<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2010-08-31.

Permanent Link: http://ufdc.ufl.edu/UFE0022494/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2010-08-31.
Physical Description: Book
Language: english
Creator: Lee, Pui
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Pui Lee.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Reeves, Westley H.
Electronic Access: INACCESSIBLE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022494:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022494/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2010-08-31.
Physical Description: Book
Language: english
Creator: Lee, Pui
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Pui Lee.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Reeves, Westley H.
Electronic Access: INACCESSIBLE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022494:00001


This item has the following downloads:


Full Text





ROLE OF TYPE-I INTERFERONS AND TOLL-LIKE RECEPTORS IN EXPERIMENTAL
SYSTEMIC LUPUS ERYTHEMATOSUS

















By

PUI YUEN LEE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008



































2008 Pui Yuen Lee



































To my mother, Kit Ying Ip; and my father, Tsun Kin Lee, for their unconditional love and
support.









ACKNOWLEDGMENTS

It is with my deepest gratitude that I acknowledge the following individuals for their

contributions to my development as a scientist and as a person. I am forever indebted for their

assistance, guidance and support that have made this work possible.

First I would like to thank a number of faculty members for their invaluable contributions.

I sincerely thank my mentor Dr. Westley Reeves for the years of guidance. His knowledge and

insights have ignited my interest in immunology and his compassion in both research and clinical

care has shown me how a physician-scientist should be. I am grateful to my co-mentor Dr. Mark

Segal for introducing me to biomedical research during my undergraduate studies and serving as

a role model ever since. The experience in his laboratory has been instrumental to my research

endeavors and ultimately led to my decision to pursue the MD-PhD program. I would like to

express my gratitude to my committee members Drs. Richard Moyer and Edward Chan for

providing helpful advice and keeping me on track. I also thank Dr. Eric Sobel for his valuable

insights on mouse models of lupus and Dr. Minoru Satoh for answering my countless questions

regarding the pristane model and keeping me accompanied in the lab on weekends.

I am grateful for the friendship and collaboration of all members of the Reeves laboratory.

In particular, I would like to thank Jason Weinstein for sharing his expertise in flow cytometry,

which created many new possibilities for my project; Dina Nacionales for putting together study

protocols and always being available to assist with animal studies; Edward Butfiloski for

ordering supplies and for his help with i.v. injection for labeling studies; and Yi Li for managing

the lab and sharing her humorous views of life. I also thank Tolga Barker, Philip Scumpia, and

Matt Delano for their intellectual contribution on many projects.

I thank Dr. Richard Johnson for his encouragements and the Division of Nephrology for

generously providing my NIH T32 training grant support. I also appreciate the help of Dr. Wei









Mu in the Johnson laboratory, and Dr. Yanpeng Diao, Elaine Beem, and Larysa Sautin in the

Segal laboratory for their assistance with various aspects of my work.

A significant portion of this work could not be completed without the generosity of

Professor Shizuo Akira in Osaka University. I am grateful to be provided the long list of knock-

out strains not available elsewhere and given the opportunity to perform my experiments in

Japan. I would like to thank Yutaro Kumagai, Drs. Osamu Takeuchi, Taro Kawai, and Masahiro

Yamamoto of the Akira laboratory for their contributions that made it possible for me to

complete my project there in a timely manner.

I would like to extend my appreciation to my middle school teacher Anita Amigo who

tirelessly taught me the English language when I moved to the U.S. and high school teachers

Karen Kissel and Nancy Kinard who helped me discover my interest in medical science.

Further, I wish to acknowledge Manru Connie Xu, Frank Huang and many friends for their

continuous support and helping me overcome obstacles. I also thank my grandparents for their

confidence and trust in me. Finally, I would like to thank my parents for their love and guidance.

Their hard work and sacrifice have given me the opportunity to succeed in life.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ............................................................................................................... 4

L IS T O F T A B L E S ................................................................................................. ..................... 9

LIST OF FIGURES ............................................. .. ......... ........................... 10

L IST O F A B B R E V IA TIO N S .................................................... .............................................. 12

A B S T R A C T ............... ................................................................ .......................................... 15

CHAPTER

1 INTRODUCTION .................................... .. .......... ............................. 17

System ic L upus E rythem atosus ...................................................................... ................ 17
E pidem biology .............. ........................................................................ . ......18
Clinical Manifestations..................... .. ........... ............................. 18
Im m unological A bnorm alities......................................... ........................ ............... 19
T reatm en t.......................................................................................................... ........ 2 1
Involvement of IFN-I in the Pathogenesis of SLE ............... ....................................22
Type-I Interferon Signaling Pathways....................................................................22
Immunomodulatory Effects of IFN-I .........................................................................23
P athw ays of IFN -I Induction .......................................... ......................... ................ 24
Interferon-P reducing C ells ......................................................................... ................ 25
Dysregulated IFN-I Production in Human SLE .........................................................26
Evidence of IFN-I involvement in Murine Models of SLE ......................................29

2 METHODS AND MATERIALS ...................................................................................34

M o u se S tra in s .........................................................................................................................3 4
T reatm ent and T issue H arvest .. ...................................................................... ................ 35
F low C ytom etry and C ell Sorting ......................................................................... ............... 35
Conventional and Real-Time Quantitative PCR................................................................36
C y to k in e E L IS A ..................................................................... ..................... 3 7
M onocyte and D endritic C ell D epletion............................................................ ................ 37
A utoantibody M easurem ent.................................................. ............................................ 38
In V itro S tim u latio n ................................................................................................................3 8
C ell C culture w ith T M PD .................................................. .............................................. 39
Endocytosis and Phagocytosis Assays............................................................................39
S statistic al A n aly sis................................................................................................................ .. 4 0

3 NOVEL TYPE-I INTERFEREON-PRODUCING CELLS IN TMPD-INDUCED
L U PU S ......................................................................................... ..... ..................... 42



6









Introduction ........................................................ .................. 42
M materials and M methods .............. .............................................................................. 43
M ice ....................................................................... ..... ..................... 43
Q uantitative R eal-Tim e P C R .......................................... ......................... ................ 43
Flow C ytom etry ................................................................................ ....................... 44
Cell Sorting ........................................................... ...... ..................... 44
M onocyte L abeling and D epletion ..................................... ..................... ................ 44
D endritic C ell D epletion ... ....................................................................... ................ 45
S tatistic al A n a ly sis ..........................................................................................................4 5
Results........................ ... .... .. .... .......... ......... ..................... 45
The "Interferon Signature" Precedes Lupus Disease Onset.......................................45
Accumulation of Ly6Chi Monocytes Induced by TMPD Treatment...............................46
Immature Ly6Chi Monocytes are a Maj or Source of IFN-I Production.......................49
Induction of IFN-I by TMPD is not Dependent on DCs ............................................50
Surface Expression of Ly6C on Monocytes is not IFN-I-Dependent ..........................52
D iscu ssio n .............................................................................................................. ........ .. 5 3

4 TOLL-LIKE RECEPTOR 7-DEPENDENT AND FCyR-INDEPENDENT
PRODUCTION OF TYPE-I INTERFERON IN TMPD-INDUCED LUPUS .......................63

Introduction ........................................................ .................. 63
M materials and M methods .............. .............................................................................. 65
M ice ..................................................................... ....... ..................... 65
R eal-T im e Q uantitative P C R .......................................... ......................... ................ 65
Flow C ytom etry and C ell Sorting...................................... ...................... ................ 66
In V itro Stim ulation ............. .. .................. .................. .. .............. ......... ... ............ 67
Autoantibody Analysis ..... ............................. ........ ................... 67
S tatistic al A n a ly sis ..........................................................................................................6 7
R e su lts ...................................... ........... .................................................................................6 8
Induction of IFN-I by TM PD Requires M yD88......................................... ................ 68
Induction of IFN-I by TMPD is TLR7-Dependent, Immune Complex-Independent .....69
Immature Ly6Chi Monocytes Express High Levels of TLR7 .......................................72
The Y-linked Autoimmune Accelerating (Yaa) Locus Amplifies the Effects of
T M P D ...................... ..... ............... ............................................................................ 7 3
Essential Role of TLR7 in the Development of Autoantibodies................................74
Discussion ...................................................... .................. 75

5 TYPE-I INTERFERON-DEPENDENT RECRUITMENT OF INFLAMMATORY
MONOCYTES IN TMPD-INDUCED LUPUS ................................................................90

In tro du ctio n ............................................................................................................. ........ .. 9 0
M e th o d s ....................................................................................................... .................... 9 1
M ice ............................................................................................. ........ 9 1
R eal-T im e P C R ............................................................................................................... 9 2
F low C y to m etry ............................................................................................................... 9 2
M onocyte L labeling ............. .. ................... .................. ............ ........ .... ... ........... 93
In V itro Stim ulation ............. .. .................. .................. .. .............. ......... ... ............ 93









R e su lts ............... ............... ..... ..... .... ..... ... .... ............... ..... ..... ................................... 9 3
Peritoneal Recruitment of Ly6Chi Monocytes after TMPD Treatment...........................93
Chronic Recruitment of Ly6Chi Monocytes is Dependent on IFN-I signaling ...............95
Monocyte Recruitment Induced by TMPD Requires CCR2......................................97
Functions of Monocyte Subsets in TMPD-Treated Mice...........................................98
Chronic Recruitment of Granulocytes Requires IL-1 Signaling ...............................99
D discussion .................................................................................................... 100

6 DISCUSSION AND FUTURE DIRECTIONS............... ..........................112

Suitability of the TMPD-Model for the Study of SLE .......... ....................................113
C om plexity of the TM PD M odel...................................... ......................... ...............1...... 13
M echanism of TLR 7 A ctivation....................................... ......................... ............... 115
Role of TLR7 in Autoantibody Production ..................................................... ................ 116
Sequential Generation of Autoantibody Specificities in TMPD-Induced Lupus ...............118
Therapeutic Im plications ... ................... ....................................... ............... ...... 120
C o n clu sio n ................................................................................................... .................... 12 1

L IST O F R E F E R E N C E S ....................................................... ................................................ 127

B IO G R A PH IC A L SK E TC H .................................................... ............................................. 142









LIST OF TABLES


Table page

2-1. Conventional and real-tim e PCR prim ers.......................................................... ................ 41

4-1. Cytokine and chemokine PCR array analysis in TLR7 mice..........................................81

5-1. Peritoneal exudate cell subsets two weeks following TMPD treatment ........................... 105









LIST OF FIGURES


Figure page

1-1. Schem atic of IFN -I signaling pathw ays ........................................................... ................ 32

1-2. Schematic of IFN-I induction by endogenous nucleic acids............................................33

3-1. Elevated expression of IFN-I and accumulation of Ly6Chi monocytes after TMPD
tre a tm e n t ............................................................................................................................5 7

3-2. Direct recruitment of circulating Ly6Chi monocytes after TMPD treatment..................... 58

3-3. Immature Ly6Chi monocytes are major producers of IFN-I ....................... ..................... 59

3-4. Dendritic cells are not required for IFN-I production induced by TMPD .............................60

3-5. Accumulation of Ly6Chi monocytes is correlated with the frequency of anti-Sm/RNP
autoantibodies and upregulation of ISG expression ..................................... ................ 61

3-6. Expression of Ly6C on immature monocytes is not dependent on IFN-I signaling .............62

4-1. Induction of IFN -I by TM PD requires M yD 88................................................ ................ 82

4-2. Cytoplasmic nucleic acid sensors do not contribute to IFN-I production..........................83

4-3. Induction of IFN-I by TM PD is TLR7-dependent ........................................... ................ 84

4-4. Dispensable role of FcyRI and FcyRIII in TMPD-induced IFN-I production....................85

4-5. Immature Ly6Chi monocytes express high levels of TLR7..............................................86

4-6. Amplification of the response to TMPD by the Yaa locus ..............................................87

4-7. Essential role of TLR7 in autoantibody production ......................................... ................ 88

4-8. Development of anti-Su/ago2 autoantibodies is TLR7-dependent...................................89

5-1. Chronic recruitment of Ly6Chi monocytes in TMPD-treated mice................................106

5-2. The recruitment of Ly6Chi monocytes induced by TMPD requires IFN-I signaling ..........107

5-3. Rapid turnover and decreased maturation of Ly6Chi monocytes is the presence of IFN-I
sig n alin g ................................................................................ ............. .................. 10 8

5-4. Monocyte recruitment induced by TMPD is dependent on CCR2................................ 109

5-5. Functions of monocyte subsets in TMPD-treated mice...... .................... ...................110









5-6. Granulocyte influx following TMPD treatment requires IL-1 receptor..............................111

6-1. Proposed model of TM PD-induced inflammation ....... ......... ...................................... 122

6-2. Enhancement TLR7 stimulation by TM PD in vitro....................................... ............... 123

6-3. Endocytosis and phagocytosis are not affected by TMPD treatment................................124

6-4. Profile of autoantibody production in TLR7- mice....... ... ....................................... 125

6-5. Accumulation of Ly6Chi monocytes in lipogranulomas.......................... ..................1...26









LIST OF ABBREVIATIONS


Ago2 argonaute-2

ANA antinuclear antibodies

APC allophycocyanin

BMDM bone marrow-derived macrophages

Clo-lip clodronate-containing liposomes

CLP cecal ligation and puncture

DiD 1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine perchlorate

DiD-lip DiD-labeled liposomes

DNA deoxyribonucleic acid

DTR diphtheria toxin receptor

ELISA enzyme-linked immunosorbent assay

FACS fluorescence-activated cell sorting

FBS fetal bovine serum

FcyR Fc gamma receptor

FITC fluorescein isothiocyanate

IFN interferon

IFNAR interferon alpha/beta receptor

Ig immunoglobulin

IL interleukin

iNOS inducible nitric oxide synthase

i.p. intraperitoneal

IPS-1 interferon-P promoter stimulator-1

IRF interferon-regulated factor

ISG interferon-stimulated genes









i.v. intravenous

LPS lipopolysaccharide

MO macrophages

MCP-1 monocyte chemoattractant peptide-1

MDA-5 melanoma differentiation associated gene-5

MDC myeloid dendritic cells

MHC major histocompatibility complex

MO mineral oil

Mx-1 myxoma resistance response gene-1

MyD88 myeloid differentiation factor-88

NZB/W New Zealand Black / New Zealand White F 1

PBMC peripheral blood mononuclear cells

PCR polymerase chain reaction

PDC plasmacytoid dendritic cells

PDCA-1 plasmacytoid dendritic cell antigen-1

PE phycoerythrin

PEC peritoneal exudate cells RNA ribonucleic acid

Poly I:C polyinosinic: polycytidylic acid

RIG-I retinoic acid inducible gene-I

SLE systemic lupus erythematosus

RT-PCR real-time quantitative PCR

Sm Smith antigen

snRNP small nuclear ribonucleoproteins

TBK-1 TANK-binding kinase-1

TGF transforming growth factor









TLR Toll-like receptor

TMPD 2,6,10,14 tetramethylpentadecane

TNF tumor necrosis factor

TRIF TIR domain-containing adaptor inducing IFN-j3

Yaa Y-linked autoimmune acceleration









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ROLE OF TYPE-I INTERFERONS AND TOLL-LIKE RECEPTORS IN EXPERIMENTAL
SYSTEMIC LUPUS ERYTHEMATOSUS

By

Pui Yuen Lee

August 2008

Chair: Westley H. Reeves
Major: Medical Sciences Immunology and Microbiology

Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder affecting multiple

organ systems. Although the etiology remains unclear, it is increasingly recognized that

derangements of innate as well as adaptive immunity are important to the pathogenesis SLE.

Recent evidence suggests that type-I interferons (IFN-I), a family of anti-viral cytokines, are

integral to the pathogenesis of SLE. More than half of SLE patients display upregulation of a

group of IFN-I-stimulated genes (ISGs). This "interferon signature" is clinically relevant as it

correlates with active disease, presence of certain autoantibodies, and an increased incidence of

renal involvement. The mechanism responsible for the dysregulation of IFN-I production and

the source of these immunostimulatory cytokines are not clear.

Experimental lupus induced by tetramethylpentadecane (TMPD) displays key

immunological and clinical features of human SLE. TMPD-induced lupus is at present the only

model of SLE associated with excess IFN-I production and ISG expression. Therefore,

investigated the mechanism and cell subset(s) responsible for the excess IFN-I production in this

model. We demonstrate that TMPD treatment induces the accumulation of immature Ly6Chi

inflammatory monocytes, which are a major source of IFN-I in this lupus model distinct from

IFN-producing dendritic cells. The expression of IFN-I and ISGs was rapidly abolished by









monocyte depletion whereas systemic ablation of dendritic cells had little effect. In addition, we

found that IFN-I are required to maintain the chronic recruitment of Ly6Chi monocytes by

inducing the secretion of monocyte chemoattractants, thereby creating a vicious cycle of

monocyte influx and IFN-I production.

We also show for the first time that TMPD elicits IFN-I production and autoantibody

production exclusively through a Toll-like receptor 7 (TLR7)- and myeloid differentiation factor

88 (MyD88)-dependent pathway. The effects of TMPD were amplified by the Y-linked

autoimmune acceleration (Yaa) cluster, which carries a duplication of the TLR7 gene. In

contrast, other TLRs and cytoplasmic nucleic acid sensors were dispensable for IFN-I induction

in this model. The deficiency of Fcy receptors also did not impact the production of IFN-I,

arguing against the conventional view that autoantibody immune complexes are responsible for

the excess IFN-I in SLE. Taken together, these findings illustrate the importance of IFN-I and

TLR7 in the pathogenesis of TMPD-induced lupus and provide novel insights into the

"interferon signature" seen in patients with SLE.









CHAPTER 1
INTRODUCTION

This chapter discusses the epidemiology, clinical manifestations, and immunological

abnormalities associated with systemic lupus erythematosus (SLE). The basic immunology of

type-I interferons (IFN-I) and the interferon signaling pathway, as well as current evidence for

the involvement these anti-viral cytokines in the pathogenesis of SLE will be presented. This

introduction will also provide the rationale for studying the dysregulation of IFN-I using murine

models of SLE.

Systemic Lupus Erythematosus

SLE is a chronic autoimmune disease that affects multiple organ systems including the

joints, skin, kidneys, lungs, heart, and nervous system (1). In healthy individuals, the immune

system functions to detect the presence pathogens such as bacteria and viruses by distinguishing

self-antigens from foreign antigens. Upon encountering pathogen-associated molecular patterns

(PAMPs) such as nucleic acids of microbial origin, the innate immune system initiates a non-

specific inflammatory response via a number of highly conserved Toll-like receptors. The

production of inflammatory cytokines and chemokines recruits antigen presenting cells such as

monocytes and dendritic cells, which direct the adaptive immune response to produce antigen-

specific T and B cell against the foreign antigen. Unlike PAMPs, self-antigens are typically

either not recognized by the immune system, or are precluded from interaction with immune

cells by anatomical barriers. The occasional generation of autoreactive lymphocytes is also

guarded by a number of censoring mechanisms. For reasons not completely understood, such

tolerance to self tissues is breached in SLE and the immune system actively responds to a wide-

array of autoantigens by generating either autoreactive T cells or B cells. In SLE, the resulting

immune cell activation leads to autoantibody production and a vicious cycle of chronic









inflammation and tissue destruction. While the clinical manifestations and severity of the

disease vary widely, most lupus patients experience alternating periods of flares and remission.

The etiology of SLE remains unclear, although both genetic and environmental factors are

believed to play essential roles. Currently there is no cure for SLE and treatment is aimed at

symptomatic relief.

Epidemiology

In the United States, the prevalence of SLE is estimated to be 15 to 50 cases per 100,000

and about 5 million individuals are affected world-wide (2). Although males are susceptible,

90% of lupus patients are females and most are of child-bearing age. SLE is more common in

African-Americans and in Hispanic and Asian populations than in Caucasians. Hereditary

factors contribute to the susceptibility for SLE as a concordance of 26% was found in

monozygotic twins vs. 5% in dizygotic twins (3). Moreover, the familial prevalence is 10-12%

for individuals having one or more first-degree relatives diagnosed with SLE (4). Significant

familial aggregation with other autoimmune diseases including rheumatoid arthritis and

Sjogren's syndrome has also been described (5).

Clinical Manifestations

The American College of Rheumatology (ACR) has defined 11 criteria for the

classification of SLE (6, 7). The clinical criteria consist of malar rash, discoid rash,

photosensitivity, oral ulcers, arthritis, serositis, renal involvement, neurologic disorders (seizure

or psychosis) and hematologic abnormalities. Immunological criteria include the presence of

antinuclear antibodies (ANA) and more specific autoantibodies such anti-double-stranded (ds)-

DNA, anti-Sm, and anti-phospholipid. A diagnosis of SLE is made with 95% certainty if a

patient meets any 4 of the 11 ACR criteria.









In most patients, the onset of autoantibodies precedes clinical manifestations (8). While

almost all patients are positive for ANA, the presence of autoantibodies against dsDNA and the

Sm antigen are highly specific to lupus. Symptoms of SLE can vary widely due to fluctuations

in disease severity. The most common clinical findings include fatigue, arthralgia, arthritis,

photosensitivity, anemia, and leucopenia. Malar rash with the characteristic "butterfly"

distribution is found in about half of lupus patients and often reflects the presence of active

disease. Lupus nephritis occurs in 30-50% of patients and represents a major cause of early

mortality (9). Although less common, SLE patients can present with manifestations of

cardiovascular, neurologic, gastrointestinal, pulmonary, or ocular origin.

Immunological Abnormalities

Although the cause of SLE is not known, it is widely accepted that a combination of

genetic predisposition and environmental influence results in the loss of immunologic tolerance

and induction of autoimmunity. The immune system plays a central role in this process by

promoting the recognition of self-antigens and subsequent production of autoantibodies.

Hyperactivation of lymphocytes, ineffective clearance of apoptotic cells and aberrant cytokine

production are among the most studied immunological defects in SLE.

During a normal immune response to foreign antigens, antigen presenting cells (APCs)

such as dendritic cells, macrophages and B lymphocytes present processed antigenic peptides to

CD4+ helper T cells via class II major histocompatibility complex (MHC) molecules. Through

direct cell contact and cytokine secretion, these helper T cells in turn stimulate B lymphocytes to

initiate the production of antibodies. Although lymphopenia is often a manifestation of SLE, B

and T cells from lupus patients often exhibit a hyperactive phenotype. B cells from SLE patients

display enhanced proliferation, elevated antibody production and aberrant intracellular signaling

upon B cell receptor activation (10, 11). Expansion of memory cells and plasma cells has also









been linked to the hypergammaglobulinemia associated with SLE (12). Similarly, T cells from

lupus patients exhibit abnormal signal transduction upon activation (13). They also show

elevated surface expression of costimulatory molecules such as CD40-ligand and the T-cell

specific inducible costimulator (ICOS) (14), which help to promote B cell activation.

Paradoxically, while lymphocytes from lupus patients are highly reactive to nuclear antigens (15,

16), they often respond weakly to foreign antigens such as tetanus toxoid (16). This discrepancy

may be responsible for the increased susceptibility to infections and high failure rate of

vaccination seen in SLE patients.

The abnormal activation of lymphocytes in SLE may be partly explained by dysregulated

production of cytokines, a group of molecules critical to the function of innate and adaptive

immunity. In line with the excess antibody production, elevated serum levels of the T helper 2

(Th2) cytokines IL-6 (a required factor for the differentiation of B cells into antibody-secreting

plasma cells) and IL-10 (a promoter of IgG production) are found in lupus patients (17, 18).

Over-expression BAFF/Blys, which promotes the survival and proliferation of B cells, has also

been recently described (19). While Th2 cytokines are essential for antibody production (20),

activation of T cells and monocyte/macrophages by Thl cytokine production are linked to tissue

damage in SLE. Increased glomerular expression of IL-12 and IFN-y is associated with lupus

nephritis and ablation of these cytokines ameliorates glomerulonephritis in several models of

SLE (21-24)). The cytokine imbalance in SLE is complex and likely involves a broad-spectrum

of these immune modulators. More recently, research studies have shown a prominent role of

the anti-viral IFN-I in the pathogenesis of SLE. The immunobiology of IFN-I and their role in

both human lupus and murine models will be discussed in detail in the next section.









Another immunological abnormality seen in SLE is the impairment in phagocyte

functions. Apoptosis or programmed cell death is a physiological process that controls cell

proliferation and maintains tissue homeostasis. Despite the continuous turnover of aging or

injured cells, apoptotic cell debris normally does not activate the immune system as they are

rapidly taken up by surrounding cells or phagocytes such as macrophages (25). This clearance

mechanism is impaired in lupus patients and the accumulation of dead or dying cells provides a

source of a variety of intracellular antigens normally not exposed on the cell surface (26). In

addition, endogenous nucleic acids such as DNA and RNA can also function as a danger signal

to activate antigen presenting cells via TLRs (27, 28). This problem is compounded by the

deficiency of complement and impaired activity of endogenous nucleases such as DNase I and II

in the serum of SLE patients (29). This defective clearance mechanism also may be involved in

the pathogenesis of photosensitivity, a common clinical manifestation of lupus patients.

Exposure to sunlight is often sufficient to trigger a disease flare (2). It has been hypothesized

that apoptosis of skin cells and the inability to clear the debris may be partially accountable for

this effect.

Treatment

Currently there is no cure for SLE and drug treatment is directed by disease severity and

organ involvement. In milder cases, non-steroidal anti-inflammatory drugs (NSAIDs) and anti-

malarials are effective for the treatment of fatigue, skin rash, and arthritis (2). High dose

corticosteroids are often used during a disease flare followed by low-dose maintenance therapy.

For lupus nephritis, cytotoxic drugs such as cyclophosphamide and mofetil mycophenolate are

effective in controlling renal damage (2). However, most current medications act by non-

specifically suppressing the immune system and are associated with many side-effects. Many

ongoing clinical trials are evaluating the efficacy of novel compounds that specifically inhibit









lymphocyte activation molecules (i.e. anti-CD40 and CTLA4-Ig) or cytokines such as IL-6 and

IFN-I.

Involvement of IFN-I in the Pathogenesis of SLE

Originally discovered for their anti-viral properties, IFN-I exert a multitude of

immunological functions and have been increasingly recognized as a key cytokine in the

pathogenesis of autoimmune diseases. Increased serum IFN-I levels in lupus patients were first

reported over twenty years ago (30). Recent studies have found that more than half of SLE

patients display excess production of IFN-I and upregulation of a group of IFN-I-stimulated

genes (ISGs), a feature associated with active disease (31-33). In addition, IFN-I also

contributes to the pathology of several murine models of SLE. This section summarizes the

biology of the IFN-I and current evidence of their involvement in human SLE as well as murine

models of the disease.

Type-I Interferon Signaling Pathways

The fourteen subtypes of IFN-a, four IFN-ca pseudogenes, and the single IFN-P3, -K, -co,

and -s species together comprise the IFN-I cluster on human chromosome 9p22 within a

genomic duplication (34, 35). In terms of immunity and autoimmunity, IFN-a and IFN-0 are the

main types of interest. All members of the IFN-I family bind to a ubiquitously expressed

heterodimeric receptor complex composed of an ca (IFNAR1) and a 3 (IFNAR2) chain. While

IFNAR2 serves as the ligand-binding domain, both chains are required for effective signal

transduction (36).

Ligand-induced dimerization of the receptor chains results in auto- and trans-

phosphorylation of two receptor-associated Janus protein tyrosine kinases: Tyk2 on IFNAR1 and

Jaki on IFNAR2 (37). These events provide docking sites for the recruitment and









phosphorylation of STAT1 and STAT2. Phosphorylated STAT1/STAT2 heterodimers then

translocate into the nucleus, associate with IFN regulatory factor 9 (IRF-9, also known as p48)

and form the heterotrimeric complex IFN-stimulated gene factor 3 (ISGF3) (36, 38).

Subsequently, ISGF3 initiates the transcription of hundreds of IFN-I inducible genes by binding

to the upstream consensus IFN-stimulated response elements (ISRE) (39). Although not directly

involved with Jak-STAT signaling, activation of p38 mitogen-activated protein kinase (MAPK)

is required for effective formation of ISGF3 and transcription of ISRE-regulated genes (40-42).

A schematic of the IFN-I signaling cascade is depicted in Figure 1-1A.

Immunomodulatory Effects of IFN-I

The IFN-I system is an essential component linking innate and adaptive immunity.

Secreted in response to extracellular or intracellular pathogens, IFN-I enhance the expression of

class I and class II major histocompatibility complex (MHC) molecules on antigen presenting

cells and induce dendritic cell maturation (43). During the early phases of an infection, IFN-I

signaling also activates the transcription of antimicrobial genes, linking innate and adaptive

immunity and inhibits the proliferation of infected cells (44-46). In adaptive immunity, IFN-I

regulate T cell functions by promoting the effects of THI cytokines and augmenting the survival

of activated T cells (47). IFN-I signaling is also crucial for effective B cell differentiation and

memory B cell responses (48). Moreover, IFN-I have adjuvant effects, augmenting antigen-

specific immunoglobulin production and isotype switching when administered along with

soluble antigen (49). The broad effects of IFN-I further extend to the regulation of other

cytokines. IFN-I can up-regulate IFN-y production, enhance IL-6 signaling, and stimulate the

proinflammatory activity of IL-10 (50). These diverse and potent immune-enhancing effects

may underlie the involvement of IFN-I in autoimmune disorders.









Pathways of IFN-I Induction

The production of IFN-I in response to pathogens is mediated in part by the Toll-like

receptors (TLRs), a highly conserved family of membrane receptors specialized in the

recognition of pathogen-associated molecular patterns (51). While almost all TLRs are capable

of triggering the production of inflammatory cytokines such as tumor necrosis factor a (TNFa)

and IL-6 upon ligand binding, only TLR3, -4, -7, -8, and -9 trigger IFN-I production. TLR3

recognizes viral double-stranded RNA whereas TLR4 is the receptor for bacterial

lipopolysaccharide and certain viral proteins. Induction of IFN-P through these two surface

TLRs requires the adaptor molecule Toll/interleukin-1 receptor domain-containing adaptor-

inducing IFNp (TRIF) (52). In contrast to the endosomal location of TLR3, TLR4 is present on

the cell surface, although recent evidence suggests that upon LPS binding TLR4 also enters the

endosomal compartment prior to TRIF activation (53). TLR-7/-8, and -9 are also located in

endosomes but signal IFNP expression via the adaptor protein myeloid differentiation factor 88

(MyD88) (54). TLR7 and -8 bind viral single-stranded RNA while TLR9 recognizes

unmethylated CpG DNA found in bacteria (55, 56). Activation of TRIF or MyD88 recruits IKB

kinases (IkkB), which phosphorylate the downstream factors IRF-3, IRF-5, and IRF-7,

culminating in the transcription of IFN-P. Once expressed and secreted, IFN-P binds to the

IFNAR in an autocrine manner, resulting in the transcription of a group of IFN-I inducible genes.

Subsequent expression of IFN-a and IRF-7, an essential transcription factor for IFN-I,

establishes a positive-feedback loop for signal amplification (57, 58). The TLR signaling

pathways leading to IFN-I production are illustrated in Figure 1-1B.

Recently, several viruses have been shown to induce IFN-I production independent of

TLRs, uncovering novel mechanisms of detecting intracellular viral RNA via the cytoplasmic









helicase proteins retinoic-acid-inducible protein I (RIG-I) and melanoma-differentiation-

associated gene 5 (MDA-5) (59, 60). These sensors mediate IFN-I production through the

adaptor IPS-1 (IFN-0 promoter stimulator protein-1; also known as MAVS, VISA, or Cardif)

(61). Finally, research on intracellular infection by Listeria monocytogenes have unveiled a

pathway to trigger IFN-I production by intracellular DNA (62). Although the molecule

responsible for DNA interaction remains unclear, this pathway requires the activation of TANK-

binding kinase-1 (TBK-1) and IRF-3 (63). These pathways are also depicted in Figure 1-1B.

Interferon-Producing Cells

Although almost all nucleated cells are capable of producing IFN-I, a small population of

"natural IFN-producing cells" in the circulation, now known as plasmacytoid dendritic cells

(PDC) are the most potent (64, 65). Human PDCs are lineage negative cells generally

characterized by the surface expression of CD4, CD123, CD83, and class II MHC. Two other

markers, blood dendritic cell antigen 2 (BDCA-2) and BDCA-4, are also commonly used for

detecting and isolating human PDCs (66). These natural IFN-I producers can synthesize up to

1000-fold more IFN-a/3 than other cells and production can be enhanced further upon activation

of endosomal TLR7 and TLR9. A high constitutive expression of IRF-7 in these cells may be

partly responsible for their high IFN-I production (67). Upon activation, PDCs migrate to

lymph nodes in response to chemokines.

Myeloid dendritic cells (MDC) are also strong IFN-I producers during viral infections, but

whether they are as potent as PDCs is controversial (65, 68). Although monocytes/macrophages

are weak producers of IFN-I in response to TLR ligands, activation of the cytoplasmic nucleic

acid sensors can trigger high levels of IFN-P production in these cells (62). In fact, it was

recently shown that macrophages in the lungs function are the primary IFN-I producers during

viral infection and PDCs assumes the role in the absence of macrophages (69).









Dysregulated IFN-I Production in Human SLE

Given the pleiotropic effects of IFN-I on DC maturation, T cell survival, and antibody

production, it is conceivable that excess IFN-I or aberrant regulation of IFN-I signaling could

contribute to autoimmunity. Consistent with that possibility, IFNu treatment in hepatitis C

infection, malignant carcinoid syndrome, or chronic myelogenous leukemia is associated a wide

array of autoimmune manifestations. A positive fluorescent ANA test can be found in as many

as 22% of patients treated with IFN-a (70). The onset of SLE, autoimmune (Hashimoto)

thyroiditis, autoimmune hemolytic anemia, rheumatoid arthritis, vasculitis, and psoriasis all have

been reported following IFNa therapy (71-73).

High levels of IFNuc in the sera of SLE patients were first described by Hooks et al. in

1979 (30). The significance of this observation remained unclear for decades until it was shown

that serum from lupus patients, especially those with active disease, promotes the differentiation

of blood monocytes into dendritic cells (74). The capacity to induce dendritic cell differentiation

correlates with IFN-I levels and neutralization of IFN-I completely abrogates this effect.

Recent studies further demonstrated that the dysregulation of IFN-I in SLE is also evident

in gene expression profiles of lupus peripheral blood mononuclear cells (PBMCs). Since all

IFN-I subtypes signal through the same receptor complex, levels of IFN-I can be quantified by

measuring interferon stimulated gene (ISG) expression using gene microarray and real-time

polymerase chain reaction (PCR) (31, 32, 75). IFN-I inducible genes over-expressed in SLE

include anti-viral proteins [e.g. myxoma-response protein-1 (Mx-1)], apoptosis regulators

phospholipidss scramblase, TRAIL), MHC molecules (class I and II), Toll-like receptors (TLR-3

and -7), Fcy receptors (CD32a and CD64) and several interferon-inducible chemokines

(CCL2/MCP-1, CXCL10/IP-10). PBMC expression of ISGs, therefore, provides a robust









surrogate read-out of systemic IFN-I levels. Approximately half of SLE patients display

abnormally high ISG expression (defined as > 2 standard deviations above the mean ISG

expression in healthy controls). This "interferon signature" is associated with disease severity,

renal involvement, and the presence of autoantibodies against dsDNA and RNA-associated

nuclear antigens such as Sm/nRNP, SSA/Ro, and SSB/La (33, 76).

In healthy individuals, the production of IFN-I and expression of ISGs are elevated

transiently during viral infection. However, why this "interferon signature" is consistently

detected in many SLE patients is poorly understood. While evidence linking the abnormal IFN-I

production to a common exogenous trigger (i.e. viruses) has not been convincing, a number of

endogenous mechanisms for IFN-I induction have been identified. An early study described a

serum interferon-inducing factor (IIF) suggestive of DNA-antibody immune complexes in SLE

patients (77). Supporting these findings, immune complexes consisting of plasmid DNA and

anti-dsDNA autoantibodies stimulate IFN-I in normal PBMC (28), while mammalian DNA alone

has little effect (78). The identification of TLRs strengthened the notion that self-DNA may

trigger IFN-I production in SLE. In the presence FcyRIIa (CD32), internalized DNA-containing

immune complexes activate dendritic cells via TLR-9, the receptor for unmethylated CpG DNA

found in bacteria (and plasmid DNA) (79).

Several groups have recently reported that endogenous RNA also may induce IFN-I by

binding to TLRs (27, 80, 81). Originally described to recognize viral G/U-rich single-stranded

RNAs (55), TLR7 is capable of binding certain mammalian RNA sequences resulting in the

activation of PDCs (80, 81). Consistent with these reports, human Ul RNA (associated with

snRNP particles) and Y RNAs (associated with Ro60 protein) also potently induce IFN-I

production through an endosomal MyD88-dependent pathway involving TLR7 (80, 82).









Based on these findings, many researchers believe that the endogenous stimulatory DNA

and RNA molecules may originate from apoptotic or necrotic cells in the circulation (83).

Unlike healthy individuals, the mechanism for apoptotic cell clearance is impaired in SLE

patients, providing a source of endogenous nucleic acids. It is believed that the presence of DNA

or RNA is not sufficient to initiate an inflammatory response because the TLRs recognizing

these ligands are located in the endosomes (78). In the presence of autoantibodies (i.e. anti-

dsDNA, anti-Sm/RNP), however, the formation of immune complexes may then enhance the

internalization the endogenous nucleic acids present in apoptotic bodies into endosomes (Figure

2). Thus, interaction of the endogenous ligands with corresponding endosomal TLRs is

hypothesized to be responsible for the "interferon signature" in SLE, though this remains to be

verified experimentally and whether immune complex or FcyRs are absolute requirements is

controversial (27, 84).

Most studies to date have attributed the elevated IFN-I production in SLE to PDCs, a

view supported by the ability of DNA and RNA immune complexes to induce IFN-I production

by PDCs in vitro (28, 80). The TLRs implicated in binding endogenous nucleic acids,

specifically TLR7, 8 and 9 are highly expressed on human PDCs and B cells but not myeloid

dendritic cells (MDCs), monocytes, or macrophages (85). However, the number of circulating

PDCs in SLE patients is unexpectedly low. A profound reduction in the number of PDCs and

MDCs is characteristic of SLE patients, especially those with renal involvement (33). Similar

findings have been reported by other groups and most believe that the depletion of PDCs reflect

migration of these cells to tissues and lymphoid organs following activation (64). Consistent

with this view, increased numbers of PDCs and elevated IFN-I secretion have been found in

lupus skin lesions and lymph node biopsies from SLE patients (86). Nevertheless, direct









evidence showing PDCs are the primary source of excess IFN-I in SLE is lacking. Depletion of

PDCs in vitro reduced IFN-I production by only -40%, suggesting that other cell types may also

be involved (74).

Evidence of IFN-I involvement in Murine Models of SLE

The involvement of IFN-I in the pathogenesis of SLE has also been studied in many

experimental models of the disease. While both New Zealand Black (NZB) and New Zealand

White (NZW) strains are autoimmune-prone, the Fl generation bred from these strains (NZB/W

F l) spontaneously develop a lupus-like disease characterized by immune-complex

glomerulonephritis and autoantibodies to dsDNA (87). The NZB/W model is most valuable for

studying the role of genetics in SLE as multiple susceptibility loci are required for disease

manifestations. A recent study illustrated that the development of glomerulonephritis, ANA and

anti-dsDNA antibodies is accelerated by exogenous IFN-a (88), whereas deletion of IFN-a/P

receptor (IFNAR) in NZB mice slows the progression of autoimmune hemolytic anemia and

enhances survival (89). In line with these findings, the development of ANA and renal disease in

B6.Nba2 congenic mice (C57/BL6 mice with a susceptibility loci derived from the NZB strain)

is also dependent on IFN-I signaling (90).

Unexpectedly, the role of IFN-I seems to be reversed in the MRLlpr/lpr model. The

combination of the autoimmune-prone MRL background and the lpr mutation (disruption of the

pro-apoptotic regulator fas) results in a lymphoproliferative disorder with features of SLE

including glomerulonephritis, arthritis, and autoantibodies to Sm and anti-dsDNA (91). In

contrast to NZB/W Fl mice, disease amelioration has been reported in MRLlpr/1pr mice treated

with exogenous IFN-I while IFNAR deficiency reduced survival (92). Whether these findings

reflect the role of IFN-I in human SLE remains to be determined as intrinsic upregulation of









IFN-I and ISG expression (in the absence of exogenous IFN-I) seen in lupus patients has not

been reported in these mouse models.

The only reported murine model that recapitulates the "interferon signature" seen in

human SLE is experimental lupus induced by the hydrocarbon 2,6,10,14-tetramethylpentadecane

(TMPD), also known as pristane (93). For decades, TMPD has been utilized to induce

plasmacytoma and enhance antibody production by hybridoma (94, 95). In 1994, Satoh et. al.

reported that a single peritoneal injection of TMPD in non-autoimmune prone strains (e.g.

BALB/c) was sufficient to induce many key immunological and clinical features of human SLE,

including the production of autoantibodies against dsDNA and Sm/nRNP, and the development

of immune complex-mediated glomerulonephritis as well as late-onset arthritis (96, 97). In

addition to the chronic inflammatory response in the peritoneal cavity, mice treated with TMPD

display upregulated expression of ISGs such as Mx-1 and IRF7 in the peripheral blood.

Importantly, renal disease and the generation of anti-dsDNA and anti-Sm/nRNP autoantibodies

are highly dependent on IFN-I as these features of SLE are abolished in IFNAR-deficient mice

(93). Consistent with the ability to elicit IFN-I production, TMPD-treatment of NZB/W Fl mice

accelerates disease progression and induces the development of anti-Sm/nRNP autoantibodies,

which are normally absent in this strain (98).

The presence of the "interferon signature" and the dependency of disease features on

IFN-I signaling offer the unique opportunity to dissect the role of IFN-I in experimental lupus.

The mechanism responsible for TMPD-induced IFN-I production and the subsequent lupus

manifestations is largely unknown. Whether PDCs and/or other cell subsets are the main

producers of IFN-I in this model is of great interest since the source of IFN-I in human SLE is

also unclear. Finally, whether chronic inflammation induced by the hydrocarbon contributes to









the production of IFN-I and the onset of autoimmunity also warrants attention. The subsequent

chapters will address these questions in detail. Results from these studies may shed light on the

same questions regarding human SLE.










0O
000
/00 IFN-a/p

IFNAR


*i]FjAK1


Mx-1
IRF-7
Sca-1
MCP-1


2)


LPS dsRNA


0 IFN a/3
00
n 0


Figure 1-1. Schematic of IFN-I signaling pathways. A) All subtypes of IFN-I bind to the IFNAR
complex and initiate phosphorylation of the kinases JAK1 and Tyk2. Subsequent
phosphorylation and translocation of STAT1 and STAT2 triggers the transcription of
interferon-stimulated genes such as Mx-1, IRF7, Sca-1 and MCP-1. B) IFN-I
induction by pathogen-associated molecular patterns such as viral RNA and DNA is
mediated by TLRs and cytoplasmic nucleic acid sensors.


NFkB antiviral
Cytoplasmic -W response
ssRNA md -A

Cytoplasmic DNA--











dsDNA ssRNA
Immune complexes



anti-dsDNA I anti-Sm/RNP
antibodies antibodies




Jr internalization



j endosome
TLR-9 TLR-7

IFN-I production


Figure 1-2. Schematic of IFN-I induction by endogenous nucleic acids. Mammalian nucleic
acids are normally non-stimulatory because they do not enter endosomes, where
TLR7 and TLR9 are present. Immune complexes formed by lupus autoantibodies
and endogenous nucleic acids are internalized via FcyRIIa and allows the interaction
between the nucleic acids and TLRs, leading to the production of IFN-I.









CHAPTER 2
METHODS AND MATERIALS

Mouse Strains

These studies were approved by the Institutional Animal Care and Use Committees at the

University of Florida (Gainesville, FL) and Osaka University (Osaka, Japan). C57BL/6 wild

type, B6.IL-1R/ -, B6.IL6- -, B6.CCR2-/-, BXSB.Yaa males and BXSB female controls, wild-type

BALB/cJ and BALB/c.IFNy-/- mice were purchased from Jackson Laboratories (Bar Harbor,

ME). B6.FVB-TgItga-DTEGFP.57Lan/J backcrossed to a BALB/c background, referred to as

CD1 c-DTR (diphtheria toxin receptor) mice (99, 100), were a gift from L.Moldawer (UF).

CD1 c-DTR mice were maintained as heterozygote crosses and littermates not expressing the

transgene were used as controls. BXSB X B6 F 1 mice were generated by breeding BXSB males

with C57BL/6 females. FcyRI/II-/- mice were purchased from Taconic (Hudson, NY).

129Sv/Ev Type I interferon receptor a-chain deficient (IFNAR--) mice and wild type controls

(129Sv/Ev) were purchased from B&K Universal Limited (Grimston, Aldbrough, England).

These mice were all housed in a specific pathogen-free (SPF) facility at Malcolm Randall VA

Medical Center (Gainesville, FL).

MyD88-/-, TRIF-/-, TLR7-/-, TLR9-/-, IFNAR-/- mice backcrossedd >7 generations to the

C57BL/6 background) and IPS-1-/-, TNF-/-, TNF-/-TBK-l/- (on a mixed 129Sv/ B6 background)

have all been described previously (52, 54, 56, 69, 101, 102) and were bred and maintained in a

SPF facility in the Research Institute for Microbial Diseases, Osaka University. Wild-type

C57BL/6 and heterozygous littermates were used as controls. BALB/c.TLR7/- and TLR9-/- mice

backcrossedd >8 generations to the BALB/c background) and wild-type BALB/c mice used for

long-terms studies of autoantibody production from acquired from Oriental Bioservices (Kyoto,

Japan) and housed in an SPF facility at Osaka University.









Treatment and Tissue Harvest

Eight to sixteen week-old mice received a single intraperitoneal (i.p.) injection of 0.5 ml

TMPD (Sigma-Aldrich, St. Louis, MO), mineral oil (Harris Teeter, Mathews, NC), 4%

thioglycollate (BD Bioscience, San Jose, CA), squalene (Sigma), n-hexadecane (Sigma), or

PBS. For short-term experiments, blood samples were obtained before, and weekly after TMPD

treatment by tail-vein bleed. Peritoneal cells were collected by lavage using 5 ml of DMEM

supplemented with 10% fetal calf serum, 10 mM HEPES, glutamine, and penicillin/streptomycin

(complete DMEM) and isolated for RNA extraction or flow cytometry analysis and lavage fluid

was stored at -800C for ELISA. Spleen cells were collected by meshing the spleen against a

45[M plastic strainer followed by red blood cell lysis before resuspension in complete DMEM.

For long-term experiments, serum was collected monthly after treatment for 6-8 months.

Kidneys were harvested and frozen immediate in OCT compound (TissueTek, Torrance, CA) for

tissue section. Cecal ligation and puncture were performed as described (100, 103).

Flow Cytometry and Cell Sorting

The following conjugated antibodies were used: CD1 lb-phycoerythrin (PE), anti-CD 1 ib-

allophycocyanin (APC), anti-CD4-APC, anti-CD8-PE, anti-CD 11 c-PE, anti-CD 11 c- fluorescein

isothiocyanate (FITC), anti-B220-APC Cy7, anti-CD80-PE, anti-CD86-FITC, anti-I-A/I-E-PE,

anti-Mac-3-FITC, anti-Ly6G-PE, anti-Sca-1-PE, anti-NK1.1-PE (all from BD Bioscience, San

Jose, CA), anti-Ly6C-FITC, anti-Ly6C-biotin, avidin-APC (eBioscience, San Diego, CA), anti-

F4/80-FITC, anti-Moma2-FITC (Serotec, Raleigh, NC), and anti-CD 1 lb-Pacific blue (Caltag

Laboratories, Burlingame, CA). Prior to surface staining, 105 peritoneal or ficoll gradient-

isolated peripheral blood cells were incubated with anti-mouse CD16/32 (BD Bioscience) for 10

min. Cells were then stained with optimized amount of primary antibody or the appropriate

isotype control for 10 min at room temperature before washing and resuspending in PBS









supplemented with 0.1% NaN3 and 1% bovine serum albumin. For intracellular staining, cells

were permeabilized with Perm/Fix buffer (BD Bioscience) and incubated with antibodies against

Mac-3 and Moma-2 in Perm/Wash buffer (BD Bioscience). Fifty thousand cells per sample

were acquired by a CYAN cytometer (Dako, Fort Collins, CO) and analyzed with FCS Express 3

(De Novo Software, Ontario, Canada).

For cell sorting, peritoneal cells from TMPD-treated mice (107) were stained with anti-

Ly6G-PE, washed, and incubated with magnetic bead-conjugated anti-PE (Miltenyi Biotec,

Auburn, CA). Granulocytes (>99% purity) were positively selected using MS columns while the

negative fraction was stained with anti-CD 1 lb-APC, washed, and incubated with magnetic bead-

conjugated anti-APC (Miltenyi Biotec). Positive selection using MS columns yielded >85%

Ly6Chi monocytes. The negative fraction consisted of lymphocytes and dendritic cells (DCs).

Cell sorting using a FACS DIVA flow cytometer (BD Bioscience) yielded similar results with a

higher purity of Ly6Chi monocytes (>95%). For morphological analysis, 3 X 104 sorted cells

were cytospun onto glass slides and stained using the Hema3 kit (modified Wright stain; Fisher

Scientific, Pittsburg, PA)

Conventional and Real-Time Quantitative PCR

Total RNA was extracted from 106 cells using Trizol reagent (Invitrogen, Carlsbad, CA)

and cDNA was synthesized using Superscript II First-Strand Synthesis Kit (Invitrogen). Real-

time PCR was performed using the SYBR Green Core Reagent Kit (Applied Biosystems, Foster

City, CA) with an Opticon II thermocycler (MJ Research, Waltham, MA). Amplification

conditions were: 950C for 10 min, followed by 45 cycles of 940C for 15 s, 600C for 25 s, and

720C for 25 s. After the final extension (720C for 10 min), a melting-curve analysis was

performed to ensure specificity of the products. IFN-I genes were amplified by conventional









PCR using a PTC-100 programmable thermal controller (MJ Research). Amplification

conditions were: 950C for 5 min, followed by 40 cycles of 940C for 30 s, 600C for 1 min, and

720C for 1 min. After a final extension (720C for 10 min), PCR products were analyzed by

agarose gel electrophoresis. Sequences of all real-time and conventional PCR primers are

provided in Table 2-1.

Cytokine ELISA

ELISAs for IL-6, IL-12, MCP-1, TNF-a and IFN-0 in peritoneal lavage fluid and cell

culture media were performed as using monoclonal antibody pairs (BD Bioscience). After

incubation with biotinylated cytokine-specific antibodies, 100 [il/well of 1:1000 streptavidin-

alkaline phosphatase was added and the reaction was developed with p-nitrophenyl phosphate

substrate (Sigma). Standard curves were generated using recombinant cytokines and cytokine

concentrations were calculated using a four-parameter logistic equation (Softmax Pro 3.0).

Monocyte and Dendritic Cell Depletion

Depletion of peritoneal monocytes was performed by injecting 200 gL of clodronate-

containing liposomes (clo-lip) a gift from Roche Pharmaceuticals) i.p. in wild-type BALB/c mice

treated with TMPD two weeks earlier. To trace monocyte subsets in vivo, PBS-containing

liposomes were labeled with the fluorescent dye 1,1'-dioctadecyl-3,3,3',3'-

tetramethylindodicarbocyanine perchlorate (DiD) as described (12, 13). To label Ly6C-

monocytes, 150 [tL of DiD-liposomes were injected i.v. into TMPD-treated mice. Clo-lip (200

[l) was delivered i.v. 24 hr prior to the injection of DiD-liposomes for the labeling of Ly6Chi

monocytes. Analysis was performed 24 hr after labeling. DC ablation was performed in TMPD-

treated CD1 c-DTR mice by injecting 4 ng/g body weight of diphtheria toxin (DT; Sigma) i.p.

Mice were sacrificed for analysis 48 hr after clo-lip or DT administration.









Autoantibody Measurement

Antinuclear antibodies were measured by indirect immunofluorescence using HEp-2 cells

(INOVA, San Diego, CA). Sera were diluted 1:40 and titers were determined using an Image

Titer titration emulation system (Rhigene, Inc., Des Plaines, IL).

Anti-nRNP/Sm antigen capture ELISA was performed by coating microtiter plates (Nunc)

overnight with 50 [tl of human anti-nRNP IgG (20 pg/ml). Half of the wells were incubated for

1 h with 50 [l of K562 cell lysate and the other half with NET/NP40 alone. After washing, 100

[l of diluted mouse serum (1:250) were added to wells coated with either K562 cell lysate or

buffer alone, incubated for 1 h, washed three times, followed by 1 h incubation with alkaline

phosphatase-conjugated goat anti-mouse IgG antibodies (Southern Biotechnology). OD reading

at 405 nm was converted to units based on a standard curve generated by known concentrations

of anti-RNP antibodies (clone 2.73). Specific binding was determined by subtracting the value

of the control wells (coated with antibodies but no antigen) from the value of the antigen-coated

wells.

To measure anti-dsDNA autoantibodies, ELISA plates were coated with calf thymus DNA

(60tg) resuspended in Reacti-bind DNA binding buffer (Pierce). Anti-ssDNA autoantibodies

were measured similarly except calf thymus DNA was denatured (95 C x 5 min) and incubated

on ice for 5 min prior to resuspension in Reacti-bind buffer. After overnight incubation, plates

were blocked with NET/NP40 + 0.5% BSA for 1 h, followed by the addition of 100 tl of diluted

mouse serum (1:250) to each well. Subsequent steps were performed as described above for

Anti-nRNP/Sm ELISA.

In Vitro Stimulation

Whole PECs or sorted populations were resuspended in complete DMEM (containing 10%

FCS, 10 mmol/L HEPES, glutamine, and penicillin/streptomycin plus 10 U/ml heparin) were









seeded on 96 well cell-culture plates (5 X 104 cells/well). Cells were stimulated with the

indicated doses of peptidoglycan, poly I:C, R848, CpG ODN2395 (Invivogen, San Diego, CA),

or LPS (from Salmonella typhimurium; Sigma) and incubated at 37 C in a 5% CO2 atmosphere

for 24 h before collecting the supernatant.

Cell Culture with TMPD

One mL of TMPD, mineral oil, or squalene was added to 9 mL of fetal bovine serum in a

15 mL polypropylene tube and rotated for 48 h at 40C. The surface layer of unincorporated

hydrocarbon oil was removed by aspiration at the end of the incubation. The amount of TMPD

incorporated using this method was approximately 1 [tg/mL as determined by gas

chromatography / mass spectroscopy (not shown; Analytical Toxicology Core, University of

Florida). J774 cells or BMDM were seeded on 24-well plates (5 X 105 cells/well) and cultured

overnight in complete DMEM containing 10% FCS with or without hydrocarbon oils. For

subsequent stimulation, cells were washed with PBS and fresh complete medium was added

prior to the addition of TLR ligands. Incorporation of TMPD in DMSO and P-cyclodextrin

(Sigma) has been described previously (104). TMPD (10% v/v) also was added to ethanol or

mannide monooleate (Sigma; 5% in PBS). Solvent alone was used as a control and a range of

TMPD concentrations (3 300 pM) was tested.

Endocytosis and Phagocytosis Assays

Endocytosis was quantified by uptake of FITC-dextran (5 tg/mL; Sigma) and

phagocytosis by internalization of FITC-labeled microbeads (10:1 beads:cells ratio; Invitrogen)

or DiD-labeled apoptotic BW5147 cells (10:1 apoptotic cell : target cell ratio) following

overnight incubation of J774 cells in complete medium with or without TMPD. Apoptosis of

BW5147 cells was induced by heat-shock at 45 C for 10 min. Following 4 h incubation at 37









C, apoptotic cells (>80% annexin V positive) were labeled with the fluorescent dye DiD

(tetramethylindodicarbocyanine perchlorate; Invitrogen). J774 Cells were washed and incubated

(in PBS + 0.5% BSA) with the fluorescent substrates for 30 min at 370 C, washed 3 times, and

analyzed by flow cytometry.

Statistical Analysis

For quantitative variables, differences between groups were analyzed by the unpaired

Student's t-test. Survival curves were analyzed using the log-rank test. ANA titers and

autoantibody levels were compared using Mann-Whitney U test. Data are presented as mean +

s.d. All tests were two-sided and a p-value less than 0.05 was considered significant. Statistical

analyses were performed using Prism 4.0 (GraphPad Software, San Diego, CA).










Table 2-1. Conventional and real-time PCR primers
Gene Forward
Mx-1 GATCCGACTTCACTTCCAGATGG
CCL2 AGGTCCCTGTCATGCTTCTG
IP-10 CCTGCAGGATGATGGTCAAG
IFN-a* ATGGCTAGRCTCTGTGCTTTCCT
IFN-a5* TGTGACCTTCTTCAGACTC
IFN-P* AGCTCCAAGAAAGGACGAACAT
iNOS ATCGACCCGTCCACAGTATG
IL-12p40 GAGTGGACTGGACTCCCGA
P-actin CCCACACTGTGCCCATCTAC
IRF-7 TGCTGTTTGGAGACTGGCTAT
CCR2 CTGCCTGCAAAGACCAGAAG
TLR3 TCCGCCCTCTTCGTAACT TG
TLR4 GAGGCAGCAGGTGGAATT GT
TLR7 GGCTGAACCATCTGGAAGAA
TLR9 TGCTTTGGCCTTTCACTCTT
CCL7 GATCTCTGCCACGCTTCTGT
CCL12 GTCCTCAGGTATTGGCTGGA
CX3CL1 CGCGTTCTTCCATTTGTGTA
CXCL1 GCTGGGATTCACCTCAAGAA
CXCL5 CCCCTTCCTCAGTCATAGCC
Arg- 1 GCACTGAGGAAAGCTGGTCT
18S RNA CGGCTACCACATCCAAGGAA
* primers designed for conventional PCR.


Reverse
CATCTCAGTGGTAGTCAACCC
GGATCATCTTGCTGGTGAAT
GAATTCTTGCTTCGGCAGTT
AGGGCTCTCCAGAYTTCTGCTCTG
CTCCTCCTTGCTCAATC
ATTCTTGCTTCGGCAGTTAC
GATGGACCCCAAGCAAGACT
CAAGTTCTTGGGCGGGTCTG
CGCTCGGTCAGGATCTTCAT
TCCAAGCTCCCGGCTAAGT
TATGCCGTGGATGAACTGAG
TTGGCGGCTGGTAATCTTCT
TGCTCAGGATTCGAGGCTTT
TAAGCTGGATGGCAGATCCT
AACTGCGCTCTGTGCCTTAT
ATAGCCTCCTCGACCCACTT
CACTGGCTGCTTGTGATTCT
AGCTGATAGCGGATGAGCAA
TCTCCGTTACTTGGGGACAC
TGCATTCCGCTTAGCTTTCT
GACCGTGGGTTCTTCACAAT
GCTGGAATTACCGCGGCT









CHAPTER 3
NOVEL TYPE-I INTERFEREON-PRODUCING CELLS IN TMPD-INDUCED LUPUS

Introduction

Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder affecting multiple

organs including the skin, joints, kidneys, lungs, heart and the nervous system (1). Antinuclear

antibodies against small ribonucleoproteins (snRNPs) and double-stranded (ds) DNA are

pathognomonic of the disease (1). Recent evidence suggests that type-I interferons (IFN-I), a

family of anti-viral cytokines, are integral to the pathogenesis of SLE. More than half of SLE

patients display upregulation of a group of IFN-I-stimulated genes (ISGs) (31-33). This

"interferon signature" is clinically relevant as it correlates with active disease, presence of certain

autoantibodies, and an increased incidence of renal involvement (33, 76). Supporting a causal

role of IFN-I, therapeutic use of recombinant IFN-a is linked to a wide array of autoimmune

manifestations and there are reports of SLE following treatment (72). Although an association

between elevated IFN-I levels and SLE is well established, its origin is unclear.

Experimental lupus induced by 2, 6, 10, 14-tetramethylpentadecane (TMPD) displays key

immunological and clinical features of human SLE, including the production of autoantibodies

against dsDNA and snRNPs, and the development of immune complex-mediated

glomerulonephritis and arthritis (96). We recently reported that TMPD-induced lupus is

associated with excess IFN-I production and upregulation of ISGs (103). This is at present the

only murine model reported to have the "interferon signature". IFN-I signaling is critically

required in this model as shown by the absence of lupus autoantibodies and kidney disease in

IFN-I receptor deficient mice (93). The source of the excess IFN-I, however, has not been

examined. In this study, we aimed to identify and characterize the cell populations) responsible

for increased IFN-I production in TMPD-induced lupus.









Materials and Methods


Mice

Wild-type BALB/cJ, and B6.FVB-TgItgax-DTREFP.57Lan/J backcrossed to a BALB/c

background, referred to as CD 11 c-DTR (diphtheria toxin receptor) mice (99, 100), were

purchased from Jackson Laboratories (Bar Harbor, ME) and housed in a conventional facility.

CD1 c-DTR mice were maintained as heterozygote crosses and littermates not expressing the

transgene were used as controls. 129Sv/Ev Type I interferon receptor a-chain deficient mice

(IFNAR-/-) and wild type controls (129Sv/Ev; IFNAR/) were purchased from B&K Universal

Limited (Grimston, Aldbrough, England). Eight-week-old mice received a single intraperitoneal

(i.p.) injection of 0.5 ml TMPD (Sigma-Aldrich, St. Louis, MO), mineral oil (Harris Teeter,

Mathews, NC), 4% thioglycollate (BD Bioscience, San Jose, CA), squalene (Sigma), n-

hexadecane (Sigma), or PBS. Peritoneal cell isolation, and cecal ligation and puncture were

performed as described (100, 103).

Quantitative Real-Time PCR

Real-time PCR (RT-PCR) and conventional PCR were performed as described (103).

Briefly, total RNA was extracted from 106 peritoneal cells using Trizol reagent (Invitrogen,

Carlsbad, CA) and cDNA was synthesized using Superscript II First-Strand Synthesis Kit

(Invitrogen). RT-PCR was performed using the SYBR Green Core Reagent Kit (Applied

Biosystems, Foster City, CA) with an Opticon II thermocycler (MJ Research, Waltham, MA).

Amplification conditions were: 950C for 10 min, followed by 45 cycles of 940C for 15 s, 60C

for 25 s, and 720C for 25 s. After the final extension (720C for 10 min), a melting-curve analysis

was performed to ensure specificity of the products. IFN-I genes were amplified by

conventional PCR using a PTC-100 programmable thermal controller (MJ Research).

Amplification conditions were: 950C for 5 min, followed by 40 cycles of 940C for 30 s, 600C for









1 min, and 720C for 1 min. After a final extension (720C for 10 min), PCR products were

analyzed by agarose gel electrophoresis.

Flow Cytometry

All antibodies were purchased from BD Bioscience with the exceptions of anti-Ly6C-

FITC, anti-Ly6C-biotin, avidin-APC (eBioscience, San Diego, CA), anti-F4/80-FITC, anti-

Moma2-FITC (Serotec, Raleigh, NC), and anti-CD 1 lb-Pacific blue (Caltag Laboratories,

Burlingame, CA). Cell staining was performed as described (103). Propidium iodide

(Invitrogen) staining was performed following manufacturer's protocol. Fifty thousand events

per sample were acquired by a CYAN ADP flow cytometer (Dako, Fort Collins, CO) and

analyzed with FCS Express 3 (De Novo Software, Ontario, Canada).

Cell Sorting

Peritoneal cells from TMPD-treated mice (107) were stained with anti-Ly6G-PE, washed,

and incubated with magnetic bead-conjugated anti-PE (Miltenyi Biotec, Auburn, CA).

Granulocytes (>99% purity) were positively selected using MS columns while the negative

fraction was stained with anti-CD 1 lb-APC, washed, and incubated with magnetic bead-

conjugated anti-APC (Miltenyi Biotec). Positive selection using MS columns yielded >85%

Ly6Chi monocytes. The negative fraction consisted of lymphocytes and dendritic cells (DCs).

Cell sorting using a FACS DIVA flow cytometer (BD Bioscience) yielded similar results with a

higher purity of Ly6Chi monocytes (>95%). For morphological analysis, 3 X 104 sorted cells

were cytospun onto glass slides and stained using the Hema3 kit (modified Wright stain; Fisher

Scientific, Pittsburg, PA).

Monocyte Labeling and Depletion

Clodronate (a gift from Roche Diagnostics) liposomes (Clo-lip) and 1,1 '-dioctadecyl-

3,3,3',3'-tetramethylindodicarbocyanine perchlorate (DiD)-liposomes were produced as









described (105, 106). To label Ly6C- monocytes, 150 [aL of DiD-liposomes were injected i.v.

into TMPD-treated mice. Clo-lip (200 pl) was delivered i.v. 24 hr prior to the injection of DiD-

liposomes for the labeling of Ly6Chi monocytes. Analysis was performed 24 hr after labeling. To

deplete peritoneal monocytes, 200 pL of clodronate-containing liposomes were injected i.p. in

wild-type BALB/c mice treated with TMPD two weeks earlier.

Dendritic Cell Depletion

DC ablation was performed in TMPD-treated CD1 c-DTR mice by injecting 4 ng/g body

weight of diphtheria toxin (DT; Sigma) i.p. Mice were sacrificed for analysis 48 hr after clo-lip

or DT administration.

Statistical Analysis

For quantitative variables, differences between groups were analyzed by the Student's

unpaired t-test. Bivariate correlations were assessed using Spearman's correlation coefficient.

Data were presented as mean s.d. All tests were two-sided and a p-value less than 0.05 was

considered statistically significant. Statistical analyses were performed using GraphPad Prism

4.0 (GraphPad Software, San Diego, CA).



Results

The "Interferon Signature" Precedes Lupus Disease Onset

Although the link between SLE and IFN-I is firmly established, it remains unclear whether

the "interferon signature" precedes disease manifestations. In the TMPD model of SLE,

production of lupus autoantibodies (anti-Sm, -nRNP and -dsDNA) and development of immune-

complex-mediated glomerulonephritis occur approximately four to six months after peritoneal

exposure to the hydrocarbon oil (96). Upregulation of IFN-a and IFN-P, on the other hand, was

observed in peritoneal exudate cells (PECs) within two weeks of TMPD treatment (Figure 3-1A).









Although consensus PCR primers can amplify most IFN-a subtypes, quantification of ISG

expression allows assessment of total IFN-I proteins, since all IFN-I subtypes bind to single

receptor complex to activate ISG expression. Accordingly, a panel of ISGs including myxoma

resistance protein-1 (Mx-1), macrophage chemoattractant protein-1 (MCP-1/CCL2), and IP-

10/CXCL10 were also highly upregulated (Figure 3-1B) two weeks after TMPD treatment. In

contrast, ISG expression was only modestly increased in mice treated with mineral oil, a control

hydrocarbon oil that triggers chronic inflammation without features of lupus. Supporting the

gene expression data, elevated levels of IFN-P and MCP-1 protein along with the inflammatory

cytokines tumor necrosis factor-a (TNF-a) and interleukin (IL)-12 were demonstrated in

peritoneal lavage fluid of TMPD-treated mice (not shown). Thus, the "interferon signature"

induced by TMPD was established within 2 weeks of treatment, long before the appearance of

lupus autoantibodies and kidney pathology.

Accumulation of Ly6Chi Monocytes Induced by TMPD Treatment

To identify the source of IFN-I production, we analyzed different cell populations in the

peritoneal exudate two weeks following TMPD treatment. More than 80% of the cells in the

inflammatory exudate were CD1 lb+ (not shown). Since CD1 b is expressed by

monocytes/macrophages, granulocytes and peritoneal B I cells, we utilized the marker Ly6C to

distinguish these populations (107, 108). In untreated or PBS-treated animals, resting peritoneal

cells predominantly consisted of macrophages (CD1 lbhi Ly6C-) and B cells (CD lIbmid Ly6C-;

Figure 3-1C). As described previously (107), peritoneal macrophages expressed the F4/80

antigen while B 1 cells were positive for the B cell markers B220 and CD5 (not shown).

Interestingly, both resting cell types were depleted two weeks following TMPD treatment while

two distinct populations emerged: CD1 lb+ Ly6Chi cells (RI), consistent with the phenotype of

immature monocytes (108), and CD lb+ Ly6Cmid cells (R2) characteristic of granulocytes









(Figure 3-1C, D). The latter (R2) also expressed the neutrophil marker Ly6G (not shown). These

populations each represented ~ 30% of cells in the peritoneal inflammatory infiltrate.

Morphology of the monocyte and granulocyte populations was consistent with their surface

marker profile (Figure 3-1E). These findings were consistent in other wild-type strains (C57/BL6

and BALB/c), except that these strains showed a greater influx of granulocytes (not shown).

Treatment with mineral oil, which does not induce the interferon signature, resulted in

similar accumulation of granulocytes, but few Ly6Chi monocytes were present (Figure 3-1C, D).

Instead, mature monocytes resembling resting peritoneal macrophages were found (R3, Figure 3-

IC, D). Compared to the Ly6Chi monocytes, these cells were larger, more vacuolated, and

displayed rounded nuclei, suggestive of a more differentiated phenotype (Figure 3-1E). The

accumulation of Ly6Chi monocytes was specific to TMPD treatment as this pattern was not seen

in sterile peritonitis induced by thioglycollate or septic peritonitis induced by cecal ligation and

puncture (CLP; Figure 3-1C).

Flow cytometry analysis of Ly6Chi monocytes from TMPD-treated animals demonstrated

intense expression of the myeloid markers Mac-3 and Moma-2 (Figure 3-1F).

Supporting their immature phenotype, only a small fraction of Ly6Chi monocytes

expressed the macrophage marker F4/80, major histocompatibility complex (MHC) class II (I-

A), and the costimulatory molecules CD80 and CD86 (Figure 3-1F). This was in sharp contrast

to mature peritoneal macrophages, which expressed these markers at high levels (not shown).

Ly6Chi monocytes also lacked markers of dendritic cells (CD1 c and CD205), B cells (B220 and

CD19), T cells (CD3), granulocytes (Ly6G) or NK cells (Pan-NK; Figure 3-1F and not shown).

The absence of B220 and CD1 c expression distinguishes these cells from the previously

described natural interferon-producing cells, which also express Ly6C, albeit at much lower









levels compared to Ly6Chi monocytes (64, 109). Curiously, these monocytes exhibited strong

expression of Sca-1 (Ly6A/E; Figure 3-1F), a marker normally found on hematopoietic stem

cells and certain T-cell subsets (110).

While the accumulation of Ly6Chi monocytes was evident after two weeks, these cells

appeared in the peritoneal cavity as early as one day after TMPD treatment (Figure 3-1G).

However, this observation was not limited to TMPD as a similar pattern of acute peritoneal

inflammation was elicited by mineral oil (Figure 3-1G). But the appearance of Ly6Chi

monocytes in response to mineral oil was transient compared to TMPD. Only a small population

of Ly6Chi monocytes was found in the peritoneal cavity two weeks after mineral oil treatment

whereas the response was maintained for several months with TMPD treatment (Figure 3-1C and

not shown).

To investigate the source of the accumulating Ly6Chi monocytes, we first performed a cell

cycle analysis to determine whether these cells were proliferating in the peritoneal cavity.

Propidium iodide staining revealed that virtually all Ly6Chi monocytes in the peritoneal exudate

elicited by TMPD were in Gl phase (Figure 3-2A), indicating that extramedullary myelopoiesis

at the site of inflammation is not a likely explanation for the monocyte accumulation.

Recent studies have demonstrated that Ly6Chi monocytes egress from the bone marrow

and that expression of Ly6C diminishes as they mature in the circulation (105). We therefore

examined whether TMPD treatment alters the maturation profile of peripheral blood monocytes.

In untreated animals, mature circulating monocytes (Ly6C-) outnumbered their immature Ly6Chi

counterparts by about 2:1 (Figure 3-2B). Two weeks after TMPD treatment, the frequency of

Ly6Chi monocytes in the peripheral blood doubled while the Ly6C- subset remained constant

(Figure 3-2B).









To demonstrate the migration of Ly6Chi monocytes into the peritoneal cavity following

TMPD injection, we selectively labeled monocyte subsets in vivo. As described previously (105),

intravenous injection of liposomes containing the fluorescent dye DiD labeled strictly Ly6C-

monocytes in the circulation (Figure 3-2C left). Consistent with the paucity of Ly6C- monocytes

in the response to TMPD, DiD+ cells were not recovered from the peritoneal cavity. Using

clodronate-containing liposomes first to deplete mature monocytes (105), circulating Ly6Chi

monocytes were specifically labeled by the subsequent administration of DiD-liposomes (Figure

3-2C right). After 24 hours, more than one-third of Ly6Chi monocytes in the peritoneal cavity

were DiD indicating that TMPD treatment induces rapid and specific recruitment of this

monocyte subset. Taken together, the data suggest that TMPD treatment results in the export of

Ly6Chi monocytes from the bone marrow into the circulation and followed by their specific

recruitment and accumulation in the peritoneal cavity.

Immature Ly6Chi Monocytes are a Major Source of IFN-I Production

Using magnetic bead sorting, we separated PECs from TMPD-treated mice into Ly6Chi

monocytes, Ly6G granulocytes, and a negative fraction consisting of lymphocytes and dendritic

cells. Although the Ly6Chi monocyte fraction contained a small percentage of contaminating

Ly6G granulocytes, DCs were found only in the negative fraction (not shown). PCR analysis

revealed that Ly6Chi monocytes were the predominant source of IFN-a and IFN-0 expression

(Figure 3-3A). IFN-I transcripts also were detected in other populations, albeit at significantly

lower levels (Figure 3-3A). Ly6Chi monocytes expressed high levels of the interferon-stimulated

chemokine MCP-1 and moderate levels of TNF-a and IL-12 (Figure 3-3B) as well. Granulocytes

accounted for the remaining TNF-a transcripts and the majority of inducible nitric oxide

synthase (iNOS) expression. Not surprisingly, IL-12 transcripts were found predominantly in

cells of the negative fraction as this cytokine was most likely derived from DCs (Figure 3-3B).









Similar results were obtained when this experiment was repeated using flow cytometric cell

sorting to increase the purity of sorted populations (not shown).

To confirm that Ly6Chi monocytes were major producers of IFN-I, we asked whether

their depletion abolishes the interferon signature. Treatment with clodronate-containing

liposomes (clo-lip) effectively eliminates monocytes in vivo (106). Indeed, a single dose of clo-

lip i.p. was sufficient to eliminate about 80% of peritoneal Ly6Chi monocytes in mice pretreated

with TMPD (Figure 3-3C). There were also slight reductions in the number of DCs and

lymphocytes (not shown) whereas the number of CD1 lb+ Ly6Cmid Ly6G granulocytes was

unaffected by clo-lip treatment.

Concomitant with the depletion of Ly6Chi monocytes, the expression of IFN-a, IFN-P, and

ISGs was drastically reduced (Figure 3-3D, E). Similarly, the expression of TNF-cL, which was

highly expressed by Ly6Chi monocytes, also diminished upon their depletion. The expression of

IL-12, which was expressed mainly by the negative cell fraction comprised of lymphocytes and

DCs, did not change significantly after clo-lip treatment (Figure 3-3E). The effect of clo-lip was

transient as the number of Ly6Chi monocytes and the expression of ISGs returned to pre-

treatment levels after four days (not shown).

Induction of IFN-I by TMPD is not Dependent on DCs

Plasmacytoid DCs are capable of secreting large amounts of IFN-I during viral infection

and are thought to be primary interferon producers in SLE (64, 84). In the peritoneal cavity of

TMPD-treated animals, CD11 c+ I-A+ DCs comprised of- 2% of the infiltrating inflammatory

cells. Most peritoneal DCs expressed CD1 lb but not B220 (Figure 3-4A), consistent with the

phenotype of myeloid DCs. However, PDCs may home to other secondary lymphoid tissue

following activation (64, 109). To elucidate the extent to which DCs contribute to IFN-I









production in the TMPD model, we utilized transgenic mice carrying the simian diphtheria toxin

receptor under the control of the CD 11 c promoter (CD 11 c-DTR)(99). Inj section of diphtheria

toxin (DT) rapidly ablates both PDCs and MDCs systemically in CD1 c-DTR mice whereas

wild-type mice are unaffected by the toxin (99).

Two days following DT injection, TMPD-treated CD1 c-DTR mice showed >85%

depletion of CD1 c I-A DCs in the peritoneal exudate compared to wild-type controls (Figure

3-4B,C). In line with previous reports (100, 111), DC depletion was systemic as splenic MDCs

and PDCs were also depleted by 70-80% (Figure 3-4B,C). In contrast, there was no significant

difference in the peritoneal accumulation of Ly6Chi monocytes, granulocytes, and lymphocytes

(Figure 3-4C and not shown). Both CD11 chiCD11 I-A MDCs and CD11 c+B220+PDCA-1 +

PDCs were depleted to a similar degree in the spleen (Figure 3-4D) and lymph nodes (not

shown). Systemic depletion of DCs did not affect TMPD-induced IFN-I production as the

expression of IFN-I and ISGs were unaffected in CD1 lc-DTR animals (Figure 3-4E,F). The

expression of TNF-c. and iNOS was also unchanged (not shown). In contrast, IL-12 expression

was drastically reduced in the absence of DCs (Figure 3-4F), consistent with the cell sorting

experiment (Figure 3-3E). Taken together, the data indicate that DCs were the primary source of

IL-12 but not IFN-I.

We also tried to deplete PDCs using the recently described PDC-specific antibody 120G8

(112). Treatment with 120G8 i.p. resulted in -70% depletion of splenic PDCs after 24 hr,

comparable to the levels seen in CD1 c-DTR mice. However, peritoneal Ly6Chi monocytes and

T lymphocytes were also reduced by >50% (not shown). While the antigen bound by 120G8 and

PDCA-1 is normally expressed on PDCs, its expression can be induced by IFN-I in other cell

types (112, 113). Indeed, elevated IFN-I production in TMPD mice is associated with the









expression of this PDC antigen on Ly6Chi monocytes, granulocytes and T lymphocytes (not

shown), making selective antibody-mediated depletion of PDCs unfeasible in this model.

Accumulation of Ly6Chi Monocytes is Associated with Autoantibody Production

Expression of ISGs is associated with autoantibodies against Sm/RNP in SLE patients (33,

76). In the TMPD model, 60-70% of treated BALB/c mice exhibit anti-Sm/RNP antibodies after

4-6 months vs. 0% of IFN-I receptor deficient mice (93). These autoantibodies either appear less

frequently or are completely absent in mice treated with other adjuvant oils such as n-

hexadecane, squalene, or mineral oil (114). Interestingly, treatment with n-hexadecane (which

induces anti-Sm/RNP in about 25% of treated animals) elicited the accumulation of Ly6Chi

monocytes, albeit the response was milder than with TMPD, whereas squalene (which induces a

weak anti-Sm/RNP response in <10% of treated animals) recruited mostly mature

monocytes/macrophages and few Ly6Chi monocytes, resembling the pattern seen with MO

(Figure 3-5A). Since Ly6Chi monocytes were the major source of IFN-I in TMPD-treated mice,

we examined whether the frequency of anti-Sm/RNP autoantibodies correlates with the number

of these cells. Indeed, the adjuvant oils' ability to elicit anti-Sm/RNP antibodies was highly

correlated (r2=0.98) with the accumulation of Ly6Chi monocytes (Figure 3-5B, upper panel).

Numbers of Ly6Chi monocytes also correlated with ISG expression (Figure 3-5B, lower panel),

supporting our finding that these cells are major IFN-I producers. In contrast, the recruitment of

granulocytes was similar among all treatment groups and more DCs were present in the PECs

following MO or squalene treatment than TMPD (not shown).

Surface Expression of Ly6C on Monocytes is not IFN-I-Dependent

Since Ly6C is an interferon-inducible gene (115), it is possible that IFN-I production

triggered by TMPD treatment contributes to the Ly6Chi monocyte phenotype. To address this

issue, we analyzed monocyte subsets in IFN-I receptor-deficient (IFNAR-W-) mice. Compared to









wild type controls, untreated IFNAR- mice showed similar levels of Ly6Chi and Ly6C-

monocytes in the circulation, accounting for approximately 2 and 5% of PBMC, respectively

(not shown). Two weeks following TMPD treatment, IFNAR-1- mice also displayed increased

numbers of circulating Ly6Chi monocytes, albeit the response was milder than that of wild type

controls (Figure 3-6). Importantly, Ly6Chi and Ly6C- monocytes, as well as the Ly6Cmid

granulocyte populations in the peripheral blood were clearly discernible even in the absence of

IFN-I signaling. The number of bone marrow precursors of Ly6Chi monocytes was also

comparable between wild-type and IFNAR- mice (Figure 3-6). These data suggest that

although IFN-I have been shown to induce Ly6C expression (115), the Ly6Chi phenotype of the

immature monocyte population in naive or TMPD-treated mice was not dependent on IFN-I

signaling.

Discussion

Elevated serum IFN-I was first associated with SLE over two decades ago (30). Recent

studies using microarrays and RT-PCR further defined a panel of ISGs over-expressed in the

peripheral blood of SLE patients (31-33). While this interferon signature has been linked to

disease activity, kidney involvement, and autoantibody levels, the source of IFN-I responsible

for the interferon signature remains a matter of speculation. This issue has been difficult to

address using animal models as most of them do not exhibit upregulation of IFN-I.

We recently reported that murine lupus induced by TMPD is associated with elevated IFN-

I production and ISG expression (103). Disruption of IFN-I signaling completely abrogates the

development of kidney disease and the onset of autoantibody production (93). In this study, we

show that Ly6Chi monocytes are a major source of IFN-I in the TMPD model of lupus.

Upregulation of IFN-I and ISGs occurred long before the clinical manifestations of lupus and

coincided with an accumulation of Ly6Chi monocytes. These immature monocytes expressed









large amounts of IFN-I and the "interferon signature" was rapidly abolished upon depletion of

these cells by clo-lip. Moreover, the abundance of Ly6Chi monocytes was highly associated with

the ability of various adjuvant oils to induce anti-Sm/RNP antibodies. In contrast, systemic

depletion of DCs did not alter IFN-I production triggered by TMPD.

While Ly6Chi monocytes were found in the inflammatory infiltrate one day after

thioglycollate (105, 106) or mineral oil administration, the response was transient as the number

of these cells was drastically reduced after 72 hours. The recruitment and accumulation of

Ly6Chi monocytes seen in TMPD-treated animals, on the other hand, persisted for as long as 4

months after treatment. A recent study shows that the egression of Ly6Chi monocytes from the

bone marrow in response to Listeria monocytogenes infection is dependent on the interaction

between the monocyte attractant CCL2/MCP-1 and its receptor CCR2 (116). Interestingly, as

confirmed here, MCP-1 is an ISG that is induced by TMPD treatment, raising the possibility that

the production of interferon-inducible chemokines may drive the recruitment of Ly6Chi

monocytes. This is relevant to human SLE as elevated serum levels of MCP-1 have been

associated with the interferon signature (32). How TMPD-treatment maintains the infiltrating

monocytes in an immature state is unknown, but a defect intrinsic to the cells is unlikely as

Ly6Chi monocytes spontaneously acquired a mature macrophage-like phenotype (Ly6C- F4/80+ I-

A ) in vitro (not shown). The immaturity of Ly6Chi monocytes may be important to their ability

to produce IFN-I as their mature counterparts elicited by mineral oil displayed significantly

lower levels. Analogously, PDCs also are better equipped to secrete large amounts of IFN-I

when immature (117).

Prolonged elevation of IFN-I may promote DC maturation (74), T cell survival (47),

isotype class-switching (49), and B cell maturation into plasma cells (48), culminating in the loss









of tolerance and autoantibody production. It is noteworthy that while IFN-I is essential to

TMPD-induced lupus (93), other factors such as IL-12 and IFN-y play important roles since

autoantibody production and kidney disease development are reduced in deficient mice (23, 24).

Our findings challenge the conventional view that PDCs are solely responsible for the

elevated IFN-I in SLE. In TMPD-treated mice, the vast majority of the increased IFN-I

production is derived from the 20-30% of peritoneal cells that are Ly6Chi CD1 lb+ B220- CD1 lc-

monocytes. Although, PDCs can synthesize up to 1000-fold more IFN-a than most other cell

types (65), the number of circulating PDCs is drastically reduced in SLE patients (33, 118).

While it is plausible that PDCs home to tissues following activation, a view supported by the

presence of these cells in lupus skin lesions (86), there is little direct evidence connecting tissue

PDCs to the excess serum IFN-I seen in SLE patients. Indeed, as tissue (e.g. spleen) PDCs were

greatly reduced by DT treatment of CD1 lc-DTR mice, despite little effect on ISG expression, it

is unlikely that PDCs were the main source of IFN-I in TMPD-induced lupus. Also, the elevation

of IFN-I in this model occurs within two weeks of treatment, long before the appearance of

autoantibodies against dsDNA and snRNP and formation of immune complexes. The proposed

mechanism of IFN-I induction in PDCs by endogenous nucleic acids present in immune

complexes, therefore, is not a likely explanation of our findings (84). Nevertheless, PDCs may

function to amplify IFN-I production once autoantibodies and immune complexes develop.

MDCs also play a role in TMPD-induced lupus as they are the major source of IL-12, a cytokine

critical for the development of kidney disease in this model (24). The role of DCs in human SLE

is more difficult to assess as targeted DC therapy is not yet available.-

It is noteworthy that Ly6Chi monocytes also have been recently reported to play a role in

atherosclerosis (119). Therefore, these monocyte-like interferon producing cells could play a role









in the premature atherosclerosis seen in SLE patients. A CD14hiCD16- monocyte subset (also

called "classical monocytes") is the equivalent of murine Ly6Chi monocytes in terms of

migratory properties (108). Whether this or other monocyte subsets produce IFN-I in human SLE

warrants detailed investigation.











MO TMPD 10000- CETMPD =CMO
IFNP3 10
-o 1000-
5D
18s 100- X

10-

MX-1 IP-10 MCP-1
C
PBS TMPD Mineral Oil Thioglycollate CLP




CD11b

D u' created MO ITMPD F Mac-3 Morma-2 F4/80



I20- I-A CD80 CD86

Ri R2 R3 e W e e^ W '0 W e W Y 'e ei
B220 CD11c Sca-1





G TMPD Mineral Oil
15%



CD11b


Figure 3-1. Elevated expression of IFN-I and accumulation of Ly6Chi monocytes after TMPD
treatment. Comparisons of A) IFN-I expression (conventional PCR) and B) ISG
expression (RT-PCR) in peritoneal cells two weeks after TMPD or MO treatment. C)
Flow cytometry of peritoneal cells in wild-type 129Sv mice treated with PBS, TMPD
(2 weeks), mineral oil (2 weeks), thioglycollate (3 days), and cecal-puncture ligation
(3 days). Boxes indicate Ly6Chi immature monocytes (RI), CD1 lb+ Ly6Cmid
granulocytes (R2), and Ly6C- mature monocytes/macrophages (R3). D)
Quantification and E) morphologic analysis of peritoneal cell populations. F) Flow
cytometry of surface makers on Ly6Chi immature monocytes. G) Flow cytometry of
peritoneal cells from wild-type 129Sv mice treated with TMPD or mineral oil for 1
day. Shaded region (panel F) represents isotype control staining and boxes indicate
Ly6Chi immature monocytes. Each bar (panels B and D) represents the mean of 4
animals and error bars indicate standard deviation (s.d.). p < 0.05 (Student's t-test).











PropidG,um Iodide>99%


Propidium Iodide


Labeling of Ly6C mono
DiD-lip
V
Oh 24h


Labeling of Ly6C" mono
Clo-lip DiD-lip

Oh 24h 48h


untreated TMPD



Ly6C
C Untreated IC1 week M2 weeks


4

23A l~


PBMC




PEC


DiD


Figure 3-2. Direct recruitment of circulating Ly6Chi monocytes after TMPD treatment. A)
Propidium idodide cell cycle analysis of peritoneal cells two weeks after TMPD
treatment. B) Flow cytometry of Ly6C expression on peripheral blood monocytes
(gated on CD1 lb+Ly6G- cells) and quantification of peripheral blood Ly6Chi and
Ly6C- monocytes following TMPD treatment (n = 4 per group). C) Flow cytometry
of peripheral blood and peritoneal monocytes (gated on CD1 lb+Ly6G- cells) in
TMPD-treated mice 24 hr after administration of DID-liposomes. Data are
representative of 3 independent experiments.










A AIIl cells
cA -B f lGranulocytes
S0 0MI Ly6Chi Monocytes
I1 I Negative fraction
0 0



IFN-a5

IFN-a2 TNF-ax
IFN-b ...
13-actin --
IL-12


TMPD + PBS TMPD + Clo-lip --------------

,INOS


CD11b 1 10 100 1000
D E Fold Expression

1000- CITMPD + PBS
PBS Clo-lip c I-TMPD + Clo-lip
IFNax 100- T
IFNP
18s
10-


Mx-1 MCP-1 IP-10 TNF IL-12

Figure 3-3. Immature Ly6Chi monocytes are major producers of IFN-I. Analysis of A) IFN-I
expression (conventional PCR) and B) ISG expression (RT-PCR) in magnetic bead-
sorted peritoneal Ly6Chi monocytes, granulocytes and the negative fraction
lymphocytess and DCs) from wild-type 129sv mice treated with TMPD (2 weeks). C)
Flow cytometry of TMPD-elicited peritoneal cells 2 days following treatment with
clodronate-containing liposomes (clo-lip). Box indicates Ly6Chi monocytes. D) IFN-I
expression (conventional PCR) and E) ISG expression (RT-PCR) in peritoneal cells
after clodronate-liposome or PBS treatment. Each bar represents the mean of 5
animals and error bars indicate s.d. p < 0.05 (Student's t-test).


paa////i/saa / I---












BALB/c

02 3%


I-A B220


A







C
S4(


8 2

if


IFNa
IFNO
18s


--] BALB/c
1000- M CD11c-DTR

.0
I 100-

3_ 10-

1 Mx-1 MCP-1 IP-10 IL-12
Mx-1 MCP-1 IP-10 IL-12


Figure 3-4. Dendritic cells are not required for IFN-I production induced by TMPD. A) Flow
cytometry of peritoneal DCs two weeks after TMPD treatment. Box indicate CD1 Ic
I-A+ DCs. B) Depletion in CD1 c-DTR mice 2 days after diphtheria toxin (DT)
injection. Box indicates CD 11c+ I-A DCs. C) Quantification of peritoneal dendritic
cells and Ly6Chi monocytes. D) Quantification of splenic DC depletion. MDCs were
defined as CD1 l hi I-A+ CD1 lb+ cells and PDCs were defined as CD1 c B220+
PDCA-1 E) IFN-I expression (conventional PCR) and F) ISG expression (RT-PCR)
in peritoneal exudates cells. Each bar represents the mean of 6 animals and error bars
indicate s.d. p < 0.05 (Student's t-test).


30-
25 T
20.
0 15

15
10
BALB/c CD1c-DTR


CD11 c-DTR


PEC





Spleen


BALB/c CD11c-DTR












N-Hexadecane Squalene


CD11b


B 70-
+ 60- R2=0.98 TMPD
z 50- p<0.01. --
40-
c? 30-
S.. HEX
m 20
S10- .-S"Q

0 5 10 15 20 25 30
% Ly6Ch' Monocyte


3000-
30 R2=0.98 TMPD
E p<0.01
2000-


1000-
S .. HEX
D MO
0 5 10 15 20 25 30
% Ly6Ch' Monocyte

Figure 3-5. Accumulation of Ly6Chi monocytes is correlated with the frequency of anti-Sm/RNP
autoantibodies and upregulation of ISG expression. A) Flow cytometry of peritoneal
cells in wild-type 129Sv mice treated with n-hexadecane (2 weeks) or squalene (2
weeks). Boxes indicate Ly6Chi immature monocytes. Correlation of the levels of
Ly6Chi monocyte accumulation with B) the frequency of anti-Sm/RNP autoantibodies
(6 months) and ISG expression (2 weeks) induced by TMPD, n-hexadecane (HEX),
squalene (SQ), and mineral oil (MO) and PBS. Autoantibody frequencies represent
the mean of >10 mice per group from previous studies. Percentage of Ly6Chi
monocytes and ISG expression index represent the mean of 4 mice. Error bars
indicate s.d. ISG expression index was calculated as follows: mean relative
expression of (Mx-1 + MCP + IP-10)/3.









Wild-type IFNAR+

...,PBMC




Marrow


CD11b
Figure 3-6. Expression of Ly6C on immature monocytes is not dependent on IFN-I signaling.
Flow cytometry analysis of monocyte subsets in the peripheral blood (upper) and
bone marrow (lower) of wild-type 129sv and IFN-I receptor-deficient mice two
weeks after TMPD-treatment. Boxes and ovals indicate peripheral blood Ly6Chi
monocytes and bone marrow Ly6Chi monocyte precursors, respectively.









CHAPTER 4
TOLL-LIKE RECEPTOR 7-DEPENDENT AND FCyR-INDEPENDENT PRODUCTION OF
TYPE-I INTERFERON IN TMPD-INDUCED LUPUS

Introduction

SLE is a chronic autoimmune disease characterized by the production of autoantibodies

against double stranded (ds)-DNA and small nuclear ribonucleoproteins (snRNPs), including the

Sm/RNP antigens, Ro/SS-A, and other antigens (1). Recent evidence strongly suggests that

type-I interferons (IFN-I), a family of antiviral cytokines, are integral to the pathogenesis of

SLE. Elevated serum levels of IFN-I and over-expression of interferon-stimulated genes (ISGs)

in the peripheral blood of SLE patients have been demonstrated by several groups (31, 32, 76).

This "interferon signature" is associated with active disease and autoantibodies against dsDNA

and the Sm/RNP and Ro/SS-A antigens (33, 75).

The etiology of excess IFN-I in SLE is incompletely understood. Research on innate

immunity has led to the identification of several pathways mediating IFN-I production in

mammalian cells. Toll-like receptor (TLR)3, a sensor for viral dsRNA, and TLR4, the receptor

for lipopolysaccharide (LPS) both stimulate IFN-I secretion through TIR domain-containing

adaptor inducing IFN-P (TRIF) (52). In contrast, TLR7/8 and TLR9 mediate IFN-I production

via myeloid differentiation factor-88 (MyD88) in response to single-stranded(ss)-RNA and

unmethylated CpG DNA, respectively (54, 55, 120). In addition, cytoplasmic receptors that

recognize intracellular nucleic acids and induce IFN-I have been described recently. Retinoic

acid inducible gene-I (RIG-I) and melanoma differentiation associated gene-5 (MDA-5)

recognize cytoplasmic RNA and trigger IFN-I by activating interferon-3 promoter stimulator-1

(IPS-1, also known as MAVS, VISA and CARDIF) and IRF-3 (60, 61, 121). Cytoplasmic DNA

binds to a cytoplasmic sensor and triggers IFN-I production via a pathway requiring TANK-

binding kinase-1 (TBK-1) and IRF-3 (62, 122).









Nucleic acids from dying cells may act as ligands for TLR7/8 and TLR9 to trigger IFN-I

production in SLE. In plasmacytoid dendritic cells, immune complexes formed by

autoantibodies to DNA and snRNPs help transport these endogenouss ligands" to endosomes

containing TLR7, 8 and 9, resulting in IFN-I production (84). This hypothesis is supported by in

vitro studies (77, 80). However, therapeutic administration of IFN-a can directly trigger the

production of anti-dsDNA antibodies (72) and in several murine lupus models, IFN-I production

is required for the induction of autoantibodies (89, 90, 93), suggesting that IFN-I dysregulation

may occur upstream of autoantibody development. Therefore, it remains controversial whether

nucleic acid-containing immune complexes in SLE initiate IFN-I production or act to perpetuate

a positive feedback loop of IFN-production initiated by another factor, such as a viral infection.

Experimental lupus induced by TMPD (pristane) displays many key immunological and

clinical features of human SLE, including the presence of the "interferon signature" and lupus

autoantibodies such as anti-dsDNA, anti-Sm, and anti-RNP (96, 97, 103). Importantly, IFN-I

play an essential role in this model as glomerulonephritis and autoantibody production (anti-

Sm/RNP, -dsDNA, and -Su) are abolished in IFN-I receptor-deficient (IFNAR-'-) mice (93).

Unexpectedly, a population of Ly6Chi immature monocytes that accumulates in the peritoneal

cavity after TMPD treatment, rather than dendritic cells, is the major source of IFN-I in this

model (see chapter 3). The persistent influx of Ly6Chi monocytes and production of IFN-I occur

within two weeks of TMPD treatment, long before the appearance of autoantibodies against

snRNPs and dsDNA (3-5 months), suggesting that the initial wave of IFN-I production is

independent of RNA-containing immune complexes. In this study, we aimed to elucidate the

mechanism of IFN-I production in TMPD-induced lupus.









Materials and Methods


Mice

MyD88-'-, TRIF-'-, TLR7- -, TLR9"--, IFNAR- mice backcrossedd >7 generations to the

C57BL/6 background) and IPS-1-/-, TNF-/-, TNF-/-TBK-l/- (on a mixed 129Sv/ B6 background)

have all been described previously (52, 54, 56, 69, 101, 102). Wild-type C57BL/6 and

heterozygous littermates were used as controls. BALB/c.TLR7- backcrossedd >8 generations to

the BALB/c background) and wild-type BALB/c mice were used for long-terms studies of

autoantibody production. Animals were bred and maintained in a specific pathogen-free facility

of the Research Institute for Microbial Diseases, Osaka University. C57BL/6 wild type and

FcyRI/III -/ mice (Taconic, Hudson, NY) and BXSB mice (Jackson Laboratories, Bar Harbor,

ME) were maintained in a specific pathogen-free facility at the University of Florida. BXSB X

B6 Fl mice were generated by breeding BXSB males with C57BL/6 females. The mixed

background of several strains used in this study did not alter the response to TMPD as measured

by the expression of ISGs and peritoneal cell influx (data not shown). Twelve to sixteen-week

old animals received a single intraperitoneal (i.p.) injection of 0.5 mL TMPD (Sigma-Aldrich, St.

Louis, MO). Blood samples were obtained before, and weekly after TMPD treatment.

Peritoneal cells, spleen, and blood were harvested two weeks after treatment. Monocyte

depletion was performed by i.p. injection of clodronate-containing liposomes (200 pL) as

described (106). These studies were approved by the Institutional Animal Care and Use

Committee.

Real-Time Quantitative PCR

RT-PCR was performed as described (103). Briefly, total RNA was extracted from 106

peritoneal cells using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized

using Superscript II First-Strand Synthesis Kit (Invitrogen) following the manufacturer's









protocol. SYBR green RT-PCR analysis was performed using an Opticon II thermocycler (MJ

Research, Waltham, MA). Amplification conditions were: 950C for 10 min, followed by 45

cycles of 940C for 15 s, 600C for 25 s, and 720C for 25 s. After the final extension (720C for 10

min), a melting-curve analysis was performed to ensure specificity of the products. Primers used

in this study are listed in Table 2-1. The expression ofMxl, IRF7, 18s rRNA also were analyzed

using Taqman primers and probes purchased from Applied Biosystems and the results were

consistent with the SYBR green method (data not shown). Cytokine/chemokine PCR array

(Superarray, Frederick, MD) analysis was performed using an ABI 7700 Sequence Detector

(Applied Biosystems) following the manufacturer's protocols.

Flow Cytometry and Cell Sorting

The following conjugated antibodies were used: anti-CD1 lb-phycoerythrin (PE), anti-

CD8-allophycocyanin (APC), anti-CD4- fluorescein isothiocyanate (FITC), anti-CD 11 c-PE,

anti-B220-PerCPCy5.5, anti-Sca-1-PE, anti-CD64-PE, anti-CD32/16-PE(all from BD

Bioscience), anti-Ly6C-FITC, anti-Ly6C-biotin, and avidin-APC (eBioscience, San Diego, CA).

Prior to surface staining, peritoneal or peripheral blood cells were incubated with anti-mouse

CD16/32 ("Fc block"; BD Bioscience) for 10 min. Cells were then stained with an optimized

amount of primary antibody or the appropriate isotype control for 10 min at room temperature

before washing and resuspending in PBS supplemented with 0.1% bovine serum albumin.

Intracellular staining for TLR7 was performed as described (123) using rabbit anti-mouse TLR7

or rabbit IgG isotype control (EBioscience) and goat anti-rabbit IgG-FITC (Southern

Biotechnology). Fifty thousand events per sample were acquired using a FacsCalibur (BD

Bioscience) and analyzed with FCS Express 3 Software (De Novo Software, Ontario, Canada).

Cell sorting was performed using a FACS DIVA flow cytometer (BD Bioscience). Peritoneal,









splenic, and bone marrow Ly6Chi monocytes (CD1 lb+Ly6Chi), peritoneal dendritic cells

(CD1 c ) and granulocytes (CD1 lb+Ly6G+) were sorted to >90% purity for cell culture or RNA

isolation.

In Vitro Stimulation

Sorted cells resuspended in complete DMEM (containing 10% FCS, 10 mmol/L HEPES,

glutamine, and penicillin/streptomycin plus 10 U/ml heparin) were seeded on 96 well cell-culture

plates (5 X 104 cells/well). Cells were stimulated with the indicated doses of peptidoglycan, poly

I:C, R848, CpG ODN2395 (Invivogen, San Diego, CA), or LPS (from Salmonella typhimurium;

Sigma) and incubated at 37 C in a 5% CO2 atmosphere for 24 h before collecting the

supernatant. MCP-1 and IL-6 ELISAs (BD Biosciences) were performed following

manufacturer's instructions. Optical density was converted to concentration using standard

curves based on recombinant cytokines analyzed by a four-parameter logistic equation (Softmax

Pro 3.1 software).

Autoantibody Analysis

Serum antinuclear antibodies in BALB/c.TLR7 and wild-type BALB/c mice were

determined 12 and 24 wks after TMPD by indirect immunofluorescence using HEp-2 cells

(INOVA, San Diego, CA). Sera were diluted 1:40 and titers were determined using an Image

Titer titration emulation system (Rhigene, Inc., Des Plaines, IL). Immunoprecipitation and

antigen-capture ELISA to detect serum autoantibodies against nRNP/Sm were performed as

described (96, 124). Determination of anti-Su/ago2 by ELISA also has been described (125).

Statistical Analysis

For quantitative variables, differences between groups were analyzed by the unpaired

Student's t-test. Survival curves were analyzed using the log-rank test. ANA titers and

autoantibody levels were compared using Mann-Whitney U test. Data are presented as mean +









s.d. All tests were two-sided and a p-value less than 0.05 was considered significant. Statistical

analyses were performed using Prism 4.0 (GraphPad Software, San Diego, CA).



Results

Induction of IFN-I by TMPD Requires MyD88

To identify the mechanism of IFN-I induction by TMPD, we first analyzed the effect of

TMPD on mice with deficiency of the adaptor molecules TRIF or MyD88. TRIF is required to

trigger IFN-I production by TLR3 and TLR4 (52), whereas MyD88 mediates TLR7/8 and TLR9

signaling (54, 55, 120). Previously we have shown that within two weeks of TMPD treatment,

an accumulation of IFN-I-producing CD 1 lb+Ly6Chi monocytes can be detected in the peritoneal

cavity in wild-type mice concurrent with increased IFN-I production and ISG expression (see

Chapter 3). Compared with wild-type mice, the total number of peritoneal exudate cells (PECs)

was significantly reduced in MyD88-/- mice after TMPD treatment (Figure 4-1A). Both Ly6Chi

monocytes and granulocytes (defined as CD1 lb Ly6G Ly6Cmid) were decreased by >90%

(Figure 4-1A,B). Importantly, IFN-I induction by TMPD was completely dependent on MyD88

as elevated expression of the ISGs myxoma response protein-1 (Mxl) and interferon regulatory

factor-7 (IRF7) in PECs was abolished in MyD88-/- mice as also seen in IFNAR-deficient mice

(Figure 4-1C). The levels of the interferon-inducible chemokine monocyte chemoattractant

protein-1 (MCP-1/CCL2) in the peritoneal lavage fluid were also reduced in the absence of

MyD88 (Figure 4-1D). In contrast, TRIF deficiency did not impact the accumulation of PEC

populations or the increased expression of ISGs (Figure 4-1A-D). Although we were unable to

detect significant changes in serum IFN-a/p levels by ELISA, IFN-I secretion was required for

the response to TMPD as the upregulation of ISGs and recruitment of Ly6Chi monocytes were









abolished in IFNAR-'- mice (Figure 4-1A-D). The absence of IFN-I signaling, however, did not

affect the influx of granulocytes (Figure 4-1A,B).

The increase in IFN-I following TMPD treatment is not limited to the peritoneal cavity as

the "interferon signature" is also detectable in the peripheral blood (93). We found that surface

expression of the interferon-inducible gene Sca-1 (Ly6A/E) on B cells was dramatically up-

regulated in wild-type mice treated with TMPD (Figure 4-1E). Although Sca-1 is naturally

expressed by certain lymphocyte subsets and hematopoietic stem cells (110), TMPD induced

Sca-1 expression in virtually all B cells in wild-type, but not IFNAR-/- mice (Figure 4-1E).

Increased Sca-1 expression was also evident on CD8+ and CD4+ T cells (not shown). Similar to

the pattern of ISG expression in PECs, upregulation of Sca-1 was reduced in MyD88-/-, but not

TRIF-/- mice (Figure 4-1E), further supporting an essential role of MyD88 in IFN-I production.

To address whether cytoplasmic nucleic acid sensors also contribute to TMPD-induced

IFN-I production, we tested the effect of TMPD on IPS-1-/- and TNF-/-TBK -/- mice [TBK-1-/- is

embryonically lethal unless crossed onto a TNFa-/- background (69)]. IPS-1 is a required

adaptor for intracellular viral RNA detection via RIG-I and MDA-5 (61), whereas TBK-1 is

required for cytoplasmic DNA-induced IFN-I secretion (126). Expression of Mx] and IRF7 in

PECs was comparable in wild-type, IPS-1-/-, TNF-/-TBK-1-/-, and TNF- mice (Figure 4-2),

suggesting that the intracellular nucleic acid-sensing pathways were not required for IFN-I

production. The patterns of peritoneal cell influx and Sca-1 expression on peripheral blood

lymphocytes were also similar among these strains (not shown). Taken together, our data

indicate that TMPD-elicited IFN-I production was strictly MyD88-dependent.

Induction of IFN-I by TMPD is TLR7-Dependent, Immune Complex-Independent

Since MyD88 mediates IFN-I induction by TLR7 and TLR9, we next investigated which

of these innate receptors is responsible for the effect of TMPD. Two weeks after TMPD









treatment, the number of PECs in TLR9- mice was reduced by about 20% compared to TLR7T-

and wild-type controls. The numbers of Ly6Chi monocytes and granulocytes also were reduced

in the absence of TLR9, although the pattern of the cellular influx remained similar to wild-type

animals (Figure 4-3A, B).

Interestingly, TLR7- mice exhibited a specific reduction of Ly6Chi monocytes in the

peritoneal cavity (Figure 4-3A). Despite the decrease in these immature monocytes, total PEC

counts in TLR7T mice were comparable to wild-type controls due to a significant increase in the

number of granulocytes (Figure 4-3A, B). An accumulation of CD11lb+Ly6C- residential

macrophages also was evident in the absence of TLR7 (Figure 4-3B). These patterns are

strikingly similar to those observed in IFNAR-/- mice (Figure 4-1A-D). Indeed, the increased

Mx] and IRF7 expression and MCP-1 production were abrogated in TLR7T- mice (Figure 4-3C).

Upregulation of Sca-1 expression on B cells also was reduced in these mice after TMPD

treatment (Figure 4-3D), recapitulating the findings in MyD88- and IFNAR-/- mice. On the

contrary, ISG expression in PECs and surface expression of Sca-1 were similar in TLR9-/ mice

compared with wild-type controls. These findings suggest that although TLR9 may contribute to

the inflammatory response, IFN-I induction by TMPD was mediated primarily by TLR7.

To further define the role of TLR7 in the inflammatory response to TMPD, we compared

the expression of various cytokines and chemokines in wild-type and TLR7 animals using a

PCR array. Following TMPD treatment, peritoneal cells from wild-type mice displayed

dramatically higher expression of several interferon-stimulated chemokines including CCL2,

CCL12, CCL7, and CXCL10 in comparison with TLR7- mice (Table 4-1). This pattern of

chemoattractant production is similar to the chemokine signature recently described in SLE

patients (127). These observations support the role of TLR7 as the primary mediator of IFN-I









production in the TMPD lupus model. Interestingly, consistent with the increased number of

peritoneal granulocytes in TMPD-treated TLR7-/- mice (Figure 4-3A), the neutrophil

chemoattractant CXCL5 was upregulated in the absence of TLR7 whereas the expression of other

inflammatory mediators was comparable between the groups (Table 4-1).

Several studies have demonstrated that self-RNA present in immune complexes may act as

an endogenous TLR7 ligand causing the production of IFN-I (77, 80). Fcy-receptors (FcyR)

have been reported to play an essential role in this process by enhancing the internalization of

immune complexes, allowing RNA to interact with TLR7 in endosomes (128). Deficiency of

either TLR7 or FcyR y-chain, an integral component of FcyRI and FcyRIII, renders murine DCs

unable to produce IFN-I in response to lupus immune complexes (129). Since TMPD induces

IFN-I production long before the onset of lupus autoantibodies and immune complexes (see

Chapter 3), we examined the potential role of FcyR in the IFN-I response to TMPD. Surface

expression of FcyRI (CD64) and FcyRII/III (CD32/CD16) in TMPD-induced PECs was

prominent on Ly6Chi monocytes (Figure 4-4A). FcyRs were also expressed by a fraction of

granulocytes, whereas lymphocytes and DCs in the peritoneal cavity displayed little surface

expression of these receptors (Figure 4-4A).

We next analyzed the effects of TMPD on FcyR y-chain-deficient mice (FcyR-/-). The

accumulation of Ly6Chi monocytes and upregulation of ISG expression were comparable in

FcyR7 and wild-type mice (Figure 4-4B,C). Elevated surface expression of Sca-1 on peripheral

blood lymphocytes was also similar between the groups (not shown). Taken together, these

findings suggest that TMPD elicits IFN-I production through a TLR7-dependent, but FcyR-

independent pathway.









Immature Ly6Chi Monocytes Express High Levels of TLR7

Next we examined the distribution of TLR7 expression in the inflammatory infiltrate

induced by TMPD. PECs from mice treated with TMPD two weeks earlier were sorted into four

distinct populations based on surface marker phenotype: Ly6Chi monocytes (CD1 lb +Ly6Chi;

-30% of PECs), granulocytes (CD lb+Ly6G+; -30%), DCs (CD lc+; -2%), and a negative

fraction containing mainly B and T lymphocytes. As reported previously (see Chapter 3), the

DC fraction consisted of >80% CD1 lb myeloid DCs and few PDCs (CD1 lc+CD1 lb-B220+)

were present.

Quantitative PCR revealed that Ly6Chi monocytes expressed higher levels of TLR7 than

other peritoneal cell subsets (Figure 4-5A). Prominent expression of the chemokine receptor

CCR2 is consistent with their immature monocytic phenotype as reported previously (108). In

striking contrast, elevated expression of TLR7 was not a feature of Ly6Chi monocytes in the

spleen or bone marrow. While TLR7 expression also was found on other PEC subsets, DCs

displayed greater expression of TLR3 and TLR9 whereas TLR4 transcripts were predominantly

found in granulocytes (Figure 4-5A).

In line with these findings, when peritoneal Ly6Chi monocytes were depleted by i.p.

injection of clodronate-containing liposomes (clo-lip), the expression of TLR7 by PECs was

greatly reduced whereas the levels of TLR9 transcripts remained unaffected (Figure 4-5B). We

further analyzed the response of Ly6Chi monocytes to various TLR ligands in vitro. Sorted

Ly6Chi monocytes secreted large amounts of MCP-1 and IL-6 when co-cultured with the

synthetic TLR7 ligand R848 (Figure 4-5C). They also responded to the TLR4 ligand LPS, albeit

less strongly even at the highest dose of LPS tested (10 [g/mL). Consistent with their low levels

of TLR3 and TLR9 expression, Ly6Chi monocytes exhibited weak responses to poly I:C and

CpG DNA (Figure 4-5C). In contrast, isolated granulocytes did not produce measurable









amounts of MCP-1 or IL-6 in response to any TLR ligands used in this study (not shown).

Hence, Ly6Chi monocytes recruited to the peritoneal cavity after TMPD treatment expressed

high levels of TLR7 and actively responded to TLR7 ligands.

The Y-linked Autoimmune Accelerating (Yaa) Locus Amplifies the Effects of TMPD

The Yaa locus is essential for spontaneous development of autoantibodies and

glomerulonephritis in the BXSB model of murine lupus (130). Yaa also accelerates disease

onset in other lupus-prone strains (131, 132). TLR7 is among the 17 genes found in the Yaa

locus (133, 134). Because TLR7 is normally located on the X chromosome, males possess one

copy of the gene while a similar gene dosage is achieved females through X-inactivation. Male

Yaa mice, however, have two functional copies of the gene (133, 134). A recent study showed

that the TLR7 gene duplication alone was responsible for the autoimmune features associated

with the Yaa mutation (135).

Since TMPD induces IFN-I production via TLR7, we asked whether the effects of the

adjuvant oil are more pronounced in the presence of the Yaa locus. Compared to female controls

(designated TLR7 ), BXSB X B6 male mice carrying the Yaa mutation (TLR7 /vaa) exhibited

greater accumulation of Ly6Chi monocytes in the peritoneal cavity two weeks after TMPD

treatment (Figure 4-6A). Importantly, increasing the gene dosage of TLR7 was associated with

significantly higher production of IFN-I, assessed by measuring ISG expression (Figure 4-6B).

In contrast, the IFN-I response to TMPD was similar between males and females in wild-type

strains including C57BL/6, BALB/c, and 129Sv (not shown).

We further examined the long term effect of TMPD treatment in the BXSB model.

Consistent with previous studies (130), BXSB males died prematurely beginning at 5 months of

age (Figure 4-6C). Mortality was significantly accelerated when a single dose of TMPD was

administered i.p. at 8-10 weeks of age. Sixty percent of TMPD-treated animals succumbed by 5









months of age, vs. 20% in the control group. Whereas 5/10 PBS-treated animals survived until 7

months, only 1/10 in the TMPD-treated group remained. Thus, not only was the induction of

IFN-I accentuated by the Yaa mutation, TMPD treatment also hastened disease progression in

the BXSB mice.

Essential Role of TLR7 in the Development of Autoantibodies

In MRL-lpr mice, TLR7 is required for the development of anti-Sm antibodies (136). To

assess whether TLR7 also is involved in autoantibody production in the TMPD-lupus, we

compared the long-term response to TMPD in wild-type BALB/c and BALB/c.TLR7/- mice. No

mortality was found in either group and only mild proteinuria was detected by 24 wks-post

treatment (not shown). Comparable to previous observations (137), BALB/c mice displayed

significant hypergammaglobulinemia 24 wks after TMPD treatment (Figure 4-7A). The increase

in serum IgG was reduced by 50% in TLR7-/- mice while IgM levels were similar between

groups. Consistent with the role of IFN-I in IgG2a isotype switching (48), IgG2a was

profoundly reduced in TLR7-/- mice (Figure 4-7B). IgGI and IgG2b levels also were reduced

mildly in the absence of TLR7 whereas IgG3 increased slightly.

As early as 12 wks after TMPD treatment, 8/12 wild-type mice developed serum

antinuclear antibodies (ANA) and anti-nRNP/Sm autoantibodies (Figure 4-7C, D). In contrast,

only one TLR7-/- mouse showed a low titer ANA and none developed autoantibodies to

nRNP/Sm (Figure 4-7C, D). Similar to IFNAR-deficient animals (93), most TLR7-/- mice

exhibited low levels of ANA of unknown specificity by 24 wks post-treatment but the titers were

lower than BALB/c controls (Figure 4-7C). A single TLR7-/- animal with high titer ANA

(1:1280) produced autoantibodies against DNA/chromatin (not shown). In contrast,

autoantibodies against nRNP/Sm remained undetectable in all TLR7-/- mice (Figure 4-7D). We

further confirmed the autoantibody profile by immunoprecipitation using nuclear extracts from









35S-labeled K562 cells. Consistent with the ELISA data, autoantibodies against various

components of nRNP/Sm (A-G) were found in wild-type, but not TLR7- mice (Figure 4-7E).

Immunoprecipitation studies also revealed that autoantibodies against the Su antigen,

which develops in -20 % of lupus patients (138) and -50% of TMPD-treated BALB/c mice

(138), were not induced in TLR7 mice (Figure 4-8A). Su antigen is an RNA-binding protein,

also known as argonaute 2 (ago2), involved in the microRNA pathway (125, 139). ELISA using

recombinant ago2 confirmed that the development of autoantibodies against Su/ago2 required

TLR7 (Figure 4-8B), suggesting that the autoimmune response to microRNA-associated antigens

also is mediated by TLR7. Thus, in addition to its role in mediating IFN-I production, TLR7 is

essential for the generation autoantibodies against RNA-associated antigens (nRNP/Sm and

Su/ago2) in TMPD-induced lupus.

Discussion

Recent studies strongly suggest a link between elevated IFN-I production and the

pathogenesis of SLE. More than half of SLE patients display increased expression of ISGs,

often in association with active disease and autoantibodies against snRNPs and DNA, as well as

renal involvement and endothelial dysfunction (31-33, 75, 76, 140). However, the exact cause of

IFN-I dysregulation in lupus remains controversial and it is unclear whether IFN-I

overproduction promotes autoantibody production or vice versa.

TMPD-induced lupus recapitulates many features of human SLE including

glomerulonephritis, arthritis, and autoantibodies against dsDNA and snRNPs (96, 97). Like

SLE, TMPD-lupus is more severe in females than males (141). We recently found that TMPD-

treated mice exhibit the interferon signature and that their lupus is dependent on IFN-I signaling

(93). Here, we show that TMPD triggers IFN-I production via the TLR7/MyD88 pathway. Our

data also exclude a major role of other pathways of IFN-I production, including TLR9,









TLR3/TLR4/TRIF, RIG-I/Mda5/IPS-1, and DAI/TBK1. Although there was a strict requirement

for TLR7 and MyD88, expression of ISGs and recruitment of Ly6Chi monocytes in response to

TMPD was unexpectedly independent of FcyRs, suggesting that uptake of immune complexes is

not required for IFN-I production in this model.

The innate sensors TLR7 and TLR9 have been implicated in SLE due to their ability to

recognize endogenous nucleic acids and trigger IFN-I production (83). Mammalian nucleic

acids are generally weak TLR ligands due in part to their inability to reach the endosomal

compartment where TLR7 and TLR9 are localized. When they form ICs with lupus

autoantibodies (anti-Sm/RNP or anti-dsDNA), endogenous nucleic acids may be delivered more

efficiently to endosomes due to uptake by FcyRs, stimulating IFN-I production by PDCs (83,

84). This model for IFN-I induction in human SLE is supported by numerous in vitro studies

(80, 82, 128). Whereas FcyRIIa mediates the activation of human PDCs, ICs trigger IFN-I

production by murine PDCs in a TLR7- and FcyRI/III-dependent manner (129).

However, it is not known whether the development of anti-ribonucleoprotein

autoantibodies is a cause of IFN-I dysregulation or a consequence of it. Therapeutic use of IFN-

a can induce many features of SLE including anti-dsDNA antibodies, suggesting that IFN-I

dysregulation occurs upstream of IC formation. Consistent with that view, IFN-I upregulation in

the TMPD model occurs within the first two weeks of treatment, more than two months before

the onset of lupus autoantibodies (see Chapter 3). FcyRI and FcyRIII were not required for the

IFN-I response to TMPD, since it was unaffected in y-chain-deficient mice. Moreover, a

previous study showed that the absence of FcyRI/III or FcyRIIb does not affect anti-Sm/RNP

autoantibody production in TMPD-treated mice (142). Although IC formation and FcyRs are not









required to initiate IFN-I production, we cannot exclude the possibility that they amplify IFN-I

secretion and accelerate disease progression subsequent to the development of autoantibodies.

A pathogenic role of TLR7 has been described in several murine lupus models. The 1pr

mutation (which leads to aberrant apoptosis due to the deficiency offas) drastically accelerates

autoantibody production and kidney disease in the autoimmune prone MRL background (91). In

MRL-lpr mice, TLR7 ligands accelerate the onset of glomerulonephritis whereas deletion of

TLR7 abrogates the development of anti-Sm autoantibodies and reduces the severity of nephritis

(123, 136). Lupus in MRL-lpr mice is ameliorated, not exacerbated by IFN-I (92), and the 1pr

defect prevents induction of TMPD-lupus (143).

Dual engagement of TLR7 and the B-cell receptor can directly activate autoreactive B cells

in the AM14 model, which spontaneously produce rheumatoid factors derived from MRL-lpr

mice (144). TLR7 also is required for the spontaneous production of autoantibodies against

ssRNA in 564Igi transgenic mice, in which the heavy and light chain genes encoding an anti-

RNA immunoglobulin have been inserted into the heavy and light chain loci of the non-

autoimmune C57BL/6 background (145). The connection between TLR7 and the generation of

RNA-associated autoantibodies is further illustrated by the recent demonstration of a duplication

of the TLR7 gene in Yaa mice. The presence of the Yaa cluster was sufficient to induce RNA-

associated autoantibodies in C57BL/6 FcyIIB mice and C57BL6.Slel mice, two autoimmune

strains that normally lack these antibody specificities (133, 134). TLR7, and not the other 16

genes affected by the Yaa mutation, is responsible for the autoimmune pathology (135).

Increased IFN-I production has not been reported in these models, however. Our findings

indicate that TLR7 also plays an essential role in TMPD lupus. Similar to MRL-lpr (136), TLR7

is required to generate anti-nRNP/Sm autoantibodies in TMPD-lupus. The interferon signature









in TMPD-treated mice, which is established within 2 weeks of treatment (long before the

appearance of anti-nRNP autoantibodies), was abolished in the absence of TLR7. In contrast,

the effects of TMPD were amplified in the presence of Yaa. Therefore, TLR7 is likely to be

involved directly in the induction of IFN-I, even in the absence of autoantibodies and ICs.

We have shown previously that Ly6Chi monocytes are a major source of IFN-I in the

TMPD model. Depletion of monocytes, but not DCs, reduced IFN-I production and ISG

expression. Here we found that Ly6Chi monocytes express higher levels of TLR7 and display a

greater response in vitro to R848 than to other TLR ligands. While TLR7 normally is found on

monocytes and macrophages, its expression on peritoneal Ly6Chi monocytes in TMPD-treated

mice was several-fold higher than on splenic or bone marrow monocytes. In contrast, DCs in the

peritoneal exudate displayed lower levels of TLR7 and more prominent TLR3 and TLR9

expression. The high expression of TLR7 by Ly6Chi monocytes may be of critical importance in

the pathogenesis of TMPD lupus, as increased TLR7 gene dosage is sufficient to trigger anti-

RNA antibodies and glomerulonephritis in C57BL/6 mice (135). Interestingly, the recruitment

of Ly6Chi monocytes to the peritoneum seems partially dependent on IFN-I, as seen in TLR7-/-,

MyD88-/-, and IFNAR- mice. TLR7 signaling also induces the expression of several interferon-

stimulated chemokines (CCL2, CCL7, and CCL12), suggesting that the mechanism may involve

enhanced production of monocyte chemoattractants, creating an amplification loop of Ly6Chi

monocyte recruitment and IFN-I production. The recruitment of DCs and granulocytes, on the

other hand, was not dependent on IFN-I or TLR7.

The exact mechanism linking TMPD to the activation of TLR7 on Ly6Chi monocytes

and/or other cell subsets remains uncertain. While it is possible that the TMPD acts as a TLR7

ligand, its hydrocarbon structure is distinct from known TLR7 ligands including ssRNA, R848,









loxoribine, and other guanosine analogues. However, the structure of hydrocarbon oils is related

to their ability to stimulate IFN-I production. Hexadecane, which differs from TMPD by the

addition of one carbon and the absence of four methyl groups, elicits less ISG expression and a

lower incidence of anti-RNP autoantibodies (see Chapter 3). Other adjuvant oils such as

medicinal mineral oil lack the ability to induce lupus autoantibodies and IFN-I production (146).

Alternatively, TMPD may function indirectly by modifying or stabilizing endogenous TLR7

ligands such as the Ul RNA component of the Sm/RNP antigen, which is released from dying

cells (27, 81, 147). Incorporation of TMPD into the plasma membrane also could affect the

function and/or stability of TLRs (148). Further studies are needed to define the mechanism of

TLR7 activation by TMPD, although in vitro investigations on the proinflammatory properties of

the adjuvant oil are significantly limited by the immiscible nature of TMPD in aqueous solutions.

It is noteworthy that besides activating IFN-I production via TLR7, TMPD also induced

granulocyte recruitment via a MyD88-dependent, but TLR7-independent pathway. The number

of peritoneal granulocytes actually increased in the absence of IFN-I production, as seen in

TLR7- and IFNAR- mice. MyD88 is employed in the signaling pathways of other cytokines

(IL-1 and IL-18) and TLRs (except TLR3), which are potential mediators of granulocyte

recruitment in this model.

Finally, our findings may shed light on other pathology induced by TMPD. The

development of plasmacytomas following i.p. injection of TMPD in BALB/cAnPt mice was first

described over three decades ago (94). Subsequently TMPD was used to enhance monoclonal

antibody production by hybridomas (95). How TMPD elicits these effects is incompletely

understood, although IL-6 has been implicated. Interestingly, while TLR7 can trigger B cell

activation and antibody production (144), IFN-I plays an important role in antibody class-









switching and promotes plasma cell differentiation in the presence of IL-6 (149). Whether TLR7

activation and IFN-I production are involved in the pathogenesis of plasmacytomas and

enhancement of antibody production by hybridomas warrants further investigation.












Table 4-1. Cytokine and chemokine PCR array analysis in TLR7T- mice.


* fold difference indicates the average expression difference between TLR7-'- and wild-type mice (n = 2 per group).
Positive values indicate increased expression in wild-type mice, negative values represent increased expression in
TLR7-1- mice, and zero indicates identical expression levels.


Ref Seq
NM_011331
NM_013654
NM_011333
NM_021274
NM_008599
NM_013653
NM_011329
NM_008337
NM_013652
NM_021443
NM_010735
NM_007768
NM_019932
NM_021704
NM_019494
NM_011337
NM_011332
NM_010554
NM_010798
NM_011330
NM_009142
NM_011338
NM_011577
NM 021283
NM_009139
NM 010548
NM_011888
NM_018866
NM_008518
NM 013693
NM_008176
NM_016960
NM 008361
NM_019577
NM_009138
NM 009141


Gene
Ccll2
Ccl7
Ccl2
CxcllO
Cxcl9
Ccl5
Ccll
Ifng
Ccl4
Ccl8
Lta
Crp
Cxcl4
Cxcll2
Cxcll
Ccl3
Ccl17
Ilia
Mif
Ccll I
Cx3cll
Ccl9
Tgfbl
114
Ccl6
1110
Cc119
Cxcll3
Ltb
Tnf
Cxcll
Ccl20
Illb
Ccl24
Ccl25
Cxcl5


Description
Chemokine (C-C motif) ligand 12
Chemokine (C-C motif) ligand 7
Chemokine (C-C motif) ligand 2
Chemokine (C-X-C motif) ligand 10
Chemokine (C-X-C motif) ligand 9
Chemokine (C-C motif) ligand 5
Chemokine (C-C motif) ligand 1
Interferon gamma
Chemokine (C-C motif) ligand 4
Chemokine (C-C motif) ligand 8
Lymphotoxin A
C-reactive protein, pentraxin-related
Chemokine (C-X-C motif) ligand 4
Chemokine (C-X-C motif) ligand 12
Chemokine (C-X-C motif) ligand 11
Chemokine (C-C motif) ligand 3
Chemokine (C-C motif) ligand 17
Interleukin 1 alpha
Macrophage migration inhibitory factor
Small chemokine (C-C motif) ligand 11
Chemokine (C-X3-C motif) ligand 1
Chemokine (C-C motif) ligand 9
Transforming growth factor, beta 1
Interleukin 4
Chemokine (C-C motif) ligand 6
Interleukin 10
Chemokine (C-C motif) ligand 19
Chemokine (C-X-C motif) ligand 13
Lymphotoxin B
Tumor necrosis factor
Chemokine (C-X-C motif) ligand 1
Chemokine (C-C motif) ligand 20
Interleukin 1 beta
Chemokine (C-C motif) ligand 24
Chemokine (C-C motif) ligand 25
Chemokine (C-X-C motif) ligand 5


Fold Difference*
-33.9362
-28.4818
-24.7422
-16.2245
-6.08813
-5.58203
-5.45568
-5.01697
-1.53374
-1.40583
-1.05032
-0.98869
-0.62988
-0.3878
-0.38105
-0.3689
-0.18197
-0.13888
-0.07331
-0.0577
-0.04255
0.209733
0.255246
0.375313
0.376835
0.385754
0.770252
1.524727
2.057481
2.238394
2.893923
3.457557
3.74199
4.259322
8.293495
15.13422










B C


Wild-type


MyD88 -I-


TRIF -I- IFNAR --
33.4%CD11 2%




CD11b


Mx-1




S200 IRF-7
S I50
-100
5 0.


E Wild-type IFNAR MyD88 -- TRIF 4-
,,[ MFI=22 | MFI=9 1R 1 F11 MF=330
i i i Baseline

S MFI= 76 FI= 13 MFI 19220 MFI=86



B220


Figure 4-1. Induction of IFN-I by TMPD requires MyD88. A) Comparison of the number of
total PEC, Ly6Chi monocytes, and granulocytes two weeks after TMPD treatment in
wild-type (n = 5), MyD88' (n = 6), TRIF- (n = 4) and IFNAR-1- mice (n = 4). B)
Flow cytometry of peritoneal cells (box indicates Ly6Chi monocytes and oval
indicates granulocytes). C) RT-PCR analysis of Mx] and IRF7 expression in PECs
(normalized to peritoneal cells from an untreated wild-type mouse). D) ELISA
quantification of MCP-1 in the peritoneal lavage fluid of TMPD treated mice. E)
Flow cytometry analysis of Sca-1 expression on peripheral blood mononuclear cells
(MFI denotes mean fluorescence intensity of Sca-1 on B220+ cells). Each bar (panels
A, C, D) represents the mean and error bars indicate standard error (SE). p < 0.05
(Student's t-test).


0 'A











Mx-1


.0 60




0-

20
200 IRF-7
g 160-



& 40]

"A N -- 0 --






Figure 4-2. Cytoplasmic nucleic acid sensors do not contribute to IFN-I production. RT-PCR
analysis of Mxl and IRF7 expression in PECs from wild-type (n = 5), IPS-I- (n = 5),
TNF- (n = 2), and TNF-/-TBK-1-/- (n = 4) animals (normalized to peritoneal cells
from an untreated wild-type animal) two weeks after TMPD treatment. Each bar
represents the mean and error bars indicate SE.












B Wild-type
308%


0 -f^


TLR7 -


TLR9 -"
336%


S"4 '1 *'


CD11b


C,40,
301

11)
i6 0
10
I-


8
*s-12'


E
z -
- 0
,@20
'-5
S10i
C-5
0 0 -' -


Baseline



TMPD


..500
050
0
s? '


Figure 4-3. Induction of IFN-I by TMPD is TLR7-dependent. A) Comparison of the number of
total PEC, Ly6Chi monocytes, and granulocytes two weeks after TMPD treatment in
wild-type (n = 5), TLR7-'- (n = 5), TLR9-'- (n = 5) mice. B) Flow cytometry analysis
of peritoneal cells (box indicates Ly6Chi monocytes). C) RT-PCR analysis of Mx]
and IRF7 expression in PECs (normalized to peritoneal cells from an untreated wild-
type animal) and ELISA quantification of MCP-1 in the peritoneal lavage fluid. D)
Flow cytometry of Sca-1 surface expression on peripheral blood mononuclear cells
(MFI denotes mean fluorescence intensity of Sca-1 on B220+ cells). Each bar (panels
A, C, D) represents the mean and error bars indicate SE. p < 0.05 (Student's t-test).


Wild-type TLR7"- TLR94-
V,| FI= 3 V a MF-40

66-I 1- .

(0 FI MFI]66 | MFI= 471 F MFI=919

w^lll













Ly6Chhi
monocytes .. ..

Granulocytes /.,.,

Lymphocytes '
&DCs
FcyRI FcyRII/III

B FcyRI FcyR4-


-J ',01


CD11b

C LIIFcyR+/+ iFcyR-/-
1000

100
C.
X
10

Mx-1 IRF-7

Figure 4-4. Dispensable role of FcyRI and FcyRIII in TMPD-induced IFN-I production. A) Flow
cytometry analysis of FcyRI (CD64) and FcyRII/III (CD32/CD16) in PEC
populations in TMPD-treated wild-type mice. B) Peritoneal cell influx and C) ISG
expression in wild-type mice and FcyRI/III-/- (y-chain deficient) mice two weeks after
TPMD treatment. Each bar represents the mean (n = 3) and error bars indicate SE.











A TLR3 TLR4 TLR7 TLR9 CCR2 B r1PBS Clo-lip
SGranulocytes
PEC Dendritic cells "
Neg. fraction IL
Bone marrow Ly6C" mono 50
Spleen Ly6C mono
0 1GO 230 0 100 200 5 10 0 5 10 0 5 10 0
Fold expression TLR7 TLR9

C
16- 8-
E 12- 6-
8-J
4- -2- 0 -=

Med PIC LPS R848 CpG Med PIC LPS R848 CpG


Figure 4-5. Immature Ly6Chi monocytes express high levels of TLR7. A) RT-PCR analysis of
TLR expression in sorted PEC populations, splenic Ly6Chi monocytes and bone
marrow monocyte precursors from wild-type TMPD-treated mice. B) RT-PCR
analysis of TLR7 and TLR9 expression in PECs from TMPD-treated mice 48 hrs
after i.p. injection of PBS or clodronate-liposomes. C) ELISA for MCP-1 and IL-6
produced by sorted peritoneal Ly6Chi monocytes (5 X 104 cells/well) 24 h after TLR
ligand stimulation. Wedge denotes increasing concentrations of LPS, R848, CpG
DNA (100 ng/mL, 1 [g/mL, and 10 [g/mL) and poly I:C (200 ng/mL, 2 [g/mL, and
20 [ig/mL). All mice were treated with TMPD for two weeks. Data are
representative of two independent experiments.











A TLR7+*+ TLR7+Naa


-- ,., -,

CD11b

B L. ETLR7-T
200- TLR7'+
TLR7+'Yaa
.0 150 L
S. 100-
"2 50

Mx-1 IRF7

C
100 --PBS
580 -.-TMPD

6 0 "
40 P<0.05
20- ,

0 12 4 6 78
Age (months)

Figure 4-6. Amplification of the response to TMPD by the Yaa locus. A) Flow cytometry of
peritoneal cell and B) RT-PCR analysis of ISG expression in BXSB X B6 female
(TLR7 ) and male mice (TLR7 /Yaa) two weeks after TMPD treatment. denotes
p<0.05 (Student's t-test). C) Survival curve for male BXSB mice after PBS or
TMPD treatment (arrow denotes treatment at 8-10 weeks of age).














C 1280


LJ BALB/C
m TLR7-'-


Baseline 24 wks Baseline 24 wks
IgM IgG




5000- a
30001 a
1000-

200-

100- 0
00
0 n 000

BALB/c TLR7-' BALB/c TLR74-
12 wks 24 wks


IgGI IgG2a IgG2b IgG3


BALB/c


0 coo
0 a




BALB/c TLR7 BALB/c TLR74-
12 wks 24 wks


TLR7-'-


5- -- --6--*


S45
A -m
B/BW I m m .T


C


E/F
G


m mm
- -mn


-20
-14


Figure 4-7. Essential role of TLR7 in autoantibody production. A) Total IgM, IgG and B) IgG
subclass levels in BALB/c.TLR7T- (n = 8) and wild-type BALB/c mice (n = 12)
before and 24 weeks after TMPD treatment. Bars represent the mean and error bars
indicate SE. p<0.05, ** p<0.001 (unpaired t-test). C) Fluorescent ANA titers
titrationn emulation) and D) anti-nRNP/Sm IgG levels (antigen-capture ELISA) at 12
weeks and 24 weeks post-TMPD treatment. Line indicates median and denotes
p<0.05 (Mann-Whitney U test). E) Immunoprecipitation of serum autoantibodies (n
6 per group) using nuclear extracts from 35S-labeled K562 cells (12.5%
polyacrylamide gel). Arrows indicate components of nRNP/Sm and numerical values
denote the molecular weight (kD).


aDD a













BALB/c

l-U--- am-1


TLR7-'-


0


0
000


BALB/c TLR7-'- BALB/c TLR74-
Baseline 24 wks


Figure 4-8. Development of anti-Su/ago2 autoantibodies is TLR7-dependent. A)
Immunoprecipitation of serum autoantibodies 24 wks after TMPD treatment (n = 6
per group; 8% polyacrylamide gel). Arrows indicate the 100 kD Su antigen and
numerical values denote the molecular weight (kD). B) Anti-Su/ago levels at
baseline and 24 wks post-TMPD treatment measured by ELISA using recombinant
ago2 protein. indicates p<0.05 (Mann-Whitney U test).









CHAPTER 5
TYPE-I INTERFERON-DEPENDENT RECRUITMENT OF INFLAMMATORY
MONOCYTES IN TMPD-INDUCED LUPUS

Introduction

Chronic inflammation is a pathological condition characterized by unremitting production

of cytokines and other mediators in response to persistent microbial infection or chemical agents

(150). In chronic autoimmune disorders such as systemic lupus erythematosus (SLE),

endogenous antigens also may play an important role in perpetuating the chronic inflammatory

state (26). Regardless of the cause, a common feature of chronic inflammation is the persistent

homing of circulating monocytes to the site of injury (150).

Two major subsets of blood monocytes have been identified in mice. Inflammatory

monocytes (also called Ly6Chi monocytes), characterized by surface expression of Ly6C and the

chemokine receptor CCR2, are newly released from the bone marrow and actively recruited to

inflamed tissue (108). On the other hand, residential monocytes (also called Ly6C- monocytes)

in the circulation express CX3CR1 and infiltrate non-inflamed tissues where they differentiate

into residential tissue macrophages (MO) (105, 108). Under steady-state conditions,

inflammatory monocytes spontaneously mature into the residential subset in the circulation.

(105, 108). Upon their recruitment to sites of injury, inflammatory monocytes also can

differentiate into MO, which exhibit enhanced phagocytic activity, or dendritic cells that help

capture antigens for presentation to lymphocytes (116, 151). Tissue monocyte/ MO also can

amplify the immune response by secreting inflammatory cytokines and chemokines, which

recruit other immune cells. In chronic inflammation, however, persistent production of these

inflammatory mediators often leads to tissue damage, resulting in cycles of tissue destruction and









repair. The mechanism underlying the continuous recruitment of monocytes in chronic

inflammation is not well defined.

Intraperitoneal administration of 2,6,10,14 tetramethylpentadecane (TMPD; also known as

pristane) potently induces chronic inflammation in mice. The influx of mononuclear and

polymorphonuclear leukocytes to the peritoneal cavity persists for months after injection of this

hydrocarbon oil (152). The chronic inflammatory state also promotes tumorigenesis, as TMPD

was found to induce plasmacytomas more than three decades ago (94). Subsequently, TMPD

was used to enhance monoclonal antibody production by hybridoma cells implanted in the

peritoneal cavity (95). TMPD treatment stimulates the development of highly organized ectopic

lymphoid structures ("lipogranulomas"), a feature often associated with chronic inflammatory

disorders (152). The ectopic lymphoid tissue may play a key role in the induction of lupus-like

autoimmune disease autoantibodiess, glomerulonephritis, arthritis, pulmonary vasculitis) in

TMPD treated mice (103).

How TMPD causes chronic inflammation is not well understood, but a pathological role

of several cytokines has been suggested. IL-6 is essential for the generation of plasmacytomas

(153), whereas IL-12 is required for the development of TMPD-induced glomerulonephritis (24).

Recently, it was found that type I interferons (IFN-I; including IFN-c and IFN-P3) and type II

interferon (IFN-y) both contribute to autoantibody production in TMPD-treated mice (23, 103).

Using TMPD-induced chronic peritonitis as a model, we examined the mechanisms) underlying

the chronic recruitment of monocytes and granulocytes to sites of inflammation.

Methods

Mice
These studies were approved by the Institutional Animal Care and Use Committee. Wild-

type C57BL/6, IL-6- -, TNFa-/-, CCR2- and IL-1R- mice (all on a C57BL/6 background),









C3H/HeJ, C3H/HeOuJ, BALB/c, and BALB/c.IFN-y-'- were from Jackson Laboratories (Bar

Harbor, ME). 129Sv/Ev Type I interferon receptor a-chain deficient (IFNAR--) mice and wild

type controls (129Sv/Ev), originally from B&K Universal Limited (Grimston, Aldbrough,

England), were bred in our facility. All mice were maintained a specific pathogen free facility at

the University of Florida. Mice (8- to 10-weeks old) received TMPD (0.5 ml i.p., from Sigma-

Aldrich, St. Louis, MO), 4% thioglycollate (BD Bioscience, San Jose, CA) or PBS. Peritoneal

exudate cells were isolated as described (100, 103). For morphological analysis, 5 x 104 sorted

cells were cytospun onto glass slides (Fisher Scientific, Pittsburg, PA) and stained using the

Hema3 kit (Fisher).

Real-Time PCR

RT-PCR was performed as described (103). Briefly, total RNA was extracted from 106

peritoneal cells using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized

using Superscript II First-Strand Synthesis Kit (Invitrogen). RT-PCR was performed using the

SYBR Green Core Reagent Kit (Applied Biosystems, Foster City, CA) with an Opticon II

thermocycler (MJ Research, Waltham, MA). Amplification conditions were: 950C for 10 min,

followed by 45 cycles of 940C for 15 s, 600C for 25 s, and 720C for 25 s. After the final

extension (720C for 10 min), a melting-curve analysis was performed to ensure specificity of the

products. Primers used in this study are included in Table 2-1.

Flow Cytometry

All antibodies were purchased from BD Bioscience with the exceptions of anti-Ly6C-

FITC, anti-Ly6C-biotin, avidin-APC (eBioscience, San Diego, CA), anti-F4/80-FITC, and anti-

CD 1 lb-Pacific blue (Caltag Laboratories, Burlingame, CA). Cell staining was performed as

described (103). Fifty thousand events per sample were acquired using a CYAN ADP flow









cytometer (Dako, Fort Collins, CO) and analyzed with FCS Express 3 (De Novo Software,

Ontario, Canada).

Monocyte Labeling

Clodronate (a gift from Roche Diagnostics) liposomes (Clo-lip) and 1,1 '-dioctadecyl-

3,3,3',3'-tetramethylindodicarbocyanine perchlorate (DiD)-liposomes were produced as

described (105, 106). To label Ly6C- monocytes, 150 [L of DiD-liposomes were injected i.v.

into TMPD-treated mice. Clo-lip (200 ld) was delivered i.v. 24 hr prior to the injection of DiD-

liposomes for the labeling of Ly6Chi monocytes (105). Cells were analyzed 24 or 72 h after

labeling. To test phagocytic activity of peritoneal monocyte/MO in vivo, 50 tL of DiD-

liposomes were injected i.p. and peritoneal cells were analyzed by flow cytometry 1 h later.

In Vitro Stimulation

PECs resuspended in complete DMEM (containing 10% FCS, 10 mmol/L HEPES,

glutamine, and penicillin/streptomycin plus 10 U/ml heparin) were seeded on 96 well cell-culture

plates (105 cells/well). Cells were stimulated with the indicated doses of peptidoglycan, R848

(Invivogen, San Diego, CA), or LPS (from Salmonella typhimurium; Sigma) and incubated at

37 C in a 5% C02 atmosphere for 24 h before collecting the supernatant. IL-12, TNF-c ,

MCP-1 and IL-6 ELISAs (BD Biosciences) were performed following the manufacturer's

instructions. Optical density was converted to concentration using standard curves based on

recombinant cytokines analyzed by a four-parameter logistic equation (Softmax Pro 3.1).



Results

Peritoneal Recruitment of Ly6Chi Monocytes after TMPD Treatment

We analyzed the peritoneal cell infiltrate at various time points after i.p. injection of

TMPD. In untreated mice, peritoneal lavage yielded mainly B220+CD1 lb+ BI lymphocytes









(Figure 5-1A, circle) and B220-CD1 lb myeloid cells (Figure 5-1A, box) that included mostly

granulocytes and monocyte/MD. Granulocytes, characterized by the expression of Ly6G,

comprised only a small portion of the myeloid population (CD1 lb+B220- gate; Figure 5-1A,

right). Thus, the Ly6G- cells were predominantly monocyte/M(. Consistent with other studies

(105, 107), residential peritoneal macrophages did not exhibit surface expression of Ly6C

(CD1 lb+B220-Ly6G- gate; Figure 5-1A right), a marker highly expressed on inflammatory

monocytes.

Using the same method of analysis, a strikingly different pattern was observed 18 hrs after

TMPD treatment (Figure 5-1B). A dramatic expansion of CDl lb+B220- peritoneal exudate cells

(PEC) and a reduction in both B 1 lymphocytes and conventional B cells were observed (Figure

5-1B left). Granulocytes were the predominant population at this time point, outnumbering

monocyte/MO by ~2 to 1. Unlike residential peritoneal MO, the majority of monocytes elicited

by TMPD expressed high levels of Ly6C, suggestive of an inflammatory phenotype. The

chronic nature of the response to TMPD was confirmed by the presence of granulocytes and

Ly6Chi monocytes in the peritoneal cavity two weeks, and even two months after the initial

injection (Figure 5-1B).

An early influx of granulocytes and Ly6Chi monocytes was also detected in the sterile

peritonitis induced by thioglycollate (Figure 5-1C). However, the response was transient by

comparison with TMPD. Monocytes elicited by thioglycollate gradually developed a mature

Ly6C- phenotype whereas granulocytes were absent by 72 h (Figure 5-1C). The depletion of B

lymphocytes was also not a feature of thioglycollate-induced inflammation (the reduced

percentage of these cells was due to expansion of the myeloid populations).









Chronic Recruitment of Ly6CIh Monocytes is Dependent on IFN-I signaling

Proinflammatory cytokines including IL-6, TNFa, IFN-y and IFN-I are produced in the

peritoneum of TMPD-treated mice (103, 146, 154). We asked whether these cytokines play a

role in the persistent inflammatory cell influx in response to TMPD. Compared to wild-type

C57BL/6 controls, mice deficient of IL-6 or TNFa showed a similar influx of granulocytes and

Ly6Chi monocytes to the peritoneal cavity two weeks after TMPD treatment (Figure 5-2A, Table

1). The persistent inflammatory response also was not explained by the presence of endotoxin as

a similar pattern was seen in C3H/HeJ mice, which carry a mutation in Toll-like receptor (TLR)-

4. Moreover, the absence of IFN-y also did not affect the pattern of inflammatory cell

recruitment, although the BALB/c background itself was associated with a greater number of

granulocytes (Figure 5-2B, Table 5-1). Interestingly, while a sustained accumulation of

granulocytes was found in TMPD-treated IFNAR- mice, the majority of monocyte/MO in the

peritoneal cavity exhibited a mature, Ly6C- phenotype (Figure 5-2B, Table 5-1). This

observation was not caused by genetic background differences as wild-type 129Sv and B6 mice

demonstrated comparable responses to TMPD (Table 5-1). Consistent with our analysis by flow

cytometry, visual examination of PECs showed numerous polymorphonuclear cells in wild-type

and IFNAR-/- mice (Figure 5-2B). Whereas cells with monocytic morphology were found in the

peritoneal cavity of wild-type mice, PECs from IFNAR- mice consisted mainly of revealed the

presence of larger, vacuolated cells consistent with a mature, MO-like morphology (Figure 5-

2C). These findings were specific for TMPD as the inflammatory response to thioglycollate was

similar in wild-type and IFNAR- mice (Figure 5-2C and not shown).

Under steady state conditions, both residential (Ly6C-) and inflammatory monocytes

(Ly6Chi) are present in the circulation (105, 108). The accumulation of Ly6C- monocyte/MO in









TMPD-treated IFNAR-'- mice suggests that either this subset is preferentially recruited to the

peritoneal cavity, or the infiltrating Ly6Chi monocytes rapidly attains a mature phenotype at the

site of inflammation. To address these possibilities, we monitored the influx of monocytes to the

peritoneal cavity in vivo using fluorescently labeled liposomes. Neither Ly6C- nor Ly6Chi

circulating monocytes displayed fluorescence prior to labeling (CD1 lb+Ly6G- gate; Figure 5-

3A). As described previously (105), i.v. injection of liposomes containing the fluorescent dye

DiD (DiD-lip) selectively labeled Ly6C- monocytes (Figure 5-3B,C). After 24 h, > 40% of

circulating Ly6C- monocytes were DiD+ in TMPD-treated wild-type and IFNAR- mice, but few

DiD+ cells had migrated into the peritoneal cavity in either strain. Thus, the absence of IFN-I

signaling does not result in the preferential recruitment of Ly6C- monocytes from the bone

marrow.

To track the migration of circulating Ly6Chi monocytes, clodronate-liposomes (clo-lip)

were first given to deplete the Ly6C- subset. Twenty-four hours after the administration of DiD-

lip, -50% of peripheral blood Ly6Chi monocytes were fluorescently labeled in TMPD-treated

wild-type and IFNAR-L- mice (Figure 5-3D,E). Importantly, a similar percentage of Ly6Chi

monocytes in the peritoneal cavity of wild-type mice were DiD+, indicating that the majority of

cells in this subset entered the peritoneal cavity within the past 24 h. Although fewer peritoneal

Ly6Chi monocytes were found in the absence of IFN-I signaling, a milder influx of DiD+ Ly6Chi

monocytes were seen in IFNAR-'- mice (Figure 5-3D,E).

We extended the analysis to 72 h after i.v. injection of DiD-lip. Based on preliminary

studies, few DiD+ monocytes remained in the circulation at this time and further influx of labeled

cells to the peritoneal cavity was negligible (not shown). This allowed us to trace the fate of

DiD+Ly6Chi monocytes that had migrated into the peritoneal cavity during the previous 48 h. In









contrast to the earlier time point, few peritoneal Ly6Chi monocytes were DiD+ in wild-type mice

at this time, suggestive of a high turnover rate of the infiltrating monocytes (Figure 5-3F).

Curiously, the number of DiD+ monocytes in IFNAR- remained similar compared to 24 h post-

labeling. A maturation continuum was also evident in IFNAR-/- mice, as the majority of DiD+

monocytes at this time-point showed reduced or no expression of Ly6C (Figure 5-3F). Hence,

maturation of Ly6Chi monocytes, rather than recruitment of the Ly6C- subset, is responsible for

the accumulation of Ly6C- monocytes/MO in IFNAR- mice. Taken together, these data

illustrate the essential role of IFN-I in promoting the continuous recruitment of Ly6Chi

monocytes to the peritoneal cavity following TMPD treatment and are consistent with an IFN-

induced monocyte maturation deficit.

Monocyte Recruitment Induced by TMPD Requires CCR2

Since IFN-I are not known to possess direct chemotactic properties, we reasoned that the

production of chemokines induced by IFN-I signaling may be responsible for the influx of

Ly6Chi monocytes. Previous studies have shown that several monocyte chemoattractants

including CCL2, CCL7, and CCL12 are IFN-inducible genes (127, 155). Indeed, these

chemokines were highly expressed in PECs from TMPD-treated wild-type mice, but not IFNAR

/- mice (Figure 5-4A). Reduced levels of CCL2 protein also were observed in the peritoneal

lavage fluid of IFNAR-/- mice (Figure 5-4B). Conversely, the expression of CX3CL1, which

mediates the migration of Ly6C- monocytes (108), and the neutrophil attractants CXCL1 and

CXCL5, was affected modestly at best by the absence of IFN-signaling (Figure 5-4A). These

data supported the observation that IFN-I is essential for the influx of inflammatory monocytes,

but not Ly6C- monocytes or granulocytes.









To further examine the role of monocyte chemoattractants, we administered TMPD to

mice deficient of CCR2, the major receptor for CCL2, CCL7 and CCL12. Supporting the role of

these chemokines, PECs from CCR2- mice were comprised of primarily of granulocytes two

weeks post-treatment (Figure 5-4C, D). Both Ly6Chi and Ly6C- monocyte subsets were largely

absent in CCR2- animals whereas the number of granulocytes increased slightly compared to

controls (Figure 5-4D). Thus, the chronic influx of Ly6Chi monocytes induced by TMPD

requires the interaction between IFN-inducible chemokines and CCR2.

Functions of Monocyte Subsets in TMPD-Treated Mice

To evaluate the functional significance of the preferential recruitment of Ly6Chi monocytes

induced by IFN-I, we stimulated peritoneal monocyte/MO from wild-type and IFNAR-/- mice

with the TLR ligands peptidoglycan, lipopolysaccharide, and R848. Strikingly, the production of

IL-6, TNF-a, and MCP-1 in response to TLR-ligands were dramatically reduced in the absence

of IFN-I signaling (Figure 5-5A). Monocytes/MO from TMPD-treated IFNAR-/- mice showed

minimal production of TNF-a and MCP-1, even at the highest dose of TLR ligands tested.

The lack of inflammatory cytokine production in monocyte/MO from TMPD-treated

IFNAR- mice raised the question whether these cells differentiated towards the alternatively

activated M2 phenotype. Downregulation of inducible nitric oxide synthase (iNOS) and

upregulation of arginase-1 (arg-1) and TGF-P expression are characteristic features of M2

macrophages (156, 157). RT-PCR analysis of these genes in peritoneal monocytes/MO did not

reveal any differences between wild-type and IFNAR- mice (Figure 5-5B), suggesting that

alternative activation of monocyte/MO in the absence of IFN-I signaling is unlikely to explain

the discrepancy in cytokine production.









We assessed phagocytic function of peritoneal monocyte/MO in vivo by direct i.p.

injection of DiD-labeled liposomes. In contrast to cytokine production, phagocytosis was greatly

enhanced in monocyte/MO from IFNAR-'- mice compared with wild-type controls (Figure 5-5C).

Both the percentage of cells engulfing liposomes and the amount of uptake per cell (measured by

mean fluorescence intensity) were increased in the absence of IFN-I signaling (Figure 5-5C).

Further analysis revealed that the discrepancy was largely due to the predominance of Ly6C-

monocyte/MO in IFNAR-1- mice, which were more highly phagocytic than the Ly6Chi monocytes

(Figure 5-5D). It is noteworthy that although present in smaller numbers, the Ly6C- subset in

wild-type mice was also highly phagocytic. IFN-I treatment of bone-marrow derived MO in

vitro did not inhibit phagocytosis (not shown), indicating that the difference seen in wild-type

and IFNAR-"- mice was probably due to the difference in monocyte/MO subsets rather than a

direct effect of IFN-I. Therefore, IFN-I directs the recruitment of Ly6Chi monocytes that are

highly responsive to pathogenic stimuli but only weakly phagocytic.

Chronic Recruitment of Granulocytes Requires IL-1 Signaling

Finally, we investigated the mechanism of chronic granulocyte recruitment in TMPD-

treated mice. In contrast to Ly6Chi monocytes, the influx of granulocytes was independent of

IFN-I signaling and CCR2 interactions (Figures 5-2B, 5-4D). Deficiency of IL-6, TNF-uc, IFN-y,

or functional TLR4 also did not affect granulocyte recruitment. A recent study found that IL-1

signaling plays a role in granulocyte influx in urate crystal-induced peritonitis (158). To

examine the contribution of IL-1 signaling, we tested the effect of TMPD on IL-1 receptor-

deficient (IL-1R'-) mice. The number of granulocytes in the peritoneal cavity was greatly

reduced in IL-1R-W mice, whereas the accumulation of Ly6Chi monocytes was unaffected (Figure

5-6A, B). PECs from IL-1R-/- mice showed significantly reduced expression of the granulocyte









attractant CXCL5 and a slight reduction in CXCL1 (Figure 5-6C). Consistent with the normal

recruitment of Ly6Chi monocytes, expression of the IFN-inducible monocyte chemoattractants

CCL2, CCL7 and CCL12 as well as CX3CL1 was not affected.

We further analyzed whether components of the recently described inflammasome

complex act upstream of IL-IR. Upon detecting certain foreign stimuli [i.e. asbestos, silica

(159)] or endogenous molecules released by damaged cells [i.e. ATP, urate crystals (158)],

activation of the inflammasome results in the release of proinflammatory cytokines including IL-

l13 (160), which mediates the recruitment of granulocytes However, the deficiency of the major

inflammasome components NALP3 (cryopyrin), ASC (apoptosis-associated speck-like protein

containing a caspase recruitment domain), or caspase-1 did not impact the influx of granulocytes

or monocytes in TMPD-treated mice (Figure 5-6D and not shown). These findings suggest that

granulocyte influx in the chronic inflammatory response to TMPD is specifically mediated by an

IL-1R-dependent pathway, independent of inflammasome signaling or the mechanisms utilized

in monocyte recruitment.



Discussion

Chronic inflammation can be caused by persistent immune responses to microbes,

chemicals, or autoantigens (150). Despite the heterogeneity of etiologic factors, continuous

infiltration of monocytes is a common feature of many types of chronic inflammation. Using

TMPD to induce chronic peritonitis, we show in this study that the persistent recruitment of

inflammatory Ly6Chi monocytes was mediated specifically by IFN-I. These antiviral cytokines

activate the production of monocyte chemoattractants and recruit Ly6Chi monocytes in a CCR2-

dependent manner. Curiously, the rapid turnover of recruited monocytes in the peritoneum of









TMPD-treated mice was associated with a lack of differentiation into phagocytic Ly6C-

monocyte/MO, consistent with previous observations that the uptake of carbon particles is

reduced substantially following TMPD injection (161). These findings define an important role

of IFN-I in maintaining the chronic inflammatory state.

IFN-I are primarily known for their antiviral and anti-proliferative properties and a

prominent role in chronic inflammation has not been established previously (36). Studies on

acute murine cytomegalovirus infection illustrated that early antiviral defense is orchestrated by

IFN-I and the downstream production of IFN-inducible chemokines. Recruitment of NK cells

and macrophages to the site of infection is mediated by the production of CXCL3 and CCL2,

respectively (162, 163). Our results suggest that a similar mechanism is involved in the chronic

inflammation induced by TMPD, as IFN-I (but not other inflammatory mediators such as TNFa,

IL-6 and IFNy) is required to maintain the chronic recruitment of inflammatory monocytes to the

peritoneum. PECs from wild-type mice treated with TMPD displayed elevated expression of the

IFN-inducible monocyte chemoattractants CCL2, CCL7, and CCL12, promoting the migration

of monocytes to the site of inflammation through interactions with CCR2. Due to shared

receptor utilization, the relative contribution of each of these chemokines is unclear, although

recent studies suggest a synergy of CCL2 and CCL7 in recruiting monocytes (164, 165).

Interestingly, the chronic influx and rapid turnover of Ly6Chi monocytes was accompanied

by a concomitant reduction of Ly6C- monocyte/MO in the peritoneal cavity of TMPD-treated

mice. While Ly6Chi monocytes were also initially recruited following thioglycollate treatment,

few were found in the peritoneal cavity after 72 h as the majority of PECs were F4/80+Ly6C-

residential monocytes/MF. Unexpectedly, the pattern induced by TMPD was almost completely

dependent on IFN-I signaling. Labeling studies suggested that the accumulation of Ly6C-









monocyte/MO in IFNAR-'- mice was not due to direct recruitment of circulating Ly6C-

monocytes. Instead, the small number of Ly6Chi monocytes recruited to the peritoneal cavity

later differentiated into the Ly6C- subset. This view is supported by the deficiency of both

Ly6Chi and Ly6C- subsets in the absence of CCR2, which mediates the migration of Ly6Chi but

not Ly6C- monocytes (108, 119). How IFN-I interfere with differentiation or maturation of

Ly6Chi monocytes into the Ly6C- subset remains unclear.

The predominance of Ly6Chi monocytes is likely to amplify the inflammatory cascade as

these cells produced large amounts of inflammatory mediators in response to stimulation with

TLR2, 4, or 7 ligands. Ly6Chi monocytes may establish a vicious cycle of monocyte recruitment

and cytokine/chemokine production as they constitute a maj or source of IFN-I and CCL2 in

TMPD-treated mice (see Chapter 3). In contrast, Ly6C- monocyte/MO exhibited much greater

phagocytic capacity, but produced only small amounts of IFN-I, CCL2, IL-12, or TNFa.

Enhanced phagocytic function of Ly6C- monocytes in vivo also is illustrated by the preferential

labeling of this subset upon administration of DiD-liposomes alone, whereas depletion by clo-

liposomes was required in order to effectively label the Ly6Chi subset. We conclude that the

relative deficiency of Ly6C- monocyte/MO in the presence of IFN-I impairs phagocytic capacity

at the site of inflammation, leading to defective clearance of the triggering stimuli and

perpetuation of the inflammatory response. This possibility also is supported by the defective

clearance of carbon particles following i.p. TMPD injection (161).

Our findings suggest a potential role of IFN-I in clinical conditions associated with chronic

inflammation. In SLE, a chronic autoimmune condition characterized by the production of

antibodies to numerous self-antigens, serum levels of IFN-I correlate with disease severity,

kidney inflammation, and the presence of autoantibodies (31, 32). Numerous IFN-inducible









genes, including CCL2 and CCL7, are also coordinately overexpressed in lupus patients (127).

Interestingly, defective phagocyte function is well-established in SLE (26). Aberrant clearance

of apoptotic debris is thought to provide the autoantigens that initiate the autoimmune response

(166). Whether the dysregulation of IFN-I production in human SLE disrupts the balance of

inflammatory vs. residential monocyte subsets and/or contributes to the phagocytosis defect

warrants detailed investigation.

In addition, IFN-I may contribute to chronic inflammation in atherosclerosis. Circulating

Ly6Chi monocytes are chronically elevated in mice with atherosclerotic heart disease and these

inflammatory monocytes infiltrate the atheromatous lesion in apoE-deficient mice (119, 151).

Recombinant IFN-I administration accelerates plaque development in mice and human plaque

tissue exhibits elevated expression of IFN-ca as well as CCL2 (167, 168). In view of our

findings, it will be interesting to determine whether a similar IFN-I-chemokine feedback loop

contributes to the chronic monocytosis in atherogenesis or the accelerated atherosclerosis of SLE

patients (169).

We have also partially elucidated the mechanism for chronic granulocytes recruitment in

the TMPD model. Because of shared utilization of IL-IR, whether IL-lac and/or IL-13 are

essential for this process remains to be determined. We have ruled out the involvement of major

components of the inflammasome complex, which activates caspase-1 and stimulates the release

of IL-13 in response to exogenous and endogenous danger signals (158-160). However, other

mechanisms of IL-13P production remains possible (170) and recruitment of granulocytes to the

peritoneal cavity can also be mediated by IL-lac (171). Futures studies are needed to further

define the pathway(s) responsible for granulocyte recruitment.









In conclusion, our study defines an essential role of IFN-I in the recruitment of monocytes

in the TMPD-induced model of chronic inflammation. These findings suggest that novel

therapies aimed at neutralizing IFN-I and/or downstream chemokines may be effective treating

lupus and other chronic inflammatory conditions.












Table 5-1. Peritoneal exudate cell subsets two weeks following TMPD treatment
Ly6Chi Ly6C
Strain n monocytes Granulocytes mono/MID Dendritic cells B lymphocytes
(CD11lb+Ly6ChI) (CD11lbLy6G+) (CD11lb+Ly6C-) (CD11lcIA+) (B220+)
C57BL/6 6 6.32 1.44 5.04 1.25 2.01 0.33 0.68 0.11 0.88 0.15
B6.TNFa- 3 4.80 + 0.50 4.75 0.77 0.95 0.20 0.80 + 0.21 1.10 + 0.39
B6.IL-6-/- 3 4.81 0.62 6.13 0.78 1.47 0.29 0.43 0.07 0.40 0.25
C3H/HeJ 4 4.5 1.58 4.24 1.10 1.31 0.37 0.53 0.11 1.35 0.39
BALB/cJ 2 2.61 0.09 9.7 1.93 0.23 0.05 0.24 0.01 1.15 0.25
c.IFN-y 2 2.86 0.34 12.53 0.47 0.66 0.06 0.28 0.01 1.42 0.02
129Sv 7 4.85 0.48 3.23 0.54 0.35 0.16 0.33 0.11 0.95 0.22
129.IFNAR-/- 7 0.63 0.11 7.00 0.65 2.98 0.76 0.25 0.02 1.05 0.29











Untreated
10 8220-
10 29% Gate

10 AI Ly6G-
10 10' 10' 10 10 Mono/MD Gate"
CD11b
Ly6C

B TMPD 18 hrs 2 weeks 2 months

m io Ly6G
10 B 1~

00 107 PLy6G --- ->
10o I : 71 I 6 8 2%. 8 1 F 8
CD11b t0\ L\1
Ly6C

C
Thioglycollate 18 hrs 48 hrs 72 hrs

o'- 4%4%

S :- ,/ Ly6G--
104 1 10 101
CDIlb 10J C1L-
Ly6C >

Figure 5-1. Chronic recruitment of Ly6Chi monocytes in TMPD-treated mice. A) Cell subset
analysis of peritoneal cells from untreated C57BL/6 mice by flow cytometry. Left:
two-dimensional dot plot (left) shows the presence of CD 1 lb B220+ B 1 lymphocytes
(circle) and CD1 lb+B220- myeloid cells (box). Right: (upper) histogram analysis of
the percentage of Ly6G granulocytes and Ly6G- monocyte/MO in the myeloid cell
gate (CD1 lb B220-); (lower) histogram analysis of Ly6C expression on
monocyte/MO (CDllb+ B220- Ly6G- gate). Flow cytometry analysis of peritoneal
exudate cells (PECs) from B) TMPD-treated or C) thioglycollate-treated mice. Left:
two-dimensional dot plot of PECs 18 h after treatment; Right: histogram analysis of
Ly6G and Ly6C expression (as described above) at the indicated time points after
treatment.











C57BL/6 B6.IL-&6- B6.TNFr*- C3H/HeJ
48% 51% 45%
CD11b+



Gate

Ly6C

B
BALB/c c IFNg'- 129Sv 129.1FNAR+
CDIb+ % 81 54% 1 b+


Gate ___.. .. ,., ,, ,,


Ly6C >


C IFNAR++ IFNAR-/-




met |TMPD






S' Thioglycollate





Figure 5-2. The recruitment of Ly6Chi monocytes induced by TMPD requires IFN-I signaling.
Flow cytometry analysis of PECs from A) wild-type C57BL6, IL-6- -, TNF-c-/-,
C3H/HeJ and B) BALB/c, IFN-y--, 129Sv, and IFNAR- mice two weeks after
TMPD-treatment. Upper panels: histogram analysis of the percentage of Ly6G+
granulocytes and Ly6G- monocyte/MO in the myeloid cell gate (CD1 lb B220-);
lower panels: histogram analysis of Ly6C expression on monocyte/MO (CD1 lb
B220- Ly6G- gate). C) Morphologic analysis of PECs from 129Sv and IFNAR-/- mice
after TMPD (2 weeks) or thioglycollate treatment (3 days).










A B DiD-lip C
Oh Ly6C- mono
Oh 24h
PBMC monocyte gate IFNAR IFNAR 100 CIFNAR+1+

SL|* PBMC -

CD11b DiD 20.
E PEC 0. r.
PBMC PEC

DiD

D Clo-ip DiD-lip E F
t T --# Ly6Ch' mono
Oh 24h 48h CIo-lip DD-lip
100 ---l FNAR +/+ 0
IFNAR8*I IFNAR 80- IFNAR-I- Oh 24h 96h

SPBMC 5 IFNAR IFNAR
to 20 |

PEC PBMC PEC DiD
DiDD
DiD

Figure 5-3. Rapid turnover and decreased maturation of Ly6Chi monocytes is the presence of
IFN-I signaling. A) Gating strategy for the analysis of peripheral blood monocytes
(CD1 lb+ Ly6G-) used for subsequent labeling experiments. B) Flow cytometry
analysis and C) quantification of DiD+ Ly6C- monocytes in the peripheral blood and
peritoneum in TMPD-treated mice IFNARW (129Sv) or IFNAR-'- mice 24 hr after
administration of DiD-liposomes. D) Flow cytometry analysis and E) quantification
of DiD+ Ly6Chi monocytes 48 h or F) 96 h after pretreatment with clodronate-
liposomes followed by subsequent labeling with DiD-liposomes. All mice were
treated with TMPD two weeks before liposome injection. Bars represent the average
of 3 or more mice.










= IFNAR +/+
M IFNAR -/-


ii I,1 0I I.- !l ['Tm


\~ <~.
(5' ~5>


CCR2 -/


TQ a"" ,
teWg^
^9*.t
*JSiA


IFNAR +/+ -/-


= CCR2 +/+
I CCR2 -/-


Ly6CN
monocytes
Ly6C-
mono/mD
Ly6G
granulocytes


0 210
3



0 2 4 6 8 10


Figure 5-4. Monocyte recruitment induced by TMPD is dependent on CCR2. A) RT-PCR of
chemokine expression in PECs and B) ELISA analysis of CCL2 in peritoneal lavage
from IFNARR (129Sv) or IFNAR-/- mice 2 weeks after TMPD treatment. C)
Morphologic analysis and D) quantification of granulocytes and monocyte/M(D in
wild-type and CCR2-/- mice.


CCL2


10000-













IFNAR -'- D IFNAR -

10 10 10
8 8 /-
IL-6 6 6 6
(ng/mL) 4 4 4
2 2 2
00 0


25
TNF,,. 15
(ng/mL) 10 7
5
0


25
20
15
10
0 ,
0o-La^.


25
20
15
10
5
0


MCP-1 2 2
(ngfm L) 1 1 Z 1

0 0 0


20
15
IL-12 1
(ng/mL)



PGN


20
15
10
5LPS


LPS


C


Mono/M Gate


20
15
10




R848


I FNAR /+
1I FNAR -/-


iNOS Arginase-1 TGF-p


% DiD+ MFI
IFNAR"" 25,6 203
[] IFNAR 52,5 439


IFNAR *' IFNAR 4


DiD


Figure 5-5. Functions of monocyte subsets in TMPD-treated mice. A) ELISA quantification of
cytokine and chemokine production in adherent PECs from TMPD-treated IFNAR+/+
(129Sv) or IFNAR-/- mice cocultured with peptidoglycan (2 [g/mL), LPS (1 [g/mL)
or R848 ([g/mL) for 20 h. B) RT-PCR analysis of iNOS, Arginase-1, and TGF-P
expression in PECs. Flow cytometry analysis of DiD-liposome phagocytosis in C)

total PECs or D) monocyte/M(D (CD1 lb +B220-Ly6G- gate) in IFNAR+ or IFNAR-/-
mice two weeks after TMPD treatment.











IL-1R.'* IL-1R-'-
I 40% 5%


Ly6G
, ',g -------- ^


MJIL-1R






ni nl 1-16


IL-1R-'-










D


y
0


Figure 5-6. Granulocyte influx following TMPD treatment requires IL-1 receptor. A) Flow
cytometry analysis of PECs from wild-type C57BL/6 and IL-lR- /-mice two weeks
after TMPD-treatment. Upper panel: histogram analysis of the percentage of Ly6G
granulocytes and Ly6G- monocyte/MO in the myeloid cell gate (CD1 lb+B220-);
lower panel: histogram analysis of Ly6C expression on monocyte/MO (CD1 lb+
B220- Ly6G- gate). B) Morphologic analysis of PECs from IL-lR- mice. C) RT-
PCR of chemokine expression in PECs from wild-type C57BL/6 and IL-1R-- mice 2
weeks after TMPD treatment. Each bar represents the average from 5 mice. C)
Quantification of granulocyte influx in mice deficient in IL-1Rl or various
components of the inflammasome complex (2 weeks after TMPD treatment).


CD11 b+
B220-
Gate


Ly6G-
Gate


1000-1


.i 1









CHAPTER 6
DISCUSSION AND FUTURE DIRECTIONS

Although the etiology of SLE remains unknown, early studies focused on the adaptive

immune system as abnormalities of B and T lymphocytes were thought to be the basis of the

autoimmune condition. This paradigm has undergone a dramatic change with recent advances in

the field of innate immunity. It is now increasingly recognized that components of the innate

immune system, normally function to recognize invasion by microbial pathogens, play an

essential role in the recognition of self-antigens and subsequent initiation of the adaptive immune

response. The involvement of TLRs and IFN-I in SLE are among the best examples illustrating

the link between aberrant activation of innate immune system and the induction of

autoimmunity.

The work presented in previous chapters highlights the importance of innate immunity in

experimental SLE induced by TMPD. Supporting a pathogenic role of IFN-I, overproduction of

the anti-viral cytokines was responsible for many manifestations of lupus in TMPD-treated mice

including the development of autoantibodies and glomerulonephritis (93). We found that a

population of immature, inflammatory monocytes characterized by high levels of Ly6C

expression was a major source of IFN-I in TMPD-treated mice. Further investigation revealed

that activation of TLR7, an innate sensor of ssRNA in endosomes, was responsible for the

production of IFN-I and the recruitment of Ly6Chi monocytes, where as the CpG-DNA sensor

TLR9 and other pathways of IFN-I induction were not required. We also uncovered a new role

of IFN-I in mediating the chronic influx of Ly6Chi monocytes, establishing a vicious cycle of

monocyte recruitment and IFN-I production. In spite of these novel findings, many questions

regarding the TMPD model of SLE remain to be addressed.









Suitability of the TMPD-Model for the Study of SLE

Since its initial discovery more than 14 yrs ago, the TMPD model has often been criticized

for the lack of relevance to human SLE. The use of an exogenous hydrocarbon and the inducible

nature in non-autoimmune prone mice are incompatible with the human disease, which is heavily

influenced by genetic factors. However, because the etiology of lupus is unknown and likely to

be multi-factorial, no current animal models fully resemble the human syndrome, which itself is

heterogeneous as symptoms vary widely among lupus patients (1).

While the inducible nature of the model is not suitable for genetic studies of lupus, many

of the autoimmune features in mice treated with TMPD recapitulate the human disease. The

combination of lupus-specific antibodies (anti-Sm and anti-dsDNA), glomerulonephritis, and

female predisposition in TMPD-induced lupus is only paralleled by the MRl-lpr model (91).

Importantly, the TMPD model is currently the only model that exhibits the "interferon signature"

seen in more than half of lupus patients (32, 103). As the role of innate immunity is increasingly

recognized, our findings presented in previous chapters illustrate that innate components such as

TLRs and IFN-I are essential for disease development in this model. The inducible nature of

TMPD-induced lupus, in fact, offers an advantage over the genetic models as it allows temporal

assessment of upstream and downstream effects. This model further provides the opportunity to

test the efficacy of anti-IFN and anti-TLR7 therapeutic approaches. Therefore, the TMPD model

can yield valuable insights into the pathogenesis of SLE.

Complexity of the TMPD Model

The previous chapters have individually described novel features pertinent to the

involvement of IFN-I in the TMPD model. The observation of IFN-I production by Ly6Chi

monocytes (Chapter 3), the involvement of TLR7 activation (Chapter 4), and the role of IFN-I in

maintaining monocyte recruitment (Chapter 5) together illustrate that activation of specific









pathways involved in innate immunity, rather than "non-specific inflammation", is responsible

for the early effects of TMPD. Creating a model for how TMPD causes lupus based on our

current understanding uncovers a complex network of feedback interactions between the

recruitment of Ly6Chi monocytes, the production of IFN-I, and the expression of TLR7. While

Ly6Chi monocytes constitute a major subset of IFN-I producing cells, IFN-I and IFN-inducible

chemokines mediate further recruitment of monocytes from the peripheral blood and bone

marrow (Figure 6-1). This process is amplified by IFN-I signaling, which is subject to autocrine

feedback that enhances production of IFN-I. The expression of TLR7, which mediates the

production of IFN-I in this model, is also IFN-inducible. High levels of TLR7 expression in

Ly6Chi monocytes may further contribute to their ability to produce IFN-I. Finally, the chronic

presence of high levels of IFN-I may induce the activation of lymphocytes and dendritic cells

and initiate the immune response to autoantigens.

An important unanswered question is how TMPD initiates this cycle of monocyte

recruitment and IFN-I production. Since Ly6Chi monocytes are not normally present in the

peritoneal cavity and their recruitment is largely dependent on CCR2, another cell type likely

initiates the inflammatory response by producing the first wave of IFN-I and monocyte

chemoattractants (Figure 6-1). This hypothesis is supported by the presence of IFN-I production

(albeit at reduced levels) in CCR2- mice despite the absence of Ly6Chi monocytes (unpublished

observation). Because most of our previous studies have focused on the peritoneal inflammatory

infiltrates, further studies are needed to determine whether cells lining the peritoneal cavity (i.e.

mesothelial cells and stromal cells) contribute to the inflammatory response to TMPD.

We recognize that the in vivo effect of TMPD may be more complex as at least one other

pathway (MyD88- and IL-1R dependent but TLR7- and IFNAR-independent) is activated for the









recruitment of granulocytes. Nevertheless, our results argue against the prevailing hypothesis

that the interaction between immune complexes and FcyRs is required for TLR7-mediated IFN-I

production. FcyRs seem to be dispensable in this model as both short-term IFN-I production and

long-term autoantibody development (142) are unaffected in FcyR-deficient mice, although we

do not exclude the possibility that immune complex-FcyR interaction may amplify the

autoimmune response after the onset of autoantibodies.

Mechanism of TLR7 Activation

The hydrocarbon structure of TMPD does not resemble any synthetic ligands (such as

R848, loxoribine, and other guanosine analogues) or natural agonists (ssRNA) for TLR7.

Therefore, it remains enigmatic why TMPD preferentially induces TLR7 activation in vivo. To

further investigate the link between TMPD treatment and TLR7 activation, we studied the effect

of TMPD in vitro. Although TMPD has been used for decades, mechanistic studies on its

cellular effects have been limited by the hydrocarbon's poor immiscibility in aqueous solutions.

We found that this problem could be circumvented by first mixing TMPD with fetal bovine

serum prior to the addition of culture medium. Typically TMPD was incorporated at a

concentration of 1 [g/mL as determined by gas chromatography-mass spectroscopy (M. Satoh

and N. Szabo, UF Toxicology Core; unpublished observation). Unlike stimulation with R848, a

TLR7 ligand that elicits IL-6 production and costimulatory molecule upregulation in murine

J774 macrophages, the addition of TMPD in vitro did not induce these responses (Figure 6-2A

and not shown). TMPD solubilized in non-physiological solvents such as ethanol, DMSO,

mannide monooleate, or 3-cyclodextrin were also ineffective in triggering TLR7 activation

(Figure 6-2A), suggesting that TMPD itself is not a ligand for TLR7.









However, exposure to TMPD dramatically enhanced the response to subsequent

stimulation with TLR7 ligands. R848-induced IL-6 production and costimulatory molecule

upregulation were augmented in J774 cells pretreated overnight with TMPD (Figure 6-2B) and

similar enhancement of chemokine and cytokine production was found in bone-marrow derived

macrophages (Figure 6-2C). Importantly, these observations were specific to TMPD as

treatment with other hydrocarbon oils that do not induce lupus, such as medicinal mineral oil and

squalene, did not enhance stimulation by R848 (Figure 6-2D).

We further examined whether TMPD augments the response to TLR7 ligands by altering

the expression or location of TLR7. TLR7 remained exclusively intracellular regardless of

TMPD treatment and its expression levels were not affected at the protein or mRNA level

(Figure 6-2E). Moreover, TMPD treatment did not enhance endocytosis of FITC-dextran or

phagocytosis of latex beads (Figure 6-3), suggesting that accelerated uptake of ligands is also

unlikely to explain our findings. Taken together, these data indicate that TMPD is not a direct

ligand for TLR7 but instead acts to enhance the response to TLR7 stimulation. Although the

underlying mechanisms are distinct, the pathologic consequences of excess TLR7 activation are

shared by TMPD-induced lupus and the Yaa (BXSB male) lupus model. An important

unanswered question that encompasses both models is the nature of the exogenous or

endogenous ligands responsible for activating the TLR7 pathway. Future studies are also needed

to better understand the cellular targets of TMPD responsible for the enhancement of TLR

responses.

Role of TLR7 in Autoantibody Production

We have shown in TLR7- mice that in addition to mediating IFN-I production, TLR7 is

required for the development of anti-nRNP/Sm autoantibodies. The latter was also reported in a

previous study in the MRL-lpr model (136), which does not exhibit IFN-I dysregulation,









suggesting that TLR7 may mediate the generation these autoantibody specificities even in the

absence of excess IFN-I. However, anti-nRNP/Sm autoantibodies were also absent in TMPD-

treated IFNAR-/- mice (93) and multiple groups have reported a strong association between the

"interferon signature" and the presence of these autoantibodies in human SLE (32, 33, 76).

Therefore, it was unclear whether TLR7 simply provides the IFN-I necessary to promote class-

switch of anti-nRNP/Sm autoantibodies, or act upstream to generate these autoantibodies.

This question was addressed by analyzing IgM autoantibodies to nRNP/Sm. If TLR7 was

only required for IFN-I production, normal or higher levels of IgM anti-nRNP/Sm would be

expected in TLR7- mice due to the lack of isotype class-switch, whereas a complete absence of

IgM anti-nRNP/Sm would be expected if TLR7 acts upstream in generating these autoantibodies.

Results were consistent with the latter possibility as IgM anti-nRNP/Sm also was reduced

significantly in TLR7-/- mice (Figure 6-4A). The mechanism linking activation of TLR7 to the

production of autoantibodies against RNA-associated antigens remains to be elucidated, although

the proposed synergism of TLR7 and the B-cell receptor may play a role in this model (144).

Furthermore, we extended our analysis to the production of autoantibodies to DNA and

chromatin. Studies in the MRL-lpr model showed that TLR9 is required to generate these

autoantibodies (136). Consistent with previous observations, TMPD-treated BALB/c mice

produced moderate levels of autoantibodies against dsDNA, ssDNA, and chromatin by 24 weeks

post-treatment. Curiously, IgG autoantibodies to these antigens were largely absent in TLR7 --

mice whereas IgM levels were comparable to the control group (Figure 6-4B-D). This suggests

that although TLR7 is not directly required to generate the immune response to DNA and DNA-

associated antigens, IFN-I production downstream of TLR7 activation promotes the IgG class-

switch of these autoantibody specificities.









For unclear reasons, a single animal in the TLR7-'- group produced high levels of

autoantibodies to DNA and ssDNA. The same animal also displayed a high titer of ANA

(1:1280) in an earlier analysis (Figure 4-7C). The TLR7-/- genotype was confirmed by PCR (not

shown) and also supported by the absence of anti-nRNP/Sm autoantibodies, suggesting that the

presence of other factors, such as a viral infection, may bypass the requirement of IFN-I

production (downstream of TLR7 activation) and drive the class-switch of anti-DNA

autoantibodies. A similar pattern was previously found in IFN-y-deficient mice (23). Despite a

reduction in the overall frequency of IgG anti-nRNP/Sm autoantibodies (22% vs. -70% in wild

type), a few IFN-y- mice produced them at high levels comparable to wild-type controls. The

explanation for this observation will require study of larger numbers of mice.

The role of TLR9 in TMPD model has not been assessed fully. While TLR9 does not

contribute significantly to IFN-I production, it is probably required to initiate autoantibody

production against DNA and DNA-association antigens as in other models (136). The

autoantibody profile in TLR9-/- mice will need to be determined in future studies. Whether

TLR9 also exerts protective effects, as shown in MRL-lpr mice (136), also warrants further

evaluation.

Sequential Generation of Autoantibody Specificities in TMPD-Induced Lupus

Another intriguing aspect of TMPD-lupus is the sequential appearance of autoantibody

specificities. Those targeting RNA-associated antigens (IgG anti-RNP/Sm and anti-Su/ago2)

tend to appear by 3 months post-treatment whereas IgG anti-ssDNA and anti-dsDNA

autoantibodies typically do not appear until 5-6 months (96). If TLR9 indeed mediates anti-

DNA autoantibody production in this model, it raises the question of why TLR7-dependent

autoantibody specificities are consistently generated two months before the onset of TLR9-









dependent specificities. Preferential enhancement of TLR7, but not TLR9 activation in vitro by

TMPD may have implications in this issue.

The timing of autoantibody production is also interesting in view of our finding that IFN-I

production appears within days of TMPD treatment. Additional cofactors are required to break

tolerance and initiate the autoimmune response between the onset of IFN-I upregulation to the

appearance of the first wave of autoantibodies after ~3 months. Supporting this view,

administration of exogenous IFN-ac alone was not sufficient to trigger autoantibody production

in BALB/c mice (88). A potentially important cofactor in the TMPD-model is the development

of ectopic lymphoid tissue known as lipogranulomas (94). These lymphoid structures typically

appear in the peritoneal cavity within 2-3 months of TMPD treatment, coinciding with the onset

of autoantibody production. This ectopic tissue morphologically resembles secondary lymphoid

structures and contains B lymphocytes, T lymphocytes, DCs, as well as monocytes/MO (103).

Lipogranulomas are functional lymphoid structures as demonstrated by their ability generate

antigen-specific B and T lymphocytes (J. Weinstein et. al. manuscript in press). Importantly,

anti-Sm/RNP autoantibody-producing cells also are observed within the ectopic tissue. In view

the similar timing between lipogranuloma formation and autoantibody development, it is

possible that these lipogranulomas serve as a location permissive to the breach of tolerance and

the generation of autoreactive lymphocytes. Interestingly, as the inflammatory response to

TMPD began to resolve in the peritoneal cavity by 6 months post-treatment, the expression of

IFN-I (103) and the influx of Ly6Chi monocytes seemed to be maintained within the

lipogranulomas (Figure 6-5).

The contribution of lymphoid neogenesis to the development of autoimmunity is a subject

of ongoing investigation in our laboratory. Although medicinal mineral oil and squalene









treatment also induce the formation of lipogranulomas, mice treated with these hydrocarbons do

not develop the "interferon signature" or lupus autoantibodies [anti-nRNP/Sm, anti-dsDNA

(114)]. Thus, the presence of ectopic lymphoid structures and excess production of IFN-I may

be co-requisites driving the onset of autoimmunity in the TMPD model. This possibility can be

further evaluated by 1) introducing exogenous IFN-I to mice treated with mineral oil or squalene;

and by 2) inhibiting lymphoid neogenesis by targeting lymphotoxin a/3.

An additional variable that that affects autoantibody production is the genetic variation

among mouse strains. The frequency of anti-nRNP/Sm following TMPD treatment, for example,

ranges from -70% in BALB/c mice to -35% in the C57/BL6 background (172). On the other

hand, the production of anti-ribosomal P autoantibodies was common in SJL but rare in BALB/c

mice (173). Even within the same strain, the female gender is more susceptible to autoantibody

production and kidney disease development following TMPD treatment (141). We found that

these discrepancies are not explained by differences in TLR7 activation and IFN-I production.

Among the wild-type mice tested in our studies (BALB/c, C57/BL6, 129Sv, C3H), the

expression of ISGs two weeks after treatment was similar regardless of strain or sex. Further

studies will be required to examine the contribution of genetics and sex in this model.

Therapeutic Implications

With accumulating evidence on the pathogenic role of IFN-I in SLE, monoclonal

antibodies to IFN-a as well as IFNAR are already being tested in phase I clinical trials.

However, efficacy of these antibodies has not been shown in murine lupus, probably due to the

absence of IFN-I dysregulation in most spontaneous models (C Szeto, et al., Manuscript in

Preparation). A possible unwanted effect of global IFN-I blockade is an increased risk for viral

infection, a problem that may be reduced by selectively inhibiting TLR7 while leaving other

pathways of IFN-I induction intact. In fact, oligodeoxynucleotides capable of antagonizing









TLR7 and/or TLR9 have also been recently described (80). These compounds have ameliorated

disease features in MRL-lpr (174), but effects on IFN-I were not reported. Based on our

findings, the TMPD model offers the unique opportunity to assess therapeutic approaches

targeting IFN-I as well as TLR7. The appearance of the "interferon signature" and accumulation

of Ly6Chi monocytes within two weeks of TMPD treatment allow rapid assessment of the

efficacy of IFN-I inhibition by various therapeutic approaches. In addition, the sequential

generation of lupus autoantibodies and the development of glomerulonephritis (as well as

arthritis and pulmonary vasculitis) in the TMPD model further allow the evaluation of clinical

efficacy in long-term studies.

Conclusion

The work presented here illustrates the important contribution of innate immunity to the

development of autoimmunity in the TMPD model of SLE. Our findings define for the first time

a pathway responsible for chronic overproduction of IFN-I, a feature seen in more than half of

SLE patients. In addition, we have identified a novel subset of IFN-producing cells and

uncovered novel actions of IFN-I. These studies enhance our understanding of the TMPD model

and argue against current paradigms for the pathogenesis of SLE, which are based largely on in

vitro findings. Although the complexity of the TMPD-induced lupus has just begun to unravel,

our findings may provide novel insight into the pathogenesis of human SLE as well.













Bone
Marrnw


2 TLR7


3


Wf I TMPD
MCP-1 R

5 oOo IFNctoo

--- ------- o. Ly6Ch /7X\/ 8
4 Monocytes
Peripheral blood 4
\^ Lymphocytes & OCs
Site of Inflammation (peritoneal Cavity)

Figure 6-1. Proposed model of TMPD-induced inflammation. Upon i.p. administration of
TMPD (1), TLR7-dependent production of IFN-I by cells in the peritoneal cavity (2)
induces the production of MCP-1 (3), which elicits release of immature inflammatory
monocytes from the bone marrow and induces the expression of TLR7 on Ly6Chi
monocytes. Ly6Chi monocytes recruited to the site of inflammation become a major
source of IFN-I and CCL2/MCP-1 (5), establishing a vicious cycle of IFN-I
production and monocyte recruitment. IFN-I further perpetuate the inflammatory
response by inducing the expression of more TLR7 (7), exacerbating the
overproduction of IFN-I. Finally, the chronic presence of high levels of IFN-I
induces the activation of lymphocytes and dendritic cells (8), initiating inappropriate
immune response to autoantigens.











PBS NO I
R848
serum NO
ethanol ND
DMSO ND
MM ND
p-CyD ND
0.0 0.5 1.0
IL-6 (ng/mL)


1i Medium -ITMPD

6- 28
4 '
PBS R848 PBS

PBS R848 PBS


63
CD80
A 51
SCD86

R848


15-
10
5
PBS R848 2395
PBS R848 2395


MPBS 11R848


Medium

Mineral Oil

Squalene

TMPD
0 2 4 6 8(
IL-6 (ng/mL)


0 100200300
CD80 MFI
(% change)


Anti-TLR7 Rabbit IgG
Intracellular Surface

Medium A


TMPD / 0

FL1 >


Figure 6-2. Enhancement TLR7 stimulation by TMPD in vitro. A) ELISA for IL-6 production in
J774 cells cultured in the presence of R848 (1 [tg/mL), TMPD incorporated in serum
(1 [tg/mL), or TMPD (300 ptM) solubilized in ethanol, DMSO, mannide monooleate
(MM) or P-cyclodextrin (P-CyD). ND, not detectable. B) ELISA (IL-6, IL-12 and
MCP-1) and flow cytometric analysis (CD80 and CD86) in J774 cells or C) bone
marrow-derived macrophages cultured for 20 h with or without TMPD and stimulated
with PBS, R848 (1 [tg/mL) or ODN 2395 (2[g/mL) for 24 h. Mean fluorescent
intensity (MFI) values are provided in each histogram. D) Comparison of IL-6
production and CD80 expression (MFI) in J774 cells cultured with various
hydrocarbon oils and stimulated with PBS or R848. E) Flow cytometry and RT-PCR
analysis of TLR7 expression in J774 cells cultured with or without TMPD for 20 h.
Data are representative of three or more independent experiments.


Medium TMPD











- Medium TMPD


Dextran



104



Latex
microbeads


FL 1 >


100 101 10 103 104
FL 1 1


Apoptotic
cells


10o 10' 102 1o0 10
FL7 >

Figure 6-3. Endocytosis and phagocytosis are not affected by TMPD treatment. Quantification
of endocytosis (FITC-dextran) and phagocytosis (FITC-microbeads and DiD-labeled
apoptotic cells) in J774 cells treated with or without TMPD. Shaded curve represents
the staining of cells prior to the addition of fluorescent substrates.















Anti-nRNP/Sm


2.5 i

1.5.

0.5
0.4

0.2-


"V


BALB/c TLR7KO BALB/c TLR7KO
BALB/c TLR7KO BALB/c TLR7KO


Anti-ssDNA


0.5 -
0.01 "."

BALB/c TLR7KO BALB/c TLR7KO
IgG IgM



Anti-Chromatin


BALB/c TLR7KO
IgG


BALB/c TLR7KO

IgM


p = 0.09


E


U..*


T
*v
"--;-
-i-_ ^


BALB/c TLR7KO BALB/c TLR7KO


Figure 6-4. Profile of autoantibody production in TLR7-/- mice. ELISA measurement of serum
IgM and IgG autoantibodies against A) nRNP/Sm, B) dsDNA, C) ssDNA, and D)
chromatin in wild-type BALB/c (n = 12) and TLR7-/- mice (n = 8) 24 weeks after
TMPD treatment. p<0.05; ns: not significant (Mann-Whitney U test).


to
1.5-
0 1.0-

0.5-
00


Anti-dsDNA












PEC (2 weeks)


CD11b


B PEC (6 months)

-o'l --





10 10 1 102 10 10
CD11b


Lipogranuloma (6 months)
10 18%
10 1


10 I
10
10 1 0I 10 U*
CD11b


Figure 6-5. Accumulation of Ly6Chi monocytes in lipogranulomas. Flow cytometry analysis
comparing the presence of Ly6Chi monocytes A) in the peritoneal cavity two weeks
after TMPD treatment and B) in the peritoneal cavity as well as lipogranulomas 6
months after treatment.









LIST OF REFERENCES


1. Reeves, W.H., Narain,S., and Satoh,M. 2004. Autoantibodies in systemic lupus
erythematosus. In Arthritis and Allied Conditions. L.W. W.J.Koopman and Moreland,
editor. Lippincott Williams & Wilkins, Philadelphia, PA. 1497-1521.

2. Hanh, B.H. 2005. Systemic Lupus Erythematosus. In Harrison's Principles of Internal
Medicine. D.L.e.a. Kasper, editor. McGraw-Hill Medical, New York City. 1956-1967.

3. Deapen, D., A. Escalante, L. Weinrib, D. Horwitz, B. Bachman, P. Roy-Burman, A.
Walker, and T.M. Mack. 1992. A revised estimate of twin concordance in systemic lupus
erythematosus. At th/ iti, Rheum 35:311-318.

4. Tsao, B.P., and H. Wu. 2006. Genetics of Human Lupus. In Dubois' Lupus
Erythematosus. D.J.e.a. Wallace, editor. Lippincott Williams & Wilkins. 54-80.

5. Alarcon-Segovia, D., M.E. Alarcon-Riquelme, M.H. Cardiel, F. Caeiro, L. Massardo,
A.R. Villa, and B.A. Pons-Estel. 2005. Familial aggregation of systemic lupus
erythematosus, rheumatoid arthritis, and other autoimmune diseases in 1,177 lupus
patients from the GLADEL cohort. At tih/ iti% Rheum 52:1138-1147.

6. Tan, E.M., A.S. Cohen, J.F. Fries, A.T. Masi, D.J. McShane, N.F. Rothfield, J.G.
Schaller, N. Talal, and R.J. Winchester. 1982. The 1982 revised criteria for the
classification of systemic lupus erythematosus. At ith iti,% Rheum 25:1271-1277.

7. Hochberg, M.C. 1997. Updating the American College of Rheumatology revised criteria
for the classification of systemic lupus erythematosus. Arthritis & Rheumatism 40:1725.

8. Arbuckle, M.R., M.T. McClain, M.V. Rubertone, R.H. Scofield, G.J. Dennis, J.A. James,
and J.B. Harley. 2003. Development of autoantibodies before the clinical onset of
systemic lupus erythematosus. NEngl JMed 349:1526-1533.

9. Urowitz, M.B., A.A. Bookman, B.E. Koehler, D.A. Gordon, H.A. Smythe, and M.A.
Ogryzlo. 1976. The bimodal mortality pattern of systemic lupus erythematosus. Am J
Med 60:221-225.

10. Klinman, D.M., A. Shirai, Y. Ishigatsubo, J. Conover, and A.D. Steinberg. 1991.
Quantitation of IgM- and IgG-secreting B cells in the peripheral blood of patients with
systemic lupus erythematosus. Arthritis Rheum 34:1404-1410.

11. Liossis, S.N., B. Kovacs, G. Dennis, G.M. Kammer, and G.C. Tsokos. 1996. B cells from
patients with systemic lupus erythematosus display abnormal antigen receptor-mediated
early signal transduction events. J Clin Invest 98:2549-2557.

12. Odendahl, M., A. Jacobi, A. Hansen, E. Feist, F. Hiepe, G.R. Burmester, P.E. Lipsky, A.
Radbruch, and T. Dorner. 2000. Disturbed peripheral B lymphocyte homeostasis in
systemic lupus erythematosus. JImmunol 165:5970-5979.









13. Liossis, S.N., X.Z. Ding, G.J. Dennis, and G.C. Tsokos. 1998. Altered pattern of
TCR/CD3-mediated protein-tyrosyl phosphorylation in T cells from patients with
systemic lupus erythematosus. Deficient expression of the T cell receptor zeta chain. J
Clin Invest 101:1448-1457.

14. Desai-Mehta, A., L. Lu, R. Ramsey-Goldman, and S.K. Datta. 1996. Hyperexpression of
CD40 ligand by B and T cells in human lupus and its role in pathogenic autoantibody
production. J Clin Invest 97:2063-2073.

15. Goldman, J.A., A. Litwin, L.E. Adams, R.C. Krueger, and E.V. Hess. 1972. Cellular
immunity to nuclear antigens in systemic lupus erythematosus. J Clin Invest 51:2669-
2677.

16. Gottlieb, A.B., R.G. Lahita, N. Chiorazzi, and H.G. Kunkel. 1979. Immune function in
systemic lupus erythematosus. Impairment of in vitro T-cell proliferation and in vivo
antibody response to exogenous antigen. J Clin Invest 63:885-892.

17. Linker-Israeli, M., R.J. Deans, D.J. Wallace, J. Prehn, T. Ozeri-Chen, and J.R.
Klinenberg. 1991. Elevated levels of endogenous IL-6 in systemic lupus erythematosus.
A putative role in pathogenesis. JImmunol 147:117-123.

18. Llorente, L., W. Zou, Y. Levy, Y. Richaud-Patin, J. Wijdenes, J. Alcocer-Varela, B.
Morel-Fourrier, J.C. Brouet, D. Alarcon-Segovia, P. Galanaud, and D. Emilie. 1995. Role
of interleukin 10 in the B lymphocyte hyperactivity and autoantibody production of
human systemic lupus erythematosus. JExp Med 181:839-844.

19. Pers, J.O., C. Daridon, V. Devauchelle, S. Jousse, A. Saraux, C. Jamin, and P. Youinou.
2005. BAFF overexpression is associated with autoantibody production in autoimmune
diseases. Ann N YAcadSci 1050:34-39.

20. Kurt-Jones, E.A., S. Hamberg, J. Ohara, W.E. Paul, and A.K. Abbas. 1987.
Heterogeneity of helper/inducer T lymphocytes. I. Lymphokine production and
lymphokine responsiveness. JExp Med 166:1774-1787.

21. Haas, C., B. Ryffel, and M. Le Hir. 1997. IFN-gamma is essential for the development of
autoimmune glomerulonephritis in MRL/Ipr mice. JImmunol 158:5484-5491.

22. Haas, C., B. Ryffel, and M. Le Hir. 1998. IFN-gamma receptor deletion prevents
autoantibody production and glomerulonephritis in lupus-prone (NZB x NZW)F 1 mice. J
Immunol 160:3713-3718.

23. Richards, H.B., M. Satoh, J.C. Jennette, B.P. Croker, H. Yoshida, and W.H. Reeves.
2001. Interferon-gamma is required for lupus nephritis in mice treated with the
hydrocarbon oil pristane. Kidney Int 60:2173-2180.

24. Calvani, N., M. Satoh, B.P. Croker, W.H. Reeves, and H.B. Richards. 2003.
Nephritogenic autoantibodies but absence of nephritis in Il-12p35-deficient mice with
pristane-induced lupus. Kidney Int 64:897-905.









25. Pittoni, V., and G. Valesini. 2002. The clearance of apoptotic cells: implications for
autoimmunity. Autoimmun Rev 1:154-161.

26. Herrmann, M., R.E. Voll, O.M. Zoller, M. Hagenhofer, B.B. Ponner, and J.R. Kalden.
1998. Impaired phagocytosis of apoptotic cell material by monocyte-derived
macrophages from patients with systemic lupus erythematosus. Ait ti/l iti Rheum 41:1241-
1250.

27. Kelly, K.M., H. Zhuang, D.C. Nacionales, P.O. Scumpia, R. Lyons, J. Akaogi, P. Lee, B.
Williams, M. Yamamoto, S. Akira, M. Satoh, and W.H. Reeves. 2006. "Endogenous
adjuvant" activity of the RNA components of lupus autoantigens Sm/RNP and Ro 60.
Arthritis Rheum 54:1557-1567.

28. Vallin, H., A. Perers, G.V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA
antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous
IFN-alpha inducer in systemic lupus erythematosus. JImmunol 163:6306-6313.

29. Tew, M.B., R.W. Johnson, J.D. Reveille, and F.K. Tan. 2001. A molecular analysis of the
low serum deoxyribonuclease activity in lupus patients. At ihl iti Rheum 44:2446-2447.

30. Hooks, J.J., H.M. Moutsopoulos, S.A. Geis, N.I. Stahl, J.L. Decker, and A.L. Notkins.
1979. Immune interferon in the circulation of patients with autoimmune disease. NEngl J
Med 301:5-8.

31. Baechler, E.C., F.M. Batliwalla, G. Karypis, P.M. Gaffney, W.A. Ortmann, K.J. Espe,
K.B. Shark, W.J. Grande, K.M. Hughes, V. Kapur, P.K. Gregersen, and T.W. Behrens.
2003. Interferon-inducible gene expression signature in peripheral blood cells of patients
with severe lupus. Proc NatlAcad Sci USA 100:2610-2615.

32. Bennett, L., A.K. Palucka, E. Arce, V. Cantrell, J. Borvak, J. Banchereau, and V. Pascual.
2003. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J
Exp Med 197:711-723.

33. Zhuang, H., S. Narain, E. Sobel, P.Y. Lee, D.C. Nacionales, K.M. Kelly, H.B. Richards,
M. Segal, C. Stewart, M. Satoh, and W.H. Reeves. 2005. Association of anti-
nucleoprotein autoantibodies with upregulation of Type I interferon-inducible gene
transcripts and dendritic cell maturation in systemic lupus erythematosus. Clin Immunol.

34. Diaz, M.O., H.M. Pomykala, S.K. Bohlander, E. Maltepe, K. Malik, B. Brownstein, and
O.I. Olopade. 1994. Structure of the human type-I interferon gene cluster determined
from a YAC clone contig. Genomics 22:540-552.

35. Fountain, J.W., M. Karayiorgou, D. Taruscio, S.L. Graw, A.J. Buckler, D.C. Ward, N.C.
Dracopoli, and D.E. Housman. 1992. Genetic and physical map of the interferon region
on chromosome 9p. Genomics 14:105-112.

36. Pestka, S., C.D. Krause, and M.R. Walter. 2004. Interferons, interferon-like cytokines,
and their receptors. Immunol Rev 202:8-32.









37. Darnell, J.E., Jr., I.M. Kerr, and G.R. Stark. 1994. Jak-STAT pathways and
transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science 264:1415-1421.

38. Schindler, C., X.Y. Fu, T. Improta, R. Aebersold, and J.E. Darnell, Jr. 1992. Proteins of
transcription factor ISGF-3: one gene encodes the 91-and 84-kDa ISGF-3 proteins that
are activated by interferon alpha. Proc Natl Acad Sci USA 89:7836-7839.

39. Fu, X.Y., C. Schindler, T. Improta, R. Aebersold, and J.E. Darnell, Jr. 1992. The proteins
of ISGF-3, the interferon alpha-induced transcriptional activator, define a gene family
involved in signal transduction. Proc Natl Acad Sci USA 89:7840-7843.

40. Goh, K.C., S.J. Haque, and B.R. Williams. 1999. p38 MAP kinase is required for STAT1
serine phosphorylation and transcriptional activation induced by interferons. Embo J
18:5601-5608.

41. Li, Y., A. Sassano, B. Majchrzak, D.K. Deb, D.E. Levy, M. Gaestel, A.R. Nebreda, E.N.
Fish, and L.C. Platanias. 2004. Role of p38alpha Map kinase in Type I interferon
signaling. JBiol Chem 279:970-979.

42. Uddin, S., B. Majchrzak, J. Woodson, P. Arunkumar, Y. Alsayed, R. Pine, P.R. Young,
E.N. Fish, and L.C. Platanias. 1999. Activation of the p38 mitogen-activated protein
kinase by type I interferons. JBiol Chem 274:30127-30131.

43. Theofilopoulos, A.N., R. Baccala, B. Beutler, and D.H. Kono. 2005. Type I interferons
(alpha/beta) in immunity and autoimmunity. Annu Rev Immunol 23:307-336.

44. Dalod, M., T. Hamilton, R. Salomon, T.P. Salazar-Mather, S.C. Henry, J.D. Hamilton,
and C.A. Biron. 2003. Dendritic cell responses to early murine cytomegalovirus
infection: subset functional specialization and differential regulation by interferon
alpha/beta. JExp Med 197:885-898.

45. Doyle, S., S. Vaidya, R. O'Connell, H. Dadgostar, P. Dempsey, T. Wu, G. Rao, R. Sun,
M. Haberland, R. Modlin, and G. Cheng. 2002. IRF3 mediates a TLR3/TLR4-specific
antiviral gene program. Immunity 17:251-263.

46. Sen, G.C., and R.M. Ransohoff. 1993. Interferon-induced antiviral actions and their
regulation. Adv Virus Res 42:57-102.

47. Marrack, P., J. Kappler, and T. Mitchell. 1999. Type I interferons keep activated T cells
alive. JExp Med 189:521-530.

48. Finkelman, F.D., A. Svetic, I. Gresser, C. Snapper, J. Holmes, P.P. Trotta, I.M. Katona,
and W.C. Gause. 1991. Regulation by interferon alpha of immunoglobulin isotype
selection and lymphokine production in mice. JExp Med 174:1179-1188.









49. Le Bon, A., G. Schiavoni, G. D'Agostino, I. Gresser, F. Belardelli, and D.F. Tough. 2001.
Type i interferons potently enhance humoral immunity and can promote isotype
switching by stimulating dendritic cells in vivo. Immunity 14:461-470.

50. Sharif, M.N., I. Tassiulas, Y. Hu, I. Mecklenbrauker, A. Tarakhovsky, and L.B. Ivashkiv.
2004. IFN-alpha priming results in a gain of proinflammatory function by IL-10:
implications for systemic lupus erythematosus pathogenesis. Jlmmunol 172:6476-6481.

51. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu Rev Immunol
21:335-376.

52. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, 0. Takeuchi, M.
Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the
MyD 88-independent toll-like receptor signaling pathway. Science 301:640-643.

53. Kagan, J.C., T. Su, T. Horng, A. Chow, S. Akira, and R. Medzhitov. 2008. TRAM
couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat
Immunol 9:361-368.

54. Hemmi, H., T. Kaisho, 0. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, H.
Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral compounds activate immune
cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol 3:196-200.

55. Diebold, S.S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004. Innate antiviral
responses by means of TLR7-mediated recognition of single-stranded RNA. Science
303:1529-1531.

56. Hemmi, H., 0. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K.
Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor recognizes
bacterial DNA. Nature 408:740-745.

57. Levy, D.E., I. Marie, E. Smith, and A. Prakash. 2002. Enhancement and diversification of
IFN induction by IRF-7-mediated positive feedback. JInterferon Cytokine Res 22:87-93.

58. Sato, M., N. Hata, M. Asagiri, T. Nakaya, T. Taniguchi, and N. Tanaka. 1998. Positive
feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7.
FEBS Lett 441:106-110.

59. Kato, H., 0. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A.
Jung, T. Kawai, K.J. Ishii, 0. Yamaguchi, K. Otsu, T. Tsujimura, C.S. Koh, C. Reis e
Sousa, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I
helicases in the recognition of RNA viruses. Nature 441:101-105.

60. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K.
Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in
double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730-737.









61. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K.J. Ishii, 0. Takeuchi,
and S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I
interferon induction. Nat Immunol 6:981-988.

62. Stetson, D.B., and R. Medzhitov. 2006. Recognition of cytosolic DNA activates an IRF3-
dependent innate immune response. Immunity 24:93-103.

63. Ishii, K.J., C. Coban, H. Kato, K. Takahashi, Y. Torii, F. Takeshita, H. Ludwig, G.
Sutter, K. Suzuki, H. Hemmi, S. Sato, M. Yamamoto, S. Uematsu, T. Kawai, 0.
Takeuchi, and S. Akira. 2006. A Toll-like receptor-independent antiviral response
induced by double-stranded B-form DNA. Nat Immunol 7:40-48.

64. Cella, M., D. Jarrossay, F. Facchetti, 0. Alebardi, H. Nakajima, A. Lanzavecchia, and M.
Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce
large amounts of type I interferon. Nat Med 5:919-923.

65. Coccia, E.M., M. Severa, E. Giacomini, D. Monneron, M.E. Remoli, I. Julkunen, M.
Cella, R. Lande, and G. Uze. 2004. Viral infection and Toll-like receptor agonists induce
a differential expression of type I and lambda interferons in human plasmacytoid and
monocyte-derived dendritic cells. Eur JImmunol 34:796-805.

66. Dzionek, A., Y. Sohma, J. Nagafune, M. Cella, M. Colonna, F. Facchetti, G. Gunther, I.
Johnston, A. Lanzavecchia, T. Nagasaka, T. Okada, W. Vermi, G. Winkels, T.
Yamamoto, M. Zysk, Y. Yamaguchi, and J. Schmitz. 2001. BDCA-2, a novel
plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is
a potent inhibitor of interferon alpha/beta induction. JExp Med 194:1823-1834.

67. Izaguirre, A., B.J. Barnes, S. Amrute, W.S. Yeow, N. Megjugorac, J. Dai, D. Feng, E.
Chung, P.M. Pitha, and P. Fitzgerald-Bocarsly. 2003. Comparative analysis of IRF and
IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells. J
Leukoc Biol74:1125-1138.

68. Diebold, S.S., M. Montoya, H. Unger, L. Alexopoulou, P. Roy, L.E. Haswell, A. Al-
Shamkhani, R. Flavell, P. Borrow, and C. Reis e Sousa. 2003. Viral infection switches
non-plasmacytoid dendritic cells into high interferon producers. Nature 424:324-328.

69. Matsui, K., Y. Kumagai, H. Kato, S. Sato, T. Kawagoe, S. Uematsu, 0. Takeuchi, and S.
Akira. 2006. Cutting edge: Role of TANK-binding kinase 1 and inducible IkappaB kinase
in IFN responses against viruses in innate immune cells. JImmunol 177:5785-5789.

70. Kalkner, K.M., L. Ronnblom, A.K. Karlsson Parra, M. Bengtsson, Y. Olsson, and K.
Oberg. 1998. Antibodies against double-stranded DNA and development of polymyositis
during treatment with interferon. Qjm 91:393-399.

71. Ioannou, Y., and D.A. Isenberg. 2000. Current evidence for the induction of autoimmune
rheumatic manifestations by cytokine therapy. Ai iln iti Rheum 43:1431-1442.









72. Ronnblom, L.E., G.V. Alm, and K.E. Oberg. 1991. Autoimmunity after alpha-interferon
therapy for malignant carcinoid tumors. Ann Intern Med 115:178-183.

73. Wilson, L.E., D. Widman, S.H. Dikman, and P.D. Gorevic. 2002. Autoimmune disease
complicating antiviral therapy for hepatitis C virus infection. Semin At th/iit i Rheum
32:163-173.

74. Blanco, P., A.K. Palucka, M. Gill, V. Pascual, and J. Banchereau. 2001. Induction of
dendritic cell differentiation by IFN-alpha in systemic lupus erythematosus. Science
294:1540-1543.

75. Kirou, K.A., C. Lee, S. George, K. Louca, I.G. Papagiannis, M.G. Peterson, N. Ly, R.N.
Woodward, K.E. Fry, A.Y. Lau, J.G. Prentice, J.G. Wohlgemuth, and M.K. Crow. 2004.
Coordinate overexpression of interferon-alpha-induced genes in systemic lupus
erythematosus. At t/ii ti, Rheum 50:3958-3967.

76. Kirou, K.A., C. Lee, S. George, K. Louca, M.G. Peterson, and M.K. Crow. 2005.
Activation of the interferon-alpha pathway identifies a subgroup of systemic lupus
erythematosus patients with distinct serologic features and active disease. Ait th itin
Rheum 52:1491-1503.

77. Vallin, H., S. Blomberg, G.V. Alm, B. Cederblad, and L. Ronnblom. 1999. Patients with
systemic lupus erythematosus (SLE) have a circulating inducer of interferon-alpha (IFN-
alpha) production acting on leucocytes resembling immature dendritic cells. Clin Exp
Immunol 115:196-202.

78. Barton, G.M., J.C. Kagan, and R. Medzhitov. 2006. Intracellular localization of Toll-like
receptor 9 prevents recognition of self DNA but facilitates access to viral DNA. Nat
Immunol 7:49-56.

79. Means, T.K., E. Latz, F. Hayashi, M.R. Murali, D.T. Golenbock, and A.D. Luster. 2005.
Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32
and TLR9. J Clin Invest 115:407-417.

80. Barrat, F.J., T. Meeker, J. Gregorio, J.H. Chan, S. Uematsu, S. Akira, B. Chang, 0.
Duramad, and R.L. Coffman. 2005. Nucleic acids of mammalian origin can act as
endogenous ligands for Toll-like receptors and may promote systemic lupus
erythematosus. J Exp Med 202:1131-1139.

81. Savarese, E., O.W. Chae, S. Trowitzsch, G. Weber, B. Kastner, S. Akira, H. Wagner,
R.M. Schmid, S. Bauer, and A. Krug. 2006. Ul small nuclear ribonucleoprotein immune
complexes induce type I interferon in plasmacytoid dendritic cells through TLR7. Blood
107:3229-3234.

82. Bave, U., M. Magnusson, M.L. Eloranta, A. Perers, G.V. Alm, and L. Ronnblom. 2003.
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid
dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells
combined with lupus IgG. JImmunol 171:3296-3302.









83. Marshak-Rothstein, A. 2006. Toll-like receptors in systemic autoimmune disease. Nat
Rev Immunol 6:823-835.

84. Ronnblom, L., M.L. Eloranta, and G.V. Alm. 2006. The type I interferon system in
systemic lupus erythematosus. Ai i/ liti% Rheum 54:408-420.

85. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres,
and G. Hartmann. 2002. Quantitative expression of toll-like receptor 1-10 mRNA in
cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG
oligodeoxynucleotides. JImmunol 168:4531-4537.

86. Farkas, L., K. Beiske, F. Lund-Johansen, P. Brandtzaeg, and F.L. Jahnsen. 2001.
Plasmacytoid dendritic cells (natural interferon- alpha/beta-producing cells) accumulate
in cutaneous lupus erythematosus lesions. Am JPathol 159:237-243.

87. Burnet, F.M., and M.C. Holmes. 1965. The natural history of the NZB/NZW Fl hybrid
mouse: a laboratory model of systemic lupus erythematosus. Australas Ann Med 14:185-
191.

88. Mathian, A., A. Weinberg, M. Gallegos, J. Banchereau, and S. Koutouzov. 2005. IFN-
alpha induces early lethal lupus in preautoimmune (New Zealand Black x New Zealand
White) Fl but not in BALB/c mice. JImmunol 174:2499-2506.

89. Santiago-Raber, M.L., R. Baccala, K.M. Haraldsson, D. Choubey, T.A. Stewart, D.H.
Kono, and A.N. Theofilopoulos. 2003. Type-I interferon receptor deficiency reduces
lupus-like disease in NZB mice. JExp Med 197:777-788.

90. Jorgensen, T.N., E. Roper, J.M. Thurman, P. Marrack, and B.L. Kotzin. 2007. Type I
interferon signaling is involved in the spontaneous development of lupus-like disease in
B6.Nba2 and (B6.Nba2 x NZW)F(1) mice. Genes Immun 8:653-662.

91. Pisetsky, D.S., G.A. McCarty, and D.V. Peters. 1980. Mechanisms of autoantibody
production in autoimmune MRL mice. JExp Med 152:1302-1310.

92. Hron, J.D., and S.L. Peng. 2004. Type I IFN protects against murine lupus. JImmunol
173:2134-2142.

93. Nacionales, D.C., K.M. Kelly-Scumpia, P.Y. Lee, J.S. Weinstein, R. Lyons, E. Sobel, M.
Satoh, and W.H. Reeves. 2007. Deficiency of the type I interferon receptor protects mice
from experimental lupus. At /th iti Rheum 56:3770-3783.

94. Anderson, P.N., and M. Potter. 1969. Induction of plasma cell tumours in BALB-c mice
with 2,6,10,14-tetramethylpentadecane (pristane). Nature 222:994-995.

95. Hoogenraad, N., T. Helman, and J. Hoogenraad. 1983. The effect of pre-injection of mice
with pristane on ascites tumour formation and monoclonal antibody production. J
Immunol Methods 61:317-320.









96. Satoh, M., and W.H. Reeves. 1994. Induction of lupus-associated autoantibodies in
BALB/c mice by intraperitoneal injection of pristane. JExpMed 180:2341-2346.

97. Satoh, M., A. Kumar, Y.S. Kanwar, and W.H. Reeves. 1995. Anti-nuclear antibody
production and immune-complex glomerulonephritis in BALB/c mice treated with
pristane. Proc Natl Acad Sci USA 92:10934-10938.

98. Yoshida, H., M. Satoh, K.M. Behney, C.G. Lee, H.B. Richards, V.M. Shaheen, J.Q.
Yang, R.R. Singh, and W.H. Reeves. 2002. Effect of an exogenous trigger on the
pathogenesis of lupus in (NZB x NZW)F1 mice. A/i/ il, Rheum 46:2235-2244.

99. Jung, S., D. Unutmaz, P. Wong, G. Sano, K. De los Santos, T. Sparwasser, S. Wu, S.
Vuthoori, K. Ko, F. Zavala, E.G. Pamer, D.R. Littman, and R.A. Lang. 2002. In vivo
depletion of CD1 lc(+) dendritic cells abrogates priming of CD8(+) T cells by exogenous
cell-associated antigens. Immunity 17:211-220.

100. Scumpia, P.O., P.F. McAuliffe, K.A. O'Malley, R. Ungaro, T. Uchida, T. Matsumoto,
D.G. Remick, M.J. Clare-Salzler, L.L. Moldawer, and P.A. Efron. 2005. CD1 lc+
dendritic cells are required for survival in murine polymicrobial sepsis. JImmunol
175:3282-3286.

101. Kumar, H., T. Kawai, H. Kato, S. Sato, K. Takahashi, C. Coban, M. Yamamoto, S.
Uematsu, K.J. Ishii, 0. Takeuchi, and S. Akira. 2006. Essential role of IPS-1 in innate
immune responses against RNA viruses. JExp Med 203:1795-1803.

102. Adachi, 0., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K.
Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of
IL-1- and IL-18-mediated function. Immunity 9:143-150.

103. Nacionales, D.C., K.M. Kelly, P.Y. Lee, H. Zhuang, Y. Li, J.S. Weinstein, E. Sobel, Y.
Kuroda, J. Akaogi, M. Satoh, and W.H. Reeves. 2006. Type I interferon production by
tertiary lymphoid tissue developing in response to 2,6,10,14-tetramethyl-pentadecane
(pristane). Am JPathol 168:1227-1240.

104. Janz, S., and E. Shacter. 1991. A new method for delivering alkanes to mammalian cells:
preparation and preliminary characterization of an inclusion complex between beta-
cyclodextrin and pristane (2,6,10,14-tetramethylpentadecane). Toxicology 69:301-315.

105. Sunderkotter, C., T. Nikolic, M.J. Dillon, N. Van Rooijen, M. Stehling, D.A. Drevets,
and P.J. Leenen. 2004. Subpopulations of mouse blood monocytes differ in maturation
stage and inflammatory response. JImmunol 172:4410-4417.

106. Van Rooijen, N., and A. Sanders. 1994. Liposome mediated depletion of macrophages:
mechanism of action, preparation of liposomes and applications. JImmunolMethods
174:83-93.









107. Cook, A.D., E.L. Braine, and J.A. Hamilton. 2003. The phenotype of inflammatory
macrophages is stimulus dependent: implications for the nature of the inflammatory
response. JImmunol 171:4816-4823.

108. Geissmann, F., S. Jung, and D.R. Littman. 2003. Blood monocytes consist of two
principal subsets with distinct migratory properties. Immunity 19:71-82.

109. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-
Dambuyant, A. Vicari, A. O'Garra, C. Biron, F. Briere, and G. Trinchieri. 2001. Mouse
type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat
Immunol 2:1144-1150.

110. Spangrude, G.J., Y. Aihara, I.L. Weissman, and J. Klein. 1988. The stem cell antigens
Sca-1 and Sca-2 subdivide thymic and peripheral T lymphocytes into unique subsets. J
Immunol 141:3697-3707.

111. Kassim, S.H., N.K. Rajasagi, X. Zhao, R. Chervenak, and S.R. Jennings. 2006. In vivo
ablation of CD11c-positive dendritic cells increases susceptibility to herpes simplex virus
type 1 infection and diminishes NK and T-cell responses. J Virol 80:3985-3993.

112. Asselin-Paturel, C., G. Brizard, J.J. Pin, F. Briere, and G. Trinchieri. 2003. Mouse strain
differences in plasmacytoid dendritic cell frequency and function revealed by a novel
monoclonal antibody. JImmunol 171:6466-6477.

113. Blasius, A.L., E. Giurisato, M. Cella, R.D. Schreiber, A.S. Shaw, and M. Colonna. 2006.
Bone marrow stromal cell antigen 2 is a specific marker of type I IFN-producing cells in
the naive mouse, but a promiscuous cell surface antigen following IFN stimulation. J
Immunol 177:3260-3265.

114. Kuroda, Y., J. Akaogi, D.C. Nacionales, S.C. Wasdo, N.J. Szabo, W.H. Reeves, and M.
Satoh. 2004. Distinctive patterns of autoimmune response induced by different types of
mineral oil. Toxicol Sci 78:222-228.

115. Dumont, F.J., and L.Z. Coker. 1986. Interferon-alpha/beta enhances the expression of Ly-
6 antigens on T cells in vivo and in vitro. Eur JImmunol 16:735-740.

116. Serbina, N.V., and E.G. Pamer. 2006. Monocyte emigration from bone marrow during
bacterial infection requires signals mediated by chemokine receptor CCR2. Nat Immunol
7:311-317.

117. Kadowaki, N., S. Antonenko, J.Y. Lau, and Y.J. Liu. 2000. Natural interferon alpha/beta-
producing cells link innate and adaptive immunity. JExp Med 192:219-226.

118. Scheinecker, C., B. Zwolfer, M. Koller, G. Manner, and J.S. Smolen. 2001. Alterations of
dendritic cells in systemic lupus erythematosus: phenotypic and functional deficiencies.
Ai /i ii%/ Rheum 44:856-865.









119. Tacke, F., D. Alvarez, T.J. Kaplan, C. Jakubzick, R. Spanbroek, J. Llodra, A. Garin, J.
Liu, M. Mack, N. van Rooijen, S.A. Lira, A.J. Habenicht, and G.J. Randolph. 2007.
Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate
within atherosclerotic plaques. J Clin Invest 117:185-194.

120. Hemmi, H., T. Kaisho, K. Takeda, and S. Akira. 2003. The roles of Toll-like receptor 9,
MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two
distinct CpG DNAs on dendritic cell subsets. JImmunol 170:3059-3064.

121. Hornung, V., J. Ellegast, S. Kim, K. Brzozka, A. Jung, H. Kato, H. Poeck, S. Akira, K.K.
Conzelmann, M. Schlee, S. Endres, and G. Hartmann. 2006. 5'-Triphosphate RNA is the
ligand for RIG-I. Science 314:994-997.

122. Stockinger, S., B. Reutterer, B. Schaljo, C. Schellack, S. Brunner, T. Materna, M.
Yamamoto, S. Akira, T. Taniguchi, P.J. Murray, M. Muller, and T. Decker. 2004. IFN
regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is
mediated by a TLR- and Nod2-independent mechanism. JImmunol 173:7416-7425.

123. Pawar, R.D., P.S. Patole, D. Zecher, S. Segerer, M. Kretzler, D. Schlondorff, and H.J.
Anders. 2006. Toll-like receptor-7 modulates immune complex glomerulonephritis. JAm
Soc Nephrol 17:141-149.

124. Richards, H.B., M. Satoh, M. Shaw, C. Libert, V. Poli, and W.H. Reeves. 1998.
Interleukin 6 dependence of anti-DNA antibody production: evidence for two pathways
of autoantibody formation in pristane-induced lupus. JExp Med 188:985-990.

125. Ikeda, K., M. Satoh, K.M. Pauley, M.J. Fritzler, W.H. Reeves, and E.K. Chan. 2006.
Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing
complex (RISC) using a monoclonal antibody. JImmunolMethods 317:38-44.

126. Takaoka, A., Z. Wang, M.K. Choi, H. Yanai, H. Negishi, T. Ban, Y. Lu, M. Miyagishi,
T. Kodama, K. Honda, Y. Ohba, and T. Taniguchi. 2007. DAI (DLM-1/ZBP1) is a
cytosolic DNA sensor and an activator of innate immune response. Nature 448:501-505.

127. Bauer, J.W., E.C. Baechler, M. Petri, F.M. Batliwalla, D. Crawford, W.A. Ortmann, K.J.
Espe, W. Li, D.D. Patel, P.K. Gregersen, and T.W. Behrens. 2006. Elevated serum levels
of interferon-regulated chemokines are biomarkers for active human systemic lupus
erythematosus. PLoS Med 3 :e491.

128. Batteux, F., P. Palmer, M. Daeron, B. Weill, and P. Lebon. 1999. FCgammaRII (CD32)-
dependent induction of interferon-alpha by serum from patients with lupus
erythematosus. Eur Cytokine Netw 10:509-514.

129. Yasuda, K., C. Richez, J.W. Maciaszek, N. Agrawal, S. Akira, A. Marshak-Rothstein,
and I.R. Rifkin. 2007. Murine dendritic cell type I IFN production induced by human
IgG-RNA immune complexes is IFN regulatory factor (IRF)5 and IRF7 dependent and is
required for IL-6 production. JImmunol 178:6876-6885.









130. Murphy, E.D., and J.B. Roths. 1979. A Y chromosome associated factor in strain BXSB
producing accelerated autoimmunity and lymphoproliferation. Arthritis Rheum 22:1188-
1194.

131. Izui, S., M. Higaki, D. Morrow, and R. Merino. 1988. The Y chromosome from
autoimmune BXSB/MpJ mice induces a lupus-like syndrome in (NZW x C57BL/6)F1
male mice, but not in C57BL/6 male mice. Eur JImmunol 18:911-915.

132. Bolland, S., Y.S. Yim, K. Tus, E.K. Wakeland, and J.V. Ravetch. 2002. Genetic
modifiers of systemic lupus erythematosus in FcgammaRIIB(-/-) mice. JExp Med
195:1167-1174.

133. Subramanian, S., K. Tus, Q.Z. Li, A. Wang, X.H. Tian, J. Zhou, C. Liang, G. Bartov,
L.D. McDaniel, X.J. Zhou, R.A. Schultz, and E.K. Wakeland. 2006. A Tlr7 translocation
accelerates systemic autoimmunity in murine lupus. Proc Natl Acad Sci USA 103:9970-
9975.

134. Pisitkun, P., J.A. Deane, M.J. Difilippantonio, T. Tarasenko, A.B. Satterthwaite, and S.
Bolland. 2006. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene
duplication. Science 312:1669-1672.

135. Deane, J.A., P. Pisitkun, R.S. Barrett, L. Feigenbaum, T. Town, J.M. Ward, R.A. Flavell,
and S. Bolland. 2007. Control of toll-like receptor 7 expression is essential to restrict
autoimmunity and dendritic cell proliferation. Immunity 27:801-810.

136. Christensen, S.R., J. Shupe, K. Nickerson, M. Kashgarian, R.A. Flavell, and M.J.
Shlomchik. 2006. Toll-like receptor 7 and TLR9 dictate autoantibody specificity and
have opposing inflammatory and regulatory roles in a murine model of lupus. Immunity
25:417-428.

137. Hamilton, K.J., M. Satoh, J. Swartz, H.B. Richards, and W.H. Reeves. 1998. Influence of
microbial stimulation on hypergammaglobulinemia and autoantibody production in
pristane-induced lupus. Clin Immunol Immunopathol 86:271-279.

138. Satoh, M., J.J. Langdon, C.H. Chou, D.P. McCauliffe, E.L. Treadwell, T. Ogasawara, M.
Hirakata, A. Suwa, P.L. Cohen, R.A. Eisenberg, and et al. 1994. Characterization of the
Su antigen, a macromolecular complex of 100/102 and 200-kDa proteins recognized by
autoantibodies in systemic rheumatic diseases. Clin Immunol Immunopathol 73:132-141.

139. Jakymiw, A., K. Ikeda, M.J. Fritzler, W.H. Reeves, M. Satoh, and E.K. Chan. 2006.
Autoimmune targeting of key components of RNA interference. At th/ i ti Res Ther
8:R87.

140. Lee, P.Y., Y. Li, H.B. Richards, F.S. Chan, H. Zhuang, S. Narain, E.J. Butfiloski, E.S.
Sobel, W.H. Reeves, and M.S. Segal. 2007. Type I interferon as a novel risk factor for
endothelial progenitor cell depletion and endothelial dysfunction in systemic lupus
erythematosus. At tih iiti Rheum 56:3759-3769.









141. Smith, D.L., X. Dong, S. Du, M. Oh, R.R. Singh, and R.R. Voskuhl. 2007. A female
preponderance for chemically induced lupus in SJL/J mice. Clin Immunol 122:101-107.

142. Clynes, R., N. Calvani, B.P. Croker, and H.B. Richards. 2005. Modulation of the immune
response in pristane-induced lupus by expression of activation and inhibitory Fc
receptors. Clin Exp Immunol 141:230-237.

143. Satoh, M., J.P. Weintraub, H. Yoshida, V.M. Shaheen, H.B. Richards, M. Shaw, and
W.H. Reeves. 2000. Fas and Fas ligand mutations inhibit autoantibody production in
pristane-induced lupus. JImmunol 165:1036-1043.

144. Lau, C.M., C. Broughton, A.S. Tabor, S. Akira, R.A. Flavell, M.J. Mamula, S.R.
Christensen, M.J. Shlomchik, G.A. Viglianti, I.R. Rifkin, and A. Marshak-Rothstein.
2005. RNA-associated autoantigens activate B cells by combined B cell antigen
receptor/Toll-like receptor 7 engagement. J Exp Med 202:1171-1177.

145. Berland, R., L. Fernandez, E. Kari, J.H. Han, I. Lomakin, S. Akira, H.H. Wortis, J.F.
Kearney, A.A. Ucci, and T. Imanishi-Kari. 2006. Toll-like receptor 7-dependent loss of B
cell tolerance in pathogenic autoantibody knockin mice. Immunity 25:429-440.

146. Kuroda, Y., D.C. Nacionales, J. Akaogi, W.H. Reeves, and M. Satoh. 2004.
Autoimmunity induced by adjuvant hydrocarbon oil components of vaccine. Biomed
Pharmacother 58:325-337.

147. Vollmer, J., S. Tluk, C. Schmitz, S. Hamm, M. Jurk, A. Forsbach, S. Akira, K.M. Kelly,
W.H. Reeves, S. Bauer, and A.M. Krieg. 2005. Immune stimulation mediated by
autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8.
JExp Med 202:1575-1585.

148. Bly, J.E., L.R. Garrett, and M.A. Cuchens. 1990. Pristane induced changes in rat
lymphocyte membrane fluidity. Cancer Biochem Biophys 11:145-154.

149. Jego, G., A.K. Palucka, J.P. Blanck, C. Chalouni, V. Pascual, and J. Banchereau. 2003.
Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon
and interleukin 6. Immunity 19:225-234.

150. Kumar, V., A. Abbas, and N. Fausto. 2004. Robbins & Cotran Pathologic Basis of
Disease. Elsevier Health Sciences, Philadephia, PA. 1552 pp.

151. Swirski, F.K., P. Libby, E. Aikawa, P. Alcaide, F.W. Luscinskas, R. Weissleder, and M.J.
Pittet. 2007. Ly-6Chi monocytes dominate hypercholesterolemia-associated monocytosis
and give rise to macrophages in atheromata. J Clin Invest 117:195-205.

152. Cancro, M., and M. Potter. 1976. The requirement of an adherent cell substratum for the
growth of developing plasmacytoma cells in vivo. JExp Med 144:1554-1567.









153. Richards, H.B., M. Satoh, V.M. Shaheen, H. Yoshida, and W.H. Reeves. 1999. Induction
of B cell autoimmunity by pristane. Curr Top Microbiol Immunol 246:387-392;
discussion 393.

154. Lee, P.Y., J.S. Weinstein, D.C. Nacionales, P.O. Scumpia, Y. Li, E. Butfiloski, N. van
Rooijen, L. Moldawer, M. Satoh, and W.H. Reeves. 2008. A novel Type I IFN-producing
cell subset in murine lupus. JImmunol 180:5101-5108.

155. Toshchakov, V., B.W. Jones, P.Y. Perera, K. Thomas, M.J. Cody, S. Zhang, B.R.
Williams, J. Major, T.A. Hamilton, M.J. Fenton, and S.N. Vogel. 2002. TLR4, but not
TLR2, mediates IFN-beta-induced STAT1 alpha/beta-dependent gene expression in
macrophages. Nat Immunol 3:392-398.

156. Mills, C.D., K. Kincaid, J.M. Alt, M.J. Heilman, and A.M. Hill. 2000. M-1/M-2
macrophages and the Thl/Th2 paradigm. JImmunol 164:6166-6173.

157. Munder, M., M. Mallo, K. Eichmann, and M. Modolell. 1998. Murine macrophages
secrete interferon gamma upon combined stimulation with interleukin (IL)-12 and IL-18:
A novel pathway of autocrine macrophage activation. JExp Med 187:2103-2108.

158. Martinon, F., V. Petrilli, A. Mayor, A. Tardivel, and J. Tschopp. 2006. Gout-associated
uric acid crystals activate the NALP3 inflammasome. Nature 440:237-241.

159. Dostert, C., V. Petrilli, R. Van Bruggen, C. Steele, B.T. Mossman, and J. Tschopp. 2008.
Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica.
Science 320:674-677.

160. Martinon, F., K. Burns, and J. Tschopp. 2002. The inflammasome: a molecular platform
triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell
10:417-426.

161. Moore, J.M., and T.V. Rajan. 1994. Pristane retards clearance of particulate materials
from the peritoneal cavity of laboratory mice. JlImmunolMethods 173:273-278.

162. Salazar-Mather, T.P., T.A. Hamilton, and C.A. Biron. 2000. A chemokine-to-cytokine-to-
chemokine cascade critical in antiviral defense. J Clin Invest 105:985-993.

163. Salazar-Mather, T.P., C.A. Lewis, and C.A. Biron. 2002. Type I interferons regulate
inflammatory cell trafficking and macrophage inflammatory protein alpha delivery to
the liver. JClin Invest 110:321-330.

164. Tsou, C.L., W. Peters, Y. Si, S. Slaymaker, A.M. Aslanian, S.P. Weisberg, M. Mack, and
I.F. Charo. 2007. Critical roles for CCR2 and MCP-3 in monocyte mobilization from
bone marrow and recruitment to inflammatory sites. J Clin Invest 117:902-909.

165. Jia, T., N.V. Serbina, K. Brandl, M.X. Zhong, I.M. Leiner, I.F. Charo, and E.G. Pamer.
2008. Additive roles for MCP-1 and MCP-3 in CCR2-mediated recruitment of









inflammatory monocytes during Listeria monocytogenes infection. JImmunol 180:6846-
6853.

166. Kalden, J.R. 1997. Defective phagocytosis of apoptotic cells: possible explanation for the
induction of autoantibodies in SLE. Lupus 6:326-327.

167. Niessner, A., M.S. Shin, 0. Pryshchep, J.J. Goronzy, E.L. Chaikof, and C.M. Weyand.
2007. Synergistic proinflammatory effects of the antiviral cytokine interferon-alpha and
Toll-like receptor 4 ligands in the atherosclerotic plaque. Circulation 116:2043-2052.

168. Yla-Herttuala, S., B.A. Lipton, M.E. Rosenfeld, T. Sarkioja, T. Yoshimura, E.J. Leonard,
J.L. Witztum, and D. Steinberg. 1991. Expression of monocyte chemoattractant protein 1
in macrophage-rich areas of human and rabbit atherosclerotic lesions. Proc Natl Acad Sci
USA 88:5252-5256.

169. Roman, M.J., B.A. Shanker, A. Davis, M.D. Lockshin, L. Sammaritano, R. Simantov,
M.K. Crow, J.E. Schwartz, S.A. Paget, R.B. Devereux, and J.E. Salmon. 2003.
Prevalence and correlates of accelerated atherosclerosis in systemic lupus erythematosus.
NEngl JMed 349:2399-2406.

170. Mehta, V.B., J. Hart, and M.D. Wewers. 2001. ATP-stimulated release of interleukin
(IL)-lbeta and IL-18 requires priming by lipopolysaccharide and is independent of
caspase-1 cleavage. JBiol Chem 276:3820-3826.

171. Chen, C.J., H. Kono, D. Golenbock, G. Reed, S. Akira, and K.L. Rock. 2007.
Identification of a key pathway required for the sterile inflammatory response triggered
by dying cells. NatMed 13:851-856.

172. Akaogi, J., D.C. Nacionales, Y. Kuroda, W.H. Reeves, and M. Satoh. 2003. Ecotropic
murine leukemia viruses and exogenous mouse mammary tumor viruses are not essential
for pristane-induced lupus. A/ ii ti, Rheum 48:2990-2992.

173. Satoh, M., K.J. Hamilton, A.K. Ajmani, X. Dong, J. Wang, Y.S. Kanwar, and W.H.
Reeves. 1996. Autoantibodies to ribosomal P antigens with immune complex
glomerulonephritis in SJL mice treated with pristane. JImmunol 157:3200-3206.

174. Pawar, R.D., A. Ramanjaneyulu, O.P. Kulkarni, M. Lech, S. Segerer, and H.J. Anders.
2007. Inhibition of Toll-like receptor-7 (TLR-7) or TLR-7 plus TLR-9 attenuates
glomerulonephritis and lung injury in experimental lupus. JAm Soc Nephrol 18:1721-
1731.









BIOGRAPHICAL SKETCH

Pui Yuen Lee was born in 1981, in Guangzhou, China. He moved to Florida, USA, with

his family in 1993 and graduated from Palm Beach Gardens High School in 1999. He then

attended the University of Florida, where he graduated with highest honors in 2002 and received

Bachelor of Science degrees in molecular biology and medical sciences. Pui was admitted to the

University of Florida Junior Honors Medical Program in 2001 and subsequently the MD-PhD

program in 2002.

Pui began his research studies in Dr. Mark Segal's laboratory with the University Scholars

Program in 2000 and completed his undergraduate thesis there after 2 years. During the summer

before medical school, he completed a Clinical Research Center fellowship in Dr. Westley

Reeve's laboratory. Following the first year of medical school, Pui was accepted to the

NIH/NSF East Asia fellowship program, where he spent the summer working in Dr. Shizuo

Akira's laboratory in Osaka University in Japan. In 2004, Pui returned to Dr. Reeve's laboratory

to begin his Ph.D. training and studied the role of type-I interferons and Toll-like receptors in a

mouse model of lupus. Upon completing the Ph.D. degree, he plans to finish the final two years

of medical school and enter residency training in internal medicine.





PAGE 1

ROLE OF TYPE-I INTERFERONS AND TOLL-LIKE RECEPTORS IN EXPERIMENTAL SYSTEMIC LUPUS ERYTHEMATOSUS By PUI YUEN LEE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Pui Yuen Lee 2

PAGE 3

To my mother, Kit Ying Ip; and my father, Tsun Kin Lee, for their unconditional love and support. 3

PAGE 4

ACKNOWLEDGMENTS It is with my deepest gratitude that I acknowledge the following individuals for their contributions to my development as a scientist and as a person. I am forever indebted for their assistance, guidance and support that have made this work possible. First I would like to thank a number of faculty members for their invaluable contributions. I sincerely thank my mentor Dr. Westley Reeves for the years of guidance. His knowledge and insights have ignited my interest in immunology and his compassion in both research and clinical care has shown me how a physician-scientist should be. I am grateful to my co-mentor Dr. Mark Segal for introducing me to biomedical research during my undergraduate studies and serving as a role model ever since. The experience in his laboratory has been instrumental to my research endeavors and ultimately led to my decision to pursue the MD-PhD program. I would like to express my gratitude to my committee members Drs. Richard Moyer and Edward Chan for providing helpful advice and keeping me on track. I also thank Dr. Eric Sobel for his valuable insights on mouse models of lupus and Dr. Minoru Satoh for answering my countless questions regarding the pristane model and keeping me accompanied in the lab on weekends. I am grateful for the friendship and collaboration of all members of the Reeves laboratory. In particular, I would like to thank Jason Weinstein for sharing his expertise in flow cytometry, which created many new possibilities for my project; Dina Nacionales for putting together study protocols and always being available to assist with animal studies; Edward Butfiloski for ordering supplies and for his help with i.v. injection for labeling studies; and Yi Li for managing the lab and sharing her humorous views of life. I also thank Tolga Barker, Philip Scumpia, and Matt Delano for their intellectual contribution on many projects. I thank Dr. Richard Johnson for his encouragements and the Division of Nephrology for generously providing my NIH T32 training grant support. I also appreciate the help of Dr. Wei 4

PAGE 5

Mu in the Johnson laboratory, and Dr. Yanpeng Diao, Elaine Beem, and Larysa Sautin in the Segal laboratory for their assistance with various aspects of my work. A significant portion of this work could not be completed without the generosity of Professor Shizuo Akira in Osaka University. I am grateful to be provided the long list of knock-out strains not available elsewhere and given the opportunity to perform my experiments in Japan. I would like to thank Yutaro Kumagai, Drs. Osamu Takeuchi, Taro Kawai, and Masahiro Yamamoto of the Akira laboratory for their contributions that made it possible for me to complete my project there in a timely manner. I would like to extend my appreciation to my middle school teacher Anita Amigo who tirelessly taught me the English language when I moved to the U.S. and high school teachers Karen Kissel and Nancy Kinard who helped me discover my interest in medical science. Further, I wish to acknowledge Manru Connie Xu, Frank Huang and many friends for their continuous support and helping me overcome obstacles. I also thank my grandparents for their confidence and trust in me. Finally, I would like to thank my parents for their love and guidance. Their hard work and sacrifice have given me the opportunity to succeed in life. 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................9 LIST OF FIGURES .......................................................................................................................10 LIST OF ABBREVIATIONS ........................................................................................................12 ABSTRACT ...................................................................................................................................15 CHAPTER 1 INTRODUCTION..................................................................................................................17 Systemic Lupus Erythematosus..............................................................................................17 Epidemiology..................................................................................................................18 Clinical Manifestations....................................................................................................18 Immunological Abnormalities.........................................................................................19 Treatment.........................................................................................................................21 Involvement of IFN-I in the Pathogenesis of SLE.................................................................22 Type-I Interferon Signaling Pathways.............................................................................22 Immunomodulatory Effects of IFN-I..............................................................................23 Pathways of IFN-I Induction...........................................................................................24 Interferon-Producing Cells..............................................................................................25 Dysregulated IFN-I Production in Human SLE..............................................................26 Evidence of IFN-I involvement in Murine Models of SLE............................................29 2 METHODS AND MATERIALS...........................................................................................34 Mouse Strains.........................................................................................................................34 Treatment and Tissue Harvest................................................................................................35 Flow Cytometry and Cell Sorting...........................................................................................35 Conventional and Real-Time Quantitative PCR.....................................................................36 Cytokine ELISA.....................................................................................................................37 Monocyte and Dendritic Cell Depletion.................................................................................37 Autoantibody Measurement....................................................................................................38 In Vitro Stimulation................................................................................................................38 Cell Culture with TMPD........................................................................................................39 Endocytosis and Phagocytosis Assays....................................................................................39 Statistical Analysis..................................................................................................................40 3 NOVEL TYPE-I INTERFEREON-PRODUCING CELLS IN TMPD-INDUCED LUPUS....................................................................................................................................42 6

PAGE 7

Introduction.............................................................................................................................42 Materials and Methods...........................................................................................................43 Mice.................................................................................................................................43 Quantitative Real-Time PCR...........................................................................................43 Flow Cytometry...............................................................................................................44 Cell Sorting......................................................................................................................44 Monocyte Labeling and Depletion..................................................................................44 Dendritic Cell Depletion..................................................................................................45 Statistical Analysis..........................................................................................................45 Results.....................................................................................................................................45 The Interferon Signature Precedes Lupus Disease Onset............................................45 Accumulation of Ly6C hi Monocytes Induced by TMPD Treatment...............................46 Immature Ly6C hi Monocytes are a Major Source of IFN-I Production..........................49 Induction of IFN-I by TMPD is not Dependent on DCs.................................................50 Surface Expression of Ly6C on Monocytes is not IFN-I-Dependent.............................52 Discussion...............................................................................................................................53 4 TOLL-LIKE RECEPTOR 7-DEPENDENT AND FCR-INDEPENDENT PRODUCTION OF TYPE-I INTERFERON IN TMPD-INDUCED LUPUS.......................63 Introduction.............................................................................................................................63 Materials and Methods...........................................................................................................65 Mice.................................................................................................................................65 Real-Time Quantitative PCR...........................................................................................65 Flow Cytometry and Cell Sorting....................................................................................66 In Vitro Stimulation.........................................................................................................67 Autoantibody Analysis....................................................................................................67 Statistical Analysis..........................................................................................................67 Results.....................................................................................................................................68 Induction of IFN-I by TMPD Requires MyD88..............................................................68 Induction of IFN-I by TMPD is TLR7-Dependent, Immune Complex-Independent.....69 Immature Ly6C hi Monocytes Express High Levels of TLR7.........................................72 The Y-linked Autoimmune Accelerating (Yaa) Locus Amplifies the Effects of TMPD..........................................................................................................................73 Essential Role of TLR7 in the Development of Autoantibodies.....................................74 Discussion...............................................................................................................................75 5 TYPE-I INTERFERON-DEPENDENT RECRUITMENT OF INFLAMMATORY MONOCYTES IN TMPD-INDUCED LUPUS.....................................................................90 Introduction.............................................................................................................................90 Methods..................................................................................................................................91 Mice.................................................................................................................................91 Real-Time PCR...............................................................................................................92 Flow Cytometry...............................................................................................................92 Monocyte Labeling..........................................................................................................93 In Vitro Stimulation.........................................................................................................93 7

PAGE 8

Results.....................................................................................................................................93 Peritoneal Recruitment of Ly6C hi Monocytes after TMPD Treatment...........................93 Chronic Recruitment of Ly6C hi Monocytes is Dependent on IFN-I signaling...............95 Monocyte Recruitment Induced by TMPD Requires CCR2...........................................97 Functions of Monocyte Subsets in TMPD-Treated Mice................................................98 Chronic Recruitment of Granulocytes Requires IL-1 Signaling.....................................99 Discussion.............................................................................................................................100 6 DISCUSSION AND FUTURE DIRECTIONS....................................................................112 Suitability of the TMPD-Model for the Study of SLE.........................................................113 Complexity of the TMPD Model..........................................................................................113 Mechanism of TLR7 Activation...........................................................................................115 Role of TLR7 in Autoantibody Production..........................................................................116 Sequential Generation of Autoantibody Specificities in TMPD-Induced Lupus.................118 Therapeutic Implications......................................................................................................120 Conclusion............................................................................................................................121 LIST OF REFERENCES.............................................................................................................127 BIOGRAPHICAL SKETCH.......................................................................................................142 8

PAGE 9

LIST OF TABLES Table page 2-1. Conventional and real-time PCR primers...............................................................................41 4-1. Cytokine and chemokine PCR array analysis in TLR7 -/mice...............................................81 5-1. Peritoneal exudate cell subsets two weeks following TMPD treatment..............................105 9

PAGE 10

LIST OF FIGURES Figure page 1-1. Schematic of IFN-I signaling pathways................................................................................32 1-2. Schematic of IFN-I induction by endogenous nucleic acids.................................................33 3-1. Elevated expression of IFN-I and accumulation of Ly6C hi monocytes after TMPD treatment............................................................................................................................57 3-2. Direct recruitment of circulating Ly6C hi monocytes after TMPD treatment........................58 3-3. Immature Ly6C hi monocytes are major producers of IFN-I..................................................59 3-4. Dendritic cells are not required for IFN-I production induced by TMPD.............................60 3-5. Accumulation of Ly6C hi monocytes is correlated with the frequency of anti-Sm/RNP autoantibodies and upregulation of ISG expression..........................................................61 3-6. Expression of Ly6C on immature monocytes is not dependent on IFN-I signaling.............62 4-1. Induction of IFN-I by TMPD requires MyD88.....................................................................82 4-2. Cytoplasmic nucleic acid sensors do not contribute to IFN-I production.............................83 4-3. Induction of IFN-I by TMPD is TLR7-dependent................................................................84 4-4. Dispensable role of FcRI and FcRIII in TMPD-induced IFN-I production.......................85 4-5. Immature Ly6C hi monocytes express high levels of TLR7...................................................86 4-6. Amplification of the response to TMPD by the Yaa locus....................................................87 4-7. Essential role of TLR7 in autoantibody production..............................................................88 4-8. Development of anti-Su/ago2 autoantibodies is TLR7-dependent........................................89 5-1. Chronic recruitment of Ly6C hi monocytes in TMPD-treated mice.....................................106 5-2. The recruitment of Ly6C hi monocytes induced by TMPD requires IFN-I signaling..........107 5-3. Rapid turnover and decreased maturation of Ly6C hi monocytes is the presence of IFN-I signaling...........................................................................................................................108 5-4. Monocyte recruitment induced by TMPD is dependent on CCR2......................................109 5-5. Functions of monocyte subsets in TMPD-treated mice.......................................................110 10

PAGE 11

5-6. Granulocyte influx following TMPD treatment requires IL-1 receptor..............................111 6-1. Proposed model of TMPD-induced inflammation..............................................................122 6-2. Enhancement TLR7 stimulation by TMPD in vitro............................................................123 6-3. Endocytosis and phagocytosis are not affected by TMPD treatment..................................124 6-4. Profile of autoantibody production in TLR7 -/mice............................................................125 6-5. Accumulation of Ly6C hi monocytes in lipogranulomas......................................................126 11

PAGE 12

LIST OF ABBREVIATIONS Ago2 argonaute-2 ANA antinuclear antibodies APC allophycocyanin BMDM bone marrow-derived macrophages Clo-lip clodronate-containing liposomes CLP cecal ligation and puncture DiD 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine perchlorate DiD-lip DiD-labeled liposomes DNA deoxyribonucleic acid DTR diphtheria toxin receptor ELISA enzyme-linked immunosorbent assay FACS fluorescence-activated cell sorting FBS fetal bovine serum FcR Fc gamma receptor FITC fluorescein isothiocyanate IFN interferon IFNAR interferon alpha/beta receptor Ig immunoglobulin IL interleukin iNOS inducible nitric oxide synthase i.p. intraperitoneal IPS-1 interferonpromoter stimulator-1 IRF interferon-regulated factor ISG interferon-stimulated genes 12

PAGE 13

i.v. intravenous LPS lipopolysaccharide M macrophages MCP-1 monocyte chemoattractant peptide-1 MDA-5 melanoma differentiation associated gene-5 MDC myeloid dendritic cells MHC major histocompatibility complex MO mineral oil Mx-1 myxoma resistance response gene-1 MyD88 myeloid differentiation factor-88 NZB/W New Zealand Black / New Zealand White F1 PBMC peripheral blood mononuclear cells PCR polymerase chain reaction PDC plasmacytoid dendritic cells PDCA-1 plasmacytoid dendritic cell antigen-1 PE phycoerythrin PEC peritoneal exudate cells RNA ribonucleic acid Poly I:C polyinosinic: polycytidylic acid RIG-I retinoic acid inducible gene-I SLE systemic lupus erythematosus RT-PCR real-time quantitative PCR Sm Smith antigen snRNP small nuclear ribonucleoproteins TBK-1 TANK-binding kinase-1 TGF transforming growth factor 13

PAGE 14

TLR Toll-like receptor TMPD 2,6,10,14 tetramethylpentadecane TNF tumor necrosis factor TRIF TIR domain-containing adaptor inducing IFNYaa Y-linked autoimmune acceleration 14

PAGE 15

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF TYPE-I INTERFERONS AND TOLL-LIKE RECEPTORS IN EXPERIMENTAL SYSTEMIC LUPUS ERYTHEMATOSUS By Pui Yuen Lee August 2008 Chair: Westley H. Reeves Major: Medical Sciences Immunology and Microbiology Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder affecting multiple organ systems. Although the etiology remains unclear, it is increasingly recognized that derangements of innate as well as adaptive immunity are important to the pathogenesis SLE. Recent evidence suggests that type-I interferons (IFN-I), a family of anti-viral cytokines, are integral to the pathogenesis of SLE. More than half of SLE patients display upregulation of a group of IFN-I-stimulated genes (ISGs). This interferon signature is clinically relevant as it correlates with active disease, presence of certain autoantibodies, and an increased incidence of renal involvement. The mechanism responsible for the dysregulation of IFN-I production and the source of these immunostimulatory cytokines are not clear. Experimental lupus induced by tetramethylpentadecane (TMPD) displays key immunological and clinical features of human SLE. TMPD-induced lupus is at present the only model of SLE associated with excess IFN-I production and ISG expression. Therefore, investigated the mechanism and cell subset(s) responsible for the excess IFN-I production in this model. We demonstrate that TMPD treatment induces the accumulation of immature Ly6C hi inflammatory monocytes, which are a major source of IFN-I in this lupus model distinct from IFN-producing dendritic cells. The expression of IFN-I and ISGs was rapidly abolished by 15

PAGE 16

monocyte depletion whereas systemic ablation of dendritic cells had little effect. In addition, we found that IFN-I are required to maintain the chronic recruitment of Ly6C hi monocytes by inducing the secretion of monocyte chemoattractants, thereby creating a vicious cycle of monocyte influx and IFN-I production. We also show for the first time that TMPD elicits IFN-I production and autoantibody production exclusively through a Toll-like receptor 7 (TLR7)and myeloid differentiation factor 88 (MyD88)-dependent pathway. The effects of TMPD were amplified by the Y-linked autoimmune acceleration (Yaa) cluster, which carries a duplication of the TLR7 gene. In contrast, other TLRs and cytoplasmic nucleic acid sensors were dispensable for IFN-I induction in this model. The deficiency of Fc receptors also did not impact the production of IFN-I, arguing against the conventional view that autoantibody immune complexes are responsible for the excess IFN-I in SLE. Taken together, these findings illustrate the importance of IFN-I and TLR7 in the pathogenesis of TMPD-induced lupus and provide novel insights into the interferon signature seen in patients with SLE. 16

PAGE 17

CHAPTER 1 INTRODUCTION This chapter discusses the epidemiology, clinical manifestations, and immunological abnormalities associated with systemic lupus erythematosus (SLE). The basic immunology of type-I interferons (IFN-I) and the interferon signaling pathway, as well as current evidence for the involvement these anti-viral cytokines in the pathogenesis of SLE will be presented. This introduction will also provide the rationale for studying the dysregulation of IFN-I using murine models of SLE. Systemic Lupus Erythematosus SLE is a chronic autoimmune disease that affects multiple organ systems including the joints, skin, kidneys, lungs, heart, and nervous system (1). In healthy individuals, the immune system functions to detect the presence pathogens such as bacteria and viruses by distinguishing self-antigens from foreign antigens. Upon encountering pathogen-associated molecular patterns (PAMPs) such as nucleic acids of microbial origin, the innate immune system initiates a non-specific inflammatory response via a number of highly conserved Toll-like receptors. The production of inflammatory cytokines and chemokines recruits antigen presenting cells such as monocytes and dendritic cells, which direct the adaptive immune response to produce antigen-specific T and B cell against the foreign antigen. Unlike PAMPs, self-antigens are typically either not recognized by the immune system, or are precluded from interaction with immune cells by anatomical barriers. The occasional generation of autoreactive lymphocytes is also guarded by a number of censoring mechanisms. For reasons not completely understood, such tolerance to self tissues is breached in SLE and the immune system actively responds to a wide-array of autoantigens by generating either autoreactive T cells or B cells. In SLE, the resulting immune cell activation leads to autoantibody production and a vicious cycle of chronic 17

PAGE 18

inflammation and tissue destruction. While the clinical manifestations and severity of the disease vary widely, most lupus patients experience alternating periods of flares and remission. The etiology of SLE remains unclear, although both genetic and environmental factors are believed to play essential roles. Currently there is no cure for SLE and treatment is aimed at symptomatic relief. Epidemiology In the United States, the prevalence of SLE is estimated to be 15 to 50 cases per 100,000 and about 5 million individuals are affected world-wide (2). Although males are susceptible, 90% of lupus patients are females and most are of child-bearing age. SLE is more common in African-Americans and in Hispanic and Asian populations than in Caucasians. Hereditary factors contribute to the susceptibility for SLE as a concordance of 26% was found in monozygotic twins vs. 5% in dizygotic twins (3). Moreover, the familial prevalence is 10-12% for individuals having one or more first-degree relatives diagnosed with SLE (4). Significant familial aggregation with other autoimmune diseases including rheumatoid arthritis and Sjogrens syndrome has also been described (5). Clinical Manifestations The American College of Rheumatology (ACR) has defined 11 criteria for the classification of SLE (6, 7). The clinical criteria consist of malar rash, discoid rash, photosensitivity, oral ulcers, arthritis, serositis, renal involvement, neurologic disorders (seizure or psychosis) and hematologic abnormalities. Immunological criteria include the presence of antinuclear antibodies (ANA) and more specific autoantibodies such anti-double-stranded (ds)-DNA, anti-Sm, and anti-phospholipid. A diagnosis of SLE is made with 95% certainty if a patient meets any 4 of the 11 ACR criteria. 18

PAGE 19

In most patients, the onset of autoantibodies precedes clinical manifestations (8). While almost all patients are positive for ANA, the presence of autoantibodies against dsDNA and the Sm antigen are highly specific to lupus. Symptoms of SLE can vary widely due to fluctuations in disease severity. The most common clinical findings include fatigue, arthralgia, arthritis, photosensitivity, anemia, and leucopenia. Malar rash with the characteristic butterfly distribution is found in about half of lupus patients and often reflects the presence of active disease. Lupus nephritis occurs in 30-50% of patients and represents a major cause of early mortality (9). Although less common, SLE patients can present with manifestations of cardiovascular, neurologic, gastrointestinal, pulmonary, or ocular origin. Immunological Abnormalities Although the cause of SLE is not known, it is widely accepted that a combination of genetic predisposition and environmental influence results in the loss of immunologic tolerance and induction of autoimmunity. The immune system plays a central role in this process by promoting the recognition of self-antigens and subsequent production of autoantibodies. Hyperactivation of lymphocytes, ineffective clearance of apoptotic cells and aberrant cytokine production are among the most studied immunological defects in SLE. During a normal immune response to foreign antigens, antigen presenting cells (APCs) such as dendritic cells, macrophages and B lymphocytes present processed antigenic peptides to CD4+ helper T cells via class II major histocompatibility complex (MHC) molecules. Through direct cell contact and cytokine secretion, these helper T cells in turn stimulate B lymphocytes to initiate the production of antibodies. Although lymphopenia is often a manifestation of SLE, B and T cells from lupus patients often exhibit a hyperactive phenotype. B cells from SLE patients display enhanced proliferation, elevated antibody production and aberrant intracellular signaling upon B cell receptor activation (10, 11). Expansion of memory cells and plasma cells has also 19

PAGE 20

been linked to the hypergammaglobulinemia associated with SLE (12). Similarly, T cells from lupus patients exhibit abnormal signal transduction upon activation (13). They also show elevated surface expression of costimulatory molecules such as CD40-ligand and the T-cell specific inducible costimulator (ICOS) (14), which help to promote B cell activation. Paradoxically, while lymphocytes from lupus patients are highly reactive to nuclear antigens (15, 16), they often respond weakly to foreign antigens such as tetanus toxoid (16). This discrepancy may be responsible for the increased susceptibility to infections and high failure rate of vaccination seen in SLE patients. The abnormal activation of lymphocytes in SLE may be partly explained by dysregulated production of cytokines, a group of molecules critical to the function of innate and adaptive immunity. In line with the excess antibody production, elevated serum levels of the T helper 2 (T h 2) cytokines IL-6 (a required factor for the differentiation of B cells into antibody-secreting plasma cells) and IL-10 (a promoter of IgG production) are found in lupus patients (17, 18). Over-expression BAFF/Blys, which promotes the survival and proliferation of B cells, has also been recently described (19). While Th2 cytokines are essential for antibody production (20), activation of T cells and monocyte/macrophages by Th1 cytokine production are linked to tissue damage in SLE. Increased glomerular expression of IL-12 and IFNis associated with lupus nephritis and ablation of these cytokines ameliorates glomerulonephritis in several models of SLE (21-24)). The cytokine imbalance in SLE is complex and likely involves a broad-spectrum of these immune modulators. More recently, research studies have shown a prominent role of the anti-viral IFN-I in the pathogenesis of SLE. The immunobiology of IFN-I and their role in both human lupus and murine models will be discussed in detail in the next section. 20

PAGE 21

Another immunological abnormality seen in SLE is the impairment in phagocyte functions. Apoptosis or programmed cell death is a physiological process that controls cell proliferation and maintains tissue homeostasis. Despite the continuous turnover of aging or injured cells, apoptotic cell debris normally does not activate the immune system as they are rapidly taken up by surrounding cells or phagocytes such as macrophages (25). This clearance mechanism is impaired in lupus patients and the accumulation of dead or dying cells provides a source of a variety of intracellular antigens normally not exposed on the cell surface (26). In addition, endogenous nucleic acids such as DNA and RNA can also function as a danger signal to activate antigen presenting cells via TLRs (27, 28). This problem is compounded by the deficiency of complement and impaired activity of endogenous nucleases such as DNase I and II in the serum of SLE patients (29). This defective clearance mechanism also may be involved in the pathogenesis of photosensitivity, a common clinical manifestation of lupus patients. Exposure to sunlight is often sufficient to trigger a disease flare (2). It has been hypothesized that apoptosis of skin cells and the inability to clear the debris may be partially accountable for this effect. Treatment Currently there is no cure for SLE and drug treatment is directed by disease severity and organ involvement. In milder cases, non-steroidal anti-inflammatory drugs (NSAIDs) and anti-malarials are effective for the treatment of fatigue, skin rash, and arthritis (2). High dose corticosteroids are often used during a disease flare followed by low-dose maintenance therapy. For lupus nephritis, cytotoxic drugs such as cyclophosphamide and mofetil mycophenolate are effective in controlling renal damage (2). However, most current medications act by non-specifically suppressing the immune system and are associated with many side-effects. Many ongoing clinical trials are evaluating the efficacy of novel compounds that specifically inhibit 21

PAGE 22

lymphocyte activation molecules (i.e. anti-CD40 and CTLA4-Ig) or cytokines such as IL-6 and IFN-I. Involvement of IFN-I in the Pathogenesis of SLE Originally discovered for their anti-viral properties, IFN-I exert a multitude of immunological functions and have been increasingly recognized as a key cytokine in the pathogenesis of autoimmune diseases. Increased serum IFN-I levels in lupus patients were first reported over twenty years ago (30). Recent studies have found that more than half of SLE patients display excess production of IFN-I and upregulation of a group of IFN-I-stimulated genes (ISGs), a feature associated with active disease (31-33). In addition, IFN-I also contributes to the pathology of several murine models of SLE. This section summarizes the biology of the IFN-I and current evidence of their involvement in human SLE as well as murine models of the disease. Type-I Interferon Signaling Pathways The fourteen subtypes of IFN-, four IFNpseudogenes, and the single IFN-, -, -, and species together comprise the IFN-I cluster on human chromosome 9p22 within a genomic duplication (34, 35). In terms of immunity and autoimmunity, IFNand IFNare the main types of interest. All members of the IFN-I family bind to a ubiquitously expressed heterodimeric receptor complex composed of an (IFNAR1) and a (IFNAR2) chain. While IFNAR2 serves as the ligand-binding domain, both chains are required for effective signal transduction (36). Ligand-induced dimerization of the receptor chains results in autoand trans-phosphorylation of two receptor-associated Janus protein tyrosine kinases: Tyk2 on IFNAR1 and Jak1 on IFNAR2 (37). These events provide docking sites for the recruitment and 22

PAGE 23

phosphorylation of STAT1 and STAT2. Phosphorylated STAT1/STAT2 heterodimers then translocate into the nucleus, associate with IFN regulatory factor 9 (IRF-9, also known as p48) and form the heterotrimeric complex IFN-stimulated gene factor 3 (ISGF3) (36, 38). Subsequently, ISGF3 initiates the transcription of hundreds of IFN-I inducible genes by binding to the upstream consensus IFN-stimulated response elements (ISRE) (39). Although not directly involved with Jak-STAT signaling, activation of p38 mitogen-activated protein kinase (MAPK) is required for effective formation of ISGF3 and transcription of ISRE-regulated genes (40-42). A schematic of the IFN-I signaling cascade is depicted in Figure 1-1A. Immunomodulatory Effects of IFN-I The IFN-I system is an essential component linking innate and adaptive immunity. Secreted in response to extracellular or intracellular pathogens, IFN-I enhance the expression of class I and class II major histocompatibility complex (MHC) molecules on antigen presenting cells and induce dendritic cell maturation (43). During the early phases of an infection, IFN-I signaling also activates the transcription of antimicrobial genes, linking innate and adaptive immunity and inhibits the proliferation of infected cells (44-46). In adaptive immunity, IFN-I regulate T cell functions by promoting the effects of T H 1 cytokines and augmenting the survival of activated T cells (47). IFN-I signaling is also crucial for effective B cell differentiation and memory B cell responses (48). Moreover, IFN-I have adjuvant effects, augmenting antigen-specific immunoglobulin production and isotype switching when administered along with soluble antigen (49). The broad effects of IFN-I further extend to the regulation of other cytokines. IFN-I can up-regulate IFNproduction, enhance IL-6 signaling, and stimulate the proinflammatory activity of IL-10 (50). These diverse and potent immune-enhancing effects may underlie the involvement of IFN-I in autoimmune disorders. 23

PAGE 24

Pathways of IFN-I Induction The production of IFN-I in response to pathogens is mediated in part by the Toll-like receptors (TLRs), a highly conserved family of membrane receptors specialized in the recognition of pathogen-associated molecular patterns (51). While almost all TLRs are capable of triggering the production of inflammatory cytokines such as tumor necrosis factor (TNF) and IL-6 upon ligand binding, only TLR3, -4, -7, -8, and -9 trigger IFN-I production. TLR3 recognizes viral double-stranded RNA whereas TLR4 is the receptor for bacterial lipopolysaccharide and certain viral proteins. Induction of IFNthrough these two surface TLRs requires the adaptor molecule Toll/interleukin-1 receptor domain-containing adaptor-inducing IFN (TRIF) (52). In contrast to the endosomal location of TLR3, TLR4 is present on the cell surface, although recent evidence suggests that upon LPS binding TLR4 also enters the endosomal compartment prior to TRIF activation (53). TLR-7/-8, and -9 are also located in endosomes but signal IFN expression via the adaptor protein myeloid differentiation factor 88 (MyD88) (54). TLR7 and -8 bind viral single-stranded RNA while TLR9 recognizes unmethylated CpG DNA found in bacteria (55, 56). Activation of TRIF or MyD88 recruits IB kinases (IkkB), which phosphorylate the downstream factors IRF-3, IRF-5, and IRF-7, culminating in the transcription of IFN-. Once expressed and secreted, IFNbinds to the IFNAR in an autocrine manner, resulting in the transcription of a group of IFN-I inducible genes. Subsequent expression of IFNand IRF-7, an essential transcription factor for IFN-I, establishes a positive-feedback loop for signal amplification (57, 58). The TLR signaling pathways leading to IFN-I production are illustrated in Figure 1-1B. Recently, several viruses have been shown to induce IFN-I production independent of TLRs, uncovering novel mechanisms of detecting intracellular viral RNA via the cytoplasmic 24

PAGE 25

helicase proteins retinoic-acid-inducible protein I (RIG-I) and melanoma-differentiation-associated gene 5 (MDA-5) (59, 60). These sensors mediate IFN-I production through the adaptor IPS-1 (IFNpromoter stimulator protein-1; also known as MAVS, VISA, or Cardif) (61). Finally, research on intracellular infection by Listeria monocytogenes have unveiled a pathway to trigger IFN-I production by intracellular DNA (62). Although the molecule responsible for DNA interaction remains unclear, this pathway requires the activation of TANK-binding kinase-1 (TBK-1) and IRF-3 (63). These pathways are also depicted in Figure 1-1B. Interferon-Producing Cells Although almost all nucleated cells are capable of producing IFN-I, a small population of natural IFN-producing cells in the circulation, now known as plasmacytoid dendritic cells (PDC) are the most potent (64, 65). Human PDCs are lineage negative cells generally characterized by the surface expression of CD4, CD123, CD83, and class II MHC. Two other markers, blood dendritic cell antigen 2 (BDCA-2) and BDCA-4, are also commonly used for detecting and isolating human PDCs (66). These natural IFN-I producers can synthesize up to 1000-fold more IFN-/ than other cells and production can be enhanced further upon activation of endosomal TLR7 and TLR9. A high constitutive expression of IRF-7 in these cells may be partly responsible for their high IFN-I production (67). Upon activation, PDCs migrate to lymph nodes in response to chemokines. Myeloid dendritic cells (MDC) are also strong IFN-I producers during viral infections, but whether they are as potent as PDCs is controversial (65, 68). Although monocytes/macrophages are weak producers of IFN-I in response to TLR ligands, activation of the cytoplasmic nucleic acid sensors can trigger high levels of IFNproduction in these cells (62). In fact, it was recently shown that macrophages in the lungs function are the primary IFN-I producers during viral infection and PDCs assumes the role in the absence of macrophages (69). 25

PAGE 26

Dysregulated IFN-I Production in Human SLE Given the pleiotropic effects of IFN-I on DC maturation, T cell survival, and antibody production, it is conceivable that excess IFN-I or aberrant regulation of IFN-I signaling could contribute to autoimmunity. Consistent with that possibility, IFN treatment in hepatitis C infection, malignant carcinoid syndrome, or chronic myelogenous leukemia is associated a wide array of autoimmune manifestations. A positive fluorescent ANA test can be found in as many as 22% of patients treated with IFN(70). The onset of SLE, autoimmune (Hashimoto) thyroiditis, autoimmune hemolytic anemia, rheumatoid arthritis, vasculitis, and psoriasis all have been reported following IFN therapy (71-73). High levels of IFN in the sera of SLE patients were first described by Hooks et al. in 1979 (30). The significance of this observation remained unclear for decades until it was shown that serum from lupus patients, especially those with active disease, promotes the differentiation of blood monocytes into dendritic cells (74). The capacity to induce dendritic cell differentiation correlates with IFN-I levels and neutralization of IFN-I completely abrogates this effect. Recent studies further demonstrated that the dysregulation of IFN-I in SLE is also evident in gene expression profiles of lupus peripheral blood mononuclear cells (PBMCs). Since all IFN-I subtypes signal through the same receptor complex, levels of IFN-I can be quantified by measuring interferon stimulated gene (ISG) expression using gene microarray and real-time polymerase chain reaction (PCR) (31, 32, 75). IFN-I inducible genes over-expressed in SLE include anti-viral proteins [e.g. myxoma-response protein-1 (Mx-1)], apoptosis regulators (phospholipids scramblase, TRAIL), MHC molecules (class I and II), Toll-like receptors (TLR-3 and -7), Fc receptors (CD32a and CD64) and several interferon-inducible chemokines (CCL2/MCP-1, CXCL10/IP-10). PBMC expression of ISGs, therefore, provides a robust 26

PAGE 27

surrogate read-out of systemic IFN-I levels. Approximately half of SLE patients display abnormally high ISG expression (defined as > 2 standard deviations above the mean ISG expression in healthy controls). This interferon signature is associated with disease severity, renal involvement, and the presence of autoantibodies against dsDNA and RNA-associated nuclear antigens such as Sm/nRNP, SSA/Ro, and SSB/La (33, 76). In healthy individuals, the production of IFN-I and expression of ISGs are elevated transiently during viral infection. However, why this interferon signature is consistently detected in many SLE patients is poorly understood. While evidence linking the abnormal IFN-I production to a common exogenous trigger (i.e. viruses) has not been convincing, a number of endogenous mechanisms for IFN-I induction have been identified. An early study described a serum interferon-inducing factor (IIF) suggestive of DNA-antibody immune complexes in SLE patients (77). Supporting these findings, immune complexes consisting of plasmid DNA and anti-dsDNA autoantibodies stimulate IFN-I in normal PBMC (28), while mammalian DNA alone has little effect (78). The identification of TLRs strengthened the notion that self-DNA may trigger IFN-I production in SLE. In the presence FcRIIa (CD32), internalized DNA-containing immune complexes activate dendritic cells via TLR-9, the receptor for unmethylated CpG DNA found in bacteria (and plasmid DNA) (79). Several groups have recently reported that endogenous RNA also may induce IFN-I by binding to TLRs (27, 80, 81). Originally described to recognize viral G/U-rich single-stranded RNAs (55), TLR7 is capable of binding certain mammalian RNA sequences resulting in the activation of PDCs (80, 81). Consistent with these reports, human U1 RNA (associated with snRNP particles) and Y RNAs (associated with Ro60 protein) also potently induce IFN-I production through an endosomal MyD88-dependent pathway involving TLR7 (80, 82). 27

PAGE 28

Based on these findings, many researchers believe that the endogenous stimulatory DNA and RNA molecules may originate from apoptotic or necrotic cells in the circulation (83). Unlike healthy individuals, the mechanism for apoptotic cell clearance is impaired in SLE patients, providing a source of endogenous nucleic acids. It is believed that the presence of DNA or RNA is not sufficient to initiate an inflammatory response because the TLRs recognizing these ligands are located in the endosomes (78). In the presence of autoantibodies (i.e. anti-dsDNA, anti-Sm/RNP), however, the formation of immune complexes may then enhance the internalization the endogenous nucleic acids present in apoptotic bodies into endosomes (Figure 2). Thus, interaction of the endogenous ligands with corresponding endosomal TLRs is hypothesized to be responsible for the interferon signature in SLE, though this remains to be verified experimentally and whether immune complex or FcRs are absolute requirements is controversial (27, 84). Most studies to date have attributed the elevated IFN-I production in SLE to PDCs, a view supported by the ability of DNA and RNA immune complexes to induce IFN-I production by PDCs in vitro (28, 80). The TLRs implicated in binding endogenous nucleic acids, specifically TLR7, 8 and 9 are highly expressed on human PDCs and B cells but not myeloid dendritic cells (MDCs), monocytes, or macrophages (85). However, the number of circulating PDCs in SLE patients is unexpectedly low. A profound reduction in the number of PDCs and MDCs is characteristic of SLE patients, especially those with renal involvement (33). Similar findings have been reported by other groups and most believe that the depletion of PDCs reflect migration of these cells to tissues and lymphoid organs following activation (64). Consistent with this view, increased numbers of PDCs and elevated IFN-I secretion have been found in lupus skin lesions and lymph node biopsies from SLE patients (86). Nevertheless, direct 28

PAGE 29

evidence showing PDCs are the primary source of excess IFN-I in SLE is lacking. Depletion of PDCs in vitro reduced IFN-I production by only ~40%, suggesting that other cell types may also be involved (74). Evidence of IFN-I involvement in Murine Models of SLE The involvement of IFN-I in the pathogenesis of SLE has also been studied in many experimental models of the disease. While both New Zealand Black (NZB) and New Zealand White (NZW) strains are autoimmune-prone, the F1 generation bred from these strains (NZB/W F1) spontaneously develop a lupus-like disease characterized by immune-complex glomerulonephritis and autoantibodies to dsDNA (87). The NZB/W model is most valuable for studying the role of genetics in SLE as multiple susceptibility loci are required for disease manifestations. A recent study illustrated that the development of glomerulonephritis, ANA and anti-dsDNA antibodies is accelerated by exogenous IFN(88), whereas deletion of IFN-/ receptor (IFNAR) in NZB mice slows the progression of autoimmune hemolytic anemia and enhances survival (89). In line with these findings, the development of ANA and renal disease in B6.Nba2 congenic mice (C57/BL6 mice with a susceptibility loci derived from the NZB strain) is also dependent on IFN-I signaling (90). Unexpectedly, the role of IFN-I seems to be reversed in the MRL lpr/lpr model. The combination of the autoimmune-prone MRL background and the lpr mutation (disruption of the pro-apoptotic regulator fas) results in a lymphoproliferative disorder with features of SLE including glomerulonephritis, arthritis, and autoantibodies to Sm and anti-dsDNA (91). In contrast to NZB/W F1 mice, disease amelioration has been reported in MRL lpr/lpr mice treated with exogenous IFN-I while IFNAR deficiency reduced survival (92). Whether these findings reflect the role of IFN-I in human SLE remains to be determined as intrinsic upregulation of 29

PAGE 30

IFN-I and ISG expression (in the absence of exogenous IFN-I) seen in lupus patients has not been reported in these mouse models. The only reported murine model that recapitulates the interferon signature seen in human SLE is experimental lupus induced by the hydrocarbon 2,6,10,14-tetramethylpentadecane (TMPD), also known as pristane (93). For decades, TMPD has been utilized to induce plasmacytoma and enhance antibody production by hybridoma (94, 95). In 1994, Satoh et. al. reported that a single peritoneal injection of TMPD in non-autoimmune prone strains (e.g. BALB/c) was sufficient to induce many key immunological and clinical features of human SLE, including the production of autoantibodies against dsDNA and Sm/nRNP, and the development of immune complex-mediated glomerulonephritis as well as late-onset arthritis (96, 97). In addition to the chronic inflammatory response in the peritoneal cavity, mice treated with TMPD display upregulated expression of ISGs such as Mx-1 and IRF7 in the peripheral blood. Importantly, renal disease and the generation of anti-dsDNA and anti-Sm/nRNP autoantibodies are highly dependent on IFN-I as these features of SLE are abolished in IFNAR-deficient mice (93). Consistent with the ability to elicit IFN-I production, TMPD-treatment of NZB/W F1 mice accelerates disease progression and induces the development of anti-Sm/nRNP autoantibodies, which are normally absent in this strain (98). The presence of the interferon signature and the dependency of disease features on IFN-I signaling offer the unique opportunity to dissect the role of IFN-I in experimental lupus. The mechanism responsible for TMPD-induced IFN-I production and the subsequent lupus manifestations is largely unknown. Whether PDCs and/or other cell subsets are the main producers of IFN-I in this model is of great interest since the source of IFN-I in human SLE is also unclear. Finally, whether chronic inflammation induced by the hydrocarbon contributes to 30

PAGE 31

the production of IFN-I and the onset of autoimmunity also warrants attention. The subsequent chapters will address these questions in detail. Results from these studies may shed light on the same questions regarding human SLE. 31

PAGE 32

A B Figure 1-1. Schematic of IFN-I signaling pathways. A) All subtypes of IFN-I bind to the IFNAR complex and initiate phosphorylation of the kinases JAK1 and Tyk2. Subsequent phosphorylation and translocation of STAT1 and STAT2 triggers the transcription of interferon-stimulated genes such as Mx-1, IRF7, Sca-1 and MCP-1. B) IFN-I induction by pathogen-associated molecular patterns such as viral RNA and DNA is mediated by TLRs and cytoplasmic nucleic acid sensors. 32

PAGE 33

Figure 1-2. Schematic of IFN-I induction by endogenous nucleic acids. Mammalian nucleic acids are normally non-stimulatory because they do not enter endosomes, where TLR7 and TLR9 are present. Immune complexes formed by lupus autoantibodies and endogenous nucleic acids are internalized via FcRIIa and allows the interaction between the nucleic acids and TLRs, leading to the production of IFN-I. 33

PAGE 34

CHAPTER 2 METHODS AND MATERIALS Mouse Strains These studies were approved by the Institutional Animal Care and Use Committees at the University of Florida (Gainesville, FL) and Osaka University (Osaka, Japan). C57BL/6 wild type, B6.IL-1R -/, B6.IL6 -/, B6.CCR2 -/, BXSB.Yaa males and BXSB female controls, wild-type BALB/cJ and BALB/c.IFN-/mice were purchased from Jackson Laboratories (Bar Harbor, ME). B6.FVB-Tg .Itgax-DTR/EGFP.57 Lan/J backcrossed to a BALB/c background, referred to as CD11c-DTR (diphtheria toxin receptor) mice (99, 100), were a gift from L.Moldawer (UF). CD11c-DTR mice were maintained as heterozygote crosses and littermates not expressing the transgene were used as controls. BXSB X B6 F1 mice were generated by breeding BXSB males with C57BL/6 females. FcRI/III -/mice were purchased from Taconic (Hudson, NY). 129Sv/Ev Type I interferon receptor -chain deficient (IFNAR -/) mice and wild type controls (129Sv/Ev) were purchased from B&K Universal Limited (Grimston, Aldbrough, England). These mice were all housed in a specific pathogen-free (SPF) facility at Malcolm Randall VA Medical Center (Gainesville, FL). MyD88 -/, TRIF -/, TLR7 -/, TLR9 -/, IFNAR -/mice (backcrossed >7 generations to the C57BL/6 background) and IPS-1 -/, TNF -/, TNF -/TBK1 -/(on a mixed 129Sv/ B6 background) have all been described previously (52, 54, 56, 69, 101, 102) and were bred and maintained in a SPF facility in the Research Institute for Microbial Diseases, Osaka University. Wild-type C57BL/6 and heterozygous littermates were used as controls. BALB/c.TLR7 -/and TLR9 -/mice (backcrossed >8 generations to the BALB/c background) and wild-type BALB/c mice used for long-terms studies of autoantibody production from acquired from Oriental Bioservices (Kyoto, Japan) and housed in an SPF facility at Osaka University. 34

PAGE 35

Treatment and Tissue Harvest Eight to sixteen week-old mice received a single intraperitoneal (i.p.) injection of 0.5 ml TMPD (Sigma-Aldrich, St. Louis, MO), mineral oil (Harris Teeter, Mathews, NC), 4% thioglycollate (BD Bioscience, San Jose, CA ), squalene (Sigma), n-hexadecane (Sigma), or PBS. For short-term experiments, blood samples were obtained before, and weekly after TMPD treatment by tail-vein bleed. Peritoneal cells were collected by lavage using 5 ml of DMEM supplemented with 10% fetal calf serum, 10 mM HEPES, glutamine, and penicillin/streptomycin (complete DMEM) and isolated for RNA extraction or flow cytometry analysis and lavage fluid was stored at -80C for ELISA. Spleen cells were collected by meshing the spleen against a 45M plastic strainer followed by red blood cell lysis before resuspension in complete DMEM. For long-term experiments, serum was collected monthly after treatment for 6-8 months. Kidneys were harvested and frozen immediate in OCT compound (TissueTek, Torrance, CA) for tissue section. Cecal ligation and puncture were performed as described (100, 103). Flow Cytometry and Cell Sorting The following conjugated antibodies were used: CD11b-phycoerythrin (PE), anti-CD11b-allophycocyanin (APC), anti-CD4-APC, anti-CD8-PE, anti-CD11c-PE, anti-CD11cfluorescein isothiocyanate (FITC), anti-B220-APC Cy7, anti-CD80-PE, anti-CD86-FITC, anti-I-A/I-E-PE, anti-Mac-3-FITC, anti-Ly6G-PE, anti-Sca-1-PE, anti-NK1.1-PE (all from BD Bioscience, San Jose, CA), anti-Ly6C-FITC, anti-Ly6C-biotin, avidin-APC (eBioscience, San Diego, CA), anti-F4/80-FITC, anti-Moma2-FITC (Serotec, Raleigh, NC), and anti-CD11b-Pacific blue (Caltag Laboratories, Burlingame, CA). Prior to surface staining, 10 5 peritoneal or ficoll gradient-isolated peripheral blood cells were incubated with anti-mouse CD16/32 (BD Bioscience) for 10 min. Cells were then stained with optimized amount of primary antibody or the appropriate isotype control for 10 min at room temperature before washing and resuspending in PBS 35

PAGE 36

supplemented with 0.1% NaN 3 and 1% bovine serum albumin. For intracellular staining, cells were permeabilized with Perm/Fix buffer (BD Bioscience) and incubated with antibodies against Mac-3 and Moma-2 in Perm/Wash buffer (BD Bioscience). Fifty thousand cells per sample were acquired by a CYAN cytometer (Dako, Fort Collins, CO) and analyzed with FCS Express 3 (De Novo Software, Ontario, Canada). For cell sorting, peritoneal cells from TMPD-treated mice (10 7 ) were stained with anti-Ly6G-PE, washed, and incubated with magnetic bead-conjugated anti-PE (Miltenyi Biotec, Auburn, CA). Granulocytes (>99% purity) were positively selected using MS columns while the negative fraction was stained with anti-CD11b-APC, washed, and incubated with magnetic bead-conjugated anti-APC (Miltenyi Biotec). Positive selection using MS columns yielded >85% Ly6C hi monocytes. The negative fraction consisted of lymphocytes and dendritic cells (DCs). Cell sorting using a FACS DIVA flow cytometer (BD Bioscience) yielded similar results with a higher purity of Ly6C hi monocytes (>95%). For morphological analysis, 3 X 10 4 sorted cells were cytospun onto glass slides and stained using the Hema3 kit (modified Wright stain; Fisher Scientific, Pittsburg, PA) Conventional and Real-Time Quantitative PCR Total RNA was extracted from 10 6 cells using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized using Superscript II First-Strand Synthesis Kit (Invitrogen). Real-time PCR was performed using the SYBR Green Core Reagent Kit (Applied Biosystems, Foster City, CA) with an Opticon II thermocycler (MJ Research, Waltham, MA). Amplification conditions were: 95C for 10 min, followed by 45 cycles of 94C for 15 s, 60C for 25 s, and 72C for 25 s. After the final extension (72C for 10 min), a melting-curve analysis was performed to ensure specificity of the products. IFN-I genes were amplified by conventional 36

PAGE 37

PCR using a PTC-100 programmable thermal controller (MJ Research). Amplification conditions were: 95C for 5 min, followed by 40 cycles of 94C for 30 s, 60C for 1 min, and 72C for 1 min. After a final extension (72C for 10 min), PCR products were analyzed by agarose gel electrophoresis. Sequences of all real-time and conventional PCR primers are provided in Table 2-1. Cytokine ELISA ELISAs for IL-6, IL-12, MCP-1, TNFand IFNin peritoneal lavage fluid and cell culture media were performed as using monoclonal antibody pairs (BD Bioscience). After incubation with biotinylated cytokine-specific antibodies, 100 l/well of 1:1000 streptavidin-alkaline phosphatase was added and the reaction was developed with p-nitrophenyl phosphate substrate (Sigma). Standard curves were generated using recombinant cytokines and cytokine concentrations were calculated using a four-parameter logistic equation (Softmax Pro 3.0). Monocyte and Dendritic Cell Depletion Depletion of peritoneal monocytes was performed by injecting 200 L of clodronate-containing liposomes (clo-lip) a gift from Roche Pharmaceuticals) i.p. in wild-type BALB/c mice treated with TMPD two weeks earlier. To trace monocyte subsets in vivo, PBS-containing liposomes were labeled with the fluorescent dye 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine perchlorate (DiD) as described (12, 13). To label Ly6Cmonocytes, 150 L of DiD-liposomes were injected i.v. into TMPD-treated mice. Clo-lip (200 l) was delivered i.v. 24 hr prior to the injection of DiD-liposomes for the labeling of Ly6C hi monocytes. Analysis was performed 24 hr after labeling. DC ablation was performed in TMPD-treated CD11c-DTR mice by injecting 4 ng/g body weight of diphtheria toxin (DT; Sigma) i.p. Mice were sacrificed for analysis 48 hr after clo-lip or DT administration. 37

PAGE 38

Autoantibody Measurement Antinuclear antibodies were measured by indirect immunofluorescence using HEp-2 cells (INOVA, San Diego, CA). Sera were diluted 1:40 and titers were determined using an Image Titer titration emulation system (Rhigene, Inc., Des Plaines, IL). Anti-nRNP/Sm antigen capture ELISA was performed by coating microtiter plates (Nunc) overnight with 50 1 of human anti-nRNP IgG (20 pg/ml). Half of the wells were incubated for 1 h with 50 1 of K562 cell lysate and the other half with NET/NP40 alone. After washing, 100 1 of diluted mouse serum (l:250) were added to wells coated with either K562 cell lysate or buffer alone, incubated for 1 h, washed three times, followed by 1 h incubation with alkaline phosphatase-conjugated goat anti-mouse IgG antibodies (Southern Biotechnology). OD reading at 405 nm was converted to units based on a standard curve generated by known concentrations of anti-RNP antibodies (clone 2.73). Specific binding was determined by subtracting the value of the control wells (coated with antibodies but no antigen) from the value of the antigen-coated wells. To measure anti-dsDNA autoantibodies, ELISA plates were coated with calf thymus DNA (60g) resuspended in Reacti-bind DNA binding buffer (Pierce). Anti-ssDNA autoantibodies were measured similarly except calf thymus DNA was denatured (95 C x 5 min) and incubated on ice for 5 min prior to resuspension in Reacti-bind buffer. After overnight incubation, plates were blocked with NET/NP40 + 0.5% BSA for 1 h, followed by the addition of 100 1 of diluted mouse serum (l:250) to each well. Subsequent steps were performed as described above for Anti-nRNP/Sm ELISA. In Vitro Stimulation Whole PECs or sorted populations were resuspended in complete DMEM (containing 10% FCS, 10 mmol/L HEPES, glutamine, and penicillin/streptomycin plus 10 U/ml heparin) were 38

PAGE 39

seeded on 96 well cell-culture plates (5 X 10 4 cells/well). Cells were stimulated with the indicated doses of peptidoglycan, poly I:C, R848, CpG ODN2395 (Invivogen, San Diego, CA ), or LPS (from Salmonella typhimurium; Sigma) and incubated at 37 C in a 5% CO 2 atmosphere for 24 h before collecting the supernatant. Cell Culture with TMPD One mL of TMPD, mineral oil, or squalene was added to 9 mL of fetal bovine serum in a 15 mL polypropylene tube and rotated for 48 h at 4C. The surface layer of unincorporated hydrocarbon oil was removed by aspiration at the end of the incubation. The amount of TMPD incorporated using this method was approximately 1 g/mL as determined by gas chromatography / mass spectroscopy (not shown; Analytical Toxicology Core, University of Florida). J774 cells or BMDM were seeded on 24-well plates (5 X 10 5 cells/well) and cultured overnight in complete DMEM containing 10% FCS with or without hydrocarbon oils. For subsequent stimulation, cells were washed with PBS and fresh complete medium was added prior to the addition of TLR ligands. Incorporation of TMPD in DMSO and -cyclodextrin (Sigma) has been described previously (104). TMPD (10% v/v) also was added to ethanol or mannide monooleate (Sigma; 5% in PBS). Solvent alone was used as a control and a range of TMPD concentrations (3 300 M) was tested. Endocytosis and Phagocytosis Assays Endocytosis was quantified by uptake of FITC-dextran (5 g/mL; Sigma) and phagocytosis by internalization of FITC-labeled microbeads (10:1 beads:cells ratio; Invitrogen) or DiD-labeled apoptotic BW5147 cells (10:1 apoptotic cell : target cell ratio) following overnight incubation of J774 cells in complete medium with or without TMPD. Apoptosis of BW5147 cells was induced by heat-shock at 45 C for 10 min. Following 4 h incubation at 37 39

PAGE 40

C, apoptotic cells (>80% annexin V positive) were labeled with the fluorescent dye DiD (tetramethylindodicarbocyanine perchlorate; Invitrogen). J774 Cells were washed and incubated (in PBS + 0.5% BSA) with the fluorescent substrates for 30 min at 37 C, washed 3 times, and analyzed by flow cytometry. Statistical Analysis For quantitative variables, differences between groups were analyzed by the unpaired Students t-test. Survival curves were analyzed using the log-rank test. ANA titers and autoantibody levels were compared using Mann-Whitney U test. Data are presented as mean s.d. All tests were two-sided and a p-value less than 0.05 was considered significant. Statistical analyses were performed using Prism 4.0 (GraphPad Software, San Diego, CA). 40

PAGE 41

Table 2-1. Conventional and real-time PCR primers Gene Forward Reverse Mx-1 GATCCGACTTCACTTCCAGATGG CATCTCAGTGGTAGTCAACCC CCL2 AGGTCCCTGTCATGCTTCTG GGATCATCTTGCTGGTGAAT IP-10 CCTGCAGGATGATGGTCAAG GAATTCTTGCTTCGGCAGTT IFN-* ATGGCTAGRCTCTGTGCTTTCCT AGGGCTCTCCAGAYTTCTGCTCTG IFN-5* TGTGACCTTCTTCAGACTC CTCCTCCTTGCTCAATC IFN-* AGCTCCAAGAAAGGACGAACAT ATTCTTGCTTCGGCAGTTAC iNOS ATCGACCCGTCCACAGTATG GATGGACCCCAAGCAAGACT ILp GAGTGGACTGGACTCCCGA CAAGTTCTTGGGCGGGTCTG -actin CCCACACTGTGCCCATCTAC CGCTCGGTCAGGATCTTCAT IRF-7 TGCTGTTTGGAGACTGGCTAT TCCAAGCTCCCGGCTAAGT CCR2 CTGCCTGCAAAGACCAGAAG TATGCCGTGGATGAACTGAG TLR3 TCCGCCCTCTTCGTAACT TG TTGGCGGCTGGTAATCTTCT TLR4 GAGGCAGCAGGTGGAATT GT TGCTCAGGATTCGAGGCTTT TLR7 GGCTGAACCATCTGGAAGAA TAAGCTGGATGGCAGATCCT TLR9 TGCTTTGGCCTTTCACTCTT AACTGCGCTCTGTGCCTTAT CCL7 GATCTCTGCCACGCTTCTGT ATAGCCTCCTCGACCCACTT CCL12 GTCCTCAGGTATTGGCTGGA CACTGGCTGCTTGTGATTCT CX3CL1 CGCGTTCTTCCATTTGTGTA AGCTGATAGCGGATGAGCAA CXCL1 GCTGGGATTCACCTCAAGAA TCTCCGTTACTTGGGGACAC CXCL5 CCCCTTCCTCAGTCATAGCC TGCATTCCGCTTAGCTTTCT Arg-1 GCACTGAGGAAAGCTGGTCT GACCGTGGGTTCTTCACAAT 18S RNA CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT primers designed for conventional PCR. 41

PAGE 42

CHAPTER 3 NOVEL TYPE-I INTERFEREON-PRODUCING CELLS IN TMPD-INDUCED LUPUS Introduction Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder affecting multiple organs including the skin, joints, kidneys, lungs, heart and the nervous system (1). Antinuclear antibodies against small ribonucleoproteins (snRNPs) and double-stranded (ds) DNA are pathognomonic of the disease (1). Recent evidence suggests that type-I interferons (IFN-I), a family of anti-viral cytokines, are integral to the pathogenesis of SLE. More than half of SLE patients display upregulation of a group of IFN-I-stimulated genes (ISGs) (31-33). This interferon signature is clinically relevant as it correlates with active disease, presence of certain autoantibodies, and an increased incidence of renal involvement (33, 76). Supporting a causal role of IFN-I, therapeutic use of recombinant IFNis linked to a wide array of autoimmune manifestations and there are reports of SLE following treatment (72). Although an association between elevated IFN-I levels and SLE is well established, its origin is unclear. Experimental lupus induced by 2, 6, 10, 14-tetramethylpentadecane (TMPD) displays key immunological and clinical features of human SLE, including the production of autoantibodies against dsDNA and snRNPs, and the development of immune complex-mediated glomerulonephritis and arthritis (96). We recently reported that TMPD-induced lupus is associated with excess IFN-I production and upregulation of ISGs (103). This is at present the only murine model reported to have the interferon signature. IFN-I signaling is critically required in this model as shown by the absence of lupus autoantibodies and kidney disease in IFN-I receptor deficient mice (93). The source of the excess IFN-I, however, has not been examined. In this study, we aimed to identify and characterize the cell population(s) responsible for increased IFN-I production in TMPD-induced lupus. 42

PAGE 43

Materials and Methods Mice Wild-type BALB/cJ, and B6.FVB-Tg .Itgax-DTR/EGFP.57 Lan/J backcrossed to a BALB/c background, referred to as CD11c-DTR (diphtheria toxin receptor) mice (99, 100), were purchased from Jackson Laboratories (Bar Harbor, ME) and housed in a conventional facility. CD11c-DTR mice were maintained as heterozygote crosses and littermates not expressing the transgene were used as controls. 129Sv/Ev Type I interferon receptor -chain deficient mice (IFNAR -/) and wild type controls (129Sv/Ev; IFNAR +/+ ) were purchased from B&K Universal Limited (Grimston, Aldbrough, England). Eight-week-old mice received a single intraperitoneal (i.p.) injection of 0.5 ml TMPD (Sigma-Aldrich, St. Louis, MO), mineral oil (Harris Teeter, Mathews, NC), 4% thioglycollate (BD Bioscience, San Jose, CA ), squalene (Sigma), n-hexadecane (Sigma), or PBS. Peritoneal cell isolation, and cecal ligation and puncture were performed as described (100, 103). Quantitative Real-Time PCR Real-time PCR (RT-PCR) and conventional PCR were performed as described (103). Briefly, total RNA was extracted from 10 6 peritoneal cells using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized using Superscript II First-Strand Synthesis Kit (Invitrogen). RT-PCR was performed using the SYBR Green Core Reagent Kit (Applied Biosystems, Foster City, CA) with an Opticon II thermocycler (MJ Research, Waltham, MA). Amplification conditions were: 95C for 10 min, followed by 45 cycles of 94C for 15 s, 60C for 25 s, and 72C for 25 s. After the final extension (72C for 10 min), a melting-curve analysis was performed to ensure specificity of the products. IFN-I genes were amplified by conventional PCR using a PTC-100 programmable thermal controller (MJ Research). Amplification conditions were: 95C for 5 min, followed by 40 cycles of 94C for 30 s, 60C for 43

PAGE 44

1 min, and 72C for 1 min. After a final extension (72C for 10 min), PCR products were analyzed by agarose gel electrophoresis. Flow Cytometry All antibodies were purchased from BD Bioscience with the exceptions of anti-Ly6C-FITC, anti-Ly6C-biotin, avidin-APC (eBioscience, San Diego, CA), anti-F4/80-FITC, anti-Moma2-FITC (Serotec, Raleigh, NC), and anti-CD11b-Pacific blue (Caltag Laboratories, Burlingame, CA). Cell staining was performed as described (103). Propidium iodide (Invitrogen) staining was performed following manufacturers protocol. Fifty thousand events per sample were acquired by a CYAN ADP flow cytometer (Dako, Fort Collins, CO) and analyzed with FCS Express 3 (De Novo Software, Ontario, Canada). Cell Sorting Peritoneal cells from TMPD-treated mice (10 7 ) were stained with anti-Ly6G-PE, washed, and incubated with magnetic bead-conjugated anti-PE (Miltenyi Biotec, Auburn, CA). Granulocytes (>99% purity) were positively selected using MS columns while the negative fraction was stained with anti-CD11b-APC, washed, and incubated with magnetic bead-conjugated anti-APC (Miltenyi Biotec). Positive selection using MS columns yielded >85% Ly6C hi monocytes. The negative fraction consisted of lymphocytes and dendritic cells (DCs). Cell sorting using a FACS DIVA flow cytometer (BD Bioscience) yielded similar results with a higher purity of Ly6C hi monocytes (>95%). For morphological analysis, 3 X 10 4 sorted cells were cytospun onto glass slides and stained using the Hema3 kit (modified Wright stain; Fisher Scientific, Pittsburg, PA). Monocyte Labeling and Depletion Clodronate (a gift from Roche Diagnostics) liposomes (Clo-lip) and 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine perchlorate (DiD)-liposomes were produced as 44

PAGE 45

described (105, 106). To label Ly6C monocytes, 150 L of DiD-liposomes were injected i.v. into TMPD-treated mice. Clo-lip (200 l) was delivered i.v. 24 hr prior to the injection of DiD-liposomes for the labeling of Ly6C hi monocytes. Analysis was performed 24 hr after labeling. To deplete peritoneal monocytes, 200 L of clodronate-containing liposomes were injected i.p. in wild-type BALB/c mice treated with TMPD two weeks earlier. Dendritic Cell Depletion DC ablation was performed in TMPD-treated CD11c-DTR mice by injecting 4 ng/g body weight of diphtheria toxin (DT; Sigma) i.p. Mice were sacrificed for analysis 48 hr after clo-lip or DT administration. Statistical Analysis For quantitative variables, differences between groups were analyzed by the Students unpaired t-test. Bivariate correlations were assessed using Spearmans correlation coefficient. Data were presented as mean s.d. All tests were two-sided and a p-value less than 0.05 was considered statistically significant. Statistical analyses were performed using GraphPad Prism 4.0 (GraphPad Software, San Diego, CA). Results The Interferon Signature Precedes Lupus Disease Onset Although the link between SLE and IFN-I is firmly established, it remains unclear whether the interferon signature precedes disease manifestations. In the TMPD model of SLE, production of lupus autoantibodies (anti-Sm, -nRNP and -dsDNA) and development of immune-complex-mediated glomerulonephritis occur approximately four to six months after peritoneal exposure to the hydrocarbon oil (96). Upregulation of IFNand IFN-, on the other hand, was observed in peritoneal exudate cells (PECs) within two weeks of TMPD treatment (Figure 3-1A). 45

PAGE 46

Although consensus PCR primers can amplify most IFNsubtypes, quantification of ISG expression allows assessment of total IFN-I proteins, since all IFN-I subtypes bind to single receptor complex to activate ISG expression. Accordingly, a panel of ISGs including myxoma resistance protein-1 (Mx-1), macrophage chemoattractant protein-1 (MCP-1/CCL2), and IP-10/CXCL10 were also highly upregulated (Figure 3-1B) two weeks after TMPD treatment. In contrast, ISG expression was only modestly increased in mice treated with mineral oil, a control hydrocarbon oil that triggers chronic inflammation without features of lupus. Supporting the gene expression data, elevated levels of IFNand MCP-1 protein along with the inflammatory cytokines tumor necrosis factor(TNF-) and interleukin (IL)-12 were demonstrated in peritoneal lavage fluid of TMPD-treated mice (not shown). Thus, the interferon signature induced by TMPD was established within 2 weeks of treatment, long before the appearance of lupus autoantibodies and kidney pathology. Accumulation of Ly6C hi Monocytes Induced by TMPD Treatment To identify the source of IFN-I production, we analyzed different cell populations in the peritoneal exudate two weeks following TMPD treatment. More than 80% of the cells in the inflammatory exudate were CD11b + (not shown). Since CD11b is expressed by monocytes/macrophages, granulocytes and peritoneal B1 cells, we utilized the marker Ly6C to distinguish these populations (107, 108). In untreated or PBS-treated animals, resting peritoneal cells predominantly consisted of macrophages (CD11b hi Ly6C ) and B1 cells (CD11b mid Ly6C ; Figure 3-1C). As described previously (107), peritoneal macrophages expressed the F4/80 antigen while B1 cells were positive for the B cell markers B220 and CD5 (not shown). Interestingly, both resting cell types were depleted two weeks following TMPD treatment while two distinct populations emerged: CD11b + Ly6C hi cells (R1), consistent with the phenotype of immature monocytes (108), and CD11b + Ly6C mid cells (R2) characteristic of granulocytes 46

PAGE 47

(Figure 3-1C, D). The latter (R2) also expressed the neutrophil marker Ly6G (not shown). These populations each represented ~ 30% of cells in the peritoneal inflammatory infiltrate. Morphology of the monocyte and granulocyte populations was consistent with their surface marker profile (Figure 3-1E). These findings were consistent in other wild-type strains (C57/BL6 and BALB/c), except that these strains showed a greater influx of granulocytes (not shown). Treatment with mineral oil, which does not induce the interferon signature, resulted in similar accumulation of granulocytes, but few Ly6C hi monocytes were present (Figure 3-1C, D). Instead, mature monocytes resembling resting peritoneal macrophages were found (R3, Figure 3-1C, D). Compared to the Ly6C hi monocytes, these cells were larger, more vacuolated, and displayed rounded nuclei, suggestive of a more differentiated phenotype (Figure 3-1E). The accumulation of Ly6C hi monocytes was specific to TMPD treatment as this pattern was not seen in sterile peritonitis induced by thioglycollate or septic peritonitis induced by cecal ligation and puncture (CLP; Figure 3-1C). Flow cytometry analysis of Ly6C hi monocytes from TMPD-treated animals demonstrated intense expression of the myeloid markers Mac-3 and Moma-2 (Figure 3-1F). Supporting their immature phenotype, only a small fraction of Ly6C hi monocytes expressed the macrophage marker F4/80, major histocompatibility complex (MHC) class II (I-A), and the costimulatory molecules CD80 and CD86 (Figure 3-1F). This was in sharp contrast to mature peritoneal macrophages, which expressed these markers at high levels (not shown). Ly6C hi monocytes also lacked markers of dendritic cells (CD11c and CD205), B cells (B220 and CD19), T cells (CD3), granulocytes (Ly6G) or NK cells (Pan-NK; Figure 3-1F and not shown). The absence of B220 and CD11c expression distinguishes these cells from the previously described natural interferon-producing cells, which also express Ly6C, albeit at much lower 47

PAGE 48

levels compared to Ly6C hi monocytes (64, 109). Curiously, these monocytes exhibited strong expression of Sca-1 (Ly6A/E; Figure 3-1F), a marker normally found on hematopoietic stem cells and certain T-cell subsets (110). While the accumulation of Ly6C hi monocytes was evident after two weeks, these cells appeared in the peritoneal cavity as early as one day after TMPD treatment (Figure 3-1G). However, this observation was not limited to TMPD as a similar pattern of acute peritoneal inflammation was elicited by mineral oil (Figure 3-1G). But the appearance of Ly6C hi monocytes in response to mineral oil was transient compared to TMPD. Only a small population of Ly6C hi monocytes was found in the peritoneal cavity two weeks after mineral oil treatment whereas the response was maintained for several months with TMPD treatment (Figure 3-1C and not shown). To investigate the source of the accumulating Ly6C hi monocytes, we first performed a cell cycle analysis to determine whether these cells were proliferating in the peritoneal cavity. Propidium iodide staining revealed that virtually all Ly6C hi monocytes in the peritoneal exudate elicited by TMPD were in G1 phase (Figure 3-2A), indicating that extramedullary myelopoiesis at the site of inflammation is not a likely explanation for the monocyte accumulation. Recent studies have demonstrated that Ly6C hi monocytes egress from the bone marrow and that expression of Ly6C diminishes as they mature in the circulation (105). We therefore examined whether TMPD treatment alters the maturation profile of peripheral blood monocytes. In untreated animals, mature circulating monocytes (Ly6C ) outnumbered their immature Ly6C hi counterparts by about 2:1 (Figure 3-2B). Two weeks after TMPD treatment, the frequency of Ly6C hi monocytes in the peripheral blood doubled while the Ly6C subset remained constant (Figure 3-2B). 48

PAGE 49

To demonstrate the migration of Ly6C hi monocytes into the peritoneal cavity following TMPD injection, we selectively labeled monocyte subsets in vivo. As described previously (105), intravenous injection of liposomes containing the fluorescent dye DiD labeled strictly Ly6C monocytes in the circulation (Figure 3-2C left). Consistent with the paucity of Ly6C monocytes in the response to TMPD, DiD + cells were not recovered from the peritoneal cavity. Using clodronate-containing liposomes first to deplete mature monocytes (105), circulating Ly6C hi monocytes were specifically labeled by the subsequent administration of DiD-liposomes (Figure 3-2C right). After 24 hours, more than one-third of Ly6C hi monocytes in the peritoneal cavity were DiD + indicating that TMPD treatment induces rapid and specific recruitment of this monocyte subset. Taken together, the data suggest that TMPD treatment results in the export of Ly6C hi monocytes from the bone marrow into the circulation and followed by their specific recruitment and accumulation in the peritoneal cavity. Immature Ly6C hi Monocytes are a Major Source of IFN-I Production Using magnetic bead sorting, we separated PECs from TMPD-treated mice into Ly6C hi monocytes, Ly6G + granulocytes, and a negative fraction consisting of lymphocytes and dendritic cells. Although the Ly6C hi monocyte fraction contained a small percentage of contaminating Ly6G + granulocytes, DCs were found only in the negative fraction (not shown). PCR analysis revealed that Ly6C hi monocytes were the predominant source of IFNand IFNexpression (Figure 3-3A). IFN-I transcripts also were detected in other populations, albeit at significantly lower levels (Figure 3-3A). Ly6C hi monocytes expressed high levels of the interferon-stimulated chemokine MCP-1 and moderate levels of TNFand IL-12 (Figure 3-3B) as well. Granulocytes accounted for the remaining TNFtranscripts and the majority of inducible nitric oxide synthase (iNOS) expression. Not surprisingly, IL-12 transcripts were found predominantly in cells of the negative fraction as this cytokine was most likely derived from DCs (Figure 3-3B). 49

PAGE 50

Similar results were obtained when this experiment was repeated using flow cytometric cell sorting to increase the purity of sorted populations (not shown). To confirm that Ly6C hi monocytes were major producers of IFN-I, we asked whether their depletion abolishes the interferon signature. Treatment with clodronate-containing liposomes (clo-lip) effectively eliminates monocytes in vivo (106). Indeed, a single dose of clo-lip i.p. was sufficient to eliminate about 80% of peritoneal Ly6C hi monocytes in mice pretreated with TMPD (Figure 3-3C). There were also slight reductions in the number of DCs and lymphocytes (not shown) whereas the number of CD11b + Ly6C mid Ly6G + granulocytes was unaffected by clo-lip treatment. Concomitant with the depletion of Ly6C hi monocytes, the expression of IFN-, IFN-, and ISGs was drastically reduced (Figure 3-3D, E). Similarly, the expression of TNF-, which was highly expressed by Ly6C hi monocytes, also diminished upon their depletion. The expression of IL-12, which was expressed mainly by the negative cell fraction comprised of lymphocytes and DCs, did not change significantly after clo-lip treatment (Figure 3-3E). The effect of clo-lip was transient as the number of Ly6C hi monocytes and the expression of ISGs returned to pre-treatment levels after four days (not shown). Induction of IFN-I by TMPD is not Dependent on DCs Plasmacytoid DCs are capable of secreting large amounts of IFN-I during viral infection and are thought to be primary interferon producers in SLE (64, 84). In the peritoneal cavity of TMPD-treated animals, CD11c + I-A + DCs comprised of ~ 2% of the infiltrating inflammatory cells. Most peritoneal DCs expressed CD11b but not B220 (Figure 3-4A), consistent with the phenotype of myeloid DCs. However, PDCs may home to other secondary lymphoid tissue following activation (64, 109). To elucidate the extent to which DCs contribute to IFN-I 50

PAGE 51

production in the TMPD model, we utilized transgenic mice carrying the simian diphtheria toxin receptor under the control of the CD11c promoter (CD11c-DTR)(99). Injection of diphtheria toxin (DT) rapidly ablates both PDCs and MDCs systemically in CD11c-DTR mice whereas wild-type mice are unaffected by the toxin (99). Two days following DT injection, TMPD-treated CD11c-DTR mice showed >85% depletion of CD11c + I-A + DCs in the peritoneal exudate compared to wild-type controls (Figure 3-4B,C). In line with previous reports (100, 111), DC depletion was systemic as splenic MDCs and PDCs were also depleted by 70-80% (Figure 3-4B,C). In contrast, there was no significant difference in the peritoneal accumulation of Ly6C hi monocytes, granulocytes, and lymphocytes (Figure 3-4C and not shown). Both CD11c hi CD11b + I-A + MDCs and CD11c + B220 + PDCA-1 + PDCs were depleted to a similar degree in the spleen (Figure 3-4D) and lymph nodes (not shown). Systemic depletion of DCs did not affect TMPD-induced IFN-I production as the expression of IFN-I and ISGs were unaffected in CD11c-DTR animals (Figure 3-4E,F). The expression of TNFand iNOS was also unchanged (not shown). In contrast, IL-12 expression was drastically reduced in the absence of DCs (Figure 3-4F), consistent with the cell sorting experiment (Figure 3-3E). Taken together, the data indicate that DCs were the primary source of IL-12 but not IFN-I. We also tried to deplete PDCs using the recently described PDC-specific antibody 120G8 (112). Treatment with 120G8 i.p. resulted in ~70% depletion of splenic PDCs after 24 hr, comparable to the levels seen in CD11c-DTR mice. However, peritoneal Ly6C hi monocytes and T lymphocytes were also reduced by >50% (not shown). While the antigen bound by 120G8 and PDCA-1 is normally expressed on PDCs, its expression can be induced by IFN-I in other cell types (112, 113). Indeed, elevated IFN-I production in TMPD mice is associated with the 51

PAGE 52

expression of this PDC antigen on Ly6C hi monocytes, granulocytes and T lymphocytes (not shown), making selective antibody-mediated depletion of PDCs unfeasible in this model. Accumulation of Ly6C hi Monocytes is Associated with Autoantibody Production Expression of ISGs is associated with autoantibodies against Sm/RNP in SLE patients (33, 76). In the TMPD model, 60-70% of treated BALB/c mice exhibit anti-Sm/RNP antibodies after 4-6 months vs. 0% of IFN-I receptor deficient mice (93). These autoantibodies either appear less frequently or are completely absent in mice treated with other adjuvant oils such as n-hexadecane, squalene, or mineral oil (114). Interestingly, treatment with n-hexadecane (which induces anti-Sm/RNP in about 25% of treated animals) elicited the accumulation of Ly6C hi monocytes, albeit the response was milder than with TMPD, whereas squalene (which induces a weak anti-Sm/RNP response in <10% of treated animals) recruited mostly mature monocytes/macrophages and few Ly6C hi monocytes, resembling the pattern seen with MO (Figure 3-5A). Since Ly6C hi monocytes were the major source of IFN-I in TMPD-treated mice, we examined whether the frequency of anti-Sm/RNP autoantibodies correlates with the number of these cells. Indeed, the adjuvant oils ability to elicit anti-Sm/RNP antibodies was highly correlated (r 2 =0.98) with the accumulation of Ly6C hi monocytes (Figure 3-5B, upper panel). Numbers of Ly6C hi monocytes also correlated with ISG expression (Figure 3-5B, lower panel), supporting our finding that these cells are major IFN-I producers. In contrast, the recruitment of granulocytes was similar among all treatment groups and more DCs were present in the PECs following MO or squalene treatment than TMPD (not shown). Surface Expression of Ly6C on Monocytes is not IFN-I-Dependent Since Ly6C is an interferon-inducible gene (115), it is possible that IFN-I production triggered by TMPD treatment contributes to the Ly6C hi monocyte phenotype. To address this issue, we analyzed monocyte subsets in IFN-I receptor-deficient (IFNAR -/) mice. Compared to 52

PAGE 53

wild type controls, untreated IFNAR -/mice showed similar levels of Ly6C hi and Ly6C monocytes in the circulation, accounting for approximately 2 and 5% of PBMC, respectively (not shown). Two weeks following TMPD treatment, IFNAR -/mice also displayed increased numbers of circulating Ly6C hi monocytes, albeit the response was milder than that of wild type controls (Figure 3-6). Importantly, Ly6C hi and Ly6C monocytes, as well as the Ly6C mid granulocyte populations in the peripheral blood were clearly discernible even in the absence of IFN-I signaling. The number of bone marrow precursors of Ly6C hi monocytes was also comparable between wild-type and IFNAR -/mice (Figure 3-6). These data suggest that although IFN-I have been shown to induce Ly6C expression (115), the Ly6C hi phenotype of the immature monocyte population in nave or TMPD-treated mice was not dependent on IFN-I signaling. Discussion Elevated serum IFN-I was first associated with SLE over two decades ago (30). Recent studies using microarrays and RT-PCR further defined a panel of ISGs over-expressed in the peripheral blood of SLE patients (31-33). While this interferon signature has been linked to disease activity, kidney involvement, and autoantibody levels, the source of IFN-I responsible for the interferon signature remains a matter of speculation. This issue has been difficult to address using animal models as most of them do not exhibit upregulation of IFN-I. We recently reported that murine lupus induced by TMPD is associated with elevated IFN-I production and ISG expression (103). Disruption of IFN-I signaling completely abrogates the development of kidney disease and the onset of autoantibody production (93). In this study, we show that Ly6C hi monocytes are a major source of IFN-I in the TMPD model of lupus. Upregulation of IFN-I and ISGs occurred long before the clinical manifestations of lupus and coincided with an accumulation of Ly6C hi monocytes. These immature monocytes expressed 53

PAGE 54

large amounts of IFN-I and the interferon signature was rapidly abolished upon depletion of these cells by clo-lip. Moreover, the abundance of Ly6C hi monocytes was highly associated with the ability of various adjuvant oils to induce anti-Sm/RNP antibodies. In contrast, systemic depletion of DCs did not alter IFN-I production triggered by TMPD. While Ly6C hi monocytes were found in the inflammatory infiltrate one day after thioglycollate (105, 106) or mineral oil administration the response was transient as the number of these cells was drastically reduced after 72 hours. The recruitment and accumulation of Ly6C hi monocytes seen in TMPD-treated animals, on the other hand, persisted for as long as 4 months after treatment. A recent study shows that the egression of Ly6C hi monocytes from the bone marrow in response to Listeria monocytogenes infection is dependent on the interaction between the monocyte attractant CCL2/MCP-1 and its receptor CCR2 (116). Interestingly, as confirmed here, MCP-1 is an ISG that is induced by TMPD treatment, raising the possibility that the production of interferon-inducible chemokines may drive the recruitment of Ly6C hi monocytes. This is relevant to human SLE as elevated serum levels of MCP-1 have been associated with the interferon signature (32). How TMPD-treatment maintains the infiltrating monocytes in an immature state is unknown, but a defect intrinsic to the cells is unlikely as Ly6C hi monocytes spontaneously acquired a mature macrophage-like phenotype (Ly6C F4/80 + I-A + ) in vitro (not shown). The immaturity of Ly6C hi monocytes may be important to their ability to produce IFN-I as their mature counterparts elicited by mineral oil displayed significantly lower levels. Analogously, PDCs also are better equipped to secrete large amounts of IFN-I when immature (117). Prolonged elevation of IFN-I may promote DC maturation (74), T cell survival (47), isotype class-switching (49), and B cell maturation into plasma cells (48), culminating in the loss 54

PAGE 55

of tolerance and autoantibody production. It is noteworthy that while IFN-I is essential to TMPD-induced lupus (93), other factors such as IL-12 and IFNplay important roles since autoantibody production and kidney disease development are reduced in deficient mice (23, 24). Our findings challenge the conventional view that PDCs are solely responsible for the elevated IFN-I in SLE. In TMPD-treated mice, the vast majority of the increased IFN-I production is derived from the 20-30% of peritoneal cells that are Ly6C hi CD11b + B220 CD11c monocytes. Although, PDCs can synthesize up to 1000-fold more IFNthan most other cell types (65), the number of circulating PDCs is drastically reduced in SLE patients (33, 118). While it is plausible that PDCs home to tissues following activation, a view supported by the presence of these cells in lupus skin lesions (86), there is little direct evidence connecting tissue PDCs to the excess serum IFN-I seen in SLE patients. Indeed, as tissue (e.g. spleen) PDCs were greatly reduced by DT treatment of CD11c-DTR mice, despite little effect on ISG expression, it is unlikely that PDCs were the main source of IFN-I in TMPD-induced lupus. Also, the elevation of IFN-I in this model occurs within two weeks of treatment, long before the appearance of autoantibodies against dsDNA and snRNP and formation of immune complexes. The proposed mechanism of IFN-I induction in PDCs by endogenous nucleic acids present in immune complexes, therefore, is not a likely explanation of our findings (84). Nevertheless, PDCs may function to amplify IFN-I production once autoantibodies and immune complexes develop. MDCs also play a role in TMPD-induced lupus as they are the major source of IL-12, a cytokine critical for the development of kidney disease in this model (24). The role of DCs in human SLE is more difficult to assess as targeted DC therapy is not yet available. It is noteworthy that Ly6C hi monocytes also have been recently reported to play a role in atherosclerosis (119). Therefore, these monocyte-like interferon producing cells could play a role 55

PAGE 56

in the premature atherosclerosis seen in SLE patients. A CD14 hi CD16 monocyte subset (also called classical monocytes) is the equivalent of murine Ly6C hi monocytes in terms of migratory properties (108). Whether this or other monocyte subsets produce IFN-I in human SLE warrants detailed investigation. 56

PAGE 57

Figure 3-1. Elevated expression of IFN-I and accumulation of Ly6C hi monocytes after TMPD treatment. Comparisons of A) IFN-I expression (conventional PCR) and B) ISG expression (RT-PCR) in peritoneal cells two weeks after TMPD or MO treatment. C) Flow cytometry of peritoneal cells in wild-type 129Sv mice treated with PBS, TMPD (2 weeks), mineral oil (2 weeks), thioglycollate (3 days), and cecal-puncture ligation (3 days). Boxes indicate Ly6C hi immature monocytes (R1), CD11b + Ly6C mid granulocytes (R2), and Ly6C mature monocytes/macrophages (R3). D) Quantification and E) morphologic analysis of peritoneal cell populations. F) Flow cytometry of surface makers on Ly6C hi immature monocytes. G) Flow cytometry of peritoneal cells from wild-type 129Sv mice treated with TMPD or mineral oil for 1 day. Shaded region (panel F) represents isotype control staining and boxes indicate Ly6C hi immature monocytes. Each bar (panels B and D) represents the mean of 4 animals and error bars indicate standard deviation (s.d.). p < 0.05 (Students t-test). 57

PAGE 58

Figure 3-2. Direct recruitment of circulating Ly6C hi monocytes after TMPD treatment. A) Propidium idodide cell cycle analysis of peritoneal cells two weeks after TMPD treatment. B) Flow cytometry of Ly6C expression on peripheral blood monocytes (gated on CD11b + Ly6G cells) and quantification of peripheral blood Ly6C hi and Ly6C monocytes following TMPD treatment (n = 4 per group). C) Flow cytometry of peripheral blood and peritoneal monocytes (gated on CD11b + Ly6G cells) in TMPD-treated mice 24 hr after administration of DID-liposomes. Data are representative of 3 independent experiments. 58

PAGE 59

Figure 3-3. Immature Ly6C hi monocytes are major producers of IFN-I. Analysis of A) IFN-I expression (conventional PCR) and B) ISG expression (RT-PCR) in magnetic bead-sorted peritoneal Ly6C hi monocytes, granulocytes and the negative fraction (lymphocytes and DCs) from wild-type 129sv mice treated with TMPD (2 weeks). C) Flow cytometry of TMPD-elicited peritoneal cells 2 days following treatment with clodronate-containing liposomes (clo-lip). Box indicates Ly6C hi monocytes. D) IFN-I expression (conventional PCR) and E) ISG expression (RT-PCR) in peritoneal cells after clodronate-liposome or PBS treatment. Each bar represents the mean of 5 animals and error bars indicate s.d. p < 0.05 (Students t-test). 59

PAGE 60

Figure 3-4. Dendritic cells are not required for IFN-I production induced by TMPD. A) Flow cytometry of peritoneal DCs two weeks after TMPD treatment. Box indicate CD11c + I-A + DCs. B) Depletion in CD11c-DTR mice 2 days after diphtheria toxin (DT) injection. Box indicates CD11c + I-A + DCs. C) Quantification of peritoneal dendritic cells and Ly6C hi monocytes. D) Quantification of splenic DC depletion. MDCs were defined as CD11c hi I-A + CD11b + cells and PDCs were defined as CD11c + B220 + PDCA-1 + E) IFN-I expression (conventional PCR) and F) ISG expression (RT-PCR) in peritoneal exudates cells. Each bar represents the mean of 6 animals and error bars indicate s.d. p < 0.05 (Students t-test). 60

PAGE 61

Figure 3-5. Accumulation of Ly6C hi monocytes is correlated with the frequency of anti-Sm/RNP autoantibodies and upregulation of ISG expression. A) Flow cytometry of peritoneal cells in wild-type 129Sv mice treated with n-hexadecane (2 weeks) or squalene (2 weeks). Boxes indicate Ly6C hi immature monocytes. Correlation of the levels of Ly6C hi monocyte accumulation with B) the frequency of anti-Sm/RNP autoantibodies (6 months) and ISG expression (2 weeks) induced by TMPD, n-hexadecane (HEX), squalene (SQ), and mineral oil (MO) and PBS. Autoantibody frequencies represent the mean of >10 mice per group from previous studies. Percentage of Ly6C hi monocytes and ISG expression index represent the mean of 4 mice. Error bars indicate s.d. ISG expression index was calculated as follows: mean relative expression of (Mx-1 + MCP + IP-10)/3. 61

PAGE 62

Figure 3-6. Expression of Ly6C on immature monocytes is not dependent on IFN-I signaling. Flow cytometry analysis of monocyte subsets in the peripheral blood (upper) and bone marrow (lower) of wild-type 129sv and IFN-I receptor-deficient mice two weeks after TMPD-treatment. Boxes and ovals indicate peripheral blood Ly6C hi monocytes and bone marrow Ly6C hi monocyte precursors, respectively. 62

PAGE 63

CHAPTER 4 TOLL-LIKE RECEPTOR 7-DEPENDENT AND FCR-INDEPENDENT PRODUCTION OF TYPE-I INTERFERON IN TMPD-INDUCED LUPUS Introduction SLE is a chronic autoimmune disease characterized by the production of autoantibodies against double stranded (ds)-DNA and small nuclear ribonucleoproteins (snRNPs), including the Sm/RNP antigens, Ro/SS-A, and other antigens (1). Recent evidence strongly suggests that type-I interferons (IFN-I), a family of antiviral cytokines, are integral to the pathogenesis of SLE. Elevated serum levels of IFN-I and over-expression of interferon-stimulated genes (ISGs) in the peripheral blood of SLE patients have been demonstrated by several groups (31, 32, 76). This interferon signature is associated with active disease and autoantibodies against dsDNA and the Sm/RNP and Ro/SS-A antigens (33, 75). The etiology of excess IFN-I in SLE is incompletely understood. Research on innate immunity has led to the identification of several pathways mediating IFN-I production in mammalian cells. Toll-like receptor (TLR)3, a sensor for viral dsRNA, and TLR4, the receptor for lipopolysaccharide (LPS) both stimulate IFN-I secretion through TIR domain-containing adaptor inducing IFN(TRIF) (52). In contrast, TLR7/8 and TLR9 mediate IFN-I production via myeloid differentiation factor-88 (MyD88) in response to single-stranded(ss)-RNA and unmethylated CpG DNA, respectively (54, 55, 120). In addition, cytoplasmic receptors that recognize intracellular nucleic acids and induce IFN-I have been described recently. Retinoic acid inducible gene-I (RIG-I) and melanoma differentiation associated gene-5 (MDA-5) recognize cytoplasmic RNA and trigger IFN-I by activating interferonpromoter stimulator-1 (IPS-1, also known as MAVS, VISA and CARDIF) and IRF-3 (60, 61, 121). Cytoplasmic DNA binds to a cytoplasmic sensor and triggers IFN-I production via a pathway requiring TANK-binding kinase-1 (TBK-1) and IRF-3 (62, 122). 63

PAGE 64

Nucleic acids from dying cells may act as ligands for TLR7/8 and TLR9 to trigger IFN-I production in SLE. In plasmacytoid dendritic cells, immune complexes formed by autoantibodies to DNA and snRNPs help transport these endogenous ligands to endosomes containing TLR7, 8 and 9, resulting in IFN-I production (84). This hypothesis is supported by in vitro studies (77, 80). However, therapeutic administration of IFNcan directly trigger the production of anti-dsDNA antibodies (72) and in several murine lupus models, IFN-I production is required for the induction of autoantibodies (89, 90, 93), suggesting that IFN-I dysregulation may occur upstream of autoantibody development. Therefore, it remains controversial whether nucleic acid-containing immune complexes in SLE initiate IFN-I production or act to perpetuate a positive feedback loop of IFN-production initiated by another factor, such as a viral infection. Experimental lupus induced by TMPD (pristane) displays many key immunological and clinical features of human SLE, including the presence of the interferon signature and lupus autoantibodies such as anti-dsDNA, anti-Sm, and anti-RNP (96, 97, 103). Importantly, IFN-I play an essential role in this model as glomerulonephritis and autoantibody production (anti-Sm/RNP, -dsDNA, and -Su) are abolished in IFN-I receptor-deficient (IFNAR -/) mice (93). Unexpectedly, a population of Ly6C hi immature monocytes that accumulates in the peritoneal cavity after TMPD treatment, rather than dendritic cells, is the major source of IFN-I in this model (see chapter 3). The persistent influx of Ly6C hi monocytes and production of IFN-I occur within two weeks of TMPD treatment, long before the appearance of autoantibodies against snRNPs and dsDNA (3-5 months), suggesting that the initial wave of IFN-I production is independent of RNA-containing immune complexes. In this study, we aimed to elucidate the mechanism of IFN-I production in TMPD-induced lupus. 64

PAGE 65

Materials and Methods Mice MyD88 -/, TRIF -/, TLR7 -/, TLR9 -/, IFNAR -/mice (backcrossed >7 generations to the C57BL/6 background) and IPS-1 -/, TNF -/, TNF -/TBK1 -/(on a mixed 129Sv/ B6 background) have all been described previously (52, 54, 56, 69, 101, 102). Wild-type C57BL/6 and heterozygous littermates were used as controls. BALB/c.TLR7 -/(backcrossed >8 generations to the BALB/c background) and wild-type BALB/c mice were used for long-terms studies of autoantibody production. Animals were bred and maintained in a specific pathogen-free facility of the Research Institute for Microbial Diseases, Osaka University. C57BL/6 wild type and FcRI/III -/mice (Taconic, Hudson, NY) and BXSB mice (Jackson Laboratories, Bar Harbor, ME) were maintained in a specific pathogen-free facility at the University of Florida. BXSB X B6 F1 mice were generated by breeding BXSB males with C57BL/6 females. The mixed background of several strains used in this study did not alter the response to TMPD as measured by the expression of ISGs and peritoneal cell influx (data not shown). Twelve to sixteen-week old animals received a single intraperitoneal (i.p.) injection of 0.5 mL TMPD (Sigma-Aldrich, St. Louis, MO). Blood samples were obtained before, and weekly after TMPD treatment. Peritoneal cells, spleen, and blood were harvested two weeks after treatment. Monocyte depletion was performed by i.p. injection of clodronate-containing liposomes (200 L) as described (106). These studies were approved by the Institutional Animal Care and Use Committee. Real-Time Quantitative PCR RT-PCR was performed as described (103). Briefly, total RNA was extracted from 10 6 peritoneal cells using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized using Superscript II First-Strand Synthesis Kit (Invitrogen) following the manufacturers 65

PAGE 66

protocol. SYBR green RT-PCR analysis was performed using an Opticon II thermocycler (MJ Research, Waltham, MA). Amplification conditions were: 95C for 10 min, followed by 45 cycles of 94C for 15 s, 60C for 25 s, and 72C for 25 s. After the final extension (72C for 10 min), a melting-curve analysis was performed to ensure specificity of the products. Primers used in this study are listed in Table 2-1. The expression of Mx1, IRF7, 18s rRNA also were analyzed using Taqman primers and probes purchased from Applied Biosystems and the results were consistent with the SYBR green method (data not shown). Cytokine/chemokine PCR array (Superarray, Frederick, MD) analysis was performed using an ABI 7700 Sequence Detector (Applied Biosystems) following the manufacturers protocols. Flow Cytometry and Cell Sorting The following conjugated antibodies were used: anti-CD11b-phycoerythrin (PE), anti-CD8-allophycocyanin (APC), anti-CD4fluorescein isothiocyanate (FITC), anti-CD11c-PE, anti-B220-PerCPCy5.5, anti-Sca-1-PE, anti-CD64-PE, anti-CD32/16-PE(all from BD Bioscience), anti-Ly6C-FITC, anti-Ly6C-biotin, and avidin-APC (eBioscience, San Diego, CA). Prior to surface staining, peritoneal or peripheral blood cells were incubated with anti-mouse CD16/32 (Fc block; BD Bioscience) for 10 min. Cells were then stained with an optimized amount of primary antibody or the appropriate isotype control for 10 min at room temperature before washing and resuspending in PBS supplemented with 0.1% bovine serum albumin. Intracellular staining for TLR7 was performed as described (123) using rabbit anti-mouse TLR7 or rabbit IgG isotype control (EBioscience) and goat anti-rabbit IgG-FITC (Southern Biotechnology). Fifty thousand events per sample were acquired using a FacsCalibur (BD Bioscience) and analyzed with FCS Express 3 Software (De Novo Software, Ontario, Canada). Cell sorting was performed using a FACS DIVA flow cytometer (BD Bioscience). Peritoneal, 66

PAGE 67

splenic, and bone marrow Ly6C hi monocytes (CD11b + Ly6C hi ), peritoneal dendritic cells (CD11c + ) and granulocytes (CD11b + Ly6G + ) were sorted to >90% purity for cell culture or RNA isolation. In Vitro Stimulation Sorted cells resuspended in complete DMEM (containing 10% FCS, 10 mmol/L HEPES, glutamine, and penicillin/streptomycin plus 10 U/ml heparin) were seeded on 96 well cell-culture plates (5 X 10 4 cells/well). Cells were stimulated with the indicated doses of peptidoglycan, poly I:C, R848, CpG ODN2395 (Invivogen, San Diego, CA ), or LPS (from Salmonella typhimurium; Sigma) and incubated at 37 C in a 5% CO 2 atmosphere for 24 h before collecting the supernatant. MCP-1 and IL-6 ELISAs (BD Biosciences) were performed following manufacturers instructions. Optical density was converted to concentration using standard curves based on recombinant cytokines analyzed by a four-parameter logistic equation (Softmax Pro 3.1 software). Autoantibody Analysis Serum antinuclear antibodies in BALB/c.TLR7 -/and wild-type BALB/c mice were determined 12 and 24 wks after TMPD by indirect immunofluorescence using HEp-2 cells (INOVA, San Diego, CA). Sera were diluted 1:40 and titers were determined using an Image Titer titration emulation system (Rhigene, Inc., Des Plaines, IL). Immunoprecipitation and antigen-capture ELISA to detect serum autoantibodies against nRNP/Sm were performed as described (96, 124). Determination of anti-Su/ago2 by ELISA also has been described (125). Statistical Analysis For quantitative variables, differences between groups were analyzed by the unpaired Students t-test. Survival curves were analyzed using the log-rank test. ANA titers and autoantibody levels were compared using Mann-Whitney U test. Data are presented as mean 67

PAGE 68

s.d. All tests were two-sided and a p-value less than 0.05 was considered significant. Statistical analyses were performed using Prism 4.0 (GraphPad Software, San Diego, CA). Results Induction of IFN-I by TMPD Requires MyD88 To identify the mechanism of IFN-I induction by TMPD, we first analyzed the effect of TMPD on mice with deficiency of the adaptor molecules TRIF or MyD88. TRIF is required to trigger IFN-I production by TLR3 and TLR4 (52), whereas MyD88 mediates TLR7/8 and TLR9 signaling (54, 55, 120). Previously we have shown that within two weeks of TMPD treatment, an accumulation of IFN-I-producing CD11b + Ly6C hi monocytes can be detected in the peritoneal cavity in wild-type mice concurrent with increased IFN-I production and ISG expression (see Chapter 3). Compared with wild-type mice, the total number of peritoneal exudate cells (PECs) was significantly reduced in MyD88 -/mice after TMPD treatment (Figure 4-1A). Both Ly6C hi monocytes and granulocytes (defined as CD11b + Ly6G + Ly6C mid ) were decreased by >90% (Figure 4-1A,B). Importantly, IFN-I induction by TMPD was completely dependent on MyD88 as elevated expression of the ISGs myxoma response protein-1 (Mx1) and interferon regulatory factor-7 (IRF7) in PECs was abolished in MyD88 -/mice as also seen in IFNAR-deficient mice (Figure 4-1C). The levels of the interferon-inducible chemokine monocyte chemoattractant protein-1 (MCP-1/CCL2) in the peritoneal lavage fluid were also reduced in the absence of MyD88 (Figure 4-1D). In contrast, TRIF deficiency did not impact the accumulation of PEC populations or the increased expression of ISGs (Figure 4-1A-D). Although we were unable to detect significant changes in serum IFN-/ levels by ELISA, IFN-I secretion was required for the response to TMPD as the upregulation of ISGs and recruitment of Ly6C hi monocytes were 68

PAGE 69

abolished in IFNAR -/mice (Figure 4-1A-D). The absence of IFN-I signaling, however, did not affect the influx of granulocytes (Figure 4-1A,B). The increase in IFN-I following TMPD treatment is not limited to the peritoneal cavity as the interferon signature is also detectable in the peripheral blood (93). We found that surface expression of the interferon-inducible gene Sca-1 (Ly6A/E) on B cells was dramatically up-regulated in wild-type mice treated with TMPD (Figure 4-1E). Although Sca-1 is naturally expressed by certain lymphocyte subsets and hematopoietic stem cells (110), TMPD induced Sca-1 expression in virtually all B cells in wild-type, but not IFNAR -/mice (Figure 4-1E). Increased Sca-1 expression was also evident on CD8 + and CD4 + T cells (not shown). Similar to the pattern of ISG expression in PECs, upregulation of Sca-1 was reduced in MyD88 -/, but not TRIF -/mice (Figure 4-1E), further supporting an essential role of MyD88 in IFN-I production. To address whether cytoplasmic nucleic acid sensors also contribute to TMPD-induced IFN-I production, we tested the effect of TMPD on IPS-1 -/and TNF -/TBK1 -/mice [TBK-1 -/is embryonically lethal unless crossed onto a TNF-/background (69)]. IPS-1 is a required adaptor for intracellular viral RNA detection via RIG-I and MDA-5 (61), whereas TBK-1 is required for cytoplasmic DNA-induced IFN-I secretion (126). Expression of Mx1 and IRF7 in PECs was comparable in wild-type, IPS-1 -/, TNF -/TBK-1 -/, and TNF -/mice (Figure 4-2), suggesting that the intracellular nucleic acid-sensing pathways were not required for IFN-I production. The patterns of peritoneal cell influx and Sca-1 expression on peripheral blood lymphocytes were also similar among these strains (not shown). Taken together, our data indicate that TMPD-elicited IFN-I production was strictly MyD88-dependent. Induction of IFN-I by TMPD is TLR7-Dependent, Immune Complex-Independent Since MyD88 mediates IFN-I induction by TLR7 and TLR9, we next investigated which of these innate receptors is responsible for the effect of TMPD. Two weeks after TMPD 69

PAGE 70

treatment, the number of PECs in TLR9 -/mice was reduced by about 20% compared to TLR7 -/and wild-type controls. The numbers of Ly6C hi monocytes and granulocytes also were reduced in the absence of TLR9, although the pattern of the cellular influx remained similar to wild-type animals (Figure 4-3A, B). Interestingly, TLR7 -/mice exhibited a specific reduction of Ly6C hi monocytes in the peritoneal cavity (Figure 4-3A). Despite the decrease in these immature monocytes, total PEC counts in TLR7 -/mice were comparable to wild-type controls due to a significant increase in the number of granulocytes (Figure 4-3A, B). An accumulation of CD11b + Ly6C residential macrophages also was evident in the absence of TLR7 (Figure 4-3B). These patterns are strikingly similar to those observed in IFNAR -/mice (Figure 4-1A-D). Indeed, the increased Mx1 and IRF7 expression and MCP-1 production were abrogated in TLR7 -/mice (Figure 4-3C). Upregulation of Sca-1 expression on B cells also was reduced in these mice after TMPD treatment (Figure 4-3D), recapitulating the findings in MyD88 -/and IFNAR -/mice. On the contrary, ISG expression in PECs and surface expression of Sca-1 were similar in TLR9 -/mice compared with wild-type controls. These findings suggest that although TLR9 may contribute to the inflammatory response, IFN-I induction by TMPD was mediated primarily by TLR7. To further define the role of TLR7 in the inflammatory response to TMPD, we compared the expression of various cytokines and chemokines in wild-type and TLR7 -/animals using a PCR array. Following TMPD treatment, peritoneal cells from wild-type mice displayed dramatically higher expression of several interferon-stimulated chemokines including CCL2, CCL12, CCL7, and CXCL10 in comparison with TLR7 -/mice (Table 4-1). This pattern of chemoattractant production is similar to the chemokine signature recently described in SLE patients (127). These observations support the role of TLR7 as the primary mediator of IFN-I 70

PAGE 71

production in the TMPD lupus model. Interestingly, consistent with the increased number of peritoneal granulocytes in TMPD-treated TLR7 -/mice (Figure 4-3A), the neutrophil chemoattractant CXCL5 was upregulated in the absence of TLR7 whereas the expression of other inflammatory mediators was comparable between the groups (Table 4-1). Several studies have demonstrated that self-RNA present in immune complexes may act as an endogenous TLR7 ligand causing the production of IFN-I (77, 80). Fc-receptors (FcR) have been reported to play an essential role in this process by enhancing the internalization of immune complexes, allowing RNA to interact with TLR7 in endosomes (128). Deficiency of either TLR7 or FcR -chain, an integral component of FcRI and FcRIII, renders murine DCs unable to produce IFN-I in response to lupus immune complexes (129). Since TMPD induces IFN-I production long before the onset of lupus autoantibodies and immune complexes (see Chapter 3), we examined the potential role of FcR in the IFN-I response to TMPD. Surface expression of FcRI (CD64) and FcRII/III (CD32/CD16) in TMPD-induced PECs was prominent on Ly6C hi monocytes (Figure 4-4A). FcRs were also expressed by a fraction of granulocytes, whereas lymphocytes and DCs in the peritoneal cavity displayed little surface expression of these receptors (Figure 4-4A). We next analyzed the effects of TMPD on FcR -chain-deficient mice (FcR -/). The accumulation of Ly6C hi monocytes and upregulation of ISG expression were comparable in FcR -/and wild-type mice (Figure 4-4B,C). Elevated surface expression of Sca-1 on peripheral blood lymphocytes was also similar between the groups (not shown). Taken together, these findings suggest that TMPD elicits IFN-I production through a TLR7-dependent, but FcR-independent pathway. 71

PAGE 72

Immature Ly6C hi Monocytes Express High Levels of TLR7 Next we examined the distribution of TLR7 expression in the inflammatory infiltrate induced by TMPD. PECs from mice treated with TMPD two weeks earlier were sorted into four distinct populations based on surface marker phenotype: Ly6C hi monocytes (CD11b + Ly6C hi ; ~30% of PECs), granulocytes (CD11b + Ly6G + ; ~30%), DCs (CD11c + ; ~2%), and a negative fraction containing mainly B and T lymphocytes. As reported previously (see Chapter 3), the DC fraction consisted of >80% CD11b + myeloid DCs and few PDCs (CD11c + CD11b B220 + ) were present. Quantitative PCR revealed that Ly6C hi monocytes expressed higher levels of TLR7 than other peritoneal cell subsets (Figure 4-5A). Prominent expression of the chemokine receptor CCR2 is consistent with their immature monocytic phenotype as reported previously (108). In striking contrast, elevated expression of TLR7 was not a feature of Ly6C hi monocytes in the spleen or bone marrow. While TLR7 expression also was found on other PEC subsets, DCs displayed greater expression of TLR3 and TLR9 whereas TLR4 transcripts were predominantly found in granulocytes (Figure 4-5A). In line with these findings, when peritoneal Ly6C hi monocytes were depleted by i.p. injection of clodronate-containing liposomes (clo-lip), the expression of TLR7 by PECs was greatly reduced whereas the levels of TLR9 transcripts remained unaffected (Figure 4-5B). We further analyzed the response of Ly6C hi monocytes to various TLR ligands in vitro. Sorted Ly6C hi monocytes secreted large amounts of MCP-1 and IL-6 when co-cultured with the synthetic TLR7 ligand R848 (Figure 4-5C). They also responded to the TLR4 ligand LPS, albeit less strongly even at the highest dose of LPS tested (10 g/mL). Consistent with their low levels of TLR3 and TLR9 expression, Ly6C hi monocytes exhibited weak responses to poly I:C and CpG DNA (Figure 4-5C). In contrast, isolated granulocytes did not produce measurable 72

PAGE 73

amounts of MCP-1 or IL-6 in response to any TLR ligands used in this study (not shown). Hence, Ly6C hi monocytes recruited to the peritoneal cavity after TMPD treatment expressed high levels of TLR7 and actively responded to TLR7 ligands. The Y-linked Autoimmune Accelerating (Yaa) Locus Amplifies the Effects of TMPD The Yaa locus is essential for spontaneous development of autoantibodies and glomerulonephritis in the BXSB model of murine lupus (130). Yaa also accelerates disease onset in other lupus-prone strains (131, 132). TLR7 is among the 17 genes found in the Yaa locus (133, 134). Because TLR7 is normally located on the X chromosome, males possess one copy of the gene while a similar gene dosage is achieved females through X-inactivation. Male Yaa mice, however, have two functional copies of the gene (133, 134). A recent study showed that the TLR7 gene duplication alone was responsible for the autoimmune features associated with the Yaa mutation (135). Since TMPD induces IFN-I production via TLR7, we asked whether the effects of the adjuvant oil are more pronounced in the presence of the Yaa locus. Compared to female controls (designated TLR7 +/+ ), BXSB X B6 male mice carrying the Yaa mutation (TLR7 +/Yaa ) exhibited greater accumulation of Ly6C hi monocytes in the peritoneal cavity two weeks after TMPD treatment (Figure 4-6A). Importantly, increasing the gene dosage of TLR7 was associated with significantly higher production of IFN-I, assessed by measuring ISG expression (Figure 4-6B). In contrast, the IFN-I response to TMPD was similar between males and females in wild-type strains including C57BL/6, BALB/c, and 129Sv (not shown). We further examined the long term effect of TMPD treatment in the BXSB model. Consistent with previous studies (130), BXSB males died prematurely beginning at 5 months of age (Figure 4-6C). Mortality was significantly accelerated when a single dose of TMPD was administered i.p. at 8-10 weeks of age. Sixty percent of TMPD-treated animals succumbed by 5 73

PAGE 74

months of age, vs. 20% in the control group. Whereas 5/10 PBS-treated animals survived until 7 months, only 1/10 in the TMPD-treated group remained. Thus, not only was the induction of IFN-I accentuated by the Yaa mutation, TMPD treatment also hastened disease progression in the BXSB mice. Essential Role of TLR7 in the Development of Autoantibodies In MRL-lpr mice, TLR7 is required for the development of anti-Sm antibodies (136). To assess whether TLR7 also is involved in autoantibody production in the TMPD-lupus, we compared the long-term response to TMPD in wild-type BALB/c and BALB/c.TLR7 -/mice. No mortality was found in either group and only mild proteinuria was detected by 24 wks-post treatment (not shown). Comparable to previous observations (137), BALB/c mice displayed significant hypergammaglobulinemia 24 wks after TMPD treatment (Figure 4-7A). The increase in serum IgG was reduced by 50% in TLR7 -/mice while IgM levels were similar between groups. Consistent with the role of IFN-I in IgG2a isotype switching (48), IgG2a was profoundly reduced in TLR7 -/mice (Figure 4-7B). IgG1 and IgG2b levels also were reduced mildly in the absence of TLR7 whereas IgG3 increased slightly. As early as 12 wks after TMPD treatment, 8/12 wild-type mice developed serum antinuclear antibodies (ANA) and anti-nRNP/Sm autoantibodies (Figure 4-7C, D). In contrast, only one TLR7 -/mouse showed a low titer ANA and none developed autoantibodies to nRNP/Sm (Figure 4-7C, D). Similar to IFNAR-deficient animals (93), most TLR7 -/mice exhibited low levels of ANA of unknown specificity by 24 wks post-treatment but the titers were lower than BALB/c controls (Figure 4-7C). A single TLR7 -/animal with high titer ANA (1:1280) produced autoantibodies against DNA/chromatin (not shown). In contrast, autoantibodies against nRNP/Sm remained undetectable in all TLR7 -/mice (Figure 4-7D). We further confirmed the autoantibody profile by immunoprecipitation using nuclear extracts from 74

PAGE 75

35 S-labeled K562 cells. Consistent with the ELISA data, autoantibodies against various components of nRNP/Sm (A-G) were found in wild-type, but not TLR7 -/mice (Figure 4-7E). Immunoprecipitation studies also revealed that autoantibodies against the Su antigen, which develops in ~20 % of lupus patients (138) and ~50% of TMPD-treated BALB/c mice (138), were not induced in TLR7 -/mice (Figure 4-8A). Su antigen is an RNA-binding protein, also known as argonaute 2 (ago2), involved in the microRNA pathway (125, 139). ELISA using recombinant ago2 confirmed that the development of autoantibodies against Su/ago2 required TLR7 (Figure 4-8B), suggesting that the autoimmune response to microRNA-associated antigens also is mediated by TLR7. Thus, in addition to its role in mediating IFN-I production, TLR7 is essential for the generation autoantibodies against RNA-associated antigens (nRNP/Sm and Su/ago2) in TMPD-induced lupus. Discussion Recent studies strongly suggest a link between elevated IFN-I production and the pathogenesis of SLE. More than half of SLE patients display increased expression of ISGs, often in association with active disease and autoantibodies against snRNPs and DNA, as well as renal involvement and endothelial dysfunction (31-33, 75, 76, 140). However, the exact cause of IFN-I dysregulation in lupus remains controversial and it is unclear whether IFN-I overproduction promotes autoantibody production or vice versa. TMPD-induced lupus recapitulates many features of human SLE including glomerulonephritis, arthritis, and autoantibodies against dsDNA and snRNPs (96, 97). Like SLE, TMPD-lupus is more severe in females than males (141). We recently found that TMPD-treated mice exhibit the interferon signature and that their lupus is dependent on IFN-I signaling (93). Here, we show that TMPD triggers IFN-I production via the TLR7/MyD88 pathway. Our data also exclude a major role of other pathways of IFN-I production, including TLR9, 75

PAGE 76

TLR3/TLR4/TRIF, RIG-I/Mda5/IPS-1, and DAI/TBK1. Although there was a strict requirement for TLR7 and MyD88, expression of ISGs and recruitment of Ly6C hi monocytes in response to TMPD was unexpectedly independent of FcRs, suggesting that uptake of immune complexes is not required for IFN-I production in this model. The innate sensors TLR7 and TLR9 have been implicated in SLE due to their ability to recognize endogenous nucleic acids and trigger IFN-I production (83). Mammalian nucleic acids are generally weak TLR ligands due in part to their inability to reach the endosomal compartment where TLR7 and TLR9 are localized. When they form ICs with lupus autoantibodies (anti-Sm/RNP or anti-dsDNA), endogenous nucleic acids may be delivered more efficiently to endosomes due to uptake by FcRs, stimulating IFN-I production by PDCs (83, 84). This model for IFN-I induction in human SLE is supported by numerous in vitro studies (80, 82, 128). Whereas FcRIIa mediates the activation of human PDCs, ICs trigger IFN-I production by murine PDCs in a TLR7and FcRI/III-dependent manner (129). However, it is not known whether the development of anti-ribonucleoprotein autoantibodies is a cause of IFN-I dysregulation or a consequence of it. Therapeutic use of IFNcan induce many features of SLE including anti-dsDNA antibodies, suggesting that IFN-I dysregulation occurs upstream of IC formation. Consistent with that view, IFN-I upregulation in the TMPD model occurs within the first two weeks of treatment, more than two months before the onset of lupus autoantibodies (see Chapter 3). FcRI and FcRIII were not required for the IFN-I response to TMPD, since it was unaffected in -chain-deficient mice. Moreover, a previous study showed that the absence of FcRI/III or FcRIIb does not affect anti-Sm/RNP autoantibody production in TMPD-treated mice (142). Although IC formation and FcRs are not 76

PAGE 77

required to initiate IFN-I production, we cannot exclude the possibility that they amplify IFN-I secretion and accelerate disease progression subsequent to the development of autoantibodies. A pathogenic role of TLR7 has been described in several murine lupus models. The lpr mutation (which leads to aberrant apoptosis due to the deficiency of fas) drastically accelerates autoantibody production and kidney disease in the autoimmune prone MRL background (91). In MRL-lpr mice, TLR7 ligands accelerate the onset of glomerulonephritis whereas deletion of TLR7 abrogates the development of anti-Sm autoantibodies and reduces the severity of nephritis (123, 136). Lupus in MRL-lpr mice is ameliorated, not exacerbated by IFN-I (92), and the lpr defect prevents induction of TMPD-lupus (143). Dual engagement of TLR7 and the B-cell receptor can directly activate autoreactive B cells in the AM14 model, which spontaneously produce rheumatoid factors derived from MRL-lpr mice (144). TLR7 also is required for the spontaneous production of autoantibodies against ssRNA in 564Igi transgenic mice, in which the heavy and light chain genes encoding an anti-RNA immunoglobulin have been inserted into the heavy and light chain loci of the non-autoimmune C57BL/6 background (145). The connection between TLR7 and the generation of RNA-associated autoantibodies is further illustrated by the recent demonstration of a duplication of the TLR7 gene in Yaa mice. The presence of the Yaa cluster was sufficient to induce RNA-associated autoantibodies in C57BL/6 FcIIB -/mice and C57BL6.Sle1 mice, two autoimmune strains that normally lack these antibody specificities (133, 134). TLR7, and not the other 16 genes affected by the Yaa mutation, is responsible for the autoimmune pathology (135). Increased IFN-I production has not been reported in these models, however. Our findings indicate that TLR7 also plays an essential role in TMPD lupus. Similar to MRL-lpr (136), TLR7 is required to generate anti-nRNP/Sm autoantibodies in TMPD-lupus. The interferon signature 77

PAGE 78

in TMPD-treated mice, which is established within 2 weeks of treatment (long before the appearance of anti-nRNP autoantibodies), was abolished in the absence of TLR7. In contrast, the effects of TMPD were amplified in the presence of Yaa. Therefore, TLR7 is likely to be involved directly in the induction of IFN-I, even in the absence of autoantibodies and ICs. We have shown previously that Ly6C hi monocytes are a major source of IFN-I in the TMPD model. Depletion of monocytes, but not DCs, reduced IFN-I production and ISG expression. Here we found that Ly6C hi monocytes express higher levels of TLR7 and display a greater response in vitro to R848 than to other TLR ligands. While TLR7 normally is found on monocytes and macrophages, its expression on peritoneal Ly6C hi monocytes in TMPD-treated mice was several-fold higher than on splenic or bone marrow monocytes. In contrast, DCs in the peritoneal exudate displayed lower levels of TLR7 and more prominent TLR3 and TLR9 expression. The high expression of TLR7 by Ly6C hi monocytes may be of critical importance in the pathogenesis of TMPD lupus, as increased TLR7 gene dosage is sufficient to trigger anti-RNA antibodies and glomerulonephritis in C57BL/6 mice (135). Interestingly, the recruitment of Ly6C hi monocytes to the peritoneum seems partially dependent on IFN-I, as seen in TLR7 -/, MyD88 -/, and IFNAR -/mice. TLR7 signaling also induces the expression of several interferon-stimulated chemokines (CCL2, CCL7, and CCL12), suggesting that the mechanism may involve enhanced production of monocyte chemoattractants, creating an amplification loop of Ly6C hi monocyte recruitment and IFN-I production. The recruitment of DCs and granulocytes, on the other hand, was not dependent on IFN-I or TLR7. The exact mechanism linking TMPD to the activation of TLR7 on Ly6C hi monocytes and/or other cell subsets remains uncertain. While it is possible that the TMPD acts as a TLR7 ligand, its hydrocarbon structure is distinct from known TLR7 ligands including ssRNA, R848, 78

PAGE 79

loxoribine, and other guanosine analogues. However, the structure of hydrocarbon oils is related to their ability to stimulate IFN-I production. Hexadecane, which differs from TMPD by the addition of one carbon and the absence of four methyl groups, elicits less ISG expression and a lower incidence of anti-RNP autoantibodies (see Chapter 3). Other adjuvant oils such as medicinal mineral oil lack the ability to induce lupus autoantibodies and IFN-I production (146). Alternatively, TMPD may function indirectly by modifying or stabilizing endogenous TLR7 ligands such as the U1 RNA component of the Sm/RNP antigen, which is released from dying cells (27, 81, 147). Incorporation of TMPD into the plasma membrane also could affect the function and/or stability of TLRs (148). Further studies are needed to define the mechanism of TLR7 activation by TMPD, although in vitro investigations on the proinflammatory properties of the adjuvant oil are significantly limited by the immiscible nature of TMPD in aqueous solutions. It is noteworthy that besides activating IFN-I production via TLR7, TMPD also induced granulocyte recruitment via a MyD88-dependent, but TLR7-independent pathway. The number of peritoneal granulocytes actually increased in the absence of IFN-I production, as seen in TLR7 -/and IFNAR -/mice. MyD88 is employed in the signaling pathways of other cytokines (IL-1 and IL-18) and TLRs (except TLR3), which are potential mediators of granulocyte recruitment in this model. Finally, our findings may shed light on other pathology induced by TMPD. The development of plasmacytomas following i.p. injection of TMPD in BALB/cAnPt mice was first described over three decades ago (94). Subsequently TMPD was used to enhance monoclonal antibody production by hybridomas (95). How TMPD elicits these effects is incompletely understood, although IL-6 has been implicated. Interestingly, while TLR7 can trigger B cell activation and antibody production (144), IFN-I plays an important role in antibody class79

PAGE 80

switching and promotes plasma cell differentiation in the presence of IL-6 (149). Whether TLR7 activation and IFN-I production are involved in the pathogenesis of plasmacytomas and enhancement of antibody production by hybridomas warrants further investigation. 80

PAGE 81

Table 4-1. Cytokine and chemokine PCR array analysis in TLR7 -/mice. Ref Seq Gene Description Fold Difference* NM_011331 Ccl12 Chemokine (C-C motif) ligand 12 -33.9362 NM_013654 Ccl7 Chemokine (C-C motif) ligand 7 -28.4818 NM_011333 Ccl2 Chemokine (C-C motif) ligand 2 -24.7422 NM_021274 Cxcl10 Chemokine (C-X-C motif) ligand 10 -16.2245 NM_008599 Cxcl9 Chemokine (C-X-C motif) ligand 9 -6.08813 NM_013653 Ccl5 Chemokine (C-C motif) ligand 5 -5.58203 NM_011329 Ccl1 Chemokine (C-C motif) ligand 1 -5.45568 NM_008337 Ifng Interferon gamma -5.01697 NM_013652 Ccl4 Chemokine (C-C motif) ligand 4 -1.53374 NM_021443 Ccl8 Chemokine (C-C motif) ligand 8 -1.40583 NM_010735 Lta Lymphotoxin A -1.05032 NM_007768 Crp C-reactive protein, pentraxin-related -0.98869 NM_019932 Cxcl4 Chemokine (C-X-C motif) ligand 4 -0.62988 NM_021704 Cxcl12 Chemokine (C-X-C motif) ligand 12 -0.3878 NM_019494 Cxcl11 Chemokine (C-X-C motif) ligand 11 -0.38105 NM_011337 Ccl3 Chemokine (C-C motif) ligand 3 -0.3689 NM_011332 Ccl17 Chemokine (C-C motif) ligand 17 -0.18197 NM_010554 Il1a Interleukin 1 alpha -0.13888 NM_010798 Mif Macrophage migration inhibitory factor -0.07331 NM_011330 Ccl11 Small chemokine (C-C motif) ligand 11 -0.0577 NM_009142 Cx3cl1 Chemokine (C-X3-C motif) ligand 1 -0.04255 NM_011338 Ccl9 Chemokine (C-C motif) ligand 9 0.209733 NM_011577 Tgfb1 Transforming growth factor, beta 1 0.255246 NM_021283 Il4 Interleukin 4 0.375313 NM_009139 Ccl6 Chemokine (C-C motif) ligand 6 0.376835 NM_010548 Il10 Interleukin 10 0.385754 NM_011888 Ccl19 Chemokine (C-C motif) ligand 19 0.770252 NM_018866 Cxcl13 Chemokine (C-X-C motif) ligand 13 1.524727 NM_008518 Ltb Lymphotoxin B 2.057481 NM_013693 Tnf Tumor necrosis factor 2.238394 NM_008176 Cxcl1 Chemokine (C-X-C motif) ligand 1 2.893923 NM_016960 Ccl20 Chemokine (C-C motif) ligand 20 3.457557 NM_008361 Il1b Interleukin 1 beta 3.74199 NM_019577 Ccl24 Chemokine (C-C motif) ligand 24 4.259322 NM_009138 Ccl25 Chemokine (C-C motif) ligand 25 8.293495 NM_009141 Cxcl5 Chemokine (C-X-C motif) ligand 5 15.13422 fold difference indicates the average expression difference between TLR7 -/and wild-type mice (n = 2 per group). Positive values indicate increased expression in wild-type mice, negative values represent increased expression in TLR7 -/mice, and zero indicates identical expression levels. 81

PAGE 82

Figure 4-1. Induction of IFN-I by TMPD requires MyD88. A) Comparison of the number of total PEC, Ly6C hi monocytes, and granulocytes two weeks after TMPD treatment in wild-type (n = 5), MyD88 -/(n = 6), TRIF -/(n = 4) and IFNAR -/mice (n = 4). B) Flow cytometry of peritoneal cells (box indicates Ly6C hi monocytes and oval indicates granulocytes). C) RT-PCR analysis of Mx1 and IRF7 expression in PECs (normalized to peritoneal cells from an untreated wild-type mouse). D) ELISA quantification of MCP-1 in the peritoneal lavage fluid of TMPD treated mice. E) Flow cytometry analysis of Sca-1 expression on peripheral blood mononuclear cells (MFI denotes mean fluorescence intensity of Sca-1 on B220 + cells). Each bar (panels A, C, D) represents the mean and error bars indicate standard error (SE). p < 0.05 (Students t-test). 82

PAGE 83

Figure 4-2. Cytoplasmic nucleic acid sensors do not contribute to IFN-I production. RT-PCR analysis of Mx1 and IRF7 expression in PECs from wild-type (n = 5), IPS-1 -/(n = 5), TNF -/(n = 2), and TNF -/TBK-1 -/(n = 4) animals (normalized to peritoneal cells from an untreated wild-type animal) two weeks after TMPD treatment. Each bar represents the mean and error bars indicate SE. 83

PAGE 84

Figure 4-3. Induction of IFN-I by TMPD is TLR7-dependent. A) Comparison of the number of total PEC, Ly6C hi monocytes, and granulocytes two weeks after TMPD treatment in wild-type (n = 5), TLR7 -/(n = 5), TLR9 -/(n = 5) mice. B) Flow cytometry analysis of peritoneal cells (box indicates Ly6C hi monocytes). C) RT-PCR analysis of Mx1 and IRF7 expression in PECs (normalized to peritoneal cells from an untreated wild-type animal) and ELISA quantification of MCP-1 in the peritoneal lavage fluid. D) Flow cytometry of Sca-1 surface expression on peripheral blood mononuclear cells (MFI denotes mean fluorescence intensity of Sca-1 on B220 + cells). Each bar (panels A, C, D) represents the mean and error bars indicate SE. p < 0.05 (Students t-test). 84

PAGE 85

Figure 4-4. Dispensable role of FcRI and FcRIII in TMPD-induced IFN-I production. A) Flow cytometry analysis of FcRI (CD64) and FcRII/III (CD32/CD16) in PEC populations in TMPD-treated wild-type mice. B) Peritoneal cell influx and C) ISG expression in wild-type mice and FcRI/III -/(-chain deficient) mice two weeks after TPMD treatment. Each bar represents the mean (n = 3) and error bars indicate SE. 85

PAGE 86

Figure 4-5. Immature Ly6C hi monocytes express high levels of TLR7. A) RT-PCR analysis of TLR expression in sorted PEC populations, splenic Ly6C hi monocytes and bone marrow monocyte precursors from wild-type TMPD-treated mice. B) RT-PCR analysis of TLR7 and TLR9 expression in PECs from TMPD-treated mice 48 hrs after i.p. injection of PBS or clodronate-liposomes. C) ELISA for MCP-1 and IL-6 produced by sorted peritoneal Ly6C hi monocytes (5 X 10 4 cells/well) 24 h after TLR ligand stimulation. Wedge denotes increasing concentrations of LPS, R848, CpG DNA (100 ng/mL, 1 g/mL, and 10 g/mL) and poly I:C (200 ng/mL, 2 g/mL, and 20 g/mL). All mice were treated with TMPD for two weeks. Data are representative of two independent experiments. 86

PAGE 87

Figure 4-6. Amplification of the response to TMPD by the Yaa locus. A) Flow cytometry of peritoneal cell and B) RT-PCR analysis of ISG expression in BXSB X B6 female (TLR7 +/+ ) and male mice (TLR7 + / Yaa ) two weeks after TMPD treatment. denotes p<0.05 (Students t-test). C) Survival curve for male BXSB mice after PBS or TMPD treatment (arrow denotes treatment at 8-10 weeks of age). 87

PAGE 88

Figure 4-7. Essential role of TLR7 in autoantibody production. A) Total IgM, IgG and B) IgG subclass levels in BALB/c.TLR7 -/(n = 8) and wild-type BALB/c mice (n = 12) before and 24 weeks after TMPD treatment. Bars represent the mean and error bars indicate SE. p<0.05, ** p<0.001 (unpaired t-test). C) Fluorescent ANA titers (titration emulation) and D) anti-nRNP/Sm IgG levels (antigen-capture ELISA) at 12 weeks and 24 weeks post-TMPD treatment. Line indicates median and denotes p<0.05 (Mann-Whitney U test). E) Immunoprecipitation of serum autoantibodies (n = 6 per group) using nuclear extracts from 35 S-labeled K562 cells (12.5% polyacrylamide gel). Arrows indicate components of nRNP/Sm and numerical values denote the molecular weight (kD). 88

PAGE 89

Figure 4-8. Development of anti-Su/ago2 autoantibodies is TLR7-dependent. A) Immunoprecipitation of serum autoantibodies 24 wks after TMPD treatment (n = 6 per group; 8% polyacrylamide gel). Arrows indicate the 100 kD Su antigen and numerical values denote the molecular weight (kD). B) Anti-Su/ago levels at baseline and 24 wks post-TMPD treatment measured by ELISA using recombinant ago2 protein. indicates p<0.05 (Mann-Whitney U test). 89

PAGE 90

CHAPTER 5 TYPE-I INTERFERON-DEPENDENT RECRUITMENT OF INFLAMMATORY MONOCYTES IN TMPD-INDUCED LUPUS Introduction Chronic inflammation is a pathological condition characterized by unremitting production of cytokines and other mediators in response to persistent microbial infection or chemical agents (150). In chronic autoimmune disorders such as systemic lupus erythematosus (SLE), endogenous antigens also may play an important role in perpetuating the chronic inflammatory state (26). Regardless of the cause, a common feature of chronic inflammation is the persistent homing of circulating monocytes to the site of injury (150). Two major subsets of blood monocytes have been identified in mice. Inflammatory monocytes (also called Ly6C hi monocytes), characterized by surface expression of Ly6C and the chemokine receptor CCR2, are newly released from the bone marrow and actively recruited to inflamed tissue (108). On the other hand, residential monocytes (also called Ly6C monocytes) in the circulation express CX 3 CR1 and infiltrate non-inflamed tissues where they differentiate into residential tissue macrophages (M) (105, 108). Under steady-state conditions, inflammatory monocytes spontaneously mature into the residential subset in the circulation. (105, 108). Upon their recruitment to sites of injury, inflammatory monocytes also can differentiate into M, which exhibit enhanced phagocytic activity, or dendritic cells that help capture antigens for presentation to lymphocytes (116, 151). Tissue monocyte/ M also can amplify the immune response by secreting inflammatory cytokines and chemokines, which recruit other immune cells. In chronic inflammation, however, persistent production of these inflammatory mediators often leads to tissue damage, resulting in cycles of tissue destruction and 90

PAGE 91

repair. The mechanism underlying the continuous recruitment of monocytes in chronic inflammation is not well defined. Intraperitoneal administration of 2,6,10,14 tetramethylpentadecane (TMPD; also known as pristane) potently induces chronic inflammation in mice. The influx of mononuclear and polymorphonuclear leukocytes to the peritoneal cavity persists for months after injection of this hydrocarbon oil (152). The chronic inflammatory state also promotes tumorigenesis, as TMPD was found to induce plasmacytomas more than three decades ago (94). Subsequently, TMPD was used to enhance monoclonal antibody production by hybridoma cells implanted in the peritoneal cavity (95). TMPD treatment stimulates the development of highly organized ectopic lymphoid structures (lipogranulomas), a feature often associated with chronic inflammatory disorders (152). The ectopic lymphoid tissue may play a key role in the induction of lupus-like autoimmune disease (autoantibodies, glomerulonephritis, arthritis, pulmonary vasculitis) in TMPD treated mice (103). How TMPD causes chronic inflammation is not well understood, but a pathological role of several cytokines has been suggested. IL-6 is essential for the generation of plasmacytomas (153), whereas IL-12 is required for the development of TMPD-induced glomerulonephritis (24). Recently, it was found that type I interferons (IFN-I; including IFNand IFN-) and type II interferon (IFN-) both contribute to autoantibody production in TMPD-treated mice (23, 103). Using TMPD-induced chronic peritonitis as a model, we examined the mechanism(s) underlying the chronic recruitment of monocytes and granulocytes to sites of inflammation. Methods Mice These studies were approved by the Institutional Animal Care and Use Committee. Wild-type C57BL/6, IL-6 -/, TNF -/, CCR2 -/and IL-1R -/mice (all on a C57BL/6 background), 91

PAGE 92

C3H/HeJ, C3H/HeOuJ, BALB/c, and BALB/c.IFN-/were from Jackson Laboratories (Bar Harbor, ME). 129Sv/Ev Type I interferon receptor -chain deficient (IFNAR -/) mice and wild type controls (129Sv/Ev), originally from B&K Universal Limited (Grimston, Aldbrough, England), were bred in our facility. All mice were maintained a specific pathogen free facility at the University of Florida. Mice (8to 10-weeks old) received TMPD (0.5 ml i.p., from Sigma-Aldrich, St. Louis, MO), 4% thioglycollate (BD Bioscience, San Jose, CA) or PBS. Peritoneal exudate cells were isolated as described (100, 103) For morphological analysis, 5 x 104 sorted cells were cytospun onto glass slides (Fisher Scientific, Pittsburg, PA) and stained using the Hema3 kit (Fisher). Real-Time PCR RT-PCR was performed as described (103). Briefly, total RNA was extracted from 106 peritoneal cells using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized using Superscript II First-Strand Synthesis Kit (Invitrogen). RT-PCR was performed using the SYBR Green Core Reagent Kit (Applied Biosystems, Foster City, CA) with an Opticon II thermocycler (MJ Research, Waltham, MA). Amplification conditions were: 95C for 10 min, followed by 45 cycles of 94C for 15 s, 60C for 25 s, and 72C for 25 s. After the final extension (72C for 10 min), a melting-curve analysis was performed to ensure specificity of the products. Primers used in this study are included in Table 2-1. Flow Cytometry All antibodies were purchased from BD Bioscience with the exceptions of anti-Ly6C-FITC, anti-Ly6C-biotin, avidin-APC (eBioscience, San Diego, CA), anti-F4/80-FITC, and anti-CD11b-Pacific blue (Caltag Laboratories, Burlingame, CA). Cell staining was performed as described (103). Fifty thousand events per sample were acquired using a CYAN ADP flow 92

PAGE 93

cytometer (Dako, Fort Collins, CO) and analyzed with FCS Express 3 (De Novo Software, Ontario, Canada). Monocyte Labeling Clodronate (a gift from Roche Diagnostics) liposomes (Clo-lip) and 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine perchlorate (DiD)-liposomes were produced as described (105, 106). To label Ly6C monocytes, 150 L of DiD-liposomes were injected i.v. into TMPD-treated mice. Clo-lip (200 l) was delivered i.v. 24 hr prior to the injection of DiD-liposomes for the labeling of Ly6C hi monocytes (105). Cells were analyzed 24 or 72 h after labeling. To test phagocytic activity of peritoneal monocyte/M in vivo, 50 L of DiD-liposomes were injected i.p. and peritoneal cells were analyzed by flow cytometry 1 h later. In Vitro Stimulation PECs resuspended in complete DMEM (containing 10% FCS, 10 mmol/L HEPES, glutamine, and penicillin/streptomycin plus 10 U/ml heparin) were seeded on 96 well cell-culture plates (105 cells/well). Cells were stimulated with the indicated doses of peptidoglycan, R848 (Invivogen, San Diego, CA ), or LPS (from Salmonella typhimurium; Sigma) and incubated at 37 C in a 5% CO2 atmosphere for 24 h before collecting the supernatant. IL-12, TNF, MCP-1 and IL-6 ELISAs (BD Biosciences) were performed following the manufacturers instructions. Optical density was converted to concentration using standard curves based on recombinant cytokines analyzed by a four-parameter logistic equation (Softmax Pro 3.1). Results Peritoneal Recruitment of Ly6C hi Monocytes after TMPD Treatment We analyzed the peritoneal cell infiltrate at various time points after i.p. injection of TMPD. In untreated mice, peritoneal lavage yielded mainly B220 + CD11b + B1 lymphocytes 93

PAGE 94

(Figure 5-1A, circle) and B220 CD11b + myeloid cells (Figure 5-1A, box) that included mostly granulocytes and monocyte/M. Granulocytes, characterized by the expression of Ly6G, comprised only a small portion of the myeloid population (CD11b + B220 gate; Figure 5-1A, right). Thus, the Ly6G cells were predominantly monocyte/M. Consistent with other studies (105, 107), residential peritoneal macrophages did not exhibit surface expression of Ly6C (CD11b + B220 Ly6G gate; Figure 5-1A right), a marker highly expressed on inflammatory monocytes. Using the same method of analysis, a strikingly different pattern was observed 18 hrs after TMPD treatment (Figure 5-1B). A dramatic expansion of CD11b + B220 peritoneal exudate cells (PEC) and a reduction in both B1 lymphocytes and conventional B cells were observed (Figure 5-1B left). Granulocytes were the predominant population at this time point, outnumbering monocyte/M by ~2 to 1. Unlike residential peritoneal M, the majority of monocytes elicited by TMPD expressed high levels of Ly6C, suggestive of an inflammatory phenotype. The chronic nature of the response to TMPD was confirmed by the presence of granulocytes and Ly6C hi monocytes in the peritoneal cavity two weeks, and even two months after the initial injection (Figure 5-1B). An early influx of granulocytes and Ly6C hi monocytes was also detected in the sterile peritonitis induced by thioglycollate (Figure 5-1C). However, the response was transient by comparison with TMPD. Monocytes elicited by thioglycollate gradually developed a mature Ly6C phenotype whereas granulocytes were absent by 72 h (Figure 5-1C). The depletion of B lymphocytes was also not a feature of thioglycollate-induced inflammation (the reduced percentage of these cells was due to expansion of the myeloid populations). 94

PAGE 95

Chronic Recruitment of Ly6C hi Monocytes is Dependent on IFN-I signaling Proinflammatory cytokines including IL-6, TNF, IFNand IFN-I are produced in the peritoneum of TMPD-treated mice (103, 146, 154). We asked whether these cytokines play a role in the persistent inflammatory cell influx in response to TMPD. Compared to wild-type C57BL/6 controls, mice deficient of IL-6 or TNF showed a similar influx of granulocytes and Ly6C hi monocytes to the peritoneal cavity two weeks after TMPD treatment (Figure 5-2A, Table 1). The persistent inflammatory response also was not explained by the presence of endotoxin as a similar pattern was seen in C3H/HeJ mice, which carry a mutation in Toll-like receptor (TLR)-4. Moreover, the absence of IFNalso did not affect the pattern of inflammatory cell recruitment, although the BALB/c background itself was associated with a greater number of granulocytes (Figure 5-2B, Table 5-1). Interestingly, while a sustained accumulation of granulocytes was found in TMPD-treated IFNAR -/mice, the majority of monocyte/M in the peritoneal cavity exhibited a mature, Ly6C phenotype (Figure 5-2B, Table 5-1). This observation was not caused by genetic background differences as wild-type 129Sv and B6 mice demonstrated comparable responses to TMPD (Table 5-1). Consistent with our analysis by flow cytometry, visual examination of PECs showed numerous polymorphonuclear cells in wild-type and IFNAR -/mice (Figure 5-2B). Whereas cells with monocytic morphology were found in the peritoneal cavity of wild-type mice, PECs from IFNAR -/mice consisted mainly of revealed the presence of larger, vacuolated cells consistent with a mature, M-like morphology (Figure 5-2C). These findings were specific for TMPD as the inflammatory response to thioglycollate was similar in wild-type and IFNAR -/mice (Figure 5-2C and not shown). Under steady state conditions, both residential (Ly6C ) and inflammatory monocytes (Ly6C hi ) are present in the circulation (105, 108). The accumulation of Ly6C monocyte/M in 95

PAGE 96

TMPD-treated IFNAR -/mice suggests that either this subset is preferentially recruited to the peritoneal cavity, or the infiltrating Ly6C hi monocytes rapidly attains a mature phenotype at the site of inflammation. To address these possibilities, we monitored the influx of monocytes to the peritoneal cavity in vivo using fluorescently labeled liposomes. Neither Ly6C nor Ly6C hi circulating monocytes displayed fluorescence prior to labeling (CD11b + Ly6G gate; Figure 5-3A). As described previously (105), i.v. injection of liposomes containing the fluorescent dye DiD (DiD-lip) selectively labeled Ly6Cmonocytes (Figure 5-3B,C). After 24 h, > 40% of circulating Ly6C monocytes were DiD + in TMPD-treated wild-type and IFNAR -/mice, but few DiD + cells had migrated into the peritoneal cavity in either strain. Thus, the absence of IFN-I signaling does not result in the preferential recruitment of Ly6C monocytes from the bone marrow. To track the migration of circulating Ly6C hi monocytes, clodronate-liposomes (clo-lip) were first given to deplete the Ly6C subset. Twenty-four hours after the administration of DiD-lip, ~50% of peripheral blood Ly6C hi monocytes were fluorescently labeled in TMPD-treated wild-type and IFNAR -/mice (Figure 5-3D,E). Importantly, a similar percentage of Ly6C hi monocytes in the peritoneal cavity of wild-type mice were DiD + indicating that the majority of cells in this subset entered the peritoneal cavity within the past 24 h. Although fewer peritoneal Ly6C hi monocytes were found in the absence of IFN-I signaling, a milder influx of DiD + Ly6C hi monocytes were seen in IFNAR -/mice (Figure 5-3D,E). We extended the analysis to 72 h after i.v. injection of DiD-lip. Based on preliminary studies, few DiD + monocytes remained in the circulation at this time and further influx of labeled cells to the peritoneal cavity was negligible (not shown). This allowed us to trace the fate of DiD + Ly6C hi monocytes that had migrated into the peritoneal cavity during the previous 48 h. In 96

PAGE 97

contrast to the earlier time point, few peritoneal Ly6C hi monocytes were DiD + in wild-type mice at this time, suggestive of a high turnover rate of the infiltrating monocytes (Figure 5-3F). Curiously, the number of DiD + monocytes in IFNAR -/remained similar compared to 24 h post-labeling. A maturation continuum was also evident in IFNAR-/mice, as the majority of DiD + monocytes at this time-point showed reduced or no expression of Ly6C (Figure 5-3F). Hence, maturation of Ly6C hi monocytes, rather than recruitment of the Ly6C subset, is responsible for the accumulation of Ly6C monocytes/M in IFNAR -/mice. Taken together, these data illustrate the essential role of IFN-I in promoting the continuous recruitment of Ly6C hi monocytes to the peritoneal cavity following TMPD treatment and are consistent with an IFN-induced monocyte maturation deficit. Monocyte Recruitment Induced by TMPD Requires CCR2 Since IFN-I are not known to possess direct chemotactic properties, we reasoned that the production of chemokines induced by IFN-I signaling may be responsible for the influx of Ly6C hi monocytes. Previous studies have shown that several monocyte chemoattractants including CCL2, CCL7, and CCL12 are IFN-inducible genes (127, 155). Indeed, these chemokines were highly expressed in PECs from TMPD-treated wild-type mice, but not IFNAR -/mice (Figure 5-4A). Reduced levels of CCL2 protein also were observed in the peritoneal lavage fluid of IFNAR -/mice (Figure 5-4B). Conversely, the expression of CX3CL1, which mediates the migration of Ly6Cmonocytes (108), and the neutrophil attractants CXCL1 and CXCL5, was affected modestly at best by the absence of IFN-signaling (Figure 5-4A). These data supported the observation that IFN-I is essential for the influx of inflammatory monocytes, but not Ly6C monocytes or granulocytes. 97

PAGE 98

To further examine the role of monocyte chemoattractants, we administered TMPD to mice deficient of CCR2, the major receptor for CCL2, CCL7 and CCL12. Supporting the role of these chemokines, PECs from CCR2 -/mice were comprised of primarily of granulocytes two weeks post-treatment (Figure 5-4C, D). Both Ly6C hi and Ly6C monocyte subsets were largely absent in CCR2 -/animals whereas the number of granulocytes increased slightly compared to controls (Figure 5-4D). Thus, the chronic influx of Ly6C hi monocytes induced by TMPD requires the interaction between IFN-inducible chemokines and CCR2. Functions of Monocyte Subsets in TMPD-Treated Mice To evaluate the functional significance of the preferential recruitment of Ly6C hi monocytes induced by IFN-I, we stimulated peritoneal monocyte/M from wild-type and IFNAR -/mice with the TLR ligands peptidoglycan, lipopolysaccharide, and R848. Strikingly, the production of IL-6, TNF-, and MCP-1 in response to TLR-ligands were dramatically reduced in the absence of IFN-I signaling (Figure 5-5A). Monocytes/M from TMPD-treated IFNAR -/mice showed minimal production of TNFand MCP-1, even at the highest dose of TLR ligands tested. The lack of inflammatory cytokine production in monocyte/M from TMPD-treated IFNAR -/mice raised the question whether these cells differentiated towards the alternatively activated M2 phenotype. Downregulation of inducible nitric oxide synthase (iNOS) and upregulation of arginase-1 (arg-1) and TGFexpression are characteristic features of M2 macrophages (156, 157). RT-PCR analysis of these genes in peritoneal monocytes/M did not reveal any differences between wild-type and IFNAR -/mice (Figure 5-5B), suggesting that alternative activation of monocyte/M in the absence of IFN-I signaling is unlikely to explain the discrepancy in cytokine production. 98

PAGE 99

We assessed phagocytic function of peritoneal monocyte/M in vivo by direct i.p. injection of DiD-labeled liposomes. In contrast to cytokine production, phagocytosis was greatly enhanced in monocyte/M from IFNAR -/mice compared with wild-type controls (Figure 5-5C). Both the percentage of cells engulfing liposomes and the amount of uptake per cell (measured by mean fluorescence intensity) were increased in the absence of IFN-I signaling (Figure 5-5C). Further analysis revealed that the discrepancy was largely due to the predominance of Ly6C monocyte/M in IFNAR -/mice, which were more highly phagocytic than the Ly6C hi monocytes (Figure 5-5D). It is noteworthy that although present in smaller numbers, the Ly6C subset in wild-type mice was also highly phagocytic. IFN-I treatment of bone-marrow derived M in vitro did not inhibit phagocytosis (not shown), indicating that the difference seen in wild-type and IFNAR -/mice was probably due to the difference in monocyte/M subsets rather than a direct effect of IFN-I. Therefore, IFN-I directs the recruitment of Ly6C hi monocytes that are highly responsive to pathogenic stimuli but only weakly phagocytic. Chronic Recruitment of Granulocytes Requires IL-1 Signaling Finally, we investigated the mechanism of chronic granulocyte recruitment in TMPD-treated mice. In contrast to Ly6C hi monocytes, the influx of granulocytes was independent of IFN-I signaling and CCR2 interactions (Figures 5-2B, 5-4D). Deficiency of IL-6, TNF-, IFN-, or functional TLR4 also did not affect granulocyte recruitment. A recent study found that IL-1 signaling plays a role in granulocyte influx in urate crystal-induced peritonitis (158). To examine the contribution of IL-1 signaling, we tested the effect of TMPD on IL-1 receptor-deficient (IL-1R -/) mice. The number of granulocytes in the peritoneal cavity was greatly reduced in IL-1R -/mice, whereas the accumulation of Ly6C hi monocytes was unaffected (Figure 5-6A, B). PECs from IL-1R -/mice showed significantly reduced expression of the granulocyte 99

PAGE 100

attractant CXCL5 and a slight reduction in CXCL1 (Figure 5-6C). Consistent with the normal recruitment of Ly6C hi monocytes, expression of the IFN-inducible monocyte chemoattractants CCL2, CCL7 and CCL12 as well as CX3CL1 was not affected. We further analyzed whether components of the recently described inflammasome complex act upstream of IL-1R. Upon detecting certain foreign stimuli [i.e. asbestos, silica (159)] or endogenous molecules released by damaged cells [i.e. ATP, urate crystals (158)], activation of the inflammasome results in the release of proinflammatory cytokines including IL-1 (160), which mediates the recruitment of granulocytes However, the deficiency of the major inflammasome components NALP3 (cryopyrin), ASC (apoptosis-associated speck-like protein containing a caspase recruitment domain), or caspase-1 did not impact the influx of granulocytes or monocytes in TMPD-treated mice (Figure 5-6D and not shown). These findings suggest that granulocyte influx in the chronic inflammatory response to TMPD is specifically mediated by an IL-1R-dependent pathway, independent of inflammasome signaling or the mechanisms utilized in monocyte recruitment. Discussion Chronic inflammation can be caused by persistent immune responses to microbes, chemicals, or autoantigens (150). Despite the heterogeneity of etiologic factors, continuous infiltration of monocytes is a common feature of many types of chronic inflammation Using TMPD to induce chronic peritonitis, we show in this study that the persistent recruitment of inflammatory Ly6C hi monocytes was mediated specifically by IFN-I. These antiviral cytokines activate the production of monocyte chemoattractants and recruit Ly6C hi monocytes in a CCR2-dependent manner. Curiously, the rapid turnover of recruited monocytes in the peritoneum of 100

PAGE 101

TMPD-treated mice was associated with a lack of differentiation into phagocytic Ly6C monocyte/M, consistent with previous observations that the uptake of carbon particles is reduced substantially following TMPD injection (161). These findings define an important role of IFN-I in maintaining the chronic inflammatory state. IFN-I are primarily known for their antiviral and anti-proliferative properties and a prominent role in chronic inflammation has not been established previously (36). Studies on acute murine cytomegalovirus infection illustrated that early antiviral defense is orchestrated by IFN-I and the downstream production of IFN-inducible chemokines. Recruitment of NK cells and macrophages to the site of infection is mediated by the production of CXCL3 and CCL2, respectively (162, 163). Our results suggest that a similar mechanism is involved in the chronic inflammation induced by TMPD, as IFN-I (but not other inflammatory mediators such as TNF, IL-6 and IFN) is required to maintain the chronic recruitment of inflammatory monocytes to the peritoneum. PECs from wild-type mice treated with TMPD displayed elevated expression of the IFN-inducible monocyte chemoattractants CCL2, CCL7, and CCL12, promoting the migration of monocytes to the site of inflammation through interactions with CCR2. Due to shared receptor utilization, the relative contribution of each of these chemokines is unclear, although recent studies suggest a synergy of CCL2 and CCL7 in recruiting monocytes (164, 165). Interestingly, the chronic influx and rapid turnover of Ly6C hi monocytes was accompanied by a concomitant reduction of Ly6C monocyte/M in the peritoneal cavity of TMPD-treated mice. While Ly6C hi monocytes were also initially recruited following thioglycollate treatment, few were found in the peritoneal cavity after 72 h as the majority of PECs were F4/80 + Ly6C residential monocytes/M. Unexpectedly, the pattern induced by TMPD was almost completely dependent on IFN-I signaling. Labeling studies suggested that the accumulation of Ly6C 101

PAGE 102

monocyte/M in IFNAR -/mice was not due to direct recruitment of circulating Ly6Cmonocytes. Instead, the small number of Ly6C hi monocytes recruited to the peritoneal cavity later differentiated into the Ly6C subset. This view is supported by the deficiency of both Ly6C hi and Ly6C subsets in the absence of CCR2, which mediates the migration of Ly6C hi but not Ly6C monocytes (108, 119). How IFN-I interfere with differentiation or maturation of Ly6C hi monocytes into the Ly6C subset remains unclear. The predominance of Ly6C hi monocytes is likely to amplify the inflammatory cascade as these cells produced large amounts of inflammatory mediators in response to stimulation with TLR2, 4, or 7 ligands. Ly6C hi monocytes may establish a vicious cycle of monocyte recruitment and cytokine/chemokine production as they constitute a major source of IFN-I and CCL2 in TMPD-treated mice (see Chapter 3). In contrast, Ly6C monocyte/M exhibited much greater phagocytic capacity, but produced only small amounts of IFN-I, CCL2, IL-12, or TNF. Enhanced phagocytic function of Ly6C monocytes in vivo also is illustrated by the preferential labeling of this subset upon administration of DiD-liposomes alone, whereas depletion by clo-liposomes was required in order to effectively label the Ly6C hi subset. We conclude that the relative deficiency of Ly6C monocyte/M in the presence of IFN-I impairs phagocytic capacity at the site of inflammation, leading to defective clearance of the triggering stimuli and perpetuation of the inflammatory response. This possibility also is supported by the defective clearance of carbon particles following i.p. TMPD injection (161). Our findings suggest a potential role of IFN-I in clinical conditions associated with chronic inflammation. In SLE, a chronic autoimmune condition characterized by the production of antibodies to numerous self-antigens, serum levels of IFN-I correlate with disease severity, kidney inflammation, and the presence of autoantibodies (31, 32). Numerous IFN-inducible 102

PAGE 103

genes, including CCL2 and CCL7, are also coordinately overexpressed in lupus patients (127). Interestingly, defective phagocyte function is well-established in SLE (26). Aberrant clearance of apoptotic debris is thought to provide the autoantigens that initiate the autoimmune response (166). Whether the dysregulation of IFN-I production in human SLE disrupts the balance of inflammatory vs. residential monocyte subsets and/or contributes to the phagocytosis defect warrants detailed investigation. In addition, IFN-I may contribute to chronic inflammation in atherosclerosis. Circulating Ly6C hi monocytes are chronically elevated in mice with atherosclerotic heart disease and these inflammatory monocytes infiltrate the atheromatous lesion in apoE-deficient mice (119, 151). Recombinant IFN-I administration accelerates plaque development in mice and human plaque tissue exhibits elevated expression of IFNas well as CCL2 (167, 168). In view of our findings, it will be interesting to determine whether a similar IFN-I-chemokine feedback loop contributes to the chronic monocytosis in atherogenesis or the accelerated atherosclerosis of SLE patients (169). We have also partially elucidated the mechanism for chronic granulocytes recruitment in the TMPD model. Because of shared utilization of IL-1R, whether IL-1 and/or IL-1 are essential for this process remains to be determined. We have ruled out the involvement of major components of the inflammasome complex, which activates caspase-1 and stimulates the release of IL-1 in response to exogenous and endogenous danger signals (158-160). However, other mechanisms of IL-1 production remains possible (170) and recruitment of granulocytes to the peritoneal cavity can also be mediated by IL-1 (171). Futures studies are needed to further define the pathway(s) responsible for granulocyte recruitment. 103

PAGE 104

In conclusion, our study defines an essential role of IFN-I in the recruitment of monocytes in the TMPD-induced model of chronic inflammation. These findings suggest that novel therapies aimed at neutralizing IFN-I and/or downstream chemokines may be effective treating lupus and other chronic inflammatory conditions. 104

PAGE 105

Table 5-1. Peritoneal exudate cell subsets two weeks following TMPD treatment Strain n Ly6C hi monocytes (CD11b + Ly6C hi ) Granulocytes (CD11b + Ly6G + ) Ly6C mono/M (CD11b + Ly6C ) Dendritic cells (CD11c + IA + ) B lymphocytes (B220 + ) C57BL/6 6 6.32 1.44 5.04 1.25 2.01 0.33 0.68 0.11 0.88 0.15 B6.TNF -/3 4.80 0.50 4.75 0.77 0.95 0.20 0.80 0.21 1.10 0.39 B6.IL-6 -/3 4.81 0.62 6.13 0.78 1.47 0.29 0.43 0.07 0.40 0.25 C3H/HeJ 4 4.5 1.58 4.24 1.10 1.31 0.37 0.53 0.11 1.35 0.39 BALB/cJ 2 2.61 0.09 9.7 .93 0.23 0.05 0.24 0.01 1.15 0.25 c.IFN-/2 2.86 0.34 12.53 0.47 0.66 0.06 0.28 0.01 1.42 0.02 129Sv 7 4.85 0.48 3.23 0.54 0.35 0.16 0.33 0.11 0.95 0.22 129.IFNAR -/7 0.63 0.11 7.00 0.65 2.98 0.76 0.25 0.02 1.05 0.29 105

PAGE 106

Figure 5-1. Chronic recruitment of Ly6C hi monocytes in TMPD-treated mice. A) Cell subset analysis of peritoneal cells from untreated C57BL/6 mice by flow cytometry. Left: two-dimensional dot plot (left) shows the presence of CD11b + B220 + B1 lymphocytes (circle) and CD11b + B220 myeloid cells (box). Right: (upper) histogram analysis of the percentage of Ly6G + granulocytes and Ly6Gmonocyte/M in the myeloid cell gate (CD11b + B220 ); (lower) histogram analysis of Ly6C expression on monocyte/M (CD11b + B220 Ly6G gate). Flow cytometry analysis of peritoneal exudate cells (PECs) from B) TMPD-treated or C) thioglycollate-treated mice. Left: two-dimensional dot plot of PECs 18 h after treatment; Right: histogram analysis of Ly6G and Ly6C expression (as described above) at the indicated time points after treatment. 106

PAGE 107

Figure 5-2. The recruitment of Ly6C hi monocytes induced by TMPD requires IFN-I signaling. Flow cytometry analysis of PECs from A) wild-type C57BL6, IL-6 -/, TNF-/, C3H/HeJ and B) BALB/c, IFN-., 129Sv, and IFNAR -/mice two weeks after TMPD-treatment. Upper panels: histogram analysis of the percentage of Ly6G + granulocytes and Ly6G monocyte/M in the myeloid cell gate (CD11b + B220 ); lower panels: histogram analysis of Ly6C expression on monocyte/M (CD11b + B220 Ly6G gate). C) Morphologic analysis of PECs from 129Sv and IFNAR -/mice after TMPD (2 weeks) or thioglycollate treatment (3 days). 107

PAGE 108

Figure 5-3. Rapid turnover and decreased maturation of Ly6C hi monocytes is the presence of IFN-I signaling. A) Gating strategy for the analysis of peripheral blood monocytes (CD11b + Ly6G ) used for subsequent labeling experiments. B) Flow cytometry analysis and C) quantification of DiD + Ly6C monocytes in the peripheral blood and peritoneum in TMPD-treated mice IFNAR +/+ (129Sv) or IFNAR -/mice 24 hr after administration of DiD-liposomes. D) Flow cytometry analysis and E) quantification of DiD + Ly6C hi monocytes 48 h or F) 96 h after pretreatment with clodronate-liposomes followed by subsequent labeling with DiD-liposomes. All mice were treated with TMPD two weeks before liposome injection. Bars represent the average of 3 or more mice. 108

PAGE 109

Figure 5-4. Monocyte recruitment induced by TMPD is dependent on CCR2. A) RT-PCR of chemokine expression in PECs and B) ELISA analysis of CCL2 in peritoneal lavage from IFNAR +/+ (129Sv) or IFNAR -/mice 2 weeks after TMPD treatment. C) Morphologic analysis and D) quantification of granulocytes and monocyte/M in wild-type and CCR2 -/mice. 109

PAGE 110

Figure 5-5. Functions of monocyte subsets in TMPD-treated mice. A) ELISA quantification of cytokine and chemokine production in adherent PECs from TMPD-treated IFNAR +/+ (129Sv) or IFNAR -/mice cocultured with peptidoglycan (2 g/mL), LPS (1 g/mL) or R848 (g/mL) for 20 h. B) RT-PCR analysis of iNOS, Arginase-1, and TGFexpression in PECs. Flow cytometry analysis of DiD-liposome phagocytosis in C) total PECs or D) monocyte/M (CD11b + B220 Ly6G gate) in IFNAR +/+ or IFNAR -/mice two weeks after TMPD treatement. 110

PAGE 111

Figure 5-6. Granulocyte influx following TMPD treatment requires IL-1 receptor. A) Flow cytometry analysis of PECs from wild-type C57BL/6 and IL-1R -/mice two weeks after TMPD-treatment. Upper panel: histogram analysis of the percentage of Ly6G + granulocytes and Ly6Gmonocyte/M in the myeloid cell gate (CD11b + B220 ); lower panel: histogram analysis of Ly6C expression on monocyte/M (CD11b + B220 Ly6G gate). B) Morphologic analysis of PECs from IL-1R -/mice. C) RT-PCR of chemokine expression in PECs from wild-type C57BL/6 and IL-1R -/mice 2 weeks after TMPD treatment. Each bar represents the average from 5 mice. C) Quantification of granulocyte influx in mice deficient in IL-1R -/or various components of the inflammasome complex (2 weeks after TMPD treatment). 111

PAGE 112

CHAPTER 6 DISCUSSION AND FUTURE DIRECTIONS Although the etiology of SLE remains unknown, early studies focused on the adaptive immune system as abnormalities of B and T lymphocytes were thought to be the basis of the autoimmune condition. This paradigm has undergone a dramatic change with recent advances in the field of innate immunity. It is now increasingly recognized that components of the innate immune system, normally function to recognize invasion by microbial pathogens, play an essential role in the recognition of self-antigens and subsequent initiation of the adaptive immune response. The involvement of TLRs and IFN-I in SLE are among the best examples illustrating the link between aberrant activation of innate immune system and the induction of autoimmunity. The work presented in previous chapters highlights the importance of innate immunity in experimental SLE induced by TMPD. Supporting a pathogenic role of IFN-I, overproduction of the anti-viral cytokines was responsible for many manifestations of lupus in TMPD-treated mice including the development of autoantibodies and glomerulonephritis (93). We found that a population of immature, inflammatory monocytes characterized by high levels of Ly6C expression was a major source of IFN-I in TMPD-treated mice. Further investigation revealed that activation of TLR7, an innate sensor of ssRNA in endosomes, was responsible for the production of IFN-I and the recruitment of Ly6C hi monocytes, where as the CpG-DNA sensor TLR9 and other pathways of IFN-I induction were not required. We also uncovered a new role of IFN-I in mediating the chronic influx of Ly6C hi monocytes, establishing a vicious cycle of monocyte recruitment and IFN-I production. In spite of these novel findings, many questions regarding the TMPD model of SLE remain to be addressed. 112

PAGE 113

Suitability of the TMPD-Model for the Study of SLE Since its initial discovery more than 14 yrs ago, the TMPD model has often been criticized for the lack of relevance to human SLE. The use of an exogenous hydrocarbon and the inducible nature in non-autoimmune prone mice are incompatible with the human disease, which is heavily influenced by genetic factors. However, because the etiology of lupus is unknown and likely to be multi-factorial, no current animal models fully resemble the human syndrome, which itself is heterogeneous as symptoms vary widely among lupus patients (1). While the inducible nature of the model is not suitable for genetic studies of lupus, many of the autoimmune features in mice treated with TMPD recapitulate the human disease. The combination of lupus-specific antibodies (anti-Sm and anti-dsDNA), glomerulonephritis, and female predisposition in TMPD-induced lupus is only paralleled by the MRl-lpr model (91). Importantly, the TMPD model is currently the only model that exhibits the interferon signature seen in more than half of lupus patients (32, 103). As the role of innate immunity is increasingly recognized, our findings presented in previous chapters illustrate that innate components such as TLRs and IFN-I are essential for disease development in this model. The inducible nature of TMPD-induced lupus, in fact, offers an advantage over the genetic models as it allows temporal assessment of upstream and downstream effects. This model further provides the opportunity to test the efficacy of anti-IFN and anti-TLR7 therapeutic approaches. Therefore, the TMPD model can yield valuable insights into the pathogenesis of SLE. Complexity of the TMPD Model The previous chapters have individually described novel features pertinent to the involvement of IFN-I in the TMPD model. The observation of IFN-I production by Ly6C hi monocytes (Chapter 3), the involvement of TLR7 activation (Chapter 4), and the role of IFN-I in maintaining monocyte recruitment (Chapter 5) together illustrate that activation of specific 113

PAGE 114

pathways involved in innate immunity, rather than non-specific inflammation, is responsible for the early effects of TMPD. Creating a model for how TMPD causes lupus based on our current understanding uncovers a complex network of feedback interactions between the recruitment of Ly6C hi monocytes, the production of IFN-I, and the expression of TLR7. While Ly6C hi monocytes constitute a major subset of IFN-I producing cells, IFN-I and IFN-inducible chemokines mediate further recruitment of monocytes from the peripheral blood and bone marrow (Figure 6-1). This process is amplified by IFN-I signaling, which is subject to autocrine feedback that enhances production of IFN-I. The expression of TLR7, which mediates the production of IFN-I in this model, is also IFN-inducible. High levels of TLR7 expression in Ly6C hi monocytes may further contribute to their ability to produce IFN-I. Finally, the chronic presence of high levels of IFN-I may induce the activation of lymphocytes and dendritic cells and initiate the immune response to autoantigens. An important unanswered question is how TMPD initiates this cycle of monocyte recruitment and IFN-I production. Since Ly6C hi monocytes are not normally present in the peritoneal cavity and their recruitment is largely dependent on CCR2, another cell type likely initiates the inflammatory response by producing the first wave of IFN-I and monocyte chemoattractants (Figure 6-1). This hypothesis is supported by the presence of IFN-I production (albeit at reduced levels) in CCR2 -/mice despite the absence of Ly6C hi monocytes (unpublished observation). Because most of our previous studies have focused on the peritoneal inflammatory infiltrates, further studies are needed to determine whether cells lining the peritoneal cavity (i.e. mesothelial cells and stromal cells) contribute to the inflammatory response to TMPD. We recognize that the in vivo effect of TMPD may be more complex as at least one other pathway (MyD88and IL-1R dependent but TLR7and IFNAR-independent) is activated for the 114

PAGE 115

recruitment of granulocytes. Nevertheless, our results argue against the prevailing hypothesis that the interaction between immune complexes and FcRs is required for TLR7-mediated IFN-I production. FcRs seem to be dispensable in this model as both short-term IFN-I production and long-term autoantibody development (142) are unaffected in FcR-deficient mice, although we do not exclude the possibility that immune complex-FcR interaction may amplify the autoimmune response after the onset of autoantibodies. Mechanism of TLR7 Activation The hydrocarbon structure of TMPD does not resemble any synthetic ligands (such as R848, loxoribine, and other guanosine analogues) or natural agonists (ssRNA) for TLR7. Therefore, it remains enigmatic why TMPD preferentially induces TLR7 activation in vivo. To further investigate the link between TMPD treatment and TLR7 activation, we studied the effect of TMPD in vitro. Although TMPD has been used for decades, mechanistic studies on its cellular effects have been limited by the hydrocarbons poor immiscibility in aqueous solutions. We found that this problem could be circumvented by first mixing TMPD with fetal bovine serum prior to the addition of culture medium. Typically TMPD was incorporated at a concentration of 1 g/mL as determined by gas chromatography-mass spectroscopy (M. Satoh and N. Szabo, UF Toxicology Core; unpublished observation). Unlike stimulation with R848, a TLR7 ligand that elicits IL-6 production and costimulatory molecule upregulation in murine J774 macrophages, the addition of TMPD in vitro did not induce these responses (Figure 6-2A and not shown). TMPD solubilized in non-physiological solvents such as ethanol, DMSO, mannide monooleate, or -cyclodextrin were also ineffective in triggering TLR7 activation (Figure 6-2A), suggesting that TMPD itself is not a ligand for TLR7. 115

PAGE 116

However, exposure to TMPD dramatically enhanced the response to subsequent stimulation with TLR7 ligands. R848-induced IL-6 production and costimulatory molecule upregulation were augmented in J774 cells pretreated overnight with TMPD (Figure 6-2B) and similar enhancement of chemokine and cytokine production was found in bone-marrow derived macrophages (Figure 6-2C). Importantly, these observations were specific to TMPD as treatment with other hydrocarbon oils that do not induce lupus, such as medicinal mineral oil and squalene, did not enhance stimulation by R848 (Figure 6-2D). We further examined whether TMPD augments the response to TLR7 ligands by altering the expression or location of TLR7. TLR7 remained exclusively intracellular regardless of TMPD treatment and its expression levels were not affected at the protein or mRNA level (Figure 6-2E). Moreover, TMPD treatment did not enhance endocytosis of FITC-dextran or phagocytosis of latex beads (Figure 6-3), suggesting that accelerated uptake of ligands is also unlikely to explain our findings. Taken together, these data indicate that TMPD is not a direct ligand for TLR7 but instead acts to enhance the response to TLR7 stimulation. Although the underlying mechanisms are distinct, the pathologic consequences of excess TLR7 activation are shared by TMPD-induced lupus and the Yaa (BXSB male) lupus model. An important unanswered question that encompasses both models is the nature of the exogenous or endogenous ligands responsible for activating the TLR7 pathway. Future studies are also needed to better understand the cellular targets of TMPD responsible for the enhancement of TLR responses. Role of TLR7 in Autoantibody Production We have shown in TLR7 -/mice that in addition to mediating IFN-I production, TLR7 is required for the development of anti-nRNP/Sm autoantibodies. The latter was also reported in a previous study in the MRL-lpr model (136), which does not exhibit IFN-I dysregulation, 116

PAGE 117

suggesting that TLR7 may mediate the generation these autoantibody specificities even in the absence of excess IFN-I. However, anti-nRNP/Sm autoantibodies were also absent in TMPD-treated IFNAR -/mice (93) and multiple groups have reported a strong association between the interferon signature and the presence of these autoantibodies in human SLE (32, 33, 76). Therefore, it was unclear whether TLR7 simply provides the IFN-I necessary to promote class-switch of anti-nRNP/Sm autoantibodies, or act upstream to generate these autoantibodies. This question was addressed by analyzing IgM autoantibodies to nRNP/Sm. If TLR7 was only required for IFN-I production, normal or higher levels of IgM anti-nRNP/Sm would be expected in TLR7 -/mice due to the lack of isotype class-switch, whereas a complete absence of IgM anti-nRNP/Sm would be expected if TLR7 acts upstream in generating these autoantibodies. Results were consistent with the latter possibility as IgM anti-nRNP/Sm also was reduced significantly in TLR7 -/mice (Figure 6-4A). The mechanism linking activation of TLR7 to the production of autoantibodies against RNA-associated antigens remains to be elucidated, although the proposed synergism of TLR7 and the B-cell receptor may play a role in this model (144). Furthermore, we extended our analysis to the production of autoantibodies to DNA and chromatin. Studies in the MRL-lpr model showed that TLR9 is required to generate these autoantibodies (136). Consistent with previous observations, TMPD-treated BALB/c mice produced moderate levels of autoantibodies against dsDNA, ssDNA, and chromatin by 24 weeks post-treatment. Curiously, IgG autoantibodies to these antigens were largely absent in TLR7 -/mice whereas IgM levels were comparable to the control group (Figure 6-4B-D). This suggests that although TLR7 is not directly required to generate the immune response to DNA and DNA-associated antigens, IFN-I production downstream of TLR7 activation promotes the IgG class-switch of these autoantibody specificities. 117

PAGE 118

For unclear reasons, a single animal in the TLR7 -/group produced high levels of autoantibodies to DNA and ssDNA. The same animal also displayed a high titer of ANA (1:1280) in an earlier analysis (Figure 4-7C). The TLR7 -/genotype was confirmed by PCR (not shown) and also supported by the absence of anti-nRNP/Sm autoantibodies, suggesting that the presence of other factors, such as a viral infection, may bypass the requirement of IFN-I production (downstream of TLR7 activation) and drive the class-switch of anti-DNA autoantibodies. A similar pattern was previously found in IFN--deficient mice (23). Despite a reduction in the overall frequency of IgG anti-nRNP/Sm autoantibodies (22% vs. ~70% in wild type), a few IFN-/mice produced them at high levels comparable to wild-type controls. The explanation for this observation will require study of larger numbers of mice. The role of TLR9 in TMPD model has not been assessed fully. While TLR9 does not contribute significantly to IFN-I production, it is probably required to initiate autoantibody production against DNA and DNA-association antigens as in other models (136). The autoantibody profile in TLR9 -/mice will need to be determined in future studies. Whether TLR9 also exerts protective effects, as shown in MRL-lpr mice (136), also warrants further evaluation. Sequential Generation of Autoantibody Specificities in TMPD-Induced Lupus Another intriguing aspect of TMPD-lupus is the sequential appearance of autoantibody specificities. Those targeting RNA-associated antigens (IgG anti-RNP/Sm and anti-Su/ago2) tend to appear by 3 months post-treatment whereas IgG anti-ssDNA and anti-dsDNA autoantibodies typically do not appear until 5-6 months (96). If TLR9 indeed mediates anti-DNA autoantibody production in this model, it raises the question of why TLR7-dependent autoantibody specificities are consistently generated two months before the onset of TLR9118

PAGE 119

dependent specificities. Preferential enhancement of TLR7, but not TLR9 activation in vitro by TMPD may have implications in this issue. The timing of autoantibody production is also interesting in view of our finding that IFN-I production appears within days of TMPD treatment. Additional cofactors are required to break tolerance and initiate the autoimmune response between the onset of IFN-I upregulation to the appearance of the first wave of autoantibodies after ~3 months. Supporting this view, administration of exogenous IFNalone was not sufficient to trigger autoantibody production in BALB/c mice (88). A potentially important cofactor in the TMPD-model is the development of ectopic lymphoid tissue known as lipogranulomas (94). These lymphoid structures typically appear in the peritoneal cavity within 2-3 months of TMPD treatment, coinciding with the onset of autoantibody production. This ectopic tissue morphologically resembles secondary lymphoid structures and contains B lymphocytes, T lymphocytes, DCs, as well as monocytes/M (103). Lipogranulomas are functional lymphoid structures as demonstrated by their ability generate antigen-specific B and T lymphocytes (J. Weinstein et. al. manuscript in press). Importantly, anti-Sm/RNP autoantibody-producing cells also are observed within the ectopic tissue. In view the similar timing between lipogranuloma formation and autoantibody development, it is possible that these lipogranulomas serve as a location permissive to the breach of tolerance and the generation of autoreactive lymphocytes. Interestingly, as the inflammatory response to TMPD began to resolve in the peritoneal cavity by 6 months post-treatment, the expression of IFN-I (103) and the influx of Ly6C hi monocytes seemed to be maintained within the lipogranulomas (Figure 6-5). The contribution of lymphoid neogenesis to the development of autoimmunity is a subject of ongoing investigation in our laboratory. Although medicinal mineral oil and squalene 119

PAGE 120

treatment also induce the formation of lipogranulomas, mice treated with these hydrocarbons do not develop the interferon signature or lupus autoantibodies [anti-nRNP/Sm, anti-dsDNA (114)]. Thus, the presence of ectopic lymphoid structures and excess production of IFN-I may be co-requisites driving the onset of autoimmunity in the TMPD model. This possibility can be further evaluated by 1) introducing exogenous IFN-I to mice treated with mineral oil or squalene; and by 2) inhibiting lymphoid neogenesis by targeting lymphotoxin /. An additional variable that that affects autoantibody production is the genetic variation among mouse strains. The frequency of anti-nRNP/Sm following TMPD treatment, for example, ranges from ~70% in BALB/c mice to ~35% in the C57/BL6 background (172). On the other hand, the production of anti-ribosomal P autoantibodies was common in SJL but rare in BALB/c mice (173). Even within the same strain, the female gender is more susceptible to autoantibody production and kidney disease development following TMPD treatment (141). We found that these discrepancies are not explained by differences in TLR7 activation and IFN-I production. Among the wild-type mice tested in our studies (BALB/c, C57/BL6, 129Sv, C3H), the expression of ISGs two weeks after treatment was similar regardless of strain or sex. Further studies will be required to examine the contribution of genetics and sex in this model. Therapeutic Implications With accumulating evidence on the pathogenic role of IFN-I in SLE, monoclonal antibodies to IFNas well as IFNAR are already being tested in phase I clinical trials. However, efficacy of these antibodies has not been shown in murine lupus, probably due to the absence of IFN-I dysregulation in most spontaneous models (C Szeto, et al., Manuscript in Preparation). A possible unwanted effect of global IFN-I blockade is an increased risk for viral infection, a problem that may be reduced by selectively inhibiting TLR7 while leaving other pathways of IFN-I induction intact. In fact, oligodeoxynucleotides capable of antagonizing 120

PAGE 121

TLR7 and/or TLR9 have also been recently described (80). These compounds have ameliorated disease features in MRL-lpr (174), but effects on IFN-I were not reported Based on our findings, the TMPD model offers the unique opportunity to assess therapeutic approaches targeting IFN-I as well as TLR7. The appearance of the interferon signature and accumulation of Ly6C hi monocytes within two weeks of TMPD treatment allow rapid assessment of the efficacy of IFN-I inhibition by various therapeutic approaches. In addition, the sequential generation of lupus autoantibodies and the development of glomerulonephritis (as well as arthritis and pulmonary vasculitis) in the TMPD model further allow the evaluation of clinical efficacy in long-term studies. Conclusion The work presented here illustrates the important contribution of innate immunity to the development of autoimmunity in the TMPD model of SLE. Our findings define for the first time a pathway responsible for chronic overproduction of IFN-I, a feature seen in more than half of SLE patients. In addition, we have identified a novel subset of IFN-producing cells and uncovered novel actions of IFN-I. These studies enhance our understanding of the TMPD model and argue against current paradigms for the pathogenesis of SLE, which are based largely on in vitro findings. Although the complexity of the TMPD-induced lupus has just begun to unravel, our findings may provide novel insight into the pathogenesis of human SLE as well. 121

PAGE 122

Figure 6-1. Proposed model of TMPD-induced inflammation. Upon i.p. administration of TMPD (1), TLR7-dependent production of IFN-I by cells in the peritoneal cavity (2) induces the production of MCP-1 (3), which elicits release of immature inflammatory monocytes from the bone marrow and induces the expression of TLR7 on Ly6C hi monocytes. Ly6C hi monocytes recruited to the site of inflammation become a major source of IFN-I and CCL2/MCP-1 (5), establishing a vicious cycle of IFN-I production and monocyte recruitment. IFN-I further perpetuate the inflammatory response by inducing the expression of more TLR7 (7), exacerbating the overproduction of IFN-I. Finally, the chronic presence of high levels of IFN-I induces the activation of lymphocytes and dendritic cells (8), initiating inappropriate immune response to autoantigens. 122

PAGE 123

Figure 6-2. Enhancement TLR7 stimulation by TMPD in vitro. A) ELISA for IL-6 production in J774 cells cultured in the presence of R848 (1 g/mL), TMPD incorporated in serum (1 g/mL), or TMPD (300 M) solubilized in ethanol, DMSO, mannide monooleate (MM) or -cyclodextrin (-CyD). ND, not detectable. B) ELISA (IL-6 IL-12 and MCP-1) and flow cytometric analysis (CD80 and CD86) in J774 cells or C) bone marrow-derived macrophages cultured for 20 h with or without TMPD and stimulated with PBS, R848 (1 g/mL) or ODN 2395 (2g/mL) for 24 h. Mean fluorescent intensity (MFI) values are provided in each histogram. D) Comparison of IL-6 production and CD80 expression (MFI) in J774 cells cultured with various hydrocarbon oils and stimulated with PBS or R848. E) Flow cytometry and RT-PCR analysis of TLR7 expression in J774 cells cultured with or without TMPD for 20 h. Data are representative of three or more independent experiments. 123

PAGE 124

Figure 6-3. Endocytosis and phagocytosis are not affected by TMPD treatment. Quantification of endocytosis (FITC-dextran) and phagocytosis (FITC-microbeads and DiD-labeled apoptotic cells) in J774 cells treated with or without TMPD. Shaded curve represents the staining of cells prior to the addition of fluorescent substrates. 124

PAGE 125

Figure 6-4. Profile of autoantibody production in TLR7 -/mice. ELISA measurement of serum IgM and IgG autoantibodies against A) nRNP/Sm, B) dsDNA, C) ssDNA, and D) chromatin in wild-type BALB/c (n = 12) and TLR7 -/mice (n = 8) 24 weeks after TMPD treatment. p<0.05; ns: not significant (Mann-Whitney U test). 125

PAGE 126

Figure 6-5. Accumulation of Ly6C hi monocytes in lipogranulomas. Flow cytometry analysis comparing the presence of Ly6C hi monocytes A) in the peritoneal cavity two weeks after TMPD treatment and B) in the peritoneal cavity as well as lipogranulomas 6 months after treatment. 126

PAGE 127

LIST OF REFERENCES 1. Reeves, W.H., Narain,S., and Satoh,M. 2004. Autoantibodies in systemic lupus erythematosus. In Arthritis and Allied Conditions. L.W. W.J.Koopman and Moreland, editor. Lippincott Williams & Wilkins, Philadelphia, PA. 1497-1521. 2. Hanh, B.H. 2005. Systemic Lupus Erythematosus. In Harrison's Principles of Internal Medicine. D.L.e.a. Kasper, editor. McGraw-Hill Medical, New York City. 1956-1967. 3. Deapen, D., A. Escalante, L. Weinrib, D. Horwitz, B. Bachman, P. Roy-Burman, A. Walker, and T.M. Mack. 1992. A revised estimate of twin concordance in systemic lupus erythematosus. Arthritis Rheum 35:311-318. 4. Tsao, B.P., and H. Wu. 2006. Genetics of Human Lupus. In Dubois' Lupus Erythematosus. D.J.e.a. Wallace, editor. Lippincott Williams & Wilkins. 54-80. 5. Alarcon-Segovia, D., M.E. Alarcon-Riquelme, M.H. Cardiel, F. Caeiro, L. Massardo, A.R. Villa, and B.A. Pons-Estel. 2005. Familial aggregation of systemic lupus erythematosus, rheumatoid arthritis, and other autoimmune diseases in 1,177 lupus patients from the GLADEL cohort. Arthritis Rheum 52:1138-1147. 6. Tan, E.M., A.S. Cohen, J.F. Fries, A.T. Masi, D.J. McShane, N.F. Rothfield, J.G. Schaller, N. Talal, and R.J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25:1271-1277. 7. Hochberg, M.C. 1997. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis & Rheumatism 40:1725. 8. Arbuckle, M.R., M.T. McClain, M.V. Rubertone, R.H. Scofield, G.J. Dennis, J.A. James, and J.B. Harley. 2003. Development of autoantibodies before the clinical onset of systemic lupus erythematosus. N Engl J Med 349:1526-1533. 9. Urowitz, M.B., A.A. Bookman, B.E. Koehler, D.A. Gordon, H.A. Smythe, and M.A. Ogryzlo. 1976. The bimodal mortality pattern of systemic lupus erythematosus. Am J Med 60:221-225. 10. Klinman, D.M., A. Shirai, Y. Ishigatsubo, J. Conover, and A.D. Steinberg. 1991. Quantitation of IgMand IgG-secreting B cells in the peripheral blood of patients with systemic lupus erythematosus. Arthritis Rheum 34:1404-1410. 11. Liossis, S.N., B. Kovacs, G. Dennis, G.M. Kammer, and G.C. Tsokos. 1996. B cells from patients with systemic lupus erythematosus display abnormal antigen receptor-mediated early signal transduction events. J Clin Invest 98:2549-2557. 12. Odendahl, M., A. Jacobi, A. Hansen, E. Feist, F. Hiepe, G.R. Burmester, P.E. Lipsky, A. Radbruch, and T. Dorner. 2000. Disturbed peripheral B lymphocyte homeostasis in systemic lupus erythematosus. J Immunol 165:5970-5979. 127

PAGE 128

13. Liossis, S.N., X.Z. Ding, G.J. Dennis, and G.C. Tsokos. 1998. Altered pattern of TCR/CD3-mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. Deficient expression of the T cell receptor zeta chain. J Clin Invest 101:1448-1457. 14. Desai-Mehta, A., L. Lu, R. Ramsey-Goldman, and S.K. Datta. 1996. Hyperexpression of CD40 ligand by B and T cells in human lupus and its role in pathogenic autoantibody production. J Clin Invest 97:2063-2073. 15. Goldman, J.A., A. Litwin, L.E. Adams, R.C. Krueger, and E.V. Hess. 1972. Cellular immunity to nuclear antigens in systemic lupus erythematosus. J Clin Invest 51:2669-2677. 16. Gottlieb, A.B., R.G. Lahita, N. Chiorazzi, and H.G. Kunkel. 1979. Immune function in systemic lupus erythematosus. Impairment of in vitro T-cell proliferation and in vivo antibody response to exogenous antigen. J Clin Invest 63:885-892. 17. Linker-Israeli, M., R.J. Deans, D.J. Wallace, J. Prehn, T. Ozeri-Chen, and J.R. Klinenberg. 1991. Elevated levels of endogenous IL-6 in systemic lupus erythematosus. A putative role in pathogenesis. J Immunol 147:117-123. 18. Llorente, L., W. Zou, Y. Levy, Y. Richaud-Patin, J. Wijdenes, J. Alcocer-Varela, B. Morel-Fourrier, J.C. Brouet, D. Alarcon-Segovia, P. Galanaud, and D. Emilie. 1995. Role of interleukin 10 in the B lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. J Exp Med 181:839-844. 19. Pers, J.O., C. Daridon, V. Devauchelle, S. Jousse, A. Saraux, C. Jamin, and P. Youinou. 2005. BAFF overexpression is associated with autoantibody production in autoimmune diseases. Ann N Y Acad Sci 1050:34-39. 20. Kurt-Jones, E.A., S. Hamberg, J. Ohara, W.E. Paul, and A.K. Abbas. 1987. Heterogeneity of helper/inducer T lymphocytes. I. Lymphokine production and lymphokine responsiveness. J Exp Med 166:1774-1787. 21. Haas, C., B. Ryffel, and M. Le Hir. 1997. IFN-gamma is essential for the development of autoimmune glomerulonephritis in MRL/Ipr mice. J Immunol 158:5484-5491. 22. Haas, C., B. Ryffel, and M. Le Hir. 1998. IFN-gamma receptor deletion prevents autoantibody production and glomerulonephritis in lupus-prone (NZB x NZW)F1 mice. J Immunol 160:3713-3718. 23. Richards, H.B., M. Satoh, J.C. Jennette, B.P. Croker, H. Yoshida, and W.H. Reeves. 2001. Interferon-gamma is required for lupus nephritis in mice treated with the hydrocarbon oil pristane. Kidney Int 60:2173-2180. 24. Calvani, N., M. Satoh, B.P. Croker, W.H. Reeves, and H.B. Richards. 2003. Nephritogenic autoantibodies but absence of nephritis in Il-12p35-deficient mice with pristane-induced lupus. Kidney Int 64:897-905. 128

PAGE 129

25. Pittoni, V., and G. Valesini. 2002. The clearance of apoptotic cells: implications for autoimmunity. Autoimmun Rev 1:154-161. 26. Herrmann, M., R.E. Voll, O.M. Zoller, M. Hagenhofer, B.B. Ponner, and J.R. Kalden. 1998. Impaired phagocytosis of apoptotic cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41:1241-1250. 27. Kelly, K.M., H. Zhuang, D.C. Nacionales, P.O. Scumpia, R. Lyons, J. Akaogi, P. Lee, B. Williams, M. Yamamoto, S. Akira, M. Satoh, and W.H. Reeves. 2006. "Endogenous adjuvant" activity of the RNA components of lupus autoantigens Sm/RNP and Ro 60. Arthritis Rheum 54:1557-1567. 28. Vallin, H., A. Perers, G.V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus. J Immunol 163:6306-6313. 29. Tew, M.B., R.W. Johnson, J.D. Reveille, and F.K. Tan. 2001. A molecular analysis of the low serum deoxyribonuclease activity in lupus patients. Arthritis Rheum 44:2446-2447. 30. Hooks, J.J., H.M. Moutsopoulos, S.A. Geis, N.I. Stahl, J.L. Decker, and A.L. Notkins. 1979. Immune interferon in the circulation of patients with autoimmune disease. N Engl J Med 301:5-8. 31. Baechler, E.C., F.M. Batliwalla, G. Karypis, P.M. Gaffney, W.A. Ortmann, K.J. Espe, K.B. Shark, W.J. Grande, K.M. Hughes, V. Kapur, P.K. Gregersen, and T.W. Behrens. 2003. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc Natl Acad Sci U S A 100:2610-2615. 32. Bennett, L., A.K. Palucka, E. Arce, V. Cantrell, J. Borvak, J. Banchereau, and V. Pascual. 2003. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med 197:711-723. 33. Zhuang, H., S. Narain, E. Sobel, P.Y. Lee, D.C. Nacionales, K.M. Kelly, H.B. Richards, M. Segal, C. Stewart, M. Satoh, and W.H. Reeves. 2005. Association of anti-nucleoprotein autoantibodies with upregulation of Type I interferon-inducible gene transcripts and dendritic cell maturation in systemic lupus erythematosus. Clin Immunol. 34. Diaz, M.O., H.M. Pomykala, S.K. Bohlander, E. Maltepe, K. Malik, B. Brownstein, and O.I. Olopade. 1994. Structure of the human type-I interferon gene cluster determined from a YAC clone contig. Genomics 22:540-552. 35. Fountain, J.W., M. Karayiorgou, D. Taruscio, S.L. Graw, A.J. Buckler, D.C. Ward, N.C. Dracopoli, and D.E. Housman. 1992. Genetic and physical map of the interferon region on chromosome 9p. Genomics 14:105-112. 36. Pestka, S., C.D. Krause, and M.R. Walter. 2004. Interferons, interferon-like cytokines, and their receptors. Immunol Rev 202:8-32. 129

PAGE 130

37. Darnell, J.E., Jr., I.M. Kerr, and G.R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415-1421. 38. Schindler, C., X.Y. Fu, T. Improta, R. Aebersold, and J.E. Darnell, Jr. 1992. Proteins of transcription factor ISGF-3: one gene encodes the 91-and 84-kDa ISGF-3 proteins that are activated by interferon alpha. Proc Natl Acad Sci U S A 89:7836-7839. 39. Fu, X.Y., C. Schindler, T. Improta, R. Aebersold, and J.E. Darnell, Jr. 1992. The proteins of ISGF-3, the interferon alpha-induced transcriptional activator, define a gene family involved in signal transduction. Proc Natl Acad Sci U S A 89:7840-7843. 40. Goh, K.C., S.J. Haque, and B.R. Williams. 1999. p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. Embo J 18:5601-5608. 41. Li, Y., A. Sassano, B. Majchrzak, D.K. Deb, D.E. Levy, M. Gaestel, A.R. Nebreda, E.N. Fish, and L.C. Platanias. 2004. Role of p38alpha Map kinase in Type I interferon signaling. J Biol Chem 279:970-979. 42. Uddin, S., B. Majchrzak, J. Woodson, P. Arunkumar, Y. Alsayed, R. Pine, P.R. Young, E.N. Fish, and L.C. Platanias. 1999. Activation of the p38 mitogen-activated protein kinase by type I interferons. J Biol Chem 274:30127-30131. 43. Theofilopoulos, A.N., R. Baccala, B. Beutler, and D.H. Kono. 2005. Type I interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol 23:307-336. 44. Dalod, M., T. Hamilton, R. Salomon, T.P. Salazar-Mather, S.C. Henry, J.D. Hamilton, and C.A. Biron. 2003. Dendritic cell responses to early murine cytomegalovirus infection: subset functional specialization and differential regulation by interferon alpha/beta. J Exp Med 197:885-898. 45. Doyle, S., S. Vaidya, R. O'Connell, H. Dadgostar, P. Dempsey, T. Wu, G. Rao, R. Sun, M. Haberland, R. Modlin, and G. Cheng. 2002. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17:251-263. 46. Sen, G.C., and R.M. Ransohoff. 1993. Interferon-induced antiviral actions and their regulation. Adv Virus Res 42:57-102. 47. Marrack, P., J. Kappler, and T. Mitchell. 1999. Type I interferons keep activated T cells alive. J Exp Med 189:521-530. 48. Finkelman, F.D., A. Svetic, I. Gresser, C. Snapper, J. Holmes, P.P. Trotta, I.M. Katona, and W.C. Gause. 1991. Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice. J Exp Med 174:1179-1188. 130

PAGE 131

49. Le Bon, A., G. Schiavoni, G. D'Agostino, I. Gresser, F. Belardelli, and D.F. Tough. 2001. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14:461-470. 50. Sharif, M.N., I. Tassiulas, Y. Hu, I. Mecklenbrauker, A. Tarakhovsky, and L.B. Ivashkiv. 2004. IFN-alpha priming results in a gain of proinflammatory function by IL-10: implications for systemic lupus erythematosus pathogenesis. J Immunol 172:6476-6481. 51. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu Rev Immunol 21:335-376. 52. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301:640-643. 53. Kagan, J.C., T. Su, T. Horng, A. Chow, S. Akira, and R. Medzhitov. 2008. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol 9:361-368. 54. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol 3:196-200. 55. Diebold, S.S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303:1529-1531. 56. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740-745. 57. Levy, D.E., I. Marie, E. Smith, and A. Prakash. 2002. Enhancement and diversification of IFN induction by IRF-7-mediated positive feedback. J Interferon Cytokine Res 22:87-93. 58. Sato, M., N. Hata, M. Asagiri, T. Nakaya, T. Taniguchi, and N. Tanaka. 1998. Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7. FEBS Lett 441:106-110. 59. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K.J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C.S. Koh, C. Reis e Sousa, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441:101-105. 60. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730-737. 131

PAGE 132

61. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K.J. Ishii, O. Takeuchi, and S. Akira. 2005. IPS-1, an adaptor triggering RIG-Iand Mda5-mediated type I interferon induction. Nat Immunol 6:981-988. 62. Stetson, D.B., and R. Medzhitov. 2006. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity 24:93-103. 63. Ishii, K.J., C. Coban, H. Kato, K. Takahashi, Y. Torii, F. Takeshita, H. Ludwig, G. Sutter, K. Suzuki, H. Hemmi, S. Sato, M. Yamamoto, S. Uematsu, T. Kawai, O. Takeuchi, and S. Akira. 2006. A Toll-like receptor-independent antiviral response induced by double-stranded B-form DNA. Nat Immunol 7:40-48. 64. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, and M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 5:919-923. 65. Coccia, E.M., M. Severa, E. Giacomini, D. Monneron, M.E. Remoli, I. Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral infection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol 34:796-805. 66. Dzionek, A., Y. Sohma, J. Nagafune, M. Cella, M. Colonna, F. Facchetti, G. Gunther, I. Johnston, A. Lanzavecchia, T. Nagasaka, T. Okada, W. Vermi, G. Winkels, T. Yamamoto, M. Zysk, Y. Yamaguchi, and J. Schmitz. 2001. BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction. J Exp Med 194:1823-1834. 67. Izaguirre, A., B.J. Barnes, S. Amrute, W.S. Yeow, N. Megjugorac, J. Dai, D. Feng, E. Chung, P.M. Pitha, and P. Fitzgerald-Bocarsly. 2003. Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells. J Leukoc Biol 74:1125-1138. 68. Diebold, S.S., M. Montoya, H. Unger, L. Alexopoulou, P. Roy, L.E. Haswell, A. Al-Shamkhani, R. Flavell, P. Borrow, and C. Reis e Sousa. 2003. Viral infection switches non-plasmacytoid dendritic cells into high interferon producers. Nature 424:324-328. 69. Matsui, K., Y. Kumagai, H. Kato, S. Sato, T. Kawagoe, S. Uematsu, O. Takeuchi, and S. Akira. 2006. Cutting edge: Role of TANK-binding kinase 1 and inducible IkappaB kinase in IFN responses against viruses in innate immune cells. J Immunol 177:5785-5789. 70. Kalkner, K.M., L. Ronnblom, A.K. Karlsson Parra, M. Bengtsson, Y. Olsson, and K. Oberg. 1998. Antibodies against double-stranded DNA and development of polymyositis during treatment with interferon. Qjm 91:393-399. 71. Ioannou, Y., and D.A. Isenberg. 2000. Current evidence for the induction of autoimmune rheumatic manifestations by cytokine therapy. Arthritis Rheum 43:1431-1442. 132

PAGE 133

72. Ronnblom, L.E., G.V. Alm, and K.E. Oberg. 1991. Autoimmunity after alpha-interferon therapy for malignant carcinoid tumors. Ann Intern Med 115:178-183. 73. Wilson, L.E., D. Widman, S.H. Dikman, and P.D. Gorevic. 2002. Autoimmune disease complicating antiviral therapy for hepatitis C virus infection. Semin Arthritis Rheum 32:163-173. 74. Blanco, P., A.K. Palucka, M. Gill, V. Pascual, and J. Banchereau. 2001. Induction of dendritic cell differentiation by IFN-alpha in systemic lupus erythematosus. Science 294:1540-1543. 75. Kirou, K.A., C. Lee, S. George, K. Louca, I.G. Papagiannis, M.G. Peterson, N. Ly, R.N. Woodward, K.E. Fry, A.Y. Lau, J.G. Prentice, J.G. Wohlgemuth, and M.K. Crow. 2004. Coordinate overexpression of interferon-alpha-induced genes in systemic lupus erythematosus. Arthritis Rheum 50:3958-3967. 76. Kirou, K.A., C. Lee, S. George, K. Louca, M.G. Peterson, and M.K. Crow. 2005. Activation of the interferon-alpha pathway identifies a subgroup of systemic lupus erythematosus patients with distinct serologic features and active disease. Arthritis Rheum 52:1491-1503. 77. Vallin, H., S. Blomberg, G.V. Alm, B. Cederblad, and L. Ronnblom. 1999. Patients with systemic lupus erythematosus (SLE) have a circulating inducer of interferon-alpha (IFN-alpha) production acting on leucocytes resembling immature dendritic cells. Clin Exp Immunol 115:196-202. 78. Barton, G.M., J.C. Kagan, and R. Medzhitov. 2006. Intracellular localization of Toll-like receptor 9 prevents recognition of self DNA but facilitates access to viral DNA. Nat Immunol 7:49-56. 79. Means, T.K., E. Latz, F. Hayashi, M.R. Murali, D.T. Golenbock, and A.D. Luster. 2005. Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9. J Clin Invest 115:407-417. 80. Barrat, F.J., T. Meeker, J. Gregorio, J.H. Chan, S. Uematsu, S. Akira, B. Chang, O. Duramad, and R.L. Coffman. 2005. Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus. J Exp Med 202:1131-1139. 81. Savarese, E., O.W. Chae, S. Trowitzsch, G. Weber, B. Kastner, S. Akira, H. Wagner, R.M. Schmid, S. Bauer, and A. Krug. 2006. U1 small nuclear ribonucleoprotein immune complexes induce type I interferon in plasmacytoid dendritic cells through TLR7. Blood 107:3229-3234. 82. Bave, U., M. Magnusson, M.L. Eloranta, A. Perers, G.V. Alm, and L. Ronnblom. 2003. Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG. J Immunol 171:3296-3302. 133

PAGE 134

83. Marshak-Rothstein, A. 2006. Toll-like receptors in systemic autoimmune disease. Nat Rev Immunol 6:823-835. 84. Ronnblom, L., M.L. Eloranta, and G.V. Alm. 2006. The type I interferon system in systemic lupus erythematosus. Arthritis Rheum 54:408-420. 85. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann. 2002. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol 168:4531-4537. 86. Farkas, L., K. Beiske, F. Lund-Johansen, P. Brandtzaeg, and F.L. Jahnsen. 2001. Plasmacytoid dendritic cells (natural interferonalpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol 159:237-243. 87. Burnet, F.M., and M.C. Holmes. 1965. The natural history of the NZB/NZW F1 hybrid mouse: a laboratory model of systemic lupus erythematosus. Australas Ann Med 14:185-191. 88. Mathian, A., A. Weinberg, M. Gallegos, J. Banchereau, and S. Koutouzov. 2005. IFN-alpha induces early lethal lupus in preautoimmune (New Zealand Black x New Zealand White) F1 but not in BALB/c mice. J Immunol 174:2499-2506. 89. Santiago-Raber, M.L., R. Baccala, K.M. Haraldsson, D. Choubey, T.A. Stewart, D.H. Kono, and A.N. Theofilopoulos. 2003. Type-I interferon receptor deficiency reduces lupus-like disease in NZB mice. J Exp Med 197:777-788. 90. Jorgensen, T.N., E. Roper, J.M. Thurman, P. Marrack, and B.L. Kotzin. 2007. Type I interferon signaling is involved in the spontaneous development of lupus-like disease in B6.Nba2 and (B6.Nba2 x NZW)F(1) mice. Genes Immun 8:653-662. 91. Pisetsky, D.S., G.A. McCarty, and D.V. Peters. 1980. Mechanisms of autoantibody production in autoimmune MRL mice. J Exp Med 152:1302-1310. 92. Hron, J.D., and S.L. Peng. 2004. Type I IFN protects against murine lupus. J Immunol 173:2134-2142. 93. Nacionales, D.C., K.M. Kelly-Scumpia, P.Y. Lee, J.S. Weinstein, R. Lyons, E. Sobel, M. Satoh, and W.H. Reeves. 2007. Deficiency of the type I interferon receptor protects mice from experimental lupus. Arthritis Rheum 56:3770-3783. 94. Anderson, P.N., and M. Potter. 1969. Induction of plasma cell tumours in BALB-c mice with 2,6,10,14-tetramethylpentadecane (pristane). Nature 222:994-995. 95. Hoogenraad, N., T. Helman, and J. Hoogenraad. 1983. The effect of pre-injection of mice with pristane on ascites tumour formation and monoclonal antibody production. J Immunol Methods 61:317-320. 134

PAGE 135

96. Satoh, M., and W.H. Reeves. 1994. Induction of lupus-associated autoantibodies in BALB/c mice by intraperitoneal injection of pristane. J Exp Med 180:2341-2346. 97. Satoh, M., A. Kumar, Y.S. Kanwar, and W.H. Reeves. 1995. Anti-nuclear antibody production and immune-complex glomerulonephritis in BALB/c mice treated with pristane. Proc Natl Acad Sci U S A 92:10934-10938. 98. Yoshida, H., M. Satoh, K.M. Behney, C.G. Lee, H.B. Richards, V.M. Shaheen, J.Q. Yang, R.R. Singh, and W.H. Reeves. 2002. Effect of an exogenous trigger on the pathogenesis of lupus in (NZB x NZW)F1 mice. Arthritis Rheum 46:2235-2244. 99. Jung, S., D. Unutmaz, P. Wong, G. Sano, K. De los Santos, T. Sparwasser, S. Wu, S. Vuthoori, K. Ko, F. Zavala, E.G. Pamer, D.R. Littman, and R.A. Lang. 2002. In vivo depletion of CD11c(+) dendritic cells abrogates priming of CD8(+) T cells by exogenous cell-associated antigens. Immunity 17:211-220. 100. Scumpia, P.O., P.F. McAuliffe, K.A. O'Malley, R. Ungaro, T. Uchida, T. Matsumoto, D.G. Remick, M.J. Clare-Salzler, L.L. Moldawer, and P.A. Efron. 2005. CD11c+ dendritic cells are required for survival in murine polymicrobial sepsis. J Immunol 175:3282-3286. 101. Kumar, H., T. Kawai, H. Kato, S. Sato, K. Takahashi, C. Coban, M. Yamamoto, S. Uematsu, K.J. Ishii, O. Takeuchi, and S. Akira. 2006. Essential role of IPS-1 in innate immune responses against RNA viruses. J Exp Med 203:1795-1803. 102. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1and IL-18-mediated function. Immunity 9:143-150. 103. Nacionales, D.C., K.M. Kelly, P.Y. Lee, H. Zhuang, Y. Li, J.S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, and W.H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue developing in response to 2,6,10,14-tetramethyl-pentadecane (pristane). Am J Pathol 168:1227-1240. 104. Janz, S., and E. Shacter. 1991. A new method for delivering alkanes to mammalian cells: preparation and preliminary characterization of an inclusion complex between beta-cyclodextrin and pristane (2,6,10,14-tetramethylpentadecane). Toxicology 69:301-315. 105. Sunderkotter, C., T. Nikolic, M.J. Dillon, N. Van Rooijen, M. Stehling, D.A. Drevets, and P.J. Leenen. 2004. Subpopulations of mouse blood monocytes differ in maturation stage and inflammatory response. J Immunol 172:4410-4417. 106. Van Rooijen, N., and A. Sanders. 1994. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Methods 174:83-93. 135

PAGE 136

107. Cook, A.D., E.L. Braine, and J.A. Hamilton. 2003. The phenotype of inflammatory macrophages is stimulus dependent: implications for the nature of the inflammatory response. J Immunol 171:4816-4823. 108. Geissmann, F., S. Jung, and D.R. Littman. 2003. Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19:71-82. 109. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O'Garra, C. Biron, F. Briere, and G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat Immunol 2:1144-1150. 110. Spangrude, G.J., Y. Aihara, I.L. Weissman, and J. Klein. 1988. The stem cell antigens Sca-1 and Sca-2 subdivide thymic and peripheral T lymphocytes into unique subsets. J Immunol 141:3697-3707. 111. Kassim, S.H., N.K. Rajasagi, X. Zhao, R. Chervenak, and S.R. Jennings. 2006. In vivo ablation of CD11c-positive dendritic cells increases susceptibility to herpes simplex virus type 1 infection and diminishes NK and T-cell responses. J Virol 80:3985-3993. 112. Asselin-Paturel, C., G. Brizard, J.J. Pin, F. Briere, and G. Trinchieri. 2003. Mouse strain differences in plasmacytoid dendritic cell frequency and function revealed by a novel monoclonal antibody. J Immunol 171:6466-6477. 113. Blasius, A.L., E. Giurisato, M. Cella, R.D. Schreiber, A.S. Shaw, and M. Colonna. 2006. Bone marrow stromal cell antigen 2 is a specific marker of type I IFN-producing cells in the naive mouse, but a promiscuous cell surface antigen following IFN stimulation. J Immunol 177:3260-3265. 114. Kuroda, Y., J. Akaogi, D.C. Nacionales, S.C. Wasdo, N.J. Szabo, W.H. Reeves, and M. Satoh. 2004. Distinctive patterns of autoimmune response induced by different types of mineral oil. Toxicol Sci 78:222-228. 115. Dumont, F.J., and L.Z. Coker. 1986. Interferon-alpha/beta enhances the expression of Ly-6 antigens on T cells in vivo and in vitro. Eur J Immunol 16:735-740. 116. Serbina, N.V., and E.G. Pamer. 2006. Monocyte emigration from bone marrow during bacterial infection requires signals mediated by chemokine receptor CCR2. Nat Immunol 7:311-317. 117. Kadowaki, N., S. Antonenko, J.Y. Lau, and Y.J. Liu. 2000. Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med 192:219-226. 118. Scheinecker, C., B. Zwolfer, M. Koller, G. Manner, and J.S. Smolen. 2001. Alterations of dendritic cells in systemic lupus erythematosus: phenotypic and functional deficiencies. Arthritis Rheum 44:856-865. 136

PAGE 137

119. Tacke, F., D. Alvarez, T.J. Kaplan, C. Jakubzick, R. Spanbroek, J. Llodra, A. Garin, J. Liu, M. Mack, N. van Rooijen, S.A. Lira, A.J. Habenicht, and G.J. Randolph. 2007. Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques. J Clin Invest 117:185-194. 120. Hemmi, H., T. Kaisho, K. Takeda, and S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J Immunol 170:3059-3064. 121. Hornung, V., J. Ellegast, S. Kim, K. Brzozka, A. Jung, H. Kato, H. Poeck, S. Akira, K.K. Conzelmann, M. Schlee, S. Endres, and G. Hartmann. 2006. 5'-Triphosphate RNA is the ligand for RIG-I. Science 314:994-997. 122. Stockinger, S., B. Reutterer, B. Schaljo, C. Schellack, S. Brunner, T. Materna, M. Yamamoto, S. Akira, T. Taniguchi, P.J. Murray, M. Muller, and T. Decker. 2004. IFN regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is mediated by a TLRand Nod2-independent mechanism. J Immunol 173:7416-7425. 123. Pawar, R.D., P.S. Patole, D. Zecher, S. Segerer, M. Kretzler, D. Schlondorff, and H.J. Anders. 2006. Toll-like receptor-7 modulates immune complex glomerulonephritis. J Am Soc Nephrol 17:141-149. 124. Richards, H.B., M. Satoh, M. Shaw, C. Libert, V. Poli, and W.H. Reeves. 1998. Interleukin 6 dependence of anti-DNA antibody production: evidence for two pathways of autoantibody formation in pristane-induced lupus. J Exp Med 188:985-990. 125. Ikeda, K., M. Satoh, K.M. Pauley, M.J. Fritzler, W.H. Reeves, and E.K. Chan. 2006. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody. J Immunol Methods 317:38-44. 126. Takaoka, A., Z. Wang, M.K. Choi, H. Yanai, H. Negishi, T. Ban, Y. Lu, M. Miyagishi, T. Kodama, K. Honda, Y. Ohba, and T. Taniguchi. 2007. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448:501-505. 127. Bauer, J.W., E.C. Baechler, M. Petri, F.M. Batliwalla, D. Crawford, W.A. Ortmann, K.J. Espe, W. Li, D.D. Patel, P.K. Gregersen, and T.W. Behrens. 2006. Elevated serum levels of interferon-regulated chemokines are biomarkers for active human systemic lupus erythematosus. PLoS Med 3:e491. 128. Batteux, F., P. Palmer, M. Daeron, B. Weill, and P. Lebon. 1999. FCgammaRII (CD32)-dependent induction of interferon-alpha by serum from patients with lupus erythematosus. Eur Cytokine Netw 10:509-514. 129. Yasuda, K., C. Richez, J.W. Maciaszek, N. Agrawal, S. Akira, A. Marshak-Rothstein, and I.R. Rifkin. 2007. Murine dendritic cell type I IFN production induced by human IgG-RNA immune complexes is IFN regulatory factor (IRF)5 and IRF7 dependent and is required for IL-6 production. J Immunol 178:6876-6885. 137

PAGE 138

130. Murphy, E.D., and J.B. Roths. 1979. A Y chromosome associated factor in strain BXSB producing accelerated autoimmunity and lymphoproliferation. Arthritis Rheum 22:1188-1194. 131. Izui, S., M. Higaki, D. Morrow, and R. Merino. 1988. The Y chromosome from autoimmune BXSB/MpJ mice induces a lupus-like syndrome in (NZW x C57BL/6)F1 male mice, but not in C57BL/6 male mice. Eur J Immunol 18:911-915. 132. Bolland, S., Y.S. Yim, K. Tus, E.K. Wakeland, and J.V. Ravetch. 2002. Genetic modifiers of systemic lupus erythematosus in FcgammaRIIB(-/-) mice. J Exp Med 195:1167-1174. 133. Subramanian, S., K. Tus, Q.Z. Li, A. Wang, X.H. Tian, J. Zhou, C. Liang, G. Bartov, L.D. McDaniel, X.J. Zhou, R.A. Schultz, and E.K. Wakeland. 2006. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proc Natl Acad Sci U S A 103:9970-9975. 134. Pisitkun, P., J.A. Deane, M.J. Difilippantonio, T. Tarasenko, A.B. Satterthwaite, and S. Bolland. 2006. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science 312:1669-1672. 135. Deane, J.A., P. Pisitkun, R.S. Barrett, L. Feigenbaum, T. Town, J.M. Ward, R.A. Flavell, and S. Bolland. 2007. Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity 27:801-810. 136. Christensen, S.R., J. Shupe, K. Nickerson, M. Kashgarian, R.A. Flavell, and M.J. Shlomchik. 2006. Toll-like receptor 7 and TLR9 dictate autoantibody specificity and have opposing inflammatory and regulatory roles in a murine model of lupus. Immunity 25:417-428. 137. Hamilton, K.J., M. Satoh, J. Swartz, H.B. Richards, and W.H. Reeves. 1998. Influence of microbial stimulation on hypergammaglobulinemia and autoantibody production in pristane-induced lupus. Clin Immunol Immunopathol 86:271-279. 138. Satoh, M., J.J. Langdon, C.H. Chou, D.P. McCauliffe, E.L. Treadwell, T. Ogasawara, M. Hirakata, A. Suwa, P.L. Cohen, R.A. Eisenberg, and et al. 1994. Characterization of the Su antigen, a macromolecular complex of 100/102 and 200-kDa proteins recognized by autoantibodies in systemic rheumatic diseases. Clin Immunol Immunopathol 73:132-141. 139. Jakymiw, A., K. Ikeda, M.J. Fritzler, W.H. Reeves, M. Satoh, and E.K. Chan. 2006. Autoimmune targeting of key components of RNA interference. Arthritis Res Ther 8:R87. 140. Lee, P.Y., Y. Li, H.B. Richards, F.S. Chan, H. Zhuang, S. Narain, E.J. Butfiloski, E.S. Sobel, W.H. Reeves, and M.S. Segal. 2007. Type I interferon as a novel risk factor for endothelial progenitor cell depletion and endothelial dysfunction in systemic lupus erythematosus. Arthritis Rheum 56:3759-3769. 138

PAGE 139

141. Smith, D.L., X. Dong, S. Du, M. Oh, R.R. Singh, and R.R. Voskuhl. 2007. A female preponderance for chemically induced lupus in SJL/J mice. Clin Immunol 122:101-107. 142. Clynes, R., N. Calvani, B.P. Croker, and H.B. Richards. 2005. Modulation of the immune response in pristane-induced lupus by expression of activation and inhibitory Fc receptors. Clin Exp Immunol 141:230-237. 143. Satoh, M., J.P. Weintraub, H. Yoshida, V.M. Shaheen, H.B. Richards, M. Shaw, and W.H. Reeves. 2000. Fas and Fas ligand mutations inhibit autoantibody production in pristane-induced lupus. J Immunol 165:1036-1043. 144. Lau, C.M., C. Broughton, A.S. Tabor, S. Akira, R.A. Flavell, M.J. Mamula, S.R. Christensen, M.J. Shlomchik, G.A. Viglianti, I.R. Rifkin, and A. Marshak-Rothstein. 2005. RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. J Exp Med 202:1171-1177. 145. Berland, R., L. Fernandez, E. Kari, J.H. Han, I. Lomakin, S. Akira, H.H. Wortis, J.F. Kearney, A.A. Ucci, and T. Imanishi-Kari. 2006. Toll-like receptor 7-dependent loss of B cell tolerance in pathogenic autoantibody knockin mice. Immunity 25:429-440. 146. Kuroda, Y., D.C. Nacionales, J. Akaogi, W.H. Reeves, and M. Satoh. 2004. Autoimmunity induced by adjuvant hydrocarbon oil components of vaccine. Biomed Pharmacother 58:325-337. 147. Vollmer, J., S. Tluk, C. Schmitz, S. Hamm, M. Jurk, A. Forsbach, S. Akira, K.M. Kelly, W.H. Reeves, S. Bauer, and A.M. Krieg. 2005. Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp Med 202:1575-1585. 148. Bly, J.E., L.R. Garrett, and M.A. Cuchens. 1990. Pristane induced changes in rat lymphocyte membrane fluidity. Cancer Biochem Biophys 11:145-154. 149. Jego, G., A.K. Palucka, J.P. Blanck, C. Chalouni, V. Pascual, and J. Banchereau. 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19:225-234. 150. Kumar, V., A. Abbas, and N. Fausto. 2004. Robbins & Cotran Pathologic Basis of Disease. Elsevier Health Sciences, Philadephia, PA. 1552 pp. 151. Swirski, F.K., P. Libby, E. Aikawa, P. Alcaide, F.W. Luscinskas, R. Weissleder, and M.J. Pittet. 2007. Ly-6Chi monocytes dominate hypercholesterolemia-associated monocytosis and give rise to macrophages in atheromata. J Clin Invest 117:195-205. 152. Cancro, M., and M. Potter. 1976. The requirement of an adherent cell substratum for the growth of developing plasmacytoma cells in vivo. J Exp Med 144:1554-1567. 139

PAGE 140

153. Richards, H.B., M. Satoh, V.M. Shaheen, H. Yoshida, and W.H. Reeves. 1999. Induction of B cell autoimmunity by pristane. Curr Top Microbiol Immunol 246:387-392; discussion 393. 154. Lee, P.Y., J.S. Weinstein, D.C. Nacionales, P.O. Scumpia, Y. Li, E. Butfiloski, N. van Rooijen, L. Moldawer, M. Satoh, and W.H. Reeves. 2008. A novel Type I IFN-producing cell subset in murine lupus. J Immunol 180:5101-5108. 155. Toshchakov, V., B.W. Jones, P.Y. Perera, K. Thomas, M.J. Cody, S. Zhang, B.R. Williams, J. Major, T.A. Hamilton, M.J. Fenton, and S.N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-beta-induced STAT1alpha/beta-dependent gene expression in macrophages. Nat Immunol 3:392-398. 156. Mills, C.D., K. Kincaid, J.M. Alt, M.J. Heilman, and A.M. Hill. 2000. M-1/M-2 macrophages and the Th1/Th2 paradigm. J Immunol 164:6166-6173. 157. Munder, M., M. Mallo, K. Eichmann, and M. Modolell. 1998. Murine macrophages secrete interferon gamma upon combined stimulation with interleukin (IL)-12 and IL-18: A novel pathway of autocrine macrophage activation. J Exp Med 187:2103-2108. 158. Martinon, F., V. Petrilli, A. Mayor, A. Tardivel, and J. Tschopp. 2006. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature 440:237-241. 159. Dostert, C., V. Petrilli, R. Van Bruggen, C. Steele, B.T. Mossman, and J. Tschopp. 2008. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 320:674-677. 160. Martinon, F., K. Burns, and J. Tschopp. 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10:417-426. 161. Moore, J.M., and T.V. Rajan. 1994. Pristane retards clearance of particulate materials from the peritoneal cavity of laboratory mice. J Immunol Methods 173:273-278. 162. Salazar-Mather, T.P., T.A. Hamilton, and C.A. Biron. 2000. A chemokine-to-cytokine-to-chemokine cascade critical in antiviral defense. J Clin Invest 105:985-993. 163. Salazar-Mather, T.P., C.A. Lewis, and C.A. Biron. 2002. Type I interferons regulate inflammatory cell trafficking and macrophage inflammatory protein 1alpha delivery to the liver. J Clin Invest 110:321-330. 164. Tsou, C.L., W. Peters, Y. Si, S. Slaymaker, A.M. Aslanian, S.P. Weisberg, M. Mack, and I.F. Charo. 2007. Critical roles for CCR2 and MCP-3 in monocyte mobilization from bone marrow and recruitment to inflammatory sites. J Clin Invest 117:902-909. 165. Jia, T., N.V. Serbina, K. Brandl, M.X. Zhong, I.M. Leiner, I.F. Charo, and E.G. Pamer. 2008. Additive roles for MCP-1 and MCP-3 in CCR2-mediated recruitment of 140

PAGE 141

inflammatory monocytes during Listeria monocytogenes infection. J Immunol 180:6846-6853. 166. Kalden, J.R. 1997. Defective phagocytosis of apoptotic cells: possible explanation for the induction of autoantibodies in SLE. Lupus 6:326-327. 167. Niessner, A., M.S. Shin, O. Pryshchep, J.J. Goronzy, E.L. Chaikof, and C.M. Weyand. 2007. Synergistic proinflammatory effects of the antiviral cytokine interferon-alpha and Toll-like receptor 4 ligands in the atherosclerotic plaque. Circulation 116:2043-2052. 168. Yla-Herttuala, S., B.A. Lipton, M.E. Rosenfeld, T. Sarkioja, T. Yoshimura, E.J. Leonard, J.L. Witztum, and D. Steinberg. 1991. Expression of monocyte chemoattractant protein 1 in macrophage-rich areas of human and rabbit atherosclerotic lesions. Proc Natl Acad Sci U S A 88:5252-5256. 169. Roman, M.J., B.A. Shanker, A. Davis, M.D. Lockshin, L. Sammaritano, R. Simantov, M.K. Crow, J.E. Schwartz, S.A. Paget, R.B. Devereux, and J.E. Salmon. 2003. Prevalence and correlates of accelerated atherosclerosis in systemic lupus erythematosus. N Engl J Med 349:2399-2406. 170. Mehta, V.B., J. Hart, and M.D. Wewers. 2001. ATP-stimulated release of interleukin (IL)-1beta and IL-18 requires priming by lipopolysaccharide and is independent of caspase-1 cleavage. J Biol Chem 276:3820-3826. 171. Chen, C.J., H. Kono, D. Golenbock, G. Reed, S. Akira, and K.L. Rock. 2007. Identification of a key pathway required for the sterile inflammatory response triggered by dying cells. Nat Med 13:851-856. 172. Akaogi, J., D.C. Nacionales, Y. Kuroda, W.H. Reeves, and M. Satoh. 2003. Ecotropic murine leukemia viruses and exogenous mouse mammary tumor viruses are not essential for pristane-induced lupus. Arthritis Rheum 48:2990-2992. 173. Satoh, M., K.J. Hamilton, A.K. Ajmani, X. Dong, J. Wang, Y.S. Kanwar, and W.H. Reeves. 1996. Autoantibodies to ribosomal P antigens with immune complex glomerulonephritis in SJL mice treated with pristane. J Immunol 157:3200-3206. 174. Pawar, R.D., A. Ramanjaneyulu, O.P. Kulkarni, M. Lech, S. Segerer, and H.J. Anders. 2007. Inhibition of Toll-like receptor-7 (TLR-7) or TLR-7 plus TLR-9 attenuates glomerulonephritis and lung injury in experimental lupus. J Am Soc Nephrol 18:1721-1731. 141

PAGE 142

BIOGRAPHICAL SKETCH Pui Yuen Lee was born in 1981, in Guangzhou, China. He moved to Florida, USA, with his family in 1993 and graduated from Palm Beach Gardens High School in 1999. He then attended the University of Florida, where he graduated with highest honors in 2002 and received Bachelor of Science degrees in molecular biology and medical sciences. Pui was admitted to the University of Florida Junior Honors Medical Program in 2001 and subsequently the MD-PhD program in 2002. Pui began his research studies in Dr. Mark Segals laboratory with the University Scholars Program in 2000 and completed his undergraduate thesis there after 2 years. During the summer before medical school, he completed a Clinical Research Center fellowship in Dr. Westley Reeves laboratory. Following the first year of medical school, Pui was accepted to the NIH/NSF East Asia fellowship program, where he spent the summer working in Dr. Shizuo Akiras laboratory in Osaka University in Japan. In 2004, Pui returned to Dr. Reeves laboratory to begin his Ph.D. training and studied the role of type-I interferons and Toll-like receptors in a mouse model of lupus. Upon completing the Ph.D. degree, he plans to finish the final two years of medical school and enter residency training in internal medicine. 142