<%BANNER%>

Generation, Characterization and Risk Assessment of Transgenic Apomictic Bahiagrass

Permanent Link: http://ufdc.ufl.edu/UFE0022475/00001

Material Information

Title: Generation, Characterization and Risk Assessment of Transgenic Apomictic Bahiagrass
Physical Description: 1 online resource (117 p.)
Language: english
Creator: Sandhu, Sukhpreet
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: apomictic, assessment, bahiagrass, biolistic, flow, gene, herbicide, resistant, risk, transgenic
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bahiagrass (Paspalum notatum Flugge) is a warm season perennial species distributed in tropical and subtropical regions. It supports the cattle beef production system in Florida, where diploid sexual and tetraploid apomictic cultivars are grown widely as pasture and utility turf. Apomictic cultivars like 'Argentine' represent promising targets for genetic transformation due to their asexual seed production. The major objective of this research was to study pollen-mediated gene flow from transgenic to non-transgenic bahiagrass using herbicide resistance as a marker. Experiment involving the generation and molecular characterization of herbicide resistant transgenic bahiagrass, pollen-mediated gene transfer, breeding behavior of hybrids, and the fate of transgene(s) are described. Unlinked, minimal transgene expression cassettes (MCs) were introduced into Argentine bahiagrass by biolistic transformation. Co-expression of unlinked nptII and bar genes occurred in 19 of 20 co-transformed lines (95% co-expression frequency). Transgenic lines were morphologically identical to wild-type bahiagrass, produced viable pollen, and were resistant to 0.6% glufosinate ammonium in the greenhouse and field. Uniform seed progeny with stable integration and expression of nptII and bar was confirmed by Southern blot hybridization, ELISA and herbicide application, respectively. Open-pollination of transgenic and non-transgenic bahiagrass was conducted in the field and greenhouse at a close physical distance (0.5 to 2.5m), to ensure a detectable level of gene transfer. Gene transfer from transgenic apomictic tetraploid bahiagrass to sexual diploid bahiagrass or to apomictic tetraploid bahiagrass was 0.03% and 0.17%, respectively, under field conditions, and 0.16% for both cases under greenhouse conditions. A total of 56 hybrids were identified from 44,205 germinated seedlings derived from non-transgenic pollen receptors. Twelve of 13 hybrids examined by flow cytometer and karyotypic analysis were triploids. An apospory-linked RFLP marker was detected in 15 of 17 triploid hybrids and all 12 tetraploid hybrids analyzed. The majority of hybrids showed reduced vigor. During the first year, five of 10 hybrids flowered with viable pollen while two of the non-flowering hybrids did not persist under greenhouse conditions. Gene transfer between transgenic and non-transgenic bahiagrass can occur under field conditions; however, hybridization frequency is low compared to other transgenic cross-pollinating grasses, and the resulting hybrids display reduced fitness.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sukhpreet Sandhu.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Altpeter, Fredy.
Local: Co-adviser: Blount, Ann R.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022475:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022475/00001

Material Information

Title: Generation, Characterization and Risk Assessment of Transgenic Apomictic Bahiagrass
Physical Description: 1 online resource (117 p.)
Language: english
Creator: Sandhu, Sukhpreet
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: apomictic, assessment, bahiagrass, biolistic, flow, gene, herbicide, resistant, risk, transgenic
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bahiagrass (Paspalum notatum Flugge) is a warm season perennial species distributed in tropical and subtropical regions. It supports the cattle beef production system in Florida, where diploid sexual and tetraploid apomictic cultivars are grown widely as pasture and utility turf. Apomictic cultivars like 'Argentine' represent promising targets for genetic transformation due to their asexual seed production. The major objective of this research was to study pollen-mediated gene flow from transgenic to non-transgenic bahiagrass using herbicide resistance as a marker. Experiment involving the generation and molecular characterization of herbicide resistant transgenic bahiagrass, pollen-mediated gene transfer, breeding behavior of hybrids, and the fate of transgene(s) are described. Unlinked, minimal transgene expression cassettes (MCs) were introduced into Argentine bahiagrass by biolistic transformation. Co-expression of unlinked nptII and bar genes occurred in 19 of 20 co-transformed lines (95% co-expression frequency). Transgenic lines were morphologically identical to wild-type bahiagrass, produced viable pollen, and were resistant to 0.6% glufosinate ammonium in the greenhouse and field. Uniform seed progeny with stable integration and expression of nptII and bar was confirmed by Southern blot hybridization, ELISA and herbicide application, respectively. Open-pollination of transgenic and non-transgenic bahiagrass was conducted in the field and greenhouse at a close physical distance (0.5 to 2.5m), to ensure a detectable level of gene transfer. Gene transfer from transgenic apomictic tetraploid bahiagrass to sexual diploid bahiagrass or to apomictic tetraploid bahiagrass was 0.03% and 0.17%, respectively, under field conditions, and 0.16% for both cases under greenhouse conditions. A total of 56 hybrids were identified from 44,205 germinated seedlings derived from non-transgenic pollen receptors. Twelve of 13 hybrids examined by flow cytometer and karyotypic analysis were triploids. An apospory-linked RFLP marker was detected in 15 of 17 triploid hybrids and all 12 tetraploid hybrids analyzed. The majority of hybrids showed reduced vigor. During the first year, five of 10 hybrids flowered with viable pollen while two of the non-flowering hybrids did not persist under greenhouse conditions. Gene transfer between transgenic and non-transgenic bahiagrass can occur under field conditions; however, hybridization frequency is low compared to other transgenic cross-pollinating grasses, and the resulting hybrids display reduced fitness.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sukhpreet Sandhu.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Altpeter, Fredy.
Local: Co-adviser: Blount, Ann R.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022475:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101202_AAAAAV INGEST_TIME 2010-12-02T09:58:21Z PACKAGE UFE0022475_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 6630 DFID F20101202_AAANFL ORIGIN DEPOSITOR PATH sandhu_s_Page_057thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
0b760e234426e5adda69e358f4af065c
SHA-1
c097ddabcc40ccabf62a7c87aa40e227dcdf1401
3923 F20101202_AAAMTQ sandhu_s_Page_076.QC.jpg
b43600cf4339bbaae0f7f95f54cc44ac
103e2f957db51c65ab7886ad0a56579b219d30ac
30462 F20101202_AAAMOT sandhu_s_Page_094.QC.jpg
b9960949a861a93ed452a31f0a7f5285
5bbe8a1f64e401260224df3fa42fb274becfe443
1051973 F20101202_AAAMYO sandhu_s_Page_071.jp2
a7ba9d162f96b1fe13c5162f93e5cfca
6e947ed030f61a714220d0321fa6ed02ad14a7be
25271604 F20101202_AAANAO sandhu_s_Page_030.tif
4906be70dda0de6bb7812352cbae7804
2c2df6745a6c014dba0b142bd87dd2ba72241224
6136 F20101202_AAANFM sandhu_s_Page_058thm.jpg
2ece5c9ac13158bc8b9480521d40680f
cc0fe3c598bf9f5ac3502e02b40c52d7af834fc9
83909 F20101202_AAAMTR sandhu_s_Page_066.jpg
c83009666b01737dcf58127bf15241c0
1298ad86816be7c99bf42057b9390be8e944f3df
16490 F20101202_AAAMOU sandhu_s_Page_077.QC.jpg
016eb9ab8d5d8657974ca109dbbb03fd
b4d445d7bb828996d5769bc6343758d16337e0df
1051944 F20101202_AAAMYP sandhu_s_Page_072.jp2
9c9e7aaf823f73e6639a6ab4e3baecc6
dc9036e864f6fed6354762f51465db9abf657c3a
F20101202_AAANAP sandhu_s_Page_031.tif
49852efa1c82f4d53971311da0f6fe56
50dbf155c415ef9e2ab58a9db94b14646b91cdf2
28441 F20101202_AAANFN sandhu_s_Page_059.QC.jpg
4fec889a16ba008ff6859d12cc34f9e1
215d90bb85633c765e59500d34551137e5e5b91d
109462 F20101202_AAAMOV sandhu_s_Page_109.jpg
533502e0f09a4b08d44477986317699a
06b77d7c9475883c0cc4e8082305059c348d507a
1051957 F20101202_AAAMYQ sandhu_s_Page_074.jp2
c59e7e55626418d2dfb35e05aa8922ff
be0de890cdf29af217d5cb62a5bd5fa477f327d2
F20101202_AAANAQ sandhu_s_Page_032.tif
40ceef32839d6ec1b1496a9dc6facd26
d7cdaeb98b70a8da83b879b065cbbf4db3340b2c
F20101202_AAAMTS sandhu_s_Page_022.tif
2472f67b94b0f819382dc54c38acf4dd
4db485b503d6ddc5ccd21adec4b0f073e7afbe95
28837 F20101202_AAANFO sandhu_s_Page_060.QC.jpg
16ed8b9d300c29f3f40849635be67f51
82330fdf63edc800eb68de339b01a9d6889b9421
866144 F20101202_AAAMOW sandhu_s_Page_081.jp2
8ec5d7375440f2ab1fe19079b647c3d3
975a9f18f11f5843cc7bd945d4a8ba14cbd87708
1051974 F20101202_AAAMYR sandhu_s_Page_075.jp2
2321e90a1ca2bb3bcba836df1ba674de
7594cc4d562ad13136374d4e9a9169af60438c18
F20101202_AAANAR sandhu_s_Page_034.tif
57c7af4eba0a34e97d6d53565ccb9a06
5bcc76a5ba4e39affaa99be4c338b6ce9971c982
6827 F20101202_AAAMTT sandhu_s_Page_001.QC.jpg
7798543b27d6f541766292bf1d4f4900
6823ae873a7cf2d903f2e64e34da6a2704f3fef8
6656 F20101202_AAANFP sandhu_s_Page_060thm.jpg
730f49acbfb58103c4104b9d28653bd0
beadb371201b24b84bbee86fb1439c78250afd9f
6389 F20101202_AAAMOX sandhu_s_Page_012thm.jpg
db37c04500648d88fa0ffc3b83042b97
0f1f28901750d8fd928e5605811c455958a5c37a
727650 F20101202_AAAMYS sandhu_s_Page_077.jp2
28ad18021642685c424a060ba035b625
120e8eba215dd4e7d4bb9149112ac8877598b853
F20101202_AAANAS sandhu_s_Page_036.tif
1b3ccb5e8c1973a73395e8c765745ed1
dfebf3d0027777f9683c6cc282de9b6b2681bc50
6296 F20101202_AAAMTU sandhu_s_Page_019thm.jpg
69c9dd9f86acdf562f42ddc277b49a56
d55ccb33360289a373f645ed5f8a17ad757c1873
29082 F20101202_AAANFQ sandhu_s_Page_061.QC.jpg
23ceaa18acb7e230b1856fe30298f4d7
df5e28a67d600afa76e184771c04a30c2cadad3c
91627 F20101202_AAAMMA sandhu_s_Page_040.jpg
966fac7022fca84982489abde77c37fd
5b05f7b09ef39b672ebf55541ea327613fac0601
1051959 F20101202_AAAMOY sandhu_s_Page_087.jp2
2cf6331f5af02d46f8f6a0e5b2cc30df
6e160547272b97671af94f52989a43f56544cd44
F20101202_AAANAT sandhu_s_Page_037.tif
11b749582d0964ed0f1aee72ea281c6a
de2580db5c08cfd7f6a9242c4c82761d53df7a47
F20101202_AAAMTV sandhu_s_Page_041.tif
0e32a5ecf040efc910377c0d117dabee
5af31775698e5ecc376a93b10f568ed22b3dfda9
27896 F20101202_AAANFR sandhu_s_Page_062.QC.jpg
a427ab20f535b54e1ee5198eb0c9e488
b27815dc371500e9af2b779bbbb26ecd4c554868
26561 F20101202_AAAMMB sandhu_s_Page_017.QC.jpg
ad87a8c1a6a874f5ec0b7b68e63434a8
9b011f9561fe1d595df57cf9c805337908c45bc5
738940 F20101202_AAAMOZ sandhu_s_Page_046.jp2
505f6304e2ceb5d2c4e6016e32778ba2
3152ea3407b41486133aa4ce2ac4edd84c372531
695292 F20101202_AAAMYT sandhu_s_Page_079.jp2
07f65e9f9ed78b8369f77354e0b991ff
fb6a25d9db986685474d9722d0a8e378c92bb2e5
F20101202_AAANAU sandhu_s_Page_038.tif
bfc8f867175ee64b60ceac936c8f9721
fec6b743f27da0b347faa6896df99ec822bb6949
27231 F20101202_AAAMTW sandhu_s_Page_075.QC.jpg
008b5bda555c824d2a9a0b14ab1664d8
9ba021f4c0587f465f7cbc421cbf14d29baefa33
6654 F20101202_AAANFS sandhu_s_Page_062thm.jpg
671701ef7d4c80ccadc74a48ef776daf
2c4e28ec89a77ca1428b89ec252f632a4d46e2a0
923040 F20101202_AAAMMC sandhu_s_Page_100.jp2
9d8c9b1118466c19c41648cbcfd57cc8
8cf8b1e95ad3afc01dcb802a17c3b7c4a8d752d4
1051739 F20101202_AAAMYU sandhu_s_Page_080.jp2
572e7edd82980de7f187a2e2b18ead63
c9c73eb9c8c0d1d0818fd9e68bcb91e10f271b43
F20101202_AAANAV sandhu_s_Page_039.tif
ea357f391c84a57a1650b2cce445469f
db94a050f8ac65156a76e58e39b326acc5a5814f
127441 F20101202_AAAMTX UFE0022475_00001.xml FULL
24833f784ebf05af9a614a63dab7227a
07efa10833430be27ff258a026678e3e4110a0f6
5796 F20101202_AAANFT sandhu_s_Page_063thm.jpg
d499802b99b6ed64689a842f1319dd33
9e841d758b9452fc188a4e594a584e8eba08110c
17149 F20101202_AAAMMD sandhu_s_Page_008.QC.jpg
1a4d4b56211b2f6b39eb45feeb5fe9ab
158efbf6bb604e01869aab0bf74badb0b69c3e13
1051930 F20101202_AAAMYV sandhu_s_Page_082.jp2
08f4d87b49f691f15662e3ba148ea578
004bf09336a32d470769c5dc55458497263e1975
F20101202_AAANAW sandhu_s_Page_040.tif
d06063225e22f934bb1bf445f2b068c5
c1c94571b4836f40d660295f1826285f546c03a0
F20101202_AAAMRA sandhu_s_Page_059.tif
8ebd87511986f2ee777d15914bbac625
a49bafb1c187eb0fe7b361d1aab1b02401b8016d
27276 F20101202_AAANFU sandhu_s_Page_064.QC.jpg
2580e225e69c9f57891924db6902d8de
4d24115b9985de3d3fe95935cea4454e45e71d92
1051928 F20101202_AAAMME sandhu_s_Page_034.jp2
efacf88bf9e576f56ce58801a27cafbf
59a68ade6c8a07a61320d914064b0ce0faf92c45
824262 F20101202_AAAMYW sandhu_s_Page_083.jp2
89b1adff330900d7bae49c79dd98d7af
2e301286a4c9f9286ad3e48cb29c9348d4cfcfdf
F20101202_AAANAX sandhu_s_Page_042.tif
94b05bb95c7ae53facfe6e2c43ec854c
c519940efa420ef61400ed11a77fc6a6e037a19e
6880 F20101202_AAAMRB sandhu_s_Page_104thm.jpg
35a778913035a9cd684ecdde7ac283b8
f422a67262906539c9b20edc1a2a624102929c58
6300 F20101202_AAANFV sandhu_s_Page_064thm.jpg
9442a744cf1015c08377e6ef39ba4b2d
f7c88cec4e73af60a063f9ebc6be4c99a9da5fcf
F20101202_AAAMMF sandhu_s_Page_107.tif
88e2100ff331a1c64465c94ab8081a59
ba220f9bcbff66e3e7e67a11b16281b7c51ee775
1051894 F20101202_AAAMYX sandhu_s_Page_084.jp2
36012ab1ca4b3fc8df6171a640de5148
d59596f0e2e2e7a14a8c48d340409135cf6918cf
F20101202_AAANAY sandhu_s_Page_043.tif
a1ae5d1f20625ce2892cf032dd19a0a5
ad68514f64da64991eb23ca5ee41d9adf4227806
F20101202_AAAMRC sandhu_s_Page_077.tif
d6d2635fd8c238ef61a0a72b7876e73f
1b22e66d3cbbde7608e9d42a719450d29a197577
27046 F20101202_AAANFW sandhu_s_Page_065.QC.jpg
2256487abbd413c832749240adb74f5e
dd2946ac304fe792d735ea9e62e0bf758615b194
88103 F20101202_AAAMWA sandhu_s_Page_085.jpg
7ae74223db4c7365b321cd3b2ea85c8e
b329fb79cbb96c2292656d31493002e69a1ba2c4
1051914 F20101202_AAAMYY sandhu_s_Page_085.jp2
0d3bc00ee94ed607573557daad34e865
209a36371b7116f9b3ab10e948e54d96b683d550
F20101202_AAANAZ sandhu_s_Page_044.tif
4eea34c6e7e69e97bec6d8abcd33ee27
b3e19ee800d386737d530a36ee75da057f80d44c
3737 F20101202_AAAMRD sandhu_s_Page_002.jpg
f3b121dab7d1e94fd7d69cbe431ecdd5
5ee49aee269cd89a9d79b0e318d6a0b4ea842093
7002 F20101202_AAAMMG sandhu_s_Page_108thm.jpg
9064a948ade646be22411825b8ef6cfb
1f09ed28efbf3d6dfe8f2917c6661251296b1d12
6333 F20101202_AAANFX sandhu_s_Page_065thm.jpg
c03df356064b597cf0cf2225885c8b5f
af810c0b57b24b6b685462892f5457f3fcd7ede0
92418 F20101202_AAAMWB sandhu_s_Page_088.jpg
6afa4b8da75713336db762d9c9fd542c
1e5dbc8015b359bdcf3c6108fe5b7bbdeda20d39
965146 F20101202_AAAMYZ sandhu_s_Page_086.jp2
e73360cf13ac7770883b2f6a89fb98b8
a00988662ddf2ef77185937908e0a5c89520b7c2
90738 F20101202_AAAMRE sandhu_s_Page_032.jpg
b6d7d7524e40f5737d54edb74b9bda0c
23dd20037933f5df1425646cd01d6f96f53ce59a
26353 F20101202_AAANFY sandhu_s_Page_066.QC.jpg
3bbf68f54de97bc29e17811df0d5b071
720a8ac8de959aea9da30caedb9f9c33e55cc37d
109936 F20101202_AAAMWC sandhu_s_Page_089.jpg
8bc5f4428f59effd21f2600646605cb3
7a11020d2d491c4f3880817119d3f3cc1b2a85e7
97793 F20101202_AAAMRF sandhu_s_Page_018.jpg
c643e9b2f7ef608157d0f5fd18061bee
0a15ecf2035929b6911c2a36b1e989613ae31def
27337 F20101202_AAAMMH sandhu_s_Page_013.QC.jpg
8ffca8080da1b732bd6e3900a54e0dad
d947a19834e4fb5409407a31b09362c0e9af5c33
6180 F20101202_AAANFZ sandhu_s_Page_066thm.jpg
122b57a717ebaba568357d353bc0ee80
3e6534d88e36ea7cb0d89c150f44a3c9f902f179
465 F20101202_AAANDA sandhu_s_Page_002thm.jpg
6fe185997cf17691696bffd284bb7904
4b4e99fa1dfa52c3b5b088df2dafaf19d4868e60
124949 F20101202_AAAMWD sandhu_s_Page_091.jpg
f333a654381603f479303af697388f44
c32a6f150e034b33a9657065e221e324a8470d57
92088 F20101202_AAAMRG sandhu_s_Page_024.jpg
a322e03ca270b49e3a4470aa41a309dd
b9eafb4f4490a224f092fa942d42bdaf98ebb9a3
4226 F20101202_AAAMMI sandhu_s_Page_081thm.jpg
dea6678a48afa510d45a70bc917fa0bc
301b8106bff698b3b4e4d1588a55745469585d1a
575 F20101202_AAANDB sandhu_s_Page_003thm.jpg
ecd92c57e90bee24c22a72a6c596ee35
f9967198c3b1d5cfc8693c5fde67560dccb0d77d
125567 F20101202_AAAMWE sandhu_s_Page_093.jpg
1c553c1b582bc3595fd4c94339673708
91178f47142f74c7d4fb632355b80f3d4ab0c99c
F20101202_AAAMRH sandhu_s_Page_013.jp2
e462b8050af3a9e25b26997b81aaa314
790b1c2d727b3da222476ff4fb6341b12b7db9ce
F20101202_AAAMMJ sandhu_s_Page_101.tif
fead830639ba91295e7c248e35ecdf82
b1ca2c583dcc41530046acf6380a74fb3c910ff7
6869 F20101202_AAANIA sandhu_s_Page_110thm.jpg
6d00fe306f342495596eb38e8e91fd56
73fdc9934863bde24ac234fde438171a38a40d26
23285 F20101202_AAANDC sandhu_s_Page_004.QC.jpg
5bc3835c276878e625e297318df554ea
c60b6a8d2201f965c28e178060b74a9c4696b003
124891 F20101202_AAAMWF sandhu_s_Page_095.jpg
dbef81c11bfe3597d0db9c07f7458b13
22f274bd24bb7acb9232e0eb9e6abde085a828c9
6747 F20101202_AAAMRI sandhu_s_Page_074thm.jpg
e80639ecb6155f894ad17a18d560764f
83ec6e7e5856e7830dae69b08330a5d0f5b2f4be
F20101202_AAAMMK sandhu_s_Page_057.tif
4ecac875b48c2523e22f7836bcf4d623
7061d452bbd453df51fb4661e38832aa28a8d220
29096 F20101202_AAANIB sandhu_s_Page_111.QC.jpg
68abdd4fc42d7aef768ad63b2e3a307c
8e8505c75bef8c6473c2974c07ee92598bbc5335
5483 F20101202_AAANDD sandhu_s_Page_004thm.jpg
2e413f48de9040dc4d977b610a5c5e38
287016c26316567ea59b8d0ea32305fb52d45646
113182 F20101202_AAAMWG sandhu_s_Page_097.jpg
751fe29fb4d0e2b759f97106517c795d
2a8c84f339126aad4cfca815feabcb14564621ce
115543 F20101202_AAAMRJ sandhu_s_Page_094.jpg
3421e04d08b70eedaaad8d6c1af2b577
8e42d59251e3503debef8b8349d60e21eb06a72a
F20101202_AAAMML sandhu_s_Page_048.tif
0e447b226d956a80fa6fe11613290880
16ad284a173b8124ff658fa833c17b833ee01334
22845 F20101202_AAANDE sandhu_s_Page_005.QC.jpg
963796d8f975d21afcb1fbee468df4c4
cc0d45097960c7bcc152f5dd924d3965e00c5c52
88738 F20101202_AAAMWH sandhu_s_Page_099.jpg
3542c8d57b3b30da3bf2fc08e9d55f59
b4967a200e80309637568b7cc7eb1788e2837cab
1271 F20101202_AAAMRK sandhu_s_Page_103thm.jpg
fd4090d9ac5d177695d2e75db8fc7aa2
3cebabe8705dd25a3b3056073bfcae102c73854b
1051985 F20101202_AAAMMM sandhu_s_Page_096.jp2
0f1c137d6feb9d102cd161fd44223394
3c2d295c225381bd251c488bf9f68facfcaf86ff
6669 F20101202_AAANIC sandhu_s_Page_111thm.jpg
e4ba62eb43874b0d643013d443fab339
b52a24013e95361a962eff55f8600f3198240a26
5527 F20101202_AAANDF sandhu_s_Page_005thm.jpg
1512994cc691eb58777b83de9ccff5f6
912e2a1240e4b9bb9621ea8e28ddcefaa59a5e5a
73120 F20101202_AAAMWI sandhu_s_Page_100.jpg
b0b8b6ec15e484afd4b2088f1a34aa33
855873ac741d95b57f27a954124151b5b504360b
F20101202_AAAMRL sandhu_s_Page_115.tif
3d93b3ea78da36aa27212fb814b42846
63c1d6de4b3779d9c6be7f2ea2ce626a782c4b41
10969 F20101202_AAAMMN sandhu_s_Page_076.jpg
5572216cf8af0d8558ea2ab4241a9595
21de8f82ab66a37aec10172cf71318fc61a1a934
29044 F20101202_AAANID sandhu_s_Page_112.QC.jpg
e83b72aaff1dc4aa7a2097f91aa9bb0a
62b8d97289afd16c931e929ae511fb9dd1f39c8c
5734 F20101202_AAANDG sandhu_s_Page_006thm.jpg
061cf5d2ee8ffc268a25e73a8e4bf28e
f88530c79c313d5ceec7df8902a3ffef40f4c4ee
70175 F20101202_AAAMWJ sandhu_s_Page_101.jpg
3eb294d2bf7d0aaaffa4fb9f1297b1c5
248189e3eaa74c83db9d18acbe9178287416ee0a
97926 F20101202_AAAMMO sandhu_s_Page_098.jpg
a6317246a73631a3018058dddee67a70
7a628f86960950ceed75971fc95b7f586f471226
6902 F20101202_AAANIE sandhu_s_Page_112thm.jpg
650ca4b1b4157b630ca3979756ed2e1d
a374e41558adc636c1a5f2f429b16ff59d5ca010
10471 F20101202_AAANDH sandhu_s_Page_007.QC.jpg
b2e97483c2629601edb57d9c2e08c56a
0765521c2929f0421fe755bc8eeb080bd48d5dd5
56049 F20101202_AAAMWK sandhu_s_Page_102.jpg
b0d6e649ca6ce26d765c6ee8687a1bb5
5f12630185b953b6288ff694afffd3cc633e2a34
F20101202_AAAMRM sandhu_s_Page_010.tif
5d63b76396d15e1d55f79f7fbb006f5c
ce6a916a292e82f34826dd994cdd01cb613f91ac
10561 F20101202_AAAMMP sandhu_s_Page_079.QC.jpg
0a30bb1c13169064fdae47e025bca996
48158b6d5d962577829a6e29fd1b39044a4bc43d
29131 F20101202_AAANIF sandhu_s_Page_113.QC.jpg
188a9b7365486d34d68fe3f18f7bd6c5
5096a0310e9bccabc38d0ed9f94cd96768e88488
4285 F20101202_AAANDI sandhu_s_Page_008thm.jpg
8279940fe80957835f3ac82ad06b3192
08d7230d0b6781614a0640df2c313d1ff2f1b8ea
12441 F20101202_AAAMWL sandhu_s_Page_103.jpg
568f4df9d387a6266843aa036e0aa72c
f9bca7ffaf29caaeb498f8c4a0fb6d044be65a34
F20101202_AAAMRN sandhu_s_Page_111.jp2
90ecdc1fa0b0b7e9ca8fb916318967ca
0fb1ac8f9a97cf644514e9f533b815365b9705b2
31811 F20101202_AAAMMQ sandhu_s_Page_095.QC.jpg
6ca3c426a7adfd969a8898fbedea3c49
a0f90007f142ddbb527af1aef4a39efef54c257c
7129 F20101202_AAANIG sandhu_s_Page_113thm.jpg
43921bcf55bb58147e41bb2ebf693466
b5d9e1090a46a326eb5341dd64af6bc4d1a3965d
21423 F20101202_AAANDJ sandhu_s_Page_009.QC.jpg
2db5b249234f04781eb0a7a1db7f0d61
7f91927f631d908bde4c278532655832d5bd2d0d
108576 F20101202_AAAMWM sandhu_s_Page_104.jpg
739c9f38622f364fffe0b6465149e127
a696e8d57bf124039a703f210a0f902428faf21e
3514 F20101202_AAAMRO sandhu_s_Page_053thm.jpg
e158a5aec6a202914fccfcc5b4ec085f
958dad53c388378d3f733485b24a97dbff176e32
29001 F20101202_AAAMMR sandhu_s_Page_074.QC.jpg
d19a5779fe23acf27398cac78763804e
032d46458ec100587b14fd93c5947b1ef409bf91
30472 F20101202_AAANIH sandhu_s_Page_115.QC.jpg
6d237d12559c1891db283e452efb98c3
8c50c4c0efae5232e3aff02eb0dc068266ec363f
5387 F20101202_AAANDK sandhu_s_Page_010thm.jpg
ba1e353f9fdb2d99be4e0860c1858f94
46ad6b5babb7712b67b8131e49b79378ca85f5de
108157 F20101202_AAAMWN sandhu_s_Page_108.jpg
5d2d69d49bb620497b174448b6d9f16e
ef19bdb7a8cf89d5944ede70622f002630f1f1f6
126365 F20101202_AAAMRP sandhu_s_Page_087.jpg
c7b525bc7a2016b40a30e98cea58d40d
4a61126d4248ed5593c1dbc76d320f9c5a8cc7d9
16483 F20101202_AAAMMS sandhu_s_Page_015.QC.jpg
01cc4167402cfdadff531808870c3207
11bdf2d46e24f1e067ea72c98d7f9ceae42c0006
6898 F20101202_AAANII sandhu_s_Page_115thm.jpg
907299b71b934eb50a5ec8de9b64f6ae
a6b3866840e25da698d58ceffd925ace117382f4
4434 F20101202_AAANDL sandhu_s_Page_011thm.jpg
14c3519b919688a570e0d73006d127b7
85d7af73bd5a669051880a3b1ad06bca37e014b5
105553 F20101202_AAAMWO sandhu_s_Page_111.jpg
42ee091f14e0b47b47c67a1e2cf35695
c3d4cf3d279f99af0d9261071a3fa63e24c85367
28742 F20101202_AAAMRQ sandhu_s_Page_067.QC.jpg
9b9a5c6d7581fb388208c4c235f44cb4
7dbbe44a2d793ebabe4e8337d1803e8459d24921
8346 F20101202_AAAMMT sandhu_s_Page_051.QC.jpg
929d64eae63411d045594731b397dbe9
9273ba54bf2fdc55fa969e4a4cd329d5b3a0eef5
3637 F20101202_AAANIJ sandhu_s_Page_116thm.jpg
449ad4ec155e2b06bb1b0dd345944e37
0cb987a17614a3fc82915c41e4c4b4cef6556eae
26668 F20101202_AAANDM sandhu_s_Page_012.QC.jpg
ced7b81554404965125d33781b29e440
69a3b1aba6662e77fd88fa4dea07f62c348f8a44
84223 F20101202_AAAMRR sandhu_s_Page_017.jpg
7ffbb56d9fef40ac742ced5f40c55c99
09cdb29a95263b8107447428ba8f5e3616e21f55
F20101202_AAAMMU sandhu_s_Page_091.tif
e0b1f0419047e072ccd4eb42b8672b92
57145b004e33698dce6510cc7c5f31c188709a64
102263 F20101202_AAAMWP sandhu_s_Page_112.jpg
84c04cd0fa2a58868a78b2a9ced04321
c6f47eb6d0bcabd250fc18760a4f01234f53740b
3544 F20101202_AAANIK sandhu_s_Page_117thm.jpg
7336c8eda27a068da2178c6abcfb81f9
9f10958f64ec876850396cc762fe86a66a57552b
6463 F20101202_AAANDN sandhu_s_Page_013thm.jpg
77085f73792eadb8eac17e1f685e1a06
19338859aa906cb0b8fd7c48105e8ec6e9eb6c41
25265604 F20101202_AAAMRS sandhu_s_Page_079.tif
cf090f22b7cc24a6a844088501eda3cd
fbf24dcbd1785589177e09c2cf5301c32ddb032b
22292 F20101202_AAAMMV sandhu_s_Page_086.QC.jpg
0fd9264c3ed4c2a90c06f59425cd1375
dcfef44310b1c45159f4c959bb45fa374ac31cb3
104869 F20101202_AAAMWQ sandhu_s_Page_113.jpg
3354d422596ea4a25989e439bc301940
1dbb319104491cf42262483689804538b9c0d7f7
87492 F20101202_AAANIL UFE0022475_00001.mets
8ce85fcfd6ae6ac741795c1f55b320e9
b845fbc5d07ef3a9a4e952e9f7894a80b4aa816b
27791 F20101202_AAANDO sandhu_s_Page_014.QC.jpg
89762917d5e9378979d44fb198eaacf1
73dcac78b3d482035cb6214e4a90e0801c87ed73
F20101202_AAAMRT sandhu_s_Page_009.jp2
629c45aea5e53b824e912a31d4bed36d
9d3ef283dbe45e4b4473ac3716da8252f8a5b071
29445 F20101202_AAAMMW sandhu_s_Page_031.QC.jpg
828a562d5d0da0646eb22efbbf135ffb
97555a939587cd79a15767b45ce63de0910f17bb
6593 F20101202_AAANDP sandhu_s_Page_014thm.jpg
c6701002f4f2f2136457e9e7f066de0c
5cd865b395413f75cc0b8f8bc7ee588e52fa6222
6553 F20101202_AAAMRU sandhu_s_Page_070thm.jpg
fc184ac20da25d7cfebdbd91472483ac
2a9038350f656a3197b7878da76b5ec6955c3455
15002 F20101202_AAAMMX sandhu_s_Page_117.QC.jpg
047c31baec3a24d0bdd2905b43c90c1f
1e02a192a6e9406b44a64debbde99d9e5e1066db
101640 F20101202_AAAMWR sandhu_s_Page_114.jpg
5518a76c2dc63e76f6750d793386f377
0deb76947eecc421e57797f871dba6da54cd59f4
3944 F20101202_AAANDQ sandhu_s_Page_015thm.jpg
8c86b9158d42deae11bc756a88c00168
adfbc7c53379f0bd352f115d120fba2d3af030e5
6413 F20101202_AAAMRV sandhu_s_Page_075thm.jpg
bdbb7db1b6a68829b1b0623f61ba54b0
240b72c8494d91a793901196bbe7989395dcc6e5
17697 F20101202_AAAMMY sandhu_s_Page_054.QC.jpg
1073a054f00f0c5c6fc7985798a067d4
f8c0c49b239f12111893f34a162dfc765df692dc
110543 F20101202_AAAMWS sandhu_s_Page_115.jpg
3061a453010d00375d9d9bc12edc71d0
f30ea585f17fa12621635c93be354b5bad0b9c40
6377 F20101202_AAANDR sandhu_s_Page_016thm.jpg
9c482b12701629f175189addb5f17b43
3316cb9ace094f1237a663f3da8e3516071c2376
F20101202_AAAMRW sandhu_s_Page_092.tif
d7dd94f65a4ee236e176bf0eedd3ee56
cd35ef15c12b5a0ad8f554033d893d47f468c7fc
29503 F20101202_AAAMMZ sandhu_s_Page_110.QC.jpg
9f28dd5b0ff3079539913222ea7c77c2
69a2579d43e9689f089b2c1279d29dc4fef34fe5
255867 F20101202_AAAMWT sandhu_s_Page_001.jp2
dd63ac9c495f426f28ebd66df83e66a0
f21be65fe9e672dc846d83fbb3f24c3e72601b12
6316 F20101202_AAANDS sandhu_s_Page_017thm.jpg
e14fca79563b46c6499ae88d0ab2aac3
435791b6f87819e8aa5c699fd3d65d0f4921ee31
60426 F20101202_AAAMRX sandhu_s_Page_011.jpg
f3b0763dd505518b3f8d9428fb541c2b
53016ac03dd2768a93713467c897ecc82fb088f4
62047 F20101202_AAAMWU sandhu_s_Page_003.jp2
663cb169d4c5115560e1380c8256bcfc
fdd323a46d358a655e1d7e4a15004472d7ba7215
30884 F20101202_AAANDT sandhu_s_Page_018.QC.jpg
22dc0bf41f90f8d9769bfcc9db5dc391
45e632144835f985b6332a54c4adedb3e8b19a3f
109881 F20101202_AAAMPA sandhu_s_Page_106.jpg
0dfd988ba0ddb5bf2dd816a8a8e7e9f0
3942d79a61a0996fa73ebf3160f1ef709f51a88d
27187 F20101202_AAAMRY sandhu_s_Page_085.QC.jpg
6b6874716908286d5c63ea8839acd925
c1b8f4732367b9369be471883231b897f6b6a08d
1051986 F20101202_AAAMWV sandhu_s_Page_005.jp2
a82e807c873b8a513f1ed9813d9db601
f4400610a94b4ffa29d3203014f87246f58d3bf8
6974 F20101202_AAANDU sandhu_s_Page_018thm.jpg
4bbb2e2c66b063f7d3fb5ea80f0d61c3
bfc04f3f8a7ee01010b7c742b6e061f562e99f2e
1051977 F20101202_AAAMPB sandhu_s_Page_058.jp2
2f6bd268328975ab93fd67a478090ef9
48b601d3f1e3f01ca02b54f87f51e769faa5be02
6653 F20101202_AAAMRZ sandhu_s_Page_033thm.jpg
71e512ec46737c88f4c8682d02162f87
8b533e5be9edb60e3eefaef31334a7556a093e05
F20101202_AAAMWW sandhu_s_Page_007.jp2
7d44fbc019c1988fecc3fd77b27da03b
3d40345fa1c8e221ba4f5e3cfebc7a501727112e
27430 F20101202_AAANDV sandhu_s_Page_020.QC.jpg
d001f8520e3b0922862d4228b28f5194
c381215510d037a355bbb13c1960fc22ff19151b
989770 F20101202_AAAMWX sandhu_s_Page_010.jp2
5ee5749a452adb38a7279b1768cea3cb
96f16b105f4d3a12e88406cd9ec8f1181face50d
5642 F20101202_AAAMPC sandhu_s_Page_049thm.jpg
f3d479376e3de06ff0c281ca0af80be2
5d927a1f31287c0c8d65a1a85a09905d7027346a
6412 F20101202_AAANDW sandhu_s_Page_020thm.jpg
22c599b39bdd10347bd17b0efb482d1b
2b0bc90c575299a2d7513f4340eadc4b2ad1ad67
22757 F20101202_AAAMUA sandhu_s_Page_001.jpg
4e6d662f65fb689c6a14915d19bef805
f6a3bc33dcedd2559b8115c7859243faf48c2973
807740 F20101202_AAAMWY sandhu_s_Page_011.jp2
53431910581ef30efd48d20aea60d073
dfcbde44995b1e128a70ab075ebad812887abf4a
6559 F20101202_AAAMPD sandhu_s_Page_067thm.jpg
e80018ee5ab7b0fcaad106328a90271c
2ffecfa595531ec1fdd43f97fed34ca8e1d49dea
25909 F20101202_AAANDX sandhu_s_Page_021.QC.jpg
3f5fd138009d7b36f81e85c38259c0cb
e65468cee1b193191a384da1d697ee9ba827eb32
101653 F20101202_AAAMUB sandhu_s_Page_005.jpg
134ca2590a594412e16d369c65bb1a67
8cd34e7b77865f28cd900aacb1aa767462826c6d
1051949 F20101202_AAAMWZ sandhu_s_Page_012.jp2
858963dce4a7f6b97b4a55ea12e2c078
e461531f77da56609e8b683a75de06be4db4c7f4
6730 F20101202_AAAMPE sandhu_s_Page_072thm.jpg
72bfa6446f074c5390ad647efee1a9eb
f8671e1d51bf6d577e072350673049b139d85c92
28017 F20101202_AAANDY sandhu_s_Page_022.QC.jpg
8775ffec182d6040f7d08895a18cf638
b921e8a37d8452aaef4e8d0d5f63bfef091675c1
116269 F20101202_AAAMUC sandhu_s_Page_006.jpg
f0e10ee342bdd7e83a7b4243fae6a4b6
1255044cdaae0582fe2375c4803d85b6843f17d2
104453 F20101202_AAAMPF sandhu_s_Page_105.jpg
9add78b1e33cb18571acf3f69068c3c9
e2bd332cb71150198aa2f6d158efa757ee574af9
6712 F20101202_AAANDZ sandhu_s_Page_022thm.jpg
1e7f7d268510e832f4aa9b16dac622c7
01e071adf62f3650fce7c1fc223cf2f4f3facc52
1051931 F20101202_AAAMZA sandhu_s_Page_088.jp2
34d546192b1243012a8e6d6ba72b45c1
f1966e95ed2452e38d99014b087f7fe93beca22d
F20101202_AAANBA sandhu_s_Page_045.tif
2af3f3b1f8341aabba6263de377c38c7
23221dbc642f40d688782696a61efaba1bf11c77
43846 F20101202_AAAMUD sandhu_s_Page_007.jpg
dc8fd37d7e7cd9120a7a1975cf2955a2
36c94ca624809b30b3d2b6bfd222828f4a52075b
F20101202_AAAMPG sandhu_s_Page_114.tif
1e49f0173cfb9627da4dea118e555803
d7459f0bcc392bd558d953683926de928e1762a1
1051954 F20101202_AAAMZB sandhu_s_Page_089.jp2
91f461c5ec03142b5b8006e40849d01e
74170940c5b88cbcaf555cb3f3904853be85189a
F20101202_AAANBB sandhu_s_Page_046.tif
5970d469bba61e4cab3e7595e4e1b748
4ac29e5d78b02b5057941ea5efde4576d09505d3
66612 F20101202_AAAMUE sandhu_s_Page_008.jpg
41709ec7518e6b2a839522b4fabd15c5
c6be4a7f28e3dfd8e410971e91dca92b1ca046ca
585306 F20101202_AAAMPH sandhu_s_Page_078.jp2
d8b74960d89ef75896187182d16ab03c
3097a4d4769d5f16a70a3b8454ee62a23b417188
1051984 F20101202_AAAMZC sandhu_s_Page_090.jp2
19f62f65096e922ab1ec106a410e4e85
9a3594cdfb60590e957c404eee981992e2955cda
F20101202_AAANBC sandhu_s_Page_049.tif
313a55d7f347e5036d14168282a814c5
c752f2e7efdf7316b0dddd7cbb11c84394ae4759
82944 F20101202_AAAMUF sandhu_s_Page_009.jpg
79a08d7ec2edbaf63969868c8f27345c
58600f40af008ae3111d9dec2c0a0f9b61333237
2573 F20101202_AAAMPI sandhu_s_Page_007thm.jpg
b824eaf049fd15094f7fba7c6c7fa83d
05f31eb8a34ec936546471c471c93ce2ff6a5867
6833 F20101202_AAANGA sandhu_s_Page_068thm.jpg
241c472a0802dbc2462957748b52cf96
5bd80c6142a493c737ce38d1f60c46b8e84e5ac7
F20101202_AAAMZD sandhu_s_Page_091.jp2
8b6ee8a0dd9055ecec6e9645dc36cdad
7d3a8412adc76b28217ebbd3a5b9da04c8ebc5a4
F20101202_AAANBD sandhu_s_Page_050.tif
91b9c836ec2a4e4e45569548bec70d40
56cfedacf8e95da17078ee2d8806943838dbe10b
75232 F20101202_AAAMUG sandhu_s_Page_010.jpg
7be8ae7cb176464af526a370c2406e38
823b5ceb09f614e39c2aeb35f580121b8257f538
26776 F20101202_AAAMPJ sandhu_s_Page_045.QC.jpg
541a47b887a2be8ac17597b40ae163ce
a8849ca9d6ea6a5620a51fb81350dee0e91ddba1
30527 F20101202_AAANGB sandhu_s_Page_069.QC.jpg
42db03ade0b5cc9cb7d76bc19276762c
d250859c3bcc60a42c7678797e7549816385f4d5
1051982 F20101202_AAAMZE sandhu_s_Page_093.jp2
44f566fdd24eb9e97ded1d765368329f
af0dc82c5515829cebfc1aaf603a6347c7a83f7f
F20101202_AAANBE sandhu_s_Page_051.tif
5389f358b0401fe8713ee6022a9e4d09
4c34d90aba18abc19e3656b0ab48eea1f60379e0
89846 F20101202_AAAMUH sandhu_s_Page_013.jpg
6f5227e2a55105b1dc70ac1d49bb0277
02008bf6f8bf20ffba366ea7acc4c6e30a1f2e63
6834 F20101202_AAANGC sandhu_s_Page_069thm.jpg
d94a16c2ab9200eae38771f2aaceb59e
2cd719fc3465d7ebbcce5327bf6a404181d97069
1051970 F20101202_AAAMZF sandhu_s_Page_094.jp2
7482b44dd38b1dd14c6071852a30d8dd
3052544079f1c6e6c311305052d6937d67bc65b5
F20101202_AAANBF sandhu_s_Page_052.tif
aa50cce4fa0d8a1061303ed6c5588c30
6d189843b8147a43eb82e875641b9bd0cab46453
88759 F20101202_AAAMUI sandhu_s_Page_016.jpg
26c4e1b23190df46652baa9152080689
68c941e4e2767e7436876772c8eaa649d1147a8b
28519 F20101202_AAAMPK sandhu_s_Page_114.QC.jpg
7cbf016fa8f97e43e740cbee244b15d8
ce8720df1a3c150f0efbd3b6fccf14c8f3e02b38
28548 F20101202_AAANGD sandhu_s_Page_070.QC.jpg
da0cdcb6a1be74ecdc8471ce12994f2b
57e6595aab2e11dd61f7538a76b0628b6c9704c6
F20101202_AAANBG sandhu_s_Page_053.tif
31de5e9949439dc12ada227bd9d25ac1
70e84e8d23771597385c490a4db3e0661f343be6
1051921 F20101202_AAAMZG sandhu_s_Page_095.jp2
18acf07eea95fea409aa6964e8e6be7c
5e200579f957b386ebe2645433b0e0a7b058c1b1
86658 F20101202_AAAMUJ sandhu_s_Page_019.jpg
b77cd1691518d73d03fab6b16cecae20
777e1fdee1a14b35dc461372ef9af77225f01d67
5612 F20101202_AAAMPL sandhu_s_Page_082thm.jpg
cc95eebb79ef06e17f48d0febaa10300
c7aca3d8c786cd5db9cf2bb3bb0aed721a625de2
27864 F20101202_AAANGE sandhu_s_Page_071.QC.jpg
d5e162b46ad33f3559683a77902c061a
7680f5b6aadc1483f402044a8b5eae2b0a1dd75d
F20101202_AAANBH sandhu_s_Page_054.tif
220f1bd5e7da1277db2092e5c6c46d2f
83b705b58846d0c10cad5a20a41273b83200d79a
1051956 F20101202_AAAMZH sandhu_s_Page_097.jp2
6949ef6968b84504af75aa17a06f5ac5
b2c1c95ee42043628d22eda8fa831c6f04e93e02
89249 F20101202_AAAMUK sandhu_s_Page_020.jpg
ad33bfbc4a42965dc08ed5922bb3fc07
b88903807a45d3a3b043e629646fd0ae44121648
5287 F20101202_AAAMPM sandhu_s_Page_009thm.jpg
5b2e3e8ffbf29859282cc16ee10da1fa
26637e02579e2f337b49cf4d007ce9c2d7fdad03
28826 F20101202_AAANGF sandhu_s_Page_073.QC.jpg
a6b3aa3b8dccbda622187e56a8555e9d
a6fd5b9f2b3fc1a9e0bf9864f3adf06f8e188597
F20101202_AAANBI sandhu_s_Page_055.tif
314beeedf473c2caf12df875601f56fd
9c1a5ee219ac39585958b50ce456b3ad0414d8b8
F20101202_AAAMZI sandhu_s_Page_098.jp2
b7d211886901904c6ee32ce6ab5c5e93
9848c4cfde47efb66cec03e26ebd35dcd8f33360
87707 F20101202_AAAMUL sandhu_s_Page_023.jpg
4f07e739ecfd27f7f17d34d9bd06cb38
de8ac69c135264a17bbfe1159e139a4fcdb5f51b
682864 F20101202_AAAMPN sandhu_s_Page_054.jp2
2c62b79e3ac190a090eb9d644548de0c
d82802710e639532093e844d6157ff1777eb994e
6790 F20101202_AAANGG sandhu_s_Page_073thm.jpg
3a3f44ec911bc95ed55811bca2459434
0cc64728461ca46b4e7d061fcd428c7e5350954c
F20101202_AAANBJ sandhu_s_Page_060.tif
9628c6b4753437b86720abe77c1ba2cf
720288bed6a5f7db520e23cc16eb49440a135631
1051971 F20101202_AAAMZJ sandhu_s_Page_099.jp2
f01fe7df3078f51a9bf2593eefae52a4
f424901a256821e5d7b0b633490f33901b284e28
94027 F20101202_AAAMUM sandhu_s_Page_025.jpg
08c941e20612a7d455373dbff4fc4dc2
10190b5cee613b5943959980ecb448b771c73222
F20101202_AAAMPO sandhu_s_Page_013.tif
8418e44a71b642c8979dbae2cf17b578
29596ea85a918fac6cc516bd4e89ca29d4ab6281
1011 F20101202_AAANGH sandhu_s_Page_076thm.jpg
2e246262ea7923a09ceace4da037f916
f43ca48abd267c9a055203fe650ab71af2811c1e
F20101202_AAANBK sandhu_s_Page_062.tif
39824c8e88b9c07c8124d281f68b0333
30b31a8051be9c20fc2cf1eaf80fe48068df96b5
903599 F20101202_AAAMZK sandhu_s_Page_101.jp2
e6498e4984a1c53da6e1e2b413379096
b4dd4c73e6bbd211a635ea35ef1a6a0dc489409b
85533 F20101202_AAAMUN sandhu_s_Page_026.jpg
5954274f2dac0f4fce62a77eb7243872
811ac109240e961f0141cb6f70fc4c5e831926a0
23332 F20101202_AAAMPP sandhu_s_Page_052.QC.jpg
6a09044e423fd91b84c7f27654f4939e
a2499c0889d6eafe03e868087990716c74c6f675
15255 F20101202_AAANGI sandhu_s_Page_078.QC.jpg
bc47a4b2819116b90c8f602b6d6f861f
12f838f78dd70cc701921dfb48d07715eaa5682c
F20101202_AAANBL sandhu_s_Page_063.tif
e9554a731cd3758cd9a6d5a9e2275cbc
ea3082b4aaceefedfcddd8eb766e834a8a57e4eb
42142 F20101202_AAAMUO sandhu_s_Page_027.jpg
b45359ee5aae1271696579f1415007dc
eb029363049f0127a5824af0a732ea54b251931b
114680 F20101202_AAAMPQ sandhu_s_Page_107.jpg
56f56ef2d9d4496f3b1f5c5b945d7ab4
450f86fd5733ef04f049aaefb860cd7bb337199d
711380 F20101202_AAAMZL sandhu_s_Page_102.jp2
8ef9c367b2fec413c3b5e1f867d1f0d8
a49655c9a0f226fb85888f48d04a7de8fc2ca7ed
3922 F20101202_AAANGJ sandhu_s_Page_078thm.jpg
cf18d1f63d9335e17471203a7704de7d
e09b48814475e3bec84529c2dc741813e9d786f8
F20101202_AAANBM sandhu_s_Page_064.tif
abf32261d04c6942c84959d035b4fe10
5854cd3cc374feea1572fb486ff2dd64954ba156
89453 F20101202_AAAMPR sandhu_s_Page_075.jpg
7a4b65a45b11c4fec83f3f08751b2c08
6938e022dc41048c7005a5db6b4f9da869cf7b6d
128610 F20101202_AAAMZM sandhu_s_Page_103.jp2
f2a98e1bdd03ad342a5fb3077be24256
d386e92cd3c1e3fa99bab7b733ace58ae5efa004
2581 F20101202_AAANGK sandhu_s_Page_079thm.jpg
ff71e3b52bdcedf5559cc177913bc486
8421436368a369a2ff954dd58c7d30668a3c722f
F20101202_AAANBN sandhu_s_Page_065.tif
45c55f7c75dd35ad0fe8bbe8a6f43ede
4cf81ae6d8e9632252f4a5d6a380f4075333dc70
26105 F20101202_AAAMUP sandhu_s_Page_028.jpg
f2cf890045953f695d2b62e15b6a6b38
1066cc7c41f060776656699ec882f24e29a583e9
91816 F20101202_AAAMPS sandhu_s_Page_060.jpg
2066db7c58a4d204641941ffd4da1c8e
0ba9ffb06aa03ae8ebe2d48eb88604de969703c3
F20101202_AAAMZN sandhu_s_Page_104.jp2
bf82707916fac4cc6ebdad7af375d7b2
a2e0d0021abca099e2ec10ce16d633b12f50ef0f
18950 F20101202_AAANGL sandhu_s_Page_080.QC.jpg
43f2625d8c2726d85e36c1d536e9e74e
212a51ee00a5366a0c2aa8cdd4370c3fe66af0f5
F20101202_AAANBO sandhu_s_Page_066.tif
549693ca87cd3da4323bbeaabfffadfa
0ab6ffb235d19932c4c01f0a7f5d589e0889762f
29709 F20101202_AAAMUQ sandhu_s_Page_030.jpg
24d11354dfcd2c0413de02eb9f370041
f5e3cc0116fc5ce09f6f7ebb3ce50c5ecd1f3910
7176 F20101202_AAAMPT sandhu_s_Page_105thm.jpg
ff06bc658a16b1620a4a3aa12c0798c1
10efbcfdad9bc139b0ccca3912e2f3e37db2e874
1051983 F20101202_AAAMZO sandhu_s_Page_105.jp2
1eedce3a37fd0f3576906b3d052ec79b
517c301057d79577aea6e4b156e9503225f0cb6a
4882 F20101202_AAANGM sandhu_s_Page_080thm.jpg
93be824c618deea66e8b5801f7623757
d2da208de49c0bdf697beb7aff58c111f4592a1a
F20101202_AAANBP sandhu_s_Page_068.tif
0b09a968f251e53dc9ac3b3597451635
8d274ee59a645dd26b99e21a12957c78efe3faea
94662 F20101202_AAAMUR sandhu_s_Page_031.jpg
0ed857a500dfe72777ec0a460bcb2da1
9466a7914c63254262cc0a3bcf78627e5644a5ff
72141 F20101202_AAAMPU sandhu_s_Page_086.jpg
779d7bdb94b2d28c3c1f1145963fdf99
4a7a869162123e4ddb80192ab59c758d9d166e43
F20101202_AAAMZP sandhu_s_Page_106.jp2
798ecbd567ed194ba12d1a3c067597e0
0b2be6c45783df21a8eb279ae02ad5a7e37d6dce
16229 F20101202_AAANGN sandhu_s_Page_081.QC.jpg
16167df8306b4789ce9d17fbc4e53c60
757eb45f02d03df6d5c48e8d227003acbc0ba0cf
F20101202_AAANBQ sandhu_s_Page_069.tif
494b01bdfeffbf3763d7700546098838
71b3aaf0f27df1084bf55fd5c609ddbfb38ec41a
83376 F20101202_AAAMUS sandhu_s_Page_034.jpg
c5f86cc6af25640b84a5f532c3fc075f
9ad667ede7537679809d7616f79256236a05c338
92993 F20101202_AAAMPV sandhu_s_Page_029.jpg
f9484c3af162f2599f6454d6ff603565
fb182828d2c2abe01bc59ea9966242836333ca09
F20101202_AAAMZQ sandhu_s_Page_108.jp2
8c6f8726f62b119739cba33b8d18e809
104eb25730cfb1ed43bf7fe91acb5ff3b9e1c832
20647 F20101202_AAANGO sandhu_s_Page_082.QC.jpg
2941150a8bba374f8e9cd9b7c32b6fc5
0b0fa3ad62a25b57c2593806cca9d06d15bba782
F20101202_AAANBR sandhu_s_Page_070.tif
4dc3252fa307462b331556f4bb4a29e5
080fd317fe8d913e6a464c722df78f8b15da6c48
90816 F20101202_AAAMUT sandhu_s_Page_036.jpg
a66444a99bb5772dd22b53cf5c4703c4
315970c687054bb756bc9ed146038ff645f20fd6
1051966 F20101202_AAAMPW sandhu_s_Page_112.jp2
e01994adb749295fd2eeac7a486d0df9
647d9dc99f00e08648ffb2f4b60fbdbb8674ee9d
1051960 F20101202_AAAMZR sandhu_s_Page_109.jp2
e286d7ef2c460f7924c62ab8dd279e35
cfebad02bf899abe4254b42efca69d7675ccf644
16588 F20101202_AAANGP sandhu_s_Page_083.QC.jpg
6a1fa03de5d2eb38e4f1c13dec37ab27
dc6b07f194695afca8504c3e63be3dfc3018c421
F20101202_AAANBS sandhu_s_Page_071.tif
5623d239abc0198c64a996b459cee87e
411ba34c794d9e376c7bac3e494fd8e253256475
94358 F20101202_AAAMUU sandhu_s_Page_038.jpg
2872e429f212a646db196d0f94df7292
91830815a044fd852764f671f6c55f0791a30816
6481 F20101202_AAAMPX sandhu_s_Page_042thm.jpg
24fcd56c60f194eb178bb311fc657f0f
ada7af88ad27eb0600ead1764fceb5e37f1fa386
1051981 F20101202_AAAMZS sandhu_s_Page_110.jp2
c6d4848324dbff5b0211276cf9b581bb
94ec05be9b807312b3fb5acd667253849cb4d38e
4507 F20101202_AAANGQ sandhu_s_Page_083thm.jpg
e96e698383c59b999dc9951bb4bd5f7b
17ede8494a0f430a00fddbbcc5aa37406ffa729c
F20101202_AAANBT sandhu_s_Page_072.tif
ea0029ae53e563893caeafc7406c2356
d4b6031a4f36534f192024b25f1782070f1ac9e2
88769 F20101202_AAAMUV sandhu_s_Page_039.jpg
22dc097622fc0345b1300d72459115be
67686f2d24551fd2b7f9b0327b620563926b0a6e
25646 F20101202_AAAMNA sandhu_s_Page_058.QC.jpg
6355f6560aef09c23d1b5f2c390b783e
0477d2360c1e059f46519870e93b86be8cee1d8c
93633 F20101202_AAAMPY sandhu_s_Page_056.jpg
b744f71cc07e13ca9b9be2d93238cd97
7a4087e0da4422fb2ce79d553b7c967a2b4206ac
F20101202_AAAMZT sandhu_s_Page_113.jp2
2990a22081ab5a51051b1be1d262b65f
2b42de079347d435ecdd5d4f92058a08b3b62a85
26047 F20101202_AAANGR sandhu_s_Page_084.QC.jpg
ab492e42888c674ed2462be4d4e3244d
fc382c6739b38ef32287db1a92bf52c5c12305b2
F20101202_AAANBU sandhu_s_Page_073.tif
f088699f20b9fbd937823aac2b42f2ad
eda0baf09fb8032ab7417c6553d6462a352ecf16
89868 F20101202_AAAMUW sandhu_s_Page_041.jpg
f63a7757f1b88409735335e69d025fbc
8d246aa8afd807837e7cf8b60f15219778af6cbe
24438 F20101202_AAAMNB sandhu_s_Page_099.QC.jpg
86a0476109f46611ea9d207e3aac366d
a11cd0fed5b8cba8c5d34a2dc6e7b2d5cdf38744
F20101202_AAAMPZ sandhu_s_Page_112.tif
0867a8f417c26fbc7be5b779aae0554b
8717b94930e770b405e460f2e353de995132931a
6130 F20101202_AAANGS sandhu_s_Page_084thm.jpg
2b8a4dea660c8279c8df757516cd451c
08feabc701417a9c5a1ddc9bf9b26eea59d34aaa
F20101202_AAANBV sandhu_s_Page_074.tif
5ba50515ab0ff4b9e2c767f732f6e8f0
527477de59eecbac301ae508aa10fdc36b968d14
89114 F20101202_AAAMUX sandhu_s_Page_042.jpg
d1d894c3182a13ff564994f0f1174c47
1f6c923c0d34241e8263d5ddd60ed4ae15965984
97615 F20101202_AAAMNC sandhu_s_Page_052.jpg
c21c2f0964e32d17a597bc392e21d584
abacd1168db2fa7c1b51276a7e05f36d16533fc1
F20101202_AAAMZU sandhu_s_Page_115.jp2
ff53bcb57b12508f6589210f1fede8ce
f93a65b7b7a78d88cee1799cca55762692eaf024
6459 F20101202_AAANGT sandhu_s_Page_085thm.jpg
b5ed7ab67119d9c949e61ad6fde7820d
64f3ece4f9694083100c06a8af82e7308a4a3cfd
F20101202_AAANBW sandhu_s_Page_075.tif
503b75426839e615599477690e1f2998
a7b54dacd6f2170040fca546769af258a14d5ca7
93158 F20101202_AAAMUY sandhu_s_Page_043.jpg
ddcff4358c48a8cd8885a68a85e4e418
0476ac980dbcf9107eafa00f7f5e1db85f6bc431
554315 F20101202_AAAMND sandhu_s_Page_027.jp2
8a4d98e7c1c9d2c467ac4286ec409cdf
6959652910feb693d49b4105bf609908cd111994
710616 F20101202_AAAMZV sandhu_s_Page_116.jp2
87376ddf17f9f1722109b4be2eb0de29
938d474000e412d5661032d102682fa25d14a7d1
112447 F20101202_AAAMSA sandhu_s_Page_092.jpg
0aec1cd5cfb8b838dc241e3a3641eb78
8487c011228ef3bef9f1b87956c91652bb8c669c
5196 F20101202_AAANGU sandhu_s_Page_086thm.jpg
0b9691a66b7cefd92668ba2260a42a8c
c230b06d1bc0962520e4a596f6528d985f560ffe
F20101202_AAANBX sandhu_s_Page_078.tif
22b2977380c11cf352602046abde0382
ab60261a735183b7297b44ad7815b676ec1caeec
89124 F20101202_AAAMUZ sandhu_s_Page_044.jpg
d3be525042607a8b70711e0561aa0bb2
e07ad52a7803d5d850c6da5c9f0031fce895d4d8
6425 F20101202_AAAMNE sandhu_s_Page_024thm.jpg
3f25119e65c15ac209ee9224457433d1
6c12f627a51852330db91e368e2e002a3377566e
F20101202_AAAMZW sandhu_s_Page_001.tif
347cd96b82efb176065d8a401c37a1b7
bcf1d336d3281b83657fbbd53afe02a33e926583
66376 F20101202_AAAMSB sandhu_s_Page_047.jpg
c6b5b22c1a7d37f980dd8adf36af4882
7afc2c6a76cfdb06bfdd8334b6d5de5a252c16ee
33501 F20101202_AAANGV sandhu_s_Page_087.QC.jpg
ddcfc82587d9d9e803720e8499b6b3d2
51a7ed6f9d52119f935e5f672b71c8616ba1cde5
F20101202_AAANBY sandhu_s_Page_080.tif
90678a6631747771c0aed58ecabd7792
2e7c7cf4fea9ede4741c4edc9218a910f78c6e68
90931 F20101202_AAAMNF sandhu_s_Page_022.jpg
5b8e0276cb5b757675a59211768427c6
a7afb4be0d58a0bb51e690b0cff3dbeafdad267d
F20101202_AAAMZX sandhu_s_Page_002.tif
f1c9023cd65732a16486d89caa3854d9
600373281d2ccb4ca564e29fa4292e2a6ca9f856
51708 F20101202_AAAMSC sandhu_s_Page_015.jpg
d32c4eede446641a69541c6a5920e07d
8e1ef302027b7c0dc701fcaa0bf3b1afed563c32
7203 F20101202_AAANGW sandhu_s_Page_087thm.jpg
a2990fb59cdf718fd01e8829fd1c326a
0bf82af68293c2a0a1ff419da8ee1237cfb00882
F20101202_AAANBZ sandhu_s_Page_081.tif
b0035b0d9d814ce321fe1bbc6f3a0a1a
c18f62ef7f93542c53035e6f40776bfd8750062f
F20101202_AAAMNG sandhu_s_Page_094.tif
fdc880b9c41ecfab068dcf32451bfb78
5ffe356dcb013ff493a27e589b38c81541115275
F20101202_AAAMXA sandhu_s_Page_014.jp2
2c199f7a7acd1c830f3aef89a4a017d6
ec3a68f45e640b6e32c7f2c4fa758372fba2bea4
F20101202_AAAMZY sandhu_s_Page_003.tif
092f2709028a1712c3c994a9d4102f38
0fca6059a095355b7fa1a75a9edcdadde131e9be
15181 F20101202_AAAMSD sandhu_s_Page_116.QC.jpg
d15abe4db985f567e71a200c08c5c132
0a2a93dc66d747159100fcace3350892cd2e8256
25213 F20101202_AAANGX sandhu_s_Page_088.QC.jpg
77acdb290c517c1b0a32218c14dfe35d
1c3afa0d33ce4bf9759660848591ece2cd854fdd
F20101202_AAAMNH sandhu_s_Page_028.tif
b240ac109c31af035b256a5260a59c0b
6d08adf31167406515b9160d02b0979223f7a6fb
691035 F20101202_AAAMXB sandhu_s_Page_015.jp2
c069bcdfbd9846dd01bce5e84d8086bf
a9419c2b5ea8f2bf872a76acd94745d41a99f18b
F20101202_AAAMZZ sandhu_s_Page_005.tif
0447a69c5623c2eb786850aaf0d236fc
f27a542a83ba39a5a3c0a9ec54d3894658e92032
F20101202_AAAMSE sandhu_s_Page_035.tif
b9c250524191180a25b7f79a8fdc9a82
287e5807a6f96ff2c370afe4e593d56e10950547
5519 F20101202_AAANGY sandhu_s_Page_088thm.jpg
a789d9b0d58f61d69830a44f03299678
71a6ac59d54635e785ec2ffa7ce79a2646179b4f
F20101202_AAAMXC sandhu_s_Page_016.jp2
f60eae05c8d100b5d0af5a88c94a6388
3b78329cdcbec5c389903e3a474b845f03554702
F20101202_AAAMSF sandhu_s_Page_058.tif
85619ede05c5fe35dab1a800d8c1dbb7
6e4f98f27f350133ee8b40d5e04e5d41ebf7bee3
28612 F20101202_AAANGZ sandhu_s_Page_089.QC.jpg
13ba8f1c84ba37ba906e02b43f576669
02af9b7e761e1c96f0f7faf3f39e0a4916474c88
27435 F20101202_AAANEA sandhu_s_Page_023.QC.jpg
74f9c87f4393b570cf666fdc1d9b7b31
1a4a9a714357bac7a7a5ee58047c082a5441541b
8181 F20101202_AAAMNI sandhu_s_Page_030.QC.jpg
1830019b17fd8518f5840d422baefd55
4652c4354f9cbadbd50503ae74925a8714f9c4fb
1051952 F20101202_AAAMXD sandhu_s_Page_017.jp2
04a4904f67723bc912ac0c173d799365
3267a144f425462394da5bbeef32771d91df9671
29198 F20101202_AAAMSG sandhu_s_Page_040.QC.jpg
fe05b6a3ca27e98b0254e9ff81144b50
cf52a27a068dd761faa490939da69d4bd5e01f20
28302 F20101202_AAANEB sandhu_s_Page_024.QC.jpg
7bdb765d6a59d5fe8c540435015e5b3a
0a065aa34e2f2d8029574ffce23a869db64bfb5f
6702 F20101202_AAAMNJ sandhu_s_Page_041thm.jpg
9f3fe58e1eb0b2df71b03cc32a9de11e
0d60dc33072b2b01c2f7608e44f901c541f128da
1051968 F20101202_AAAMXE sandhu_s_Page_018.jp2
9c65916c29d80dabc704c44ecf6db6c8
2a8b41c51c46c74522317472b48c4596ccd26d8f
6845 F20101202_AAAMSH sandhu_s_Page_038thm.jpg
6d465cad30f712c4b0aacae5c3f98504
73f959339174609d614d47a236845d219c0ea5c1
6867 F20101202_AAANEC sandhu_s_Page_025thm.jpg
d7514773eb16f0c7c76ccd1a58b70ac8
e8eb23320270816555774818b6197e6bbbd8eca9
27750 F20101202_AAAMNK sandhu_s_Page_019.QC.jpg
e42fb8a970cd03e84644a19d4e61ad0d
5797710373945c8a4cda318f31021fe88a29f53c
1051980 F20101202_AAAMXF sandhu_s_Page_019.jp2
bc47a727f1b6bbf1ae00b90698cd6473
cb3bae77357a972e4f93c5c57c4fc1cf848a6b8c
F20101202_AAAMSI sandhu_s_Page_033.tif
378b20d6f20dc36305d9c1c468a75780
3edb853ffec6717dd8754bff600b68c0368c07d2
25853 F20101202_AAANED sandhu_s_Page_026.QC.jpg
5a04054fadbcfe4601a797ff9eac26d2
95a7e5e0204ecdb91b9755b08bc13e967e056f23
F20101202_AAAMNL sandhu_s_Page_107.jp2
01b9d3b8000c6a4710b3f089222d66b8
38037b5611141e8e1275e20228c1d6df85bd43e1
1051969 F20101202_AAAMXG sandhu_s_Page_020.jp2
d2386b44eaa031f92c90014ecd22a0ed
3287e5fc669433246f7e4f84173b80c9fa0de9e1
6538 F20101202_AAAMSJ sandhu_s_Page_061thm.jpg
ff32fe087b6987a524c81e849a0a6beb
d4dd2d64ebc8f60a408f73bdbf50f889965f99f6
12931 F20101202_AAANEE sandhu_s_Page_027.QC.jpg
65ad6cba2f1ec1175baf755af62cdcf1
011cf1aed886476dae8dfb50b0744d893528510d
6297 F20101202_AAAMNM sandhu_s_Page_021thm.jpg
24ec01be5c4454d8e8212cc246e888c6
5ea245a3ccf6aa3a195ba9fb64166748ee4563b3
F20101202_AAAMXH sandhu_s_Page_021.jp2
284d16a957158052ed38da1dd6689a26
2e5c6e3b58dcc1cacdbcbd2206669f6732e99e8a
14859 F20101202_AAAMSK sandhu_s_Page_050.jpg
3802256157b29b7ca5ed9eea05937ef1
ef7be3ce03ba56e2c7b15c3f1e6f23bc55df720e
8431 F20101202_AAANEF sandhu_s_Page_028.QC.jpg
faf8ba8295de07bdc39a8cf73d293214
bd0544f9602c8e9bef3bcb8e028bad7c53996b22
F20101202_AAAMNN sandhu_s_Page_066.jp2
e180635bed8d6dce23c6838ba6932e2a
229c73299c6a733ed0931ec47268f8f9351338a4
1051958 F20101202_AAAMXI sandhu_s_Page_022.jp2
d0cf580710063cf3b49c6e60e98ff29a
0e574e6fe7958686b62db4dd450748a0cd7bd261
F20101202_AAAMSL sandhu_s_Page_067.tif
d4d32436a94ebec594f7842da434483a
0c87a7f3abeeb6553926cadd94d33c790327cf1b
2390 F20101202_AAANEG sandhu_s_Page_028thm.jpg
5f894cfcaf6055aadccae5ff9823aa26
6ff7bd932a543a1eb64d83be44fb7c80cb59fc98
159369 F20101202_AAAMNO sandhu_s_Page_050.jp2
0888f2f98f7bf39929f8622b10e0fa28
7f756623e1cf5f0816066e4b020061daf9da7d40
F20101202_AAAMXJ sandhu_s_Page_024.jp2
96eb1621cecd1f4eb05279a50fee97c3
f8ec9a66bf787e870807f02e631644330f9d3e75
F20101202_AAAMSM sandhu_s_Page_015.tif
f2a175b577b89f28989cef35b83bb397
97830e386e89e637c75c6d8e0cefd19c7493f38f
28273 F20101202_AAANEH sandhu_s_Page_032.QC.jpg
c4120a1957490c6a33738a00ec9bc87a
d863a11c309fb891cb10998ffdf2c00d01349aa4
28368 F20101202_AAAMNP sandhu_s_Page_057.QC.jpg
f2b5f2bb982f670dc9213c72738f7df7
38c579224ff5cc6431cc7fb15a1d1276db03cae7
F20101202_AAAMXK sandhu_s_Page_025.jp2
a6d8e0dc1ef3ae5a5e95d81ef03b478f
f3196ebba480fa0c5a888427be07838377da7a07
6624 F20101202_AAANEI sandhu_s_Page_032thm.jpg
5b01a5e6c6adfd27c64b6ae43a228b7f
14bc968ab93ab06936db6e8d5e8454da1ecd8e54
4712 F20101202_AAAMNQ sandhu_s_Page_054thm.jpg
21d43794559a3a3c6c54c8874618ef0e
4759bbef37cf70c8912ba6bfc3d1f1e9eda49899
300298 F20101202_AAAMXL sandhu_s_Page_028.jp2
02fd8f35a0d6502bed2ad753dfa76535
8780c5269909dfa4ad3ea09ff75847a8b155718a
F20101202_AAAMSN sandhu_s_Page_014.tif
2a5ced2f56cb24ffb1f2dfe5222fb65c
1892c1fe49ebeca8bfbc62776b68c0aa857602aa
28603 F20101202_AAANEJ sandhu_s_Page_033.QC.jpg
c99f1b6646e77f978e8f7a81f9b29d66
30859c067a932e6096ddc6bb2816d7250db2c351
4701 F20101202_AAAMNR sandhu_s_Page_047thm.jpg
8e23ede02e88c87f5aa2d146bcbf8753
aa8514b21af3403b0215c624eeb52df2e1736977
1051857 F20101202_AAAMXM sandhu_s_Page_029.jp2
1e57ebccc4d258ad572743ebb2c32d81
57da800fcf9857135d2c3208779328940a5251a8
F20101202_AAAMSO sandhu_s_Page_110.tif
89a20cd34ac62c78f1a389206772488c
6c8e074184e803599ee9ef28a58028386fe5520e
26084 F20101202_AAANEK sandhu_s_Page_034.QC.jpg
7d86de6715c99131dacce6090a8a7e3c
b23979f3b8c4ca51de0d8b75594a4f4941d03736
6454 F20101202_AAAMNS sandhu_s_Page_023thm.jpg
831c6092ff0639752fcb58d521dad264
51f09b4b5a4ab3c91b1aff71b7e263c98b9f943f
390593 F20101202_AAAMXN sandhu_s_Page_030.jp2
68cf1a1e6f13211b39f2280646acfefd
43081918dc2a1c5f9b62854976993d68f8925f4d
F20101202_AAAMSP sandhu_s_Page_076.tif
a7b7b18b68df0fc9f2391810be711ed2
b3d5619cec3adf7c10166e81c88023f9668b139e
6090 F20101202_AAANEL sandhu_s_Page_034thm.jpg
248e834acd1690254f03d15200458a88
b6d6296874bb87e2af54bb1b1fe6f4a5672361da
6358 F20101202_AAAMNT sandhu_s_Page_039thm.jpg
6e34a549a75805039f4b977e138e2948
f6d434aa3b06c898717ad67f791bba9e37c8bfb1
1051978 F20101202_AAAMXO sandhu_s_Page_032.jp2
18e99c55bde082d8b5a50d2edb4598db
adf03487d3fd6b85d907a1a057363a1f53b15ac2
90431 F20101202_AAAMSQ sandhu_s_Page_033.jpg
210ef00a4eae2df7c404945c911185b7
58546e193b20500746b774bb315b4981ef9bc1e5
7170 F20101202_AAANEM sandhu_s_Page_035thm.jpg
1867477649e0de6affa4c6f6a987c172
60fb2e507343d71deedddb546c8c9aa02538d2cf
6815 F20101202_AAAMNU sandhu_s_Page_094thm.jpg
66c43bec39451b12c868f2ee1ba3cfb8
459e08ae34d0fd833f81ea02c91f6ce20b9e7b7b
F20101202_AAAMXP sandhu_s_Page_035.jp2
8ca6ccdeb648dce78feaae4c1239148e
7fa30e50a64891f911f28f6fbea46aaa4838f562
F20101202_AAAMSR sandhu_s_Page_047.tif
780fe8bf6340c12374c2672ab89b09c0
85dd60a34df726804bb043945c61570dd8438de7
29492 F20101202_AAANEN sandhu_s_Page_036.QC.jpg
440ac34d456bbcd8445cc678cce7942a
706c48138861b75044243d570a802f5eb32d2958
91113 F20101202_AAAMNV sandhu_s_Page_014.jpg
20aab1967c7f97f1536c977ea2b71ad9
5751c5f27d2c4471d9115a88fb534003c5c4ad0e
1051927 F20101202_AAAMXQ sandhu_s_Page_036.jp2
6e06e4a6250fe3b126a18f511ef4e312
659644886403fbf2c543e43dc527492be31df675
F20101202_AAAMSS sandhu_s_Page_004.tif
9b8e955410e1f2eab3ab7f84a912248c
cc854dda9d9663468eacf6f0606d14ac83cc35bc
6475 F20101202_AAANEO sandhu_s_Page_036thm.jpg
2634100cadc2b75693b32436b705c9af
82d567113a55a55f6bb7727826ee21cd6fe0fa5e
F20101202_AAAMNW sandhu_s_Page_006.tif
94bb6ee9e5978b21513b3e3f50ab03b6
1f65138a8bf9bde7c9f699e95520bf5d30880300
F20101202_AAAMXR sandhu_s_Page_037.jp2
2d040b8580300f88361fb71d33b38136
5fd74391b03a261bd6f76b387f1bd2a0f03f9836
F20101202_AAAMST sandhu_s_Page_049.jp2
9211c563b81f345b8f69e4a70a84670e
d359f8a27e514612cabdbd20704bdcafa2f579ae
28397 F20101202_AAANEP sandhu_s_Page_037.QC.jpg
d6329facb39a49ad3cea1ac0137139a2
1d2fcdcd31ca327f41816d6aae351c5f5a14e5ba
1770 F20101202_AAAMNX sandhu_s_Page_003.QC.jpg
4aed99492cc4f0e56c4131c8e0e96b30
5448e5f377b61cd170676e7ccc0e8209d54da18c
28238 F20101202_AAAMSU sandhu_s_Page_072.QC.jpg
36e42360387def29814e09729e393ed7
86e9b4ccac6af48e6fcdbf7762a19689a81d88cc
6607 F20101202_AAANEQ sandhu_s_Page_037thm.jpg
0f0b74fc4d943527ad1b562ec8a5d712
c27541655227fd7cde7e069b638fbb5e4da9cbbf
84386 F20101202_AAAMNY sandhu_s_Page_058.jpg
68cca1ed0004a7b5b500d0766e1f469c
4433ce8c8f685b8e3fdcb8624243064ecd4d1713
F20101202_AAAMXS sandhu_s_Page_038.jp2
a62c642e094491b869c6c3681f766789
9a9cc14048bb62eaef5164b4b32dd8b78b0a0dcd
4041 F20101202_AAAMSV sandhu_s_Page_077thm.jpg
73be57a71fda4033cf16a1f0bd4841f0
e1c8625604e7a93f7db9586b9f35699938469103
29484 F20101202_AAANER sandhu_s_Page_038.QC.jpg
75975e510911962903eee3b3de714633
3b49ad565b7d40ed77fd3bda95f94f094e425b03
1051965 F20101202_AAAMNZ sandhu_s_Page_026.jp2
c5db8fa689678dda7e58b384386037f9
d14c089ea1a7a83dc937fca661c2caea58ddac96
F20101202_AAAMXT sandhu_s_Page_039.jp2
230fa37467b203e5b99e62d16e92ba13
44e6f2a264be95236ed80236839255670a74a728
F20101202_AAAMSW sandhu_s_Page_102.tif
4928edd0eb0e4610fb24dba6742c1972
2a69f13c08456095879a8fd2d0107deb8c4c0245
29153 F20101202_AAANES sandhu_s_Page_039.QC.jpg
6ef689b4e45972323f77f9649ae187fe
cb2051561cad56b46238df9984b8dd4c3ac3f8b6
1051953 F20101202_AAAMXU sandhu_s_Page_040.jp2
c98af4cfec3fd4a67b76a2f2f70d3f12
10a1fa915c1f71ab30af78c0797331337f266f91
1051937 F20101202_AAAMSX sandhu_s_Page_031.jp2
bba1e744361ff78694036403d1c84cf4
dee5f597a1cea60756d109d3a294afb5e8d809d0
6758 F20101202_AAANET sandhu_s_Page_040thm.jpg
c1fe9c0633bf6cef850c90d55862147c
c19b65069be9b89ec8667c1ebf22205d13c3cf76
F20101202_AAAMXV sandhu_s_Page_041.jp2
230f170937b263ba9b6723abe09d023c
307bb7ef1198af9e8bb61b5634faa4da74b7509e
29298 F20101202_AAAMQA sandhu_s_Page_025.QC.jpg
dda1356121e25c02e7ddbc7818c10de5
c35aaf825ca05f96e657259579fa50a1b113ea5c
3562 F20101202_AAAMSY sandhu_s_Page_103.QC.jpg
d62faf929f9c34b2c2b8bafbc93bb817
a8ed0e7c12795551d51d816ddf1a559d4d4c8004
28457 F20101202_AAANEU sandhu_s_Page_041.QC.jpg
8d26e3d3794d77016db93ef1b140d10d
494e5c408cca295e35015648cff739ced6521bd2
F20101202_AAAMXW sandhu_s_Page_042.jp2
49f83d8f53dbd84c6aef5ee4e0d3df1b
9c4abcb2aeedcfa93e3311d38c915eefbcca6fe2
73757 F20101202_AAAMQB sandhu_s_Page_004.jpg
b6d3216928f7adf07480926fba0b7b66
a3fdc0b7a6190805fc0dc4caecb0874557e6dd93
608012 F20101202_AAAMSZ sandhu_s_Page_117.jp2
2a9d56363fdc0e7825d6df2e0fe8ca4d
355b915f1aacfcc043917303da6068a43b8e7e10
28944 F20101202_AAANEV sandhu_s_Page_043.QC.jpg
1f5881fe746d7cf45404ff5630f5f043
f74a0d0ccfd44b5e1131f7ed929a9ba7d500027a
F20101202_AAAMXX sandhu_s_Page_044.jp2
3dae980dceedb434690c44d7067de968
80cf51813271328376512372931d7e7087096917
6910 F20101202_AAAMQC sandhu_s_Page_114thm.jpg
38d0183c96d2880d4c3601ac22ca789f
b2c4fd89e3064dff47e585234792f8e90a34ce33
6883 F20101202_AAANEW sandhu_s_Page_043thm.jpg
9e3e50a4af704aa6fcb54c48c9855d4a
3f02f2e73f55f4479f7d8cc9ea7e8797d4175cc4
1051979 F20101202_AAAMXY sandhu_s_Page_045.jp2
b6f7b05fb7c52b73b175b1c766e3d371
487107ab64fc5495512b910f4e6b97a562e1ad9d
32904 F20101202_AAAMQD sandhu_s_Page_091.QC.jpg
88c0918bd82223ffbbb9952939e8e69b
f55f6124ede0808d9b75bd5b4c743d507160bf46
85547 F20101202_AAAMVA sandhu_s_Page_045.jpg
8383be501d7547c8bb5355d343b2e64f
3e73e58937479479eb5c3da656fe44ff33735db9
27857 F20101202_AAANEX sandhu_s_Page_044.QC.jpg
8e1ad30543df5d59b5360577b3c5b810
e6b1a27101624495a93f3d7168a30af33c141686
807828 F20101202_AAAMXZ sandhu_s_Page_047.jp2
88eb55a4e7c882547910155ea475d912
a649be5b2453fbcf3e7952a07e5c8120c04a5e80
68625 F20101202_AAAMQE sandhu_s_Page_080.jpg
751e19ff12539c29a58ee0b9c2b37ec4
6438e05ffcf3eb75657858c376d9e095e3b8357e
54929 F20101202_AAAMVB sandhu_s_Page_046.jpg
0d509f858d7aa9d1b6d3b2a7388b4df5
753934d7852d460edb352deac866a77fc37683d2
6672 F20101202_AAANEY sandhu_s_Page_044thm.jpg
96840c6667e69529efe9963316f3a6fb
acec28aed17e3b69e437b985034a7df463c57b80
F20101202_AAAMQF sandhu_s_Page_114.jp2
d6b5b43fb623ab8df4fb1c698d3bfc27
5a9b758e4dd79ce7bcccf51fff0b9614ad51e5fa
21835 F20101202_AAAMVC sandhu_s_Page_048.jpg
236860ed4018a504640324b78dc118ed
63a94682f8e3dd480acaaa0b5a3c70c37212f4b0
4243 F20101202_AAANEZ sandhu_s_Page_046thm.jpg
7794aa04a52d25dfe22f008b76d9b522
436bfbeeae95778dad1d47d5b5e0f3359df6e783
F20101202_AAANCA sandhu_s_Page_082.tif
710144dde29da28715e45981c76278ee
54c69b69b16a19cfce2ec2242b3e0777bebf7223
6749 F20101202_AAAMQG sandhu_s_Page_056thm.jpg
1586cb8d9bd88371612d3d7053cd39ef
205aa8ced629fa9064247ebfd000b05097ad8f5e
28728 F20101202_AAAMVD sandhu_s_Page_051.jpg
7f3717190fde1a4cfab2eb9ddfd20dd9
a05ed45223bc57ea61bb2dfbe1ac127091f3aa75
F20101202_AAANCB sandhu_s_Page_083.tif
06503660beec124b18c5eac0946ea6b9
d1ee87eacbf9921910087dfd40986f3f0d145f52
3160 F20101202_AAAMQH sandhu_s_Page_027thm.jpg
facb530952a374acdff8c9885535611b
70ce9b5415b942c49e9733d08349077c60c3ddd5
40173 F20101202_AAAMVE sandhu_s_Page_053.jpg
3351a34f2924598d67c8f7778362fdb4
7fd04c0ff472af785206c7f96d9b129effe4c6e0
6568 F20101202_AAANHA sandhu_s_Page_089thm.jpg
7616b414bc373c013fd32abac8eb328e
1ba15dea4433d395d648e04f133a8af18844fbd3
F20101202_AAANCC sandhu_s_Page_084.tif
36be27200e54548387391aa571783827
01f0bbb3e3e26267d574fa0f47ffc78f1d3cda28
27631 F20101202_AAAMQI sandhu_s_Page_002.jp2
0ecdafd65ab9077e4203bf1a38365026
bf48766866d7a2f4ea6f1cc50a4b117397a37d83
56406 F20101202_AAAMVF sandhu_s_Page_054.jpg
d3cd6b3d8ed0d9265dfa0e9f4c48bfd1
806b078c68b3d78cccf4239088b5b93a64334d1c
F20101202_AAANCD sandhu_s_Page_085.tif
08f495bb6fa548f4136ae26f0cb47be9
52019063e661c58f15de7362d86dec7e66293f5b
6978 F20101202_AAAMQJ sandhu_s_Page_003.jpg
b0840cdb4e6d98d0707c04ec9fb0e223
5611eb907e65f46106334bb24dac7a3b23b64af5
64452 F20101202_AAAMVG sandhu_s_Page_055.jpg
3c42af7b1ddd28b3152a6b00d971c9c5
8612fdd8201b04d5646b70f985a874c9f7cbdb2b
29901 F20101202_AAANHB sandhu_s_Page_090.QC.jpg
63527ebc1bf9d013e96b6e3ec5ca38c1
281de7418f8ba2a7abd4fa118f94516afca619ac
F20101202_AAANCE sandhu_s_Page_086.tif
5e12f5ab5978cb5d5992f35dc97c1c1d
03c1122462081978243148c075e28c0c7461da1a
F20101202_AAAMQK sandhu_s_Page_008.tif
ef990febdb46a9a5985b945b237d2d38
a6e6212bdb3b22734a6295747ee25238fa335e7a
91609 F20101202_AAAMVH sandhu_s_Page_057.jpg
2acc6225f09eb5447049af655106fb18
89cd0ad05a296c0d3a94345f3535595bcf38e856
6576 F20101202_AAANHC sandhu_s_Page_090thm.jpg
177894af459b8ce7eed75e8799cc52ed
0724606399671de3927ba89233118e1a91ac31f7
F20101202_AAANCF sandhu_s_Page_087.tif
9e3994ed3d70286eb7f942fc33d3654e
a1b416a0c12d465b11bdde446e3d23b9c7471741
94850 F20101202_AAAMVI sandhu_s_Page_061.jpg
d2f7842756de758f01066254a712ea8f
aae63223293715ccff4d6ad0c7e7ff2bb6c7b901
7537 F20101202_AAANHD sandhu_s_Page_091thm.jpg
101beeed34e1ebd7927a1d081a7a6416
a9c6c8b27f89cdebd18c954fd8ed93ddbf15c930
F20101202_AAANCG sandhu_s_Page_088.tif
135ff5bd35e7e2064c9b127692eb7164
b23de93ec1de6508cf5fce5f21147705652fdff4
1051674 F20101202_AAAMQL sandhu_s_Page_055.jp2
094fc0f9faf5570aa73ff1d8243af30c
1d353c168bec51053b9f506ef45a40fe875f95ac
87401 F20101202_AAAMVJ sandhu_s_Page_062.jpg
98148ab200318d950301bf2313351d59
c53ae2026c7c0c7cb7611076ae0d2bc682c5178b
29601 F20101202_AAANHE sandhu_s_Page_092.QC.jpg
1b0978a1259ef8acf5916fef70e2ecd8
5046de23e68b71e9f4c38fcc7bbe7ac238645362
F20101202_AAANCH sandhu_s_Page_090.tif
e771ca3ea33da8206fcb9f7f3f7e04b1
b5530f407d6e0365ba6be8254d23240a8180e092
6327 F20101202_AAAMQM sandhu_s_Page_045thm.jpg
1db68317326a5af10ae5aabb96677ed9
3c6fab853a3500de24a60194187f2859c88bf36e
86786 F20101202_AAAMVK sandhu_s_Page_064.jpg
c4d73a56ec0c04d84f3011b1ae90ccd8
e572aa9d92961bd77592d0687cbb555fd82b8f47
6873 F20101202_AAANHF sandhu_s_Page_092thm.jpg
15f75b4caaeb12eab8d9a572237ea4ce
d4098f4d09256cb41d50b990cd45e7c13c9c3efc
F20101202_AAANCI sandhu_s_Page_093.tif
4713e05f83be9e3e5af52810250ddb50
370cb0a0c5a0cc975b051924f793bfd146ff7d0e
22171 F20101202_AAAMQN sandhu_s_Page_010.QC.jpg
b52e7eda300a8b8963044a3afabd11df
52bc4015470a78e22455fd5838bf63c18b2c8cf8
84367 F20101202_AAAMVL sandhu_s_Page_065.jpg
ad017a27f0065fda58ed20fab178754f
39a71af1cae10dcf6dc8e8663e5b124650b94e8d
33185 F20101202_AAANHG sandhu_s_Page_093.QC.jpg
b667cc050df8bdad9c002832aef318fd
b745e05cfbf37461deda540a2487192001f7f197
F20101202_AAANCJ sandhu_s_Page_095.tif
5275ed45e084907b8fe0870cc10a6f03
f752857339c5c63c5679831d590d4db7a3692990
F20101202_AAAMQO sandhu_s_Page_026.tif
f9f14d88b57140c6e5714778ae6a26b2
0c003e14eefe8cb7cea97359e16a235038d72e8b
89930 F20101202_AAAMVM sandhu_s_Page_067.jpg
e9684341d2f8720f0a5fd1f494fd5a41
57815e14915f283275b92a57c9fd7588e0cd24c3
7240 F20101202_AAANHH sandhu_s_Page_093thm.jpg
b9d2a37ff9b5493c5af37329e3d76b0b
7dcca51f162955c91e42d854f5513a3f50526567
F20101202_AAANCK sandhu_s_Page_096.tif
9822108fc33898c73c5aaee209e4e9a3
2c0e06b39ebb4de65a6558a940587062e0dde7dd
F20101202_AAAMQP sandhu_s_Page_111.tif
73d5a548122873c241f5710ac0d8e68d
38e55c5d1a60025bbe288cd591385b26a193e4e6
94605 F20101202_AAAMVN sandhu_s_Page_068.jpg
b2b158f253f658470951878862d887ba
4846e453d35f24dc1107184ec52f95d7b80d03e7
6958 F20101202_AAANHI sandhu_s_Page_095thm.jpg
f282cbe590d65b37fdabe915dae6cd82
d152a34a080d7e41051a6b01236fee0a805def7b
F20101202_AAANCL sandhu_s_Page_098.tif
fbfc2cdd3f3c39bf148cf8e622acbddc
9c060c206fa95a2e52c0bc3d12bc59af9b5aded1
1027215 F20101202_AAAMQQ sandhu_s_Page_063.jp2
ab01fdd2c85ee6ad6ae666022f938928
6fe04db89deb376d1d3dbd8266edf721b68c437b
93636 F20101202_AAAMVO sandhu_s_Page_069.jpg
dfde6b835dce37c5718873c72590b648
71761f6da16dff1e2602ea6234a229986749eb7d
6659 F20101202_AAANHJ sandhu_s_Page_096thm.jpg
5bab3736ffca02c7ae3c63230a0cb87d
83496fae030ad16d40b9cd83feb870d6344810a3
F20101202_AAANCM sandhu_s_Page_099.tif
1c706006612e54eaf63dbc3edb688cdd
08f0a414ae5dc695c8c544991b89f3e1a0f4679d
6544 F20101202_AAAMQR sandhu_s_Page_059thm.jpg
4111769349cc9ad1c7968275d52926cf
3477f502583fd5870a6f03983508be2e1ab5e5be
30500 F20101202_AAAMLU sandhu_s_Page_107.QC.jpg
17a4e1e93fd2e350f385977d13f015ba
7dfb8e6db8c651aec247e5152750b1e5854da48f
90678 F20101202_AAAMVP sandhu_s_Page_070.jpg
1f3657c5c31afa6f41755e8982e35d0c
327c4e9ae80fce0330d18d4b40698abbbc8a5edb
29941 F20101202_AAANHK sandhu_s_Page_097.QC.jpg
343432ec08ad1d1918b1d16c3678dc42
69f4a50fb506d88dbd8982fdbcd432b090d04d99
F20101202_AAANCN sandhu_s_Page_100.tif
0b24079bc4462923dd113ad92fd6219d
d2f0854a908bba124b7c2009887136d098271f17
6738 F20101202_AAAMQS sandhu_s_Page_031thm.jpg
5e573632608a3881bae1af6053012536
b8e5ca040d1f5616fb2716e88869c52ff463087f
1051948 F20101202_AAAMLV sandhu_s_Page_023.jp2
81bfb9a908908625a80611635a31b9da
1b1422ce988a4b51ef834d2c12247b75a9b2c0f9
6558 F20101202_AAANHL sandhu_s_Page_097thm.jpg
cba23e40c20cfe3279d921ae7c3ee8e1
d3593f125e8b4651e6ea2528fcee7430a92c266f
F20101202_AAANCO sandhu_s_Page_103.tif
e25fb05b821e2c8fc3991407b504cab4
00bac7608b4238b1c62820c0cff79314aa7095ad
86246 F20101202_AAAMQT sandhu_s_Page_012.jpg
ddff42175b27cb94b17b124ea5a0cccd
d6c3f2eb43e0d67b823127c877e91b47b22b5da7
F20101202_AAAMLW sandhu_s_Page_033.jp2
702cd64e2fd29f8618ce7f62123420b9
f898953a40352b14705059d517b9a0666c6f9275
89539 F20101202_AAAMVQ sandhu_s_Page_071.jpg
0933e6967bd56a29113cbde4167d5573
d112b2382d24c0d4b0666bda7aa2dcec8e2386f8
25847 F20101202_AAANHM sandhu_s_Page_098.QC.jpg
62506f0e3e0e6321c0a843e7faf397a2
de26a91b72d29bbd10c6d98a4c5927b8d1b06a56
F20101202_AAANCP sandhu_s_Page_104.tif
95717959b0f901df4fffc211ae6d8d0a
0ea962dfe68528990fb121174dc561b7e9360227
F20101202_AAAMQU sandhu_s_Page_023.tif
b781c707a264030d0067063ca1117dc0
98cd8775601238b73169fbdf252a3c98472ee312
F20101202_AAAMLX sandhu_s_Page_097.tif
9f8ba7b7fdb6acfb51d178d36c655136
4885b9fef2517d551dedfa19ed4393dbabfd34f2
90746 F20101202_AAAMVR sandhu_s_Page_072.jpg
8ed9d400ba8bfaf030253dd34cc52174
4e3adf12c0f08418ecf105b886defd5bac070f68
19537 F20101202_AAANHN sandhu_s_Page_100.QC.jpg
de731dc76c47f14f5f83c3a7f924a6da
593edffe4140f925505652cae12788a6ad148cbf
F20101202_AAANCQ sandhu_s_Page_105.tif
0483829be1e87cb6e04e464479055c72
f880825e6646d43c4abc7126791a55bd1604d66f
5002 F20101202_AAAMQV sandhu_s_Page_050.QC.jpg
775d1a1099a67d5feb5fbccfcb921917
9e2727f5acc3a0031378389bc6b0dbeff71476e1
F20101202_AAAMLY sandhu_s_Page_057.jp2
bece6e473fb76a4020b62c0cd9cb6bdf
91bb57ced4bb8bfeb49d83d54ed195d2a68691fe
93353 F20101202_AAAMVS sandhu_s_Page_074.jpg
9723c5edbbe890df133535524208181c
3861f39d2c61cdb144fc29fb3ecdaf0fbbc1bda9
4865 F20101202_AAANHO sandhu_s_Page_100thm.jpg
b51b9a4bd7b2c4f312fd1645651c1a8c
f93e95785b46d5f83184e6d1a38f27fbe52f6e4e
F20101202_AAANCR sandhu_s_Page_106.tif
ac1bde7c9bdd629cad055fb7ebb0ee9c
a6f46e5dc3c3042de5f7cf07fd29915124c54384
31025 F20101202_AAAMLZ sandhu_s_Page_035.QC.jpg
cd4983ada4a8bb4d2b2ce7991fdee2cb
8f524118885cee17ae096bd03ab2fc58a92bd5e8
57765 F20101202_AAAMVT sandhu_s_Page_077.jpg
c7f3cfe72a2644d84decc7a5bfefcd8b
169737c381c484429d77bfc301c2e01f47c89ca6
F20101202_AAAMQW sandhu_s_Page_006.jp2
6e29124ba148469954e180188d49b152
594caf7e8fa59dc2615871252b37daa0e45ac829
19225 F20101202_AAANHP sandhu_s_Page_101.QC.jpg
f4397b615e8dedd30d10e4288cbefa0e
03790c39d372b4bd18b08c10ac177486ebe50809
F20101202_AAANCS sandhu_s_Page_108.tif
a0acbb553ceac1a518bb39b00270ea6c
df68969c45731690ec57fe0ad8a994d25351045f
49812 F20101202_AAAMVU sandhu_s_Page_078.jpg
3684cf1fdbf208ae5987283013537f7a
96d157b64a05db6a29898ead20b4e4858c4fcf3e
26571 F20101202_AAAMQX sandhu_s_Page_016.QC.jpg
5af8444c6245bf79c0485f1161e2075a
3b219039a8c40ed3a7f26dffa2e354eebb65a256
4858 F20101202_AAANHQ sandhu_s_Page_101thm.jpg
050b365d5d7def715958f9355e628114
3a7fc727b422c811f11767d579f668021e656207
F20101202_AAANCT sandhu_s_Page_109.tif
a90776fd37460fd706454128690d1b4b
d9d08d41175b3578b4818fbfc4689227c4baf11c
37736 F20101202_AAAMVV sandhu_s_Page_079.jpg
19e173e3110c8bcf5d3b96a7374c57fc
fd2f7e47abdcb2f704797d626d779209945a4cd4
F20101202_AAAMOA sandhu_s_Page_061.tif
43315ed2523d04a04085c81defc37c83
f87f55deca9f1568eb4f2bc721625fe17742b054
56909 F20101202_AAAMQY sandhu_s_Page_116.jpg
1894a1cf47fb91a02f1f2ecc86b5d1fc
1eacef59f9749eaf4bf70ba011e33beafa564fd8
15505 F20101202_AAANHR sandhu_s_Page_102.QC.jpg
1684d0c7fb268c7c77f9d80d78eec2ca
275004bd1883c0c7c552f18ff0bdab410c030d3a
F20101202_AAANCU sandhu_s_Page_113.tif
6736655f3fd9d6598853af0cc0808983
26f8e2a0c5ad18951c816a0aaf56019b5a006a2a
62620 F20101202_AAAMVW sandhu_s_Page_081.jpg
568dafddbd24863c0de339b72fc06b42
e10e2f523dd4fda2ebe3352f62f9767d70f8a0c5
5958 F20101202_AAAMOB sandhu_s_Page_098thm.jpg
364988df71fbb9ae6d5d2c8b7461f802
12fdc3b15194419e8a6732dc4d1c2e29777d2ec5
89010 F20101202_AAAMQZ sandhu_s_Page_037.jpg
9d8167e248bd747599948e59fd5dd321
22e7b815536217edf93a92b7b5c61f8f84cff3fc
3965 F20101202_AAANHS sandhu_s_Page_102thm.jpg
0a96e695dbf05712e32c13d194eeac80
68cd76c0706919aea7848a374468cf631e939a00
F20101202_AAANCV sandhu_s_Page_116.tif
6d31c3c9d017ffeb9423121f6923ee2a
826a330f270e8260e3853a54e4f28aeb3c8bc1c8
73024 F20101202_AAAMVX sandhu_s_Page_082.jpg
3fcc41c955c9f54521cb1ac6292f16ee
c2b7e4042e5be440db9ac17f9dbcfa671677da12
27313 F20101202_AAAMOC sandhu_s_Page_042.QC.jpg
c5f70188eaf3417eeacc0ebad8502d06
e3c4f6b20df3d7ec64d995581590b1b55807509c
29702 F20101202_AAANHT sandhu_s_Page_104.QC.jpg
2c5cec83e3b5f0408739ac50e45db8d2
d45ee32cb5f7d541c6f086b8ae18f30b7a2485bb
F20101202_AAANCW sandhu_s_Page_117.tif
d65c83c99d8b11e11dbea6f6a3bf41da
92802dc14e509dd64951cf8e8bc163f93776d345
24586 F20101202_AAAMTA sandhu_s_Page_006.QC.jpg
356ef70b9f1a481d8a385e0ed1bd39c7
d89b6aebd19fbe1cfc56ca9e99e0b2290ca0e0c9
60337 F20101202_AAAMVY sandhu_s_Page_083.jpg
3dc24979ae194753a5f25586dc6aa297
a6b50af1ca7e7a35ac7cde6e9f8a40941e06d2a5
2219 F20101202_AAAMOD sandhu_s_Page_030thm.jpg
33dfbd698e5ac1f87948bcb3366dee18
c23f37d7b9d1304b507c7665591a79a791b03306
29155 F20101202_AAANHU sandhu_s_Page_105.QC.jpg
191f1ddda79c0e5e272b04c107c02e35
f3f6b424c4d9ae02f3d571d219848c0b89d7f041
1533070 F20101202_AAANCX sandhu_s.pdf
cc43143bbeff3201e4002a8fb5dbff34
f3a8206ba9c94af9d9cda3411b341b204044e515
110213 F20101202_AAAMTB sandhu_s_Page_090.jpg
4e16d3c52465462f48e359b4c1b8c404
26fd5b56d73f956646d5ac12d16b29286876cf97
82908 F20101202_AAAMVZ sandhu_s_Page_084.jpg
2dbc2471fa93afd60d928fac4206b92e
c40ca768628aa5719e7620d7b4ad6d370ecce274
F20101202_AAAMOE sandhu_s_Page_089.tif
fda42c5d21a5648483d472ca9da155f0
42ca86887a98c2b41fa04e4f70680610827ab270
30496 F20101202_AAANHV sandhu_s_Page_106.QC.jpg
42141ff6e4ef32581f972ffc86939703
e3c9ac55a037417be9bbd693505d9962686fdca3
1693 F20101202_AAANCY sandhu_s_Page_001thm.jpg
120496b619c44f4114458dcfea3737bb
208ac1d6d3ab37937fbfa7fea45428023139d43e
82670 F20101202_AAAMTC sandhu_s_Page_021.jpg
b2ebc79eaa1f4b160782716720085357
22bf22573e679b0c8fd6c00e9f4e84418a62b63b
1051963 F20101202_AAAMOF sandhu_s_Page_092.jp2
412c84d25a091ec6160f256686d5683f
d98a6d7da36217e959b9ba30e072a8981c586631
7018 F20101202_AAANHW sandhu_s_Page_106thm.jpg
8954caecf7b6a798dfac34eb35f2f8e8
1ef1203366e7fe25f5338364a00fe8078af7f9aa
1071 F20101202_AAANCZ sandhu_s_Page_002.QC.jpg
8e8c64be8ec9ef429997813d7ab18c5d
7b6050cfa187860220ce9a3d8b61b8d8aca52436
6854 F20101202_AAAMTD sandhu_s_Page_109thm.jpg
19a4f31c4f289cde71a2e13eb8cc049b
e7f3c15484a088472f8725435cc6adf538632f23
976633 F20101202_AAAMOG sandhu_s_Page_004.jp2
6d64fc51a93347a0cf7aa2ffbc938181
44b5aecf60915baa5640f8e6ed09b239220af2e1
348968 F20101202_AAAMYA sandhu_s_Page_051.jp2
c49131bce0cb367a6d140c779f52abf1
3c9626d1ebd768c456913060d3ec14c40aef1192
F20101202_AAANAA sandhu_s_Page_007.tif
52dd25bf25abbb48a322667ffc2b4f7a
9bcbc238f1dcc76896275b0d684d07e7ef140839
7123 F20101202_AAANHX sandhu_s_Page_107thm.jpg
25c09887b7959f5fc1c9bb3a7842df68
bdc0d3ab9bb0a9b8a07a837eb9a502d32648cb5c
76439 F20101202_AAAMTE sandhu_s_Page_063.jpg
12c8e521c11d19d907e1018a96090fad
b4c7be8ae0a07a17f3aa6c99820ab0bbec64cb09
115885 F20101202_AAAMOH sandhu_s_Page_076.jp2
01de9404b758aa8d7878ed14371964e5
54b25487555edd46724c9eced90e1533bbcabdf4
1051942 F20101202_AAAMYB sandhu_s_Page_052.jp2
eff642081e1db8f1066973aa550cedd9
a3c726aad20972e176d7245913efe10620b8610e
F20101202_AAANAB sandhu_s_Page_009.tif
68a32ef17ca228f7186af2811da31f06
5496b5d77802b47d3d39e3bf07e82af4f881f6cd
29904 F20101202_AAANHY sandhu_s_Page_108.QC.jpg
46974f23ff2ba555efad96814acfe8f8
2fe0d6e67957cc5b0375f806826e5318bb99cef3
5839 F20101202_AAAMTF sandhu_s_Page_099thm.jpg
e237844030ce16b1e342cc01fd85b349
facbc1e9925953219e36b9b7a3507eb2557ad67b
24143 F20101202_AAAMOI sandhu_s_Page_029.QC.jpg
e4f73988c51e19bfb88d59a4c19de7b0
480cbe7dc092975b74849511fcf0283ddb1f9aaa
496979 F20101202_AAAMYC sandhu_s_Page_053.jp2
785a04a45235931eff5fc3458355c761
6f98262119ff90622916b6fda69c33916bd5d8ff
F20101202_AAANAC sandhu_s_Page_011.tif
37ae93549ef64ba53854fb0e27404025
c73dc701d7aeabd8d46c9f181781aba54ea48ec0
29859 F20101202_AAANHZ sandhu_s_Page_109.QC.jpg
afd5b04c57c8a2c84cdfa089e5f704ec
25554281be157d39c8558cf6dfa771f4348b7f49
19873 F20101202_AAANFA sandhu_s_Page_047.QC.jpg
1f1ee0cf8232fe334a8a9ab2677e1c1c
fad7ae8508ff6ab17725afa214682b1e42293be3
F20101202_AAAMTG sandhu_s_Page_043.jp2
2853d4e3018a4d59331e7a543ad27e1e
30cbf945129bb24ebd6c8cc12122f44e855beaa2
1051915 F20101202_AAAMYD sandhu_s_Page_056.jp2
1fcfb9702a0b1d95799ed3ec58b232b2
0652d7cbcd291913508878811231df0e30a71989
F20101202_AAANAD sandhu_s_Page_012.tif
266f5b310bea001e5406ee465f2f7fbe
85e62402044ba7bcad9bbde5724ee9f2302243c2
6837 F20101202_AAANFB sandhu_s_Page_048.QC.jpg
b5d8944879b207321f2ecfa48f78e792
72a79920f8db9ae360f2ac000eb6709db07bde1a
30397 F20101202_AAAMTH sandhu_s_Page_068.QC.jpg
36fa7c1db2718acf114ae12cb98e27e0
267bbc191d28edcece3f2f57cdfdd45d184c3c62
99297 F20101202_AAAMOJ sandhu_s_Page_035.jpg
a0262b4c33c4576ef2743d5598cc8fd0
b697e30e2efbb43a96d55c2c047036412ef2fd7e
1051976 F20101202_AAAMYE sandhu_s_Page_059.jp2
56ede836c9d32895d3b5881ba6f6b097
92cecd5d3dab41e1baf337a0522a9eb687078d04
F20101202_AAANAE sandhu_s_Page_016.tif
9b75d758a2b978aaa5957f442ae8e17f
bed0b4a2d7332d647f499d03c2510e180396af21
1940 F20101202_AAANFC sandhu_s_Page_048thm.jpg
e5e710abe1f13d51135a593bcf2ed26f
81586494d84bda3e3248ca1a9ed705a69a1e49a2
16836 F20101202_AAAMTI sandhu_s_Page_046.QC.jpg
80486b722cd2ff7cd5ac591d9aa75e32
ce8321854e7646561556c3cf75da6eba474464ee
19223 F20101202_AAAMOK sandhu_s_Page_011.QC.jpg
84d04b734b6daa2c68541c50a936d948
1dd0596f2734e7266e58f62a965158d29c1cf24e
F20101202_AAAMYF sandhu_s_Page_060.jp2
59af35c5758bd565a1aef95fdccadf18
20365ccb830473839ec3ba09d0b580c6816d6013
F20101202_AAANAF sandhu_s_Page_017.tif
b5d0594f73e2102f9aa93b76b3898575
47a32a5a0927d80c3a4bbadd4cd171f4c364539e
21790 F20101202_AAANFD sandhu_s_Page_049.QC.jpg
fbb370af90fbf50b137117fdd67e39ee
4128c230bf5634f4aae57161bbb26f227ffbd727
108673 F20101202_AAAMTJ sandhu_s_Page_110.jpg
a056d595c1f966fb129007a7c0a6f99e
8ccae552df3ac4edd09b758b7cebb86e29bdfb2e
245360 F20101202_AAAMOL sandhu_s_Page_048.jp2
568b2d50c5c13bd6e2da7e800e6b9094
3fb06134020db682a6b6d53b9ec29aa404cdcb5e
1051916 F20101202_AAAMYG sandhu_s_Page_061.jp2
956d58e31731e9d0968d29078753f5af
9d1e5e8384656daf65adf236083b11236d9e8b78
F20101202_AAANAG sandhu_s_Page_018.tif
5c5253f7ce58d50aea12159872522edf
b5b89f787e1d55437ee5bc9acab388c3bbea44f6
1585 F20101202_AAANFE sandhu_s_Page_050thm.jpg
e6ccf7317b834175e36b6a67677cd5cc
9047142fcef25763f7eddc02d50ba4df2323c25b
88868 F20101202_AAAMTK sandhu_s_Page_059.jpg
fb4f8c6ac611cc223f2610b87a6ed8fa
cfb214b54cafe6d70f288755a9348a22bed1c959
F20101202_AAAMOM sandhu_s_Page_008.jp2
64136336f845b8e9a36beed3a6b1a36d
1e0e4ac58101a58b1198a9e87f1b69975f93c836
F20101202_AAAMYH sandhu_s_Page_062.jp2
58a5a927f1f932424da1093b9439301d
66c1d1e7667321d5288fb6183877d7dde1359205
F20101202_AAANAH sandhu_s_Page_019.tif
f9ccaf194ae6ad4a1e50ec2dd1adc01c
393141337e9b92b7a0d4cc1905cb2bd92acd25fd
2343 F20101202_AAANFF sandhu_s_Page_051thm.jpg
3e7b838ff3c129385fddbcf297d37ed2
29e2b66f1d334ef7b49936a5444249d3b590599f
6683 F20101202_AAAMTL sandhu_s_Page_071thm.jpg
7d57275f1d5f011bbcb81e9b53e33495
1eec27c71b0f8b7e5b2e3676eaa5093c972ec12c
6368 F20101202_AAAMON sandhu_s_Page_026thm.jpg
2ff99a959d5d3c3632fc01217c73052d
568cd33d4b5f47b036923022b3e6090d37d7fb7e
F20101202_AAAMYI sandhu_s_Page_064.jp2
b0a9e7a8e741a8f719f6b63b5a2837b8
9b861032959287abe6f4cbfb4b852d84ce448ead
F20101202_AAANAI sandhu_s_Page_020.tif
5ff86109726a918de856398ec78519a2
61f852a1683303595aadb83e84ef4792230b17eb
5242 F20101202_AAANFG sandhu_s_Page_052thm.jpg
29092ced2980794c5f4334f0dd458a52
467347525881af6e73f2e476a758170dc08dc3cb
92603 F20101202_AAAMTM sandhu_s_Page_073.jpg
e28e6b87fc29c699df07e2dde9b6f71a
4969a3500d3cc67df6d536c3f79f4e1663bde8c7
1051961 F20101202_AAAMOO sandhu_s_Page_073.jp2
f2652a04daeb0753710cb9e8e47ccba6
4dd282d9d8183a0b30b02e71236a808c1c41cb57
F20101202_AAAMYJ sandhu_s_Page_065.jp2
77eabce5d7e482f79d98c5314ffd6344
f50a45874041d75fda2fe3322a7baedccbaad7e3
F20101202_AAANAJ sandhu_s_Page_021.tif
a4f7e48f1bc85eccf0c18c2a6e1c6d71
eacad3e64b0b5599723fb4c0063640b9205157c2
12488 F20101202_AAANFH sandhu_s_Page_053.QC.jpg
22bfc014a06468ffab4111d0b647bce6
feca04a826ed6a9dd697fcb60bc794d0439e2852
F20101202_AAAMTN sandhu_s_Page_056.tif
ca8fb0301ad50bf3912cf63bdf0b2df6
08bdb10810cbab5a95b6b73214a8d2bfd42c5cdd
109444 F20101202_AAAMOP sandhu_s_Page_096.jpg
ed4b57f5b90179f1b377017e5c7d6f77
cdd0272777c1b3985b0740e0206ac124feb69c2b
1051933 F20101202_AAAMYK sandhu_s_Page_067.jp2
22abec57f137c9eb19d0c184c5e3a578
19914d7e14403876bd2e564ce95da228f8e12e29
F20101202_AAANAK sandhu_s_Page_024.tif
26e67be65de2b11b69768459f3dc877e
26a2913d2f7323439ae0c783059e9c44d6b028d6
17023 F20101202_AAANFI sandhu_s_Page_055.QC.jpg
7c22e94674a3fc90da97c11cfb36c9bb
de08a412130b44fbc62f6064ff9f228c851f096f
6049 F20101202_AAAMOQ sandhu_s_Page_029thm.jpg
17def30376368444d31f51454a227c20
2f52a23210c81b9206ceecbd914a480b08531304
1051975 F20101202_AAAMYL sandhu_s_Page_068.jp2
b389cf3708548adfaacc4557def28352
e543fa9732efe47aaba3083715bb84c6fb195ba8
F20101202_AAANAL sandhu_s_Page_025.tif
bf5569a79d3feedd11ef9b86504e2815
5febf91f3a940cec81b51645a3160473bcaaf89c
4327 F20101202_AAANFJ sandhu_s_Page_055thm.jpg
78362e2b2923664b5f664acc05322eb4
c0902d1726fb280f0d5e89ade9a5db074150e56c
23768 F20101202_AAAMTO sandhu_s_Page_063.QC.jpg
65f01feabbbcfb46474e2c60572cc93c
8ca3980bf3de4d8669aca71a2a6b239f0228e58c
80151 F20101202_AAAMOR sandhu_s_Page_049.jpg
3f6474c5be07d54a560e52c25a45330b
c6a9547bef121ac47156f0b6fc14f53c3963991d
F20101202_AAAMYM sandhu_s_Page_069.jp2
a7e0bdd7342026872e5d81189f4aebe1
c93ef7393389fc2e932c00807a018ba1ff4ac9b7
F20101202_AAANAM sandhu_s_Page_027.tif
a0bdcb14dd90d6e2f1ddcf72eb0ddbd7
e7f7ef0a68ae3a28680af4ba87c197d5331956a8
29247 F20101202_AAANFK sandhu_s_Page_056.QC.jpg
69c79dc8895f6ec2c1359d1738396c43
2c5f076f237608f0494de84a32f6c15799ea0e18
28632 F20101202_AAAMTP sandhu_s_Page_096.QC.jpg
474e3dcaa7dc60a2fec786cc55944fc6
396c30d34a49f78680eaf52d99960973c01ecce5
47363 F20101202_AAAMOS sandhu_s_Page_117.jpg
ed7cceaf9ad1512500f558a2ce4f8dad
5efe6f48c0fee6c12bc4202e34e28f29b1b0c088
1051923 F20101202_AAAMYN sandhu_s_Page_070.jp2
ee466079142ac5d6e8ecb683ec12f3ac
680d278c815a6478c5bdb8db6b0a8f30fd11c48c
F20101202_AAANAN sandhu_s_Page_029.tif
d8cea6e4a6df5043bda4ef7cb768e67a
427b79e61a06122dafa64baf4d6530794baf1917



PAGE 1

1 GENERATION, CHARACTERIZATION AND RISK ASSESSMENT OF TRANSGENIC APOMICTIC BAHIAGRASS By SUKHPREET SANDHU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Sukhpreet Sandhu

PAGE 3

3 To my husband, parents, sist er and brother-in-law for their love and unfaltering faith in me.

PAGE 4

4 ACKNOWLEDGMENTS I first thank God Al mighty for His inspiration, support and bliss. I am especially grateful to my major advisor, Dr. Fredy Altpeter, for his continual guidance, patience, encouragement and financial support. His knowledge an d enthusiasm for work has been a great source of inspiration for me. I thank my committee members for their time and effort. Sincere thanks go to Dr. Ann Blount whose positive attitude and appreciation helped me to accomplish my goals. I thank Dr. Kenneth Quesenberry and Dr. Maria Gallo fo r their keen observations and meticulous suggestions. I especially thank Dr. Megh Singh for providing financial support, and for his commitment and belief in my capabilities. I thank all lab members for their help and cam araderie that made it an enjoyable working environment. I thank Dr. Victoria James Hurr a nd Dr. Walid Fouad for their generous assistance in research. I especially apprec iate the friendship of Isaac Neibaur, Loan Ngo, Paula Lomba and John Leeds. I thank Dr. Hangning Zhang, Jeff Seib, Eric Ostmark, Richard Fetheire, Melissa Thorpe and Jeff Jones for their assistance with labor atory and field work. I thank Dr. Kenneth Quesenberry, Dr. Lynn Sollenberger, Dr. Ernest He ibert, Dr. Victoria James Hurr and Carlos Acuna for providing necessary labor atory equipment and materials. I am grateful to Dr. Greg MacDonald for his unconditional support throughout my studies at UF. I am thankful to Bob and Harrioet Soffes for providing accommodation during my field study in Marianna, FL. I appreciate my family for their affection and encouragement to pur sue my ambitions in life.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4LIST OF TABLES................................................................................................................. ..........8LIST OF FIGURES.........................................................................................................................9ABSTRACT...................................................................................................................................10CHAPTER 1 INTRODUCTION..................................................................................................................122 APOMICTIC BAHIAGRASS EXPRESSING THE BAR GE NE IS HIGHLY RESISTANT TO GLUFOSINA TE UNDER FIELD CONDITIONS................................... 16Introduction................................................................................................................... ..........16Materials and Methods...........................................................................................................17Callus Induction...............................................................................................................17Gene Expression Cassettes..............................................................................................17Biolistic Transformation, Plan t Regeneration and Propagation...................................... 18Glufosinate Application................................................................................................... 19Greenhouse application............................................................................................ 19Field application....................................................................................................... 20Immuno-detection of PAT using a Lateral Flow Membrane Strip..................................20Southern Hybridization...................................................................................................21Results.....................................................................................................................................21Regeneration of Transgenic Plants..................................................................................21Evaluation of Herbicide Resistance................................................................................. 21Molecular Analysis of the Herbicide Resistant Lines..................................................... 23Discussion...............................................................................................................................243 CO-INTEGRATION, CO-EXPRESSION AND INHERITANCE OF UNLINKE D MINIMAL TRANSGENE EXPRESSION CASSETTES IN AN APOMICTIC TURF AND FORAGE GRASS ( Paspalum notatum Flugge)...........................................................31Introduction................................................................................................................... ..........31Materials and Methods...........................................................................................................33Gene Constructs...............................................................................................................33Plant Material, Transformation and Regeneration..........................................................33Screening of Putative Transgenic Lines for Transgene Expression................................ 34Characterization of Transgene Integrati on, Genomic DNA Isolation, Southern Blot Analysis, Polymerase Chain Reaction (PCR) and Sequence Analysis of PCR Products........................................................................................................................35

PAGE 6

6 Quantification of Transgene Expression.........................................................................36T1 Progeny Characterization: Transgene Integration, Expression and Herbicide Resistance....................................................................................................................36Results.....................................................................................................................................37Transformation Efficiency and Transgene Integration.................................................... 37Transgene Expression...................................................................................................... 39Correlation of Transgene Expression and Transgene Integration................................... 40T1 Progeny Analysis........................................................................................................ 40Discussion...............................................................................................................................414 POLLEN-MEDIATED GENE FLOW FROM TRANSGENIC APOMICTIC TETRAPLOID BAHIAGRASS AND BREEDI NG BEHAVIOR OF INTRA-SPECIFIC HYBRIDS ...............................................................................................................................56Introduction................................................................................................................... ..........56Materials and Methods...........................................................................................................59Pollen Donor....................................................................................................................59Greenhouse Experiment Layout...................................................................................... 60Field Experiment Layout.................................................................................................61Open-pollination and Seedhead Collection..................................................................... 62Screening of Seed Progeny..............................................................................................62Hybrid Confirmation....................................................................................................... 63Transgene expression............................................................................................... 63Transgene integration............................................................................................... 63Hybrid Characterization: Phenotype...............................................................................64Hybrid Characterization: Cytogenetic.............................................................................64Flow cytometric determination of ploidy................................................................. 64Karyotypic analysis using root-tip preparations.......................................................64Hybrid Characterization: Reproductive...........................................................................65Embryo sac analysis................................................................................................. 65Pollen viability......................................................................................................... 65F2 seed production and viability............................................................................... 65RFLP marker analysis for apomixis......................................................................... 66Results.....................................................................................................................................66Transgenic Pollen Source................................................................................................ 66Anthesis and Synchrony of Flowering............................................................................67Pollen-mediated Gene Transfer from Transg enic Tetraploid to Diploid Bahiagrass...... 67Pollen-mediated Gene Transfer from Transgenic Tetraploid to Tetraploid Bahiagrass.................................................................................................................... 67Hybrids: Transgene Characterization..............................................................................68Hybrids: Cytogeneti c Characterization........................................................................... 68Hybrids: Growth and Repr oductive Characterization..................................................... 69Discussion...............................................................................................................................705 CONCLUSIONS.................................................................................................................... 84

PAGE 7

7 APPENDIX LABORATORY PROTOCOLS USED FO R BI OLISTIC TRANSFORMATION, TISSUE CULTURE AND CHARACTERIZATION OF TRANSGENIC PARENT AND HYBRID BAHIAGRASS PLANTS............................................................................. 87Protocols for Molecular Cloning............................................................................................ 87Protocol for Particle Bombardment using PDS-1000/He....................................................89Tissue Culture Induction, Maintenance, Selection and Plant Regeneration........................... 90Molecular Techniques used in the Confir mation of Putative Transgenic Plants.................... 92Cytological Techniques used in the Character ization of Herbicide Resistant Hybrids.......... 98Buffers and Solutions.......................................................................................................... ...99LIST OF REFERENCES.............................................................................................................104BIOGRAPHICAL SKETCH.......................................................................................................117

PAGE 8

8 LIST OF TABLES Table page 3-1 Southern blot expected band size from potential MC/concatemers................................... 47 3-2 Expression analysis of unlinked transgenes....................................................................... 47 3-3 Transgene integration and expression level based on Southern blot and E LISA.............. 48 4-1 Pollen-mediated gene transfer freque ncy from herbicide resistant apomictic tetraploid bahiagrass to diploid bahiag rass following open pollination at 0.5 to 2.5m distance between the pollen donor and recipient............................................................... 77 4-2 Pollen-mediated gene transfer freque ncy from herbicide resistant apomictic tetraploid bahiagrass to tetraploid bahi agrass following open pollination at 0.5 to 2.5m distance between the po llen donor and recipient...................................................... 77 4-3 DNA ploidy determination through flow cy tom eter and chromosome counting of F1 hybrids obtained from sexual diploid pollen r eceptors O.P. with transgenic apomictic tetraploid bahiagrass as pollen donor.................................................................................78 4-4 Embryo sac types in the F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass........................................................ 78 4-5 Growth, habit and fertility of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass........................................79

PAGE 9

9 LIST OF FIGURES Figure page 2-1 Diagrammatic representation of the npt II and bar gene expression cass ette used for genetic transformation of bahiagrass.................................................................................282-2 Generation and evaluation of herbicide resistant bahiagrass............................................. 292-3 Southern blot analysis of transgenic bahiagrass................................................................303-1 Expression cassettes and Southern blot analysis of 21 transgenic lines............................ 493-2 PCR analysis of putative bar npt II 3-3 concatemers......................................................513-3 Sequence analysis of transgenic bahiagrass lines.............................................................. 523-4 The npt II and bar transgene expression for T0 transgenic lines........................................ 533-5 Southern blot analysis of T1 progeny plants...................................................................... 543-6 Transgene expression analysis in the T1 progeny..............................................................554-1 Pollination experiments under greenhouse a nd field conditions and screening of O.P. seed....................................................................................................................................804-2 Transgene expression and integration in F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass............................. 814-3 Karyotypic analysis of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetrap loid bahiagrass as pollen donor......................................824-4 Reproductive characterization of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass as pollen donor............... 824-5 Molecular marker analysis of F1 hybrids using RFLP marker linked to apospory in tetraploid Paspalum notatum .............................................................................................83

PAGE 10

10 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENERATION, CHARACTERIZATION AND RISK ASSESSMENT OF TRANSGENIC APOMICTIC BAHIAGRASS By Sukhpreet Sandhu August 2008 Chair: Fredy Altpeter Co-chair: Ann R. Blount Major: Agronomy Bahiagrass ( Paspalum notatum Flugge) is a warm season pere nnial species distributed in tropical and subtropical re gions. It supports the ca ttle beef production system in Florida, where diploid sexual and tetraploid apomictic cultivar s are grown widely as pasture and utility turf. Apomictic cultivars like Argentine represent pr omising targets for genetic transformation due to their asexual seed production. The major obj ective of this research was to study pollenmediated gene flow from transgenic to non-transg enic bahiagrass using herb icide resistance as a marker. Experiment involving the generation and molecular characte rization of herbicide resistant transgenic bahiagrass, pollen-mediated gene transfer, br eeding behavior of hybrids, and the fate of transgene(s) are described. Unlinked, minimal transgene expression cassett es (MCs) were introduced into Argentine bahiagrass by biolistic transfor mation. Co-expression of unlinked npt II and bar genes occurred in 19 of 20 co-transformed lines (95% co-exp ression frequency). Tr ansgenic lines were morphologically identical to wild-t ype bahiagrass, produced viable pollen, and were resistant to 0.6% glufosinate ammonium in the greenhouse a nd field. Uniform seed progeny with stable

PAGE 11

11 integration and expression of npt II and bar was confirmed by Southern blot hybridization, ELISA and herbicide app lication, respectively. Open-pollination of transgenic and non-tran sgenic bahiagrass was conducted in the field and greenhouse at a close physical distance (0.5 to 2.5m), to ensure a detectable level of gene transfer. Gene transfer from transgenic apom ictic tetraploid bahiagrass to sexual diploid bahiagrass or to apomictic tetraploid bahiag rass was 0.03% and 0.17%, re spectively, under field conditions, and 0.16% for both cases under green house conditions. A total of 56 hybrids were identified from 44,205 germinated seedlings deri ved from non-transgen ic pollen receptors. Twelve of 13 hybrids examined by flow cytometer and karyotypic analysis were triploids. An apospory-linked RFLP marker was detected in 15 of 17 triploid hybrids and all 12 tetraploid hybrids analyzed. The majority of hybrids showed reduced vigor. During the first year, five of 10 hybrids flowered with viable pollen while two of the non-flowering hybrids did not persist under greenhouse conditions. Gene transf er between transgenic and non-transgenic bahiagrass can occur under field conditions; how ever, hybridization frequency is low compared to other transgenic cross-pollinating grasses, and th e resulting hybrids display reduced fitness.

PAGE 12

12 CHAPTER 1 INTRODUCTION Bahiagrass ( Paspalum notatum Flugge) is a perennial, warm season grass native to South America. It is a primary component of native grasslands in southern Brazil, Paraguay, Uruguay and northeastern Argentina (Gat es et al. 2004). In Florida, it is a popular forage grass characterized by drought tolerance, excellent persistence under cont inuous grazing, and few disease and pest problems (Gates et al. 2004) Pseudogamous apomictic tetraploid (2n=4x=40) races are the most common form of this specie s found near its center of genetic diversity. The sexual self-incompatible diploid (2n=2x=20) cy totypes, commonly called Pensacola inhabit only limited areas in its native ha bitat (Daurelio et al. 2004). Pens acola bahiagrass has become one of the major forage grasses in the southeas tern United States since its introduction in 1945 (Burton 1967; Gates et al. 2004). Bahiagrass spreads by short rhizomes. Internod es are short and leaves are crowded at the base with overlapping keeled sh eaths. The characteristic V-shaped inflorescences are the two racemes which can be ascending, recurved-divergent in some races. Solitary spikelets are borne in two rows on the rachis (Gates et al. 2004). Flowering starts from the middle and advances towards the terminal portion of th e raceme. Anthesis is completed in four to five days (Burton 1942). Anthesis in most florets occurs in the morning between 6:00-8:00AM. Weather conditions including temperature and humi dity influence the timing and rate of anthesis. Warm temperatures hasten anthesis, whereas humid conditions delay dehiscence of exerted anthers (Burton 1942). Herbage accumulation in bahiagrass shows a seasonal pattern determined by temperature, rainfall and daylength (Gates et al. 2001; Mislevy et al. 2001; Sinclair et al. 2001). Strong support from the beef industry sector has prom pted several breeding programs to target

PAGE 13

13 bahiagrass improvement and variety development. Traditional breeding fo r bahiagrass cultivar development is based on recurrent selection for cold tolerance, earlyand late-season forage growth, and ample stolon development within th e original Pensacola germplasm. Recurrent Restricted Phenotypic Selecti on (RRPS) for yield has resu lted in altered morphology with upright growth habit and reduced rhizome developm ent in diploid cytotypes (Blount et al. 2001). Although traditional breeding procedures have been successful in obtaining higher yields and other desirable traits in the diploid sexual fo rm (Pensacola) of bahiag rass, breeding tetraploid apomictic cultivars has been difficult. Forage impr ovement of apomictic cultivars is limited due to the lack of genetic recombin ation during asexual seed produc tion (Blount et al. 2001). Sexual tetraploid bahiagrass have been artificially generated by colchine treatment of diploid seeds or calli. This novel germplasm represents valuable parent material for genetic improvement of tetraploid bahiagrass (Forbes and Burton 1961; Qu arin et al. 2001; Quesenberry and Smith 2003; Acuna et al. 2007). Genetic transf ormation offers the opportunity to utilize heterologous genes for bahiagrass improvement (Altpeter et al. 2008). Transgenic plants of the commercially important apomictic cultivar Argentine were generated to improve turf quality, drought and cold tolerance and herbicide resistance (Agharkar et al. 2007; Sandhu et al. 2007; Zhan g et al. 2007; James et al. 2008). A viable seed industry in the southeastern United States is supporte d by locally grown bahiag rass; however pasture establishment is often slow due to seed dormancy and reduced seedling vigor. These characteristics, together with the open growth habit of bahi agrass encourage weed growth. Therefore, chemical weed control or mechanical mowing is often necessary to achieve uniform weed-free pastures. However, bahiagrass is often damaged by commercially available post-

PAGE 14

14 emergence herbicides. Hence, genetic transformati on to produce herbicide tolerant bahiagrass is a desirable approach to enhance bahi agrass utility as forage and turf. Biolistic transformation using minimal linear expression cassettes (MCs) reduces transgene loci complexity and copy number whil e supporting stable expr ession (Fu et al. 2000; Altpeter et al. 2005). However, a detailed analysis of transgen e integration, expression and inheritance in an apomictic progeny is lacking. Su ch information is also important for the risk assessment of transgenic plants, since introduc ed trait(s) can have a large effect on the introgression of transgen e(s) in nature (Felber et al. 2007). By employing vector-free constructs, the clean DNA technology enhances the bio-safety of genetically modified plants (GMPs) (Fu et al. 2000; Agrawal et al. 2005). Apomictic seed production maintains the maternal genotype in the progeny without transgene segreg ation. This is a desirable feat ure for seed production in both hybrid varieties (Hanna 1995; Sa vidan 2000) and GMPs. The obligat e or facultative nature of apomixis in P. notatum has been determined by embryo sac observations (Quarin and Hanna 1980; Quarin et al. 1982). However this met hod provides limited information on the expression of apomixis in the seed proge ny of facultative apomicts. Prog eny analysis using molecular markers overcomes this limitation (Ortiz et al. 1997; Martinez et al. 2003), although this approach, like the embryo sac analysis can be re stricted by sample size. Progeny analysis with a phenotypic marker (such as herbic ide resistance) is a better a pproach to determine percent apomictic seed production. The use of a herbicide resistance marker allows rapid screening of large populations. This feature has been exploited in pollen-mediated gene flow studies of other transgenic crops such as rice ( Oryza sativa, Messeguer et al. 2001;Chen et al. 2004), tall fescue ( Festuca arundinaceae ; Wang et al. 2004) and creeping bentgrass ( Agrostis stolonifera ; Watrud et al. 2004;).

PAGE 15

15 A major environmental concern relating to transgenic plants is their gene flow to wild relatives. For an assessment of eco logical risks associated with tr ansgenic plants, it is important to understand the mechanism and consequences of transgene flow (Chapman and Burke 2006). Gene flow and introgression of transgenes de pend on the hybridization rate, the fitness of hybrids, and the behavior of transgene(s). Pollen -mediated gene flow studies provide important data on hybridization frequency, the potential of introgression, and further direct transgene containment strategies. Objectives The goal of this research was to evaluate the potential of gene flow in transgenic bahiagrass. The specific objectives were: 1. Generation of transgenic herbicide resistan t bahiagrass using biolistic transformation. 2. Molecular analysis of the herbicide resistant bar gene and the selectable marker antibiotic resistance gene npt II in transgenic bahiagrass and in seed progeny. 3. Determination of gene transfer rate and fate of hybrids from herbicide resistant transgenic bahiagrass to non-transgenic bahiagrass under field and greenhouse conditions.

PAGE 16

16 CHAPTER 2 APOMICTIC BAHIAGRASS EXPRESSING THE BAR GE NE IS HIGHLY RESISTANT TO GLUFOSINATE UNDER FIELD CONDITIONS (Re-printed from Sandhu et al. 2007 with permission from Crop Science1) Introduction Bahiagrass is an im portant turf and forage gra ss in the southeastern United States and in subtropical regions around the world. Commercially important cytotypes include sexually reproducing, cross pollinating diploids (2n=2x=20 ) like Pensacola or Tifton 9 and apomictic, tetraploid (2n=4x=40) genotypes like Argentine (Gates et al. 2004). Genetic improvement of tetraploid bahiagrass cultivars has been compro mised by the absence of ge netic recombination in apomictic cytotypes. Genetic manipulation through cellular and molecular techniques will overcome this hurdle. The obligate apomict Ar gentine (Burton 1948) re presents a preferred target for genetic transformation to incorporat e herbicide resistance. Its apomictic mode of reproduction will allow generation of uniform tran sgenic seed progeny with a reduced risk of unintended gene dispersal by polle n. Bahiagrass is drought and heat tolerant and resists most insects and diseases. However, its open growth habit supports weed encroachment and its very low tolerance to commercially available herbicides make weed management a difficult task. Hence, development of herbicide resistant Argentine bahiagrass will reduce weed management problems for this low input grass. Glufosinate ammonium is a post-emergence he rbicide widely used for broad-spectrum weed control. The short half life (seven days) of glufosinat e ammonium limits soil residual activity and makes it environmentally benign. Co mmercially available glufosinate ammonium resistant crops include cotton, co rn and canola (Castle et al. 2006). Transgenic glufosinate 1 Sandhu S, Altpeter F, Blount AR (2007) Apomictic bahiagrass expressing the bar gene is highly resistant to glufosinate under field conditions. Crop Sci. 47:1691-1697

PAGE 17

17 ammonium herbicide resistant turf and forage grasses have been reported from several species including creeping bentgrass ( Agrostis palustris Huds., Hartman et al 1994; Luo et al. 2004), bermudagrass (Cynodon dactylon Goldman et al. 2004; Li et al. 2005) and Kentucky bluegrass ( Poa pratensis L.; Gao et al. 2006). Transg enic plants expressing the bar gene in the experimental apomictic genotype Tifton 7 and the diploid bahiagrass cultivar Pensacola have been recently reported (Smith et al. 2002; Gondo et al. 2005). However, herbicide resistance was not investigated in these transgenic bahiagrass lines, other than regeneration of plants from bialaphos-containing culture medi um (Gondo et al. 2005) or leaf pa inting of primary transgenic plants with 0.4% glufosinate am monium (Smith et al. 2002). This is the first report of bar transgene expression in apomictic progeny of the commercially important bahiagrass cultivar Argentin e and identification of transgenic lines with high level herbicide resistance under bot h greenhouse and field conditions. Materials and Methods Callus Induction Em bryogenic callus was induced from germinati ng seedlings as described by Altpeter and James (2005). The callus induction medium (CIM) consisted of MS salts (Murashige and Skoog 1962), 30 g l-1 sucrose, 1.1 mg l-1 6Benzylaminopurine (BAP), 3 mg l-1 3,6-Dichloro-2methoxy benzoic acid (dicamba) and 6 g l-1 agarose (Sigma, St. Louis, Mo.), supplemented with filter sterilized MS v itamins (Murashige and Skoog 1962), which were added after the medium was autoclaved for 20 min. Calli were kept in darkness at 28C and subcultured to fresh CIM biweekly. Gene Expression Cassettes Plasm id p35S-int-nptII contains the selectable marker gene npt II gene (Bevan 1984) under the transcriptional control of the constitutive CaMV 35S promoter (Odell et al. 1985) with the

PAGE 18

18 HSP70 intron (Rochester et al. 1986) and CaMV 35S 3UTR (Dixon et al. 1986). The pJFbar plasmid contains the bar gene (encoding phosphinothricin acetyltransferase) (Thompson et al. 1987), under transcriptional contro l of the constitutive maize ubi quitin promoter, first intron (Christensen and Quail 1996) and CaMV 35S 3UTR (Dixon et al. 1986) (Fig. 2-1). The npt II gene expression cassette was exci sed from plasmid p35S-int-nptII using Not I and Alwn I to generate a 2.5 kb fragment. The bar gene expression cassette was excised from pJFbar plasmid with IsceI flanking the expression cassettes, to produce a fragment of 2.7 kb. Following restriction digests, transgene expression cassettes were isolat ed by gel electrophoresis and the corresponding bands were excised and purified by the Wizard SV Gel and PCR cleanup system (Promega U.S., Madison, WI) to remove vector backbone sequences. Biolistic Transformation, Plant Regeneration and Propagation The npt II an d bar gene expression cassettes were us ed in a 1:2 molar ratio and coprecipitated on 1.0 m diameter gold particle s as described (Altpet er and James 2005). Embryogenic calli were placed on CIM medium s upplemented with 0.4M sorbitol, for 4-6 hours prior to gene transfer. The Bi oRad PDS-1000 / He device (Sanford et al. 1991) was used for biolistic gene transfer at 1100 psi and 28 mm Hg The bombarded calli were transferred to fresh CIM medium following the gene transfer and kept in the dark for 10 days. Then they were transferred to low li ght conditions (30Em-2s-1), with 16/8h (light/dark) photoperiod, at 28C, on selection CIM medium containing 50 mg l-1 of paromomycin. After 4 weeks, the calli were subcultured on shoot regeneration medium, si milar to CIM except for containing 0.1 mg l-1 BAP, and no dicamba. These cultures were transferred to an illuminated (150Em-2s-1) incubator with a 16/8h (light/dark) photoperiod at 28C. To indu ce root formation, calli were transferred to hormone-free CIM medium. The regenerated plantle ts were transplanted into Fafard 2 potting mix (Fafard, Inc. USA, Apopka, FL) and acclimatiz ed in growth chambers set at the conditions

PAGE 19

19 described above, and later moved to an air-c onditioned greenhouse at 30/20C (day/night) and natural photoperiod. Plants were fertilized bi-w eekly with Miracle-Gro Lawn Food (Scotts Miracle-Gro Products Inc., Marysville, OH) at the recommended rate. Visual observations of plant morphology were recorded. Seed viability was determined by germination. Lemma and palea were removed with a scalpel to break se ed dormancy and seedlings were evaluated for transgene expression. Glufosinate Application Greenhouse application Ignite (18.1% glufosinate amm onium, activ e ingredient, AgrEvo Inc., USA, Wilmington, DE) was used for herbicide applications. Thirty-t wo putative transgenic lines were sprayed with 0.2% glufosinate ammonium using a hand sprayer. Wild-type (WT) bahiagrass (non-transgenic cultivar Argentine) was used as negative contro l and a known herbicide re sistant bahiagrass plant was used as a positive control. Visual observations of plant in jury or other symptoms were recorded 14 days after he rbicide application. Eighteen of the a bove lines were further tested at three different concentrations of glufosinate a mmonium. A completely randomized experimental design (CRD) with two replications per line and 3 treatment concentrat ions, 0.2%, 0.5% or 1.0% glufosinate ammonium was use d. One liter of the herbicide mixture containing 8 drops of Tween (Fisher Biotech, NJ, USA), was used to treat 38 individual plants. Using a hand sprayer, each plant was dosed until the herbicide ran off. Visual observations for plant injury were scored 14 days after herbic ide application. The degree of pl ant injury was scored on a 1-5 scale as follows: 1: Plant with no injury; 2: 2 to 3 leaves per plant display necrosis at the leaf tip (less than 10% of the leaf area); 3: Most leaves display between 10 to 40% leaf necrosis; 4: Most leaves display between 40 to 80% leaf necrosis; 5: All leaves display 80 to 100% leaf necrosis.

PAGE 20

20 Field application USDA-APHIS (USDAAPHIS permit 05-365-01r) allowed evaluation and seed production of transgenic herbicide resistant lines under fiel d conditions in a designa ted plot in Marianna, Florida. Highly resistant transgenic lines 2, 3 and 33, along with the wild-type were vegetatively propagated in the greenhouse and transplanted into the field by the end of May 2006. Transgenic lines were transplanted in the center of 1m diamet er circular plots with wild-type plants located to the outside. There were 4 plants of each transgenic line per plot and each circular plot set up was replicated four times. Viable seeds were pr oduced on wild-type and transgenic bahiagrass plants during July and August following a sing le nitrogen applica tion of 30 kg hectare-1. Herbicide resistance of the above lines was tested by applying 0.3% and 0.6% glufosinate ammonium application in two pl ots per treatment on September 1st 2006. Applying 0.3% glufosinate ammonium is the recommended field ra te for control of broadl eaf and grassy weeds. The herbicide was applied till run off using a hand sprayer. Visual observations were recorded 14 days after herbicide application. Immuno-detection of PAT using a Lateral Flo w Membrane Strip An immuno-chromatographic detection kit th at uses lateral flow membrane strips (Envirologix, Quick Stix for LibertyL ink/bar) for the analysis of the bar gene product, phosphinothricin acetyltransferase (PAT) was employed in this study. Total protein was extracted with the buffer solution provided in the kit, and the prot ein concentration was estimated using the Bradford assay (Bradford 1976). Protein extracts (50l) at a concentration of 1 g l-1 were used for the assay. Protein extracts from non-transformed wild-type bahiagrass were used as a negative control. The lateral fl ow membrane assay was performed on all lines that showed no injury after application of 0.2% glufosinate a mmonium and on T1 progeny from selected lines.

PAGE 21

21 Southern Hybridization Fresh leaf tissue (3 g) w as used to extract genomic DNA by th e CTAB method (Murray and Thompson 1980). Genomic DNA (20 g) digested with Bgl II was electrophoresed overnight at 20V on a 1.0% agarose gel in 1x TAE buffer (Sambrook and Russell 2001) and then transferred to Hybond N membrane (Amersham Ph armacia Biotech, Piscataway, N. J.) with 0.4N NaOH (Sambrook and Russell 2001). The full-length coding region of the bar gene, (0.56 kb) used as a probe was obtained by re striction digestion of pJFbar with Mlu I and XhoI followed by gel extraction (QIAquick gel ex traction kit, Qiagen Inc., Va lencia, CA). Labeling of the probe with [32P] dCTP was done using the Prime-a-gene labeling system (Promega, U.S., Madison, WI). The membrane was pre-hybridized for 4 hours at 65C and then hybridized overnight in the hybridization buffer cont aining denatured salm on sperm DNA (1 g l-1) and the labeled probe (Sambrook and Russell 2001). The membrane was washed with 0.1X SSC and 0.1% SDS at 65C prior to expos ure to Kodak Biomax MS autoradiography film at -80C for 30hrs. Results Regeneration of Transgenic Plants Growth, regeneration of plants (Fig. 2-2A) and root form a tion on paromomycin containing culture medium allowed for the selection of 32 in dependent putative transgenic plants (Fig. 22B) from a total of 300 bombarded callus pieces and a total of 10 bombardments. Evaluation of Herbicide Resistance Screening for expression of the co-transfor med bar gene initially was done by applying a foliar application of a low concentration (0.2 %) of glufosinate amm onium to the putative transformants. Preliminary experiments had indi cated that 0.2% glufosin ate ammonium was the lowest concentration that resulte d in 90-100% leaf necrosis in wild-type Argentine bahiagrass.

PAGE 22

22 Therefore, this herbicide resistance screening was expected to contain lines with a low level of bar gene expression. Thirty lines (93.3% of the putative transgen ic plants) survived the 0.2% glufosinate ammonium application and displayed no necrosis or onl y minor leaf tip necrosis. In contrast, two lines (lines 16 and 40) displayed extreme injury symptoms similar to those shown by wild-type plants. Further testing of the level of herbicide tolerance was performed by applying 0.2%, 0.5% and 1.0% glufosinate ammonium to 18 randomly se lected herbicide tolera nt lines, as well as wild-type and one susceptible lin e (16). These lines showed differences in the response to applications of higher concentr ations of glufosinate ammonium (0.5% and 1.0%) (Fig. 2-2C and D). Highly resistant lines incl uding 2, 3, 4, 11, and 33 did not display any injury or stress symptoms even at the highest application rate of at 1.0% glufosinate ammonium (injury score 1, Fig. 2-2C). Lines 7, 10, 19, 28, and 52 showed no injury following an application of 0.2% glufosinate ammonium, and only mild or no inju ry at 0.5% glufosinate ammonium as well as minor injury symptoms at 1.0% glufosinate ammonium (scored 1.5-2). Lines 6, 21, 22, 24, 32, 36, 38 and 39 displayed moderate leaf injury (score s between 2 and 3) at the lowest glufosinate ammonium concentration, but sti ll survived applications of 0.5% or 1.0% glufosinate ammonium (Fig. 2-2D). Herbicide leaf injury in line 24 was moderate. Howeve r, this line displayed a growth inhibition following application of 0.5 or 1.0% of glufosinate ammonium. Wild-type bahiagrass showed 100% leaf necrosis at all gluf osinate ammonium application levels. Under greenhouse and field conditio ns, transgenic bahiagrass plants did not differ from wild-type plants in appearance and produced seeds which germinated into seedlings (Fig. 2-2E). The field application of 0.3% (t he recommended application rate that is equivalent to 32 fl.oz./acre applied with 15 gal water) and 0.6% glufosinate ammonium (two times the

PAGE 23

23 recommended application rate) did not produce any in jury symptoms in any of the replications of the transgenic lines. In contrast, all the su rrounding wild-type bahiagrass plants showed 100% leaf necrosis (Fig. 2-2F and G). Also, it wa s observed, that applica tion of 0.3% and 0.6% glufosinate ammonium fully suppressed comm on weeds which co-established with the transplanted bahiagrass, including common bermudagrass ( Cynodon dactylon ), goosegrass ( Eleusine indica ), crabgrass ( Digitaria sanguinalis ), crowfootgrass ( Dactyloctenium aegyptium ), pigweed ( Amaranthus spp.), teaweed ( Sida spinosa) and wild radish ( Raphanus raphanistrum ). Molecular Analysis of the Herbicide Resistant Lines Immuno-detection of the bar gene product phosphinothricin acetyltransferase (PAT) was accom plished by a lateral flow membrane assay (Quick Stix for Liberty Link, Envirologix). This is a qualitative assay with very high detection limit. The PAT detection band is often faint in most samples, but provides a quick and easy method of protein expression in transgenic lines. All bahiagrass lines that were resistant to 0.2% glufosinate ammonium application showed the PAT-sp ecific band in the immuno-chromat ographic assay (indicated with an arrow in Fig. 2-2H ), in cont rast to the wild-type and glufos inate ammonium susceptible lines 16 and 40 which did not display this band (data not shown). Stable bar expression in apomictic progeny plants was indicated by the presence of the PAT-specific band in the immunochromatographic assay (Fig. 2-2I). Southern bl ot analysis of the genomic DNA of herbicide resistant bahiagrass lines confirmed the stable integration of the bar gene (Fig. 2-3). All lines showed a different integration pattern indicating that they were obtained from independent transformation events. Most tran sgenic lines showed complex bar gene integration patterns. An exception from this trend was line 7 w ith approximately two copies of the bar gene.

PAGE 24

24 Discussion The genera tion of fertile, bar transgenic bahiagrass lines fr om cultivar Argentine that display high levels of resistance to glufosin ate ammonium under controlled environment and field conditions is described here. Following biol istic gene transfer, a total of 30 independent transgenic plants expressing the bar gene, as detected by herb icide tolerance and immunochromatographic assays, were regenerated from 300 pieces of embryogenic callus. This transformation efficiency (10%) compares favorably to an earlier report with 2.2% transformation efficiency in bahiagrass (Gondo et al. 2005). Smith et al. (2002) reported that more than 90% of the putative transgenic li nes displaying tolerance to 0.4% glufosinate ammonium were non-transgenic escapes. Inte restingly, application of 0.2% glufosinate ammonium was an efficient screening tool in th e experiments presented here. Expression of the bar gene was confirmed with immuno-chromatography in all plants which displayed tolerance to 0.2% glufosinate ammonium. Genotypic differenc es and alterations in tissue culture and selection protocols may have contributed to th ese contrasting findings. With prolonged culture, bahiagrass callus tends to unde rgo somaclonal variation whic h leads to a reduction in regeneration potential and nega tively affects transformation efficiency (data not shown). The importance of a short tissue culture peri od has been emphasized in earlier monocot transformation reports (e.g. Altpeter et al. 1996; Zhang et al. 2003; Gao et al. 2006). Gondo et al. (2005) have reporte d the production of a herbicide resistant diploid bahiagrass cytotype ( Paspalum notatum cv. Pensacola). However, regeneration of plants on bialaphoscontaining culture medium was the only presented evidence of herbicide resistance. In contrast, the experiments described here, focused on th e production of transgenic bahiagrass with resistance to high concentra tions of glufosinate ammonium Application of glufosinate ammonium under greenhouse cond itions at different concentr ations (0.2%, 0.5% or 1.0%)

PAGE 25

25 identified different levels of herbicide resist ance in independent transgenic bahiagrass lines ranging from no injury to moderate injury at the highest (1.0%) glufosinate ammonium application level. Wild-type bahi agrass showed 100% leaf necrosis at all glufosinate ammonium application levels. Glufosinate ammonium is an inhibitor of glutamine synthase (GS), a key enzyme in the nitrogen assimilation pathway. GS inhibition leads to ammonia accumulation, resulting in phytotoxicity. The bar gene encodes phosphinothricin acetyltransferase (PAT) which inactivates glufosinate ammoni um by acetylating its active amino group. Low level herbicide resistance in some of the lines is probably a re sult of inadequate PAT levels, thus resulting in partial leaf necrosis. Glufosinat e ammonium has also been shown to have an indirect effect on plant photosynthesis, which may be responsible for the growth inhibition observed in line 24 (Wild and Wendler 1993). Representative lines from each resistance level were selected for Southern blot analysis. Multiple transgene copies have been associated with reduced expression levels, due to transgene silencing at the transcriptional or post-transcriptional level (Wang and Waterhouse 2000). The complex transgene integrati on pattern of transgenic line 52 resulted in a similar, moderate herbicide resistance level as in line 7 that contained approximately two copies of the bar gene. Further, line 52 stably expressed the transgene in progeny seedlings as detected by immuno-chromatography despite its complex tr ansgene integration pattern. On the other hand, highly resistant lines 4, and 33, had less copies of the bar gene compared to the moderate resistant lines 28 and 52. The obser ved line to line vari ation could be due to the position of transgene insertion and may be influenced by the transcriptiona l activity of neighboring regions or by flanking endogenous regulatory seque nces (Meyer 2000). A common band of approximately 3 kb was observed in all transgenic lines, which could be due to the formation of concatemers. This rather complex transgene inte gration pattern was observed despite the use of

PAGE 26

26 minimal cassettes without vector backbone. In c ontrast Fu et al. (2000) observed a simple integration pattern and lower copy numbers with minimal cassettes than plasmids. However, consistent with our findings, Breitler et al. (2002) also describe d highly complex transgenic loci following the use of minimal cassett es. This result suggests that th e complexity of a transgenic locus depends on factors intrinsic to the plant and not to the transgen e as stated earlier by Agrawal et al. (2005). All naturally occurring tetraploid bahiagrass genotypes are considered apomictic (Burton 1948). The commercially important apomictic cultiv ar Argentine used in this study represents the preferred target for genetic transformation to incorporate herbicide resistance. Its apomictic mode of reproduction supports the generation of uniform transgenic seed progeny with a reduced likelihood of unintended gene dispersal by pollen. Transgenic lines 2, 3 and 33 were establishe d in the field under USDA-APHIS permit no. 05-365-01r and herbicide resist ance was evaluated by applic ation of 0.3% and 0.6% of glufosinate ammonium. The app lication of 0.3% glufosinate a mmonium is the recommended application rate, and it resulted in 100% leaf necrosis of non-tran sgenic bahiagrass and all the annual and perennial weeds that co-established during the field trail. Fig. 2-2G shows the difference between the glufosinate ammonium resistant transgenic lines 2, 3 and 33 in the center and the wild-type bahiagrass plants surrounding them that display 100% necrosis. All these, transgenic bahiagrass lines had a normal phenot ype and produced viable seeds under greenhouse and field conditions. Bahiagrass seedlings easily succumb to weed pres sure until they are 5-6 tall, and are very sensitive to phenoxy herbicides (Chambliss and Ad jei 2006). Bahiagrass pasture establishment is variable due to poor seedling vigor, slow germ ination and sensitivity to soil moisture. Poor

PAGE 27

27 stands of bahiagrass encourage weed infestation and re-seeding a poorly esta blished pasture of bahiagrass without weed control is not an effective way to in crease economic returns (Gates 2000). Most problematic is the lack of a sel ective herbicide to cont rol grassy weeds in bahiagrass. The following weeds co-established during our field trial: common bermudagrass ( Cynodon dactylon ), goosegrass ( Eleusine indica ), crabgrass ( Digitaria sanguinalis ), crowfootgrass (Dactyloctenium aegyptium ), pigweed ( Amaranthus spp.), teaweed ( Sida spinosa), and wild radish ( Raphanus raphanistrum ). All these problematic weeds displayed 100% leaf necrosis following application of 0.3% gluf osinate ammonium. This demonstrates that glufosinate ammonium resistant ba hiagrass will work effectively in weed control programs and increase the value of this low input turf and forage grass.

PAGE 28

28 Figure 2-1. Diagrammatic representation of the npt II and bar gene expression cassettes used for genetic transformation of bahiagrass. CaMV 35 S promoterNot I BamHI Not I nptII gene expression cassette (2554 bp) npt II CaMV 35S-polyA HSP-intron probeAubi-1 promoter bar gene expression cassette (2771 bp) ubi-1 intron CaMV 35S-polyA barIsce I Isce I EcoR I probeB Bgl II

PAGE 29

29 To T1 Line 52 2h 2i FG BE 0.2% glufosinateC 0.5% glufosinate 1.0% glufosinateD A WT 4 WT 24 WT 4 11 19 38 22 28 33 2 3 52 24 1 2 3 4 5 6 7 8 910 HI To T1 Line 52 2h 2i FG BE 0.2% glufosinateC 0.5% glufosinate 1.0% glufosinateD A WT 4 WT 24 WT 4 11 19 38 22 28 33 2 3 52 24 1 2 3 4 5 6 7 8 910 HI Figure 2-2. Generation and evalua tion of herbicide resistant ba hiagrass. A) Regeneration of plants from embryogenic bahiagrass callus following gene transfer. B) Transgenic bahiagrass plants established in soil in the greenhouse. C and D) Response of nontransgenic wild-type bahiagrass (WT) and transgenic bahiagrass line 4 or line 24 expressing the bar gene, 14 days after application of 0.2%, 0.5% or 1.0% glufosinate ammonium under greenhouse conditions. E) Seed-derived progeny plants of transgenic bahiagrass. F and G) Tran sgenic bahiagrass lines expressing the bar gene (center) surrounded by non-transgenic bahiagra ss plants before and 14 days after application of 0.6% glufosinate ammoni um under field conditions. H and I) Immunodetection of bar encoded phosphinothricin acetyltransferase (PAT) in T0 transgenic lines and seed-derived (T1) progeny of transgenic plants by lateral flow membrane assay (Libertylink Stix Test). Protein extr acts with detectable le vels of PAT display a PAT-specific band indicated by the arrow, whereas extracts from non-transgenic, wild-type (WT) bahiagrass shows a separate band, common to all lines which indicates the functionality of th e lateral flow membrane strip.

PAGE 30

30 Figure 2-3. Southern blot analysis of transg enic bahiagrass. Genomi c DNA (20 g) from nontransgenic wild-type (WT) and transgenic bahiagrass lines (4-52) was digested with Bgl II which cuts once in the expression cassette of the bar gene (Fig. 2-1). The full length coding region of the bar gene was used as a probe and labeled with 32 PCTP. Linearized pJFbar plasmid (20 pg) was used as a positive control (PC). Lambda HindIII was used as DNA marker. 9.4 6.5 4.3 2.0kb 2.3 23.1 WT PC4 7 11 19 22 24 2833 52

PAGE 31

31 CHAPTER 3 CO-INTEGRATION, CO-EXPRESSION AND INHERITANCE OF UNLINKE D MINIMAL TRANSGENE EXPRESSION CASSETTES IN AN APOMICTIC TURF AND FORAGE GRASS ( Paspalum notatum FLUGGE) Introduction Biolistic gene transfer is one of the most versatile plant transform ation methods (reviewed by Altpeter et al. 2005). It is the preferred met hod for simultaneous transfer of multiple genes in applications like gene stacking or pathway e ngineering because it eliminates the need for multiple Agrobacterium strains, or sequential crossing (C hen et al. 1998a; Maqbool et al. 2001; Datta et al. 2003). In contrast to Agrobacterium -mediated gene transfer, biolistic gene transfer of MCs avoids the integration of vector backbone sequences into the recipient genome (Fu et al. 2000). Vector sequences are of bacterial origin and trigger gene silencing mechanisms because of their unusual sequence composition and the inability to bind eukaryotic nuclear proteins. They often acquire dense methylation that can spread into neighboring transgenes (Jakowitsch et al. 1999). Further, vector backbone sequences may bear recombination hotspots like AT-rich sequences or origins of replication which can stimulate transgene rearrangement by plasmidplasmid illegitimate recombination (Muller et al. 1999; Kohli et al. 1999a). Persistence of prokaryotic selectable marker e xpression cassettes from vector b ackbone sequences in transgenic crops is considered problematic by most biosaf ety regulatory authoriti es. Transgene expression following biolistic transfer of minimal, linear transgene expression cons tructs lacking vector backbone sequences (MCs), has been reported in ri ce (Fu et al. 2000; Breitle r et al. 2002; Loc et al. 2002; Agrawal et al. 2005; Zhao et al. 2007), wheat (Yao et al. 2006), soybean (Gao et al. 2007); potato (Romano et al. 2003), grapevine (Vidal et al. 2006) a nd bean (Vianna et al. 2004). Plants transformed with MCs displayed lower transgene copy numbers and higher expression stability than plants transformed with whole plasmids (Fu et al. 2000; Vidal et al. 2006).

PAGE 32

32 However, several reports describe complex tr ansgene integration patterns following biolistic transfer of MCs (Breitler et al. 2002; Romano et al. 2003; Sandhu et al. 2007; Zhao et al. 2007). Co-expression frequencies of unlinked MCs were higher than previously reported for whole plasmid transformants (Fu et al. 2000; Agrawal et al. 2005). Two MCs were co-introduced into the apomictic bahiagrass cultivar Argentine. Bahiagrass is a primary forage grass in the southeastern Unit ed States and also a popu lar low-input turfgrass. Its apomictic cytotypes may provide several benefits compared to sexua lly reproducing grasses. These benefits include uniform seed progeny an d a drastically reduced gene flow by pollen. A bahiagrass tissue culture and transformation protoc ol developed in our la boratory (Altpeter and James 2005) has been successfully used to improve turf quality (Agharkar et al. 2007; Zhang et al. 2007) and to introduce other im portant traits includi ng abiotic stress resistance (James et al. 2008), insect (Luciani et al. 2007) and herbic ide resistance (Sandhu et al. 2007). Previously, genetic transformation was reported in apomictic bahiagrass genotype Tifton 7 (Smith et al. 2002) and sexual diploid cultivar Pensacola (G ondo et al. 2005). However, a detailed study of the behavior of MCs in an apomictic species is lacking. Apomictic species produce seeds by bypassing the meiotic reduction phase and hence no genetic recombination results in uniform seed progeny. This feature is desirable for tran sgenic crops as it avoids transgene segregation. However, mitotic recombination or somatic rear rangements which are often heritable can occur in plant cells (Das et al. 1990; Tovar and Lichtenstein 1992; Wang et al. 1999). Therefore it is important to investigate transgene transmission and expression in an apomictic seed progeny. Here the results from co-integration and quant itative co-expression analyses of two unlinked MCs are reported in a population of independent primary transfor mants and their apomictic seed progeny.

PAGE 33

33 Materials and Methods Gene Constructs Minim al linear transgene expression cassettes were used for transformation with the selectable marker genes, npt II and bar The expression cassette containing the npt II gene under the transcriptional regulation of the constitutive Cauliflower mosaic virus (CaMV) 35S promoter (Odell et al 1985) with HSP70 intron (Rochester et al. 1986) and CaMV 35S 3UTR (Dixon et al. 1986) was excised from plasmid pHZnptII by restriction digest with Not I (Fig. 3-1A). Plasmid pJFbar carrying the bar gene under the control of th e constitutive maize ubiquitin promoter and first intron (Christensen and Quail 1996) and CaMV 35S 3UTR (Dixon et al. 1986) yielded the minimal bar gene cassettes after re striction digest with IsceI (Fig. 3-1C). The digested MCs were subject to gel electrophoresis, excised and purified with the QIAquick gel purification kit (Qiagen Inc., Valencia, CA) acco rding to the manufacturers instruction. Plant Material, Transformation and Regeneration Em bryogenic callus of cultivar Argentine was in itiated from mature seeds as described by Altpeter and James (2005). Callus induc tion medium (CIM) contained 4.3 g l-1 MS salts (Murashige and Skoog 1962), 30 g l-1 sucrose, 1.1 mg l-1 6Benzylaminopurine (BAP), 3 mg l-1 3,6-Dichloro-2-methoxy benzoic acid (dicamba), MS vitamins and 3 g l-1 phytagel (Sigma, St. Louis, Mo.) and the pH was adjusted to 5.8. Call us was maintained in darkness at a temperature of 28C and subcultured to fresh CIM medium bi weekly. Six wks after cu lture initia tion, calli were transferred to CIM supplemented with 0.4 M sorbitol, for four to six hrs before transformation. Linear minimal npt II and bar gene expression constructs were co-precipitated on 1.0m gold particles in a 1:2 molar ra tio. Gold particles coated with npt II MC and bar MC were delivered to the target tissue, using a DuPont PDS-1000/He devi ce (Sanford et al. 1991) at 1100 psi and 28mmHg. The preparation of MCs, DNA coating of gold particles, and particle

PAGE 34

34 bombardment were performed as described in Altpeter and Sandhu (2008). Briefly, DNA was precipitated onto 1.8 mg gol d particles (60 mg ml-1 stock) using 0.1 M spermidine and 2.5 M calcium chloride. The amount of DNA delivered to the target tissue on a per shot basis was 55.5 ng npt II MC and 120.4ng bar MC. Calli were transferred to CIM medium after microprojectile bombardment, and cultured for 10 days in darkness at 28C, followed by two biweekly subcultures on selective CIMmedium containing 50 mg l-1 paramomycin and 6 g l-1 agarose at 30mol-2s-1 light intensity with 16/8-h (light/dark) photoperiod, at 28C. Following four wks of selection, actively growing calli were transferred to shoot rege neration medium containing MS salts and vitamins, 30 g l-1 sucrose, 0.1 mg l-1 BAP, and no dicamba and cultured at 150mol-2s-1 light intensity with a 16/8-h (light/dark) photope riod at 28C. Two wks, later regenerating calli were placed on hormone-free shoot regeneration medium to enha nce root formation and shoot elongation. Regenerated plantlets with roots were transplant ed to pots filled with Fafard 2 potting mix (Fafard, Inc., Apopka, FL) and cultiv ated in an air-conditioned greenhouse at 28C/20C day/night temperatur e with a natural photoperiod. Screening of Putative Transgenic Lines for Transgene Expression Putativ e transgenic lines were screened fo r the expression of the selectable marker npt II gene using a commercially available enzymelinked immunoadsorbent assay (ELISA) assay (NPTII ELISA, Agdia Inc. Elkhart, IN). The as say was performed according to manufacturers instructions, using 20 g of total protein pe r well. Transgene expre ssion was determined by visual observation. Expression of the bar gene was determined by foliar application of 0.2% glufosinate ammonium as desc ribed in Sandhu et al. (2007).

PAGE 35

35 Characterization of Transgene Integratio n, Genomic DNA Isolation, Southern Blot Analysis, Polymerase Chain Reaction (PCR) and Sequen ce Analysis of PCR Products Total genomic DNA was extracted from leaf ti ssue using the CTAB pr otocol (Murray and Thompson 1980). DNA (20g) from transgenic line s and nontransformed wild-type bahiagrass was digested with restriction enzymes having on e recognition site in the expression cassettes ( BamHI for npt II and EcoR I and BglII for bar ). The digested genomic DNA was electrophoresed overnight, and blotted onto Hybond N membrane (Amersham Pharmacia Biotech, Piscataway, NJ). The complete coding sequences for npt II and bar were isolated from their respective plasmids by restriction digestion and gel purification, and used as probes for Southern blot analysis. The npt II probe was isolated from pHZnptII us ing restriction enzymes flanking the npt II CDS ( BamHI and XhoI). The bar probe was isolated from pJFb ar using restriction enzymes flanking the bar CDS ( Mlu I and XhoI). For probe labeling, the Pr ime-a-gene labeling system (Promega U.S., Madison, WI) was used with 25ng of probe DNA and [32P] dCTP. The hybridization procedure followed that de scribed in Sambrook and Russell (2001). For PCR analysis of potential concatemer s, primers designed to amplify 3-3 bar npt II integration from genomic DNA were: Forward primer 5CTCTACACCCACCTGCTGAAG3; Reverse primer 5CGTTGGCTACCCGTGATATT3. The PCR reaction was carried out with 200 ng genomic DNA using HotStarTaq DNA polymerase (Qiagen Inc., Valencia, CA) in a buffer supplied by the manufacturer. Optimized reaction conditions were as follows: denaturation at 95C for 15 min, followed by 35 cycles of 94C fo r 30 sec, 59.3C for 1 min, 72C for 30 sec and final extension at 72C for 10 min. PCR products were analyzed by electrophoresis on 1.2% agarose gels with an expected product size of 759 bp. Amplified PCR products were cloned into pDRIVE cloning vector (Qiagen Inc., Valencia, CA) using the Qiagen PCR cloning kit. Qiagen EZ competent cells were transfor med with the ligated pDRIVE ve ctor by electroporation using a

PAGE 36

36 Biorad micropulser (Bio-Rad Laboratories In c., Hercules CA). Transformed cells were immediately placed in SOC medium and incubated at 37C for one hr following which the cells were plated on LB agar plate with the antibiotic kanamycin (50 mg l-1). Plasmids from individual colonies were purified using the QIA Mini prep kit (Qiagen Inc., Valencia CA) and further tested by PCR to confirm cloning. Samples were sequenced by MWG (MWG-Biotech Inc., High Point NC) using T7 and SP6 primer pairs and sequences were compared to the concatemeric 3-3 bar npt II template. Quantification of Protein Expression Quantita tive NPTII and PAT protein expression were analyzed with commercially available ELISA assay kits (Agdia nptII ELISA, Agdia Inc. Elkhart, IN; Envirologix LibertyLink pat/bar ELISA, Envirologix Inc ., Portland, Maine). Total protein was extracted from the second fully expanded leaf using a pr otein extraction buffer and quantified using the Bradford assay (Bradford 1976). Four independent protein extracts from two clonal plants were used for quantification and 20 g of the total protein per extract was loaded per well. The assay was performed using wild-type bahiagrass as a negative control and a known sample expressing the transgene as a positive control. Reaction ki netics were recorded at 655nm using an ELISA microplate reader (Model 680; Bi o-Rad Laboratories, Inc., Herc ules, CA). O.D values were compared within the linear rang e of the reaction kinetics at 5 00sec after additi on of the ELISA substrate. The O.D values indicative of relative expression of NPTII and PAT were plotted for 12 transgenic lines. T1 Progeny Characterization: Transgene Integration, Expression and Herbicide Resistance Ten T1 progeny plants derived from line 52 a nd 18 progeny plants derived from line 24 were used for Southern blot analysis. The pr ocedure for genomic DNA isolation, blotting and hybridization was the same as described earlier for T0 plants. Quantitative protein expression was

PAGE 37

37 analyzed for 10 T1 progeny plants from line 52 using the T0 parent as a positive control and wildtype as a negative control. NPTII and PAT prot ein ELISAs were performed using commercially available kits (Agdia nptII ELISA, Agdia Inc. Elkhart, IN; Envirologix LibertyLink pat/bar ELISA, Envirologix Inc., Portland, ME) following the manufacturers instructions. The O.D. values read at 500 sec were plotted and statistically anal yzed using Tukeys Test ( =0.05). Herbicide resistance of T1 progeny was tested by applicati on of Ignite (18.1% glufosinate ammonium, active ingredient, AgrEvo Inc ., USA, Wilmington, DE) using line 52 T0, line 24 T0 and line 4 T0 as positive controls and wild-type as nega tive control. Ten progeny plants from line 52 and 18 progeny plants from line 24 were sprayed with 5.0% glufosinate (commercial application rate) and two wks following applicati on visual observations were made for percent necrosis compared to the T0 parent. Results Transformation Efficiency and Transgene Integration A total of 21 transgen ic plants expressing npt II were regenerated following paromomycin selection. Co-transformation of both npt II and bar was detected in 20 of the 21 transgenic lines, resulting in a 95% co-t ransformation frequency. Transgene integration patterns of all regenerated lines (lines 2, 3, 4, 6, 7, 10, 11, 16, 18, 19, 21, 22, 24, 28, 32, 33, 36, 38, 39, 40, and 52) were anal yzed. Southern blot analyses were performed following restriction digestion with e ndonucleases that cut at a single site in the transgene expression casse ttes. Unique hybridizati on patterns for individu al transgenic lines confirmed the independent nature of the transgenic lines (Fig. 3-1). Transgene integration for npt II and bar showed a weak positive linear correlation (R2=0.59). Four transgenic lines displayed a single npt II integration event, 15 transg enic lines had two to four npt II integration events and; 2 transgenic lines had more than four npt II integration events (lines 21 and 37; Fig.

PAGE 38

38 3-1B). Fifteen transgenic lines had more than four bar integration events, five transgenic lines displayed 2-4 bar integration events and none of the bar lines had a single integration event (Fig. 3-1D and E). Line 16, not expressing the bar gene, displayed two integration events, while a non-expressing line (line 40) did not show co-integration of the bar gene, resulting in a cointegration frequency of bar and npt II of 95%. In contrast to the relatively simple integration patterns obtained for the npt II gene, Southern blots for the bar gene showed higher integration events and complex integration patter ns. Following restriction digest with EcoR I and hybridization with the bar probe, several lines showed a band of approximately 2.7 kb which suggests transgene concatemers. Restriction digestion with EcoR I was not able to differentiate between 3-3 or 3-5 homomultimerization due to similar expected hybridization band sizes of 2.72 kb or 2.77 kb for these two events. Table 3-1 summarizes the expected band size in Southern blot using different restriction enzy mes and transgene combinations. An additional Southern blot analysis using Bgl II (Fig. 3-1E) allowed differentiation between 3-3 and 3-5 homomultimerization. Bgl II like EcoR I, cleaves the entire bar expression cassette once (Fig. 31A; 3-1C), but at a differe nt position (1810 bp in the bar MC). Therefore, 3-3 orientation of bar concatemers results in a 3.6 kb band, whereas a 3-5 concatemer re sults in a 2.7 kb band, which was not detected. Transgenic lines 3, 4, 6, 7, 10, 11, 19, 21, 22, 24, 28, 33, and 52 (lines 2, 32, 36 and 39 were not included in the Southern blot) showed a 3.6 kb hybridization band, which suggests that they contain 3-3 bar gene homomultimers. PCR amplification of potential 3-3 bar or npt II homoconcatemers was not successful desp ite using various primer combinations. However, primers for heteromultimeric 3-3 bar-npt II concatemers supported generation of PCR amplification products of the expected product size in nine transgenic lines (3, 4, 18, 19, 21, 22 24, 32, and 39; Fig. 3-2). Cloning and sequence analysis of these amplification products

PAGE 39

39 confirmed bar-npt II 3-3 concatemers in three lines (4, 18, 21). PCR products from the remaining five lines were not cloned. Sequence analysis of the PCR amplified transgene loci detected a 363 bp truncated sequence in line 18 (position 369-730) resulting in the bar 3 end missing 175 bp and the entire CaMV 3UTR. Sim ilarly a 125 bp deletion was detected in the CaMV 3UTR of line 4 (position 611-734; Fig. 3-3). In line 21 the 3 end of the bar gene was truncated by 76 bp and the entire CaMV 3 UTR was replaced by 264 bp from the ubiquitin promoter and first intron region of vector pJFbar (Fig. 3-3). Protein Expression ELISA confirm ed NPTII expression of in 21 independent transgenic lines. Co-expression of PAT in the 20 transgenic lines containing both transgenes was further studied by herbicide treatment using 0.2% glufosinat e ammonium. Nineteen of thes e 20 lines displayed herbicide resistance indicating a 95% co-expression frequency of bar and npt II. These transgenic lines had normal phenotypes, growth habits, and seed production. Twelve independent transgenic lines were randomly selected for quantitative ELISA analysis of NPTII and PAT expression. The relative protein expression wa s analyzed by plotting the O.D values over time. O.D values at the linea r phase of the curve ( 500 sec) are shown in Figure 3-4. Relative co-expression of NPTII a nd PAT was evaluated by subtracting the O.D value of the wild-type, used as negative control. The relative protein e xpression as shown in Figure 3-4, allowed clustering of the transgenic plants into th ree categories: High expressing lines (O.D of 0.6 and above); medium expre ssing lines (O.D between 0.2 and 0.6); low expressing lines (O.D less than 0.2). High NPTII expressors include lines 4, 33, 16, 19 and 24; medium expressors include lines, 11 and 33; and low expressors include lines, 52, 7, 28, 18 and 22. High PAT expressors include lines 4, 33, 11, 19, 52 and 28; medium express ors include lines 38, 7, 18 and 22; and low

PAGE 40

40 expressors include line 24 (line 16, di d not show PAT expression). Protein expression of unlinked nptII and bar did show any correlation (R2=0.13; Table 3-3). Correlation of Transgene Integration and Protein Expression A clear correlation betw een integration ev ents and expression was not found for both npt II (R2=0.01) and bar (R2=0.1). Low or medium npt II integration events produced high protein expression in transgenic lines 19, 24 a nd 4, 33 respectively (Table 3-3). High bar integration events in transgenic lines 11, 19, 28 and 52 prod uced high PAT expression, while lines 4 and 33 with medium integration events, also displayed high protein expression (Table 3-3). Transgenic lines 11, 18, 22 and 28 with comparatively strong PAT and weak NPTII expression typically had five or more bar integration events and in all cases a lower number of npt II integration events. However, in line 24 with a single npt II integration event a nd more than five bar integration events, a high NPTII but low PAT expression was detected. Low NPTII was produced in both low (e.g. line 7) and medium npt II integration lines (e.g. line 52). In general, high protein expression was supported by both high and low transgene integration events (Table 3-3). Transgenic line 4 was the highest npt II and bar expressor despite the presence of at least one heteromultimeric 3-3 bar npt II concatemer (Fig. 3-3). NPT II expression in line 18 was 25 times lower than in line 19 with similar integration events. T1 Progeny Analysis Analysis of 10 seed-derived progeny plants from line 52 and 18 seed-derived progeny plants from line 24 showed identical bar and npt II hybridization patterns as found in their respective primary transformant (Fig. 3-5). Npt II expression level in 10 seed-derived progeny plants from line 52 showed no significant difference ( P <0.05) relative to their T0 parent (Fig. 36A). PAT expression was significantly higher fo r one of the progeny plants, but the remaining nine progeny plants showed no significant difference in expression ( P <0.05) relative to their T0

PAGE 41

41 parent (Fig. 3-6A). In contrast to the wild-type, all 10 proge ny from line 52 survived 0.5% glufosinate without any visible injury symptoms. The progeny from line 24 showed leaf tip necrosis (Fig. 3-6B) which was comparable to the T0 parent (not shown) a nd consistent with the low PAT expression (Fig. 3-4). Discussion Behavior of two unlinked, linear m inimal gene constructs without vector backbone (MCs) is described for the apomic tic turf and forage grass Paspalum notatum Co-integration and coexpression frequenc y of the unlinked bar transgene in npt II transformants was 95%, as confirmed by Southern blot anal ysis and ELISA and herbicide re sistance screeni ng, respectively. This co-expression frequency is in the same range as reported earlier for co-integrated MCs in rice (88%; Fu et al. 2000). The co-expression fr equency of MCs in bahiagrass is higher compared to most earlier reports using unlinke d plasmids in other monocot species including 65% in Kentucky bluegrass (Gao et al. 2006), 50-79% in creeping bentgrass (Wang et al. 2003), 40% in wheat (Altpeter et al. 1996 ); 37-50% in perennial ryegrass a nd Italian ryegra ss (Dalton et al. 1999) and 18% in maize (Gordon-Kamm et al. 1990). Chen et al. (1998a) identified a clear co rrelation between molar ratios of the cotransformed, unlinked plasmids, with an incr ease from 37% to 85% co-expression when the plasmid amount of the target gene was increased fr om 1:1 to 1:12 with respect to the selectable marker gene. However, such high ratios of target gene to selectable marker gene could result in reduced transformation efficiency and higher complexity of transg enic target loci. The present study confirmed that even a 1:2 molar ratio of sel ected to non-selected MCs resulted in 95% cointegration (20 out of 21 lines showed co-integration of bar and npt II genes) and co-expression (19 out of 20 lines with co-integrated bar and npt II genes co-expressed both transgenes). Cotransformation with a 1:3 mola r ratio of two unlinked plasmids resulted in 87% co-

PAGE 42

42 transformation and 59% co-expressi on frequency in transgenic ri ce (Vain et al. 2002). Complex transgenic loci containing multiple intact and/or truncated copies were observed in transgenic rice following biolistic transfer of plasmids (Vain et al. 2002). Such complex loci and higher copy number have been associated with low tr ansgene expression due to silencing or other transcriptional limitations (Matzke et al. 1994, Vain et al. 1999; Allen et al. 2000; Vain et al. 2002). Biolistic transfer of MCs has resulted in simp ler transgene integrati on patterns with higher expression stability than using whole plasmids (F u et al. 2000; Vidal et al. 2006). Southern blot analysis of bahiagrass revealed a more complex tr ansgene integration pattern for the non-selected bar than for the selected npt II MC. The high co-expression frequency of both transgenes (95%) suggests that there is an absence of a selectiv e advantage for low complexity. Interestingly, the lower quantity of npt II compared to bar MCs used during transformation seems to be correlated to the copy number as proposed earlier by Vain et al. (2002) for co-tra nsformation of unlinked plasmids. Transgene copy number could be posit ively or negatively related to its expression (Hobbs et al. 1990). Kohli et al. (1999b) also reported that in creased copy number does not always result in reduced expres sion levels or silencing. Integr ation of quantitative ELISA and Southern blot data showed that high expression of MCs in bahi agrass was independent of copy number. Most lines with high bar copy number also exhibite d high PAT expression (eg. 11, 19, 28 and 52); the only exception was low PAT expression in line 24 high bar copies. These results suggest a low gene silencing frequency in the high copy number transgenic bahiagrass lines. Functional analysis also showed th at the transgenic lines with complex integration were resistant to the commercial application rate of Ignite herbicide under greenhouse and field conditions (Sandhu et al. 2007).

PAGE 43

43 Southern blot data suggested the presence of bar homoconcatemers in several transgenic bahiagrass lines. In addition, PCR analysis indica ted that nine out of 20 transgenic lines had heteromultimeric bar npt II concatemers. Sequence analysis of transgenic loci confirmed deletions and insertions in the 3 UTR region of the MCs consistent with the size of the PCR amplification products. The absence of geno mic DNA in these concatemers suggests that recombination events took place prior to integr ation and may be favored by the presence of potential recombination hot s pots in the CaMV 3UTR. The CaMV 3UTR was used in both, bar and npt II gene constructs which could have caused the frequent formation of heteromultimeric bar npt II concatemers. The presence of the CaMV 35S promoter resulting in concatemers and recombination hotspots in this sequence was also proposed (Kohli et al. 1999a). Elimination of the vector backbone may reduce gene clusteri ng and other transgene rearrangements by limiting the substrate availability for homologous recombination prior to transgene integration as proposed by Agrawal et al. 2005. However, the pr esence of recombinoge nic sequences within the MCs and larger quantities of MC molecules during transformation may enhance the complexity of transgenic loci. In agreement with the present fi ndings, several earlier reports also described complex transgene integration patterns following biolistic transfer of MCs (Breitler et al. 2002, Romano et al. 2003, Zhao et al. 2007). Tr ansgene loci with 3-3 concatemers may support the formation of double stranded RNA by read through transcription and RNAi induced gene silencing (reviewed in Iyer et al. 2000). In terestingly, 3-3 concatemers were confirmed in both line 18 and line 4. Despite the presence of 3-3 npt IIbar heteroconcatemers, both transgenes were highly expressed in line 4. In contrast, line 18 showed a low bar expression. Other possible sources of variati on in transgene expression include position effects, and effects caused by somaclonal variation and regulatory se quences (Butaye et al. 2005). Despite the

PAGE 44

44 complex integration of MCs a high co-expressi on frequency was observed in bahiagrass and these earlier studies. This suggest s that most of the MCs may inse rt at independent loci, while plasmid sequences on the other hand tend to b ecome physically and gene tically linked (Perucho et al. 1980; Lyznik et al. 1989). Co-transformed, unlinked plasmids typically co -segregate as a singl e genetic locus (Hadi et al. 1996; Chen et al. 1998b). In contrast, the vast majority of co-integrated, unlinked MCs segregated as independent genetic loci (Romano et al. 2003; Agrawal et al. 2005). Cosegregation of multiple transgene expression casse ttes as a single genetic locus is critically important for gene stacking and pathway engineeri ng. Therefore, the report ed segregation of cointegrated unlinked MCs as independent genetic loci presents a severe limitation of the MC technology in sexually reproducing sp ecies. In contrast, transformation of apomictic species like bahiagrass with MCs allows gene stacking and overcomes this limitation. However, segregation of single transgenes from a co-transformed, unlinke d selectable marker gene may be desirable to simplify the regulatory process and improve consumer acceptance (Rosellini and Veronesi 2007). This approach has been used in generatin g marker free transgen ic plants (reviewed by Ebunima et al. 2001 and Darbani et al. 2007). Hen ce, concerns about selectable marker genes need to be addressed differently in apomictic species. Alternatives include marker removal by site-specific recombination (H are and Chua 2002), genetic progr amming (Verweire et al. 2007), marker free regeneration of transgenic plants (Popelka et al. 2003) and use of alternative selection markers (Joersbo et al. 1998; Erikson et al. 2004). Gene dosage is a critical factor determini ng transgene expression and stability in the progeny. Additive effects on transgene expression were reported in homozygous transgenic rice lines; the homozygous state may be associated with lower transgene expression levels, gene

PAGE 45

45 silencing or counter selecti on of homozygous plants across generations (James et al. 2002). Hence, T0 parents may provide little information about future transgene behavior and stability. Transgene instability caused either by inher itance or expression limits the utility of early generation testing (Breg itzer and Tonks 2003). Obligate apomictic target species like the ba hiagrass cultivar Argentine, produce uniform seed progeny without segregation of genetic lo ci due to the bypassing of meiosis and hence maintain a hemizygous state of the transgene in the progeny. This system will increase transgene stability in the progeny and will be useful fo r multigene stacking. Gene tic transformation of other apomictic grass species has be en reported in Kentucky bluegrass ( Poa pratensis L.; Ha et al. 2001; Gao et al. 2006), Dichanthium annulatum (Dalton et al. 2003; Kumar et al. 2005), buffel grass ( Cenchrus ciliaris L.; Batra and Kumar 2003) and blue grama grass ( Bouteloua gracilis ; Aguado-Santacruz et al. 20 02). However, transgene transmission in the apomictic progeny has not been analyzed in most cases a nd so far only introduction of full plasmids was described in these apomicts. Dalt on et al. (2003) reported 68-100% hph transgene expression and identical hybridization patterns in seed derived progeny from thr ee transgenic lines. Identical uid A gene integration pattern and no transgene expression in the progeny were correlated to apomictic inheritance of transgen es, but lack of expression due to transgene silencing following biolistic transfer of plasmids. Gene integration patterns identical to the parent and 100% transgene transmission in seed derived progeny fr om bahiagrass showed apomictic inheritance of bar and npt II genes. Uniform expression levels of co-transformed MCs in apomictic seed progeny and high co-expression frequency (95%) obt ained here will likely facilitate multitransgene stacking in bahiagrass.

PAGE 46

46 Agrobacteriummediated gene transfer has been reported to result in partial vector backbone integration with frequencies between 31 and 70% (Zhang et al. 2008; Afolabi et al. 2004; Shou et al. 2004; Lange et al. 2006). Transgene integration through either Agrobacteriummediated or biolistic transfor mation has been proposed to occur through a similar mechanism involving illegitimate recombination (Zhang et al. 2008; Kohli et al. 1999b). Complex transgene loci commonly associated with biolistic transformation have al so been reported in Agrobacterium -mediated transformation (Kononov et al 1997; Zhang et al. 2008). Clean DNA technology, employing the use of MCs for biolistic transformation is not only important to increase transgene expression stab ility but may also facilitate regulatory approval for commercial release. Our results demonstrate that biolistic co -transformation of MCs supports efficient transformation of the commercially important, apomictic turf and forage grass bahiagrass. High level of transgene co-expression, uniform transg ene transmission and expression in apomictic seed progeny plants that excluded vector backbo ne sequences from the bahiagrass genome were observed.

PAGE 47

47 Table 3-1. Southern blot expected band size from MC/concatemers Orientation MC/concatemer Restriction enzyme Probe Expected size of band (kb) bar MC EcoRI bar CDS 1.36 bar MC Bgl II bar CDS 0.96 npt II MC BamHI Npt II CDS 1.47 3-3 bar-bar EcoR I bar CDS 2.72 5-5 bar-bar EcoR I bar CDS ND 3-5 bar-bar EcoR I bar CDS 2.77 3-3 bar-bar Bgl II bar CDS 3.62 5-5 bar-bar Bgl II bar CDS ND 3-5 bar-bar Bgl II bar CDS 2.77 3-3 npt IInpt II BamHI npt II CDS 2.15 5-5 npt IInpt II BamHI npt II CDS ND 3-5 npt IInpt II BamHI npt II CDS 2.56 3-5 bar npt II EcoR I bar CDS 3.92 3-5 npt IIbar BamHI npt II CDS 3.85 3-3 bar npt II EcoR I bar CDS 3.92 5-3 npt IIbar BamHI npt II CDS 3.85 NDnon-detectable in Southern blot. 5-5 concatemers cannot be detected using a restriction enzyme which cuts upstream of the probe. Table 3-2. Expression analysis of unlinked transgenes Line % transgene expression npt II bar 4 100 100 33 83.15 65.31 24 72.75 7.96 19 70.22 52.24 38 50.84 38.16 11 29.21 65.31 52 10.39 54.08 7 7.36 24.08 28 3.85 68.98 18 3.51 19.39 22 3.48 41.02 Line 16 was excluded, sin ce it did not express the npt II gene. Percent transgene expression of all transgenic lines was calculated from the O.D values and using the highest expressing line as 100%.

PAGE 48

48 Table 3-3. Transgene integration and expressi on level based on Southern blot and ELISA Integration Low (1-2 hybridization signals) Medium (3-5 hybridization signals) High (> 5 hybridization signals) Expression npt II bar npt II bar npt II bar Low (O.D<0.2) 7, 16, 18 28 24 Medium (O.D 0.2-0.6) 22, 38 7, 38 11 18, 22 High (O.D>0.6) 19, 24 16 4, 33 4, 33 11,19, 28, 52

PAGE 49

49 Figure 3-1. Expression cassettes and Southern blot analysis of 21 transgenic lines. A) npt II gene xpression cassette (2.5 kb) used for biolisti c transformation. Also shown is full-length npt II gene used as the probe. B) Southern blot for the npt II transgene. Genomic DNA from transgenic lines and wild-type were digested with Bam HI, which was unique in the npt II MCs. Full-length coding sequence of the npt II gene was used as probe. PC refers to the positive control which was lin earized plasmid pHZnptII (5.1 kb); NC, the negative control was untransfor med wild-type bahiagrass. C) bar gene expression cassette (2.7 kb) used for biolistic transf ormation. Full-length coding sequence of the bar gene was used as probe. D) Southern blot for the bar gene with Eco RI. Genomic DNA was digested which has a single site in the bar gene expression cassette. Linearized pJFbar plasmid (9.8 kb) was used as positive control and wild-type bahiagrass genomic DNA was the negative control. E) Southern blot for the bar gene prepared using restriction enzyme BglII, which has a unique site in the bar MC. The restricted genomic DNA was electrophores ed, blotted and hybridized with the bar gene CDS following standard procedures. Lamda HindIII DNA marker was used to assess band size .CaMV 35 S promoterNot I BamHI Not I npt II gene expression cassette (2554 bp) npt II CaMV 35S-polyA HSP-intron probeAPC 4 7 11 192224 2833 523 6 101618213239 38 40 362NC kb PC 4 7 1119 22242833523 6 10 16182132393840362 NC 2.3 9.4 6.5 4.3 23.1 B23.1 kb 9.4 6.5 4.3 2.3D Dubi-1 promoter bar gene expression cassette (2771 bp) ubi-1 intron CaMV 35S-polyA barIsce I Isce I EcoR I probeC Bgl II

PAGE 50

50 Figure 3-1. contd. 346 7 10 111618 19 21 22 24 2833 38 4052PC NC kb 2.3 9.4 6.5 4.3 23.1 E

PAGE 51

51 Figure 3-2. PCR analysis of putative bar npt II 3-3 concatemers. Prim er pairs were designed to amplify 3-3 bar npt II concatemers from the genomic DNA of T0 transgenic lines. Forward primer 5CTCTACACCCACCT GCTGAAG3; Reverse primer 5CGTTGGCTACCCGTGATATT3. The e xpected product size was 759bp. L1kb ladder;WT-wild-type and; NC-negative control L 3 4 6 7 10 11 16 181921 2224 L28323339 38 252 WTNC L 3 4 6 7 10 11 16 181921 2224 L28323339 38 252 WTNC

PAGE 52

52 Figure 3-3. Sequence analysis of transgenic bahiag rass lines.The primers were designed for a 33 barnpt II gene concatemer with forward primer in the bar gene and reverse primer in the npt II gene. The PCR product sequence was aligned with the concatemer sequence (as described in the diagram) using BLAST and mismatched sequence stretches were separately a ligned to configure rearrange ments in the vector DNA. probe 1 310 468 731 925 1068 1751 Ubi-1 promoter ubi-1 intron bar CaMV 35S poly A EcoRI 3.9kb npt II HSPintron CaMV 35S promoter probe 1 310 468 731 925 1068 1751 Ubi-1 promoter ubi-1 intron bar CaMV 35S poly A EcoRI 3.9kb npt II HSPintron CaMV 35S promoter line 21310ctctacacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcgctgtcatcgggctgcccaacgacccga gcgtgcgcatgcacgaggcgctcggatatgccccccgcggcatgctgcgggcggccggcttcaagcacgggaactg468 468[gggagatctggttgtgtgtgtgtgcgctccgaacaacacgaggttggggaaagagggtgtggagggggtgtctat ttattacggcgggcgaggaagggaaagcgaaggagcggtgggaaaggaatcccccgtagctgccggtgccgtgaga ggaggaggaggccgcctgccgtgccggctcacgtctgccgctccgccacgcaatttctggatgccgacagcggagca agtccaacggtggagcggaactctccgccccaattc] 730 731tagggataacagggtaatgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtattttacaa atacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattcccttatctgggaactactcac acatattatggagccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcg ataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacg1068line 18310 ctctacacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcgctgtc369 369{ atcgggctgcccaacgacccgagcgtgcgcatgcacgaggcgctcggatatgccccccgcggcatgctgcgggcggccg gcttcaagcacgggaactggcatgacgtgggtttctggcagctggacttcagcctgccggtaccgccccgtccggtcctgcccgtca ccgagatttgactcgagtttctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttga gcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaat ccagatcccc } 730 731ctagggataacagggtaatgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtattttaca aatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattcccttatctgggaactactc acacattattatggagccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcgg cgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacg1068line 4 310tctacacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcgctgtcatcgggctgcccaacgacccgag cgtgcgcatgcacgaggcgctcggatatgccccccgcggcatgctgcgggcggccggcttcaagcacgggaactggcatgacgt gggtttctggcagctggacttcagcctgccggtaccgccccgtccggtcctgcccgtcaccgagatttgactcgagtttctccataataa tgtgtgagtagttcccagataagggaattagggttcctataggg610 611{ gtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaa ccaaaatccagtactaaaatccagatccccctag } 734 735gataacagggtaatgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtattttacaaatac aaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattcccttatctgggaactactcacacat tattatggagcagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgatacc gtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacg1068[ ] parentheses indicate inserted base pairs where bold base pairs indicate an insertion matching a 264bp sequence from the ubiquitinpromoter and first intron region of vector pJFBarin replacement of the region 468 to 731 shown in the graph above. { } parentheses indicate deleted base pairs where underlined basepairsare the missing base pairs

PAGE 53

53 Figure 3-4. The npt II and bar transgene expression levels for T0 transgenic lines. NPTII and PAT ELISAs were performed as per manufacturers instructions using wild-type nontransformed bahiagrass as the negative c ontrol and known transgene expressing plant as positive control. The O.D values (655nm) obtained after 500 seconds of addition of ELISA substrate are plotted for relative expression of npt II and bar transgenes. 0 0.3 0.6 0.9 1.2 1.54163324193811527281822 nptII bar Independent Transgenic LinesTransgene Expression O.D. (655nm) at 500 sec.

PAGE 54

54 Figure 3-5. Southern blot analysis of T1 progeny plants. Southern blot analysis for characterization of T1 progeny plants was as described for T0 plants in Fig. 3-1. A) npt II transgene integration pattern of T0 and 10 T1 progeny plants obtained from line 52). B) bar transgene integration pattern of T0 and 10 T1 progeny plants obtained from line 52. C) npt II transgene integration pattern of T0 and 18 T1 progeny plants obtained from line 24. D) bar transgene integration pattern of T0 and 18 T1 progeny plants obtained from line 24 Lambda HindIII was used as DNA marker. 23.1 6.5 4.3 9.4 2.3 WT T01 2 3 4 56 78 9 10PC A kb 23.1 6.5 4.3 9.4 2.3 WT T01 2 3 4 56 78 9 10PC A 23.1 6.5 4.3 9.4 2.3 WT T01 2 3 4 56 78 9 10PC A kbPCT01 2 3 4 56 78 910WT 4.3 9.4 2.3 6.5 B kb PCT01 2 3 4 56 78 910WT 4.3 9.4 2.3 6.5 B kb23.1 6.5 9.4 PC T01 2 3 4 56 78 91011 12 13 14 15 16 17 18 WT C 4.3 2.3 kb 23.1 6.5 9.4 PC T01 2 3 4 56 78 91011 12 13 14 15 16 17 18 WT C 4.3 2.3 kbkb 9.4 PC T01 2 3 4 56 78 91011 12 13 14 15 16 17 18 WT D 23.1 6.5 4.3 2.3 kb 9.4 PC T01 2 3 4 56 78 91011 12 13 14 15 16 17 18 WT D 23.1 6.5 4.3 2.3

PAGE 55

55 Figure 3-6. Transgene expression analysis in T1 progeny. A) Npt II and bar transgene expression for T1 progeny plants from line 52. NPTII a nd PAT ELISA was performed following manufacturers instructions using wild-type non-tr ansformed bahiagrass plant as negative control and known transgene expressing plant as positive control. Tukeys test at =0.05 showed no significant difference between the T0 parent and T1 progeny except when indicated by asterisk (*). B) Herbicide resistance of T1 progeny plants. Progeny plants from line 52 and line 24 in comparison to wild-type bahiagrass 2 weeks after treating with 0.5% glufosinate. 0 0.1 0.2 0.3 0.4 T0T1T2T3T4T5T6T7T8T9T10 nptII bar ALine 52 T1 progeny=0.05O.D. (655nm) at 500 sec.Transgene Expression in T1 progeny WT 52 T124 T1B 0 0.1 0.2 0.3 0.4 T0T1T2T3T4T5T6T7T8T9T10 nptII bar ALine 52 T1 progeny=0.05O.D. (655nm) at 500 sec.Transgene Expression in T1 progeny 0 0.1 0.2 0.3 0.4 T0T1T2T3T4T5T6T7T8T9T10 nptII bar ALine 52 T1 progeny=0.05O.D. (655nm) at 500 sec.Transgene Expression in T1 progeny WT 52 T124 T1B

PAGE 56

56 CHAPTER 4 POLLEN-MEDIATED GENE FLOW FROM TRANSGENI C APOMICTIC TETRAPLOID BAHIAGRASS AND BREEDING BEHAVIOR OF INTRA-SPECIFIC HYBRIDS Introduction Bahiagrass ( Paspalum notatum ) is the single most importa nt seed propagated pasture species in Florida (Chambliss a nd Sollenberger 1991). The most dominant cytotypes in its native South American habitat are te traploid (2n=4x=40) which produce seed asexually through apomixis (Pozzobon and Walls 1997). Naturally occu rring sexual tetr aploid plants have not been found in P. notatum (Espinoza et al. 2006). A diploid cy totype known as Pensacola bahiagrass was introduced in Florida in 1945 and is sexual a nd cross pollinating due to self-incompatibility (Quarin et al 2001). This diploid race of bahiagrass represents th e dominant cytotype naturalized in the southeastern US, but naturally occurs onl y in a small area in the Santa Fe province in Argentina (Burton 1967; Blount et al. 2002). They are allogamous self-incompatible and wind pollinated (Burton 1955). Apomixis in Paspalum notatum is characterized by apospor y, where unreduced embryo sacs develop from nucellar somatic cells. Sexual or apomictic plants can be differentiated on the basis of structure, number of embryos sacs pe r ovule and orientation of the egg cell in the embryo sac. A sexual plant has a characteristic si ngle embryo sac, with the egg cell towards the micropylar end and antipodals towards the chala zal end. Apomictic plants show multiple embryo sacs with an unreduced egg cell a nd central nuclei, but lack the an tipodal cells (Ortiz et al. 1997; Quarin et al. 2001). There are two hypotheses to explain the co mplete absence or lack of expression of apomixis in diploid cytotypes. The first hypothesis proposed by Nogler (1984) is based on the assumption that monoploid (n=x) gametes cannot transfer the apomictic trait. Apomixis is thus a monogenic dominant trait th at can only be transmitted in the heterozygous state through diploid or pol yploid gametes. Apospory in P. notatum and P. simplex is inherited as

PAGE 57

57 a single dominant gene with tetrasomic inheritanc e and incomplete penetrance (Martinez et al. 2001). A pleiotropic lethal effect is proposed to prevent transmission of apospory through monoploid gametes (Martinez et al. 2001; Caceres et al. 2001). The second hypothesis proposed by Mogie (1988) assumes a dosage requirement for the expression of apomixis. The absence of apomixis in diploids is hence an expression effect rather than non-transmission of apomictic genes (Quarin et al. 2001). Triploid hybrids obtained from sexual 2x and apomictic 4x crosses are ideal plant material to study inheritance of apomixis in P. notatum and also to evaluate the lack of apomixis at the diploid level (Martinez et al. 2007). Molecular markers such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) completely linked to apospory have been described (Ortiz et al. 1997; St ein et al. 2004; Martinez et al. 2003). RFLP rice C1069 locus is a codominant marker mapping to the telomeric lo ng arm of chromosome 12 in rice. It is considered to be completely linked to apospory in P. simplex and P. notatum (Pupilli et al. 2001; Martinez et al. 2003). The apomictic bahiagrass cultivar Arge ntine is a preferred target for genetic transformation since its apomictic mode of reproduction should allow the production of uniform seed progeny and potentially reduce the risk of unintended gene dispersal by pollen. It is also a commercially important cultivar and genetic im provement through traditional breeding has not been possible due to the lack of female meio tic recombination during seed production. Genetic transformation of bahiagrass has been reported fro m several laboratories and improvement of the species following introduction of transgenes wa s documented. Smith et al. (2002) first reported the recovery of transgenic bahiagrass plants after bio listic introduction of bar gene into the apomictic bahiagrass accession Tifton 7. Altpeter and James (2005) described a highly efficient

PAGE 58

58 biolistic transformation protocol for the commerci ally important, apomictic cultivar Argentine. This protocol has now been successfully used to introduce a number of important traits to Argentine including herbicide resist ance (Sandhu et al. 2007); abiotic stress tolerance (James et al. 2008) and improved turf quality (Agharkar et al. 2007; Zhang et al. 2007). Transgenic, herbicide resistant bahiagrass pl ants of the sexual diploid cul tivar Pensacola (Gondo et al. 2005) and insect resistant plants from diploid cultivar Tifton 9 have also been reported (Luciani et al. 2007). Pollen-mediated gene transfer is an e nvironmental concern regarding genetically modified (GM) plants. Transgenic crops can be broadly categorized into high, medium and low risk crops based on the reproductive biology, mo de of pollination, locat ion of the crop and production area. Crop species which are genetically distinct and in trogression is limited to the geographic center of diversity are considered very low risk crops. Wind cross-pollinated species that have a prevalence of relatives in the same genus are considered high risk crops (Stewart et al. 2003). Tetraploid to diploid gene flow may occur through the formation of triploids. Naturally occurring triploids have been found near the center of diversity for Paspalum notatum (Quarin et al. 1989; Tischler and Burson 1995) Because of the ploidy barrier very low gene transfer frequencies are expected from tetraploid to diploid bahiagrass. Detailed reproductive and cytogenetic characterization of hybr id plants will add valuable in formation for risk assessment of transgenic bahiagrass. Using herbicide resistance as a screenable ma rker allows efficient identification of rare pollen-mediated gene transfer events and can also help to monitor the mo de of reproduction in apomictic tetraploids. Embryo sac analysis using an ovule clearing technique enables the

PAGE 59

59 differentiation of apomictic or meiotic embryo sacs (Young et al. 1979; Quarin et al. 1982; Acuna et al. 2007). However, whether meiotic em bryo sacs present in apomictic plants form viable seeds is unclear. Seed pr ogeny analysis is hence important to determine the frequency of functional apomixis or amphimixis (Ozias -Akins 2006). Any sexual reproduction in a heterozygous apomictic plant will produce off-type individuals. A quantitative assessment of the degree of sexuality versus apomixis can be estimated by the use of a dominant phenotypic marker. Flow cytometry is a widely used tech nique for rapid detecti on of DNA ploidy (Valkonen 1994; Taliaferro et al. 1997; Dolezel et al. 1997; Roux 2003; Dolezel et al. 2007). It has been applied for large-scale comparative analyses of genome size, repr oductive biology, taxonomic identification and delineation (reviewed by Kron et al. 2007 and Ochatt 2008). The flow cytometeric seed screen (FCSS; Matzk et al. 2000) is an alternative method to establish apomixis or amphimixis mode of reproduction. The objectives of this work were to determin e the frequency of gene flow from transgenic apomictic tetraploid bahiagrass to sexual diploi d or apomictic tetraploid bahiagrass cultivars under field and greenhouse conditions, and charac terize intra-specific hybrids for transgene integration, ploidy, fertility and mode of reproduction. Materials and Methods Pollen Donor The pollen donor for this gene flow study wa s a transgenic herbicide resistant bahiagrass line (B9). This line was generate d by Dr. Victoria James Hurr (P ost-doctoral Fellow, Department of Agronomy, University of Florida, Gainesvi lle) in our laboratory by the transformation of apomictic tetraploid bahiagrass cultivar Argent ine with pJFbar. Plasmid pJFbar contains the bar gene (Thompson et al. 1987) under the control of the constitutive maize ubiquitin promoter and first intron (Christensen and Qu ail 1996) and CaMV 35S 3UTR (D ixon et al. 1986). Transgenic

PAGE 60

60 calli and regenerating shoots were selected fo r herbicide resistance by inclusion of 3mg l-1 bialaphos (Phytotechnologies In c., Shawanee Mission, KS). Furthe r characterization of line B9 was carried out as part of this st udy. Southern blot analysis of the bar gene was carried out by Bgl II digested genomic DNA from line B 9. Blotting and hybridization with the bar probe was carried out according to sta ndard procedures (Sambrook and Russell 2001). Viable pollen is required for apomictic seed production in Argen tine. Formation of viable seed by complete exclusion of pollen (selfing) from other plants is indicative of viable pollen production by the mother plant. The emerging inflorescences were bagged in a glassine po llination bag to exclude foreign pollen. The bags were shaken every morning (between 6:30 to 7:30 AM) to ensure pollination. The viability of self ed seeds was checked by germination. In order to confirm the apomictic seed production of line B9, a set of 30 seed-derived progeny plants were sprayed with 0.3% glufosinate i.e the recommended a pplication rate of the herbicide. Greenhouse Experiment Layout Non-transgenic bahiagrass plants were placed at a distance of 0.5 to 2.5m from transgenic bahiagrass (B9). Open-pollination under air-conditioned greenhouse conditions allowed transgene containment. The greenhouse environment also facilitated the synchronization of flowering of transgenic pollen donor plants and non-transgenic pollen receptor plants. A flex duct system ensured continuous and even airflo w supporting pollen dispersal. An ebb and flow irrigation system increased the humidity and su pported the production of high quality seed. The plants were maintained at 28C day and 23 C night temperature and natural photoperiod. Equal numbers of B9 pollen donor plants (10) were used in all experiments to generate similar pollen sources. The greenhouse experiment s to assess the hybrid ization potential of transgenic apomictic bahiagrass with non-transgenic bahiagrass were carried out in five sets in different greenhouses:

PAGE 61

61 1) pollen-mediated gene transfer from transg enic apomictic tetraploid to a population of 30 different non-transgenic sexual di ploid bahiagrass genotypes; 2) pollen-mediated gene transfer from transgenic apomictic tetraploid to 30 clonal plants of a single diploi d genotype i.e. clone1; 3) pollen-mediated gene transfer from transgenic apomictic tetraploid to 30 clonal plants of a second single diploid genotype i.e clone21; 4) pollen-mediated gene transfer from transgenic apomictic tetraploid to three nontransgenic highly apomictic tetraploids i.e. cv. Argentine, cv. Paraguay22 and the experimental hybrid Tifton 7; and 5) pollen-mediated gene transfer from transgenic apomictic tetraploid to a non-transgenic facultative apomictic tetraploid accession with a known high degree of sexuality(determine d by embryo sac analysis). This accession was provided by Carlos Acuna (Graduate student, Department of Agr onomy, University of Florida, Gainesville, FL) for this study and is referred to as facultative tetr aploid for simplicity. Field Experiment Layout The field study was conducted for tw o consecuti ve years (2005 and 2006) at North Florida Research and Education Center (NFREC), Mari anna, FL. Transgenic apomictic pollen donor plants (24 plants plot-1) were planted in a circle of 0.5m radius. An adjace nt concentric zone of 1m was left without plants, followed by a concen tric 0.5m strip of non-transgenic bahiagrass. Two plots represented 2 replicati ons of each of the two experime nts. The first experiment was similar to greenhouse set 1 with 64 non-transgenic diploid cultivar Pensacola plants as pollen receptors planted in the outer 0.5m strip. The se cond experiment was similar to greenhouse set 4 with 64 non-transgenic highly apomictic tetrap loid bahiagrass genotypes planted as pollen receptors in the 0.5m strip. The tetraploid pollen recipients including Argentine, Paraguay 22 and 1 Clonal plants for the second and third experiment set were generated by clonal propagation of a single seedling of cultivar Pensacola in liquid culture media containing 4.3 g l -1 MS salts with vitamins (Murashige and Skoog 1962), 30 g l-1 sucrose and 0.3 mg l-1 6Benzylaminopurine (BAP).

PAGE 62

62 Tifton 7 were selected based on their abundance and/or availability in Florid a. Total diameter of each plot was 4m. All plants were clonally propa gated in greenhouses and transplanted to the field in May, 2005. Transgenicand non-transgenic plants were ca 0.5m apart at full maturity, and maximum distance between the pollen recep tor and pollen donor was 2.5m. The field study was carried out in compliance with USDA-AP HIS guidelines (Notification no. 05-076-11n and Permit No.05-364-01r). In order to prevent seed dispersal by birds or animals, cage-like structure were built on a wooden scaffold with mosquito ne t. The four transgenic plots were separated by a distance of 30 to 88m. An isolation zone of 100 m surrounding the transgenic plots was mowed weekly. Open-pollination and Seedhead Collection Transgenic pollen donor and non-transgenic poll en receptor plants were allowed to open pollinate (O.P.) in the greenhouse and field. At an thesis, the inflorescences were marked with a colored tape to monitor synchronous flowering of transgenic pollen donors and non-transgenic pollen receptors. O.P. seed heads were bagged in glassine pollination bags 10 days after pollination to prevent seed loss (Fig. 4-1A-B). Mature seeds were harvested 30 days after pollination, air dried, and stored in double containe rs at room temperature. Seed head collection continued until the end of flowering. Screening of Seed Progeny The seeds obtained from non-transgenic plants were germ inated following acid treatment to break seed dormancy. Seedlings were grow n in germination flats containing Fafard 2 potting mix (Fafard Inc., Apopka FL) and were ma intained in the greenhouse at 28/23C day / night temperature and natural phot operiod. The herbicide concentr ation was optimized for this study to identify even those tr ansgenic hybrids expressing the transgene at a low level. A concentration of 0.14% glufosin ate ammonium (Ignite, ArgEvo Inc., Wilmington, DE) was

PAGE 63

63 applied to seedlings until runoff at six weeks afte r germination (Fig. 4-1C-D). This is the lowest concentration of glufosinate ammonium that st ill produces 80 to 100% necrosis in non-transgenic bahiagrass. Herbicide resistant seedlings (F1 hybrids) were scored for necrosis three weeks after glufosinate application. The herbic ide resistant putative hybrid s eedlings were transplanted to pots for further characterization. Hybrid Confirmation Transgene expression Protein extracts of the herbicid e resistant putative hybrid plan ts were analyzed with the immuno-chrom atographic lateral membrane Quick Stix (LibertyLink/ bar Envirologix, Portland, ME) assay for the determination of bar gene product phosphinothricin acetyl transferase (PAT). Total protein was extracted from 300mg leaf tissue using 150 l extraction buffer (supplied with the kit). Protein extracts from non-transformed wild-type bahiagrass were used as a negative control (NC) and known transgen ic plant(s) expressing PAT (B9) was used as positive control. Transgene integration Southern blot analysis wa s carried out to evalu ate bar gene integration into the genome of the putative hybrid plants. Genomic DNA was extracted fr om fresh leaf tissu e according to the CTAB method (Murray and Thompson 1980). DNA wa s subjected to electrophoresis following digestion with Bgl II which has a unique site in the pl asmid pJFbar. Blotting and hybridization procedures were carried out following a sta ndardized protocol (Sambrook and Russell 2001). The full-length coding sequence of the bar gene was radio-labeled with [32P] dCTP using the Prime-a-gene labeling system (Promega, U. S., Madison, WI) and used as a probe.

PAGE 64

64 Hybrid Characterization: Phenotype Herbicide resistant hybrid (F1) plants verified by Southern bl ot analysis were maintained under greenhouse conditions at 28C day, 23 C night and natural photoperiod. Visual observations for phenotypic character istics such as leaf width and growth habit (prostrate or upright) were recorded from two vege tative clones per hybrid plant. Hybrid Characterization: Cytogenetic Flow cytometric determination of ploidy F1 hybrid plants obtained from the seed progeny of O.P. sexual diploids were characterized for DNA ploidy using a Partec Ploidy Analyzer P.A (Partec North Am erica Inc., Mt. Laurel, NJ). Shoot apical meristems (ca. 5mm section) were macerated in 500l Partec CyStain UV solution A (supplied with the kit) using a clean razor blade. The material was incubated for 3 min at room temperature followed by filtrati on through 1 micron nylon mesh. Th e filtrate was stained with 1500l Partec CyStain UV solution B (supplied with the kit) for 3 min before reading. Mean peak values were recorded when cell count were ca. 10,000. The analyzer was arbitrarily calibrated using a known tetraploid bahiagrass (Argentine), and a known diploid bahiagrass cultivar (Pensacola). The peak values indicate the average of four inde pendent sample extracts. Karyotypic analysis using root-tip preparations Cleaned healthy roots (ca. 5cm ) were pretreated with 8-hydroxyquinoline followed by overnight treatment with fixative (95% ethanol: acet ic acid, 3:1 v/v). Fixe d material was stored in 70% ethanol. For root-tip preparations, ca. a 2mm section of the root-tip (excluding the root cap) was excised and chopped in 45% acetic acid followed by addition of aceto-orcein stain. A cover slip was carefully placed, a nd gently tapped to spread the cells. The material was allowed to stain for 30 min before observing under a compound microscope. Chromosomes were counted at 500x or 1000x magnification.

PAGE 65

65 Hybrid Characterization: Reproductive Embryo sac analysis Inflorescences were co llected at anthes is and fixed in FAA (70% ethanol: 37% formaldehyde: glacial acetic acid, 18 :1:1) for 24 hrs. Pistils were di ssected from the spikelets and prepared following the ovule clear ing technique of Young et al (1979). Ovules were observed under a differential interference contrast (DIC) microscope (Nikon Melville, NY). A minimum of 20 ovules were observed for each plant analyz ed. Meiotic embryo sacs were characterized by a single embryo sac containing the egg cell and the central nuclei at the micropylar end and mass of anitpodals at the chalazal end. Apomictic embryo sacs were differentiated from sexual embryo sacs by the presence of multiple embryo sacs and also by the position of the egg cell. Pollen viability A clean glas s slide containing a drop of aceto-orcein stain was dusted with pollen from a dehiscing inflorescence. A cover slip was gently placed and observations on pollen viability were recorded using a microscope fitted with line tran sects. Viable pollen appeared dark red, while non viable pollen appeared white or faint pink. F2 seed production and viability O.P. seeds from F1 hybrid plants were collected from greenhouse grown plants. Seed heads were thrashed and fully developed seeds were manually separated from the empty seeds (i.e. seeds that are devoid of embryo, endosperm and nu cellus). Germination was facilitated by partial removal of the lemma and palea surrounding the mature seed. The seeds were soaked in water overnight before placing in soil to facilitate germination. Germinated seedlings were maintained in a growth chamber at 28/23C day/night temperature and 12 h photoperiod. The plantlets were moved to the greenhouse at the 6-le af stage and maintained at 28/23C day/night temperature and natural photoperiod.

PAGE 66

66 RFLP marker analysis for apomixis RFLP analysis was followed as describe d by Martinez et al. (2003) with som e modifications. Following complete digestion with EcoR I, the samples were electrophoresed in a 1.5% w/v agarose gel/1xTAE overnight at 20 V. DNA was blotted onto nitr ocellulose membrane (Amersham Pharmacia Biotech, Piscataway, N. J. ) using 20x SSC following the neutral transfer procedure. The C1069 probe (Accession no. D15675) was amplified from rice ( Oryza sativa Japonica) genomic DNA using primers designed from the sequence information at the NCBI database. The PCR product was purified using th e Qiagen PCR purification kit (Qiagen Inc., Valencia, CA). Sequence analysis (MWG-Biotech Inc., High Point NC) was used to confirm the successful amplification of C1069. Following sequence confirmation, the C1069 probe was radio-labeled with [32P] dCTP using the Prime-a-gene labeling system (Promega U.S., Madison, WI). Overnight hybridiz ation with the hybridization bu ffer containing labeled probe and denatured herring sperm DNA (1 g l-1) was carried out at 65C Washing was performed at 65C and included the followi ng steps: quick wash using 2x SSC; 20 min low stringency wash using 2xSSC, 0.5% SDS; 20 min high string ency wash using 0.2x SSC, 0.1% SDS. The membrane was exposed to autoradiographic film (Kodak Biomax MS autoradiography) for 48 h at -80C. Results Transgenic Pollen Source Single copy bar gene integration in pollen donor line B9 was detected by Southern blot analysis (Fig. 4-2B). Dark red stained pollen indicated the production of viable pollen in the transgen ic line B9. Transgenic lin e B9 did not differ from wild-type in growth and seed set. This line produced viable seeds under open and self po llination. All 30 seed-derived progeny plants

PAGE 67

67 were herbicide resistant to 0.3% glufosinate which is the recommende d rate for control of grassy weeds (data not shown). Anthesis and Synchrony of Flowering Weekly tagg ing of pollinating seedheads suppor ted monitoring of synchrony of flowering of transgenic and non-transgenic plants and iden tification of the peak flowering period. Seeds formed following this peak period were selected for seed progeny analysis. For each experiment, there were more than 30 inflorescences per genotype during this peak period. Pollen-mediated Gene Transfer from Transg enic Tetraploid to Diploid Bahiagrass The first greenhouse experim ent with a populatio n of diploid genotypes as pollen receptors showed 0.16% (13 herbicide resistant hybrids out of 8330 seedlings; Table 4-1) gene transfer from the transgenic apomictic pollen donor. The response of two clonal genotypes in the second and third experiment sets was different de pending on the genotype. Clone 1 showed a hybridization rate of 3.6% (12 herbicide resistant hybrids out of 332 seedlings) whereas clone 2 did not produce any hybrids (none out of 5209 seed lings; Table 4-1). It wa s also observed that clone 1 (1900 seeds) formed less seed as compared to clone 2 (13400 seeds). Greenhouse evaluation of field produced O.P. s eed from a population of diploid genotypes showed a hybridization frequency of 0 to 0.05% (Table 4-1). Out of 7102 seedlings from O.P. seeds produced in 2005, no herbicid e resistant hybrid plants we re detected. Five herbicide resistant hybrid plants were identified from 10,040 seedlings from O.P. seed produced in 2006 (0.05%). Pollen-mediated Gene Transfer from Transgen ic Tetraploid to Tetraploid Bahiagrass Gene transfer to three highly apom ictic te traploid genotypes was similar under greenhouse and field conditions (0.16% and 0.17 %, respectively). Evaluation of O.P. seed progeny from the fourth greenhouse experiment set yielded 10 he rbicide resistant hybrids out of 6297 seedlings.

PAGE 68

68 Field evaluation of seed progeny from the same pollen receptors produced 11 herbicide resistant hybrids out of 6200 seedlings (Table 4-2). Seeds from the three different apomictic cultivars were separately harvested in the greenhouse. Am ongst the highly apomictic tetraploids, Paraguay 22 showed the highest hybridization frequency (0.32%), producing 5 herb icide resistant hybrids from 1559 seedlings analyzed. Argentine bahi agrass showed 0.11% hybridization frequency yielding 4 herbicide resistant hybrids out of 3669 seedlings analyzed; while Tifton 7 progeny produced one herbicide resistant hybrid out of 1062 seedlings (0.09% hybridization frequency). Paraguay 22 also produced the most seedheads, followed by Argentine, and Tifton 7 (data not shown). The facultative apomictic accession used as pollen receptor in the fifth greenhouse experiment set produced 15 herbic ide resistant hybrids out of 724 seedlings (2.7%; Table 4-2). Hybrids: Transgene Characterization All herb icide resistant hybrids plants which were detected by herbicide screening were confirmed to express the bar gene using the lateral membra ne flow immuno-chromatography assay (a representative image is shown in Fi g. 4-2A).The following herbicide resistant hybrid plants were selected for Southern blot analysis: a) R1, R2, R3, R4, R5, R6, and R7 resulting from hybridization of a population sexual diploid genotypes with the apom ictic transgenic tetraploid ; b) R8 and R20 resulting from hybridization of se xual diploid clonal plants with the apomictic transgenic tetraploid; and c) FR1, FR2 and FR3 obtained from gene transfer to population of sexual diploids under field conditions. All the hybrid plants analyzed showed a single functional copy of the bar gene identical to the pollen parent B9 (Fig. 4-2B). Hybrids: Cytogenetic Characterization The diploid and tetraploid peak values we re best optim ized at 99 and 316 respectively given the operating condition of the Partec Ploidy analyzer. Ploidy determination using the flow cytometer showed mean peak values intermedia te between the 4x and 2x controls. Hybrid R7

PAGE 69

69 showed a peak value similar to the 2x control (Table 4-3). Root tip chromosome counts of representative plants were confirmed as follows: R1, 2n=30; R6, 2n=26 and R3, 2n=34(Fig. 4-3); R2, R4, R5, 2n=28; R7, 2n=20 and; FR3, 2n=30 (Table 4-3). Hybrids: Growth and Repro ductive Characteriz ation Embryo sacs of five hybrids which flowered during the first year (R1, R3, R4, R5, and R6) were characterized. A majority of the ovules in hybrids R1, R3, R5 and R6 showed multiple pairs of central cells and an or ganized sexual embryo sac (Table 44; Fig. 4-4C). A single sexual embryo was occasionally found in inverted orienta tion in some ovules of hybrids R1, R3, R4 and R5 (Table 4-4). The percent of aborted ovules was as high as 50% in hybrid R3. (Table 4-5). Flowering hybrids R1 and R3 had very low seed set as only ca. 1.0% of the ovules matured to form developed seeds. The seed set in hybrids R4, R5 and R6 was between 8.8-12.7%; at least one germinated seed was obtained fr om R4, R5 and R6 (Table 4-5). Differences in growth, habit and fertility of ten hybrids resulting from hybridization of sexual diploid population x apomictic transgenic te traploid are summarized in Table 4-5. Hybrid R1, R3, and R5 grew normally, while R2, R4, R6 R8, R9 and R10 showed slower growth as compared to the diploid parent (Table 4-5). Hybrid R2 displaye d a distinctive dwarf phenotype with fine leaves and slow growth. Hybrid R7 displayed a phenotype resembling diploid bahiagrass but had a very slow growth rate. Hybr ids R9 and R10 did not survive beyond the first year. Hybrids R2, R7, R8, R9, and R10 did not fl ower during an entire year of observation under natural photoperiod. Pollen stainability in hybri ds R1, R3, R4, R5 and R6 varied between 6075% (Fig. 4A-B; Table 4-5). When diploid pollen receptors were used th ere was segregation of the apospory locus in the F1 hybrids. The apospory-specific RFLP marker with a hybridizati on signal of 4.9 kb was detected in 15 out of 17 hybrids analyzed (Fig. 45A). When tetraploid cu ltivars were used as

PAGE 70

70 pollen receptors the apospory-specific RFLP mark er with a hybridization signal of 4.9 kb was detected in all 12 tetraploid hybrids analyzed (Fig.4-5B). Discussion This study evaluates intraspecific pollen-m ediated transgene fl ow from apomictic tetraploid bahiagrass to diploid or tetraplo id bahiagrass under greenhouse and field conditions and characterization of hybrids. The potential for gene flow depends on a) the existence of synchronous flowering between the transgenic and the non-transgenic counterpart; b) compatibility between genotypes or the mating system; and c) mode of pollinati on. Among other factors affecting gene flow, the particular characteristics of the habitat wher e a species is grown is an important criteria especially for crop species grown in areas othe r than its center of di versity (Messeguer 2003). Risk assessment of transgenic crop species has to be addressed on a case by case basis due to the complexity of the nature of gene flow (Cha pman and Burke 2006). Cross pollinating perennial grasses impose a greater risk of gene transfer as compared to gr asses that are self-pollinating or reproduce asexually. Cro ss-pollinating transgenic perennial ryegrass ( Lolium perenne ) showed up to 2% gene transfer to nontransgenic ryegrass growing 14 4m away (Cunliffe et al. 2004). The frequency of gene transfer is highest at a short distance (0-1m) and decreases dramatically over distance (Messeguer et al. 2004; Cunliffe et al. 2004). The size of the pollen source plots also influences gene flow. A 162 ha transgenic cr eeping bentgrass field resu lted in hybridization rates of 0.03 to 2% at 21 km distance from the pollen source (Watrud et al. 2004). Kentucky bluegrass ( Poa pratensis L.) a facultative apomictic species has been reported to have a rate between zero to 16% gene transfer and an ove rall 0.5% hybridization frequency at 0 to 1m (Johnson et al. 2006). Proximal herbicide-tolerant and non-transgenic wild-type zoysiagrass ( Zoysia japonica Steud.) showed 6% cro ss-pollination, whereas the rate of hybridization was

PAGE 71

71 reduced to 1.2% at 0.5m and 0.12% at 3m (Bae et al. 2008). Tall fescue ( Festuca arundinacea ) showed 5% hybridization frequency at 50 m, decreasing to 0.96% at 150 m and no gene flow was detectable at 200 m (Wang et al. 2004). The dr astic reduction in gene flow frequency with distance is related to a reduc tion in pollen density (Song et al. 2003; Song et al. 2004). Pollen-mediated gene flow in asexually reproducing species like P. notatum should therefore first be studied at a short distance since a very low gene flow frequency is expected and larger distances might not result in detectable gene flow. The frequency of gene transfer to a population of sexual diploid bahiagrass in both fi eld and greenhouse was lower as compared to other cross-pollinating perennial grasses. Tetraploid cultivars of bahiagrass such as Argentine are considered obligate apomicts. The differentiation of apomictic or meiotic embryos sacs has been used to char acterize the nature of seed production (Quarin and Hanna 1980; Quarin et al. 1982). Seed progeny from openpollinated transgenic tetraploids showed identi cal gene integration patterns as expected for apomictic inheritance (Sandhu and A ltpeter 2008). In pollination, timing is a critical factor in the expression of amphimixis in facultative apomictic P. notatum (Espinoza et al. 2002). In contrast to field studies, greenhouse experiments facilita te synchronization of fl owering of different genotypes. Deliberate synchronization of sexual di ploid genotypes and the transgenic apomictic tetraploid pollen donor could have resulted in a higher gene transf er to sexual diploid genotypes under greenhouse as compared to field conditions. Also, greater availability of wild-type sexual diploid pollen could be a plausibl e explanation for the lower gene transfer observed in the field as compared to the greenhouse. Since, transgen ic apomictic pollen donor and the non-transgenic highly apomictic tetraploid pollen receptors flow ered synchronously under field conditions, the

PAGE 72

72 rate of gene transfer (0.16 and 0.17%) was very similar to that observed under greenhouse conditions. The use of self-incompatible clonal diploids as maternal parent and transgenic tetraploids as pollen source is a direct approach for enhancing the hybridi zation potential. In the current experiments, it also allowed differentiation of the degree of self-incompatibility that exists in the different sexual genotypes. This approach is similar to the use of male-sterile receptor plants designed to reduce pollen competitio n (Jia et al. 2007; Yuan et al 2007). Higher self-fertility in the second clone in contrast to the first clonal population was evident as the latter produced 7 times less seed, and 3.6% of those were hybrids. T hus, variation exists in the self-incompatibility of diploid genotypes as reported ear lier (Burton 1955; Acuna et al 2007) The use of male-sterile (ms) rice lines as pollen receptors produced ve ry high hybridization frequencies (3.1 to 36.1%; Jia et al. 2007). The relatively low hybridization frequencies observed in the present study could be due to the ploidy barrier be tween the pollen receptor and po llen donor. The results suggest that clonal diploids as pollen receptors overestim ates gene flow (0.16% vs 3.6%). These results are consistent with previous re ports on gene flow using male-ste rile plants as pollen receptors (Wang et al. 2006; Hoyle et al. 2007). The use of different pollen receptors in this study showed pollen competition as a significant factor affecting gene flow. A theoretical assessment has shown that even low hybridization rates of 0.1% could lead to the establishment of a modera tely advantageous (s=0.10) tr ansgene (Haygood et al. 2004). Hence, besides evaluating hybridization frequencie s, it is important to study the fate of such hybrids (Chapman and Burke 2006; Hails and Morley 2005). Earlier studies in perennial grasses did not include the phenotypic and reproductive characterization of intraspecific hybrids. Fate of hybrids is determined by their fitn ess criteria such as survival, fertility, mode of reproduction,

PAGE 73

73 reproductive compatibility and transgene insertion (Chapman and Burke 2006; Jackson et al. 2004). Hybrid fitness is the best predictor of allelic spread (Chapman and Burke 2006). In P. limbatum a spontaneous hypotriploid hybrid from a diploid plant and an apomictic 4x male parent, was characterized as apomictic but seed sterile (Acuna et al. 2004). Apomictic triploid hybrids could release th e genetic variability in apomictic tetraploids and transfer the apomict trait from tetraploids to diploids (H anna and Burton 1986). However, spontaneous or manual production of triploids in different Paspalum species has resulted in a male sterile hybrid plant. Acuna et al. (2004) reported that the hypo triploid hybrid was 100% male sterile. Hanna and Burton (1986) also reporte d 0.02% viable pollen from a P. notatum apomictic triploid originating from an apomictic tetraploid plant an d a sexual diploid male parent. Our results are in contrast to earlier findings. The (near) triplo id hybrids produced in the present study from a sexual diploid plant and an apomictic tetraploid male parent produced apparent viable pollen although viable seed production was limited. High pollen stainability in triplo id plants is a rare occurrence. However, triploid F1 interspecific wheat hybrids have been detected with upto 94% pollen fertility based on aceto-carmi ne staining assay (Matsouka et al. 2007). A higher vigor of the triploid bahiagrass hybrid plant compared to both parents was repor ted by Hanna and Burton (1986). In contrast, most of the triploid hybrids in the current study showed reduced vigor compared to both parents, and some of them did not survive under greenhouse conditions. Seed set was reduced (1.5-12%) compared to an averag e seed set of 39% for O.P. diploids and 36% for O.P. apomictic tetraploids (Acuna 2006). Flow cytometry detected most hybrids as near triploids. The fact that peak values of tetraploids appeared reproducibly at more than d ouble the value of the dipl oid is an ununderstood anamoly. Karyotypic analysis using root-tip chro mosome counting further confirmed triploid or

PAGE 74

74 near triploid nature with irregular chromosome numbers in hybrids obtained from sexual diploid maternal plants and tetraploid apomictic polle n donor plants. Triploid progeny produced from sexual diploid maternal and apomic tic tetraploid pollen donors of Taraxacum sect. Ruderalia are also characterized by irregular chromosome numbers (Martinf iova et al. 2007). Chromosome elimination during microsporogenesis was reported in P. subciliatum (Adamowski et al. 1998). Chromosome elimination has been widely observed in interspecific crosses or in allotetraploid genomes (Gernand et al. 2006; Adamowski et al 1998). Asynchronous cell cycle of two paternal species could cause meiotic instabilities a nd result in chromosome elimination. Lagging bivalents are characteristic cytological eviden ce for such meiotic irregularities leading to chromosome elimination. The tetraploid accessions of P. notatum originated from autopolyploidization and are known to show high frequency of meiotic irregularities (such as anaphase laggards, micronuclei formation) and abnormal tetrads leading to unbalanced gametes (Quarin 1992; Adamowski et al. 2005). Chromoso me irregularities observed in the triploid hybrids could be caused by such meiotic instabilities during microspore formation in tetraploid pollen donors. Interestingly, one hybrid (R7) with a complete chromosome complement of 20 chromosomes was detected from O.P sexual diploid genotypes. This hybrid (R7) did not resemble a typical diploid phenotype and was very slow growing. Further characterization of meiotic chromosome pairing in this hybrid (R7) was not possible as it did not flower. RFLP C1069 marker is considered a simple dose restriction fragment (Martinez et al. 2003) and is expected to segregate 1:1 for pr esence: absence in the F1 for a simplex (A---) condition (Wu et al. 1992). Earlie r reports have suggested ratios close to 3:1 expression of sexuality/apomixis in a segregating tetraploid hy brid population (Stein et al. 2004; Martinez et al. 2001). Such distortion towards sexuality has been explained by a lethal do minant effect of the

PAGE 75

75 apospory gene with incomplete penetrance. Apospory in Bracharia spp., Panicum maximum and Pennisetum ciliare had been confirmed as a single domin ant gene with tetrasomic inheritance (Do Valle et al. 1994; Savidan 1981; Sherwood et al. 1994). Stein et al. (2004) suggested disomic inheritance based on AFLP markers link ed to the apoallele and preferential chromosome pairing in the a pospory specific genomic region (A SGR). In the present study openpollination of a sexual diploid female with transgenic, apomictic tetraploid male resulted in 13 apomictic and 2 sexual F1 individuals based on RF LP analysis. This ratio could suggest disomic inheritance of the apomixis locus. Cytogenetic observations of the embryo sac of five hybrids showed sexual or facultative apomixis in at least four of the five hybrids. These data may support Mogies hypothesis that there is a dosage requirement for expre ssion of apomixis. (Mogie 1988; Quarin et al. 2001). Martinez et al. (2001) discounted the diso mic model for inheritance of apomixis due to the lack of segregation for ap omixis in selfed F2 progeny from sexual F1s. However, it may be possible that female gametes have a lower transmission rate of the ASGR than the male gametes. Interestingly, all tetraploid hybrids evalua ted for the presence of apospory-specific RFLP marker tested positive. Linkage of the bar gene to the aposporous lo cus is an unlikely cause for this result, since segregation of the aposporous RF LP marker was detected in herbicide resistant triploid hybrids derived from the same pollen donor. Therefore, a low degree of amphimixis in the tetrapoid bahiagrass genotypes used as pollen receptor is the only plausible explanation for a lower frequency of pollen mediat ed gene transfer between apom ictic tetraploid genotypes. Thus, tetraploid apomictic bahiagrass does not provide complete transgene containment under unfavorable conditions. Howeve r, intra-specific gene transfer from apomictic bahiagrass is

PAGE 76

76 drastically reduced compared to sexually reproducing perennial grasses and the majority of hybrids either did not produce seeds or resulting seedlings showed reduced vigor.

PAGE 77

77 Table 4-1. Pollen-mediated gene transfer frequenc y from herbicide resistant apomictic tetraploid bahiagrass to diploid bahiagrass followi ng open pollination at 0.5 to 2.5m distance between the pollen donor and recipient. Location Pollen Recipient No. plants screened No. of hybrids (%) Greenhouse 1 Population of Pensacola genotypes 8300 13 (0.16%) Greenhouse 2 Single genotype of Pensacola clonally propagated (Clone 1) 332 12 (3.61%) Greenhouse 3 Single genotype of Pensacola clonally propagated (Clone 2) 5209 0 (0.00%) Field 2005 Population of Pensacola genotypes 7100 0 (0.00%) Field 2006 Population of Pensacola genotypes 10040 5 (0.05%) Table 4-2. Pollen-mediated gene transfer frequenc y from herbicide resistant apomictic tetraploid bahiagrass to tetraploid bahiagrass following open pollination at 0.5 to 2.5m distance between the pollen donor and recipient. Location Pollen Recipient No. of seedlings screened No. of herbicide resistant seedlings (%) Greenhouse 4 Highly apomictic genotypes 6297 10 (0.16%) Greenhouse 5 Facultative apomictic genotype 724 15 (2.07%) Field 2005 Highly apomictic genotypes 6200 11 (0.17%)

PAGE 78

78 Table 4-3. DNA ploidy determination through flow cytometer and chromosome counting of F1 hybrids obtained from sexual diploid pollen r eceptors O.P. with transgenic apomictic tetraploid bahiagrass as pollen donor Sample Peak Chromosome counting (2n) 4x Known 316 40 2x Known 99 20 R1 182 30 R2 164 28 R3 220 34 R4 149 28 R5 149 28 R6 128 26 R7 110 20 R14 148 R17 213 R18 204 R19 135 R20 206 R21 130 *chromosome counting was not attempted in this sample Table 4-4. Embryo sac types in the F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass One ovule had single sexual embryo s ac with inverted orientation Two ovules had a single sexual embr yo sac with inverted orientation No. of ovules with Hybrid No. of ovules Apomictic Apomictic+Sexual Sexual Aborted R1 37 0 21 7 9 R3 40 0 17 3 20 R4 33 12 8 3 10 R5 33 4 20 5 4 R6 30 0 15 2 13

PAGE 79

79Table 4-5. Growth, habit and fertility of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass Hybrid Growth rate Habit, phenotypic characteristics Pollen viability (%) Seed set (%) Viable seeds (%) R1 Normal Upright, wide leaves 70 13/850(1.5) 0/13 R2 Slow Upright, shorter internodes, fine leaves Did not flower in the first year R3 Normal Prostrate, wide leaves 75 7/550(1.3) 0/7 R4 Slow Upright, wide l eaves 60 33/260(12.7) 1/33 (3.0) R5 Normal Upright, fine leaves 60 26/260(9.6) 1/26 (3.8) R6 Slow Upright, fine leaves 60 43/488(8.8) 7/43 (16.3) R7 Very slow Upright, fine leaves Did not flower R8 Slow Upright, wide l eaves Did not flower R9 Slow Prostrate, wide leaves Did not flower and did not persist R10 Slow Prostrate, wide leaves Did not flower and did not persist Categorized for growth rate compared to a diploid plantstarting with very slow, slow or normal in ascending order Indicated as ratio of seeds /total number of seeds including seeds and empty seeds (empty seeds are those devoid of embryo, endosperm and nucellus)

PAGE 80

80 Figure 4-1. Pollination experiments under greenhouse and field conditions and screening of O.P. seed. A and B) Greenhouse and field experi ment set up showing tetraploid pollen donor (middle) and tetraploid pollen recepto r plants during the peak flowering period. Newly emerged inflorescences were tagge d with colored tape and pollinated inflorescences were bagged in glassine bags. C and D) Six-week old seedlings derived from O.P. seed from the pollination experiments before and after herbicide application. A CD B

PAGE 81

81 Figure 4-2. Transgene expre ssion and integration in F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass. A) Representative samples (R1 and R2) showing immuno-chromatographic determination of bar/PAT expression in the F1 hybrid plants using the Libertylink Sticx Test. The top band is common to all samples and indicated functionality of the stix assay. The lower PAT-specific band confirms the presence of PAT in the protein extract. B) Southern blot analysis showing bar gene integration of the B9 pollen parent and F1 hybrids (R-). Genomic DNA was digested with Bgl II, which excises a 5.0 kb band in pJFbar. The full length coding region of the bar gene was used as a probe. Wild-type bahiagrass was used as negative control (WT) and the transgenic pollen parent (B9) was used as positive control in both (A) an d (B); hybrids R1-R7 originating from a population of sexual diploid pollen receptors under greenhouse conditions; R8 and R20 originating from clonal diploid genotype under greenhouse conditions and; FR1 to FR3 originating fr om a population of sexual diploids under field conditions. WTB9R1R2A B WT B9 R1 R2 R3 R4 R5 R6 R7 R8 R20 FR1 FR2 FR3 B WT B9 R1 R2 R3 R4 R5 R6 R7 R8 R20 FR1 FR2 FR3

PAGE 82

82 Figure 4-3. Karyotypi c analysis of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahi agrass as pollen donor.Root-tip chromosome preparations of herbicide resistant F1 hybrids showing R1 with 2n=30, R6 with 2n=26 and R3 with 2n=34. The root-tips were prepared by 4 h treatment with 8hydroxyquinoline and 24 h treatment with 95% ethanol: acetic acid, 3:1 v/v. Fixed roots were squashed using 45% acetic acid and stained with orcei n. The observations were made under a microscope with 40x magnification. Figure 4-4. Reproductive characterization of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic te traploid bahiagrass as pollen donor. A) and B) Pollen grains of hybrid R1 and R6. Dark red stained pollen indicates viable pollen, while light or transparent pollen are non-viable. C) An ovule from R6 hybrid plant bearing a sexual embryo sac characterized by antipodals, and aposporous embryo sac characterized by the second pair of polar nucle. References: a antipodals; e egg cell; p polar nuclei. R1R6 R3 AB Ca p p e

PAGE 83

83 Figure 4-5. Molecular marker analysis of F1 hybrids using RFLP marker linked to apospory in tetraploid Paspalum notatum. A) RFLP analysis of F1 hybrids obtained from sexual diploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass as pollen donor. B) RFLP analysis of F1 hybrids obtained from apomictic tetraploid pollen receptors O.P. with transgenic apomictic tetraploid bahiagrass as pollen donor. Hybridization was carried with the C1069 ri ce probe following digestion of genomic DNA with EcoRI. Arrows indicate the apospor y specific 4900 bp (indicated by the arrow) restriction fragment. A= tetrap loid aposporous; S= diploid sexual; R-= herbicide resistant F1 hybrids; R1to R7 hybrids or iginating from a population of sexual diploid genotypes under greenhouse c onditions; R8 to R22 hybrids originating from clonal diploid genotype under gr eenhouse conditions; R23 to R45 hybrids originating from highly apomictic tetrap loid genotypes under greenhouse conditions and; R50 to R54 hybrids originating from facultative apomictic tetraploid genotypes. A S R1 R2 R3 R4 R5 R6 R7 R8 R12 R17 R18 R20 R21 R22 R14 A A S R1 R2 R3 R4 R5 R6 R7 R8 R12 R17 R18 R20 R21 R22 R14 A A S R23 R25 R26 R40 R41 R42 R43 R44 R45 R50R52 R54B A S R23 R25 R26 R40 R41 R42 R43 R44 R45 R50R52 R54B

PAGE 84

84 CHAPTER 5 CONCLUSIONS Bahiagrass is a prim ary component of native grassland in southern Brazil, Paraguay, Uruguay and northeastern Argentina (Gates et al. 2004). Pseudogamous apomictic tetraploid races are the most common form of this specie s found near its center of genetic diversity. The sexual self-incompatible diploid cytotypes, commonly called Pen sacola inhabit only limited areas in its native habitat (Dau relio et al. 2004). Pensacola bahiagrass has become one of the major forage grasses in the southeastern Unit ed States since its in troduction in 1945 (Burton 1967; Gates et al. 2004). Genetic improvement of tetraploid bahiag rass through traditional breeding has been limited due to its asexual seed production (Blount et al. 2003). Gene tic transformation of apomictic cytotypes is thus an alternative approach to develop im proved cultivars. The introduction of a number of different transgenes in bahiagrass has resulted in plants with improved turf quality (Agharkar et al. 2007; Zhang et al. 2007), abiotic (James et al. 2008) and biotic (Luciani et al. 2007) st ress tolerance and herbicide resi stance (Sandhu et al. 2007). The transgenic lines are now being evaluated in the field. Concer ns about potential environmental risks associated with genetically modified tu rf or forage grasses currently slow their deregulation. Hybridization of transgenic plants with their wild relatives is one of the major environmental concerns. To address this poten tial problem, it is important to study both the pollen-mediated gene flow from the transgenic plants, as well the behavior and fate of transgenes. The production of uniform seed progeny wit hout segregation of genetic loci is a characteristic feature of apomic tic species such as Argentine bahiagrass. This feature supports transgene stability and the inhe ritance of complex transgene integration in the seed progeny

PAGE 85

85 without segregation. It can thus allow stacking of multiple unlinked transgenes in the same transgenic line for pathway engineering or co-i ntroduction of multiple traits while maintaining uniform transgene expression in the seed progeny. It also reduces the risk of transgene dispersal through pollen. Stable and high co-expression of nptII and bar was confirmed in the apomictic seed progeny of herbicide re sistant transgenic bahiagra ss. Co-expression of unlinked nptII and bar genes occurred in 19 of the 20 co-transform ed lines (95% co-expression frequency). Quantification of transgene co-expression revealed that several lines with complex integration patterns displayed a higher tran sgene expression than lines with simple transgene integration patterns. Several transgenic lines displayed hybridization signals indicative of concatemerization. Concatemers were confirmed following PCR amplif ication and sequence analysis of transgene loci. However, the occurrence of complex transg ene loci was significantly reduced by lowering the amount of DNA during the microparticle coating. Transgenic bahiagrass plants were resistant to a field application of 0.6% glufosinate ammonium which is twice the recommended rate for weed control. They were mo rphologically identical to the non-transgenic w ild-type, and produced viable pollen. Under field conditions at clos e physical proximity (0.5 to 2.5m) with the non-transgenic bahiagrass, the average frequency of gene tran sfer from transgenic apomictic tetraploid bahiagrass to sexual diploid and apomictic tetraploid bahiagrass was 0.03% and 0.17% respectively. Under greenhouse conditions the fre quency of gene transfer from transgenic apomictic tetraploid bahiagrass to a non-transgenic population of sexual diploids or highly apomictic tetraploids was 0.16%. The majority of hybrids originating from sexua l diploid pollen receptors were either near triploids or triploids, although one diploid hybrid was detected. Chromosome variation in the

PAGE 86

86 intraspecific hybrids is apparently a result of irregular meiosis during the formation of microspores in the pollen parent. The intra-sp ecific hybrids showed variation in habit and phenotype. Slow growth and reduced seed set compared to the diploid parent indicated compromised fitness of such hybrids. The increased proportion of apomictic intraspecific hybrids is in contrast to earlier reports. The data supports disomic inheritance of the apomixis gene or the presence of a low degree of amphimixis in cult ivar Argentine. Embryo sac analysis of five intraspecific hybrids showed the presence of meio tic and aposporous embryo sac, thus indicating facultative apomixis. Progeny analysis from the intra-specific hybrids wo uld thus be the most conclusive evidence to determine the facultative apomictic or sexual nature of such hybrids. Martinez et al. (2007) reported th at ploidy contribution of the male gametes from triploid hybrids depends upon the chromosome number of th e female gamete. Male gamete formation in the triploid and tetraplo id intraspecific hybrids obtained fr om this study would further enhance our understanding of transgene introg ression. Due to the unique feat ures of some hybrids (eg. R2 with a fine leaves and short in ternodes, non flowering), it would be interesting to study their performance, persistence and turf quality under field conditions. In summary, gene transfer between transg enic and non-transgenic bahiagrass can occur under field conditions, although the frequency of hybridization is low as compared to other transgenic cross-pollinating grasses and hybrids show reduced fitness.

PAGE 87

87 APPENDIX LABORATORY PROTOCOLS USED FOR BIOLISTIC TRANSFORMATION, TISSUE CULT URE AND CHARACTERIZATION OF TRANSGENIC PARENT AND HYBRID BAHIAGRASS PLANTS Protocols for Molecular Cloning Glycerol Stocks 1. Initiate E. coli culture containing desired plasmid in 2 ml sterile LB broth containing the appropriate antibiotic (kanamycin for plasmid pJFbar). Incubate overnight at 37C on an orbital shaker with 220 rpm with 1 orbit. 2. Add 0.85 ml of the bacterial cult ure and 0.15 ml sterile glycerol into a sterile microfuge tube with a hole pierced in the lid. 3. Mix by vortexing and immediatel y freeze using liquid nitrogen. Store at -80C. Prepare several tubes for plasmid. Avoi d successive freeze-thaw cycles. Amplification and Purification of Plasmid DNA Using the QIAGEN Plasmid Midi Kit QIAGEN plasmid purification protocol as provided by the manufacturer All buffers (P1, P2, P3, QBT, QC, QF TE) are supplied with the QIAGEN kit 1. Inoculate a starter culture of 2-5 ml LB medium containing th e 1g/ml of the appropriate antibiotic. Frozen glycerol stocks or freshl y streaked selective plate can be used for inoculation. Incubate for ~8h at 37C with vigorous shaking (~220 rpm on an orbital shaker with 1 orbit). Use a tube or flask with a volume of at least 4 times the volume of the culture 2. Use the starter culture to initiate an overnigh t culture. Use 100l of the starter culture in 50 ml LB medium containing the appropriate an tibiotic. For low-copy plasmids, inoculate 100 ml medium. Incubate at 37C for 12-16 h on an orbital shaker. The vessel used should have a capacity atleast 4 times the volume of the culture 3. Harvest bacterial cells by centrifugation at 6000 g for 15 min at 4C. Remove all traces of supernatant by pipetting. 4. Resuspend the bacterial pellet in 4 ml buffe r P1. The bacteria should be resuspended completely by vortexing or pipetting up and down until no cell clumps remain. 5. Add 4 ml Buffer P2. Mix gently but thoroughly by inverting 4-6 times. Incubate at room temperature for 5 min. Contents shou ld not be vortexed at this stage. 6. Add 4 ml of chilled buffer P3. Immediately mi x immediately by gently inverting the tubes 4-6 times. Incubate on ice for 15 to 20 min. Af ter the addition of buffer P3, a fluffy white material forms and the lysate becomes less viscous. If the material still appears viscous and brownish, more mixing is required to completely neutralize the solution. 7. Centrifuge at 20,000g for 30 min at 4C. Re move supernatant containing plasmid DNA promptly. Before loading the centrifuge, the sample should be mixed again 8. Centrifuge the supernatant again at 20, 000g for 15 min at 4C. Remove supernatant containing plasmid DNA promptly. 9. Equilibrate a QIAGEN-tip 100 by applying 4 ml Buffer QBT, and allow the column to empty by gravity flow. 10. Apply the supernatant from step 8 to the QIAGEN-tip and allow it to enter the resin by gravity flow.

PAGE 88

88 11. Wash the QIAGEN-tip with 2 times10 ml Buffer QC. 12. Elute DNA with 5 ml buffer QF. Coll ect the eluate in a 10 ml tube. 13. Precipitate DNA by adding 3.5 ml isopropanol to the eluted DNA. Mix and centrifuge immediately at 1500 g for 30 min at 4C. Care fully decant the supernatant. All solutions should be at room temperature in or der to minimize salt precipitation. 14. Wash DNA pellet with 2 ml 70% ethanol, and centrifuge at 1500 g for 10 min. Carefully decant the supernatant wit hout disturbing the pellet. 15. Air-dry the pellet for 5-10 min and redisso lve the DNA in a 200 l TE buffer. Allow the pellet to resuspend in TE buffer overnight at 4C before transferring to a sterile micorfuge tube. Preparation of Minimal Linear Expression Cassettes 1. Digest 100g of plasmid DNA usi ng restriction enzymes which excise the gene expression cassette (promoter, gene, poly A) and have no restriction site within the cassette. 2. Check for complete digestion by running a 1l a liquot of the digest on a 0.8% agarose gel. Complete digestion will be indicated by the exac t number of bands as expected. (eg. if 2 enzymes cutting one at each side of the expression cassette have single site in the plasmid, it will give 2 bands. The size of fragment of interest will depend on the relative size of the expression cassette to the whole plasmid. 3. Load 10-15 g/ well on a 0.8% agarose gel and electrophorese at 70V for 2 h to achieve good separation of bands. 4. Excise the band corresponding to the expression cassette using a UV-transilluminator. 5. Purify the excised band with the QIAquick ge l purification kit (Qiagen Inc., Valencia, CA) following the instructions manual. 6. Check quality by electrophoresing 2 l of the fragment DNA (expression cassette). 7. Quantify the fragment yield using na nodrop (ND-1000 spectrophotometer, Nanodrop Technologies, Wilmington, DE). Restriction Digestions to Prepa re Minimal Expression Cassettes pJFbar digestion Restriction Enzyme IsceI (Promega) pJFbar plasmid (100 g) 40 l Restriction Buffer 2 10X 10 l BSA 10X 10 l IsceI 10 l DdH2O 30 l Final volume 100 l Digest overnight at 37C

PAGE 89

89 Gel Extraction Using QIAquick Gel Extraction Kit Prepare Buffer PE by adding 40 ml 100% ethanol to the provided concentrate. Always use protective wear to protect skin and eyes from harmful UV radiation. When running a gel ensure that all buffers were ma de fresh, when staining a gel make sure to use a fresh batch of ethidium bromide so as to not contaminate your plasmid with foreign DNA or DNase. 1. Visualize DNA bands under a UV transilluminator. 2. Excise the DNA fragment precisely from the ag arose gel using a clean sharp scalpel. Avoid excess agarose. Proceed quickly to avoid long UV exposure 3. Weigh the excised agarose gel and distribute approximately 400 mg per microfuge tube. 4. Add 3 volumes of Buffer QG to 1 volume of gel. 5. Incubate at 50C in a heating block for 10 min or until the gel has completely dissolvde. Vortex every 2 min during incubation to ensure complete dissolution of gel. After incubation check that the color of the mixture remains similar to Buffer QG (yellow), indicating that the pH has not changed. 6. Add 1 gel volume of isopropanol to the mixture and mix by inverting the tube several times. 7. Place a QIAquick spin column in a provided 2 ml collection tube and apply the sample to the column. 8. Centrifuge at 16,100g for 1 min us ing table top centrifuge. Repeat this step if the volume of the mixture is more than 800 l, the maximum capacity of the QIAquick column. 9. Discard the flow-through and place the co lumn in the same collection tube. 10. Wash the QIAquick column by adding 750 l Buff er PE to the column and centrifuging for 1 min at 15,700g. 11. Discard the flow-through, place the column back in the same collection tube and spin for an additional 1 min at 15,700g to remove residual ethanol from Buffer PE. 12. Place the QIAquick column in a clean, sterile 1.5 ml microcentrifuge tube. 13. Add 30 l Buffer EB (10 mM Tris-Cl, pH 8.5) to the center of the QIAquick membrane to elute DNA, let stand for 1 min and th en centrifuge for 1 min at 15,700g. 14. Store DNA at -20C. Protocol for Particle Bo mbardment using PDS-1000/He Preparation of Gold Stock (60mg ml-1) 1. Weigh 60mg of 1.0 m gold particles in a sterile 1.5ml microfuge tube. 2. Vortex for 3-5 min after adding 1ml of 70% ethanol. 3. Centrifuge briefly (5sec) to pellet the microparticles. 4. Discard the supernatant, follow by 3 washes with 1ml autoclaved ddH20. 5. Vortex for 1 min. 6. Centrifuge briefly (3-5sec) and again remove the supernatant. 7. Add 1ml sterile 50% v/v glycerol. 8. Store the gold stock at -20C.

PAGE 90

90 Preparation of DNA Coat ed Microparticles 1. Transfer 30 l of the gold stock suspensi on after vortexing to a 1.5 ml sterile microfuge tube. 2. Add gene expression cassette (1-5g) and sterilized ddH2O to a final volume of 60l and vortex at low speed for 30 sec. 3. Place 20 l 0.1 M freshly prepared spermidine and 50 l 2.5 M CaCl2 on the lid of the eppendorf tube. 4. Mix all components by closing the lid and vortexing for 1 min. 5. Centrifuge briefly (3-5se c) to pellet the gold. 6. Discard the supernatant without disturbing the pellet and add 250 l absolute ethanol for washing. 7. Centrifuge briefly (3-5sec) and discard the supernatant. 8. Repeat the previous washing with ethanol once more. 9. Resuspend the pellet in 90 l absolute ethanol by sonication for 1 s. 10. Keep the DNA coated microparticles on ice. Biolistic Bombardment 1. Turn on PDS-1000/He Particle Delivery Syst em and vacuum pump; ensure the helium supply is at least 200 psi above the desired pressure optimum. 2. Place the rupture disk in the centre of the ruptur e disk holder and secure it properly inside the chamber. 3. Place macrocarriers into holders with forceps and push down with a sterile blunt object to secure it in holders. 4. Prior to use, resuspend the DNA-coated microparticles by briefly vortexing. 5. Apply 5 l of the suspension of DNA coated microparticles into the center (inner 5mm diameter) of the macrocarrier; allow for comp lete evaporation of ethanol before use. 6. Place stopping screen into the macrocarrier pl ate and insert the inverted macrocarrier assembly on top. Secure the lid on top of the shelf assembly. 7. Place macrocarrier plate containing the macro carrier at the highest level of the inner chamber. 8. Place tissue culture plate on shelf 2 below the macrocarrier plate (6 cm below). 9. Initiate a vacuum to 27.5 Hg; press and hold th e fire button until the disc ruptures at 1100psi. Eye protection must be worn. 10. Vent the vacuum and remove petri dish. 11. Dismantle the assembly and prepare for the next shot. Tissue Culture Induction, Maintenance, Selection and Plant Regeneration Seed Preparation for B ahiagrass Callus Induction 1. Weigh 2.0g seed in a vial and treat with conc entrated sulfuric acid for 12-16 min (increase the time for larger seed). Sulfuric acid is scarification treatment to break the dormancy. 2. Transfer the seeds to an empty beaker using 500 ml dH2O. Stir the mixture with a glass rod to mix. Decant the liquid and floating debris. 3. Add 500 ml dH2O to the seeds and strain them th rough two layers of cheesecloth.

PAGE 91

91 4. Gently rub the seeds in the cl oth to remove the debris. 5. Wash the seeds with 500 ml dH2O and repeat the steps 3-5, two times. 6. After the third wash, leave the seeds in the cheesecloth and dry them for 15 min. 7. Transfer the seeds to a 9 cm Petridish. 8. For sterilization, mix 20 ml of 6% sodium hypochlorite solution a nd 10 ml glacial acetic acid. Place the resulting solution at the bottom of a glass dessi cator in the fume hood to avoid inhalation of fumes. 9. Place open Petridishes of seeds and lid in the dessicator for 1 h. Chlorine fumes from the mixture will sterilize the seeds and inside of the Petridishes. 10. Add enough autoclaved dH2O to submerge the seeds and leave to soak for at least 1 h before placing the seeds on the surface of on culture medium. 11. Place 20 seeds per Petridish. Tissue Culture of Seedling-derived Calli of Bahiagrass 1. Initiate cultures on a callus induction me dia (CIM; see media preparation below) and subcultured to a new medium of the same composition biweekly. 2. Maintain cultures under low light intensity (30 Em-2s-1 light) at 28C and 16 h photoperiod in an incubator. 3. Continue the callus induction phase for 2-4 we eks. Bahiagrass calli are bombarded 6-weeks after culture initiation. 4. Placed tissues on callus induction medium supplem ented with 0.4M sorb itol (osmoticum) 4-6 h prior to bombardment. Immediately after bombardment, or up to 16 h after bombardment,transferr tissues to callus induc tion medium (CIM) and maintain under 30 Em-2s-1 illumination at 28C and 16 h photoperiod for 7 days before initiation of selection. Selection and Regeneration Protocol for Bahiagrass using npt II/Paromomycin 1. Transfer calli onto selecti on medium 7 d after gene transfer and maintain at 30 Em-2sec-1 illumination, with a 16 h photoperiod at 25C. Th e selection medium consists of CIM with 50 mg L-1 paromomycin. Phytagel is replaced by agarose (Type I, Sigma). Track the identity of independent callus lines through selection and regenera tion procedure to recover independent transformants. 2. Subculture calli to new selection medium biweek ly until 28 d after initi ation of selection. 3. Transfer calli to regeneration selection medium containing all components of selection medium but with 1.1 mg L-1 BAP, replacing 0.1 mg L-1 BAP and no auxin. Maintain calli on regeneration selection medium for 14 d and increase the light intensity from 30 Em-2sec-1 to 150 Em-2sec-1 light. 4. Transfer calli with shoots to selection rooting media in deep Petri-dishes containing 50 mg L1 paromomycin without growth regulators. Incubate unde r high light intensity (150 Em-2s-1 light), 16 h photoperiod at 25C for 14 d. 5. Transplant elongated shoots with roots into compost and maintain in a growth chamber with 12 h photoperiod at 25C temperat ure. Keep the regenerated plan ts covered during the first 46 d with a transparent container to maintain humidity.

PAGE 92

92 6. After 14 d of acclimatization in growth chambers move the transgenic plants to glasshouses maintained at 28C day and 22C night, under natural photoperiod. Molecular Techniques used in the Confirma tion of Putative Transgenic Plants Immunochromatographic bar /PAT QuickStix Test QuickStix Libertylink bar/PAT (EnviroLogix, Portland, Ma ine, US) kit for as provided by the manufacturer The QuickStix strips must be allowed to come to room temperature before use. 1. Harvest 3 leaf segments in a centrifuge tube 2. Add 150l of the extraction buffer supplied with the kit. 3. Grind the tissue until the buffer turns dark green 4. Centrifuge for 5 min 5. Remove the supernatant with a yellow pi pette without disturbi ng the leaf debris. 6. At this step, the total protein may be quantified or the Quick Stix may be directly used. (for protein estimation please see NPTII ELISA protocol). 7. Place the strip into the extraction tube. The samp le will travel up the strip. Use a rack to support multiple tubes if needed. 8. Allow the strip to develop for 10 min before making final assay interpretations. Positive sample results may become obvious much more quickly. Development of the control line within 10 min indicates that th e strip has functioned properly. The sample extract containing bar/PAT will develop a second line (test line) on the membrane strip between the control line and the protective tape, within 10 min of sample addition. NPTII ELISA Assay Stable Transformants Protein Extraction 1. Harvest 600mg of young fresh leaf tissue. Store samples on ice. 2. Add 10mg polyvinyl pyrrolidone (PVP) and 600 l 10x PEB1 buffer (supplied with the nptII Agdia ELISA kit) to each sample. 3. Grind the leaf samples using a micr opestle. Keep the samples on ice. 4. Centrifuge the samples at 20,800g at 4C for 15 min. 5. Transfer the supernatant to a new micr ocentrifuge tube and store on ice. Protein Estimation 6. Dilute Protein Determination Reagent (USB Corporation, product code 30098) 1:5 using sterile ddH2O. Prepare enough to use 1 ml per samp le including standards and blank. 7. Prepare a standard dilution series using BSA (0-20 g). 8. Add 1 ml diluted Protein Determination Reagen t to each cuvette. Add 5 l of sample to each cuvette and mix by vortexing. 9. Incubate at room-temperature while preparing the remaining samples. 10. Measure OD595 of each sample (ideally these should be between 0.2 and 0.8). 11. Plot a standard curve using BS A and use it to estimate total protein concentration of the samples. 12. Calculate the volume of each sample requi red for 15 g total protein per well.

PAGE 93

93 Assay 13. Prepare the samples, including wild-type usi ng 15 g protein and the volume of buffer PEB1 required to make the total volume 110 l. 14. Prepare standards as follows: 110 l buffer PEB1 (negative control) and 110 l of the provided positive control. 15. Prepare a humid box by putting damp paper towel in a box with a lid. 16. Add 100 l of each sample and standard in the ELISA microplate provided with the kit. The order of samples should be noted at this time. 17. Place the plate in the humid box and incubate for 2 hours at room temperature. 18. Prepare the wash buffer PBST by dilu ting 5 ml to 100 ml (20x) with ddH2O. 19. Prepare the enzyme conjugate diluent by mi xing 1 part MRS-2 with 4 parts 1x buffer PBST. Make enough to add 100 l per well. 20. A few minutes before the incubation ends, add 10 l from bottle A and 10 l from bottle B per 1 ml of enzyme conjugate diluen t to prepare the enzyme conjugate. 21. When incubation is complete, remove plate from humid box and empty wells. 22. Fill all wells with 1x buffer PBST and then empty them again. Repeat 5x. 23. Ensure complete removal of wash solution by tapping the frame firmly upside down on paper towels. 24. Add 100 l of the prepared enzyme conjugate into each well and incubate the plate in the humid box for 2hrs at room temperature. 25. In the meanwhile, aliquot sufficient TMB substr ate (100 l per well) and allow it to warm to room temperature. 26. When the incubation is complete, wash th e plate with 1x buffer PBST as before. 27. Add 100 l of room temperature TMB substrat e solution to each well and place the plate back in the humid box for 15 min. A blue color will develop, the intensity of which will be directly proportional to the am ount of NPTII protein in the sa mple, while negative samples will remain white. 28. To stop the reaction, add 50 l 3M sulphuric acid to each well. The substrate color will change from blue to yellow. 29. The results must be recorded within 15 min af ter addition of the stop solution otherwise the reading will decline. 30. Color development can be visually scored or recorded with the help of an ELISA plate reader. DNA Extraction CTAB Method 1. Autoclave mortars, pestles and spatulas for 20 min and dry in an incubator oven at 60C. 2. Prepare enough CTAB buffer (5ml/gram leaf material) for use by adding mercaptoethanol fresh (200l -mercaptoethanol per 100ml buffer or 30 l in 15ml). Heat to 65C in a water bath. 3. Harvest 3g young leaf material and stor e on ice or freeze in liquid nitrogen. 4. Cool mortar and pestle by a dding liquid nitrogen. Chop fresh leaf into the liquid nitrogen using scissors or add leaf and then cut into small slices. Grind to a fine powder under nitrogen approximately 3 times. 5. Add frozen leaf powder to 15ml pre-heated buffer in a 50ml disposable polypropylene tube and mix well to remove lumps using a spatula or glass rod.

PAGE 94

94 6. Incubate at 65C, 1 hour. Mix the conten ts in between as well (1-3 times). 7. Cool to room temperature. 8. Add equal volume (15ml) chloroform/isoamylalcohol (24:1) and mix gently to form an emulsion for approx 30 mins. Fist mix by hand and on an orbital shak er (Adams Nutator Mixer) for 15 min. Mix with hand by gently inverting the tubes and then again put it on the shaker for another 10-15 mins. 9. Spin, 4000rpm, 1 min. Remove lo wer layer using a 10ml pipette. 10. Spin, 4000rpm, 10 mins. Transfer top layer to a fresh 50ml tube. 11. Add 2/3 volumes isopropanol and mix gently by inverting. The DNA will precipitate. 12. Use a blue pipette tip to hold the DNA insi de the tube and pour away the liquid. 13. Transfer DNA to a clean 1.5ml eppendorf tube. 14. Wash 2 times in 70% ethanol by holding the DNA in the tube with the pipette tip. 15. Spin, max speed, 1 min. Remove supernatant. 16. Air-dry for 15 min in a clean bench and resuspend in 500l TE. 17. Add 2l RNaseA (30mg/ml) and incubate at 60C overnight. 18. Add 300l phenol/ chloroform (25:24:1 P:C:IAA) (lower layer in the bottle) and mix by inverting and tapping to form an emulsion. 19. Centrifuge for 7 min at 14000 rpm. Transfer supernatant to a clean tube without disturbing the interface. 20. Repeat phenol/ chloroform extraction. 21. Add 300l chloroform/isoamylalcohol (24: 1) and mix to form an emulsion. 22. Centrifuge for 7 min at 14000 rpm. Tran sfer supernatant to a clean tube. 23. Repeat chloroform extraction. 24. Add 1/10 volume (50l) sodium acetate and 2 volumes (1000l) 100% EtOH. 25. Centrifuge briefly and remove supernatant. 26. Wash two times using 70% ethanol. First wa sh, pour off the ethanol, and in second wash pipette the supernatant after a brief spin. 27. Dry the pellet for 15-25 mins in a vacuum rota tory evaporator (hea ting on) and resuspend in 200l autoclaved T1/10E. Allow the DNA pellet to re suspend overnight at 60C. 28. Prepare 10x dilution of the DNA stock. Use 1l to check concentrati on and quality using the Nanodrop spectrophotometer and by gel elec trophoresis of samples in a 0.8% agarose gel (80V, 60 min). 29. Store the dilutions and stocks at 4C. Southern Blotting Gel electrophoresis 1. Extract genomic DNA from transgenic lines as well as wild-type using the CTAB method as described above. 2. Digest 1g DNA from all samples with the re striction enzyme to be used for Southern blotting. Run the digested DNA on a 1% agar ose gel to ensure co mplete restriction digestion. 3. Use 15g DNA to set up restriction digests for Southern blotting. First, estimate the volume of each sample required to get 15 g DNA and pipet it into a sterile 1.5 ml microcentrifuge tube. Add steril e ddH2O to make up the volume to 30 l. 4. Set up the digestion as follows:

PAGE 95

95 DNA (15 g DNA + sterile ddH2O) 30.0 l 10x BamHI buffer 6.0 l 100x BSA 0.6 l BamHI (1000U/l) 2.0 l Sterile ddH2O 21.4 l Final volume 60.0 l 5. Prepare a master mix for all samples that includes the buffer, BSA (if required for the enzyme chosen), enzyme and water. Mix by pipetting and add 30 l DNA. Mix well, centrifuge briefly and incubate in a waterbath at 37C over-night. 6. Run 2 l from each digest on a 1% agarose gel to ensure complete digestion. 7. Prepare a 1 cm thick 1% agarose gel for Southern blotting using 1x TAE. Concentrate all the digest s to reduce the volume by half (30 l) in a Speed-Vac. 8. Centrifuge the samples briefly and add 6 l 6x loading dye. Mix well by pipetting. Load samples on the gel. Also load a molecular weight marker (1 kb ladder, New England Biolabs) for estimating band size following hybridization. 9. Dilute the plasmid containing the tran sgene and load 50pg as a positive control. 10. Run the gel at 20V over-night (12-14 hours) in 1x TAE. 11. Remove the gel from the electrophoresis a nd cut excess gel using a scalpel. Measure the dimensions of the gel. 12. Stain the gel for one hour using freshly pr epared ethidium bromide stain (0.05g/ 13. Wash the gel five times using de-ionized water (DI H2O). 14. Visualize the gel on a gel-documentation sy stem to check complete digestion of all samples. Also measure and record the distance of the bands of the molecular weight marker from the top of the gel. DNA transfer blottingalkaline transfer procedure 15. Prepare 500 ml 0.25N hydr ochloric acid (HCl) and 3L 0.4N sodium hydroxide (NaOH) solution per blot. 16. Treat the gel with 0.25N HCl on a shak er with gentle shaking for 15 min for depurination. Wash the gel three times with DI H2O. 17. Cut three pieces of filter paper to match th e size of the gel and two pieces for the bridge (24x18 cm). Also cut a piece of the Hybond-N membrane (Amersham) to match the size of the gel. 18. Treat the gel with 0.4N NaOH on a sh aker with gentle shaking for 30 min. 19. Assemble the tray and the platform on which th e blot is to be set up. Place the filter paper bridge on top of each other on the platform and fold them so that it dips into the tray on both sides. 21. Pour 0.4N NaOH on the bridge to wet it co mpletely. Roll a glass rod over it several times to remove air bubbles. Pour more NaOH onto the bridge. 22. Place the gel in the center of the bridge, pour NaOH over it and remove air bubbles. 23. Mark the membrane to determine the orientation of the gel following blotting. 24. Wet the membrane using 0.4N NaOH, place the membrane on the gel; pour NaOH onto it and remove air bubbles. 25. Place three pieces of Whatmann filter pape r on the membrane; remove air bubbles after placing each piece. Pour more NaOH over the to p to avoid drying of the filter papers. 26. Place pieces of parafilm a ll around the gel to cover the br idge to ensure that the movement of the transfer buffer (0.4N NaOH) takes place only through the gel.

PAGE 96

96 27. Fill the tray with the tran sfer buffer to the top and cover the tray with Saran wrap to prevent evaporation of the buffer during blotting. 28. Place a stack of absorbent paper towels on the gel and place another piece of plexi-glass on top. On this, place a small we ight ( ca. 750g) to ensure uniform blotting and leave over-night (16-18 hours). 29. Disassemble the blot. Wrap the membrane in a cling film and expose it to UV for 2 min to fix the DNA on the membrane. Store the membrane in a zip-loc bag at 4C. 30. Visualize the gel using a gel-documentati on system to make sure the transfer was complete. 31. Follow the hybridization protocol described below. For neutral transfer procedure, 20x SSC is used as transfer buffer in place of 0.4N NaOH. Treatment of the gel includes 10 min depurina tion treatment with 0.125N HCl, followed by 30 min treatment with denaturation buffer and 30 min treatment with neutralization buffer. All other steps are same as described above. Hybridization using the Prime-a-Gene Labeling System (Promega) 1. Check the radioactive working area for previous contamination before working. Thaw blocking DNA (sheared salmon sperm DNA), labeling buffer, dNTPs (dATP, dGTP, dTTP), BSA and probe on ice. Place [ -32P] dCTP behind the plexiglass shield to thaw. 2. Pre-heat the hybridization oven and water-bath to 65C. Place the hybridization buffer in the water-bath. 3. Roll the membrane and place it inside the hybrid ization tube. Add 50 ml 5x SSC to the tube and pre-wet the membrane for 5-10 min. Make sure that there are no leaks. 5. Estimate the volume of probe required to get 25 ng of the probe and pipette it into a clean microcentrifuge tube. Make up the volume to 30 l using the nuclease-free water provided with the labeling kit. 6. Close the tube tigh tly and boil the probe for 5 min. Al so boil 500 l of salmon sperm DNA in a separate tube. Place on ice fo r 5 min immediately after boiling. 7. Discard the 5x SSC into the sink and invert the hybridization tube s on a paper tissue to drain. 8. Prepare the dNTP mix by mixing equal parts of dTTP, dA TP and dGTP. Prepare enough to use 2 l per labeling reaction. 9. Set up the labeling reaction as follows: Add the following to the denatured probe5x labelling buffer 10 l Unlabeled dNTP mix 2 l BSA 2 l Klenow (5U/l) 1 l Total volume 45 l 10. Move the mixture behind th e plexiglass shield; add 5 l [ -32P] dCTP and mix well by pipetting. Final volume of the reaction is 50 l. 11. Incubate the mixture behind the plexigla ss shield at room-temperature for 4 hours.

PAGE 97

97 12. For pre-hybridization, ad d 15 ml pre-heated (65C) hybridization buffer and 500l denatured salmon sperm DNA in the hybridization tube. 14. Place the tubes in the hybridization oven and incubate at 65C for 4h. 15. Add 500 l salmon sperm DNA to the labeled probe and boil for 5 min behind the plexiglass shield. 16. Discard the pre-hybridization solution into the sink and drai n the tube on a paper towel. 17. Just before the probe is ready, add 8 ml pre-heated hybridization buffer in the hybridization tube and move the tube behind the plexiglass shield. 18. Immediately after boiling, add the probe mi xture to the hybridizati on tube. Take care to avoid any spills. 19. Place the hybridization tube in the hybridi zation oven and incubate over-night at 65C (18 hours). 20. Prepare the wash solution (0.1x SSC + 0.1% SDS). Prepare enough to use 70 ml per wash for three washes per blot. 21. Heat the solution to 65 C using the water-bath. 22. Remove hybridization tubes from the oven and place behind the plexiglass shield. 23 Working behind the plexiglass shield, dispose the hybridization solutio n into the hazardous waste container using a funnel ta king care to avoid any spills. 24. Pour 70 ml pre-heated wash solution (65C) into the hybridization tube; replace the lid tightly and perform a quick wash by shaking the tube for a few seconds. 25. Dispose the wash solution into the hazardous waste contai ner and add another 70 ml preheated wash solution into the tube. 26. Place the tubes in the oven for 20 min. Working behind the plexiglass shield, dispose the wash solution into the hazardous waste contai ner and add 70 ml preheated wash solution into the tube for the final wash. 27 Place the tube in the oven for 20 min. Remove the tubes from the oven and place them behind the plexiglass shield. Dispose the wash solution into the hazardous waste container and wrap the membrane in Saran wrap. 28 Check for radioactivity on the membrane usi ng a Geiger counter. Also check the working area for any radioactive contamination. 29. Place the membrane with an X-ray film (Koda k) in an autoradiography cassette and allow 16-18 hours for exposure depending on the intensity of the signal from the Geiger counter. Place the cassette at -80C during exposure. Polymerase Chain Reaction Set up using the HotStarTaq DNA Polymerase (Qiagen) 1. Prepare a master-mix for all the sample s including the wild-type and a known positive control.as follows: 10x Buffer 2.50 l 5x Q solution 5.00 l 50x dNTP mix 0.50 l 50x MgCl2 0.50 l 10 M Forward primer 1.00 l 10 M Reverse primer 1.00 l HotStarTaq 0.15 l Sterile ddH2O 13.35 l

PAGE 98

98 Final volume 24.00 l 3. Dispense 24 l of the master mix into each tube. 4. Add 1 l sample DNA for each sample tube (100-200 ng), 1 l sterile ddH2O to the negative control and 1 l plasmid (100pg/l) to the positive control. Mix well by pipetting, spin briefly and start the PCR program. Note: Remember to start the PCR program with 15 min at 95C to activate the HotStarTaq polymerase. Cytological Techniques used in the Charact erization of Herbicide Resistant Hybrids Embryo Sac Analysis 1. The flowering season of bahiagrass starts in May and continues until September. Maintain good plant growth by appropriate watering and biweekly application of fertilizer (e.g. Miracle Gro lawn food, The Scotts Company) (. Keep plants in greenhouse at 85F and natural photoperiod). 2. When the inflorescence has emerged and anthesis has started (generally the terminal portion of the raceme), remove the part of the raceme which flowered in the morning. 3. Next morning (between 7:00-9:00AM), rem ove the portion of the raceme which has flowering, (keeping the unflowered porti on intact) using a pa ir of scissors. 4. Fix the inflorescence in 70% ethanol: acetic ac id: methyl salicyclat e (3:1:1 v/v) for 2h. 5. Dissect the pistils carefully unde r a dissectoscope. Do not rem ove the two feathery stigmas (one on each side of the pistil). Prepare atleas t 25 pistils for each sample and place them in a clean microcentrifuge tube with the fixing solution. 6. Leave the pistils in the fixing solution overnight at room temperature. 7. Treat the pistils with a serious of solution as follows: Hydrogen peroxide 2 h 50% ethanol 45 min 75% ethanol 45 min 100% ethanol 45 min 50% ethanol: 50%met hyl salicyclate 45 min 25% ethanol: 75% met hyl salicyclate 45 min 100% methyl salicyclate overnight 8. Arrange the pistils on a clean si de. Add a drop of methyl salicyc late. Put the cover slip on it carefully. 9. Observe under a differential contrast microscope (DIC) at 20x magnification. Pollen Staining Procedure 1. Put a drop of orcein stain on a clean glass slide. 2. At the time anthesis between 7:00-9:00AM, collect the pollen by dusting it on the clean glass slide with a drop of the stain. 3. Gently cover it with a cover slip. 4. Observe the pollen grains under a microscope at 20x magnification.

PAGE 99

99 Ploidy Determination using Flow Cytometer 1. Harvest the shoot meristem by excising atleast 5cm below the outermost leaf roll. Place it on a damp paper towel and put it in a zip-loc bag. Keep samples on ice. 2. Remove the outer layer of mature leaf. Exci se (1cm) the bottom part of the leaf roll. 3. Put 400l of CyStain A. Finely chop the meri stematic region usi ng a razor blade and a scalpel 4. Allow an incubation of 3 min at room temperature 5. Place the 1 micron nylon mesh filter on a clean disposable cuvette. Filter the material through the 1 micron mesh. 6. Add 800 l to the solution. Allow 3 min for staining 7. Place the cuvette in the sample holder on the Partec ploidy PA analyzer. 8. Read the diploid and tetraploid samples first, followed by the samples. Root-tip Preparations for Chromosome Counting 1. Harvest actively growing root s (5cm from the root tip). 2. Pre-treat the roots with 4hybdroxyquinoline for 4 h in the refrigerator. 3. Fix the material in 95% ethanol: acetic acid (3:1 v/v) overnight the refrigerator. 4. Store root samples in 70% ethanol. 5. Remove the root cap and place 5mm portion of the root-tip on a clean glass slide. 6. Put a drop of 45% acetic acid and macerate the sample using the a small round object (such as, rear end of a needle). 7. Put a drop of orcein stain. Allow the samples to stain for atleast 30 min. 8. Observe under a microscope, first at 20x and then at 40x. Buffers and Solutions Stock Solutions Kanamycin (10 mg/ml) Dissolve 100 mg kanamycin in 10 ml ddH2O. Filter sterilize and store in aliquots at 20C. Use 5 l per ml of LB broth. Paromomycin (50 mg/ml) Dissolve 0.5g paromomycin sulphate in 10 ml ddH2 O. Filter sterilize and store in aliquots at 20C. Use 1 ml/L media. CuSO4 (12.45mg/ml) 0.6225g CuSO4.5H2O dissolved in 50 ml ddH2O. Filter sterilize by usin g 1 micron filter fitted to a syringe. Store in aliquots at 20C. Use 100 l/L media. MS Vitamins (1000x) 5.156g powdered stock dissolved in 50ml ddH2O. Filter sterilize and store in aliquots at 20C. Use 1 ml/L media.

PAGE 100

100 BAP (1mg/ml) 0.025g powder dissolved in 500 l 1N NaOH. Make up to 25ml with ddH2O. Filter sterilize and store in aliquots at -20C. Use 1.1 ml/L media. Dicamba (2mg/ml) 0.1g dissolved in 1ml absolute EtOH (200 proof) by warming to 40C. Slowly add 49ml warm ddH2O (40C). Stir to dissolve. Filter sterilize and store in aliquots at -20C. Use 1.5 ml/L media. Media Callus Induction medium (IF) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 1.2 g phytagel. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 440 l BAP (1 mg/ml) 600 l Dicamba (2 mg/ml) Osmotic medium (0.4M IF) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose 29.12 g Sorbitol Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 1.2 g phytagel. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 440 l BAP (1 mg/ml) 600 l Dicamba (2 mg/ml) Selection medium (IFP50) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bo ttles and add 2.4 g agarose. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 440 l BAP (1 mg/ml) 600 l Dicamba (2 mg/ml)

PAGE 101

101 400 l Paromomycin (50 mg/ml) Regeneration medium (IFRP50) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bo ttles and add 2.4 g agarose. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 40 l BAP (1 mg/ml) 400 l Paromomycin (50 mg/ml) Rooting medium (NHP50) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bo ttles and add 2.4 g agarose. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 400 l Paromomycin (50 mg/ml) Buffers CTAB buffer (500 ml) 50 ml 1M Tris-HCl 20 ml 0.5M EDTA (disodium salt) 40.91 g NaCl 10g CTAB Make up the volume to 500 ml with ddH2O and autoclave for 20 min. 3M sodium acetate (50 ml) Dissolve 4.1 g sodium acetate in 50 ml ddH2O. Adjust pH to 5.2 with glacial acetic acid. 0.5M EDTA disodium salt, pH 8.0 (100 ml) Dissolve 18.61 g EDTA disodium salt in 100 ml ddH2O. 6x Loading dye (100 ml) 0.25% bromophenol blue 0.25% xylene cyanol FF 15% Ficoll Dissolve 15 g Ficoll in 60 ml ddH2O while stirri ng constantly. Add 20 ml ddH2O and warm the mixture. Add 0.25 g of both dyes, dissolve completely and make up volume to 100 ml with ddH2O. Autoclave for 20 min and store at room temperature.

PAGE 102

102 50x TAE (1L) 242 g Tris base 57.1 ml glacial acetic acid 100 ml 0.5M EDTA (pH 8.0) Combine all components in ddH2O, make the final volume to 1000 ml. Autoclave for 20 min. Use 1x TAE as running buffer. 5X TBE (1L) 54 g Tris base 27.5 g boric acid 20 ml 0.5M EDTA (pH 8.0) Combine all components in ddH2O, make the final volume to 1000 ml. Autoclave for 20 min. Use 0.5x TBE as running buffer. Hybridization Buffer (500 ml) 125 ml 1M Na2HPO4 (pH 7.4) 1 ml 0.5M EDTA (pH 8.0) 5 g BSA 175 ml 20% SDS Make up the volume to 500 ml with ddH2O. Autoclave for 20 min and store at 4C. 1M Na2HPO4, pH 7.4 (1L). Dissolve 142 g Na2HPO 4 in 800 ml ddH20. Adjust the pH to 7.4 with phosphoric acid and make up the volume to 1L. 20x SSC, pH 7.0 (1L) 175.3 g NaCl 88.2 g sodium citrate Dissolve in 800 ml ddH2O. Adjust pH to 7.0 w ith 1N HCl, make up the volume to 1L and autoclave for 20 min. 0.125N HCl 11ml conc HCl 898 ml dd H20 Denturation Buffer 87.66g NaCl 20g NaOH Dissolve in 800 ml ddH20 and make final volume to 1000 ml. Neutralization Buffer 87.66g NaCl 60.5g Trizma base Dissolve in 800 ml ddH20. Adjust pH to 7.5 with conc. HCl. Make final volume to 1000 ml with dd H20.

PAGE 103

103 Cytological Staining Solution Orcein Stain 0.4g Orcein 10 ml propinonic acid 10 ml lactic acid Disslove the mixture and filter it through Whatman filte r paper No. 1. Store it in the refrigerator at 4C.

PAGE 104

104 LIST OF REFERENCES Acuna CA (2006) Bahiagrass germ plasm reproduc tive characterization, and breeding at the tetraploid level. M.S. Thesis, University of Florida, Gainesville, FL Acuna CA, Blount AR, Quesenberry KH, Hanna WW, Kenworthy KE (2007) Reproductive characterization of bahiagrass germplasm. Crop Sci 47:1711-1717 Acuna CA, Martinez EJ, Quarin CL (2004) A pospory followed by sterility in a hypotriploid hybrid (2xX4x) of Paspalum. Caryologia 57:373-378 Adamowski E, Pagliarini MS, Batista LAR (1998) Chromosome elimination in Paspalum subciliatum (Notata group). Se x Plant Rep 11:272-276 Adamowski E, Pagliarini MS, Bonato ABM, Batista LAR, Valls JBM (2005) Chromosome numbers and meiotic behavior of some Paspalum accessions. Genet Mol Biol 28:773-780 Afolabi AS, Worland B, Snape JW, Vain P (2004) A large-scale study of rice plants transformed with different T-DNAs provides new insight s into locus composition and T-DNA linkage configurations. Theor Appl Genet 109:815-826 Agharkar M, Lom ba P, Altpeter F, Zhang H, Ke nworthy K, Lange T (2007) Stable expression of AtGA2ox1 in a low-input turfgrass (Paspalum notatum Flugge) reduces bioactive gibberellin levels and improve s turf quality in field conditions. Plant Biotechnol J 5:791801 Agrawal PK, Kohli A, Twyman RM, Christou P ( 2005) Transformation of plants with multiple cassettes generates simple transgene integr ation patterns and high expression levels. Mol Breeding 16:247-260 Aguado-Santacruz GA, Rascon-Cruz Q, Cabrera-Ponce JL, Martinez-Hernandez A, OlaldePortugal V, Herrera-Estrella L (2002) Transgenic plants of blue gram a grass, Bouteloua gracilis (HBK) Lag. ex Steud., from micr oprojectile bombardment of highly chlorophyllous embryogenic cells Theor Appl Genet 104:763-771 Altpeter F, Vasil V, Srivastava V, Stoeger E, Vasil IK (1996) Accelerated production of transgenic wheat (Triticum aestivum L.) plants. Plant Cell Rep 16:12-17 Altpeter F, Baisakh N, Beachy R Bock R, Capell T, Christou P, Daniell H, Datta K, Datta S, Dix PJ, Fauquet C, Huang N, Kohli A, Mooibroek H, Nicholson L, Nguyen TT, Nugent G, Raemakers K, Romano A, Somers DA, Stoger E, Taylor N and Visser R (2005) Particle bombardment and the genetic enhancem ent of crops: myths and realities. Mol Breeding 15:305-327 Altpeter F, James VA (2005) Genetic tr ansformation of turf-type bahiagrass (Paspalum notatum Flugge) by biolistic gene transfer. Intern Turfgrass Soc Res J 10:485-489

PAGE 105

105 Altpeter F, Sandhu S (2008) Geneti c TransformationBiolistic Prot ocols. In: Plant Cell Culture Methods Express. Davey M, Anthony P (eds), Scion Publishing Ltd., Bloxham, United Kingdom (submitted) Altpeter F, Agharkar M, Sandhu S. (2008) Bahi agrass. In: A compendium of Transgenic Crop Plants: Vol 1. Kole C, Hall TC (eds), Blackwell Scientific, Oxford, United Kingdom (in press). Allen GC, Spiker S, Thompson WF (2000) Use of matrix attachment regions (MARs) to minimize transgene silencing. Plant Mol Biol 43:361-376 Bae TW, Vanjildorj E, Song SY, Nishiguchi S, Yang SS, Chandrashekhar T, Kang TW, Kim JI, Koh YJ, Lee J, Lee YE, Ryu KH, Lee HY, Park SY (2008) Environmental risk assessment of genetically engineered herbicide-tolerant Zoysia japonica. J Environmental Quality 37:207-218 Batra S, Kumar S (2003) Agrobacterium-mediated transient GUS gene expression in buffel grass (Cenchrus ciliaris L.) J Appl Genet 44:449-458 Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12:8711-8721 Blount AR, Quesenberry KH, Mislevy P, Gates RN, Sinclair TR (2001) Bahiagrass and other Paspalum species: An overview of the plant breeding efforts in the southern Coastal Plain. Proc 56th Southern Pasture Forage Crop Impr ovement Conference, Springdale, US Blount AR, Dankers H, Momol MT, Kucharek TA (2002) Severe dollar spot fungus on bahiagrass in Florida [Online]. Available at: http://dx.doi.org/10.1094/CM-2002-092701-RS (verif ied 30 April 2004). Blount AR, Quesenberrry K, Meyer B, Gates R (2003) The bahiagrass and Paspalum breeding program. Proc Sod-based Cropping Systems Co nference. North Florida Research and Education Center-Quincy, University of Florida, Gainesville, FL. Feb. 20-21, 2003 Bradford MM (1976) Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of prot ein-dye binding. Anal Biochem 72:248-254 Breitler JC, Labeyrie A, Meyna rd D, Legavre T, Guiderdoni E (2002) Efficient microprojectile bombardment-mediated transformation of rice using gene cassettes. Theor Appl Genet 104:709-719 Bregitzer P, Tonks D (2003) Inhe ritance and expression of transgenes in barley. Crop Sci 43:412 Burton GW (1942) Observations on the flowering habits of four Paspalum species. J Amer Soc Agron 34:205-210

PAGE 106

106 Burton GW (1948) The method of re production in common bahiagrass, Paspalum notatum. J Am Soc Agron 40:443-452 Burton GW (1955) Breeding Pensacola Bahiagrass, Paspalum notatum: I Method of Reproduction. Agron J 47:311-314 Burton GW (1967) A search for origin of Pensacola bahiagrass. Econ Bot 21:379 Butaye KMJ, Cammue BPA, Delaure Sl, DeBolle MFC (2005) Approaches to minimize variation of transgen e expression in plants Mol Breeding 16:79-91 Caceres ME, Matzk F, Busti A, Pupilli F, Arcioni S (2001) Apomixis and sexuality in Paspalum simplex: characterization of the mode of re production in segregating progenies by different methods. Sex Plant Rep 14:201-206 Castle LA, Wu GS, McElroy D (2006) Agricultura l input traits: past, present and future. Curr Opin Biotech 17:105-112 Chambliss CG, Adjei MB (2006) Bahiagrass. EDIS SS-AGR-36 Chambliss CG, Adjei MB (1991) Bahiagrass: Th e foundation of cow-calf nutrition in Florida p. 74-80. In: Beef Cattle Short Course Proc, Inst Food Agric Sci, University of Florida, Gainesville, FL. May1-3, 1991 Chapman MA, Burke JM (2006) Letting the gene out of the bottle: the population genetics of genetically modified crops. New Phytologist 170:429-443 Chen LJ, Marmey P, Taylor NJ, Brizard J, Espi noza C, DCruz P, Huet H, Zhang S, deKochko A, Beachy RN, Fauquet CM (1998a) Expression a nd inheritance of multi ple transgenes in rice plants. Nature Biotechnol 16:1060-1064 Chen LJ, Zhang S, Beachy RN, Fauquet CM (19 98b) A protocol for consistent large scale production of fertile transgenic rice plants. Plant Cell Rep 18:25-31 Chen LJ, Lee DS, Song ZP, Suh HS, Lu BR ( 2004) Gene flow from cultivated rice (Oryza sativa) to it weedy and wild rela tives. Annals Bot 93:67-73 Christensen AH, Quail PH (1996). Ubiquitin promoter-based vector s for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 5:213-218 Cunliffe KV, Vecchies AC, Jones ES, Kearney GA, Forster JW, Spangenberg GC, Smith KF (2004) Assessment of gene flow using tetr aploid genotypes of perennial ryegrass (Lolium perenne L.). Aust J Agri Res 55:389-396 Dalton SJ, Bettany AJE, Timms E, Morri s P (1999) Co-transformed, diploid Lolium perenne (perennial ryegrass), Lolium multiflorum (Italian ryegrass) and Lolium temulentum (darnel) plants produced by microprojectile bombardment. Plant Cell Rep 18:721-726

PAGE 107

107 Dalton SJ, Bettany AJE, Bhat V, Gupta MG, Bailey K, Timms E, Morris P (2003) Genetic transformation of Dichanthium annulatum (Forssk)an apomictic tropical forage grass. Plant Cell Rep 21:974-980 Darbani B, Eimanifar A, Stewart Jr. CN, Cama rgo WN (2007) Methods to produce marker-free transgenic plants. Biotech J 2:83-90 Das OP, Leviminzi S, Kour M, Benner M, Messing J (1990) A somatic rearrangement contributing to genetic diversity in ma ize. Proc Natl Acad Sci USA 87:7809-7813 Datta K, Biasakh N, Oliva N, Torrizo L, Albrigo E, Tan J, Rai M, Rehana S, Al-Babili S, Beyer P, Potrykus I (2003) Bioengineered golden indica rice cultivars with beta-carotene metabolism in the endosperm with hygromycin and mannose selection systems. Plant Biotechnol J 1:81-90 Dolezel J, Lysak MA, Houwe IV, Dolezelova M, Roux N (1997) Use of flow cytometry for rapid ploidy determination in Musa species. Infomusa 6:6-9 Dolezel J, Greilhuber J, Suda J (2007) Estimatio n of nuclear DNA content in plants using flow cytometry. Nat Protocols 2:2233-2244 Do Valle CB, Glienke C, Legui zamon GOC (1994) Inheritance of apomixis in Brachiaria, a tropical forage grass. Apomixis Newsl 7:42-43 Dixon L, Nyffenegger T, Delley G, Martinezizquierdo J, Hohn T ( 1986) Evidence for replicative recom bination in Cauliflower Mosaic-Virus. Virology 150:463-468 Daurelio LD, Espinoza F, Quarin CL, Pessino SC (2004) Genetic diversity in sexual diploid and apomictic tetraploid populations of Paspalum notatum situated in sympatry and allopatry. Plant Syst Evol 244:189-199 Ebunima H, Sugita K, Matsunaga E, Endo S, Ya mada K, Komamine K ( 2001) Systems for the removal of a selection marker and their combination with a positive marker. Plant Cell Rep 20:383 Erikson O, Hertzberg M, Nasholm T (2004) A conditional marker gene allowing both positive and negative selection in plants. Nat Biotech 22:455-458 Espinoza F, Pessino SC, Quarin CL, Valle EM (2002) Effect of pollination timing on the rate of apomictic reproduction revealed by RAPD markers in Paspalum notatum. Annals Bot 89:16-170 Espinoza F, Daurelio LD, Pessino SC, Valle EM, Quarin CL (2006) Genetic characterization of Paspalum notatum accessions by AFLP markers. Plant Syst Evol 258:147-159 Forbes I, Burton GW (1961) Cytology of di ploids, natural and induced tetraploids and intraspecific hybrids of bahiagrass, Paspalum notatum Flugge. Crop Sci1:402-406

PAGE 108

108 Fu X, Duc LT, Fontana S, Bong BB, Tinjuangj un P, Sudhakar D, Twyman RM, Christou P, Kohli A (2000) Linear transgene constructs lacking vector backbone sequences generate low-copy-number transgenic pl ants with simple integrati on patterns. Transgenic Res 9:11-19 Felber F, Kozlowski G, Arrigo N, Gaudagnualo R (2007) Genetic and ecological consequences of transgene flow to the wild flora. Green ge ne technology: Research in an area of social conflict. In: Advances in biochemical engineering/ bi otechnology 107:173-205 Gao CX, Jiang L, Folling M, Han LB, Nielse n KK (2006) Generation of large numbers of transgenic Kentucky bluegrass (Poa pratensis L.) plants following biolistic gene transfer. Plant Cell Rep 25:19-25 Gao XR, Wang CK, Su Q, Wang Y, An LJ (2007) Phytase expre ssion in transgenic soybeans: stable transformation with a vector-less construct. Biotech Lett 29:1781-1787 Gates RN (2000) Response of incomplete Tifton 9 bahiagrass stands to renovation. J Range Manage 53:614-616 Gates RN, Mislevy P, Martin FG (2001) Herb age accumulation of three bahiagrass populations during the cool season. Agron J 93:112-117 Gates RN, Quarin CL and Pedreira CGS (2004) Bahiagrass. In: Warm-Season (C4) grasses, Agronomy monograph no 45s. Moser LE, Bu rson BL, Sollenberger LE (eds), ASA, CSSA, SSSA, Madison, WI Gernand D, Rutten T, Pickering R, Houben A (2006) Elimination of chromosomes in Hordeum vulgare x H. bulbosum crosses at mitosis and interphase involves micronucleus formation and progressive heterochromatiniza tion. Cytogenet Genome Res 114:169-174 Goldman, JJ, Hanna WW, Flemi ng GH, Ozias-Akins P (2004) Ploidy variation among herbicideresistant bermudagrass plants of cv TifEagle transformed with the bar gene. Plant Cell Rep 22:553-560 Gondo T, Tsuruta S, Akashi R, Kawamura O, Hoffmann F (2005) Green, herbicide-resistant plants by particle inflow gun-mediated ge ne transfer to diploid bahiagrass (Paspalum notatum). J Plant Physiol 162:1367-1375 Gordon-Kamm WJ, Spencer TM, Ma ngano ML, Adams TR, Daines RJ, Start WG, OBrien JV, Chambers SA, Adams Jr. WR, Willets NG, Rice TB, Mackey CH, Krueger RW, Kausch AP, Lemaux PG (1990) Transformation of maize cells and regeneration of fertile transgenic plants. Plant Cell 2:603-618 Ha CD, Lemaux PG, Cho MJ (2001) Stable transf ormation of a recalcitrant Kentucky bluegrass (Poa pratensis L.) cultivar using mature seed-derived highly regenerative tissues. In Vitro Cell Dev Biol Plant 47:6-11

PAGE 109

109 Hadi MZ, McMullen MD, Finer JJ (1996) Transfor mation of 12 different plasmids into soybean via particle bombardment. Plant Cell Rep 15:500-505 Hanna WW, Burton GW (1986) Cytogenetics and breed ing behavior of an apomictic triploid in bahiagrass. J Heredity 77:457-459 Hanna WW (1995) Use of apomixis in cu ltivar development. Adv Agron 54:333-350 Hails RS, Morley K (2005) Genes invading new populations: a risk assessment perspective. Trends Ecol Evol 20:245-252 Hare PD, Chua NH (2002) Excision of selectable marker genes from transgenic plants Nat Biotechnol 20:575-580 Hartman CL, Lee L, Day PR, Tumer NE (1994) Herbicide-resi stant turfgrass (Agrostis palustris Huds) by biolistic transformation. Bio-Tech 12:919-923 Haygood R, Ives AR, Andow DA (2004) Population genetics of transgene containment. Ecol Lett 7:213-220 Hobbs SLA, Kpodar P, Delong CMO (1990) Th e effect of T-DNA copy number, position and methylation on reporter gene expression in tobacco transf ormants. Plant Mol Biol 15:851-864 Hoyle M, Hayter K, Cresswell JE (2007) Effect of pollinator abundance on self-fertilization and gene flow: application to GM canola. Ecological Adaptations 17:2123-2135 Iyer LM, Kumpatla SP, Chandrashekharan MB Hall TC (2000) Transgene silencing in monocots. Plant Mol Biol 43:323-346 Jackson MW, Stinchcombe JR, Korves TM, Schmitt J (2004) Costs and benefits of cold tolerance in transgenic Arabidopsis thaliana. Mol Ecol 13:3609-3615 Jakowitsch J, Papp I, Moscone EA, van der Winden J, Matzke M, Matzke AJM (1999) Molecular and cytogenetic char acterization of a transgene lo cus that induces silencing and m ethylation of homologous promot ers in trans. Plant J 17:131-140 James VA, Avart C, Worland B, Snape JW Vain P (2002) The relationship between homozygous and hemizygous transgene expressi on levels over generations in populations of transgenic rice plants. Theor Appl Genet 104:53-661 James VA, Neibaur I, Altpeter F (20 08) Stress inducible expression of DREB1A transcription factor from xeric Hordeum spontaneum L. in turf and forage grass (Paspalum notatum Flugge) enhances abiotic stress to lerance. Transgenic Res 17:93-104 Jia S, Wang F, Shi L, Yuan Q, Liu W, Liao Y, Li S, Jin W, Peng H (2007) Transgene flow to hybrid rice and its male-sterile lines. Transgenic Res 16:491-501

PAGE 110

110 Johnson PG, Larson SR, Anderton AL, Patterson JT, Cattani DJ, Nelson EK (2006) Pollenmediated gene flow from Kentucky bluegrass under cultivated field conditions. Crop Sci 46:1990-1997 Joersbo M, Donaldson I, Kreiberg J, Petersen S, Brunstedt J, Okkels FT (1998) Analysis of mannose selection used for transformati on of sugar beet. Mol Breeding 4:111-117 Kohli A, Griffiths S, Palacios N, Twyman RM, Vain P, Laurie DA, Christou P (1999a) Molecu lar characterization of transforming plasmid rearrangements in transgenic rice reveals a recombination hotspot in the CaMV 35S promoter and confirms the predominance of microhomology mediated recombination. Plant J 17:591-601 Kohli A, Gahakwa D, Vain P, Laurie DA, Christou P (1999b) Transgene expression in rice engineered through particle bombardmen t: molecular factors controlling stable expression and transgene silencing. Planta 208:88-97 Kononov ME, Bassuner B, Gelvin SB (1997) Inte gration of T-DNA binary vector 'backbone' sequences into the tobacco genome: Ev idence for multiple complex patterns of integration. Plant J 11:945-957 Kron P, Suda J, Husband BC (2007) Applications of flow cytometry to evolutionary and population biology. Annu Rev Ec ol Evol Syst 38:847-876 Kumar J, Shukla SM, Bhat V, Gupta S, Gupta MG (2005) In vitro plant regeneration and genetic transformation of Dichanthium annulatum. DNA Cell Biol 24:670-679 Lange M, Vincze E, Moller MG, Holm PB (2006) Molecular analysis of transgene and vector backbone integration into the barley genome following Agrobacterium-mediated transformation. Plant Cell Rep 25:815-820 Li L, Li R, Fei S, Qu R (2005) Agrobacterium-mediated transformation of common bermudagrass (Cynodon dactylon). Plant Cell Tissue Organ Cult 83:223-229 Loc NT, Tinjuangjun P, Gatehouse AMR, Christou P, Gatehouse JA (2002) Linear transgene constructs lacking vector backbone sequences generate transgenic rice plants which accumulate higher levels of proteins confe rring insect resistance. Mol Breeding 9:231244 Luciani G, Altpeter F, Yacta yo-Chang J, Zhang H, Gallo M, Meagher R, Wofford D (2007) Expression of cry1Fa in bahiagrass enhances resist ance to fall armyworm. Crop Sci 47:2430-2436 Luo, H, Hu Q, Nelson H, Longo C, Kausch AP, Chandlee JM, Wipff JK, Fricker CR (2004) Agrobacterium tumefaciens-mediated creeping bentgrass (Agrostis stolonifera L.) transformation using phosphinothr icin selection results in a high frequency of single-copy transgene integration. Plant Cell Rep 22:645-652

PAGE 111

111 Lyznik LA, Ryan RD, Ritchie SW, Hodges TK (1989) Stable co-transformation of maize protoplasts with gusA and neo genes. Plant Mol Biol 13:151-162 Maqbool SB, Riazuddin S, Loc NT, Gatehouse AMR, Gatehouse JA, Christou P (2001) Expression of multiple insecticidal genes confers broad resistance against a range of different rice pests. Mol Breeding 7:85-93 Martinez EJ, Urbani MH, Quarin CL, Ortiz JPA (2001) Inheritance of apospory in bahiagrass, Paspalum notatum. Hereditas 135:19-25 Martinez EJ, Hopp HE, Stein J, Ortiz JPA, Qu arin CL (2003) Genetic characterization of apospory in tetraploid Paspalum notatum based on the identifica tion of linked molecular markers. Mol Breeding 12:319-327 Martinez EJ, Acuna CA, Hojsgaard DH, Tcach MA Quarin CL (2007) Segregation for sexual seed production in Paspalum as directed by male gametes of apomictic triploid plants. Annals Bot 100:1239-1247 Martinfiova L, Majesky L, Mat onfi P (2007) Polyploid progeny from crosses between diploid sexuals and tetraploid ap omictic pollen donors in Taraxacum sect. Ruderalia. ACTA Biologica Cracoviensia Series Botanica 49:47-54 Matzke AJM, Neuhuber F, Park YD, Ambros PF, Matzke MA (1994) Ho mology-dependent gene silencing in transgenic plants: epistatic silencing loci contain multiple copies of methylated transgenes. Mol Gen Genet 244:219-229 Matsuoka Y,Takumi S, Kawahara T (2007) Natura l variation for fertile triploid F1 hybrid formation in allohexaploid wheat va riation. Theor Appl Genet 115:509-518 Matzk F, Meister A, Schubert I (2000) An effi cient screen for reproductive pathways using mature seeds of monocots a nd dicots. Plant J 21:97-108 Messeguer J, Fogher C, Guiderdoni E, Marfa V, Catala MM, Baldi G, Mele E (2001) Field assessments of gene flow from transgenic cultivated rice (Oryza sativa L.) using herbicide resistance gene as tracer marker. Theor Appl Genet 103:1151-1159 Messeguer J (2003) Gene flow assessment in transgenic plants. Plant Cell Tiss Organ Cult 73:201-212 Messeguer J, Marfa V, Catala MM, Guideroni E, Mele E (2004) A field study of pollenmediated gene flow from Mediterranean GM rice to conventional rice and the red rice weed. Mol Breeding 13:103-112 Meyer P (2000) Transcriptional transgene silencing and chromatin components. Plant Mol Biol 43:221-234

PAGE 112

112 Mislevy P, Sinclair TR, Ray JD (2001) Extended daylength to in crease fall/winter yields of warm-season perennial grasses. p. 256-257. In: Gomide JE et al. (ed.) Proc. 19th Int. Grasslands Cong., Sao Pedr o, SP, Brazil, 11-21 Feb Mogie M (1988) A model for the ev olution and control of generati ve apomixis. Biol J Linnean Soc 35:127153 Muller AE, Kamisugi Y, Gruneberg R, Niedenhof I, Horold RJ, Meyer P (1999) Palindromic sequences and A plus T-rich DNA elem ents promote illegitimate recombination in Nicotiana tabacum. J Mol Biol 291:29-46 Murashige T, Skoog F (1962) A revised medium fo r rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473-497 Murray MG, Thompson WF (1980) Rapid isolat ion of high molecula r-weight plant DNA. Nucleic Acids Res 8:4321-4325 Nogler GA (1984) Genetics of apospory in apomictic Ranunculus auricomus V.Conclusions. Botanica Helvetica 94:411-422 Ochatt S (2008) Flow cytometry in plant breeding. Cytometry 73A:581-598. Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences required for activity of the Cauliflower Mosaic Virus-35S promoter. Nature 313:810-812 Ortiz JPA, Pessiono SC, Leblanc O, Hayward MD, Quarin CL (1997) Genetic fingerprinting for determining the mode of reproduction in Paspalum notatum, a subtropical apomicitc forage grass. Theor Appl Genet 95:850-856 Ozias-Akins P (2006) Apomixis: Developmental ch aracteristics and genetics. Crit Rew Plant Sci 25:199-214 Perucho M, Hanahan D, Wigler M (1980) Geneti c and physical linkage of exogenous sequences in transformed cells. Cell 22:309-317 Popelka JC, Xu JP, Altpeter F (2003) Generation of rye (Secale cereale L.) plants with low transgene copy number after bi olistic gene transfer and pr oduction of instantly markerfree transgenic rye. Transgenic Res 12:587-596 Pozzobon MT, Valls JFM (1997) Chromosome number in germplasm accessions of Paspalum notatum (Gramineae). Brazilian J Gen 20:29-34 Pupilli F, Lambobarda P, Caceres ME, Quarin CL, Arcioni S (2001) The chromosome segment related to apomixis in Paspalum simplex is homeologous to the telomeric region of the long arm of rice chromosome 12. Mol Breeding 8:53-61 Quarin CL, Hanna WW (1980) Effect of thr ee ploidy levels on me iosis and mode of reproduction in Paspalum hexastachyum. Crop Sci 20:69-75

PAGE 113

113 Quarin CL, Hanna WW, Fernandes A (1982) Ge netic studies in dipl oid and tetraploid Paspalum speciesembryo sac development, chro mosome behavior and fertility in Paspalum cromyorrhizon, Paspalum laxum and Paspalum proliferum. J Heredity 73:254-256 Quarin CL (1992) The nature of apomixis and its origin in panicoid grasses. Apomixis Newsl 5:8-15 Quarin CL, Norrmann GA, Urbani M ( 1989) Polyploidization in aposporous Paspalum species. Apomixis Newsl 1:28-29 Quarin CL, Espinoza F, Martinez EJ, Pessino SC, Bovo OA (2001) A rise of ploidy level induces the expression of apomixis in Paspalum notatum. Sex Plant Reprod 13:243-249 Quesenberry KH, Smith R (2003). Production of se xual tetraploid bahiagrass using in vitro chromosome doubling agents. p. 145. In A. Hopkins and R. Barker (ed.) Molecular breeding of forage and turf. Abstracts, Third Int Symp, Dallas, TX. 18 May 2003. Rochester DE, Winer JA, Shah DM (1986) Th e structure and expression of maize genes encoding the major heat shock protein, hsp70. EMBO J 5:451-458 Romano A, Raemakers K, Bernardi J, Visser R, Mooibroek H (2003) Tran sgene organization in potato after particle bombardment-mediated (c o-)transformation using plasmids and gene cassettes. Transgenic Res 12:461 Rosellini D, Veronesi F (2007) Safe genetical ly engineered plants. J Phy Conden Matter 19:395005-395012 Roux N (2003) Rapid detection of aneuploidy in Musa using flow cytometry. Plant Cell Rep 21:483-490 Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press Sandhu S, Altpeter F, Blount AR (2007) Apomictic bahiagrass expressing the bar gene is highly resistant to glufosinate under field conditions. Crop Sci 47:1691-1697 Sandhu S, Altpeter F (2008) Co-integration, co-expression and inheritance of unlinked minimal transgene expression cassettes in ap omictic turf and forage grass (Paspalum notatum Flugge) Plant Cell Rep (submitted) Sanford JC, Vit MJ, Russell JA, Smith ED, Harpending, PR, De Roy MK, Johnson SA (1991) An improved helium-driven biolis tic device. Technique 3:3-16 Savidan Y (1981) Genetics and utilization of apomixis for the improvement of guineagrass (Panicum maximum Jacq.). Proc XIV Intl Grassl and Congr, Lexington, KY p 182-184 Savidan Y (2000) Apomixis: genetics a nd breeding. Plant Breeding Rev 18:13-86

PAGE 114

114 Sherwood RT, Berg CC, Young BA (1994) Inheritance of apospory in buffelgrass. Crop Sci 34:1490-1494 Shou HX, Frame BR, Whitham SA, Wang K (2004) Assessment of transgenic maize events produced by particle bombardm ent or Agrobacterium-mediated transformation. Mol Breeding 13:201-208 Sinclair TR, Mislevy P, Ray JD (2001) Short photoperiod inhibits winter growth of subtropical grasses. Planta 213:488-491 Smith RL, Grando MF, Li YY, Seib JC, Shatters RG Jr (2002) Transformation of Bahiagrass (Paspalum notatum Flugge). Plant Cell Rep 20:1017-1021 Song Z, Lu BR, Zhu YG, Chen J (2003) Gene flow from cultivated rice to the wild species Oryza rufipogon under experimental field condit ions. New Phytologist 157:657-665 Song Z, Lu BR, Chen J (2004) Pollen flow of cultivated rice measured under experimental conditions. Biodiversity a nd conservation 13:579-590 Stein J, Quarin CL, Martinez EJ, Pessino SC (2004) Tetraploid races of Paspalum notatum show polysomic inheritance and preferential chromosome pairing around the aposporycontrolling locus. Theo r Appl Genet 109:186-191 Stewart Jr. CN, Halfhill MD, Warwick SI (2003) Transgene introgression from genetically modified crops to their wild relatives. Nat Genet 4:806-817 Taliaferro CM, Hopkins AA, Henthorn JC, Mu rphy CD, Edwards RM (1997) Use of flow cytometry to estimate ploidy level in Cynodon species. Internatl Turfgrass Soc Res J 8:385-392 Thompson CJ, Movva NR, Tizard R, Crameri R, Davies JE, Lauwereys M, Botterman J (1987) Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus. EMBO J 6:2519-2523 Tischler CR, Burson BL (1995) Evaluating different bahiagrass cyto types for heat tolerance and leaf epicuticular wax co ntent. Euphytica 84:229-235 Tovar J, Lichtenstein C (1992) Somatic and meiotic chromosomal recombination between inverted duplications in transgenic tobacco plants. Plant Cell 4:319 Vain P, Worland B, Kohli A, Snape JW, Chri stou P, Allen GC, Thompson WF (1999) Matrix attachment regions increase transgene expression levels and stability in transgenic rice plants and their prog eny. Plant J 18:233-242 Vain P, James VA, Worland B, Snape JW (2002) Transgene behavior acro ss two generations in a large random population of transgenic rice pl ants produced by particle bombardment. Theor Appl Genet 105:878-889

PAGE 115

115 Valkonen JPT (1994) Nuclear DNA content of the Solanum spp. in the series etuberosa as determined by laser flow cytometry. Annals App Biol 125:589-600 Verweire D, Verleven K, De Buck S, Claey s M, Angenon G (2007) Ma rker-free transgenic plants though genetically programmed au to-excision. Plant Physiol 145:1220-1231 Vianna GR, Albino MMC, Dias BBA, Silva LM, Rech EL, Aragao FJL (2004) Fragment DNA as vector for genetic transformation of bean (Phaseolus vulgaris L.) Scientia Horticulturae 99:37-378 Vidal JR, Kikkert JR, Donzelli BD, Wallace PG, Reisch BI (2006) Biolis tic transformation of grapevine using minimal gene cassett e technology. Plant Cell Rep 25:807-14 Wang RRC, Li XM, Chatterton NJ (1999) Loss of heterozygosity and accelerated genotype fixation in rice hybrid s. Genome 42:789-796 Wang MB, Waterhouse PM ( 2000) High-efficiency si lencing of a beta-glucuronidase gene in rice is correlated with repetitive transgen e structure but is independent of DNA methylation. Plant Mol Biol 43:67-82 Wang Y, Kausch AP, Chandlee JM, Luo H, Rue mmele BA, Browning M, Jackson N, Goldsmith MR (2003) Co-transfer and expressi on of chitinase, glucanase, and bar genes in creeping bentgrass for conferring fungal dise ase resistance. Plant Sci 165:497-506 Wang ZY, Lawrence A, Hopkins A, Bell J, Scott M (2004) Pollen-mediated transgene flow in the wind-pollinated grass species tall fescue (Festuca arundinaceae Schreb.) Mol Breeding 14:47-60 Wang J, Yang X, Li Y, Elliot PF (2006) Pollination competition effects on gene flow estimation: using regular vs. male-sterile bait plants. Agron J 98:1060-1064 Watrud LS, Lee HE, Fairbrother A, Burdick C, Reichman JR, Bollman M, Strom M, King Gm Van de Water PK (2004) Evidence of landscapelevel, pollen-mediated gene flow from genetically modified creepi ng bentgrass with CP4 EPSPS as a marker. Proc Natl Acad Sci USA 101:14533-14538 Wild A, Wendler C (1993) I nhibitory action of glufosinate ammonium on photosynthesis. Zeitschrift Fur Naturforschung C-a Journal of Biosciences 48:367-373 Wu KK, Burnquist W, Sorells ME, Tew TL, M oore PH, and Tanksley SD (1992) The detection and estimation of linkage in polyploids usi ng single-dose restric tion fragments. Theor Appl Genet 83:294-300 Yao Q, Cong L, Chang JL, Li KX, Yang GX, He GY (2006) Low copy number gene transfer and stable expression in a commercial wheat cultivar via particle bombardment. J Exptl Bot 57:3737-3746

PAGE 116

116 Young BA, Sherwood RT, Bashaw EC (1979) Cleared -pistil and thick-sectioning techniques for detecting aposporous apomixis in grasses. Can J Bot 57:1668-1672 Yuan QH, Shi L, Wang F, Cao B, Qian Q, Lei XM, Liao YL, Liu WG, Cheng L, Jia SR (2007) Investigation of rice transgene flow in compass sectors by using male sterile line as a pollen detector. Theor Appl Genet 115:549-560 Zhang G, Lu S, Chen TA, Funk CR, Meyer CA (2003) Transformation of triploid bermudagrass (Cynodon dactylon x C-transvaalensis cv. TifEagle) by means of biolistic bombardment. Plant Cell Rep 21:860-864 Zhang H, Lomba P, Altpeter F (2007) Improve d turf quality of tran sgenic bahiagrass (Paspalum notatum Flugge) constitutively expressing th e ATHB16 gene, a repressor of cell expansion. Mol Breeding 20:415-423 Zhang J, Cai L, Cheng J, Mao H, Fan X, Meng Z, Chan KM, Zhang H, Qi J, Ji L, Hong Y (2008) Transgene integration a nd organization cotton (Gossypium hirsutum L.) genome. Transgenic Res 17:293-306. Zhao Y, Qian Q, Wang H, Hunang D (2007) Hereditary behavior of bar gene cassette is complex in rice mediated by particle bombardment. J Genet Genomics 34:824-835

PAGE 117

117 BIOGRAPHICAL SKETCH Sukhpreet S andhu was born in Jammu, India, to parents Col. Manjit. S. Sandhu and Jaswant Sandhu. Although originally from Punjab, she spent her childhood in different parts of India including, Jammu and Kash mir, Darjeeling, and the desert s of Rajasthan. She graduated from BCM Model Senior Secondary School, Ludhi ana in 1996, and pursued a B.S. (Science) from Government College for Women, Ludhiana. She was awarded the Meri t Certificate for an outstanding academic achievement. She joined the Punjab Agricultural University (PAU), Ludhiana, and graduated with an M.S. (Biochemistry) in 2002. Im mediately after graduation, she joined as a Research Fellow, at the Department of Agronomy, PAU. She continued to work until she came to US to pursue a Ph.D at the Univ ersity of Florida (UF). The Department of Agronomy, UF awarded her the Fred Hull Award for excellence in academics and research. She graduated with a Ph.D. (Agronomy) from UF in 2008.