<%BANNER%>

MicroRNA Regulation in GW/P Body Cell Biology, Lipopolysaccharide Signaling, and Rheumatoid Arthritis

Permanent Link: http://ufdc.ufl.edu/UFE0022419/00001

Material Information

Title: MicroRNA Regulation in GW/P Body Cell Biology, Lipopolysaccharide Signaling, and Rheumatoid Arthritis
Physical Description: 1 online resource (111 p.)
Language: english
Creator: Pauley, Kaleb
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: arthritis, bodies, cytokines, gw, interference, lipopolysaccharide, microrna, processing, rheumatoid, rna
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: MicroRNA (miRNA) are a recently discovered class of small RNA molecules that negatively regulate gene expression by targeting specific messenger RNAs (mRNAs). Once bound to the 3? untranslated region of their target mRNA, miRNA cause the translational repression or degradation of that message. Due to the novelty of miRNA research, the cell biology of miRNA-mediated regulation is not yet well understood, but it is known that miRNA and miRNA-effector proteins such as argonaute-2, GW182, and Rck/p54 all localize to cytoplasmic foci known as GW or P bodies (GWB). To better understand the cell biology of miRNA function, we first examined the relationship between GWB and miRNA. We found that in the absence of mature miRNA, GWB formation was abolished, indicating that miRNA are required for the formation of GWB and may be useful indicators of miRNA activity in cells. Next, we examined the effect of immune stimulation on GWB formation and found that the number and size of GWB increased in response to lipopolysaccharide (LPS) treatment in human monocytes. Furthermore, we found that the expression of three miRNA, miR-146a, miR-155, and miR-132, was concurrently increased in LPS-stimulated cells, and that miR-146a regulated LPS-induced cytokine production. These findings further establish GWB as biomarkers for miRNA activity and demonstrate a role for miRNA regulation in LPS-induced cytokine production. Finally, we investigated miRNA expression in rheumatoid arthritis (RA) patients compared to healthy controls. Interestingly, the expression of miR-146a, miR-155, miR-132 and miR-16 was significantly increased in the RA patients; however, we found that the increased miR-146a in RA patients did not negatively regulate its target genes. These findings suggest a possible role for defective miRNA regulation in RA pathogenesis, and implicate miRNA expression as a potential marker for RA diagnosis, treatment efficacy, or therapeutic target.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kaleb Pauley.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Chan, Edward K.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022419:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022419/00001

Material Information

Title: MicroRNA Regulation in GW/P Body Cell Biology, Lipopolysaccharide Signaling, and Rheumatoid Arthritis
Physical Description: 1 online resource (111 p.)
Language: english
Creator: Pauley, Kaleb
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: arthritis, bodies, cytokines, gw, interference, lipopolysaccharide, microrna, processing, rheumatoid, rna
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: MicroRNA (miRNA) are a recently discovered class of small RNA molecules that negatively regulate gene expression by targeting specific messenger RNAs (mRNAs). Once bound to the 3? untranslated region of their target mRNA, miRNA cause the translational repression or degradation of that message. Due to the novelty of miRNA research, the cell biology of miRNA-mediated regulation is not yet well understood, but it is known that miRNA and miRNA-effector proteins such as argonaute-2, GW182, and Rck/p54 all localize to cytoplasmic foci known as GW or P bodies (GWB). To better understand the cell biology of miRNA function, we first examined the relationship between GWB and miRNA. We found that in the absence of mature miRNA, GWB formation was abolished, indicating that miRNA are required for the formation of GWB and may be useful indicators of miRNA activity in cells. Next, we examined the effect of immune stimulation on GWB formation and found that the number and size of GWB increased in response to lipopolysaccharide (LPS) treatment in human monocytes. Furthermore, we found that the expression of three miRNA, miR-146a, miR-155, and miR-132, was concurrently increased in LPS-stimulated cells, and that miR-146a regulated LPS-induced cytokine production. These findings further establish GWB as biomarkers for miRNA activity and demonstrate a role for miRNA regulation in LPS-induced cytokine production. Finally, we investigated miRNA expression in rheumatoid arthritis (RA) patients compared to healthy controls. Interestingly, the expression of miR-146a, miR-155, miR-132 and miR-16 was significantly increased in the RA patients; however, we found that the increased miR-146a in RA patients did not negatively regulate its target genes. These findings suggest a possible role for defective miRNA regulation in RA pathogenesis, and implicate miRNA expression as a potential marker for RA diagnosis, treatment efficacy, or therapeutic target.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kaleb Pauley.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Chan, Edward K.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022419:00001


This item has the following downloads:


Full Text

PAGE 1

MicroRNA REGULATION IN GW/P BODY CELL BIOLOGY, LIPOPOLYSACCHARIDE SIGNALING, AND RHEUMATOID ARTHRITIS By KALEB MARIE PAULEY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Kaleb Marie Pauley 2

PAGE 3

To my mom who has always b een supportive, encouraging, and extremely patient. To my husband who has given me love and support. To my mentors who have given me guidance and wisdom. 3

PAGE 4

ACKNOWLEDGMENTS It is with great appreciation and sincere thanks that I acknowledge the following individuals for their professional or personal role in my academic journey. First and foremost, I thank my Lord and Savior Jesus Christ who has co ntinually blessed my life. I thank my family, especially my mother and husband, for always bei ng there for me and for being extremely patient with my academic career choices. I thank my mentor, Dr. Edward Chan, for hi s guidance throughout my research. He has given me the skills, wisdom, and independence I n eed to join the scientific community, and has provided us with a second family. I also tha nk my former mentor, Dr. Laura Jenski, for her guidance and for giving me the opportuni ty to begin my research career. I would also like to thank the members of my committee, Dr. Minoru Satoh, Dr. Brian Harfe, Dr. Sally Litherland, and Dr. Shannon Holliday for their support and advice throughout my research. I thank all the past and presen t members of the Chan lab for their friendship, assistance, and collaboration. A special thanks to my fello w graduate students in the lab, Shangli (a.k.a. Jesse) Lian, Songqing Li, and Paul Dominguez-Gutierrez for making the lab a fun place to be. I would also like to thank Dr. Andrew Jakymiw and Dr. Keigo Ikeda for their friendship and guidance. I thank John Hamel for teaching me the basics when I first joined the lab. Finally, I thank all the other members of the lab who have helped me throughout the years. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 ABSTRACT...................................................................................................................................11 CHAPTER 1 INTRODUCTION................................................................................................................. .13 What Are MicroRNAs?..........................................................................................................13 Biogenesis and Maturation of miRNA...................................................................................14 Cell Biology of miRNA Pathway...........................................................................................15 Targeting Specificity of miRNA............................................................................................17 Roles of miRNA in Immunology...........................................................................................17 Production of miR-125b, miR-132, miR-146a, and miR-155 in Response to LPS........18 The miRNA Let-7i Regulates TLR4...............................................................................19 Normal Immune Function, Germinal Center Response, and Generation of Ig ClassSwitched Plasma Cells Require miR-155....................................................................19 Immune Cell Development Involv es miR-150, miR-181a, and miR-223.......................20 Viruses and miRNAs (miR-32, miR-122, and Viral miRNAs).......................................21 Defects of miRNA in Diseases...............................................................................................22 Cancer and miRNA.........................................................................................................22 Chronic Lymphocytic Leukemia and miR-15a/miR-16-1..............................................23 Cancer and miR-17-92....................................................................................................23 Breast Cancer and Let-7..................................................................................................23 Systemic Lupus Erythematosus and miRNA..................................................................24 Components of GW/P Bodies are Ta rgeted in Autoimmune Diseases...........................25 Summary.................................................................................................................................26 2 FORMATION OF GW BODIES IS A CONSEQUENCE OF MICRORNA GENESIS......31 Introduction................................................................................................................... ..........31 Materials and Methods...........................................................................................................32 Short Hairpin RNA Construct.........................................................................................32 Cell Culture and Transfections........................................................................................33 Synthesis of miRNA and siRNA.....................................................................................33 Indirect Immunofluorescence..........................................................................................34 The RNase Protection Assay...........................................................................................34 The RT-PCR Assay.........................................................................................................35 Western Blot Analysis.....................................................................................................35 Results and Discussion......................................................................................................... ..35 5

PAGE 6

3 FORMATION OF GW/P BODIES AS A MARKER FOR MICRORNA-MEDIATED REGULATION OF INNATE IMMUNE SIGNALING........................................................50 Introduction................................................................................................................... ..........50 Material and Methods.............................................................................................................52 Cell Culture and LPS/Cytokine Treatment......................................................................52 Immunofluorescence.......................................................................................................52 Western Blots..................................................................................................................53 The qRT-PCR Assay.......................................................................................................53 Synthesis and Transfecti on of siRNA and miRNA.........................................................54 Multiplex Analysis of Cytokines.....................................................................................54 Results.....................................................................................................................................55 GWB Increase in Size and Number in Response to LPS Stimulation............................55 Upregulation of miR-146a, miR-132, and miR-155 in THP-1 Cells in Response to LPS...............................................................................................................................56 The Rck/p54 and Ago2 Proteins are Requi red for LPS-Induced GWB Assembly.........56 Transfection of miR-146a Alone Can Induce an Increase in GWB Size and Number...57 MicroRNA Play a Role in the Regulati on of THP-1 Cytokine and Chemokine Production....................................................................................................................5 8 Discussion...............................................................................................................................60 Proposed Model for miRNA-Mediated GWB Assembly After LPS Stimulation...........60 Observation of GWB as Biom arkers for miRNA Activity.............................................62 Depletion of miRNA Affects Cyto kine and Chemokine Production..............................63 4 UPREGULATED MIR-146A EXPRESSION IN PERIPHERAL BLOOD MONONUCLEAR CELLS FROM RHEUMATOID ARTHRITIS PATIENTS..................76 Introduction................................................................................................................... ..........76 Material and Methods.............................................................................................................77 Patients and Controls.......................................................................................................77 Collection of PBMC and qRT-PCR................................................................................78 Cell Culture and Cytokine Treatment..............................................................................79 Indirect Immunofluorescence (IIF).................................................................................79 Transfection of siRNA....................................................................................................80 Multiplex Analysis of Cytokines.....................................................................................80 Results and Discussion......................................................................................................... ..80 Specific Cytokines/Chemokines Induce GW B in THP-1 Cells and Human PBMCs.....80 Increased Expression of miR-146a, miR-155, miR-132, and miR-16 in RA Patient PBMCs.........................................................................................................................81 Monocyte/Macrophage Population of RA PBMCs Exhibits Increased miRNA Expression....................................................................................................................84 Expression of TRAF6 and IRAK-1 Is Sim ilar Between RA Patients and Controls.......84 Conclusions.....................................................................................................................86 5 CONCLUSIONS.................................................................................................................. ..94 Formation of GWB is a Consequence of miRNA Genesis.....................................................94 6

PAGE 7

Formation of GW/P Bodies as Marker for miRNA-Mediated Regulation of Innate Immune Signaling...............................................................................................................95 Upregulation of miR-146a Expression in Peripheral Blood Mononuclear Cells From Rheumatoid Arthritis Patients.............................................................................................97 REFERENCES..............................................................................................................................99 BIOGRAPHICAL SKETCH.......................................................................................................111 7

PAGE 8

LIST OF TABLES Table page 1-1 Important miRNAs in immunology...................................................................................27 3-1 Potential miRNA regulation of cytokine/chemokine mRNAs in THP-1 cells..................65 4-1 Demographic and clinical information of patients.............................................................88 8

PAGE 9

LIST OF FIGURES Figure page 1-1 Guidelines of miRNA-mRNA interactions........................................................................28 1-2 Biogenesis and function of miRNAs.................................................................................29 1-3 GW bodies are present in all mamma lian cell types examined to date.............................30 2-1 MicroRNA is present in GWBs.........................................................................................40 2-2 Loss of GWB staining in HeLa cells afte r transient transfection of shRNA plasmid targeting Drosha.................................................................................................................41 2-3 Loss of P body marker Dcp1a staining in HeLa cells after transient transfection of shRNA plasmid targeting Drosha......................................................................................42 2-4 Loss of GWB staining in Drosha-deficient HeLa cells and transfection of synthetic siRNAs rescues GWBs......................................................................................................43 2-5 Characterization of Drosha deficient cells using RT-PCR an d Western blot and demonstration of reduced miRNA levels...........................................................................45 2-6 Drosha-deficient cells are functionally competent for transfected siRNA-mediated knockdown of target lamin A/C.........................................................................................46 2-7 Transfection of chemically modified RISC-free siRNA did not rescue GWB formation in Drosha-deficient HeLa cells..........................................................................47 2-8 Disassembly of GWB in HeLa cells resulting from DGCR8 knockdown and reassembly after siRNA transfection.................................................................................48 2-9 The GWB are foci devoted to miRNA processing............................................................49 3-1 Assembly of GWB is induced by LPS...............................................................................66 3-2 Expression of GWB protein compone nts in THP-1 cells unaffected by LPS treatment...................................................................................................................... ......67 3-3 Stimulation with LPS induces upreg ulation of miR-146a, miR-132, and miR-155..........68 3-4 Depletion of Rck/p54 and Ago2 results in loss of LPS-induced GWB assembly.............69 3-5 Transfection of miR-146a alone can i nduce formation of GWB and repress TRAF6 and IRAK-1 mRNA...........................................................................................................70 3-6 Pre-transfection of miR-146a in THP-1 cells reduces LPS-induced cytokine/chemokine production.........................................................................................71 9

PAGE 10

3-7 Knockdown of TRAF6 or IRAK-1 results in decreased production of certain cytokines............................................................................................................................72 3-8 Depletion of miRNA results in incr eased LPS-induced cytokine production...................73 3-9 Model of LPS-induced GWB assembly.............................................................................75 4-1 Stimulation with TNFresults in increased number of GWB in THP-1 and human PBMCs...............................................................................................................................89 4-2 Aberrant expression of miR-146a, miR-155, miR-132 a nd miR-16 is exhibited by RA patient PBMCs compared to healthy controls.............................................................90 4-3 Monocyte/macrophage fraction of PBMC s exhibit increased miRNA expression compared to lymphocyte fraction......................................................................................91 4-4 Expression levels of TRAF6 and IRAK-1 are similar between RA patients, healthy controls and disease controls.............................................................................................92 4-5 Knockdown of TRAF6 and/or IR AK-1 results in decreased TNFproduction in THP-1 cells........................................................................................................................93 10

PAGE 11

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MicroRNA REGULATION IN GW/P BODY CELL BIOLOGY, LIPOPOLYSACCHARIDE SIGNALING, AND RHEUMATOID ARTHRITIS By Kaleb Marie Pauley August 2008 Chair: Edward K.L. Chan Major: Medical SciencesImmunology and Microbiology MicroRNA (miRNA) are a recently discovere d class of small RNA molecules that negatively regulate gene expression by targe ting specific messenger RNAs (mRNAs). Once bound to the 3 untranslated region of their target mRNA, miRNA cause the translational repression or degradation of that message. Due to the novelty of miRNA research, the cell biology of miRNA-mediated regul ation is not yet well underst ood, but it is known that miRNA and miRNA-effector proteins such as ar gonaute-2, GW182, and Rck/p54 all localize to cytoplasmic foci known as GW or P bodies (GWB ). To better understa nd the cell biology of miRNA function, we first examined the relations hip between GWB and mi RNA. We found that in the absence of mature mi RNA, GWB formation was abolis hed, indicating that miRNA are required for the formation of GWB and may be us eful indicators of mi RNA activity in cells. Next, we examined the effect of immune s timulation on GWB formation and found that the number and size of GWB increased in response to lipopolysacchar ide (LPS) treatment in human monocytes. Furthermore, we found that the expression of three miRNA, miR-146a, miR-155, and miR-132, was concurrently increased in LPSstimulated cells, and that miR-146a regulated LPS-induced cytokine production. These findings further establ ish GWB as biomarkers for miRNA activity and demonstrate a role for miRNA regulation in LPS-induced cytokine 11

PAGE 12

production. Finally, we investigated miRNA expression in rheuma toid arthritis (RA) patients compared to healthy controls. Interestingl y, the expression of mi R-146a, miR-155, miR-132 and miR-16 was significantly increased in the RA patients; however, we f ound that the increased miR-146a in RA patients did not negatively regulate its target genes. These findings suggest a possible role for defective miRNA regulation in RA pat hogenesis, and implicate miRNA expression as a potential marker for RA diagnos is, treatment efficacy, or therapeutic target. 12

PAGE 13

CHAPTER 1 INTRODUCTION What Are MicroRNAs? MicroRNAs (miRNAs) are small non-coding RNAs that are 20-22 nucleotides long and were discovered relatively recently. The current known function of miRNAs is primarily in the regulation of certain subsets of messenger RNAs (mRNAs) via hybrid ization to their 3 untranslated region (UTR) (Fig. 1-1). These mi RNAs are often evoluti onarily conserved and they regulate their target mR NAs by leading to degradation or repression of translation. Although miRNAs are similar in structure to small interfering RNAs (siRNAs), there are distinctions between the two mo lecules. While miRNAs are endogenously produced from larger precursor forms, siRNAs are typically exogenously introduced. Most miRNAs bind their target mRNAs by binding partially complementary sites in their 3 UTR (Fig. 1-1), while siRNAs bind their targets at one completely complementary site. The importance of miRNA regulation to normal cellular functions is becoming increasingly clear as more mi RNA targets are discovered. Curre ntly, it is known that miRNA play a role in regulati ng cellular processes such as apoptosis differentiation, and the cell cycle. The most recent release of the miRNA sequence database, miRBase (version 10.1), includes 5,395 predicted miRNAs in 12 species of plants and animals and several viruses (1,2). For humans, this database lists 540 predicted miRNA sequences and other bioinformatic predictions indicate that as much as one-t hird of all mRNAs may be regulated by miRNA (3). Although it was initially believed that miRNAs were encoded in intergenic regions, it is now known that the majority of human miRNA loci are located within the intronic regions of either coding or noncoding transcription units and are transcribed in parallel w ith other transcripts (4-6). 13

PAGE 14

The identification of miRNA genes is typically achieved using one of three approaches. The first approach is through forward genetics where mutations are identified that produce a certain phenotype. This approach was used to identify the first two miRNAs, lin-4 and let-7 (4,7,8). A second approach is using directional cloning to construct a cDNA library for endogenous small RNAs (9). However, a limitation of this approach is that miRNAs expressed only under certain conditions, or in specific cell types, or at lo w levels may be difficult to identify. The third approach is bioinformatic predictions. This approach is becoming more popular as advanced prediction programs are deve loped. Some of the most recent rules of miRNA prediction involve the interaction of miRNA with their target mRNAs and will be discussed later. Numerous techniques have been developed to detect miRNAs. Northern blotting is widely used, but may not be sensitive enough to detect lowly expressed miRNAs. Quantitative real-time PCR assays have also been devel oped for the detection of miRNA and have the advantage of increased sensitivity. Additiona lly, miRNA arrays are being implemented for miRNA expression profiling. Biogenesis and Maturation of miRNA First, miRNAs are transcribed from the genome by RNA polymerase II as primary miRNA (pri-miRNA) transcripts that range from hundreds to thousands of nucleotides in length, and like other RNA polymerase II transcripts, are capped and polyadenlyated (10,11). In animals, miRNA maturation is achieved by two main processing steps involving two ribonuclease III (RNase III) enzymes, Drosha and Dicer (Fig. 1-2). Drosha and its partner protein DGCR8 process the nuclear pri-miRNA into ~70 nucleotide precursor miRNA (premiRNA) molecule (12-16). The pre-miRNA is then exported from the nucleus to the cytoplasm by Exportin 5/RanGTP which specifically recogni zes the structure of pr e-miRNA molecules (1714

PAGE 15

19). Once in the cytoplasm, pre-miRNA is cleav ed by Dicer along with its partner protein TRBP (trans-activator RNA binding pr otein) into a ~21 nucleotide miRNA duplex similar to siRNA and one strand is selected to be loaded into the RNA-induced silencing complex (RISC) in a dynamic process that is not yet fully underst ood (20,21). Once loaded into RISC, the miRNA will bind to its target mRNA causing degradatio n or translational repression (Fig. 1-2). Recently, an alternative Drosha-independent pathway for miRNA maturation has been reported in Caenorhabditis elegans, Drosophila melanogaster and mammals (22-24). In this pathway, short hairpin introns are spliced into pre-miRNA mimics referred to as mirtrons (premiRNAs/introns) that can enter the miRNA-bi ogenesis pathway without Drosha-mediated cleavage (Fig. 1-2) (22-24). However, mirtr ons represent a relatively small population of miRNAs, and the majority of miRNAs are pr ocessed by the Drosha-dependent pathway. Cell Biology of miRNA Pathway The key components of RISC are the argonaut e (Ago) family of proteins. In mammals, there are four Ago proteins (Ago1-4), but only Ago2 is known to function in the miRNA and siRNA pathways. Ago2 has been shown to cleave mRNA targeted by miRNA or siRNA and is known as the catalytic enzyme of RNAi (25,26). In addition, tethering Ago2 to mRNA mimics miRNA-mediated translational repression (27). In addition to Ago proteins, numerous other proteins are required for miRNA functioning including GW182 and Rck/p54, and these proteins ar e enriched in discrete cytoplasmic foci known as GW bodies (GWB, Fig. 1-3). In mammals, these foci were discovered in 2002 using an autoimmune serum from a patient with motor and sensory neuropathy (28), and most subsequent GWB reactive sera have been identif ied from patients with neurological symptoms (33%), Sjgrens syndrome (31%), and various other autoimmune disorders including systemic lupus erythematosus (SLE, 12%), rheumatoid arthritis (7%), and primary biliary cirrhosis (10%) 15

PAGE 16

(29). About the same time period, similar foci were discovered in yeast and referred to as processing bodies (P bodies) or Dcp-containing foci (30-32). Initially named after the identification of the marker pr otein GW182, GWB are found in al l mammalian cells examined to date and were shown to be distinct from othe r known cytoplasmic organelles such as Golgi complex, endosomes, lysosomes or peroxisome s (28). Immuno-electron microscopy data revealed that GWB vary in size from 100-300 nm in diameter and are composed of 8-10 nm strands or fibrils on which all of the gold labels are clustered (Fig. 1-3 D and E). Also, GWB are devoid of a lipid membrane and vary in size a nd number during the cell cy cle (28,33). The foci are small during early S phase, larger during late S and early G2 phases and absent during mitosis (33). The analysis of GWB during cell proliferation via stimulation of mouse splenocytes and T cells with concanavalin A (C onA) revealed that GWB were larger and more numerous in proliferating cells (33). The GW182 protein was dem onstrated to be an essential component of GWB in that knoc kdown of GW182 results in the disassembly of GWB (33,34). The involvement of GWB in the miRNA path way and RNAi is based on the evidence that Ago2, siRNA, miRNA, and mRNAs targeted by miRNA/siRNA all localize to these bodies (35-38). Based on data from several reports, GWB may be useful biomarkers for miRNA or siRNA activity. It was reported in 2006 that miRNA are required for GWB assembly (36). Upon miRNA depletion via knockdown of Drosha or DGCR8 and t hus inhibiting the maturation pathway, GWB disassembled (36). However, in troduction of siRNA as a surrogate for miRNA enabled GWB to reassemble, indicating that small RNA (either miRNA or siRNA) are required for the formation of these foci (36). A later report demonstrated that transfection of functional siRNA into cells induced larger and more numer ous GWB (39). This observation was dependent on the presence of the endogenous targeted mRNA ( 39). In our most recent study, we show that 16

PAGE 17

lipopolysaccharide (LPS) stimula tion of human monocytes results in increased production of miR-146a, miR-132, and miR-155 and increased GWB formation (40)(Pauley et al., submitted). This increase in GWB is dependent on the miRNA-effector proteins Ago2 and Rck/p54, and can be replicated by transfecting pre-miR-146a into the cells indicating that miRNA activity is responsible for the increase in GWB formation (P auley et al., submitted). Taken together, these studies suggest that GWB may serve as us eful biomarkers for miRNA/siRNA activity. Targeting Specificity of miRNA Mammalian miRNAs pair to the 3UTRs of mRNAs. Traditionally, it was thought that the main requirement for miRNA target recognition was the perfect matching of the ~7 nucleotide site called the seed region (F ig. 1-1); however, seed matche s do not always confer miRNAmediated repression of the target mRNA. In 20 07, Grimson, et al. combined computational and experimental approaches to uncover five general features of seed matching that increase the accuracy of predicting miRNA:mRNA pairs (41). These features are an AU-rich nucleotide composition near the site, proximity to site s for coexpressed miRNAs (which leads to cooperative action), proximity to residues pa iring to miRNA nucleot ides 13-16, positioning within the 3 UTR at least 15 nucleotides aw ay from the stop codon, and positioning away from the center of long UTRs (41). Based on these rules, Grimson, et al. developed a new miRNA database ( http://www.targetscan.org ) to narrow down which miRNA:mRNA target relationships are most promising for experimental followup (41). Another popular algorithm used for miRNA target prediction is miRa nda (http://microrna.sanger.ac.uk). Roles of miRNA in Immunology Regulation of the immune system is vita l to preventing many pathogenic disorders including autoimmune disease a nd cancers, and mammals have developed a complex system of checks and balances for immune regulation in or der to maintain self tolerance while allowing 17

PAGE 18

immune responses to foreign pathogens, most of which are not fully understood. Recently, it has become evident that miRNAs play an important role in regulating immune response, as well as immune cell development. Amazingly, a relati vely small number of specific miRNAs are coming to light as important regulators of the immune system. Their functions are discussed below and summarized in Table 1-1. Production of miR-125b, miR-132, mi R-146a, and miR-155 in Response to LPS Three miRNAs, miR-146a, miR-132, and miR-155, were recently found to be upregulated in response to LPS treatment of hu man monocytes (40). Fu rther analysis of miR146a induction by LPS, TNF, and IL-1 revealed that this induction was NF B-dependent and the mRNA targets of miR-146a include IL-1 re ceptor associated kinase (IRAK1) and TNF receptor-associated factor-6 (TRAF6) which ar e key components in the TLR4 signaling pathway (40). Interestingly, miR-146a was only induced in response to cell-surface TLR (TLR2, TLR4, TLR5) signaling and not intracellu lar TLR (TLR3, TLR7, TLR9) si gnaling, indicating that miR146a plays a role in regulating th e innate immune response to b acterial pathogens but not viral pathogens (40). In mouse macrophages, miR-155 was upregulat ed by polyriboinosinic:polyribocytidylic acid [poly(I:C)] and IFNas well as a number of TLR ligands (42,43). These data suggest that miR-155 is involved in the regulation of both bact erial and viral innate immune responses. Most recently, it was reported that sustained expr ession of miR-155 in mouse bone marrow cells caused granulocyte/monocyte expansion and these populations of cells were characteristic of myeloid neoplasia (44). Additionally, miR-125b expression was decr eased in response to LPS in mouse macrophages (43). Since miR-125b was shown to be capable of targeting the 3UTR of TNF18

PAGE 19

mRNA, this miRNA may be down-regulated to allow for the LPS-induced production of TNF(43). The miRNA Let-7i Regulates TLR4 In 2007, it was reported that in human biliary epithelial cells (chola ngiocytes), miRNA let7i regulates TLR4 expression (45). In addition, cholangiocytes infected with Cryptosporidium parvum a parasite that causes intestinal and bilia ry disease, exhibited decreased expression of let-7i that was associated with an increase in TLR4 expression ( 45). These data further suggest that miRNA-mediated post-transc riptional regulation is critical for innate immune cell response to microbial infection. Normal Immune Function, Germinal Center Response, and Generation of Ig ClassSwitched Plasma Cells Require miR-155 In addition to its regulatory roles in inna te immunity, miR-155 has been shown to be a key factor for normal adaptive immune respons es. miR-155 is processed from the non-coding RNA known as bic, which is now known to be pri-miR-155 (46,47). Increased expression of bic/miR-155 is found in activated B and T cells (48,49) as well as in activated macrophages (40,42), and is associated with B cell malignancies (50-52). In 2007, Rodriguez et al. reported that miR155 is essential for normal functioning of B and T lymphocytes, as well as dendritic cells (DCs) (53). They found that mice deficient in bic/miR-155 diminished adaptive immune responses. Specifically, the bic/miR-155 deficient mice were unable to develop immunity to Salmonella typhimurium after intravenous immunization (53). Further analysis revealed impaired B and T cell functioning as well as defective antigen presentation by DCs (53). Thes e data suggest a regulatory role for miR-155 in the functions of both lymphocytes and DCs. 19

PAGE 20

At the same time, Thai et al. reported th at miR-155 regulates germinal center response (54). Initially, they found that germinal center B cells normally upregulate the expression of bic/miR-155 during the course of the germinal center response. Using bic/miR-155 deficient mice, they determined that miR-155 regulates the ge rminal center response at least in part at the level of cytokine production (54). Later in 2007, it was reported that miR155 is also responsible for regulating the generation of immunoglobulin (Ig) class switched plasma cells (55). In this study, B cells lacking miR-155 failed to generate high-affinity IgG1 antibodies (55). A transcription factor, Pu.1, was shown to be targeted by miR-155, and overexpression of Pu.1 leads to the production of fewer IgG1 cells, indicating that miR-155 re gulation of Pu.1 may be responsible for the normal generation of Ig classswitched plasma cells (55). Immune Cell Development Invol ves miR-150, miR-181a, and miR-223 Several studies have reported the involvem ent of miRNA in the development of immune cells (56-58). One of the first miRNAs describe d to have a role in the development of immune cells was miR-181a which was shown to be highly expressed in thymus cells and expressed at a lower level in the heart, lymph nodes, and bone marrow (59,60). In bone marrow-derived B cells, miR-181a expression was shown to decrea se during B cell development from the pro Bcell to pre-B cell stage (58). In addition, miR-181a may have a role in regulating lymphocyte development based on evidence that expressi on of miR-181a in hematopoietic stem and progenitor cells resulted in an increase in CD19+ B cells and a decrease in CD8+ T cells (59). miR-181a has also been shown to modulate T-ce ll receptor (TCR) signaling, thus affecting the sensitivity of T cells to antigens (60). 20

PAGE 21

Granulopoiesis has been reported to be regulated in part by miR-223 (61,62). Two transcription factors, PU.1 and C/ EBP, are reported to control the expression of miR-223 during granulocytic differentiation which in turn cont rols the development of granulocytes (61,62). Finally, miR-150, a miRNA that is specifica lly expressed in mature lymphocytes, was reported to be critical for B cell differentiation (58). miR-150 blocks the development of B cells from the pro-B to the pre-B stage, thereby bl ocking the production of mature B cells (58). Further studies in mice have shown that miR-150 overexpression results in dramatically impaired B cell development, but normal T cell development (63). Viruses and miRNAs (miR-32, miR-122, and Viral miRNAs) Recently, it has become clear that some hos t miRNAs protect against viral infection, while some viruses have been shown to produce mi RNAs of their own that regulate both viral and host genes. In 2005, it was reported that human miR-32 is involved in antiviral defense against primate foamy virus type 1 (PFV1) in hum an cells via downregula tion of at least five different PFV1 mRNAs (64). The downregulation of these viral ge nes results in slower PFV1 replication. More recently, Pedersen, et al. reported that IFNstimulation of hepatic cells results in the production of at least eight miRNAs (miR-1, miR-30, miR-128, miR-196, miR-296, miR351, miR-431, and miR-448) that have perfect seed complementarity to hepatitis C virus (HCV) mRNAs (65). Additionally, miR-122, a miRNA that was previously shown to be required for HCV replication (66), was significan tly reduced in response to IFNtreatment (65). These findings demonstrate that the mammalian immune system is utilizing miRNAmediated gene regulation to combat viral infecti ons. However, it is becoming clear that viruses are also utilizing miRNA in order to evade host immune responses. Kaposi sarcoma-associated herpes virus (KSHV) was found to encode 12 miRNA genes (67-69). Thrombospondin-1, a 21

PAGE 22

strong tumor suppressor and anti-a ngiogenic factor, was identified as one target of these miRNA suggesting that KSHV-encoded miRNA may contribute directly to pat hogenesis (70). It has also been shown that one of these KSHV-miRNA, miR-K12-11, has 100% seed sequence identity with human miR-155, thus likely cross regulates the same endogenous targets as miR-155 (71). Other viruses, including Ep stein-Barr virus (EBV) and human cytomegalovirus (HCMV), are reported to produce their own miRNAs. EBV produces miRNAs during di fferent stages that may contribute to viral maintenance and latenc y, including miR-BART2 which targets the EBVDNA polymerase BALF5 (68,72). HCMV-encoded miR-UL112 represses the expression of MHC-class-I-polypeptide-related sequence B (MICB) which is required for natural killer cellmediated killing of virus-infected cells (73). Defects of miRNA in Diseases Countless miRNAs are thought to be involved in cancer based on their expression profiles. The most extensively studied miRNAs involved in cancer are miR-155, let-7, and two miRNA clusters, miR-15a/miR-16-1 and miR-17/miR-18a/miR-19a/miR-20a/miR-19b-1/miR-92-1 (known as the miR-17-92 polycistron). Cancer and miRNA In humans, miR-155 is overexpressed in a number of solid tumors, including breast, colon, and lung (74-76). In the lung, angiotensin II T ype 1 Receptor is a reported target for miR-155, and high expression levels of miR155 are correlated with shorter post operative survival in lung cancer patients (76,77). miR-155 is also overexpressed in seve ral human lymphomas including Hodgkin and B cell lymphomas (51,52,78). Transgenic mice overexpressing miR-155 exhibit B cell proliferation defects and lymphoblastic leukemia (50). 22

PAGE 23

Chronic Lymphocytic Leukem ia and miR-15a/miR-16-1 The first evidence that miRNAs were invol ved in cancer was found by studies on chronic lymphocytic leukemia (CLL). Approximately half of all CLL cases exhibit heterozygous or homozygous deletions of chromosome 13q14.3, but a causative gene in this region remained elusive. In 2002, two clustered miRNAs, miR15a and miR-16-1 were identified as possible candidates (79). The expression of these miRNA was greatly reduced in the majority of CLL cases examined (79). Further studies revealed that both miR-15a and miR-16-1 posttranscriptionally regulate Bcl2, a potent anti -apoptotic factor, and overexpression of these miRNAs resulted in apoptotic cell death in a leukemia cell line (80). These data demonstrate the significance of miRNA involvement cancer development by regulating apoptosis. Cancer and miR-17-92 miRNAs may be encoded as clus ters transcribed as polycistron ic pri-miRNA transcripts. One example of this is the miR-17-92 polycis tron which contains 7 miRNAs (miR-17/miR18a/miR-19a/miR-20a/miR-19b-1/miR-92-1) (81) Overexpression of miR-17-92 has been confirmed in several B cell lymphomas (82) and in various tumors incl uding breast, colon, lung, prostate, and pancreatic endocri ne (75). In 2007, Venturini, et al. reported the increased expression of miR-17-92 in certain stages of ch ronic myeloid leukemia (CML) (83). In a recent study, mice were generated with high expression of miR-17-92 in lymphocytes (84). These mice developed lymphoproliferative dise ase and autoimmunity and died prematurely (84). This data is consistent with previous reports of lymphoma patients identified with amplifications of the miR-17-92 coding region. Breast Cancer and Let-7 In 2005, it was reported that the let-7 fa mily of miRNAs negatively regulate the oncogene RAS, and that the low expression of le t-7, which leads to high levels of RAS, is 23

PAGE 24

correlated with poor survival of lung cancer (76,8 5-87). More recently, Yu et al. reported that let-7 regulates the self renewal and tumorigenicity of breast ca ncer cells (88). Specifically, breast tumor-initiating cells (BT-IC ) exhibited markedly reduced levels of the let-7 family miRNAs, and overexpression of let-7 in thes e cells led to reduced proliferation and mammosphere formation (88). Altered miRNA expression in different types of cancer is becoming a useful biomarker to help with clinical diagnosis, and may also contri bute to the pathogenesis of the disease. As we learn more about the roles of miRNA in cancer development and progression, they may become candidate targets for cancer treatments. Systemic Lupus Erythematosus and miRNA In addition to cancer, miRNAs are now reporte d to play a role in many other diseases including Touretts Syndrome, Alzheimers dise ase, and SLE (89-91). In 2007, a new pathway regulating autoimmunity that involves mi RNA was discovered in T lymphocytes as demonstrated in the sanroque mouse (92). The latter mouse was originally selected from screening mutant mice derived from the chemi cal mutagen N-ethyl-N-nitrosourea (ENU), and has been shown to result from a mutation in th e gene Roquin that encodes a RING-type ubiquitin ligase. In normal T cells, Roquin regulates th e expression of inducible T-cell co-stimulator (ICOS) by promoting the degrad ation of ICOS mRNA. In sanroque mice, the absence of this regulation leads to an accumulation of lymphoc ytes that is associated with a lupus-like autoimmune syndrome. Yu et al. report th at miR-101 is required for the Roquin-mediated degradation of ICOS mRNA (92) Mutations of the miR-101 binding sites introduced into the 3UTR of ICOS mRNA disrupted th e repressive activity of Roquin (92). These findings reveal a critical miRNA-mediated regul atory pathway that prevents lymphocyte accumulation and autoimmunity. 24

PAGE 25

There is emerging evidence for the involvement of miRNA dysregulation in human lupus. A study of 23 SLE patients in China revealed that 16 miRNAs were differentially expressed in SLE patients compared to healthy co ntrols, suggesting that miRNAs may be useful diagnostic markers and may be involved in the pathogenesis of S LE (90). Confirmatory data from other SLE populations as well as defini ng the potential functional defects are ongoing studies to be reported in the near future. Components of GW/P Bodies are Ta rgeted in Autoimmune Diseases In 1994, Satoh, et al. characterized auto antigens of 100/102 and 200 kDa recognized by anti-Su autoantibodies (93). Autoantibodies that immunoprecipitated the 100/102 and 200 kDa proteins were detected in sera of up to 20% of patients with SLE, scleroderma, and overlap syndromes (93). In 2006, Jakymiw et al. repor ted that anti-Su autoantibodies from human patients with rheumatic diseases and a mouse model of autoimmunity re cognize the catalytic enzyme in the RNAi/miRNA pathways, Ago2, as well as Ago1, 3, 4 and Dicer (94). Additionally, by immunofluorescence, the anti-Su autoantibodies were shown to recognize GWB (94). Recently, an investigation into the clinical and serological features of patients with autoantibodies to GWB revealed that the most common clinical presenta tions of these patients were neurological symptoms, Sjgrens syndrome, SLE, rheumatoid arthr itis and primary biliary cirrhosis (29). The most common autoantigens targeted by these patients were Ge-1/Hedls (58%), GW182 (40%), and Ago2 (16%) and 18% of GWB reactive sera did not react to any of the antigens analyzed indicating that there are othe r target autoantigens yet to be discovered (29). The finding that Ge-1 is the most common autoantigen target in GWB was surprising since most studies have focused on GW182 and Ago2. However, in 2005 it was reported that 5% of primary biliary cirrhosis patients have au toantibodies against GWB, and one of these sera 25

PAGE 26

was used to identify the autoantigen Ge-1 (95) Knockdown of Ge-1 resulted in the loss of GWB indicating that Ge-1 is an important component of GWB (95). The function of Ge-1 is not yet fully understood, but some evidence suggests that it may act prior to the 5-decapping step in mRNA degradation (95). GW182, a 182 kDa protei n containing multiple glycine-tryptophan (GW) repeats and an RNA recognition motif, has also been shown to be required for GWB formation (28,34). Additionally, depletion of GW182 in human cells results in impaired RNAi function (34,96,97). These data demonstrate an autoimmune response to key components of the RNAi/miRNA pathways which could implicat e the miRNA pathway involvement in the induction and production of autoantibody. Summary In summary, miRNAs are emerging as importa nt regulators of both innate and adaptive immune responses and development and differen tiation of immune cells. Disruption of these critical regulatory molecules can result in the development of cancer and autoimmune diseases. Amazingly, recent work by many groups has unveiled a relatively small number of miRNAs that are involved in regulating the immune system. With the current interests in using siRNA for gene therapy, miRNA targeted therapeutics have a promising future. However, as the miRNA field is still at an early stage, it will be intere sting and important to monitor new developments in the next few years whether these are the correct subset of miRNAs critical for immune functions. This chapter has been ac cepted for publication in Annals of the New York Academy of Sciences: The Year in Immunology 2008. 26

PAGE 27

Table 1-1. Important miRNAs in immunology. miRNA Function Target Reference hsa-miR-146a Regulates immune response to bacterial infection TRAF6 and IRAK1 (40) hsa-miR-132 Regulates immune response to bacterial infection Not determined (40) hsa-miR-155 Regulates immune response to bacterial/viral infection; Required for normal function of lymphocytes, germinal center response, and generation of Ig class switched plasma cells PU.1, c-Maf (40,4244,48-55) hsa-miR-125b Decreased during inflammatory response to allow for TNFproduction TNF(43) hsa-let-7i Regulates innate immune response TLR4 (45) hsa-miR-181a Regulates B/T cell development, modulates TCR signaling Not determined (58-60) hsa-miR-150 Regulates production of mature B cells Not determined (58,63) hsa-miR-223 Regulates granulopoiesis Not determined (61,62) hsa-miR-32 Involved in antiviral defense against PFV1 by downregulating PFV1 mRNAs PFV1 mRNAs (64) hsa-miR-122 Required for HCV replication, reduced in response to IFNNot determined (65,66) kshv-miR-K12-11 hsa-miR-155 ortholog Probably shares endogenous targets with hsa-miR-155 (71) hcmv-miR-UL112 Inhibits NK-mediated killing of HCMV-infected cells MICB (73) ebv-miR-BART2 Targets EBV-DNA polymerase BALF5 to regulate viral gene expression BALF5 (68,72) 27

PAGE 28

Figure 1-1. Guidelines of miRNA-mRNA intera ctions. miRNAs bind their target mRNAs by base pairing partially complementary sequen ces in the 3UTR. The seed region of miRNA is nucleotides 2-7. This region mu st be perfectly complementary between the miRNA and mRNA target. At nucleoti de position 1, an A residue on the mRNA improves site efficiency, but does not need to base pair with the miRNA nucleotides (indicated by dashed line). The bulges cr eated by mismatched based pairs must be present in the central region of the miRNAmRNA duplex. In addition, there must be reasonable complementarity between the miRNA-mRNA duplex at nucleotides 13-16 (indicated in bold). Thes e factors improve miRNA bi nding site efficacy (41). 28

PAGE 29

Figure 1-2. Biogenesis and functi on of miRNAs. miRNAs are tr anscribed from the genome as long primary transcripts known as prim ary miRNA (pri-miRNA). The RNase III enzyme Drosha and its partner protein DGCR8 then cleave the pri-miRNA into precursor form (pre-miRNA). In some rare cases, miRNAs can be derived from mRNA splicing of intronic sequences therefore bypassing Drosha/DGCR8 processing. These miRNAs are referred to as mirtrons. Pre-miRNA is exported by Exportin 5 into the cytoplasm. Once in the cytoplasm, the hairpin loop of the premiRNA is cleaved by the second RNase III enzyme Dicer with its partner protein TRBP, and the resulting miRNA duplex is lo aded into RISC. Components of RISC, Ago proteins, miRNA and mRNA targets a ll localize and are highly enriched in cytoplasmic foci known as GW bodies (GWB) or processing bodies (P bodies). The Ago proteins bind the miRNA and target mRNA resulting in the degradation or translation repression of the mRNA. Th e degree of miRNA-mRNA complementarity dictates whether the mRNA is degraded by endonucleolytic cleavage (perfect complementarity) or translationally repr essed (partial complementarity). Under starvation conditions or cellular stress, it has been reported that certain miRNA can activate translation or derepress their target mRNA if certain protein factors (HuR or FXR1) are present (98,99). 29

PAGE 30

Figure 1-3. GW bodies are present in all mamma lian cell types examined to date. (A) THP-1 human monocytic or (B) MOLT-4 cells stai ned by indirect immunofluorescence with human anti-GWB serum. Arrows indicate ex amples of GWB. (C) Human peripheral blood mononuclear cells (PBMCs) stained w ith rabbit antibodies to Rck/p54, another marker for GW/P bodies and a protein required for RNA interference. (D) Immunogold electron microscopy image of GW Bs in the cytoplasm of HeLa cells during interphase. Representative gold-lab eled cytoplasmic GWBs are structures with diameters varying from 100-300 nm [a dd reference #33 here]. The gold labels are clustered on electron dense fibrils or strands (arrows), 8 to 10 nm in diameter, which are more obvious in the enlarged image (E). These fibrils appear to form the matrix that the gold decorates. 30

PAGE 31

CHAPTER 2 FORMATION OF GW BODIES IS A CONSEQUENCE OF MICRORNA GENESIS Introduction In the past few years, unique cytoplasmic foci have been described in both yeast and mammalian cells that have a role in mRNA pro cessing and degradation. They have been named P bodies in yeast (31,100), and in mammalian cells they have been named Dcp-containing bodies (32,101), GW bodies (GWBs) (28) or mammalian P bodi es (35). In this report we will refer to the mammalian cytoplasmic foci as GWBs. GWBs were initially named as such because they represented the cytoplasmic localization of the mRNA binding protein GW182. The GW182 protein has repetitive glycine (G)/tryptophan (W) residues and a canonical RNA recognition motif, and was shown to associate with certain mRNAs in HeLa cells (28). The GW182 protein is a salient feature of GWBs in that reduction of the GW182 protein leads to a decline in the number of GWBs (33). The GW182 protein is conserved among mammalian cells and recently, a protein called AIN-1, with limited sequence similarity to GW182 was identified in C. elegans and shown to interact with components of the RISC complex (102). Yeast P bodies and mammalian GWBs are similar in that they are both composed of protei ns involved in mRNA degradation, nonsense mediated decay (N MD), and translation (14,31,101,103-108). However, key differences include the observations that there is no protein with significant sequence homology or identity to GW182 in yeast, and GWBs have been linked to RNA interference (RNAi)(34), a pathway that has yet to be described in S. cerevisiae Interestingly, GWBs appear to be involved in RNAi based on the evidence that Ago2, transfected siRNA, miRNA, and reporter mRNAs targeted by miRNA lo calize to these bodies (34,35,37,38). Furthermore, the GW182 protein has been shown to play an important functional 31

PAGE 32

role in RNAi (34,96,109). Although GWBs are implicated in the miRNA pathway, the functional requirement of miRNA in GWB formation remains unclear. These miRNA are small 21-23 nucleotide non-c oding RNAs that target specific mRNAs either for degradation or the pr evention of its translation into protein via the RNAi pathway (110). Genes encoding miRNA are transcribed by RNA polymerase II to generate the primary miRNA transcript (pri-miRNA), which is capped and polyadenylated (10,11). In the nucleus, a RNase III enzyme known as Drosha, in conjunction with its partner DGCR8 in mammals, or its equivalent Pasha in Drosophila cleave the pri-miRNA transcript producing a ~70-mer hairpin pre-miRNA structure, which is then transported to the cy toplasm via exportin 5 (12-14,1618,111). In human cells, studies have shown that knockdown of Drosha results in a sharp decline of pre-miRNA and miRNA accompanied by the accumulation of pri-miRNA (13-16). Furthermore knockdown of DGCR8 with siRNA, also results in a sharp reduction in the amount of premiRNAs and hence mature miRNAs (13-15). Taken together, these studies demonstrate the importance of Drosha and DGCR8 in the generation of mature miRNA. At the start of our study, miRNA localization to GWBs had not yet been reported. As a result, to further clarify the relationship betw een GWBs and the miRNA pathway, we wanted to demonstrate the presence of miRNA in GWBs and determine whether miRNA were important for the generation of these structures. Materials and Methods Short Hairpin RNA Construct The short hairpin constructs to Drosha, DGCR8, and Narf were obtained from Open Biosystems (Huntsville, AL) and named pD rosha-sh (clone ID V2HS_71783), pDGCR8-sh (V2HS_98193), pDGCR8-sh2 (V2HS_98477), and pNarf-sh (V2HS_50154). Ten additional 32

PAGE 33

unrelated clones were also purchased, and shown to behave similarly as the negative control pNarf-sh. Cell Culture and Transfections HeLa CCL2 cells obtained from ATCC were cu ltured in Dulbeccos Modified of Eagles Medium containing 10% fetal bovine serum. HeLa cells s eeded to approximately 90% confluency in a 6 well plate or 8-chamber slide were transfected with the pDrosha-sh plasmid using Lipofectamine 2000 (Invitrogen) or A rrest-In (OpenBiosyst ems). For transient transfections, pDrosha-sh was cotransfected with phrGFP main taining the total DNA amount as per manufacturers instructions. To generate a homogenous population of Drosha-deficient cells, selection pressure was applied using 2 g/ml puromycin 2 days after the initial transfection of pDrosha-sh. Ten days after the initial transfection la rge enough colonies were maintained for further experimentation. Fluorescent labeled miRNA/siR NA were transfected into HeLa cells or Drosha-deficient cells using Oligofectamine (Invi trogen) as recommended. After 48 hrs of transfection, samples were processed either by IIF, RT -PCR, or Western blot either immediately or at 24 and 48 hr after transfection. Synthesis of miRNA and siRNA The miRNA let-7 siRNA to lamin A/C, and si CONTROL RISC-free siRNA were synthesized by Dharmacon Inc., Lafayette, CO The mature miRNA sequence for let-7 was UGAGGUAGUAGGUUGUG UGGUU. Both the antisense and sense strands, relative to the mature miRNA were synthesized and annealed according to the manu facturers specified recommendations. The 3end of the miRNA antis ense strand was labeled with Cy3. For siRNA to lamin A/C, the target sequence fo r lamin A/C was AACUGGACUUCCAGAAGAACA, 33

PAGE 34

which is situated 608-628 nts 3 from the star t codon. The 5end of the siRNA antisense strand was labeled with Cy3. Indirect Immunofluorescence HeLa cells were stained as previously described (28). GWBs were detected with human anti-GWB sera (1:2,000 to 1:10,000). Lamin A/ C was detected with a mouse monoclonal antibody (Santa Cruz Biotechnology ). Drosha was detected with rabbit anti-Drosha antibodies (1:1000). Secondary antibodies used were Al exa Fluor 488 (1:400), Al exa Fluor 568 (1:400), Alexa Fluor 350 (1:100) and Cy5conjugated goat anti-human IgG (1:100) from Molecular Probes. Glass coverslips were mounted onto the gl ass slides using either Vectashield Mounting Medium without 4,6-diamidino-2-phenylindole (DAPI) or Vectashield Mounting Medium with no DAPI (VECTOR Laboratories). Fl uorescence images were taken with Zeiss Axiovert 200M microscope and a Zeiss AxioCam MRm camera using the 40x 0.75 NA objective. Fixation and permeabilization of cells was done using 3% paraformaldehyde and 0.5% Triton X-100, respectively. Color images were as sessed using Adobe Photoshop version 7. The RNase Protection Assay Phosphate buffed saline containing complete protease cocktail inhibitors (Roche, Indianapolis, IN) and RNasin inhibitor was a dded to a 1 ml HeLa cell pellet, containing 109 cells and sonicated. The supernatant fractions were then used for immunoprecipitation, which was set up as follows: 200 l protein A Sepharose beads, 20ul anti -GW182 or control serum, 500ul NET2 buffer (150mM NaCl, 5mM EDTA pH 8, 50mM Tr is, pH 7.4), 400ul of supernatant. RNA was then isolated from immunoprecipitate by phenol/c hloroform extraction a nd ethanol precipitated. The mir VanaTM miRNA probe construction kit (Ambi on) was used to synthesize the 32P-labeled let-7 probe. Probe hybridization and RNase prot ection was then carried out using the mir VanaTM miRNA detection kit (Ambion) according to manufacturers instructions. 34

PAGE 35

The RT-PCR Assay RNA was isolated and extrac ted from HeLa cells using th e RNAeasy Mini kit (Qiagen, Mississauga, ON). Reverse transcription was carrie d out using Omniscript RT (Qiagen). The primers constructed for lamin A/C were as follows: 5 TGGTCAGCCG CGAGGTGT 3 and 5 AGAGGCTGTCGATGCGGATGC 3 The expected PCR product size was 702bp. The primers constructed for Drosha were: 5 AGTACGCCATAACCAACGAC 3 and 5 GTACTTCCGTTCGATGAACC 3 and the expect ed PCR product size was 452bp. The primers constructed for human GAPDH were: 5 TGGTATCGTGGAAGGACTCATGAC 3 and 5 ATGCCAGTGAGCTTCCCGTTCAGC 3 and the expected PCR product size was 197bp. For miRNA RT-PCR, RNA was isolated and extracted from HeLa cells using the mir Vana miRNA Isolation kit enrichment pro cedure for small RNAs (Ambion). The mir Vana qRT-PCR miRNA Detection kit and mir Vana qRT-PCR miRNA Primer sets were used for miR16, Let7a, miR24 and 5S RNA. Western Blot Analysis HeLa cell extract or immunopr ecipitated samples were load ed onto a 12% SDS-PAGE gel and transferred using a semi-dry apparatus (B ioRad) as described (33). Human anti-GW182 serum was used at a 1:10,000 dilution. The followi ng antibodies/dilutions we re also used: rabbit anti-Drosha antibodies (Abcam, Cambridge, MA) 1:500; human anti-lamin A/C antibodies 1:200; mouse anti-tubulin anti bodies 1:3,000; rabbit anti-Ago2 antibodies 1:500; rabbit antiRck/p54 antibodies 1:500; mouse anti-actin an tibodies 1:10,000. Results and Discussion To begin, we transfected HeLa cells with Cy3-3-labeled let-7 miRNA, to visually observe the intracellular locali zation of miRNA. We observed th at the Cy3-labeled miRNA was located mostly in discrete foci which co-loc alized with GWBs by i ndirect immunofluorescence 35

PAGE 36

(IIF) (Fig. 2-1a). Larger foci were also obser ved that were not GWBs, however based on colocalization with other organelle markers, thes e larger structures were late endosomes or lysosomes (data not shown). This transfection data is consistent with a re cent report showing that HeLa nuclei microinjected with in vitro transcribed Cy3-pre-let7 miRNA are found in or adjacent to mammalian P bodies (37). To determine whether let-7 was naturally found within GWBs, HeLa cell extracts were immunoprecip itated using anti-GW182 antibodies. An RNase protection assay using a 32P-labeled let-7 probe was then performed to specifically determine whether endogenous let-7 was localized to the immunopr ecipitate. As expected, the immunoprecipitates contained let-7 whereas the product immunopr ecipitated by normal human serum did not (Fig. 2-1b). This result supporte d the observations made with the IIF data described above. Next, we questioned the importance of mi RNA in GWB formation and whether the disruption of mature miRNA pr oduction would generate a phe notype associated with GWBs. Our approach was based on the published strategy that knockdown of Drosha or DGCR8 resulted in a reduction in the amount of pre-miRNA a nd mature miRNA after 72 hours (13-15). As a result, HeLa cells were transiently transfected with a plasmid encoding a short hairpin RNA (shRNA) targeting Drosha (pDrosha-sh) to re duce Drosha protein through RNAi. Ten other unrelated plasmids, including one encoding shRNA to nuclear pre-lamin A recognition factor (pNarf-sh), were also transfected into HeLa cells as controls for any nonspecific effect associated with these plasmids. These shRNAs are transcribed in the nucleus and processed by Drosha/DGCR8 in a similar manner to endogenous pri-miRNA. Thus when Drosha/DGCR8 is knocked down by the shRNA-derived siRNA, proce ssing and maturation of newly transcribed shRNAs, as well as endogenous pri-miRNAs, are i nhibited resulting in a reduction in these RNA 36

PAGE 37

levels. Since the transfection efficiency usi ng the typical transfecti ng agent Lipofectamine2000 was ~20-25%, we cotransfected a GFP expression pl asmid (phrGFP) such that transfected cells were identifiable. These cells were then stained for GWBs by IIF using human anti-GWB antibodies (28,33,104) and for Drosha protein by rabbit anti-Drosha antibodies. Seventy-two hours after transfection, the major ity of cells cotransfected with pDrosha-sh and phrGFP had a clear reduction in number and size of GWBs (Fig. 2-2 iii) and there was a strong correlation with the reduction in Drosha staining (Fig. 2-2, ii). Control cells tr ansfected with phrGFP and pNarfsh showed a normal distribution of GWBs and Drosha protein (Fig 2-2, v-viii). The Droshadeficient cells were also stai ned with an additional P body marker, Dcp1a, which showed an identical phenotype as GW B staining (Fig 2-3). However, since the transfection efficiency of the plasmid was only ~20% and the number and size of GWB is known to vary during the cel l cycle (33), we verified this observation by selecting pDrosha-sh transfected cells by puromycin resistance. After 21 days of selection, we reproduced the phenotype obtained with the transiently transfec ted HeLa cells, in that the number of GWBs sharply declined in the selected cells (Fig. 2-4b, compare to 2-4a). In a typical experiment, 95% of selected cells completely lacked GWBs with the remaining 5% have residual 1-2 small GWBs. It was confirmed that Drosha pr otein was substantially reduced in these cells by RNA and protein analysis (Fig 2-5a, 2-5c) a nd, as predicted, mature miRNA levels were greatly reduced in these cells compared to untr eated HeLa (Fig 2-5b). These results suggested that miRNA was central to GWB formation. We then set out to examine if the introduc tion of siRNA, as a surrogate for miRNA, could rescue GWB formation. Transfection of the Drosha knockdown cells with lamin A/C siRNA resulted in the reappearan ce of GWBs in these cells with in 48hr (compare Fig. 2-4a, vii 37

PAGE 38

to iv), the localization of siRNA to GWBs (F ig. 2-4d), and a markedly reduced expression of lamin A/C mRNA (Fig. 2-6) and pr otein (Fig. 2-4c, viii, Fig. 24d and Fig. 2-6b). HeLa cells and the Drosha knockdown cells had normal levels of lamin A/C mRNA/protein expression prior to the addition of lamin A/C siRNA (Fig. 2-6a, 26b). Transfection of siRNA that cannot be incorporated into RISC (RISC-free siRNA) in to Drosha-deficient cell s failed to rescue GWB formation (Fig 2-7). To independently substantiate the observed reduction in the number of GWBs seen in Drosha-deficient cells, we transfected HeLa cells with two separate plasmids (pDGCR8-sh, pDGCR8-sh2) encoding short hairpi n RNA directed to different sequences in the mRNA for the partner of the Drosha protein, DGCR8. Figure 2-8 shows cells that were transfected with phrGFP alone or co-transfected with both phrGFP and pDGCR8-sh. Interestingly, 72 hours after cotransfection of phrGFP and pDCGR8-sh, most GFP positive transfected cells had a clear reduction in number and size of GW Bs (Fig. 2-8, vi), compared to cells transfected with phrGFP alone (Fig. 2-8, iii). Identical results were observed using pDGCR8-sh2. Figure 2-8, vii-ix, shows the reappearance of GWBs in pDGCR8-sh-transfected GW B-deficient cells when they were subsequently transfected with la min A/C siRNA (compare ix to vi). Figure 2-9 is a schematic summary of our in terpretation of the pathways involved in mRNA targeting by miRNA and their eventual GWB destination. Some of the steps required for pri-miRNA processing to mature miRNA or siRNA are well documented and reviewed elsewhere (110). Based on recently published re ports (35,96,112) and on the data presented here, we propose that the initiation of the events lead ing to the formation of GWBs requires miRNA. We cannot rule out the possibility that miRNA depl etion is having a direct or indirect effect on the expression of other components of GWB required for its assembly. However, we showed that 38

PAGE 39

siRNA served as a surrogate for miRNA to rest ore GWBs and RNAi activity was still functional (Fig 2-6). We further propose that following the initial partnering of the correct mRNA with the Ago2/miRNA complex and perhaps with the assistance of mRNA binding proteins such as GW182, more proteins are recruited leading to the formation of these cytoplasmic foci. The recruited proteins probably in clude a complex of mRNA degrad ation associated proteins (95,103,113). Our data is consistent with previo us work showing actinomycin D leading to disassembly of GW/P bodies (101) since it is kno wn that miRNA are transcribed by Pol II (11). In conclusion, GWB formation appears to be miRNA dependent, or most likely Ago2miRNA and/or Ago2-miRNA/target-mRNA driven, thereby possibly providing a microenvironment for RNAi which would result in either mRNA degradation or repressed mRNA translation. However, we cannot exclude the alternative possibility that the RNAi machinery may be recycled within GWBs, or th at the RNAi machinery relocates to GWBs to allow for the ultimate disposal of the targeted mR NA or to prevent its translation. Future studies in examining the requirement of Ago2 and Dicer in GWB formation will be needed to further elucidate the current findings. This work was published in 2006 in EMBO Reports volume 7, issue 9, pages 904-910. 39

PAGE 40

Figure 2-1. MicroRNA is present in GWBs. (A) Transfected let7 miRNA 3-labeled with Cy3 was localized to GWBs in HeLa cells 24 hours post-transfection. HeLa cells were transiently transfected with Cy3-3-let-7 after which they were fixed and stained with human anti-GWB serum. Analysis showed that the miRNA (i, arrows) was found within GWBs (ii, arrows). Nuclei were counterstained by DAPI (iii). Note that miRNA transfected cells often show addi tional large cytoplasmic aggregates (i, arrowheads) distinct from GWBs (ii, arrows). The merged images are seen in iv. Bar, 10 m. (B) Biochemical detection of let-7 RNA using an RNase protection assay (upper) and GW182 protein by west ern blot analysis (lower, lane 2). Lane 1 and 3 are control immunoprecipitate w ith normal human serum ( NHS), and total RNA and protein from HeLa cell extracts, respectively. 40

PAGE 41

Figure 2-2. Loss of GWB staining in HeLa cells after transient transfection of shRNA plasmid targeting Drosha. A shRNA plasmid targe ting Drosha (pDrosha-sh) or unrelated control pre-lamin A recognition factor (pNarf -sh) was co-transfected with the phrGFP plasmid at a 5:1 molar ratio. After 72 hour s, cells transfecte d with pDrosha-sh identified by the co-expression of GFP (i, dashed circular lines, which outline the cell nuclei and also indicate two cells that di ffer in level of GFP expression; wk, weak GFP signal) showed complete knockdown of Drosha (ii) a nd virtually complete loss of GWB staining (iii). Untransfected cells had normal GWBs (arrows) and stained positively for Drosha. Control cells transfect ed with phrGFP and pNarf-sh (v) showed normal expression of Drosha (vi) and GWBs (arrows, vii). Drosha, GWBs, and lamin A/C were detected by rabbit anti-Drosha (red), human anti-GWB (white), and mouse anti-lamin A/C (blue) antibodies as describe d in Methods. Panels iv and viii, merged images. Bar, 10 m. 41

PAGE 42

Figure 2-3. Loss of P body marker Dcp1a staining in HeLa cells after transient transfection of shRNA plasmid targeting Drosha. HeLa cells were co-transfected with pDrosha-sh and phrGFP plasmids at a 5:1 molar ratio. After 48 hours, cells transfected with pDrosha-sh identified by the co-expression of GFP showed almost complete loss of GWB staining (vi, x) as well as loss of Dcp1a staining (v, ix) compared to untransfected cells (i, ii). Residual staining of incompletely disassembled GWBs (arrows) in transfected cells are seen in pane ls vi and x. Panels iv-vii and viii-xi show representative transfected cel ls with high and low expression of GFP, respectively. Dcp1a and GWBs were detected by rabbi t anti-Dcp1a (red) and human anti-GWB (white) serum as described in Methods. Mo st foci positive for Dcp1a coincide with those positive for GWB stai ning (arrows); however, there are some foci much stronger in Dcp1a staining (open arrowhead) and others much stronger in GWB staining (arrowheads). Merged images of GFP, Dcp1a (red), GWB (white), and DAPI (blue) are shown in panels ii i, vii, and xi. Bar, 10 m. 42

PAGE 43

Figure 2-4. Loss of GWB staining in Drosha-deficient HeLa cells and transfection of synthetic siRNAs rescues GWBs. HeLa cells transfected with pDrosha-sh plasmid were allowed to grow in the presence of 2 g/ml puromycin to select for cells which were later transfected with lamin A/C siRNA. Untreated HeLa (A), Drosha-deficient cells (S4) selected for 21 days (B), and S4 cel ls 48 hours post transf ection with siRNA (C) were co-stained with anti-GW182 anti body and Alexa 488-goat anti-human IgG (green, i, iv, vii) and anti-lamin A/C monoclonal antibody and Alexa 350-goat antimouse IgG (blue, ii, v, viii). GWBs (arrows) were readily detected in untreated HeLa cells (i). Most of the GWB staining was lost in S4 ce lls, but dispersed residual GWB staining was still observable (arrows, iv). Many GWBs were observed in S4 cells after transfection with siRNA (arrows, vii) The knockdown of lami n A/C in S4 cells 43

PAGE 44

transfected with lamin A/C siRNA was eff ective (viii), with only few cells with detectable lamin A/C (arrowhead). (D ) Cy3-labeled siRNA for lamin A/C localized to GWBs in transfected S4 cells. The majority of Cy3-siRNA appeared aggregated in the cytoplasm but some were detected in GWBs (arrows). Efficient lamin A/C knockdown was observed and was indicated by the absence of lamin A/C staining in the nucleus (dashed circle). Inserts are 1.5x enlarged and the Cy3 signal is enhanced to show the localization of siRNA to GWBs. Bar, 10 m. 44

PAGE 45

Figure 2-5. Characterization of Drosha deficient cells usi ng RT-PCR and Western blot and demonstration of reduced miRNA levels. (A) Reduction of Drosha mRNA levels demonstrated by RT-PCR comparing untreat ed HeLa and pDrosha-sh transfected HeLa cells as described in Figure 22. GAPDH analysis was included for comparison. (B) Reduction of mature miRNA levels demonstrated by RT-PCR comparing untreated HeLa and pDrosha-sh tr ansfected cells. 5S RNA analysis was included for comparison. (C) Western blot analysis showing a reduction of Drosha protein level in pDrosha-sh transfecte d cells (data also shown from duplicate experiment) compared to untreated He La cells. GW182, Ago2, Rck/p54 and actin levels are shown for comparison. 45

PAGE 46

Figure 2-6. Drosha-deficient cel ls are functionally competent for transfected siRNA-mediated knockdown of target lamin A/C. (A) RT-PCR analysis demonstrating reduction of lamin A/C mRNA levels in Drosha-deficient cells. (B) Western blot analysis of lamin A/C protein levels demonstrating functional RNAi activity when siRNA are transfected into Drosha-deficient cells. Actin levels were monitored to control for sample loading. 46

PAGE 47

Figure 2-7. Transfection of chemically modi fied RISC-free siR NA did not rescue GWB formation in Drosha-deficient HeLa cells. HeLa cells were transfected with pDroshash plasmid and then subsequently transfect ed with RISC-free siRNA. Seventy-two hours after the initial transfection, Drosha was drastically reduced in transfected cells (vi) compared to untransfected cells (ii) and there was a loss of GWBs in Droshadeficient cells (v). Transfection of RI SC-free siRNA was unable to rescue GWB formation (ix). Merged images of GWB, Drosha, and DAPI are shown in panels iv viii, and xii. GWBs and Drosha were detected by human anti-GWB (green) serum and rabbit anti-Drosha (red) antibodies as described in Methods. Bar, 10 m. 47

PAGE 48

Figure 2-8. Disassembly of GWB in HeLa cells resulting from DGCR8 knockdown and reassembly after siRNA transfection. A shRNA plasmid targeting DGCR8 (pDGCR8sh) was co-transfected with the phrGFP pl asmid at a 5:1 molar ratio. After 72 hours, transfected cells identified by the co-expression of GFP showed almost complete absence of GWB staining, although a few w eakly stained GWBs were detectable (arrows, vi). In contrast, GWBs were detected in phrGFP alone transfected cells (arrows, iii). Transfection of siRNA for lamin A/C into DGCR8 knockdown cells resulted in a reappearance of GWBs (arro ws, ix) and a reduction in lamin A/C protein in these cells 48 hours post -siRNA transfection. Bar, 10 m. 48

PAGE 49

Figure 2-9. The GWB are foci devoted to miRNA processing. In this schematic diagram, primiRNA nuclear transcripts ar e cleaved by Drosha/DGCR8 complex into hairpin premiRNA, which are exported to the cytoplasm via exportin 5. In the cytoplasm, Dicer is responsible for cleavage of pre-mi RNA generating the mature miRNA. Upon correct interaction and pa rtnering of the miRNA to mRNA containing the miRNAtargeted sequence element X in the pres ence of Ago2/RISC, cytoplasmic foci form upon association of other proteins (see text). However in the absence or low levels of miRNA, as a result of Drosha or DGCR8 protein knockdown, these foci do not form. The transfection of siRNA as a surrogate for miRNA leads to the apparent reassembly of GWBs. 49

PAGE 50

CHAPTER 3 FORMATION OF GW/P BODIES AS A MARKER FOR MICRORNA-MEDIATED REGULATION OF INNATE IMMUNE SIGNALING Introduction The cytoplasmic foci known as GW or P bodies here referred to as GWB, are present in mammalian cells that have a role in mRNA processing and degradation and have recently been linked to the RNA interference (RNAi) a nd microRNA (miRNA) pathways (114,115). Specifically, it has been shown that small in terfering RNA (siRNA) and miRNA localize to GWB (34,36,37). It has also been shown that argonaute 2 (Ago2), the slicing enzyme of RNAi, interacts with a critical GW B protein, GW182, and localizes to GWB (34,38,96,97). In addition, we have shown that the formation of GWB is a consequence of miRNA biogenesis (36), and our latest report demonstrated that siRNA-mediated silencing of endogenous targets results in the induction of GWB assembly (39). Others ha ve also demonstrated the link between RNAmediated gene silencing and GWB formation (116). Relatively little is known about the targets of specific miRNA except that most miRNA have specific target sites in the 3 untranslate d regions (UTR) of their mRNA targets. AU-rich elements (AREs) are the predominant motifs in the 3UTR of mRNAs that regulate mRNA stability (117). It was previously thought that AREs were main ly involved in the regulation of relatively few mRNAs such as cytokine and gr owth factor mRNAs. However, it is now known that ARE mRNAs make up roughly 8% of mR NAs transcribed from the human genome including those involved in cell growth a nd differentiation, immune responses, signal transduction, and apoptosis (117). Many cytokine mRNAs, including those for tumor necrosis factor(TNF), interleukins, interferons, and granulocyte-macrophage colony -stimulating factor (GM-CSF), have very short half-lives, and their degradation is regulated by AREs in their 3UTR (117). 50

PAGE 51

Since miRNA are known to target sequences in the 3UTR of mRNAs, it is interesting to postulate that cytokine mRNAs could be regulat ed by miRNA. In fact, recent studies have reported that miRNA are involve d in some ARE-mediated mR NA degradation. In 2005, Jing et al reported that miR-16 targets the ARE in the 3UTR of TNFmRNA and is required for its degradation (118). In 2006, Takahashi et al. showed that Dicer is required for ARE-mediated degradation of GM-CSF mRNA, sugges ting that mature miRNA play a ro le in this process (119). Additionally, two recent reports demonstrated th at certain miRNA may activate or derepress their target mRNA under specific cel lular conditions (98,99). Vasudevan et al. reported that miR-369-3 was able to activ ate translation of TNFmRNA, but this activa tion was not specific to that miRNA-mRNA pair, therefore this phe nomenon may be true fo r other miRNA as well (99). Further connections between miRNA and the mammalian immune system are becoming more evident with recent publications (120,121). One recent report showed that certain miRNA are upregulated in human monocytes in respons e to lipopolysaccharide (LPS) (40). LPS is a component of the outer membrane of gram-negativ e bacteria that activates the production of proinflammatory cytokines in monocytes and macr ophages. LPS stimulates toll like receptor 4 (TLR4) activating several intracellular signali ng cascades that lead to the production of TNF, IL-6, monocyte chemoattractant protein-1 (MCP-1 ) and other pro-inflammatory cytokines and chemokines (122). Taganov et al. reported that LPS stimulation of THP-1 monocytes resulted in increased expression of miR-146a, miR-155 and miR-132, and they showed that TRAF6 and IRAK1, proteins in the TLR4 signaling pathway, were likely targets of miR-146a (40). In addition, miR-155 has also been linked to severa l other immune functions including germinal 51

PAGE 52

center response (54), normal lymphocyte f unctions (53), and regulation of immunoglobulin class-switched plasma cells (55) Taken together, these recent reports demonstr ate an important role for miRNA in normal immune functions. The aim of this study is to investigate the effect of innate immune signaling and related miRNA on GWB since the latter has b een implicated in miRNA biogenesis in our earlier report (36). Material and Methods Cell Culture and LPS/Cytokine Treatment THP-1 human monocytes obtained from Ameri can Type Culture Collection (Manassas, VA) were cultured in RPMI 1640 medium with 2 mM L-glutamine adjusted to contain 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate and supplemented with 0.05 mM 2mercaptoethanol and 10% fetal bovine seru m. THP-1 cells were seeded at 5x105 cells per well in a six-well plate and treated with 1 g/ml LPS from Salmonella enterica serotype minnesota (Sigma, St. Louis, MO) unless stat ed otherwise. After designated treatment time, cells were harvested and washed once in PBS prior to analysis. Immunofluorescence THP-1 cells were cytospun onto glass slides at 1,000 rpm for 5 minutes. Cells were fixed in 3% paraformaldehyde for 10 minutes and perm eabilized in 0.5% Triton X-100 for 5 minutes. GWB were detected with human anti-GWB se ra (1:6000) and rabbit anti-Dcp1a (1:1000). Secondary antibodies used were Alexa Fluor 488 goat anti-human IgG (1:400) and Alexa Fluor 568 goat anti-rabbit IgG (1:400) from Molecular Pr obes (Carlsbad, CA). Slides were mounted using Vectashield Mounting Medium with 4,6-diamidino-2-phenylindole (DAPI) (VECTOR Laboratories, Burlingame, CA). Fluorescence im ages were taken with Zeiss Axiovert 200M microscope and a Zeiss AxioCam MRm camera using the 20x or 40x 0.75 NA objectives. Color 52

PAGE 53

images were assessed using Adobe Photoshop vers ion 7. GWB were counted using Cell-Profiler image analysis software (123). Western Blots THP-1 cell extracts were loaded onto a 7.5% SDS-PAGE gel and transferred to nitrocellulose. The following antibodies and d ilutions were used: ra bbit anti-Ago2 antibodies 1:500; rabbit anti-Dcp1a antibodies 1:1,000; rabbit anti-Rck/p54 antibodies 1:500 (MBL International, Woburn, MA); m ouse anti-tubulin antibodies 1:5,000; mouse anti-actin antibodies 1:10,000; rabbit anti-Drosha antibodies 1:500 (Abcam, Cambridge, MA); and rabbit anti-golgin97 (124) antibodies 1:200. Secondary goat anti -mouse and anti-rabbit an tibodies conjugated to horse radish peroxidase (HRP) were used at 1:10,000 dilutions (Southern Biotech, Birmingham, AL). Densitometric analysis of the developed film was performed using Image J software (125). Protein levels were normalized to tubulin and the fold change in protein level between LPStreated and untreated samples was calculated for each time point. The qRT-PCR Assay RNA isolates were prepared using the mir Vana miRNA Isolation kit (Ambion, Austin, TX) according to the manufacturers protocol. R NA concentrations were determined and equal amounts of each RNA sample were used for qR T-PCR. qRT-PCR was performed using the TaqMan MicroRNA Reverse Transcription Kit, TaqMan Universal PCR Master Mix, and TaqMan MicroRNA Assay primers for human miR-146a human miR-132, human miR-155 and human let-7a (Applied Biosystems, Foster Cit y, CA ). The cycle threshold (Ct) values, corresponding to the PCR cycle number at whic h fluorescence emission reaches a threshold above baseline emission, were determined and the miRNA expression, relative to untreated controls, was calculated using the 2Ct method (126). 53

PAGE 54

Synthesis and Transfect ion of siRNA and miRNA siRNAs targeting Rck/p54, Ago2 and Dr osha and pre-miR-146a (Ambion) were transfected into THP-1 cells using Lipofectamine 2000 (Invitroge n, Carlsbad, CA) according to the manufacturers instructions. To monitor the transfection efficien cy, Cy3-labeled siRNA targeting lamin A/C or Cy3-labe led pre-miR-negative control (Amb ion) were transfected into cells in parallel to all transf ections, and at least 80% transfection efficiency was achieved. The siRNAs used in this study were all purchased from Dharmacon (Lafayette, CO) and dissolved in 1x Universal buffer (provided by Dharmacon), and the resulting 20 stock was stored in aliquots at -20C prior to use. The sense a nd antisense strand sequen ces are listed below: hAgo2: 5-GCA CGG AAG UCC AUC UGA A dTdT-3 and 5-UUC AGA UGG ACU UCC GUG C dTdT-3 (127); hRck/p54: 5-GCA GA A ACC CUA UGA GAU UUU-3 and 5-AAU CUC AUA GGG UUU CUG CUU-3 (127); hDro sha: 5-CGA GUA GGC UUC GUG ACU U dTdT-3 and 5-AAG UCA CGA AGC CUA CUC G dTdT-3 (16). Multiplex Analysis of Cytokines THP-1 cells were transfected as desc ribed above, and then treated with 2 g/ml LPS for 24 or 48 hours in culture medium. The culture supernatant was then harvested and frozen at -80C for storage before multiplex analysis. The human cytokine/chemokine LINCOplex premixed kit (Millipore, Billerica, MA) or Beadlyte human 22-plex multi-cytokine detection system (Millipore) were used according to the manufacturers protocol to quantitatively detect the following human cytokines/chemokines: GMCSF, IFN, IL-1 IL-6, IL-10, IP-10, IL-12p40, IL-12p70, MCP-1, and TNF. Samples were analyzed on a Luminex 200 system (Luminex, Austin, TX). 54

PAGE 55

Results GWB Increase in Size and Number in Response to LPS Stimulation Stimulation of human monocytes/macrophages with LPS is a well-characterized model of innate immune signaling (122). To determine if there were any changes in GWB associated with innate immune signaling, we trea ted THP-1 human monocytes with 1 g/ml LPS for 0 to 24 hours and monitored GWB by indirect immunofluor escence (Figure 3-1A). Within 4 hours of LPS stimulation the number and size of GWB significantly incr eased compared to untreated cells. The number of GWB was hi ghest at 8 hours of LPS stimulation, and then declined at 12 and 24 hours. This observation was quantified by using CellProfiler image analysis software to count the number of GWB per cell. As show n in Figure 3-1B, the average number of GWB increased almost 2-fold with 8 hours of LPS treat ment compared to untrea ted cells cultured in parallel (18.6 in LPS-treated ve rsus 10.5 in untreated cells). At each time point examined, there was a significant increase in th e number of GWB in LPS-treated cells compared to untreated cells by one-way ANOVA (P<0.001). This experiment was repeated more than 10 times with similar results obtained each time over a period of 2 years. Next, we examined the expression levels of some of the protein components of GWB by Western blot in order to determine if the GWB forming in response to LPS were assembled from de novo proteins or pre-existing proteins in the cy toplasm. THP-1 cell extracts were prepared from cells treated with 1 g/ml LPS for 4, 8, or 24 hours togeth er with paired untreated cells harvested at the corresponding time point (Figure 32A). Densitometric analysis of the Western blot data estimated that there were only slig ht changes in the expres sion levels of Ago2, Dcp1, and Rck/p54 in LPS treated cells compared to un treated cells (Figure 3-2B). We believe that these modest changes in protein levels do not reflect the signific ant increase in size and number 55

PAGE 56

of GWB, suggesting that LPS-induced GWB are formed from pre-existing proteins in the cytoplasm rather than entirely from de novo proteins. Upregulation of miR-146a, miR-132, and miR155 in THP-1 Cells in Response to LPS Based on the recent work by Taganov et al. on the upregulation of certain miRNA in response to LPS (40), and our recent work demonstrating th e importance of miRNA for GWB formation (36), we speculated th at the LPS-induced increase in the size and number of GWB could be the result of increased miRNA expression in the cells. To test this hypothesis, we first set out to confirm that in our experimental conditions, these miRNA were upregulated in response to LPS. We examined the expre ssion of miR-146a, miR-132, miR-155 and let-7a in THP-1 cells after LPS stimulation by quantitative real time PCR (qRT-PCR). As expected, the expression of let-7a was unaffected by LPS treat ment and was used to normalize the expression of miR-146a, miR-155, and miR-132. Fold chan ge in miRNA expression was calculated by comparing 4, 8, 12, and 24 hour LPS treatments to untreated samples cultured in parallel. As shown in Figure 3-3A, miR-146a was increased an average of 19 fold after 4 hours and 28 fold after 8 hours LPS treatment. In addition, miR-132 expression was increased 3.8 fold after 24 hours of LPS treatment (Figure 3-3B) and miR-155 expression was increased 2.6 fold after 8 hours of LPS treatment (Figure 3-3C). These da ta show that LPS stimulation results in the upregulation of certain miRNA coinciding with an increase in the size and number of GWB, indicating a role for miRNA in the increase of GWB. The Rck/p54 and Ago2 Proteins are Re quired for LPS-Induced GWB Assembly To further demonstrate the connection be tween LPS-induced miRNA and GWB, we examined the effect of depleting two prot ein components of GWB that are known to be important for miRNA function, Rck/p54 and Ago2 (127). We used siRNA to knockdown Rck/p54 or Ago2 in THP-1 cells, in cubated the cells for 48 hours, a nd then treated the cells with 56

PAGE 57

LPS and monitored GWB expression by immu nofluorescence. Figure 3-4A shows the knockdown of Rck/p54 (~90% reduction) and Ago2 (~70% reduction) under these experimental conditions. As shown in Figure 3-4B, the av erage number of GWB per cell in the Rck/p54depleted cells was reduced to 4.7 compared to an average of 9.7 foci per cell in mock-transfected cells prior to LPS treatment. These data are cons istent with previous re ports demonstrating that Rck/p54 depletion results in the loss of GWB (39,127). In add ition, LPS stimulation of Rck/p54 depleted cells did not induce an increase in the number of GWB at all tim e points examined. At 8 hours, when the maximum increase in GWB after LPS treatment of the mock transfected cells was seen, Rck/p54 depleted cells had an average of 3.1 foci per cell compared to 23.5 foci per cell in mock transfected cells (F igure 3-4B), representing an 87% reduction. Consistent with our previous report (39), in Ago2-de pleted cells, the average number of GWB per cell was similar to that of mock-transfected cells prior to LPS stimul ation (Figure 3-4B). Li ke the Rck/p54-depleted cells, there was no increase in the number of GWB in Ago2-depleted cells except after 4 hours of LPS stimulation. We speculate that this initial increase in GWB could be due to incomplete knockdown of Ago2 as shown in Figure 3-4A. Overal l, this data demonstrated that Rck/p54 and Ago2 were both required for the LPS-induced increase in GWB assembly, supporting our hypothesis that miRNA is responsible for this phenomenon, therefore in the absence of a functional miRNA pathway, GWB are no longer affected by LPS stimulation. Transfection of miR-146a Alone Can Induce an Increase in GWB Size and Number Since LPS has only been shown to induce the expression of a few miRNA (40), and in our experimental system miR-146a was the most affected by LPS treatment, we wanted to demonstrate whether or not the introduction of miR-146a alone in to the cells could induce an increase in the size and numb er of GWB similar to LPS-induced GWB assembly. We transfected precursor miR-146a (pre-miR-146a) at a concentration of 30nM into THP-1 cells and 57

PAGE 58

after 24 hours examined GWB by immunofluorescence. To monitor transfection efficiency, we also transfected the cells w ith a Cy3-labeled-pre-miR negative control which mimics an endogenous miRNA but has no endogenous target. Figure 3-5A shows the increase in GWB size and number in cells transfected with pre-miR-146a compared to mock transfected cells. As shown in Figure 3-5B, only the ce lls transfected with pre-miR-146a exhibited greater than 2-fold increase in the average number of GWB per cell similar to the increase seen with 8 hours LPS treatment. This experiment was repeated using 15 nM, 7.5 nM, 3.75 nM, 1.88 nM, and 0.94 nM concentrations of pre-miR-146a, and a similar increase in size and number of GWB can be observed with as little as 1.8 nM pre-miR-146a (d ata not shown). We also isolated total RNA from the transfected cells and analyzed the mR NA levels of TNF receptor-associated factor 6 (TRAF6) and IL-1 receptor associated kinase (IRAK-1), the putative ta rgets of miR-146a (40), by qRT-PCR. THP-1 cells tran sfected with pre-miR-146a show ed an 85% reduction in the mRNA level of TRAF6 and a 51% reduction in th e level IRAK-1 compared to mock transfected cells (Figure 3-5C). These data indicate that miR-146a alone can induce an increase in the size and number of GWB and can negatively regula te endogenous TRAF6 and IRAK-1 at the mRNA level. MicroRNA Play a Role in the Regulation of THP-1 Cytokine and Chemokine Production Since we confirmed that miR-146a targets TRAF6 and IRAK-1, we wanted to determine the functional significan ce of this regulation. To do this, we monitored LPS-induced cytokine and chemokine production in mock transfected cells compared to cells transfected with pre-miR146a using quantitative multiplex cytokine anal ysis. The pre-miR-146a and mock transfected cells were treated with 2 g/ml LPS for 24 hours and the culture supernatants were harvested and analyzed. Five detected cyt okines/chemokines (IL-8, IP-10, IL-1 IL-6 and MCP-1) exhibited decreased production in LPS-induced THP-1 cells transfected with pre-miR-146a compared to 58

PAGE 59

mock transfected cells (Figure 3-6). The production of IL-8, IP-10, and MCP-1 was decreased by approximately 70%, while that of IL-1 and IL-6 was decreased 89% and 92%, respectively (Figure 3-6). In these expe riments the production of TNFwas not affected by transfection of pre-miR146a, but this may be due to the low level of TNFproduced after 24 hours of LPS treatment (less than 5 pg/ml, data not shown). These data demonstrate th at the delivery of miR146a prior to the addition of LPS inhibits L PS-mediated cytokine/chemokine production; the underlying mechanism may be that miR-146a re gulates TRAF6 and IRAK1 and ultimately results in the decreased production of these cyt okines and chemokines. To further investigate this mechanism, we performed a similar experi ment in TRAF6 or IRAK-1 deficient THP-1 cells and found that different cytokines/chemokines were affected by the knockdown of these proteins (Figure 3-7). This data indicat es that miR-146a probably targets a number of proteins in addition to TRAF6 and IRAK-1 and may regulate the pr oduction of certain cytokines through other mechanisms not yet understood. We also wanted to examine LPS-induced cy tokine/chemokine production in the absence of miRNA regulation. Since it is unlikely that only one miRNA regulates this process, we depleted all miRNA from THP-1 cells by knocki ng down Drosha. First we transfected THP-1 cells with siRNA targeting Drosha to inhibit maturation of endogenous miRNA, and then these miRNA-deficient cells were compared to mock tr ansfected cells. Figure 3-8A shows that cells transfected with siRNA targeting Drosha demonstrated at least a 70% reduction in the level of Drosha protein 4 days after transfection. We also examined the amount of miRNA in Droshadepleted cells 3 and 4 days after transfection. Consistent with prev ious Drosha knockdown studies (13-16,36), miRNA were de pleted to less than 20% of normal levels 4 days after 59

PAGE 60

transfection (Figure 3-8B). Based on these data, subsequent experiments were performed 4 days after transfection. Next, we examined cytokine and chemokine production in these miRNA-depleted cells compared to mock-transfected cells cultured with or without 2 g/ml LPS for 48 hours. Multiplex analysis was used to quantitatively detect cytokines in the culture supernatants. Figure 3-8C shows 11 detected cytokines/chemokines in the culture supernatants of mock transfected cells treated with LPS for 48 hour s. The percent change in cy tokine and chemokine production between mock transfected and Drosha-depleted cells was calculated and is displayed in Figure 38D. Interestingly, 8 of the cytokines/chemokines examined (IL-12p70, IL-10, TNF, GM-CSF, IP-10, MCP-1, IL-1 and IL-6) demonstrated at least a 20% increase in production in the supernatants of miRNA-depleted cells, while the other three cytokines examined (IL-8, IFN, and IL-12p40) showed no change or a decrease in production between co ntrol cells and miRNAdepleted cells (Figure 3-8D). Certain cytokines, such as IL-12p70, IL-10, TNF, and GM-CSF are more affected by miRNA-depletion as dem onstrated by a greater than 100% increase in production (Figure 3-8D). These data indicated that while miRNA are not required for the LPSinduced production of the cytokine s examined, they play a role in the regulation of cytokine levels in THP-1 cells. Discussion Proposed Model for miRNA-Mediated GW B Assembly After LPS Stimulation Our proposed model for the LPS-induced a ssembly of GWB via the miRNA pathway is illustrated in Figure 3-9. LPS binds to LPS-bi nding protein (LBP) which in turn is then transferred to CD14 on the cell surf ace (step 1) (for review see ( 122)). LPS-CD14 then interacts with TLR4 and its accessory protein MD-2. TLR4 stimulation by LPS activates signal transduction via MyD88 ultimately phosphorylating I B (step 2). Phosphorylated I B is then 60

PAGE 61

released from NF B and degraded while NF B translocates to the nucleus and activates the transcription of pro-inflammatory cytokine s and miRNA including mi R-146a, miR-155, and miR-132 (step 3) (Figure 3-3) (40,122). Among thes e, miR-146a has the highest fold increase in expression in response to LPS (Figure 3-3) (40). The miRNA are transcribed as pri-miRNA, wh ich are then processed into pre-miRNA by the Drosha/DGCR8 microprocessor complex (not shown). The pre-miRNA are exported into the cytoplasm by exportin 5 and cl eaved by Dicer into mature miRNA duplexes, which are loaded into the Ago2/RISC (RNA-induced silencing complex) complex where they bind their target mRNA (step 4) (20). In the case of miR146a, TRAF6 and IRAK-1, proteins in the MyD88 signaling pathway, are known targ et mRNAs (Figure 3-5C) (40). The miRNA/RISC complex enter the GWB, a lthough it is not clear whether this occurs after the miRNA/RISC complex is formed in the cy toplasm or if the miRNA is loaded into RISC inside GWB (114,115). The influx of miRNA duplexes may resu lt in the rapid 2-fold increase in the number of GWB in the cell within 8 hours of LPS exposure (step 5) described in the current report. We hypothesize that this expansion of GW B in the cytoplasm allows for more efficient inhibition of mRNA targets resu lting in the ability of the ce ll to rapidly regulate signaling cascades and cytokine secreti on. The increase in GWB number and size may be due to an accumulation of target mRNAs undergoing degrad ation by a limited amount of decay factors (128). An alternative interpretation may be that some of the mRNAs are being degraded independently of miRNA via a GWB mediated pathway, but this seems unlikely based on the evidence shown in this report of miRNA involvement. The target mRNAs are translationally repres sed (or degraded) resul ting in a reduction of protein expression (step 6). TRAF6 or IRAK-1 regulation by miR146a results in the subsequent 61

PAGE 62

blockage of NF B activation leading to th e downregulation of inflammatory cytokine production (Figure 3-6). Depletion of miRNA or GWB by knocking do wn Drosha, Rck/p54 and Ago2 results in a lack of regulation after exposure to LPS (step 7). This lack of regulation leads to overproduction of inflammatory cytokines (IL6 shown as example) and may affect other monocyte functions (Figure 3-8D). Observation of GWB as Biomarkers for miRNA Activity Our previous report showed that miRNA bi ogenesis is required for GWB assembly under normal cellular conditions (36). Specifically, we knocked down Drosha or DGCR8 with short hairpin RNA plasmids in order to stop miRNA maturation at the pr i-miRNA level. After mature miRNA were depleted in the cytoplasm, we obs erved that GWB were disassembled. Our data showed that mature miRNA are required for normal GWB assembly, and exogenously introduced siRNA can act as a surrogate for endogenous miRNA to reassemble GWB (36). Our most recent study also showed th at GWB assembly is also linke d to siRNA activity (39). We reported that the transfection of siRNA into ma mmalian cells led to an increase in number and size of GWB, and that this siRNA-induced GWB assembly was dependent on the presence of an endogenous target mRNA (39). Also, like the data reported here for LPS-induced GWB, Rck/p54 and Ago2 proteins were found to be requir ed for the siRNA-mediated increase in GWB (39). These reports show that GWB can serve as biomarkers for miRNA and siRNA activity. In this report, we describe a more natural conditi on with inducible miRNA fr om LPS stimulation of TLR4 demonstrating a mechanistic relationship be tween GWB and miRNA activity (Figure 3-9). Our data extend the current know ledge of GWB and their rela tionship to innate immune signaling, and are consistent with previous re ports demonstrating GWB as biomarkers for miRNA and/or siRNA activity (36,39). 62

PAGE 63

Depletion of miRNA Affects Cytoki ne and Chemokine Production Our finding that the production of some cytokines and chemokines was increased in cells depleted of miRNA suggests that miRNA play a role in the regulati on of these functions. Interestingly, the production of IL-6, IP-10, MCP-1, IL-10, IL-1 IL-12p70, TNF, and GMCSF were increased by miRNA de pletion indicating th at the production of these cytokines is regulated by miRNA (Table 3-1). Howeve r, two of the cytokines examined (IFN, and IL12p40) exhibited a decrease in production in re sponse to miRNA depletion and IL-8 was not affected by miRNA depletion (Table 3-1). Th is suggests that miRNA may positively regulate the production of these cytokines (99), or that miRNA are not involved in their regulation. However, upon transfection of pre-miR-146a, only fi ve of these cytokines/chemokines exhibited decreased production (IL-6, IP-10, IL-8, MCP-1, and IL-1 Table 3-1). This discrepancy in data could be due to the fact that some cytokines are directly regulated by miRNA or indirectly regulated by miRNA through other signaling pathways. On the other hand, the data show that major cytokines and chemokines (IL-6, IP-10, IL -8, MCP-1) induced by LPS in THP-1 cells do appear to be regulated by the major induced miRNA miR-146a (Table 3-1). The regulation of TNFand GM-CSF mRNA by miRNA is consistent with previous reports (118,119). These reports demonstrated that miR-16 was able to target the ARE in the 3 UTR of TNFmRNA (118), and that Dicer, an RNase III enzyme that cleaves pre-miRNA into mature miRNA, is required for the ARE-me diated degradation of GM-CSF mRNA (118,119). This led us to investigate whether the other cyt okines that were increased in response to miRNA depletion contained predicted miRNA binding sites or ARE in their mRNA. The number of predicted miRNA binding sites in each cytoki ne mRNA were compiled from two different miRNA databases. As shown in Table 3-1, the number of predicted miRNA binding sites for a particular mRNA can vary greatly between the different databases demonstrating the current 63

PAGE 64

limitation in these predictions. However, our data indicating miRNA-re gulation of cytokine production is overall consistent with the predicted miRNA bindi ng sites of these cytokines. There are some exceptions where our data indicate miRNA regulati on while there are no predicted miRNA binding sites and vice versa. These exceptions may be due to current limitations in accurately predicting miRNA binding sites in mRNA. In summary, our report has shown that GWB can serve as biomarkers for miRNA activity during innate immune signaling. We have demonstr ated that miRNA may play an important role in regulating human monocyte functions such as cytokine an d chemokine production. These findings may be clinically significant for patients suffering from autoimmune diseases such as systemic lupus erythematosus, Sjgrens syndrome, and rheumatoid arthritis that are driven by the overproduction of inflammatory cytokines, and further investig ations are needed to evaluate the therapeutic potent ial of these findings. This work has been submitted for publication in 2008 in Molecular Biology of the Cell 64

PAGE 65

Table 3-1. Potential miRNA regulation of cytokine/chemokine mRNAs in THP-1 cells. LPS induced Cytokine/Chemokinea ARE in 3UTRb Number of TargetScan predicted miRNA binding sitesd Number of miRBase predicted miRNA binding sitesf Decreased production in pre-miR146a transfected cellsg Increased production in miRNA depleted cellsh IL-6 yes 2 12 yes yes IP-10 no 2 17 yes yes IL-8 yes 0 10 yes no MCP-1 yesc 2 20 yes yes IL-12p40 yes 2 15 not detected no IFNyes 1 19 not detected no IL-10 yes 5 16 not detected yes IL-1 yes 0 19 yes yes IL-12p70 yes 1 18 not detected yes TNFyes 0e 19 no yes GM-CSF yes 2 13 not detected yes aListed in order of level of pr oduction as shown in Figure 7C. bCompiled using the Human AURich Element-Containing mRNA Database (ARED) 3.0 (129). cFrom reference (130). dConserved miRNA binding sites compiled from TargetScan 4.0 ( www.targetscan.org ) (41). eNo predicted conserved miRNA binding site s, 1 miRNA reported to target TNFmRNA (118). fCompiled from miRBase version 4 ( http://microrna.sanger.ac.uk ) (131). gData from Figure 6. hData from Fig 7D. 65

PAGE 66

Figure 3-1. Assembly of GWB is induced by LPS. (A) THP-1 cells treated with 1 g/ml LPS showed a time-dependent increase in th e number and size of GWB. After LPS treatment, cells were fixed and costaine d with human anti-GWB serum (green) and rabbit anti-Dcp1a (red). Nuclei were c ounterstained by 4,6-diam idino-2-phenylindole (DAPI, blue). Images were acquired at 400x original magnification. Images shown are representative of ten inde pendent experiments. Bar, 10 m. (B) Bar graph showing representative data from the CellP rofiler image analysis software used to quantitate the average number of foci per ce ll in untreated cells or LPS-treated cells for 0 to 24 hours after LPS incubation (n> 150 cells analyzed for each treatment). Asterisks (*) indicate P<0.001 compared to untreated control as determined by oneway ANOVA. 66

PAGE 67

Figure 3-2. Expression of GW B protein components in THP-1 cells unaffected by LPS treatment. (A) THP-1 cell extracts from LPS treated (+) or untreated (-) cells for each time point were compared using Western blot detection of Rck/p54, Dcp1a, Ago2 and actin, which is shown as a loading contro l. Representative data shown from 3 independent experiments. (B) Quantitative an alysis of 3 independent western blots. Rck/p54, Dcp1a and Ago2 protein levels were first normalized to tubulin protein, and then the fold change between LPS-treated and untreated samples was calculated. Average plus SD is shown. 67

PAGE 68

Figure 3-3. Stimulation with LPS induces upregulation of miR-146a miR-132, and miR-155. THP-1 cells were stimulated with 1 g/ml LPS for 4, 8, 12, or 24 hours or left untreated. RNA was isolated from cells and qRT-PCR analysis was performed as described in Methods. Fold change mi R-146a (A), miR-132 (B), and miR-155 (C) from LPS-treated cells compared to untreated cells cultured in parallel was calculated after normalization to let-7a expression. Average plus SD shown, n=3 independent experiments. Asterisks (*) indicate P<0.05 compared to untreated controls. 68

PAGE 69

Figure 3-4. Depletion of Rck/p54 and Ago2 results in loss of LPS-induced GWB assembly. (A) Reduction in protein levels of Rck/p54 a nd Ago2 demonstrated by using Western blot to compare mock transfected cells or cells transfected with siRNA targeting Rck/p54 or Ago2. Tubulin levels were included as a loading control. Cells were harvested 48 hours after transfection. For the mock transfected cells, 10, 30, and 100 indicate percent input of cell lysate. (B) LPSinduced GWB assembly was abolished by knockdown of Rck/p54 or Ago2. THP-1 cells we re transfected with siRNA targeting Rck/p54 or Ago2, or mock transfected, a nd then 48 hours later the cells were stimulated with 1 g/ml LPS for 0, 4, 8, or 24 hours. GWB were monitored by immunofluorescence and counted using CellProfiler image analysis software. Average plus SD is shown, n>250 cells anal yzed in two independent experiments. Asterisks (*) indicate P<0.001 compared to corresponding time point for mock transfected cells as determined by one-wa y ANOVA. Dashed line indicates average foci per cell in normal untreated cells. 69

PAGE 70

Figure 3-5. Transfection of mi R-146a alone can induce formation of GWB and repress TRAF6 and IRAK-1 mRNA. THP-1 cells were tran sfected with 30nM pre-miR-146a or Cy3labeled pre-miR negative control and inc ubated for 24 hours and compared to mock transfected cells. (A) GWB staining showed cells transfected with pre-miR-146a exhibited an increase in the number of GW B compared to mock and negative control (not shown). (B) GWB were counted usi ng CellProfiler image analysis software. Average and SEM is shown, n>300 cells an alyzed. Asterisks (*) indicate P<0.001 compared to mock transfected cells as determined by one-way ANOVA. (C) Total RNA was isolated from pre-miR-146a, ne gative control pre-miR, and mock transfected cells 48 hours after transfection and analyzed for TRAF6 and IRAK-1 expression by qRT-PCR as de scribed in Methods. Average plus SD is shown, n=2 independent experiments. 70

PAGE 71

Figure 3-6. Pre-transfection of miR-146a in THP-1 cells reduces LPS-induced cytokine/chemokine production. THP-1 cells were transfected with pre-miR-146a, incubated for 48 hours, and then treated with LPS for 24 hours. Culture supernatants were collected from LPS treated and untreated cells. Multiplex an alysis was used to quantitatively detect cytokines and chem okines as described in Methods. The cytokine/chemokine concentrations in LPS-treated culture supernatants were normalized to untreated culture supernatants and are shown in two scales. Mock represents level of cytokine s/chemokine induced by LPS alone after 24 hours. THP-1 cells transfected with pre-miR-146a exhibi ted decreased production of cytokines. Average plus SD is shown, n=2 independent experiments. 71

PAGE 72

Figure 3-7. Knockdown of TRAF6 or IRAK-1 results in decreased production of certain cytokines. A and C) siRNA targeting TR AF6 or IRAK-1 was transfected into THP-1 cells, and knockdown efficiency was determined using qRT-PCR. B and D) 48 hours after transfection, mock and TRAF6 or IRAK1 deficient cells were treated with LPS for 24 hours. Cytokine pr oduction was measured using a multiplex assay. Percent change between mock and TRAF6 deficient cells is shown. 72

PAGE 73

Figure 3-8. Depletion of miRNA results in increased LPS-induced cytokine production. Reduction of endogenous miRNA was ach ieved in THP-1 cells by siRNA knockdown of Drosha. (A) Reduction in leve l of Drosha protein shown by Western blot analysis comparing mock transfected cells with cells transfected with siRNA targeting Drosha. Golgin-97 levels are show n as loading control. (B) Comparison of miRNA levels in day 3 and 4 show Dros ha knockdown resulted in depletion of miRNA Let-7a and miR-146a after 4 days as determined by qRT-PCR described in Methods. All subsequent assays were performed 4 days after siRNA transfection. Mock 10, 30, and 100 indicate percent of RNA input from mock transfected cells. (C) Cytokine and chemokine production in LPS-treated control THP-1 cell culture supernatant after 48 hours. C ontrol cells were cultured in the presence or absence of LPS for 48 hours and their cultu re supernatants were harv ested. Multiplex analysis was used to detect cytokines/chemok ines as described in Methods. The 73

PAGE 74

cytokine/chemokine concentrations in LPS-treated culture supernatants were normalized to untreated culture supernatants and are shown in tw o scales. (D) The percent change in cytokine/chemokine production was calculated by comparing culture supernatants of miRNA-depleted and mock transfected control cells. 74

PAGE 75

Figure 3-9. Model of LPS-induced GWB assembly. See text in Discussion. 75

PAGE 76

CHAPTER 4 UPREGULATED MIR-146A EXPRESSION IN PERIPHERAL BLOOD MONONUCLEAR CELLS FROM RHEUMATOID ARTHRITIS PATIENTS Introduction Rheumatoid arthritis (RA) is a systemic autoimmune disorder characterized by chronic inflammation of synovial tissue which results in i rreversible joint damage (132). Inflammatory cytokines, including tumor necrosis factor(TNF) and interleukin-1 (IL-1 ), play an important role in RA pathogenesis, and inhibitio n of these cytokines can ameliorate disease in some patients (133,134). MicroRNA (miRNA) are small non-coding RNA mo lecules that negatively regulate gene expression at the post-transcriptiona l level (135,136). It is predicted that as much as one-third of all messenger RNAs (mRNAs) are targeted fo r miRNA-mediated regulation (3), and the importance of miRNA regulation is becoming increas ingly clear as new roles in critical cellular processes such as apoptosis, differentia tion, and the cell cycle are discovered. The biogenesis and maturation of miRNA are dependent on two RNase III enzymes, Drosha and Dicer. First, miRNA are transcri bed by RNA polymerase II into a long primary miRNA (pri-miRNA) transcript (10,11). The pr i-miRNA is then cleaved by Drosha and its partner protein DGCR8 into a ~70 nucleotide (n t) precursor miRNA (pre-miRNA) molecule (1216). The pre-miRNA is then exported into the cy toplasm via Exportin 5 where it is cleaved into a ~21 nucleotide miRNA duplex similar in struct ure to small interferin g RNA (siRNA) (20,21). One strand of the miRNA duplex is then loaded into the RNA-induced s ilencing complex (RISC) where it binds the 3 untranslated region (3UTR) of its target mRNA causing the degradation or translational repression of that mRNA (21). The key components of RISC are the argonaut e proteins 1-4 (Ago1-4) Ago2 is known to be the catalytic enzyme of RNA interference (RNAi) and is critical for both miRNA and siRNA 76

PAGE 77

function (25,26). In addition to Ago2, many othe r proteins are criti cal for miRNA function, including GW182 and Rck/p54. These proteins, as well as miRNA and siRNA, localize to cytoplasmic foci known as GW or P bodies (here referred to as GWB). Our recent studies have established GWB to be useful biomarkers for siRNA and miRNA activity in cells (36,39). Our latest study demonstrated that th e number and size of GWB signi ficantly increases concurrently with increased miRNA expressi on in lipopolysaccharide (LPS)-tre ated THP-1 cells, implicating that GWB can be monitored as biomarkers for miRNA activity (Pauley et al. in preparation). TNFstimulation has been shown to induce the expression of certain miRNA including miR-146a and miR-155, in monocytes and macrophages (40,42). Based on these data and the fact that TNFplays an important role in RA pathoge nesis as supported by the development of successful anti-TNFtherapies, we set out to examin e miRNA expression in RA patients compared to healthy controls. In this study, we obtained peripheral blood mononuclear cells (PBMCs) from RA patients and controls and examined the expre ssion of miR-146a, miR-155, miR-132, miR-16, and miRNA let-7a. These miRNA were chosen for examination based on previous reports linking them to immune stimulation by LPS or TNF, or in the case of miR-16, its ability to target the 3UTR of TNF(40,42,118). MiRNA let-7a was chosen as a control. This study is significant because it demonstrates that miRNA expressi on in RA PBMCs may mimic the conditions in synovial tissue, and thus enable us to bypass the need for synovi al tissue samples allowing for the analysis of larger patient populations. Material and Methods Patients and Controls Sixteen patients who fulfilled the American College of Rheumatology classification criteria for RA were included in the study. Their demographic and clinical information is 77

PAGE 78

included in Table 4-1. Four dis ease controls, including one SLE, two Sjgrens syndrome (SjS), and one systemic sclerosis (SSc), were incl uded. Nine healthy donors with no history of autoimmune disease were included as controls This study was approved by the University of Florida Institutional Review Board, and written permission was obtained from all subjects who participated in the study. Collection of PBMC and qRT-PCR Blood samples were collected in EDTA-tre ated tubes and PBMCs were isolated by standard Ficoll density-g radient centrifugation. PBMCs were wa shed once in sterile PBS before culture or RNA isolation. Total RNA was isol ated from freshly obtained PBMCs using the mir Vana miRNA Isolation kit (Ambion, Austin, TX ) according to the manufacturers protocol. RNA concentrations were determined and equa l amounts of each RNA sample were used for qRT-PCR. MiRNA qRT-PCR was performed using the TaqMan MicroRNA Reverse Transcription Kit, TaqMan Universal PCR Ma ster Mix, and TaqMan MicroRNA Assay primers for human miR-146a, miR-155, miR132, miR-16 and let-7a (Applied Biosystems, Foster City, CA ). mRNA qRT-PCR was performed usi ng the TaqMan High-Capacity cDNA Reverse Transcription Kit, TaqMan Fast PCR Master Mix, and TaqMan mRNA assay primers (Applied Biosystems). All reactions were analyzed using StepOne Real-Time PCR System (Applied Biosystems). The levels of miRNA were norma lized to U44 controls whereas mRNA levels were normalized to 18S RNA. The cycle thresh old (Ct) values, corresponding to the PCR cycle number at which fluorescence emission reaches a threshold above baseline emission, were determined and the relative miRNA or mRNA expression was calculated using the 2Ct method (126). 78

PAGE 79

Cell Culture and Cytokine Treatment THP-1 human monocytes obtained from Ameri can Type Culture Collection (Manassas, VA) were cultured in RPMI 1640 medium with 2 mM L-glutamine, 4.5 g/L glucose, 10 mM HEPES, 1.0 mM sodium pyruvate, 0.05 mM 2-mer captoethanol, and 10% fetal bovine serum. THP-1 cells were seeded at 5x105 cells per well in a six-well pl ate and treated with 10 ng/ml of TNF, IFN, IL-12p70, IL-4, IL-10 (BD Biosciences, San Jose, CA), IFN, IFN(PBL Interferon Source, New Brunswick, NJ), or MCSF (US Biological, Swampscott, MA). Cells were also treated with 25 ng/ml MCP-1 (Sigma) in serum free media. After designated treatment time, cells were harvested and wash ed once in PBS prior to analysis. Indirect Immunofluorescence (IIF) The THP-1 cells were cytospun onto glass slid es at 1,000 rpm for 5 minutes. PBMCs were cultured on glass slides at 37C for 1 hour. Ce lls were fixed in 3% paraformaldehyde for 10 minutes and permeabilized in 0.5% Triton X-100 fo r 5 minutes. GWB were detected in THP-1 cells with a human prototype an ti-GWB serum (28) used at 1: 6000 dilution, and in PBMCs with rabbit anti-Rck/p54 antibodies used at 1:500 di lution. TRAF6 and IRAK-1 were detected using rabbit anti-TRAF6 (1:50, Santa Cruz Biotechnol ogy, Santa Cruz, CA) and rabbit anti-IRAK-1 (1:50, Santa Cruz Biotechnology). Secondary antibodies used were Alexa Fluor 488 goat antihuman IgG or goat anti-rabbit IgG (1:400) from Molecular Probes (Carlsbad, CA). Slides were mounted using Vectashield Mounting Medium with 4,6-diamidino2-phenylindole (DAPI) (VECTOR Laboratories, Burlingame CA). Fluorescence images were taken with Zeiss Axiovert 200M microscope and a Zeiss AxioCam MRm camera using the 20x or 40x 0.75 NA objectives. Color images were assessed using Adobe Phot oshop version 7. GWB were counted using CellProfiler image analysis software (123). 79

PAGE 80

Transfection of siRNA The siRNAs targeting TRAF6 and IRAK-1 we re transfected into THP-1 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) accordi ng to the manufacturers instructions. To monitor the transfection efficiency, Cy3-labeled siRNA targeting lamin A/C was transfected into cells in parallel in all transf ections, and at least 80% transfection efficiency was achieved. The siRNAs used in this study were all purchased from Applied Biosystems. The sense and antisense strand sequences are listed below: IR AK-1: 5-GGUUUCGUCA CCCAAACAUtt-3 and 5AUGUUUGGGUGACGAAACCtg3; TRAF6: 5-GGUUGUUUGCACAAGAUGGtt-3 and 5-CCAUCUUGUGCAAACAACCtt-3. Multiplex Analysis of Cytokines The THP-1 cells were transfected as de scribed above, and then treated with 1 g/ml LPS ( Salmonella enterica serotype minnesota, Sigma, St. Louis, MO) for 24 hours in culture medium. The culture supernatant was then harvested and frozen at -80C for storage before multiplex analysis. The human cytokine/chemokine LI NCOplex premixed kit (LINCO Research, St. Charles, MO) was used according to the manufactur ers protocol to quantitatively detect human MCP-1and TNF. Results and Discussion Specific Cytokines/Chemokines Induce GWB in THP-1 Cells and Human PBMCs Since our previous work demonstrating that GWB can be used as biomarkers for miRNA activity (Pauley et al. in preparation), we began examining a variety of cytokines and chemokines for their ability to stimulate miR NA activity in human monocytic THP-1 cells. THP-1 cells were treat ed with 10 ng/ml TNF, IFN, IFN, IFN, IL-12p70, M-CSF, IL-4, and IL-10 or 25 ng/ml MCP-1 for four hours. IIF was performed using a human anti-GWB serum to detect GWB in the cells. As s hown in Figure 4-1A, the pro-inflammatory 80

PAGE 81

cytokines/chemokines TNF, IFN, IFN, IFN, and MCP-1 resulted in a significant increase in the number of GWB per cell co mpared to untreated cells cultu red in parallel (P<0.0001 as determined by one-way ANOVA). However, IL-12p70, M-CSF, IL-4 and IL-10 had no significant effect on the number of GWB. TNFelicited the strongest response in THP-1 cells with 4-fold increase in the average number of GWB per cell (Figure 4-1A and C). These experiments were repeated at least three times with reproducible results each time. Next, we decided to examine the effect of TNFstimulation on human PBMC GWB. GWB staining using human PBMCs from a hea lthy donor, after 4 hours stimulation with TNF(1 ng/ml) is shown. Similar to THP-1 cells, the number of GWB per cell in creased 3.5 fold after TNFstimulation of PBMCs (Figure 4-1B a nd C, P<0.0001 as determined by Mann Whitney test). This data indicates that THP-1 cells may be suitable to substitute for human PBMCs in some of the subsequent experiments. Increased Expression of miR-146a, miR-155, miR-132, and miR-16 in RA Patient PBMCs In Figure 4-1 we have shown that TNFis a potent inducer of GWB and therefore, miRNA activity. Our preliminary studies and work from other investigators have confirmed that TNFstimulation induces the e xpression of certain miRNA in cluding miR-146a and miR-155 (40,42). Based on these data a nd the important role of TNFin RA pathogenesis and therapies, we began to investigate the expression levels of miRNA in RA patients compared to healthy and disease controls. PBMCs were obtained from patients (n=17 RA, n=4 disease controls) and healthy donors (n=9) and isolated by Ficoll de nsity-gradient centrif ugation. Initially, RA PBMCs were monitored by IIF for GWB; however, we did not observe an increased number of GWB in RA compared to healthy controls (not shown). This discrepancy could be due to the limited sensitivity in th e quantitation of GWB. 81

PAGE 82

As shown in Figure 4-2A, the average relative expression of miR-146a, miR-155, miR132 and miR-16 was 2.6, 1.8, 2.0, and 1.9 fold, respectiv ely, higher for RA patients compared to healthy controls (P<0.01 for miR-146a, P<0.05 for miR-155, miR-132, and miR-16 as determined by one-way ANOVA). The expressi on of miRNA let-7a was not significantly different between RA patients and healthy cont rols (Figure 4-2A). Disease control miRNA expression resembled that of healthy controls. To examine the relationship between RA di sease activity and miRNA expression levels, patients were classified into inactive/remission and active patients based on C-reactive protein (CRP) and erythrocyte sedimenta tion rate (ESR) values. Three patients with normal CRP and ESR (Table 4-1) were classified as inactive, wh ile eight patients with el evated CRP and/or ESR (Table 4-1) were classified as active (Figure 4-2B). Those patients with incomplete or no available data were omitted (Table 4-1). MiR NA expression levels were compared between the groups. Interestingly, high miR-146a and miR-16 expression seemed to correlate with active disease, while low expression correlated w ith inactive disease (Figure 4-2B, p<0.05 as determined by t-test). Although larger patient popul ations are needed for this analysis, this data indicates that miR-146a and miR16 expression levels may be a useful marker of RA disease activity. Figure 4-2C shows miRNA expr ession of two samples from a single RA patient collected over a two month interval. The miRNA levels of this patient were largely unchanged over the two month interval, indicating that miRNA expression in RA patients may be consistent over time. In this patient, miR-146a, miR-155, and miR-132 expression was stable over this time period, while the expression of miR-16 and miR NA let-7a increased approximately 3.5 and 2.482

PAGE 83

fold, respectively. However, a larger patient pop ulation must be examined in order to validate this data. To further analyze the increased miRNA expr ession in these RA pa tients, we compared miR-146a, miR-155, and miR-132 expression levels with patient clinical and demographic information (Table 4-1) and found no significant trends or correlations between high expression levels and age, race, or medications. Patient s receiving no medications at the time of miRNA analysis exhibited the same trend of elevated miRNA expression indicating that treatment with medications is not responsible for the in creased miRNA expression in RA patients. Recently, two reports have shown increas ed miR-146 and miR-155 expression in RA synovial tissue and fibroblasts (137,138). Stanczyk et al. reported a 4-fold increase in miR-146a expression and a 2-fold increase in miR-155 expre ssion in RA synovial fibroblasts compared to osteoarthritis synovial fibroblasts, and demonstrated that miR-155 expression can repress the induction of matrix metalloproteinases 3 and 1 indicating that miR-155 may be involved in modulating the destructive properties of RA synovial fibroblasts (138 ). However, in this report, miR-155 expression from RA PBMC s was not significantly different from control PBMCs (138). This discrepancy could be due to differences in experimental techniques or patient populations. Nakasa et al. also reported an approximatel y 4-fold increase in miR-146a expression in RA synovial tissue (137). Our data demonstrate th at RA patient PBMCs e xhibit elevated miRNA expression in a similar manner to RA synovial tissue with a 2.6-fold increase in miR-146a expression and a 1.8-fold increase in miR-155 expr ession. Due to the invasiveness involved in collecting samples, monitoring miRNA expression in RA synovial tissue is, in most cases, limited to extremely severe patients undergoing joint surgery or replacement. Since blood 83

PAGE 84

collection is not invasive this allows for easy sample collection over time which is a distinct advantage when monitoring disease activity and treatment efficacy. Monocyte/Macrophage Population of RA PBMCs Exhibits Increased miRNA Expression Since PBMCs are composed of a mixed cel l population, the two main components of which are monocytes/macrophages and lymphocyt es, we wanted to determine which cell population in RA patients exhibits increased miRNA expression. PBMCs were isolated from RA patients (n=2) and incubated in tissue cu lture dishes at 37C for 1 hour. The monocyte/macrophage population adhered to the dish, while lymphocytes remained in suspension. The adherent cells were washed five times with sterile PBS, and the non-adherent cells were collected and washed with sterile PBS. The purity of the adherent population was approximately 80% as determined by microsco py. RNA was isolated from the cells, miRNA expression was analyzed by qRT-PCR, and the da ta was normalized with in the total group of patient and control samples. The expre ssion of miR-146a, miR-155, miR-132, and miR-16 was 2.8, 1.6, 4.2, and 3.4-fold higher, respectively, in m onocytes compared to lymphocytes (Figure 43, P<0.02 as determined by Mann-Whitney test). Let-7a expression was similar between monocytes and lymphocytes (not shown). Figur e 4-3B shows the average expression (miR-146a, miR-155, miR-132, and miR-16 combined) for the m onocyte and lymphocyte populations of two RA patients (P<0.02 as determined by Mann-Whitn ey test). These results suggest that monocytes/macrophages contribute to the increased miRNA expression observed in RA patients more than lymphocytes, but further studies need to be performed to confirm this observation. Expression of TRAF6 and IRAK-1 Is Simi lar Between RA Patients and Controls Since the majority of the RA patients exhibited increased expression of miR-146a compared to healthy and disease controls, we deci ded to examine the expression of two targets of 84

PAGE 85

miR-146a, TRAF6 and IRAK-1. TRAF6 and IRAK1 mRNA expression was analyzed by qRTPCR (Figure 4-4A and B). Since RA patients exhibited increased miR-146a production compared to controls, we expected to observe decreased TRAF6 and/or IRAK-1 expression in RA patients compared to controls, and overall the mRNA levels of TRAF6 and IRAK-1 do not exhibit the same degree of variability betw een patients that we observed with miRNA expression. This may indicate that TRAF6 and IRAK-1 transcripts are u nder other levels of control. However, TRAF6 and IRAK-1 mRNA expression was very similar between RA patients and controls. To confirm this discre pancy, we analyzed TR AF6 and IRAK-1 protein levels by IIF in one healthy control and one RA patient whose miR-146a level was increased (Figure 4-2A). PBMCs were processed for IIF as previously describe d and were stained for TRAF6 and IRAK-1. Image J software was used to quantify the relative level of fluorescence for at least 20 cells. As shown in Figure 4-4C there was no significant difference in TRAF6 or IRAK-1 protein levels between the RA patient and healthy control, which is consistent with the mRNA analysis. It is interesting to specula te that this lack of regulation of TRAF6/IRAK-1 by miR-146a could play a role in RA pathoge nesis, especially sin ce it has been reported that inhibition of IRAK-1 using antisense oligonucle otides results in decreased LPS-induced cytokine production (139) and our previous studies have shown that transfection of miR-146a into THP-1 monocytes results in knockdown of TRAF6 and IRAK-1 expression and inflammatory cytokine production. To further investigate this possibility, we tr ansfected siRNA targeting TRAF6 and/or IRAK-1 into THP-1 cells. The knockdown efficiency was determined by analyzing TRAF6 and IRAK-1 mRNA levels by qRT-PCR and at least 80% and 60% knockdown was achieved for TRAF6 and IRAK-1, respectively (Figure 4-5A). Two days after transfection, knockd own and control cells 85

PAGE 86

were treated with 1 g/ml LPS for 24 hours. Culture s upernatants were collected and cytokines/chemokines were quantitatively detected using a human cytokine multiplex assay. TNFproduction was drastically reduced in th e TRAF6 and/or IRAK-1 deficient cells compared to mock transfected cells (Figure 45B), while MCP-1 production was not affected by TRAF6 or IRAK-1 knockdown (Figure 4-5C). This data demonstrates that TRAF6 and IRAK-1 are required for the production of TNFin THP-1 cells. Taken together, it is reasonable to hypothesize that the absence of TRAF6/IRAK-1 regulation by mi R-146a in RA patients could contribute to the prolong ed production of TNFthat many of these patients exhibit. Furthermore, it would be interesting to invest igate the expression patte rns of miR-146a, TRAF6 and IRAK-1 in RA patients who are responsive to anti-TNFtherapy versus those who are not responsive. Clearly, further studies are needed to elucidate the role of miR-146a regulation in RA pathogenesis and the mechanism by whic h TRAF6/IRAK-1 escape miR-146a regulation. Conclusions In summary, this study has shown that RA patient PBMCs exhibit st atistically significant increased expression of miR-146a, miR-155, mi R-132 and miR-16 compared to healthy and disease controls. Furthermore, we demonstrat e that although miR-146a expression is increased in RA patients, levels of the two establis hed miR-146a targets TRAF6 and IRAK-1 in RA patients are similar to controls. We also show that TRAF6 and IRAK-1 regulation is important for TNFproduction in THP-1 cells. Normally, stimulus such as LPS or TNFwill induce the expression of miR-146a, miR155, and miR-132 in a NF B-dependent manner (40). In the case of miR-146a, this will lead to the negative regulation of TRAF6 and IRAK-1, which in turn will decrease the production of pro-inflammatory cytokines/chemokines including TNF. Thus the function of miR-146a, at least in part, is to control the extent of the stimulation such that the production of some of these 86

PAGE 87

pro-inflammatory cytokines/chemokines will not continue for an extended period of time. However, in RA patients, the increased miR-146a is unable to negativ ely regulate TRAF6 or IRAK-1 which may lead to prolonged TNFproduction and disease progression. While it is very exciting that two indepe ndent studies have shown increased miRNA expression in RA synovial tissue, analyzing miRNA expression in patient PBMCs presents a distinct advantage over analyz ing synovial tissue samples. Collection of PBMCs is noninvasive, and samples can be collected from patient s ranging in disease seve rity from early onset to more severe, while synovial tissue collecti on is biased towards patients with severe degenerative disease. With further validati ons and studies on larger patient populations, monitoring of selected miRNA co uld prove to be a valuable a ddition to RA diagnostics, or monitoring disease progression or treatment efficacy. The underlying mechanisms resulting in increased miRNA expression and inability of mi R-146a to regulate its targets need to be elucidated, and these mechanisms may be poten tial targets for the development of new RA therapies. This work has been submitted for publication in 2008 in Arthritis Research and Therapy 87

PAGE 88

Table 4-1. Demographic and clin ical information of patients* Subject Sex Age Medications CRP ESR RA Patients RA-1a1 M 65 None 4.142 9 RA-1b M 65 MTX 11.8 18 RA-2 F 33 Enbrel; Naproxen 25.7 18 RA-3 F 43 Enbrel No data No data RA-4 F 45 None 98.4 84 RA-5 F 55 MTX 4.8 26 RA-6 F 73 None 2.1 30 RA-7 F 51 Plaquenil; MTX; Prednisone No data 15 RA-8 M 61 Prednisone; MTX; Plaquenil; Azalfadine No data 1 RA-9 M 46 Medrol; MTX; Enbrel 2 9 RA-10 F 32 Arava 94.2 63 RA-11 F 50 Enbrel; MTX No data No data RA-12 M 67 MTX; Celebrex; Prednisone 0.6 11 RA-13 F 55 MTX No data 17 RA-14 F 33 Plaquenil; Motrin 2.8 7 RA-15 F 55 None 168.2 88 RA-16 F 56 Prednisone; Minocycline No data No data Disease controls SLE1 F 36 MTX; Plaquenil; Redinizine SjS1 F 30 Plaquenil; Cellcept SjS2 M 21 Plaquenil SSc1 F 57 Cyclosporine; Plaquenil; Prednisone; Cellcept *CRP= C-reactive protein; ESR= erythrocyte se dimentation rate; RA= rheumatoid arthritis; SLE= systemic lupus erythematosus; SjS= Sjgrens syndrome; SSc= scleroderma; MTX= methotrexate. 1Sample collected from RA-1 before and after MTX treatment. 2Normal value less than 0.8. Normal CRP<4.9 mg/L, normal ESR<20 mm/H for females, <10 mm/H for males. 88

PAGE 89

Figure 4-1. Stimulation with TNFresults in increased number of GWB in THP-1 and human PBMCs. A) THP-1 cells were treated with 10 ng/ml TNF, IFN, IFN, IFN, IL-12p70, M-CSF, IL-4, IL-10 or 25 ng/ml MC P-1 for four hours. IIF was performed using a human anti-GWB serum to detect GWB, and the number of GWB were counted using CellProfiler image analysis software. Average number of GWB per cell and SEM is shown. Asterisks (*) indicate P<0.0001 as determined by one-way ANOVA. B) Human PBMCs were obtained from a healt hy donor and isolated using Ficoll density-gradient centrifugation. The cel ls were then cultured four hours in the presence of 1 ng/ml TNF. GWB were detected by IIF using rabbit anti-Rck/p54 antibodies. Average number of GWB and SEM is shown. Asterisk (*) indicates P<0.0001 as determined by Mann-Whitney test C) IIF image of THP-1 and PBMCs treated with 10 ng/ml or 1 ng/ml TNFfor four hours, respectively. GWB shown in green, nuclei counterstained w ith DAPI (blue). Bar, 10 m. 89

PAGE 90

Figure 4-2. Aberrant expre ssion of miR-146a, miR-155, miR-132 and miR-16 is exhibited by RA patient PBMCs compared to healthy cont rols. A) RNA was isolated from healthy control (n=9), disease control (n=4) and RA patient (n=17) PBMCs, and relative expression levels of miR-146a, miR-155, miR-132, miR-16, and miRNA let-7a were analyzed by qRT-PCR using U44 RNA as an in ternal control. Average is indicated by bars. Asterisks (*) indi cate P<0.05, (**) indicates P<0.01 as determined by oneway ANOVA. For RA patients, closed circ les indicate patients undergoing anti-TNFtherapy at time of sample collectio n, squares indicate me thotrexate (MTX) treatment, and open circles indicate other or no treatment. B) Disease activity was determined for patients using CRP and ESR values and correlated with miRNA expression. Normal CRP and ESR values we re classified as inactive disease (n=3, Table 1, patients 9, 12, and 14), and higher than normal CRP or ESR values were classified as active disease (n=8, Tabl e 1, patients 1a, 1b, 2, 4, 5, 6, 10, and 15). Those patients with no or incomplete da ta for CRP/ESR values were omitted. Asterisk (*) indicates p<0.05 as determined by t-test. C) PBMCs were collected from patient RA-1 before (November, 2007) and after (January, 2008) MTX treatment and miRNA expression was examined using qRT-PCR. miRNA expr ession is largely consistent over time with the ex ception of increased miR-16 expression. 90

PAGE 91

Figure 4-3. Monocyte/macrophage fraction of PBMCs exhibit increased miRNA expression compared to lymphocyte fraction. PBMCs were collected from RA patients and separated into monocyte/macrophage and lymphocyte populations by allowing the monocytes/macrophages to adhere to a tissu e culture dish. A) miRNA expression was examined using qRT-PCR. SEM is shown, n=2 patients. B) Average expression of miR-146a, miR-155, miR-132 a nd miR-16 is shown for monocyte and lymphocyte populations for 2 RA patients. Asterisk (*) indicate P<0.02 as determined by Mann-Whitney test. SEM is shown. 91

PAGE 92

Figure 4-4. Expression levels of TRAF6 and IRAK-1 are similar between RA patients, healthy controls and disease controls. RNA was isol ated from healthy c ontrol (n=9), disease control (n=4) and RA patient (n=14) PBMC s and mRNA expression levels of TRAF6 (A) and IRAK-1 (B) were analyzed using qRT-PCR. C) PBMCs isolated from a healthy control and RA patient were incuba ted on glass slides for 1 hour at 37C. The adhered cells were fixed and permeab ilized in 3% paraformaldehyde and 0.5% Triton X-100, respectively. Protein levels of TRAF6 and IRAK-1 were analyzed by immunofluorescence using rabbit anti-T RAF6 and anti-IRAK-1 antibodies, and relative fluorescence was determined using Im ageJ analysis software. SEM is shown, n> 20 cells. 92

PAGE 93

Figure 4-5. Knockdown of TRAF6 and/or IRAK-1 results in decreased TNFproduction in THP-1 cells. THP-1 cells were transfect ed with siRNA targeting TRAF6 and/or IRAK-1. A) 48 hours after transfection, mR NA levels of TRAF6 and IRAK-1 were analyzed by qRT-PCR and normalized to mock transfected cells. SEM shown, n=2. After knockdown of TRAF6 and/or IRAK-1 wa s confirmed by qRT-PCR, cells were treated with 1 g/ml LPS for 24 hours and culture supernatants were collected. Multiplex assay was used to quantitatively detect TNF(B) and MCP-1 (C). 93

PAGE 94

CHAPTER 5 CONCLUSIONS Formation of GWB is a Cons equence of miRNA Genesis This study first examined the relationship between GWB and miRNA. Previous to our study, GWB were believed to be involved in mRNA storage and/or degr adation and were only linked to RNAi by the localizat ion of RNAi and miRNA-relate d proteins such as GW182 and Ago2. Our study set out to further characteri ze the role of GWB in the endogenous miRNA pathway. We found that endoge nous let-7 miRNA co-precipitated with the GW182 protein complex, and that miRNA transfected into ce lls localizes to GWB (36). Depletion of endogenous miRNA was achieved by knocking down Drosha or its partne r protein DGCR8, both of which are critical for the generation of mature miRNA, an d resulted in the loss of GWB formation (36). However, subse quent introduction of siRNA targ eting lamin A/C as a surrogate for miRNA resulted in the reappearance of GWB and the concurrent knockdown of lamin A/C protein (36). These data indica te that GWB formation is depe ndent on the presence of small RNA (siRNA or miRNA) in the cells. This work has significantly contributed to the understanding of the role of GWB in miRNA function within the cell. This study wa s performed in a mammalian cell system and published in EMBO Reports in 2006 (36), and recently, anothe r group has reproduced our results in Drosophila cells. Eulalio et al. depleted miRNA from Drosophila S2 cells by using siRNA to knock down Drosha or Pasha, the Drosophila ortholog of DGCR8, and found that GWB were disassembled (116). They go on to propose that in Drosophila, GWB are a consequence of miRNA and siRNA activity, theref ore disrupting the siRNA or miRNA pathway at any step prevents the formation of GWB (116). Nota bly, this group uses siRNA to knockdown Drosha and Pasha compared to our technique of using shRNA to knockdown these genes. 94

PAGE 95

In the mammalian system, further studies need to be performed in order to determine whether or not GWB are required for miRNA function, or if they form as a result of miRNA. However, sometimes in vitro manipulations do not yield an accurate depiction of in vivo cellular conditions. For example, in Drosophila, GWB ar e not required for mi RNA/siRNA function as demonstrated by the functionality of RNA-mediated gene silencing in ce lls lacking detectable microscopic GWB (116). In vivo however, GWB form in order to provide a microenvironment for this process. One can argue that despite the l ack of requirement for GWB in miRNA/siRNA function under artificial in vitro conditions, the important f act of the matter is that in vivo GWB formation does occur in response to miRNA/siRNA activity, perhaps in order to allow for these processes to occur more efficiently by localizing all of the proteins involved to one cytoplasmic foci rather than having them scattered throughout the cytoplasm. Formation of GW/P Bodies as Marker for mi RNA-Mediated Regulation of Innate Immune Signaling The next part of this study examined the e ffects of LPS stimulation of human monocytes on GWB formation, miRNA induction, miRNA target regulation, and downstream cytokine and chemokine expression. We found that the numbe r and size of GWB significantly increased in response to LPS stimulation and this increase was abolished when the miRNA-effector proteins Rck/p54 or Ago2 were depleted (140). When miRNA was depleted in THP-1 cells by knocking down Drosha, cytokine pr oduction was significantly altered ( 140). Since the level of miR-146a increased by 100 fold during LPS stimulation, we examined the transfection of precursor miR146a alone and showed similar increases in GW B and reduction in major cytokines/chemokines induced by LPS, implicating that miR-146a alone could be responsible fo r this effect (140). These data show that the size and number of GWB serve as a biomarker for miRNA mediated 95

PAGE 96

gene regulation, and miRNA play a significant role in the regulation of LPS-induced cytokine production in human monocytes. The ability to monitor GWB as markers for miRNA activity provides a useful technique for screening different treatments or cellular conditions for their e ffect on miRNA activity before performing costly and time consuming microarray studies. We have empl oyed this technique to screen various cytokines and chemokines for th eir ability to induce miRNA activity (Figure 41A). This study, which has been submitted for publication in Molecular Biology of the Cell is the first to demonstrate that miRNA plays a role in regulating LPS-induc ed cytokine/chemokine production in monocytes. This finding is signifi cant since the regulation of cytokine/chemokine production is critical in maintaining normal imm une function. Overproduction of inflammatory cytokines/chemokines can result in cellular da mage and apoptosis, and plays a role in the pathogenesis of many autoimmune diseases such as SLE and RA. Regulation of this process by miRNA permits for the fine-tuning of the inflammatory response. Based on our data shown in Figure 3-3, that expression of miR-146a is increased up to 100-fold after 24 hours of LPS stim ulation, it is interesting to sp eculate that miR-146a may also play a role in endotoxin tolerance. Endotoxi n tolerance is a well known phenomenon in which repeated exposure to endotoxin results in a diminished immune response, usually characterized by a reduction in pro-inflammatory cytokine pr oduction (141). This phenomenon is thought to have developed as a protective evolutiona ry mechanism to prevent death caused by overwhelming cytokine release in se psis (141). Interestingly, a recent report demonstrated that in PBMCs from young rats, IRAK-1 expressi on is decreased under endotoxin tolerance conditions (142). Since we have demonstrated that miR-146a leve ls are high up to 24 hours after 96

PAGE 97

LPS stimulation, and we have shown that mi R-146a can negatively regulate IRAK-1, it is possible that miR-146a regulation is important for endotoxin tolerance. However, further work is needed to determine if this hypothesis is correct. Upregulation of miR-146a Expression in Peripheral Blood Mononuclear Cells From Rheumatoid Arthritis Patients In the final part of this study, the expressi on of selected miRNA was examined in RA. Total RNA was isolated from PBMCs obtained from RA patients, healthy, and disease controls and the expression of miR-146a, miR-155, miR132, miR-16, and miRNA let-7a was analyzed using qRT-PCR. RA PBMCs exhibited between 1.8 to 2.6 fold increase in miR-146a, miR-155, miR-132, and miR-16 expression, wh ile let-7a expression was not significantly different compared to healthy controls. In addition, two targets of miR-146a, TRAF6 and IRAK-1, were similarly expressed between RA patients and controls, despite the increa sed expression of miR146a in RA patients. Repression of TRAF6 and/or IRAK-1 in THP-1 cells resulted in up to an 86% reduction in TNFproduction, implicating that normal miR-146a function is critical for the regulation of TNFproduction. These data suggest a possible mechanism contributing to RA pathogenesis where miR-146a expression is increased but unable to properly function, leading to prolonged TNFproduction in RA patients. Recent studies have shown that RA patient synovial tissue and synovi al fibroblasts exhibit increase d expression of certain miRNA. Our data thus demonstrate that miRNA expression in RA PBMCs mimics that of synovial tissue/fibroblasts. The increased miRNA expressi on in RA patients is potentially useful as a marker for disease diagnosis, pr ogression, or treatment efficacy. This study, which has been submitted for publication in Arthritis Research and Therapy is significant for several reasons. First, this is the first study to demonstrate differential miRNA expression in RA PBMCs. With further validations and studie s on larger patient populations, 97

PAGE 98

monitoring of selected miRNA co uld prove to be a valuable a ddition to RA diagnostics, or monitoring disease progression or tr eatment efficacy. Second, we have demonstrated a defect in miR-146as ability to regulate TRAF6 and IRAK-1 in RA patients. Th is defective regulation could lead to prolonged and increased TNFproduction and disease prog ression in RA patients. Finally, we have shown that miRNA expressi on in RA PBMCs may mimic that of synovial tissue or fibroblasts. Analyzing miRNA expression in patient PBMCs presents a distinct advantage over analyzing synovial tissue sample s since collection of PBMCs is non-invasive, and samples can be collected from patients ranging in disease severity from early onset to more severe, while synovial tissue collection is biased towards patients with severe degenerative disease. 98

PAGE 99

REFERENCES 1. Griffiths-Jones, S. 2004. The microRNA Registry. Nucleic. Acids. Res. 32:D109-D111. 2. Griffiths-Jones, S., R. J. Grocock, S. van Dongen, A. Bateman, and A. J. Enright. 2006. miRBase: microRNA sequences, targ ets and gene nomenclature. Nucleic. Acids. Res. 34:D140-D144. 3. Lewis, B. P., C. B. Burge, and D. P. Bartel. 2005. Conserved seed pairing, often flanked by adenosines, indicates th at thousands of human ge nes are microRNA targets. Cell. 120:15-20. 4. Kim, V. N., and J. W. Nam. 2006. Genomics of microRNA. Trends. Genet. 22:165-173. 5. Kim, Y. K., and V. N. Kim. 2007. Processing of intronic microRNAs. EMBO. J. 26:775783. 6. Rodriguez, A., S. Griffiths-Jones, J. L. Ashurst, and A. Brad ley. 2004. Identification of mammalian microRNA host gene s and transcription units. Genome. Res. 14:1902-1910. 7. Lee, R. C., R. L. Feinbaum, and V. Am bros. 1993. The C. elegans heterochronic gene lin4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843-854. 8. Reinhart, B. J., F. J. Slack, M. Basson, A. E. Pasquinelli, J. C. Bettinger, A. E. Rougvie, H. R. Horvitz, and G. Ruvkun. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 403:901-906. 9. Ambros, V., and R. C. Lee. 2004. Identif ication of microRNAs and other tiny noncoding RNAs by cDNA cloning. Methods. Mol. Biol. 265:131-158. 10. Cai, X., C. H. Hagedorn, and B. R. Cu llen. 2004. Human microRNAs are processed from capped, polyadenylated transcripts th at can also function as mRNAs. RNA. 10:19571966. 11. Lee, Y., M. Kim, J. Han, K. H. Yeom, S. Lee, S. H. Baek, and V. N. Kim. 2004. MicroRNA genes are transcribed by RNA polymerase II. EMBO. J. 23:4051-4060. 12. Denli, A. M., B. B. Tops, R. H. Plasterk, R. F. Ketting, and G. J. Hannon. 2004. Processing of primary microRNAs by the Microprocessor complex. Nature. 432:231-235. 13. Gregory, R. I., K. P. Yan, G. Amuthan, T. Chendrimada, B. Doratotaj, N. Cooch, and R. Shiekhattar. 2004. The Microprocessor complex mediates the genesis of microRNAs. Nature. 432:235-240. 14. Han, J., Y. Lee, K. H. Yeom, Y. K. Kim, H. Jin, and V. N. Kim. 2004. The DroshaDGCR8 complex in primary microRNA processing. Genes. Dev. 18:3016-3027. 99

PAGE 100

15. Landthaler, M., A. Yalcin, and T. Tu schl. 2004. The human DiGeorge syndrome critical region gene 8 and Its D. me lanogaster homolog are required for miRNA biogenesis. Curr. Biol. 14:2162-2167. 16. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature. 425:415-419. 17. Lund, E., S. Guttinger, A. Calado, J. E. Dahlberg, and U. Kutay. 2004. Nuclear export of microRNA precursors. Science. 303:95-98. 18. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes. Dev. 17:3011-3016. 19. Zeng, Y., and B. R. Cullen. 2004. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5. Nucleic. Acids. Res. 32:4776-4785. 20. Du, T., and P. D. Zamore. 2005. microPrimer: the biogenesis and function of microRNA. Development. 132:4645-4652. 21. Filipowicz, W., S. N. Bhattacharyya, and N. Sonenberg. 2008. Mechanisms of posttranscriptional regulation by microRNAs: are the answers in sight? Nat. Rev. Genet. 9:102-114. 22. Ruby, J. G., C. H. Jan, and D. P. Bartel. 2007. Intronic microRNA precursors that bypass Drosha processing. Nature. 448:83-86. 23. Berezikov, E., W. J. Chung, J. Willis, E. Cuppen, and E. C. Lai. 2007. Mammalian mirtron genes. Mol. Cell. 28:328-336. 24. Okamura, K., J. W. Hagen, H. Duan, D. M. Tyler, and E. C. Lai. 2007. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell. 130:89-100. 25. Meister, G., M. Landthaler, A. Patkanio wska, Y. Dorsett, G. Teng, and T. Tuschl. 2004. Human Argonaute2 mediat es RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell. 15:185-197. 26. Liu, J., M. A. Carmell, F. V. Rivas, C. G. Marsden, J. M. Thomson, J. J. Song, S. M. Hammond, L. Joshua-Tor, and G. J. Hannon. 2004. Argonaute2 is the catalytic engine of mammalian RNAi. Science. 305:1437-1441. 27. Pillai, R. S., C. G. Artus, and W. Filip owicz. 2004. Tethering of human Ago proteins to mRNA mimics the miRNA-mediated repression of protein synthesis. RNA. 10:15181525. 28. Eystathioy, T., E. K. L. Chan, S. A. Tene nbaum, J. D. Keene, K. Griffith, and M. J. Fritzler. 2002. A phosphorylated cytoplasmic autoantigen, GW182, associates with a 100

PAGE 101

unique population of human mRNAs with in novel cytoplasmic speckles. Mol. Biol. Cell. 13:1338-1351. 29. Bhanji, R. A., T. Eystathioy, E. K. L. Chan, D. B. Bloch, and M. J. Fritzler. 2007. Clinical and serological f eatures of patients with autoantibodies to GW/P bodies. Clin. Immunol. 125:247-256. 30. Ingelfinger, D., D. J. Arndt-Jovin, R. Luhrmann, and T. Achsel. 2002. The human LSm17 proteins colocalize with the mRNA-degradi ng enzymes Dcp1/2 and Xrnl in distinct cytoplasmic foci. RNA. 8:1489-1501. 31. Sheth, U., and R. Parker. 2003. Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science. 300:805-808. 32. van Dijk, E., N. Cougot, S. Meyer, S. Babajko, E. Wahle, and B. Seraphin. 2002. Human Dcp2: a catalytically active mRNA decapping enzyme located in specific cytoplasmic structures. EMBO. J. 21:6915-6924. 33. Yang, Z., A. Jakymiw, M. R. Wood, T. Eystathioy, R. L. Rubin, M. J. Fritzler, and E. K. L. Chan. 2004. GW182 is critical for the stabil ity of GW bodies expr essed during the cell cycle and cell proliferation. J. Cell. Sci. 117:5567-5578. 34. Jakymiw, A., S. Lian, T. Ey stathioy, S. Li, M. Satoh, J. C. Hamel, M. J. Fritzler, and E. K. L. Chan. 2005. Disruption of GW bodies impairs mammalian RNA interference. Nat. Cell. Biol. 7:1267-1274. 35. Liu, J., M. A. Valencia-Sanchez, G. J. Hannon, and R. Parker. 2005. MicroRNAdependent localization of target ed mRNAs to mammalian P-bodies. Nat. Cell. Biol. 7:719-723. 36. Pauley, K. M., T. Eystathioy, A. Jakymiw, J. C. Hamel, M. J. Fritzler, and E. K. L. Chan. 2006. Formation of GW bodies is a consequence of miRNA genesis. EMBO. Rep. 7:904910. 37. Pillai, R. S., S. N. Bhattacharyya, C. G. Artus, T. Zoller, N. Cougot, E. Basyuk, E. Bertrand, and W. Filipowicz. 2005. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science. 309:1573-1576. 38. Sen, G. L., and H. M. Blau. 2005. Argona ute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat. Cell. Biol. 7:633-636. 39. Lian, S., M. J. Fritzler, J. Katz, T. Ham azaki, N. Terada, M. Satoh, and E. K. L. Chan. 2007. Small Interfering RNA-mediated Silencin g Induces Target-dependent Assembly of GW/P Bodies. Mol. Biol. Cell. 18:3375-3387. 40. Taganov, K. D., M. P. Boldin, K. J. Chang, and D. Baltimore. 2006. NF-B-dependent induction of microRNA miR-146, an inhibitor ta rgeted to signaling proteins of innate immune responses. Proc. Natl. Acad. Sci. U S. A. 103:12481-12486. 101

PAGE 102

41. Grimson, A., K. K. Farh, W. K. Johnston, P. Garrett-Engele, L. P. Lim, and D. P. Bartel. 2007. MicroRNA targeting specificity in mamma ls: determinants beyond seed pairing. Mol. Cell. 27:91-105. 42. O'Connell, R. M., K. D. Taganov, M. P. Boldin, G. Cheng, and D. Baltimore. 2007. MicroRNA-155 is induced during the m acrophage inflammatory response. Proc. Natl. Acad. Sci. U S. A. 104:1604-1609. 43. Tili, E., J. J. Michaille, A. Cimino, S. Costinean, C. D. Dumitru, B. Adair, M. Fabbri, H. Alder, C. G. Liu, G. A. Calin, and C. M. Croce. 2007. Modulation of miR-155 and miR125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the respon se to endotoxin shock. J. Immunol. 179:5082-5089. 44. O'Connell, R. M., D. S. Rao, A. A. Chaudhur i, M. P. Boldin, K. D. Taganov, J. Nicoll, R. L. Paquette, and D. Baltimore. 2008. Sust ained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. J. Exp. Med. 205:585-594. 45. Chen, X. M., P. L. Splinter, S. P. O'ha ra, and N. F. Larusso. 2007. A cellular miRNA, let7i, regulates toll-like receptor 4 expressi on and contributes to cholangiocyte immune responses against Cryptos poridium parvum infection. J. Biol. Chem. 282:28929-28938. 46. Tam, W., D. Ben-Yehuda and W. S. Hayward. 1997. bic, a novel gene activated by proviral insertions in avian leukosis virus-induced lym phomas, is likely to function through its noncoding RNA. Mol. Cell. Biol. 17:1490-1502. 47. Tam, W. 2001. Identification and characte rization of human BIC, a gene on chromosome 21 that encodes a noncoding RNA. Gene. 274:157-167. 48. Haasch, D., Y. W. Chen, R. M. Reilly, X. G. Chiou, S. Koterski, M. L. Smith, P. Kroeger, K. McWeeny, D. N. Halbert, K. W. Mollison, S. W. Djuric, and J. M. Trevillyan. 2002. T cell activation induces a noncoding RNA transcript sensitive to inhibition by immunosuppressant drugs a nd encoded by the proto-oncogene, BIC. Cell. Immunol. 217:78-86. 49. van den Berg, A., B. J. Kroesen, K. Kooi stra, D. de Jong, J. Briggs, T. Blokzijl, S. Jacobs, J. Kluiver, A. Diepstra, E. Maggio, and S. Poppema. 2003. High expression of Bcell receptor inducible gene BIC in all subtypes of Hodgkin lymphoma. Genes. Chromosomes. Cancer. 37:20-28. 50. Costinean, S., N. Zanesi, Y. Pekarsky, E. Tili, S. Volinia, N. Heerema, and C. M. Croce. 2006. Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. Proc. Natl. Acad. Sci. U S. A. 103:7024-7029. 51. Kluiver, J., S. Poppema, D. de Jong, T. Blokzijl, G. Harms, S. Jacobs, B. J. Kroesen, and A. van den Berg. 2005. BIC and miR-155 ar e highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas. J. Pathol. 207:243-249. 102

PAGE 103

52. Metzler, M., M. Wilda, K. Busc h, S. Viehmann, and A. Borkhardt. 2004. High expression of precursor micr oRNA-155/BIC RNA in childre n with Burkitt lymphoma. Genes. Chromosomes. Cancer. 39:167-169. 53. Rodriguez, A., E. Vigorito, S. Clare, M. V. Warren, P. Couttet, D. R. Soond, S. van Dongen, R. J. Grocock, P. P. Das, E. A. Mi ska, D. Vetrie, K. Okkenhaug, A. J. Enright, G. Dougan, M. Turner, and A. Bradley. 2007. Requirement of bic/microRNA-155 for normal immune function. Science. 316:608-611. 54. Thai, T. H., D. P. Calado, S. Casola, K. M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. Frendewey, D. Valenzuela, J. L. Kutok, M. Schmidt-Supprian, N. Rajewsky, G. Yancopoulos, A. Rao, and K. Rajewsky. 2007. Regulation of the germinal center response by microRNA-155. Science. 316:604-608. 55. Vigorito, E., K. L. Perks, C. breu-Goodger, S. Bunting, Z. Xiang, S. Kohlhaas, P. P. Das, E. A. Miska, A. Rodriguez, A. Bradley, K. G. Smith, C. Rada, A. J. Enright, K. M. Toellner, I. C. Maclennan, and M. Turner 2007. microRNA-155 regulates the generation of immunoglobulin class-switched plasma cells. Immunity. 27:847-859. 56. Neilson, J. R., G. X. Zheng, C. B. Burg e, and P. A. Sharp. 2007. Dynamic regulation of miRNA expression in ordered stages of cellular development. Genes. Dev. 21:578-589. 57. Wu, H., J. R. Neilson, P. Kumar, M. Manocha, P. Shankar, P. A. Sharp, and N. Manjunath. 2007. miRNA Profiling of Naive, Effector and Memory CD8 T Cells. PLoS. ONE. 2:e1020. 58. Zhou, B., S. Wang, C. Mayr, D. P. Bart el, and H. F. Lodish. 2007. miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely. Proc. Natl. Acad. Sci. U S. A. 104:7080-7085. 59. Chen, C. Z., L. Li, H. F. Lodish, and D. P. Bartel. 2004. MicroRNAs modulate hematopoietic lineage differentiation. Science. 303:83-86. 60. Li, Q. J., J. Chau, P. J. Ebert, G. Sylv ester, H. Min, G. Liu, R. Braich, M. Manoharan, J. Soutschek, P. Skare, L. O. Klein, M. M. Davis, and C. Z. Chen. 2007. miR-181a is an intrinsic modulator of T ce ll sensitivity and selection. Cell. 129:147-161. 61. Fazi, F., A. Rosa, A. Fatica, V. Gelmetti, M. L. De Marchis, C. Nervi, and I. Bozzoni. 2005. A minicircuitry comprised of microRNA-223 and transc ription factors NFI-A and C/EBPalpha regulates human granulopoiesis. Cell. 123:819-831. 62. Fukao, T., Y. Fukuda, K. Kiga, J. Sharif, K. Hino, Y. Enomoto, A. Kawamura, K. Nakamura, T. Takeuchi, and M. Tanabe. 2007. An evolutionarily conserved mechanism for microRNA-223 expression reveal ed by microRNA gene profiling. Cell. 129:617-631. 63. Xiao, C., D. P. Calado, G. Galler, T. H. Thai, H. C. Patterson, J. Wang, N. Rajewsky, T. P. Bender, and K. Rajewsky. 2007. MiR-150 controls B cell differentiation by targeting the transcription factor c-Myb. Cell. 131:146-159. 103

PAGE 104

64. Lecellier, C. H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A. Saib, and O. Voinnet. 2005. A cellular microRNA medi ates antiviral defense in human cells. Science. 308:557-560. 65. Pedersen, I. M., G. Cheng, S. Wieland, S. Volinia, C. M. Croce, F. V. Chisari, and M. David. 2007. Interferon modulation of cellular microRNAs as an antiviral mechanism. Nature. 449:919-922. 66. Jopling, C. L., M. Yi, A. M. Lancaste r, S. M. Lemon, and P. Sarnow. 2005. Modulation of hepatitis C virus RNA abundan ce by a liver-specific MicroRNA. Science. 309:15771581. 67. Cai, X., S. Lu, Z. Zhang, C. M. Gonzalez, B. Damania, and B. R. Cullen. 2005. Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. U S. A. 102:5570-5575. 68. Pfeffer, S., A. Sewer, M. Lagos-Quintana, R. Sheridan, C. Sander, F. A. Grasser, L. F. van Dyk, C. K. Ho, S. Shuman, M. Chien, J. J. Russo, J. Ju, G. Randall, B. D. Lindenbach, C. M. Rice, V. Simon, D. D. Ho, M. Zavolan, and T. Tuschl. 2005. Identification of microRNAs of the herpesvirus family. Nat. Methods. 2:269-276. 69. Samols, M. A., J. Hu, R. L. Skalsky, and R. Renne. 2005. Cloning and identification of a microRNA cluster within the latency-associ ated region of Kaposi's sarcoma-associated herpesvirus. J. Virol. 79:9301-9305. 70. Samols, M. A., R. L. Skalsky, A. M. Maldona do, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Identification of cellular genes targeted by KSHV-encoded microRNAs. PLoS. Pathog. 3:e65. 71. Skalsky, R. L., M. A. Samols, K. B. Plaisan ce, I. W. Boss, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J. Virol. 81:12836-12845. 72. Pfeffer, S., M. Zavolan, F. A. Grasser, M. Chien, J. J. Russo, J. Ju, B. John, A. J. Enright, D. Marks, C. Sander, and T. Tuschl. 2004. Identification of virus-encoded microRNAs. Science. 304:734-736. 73. Stern-Ginossar, N., N. Elefant, A. Z immermann, D. G. Wolf, N. Saleh, M. Biton, E. Horwitz, Z. Prokocimer, M. Prichard, G. Hahn, D. Goldman-Wohl, C. Greenfield, S. Yagel, H. Hengel, Y. Altuvia, H. Margalit, and O. Mandelboim. 2007. Host immune system gene targeting by a viral miRNA. Science. 317:376-381. 74. Iorio, M. V., M. Ferracin, C. G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Campiglio, S. Menar d, J. P. Palazzo, A. Rosenberg, P. Musiani, S. Volinia, I. Nenci, G. A. Calin, P. Querzoli, M. Negrini, and C. M. Croce. 2005. MicroRNA gene expression deregu lation in human breast cancer. Cancer. Res. 65:70657070. 104

PAGE 105

75. Volinia, S., G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueitt, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce. 2006. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc. Natl. Acad. Sci. U S. A. 103:2257-2261. 76. Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto, M. Yi, R. M. Stephens, A. Okamoto, J. Yokota, T. Tanaka, G. A. Cali n, C. G. Liu, C. M. Croce, and C. C. Harris. 2006. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer. Cell. 9:189-198. 77. Martin, M. M., E. J. Lee, J. A. Buckenberger, T. D. Schmittgen, and T. S. Elton. 2006. MicroRNA-155 regulates human angiotensin II type 1 receptor expression in fibroblasts. J. Biol. Chem. 281:18277-18284. 78. Eis, P. S., W. Tam, L. Sun, A. Chadbu rn, Z. Li, M. F. Gomez, E. Lund, and J. E. Dahlberg. 2005. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc. Natl. Acad. Sci. U S. A. 102:3627-3632. 79. Calin, G. A., C. D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, L. Rassenti, T. Ki pps, M. Negrini, F. Bullrich, and C. M. Croce. 2002. Frequent deletions and down-re gulation of microRNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. U S. A. 99:15524-15529. 80. Cimmino, A., G. A. Calin, M. Fabbri, M. V. Iorio, M. Ferracin, M. Shimizu, S. E. Wojcik, R. I. Aqeilan, S. Zupo, M. Dono, L. Rassenti, H. Alder, S. Volinia, C. G. Liu, T. J. Kipps, M. Negrini, and C. M. Croce. 2005. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Natl. Acad. Sci. U S. A. 102:13944-13949. 81. Tanzer, A., and P. F. Stadler. 2004. Mo lecular evolution of a microRNA cluster. J. Mol. Biol. 339:327-335. 82. He, L., J. M. Thomson, M. T. Hemann, E. Hernando-Monge, D. Mu, S. Goodson, S. Powers, C. Cordon-Cardo, S. W. Lowe, G. J. Hannon, and S. M. Hammond. 2005. A microRNA polycistron as a potential human oncogene. Nature. 435:828-833. 83. Venturini, L., K. Battmer, M. Castoldi, B. Schultheis, A. Hochhaus, M. U. Muckenthaler, A. Ganser, M. Eder, and M. Scherr. 2007. Expression of the miR-17-92 polycistron in chronic myeloid leukemia (CML) CD34+ cells. Blood. 109:4399-4405. 84. Xiao, C., L. Srinivasan, D. P. Calado, H. C. Patterson, B. Zhang, J. Wang, J. M. Henderson, J. L. Kutok, and K. Rajews ky. 2008. Lymphoproliferative disease and autoimmunity in mice with increased miR-17-92 expression in lymphocytes. Nat. Immunol. 9:405-414. 85. Akao, Y., Y. Nakagawa, and T. Naoe. 2006. let-7 microRNA functions as a potential growth suppressor in hu man colon cancer cells. Biol. Pharm. Bull. 29:903-906. 105

PAGE 106

86. Johnson, S. M., H. Grosshans, J. Shingara, M. Byrom, R. Jarvis, A. Cheng, E. Labourier, K. L. Reinert, D. Brown, and F. J. Slack. 2005. RAS is regulated by the let-7 microRNA family. Cell. 120:635-647. 87. Takamizawa, J., H. Konishi, K. Yanagisawa, S. Tomida, H. Osada, H. Endoh, T. Harano, Y. Yatabe, M. Nagino, Y. Nimura, T. Mitsudomi, and T. Takahashi. 2004. Reduced expression of the let-7 microRNAs in human lung cancers in associa tion with shortened postoperative survival. Cancer. Res. 64:3753-3756. 88. Yu, F., H. Yao, P. Zhu, X. Zhang, Q. Pan, C. Gong, Y. Huang, X. Hu, F. Su, J. Lieberman, and E. Song. 2007. let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell. 131:1109-1123. 89. Abelson, J. F., K. Y. Kwan, B. J. O'Roak, D. Y. Baek, A. A. Stillman, T. M. Morgan, C. A. Mathews, D. L. Pauls, M. R. Rasin, M. G unel, N. R. Davis, A. G. Ercan-Sencicek, D. H. Guez, J. A. Spertus, J. F. Leckman, L. S. Dure, R. Kurlan, H. S. Singer, D. L. Gilbert, A. Farhi, A. Louvi, R. P. Lifton, N. Sestan, and State MW. 2005. Sequence variants in SLITRK1 are associated with Tourette's syndrome. Science. 310:317-320. 90. Dai, Y., Y. S. Huang, M. Tang, T. Y. Lv, C. X. Hu, Y. H. Tan, Z. M. Xu, and Y. B. Yin. 2007. Microarray analysis of microRNA expressi on in peripheral blood cells of systemic lupus erythematosus patients. Lupus. 16:939-946. 91. Lukiw, W. J. 2007. Micro-RNA speciation in fetal, adult and Alzheimer's disease hippocampus. Neuroreport. 18:297-300. 92. Yu, D., A. H. Tan, X. Hu, V. Athanasopoulos N. Simpson, D. G. Silva, A. Hutloff, K. M. Giles, P. J. Leedman, K. P. Lam, C. C. Goodnow, and C. G. Vinuesa. 2007. Roquin represses autoimmunity by limiting inducib le T-cell co-stimulator messenger RNA. Nature. 450:299-303. 93. Satoh, M., J. J. Langdon, C. H. Chou, D. P. McCauliffe, E. L. Treadwell, T. Ogasawara, M. Hirakata, A. Suwa, P. L. Cohen, R. A. Eisenberg, and 1994. Characterization of the Su antigen, a macromolecular complex of 100/102 and 200-kDa proteins recognized by autoantibodies in systemic rheumatic diseases. Clin. Immunol. Immunopathol. 73:132141. 94. Jakymiw, A., K. Ikeda, M. J. Fritzler, W. H. Reeves, M. Satoh, and E. K. L. Chan. 2006. Autoimmune targeting of key co mponents of RNA interference. Arthritis. Res. Ther. 8:R87. 95. Yu, J. H., W. H. Yang, T. Gulick, K. D. Bloch, and D. B. Bloch. 2005. Ge-1 is a central component of the mammalian cytoplasmic mRNA processing body. RNA. 11:1795-1802. 96. Liu, J., F. V. Rivas, J. Wohlschlegel, J. R. Yates, III, R. Parker, and G. J. Hannon. 2005. A role for the P-body component GW182 in microRNA function. Nat. Cell. Biol. 7:12611266. 106

PAGE 107

97. Meister, G., M. Landthaler, L. Peters, P. Y. Chen, H. Urlaub, R. Luhrmann, and T. Tuschl. 2005. Identification of nove l argonaute-associated proteins. Curr. Biol. 15:21492155. 98. Bhattacharyya, S. N., R. Habermacher, U. Martine, E. I. Closs, and W. Filipowicz. 2006. Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell. 125:1111-1124. 99. Vasudevan, S., Y. Tong, and J. A. Steitz 2007. Switching from repression to activation: microRNAs can up-regulate translation. Science. 318:1931-1934. 100. Teixeira, D., U. Sheth, M. A. Valencia-Sanchez, M. Brengues, and R. Parker. 2005. Processing bodies require RNA for assemb ly and contain nontranslating mRNAs. RNA. 11:371-382. 101. Cougot, N., S. Babajko, and B. Seraphi n. 2004. Cytoplasmic foci are sites of mRNA decay in human cells. J. Cell. Biol. 165:31-40. 102. Ding, L., A. Spencer, K. Morita, and M. Han. 2005. The developmental timing regulator AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to cytoplasmic P bodies in C. elegans. Mol. Cell. 19:437-447. 103. Andrei, M. A., D. Ingelfinger, R. He intzmann, T. Achsel, R. Rivera-Pomar, and R. Luhrmann. 2005. A role for eIF4E and eIF4Etransporter in targeting mRNPs to mammalian processing bodies. RNA. 11:717-727. 104. Eystathioy, T., A. Jakymiw, E. K. L. Cha n, B. Seraphin, N. Cougot, and M. J. Fritzler. 2003. The GW182 protein colocalizes with mRNA degradation associated proteins hDcp1 and hLSm4 in cytoplasmic GW bodies. RNA. 9:1171-1173. 105. Bashkirov, V. I., H. Schert han, J. A. Solinger, J. M. Bu erstedde, and W. D. Heyer. 1997. A mouse cytoplasmic exoribonuclease (mXRN1p) with preference for G4 tetraplex substrates. J. Cell. Biol. 136:761-773. 106. Fukuhara, N., J. Ebert, L. Unterholzner, D. Lindner, E. Izaurralde, and E. Conti. 2005. SMG7 is a 14-3-3-like adaptor in the nonsense-mediated mRNA decay pathway. Mol. Cell. 17:537-547. 107. Kedersha, N., G. Stoecklin, M. Ayodele, P. Yacono, J. Lykke-Andersen, M. J. Fritzler, D. Scheuner, R. J. Kaufman, D. E. Golan, and P. Anderson. 2005. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J. Cell. Biol. 169:871-884. 108. Unterholzner, L., and E. Izaurralde. 2004. SMG7 acts as a molecular link between mRNA surveillance and mRNA decay. Mol. Cell. 16:587-596. 107

PAGE 108

109. Rehwinkel, J., I. Behm-Ansmant, D. Gatfield, and E. Izaurralde. 2005. A crucial role for GW182 and the DCP1:DCP2 decapping complex in miRNA-mediated gene silencing. RNA. 11:1640-1647. 110. Tang, G. 2005. siRNA and miR NA: an insight into RISCs. Trends. Biochem. Sci. 30:106114. 111. Tomari, Y., and P. D. Zamore. 2005. MicroRNA biogenesis: drosha can 't cut it without a partner. Curr. Biol. 15:R61-R64. 112. Valencia-Sanchez, M. A., J. Liu, G. J. Hannon, and R. Parker. 2006. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes. Dev. 20:515-524. 113. Fenger-Gron, M., C. Fillman, B. No rrild, and J. Lykke-Andersen. 2005. Multiple processing body factors and the ARE bindi ng protein TTP activate mRNA decapping. Mol. Cell. 20:905-915. 114. Eulalio, A., I. Behm-Ansmant, and E. I zaurralde. 2007. P bodies: at the crossroads of post-transcriptional pathways. Nat. Rev. Mol. Cell. Biol. 8:9-22. 115. Jakymiw, A., K. M. Pauley, S. Li, K. Ikeda, S. Lian, T. Eystathioy, M. Satoh, M. J. Fritzler, and E. K. L. Chan. 2007. The role of GW/P-bodies in RNA processing and silencing. J. Cell. Sci. 120:1317-1323. 116. Eulalio, A., I. Behm-Ansmant, D. Schw eizer, and E. Izaurralde. 2007. P-body formation is a consequence, not the cause, of RNA-mediated gene silencing. Mol. Cell. Biol. 27:3970-3981. 117. Khabar, K. S. 2005. The AU-rich transcriptom e: more than interfer ons and cytokines, and its role in disease. J. Interferon. Cytokine. Res. 25:1-10. 118. Jing, Q., S. Huang, S. Guth, T. Zarubin, A. Motoyama, J. Chen, P. F. Di, S. C. Lin, H. Gram, and J. Han. 2005. Involvement of mi croRNA in AU-rich element-mediated mRNA instability. Cell. 120:623-634. 119. Takahashi, H., M. Maeda, H. Sawa, H. Hasegawa, M. Moriyama, T. Sata, W. W. Hall, and T. Kurata. 2006. Dicer and positive charge of proteins decrease the stability of RNA containing the AU-rich element of GM-CSF. Biochem. Biophys. Res. Commun. 340:807814. 120. Gantier, M. P., A. J. Sadler, and B. R. Williams. 2007. Fine-tuning of the innate immune response by microRNAs. Immunol. Cell. Biol. 85:458-462. 121. Taganov, K. D., M. P. Boldin, and D. Baltimore. 2007. MicroRNAs and immunity: tiny players in a big field. Immunity. 26:133-137. 122. Guha, M., and N. Mackman. 2001. LPS induction of gene expression in human monocytes. Cell. Signal. 13:85-94. 108

PAGE 109

123. Carpenter, A. E., T. R. Jones, M. R. Lamp recht, C. Clarke, I. H. Kang, O. Friman, D. A. Guertin, J. H. Chang, R. A. Lindquist, J. Mo ffat, P. Golland, and D. M. Sabatini. 2006. CellProfiler: image analysis software fo r identifying and quantifying cell phenotypes. Genome. Biol. 7:R100. 124. Griffith, K. J., E. K. L. Chan, C. C. L ung, J. C. Hamel, X. Guo, K. Miyachi, and M. J. Fritzler. 1997. Molecular cloning of a novel 97kd Golgi complex autoantigen associated with Sjogren's syndrome. Arthritis. Rheum. 40:1693-1702. 125. Abramoff, M. D., P. J. Magelhaes, and S. J. Ram. 2004. Image Processing with ImageJ. Biophotonics International 11:36-42. 126. Livak, K. J., and T. D. Schmittgen. 2001. Anal ysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402-408. 127. Chu, C. Y., and T. M. Rana. 2006. Tr anslation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54. PLoS. Biol. 4:e210. 128. Franks, T. M., and J. Lykke-Andersen. 2007. TTP and BRF proteins nucleate processing body formation to silence mRNA s with AU-rich elements. Genes. Dev. 21:719-735. 129. Bakheet, T., B. R. Williams, and K. S. Khabar. 2006. ARED 3.0: the large and diverse AU-rich transcriptome. Nucleic. Acids. Res. 34:D111-D114. 130. Bakheet, T., M. Frevel, B. R. Willia ms, W. Greer, and K. S. Khabar. 2001. ARED: human AU-rich element-containing mRNA da tabase reveals an unexpectedly diverse functional repertoire of encoded proteins. Nucleic. Acids. Res. 29:246-254. 131. Griffiths-Jones S. 2006. miRBase : the microRNA sequence database. Methods. Mol. Biol. 342:129-138. 132. Smolen, J. S., D. Aletaha, M. Koe ller, M. H. Weisman, and P. Emery. 2007. New therapies for treatment of rheumatoid arthritis. Lancet. 370:1861-1874. 133. Bresnihan, B., J. M. varo-Gracia, M. Cobby, M. Doherty, Z. Domljan, P. Emery, G. Nuki, K. Pavelka, R. Rau, B. Rozman, I. Watt, B. Williams, R. Aitchison, D. McCabe, and P. Musikic. 1998. Treatment of rheumatoid arthritis with recombinant human interleukin-1 receptor antagonist. Arthritis. Rheum. 41:2196-2204. 134. Lipsky, P. E., D. M. van der Heijde, E. W. St Clair, D. E. Furst, F. C. Breedveld, J. R. Kalden, J. S. Smolen, M. Weisman, P. Emer y, M. Feldmann, G. R. Harriman, and R. N. Maini. 2000. Infliximab and methotrexate in the treatment of rheumatoid arthritis. AntiTumor Necrosis Factor Trial in Rheumatoid Arthritis with Concomitant Therapy Study Group. N. Engl. J. Med. 343:1594-1602. 135. Fabbri, M., C. M. Croce, and G. A. Calin. 2008. MicroRNAs. Cancer. J. 14:1-6. 109

PAGE 110

136. Lodish, H. F., B. Zhou, G. Liu, and C. Z. Chen. 2008. Micromanagement of the immune system by microRNAs. Nat. Rev. Immunol. 8:120-130. 137. Nakasa, T., S. Miyaki, A. Okubo, M. Hashim oto, K. Nishida, M. Ochi, and H. Asahara. 2008. Expression of microRNA-146 in rheu matoid arthritis synovial tissue. Arthritis. Rheum. 58:1284-1292. 138. Stanczyk, J., D. M. Pedrioli, F. Brentano, O. Sanchez-Pernaute, C. Kolling, R. E. Gay, M. Detmar, S. Gay, and D. Kyburz. 2008. Alte red expression of MicroRNA in synovial fibroblasts and synovial tissue in rheumatoid arthritis. Arthritis. Rheum. 58:1001-1009. 139. Cuschieri, J., V. Bulmus, D. Gourlay, I. Ga rcia, A. Hoffman, P. Stayton, and R. V. Maier. 2004. Modulation of macrophage responsiven ess to lipopolysaccharide by IRAK-1 manipulation. Shock. 21:182-188. 140. Pauley, K. M., M. Satoh, P. R. Dominguez-Gu tierrez, S. M. Wallet, L. S. Holliday, W. H. Reeves, and E. K. L. Chan. 2008. Formation of GW/P Bodies as Marker for miRNAMediated Regulation of I nnate Immune Signaling. Mol. Biol. Cell. submitted. 141. Broad, A., D. E. Jones, and J. A. Kirby. 2006. Toll-like receptor (TLR) response tolerance: a key physiological "damage limita tion" effect and an important potential opportunity for therapy. Curr. Med. Chem. 13:2487-2502. 142. Li, Y., E. A. Howell, A. S. Lagoo, M. Kuch ibhatla, H. Pan, H. J. Cohen, and S. A. Lagoo. 2008. Differential gene expression of IRAK-1 and IRAK-M in peripheral blood mononuclear cells of young and aged rats following preconditi oning with endotoxin. Shock. 110

PAGE 111

BIOGRAPHICAL SKETCH Kaleb Marie Pauley was born in Charleston, We st Virginia. She graduated from South Charleston High School in 1998, and then attended college at Morehead State University in Morehead, Kentucky for two years. In 2000, sh e transferred to Marshall University in Huntington, West Virginia where sh e earned a Bachelor in Science degree in biological sciences in 2002. At this time, Kaleb developed an interest in research and decided to pursue a Master of Science degree in biological sciences in the labor atory of Dr. Laura Jenski. With Dr. Jenskis guidance, Kaleb managed the flow cytometry core facility while she completed her research project focused on the role of docosahex eanoic acid in modulating class I major histocompatibility complex structure and function. During this time, Kale b decided to continue her research career and was accepted to the Interdis ciplinary Program in biomedical sciences at the University of Florida. In the summer of 2004, Kaleb defended her masters thesis, married the love of her life, and moved to Gain esville, Florida to pursue her Ph.D. Kaleb decided to join the immunology a nd microbiology concentration, and ended up joining the lab of Dr. Edward K.L. Chan. Here, her research focused on the role of microRNA regulation in GW/P body formati on, innate immune signaling, and rheumatoid arthritis. After her doctorate work, Kaleb plans on accepting a postdoctoral position in an immunology lab where she can widen her knowledge of autoimmune diseases. She also h opes to start a family with her husband, Brad. 111