<%BANNER%>

Elucidating the Function and Expression Pattern of a Novel Adenine Nucleotide Translocase, Ant4

Permanent Link: http://ufdc.ufl.edu/UFE0022493/00001

Material Information

Title: Elucidating the Function and Expression Pattern of a Novel Adenine Nucleotide Translocase, Ant4
Physical Description: 1 online resource (84 p.)
Language: english
Creator: Brower, Jeffrey
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The adenine nucleotide translocases (Ant) facilitate the transport of ADP and ATP by an antiport mechanism across the inner mitochondrial membrane, thus playing an essential role in cellular energy metabolism. We recently identified a novel member of the Ant family in mouse, Ant4, of which gene configuration as well as amino acid homology is well conserved among mammals. The conservation of Ant4 in mammals, along with the absence of Ant4 in non-mammalian species, suggests a unique and indispensable role for this ADP/ATP carrier gene in mammalian development. Of interest, in contrast to its paralog Ant2, which is encoded by the X chromosome and ubiquitously expressed in somatic cells, Ant4 is encoded by an autosome and selectively expressed in testicular germ cells. Immunohistochemical examination as well as RNA expression analysis using separated spermatogenic cell types revealed that Ant4 expression was particularly high at the spermatocyte stage. When we generated Ant4 deficient mice by targeted disruption, a significant reduction in testicular size was observed without any other distinguishable abnormalities in mice. Histological examination as well as stage-specific gene expression analysis in adult and neonatal testes revealed a severe reduction of spermatocytes accompanied by increased apoptosis. Subsequently, the Ant4 deficient male mice were infertile. Taken together, these data elucidated the indispensable role of Ant4 in murine spermatogenesis. Considering the unique conservation and chromosomal location of the Ant family genes in mammals, Ant4 gene may have arose in mammalian ancestors and been conserved in mammals to serve as the sole and essential mitochondrial ADP/ATP carrier during spermatogenesis where the sex chromosome-linked Ant2 gene is inactivated.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jeffrey Brower.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Terada, Naohiro.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022493:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022493/00001

Material Information

Title: Elucidating the Function and Expression Pattern of a Novel Adenine Nucleotide Translocase, Ant4
Physical Description: 1 online resource (84 p.)
Language: english
Creator: Brower, Jeffrey
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The adenine nucleotide translocases (Ant) facilitate the transport of ADP and ATP by an antiport mechanism across the inner mitochondrial membrane, thus playing an essential role in cellular energy metabolism. We recently identified a novel member of the Ant family in mouse, Ant4, of which gene configuration as well as amino acid homology is well conserved among mammals. The conservation of Ant4 in mammals, along with the absence of Ant4 in non-mammalian species, suggests a unique and indispensable role for this ADP/ATP carrier gene in mammalian development. Of interest, in contrast to its paralog Ant2, which is encoded by the X chromosome and ubiquitously expressed in somatic cells, Ant4 is encoded by an autosome and selectively expressed in testicular germ cells. Immunohistochemical examination as well as RNA expression analysis using separated spermatogenic cell types revealed that Ant4 expression was particularly high at the spermatocyte stage. When we generated Ant4 deficient mice by targeted disruption, a significant reduction in testicular size was observed without any other distinguishable abnormalities in mice. Histological examination as well as stage-specific gene expression analysis in adult and neonatal testes revealed a severe reduction of spermatocytes accompanied by increased apoptosis. Subsequently, the Ant4 deficient male mice were infertile. Taken together, these data elucidated the indispensable role of Ant4 in murine spermatogenesis. Considering the unique conservation and chromosomal location of the Ant family genes in mammals, Ant4 gene may have arose in mammalian ancestors and been conserved in mammals to serve as the sole and essential mitochondrial ADP/ATP carrier during spermatogenesis where the sex chromosome-linked Ant2 gene is inactivated.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jeffrey Brower.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Terada, Naohiro.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022493:00001


This item has the following downloads:


Full Text





ELUCIDATING THE FUNCTION AND EXPRESSION PATTERN OF A NOVEL ADENINE
NUCLEOTIDE TRANSLOCASE, ANT4
















By

JEFFREY VINCENT BROWER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008



































2008 Jeffrey V. Brower































To my loving parents, family and friends for all of their continued support and encouragement









ACKNOWLEDGMENTS

I would like to first thank my mentor, Dr. Naohiro Terada without whom none of this work

would have been possible. Dr. Terada's constant wisdom, guidance, insight and friendship have

been the reason for any success I have had during my graduate career. The environment that Dr.

Terada creates for all of his graduate students is one of comfort and understanding while at the

same time stimulation of critical thinking and innovation. I could never begin to express in words

my absolute gratitude and respect for him. I would next like to thank Dr. Paul Oh who has been

my "second" mentor. Dr. Oh's contributions to my development as a graduate student and

individual have been immense and I can not begin to thank him enough. I would also like to

thank all of my committee members, Dr. David Julian, Dr. Jim Resnick and Dr. Stephen Sugrue

for their continued insight and essential assistance with my research. I would also like to thank

our collaborator Dr. John McCarrey at the University of Texas at San Antonio for his significant

contributions to my work.

Next, I would like to thank all of the members of the Terada lab, past and present, whom

all have made a significant impact on my graduate career and overall happiness. In particular, Dr.

Masahiro (Max) Oka, who oversaw a large part of my technical development, and also Dr.

Takashi (Charlie) Hamazaki, Dr. Nemanja Rodic, Dr. Michael Rutenberg, Dr. Amar Singh, Dr.

Sarah Kehoe, Dr. Brad Willenberg, Amy Meacham, and Katherine Hankowski.

I would like to give a special thanks to my parents, Clay and Cynthia, and my brother

Jamie, whose love, support and encouragement are unwavering. Finally I would like to thank the

rest of my family and friends who have supported me in many ways, without which I may have

not been so successful in my graduate studies.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

LIST OF FIGURES .................................. .. ..... ..... ................. .7

A B S T R A C T ......... ....................... .................. .......................... ................ .. 9

CHAPTER

1 INTRODUCTION ............... ................. ........... ................................. 11

M itochondria.......... .......................... ................................................. 11
M itochondrial Structure........ .......................................................................... ........ ..... .. .11
M itoch on drial F u n action .............................................................................. ......................13
A denine N ucleotide Translocases................................................. .............................. 15
Adenine Nucleotide Translocase 4 ............................. ......................................... 16
S p e rm ato g e n e sis ............................................................................................................... 1 7
M eiosis I .............. .... ...............................................................17
M e io sis II ................... ...................1...................9..........
S p e rm io g e n e sis ................................................................................................................. 1 9
Som atic Cell Supportive Function................................................... 20

2 M A TER IA L S A N D M ETH O D S ..................................................................................... 22

Im m unostaining .................. .................................................................... 22
Preparation of Stage-specific Spermatogenic Cells................................................. 23
R e a l-T im e P C R ................................................................................................................. 2 3
T targeting V sector C construction ....................................................................................24
Generation of Ant4-- M ice .... ....................................................................................24
Southern Blotting ................... ...................................25
P C R G en o ty p in g ............................................................................................................... 2 6
Im m unoblotting ................................................................27
R T -P C R A n aly sis .............................................................................2 7
T U N E L A ssay ..................................................................2 9
X -gal Staining ................... ...................2...................9..........
M eiotic C hrom osom al Spreads.......................................................... ...............................30
Prom other A analysis .............................................. ........ ........................ ...................... 31
Bisulfite Sequencing and Combined Bisulfite Restriction Analysis .............. ............... 31

3 R E SU L T S .............. ... ................................................................33

A nt4 Phylogeny ................................ ........ ... ... .........................33
The Autosomal Ant4 Gene is Conserved in Mammals ................. ................. ..........33
A nt4 E expression P pattern ...................... ............................... .. ....................34
Ant4 Expression is Highest in Primary Spermatocytes ..........................................................34









A nt4 Function W within the Testis..................................................................................... 36
Generation of Mice with a Targeted Disruption of Ant4 ........................... .......... 36
Ant4 Deficient Mice Exhibit Impaired Spermatogenesis and Infertility............................. 37
A nt4/- G erm Cells U ndergo M eiotic A rrest...................................................... ..................37
Ant4 Deficient Mice Possess a Decreased Number of Pachytene Spermatocytes and an
Absence ofDiplotene Sperm atocytes ........................................................................... 38
Ant4 Deficient Male Mice Exhibit Increased Levels of Apoptosis Within the Testis...........39
A nt4 Prom other CpG A analysis ............................................... ................... ............... 40
Identification of CpG Islands at the Promoter Regions of Antl, Ant2 and Ant4 .................41
Real-Time PCR Analysis of Anti, Ant2 and Ant4 Transcript Levels in Various Tissues.....41
Methylation Analysis of Anti, Ant2, and An4 Promoter Proximal CpG's in Various
T issues......... .......................... ...................................... ......... ...... 42

4 DISCUSSION AND CONCLUSION .............................................................................72

L IST O F R E F E R E N C E S ............... ............ ........... .............................. ....................................79

B IO G R A PH IC A L SK E T C H .............................................................................. .....................84











LIST OF FIGURES

Figure page

3-1 Phylogeny of ADP, ATP carrier proteins. .............................................. ............... 44

3-2 Ant4 expression is highest in mouse spermatocytes ......................................................45

3-3 Ant4 expression is highest in human spermatocytes. .............................. ................46

3-4 Ant4 is localized to the sperm midpiece. ........................................ ........................ 47

3-5 A nt4 peaks during m eiosis I. ..................................................................... ..................48

3-6 Ant2 levels are low to absent during meiosis I....................................... ............... 49

3-7 Histological analysis of Ant4 protein within the ovaries.............................................50

3-8 G ene targeting of A nt4. ...................... ........ ................ ... .... ........ ..... .. ... 51

3-9 Confirmation of disrupted Ant4 Gene. ........................................ ......................... 52

3-10 Ant4 promoter-driven 3-galactosidase expression pattern in testes..............................53

3-11 Severe reduction of testicular mass in Ant4-deficient mice. .......................... ..........54

3-12 Ant4-deficient testis exhibit gross histological abnormalities..........................................55

3-13 Testicular w eight analysis............................................... ................... ............... 56

3-14 Transcript analysis of Ant-deficient testis. ........... ... ............. ............57

3-15 Sycp3 Chrom osom al analysis. ................................................. ............................... 58

3-16 Ant4 wild-type spermatocytic chromosomal spread............................... ...............59

3-17 Ant4-deficient testis lack diplotene spermatocytes..........................................................60

3-18 Pachytene abnormalities in Ant4-deficient spermatocytes.........................................61

3-19 Quantification of spermatocytes in Ant4-deficient testis............................................62

3-20 Sperm atocyte counts. .......................... ...... ..................... .... ...... ......... 63

3-21 Apoptotic analysis of Ant4-deficient testis in comparison to controls..............................64

3-22 Cleaved Caspase-3 analysis. ...... ........................... ..........................................65











3-23 Postnatal development in the Ant4+/- and Ant4-/- testis............... .............. .............66

3-24 Adenine nucleotide translocase promoter analysis............ .................... ..................67

3-25 Anti, Ant2, and Ant4 transcript level analysis in various tissues. ...................................68

3-26 Combined bisulfite restriction analysis (COBRA) of Anti, Ant2, and Ant4 promoter
proxim al CpG dinucleotides.. .............................. ... ......................................... 69

3-27 Bisulfite sequence analysis of Anti, Ant2, and Ant4 promoter proximal CpG
islands ......................................................... ...................................70

3-28 Methylation and expression correlation of Anti, Ant2, and Ant4 in various tissues........71










Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


ELUCIDATING THE FUNCTION AND EXPRESSION PATTERN OF A NOVEL ADENINE
NUCLEOTIDE TRANSLOCASE, ANT4

By

Jeffrey V. Brower

August 2008

Chair: Naohiro Terada
Major: Medical Sciences-Molecular Cell Biology

The adenine nucleotide translocases (Ant) facilitate the transport of ADP and ATP by an

antiport mechanism across the inner mitochondrial membrane, thus playing an essential role in

cellular energy metabolism. We recently identified a novel member of the Ant family in mouse,

Ant4, of which gene configuration as well as amino acid homology is well conserved among

mammals. The conservation of Ant4 in mammals, along with the absence of Ant4 in non-

mammalian species, suggests a unique and indispensable role for this ADP/ATP carrier gene in

mammalian development. Of interest, in contrast to its paralog Ant2, which is encoded by the X

chromosome and ubiquitously expressed in somatic cells, Ant4 is encoded by an autosome and

selectively expressed in testicular germ cells. Immunohistochemical examination as well as RNA

expression analysis using separated spermatogenic cell types revealed that Ant4 expression was

particularly high at the spermatocyte stage. When we generated Ant4 deficient mice by targeted

disruption, a significant reduction in testicular size was observed without any other

distinguishable abnormalities in mice. Histological examination as well as stage-specific gene

expression analysis in adult and neonatal testes revealed a severe reduction of spermatocytes

accompanied by increased apoptosis. Subsequently, the Ant4 deficient male mice were infertile.









Taken together, these data elucidated the indispensable role of Ant4 in murine spermatogenesis.

Considering the unique conservation and chromosomal location of the Ant family genes in

mammals, Ant4 gene may have arose in mammalian ancestors and been conserved in mammals

to serve as the sole and essential mitochondrial ADP/ATP carrier during spermatogenesis where

the sex chromosome-linked Ant2 gene is inactivated.









CHAPTER 1
INTRODUCTION

Mitochondria

The mitochondria are membrane enclosed organelles ranging in size from 1-10 [im and are

found in most eukaryotic cells (1,2). The mitochondria are often described as the "power houses"

of the cell due to the role they play in ATP production from ADP and Pi. They are responsible

for the vast majority of the ATP produced for utilization by the cell in its many energy

demanding processes. The mitochondria have also been implicated to play a role in ageing, the

cellular death cascade, cell signaling, cellular differentiation, as well as growth and cell cycle

control (3). Mitochondria have also been shown to play a role in many disease pathologies

(mitochondrial mutations disease). The mitochondrion is believed to have arisen through the

engulfment, by an early eukaryote, of a simpler bacterial prokaryote. These two organisms then

developed a relationship in which both benefited and thus became symbionts.

Mitochondrial Structure

The mitochondria have a specialized structure in order to most efficiently support their

numerous functions. The mitochondrion consists of both an inner and an outer membrane

composed of phospholipid bilayers containing numerous proteins (2,4). The inner and outer

membranes are separated by what is known as the intermembrane space. The invaginations of

the inner membrane are known as cristae, and the region within the inner membrane is the

matrix.

The mitochondrial outer membrane is composed of both a phospholipid bilayer and

proteins, enclosing the organelle. The outer membrane has a phospholipid to protein ration of

about 1:1 by weight, similar to the eukaryotic cell membrane (2,4). Contained within the outer

membrane are integral proteins called porins which allow for the free diffusion of molecules of a









molecular weight of 5000 Daltons or less (2,4). There is a multi-subunit protein termed the

translocase of the outer membrane that is able to actively move larger proteins containing an N-

terminal signaling sequence, across the membrane and into the intermembrane space (5).

The intermembrane space contains a similar concentration of ions and sugars to that of the

cytosol since the outer membrane is permeable to small molecules (4). The composition of larger

protein molecules however, is quite different since they must possess a specific targeting

sequence to be translocated into the intermembrane space (2,5).

The mitochondrial inner membrane contains the majority of the proteins that play a role in

energy metabolism. The inner membrane contains proteins with essentially four types of

functions, protein import, regulation of metabolite passage into and out of the matrix, the

carrying out of the redox reactions essential to oxidative phosphorylation, and ATP synthesis

(2,4). The protein to phospholipid ratio of the inner membrane is different from that of the outer

membrane as the protein composition is much greater (3:1 by weight) (4). The inner membrane

is also unique in that it is rich in an unusual phospholipid, cardiolipin, which was originally

discovered in bovine hearts (6). Cardiolipin is unique in that it contains four fatty acids rather

than the characteristic two, which may play a role in making the inner membrane more highly

impermeable to all molecules (2,4). It is important to note that the mitochondrial inner membrane

does not contain porins and almost all ions require a specific transporter to enter or exit the

matrix compartment. This impermeability of the inner membrane is essential for the production

of the membrane potential established by the action of the enzymes of the electron transport

chain. The inner membrane contains folds known as cristae.

The cristae, which are formed by the invaginations of the inner membrane, are responsible

for expanding the surface area of the inner membrane. This increased surface area provides more









space for the enzymes of the electron transport chain thus increasing the mitochondrion's ability

to produce ATP. Cells which possess a higher demand for ATP, typically contain more cristae

(4).

The space enclosed by the inner membrane is known as the matrix and contains

approximately 2/3 of the total proteins present within the mitochondria (4). The matrix contains a

mixture of enzymes, specialized mitochondrial ribosomes, tRNA, and mitochondrial DNA. A

published human mitochondrial DNA sequence consisted of 16, 569 base pairs which encoded

37 total genes, 24 tRNA and rRNAs and 13 peptides (2,7). The mitochondrion has a specialized

structure in order to carry out its many essential functions.

Mitochondrial Function

The mitochondria are most well known for the production of ATP for utilization during the

cell's many metabolic processes (1,2,8). The mitochondrion however, is also involved in many

other cellular pathways and processes.

The mitochondria are highly invested in the process of energy metabolism and rely on

glycolysis, which occurs in the cytoplasm, to metabolize glucose. Briefly, glucose is

phosphorylated by hexokinase to form glucose-6-phosphate which is subsequently rearranged to

form fructose-6-phosphate. Fructose-6-phosphate is split by aldolase into two triose sugars,

dihydroxyacetone phosphate and glyceraldehyde 3-phosphate (2,8-12). Dihydroxyacetone

phosphate is rapidly converted into glyceraldehyde 3-phosphate by triosephosphate isomerase.

The two molecules of glyceraldehyde 3-phosphate are then dehydrogenated and phosphorylated

to make 1,3-biphosphoglycerate. The 1,3-biphosphoglycerate molecules are then converted into

3-phosphoglycerate and subsequently 2-phosphoglycerate. 2-phosphoglyecerate next becomes

phosphoenolpyruvate which is finally converted into pyruvate. The pyruvate is then converted









into Acetyl CoA by pyruvate dehydrogenase which can subsequently enter the tricarboxylic acid

cycle (TCA cycle). (2, 8-12) The process of glycolysis produces an overall 2 net ATP molecules.

The tricarboxylic acid cycle utilizes Acetyl CoA as the initial substrate. The TCA cycle

takes place in the matrix of the mitochondria. Briefly, Acetyl CoA is converted into Citrate by

Citrate synthase, which is next converted into Isocitrate by Aconitase. Isocitrate is then

converted into a-ketogluterate by isocitrate dehydrogenase, which is subsequently converted into

Succinyl-CoA by a-ketogluterate dehydrogenase. Succinyl-CoA is converted into Succinate by

the Succinyl-CoA synthetase (2, 8-12). Succinate dehydrogenase then converts Succinate into

Fumerate which is subsequently converted into Malate through the action of Fumarase. Malate is

finally converted into Oxaloacetate by Malate dehydrogenase. The TCA cycle produces two net

GDP molecules from each molecule of glucose. During this cycle NAD+ is reduced to NADH

during the conversions of Isocitrate to a-ketogluterate, a-ketogluterate to Succinyl-CoA, and

Malate to Oxaloacetate (2, 8-12). These reduced electron carriers are then utilized by the electron

transport chain.

The electron transport chain is located along the mitochondrial inner membrane and is

composed of a number of complexes (Complexes I-IV) that mediate the transfer of electrons

along the transport chain. Complex I, also known as NADH dehydrogenase, accepts two

electrons from NADH and transfers them to ubiquinone, a lipid soluble carrier which is able to

diffuse readily through the membrane (2, 8-12). Complex I is also responsible for pumping two

protons into the intermembrane space. Complex III, cytochrome bcl, accepts two electrons from

the reduced ubiquinone (QH2) and transfers them to two molecules of cytochrome C one at a

time. Complex III also pumps two protons into the intermembrane space (2, 8-12). Complex IV,

also known as cytochrome c oxidase, next removes four electrons from four cytochrome c









molecules. Complex IV also pumps four protons into the intermembrane space. In turn complex

IV transfers these electrons to the terminal electron acceptor, molecular oxygen producing water,

thus the absolute necessity of 02. Next the F FO ATP synthase utilizes the proton gradient that

has been established by the coupled electron transport and hydrogen shuttling, to produce ATP

from ADP and Pi (2, 8-12). The FIFO ATP synthase relies on the availability of ADP and also

the removal of ATP for subsequent ATP production. This essential function is carried out by the

adenine nucleotide translocases.

Adenine Nucleotide Translocases

The adenine nucleotide translocase/translocator (Ant), also called ADP/ATP carrier (Aac),

belongs to the mitochondrial solute carrier family which supports a variety of transport activities

across the mitochondrial inner membrane (13-19). The Ant proteins facilitate the exchange of

ADP/ATP by an antiport mechanism across the inner membrane of the mitochondria, (13,15,16)

and thus are considered to be essential for the utilization of ATP produced by oxidative

respiration (13-16,20). The Ant proteins are also thought to be an integral component of the

mitochondrial permeability transition pore (21-23), although this function is still in question (24).

The Ant proteins are the most abundant proteins of the mitochondrial inner membrane and

are comprised of approximately 300-320 amino acid residues which form six transmembrane

helices. The functional unit is likely a homodimer acting as a gated pore that channels single

molecules of ADP and ATP (25) Until recently, it has been believed that humans posses three

members of the ANT family of genes: ANT] (SLC25A4), which is expressed primarily in the

heart and skeletal muscle; ANT2 (SLC25A5), which is expressed in rapidly growing cells and is

inducible; and ANT3 (SLC25A6), which appears to be constitutively expressed in all tissues

(26,27). In contrast, rodents were believed to possess only two members of the Ant family: Ant]

which is expressed at high levels in heart, skeletal muscle, and brain; and Ant2 which is









expressed in all tissues but skeletal muscle (14). Mouse Ant2 is the ortholog of human ANT2 and

seems to combine the functions of human ANT2 and ANT3 (28,29). Genetic inactivation of Ant]

resulted in viable mice (15). However, these animals developed mitochondrial myopathy and

severe exercise intolerance along with hypertrophic cardiomyopathy (15,19). In humans, there is

a clinical manifestation known as autosomal dominant progressive external opthalmoplegia

(adPEO) which is associated with ANTI as well as TWINKLE, and POLymutation (30). This

disorder is characterized molecularly by the accumulation of numerous mitochondrial DNA

mutations and clinically by the appearance of external opthalmoplegia, ptosis, and progressive

skeletal muscle weakness (31). In the cases of ANTI mutation, Al 14P, L98P, A90D, D104G,

and V289M substitutions have been reported to be associated with adPEO (32). Gene disruption

of Ant2 in mice appears to result in embryonic to perinatal lethality, although a detailed

phenotype has not yet been published (http://www.patentdebate.com/PATAPP/20050091704).

There have been no reports regarding ANT2 or ANT3 mutations in human.

Adenine Nucleotide Translocase 4

Utilizing various approaches, we and others recently identified a novel member of the Ant

family, Ant4, both in mouse and human (16,17,33). The mouse Ant4 gene was predicted to

encode a 320 amino acid protein, and shared amino acid sequence homology with the other

mouse Ant proteins previously identified (70.1% and 69.1% overall amino acid identity to Anti

and Ant2, respectively). The Ant4 gene also contained three tandem repeats of a domain of

approximately 100 residues, each domain containing two transmembrane regions, a characteristic

shared by all members of the Ant family (34). Dolce et al. demonstrated that human ANT4

(AAC4) indeed localizes to mitochondria in cells and can actively exchange ADP for ATP by an









electrogenic antiport mechanism in vitro. Of interest, the Ant4 gene is expressed selectively in

the testis, both in mouse and human (17,33).

Spermatogenesis

The recently discovered Ant4 is expressed exclusively within the testis. The testis are

composed of both somatic and germ cell populations. Within the testis is an extensive network of

tubular structures known as the seminiferous tubules (35, 36). The seminiferous tubules are the

sight of a highly specialized process known as spermatogenesis. Spermatogenesis is the process

by which a resident stem cell population gives rise to differentiating and maturing cells which

eventually become mature sperm.

Spermatogenesis occurs within the seminiferous tubules of the testis and commences

within the stem cells of the testis the spermatogonial cells (type A), located along the basal

lamina (37). The type A spermatogonia undergo an asymmetric mitotic cell division to give rise

to another type A and a type B spermatogonium. The type A spermatogonial cells proliferate

repeatedly and are responsible for the constant replenishment of the germinal cell population

within the seminiferous epithelium (36). The type B spermatogonia, which are the last cell type

of the seminiferous epithelium to be produced by means of a mitotic division, are committed to

enter meiosis I as primary spermatocytes. The process of meiosis is unique to gametogenesis and

is essential for the production of haploid gametes and thus preservation of the species.

Meiosis I

Meiosis is a highly specialized process restricted to the germinal cells of the gametes.

Meiosis I is initiated in the primary spermatocytes and is separated into interphase, prophase,

metaphase, telophase, and anaphase (38-41). During interphase the chromosomes replicate, prior

to prophase I. By prophase I of meiosis I, which is an elongated prophase in comparison to

prophase of mitosis and meiosis II, the chromosomes have replicated. This elongated prophase is









further broken down into leptotene, zygotene, pachytene, diplotene and diakinesis (40,41).

During leptotene the individual chromosomes begin to condense, forming long strands present

within the nucleus. At this point, sister chromatids are tightly associated with one another as to

be indistinguishable. Following leptotene is zygotene, during which time the chromosomes

condense further and become visibly distinguishable as long thread-like stands. At this point,

homologous chromosomes begin to seek out one another and initiate the process of synapsis.

This synapsis is mediated through the synaptonemal protein complex which allows homologous

chromosomes to align along their lengths and form tight associations with one another. The next

stage of prophase I is pachytene. During pachytene the complete condensation and synapsis of

homologous chromosomes is completed. The now completely synapsed homlogous

chromosomes are referred to as bivalents or tetrads due to the presence of the two sister

chromatids of each homologue (40). Pachytene is a very important stage of meiosis, as it is

responsible for the generation of genetic diversity. This genetic diversity arises from the random

process of genetic exchange that occurs between nonsister chromatids of homologous

chromosomes. Following pachytene is the stage known as diplotene. During diplotene the

synaptonemal complex begins to degrade and homologous chromosomes begin to separate from

one another, remaining tightly associated at chiasmata, the regions where crossing-over occurred.

During the next stage, diakinesis, the chromosomes further condense and the nuclear membrane

disintegrates and the meiotic spindle begins to form (40,41). Following prophase I is metaphase

I, during which kinetochore microtubules from both centrioles attach to the kinetochores of

homologues. The homologous chromosomes align along the equatorial plate due to a continuous

force exerted in a counterbalancing manner by the microtubules upon the bivalents. Random

assortment is generated based upon the random orientation of the bivalents about the metaphase









plane (38,40). Next the microtubules attached at the kinetochores shorten and pull homologous

chromosomes apart, towards opposing poles, during anaphase I (40). Following anaphase I the

centromeres arrive at the poles and each daughter cell now possesses half the number of

chromosomes. However, each chromosome consists of two sister chromatids. Cytokinesis

occurs, which is the pinching of the cellular membrane as to form two cells (38). The cells now

enter a resting state known as interphase II. During the above described process of meiosis I, the

diploid primary spermatocytes have undergone a reductive division, effectively halving their

chromosomal content. Subsequently meiosis II ensues, during which the secondary

spermatocytes undergo an equational division. At this point the primary spermatocyes become

secondary spermatocytes as they enter meiosis II.

Meiosis II

The secondary spermatocytes proceed through the stages of meiosis II, consisting of

interphase, prophase, metaphase, anaphase and telophase (38-41). These stages are similar to

meiosis I except that prophase I is not broken down into sub-stages as it was in meiosis I.

Briefly, during prophase II the nuclear envelope disappears, and the chromatids condense, in

metaphase II the microtubules associated with the kinetochore and attach at the polar centrioles

resulting in the formation of a metaphase II plate, oriented perpendicular to the metaphase I plate

(40). Next during anaphase II the sister chromatids are separated and moved to opposing poles.

Following anaphase II is telophase II which is similar to telophase I during which chromosomes

uncoil and lengthen, nuclear envelopes form and cellular cleavage occurs (38). The result is four

haploid cells which exit meiosis and become sparmatids.

Spermiogenesis

Spermatids are the haploid results of meiosis. Spermatids undergo further maturation and

terminal differentiation during the process known as spermiogenesis. There are three major









changes through which the spermatids must undertake. First the nucleus elongates and histones

are replaced with protamines which allow for the establishment of highly condensed chromatin.

This highly condensed transformation of the chromatin is necessary in order to accommodate the

significantly reduced cytosolic and nuclear compartments of the sperm. Next the Golgi apparatus

produces a lysosomal-like granule that forms above the nucleus, towards the tip of the

developing spermatid. This lysosomal granule will form the future acrosome which is an

essential component of the penetration of the zona pellucida and subsequent sperm/egg fusion

(36). Finally the spermatid elongates and forms a tail along which mitochondria are deposited in

the proximal region. Also excess cytoplasm is released as the residual cytoplasmic body (36).

Following the morphological changes that occur to the spermatids as they mature, release of

spermatozoa into the seminiferous tubule lumen occurs by the process of spermiation (36). The

entire process of spermatogenesis relies heavily on the somatic constituent of the testicular

environment.

Somatic Cell Supportive Function

The somatic cells present within the seminiferous epithelium provide support and direction

to the developing germ cells in various ways, and thus play an important role in the development

of the germ cell compartment of the testis. The Sertoli cell extends from the basement membrane

to the lumen of the seminiferous epithelium and is responsible for supporting and protecting the

developing germinal cells (36). The Sertoli cells have both endocrine and structural roles in the

development of the germ cells as they secrete a number of substances which have profound

effects on the maturation and progression of the germ cells.

Sertoli cells are responsible for the production and secretion of a number of factors

necessary for the maintenance and maturation of the germ cells (42,43). Some such factors

secreted by the Sertoli cells are, inhibins and activins, which together work to regulate the









secretion of FSH from the pituitary gland, glial cell-line derived neurotrophic factor (GDNF),

which plays a role in undifferentiating spermatogonial cell progression, and the Ets related

molecule (ERM), which is needed for spermatogonial stem cell maintenance, to name a few

(42,43). The Sertoli cells also play a very important role in the structural support of the

developing germ cell compartment.

The Sertoli cells are often referred to as the "nurse" or "mother" cells of the seminiferous

epithelium (36). In addition to providing secretary support, they also are responsible for the

structural and directional support of the germ cells. Sertoli cells are in direct contact with the

maturing germ cells from the spermatogonial stage all the way until their release into the

seminiferous epithelium as late spermatids. The tight junctions present between adjacent Sertoli

cells are responsible for the establishment and integrity of the blood-testis barrier (36, 42). This

Sertoli cell interaction separates the seminiferous epithelium into basal and adluminal

compartments. This blood-testis barrier mediated by Sertoli cell tight junctions, is responsible for

determining which molecules enter and exit the adluminal compartment. The blood-testis barrier

also makes the adluminal compartment and immune privileged site (42). The Sertoli cells also

determine when the maturing and differentiating spermatogonial cells will pass through the tight

junctions and into the adluminal compartment. Without the function of intact Sertoli cells,

spermatogenesis can not occur (42).









CHAPTER 2
MATERIALS AND METHODS

Immunostaining

Testes were harvested from 6-week-old wild-type or mutant male mice. All mice have

been maintained under standard specific-pathogen-free (SPF) conditions, and the procedures

performed on the mice were reviewed and approved by the University of Florida Institutional

Animal Care and Use Committee (IACUC). The tissues were then fixed in a mild fixative (10%

formalin) overnight with rocking. Following fixation the tissues were dehydrated using an

organic solvent (beginning with PBS and working towards more dehydrating solutions such as

Citrasol). The tissues were then imbedded in paraffin and sectioned. Formalin-fixed, paraffin

embedded human testis tissue was obtained through the University of Florida Department of

Pathology tissue bank. Use of human tissue was performed in accordance with IRB-approved

protocols at the University of Florida. Tissues were re-hydrated with organic solvents of

decreasing concentrations (beginning with Citrasol and moving towards more hydrating

solutions and ending with PBS). Deparaffinized and re-hydrated 5 [tm tissue sections were

stained with rabbit polyclonal antibodies against mouse Ant4, or a cleaved Caspase-3 (Cell

Signaling Technologies, Danvers, MA). Slides were blocked for endogenous peroxidase activity

and then unmasked in Target Retrieval Solution (Dako, Carpinteria, CA). Antibody was applied

at 1:600 (Ant4) or 1:200 (Caspase-3) for one hour at room temperature prior to identification

using the DAB Envision kit (Dako). An isotype and concentration matched negative control

section was included for each tissue. Slides were counterstained with hematoxylin. For

immunostaining of human ANT4, rabbit polyclonal antibodies were raised against the N-

terminal human ANT4 peptide (REPAKKKAEKRLFDC) and purified through an affinity

column using the same peptide (Sigma Genosys, The Woodlans, TX).









Preparation of Stage-specific Spermatogenic Cells

Stage-specific spermatogenic cells were prepared from neonatal, prepubertal and adult CD-

1 mice by sedimentation through a 2-4% BSA "Sta Put" gradient at unit gravity as described

previously (44). Specifically, primitive type A spermatogonia were recovered from testis of

male mice at 6 days postpartum (dpp). Similarly, type A and type B spermatogonia were

recovered from males at 8dpp, preleptotene, leptotene + zygotene, and juvenile pachytene

spermatocytes were recovered from males at 18 dpp, and adult pachytene spermatocytes, round

spermatids and residual cytoplasmic bodies were recovered from males at 60+ dpp. Purities of

recovered cell types were assessed on the basis of morphological characteristics when viewed

under phase optics and were >85% for prospermatogonia, spermatogonia, and juvenile

spermatocytes (preleptotene, leptotene plus zygotene, and juvenile pachytene) and >95% for

adult pachytene spermatocytes and round spermatids (44).

Real-Time PCR

Total RNA was extracted using the RNA aqueous kit (Ambion). cDNA was synthesized

using the HiCapacity cDNA Archive kit using random primers (Applied Biosystems, Foster City,

CA). Briefly, 10 [L Reverse Transcription Buffer, 4 [L 25X dNTPs, 10 [L 10X Random

Primers, 5 [iL MultiScribe Reverse Transcriptase, and 21 |iL ofnuclease-free H20 was incubated

with 50 iL of RNA (2 Gg). Reaction consisted of two steps, first a 25C incubation for 10

minutes, and second a 37C incubation for 120 minutes.

Real-time PCR reaction was performed using the TaqMan Gene Expression Assay

(Applied Biosystems) according to manufacturer's instructions. Each 20 [iL reaction consisted

of 10 iL of TaqMan Universal PCR Master Mix, No AmpErase-UNG; 1 iL of TaqMan Gene

Expression Assay Mix, for fl-actin (VIC-labeled), Ant4 (FAM-labeled), or Ant2 (FAM-labeled);

and 9 [L of cDNA (50 ng). Reactions were performed using Applied Biosystems 7900HT Fast









Real-Time PCR instrument. Gene expression analysis was performed using the comparative CT

method using /-actin for normalization.

Targeting Vector Construction

The targeting vector was designed to replace exons 2-4 of the mouse Ant4 gene with an

SV40 splicing donor/acceptor signals-IRES (internal ribosomal entry site)-Bgal-and PGKneor

(neomycin resistant gene cassette driven by the PGK promoter) cassette of the pNF-SIBN

targeting vector. The targeting construct was generated by sequential subcloning of the 5'

homology arm, 3' homology arm, and diphtheria toxin gene into the pNF-SIBN vector. A 2.0 kb

fragment containing exon 1 and a 5.3 kb fragment containing exons 5-6 was amplified from

mouse ES cell (R1, 129/SvJ strain) genomic DNA and used as the source of 5' and 3'

homologous arms for the targeting constructs, respectively. Targeting arms were amplified by

LA Taq PCR system (Takara, Madison, WI) with the following primers Ant4-5.f (5-

CCGCTCGAGCTCTCATTGTTTTAACTGGATACGTG), Ant4-5.r (5-

GCGTGTCGACTGGCCCTGCACATTCTCCAAAACACC), Ant4-3.f (5-

CCCGCTCGAGGAGTAATTGGTGACTTTAAGTGG) and Ant4-3.r (5-

GCGTGTCGACTGCTCACTAAATGGACTCTGGG). The homologous arms were cloned into

pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA). Following excision from pCR2.1-TOPO

vectors, the 5' homologous arm was ligated into the Xhol site, and the 3' homologous arm was

ligated into the SalI site in the pNF-SIBN targeting vector. To increase selection efficiency of

positive clones, we inserted the negative selection gene (diphtheria toxin) into the Xhol site.

Generation of Ant4-/- Mice

The targeting vector was linearized with SalI digestion, and transfected into J1 ES cells by

electroporation as we previously described (45). Genomic DNA from -450 G418-resistant

colonies was screened, and homologous recombination in ES cells confirmed by genomic









Southern blotting. Upon initial Southern blot screening with a 5' external probe followed by

confirmation with a 3' internal probe, three successfully targeted ES clones were identified. ES

cells from one positive clone were injected into blastocysts of the C57BL/6 (B6) strain. Chimeric

male mice were mated with females on a B6 background.

Southern Blotting

Genomic DNA was extracted using the DNA Wizard Genomic DNA purification Kit

(Promega, Madison, WI, http://www.promega.com). Briefly, mouse tails clips were performed to

obtain tissue. Tissue lysis solution was prepared by adding 120 [tL of a 0.5M EDTA to 500 [tL

of Nuclei Lysis Solution and chilled on ice until solution turns cloudy. Next 600 [iL of the lysis

solution was added to 0.5-1 cm of fresh mouse tail in a 1.5 ml microcentrifuge tube. To the

solution was added 17.5 [tL of 20 mg/ml Proteinase K. Samples were then incubated overnight in

a 55C water bath with gentle shaking. Following overnight incubation, 3 [tL of RNase solution

was added to the nuclear lysate, mixed by inversion and incubated at 37C for 17 minutes. The

samples were then allowed to cool to room temperature for approximately 5 minutes. Next, 250

ItL of Protein Precipitation Solution was added to the room temperature samples and placed at -

20C for approximately 5 minutes. Following incubation at -20C the samples were centrifuged

for 5 minutes at 15,700 g. The precipitated protein will form a tight white pellet. The supernatant

was carefully removed and transferred to a clean 1.5 ml microcentrifuge tube containing 600 [iL

of room temperature isopropanol. The samples were then gently mixed by inversion until white

thread-like strands of DNA began to be visible. The samples were then centrifuged for 5 minutes

at 15,700 g. The DNA was visible as a small white pellet and the supernatant was carefully

removed. Next, 600 [iL of room temperature 70% ethanol was added and the tubes were

vortexed gently and briefly to wash the pellet. The samples were then centrifuged for 1 minute at

15,700 g and the supernatant was removed carefully. The tubes were then inverted on a paper









towel and left to air-dry for 15 minutes. Following air-drying at room temperature, the samples

were placed into a heat block set to 90C for 1-3 minutes to ensure proper drying. The samples

were then rehydrated by placing them in 100 [iL of DNA rehydration solution overnight at 4C.

The genomic DNA was then deigested with BamHI and separated in 1% agarose gels. After

denaturation and neutralization of the gel, DNA was transferred to nylon membranes and

hybridized with specific 5' external and 3' internal probes.

PCR Genotyping

In order to rapidly and effectively determine the genotype of the resultant mice of set

matings, we developed a PCR based genotyping technique. Genomic DNA was extracted using

the DNA Wizard Genomic DNA purification Kit (Promega, Madison, WI,

http://www.promega.com). The DNA samples then underwent a PCR amplification using

primers specific for each allele. For the Ant4 targeted allele the forward primer was designed in

intron 1, and the reverse primer was designed at the splicing donor/acceptor site of the P-gal-

PGK-neomycin cassette. Primers F- GTTTTGGAGAATGTGCAGGG, R-

GCAACATCCACTGAGGAGCAGTTC. The resulting amplicon was approximately 250 bps. In

order to detect the wild-type allele, we designed primers to amplify the exon-intron 2 region

which was absent from the targeted allele. The forward primer was designed in exon 2 and the

reverse primer was designed in intron 2. Primers F- GGCAATTTGGCAAATGTTATTCG, R-

GCGATCCCTAGTTACTGAAACTAAG. The resulting amplification product was

approximately 350 bps. In order to effectively amplify from a genomic template, we designed a

genomic specific PCR program. Genomic PCR: step 1- 90C for 15 minutes, step 2- 94C for 1

minute, step 3- 55C for 1 minute, step 4- 72C for 1 minute, step 5- go to step 2 and repeat 39

times, step 6- 72C for 10 minutes, hold at 4C.









Immunoblotting

We used testis and heart samples from 6 wk-old-mice for western blotting. For testis and

heart, tissues were frozen using liquid nitrogen and mechanically minced with a razor blade.The

cells were then lysed in RIPA buffer, and 35 tg of total protein was separated by sodium

dodecyl sulfate-10% polyacrylamide gel elctrophoresis and transferred to a nitrocellulose

membrane. The following were used as primary antibodies; the rabbit polyclonal antibodies

against Ant4 as we previously described (17), Anti-Anti and Ant2 antibodies provided by

Douglas C. Wallace (UC Irvine); Actin (sc-1615 Santa Cruz, Santa Cruz, CA); and GAPDH

(RDI-TRK5G4-6C5 Research Diagnostics, Flanders, NJ). Peroxidase-conjugated

immunoglobulin G (Santa Cruz) was used as the secondary antibody, followed by enhanced

chemiluminescence (ECL) detection (Amersham, Piscataway, NJ).

RT-PCR Analysis

We isolated total RNA from testes of wild-type, heterozygous and homozygous mutant

6wk-old-mice using the RNA aqueous kit according to manufacturer's instructions (Ambion,

Austin, TX). Briefly testes were removed dissected into two equal halves and tunica albugenia

were removed. The seminiferous tubules were then finely minced with a razor blade. The minced

tissue was then placed in 350 [tL of Lysis/Binding solution and gently vortexed to lyse the tissue.

An equal volume of 64% ethanol was added and the lysate was spun through a filter cartridge at

13,000 RPM for 1 minute in a tabletop centrifuge. The cartridge was washed with 700 [tL Wash

Solution 1, then two more times with 500 [tL Wash Solution 2. RNA was eluted by adding 35 itL

o pre-warmed Elution Solution.

The cDNA was synthesized using a SuperScript II first-strand synthesis system with

oligo(dT) (GIBCO BRL, Grand Island, NY). PCR was performed using Taq DNA polymerase

(Eppendorf, Westbury, NY). RT step was performed by mixing 1 [tL Oligo(dt), 1 [tL 10mM









dNTP, and 1-2 pg of total RNA, and DEPC-H20 to a final volume of 10 pL. Mixture was

incubated at 65 C for 5 minutes, and then 4C for 2 minutes. Next, 9 [L of reaction m ixture

consisting of 2 [L 1OX PCR buffer, 2 [L 0.1 M DTT, 4 [L 25mM MgCl2 and 1 [L of

RNaseOUT, was added to the reaction and incubated at 42C for 2 minutes. Then, 1 [L of

SuperScript RT was added to the mixture and the reaction was performed at 42C for 50 minutes.

The reaction was terminated by a 15 minute incubation at 70C. The RNA was degraded by

addition of 1 [L RNase H at 37C for 20 minutes. The cDNA was diluted up to 200 [L with

water. The PCR reaction was performed by incubating 5 [L of cDNA with 0.25 [L of 50 [m

each primer, 0.5 [L 10mM dNTPs, 2.5 [L 10X PCR buffer, 0.125 [L Taq in a final volume of

25 IL. The PCR reaction consisted of the following steps: a preliminary incubation of 94C for 3

minutes, then 94C for 1 minute, 55C for 1 minute, 72C for 1 minute, and repeated to step 2, 29

more times. For each gene, primers were designed from different exons, avoiding pseudogenes,

and being sure that the PCR product would represent the RNA target and not background

genomic DNA. Primer sequences: Ant4 F-GGAGCAACATCCTTGTGTG, Ant4 R-

AGAAATGGGGTTTCCTTTGG, Dazl F-GCCAGCACTCAGTCTTCATC, Dazl R-

GTTGGAGGCTGCATGTAAGT, Dmcl F-GGCCTCCGCGTTCTGGGTCG, Dmcl R-

CTCATCATCTTGGAATCCCGATTCTTCC, A-Myb F-, A-Myb R-, Dvl3 F-

CAGCATCACAGACTCCA, Dvl3 R-CAGCCTGCACCGGCAAATC, Sycp3 F-

GCAGAGAGCTTGGTCGGGGCC, Sycp3 R-CTGAACCAGACAGATCTTTATCATCTTTC,

Cyclin Al F-GAGAAGAACCTGAGAAGCAGG, Cyclin Al R-

CTGGCCACAGGTCCTCCTGTAC, HoxA4 F-GAAGGGCAAGGAGCCGGTGGTG, HoxA4

R-CTCCGGTTCTGAAACCAGATCTTG, Dvll F-TGAGACAGGCACAGAGT, Dvll R-









GTCTGGGACACGATCTC, P-Actin F-ATGGATGACGATATCGCT, P-Actin R-

ATGAGGTAGTCTGTCAGGT

TUNEL Assay

Paraformaldehyde fixed, paraffin embedded sections (5 [im) were de-paraffinized and re-

hydrated through a graded series of ethanol through water. Slides were then placed in 0.1M

citrate buffer pH 6.0 and permeabilized by exposure to 6 minutes of microwave irradiation

(350W). Staining was performed using the In Situ Cell Death Detection Kit (Roche Applied

Science, Indianapolis, IN) following the manufacturer's instructions. TUNEL reaction mixture

containing TdT and fluorescein-dUTP was incubated on the slides for 1 hour at 370C, with

negative control slides receiving labeling mixture devoid of TdT enzyme. After 3 washes in 1X

PBS, slides were cover-slipped using Vectorshield with DAPI (Vectorlabs, Burlingame, CA). In

some experiments, fluorescein-dUTP was visualized using anti- fluorescein antibody conjugated

with alkaline phosphatase.

X-gal Staining

Testes were harvested from 6-week-old wild-type (+/+), heterozygous (+/-), and

homozygous (-/-) mutant male mice and dissected into two equal halves. The tissues were then

fixed in a mild fixative (10% formalin) for approximately 10-15 minutes. Following brief

fixation, X-gal staining was carried out overnight with rocking, in order to prevent misshaping of

the organ. The samples then underwent post fixation to further ensure the integrity of the tissue.

Following post fixation the tissues were dehydrated using an organic solvent (PBS-Citrasol). The

tissues were then imbedded in paraffin and sectioned. Following paraffin imbedding the tissues

were re-hydrated with organic solvent (Citrasol-PBS) of decreasing concentrations. Slides were

counterstained with hematoxylin.









Meiotic Chromosomal Spreads

Meiotic chromosomal spreads were prepared using a protocol similar to that in Peters et al.

(1997). Briefly, testes were freshly dissected from adult mice (6 weeks) and decapsulated.

Tunica albuginea was removed by physical dissociation following the dissection of the testis into

two equal halves. Extratubular tissue was removed by rinsing the seminiferous tubules with PBS

in the lid of a Petri dish. Following rinsing, the seminiferous tubules were blotted on a paper

towel to remove any excess PBS. Tubules were then placed in approximately 1 ml of hypotonic

extraction buffer (30mM Tris, 50mM sucrose, 17mM trisodium citrate dehydrate, 5mM EDTA,

.5mM PMSF, pH 8.2) inverted 3-6 times and incubated at room temperature for 30-50 min.

Following incubation, one-inch lengths of tubules were dissected out and placed in 201L of

sucrose solution (100mM sucrose pH 8.2, set with NaOH) and torn, into small pieces with fine

forceps. The volume was then increased to 40[L with sucrose solution and pipetted to give a

cloudy suspension, which was spread onto two slides dipped in formaldehyde solution (1%

formaldehyde, 0.15% Triton-X100 in water adjusted with sodium borate to pH 9.2). Note: it is

very important that the formaldehyde solution be made up fresh every time, as the pH may

fluctuate and affect the fixation and spreading process. Slides were then air-dried for 2-3 hrs in a

humidified chamber and then left to air-dry for the remainder of the time until the slides were

dry,and used immediately or stored at -20/-800C. For immunostaining, slides were rinsed for 5

min in PBS and then incubated for 30 min in wash/dilution buffer (3% BSA, .5% Triton X100 in

PBS). This protocol was adapted from Nickerson et al. 2007. Spermatocytic preparations were

incubated with both rabbit polyclonal Sycp3 (Ab 15092, Abcam) and mouse monoclonal yH2AX

(Ab22551, Abcam) at 1:200 dilutions. Antibodies were diluted in wash/dilution buffer and

incubated at 40C overnight. Following three 3-min washes in PBS, fluorescent conjugated









secondary antibody, diluted 1:2000 in wash/dilution buffer, were added and incubated for 45 min

at room temperature in the dark. Sycp3 staining was visualized with an Alexa-fluor 488-

conjugated anti-rabbit secondary antibody and yH2AX was visualized with a Cy3-conjugated

anti-mouse secondary antibody. Slides were then washed in PBS, stained and mounted with

Vectashield (Vector Laboratories, Inc. Burlingame, CA 94010) containing DAPI. DAPI was

added to slides to visualize DNA.

Promoter Analysis

The promoter regions of Ant], Ant2, and Ant4 were analyzed for the presence of CpG

islands using the MethPrimer program (http://www.urogene.org/methprimer/indexl.html).

Briefly, sequences containing 500 bp upstream of the transcription start site and 212 bp

downstream, were entered and searched by MethPrimer for CpG islands, for Ant], Ant2, and

Ant4. The predictions were then further confirmed by sequence analysis of these regions.

Bisulfite Sequencing and Combined Bisulfite Restriction Analysis

DNA was extracted from various tissues using the DNA Wizard Genomic DNA

purification Kit (Promega, Madison, WI, http://www.promega.com). Testes were decapsulated,

and seminiferous tubules were collected for analysis. A bisulfite reaction was performed using

the EZ DNA Methylation Kit (Zymo Research, Orange, CA, http://www.zymoresearch.com).

Briefly Up to 2 [g of genomic DNA was used for conversion with the bisulfite reagent.

Approximately 80 ng of bisulfite-converted DNA was used as template for each PCR analysis.

The polymerase chain reaction (PCR) was performed in 25 [L reaction mixtures containing 2 [L

of bisulfite converted DNA (50-100ng), 1 [M of primers, .625 U of HotStar Taq (Qiagen,

Maryland, USA), 200 [M deoxy-nucleotide triphosphates and .25x Qsolution. Primers used for

combined bisulfite restriction analysis (COBRA) were Ant]: 5'-GGAAGGGGTGGAAGTTTG

and 5'-CTAATCCCCCATACTAAAAACC; Ant2: 5'-GGTTTGATTAGGTGTTAAGGGTAAG









and 5'-ACATCTATCATATTAAAAACAAAAA; Ant4: 5'-

GTAGTATTTGGTTAGAGTGTGTTTTTTGG and 5'-ACACTAAAAAAAACTAAAAAACC

(40 cycles). Following PCR amplification, fragments were purified using a PCR purification kit

(Qiagen) and eluted into a final volume of 35 pL. Digestion of PCR purified fragments was then

carried out with Hhal as follows: 35 [tL eluted PCR purified fragments, 4.5 [tL of NEB buffer 4

(New England Biolabs, Beverly, MA), 1.5 [L of Hhal enzyme (New England Biolabs), .25 [l of

Bovine serum albumin (New England Biolabs), and 3.75 iL water. Digestion was carried out

overnight and products were subsequently subjected to electrophoresis at 100V for 30min. on 2%

agarose gels. Primers used for bisulfite sequencing were Ant]: 5'-

TGTTTAGGGATTAGTTTAGTTAATG and 5'- CTAATCCCCCATACTAAAAACC; Ant2: 5'-

GGTTTGATTAGGTGTTAAGGGTAAG and 5'- ACATCTATCATATTAAAAACAAAAA;

Ant4: 5'-TTGTTGTGTATTGATTGAGTATG and 5'- ACACTAAAAAAAACTAAAAAACC.

PCR fragments were cloned into pCRII-TOPO cloning vector (Invitrogen, Carlsbad, CA,

http://www.invitrogen.com), and individual clones were sequenced.









CHAPTER 3
RESULTS

Ant4 Phylogeny

As one of many steps in determining the function of Ant4 we decided to investigate the

similarities and differences between Ant4 and the other Ants. In order to do this, we carried out a

phylogenic analysis of the adenine nucleotide translocases, which was based on the amino acid

sequences of each Ant.

The Autosomal Ant4 Gene is Conserved in Mammals

The deduced amino acid sequence of Ant4 is well conserved among mammals (around or

over 90%) (Table 2-1); however, a phylogram indicates that Ant4 is relatively distinct from the

other mammalian Ant family peptides, Anti, 2 & 3 (Fig. 3-1). Indeed, the amino acid identity

between Ant4 and other Ants is approximately 70%. Of interest, the gene configuration of Ant4

is also well conserved among mammals, but different from that of other Ant members. The Ant4

gene always consists of 6 exons whereas the other Ants have 4 exons in all mammalian species

investigated. Another distinguishing characteristic of mammalian Ants is in their chromosomal

location. The Ant] gene, which is predominantly expressed in skeletal muscle and heart, is on an

autosome. The Ant2 gene, which is ubiquitously expressed in somatic organs, is encoded by the

X chromosome and the Ant3 gene which has been identified in only a portion of mammalian

species so far, including human, cow and dog is also located on the X chromosome. Rodents

apparently do not possess the Ant3 ortholog, based on a search of the published genome

databases. Ant3 has the highest homology with Ant2, and is ubiquitously expressed in somatic

organs like Ant2. It should be noted that the human ANT3 gene is localized to the tip of the short

arm (Xp22) of the X chromosome, which is known as the pseudoautosomal region 1 (PAR1). In

contrast to Ant2 and Ant3, the Ant4 gene is always encoded by an autosome. Moreover, in









contrast to Ant] and Ant2, of which orthologs are found in other species including amphibians

and fish, the Ant4 gene apparently exists only in mammals including the marsupials. Ant4 is

found in both eutherian and metatherian species suggesting the presence of Ant4 in their common

therian ancestor. The eutherian radiation event representing the divergence of eutherian and

metatherian lineages occurred -150 million years ago suggesting that the emergence of Ant4

occurred at least 150 million years ago (44,46), relatively close to the origin of mammals (-200

million years ago).

Ant4 Expression Pattern

The exact expression profile of Ant4 in testis had not been determined. In order to gain

insight into the possible function of Ant4 within the testis we sought to determine the exact

expression pattern of Ant4, and thus determine which cell types relied on Ant4. We

demonstrated in a previous publication that Ant4 protein was expressed in testicular germ cells

of mice (17); however, due to the limited resolution we obtained during immunostaining of

cryopreserved tissues, we were unable to further define the exact expression profile of the

protein within the testis at that time. As a result, we chose to utilize an alternative tissue

preparation technique in order to increase the sensitivity of our analysis.

Ant4 Expression is Highest in Primary Spermatocytes

Utilizing paraffin-embedded formalin-fixed tissues we were able to determine more

precisely the expression pattern of Ant4 in mouse testis. Of interest, it appears that Ant4 protein

expression is highest in spermatocytes among testicular germ cells, based upon nuclear

morphology and position within the seminiferous epithelium (Figure 3-2). Interestingly, mouse

sperm also possess Ant4 protein within the midpiece or neck region (Figure 3-3). We also

examined the expression pattern of ANT4 in human testis samples using polyclonal antibodies

raised against human ANT4 and were able to more clearly distinguish the cell types within









which ANT4 was expressed (Figure 3-4). The human immunohistochemistry data provided us

with evidence that primary spermatocytes express the highest levels of the ANT4 protein,

whereas spermatogonial cells express a lower level. Importantly, Sertoli cells or other somatic

interstitial cells did not express ANT4. In order to further define the stage specific-expression of

Ant4 in male germ cells, we analyzed Ant4 mRNA expression in separated spermatogenic cell

types of mouse using real-time RT-PCR analysis (Figure 3-5). Ant4 transcript levels began to

increase upon transition of premeiotic type B spermatogonia into the early stages of meiosis as

represented by preleptotene spermatocytes (PL). The transcript level of Ant4 continued to

increase through the leptotene and zygotene spermatocyte stages, peaking in early pachytene

spermatocytes. Ant4 transcript levels then began to decrease in late pachytene spermatocytes and

in later round spermatids (Figure 3-5). Thus, high levels of Ant4 expression are likely associated

with entry of the male germ cells into meiosis. In contrast, the fraction enriching Sertoli cells

expressed a very low level of Ant4. We also confirmed here, by real time RT-PCR, that the Ant4

transcript is very low or undetectable in somatic organs and ovary. It should be noted here that,

in contrast to a previous observation using a cryopreserved specimen (17), developing oocytes

did not show any detectable Ant4 expression in paraffin-embedded formalin-fixed tissues

(Figure 3-7). Using the same RNA samples prepared for the study above, we also investigated

the expression pattern of the Ant2 gene in various organs and spermatogenic cell types (Figure 3-

6). Of interest, the expression profile of Ant2 in mice was reciprocal to that of Ant4. The Ant2

transcript was high in somatic organs, but relatively low in whole testis and almost completely

undetectable in testicular germ cells, except primitive spermatogonia.









Ant4 Function Within the Testis

We first sought to confidently determine the expression profile of Ant4. Following the

elucidation of the expression pattern of Ant4 we extended our study to the investigation of its

function.

Generation of Mice with a Targeted Disruption of Ant4

To investigate the in vivo function of Ant4, we generated Ant4-deficient mice by

homologous recombination in embryonic stem (ES) cells. The targeted disruption deleted exons

2 to 4, which encode amino acid residues 79-212 (Figure 3-8A). An IRES-Bgal cassette was

inserted with a splicing acceptor site to allow for examination of the activity of the Ant4

promoter. Disruption of the Ant4 gene in mice was confirmed by Southern blot analysis (Figure

3-8B) and genomic PCR amplification (Figure 3-8C). Immunoblotting was used to confirm the

absence of Ant4 protein expression in the Ant4-deficient mice as well as to analyze the levels of

Anti and Ant2 (Figure 3-9). The relative protein levels of Ant2 in the Ant4-~- testis, when

normalized by total protein amount, were increased in comparison to controls, whereas Ant2

levels were unaffected in heart. Interestingly, the levels of Ant2 as assayed by western blot were

slightly increased in the testicular preparation of the Ant4-deficient mice. This inconsistency in

the protein levels of Ant2 could be due to the increased somatic cell contribution as a proportion

of the whole loaded protein. This would be the result of a higher somatic cell contribution in the

Ant4-deficient testis due to the severely decreased germ cell component. Since Ant2 is

ubiquitously expressed in most somatic tissues, the increased proportion of somatic tissue could

explain this slight inconsistency in protein levels. The levels of Anti protein expression, which

were high in heart and undetectable in testis, were unaffected by Ant4 disruption. The Ant4-

promoter-driven P-galactosidase expression from our targeted allele also enabled us to examine

the Ant4 expression profiles in mice. As expected, X-gal staining in Ant4 mice was observed









only in the testis but not in any other organs (data not shown). X-gal staining of the Ant4+- testis

demonstrated that the P-galactosidase activity was most clearly detectable when male germ cells

transitioned into cells morphologically representative of spermatocytes (Figure 3-10), consistent

with the immunohistochemistry data above.

Ant4 Deficient Mice Exhibit Impaired Spermatogenesis and Infertility

The Ant4- mice were viable and exhibited apparently normal development. The

interbreeding of Ant4 mice produced offspring of normal litter size, and conformed to the

Mendelian ratios of Ant4+/+, Ant4+- and Ant4- inheritance, 9, 27, and 13 respectively. In contrast

to the similar body sizes between the wild type and mutant mice (data not shown), the testes of

Ant41- adults were smaller than those ofAnt4+/+ adults (Figure 3-11). Testes from 6-week-old

Ant4 males were approximately one-third the weight of those from control males. Closer

examination of testicular development revealed similar growth patterns of the testis until

approximately 17 days after birth, suggesting normal growth of the spermatogonia (Figure 3-13)

(47). Subsequent development was impaired in Ant4- testis. Histological analysis of Ant4-

deficient testis demonstrated clear morphological aberrations in the process of spermatogenesis

as evident by the severe reduction of spermatocytes and vacuolization of the seminiferous

epithelium (Figure 3-12). Furthermore, mating of Ant4 deficient males with wild-type females

did not produce any offspring. In contrast, Ant4~-- females were fertile and did not show any

apparent ovarian abnormalities.

Ant4-/- Germ Cells Undergo Meiotic Arrest

To determine the stage at which Ant4-~- germ cells undergo arrest, RT-PCR analysis of

transcripts present in different specific spermatogenic cell types was carried out (Figure 3-14).

Dazl, which is expressed throughout spermatogenesis, was similarly expressed in the Ant4+/+,

Ant4 -, and Ant4 testis. The DNA mismatch repair gene Dmcl, which is expressed before the









pachytene spermatocyte stage (48, 49), did not exhibit significantly different expression patterns

either. The expression of A-Myb, which is a transcription factor of the Myb-family that is

expressed in type B spermatogonia and leptotene to pachytene spermatocytes (50), decreased in

the Ant4- testis. The expression of Dvl3, which has been shown to be present from primitive

type A spermatogonia through pachytene spermatocytes (51), also decreased in the Ant4- testis.

Synaptonemal complex protein 3 (Sycp3), which is restricted to the zygotene to diplotene

spermatocytes (52), was markedly decreased in the Ant4- testis. Transcripts normally present in

pachytene spermatocytes and at later stages, such as HoxA4 and CyclinA1 (53,54), were not

detected in the Ant4- testis. In addition, Dvll, which is expressed in round, elongating, and

elongated spermatids (51), was also undetectable in the Ant4-~- testis. These data indicate a

decrease in meiotic, specifically at the stage of pachytene and beyond, and an absence of the

postmeiotic germ cells in the Ant4-1- testis.

Ant4 Deficient Mice Possess a Decreased Number of Pachytene Spermatocytes and an
Absence of Diplotene Spermatocytes

To further investigate the stage of Ant4-deficient spermatocytic arrest we utilized

synaptonemal complex protein 3 (Sycp3) staining (Figure 3-15). Synaptonemal complex protein

3 (Sycp3) mediates the pairing and synapsis of homologous chromosomes during meiosis I and

thus is utilized to demarcate the chromosomes. Upon analysis with Sycp3, the seminiferous

epithelium of Ant4-deficient mice showed an increased proportion of leptotene like

spermatocytes, as determined by the chromosomal condensation status of these cells. The Ant4-

deficient spermatocytic compartment also contained zygotene and pachytene like cells, however

the proportion of these cell types were decreased in comparison to controls.

In order to more precisely determine the stage of arrest of Ant4-deficient spermatogenic

cells, we next performed a chromosomal spread analysis utilizing Sycp3, yH2AX and DAPI on









Ant4 wild-type (Figure 3-16) and Ant4-deficient (Figure 3-17) spermatocytes respectively.

Phosphorylated H2AX (yH2AX) is a histone variant known to associate with double strand

breaks. yH2AX is also known to associate with the chromosomes during meiosis I, specifically

leptotene through diplotene of prophase I. yH2AX is implicated to have a role in conferring the

heterochromatic transformation of the X and Y chromosomes that occurs during meiosis I. Sycp3

and yH2AX localization allowed us to determine exactly which stages of the meiotic prophase I

were absent in the Ant4-deficient mice in comparison to controls. These data indicate a decrease

in zygotene and pachytene spermatocytes with a complete absence of diplotene spermatocytes in

Ant4-/- testes. We also found there to be a severe reduction in the percentage of pachytene

spermatocytes (Figure 3-19). The overall number of pachytene spermatocytes were also severely

decreased in comparison to controls (Figure 3-20). Utilizing yH2AX staining we investigated the

affects of Ant4 deletion on sex body formation and XY inactivation which normally occur during

meiosis I in the male germ cells. In the Ant4-/- spermatocytes there were abnormalities in both

the localization of yH2AX and also the condensation status of the XY chromosomes during

pachytene (Figures 3-17 and 3-18). These data indicate that Ant4 depletion leads to

abnormalities in the formation of the sex body and in the proper inactivation of the X and Y

chromosomes.

Ant4 Deficient Male Mice Exhibit Increased Levels of Apoptosis Within the Testis

TUNEL labeling and cleaved caspase-3 staining were utilized to analyze the apoptotic

profile of adult (6 wks)Ant4-1- testis in comparison to controls (Figures 3-21 and 3-22). The testis

ofAnt4-deficient mice exhibited increased levels of TUNEL-positive cells within the

seminiferous tubules as compared to controls (Figure 3-21). Upon closer examination, the

majority of the TUNEL-positive cells within the seminiferous tubules of Ant4-1- mice appeared to









be spermatocytes based upon cellular morphology and position within the seminiferous

epithelium (Figure 3-21 bottom panel). We also utilized caspase-3 staining within the testis to

confirm the differential apoptotic profiles present between Ant4-deficient testis and controls

(Figure 3-22). Taken together, these results suggest that the Ant4- testis contain a significantly

higher number of apoptotic cells than controls, and the majority of these cells appear to be early

spermatocytes. In order to investigate further the testicular development of Ant4- mice in

comparison to controls, we utilized the synchronous nature of the first spermatogenic cycle in

postnatal testes. Following birth, the testis undergo the first spermatogenic cycle which produces

germ cells of advancing development with increasing age (47). Thus, the testis at 7 days

postpartum contains only spermatogonia and somatic cells. At 12 days, leptotene and zygotene

spermatocytes appear and by day 17 early pachytene spermatocytes are found. By day 22, more

advanced pachytene spermatocytes and round spermatids are present, and by day 35, the

complete complement of germ cells begins to be present (47). Around day 17, the Ant4-1- testis

began to exhibit signs of increased cell death within the germ cell compartment (Figure 3-23).

By day 22 clear morphological differences were present between Ant4- and control testes. These

data further support our observation that in the Ant4- testis, the early spermatocytes begin to

undergo changes indicative of cell death and that by the pachytene stage these spermatocytes

undergo apoptosis.

Ant4 Promoter CpG Analysis

In order to investigate the role of methylation in the regulation of the adenine nucleotide

translocase family of genes, we carried out a promoter CpG dinucleotide analysis. We utilized

the MethPrimer program (http://www.urogene.org/methprimer/indexl.html) to determine the

presence or absence of promoter proximal CpG islands within the adenine nucleotide









translocases' genomic loci. We identified distinct CpG islands as calculated by MethPrimer

within the Anti, Ant2, and Ant4 promoter proximal regions.

Identification of CpG Islands at the Promoter Regions of Anti, Ant2 and Ant4

In order to determine if Ant] and Ant2, similarly to Ant4 were regulated in part by

methylation we first investigated the promoter proximal regions of Ant], Ant2, and Ant4 for the

presence of CpG rich areas known as CpG islands. The regions investigated extended 500 bp

upstream of the predicted transcription initiation site and 212 bp downstream from the

transcription initiation site extending into exon 1. Interestingly, this analysis revealed that like

Ant4, Ant] and Ant2 contained clearly discernable CpG islands within their promoter proximal

regions ( Figure 3-24).

Real-Time PCR Analysis of Anti, Ant2 and Ant4 Transcript Levels in Various Tissues

For the purpose of our study it was necessary to determine the transcript levels of Antl,

Ant2, and Ant4 in various tissues and to determine in which tissues each was expressed at its

highest and lowest levels. In order to determine the transcript levels of each of Ant], Ant2 and

Ant4 we utilized TaqmanTM real-time PCR analysis of RNA isolated from male mouse testis,

kidney, heart, skeletal muscle, and tail, as well as RNA isolated from female tail. Each tissue was

chosen carefully after searching the published data regarding the expression levels of Anti, 2,

and 4 in various tissues. The goal of the expression analysis was to determine the tissues in

which each Ant was expressed at its highest and lowest levels. These data demonstrate that

within the tissues analyzed, Anti is expressed most significantly in heart and skeletal muscle

with the lowest transcript levels being present in liver; Ant2 is significantly expressed at the

transcript level in kidney with the lowest levels being detectable in skeletal muscle or testis; and

Ant4 is expressed most significantly in testis with the absence or very low levels of transcript

being detectable in kidney (Figure 3-25).









Methylation Analysis of Anti, Ant2, and An4 Promoter Proximal CpG's in Various Tissues

To investigate the methylation status of Ant], Ant2, and Ant4 in various mouse tissues we

utilized combined bisulfite restriction analysis (COBRA). Using the restriction enzyme Hhal

which digests DNA protected from bisulfite conversion by methylation at the sequence GCGC,

we were able to quickly determine the methylation status of the promoter regions of Ant], Ant2,

and Ant4 in various tissues. Hhal digestion of Ant], Ant2, and Ant4 promoter loci revealed an

absence of methylation at the Ant1 and Ant2 promoter regions in all tissues analyzed, whereas

Ant4 exhibited the same methylation pattern as previously published (Figure 3-26) (Rodic et al.).

Interestingly, Ant2 which is located on the X chromosome shows a partial methylation pattern in

female tissue when analyzed by COBRA. The partial methylation of Ant2 in female tissue is

most probably due to the random inactivation of one of the X chromosomes which occurs in

females. In order to further probe the methylation status of Ant], Ant2, and Ant4 we utilized

bisulfite sequencing analysis. Bisulfite analysis of promoter proximal CpG islands was carried

out on selected tissues for Ant], Ant2, and Ant4. We utilized the expression analysis to determine

the tissues to be analyzed based on expression levels. For each of Ant], Ant2, and Ant4 we chose

one tissue in which transcript levels were significantly present for each and also one in which

little to no transcript was detectable. This allowed us to determine if there was any differential

methylation status present between tissues in which these Ants were significantly expressed or

not significantly expressed. To analyze the Anti promoter proximal CpG island methylation

status we utilized heart as the expressing tissue and liver as the non-expressing tissue. For Ant2

analysis we utilized kidney as the expressing tissue and skeletal muscle as the low expressing

tissue, we also analyzed female tail to confirm our COBRA data for the partial methylation

pattern present. For Ant4 we utilized testis as the tissue expressing Ant4 and kidney as the tissue

with little or no detectable expression. Bisulfite analysis confirmed our COBRA data









demonstrating no differential methylation analysis within tissues significantly expressing and not

significantly expressing Ant], and Ant2 (Figure 3-27). Whereas Ant4 showed a differential

methylation pattern between tissues in which it was significantly expressed and tissue in which

the transcript was low to absent.


















Ant2.X.tropicalis

Ant4.M.domestica
Ant4.H.sapiencs
/ ~Ant4.B.taurus
Ant4.C.familiaris


Pet9.S.cerevisiae

Aac3.S.cerevisiae


Aacl .A.thaliana


F25B4.7.C.elegans


Aac3.A.thaliana


R07E3.4.C.elegans


Figure 3-1. Phylogeny of ADP, ATP carrier proteins. A phylogram was generated using the
ClustalW program (European Bioinformatics Institute). Ensemble gene IDs for Anti,
2, 3, & 4 are shown in Table 1. Others include: Anopheles gambiae
(ENSANGG000000 17789), Drosophila melanogaster (CG16944, CG1683),
Saccharomyces cerevisiae (YBL030C, YBR056W, YMR056C), Arabidopsis thaliana
(NP_196853, NP_850541, NP_194568) and Caenorhabditis elegans (R07E3.4,
F25B4.7).


Ant.A.gambiae


Ant4.R.norvegicus









4^- ^


Figure 3-2. Ant4 expression is highest in mouse spermatocytes. (A) Immunohistochemical
analysis of Ant4 expression in mouse testis: Paraffin-embedded sections of mouse
testis from wild-type 6-week-old mice were incubated with a rabbit polyclonal
antibody against mouse Ant4. Ant4 staining was visualized using DAB (brown), and
slides were counterstained with hematoxylin. In control (top left), rabbit IgG was
used as a primary antibody. Scale bars: 40 am.








.7- 1 I=,-w AM


-.' -_ 9- q .









Figure 3-3. Ant4 expression is highest in human spermatocytes. (B) Immunohistochemical
analysis of ANT4 expression in human testis: Formalin-fixed, paraffin-embedded
sections of human testis from a 32 old male were incubated with a rabbit polyclonal
antibody raised against human ANT4. ANT4 staining was visualized using DAB
(brown), and slides were counterstained with hematoxylin. Arrows, arrowheads and
asterisks indicate spermatogonia, Sertoli cells and spermatocytes, respectively. Scale
bars: 50 am.







L



.1
-


VI


Figure 3-4. Ant4 is localized to the sperm midpiece. Left: Phase contrast microscopy of adult (6
weeks) mouse sperm isolated from the caudal epididymis. Right:
Immunoflourescence of Ant4 expression in mouse sperm. Formaldehyde fixed,
methanol permeablized sperm were incubated with the affinity-purified rabbit-anti
mouse Ant4 antibodies at a concentration of 1:100. Alexa flour 488 conjugated goat-
anti rabbit secondary antibodies were added at a 1:200 dilution. DAPI was added to
slides and visualized using fluorescent microscopy. 60X magnification


41










300

250 -

200

150 "

100 -

50 l
0

h.l f L ILi
W .u




Figure 3-5. Ant4 peaks during meiosis I. TaqmanTM Real-time PCR analysis of Ant4 transcript
levels in purified mouse spermatogenic cell types (PA = primitive type A
spermatogonia, A = type A spermatogonia, B = type B spermatogonia, PL =
preleptotene spermatocyes, L+Z = leptotene + zygotene spermatocytes, EP = early
pachytene spermatocytes, LP = late or adult spermatocytes, RS= round spermatids,
JS= juvenile sertoli cells) and various other tissues (whole testis, heart, liver, brain,
kidney, ovary, and embryonic stem cells) (6week-old-mice). The relative transcript
levels are shown in each graph when the transcript level of Ant4 in heart was set to 1.









4 -
35-
3-
25-
2
1.5


0
i






Figure 3-6. Ant2 levels are low to absent during meiosis I. TaqmanTM Real-time PCR analysis
of Ant2 transcript levels in purified mouse spermatogenic cell types (PA = primitive
type A spermatogonia, A = type A spermatogonia, B = type B spermatogonia, PL =
preleptotene spermatocyes, L+Z = leptotene + zygotene spermatocytes, EP = early
pachytene spermatocytes, LP = late or adult spermatocytes, RS= round spermatids,
JS= juvenile sertoli cells) and various other tissues (whole testis, heart, liver, brain,
kidney, ovary, and embryonic stem cells) (6week-old-mice). The relative transcript
levels are shown in each graph when the transcript level of Ant2 in heart was set to 1.









A B



5 i.



a~A -~


1 '1A
I ia. b i.



Figure 3-7. Histological analysis of Ant4 protein within the ovaries. Immunohistochemical
analysis of paraffin-embedded sections of testes (A) and ovaries (B) from wild type
(+/+) adult mice using a polyclonal antibody to Ant4. Scale Bars: 50jm. In contrast to
a previous observation using a cryopreserved specimen (5), developing oocytes did
not show any Ant4 expression. The present data are more consistent with real-time
PCR analysis (Fig. 2C) and Northern blot analysis (5). Collectively, Ant4 expression
appears to be low in ovaries including oocytes.











1 kb

AnI-----u
B
. I Ant4 locus
e /--


Targeting construct


5 6


Targeted allele


+/+ +/- -1-


+/+ +/- -I-


6.3kb .

4.9kb o.


500-


200 -


S"-ma


Figure 3-8. Gene targeting of Ant4 (A) Strategy used for targeted disruption of the Ant4 gene. (B)
Southern blot analysis of BamHI-digested genomic DNA extracted from tails of wild-
type (+/+), heterozygous (+/-) and homozygous (-/-) mutant mice. DNA was
hybridized with the probe shown (5' external probe). (C) PCR analysis using allele-
specific primers of genomic DNA of the indicated genotypes. Arrowheads in (A)
denote the primers used for PCR amplification.


5'-probe






DT


X,

^ ^ IRES-BGal


I 1! "
3 0 4VPr 5


2- 4
2) 4


B


PGK-Neo


I


5


- I


IRES-BGal


PGK-Neo







Testes Heart

+/+ +/- -1- +I+ +/- -1-
Ant4 -

Ant2 a -.- a
Anti n -
f3-acti n e GAPDH
Figure 3-9. Confirmation of disrupted Ant4 Gene. Western blot analysis of Ant4 peptide
expression as well as Anti and Ant2 in both testis and heart.




































14W q% MR#~ ^ ^ I


Figure 3-10. Ant4 promoter-driven P-galactosidase expression pattern in testes. X-gal staining of
wild-type (+/+, left panels), and heterozygous (+/-, right panels) testes, with low (top
panels) and high (bottom panels) power magnification. Ant4 promoter-driven 3-
galactosidase was not detected in spermatogonia or Sertoli cells, but was seen in
primary spermatocytes and the subsequent cell types of spermatogenesis in
heterozygous testes. Slides were counterstained with hematoxylin. Scale bars: 50 am.
































Figure 3-11. Severe reduction of testicular mass in Ant4-deficient mice. Gross morphology of
testis from 6-week-old mice.




























Figure 3-12. Ant4-deficient testis exhibit gross histological abnormalities. Histological analysis
of testis (6-week-old) by hematoxylin and eosin staining. Scale bars: 50 [pm.








120
110 +/
100 +/
O 90 A -
E 80 T
S70
60
? 50
I 40
30 t A A A
20


5 10 15 20 25 30 35 40 45 50 5M
Age (days)

Figure 3-13. Testicular weight analysis. (A) Weight comparison of testis of the indicated
genotypes (7 to 49 days old and 5 months). ) (B) RT-PCR gene expression analysis in
testis (6-week-old).







+/+ +1- -/-


+/+ +1- -/-


Ant4 Sycp3
Dazd CyclinAl
Dmcl HIoxA4
A-Myb DvlI
Dvt3 6 -actin


Figure 3-14. Transcript analysis of Ant-deficient testis. (A) Weight comparison of testis of the
indicated genotypes (7 to 49 days old and 5 months). ) (B) RT-PCR gene expression
analysis in testis (6-week-old).






































Figure 3-15. Sycp3 Chromosomal analysis. Immunohistochemical analysis of primary
spermatocytes using Sycp3 staining in wild-type testis (left Panel) and in Ant4-
deficient testis (right panel). Lower panels are high magnification images. Scale Bars:
50 rtm.








DAPI


YH2AX Svcp3


Merge


Zygotene





Pachytene





Diplotene



Figure 3-16. Ant4 wild-type spermatocytic chromosomal spread. Chromosomal spread analysis
of freshly dissected testis from 6 week old wild-type mice. Spermatocytic
preparations were incubated with both rabbit polyclonal Sycp3 and mouse
monoclonal yH2AX at 1:200 dilutions. Sycp3 staining was visualized with an Alexa-
fluor 488 conjugated anti-rabbit secondary antibody and yH2AX was visualized with
a Cy3 conjugated anti-mouse secondary antibody.









DAPI


YH2AX Sycp3


Merge


Leptotene





Zygotene


-i-


Pachytene


-'-

Figure 3-17. Ant4-deficient testis lack diplotene spermatocytes. Chromosomal spread analysis of
freshly dissected testis from 6 week old Ant4-deficient mice. Spermatocytic
preparations were incubated with both rabbit polyclonal Sycp3 and mouse
monoclonal yH2AX at 1:200 dilutions. Sycp3 staining was visualized with an Alexa-
fluor 488 conjugated anti-rabbit secondary antibody and yH2AX was visualized with
a Cy3 conjugated anti-mouse secondary antibody.









YH2AX Svcp3


Pachytene






Pachytene

-I-




Pachytene

-I-




Pachytene
-'-

Figure 3-18. Pachytene abnormalities in Ant4-deficient spermatocytes. Chromosomal analysis of
Ant4-/- pachytene spermatocytes utilizing Sycp3 and yH2AX staining. 60X
magnification


DAPI


Merqe









Ant4 +/+
Leptotene
7%


Zygotene
22%


Ant4 -/-


Pachytene
8%


Zygotene
26%


Leptotene
66%


Pachytene
56%


Figure 3-19. Quantification of spermatocytes in Ant4-deficient testis. Percentage analysis of the
spermatocytic cells present in the seminiferous epithelium of Ant4 wild-type and
Ant4-deficient testes.


Diplotene
15%









I Ant4 +/+ U Ant4 -


Leptotene


Zygoten e


400
350
300
250
200
150
100
50
0


Diplotene


Figure 3-20. Spermatocyte counts. Quantification of spermatocytes, leptotene through diplotene
of Ant4-deficient testis in comparison to controls.


Pachytene


I1




































Figure 3-21. Apoptotic analysis of Ant4-deficient testis in comparison to controls. TUNEL
analysis of Ant4 heterozygous mice (left panel) and Ant4-deficient testis (right
panel). Lower panels are high magnification images. Scale Bars: 50gm























Figure 3-22. Cleaved Caspase-3 analysis. Immunohistochemical analysis of cleaved caspase-3
expression in testis from 6-week-old heterozygous mice (left), homozygous mutant
mice (right). Cleaved caspase-3 staining was visualized using DAB (brown), and
slides were counterstained with hematoxylin. Scale bars: 50 tm.















































Figure 3-23. Postnatal development in the Ant4+/- and Ant4-/- testis. Left panels: Histological
analysis (hematoxylin and eosin staining) of the testis during the first wave of
spermatogenesis (D7-D22) and in the sexually mature adult, (D42) of heterozygous
(+/-), and homozygous (-/-) mutant mice. Right panels: TUNEL analysis of the first
wave of spermtogenesis (D7-D22) and in the adult, (D42) testis of heterozygous (+/-),
and homozygous (-/-) mutant mice. Cells having DNA breaks were labeled using TdT
and fluorescein-dUTP, and visualized using anti-fluorescein antibody conjugated with
alkaline phosphatase (blue). Slides were counterstained with Nuclear Fast Red (pink).






66









Ant1




Ant2




Ant4


I


+212



+212


4HHHifH1111 11111


I IiIIIIIIIIIIIII uI~ IIIIIII.i~iI iIIIII,


+212


- Exon

CpG Island


Figure 3-24. Adenine nucleotide translocase promoter analysis. Analysis of Antl, Ant2, and
Ant4 promoter proximal regions for the presence of CpG islands. The regions
investigated extended 500 bp upstream of the predicted transcription initiation site
and 212 bp downstream from the transcription initiation site extending into exon 1.


-500



-500


i i I


-500


I


I


I M


I












_ _


5

s 4

13

2-

1

0


AMIL,
Testis
(M)

T


Liver
(M)


Tail(F) Tail(M)


Heart Kidney Muscle Tail (F) Tail (M)
(M) (M) (M)


Ant1 -


Ant2



Ant4


Liver Heart
(M) (M)


Kidney Muscle
(M) (M)


Tail (F) Tail (M)


Figure 3-25. Anti, Ant2, and Ant4 transcript level analysis in various tissues. TaqmanTM Real-
time PCR analysis of Ant], Ant2, andAnt4 transcript levels in testis, liver, heart,
kidney, muscle, and male and female tail. Antl:light gray, Ant2: dark gray, and Ant4:
black.


Testis Liver Heart Kidney Muscle
(M) (M) (M) (M) (M)


7-
6-


S4-
3-
2-
1-
0-


18


Testis
(M)


I I I I I I I


..--


















-- m
"~~~ *'W'^HBIH
;..'.,..r,.


U1


i
: 4
,, .., ii i ., ,
Amoki .^*kl;i feL.. ^ A -


Figure 3-26. Combined Bisulfite Restriction analysis (COBRA) of Anti, Ant2, and Ant4
promoter proximal CpG dinucleotides. Restriction analysis in testis, liver, heart,
kidney, muscle, and male and female tail. U:unmethylated at restriction site,
M:methylated at restriction site investigated.


Ant1





Ant2


-u
:IM


Ant4


3M


RPM1












Ant1


I II I I III IIHll


-500


Heart (M)


Liver (M)

Ant4


-500

Testis (M)


Ant2

--,I,,,I-


Kidney (M)


Skeletal
Muscle (M)

Tail (F)


Kidney (M)


Figure 3-27. Bisulfite sequence analysis of Anti, Ant2, and Ant4 promoter proximal CpG
islands. Representative bisulfite analysis in various tissue types


11 1


,11111MI


H











Testes
Heart
Kidney
Muscle
Liver
Tail(F)
Tail(M)


S- unmethylated
*- methylated
(- mixture


E
-H++-
+


- expression level
high expression
intermediate


low to absent

Figure 3-28. Methylation and expression correlation of Antl, Ant2, and Ant4 in various tissues.


Antl Ant2 Ant4
Methylation Methylation Methylation
status E status E status E
O + 0 ++
O ++ 0 + S -
0 + 0 ++ -
O ++ O + -
O 0 + S -
0 + + -
0 + 0 + S -









CHAPTER 4
DISCUSSION AND CONCLUSION

Spermatogenesis is the process by which self-renewing testicular precursors undergo

proliferation, differentiation and maturation to produce viable spermatozoa. This process of

spermatogenesis is one of the most elegant and complex examples of cellular growth and

differentiation present within the mammalian system. Thus, there are many stages at which

aberrations in spermatogenesis may lead to infertility. During the complex and energy

demanding process of spermatogenesis the proliferating and differentiating spermatogenic cells

rely on the production and availability of ATP from the mitochondria. Classically, aberrant

mitochondrial function has been connected with deficient sperm motility. Reduced sperm

motility has been reported in patients with mitochondrial diseases (55, 56), and pathogenic

mutant mitochondrial DNA (mtDNA) has also been identified in semen samples of patients with

fertility problems (57-59). However, a recent study revealed that the accumulation of mutant

mitochondrial DNA in mice induced male infertility due to oligospermia and asthenozoospermia

(60). Further, spermatogenic cells carrying >75-80% mutant mitochondrial DNA demonstrated

meiotic arrest and displayed enhanced apoptosis, indicating that normal mitochondrial

respiration is required for mammalian spermatogenesis as well as for sperm motility (60).

The present work has identified an essential role for the Ant4 gene in mammalian

spermatogenesis. The Ant4 gene is expressed exclusively during spermatogenesis both in mice

and humans, while other Ants are utilized in somatic cells. Thus, Ant4 likely serves as the sole

mitochondrial ADP/ATP carrier during spermatogenesis. Furthermore, without a functional

ADP/ATP carrier protein ATP would not be efficiently transported into the cytosol, thus Ant4 is

considered to be critical for normal spermatogenesis. Also, as a result of the absence of

functional ADP/ATP translocation it might be inferred that inhibition of the electron transport









chain would occur. This inhibition would be due to the absence of a substrate for ATP

production and also by the accumulation of ATP within the matrix of the mitochondria. The

inhibition of the translocation of ADP/ATP would also result the production of high levels of

reactive oxygen species due to the "leaking" of electrons form the 'backed-up" electron transport

chain. Concomitant with the production of increased proportions of reactive oxygen species

would also be the disruption of the electrochemical membrane potential of the mitochondria

which might result in the depolarization of the membrane leading to apoptosis. Indeed, the

disruption of the Ant4 gene resulted in meiotic arrest in mice as evidenced by the loss of meiotic

and post-meiotic germ cells in the Ant4-deficient testis. The phenotype was similar to that seen in

mice with aberrant mitochondrial DNA (60). Further, this loss appeared to result from an

increase in apoptosis within the early spermatocyte population. This apoptosis led to the

complete absence of diplotene spermatocytes and a severe reduction in the number of pachytene

spermatocytes within the seminiferous epithelium of Ant4-deficient testis. Ant4-deficiency also

resulted in the improper localization of yH2AX with the chromosomes and clear deficiencies in

the heterochromatinization of the X and Y chromosomes. Although the exact Ant4 function of

Ant4 within male germ cell mitochondria remains to be determined, the current study supports

an idea that the ATP supply through normal oxidative respiration is critical for the processes of

male germ cell meiosis.

Chromosomal locations of the Ant family genes are unique and conserved among

mammalian species. The Ant2 gene, which is ubiquitously expressed in somatic cells, is encoded

by the X chromosome in all the mammalian species investigated. In mammalian males the X and

Y chromosomes are known to undergo a heterochromatic transformation upon entry into

meiosis, during prophase I, due to a lack of a homologous pairing partner (61-67). This









transformation, known as meiotic-sex chromosome inactivation (MSCI), confers transcriptional

repression upon the X and Y chromosomes as demonstrated by RNA polymerase II exclusion

(65, 66). On the other hand, the Ant4 gene, which apparently exists only in mammals, is always

encoded on autosomes. These implicate a hypothesis that Ant4 may have originally arose to

compensate the loss of Ant2 function during male meiosis. Female mammals have two X

chromosomes and do not undergo MSCI (65, 66), which is consistent with the fact that Ant4-

deficient female mice exhibit no observable decrease in fertility. Indeed, the Ant2 and Ant4

expression profiles were mutually reciprocal in the mice, and the Ant2 expression was

particularly low during spermatogenesis (Figure 3-6). Of interest, the expression of Ant2 is very

low not only in male meiotic germ cells but throughout spermatogenesis within the testis.

Although the classical examples of MSCI show the repression of the genes after the pachytene

stage, it is known that almost half of the X chromosome-linked genes are not expressed

throughout spermatogenesis like the Ant2 gene (65). After the emergence of Ant4 in mammals,

the expression of Ant2 may have undergone further modifications to reduce transcription of the

gene. In contrast to the low Ant2 transcript levels in testicular germ cells, the overall Ant2

expression, both protein and mRNA, were more detectable in the whole testis preparation

(Figures 3-6 and 3-9). This discrepancy may be due to a predominant expression of Ant2 in

somatic cells of the testis such as interstitial Leydig cells and vascular endothelial cells.

However, we are currently unable to test this assumption because antibodies we had raised

against Ant2 as well as any other available Ant2 antibodies do not work for

immunohi stochemi stry.

Mammals have evolved a mechanism to compensate for the loss of gene expression from

the sex chromosomes during male meiosis (46, 62, 64). Multiple autosomal retrogenes of X









chromosome origin have been reported as candidates potentially compensating for the absence of

essential sex-linked gene expression during male meiosis, as exemplified by the Pgkl/Pgk2 gene

family (68-71). Although such retrogenes are considered to positively support male meiosis,

there has been only one report so far (Utpl4b) to clearly demonstrate the absolute necessity of

such retrogenes in male meiosis (72, 73). It seems that even Pgk2 null mice demonstrate minimal

male infertility (depending on genetic background) mainly due to a sperm motility defect (74). In

contrast, the present study demonstrates that the Ant4 gene is essential for male meiosis. Indeed,

the Ant4 gene likely arose before the divergence of eutherian and metatherian lineages around

the time when MSCI may have initiated (67). Thus, the Ant family of genes may be among the

most essential to be compensated for during male meiosis. Interestingly, the Ant4 gene is not a

retrogene in contrast to all the other known potential autosomal "compensation" genes. This

suggests that Ant4 may have been generated by a standard gene duplication event in mammalian

ancestors. It should be noted here that certain mammalian species including human, cow and dog

but not rodents have another Ant, Ant3 on the tip of the X chromosome (61,75). Human ANT3 is

encoded on Xp22 within the PAR1 region (40). This region is highly conserved between X and

Y chromosomes, and is known to escape from sex chromosome inactivation during male meiosis

(63, 65, 75). Thus, it would be plausible that some mammalian species may have evolved an

additional protective mechanism to secure male meiosis. However, the role of ANT3 in human

spermatogenesis is questionable, considering the fact that ANT3 expression is very low, just as

ANT2 expression, in human testis (http://symatlas.gnf.org/SymAtlas/).

An alternative hypothesis, not entirely exclusive of the above theory, is that the

specification of the Ant4 gene may have occurred in order to better support the process of

spermatogenesis. Indeed, Ant4 has distinguished N-terminus and C-terminus regions that are









conserved across mammalian species, which could potentially be adapted to a specific energy

requiring process during male meiosis or subsequent sperm function. A recent report

demonstrated that mitochondrial respiration defects due to the accumulation of mutated

mitochondrial DNA lead to meiotic arrest and/or asthenozoospermia (60). This implies that male

meiosis is one of the most energy demanding processes and is highly dependent on the

production and availability of ATP from the mitochondria. It is possible that Ant4 may have been

altered during evolution in order to adjust to better fit such an energy demanding cellular

environment. We believe this hypothesis to be more likely as demonstrated by our recent data.

The improper localization of yH2AX and incomplete heterochromatinization of the X and Y

chromosomes observed in the Ant4-deficient mice suggest that the X chromosome may not be

completely silenced. Since it is quite clear that Ant4-deficiency results in improper condensation

of the X and Y chromosomes, it is possible that Ant2 transcript could be produced off of the now

slightly more euchromatic X. This would support the specialization theory of Ant4, in that the

kinetics of Ant2 ADP/ATP exchange may not be best suited for the process of spermatogenesis.

In addition, ANT4 has been recently isolated from the fibrous sheath of the human sperm

flagellar principal piece using mass spectrometry proteomics and was shown to co-localize with

glycolytic enzymes (33). Ant4 may have obtained an additional function which is advantageous

for mammalian fertility regarding sperm function as well.

In summary, the present data demonstrate an essential role for Ant4 in murine

spermatogenesis, more particularly in the survival of meiotic male germ cells. We have clearly

demonstrated that Ant4 deficiency results in the failure of the germ cells to progress through the

essential process of meiosis. Specifically that Ant4 plays a crucial role during prophase I of

meiosis I, and that in the absence of Ant4 there is a severe reduction in the number of pachytene









spermatocytes, with a complete absence of diplotene spermatocytes. Ant4-deficiency also results

in the improper localization of yH2AX and aberrations in the heterochromatinization of the X

and Y chromosomes, which normally occurs during prophase I. Additionally, this study

demonstrates the molecular conservation of the Ant family of genes in mammals, and suggests a

non-retrogene-based compensational mechanism of meiotic-sex chromosome inactivation in

mammals.

This work has contributed a significant quantity of knowledge towards understanding the

unique requirements of spermatogenesis, which have provided a solid foundation upon which to

study male germ cell development. Approximately 15% of all couples are affected by infertility

with half of all cases being attributed to the male (76). Due to the recent discovery of ANT4

there are currently no known clinical male infertility deficiencies related to ANT4. Our work in

mouse has paved the way for the future discovery of any possible linkages of ANT4 to male

infertility. Furthermore, despite currently available contraceptive methods, the world's

population exceeds 6 billion and is currently increasing annually by approximately 80 million.

These ever increasing numbers are resulting in overpopulation in many parts of the world leading

to environmental destruction and a great deal of human suffering. Family-planning organizations

estimate that much of this growth is unintended, indeed half of all conceptions are unplanned and

half of the resulting pregnancies are undesired (77). This high rate of unintended pregnancy can

be attributed to inadequate access to, or use of contraceptives, or both. Therefore, there is a

significant need for a wider variety of contraceptive options in order to help control the high rate

of unintended pregnancies. In particular developing alternative approaches for male based

contraception could prove to be beneficial in decreasing the numbers of unwanted pregnancies.

Currently male-directed contraception options are very limited, consisting of only condoms or









vasectomy. Despite this, men currently account for a third of all contraceptive use (78). Research

into the development of a hormonal contraceptive for men analogous to the estrogen and

progesterone pill used successfully by women has been undertaken and demonstrated to be

effective in trials with most men, however, overall efficiency and efficacy is not yet as reliable as

hormonal contraceptives in women (79). An alternative molecularly based male contraceptive

with safety, efficacy, better cost-performance and less significant side effects would be highly

beneficial. The appeal of a male contraceptive to men is widespread as in surveys, the majority

of men indicate a willingness to utilize such a male contraceptive if available (80-82). Also

approximately 98% of women in stable, monogamous, relationships would be willing to rely on

their male partner to use such a method (80). Our work in characterizing a novel, testis specific

adenine nucleotide translocase has provided a valuable foundation upon which to research the

development of a male specific contraceptive. The future work will rely on our analysis and

resultant phenotype of Ant4 disruption demonstrated here. The combination of our Ant4-

deficient mouse model and the unique amino acid sequence and testis specific expression of

Ant4 may prove to be ideal for the development of a male contraceptive and thus may contribute

greatly to the future of contraception.









LIST OF REFERENCES

1. Henze, K., and Martin, W. (2003) Nature 426, 127-128

2. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) Molecular
Biology of the Cell. 4 Edition. Garland Science

3. McBride, H.M., Neuspiel, and M., Wasiak, S. (2006) Curr. Biol. 16, (14): 551

4. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (1994) Molecular
Biology of the Cell. New York: Garland Publishing Inc

5. Herrmann, J.M., and Neupert, W. (2000) Curr. Opin. Microbiol. 3, (2): 210-214

6. McMillin, J.B., and Dowhan, W. (2002) Biochim. etBiophys. Acta. 1585, 97-107

7. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., and Coulson, A.R. (1981)
Nature 410, 141

8. Voet, D., Voet, J.G., and Pratt, C.W. (2006) Fundamentals ofBiochemistry, 2ndEdition.
John Wiley and Sons, Inc

9. Berg, J.M., Tymoczko, J.L., Stryer, L. (2002) Biochemistry 5th Edition. WH Freeman and
Company

10. Buchanan, J. (2000). Biochemistry & molecular biology ofplants, 1st Edition, American
society of plant physiology

11. Rich, P.R. (2003) Biochem. Soc. Trans. 31, (6): 1095-105

12. Voet, D., and Voet, J.G. Biochemistry, 3rd Edition. John Wiley and Sons, Inc

13 Gawaz, M., Douglas, M.G., and Klingenberg, M. (1990) J. Biol. Chem. 265, 14202-14208

14. Levy, S.E., Chen, Y., Graham, B.H., and Wallace D.C. (2002) Gene 254, 57-66

15. Graham, B.H., Waymire, K.G., Cottrell, B., Trounce, I.A., MacGregor, G.R., and Wallace,
D.C. (1997) Nat. Genet. 16, 226-234

16. Dolce, V., Scarcia, P., Lacopetta, D., and Palmieri, F. (2005) FEBSLett. 579, 633-637

17. Rodic, N., Oka, M., Hamazaki, T., Murawski, M.R., Jorgensen, M., Maatouk, D.M.,
Resnick, J.L., Li, E., and Terada, N. (2005) Stem Cells 23, 93-102

18. Fiore, C., Trezeguet, V., Le Saux, A., Roux, P., Schwimmer, C., Dianoux, A.C., Noel,
F.,Lauquin, G.J., Brandolin, G., Vignais, P.V. (1998) Biochimie 80, 137-150









19. Palmieri, L., Alberio, S., Pisano, I., Lodi, T., Meznaric-Petrusa, M., Zidar, J., Santoro, A.,
Scarsia, P., Fontanesi, F., Lamantea, E., Forrero, I., and Zebiani, M. (2005) Hum. Mol.
Genet. 14, 3079-3088

20. Santamaria, M., Lanave, C., and Saccone, C. Gene 333, 51-59

21. Zoratti, M., and Szabo, I. (1995) Biochim. Biophys. Acta. 1241, 139-76

22. Nicolli, A., Basso, E., Petronilli, V., Wenger, R.M., and Bernardi, P. (1996) J. Biol. Chem.
271, 2185-92

23. Halestrap, A.P., Woodfield, K.Y., and Connem, C.P. (1997) J. Biol. Chem. 272, 3346-54

24. Kokoszka, J.E., Waymire, K.G., Levy, S.E., Sligh, J.E., Cai, J., Jones, D.P., MacGregor,
G.R., and Wallace, D.C. (2004) Nature 427, 461-5

25. Hackenberg, H., and Klingenberg, M. (1980) Biochemistry 19, 548-555

26. Stepien, G., Torroni, A., Chung, A.B., Hodge, J.A., and Wallace, D.C. (1992) J. Biol.
Chem. 267, 14592-7

27. Lunardi, J., Hurko, O., Engel, W.K., and Attardi, G. (1992) J. Biol. Chem. 267, 15267-70

28. Ellison, J.W., Salido, E.C., and Shapiro, L.J. (1996) Genomics 36, 369-71

29. Ceci, J.D. (1994) Mamm. Genome 5, S124-38

30. Hirano, M., and DiMauro, S. (2001) Nephrology 57, 2163-216

31. Van Goethem, G., Dermaut, B., Lofgren, A., Martin, J.J., and Van Broeckhoven, C. (2001)
Nat. Genetics 28, 211-212

32. Lodi, T., Bove, C., Fontanesi, F., Viola, A.M., and Ferrero, I. (2006) Biochem. Biophys.
Res. Commun. 341, 810-5

33. Kim, Y.H., Haidl, G., Schaefer, M., Egner, U., and Herr, J.C. (2007) Dev. Biol. 302, 463-
476

34. Belzacq, A.S., Vieira, H.L., Kroemer, G., and Brenner, C. (2002) Biochimie 84, 167-176

35. Heller, C.G.; Clermont, Y. (1963) Science 140, (3563): 184-6

36. Hess, R.A. (1999) Encyclopedia ofReproduction, Volume 4. Academic Press

37. Chiarini-Garcia, H., Raymer, A.M., Russel, L.D. (2003) Reproduction 126, 669-680

38. Principles of Genetics, Fourth Edition, John Wiley and Sons, Inc., 2006









39. Raven, P.H., Johnson, G.B., Mason, K.A., Losos, J., and Singer, S. (2007) Biology, Eighth
Edition, McGraw-Hill

40. Petronczki, Mark; Siomos, Maria F. & Nasmyth, Kim (2003) Cell 112 (4): 423-40

41. Griffiths, A.J.F., Wessler, S.R., Lewontin, R.C., Gelbart, W.M., Suzuki, D.T., and Miller,
J.H. (2005) Introduction to Genetic Analysis, Eighth Edition, W.H. Freeman and Company

42. Xiong, X., Wang, A., Liu, G., Liu, H., Wang, C., Xia, T., Chen, X., and Yang, K. (2006)
Environ. Res. 101 (3): 334-9

43. Sofikitis, N., Giotitisas, N., Tsounapi, P., Baltogiannis, D., Giannakis, D., and Pardalidis,
N. (2008) J. Steroid Biochem. Mol. Biol. In Press

44. McCarrey, J.R., and Thomas, K. (1987) Nature 326, 501-505

45. Kawasome, H., Papst, P., Webb, S., Keller, G.M., Johnson, G.L., Gelfand, E.W., and
Terada, N. (1998) Proc. Natl. Acad. Sci. USA. 95, 5033-5038

46. Wang, P.J. (2004) Trends Endocrinol. Metab. 15, 79-83

47. Richardson, L.L., Pedigo, C., and Handel, M.A. (2000) Biol. Reprod. 62, 789-79

48. Habu, T., Taki, T., West, A., Nishimune, Y., and Morita, T. (1996) Nucleic Acids Res. 24,
470-477

49. Kuramochi-Miyagawa, S., Kimura, T., Ijiri, T.W., Isobe, T., Asada, N., Fujita, Y., Ikawa,
M., Iwai, N., Okabe, M. Deng, W., Lin, H., Matsuda, and Y., Nakano, T. (2004)
Development 131, 839-849

50. Mettus, R.V., Litvin, J., Wali, A., Toscani, A., Latham, K., Hatton, K., and Reddy, E.P.
(1994) Oncogene 9, 3077-3086

51. Guo, R., Yu, Z., Guan, J., Ge, Y., Ma, J., Li, S., Wang, S., Xue, S., and Han, D. (2004)
Mol. Repro. Devel. 67, 264-272

52. Meuwissen, R.L., Offenberg, H.H., Dietrich, A.J., Risewijk, A., van lersel, M., and
Heyting, C. (1992)EMBO J. 11, 5091-5100

53. Rubin, M., Toth, L.E., Patel, M.D., D'Eustachio, P., and Nguyen-Huu, M.C. (1986) Science
233, 663-667

54. Sweeney, C., Murphy, M., Kubelka, M., Ravnik, S.E., Hawkins, C.F., Wolgemuth, D.J.,
and Carrington, M. (1996) Development 122, 53-64

55. Folgero, T., Bertheussen, K., Lindal, S., Torberqsen, and T., Oian, P. (1993) Hum. Reprod.
8, 1863-1868

56. Spiropoulos, J., Tumbull, D.M., and Chinnery, P.F. (2002) Mol. Hum. Reprod. 8, 719-721









57. Kao, S., Chao, H.T., and Wei, Y.H. (1995) Biol. Reprod. 52, 729-736

58. Lestienne, P., Reynier, P., Chretien, M.F., Penisson-Besnier, I., Malthiery, Y., and Rohmer,
V. (1997) Mol. Hum. Reprod. 3, 811-814

59. Carra, E., Sanqiorqi, D., Gattuccio, F., and Rinaldi, A.M. (2004) Biochem. Biophys. Res.
Commun. 10, 333-339

60. Nakada, K., Sato, A., Yoshida, K., Morita, T., Tanaka, H., Inoue, S., Yonekawa, H., and
Hayashi, J. (2006) Proc. Natl. Acad. Sci. USA. 103, 15148-53

61. Charchar, F.J., Svartman, M., El-Mogharbel, N., Venture, M., Kirby, P., Matarazzo, M.R.,
Ciccodicola, A., Rocchi, M., D'Esposito, M., and Graves, J.A.M. (2003) Genome Res. 13,
281-286

62. Emerson, J.J., Kaessmann, H., Betran, E., and Long, M. (2004) Science 303, 537-540

63. Femandez-Capetillo, O., Mahadevaiah, S.K., Celeste, A., Romanienko, P.J., Camerini-
Otero, R.D., Bonner, W.M., Manova, K., Burgoyne, P., and Nussenzweig, A. (2003) Dev.
Cell 4, 497-508

64. Graves, J.A.M. (2006) Cell 124, 901-914

65. Khalil, A.M., Boyar, F.Z., and Driscoll, D.J. (2004) Proc. Natl. Acad. Sci. USA. 101,
16583-16587

66. Namekawa, S.H., Park, P.J., Zhang, L., Shima, J.E., McCarrey, J.R., Griswold, M.D., and
Lee, J.T. (2006) Curr. Biol. 16, 660-667

67. Turner, J.M.A., Mahadevaiah, S.K., Ellis, P.J.I., Mitchell, M.J., and Burgoyne, P.S. (2006)
Dev. Cell 10, 521-529

68. Chen, K., Knorr, C., Moser, G., Gatphayak, K., and Brenig, B. (2004) Mamm. Genome 15,
996-1006

69. Erickson, R.P., Kramer, J.M., Rittenhouse, J., and Salkeld, A. (1980) Proc. Natl. Acad. Sci.
USA. 77, 6086-6090

70. McCarrey, J.R., Geyer, C.B., and Yoshioka, H. (2005) N.Y. Acad. Sci. 1061, 226-242

71. McCarrey, J.R., Berg, W.M., Paragioudakis, S.J., Zhang, P.L., Dilworth, D.D., Arnold,
B.L., Rossi, J.J. (1992) Dev. Biol. 154, 160-168

72. Ohta, H., Yomogida, K., Tadokoro, Y., Tohda, A., Dohmae, K., and Nishimune, Y. (2001)
Int. J. Androl. 24, 15-23

73. Bradley, J., Baltus, A., Skaletsky, H., Royce-Tolland, M., Dewar, K., and Page, D.C.
(2004) Nat. Genet 36, 872-876









74. Bailey, J., Evans, J.P., Hardy, M., Herr, J.C., Loveland, K., Matsumoto, A., Trasler, J.,
Turek, P.J., Vasquez-Levin, M., and Wang, C. Synopsis: 2005 annual meeting of the
American Society of Andrology. 26, 678-688

75. Toder, R., and Graves, J.A.M. (1998) Mamm. Gen. 9, 373-376

76. Nakada, K., Sato, A., Yoshido, K., Morita, T., Tanaka, H., Inoue, S., Yonekawa, H.,
Hayashi, J. (2006) Proc. Natl. Acad. Sci. USA. 103(41), 15148-15153

77. Henshaw, S.K. (1998) Unintended pregnancy in the US. Fam. Plan. Perspect 30, 24-29

78. Piccinino, L.J., and Mosher, W.D. (1998) Trends in contraceptive use in the United States:
1982-1995. Fam. Plan. Perspect 30, 4-10

79. Amory, J.K., Page, S.T., and Bremner, W.J. (2006) Drug insight: recent advances in male
hormonal contraception. Nat. Clin. Practice 2, 32-41

80. Heinemann, K., Saad, F., Wiesemes, M., White, S., and Heinemann, L. (2005) Attitudes
toward male fertility control: results of a multinational survey on four continents. Hum.
Reprod. 20, 549-556

81. Martin, C.W., Anderson, R.A., Cheng, L., Ho, P.C., van der Spuy, Z., Smith, K.B., Glasier,
A.F., Everington, D., and Baird, D.T. (2000) Human Reprod. 15, 637-645

82. Glasier, A.F., Anakwe, R., Everington, D., Martin, C.W., van der Spuy, Z., Cheng, L., Ho,
P.C., and Anderson, R.A. (2000) Human Reprod 15, 646-649









BIOGRAPHICAL SKETCH

Jeffrey V. Brower was born in Hicksville, New York, where he lived for eight years. He

and his family then moved to Saint Augustine, Florida, where he attended fourth grade. After

staying briefly in Florida, he and his family returned to Long Island, New York, where he would

finish his secondary education. Following graduation from high school, he then returned with his

family to Florida. Jeffrey received his BS in microbiology and cell science with a minor in

chemistry from the University of Florida in 2004. Jeffrey decided to stay at the University of

Florida for graduate school, and in 2008, he received his Ph.D in the molecular cell biology

concentration of medical sciences in the laboratory of Naohiro Terada, M.D., Ph.D. His work

focused on determining the function of a newly discovered member of the adenine nucleotide

translocase family of genes, Ant4. This work led him to the identification of an essential function

for Ant4, which he found to by germ cell specific, in the process of spermatogenesis. Jeffrey has

been accepted to medical school at the University of Florida and will begin in August of 2008.

He hopes to continue his research endeavors focusing more on the clinical aspects of medicine

while integrating his knowledge of the basic sciences.





PAGE 1

1 ELUCIDATING THE FUNCTION AND EXPRE SSION PATTERN OF A NOVEL ADENINE NUCLEOTIDE TRANSLOCASE, ANT4 By JEFFREY VINCENT BROWER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Jeffrey V. Brower

PAGE 3

3 To my loving parents, family and friends for a ll of their continued s upport and encouragement

PAGE 4

4 ACKNOWLEDGMENTS I would like to first thank my mentor, Dr. Naohi ro Terada without whom none of this work would have been possible. Dr. Terada's constant wisdom, guidance, insight and friendship have been the reason for any success I have had during my graduate career. The environment that Dr. Terada creates for all of his gr aduate students is one of comf ort and understanding while at the same time stimulation of critical thinking and in novation. I could never begi n to express in words my absolute gratitude and respect for him. I woul d next like to thank Dr. Paul Oh who has been my "second" mentor. Dr. Oh's contributions to my development as a graduate student and individual have been immense and I can not be gin to thank him enough. I would also like to thank all of my committee members, Dr. David Julian, Dr. Jim Resnick and Dr. Stephen Sugrue for their continued insight and essential assistance with my research. I would also like to thank our collaborator Dr. John McCarre y at the University of Texas at San Antonio for his significant contributions to my work. Next, I would like to thank all of the members of the Terada lab, past and present, whom all have made a significant impact on my graduate career and overall happin ess. In particular, Dr. Masahiro (Max) Oka, who oversaw a large part of my technical development, and also Dr. Takashi (Charlie) Hamazaki, Dr. Nemanja Rodi c, Dr. Michael Rutenberg, Dr. Amar Singh, Dr. Sarah Kehoe, Dr. Brad Willenberg, Amy Meacham, and Katherine Hankowski. I would like to give a special thanks to my parents, Clay and Cynthia, and my brother Jamie, whose love, support and encouragement ar e unwavering. Finally I would like to thank the rest of my family and friends who have supporte d me in many ways, without which I may have not been so successful in my graduate studies.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF FIGURES................................................................................................................ .........7 ABSTRACT....................................................................................................................... ..............9 CHAPTER 1 INTRODUCTION..................................................................................................................11 Mitochondria................................................................................................................... ........11 Mitochondrial Structure........................................................................................................ ..11 Mitochondrial Function......................................................................................................... .13 Adenine Nucleotide Translocases...........................................................................................15 Adenine Nucleotide Translocase 4.........................................................................................16 Spermatogenesis................................................................................................................ .....17 Meiosis I...................................................................................................................... ...........17 Meiosis II..................................................................................................................... ...........19 Spermiogenesis................................................................................................................. ......19 Somatic Cell Supportive Function..........................................................................................20 2 MATERIALS AND METHODS...........................................................................................22 Immunostaining................................................................................................................. .....22 Preparation of Stage-specif ic Spermatogenic Cells................................................................23 Real-Time PCR.................................................................................................................. .....23 Targeting Vector Construction...............................................................................................24 Generation of Ant4-/Mice.....................................................................................................24 Southern Blotting.............................................................................................................. ......25 PCR Genotyping................................................................................................................. ....26 Immunoblotting................................................................................................................. .....27 RT-PCR Analysis................................................................................................................ ...27 TUNEL Assay.................................................................................................................... ....29 X-gal Staining................................................................................................................. ........29 Meiotic Chromosomal Spreads...............................................................................................30 Promoter Analysis.............................................................................................................. ....31 Bisulfite Sequencing and Combined Bisulfite Restriction Analysis......................................31 3 RESULTS........................................................................................................................ .......33 Ant4 Phylogeny................................................................................................................. .....33 The Autosomal Ant4 Gene is Conserved in Mammals..........................................................33 Ant4 Expression Pattern........................................................................................................ .34 Ant4 Expression is Highest in Primary Spermatocytes..........................................................34

PAGE 6

6 Ant4 Function Within the Testis.............................................................................................36 Generation of Mice with a Ta rgeted Disruption of Ant4.......................................................36 Ant4 Deficient Mice Exhibit Impaired Spermatogenesis and Infertility................................37 Ant4-/Germ Cells Undergo Meiotic Arrest...........................................................................37 Ant4 Deficient Mice Possess a Decreased Numb er of Pachytene Spermatocytes and an Absence of Diplotene Spermatocytes.................................................................................38 Ant4 Deficient Male Mice Exhibit Increased Levels of Apoptosis Within the Testis...........39 Ant4 Promoter CpG Analysis.................................................................................................40 Identification of CpG Islands at the Prom oter Regions of Ant1, Ant2 and Ant4...................41 Real-Time PCR Analysis of Ant1, Ant2 and An t4 Transcript Levels in Various Tissues.....41 Methylation Analysis of Ant1, Ant2, and An4 Promoter Proximal CpG's in Various Tissues........................................................................................................................ .........42 4 DISCUSSION AND CONCLUSION....................................................................................72 LIST OF REFERENCES............................................................................................................. ..79 BIOGRAPHICAL SKETCH.........................................................................................................84

PAGE 7

7 LIST OF FIGURES Figure page 3-1 Phylogeny of ADP, ATP carrier proteins..........................................................................44 3-2 Ant4 expression is highest in mouse spermatocytes..........................................................45 3-3 Ant4 expression is highest in human spermatocytes.........................................................46 3-4 Ant4 is localized to the sperm midpiece............................................................................47 3-5 Ant4 peaks during meiosis I..............................................................................................48 3-6 Ant2 levels are low to absent during meiosis I..................................................................49 3-7 Histological analysis of Ant4 protein within the ovaries...................................................50 3-8 Gene targeting of Ant4 .......................................................................................................51 3-9 Confirmation of disrupted Ant4 Gene...............................................................................52 3-10 Ant4 promoter-driven -galactosidase expression pattern in testes...................................53 3-11 Severe reduction of testicul ar mass in Ant4-deficient mice..............................................54 3-12 Ant4-deficient testis exhibit gross histological abnormalities...........................................55 3-13 Testicular weight analysis................................................................................................ ..56 3-14 Transcript analysis of Ant-deficient testis.........................................................................57 3-15 Sycp3 Chromosomal analysis............................................................................................58 3-16 Ant4 wild-type spermatocytic chromosomal spread..........................................................59 3-17 Ant4-deficient testis lack diplotene spermatocytes............................................................60 3-18 Pachytene abnormalities in Ant4-deficient spermatocytes................................................61 3-19 Quantification of spermatocy tes in Ant4-deficient testis...................................................62 3-20 Spermatocyte counts....................................................................................................... ...63 3-21 Apoptotic analysis of Ant4-deficient testis in comparison to controls..............................64 3-22 Cleaved Caspase-3 analysis...............................................................................................65

PAGE 8

8 3-23 Postnatal development in th e Ant4+/and Ant4-/testis...................................................66 3-24 Adenine nucleotide transl ocase promoter analysis............................................................67 3-25 Ant1, Ant2, and Ant4 transcript level analysis in various tissues.....................................68 3-26 Combined bisulfite restriction analysis (COBRA) of Ant1, Ant 2, and Ant4 promoter proximal CpG dinucleotides..............................................................................................69 3-27 Bisulfite sequence analysis of Ant 1, Ant2, and Ant4 promoter proximal CpG islands........................................................................................................................ ........70 3-28 Methylation and expression correlation of Ant1, Ant2, and Ant4 in various tissues........71

PAGE 9

9 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ELUCIDATING THE FUNCTION AND EXPRE SSION PATTERN OF A NOVEL ADENINE NUCLEOTIDE TRANSLOCASE, ANT4 By Jeffrey V. Brower August 2008 Chair: Naohiro Terada Major: Medical Sciences -Molecular Cell Biology The adenine nucleotide translocases (Ant) faci litate the transport of ADP and ATP by an antiport mechanism across the inner mitochondrial me mbrane, thus playing an essential role in cellular energy metabolism. We recently identified a novel member of the Ant family in mouse, Ant4 of which gene configuration as well as amino acid homology is well conserved among mammals. The conservation of Ant4 in mammals, along with the absence of Ant4 in nonmammalian species, suggests a unique and indispen sable role for this ADP/ATP carrier gene in mammalian development. Of interest in contrast to its paralog Ant2 which is encoded by the X chromosome and ubiquitously expressed in somatic cells, Ant4 is encoded by an autosome and selectively expressed in testic ular germ cells. Immunohistochemical examination as well as RNA expression analysis using separated spermatogeni c cell types revealed that Ant4 expression was particularly high at the spermato cyte stage. When we generated Ant4 deficient mice by targeted disruption, a significant reducti on in testicular size was observed without any other distinguishable abnormalities in mi ce. Histological examination as well as stage-specific gene expression analysis in adult and neonatal testes revealed a seve re reduction of spermatocytes accompanied by increased apoptosis. Subsequently, the Ant4 deficient male mice were infertile.

PAGE 10

10 Taken together, these data elucid ated the indispensable role of Ant4 in murine spermatogenesis. Considering the unique conservation and chromosomal location of the Ant family genes in mammals, Ant4 gene may have arose in mammalian ances tors and been conserved in mammals to serve as the sole and essential mitochondria l ADP/ATP carrier during spermatogenesis where the sex chromosome-linked Ant2 gene is inactivated.

PAGE 11

11 CHAPTER 1 INTRODUCTION Mitochondria The mitochondria are membrane enclosed organe lles ranging in size from 1-10 m and are found in most eukaryotic cells ( 1,2). The mitochondria are often described as the "power houses" of the cell due to the role they play in ATP production from ADP and Pi. They are responsible for the vast majority of the ATP produced for utilization by the cell in its many energy demanding processes. The mitochondria have also b een implicated to play a role in ageing, the cellular death cascade, cell signali ng, cellular differentiation, as well as growth and cell cycle control (3). Mitochondria have also been shown to play a ro le in many disease pathologies (mitochondrial mutations disease). The mitochondri on is believed to have arisen through the engulfment, by an early eukaryote, of a simpler bacterial prokaryote. These two organisms then developed a relationship in which both be nefited and thus became symbionts. Mitochondrial Structure The mitochondria have a specialized structure in order to most e fficiently support their numerous functions. The mitochondrion consists of both an inner and an outer membrane composed of phospholipid bilayers containing nu merous proteins (2,4). The inner and outer membranes are separated by what is known as th e intermembrane space. The invaginations of the inner membrane are known as cristae, and the region within the inner membrane is the matrix. The mitochondrial outer membrane is com posed of both a phospholipid bilayer and proteins, enclosing the organelle. The outer me mbrane has a phospholipid to protein ration of about 1:1 by weight, similar to the eukaryotic cell membrane (2,4). Contained within the outer membrane are integral proteins called porins whic h allow for the free diffusion of molecules of a

PAGE 12

12 molecular weight of 5000 Daltons or less (2,4 ). There is a multi-subunit protein termed the translocase of the outer membrane that is able to actively move larger proteins containing an Nterminal signaling sequence, across the membra ne and into the intermembrane space (5). The intermembrane space contains a similar concentration of ions and sugars to that of the cytosol since the outer membrane is permeable to small molecules (4). The composition of larger protein molecules however, is quite different since they must possess a specific targeting sequence to be translocated into the intermembrane space (2,5). The mitochondrial inner membrane contains the majo rity of the proteins that play a role in energy metabolism. The inner membrane contains proteins with essen tially four types of functions, protein import, regula tion of metabolite passage into and out of the matrix, the carrying out of the redox reacti ons essential to oxidative pho sphorylation, and ATP synthesis (2,4). The protein to phospholipid ra tio of the inner membrane is different from that of the outer membrane as the protein composition is much great er (3:1 by weight) (4 ). The inner membrane is also unique in that it is rich in an u nusual phospholipid, cardiolipin, which was originally discovered in bovine hearts (6). Cardiolipin is uni que in that it contains four fatty acids rather than the characteristic two, which may play a ro le in making the inner membrane more highly impermeable to all molecules (2,4). It is importa nt to note that the mito chondrial inner membrane does not contain porins and almost all ions requi re a specific transporter to enter or exit the matrix compartment. This impermeability of th e inner membrane is essential for the production of the membrane potential esta blished by the action of the enzy mes of the electron transport chain. The inner membrane contains folds known as cristae. The cristae, which are formed by the invagina tions of the inner membrane, are responsible for expanding the surface area of the inner membrane. This increased surface area provides more

PAGE 13

13 space for the enzymes of the electron transport ch ain thus increasing the mitochondrion's ability to produce ATP. Cells which possess a higher dema nd for ATP, typically contain more cristae (4). The space enclosed by the inner membrane is known as the matrix and contains approximately 2/3 of the total prot eins present within the mitochondria (4). The matrix contains a mixture of enzymes, specialized mitochondr ial ribosomes, tRNA, and mitochondrial DNA. A published human mitochondrial DNA sequence cons isted of 16, 569 base pairs which encoded 37 total genes, 24 tRNA and rRNAs and 13 peptid es (2,7). The mitochondr ion has a specialized structure in order to carry out its many essential functions. Mitochondrial Function The mitochondria are most well known for the production of ATP for utilization during the cell's many metabolic processes (1,2,8). The mito chondrion however, is also involved in many other cellular pathways and processes. The mitochondria are highly invested in th e process of energy metabolism and rely on glycolysis, which occurs in the cytoplasm, to metabolize glucose. Briefly, glucose is phosphorylated by hexokinase to fo rm glucose-6-phosphate which is subsequently rearranged to form fructose-6-phosphate. Fructose-6-phosphate is split by aldolase into two triose sugars, dihydroxyacetone phosphate and glyceralde hyde 3-phosphate (2,8-12). Dihydroxyacetone phosphate is rapidly converted into glyceraldehyde 3-phosphat e by triosephosphate isomerase. The two molecules of glyceraldehyde 3-phospha te are then dehydrogenated and phosphorylated to make 1,3-biphosphoglycerate. The 1,3-biphosphogly cerate molecules are then converted into 3-phosphoglycerate and subsequently 2-phosphogl ycerate. 2-phosphoglyecerate next becomes phosphoenolpyruvate which is finally converted in to pyruvate. The pyruvate is then converted

PAGE 14

14 into Acetyl CoA by pyruvate dehyd rogenase which can subsequently enter the tricarboxylic acid cycle (TCA cycle). (2, 8-12) The process of glyc olysis produces an overa ll 2 net ATP molecules. The tricarboxylic acid cycle utilizes Acetyl CoA as the initial substrate. The TCA cycle takes place in the matrix of the mitochondria. Br iefly, Acetyl CoA is c onverted into Citrate by Citrate synthase, which is next converted into Isocitrate by Aconitase. Isocitrate is then converted into -ketogluterate by isocitrate dehydrogenase, which is subs equently converted into Succinyl-CoA by -ketogluterate dehydrogenase. Succinyl-C oA is converted into Succinate by the Succinyl-CoA synthetase (2, 8-12). Succinate dehydrogenase then converts Succinate into Fumerate which is subsequently converted into Malate through the action of Fumarase. Malate is finally converted into Oxalo acetate by Malate dehydrogenase. The TCA cycle produces two net GDP molecules from each molecule of glucose. During this cycle NAD+ is reduced to NADH during the conversions of Isocitrate to -ketogluterate, -ketogluterate to Succinyl-CoA, and Malate to Oxaloacetate (2, 8-12) These reduced electron carriers are then utilized by the electron transport chain. The electron transport chain is located along the mitochondr ial inner membrane and is composed of a number of complexes (Complexes I-IV) that mediate the transfer of electrons along the transport chain. Complex I, also known as NADH dehydrogenase, accepts two electrons from NADH and transfer s them to ubiquinone, a lipid sol uble carrier which is able to diffuse readily through the membra ne (2, 8-12). Complex I is also responsible for pumping two protons into the intermembrane space. Complex III, cytochrome bc1, accepts two electrons from the reduced ubiquinone (QH2) and tr ansfers them to two molecules of cytochrome C one at a time. Complex III also pumps two protons into the intermembrane space (2, 8-12). Complex IV, also known as cytochrome c oxidase, next remo ves four electrons from four cytochrome c

PAGE 15

15 molecules. Complex IV also pumps four protons into the intermembrane space. In turn complex IV transfers these electrons to the terminal electron acceptor, molecular oxygen producing water, thus the absolute necessity of O2. Next the F1FO ATP synthase utilizes the proton gradient that has been established by the coupled electron tr ansport and hydrogen shuttling, to produce ATP from ADP and Pi (2, 8-12). The F1FO ATP syntha se relies on the availability of ADP and also the removal of ATP for subsequent ATP production. This essential function is carried out by the adenine nucleotide translocases. Adenine Nucleotide Translocases The adenine nucleotide translocase/translocator (Ant), also called ADP/ATP carrier (Aac), belongs to the mitochondrial solute carrier family which supports a variety of transport activities across the mitochondrial inner membrane (13-19). The Ant proteins facilitate the exchange of ADP/ATP by an antiport mechanism across the inner membrane of the mitochondria, (13,15,16) and thus are considered to be essential fo r the utilization of ATP produced by oxidative respiration (13-16,20). The Ant pr oteins are also thought to be an integral component of the mitochondrial permeability transition pore (21-23), although this function is still in question (24). The Ant proteins are the most abunda nt proteins of the mitochondrial inner membrane and are comprised of approximately 300-320 amino acid residues which form six transmembrane helices. The functional unit is likely a homodimer act ing as a gated pore that channels single molecules of ADP and ATP (25) Until recently, it has been believed that humans posses three members of the ANT family of genes: ANT1 ( SLC25A4 ), which is expressed primarily in the heart and skeletal muscle; ANT2 ( SLC25A5 ), which is expressed in rapidly growing cells and is inducible; and ANT3 ( SLC25A6 ), which appears to be constitu tively expressed in all tissues (26,27). In contrast, rodents were believ ed to possess only two members of the Ant family: Ant1 which is expressed at high levels in heart, skeletal muscle, and brain; and Ant2 which is

PAGE 16

16 expressed in all tissues but skeletal muscle (14). Mouse Ant2 is the ortholog of human ANT2 and seems to combine the functions of human ANT2 and ANT3 (28,29). Genetic inactivation of Ant1 resulted in viable mice (15). However, th ese animals developed mitochondrial myopathy and severe exercise intolerance along with hypertrophic cardiomyopathy (15,19). In humans, there is a clinical manifestation known as autosomal dominant progressive ex ternal opthalmoplegia (adPEO) which is associated with ANT1 as well as TWINKLE and POL mutation (30). This disorder is characterized molecularly by th e accumulation of numerous mitochondrial DNA mutations and clinically by the appearance of external opthalmopl egia, ptosis, and progressive skeletal muscle weakness (31). In the cases of ANT1 mutation, A114P, L98P, A90D, D104G, and V289M substitutions have been reported to be associated with adPE O (32). Gene disruption of Ant2 in mice appears to result in embryonic to perinatal lethalit y, although a detailed phenotype has not yet been published (http://www.patentdebate.com/PATAPP/20050091704). There have been no reports regarding ANT2 or ANT3 mutations in human. Adenine Nucleotide Translocase 4 Utilizing various approaches, we and others recently identified a novel member of the Ant family, Ant4 both in mouse and human (16,17,33). The mouse Ant4 gene was predicted to encode a 320 amino acid protein, and shared amino acid sequence homology with the other mouse Ant proteins previously identified (70.1% and 69.1% overall amino acid identity to Ant1 and Ant2, respectively). The Ant4 gene also contained three tandem repeats of a domain of approximately 100 residues, each domain containi ng two transmembrane regi ons, a characteristic shared by all members of the Ant family (34). Dolce et al. demonstrated that human ANT4 (AAC4) indeed localizes to mitochondria in ce lls and can actively exchange ADP for ATP by an

PAGE 17

17 electrogenic antiport mechanism in vitro Of interest, the Ant4 gene is expressed selectively in the testis, both in mouse and human (17,33). Spermatogenesis The recently discovered Ant4 is expressed excl usively within the testis. The testis are composed of both somatic and germ cell populations. Within the testis is an extensive network of tubular structures known as the se miniferous tubules (35, 36). Th e seminiferous tubules are the sight of a highly specialized pr ocess known as spermatogenesis. Spermatogenesis is the process by which a resident stem cell population gives ri se to differentiating and maturing cells which eventually become mature sperm. Spermatogenesis occurs within the seminiferous tubules of the testis and commences within the stem cells of the testis the spermatogonial cells (type A), located along the basal lamina (37). The type A sperma togonia undergo an asymmetric mito tic cell division to give rise to another type A and a type B spermatogonium The type A spermatogonial cells proliferate repeatedly and are responsible for the constant replenishment of the germinal cell population within the seminiferous epithelium (36). The type B spermatogonia, which are the last cell type of the seminiferous epithelium to be produced by means of a mitotic division, are committed to enter meiosis I as primary spermatocytes. The pro cess of meiosis is unique to gametogenesis and is essential for the production of haploid game tes and thus preservation of the species. Meiosis I Meiosis is a highly specialized process restrict ed to the germinal cells of the gametes. Meiosis I is initiated in the primary spermatocy tes and is separated into interphase, prophase, metaphase, telophase, and anaphase (38-41). During interphase the chromosomes replicate, prior to prophase I. By prophase I of meiosis I, wh ich is an elongated prophase in comparison to prophase of mitosis and meiosis II, the chromosome s have replicated. This elongated prophase is

PAGE 18

18 further broken down into leptotene, zygotene, pachytene, diplotene a nd diakinesis (40,41). During leptotene the individual chromosomes begi n to condense, forming long strands present within the nucleus. At this point, sister chromatid s are tightly associated with one another as to be indistinguishable. Following leptotene is zygotene, during which time the chromosomes condense further and become visibly distinguishabl e as long thread-like st arnds. At this point, homologous chromosomes begin to seek out one another and initia te the process of synapsis. This synapsis is mediated through the synapt onemal protein complex wh ich allows homologous chromosomes to align along their lengths and form tight associations with one another. The next stage of prophase I is pachytene. During pachyt ene the complete condens ation and synapsis of homologous chromosomes is completed. Th e now completely synapsed homlogous chromosomes are referred to as bivalents or te trads due to the presence of the two sister chromatids of each homologue (40). Pachytene is a very important stage of meiosis, as it is responsible for the generation of genetic diversit y. This genetic diversity arises from the random process of genetic exchange that occurs between nonsister chro matids of homologous chromosomes. Following pachytene is the st age known as diplotene. During diplotene the synaptonemal complex begins to degrade and ho mologous chromosomes begin to separate from one another, remaining tightly a ssociated at chiasmata, the regi ons where crossing-over occurred. During the next stage, diakinesis, the chromoso mes further condense and the nuclear membrane disintegrates and the meiotic spindle begins to form (40,41). Following prophase I is metaphase I, during which kinetochore microt ubules from both centrioles at tach to the ki netochores of homologues. The homologous chromosomes align al ong the equatorial plate due to a continuous force exerted in a counterbalancing manner by the microtubules upon th e bivalents. Random assortment is generated based upon the random orie ntation of the bivalent s about the metaphase

PAGE 19

19 plane (38,40). Next the microtubules attached at the kinetochores shorten and pull homologous chromosomes apart, towards opposing poles, during anaphase I (40). Following anaphase I the centromeres arrive at the poles and each daughter cell now possesses half the number of chromosomes. However, each chromosome consis ts of two sister chromatids. Cytokinesis occurs, which is the pinching of the cellular memb rane as to form two cells (38). The cells now enter a resting state known as in terphase II. During the above desc ribed process of meiosis I, the diploid primary spermatocytes have undergone a reductive divi sion, effectively halving their chromosomal content. Subsequently meiosi s II ensues, during which the secondary spermatocytes undergo an equational division. At this point the primary spermatocyes become secondary spermatocytes as they enter meiosis II. Meiosis II The secondary spermatocytes proceed through th e stages of meiosis II, consisiting of interphase, prophase, metaphase, anaphase and te lophase (38-41). These stages are similar to meiosis I except that prophase I is not broken down into sub-stages as it was in meiosis I. Briefly, during prophase II the nu clear envelope disappears, and the chromatids condense, in metaphase II the microtubules associated with the kinetochore and attach at the polar centrioles resulting in the formation of a metaphase II plate, oriented perpendicular to the metaphase I plate (40). Next during anaphase II the sister chro matids are separated and moved to opposing poles. Following anaphase II is telophase II which is similar to telophase I during which chromosomes uncoil and lengthen, nuclear envelo pes form and cellular cleavage o ccurs (38). The result is four haploid cells which exit meiosis and become sparmatids. Spermiogenesis Spermatids are the haploid resu lts of meiosis. Spermatids undergo further maturation and terminal differentiation during the process know n as spermiogenesis. There are three major

PAGE 20

20 changes through which the spermatids must under take. First the nucleus elongates and histones are replaced with protamines which allow for the establishment of highly condensed chromatin. This highly condensed transformation of the chroma tin is necessary in order to accommodate the significantly reduced cytosolic and nuclear compartm ents of the sperm. Next the Golgi apparatus produces a lysosomal-like granule that form s above the nucleus, towards the tip of the developing spermatid. This lysosomal granule will form the future acrosome which is an essential component of the penetr ation of the zona pellucida a nd subsequent sperm/egg fusion (36). Finally the spermatid elongates and forms a tail along which mitochondria are deposited in the proximal region. Also excess cytoplasm is released as the residua l cytoplasmic body (36). Following the morphological changes that occur to the spermatids as they mature, release of spermatozoa into the seminiferous tubule lumen occurs by the process of spermiation (36). The entire process of spermatogenesi s relies heavily on the somatic constituent of the testicular environment. Somatic Cell Supportive Function The somatic cells present within the seminife rous epithelium provide support and direction to the developing germ cells in various ways, and thus play an important role in the development of the germ cell compartment of the testis. The Sertoli cell extends from the basement membrane to the lumen of the seminiferous epithelium a nd is responsible for supporting and protecting the developing germinal cells (36). The Sertoli cells have both endocrine and st ructural roles in the development of the germ cells as they secrete a number of substances which have profound effects on the maturation and progression of the germ cells. Sertoli cells are responsible for the producti on and secretion of a number of factors necessary for the maintenance and maturation of the germ cells (42,43). Some such factors secreted by the Sertoli cells are, inhibins and activins, which together work to regulate the

PAGE 21

21 secretion of FSH from the pitu itary gland, glial cell-line derive d neurotrophic factor (GDNF), which plays a role in undiffe rentiating spermatogonial cell pr ogression, and the Ets related molecule (ERM), which is needed for spermatogonial stem cell maintenance, to name a few (42,43). The Sertoli cells also play a very impor tant role in the stru ctural support of the developing germ cell compartment. The Sertoli cells are often referre d to as the "nurse" or "mothe r" cells of the seminiferous epithelium (36). In addition to providing secret ory support, they also are responsible for the structural and directional support of the germ cells Sertoli cells are in di rect contact with the maturing germ cells from the spermatogonial st age all the way until th eir release into the seminiferous epithelium as late spermatids. The tight junctions present between adjacent Sertoli cells are responsible for the esta blishment and integrity of the bl ood-testis barrier (36, 42). This Sertoli cell interaction separates the semini ferous epithelium into basal and adluminal compartments. This blood-testis barrier mediated by Sertoli cell tight juncti ons, is responsible for determining which molecules ente r and exit the adluminal compartm ent. The blood-testis barrier also makes the adluminal compartment and immune privileged site (42). The Sertoli cells also determine when the maturing and differentiating spermatogonial cells will pass through the tight junctions and into the adluminal compartment. Without the function of intact Sertoli cells, spermatogenesis can not occur (42).

PAGE 22

22 CHAPTER 2 MATERIALS AND METHODS Immunostaining Testes were harvested from 6-week-old wild-t ype or mutant male mice. All mice have been maintained under standard specific-pat hogen-free (SPF) conditions and the procedures performed on the mice were reviewed and approved by the University of Florida Institutional Animal Care and Use Committee (IACUC). The tissu es were then fixed in a mild fixative (10% formalin) overnight with rocking. Following fi xation the tissues were dehydrated using an organic solvent (beginni ng with PBS and working towards more dehydrating solutions such as Citrasol). The tissues were then imbedded in paraffin and sectioned. Formalin-fixed, paraffin embedded human testis tissue was obtained throu gh the University of Fl orida Department of Pathology tissue bank. Use of human tissue was performed in accordance with IRB-approved protocols at the University of Florida. Tissues were re-hydrat ed with organic solvents of decreasing concentrations (beginning with Citrasol and moving towards more hydrating solutions and ending with PBS). Deparaffinized and re-hydrated 5 m tissue sections were stained with rabbit polyclonal antibodies against mouse Ant4, or a cleaved Caspase-3 (Cell Signaling Technologies, Danvers, MA). Slides we re blocked for endogenous peroxidase activity and then unmasked in Target Retrieval Soluti on (Dako, Carpinteria, CA ). Antibody was applied at 1:600 (Ant4) or 1:200 (Caspase -3) for one hour at room temper ature prior to identification using the DAB Envision kit (Dako). An isotype and concentration matched negative control section was included for each tissue. Slides were counterstained with hematoxylin. For immunostaining of human ANT4, rabbit polyclona l antibodies were ra ised against the Nterminal human ANT4 peptide (REPAKKKAEKRL FDC) and purified through an affinity column using the same peptide (S igma Genosys, The Woodlans, TX).

PAGE 23

23 Preparation of Stage-sp ecific Spermatogenic Cells Stage-specific spermatogenic cells were prepar ed from neonatal, prepubertal and adult CD1 mice by sedimentation through a 2-4% BSA Sta Put gradient at unit gravity as described previously (44). Specifically, primitive type A spermatogonia were recovered from testis of male mice at 6 days postpartum (dpp). Simila rly, type A and type B spermatogonia were recovered from males at 8dpp, prel eptotene, leptotene + zygotene, and juvenile pachytene spermatocytes were recovered from males at 18 dpp, and adult pachytene spermatocytes, round spermatids and residual cytoplasmic bodies were recovered from males at 60+ dpp. Purities of recovered cell types were assessed on the basi s of morphological characteristics when viewed under phase optics and were 85% for prospermatogonia, sp ermatogonia, and juvenile spermatocytes (preleptotene, leptotene plus zygotene, and juvenile pachytene) and 95% for adult pachytene spermatocyte s and round spermatids (44). Real-Time PCR Total RNA was extracted using the RNA a queous kit (Ambion). cDNA was synthesized using the HiCapacity cDNA Archive kit using ra ndom primers (Applied Bios ystems, Foster City, CA). Briefly, 10 L Reverse Transcription Buffer, 4 L 25X dNTPs, 10 L 10X Random Primers, 5 L MultiScribe Reverse Transcriptase, and 21 L of nuclease-free H2O was incubated with 50 L of RNA (2 g). Reaction consisted of two steps, first a 25 C incubation for 10 minutes, and second a 37 C incubation for 120 minutes. Real-time PCR reaction was performed us ing the TaqMan Gene Expression Assay (Applied Biosystems) according to manufacturers instructions. Each 20 L reaction consisted of 10 L of TaqMan Universal PCR Master Mi x, No AmpErase-UNG; 1 L of TaqMan Gene Expression Assay Mix, for -actin (VIC-labeled), Ant4 (FAM-labeled), or Ant2 (FAM-labeled); and 9 L of cDNA (50 ng). Reactions were pe rformed using Applied Biosystems 7900HT Fast

PAGE 24

24 Real-Time PCR instrument. Gene expression anal ysis was performed using the comparative CT method using -actin for normalization. Targeting Vector Construction The targeting vector was designed to replace exons 24 of the mouse Ant4 gene with an SV40 splicing donor/acceptor signals-IRES (inter nal ribosomal entry site)-gal-and PGKneor (neomycin resistant gene cassette driven by the PGK promoter) casse tte of the pNF-SIBN targeting vector. The targeting construct was generated by sequential subcloning of the 5' homology arm, 3' homology arm, and diphtheria toxin gene into the pNF-SIBN vector. A 2.0 kb fragment containing exon 1 a nd a 5.3 kb fragment containing exons 5-6 was amplified from mouse ES cell (R1, 129/SvJ strain ) genomic DNA and used as the source of 5' and 3' homologous arms for the targeting constructs, respectively. Targeting arms were amplified by LA Taq PCR system (Takara, Madison, WI) with the following primers Ant4-5.f (5CCGCTCGAGCTCTCATTGTTTTAACTGGATACGTG), Ant4-5.r (5GCGTGTCGACTGGCCCTGCACATTCTCCAAAACACC), Ant4-3.f (5CCCGCTCGAGGAGTAATTGGTGACTTTAAGTGG) and Ant4-3.r (5GCGTGTCGACTGCTCACTAAATGGACTCTGGG). The homologous arms were cloned into pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA). Following excision from pCR2.1-TOPO vectors, the 5' homologous arm was ligated into the XhoI site and the 3' homologous arm was ligated into the SalI site in the pNF-SIBN target ing vector. To increase selection efficiency of positive clones, we inserted the negative selection gene (diphtheria toxin) into the XhoI site. Generation of Ant4-/Mice The targeting vector was linearized with SalI di gestion, and transfected into J1 ES cells by electroporation as we previously described (45). Genomic DNA from ~450 G418-resistant colonies was screened, and homologous recomb ination in ES cells confirmed by genomic

PAGE 25

25 Southern blotting. Upon initial Southern blot sc reening with a 5' external probe followed by confirmation with a 3' internal probe, three successfully targeted ES clones were identified. ES cells from one positive clone were injected into bl astocysts of the C57BL/6 (B6) strain. Chimeric male mice were mated with females on a B6 background. Southern Blotting Genomic DNA was extracted using the DNA Wizard Genomic DNA purification Kit (Promega, Madison, WI, http://www.promega.com). Briefly, mous e tails clips were performed to obtain tissue. Tissue lysis solution was prepared by adding 120 L of a 0.5M EDTA to 500 L of Nuclei Lysis Solution and chilled on ice unt il solution turns cloudy. Next 600 L of the lysis solution was added to 0.5-1 cm of fresh mouse tail in a 1.5 ml microcentrifuge tube. To the solution was added 17.5 L of 20 mg /ml Proteinase K. Samples were then incubated overnight in a 55 C water bath with gentle shaking. Following overnight incubation, 3 L of RNase solution was added to the nuclear lysate, mixed by inversion and incubated at 37 C for 17 minutes. The samples were then allowed to cool to room temperature for approximately 5 minutes. Next, 250 L of Protein Precipitation Solu tion was added to the room temp erature samples and placed at 20 C for approximately 5 minutes Following incubation at -20 C the samples were centrifuged for 5 minutes at 15,700 g. The precipitated protein will form a tight white pellet. The supernatant was carefully removed and transferred to a clean 1.5 ml microcentrifuge tube containing 600 L of room temperature isopropanol. The samples we re then gently mixed by inversion until white thread-like strands of DNA began to be visible. The samples were then centrifuged for 5 minutes at 15,700 g. The DNA was visible as a small white pellet and the supern atant was carefully removed. Next, 600 L of room temperature 70% ethanol was added and the tubes were vortexed gently and briefly to wash the pellet. The samples were then centrifuged for 1 minute at 15,700 g and the supernatant was re moved carefully. The tubes were then inverted on a paper

PAGE 26

26 towel and left to air-dry for 15 minutes. Following air-drying at room temperature, the samples were placed into a heat block set to 90 C for 1-3 minutes to ensure proper drying. The samples were then rehydrated by placing them in 100 L of DNA rehydration solution overnight at 4 C. The genomic DNA was then deigested with BamH I and separated in 1% agarose gels. After denaturation and neutralization of the gel, DNA was transferred to nylon membranes and hybridized with specific 5' exte rnal and 3' internal probes. PCR Genotyping In order to rapidly and eff ectively determine the genotype of the resultant mice of set matings, we developed a PCR based genotyping technique. Genomic DNA was extracted using the DNA Wizard Genomic DNA purifica tion Kit (Promega, Madison, WI, http://www.promega.com). The DNA samples then underwent a PCR amplification using primers specific for each allele. For the Ant4 targeted allele the forward primer was designed in intron 1, and the reverse primer was designed at the splicing donor/acceptor site of the -galPGK-neomycin cassette. Primer s FGTTTTGGAGAAT GTGCAGGG, RGCAACATCCACTGAGGAGC AGTTC. The resulting amplicon was approximately 250 bps. In order to detect the wild-type allele, we desi gned primers to amplify the exon-intron 2 region which was absent from the targeted allele. The forward primer was designed in exon 2 and the reverse primer was designed in intron 2. Primers FGGCAATTTGGCAAATGTTATTCG, RGCGATCCCTAGTTACTGAAACTAAG. The re sulting amplification product was approximately 350 bps. In order to effectively am plify from a genomic template, we designed a genomic specific PCR program. Genomic PCR: step 190 C for 15 minutes, step 294 C for 1 minute, step 355 C for 1 minute, step 472 C for 1 minute, step 5go to step 2 and repeat 39 times, step 672 C for 10 minutes, hold at 4 C.

PAGE 27

27 Immunoblotting We used testis and heart samples from 6 wk -old-mice for western blotting. For testis and heart, tissues were frozen using liquid nitrogen and mechanically minced with a razor blade.The cells were then lysed in RIPA buffer, and 35 g of total protein was separated by sodium dodecyl sulfate-10% polyacrylamide gel elctrophor esis and transferred to a nitrocellulose membrane. The following were used as primar y antibodies; the rabb it polyclonal antibodies against Ant4 as we previously described ( 17), Anti-Ant1 and Ant2 antibodies provided by Douglas C. Wallace (UC Irvine); Actin (sc-161 5 Santa Cruz, Santa Cruz, CA); and GAPDH (RDI-TRK5G4-6C5 Research Diagnostics, Flanders, NJ). Peroxidase-conjugated immunoglobulin G (Santa Cruz) was used as the secondary antibody, followed by enhanced chemiluminescence (ECL) detection (Amersham, Piscataway, NJ). RT-PCR Analysis We isolated total RNA from testes of w ild-type, heterozygous and homozygous mutant 6wk-old-mice using the RNA aqueous kit accord ing to manufacturer's instructions (Ambion, Austin, TX). Briefly testes were removed dissect ed into two equal halves and tunica albugenia were removed. The seminiferous tu bules were then finely minced with a razor blade. The minced tissue was then placed in 350 L of Lysis/Binding so lution and gently vortexed to lyse the tissue. An equal volume of 64% ethanol was added and th e lysate was spun through a filter cartridge at 13,000 RPM for 1 minute in a tabletop centrifuge. Th e cartridge was washed with 700 L Wash Solution 1, then two more times with 500 L Wa sh Solution 2. RNA was eluted by adding 35 L o pre-warmed Elution Solution. The cDNA was synthesized using a SuperScrip t II first-strand synthesis system with oligo(dT) (GIBCO BRL, Gra nd Island, NY). PCR was performed using Taq DNA polymerase (Eppendorf, Westbury, NY). RT step was perfor med by mixing 1 L Oligo(dt), 1 L 10mM

PAGE 28

28 dNTP, and 1-2 g of total RNA, and DEPC-H2O to a final volume of 10 L. Mixture was incubated at 65 C for 5 minutes, and then 4 C for 2 minutes. Next, 9 L of reaction m ixture consisting of 2 L 10X PCR buffer, 2 L 0.1 M DTT, 4 L 25mM MgCl2 and 1 L of RNaseOUT, was added to the reaction and incubated at 42 C for 2 minutes. Then, 1 L of SuperScript RT was added to the mixtur e and the reaction was performed at 42 C for 50 minutes. The reaction was terminated by a 15 minute incubation at 70 C. The RNA was degraded by addition of 1 L RNase H at 37 C for 20 minutes. The cDNA was diluted up to 200 L with water. The PCR reaction was performed by inc ubating 5 L of cDNA with 0.25 L of 50 m each primer, 0.5 L 10mM dNTPs, 2.5 L 10X PCR buffer, 0.125 L Taq in a final volume of 25 L. The PCR reaction consisted of the follo wing steps: a preliminary incubation of 94 C for 3 minutes, then 94 C for 1 minute, 55 C for 1 minute, 72 C for 1 minute, and repeated to step 2, 29 more times. For each gene, primers were design ed from different exons, avoiding pseudogenes, and being sure that the PCR product would re present the RNA target and not background genomic DNA. Primer sequences: Ant4 F-GGAGCAACATCCTTGTGTG, Ant4 RAGAAATGGGGTTTCCTTTGG, D azl F-GCCAGCACTCAGT CTTCATC Dazl RGTTGGAGGCTGCATGTAAGT, Dmc1 FGGCCTCCGCGTTCTGGGTCG, Dmc1 RCTCATCATCTTGGAATCCCGATTCTTCC, AMyb F, A-Myb R, Dvl3 FCAGCATCACAGACTCCA, Dvl3 R-CA GCCTGCACCGGCAAATC, Sycp3 FGCAGAGAGCTTGGTCGGGGCC, Sycp3 RCTGAACCAGACAGATC TTTATCATCTTTC, Cyclin A1 F-GAGAAGAACCTGA GAAGCAGG, Cyclin A1 RCTGGCCACAGGTCCTCCTGTAC, HoxA4 FGAAGGGCAAGGAGCCGGTGGTG, HoxA4 R-CTCCGGTTCTGAAACCAGATCTTG, Dvl1 F-TGAGACAGGCACAGAGT, Dvl1 R-

PAGE 29

29 GTCTGGGACACGATCTC, -Actin F-ATGGATGACGATATCGCT, -Actin RATGAGGTAGTCTGTCAGGT TUNEL Assay Paraformaldehyde fixed, paraffin embedded sect ions (5 m) were de-paraffinized and rehydrated through a graded series of ethanol th rough water. Slides were then placed in 0.1M citrate buffer pH 6.0 and permeabilized by exposure to 6 minutes of microwave irradiation (350W). Staining was performed using the In S itu Cell Death Detection Kit (Roche Applied Science, Indianapolis, IN) following the manufact urers instructions. TUNEL reaction mixture containing TdT and fluorescein-dUTP was in cubated on the slides for 1 hour at 37oC, with negative control slides receiving labeling mixture devoid of TdT enzyme. After 3 washes in 1X PBS, slides were cover-slipped using Vectorshield with DAPI (V ectorlabs, Burlingame, CA). In some experiments, fluorescein-dUTP was visuali zed using antifluorescein antibody conjugated with alkaline phosphatase. X-gal Staining Testes were harvested from 6-week-old w ild-type (+/+), hete rozygous (+/-), and homozygous (-/-) mutant male mice and dissected in to two equal halves. Th e tissues were then fixed in a mild fixative (10% formalin) fo r approximately 10-15 minutes. Following brief fixation, X-gal staining was carried out overnight with rocking, in order to prevent misshaping of the organ. The samples then underwent post fixation to further ensure the integrity of the tissue. Following post fixation the tissues were dehydrate d using an organic solv ent (PBS-Citrasol). The tissues were then imbedded in paraffin and s ectioned. Following paraffi n imbedding the tissues were re-hydrated with organic so lvent (Citrasol-PBS) of decreasi ng concentrations. Slides were counterstained with hematoxylin.

PAGE 30

30 Meiotic Chromosomal Spreads Meiotic chromosomal spreads were prepared using a protocol similar to that in Peters et al. (1997). Briefly, testes were freshly dissected from adult mice (6 weeks) and decapsulated. Tunica albuginea was removed by physical dissociati on following the dissecti on of the testis into two equal halves. Extratubular tissue was removed by rinsing the seminiferous tubules with PBS in the lid of a Petri dish. Following rinsing, th e seminiferous tubules were blotted on a paper towel to remove any excess PBS. Tubules were then placed in approximately 1 ml of hypotonic extraction buffer (30mM Tris, 50mM sucrose, 17 mM trisodium citrate dehydrate, 5mM EDTA, .5mM PMSF, pH 8.2) inverted 3-6 times and in cubated at room temperature for 30-50 min. Following incubation, one-inch lengths of tubules were dissected out and placed in 20L of sucrose solution (100mM sucrose pH 8.2, set with NaOH) and torn, into small pieces with fine forceps. The volume was then increased to 40L with sucrose solution an d pipetted to give a cloudy suspension, which was spread onto two s lides dipped in formaldehyde solution (1% formaldehyde, 0.15% Triton-X100 in water adjusted with sodium borate to pH 9.2). Note: it is very important that the formaldehyde solution be made up fresh every time, as the pH may fluctuate and affect the fixation and spreading proce ss. Slides were then air-dried for 2-3 hrs in a humidified chamber and then left to air-dry fo r the remainder of the time until the slides were dry,and used immediately or stored at -20/-80C. For immunostaining, slides were rinsed for 5 min in PBS and then incubated for 30 min in wash/dilution buffer (3% BSA, .5% Triton X100 in PBS). This protocol was adapted from Nickerson et al. 2007. Spermatocytic preparations were incubated with both rabbit polyclonal Sycp3 (Ab15092, Abcam) and mouse monoclonal H2AX (Ab22551, Abcam) at 1:200 dilutions. Antibodies were diluted in wash/dilution buffer and incubated at 4C overnight. Following three 3-min washes in PBS, fluorescent conjugated

PAGE 31

31 secondary antibody, diluted 1:2000 in wash/dilution buffer, were added and incubated for 45 min at room temperature in the dark. Sycp3 stai ning was visualized w ith an Alexa-fluor 488conjugated anti-rabbit secondary antibody and H2AX was visualized with a Cy3-conjugated anti-mouse secondary antibody. Slides were then washed in PBS, stained and mounted with Vectashield (Vector Laboratories, Inc. Bur lingame, CA 94010) cont aining DAPI. DAPI was added to slides to visualize DNA. Promoter Analysis The promoter regions of Ant1 Ant2 and Ant4 were analyzed for the presence of CpG islands using the MethPrimer program (h ttp://www.urogene.org/methprimer/index1.html). Briefly, sequences containing 500 bp upstream of the transcription start site and 212 bp downstream, were entered and searched by MethPrimer for CpG islands, for Ant1 Ant2 and Ant4 The predictions were then further confir med by sequence analysis of these regions. Bisulfite Sequencing and Combined Bisulfite Restriction Analysis DNA was extracted from various tissu es using the DNA Wizard Genomic DNA purification Kit (Promega, Madi son, WI, http://www.promega.com). Testes were decapsulated, and seminiferous tubules were collected for an alysis. A bisulfite reac tion was performed using the EZ DNA Methylation Kit (Zymo Research, Orange, CA, http://www.zymoresearch.com). Briefly Up to 2 g of genomic DNA was used for conversion with the bisulfite reagent. Approximately 80 ng of bisulfite-converted DNA was used as template for each PCR analysis. The polymerase chain reaction (PCR) was performe d in 25 L reaction mixtures containing 2 L of bisulfite converted DNA (50-100ng), 1 M of primers, .625 U of HotStar Taq (Qiagen, Maryland, USA), 200 M deoxy-nucleotide triphos phates and .25x Qsolution. Primers used for combined bisulfite restric tion analysis (COBRA) were Ant1 : 5'-GGAAGGGGTGGAAGTTTG and 5'-CTAATCCCCCATACTAAAAACC; Ant2 : 5'-GGTTTGATTAGGTGTTAAGGGTAAG

PAGE 32

32 and 5'-ACATCTATCATATTAAAAACAAAAA; Ant4 : 5'GTAGTATTTGGTTAGAGTGTGTTTTTTGG and 5'-ACACTAAAAAAAACTAAAAAACC (40 cycles). Following PCR amplification, fragment s were purified using a PCR purification kit (Qiagen) and eluted into a fina l volume of 35 L. Digestion of PCR purified fragments was then carried out with HhaI as follows: 35 L eluted PCR purified fragments, 4.5 L of NEB buffer 4 (New England Biolabs, Beverly, MA), 1.5 L of HhaI enzyme (New England Biolabs), .25 l of Bovine serum albumin (New England Biolabs), and 3.75 L water. Digestion was carried out overnight and products were subs equently subjected to electrophor esis at 100V for 30min. on 2% agarose gels. Primers used for bisulfite sequencing were Ant1 : 5'TGTTTAGGGATTAGTTTAGTTAATG and 5'CTAATCCCCCATACTAAAAACC; Ant2 : 5'GGTTTGATTAGGTGTTAAGGGTAAG and 5' ACATCTATCATATTAAAAACAAAAA; Ant4 : 5'-TTGTTGTGTATTGATTGAGTATG and 5'ACACTAAAAAAAACTAAAAAACC. PCR fragments were cloned into pCRII-TOP O cloning vector (Invitrogen, Carlsbad, CA, http://www.invitrogen.com), and individual clones were sequenced.

PAGE 33

33 CHAPTER 3 RESULTS Ant4 Phylogeny As one of many steps in determining the func tion of Ant4 we decide d to investigate the similarities and differences between Ant4 and the other Ants. In or der to do this, we carried out a phylogenic analysis of the adenine nucleotide tr anslocases, which was based on the amino acid sequences of each Ant. The Autosomal Ant4 Gene is Conserved in Mammals The deduced amino acid sequence of Ant4 is well conserved among mammals (around or over 90%) (Table 2-1); however a phylogram indicates that Ant4 is relatively distinct from the other mammalian Ant family peptides, Ant1, 2 & 3 (Fig. 3-1). Indeed, the amino acid identity between Ant4 and other Ants is approximately 70%. Of interest, the gene configuration of Ant4 is also well conserved among mammals, but different from that of other Ant members. The Ant4 gene always consists of 6 exons whereas the other Ants have 4 exons in all mammalian species investigated. Another distinguish ing characteristic of mammalian Ants is in their chromosomal location. The Ant1 gene, which is predominantly expressed in skeletal muscle and heart, is on an autosome. The Ant2 gene, which is ubiquitously expressed in somatic organs, is encoded by the X chromosome and the Ant3 gene which has been identified in only a portion of mammalian species so far, including human, cow and dog is also located on the X chromosome. Rodents apparently do not possess the Ant3 ortholog, based on a search of the published genome databases. Ant3 has the highest homology with Ant2 and is ubiquitously expressed in somatic organs like Ant2 It should be noted that the human ANT3 gene is localized to the tip of the short arm (Xp22) of the X chromosome, which is known as the pseudoautosomal region 1 (PAR1). In contrast to Ant2 and Ant3 the Ant4 gene is always encoded by an autosome. Moreover, in

PAGE 34

34 contrast to Ant1 and Ant2 of which orthologs are found in other species including amphibians and fish, the Ant4 gene apparently exists only in mammals including the marsupials. Ant4 is found in both eutherian and metatherian species suggesting the presence of Ant4 in their common therian ancestor. The eutherian radiation even t representing the diverg ence of eutherian and metatherian lineages occurred ~150 million year s ago suggesting that the emergence of Ant4 occurred at least 150 million years ago (44,46), rela tively close to the origin of mammals (~200 million years ago). Ant4 Expression Pattern The exact expression profile of Ant4 in testis had not been determined. In order to gain insight into the possible function of Ant4 within the testis we sought to determine the exact expression pattern of Ant4, and thus dete rmine which cell types relied on Ant4. We demonstrated in a previous public ation that Ant4 protein was expr essed in testicular germ cells of mice (17); however, due to the limited resolution we obt ained during immunostaining of cryopreserved tissues, we were unable to furthe r define the exact expression profile of the protein within the testis at that time. As a re sult, we chose to utilize an alternative tissue preparation technique in order to in crease the sensitivity of our analysis. Ant4 Expression is Highest in Primary Spermatocytes Utilizing paraffin-embedded formalin-fixed ti ssues we were able to determine more precisely the expression pattern of Ant4 in mouse te stis. Of interest, it ap pears that Ant4 protein expression is highest in spermatocytes am ong testicular germ cells, based upon nuclear morphology and position within th e seminiferous epithelium (Fi gure 3-2). Interestingly, mouse sperm also possess Ant4 protein within the mi dpiece or neck region (Figure 3-3). We also examined the expression pattern of ANT4 in hu man testis samples using polyclonal antibodies raised against human ANT4 and were able to more clearly distinguis h the cell types within

PAGE 35

35 which ANT4 was expressed (Figure 3-4). The hu man immunohistochemistry data provided us with evidence that primary spermatocytes expr ess the highest levels of the ANT4 protein, whereas spermatogonial cells expr ess a lower level. Importantly, Sertoli cells or other somatic interstitial cells did not expre ss ANT4. In order to further define the stage specific-expression of Ant4 in male germ cells, we analyzed Ant4 mRNA expression in separated spermatogenic cell types of mouse using real-time RT-PCR analysis (Figure 3-5). Ant4 transcript levels began to increase upon transition of premei otic type B spermatogonia into th e early stages of meiosis as represented by preleptotene spermatocy tes (PL). The transcript level of Ant4 continued to increase through the leptotene and zygotene sper matocyte stages, peaking in early pachytene spermatocytes. Ant4 transcript levels then began to decrea se in late pachytene spermatocytes and in later round spermatids (Figur e 3-5). Thus, high levels of Ant4 expression are likely associated with entry of the male germ cells into meiosis. In contrast, the fracti on enriching Sertoli cells expressed a very low level of Ant4 We also confirmed here, by real time RT-PCR, that the Ant4 transcript is very low or undetect able in somatic organs and ovary. It should be noted here that, in contrast to a previous observation using a cryopreserved specimen ( 17), developing oocytes did not show any detectable Ant4 expression in paraffin-embedded formalin-fixed tissues (Figure 3-7). Using the same RNA samples prepared fo r the study above, we also investigated the expression pattern of the Ant2 gene in vari ous organs and spermatogenic cell types (Figure 36). Of interest, the expression profile of Ant2 in mice was reciprocal to that of Ant4 The Ant2 transcript was high in somatic organs, but relative ly low in whole testis and almost completely undetectable in testicular germ cells, except primitive spermatogonia.

PAGE 36

36 Ant4 Function Within the Testis We first sought to confidently determine th e expression profile of Ant4. Following the elucidation of the expression patt ern of Ant4 we extended our st udy to the investigation of its function. Generation of Mice with a Targeted Disruption of Ant4 To investigate the i n vivo function of Ant4 we generated Ant4 -deficient mice by homologous recombination in embryonic stem (ES) cells. The targeted disruption deleted exons 2 to 4, which encode amino acid residues 79212 (Figure 3-8A). An IRES-gal cassette was inserted with a splicing acceptor site to al low for examination of the activity of the Ant4 promoter. Disruption of the Ant4 gene in mice was confirmed by S outhern blot analysis (Figure 3-8B) and genomic PCR amplification (Figure 38C). Immunoblotting was used to confirm the absence of Ant4 protein expression in the Ant4 -deficient mice as well as to analyze the levels of Ant1 and Ant2 (Figure 3-9). The relative protein levels of Ant2 in the Ant4-/testis, when normalized by total protein amount, were increased in comparison to controls, whereas Ant2 levels were unaffected in heart. Interestingly, the levels of Ant2 as assayed by western blot were slightly increased in the testicul ar preparation of the Ant4-deficie nt mice. This inconsistency in the protein levels of Ant2 could be due to th e increased somatic cell c ontribution as a proportion of the whole loaded protein. This would be the result of a higher somatic cell contribution in the Ant4-deficient testis due to the severely d ecreased germ cell component. Since Ant2 is ubiquitously expressed in most somatic tissues, the increased pr oportion of somatic tissue could explain this slight inconsistency in protein levels. The levels of Ant1 protein expression, which were high in heart and undetectab le in testis, were unaffected by Ant4 disruption. The Ant4 promoter-driven -galactosidase expression from our targeted allele also enabled us to examine the Ant4 expression profiles in mice. As expected, X-gal staining in Ant4+/mice was observed

PAGE 37

37 only in the testis but not in any other organs (data not shown). X-gal staining of the Ant4+/testis demonstrated that the -galactosidase activity was most clearly detectable when male germ cells transitioned into cells morphological ly representative of spermatocy tes (Figure 3-10), consistent with the immunohistochemistry data above. Ant4 Deficient Mice Exhibit Impai red Spermatogenesis and Infertility The Ant4-/mice were viable and exhibited a pparently normal development. The interbreeding of Ant4+/mice produced offspring of normal litter size, and conformed to the Mendelian ratios of Ant4+/+, Ant4+/and Ant4-/inheritance, 9, 27, and 13 re spectively. In contrast to the similar body sizes between th e wild type and mutant mice (d ata not shown), the testes of Ant4-/adults were smaller than those of Ant4+/+ adults (Figure 3-11). Testes from 6-week-old Ant4-/males were approximately one-third the wei ght of those from control males. Closer examination of testicular development revealed similar growth patterns of the testis until approximately 17 days after birth, suggesting norm al growth of the spermatogonia (Figure 3-13) (47). Subsequent development was impaired in Ant4-/testis. Histological analysis of Ant4deficient testis demonstrated clear morphological aberrations in the process of spermatogenesis as evident by the severe reduction of spermato cytes and vacuolization of the seminiferous epithelium (Figure 3-12). Furthermore, mating of Ant4 deficient males with wild-type females did not produce any offspring. In contrast, Ant4-/females were fertile and did not show any apparent ovarian abnormalities. Ant4-/Germ Cells Undergo Meiotic Arrest To determine the stage at which Ant4-/germ cells undergo arrest, RT-PCR analysis of transcripts present in different specific sperma togenic cell types was carried out (Figure 3-14). Dazl which is expressed throughout spermatoge nesis, was similarly expressed in the Ant4+/+, Ant4+/-, and Ant4-/testis. The DNA mismatch repair gene Dmc1 which is expressed before the

PAGE 38

38 pachytene spermatocyte stage (48, 49), did not exhibit significantly different expression patterns either. The expression of A-Myb which is a transcription factor of the Myb -family that is expressed in type B spermatogoni a and leptotene to pachytene spermatocytes (50), decreased in the Ant4-/testis. The expression of Dvl3 which has been shown to be present from primitive type A spermatogonia through pachytene sper matocytes (51), also decreased in the Ant4-/testis. Synaptonemal complex protein 3 ( Sycp3 ), which is restricted to the zygotene to diplotene spermatocytes (52), was markedly decreased in the Ant4-/testis. Transcripts normally present in pachytene spermatocytes and at later stages, such as HoxA4 and CyclinA1 (53,54), were not detected in the Ant4-/testis. In addition, Dvl1 which is expressed in round, elongating, and elongated spermatids (51), was also undetectable in the Ant4-/testis. These data indicate a decrease in meiotic, specifically at the stag e of pachytene and beyond, and an absence of the postmeiotic germ cells in the Ant4-/testis. Ant4 Deficient Mice Possess a Decreased Nu mber of Pachytene Spermatocytes and an Absence of Diplotene Spermatocytes To further investigate the stage of Ant4-def icient spermatocytic arrest we utilized synaptonemal complex protein 3 (Sycp3) staini ng (Figure 3-15). Synaptonemal complex protein 3 (Sycp3) mediates the pairing and synapsis of homologous chromosomes during meiosis I and thus is utilized to demarcate the chromosome s. Upon analysis with Sycp3, the seminiferous epithelium of Ant4-deficient mice showed an increased proportion of leptotene like spermatocytes, as determined by the chromosoma l condensation status of these cells. The Ant4deficient spermatocytic compartment also cont ained zygotene and pachytene like cells, however the proportion of these cell types were decreased in comparison to controls In order to more precisely determine the stag e of arrest of Ant4-deficient spermatogenic cells, we next performed a chromoso mal spread analysis utilizing Sycp3, H2AX and DAPI on

PAGE 39

39 Ant4 wild-type (Figure 3-16) and Ant4-deficient (Figure 3-17) spermatocytes respectively. Phosphorylated H2AX ( H2AX) is a histone variant known to associate with double strand breaks. H2AX is also known to associate with the chromosomes during meiosis I, specifically leptotene through diplotene of prophase I. H2AX is implicated to have a role in conferring the heterochromatic transformation of the X and Y chromosomes that occurs during meiosis I. Sycp3 and H2AX localization allowed us to determine exact ly which stages of the meiotic prophase I were absent in the Ant4-deficient mice in compar ison to controls. These data indicate a decrease in zygotene and pachytene spermatocytes with a co mplete absence of diplotene spermatocytes in Ant4-/testes. We also found there to be a se vere reduction in the pe rcentage of pachytene spermatocytes (Figure 3-19). The overall number of pachytene spermatocytes were also severely decreased in comparison to controls (Figure 3-20). Utilizing H2AX staining we investigated the affects of Ant4 deletion on sex body formation and XY inactivation which normally occur during meiosis I in the male germ cells. In the Ant4-/spermatocytes there we re abnormalities in both the localization of H2AX and also the condensation stat us of the XY chromosomes during pachytene (Figures 3-17 and 3-18). These da ta indicate that Ant4 depletion leads to abnormalities in the formation of the sex body and in the proper inactivation of the X and Y chromosomes. Ant4 Deficient Male Mice Exhibit Increased Levels of Apoptosis Within the Testis TUNEL labeling and cleaved caspase-3 staining were utilized to analyze the apoptotic profile of adult (6 wks) Ant4-/testis in comparison to controls (Figures 3-21 and 3-22). The testis of Ant4deficient mice exhibited increased levels of TUNEL-positive cells within the seminiferous tubules as compared to contro ls (Figure 3-21). Upon closer examination, the majority of the TUNEL-positive cells w ithin the seminiferous tubules of Ant4-/mice appeared to

PAGE 40

40 be spermatocytes based upon cellular morphol ogy and position within the seminiferous epithelium (Figure 3-21 bottom panel). We also util ized caspase-3 staining within the testis to confirm the differential apoptot ic profiles present between Ant4 -deficient testis and controls (Figure 3-22). Taken together, these results suggest that the Ant4-/testis contain a significantly higher number of apoptotic cells than controls, and the majority of these cells appear to be early spermatocytes. In order to investigate further the testicular development of Ant4-/mice in comparison to controls, we utilized the synchron ous nature of the first spermatogenic cycle in postnatal testes. Following birth, the testis underg o the first spermatogenic cycle which produces germ cells of advancing development with incr easing age (47). Thus, the testis at 7 days postpartum contains only spermatogonia and soma tic cells. At 12 days, leptotene and zygotene spermatocytes appear and by day 17 early pac hytene spermatocytes are found. By day 22, more advanced pachytene spermatocytes and round spermatids are present, and by day 35, the complete complement of germ cells begi ns to be present (47). Around day 17, the Ant4-/testis began to exhibit signs of increased cell death within the germ cell compartment (Figure 3-23). By day 22 clear morphological diffe rences were present between Ant4-/and control testes. These data further support our observation that in the Ant4-/testis, the early spermatocytes begin to undergo changes indicative of cell death and that by the pachytene stage these spermatocytes undergo apoptosis. Ant4 Promoter CpG Analysis In order to investigat e the role of methylation in the regulation of the adenine nucleotide translocase family of genes, we carried out a promoter CpG dinucleotide analysis. We utilized the MethPrimer program (http://www.urogene.or g/methprimer/index1.html) to determine the presence or absence of promoter proximal CpG islands within the adenine nucleotide

PAGE 41

41 translocases' genomic loci. We identified distinct CpG islands as calculated by MethPrimer within the Ant1, Ant2, and Ant4 promoter proximal regions. Identification of CpG Islands at the Pr omoter Regions of An t1, Ant2 and Ant4 In order to determine if Ant1 and Ant2 similarly to Ant4 were regulated in part by methylation we first investigated the promoter proximal regions of Ant1 Ant2 and Ant4 for the presence of CpG rich areas known as CpG isla nds. The regions investigated extended 500 bp upstream of the predicted tr anscription initiation site and 212 bp downstream from the transcription initiation site extend ing into exon 1. Interestingly, this analysis revealed that like Ant4 Ant1 and Ant2 contained clearly discernable CpG is lands within their promoter proximal regions ( Figure 3-24). Real-Time PCR Analysis of Ant1, Ant2 and An t4 Transcript Levels in Various Tissues For the purpose of our study it was necessary to determine the transcript levels of Ant1 Ant2 and Ant4 in various tissues and to determine in which tissues each was expressed at its highest and lowest levels. In order to determine the tran script levels of each of Ant1 Ant2 and Ant4 we utilized TaqmanTM real-time PCR analysis of RNA is olated from male mouse testis, kidney, heart, skeletal muscle, and tail, as well as RNA isolated from female tail. Each tissue was chosen carefully after searchi ng the published data regarding th e expression levels of Ant1, 2, and 4 in various tissues. The goal of the expre ssion analysis was to determine the tissues in which each Ant was expressed at its highest and lowest levels. These data demonstrate that within the tissues analyzed, Ant1 is expressed most significantly in heart and skeletal muscle with the lowest transcript levels being present in liver; Ant2 is significantly expressed at the transcript level in kidney with the lowest levels be ing detectable in skeletal muscle or testis; and Ant4 is expressed most significantly in testis with the absence or very low levels of transcript being detectable in kidney (Figure 3-25).

PAGE 42

42 Methylation Analysis of Ant1, Ant2, and An 4 Promoter Proximal CpG's in Various Tissues To investigate the methylation status of Ant1 Ant2 and Ant4 in various mouse tissues we utilized combined bisulfite restriction analysis (COBRA). Using the restriction enzyme HhaI which digests DNA protected from bisulfite c onversion by methylation at the sequence GCGC, we were able to quickly determine the met hylation status of the promoter regions of Ant1 Ant2 and Ant4 in various tissues. HhaI digestion of Ant1 Ant2 and Ant4 promoter loci revealed an absence of methylation at the Ant1 and Ant2 promoter regions in all tissues analyzed, whereas Ant4 exhibited the same methylation pattern as prev iously published (Figure 3-26) (Rodic et al. ). Interestingly, Ant2 which is located on the X ch romosome shows a partial methylation pattern in female tissue when analyzed by COBRA. The partia l methylation of Ant2 in female tissue is most probably due to the random inactivation of one of the X chromosomes which occurs in females. In order to further pr obe the methylation status of Ant1 Ant2 and Ant4 we utilized bisulfite sequencing analysis. Bisulfite analysis of promoter proximal CpG islands was carried out on selected tissues for Ant1 Ant2 and Ant4 We utilized the expression analysis to determine the tissues to be analyzed based on expression levels. For each of Ant1 Ant2 and Ant4 we chose one tissue in which transcript levels were signi ficantly present for each and also one in which little to no transcript was detectable. This allowe d us to determine if there was any differential methylation status present between tissues in which these Ants were significantly expressed or not significantly expressed. To analyze the An t1 promoter proximal CpG island methylation status we utilized heart as the expressing tis sue and liver as the nonexpressing tissue. For Ant2 analysis we utilized kidney as the expressing tissue and skeletal muscle as the low expressing tissue, we also analyzed female tail to conf irm our COBRA data for the partial methylation pattern present. For Ant4 we utilized testis as the tissue e xpressing Ant4 and kidney as the tissue with little or no detectable expression. Bi sulfite analysis confirmed our COBRA data

PAGE 43

43 demonstrating no differential methylation analysis within tissues significa ntly expressing and not significantly expressing Ant1 and Ant2 (Figure 3-27). Whereas An t4 showed a differential methylation pattern between tissues in which it was significantly expresse d and tissue in which the transcript was low to absent.

PAGE 44

44 Figure 3-1. Phylogeny of ADP, ATP carrier proteins. A phylogram was generated using the ClustalW program (European Bioinformatics Institute). Ensembl gene IDs for Ant1, 2, 3, & 4 are shown in Table 1. Others include: Anopheles gambiae (ENSANGG00000017789), Drosophila me lanogaster (CG16944, CG1683), Saccharomyces cerevisiae (YBL030C, YBR 056W, YMR056C), Arabidopsis thaliana (NP_196853, NP_850541, NP_194568) and Ca enorhabditis elegans (R07E3.4, F25B4.7).

PAGE 45

45 Figure 3-2. Ant4 expression is highest in mouse spermatocytes. (A) Immunohistochemical analysis of Ant4 expression in mouse te stis: Paraffin-embedded sections of mouse testis from wild-type 6-week-old mice were incubated with a rabbit polyclonal antibody against mouse Ant4. Ant4 staining was visualized using DAB (brown), and slides were counterstained with hematoxylin. In contro l (top left), rabbit IgG was used as a primary antibody. Scale bars: 40 m.

PAGE 46

46 Figure 3-3. Ant4 expression is highest in hum an spermatocytes. (B) Immunohistochemical analysis of ANT4 expression in human te stis: Formalin-fixed, paraffin-embedded sections of human testis from a 32 old ma le were incubated with a rabbit polyclonal antibody raised against human ANT4. ANT4 staining was visualized using DAB (brown), and slides were counterstained with hematoxylin. Arrows, arrowheads and asterisks indicate spermatogonia, Sertoli cells and spermato cytes, respectively. Scale bars: 50 m.

PAGE 47

47 Figure 3-4. Ant4 is localized to the sperm midpiece. Left: Phase contrast microscopy of adult (6 weeks) mouse sperm isolated from the caudal epididymis. Right: Immunoflourescence of Ant4 expression in mouse sperm. Formaldehyde fixed, methanol permeablized sperm were incubate d with the affinity-purified rabbit-anti mouse Ant4 antibodies at a concentrati on of 1:100. Alexa flour 488 conjugated goatanti rabbit secondary antibodi es were added at a 1:200 dilution. DAPI was added to slides and visualized using fluor escent microscopy. 60X magnification

PAGE 48

48 Figure 3-5. Ant4 peaks during meiosis I. TaqmanTM Real-time PCR analysis of Ant4 transcript levels in purified mouse spermatogenic cell types (PA = primitive type A spermatogonia, A = type A spermatogoni a, B = type B spermatogonia, PL = preleptotene spermatocyes, L+Z = leptotene + zygotene spermatocytes, EP = early pachytene spermatocytes, LP = late or adult spermatocytes, RS= round spermatids, JS= juvenile sertoli cells) a nd various other tissues (whole testis, heart, liver, brain, kidney, ovary, and embryonic stem cells) (6w eek-old-mice). The re lative transcript levels are shown in each graph when the transc ript level of Ant4 in heart was set to 1.

PAGE 49

49 Figure 3-6. Ant2 levels are low to absent during meiosis I. Ta qmanTM Real-time PCR analysis of Ant2 transcript levels in purified m ouse spermatogenic cell types (PA = primitive type A spermatogonia, A = type A sperma togonia, B = type B spermatogonia, PL = preleptotene spermatocyes, L+Z = leptotene + zygotene spermatocytes, EP = early pachytene spermatocytes, LP = late or adult spermatocytes, RS= round spermatids, JS= juvenile sertoli cells) a nd various other tissues (whole testis, heart, liver, brain, kidney, ovary, and embryonic stem cells) (6w eek-old-mice). The re lative transcript levels are shown in each graph when the transc ript level of Ant2 in heart was set to 1.

PAGE 50

50 Figure 3-7. Histological analysis of Ant4 prot ein within the ovarie s. Immunohistochemical analysis of paraffin-embedded sections of testes (A) and ovaries (B) from wild type (+/+) adult mice using a polyclona l antibody to Ant4.Scale Bars: 50 m. In contrast to a previous observation using a cryopreserv ed specimen (5), developing oocytes did not show any Ant4 expression. The present da ta are more consistent with real-time PCR analysis (Fig. 2C) and Northern blot analysis (5). Collectively, Ant4 expression appears to be low in ova ries including oocytes.

PAGE 51

51 Figure 3-8. Gene targeting of Ant4 (A) Strategy used for ta rgeted disruption of the Ant4 gene. (B) Southern blot analysis of BamHI-digested genomic DNA extracted from tails of wildtype (+/+), heterozygous (+/-) and homozygous (-/-) mutant mice. DNA was hybridized with the probe shown (5 external probe). (C) PCR analysis using allelespecific primers of genomic DNA of the i ndicated genotypes. Arrowheads in (A) denote the primers used for PCR amplification. B C A

PAGE 52

52 Figure 3-9. Confirmation of disrupted Ant4 Gene Western blot analysis of Ant4 peptide expression as well as Ant1 and Ant2 in both testis and heart.

PAGE 53

53 Figure 3-10. Ant4 promoter-driven -galactosidase expression pattern in testes. X-gal staining of wild-type (+/+, left panels), and heterozygous (+/-, right panels) testes, with low (top panels) and high (bottom pa nels) power magnification. Ant4 promoter-driven galactosidase was not detected in sperma togonia or Sertoli cells, but was seen in primary spermatocytes and the subseque nt cell types of spermatogenesis in heterozygous testes. Sl ides were counterstained w ith hematoxylin. Scale bars: 50 m.

PAGE 54

54 Figure 3-11. Severe reduction of testicular mass in Ant4-deficient mice. Gross morphology of testis from 6-week-old mice.

PAGE 55

55 Figure 3-12. Ant4-deficient testis exhibit gross histological abnormalities. Histological analysis of testis (6-week-old) by hematoxy lin and eosin staining. Scale bars: 50 m.

PAGE 56

56 Figure 3-13. Testicular weight analysis. (A) Weight comparison of testis of the indicated genotypes (7 to 49 days old and 5 months). ) (B) RT-PCR gene expression analysis in testis (6-week-old).

PAGE 57

57 Figure 3-14. Transcript analysis of Ant-deficient testis. (A) Wei ght comparison of testis of the indicated genotypes (7 to 49 days old and 5 months). ) (B) RT-PCR gene expression analysis in testis (6-week-old).

PAGE 58

58 Figure 3-15. Sycp3 Chromosomal anal ysis. Immunohistochemical analysis of primary spermatocytes using Sycp3 staining in wild -type testis (left Panel) and in Ant4deficient testis (right panel). Lower panels are high magnification images. Scale Bars: 50 m.

PAGE 59

59 Figure 3-16. Ant4 wild-type spermatocytic chro mosomal spread. Chromosomal spread analysis of freshly dissected testis from 6 we ek old wild-type mice. Spermatocytic preparations were incubated with bo th rabbit polyclonal Sycp3 and mouse monoclonal H2AX at 1:200 dilutions. Sycp3 stai ning was visualized with an Alexafluor 488 conjugated anti-rabb it secondary antibody and H2AX was visualized with a Cy3 conjugated anti-mouse secondary antibody. Leptotene Zygotene Pachytene Diplotene DAPI H2AX Sycp3Merge +/+ +/+ +/+ +/+

PAGE 60

60 Figure 3-17. Ant4-deficient testis lack diplotene spermatocytes. Chromosomal spread analysis of freshly dissected testis from 6 week ol d Ant4-deficient mice. Spermatocytic preparations were incubated with bo th rabbit polyclonal Sycp3 and mouse monoclonal H2AX at 1:200 dilutions. Sycp3 stai ning was visualized with an Alexafluor 488 conjugated anti-rabb it secondary antibody and H2AX was visualized with a Cy3 conjugated anti-mouse secondary antibody. Leptotene Zygotene Pachytene DAPI H2AX Sycp3Merge -/-/-/-

PAGE 61

61 Figure 3-18. Pachytene abnormalities in Ant4-deficie nt spermatocytes. Chromosomal analysis of Ant4-/pachytene spermatocytes utilizing Sycp3 and H2AX staining. 60X magnification Pachytene Pachytene Pachytene Pachytene DAPI H2AX Sycp3Merge -/-/-/-/-

PAGE 62

62 Figure 3-19. Quantification of spermatocytes in Ant4 -deficient testis. Percentage analysis of the spermatocytic cells present in the semini ferous epithelium of Ant4 wild-type and Ant4-deficient testes.

PAGE 63

63 Figure 3-20. Spermatocyte counts. Quantification of spermatocytes, leptotene through diplotene of Ant4-deficient testis in comparison to controls.

PAGE 64

64 Figure 3-21. Apoptotic analysis of Ant4-deficie nt testis in comparis on to controls. TUNEL analysis of Ant4 heterozygous mice (left panel) and Ant4-deficient testis (right panel). Lower panels are high magnification images. Scale Bars: 50m

PAGE 65

65 Figure 3-22. Cleaved Caspase-3 an alysis. Immunohistochemical an alysis of cleaved caspase-3 expression in testis from 6-week-old he terozygous mice (left), homozygous mutant mice (right). Cleaved caspase-3 staining wa s visualized using DAB (brown), and slides were counterstained w ith hematoxylin. Scale bars: 50 m.

PAGE 66

66 Figure 3-23. Postnatal development in the Ant4+/ and Ant4-/testis. Le ft panels: Histological analysis (hematoxylin and eosin staining) of the testis during the first wave of spermatogenesis (D7-D22) and in the sexua lly mature adult, (D42) of heterozygous (+/-), and homozygous (-/-) mutant mice. Ri ght panels: TUNEL analysis of the first wave of spermtogenesis (D7-D22) and in the adult, (D42) testis of heterozygous (+/-), and homozygous (-/-) mutant mice. Cells ha ving DNA breaks were labeled using TdT and fluorescein-dUTP, and visualized usi ng anti-fluorescein antibody conjugated with alkaline phosphatase (blue). S lides were counterst ained with Nuclear Fast Red (pink).

PAGE 67

67 Figure 3-24. Adenine nucleotide translocase prom oter analysis. Analysis of Ant1, Ant2, and Ant4 promoter proximal regions for th e presence of CpG islands. The regions investigated extended 500 bp upstream of the predicted transcription initiation site and 212 bp downstream from the transcripti on initiation site ex tending into exon 1.

PAGE 68

68 Figure 3-25. Ant1, Ant2, and Ant4 transcript level analysis in various tissues. TaqmanTM Realtime PCR analysis of Ant1 Ant2, and Ant4 transcript levels in testis, liver, heart, kidney, muscle, and male and female tail. Ant1:light gray, Ant2: dark gray, and Ant4: black. Ant1 Ant2 Ant4

PAGE 69

69 Figure 3-26. Combined Bisulfite Restriction an alysis (COBRA) of Ant1, Ant2, and Ant4 promoter proximal CpG dinucleotides. Restric tion analysis in testis, liver, heart, kidney, muscle, and male and female tail U:unmethylated at restriction site, M:methylated at restric tion site investigated.

PAGE 70

70 -500 +212 Heart (M) Liver (M)Ant1 -500 +212 Ant2 Kidney (M) Skeletal Muscle (M) Tail (F)Ant4Testis (M) -500+212 Kidney (M) Figure 3-27. Bisulfite sequence analysis of Ant1, Ant2, and Ant4 promoter proximal CpG islands. Representative bisulfite analysis in various tissue types

PAGE 71

71 Figure 3-28. Methylation and expres sion correlation of Ant1, Ant2, and Ant4 in various tissues.

PAGE 72

72 CHAPTER 4 DISCUSSION AND CONCLUSION Spermatogenesis is the process by which se lf-renewing testicular precursors undergo proliferation, differentiation and maturation to produce viable spermatozo a. This process of spermatogenesis is one of the most elegant and complex examples of cellular growth and differentiation present within the mammalian sy stem. Thus, there are many stages at which aberrations in spermatogenesis may lead to infertility. During the complex and energy demanding process of spermatogene sis the proliferating and diffe rentiating spermatogenic cells rely on the production and availability of ATP from the mitochondria. Classically, aberrant mitochondrial function has been connected wi th deficient sperm motility. Reduced sperm motility has been reported in patients with mitochondrial diseases (55, 56), and pathogenic mutant mitochondrial DNA (mtDNA) has also been identified in semen samples of patients with fertility problems (57-59). However, a recent st udy revealed that the accumulation of mutant mitochondrial DNA in mice induced male infertility due to oligospermia and asthenozoospermia (60). Further, spermatogenic cells carrying > 75-80% mutant mitochond rial DNA demonstrated meiotic arrest and displayed enhanced a poptosis, indicating that normal mitochondrial respiration is required for mammalian spermatogenesis as well as for sperm motility (60). The present work has identified an essential role for the Ant4 gene in mammalian spermatogenesis. The Ant4 gene is expressed exclusively during sperma togenesis both in mice and humans, while other Ants are ut ilized in somatic cells. Thus, Ant4 likely serves as the sole mitochondrial ADP/ATP carrier during spermatoge nesis. Furthermore, without a functional ADP/ATP carrier protein ATP would not be efficientl y transported into the cytosol, thus Ant4 is considered to be critical for normal spermat ogenesis. Also, as a re sult of the absence of functional ADP/ATP translocation it might be inferred that inhibi tion of the electron transport

PAGE 73

73 chain would occur. This inhibition would be due to the absence of a substrate for ATP production and also by the accumulation of ATP w ithin the matrix of the mitochondria. The inhibition of the translocation of ADP/ATP woul d also result the produc tion of high levels of reactive oxygen species due to the "leaking" of electrons form th e 'backed-up" electron transport chain. Concomitant with the production of increased proporti ons of reactive oxygen species would also be the disruption of the electrochemical membrane potential of the mitochondria which might result in the depolarization of th e membrane leading to apoptosis. Indeed, the disruption of the Ant4 gene resulted in meiotic ar rest in mice as evidenced by the loss of meiotic and post-meiotic germ cells in the Ant4 -deficient testis. The phenotype was similar to that seen in mice with aberrant mitochondrial DNA (60). Furt her, this loss appeared to result from an increase in apoptosis within the early sper matocyte population. This apoptosis led to the complete absence of diplotene spermatocytes and a severe reduction in the number of pachytene spermatocytes within the seminiferous epithelium of Ant4-deficient testis. Ant4-deficiency also resulted in the improper localization of H2AX with the chromosomes a nd clear deficiencies in the heterochromatinization of the X and Y chro mosomes. Although the ex act Ant4 function of Ant4 within male germ cell mitochondria rema ins to be determined, the current study supports an idea that the ATP supply through normal oxidative respiration is critical for the processes of male germ cell meiosis. Chromosomal locations of the Ant fam ily genes are unique and conserved among mammalian species. The Ant2 gene, which is ubiquitously expre ssed in somatic cells, is encoded by the X chromosome in all the mammalian species investigated. In mammalian males the X and Y chromosomes are known to undergo a hetero chromatic transformation upon entry into meiosis, during prophase I, due to a lack of a homologous pairing partner (61-67). This

PAGE 74

74 transformation, known as meiotic-sex chromosome inactivation (MSCI), c onfers transc riptional repression upon the X and Y chromosomes as de monstrated by RNA polymerase II exclusion (65, 66). On the other hand, the Ant4 gene, which a pparently exists only in mammals, is always encoded on autosomes. These implicate a hypothesis that Ant4 may have originally arose to compensate the loss of Ant2 function during male meiosis. Female mammals have two X chromosomes and do not undergo MSCI (65, 66), wh ich is consistent w ith the fact that Ant4 deficient female mice exhibit no observab le decrease in fertility. Indeed, the Ant2 and Ant4 expression profiles were mutually reciprocal in the mice, and the Ant2 expression was particularly low during spermatogenesis (Fi gure 3-6). Of interest, the expression of Ant2 is very low not only in male meiotic germ cells but throughout spermatogenesi s within the testis. Although the classical examples of MSCI show the repression of the genes after the pachytene stage, it is known that almost half of th e X chromosome-linked genes are not expressed throughout spermatogenesis like the Ant2 gene (65). After the emergence of Ant4 in mammals, the expression of Ant2 may have undergone further modificati ons to reduce transcription of the gene. In contrast to the low Ant2 transcript levels in testicular germ cells, the overall Ant2 expression, both protein and mRNA were more detectable in the whole testis preparation (Figures 3-6 and 3-9). This discrepancy ma y be due to a predominant expression of Ant2 in somatic cells of the testis such as interstitial Leydig cells and vascul ar endothelial cells. However, we are currently unable to test this assumption because antibodies we had raised against Ant2 as well as a ny other available Ant2 antibodies do not work for immunohistochemistry. Mammals have evolved a mechanism to compen sate for the loss of gene expression from the sex chromosomes during male meiosis (46, 62, 64). Multiple autosomal retrogenes of X

PAGE 75

75 chromosome origin have been reported as candi dates potentially compensating for the absence of essential sex-linked gene expression duri ng male meiosis, as exemplified by the Pgk1 / Pgk2 gene family (68-71). Although such retrogenes are considered to positively support male meiosis, there has been only one report so far ( Utp14b ) to clearly demonstrate th e absolute necessity of such retrogenes in male meiosis (72, 73). It seems that even Pgk2 null mice demonstrate minimal male infertility (depending on genetic background) mainly due to a sperm motility defect (74). In contrast, the present stud y demonstrates that the Ant4 gene is essential for male meiosis. Indeed, the Ant4 gene likely arose before the divergence of eutherian and metatherian lineages around the time when MSCI may have initiated (67). Thus, the Ant family of genes may be among the most essential to be compensated for during male meiosis. Interestingly, the Ant4 gene is not a retrogene in contrast to all th e other known potential autosoma l "compensation" genes. This suggests that Ant4 may have been generated by a standa rd gene duplication event in mammalian ancestors. It should be noted here that certa in mammalian species including human, cow and dog but not rodents have another Ant Ant3 on the tip of the X ch romosome (61,75). Human ANT3 is encoded on Xp22 within the PAR1 region (40). Th is region is highly conserved between X and Y chromosomes, and is known to escape from se x chromosome inactivation during male meiosis (63, 65, 75). Thus, it would be plausible that some mammalian species may have evolved an additional protective mechanism to secure male meiosis. However, the role of ANT3 in human spermatogenesis is questionable, considering the fact that ANT3 expression is very low, just as ANT2 expression, in human testis (h ttp://symatlas.gnf.org/SymAtlas/). An alternative hypothesis, not entirely excl usive of the above th eory, is that the specification of the Ant4 gene may have occurred in orde r to better support the process of spermatogenesis. Indeed, Ant4 has distinguished N-terminus a nd C-terminus regions that are

PAGE 76

76 conserved across mammalian species, which could pot entially be adapted to a specific energy requiring process during male meiosis or subsequent sperm function. A recent report demonstrated that mitochondrial respiration defects due to the accumulation of mutated mitochondrial DNA lead to meiotic arrest and/or as thenozoospermia (60). This implies that male meiosis is one of the most energy demandi ng processes and is highly dependent on the production and availability of ATP from the mitochondria. It is possible that Ant4 may have been altered during evolution in orde r to adjust to better fit su ch an energy demanding cellular environment. We believe this hypo thesis to be more likely as demonstrated by our recent data. The improper localization of H2AX and incomplete heterochromatinization of the X and Y chromosomes observed in the Ant4-deficient mi ce suggest that the X chromosome may not be completely silenced. Since it is quite clear that Ant4-deficiency results in improper condensation of the X and Y chromosomes, it is possible that An t2 transcript could be produced off of the now slightly more euchromatic X. This would support the specialization theory of Ant4, in that the kinetics of Ant2 ADP/ATP exchange may not be be st suited for the process of spermatogenesis. In addition, ANT4 has been recently isolated from th e fibrous sheath of the human sperm flagellar principal piece using mass spectrometry pr oteomics and was shown to co-localize with glycolytic enzymes (33). Ant4 may have obtained an additional function which is advantageous for mammalian fertility regard ing sperm function as well. In summary, the present data de monstrate an essential role for Ant4 in murine spermatogenesis, more particularly in the surviv al of meiotic male germ cells. We have clearly demonstrated that Ant4 deficiency results in the failure of the germ cells to progress through the essential process of meiosis. Sp ecifically that Ant4 plays a cr ucial role during prophase I of meiosis I, and that in the absen ce of Ant4 there is a severe re duction in the number of pachytene

PAGE 77

77 spermatocytes, with a complete absence of diplot ene spermatocytes. Ant4-deficiency also results in the improper localization of H2AX and aberrations in the heterochromatinization of the X and Y chromosomes, which normally occurs dur ing prophase I. Additi onally, this study demonstrates the molecular conservation of the Ant family of genes in mammals, and suggests a non-retrogene-based compensational mechanism of meiotic-sex chromosome inactivation in mammals. This work has contributed a significant qua ntity of knowledge towa rds understanding the unique requirements of spermatogenesis, whic h have provided a solid foundation upon which to study male germ cell development. Approximately 15% of all couples are affected by infertility with half of all cases being at tributed to the male (76). Due to the recent discovery of ANT4 there are currently no known clinical male infer tility deficiencies related to ANT4. Our work in mouse has paved the way for the future discov ery of any possible linkages of ANT4 to male infertility. Furthermore, despite currently available contraceptive methods, the world's population exceeds 6 billion and is currently increasing annually by approximately 80 million. These ever increasing numbers ar e resulting in overpopulation in ma ny parts of the world leading to environmental destruction and a great deal of human suffering. Family-planning organizations estimate that much of this growth is unintended, indeed half of all conc eptions are unplanned and half of the resulting pregnancie s are undesired (77). This high ra te of unintended pregnancy can be attributed to inadequate access to, or use of contraceptives, or both. Therefore, there is a significant need for a wider variety of contraceptive options in order to help control the high rate of unintended pregnancies. In particular developing alternativ e approaches for male based contraception could prove to be beneficial in decreasing the numb ers of unwanted pregnancies. Currently male-directed contraception options ar e very limited, consisting of only condoms or

PAGE 78

78 vasectomy. Despite this, men currently account for a third of all contracep tive use (78). Research into the development of a hormonal contracep tive for men analogous to the estrogen and progesterone pill used successf ully by women has been underta ken and demonstrated to be effective in trials with most men, however, overall efficiency and efficacy is not yet as reliable as hormonal contraceptives in women (79). An a lternative molecularly based male contraceptive with safety, efficacy, better cost-performance a nd less significant side effects would be highly beneficial. The appeal of a male contraceptive to men is widespread as in surveys, the majority of men indicate a willingness to ut ilize such a male contraceptive if available (80-82). Also approximately 98% of women in stable, monogamous relationships would be willing to rely on their male partner to use such a method (80). Our work in characterizing a novel, testis specific adenine nucleotide translocase has provided a valuable foundati on upon which to research the development of a male specific contraceptive. The future work will rely on our analysis and resultant phenotype of Ant4 disruption demons trated here. The combination of our Ant4deficient mouse model and the unique amino acid sequence and testis specific expression of Ant4 may prove to be ideal for the development of a male contraceptive and thus may contribute greatly to the future of contraception.

PAGE 79

79 LIST OF REFERENCES 1. Henze, K., and Martin, W. (2003) Nature 426 127 2. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) Molecular Biology of the Cell. 4th Edition. Garland Science 3. McBride, H.M., Neuspiel, and M., Wasiak, S. (2006) Curr. Biol. 16 (14): 551 4. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (1994) Molecular Biology of the Cell New York: Garland Publishing Inc 5. Herrmann, J.M., and Neupert, W. (2000) Curr. Opin. Microbiol. 3 (2): 210 6. McMillin, J.B., and Dowhan, W. (2002) Biochim. et Biophys. Acta. 1585 97 7. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., and Coulson, A.R. (1981) Nature 410 141 8. Voet, D., Voet, J.G., and Pratt, C.W. (2006) Fundamentals of Biochemistry, 2nd Edition John Wiley and Sons, Inc 9. Berg, J.M., Tymoczko, J.L., Stryer, L. (2002) Biochemistry 5th Edition WH Freeman and Company 10. Buchanan, J. (2000). Biochemistry & molecu lar biology of plants 1st Edition, American society of plant physiology 11. Rich, P.R. (2003) Biochem. Soc. Trans. 31 (6): 1095 12. Voet, D., and Voet, J.G. Biochemistry, 3rd Edition. John Wiley and Sons, Inc 13 Gawaz, M., Douglas, M.G., and Klingenberg, M. (1990) J. Biol. Chem. 265 14202-14208 14. Levy, S.E., Chen, Y., Graham, B.H., and Wallace D.C. (2002) Gene 254 57-66 15. Graham, B.H., Waymire, K.G., Cottrell, B ., Trounce, I.A., MacGregor, G.R., and Wallace, D.C. (1997) Nat. Genet. 16 226-234 16. Dolce, V., Scarcia, P., Lacopetta, D., and Palmieri, F. (2005) FEBS Lett. 579 633-637 17. Rodic, N., Oka, M., Hamazaki, T., Murawski, M.R., Jorgensen, M., Maatouk, D.M., Resnick, J.L., Li, E., and Terada, N. (2005) Stem Cells 23 93-102 18. Fiore, C., Trzguet, V., Le Saux, A., R oux, P., Schwimmer, C., Dianoux, A.C., Nol, F.,Lauquin, G.J., Brandolin, G., Vignais, P.V. (1998) Biochimie 80 137

PAGE 80

80 19. Palmieri, L., Alberio, S., Pisano, I., Lodi, T., Meznaric-Petrusa, M., Zidar, J., Santoro, A., Scarsia, P., Fontanesi, F., Lamantea, E., Forrero, I., and Zebiani, M. (2005) Hum. Mol. Genet. 14 3079-3088 20. Santamaria, M., Lanave, C., and Saccone, C. Gene 333 51-59 21. Zoratti, M., and Szabo, I. (1995) Biochim. Biophys. Acta. 1241 139-76 22. Nicolli, A., Basso, E., Petronilli, V., Wenger, R.M., and Bernardi, P. (1996) J. Biol. Chem. 271 2185-92 23. Halestrap, A.P., Woodfield, K. Y., and Connem, C.P. (1997) J. Biol. Chem. 272 3346-54 24. Kokoszka, J.E., Waymire, K.G., Levy, S.E., Sligh, J.E., Cai, J., Jones, D.P., MacGregor, G.R., and Wallace, D.C. (2004) Nature 427 461-5 25. Hackenberg, H., and Klingenberg, M. (1980) Biochemistry 19 548 26. Stepien, G., Torroni, A., Chung, A.B., Hodge, J.A., and Wallace, D.C. (1992) J. Biol. Chem. 267 14592-7 27. Lunardi, J., Hurko, O., Engel, W.K., and Attardi, G. (1992) J. Biol. Chem. 267 15267-70 28. Ellison, J.W., Salido, E.C., and Shapiro, L.J. (1996) Genomics 36 369-71 29. Ceci, J.D. (1994) Mamm. Genome 5 S124-38 30. Hirano, M., and DiMauro, S. (2001) Nephrology 57 2163-216 31. Van Goethem, G., Dermaut, B., Lofgren, A., Martin, J.J., and Van Broeckhoven, C. (2001) Nat. Genetics 28 211-212 32. Lodi, T., Bove, C., Fontanesi, F., Viola, A.M., and Ferrero, I. (2006) Biochem. Biophys. Res. Commun. 341 810-5 33. Kim, Y.H., Haidl, G., Schaefer, M., Egner, U., and Herr, J.C. (2007) Dev. Biol. 302 463476 34. Belzacq, A.S., Vieira, H.L., Kroemer, G., and Brenner, C. (2002) Biochimie 84 167-176 35. Heller, C.G.; Clermont, Y. (1963) Science 140 (3563): 184-6 36. Hess, R.A. (1999) Encyclopedia of Reproduction Volume 4. Academic Press 37. Chiarini-Garcia, H., Raymer, A.M., Russel, L.D. (2003) Reproduction 126, 669-680 38. Principles of Genetics, Fourth Edition, John Wiley and Sons, Inc., 2006

PAGE 81

81 39. Raven, P.H., Johnson, G.B., Mason, K.A., Loso s, J., and Singer, S. (2007) Biology, Eighth Edition, McGraw-Hill 40. Petronczki, Mark; Siomos, Maria F. & Nasmyth, Kim (2003) Cell 112 (4): 423-40 41. Griffiths, A.J.F., Wessler, S.R., Lewontin, R. C., Gelbart, W.M., Suzuki, D.T., and Miller, J.H. (2005) Introduction to Genetic Analysis, Eighth Edition, W.H. Freeman and Company 42. Xiong, X., Wang, A., Liu, G., Liu, H., Wang, C ., Xia, T., Chen, X., and Yang, K. (2006) Environ. Res. 101 (3): 334-9 43. Sofikitis, N., Giotitisas, N., Tsounapi, P., Balt ogiannis, D., Giannakis, D., and Pardalidis, N. (2008) J. Steroid Biochem. Mol. Biol. In Press 44. McCarrey, J.R., and Thomas, K. (1987) Nature 326 501-505 45. Kawasome, H., Papst, P., Webb, S., Kelle r, G.M., Johnson, G.L., Gelfand, E.W., and Terada, N. (1998) Proc. Natl. Acad. Sci. USA. 95 5033-5038 46. Wang, P.J. (2004) Trends Endocrinol. Metab. 15 79-83 47. Richardson, L.L., Pedigo, C., a nd Handel, M.A. (2000) Biol. Reprod. 62 789-79 48. Habu, T., Taki, T., West, A., Nishimune, Y., and Morita, T. (1996) Nucleic Acids Res. 24 470-477 49. Kuramochi-Miyagawa, S., Kimura, T., Ijiri, T.W., Isobe, T., Asada, N., Fujita, Y., Ikawa, M., Iwai, N., Okabe, M. Deng, W., Lin, H., Matsuda, and Y., Nakano, T. (2004) Development 131 839-849 50. Mettus, R.V., Litvin, J., Wali, A., Toscan i, A., Latham, K., Hatton, K., and Reddy, E.P. (1994) Oncogene 9 3077-3086 51. Guo, R., Yu, Z., Guan, J., Ge, Y., Ma, J., Li, S., Wang, S., Xue, S., and Han, D. (2004) Mol. Repro. Devel. 67 264-272 52. Meuwissen, R.L., Offenberg, H.H., Dietrich, A.J., Risewijk, A., van Iersel, M., and Heyting, C. (1992) EMBO J. 11 5091-5100 53. Rubin, M., Toth, L.E., Patel, M.D., D' Eustachio, P., and Nguyen-Huu, M.C. (1986) Science 233 663-667 54. Sweeney, C., Murphy, M., Kubelka, M., Ravni k, S.E., Hawkins, C.F., Wolgemuth, D.J., and Carrington, M. (1996) Development 122 53-64 55. Folgero, T., Bertheussen, K., Lindal, S., Torberqsen, and T., Oian, P. (1993) Hum. Reprod. 8 1863-1868 56. Spiropoulos, J., Turnbull, D.M ., and Chinnery, P.F. (2002) Mol. Hum. Reprod. 8 719-721

PAGE 82

82 57. Kao, S., Chao, H.T., and Wei, Y.H. (1995) Biol. Reprod. 52 729-736 58. Lestienne, P., Reynier, P., Chretien, M.F., Peni sson-Besnier, I., Malthiery, Y., and Rohmer, V. (1997) Mol. Hum. Reprod. 3 811-814 59. Carra, E., Sanqiorqi, D., Gattucci o, F., and Rinaldi, A.M. (2004) Biochem. Biophys. Res. Commun. 10 333-339 60. Nakada, K., Sato, A., Yoshida, K., Morita T., Tanaka, H., Inoue, S., Yonekawa, H., and Hayashi, J. (2006) Proc. Natl. Acad. Sci. USA. 103 15148-53 61. Charchar, F.J., Svartman, M., El-Mogharbel, N., Venture, M., Kirby, P., Matarazzo, M.R., Ciccodicola, A., Rocchi, M., D'Espos ito, M., and Graves, J.A.M. (2003) Genome Res. 13 281-286 62. Emerson, J.J., Kaessmann, H., Betran, E., and Long, M. (2004) Science 303 537-540 63. Fernandez-Capetillo, O., Mahadevaiah, S.K ., Celeste, A., Romanienko, P.J., CameriniOtero, R.D., Bonner, W.M., Manova, K., Bu rgoyne, P., and Nussenzweig, A. (2003) Dev. Cell 4 497-508 64. Graves, J.A.M. (2006) Cell 124 901-914 65. Khalil, A.M., Boyar, F.Z., and Driscoll, D.J. (2004) Proc. Natl. Acad. Sci. USA. 101 16583-16587 66. Namekawa, S.H., Park, P.J., Zhang, L., Shima, J.E., McCarrey, J.R., Griswold, M.D., and Lee, J.T. (2006) Curr. Biol. 16 660-667 67. Turner, J.M.A., Mahadevaiah, S.K., Ellis, P. J.I., Mitchell, M.J., and Burgoyne, P.S. (2006) Dev. Cell 10 521-529 68. Chen, K., Knorr, C., Moser, G., Gatphayak, K., and Brenig, B. (2004) Mamm. Genome 15 996-1006 69. Erickson, R.P., Kramer, J.M., Ritt enhouse, J., and Salkeld, A. (1980) Proc. Natl. Acad. Sci. USA. 77 6086-6090 70. McCarrey, J.R., Geyer, C.B., and Yoshioka, H. (2005) N.Y. Acad. Sci. 1061 226-242 71. McCarrey, J.R., Berg, W.M., Paragioudakis, S.J., Zhang, P.L., Dilworth, D.D., Arnold, B.L., Rossi, J.J. (1992) Dev. Biol. 154 160-168 72. Ohta, H., Yomogida, K., Tadokoro, Y., Tohda A., Dohmae, K., and Nishimune, Y. (2001) Int. J. Androl. 24 15-23 73. Bradley, J., Baltus, A., Skaletsky, H., Roy ce-Tolland, M., Dewar, K., and Page, D.C. (2004) Nat. Genet 36 872-876

PAGE 83

83 74. Bailey, J., Evans, J.P., Hardy, M., Herr, J.C., Loveland, K., Matsumoto, A., Trasler, J., Turek, P.J., Vasquez-Levin, M., and Wang, C. Synopsis: 2005 annual meeting of the American Society of Andrology. 26 678-688 75. Toder, R., and Graves, J.A.M. (1998) Mamm. Gen. 9 373-376 76. Nakada, K., Sato, A., Yoshido, K., Morita T., Tanaka, H., Inoue, S., Yonekawa, H., Hayashi, J. (2006) Proc. Natl. Acad. Sci. USA. 103(41) 15148-15153 77. Henshaw, S.K. (1998) Unintended pregnancy in the US. Fam. Plan. Perspect 30 24 78. Piccinino, L.J., and Mosher, W.D. (1998) Tre nds in contraceptive use in the United States: 1982. Fam. Plan. Perspect 30 4 79. Amory, J.K., Page, S.T., and Bremner, W.J. (2006) Drug insight: recen t advances in male hormonal contraception. Nat. Clin. Practice 2 32-41 80. Heinemann, K., Saad, F., Wiesemes, M., Wh ite, S., and Heinemann, L. (2005) Attitudes toward male fertility control: results of a multinational survey on four continents. Hum. Reprod. 20 549 81. Martin, C.W., Anderson, R.A., Cheng, L., Ho, P.C., van der Spuy, Z., Smith, K.B., Glasier, A.F., Everington, D., and Baird, D.T. (2000) Human Reprod. 15 637 82. Glasier, A.F., Anakwe, R., Everington, D., Martin, C.W., van der Spuy, Z., Cheng, L., Ho, P.C., and Anderson, R.A. (2000) Human Reprod 15 646

PAGE 84

BIOGRAPHICAL SKETCH Jeffrey V. Brower was born in Hicksville, Ne w York, where he lived for eight years. He and his family then moved to Saint Augustine, Fl orida, where he attended fourth grade. After staying briefly in Florida, he and his family returned to Long Island, New York, where he would finish his secondary education. Following graduation from high school he then returned with his family to Florida. Jeffrey received his BS in microbiology and cell sc ience with a minor in chemistry from the University of Florida in 2004. Jeffrey decided to stay at the University of Florida for graduate school, and in 2008, he r eceived his Ph.D in the molecular cell biology concentration of medical sciences in the laborato ry of Naohiro Terada, M.D., Ph.D. His work focused on determining the function of a newly discovered member of the adenine nucleotide translocase family of genes, Ant4. This work led him to the identification of an essential function for Ant4, which he found to by germ cell specific, in the process of spermatogenesis. Jeffrey has been accepted to medical school at the Univers ity of Florida and will begin in August of 2008. He hopes to continue his research endeavors focusing more on the clinical aspects of medicine while integrating his knowledge of the basic sciences.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101114_AAAAGR INGEST_TIME 2010-11-14T18:43:19Z PACKAGE UFE0022493_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 3497 DFID F20101114_AACIOM ORIGIN DEPOSITOR PATH brower_j_Page_65thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
c166c63295ec6baf97452a1e71784da4
SHA-1
a7986af27d925e3076170efcb258c8a917ffe975
2113 F20101114_AACIJO brower_j_Page_23.txt
00c356fbc1a19d2d1cface758e9f2ad3
c5ec1abe8c66df63d152a02a8966760eac48f5d2
452331 F20101114_AACIER brower_j_Page_71.jp2
8db45b7191ebee96a13ef7e772612710
6b8375fedea44ef1f0128bd1fbd4af04a48ebf05
25271604 F20101114_AACHXU brower_j_Page_47.tif
d156f2fe39462cc9f04b3cd6afe65d64
b9bb56b1be55cd201dd32d7953702911efd92c16
6681 F20101114_AACHSW brower_j_Page_15thm.jpg
47aed235414b09451597c1c7c6848252
5976623d23ba5e595347ad05b30a654e9684a1ac
12659 F20101114_AACION brower_j_Page_65.QC.jpg
e4a28fc52923b201fe564064889a46e3
e664338f4742e94e5e1ced61790761afe2cbab7b
1993 F20101114_AACIJP brower_j_Page_24.txt
105d75b83599625cb5e2fbabe88f7ee4
ffecbbc287e2a1082aa8cf7604667eba1e922119
117800 F20101114_AACIES brower_j_Page_72.jp2
284da28f48e4ce15649b9323c57de905
9088081c1f6d265c0353cd98992ad9b1cea82566
1053954 F20101114_AACHXV brower_j_Page_09.tif
fef558f26bd3aea2928cf751341d1489
e2073e557ba77d20c7fb7247e06e7ea737ca6158
7094 F20101114_AACHSX brower_j_Page_81thm.jpg
bf6ceff6b9ba425d06835b939cfc9318
fb032870613aebfb13e91fe66559ad0f664e3cb7
37632 F20101114_AACIOO brower_j_Page_66.QC.jpg
bd3fff5077a8bfb14e06325a27af51fb
93064330257e62114c8710a1f2c042cb5e840a70
2265 F20101114_AACIJQ brower_j_Page_25.txt
9aa890043a62c8ae7e16dfc1d9e7a8c0
2adb558fcecd9dad96cfa522e6dc6b732e062cd6
2263 F20101114_AACHXW brower_j_Page_81.txt
7899aff4fdc360ef0db075f7b8526586
882ee0d82303c66ee0a0edcfa8b5d267de25cd20
15358 F20101114_AACHSY brower_j_Page_71.pro
7e43e73478ec1bf0bc878dd83932cf06
cc3e813482a712e0dba177e71992d046240eff6c
119645 F20101114_AACIET brower_j_Page_76.jp2
a87edaadb22c8825c2d35580ff9939c6
a18fd53a537e119e5e78a37e38434896090eee64
F20101114_AACIJR brower_j_Page_26.txt
80c57ff4bb414ba5f13405aea53b8ed3
88847b874a1a8debaa2ad6deead85a704e904be7
30333 F20101114_AACHXX brower_j_Page_15.QC.jpg
3bba0dad62f8bc841c687299036f6f4c
b689516df88212e6f651c6a1cd8f4ab606a0aee6
59235 F20101114_AACHSZ brower_j_Page_60.jpg
f63993b533583b8bde81eff5fd7bbc72
c9934fda67256719633089a327c2778faa677afb
118778 F20101114_AACIEU brower_j_Page_77.jp2
3a8410d64f264fd402c3c746e2c6363c
a0b4c5f3161264c6718739c7473874fb9f42ec95
10110 F20101114_AACIOP brower_j_Page_67.QC.jpg
bc1b0cafa1ca65804e0d1b7d04b28f85
d37ace59b98ccd2ebc3340b9d642c9d9ae499d21
2084 F20101114_AACIJS brower_j_Page_27.txt
16898675b6c50ff958e6a54f5f733351
81f2eb45cdc7a66fe4426a0867f8a9eb2df7435d
91166 F20101114_AACHXY brower_j_Page_39.jpg
02a65d190d071ace06a619e74331cfc2
c401438d118e2a8500887b8f775f5fe8984966cf
108629 F20101114_AACIEV brower_j_Page_80.jp2
3f38f79111cbed7a881e659042caf92f
830350fdf7f54c74fdde0d529b639ddd943bea2b
5252 F20101114_AACIOQ brower_j_Page_69thm.jpg
90c3010b47ea253f65bea38c89769877
29f42fb882cb88f4e40d9676f61243921e99cd5e
1793 F20101114_AACIJT brower_j_Page_28.txt
3f63882e4281ea1926e3af0a2007c4b7
2c8da97d9e8f0fcc1e64ac34c93bcd9121e4f2e0
118459 F20101114_AACIEW brower_j_Page_81.jp2
065e0ae3fd6e81bc57d1a653ea5c023f
c4f8640af64cfccc758481409c285ade348985f0
F20101114_AACHVA brower_j_Page_62.tif
64f3ea1d1703df7f0a5390daea5fd7b1
feecc09d9d3025ea181a6c26925db23caaa10015
17686 F20101114_AACIOR brower_j_Page_69.QC.jpg
cea7a1775128dcff10c4497e0a9cda3f
8c458871a57896156aec7a0a51c0fadfe76fa1e6
2171 F20101114_AACIJU brower_j_Page_30.txt
3cdb3694a6d727cc143e4cb2b657f644
158e0cc6885c996946b0f27ca5d5b2796d229678
9825 F20101114_AACHXZ brower_j_Page_56.QC.jpg
b5d782b8f39044f1157baddcbc3f616a
38938f844df06608119f3793a2c7f0c103589902
114544 F20101114_AACIEX brower_j_Page_82.jp2
0bbfef665ba9c5258bf17dc2e8d42227
c6f397954b7c9725ce54af0a0c66b956a38fc15f
962 F20101114_AACHVB brower_j_Page_51.txt
f32cb5530c25b22677ba7c664a00a409
7cc1c32ed5bd4097ffc0295957fe00a05481da43
17599 F20101114_AACIOS brower_j_Page_71.QC.jpg
e4633f98c69e3efbbc4d06cdeaa19ec2
bbfc517b7de38526ac00dc573793a8b091c6227a
2080 F20101114_AACIJV brower_j_Page_31.txt
002b78e386ba7b16ddbee1aaa999c414
0629fda92e0c00c4c82cdead7c878f7adaa063ed
16974 F20101114_AACICA brower_j_Page_43.jpg
a56c1a5c6ea31c4b95ab6262d759a9fe
1acdad124d8a0e57513366f6e1c1aaa3b4492d77
75072 F20101114_AACIEY brower_j_Page_83.jp2
eb4804a218f47b77d3e11461b2c23862
aacea3247484e45d849afc1cb2f1c3b898c94814
F20101114_AACHVC brower_j_Page_04.tif
3132b80b36d8a2be188d3933d5f2db85
deb285a0542766491c7c55a89d7774ed132e7860
6597 F20101114_AACIOT brower_j_Page_72thm.jpg
98b207674e0373bef7a580ddda865035
96a69642fbc011539424b3ae3b8ed247ceba704b
1133 F20101114_AACIJW brower_j_Page_32.txt
d6598054bee6fe7b86867be9bb711d79
304791ed5248ea9adc3f009213aaaa00923e73b5
52628 F20101114_AACICB brower_j_Page_45.jpg
b1e577f3137fa9f01e3a547cea1f8233
8dc65ec5693ac087e7fda83208a030f4bd242eb4
75463 F20101114_AACIEZ brower_j_Page_84.jp2
2787f75217955c6be50aa769afcf9e5b
6da2e47d287f871a1e8d66e34ac3cd95236810ae
86685 F20101114_AACHVD brower_j_Page_80.jpg
f071ad87bf84f9a62ff172dded6bc83e
93ad8f3e468203b46b358118e74c663d64855f3e
28087 F20101114_AACIOU brower_j_Page_72.QC.jpg
5ec76430eb8863fcfe04e0e7baa065f5
1d40ca0799e6e6550cea9b2fb6946727f69be256
2033 F20101114_AACIJX brower_j_Page_35.txt
bf0c86306fc8f29397ce4cc47ff403cc
61560959d89dc39de7a01dda27b3ed2830cea038
41710 F20101114_AACICC brower_j_Page_47.jpg
f6ec84e3c2aaf0c802ff4cdaf6fcbca7
3e4b60be6654d2384217190760f5c85262ac9a43
122100 F20101114_AACHVE brower_j_Page_25.jp2
22f6346d14a3e7e70c2c014ae979165f
f49abccf29abe395d1b17ac9c61d62b09a5fbd72
28256 F20101114_AACIOV brower_j_Page_73.QC.jpg
994805ebd674f0952e211474badebf96
339415138808c627da360f8d33785985e431701d
2181 F20101114_AACIJY brower_j_Page_37.txt
3ad7f140b69f1f8819df6e6331833592
2bf2585858eda3511eb162bba3f1e8f943f5e47a
2703 F20101114_AACIHA brower_j_Page_03.pro
0546c00aecfdbeb72e12fd0d6d48a1e8
981eacb912ea519f0969fa34039e0ad0423a3b68
55117 F20101114_AACHVF brower_j_Page_77.pro
4804105aa39d5efcf4d94754fd76b549
2be8ef5b14dc2f872f03e2da09af4a20df482a27
6499 F20101114_AACIOW brower_j_Page_74thm.jpg
08ac684e21ccdf0b01d5547d2fa38758
6ebc1f3e1ec297791769d7d7fb203d52fb59a429
2125 F20101114_AACIJZ brower_j_Page_39.txt
9098efd3af534623e6580c70adaf7418
69bb35da6184ec696a3b1ce9d2eb69301fbcf853
103241 F20101114_AACIHB brower_j_Page_05.pro
32dcd4fd89ac381c1480d9062d7df9a5
d79276aa4988d26a2609a3710317276f9ad9cec4
41024 F20101114_AACICD brower_j_Page_49.jpg
3945fb9026c0d14fc1f480bdd26a6980
50ee3cc51786575fe0f502c9e28787f98af6b01b
91286 F20101114_AACHVG brower_j_Page_76.jpg
4fc000cde20c844e9f8ee93261d18277
b74eb92cd34269b48ea20717e1b8ec5cc4681ff2
27745 F20101114_AACIOX brower_j_Page_74.QC.jpg
d73ddb20b03ec7b31116e3c2fb5326e9
c94996c7f16a86c0c55cdf04fc445fd50d79d589
42814 F20101114_AACIHC brower_j_Page_06.pro
d8262d420d6023aa1fe8d2574f7bc41f
77cf685705aeb854b1e2487c64eec4ad65eb0f44
62494 F20101114_AACICE brower_j_Page_50.jpg
cdd8547850e391471cdafd81a1854430
00dea52208d40244dc86d34fe4fa4883ddfc5bf6
F20101114_AACHVH brower_j_Page_63.tif
7e77439e6f003fbb944dc8c1cd504095
75ccc288f98bcb75b880147de8a053c8bfc4a596
6906 F20101114_AACIOY brower_j_Page_75thm.jpg
acc0baf3da56e1830fff16467d366b02
b5b64c6693d108590065fcfa4c2412f65f96996b
1069 F20101114_AACIMA brower_j_Page_02.QC.jpg
0c98525750200d3ad4fc8dfc065d3445
fe3d9967cabb4c0f77d3c6c10a6bed5ace951711
21426 F20101114_AACIHD brower_j_Page_08.pro
f1b5e97b8846495fd093906392aeec4a
2937a947366031380410d9eeff03ca448dc14862
23473 F20101114_AACICF brower_j_Page_52.jpg
fbb68866d04e711e00b68d83762aa9b5
aff605ea2b4ab039ca4143a5da61cdf4db4082bf
613 F20101114_AACHVI brower_j_Page_69.txt
09ffe39790ebc2f128ec6ee4f86c9ec7
397e1ddcfb883c1d6c99ec1f5b8b0126ffa5acaa
6843 F20101114_AACIOZ brower_j_Page_76thm.jpg
1456f3c9ea93ef25857af10ef9b7c5eb
6e7ce46e428c72187c8cf476b5be51e25aa05379
714 F20101114_AACIMB brower_j_Page_03thm.jpg
5f8f94430253fe853d729c5b3f7c7fd4
330c3145e79f1bac9a3820b8402b33bfdf90f742
47034 F20101114_AACIHE brower_j_Page_09.pro
3e06180f22e55bbe51ad08dfc39a9a2a
9a30cd08cce7af4cccac8366d582bb27291bfbae
84357 F20101114_AACICG brower_j_Page_53.jpg
e78ed0686f23344ec0bfc5501ae2dd09
d32c5b7b8fd5d2e2c5fb2c050594a2b6f254d2d3
8676 F20101114_AACHVJ brower_j_Page_63.QC.jpg
b2ece205e7bbb9dbc1218af1492e0a5f
ef5f0061236304645efcf11d4aeea1fda84f637a
2276 F20101114_AACIMC brower_j_Page_03.QC.jpg
2428c234874d769426bbe56347f70d4e
d358faf261ca7bf62259160fcbc97fdd2a1d996d
47958 F20101114_AACIHF brower_j_Page_11.pro
63c83666dadbab23af70b790ba22b8d2
113e4af0d2bf4c196de233caeedcb2a8127e6ef9
24114 F20101114_AACICH brower_j_Page_54.jpg
0043a2bb79a5db61b31ca2aaf928a054
b415e83ab02677fa816ea125f5423c556b8cf588
F20101114_AACHVK brower_j_Page_76.tif
4cccf3ce50c6328a58dfd735d00dd2c7
e3e6448296bb0e79b4905b4ba2ed0b018248044f
6131 F20101114_AACIMD brower_j_Page_04thm.jpg
49052cb8d85db44605650e6ccaa9e9a5
e9146fa72161147523d6227e3b80e40523883847
49374 F20101114_AACIHG brower_j_Page_13.pro
299669cad467d8b8ac2869b9b62b9784
2f7bc149ed523f7acd57c9e8ba1bb25b680ccbd3
58880 F20101114_AACICI brower_j_Page_55.jpg
6d50500ec62bc685ebefaa31585a095e
e77c54b0566e4d528f383ad61b351a5839f39186
490872 F20101114_AACHVL brower_j_Page_49.jp2
551ce986d13b57451448e9a00465aa39
39f671be9bddda90b085ce438c2bda44c6f45214
25834 F20101114_AACIME brower_j_Page_04.QC.jpg
efe0280af45abaf82de691ae02b2a6f5
03a321cd0a7b0f73e8543a8a5b7ee3db7aac9dfd
56422 F20101114_AACIHH brower_j_Page_15.pro
a81af025998675b8946148ae03d82920
bf4ead03c0b52d2a8eb658d4a178ada7576a695a
26881 F20101114_AACICJ brower_j_Page_56.jpg
933f86513ab01adeb1fc2c6cf4864d95
2681401c8df414b692a36dc9bf80dc6e9e9df5f8
53218 F20101114_AACHVM brower_j_Page_74.pro
4d5ea6e511f167e5f256767c286f574c
a46ff0956f7aef94758a3e7fc4fe2d4a10cbfb0d
4613 F20101114_AACIMF brower_j_Page_05thm.jpg
1bf33b05a7769aad49e20f5da90f23c6
5f20477164f88103b906a4e9a0cd1e8c2026c423
29792 F20101114_AACICK brower_j_Page_57.jpg
ddc705457a1b4cef1b7bed89e39cea06
5d2affc6e0dfacdeec2f605f96bff12dea3990ee
54687 F20101114_AACHVN brower_j_Page_37.pro
8b242a37e64785942975484a69275b6b
1b73af694c1ec6f7849af1dfb949fd41a1ee27bf
5497 F20101114_AACIMG brower_j_Page_07thm.jpg
300337425ed6f84854fb4aa0637f50a8
1ada7932db1ac3a466196067b542208424a324d0
51029 F20101114_AACIHI brower_j_Page_16.pro
df323d54e81fe86e9b2e2e88ff506e49
38c1d63a40e9ee81740d9ee175270bb5243a8576
22926 F20101114_AACICL brower_j_Page_62.jpg
ac7872fb9e1d61506850dfa6e73b8b32
92f31a404edc9572a4aa26fb95d310f7cd3757c5
18488 F20101114_AACHVO brower_j_Page_60.QC.jpg
6ba79760058313c86855a20b59200a67
478e2eacc792efde325d70b1e82d574a6193da54
22072 F20101114_AACIMH brower_j_Page_07.QC.jpg
a41a7c265b946f6068635aeec765032b
7eaf6c63492a402614586d015159516b7b16e404
52751 F20101114_AACIHJ brower_j_Page_17.pro
83d17d011a958bc9aabe2676ae7f86e6
331da71afa8b58eeb0d3633380d3ce95b6dc3c75
22303 F20101114_AACICM brower_j_Page_63.jpg
82b3262d9e1ef4fe92b908a9b952b86e
afc5eb863e0a4e8ef8cdb9a69d8003c610895ecd
21327 F20101114_AACHVP brower_j_Page_10.jpg
43181d8e8a28c997160c022cd8f063fd
8a93bd0098ced49ee364a6859aa7685f9de9b272
2626 F20101114_AACIMI brower_j_Page_08thm.jpg
0141d11ac099f70ea75e517c5db90548
0af2a5037381f8172c2892ea60695b229307db81
55025 F20101114_AACIHK brower_j_Page_20.pro
d0fefe165a19d3f148927babac0d6c77
1ddae0ce7fd46369a2f863ff02f2ecb7a1715c81
51294 F20101114_AACICN brower_j_Page_64.jpg
ab5bedf2abbc14ba33528fc74656d21d
878a0bc49885029f000b2c3344677928e97a724e
15342 F20101114_AACHVQ brower_j_Page_46.pro
1414b66e1f5333dbad1a553bfb4fd3c3
457822789a63b7a2fcda5f6265abb75ee8a59a1f
9607 F20101114_AACIMJ brower_j_Page_08.QC.jpg
9e3fdb1a32312af92e04200f17d5e98a
20244beeec14814c962afc5a770933c380644b8f
41595 F20101114_AACIHL brower_j_Page_21.pro
eb30ef3a3af594ec0c01aa640bae641c
96938ddedf6126c5a7ff6db4a0a131219c4e5563
33411 F20101114_AACICO brower_j_Page_67.jpg
198aec715f9c3918f7dcdd132908b501
e39e44dda809158a371f134f3bfd128ca89ad66e
1051890 F20101114_AACHVR brower_j_Page_58.jp2
9347aead721b7c85088d4ebb4470cc89
faf9e57fb8b3e97c1a4417229e40f1aa392a882e
5928 F20101114_AACIMK brower_j_Page_09thm.jpg
1b02f7ce13fadbcc2b2cd41e78477e32
a08bb9b1614635aaaa5f53642b8b739448c82a69
52128 F20101114_AACIHM brower_j_Page_23.pro
58672917a56a55d75d1006ef1274af1d
c67c913e16ffe9483d1bb79ea3213040d55e63dc
39698 F20101114_AACICP brower_j_Page_68.jpg
c3234dc1934bd92c9b04826d9c5c669a
ef62ce1efb17a26019effa815ce777d51a341c76
28539 F20101114_AACHVS brower_j_Page_36.QC.jpg
9ac4b6f352fed0dd60fef3670505229f
271e2ad57d300f416eb12153b6a19753b99f85f2
24835 F20101114_AACIML brower_j_Page_09.QC.jpg
0dcbe4fd943072443f819b272513ea78
6cb7cc4255944829c2b6f1f30ec368507d439d49
49173 F20101114_AACIHN brower_j_Page_24.pro
638dff615a10169d87df2515e5cc5b39
4e3c8ca1ab964596e3e4d5362554362ba6d2c112
44364 F20101114_AACICQ brower_j_Page_70.jpg
0fc0d88224701d3420701956f52f6754
118eddcd850294149508aa1d7efbd853aa29c2ce
23891 F20101114_AACHVT brower_j_Page_01.jpg
999615de1f761ab4fe36df2daf374d4e
6db0086cf7286f5e1512632b55b6b0c06df598ab
1749 F20101114_AACIMM brower_j_Page_10thm.jpg
71ed66d74de86ec4466304046418668f
ccb8b02100fdd0d84788bebe25d1c86a4eb03dce
50965 F20101114_AACIHO brower_j_Page_27.pro
fbe7adef91e229ea8eccfad88c2ba8a7
fa2b595bb2eb8bbcf4834e5061c88b180d01595b
90961 F20101114_AACICR brower_j_Page_72.jpg
64a074f7313fdde3e9ef7d642fbc4891
dd2662062af159ce1eb548b3d4520291e9db8c8c
7458 F20101114_AACHVU brower_j_Page_61.pro
01fdbc8b239d0719d0637c5b27a084a5
7931ef747603b23020dde99588f763b8ee69d290
89881 F20101114_AACICS brower_j_Page_73.jpg
0d3da238a3cb2830ff2206cf91ddbea3
2db6d36499ba854773aa0029255262ebf1b54f20
F20101114_AACHVV brower_j_Page_33.tif
107d42bb1e6655291edcc55781f7bd86
5048196edcea2eceb0944b33fe1c1abae878b163
44999 F20101114_AACIHP brower_j_Page_28.pro
0bfb82f23e16c45776cd38ab38074609
65650eee2fe839b117ddefbdb401a563ec26b25f
6838 F20101114_AACIMN brower_j_Page_10.QC.jpg
0fbcc92ca43843292544ef1b512e0498
7f8c19b31f722424267cee78ffa20ecb7919ff63
93380 F20101114_AACICT brower_j_Page_75.jpg
ce1abff1650e16ac5b15c772c495a97a
00cd9c1eecc051bbea0712659ec38fa9a33da77a
F20101114_AACHVW brower_j_Page_16.tif
22d4b603c5e8b0f3b24bfcd957d8e4f6
663f40deb333d62d59d02ad8bdeee6a6a2287050
46222 F20101114_AACIHQ brower_j_Page_29.pro
e7f23840a20a3ac0430d57c0faf4a652
b2c57f37cf301aab651e3ca8e5d171fc05009de1
25246 F20101114_AACIMO brower_j_Page_11.QC.jpg
aae72066d042ffc89242d817f6b1ebec
98cc57d382d24853e39c5e9510076d2f49b5d2b2
91515 F20101114_AACICU brower_j_Page_77.jpg
9f7705065745504eae8349cb396c7f24
4bdf248d6b7854f1dcc8504f1453316a1a571667
54706 F20101114_AACIHR brower_j_Page_30.pro
9c1a00f7c169362197b01c11f5c59799
c412d5a52d9d57623c6c4418cc51c6171f86b368
28047 F20101114_AACIMP brower_j_Page_12.QC.jpg
39f4ccc5d8250fb71be8a76e6290cbff
2b2fc84d332d64d2ae43f8b782f28c7907ab4af3
87854 F20101114_AACICV brower_j_Page_79.jpg
8014ca616020595c22f4acb250f11584
8b4d0516b2dd2d889ac3a070988a5cead7d2e7ec
13520 F20101114_AACHVX brower_j_Page_51.QC.jpg
cc7e534e0951806e738d8ed9b800ebe5
8ce0450d59910180c056b2cc38869325e6fa1d3a
51812 F20101114_AACIHS brower_j_Page_31.pro
3e3a14f57570c2409616dba172df00e0
03dc27e7e4f7741dfb7632865e1f3b1e1727fdf0
6416 F20101114_AACIMQ brower_j_Page_13thm.jpg
56a574af65887c520cf10d8574459dca
59d1ea2018c4720c60dd01becd4610ebfae55c30
95183 F20101114_AACICW brower_j_Page_81.jpg
d90beaef74ac35b4a91e01e1adf03fd4
c5b8878cf3c437ed64cd1037e66a43a94599d874
103256 F20101114_AACHTA brower_j_Page_11.jp2
43649ee639bb9fddcb4fd4d4edbd6e99
93e8c9ac53ad250130e0e93b004fed7e5214b69e
28792 F20101114_AACHVY brower_j_Page_20.QC.jpg
5d926f6b5d92f37f73e198bde16656a8
135935137bff98c6594728c00723351885e6af3b
49628 F20101114_AACIHT brower_j_Page_33.pro
93bbf74a897192cc14c879e0ede332e3
c83d249512b39c07341a75a3aba54bed7e2851f5
26462 F20101114_AACIMR brower_j_Page_13.QC.jpg
0c6f071b7eebfa3a274eb6c8780d49ba
18044a16b36233565f727d7f3c81b6f4f97c22b7
90479 F20101114_AACICX brower_j_Page_82.jpg
d2b845ff9c3dc231c40c1e2f20d24191
6e8d12eb9d16eb1a90625e72f20d35a358b96526
20732 F20101114_AACHTB brower_j_Page_51.pro
dbf4af71068884ba5b325e38dc0ab2b9
44ae59a42c9209caee1650b3315a7ee0ebf8b012
87905 F20101114_AACHVZ brower_j_Page_16.jpg
1f2c129e7b087689353a74226a66d3e2
3cac7a72cd09b5f5f15195e979292b6bc5bbe3cd
53634 F20101114_AACIHU brower_j_Page_34.pro
9017575f9b50bcf710a5c026f96aaa8b
3fc61ca7c37715f9826cf36bebaf9d899021b9fc
28593 F20101114_AACIMS brower_j_Page_14.QC.jpg
5f7532c040fcc82503cf9115f46d561d
708193dceba31c1af304b9786384ba8bc04eb05f
2039 F20101114_AACIAA brower_j_Page_09.txt
0ab4961bd3a04596673e763ac912603b
af5bc7c9aedf9952c2b2c578d9010815364de85e
62836 F20101114_AACICY brower_j_Page_83.jpg
2f92013d340d85d36225b42f7339c1f7
b1330fcbdebde067e18d8f2da2d7f31e083278e6
47301 F20101114_AACHTC brower_j_Page_71.jpg
0bed5785dedaecc17dd99ee285ced8f0
34aa61441d21374bec33dfb2a4099a393712ef85
55001 F20101114_AACIHV brower_j_Page_36.pro
de5be41a8d50c22ba0d23132667d324c
717843ed464f18113350c4653808b516abaeb51d
6421 F20101114_AACIMT brower_j_Page_16thm.jpg
7d1be26d8bc3a729d96fa6f25f410982
37d1ca2c56c45d88275c246d0ab14d807f95c9b1
5490 F20101114_AACICZ brower_j_Page_02.jp2
6b620b96704d4ba6d7fc53ca3abf33a6
bc599c4f89533c148513d479a1bf179827b16f74
18736 F20101114_AACHTD brower_j_Page_32.QC.jpg
78d9349e7924ec11e6d5c07c5b70c804
8b96048309f3dcef1e8268972d8d93c3eab99600
54191 F20101114_AACIHW brower_j_Page_39.pro
1fc8802bae3a634b6bf878c21d6ab66a
8e85453b50caa4453012b60a16489758608865bc
1415 F20101114_AACHYA brower_j_Page_83.txt
d2e2be7ad1b33a9e031e939856cf728b
d3beecca14249ff567a0c7fc2bfc03dc1cd2cf0f
5199 F20101114_AACIMU brower_j_Page_21thm.jpg
9a9745ece2f0dde18190d96a4d858f03
1174ce79cd08ddee8e599ce58104bdd06a1789d8
F20101114_AACIAB brower_j_Page_59.tif
121d018851f2613552a91867db39ca66
8c92382c7fbd8d22daaef1514aeb41192de765ca
60068 F20101114_AACHTE brower_j_Page_42.pro
1f14a2a53141648ce6598b6361066133
f97cc257503d3d7f9518fc4954356e5bac1742be
53371 F20101114_AACIHX brower_j_Page_40.pro
58dfc8c7198fab5eb79b55d3def33fbc
a65c76a4ea15eedcffa7c620e1279e446a178489
1051985 F20101114_AACHYB brower_j_Page_05.jp2
b26587acfef60dd880a56944dc579fc2
0387ab49d08b6e034e4246963c0dc1bac5c80dc7
21692 F20101114_AACIMV brower_j_Page_21.QC.jpg
c10745f7f4f0afeae4300aa39ae352b3
7e1161aeb71f688c3b4108f86973b71ea7bab903
F20101114_AACHTF brower_j_Page_15.tif
4f8d6ac80d5e6d9a1d2cedad947e1586
0d8c7205bf0afba107396ce2cb3fe3902bc4ccc3
F20101114_AACIFA brower_j_Page_06.tif
0ea75bfd87f92c0a2cc8bf294d8eecaf
f3e8fc6746eb02c0e59794e2bbc7197e2c383ee2
55144 F20101114_AACIHY brower_j_Page_41.pro
59eb12f2f4506ecaa61a0ad30a085fa5
ba85fd0ad1ae8fd0af59afc2b0b29fb46a2a6f48
123536 F20101114_AACHYC brower_j_Page_18.jp2
6105b8838f2edb3221661735603c69a3
47dd69462bef8c2bd619b4fe745dbb3dab717b50
41165 F20101114_AACIAC brower_j_Page_65.jpg
9b396d712bc9f89b721d7d3fc214aca9
d24c07d580405888cd465d80af62364e0e26f9f1
6383 F20101114_AACIMW brower_j_Page_22thm.jpg
d319535fa5b5a8ec5fa1d5e0c34db4c5
902ac7a21c326c4604611fb9827bcbb9251b9b1a
19951 F20101114_AACIHZ brower_j_Page_44.pro
78ef3a31f90282435df655cde72b310f
991056657f64761f92b937c09e208dc655a5e252
19273 F20101114_AACHTG brower_j_Page_46.QC.jpg
d0ef5d2b292fc7ccd2c29a9c0014752b
1fad6ad834a89c01e3d3af532f289846517410aa
F20101114_AACIFB brower_j_Page_07.tif
80fe3f0318868d8e965d4d7d5dea1041
39c8e96bfc02c47b767d2604f18d93c4b2be42b8
110909 F20101114_AACHYD brower_j_Page_26.jp2
11921ebba8d6d8d33938484a4e8910ff
929f2f4a0ac6b2aca420fb62233d1be02c92c59e
2207 F20101114_AACIAD brower_j_Page_38.txt
97283087935db67317c96a569a794094
6b17aa9bca64ece03c3870986d50243e74aa763a
6454 F20101114_AACIMX brower_j_Page_23thm.jpg
45d21da5df179e4839a33397eb55a942
15e9ec057983eb55ed34b17653c84b8e19507766
F20101114_AACHTH brower_j_Page_01.tif
a8887de53f229fc62687da034dd16066
0245552c548981efe37c7da84605d6ec7fd03507
F20101114_AACIFC brower_j_Page_11.tif
50aabc5a0e4d66e82b98d1d715b0a1c0
194e2e0a737d54ad656a85ffe49ba4367632d0ca
4335 F20101114_AACHYE brower_j_Page_68thm.jpg
e7610231e969cecf28712f362eba20c0
1a64624548316ad4afc088bfb184f9935432315e
1957 F20101114_AACIAE brower_j_Page_04.txt
dff773c04756a2aadb46a517128bf981
5107a561f816c4c4329ad2f801d8250f3c3e1e4a
28875 F20101114_AACIMY brower_j_Page_23.QC.jpg
6303094a6ddf7aacdcdd9740a9128c3e
1d8b1e35fd2dd3e436663749756087c16673cbf7
2343 F20101114_AACIKA brower_j_Page_42.txt
cbb7259f48399e7c0cc9daa035385c07
46879d8c9a7adb11d82a157fcbf6f46d387ba72c
89491 F20101114_AACHTI brower_j_Page_28.jpg
dae98ce73379ade094b358c431091be9
d4cae05beb9203019fd8e854190fb2cb8a2d2b47
F20101114_AACIFD brower_j_Page_12.tif
5368b30c9f9e2dd7b91aa6680a8d99ed
10b8f09b987152c36d1780a7b87354e95a61a722
84306 F20101114_AACHYF brower_j_Page_78.jp2
6ba27514f71d3630ffaef615ed1a74ed
0a7a68e0c3093ce63b34d32c41a1d928c2992212
95 F20101114_AACIAF brower_j_Page_02.txt
c06a6286648f906b6429b960143e8ae2
dcf9ec75556db5f0de6f3b27280646f7c29d965b
6520 F20101114_AACIMZ brower_j_Page_24thm.jpg
6d2c20cdc76d0b6f7016b24ff26cac20
a356be4a41529c0925a84a5150ce4e731c1d8fde
344 F20101114_AACIKB brower_j_Page_43.txt
20e82e7f6df0cc8374dfe290c67dfc06
dd095d3c7335b582bcf91dfbea4e15a4c8bd9ef9
1653 F20101114_AACHTJ brower_j_Page_21.txt
5fe2ee6fca95eb9ee1451b8d01371dd4
effba266f3717b78d86b3c624b345b9a28b357ed
F20101114_AACIFE brower_j_Page_13.tif
f196a94f8c5e5cf4e6f014230ff57a46
3e1514b7e880e735a165ba6f3c18e87a85dffc32
28330 F20101114_AACHYG brower_j_Page_34.QC.jpg
8efa05c62f04fc7b4cc03d39a561fdf9
bf5bf8e70dc9999c22ddb21de10c53f1b67dac24
55442 F20101114_AACIAG brower_j_Page_38.pro
a12afeade5f76490869387ff2992140e
886304f25143c6a7dca60bf840b6eff35a810e27
853 F20101114_AACIKC brower_j_Page_44.txt
154bdcd9a1a017c80fe485a9eeb39d38
1f417fde81782f92ecc1ce84835306ec10bca2c5
F20101114_AACHTK brower_j_Page_71.tif
0ba936727da1ed202b5b577128cf500e
62e8f6fe42657f70e7bce8a8696330f2ec51b3c3
F20101114_AACIFF brower_j_Page_14.tif
c892a6de5739f8f2f1a0efc5dd6894bf
1bc64989dcc463ce11747843b4433de0cbdb7d47
18897 F20101114_AACHYH brower_j_Page_05.QC.jpg
c2ebf8109e1aa12bdbb31f9e4ecb321f
c339e673e85470f69502da4c7256eafb087bd524
28532 F20101114_AACIAH brower_j_Page_30.QC.jpg
932348158fe2fc1708082d72a5a4da06
e9bc2b4b3f751bfd93d19c2be41ea4db6956d14a
28380 F20101114_AACIPA brower_j_Page_76.QC.jpg
ee73715b75503d195e012217da2f6526
6dad8c90acb4c9bc7f26f7c901e9b43dfc22edfa
536 F20101114_AACIKD brower_j_Page_45.txt
9d836e50f2ce9089811c36fee25dae49
0cbd44c03ea0c65f42bbae288b1e912fcdd612c0
470 F20101114_AACHTL brower_j_Page_02thm.jpg
f4c1db6329007e791e2203f157178fff
8f1d6bb3cbd542e502e23fccc8abcfad04b13487
2835 F20101114_AACHYI brower_j_Page_52thm.jpg
8830fb314dc7a8904dcb62a5dada4330
910d0d1df5903bae49af19fb2d989e00e3838698
54449 F20101114_AACIAI brower_j_Page_14.pro
313b6e9f581af29f34639b41d193975c
952b1f12a89996a2b076a6ab3252d851ac413437
6563 F20101114_AACIPB brower_j_Page_77thm.jpg
3b50a544a9a26ded17ba2f8db5e30237
f14ad4318081caa71601ce2a3534561a9644d0c4
722 F20101114_AACIKE brower_j_Page_46.txt
2b4a5363268c55ebfa55b2053dcb99d4
e8bf49840483a6a2c24145016a252651950392cd
F20101114_AACHTM brower_j_Page_39.tif
0b79b9478bc0ca79e73c8dfac6061296
8bf16b417b18a79e1fdb58ce6f95f471e8774e0e
F20101114_AACIFG brower_j_Page_17.tif
d89238c2dc3bdd13db86b006dbdce305
0b89b1e04fb8da626e13d358b1e2c793a418fcd4
55601 F20101114_AACHYJ brower_j_Page_76.pro
d945cf17f72308b090d83fc78833737e
a5496f4b396c4637d9cadabbe91228e4f317d5ae
2188 F20101114_AACIAJ brower_j_Page_20.txt
89dd09c6c09d029b6728a7bbe9fa5019
8e1fa9dc01ef9dac0841818f9ed404e6b054eade
4826 F20101114_AACIPC brower_j_Page_78thm.jpg
2421dc4d5c40861fae30201d8d62e911
fda44063bb2a6f2a460371d6ff24a17e072c9f8e
696 F20101114_AACIKF brower_j_Page_47.txt
a3dbd37e65a1fa0699c17056c166ccbc
7e369b0b4464d29aa73f23f04b80c9d8aabaf605
F20101114_AACHTN brower_j_Page_58.tif
75fb33621725edc742e31edfc8f7ac39
fb2138df6d3856bb87ed9b55dd47f7efe5b28ed4
F20101114_AACIFH brower_j_Page_19.tif
59b8902993283ff9d45a477a1b6d49a2
99c8d1a0bd56a9fb53cd8b8fa297d4152693b92e
131750 F20101114_AACHYK brower_j_Page_66.jpg
7421dab9aecf06fd8e79ba273cb5f2dd
2cd23417767f0652191107cbbd0d627368002032
4193 F20101114_AACIAK brower_j_Page_44thm.jpg
f9547d478253abb5de85983347a097b9
6656338e9b9ea149e1dee0b353835727b233b3d4
20429 F20101114_AACIPD brower_j_Page_78.QC.jpg
608f46ef6020c4a3ee98fab8e5a2f823
58c6eefeb87674aa9fe68eaa526da9569d5518ad
954 F20101114_AACIKG brower_j_Page_48.txt
1f9158f3df3593253b12fc4d0d32fcac
4775f4c2df7a1255b508d319827b0be9168e60c9
19357 F20101114_AACHTO brower_j_Page_49.pro
d8a4941e5f958a08526bb53a741c9251
5b3c8520ecf9cb09a5c043983773d230f3602f12
F20101114_AACIFI brower_j_Page_20.tif
df27f6f3c8600e28a9765ce76a8ba2bf
c44d26d002088222fbc47a14126cde788c86091c
F20101114_AACHYL brower_j_Page_83.tif
4e03e80d9c349fc7a35807145111ba93
39773b7d19c2956d840391c8713bbd7f4141ecc6
6279 F20101114_AACIAL brower_j_Page_17thm.jpg
87d2c45fe08bfa3ea96b293f25ec7f4e
ba96d27cd0f56fc2531d1d52a059d3fb587b9692
6568 F20101114_AACIPE brower_j_Page_79thm.jpg
ce17b068a69d0f6abbe3eb57b9cb3d3c
606de17b16197c192ffc869c2c5d38fda01b289c
467 F20101114_AACIKH brower_j_Page_52.txt
80423acaa21b2171d6277e5d281f470a
2ef66bd343de5e7f0ad70b78678a142f772f1533
29055 F20101114_AACHTP brower_j_Page_75.QC.jpg
4da5ab745d9a6801eeceb1d742c20fd1
5754d6d1bc7f38406d3a7316d978512e32fcc9e1
F20101114_AACIFJ brower_j_Page_23.tif
a68d7f919253926e7446bbf8b61e059d
54f870175debd5517d95ab0dbb378b5d143ac9ef
49360 F20101114_AACHYM brower_j_Page_44.jpg
d517dfa4fe4d5c4606db19be08949b24
dc539f4705e462de380601703d09e4f99ca52a54
116967 F20101114_AACIAM brower_j_Page_74.jp2
91be7ff8b1ff4e3eec9c1ddb8d98f451
9a18b67cbd39868636f1b08fe24cba2f33bd52d4
26755 F20101114_AACIPF brower_j_Page_79.QC.jpg
0116c247e23843e0fd00ec9df3ac1cbc
984077f2c3b3c8f414335684644c32567d037fec
195 F20101114_AACIKI brower_j_Page_54.txt
f35add27f139f14383a41e5b4b8b8ce4
6daede72d8daef0d9de31bb4b0317e2d6802bf6d
2123 F20101114_AACHTQ brower_j_Page_40.txt
e2df7d501e577f7215f917d4249c621c
beeb5a65ec03d59764d15cd10494feef696a2766
F20101114_AACIFK brower_j_Page_24.tif
5dac7ed4e1a7adb774451ba6acd2b207
f91fe377a59ac5bc30960b7e94f2473580951c47
117408 F20101114_AACHYN brower_j_Page_41.jp2
76f41f540236607c9ff38e6ee6fee51d
528a47134c2325fb5871b8279b293dd2d8c42003
1036681 F20101114_AACIAN brower_j_Page_60.jp2
7bf7d9505b45a19e7d11b10ae834955b
19d09e9ca6c0c7fe20b78c477feba94950a49aa8
18619 F20101114_AACIPG brower_j_Page_84.QC.jpg
ba50850ad6aa5eee7df21513170a7bcb
be3698b9365615fbc0c2a9fcf1f12fedb5fa9c60
243 F20101114_AACIKJ brower_j_Page_55.txt
5a2dbf9c3d2c12b0cf08f8eb2bb3162b
4fc56ea3fcdba81ef9aaabb56913bcfc11ef2052
4292 F20101114_AACHTR brower_j_Page_51thm.jpg
262dcd449c27969f1ba3f1b3162c9f56
68845fd5f7edfd68735d65206be5e42dbe2f7993
F20101114_AACIFL brower_j_Page_25.tif
cff95eb8277619b9b284e1e484962eca
f48387ec5e5dbbadde9cb5f329b6a6d3933ae506
2157 F20101114_AACHYO brower_j_Page_34.txt
6a41f7b09805b784a86ceae1e1468d45
11250323b874300e0de085bffc4bdcba3ecab811
8598 F20101114_AACIAO brower_j_Page_43.pro
dd955b0cd7b3c0c3265219e1050180f5
8822962bfb3a8a7bfe788a91691e87bd79398847
98059 F20101114_AACIPH UFE0022493_00001.mets FULL
223f20385d7dc44ce6bf7524904f2a84
2b3f61d168f40838b0f513f17d62a199a21d19ad
628 F20101114_AACIKK brower_j_Page_56.txt
d8d0d3a7b76b64751a6abcbc7a518055
94a29eaf9f05e9f837e63318923fc4a70e982beb
2238 F20101114_AACHTS brower_j_Page_15.txt
2b69477dadbfbf38dab73267c02845b7
edf70128415a131ad0798da5b69a60fd1a809374
F20101114_AACIFM brower_j_Page_26.tif
5befd392e5bc1915f8a22ee2da4003a8
aec66a486e4312be471de23fbe56a0a462b493e8
48643 F20101114_AACHYP brower_j_Page_04.pro
c753d6c07cda12b4a619fe5d10796d3f
cc4b4f8ff2ba2488dfe174198f2c1116f223030e
6716 F20101114_AACIAP brower_j_Page_39thm.jpg
d072062896c24e56019a0757a36253ef
43e3e48b0f627a360e6a819ac7f1ff7dbcc0e927
F20101114_AACHTT brower_j_Page_03.tif
25619c228b97b6667f1b7a5c345826ba
2606fb8a7573fceca207e325b3a7d25b93cd88f3
F20101114_AACIFN brower_j_Page_27.tif
1cf2fd5a9cd8ca7206474998c3d5d428
5e864bbd1b7d07cc4032245af0ec3648f07877d4
22539 F20101114_AACHYQ brower_j_Page_43.jp2
86629b6ffc44372020e9c9c398a2cdb9
3b7d6d217ce214c88159fc88e3bd4f51811f69d0
27461 F20101114_AACIAQ brower_j_Page_26.QC.jpg
3a4eedc344211c7d14884f7e5f4ef3fa
301e4c3a6cce56b315bd0e99a758dcdaecb4c1bf
365 F20101114_AACIKL brower_j_Page_58.txt
f3c84d00944f32939a934e93f39d9062
80eb677708f53cb3be0d2a182a3e194933be935c
11126 F20101114_AACHTU brower_j_Page_57.pro
f4577b0c49de8c3ddebe7bdf20f284c8
173c47a472fd22af682dee600ecd29119fd459c4
F20101114_AACIFO brower_j_Page_29.tif
0b1b9f5ac44164128c11c2ff6b765508
4ab127b47201260652f4534a72455f0d3f634ec9
80311 F20101114_AACHYR brower_j_Page_58.jpg
958afbac6f6f561a45e1c1ba0cdcb7a7
cf286b3971239b3604cf311204a57765ffead0d4
70454 F20101114_AACIAR brower_j_Page_59.jpg
86c120eec1bc5d6b5f05db57fa28ab35
6f884bb5ee4c6cbfb200d50d10037fa731a6de25
625 F20101114_AACIKM brower_j_Page_59.txt
09818e41f40e9b2b1237125e56b3c21f
15dd56516fc7239919f984f3aa02142a33136ae7
F20101114_AACIFP brower_j_Page_34.tif
e4a44477af9633cb0b7adde2a2566cdd
bd31e29a2380586bbd460ec5831bfc8df1582703
12309 F20101114_AACHYS brower_j_Page_70.QC.jpg
973951a02ecc015101c8c67b1f3a4f49
c5635068c067cbaa6d9a46e5e1d67b8d5d707edb
14782 F20101114_AACIAS brower_j_Page_44.QC.jpg
3bf567096de07fec9155f2b1a797fc3d
af0e49148d07ba979df52e122e610f01a9a8875a
441 F20101114_AACIKN brower_j_Page_61.txt
64b58c22217372ee109ab2d96f202830
e5e0f9e83c079e84adbbefa4aae9440a4ad01481
114620 F20101114_AACHTV brower_j_Page_17.jp2
4bdef9c6c68423fe61c467ad5050d6be
4e2d118bd1dfa7742c4dd0117b4d7584511e4d5e
F20101114_AACIFQ brower_j_Page_35.tif
5e4e0d6573f302a19e59a4ca0742f9a3
2c5a6d443da390d93b86199600a6eed4c3c48d1f
49497 F20101114_AACHYT brower_j_Page_26.pro
f0a42cc761b0f08e85cb48f48074e030
fafc12a8a047bcdbb8e9dfd00b6033f4007f7770
37977 F20101114_AACIAT brower_j_Page_78.pro
9ddcd98b185a0a40ac8a6cc5939a654b
bfa4266dcaa4d11fc2387ec7b5dd725bba5ca50d
428 F20101114_AACIKO brower_j_Page_62.txt
64978a7c8c3d0a65bda064c10b625dca
cf31c9d105e6784cdee883dd9cf2d7499186b01f
533 F20101114_AACHTW brower_j_Page_57.txt
d7c42f276ef413903d0fdabdebaf8795
57da86b2fa40667d0fb2a4a89f26539933812ba6
F20101114_AACIFR brower_j_Page_36.tif
2a38fb226195b05b4b3b8835f01e23cb
b28f823b15528f4bbde762175acddcae1c438c5b
F20101114_AACHYU brower_j_Page_50.tif
e85035f53cf1f27cddb9103aac0d8db7
fd441ef999bbab054ce2530fe52b1ee7915ae2ea
381656 F20101114_AACIAU brower_j_Page_68.jp2
230e37d62bbabd6ac45b5a1fd9cd19ac
947552d1c0523800b8c524653641c7cf2c1588c4
317 F20101114_AACIKP brower_j_Page_63.txt
49942aaec17525ff85c4b70cfae58552
c74a0c32914724b45e3595b9818a2445ebe6385c
F20101114_AACIFS brower_j_Page_37.tif
01e7f3ca82416bf6b0e71de8365a24b5
143537c22821cde1705052c9b84d020aee40e595
F20101114_AACHYV brower_j_Page_08.tif
6e07d96dc9faacf4ced1dc1cd9fa758c
4ef746252b3818c87027ed4c73a86aa0408701b3
7033 F20101114_AACIAV brower_j_Page_42thm.jpg
d480f8a1b61788fd88edd0b0b0bb2df4
3df2e68d319c1150b66aa9c678fb5c983380bc77
F20101114_AACHTX brower_j_Page_72.txt
0224e339a4f3a4fc98a520e0ec508784
5763d9a36b5e148f9658dfe7b12e5b60464d93a4
392 F20101114_AACIKQ brower_j_Page_65.txt
17491262fc34fe0a1143d537dc22ac6b
9a163fd9195aa3617c1a9cc0116b2494c5ab27c6
F20101114_AACIFT brower_j_Page_38.tif
9fc203f6fc4b32276d1a3bd0029aa898
d77980a2a4a646b07d6d8d2c732fb32a15774906
18438 F20101114_AACHYW brower_j_Page_55.QC.jpg
a049e995ed394f03ea1458b120ed7ab6
ae0c3a0cf44b822172d4d78ddb7fa10224a637d2
1027 F20101114_AACIAW brower_j_Page_50.txt
759548dd60c8daa91707e1ff5204f2ec
bc1bc9b81dcce90cce6e3e59b5f70b36398c69ee
2152 F20101114_AACHTY brower_j_Page_19.txt
7118542598e01bc0f88373adeb41d69b
1791a888712430462a6c313b4973ae2c0d008186
830 F20101114_AACIKR brower_j_Page_68.txt
a762dc66432bca10073fb7e28319597c
ccd7801ba3674df1d0cf8d9a72ee141b83280936
F20101114_AACIFU brower_j_Page_40.tif
f8ee824eddc57d77060ea1133d2e7891
f917fb935e7f0a5a9a55ec61651c240fb9a1887d
445 F20101114_AACHYX brower_j_Page_10.txt
0ebd07552832938a9ece7127f6643495
e4a38c5ad0adc6ee76887bf077af886aff58504f
126886 F20101114_AACIAX UFE0022493_00001.xml
ccc9d43a32d51e397efd995ba0526847
ae7fb860d74f85ee3f8ee723aef57dcb33bcc244
30197 F20101114_AACHTZ brower_j_Page_25.QC.jpg
0315f680a49b7f99780ef528de0a957e
1d77a259b55201841505e09febc6c5a1de4ea405
463 F20101114_AACIKS brower_j_Page_70.txt
0403a5d60b9a54a19df0149eaf63e543
225ef1c993c0583defa9bfc93c29be523730f06b
F20101114_AACIFV brower_j_Page_41.tif
6eb628eecdeabb8ad74a23609fbc7a3e
fd9566666764edaa7942c4e7de6bf5fecdd2d009
14743 F20101114_AACHYY brower_j_Page_53.pro
6fc65d1b00a079eca939b0b1c0bc9bf1
7e5882363ab4a65f7f91f394f8b67fe69880a6e4
872 F20101114_AACIKT brower_j_Page_71.txt
3481922caad331cb9e0b3aa2310ac111
24838b6e2119860bd6483f769dfaa84722579a83
F20101114_AACIFW brower_j_Page_42.tif
5dcb717b00672e54e1b9bd171e6b763c
da64772d243aa6031a4518eef36399208e352812
6623 F20101114_AACHWA brower_j_Page_14thm.jpg
ba23151b837256f1035b082581208267
65a59103a7d7a147eb6e07c6fd24a1c0dbfbd8cc
123212 F20101114_AACHYZ brower_j_Page_75.jp2
053fc283cb7e202c557e3cdb5098d4ce
cc5e6a232306ad8630257ac6ad3941b39cfee353
2133 F20101114_AACIKU brower_j_Page_73.txt
9cccd18d602b47e9f995f1215df011bb
4726a76cec482c235c45561d893f6aac40f2fb91
F20101114_AACIFX brower_j_Page_43.tif
5534a11d9e215bac999c7a7d7fa6a29f
bebaba2bf4733c10a5a26646d461c425fd298c95
F20101114_AACHWB brower_j_Page_21.tif
92b9299907abb9a7e6a9666fcf96ad11
4307f904e7d5809ccb90ce37098e47a1685bc5bd
2156 F20101114_AACIKV brower_j_Page_77.txt
117b4e808d085bfdcd93b2d8c136b720
79ef2bb75a195d57fbc82f191b06400043d23b87
8423998 F20101114_AACIFY brower_j_Page_44.tif
aec17b26192f9e3d4a006b26a991738b
1395840c4a91a61296988bfc22bf44359136d8b9
1503 F20101114_AACHWC brower_j_Page_78.txt
773e8a3d9f410d9165d95f2027b22914
e871516f99ed63a9982d8931a818470d20239267
10338 F20101114_AACIDA brower_j_Page_03.jp2
10ce3ca62ee6c2584c46eea10cdd9ccf
36e16c1af79fb7d15764e0efceeefde92d677e96
1998 F20101114_AACIKW brower_j_Page_80.txt
cd262e9046dfa3bb6afb60ac0680356c
65619a4f1fccb2d6a87ee889e615bd88e49f82c0
F20101114_AACIFZ brower_j_Page_45.tif
c2996ce69827c999d151c6ddd4bda2f9
8067e8ad50948fa1f85d12754f086f879dc4aad9
F20101114_AACHWD brower_j_Page_46.tif
57318912408d633591608e5a3490c3ee
aa77e37c96220afd413aa6f696008bcae0350deb
105359 F20101114_AACIDB brower_j_Page_04.jp2
ca56e9b577d0e6e09e56b8099fb9b8c5
a19e6dbd33eb22a90e4f07d0b1511ec4dddeec3d
2163 F20101114_AACIKX brower_j_Page_82.txt
44b19d598a3e68ec5db8c371b18578e1
f934e2964a405142b5ea9308db7057be76011b62
84748 F20101114_AACHWE brower_j_Page_33.jpg
5da0c56a1ff828616f659e77e45f27e4
ace0281dba2b35b6c0c41374d5e9b26bc18c4f24
1051983 F20101114_AACIDC brower_j_Page_07.jp2
37579e52beab9ec1a6d11561c8a6b72a
956cd7543b19bf8950e43b96236abef54df82040
1394 F20101114_AACIKY brower_j_Page_84.txt
1b802054fc9180f5ab61f30629238563
5a8f883f135e5520772f59b78964d5156480b5ec
12495 F20101114_AACIIA brower_j_Page_45.pro
a81670bd5725f63bf632c63ac828fa64
50e2ef0a612a1fbb3b91c69abb4fc145162cabdb
26855 F20101114_AACHWF brower_j_Page_01.jp2
265806d9212bb38a2bd8f7bbb9283e96
25e7ccee910548f966e401d86c676da8cc94e45f
797301 F20101114_AACIDD brower_j_Page_08.jp2
8609695646deeea91ae48a7bacfa0c00
f2d395d66d1fda5d9b17abe70f9f6152c012a2f2
3478006 F20101114_AACIKZ brower_j.pdf
78c27eab0424793bd5eae77bc9566a93
1552259872dbb263af558b193a51b5c986a6ccd0
15274 F20101114_AACIIB brower_j_Page_47.pro
f3ac985f8fec570eb488006c000c3263
b4a4a9730ee8231f5870567d54e7183d60c3dbdd
17779 F20101114_AACHWG brower_j_Page_83.QC.jpg
a3269932f242a25779353e148e7541c8
ba58e054e28f18aa5d27295e1b0bc40a1d9b1c55
19368 F20101114_AACIIC brower_j_Page_48.pro
a4219923161e57f7139dd2b106835157
08447cd4187885ce9ee658ea2213ef42a1c26a5b
718 F20101114_AACHWH brower_j_Page_53.txt
9956697002ebba2231f64bb057e40036
7f58a37b39893ba478df78160e74acae2d51b0fe
104350 F20101114_AACIDE brower_j_Page_09.jp2
9f4d9d115026493bae086e533795c54a
9821867b943ec84124ba6a178efbf85662814541
28878 F20101114_AACINA brower_j_Page_24.QC.jpg
e077a9b422dec689ddea50e6d19b9f49
c5dcd3ab5ac04460b241e4a39d72a94e83cd6034
18705 F20101114_AACIID brower_j_Page_50.pro
ee3a0d0ec2139d5e6bc7fbdac83726fe
b5d440683d6c988bd3508acbc0dc453a88166ed9
115108 F20101114_AACHWI brower_j_Page_19.jp2
d1dc9a7ff0cf24d949b57c7ed187938d
ae4141865418d82b0376df935f2838cc19a69286
28413 F20101114_AACIDF brower_j_Page_10.jp2
cb24ba4b585c577afb48e37dd94b5622
e7e801391d93b55b2d2d07c9bb1b90ffd2ecb3be
7130 F20101114_AACINB brower_j_Page_25thm.jpg
ac6abe4694e4238dba4cc92cabf13ed3
79222e68ceea60c7b3de0ad275ad9b053c45f8c6
8174 F20101114_AACIIE brower_j_Page_52.pro
7d5329dbf5ef9037b7cb51ba879bc6ce
12da1751356547af276fda04678a0a5cd7063704
F20101114_AACHWJ brower_j_Page_52.tif
57cfc090009b21a39872a53646168606
8d580e3e34cc501ff36ed452137721dc949a7bc8
110102 F20101114_AACIDG brower_j_Page_13.jp2
cd1339bbabe8a38f2a744b67214d41fd
45773a8783fa51a327a5de0873eb5659379382b1
6509 F20101114_AACINC brower_j_Page_26thm.jpg
73824d91ac8f95e47c0799a4bdd70b62
3044ca57bf4c88a8e11082d5fde48a09aa0c77e4
3446 F20101114_AACIIF brower_j_Page_54.pro
f5fb561e7903a2e45ff8fbbadfc17189
fbfa62edad7c656be1426a51af462ad2a71f476f
1051986 F20101114_AACHWK brower_j_Page_53.jp2
b32ff5255bd23efce754fd4780688133
c62196ceb3feb24de7d60d0df146862f77e63a1f
118975 F20101114_AACIDH brower_j_Page_14.jp2
69f9cf2a18f671665aba484476bdd1ad
fb056e45d5d7a496643efeaf29b6476b92549157
28326 F20101114_AACIND brower_j_Page_27.QC.jpg
5b6e48ee82866156bd7bf294edf674fc
aa5c8b602204b96fb5dd7ef4bd0f047fc3afb460
4876 F20101114_AACIIG brower_j_Page_55.pro
deb7a25d2e2a07ffda0a7a891e3366bb
2b950bdef24a38b04f21f556facc3edf1d982a03
63969 F20101114_AACHWL brower_j_Page_78.jpg
1f8a00115e92102b395630399f97ed4a
7799d3b71eaf92ae6ace6b0066741b330bc6e928
113791 F20101114_AACIDI brower_j_Page_16.jp2
9945cbbe2c12a54b007b3332812b6ef3
dabc3c737a415823cde8ceb459c9a2c1f53c222d
28568 F20101114_AACINE brower_j_Page_28.QC.jpg
5b181c6ed75d498734ab0a89a3509d07
f2863e124331e55e5e1cccae8e9881abd8dc23a3
11720 F20101114_AACIIH brower_j_Page_56.pro
1860a52a9857942e8a35ee9391eb1c9f
7e085c9f57c1e56190f173737205823c1363dcc8
56870 F20101114_AACHWM brower_j_Page_25.pro
588aa73a66e5f0c53d87bcde04b2f5e1
ea22c084ce2784e4c01f3c377e4f105aa5b79e84
118288 F20101114_AACIDJ brower_j_Page_20.jp2
a880574c98c7349cd71bb2318317e5ec
61dcc09a54468c27588f16c1bf43339404c3af5c
25429 F20101114_AACINF brower_j_Page_29.QC.jpg
fba9b41938f4b82340afb7582b7b809b
bbc99e42859160b3d4bee88865a82d7c288c8b06
7012 F20101114_AACIII brower_j_Page_58.pro
727171a1f9542d67789eb3b305c53d37
1559f87c549af041b2f5f855f0bc4d539af6a79d
3009 F20101114_AACHWN brower_j_Page_63thm.jpg
03fec9d22a09871cd8bd56589d11545f
4b71af9768f03ac565c6a83152f38c962107ba92
89847 F20101114_AACIDK brower_j_Page_21.jp2
02316ab200d49a8e014b9c0b1d1a239d
e6cbc49d9167ce79c74fbaaacbd6f28da3a67dc2
6720 F20101114_AACING brower_j_Page_30thm.jpg
032d35347074746c523a0ee882973e8d
68ef21abcdc031492c87edd415caef420b475aa0
F20101114_AACHWO brower_j_Page_30.tif
1d5ffcf8da560c17e2fb4c7df14fab4a
849940f21f44aaa822d6cbec6ffe4957dcd2ce0b
112975 F20101114_AACIDL brower_j_Page_22.jp2
dca96b88447f1f06ee8fd56a43fe30e1
a79c17fb9f5610ab4828c0cffd212b24df9d66ce
6472 F20101114_AACINH brower_j_Page_31thm.jpg
fc199d39abcf4630473009ef87754d9b
f1cf6104edc6c77501a0d187fa3cebb33f703492
13781 F20101114_AACIIJ brower_j_Page_59.pro
e8765ef1ee92cef212e93cbb75738bc7
ead25de3277cf05a4050647095c299197bff31a7
90575 F20101114_AACHWP brower_j_Page_12.jpg
bd28b17d0b8cc9d80fb82f55219455f1
2d527f0fd515810c6170e2a2a469db8fa3dc6ceb
118024 F20101114_AACIDM brower_j_Page_23.jp2
bab74442dd68e7e438ffc434e2b217a9
13845b45a7e832af0c52a8a24acdbe826203c036
6429 F20101114_AACINI brower_j_Page_33thm.jpg
e047601ef1a25caea7d0d9574b7cd88c
8d42f3b1caf9d0bace88db0d21d99f2d7492f9b2
14238 F20101114_AACIIK brower_j_Page_60.pro
47e158aed25570acf0d5b58097e50bac
dd2dbf41a962e7c17543995131a18c45bbddb51b
F20101114_AACHWQ brower_j_Page_75.tif
e7d01b376753e5b8e6c5f818c8037cb7
1a665c2f07cee91df3aeeb29ad6303a11c5441b3
114174 F20101114_AACIDN brower_j_Page_24.jp2
234c2ccd443289fe952540b6f98ef965
dff80d609748843e3029715bcd5b8325d9eb1498
27009 F20101114_AACINJ brower_j_Page_33.QC.jpg
f5e72303699699a708e2025579eb5df4
e39829d1a0b1a163550b7e780cb989dca37d3469
9363 F20101114_AACIIL brower_j_Page_62.pro
fbb5516e426e03d2c111327ff0261c80
32bf08be122bee0ec0ff11ae5c65eca192aab7ab
F20101114_AACHWR brower_j_Page_32.tif
a4f7ebd0c38500f3bf09be41e0ba4425
347144b9679bff85a6426e29b979d3f96720f7a4
114038 F20101114_AACIDO brower_j_Page_27.jp2
bbcf31a88de4beb442999e1fbaec6b93
9eb673809f6781fd29ce2b78daa04338d1d8c6ff
F20101114_AACINK brower_j_Page_34thm.jpg
198c39d772921680d0f00e7881c243f7
7d129da002b3ea90a50054570b11cc732bf461f4
7387 F20101114_AACIIM brower_j_Page_63.pro
90ecd606d023ad1e15af606a1e86bd6d
1e70f463966c985b3d826c044e2db9f94621fb44
5900 F20101114_AACHWS brower_j_Page_61thm.jpg
258af82d9a8eb36a0923e63f8566fe64
e4d2ac2764fa4d8b22cf6059996b3a0630c46320
108829 F20101114_AACIDP brower_j_Page_28.jp2
750c04e139121a9de473e09b4dbac1e6
b640d85b93cb1b32f8a12ecf3a170769201dbc24
6240 F20101114_AACINL brower_j_Page_35thm.jpg
d333f2d7ccb3fc3a6d5bae4d6042b774
d60ab12ac7a416ebece21b0b8c6c1556ad850f39
6529 F20101114_AACIIN brower_j_Page_64.pro
a9bb637311fca386ec34a6f25efc363c
d10c96c5127488471b88747267e6e9b0fb3a584b
7933 F20101114_AACHWT brower_j_Page_52.QC.jpg
38e8d2bdf093301d45a5b69529a78d7c
2dfe1afff9c9675d80ef30640bb790dc782365d2
104479 F20101114_AACIDQ brower_j_Page_29.jp2
4e87ce5f919b7eef5742db9218a9d586
cbdc8d24c887b609e471f88a00be1a03f94457a1
27159 F20101114_AACINM brower_j_Page_35.QC.jpg
89801afd4c9d81eb4d6aff072ede0ca1
7695f38ea7d29e9a5086ada721d6e7d845695fcf
8494 F20101114_AACIIO brower_j_Page_65.pro
3e9c0a92007b4285c75b5d3b31fad1fd
c1979a99df5ac266164cb3129cbf5e37b16aea81
119359 F20101114_AACIDR brower_j_Page_30.jp2
9f8f90e6c720ea7b0ec70e2d11797581
8c507781f9916da1ce0883b806b05bcff8d4d265
94430 F20101114_AACHWU brower_j_Page_15.jpg
6d25324a3496a5b09bde6c5ae05eda50
d79e7c7f6ad3dc2926660f9538970213fb6d6202
6658 F20101114_AACINN brower_j_Page_36thm.jpg
7334d6b77e1d3286e29e693ba138e2d9
ea79dab6eedf8d6d32359f9a2abc8178ef624c9b
12729 F20101114_AACIIP brower_j_Page_69.pro
99f3905314ebae547e23fe0fa2ae0904
30b76bc2829ae48f68f3cb89ee4d8aa2153e7d8f
71045 F20101114_AACIDS brower_j_Page_32.jp2
8b5c4b88b08ddd119f841890814bfcc6
16991c0933e7a109a92f8eed94108cb4d598ef70
F20101114_AACHWV brower_j_Page_75.txt
440da45d0500380112a75af6a4ae7573
d10bef9cf0d3fbd0502f8f81ab3663045e500acc
9353 F20101114_AACIIQ brower_j_Page_70.pro
9ee65925a951d1bda8d811541864934f
afd410035876e35deb38083d12c617e8df585861
109431 F20101114_AACIDT brower_j_Page_33.jp2
98282c68401a808941c03608fe3067e0
b8a442e839e522f3cb75c561ea810693b8ebaf72
958 F20101114_AACHWW brower_j_Page_49.txt
9f154e5d53f475c21cbb1423464bbed8
bcdf68b551397518e863fe288368ff43a0d23562
27561 F20101114_AACINO brower_j_Page_40.QC.jpg
1d01a0ed07984ae38bebe7646d3dc8b6
d8cb92f36d8ed6412d8e7e5e73fdab54093dba7a
54022 F20101114_AACIIR brower_j_Page_72.pro
c00137bc57dfd680666b8d01e0fc53f9
46e24ea219e8444c7bcd610581a994d8986fb1af
113129 F20101114_AACIDU brower_j_Page_35.jp2
4d703728c7acd26df88e5e4cadba7e0a
1e60b74468b125a70595d42b7a773667840badc5
2203 F20101114_AACHWX brower_j_Page_36.txt
ad45101460ec607aa32e46f56dfeef67
d00e8e5cfbb9641a8e171f823ce0fe348315342a
28964 F20101114_AACINP brower_j_Page_41.QC.jpg
e943a9af0ee9e703155a9bb761dfdd81
4598bd924fb0a6a38c83908622d57a9ab56eeb47
54479 F20101114_AACIIS brower_j_Page_73.pro
de45114721a1b1410a06f96ffa22cafc
eb70bb0dbf123d0e195a1f7e7de67297a0d22e14
117366 F20101114_AACIDV brower_j_Page_36.jp2
72126a4260e5a64bc8ae30b9478024aa
0a6227d68da078bc88c4c034a6bd167ac410ed50
31283 F20101114_AACINQ brower_j_Page_42.QC.jpg
fcaf4b765dd0f447e4b972bf1d7efcec
7cc7dfee1359056e5d02aa2410c9ae5ad6b4d108
56334 F20101114_AACIIT brower_j_Page_75.pro
fc4ac298e87a6bea2ef2b2239feaa7f4
e2b5970085aedfd625bbdba0d32b4992f0b0d710
118293 F20101114_AACIDW brower_j_Page_37.jp2
7016f32ce5d8d520f4e7ad7a1ca3340d
4d037b09c035e1e93c43e77d586883ea00820ff2
262531 F20101114_AACHUA brower_j_Page_62.jp2
e69f3540c737c232be899343850aa417
2f2af8aa7fff612b41831368bc9f4d7a3affdcf1
58300 F20101114_AACHWY brower_j_Page_32.jpg
66760bbb93161f48708dbd0c7ebfbc84
fe0d3d55224913dc1edf5eeb06a43b3a4081c967
1535 F20101114_AACINR brower_j_Page_43thm.jpg
aef189c41d85127ba329ab996237ac24
eee57b0d6a5d8a6d02dacee5ceea30a83bc13592
50662 F20101114_AACIIU brower_j_Page_79.pro
49423e6df786429f1fbd5fd22cae0f1c
7607ff3c78d68addba233af15f35210925a33c46
122192 F20101114_AACIDX brower_j_Page_38.jp2
2b6eaed1d001f2343d3a3b07fb35bff3
ead2b606eb0d77ef9959384f388d683ff96c5bb2
120968 F20101114_AACHUB brower_j_Page_15.jp2
cd3e641cee40e664d84a41093312a89a
0a3440f57ee062edbce9b67cb480b1a3c74c4f19
14924 F20101114_AACHWZ brower_j_Page_67.pro
124aa3ffa4bad21002be6930dbdb9dbf
e429f8af47293c8e913b97b4cf631619a6d6c2c5
5510 F20101114_AACINS brower_j_Page_43.QC.jpg
1c9a372625c611433992c08317395ce3
71304901a7e32aa27c0dcb26711c2ecc52270e56
50027 F20101114_AACIIV brower_j_Page_80.pro
cec08360dff91a2e5d8b30d890c32bc7
cb2d75f365630e83af0a302d3f0f344ea1f29011
3685 F20101114_AACIBA brower_j_Page_02.jpg
3797caadc3156e14a36366171f9564d2
2d57676151a61937e82f8a685a35f370714d6c1d
118307 F20101114_AACIDY brower_j_Page_39.jp2
42ea37c310f4b55a45f2126cbf6152df
ac878f183ca79ab511b7c28f3bfc9d3c784a485a
115092 F20101114_AACHUC brower_j_Page_34.jp2
889709cfc0c8c8986f53586d348bd0fa
5e111ac6a4242b5c39a08cd9f501d8d11306b7ea
4428 F20101114_AACINT brower_j_Page_45thm.jpg
ff0d8a5b214546d0e70a340941bef138
e63650b120e2d9e85728c122396f0d2db87a2fff
56362 F20101114_AACIIW brower_j_Page_81.pro
680866f7c2c60b309a9dc5e4d20fc195
06e5b7511cbeea25d5ea67e2be7b7d678fd5c719
3176 F20101114_AACHZA brower_j_Page_67thm.jpg
466ffcf77f2e104b09850d41ced26529
a1abd2807b42bbe41658f50d8301ac8240006144
82542 F20101114_AACIBB brower_j_Page_04.jpg
30490907cf332cf2bc7eb5be7e402f10
c136890217b51a00151a8313ab04dd4bf10b0fe2
116166 F20101114_AACIDZ brower_j_Page_40.jp2
8ced3955f5a9e752537ee0d1aba50ad7
5f672142873e338cbd6aab8e1a90a2472c6e47af
5959 F20101114_AACHUD brower_j_Page_03.jpg
18a501a2bf40c393921d05dd35961537
0e0c2b7c015572e25d0770009b0dca2f3bc04a02
5501 F20101114_AACINU brower_j_Page_46thm.jpg
e0aa07609392627fedac5c3434ffb61b
8ede8daf564888f4b63969b5748409a5f4e7de3e
53760 F20101114_AACIIX brower_j_Page_82.pro
25311bf18fa28af96e490f752bb34df0
4cdf471f6084ac7fa923b20c3a20c5b2557e86a8
F20101114_AACHZB brower_j_Page_05.tif
6e18ea20fa46f294e076a2090a81c073
ac00ecf2e128b6ca3d2b510d5d48721386596422
90285 F20101114_AACHUE brower_j_Page_23.jpg
9424c6ef28de5d1802c9ddf26531dc16
7d4e1d0d6ca4732d6177010fff81b6cc01ef790b
3633 F20101114_AACINV brower_j_Page_47thm.jpg
11fd2b11979bad8d43c515a10eae2308
34431a1444dc2459f99cfdc253f48faa63498435
34861 F20101114_AACIIY brower_j_Page_83.pro
83dd3c9e7d79dbb7423d6ba05099a0fb
38ea615e7fea006dca8ce30019f10ea8540b9563
88641 F20101114_AACHZC brower_j_Page_74.jpg
31bffda38ff5fd2f324a50b0815163a1
1d9f51a39a6708734a71a5868c8f9ab3488cc682
91529 F20101114_AACIBC brower_j_Page_05.jpg
985ac2c90d7bc9f36585eea71151f294
5b11c8716ce5a0af120bcb16353f3f56d33c9e95
108369 F20101114_AACHUF brower_j_Page_79.jp2
4b07621aee19f4ffb94fcec0b1b11bcb
54df9d212c0c0fc58e4cb4506e79e22bff9521d8
F20101114_AACIGA brower_j_Page_48.tif
79526a5a3b985b6808d70f3684551b66
9be82ab840c63fa00ff1d4b115fcb59e6e4ba9c3
12164 F20101114_AACINW brower_j_Page_47.QC.jpg
198cc1757b0af6484afe12f2356c6bb5
da0efc1ef29b08c9d55f550477660deb0947cba7
34218 F20101114_AACIIZ brower_j_Page_84.pro
abedcab672031bd6df770d1b7f8b161c
31ab453164d7576445a3c9d9e8452a7a4cbe7377
43219 F20101114_AACHZD brower_j_Page_51.jpg
fce08733bf5b409af8997280ba8d5e99
2a06187a297a2168f1f2f3614b0ad84016315a6b
55300 F20101114_AACIBD brower_j_Page_06.jpg
8e573afad72611871af54e8824331c19
0ac3bd6f6a72b400b2700a9d4010a018febfe2a2
116934 F20101114_AACHUG brower_j_Page_12.jp2
cc70446551942f47222d04bb22bf658a
2079d582fbe1a11b5dcca14a0be302385eff9c14
F20101114_AACIGB brower_j_Page_49.tif
0e69c8bc0f786e31c63239657f6be28a
84c616b213b3526b1525cdcf299eac70d25a4929
4049 F20101114_AACINX brower_j_Page_48thm.jpg
9ef152c8e60307587c45e0cbd2b6153f
22fa0981b23983e01b12814d1e1e6749082c615d
28483 F20101114_AACHZE brower_j_Page_32.pro
8aa157f176ec5ec4383d6d046672765c
f80ea7265fad1a99b79f6242bea8fd3734613735
82086 F20101114_AACIBE brower_j_Page_07.jpg
b659d623a7d673c6e114cf8c3037d90c
f3bb7ffba04898c92842f937e3af6de078451ec6
3184 F20101114_AACHUH brower_j_Page_70thm.jpg
ccd642e6497dbb83323635a3b0ab7bdf
0659257dbfdad636cfba6189e2f5914054c28f56
F20101114_AACIGC brower_j_Page_51.tif
d8fe573f978cc4184ec701b25025909e
7a236c1690305d1bb3efeef02be05b86016177a2
14099 F20101114_AACINY brower_j_Page_48.QC.jpg
bd131d3cf74f1351974d023a57370491
1582c014db06cb167be0e5f40b6dd32f8f9a49e8
27649 F20101114_AACILA brower_j_Page_16.QC.jpg
f198ad7c4cef3a1f11a55389625ed280
bd344a5f51c8075367c0ffb36442d16144214419
F20101114_AACHZF brower_j_Page_27thm.jpg
cb570eae7db2aef32dd526598809b873
cffccebd297433b484786caa4812e7a0e12c1a18
80486 F20101114_AACIBF brower_j_Page_09.jpg
1033fafbf59c316063b3665a368f893f
fa508891114735dad199c94afb98b58cfabf905b
27585 F20101114_AACHUI brower_j_Page_22.QC.jpg
660d57a73df7b29e7c6c810fea7c3a77
6333e8ae48b9b88fb09c209313069942a8adf340
F20101114_AACIGD brower_j_Page_54.tif
eae88ebe8c710957b798af586470faca
6dd018a2caeb68a952608f0042f146280cd31c9c
3249 F20101114_AACINZ brower_j_Page_49thm.jpg
de8a0acefc8e86e7b52280b223deab73
3361b496aeedb6667132ce8fffaadb30f4daac43
26822 F20101114_AACILB brower_j_Page_17.QC.jpg
1973b2394b84809424c4585bc2ac1900
8c0f3a126a9477206cd2427b6c06d7e77bf7f319
332 F20101114_AACHZG brower_j_Page_64.txt
4e1dd39f62cbc5de6b7bbc53dced274a
f7a52bf45e003826e49509448b7d52df5610cdba
80765 F20101114_AACIBG brower_j_Page_11.jpg
f103e0de70a61e57e6860fdee4f0f0a3
6521fb21e7d62b8a3871cdc88db0d4eff2adfe78
F20101114_AACHUJ brower_j_Page_02.tif
64ad292d7b78ecbb302d1be5514f11ed
c4dfd2809cc4f680588b68b9c8bd705922774838
F20101114_AACIGE brower_j_Page_55.tif
56f6dd869218599841c1c4fead2f5a64
b89d101f50a2d37933149e0d1a7e1372f4d90945
F20101114_AACILC brower_j_Page_18thm.jpg
db156c0ef7d5b020078e72bece3ce4d5
039e1c4391dcdfa2eade31172799af33c0c5de1b
59716 F20101114_AACHZH brower_j_Page_84.jpg
979107d6b946d2de2ffcb2ff8ea8b275
afed19eeb1a19d63383b01e6017aae8d395d0b82
85216 F20101114_AACIBH brower_j_Page_13.jpg
992b236409da8315f2c8403516273717
a4e05d0be83781a2f62a721b283104dca35fe49b
11161 F20101114_AACHUK brower_j_Page_10.pro
4913a684a474f9d5448e1b6c874d8cac
3a0166180194f6a9c0a15f4f26250e7faab5932a
F20101114_AACIGF brower_j_Page_56.tif
c2dd0506a8d6f4726aec1eb0fb6b7e27
8c434ed4198b4c7a07b797a30bf134ff42cf7781
28987 F20101114_AACILD brower_j_Page_18.QC.jpg
1b25fa169b9926e79d134273866bc3b5
5b3d4d8c1fda1d030c46b79bcb7bde5a738ef495
F20101114_AACHZI brower_j_Page_22.tif
983f0ff4bfdcecdcda62e6b3df12b104
5c7f251c0e64167136e4e4fe496a0d89990351e6
91951 F20101114_AACIBI brower_j_Page_14.jpg
8cfabbcdf23fb5a076c8080e679f9d43
b5330e412136ea85d03d4d1a785edcdb84b76d92
56111 F20101114_AACHUL brower_j_Page_18.pro
582924a35af9bafd3bd0f7d80d1ddae9
4f9f247befd3e29ebefbc55020974a5f3e2ebb0b
F20101114_AACIGG brower_j_Page_57.tif
58a7ce883894ec3bcd4ef5cec1b1d54d
2fd0701451122c34315f71c4de30448d2596de95
6540 F20101114_AACILE brower_j_Page_19thm.jpg
d416ed13bb4c2ca420cea25476e73443
f1e42f4af67ba8d3e3eb3c844f4c8d3fcb7538e1
88149 F20101114_AACHZJ brower_j_Page_34.jpg
2314b48773796ab777870795d3bfed8b
9395677c88db95e95d1e3a1dbd8c199f8752f0b8
86725 F20101114_AACIBJ brower_j_Page_17.jpg
e2485d85528becd1565a06ab743c995f
55ca33bc39b73812d61622bed09b6a297e3fd0e2
F20101114_AACHUM brower_j_Page_10.tif
ada7244aaa96dab58942bebf5cc8215c
fcd22bc7c6e64793f8105297597bc2d4582080ce
27484 F20101114_AACILF brower_j_Page_19.QC.jpg
ab7b9b411829a7d00a3df707c5b5f711
e712977de3d040f2f3f4f0b34d81be702266c316
1051974 F20101114_AACHZK brower_j_Page_06.jp2
6e4285b0bfb0685948b8e028160af388
a7b15f8bee1c3f9ab7559986b99676b6fca90ce5
93725 F20101114_AACIBK brower_j_Page_18.jpg
24deaa035cb3a1ac4e076b488a9276d5
0b5b440e945e31512bc89894153c947de23a40fd
4316 F20101114_AACHUN brower_j_Page_32thm.jpg
6b390b34518bfa236d8764ee22dce250
2f300c79e8d5d1adc9549f2f8af9ac4887856424
F20101114_AACIGH brower_j_Page_60.tif
d274e3c4104acaf0695320cbe37e7adb
277fa2c33561e681b96f8029d992c9a73926bffe
6399 F20101114_AACILG brower_j_Page_20thm.jpg
ef31ff0596daf6ae8136cfca3da261fd
2cfee973625494c53a0b1fd3717fb12603c8f88c
46903 F20101114_AACHZL brower_j_Page_48.jpg
97f3d7e1af912e5b83dde9c415d1735a
78faf3d50f4b6b22bb2c28e96f2de536a24cae1a
87814 F20101114_AACIBL brower_j_Page_19.jpg
006308831e3f21bc68d737de6d889c0b
b38b949ce8bc64b84f8399b8f0fc68ba8e02f807
15869 F20101114_AACHUO brower_j_Page_45.QC.jpg
6168bcb118925af1aaca5e3c3c0af64b
2d0681dd16d30a58a383318ce58e1c2c6ba5f17c
F20101114_AACIGI brower_j_Page_64.tif
1894f88eb21ac22331d15c346bf9b382
b6ff624e1d7a60491bf9633d8b65c737e783a098
6572 F20101114_AACILH brower_j_Page_37thm.jpg
b8d3d5eee49e4fa39401745f03113706
faabd0c1e27930bccd9b8dfb0752e683e6f293b8
6434 F20101114_AACHZM brower_j_Page_80thm.jpg
3010c73742aef3437304675ba3cb4abd
1f4c9105c5a24574181d2ab878734dc79effed5a
90146 F20101114_AACIBM brower_j_Page_20.jpg
21f1cbac7818e0af8f552ed374a2248b
e059610c073f6d646774975960d07526c135b7c4
3134 F20101114_AACHUP brower_j_Page_06thm.jpg
3687afa3766544a167ad153f805ee2c4
9519b06da470f54c138393a957e5254188fb6658
F20101114_AACIGJ brower_j_Page_65.tif
7bdbcf74df8b8d94c0beb8eeb6d8d3a5
263f8d8ce025cfb8ffa2e2de3a43c8a3ee5ac7dd
28515 F20101114_AACILI brower_j_Page_37.QC.jpg
4891a444ceefa8e983ef9e45cc8886b2
9f391c1058aa3fd02c5ee20dcdf7a12c13d56ed2
1051921 F20101114_AACHZN brower_j_Page_55.jp2
6443fe13595c97514069afcd92f86961
c4c1e3af00d3ef662b6cec8d7635c8daaafdc044
69659 F20101114_AACIBN brower_j_Page_21.jpg
8e68adecdea713ad70243134688a6ebb
03619f8105c8445d339e187bf2ece519faf6b20f
11600 F20101114_AACHUQ brower_j_Page_49.QC.jpg
6e60ed592bd2e57b66f527a15f166a6e
346139f4b0ca9580f6cba64907833ef051d29a98
F20101114_AACIGK brower_j_Page_66.tif
2c87c8cbda94085a42d123a3df451f31
0a2eb173f47e539158deea34abf0afb53188b508
6778 F20101114_AACILJ brower_j_Page_38thm.jpg
5a379614ba6de138b1d5440db3162513
2f5d670f0b7ce881cb1b14195b6c2719d31a028e
6093 F20101114_AACHZO brower_j_Page_59thm.jpg
7990fd6013ae8afc93e41b855950466e
b0afa179d9e857de64d2b89a9afa4a2daf0c08a9
88193 F20101114_AACIBO brower_j_Page_22.jpg
681ba7ea0e9be65e3d4cc01646cf9b99
1334b8a2d7d31ad759c05b456ee59c857cda977a
55480 F20101114_AACHUR brower_j_Page_12.pro
b7aee2f27f137f5daa03dee4fbfa1d6f
9e1a53a8459a3cf6da25d4018b4c5fa927c1732f
F20101114_AACIGL brower_j_Page_67.tif
1ab444347944bba56ddc29b819b9af67
d2b917f3ba9ab1136229e07314cae43521e2291e
29273 F20101114_AACILK brower_j_Page_38.QC.jpg
93df13ed7fdc9803b27bd5d19f8da44a
a3a661d0dc640a2c3afd7110269e118281bdc333
F20101114_AACHZP brower_j_Page_81.tif
e2f4ee8536341b22070a17535d4624da
05096b88f8933f32e4ca2cc151c6ef1e3c9f26ab
86934 F20101114_AACIBP brower_j_Page_24.jpg
e23adb58a1a3c35574c5f248c4076252
3529b5c128f37b6919945758b7993e596ccd6d41
68088 F20101114_AACHUS brower_j_Page_07.pro
2553d7e79d063ec37876409546467d1a
97d49077096fc960a4b2395c196b6e66c42052a8
F20101114_AACIGM brower_j_Page_68.tif
310121fa1dc3b5a0c630787026f80e07
3eb79682277e1954944133b11d94d63682e073bd
29411 F20101114_AACILL brower_j_Page_39.QC.jpg
53a4bb7a2e2c3ffb3abd97faf1bd2a23
46b6ab09440320ffc5f38ad527d22ccd54ab7b7c
95059 F20101114_AACIBQ brower_j_Page_25.jpg
0435e9eab8d67db10710a8fe4300564b
6ef7c03f3656598f4c97a87a6e16f55a2264f688
1051982 F20101114_AACHUT brower_j_Page_64.jp2
5558d5bf29f3f32d4a7427a8d6e8d1be
3a420012315fc04124d6819057ea99988ab6fea2
F20101114_AACIGN brower_j_Page_69.tif
585a1b9457568d28bb807baec42610e4
15c042d36ff64c2c3d5517b9080fd0650383c7db
2063 F20101114_AACHZQ brower_j_Page_79.txt
b300ab0d297d34d53bb7058000d7611f
d97df34863da8fdbe1ea645d8a847fed13cd98db
86468 F20101114_AACIBR brower_j_Page_26.jpg
4f0711cd1c164c8ec55127a349b1bed6
23f3c58fff33de1e230f347463cdb6348ed41740
404514 F20101114_AACHUU brower_j_Page_56.jp2
3c6d7554ee95d50b930086037a95347d
d00dc4f7112f91ad853f68b0454529625bef3656
F20101114_AACIGO brower_j_Page_70.tif
1f0c3392cab77b12937833f5f5ad7c54
254bdcad602d1d4c51852a72b7002e34175b40ac
666420 F20101114_AACHZR brower_j_Page_44.jp2
001bed19db3aaddb07923efd6b1bc5e9
c52756ced9b8afc5adfaaa38ebfb9007ea97d53f
6610 F20101114_AACILM brower_j_Page_40thm.jpg
5835907480c769d180087a34e97e869a
4c3376ae655a063ade1b07ae482d04dc03c93462
87789 F20101114_AACIBS brower_j_Page_27.jpg
8f3c237bb9d58179ec0b4042f19bfef7
67f66b5ef06e6b27df44cff786593391a59cb662
5040 F20101114_AACHUV brower_j_Page_50thm.jpg
671095f4c80ba7f41003adea30270a80
056527344331732874638c7fedd799176e4d7324
F20101114_AACIGP brower_j_Page_72.tif
4dcd87f92b357b8f127331e7d8626b29
7760a64c8046c6f741fd773d3b47dc204b8e4351
2091 F20101114_AACHZS brower_j_Page_74.txt
0904c20c9c1daee5e113cafa85e98dd9
2f3a10ada37f103fdd9404b2ba0834a10d0a3c79
3641 F20101114_AACILN brower_j_Page_57thm.jpg
74e81157f93679bb23fd28a5053a23b5
d5588237077854250af0f69f3868f21feaa95f94
81239 F20101114_AACIBT brower_j_Page_29.jpg
616f2534f2037700c7fae8aee9574dde
819706de6e1827ab4ad65c109c38b5cd2cff2972
F20101114_AACIGQ brower_j_Page_73.tif
e14e76ebbbcdc83c4d721331cadfa753
fc2ea35f951f0f975b5019400750ec32602b8c16
6594 F20101114_AACHZT brower_j_Page_28thm.jpg
2aa9533ea3605ee05fdf416e9b054bd6
8f5cf5992b58a2569ca9c43c2899fff01a62bdee
10803 F20101114_AACILO brower_j_Page_57.QC.jpg
72be4666d6a4df59f65c7597888dcc8e
31625342750f54bd95c0df7bbb13fe3cb5d457a2
92365 F20101114_AACIBU brower_j_Page_30.jpg
dc257a6917a02ba664b8248d98112766
8b593241e2231f87b1c41b58353d7cd691dfa970
88930 F20101114_AACHUW brower_j_Page_37.jpg
df8c4277c1308c37cf10ad0c76bb1f2c
c671dba9cee209402fc9555c09b690a1e2b379ee
F20101114_AACIGR brower_j_Page_74.tif
58764bbcb2e7dd34856aa06869741164
e615427bfbc729a6182bd25051c0bdb547caeea7
2174 F20101114_AACHZU brower_j_Page_76.txt
a024b9fc5d7a9e00ffc7f37e337c09d1
9b1e9171f606589c1e189ad8b3041ece6802849b
6959 F20101114_AACILP brower_j_Page_58thm.jpg
5b6b60b2854a41cc11cdc68df20f0b62
bbcb8946333ddb217312377c5adbb918a2bbe5d4
91992 F20101114_AACIBV brower_j_Page_31.jpg
e2ea7fcef3d23a2b1841551e3a6a92c1
afc194d3040e493fbb95a41f4375be7b7535ddc5
18284 F20101114_AACHUX brower_j_Page_68.pro
ed7269b63b9ed6ab671f26f93d1d1930
a747f81d61b18e49020e03b43e82ed2ae586bf4d
F20101114_AACIGS brower_j_Page_77.tif
3479629449c0fe6ad9e542ba3622becc
323b27f54726304a132ca35339e5528e896432c5
51756 F20101114_AACHZV brower_j_Page_35.pro
0ef84978b84657cb0b54fbb2adf9b1d2
998607f7e1670248cbb43cf4c775d3c10324f59f
25786 F20101114_AACILQ brower_j_Page_58.QC.jpg
588f3d063df4a74caa05814890d2f8a5
dd56db0a57bf0979de9d08bfbd5cbec932b366cc
85931 F20101114_AACIBW brower_j_Page_35.jpg
a39e07c69f9f265b40a1415df3bdba96
d9b8a64f4dd66efa997d59869e064483e81c8e62
F20101114_AACHUY brower_j_Page_53.tif
120037aeea5ac015580d3f08a2fddd24
6ccb4fa55401bdbe9d9c2ae2750221699927f6a0
F20101114_AACIGT brower_j_Page_78.tif
23fd411bd52cf0fa433825733ec183a0
27ed727e2c67e7c1647dfdbbcafe20d1e12c525c
F20101114_AACHZW brower_j_Page_18.tif
14370dc022e9d914a290864f86fe7017
d1df97126dd559d91adca25aadc0faf9e4501e16
21779 F20101114_AACILR brower_j_Page_59.QC.jpg
bb0de9bf27edb5d53ca9aeea56b1cd8e
94243ca94acd9973daf1fcf2f3fcd3b5ce699d88
28934 F20101114_AACHUZ brower_j_Page_31.QC.jpg
7645eb8dcaec8e24052e76fde3611069
b51ae034f357bb348b97da82b8c485bc3bc4232b
F20101114_AACIGU brower_j_Page_79.tif
1652dae41300ed8ec8f27397999fb79e
55985ef81cf1c98d1eda58fb943c66988563e617
6083 F20101114_AACHZX brower_j_Page_29thm.jpg
78c2ac42d8648fc415c6720a59d8a240
8958ac3407313af281c0c2156fcfa2e972bf67ad
93582 F20101114_AACIBX brower_j_Page_38.jpg
beff0530e4c1bfe11e22a2e3340cc904
01f887f66a2ab142c814d7289d416febcda7db17
5221 F20101114_AACILS brower_j_Page_60thm.jpg
f60142a9bea0072f664dc8987a8d5896
feb87b9377b19b20c1f23d3359709323283eb4e4
F20101114_AACIGV brower_j_Page_80.tif
bcfb96594ad89ef5b6564fe3e3821501
96aa54f804e80232e532f5708d0dd0895eddda4a
703 F20101114_AACHZY brower_j_Page_60.txt
d957878b8cd27476a7ef7a7c2fe54f1f
3a436171f8eb73f7d97f501b1b5d832ebc106fbe
90539 F20101114_AACIBY brower_j_Page_41.jpg
6889de1b69a0e52c61b32463d9d022af
6b3626ebaafe06397d8d6b4638c5021d8665ec86
29145 F20101114_AACILT brower_j_Page_81.QC.jpg
9c4c460dd8f1d1043c192113e9103c9e
cc6e0af12d8cbdc46d1796d33186ed7f23a295ad
F20101114_AACIGW brower_j_Page_82.tif
4502d09c98e0515f6b9e11a6b3eb8e33
9ed64fec1bd3c7a422c33acb364378c93b9a300d
117958 F20101114_AACHXA brower_j_Page_31.jp2
42d5a5ba72a904d843f944154abcb65d
6628d78138caad4ea2963eaa212a972134e64f51
56917 F20101114_AACHZZ brower_j_Page_61.jpg
21efda27bc9779dab3780f409b4fb780
759d7015fbc531fbe80bd4696427d890a39a70fe
98333 F20101114_AACIBZ brower_j_Page_42.jpg
1c8b16d8ecab0ec4d21c8c6dfb49c5c0
922f7762fc20dae5a08b3bd575c685f35a32c907
7029 F20101114_AACILU brower_j_Page_82thm.jpg
2506e2e13c79f1241c24e4899463485e
c7dd88ae99cd27ebd41ec22a82a8c56e68ae9e19
F20101114_AACIGX brower_j_Page_84.tif
8e45355e5bcb33de1d5a87ec9bdda53e
6d69add02b03ea19fc0ee261b0e14ac3ac906117
5180 F20101114_AACHXB brower_j_Page_71thm.jpg
f9ec8568fe535caa5f7198486c875e8f
06dc6e61eb051de23d0ef28eda5d7a51efa5ca71
27376 F20101114_AACILV brower_j_Page_82.QC.jpg
1fec84d8ec319c036d7b3f4c79eef6f3
ea574ac54b909daa9d88a01e94325f3666311556
128366 F20101114_AACIEA brower_j_Page_42.jp2
9661483077218aa0336c8821f3a9932f
bdd10e08d948bec24ee1310866c7d7e826eeae00
8839 F20101114_AACIGY brower_j_Page_01.pro
187bc64197794fa5b7774b3764bb0b82
81d6aee871bf3e6fe46ad8729b083546c9d79279
52704 F20101114_AACHXC brower_j_Page_19.pro
b41a93ae5ffee73f51c5c4835e852b91
5999068d020ab579f81434ba5138fe6edb013241
4137 F20101114_AACILW brower_j_Page_83thm.jpg
76d121fff4b9193671d08c145e843e29
60b19540fb0b3f90b305ecc37179623ad18fe02a
935758 F20101114_AACIEB brower_j_Page_45.jp2
c3aad7025ae49770ad1f5bac5061f84d
e0f11d773bb24dc7bc48a41c506b8d18451a8aea
911 F20101114_AACIGZ brower_j_Page_02.pro
a599fc52f7a4f8cc3eb9c89d615c1997
4063e43e0c9e94b5d8a278fda0b90ee11e544f4d
6198 F20101114_AACHXD brower_j_Page_11thm.jpg
c93bb16fe0982df335f21870439b5f7c
f545e57fbe2fd9c88358119967a1dcf98ebd4e43
4372 F20101114_AACILX brower_j_Page_84thm.jpg
9b8a3a3876002f5e08105aabd2a59bd2
6f07ef6cc2608ef9d1976112e51f503653f548b7
1051969 F20101114_AACIEC brower_j_Page_46.jp2
3fcc0949d37c32ce88c6ad1f73312686
531dc40e232c26206e01d4a1f5afddf2a93ea23c
62907 F20101114_AACHXE brower_j_Page_46.jpg
47033841ec313c4fa89d85994388e47f
0e87dbe43ddedd9e2c1cb09827bffde62b39dc11
1821 F20101114_AACILY brower_j_Page_01thm.jpg
0bf202919d4126de7c1f7b2a925fd43b
44fd13b3f704b632daafa06ba8e6255fe8785b5e
495 F20101114_AACIJA brower_j_Page_01.txt
caa1eed254928f309e8a9428018396e6
ed4d419cc881c2702527b32f71de8880dc6b5124
589964 F20101114_AACIED brower_j_Page_47.jp2
98d5d027ee1d772fbdeb0d90d8888960
a25ad8b66f9c4b290d55f0fb580ab05ce624ca92
2176 F20101114_AACHXF brower_j_Page_41.txt
4fd45fc497749291d8ec6227f60969c7
4debe34f2801456db253b0d00e78f7cf9416163b
7379 F20101114_AACILZ brower_j_Page_01.QC.jpg
49e57b9339085635add1cbaec900c18a
39d54a45c98f7ba49f35724e6b3f20d2a78700de
154 F20101114_AACIJB brower_j_Page_03.txt
19cbc3571edd4a4ec437f539e896054e
f357002a49961355d2a00ed25cfeb70e8d8524fb
605085 F20101114_AACIEE brower_j_Page_48.jp2
8578003d1d5d924a12065d07a6d2e0d1
ec3384421e6fa28a7902e3d83973b6acf3da7fe2
278059 F20101114_AACHXG brower_j_Page_52.jp2
25ffacc8f641220462e5436adba00db4
cb2a7e27213f6f07c0600551b746e6a13c7331f6
4177 F20101114_AACIJC brower_j_Page_05.txt
8ca72bf77b8bb6e88ebcef71d1f3756a
1934348f824ea8a541276c79352f2bc7f9c388d2
F20101114_AACHXH brower_j_Page_61.tif
50f936f5318f64b2fbf1e8676bf49b9f
0d1f836905e38d944b7e80597ba47c22caacefbe
18835 F20101114_AACIOA brower_j_Page_50.QC.jpg
45279ea387a860dd998a5c9f8ef6438f
6f6d74252f858c94af9847939e839dfbd700268e
1721 F20101114_AACIJD brower_j_Page_06.txt
9e141c2d6372df53daf32a77746c9ade
181d6350461a2d85dc0dc7435d0a505d686d7198
1051845 F20101114_AACIEF brower_j_Page_50.jp2
d2ea9c4e769e75d00c7af3a43ceb953d
b3e2a52d2963c6eb039ccfb680d243fc9a7f934e
87391 F20101114_AACHXI brower_j_Page_40.jpg
8f5ed8c6e1088d0c70501191382243cb
d6e7b22f1f6a33308ecc427243ca759f9fdab476
7449 F20101114_AACIOB brower_j_Page_53thm.jpg
95c03babcacde2fc4d24a1dae961637c
c889c76f1472927282b97a392d81bd468d7d1fea
2724 F20101114_AACIJE brower_j_Page_07.txt
1f4814cc4f5e1f7c4cd5540c76b9eb61
db9f7b786c5293840ab4f89d534ec41d736bd6cd
604914 F20101114_AACIEG brower_j_Page_51.jp2
3d0e61ffbffd533d0842a10ed79d2472
3f38197212e08e59ed09b2249d68e834ee3fca29
6790 F20101114_AACHXJ brower_j_Page_73thm.jpg
00d6edea9aac5f3f909d1c33832e2942
579758732977ee2a70b8932310a6610df824694c
27013 F20101114_AACIOC brower_j_Page_53.QC.jpg
f11a2aaf2832da31126730b7b5978fd7
f7c138d6eb17f72f8a456b1d455a1840923755cd
864 F20101114_AACIJF brower_j_Page_08.txt
b485ff1f7b6154a4df814ffc3b650eb1
6a3c83d2421c64c9de21df85decca8defe6bb9e6
350997 F20101114_AACIEH brower_j_Page_54.jp2
93ce88728242343f22638c27515213d7
8767ced9129308ef23b36f3d7622859ab4ccea71
50640 F20101114_AACHXK brower_j_Page_22.pro
7f970dcabc2275074744cc854e69f91f
ea644ee7b08c71e01704f3dc270b530a81f96ac4
663 F20101114_AACHSN brower_j_Page_67.txt
3f395e2f54732b66bd5234c6cacdee45
7575fab5562ad996664743be4ec3373af0a69bd4
3069 F20101114_AACIOD brower_j_Page_54thm.jpg
f92649ff5a7fa855c25ae8792866a234
9d692a91fc1d69867f9ac82cd79d27072e1433d7
2038 F20101114_AACIJG brower_j_Page_11.txt
3746c06137258ee85fe334890111dcb5
df6d43233cab0f90c40b22873431140e101afcc5
375962 F20101114_AACIEI brower_j_Page_57.jp2
2325330ddcc0ec92f99cce2cf5d52370
f06eb8caf01fba9c055b276c1cbbf01f50d85518
28233 F20101114_AACHXL brower_j_Page_77.QC.jpg
51c9691e3286fda1f0c72b30a3ad199d
68609a9e6b1becdf6ffb63cc42534183e27af8c5
1900 F20101114_AACHSO brower_j_Page_29.txt
c5ebe87078441e846df8da524fa38bd8
3751215311196b761952d8372affe53f4d219676
8663 F20101114_AACIOE brower_j_Page_54.QC.jpg
0f9edbed25b7fce2d355b1fbb12633c7
0d0ccb8a290690a0d0a0b064b85a599fdbccda55
2186 F20101114_AACIJH brower_j_Page_12.txt
7fdd747ba3b29dfb54969c1b65dcdfe4
5ce95fa9861d2653760a8fb6eecddef8f77b2c1d
1051963 F20101114_AACIEJ brower_j_Page_59.jp2
53bc425cec15c41e9951c87995cdb06b
e5401eeebc4661bf2bf29592615e161648708d33
18932 F20101114_AACHXM brower_j_Page_66.pro
26df7d14dc94519657ecc540ba96aba0
defda3ad1c5887cb4db48bf7df04d6484dc6bb01
F20101114_AACHSP brower_j_Page_31.tif
f8f2ce5b60bd2785b6abb5b839563674
271ef05ad1b58bda093c1e1be45ffd747dad4fe0
5151 F20101114_AACIOF brower_j_Page_55thm.jpg
3ebbcc83ab6700b8ba2bdeea49b9fc2f
2c920f43e7a903e05925ff4899af6905a15ceb82
1982 F20101114_AACIJI brower_j_Page_13.txt
719d417d1a1a2f0db7a23abbfe57d40e
39b0ad305eb4f6ea541803d8f9bd7b321b3a1ea6
1041010 F20101114_AACIEK brower_j_Page_61.jp2
c6c100f44b50c19083e1a53379175089
e02b2fa445b6ea278845638a14915a032337fb4e
9147 F20101114_AACHXN brower_j_Page_66thm.jpg
e9c504b7f929dca3f877d0e625d4944e
d9f1c1a44a7a1918a595a8fc53205010ca2a8c64
27368 F20101114_AACHSQ brower_j_Page_80.QC.jpg
7c4ecb24aae007b6597cb7d7fe975001
ad98e3d97e80dedb598d98d506e7d625c359f2a0
3123 F20101114_AACIOG brower_j_Page_56thm.jpg
962efdea20589c2a88dea2e25e4e1be4
3da587288f8a73ad681e829ddb4d3105d1626d27
2138 F20101114_AACIJJ brower_j_Page_14.txt
86ff1da02c3ad84079ba5df0bf1b2857
cf0b571beb5f3cf1aac6de03ec3d086d52f9fce7
204911 F20101114_AACIEL brower_j_Page_63.jp2
69897435995eaac645f262262b7608fe
82143b9f187300c01998e90358580b7e0bdbeaaf
F20101114_AACHXO brower_j_Page_28.tif
c6ed81b8bba257d5508f913871668f9b
de3abe56a387d47f29c1c71da09efc019c6c94fb
51491 F20101114_AACHSR brower_j_Page_69.jpg
512d188a0be2aaf21ddfbef2e58557d4
091492f1aecd527b9b9f8f614cb9114e16704081
19998 F20101114_AACIOH brower_j_Page_61.QC.jpg
e9e326603a28531722533dd9d86acb1d
5425a653ade8ab436841ca7f704b936140dec1cc
751303 F20101114_AACIEM brower_j_Page_65.jp2
e3f142354ddca3786713bd673f085b74
abcb6167fc1234db45e14b830381b6280cedc0bb
33971 F20101114_AACHXP brower_j_Page_08.jpg
3d68368275f95930ce31d76a6b4c385e
e2cec09fa57be945e304b81fb241f083fdba2cb4
116845 F20101114_AACHSS brower_j_Page_73.jp2
69f6644b5d13cdfa857a2c9a334ed96a
41ec607b6fbd55f29d2029ec668d539050f8406b
2413 F20101114_AACIOI brower_j_Page_62thm.jpg
b40f96cde1cd4302313211b507ccc415
2ea2d7e9b85ecf4d8e70a98513f091dc3af7b593
2031 F20101114_AACIJK brower_j_Page_16.txt
df09aec1bb1821a8ec711f2f17ac3784
8391ea8bdb2c6a1e5d481ee8a72274380ad37c53
1051962 F20101114_AACIEN brower_j_Page_66.jp2
d23221694d2bd866e11df369a061ba1f
d17dbc0d625f676a52393829c45fba439ac667aa
907 F20101114_AACHXQ brower_j_Page_66.txt
1d8403810ec875968f1fc842332d0e71
a90d403d086623ceb4cc29197c4cc70b71be6c9e
6765 F20101114_AACHST brower_j_Page_41thm.jpg
fe4bf03e253f0574c49ee7786fa1d24d
d8919e74ec124ec9410dc4af41434e5585acec1b
7646 F20101114_AACIOJ brower_j_Page_62.QC.jpg
77a69a367804bc5aa7beaf03cd8c5b22
92f930f50de96e15872c44636226b40be1b39902
2154 F20101114_AACIJL brower_j_Page_17.txt
4dd6c9973e51f6bae59f63346d01d107
51c7965f1abf34c271d64499bfd029f05954c061
351434 F20101114_AACIEO brower_j_Page_67.jp2
acc18b6cdb15423b66b5a45d63cd0a23
9c6c9014ab47b499e6f1f5ac634e61676b74dfcf
13242 F20101114_AACHXR brower_j_Page_68.QC.jpg
9642f3a8aaaee3388231535257db9bc6
c5f495bdd33fe511790b75671a7173feb7fafa10
3989 F20101114_AACIOK brower_j_Page_64thm.jpg
c70436c85f238d35ce6144115c6b212e
7718c532bbbcac0a60b6ec896292138401c56946
2190 F20101114_AACIJM brower_j_Page_18.txt
85be352c9fc29702c3fe979120e1822a
fdce6a3634379e8c1887f9afc719575768876993
570055 F20101114_AACIEP brower_j_Page_69.jp2
e3b302438814f35e70dd167ada63073b
cb0126037c07e7d73d3c63556ee60088c8152225
13044 F20101114_AACHXS brower_j_Page_06.QC.jpg
43d5e03fdb28e8ff17f983e7e1de7a5e
e2fef669784a47df7accfba29237f6dae7d3b582
F20101114_AACHSU brower_j_Page_33.txt
74e5d2c77aee5a629ec78729b99ed29a
e6bc8bb7bee90bfa6d9e98f692cde5b2854cfb9e
14674 F20101114_AACIOL brower_j_Page_64.QC.jpg
240d7c86f274b73b9b6f4446388e5bee
00e758c31d0de5c29eb4cc88127f5e1fe8f0cd9b
F20101114_AACIJN brower_j_Page_22.txt
8a30139e1d594b3e57ebf3a5d5c9dbe8
b5e77f36feea93a9e99a00d80bd96e2abff86b6a
68162 F20101114_AACIEQ brower_j_Page_70.jp2
3e6acd678aa0d6128826c62df4f3a2de
a9ac0936a3d3e10a8808195a117aaaef8dc4f030
6662 F20101114_AACHXT brower_j_Page_12thm.jpg
ae323eebee206ae4bc7572f8359dbc27
2606a1eb468bec04b8e33bd6665fd8a22e937e40
90780 F20101114_AACHSV brower_j_Page_36.jpg
5c47d7a7975844f10feaf261aa7e45b9
f76f4383587b2883592881ae188e43ae9be66bc6