191991931ac49f
15388 F20101212_AAAQYW jantama_k_Page_073.QC.jpg
9123e1d61297a3851ca4d3610758f481
f03ac3289b360f33beedaf3bf29036180d43600a
75168 F20101212_AAARFF jantama_k_Page_109.jpg
fe4bb6b47be0387581442db12156fe95
2bf83e985c497e8d1710795d6ebce2c4b881a55b
7430 F20101212_AAARER jantama_k_Page_131thm.jpg
a97609d177244e78fe0d6cd7d06390d2
0955b36aa8f740f596486ff9b07c274a78bf5a62
6721 F20101212_AAAQZM jantama_k_Page_050thm.jpg
6a8e5db20eb9adc2c1c5541ca6ac9cca
a58bfe8b66b404f966a76af17e3d6ec100a3cdc3
3492 F20101212_AAAQYX jantama_k_Page_114thm.jpg
85d49f5437e86c9d1e1c62f3087b596b
f0e22e3957702962f8de018dcecaa1ddd81a0a0d
90205 F20101212_AAARFG jantama_k_Page_105.jpg
092f597d87829ef814ba836efbd1b235
c5fc3c13c83c32ceafad1b8db722b2a2f5e8c44e
F20101212_AAARES jantama_k_Page_063.jp2
ba2a41bba68acce17aee7675f2c2c1df
77224664eba1e9e87ad60a6b8635e9b8a08fddce
F20101212_AAAQZN jantama_k_Page_015.tif
f778a3918a48fedf372e39c3fce42694
b8559a5f715b1f85fba3de87e365813ea962509c
F20101212_AAAQYY jantama_k_Page_077.jpg
2642871a25f4c45370c1854379391a60
a2d71922fcbe23c347bd6196c3d5376960a04072
854 F20101212_AAARFH jantama_k_Page_003thm.jpg
bd39c2dbe04df5370ad763875eabffe5
ee83ca7991ec626acb94e09fc819b4d922126458
25901 F20101212_AAARET jantama_k_Page_056.QC.jpg
4469ba874df9e6d1ff7658da614bb0bf
9282969cb90638ec1fb4fb1a9e7139d028bfe8a6
27028 F20101212_AAAQZO jantama_k_Page_026.QC.jpg
99d354cd61997f38f643e14196c108e8
c90a1da5a946bd194f2ea6915aaa8839b0dceb0c
38928 F20101212_AAAQYZ jantama_k_Page_012.jpg
894fb1903fb11215d5b773148cfbd142
adc1e1f18f7b4421d213ae39deef1e6ef08fe14c
1051931 F20101212_AAARFI jantama_k_Page_110.jp2
e4e81d958e56beba93ef63b31e51a0d8
c7138fb3b60ce6c03979b1ae0abb4c0c0664ce4e
349149 F20101212_AAAREU jantama_k_Page_013.jp2
1fcbc2fd03395d0325f66c01921f4d1e
80d1a03f482dd6b2e5827b8fe831952787332780
97396 F20101212_AAARFJ jantama_k_Page_125.jpg
7be6c7bcafc7b8fc8be4870c50c1036a
2ac1538cf4a91f01f8160e34ad4fd059163f7f15
23356 F20101212_AAAREV jantama_k_Page_069.QC.jpg
b731dd5add57e26b3a947d8b9fa8e5a7
31cba4382db6613ba16cd0e5500f53d6f5228459
F20101212_AAAQZP jantama_k_Page_092.tif
95cd39a0fa96fec3a3acf69c73523d5a
dd9dc6a45acf1e904f65ef78cc3a652e88fd2993
22674 F20101212_AAARFK jantama_k_Page_001.jpg
c992f7a797cec4457a7539842ca3a5a2
8862aff19796ba519350c8e05edc18ad16817e94
1051932 F20101212_AAAREW jantama_k_Page_093.jp2
f66fd1e8f78366fe82873e748415afd6
9252593d80b4b134a8d6bdbe3ea0c0e87945adda
104743 F20101212_AAAQZQ jantama_k_Page_006.jpg
b2cc6ae56435d3d11b6114d8e83e8156
d2939cc64cace035af160daad10f27d84c110a40
6533 F20101212_AAARFL jantama_k_Page_130thm.jpg
453afb1cb9599f1e9db5c060d4d241d3
a800baddeb495fe5449f2a1fcfb9dae755c050dd
F20101212_AAAREX jantama_k_Page_051.tif
f1b49d013d95337a902acfdbf0167fd9
ba3d225de9232a38cc29dfc457cdad4afbac31b6
1051933 F20101212_AAAQZR jantama_k_Page_053.jp2
980be0ca5288cfb314e9c6395141865b
9a55f215dccea874fbf5ea76741fcaaadad34b46
F20101212_AAARGA jantama_k_Page_067.tif
9c5c29714864964a5cd62a2459c86b2e
0480211c9b44943a7f1488fa4dcd8791d9dc845e
90906 F20101212_AAARFM jantama_k_Page_031.jpg
eab5215d709d9c4b411fad4c75ddf214
d0d1a3622ebf8a37e00f2f20e09ddddaefe71943
29577 F20101212_AAAREY jantama_k_Page_079.QC.jpg
1dcf761e5c4afd312e62109ac551c122
03ccc07b0f9c08447323952a856b31992e32cf36
F20101212_AAAQZS jantama_k_Page_104.QC.jpg
0b66763a4954e11c616ff43e2a166c65
0c795ab6c30bb2abf7a44d6e7a4b06973bee1447
27820 F20101212_AAARGB jantama_k_Page_023.QC.jpg
3b5918274bc13c125225524887e6d9d6
a9b3196d3cacab483fec195005c853d6714edcac
1051946 F20101212_AAARFN jantama_k_Page_099.jp2
6617320665099626026c37722c2c45d5
f5261ac6c836b88e916498fed7ce62820d30d9b4
F20101212_AAAQZT jantama_k_Page_100.tif
700008741c100d909ed30ff4dbcfa1eb
b3db1608fe2580019e29ad880670c553847b5e7a
6880 F20101212_AAARGC jantama_k_Page_088thm.jpg
3c6be1d9555075702296878b1722cfbf
119ea994d15152ffbf9b7f9d0b05b5ce0f27c1eb
30228 F20101212_AAARFO jantama_k_Page_133.QC.jpg
82fc868f2a279a4d073998047bfd79b2
e33dd2cbbf74f87672a5ca48cf1d5e5b4ce214c4
27396 F20101212_AAAREZ jantama_k_Page_048.QC.jpg
b61aba2637a75192b92d9bf581f0bbec
e466c8ca9668aa3e5bd77892b527ec7fd7b9def4
F20101212_AAAQZU jantama_k_Page_066.tif
a64ab887e4146d70dc291e408997cdaa
e08f3117913d859d6b534409f932d1f8e6e0a379
37259 F20101212_AAARGD jantama_k_Page_138.jpg
e216653eab8bf5f5cbe704791ef0e3e3
213399b3d910bc2ce77167ae6287924ce431effc
F20101212_AAARFP jantama_k_Page_065.tif
8e73bbe5e917c9692846d9c14ebedfd2
acaaee421b2a7b7f16c9d8470678a53ac55334e6
6769 F20101212_AAAQZV jantama_k_Page_001.QC.jpg
847bd010087f7cf4fe58e633a0be6138
e295cd8b1fe6a090efa54792db01fede848ffd63
29311 F20101212_AAARGE jantama_k_Page_116.QC.jpg
116964c463b795e64abf347e19d89439
73467603bd2a45918b83dc900187d31aafcc4f7a
F20101212_AAARFQ jantama_k_Page_064.jp2
b15a0e2a48b1c3afff0fd13c05def569
72ef647074748f5a8618d7ef710f06377f502b55
7224 F20101212_AAAQZW jantama_k_Page_060thm.jpg
a7e1d9792827ff6fbad6f17d08181068
4ad01e41a20b3c5e16f8ced44158d7efea9add11
1051922 F20101212_AAARGF jantama_k_Page_120.jp2
e495db2bcced9fed46a695e0898e461e
6650b8ae2bc9a2a2da631e56038aa97a9771b6d0
6511 F20101212_AAARFR jantama_k_Page_036thm.jpg
597b3cd4c9bee20e4e53783e655ab41a
44a00d19ce1e71540eec1f234a03bb84609e3a4c
104911 F20101212_AAAQZX jantama_k_Page_084.jpg
7cbcbc1f439a6c22f4d53ee3349e50d5
f9d2b705369bb9c93d3124ad9f1f88eaac970a81
6878 F20101212_AAARGG jantama_k_Page_121thm.jpg
8af443b86fdc67bc227c51e1ded75071
9e5c460d8098a0572f08b16eb381735645be979a
68286 F20101212_AAARFS jantama_k_Page_095.jpg
e9f246e95b5fe3e6d2e8d0021d4e6148
874981301d052b1a4ae0516166e4861c0fe7cfc7
8425398 F20101212_AAAQZY jantama_k_Page_101.tif
5bd47f9059e34d203d2edcefd334464b
9e715430dbb73fa1ba420e11fedcbcc71073a843
1038076 F20101212_AAARGH jantama_k_Page_039.jp2
54ac08a2a7f6fafc5103feb3fbf4694c
8d576ac5b70a00e17bbbf4e5938d62079e491d2a
1051951 F20101212_AAARFT jantama_k_Page_126.jp2
e7bf87b31f1cf31d9e4c47918037122a
8929a134624b0ded7409159947d549c91d2cb6d2
F20101212_AAAQZZ jantama_k_Page_010.tif
84e4c5f673b9569e8803b7afdf284bcc
dabfa1e37be5065a5c211b997c10495541243725
F20101212_AAARGI jantama_k_Page_052.tif
b77f767641ccd907437001ac3f6e95da
3edef5dc0051285875680113a259bf3ece7086bb
6407 F20101212_AAARFU jantama_k_Page_041thm.jpg
c13b911c47a6f0ec612c41cdf4df71cd
3be1433f730bfee133e48820be4407caf8f9ab9e
F20101212_AAARGJ jantama_k_Page_118thm.jpg
dad4a63c2ec41f39f9e64d93e55435dd
e3446deb2c75b3d88f0d2e9a8a9439187b214f8e
327456 F20101212_AAARFV jantama_k_Page_066.jp2
dc298eb7748e27fe012ba2e81577640a
4749e1f469442b640c5a73277c5c5f64fd2fcce6
109355 F20101212_AAARGK jantama_k_Page_083.jpg
bacac444cf171ba07f0205d8967cdc42
a1f280be311581426d81e3ce4a6f0a2d80d7e665
F20101212_AAARFW jantama_k_Page_072.tif
d1e408a80183b976c95eaa4f78c7dd37
298d11939a8520e61efb4ad2766875103cde49b8
24281 F20101212_AAARGL jantama_k_Page_039.QC.jpg
b63d51a2ca87184f8ec66ffe996fd60e
2290a03b7df4e54cfc94462e96e4a6f5019e01ea
93496 F20101212_AAARFX jantama_k_Page_078.jpg
7d713e5cd132d49d02df7463b092c8c9
2865d755131f676d6a4b2335aaae6b53a5cb9d62
6981 F20101212_AAARGM jantama_k_Page_079thm.jpg
c51e9ec1281c242800a7513cf653fe3a
a06d8efae4ef6dc2023335ccaa5ab0325d1a7a73
30160 F20101212_AAARFY jantama_k_Page_088.QC.jpg
8b085107e907f869157b13c66d78ad3b
08a8cbab421c836d36d666408cc08cf11be82d89
5788 F20101212_AAARHA jantama_k_Page_097thm.jpg
5b979c5e6f9a898d85c4ce5d77d8f668
a5c718e2c727d8627a13e07d75d72b00581d1c60
89184 F20101212_AAARGN jantama_k_Page_037.jpg
b26461320a27ec4b5607b87249573cee
53ec25b1bb418ba3c80b755267c65041a0695a35
F20101212_AAARFZ jantama_k_Page_134.tif
54d86dc05646cdeb7db1a28a74e787b8
947950727fe7f1a23d4596f0ccc3436cab728281
30446 F20101212_AAARHB jantama_k_Page_060.QC.jpg
58eee9fd01e91bd484c70f183e7b6b24
38a46547bdf033dc732d4004cdd9f3e5974b2d65
555888 F20101212_AAARGO jantama_k_Page_119.jp2
3bbfa87bea2aee5970d36a71c5ea2f8b
7feef129afb3a153f6a167b17ceafb07277dec80
F20101212_AAARHC jantama_k_Page_127.jp2
082b00826f83fd5642a6b22d73b8add5
be73b97e5494cf58dab46d3b743280d93c199226
27117 F20101212_AAARGP jantama_k_Page_028.QC.jpg
5caa533295438300c78d5ea968f792fd
9d5ed3f02b0853c14234f4bdf32aa4b5e3d294dc
6573 F20101212_AAARHD jantama_k_Page_032thm.jpg
42d22e0761cb8771aedcfe227fed8ce7
c06bd2a466bae5153501e28fd4d327d2cf8a0058
24931 F20101212_AAARGQ jantama_k_Page_096.QC.jpg
05499592d54a0595ca633b42b3a70de7
eef125b6861e6a88ee4e9ace0b8c556371b5a0e1
21705 F20101212_AAARHE jantama_k_Page_070.QC.jpg
2c87d16bc6d41171f338775eb08a0098
addff11ebdb91151041b3924f5e05320655d21d5
F20101212_AAARGR jantama_k_Page_135.tif
48395316d8b674f41b5d491f1bcd694b
8061e2218085949d0a1a9beff1d73be835de3998
F20101212_AAARHF jantama_k_Page_077.tif
3f87bbbff30a18244199297a484b2ce1
283be9315c2dc0e38c787349934332762663a219
3277 F20101212_AAARGS jantama_k_Page_057thm.jpg
062ade6a90332968c4a379c0aefd3fb3
6eb398e74d2afda145d1e8cd1ff55df5cf9c7116
6863 F20101212_AAARHG jantama_k_Page_061thm.jpg
b38dc3f9988036fc84c7deaf484468a0
5b252755529f74ea08e5fc72c6e818b6cb9f2141
88664 F20101212_AAARGT jantama_k_Page_089.jpg
3e9095178734dbde511213ab704cc767
68dde4fe0f728dbf529a0e0f3635d491fb5a0e13
F20101212_AAARHH jantama_k_Page_103.tif
0fd81e559fb2629296f7a0d98a526d32
98954538d32d3b2e049048819a633bb8b195e98b
F20101212_AAARGU jantama_k_Page_093.tif
cfd1c45e21dcdf1fba3b151a58596d8c
5df27e1db7a7bd5af319990675b9811f78c5785a
F20101212_AAARHI jantama_k_Page_032.jp2
54ffc96fd8dedab0498f0442f17e230b
c7a71e5901d91f8de9060468214e2357142c79dc
89218 F20101212_AAARGV jantama_k_Page_035.jpg
c35f4842193264c48b46daa1ee69989c
259ac6141a5d304a7e9d0c038c42870c35ec7362
6733 F20101212_AAARHJ jantama_k_Page_089thm.jpg
02c3b43195def4ab0630859cba110172
c850b76f6478be0774284aaa2b0b1fc0c9bdea73
F20101212_AAARGW jantama_k_Page_023.tif
f4b5c5cde8c22775d6194ed690f7cf37
7b2525b7b4badd18454ae4e1c5924f43816b7715
F20101212_AAARHK jantama_k_Page_137.tif
0140021ca6bba8c9fc764531ce66e21a
10d0a3f7c3d82dd7cbc657cb56d14b75f9717a1b
87163 F20101212_AAARGX jantama_k_Page_022.jpg
6a24af44c06bedaee1802dd533c39ddb
a5a25ad5ff26853d264b36622c4306ca4e33124c
28749 F20101212_AAARHL jantama_k_Page_065.QC.jpg
997e8672ce04a7141b9b7454695ce480
954386e1f47f9203611fa0bb94dee357f75cb978
10798 F20101212_AAARGY jantama_k_Page_011.QC.jpg
4d85a2d72482d1347c5bb4980a79ffcd
f0a2df91ad2e5635f9c38460a4bdd3691f5a0263
91292 F20101212_AAARIA jantama_k_Page_062.jpg
1407d1d2f3b1b6d0d460da424e0b2604
7cad8e171e4f5ed55a6f90c7155d4355de4d9435
10004 F20101212_AAARHM jantama_k_Page_013.QC.jpg
6e3641957452dc73c463c7642e9837d9
71b1499974281f74b34d202e05b7d40194500ed0
F20101212_AAARGZ jantama_k_Page_088.tif
24082c0cd055077c22c99427943eb168
376594cd76c56f1258dc32b47fc9ba8cf01e19c5
80362 F20101212_AAARIB jantama_k_Page_082.jpg
982bc5d1edf3726d711cc1de95bc1a50
0a2bbad83907dc45cef9ce0495486865c09f3d50
6610 F20101212_AAARHN jantama_k_Page_128thm.jpg
29868028a9c312771ea778e163333660
7baa9ce5a31c855013f994653f74dc30b41db32b
93837 F20101212_AAARIC jantama_k_Page_091.jpg
309d706b814f489180b65777bba89d69
8415252cd6176ed02a7580e77a62d4ff31db6e1c
1051937 F20101212_AAARHO jantama_k_Page_044.jp2
45ac107e1ce6dcbdd2513dff460d73b5
547a682f63f24a4e750456f1d5c0012de246d149
39574 F20101212_AAARID jantama_k_Page_098.jpg
a241740a108bf523633867b6a4186bbb
2548277d20693d9acd4e175bc3e182fd3f46334d
F20101212_AAARHP jantama_k_Page_130.tif
d5ee5d467d9629a8dc5eedc7968f7ea1
988fc8a8b1b84f486f8911fbed417ace6381259c
101085 F20101212_AAARIE jantama_k_Page_110.jpg
bc49c5ca27aa5396814a679ea61520be
b5cc3edd2f701b3f28870971d5c00ca2914dc38c
807723 F20101212_AAARHQ jantama_k_Page_124.jp2
ae206dd8cc5b051b1f6162c578c75191
084a84be0dde1b73215d12c217484866905962af
83720 F20101212_AAARIF jantama_k_Page_120.jpg
828783156fa3a8f063c2d29009330e47
879d3ea8517e4778b1791c978c14ebe926a5df63
F20101212_AAARHR jantama_k_Page_112thm.jpg
ace2798896e2025363e866b5592a7f45
22052870393de66d966ac8efc7d6d88f479591b1
60579 F20101212_AAARIG jantama_k_Page_124.jpg
90f8ced69cf5c9b6a5d95a5b1633c36e
b4e5702ddbe7c7653ff58a1a02391a3465451754
103540 F20101212_AAARHS UFE0022504_00001.mets
e9ac8a0112d0095f8fdeb519e8803d7f
5a12cc7c4924bdfaa014121f5c747b5d65b889a4
111294 F20101212_AAARIH jantama_k_Page_129.jpg
e8454186c9ab7cba70115c033d3efd89
b30d96641a743b67299b8869281a4d93bce31dd5
F20101212_AAARII jantama_k_Page_008.jp2
32b0103120a1f54580a13e5baab9faa0
90fe78f4f2a880aab86a1bac83511e95407522da
1051954 F20101212_AAARIJ jantama_k_Page_020.jp2
394420e1c7ae14e5260caecee2522861
89986d6c351e2ff06177d727477613e284c51b88
75834 F20101212_AAARHV jantama_k_Page_004.jpg
a47698ca58a676e677103cb73f1d31fe
828af44cdcac906068e9fd2925036aa16fd6f7f4
965325 F20101212_AAARIK jantama_k_Page_021.jp2
ee1fc9659274c3c920c43d0e6a39299b
e9d7d4fbd1cf73f198b072a98a7512e0fa6771b2
59270 F20101212_AAARHW jantama_k_Page_005.jpg
ec6aeba546e5144d4708b6b14e23b7fb
fed227bdc1666aa6cb5130aacd77212b6acbc064
839503 F20101212_AAARIL jantama_k_Page_047.jp2
d8bdc2c32414af601133a4e363efc67b
4d4aa73afdcd125b3c3da6efd55e3be618f3d478
88915 F20101212_AAARHX jantama_k_Page_036.jpg
e2bc15577afbd9b2c742877bca0090e9
38641bacc89594af461e680d073cc5476660600e
F20101212_AAARJA jantama_k_Page_094.tif
a5a736465ca009c7780fb695cc35e374
9f540952383f6a264c8c5dede46d00f2e0c66730
F20101212_AAARIM jantama_k_Page_079.jp2
54a5bcbbbc4bd9bd2f699b869a4fc2bd
fce6426b7c3817c6f3974097767cbdce04899b17
102017 F20101212_AAARHY jantama_k_Page_050.jpg
c7623a13a90d74d53b43a4e6092989d1
722aaa698d651ce2325a96c231f79a19d49e1610
F20101212_AAARJB jantama_k_Page_095.tif
50d3dffd3a085d21e0d8c0f27a6fa4ec
41f5a05497e1a278ac9cba36bd1415124a746ff4
F20101212_AAARIN jantama_k_Page_085.jp2
3f56df328a5316e8f26e3bd610042630
b465ba519f362c4f520731d2d045bac8a5ad87ce
91477 F20101212_AAARHZ jantama_k_Page_053.jpg
0c78dd20d6d309765beb6dc257141f50
6099eb7fa53eb6fbb283ca75173f5940f8f9adc6
F20101212_AAARJC jantama_k_Page_108.tif
0d271128d950a169b1828142b3a464cd
2607468cb72658378262e3e3601cef7c1d119ff2
F20101212_AAARIO jantama_k_Page_089.jp2
724a3e5b6162fb015dc39297f9f24057
b60d17ce0536d92965d9f73b14de06d48345fc14
F20101212_AAARJD jantama_k_Page_119.tif
a449ed27f31df3404b09bdf26a3f0108
e946ac4049f3b84308887f2bdc45d83269086bf8
F20101212_AAARIP jantama_k_Page_096.jp2
16f401485b47b5a957c991e71d231f67
a2e64edd02a48ce876faada0dba68ef9dbe3f32a
F20101212_AAARJE jantama_k_Page_125.tif
c7070d345e3d65402bcada08100e0755
3edd1d45f0df387028e24bd0b693665a9bd4453f
F20101212_AAARIQ jantama_k_Page_105.jp2
78c131a3f003cccd15b0606494c4d94e
d9f5652e6d5f397d1b370048ea45eee1594f7a14
F20101212_AAARJF jantama_k_Page_128.tif
8bdd4aa3ec2d71bc2d404677d9187a29
2e52805ea9b230d6a09933e26fa50808548400f3
F20101212_AAARIR jantama_k_Page_130.jp2
71e7264162d3799e097401a51c7dd0be
8d9203b75ae20b964c16f29b26cd8493851c48fd
F20101212_AAARJG jantama_k_Page_132.tif
ff64e9c5ea654e7c5dd01d10bd1405ac
88747032ee1ae4af7daf5d2a397121f5f38fd0d1
F20101212_AAARIS jantama_k_Page_135.jp2
cfab7c1f44aba91f1360166ab829cf25
9a56f681e0cd74374b5c82da344ab1d0c902a112
F20101212_AAARJH jantama_k_Page_138.tif
0c25d24582894c587d27b45029de2b4b
63449d36d8725b7f2217a4a2ac12f6c912486b59
F20101212_AAARIT jantama_k_Page_025.tif
7253b61fed277b6829fa223f068d0ced
51f533bb91d8c1b94d6f7c2b5e0ca585132cd627
F20101212_AAARJI jantama_k_Page_139.tif
a740d3ad411ec38b4262803597cae040
9a9faa9a1a95cfedb3385852e51754d1f98a9a31
F20101212_AAARIU jantama_k_Page_029.tif
183ef91685faaf3b50210508e65b24ab
83495cd86d4340531db5b766d08f0b6f54fd262d
F20101212_AAARIV jantama_k_Page_034.tif
2df2296b50e881d43850a37dde9b5ab2
5c0d673e8bf6db415e68cc23ddb13489a9323977
18980 F20101212_AAARJJ jantama_k_Page_124.QC.jpg
ed7b83655b106f1c904358a1265dc88a
86e81db96b84cebe6f9e8a52b5ca64169d9a431a
F20101212_AAARIW jantama_k_Page_042.tif
dbf17859c2473816a75f82c464fcf828
af4240d4e4e749bbf659ef5a66cebcc7c3125d68
6597 F20101212_AAARJK jantama_k_Page_051thm.jpg
623d5fafa74f9e7cbda504b36d551602
5e63afd5baef78d790c0fa090b9fd8031d421148
F20101212_AAARIX jantama_k_Page_055.tif
9df99e06375d6aaafa1f79bdce53b485
3d1bc8527801be39cfebc84e2c6e9eeb90a2bfe4
23966 F20101212_AAARJL jantama_k_Page_109.QC.jpg
0bfc252cb36fc9d974f8aa037ffc7947
4e9bfb5a3e4ba3ce0745d07102be41b3db6c6f88



PAGE 1

1 METABOLIC ENGINEERING OF Escherichia coli TO EFFICIENTLY PRODUCE SUCCINATE IN MINERAL SALTS MEDIA By KAEMWICH JANTAMA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Kaemwich Jantama

PAGE 3

3 To my parents, Prateep and Nongluck Jantama. Their love, laughter, support, and sacrifice have been constant. Because of this, in all aspects of my life, I am the luckiest person in the world. I am truly grateful.

PAGE 4

4 ACKNOWLEDGEMENTS First and forem ost, I would especially like to express my sincere gratitude and deep appreciation to to my microbiology advisor, Di stinguished Professor Lonnie O. Ingram, for his extensive scientific support, for generously providing research f acilities and also for his helpful advice, constructive comments and guidance in many other areas throughout my dissertation work at Microbiology and Cell Science Departme nt, University of Florida. His extensive knowledge as a researcher and e xperience in academia taught me invaluable lessons that I will carry with me throughout my career. I extend my gratitude to my chemical engine ering advisor, Professor Spyros A Svoronos, for his warm guidance, immeasurab le attention, constant support, and continuous encouragement to persevere through the obstacl es and frustrations of my graduate study at Chemical Engineering Department, University of Florid a. He was an incredibly gifted mentor. I also thank my supervisory committees, Prof essor Keelnathan T Sh anmugam, Professor Ben Koopman, and Associated Professor Yiider Tseng, for their valuable discussions, suggestions, and insights. My generous appreciation goes out to all I ngrams lab members, especially Dr. Xueli Zhang and Jonathan C Moore for their warm frie ndship, support, kindness, helpful suggestions, encouragement, and generous contribution during my research work. Thanks always go to Sean York and Lorraine Yomano for always help keeping chemicals and equipments in proper working order. I feel lucky to have worked with such talented researchers, whose passion for research and friendly nature made every day enjoyable.

PAGE 5

5 My heartly thanks must be extended to Shirley Kelly at Chemical Engineering Department, and Janet Lyles at Microbiology and Cell Science Departments for providing excellent and superb help through all my paper work. I am obliged to Ministry of Science, Technology and Environment, Thailand for providing the Royal Thai Government Scholarship throughout six years of my abroad study in the United States of America. I am greatly indebt ed to all Thai people who have devoted me to the most valuable investment. I promise all of my philosophy and knowledge I have learnt will be returned to our nation as a whole. Finally, I wish to express my infinite thanks and appreciation to my lovely parents, Mr. Prateep and Mrs. Nongluck Jantam a, and my aunt, Miss Nongkran Jaidej, for all their grateful love and care, precious spiritua l support, patronage and sincer e encouragement. Least but not last, I want to thank a half of my soul, Dr. Sirima Suwannakut, who has been my greatest supporter and companion. Her patience and love has helped me achieve my goals throughout graduate school. I also give th anks to the Maynard family for being my home away from home while I lived in Florida. Without their inexhaustible patience, this work would not have been accomplished. My success belongs to you.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGEMENTS.............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES.......................................................................................................................10 LIST OF ABBREVIATIONS........................................................................................................ 11 ABSTRACT...................................................................................................................................17 CHAP TER 1 INTRODUCTION..................................................................................................................19 Succinate and its Importance.................................................................................................. 20 Literature Review.............................................................................................................. .....23 Brief Summary of Enzymes Invol ving in Anaerobic Ferm entation................................ 23 Succinate-Producing Microorganisms.............................................................................27 Succinate Producing Pathways in Microorganisms........................................................28 Basis for Increased Succinate Pr oduction in Previous Developed E. coli Strains .......... 30 Previously Developed Succini c Acid Producing Strains in E. coli .................................32 Objective.................................................................................................................................36 Genetic Manipulation of E. coli ......................................................................................37 Metabolic Evolution in Metabolic E ngineered E. coli ....................................................37 Metabolic Flux Analysis of Metabolic Engineered E. coli .............................................38 2 GENERAL PROCEDURES................................................................................................... 39 Medium Preparation............................................................................................................. ..39 Growth of Bacterial Cultures.................................................................................................. 39 Plasmid Preparation by Alkaline Lysis Method ..................................................................... 40 DNA Amplification by Polymerase Chain Reaction (PCR)................................................... 40 Agarose Gel Electrophoresis of DNA.................................................................................... 41 Restriction Endonuclease Digestion of DNA ......................................................................... 41 DNA Ligation.........................................................................................................................42 Preparation of E. coli Competent Cells ..................................................................................42 Preparation of E. coli Competent Cells by CaCl2 Method.............................................. 42 Preparation of E. coli Competent Cells by Electr o-transform ation Method for E. coli Carrying Temperature Sensitive Plasmid....................................................................... 42 Transformation of Competent Cells....................................................................................... 43 Transformation of E. coli By Heat Shock Method .......................................................... 43 Transformation of E. coli by electroporation ..................................................................43 Anaerobic Ferm entation ......................................................................................................... 44 Analytical Methods............................................................................................................. ....44

PAGE 7

7 3 COMBINING METABOLIC ENGINEERIN G AND MET ABOLIC EVOLUTION TO DEVELOP NONRECOMBINANT STRAINS OF Escherichia coli ATCC8739 THAT PRODUCE SUCCINA TE AND MALATE........................................................................... 46 Introduction................................................................................................................... ..........46 Materials and Methods...........................................................................................................46 Strains, Media and Growth Conditions........................................................................... 46 Genetic Methods..............................................................................................................48 Deletion of mgsA and poxB Genes ..................................................................................48 Fermentations.................................................................................................................. 51 Analyses..........................................................................................................................52 Results and Discussion......................................................................................................... ..52 Construction of KJ012 for Succi nate Production by Deletion of ldhA adhE and ackA ..............................................................................................................................52 Improvement of KJ012 by Metabolic Evolution............................................................. 55 Construction of KJ032 and KJ060.................................................................................. 56 Construction of KJ070 and KJ071 by Deletion of Methylglyoxal Synthase ( mgsA ) ......61 Construction of KJ072 and KJ073 by Deletion of Pyruvate oxidase ( poxB ) ..................62 Fermentation of KJ060 and KJ073 in AM1 Medium Containing 10%(w/v) Glucose.... 62 Conversion of Other Substrates to Succinate .................................................................. 63 Production of Malate in NBS Medium C ontaining 1 m M Betaine and 10%(w/v) Glucose........................................................................................................................64 Conclusions.............................................................................................................................64 4 BATCH CHARACTERIZATION AND M ETABOLIC DIS TRIBUTION OF EVOLVED STRAINS OF Escherichia coli ATCC8739 TO PRODUCE SUCCINATE..... 67 Introduction................................................................................................................... ..........67 Materials and Methods...........................................................................................................67 Strains, Media and Growth Conditions........................................................................... 67 Fermentations.................................................................................................................. 67 Analyses..........................................................................................................................68 Calculation Specific Production Ra tes for Excreted Metabolites ................................... 68 Metabolic Flux Analysis.................................................................................................. 69 ATP and Cell Yield Analysis..........................................................................................70 Fermentation Pathways................................................................................................... 71 Results and Discussion......................................................................................................... ..75 Batch Characterization of Evolved E. coli Strains that Pr oduce Succinate.....................75 Effect of Glucose Concentra tions to Succinate Production ..................................... 75 Effect of Initial Inocula and Acetat e on Succinate Production in KJ060.................82 Effect of Low Salt Media (AM1) on Succinate Production in KJ060 ..................... 86 Effect of low Salt Media (AM1) on Succinate Production in KJ073 ....................... 86 Metabolic Flux Analysis in E. coli S trains To Produce Succinate.................................. 87 Metabolic Flux Distributions in E. coli W ild Type.................................................. 87 Metabolic Flux Distributions in Mutant Strains .......................................................91 Effect of Gene Deletions on ATP and Cell Yields.......................................................... 93 Conclusions.............................................................................................................................95

PAGE 8

8 5 ELIMINATING SIDE PRODUCTS AND IN CR EASING SUCCINATE YIELDS IN ENGINEERED STRAINS OF Escherichia coli ATCC8739................................................ 96 Introduction................................................................................................................... ..........96 Materials and Methods...........................................................................................................97 Strains, Media and Growth Conditions........................................................................... 97 Deletion of FRT Markers in the adhE ldhA and focA-pflB Regions .............................97 Construction of Gene Deletions in tdcDE, and aspC ....................................................104 Removal of FRT Site in ackA Region And Construction of citF sfcA and pta-ackA Gene Deletions ...........................................................................................................105 Fermentations................................................................................................................ 107 Analyses........................................................................................................................107 Results and Discussion......................................................................................................... 108 Elimination of FRT Sites in KJ073 to Produce KJ091..................................................108 Deletion of tdcD and tdc E Decreased Acetate Production............................................108 Citrate lyase ( citF ) Deletion Had no Effect on Ac etate or Succinate Production.........112 Deleting aspC had no Effect on Succinate Yield.......................................................... 113 Deleting sfcA Had no Effect on Succinate Yield ...........................................................113 Deleting the Combination of aspC and sfcA Im proved Succinate Yield...................... 115 Reduction in Pyruvate and Acetate by Deletion of pta .................................................116 Conclusions...........................................................................................................................117 6 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS............................................ 120 General Accomplishments.................................................................................................... 120 Future Works........................................................................................................................122 Future use of Succinate as Bioplastics.................................................................................. 123 LIST OF REFERENCES.............................................................................................................125 BIOGRAPHICAL SKETCH.......................................................................................................139

PAGE 9

9 LIST OF TABLES Table page 1-1 Comparison of succinate production by natural producers............................................... 28 1-2 Comparison of succinate production by E. coli ................................................................33 2-1 PCR parameters for the am plification of specific genes. ..................................................41 3-1 Composition of mineral salts m edia (excluding carbon source)........................................ 47 3-2 Escherich ia coli strains, plasmids, and primers used in this study....................................49 3-3 Fermentation of glucose in minera l salts m edium by mutant strains of E. coli .................57 4-1 Escherich ia coli strains used in this study......................................................................... 68 4-2 Reactions used in Metabolic Flux An alysis (MF A) for succinate production under anaerobic condition............................................................................................................ 73 4-3 Stochiometric relationship between the me tabolic inte rmediates and metabolites and the network reactions (matrix K represented) for an anaerobic succinate production in glucose minimal medium in E. coli ...............................................................................75 4-4 Fermentation profile for succinate production in 5% a nd 10% glucose NBS m edium..... 77 4-5 Comparison of KJ060 on metabolite pr oduction using 10%(w/v) glucose (~556 m M) as substrate in NBS salt medium with diffe rent initial acetate concentrations and initial cell density........................................................................................................... ....83 4-6 Comparison of KJ060 and KJ073 on meta bolite production using 10%(w/v) glucose (~556 m M) as substrate in AM1 salt me dium with initial cell density............................. 84 4-7 Specific production rate of extracellular m etabolites........................................................ 88 4-8 Metabolic fluxes distribution of an anaerobic succinate production in 5%(w/v) and 10%(w/v) glucose NBS of various E. coli strains..............................................................90 5-1 Escherich ia coli strains, plasmids, and primers................................................................. 98 5-2 Fermentation of 10%(w/v) glucose in mi neral salts AM1 m edium (1mM betaine) by mutant strains of E. coli ...................................................................................................114

PAGE 10

10 LIST OF FIGURES Figure page 1-1 Possible production routes to succinate ba sed products as commodity and specialty chem icals...................................................................................................................... ......21 1-2 Central metabolic pathway of E. co li .................................................................................24 3-1 Fermentation of glucose to succinate................................................................................. 54 3-2 Coupling of ATP production and growth to succinate and m alate production in engineered strains of E. coli. Solid arrows connect NADH pools..................................... 55 3-3 Steps in the genetic engineer ing and m etabolic evolution of E. coli ATCC 8739 as a biocatalyst for succinate and malate production................................................................ 59 3-4 Growth during metabolic evolution of KJ012 to produce KJ017, KJ032, and KJ060. ..... 59 3-5 Fermentation products during the metabolic evolution of strains for succinate and m alate production.............................................................................................................. .60 3-6 Production of succinate and malate in m ineral salts media (10% glucose) by derivatives of E. coli ATCC 8739...................................................................................... 63 4-1 Ferm entation Pathway of E. coli under anaerobic condition.............................................72 4-2 Proposed succinate producti on pathway from glucose......................................................85 5-1 Strain constructions....................................................................................................... ...109 5-2 Standard pathway for the anaerobic metabolism of glucose in E. coli. ...........................110 5-3 Expanded portion of metabolism illustrating the pathways of additional genes that have been deleted (solid crosses) in the context of standard central metabolism. ......... 111

PAGE 11

11 LIST OF ABBREVIATIONS Ace acetate AceF lipoate acetyltransferase AceE E1 subunit of pyruvate dehydrogenase complex ACKA acetate kinase ADHE alcohol dehydrogenase ADP adenosine diphosphate AM1 Alfredo Mertinez medium version 1 AMP adenosine monophosphate ATP adenosine triphosphate ATCC american type culture collection atm atmosphere Av average Bio biomass bp base pair BSA bovine serum albumin C degree Celsius C2 2-carbon compound cAMP cyclic adenosine monophosphate CDW cell dried weight CoA coenzyme A cm centimeter C/N carbon-nitrogen ratio

PAGE 12

12 CSL corn steep liquor DAACS superfamily of transporter dATP deoxyadenosine triphosphates DctA dicarboxylate DAACS transporter dCTP deoxycytidine triphosphate dGTP deoxyguanosine triphosphate DHAP dihydroxyacetone-phosphate DNA deoxyribonucleic acid dNTP deoxynucleo tide triphosphate dTTP deoxythymidine triphosphate E1 subunit of PDH complex; AceE dimer E2 subunit of PDH comlex; AceF core E3 subunit of PDH complex; LpdA dimer EC enzyme commission on nomenclature number EDTA ethylene diamine tetraacetic acid EM extracellular or excreted malate EP extracellular or excreted pyruvate FBA flux balance analysis Fe-S ferrous-sulfur compound FLP recombinase enzyme FNR fumarate-nitrate reductase regulatory protein For formate FRT FLP recombinase recognition site

PAGE 13

13 g gram Gluc or G glucose GAPDH glyceraldehyde 3-phosphate dehydrogenase h hour HPLC high performance liquid chromatography HPr histidyl phosphorylated protein IPTG isopropyl-D-thiogalactoside kg kilogram kPa kilopascal Km michalis constant kb kilo base pair L or l liter lac lactate LB Luria-Bertani LpdA lipoamide dehydrogenase LDHA lactate dehydrogenase M molarity mal malate MFA metabolic flux analysis mg milli gram MH2 menaquinol (reduced form) MH4 cultured medium (yeast extract based medium) min minute

PAGE 14

14 ml milli liter mM milli molar MMH3 cultured medium (yeast extract based medium) MOPS 3-[N-morpholino] propanesulfonic acid MQ menaquinone (oxidized form) ms milli second MW molecular weight N normality NADH nicotinamide adenine dinucleotide (reduced form) NAD or NAD+ nicotinamide adenine dinucleotide (oxidized form) NBS New Brunswick synthetic medium NaOAc sodium acetate vi specific volumetric flux of intermediates and compounds OAA oxaloacetate OD optical density PCK phosphoenolpyruvate carboxykinase PCR polymerase chain reaction PDH pyruvate dehydrogenase complex PdhR pyruvate dehydrogenase complex regulator protein PEP phosphoenolpyruvate PFLB pyruvate fomate-lyase Pi inorganic phosphate PO4 phosphate group

PAGE 15

15 POXB pyruvate oxidase PPC phosphoenolpyruvate carboxylase PPS phosphoenolpyruvate synthase Prod productivity p.s.i. pounds per square inch PTS phosphotransferase system PYC pyruvate carboxylase PYK pyruvate kinase pyr pyruvate Red Red recombinase RnaseA ribonuclease A rpm revolution per minute v or vol volume V volts sec second SDS sodium dodecyl sulphate sp. species STP standard temperature and pressure suc succinate TAE tris-acetate-EDTA TBE tris-borate-EDTA TCA tricarboxylic acid TDCD propionate kinase

PAGE 16

16 TE tris-EDTA buffer TF transferring U unit UV ultraviolet W weight YE yeast extract YATP cell yield per mole of ATP consumed YATP MAX maximum theoretical cell yield

PAGE 17

17 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy METABOLIC ENGINEERING OF Escherichia coli TO EFFICIENTLY PRODUCE SUCCINATE IN MINERAL SALTS MEDIA By Kaemwich Jantama August 2008 Chair: Spyros A. Svoronos Cochair: Lonnie O. Ingram Major: Chemical Engineering Succinic acid, which is one of the building bl ock chemicals, is currently produced by the hydrogenation of petroleum-derived maleic anhydride. The increase in price of oil and petroleum derivatives has made the microbi al production of succinate an ec onomically attractive option for succinate as a renewable commodity chemi cal. In this dissertation, I accomplished the construction of Escherichia coli ATCC 8739 derivatives to produce succinate in mineral salts medium under anaerobic condi tions. This work was done by a combination of metabolic engineering and metabolic evolution. Both stra tegies allowed us to engineer the central metabolism of E. coli to direct the carbon flow to succinate and to select the strains that produce succinate with high titer, producti vity, and yield. Strain KJ073 ( ldhA adhE ackA ( focA pflB ) mgsA poxB ) produced succinate with molar yield of 1.2 per mole of glucose used. This strain was further engineered for improvements in succinate production by eliminating acetate, malate, and pyruvate as significan t side products. Strain KJ122 ( ldhA adhE ackA ( focA pflB ) mgsA poxB tdcDE citF aspC sfcA ) significantly increase d succinate yield (1.46 mol/mol glucose), succinate titer (680-700 mM), and average volumetric pr oductivity (0.9 g/l-h). Strain KJ134 ( ldhA adhE ( focA pflB ) mgsA poxB tdcDE citF aspC sfcA ( pta-

PAGE 18

18 ackA )) produced less pyruvate a nd acetate with the succinate yield, titer, and average productivity of 1.53 mol/mol glucose used, 600 mM, and 0.8 g/l-h, respectively. Strains KJ122 and KJ134 produced near theoretical yields of succinate during simple, anaerobic, batch fermentations using mineral salts medium without the addition of plasmid or foreign gene, and any complex nutrient. Both may be useful as biocatalysts for the commercial production of succinate. Batch experiments were conducted with a wild type of E. coli and four succinateproducing strains in order to establish how metabolic fluxes changed as a result of gene deletions and metabolic evolution. The flux through pyr uvate dehydrogenase (P DH) complex was added to the classical anaerobic fermentation pathways and mutants lacking pyruvate formate-lyase (PFLB) increased the flux through this pa thway to produce NADH required for succinate production. Also, the mutants utilized phosphoenolpyr uvate synthase (PPS) to convert pyruvate produced during glucose phosphorylation back to phosphoenolpyruvate (PEP). This provided additional PEP utilized for producing succinate. Three mutants had pflB deleted, and these exhibited considerably higher fl ux to oxaloacetate (OAA). Increas ed glucose concentration did not affect the fluxes significantly, other than decreasing lactate pr oduction for the wild type from low to lower levels and decreasing the flux to biomass for the mutant strains. ATP generation was also studied. The wild type and a pflB+ mutant had ATP yield close to the maximum theoretical values. However, the pflBmutants had very low ATP yield. Correspondingly, the cells yields (YATP) were somewhat below the maximum literature value for the wild type and pflB+ mutant, and were considerably above that maximum for the pflBmutants. It is hypothesized that the strains may activate some unknown ATP generating pathways.

PAGE 19

19 CHAPTER 1 INTRODUCTION The upward trend in the price of oil is expect ed to further in crease demand for alternative bio-based chemicals (Nordhoff et al., 2007). The use of petroleum and its derivatives for industrial chemical production could be reduced in the future by a combination of environmental concerns over toxic by-products, resistance to biodegradation, and problems associated with recycling (Hatti-Kaul et al., 2007; Sauer et al., 2008). The co ncept of green chemistry was introduced in the early 1990s to encourage the use of technologies that reduce the generation of toxic substances and offer environmentally friendly alternatives to petroleum-based products (Anastas and Warner, 1998). This is now shifting to white biotechnology, the production of renewable chemicals by microbial and enzymatic routes (Lorenz and Zinke, 2005). Microbially produced organic acids represen t potential building block molecules for the chemical industry (Lorenz and Zinke, 2005). The versatility, substrate select ivity, regioselectivity, chemoselectivity, enantioselectivity and catalysis at ambient temperatures and pressures make the production of chemicals using bi ological systems more attractive. Although biocatalysts have more commonly been used for the production of hi gh-value products such as fine chemicals and pharmaceuticals (Breuer et al., 2004; Schmid et al ., 2001; Thomas et al., 2002), the market share of white biotechnology products is predicted to ri se from 5% to 20% by 2010 (Hatti-Kaul et al., 2007; Sauer et al., 2008). However, the success of increased market share of white biotechnology products is challenged by the cost-competitivenes s of existing chemical processes with capital assets already in place for commodity chemical production. Succinic acid has been identified by the U.S. Department of Energy as one of the top 12 building block chemicals that could be produced from renewable feedstocks (Werpy and Petersen, 2004). Current succinic acid producti on by the hydrogenation of petroleum-derived

PAGE 20

20 maleic anhydride is too expensive for widespr ead use as a platform chemical. Inexpensive microbial processes could provide succinic acid as a renewable building block molecule for conversion into chemical intermediates, specialty chemicals, food ingred ients, green solvents, pharmaceutical products, and biodegradable plas tics (Lee et al., 2004; Wendisch et al., 2006; Willke andVorlop, 2004; Zeikus et al., 1999). Potent ially high volume products that can be made from succinic acid include tetrahydrofuran, 1,4-butanediol, succindiam ide, succinonitrile, dimethylsuccinate, N-methyl-pyrrolidone 2-pyrrolidone, 1,4-diaminobutane, and butyrolactone (Sauer et al., 2008) The microbial production of succinic acid from carbohydrates offers the opportunity to be both greener and more cost effective than petroleum-based alternative products. In addition, microbial succinate production incorporates CO2, a primary greenhouse gas, providing further incentiv e for production by white biotechnology. Succinate and its Importance Succinate and its derivatives have been of comm er cial interest for many applications. It is alternatively used to produce new specialty ch emicals and materials for which the demand is growing rapidly (Sado and Tajima, 1980). Examples for applications in many industries are shown in Figure 1-1. First, succinate is used as an anti-microbial agent, as a flavoring agent, and as an acidulant/pH modifier. In the food market, newly introduced flavor enhancers are sodium succinate and dilysine succinate, used in low sodium food, which can replace monosodium glutamate (Jain et al., 1989). Sec ond, succinate has been used in the production of health-related agents including pharmaceuticals, antibiotics, am ino acids, and vitamins. Third, because of its structure as a linear saturated dicarboxylic acid, succinic acid can be used as an intermediate chemical and would be converted to many chem icals applied in chemical industry such as butanediol, tetrahydrofuran, butyrolactone, and other four carbon chemicals (Dake et al., 1987).

PAGE 21

21 It also has been used in the chemical industry as a surfactant, detergen t, extender, and foaming agent and as an ion chelator in which it is used in electroplating to pr event corrosion and pitting of metals. Diethyl succinate is a useful solvent for cleaning metal surfaces or for paint stripping. Ethylene diaminedisuccinate has also been used to replace ethylene diamine tetraacetic acid (EDTA) (Bergen and Bates, 1984). A polymerizat ion product of succinic acid and 1,4 butanediol has the potential to become a biodegradable plastic (Zwicker et al., 1997). Succinylation of lysine residues improves the physical and functio nal attributes of soy proteins in foods, and succinylation of cellulose is applied in impr oving water absorbability (Wollenberg and Frank, 1988). It is evident that it is important to deve lop technologies for the pr oduction of succinate to supply the industrial needs. Figure 1-1 Possible production routes to succinate based products as commodity and specialty chemicals (Zeikus et al., 1999).

PAGE 22

22 The total market size for uses of succi nic acid is more than $400,000,000 per year. Currently, more than 15,000 tonnes of industr ial succinic acid is sold, and is produced petrochemically from butane or oxidation of be nzene through maleic an hydride. The price of succinic acid varies between $5.90-8.80/kg depe nding on its purity (Zeikus et al., 1999). However, succinate produced fermentatively is about 5,000 tonnes per year and sold at about $2.20/kg to the food market. Fermentation-based pr oduction utilizes cheap agricultural products such as corn, starch, molasses, or cheap sugars such as glucose or sucrose as carbon substrates. The production cost of succinate by fermentation is lower than that by petrochemistry thus making fermentation-derived succinate sold at a lower proposed price at about $0.55/kg if the production size will be above 75,000 tonnes (Zeikus et al., 1999). Becaus e of its economics promise, fermentation-derived succinate has the potential to become a large volume commodity chemical that is forming the basis for suppl ying many important interm ediate and specialty chemicals. Moreover as a small molecule ch emical, succinate would replace many chemicals derived from benzene and intermediate petrochemi cals, resulting in a la rge reduction in pollution from the manufacture and consumption of ove r 250 benzene-derived chemicals (Ahmed and Morris, 1994). Succinate production by fermentation has distin ct advantages over productions of other organic acids because carbon dioxide gas is consumed during succinate production. The process would decrease pollution caused by the greenhous e gas. However, the production of succinate and most of its derivativ es is currently at the advanced research and developmental stage. Since the demand of succinate in many applications is high and increasing every year, interest in anaerobic fermentation has intensified especially as how it relates to the utilization of cheap

PAGE 23

23 sugar sources such as glucose, and other agri cultural carbohydrates to produce higher-value fermentation derived succinate. Literature Review Brief Summary of Enzymes Involving in Anaerobic Fermentation In m any microorganisms including Escherichia coli the process of oxidative phosphorylation cannot occur under anaerobic conditi ons and the cell produces energy from the process of degrading the origin al substrate known as substrate level phosphorylation. The cell is trying to maximize the formation of energy. Th e reducing power, NADH, which is produced during degradation of substrate, ha s to be reoxidized for the proce ss to continue, as its supply is not limitless. It is important to note that pyruva te produced by the glycolytic pathway will enter the tricarboxylic acid cycle (TCA), at least in part, to provide essential precursors for biosynthesis. The NADH, produced in the cycle ca nnot be converted to ATP as the cells have no supply of oxygen to drive oxidative phosphoryla tion. However, the cell can recycle NADH by means of reduction of some carbon intermediates that are accumul ated under these conditions. In other words, the reducing equivalents react w ith the accumulated carbon intermediates to reduce them in their turn (Figure 1-2). In the central anaerobic metabolic pathwa y, pyruvate is assimilated to re-oxidize NADH via lactate dehydrogenase and alcohol dehydrogenase activities resulting in lactate and alcohol productions, respectively. In the simplest method of hydrogen disposal, pyruvate is reduced to lactate at the expense of NADH. The reac tion is catalyzed by a cytoplasmic lactate dehydrogenase encoded by ldhA The enzyme is jointly induced by acid pH and anaerobiosis. Lactate can be produced from dihydroxyacetonephosphate (DHAP). DHAP is converted to methylglyoxal by product of mgsA (methyglyoxal synthase) and is subsequently converted to lactate by glyoxalase activities encoded by gloAB (Wood, 1961).

PAGE 24

24 Figure 1-2. Central metabolic pathway of E. coli Solid arrows represent central fermentative pathways. Dotted arrow represen ts microanaerobic pathway ( poxB ). Dash arrow represents minor lactate producing pathway (mgsA, gloAB ). Genes: pykAF : pyruvate kinase, ldhA : lactate dehydrogenase, pflB : pyruvate formate-lyase, pta : phosphate acetyltransferase, ackA : acetate kinase, adhE : alcohol dehydrogenase, ppc : PEP carboxylase, aceEF/lpdA : acetyltransferase/dihydrolipoamide acetyltransferase component of the pyruvate dehydrogenase complex, mdh : malate dehydrogenase, fumABC : fumarase, frdABCD : fumarate reductase, fdh : formate dehydrogenase, mgsA : methyglyoxal synthase, gloAB : glyoxylase, and poxB : pyruvate oxidase (adapted from Clark, 1989). Pyruvate formate-lyase encoded by pflB which is responsible fo r anaerobic conversion of pyruvate to acetyl~CoA and formate, is posttra nslationally interconverted between active and inactive forms. The enzyme synthesis is increas ed by anaerobiosis and can be raised further by pyruvate (Knappe and Sawers, 1990). Acetyl~CoA produced from pyruvate can be used to generate ATP from ADP by conversion to acetate, or to dispose off extra reducing equivalents by

PAGE 25

25 conversion to ethanol. The first process de pends on the consecutive action of phosphate acetyltransferase probably encoded by pta and acetate kinase encoded by ackA Synthesis of these enzymes is not significantly changed by the respiratory condition of the cell. Consequently, most of the acetyl~CoA is excreted as acetate by cells growing on glucose under aerobic condition. In the absence of glucose, external ac etate is mostly utilized by reversal of the pathway catalyzed by acetyl~CoA synthethase, encoded by acs (Kumari et al., 1995). Acetyl~CoA is also converted to etha nol under anaerobic fermentation. The pathway involves a consecutive reduction of the acet yl group of acetyl~CoA to acetaldehyde, and acetaldehyde to ethanol at the expense of NA DH. The reactions are catalyzed by a single polypeptide, which is alcohol dehydrogenase, encoded by adhE The propinquity of the two sites of reduction might minimize escape of the acetal dehyde, which is chemically reactive. ADHE protein has dual enzyme activities, which ar e alcohol dehydrogenase and coenzyme~A-linked acetaldehyde dehydrogenase. However, alcohol dehydr ogenase is more sensitive to inactivation by the aerobic metabolism (Clark, 1989). The assimilation of PEP also o ccurs via carboxylation in whic h it generates succinic acid. For PEP carboxylation, fumarate reductase is acti vated and re-oxidizes NADH using fumarate as an electron acceptor. Endogenous or exogenous carbon dioxide is combined with PEP by phosphoenolpyruvate carboxylase encoded by ppc The oxaloacetate formed is reduced to malate by the activity of malate dehydrogenase encoded by mdh Malate is dehydrated to fumarate by fumarase enzymes encoded by fumABC whose anaerobic induction depends on FNR regulation. Fumarate is finally reduced to succinate by fumara te reductase. The net result is disposal of four reducing equivalents (4H+ + 4e-). Fumarate reductase encoded by frdABCD can accept electrons from various primary donor enzymes through me naquinone. Fumarate reductase is induced

PAGE 26

26 anaerobically by fumarate but is repressed by oxygen or anaerobica lly by nitrate (Cecchini et al., 2002). Pyruvate dehydrogenase multi-enzyme co mplex is composed of products of aceEF and lpdA genes. The reaction is the gateway to the TCA cycle, producing acetyl~CoA for the first reaction. The enzyme complex is composed of multip le copies of three enzymes: E1, E2 and E3, in stoichiometry of 24:24:12, respectively. The E1 dimers (encoded by aceE ) catalyze acetylation of the lipoate moieties that are attached to the E2 subunits. The E2 subunits (encoded by aceF ) are the core of pyruvate dehydrogenase complex and exhibit transacetylation. The E3 component is shared with 2-oxoglutarate dehydr ogenase and glycine cleavage multi-enzyme complexes. Pyruvate is channeled through the cat alytic reactions by attachment in thioester linkage to lipoyl groups carrying acetyl group to su ccessive active sites. This enzyme complex is active under aerobic condition (CaJacob et al., 1985). Pyruvate can be converted to CO2, Acetyl~CoA, and NADH via the enzyme complex. Under micro-aerobic condition, pyruvate oxidase encoded by poxB is responsible for generating C2 compounds from pyruvate during the tr ansition between aerobic and strict anaerobic growth condition. This enzyme couples the electron from pyruvate to ubiquinone and decarboxylates pyruvate to generate carbon dioxide and acetate (Abdel-Hamid et al., 2001). Under both aerobic and anaerobic respirations, the versatilit y of the electron transport system for generating proton motive force is made possible by employing ubiquinone or menaquinone in the plasma membrane as a diffusi ble electron carrier or adaptor to connect a donor modular unit functionally to an acceptor modular unit. The types of electron carrier and donor modulars used for electron transport depend on the pattern of gene expression in response to the growth conditions. In anaerobic conditi ons, the electron donor modular units are primary

PAGE 27

27 dehydrogenases of the flavoprotein kind. The acc eptor modular units consist of terminal reductases requiring various components, such as Fe-S. In general, when the terminal acceptor has a relatively high redox potential such as oxygen, ubiquinone is used as the redox adaptor i.e. pyruvate oxidase case. When the terminal acceptor has a relatively low redox potential such as fumarate, menaquinone is used instead for exampl e reduction of fumarate to succinate (Cecchini et al., 2002). Succinate-Producing Microorganisms Succinate is an intermediate produced in th e metabolic pathway of several anaerobic and facultative microorganisms. Many propi onate-producing bacteria such as Propionibacterium species, typical gastrointestinal bacteria such as E. coli Pectinatus sp., Bacteroides sp., rumen bacteria such as Ruminococcus flavefaciens Actinobacillus succinogens Anaerobiospirillum succiniciproducens, Bacteroides amylophilus, Prevotella ruminicola Succinimonas amylolytica Succinivibrio dextrinisolvens Wolineela succinogenes and Cytophaga succinicans produce succinic acid from sugars and amino acids (Bryan t and Small, 1956; Bryant et al., 1958; Davis et al., 1976; Guettler et al., 1996a, b; Scheifi nger and Wolin, 1973; Van der Werf et al., 1997). Most of the succinate-producing bacteria have been isolated and cultured from the rumen, because succinate is required for a precursor of propinate that is subsequent to oxidation for providing energy and biosynthe tic precursors in such an animal (Weimer, 1993). Many bacteria have been described with th e natural ability to produce succinate as a major fermentation product (Guettler et al., 1998; Table 1-1). Some of these such as Actinobacillus succinogenes (Guettler et al., 1996 a,b; Meynial-Salles et al., 2007), Anaerobiospirillum succiniciproducens (Glassner and Datta, 1992), and Mannheimia succinoproducens (Lee et al., 2006; Song et al., 2007) can produce at high rates (up to 4 g/l-h) with impressive titers of succinate (300-900 mM) and high yi elds (>1.1 mol succinate/mol

PAGE 28

28 glucose). In a recent study with a native succinate producer, A. succiniciproducens, electrodialysis, sparging with CO2, cell recycle, and batch feeding were combined (MeynialSalles et al., 2007). However, these natural produ cers require complex media ingredients, which add cost associated with production, purification, and waste disposal. Succinate Producing Pathways in Microorganisms Succinic acid producing bacteria produce varying am ounts of succinic acid as well as other products, including ethanol lactic acid, and formic aci d during mixed acid fermentation. The rumen bacteria produce succinic acid in very high concentrations, along with acetate, pyruvate, formate, and ethanol. E. coli produces succinate as a mi nor fermentation product, typically 12 mol/100 mol glucose (Wood, 1961). Unlike E. coli the rumen bacteria such as A. succiniciproducens forms succinate up to 120 mol/100 mol glucose (Nghiem et al., 1997; Samuelov et al., 1991). Several different pathways can produce succinic acid (Lee et al., 2004). One pathway involves phosphoenolpyruvate (PEP) carboxylation that is catalyzed by PEP carboxylase or PEP carboxykinase. The other pathway involves pyruvate carboxylation. Two different enzymes, malic en zyme and pyruvate carboxylase in metabolic pathways are responsible for pyruvate carboxylat ion. Malic enzyme catalyzes th e conversion of pyruvate into malic acid while pyruvate carboxylase catalyzes the conversion of pyruva te into oxaloacetate (Lee et al., 2004). Table 1-1. Comparison of succinate production by natural producers a Organism Medium/Conditiona Succinate Titer (mM)b Succinate Yield (mol/mol) Reference Actinobacillus succinogenes FZ53 130 g/l glucose supplemented with 15 g/l CSL and 5 g/l YE, 80 g/l MgCO3, anaerobic batch fermentation, 78 h incubation 898 [1.36] 1.25 Guettler et al., 1996a Anaerobiospirillum succiniciproducens ATCC 53488 120 g/l glucose in peptone/YE based medium, integrated membrane-bioreactor-electrodialysis with CO2 sparging, 150 h incubation 703 [0.55] 1.35 MeynialSalles et al., 2007

PAGE 29

29 Table 1-1. ( Continued ) Organism Medium/Conditiona Succinate Titer (mM)b Succinate Yield (mol/mol) Reference Actinobacillus succinogenes 130Z 100 g/l glucose supplemented with 15 g/l CSL and YE, 80 g/l MgCO3, anaerobic batch fermentation, CO2 sparging, 39 h incubation 678 [2.05] 1.37 Guettler et al., 1996b Mannheimia succiniciproducens ( ldhA pflB pta-ackA ) 63 g/L glucose in MMH3 (yeast extract based medium), fed batch fermentation, 0.25 vol/vol/min CO2 sparging, 30 h incubation 444 [1.75] 1.16 Lee et al., 2006 Actinobacillus succinogenes ATCC 55618 70 g/l glucose with flour hydrolysate and 5 g/l YE, anaerobic batch fermentation with 4% inoculum, 65 h incubation 302 [0.55] 1.18 Du et al., 2007 Anaerobiospirillum succiniciproducens ATCC 53488 50 g/l glucose, 2% CSL, and 25 ppm tryptophan, neutralized with 5.5 M NaCO3, saturated medium of 0.3 atm partial pressure of CO2, 29.5 h incubation 289 [1.16] 1.04 Guettler et al., 1998 Succinivibrio dextrinosolvens ATCC 19716 15 g/l of each CSL and YE, 10 0 g/l glucose, and 80 g/l MgCO3, batch fermentation, 36 h. 226 [0.74] NR Guettler et al., 1998 Corynebacterium glutanicum R 40 g/l glucose (121 g total glucose) in Defined mineral salt medium with 400 mM NaHCO3 fed batch fermentation, 6 h incubation 195 [3.83] 0.29 Okino et al., 2005 Prevotella ruminocola ATCC 19188 15 g/l of each CSL and YE, 10 0 g/l glucose, and 80 g/l MgCO3, batch fermentation, 36 h incubation 160 [0.52] NR Guettler et al., 1998 Mannheimia succiniciproducens MBEL55E KCTC 0769BP 18 g/L glucose in MH4 (YE based medium) supplemented with 119 mM NaHCO3 a continuouscell-recycle membrane reactor with the CO2 partial pressure of 101.3 kPa gas (100% CO2), 6 h incubation 144 [2.83] 1.44 Song et al., 2007 a Abbreviations: CSL, corn steep liquor ; YE, yeast extract; NR, not reported. b Average volumetric productivity is shown in brackets [g/l-h] ben eath succinate titer. The molar yield was calculated based on the pr oduction of succinate fr om metabolized sugar during both aerobic and anaerobic conditions. Biomass was generated predominantly during aerobic growth. Succinate was produced pr imarily during anaerobi c incubation with CO2, H2, or a mixture of both. Normally under anaerobic conditions, the PE P carboxylation pathway is a major pathway to produce succinic acid. A. succiniciproducens and A. succinogenes have been demonstrated to be the most effeicient succinate producing st rains. Both strains pr oduce succinic acid through four reactions catalyzed by PEP carboxykinase, ma late dehydrogenase, fumarase, and fumarate dehydrogenase. In contrast, E. coli utilizes multiple pathways to form succinic acid (Van der

PAGE 30

30 Werf et al., 1997). Unde r anaerobic conditions, E. coli utilizes glucose to primarily produce of acetate, formate, and ethanol, as well as smaller amounts of lactate and succinate (Figure 1-2). Basis for Increased Succinate Production in Previous Developed E. coli Strains It is accep ted that the enzyme generally regarded as the dominant carboxylating activity for succinate production is PEP carboxylase duri ng growth (Gokarn et al., 2000; Karp et al., 2007; Keseler et al., 2005; Mill ard et al., 1996; Unden and Kleefeld, 2004; Vemuri et al., 2002b; Wang et al., 2006). Previous studies show ed that the overexpression of a native ppc gene in E. coli resulted in higher specific succ inate production (Milla rd et al., 1996), higher specific growth rate, and lower specific acetate pr oduction due to more carboxylation of PEP to replenish TCA cycle intermediates (Farmer and Liao, 1997). Howe ver, since PEP is required for the glucose transport system, overexpressing ppc also decreases the glucose uptake rate by 15-40% without significantly increasing succinate yi eld (per glucose) as compared to an isogenic control (Chao and Liao, 1994; Gokarn et al., 2000). It has also been report ed that overexpression of the E. coli phosphoenolpyruvate carboxylase ( ppc ) is not helpful for succinate production in the absence of a mutation in pps (Chao and Liao, 1994; Gokarn et al., 2000; Kim et al., 2004; Millard et al., 1996). This failure of the native PPC to increase succinate yields diverted most research attention to a new metabolic design, overexpression of the PYC (pyruvate carboxylase) from Lactobacillus lactis or Rhizobium etli as the carboxylating step (Vemuri et al., 2002a, b; Gokarn et al., 2000; Lin et al., 2005a, b, c) rath er than pursuing furthe r work with the native repertoire of E. coli genes. Succinate produced by E. coli using the pathway generally regarded as the native fermentation pathway (phosphoe nolpyruvate carboxylase; ppc ) waste the energy of phosphoenolpyruvate by producing inor ganic phosphate. One ATP is lost per succinate produced by this pathway (Figure 1-2). Conserving this energy as ATP by using alternative enzyme

PAGE 31

31 systems represents an opportunity to increase ce ll growth and co-select for increased succinate production. Based on known genes in E. coli, three other enzyme routes ( sfcA, maeB and pckA ) for succinate production were envisioned that would conserve ATP and could thereby increase growth. However, all carboxylation steps in these alternative routes are thought to function in the reverse direction (decar boxylation) primarily for gluconeogenes is during growth on substrates such as organic acids (Keseler et al., 2005; Oh et al., 2002; Stols a nd Donnelly, 1997; Samuelov et al., 1991; Sanwal, 1970). Rumen bacteria such as A. succinogenes produce succinate as a primary product during glucose fermentation using the energy c onserving phosphoenolpyruvate carboxykinase for carboxylation (Kim et al., 2004; McKinlay et al ., 2007). Many researchers have studied the overexpression of PCK to increase carbon flow to succinate. Previous in vestigators have noted that the kinetic parameters of phosphoenolpyr uvate carboxylase (PPC) and phosphoenolpyruvate carboxykinase (PCK) may have important eff ects on carboxylation and succinate production (Millard et al., 1996; Kim et al., 2004). The Km towards bicarbonate for E.coli phosphoenolpyruvate carboxylase (PPC) is 0.15 mM (M orikawa et al., 1980), 9-fold lower (13 mM) than E. coli phosphoenolpyruvate carboxykinase (P CK) (Krebs and Bridger, 1980). Although overexpressing PCK from E. coli in multi-copy plasmid increased PCK activity by 50fold, it was reported to have no effect on su ccinate production (Mil lard et al., 1996). In E. coli K12, activities for both phosphoe nolpyruvate carboxylase and phosphoenolpyruvate carboxykinase we re reported to be equal in vitro (Van der Werf et al., 1997) with the former serving as the primary r oute to succinate. Succi nate production was also not increased when PCK from A. succiniciproducens was overexpressed in E. coli K12 (Kim et al., 2004). This enzyme also has a high Km for bicarbonate (30 mM; La ivenieks et al., 1997).

PAGE 32

32 However, when A. succiniciproducens PCK was overexpressed in a ppc mutant of E. coli K12, succinate production was increase d 6.5-fold (Kim et al., 2004). Previously Developed Succinic Acid Producing Strains in E. coli Since E. coli has an ability to grow fast without a requirem ent of complex nutrients, and is easy to manipulate its metabolic pathways by genetic engineering, it ha s a potential to become a target microorganism for strain improvement and process design for succinate production. However, the feasibility of in creasing succinate production yield in this microorganism through metabolic engineering has not yet been fully developed. In the past decade, many research groups have been studying extensively to obtain high production yield of succinic acid by metabolic engineering of E. coli strains (Table 1-2). During glycolysis, NADH is generated and re-oxidized through the reduc tion of organic intermediates derived from glucose. Unfortuna tely, no more than 0.2 mol of su ccinate is produced per mol of glucose consumed by E. coli during fermentation (Lee et al ., 2004). Analysis of metabolism in silico has been used to design gene knockouts to create a pathway in E. coli that is analogous to the native succinate pathway in M. succiniciproducens (Lee et al., 2005, 2006). The resulting strain, however, produced low levels of succinate Andersson et al. (2007) reported the highest levels of succinate produ ction by an engineered E. coli (339 mM) containing only native genes. Pyruvate carboxylation in recombinant E. coli is the major target pathway for redirecting pyruvate to succinic acid. Strain NZN111 wa s engineered by inact ivating two genes (pflB encoding pyruvate formate-lyase and ldhA encoding lactate dehydrogena se), and over-expressing two E. coli genes, malate dehydrogenase (mdh ) and phosphoenolpyruvate carboxylase ( ppc ), from multicopy plasmids (Stols et al., 1997). Fermen tation of this strain revealed that pyruvate was accumulated in the growing medium.

PAGE 33

33 Table 1-2. Comparison of succinate production by E. coli a Organism Medium/Conditiona Succinate Titer (mM)b Succinate Yield (mol/mol) Reference E. coli AFP111 ( pflAB, ldhA, ptsG ) Rhizobium etli pyc overexpressed 40 g/l glucose (90 g total glucose) in medium supplemented with 20 g/l tryptone, 10 g/l YE and 40 g/l MgCO3 dual phase-fed batch fermentation, 76 h incubation 841 [1.31] 1.68 Vemuri et al., 2002,b E. coli HL27659k/pKK313 ( iclR sdhAB ackA-pta poxB, pstG ) Sorghum vulgare pepc overexpressed 106 g/l glucose in medium supplemented with 20 g/l tryptone, 32 g/l YE and 2 g/l NaHCO3 fed batch fermentation under complete aerobic condition, 59 h incubation 499 [1.00] 0.85 Lin et al., 2005d Bacterial Isolate 130Z ATCC 55618 50 g/l glucose supplemented with 1% CSL, 0.6% YE, and 2 g/l MgCO3 neutralized with 10 N NaOH, 0.3 atm of CO2, 29.5 h incubation 388 [1.55] 1.40 Guettler et al., 1998 E. coli SBS550MG ( ldhA adhE iclR ackA-pta ), L. lactis pyc Bacillus subtilis citZ 20 g/l glucose (100 g total glucose) LB supplemented with 1 g/l NaHCO3, 200 mg/l ampicillin, and 1mM IPTG. 100% CO2 at 1L/min STP headspace, repeated fed-batch fermentation, 95 h incubation 339 [0.42] 1.61c Sanchez et al., 2005a; Cox et al., 2006 E. coli AFP184 ( pflB ldhA pts ) 102 g/l glucose supplemented with 15 g/l CSL, dual phase aerobic growth and anaerobic production, sparging with air followed by CO2, 32 h incubation 339 [1.27] 0.72 c Andersson et al., 2007 E. coli SBS550MG ( ldhA adhE iclR ackA-pta ), Overexpression of L. lactis pyc Bacillus subtilis citZ 20 g/l glucose LB supplemented with 1 g/l NaHCO3, 200 mg/l ampicillin, and 1mM IPTG. 100% CO2 at 1L/min STP headspace, batch fermentation, 24 h. incubation 162.6 [0.80] 1.61c Sanchez et al., 2005a; Cox et al., 2006 E. coli SBS110MG ( ldhA adhE ), Lactococcus lactis pyc 20 g/l glucose LB supplemented with1.5 g/l NaHCO3 and 0.5g MgCO3, 200 mg/l ampicillin, and 1mM IPTG. Dual pahse with 100% CO2 at 1L/min STP headspace, 168 h incubation 130 [0.09] 1.24 c Sanchez et al., 2005a; Sanchez et al., 2006 E. coli NZN111 (W1485 pflB ladhA ), E. coli mdh overexpressed 20 g/l glucose LB supplemented with 0.5 g MgCO3, 1.5 g/l NaOAc, 0.1 g/l ampicillin, and 10 M IPTG, 44 h incubation, sealed serum tube. 108 [0.22] 0.98 c Stols et al., 1997 E. coli JCL1208, E. coli ppc overexpressed 11 g/l glucose LB supplemented with 0.15 g MgCO3, 0.1 g/l carbenicillin, and 0.1 mM IPTG, 44 h incubation, anoxic CO2 charging at 1 atm headspace, 18 h incubation 91 [0.60] 0.44 c Millard et al., 1996 E. coli GJT Sorghum pepC 40 g/l glucose LB supplemented with 27.78 g/l MgCO3, simple batch fermentation in sealed airtight flask 80 [no data] 0.42 c Lin et al., 2005c E. coli HL51276k ( iclR icd sdhAB ackA-pta poxB, pstG ), Sorghum sp. pepC S8D mutation 10.8 g/l glucose LB supplemented with 2g/l NaHCO3 50 mg/l kanamycin, 1 mM IPTG, aerobic batch reactor, 50 h incubation 68 [0.16] 1.09 c Lin et al., 2005b

PAGE 34

34 Table 1-2. ( Continued ) Organism Medium/Conditiona Succinate Titer (mM)b Succinate Yield (mol/mol) Reference E. coli SBS880MG ( ldhA adhE fdhF ), L. lactis pyc 20 g/l glucose LB supplemented with1.5 g/l NaHCO3 and 0.5g MgCO3, 200 mg/l ampicillin, and 1mM IPTG. Dual phase with 100% CO2 headspace, 168 h incubation 60 [0.04] 0.94 c Sanchez et al., 2005b a Abbreviations: CSL, corn steep liq uor; YE, yeast extract; NR, not reported. b Average volumetric productivity is shown in brackets [g l-h] ben eath succinate titer. c The molar yield was calculated based on the production of succinate from metabolized sugar during both aerobic and anaerobic conditions. Biomass was generated predominantly during aerobic growth. Succinate was produced pr imarily during anaerobi c incubation with CO2, H2, or a mixture of both. Malate dehydrogenase (mdh ) was expressed in this strain to dissipate accumulated pyruvate to succinic acid. This strain produced 108 mM succinate with a molar yield of 0.98 mol succinate per mol of me tabolized glucose (Donnelly et al., 19 98; Millard et al ., 1996; Stols and Donnelly, 1997; Chatterjee et al., 2001). Other researchers have pursued alternative approaches that express heterologous genes from plasmids in recombinant E. coli (Table 1-2) The pyruvate carboxylase ( pyc ) from Rhizobium etli was over-expressed from a multicopy plasmid to direct carbon flow into succinate production route and succinate was produced from the strain e xpressing heterologous pyc about 841 mM (Gokarn et al., 2000; Vemu ri et al., 2002a, b). Strain SBS550MG was constructed by inactivating the isocitrate lyase repressor ( iclR ), adhE ldhA and ackA, and over-expressing Bacillus subtilis citZ (citrate synthase) and R. etli pyc from a multi-copy plasmid (Sanchez et al., 2005a). This strain has inactivated the iclR gene, which encodes a tr anscriptional repressor protein of glyoxylate bypass, resulting in constitutive activation of glyoxylate bypass via flux through isocitrate. This strain achieved a very hi gh yield, 1.6 mol succinate per mol glucose used with an average anaerobic productivity rate of 10 mM/h (Sanchez et al., 2005a).

PAGE 35

35 Another example of carboxylation of pyruvate into oxaloacetate by pyruvate carboxylase ( pyc) was developed. AFP111, a spontaneous mutation strain in the ptsG gene encoding the glucose specific permease of phosphotransferase system, produced succinate as a major product when the R. etli PYC was overexpressed, resu lting in the yield of 0.96-mol/mol glucose used. The further development for an efficient succi nate production was achieved by employing this strain in a dual phase fermentation in which an initial aerobic gr owth phase was allowed prior to an anaerobic growth phase. The final succinic acid concentration obtained was reaching the productivity of 1.3 g/l-h (Clar k, 1989; Vemuri et al., 2002a, b; Gokarn et al., 2000). Not limited to anaerobic fermentation, production of succinic acid under aerobic conditions was also characterized. The most efficient producing strain HL27659k was able to achieve a succinate yield of 0.91 mol/mol glucos e used at a dilution rate of 0.1/h. Strain HL27659k was engineered by mutating succinate dehydrogenase (sdhAB ), phosphate acetyltransferase ( pta ), acetate kinase ( ackA ), pyruvate oxidase (poxB ) glucose transporter ( ptsG ), and the isocitrate lyase repressor ( iclR ). This strain produced less than 100 mM succinate and required oxygen-limited fermentation conditi ons (Cox et al., 2006; Lin et al., 2005a, b, c; Yun et al., 2005). IclR mutation in the strain exhibits high citrate synthase and malate dehydrogenase activities resulting in highly efficient succinic acid production as a major product under aerobic conditions without pyruvate accumulation (Lin et al., 2005d). Complex, multi-stage fermentation processes ha ve also been investigated to improve succinate production using recombinant E. coli (Table 1-2). In many of these, aerobic growth phase is followed by an anaerobic fermentation phase and includes sparging with CO2, H2, or both (Andersson et al., 2007; Nghiem et al., 1999; Sanchez et al., 2005a, b; Sanchez et al., 2006; Vemuri et al., 2002a, b).

PAGE 36

36 Objective Many microorganisms that produce succi nate naturally unde r obligate anaerobic condition such as A. succinogenes, A. succiniciproducens, and M. succiniciproducens have been studied extensively for succinate producti on under anaerobic condi tion. Even though high succinate production rate have been achieved fr om these organisms, the byproducts such as acetate, lactate, formate, and ethanol have been also in high level. Unfortunately, no genetic technique is available to engi neer these microorganisms to produce homo-succinic acid under anaerobic conditions via gene de letions or disruptions. These mi croorganisms require a complex source of nutrients such as whey based medium and yeast extract for optimal growth. Moreover, to obtain high succinate producti on rate, these microorganisms also require external supplies of carbon dioxide, hydrogen, or the mixture of gases, which raise the production cost. A bacterium that exhibits fast growth, no requirements of sp ecial and expensive sour ces of nutrients during growth, and has available techniques for ge netic manipulations, would be an ideal microorganism for succini c acid production. Since E. coli exhibits fast growth, is able to grow in the minimal medium, and many genetic techniques can be applied to it, it would be a good target microorganism to be developed and studied for pract ical succinate production in the industry. All the methods for producing succinate from E. coli published have involved rich media such as Lurie-Bertani (LB) broth, which contai n sources of amino acids, proteins, and other chemicals from yeast extract and peptone. Cont aminating proteins a nd cell byproducts would have to be removed from the final product. Thus the separation process requires removal of the impurities including cells, proteins, organic ac ids, and other impurities. Antibiotics and isopropyl-D-thiogalactoside (IPTG) used for ma intaining plasmid and inducing gene overexpression increase the cost of succinate production. Carbon dioxide and hydrogen gases

PAGE 37

37 supplied to the reactor during the fermentation pro cess also raise the produc tion cost. The cost of inefficiencies related with media compos itions, downstream processing including product recovery, concentration, and purif ication has been very high. To become more attractive, the production of succinate in E. coli could be performed in a minimal medium. However the succinate production by E. coli in a minimal medium has not yet been studied. Hence, this project will study succinate produ ction in Mineral Salt Medium. To attain efficient succinate production, the specific goals will be as described below. Genetic Manipulation of E. coli E. coli ATCC 8739 will be used as a host to alter the m etabolic pathway producing succinic acid as a major fermented product. All the possible native central metabolic genes that are responsible for producing primarily anaerobic fermentation products in E. coli will be inactivated by genetic e ngineering techniques. The native gene s of central anaerobic metabolism including adhE (alcohol dehydrogenase E), ldhA (lactate dehydrogenase A), ackA (acetate kinase A), and pflB (pyruvate formate-lyase B) can be eliminated from chromosomal DNA of the parental host strain. To obtain high succini c acid production yield, the carbon flux through the phosphoenolpyruvate carboxylation route should be active rather than that through pyruvate during anaerobic fermentation (Figure 1-2). Othe r genes involved in producing organic acids other than succinate should be also inactivated so that the mutant E. coli strain channels the phosphoenolpyruvate to succinic acid. Moreover the foreign genes using during genetic manipulations can be eliminated from the E. coli genome. Metabolic Evolution in Metabolic Engineered E. coli Genetica lly modified E. coli strains obtained from gene deletions will be subsequently selected for the best representative clone via me tabolic adaptation or evol ution. The cultures will be repeatedly transferred into fresh minimal me dium for a period of time to achieve a clone in

PAGE 38

38 which the spontaneous mutations that occurred during selection result ed in phenotypes that exhibits fast cell growth, rapi d consumption of different car bon sources, and high production yield and productivity of succinic acid, but low production of other organic acids. Metabolic Flux Analysis of Metabolic Engineered E. coli Flux distributions of metabolic intermediate s and metabolic excretes will be determined by using Flux Balance Analysis (FBA) (Jin et al., 1997; Nielsen and Villadsen, 1994; Villadsen et al., 1997; Vallino and Stephanopoulos, 1993; Stephanopoulos and Vallino, 1991). The deletions of central anaerobic metabolic gene s will affect the part itioning of carbon fluxes around the phosphoenolpyruvate and pyruvate nodes. To better unde rstand the redistribution of metabolic intermediates, the experimental data from fermentation profiles of the mutant strains constructed in this study will be examined to provide further insight into the dynamics of the succinic acid production pathway. Thus, the analyzed FBA data will be useful in comparing the production of succinic acid from the E. coli mutant strains in which we would know which combinatorial enzymes would suitably be deleted from the central anaerobic metabolic pathway to achieve the highest succinic acid production yield.

PAGE 39

39 CHAPTER 2 GENERAL PROCEDURES Medium Preparation For strain construction, E. coli wild type and mutant strain s were grown in Luria-Bertani (LB) medium containing 1%(w/v) tryptone, 0.5%(w/v) yeast extract and 0.5%(w/v) NaCl. Antibiotics, kanamycin: 25 g/ml, chloramphenicol: 40 g/ml, tetracycline: 12.5 g/ml, and ampicillin: 50 g/ml, were used for selection of the E. coli transformants ha rboring antibioticresistant genes. The resulting succinic acid-producing strains were maintained on mineral NBS or AM1 salt medium with trace metal. Anaer obic fermentation cultures were composed of minimal media containing various concentrations of glucose as carbon source depending on the experiment, and supplemented with 100 mM pota ssium bicarbonate and 2 mM betaine HCl. The base used in the anaerobic fermentation experiments is a mixture of 6N potassium hydroxide and 3M potassium carbonate. Potassium carbonate is not only used for ne utralization; it also provides carbon dioxide indirectly for the PEP carboxylation pathway. Me dia were sterilized by autoclaving at 15 p.s.i for 20-30 min. For agar plates, 15%(w/v) bacter iology agar was added before autoclaving. Growth of Bacterial Cultures E. coli wild type and m utant stra ins were grown at either 30 C or 37 C, depending on the experiment, in LB broth with shaking at 200 rpm or overnight on LB agar plates. For selection of antibiotic resistant colonies, the E. coli cells were grown on LB agar plates containing antibiotics at different concentrations depending on the e xperiment. For metabolic evolution and batch experiment, NBS and AM1 salts medium supplemen ted with glucose were used instead of LB medium for cultivating the strains.

PAGE 40

40 Plasmid Preparation by Alkaline Lysis Meth od A single colony of E. coli was inoculated in 3.0 ml of LB broth, containing antibiotics and incubated with shaking at 37 C for 16-18 hours. The E. coli culture was transferred to 1.5 ml microcentrifuge tube and centrifuged at 12,000 rpm for 1 min. The pellet was resuspended in 250 l of Alkaline lysis I solution [50 mM glucos e, 10 mM EDTA and 25 mM Tris pH 8.0 with RNaseA]. Two hundreds and fifty microliters of Alkaline lysis II solution [0.2N NaOH, 1% (w/v) SDS] were added to the cell mixture. Th e cell suspension was mixed gently to prevent shearing of chromosomal DNA. Three hundreds a nd fifty microliters of Alkaline lysis III solution [60 ml of 5M potassium acetate, 11.5 ml of acetic acid, 28.5 ml distilled water] were added to the cell mixture. The mixture was im mediately centrifuged at 14,000 rpm for 15 min at room temperature. A supernatant was removed from the white cell pellet (chromosomal DNA and cell debris) and 0.1 volume of sodium acetate, pH 5.2, was added to supernatant and mixed well by inversion. Two volumes of iso-propanol or absolute ethanol was added allowing incubation at C for 15 min. The mixture was centrif uged at 14,000 rpm for 10 min at room temperature. The DNA pellet was rinsed in 70% ethanol, air dried and th en resuspended in 20 l TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) or st erile distilled water. DNA Amplification by Polymera se Chain Rea ction (PCR) The standard PCR reaction was performed us ing 10X PCR Master Mix solution (Qiagen, Valencia, CA) in a PCR reaction of 50 l. Twenty five microliters of master mix containing 10 mM of each dNTP (dATP, dGTP, dCTP and dTTP ), PCR reaction buffer (20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 1%(v/v) Triton X-100, 1 mg/ml nucleasefree BSA, and Taq polymerase enzyme), 40 pmole of each primer (forward and reverse strand primers), and 50 ng of either plasmid or chromosomal DNA template and distilled water, were

PAGE 41

41 added to the mixture. The reaction wa s performed in automated Mastercycler gradient PCR machine (Table 2-1). After the amplification reaction was finished, an aliquot of the PCR reaction mixture was examined on 0.8% (w/v) agarose ge l electrophoresis. Table 2-1. PCR parameters for the amplificatio n of specific genes. The extension time is depending on the length of the genes (1 kb/min). PCR profile to amplify genes Step Period Temperature ( C) Time (min) Number of cycles 1 Pre-denaturing 95 5 min 1 2 Denaturing Annealing Extension 95 55 72 30 sec 30 sec Vary 30 3 Extra-extension 72 10 min 1 Agarose Gel Electrophoresis of DNA To analyze the size of DNA frag ments and restriction patterns, the PCR product and DNA fragments were subjected to agarose gel electrophoresis. The appropriate amount of agarose powder was dissolved in 1X TBE buffe r [89 mM Tris-HCl, 89 mM boric acid, 25 mM EDTA pH 8.0] or 1X TAE buffer [40 mM Tris -HCl, 40 mM acetic aci d, 25 mM EDTA pH 8.0] under boiling temperature to ensure the homogeneity of the gel solution. Five microliters of loading dye [0.1%(w/v) bromopheno l blue, 40%(w/v) Ficoll and 5 mM EDTA)] was added and mixed well to the DNA samples before loading into the wells of th e solidified gel. The electrophoresis was performed at a constant vo ltage, 80 V, for 1 hour. After completion of electrophoresis, the gel was stained with 2 g/ml ethidium bromide for 5-10 minutes and destained in distilled water for 10 min. The DNA bands were visualized under UV light and photographed by a gel documentation system. Restriction Endonuclease Digestion of DNA The 20 l reaction m ixture, 0.2-1 g of plasmid DNA was com posed, 1X restriction endonuclease buffer, restriction endonuclease enzy me, approximately 5 U, and sterile distilled

PAGE 42

42 water. The restriction endonuclease buffer, the am ount of restriction endo nuclease used and the optimum condition for digestion were selected acc ording to the manufacturers instructions. DNA Ligation DNA ligation reaction was carried out using T4 DNA ligase. The linearized vector was com bined with insert DNA at the molar ratio of 1:5. The ligation mixture contained 1X ligation buffer [50 mM Tris-HCl pH 7.6, 10 mM MgCl2, 1 mM ATP, 1 mM dithiothreitol and 5%(w/v) polyethylene glycol-8000], T4 D NA ligase and sterile distilled wa ter in a final volume of 10-20 l. The ligation mixture was incubated at 14-16 C for overnight. The amount of T4 DNA ligase (1-10 units) added to the r eaction depends on the amount of total DNA in the reaction. Preparation of E. coli Competent Cells Preparation of E. coli Competent Cells by CaCl2 Method A single colony (diameter of about 2-3 mm) of E. coli was inoculated into 3 ml of LB broth and incubated at 37 C for overnight. Cells were dilu ted to 1:100 in LB medium and incubated at 37 C with shaking until the OD600 was 0.3-0.5. The culture was centrifuged at 3,000 rpm, 4 C for 10 min. The pellet was re-suspended and washed in 5 ml of ice-cold CaCl2 for 2 times. After washing the cell, the white cell pelle t was re-suspended in 2 ml of ice-cold CaCl2 and placed on ice for 1 hour. Glycerol was a dded into the cell suspension at 15%(v/v) final concentration then 200 l aliquots were stored at C. Preparation of E. coli Competent Cells by Ele ctro-transformation Method for E. coli Carrying Temperature Sensitive Plasmid A single colony (diameter of about 2-3 mm) of E. coli was inoculated into 3 ml of LB broth and incubated at 30 C for overnight. Cells were dilute d to 1:100 in LB medium with ampicillin and L-arabinose, and incubated at 30 C with viscous shaking until the OD600 reached 0.3-0.5. The culture was centrifuged at 3,000 rpm, 4 C for 10 min. The pellet was re-suspended

PAGE 43

43 and washed in 5 ml of sterile ice-cold nano-pur e water for 4 times. After washing the cell, the white cell pellet will be re-suspended in 1 ml of sterile ice-cold nano-pure water. Eighty microliters of aliquot were dispensed into electroporation cuvette. Transformation of Competent Cells Transformation of E. c oli by Heat Shock Method Plasmid DNA, 1-3 g, was mixed gently with 200 l of E. coli competent cells and placed on ice for 30 min. The cells were heat-shocked at 42 C for 90 seconds and incubated on ice for additional 5 min. The transformed cells were mixed with 800 l of LB broth and incubated at 37 C for 1 hour. Two hundreds microliters of transformed cells were then plated on LB agar plates containing suitable antibiotics de pending on antibiotic resist ant genes harbored in the plasmid, and incubated overnight at 37 C for non-temperature sensitive plasmids or 30 C for temperature sensitive plasmids. Transformation of E. c oli by electroporation Linearized DNA, 100 ng-10 g (in 5-10 l of sterile water), was mixed with electroporated competent cells, a nd the mixture was transferred to an ice-cold 0.2 cm Gene Pulser cuvette. The cuvette was inc ubated on ice for 5 minutes. The cells were pulsed by using Bio-Rad gene pulser under the conditions used with E. coli (2,500 V, pulse length 5 ms). Then 1 ml of 1 M ice-cold LB broth was added to the cuvette immediately and the solution was transferred to a sterile 15 ml t ube. The tube was incubated at 30 C with 150 rpm shaking for 1 hour. Transformed cells, 200 l, was spread on LB agar plates containing suitable antibiotics depending on antibiotic resistant genes harbored in the DNA fragments, and incubated overnight at 37C.

PAGE 44

44 Anaerobic Fermentation Seed cultures and fermentations were grown at 37 C, 100 rpm, in mineral salts NBS (Causey et al., 2004) or AM1 me dium (4.2 g/l total salts; Ma rtinez et al., 2007) containing 10%(w/v) glucose supplemented with 100 mM pota ssium bicarbonate and 2 mM betaine HCl. Fermentations were maintained at pH 7.0 by au tomatically adding a mixture of 3M potassium carbonate and 6N potassium hydroxide. Fermentations were carried out in a container with a 350 ml working volume out of 500 ml total volume Temperature was controlled by means of submersion of containers in a thermo-regulated water bath. A magnetic s tirrer beneath the bath mixed the cultures continuously. Samples were re moved from the containers during fermentation aseptically by syringe connected to the vessels. To perform metabolic evolution in the mutant strains, seed cultures were inoculated to the vessels at the final OD550 of 0.1. Twenty-four hour cultures were daily withdrawn from the vessels, and transferred into the new fresh medium by diluting the cultures to final OD550 of 0.1. The cultures were transferred daily until the phenotypes of cultures improve in terms of growth rate, fast substrate consumption, and high succinic acid production yield. Analytical Methods Fermentation samples were removed during fermentation for the measurement of cell mass, organic acids, and sugars. Cell mass was estimated from the optical density at 550 nm (0.33 mg of cell dry wei ght/ml) with a Bausch Lomb Spectronic 70 spectrophotometer. Organic acids and sugars were determined by using high performance liquid chromatography, HPLC, (Hewlett Packard 1090 series II) equipped w ith UV and refractive index detectors with a Bio-Rad Aminex HPX-87H ion exclusion column. Th e mobile phase used in the HPLC system is 4 mM sulfuric acid. Cultures co llected from the fermentor were centrifuged to separate cells and

PAGE 45

45 supernatant. The supernatant was further filtrated passing through a 0.2 m filter prior to injecting to the HPLC. The 10 linjection volumes were automatically analyzed. Organic acids were separated in the column according to their molecular weight and structure.

PAGE 46

46 CHAPTER 3 COMBINING METABOLIC ENGINEERIN G AND MET ABOLIC EVOLUTION TO DEVELOP NONRECOMBINANT STRAINS OF Escherichia coli ATCC 8739 THAT PRODUCE SUCCINATE AND MALATE Introduction The ferm entative production of succinate fr om renewable feedstocks will become increasingly competitive as petroleum prices increase. Succinate can serve as a substrate for transformation into plastics, solv ents, and other chemicals curren tly made from petroleum (Lee et al., 2004; Lee et al., 2005; Mc Kinlay et al., 2007; Wendisch et al., 2006; Zeikus et al., 1999). A variety of genetic approaches have been used to engineer strains of E. coli for succinate production with varying degrees of success (Table 1-2). Again complex ingredients have been used in the media with thes e recombinants. Many succinate-producing strains have been developed by deleting competing pathways a nd overexpressing native genes using plasmids. In this chapter, we describe novel strains of E. coli ATCC 8739 that produce succinate at high titers and yields in mine ral salt media during simple, pH-c ontrolled, batch fermentations without the addition of heterol ogous genes or plasmids. During development, an intermediate strain was characterized that produced malate as the dominant product. Materials and Methods Strains, Media and Growth Conditions NBS m ineral salts medium (Causey et al., 2004) supplemented with 100 mM KHCO3, 1 mM betaine HCl, and sugar (2%(w/v) to 10%(w/v)) was used as a fermentation broth in most studies and for maintenance of strains (Table 3-1). A new low salt medium, AM1 (4.2 g/l total salts; Martinez et al ., 2007), was developed during the latter st ages of this investigation and used in fermentations with KJ060 and KJ073 (Table 3-1). This medium was supplemented with 100 mM KHCO3 and sugar as indicated and includes 1 mM betaine when initial sugar concentrations

PAGE 47

47 were 5%(w/v) or higher. No gene encoding antibi otic resistance, plasmid, or other foreign gene is present in strains devel oped for succinate production ex cept in intermediates during construction. Strains used in this study are summ arized in Table 3-2. Derivatives of E. coli ATCC 8739 were developed for succinate production by a unique combination of gene deletions and selections for increased producti vity. Cultures were grown at 37oC in modified LB broth (per liter: 10 g Difco tryptone, 5 g Difco yeast extr act, 5 g sodium chloride) (Miller, 1992) only during strain construction. Antibiotics were included as appropriate. Table 3-1. Composition of mineral sa lts media (excluding carbon source) Component Concentration (mmol/l) aNBS + 1 mM betaine AM1 + 1 mM betaine KH2PO4 25.72 0 K2HPO4 28.71 0 (NH4)2HPO4 26.50 19.92 NH4H2PO4 0 7.56 Total PO4 80.93 27.48 Total N 53.01 47.39 bTotal K 84.13 1.00 MgSO4 7H2O 1.00 1.50 CaCl2 2H2O 0.10 0 Thiamine HCl 0.015 0 Betaine-KCl 1.00 1.00 (mol/l) c FeCl3 6H2O 5.92 8.88 CoCl2 6H2O 0.84 1.26 CuCl2 2H2O 0.59 0.88 ZnCl2 1.47 2.20 Na2MoO4 2H2O 0.83 1.24 H3BO3 0.81 1.21 MnCl2 4H2O2 0 2.50 Total Salts 12.5 g/l 4.1 g/l a NBS + 1 mM betaine: NBS medium amended with betaine (1 mM). b Calculation includes KOH used to neutralize betaine-HCl stock. c Trace metal stock (1000X) was prepared in 120 mM HCl.

PAGE 48

48 Genetic Methods Plasm ids and primers used in this study are summarized in Table 3-2. Methods for chromosomal deletions, integration, and removal of antibiotic resistance genes have been previously described (Datsenko and Wanner, 2000; Grabar et al ., 2006; Posfai et al., 1997; Zhou et al., 2006a). Sense primers contain sequences corre sponding to the N-terminus of each targeted gene (boldface type) followed by 20 bp (underlined) corres ponding to the FRT-kanFRT cassette. Anti-sense primers contain sequences corresponding to the C-terminal region of each targeted gene (boldface type) followed by 20 bp (underlined) corresponding to the cassette. Amplified DNA fragments were electroporated into E. coli strains harboring Red recombinase (pKD46). In resulting recombinants, the FRT -kanFRT cassette replaced the deleted region of the target gene by homologous recombination ( double-crossover event). The resistance gene (FRT -kanFRT) was subsequently excised from the chromosome with FLP recombinase using plasmid pFT-A, leaving a scar region contai ning one FRT site. Chromosomal deletions and integrations were verified by testing for antibiotic markers, PCR analysis, and analysis of fermentation products. Generalized P1 phage trans duction (Miller, 1992) was us ed to transfer the ( focA-pflB ) ::FRT -kanFRT mutation from strain SZ204 into strain KJ017 to produce KJ032. Deletion of mgsA and poxB Genes A m odified method was developed to delete E. coli chromosomal genes using a two-step homologous recombination process (Thomason et al., 2005). With this method, no antibiotic resistance genes or scar sequen ces remain on the chromosome af ter gene deletion. In the first recombination, part of the target gene was replaced by a DNA cassette containing a chloramphenicol resistance gene ( cat ) and a levansucrase gene ( sacB ). In the second recombination, the cat-sacB cassette was replaced with native sequences omitting the region of

PAGE 49

49 deletion. Cells containing the sacB gene accumulate levan during incubation with sucrose and are killed. Surviving recombinants are highly enriched for loss of the cat-sacB cassette. A cassette was constructed to f acilitate gene deletions. The cat-sacB region was amplified from pEL04 (Lee et al., 2001; Thomason et al., 2005) by PCR using the JM catsacB primer set (Table 3-3), digested with Nhe I, and ligated into the corresponding site of pLOI3421 to produce pLOI4151. The cat-sacB cassette was amplified by P CR using pLOI4151 (template) and the cat -up primer set ( EcoR V site included in each primer), digested with EcoR V, and used in subsequent ligations (Jantama et al., 2008a). Table 3-2. Escherichia coli strains, plasmids, and primers used in this study Relevant Characteristics Sources E. coli Strains Wild type ATCC 8739 ATCC KJ012 E. coli ATCC 8739 Wild type, ldhA:: FRT adhE:: FRT ackA:: FRT This study KJ017 KJ012, improved strain selected from 10% glucose, NBS This study KJ032 KJ017, ldhA:: FRT adhE:: FRT ackA:: FRT ( focA pflB ) :: FRT This study KJ060 KJ032, improved strain selected from 10% glucose without initial acetate, NBS This study KJ070 KJ060, mgsA This study KJ071 KJ070, improved strain selected from 10% glucose, NBS This study KJ072 KJ071, poxB This study KJ073 KJ072, improved strain selected from 10% glucose, AM1 This study SZ204 ( focA pflB ) :: FRTkanFRT Zhou, 2003 Plasmids pKD4 bla FRTkan -FRT Datsenko, 2000 pKD46 bla exo (Red recombinase), temp erature-conditional replicon Datsenko, 2000 pFT-A bla flp temperature-conditional replicon and FLP recombinase Posfai, 1997 pEL04 cat-sacB targeting cassette Lee, 2001 Thomason, 2005 pLOI3421 1.8 kbp SmaI fragment containing aac Wood, 2005 pLOI4151 bla cat; cat-sacB cassette This study pCR2.1-TOPO bla kan; TOPO TA cloning vector Invitrogen pLOI4228 bla kan; yccT-mgsA-helD (PCR) from E.coli B cloned into pCR2.1-TOPO vector This study pLOI4229 cat-sacB cassette PCR amplified from pLOI4151 ( EcoR V digested) cloned into mgsA in pLOI4228 This study pLOI4230 PCR fragment amplified from pLOI4228 (using mgsA -1/2 primers), kinase treated, then selfligation This study pLOI4274 bla kan; poxB (PCR) from E.coli C cloned into pCR2.1-TOPO vector This study pLOI4275 cat-sacB cassette PCR amplified from pLOI4151 ( EcoR V digested) cloned into poxB of pLOI4274 This study

PAGE 50

50 Table 3-2. (Continued ) Relevant Characteristics Sources pLOI4276 PCR fragment amplified from pLOI4274 (using poxB -1/2 primers), kinase treated, then selfligation This study Primer sets ldhA 5 ATGAACTCGCCGTTTTATAGCACAAAACAGTACGACAAGAAGTAC GTGTAGGCTGGAGCTGCTTC 3 5 TTAAACCAGTTCGTTCGGGCAGGTTTCGCCTTTTTCCAGATTGCT CATATGAATATCCTCCTTAG 3 This study adhE 5 ATGGCTGTTACTAATGTCGCTGAACTTAACGCACTCGTAGAGCGT GTGTAGGCTGGAGCTGCTTC 3 5 TTAAGCGGATTTTTTCGCTTTTTTCTCAGCTTTAGCCGGAGCAGC CATATGAATATCCTCCTTAG 3 Zhou, 2003 ackA 5 ATGTCGAGTAAGTTAGTACTGGTTCTGAACTGCGGTAGTTCTTCA GTGTAGGCTGGAGCTGCTTC 3 5 TCAGGCAGTCAGGCGGCTCGCG TCTTGCGCGATAACCAGTTCTTC CATATGAATATCCTCCTTAG 3 Zhou, 2003 focA-pflB 5 TTACTCCGTATTTGCATAAAAACCATGCGAGTTACGGGCCTATAA GTGTAGGCTGGAGCTGCTTC 3 5 ATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGCTGTTCT CATATGAATATCCTCCTTAG 3 This study JMcatsacB 5 TTAGCTAGCATGTGACGGAAGATCACTTCG 3 5 CCGCTAGCATCAAAGGGAAAACTGTCCATAT 3 This study cat -up 5 AGAGAGGATATCTGTGACGGAAGATCACTTCG 3 5 AGAGAGGATATCGAATTGATCCGGTGGATGAC 3 This study mgsAup/down 5 CAGCTCATCAACCAGGTCAA 3 5 AAAAGCCGTCACGTTATTGG 3 This study mgsA 1/2 5 AGCGTTATCTCGCGGACCGT3 5 AAGTGCGAGTCGTCAGTTCC 3 This study poxBup/down 5 AAGCAATAACGTTCCGGTTG 3 5 CCACTTTATCCAGCGGTAGC 3 This study poxB1/2 5 GACGCGGTGATGAAGTGAT 3 5 TTTGGCGATATAAGCTGCAA 3 This study The mgsA gene and neighboring 500 bp regions ( yccT-mgsA-helD 1435 bp) were amplified using primer set mgsA -up/down and cloned into the p CR2.1-TOPO vector (Invitrogen) to produce plasmid pLOI4228. A 1000-fold diluted prep aration of this plasmid DNA served as a template for inside-out amplification using the mgsA -1/2 primer set (both primers within the mgsA gene and facing outward). The resulting 4958 bp fragment containing the replicon was ligated to the amplified, EcoR V-digested cat-sacB cassette from pLOI4151 to produce pLOI4229. This 4958 bp fragment was also us ed to construct a second plasmid, pLOI4230 (phosphorylation and self-ligation). In pLOI4230, the central region of mgsA is absent ( yccTmgsA-mgsAhelD ). After digestion of pLOI4229 and pLOI4230 with Xmn I (within the vector), each served as a template for amplification using the mgsA -up/down primer set to produce the linear DNA fragments for integration step I (yccT-mgsAcat-sacBmgsAhelD ) and step II ( yccT-mgsA- mgsAhelD), respectively. After electroporation of the step I fragment into KJ060 containing

PAGE 51

51 pKD46 (Red recombinase) and 2 h of incubation at 30oC to allow expression and segregation, recombinants were selected for chloramphenico l (40 mg/l) and ampicillin (20 mg/l) resistance on plates (30oC, 18 h). Three clones were chosen, grown in LB with ampicillin and 5% (w/v) arabinose, and prepared for elect roporation. After electroporation with the step II fragment, cells were incubated at 37oC for 4 h and transferred into a 250-ml flask containing 100 ml of modified LB (100 mM MOPS buffer added and NaCl omitt ed) containing 10% (w/v) sucrose. After overnight incubation (37oC), clones were selected on modified LB plates (no NaCl; 100 mM MOPS added) containing 6% (w/v) sucrose (39oC, 16 h). Resulting clones were tested for loss of ampicillin and chloramphenicol resistance. Cons truction was further confirmed by PCR analysis. A clone lacking the mgsA gene was selected and designated KJ070. The poxB gene was deleted from KJ071 in a manner analogous to that used to delete the mgsA gene. Additional primer sets ( poxB -up/down and poxB -1/2) used to construct the poxB deletion are included in Table 3-2 together with the corresponding plasmids (pLOI4274, pLOI4275, and pLOI4276). The resulti ng strain was designated KJ072. Fermentations Seed cultures and ferm entations were grown at 37 C, 100 rpm in NBS or AM1 mineral salts medium containing glucose, 100 mM KHCO3 and 1 mM betaine HCl. These were maintained at pH 7.0 by the automatic addi tion of KOH during initial experiments. Subsequently, pH was maintained by adding a 1:1 mixture of 3M K2CO3 and 6N KOH. Fermentations were carried out in small fermen tation vessels with a working volume of 350 ml. Fermentations were inoculated at either an initial OD550 of 0.01 (3.3 mg CDW/l) or 0.1 (33.3 mg CDW/l) as indicated. No antibiotic resistance gene was present in the strains that were tested. Fermentation vessels were sealed except for a 16 -gauge needle, which served as a vent for

PAGE 52

52 sample removal. Anaerobiosis was rapidly ach ieved during growth with added bicarbonate serving to ensure an atmosphere of CO2. Analyses Sa mples were removed during fermentation for the measurement of cell mass, organic acids, and sugars. Cell mass were estimated from the optical density at 550 nm (0.33 mg of cell dry weight/ml) with a Bausch Lomb Spectronic 70 spectrophotometer. Organic acids and sugars were determined by using high perf ormance liquid chromatography, HPLC, (Hewlett Packard 1090 series II) equipped with UV and refr active index detectors with a Bio-Rad Aminex HPX-87H ion exclusion column. The mobile phase used in the HPLC system is 4 mM sulfuric acid. Cultures collected from the fermentor were previously centrifuged to separate cells and supernatant. The supernatant was further filtrated passing through a 0.2 m filter prior to injecting to HPLC. Ten microliters of injection volume were automatically analyzed. Organic acids were separated in the column depending on their retention times according to their molecular weight and structure. Results and Discussion Construction of KJ012 for Succinate Production by Deletion of ldhA adhE and ackA E. coli prod uces a mixture of lactate, acetate, ethanol and succinate during glucose fermentation (Figure 3-1). Major pathways leading to lactate, acet ate and ethanol were eliminated by deleting genes encoding fermentative D-lactate dehydrogenase, acetate kinase, and alcohol dehydrogenase to construct KJ012 ( ldhA::FRT adhE::FRT ackA::FRT ). This strain retained only the succinate pa thway with malate dehydrogenase and fumarate reductase as primary routes for NADH oxidation (Figure 3-2). Although strain KJ012 grew well in complex media (not shown), poor growth was observed in mineral-based media such as NBS and acetate

PAGE 53

53 was produced as the most abundant product from sugar metabolism (Table 3-3). In this NBS mineral salts medium, succinate t iter and cell yield for KJ012 were 8-fold to 7-fold lower than the unmodified parent, E. coli ATCC 8739. Poor growth and glucose fermentation could re sult from insufficient capacity to oxidize NADH using only the succinate pathway (Figure 3-1), from a deficiency of metabolites and precursors for biosynthesis (error in metabolic part itioning) due to shifts in pool sizes resulting from gene deletions, or a combination of both. Gr owth was increased 5-fold (Table 3-3) in the same medium (plus 100 mM MOPS for pH control) by providing mild aeration (100 rpm, 100 ml NBS broth, 250-ml flask) indicating that the NADH oxidation capacity limited growth. Growth was also increased (5-fold) by replacing NBS mi neral salts medium with LB indicating a deficiency in metabolic partitioning. With the co mplex nutrients of LB, succinate titers were increased 18-fold over NBS medium indicating that the succinate pathway served as the primary route for NADH oxidation in KJ012. From these resu lts, we concluded that the poor performance of KJ012 under anaerobic conditions is a comple x problem resulting primarily from suboptimal metabolic partitioning of carbon between growth and fermentation products. It is likely that previous investigators have made similar observations with E. coli engineered for succinate producti on and that this is the basis for their reliance on complex medium and two-phase process (aerobic growth and anaerobic producti on) (Andersson et al., 2007; Millard et al., 1996; Sanchez et al., 2005a; Stols et al., 1997; Vemu ri et al., 2002a, b). Absent a clear approach to decrease the co mplexity of this problem in engineered E. coli, we elected to pursue an adaptive genetic strategy termed metabolic evolution. Rather than incremental studies to identify and solve spec ific problems in metabo lic partitioning, natural selection was used to solve the aggregate pr oblem. The production of ATP for growth by KJ012

PAGE 54

54 and all subsequent derivatives in this paper is obligately c oupled to malate and succinate production during the oxidation of NADH (Figure 32). Selection for improved growth and ATP production during serial cultivati on provides a route to co-select improved growth and improved production of these dicarboxylic acids. Analogous approaches have been used to develop E. coli strains for the production of Lalanine (Zhang et al., 2007) and l actate (Zhou et al., 2003; Zhou et al., 2006a, b). Figure 3-1. Fermentation of glucose to succinate Central metabolism indicating genes deleted in constructs engineered for succinate production. Solid arrows represent central fermentative pathways. Dashed arrow represen ts microaerophilic pathway ( poxB ). Dotted arrows show pathways that normally function during aer obic metabolism, pyruvate dehydrogenase ( pdh) and the glyoxylate bypass (aceAB). Crosses represent the gene deletions performed in this study to obtain KJ012 ( ldhA, adhE, ackA ), KJ032 ( ldhA, adhE, ackA, focA-pflB ), and KJ070 (ldhA, adhE, ackA, focA-pflB, mgsA ), and KJ072 ( ldhA, adhE, ackA, focA-pflB, mgsA, poxB ). Genes and enzymes: ldhA lactate dehydrogenase; focA formate transporter; pflB pyruvate formate-lyase; pta phosphate acetyltransferase; ackA, acetate kinase; adhE, alcohol dehydrogenase; ppc, phosphoenolpyruvate carboxylase; pdh, pyruvate dehydrogenase complex; gltA, citrate synthase; mdh, malate dehydrogenase; fumABC, fumarase isozymes; frdABCD, fumarate reductase; fdh, formate dehydrogenase; mgsA methylglyoxal synthase; gloAB glyoxylase I and II; poxB pyruvate oxidase; aceAB, isocitrate lyase; acnAB aconitase; acs, acetyl-CoA synthetase, aldA and aldB, aldehyde dehydrogenase isozymes; and icd isocitrate dehydrogenase.

PAGE 55

55 Figure 3-2. Coupling of ATP pr oduction and growth to succinate and malate production in engineered strains of E. coli. Solid arrows connect NAD H pools. Dotted arrows connect NAD+ pools. During glycolysis under an aerobic conditions, the production of ATP for cell growth is obligately coupled to the oxidation of NADH. Improvement of KJ012 by Metabolic Evolution KJ012 ( ldhA::FRT adhE::FRT ackA::FRT) grew poorly in com parison to the parent E. coli ATCC 8739, exhibited lower rates of succina te production, and provide no better molar yields (Table 3-3). Despite these re sults, serial transfer of this st rain was tried as a method to coselect improved growth and su ccinate production based on the following rationale. The primary pathway for the glucose fermentation into succinat e (Figure 3-1 and 3-2) is generally thought to use phosphoenolpyruvate carboxylase ( ppc ) for the carboxylation step (Unden and Kleefeld, 2004; Fraenkel, 1996; Keseler et al., 2005; Millard et al., 1996; Gottschalk, 1985; Karp et al., 2007). This carboxylating enzyme does not conserve the high-energy phosphate in phosphoenolpyruvate and reduces the net ATP available for growth. Serial transfers of KJ012 with selection for improved growth offered an opp ortunity to select for mutational activation of

PAGE 56

56 alternative routes for succinat e production (Figure 3-2) that maintained redox balance and increased ATP yields. Metabolic evolution was carried out by seque ntially subculturing under various regimens using small, pH-controlled fermentors (Figure 3-3). Selection was begun using 5%(w/v) glucose with serial transfers at 120-h in tervals (Figure 3-4A and 3-5A). Addition of betaine, a protective osmolyte (Purvis et al., 2005; Underwood et al., 2004; Zhou et al., 2006b), increased cell growth and cell yield and allowed more frequent transf ers. Beginning at transfer 27, a bicarbonate solution was used to maintain pH and provide additional CO2 for succinate production. The rapid subsequent improvement confirmed that CO2 had become limiting (Figure 3-5A). With further selection in 5%(w/v) glucose, molar yields of succinate improved to 0.73 per mole of glucose metabolized (Table 3-3). The glucose concentration was doubled and transfers continued (Figure 3-4B and 3-5B) with modest improvement in growth (initial 24 h) and a small decline in succinate yield. With 10%(w/v) glucose, unwanted co-products (acetate, formate, and lactate) were abundant despite the absence of the primary lactate dehydrogenase ( ldhA ) and acetate kinase ( ackA ) (Table 3-3). A clone was isolated from the last transfer and designated KJ017 ( ldhA::FRT adhE::FRT ackA::FRT). Construction of KJ032 and KJ060 The gene en coding pyruvate formate-lyase ( pflB ) was deleted from KJ017 to eliminate the loss of reductant as formate and excessive pr oduction of acetyl~CoA, a potential source of acetate. The upstream formate transporter ( focA ) in this operon was also deleted. As expected, this deleted strain (KJ032) did not grow without acetate (Figure 3-4C). Deletion of pflB is well known to cause acetate auxot rophy under anaerobic conditio ns (Sawers & Bock, 1988).

PAGE 57

57 Table 3-3. Fermentation of glucose in mineral salts medium by mutant strains of E. coli Succinate Yieldc Fermentation Products (mM) e Straina Culture Conditions Media, Gluc (w/v) Cell Yieldb (g/L) mol/mol g/g Av. Vol. Prod d (g/L-h) Suc Mal Pyr Ace Lac For E. coli wild type f 0.1 OD550, 0.1 mM betaine 5%, NBS 2.00.2 0.190.02 0.12 0.120.01 493 33 0 152 0 98 4 262 9 KJ012 f 0.1 OD550, 0.1 mM betaine 5% NBS 0.30.1 0.200.01 0.13 0.040.01 60.4 26 1 KJ012 0.1 OD550, 0.1 mM betaine Shaken flask f 5% NBS + MOPS 1.5 0.10 0.06 0.02 10 226 16 KJ012 0.1 OD550 Luria Broth 5% LB 1.5 0.70 0.50 0.09 108 61 <2 14 1st TF: No betaine, 0.1 OD550, 120 h transfers 5%, NBS 0.3 0.13 0.09 0.072 6 26 <2 3rd TF: 2 mM betaine, 0.1 OD550, 96 h transfers 5%, NBS 0.7 0.28 0.18 0.128 26 71 <2 40th TF: 1 mM betaine, 0.1 OD550, 24 h transfers, 3M K2CO3+6N KOH 5%, NBS 2.3 0.73 0.48 0.251 204 179 <2 151 KJ012 ( ldhA, ackA, adhE ) (KJ017) 40th TF: 1 mM betaine, 0.1 OD550, 24 h transfers, 3M K2CO3+6N KOH 10%, NBS 1.7 0.74 0.49 0.354 288 181 38 199 2nd TF: 1 mM betaine, 0.1 OD550, 48 h transfers, 20 mM NaOAc, 3M K2CO3+6N KOH 5%, NBS 1.0 1.47 0.97 0.260 212 44 15th TF: 1 mM betaine, 0.01 OD550, 24h transfers, 5 mM NaOAc, 3M K2CO3+6N KOH 10%, NBS 1.4 1.07 0.71 0.736 596 331 9 170 <2 KJ032 ( ldhA, ackA, adhE, focA, pflB ) (KJ060) 5th TF: 1 mM betaine, 0.01 OD550, 24 h transfers, No NaOAc, 3M K2CO3+6N KOH 10%, NBS 1.4 1.04 0.69 0.711 579 318 9 161 <2

PAGE 58

58 Table 3-3. ( Continued ) a Clones were isolated from the fermentation broth at various point s and assigned strain numbers, indicated by numbers in parenth esis b Cell yield estimated from optical density (3 OD550nm = 1 g l-1 CDW). c Succinate yields were calculate d based on glucose metabolized. d Average volumetric productivity was calculated for tota l incubation time. e Abbreviations: suc, succinate; mal, malate; pyr, pyruvate; ace, acetate; lac, lacate; for, formate. f Average of 3 or more fermentations with standard devia tions. Aerobic shaken flask (100 rpm; 100 ml NBS, 250-ml flask). Succinate Yieldc Fermentation Products (mM) e Straina Culture Conditions Media, Gluc (w/v) Cell Yieldb (g/L) mol/mol g/g Av. Vol. Prod d (g/L/h) Suc Mal Pyr Ace Lac For 1st TF: 1 mM betaine, 0.01 OD550, 24 h TF, 3M K2CO3+6N KOH, 5%, NBS 1.0 1.06 0.70 0.361 294 219 25 102 KJ070 ( ldhA, ackA, adhE, focA, pflB, mgsA) (KJ071) 50th TF: 1 mM betaine, 0.01 OD550, 24 h transfers, 3M K2CO3+6N KOH 10%, NBS 1.1 0.71 0.47 0.419 341 626 <2 76 2nd TF: 1 mM betaine, 0.01 OD550, 24 h transfers, 3M K2CO3+6N KOH 10%, NBS 1.3 0.97 0.64 0.663 539 186 <2 95 6th TF: 1 mM betaine, 0.01 OD550, 24 h transfers, 3M K2CO3+6N KOH 10%, AM1 1.2 1.34 0.88 0.733 596 38 4 112 KJ072 ( ldhA, ackA, adhE, focA pflB, mgsA, poxB ) (KJ073) 45th TF: 1mM betaine, 0.01 OD550, 24 h transfers, 3M K2CO3+6N KOH 10%, AM1 1.5 1.26 0.83 0.858 699 313 103 172 KJ073 f 1mM betaine, 3M K2CO3+6N KOH 0.01 OD550 inoculum 10%, AM1 2.3 .1 1.20 .09 0.77 .03 0.82 .01 668 118 3 55 2 183 7 KJ060 f 1mM betaine, 3M K2CO3+6N KOH 0.01 OD550 inoculum 10%, AM1 2.2 .1 1.41 .07 0.92 .05 0.90 .04 733 9 39 7 250 6 21 KJ060 f 1mM betaine, 3M K2CO3+6N KOH 0.60 OD550 inoculum 10%, AM1 2.2 .1 1.61 .12 1.05 .09 0.77 .04 622 17 1.5 180 3 21 KJ071 f 1mM betaine, 3M K2CO3+6N KOH 0.01 OD550 inoculum 10%, NBS 1.5 .0 0.78 .02 0.53 .01 0.33 .04 280 516 4 58 5 64

PAGE 59

59 Figure 3-3 Steps in the genetic engineer ing and metabolic evolution of E. coli ATCC 8739 as a biocatalyst for succinate and malate producti on. This process represents 261 serial transfers providing over 2000 generations of growth-based selection. Clones were isolated from the final culture of each regimen and assigned strain designations, shown in parenthesis in Table 3-3. Figure 3-4 Growth during metabolic evolution of KJ012 to produce KJ017, KJ032, and KJ060. Strain KJ012 was sequentially transferre d in NBS medium c ontaining 5%(w/v) (A) and 10%(w/v) (B) glucose, respectively to produce KJ017. After deletion of focA and pflB the resulting strain (KJ032) was initiall y subcultured in medium supplemented with acetate (C). Acetate levels were d ecreased and subsequen tly eliminated during further transfers to produce KJ060. Broken line represents fermentation by KJ017 without acetate, added for comparis on. Symbols: optical density at OD550nm,

PAGE 60

60 Figure 3-5. Fermentation products during the metabolic evolution of strains for succinate and malate production. Cultures were supplemen ted with sodium acetate as indicated. Black arrows represent the transition betw een fermentation conditi ons as indicated by text. No formate and only small amounts of lactate were detected during metabolic evolution of KJ032. No formate and lactate were detected during metabolic evolution of KJ070 and KJ072. A (5% w/v glucose) and B (10% w/v glucose), KJ012 to KJ017; C (5% w/v glucose) and D (10% w/v glucose), KJ032 to KJ060; E. 10% glucose, KJ070 to KJ071; F. 10% glucose, KJ072 to KJ073. Symbols for all: succinate; formate; acetate; malate; ,lactate; and pyruvate. Growth and succinate production by KJ032 were restored by the addition of 20 mM acetate (Figure 3-4C and 3-5C). Production of formate a nd acetate were substantially reduced as a result of pflB (and focA ) deletion. Although this strain required ace tate for growth, additional acetate was also produced during fermentation. The same phenomenon was previously reported for pflB deleted strains during the construction of E. coli K-12 biocatalysts for pyruvate production (Causey et al., 2004). Lactate leve ls were also reduced in KJ 032 (Table 3-3; Figure 3-5C). Subsequent transfers were accompanied by improvements in growth and succinate production. Added acetate was reduced, inocula size was re duced, and glucose concentration was doubled (10%(w/v)) during subsequent tran sfers (Figure 3-5D). After reduc ing added acetate to 5 mM, an unstable population emerged that produced elevated levels of malate at the expense of succinate.

PAGE 61

61 After further transfers, acetate was omitted and a strain was developed that was no longer auxotrophic. However, succinate yields declined upon elimination of added acetate while malate and acetate levels increased. A small amount of pyruvate was also produced. A clone was isolated from the last tr ansfer and designated, KJ060 ( ldhA:: FRT adhE::FRT ackA::FRT ( focB-pflB ) ::FRT). Construction of KJ070 and KJ071 by De letion of Methylglyoxal Synthase ( mgsA ) The sm all amount of lactate present in the fermentation broths of various strains is presumed to originate from the methylglyoxal pathway (Figure 3-1; Grabar et al., 2006). Although this represents a small loss of yield, lact ate production by this pa thway is indicative of methylglyoxal accumulation, an inhibitor of bot h growth and glycolysis (Egyud and SzentGyorgyi, 1966; Grabar et al., 2006; Hopper and Cooper, 1971). Production of methylglyoxal and lactate were eliminated by deleting the mgsA gene (methylglyoxal synthase) in KJ060 to produce KJ070 ( ldhA::FRT adhE::FRT ackA::FRT ( focA-pflB ) :: FRT mgsA). Strain KJ070 was initially subcultured in 5%(w/v) glucose (Figure 3-5E). Deletion of mgsA is presumed to have increased glycolytic flux as ev idenced by the accumulation of pyr uvate in the medium (Table 33). This increase in glycolytic flux may also be responsible for the further decline in the succinate/malate ratio due to increased production of oxaloacetate, an al losteric inhibitor of fumarate reductase (Iverson et al., 2002; Sanwal, 1970). At transfer 21, glucose was doubled to 10 %(w/v) and transfers c ontinued. This higher level of glucose and subsequent transfers resu lted in further increas es in malate production, exceeding succinate in latter tran sfers (Figure 3-5E). Increased production of malate versus succinate in 10%(w/v) glucose is also consistent with increased glycolytic flux and inhibition of furmarate reductase by oxaloacetate. At transf er 50, 1.3 moles of ma late and 0.71 moles of

PAGE 62

62 succinate were produced per mole of glucose metabolized (Table 3-3). Significant amounts of acetate were also produced. A new strain was isolated from the final subculture and designated KJ071 ( ldhA::FRT adhE::FRT ackA::FRT ( focA-pflB ) :: FRT mgsA). This strain may be useful for malate production. Construction of KJ072 and KJ073 by Deletion of Pyruvate oxidase ( poxB ) Although conversion of glucose to acetate is redox neutral, partitioning of carbon to acetate decreases the yield of succinate and mala te. Pyruvate oxidase represents a potential source of acetate and CO2 during incubation under microaer ophilic conditions (Causey et al., 2004) and was targeted for gene deletion. However, deletion of poxB to produce KJ072 ( ldhA::FRT adhE::FRT ackA::FRT ( focA-pflB ) ::FRT mgsA poxB ) did not reduce acetate production indicating that alternative pathways are involved. Eliminating poxB resulted in unexpected changes in fermentation products, an increase in succinate and decrease in malate (Table 3-3; Figure 3-5F). The mechanism for this improvement in succinate production is unknown but may be related to other activities of pyruvate oxidase such as acetoin production, decarboxylation, and carboligation (Ajl and Werkman, 1948; Chang and Cronan, 2000). Strain KJ072 was subjected to 40 further r ounds of metabolic evol ution in AM1 medium, a lower salts medium, with 10 %(w/v) glucose (Table 3-3; Fi gure 3-5F). Improvements in growth, cell yield and succinate production were observed during these transfers. Malate, pyruvate and acetate levels also increased. A clon e was isolated from the final transfer and designated KJ073 ( ldhA ::FRT adhE ::FRT ackA ::FRT ( focA pflB )::FRT mgsA poxB ). Fermentation of KJ060 and KJ073 in AM 1 Medium Containing 10%( w/v) Glucose Figure 3-6 shows batch fermentations with KJ060 and KJ073, the two best biocatalysts for succinate production. Although growth was co mpleted within the initi al 48 h of incubation,

PAGE 63

63 succinate production continued fo r 96 h. One-third of succinate production occurred in the absence of cell growth. These strains produced succinate titers of 668-733 mM, with a molar yield of 1.2-1.6 based on glucose metabolized. Acetate, malate, and pyruvate accumulated as undesirable co-products and detracted from the pot ential yield of succinate (Table 3-3). The maximum theoretical yield of succinate from glucose and CO2 (excess) is 1.71 mol per mole glucose based on the following Equation 3-1: 7 C 6 H 12 O 6 + 6 CO 2 12 C 4 H 6 O 4 + 6 H 2 O (3-1) Figure 3-6. Production of succina te and malate in mineral salts media (10% glucose) by derivatives of E. coli ATCC 8739. A. Succinate production by KJ060 in AM1 medium. B. Succinate production by KJ 073 in AM1 medium. C. Production of malate by KJ071 in NBS medium. Fermentations were inoculated at a level of 33 mg DCW/l. Symbols for all: glucose; succinate; malate; cell mass. Conversion of Other Substrates to Succinate Although this study primarily focused on the conv ersion of glucose to succinate is well known that E. coli has the nativ e ability to metabolize a ll hexose and pentose sugars that are constituents of plant cell walls (Asghari et al., 1996; Underwood et al., 2004). Some strains of E. coli can also metabolize sucrose (Moniruzzaman et al., 1997). Strain KJ073 was tested for utilization of hexoses, pentoses, and using tube cultures containing 2% sugar. In all cases, these sugars were converted primarily to succinate. Strain KJ073 al so metabolized glycerol to

PAGE 64

64 succinate. During incubation with 2% glycerol 143 mM glycerol was metabolized to produce 127 mM succinate with a molar yield of 0.89, 89% of the theoretical maximum. Production of Malate in NBS Medium Contai ning 1 mM Betaine and 10% (w/v) Glucose During growth-based selections, cultures were observed to vary in their production of malate (Table 3-3), a potentia lly useful alternative product. Malate was the most abundant product from KJ071 with 10%(w/v) glucose, almost double that of succinate (Table 3-3; Figure 3-5E). This strain produced 516 mM malate with a molar yield of 1.44 based on metabolized glucose. Conclusions The f ermentative metabolism of E. coli is remarkably adaptable. Derivatives can be readily engineered and evolved to circumvent numerous deletions of genes concerned with native fementation pathways and increase fluxe s through remaining enzymes to maintain redox balance, ATP production, and growth. Though arguabl y more challenging, cells can make such adaptive changes in mineral salts media while balancing carbon partitioning for biosynthetic needs. After eliminating the primary routes for NADH oxidation (lactat e dehydrogenase, alcohol dehydrogenase) and acetate production (acetate kinase), growth and ATP production remain linked to NADH oxidation and the pr oduction of malate or succinate (Figure 3-2). Growth-based selections for NADH oxidation and ATP production cannot readily distinguish between malate and succinate as end products, since the precursors of both serve as electron acceptors. During these investigations, KJ071 was de veloped that produces more malate than succinate. This strain and further derivatives may be useful for malate production. Other strains such as KJ073 and KJ060 may be useful for succinate production. Deletion of pflB the primary source of acetyl~CoA during anaeerobic growth, resulted in an auxotrophic requirement for acetate (S awers and Bock, 1988). This requirement was

PAGE 65

65 eliminated through metabolic evolution, presumably due to increased prod uction of acetyl~CoA by other routes such as pyruvate dehydrogenase (de Graef et al., 1999). Ma ny shifts in metabolic products were unanticipated. Th e increase in malate during selections after deletion of mgsA is unexplained. Methylglyoxal is a me tabolic inhibitor that is produced in response to an imbalance in metabolism (Grabar et al., 2006). Elimination of methylglyoxal produc tion may have provided a growth-related advantage such as increased grow th rate, a shorter lag af ter inoculation, etc. The reduction in malate and shift to higher succinate production after a poxB deletion was also surprising. Little change in the acetate level was observe d indicating that eith er this enzyme was a minor source of acetate or that other route for acetate production functionally replaced it. After deletion of poxB succinate was again produced as the dominant dicarboxylic acid. With the best strains for succinate production, KJ060 and KJ073, malate and acetate remained as abundant coproducts (Table 3-3; Figure 3-5D and 3-5F). Elimination of thes e represents a further opportunity to increase yields. All previously engineered E. coli developed for succinate production have used complex media and plasmids with antibiotics for mainte nance. Most have achieved only low titers of succinate in simple batch fermentations, requiri ng more complex processes to achieve higher titers (Table 1-1 and Table 1-2). A variety of genetic approaches ha ve been reported that increase succinate production from glucose by recombinant E. coli in complex medium. In our initial construct, growth and sugar metabolism were very poor in mineral salts medium but very robust in complex, LB medium. It is likely that similar observations led previous investigators to their reliance on complex nutrients (T able 1-1 and Table 1-2). Comp lex media containing vitamins, amino acids, and other macromolecular precursors may mask potential regulatory problems in metabolism and biosynthesis that were created by metabolic engineering.

PAGE 66

66 Many investigators have also used heterol ogous genes and complicated processes that include sparging with gas (CO2, H2, O2 or air) and dual aerobic and anaerobic process steps. This complexity of process and nutrients would be expected to increase the cost of construction, materials, purification, and waste disposal. In contrast, strains KJ060 and KJ073 produced high titers of succinate (600700 mM) in simple batch fermentatio ns (10%(w/v) sugar) using mineral salts medium without any comple x nutrients or foreign genes.

PAGE 67

67 CHAPTER 4 BATCH CHARACTERIZATION AND METABO LIC DIS TRIBUTION OF EVOLVED STRAINS OF Escherichia coli ATCC 8739 TO PRODUCE SUCCINATE Introduction In chapter 3, I described the developm ent of E. coli strains that produc e succinate under anaerobic conditions in mineral salts medium (NBS or AM1) without the requirement for heterologous gene expression, rich nutrients, or antibiotics by combining metabolic engineering and metabolic evolution methods. In this chapter, I describe the effect of glucose concentration, inoculum size, growth supplements, and types of media on succinate produc tion. In this chapter, metabolic flux analysis (MFA) was performed to assess the distribution of intracellular metabolites when glucose concentration was varied. Materials and Methods Strains, Media and Growth Conditions Strains u sed in this study are summarized in Table 1 and indicated by an asterisk. No gene encoding antibiotic resistance (or other fore ign genes) is present in these strains. The precursors of the mutants used are also listed. NBS (Causey et al., 2004) mineral salts medium supplemented with 100 mM KHCO3, 1 mM betaine HCl, and glucose (5%(w/v) or 10%(w/v)) was used as a fermentation medium in most studies and for maintenance of strains. Fermentations Seed cultures and ferm entations were grown at 37 C, in a rotary shaker at 100 rpm in NBS or AM1 mineral salts media containing glucose, 100 mM KHCO3 and 1 mM betaine HCl. These were maintained at pH 7.0 by the automatic addition of KOH during initial experiments. Subsequently, pH was maintained by adding 1:1 mixtures of 3M K2CO3 and 6N KOH. Fermentations were carried out in small fermen tation vessels with a working volume of 350 ml.

PAGE 68

68 Seed cultures were inoculated at an initial OD550 of 0.1 (33.3 mg CDW/l). Each experiment was carried out in triplicate. Analyses Cell m ass was estimated from the optical dens ity at 550 nm (OD 1.0 = 333 mg of cell dry weight/l) by using a Bausch Lomb Spectronic 70 spectrophotom eter. Organic acids and sugars were determined by using high performance li quid chromatography (Grabar et al., 2006). Ethanol was analyzed using gas chromatography (Ohta et al., 2001) Table 4-1 Escherichia coli strains used in this study Strain Relevant Characteristics Source ATCC 8739* Wild type ATCC KJ012 strain C, ldhA:: FRT adhE:: FRT ackA:: FRT Jantama et al., 2008a KJ017* improved strain obtained from metabolic evolution of KJ012 with 10% glucose, NBS Jantama et al., 2008a KJ032 KJ017, ( focA pflB ) :: FRT Jantama et al., 2008a KJ060* improved strain obtained from metabolic evolution of KJ032 with 10% glucose, NBS Jantama et al., 2008a KJ070 KJ060, mgsA Jantama et al., 2008a KJ071* improved strain obtained from metabolic evolution of KJ070 with 10% glucose, NBS Jantama et al., 2008a KJ072 KJ071, poxB Jantama et al., 2008a KJ073* improved strain obtained from metabolic evolution of KJ072 with 10% glucose, NBS Jantama et al., 2008a Indicates st rain used in this study. Calculation Specific Production Rates for Excreted Meta bolites The specific production rates of several excr eted metabolites during exponential growth were calculated using two measurements 24 or 48 hours apart and based on the log mean average cell concentration during that time interval (Aristidou, 1995): tX )t(c)tt(c ri i i (4-1)

PAGE 69

69 where ci is the concentration of metabo lite i in the reactor (mmol/L) and X the log mean concentration of biomass (gCDW/L) )t(X )tt(X ln )t(X)tt(X X (4-2) Metabolic Flux Analysis Flux distributions of metabolic intermediate s and fermentation products were determined by standard methods (Jin et al., 1997; Nielse n and Villadsen, 1994; Vallino and Stephanopoulos, 1993; Stephanopoulos and Vallino, 1991). The intracellular fluxes were calculated using a stoichiometric model and applying mass balan ces around intracellular metabolites (Aristidou, 1994; Aristidou et al., 1999; Stephanopoulos et al., 1998). Figure 1 shows the fermentation pathways of E. coli. The reactions involved in the fermentation network are presented in Table 4-2. The material balances result in a set of linear algebraic equations that can be expressed in matrix notation as: r = K (4-3) where r is the vector for the net specific formation rates of 16 metabolites, v is the vector of up to 15 metabolic fluxes (mmol/g CDW-h) shown in Figure 1 (T = [1, 2, ,13, EM, EP]), and K is the matrix of stoichiometric coefficients presen ted in Table 4-3. The concentrations of eight extracellular products (glucose, succ inate, acetate, formate, lactate, ethanol, excreted malate, and excreted pyruvate) represented in the boxes of Figure 4-1 were measured, and their specific production rates were calculated using Equation 4-1. The net accumulation rates of intracellular metabolites were assumed to be zero. This is justified because pseudo-steady state can be assumed due to the high turnover of the metabolit e pool or, alternatively, balanced growth, and because the dilution term due to growth can be neglected due to low intracellular levels

PAGE 70

70 (Stephanopoulos et al., 1998). For the NADH balance, it is assumed that the NADH production and consumption must be equal and this is also included as a constraint for the calculations. The solution of Equation 4-3 is obtained using the pseudo-invers e matrix since the system is overdetermined. This corr esponds to the least squares estimate. = (KT K) KT r (4-4) However, the least squares solution gave in some cases a small negative number for fluxes of two extracellular products, the formate flux, v7, and the excreted pyruvate flux, vEP. As these metabolites are not supplied in the medium, a negative flux is not possible. In such cases, the calculated negative flux was set to 0 and the calculation of v was repeated after removing from K the column for that flux. The net NADH specific production and utiliz ation rates per mole of glucose are NADHP/G = 1 134)( v vv (4-5) NADHU/G = 1 121196) 2( v vvvv (4-6) ATP and Cell Yield Analysis Reaction 5 is reversible, and the direction a ffects ATP production or consumption. If the reaction is forward (v5 > 0) it is catalyzed with PYK produc ing one mole of ATP per mole of PEP consumed, yielding the following net ATP s ynthesis rate per mole of glucose used ATP/G = 1 3854) ( v vvvv (provided v5 > 0) (4-7) If reaction 5 is reverse, one mole of ATP is consumed but this is converted to AMP (Table 2), which is equivalent to the loss of two moles of ATP to ADP. ATP/G = 1 3854) 2( v vvvv (provided v5 < 0) (4-8)

PAGE 71

71 The cell yield (YATP) defines the amount of energy (A TP) required for the formation of microbial cells (g CDW/mole ATP). Th is can be calculated from the fluxes by YATP = ATP/G)(consumed) glucose of (moles produced biomass ofgCDW (4-9) Fermentation Pathways In this study we assume that succinate production occurs via the fermentative TCA route (Figure 1). In addition, E. coli can perform the glyoxylate bypa ss, which is an alternative pathway producing succinate. The glyoxylate bypass is normally active u nder aerobic conditions when it grows on acetate or fatty acids as carbon s ources (Cortay et al., 1989) but it is repressed by glucose (Nimmo and Nimmo, 1984). Under anaerobic conditions, IclR (isocitrate lyase transcriptional repressor) represses the transcription of the aceBAK operon that encodes isocitrate lyase, malate synthase, and isocitrate dehydr ogenase/kinase/phosphoprylase by binding to its promoter proximal site. Some E. coli strains, e.g. BL21, operate the glyoxylat e bypass during anaerobic growth due to cons titutive transcription of aceA and aceB and no transcription of iclR (Phue and Shiloach, 2004) We have confirmed that the succinate-producing st rains constructed in this study did not produce de tectable enzymatic activity of is ocitrate lyase (unpublished data). Therefore, the glyoxylate bypass was not cons idered in this flux analysis study. For many years, the PDH complex for pyr uvate conversion was considered inactive under anaerobic conditions (Guest et al., 1989; Unden et al., 2002). However, de Graef et al. (1999) showed low but signi ficant PDH activity when E. coli grows under anaerobic conditions. Kim et al. (2007) further showed that the PDH activity in the anaerobic cell could be significantly elevated by a single mutation in lpdA gene. The PDH complex provides an alternative route to acetyl~CoA, NADH, and CO2 from pyruvate. An extra NADH gained from the PDH activity can supply the additional requi rement of reducing power to produce succinate.

PAGE 72

72 The enzymatic activity of this complex was very high in the succinate-p roducing strains even when they grew under anaerobic conditions (un published data). Thus the PDH pathway was included in Figure 1 and th e metabolic flux analysis. Figure 4-1. Fermentation Pathway of E. coli under anaerobic condition. vi, represents the fluxes used in the calculation for metabolic flux analysis. The carbon flow through citrate, isocitrate, and biosynthesis is assumed to be negligible to simplify the metabolic flux calculation. The boxes represent the measured metabolites. Solid arrows represent central fermentative pathways. Enzymes listed are pdh, pyruvate dehydrogenase; mdh, malate dehydrogenase; fumA and fumB, fumarase isozymes; frd, fumarate reductase; mgsA methylglyoxal synthase; poxB pyruvate oxidase; ppc phosphoenol pyruvate carboxylase; pdh, pyruvate dehydrogenase complex; ldhA, lactate dehydrogenase; pflB, pyruvate-formate lyase; adhE, alcohol dehydrogenase, ackA; acetate kinase; tdcD, propionate kinase with acetate kinase activity; tdcE, ketobutyrate formate-lyase ; acnAB aconitase; gltA, citrate synthase; gloAB glyoxalase.

PAGE 73

73 Table 4-2. Reactions used in Metabolic Flux Analysis (MFA) for succi nate production under an aerobic condition Reaction Enzyme (s) EC number 1 Glucose + PEP Glucose-6P + pyruvate Glucose: PTS enzyme system; I, HPr, IIGlc, IIIGlc 2 Glucose-6P Biomass 3 Glucose-6P + ATP 2Glyceraldehyde 3-P + ADP a. Glucose-6P Fructose 6-P b. Fructose-6P+ATP Fructose 1,6-diP+ADP c. Fructose 1,6-diP 2Glyceraldehyde 3-P Glucose-6P isomerase Phosphofructokinase Fructose-diP aldolase 5.3.1.9 2.7.1.11 4.1.2.13 4 Glyceraldehyde-3P + NAD+ + Pi + ADP PEP + ATP + NADH + H++ H2O a. Glyceraldehyde-3P + NAD+ + Pi Glycerate-1,3-diP +NADH+H+ b. Glycerate-1,3-diP + ADP 3-Phosphoglycerate + ATP c. 3-Phosphoglycerate 2-Phosphoglycerate d. 2-Phosphoglycerate PEP + H2O 3P-Glyceraldehyde dehydrogenase 3PGlycerate kinase Phosphoglycerate mutase Enolase 1.2.1.12 3.6.1.7 5.4.2.1 4.2.1.11 5 PEP + ADP Pyruvate + ATP Pyruvate + ATP + H2O PEP + AMP + Pi Pyruvate kinase (PYK) Phosphoenolpyruvate synthase (PPS) 2.7.1.40 2.7.9.2 6 Pyruvate + NADH Lactate + NAD+ Lactate dehydrogenase 1.1.1.28 7 Pyruvate + HSCoA Formate + Acetyl~CoA Pyruvate formate-lyase 2.3.1.54 8 Acetyl~CoA +Pi + ADP Acetate + HSCoA + ATP a. Acetyl~CoA+Pi Acetyl~P + HSCoA b. Acetyl~P + ADP Acetate + ATP Acetate phosphotransferase Acetate kinase 2.3.1.8 2.7.2.1 9 Acetyl~CoA + 2NADH + 2H+ Ethanol + HSCoA + 2NAD+ a. Acetyl~CoA + NADH + H+ Acetaldehyde + HSCoA + NAD+ b. Acetaldehyde + NADH + H+ Ethanol + NAD+ Aldehyde dehydrogenase Alcohol dehydrogenase 1.2.1.10 1.1.1.1 10 PEP + CO2 OAA + Pi PEP carboxylase 4.1.1.31 11 OAA + NADH Malate + NAD+ Malate dehydrogenase 1.1.1.37 12 Malate + NADH + H+ Succinate + H2O + NAD+ Malate Fumarate + H2O Fumarate + NADH + H+ Succinate + NAD+ Fumarase ABC Fumarate reductase 4.2.1.2 1.3.5.

PAGE 74

74 Table 4-2. (Continued ) Reaction Enzyme (s) EC number 13 Pyruvate + HSCoA + NAD+ Acetyl~CoA + CO2 + NADH + H+ Pyruvate Dehydrogenase (PDH) Complex: AceF: lipoate acetyltransferase AceE: E1p subunit of PDH LpdA: lipoamide dehydrogenase 2.3.1.12 1.2.4.1 1.8.1.4 EM Malate transport Dicarboxylate DAAC S transporter, DctA No EC # EP Pyruvate transport No EC #

PAGE 75

75 Table 4-3. Stochiometric relationship between th e metabolic intermediates and metabolites and the network reactions (matrix K represented) for an anaer obic succinate production in glucose minimal medium in E. coli Flux To 1 2 3 4 5 6 7 8 9 10 11 12 13 EMEP Glucose used 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 succinate 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 Acetate 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 Formate 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 Lactate 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 Ethanol 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 Excreted Malate 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 Excreted Pyruvate 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 Pyruvate 1 0 0 0 1 -1 -1 0 0 0 0 0 -1 0 -1 Glucose-6P 1 -1 -1 0 0 0 0 0 0 0 0 0 0 0 0 Glyceraldehyde-3P 0 0 2 -1 0 0 0 0 0 0 0 0 0 0 0 Acetyl-CoA 0 0 0 0 0 0 1 -1 -1 0 0 0 1 0 0 PEP -1 0 0 1 -1 0 0 0 0 -1 0 0 0 0 0 OAA 0 0 0 0 0 0 0 0 0 1 -1 0 0 0 0 Malate 0 0 0 0 0 0 0 0 0 0 1 -1 0 -1 0 NADH 0 0 0 1 0 -1 0 0 -2 0 -1 -1 1 0 0 Results and Discussion Batch Characterization of Evolved E. coli Stra ins that Produce Succinate Effect of Glucose Concentratio ns to Succinate Production KJ012 ( ldhA, adhE, ackA ) was constructed to direct carbon flow to oxaloacetate (OAA) synthesis and to prev ent NADH oxidation from lactate and alcohol production. KJ012 strain growth and succinate production were im proved by sequentially sub-culturing for several generations to enrich for desira ble performance via metabolic evol ution (Jantama et al., 2008a). The strains are presumed to contain multiple spontaneous mutations among their genomes, which led to higher efficiency in carbon partitioning and energy to accommodate the gene modifications. KJ017, evolved from KJ012, exhibited in creased glycolytic flux and reduced fermentation time versus that of KJ012. These resu lts were consistent w ith 4 to 5-fold higher yields of succinate for both glucose concentr ations. In 5%(w/v) glucose fermentation, the average volumetric productivity of succinate and biomass yield of KJ017 were 7 and 10-fold

PAGE 76

76 higher, respectively than those of KJ012 (Table 4-4). This in dicated that the spontaneous mutations, which occurred during metabolic evol ution, caused the ac tivation of succinate production routes and the increas e in biomass yield. It show ed that the anapleurotic (phosphoenolpyruvate carboxylatio n) pathway replenishes and conserves carbon sources that would otherwise be assimilated via pyruvate form ate-lyase activity and be further lost to CO2 and H2 via formate hydrogen-lyase (encoded by fdh and hyc ) activity. This pathway also probably plays an essential role in promoting gr owth in the microorganism when levels of highenergy intermediates such as OAA or acetyl~ CoA are high (Kornberg, 1966). After completing fermentation of 5% (w/v) glucose NBS, the amount of succinate produced was ~229 mM (Table 4-4). The molar succinate yield of KJ017 was 0. 92 mol/mol glucose used. KJ017 completed the fermentation of 5% (w/v) glucose within 96 h but the remaining glucose was still about 50 mM when performing the fermentation in 10% (w/v ) glucose even though the fermentation time was prolonged. The reducing equivalent s need to be recycled to NAD+ by the action of malate dehydrogenase ( mdh ) and fumarate reductase ( frd ), thus enabling glycolysis and enhancing succinate production (Velick and Furf ine, 1963). However, a higher NADH/NAD+ ratio resulting from high glycolytic flux (i.e 10%(w/v) gl ucose) may lower the enzyme activity of glyceraldehyde 3-phosphate dehydrogenase (G APDH). This is due to lack of NAD+ binding that affects a conformational change of the enzyme activity state (Hillman, 1979). The production yield of succinate from 10%(w/v) glucose NBS wa s slightly increased to 1.08 mol/mol glucose utilized. The yield was increased about 17%, co mpared to the yield produced from 5%(w/v) glucose fermentation. The increased yield can be explained by the high glycolytic flux since succinate titer and average productivity were increased about 115% and 111%, respectively.

PAGE 77

77 Table 4-4: Fermentation profile for succinate production in 5% and 10% glucose NBS medium a Time required to complete fermentation. b Total succinate produced calculated after fermentation was completed. c Production yield calculated on a basis of mole succinate produced per mole glucose metabolized at the end of exponential growth. d Average volumetric productivity calculated on the basis of the maximum succinate level produced per total incubation time or fermentatio n finished depending on the culture condition. e Maximum biomass generated during fermentation calculated basing on bact erial cell molecular weight (CH2N0.25O0.5), 25.5 g/mol (Abbot and Claman, 1973) KJ017 produced high levels of formate and acet ate (Table 4-4) because the intracellular pyruvate pool was likely utilized by pyruvate formate-lyase activity resulting in carbon wasting and lower production yield of succinate. Highe r succinate production yields of KJ060 ( ldhA, adhE, ackA, pflB ) were obtained in both glucose concentr ations compared to KJ017. This is an effect of gene deletions re sulting in more direct carbon fl ux through an anapleurotic pathway to reoxidize NADH accumulated during glycolysis rather than through pyruvate dissimilation routes for maintaining redox balance. The os motic stress resulted from high glucose concentration did not appear to affect the succinate production in this stra in since the average productivity was still increased when hi gher glucose concentration was used. Suc. Production Strain Timea (h) Titerb (mM) Yieldc (mol/mol) Avg. Prod. (g/l-h)d Ace (mM) For (mM) Lac (mM) Eth (mM) Mal (mM) Pyr (mM) Bioe (mM) 5% GLUCOSE NBS WT 48 49 3 0.19 0.02 152 30 262 19 98 24 153 39 33 10 98 2 KJ012 144 6 1 0.20 0.01 26 1 11 1 KJ017 96 229 15 0.92 0.03 226 33 207 35 18 10 101 6 KJ060 96 332 3 1.17 0.08 106 6 19 2 15 3 93 6 KJ071 96 258 10 0.93 0.04 65 28 90 4 53 4 54 11 KJ073 72 339 3 1.24 0.13 0.12 0.01 0.04 0.00 0.28 0.02 0.41 0.00 0.31 0.01 0.54 0.03 115 5 47 3 6 2 91 2 10% GLUCOSE NBS WT 120 101 17 0.18 0.02 190 14 120 6 102 6 70 10 26 2 102 1 KJ012 144 13 2 0.28 0.08 45 1 14 1 12 3 KJ017 144 493 8 1.08 0.02 271 20 235 12 22 3 92 8 KJ060 144 660 5 1.21 0.03 117 7 137 4 9 1 70 5 KJ071 144 401 8 0.80 0.01 75 2 616 13 63 3 60 2 KJ073 96 664 5 1.12 0.03 0.10 0.01 0.01 0.00 0.59 0.00 0.65 0.02 0.33 0.01 0.80 0.01 121 12 122 4 98 2 81 2

PAGE 78

78 The succinate production in E. coli by PEP carboxylation requires an external source of carbon via bicarbonate. CO2 gas generated during acid-base ne utralization by supplementation of a mixture of K2CO3 and KHCO3 contributed to higher carbon fixation by PPC activity. KJ060 exhibited a faster rate of su ccinate production (PEP carboxylation) in 10%(w/v) glucose medium since the average productivity was increased al most 59% compared to that from 5%(w/v) glucose medium. This implies that the carboxylati on of PEP at the PEP node is preferred. The carboxylation during succinate produ ction from KJ060 would be a benefit to an environment since the strain efficiently perf orms carbon dioxide fixation. CO2 gas generated from industrial processes can directly be used to produce succinate from ine xpensive carbon sources such as glucose, corn, and/or CSL, resulting in reduced levels of greenhouse gases. Production of acetate was still high even though KJ060 cannot generate acetyl~CoA due to lack of the pyruvate route (pyruvate formatelyase and acetate kinase). However, an overflow metabolism would be one of the reasons fo r high acetate level (Andersen and von Meyenburg 1980; Doelle and Hollywood, 1976; Meyer et al., 1984; Vemuri et al., 2006). This phenomenon is induced when the rate of glycolysis exceeds a critical value in which it is the consequence of an imbalance between glucose uptake and the demand for energy and biosynthesis resulting in by-product formation from pyruvate (Aristidou et al., 1995; Farmer and Liao, 1997). Moreover, during the absence of oxygen, oxidative phosphorylati on is inhibited leading to inefficiency in NADH oxidation. KJ060 was adapted to maintain the redox balance via accumulation of succinate. With high glucose concentrations, the rate of NADH ge nerated during glycolysis is greater than the rate of NADH oxidation (Vemuri et al., 2006). The carbon flow diversion to acetate could be a means to limit NADH in the cell since the flux th rough acetyl~CoA and acetate does not generate any reducing e quivalents (el-Mansi et al., 1989).

PAGE 79

79 Methylglyoxal is a toxic interm ediate generated during glycolys is when glycolytic flux is increased (Grabar et al., 2006). The cell avoids the adverse effect of the toxic substance by converting the methylglyoxal to lactate, via gl yoxylase activity, leading the accumulation of lactate. The mgsA gene encoded for methylglyoxal syntha se was deleted from KJ060 to improve growth and to eliminate residual lactate. The resulting strain, KJ071 shows no lactate accumulation but exhibited lower succinate produ ction yield (0.80-090 mol/mol glucose used) than KJ060 (Table 4-4). However the growth rates of both strains were not significantly different (data not shown). Surprisingly, KJ071 accumulated pyruvate (~63 mM) as well as a very high level of malate (~616 mM) in 10%(w/v) glucose medium. The average succi nate productivity of KJ071 (0.33 g/l-h) was significantly lower than that of KJ060 (0.65 g/l-h). The reason for unexpected level of malate produc ed during fermentation of KJ071 is still unclear. However, we speculate that this st rain had increased flux through OAA vi a PPC activity, rather than via partitioning of carbon flow through pyr uvate catabolism, resulting in low level of acetate. It is generally known that in the presence of oxygen, the PDH comp lex oxidatively-decarboxylates pyruvate to acetyl~CoA with the conservation of reductant as NADH. Si nce KJ071 is unable to produce acetyl~CoA due to pflB mutation, the PDH activity ac tivated to some extent, to compensate the lack of pflB activity, even in the absence of oxygen. The malate accumulation was a consequence of the lower flux through PDH activity in which the rate of NADH generation was not fast e nough to efficiently convert fumarate to succinate. It is likely that the lack of NADH also influenced th e conversion rate of malate to fumarate, which then became the rate-limiting step in this pathway. Moreover, the feedback inhibition of anaerobic metabolism would account for malate accumulation. The increase in glycolytic flux may cause the decline in the succinate/malate ratio due to increased production of oxaloacetat e, an allosteric inhibitor of

PAGE 80

80 fumarate reductase (Iverson et al., 2002; Sanwal, 1970). In addition, high levels of glucose cause the catabolite repression of mdh expression due to the catabolite control of cyclic AMP (cAMP) regulatory protein (Park et al., 1995). Also high level of ma late can alloster ically inhibit phosphoenolpyruvate carboxylase (Wang et al., 2006). To reduce the product feedback inhibition of both enzymes, the strains might excrete malate out of the cell to maintain the intracellular level that keeps the carboxylation pr ocess functioning. However, how the mgsA deletion affected the metabolic shift is still unclear. Decreasing acetate production during succina te fermentation would improve downstream processing by simplifying the purification. Pyruva te oxidase (POXB) is thought to be responsible for cell survival during stationary phase by oxidation of pyruvate resulting in acetate accumulation. Pyruvate oxidase is still functiona l at low growth rates (stationary phase) and under microaerobic conditions (Abdel-Hamid et al., 2001). An elevated intracellular pyruvate level accumulated from high glycolytic flux activ ates pyruvate oxidase, which directs pyruvate to acetate via a single step decarboxylation with a concomitant reduction of flavoprotein (Hager, 1957). The effect of poxB deletion showed that KJ073 ( ldhA, adhE, ackA, pflB, mgsA, poxB ) could completely utilize 10%(w/v) glucos e within 96 h and had the highest average succinate productivity in both 5%(w/v) and 10%(w/v) glucose concentrations (0.54 and 0.80 g/lh, respectively) (Table 4-4). The lower succinate yield observed from KJ073 compared to KJ060 might be due to the effect of the mutation that caused the strain to accumulate malate since KJ073 was derived from KJ071. However, KJ073 ad apted itself to produce less malate (about 80%) compared to KJ071 and produced ~664 mM succinate from 10%(w/v) glucose NBS. Unexpectedly, KJ073 still produced a cetate at the same level as that of KJ060. This indicates that deletion of poxB did not lower the acetat e level but promoted the growth and increased

PAGE 81

81 glycolytic flux instead (Jantama et al., 2008a). Ve muri et al., (2005) revealed that the removal of POXB generally decreased the expression of PT S genes while increasing the expression of glucokinase, an alternative glucose uptake route in E. coli (Curtis and Epstein, 1975). Moreover, they also showed that the elimination of POXB activity led to increa sed expression of a key Entner-Doudoroff gene, edd (encoding phosphogluconate dehydrat ase), suggesting increased utilization of this pathway. POXB allows cells to avoid generating ATP in converting pyruvate to acetate. They propose that E. coli might respond to poxB deletion by metabolizing more glucose via the Entner-Doudoroff pathway that generates less ATP than the Embden MeyerhofParnas pathway (Vemuri et al., 2005). E. coli prefers limiting its ATP synthesis when glucose uptake rate is increased (Cha o and Liao, 1994; ; Causey et al., 2003; Koebmann et al., 2002; Patnaik et al., 1992). This result suggests the pr esence of other acetate producing pathways. The cells might compensate for the poxB deletion by increasing the rela tive expression of other genes involved in acetate formation. Fi rst, under anaerobic conditions, OA A is reduced to malate, and citrate can be converted into OAA and acetate via acetyl~CoA by citrate lyase (encoded by citDEF ) activity to recycle the in tracellular OAA pool for other me tabolic functions (Nilekani and Sirvaraman, 1983). Second, the study of the tdcD gene has revealed that it encodes a protein with acetate/propionate kinase activity (Hesslinger et al ., 1998). Based on the sequence similarity, the tdcD product is highly similar to the ackA encoded acetate kinase (Reed et al., 2003). Furthermore, the tdcE gene located downstream of tdcD in the same operon has a pyruvate/ -ketobutyrate formate-lyas e activity, which is a pfl like protein (Hesslinger et al., 1998). Both genes are involved in the metabo lism of L-threonine under anaerobic growth conditions. It is likely that the low formate a nd high acetate levels from fermentation of 5%(w/v) glucose in NBS implies that both gene products in KJ060 and its derivatives are functioning.

PAGE 82

82 The increased levels of pyruvate in KJ071 and KJ073 also resulted in a major reduction in the succinate yield and productivity compared to KJ060. The high levels of pyruvate might result from high malic enzyme activity due to increased activation of phosphoenolpyruvate carboxylase and malate dehydrogenase. The activitie s of these enzymes were found to be higher when acetate or even glucose was present in the cultures (Siddiquee et al., 2004). Effect of Initial Inocula and Acetat e on Succinate Production in KJ060 Many attempts to produce succinate with E. coli derivatives at high cell densities have been reported to increase the glucose conversion rate to succinate (San chez et al., 2005a; b; Sanchez et al., 2006). KJ060 was used to study the e ffect of initial inocula and acetate levels on succinate production. The results showed that th e higher initial cell dens ities did not promote higher glucose consumption over lower cell densit y cultures (Table 4-5 and 4-6). However, 50100 mM glucose still remained in the medium after fermentation was prolonged upto 144 h (data not shown). The requirement of biomass generation in lowe r inocula culture might have increased the rate of glucose consumption as glucose was utiliz ed and the intermediate products were used in biosynthesis without accumulation of intracellular metabolites. In contrast, the glucose utilization in high inocula culture might lead in faster accu mulation of intracellular me tabolites than that of low inocula cultures. The metabolites generated dur ing glycolysis and succinate production were accumulated to such a critical level that they c ould inhibit some enzymes involved in glycolysis and anapleurotic pathways. This may result in fe edback inhibition of glyc olysis and anapleurotic pathways, thus decreasing the rate of succinate production.

PAGE 83

83 Table 4-5. Comparison of KJ060 on metabolite production using 10%(w/v) glucose (~556 mM) as substrate in NBS salt medium with diffe rent initial acetate concentrations and initial cell density. Suc. Production Suc. Productivityd Initial OD550 Initial Acetate (mM) Timea (h) Titerb (mM) Yieldc (mol/mol) Avg. Prod. (g/l-h) Max. Prod. (g/l-h) Ace (mM) Mal (mM) Pyr (mM) Bioe (mM) 0.01 10 96 692 16 1.24 0.03 0.85 0.02 1.57 0.13 153 21 86 1 32 5 74 4 0.2 10 >144 633 30 1.33 0.06 0.71 0.03 0.90 0.04 135 12 85 5 34 2 66 4 0.01 5 >144 626 6 1.20 0.01 0.70 0.01 1.40 0.03 150 11 91 1 39 1 73 4 0.2 5 >144 596 12 1.35 0.03 0.58 0.03 1.20 0.08 151 22 75 2 20 2 66 2 0.01 0 >144 664 16 1.19 0.01 0.65 0.02 1.47 0.20 150 2 113 19 16 1 73 4 0.2 0 >144 648 2 1.24 0.03 0.61 0.01 1.30 0.08 146 10 81 1 28 2 71 4 0.01f 0 120 696 9 1.27 0.04 0.68 0.01 1.33 0.10 140 12 83 6 43 9 83 3 0.2f 0 120 690 30 1.32 0.06 0.68 0.03 1.23 0.05 171 5 39 2 10 1 77 3 a Time required to complete fermentation. b Total succinate produced calculated after fermentation was completed. c Production yield calculated on a basis of mole succinate produced per mole glucose metabolized at the end of exponential growth. d Maximum volumetric producti vity calculated on the basis of th e most productive 24-h period. Average volumetric productivity calculated on the basis of the maximum succinate level produced per total incubation time or fermentation finished depending on the culture condition. e Maximum biomass generated during fermentation cal culated basing on bacter ial cell molecular weight (CH2N0.25O0.5), 25.5 g/mol (Abbot and Claman, 1973) f The medium was supplemented with 0.1% each of peptone and yeast extract. From our studies, the succinate production yi eld was in the range of 1.1-1.6 mol/mol glucose used. The variation in the producti on yield might be dependent on the NADH availability and the functionality of glyoxylate bypass. The glyoxylate bypass might be operative in E. coli ATCC 8739 derivatives in which isocitrate lyase genes ( aceAB ) are constitutively transcribed while transcription of the isocitrate lyase repressor ( iclR ) is repressed even under anaerobic conditions (P hue and Shiloach, 2004). The glyoxylate bypass converts 2 moles of acetyl ~CoA and 1 mole of OAA to 1 mol of succinate and 1 mole of malate without the requirement of N ADH (Kornberg, 1966). However, 1 mole of malate from glyoxylate bypass requires an extra mole of NADH to be further converted to succinate. The only way to gain one extra mole of NADH is through the assimilation of

PAGE 84

84 pyruvate via the pyruvate dehydrogenase (PDH) complex, which produces 1 mole of acetyl~CoA, 1 mole of CO2 and 1 mole of NADH from one mole of pyruvate. The NADH produced from PDH activity provided more reducing equivalents to reduce fumarate to succinate resulting in a greater molar succ inate yield than 1 mol/mol glucos e used. In figure 4-2, I propose a new succinate production pathwa y that leads the maximum yield of 1.71 mol/mol glucose used. The pathway includes the activat ion of PDH activity and of th e glyoxylate bypass. The succinate production yield of 1.1-1.2 mol/mol glucose used was observed in the cultures that started with low inocula. It might imply that only the P DH activity is activated but not glyoxylate bypass, resulting in lower succinate produ ction yield than we propose. In contrast, the higher succinate production yield close to that which we propose was obtained fr om the cultures inoculated with high cell densities. It also implies that P DH is activated and glyoxylate bypass might be operative under these conditions. Table 4-6. Comparison of KJ060 and KJ073 on metabolite production using 10%(w/v) glucose (~556 mM) as substrate in AM1 salt medium with initial cell density. Suc. Production Suc. Productivityd Strain + Initial OD550 Timea (h) Titerb (mM) Yieldc (mol/mol) Avg. Prod. (g/l-h) Max. Prod. (g/l-h) Ace (mM) Mal (mM) Pyr (mM) Bioe (mM) KJ060+0.01 120 733 40 1.41 0.07 0.90 0.04 2.21 0.24 250 37 39 17 87 2 KJ060+0.20 >144 636 17 1.48 0.09 0.78 0.02 1.49 0.04 211 8 18 11 79 1 KJ060+0.40 >144 668 41 1.49 0.04 0.82 0.05 1.45 0.40 192 6 27 19 1 0 86 5 KJ060+0.60 >144 622 31 1.61 0.12 0.77 0.04 1.07 0.13 180 13 17 5 6 1 78 3 KJ073+0.01 96 668 9 1.20 0.09 0.82 0.01 1.95 0.19 183 27 118 13 55 2 97 1 a Time required to complete fermentation. b Total succinate produced calculated after fermentation was completed. c Production yield calculated on a basis of mole succinate produced per mole glucose metabolized at the end of exponential growth. d Maximum volumetric producti vity calculated on the basis of the most productive 24-h period. Average volumetric productivity calculated on the basis of the maximum succinate level produced per total incubation time or fermentation finished depending on the culture condition. e Maximum biomass generated during fermentation cal culated basing on bacter ial cell molecular weight (CH2N0.25O0.5), 25.5 g/mol (Abbot and Claman, 1973)

PAGE 85

85 Figure 4-2. Proposed succinate producti on pathway from glucose. The pathway shows maximum theoretical yield (1.71 mol/mol glucose us ed) of succinate produced during anaerobic fermentation. The blue arrow represen ts the flux through pyruvate dehydrogenase (PDH) complex that provides the extra source of NADH. The red arrow represents the carbon flow through glyoxylate bypass that yields malate and succinate from the condensation of glyoxylate a nd acetyl~CoA. +; gained, ; consumed. CIT; citrate, ACO; aconitate, IS CIT; isocitrate. The succinate production yield from high initial cell density cultures was also higher when acetate was supplied. Unlike the yield, th e maximum volumetric productivity from the low inocula (with or without initial acetate) cultures was higher than that in cultures with higher inocula (Table 4-5). In addition, the combinati on of low initial cell density growth with acetate or yeast extract/peptone supplementation pr omoted growth and increased the glucose consumption rate. The fermentation time was reduced to 96 h when acetate was added. The low glucose consumption observed in the la te log phase was possibl y due to a lack of growth supplements that are essential for gluc ose transport. To prove this, cultures were supplemented with yeast extract and peptone. The results showed that the supplemented cultures

PAGE 86

86 at both high and low initial cell densities cons umed glucose more rapidly, completing the fermentation by 120 h compared to 144 h fo r non-supplemented cultures (Table 4-5). Effect of Low Salt Media (AM1) on Succinate Production in KJ060 The succinate production yield obtained from KJ060 in AM1 was about 1.41 mol/mol glucose utilized. The production yield was dram atically increased (upto 1.61 mol/mol glucose used) with a large inoculum; however, the ma ximum volumetric productivity was decreased (Table 4-6). In addition, glucose consumption wa s reduced when the initial cell density was high (data not shown). The highe st titer of succinate was achieved w ith the lowest inoculum (Table 46). This indicates that, in the low initial cell concen tration case, the produc tion of succinate is associated with biosynthesis. In other word s, part of the glucose was consumed. The intermediates generated from catabolism were us ed for biosynthesis during succinate production. The use of these intermediates for biosynthesi s increased glycolytic flux and accompanied the succinate production without metabolite accumulation, resulting in in a shorter time to complete fermentation. In contrast, due to the lower bios ynthetic demands in the cultures with higher cell densities, metabolic intermediates were accumulate d to a level that caused feedback inhibition of glucose catabolism. Surprisingly, the malate pr oduction of KJ060 in AM1 medium was lower than that in NBS, and the pyruvate concentration was very lo w. Unfortunately, the level of acetate in AM1 was 60% higher than that from NBS medium. We hypothesize that the high level of nitrogen salts in AM1 media may activate acetate production by unknown pathways. Effect of low Salt Media (AM1) on Succinate Production in KJ073 KJ073 was used to study the effect of AM1 medium on succinate production. The results showed that the average succina te productivity was approximately the same but the succinate production yield was increased a bout 7% higher than cultures grown in NBS based medium

PAGE 87

87 (Table 4-4 and Table 4-6). However, when compared to KJ060 in AM1 medium, KJ073 exhibited lower succinate yields and productivities by 14% and 12%, respectively (Table 4-6). This suggests that the lower yield and rate of succinate produ ction resulted from a greater accumulation of malate and pyruvate in KJ073 than those in KJ060. The carbon losses to these intermediates affected the yield and rate. Metabolic Flux Analysis in E. coli Strains to Produce Succinate For each of the five strains studied, batch ferm entations were carried out in triplicate with 5%(w/v) and 10%(w/v) glucose. Table 4-7 presents the measured glucose consumption rates and specific production rates of the excreted meta bolites during the growth phase. For each metabolite, the values listed are in the order of the experiments. For example, the second run with wild type in 10%(w/v) glucose gave gl ucose consumption rate 20.77 mmol/gCDW-h, succinate production rate 2.59 mmol/gCDW-h, a cetate production rate 18.00 mmol/gCDW-h, etc. Using Equation 3, the fluxes were calculat ed for each run. The resulting means and standard deviations are presented in Table 48. Below we discuss how the metabolic fluxes change from the wild type to the mutants, and how they are affected by increased glucose concentration. Metabolic Flux Distributions in E. coli Wild Type The wild type has 5 branch points as can be seen in Figure 4-1. The first is at Glucose-6P, where v1 splits to v2 for biosynthesis and v3 for catabolism. The catabolic flux is much larger, and the split ratio is not significantly affect ed by increasing glucose concentration. The second branch point is at PEP, which is where v4 splits into v5 plus v1 to pyruvate and v10 to OAA. For both glucose concentrations, ov er 90% of PEP flux flows to pyruvate through v1+v5 (Table 4-8). That the majority of the flux is to pyruvate is expected since the apparent Km

PAGE 88

88 (Michaelis-Menten constant) for PEP of PYK (pyruvate kinase) (0.2 mM, Kornberg and Malcovati, 1973) is considerably lower than that of PPC (phos phoenolpyruvate carboxylase) (0.8 mM, Smith et al., 1980). Table 4-7. Specific production ra te of extracellular metabolites Strains Wild Strain KJ017 KJ060 KJ071 KJ073 a Specific production rate (mmol/gCDW/h) 5%b 10%b 5%b 10%c 5%b 10%c 5%b 10%b 5%c 10%d Glucose used 22.40 21.51 21.00 16.86 20.77 19.79 12.75 11.51 11.46 14.13 14.39 14.66 15.76 16.93 16.83 19.65 15.93 15.84 17.11 17.60 17.06 9.94 10.96 9.82 15.28 16.14 16.06 25.96 21.23 23.76 Succinate 2.70 2.36 2.74 2.24 2.59 2.57 10.31 11.84 11.35 15.06 15.35 15.76 19.86 21.50 21.93 23.96 19.01 18.53 17.74 17.44 16.39 12.65 14.06 12.82 16.57 18.02 17.62 30.62 25.87 28.65 Acetate 19.20 18.44 17.00 13.92 18.00 17.80 10.14 10.75 10.64 8.36 8.42 8.76 7.58 7.72 6.30 6.69 5.71 5.11 6.83 6.51 6.20 5.91 7.00 6.19 4.78 5.33 4.48 6.72 6.74 6.77 Formate 35.95 35.06 34.73 25.45 33.29 32.22 9.59 9.75 8.96 8.49 8.43 8.80 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Lactate 1.31 0.92 1.17 0.39 0.50 0.54 0.32 0.69 0.59 0.80 0.93 1.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Ethanol 19.83 19.00 17.17 15.25 18.08 17.24 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Excreted Mal ate 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 2.39 1.73 2.45 6.26 7.27 6.87 0.00 0.00 0.00 2.93 2.91 2.40 3.68 2.31 2.49 Excreted Pyruvate 0.00 0.00 0.00 0.07 0.08 1.06 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.83 0.85 0.98 0.00 0.00 0.00 0.00 0.00 0.00 2.46 2.96 2.86 2.56 2.04 2.10 a Specific production rates of extracellular metabo lites calculated from the data during growth phase b calculated from data at 0 and 24 h c calculated from data at 0 and 48 h d calculated from data at 24 and 48 h The next node is at pyruvate where v1 plus v5 splits into v6 to lactate, v7 to formate and acetyl~CoA, v13 to acetyl~CoA, and vEP to extracellular pyruvate. Under anaerobic conditions, PFLB has the highest affinity for pyruvate, with a lower Km for pyruvate than that of LDHA (PFLB = 2.0 mM; Knappe et al., 1974, LDHA = 7.2 mM; Tarmy and Kaplan, 1968a, b), thus explaining the higher flux through formate and acetyl~CoA ( v7) than through lactate (v6) (Table

PAGE 89

89 4-8). Two-fold lower flux of LDHA activity wa s observed in 10%(w/v) glucose compared to 5%(w/v) glucose. In higher glycolytic flux, E. coli requires more ATP to produce osmoprotectants, thus favoring the ATP producing PFLB path. This could explain some downregulation of the activity of LDHA. Low or no flux through the LDHA pathway has been previously observed in glucose-grown cells under excess glucose conditions (de Graef et al., 1999). There is also flux through the PDH path way. This flux might serve to limit pyruvate accumulation and to balance the NAD/NADH ratio, since flux through PFLB is an overall redoxneutral process. It has been previously reported that the PDH complex activity is not dependent on the presence of oxygen but is mediated by th e internal redox state as reflected in the NAD/NADH ratio (de Graef et al., 1999). The flux through PDH exhibited in E. coli wild type might be affected by the NAD H requirement for reduction of acetyl~CoA and acetaldehyde produced via PFLB activity. In addition, NADH is consumed in the routes towards succinate production ( v11 and v12). Increase in glucose to 10%(w/ v) increased the flux through PDH in proportion to the increase in glycolytic flux. Finally, there was little or no flux to extracellular pyruvate. The fourth branch point is at Acetyl~CoA, where v13 plus v7 split into v8 to acetate and v9 to ethanol. The flux through ADHE ( v9), along with minor contributions from the fluxes to lactate (v6) and succinate ( v11 and v12), fulfill the requirement for NADH regeneration (NADHP/G NADHU/G), as required for the redox balance. Another observation for the flux distribution in wild type is the partition of acetyl~CoA into equimolar amounts of ethanol and acetate ( v8 v9). Stephanopoulos and Vallino (1991) and Aristidou et al. (1999) al so mention this observation. The last potential branch point is at malate, wher e the split can lead to succinate or extracellular malate. No appreciable amount of excreted malate was observed.

PAGE 90

90 Table 4-8. Metabolic fluxes distribution of an anaerobic succinate production in 5%(w /v) and 10%(w/v) gluc ose NBS of various E. coli strains Strains ECC KJ017 KJ060 KJ071 KJ073 Flux Toa (mmol/gCDW/h) 5% 10% 5% 10% 5% 10% 5% 10% 5% 10% Glucose, v1 21.60.7 19.12.0 11.90.7 14.40.3 16.50.6 17.12.2 17.30.3 10.20.6 15.80.5 23.72.4 Biomass, v2 1.00.2 1.00.2 0.91.4 0.50.1 0.80.2 0.40.2 1.00.3 0.30.1 0.70.2 0.40.2 Gly-3P, v3 20.60.9 18.12.0 11.00.7 13.90.4 15.70.8 16.72.3 16.20.5 10.00.5 15.10.6 23.32.2 PEP, v4 41.21.8 36.33.9 22.01.4 27.80.7 31.41.6 33.44.6 32.41.0 19.91.0 30.21.2 46.54.4 Pyruvate, v5 16.91.2 14.71.7 -1.01.2 -2.50.1 -6.70.3 -7.00.8 -9.10.4 -3.70.2 -6.10.1 -9.21.2 Lactate, v6 1.10.2 0.50.1 0.50.2 0.90.1 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 Formate, v7 35.10.7 30.34.3 9.50.4 8.10.2 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 Acetyl-P, v8 18.40.9 16.52.3 10.50.3 9.50.2 8.20.5 7.01.0 7.20.3 6.40.5 5.60.3 8.60.3 Ethanol, v9 18.71.4 16.91.4 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 OAA, v10 2.60.2 2.50.2 11.20.8 15.40.4 21.11.1 22.73.2 24.00.7 13.30.7 20.20.7 31.23.1 Malate, v11 2.50.2 2.50.2 11.20.8 14.90.3 20.60.9 22.13.1 23.70.7 13.20.7 19.80.7 30.32.9 Succinate, v12 2.50.2 2.50.2 11.20.8 14.90.3 20.60.9 19.92.9 16.90.7 13.20.7 17.10.7 27.52.2 PDH, v13 2.11.3 3.00.3 0.90.5 2.40.1 9.30.3 8.11.2 7.80.3 6.50.4 6.30.0 10.30.6 EM, vEM 0.00.0 0.00.0 0.00.0 0.00.0 0.00.0 2.20.4 6.80.5 0.00.0 2.70.3 2.80.7 EP, vEP 0.00.0 0.10.0 0.00.0 0.00.0 0.00.0 1.50.1 0.00.0 0.00.0 3.10.3 3.10.4 ATP/G 2.60.0 2.60.1 1.60.4 1.30.0 0.60.0 0.60.0 0.30.0 0.90.0 0.50.1 0.60.1 YATP 4.90.3 5.70.7 9.61.9 7.30.3 25.91.2 13.92.4 50.714.427.02.0 16.22.0 15.10.6 NADHP/G 2.00.1 2.10.0 1.90.3 2.10.0 2.50.0 2.40.0 2.30.1 2.60.0 2.30.0 2.40.0 NADHU/G 2.00.1 2.10.0 1.90.3 2.10.0 2.50.0 2.40.0 2.30.1 2.60.0 2.30.0 2.40.0 a Specific volumetric flux during growth phase

PAGE 91

91Metabolic Flux Distributio ns in Mutant Strains For the mutant strains (KJ017, KJ060, KJ071, and KJ073) the glucose-6-P branch point again shows the majority of the car bon flux going to glyceraldehyde-3-P ( v3). For all mutant strains, increasing glucose concentration decreased the flux v2 to biomass, indicating that the mutants are less capable to dealing with high osmolality than the wild type. The split of carbon flux at the PEP node is critical since it determines the flux to the succinate production route (Figure 4-1). For strain KJ017 lacking LDHA, ACKA and ADHE, the flux towards succinate productio n is dramatically increased (T able 4-8) since this pathway solely functions to recycle NAD+ for glycolysis, resulting in th e net specific carbon flux from PEP to OAA ( v10) more than four times higher than that of the wild type. It is also noteworthy, that the need to regenerate NAD+ caused flux v5 to reverse sign, indicating that some of the pyruvate generated during glucose transport is converted back to PEP through PPS. In the strains without PFLB (KJ060, KJ071, and KJ073), the specific flux v10 from PEP to OAA increased even further to as high as 67% of v4. This indicates that th e absence of PFLB caused the strains to shift the flux from pyruvate breakdown to PEP utilization. Th e relative splits at this node were not appreciably affect ed by glucose concentration. The splits at the pyruvate node were signifi cantly affected by the ge ne deletions in the mutants. In KJ017, as in the wild type, the ma jority of the flux to pyruvate goes to formate ( v7) with some flux through PDH ( v13) and, surprisingly, a small amount of flux to lactate ( v6). It is hypothesized that an alternativ e parthway for producing lactat e may have become active, a candidate being the methylglyoxal synthase. No extracellular pyruvate was observed in KJ017. In strains KJ060, KJ071 and KJ073, no lactat e was observed. Strain KJ071 did not excrete pyruvate, but strain KJ060 did produce so me extracellular pyruvate at 10%(w/v) glucose and strain KJ073 produced some at both glucose leve ls. For all strains th e major flux out of the

PAGE 92

92 pyruvate node was the flux through PDH (v13) leading to the production of acetate. This flux dramatically increased, up to 8 fold, in the pflBstrains with respect to KJ017. The increase in the PDH flux is in agreement with the rate of succinate production (Table 4-8). This suggests that NADH produced from the PDH activity can incr ease the flux to succinate and balance the NADH production and consumption. From Table 4-8, the redox balance is accomplished by having v4 + v13 v11 + v12 in the strains lacking the ability to produce ethanol and lactate. Strain KJ032, the parent strain of KJ060 and the first strain with a pflB deletion, required acetate as a source of acetyl~C oA to grow anaerobically. Afte r the metabolic evolution KJ060 grew under anaerobic condition without acetate. The only pathway permitting the production of acetyl~CoA as source of C2 for biosynthesis from pyruvate w ould be the PDH complex. Besides the effect of internal redox state, PDH complex activity observed during anaerobic fermentation in the strains lacking PFLB could be explaine d by the regulation of FNR (fumarate-nitrate regulatory protein) and intracellular pyruvate. Quail and Gu est (1995) explaine d that FNR and PdhR repressor proteins control pdh transcription. In the absence of pyruvate, PdhR binds to the promoter of the pdh operon and inhibits transcription. Increased intracellular pyruvate levels because of the cells inability to dissimilate pyruvate might result in binding of pyruvate with PdhR thus releasing PdhR from the promoter region of the pdh operon. Control by FNR alone might not be enough to repress pdh transcription, reflecting a gr eatly increased flux through the PDH complex in the strain lacking PFLB activity. The benefit of activation of the PDH complex to succinate production is that the flux via the PDH complex pr ovides an extra mole of NADH that can be used to reduce malate to succinate. The last node for the mutants is that of v11 to malate. KJ017 produced no extracellular malate, converting all intracellular malate to succinate. KJ060 produced small amount of

PAGE 93

93 extracellular malate at high glucose levels. The decrease in NADH production via the PDH pathway, may have limited its availability fo r succinate production. Strain KJ071 produced significant amount of extracellular malate at 5%(w/v) glucose during exp onential growth. At 10%(w/v) glucose, no malate was observed durin g exponential growth, but a very high amount of malate (titer of 520 mM, Jant ama et al., 2008a) was produced in the ensuing stationary phase. Strain KJ073 produced the highest amount of succinate, particularly at 10%(w/v) glucose, splitting the flux at the node to 85% succinate at 5%(w/v) glucos e and to almost 90% succinate at 10%(w/v) glucose. The redox balance proba bly controls this split, with higher NADH production through PDH favoring succinate. It is interesting that mutant strains KJ060, KJ071, and KJ073 have high flux to acetate ( v8), even though ackA was deleted from their genomes. These strains might activate other enzymes to compensate for ACKA activity. One of the enzymes involved in the degradation of threonine is a possibility since it exhibits propionate kinase ( tdcD ) activity (Figure 4-1) and is an acetate kinase homologue (H esslinger et al., 1998). Effect of Gene Deletions on ATP and Cell Yields Neglecting carbon loss through OAA, the wild ty pe strain converts acetyl~CoA into approximately equimolar amounts of ethanol and acetate that yields an additional mole of ATP per mole of glucose used. Adding this to the tw o net moles of ATP gained from glycolysis (50% of PEP is from the PTS system that does not produce ATP) yields a maximum net ATP/G of 3 (Tempest and Neijssel, 1987). However, during fe rmentation wild type strain also produces succinate. The carbon flux to the succinate produ ction pathway does not produce ATP, resulting in production of ATP/G less than 3 (2.6) for both glucose co ncentrations. The amount of ATP produced depends on the split flux ratio from PEP to pyruvate ( v5) via PYK and to OAA ( v10) via

PAGE 94

94 PPC. In wild type strain most of the carbon flux fr om PEP flows to pyruvate, v5. This strain produces the highest amo unt of ATP/G among the five strains studied. For the strains lacking ACKA, the net maximum ATP/G is 2 because they can produce ATP only from glycolysis under anaerobic condi tions (Tempest and Neijssel, 1987). Strain KJ017 produces 1.6 ATP/G at 5%(w/v) glucose a nd 1.3 ATP/G at 10%(w/v) glucose (Table 48), somewhat lower than the theoretical maximum. This can be explained by the increase in carbon flux to the succinate production route ( v10) and the loss of energy to produce PEP from pyruvate via PPS ( v5 becomes negative). In the stra ins without PFLB and ACKA (KJ060, KJ071, and KJ073), ATP production is considerably lowe r, less than 1 ATP/G. This is attributed to substantial increase in the specific flux v10 from PEP to OAA and a substantial increase in the flux through PPS ( v5<0), which consumes 2 moles of ATP. As seen, the production of ATP in all mutant strains was low compared to the wild type. How these strains resolve the energy shortage to maintain a certain intracellular ATP level used for promoting cell growth and metabolic activity is interesting. The strains probably gain the benefit of generating ATP using other unknown pathways. This should be investigated further. It is known that the growth yield of an or ganism is proportional to the amount of ATP produced by its catabolic processes. Cell yield (YATP) is defined as the gram of dry weight of microbial cells produced per mo le of ATP formed (Bauchop a nd Elsden, 1960). The metabolic flux analysis of the data allowed us to calculate the anaerobic cell yield (YATP) neglecting maintenance and the results are shown in Table 4-5. A value for YATP MAX of 10.3 g CDW per mole ATP (Hempfling and Mainzer, 1975) has been generally accepted as the maximum YATP for the anaerobic growth of E. coli in minimal glucose media. The values estimated for the wild type and KJ017 are somewhat below YATP MAX, as would be expected since maintenance energy

PAGE 95

95 is not considered. However, the values for the strains without PFLB and ACKA (KJ060, KJ071, and KJ073) are considerably higher than YATP MAX, particularly for KJ071 at 5% w/v glucose. A probable explanation is that mo re ATP was generated than our flux analysis indicates. Conclusions The metabolism of E. coli is remarkably adaptive. Some genetic manipulations are obviously needed to engineer metabolism for the production of chemicals such as succinate with high titer, productivity, and yield close to the maximum theoretical from glucose. The combination of gene deletions and metabolic ev olution can result in significant changes in metabolite fluxes. Some interesting changes id entified in this study are increased flux through PDH for the pflB mutants and reversal of the PEP to pyruvate reaction, from the PYK-catalyzed forward reaction for the wild type to th e PPS-catalyzed reverse reaction for all ackA mutants. Analysis of ATP generation and cell yield suggests that the pflB mutants may contain an alternative route for ATP production. This should be investigated further. Metabolic flux analysis of mu tant strains that we deve loped for succinate production provided us with insights and information on how the intracellular metabolite fluxes change at branch points as a result of the genetic manipulations. This information may guide us in future genetic modifications with the goal of direct ing more carbon flux to succinate production and reducing the flux to byproducts su ch as acetate and malate.

PAGE 96

96 CHAPTER 5 ELIMINATING SIDE PRODUCTS AND INCREASING SUCCINATE YIELDS IN ENGI NEERED STRAINS OF Escherichia coli ATCC 8739 Introduction Many approaches have been investigated for the microbial production of succinic acid. E. coli has been engineered with heterologous genes to increase succina te production using both aerobic, anaerobic, and two-step combination processes (Chatterj ee et al., 2001; Jantama et al., 2008a; Sanchez et al., 2005a, b; Vemuri et al., 20 02a, b; Wu et al., 2007). Rumen bacteria have been identified and investigated that have the natural ability to produce large amounts of succinic acid anaerobically (Jantama et al., 2008a; Zeikus et al., 1999). However, most rumen bacteria and recombinant E. coli require complex nutrients (Janta ma et al., 2008a; Song and Lee, 2006; Song et al., 2007) and accumulate side products dur ing fermentation. Reducing both the levels of side products and the use of complex nutrients offer opportunities to im prove product yields and reduce costs associated with downstream pro cessing, purification, and waste disposal. In Chapter 3, I described that derivatives of E. coli ATCC 8739 were recently constructed that produce succinic acid in minimal salts medi a using simple, batch fermentations without the use of foreign genes. The best biocatalyst, KJ073 ( ldhA::FRT adhE::FRT ( focA pflB ) ::FRT ackA ::FRT mgsA poxB ), produced 1.2 mole of succinic acid per mole of metabolized glucose. However, these strains also accumulate d large amounts of acetate, malate, and pyruvate as side products. By identifying the source of th ese side products, I developed new strains that approach the maximum theoretical yield (1.71 mo l succinate per mol glucose) in simple batch fermenations.

PAGE 97

97Materials and Methods Strains, Media and Growth Conditions New derivatives of E. coli C (ATCC 8739) were devel oped for succinate production using a unique combination of gene deletions co upled with growth-based selection. Strains, plasmids, and primers used in this study are summarized in Table 5-1. During strain construction, culture s were grown at 37oC in modified LB (per lite r: 10 g Difco tryptone, 5 g Difco yeast extract, 5 g sodium chloride) (Mi ller, 1992) and supplemente d with antibiotics as appropriate (Jantama et al., 2008a ; Zhang et al., 2007). No gene encoding antibiotic resistance, plasmid, or foreign gene is pres ent in the final strains developed for succinate production. After construction, strains were grown and maintained in AM1 medium (Martinez et al., 2007). This medium was supplemented with 100 mM KHCO3 and glucose (as indicated). Betaine (1 mM) was also added when the initial glucose concentration was 5%(w/v) or higher. Deletion of FRT Markers in the adhE, ldhA and focA-pflB Regions The strategy used to make sequential gene deletions and remove the FRT markers from the adhE, ldhA and focA-pflB loci has been described previo usly (Datsenko and Wanner, 2000; Grabar et al., 2006; Jantama et al., 2008a; Zha ng et al., 2007). Plasmid pLOI4151 was used as a source of a cat-sacB cassette and Red recombinase (pKD 46) was used to facilitate doublecrossover, homologous recombination events. Chlora mphenicol resistance was used to select for integration. Growth with sucrose was used to select for loss of sacB With this approach, successive deletions were constructed to produce derivatives of KJ079 that eliminated all FRT sites. Primers and plasmids are listed in Table 5-1.

PAGE 98

98Table 5-1. Escherichia coli strains, plasmids, and primers Relevant Characteristics Sources E. coli strains KJ073 ldhA::FRT adhE::FRT ( focA pflB ) ::FRT ackA ::FRT mgsA poxB Jantama et al., 2008a KJ076 KJ073, ackA::cat-sacB translational stop sequence This study KJ079 KJ076, ackA::translational stop sequence This study TG200 KJ079, adhE::cat-sacB This study TG201 TG200, adhE This study TG202 TG201, ldhA::cat-sacB This study TG203 TG202, ldhA This study TG204 TG203, ( focA pflB ) ::cat-sacB This study KJ091 TG204, ( focA pflB ) This study KJ098 KJ091, tdcDE This study KJ104 KJ098, citF:: translational stop sequence This study KJ110 KJ104, aspC This study KJ119 KJ104, sfcA::translational stop sequence This study KJ122 KJ110, sfcA::translational stop sequence This study KJ134 KJ122, pta-ackA ::translational stop sequence This study Plasmids pKD46 bla exo (red recombinase), temper ature-conditional replicon Datsenko, 2000 pEL04 cat-sacB cassette Lee, 2001 Thomason, 2005 pCR2.1TOPO bla kan; TOPO TA cloning vector Invitrogen pLOI2228 cat ; FRT -cat-FRT cassette MartinezMorales et al., 1999

PAGE 99

99Table 5-1. ( Continued ) Relevant Characteristics Sources pLOI2511 bla kan ; FRT -kanFRT cassette Underwood et al., 2002 pLOI4162 bla cat; ligation of cat-sacB cassette ( Pac I digested) from pLOI4146 and Pac I digested pLOI4161 Jantama et al., 2008b pLOI4158 bla kan; ackA (PCR) from E.coli C (using JM ackA F1/R1 primers) cloned into pCR2.1-TOPO vector Jantama et al., 2008b pLOI4159 Sma I /Sfo I digested cat-sacB cassette from pLOI4162 cloned into the PCR amplified inside-out product from pLOI4158 (using JM ackA up1/down1) Jantama et al., 2008b pLOI4160 Pac I digestion of pLOI4159, then self-ligated Jantama et al., 2008b pLOI4280 bla kan; aspC (PCR) from E.coli C (using aspC up/down primers) cloned into pCR2.1-TOPO vector Jantama et al., 2008b pLOI4281 Sma I /Sfo I digested cat-sacB cassette from pLOI4162 cloned into the PCR amplified inside-out product from pLOI4280 (using aspC 1/2 primers) Jantama et al., 2008b pLOI4282 PCR fragment amplified insi de-out product from pLOI4280 (using aspC 1/2 primers), kinase treated, then self-ligated Jantama et al., 2008b pLOI4283 bla kan; sfcA (PCR) from E.coli C (using sfcA up/down primers) cloned into p CR2.1-TOPO vector Jantama et al., 2008b pLOI4284 Sma I /Sfo I digested cat-sacB cassette from pLOI4162 cloned into the PCR amplified inside-out product from pLOI4283 (using sfcA 1/2 primers) Jantama et al., 2008b pLOI4285 Pac I digestion of pLOI4284, then self-ligated Jantama et al., 2008b pLOI4413 bla kan; ychE-adhE-ychG (PCR) fr om E.coli C (using up/down adhE primers) cloned into pCR2.1-TOPO vector Jantama et al., 2008b pLOI4419 PCR fragment amplified in side-out product from pLOI4413 (IOadhE up/down using primers), kinase treated, then self-ligated Jantama et al., 2008b pLOI4415 bla kan; ycaO-focA-pflB-pflA (PCR) from E.coli C (using up focA /Mid pflA primers) cloned into pCR2.1-TOPO vector Jantama et al., 2008b pLOI4421 PCR fragment amplified inside -out product from pLOI4415 (using IOycaO up/IO-mid pflB down primers), kinase treated then self-ligated Jantama et al., 2008b

PAGE 100

100Table 5-1. ( Continued ) Relevant Characteristics Sources pLOI4430 bla kan; hslJ-ldhA-ydbH (PCR) from E.coli C (using ldhA A/C primers) cloned into pCR2.1-TOPO vector Jantama et al., 2008b pLOI4432 PCR fragment amplified inside -out product from pLOI4424 (using IOldhA up/down primers), kinase treated, then self-ligated Jantama et al., 2008b pLOI4515 bla kan; tdcG-tdcFED-tdcC (PCR) from E.coli C (using tdcDE up/down primers) cloned into pCR2.1-TOPO vector This study pLOI4516 Sma I /Sfo I digested cat-sacB cassette from pLOI4162 cloned into the PCR amplified inside-out product from pLOI4515 (using tdcDE F7/R7 primers) This study pLOI4517 PCR fragment amplified insi de-out product from pLOI415 (using tdcDE F7/R7 primers), kinase treated, then self-ligated This study pLOI4629 bla kan; citF (PCR) from E.coli C (using citF up2/down2 primers) cloned into pC R2.1-TOPO vector Jantama et al., 2008b pLOI4630 Sma I /Sfo I digested cat-sacB cassette from pLOI4162 cloned into the PCR amplified inside-out product from pLOI4629 (using citF 2/3 primers) Jantama et al., 2008b pLOI4631 Pac I digestion of pLOI4630, then self-ligated Jantama et al., 2008b pLOI4710 bla kan; pta-ackA (PCR) from E.coli C (using ackA up/ pta down primers) cloned into pCR2.1-TOPO vector Jantama et al., 2008b pLOI4711 Sma I /Sfo I digested cat-sacB cassette from pLOI4162 cloned into the PCR amplified inside-out product from pLOI4710 (using ackA2/pta2 primers) Jantama et al., 2008b pLOI4712 Pac I digestion of pLOI4711, then self-ligated Jantama et al., 2008b Primer sets JM ackA-F1/R1 5GCCTGAAGGCCTAAGTAGTA3 5GCACGATAGTCGTAGTCTGA3 Jantama et al., 2008b JMackAup1/ down1 5GTTGAGCGCTTCGCTGTGAG3 5GCCGCAATGGTTCGTGAACT3 Jantama et al., 2008b JMcatsacBup3/ down3 5CTCACCTCGAGTGTGACGGAAGATCACTTCG3 5GTGCAGGATCCATCAAAGGGAAAACTGTCCATAT3 Jantama et al., 2008b WM adhE A/C 5ATGGCTGTTACTAATGTCGCTGAACTTAAC GCACTCGTAGAGCGTCGGCACGTAAGAGGTTCCAA 3 5TTAAGCGGATTTTTTCGCTTTTTTCTCAGCTTTAG CCGGAGCAGCACACTGCTTCCGGTAGTCAA 3 This study

PAGE 101

101Table 5-1. ( Continued ) Relevant Characteristics Sources WM ldhA A/C 5ATGAAACTCGCCGTTTATAGCACAAAACAGTACGACAAGAAGTACGGCACGTAAGAGGTTCCAA 3 5TTAAACCAGTTCGTTCGGGCAGGTTTCGCC TTTTTCCAGATTGCTACACTGCTTCCGGTAGTCAA 3 This study WM pflB A/C 5TTACTCCGTATTTGCATAAAAACCATGCGAGTTACGGGCCTATAACGGCACGTAAGAGGTTCCAA 3 5TTACATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGCTGTTCTACACTGCTTCCGGTAGTCAA 3 This study tdcDE up/down 5CGCCGACAGAGTAATAGGTT3 5TGATGAGCTACCTGGTATGG3 This study tdcDE F7/R7 5CGATGCGGTGGCCAATTAAG3 5GACGACGTGCTGGATTACGA3 This study citF up2/down2 5GGGTATTCAGGCGTTCGATA3 5GCCCGAGAGGATGACTATGT3 Jantama et al., 2008b citF 2/3 5GGTGATCGATGTTGTGCATC3 5CCCGTTCTTGTCGTTGAGAT3 Jantama et al., 2008b Up/downadhE 5CCGCTGTCTGATAACTGGTC3 5GCATAAGCGGATGGTCACTG3 This study IOadhE up/down 5GCTGCTCCGGCTAAAGCTGA3 5ACGCTCTACGAGTGCGTTAA3 This study upfocA /Mid pflA 5AGATCGCCAGCCGCTGCAAT3 5AACCGTTGGTGTCCAGACAG3 This study IO-ycaO up/IOmid pflB down 5GCCTACATTGCGTAGGCTAT3 5GCAGCAGGACGTTATTACTC3 This study ldhA A/C 5ATGAAACTCGCCGTTTATAG3 5TTAAACCAGTTCGTTGCCC3 This study IO-ldhA up/down 5CGTTCGATCCGTATCCAAGT3 5AGGCTGGAACTCGGACTACT3 This study aspC up/down 5 TCCATCGCTTACACCAAATC3 5TGGGGGATGACGTGATATTT3 Jantama et al., 2008b aspC 1/2 5 AGATAACATGGCTCCGCTGT3 5AGGAGCGGCGGTAATGTTC3 Jantama et al., 2008b sfcAup/down 5CTATGCTTGATCGGCAACCT3 5ACGATCGCCTGGTTTTAATG3 Jantama et al., 2008b sfcA1/2 5TACCGCCGTACCTCCATCTA3 5CGTAAGGGATATAAAGCGAACG3 Jantama et al., 2008b ackA up/ pta down 5CGGGACAACGTTCAAAACAT3 5ATTGCCCATCTTCTTGTTGG3 Jantama et al., 2008b

PAGE 102

102Table 5-1. ( Continued ) Relevant Characteristics Sources ackA 2/ pta 2 5AACTACCGCAGTTCAGAACCA3 5TCTGAACACCGGTAACACCA3 Jantama et al., 2008b

PAGE 103

103 To remove the FRT site in the adhE region, hybrid primers (WM adhE A/C) for adhE::FRT target region were designed to contain approximately 50 bp of homology to the 5 and 3 regions of adhE::FRT site and 20 bp corresponding to cat-sacB gene from pLOI4151. These primers were used for PCR amplification of the cat-sacB cassette using pLOI4151 as a template. The resulting PCR product was used to replace the FRT site in adhE region with a cat-sacB cassette by a double-crossover, homologous recombination event with selection for resistance to chlorampheni col, to produce TG200. The adhE gene and surrounding sequen ce were amplified from E. coli ATCC 8739 using up/down adhE primers. The PCR product containing ych Eadh E- ych G (3.44 kb) was cloned into pCR2.1-TOPO, yielding pLOI4413. A second set of primers (IOadhE up/down) was used to amplify the inside-out product with pLOI4413 as a template and Pfu polymerase to yield a bluntended product in which a 2.6 kbp internal segment of adhE sequence was deleted. This insideout PCR product was kinase-treated and self-l igated, resulting in pLOI4419. The PCR product amplified from pLOI4419 (up/down adhE primers) was used to replace the cat-sacB cassette in TG200 with the desired chromosomal sequence by another double, homologous recombination event, with sucrose selection for loss of sacB The resulting strain was designated TG201 (KJ079 with the FRT removed from adhE region). The FRT sites in the ldhA and ( focA-pflB ) regions were removed in a manner analogous to that used to delete the adhE ::FRT site. Additional primer sets ( ldhA A/C and IOldhA up/down) used to remove the FRT site in ldhA are included in Table 5-1 together with the corresponding plasmids (pLOI4430 and pLOI4432) Strain TG202 was produced by replacing this region in TG201 with the PCR product from pLOI4151 (WMldhA A/C primers). The cat-

PAGE 104

104 sacB cassette in TG202 was replaced with the PCR product from pLOI4432 ( ldhA A/C primers) with sucrose selection for loss of sacB to produce TG203. Primer sets (upfocA /Mid pflA and IOycaO up/IO-midpflA down) and corresponding plasmids (pLOI4415 and pLOI4421) used to remove the FRT site in ( focA-pflB ) are included in Table 5-1. Strain TG204 was produced by replac ing this region in TG203 with the PCR product from pLOI4151 (WM pflB A/C primers). The cat-sacB cassette in TG204 was replaced with the PCR product from pLOI4421 (up focA/ Mid pflA primers) with sucrose selection for loss of sacB to produce KJ091. KJ091 is a derivative of KJ073 in which all FRT sites have been removed from the adhE ldhA and ( focA-pflB ) regions of the chromosome. The transformation efficiency of the cat-sacB fragment into E. coli was approximately 100 colonies per g DNA. More than 90% of recombinants selected for chloramphenicol resistance were sensitive to sucrose. After the second recombination and selection with sucrose, greater than 90% of colonies were of the de sired genotype (chloramphenmicol sensitive and insensitive to sucrose). Construction of Gene Deletions in tdcDE and aspC The tdcDE gene and neighboring 1000 bp regions ( tdcG-tdcFED-tdcC 5325 bp) were amplified using tdcDE up/down primers and cloned into the pCR2.1-TOPO vector to produce plasmid pLOI4515. To facilitate the sequential deletion of chromosomal DNA, plasmid pLOI4162 was constructed with a removable cat-sacB cassette and the option to include an 18-bp segment (5GCCTAATTAATTAATCCC3) of synthetic DNA with stop codons in all reading frames. This plasmid is composed of synthetic seque nces and parts of plasmids pLOI2228 (MartinezMorales et al., 1999), pLOI2511 (Underwood et al., 2002), and pEL04 (Lee et al., 2001;

PAGE 105

105 Thomason et al., 2005). The construction detail s of pLOI4162 were pr eviously described (Jantama et al., 2008b). The sequence of pLOI 4162 is accessible from Genbank with an accession number of EU531506. A 1000-fold diluted preparation of pLOI4515 D NA served as a template for inside-out amplification using the tdcDE F7/R7 primers (both primers within the tdcDE gene and facing outward). The resulting 6861 bp fragment containi ng the replicon was ligated to the amplified, Sma I /Sfo I-digested cat-sacB cassette from pLOI4162 (JM catsacB up3/down3 primers) to produce pLOI4516. This 6861 bp fragment was also used to construct a second plasmid, pLOI4517 (kinase treated, self -ligation) containing a deletion of tcdD and tdcE The PCR fragments amplified from pLOI4516 and pLOI4517 ( tdcDE up/down primers) were used to replace tdcDE region in KJ091. The resulting clones were tested for loss of ampicillin and chloramphenicol resistance and designated KJ098. The aspC gene was deleted from KJ104 in a manner analogous to that used to delete the tdcDE gene. Additional primer sets ( aspC up/down and aspC 1/2) used to construct the aspC deletion are included in Table 5-1 together with the corresponding plasmids (pLOI4280, pLOI4281, and pLOI4282). The resulting strain was designated KJ110. Neither KJ098, nor KJ110 contain any intervening sequence within the respective deleted regions ( tdcDE and aspC ). Removal of FRT Site in ackA Region and Construction of citF sfcA and pta-ackA Gene Deletions To eliminate the FRT site in the ackA region of KJ073, plasmids containing sequences of the desired mutation were constructed prev iously (Jantama et al., 2008b). Briefly, E. coli ATCC 8739 genomic DNA was used as the template for PCR amplification of ackA with the JM ackA F1/R1 primers that bind approximately 200 bp upstream and downstream of the ackA gene. The linear product was cloned into pCR2 .1-TOPO (Invitrogen, Carlsbad, CA) to produce

PAGE 106

106 pLOI4158. Plasmid pLOI4158 was then used as a template for inside-out PCR with JM ackA up1/down1 primers and Pfu polymerase to yield a blunt-e nded product that lacks an 808bp internal segment of ackA The Pac I-flanked cat sacB cassette ( Sma I/ Sfo I fragment from pLOI4162) was then ligated into the blunt PCR product to produce pLOI4159. Plasmid pLOI4159 served as a template for PCR amplification (JM ackA F1/R1 primers). This PCR product was used to repla ce the FRT site in the ackA region of KJ073 by double-crossover homologous recombination, with selection for ch roramphenicol resistance. The resulting clone was designated KJ076. Plasmid pLOI4159 was also digested with Pac I to remove the cat-sacB cassette and selfligated to produce pLOI4160, retaining the 18-bp translational stop sequence. Plasmid pLOI4160 served as a PCR template (JM ackA F1/R1 primers). This amplified fragment was used to replace the cat-sacB cassette in KJ076 by double-crossover hom ologous recombination with selection for loss of sacB After removal of pKD46 by growth at el evated temperature, the resulting strain was designated KJ079. In this strain, the deleted region has been replaced by the 18-bp translational stop sequence. The strategy used above to remove the FRT site from the ackA region was employed to make sequential deletions of citF sfcA and pta-ackA and to replace the deleted regions with the 18-bp translational stop sequence. Additional primer sets ( citF up2/down2 and citF 2/3) used to construct the citF deletion are included in Table 5-1 t ogether with the co rresponding plasmids (pLOI4629, pLOI4630, and pLOI4631). The re sulting strain wa s designated KJ104. The sfcA gene was deleted from strains KJ104 and KJ110, resulting in strains designated KJ119 and KJ122, respectively. Additional primer sets ( sfcA up/down and sfcA 1/2) used to

PAGE 107

107 construct the sfcA deletions are included in Table 5-1 together with the corresponding plasmids (pLOI4283, pLOI4284, and pLOI4285). The pta-ackA operon (including the synt hetic translational stop sequence) was deleted from KJ122 to produce strain KJ134. Additional primer sets ( ackA up/ pta down and ackA 2/ pta 2) used to construct this deletion are included in Table 5-1 together with the corresponding plasmids (pLOI4710, pLOI4711, and pLOI4712). St rain KJ134 does not c ontain any FRT sites or foreign genes. Fermentations Seed cultures and fermentati ons were incubated at 37 C (100 rpm) in AM1 mineral salts medium (Martinez et al., 2007) containing 10%(w/v) glucose (555 mM), 100 mM KHCO3, and 1 mM betaine HCl. A mixture of 3M K2CO3 and 6N KOH was added to maintain pH and supply CO2. Differences in base composition (mixtures of 1:1, 4:1, 6:1) had little effect on fermentation. Fermentations were carried out in ve ssels with a working volume of 350 ml. Fermentations were inoculated at an initial OD550 of 0.01 (3.3 mg CDW/l) unless indicated otherwise. Fermentation vessels we re sealed except for a 16-gauge needle that served as a vent and a port for sample removal. Anaerobiosis was rapidly achieved during growth. Added bicarbonate served to ensure an atmosphere of CO2. Analyses Cell mass was estimated from the optical density at 550 nm (OD 1.0 = 333 mg of CDW/l) by using a Bausch Lomb Spectronic 70 spectrophotom eter. Organic acids and sugars were determined by using high performance li quid chromatography (Grabar et al., 2006).

PAGE 108

108Results and Discussion Elimination of FRT Sites in KJ073 to Produce KJ091 The central anaerobic fermentation genes in E. coli ATCC 8739 wild type were sequentially deleted (Jantama et al., 2008a) us ing the method of Datsenko and Wanner (2000) with PCR products and removable antibiotic markers (FRT recognition sites and FLP recombinase). These constructions, in combination w ith metabolic evolution, were used to select mutant strains in which both gr owth and succinate production we re increased (Jantama et al., 2008a). The resulting strain KJ073 (Figure 5-1) produced 1.2 mole of succinate per mole of metabolized glucose (Jantama et al., 2008a). However, the deletion methods used for these constructions also left a single 82 to 85 bp genetic scar (FRT site ) in the region of each deleted gene ( ackA, ldhA, adhE, focA-pflB ). These FRT sites served as recognition sites for FLP recombinase (Storici et al., 1999) during removal of the antibiotic gene. Accumulation of these FRT sites in the chromosome significantly complicated further gene deletions. Prior to further strain improvements, all FR T sites in KJ073 were replaced with native DNA containing the desired deleti on (Grabar et al., 2006; Zhang et al., 2007; Jantama et al., 2008a). The resulting strain, KJ091, contains specific deletions in ackA, ldhA, adhE, focA-pflB, mgsA, and poxB and lacks all FRT sites. Production of succinate and co-products by strain KJ091 were equivalent to those of KJ073 (Table 5-2). Strain KJ091 was used as the parent for further improvements in succinate production (Figure 5-1). Deletion of tdcD and tdcE Decreased Acetate Production During the anaerobic fermentati on of glucose by unmodified E. coli (Figure 5-2), pyruvate formate-lyase ( pflB ) serves as the primary source of acetyl~CoA, precursor of acetyl~P (Karp et al., 2007; Kessler and Knappe, 1996). Acetyl~P is conve rted to acetate primarily by acetate kinase (ackA ). The abundance of acetate as a fe rmentation product in strains KJ073 and

PAGE 109

109 KJ091 was surprising since these strains contain deletions in both ackA and pflB (Figure 5-2). Acetate production increased durin g growth-based selection (Jan tama et al., 2008a) consistent with the mutational activation of alternative pathways th at increase the production of acetyl~CoA, acetyl~P, and the yield of ATP (Fig ure 5-2 and 5-3). Elimination of acetate production represented a further oppor tunity to redirect metabolism and improve succinate yield. Figure 5-1. Strain constructions. A propionate kinase with acetate ki nase activity is encoded by the tdcD gene (Figure 53), but is typically produced only for the degradation of threonine (Hesslinger et al., 1998; Reed et al., 2003). During anaerobic growth w ith 10%(w/v) glucose, expression of tdcD could functionally replace ackA increasing the production of AT P and acetate from acetyl~P and providing a competitive growth advantage. The adjacent tdcE gene in the same operon is similar to pflB and encodes a -ketobutyrate formate-lyase (Hessl inger et al., 1998) with pyruvate formate-lyase activity. It is possible that increased expression of tdcE during anaerobic growth with 10% (w/v) glucose could in crease the production of acetyl~C oA (immediate precursor of acetyl~P) and waste potential reductant as form ate (Figure 5-3). To test this hypothesis, tdcD and tdcE (adjacent genes) were simultaneously deleted from KJ091 to produce KJ098. Deletion of

PAGE 110

110 these two genes reduced acetate production by 42 % and increased succinate yield by 10% in KJ098 in comparison to KJ091, establishing the importance of this unexpected pathway in diverting carbon flow away from succinate (Table 5-2). Surprisingly, th e production of malate by KJ091 was also eliminated as a result of the ne w deletion in KJ098. The level of pyruvate in the broth (KJ098) also declined by 40%, an intermed iate that would be pr edicted to increase upon elimination of the alternative rout e for pyruvate metabolism provided by tdcE and tdcD Figure 5-2. Standard pathway for the anaerobic metabolism of glucose in E. coli. Solid arrows indicate reactions expected to be functional. Solid cro sses indicate dele ted genes. Boxed crosses represent key deletions used to construct initial strain for succinate production, KJ012 ( ldhA, adhE, ackA ). The dashed line represents oxidation of pyruvate to acetate by PoxB, a process th at is typically functional only under microaerophilic conditions. The dotted lines indicate reactions that are primarily associated with aerobic metabolism. Genes and enzymes: ppc phosphoenolpyruvate carboxylase; ldhA lactate dehydrogenase; pflB pyruvate formate-lyase; focA formate transporter; pta phosphate acetyltransferase; ackA, acetate kinase; adhE, alcohol dehydrogenase; pdh, pyruvate dehydroge nase complex; gltA, citrate synthase; mdh, malate dehydrogenase; fumA, fumB, and fumC, fumarase isozymes; frdABCD, fumarate reductase; fdh, formate dehydrogenase H; hyc, hydrogenase 3; icd, isocitrate dehydrogenase; acs acetyl~CoA synthetase; mgsA methylglyoxal synthase; poxB pyruvate oxidase; aldA aldehyde dehydrogenase; and aldB aldehyde dehydrogenase. The tdcE gene ( -ketobutyrate formate-lyase, homologous to pflB ) and tcdD gene (propionate ki nase, homologous to ackA ) are shown in parenthesis and are typically expressed duri ng threonine degradation.

PAGE 111

111 The mechanisms responsible for reductions in malate (a problem contaminant during succinate purification) and pyruvate resulti ng from deletions of tdcD and tdcE are unknown. As expected, a reduction in acetate was accompanied by a small increase in succinate yield. However, the decreased side product formation was accompanied by a decrease in the volumetric productivity of succinate. Figure 5-3. Expanded portion of metabolism illustra ting the pathways of additional genes that have been deleted (solid crosses) in the context of standard central metabolism. Succinate and acetate are principal produc ts (boxed) from fermentations by KJ073 and derivatives. Genes and enzymes: citDEF citrate lyase; gltA citrate synthase; aspC asparte aminotransferase; ppc phosphoenolpyruvate carboxylase; sfcA NAD+linked malic enzyme; fumA & fumB fumarase; frdABCD fumarate reductase; pykA & pykF pyruvate kinase; tdcE -ketobutyrate formate-lyase (homologue of pflB ); pta phosphate acetyltransferase; tcdD propionate kinase (homologue of ackA ). Pyruvate dehydrogenase is thought to func tion primarily during aerobic metabolism. NAD+ -linked malic enzyme (sfcA ) is thought to function primarily for decarboxylation during gluconeogenesis. Ge nes encoding pyruvate formate-lyase ( pflB ) and acetate kinase ( ackA ) have been deleted in all strains described in this study and are shown in parenthesis. Acetyl ~P is hypothesized to be converted to acetate by unspecified reactions (indicated by ?) such as the phosphorylation and desphosphorylation of proteins, sponta neous hydrolysis, and other reactions.

PAGE 112

112Citrate lyase ( citF ) Deletion Had no Effect on A cetate or Succinate Production Despite the elimination of two pathways fo r acetate production (Figure 5-2), significant amount of acetate was produced by strain KJ 098 (Table 5-2). Under anaerobic conditions, oxaloacetate is partitioned between a reduced product, malate, and a more oxidized intermediate, citrate (Figure 5-2). Citrate represents a potential source of this acetate. Citrate can be converted to oxaloacetate and acet ate by citrate lyase ( citDEF ), a mechanism proposed to recycle the intracellular oxaloacetate pool fo r other metabolic functions (Nilekani and Sivaraman 1983). Together with citrate synthase ( gltA ), these two enzymes could form a futile cycle that wastes the energy conserved in acetyl~CoA and accumulates acet ate. Citrate lyase expr ession is associated with growth on citrate as a co -substrate (Lutgens and Gottschal k, 1980; Kulla and Gottschalk, 1977) and this gene would not be expected du ring fermentations with excess glucose unless activated by mutations. Citrate lyase is a multi-enzyme complex com posed of three different polypeptide chains ( citDEF ) that are each essential for activ ity (Quentmeier et al., 1987). The citF gene was deleted from KJ098 to test the possibility that a citrate lyase futile cycl e is a primary source of acetate during glucose fermentation. Howeve r, acetate levels were essentially unchanged in the resulting strain KJ104, eliminating citrate lyas e as a primary source. Deletion of citF was accompanied by a small increase in pyruvate, but had no effect on succcinate yield (Table 5-2). Deletion of citF (KJ104) adversely affected the growth and re duced cell yield by 22% as compared to KJ098. Kulla (1983) reported that citrate lyase activity could not be completely eliminated in E. coli since it appears to serve a protec tive rather than a cat abolic purpose. High internal citrate pools resulting from citrate lyase de letion were proposed to interfere with v ital cell functions by chelating divalent cations. In addition, the accumulation of citrat e could result in an imbalance between glutamate and aspartate pool sizes during biosynthesis that may also adversely affect

PAGE 113

113 growth. Despite a reduced cell yield, succinate yield, titer, average productivity, and acetate levels with KJ104 were comparable to those with KJ098 (Table 5-2). Deleting aspC had no Effect on Succinate Yield Aspartate aminotransferase ( aspC ) is a multifunctional enzyme that catalyzes the synthesis of aspartate, phenylalanine and other compounds by transamination. In this reaction, Laspartate is synthesized from oxaloacetate (an intermediate from PEP carboxylation) by transamination with L-glutamate. Aspartate is a constituent of proteins and participates in many other biosynthetic pathways. About 27 percent of the cellular nitrog en has been estimated to flow through aspartate (Reitzer, 2004). Aspartate bi osynthesis and succinate production share a common intracellular pool of oxaloacetate (Figure 5-3). Deletion of aspC could increase succinate production by reducing carbon flow into aspartate, but ma y also create an auxotrophic requirement that would prevent anaerobic growth in minimal salts medium such as AM1. However, deletion of aspC from KJ104 to produce KJ110 had no effect on succinate yield, cell yield, or acetate (Table 5-2). Thus aspartase ( aspC ) did not appear to divert significant levels of oxaloacetate away from succinate in this strain. In KJ110, aspartate may be produced by an alternative route such as aspartate ammonia-lyase ( aspA ) using ammonia and fumarate as substrates. Deleting sfcA Had no Effect on Succinate Yield Significant amounts of pyruvate are present at the end of fermentation with KJ104 and other strains of E. coli engineered for succinate production (Tab le 5-2). This pyruvate represents an unwanted product and a further opportunity to increase succinate yield. The high level of pyruvate could result from the decarboxylation of malate to pyruvate by malic enzyme ( sfc A) as illustrated in Figure 5-1.

PAGE 114

114Table 5-2. Fermentation of 10% (w/v) glucose in mineral salts AM1 medium (1mM beta ine) by mutant strains of E. coli Succinate Yieldb Fermentation Products (mM) d,e,f Strain Culture Conditions (pH control, inoculum) Cell Yielda (g/L) mol/mol g/g Av. Vol. Prod c (g/L-h) Glucose Used (mM) Suc Mal Pyr Ace For KJ073 3M K2CO3+6N KOH (1:1) 0.01 OD550 inoculum 2.3 .1 1.20 .09 0.77 .03 0.82 .01 564 2 668 120 3 60 2 180 7 trace KJ091 3M K2CO3+6N KOH (1:1) 0.01 OD550 inoculum 2.2 .1 1.19 .02 0.78 .01 0.84 .01 576 687 109 72 155 trace KJ098 3M K2CO3+6N KOH (1:1) 0.01 OD550 inoculum 2.3 .1 1.30 .04 0.85 .02 0.79 .01 496 1 644 <1 42 88 KJ104 3M K2CO3+6N KOH (4:1) 0.01 OD550 inoculum 1.8 .1 1.31 .01 0.86 .01 0.78 .03 485 5 630 5 5 78 90 0 KJ104 3M K2CO3+6N KOH (6:1) 0.01 OD550 inoculum 1.9 .1 1.30 .01 0.85 .01 0.77 .01 482 620 3 94 81 KJ110 3M K2CO3+6N KOH (4:1) 0.01 OD550 inoculum 2.0 .1 1.28 .02 0.84 .01 0.79 0.01 500 640 0 4 76 110 1 KJ119 3M K2CO3+6N KOH (4:1) 0.01 OD550 inoculum 2.0 .1 1.29 .01 0.85 .01 0.81 .01 506 655 0 4 60 8 100 4 KJ122 3M K2CO3+6N KOH (4:1) 0.01 OD550 inoculum 2.3 .1 1.36 .02 0.89 .01 0.83 .01 500 680 0 <1 120 1 90 3 KJ122 3M K2CO3+6N KOH (6:1) 0.01 OD550 inoculum 2.0 .2 1.40 .02 0.92 .01 0.88 .04 510 8 700 0 6 59 110 KJ122 3M K2CO3+6N KOH (6:1) 0.15 OD550 inoculum 2.1 .1 1.46 .08 0.96 .05 0.84 .06 470 685 0 <1 120 3 122 KJ134 3M K2CO3+6N KOH (6:1) 0.01 OD550 inoculum 2.3 .1 1.53 .03 1.00 .02 0.75 .02 397 5 606 5 13 22 37 a Cell yield estimated from optical density (3 OD550nm = 1 g CDW/l). b Small amounts of glucose remained in some fermentations. Succi nate yields were calculated based on glucose metabolized. c Average volumetric productivity was calcu lated for total incubation time (96 h). d Abbreviations: Suc, succinate; Mal, malate; Pyr, pyruvate; Ace, acetate; Lac, lacate; For, formate. e Lactate was absent from all broths. f All data represent an average of 3 or mo re fermentations with standard deviations.

PAGE 115

115 This enzyme is thought to function primar ily during gluconeogenesis (Oh et al., 2002; Stols and Donnelly, 1997; Unden and Kleefeld, 2004) rather than during the anaerobic catabolism of 10% w/v glucose. Although reductive carboxylation of pyruvate to form malate is thermodynamically favored, the kinetic parameters of this enzyme favor the dehydrogenation and decarboxylation under physiological conditi ons (Stols and Donnelly, 1997). Over-expression of this enzyme to carboxylate py ruvate has been previously us ed to construct strains of E. coli for succinate production (Sto ls and Donnelly, 1997). If malic enzyme ( sfcA ) functions to carboxylate pyruvate in KJ104 (and related strains) and contributes to succinate production, deleti on of this gene would be expected to reduce succinate yield and increase the le vel of side products such as pyruvate. Alternatively, if malic enzyme functions to decarboxylate malate in KJ104, deletion of sfcA would be expected to increase succinate yield and decrease the leve l of pyruvate. To our surprise deletion of the sfcA gene from KJ104 to produce KJ119 had no measur able effect on succinate production, growth, or side product levels (Table 5-2) in comparison to KJ104. Thes e results clearly demonstrated that malic enzyme is unimportant for succinate production in KJ104 and related strains, in sharp contrast to the succinate-pr oducing strains developed by Stol s and Donnelly (1997) in which over expression of malic enzyme was used as the primary route for succinate production. Deleting the Combination of aspC and sfcA Improved Succinate Yield Although no significant benefits were obs erved from individual deletions of sfcA or aspC from KJ104, we proceeded to test the effect of deleting both genes in combination. The combined deletion of both sfcA and aspC (strain KJ122) resulted in an unexpected increase in succinate yield and titer with a small reduction in acetate (Table 4-2), in comparison to the parent strain KJ110 and related strains (KJ1 04 and KJ119). The combined deletion ( aspC and sfcA ) in KJ122 increased succinate yield, succinate tite r, and average productiv ity by 8%, 13%, and 14%,

PAGE 116

116 respectively as compared to KJ104. Although th e mechanism is unknown, it is possible that single deletions were ineffective because they were compensated in part by increased flow through the remaining enzyme activ ity, malic enzyme or aspartase (Figure 5-3), dampening any potential benefit. The increase in succinate yield and titer are presumed to result from increases in the availability of oxaloacetate and malate that allow a larger fraction of carbon to proceed to succinate. Strain KJ122 (Table 5-2) produced 1.4-1.5 mo l succinate per mol of glucose, 85% of the maximum theoretical yield (1.71 mol per mol gluc ose). To produce this high level of succinate and fully reduce malate, additional reductant was required. Although the source of this additional reductant is unknown, additional NAD(P)H could be provided by an increase in pyruvate flow through pyruvate dehydrogenase ( pdh ) or increased glucose me tabolism through the pentose phosphate pathway, together with the glyoxyl ate bypass. Although PDH co mplex is thought to function primarily during oxidative metabolism (Guest et al., 1989), it remains active during fermentation (de Graef et al., 1999) subject to me tabolite regulation (Kim et al., 2007). Further evidence of a functional PDH under anaerobic co nditions has been reported by Zhou et al. (2008). Strains containing deleti ons of pyruvate formate-lyase ( pflB ), lactate dehydrogenase ( ldhA ), and fumarate reductase ( frdBC ) are able to grow anaerobi cally and produce ethanol, but unable to grow after deletion of pdhR the transcriptional activator for pyruvate dehydrogenase. Increased function of pyruvate dehydrogenase would also offer an alternative route for acetyl~CoA, a potential precursor of acetate (Figure 5-2 and 5-3). Reduction in Pyruvate and Acetate by Deletion of pta Although KJ122 produced excellent succinate yields (1.4 mol/m ol glucose), acetate and pyruvate accumulated in the broth remained as a further opportunity to in crease yield. Pyruvate is presumed to accumulate from a metabolic ove rflow from glycolysis since pyruvate excretion

PAGE 117

117 was reduced during growth in lower concentrati ons of sugars (data not shown). This excess pryuvate may be partially responsible fo r promoting acetyl~CoA production by pyruvate dehydrogenase (Figure 5-3). Excess acetyl~CoA could then be converted to acetyl~P by phosphotransacetylase ( pta ). Acetyl~P could be converted to acetate by a variety of routes including phosphorylation and de phosphorylation of proteins (ene rgy depleting futile cycle), non-enzymatic hydrolysis, etc. Deletion of phosphotransacetylase ( pta ) in KJ122 to produce KJ134 reduced acetate and pyruvate accumulation with a small further increa se in succinate production (Table 5-2). These results clearly indicate that acetyl~P from phosph ate acetyltransferase is the primary source of acetate in KJ122 and is consistent with pyr uvate dehydrogenase or the pentose phosphate pathway serving as the source of acetyl~CoA. The modest level of acetate is presumed to represent an aggregate of many low flux metabolic reactions and nonenzymatic hydrolysis. Biomass remained high. Volumetric productivity declined by 17% in comparison to KJ122 but remained equivalent to that of the star ting strain for this investigation, KJ073. With this strain, large amounts of glucose remained unmetabolized after the 4-day fermentation. Conclusions The metabolism of E. coli is remarkably adaptive. While some genetic changes are obviously needed to reengineer metabolism for a product such as succin ate through examination of central metabolic pathways, additional mutations were clearly needed to achieve theoretical yields of succinate from glucose. Engineered strains initially grew very poorly (Jantama et al., 2008a). Growth appears to have been limited in part by the low ATP yield (predicted by pathways to be approximately 1 ATP per glucose), although this is quite adequate for other rapidly growing fermentative organisms such as Zymomomas mobilis Growth-based selection for improved strains such as KJ012 through KJ091 co-selected for increased efficiency of ATP

PAGE 118

118 production by increasing glycolytic flux (Jantama et al., 2008a), increasing the yield of ATP per glucose (directing more carbon flow into ac etyl~CoA, acetyl~P and acetate by recruiting pdh, pta, tdcD, tdcE ), and increasing succinate production to close the redox balance. These results clearly establish an initial ATP limitation as th e basis for growth based selection to increase succinate production. Further deletions (pta, tdcD, tdcE ) were required to eliminate alternative routes for acetate-linked ATP production. Some of the other observed improvement s in strains are not readily explained. These include the unexpected improvement observed after deletion of both aspC and sfcA when neither alone had a measurable effect. The beneficial effects of a poxB deletion during anaerobic fermentation (expected to be nonfunctional during anaerobic fermentation) and an mgsA deletion (very minor pathway) were also unanticipated (J antama et al., 2008a). With the deletion of pflB, tdcD, tdcE, and adhE obvious routes to acetate have been removed (Figure 5-2 and 5-3). Yet significant levels of acetate persis ted in strain KJ122. Deletion of pta encoding phosphate acetyltransferase was required to reduce the pr oduction of this undesirable co-product. The remaining pathway for acetate production fr om acetyl~P is unknown but could involve phosphorylation and dephosphorylat ion, non-enzymatic hydrolysis, pentose phosphate pathway, or others. The E. coli chromosome contains a large reservoi r of genes with diverse capabilities. Although activities have been described for most of these gene s, these vastly under estimate the catalytic potential of existing enzymes and the expanded range of activities that could be developed by relatively small mutational changes in structure or regulation. It is likely that some of the changes observed in this study such as the functional replacement of acetate kinase by the tdcD product (propionate kinase) an d pyruvate formate-lyase by the tdcE product ( -ketobutyrate

PAGE 119

119 formate-lyase) have resulted from a regulatory mutation since both are within the same operon. Increased function of pyruvate dehydrogenase under anaerobic c onditions has been previously described as a structural mutati on that reduces the extent of ac tivity inhibition by NADH (Kim et al., 2007). This enzyme is a likely source of the additional NADH required for redox balance when succinate yields exceed 1.0 mol/mol glucose. A similar mutation may have occurred during the development of KJ073 and derivatives. Alternatively, highe r pyruvate dehydrogenase activity would be expected if NADH pools were reduced by high flux to succinate. The development of KJ134 for the production of succinat e at near theoretical yields during simple batch fermentations without complex nutrients represents an importa nt step toward the development of bio-based succinic acid as a platform chemical for renewable products.

PAGE 120

120 CHAPTER 6 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS General Accomplishments Derivatives of E. coli ATCC 8739 were engineered to prod uce either succinate or malate as the major product in mineral salts media usin g simple fermentations (anaerobic stirred batch with pH control) without the addition of pl asmids or foreign genes. This was done by a combination of gene deletions (genetic engine ering) and metabolic e volution with over 2000 generations of growth-based selection. After deletion of other fermentation genes ( ldhA adhE ackA ), the pathway for malate and succinate pro duction remained as the primary route for the regeneration of NAD+. Under anaerobic conditions, ATP pr oduction for growth was obligately coupled to malate dehydrogenase and fumarate reductase activities by the requirement for NADH oxidation. Selecting strains for improved gr owth co-selected for in creased production of succinate or malate. Additional deletions were introduced as further improvements ( focA, pflB, poxB, mgsA ). The best succinate biocatalysts, strains KJ060 ( ldhA adhE ackA focA, pflB ) and KJ073 ( ldhA adhE ackA focA, pflB, mgsA, poxB ), produce 622-733 mmol of succinate with molar yields of 1.2 to 1.6 per mole of metabolized glucose. The best malate biocatalyst, strain KJ071 ( ldhA adhE ackA focA, pflB, mgsA ), produced 516 mM malate with molar yields of 1.4 per mole of glucose metabolized. We attempted to reduce the fermentation time for succinate production by using high inocula. Although, high inocula increased succ inate yield per mole of glucose, average fermentation rates were lower than with lower inocula. Supplementation with acetate increased the yield of succinate and succinate productivy. Supplementation wi th yeast extract and peptone also increased the rate of sugar metabolism by increasing cell yield.

PAGE 121

121 Metabolic flux analysis (MFA) shows that the specific succinate production rate was highest during exponential growth This is in agreement w ith the increase in the NADH production rate from the activity of the pyruvate dehydrogenase (PDH) complex. This NADH is mused for the reduction of fumarate to succinate, and redox balance is acheived. The cell yields (YATP) calculated were lower than the maximum theoretical cell yield (YATP MAX) in wild type and KJ017 due to energy uncoupling in which AT P produced from the fermentation process was used for cellular maintenance rather than for bios ynthesis. However, the values for the strains without PFLB and ACKA (KJ060, KJ071, a nd KJ073) are considerably higher than YATP MAX. A probable explanation is that mo re ATP was generated than our flux analysis indicates. A probable explanation is that mo re ATP was generated than our flux analysis indicates. KJ073 has been further improved by removi ng residual FLP recombinase sites (FRT sites) from the chromosomal regions of gene dele tions to create a strain devoid of foreign DNA, strain KJ091 ( ldhA adhE ackA ( focA pflB ) mgsA poxB ). KJ091 was further engineered for improvements in succinate production by el iminating acetate, malate, and pyruvate as significant co-products. Deletion of the propionate kinase ( tdcD ; acetate kinase homologue) and -ketobutyrate formate-lyase ( tdcE ; pyruvate formate-lyase ho mologue) genes reduced the acetate level by 50% and increased succinate yiel d (1.3 mol/mol glucose) by almost 10%, as compared to KJ091 and KJ073. Deletion of two genes encoding enzymes involved in oxaloacetate metabolism, aspartate aminotransferase (aspC ) and the NAD+-linked malic enzyme ( sfcA ) (KJ122) significantly in creased succinate yield (1.5 mol/m ol glucose), succinate titer (700 mM), and average volumetric productivity (0.9 g/l/h). Residual pyruvate and acetate levels were substantially decreased by deletion of pta encoding phosphotransacetylase, to produce KJ134 ( ldhA adhE ( focA pflB ) mgsA poxB tdcDE citF aspC sfcA ( pta-ackA )). Strains

PAGE 122

122 KJ122 and KJ134 produced near theoretical yields of succinate during simple, anaerobic, batch fermentations using mineral salts medium. Both may be useful as biocatalys ts for the commercial production of succinate. Future Works A primary technology for use of succinic acid is selective reduction to produce the wellknown butanediol (BDO), tetrahydrofuran (THF) a nd gamma-butyrolactone (GBL) families. The hydrogenation/reduction chemistry for the conversi on of succinic acid to this family of compounds is well established and is similar to the conversion of maleic anhydride to the same families of compounds (Werpy et al., 2004). For th is application, product purity must be taken into consideration during the development of strains because impurities from the fermentation might otherwise affect or inhibit the subsequent hydroge nation/reduction process. Significant improvement in fermentative succ inate production, including further strain development and process engineering is required for it to be competitive with the petrochemical production routes. Productivity improvements are required to reduce the capital and operation costs of the fermentation. A minimum productivity of 2.5 g/l-h has been proposed for the process needs (Werpy et al., 2004). A final titer is also important when considering overall process costs in which a high final titer will reduce overall separation and concentrating costs. In an ideal process, the fermentation would be performed at low pH, without requiring any neutralization. The cost of neutralizatio n is not necessarily cost prohibitive, but the conversion of the salt to the free acid does add significant costs. Metabolic e volution offers an excellent way to select for improved strains that produce su ccinate with higher titers, yi elds, and the productivities, and tolerate acidic conditions. The exact pathway for gl ucose transport in which the strains are used to import glucose into the cells is yet to be elucidated. A better understanding of what mechanism the strains use for glucose transport and of how the strains metabolize glucose would

PAGE 123

123 allow us to engineer the strain s for higher rates of glucose cata bolism, resulting in increases in succinate productivities. The inhibition or toxicity from products accumulated during fermentation has to be removed. The high levels of accumulated succinat e and acetate are likely to inhibit the glucose consumption and harm the cells. Product removal from the culture media is challenging. The use of base neutralization by simultaneously ge nerating carbon dioxide a nd forming precipitated succinate salts would be one me thod to reduce the inhibitory effects of accumulated products. However, the type and concentration of base, and time of neutralization would need to be extensively studied in order to improve the process development. Future use of Succinate as Bioplastics The synthesis of polymers based on monome rs from renewable feedstock is rapidly growing since the global environmen t issue and the rapid depletion of the oil reserves have been extensively concerned. Renewable monomers with a large functional diversity are available from a wide range of resources (Noordover et al., 2006 ). An active research using succinate as a renewable monomers substrate is also in progress for the syntheses, structures, physical properties, and degradation of biodegradable aliphatic polyeste rs (Kuwabara et al., 2002). Poly(butylene succinate) (PBS) is one of the most promising polyesters, and its good biodegradability in the natural environment has been reported (Tokiwa and Suzuki, 1977). PBS and related copolymers have been used as enviro nmentally biodegradable thermoplastics, as well as bioabsorable/biocompatible medical materials since they have useful mechanical properties due to their high molecular weight (Azim et al., 2006). Moreover, random copolymers such as poly(butylene succinateco -butylene adipate), poly(butylene succinateco -ethylene succinate), and poly(butylene succinateco -hexamethylene succinate) have been also developed to control the physical properties and the speed of biodegradati on (Gan et al., 2001).

PAGE 124

124 Poly(propylene succinate) (PPS ) is a relatively new biodegrad able polymer that is also produced using monomers from renewable resources (Hartlep et al., 2002; Kim et al., 2004). PPS has gained increasing interest, since it exhibits a highest biodegradation rate compared to that of PBS, poly(ethylene succinate), poly(propylene se bacate), and other biodegradable polymers due to its low crystallinity (Bik iaris et al., 2006; Umare et al ., 2007). However, PPS has low mechanical properties that limit its applications. The applications of biodegradable polymers including PBS, PPS, and their copolymers, have been also found in biomedical fields such as for constructing absorbable bone plates, other surgical fixation devices, surgical sutures, and controlled release drug carriers (Song and Sung, 1995). The biocompatibility, toxicity, and immunogeni city, desirable mechanical properties, and predictable biodegradation rate of polymers are currently studied and developed. As seen, succinate based polymers have a wide variety of applications. The demands for succinate are rapidly increasing. Production of succinate fe rmentatively, including strain developments, process design, and downstream purification procedures would be further extensively developed in order to supply a good source of succinate to its growing market.

PAGE 125

125 LIST OF REFERENCES Abbott BJ, Clam an, A. 1973. The relationship of substrate, growth rate, and maintenace coefficient to single cell protein pr oduction. Biotechnol Bioeng 15:117-127. Abdel-Hamid AM, Attwood MM, Guest JR. 2001. Pyruvate oxidase cont ributes to the aerobic growth efficiency of Escherichia coli Microbiol 147:1483-1498. Ahmed I, Morris D. 1994. Replacing petrochemical with biochemicals. Institute for Local Reliance, Washington, DC. Ajl SJ, Werkman CH. 1948. Enzymatic fixation of carbon dioxide in -ketoglutaric acid. Proc Natl Acad Sci USA 34:491-498. Andersen KB, von Meyerburg K. 1980. Are growth rates of Escherichia coli in batch cultures limited by respiration? J Bacteriol 144:114-123. Andersson C, Hodge D, Berglund KA, Rova U. 2007. Effect of different carbon sources on the production of succinic acid usi ng metabolically engineered Escherichia coli Biotechnol Prog 23(2):381-388. Anastas P, Warner J. 1998. Green Chemistry: Theory and Practice. London, UK: Oxford University Press. Aristidou AA. 1994. Application of Metabolic and Biochemical Engineering Techniques for the Enhancement of Recombinan t Protein Production in Escherichia coli. Ph.D. Thesis, Department of Chemical Engineerin g, Rice University, Houston, TX. Aristidou AA, San KY, Bennett GN. 1995. Metabolic engineering of Escherichia coli to enhance recombinant protein production through acetat e reduction. Biotechnol Prog 11: 475-478. Aristidou AA, San KY, Bennett GN. 1999. Metabolic flux analysis of Escherichia coli expressing the Bacillus subtilis acetolactate synthase in ba tch and continuous cultures. Biotechnol Bioe ng 63(6):737-749. Asghari A, Bothast RJ, Doran JB, I ngram LO. 1996. Ethanol production from hemicellulose hydrolysates of agricultural residues us ing genetically engineered Escherichia coli strain KO11. J Industrial Microbiol 16:42-47. Azim H, Dekhterman A, Jiang Z, Gross RA. 2006. Candida antarctica lipase B-catalyzed synthesis of Poly(butylenes succinate): shorter chain building blocks also work. Biomacromolecules 7:3093-3097. Bauchop T. and Elsden SR. 1960. The growth of microorganisms in relation to their energy supply. J Gen Microbiol 23:457-469.

PAGE 126

126 Bergen WG, Bates DB. 1984. Ionorphores: their effect on producti on efficiency and mode of action. J Anim Sci 58:1456-1483. Bikiaris DN, Papageorgiou GZ, Achilias DS. 2006. Synthesis and comparative biodegradability studies of three Poly(alkylene succin ate)s. Polym Degrad Stab 91:31-43. Breuer M, Ditrich K, Habicher T, Hauer B, Kesse ler M, Stuermer R, Zelinski T. 2004. Industrial methods for the production of optically active intermediate s. Angew Chem Int Ed 43:788. Bryant MP, Small N. 1956. Characteristics of two ne w genera of anaerobic curved rods isolated from the rumen of cattle. J Bacteriol 72:22-26. Bryant MP, Bouma C, Chu H. 1958. Bacteroides ruminicola n. sp. And the new species Succinomanas amylolytica Species of succinic acid produci ng anaerobic bacteria by the bovine rumen. J Bacteriol 76:15-23. CaJacob C, Gavino GR, Frey PA. 1985. Pyruvate dehydrogenase complex of Escherichia coli : Thiamin pyrophosphate and NADH-dependent h ydrolysis of acetyl~CoA. J Biol Chem 260(27):14610-14615. Causey TB, Zhou S, Shanmugam KT, Ingram LO. 2003. Engineering the metabolism of Escherichia coli W3110 for the conversion of sugar to redox-neutral and oxidized products. Homoacetate production. Pr oc Natl Acad Sci USA 81:4348-4352. Causey TB, Shanmugam KT, Yomano LP, Ingram LO. 2004. Engineering Escherichia coli for efficient conversion of glucose to pyr uvate. Proc Natl Acad Sci USA 101:2235-2240. Cecchini G, Schroder I, Gunsalus RP, Maklas hima E. 2002. Succinate dehydrogenase and fumarate reductase from Escherichia coli Biochimica et Biophysi ca Acta 1553:140-157. Chang YY, Cronan JE Jr. 2000. Conversion of Escherichia coli pyruvate decarboxylase to an alpha-ketobutyrate oxidase. Biochem J 352:717-724. Chao YP, Liao JC. 1994. Metabolic respons es to substrate futile cycling in Escherichia coli J Biol Chem 269:5122-5126. Chatterjee R, Cynthia SM, Kathleen C, Da vid PC, Donnelly MI. 2001. Mutation of the ptsG gene results in increased production of succinate in fermentation of glucose by Escherichia coli Appl Environ Microbiol 67:148-154. Clark, DP. 1989. The fermentation pathways of Escherichia coli FEMS Microbiol Rev 63:223234. Cortay JC, Bleicher F, Duclos B, Cenatiempo Y, Gautier GC, Prato JL, and Cozzone AJ. 1984. Utilization of acetate in Escherichia coli : structural organization and differential expression of the ace operon. Biochemie 71:1043-1049.

PAGE 127

127 Cox SJ, Shalel LS, Sanchez AM, Lin H, Peercy B, Bennett GN, San KY. 2006. Development of a metabolic network design and optimiza tion framework incorporating implement constraints: A succina te production case study. Metab Eng 8:46-57. Curtis SJ, Epstein W. 1975. Phosphorylation of Dglucose in Escherichia coli mutants defective in glucosephosphotransferase, mannosephosphotransferase, and glucokinase. J Bacteriol 122:1189-1199. de Graef MR, Alexeeva S, Snoep JL, de Mattos MJ. 1999. The steady-state internal redox state (NADH/NAD) reflects the external redox state a nd is correlate d with catabolic adaptation in Escherichia coli J Bacteriol 181:2351-2357. Dake S, Gholap RV, Chaudhuri RV. 1987. Carbonylation of 1,4butanediol diacetate using rhodium complex catalyst: a kinetic study. Ind Eng Chem Res 26:1513-1518. Datsenko KA, Wanner BL. 2000. One-step in activation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640-6645. Davis CP, Cleven D, Brown J, Balish E. 1976. Anaerobiosprillium a new genus of spiral-shaped bacteria. Int J Syst Bacteriol 26:498-504. Doelle HW, Hollywood N. 1976. Effect of specifi c growth rate and gluc ose concentration on growth and glucose metabolism of Escherichia coli K-12. Microbiol 17: 23-33. Donnelly MI, Millard CS, Clark DP, Chen MJ, Ra thke JW. 1998. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid, and ethanol. Appl Biochem Biot echnol 70:187-198. Du C, Lin SK, Koutinas A, Wang R, Webb C. 2007. Succinic acid produc tion from wheat using a biorefining strategy. Appl Microbiol Biot echnol 76(6):1263-1270. el-Mansi EM, Holms WH. 1989. Control of carbon flux to acetate excretion during growth of Escherichia coli in batch and continuous cultures. J Gen Microbiol 135:2875-2883. Egyud LG, Szent-Gyorgyi A. 1966. On the regula tion of cell division. Proc Natl Acad Sci USA 56:203-207. Farmer WR, Liao JC. 1997. Reduction of aerobic acetate production by Escherichia coli Appl Environ Microbiol 63:3205-3210. Fraenkel DG. 1996. Chapter 14, Glycolysis. In A. Bck, R. Curtiss III, J. B. Kaper, F. C. Neidhardt, T. Nystrm, K. E. Rudd, and C. L. Squires (ed.), EcoSal Escherichia coli and Salmonella : cellular and molecular biology. [On line.] http://www.ecosal.org. ASM Press, Washington, D.C.

PAGE 128

128 Gan Z, Abe H, Kurokawa H, Doi Y. 2001. Solid-S tate microstructures, thermal properties, and crystallization of biodegradable Poly(butyl ene succinate) (PBS) and its copolyesters. Biomacromolecules 2:605-613. Glassner DA, Datta R. 1992. Process for the pr oduction and purification of succinic acid. US Patent 5,143,834. Gokarn RR, Eiteman MA, Altman E. 2000. Metabolic analysis of Escherichia coli in the presence and absence of carboxylating enzymes phosphoenolpyruvate carboxylase and pyruvate carboxylase. Appl E nviron Microbiol 66:844-1850. Gottschalk G. 1985. Bacterial metabolis m. 2nd ed. Springer-Verlag, New York. Grabar TB, Zhou S, Shanmugam KT, Yomano LP, Ingram LO. 2006. Methylglyoxal bypass identified as source of chiral contamination in L(+) and D(-) lactate fermentations by recombinant Escherichia coli Biotechnol Lett 28:1527-1535. Guest JR, Angier SJ, Russell GC. 1989. Structure, expression, an d protein engin eering in the pyruvate dehydrogenase complex of Escherichia coli Ann NY Acad Sci 573:76-99. Guettler MV, Jain MK, Rumler D. 1996a. Method for making succinic acid, bacterial variants for use in the process, and methods of obtaining variants. US patent 5,573,931. Guettler MV, Jain MK, Soni BK. 1996b. Process for making succinic acid, microorganisms for use in the process and methods of obtaini ng the microorganisms. US patent 5,505,004 Guettler MV, Jain MK, Soni BK. 1998. Proces s for making succinic acid, microorganisms for use in the process and methods of obtaining the microorganisms. US Patent 5,723,322. Hager LP. 1957. Trypsin activation of a ferricyanide-linked pyruvic acid oxi dation. J Biol Chem 229(1):251-263. Hartlep H, Hussmann W, Prayit no N, Meynial-Salles I, Zeng AP. 2002. Study of two-stage processes for the microbial production of 1,3-propanediol fro m glucose. Appl Microbiol Biotechnol 60:60-66. Hatti-Kaul R, Tornvall U, Gustafsson L, Borj esson P. 2007. Industrial biotechnology for the production of bio-based chemical s-a cradle-to-grave perspective. Trends in Biotechnol 25(3):119-124. Hempfling WP, Mainzer SE. 1975. Effects of vary ing the carbon source limiting growth on yield and maintenance characteristics of Escherichia coli in continuous culture. J Bacteriol 123:1076-1087.

PAGE 129

129 Hesslinger C, Fairhurst SA, Sa wers G. 1998. Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L threonine to propiona te. Mol Microbiol 27(2):477-492. Hillman JD. 1979. Mutant analysis of glyceraldehyde 3-phosphate dehydrogenase in Escherichia coli Biochem J 179(1):99-107 Hopper DJ, Cooper RA. 1971. The regulation of Escherichia coli methylglyoxal synthase: a new control site in glycolysis. FEBS Lett 13:213-216. Iverson TM, Luna-Chavez C, Croal LR, Cecch ini G, Rees DC. 2002. Crystallographic studies of the Escherichia coli quinol-fumarate reductase wi th inhibitors bound to the quinol-binding site. J Biol Chem 277:16124-16130. Jain MK, Datta R, Zeikus JG. 1989. High value organic acids fermentation-emerging processes and products. In: Ghosh TK (ed) Bioprocess engineering: the first generation. Ellis Harwood, Chichester, pp 366-398. Jantama K, Haupt MJ, Svoronos SA, Zhang X, Moore JC, Shanmugam KT, Ingram LO. 2008a. Combining metabolic engineering and meta bolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate a nd malate. Biotechnol Bioeng 99(5):1140-1153. Jantama K, Zhang X, Moore JC, Svoronos SA, Shanmugam KT, Ingram LO. 2008b. Eliminating side products and increasing succ inate yields in engineered strains of Escherichia coli C. Biotechnol Bioeng. DOI10.1002/bit.22005. Jin S, Ye K, Shimizu K. 1997. Metabo lic flux distributions in recombinant Saccharomyces cerevisiae during foreign protein pr oduction. J Biotech 54:161-174. Karp PD, Keseler IM, Shearer A, Latendresse M, Krummenacker M, Paley SM, Paulsen IT, Collado-Vides J, Gamma-Castro S, Peralta-Gi l M, Santos-Zavaleta A, Penaloza-Spinola M, Bonavides-Martinez C, Ingraham J. 2007. Multidimensional annotation of Escherichia coli K-12 genome. Nucl Acids Res 35(22):7577-7590. Kessler D, Knappe J 1996. Anaerobic dissimilation of pyruvate In Neidhardt FC, Curtiss III R, Ingraham JL, Lin ECC, Low KB, Magasani k B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE, editors. Escherichia coli and Salmonella : cellular and molecular biology. ASM Press, Washington, D.C. pp 199-205. Keseler IM, Collado-Vides J, Gamma-Castro S, Ingraham J, Paley S, Paulsen IT, Peralta-Gil M, Karp PD. 2005. Ecocyc: A comprehensive database resource for Escherichia coli Nucl Acids Res 33:D334-D337.

PAGE 130

130 Kim DY, Yim SC, Lee PC Lee WG, Lee SY, Chang HN. 2004. Batch and continuous fermentation of succinic aci d from wood hydrolysate by Mannheimia succiniciproducens MBEL55E. Enzyme Microb Biotechnol 35:648-653. Kim Y, Ingram LO, and Shanmuga m KT. 2007. Construction of an Escherichia coli K-12 mutant for homoethanologenic fermentation of glucose or xylose without foreign genes. Appl Environ Micr obiol 73: 1766-1771. Kornberg HL and Malcovati M. 1973. Control of in situ of the pyruvate kinase activity of Escherichia coli FEBS Letters 32(2):257-259 Knappe JH, Balschkowski P, Grobner P, Schmitt T. 1974. Pyruvate formate-lyase of Escherichia coli: The acetyl-enzyme intermediate. Eur J Biochem 50:253. Knappe J, Sawers G. 1990. A radical-chemical route to acetyl~CoA: th e anaerobiclly induced pyruvate formate-lyase system of Escherichia coli. FEMS Microbiol Rev 75:383-398. Koebmann BJ, Westerhoff HV, Snoe p JL, Nilsson D, Jensen PR. 2002. The glycolytic flux in Escherichia coli is controlled by the demand fo r ATP. J Bacteriol 184:3909-3916. Kornberg H. 1966. The role and control of the glyoxylate cycle in Escherichia coli Biochem J 99: 111. Krebs A, Bridger WA.1980. "The kinetic prope rties of phosphoenolpyruvat e carboxykinase of Escherichia coli Can J Biochem 58(4):309-318. Kulla H, and Gottschalk G. 1977. Energy-depe ndent inactivation of citrate lyase in Enterobacter aerogenes J Bacteriol 132(3): 764-770. Kulla HG. 1983. Regulatory citrate lyase mutants of Salmonella typhimurium J Bacteriol 153: 546-549. Kumari S, Tishel R, Eisenbach M, Wolfe AJ. 1995. Cloning, characteriza tion, and functional expression of acs, the gene which encodes acetyl coenzyme A synthetase in Escherichia coli J Bacteriol 177(10):2878-2886. Kuwabara K, Gan Z, Nakamura T, Abe H, Doi Y. 2002. Molecular mobility and phase structure of biodegradable Poly(butylene succi nate) and Poly(butylene succinateco -butylene adipate). Biomacromolecules 3:1095-1100. Laivenieks M, Vieille C, Zeikus JG. 1997. Cloning, sequencing, and overexpression of the Anaerobiospirillum succiniciproducens phosphoenolpyruvate carboxykinase ( pckA ) gene. Appl Environ Microb iol 63(6): 2273-2280.

PAGE 131

131 Lee EC, Yu D, Martinez de Velasco J, Tessa rollo L, Swing DA, Court DL, Jenkins NA, Copeland NG. 2001. A highly efficient Escherichia coli -based chromosome engineering system adapted for recombinogenic targeti ng and subcloning of BAC DNA. Genomics 73:56-65. Lee SY, Hong SH, Lee SH, Park SJ. 2004. Fermentative production of chemicals that can be used for polymer synthesis. Macromol Biosci 4:157-164. Lee SJ, Lee DY, Kim TY, Kim BH, Lee J, Lee SY. 2005. Metabolic engineering of Escherichia coli for enhanced production of succinic acid, based on genome comparison and in silico gene knockout simulation. Appl Environ Microbiol 71:7880-7887. Lee SJ, Song H, Lee SY. 2006. Genome -based metabolic engineering of Mannheimia succiniciproducens for succic acid production. A ppl Environ Microbiol 72(3):1939 1948. Lin H, Bennett GN, San KY. 2005a. Ch emostat culture characterization of Esherichia coli mutant strains metabolically engineered fo r aerobic succinate production: A study of the modified metabolic network based on meta bolite profile, enzyme activity, and gene expression profile. Metab Eng 7:337-352. Lin H, Bennett GN, San KY. 2005b. Metabolic engineering of aerobic succinate production systems in Escherichia coli to improve process productivi ty and achieve the maximum theoretical succinate yield. Metab Eng 7:116-127. Lin H, Bennett GN, San KY. 2005c. Effect of carbon sources differing in oxidation state and transport route on succinate production in metabolically engineered Escherichia coli. J Ind Microbiol Biotechnol 32:87-93. Lin H, Bennett GN, San KY. 2 005d. Fed-batch culture of a metabolically engineered Escherichia coli strain designed for high-level su ccinate production and yield under aerobic conditions. Biotechnol Bioeng 90:775-779. Lorenz P, Zinke H. 2005. White biotechnology: differences in US and EU approaches? Trends in Biotechnol 23(12):570-574. Lutgens M, and Gottschalk G. 1980. Why a co-substrate is required for the anaerobic growth of Escherichia coli on citrate. J Gen Microbiol 119:63-70. Martinez-Morales F, Borges AC, Martinez A, Shanmugam KT, Ingram LO. 1999. Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons used during constr uction. J Bacteriol 181:71437148. Martinez A, Grabar TB, Shanmugam KT, Yoma no LP, York SW, Ingram LO. 2007. Low salt medium for lactate and etha nol production by recombinant Escherichia coli B. Biotechnol Lett 29:397-404.

PAGE 132

132 McKinlay JB, Vieille C, Zeikus JG. 2007. Prosp ects for a bio-based succinate industry. Appl Microbiol Biotechnol 76:727-740. Meyer HP, Leist C, Fiechter A. 1984. A cetate formation in continuous culture of Escherichia coli K12 D1 on defined and complex media. J Biotechnol 1: 355-358. Meynial-Salles I, Dorotyn S, Soucaille P. 2007 A new process for the continuous production of succinic acid from glucose at high yield, titer and productivity. Biotechnol Bioeng 99(1):129-135. Millard CS, Chao YP, Liao JC, Donnelly MI. 1996. Enhanced production of succinic acid by overexpression of phosphoenol pyruvate carboxylase in Escherichia coli Appl Environ Microbiol 62:1808-1810. Miller JH. 1992. A short course in bacter ial genetics. A laboratory manual and handbook for Escherichia coli and related bacteria. Plainview: Cold Spring Harbor Laboratory Press. p 456. Moniruzzaman M, Lai X, York SW, Ingram LO 1997. Extracellular me libiose and fructose are intermediates in raffinose catabolism dur ing fermentation to ethanol by engineered enteric bacteria. J Bacteriol 179:1880-1886. Morikawa, M., K. Izui, et al. 1980. Regulation of Escherichia coli phosphoenolpyruvate carboxylase by multiple effectors in vivo. Estima tion of the activities in the cells grown on various compounds. J Biochem (Tokyo) 87(2):441-449. Nghiem NP, Davison BH, Suttle BE, Richards on GR. 1997. Production of succinic acid by Anaerobiospirillum succinoproducens Appl Biochem Biot echnol 63-65: 565-576. Nghiem PP, Donnelly MI, Mill ard CS, Stols L. 1999. Method for the production of dicarboxylic acids. US Patent 5,869,301. Nielsen J, Villadsen J. 1994. Bioreaction engineering principles. New York: Plenum Press. Nilekani S, Sivaraman C.1983. Purificati on and properties of citrate lyase from Escherichia coli. Biochemistry 22(20):4657-4563. Nimmo GA and Nimmo HG.1984. The regulatory properties of isocit rate dehydrogenase kinase and isocitrate dehydrogenase phosphatase from Escherichia coli ML308 and the roles of these activities in the control of isocitrate dehydrogenase. Eur J Biochem 141:409-414. Noordover BA, van Staalduinen VG, Duchatea u R, Koning CE, van Benthem R A.T.M Mak M, Heise A, Frissen AE, van Haveren J. 2006. Coand terpolyesters based on isosorbide and succinic acid fo r coating applications: synthe sis and characterization. Biomacromolecules 7:3406-3416.

PAGE 133

133 Nordhoff S, Hocker H, Gebhardt H. 2007. Rene wable resources in the chemical industryBreaking away from oil? Biotechnol J 2:1505-1513. Oh MK, Rohlin L, Kao KC, Liao JC. 2002. Gl obal expression profiling of acetate-grown Escherichia coli J Biol Chem 277:13175-13183. Ohta K, Beall DS, Shanmugam KT, Ingr am LO. 1991. Genetic improvement of Escherichia coli for ethanol production: chro mosomal integration of Zymomonas mobilis genes encoding pyruvate decarboxylase and alc ohol dehydrogenase II. Appl Eviron Microbiol 57:893. Okino S, Inui M, Yukawa H. 2005. Production of organic acids by Corynebacterium glutanicum under oxygen deprivation. Appl Microbiol Biotec hnol 68:475-480. Park SJ, Cotter PA, Gunsalus RP. 1995. Regulation of malate dehydrogenase ( mdh ) gene expression in Escherichia coli in response to oxygen, carbon, and heme availability. J Bacteriol 177(2):6652-6656. Patnaik R, Roof WD, Young RF, Liao JC. 1992. Stimulation of glucose metabolism in Escherichia coli by a potential futile cycl e. J Bacteriol 174:7527-7535. Phue JN, Shiloach J. 2004. Transcri ption levels of key metabolic genes are the cause for different glucose utilization pathways in E. coli B (BL21) and E. coli K (JM109). J Biotechnol 109: 21-30. Posfai G, Koob MD, Kirkpatrick HA, Blattner FR. 1997. Versatile insertion plasmids for targeted genome manipulations in bacteria: Isolation, de letion, and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7 genome. J Bacteriol 179:4426-4428. Purvis JE, Yomano LP, Ingram LO. 2005. Enha nced trehalose production improves growth of Escherichia coli under osmotic stress. Appl Environ Microbiol 71:3761-3769. Quail MA, Guest JR. 1995. Purification, characte rization and mode of action of PdhR, the transcriptional repressor of the pdhR-aceEF-lpd operon of Escherichia coli. Mol Microbiol 15(3):519-29. Quentmeier A, Holzenburg A, Mayer F, Antranikia n G. 1987. Reevaluation of citrate lyase from Escherichia coli Biochim Biophys Acta 913(1):60-5. Reed JL, Vo TD, Schilling CH, Palsson BO. 2003. An expanded genome-scale model of Escherichia coli K-12 (iJR904 GSM/GPR). Ge nome Biol 4(9):R54. Reitzer, L. 2004. Chapter 3.6.1.3, Biosynthesis of Glutamate, Aspartate, Asparagine, L-Alanine, and D-Alanine. In A. Bck, R. Curtiss III, J. B. Kaper, F. C. Neidhardt, T. Nystrm, K. E. Rudd, and C. L. Squires (ed.), EcoSal Escherichia coli and Salmonella : cellular and molecular biology. [Online.] http://www.ecosal.org. Washington, D.C., ASM Press

PAGE 134

134 Sado T, Tajima M, Noguchi Research Foundatio n. 1980. Carbonylation of 1,4-butanediol by homogeneous catalyst. Japa n Kakai Tokkyo Koho 8,051,037. Samuelov NS, Lamed R, Lowe S, Zeikus JG. 1991. Influence of CO2-HCO3 levels and pH on growth, succinate production, and enzyme activities of Anaerobiospirillum succinoproducens Appl Environ Micr obiol 57:3013-3019. Sanchez AM, Bennett GN, San KY. 2005a. Nove l pathway engineering design of the anaerobic central metabolic pathway in Escherichia coli to increase succinate yield and productivity. Metab Eng 7:229-239. Sanchez AM, Bennett GN, San KY. 2005b. Efficient succinic acid production from glucose through overexpression of pyruvate carboxylase in an Escherichia coli alcohol dehydrogenase and lactate dehydrogenas e mutant. Biotechnol Prog 21:358-365. Sanchez AM, Bennett GN, San KY. 2006. Batch cu lture characterization and metabolic flux analysis of succinate-producing Escherichia coli strains. Metab Eng 8:209-226. Sanwal BD. 1970. Regulatory mechanisms invol ving nicotinamide adenine nucleotide as allosteric effectors: A control of glucos e 6-phosphate dehydrogenase. J Biol Chem 245(7):1625-1631. Sawers G, Bock A. 1988. Anaerobic regul ation of pyruvate formate-lyase from Escherichia coli K-12. J Bacter iol 170:5330-5336. Sauer M, Porro D, Mattanovich D, Branduardi P. 2008. Microbial production of organic acids: expanding the markets. Trends in Biotechnol 26(2):100-108. Scheifinger CC, Wolin MJ. 1973. Propionate forma tion from cellulose and soluble sugars by combined cultures of Bacteroides succinogenes and Selenomonas ruminantium Appl Microbiol 26:789-795. Schmid A, Dordick JS, Hauer B, Kiener A, Wubbolts M, Witholt B. 2001. Industrial biocatalysis today and tomorrow. Nature 409:258. Siddiquee KA, Arauzo-Bravo MJ, Shimizu K. 2004. Effect of a pyruvate kinase ( pykF -gene) knockout mutation on the control of gene expression and metabolic fluxes in Escherichia coli FEMS Microbiol Lett 235(1):25-33. Smith TE, Balasubramanian KA, and Beezley A. 1980. Escherichia coli Phosphoenolpyruvate carboxylase: Studies on the mechanism of syne rgistic activation by nucleotides. J Biol Chemistry 255(4):1635-1642. Song DK, Sung YK. 1995. Synthesis and characteri zation of biodegradable Poly(1,4-butanediol succinate). J Appl Polym Sci 56(11):1381-1395.

PAGE 135

135 Song H, Lee SY. 2006. Production of succinic acid by bacterial fermentation. Enzyme Microb Technol 39:352-361. Song H, Lee JW, Choi S, You JK, Hong WH Lee SY. 2007. Effects of dissolved CO2 levels on the growth of Mannheimia succiniciproducens and succinic acid production. Biotechnol Bioeng 98(6):1296-1304. Stephanopoulos G, Vallino JJ. 1991. Network rigidity and metabolic engineering in metabolite overproduction. Science 252:1675-1681. Stephanopoulos G, Aristidou AA, Nielsen J. 1998. Metabolic e ngineering: Prin ciples and Methodologies. Acadamic Press. Sandiego, CA. Stols L, Donnelly MI. 1997. Production of su ccinic acid through overexpression of NAD dependent malic enzyme in an Escherichia coli mutant. Appl Environ Microbiol 63: 2695-2701. Storici F, Coglievina M, Bruschi CV. 1999. A 2m DNA-based maker recycling system for multiple gene disruption in the yeast Saccharomyces cerevisiae Yeast 15:271-283. Tarmy EM, Kaplan NO. 1968a. Chemical characte rization of D-lactate dehydrogenase from Escherichia coli B. J Biol Chem 243:2579. Tarmy EM, Kaplan NO. 1968b. Kinetics of Escherichia coli B D-lactate dehydrogenase and evidence for pyruvate controlled change in conformation. J Biol Chem 243:2587. Tempest DW, Neijssel OM. 1987. Growth yi eld and energy distribution. In: Neidhardt FC, editor. Escherichia coli and Salmonella typhimurium. Washington, DC: American Society for Microbiology pp. 797 Thomas SM, DiCosimo R, Nagarajan V. 2002. Bio catalysis: applications and potentials for the chemical industry. Trends in Biotechnol 20:238. Thomason L, Court DL, Bubunenko M, Constantino N, Wilson H, Datta S, Oppenheim A. 2005. Current Protocols in Molecula r Biology In Ausubel FM, Brent R, Klingston RE, Moore DD, Deidman JD, Smith JA, and Struhl K, editors. Re combineering: Genetic engineering in bacteria using homologous recomb ination. New York: John Wiley & Sons. p 1.16.1-1.16.21. Tokiwa Y, Suzuki T. 1977. Hydrolysis of polyesters by lipases. Nature 270:76-78. Umare SS, Chandure AS, Padney RA. 2007. Synthe sis, characterization and biodegradable studies of 1,3-propanediol based poly esters. Polym Degrad Stab 92:464-479.

PAGE 136

136 Unden G, Achebach S, Holighaus G, Tran HG, Wackwitz B, Zeuner Y. 2002. Control of FNR function of Escherichia coli by O2 and reducing conditions. J Mol Microbiol Biotechnol. 4(3):263-268. Unden G, Kleefeld A. 2004. Chapter 3.4.5, C4-Dicarboxylate Degradation in Aerobic and Anaerobic Growth. In A. Bck, R. Curtiss III, J. B. Kaper, F. C. Neidhardt, T. Nystrm, K. E. Rudd, and C. L. Squires (ed.), EcoSalEscherichia coli and Salmonella : cellular and molecular biology. [Online.] http://www.ecosal. org. ASM Press, Washington, D.C. Underwood SA, Buszko ML, Shanmugam KT, Ingram LO. 2002. Genetic changes to optimize carbon partitioning between ethanol and biosynthesis in ethanologenic Escherichia coli. Appl Environ Microb iol 68(12):6263-6272. Underwood SA, Buszko ML, Shanmugam KT, I ngram LO. 2004. Lack of protective osmolytes limits final cell density and volumetric productivity of ethanologenic Escherichia coli KO11 during xylose fermentation. Appl Environ Microbiol 70(5): 2734-2740. Velick, SF, Furfine C. 1963. Glyceraldehyde 3-phosphate dehydrogenase; in Lardy H, Myrbach K. (eds): The Enzymes. New York Academic Press, vol. 7, pp. 243-273. Vallino JJ, Stephanopoulos G. 1993. Metabolic flux distributions in Corynebacterium glutamicum during growth and lysine overpr oduction. Biotechnol Bioeng 41:633-646. Van der Werf MJ, Guettler MV, Jain MK, Zei kus JG. 1997. Environmental and Physiological factors affecting the succinate product ratio during carbohydrate fermentation by Actinobacillus sp. 130Z. Arch Microbiol 167:332-342. Vemuri GN, Eiteman MA, Altman E. 2002a. Effects of growth mode and pyruvate carboxylase on succinic acid production by metabolically engineered strains of Escherichia coli Appl Environ Microbiol 68:1715-1727. Vemuri GN, Eiteman MA, Altman, E. 2002b. Succinate production in dual-phase Escherichia coli fermentations depends on the time of transition from aerobic to anaerobic conditions. J Ind Microbiol Biotechnol 28:325-332. Vemuri GN, Minning TA, Altman E, Eiteman MA. 2005. Physiological responses of central metabolism in Escherichia coli to deletion of pyruvate ox idase and introduction of heterologous pyruvate carboxylase Biotechnol Bioe ng 90(1):64-76. Vemuri GN, Altman E, Sangurdekar DP, Khodursky AB, Eiteman MA. 2006. Overflow metabolism in Escherichia coli during steady-state growth: transcriptional regulation and effect of the redox. Appl E nviron Microbiol 72(5):3653-3661.

PAGE 137

137 Wang J, Tan H, Zhaou ZK. 2006. Over-expression, purification, and characterization of Recombinant NAD-malic enzyme from Escherichia coli K12. Protein Expr Purif 53(1):97-103. Weimer PJ. 1993. Effects of dilution rate a nd pH on the ruminal cellulolytic bacterium Fibrobacter succinogenes S85 in cellulose fed continuous culture. Arch Microbiol 160: 288-294. Wendisch VF, Bott M, and Bernhard JE. 2006. Metabolic engineering of Escherichia coli and Corynebacterium glutamicum for biotechnological production of organic acids and amino acids. Current Opinion in Microbiol 9:1-7. Werpy T, Petersen G, editors. 2004. Top Value Added Chemicals From Biomass. US Department of Energy. http:// www1.eere.energy.gov/biomass/pdfs/35523.pdf Willke T, Vorlop KD. 2004. Industrial bioconversion of renewable resources as an alternative to conventional chemistry. Appl Microbiol Biotechnol 66:131-142. Wood BE, Yomano LP, York SW, Ingram LO. 2005. Development of industrial mediumrequired elimination of the 2,3-butanediol fe rmentation pathway to maintain ethanol yield in an ethanologenic strain of Klebsiella oxytoca Biotechnol Prog 21:1366-1372. Wood WA. 1961. Fermentation of carbohydrates and related co mpounds. In: Gunsalus IC, Stainer RY (eds). The bacteria, vol 2. Academic Press, New York London, pp 59-149. Wollenberg RH, Frank P. 1988. Modified succinimides in fuel composition. US patent 4,767,850. Wu H, Li ZM, Zhou L, Ye Q. 2007. Improved su ccinic acid production in an aerobic culture of a pflB ldhA double mutant of Escherichia coli by enhancing the anaplerotic activities in preceding aerobic culture. Appl E nviron Microbiol 73(24):7837-7843. Yun NR, San KY, Bennett GN. 2005. Enhancemen t of lactate and succinate formation in adhE or pta-ackA mutants of NADH dehydrogenase-deficient Escherichia coli J Appl Microbiol 99:1404-1412. Zeikus JG, Jain MK, Elankovan P. 1999. Bi otechnology of succinic acid production and markets for derived industrial products Appl Microbiol Bi otechnol 51:545-552. Zhang X, Jantama K, Moore JC, Shanmugam KT, Ingram LO. 2007. Production of L-alanine by metabolically engineered Escherichia coli Appl Microbiol Bi otechnol 77: 355-366. Zhou S, Shanmugam KT, Ingram LO. 2003. Functional replacement of the Escherichia coli D-()-lactate dehydrogenase gene ( ldhA ) with the L-(+)-lactate dehydrogenase gene ( ldhL ) from Pediococcus acidilactici. Appl Environ Micr obiol 69:2237-2244.

PAGE 138

138 Zhou S, Grabar TB, Shanmugam KT, Ingram LO. 2006a. Betaine tripled the volumetric productivity of D-(-)-lactate by Escherichia coli strain SZ132 in mineral salts medium. Biotechnol Lett 28:671-676. Zhou S, Shanmugam KT, Yomano LP, Grabar TB, Ingram LO. 2006b. Fermentation of 12% (w/v) glucose to 1.2 M lactate by Escherichia coli strain SZ194 using mineral salts medium. Biotechnol Lett 28:663-670. Zhou S., Iverson AG, Grayburn WS. 2008. Engin eering a native homoethanol pathway in Escherichia coli B for ethanol production. Biotechnol Lett 30:335-342. Zwicker N, Theobald U, Zahner H, Fiedler HP. 1997. Optimization of fermentation conditions for the production of ethylene-diamine-disuccinic acid by Amycolatopsis orientalis J Ind Microbiol Biotechnol 19:280-285.

PAGE 139

140 BIOGRAPHICAL SKETCH Kae mwich Jantama was born in Chiang Mai, Thailand in August 1978. He attended Montfort College, Chiang Mai, Thailand until he finished his high school. He matriculated at Chiang Mai University, Thailand for his underg raduate study in food science and technology major. He finished Bachelor of Science with fi rst class honor and received the best study award throughout his undergraduate program in March 1999. Since May 1999, he began his graduate study at Institute of Molecular Biology and Genetics, Mahidol University, Salaya Campus, Thailand. During his study, he was awarded the graduate fellowship from the National Scienc e and Technology Developm ent Agency (NSTDA), Ministry of Science, Technology and Environment, Thailand. He finished his Master of Science (Molecular Genetics and Genetic Engineering) in January 2002. In the year 2002, he was aw arded the Royal Thai Governme nt Scholarship to pursue his Ph.D. study abroad. He started his graduate study at University of Florida since August 2002 and finished Master of Engineering (Chemical E ngineering) in August 2004. After which, he continued his Doctor of Philosophy program in the Chemical Engineering Department under supervision of Professor Spyros A Svoronos. He joined his research work with Distinguished Professor Lonnie O Ingram at Microbiology a nd Cell Science Department since October 2004. He graduated his Doctor of Ph ilosophy degree in August 2008. Once he graduates from University of Florida, he will serve as a faculty member at Biotechnology Department, Instit ute of Agricultural Technology, Suranaree University of Technology, Nakorn Ratchasima, Thailand.