<%BANNER%>

Development of Novel Molecular and Serological Diagnostic Assays for the Rapid and Differential Detection of Marine Mamm...

Permanent Link: http://ufdc.ufl.edu/UFE0022405/00001

Material Information

Title: Development of Novel Molecular and Serological Diagnostic Assays for the Rapid and Differential Detection of Marine Mammal Morbilliviruses
Physical Description: 1 online resource (156 p.)
Language: english
Creator: Grant, Rebecca
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Over the past two decades, various epizootics of marine morbilliviruses have caused high mortality in cetaceans and pinnipeds. These viruses are: dolphin morbillivirus (DMV), porpoise morbillivirus (PMV), phocid distemper virus (PDV), and canine distemper virus (CDV). We have developed real-time RT-PCR assays to specifically and sensitively differentiate infections caused by DMV, PMV, PDV, and CDV targeting the hypervariable C-terminal domain of the nucleocapsid (N) gene. Total RNA, extracted from DMV, PMV, PDV, and CDV infected Vero cell cultures, exhibited high specificity and produced positive cycle threshold (CT) values after the 17th, 25th, 17th, and 16th cycles, respectively. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was targeted as a control of RNA quality using known primers and a consensus GAPDH probe that reacted with tissues of 11 different marine mammal species. Further, a generic real-time morbillivirus assay targeted a conserved region within the N gene and detected DMV, PMV, CDV, PDV, rinderpest virus (RPV) and measles virus (MV). Finally, a study comparing the expressed N protein of DMV in a baculovirus (Autographa californica) expression system and also a yeast (Kluyveromyces lactis) expression system, with one recombinant yeast strain containing a secretion domain and one without, found the proteins to be ~57-kDa by SDS-PAGE and western blot analysis. Further, a baculovirus and a yeast recombinant, lacking the yeast secretory domain, expressed the first fully assembled DMV-N recombinant proteins. Both recombinant proteins were visualized by transmission electron microscopy having similar diameters of ~22 nm and helical morphology. Purified baculovirus DMV-N protein was used as antigen in an indirect ELISA (iELISA) to detect antibodies against morbilliviruses in 31 of 96 sera samples collected from several wild marine mammal species, humans, and domestic dogs. It is anticipated that the purified yeast expressed DMV-N protein can also be used as antigen to detect morbillivirus antibodies in sera in an iELISA. In conclusion, these molecular and serological assays will advance the diagnostic capabilities of laboratories by improving the response time from stranding to diagnosis to treatment. Simultaneously, these assays may provide valuable information about previous or current infections of these deadly viruses in wild marine mammal populations.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rebecca Grant.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Romero, Carlos H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022405:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022405/00001

Material Information

Title: Development of Novel Molecular and Serological Diagnostic Assays for the Rapid and Differential Detection of Marine Mammal Morbilliviruses
Physical Description: 1 online resource (156 p.)
Language: english
Creator: Grant, Rebecca
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Over the past two decades, various epizootics of marine morbilliviruses have caused high mortality in cetaceans and pinnipeds. These viruses are: dolphin morbillivirus (DMV), porpoise morbillivirus (PMV), phocid distemper virus (PDV), and canine distemper virus (CDV). We have developed real-time RT-PCR assays to specifically and sensitively differentiate infections caused by DMV, PMV, PDV, and CDV targeting the hypervariable C-terminal domain of the nucleocapsid (N) gene. Total RNA, extracted from DMV, PMV, PDV, and CDV infected Vero cell cultures, exhibited high specificity and produced positive cycle threshold (CT) values after the 17th, 25th, 17th, and 16th cycles, respectively. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was targeted as a control of RNA quality using known primers and a consensus GAPDH probe that reacted with tissues of 11 different marine mammal species. Further, a generic real-time morbillivirus assay targeted a conserved region within the N gene and detected DMV, PMV, CDV, PDV, rinderpest virus (RPV) and measles virus (MV). Finally, a study comparing the expressed N protein of DMV in a baculovirus (Autographa californica) expression system and also a yeast (Kluyveromyces lactis) expression system, with one recombinant yeast strain containing a secretion domain and one without, found the proteins to be ~57-kDa by SDS-PAGE and western blot analysis. Further, a baculovirus and a yeast recombinant, lacking the yeast secretory domain, expressed the first fully assembled DMV-N recombinant proteins. Both recombinant proteins were visualized by transmission electron microscopy having similar diameters of ~22 nm and helical morphology. Purified baculovirus DMV-N protein was used as antigen in an indirect ELISA (iELISA) to detect antibodies against morbilliviruses in 31 of 96 sera samples collected from several wild marine mammal species, humans, and domestic dogs. It is anticipated that the purified yeast expressed DMV-N protein can also be used as antigen to detect morbillivirus antibodies in sera in an iELISA. In conclusion, these molecular and serological assays will advance the diagnostic capabilities of laboratories by improving the response time from stranding to diagnosis to treatment. Simultaneously, these assays may provide valuable information about previous or current infections of these deadly viruses in wild marine mammal populations.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rebecca Grant.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Romero, Carlos H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-02-28

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022405:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF NOVEL MOLECULAR AND SEROLOGICAL DIAGNOSTIC ASSAYS FOR THE RAPID AND DIFFERENT IAL DETECTION OF MARINE MAMMAL MORBILLIVIRUSES By REBECCA JEAN GRANT A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Rebecca Jean Grant

PAGE 3

3 To my Mom, for all her love and support.

PAGE 4

4 ACKNOWLEDGMENTS Funding for this project was provided in part by the University of Florida, College of Veterinary Medicine Departm ent of Infectious Diseases and Pa thology, Aquatic Animal Health Program, the UF Alumni Fellowship, and the UF Grinter Fellowship. All samples were collected under the NMFS Scientific Re search Permit nos. 1054-1731-00 and 1054-1731-01. Sample protocols were provided by the University of Florida Inst itutional Animal Care and Use Committee (IACUC E97 0, D438, D805, E853, E883). I first have to thank Dr. Carlos Romero who saw potential and invited me to come and do my PhD in his laboratory. He has been a wonde rful mentor and I am so thankful for everything he has taught me these past four years that open ed the door to much more opportunity as I begin my post-doctoral career. I also would like to thank my Mom, R on, Kristie, and Joshua for all their love and support despite the distance. Also, I could never ha ve been successful without my best friend and fianc, Steve. I am so thankf ul for his motivation, understanding and love during this challenge. I thank Shasta for being such a wonderful friend and cri tic. Without her, these last four years would not have been nearly as enjoyable. Also, I thank Rachel, Heather, Maggie, and Meghan for their friendship and good luck with all your projects and future aspirations. Special thanks go to Dr. Tom Ba rrett and Dr. Ashley Banyard at the Institute for Animal Health for their expertise, advice, and kindness in allowing me to come and work with them in England. I would also like to thank Dr. Alejandra Garcia-Maruni ak for all the hard work and help with the baculovirus expression system; Karen Kelley at the ICBR electron microscopy Core Lab for priceless electron microscopy pictures; Dr. Sue Moyer w ho graciously donated vital reagents for my project a nd patiently answered all of my questions; Dr. Robert Meagher at the USDA for donating larvae; Bob Bonde for his help with acquiring manatee samples; Mote Marine Laboratory for an endless supply of ma rine mammal tissue and serum samples; Dr. John

PAGE 5

5 Dame for his support of our labor atory; Sally OConnell for all you help with various tasks; and Dr. Charles Courtney for his s upport of this project. I am forever grateful to members of my supervisory committee: Dr. Carlos Romero, Dr. James Maruniak, Dr. Peter McGuire, Dr. Ayal ew Mergia and Dr. Charles Manire. Their guidance, support and expertise were invaluable and will never be forgotten or surpassed.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES.......................................................................................................................10 LIST OF TERMS/SYMBOLS/ABBREVIATIONS..................................................................... 12 ABSTRACT...................................................................................................................................15 CHAP TER 1 INTRODUCTION..................................................................................................................17 Paramyxoviruses................................................................................................................ .....17 Classification of Paramyxoviruses.................................................................................. 17 The Nucleocapsid Protein................................................................................................18 The Phophoprotein..........................................................................................................20 Cystein-rich V and C Open Reading Fram es (ORFs)..................................................... 20 Matrix Protein..................................................................................................................21 Fusion Protein..................................................................................................................21 Hemagglutinin Protein.....................................................................................................22 Large Protein...................................................................................................................22 Viral Transmission..........................................................................................................23 Viral Absorption and Penetration.................................................................................... 23 Ribonucleoprotein (RNP) Complex................................................................................ 25 Viral Transcription (mRNA Synthesis)........................................................................... 25 Genome Replication........................................................................................................ 27 Hexamer Genome Length is Required for Genome Replication: Rule of Six ............. 27 Virion Assembly and Release.........................................................................................28 The Effect of Morbillivirus es on the Immune System ....................................................30 Reservoir and Vector Theories........................................................................................ 32 Serology...........................................................................................................................34 The Terrestrial Morbilliviruses............................................................................................... 35 Peste-des-petits Ruminant Virus (PPRV)........................................................................35 Rinderpest Virus (RPV).................................................................................................. 35 Measles Virus (MV)........................................................................................................36 Marine Morbilliviruses......................................................................................................... ..38 Canine Distemper Virus (CDV)......................................................................................38 Phocine Distemper Virus (PDV)..................................................................................... 40 Cetacean Morbilliviruses: Porpoise Morbil liv irus (PMV) & Dolphin Morbillivirus (DMV)..........................................................................................................................43 Morbilliviral Diagnostics.................................................................................................46

PAGE 7

7 2 DEVELOPMENT OF REAL-TIME RT-PCR ASSAYS FOR THE DIFFERENTIAL DETECTI ON OF MARINE MORBILLIVIRUSES.............................................................. 52 Introduction................................................................................................................... ..........52 Materials and Methods...........................................................................................................54 RNA Preparation and Reverse Transcription..................................................................54 Amplification and Cloning of the Complete Nucleocapsid Genes .................................54 Primer and Probe Design for C onventional and Real-tim e RT-PCR.............................. 55 Specificity of Primers in Conventional RT-PCR............................................................ 56 Specificity of Primers and Probes in rtRT-PCR..............................................................57 Sensitivity of Primer Sets in Conventional RT-PCR...................................................... 57 One-step rtRT-PCR with RNA Extracted from Marine Mammal Tissues During a Morbillivirus Outbreak................................................................................................ 58 Amplification of Standard RNA...................................................................................... 58 Conventional and rtRT-PCR to Test for RNA Quality...................................................59 Universal Morbillivirus Primers and Probe..................................................................... 60 Results.....................................................................................................................................60 The Complete Nucleocapsid Genes................................................................................. 60 Specificity of Conventional and rtRT-PCR Assays........................................................60 Sensitivity of the Conventional RT-PCR Assays............................................................61 Sensitivity of the rtRT-PCR Assays and Standard Curves.............................................. 61 Real-time RT-PCR for the GAPDH Gene in Marine Mammal Tissues......................... 62 Differential Diagnosis of Morbillivirus Infection using Cetacean Tissues ..................... 62 Universal Morbillivirus rtRT-PCR Assay....................................................................... 63 Discussion...............................................................................................................................63 3 BACULOVIRUS ( Autographa californica Nuclear Polyhedrosis Virus) EXPRE SSION OF THE NUCLEOCAPSID GENE OF DOLPHIN MORBILLIVIRUS.............................. 76 Introduction................................................................................................................... ..........76 Materials and Methods...........................................................................................................78 Amplification of the Nucleocapsid Gene........................................................................ 78 Construction of Clones and Transfection........................................................................79 Plaque Purification of Recombinant Baculoviruses........................................................ 80 Detection of Recombinant Baculoviruses by PCR..........................................................81 Messenger RNA (mRNA) Transcript Am plification in RT-PCR................................... 82 Infection Assay and Titration of Recombinant Viruses.................................................. 83 Western Blotting.............................................................................................................. 84 Large Scale Production of Recomb i nant DMV-N #21 Baculovirus...............................85 Transmission Electron Microcopy.................................................................................. 86 Purification of Recombinant NLPs by Sucrose Cushion and CsCl Gradient .................. 87 Determination of Total Protein Concentration................................................................ 87 Development of an Indirect ELISA (iELI SA) using Recom binant Nucleocapsids........ 88 Detection of Morbillivirus Antibodies fr om a Panel of Sera in an iELISA.................... 89 Virus Neutralization........................................................................................................ 91 Inoculation of Larvae (Spodoptera fugiperda) w ith Recombinant Baculovirus............. 92 Results.....................................................................................................................................93

PAGE 8

8 Recombinant Virus Constr uction and Purification .......................................................... 93 Production of Recombin ant DMV-N Protein .................................................................. 93 Transmission Electron Microscopy................................................................................. 93 Purification of Nucleocap sid-like Particles .....................................................................94 Determination of Protein Concentration......................................................................... 94 Indirect ELISA (iELISA)................................................................................................95 Virus Neutralization........................................................................................................ 95 Expression of Recombinan t N Protein in Larvae ............................................................96 Discussion...............................................................................................................................96 4 EXPRESSION OF THE NUC LEOCAPSID GENE OF DOLPHIN M ORBILLIVIRUS IN YEAST ( Kluyveromyces lactis )......................................................................................120 Introduction................................................................................................................... ........120 Materials and Methods.........................................................................................................121 Amplification of the Nucleocapsid Gene...................................................................... 121 Cloning of DMV-N into pKLAC1 Vector.................................................................... 123 Linearization of Recombinant pKLAC1 Plas mid for Integrative Transformation of K. lactis......................................................................................................................124 PCR Screening to Test Tran sform ants for Integration and Multi-copy Integration...... 125 Growth of DMVRecombinant Yeast Strains ............................................................ 126 Growth of DMV-I Recombinant Yeast Stra ins f or Expression of DMV-N Protein..... 127 Immunoprecipitation of DMVRecom binant Yeast Lysate....................................... 127 Western Blot Detection of DMVN Expressed P rotein from DMVand DMV-I Recombinant Yeast Strains........................................................................................ 128 Transmission Electron Microcopy................................................................................ 129 Results...................................................................................................................................129 Synthesis of DMV-N in Yeast K. lac tis ........................................................................129 Detection of N Protein...................................................................................................129 Transmission Electron Microscopy (TEM) ................................................................... 130 Discussion.............................................................................................................................130 5 CONCLUSIONS.................................................................................................................. 137 LIST OF REFERENCES.............................................................................................................141 BIOGRAPHICAL SKETCH.......................................................................................................156

PAGE 9

9 LIST OF TABLES Table page 2-1 Oligonucleotides used in conventional a nd real-tim e RT-PCR assays for the four known marine morbilliviruses. (+ ) sign designates LNA bases........................................ 67 2-2 CT values obtained from a one-step real -tim e RT-PCR assay used to detect a strain of dolphin morbillivirus from cetacean tissues collected in Spain during the summer of 2007...............................................................................................................................68 3-1 Human and dog sera iELISA results showi ng the absorbance values tested against purified DMV-N antigen..................................................................................................101 3-2 Cetacean sera iELISA results showing the absorbance values against purified DMVN antigen ..........................................................................................................................102 3-3 Manatee sera iELISA results showing the absorb ance values against purified DMVN antigen..........................................................................................................................106 3-4 Pinniped sera iELISA results showing the absorb ance values against purified DMVN antigen..........................................................................................................................110 3-5 Sera samples that were positive in an iELISA assay with their corresponding virus neutralizatio n (VN) titers................................................................................................. 111

PAGE 10

10 LIST OF FIGURES Figure page 1-1 Schematic diagram of the ribonucleoprotein complex which is involved in all aspects of viral transcripti on and replication. ................................................................................. 49 1-2 Morbillivirus transcription and replication....................................................................... 50 1-3 Divergent phylogram of the deduced am ino acid sequences from the complete N gene of all member of the morbillivirus genus..................................................................51 2-1 Specificity of the primers against each of the four m arine morbilliviruses in conventional RT-PCR. DMV ; PMV ; PDV ; CDV CDV-SH (Snyder Hill Strain) and CDV-OD (Onderstepoort)........................................................................................... 69 2-2 Gel electrophoresis illustrating the se nsitiv ity of PMV-N primer sets, DMV-N primer sets, PDV-N primer se ts,and CDV-N primer sets.................................................. 70 2-3 Real-time RT-PCR Ct values for DMV PMV PDV and CDV pri mer sets and probes.................................................................................................................................71 2-4 Standard curve of the rtRT-PCR assays for DMV, PMV, PDV, and CDV....................... 72 2-5 Multiple alignment of the eleven 197-bp GAPDH fragments amplified, cloned and sequenced from various ma rine mammal species.............................................................. 73 2-6 Real-time RT-PCR CT values for the eleven different marine mammal species tested with the GAPDH primer set and probe..............................................................................74 2-7 Real-time RT-PCR with the universal morbillivirus primer set and probe assay am plifying viral RNA in a one-step assay......................................................................... 75 3-1 Supernatant collecte d, post-transfection, during days 1 through 9 .................................. 114 3-2 Plaque assay with a blue plaque, representative of a recom binant DMV-N baculovirus, compared to an uninfected control dish...................................................... 114 3-3 Agarose gel electrophoresis showing PCR results from DNA extracted from insect cells that were infected with supern atant from recombinant viral plugs......................... 115 3-4 Gel electrophoresis show ing RT-PCR results from RNA that was extracted from insect cells that were infected with s upernatant from recombinant viral plugs............... 115 3-5 SDS-PAGE followed by western blot analysis of crude lysates from infected insect cells at 72 hpi...................................................................................................................116

PAGE 11

11 3-6 Transmission electron microscopy of the recom binant nucleocapsid particles from crude lysate from a 1 L infection assay with infection at an MOI 5 and collection at 72 hpi...............................................................................................................................116 3-7 Transmission electron microscopy of DMVN infected lysate that was purified by sucrose cushion and CsCl gradient. ................................................................................117 3-8 Visible bands, indicated by arrow, from a CsCl gradien t using clarified cell lysates that were first pelleted in a sucrose cushion.................................................................... 118 3-9 SDS-PAGE followed by western blot an alysis from dialyzed CsCl bands. .................... 118 3-10 Standard curve of the generated absorb ance values for the BSA standards as they com pare to the concentration of BSA in each sample..................................................... 119 3-11 Cell lysates from infected insect larvae collected on various days post-inoculation. ...... 119 4-1 Agarose gel electrophoresis of the tw o DMV-N genes am plified by RT-PCR with one gene containing the -MF domain and one w ithout this domain............................. 133 4-2 Transformants containing the -MF domain: Ten yeast transformants were screened for integration of the DMV-N gene by PCR....................................................................133 4-3 Six DMV-I yeast transfor m ants, not containing the -MF domain, screened for integration of the DMV-N gene by PCR......................................................................... 134 4-4 Five yeast DMVand DMV-I transfor mants screen ed for multi-copy integration of the DMV-N gene by PCR................................................................................................ 134 4-5 SDS-PAGE and western blot an alysis of a lysate from a DMVrecombinant yeast strain tested for N protein expression.............................................................................. 135 4-6 Clarified lysate from DMV-I transf orm ants analyzed by SDS-PAGE and western blot analysis.....................................................................................................................135 4-7 Transmission electron micrographs of crude lysate from recombinant yeast containing the -MF domain............................................................................................136 4-8 Crude lysate from a DMV-I recomb inant collected 72 hpi and viewed by transm ission electron microscopy.................................................................................... 136

PAGE 12

12 LIST OF TERMS/SYMBOLS/ABBREVIATIONS AGP Anti-genom e Promoter -MF Alpha Mating Factor AP Alkaline Phosphatase APMV Avian Paramyxovirus BSA Bovine Serum Albumin cDNA Complementary Deoxyribonucleic Acid CDV Canine Distemper Virus cELISA Competitive ELISA CPE Cytopathic Effects CsCl Cesium Chloride CT Cycle Threshold C-terminal Carboxy Terminal DMEM Dulbeccos Modified Eagle Medium DMV Dolphin Morbillivirus DNA Deoxyribonucleic Acid ELISA Enzyme-linked Immunosorbent Assay ER Endoplasmic Reticulum FBS Fetal Bovine Serum GAPDH Glyceraldehyde 3Phosphate Dehydrogenase GFP Green Fluorescent Protein GP Genome Promoter HeV Hendra Virus hpi hours post-inoculation

PAGE 13

13 HRP Horsh-radish peroxidase iELISA Indirect ELISA kDa Kilo-Daltons LNA Locked Nucleic Acids MV Measles Virus N Nucleocapsid NDV Newcastles Disease Virus NiV Nipah Virus NLP Nucleocapsid-like Particles PBS Phosphate Buffered Saline PDV Phocine Distemper Virus PMV Porpoise Morbillivirus PPRV Peste-des-Petits Ruminant Virus RdRp RNA Dependent RNA Polymerase RNA Ribonucleic Acid RNP Ribonucleoprotein Complex rpm Rotations per minute RPV Rinderpest Virus RT Reverse Transcription RT-PCR Conventional Reverse Transc ription Polymerase Chain Reaction rtRT-PCR Real-time RT-PCR SDS-PAGE Sodium Dodecyl Sufate Polyacrylamide Gel Electrophoresis TBS Tris Buffered Saline TBS-T Tris Buffered Saline with 0.01% Tween 20 TCID50 50% Tissue Culture Infectious Doses

PAGE 14

14 TEM Transmission Electron Microscopy UME Unusual mortality event

PAGE 15

15 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENT OF NOVEL MOLECULAR AND SEROLOGICAL DIAGNOSTIC ASSAYS FOR THE RAPID AND SPECIFI C DETECTION OF MARINE MAMMAL MORBILLIVIRUSES By Rebecca Jean Grant August 2008 Chair: Carlos H. Romero Major: Veterinary Medical Sciences Over the past two decades, various epizootics of marine morbilliviruses have caused high mortality in cetaceans and pinnipeds. These viru ses are: dolphin morbillivirus (DMV), porpoise morbillivirus (PMV), phocid distemper virus (PDV), and canin e distemper virus (CDV). We have developed real-time RT-PCR assays to specif ically and sensitively differentiate infections caused by DMV, PMV, PDV, and CDV targeting the hypervariable C-terminal domain of the nucleocapsid (N) gene. Total RNA, extracted fr om DMV, PMV, PDV, and CDV infected Vero cell cultures, exhibited hi gh specificity and produced positive cycle threshold (CT) values after the 17th, 25th, 17th, and 16th cycles, respectively. The glycer aldehyde 3-phosphate dehydrogenase (GAPDH) gene was targeted as a control of RNA quality using known primers and a consensus GAPDH probe that reacted with tissues of 11 di fferent marine mammal species. Further, a generic real-time morbillivirus assay targeted a conserved region within the N gene and detected DMV, PMV, CDV, PDV, rinderpest virus (RPV) and measles virus (MV). Finally, a study comparing the expressed N protein of DMV in a baculovirus (Autographa californica ) expression system and also a yeast ( Kluyveromyces lactis ) expression system, with one recombinant yeast strain cont aining a secretion domain and one without, found

PAGE 16

16 the proteins to be ~57-kDa by SD S-PAGE and western blot analysis Further, a baculovirus and a yeast recombinant, lacking the yeast secretor y domain, expressed the first fully assembled DMV-N recombinant proteins. Both recombinan t proteins were visualized by transmission electron microscopy having similar diameters of ~22 nm and helical morphology. Purified baculovirus DMV-N protein was used as antigen in an indirect ELISA (iELISA) to detect antibodies against morbilliviruses in 31 of 96 sera samples collected from several wild marine mammal species, humans, and domestic dogs. It is anticipated that the pu rified yeast expressed DMV-N protein can also be used as antigen to detect morbillivirus antibodies in sera in an iELISA. In conclusion, these molecular and serolo gical assays will advance the diagnostic capabilities of laboratories by improving the re sponse time from stranding to diagnosis to treatment. Simultaneously, these assays may provide valuable information about previous or current infections of these deadly viru ses in wild marine mammal populations.

PAGE 17

17 CHAPTER 1 INTRODUCTION Paramyxoviruses Classification of Paramyxoviruses The f amily Paramyxoviridae is classified into the order Mononegavirales and contains two subfamilies, the Paramyxovirinae and the Pneumovirinae. All members in this family are single-stranded, negative sense RNA viruses whos e replication occurs entirely in the cytoplasm of the host cell. All paramyxoviruses have a li pid envelope and two surface glycoproteins to mediate the exit and entry of the virion, but these exact glycoproteins vary among the genera. The Paramyxovirinae contains five genera: Respirovirus, Rubulavirus, Henipavirus Avulavirus and Morbillivirus (Barrett et al., 2006; Bchen-Osmond, 1992). The enveloped viruses in the Paramyxovirinae subfamily have structurally dis tinguishing features; the size and shape of the nucleocapsids is a pproximately 18-22 nm in diameter, 1m in length, a pitch of 5.5 nm and left-handed helical symmetry (Knipe and Howley, 2001). There are three biological criteria for classification into this subfamily: antigenic cross-reactivit y between members of a genus, presence (Rubulavirus, Respirovirus Avulavirus) or absence ( Morbillivirus and Henipavirus ) of neuraminidase activity, and the va riance between the phosphoprotein (P) gene encoded in the viral genome between th e genera (Knipe and Howley, 2001). The Respirovirus genus type species is the Sendai virus (murine parainfluenza virus type 1), but also includes bovine (bPIV3) and human parainfluenza viruse s (hPIV1/3). The Rubulavirus genus type species is the Mumps virus and other species of the human (hPIV2/4a/4b) and simian (SV-5, 41) parainfluenza viruses. The next two genera have been recently classified into the Paramyxovirinae subfamily; Hendra virus (HeV) is the type species for Henipavirus genus and also consists of the Ni pah viruses (NiV). The Avulavirus genus type species is the Newcastle

PAGE 18

18 disease virus (NDV), but this genus also co ntains various other strains of the avian paramyxoviruses (APMV) (Bchen-Osmond, 1992). The type species for the Morbillivirus genus is Measles virus (MV), but also contains various strains of Canine distemper virus (C DV), Rinderpest virus (RPV), Peste-des-petits ruminants virus (PPRV), Phocine distemper vi rus (PDV), Dolphin morbillivirus (DMV), and Porpoise morbillivirus (P MV). Members of the Morbillivirus genus are encoded by six genes along their negative sense, linear, RNA genome in the following order: 3N-P(C/V)-M-F-H-L The fusion (F) and the hemagglutinin (H) repr esent the surface glycopro teins that project off of the lipid envelope and mediate viral entr y and exit from the host cell. These surface projections are 9-15 nm long and spaced 7-10 nm apart (Knipe and Howley, 2001). Inside the envelope lies a helical nucleocapsid core cont aining the RNA genome and the nucleocapsid (N), phospho(P) and large (L) proteins that initiate the intracellular virus replication (Knipe and Howley, 2001). The matrix (M) protein, which lies between the envelope and the core, is important in viral structure and is released from the core duri ng viral entry (Knipe and Howley, 2001). The Nucleocapsid Protein The N gene of the paramyxoviruses ranges fr om 489 to 553 amino acids, is elongated by helical symmetry and has a filamentous morphology with a length of approximately 600-800 nm. The width of the nucleocapsid is typically 18-22 nm and the pitch of the helix is 5.5 nm (Knipe and Howley, 2001). The N protein has two domains; the N-terminal and the C-terminal. The Nterminal is named because the N protein has a free amine (NH2) group at the 3 end of the negative sense copy and makes up ap proximately 80% of the protein. The N-terminal domain is considered to be well conserved and experiments using trypsin digestion with the recombinant N protein of Sendai virus showed that a 48-kDa N-te rminal core was left af ter digestion. After

PAGE 19

19 trypsin digestion with recombinan t MV-N, a 45-kDa N-terminal core was left intact (Bellini et al, 1986; Hummel et al., 1992; Moun tcastle et al., 1974). Using electron microscopy, the overall structure of the nucleocapsid was proven to be still intact along with the genomic RNA (Kingsbury and Darlington, 1968). Therefore, the RNA binding domains and the determinants of the helical structure must lie within the hi ghly conserved N-terminal domain and regions within this domain are critical for the assembly of the nucleocapsid (Buch holz et al., 1993). The carboxyl (C) terminal domain is so named because the 5 end of the gene, in terms of the negative sense genome, has an unbound carboxyl group. In contrast to the N-terminal domain, the C-terminal end of the N gene is poorly conserved and is considered hypervariable. The hypervariable C-terminal domain appears to be a tail extending from th e surface of the surface of the globular N-terminal body, because the C-terminal sequences appear to be susceptible to trypsin digestion (Compans et al., 1972; Heggeness et al., 1981; Knipe and Howley, 2001; Mountcastle et al., 1974). The C-terminal ta il contains the majority of the N-protein phosphorylation sites and antigen ic sites (Hsu and Kingsbury, 1982; Knipe and Howley, 2001; Ryan et al., 1993). Interestingly, the C-termin al region is not essential for assembling an encapsidated, complementary copy of the templa te like the N-termin al domain, but it is important to function as a template for new roun ds of genome replication. Experiments where the C-terminal domain of the nucleocapsid of Sendai virus was completely deleted indicated that the tail functions to mediate P-protein binding to nucleocapsids to participate in helical transitions that are necessary for template func tion (Knipe and Howley, 2001; Ryan et al., 1993). Therefore, the N protein serves as the templa te for RNA synthesis by encapsidating the genome into an RNase-resistant nucleocap sid (Knipe and Howley, 2001). The N protein associates with

PAGE 20

20 the P-L polymerase during transcription and repli cation and the M protein during virus assembly (Knipe and Howley, 2001). During an active infection, antibodies made against the N protein in the host are predominant and antibody to the N protein accoun ts for most of the complement fixing antibody (Graves et al., 1984; Norrby and Gollmar, 1972). The Phophoprotein The P gene contains a functional RNA editing si te upstream of overlapping reading frames that gives rise to an abundant number of polype ptides on a single mRNA transcript. The V and the C proteins are able to be transcribe by R NA editing (Knipe and Howley, 2001). This allows a shift to an alternat ive reading frame that results in translation of a new protein. For morbilliviruses, the P gene mRNAs are translated in to two non-structural proteins, V and C. The P protein is the only P gene that is structural and essential for vi ral RNA synthesis in all aspects (Curran et al., 1992; Knipe and Howley, 2001). Specifically, the P protein is an essential component in the viral RNA phosphoprotein co mplex (vRNAP), nascent chain assembly complex, RNA synthesis and the L protein need s to bind to the N:RNA template via the P proteins that maps to the C-terminal end that is relatively conserved (Horikami et al., 1992; Knipe and Howley, 2001). For morbilliviruses the P-carboxyl region represents the polymerase (pol) cofactor module and is never expressed by itself, but the module is translated from the unedited mRNA. Cystein-rich V and C Open Reading Frames (ORFs) The mRNA for the P pro tein is always transc ribed (unedited) from the viral genome. Transcriptional RNA editing with the addition of one G nucleotide at the editing site produces an mRNA that encodes for the V protein and RNA ed iting with the addition of two G nucleotides results in an mRNA encoding for the C protei n (Paterson and Lamb, 1990; Thomas et al., 1988).

PAGE 21

21 The V protein is expressed by all morbilliviruses and is found in the middle of the P gene. The C-terminal region of the V ORF is the most conserved of all the P gene ORFs and is found only as the C-terminal segment of a fusion protein. Therefore, this protein is never expressed by itself (Knipe and Howley, 2001). The V and C accesso ry proteins play a role in regulating viral RNA synthesis and countering host defenses to viral infection (Knipe and Howley, 2001). Matrix Protein The M protein is considered to be critical in viral morphoge nesis by interacting with the lipid b ilayer (envelope) and the cytoplasmic ta ils of the glycoproteins F and H (Knipe and Howley, 2001). The abundance of basic residues in the M protein and thei r interaction with the N proteins may be the driving force in formin g a budding virus particle and, therefore, viral assembly (Knipe and Howley, 2001). Fusion Protein The fusion or F protein is a surface g lycoprotein that mediates viral entry into the host cell by fusion of the virion envelope and the host cell plasma membrane at a neutral pH (Knipe and Howley, 2001). F proteins are synthesized as inactive precursors that must be cleaved by hostcell proteases. The fusion of the virion with the plasma membrane allows the nucleocapsid to be delivered into the cytoplasm. As the virus is re plicating, the F protein is expressed on the surface of the infected host cell and mediates fusion with the neighboring cells to form syncytia or multinucleated giant cells. Syncytia are characte ristic cytopathic effect s of morbilliviruses that can ultimately lead to tissue necrosis and spreading of the virus (Knipe and Howley, 2001). The F protein on the surface of infected cells also serves as new F pr oteins for new viruses that will obtain their envelope as they bud from the plasma membrane (K nipe and Howley, 2001).

PAGE 22

22 Hemagglutinin Protein The hem agglutinin or H protein is a surface glycoprotein that projects from the lipid membrane of the virus. Therefore, the H prot ein serves as an attachment protein and lacks detectable neuraminidase activity (Knipe and Howley, 2001). For MV vaccine strains, the cellular receptor molecule is CD46, a natural comp lement cofactor (Nanic he et al., 1993). CD46 is likely to cause virus aggreg ation during virus budding. Theref ore, this may be a reason why morbilliviruses in general do not need neuramin idase activity to free the virus from the cell surface (Knipe and Howley, 2001). The H glycopr otein is an antigenic protein because it projects from the surface of the virus and therefore the hosts immune system directly sees it. This is why this protein needs to evolve to avoid the host immune response. Therefore, neutralizing antibody responses are directed mos tly against the H glycoprotein and sometimes the F surface protein even though non-neutralizi ng antibodies are still ma de against the other viral proteins, especially the N protein (Santibanez et al., 2005). Neutralizing antibodies cant be made against the N protein because in a fully as sembled virion particle the N protein is not exposed on the surface of the virion like the tw o glycoproteins, H and F (Knipe and Howley, 2001). During an investigation of a natural infec tion of MV, antibodies to the H protein were the second most abundant to the N protein (Graves et al., 1984). Large Protein The large o r L protein is the least abundant of th e structural proteins because it is the last to be transcribed since it is located at the 5 end of the negative-sense genome. The L protein is considered structural because it forms the ribonucleoprotein complex along with the P and N proteins (Karlin et al., 2003; Kingston et al., 2004). The L protein is very large, containing approximately 2,200 amino acids, and these residu es are conserved among the genera. The L gene is thought to function as the viral polymer ase because of its large size, low abundance and

PAGE 23

23 its localization to the transcr iptionally active viral core (Kni pe and Howley, 2001). The P and the L protein form a complex, which is requ ired for polymerase activity with the N:RNA templates, but L is thought to contain the majority of the catalytic activity and is named the ribonucleoprotein complex (Curran et al., 1995; Hamaguchi et al., 1983; Horikami et al., 1992). Viral Transmission Morbilliv iruses can be transmitted by aerosol in droplet form and initial infection is believed to establish itself in the respiratory tract (Yanagi et al., 2006). From the respiratory tract the virus enters the local lymphatics and drains to the ly mph nodes where amplification of the virus occurs resulting in viremia (Yanagi et al., 2006). The primary infected blood cells are the monocytes and lymphocytes, which further trans port the virus to various organs of the host. It has been described that the lungs, skin, conjunc tivae, gastrointestinal tract, liver, kidney and genital mucosa are all affected by the viral infecti on (Hall et al., 1971; Kobune et al., 1996; McChesney et al., 1997; Sakaguchi et al., 1986). In humans, MV has an incubation time of 1014 days before clinical symptoms become detectable and can cause immunosuppression, lymphopenia and various neurological disorder s (Yanagi et al., 2006). Subacute sclerosing panencephalitis (SSPE) can occur several years after acute infection from a persistent MV infection in the central nervous system (P ermar et al., 2001; Rima and Duprex, 2006). Viral Absorption and Penetration The Edm onston vaccine strain of MV is able to use human CD46 as a cellular receptor for attachment and entry. CD46 is expressed on almost all nucleated human cells and is a member of the regulators of complement activation fa mily (Liszewski et al., 1991). As studies progressed, evidence began to accumulate that not all MV strains used CD46 as a receptor (Buckland and Wild, 1997). Signaling lymphocyte activation molecule (S LAM or CD150) is a glycoprotein of the immunoglobulin superfamily and a regulator of antigen-driven T-cell

PAGE 24

24 responses and macrophage function (Tahara et al., 2007). SLAM is a costimulatory molecule and therefore, its expression is restricted to B and T lymphocyt es, mature dendritic cells and macrophages (Aversa et al., 1997; Cocks et al., 1995; Sidorenko and Clar k, 1993). Wild type MV strains have been shown to use SLAM, not CD46, as cellular receptors (Ono et al., 2001a; Schneider-Schaulies et al., 1995; Tatsuo et al., 2000a; Yanagi et al., 2006). Edmonston, the vaccine and laboratory strain of MV uses both CD46 and SLAM. Use of two receptors is the result of the adaptation of the vaccines strains, as they are pa ssed and grown efficiently in mammalian cell lines like vero cells (African green monkey kidney cells) and MDCK cells (Madin-Darby canine kidney cells), by acquiring a number of mutati ons in their genomes (Parks et al., 2001a; Parks et al., 2001b). Amino acid re sidue 481 on the H gene has been specifically found to play an important role in determining the receptor usage of MV strains (Bartz et al., 1996; Hsu et al., 1998; Lecouturier et al., 1996; Nielsen et al., 2001; Shibahara et al., 1994; Tatsuo et al., 2000b; Vongpunsawad et al., 2004; Xie et al., 1999). The virus uses its own H surface glycoprotein to attach and absorb to the surface receptor CD46, SLAM and perhaps another receptor. Morb illiviruses do not have neuraminidase on their surface as a glycoprotein, therefore they cant use sialic acid as a receptor (Knipe and Howley, 2001). After attachment, morbillivir uses use the other su rface glycoprotein, the F protein, to fuse with the cellular plasma membrane found on th e cell surface at a neutra l pH and release the helical nucleocapsids into the cytoplasm of the host cell (K nipe and Howley, 2001). Viral uncoating or the mechanism to disrupt the ma trix:nucleocapsid (M:N ) contact once these proteins enter the hosts cytoplasm is not known fo r paramyxoviruses. In the case of influenza A virus, the equilibrium between self-assembly and disassembly is the pH change in the cell, which then allows for transcripti on and replication to occur (Knipe and Howley, 2001).

PAGE 25

25 Ribonucleoprotein (RNP) Complex Inside the en velope lies the RNA genome en capsidated by the N protein within a helical nucleocapsid to form the N:RNA template (Figure 1-1) (Kingston et al ., 2004). The RNA and N subunits can have such a strong stable interac tion that the nucleocapsi d structure does not disassociate in high salt concentr ations and density equilibrium centrifugation, indicating that the RNA is inside the nucleocapsi d structure (Vulliemoz and Roux, 2001). The phospho(P) and large (L) proteins make up the RNA-dependent RNA polymerase (RdRp) that carries out transcription and replication on the N:RNA template (Kingston et al., 2004). The P protein binds to the N protein in the C-terminal moiety of the N protein to direct templa te synthesis, and the Nterminal moiety encodes for all regions necessa ry for self-assembly and RNA binding (Figure 11) (Bankamp et al., 1996; Karlin et al., 2003; Kingston et al., 2004). The RdRp is a part of the RNP complex and works in transcription and tran slation, which were first distinguished when infected cells were treated w ith cycloheximide and mRNA sy nthesis continued but genome synthesis was lost (Robinson, 1971). Viral Transcription (mRNA Synthesis) Cis-acting prom oters or transcri ptases always begin viral RNA synthesis at the 3 end of the genome where they function to initiate leader RNAs to make mRNAs and they also initiate trancription of the antigenome (Figur e 1-2) (Knipe and Howley, 2001). The RNA genome of morbilliviruses is flanked at the 3 and 5 end by short extracistronic regions approximately 55 to 57 nucleotides at positions 79-84, 85-90, 91-96, which are called leader+ or genome promoter (GP) and leader- or anti-genome promoter (AGP), therefore indicating a high degree of se quence conservation in these areas among all members of the morbillivirus genus (Vulliemoz and Roux, 2001). These GP and AGP sequences have been

PAGE 26

26 predicted to represent promoter s for viral RNA synthesis with GP operating transcription and replication and the AGP only being used for replication (Vulliemoz and Roux, 2001). Early in the infection, during primary transcription and befo re the primary translation products have accumulated, the RdRp is restrict ed to synthesis of leader RNAs and mRNAs (Knipe and Howley, 2001). It is essential that every virion contai ns an RdRp that acts as a transcriptase that sequentially generates capped, polyadenylated mRNAs from each transcription unit during primary transcripti on (Brown et al., 2005). The downstream production of mRNAs depends on the termination of upstream mRNAs (Kolakofsky et al., 2005). The RNP complex transcribes each gene in a progr essive start-stop mechanism wh ere, after transcribing a gene, it encounters a stop codon followed by an intergenic trinucleotide (3GAA) (Brown et al., 2005). At this intergenic region, the transcriptase working with the RNP complex can continue to transcribe the next gene or de tach from the RNP complex (Fi gure 1-2) (Brown et al., 2005). Polyadenylation of each mRNAs is done by the Rd Rp seeing the intergenic trinucleotide and stuttering on a short run of te mplate U residues (four to seven nucleotides long) at the end of each gene (Knipe and Howley, 2001). The progr essive start-stop mechanism of the RdRp produces a gradient where genes like the N and P are transcribed in higher amount than the L gene. This gradient that favors pr oduction of gene transcripts at the 3 end of the genome is due to the imperfect frequency in which the RdRp rein itiates transcription of the next mRNA at gene junctions (Cathomen et al., 1998; Homann et al., 1990). Interestingly, paramyxoviruses can specifically down regulate the expr ession of particular genes, es pecially the F gene, when the RdRp reads through a junction and produces di-cis tronic (M-F mRNAs) and tri-cistronic (M-F-L mRNAs) in which only the upstream cistron is translated (Knipe and Howley, 2001).

PAGE 27

27 Once the primary transcripts have generated sufficient viral proteins, unassembled N protein (found in the RNP complex) begins to asse mble the nascent leader chain to coordinate assembly and synthesis of the RNA to cause Rd Rp to ignore the gene junctions and make the antigenome nucleocapsid. The P protein, part of the RNP complex, acts as a chaperone to deliver N to the nascent RNA a nd the P-L polymerase will initiate RNA synthesis at the 3 end of the antigenome in the absence of the P-N to make an AGP (Knipe and Howley, 2001). Genome Replication The genom e (negative polarity ) replicates by a full-length antigenome, which is a complementary copy and the antigenome is onl y found in an assembled form inside the nucleocapsid, similar to the genome (Figure 1-2) (Knipe and Howley, 2001). Antigenomes can represent 5% to 20% of the genome-sized RNAs in virus particles, but antigenomes contain no open reading frames (ORFs) and no mRNAs are known to be transcribed from them. Antigenomes are thought to serve th e specific purpose by acting as an intermediate and act as the template for genome replication (Knipe and Howl ey, 2001). Also, short tr ailer RNAs that are expressed from the antigenome 3 end are t hought to prevent the hos t cell from undergoing programmed cell death (Garcin et al., 1999). The nucleocapsid plays an important role in mediating the interaction between the RdRp and the genome (Galinski, 1991). It has been dem onstrated in an experiment with Sendai viruses that N associates with P protein to prev ent non-specific bindi ng of cellular RNA and coexpression of N and P prevent the encapsida tion of non-specific RNA by N (Curran et al., 1995). Hexamer Genome Length is Required fo r Genome Replication: Rule of Six The rule of six refers to the requirem en t of all paramyxovirus genomes known to be a polyhexameric length (6n + 0) to replicate efficiently (Kolakofsky et al., 2005). Therefore, the

PAGE 28

28 viral RdRp can initiate hundreds of nucleotides away from the 3 end of the genome, but only if the antigenome promoter is in the he xamer phase (Kolakofsky et al., 2005). In one reverse genetics experiment, mini-gen ome templates were transfected in infected cells, the results showed a requirement that paramyxoviruses need their genomes to be a a multiple of six (Vulliemoz and Roux, 2001). In efficient replication of non-hexamer-length genomes was not a result of the lack of encapsi dation of the cDNA-expressed mini-genome, but the inability of the viral RdRp to initiate at the 3 end of th e nucleocapsid (Knipe and Howley, 2001; Vulliemoz and Roux, 2001). Therefore, the rule of six must be determined by the recognition of certain nucleotides properly positione d in the promoter region of the 3 end in the N recognition points or po ckets (Vulliemoz and Roux, 2001). Likewise, in an in vitro study working with Nipah virus (NiV), which is a member of the Henipavirus genus within the Paramyxovirinae subfamily, it was shown that the virus genome was a multimer of six, but it was not known whether it conformed to the rule of six or depended on it for its functionality (Halpin et al., 2004). In this experiment CV-1 (Normal African Green Monkey Kidney Fibroblast Cell line) cells were infected with a vaccinia virus r ecombinant that expresses bacteriophage T7 RNA polymerase and transfected with one of a series of minigenome plasmids containing one to six nucleotide insertions at specific sites and three plasmids, each containing the N, P and L genes (Halpin et al., 2004). The results supported the rule of six and that hexameric phrasing positions of th e transcription initiation sites ar e conserved within the family Paramyxoviridae (Halpin et al., 2004; Kolakofsky et al., 1998). Virion Assembly and Release The site of intracellular nucleocapsid assembly is in the cytoplasm, just like all other events in the life cycle of the viruses in the family Paramyxoviridae (Knipe and Howley, 2001). It is theorized that there are two steps in the asse mbly of nucleocapsids (Knipe and Howley,

PAGE 29

29 2001). The first step is the association of free N subunits with the genome or template RNA to form the helical RNP structure (Knipe and Howl ey, 2001). The second step is the formation of the association between the P-L protein complex th at binds with the N:RNA complex to from the RNP structure or polymerase (Figure 1-1) (Knipe and Howl ey, 2001). Since paramyxovirus mRNAs are encapsidated, unlike the antigenomes, it has been concluded that the GP and AGP contain regions that encode for initiati ng encapsidation (Knipe and Howley, 2001). Paramyxoviruses obtain their envelope by buddi ng from the aplical surface of the cell (Knipe and Howley, 2001). The glycoproteins, H and F, are s ynthesized in the endoplasmic reticulum (ER) and undergo conformational matu ration before they are transported by the secretory pathway to the surface to be incorporat ed on the outside of the envelope with newly budding virions (Knipe and Howley, 2001). The m echanism of viral glycoprotein folding and conformational maturation is complicated and assisted by numerous folding enzymes and molecular chaperones (Knipe and Howley, 2001). Generally, only co rrectly folded and assembled proteins are transported out of the ER to the Golgi appara tus where the carbohydrate chains may be modified and cleavage occurs befo re transport to the plasma membrane (Knipe and Howley, 2001). The mechanism for virus as sembly at the plasma membrane is unknown, but the M protein is thought to play a major role in bringing the assembled ribonucleoprotein core to the appropriate areas on the plasma membrane to form a budding virion (Knipe and Howley, 2001). Cellular proteins are highly excluded in virion assembly and with measles virus it has been demonstrated that th e N protein distinguishes viral R NAs destined for encapsidation by the presence of a leader sequence (Castaneda et al., 1990; Knipe and Howley, 2001). Therefore, it is assumed that th e protein-protein interactions a nd the interaction of M with the cytoplasmic tails of the glycopr oteins of F and H are extremely specific and critical for proper

PAGE 30

30 virion assembly and budding (Kni pe and Howley, 2001). In a study where the glycoprotein cytoplasmic tails of recombinant MV and SV5 were deleted, these genetically engineered viruses were defective in assembly (Cathomen et al., 1998; Schmitt et al., 1999). The Effect of Morbilliviru ses on the Immune System Morbilliv iruses can be transmitted by aerosol in droplet form and previous reports suggested that initial inf ection establishes itself in the respir atory tract, but these studies were limited (Knipe and Howley, 2001; von Messling et al., 2004). A more recent publication has developed a different theory using a sensitive as say that incorporates a virulent recombinant canine distemper virus expressing a green fluorescent protein (GFP) (von Messling et al., 2004). GFP was used for easy detection to track the progression of the virus as it disseminated and infected ferrets (von Messling et al., 2004). In this study, it was shown that CDV first establishes itself in the lymphatic tissue of the oral cavity where it replicates efficiently. The virus then drains to local lymph nodes where amplification continues to occur and results in infected lymphocytes transporting the virus to va rious organs. As the circulating lymphocytes move the virus throughout the body, via the lymphatics, viremia occu rs and the virus can attack circulating monocytes (von Messlin g et al., 2004; Yanagi et al., 2006). Therefore, infection of immune cells can be described in three steps. First, the primary infected blood cells are the circulating T and B lymphocyte (von Messling et al., 2004; Yanagi et al., 2006). Second, lymphocytes residing in secondary lymphoid tissue were affected and further transport the virus to various organs of the host (von Messling et al., 2004; Yanagi et al ., 2006). In severe infections, the architecture of the spleen and lymph nodes has b een described to be partially destroyed along with the Peyers patches and to nsils, indicating that mucosal immunity (IgA) could be compromised (von Messling et al., 2004). Third, primary thymocytes were infected (von Messling et al., 2004). Infection of the respiratory tract was only described later in

PAGE 31

31 infection, but also in the skin, conjunctivae, gastrointestinal tract, liver, kidney and genital mucosa (Hall et al., 1971; Kobune et al., 1996; Pa terson et al., 1990; Sa kaguchi et al., 1986). The experiment with the ferrets is ground breaking since it has long been believed that morbilliviruses generally establish themselves in the respiratory trac t using the receptor CD46 (vaccine strains) or SLAM (wildtype strains) (Ono et al., 2001a; Schne ider-Schaulies et al., 1995; Tatsuo et al., 2000b). So how would the viru s infect epithelial cell if they do not express the SLAM receptor? A third unknown component has been hypothesized as source for morbillivirus attachment and entry that will al low spreading of the virus to the lymphatics (von Messling et al., 2004). Also, morbilliviruses may be using the oral cavity, concurrently with the respiratory tract, to insure their infectivity and su rvivability and also be more pathogenic. Since these viruses are aerosolized, theo retically, virus particle s could easily attach themselves in the oral cavity, while others travel down the trachea to establish themselves in the lungs. While one may believe either scenario, it is accepted that mo rbilliviruses, because of their affinity for T and B lymphocytes, primarily attack the two most important cells of the immune system (von Messling et al., 2004). Therefore, in severe infections or immunocompromised individuals, morbilliviruses prevent their hosts from mounting an immune response. Morbillivirus infections have long been reported to break-down their host s innate immune system, rendering the animal susceptible to opportunistic pathogens (Heany et al., 2002). Interestingly, in a study of MV, RPV, PPRV and CDV infection, the researchers also found th at both T and B subsets of lymphocytes were infected (Heany et al., 2002). Also, lymphoproliferative responses were suppressed up to several months in naturally in fected dogs, even after the morbillivirus was cleared from the host (Heany et al ., 2002). In humans, MV has an incubation time of 10-14 days before clinical symptoms become detectable a nd this has been similarly described for other

PAGE 32

32 morbilliviruses like RPV, PPRV, and CDV (Heany et al., 2002; Yanagi et al., 2006). In the study with ferrets, which are highly susceptible to CDV, the comple te destruction of the immune system was seen by one week (von Messling et al., 2004). For cetaceans, the signs of immunosuppression ha ve been described and relate to classic morbillivirus pathogenesis. In 1990, DMV was fi rst isolated and during this outbreak killed thousand of striped dolphins ( Stenella coeruleoalba ) in the Mediterranean Sea (Domingo et al., 1990). In the following two years, various isolati ons of DMV were obtained as the lethal virus traveled to Italian and Greek waters (Domingo et al., 1992; Domingo et al., 1995). During this mass mortality event, it was described that DMV infection caused encephalitis, bronchiointerstitial pneumonia with formation of multinuc leated syncytia, severe depletion of the lymph nodes and a predisposition to other secondary systemic infections from toxoplasmosis and aspergillosis (Domingo et al., 1990; Domingo et al., 1992; Domingo et al., 1995). Retrospectively, two distinct patte rns of infection were observed in the striped dolphin epidemic in 1990 (Domingo et al., 1995). The first was sy stemic, multi-organ infection, with primary damage to the lung, lymphoid tissue, and CNS, and the second consisted of a localized infection of the CNS, without lesions or DMV antigen dete cted in extraneural tis sues (Domingo et al., 1995). Reservoir and Vector Theories A study of the Baikal fauna in Lake Baikal, Siberia, showed that CDV was isolated from gastropods, specifically snails ( Baicalia carinata and Lymnaea auricularia ), living in Lake Baikal. The virus was shown to be similar to CDV by RT-PCR and sequencing of the conserved P gene after culturing and inoculation into ferrets (Kondratov et al ., 2003). This manuscript was the first to propose a possible reservoir for a ny of the marine morbilliviruses, and for the terrestrial morbilliviruses, there are no known reservoirs; only carrier theories. For all seven

PAGE 33

33 morbillivirus species, transmission occurs by dir ect contact and generally the viruses rely on infection of non-previously exposed hosts and large populations to sustain themselves (Barrett et al., 1999; Knipe and Howley, 2001). For MV, 1 out of 100 people have been known to acquire a persistent infection or encephalitis and only 1 out of 1000 will die (CDC Web, 2008). Therefore, those persons who acquire a persistent infection are carriers of the virus and could be shedding the virus to those persons who are susceptible or not vaccinat ed. For RPV and PPRV, which infect large and small ruminant s, respectively, contact betwee n infected and non-vaccinated animals (like immature animals) is critical for their survival (Barre tt et al., 1999). For the marine morbilliviruses, it is generally accepted that these viruses also need large populations of susceptible individuals to sustain themselves and persistent infec tions have been observed in a wide range of cetaceans from serological surveys us ing virus neutralization assays (Barrett et al., 1999; Knipe and Howley, 2001). For viruses, a reservoir can be defined as a nything (person, animal, plant, substance) in which an infectious agent normally lives and multiplies. A viral vector can be defined as a carrier that transfers an infec tive agent from one host to another (Knipe and Howley, 2001). For both cetacean morbilliviruses, the pilot whale ( Globicephalus melas ) has been theorized to be a vector because of its long migrational patterns and possible contact with up to thirteen various species of cetaceans (Taubenberger et al., 2000). A 378 nucleotide fragment of the P gene and 230 nucleotide fragment of the N gene was sequen ced from a pilot whale and shown to be most closely related to DMV and PMV, but distinct (T aubenberger et al., 2000). For PDV, the vector and possible reservoir co uld be grey seals ( Halichoerus grypus ) that migrate from the Northern Artic annually (Barrett et al., 1993; Harkonen et al ., 2006). Grey seals have been proven to carry PDV without being significantly aff ected and come into contact w ith large populations of harbor

PAGE 34

34 seals ( Phoca vitulina ), which are significantly affected, at common haul-out sites along the North Sea (Barrett et al., 1995). Unfortunately, a clear reservoir or vector speci es still needs to be elucidated for any of the marine morbilliviruses. Serology During an active morbillivirus infection, antibodies made against the N protein in the host are predominant because of the N genes ideal location at the 3 end of the genome and the start-stop mechanism of the RNA dependent RNA polymerase (RdRp) (Graves et al., 1984; Norrby et al., 1972). The H and F proteins are glycoproteins that project from the surface of the virion (Knipe and Howley, 2001). Therefore, neutralizing anti body responses are primar ily directed against the H protein and some against the F protein even though non-neutralizing antibodies are still made against the other viral proteins, especially the N protein (Santibanez et al., 2005). During a natural infection of MV, antibodies to the H prot ein is the second most a bundant to the N protein (Graves et al., 1984). It is known for MV, RPV and PPRV that natura l infection or vaccin ation can provide lifelong immunity (CDC Web, 2007; Ngicha be et al., 2002). It is theori zed that this could hold true for marine morbilliviruses, but publ ished serological surv eys with wild populati ons have thus far been limiting. What can be extracted from a few serological surveys is that a large number of animals, especially cetaceans, are being exposed and are possibly persistently infected depending on antibody levels, but are not showing clinical signs or succu mbing to the infection (van Bressem et al., 1998). Perhaps these findings reflec t an adaptation of the marine morbilliviruses to survive and find new hosts, just like MV, whic h in a natural infecti on only kills 1 out of 1000, but causes a persistent infection in 1 out of 100 (CDC Web, 2007).

PAGE 35

35 The Terrestrial Morbilliviruses Peste-des-petits Rumi nant Virus (PPRV) PPRV pri marily infects sheep and goats and se rological epidemiologi cal studies and virus isolations show it is currently present in Africa, the Middle East, the Arab ian Peninsula, southern Asia, Turkey and Russia. Cattle are actually dead-end hosts for PPRV, but are extremely susceptible to RPV. PPRV, like all morbillivir uses, needs close contact between infected and susceptible animals and infection results in an a cute, highly contagious disease characterized by fever, anorexia, necrotic stomatitis, diarrhea, pur ulent ocular and nasal discharge and respiratory distress (Barrett et al., 2006). Infection of PPRV is rapidly fatal in young animals and can cause persistent infection in mature an imals (Barrett et al., 2006). PPRV is still problematic in most of the previously described countries and vaccination strategies are currently being implemented to prevent the spread of the viru s and vaccination can provide lifelong immunity (Barrett et al., 2006). Rinderpest Virus (RPV) RPV most comm only infects large ruminants like cattle and buffalo and the first veterinary school in France was established in 1762 to trai n individuals to deal with the disease and treatment (Barrett et al., 2006). RPV causes typica l clinical signs as those described above for PPRV and many pandemics are described in histor y, which led to the development of the first vaccine. For example, at one time RPV was responsible for killing 80-90% of Africas cattle (Barrett et al., 2006). Over the last decade, reve rse genetics have allowed the development of several improved molecular vacci nes (Barrett et al., 2006). Reve rse genetics can simply be defined as an approach to discovering the function of a gene that proceeds in the opposite direction of so called forward genetics and has enabled negative sense viral genomes to be extensively studied. Interesti ngly, cattle which have been pr eviously exposed to PPRV have

PAGE 36

36 trouble mounting an immune response to th e RPV vaccine because PPRV-neutralizing antibodies can neutralize the attenuated or reco mbinant virus in the vaccine. Since the 1950s, several joint eradication program s were started, but ended in fa ilure because of the lack of compliance from all countries. Today, the F ood and Agricultural Organization of the United Nations (FAO) runs the Global Rinderpest Erad ication Program (GREP) and has the goal for complete eradication by 2010 (Barrett et al., 200 6). Today, RPV only exists in eastern Kenya and southern Somalia (Barrett et al., 2006). Measles Virus (MV) Measles virus (MV) is the type species for the genus and only infects hum ans. MV has been well characterized since its isolation in 1954 when Enders and Peebles inoculated primary human kidney cell lines with the blood of David Edmonston, a child affected by measles (Enders and Peebles, 1954). The first licen sed live attenuated vaccine was distributed in the U.S. in 1963 named Edmonston-B. Unfortunate ly, it was highly reactive and in 1975 was replaced with more attenuated strains re-named Edmonston A and B (Rota et al., 1994). Therefore, since MV was isolated over fifty years ago, it can be used as a prototype for the viral lif e-cycle, which is not understood for all species in the Morbillivirus genus. Currently, in most developed countries the measles vaccines in use is the trivalent MMR (vaccine contains 3 live but atte nuated viruses: Measles, Mump s, and Rubella) vaccine (CDC On-line 2007; Barrett et al., 2006) After only two doses, the MMR vaccine has been shown to induce life-long immunity (CDC On-line, 2007; Hilleman, 1994; Knipe and Howley, 2001). Ninety-five percent of people pr oduce adequate responses to all three viruses after the first injection and with a second in jection, 99.99% of people are protected (CDC On-line, 2007). Interestingly, a killed vaccine was introduced in 1964, but it had to be withdrawn in 1967 because it caused exacerbated dis ease in recipients when they c ontracted wild-type measles virus

PAGE 37

37 (Barrett et al., 2006). It is sti ll unclear of the exact cause of the exacerbation, but one likely theory is that the formalin-inactivated vaccine failed to have the B cell response undergo somatic hyper-mutation resulting in non-protective comp lement activating antibodies and atypical measles reactions (Polack et al., 1999; Polack et al., 2003). Therefore, the development of recombinant vaccines has been drastically hinde red by the inability to understand the exact mechanism causing atypical measles and to date no recombinant vacc ine has made it past clinical trials (Barrett et al., 2006). Since 1993, areas of the United States where pe ople refuse vaccination have led to the largest outbreaks of measles (CDC On-line, 2007). These particular areas include states such as Utah, Nevada and Christian Scie ntist schools in Missouri and Illi nois (CDC On-line, 2007). The worst US epidemic, since the vaccination was available almost twenty years prior, occurred in these areas during 1989-1993 (CDC On-line, 2007). During this time, 55,622 cases were reported with the majority of the cases being Hispanic and African American children under the age of five. Unfortunately, 123 people died, w ith 90% having no previ ous vaccination history (CDC On-line, 2007). Only because most people in the U.S. are already vaccinated do we not see hundreds of outbreaks occurring weekly across the nation. The convenience of global transportation has led to the need for vaccination programs to continue to exist in the U.S. It is true that the vaccine has decrea sed the number of annual cases to the lowest point ever recorded, but measles is still common, even epidemic, in othe r parts of the world despite the efforts of the WHO to eradicate the virus (CDC On-line, 2007; Ba rrett et al., 2006). Succ ess of the eradication campaigns in the Americas proves that it is po ssible to break the transmission of endemic MV (Barrett et al., 2006). In the case of unstable countries rava ged by war, poverty and other calamities, there needs to be stronger surveillance programs and also awarene ss that MV is still a

PAGE 38

38 deadly disease in order for the eradication progr am to be successful in the global eradication campaign (Barrett et al., 2006). Marine Morbilliviruses Canine Distemper Virus (CDV) Prior to 1987, CDV was thought to only naturally infect Canidae, Ursidae, Mustelidae, Viverr idae and one member of the order Artiodactyla, the collared peccary or musk hog (Barrett et al., 2006). In the early 1990s, CDV was also isolated from Felidae and Hyaenidae in association with mortalities of large cats in American zoos and in the Serengeti Plains in Tanzania (Haas et al., 1991; Roelke-Parker et al., 1996). More recently, CDV has been described to cause vaccine-induced infections in wild carnivores from domestic dogs that come into contact with them (Bush et al., 1976; Carpente r et al., 1976; Deem et al., 2000). Therefore, CDV infection has extreme implications as a pathogen for free-living and captive carnivores (Deem et al., 2000). From disease outbreaks an d serological surveys, evidence of vaccine induced CDV infection has been described in all families of terrestrial carnivores: Canidae, Felidae, Hyaenidae, Musteli dae, Procyonidae, Ursidae and Hyaeniridae (Barrett et al., 2006; Bush et al., 1976; Carpenter et al., 1976; Deem et al, 2000). Natural infec tions of CDV have also been reported in raccoons, which also may play a role in transmitting the virus to non-vaccinated dogs and other wild animals (Deem et al., 2000). In the 1990s, the rapid decline of black-footed ferrets and lions was attributed to CDV. Seroprevalence studies w ith African wild dog populations indicated that nationa l parks in Northern Botswana and Namibia were all almost 100% seropositive and were most likely the source of CDV infection for the black-footed ferrets and lions (Woodroffe et al., 1997). Mortality in CDV infected animals varies greatly among species. Ferrets have almost a 100% mortality rate and domestic dogs have been reported to have a 40-50% mortality rate. CDV can be transmitte d by aerosols, body excretions and secretions.

PAGE 39

39 Viral shedding has been reported to last as long as 60-90 days and clinical si gns are those typical to other morbilliviruses like re spiratory distress, anorexia, di arrhea, mucopurulent and ocular discharge, encephalitis, and leth argy (Deem et al., 2000). Currentl y, vaccines in wild animals are used in species considered endangered, such as the black-footed ferret and red pandas, and the Field Taxon Advisory Group does not recommend vaccination of non-domestic animals because of immunosuppressive concerns a nd cost-effectiveness (D eem et al., 2000). In the United States, CDV is most prevalent in raccoons in the southeastern U.S., part icularly Tennessee, and takes on a cyclic nature, showing up every five to seven years (CDC Web, 2008). In the winter of 1987-88, there was a mass mort ality of a population of fresh water seals ( Phoca sibirica ) in Lake Baikal, Siberi a (Barrett et al., 2006; Likhos hway Ye et al., 1989; Osterhaus et al., 1988). The virus was isolated and sequence analysis confirmed it to be genetically closest to CDV. The seals were most likely exposed to the virus by predators at haulout sites on land (Grachev et al., 1989; Likhos hway Ye et al., 1989; Visser et al., 1990). Sequence analysis confirmed that the viral strains inf ecting the seals were not phocine distemper virus (PDV), which at that same time was causing an unusual mortality event of European harbor seals ( Phoca vitulina ) in the North Sea (Barrett et al., 2006; Osterhaus, 1989). During the summer of 1997 and 2000, CDV infected the Caspian seal ( Phoca caspica) population (Forsyth and Kennedy, 1998; Kennedy et al., 2000). Caspian se als are small phocids that inhabit all parts of the Caspian Sea and are still listed as endange red due to the threat of CDV infections, local hunting from wolves and high concentrations of toxic pollutants in their environment that can reduce their ability to breed (B arrett et al., 2006; Kuiken et al ., 2006; Watanabe et al., 1999). Not only can pollutants decrease th e ability of the marine mammal to breed, but it has been well documented that organochlorines are immunosuppre ssive and are associated with increased viral

PAGE 40

40 disease (de Swart et al., 1995; Ko ller and Thigpen, 1973; Lamb et al ., 1990). Retrospectively, a mass mortality event of crabeater seals ( Lobodon carcinophagus ) in the Antarctic during the 1950s might have also been associated with CDV, but at the time the acute deaths of the seals were linked to an unkown viral in fection of the upper respirator y tract (Laws and Taylor, 1957). Since there are no known terrestria l carnivores in the Antartic, sled dogs, used for civilian transportation, which were shedding the virus as they came into contact with the seals could explain this unusual mortality event (Bengt son et al., 1991; Laws and Taylor, 1957). Interestingly, serological survey of the crab eater seal population in the 1990s showed a high prevalence of antibodies to CDV suggesting that the virus is well esta blished in the colony (Bengtson et al., 1991). Phocine Distemper Virus (PDV) In 1988, a novel m orbillivirus killed 60% of the European harbor seal (Phoca vitulina ) populations and thousands of grey seals ( Halichoerus grypus ) (Harkonen et al., 2006). The 1988 seal virus was genetically distinct from canine distemper virus, which infected Baikal seals ( Phoca sibirica ) in Siberia for the first time just a year earlier (Bostock et al., 1990; Kennedy et al., 1988b; Osterhaus et al., 1989; Osterhaus, 1990; Osterhaus and Vedder, 1988). Therefore, the novel seal virus was named phocine distemper virus (PDV) because it infected phocids (true seals) (Cook, 1989; Cosby et al., 1988; Haas et al., 1991; Mahy et al., 1988). On April 12, 1988, the first report of disease aff ecting harbor seal populations occurred in the North Sea on Anholt Island, lo cated in the central Danish Kattegat (Harkonen et. al., 2006; Osterhaus and Vedder et al., 1988). By June, the disease had spread to seal populations in the southwestern Baltic Sea, southern Norway and the Wadden Sea and by September, it had spread to harbor seal populations in Ireland, Denmark, Scotland and England (Harkonen et. al., 2006). In total, the 1988 epizootic killed approximately 23,000 seals and because of the long

PAGE 41

41 migrational patterns of transient seals, this most likely explains the capability of PDV to be carried over long distances and infect nave nonmigratory populations of seals throughout the North Sea (Harkonen et al., 2006; Jauniaux et al., 2001). On May 4, 2002, the North Sea harbor seal populations were again infected by PDV (Jensen et al., 2002). Coincidentally, this outbreak also started on Anholt Island, but the migrational pattern of the viru s varied slightly from the 1988 outbreak because the Dutch and German Wadden Seas were not affected in 2002. Ultimately, the 2002 outbreak claimed >30,000 harbor seals, but the mortality between the two outbreaks differed drastically between the regions from the 1988 outbreak (Harkonen et al ., 2006). Overall, the source for both the 1988 and 2002 outbreaks of PDV has been theorized to have started from the unusual contact with infected Arctic seals prior to migration S outh to the North Sea which most likely occurred because of the abnormally warm winter (Dietz et al., 1989). In a serological survey, there were approximately 1,600 Greenland se al blood and tissue samples collected during 1984-1987 (prior to the 1988 epizootic) to meas ure heavy metal concentrations in the Greenland marine environment and the majority of the samples te sted in a virus neutra lization assay, using the Onderstepoort strain of CDV, ha d neutralizing titers of 1/256 indi cating that the antibodies were induced by a morbillivirus antigenically si milar to CDV (Dietz et al., 1989). An important question whose answer has el uded biologists for many years was how PDV unexpectedly jumped between geographically separated populations of harbor seals. Interestingly, the grey seal (Halichoerus grypus ) became the primary candidate to support the proposed vector theory and was proven to be ab le to carry PDV without being significantly affected (Barrett et al., 1995). Also, grey seals are known fo r their long migr ational patterns whereas harbor seals are more sedent ary (Harkonen et al., 2006).

PAGE 42

42 To investigate disease transmission and its effects on the immune system, a study using virus neutralization assays and radio-immunoprecip itation assays compared the susceptibility of the two seal species to determine if grey seal s have a stronger anti body response than harbor seals (Duignan et al., 1997). It was found that free-ranging grey seals ha d a significantly higher antibody titer than harbor seals, who were also free-ranging (Duignan et al., 1997). Interestingly, in three positive controls (sera from animals in the 1988 outbreak) and sera from free-ranging animals, the sera only weakly precipitated the hemagglutinin (H) and fusion (F) glycoproteins while the grey seal positive control and free-rang ing samples strongly precip itated these proteins (Duignan et al., 1997). It is well documented th at neutralizing antibodies are made mostly against the H protein, but also th e F protein (Santibanez et al., 2005). Weak precipitation of the H and F glycoproteins from the ha rbor seal positive controls, which had reported encephalitis, could indicate chronic or pers istent infection (Duignan et al ., 1997). In dogs that have a persistent neurological in fection of CDV, it has been describe d that they also have a marked decrease, almost diminished, production of antibodi es against the glycoprot eins (Duignan et al., 1997). More recently, studies have investigated specific variation in lo ci between the major histocompatibility complexes (MHC) I (CD8+) a nd II (CD4+), which are ge nes involved in the infection pathway (Paterson et al ., 1998; Samson et al., 1996). In terestingly, inbred individuals have shown to have higher susceptibility to diseas e and this has led to the question: Did genetic variability influence the different levels of mo rtality amongst harbor seals (Harkonen et al., 2006). This also leads to another question, Do gr ey seals have a stronger innate immunity or has natural selection led to more resistant genot ypes for grey seals (Galvani et al., 2004; Harkonen et al., 2006). There is still no evidence that low genetic divers ity at MHC loci make harbor seals more susceptible to PDV because so me of the most severe ly affected populations

PAGE 43

43 had high genetic diversity compared to other car nivores (Goodman, 1998). Th erefore, the higher susceptibility of harbor seals to PDV compared to grey seals is st ill a mystery. Interestingly, the role of organochlorines (OC) ha s been speculated as a component of innate immune suppression from the 1988 epizootic because of high OC c oncentrations found in the blubber of seals (Harkonen et al., 2006). This theory has been dismissed due to recordings of decreased OC levels in several areas of the North Sea prio r to the 2002 PDV outbreak (Harkonen et al., 2006). Therefore, from the PDV outbreaks, researchers have been able to pinpoint the grey seal as the possible carrier or even vector to explain how the virus was ra pidly jumping across different countries for both the 1988 and 2002 outbreaks. Th e reason for the increased susceptibility of harbor seals to PDV still needs to be elucidated, but immunosuppression ma y be a key factor. Besides Europe, population studies in Canada with harbor and grey seal s also suggest PDV is endemic and perhaps the visual mortality is re latively insignificant because these areas have a low human density (Henderson et al., 1992; Ross et al., 1992). Cetacean Morbilliviruses: Porpoise Morbillivirus (PMV ) & Dolphin Morbillivirus (DMV) Between 1988 and 1990, a porpoise morbillivirus (PMV) was isolated for the first time from six harbor porpoises ( Phocoena phocoena) that stranded along the Ire land coasts. At first, this unusual mortality event was t hought to be linked to the epiz ootic occurring with local seal populations, but then harbor porpoises also st randed along the Dutch, English and Scottish coastlines (McCullough et al., 1991; Visser et al., 1993a; Visser et al., 1993b) and the PMV isolates were shown to be novel and distin ct from PDV and CDV (McCullough et al., 1991; Welsh et al., 1992; Visser et al., 1993c). Soon af ter, a dolphin morbilliv irus (DMV) was first isolated and characterized as novel from Mediterranean striped dolphins ( Stenella coeruleoalba ) that were stranding by the thousa nds along the Mediterranean coas ts of Spain, Italy and Greece between 1990 and 1992 (Domingo et al., 1990; van Bressem et al., 1991; van Bressem et al.,

PAGE 44

44 1993). DMV and PMV isolat es from these outbreaks were initia lly characterized against a panel of monoclonal antibodies for CDV and PDV and then later in ELISAs and indirect immunofluorescense assays to show that they were similar but distinct from PDV and CDV (Barrett et al., 1993; Blixenkrone -Moller et al., 1994; Haffar et al., 1999; Kennedy et al., 2005; McCullough et al., 1991). Later, phylogenetic analyses actually placed DMV and PMV more closely related to the terrestrial morbilliviruses like RPV, PPRV, and MV than to CDV and PDV isolates (Figure 1-3) (Banyard et al., 1993; Barrett et al., 2008; BlixenkroneMoller et al., 1994; Bolt et al., 1994). At about the same time as the European epizootics, more than half of the inshore Atlantic bottlenose dolphin ( Tursiops truncatus ) population along the Atlantic coast (New Jersey to Florida) of the United States was estimated to ha ve died (Krafft et al., 1995). No virus was isolated from stranded or dead dolphins, but retrospective immunohistochemistry studies, using DMV labeled probes, along with other histopath ological findings, which found characteristic multinucleated syncytia, led to the conclusion that DMV and PMV were the primary cause of the mass mortality event (Krafft et al., 1995). Later, considering the population studies prior to 1987 and then in the early 1990s, it was estimated that at most, only 27% of the inshore population of bottlenose dolphins was effected and not the in itial estimation of 50% (McLellan et al., 2002). Along the coast of the Gulf of Mexico in 1993, there was another inci dent of a bottlenose dolphin stranding and dying from a cetacean morbil livirus infection, but ag ain, a virus was never isolated (Lipscomb et al., 1994; Lipscomb et al., 1996). Since th e 1987-1988 mass mortality event of bottlenose dolphins, there have been numerous reports of cetacean morbillivirusinduced mortality along the Atlantic and Pacific coasts, but to date, no morbillivirus has been isolated from cetaceans that stranded from U.S waters.

PAGE 45

45 The order Cetacea is broken into two suborders, Ondontoceti which represents the toothed whales, and Mysticeti which represents the non-toot hed or baleen whales. All previously described morbillivirus epizootics above involved the ondot ocetes, but in 1997 two immature fin whales ( Balaenoptera physalus) stranded and died and it was the first confirmed report of morbillivirus in baleen whales (Jauniaux et al., 2000). Pathological investigations revealed multinucleated syncytia with large in tranuclear inclusion bodies and immunolabeling was positive for anti-morbillivirus antibodies. Prio r to this publication, morbillivirus infection and exposure had been described from serum samp les tested in serological assays from fin whales in Icelandic waters and adult minke whale ( Balaenoptera acutorostrata ), but there was no pathological or molecular evidence to suppor t these findings (Blixenkr one-Moller et al., 1996; Di Guardo et al., 1995). The close sequence relationship between the PMV and DMV has traditionally led them to be classified as two different strains under one species of virus, cetacean morbillivirus (CeMV), which is the same similarity that exists among the various strains of RPV and also PPRV (Barrett et al., 1993). Furthermore, PMV and DMV are not confined to one species because a virus more closely related to PMV has been detected in dophins, where all previous isolates of PMV had been from porpoises (Taubenberger et al., 1996). More recently, others have speculated that DMV and PMV are more genetically distinct than previously thought based on the same guidelines used to classify different strains of measles (van de Bildt et al., 2005). In this classification system, MV strains are characte rized based on the nucleotide identities and similarities found between the complete ORF for th e H gene and also the C-terminal domain of the N gene (WHO, 1988). The most distant st rains of MV have a maximum divergence of 12.4% in the C-terminal domain of the N gene and only a 7% divergence between their H genes

PAGE 46

46 (van de Bilt et al., 2005). The C-terminal do main of the DMV and PMV are 17.2% divergent in this region, supporting the distinct viral spec ies idea under the MV classification system. Whatever the case may be, more virus isolates need to be obtained to fully determine the genetic relationship for these ecologi cally important viruses. In spite of the impact of marine morbill ivirus disease on marine mammals, the viral vector(s) and reservoir(s) are st ill, for the most part, unknown. It has been speculated for the cetacean morbilliviruses that the pilot whale ( Globicephala spp.) may be an enzootic source for these viruses since they move in large groups or pods, can be found in all of the major oceans in the world and have long migrationa l patterns that allow them to co me into contact and associate with many other cetacean species (Barrett et al ., 2006). Serological surv eys performed in the mid-1990s showed evidence of morbillivirus infec tion in pilot whales and during the 1982 and 1993 mass strandings of pilot whales in the Me diterranean Sea, over 90% were morbillivirus seropositive (Barrett et al., 2006; Duignan et al., 1995). Simila rly, an investigation of harbor porpoises from the German North and Baltic Seas that stranded and died between 1991 and 1997 showed morbillivirus titers in 50% of the an imals evaluated in virus neutralization assays (Muller et al., 2002). Even though morbillivirus inf ection was not determined to be the cause of death of these 74 animals, high ti ters do indicate a continuous sp read of infection among these harbor porpoise populations (Muller et al., 2002). Morbilliviral Diagnostics Diagnostics have rapidly pr ogressed since the developm en t of PCR in 1983 by Dr. Kary Mullis. It is hard to imagine that a method developed less than 30 years ago has revolutionized science and has become an indispensable tec hnique for many different areas of biology and chemistry, including molecular virology. In the cas e of marine morbilliviruses, there are several previously described molecular assays that allow for the detection of DMV and PMV using

PAGE 47

47 conventional RT-PCR and rtRT-PCR, but the prim ers and probe sequences were based on the P gene, which is a highly conserved area of the genome (Barrett et al., 1993 ; Saliki et al., 2002). Using these methods, the PCR produ cts need to be sequenced to identify the exact morbillivirus causative agent. For PDV, there has been a rt RT-PCR previously described, but it too is based on the P gene and for CDV, there have only been rtRT-PCR assays described for the terrestrial strains, none for the aquatic (E lia et al., 2006; Hammond et al., 2005; Scagliarini et al., 2007). Therefore, the first specific aim of this project was to develop rtRT-PCR assays that can detect and differentiate between the four known ma rine mammal morbilliviruses and also be quantitative. For the marine morbilliviruses, serological detection has been reported using virus neutralization assays, ELISA assays that use m onoclonal antibodies, and ELISA assays that use recombinant RPV-N (a terrestrial morbillivirus ) protein (Reidarson et al., 1998; Saliki et al., 2002). There are multiple disadvantages to these current methods. First, virus neutralization assays require the use of live virus and are very time consuming, with results taking up to one week. Secondly, having access to monoclonal an tibodies is not always realistic and their production can be laborious. Therefore, the seco nd specific aim of this project was to express the N protein of DMV in a baculovirus ( Autographa californica ) expression system that would have the potential to be used as an antigen in an ELISA assay to detect antibodies found in sera collected from wild marine mammals. A more recent approach for protein expression has been the application of another eukaryotic system, yeast. Similar to inse ct cells, yeast have the added advantage over prokaryotic expression systems, like bacteria, in that they perf orm necessary post-translational modifications (protein folding and glycosyla tion). Additionally, un like other eukaryotic

PAGE 48

48 expression systems, yeast can be grown to very high densities with pr oduction durable strains and low overall production costs (Slibinskas et al., 2004). Using recombinant yeast strains to express morbillivirus proteins has only been de scribed for MV and RPV and not for any of the marine morbilliviruses (Samuel et al., 2003; Sh aji and Shaila, 1999; Slibinskas et al., 2004). Therefore, the third and final spec ific aim of this project was to express the N protein of DMV in yeast ( Kluyveromyces lactis ) and compare the yeast expression to the baculovirus expression system in terms of efficiency, production costs, time, and the ability of the nucleocapsid-like structures to be used as antigen in an ELISA system for the det ection of morbillivirus antibodies in sera. The three specific aims described above are desc ribed in three distinct chapters of this dissertation and are intended to be able to stand alone with the overall goal of submitting each for publication.

PAGE 49

49 Figure 1-1. Schematic diagram of the ribonucleoprote in complex which is involved in all aspects of viral transcription and re plication. The nucleocapsid binding domain, located in the C-terminal region of the N protein, binds the phosphoprotein which associates with the large protein. All together, this complex comprises all the catalytic activity of the virus. This diagram was taken from the following publication: Kingston, R., Hamel, D.J., Gay, L.S., Dahlquist, F.W., Ma tthews, B.W., 2004. Structural basis for the attachment of a paramyxoviral polymerase to its template. Proc. Natl. Acd. Sci 101, 8301-8306. Kingston et al., 2004

PAGE 50

50 Figure 1-2. Morbillivirus transcription (A) and rep lication (B). For morbilliviruses, transcription (A) occurs by a transcriptional gradient where the RNA polymerase transcribes genes located at the 3 end of the negative sens e genome in higher amounts, like the N gene, than genes located at the 5 end of the ge nome, like the L gene. For replication (B), the RNA polymerase reads through all stop codons and intergenic sequences to amplify a full positive sense copy of the antigenome. The antigenome serves as a template to make full copies of the negative sense genome. N P/V/C M F H L 3 5' A B

PAGE 51

51 Figure 1-3. Divergent phylogram of the deduced amino acid se quences from the complete N gene of all member of the morbillivirus genus. The tree was generated by Clustal W slow and accura te function using Gonnet 250 re sidues weight table, gap penalty of 10 and gap length penalty of 0.10. GenBank accession numbers are: NC_005283-Dolphin morbillivirus (DMV), EF042819 Canine distemper virus (CDV), NC001498-Measles vi rus (MV), AJ849636-Peste-despetits ruminant virus (PPRV), AY899330-Rinderpest virus (RPV), and X75717-Phocine distemper, AY949833-Porpoise morbillivirus (PMV). Divergent phylogram with 0.1 dive rgence scale representing 0.1 ami no acid substitutions per site. 0.1 Divergence D D M M V V P P M M V V PPRV MV RPV C C D D V V P P D D V V

PAGE 52

52 CHAPTER 2 DEVELOPMENT OF REAL-TIME RT-PCR ASSAYS FOR THE DIFFERENTIAL DETECTI ON OF MARINE MORBILLIVIRUSES Introduction The Morbillivirus genus is classified under the subfa mily Paramyxovirinae within the family Paramyxoviridae. Morbilliviruses possess a single-stranded, negative sense RNA genome of approximately 16 kilobases (Kb) in length (Knipe and Howley, 2001). Their genomes encode six genes, of which the nucleocap sid (N) is one of the least conserved (Knipe and Howley, 2001). Transcription begins at the 3 end of the genome where the N gene is advantageously located. Short in tergenic sequences lead to a pr ogressive start-st op transcription mechanism that ultimately leads to increased translat ion of the N gene (Brown et al., 2005). During an active infection, anti bodies against the N protein ar e the most abundantly produced (Knipe and Howley, 2001). The Morbillivirus genus contains some of the most devastating viruses known to date, such as measles virus (MV) of humans, canine distem per virus (CDV) of carnivores, rinderpest virus (RPV) of cattle and other large ruminants, and peste des petits ruminants virus (PPRV) of sheep, goats and other small ruminants. In 1987, an epiz ootic with high mortality in freshwater seals from Lake Baikal, Siberia, was caused by a strain of CDV and was the first report of a terrestrial morbillivirus entering the aquatic environment (Gr achev et al., 1989; Osterh aus et al., 1988). At about this same time, a morbillivirus outbreak was killing more than half of the inshore population of Atlantic bottlenose dolphins ( Tursiops truncatus ) along the Eastern coast of the United States (Krafft et al., 1995; Lipscomb et al., 1994). No virus was isolated from stranded or dead dolphins, but retrospective immunohistochemi stry studies and RT-PCR linked this outbreak to a dolphin morbillivirus (DMV) and toxic al gal blooms or red tides (Krafft et al., 1995; Lipscomb et al., 1994). In 1988 a morbillivirus epizootic occurred in the North Sea of

PAGE 53

53 northwestern Europe in wh ich over 23,000 harbor seals ( Phoca vitulina ) and a few hundred grey seals ( Halichoerus grypus ) died (Kennedy et al., 1988b; Oste rhaus, 1989). A novel morbillivirus was isolated from the European seals, named phocine distemper virus (PDV) and shown to be antigenically and genetically closely related to CDV (Barrett et al., 1993 ; Bostock et al., 1990; Cook, 1989; Osterhaus et al., 1990; Visser et al., 1990a). Also in 1988, the first cetacean morbillivirus was isolated from a pod of sick harbor porpoises ( Phocoena phocoena) that stranded along the Northern Ireland coast and was named porpoise morbillivirus (PMV) (Kennedy et al., 1988a; McCullough et al., 1991). In 1990 another novel morbillivirus was isolated from striped dolphins ( Stenella coeruleoalba) that were stranding along the Mediterranean coast of Spain and then again, from striped dolphins along the coasts of Italy and Greece in 1991; both were named dolphin morb illivirus (DMV) (Di Guardo et al., 1992; Domingo et al., 1990; van Bressem et al., 1993; van Bressem et al., 1991). In 2002 the North Sea harbor seal populations were again infected by a marine morbill ivirus that was proven to be similar to the 1988 PDV strain (Jensen et al., 2002). This time over 30,000 harbor seals and thousands of grey seals died (Harkonen et al., 2006). Rapid and accurate diagnosis of morbillivirus infections of stranded and sick marine mammals has been problematic since marine morb illivirus outbreaks were first recognized in 1987. Serological detection methods for marine morbilliviruses are not only time consuming, but they are inefficient for differentiating these viruses because neutralizing antibodies are crossreactive (Knipe and Howley, 2001). In the pres ent study, we explored the nucleotide sequence divergence of the N gene 3 end for the purpose of developing real-time RT-PCR assays for the specific and differential detection of these four marine morbillivir uses in cell culture and, most importantly, in tissues of stranded cetaceans.

PAGE 54

54 Materials and Methods RNA Preparation and Reverse Transcription Total RNA was extra cted from Vero cell cultures that had been infected with either canine distemper virus (CDV), dolphin morbillivirus (DMV), phocid distemper virus (PDV) and porpoise morbillivirus (PMV) using Trizol Reagent (Invitrogen, CA, USA), following the manufacturers protocol. Approximately 1g of each RNA was reverse transcribed (RT) using SuperScript II (Invitrogen) in a final reaction volume of 20 l c ontaining: 50 mM Tris-HCl ((pH 8.3)), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol (DTT), 0.5 mM of dNTP mix, 75 ng of random hexamer primers, 2U RNaseOut (Invitr ogen), and 5U M-MLV reverse transcriptase. The RT reaction was performed at 42 C for 1 hr followed by inactivation of the reverse transcriptase enzyme by heating at 70 C for 15 min. A specific reve rse transcription forward primerRT-FP (Table 2-1) was used to obtain cDNA of both DMV and PMV for the conventional PCR while for the real-time assa ys random hexamer primers (Invitrogen) were used. For the PDV and CDV assays, cDNA wa s obtained by using random hexamer primers (Invitrogen) for the RT for use in the conventional PCR. Amplification and Cloning of the Complete Nucleocapsid Genes Previous sequences published for DMV, PM V, PDV and CDV nucleocapsid (N) gene were retrieved from the GenBank database (Accession nos. AJ608288 AY949833, X75717, and NC_001921, respectively) to design primer sets to specifically amplify their complete open reading frame (ORF). Conserved upstream and downstream sequences of the N gene ORF were identified after multiple nucleotide sequen ce alignments using the DNASTAR Lasergene MegAlign function (DNASTAR, Inc., WI, USA) and primers were designed for DMV and PMV: N-ORF-FP: 5-GGGGTAGAATAACAGATAATGATAA-3 and N-ORF-RP: 5TTGGTCCTAAGTTTTTTGTAATA-3. For PDV, the primer sequences were as follows: N-

PAGE 55

55 ORF-FP: 5-GGTCAATGATCCGTCT CAAGG-3; N-ORF-RP: 5TATAATTGGCTTGAAGATGCA-3. For CDV, the primers were as follows: N-ORF-FP: 5GACAAAGTTGGCTAAGGATAGTTA-3 and N-ORF-RP: 5CGGATGAATGATTGATCGGGT-3. Amplificati on reactions were set-up in 50 l final volumes containing: 400 M of each dNTP, 800 nM of each of the above primers, Expand High Fidelity Buffer (Roche Diagnostics, Mannheim Germany), 2 mM MgCl2 2 mM KCl, 0.02 mM DTT, 0.002 mM EDTA, 0.01% Nonidet P40 (v/v), 0.01% Tween 20 (v/v ), 1% glycerol (v/v), 5 l of cDNA, and 0.07U Expand High Fidelity Enzy me. PCR assays were performed in the PTC100 thermocycler (MJ Research, Inc., MA, US A) as follows: initial denaturation at 94 C for 2 min followed by 40 cycles of three steps each; 94 C for 1 min, 60oC for 1 min and 72 C for 2 min. A final elongation step of 72 C for 7 min completed the cycling. Amplified fragments of the expected size (~ 1.6 Kbp) were cloned into the pCR.1-TOPO plasmid vector (Invitrogen) and the reaction was used to transform Top 10 competent bacteria (Invitrogen). Individual bacterial colonies were expanded as overnight minicultures (3 ml vol), plasmid DNA was extracted from these cultures using a 10 min protocol (Zhou et. al., 1990) and the correct recombinant plasmids were identified after rest riction with endonucleases XhoI and Hind III for DMV, PMV, and CDV and endonucleases XbaI and BamHI for PDV, followed by agarose gel electrophoresis. Purified plasmid DNA for se quencing was obtained from the remaining bacterial minicultures of plasmids known to carry an insert of the correct size using the Aurum Plasmid Mini DNA Kit (Bio-Rad, CA, USA). The cloned N gene inserts were fully sequenced using the CEQ2000XL sequencing instrument (Beckman Coulter Inc., CA, USA). Primer and Probe Design for Conventional and Real-time RT-PCR Areas of nucleotide diversity were identi fied in the C-terminal dom ain of the four N genes after multiple sequence alignments using th e MegAlign function of the Lasergene software

PAGE 56

56 (DNASTAR Inc., Madison, WI, USA). Primer s DMV-FP, DMV-RP, PM V-FP, PMV-RP, PDVFP, PDV-RP, CDV-FP and CDV-RP that targeted dissimilar nucleotide se quences and would not cross-hybridize among one another were designed for use in both conventional and real-time PCR (Table 2-1). Dual-labeled fluorogeni c probes (DMV-probe, PMV-probe, PDV-probe, CDV-probe) containing locked nucleic acid (L NA) bases (Invitrogen) were designed by targeting sequences within the N gene fragments amplified by the DMV and PMV N primer sets and were based on areas of nucleotide diversity to prevent cross-hybridiz ation (Table 2-1). Additionally, a third set of primers (GAPDH-FP and GAPDH-RP) and their specific probe (GAPDH probe) were designed to use as intern al control of RNA quality. All three probes contained between four to six LNA bases st rategically placed between the 14-16 DNA probe nucleotides (Table 2-1). Specificity of Primers in Conventional RT-PCR To determ ine primer specificity in conventiona l RT-PCR, all four primer sets (Table 2-1) were analyzed against cDNA obtained from DMV, PMV, PDV, and CDV. All PCR assays were performed in final volumes of 50 l containi ng: 200 M of each dNTP, 400 nM of each primer, 1 mM KCl, 1 mM (NH4)2SO4, 2 mM Tris-HCl, 2 mM MgSO4, 0.01% Triton X-100, 2.5 U of Taq DNA polymerase (New England Biolabs Inc., MA, USA) and 5l of cDNA. Amplification cycles involved an in itial heating at 94 C for 1 min followed by 40 cycles; each consisting of a denaturation step at 94 C for 30 s, a primer annealing step at 60oC for 30 s and an extension step at 72 C for 30 s. The predicted amplicon size produced by RT-PCR with DMV, PMV, PDV, and CDV primer sets assayed with DMV c DNA and PMV cDNA was 173-bp (Figure 2-1), while amplicons from PDV cDNA and CDV cDNA temp lates were 169-bp and 174-bp, respectively (Figure 2-1).

PAGE 57

57 Specificity of Primers a nd Probes in rtRT-PCR DMV-N, P MV-N, PDV-N and CDV-N gene primer sets were tested in real-time RT-PCR (rtRT-PCR) assays against cDNA obtained by revers e transcription of total RNA from all four marine morbilliviruses using random primers. All assays were performed in 25 l vol containing 200 M of each dNTP, 400 nM of each primer, 240 nM of probe, 1 mM KCL, 1 mM (NH4)2SO4, 2 mM Tris-HCl, 2 mM MgSO4, 0.01% Triton X-100, 0.05 U of Taq DNA polymerase (New England Biolabs Inc.) and 2.5 l of cDNA. The PCR amplification part of the rtRT-PCR assay was performed using the Cepheid SmartCycler II (Cepheid, CA, USA) as follows: an initial denaturation step at 95 C for 2 min followed by 40 cycles, each consisting of heating at 94 C for 10 sec, 30 sec annealing at 60 C and 72 C extension for 10 sec (Figure 2-3). Sensitivity of Primer Sets in Conventional RT-PCR In the reverse transcription step, cD NA of DMV, PMV, PDV, and CDV was obtained using the specific reverse transcription forward primer RT-FP. Using this cDNA, a 461-bp fragment was PCR amplified using forward prim er RT-FP and the reverse primer C-term-RP (Table 2-1). These PCR assays were run in a final volume of 100 l and contained 800 nM of each primer, 1 l of Accuprime Taq DNA polymerase (Invitrogen), 20 mM Tris-HCl (pH8.4), 50 mM KCl, 1.5 mM MgCl2, 1% glycerol, 200 M of each dNTP and 5l of cDNA. Cycling conditions were: initial denaturation step at 94 C for 1 min followed by 40 cycles, each of three steps; 94 C for 30 sec, 51 C for 30 sec and 68 C for 30 sec. PCR products were purified with the QIAquick PCR purification kit (Qiagen Inc., CA, USA) following the manufacturers protocol. Purified PCR products were quantitated by spectrophotometry, adjusted to the desired concentration and diluted in 10fold dilutions to obtain DNA c oncentrations ranging from 10 ng to 0.01 fg. Individual PCR assays were perf ormed with each DNA concentration in 50 l reactions to test for sensitiv ity of each primer set using conditions described above.

PAGE 58

58 One-step rtRT-PCR with RNA Extracted fr om Marine Mammal Tissues During a Morbillivirus Outbreak RNA was extracted with Trizol (Invitrogen) from tissues obtained from cetaceans that had stranded in Spanish Mediterranean sea s hores during July of 2007. These RNAs were assayed in a one-tube rtRT-PCR using the specif ic DMV-N and PMV-N primer sets and probes previously described (Table 2-1). PCR assays in 25 l vol contained 0.5 l of SuperScript III with Platinum Taq High Fidelity Enzyme (Invitrogen), 200 M of each dNTP, 1.6 mM MgSO4, 800 M of each primer and 1 g of total R NA. Cycling conditions were as follows: 60 C for 30 min, 95 C for 10 min, 50 cycles consisting of 95 C for 15 sec and 60 C for 1 min. Amplification of Standard RNA Fragm ents less than 200-bp in length were obtained by PCR with DMV, PMV, PDV, and CDV primers and were cloned in the correc t orientation into pGEM-11Z + and pGEM-T Easy (Promega Co., Madison, WI, USA) downs tream of the T7 promoter. Recombinant plasmids were linearized with enzymes SpeI, HindIII, or SacII (New England Biolabs) followed by proteinase K digestion and phenol:chlorofor m extraction. The purified linearized plasmid DNA was transcribed in vitro using the MEGAshortscript kit (Ambion Inc., TX, USA) in a reaction driven by the T7 promoter, as per prot ocol. The transcribed RNA was treated with DNase, treated with phenol: chloroform and quantitated by spectrophotometry. RNA transcripts were serially diluted in ten-fold dilutions ranging from 1x100 to 1x108 copies and reverse transcribed in duplicate, as de scribed earlier, in the presence and absence of the reverse transcriptase Superscript II (Invitr ogen). Serial ten-fold dilutions ranging in concentration from 1x100 to 1x108 copies were also performed using plasmid DNA containing the <200-bp N gene fragments of DMV, PMV, PDV, and CDV.

PAGE 59

59 Conventional and rtRT-PCR to Test for RNA Quality To evaluate the quality of cell culture or tissue extracted RNA, th e bovine glyceraldyhyde 3-phosphate dehydrogenase (GAPDH) gene was targ eted using previously published prim ers, GenBank accession no. U85042 (Inderwies et al., 2003). The predicted size of the GAPDH amplicon in conventional RT-PCR was 197-bp. Tissues available for testing were derived from 11 different species of marine mammals that included; Rissos dolphins (Grampus griseus ), harbor seals ( Phoca vitulina ), Stellar sea lions ( Eumetopias jubatus ), sea otter (Enhydra lutris ), Atlantic bottlenose dolphins ( Tursiops truncatus ), pygmy sperm whale ( Kogia breviceps ), roughtoothed dolphin ( Steno bredanensis ), beluga whale (Delphinapterus leucas ), dwarf sperm whale ( Kogia simus ), short-finned pilot whale ( Globicephala macrorhynchus), and harbor porpoise ( Phocoena phocoena). RT reactions were performed in the presence of random primers. PCR assays in 50 l vol contained 200 M of each dNTP, 400 nM of each primer, 1 mM KCl, 1 mM (NH4)2SO4, 2 mM Tris-HCl, 2 mM MgSO4, 0.01% Triton X-100, 2.5 U of Taq DNA polymerase and 5 l of cDNA. Cycling conditions for th e conventional PCR consisted of an initial denaturation step at 94 C for 1 min followed by 40 cycles; eac h consisting of a denaturation step of 94 C for 30 sec, a primer annealing step of 53oC for 30 sec and an extension step at 72 C for 30 sec. Amplified DNA fragments of the predic ted size were cloned into pCR2.1-TOPO vector (Invitrogen) and sequenced using M13 forward and reverse primers. The GAPDH nucleotide sequences obtained from all 11 species of marine mammals were subjected to multiple sequence alignment using the Lasergene MegAlign function (DNASTAR) and analyzed to design specific marine mammal GAPDH primers and a GAPDH fluorogenic probe cont aining LNA bases for use in real-time PCR (Table 2-1). A real-time PC R assay was developed to test the specificity of the GAPDH primers and probe (Table 1). PCR assays in 25 l vol contained 200 M of each dNTP, 400 nM of each primer, 240 nM of probe, 1 mM KCl, 1 mM (NH4)2SO4, 2 mM Tris-HCl,

PAGE 60

60 2 mM MgSO4, 0.01% Triton X-100, 1.25 U of Taq DNA polymerase and 2.5l of marine mammal cDNA. Cycling conditions were: initial denaturation at 95 C for 2 min followed by 40 cycles, each consisting of heating at 94 C for 10 sec, annealing at 53 C for 30 sec and extension at 72 C for 10 sec (Table 2-1). Universal Morbillivirus Primers and Probe A universal morbillivirus set of prim ers and probe was designed based on consensus nucleotide sequences of the N gene of DMV, PMV, CDV, PDV, MV and RPV that had been subjected to a multiple sequence alignment analysis. The most conserved sequences within the N protein are known to correspond to amino acids 146 to 398 of the N ORF (Banyard et al., 2008). Total RNA was extracted with Trizol (I nvitrogen) from tissues of marine mammals previously proven to be infected with morbilliviruses (Table 2-2) and from Vero cell cultures infected with each of the morbilliviruses previously described. The RNAs were tested in a onestep rtRT-PCR using the reaction conditions desc ribed earlier, and the mo rbillivirus universal primer set (Uni-N-FP and Uni-N-RP) and probe (Uni-N-probe) described in Table 2-1. Results The Complete Nucleocapsid Genes The com plete N gene of DMV, PMV, PDV a nd CDV were reverse transcribed, amplified and cloned and their ORFs found to be 1572 nt in le ngth which translated into proteins of 523 aa. The DMV and PMV ORFs shared 88.5% nt ident ity while their deduced aa sequences were 95.6% similar and 93.5% identical. Similarly, P DV and CDV ORFs shared 77% nt identity while their deduced aa sequences were 89.5% similar and 86% identical. Specificity of Convention al and rtRT-PCR Assays The DMV (DMV-FP and DVM-RP), PMV (PMV-FP and PMV-RP), PDV (PDV-FP and PDV-RP), a nd CDV (CDV-FP and CDV-RP) primer sets assayed by conventional RT-PCR only

PAGE 61

61 amplified N gene cDNA of the same virus spec ies and generated DNA fragments smaller than 200-bp (Figure 2-1). Furthermore, the same two prim er sets when used in a one-tube or two-tube RT-PCR assays in conjunction with their own LNA probes only produced positive results when assayed with cDNA of the same virus species (Figure 2-3). The DMV and PMV primers and probes did not react with cDNA originating fr om CDV and PDV total RNA and CDV and PDV primers and probes did not react with cDNA orig inating from DMV and PMV total RNA. The cycle threshold (CT) value defined a positive reaction and is the first cycle in which there is enough fluorescence detected above the background. Positive real-time assays for DMV had significant CT values that started at 17.99 and an alogous assays for PMV had positive CT values that started at 25.72 (Figure 2-3). PDV pos itive real-time assays had significant CT values at 17.38 and CDV had positive CT values at 16.97 for the Snyder Hill strain and 19.68 for the Onderstepoort stra in (Figure 2-3). Sensitivity of the Conv entional RT-PCR Assays To test the sensitivity of each prim er set for DMV, PMV, PDV and CDV in conventional RT-PCR, a 461-bp PCR product was amplified and used to make DNA dilutions with concentrations ranging from 10 ng to 0.01 fg. The 461-bp PCR product encompassed the Cterminal region sequence of the N gene and c ontained the 173-bp fragment targeted for DMV and PMV, 169-bp fragment for PDV, and the 174bp fragment for CDV in the real-time RT-PCR assays. The detection limit for the DMV conventional RT-PCR assay was 1 fg, the PMV assay had a detection limit of 100 fg, PDV had a de tection limit of 1 pg, and CDV had a limit for detecting DNA in the conventiona l assay of 1 fg (Figure 2-2). Sensitivity of the rtRT-PCR Assays and Standard Curves The DMV and PMV standard curves were generated using serially diluted control RNA and also plasm id DNA ranging from 1x100 to 1x108 copies. The generated standard curves for

PAGE 62

62 the two methods were compared and plasmid DNA was one log more sensitive for the DMV and PMV assays compared to the standard curves ge nerated using serial diluted control RNA. The standard curve generated for DMV was able to detect DNA down to 102 gene copies, compared to 103 with control RNA, and had a linear regressions (R2) equal to 0.998 (Figure 2-4). The generated standard curve for PM V was able to detect DNA to 103 gene copies, compared to 104 with control RNA, and had a R2 value of 0.997 (Figure 2-4). Base d on the results collected for the DMV and PMV assays, the generated standa rd curves for PDV and CDV were done using serially diluted plasmid DNA ranging from 1x100 to 1x108 gene copies. The PDV assay was able to detect DNA to 101 copies with a R2 value of 0.993 and the CDV assay was able to detect 103 gene copies with a R2 value of 0.995 (Figure 2-4). Real-time RT-PCR for the GAPDH Ge ne in Marine Ma mmal Tissues The GAPDH gene was targeted as an in ternal control of RNA quality using total RNA obtained from tissues of 11 differe nt species of marine mammals (Figure 2-5). RNA from all 11 species tested was reactive in the rtRT-PCR assay with CT values that ranged from 21.82 to 37.07 (Figure 2-6). Differential Diagnosis of Morbillivirus Infection using Cetacean Tissues The DMV and PMV rtRT-PCR assays were eval uated in the dif ferential detection of morbillivirus RNA in clinical samples using a one-tube rtRT-PCR assay on tissues from dead cetaceans obtained during a natural morbillivir us outbreak. Eight of 12 tissues RNA were identified as infected with a morbillivirus only when assayed with DMV primers and not with PMV primers and probe (Table 2-2). Thes e results were confirmed in every case by demonstrating after sequencing that the amp lified DNA products corresponded to N gene sequences very similar to orthologous sequences of a DMV strain available in the GenBank database.

PAGE 63

63 Universal Morbillivirus rtRT-PCR Assay The universal N gene prim er set and probe used in a one-tube RT-PCR assay with total RNA extracted from DMV, PMV, PDV, CDV, MV, RPV and PPRV allowed the detection of all morbilliviruses, except PPRV. Positive CT values ranged from 18 to 33 (Figure 2-7). However, the universal morbillivirus rtRT-PCR assay only de tected 6 out of 8 positive cetacean tissues identified with the differential DMV and PM V one-tube RT-PCR assay (Table 2-2). Discussion Real-tim e RT-PCR assays were developed for the differential detection of DMV, PMV, PDV, and CDV. These viruse s are important pathogens of marine mammals of the order Cetacea which include whales, dolphin s, and porpoises and order Carnivora which includes pinnipeds. The development and availability of these assays will aid in the timely and prompt diagnosis of morbillivirus infections in cetac eans and pinnipeds in which they cause unusual mortality events (UME) that may involve hundr eds or thousands of deaths. The timely differential diagnosis is importa nt not only to determine whethe r DMV, PMV, PDV, and CDV is involved in the UME, but also to rule out other agents and acti vities that may cause similar epizootiological events such as dinoflagellate to xins, exposure to high levels of environmental pollutants and sonar activity by military vesse ls (Fernandez et al., 2005; Jepson et al., 1999; Montie et al., 2007; Talpalar et al., 2005; van Bressem et al ., 1998; Yang et al., 2008). The assays will also make possible a diagnosis within hours of the samples arri ving in the laboratory. A more generic rtRT-PCR assay was also evaluate d on RNA extracted from infected tissues and found to have lower sensitivity but equal specificity as the PMV, DMV, PDV, and CDV assays, as infected tissues identified using the DMV di fferential rtRT-PCR were not correctly identified when the generic rtRT-PCR was used. In genera l, rtRT-PCR assays also circumvent the time consuming, cumbersome, and less sensitive inoculation of tissue extract s on cell cultures that

PAGE 64

64 usually necessitates several days for a diagnosis that may be fau lty because of low infectious virus content in the assayed samples. Previous ly described conventional RT-PCR assays for the diagnosis of marine morbilliviruses targeted the highly conserved phosphoprotein (P) gene (Barrett et al., 1993; Saliki et al., 2002) and nece ssitated post-amplificatio n resolution in agarose gel electrophoresis of amplified DNA fragments to demonstrat e the presence of an amplicon of the predicted size that still required sequencing to determine the involvement of one of these four marine morbilliviruses. The differential real-t ime assays for DMV, PMV, PDV, CDV, and the generic assay described here are based, respectiv ely, on either divergent sequences (DMV, PMV, PDV, and CDV) or highly cons erved sequences (for possibly a ll known morbilliviruses) within the N gene. The hypervariable Cterminal domain of the N gene has been determined to correspond to the last 456 nt at the 3 end and has been used fo r genotypic char acterization of different isolates of MV stra ins (van de Bildt et al., 2005; WHO, 1998). Since guidelines for classifying different species of marine and terrestrial morbilliviruses have not yet been defined, we used divergent nucleotides located at the C-te rminal domain of the N gene to design primer sets for the differential dete ction of the two cetacean morb illiviruses and two pinnipeds morbilliviruses, both in conventional RT-PCR and in the differential rtRT-PCR assays. Because nucleic acid degradati on in tissues from stranded marine mammals is the most frequent cause of poor quality am plifiable total RNA, tissue sample s for diagnosis must still be collected from freshly dead or euthanized animal s and not from animals that may have stranded dead and lay on the beach for hours before sample collection. To determine if total RNA extracted from tissues is amplifiable, an rt RT-PCR assay that target ed the GAPDH gene was developed as a control assay. As was the case for the conventional and real-time assays for morbilliviruses, the rtRT-PCR assay for GAPDH used a probe containing locked nucleic acid

PAGE 65

65 (LNA) bases. These nucleic acid analogs have previously been reported to increase hybridization and to improve allelic disc rimination (Ugozzoli et al., 2004). The one-tube and two-tube rtRT-PCR assays fo r morbilliviruses offer several advantages over conventional RT-PCR. Firstly, the real-time assays can be completed in approximately 3 to 4 hr compared to 6 hr for the conventional met hod. Secondly, the additional components in the rtRT-PCR assays were the dual-labeled fluorogeni c probes that were designed to hybridize to unique target sequences within the hypervariable domain of th e N gene of DMV, PMV, PDV, and CDV, thereby increasing the specificity and sensitivity of the assay. Thirdly, real-time detection is not only more rapid and specific, but can also be used to quantify the amount of virus present in the sample by calculating copy numbers. Conventional RT-PCR assays are strictly qualitative. For the DMV-N and PMVN rtRT-PCR assays, we determined that the DMV-N system could detect gene copies to 102 and the PMV-N system c ould detect gene copies to 103. For the PDV-N and the CDV-N rtRT-PCR assa ys, gene copies could be detected to 101 and 102, respectively. The differential rtRT-PCR assays for DMV, PMV, PDV, and CDV have been tested against reverse transcribed RNA from all seven known morbillivirus es grown in cell cultures and reacted only with their own cDNA. Furthermore, the DMV and PMV assays were evaluated with RNA extracted from tissue samples collected in a recent stranding along the Mediterranean coast of Spain during July 2007 (Raga et al., 2008) The DMV assay specifically identified as morbillivirus infected, eight of 12 tissue RNAs that were non-reactive in the PMV assay. Sequencing of the amplified DNA confirmed that the rtRT-PCR products were most closely related to a strain isolated in 1990 from the DMV epizootic that occurred in this same region (Raga et al., 2008). The generic morbillivirus rt RT-PCR assay correctly identified six of the

PAGE 66

66 seven known morbillivirus species currently contained in the genus, when applied to total RNA extracted from infected cell cultures. Although only a few cetacean tissue samples were investigated for morbillivirus using the generic rt RT-PCR, this assay confirmed the infection in six of the eight infected samples found inf ected with the DMV rtRT-PCR assay, possibly indicating lower sensitiv ity. Although the number of tissue samples processed was small, it seemed that lung, brain and spleen were the mo st appropriate tissues for virus detection. As very few complete sequences are availabl e for the N gene of DMV and PDV, only one for the N gene of PMV (Banyard et al., 2008) and no complete N gene sequences for CDV isolated from seals (only closely related terrestrial strains), refi nement of the real-time assays may be needed in the future, as more isolates of these marine morbilliviruses are obtained and sequenced. In summary, rtRT-PCR assays have been developed for the rapid, sensitive and specific differential detection of currently circ ulating strains of DMV, PMV, PDV, and CDV in cetacean and pinniped tissues. Thes e assays allow the quantitation of viral loads in clinical samples. A generic rtRT-PCR that detects DMV, PMV, CDV, PMV, RPV, and MV has also been developed for use in several marine and terre strial hosts, including humans. These assays can be used to sensitively sc reen for morbilliviruses, as w ould be the case during unusual mortality events, and can be used to quantify viral loads in clinical samples. The assays are costefficient when compared to conventional tec hniques, such as electron microscopy and virus isolation in cell culture, and have advantages related to shorter time-to-diagnosis and specificity and sensitivity when compared to conventional RT-PCR assays.

PAGE 67

67Table 2-1. Oligonucleotides used in conventional and real-time RT-PCR assays for the four known marine morbilliviruses. (+) si gn designates LNA bases Primer/probe 5Fluorophore 3Quencher Sequences 5-3 nt Amplicon Size(bp) Tm C DMV-FP ----------TGCCAGTACTCCAGGGAACATCCTT C 26 173 61.9 DMV-RP ----------TTGGGTCGTCAGTGTTGTCGGACCG TT 27 173 65.3 DMV-Probe Cy3 IBFQ A+CA+CCAAA+AGGGA+CA 15 -----61.6 PMV-FP ----------GTCTAGTGCTCCGGGGAATATCCCT A 26 173 60.8 PMV-RP ----------CTGGATCATCAGCGTTGTCAGATTG CC 27 173 61.5 PMV-Probe FAM IBFQ C+CA+TA+CCA+AG+AGGT 14 -----60.5 PDV-FP ----------GCACCTAACCAAAGACTCCCTC 22 169 57.5 PDV-RP ----------GGTCCCCTTCCTGTGTCAATTGT 23 169 59.3 PDV-Probe FAM IBFQ T+TC+CAAT+CAG+CT+CA+TT 16 -----60.4 CDV-FP ----------CGAAGTCICIAATCAACAACC 21 174 56.7 CDV-RP ----------TTTCCATCATCTTGIATAITITGGG 25 174 56.0 CDV-Probe Cy3 IBFQ C+CCA+ TT+CA+CTT+CAGT 15 -----51.0 GAPDH-FP ----------GTCTTCACTACCATGGAGAAGG 22 197 54.6 GAPDH-RP ----------TCATGGATGACCTTGGCCAG 20 197 57.3 GAPDH-Probe Cy5 IBRQ G+CCA+AGAGGG+TC+AT+CA 16 -----63.9 Univ-N FP ----------TTCAGAAYAARTTYAGTGCAGG 22 126 51 Univ-N RP ----------AARTADGCHGGRTCRAAGTA 20 126 51 Univ-N Probe FAM IBFQ TGGAGYTATGCHATGGGRGT 20 -----61 RT-FP (Convt) ----------GGTCGITCTTACTTIGACCC 18 -----56.7 C-Term-RP (Convt) ----------TTGGTTTTCIAITAGCTTGGC 19 -----55.2

PAGE 68

68 Table 2-2. CT values obtained from a one-step real-time RT-PCR assay used to detect a strain of dolphin morbillivirus from cet acean tissues collected in Spain during the summer of 2007 Samples DMV-N PMV-N Universal-N Positive Gm070331-wh1 (Lymph node) 27.96 Neg 30.37 Pos Gm070331-wh1 (Brain) 24.86 Neg 28.55 Pos Gm070331-wh1 (Lung) 28.23 Neg 29.23 Pos Sc070607-dlp1 (blood) 0 Neg 0 Neg Sc070607-dlp1 (Lung) 30.27 Neg 0 Pos Sc070607-dlp1 (Brain) 23.6 Neg 27.7 Pos Sc070612-dlp2 Mest. Lymph node 20.01 Neg 0 Pos Sc070612-dlp2 (Lung) 24.25 Neg 23.82 Pos Sc070612-dlp2 (Brain) 31.52 Neg 26.99 Pos Sc070707-dlp3 (Pre-scapula) Neg Neg Neg Neg Sc070707-dlp3 (Lung) Neg Neg Neg Neg Sc070707-dlp3 (Brain) Neg Neg Neg Neg

PAGE 69

69 Figure 2-1. Specificity of the primers against each of the four marine morbilliviruses in conventional RT-PCR. DMV (A); PMV (B); PDV (C); CDV (D). CDV-SH (Snyder Hill Strain) and CDV-OD (Onderstepoort). The negative controls are designated by ve. Positive Fragment = 173-bp 200-bp D D M M V V P P M M V V P P D D V V C C D D V V o o d d V V E E D D M M V V P P M M V V P P D D V V C C D D V V o o d d V V E E200-bp Positive Fragment = 169-bp Positive Fragment = 174-bp D D M M V V P P M M V V P P D D V V C C D D V V o o d d C C D D V V s s h h V V E E D D M M V V P P M M V V P P D D V V C C D D V V o o d d C C D D V V s s h h V V E E B D A C

PAGE 70

70 Figure 2-2. Gel electrophoresis illustrating th e sensitivity of A) PMV-N primer sets, B) DMV-N primer sets, C) PDV-N primer sets, D) CDV-N primer sets. For all gel pictures the DNA concentrations were as follows: lane 110 ng; lane 21ng; lane 3100pg; lane 410 pg; lane 51 pg; lane 6100 fg; lane 710 fg; lane 81 fg; lane 90.1 fg; lane 100 .01 fg; lane 11negative control. All fragments were less than 200-bp in length and the PMV primer set (A) detected DNA down to 100 fg, the DMV primer set (B) detected DNA down to 1 fg, the PDV primer (C) set de tected DNA down to 1 pg, and the CDV primer set (D) detected DNA down to 1 fg. A B 1 1 f f g g 1 1 0 0 0 0 f f g g -ve -ve10ng 10ng *1fg *1pg -ve -ve10ng 10ng C D

PAGE 71

71 Figure 2-3. Real-time RT-PCR Ct values fo r DMV (A), PMV (B), PDV (C), and CDV (D) primer sets and probes. Each reaction was run against all five (DMV and PMV) to six (CDV and PDV) viral RNAs and each primer set and probe was specific for only amplifying their target. DMV C t Value: 17.99 PMV C t Value: 25.72 PDV C t Value: 17.38 CDV C t Value: SH-16.97, OD-19.68 C D A B

PAGE 72

72 Figure 2-4. Standard curve of the rtRT-PCR assays for DMV (A), PMV (B), PDV (C), and CDV (D). Ten-fold dilutions of pl asmid DNA prior to amplification were used ranging from 1x100 to 1x108 copies (indicated on th e y-axis) with the CT values represented on the x-axis. Th e DMV (A) assay was able to detect DNA to 1x102 copies, PMV (B): 1x103 copies, PDV (C): 1x101 copies, CDV (D): 1x102 copies. The coefficient of determination (R2) is indicated on the graphs. A B C D

PAGE 73

73 Figure 2-5. Multiple alignment of the eleven 197-bp GAPDH fragments amplified, cloned and sequenced from vari ous marine mammal species. 1 50 100 G33-Ks .......... .......... .......... .......... .......... .......... ........t. .......... .......... .......... G30-Kb .......... .......... .......... .......... .......... .......... ........t. .......... .......... .......... G35-Pp .......... .......... .......... .......... .......... .......... .......... .......... .......g.. .......... G34-Gm .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... G32-Dl .......... .......... ....a..... .......... .......... .......... .......... .......... .......... .......... G31-Sb .......... .......... .......... .......... .......... .......... ........t. .......... .......... .......... G29-Tt .......... .......... .......... ........c. .......... .......... .......... .......... .......... .........a G25-Gg .......... .......... .......... .......... .......... .......... .......... ....c..... .......... ..c....... G28-El .......... .......... ...t...... .......... .c..g..... .......... ........t. .......t.. c......... ..c..g.... G27-Ej .......... .......... ...t...... .........a .c..g..... .......... ........t. .c......a. .......... ..c..g.... G26-Pv .......... .......... ...t...... .......... ....g..... .......... ......c... .......ta. .......... .....g.... Consensus GTCTTCACTA CCATGGAGAA GGCCGGGGCT CACTTGAAGG GTGGAGCCAA GAGGGTCATC ATCTCTGCCC CTTCTGCCGA TGCCCCCATG TTTGTCATGG 101 197 G33-Ks .......... .......... .a........ .......... ....... G30-Kb .......... .........g .c........ .......... ....... G35-Pp .......... .......... ..g....... .......... ....... G34-Gm .......... .......... .......... .......... ....... G32-Dl .......... .......... .......... .......... ....... G31-Sb .......... .......... .......... .......... ....... G29-Tt .......... .......... .......... .......... ....... G25-Gg .......... .......... .......... .......... ....... G28-El .....t.... .......... ...t..t... .......... ....... G27-Ej c....tg... .......... .a.t..t... .......... ....... G26-Pv .......... ....t..... ......t... .......... ....... Consensus TCCTGCACCA CCAACTGCTT GGCCCCCCTG GCCAAGGTCA TCCATGA G G 2 2 5 5 G G r r a a m m p p u u s s g g r r i i s s e e u u s s ( ( R R i i s s s s o o s s D D o o l l p p h h i i n n ) ) G G 2 2 6 6 P P h h o o c c a a v v i i t t u u l l i i n n a a ( ( H H a a r r b b o o r r S S e e a a l l ) ) G G 2 2 7 7 E E u u m m e e t t o o p p i i a a s s j j u u b b a a t t u u s s ( ( S S t t e e l l l l e e r r S S e e a a L L i i o o n n ) ) G G 2 2 8 8 E E n n h h y y d d r r a a l l u u t t r r i i s s ( ( S S e e a a O O t t t t e e r r ) ) G G 2 2 9 9 T T u u r r s s i i o o p p s s t t r r u u n n c c a a t t u u s s ( ( B B o o t t t t l l e e n n o o s s e e D D o o l l p p h h i i n n ) ) G G 3 3 0 0 K K o o g g i i a a b b r r e e v v i i c c e e p p s s ( ( P P y y g g m m y y S S p p e e r r m m W W h h a a l l e e ) ) G G 3 3 1 1 S S t t e e n n o o b b r r e e d d a a n n e e n n s s i i s s ( ( R R o o u u g g h h t t o o o o t t h h e e d d D D o o l l p p h h i i n n ) ) G G 3 3 2 2 D D e e l l p p h h i i n n a a p p t t e e r r u u s s l l e e u u c c a a s s ( ( B B e e l l u u g g a a W W h h a a l l e e ) ) G G 3 3 3 3 K K o o g g i i a a s s i i m m a a ( ( D D w w a a r r f f S S p p e e r r m m W W h h a a l l e e ) ) G G 3 3 4 4 G G l l o o b b i i c c e e p p h h a a l l a a m m a a c c r r o o r r h h y y n n c c h h u u s s ( ( S S h h o o r r t t f f i i n n n n e e d d p p i i l l o o t t w w h h a a l l e e ) ) G G 3 3 5 5 P P h h o o c c o o e e n n a a p p h h o o c c o o e e n n a a ( ( H H a a r r b b o o r r P P o o r r p p o o i i s s e e ) )

PAGE 74

74 Figure 2-6. Real-time RT-PCR CT values for the eleven different marine mammal species tested with the GAPDH prim er set and probe. The CT values are as follows: Steller sea lion24.06; spotted s eal21.82; rough-toothed dolphin33.00; bottlenose dolphins28.84 & 26.69; dwar f sperm whale26.22; pygmy sperm whale-33.36; short-finned pilot whale31.77 & 30.92; bowhead whale32.79; beluga whale37.07; harbor seal30.60; melon-headed whale32.73; spotted seal25.61. SSL Spotted Seal Rgh-toothed Bottlenose Bottlenose Dwarf Sp Pygmy Sp Sh. fin pilot Sh. fin pilot Bowhead NEG Beluga Harbor Seal Melon Headed Spotted Seal NEG

PAGE 75

75 Figure 2-7. Real-time RT-PCR with the universal morbillivirus primer set and probe assay amplifying viral RNA in a one-step assay. The CT values of the viral RNAs are as follows: A) MV18; B) DMV 22.5; C) PMV 25.8; D) CDV 27.1; E) PDV 30.0; F) RPV 30 .5; G) RPV2 33.0; H) MV2 27.0. A B C D EFG H

PAGE 76

76 CHAPTER 3 BACULOVIRUS ( Autographa californica Nuclear Polyhedrosis Virus) EXPRE SSION OF THE NUCLEOCAPSID GENE OF DOLPHIN MORBILLIVIRUS Introduction Marine m orbilliviruses are a group of single-stranded, enveloped, negative sense RNA viruses belonging to the family Paramyxoviridae (Knipe and Howley, 2001). Until 1987, only four morbilliviruses were known and a ll infected terrestrial animals. These viruses were human measles virus (MV), bovine rinderpest virus (RPV ), peste-des-petits ruminant virus of goats and sheep (PPRV) and canine distemper virus (CDV). During the past two decades various epizootics in marine mammals, specifically cetaceans with high mortality, were shown to have been caused by porpoise morbillivirus (PMV) and dolphin morbillivirus (DMV). There is stil l controversy as to whether PMV and DMV are separate viral species because monocl onal antibody analysis does not differentiate between them (Bolt et al., 1994; Rima et al., 1995; Saliki et al., 2002) Initially, the high degree of sequence identity between DMV and PMV was comparable to the different strains of RPV and PPRV; therefore, they we re collectively referred to as the cetacean morbilliviruses (CeMV) (Bolt et al., 1994; Rima et al., 1995). More recently, the hypervariable carboxyterminal (C-terminal) end of the nucleocapsid (N) genes were compared and a 18.3% divergence was observed, suggesting PMV and DMV are different species of morbilliviruses because the maximum divergence seen between the two most distant strains of MV is 12.4% (van de Bildt et al., 2005). During the onset of acute morbillivirus infection, the most abundant and rapidly produced antibodies are specific for the N pr otein because it is the major structural protein (Knipe and Howley, 2001). In wild-t ype morbilliviruses, and paramyxoviruses in general, the N protein is a critic al structural protein because it is involved in all aspects of

PAGE 77

77 virus transcription, replication, and it also serves to encapsidate the RNA genome (Buchholz et al., 1993; Knipe and Howley, 2001) During an active infection, antibodies made against the N protein in the host predomin ate because of its ideal location at the 3 end of the genome and the start-stop mech anism of the RNA-dependent RNA polymerase (RdRp), which is essential for transcripti on and replication (Gra ves et al., 1984; Norrby and Gollmar, 1972). Antibody to the N protein accounts for most of the complementfixing antibody, but neutralizing antibody respon ses are directed mostly against the H glycoprotein and sometimes the F surface protein (Graves et al., 1984; Norrby and Gollmar, 1972; Santibanez et al., 2005). Inte restingly, natural infection or vaccination with MV, RPV, PPRV, or CDV has been shown to induce life-long immunity in its hosts, so it is possible this could hold true for the marine morbilliviruses as well (Barrett et al., 2006; Knipe and Howley, 2001; Ngichabe et al., 2002). Although there have been successful effort s to design ELISAs for the detection of antibodies to the N protein of MV and RPV, assays have not yet been developed using baculovirus expressed recombinant DMV N (DMV-N) protein for use in an ELISA assay. Only a few labs in the world actua lly have viral stocks of these cetacean morbilliviruses. Therefore, it would be benefici al to be able to e fficiently express large quantities of DMV-N protein as antigen, st arting with non-infecti ous viral RNA, for detection of these viruses in serological assays instead of needing virus-infected cells as antigen. Here, we present data to show the expression of the first DMV recombinant nucleocapsid protein that has the potential to be used as antigen for the detection of antibodies in sera collected from marine mammals, specifically cetaceans.

PAGE 78

78 Materials and Methods Amplification of the Nucleocapsid Gene Total RNA was extra cted from Vero cell cultures that had been infected with dolphin morbillivirus (DMV) using Trizol R eagent (Invitrogen, CA, USA), following the manufacturers protocol. A pproximately 1g of each RNA was reverse transcribed (RT) using SuperScript II (Invitrogen) in a final reaction volume of 20 l containing: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothre itol (DTT), 0.5 mM of dNTP mix, 75 ng of random primers, 2 U RNaseOut (Invitrogen), and 5U M-MLV reverse transcriptase. The RT reaction was performed at 42 C for 1 hr followed by inactivation of the reverse transcriptase enzyme by heating at 70 C for 15 min. Previous sequences published for the N gene were retr ieved from the GenBank database to design primer sets to specifically amplify the co mplete open reading frame (ORF) of DMV. Conserved upstream and downstream sequences of the N gene ORF were identified after multiple nucleotide sequence alignments using the DNASTAR Lasergene MegAlign function (DNASTAR Inc., Madison, WI USA). For DMV (GenBank accession no. AJ608288 ) the following primers were designed: N-FW 5GGGGTAGAATAACAGATAATGATAA-3; N-RV 5TTGGTCCTAAGTTTTTTGTAATA-3 (Integrated DNA Technologies, Inc., IA, USA). Amplification reactions were set-up in 50 l final volumes containing: 400 M of each dNTP, 800 nM of each primer (Table 1), 1X Expand High Fidelity Buffer (Roche Diagnostics, Germany), 2 mM MgCl2, 2 mM KCl, 0.02 mM d ithiothreitol (DTT), 0.002 mM EDTA, 0.01% Nonidet P40 (v/v ), 0.01% Tween 20 (v/v), 1% glycerol (v/v), 5 l of cDNA, and 0.07U Expand High Fidelity Enzyme PCR assays were performed in the PTC-100 thermocycler (MJ Research, Inc., MA, USA) as follows: initial denaturation at

PAGE 79

79 94 C for 2 min followed by 40 cycles of three steps each; 94 C for 1 min, 60oC for 1min and 72 C for 2 min. A final elongation step of 72 C for 7 min completed the cycling. An amplified fragment of the expected size (~1.6 Kb) was cloned into the pCR.1-TOPO plasmid vector (Invitrogen) and the reaction was used to transform Top 10 competent bacteria (Invitrogen). In dividual bacterial colonies were expanded as overnight minicultures (3 ml vol), plasmid DNA was ex tracted from these cultures using a 10 min protocol (Zhou et al., 1990) and the correct recombinant plasmids were identified by restriction with endonucleases XhoI and Hi ndIII followed by agarose gel electrophoresis. Purified plasmid DNA for seque ncing was obtained from the remaining bacterial minicultures of plasmids known to carry an inse rt of the correct size using the Aurum Plasmid Mini DNA Kit (Bio-Rad, CA, USA). The cloned N gene insert was fully sequenced using the CEQ2000XL sequencing in strument and M13 primer sets (Beckman Coulter Inc., CA, USA) and N gene sp ecific primers as follows: N-FW2 5CACTTTTGCATCCAGAGG-3; N-RV2 5 -TGTGGGACCTATTGCTCT-3. The complete assembled DMV-N gene nucleotide sequence was translated using the Wisconsin Package GCG software (Version 10.3, Accelrys Inc., CA, USA) and compared with other published DMV-N morbillivirus genes using the BLAST function on the NCBI database and aligned using the MegA lign function of the Lasergene software (DNASTAR, Inc.). Construction of Clones and Transfection The DMV-N frag ment was uni-directi onally sub-cloned from pCR.1-TOPO plasmid vector (Invitrogen) into the baculovirus expre ssion vector, pBlueBac4.5, using restriction endonucleases XhoI and HindIII. Purified plasmid DNA was obtained from bacterial minicultures, described previousl y, and the sub-cloned N gene insert was

PAGE 80

80 sequenced using the CEQ2000XL (Beckman Coulter Inc.). A pBlueBac4.5 construct containing the N gene insert was co-transfected into an Sf-9 ( Spodoptera frugiperda ) cell culture along with th e linearized Bac-N-Blue DNA (I nvitrogen). Briefly, 0.5 g of linearized Bac-N-Blue (Invitrogen) DNA (wild-type Autographa californica nuclear polyhedrosis virus or AcNPV), 4 g of DMV plasmid DNA, 20 l of Cellfectin reagent (Invitrogen), and 1 ml of Graces unsupplemented insect medium (Invitrogen) were combined in a 1.5 ml tube and incubated on ice for 15 min. Three 60 mm dishes were seeded with 2 x 106 Sf-9 cells/ml using Sf-900 insect me dia (Invitrogen). Prior to adding the transfection mix, the medium was removed from the seeded plates. The cells were gently rinsed with 2 ml of unsupplemente d Graces medium and removed. Transfection mix was added in a drop-wise manner directly to the monolayer. The other two seeded 60 mm plates were used as untransfected cell control and a wild -type only transfected control dish, in which only 0.5 g of linearized Bac-N-Blue (Invitrogen) DNA (AcNPV) was used. All transfected and untransfected control dishes were incubated at 27 C for 4 hr. Following incubation, 1 ml of complete TNM-FH medium (Invitrogen) was added to each 60 mm pl ate and incubated at 27 C for another 72 hr. Approximately 500 l of supernatant was collected daily fr om the transfection dishes to screen for galactocidase activity (Figure 3-1). Plaque Purification of Recombinant Baculoviruses Around 72 hr post-inoculation (hpi), 2 ml of medium was collected from each plate and stored at 4 C to be used in plaque purification assays. To these same plates, 3 ml of fresh TNM-FH (Invitrogen) was added to the transfected or infected cells and incubated at 27 C for an additional 48 hr.

PAGE 81

81 For the plaque purification, 60 mm dishes were seeded with 2 x 106 Sf-9 cells/ml. Using 100 l of the transfection stock, serial ten-fold dilutions were made in 900 l of Sf-900 insect media (Invitrogen). Once the Sf -9 cells attached, the media were removed and the serial dilutions were inoculated in a drop-wise fashion directly to the attached cells and incubated at 27 C for 2 hrs. After incubation, the inoculum was removed and replaced with a TNM-FH medium/agarose layer (Invitrogen). The TNM-FH medium contained 12.5 ml of mQH2O, 25 ml of Graces Insect Medium (2x supplemented with FBS), and 50 l of Blue-gal (50mg/ml) and was incubated at 40 C in a water bath for approximately 10 min. The 4.0% SeaKem LE Agarose (Cambrex Bio Science, ME, USA) was heated in a microwave to fully melt the agar and then placed in a 40 C water bath to acclimate the agar to the same te mperature as the TNM-FH medium. After the inoculum was aspirated off the plates, TNMFH medium was combined in a 1:2 volume with the agarose and 6 ml of the TNMFH-me dium/agarose were layered over the cells. The agarose mixtures were allowed to cool a nd harden before the plates were placed in a sealed container with damp paper towels, wh ich prevented drying. Plates were incubated for 5-6 days at 27 C or until blue plaques were visible (Figure 3-2). Once blue plaques were visible, they were individually harves ted and placed in 2 ml of Sf-900 medium and stored at 4 C until further plaque purified again as described. Selected blue plaques were further purified three times. Detection of Recombinant Baculoviruses by PCR Recom binant viruses that were plaque purified at least three times were individually inoculated for 2 hr at 27 C onto 60 mm dishes containing 2 x 106 Sf-9 cells. After incubation, the inoculum was removed a nd replaced with 5 ml of Sf-900 medium (Invitrogen). After 72 hpi, the cell monol ayers were harvested and total DNA was

PAGE 82

82 extracted using the DNAeasy Tissue Kit (Qiagen, CA, USA), following the manufacturers protocol. Forward and reverse primer sequences that flanked the polyhedron promoter were supplied with the Bac-N-Blue expression plasmid to amplify the inserted gene of interest a nd simultaneously screen recombinants for contamination with wild-type vi rus. These primers were: FP 5TTTACTGTTTTCGTAACAGTTTTG-3; RP 5-CAACAACGCACAGAATCTAGC-3 (Integrated DNA Technologies, Inc.). All re actions were in 50 l volumes containing final concentrations of: 400 M of each dNTP, 800 nM of primers, 2.5 U of Taq polymerase (New England Biolabs, Ipswich, MA, USA), 2 mM MgCl2, 2 mM KCl, 0.02 mM DTT, 0.002 mM EDTA, 0.01% Nonidet P40 (v/v), 0.01% Tween 20 (v/v), 1% glycerol (v/v), and 5 l of cDNA. P CR assays were performed in the PTC-100 thermocycler (MJ Research, Inc.) as follows: initial denaturation at 94 C for 2 min followed by 40 cycles of three steps each; 94 C for 1 min, 60 C for 1 min and 72 C for 2 min. A final elongation step of 72 C for 7 min completed the cycling. Fragments of the expected size (~ 1.6 Kb) were amplified by those recombinants containing the DMV-N gene insert and another fragment (~860 bp) was amplified in the case of those recombinant samples also containi ng wild-type virus (Fig 3-3). Messenger RNA (mRNA) Transcript Amplification in RT-PCR Recom binant viruses that were plaque purif ied to at least the third passage were individually inoculated onto drained 3 hr cultures of Sf -9 cells. The inoculum was removed and replaced with Sf-900 medium (Invitrogen). After 72 hpi, the cell monolayers were harvested and RNA was extrac ted using Trizol LS reagent (Invitrogen), following manufacturers protocol. Each sample was treated with DNase I free of RNases (New England Biolabs). Approximately 1 g of each RNA was reverse

PAGE 83

83 transcribed (RT) using SuperScript II (Invitr ogen) in a final reac tion volume of 20 l containing; 50 mM Tris-HCl (p H 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 0.5 mM of dNTP mix, 75 ng of random primers, 2U RNaseOut (Invitrogen). Simultaneously, a duplicate of each sample was set-up as described but without reverse transcriptase. After the RT, PCRs were performed with aliquots from all reactions in 50 l volumes with the following final concentrations: 400 M of each dNTP, 800 nM of primer, 2.5U of Taq polymerase (New England Biolabs), 2 mM MgCl2, 2 mM KCl, 0.02 mM DTT, 0.002 mM EDTA, 0.01% Nonidet P40 (v/v), 0.01% Tween 20 (v/v), 1% glycerol (v/v), and 5 l of cDNA. PCRs were performed in the PTC-100 thermocycler (MJ Research, Inc.) as follows: initial denaturation at 94 C for 2 min followed by 40 cycl es of three steps each; 94 C for 1 min, 60 C for 1 min and 72 C for 2 min. Fragments of the expected size (~ 1.6 Kb) were amplified only from those reco mbinants containing mRNA transcripts for the N gene (Figure 3-4). Infection Assay and Titration of Recombinant Viruses Recom binant viruses that were negative for wild-type contamination, positive for DMV-N amplification by PCR, and positive for mRNA expression by RT-PCR were further screened for -galactocidase activity. Briefly, 24-we ll plates were seeded with 1 x 105 Sf-9 cells/well and inoculated with 500 l of supernatant from each individual plug/recombinant. After 1 hr, the inoculum was removed and replaced with 1 ml of fresh Sf-900 medium (Invitrogen) and the plate was incubated at 27 C and observed for the next 72 hr for cytopathic effects (CPE). Af ter 72 hpi, 20 l of supernatant was collected into 1.5 ml tubes from each well representing the individual recombinants. To each 1.5 ml tube, 1.3 g/l of x-gal (resuspended in 100% DMSO) was added to screen for galactocidase activity.

PAGE 84

84 The two recombinant viruse s that had very strong -galactocidase activity, DMV-N #18 and DMV-N #21, as indicated by the medi a changing to a dark blue color were chosen to be propagated in a larger volume. Briefly, T-25 flasks were seeded with 3 x 106 Sf-9 cells and allowed to attach for 1 hr. The flasks were then inoculated with 1 ml of supernatant from each recombinant for 1 hr on a slow rocking platform, and then, the inoculum was removed and replaced with 6 ml of Sf-900 medium (Invitrogen). CPE developed in both T-25 cultures by 72 hpi compar ed to the control flask in which no CPE was observed. Therefore, the cell monolayer s were harvested by detachment with a plastic cell scraper, separated from the me dium by centrifugation at 1,000 g for 5 min and the clarified supernatants were used immediately for viral titration assays. In order to titrate DMV-N #18 and DMV-N #2 1 recombinant virus stocks that were grown in the T-25 flasks, 96 well pl ates were seeded with 1 x 104 Sf-9 cells per well in Sf-900 medium containing 20 mg/ml of X-gal (Invitrogen). Seri al ten-fold dilutions were made for each virus ranging from 1 x 10-1 to 1 x 10-8. After one week, the mean tissue culture infectious doses (TCID50) were calculated, using the Spearman-Karber formula, and the recombinant virus DMV-N #21 with the highest titer (1 x 108 TCID50) was chosen for further propagation and study. Western Blotting Six 250 m l Erlenmeyer flasks (Fisher Sc ientific Co., Pittsburg, PA, USA) were seeded with 1 x 106 Sf-9 cells/ml and infected with DMV-N #21 at a multiplicity of infection (MOI) of 5, 10, and 20. Two similar flasks were infected with wild-type virus at an MOI 1 and the last flask was used as an uninfected control. Approximately 50 ml of each cell suspension were harvested at 24, 48, 72, and 96 hpi and the cells were pelleted by centrifugation at 1,000 g for 5 min. Cell pellets were frozen and thawed three

PAGE 85

85 times and lysed in 500 l of BD BaculoGold (BD Biosciences, San Jose, CA, USA) insect cell lysis buffer (10 mM Tris pH 7.5, 130 mM NaCl, 1% Triton C-100, 10 mM NaF, 10 mM NaPi, 10 mM NaPPi) with 1x prot ease inhibitor cocktail (supplied with lysis buffer), following the manufacturers protocol. Following lysis, pell ets were centrifuged at 3,000 g x 4 C and 20 l of each supernatant was loaded into 10% Bis-Tis minigels containing sodium dodecyl sufate (SDS) (Invi trogen) and subjected to electrophoresis. At the end of the electrophoresis, the prot eins in the gel were transferred onto a polyvinylidene difluoride membrane (PVDF) (I nvitrogen). Nonspecific binding sites were blocked with 5% (wt/vol) nonfat power ed milk in Tris-buffered saline (TBS) containing 0.1% (vol/vol) Tween 20 (TBS-T) overnight at 4 C with slow rocking. The membrane was probed with a 1:1000 dilution of rabbit anti-measles polyclonal antibody in TBS-T containing 5% (wt/vol ) non-fat powdered milk for 1 hr at room temperature with slow rocking. After four washes using 10 ml of TBS-T with fast rocking per wash for approximately 8 min, the membrane was probed with a secondary reagent; ImmunoPure protein G alkaline phosphata se (Pierce Biotechnol ogy, IL, USA), which was diluted 1:60,000 in TBS-T cont aining 5% non-fat milk for 1 hr at room temperature with slow rocking. The membrane was wash ed four times, as described above before adding the substrate. Approximately 1 ml of Chemiluminescent AP substrate (Millipore, MA, USA) was used in the chromogenic reaction and the membrane was exposed to Lumi-Film Chemiluminescent detection film (Roche Diagnostics, IN, USA) for one hr (Figure 3-5). Large Scale Production of R ecombinant DMV-N #21 Baculovirus Four 250 m l shaker flasks (Fisher Scien tific Co.) were infected with DMV-N #21 at an MOI 5. Approximately 72 hpi, the cell viability was calculated and the cultures

PAGE 86

86 were harvested. Cells and supernatants were separated by centrifugation at 1,000 g at 4 C for 10 min. Pellets were frozen and thawed at least ten times and treated with 1 ml of BD BaculoGold (BD Biosciences) insect cell lysis buffer (10 mM Tris (pH 7.5), 130 mM NaCl, 1% Triton C-100, 10 mM NaF, 10 mM NaPi, 10 mM NaPPi) with 1x protease inhibitor cocktail (supplied with lysis bu ffer), following the manufacturers protocol. Cells that were not completely lysed by freezing and thawing and treatment with the lysis buffer, as determined by light micros copy, were lysed by sonication using the SONICATOR unltrasonic liquid processo r (Misonix, Inc., NY, USA). Sonication consisted of 4 cycles of 30 sec sonication alternated with 1 min on ice. Samples were analyzed by SDS-PAGE and west ern blot using the protocol described above (Figure 35). Transmission Electron Microcopy Three sam ples were submitted for transmission electron microscopy (TEM), which represented clarified ce ll lysates from one-liter of a DMV-N #21 recombinant. The first sample was crude lysate (Fi gure 3-6), the second sample was from the sucrose pellet (Figure 3-7, and the third sample was the purif ied fraction of protei n collected from the CsCl gradient (Figure 3-7). Samples were prepared for TEM by negative stain. Briefly, a 10 l sample suspension was deposited onto a 400 mesh carbon-formvar coated grid. The grid containing the sample was then fl oated onto a droplet of 2% aqueous uranyl acetate for 30 sec. Excess stain was removed and the sample was air-dried. The stained sample was examined and photographed w ith a Hitachi H-7000 TEM (Hitachi High Technologies America, Inc., CA, USA) at 75 kV and photographed with Soft-Imaging Systems MegaView III (Olympus SIS, CO, USA) digital camera.

PAGE 87

87 Purification of Recombinant NLPs by Sucrose Cushion and CsCl Gradient Cell pellets were collected from a 1 L in fection experiment and lysed using the conditions described above. All solutions for the sucrose cushion and CsCl gradient were prepared in PBS. Clarified cytoplasmic ex tracts were layered over a 25% (w/w) sucrose solution and centrifuged in a Beckman SW41 ro tor for 3 hr at 23,000 rpm. Pellets were resuspended in 2 ml of PBS and placed at 4 C overnight to dissolve. Dissolved pellets were centrifuged at 8,000 g for 5 min at 4 C to remove residual debris. Samples were then mixed with an equal volume of 51% CsCl (w/w) and loaded onto a Beckman SW60 rotor for 18 hr at 42,000 rpm. Visible bands (F igure 3-8) were collected from each tube with new syringes and dialyzed at 4 C for 24 hr against PBS using Spectra/Por Biotech Cellulose Ester dialysis membranes (Spect rum Laboratories, Inc., CA, USA). The dialyzed protein bands were screened by we stern blot for detec tion of DMV-N protein (Figure 3-9) and processed by TEM (Fi gure 3-7), as described previously. Determination of Total Protein Concentration To determ ine the total protei n concentration, the Bradford Technique was utilized. In a 15 ml tube, a bovine serum albumin (BSA ) stock solution (Thermo Fisher Scientific, Inc.) was made to a final concentration of 2 mg/ml in 5 ml of PBS. To a 1.5 ml tube, 595.2 l of PBS was added followed by the ad dition of 4.8 l of BSA stock solution, which gave a final concentration of 80 g/ml of BSA. Serial ten-fold dilutions were made by mixing and then transferring 400 l of the tube containing 80 g/ml of BSA to a tube already containing 200 l of PBS, which th en had a final concentration of 53 g/ml. Serial dilutions were continued eight more times or until a final tube had a BSA concentration of 2.1 g/ml. These dilutions were then vortexed and centrifuged at 10,000 g for 2 minutes at 4 C. To Immuno 96 Microwell mi crotiter plate (Thermo Fisher

PAGE 88

88 Scientific, Inc., MA, USA), 150 l of each st andard was added and 150 l of each protein sample was added to individual wells. Then 150 l of room temperature stored Coomassie 200 Plus Reagent (Pierce, In c.) was added to each well containing a standard and the protein samp le. The plate was read immediately using the BioTek KC4 microplate reader (BioTeck Instruments, Inc., VT, USA) at an absorbance of 595 nm. The absorbance values for the standard BS A dilutions were then used to generate a standard curve with the X-axis containing th e known standard diluti on in the units g/ml and the Y-axis containing the absorbance valu es in the units nm (Figure 3-10). The generated standard curve produced the following regr ession equation: y = 0.0083x + 0.2419 with an R2 = 0.9979. The R2 value indicated the confidence in the standard dilutions and the regression equation wa s used to calculate the exact protein concentration of the unknown sample (DMV-N purified protein), based on its absorbance value. Development of an Indirect ELISA (iELISA) using Recombinant Nucleocapsid s Optimal Protein Concentration: To determine the optimal concentration of purified protein to use as antigen in an iELISA, a checkerboard ELISA assay was performed. Briefly, purified nucleocapsid-lik e proteins (NLPs) were prepared at a working dilution of 1:25 (tot al volume was 5 ml) or approx imately 328 ng/well of antigen in the diluent or carbonate bi-carbonate buffer (Sigma-Aldrich, MO, USA). Using a p1000 micropipettor and tip, 2.5 ml were then transferred to an other tube already containing 2.5 ml of diluent to give a final dilution of 1:50 or approximately 164 ng/well. Serial two-fold dilutions were then continued consecutively down to the 1:800 dilution or approximately 10.3 ng/well of antigen. To tw o Immuno 96 Microwell microtiter plates (Thermo Fisher Scientific, Inc.), 100 l of each protein dilution was added to the

PAGE 89

89 appropriate wells and allo wed to incubate at 4 C overnight. Wells were washed once with 200 l of 0.1% Tween 20 in TBS (TBS-T ). Wells were blocked with 100 l of TBS-T containing 5% non-fat milk for 1 hr at 37 C and then washed three times with 200 l of TBS-T. To the entire plate, except column 1, 50 l TBS-T containing 1% non-fat milk was added. To each well in column 1, 100 l of the known positive sera were added with a starting dilution of 1:100. From the wells containing the 1:100 dilution of each serum, serial two-fold dilutions were made by transferring 50 l to the adjacent well containing 50 l of 1% non-fat milk in TBS-T. Serial dilutions were continued by gently mixing with a multi-channel pipette until the 1:51,200 dilution. The serum dilutions, representing the primary antibody, were incubated for 2 hr at 37 C. After primary antibody incubation, the wells were washed six times with 200 l of TBS-T. The secondary reagent had a fina l concentration of 0.08 g/ml of protein G horse-radish peroxidase (Pierce Biotechnol ogies) in TBS-T containing 1% non-fat milk and 100 l was added to each well. Plates were incubated for 1 hr at 37 C followed by washing four times with 200 l of TBS-T per well. To each well, 100 l of ABTS Peroxidase Substrate (KPL Inc., MD, USA) was added a nd incubated at room temperature for 30 to 45 min and read with the BioTek KC4 micropl ate reader (BioTeck Instruments, Inc.) at an optical density of 405 nm. Detection of Morbillivirus Antibodies fro m a Panel of Sera in an iELISA Purified NLPs were diluted 1:200 (approximately 41 ng/well of protein) in carbonate bicarbonate buffer (Sigma-Aldrich) and 100 l was applied to each well of columns 1 through 9 of Immuno 96 Microwell microtiter plates (Thermo Fisher Scientific, Inc.) and allowed to coat the wells bottoms overnight at 4 C. Wells of columns 10 through 12 were coated with 100 l of carbonate bicarbonate buffer to act as

PAGE 90

90 no antigen control wells. Following overnight coating, wells were washed once with 200 l of 0.1% Tween 20 in TBS (TBS-T), blocked with 100 l of TBS-T containing 5% non-fat milk for 1 hr at 37 C and the wells were washed three times with 200 l of TBST. To the entire plate, except for wells of columns 1 and 10 where the 1:100 dilution of each serum was added, 50 l TBS-T containing 1% non-fat milk was added. To each well in column 1 and 10, 100 l of each serum (Table 3-1) were added with a starting dilution of 1:100 dilution. Serial two-fold d ilutions were made by transferring 50 l from the wells containing the 1:100 d ilution and transferring it to the adjacent well containing 50 l of 1% non-fat milk in TBS-T. Serial dilutions were continued by gently mixing with a multi-channel pipette. The sera, representing the primary antibody, were incubated for 2 hr at 37 C. After primary antibody incubation, the wells were washed six times with 200 l of TBS-T. The secondary reagent had a final concentration of 0.08 g/ml of protein G horse-radish peroxida se (Pierce Biotechnologies) in TBS-T containing 1% non-fat milk and 100 l was added to each well. Plates were incubated for 1 hr at 37 C followed by washing four times with 200 l of TBS-T in each well. To each well, 100 l of ABTS Peroxi dase Substrate (KPL Inc.) was added and incubated at room temperature for 30 to 45 min and read with the BioTek KC4 microplate reader (BioTeck Instruments, Inc.) at an optic al density of 405 nm (Table 3-1). The absorbance values were corrected for wells containing antigen by subtracting the mean absorbance value of wells not containing antigen with 1:100, 1:200, and 1:400 dilutions of the sera. An index value was also calculated to determine positive cross-reactivity with sera by taking the absorbance value of the well containing anti gen and dividing it by

PAGE 91

91 the mean absorbance from the three wells without antigen, for each individual serum (Table 3-1). Virus Neutralization Twenty-eight serum samples that had at least a 1:100 titer in the iELISA were further tested in a virus neut ralization (VN) assay using the Edmonston strain of Measles virus. Sera were diluted 1:2 in the diluent or Dulbeccos Modified Eagle Medium (DMEM) containing 1% (vol/vol ) fetal bovine serum (FBS) (I nvitrogen) and incubated at 56 C for 30 min. To a 96-well tissue culture plate (MidSci, Inc., MO, USA), 50 l of diluent was added to all wells. Then 50 l of each inactivated sera were added to the first well in their individual rows and serially diluted in a two-fold manner with a multichannel pipette, by mixing 3 times and transferri ng 50 l of each diluted serum to column 2, column 3, etc. This was repeated until co lumn 10; the 1:1,024 dilution. Then, 50 l of diluent containing 100 TCID50 of measles virus was added to all wells of columns 1 to 10. Column 11 was used as a negative contro l well having only 50 l of that particular serum and no virus (to determine if the highe st serum concentration tested was not toxic for the indicator cells). Wells of column 12 contained only indicator cells and no virus. The plates were immediately incubated at 37 C for 1 hr in an atmosphere of 5% CO2. After the incubation period, 2 x 104 Vero cells were added to each well and the plates were incubated up to 7 d as before and the cells from each individual well scored for the presence or absence of CPE. A virus titra tion was set-up simultaneously with the virus neutralizations to calculate the exact viral ti ter of the measles viru s being used in the assay. Briefly, 300 l of the working dilution of virus at 100 TCID50 was added to a tube already containing 2.7 ml of dilu ent and mixed to obtain a 1:10 dilution. Serial ten-fold dilutions were continued to the minus six dilution and two negative control columns were

PAGE 92

92 used in which virus was not added, only diluen t. The plate with this titration assay was incubated for 1 hr at 37 C and then 1 x 104 Vero cells were added to all wells. The plate was incubated for 7 d at 37oC and all wells scored individu ally for the development of CPE to calculate the actual viral tit er that was used in the assay. Inoculation of Larvae ( Spodoptera fugiperda) w ith Recombinant Baculovirus To assess the in vivo expression of recombinant baculovirus DMV-N #21, fourthinstar Spodoptera fugiperda larvae were kindly donated by Dr. Robert Meaher from the U.S. Department of Agriculture (USDA) located in Gainesville, FL, USA. Approximately 50 larvae were inj ected subcuticularly under the 3rd set of pro-legs from the head with approximately 5 x 104 TCID50 of recombinant baculovirus DMV-N #21 using a sterile 30 guage need le and a syringe pump (Sage Products, Inc., IL, USA) calibrated to release 5 l of inoculum in 5 sec. Approximately 35 larvae were also infected with 1 x 104 TCID50 of wild-type virus (AcNPV) and an additional 35 larvae were used as non-infected control larvae. The three groups of larvae were housed in individual containers containing fresh-cut star grass (Cynodon nlemfuensts Vanderyst var. nlemfuensis) and these containers were placed at 27 C in a day/night-mimicking incubator. Approximately 10 larvae infected with recombinant virus DMV-N #21, 7 larvae infected with wild-type, and 7 larvae being used as larvae controls were collected daily from 48-120 hpi Larvae were immediately sn ap-frozen, which involved being stored in individual cryo-vials and placed in liquid ni trogen storage boxes and compartments until further needed. After bei ng snap-frozen, two larvae re presenting each group were pulverized and resuspended in TBS with 2% (w t/vol) SDS. Insoluble debris was pelleted

PAGE 93

93 and supernatants were frozen and thawed thr ee times. Supernatants were tested for expression of the N protein by SDS-PAGE follo wed by western blotting (Figure 3-11). Results Recombinant Virus Construction and Purification Recom binant baculoviruses that contained the N gene of DMV were purified by at least three passages in plaque assays and te sted by PCR for wild-type contamination and amplification of the N gene (F igure 3-3). Recombinants we re further tested in RT-PCR for expression of the mRNA-N transcript (Fig ure 3-4). Only recombinant viruses that were positive for N gene amp lification, mRNA-N expression, and negative for wild-type contamination by PCR were further propagated and screened for -galactocidase activity and titrated. Production of Recombinant DMV-N Protein Sf-9 cell cultures that we re infected with recom b inant baculovirus DMV-N #21 were pelleted and treated with BaculoGol d (BD Biosciences) insect cell lysis buffer and then resolved by SDS-PAGE. Detection with a polyclonal antibody (rabbit antimeasles virus) revealed the 57-kDa fragment in western blotting (Figure 3-5). No fragment of this size was dete cted in uninfected Sf-9, Vero or in wild-type baculovirus infected cell cultures. Compared to the protein band obtained with the positive control measles virus (~60-kDa band), the band obtai ned in the case of DMV-N #21 was only 57-kDa (Figure 3-5). Transmission Electron Microscopy A crude cytoplasm ic lysate from an Sf-9 cell culture infect ed with DMV-N #21 was prepared for negative staining and electron microscopy. The observed fully assembled nucleocapsid-like pa rticles (NLPs) had characte ristic herringbone morphology

PAGE 94

94 with a diameter of approximately 22 nm (Fi gure 3-6). Purified samples from the sucrose pellet and the CsCl gradient were also submitted for TEM. For the sucrose pellet, negative staining revealed characteristic NLPs with diameter ~22 nm (Figure 3-7 A and B). For the CsCl sample, negative staini ng did not reveal typical fully assembled nucleocapsid-like particle s, like with the crude lysate a nd sucrose pellet, but it did reveal hundreds of long filamentous particles that ha d a diameter of 4-10 nm (Figure 3-7 C and D). Purification of Nucleocapsid-like Particles Using lysed and sonicated cell pellets from a 1 L infection exp eriment (described previously), clarifie d cell lysates were purified by ultracentrifugation through a sucrose cushion and CsCl gradient, in which visible bands were formed (Figure 3-8). The bands were dialyzed against PBS and after dialys is the material in the membranes were collected in 1.5ml tubes and te sted by western blot analysis (Figure 3-9). The western blot results revealed proteins of approximate ly 57-kDa for the three out of the four bands collected after purification with CsCl (Figure 3-9). The four th sample was representative of a band that formed during the CsCl gradient that was much lower than the other three bands collected. Determination of Protein Concentration Total protein concentration was determ in ed by using the regression equation that was generated with the standard curve (Figure 3-10). The st andard curve ge nerated an R2 = 0.9979 (Figure 3-10) and this was indicative of a 99% confidence in the standard dilutions and therefore, the regression equati on used to calculate protein concentration for the DMV-N samples. The purified protein ha d an absorbance value of 0.921 nm so using the absorbance as y, the value for x can be calculated as follows: 0.921 = 0.0083x +

PAGE 95

95 0.2419 = 82 g/ml. Therefore, using the regr ession equation, the pur ified protein had a concentration approximately 82 g/ml compared to the standard controls. Furthermore, a checkerboard iELISA revealed that the optimal concentration of protein that should be used as coating antigen was a 1:200 diluti on or approximately 41 ng/well of protein. Indirect ELISA (iELISA) An iELISA was developed using purified recom binant DMV-N protein as antigen at a concentration of 41 ng/we ll to screen a panel of sera representing three human sera with antibodies to measles virus, three dom estic dog sera with presumed antibodies to canine distemper virus, and 82 marine mammal sera consisting of eight different species of cetaceans and two different species of pinnipeds and manatees, for which the morbillivirus antibody content was unknown (Table 3-1). The rabbit hyperimmune serum against measles virus was also tested as a positive control. All three human sera were confirmed to contain antibodies (Table 3-1) while only two of the three domestic dog sera tested were shown to have morbillivirus antibodies (Table 3-1). In the case of marine mammal sera, 13 out of 37 manatee sera (Table 3-3), five out of eight pinniped sera (Table 3-4), and seven out of 44 cetacean sera were shown to contain morbillivirus antibodies (Table 3-2). All sera considered to be positive for morbillivirus antibodies in the iELISA yielded absorbance values equal or greater than 0.200 and index values equal or greater than 1.8 in at least the 1:100 dilutions, the lowe st dilution tested in the iELISA. Virus Neutralization The VN titers for each of the 28 sera that ha d pos itive iELISA titers, are reported in Table 3-5. All the sera had higher iELISA titers than virus neutralization titers.

PAGE 96

96 Expression of Recombinant N Protein in Larvae Expression of DMV-N #21 in vivo was determined from crude lysates of DMV-N #21 infected larvae by SDS-PAGE and wester n blot analyses. No band at 57-kDa was detected but a prominent band at 45-kDa wa s observed when the lysates were reacted with the polyclonal ra bbit anti-measles antibody (Figure 3-11). Discussion Here, we report on the expression of the first recombinant DMV-N protein produced in a baculovirus expression syst em, which is able to assemble into nucleocapsid-like particles (NLPs). The fo rmation of recombinant NLPs has been previously reported for other members of the genus Morbillivirus like MV, CDV, and RPV (Fooks et al., 1993; Hummel et al., 1992; Ismail et al., 1994; Spehner et al., 1991), but not for DMV. Also, it has b een demonstrated for MV that the ability to assemble into capsid structures is not dependent on the pres ence of MV RNA, which makes it different from other negative-stranded RNA viruses outside of the family Paramyxoviridae (Fooks et al., 1993). For DMV, previous reports ha ve demonstrated the ability to detect antibodies in sera collected from free-ranging marine mammals by using a competitive ELISA (cELISA) assay, for which mouse monoclonal antibodies are needed and produced after immunization with purified whole viral antige n (Saliki and Lehenbaue r, 2001; Saliki et al., 2002). Also, the use of baculovirus-expr essed recombinant RPV-N protein as antigen has been described for an iELISA to test cetacean sera for morbillivirus antibodies (Reidarson et al., 1998). Even though RPVN was cross-reactive with the antibodies detected against morbilliviruses in the cetacean sera, RPV is still a terrestrial morbillivirus and the N protein is slightly di fferent from DMV-N in terms of protein size

PAGE 97

97 and amino acid composition (Banyard et al., 200 8). Therefore, using DMV-N protein as antigen, which should be more closely related to the morbilliviruses that infect marine mammals, may increase sensitivity and specifici ty and consequently improve reliability of results, a much urgently needed element in marine morbillivirus diagnosis. A different study reports the use of infecti ous dolphin morbillivirus as co ating antigen in an iELISA to detect morbillivirus antibodi es in the sera of different species of small cetaceans (van Bressem et al., 2002). Unfortunately, there are only a handful of DMV isolates and access to the virus and the BSL-2 laboratory fa cility needed to handle the virus is not always feasible. Therefore, using a non-inf ectious recombinant protein as antigen, which can be handled at BSL-1 facili ties, is a much more desirable approach for implementing diagnostic assays for viruses in general. Using purified antigen at a concentration of 41 ng/well, 96 serum samples were analyzed for cross-reactivity and it was found that 31 sera were posi tive, with absorbance values 0.200 and index values 1.8, from the following 10 different animal species; Homo sapiens (Table 3-1) Canis familiaris (Table 3-1) Phocoena phocoena (Table 3-2), Kogia breviceps (Table 3-2) Grampus griseus (Table 3-2) Tursiops truncatus (Table 32) Trichechus manatus latirostris (Table 3-3) Trichechus manatus manatus (Table 3-3) Zalophus californianus (Table 3-5), and Eumetopias jubatus (Table 3-5). Similar to the way sera containing morbillivirus antibodies ca n cross-react and neutralize more than one viral species in virus neutralization assays the purified recombinant DMV-N protein cross-reacted with antibodies against morb illiviruses from the above mentioned animal species at a much higher sensitivity than the VN assay in terms of titer. The most reasonable explanation for the higher iELISA titers compared to the VN titers is the fact

PAGE 98

98 that in the iELISA the sera were tested fo r morbillivirus antibodies against the N protein while in the VN assay the antibodies are direct ed against the hemagluttinin (H) protein. For MV infection in humans, it has been shown that antibodi es against the N protein are produced in the highest amounts after a natural infection, most likely because the N protein is released from MV-infected cells in to the extracellular compartment, therefore, activating B-cell receptors before any other viral proteins ar e exposed to the host immune system (Laine et al., 2003; Jacobson et. al., 1989). It may also be important that in the pr esent VN assay, measles virus was used as indicator virus instead of a cetacean or pi nniped morbillivirus. Although morbillivirus neutralizing antibodies are somewhat cro ss-reactive, among different morbillivirus species, it has been reported that the virus th at naturally infects the animal will have the best reactivity with that an imals serum (Knipe and Howley, 2001). Therefore, sera collected from cetaceans that have been infect ed with a morbillivirus will naturally have higher neutralizing titers against cetacean morbilliviruses than against other morbilliviruses. In vivo inoculation of the recombinant DM V-N baculovirus in larvae did not produce protein bands of the expected size by western blot analysis (Figure 3-10), but it did produce protein bands at ~45-kDa. It has been previously descri bed that infection of recombinant baculoviruses for MV at incr eased multiplicities of infection enhanced proteolytic cleavage, but this would warrant further inve stigation to determine if proteolysis played an inhib itory role in the formation of complete nucleocapsids (Hummel et al., 1992; Mount castle et al., 1974).

PAGE 99

99 Purification of the DMV-N protein somehow disassemble d the protein during the CsCl gradient, while the prot eins were still fully assembled after the sucrose cushion (Figure 3-9). Disassembly of recombinant N protein has been prev iously described for MV through subsequent purification steps, but total di sassembly was never observed (Bhella et al., 2004). Interestingly, the disassembly of the prot ein did not seem to affect its antigenicity and therefore reactivity with morbillivirus serum antibodies. It has been determined by monoclonal antibody epitope mapping for MV that the immunodominant B-cell epitopes of the N protein are located in the C-terminal domain and these epitopes are linear (Zvirbliene et al., 2007). Therefore, it is possi ble that these immunodominant antigenic regions are still reactive for DMV-N, even when the protein is not in its proper confirmation. In the iELISA, we detected morbillivirus antibodies to the DMV-N protein from various species of cetacean, manatees, and pinnipeds, which correlates with previous findings. For instance, van Bresse m et al. (2001) described detecting anti-DMV antibodies from cetacean species from all over the world. Previously, Duignan and collaborators (1995) had reported the detection of antibodies to morb illiviruses in a few free-ranging Florida manatees. In the presen t study, we obtained i ELISA titers in the case of 13 serum samples collected from cap tive and free-ranging Fl orida manatees and in one free-ranging manatee transiently captured in Belize as part of a health assessment study. These results indicate that manatees from Florida and Belize may have been exposed in the past to eith er DMV or PMV, in the absence of observed and reported clinical disease. In the case of pinniped sera, we found that all four samples from California sea lions had positive iELISA titers and one out of the four samples from the Stellar sea lions were positive. Previous se rological studies have found anti-morbillivirus

PAGE 100

100 antibodies in Alaskan Stellar sea lions, walr uses, Russian and Alas kan polar bears, and ringed seals ( Phoca hispida) and harp seals (Phoca groenlandica ) from Greenland (Burek et al., 2005; Dietz et al., 1989; Follm ann et al., 1996; Nielsen et al., 2000). Also, in Europe, PDV and CDV have caused large-sc ale epizootics in several different species of pinnipeds, which caused significant populatio n declines (Harkonen et al., 2006; Jensen et al., 2002: Osterhaus et al., 1988). Here, we present the first baculovirus expressed recombinant N protein for use as an antigen in an iELISA to detect morbillivir us antibodies in sera collected from various marine and terrestrial animal species. Although the iELISA can be used to demonstrate previous exposure to morbilliviruses and antibo dies to the N protein are first to develop, further studies would have to be done to i nvestigate how early an ti-N serum antibodies can be detected after an active infection in free-ra nging marine mammal populations (Jacobson et al., 1989; Knipe and Howle y, 2001; Laine et al ., 2003). The newly developed iELISA is recommended as a practical surveillance tool to monitor the activity of marine morbilliviruses in marine mamma ls, without the need to handle infectious virus, and with the added benefit of performing the assay in diagnostic laboratories that operate in a BSL-1 environment. It is r ecommended that future work use the purified recombinant DMV-N antigen to conduct se ro-epidemiological studies to further investigate the prevalence of these marine mo rbilliviruses from animals in all the worlds major oceans.

PAGE 101

101Table 3-1. Human and dog sera iELISA re sults showing the absorbance values te sted against purified DMV-N antigen. Animal ID Sample Species Titer Rb MV Serum Polyclonal 1:400 MV487 Serum Homo sapiens 1:100 MV1231 Serum Homo sapiens 1:12800 MV784 Serum Homo sapiens 1:100 "Cassie" Serum Canis familiaris 1:400 "Drango" Serum Canis familiaris <1:100 "CoCo" Serum Canis familiaris 1:100

PAGE 102

102Table 3-2. Cetacean sera iELISA results showing th e absorbance values against purified DMV-N antigen ID Animal ID Sample Location Date Collected Species Titer V2042 "Bonnie" Serum Mote Marine Lab Aug-2005 Grampus griseus <1:100 V2047 "Clyde" Serum Mote Marine Lab Aug-2005 Grampus griseus <1:100 V2641 "Big Al" Plasma Mote Marine Lab June-2007 Grampus griseus <1:100 V2836 "Big Al" Serum Mote Marine Lab 31-Aug-07 Grampus griseus <1:100 V2642 "Betty" Plasma Mote Marine Lab June-2007 Grampus griseus <1:100 V2834 "Betty" Serum Mote Marine Lab 20-Aug-07 Grampus griseus <1:100 V2643 "Wilma" Plasma Mote Marine Lab June-2007 Grampus griseus <1:100 V2831 "Wilma" Serum Mote Marine Lab 1-Jan-07 Grampus griseus <1:100 V2137 "Jack" Serum Mote Marine Lab Oct-2005 Tursiops truncatus <1:100 V2064 PPS0502 Serum Alaska Sea Life Ctr Aug-2005 Phocoena phocoena <1:100 V2065 PPS0503 Serum Alaska Sea Life Ctr Aug-2005 Phocoena phocoena 1:100 V2783 "Ami"-MML0103A Serum Mote Marine Lab 5-Aug-02 Kogia breviceps <1:100

PAGE 103

103Table 3-2. Continued ID Animal ID Sample Location Date Collected Species Titer V2784 "Nemo"-MML0108 Serum Mote Marine Lab 10-Jan-01 Kogia breviceps <1:100 "Nemo"-0108 Serum Mote Marine Lab 12-May-01 Kogia breviceps <1:100 V2786 MML9805 Serum Mote Marine Lab 25-Aug-98 Feresa attenuata <1:100 V2788 MML9905 Serum Mote Marine Lab 1-Aug-99 Tursiops truncatus <1:100 V2792 "Moonshine"MML0326 Serum Mote Marine Lab 28-Mar-07 Stenella attenuata <1:100 V2796 "Harley"-MML0509 Serum Mote Marine Lab 5-Feb-07 Stenella longirostis <1:100 Porpoise 256 Serum University of GA Oct-05 Phocoena phocoena <1:100 Porpoise 16 Serum University of GA Oct-05 Phocoena phocoena 1:100 V2804 "Doc"-MML0414A Serum Mote Marine Lab 27-Sept-04 Steno bredanensis <1:100 V2799 "Vixen"-MML0237 Serum Mote Marine Lab 28-Jul-03 Steno bredanensis <1:100 V2805 "Dopey"-MML0414B Serum Mote Marine Lab 20-Aug-04 Steno bredanensis <1:100 V2801 "Bashful"MML04114C Serum Mote Marine Lab 15-Sept-04 Steno bredanensis <1:100 V2806 "Happy"-MML0414D Serum Mote Marine Lab 9-Aug-04 Steno bredanensis <1:100

PAGE 104

104 Table 3-2. Continued ID Animal ID Sample Location Date Collected Species Titer V2809 "Sleepy"-MML0414F Serum Mote Marine Lab 28-Jan-05 Steno bredanensis <1:100 V2803 "Sneezy"-MML0414G Serum Mote Marine Lab 28-Jan-05 Steno bredanensis <1:100 V2810 "Armand"-MML0234 Serum Mote Marine Lab 13-Jan-03 Kogia breviceps 1:100 V2812 "CR"-MML0311 Serum Mote Marine Lab 22-Apr-03 Tursiops truncatus <1:100 V2813 MML0004 Serum Mote Marine Lab 9-Feb-00 Delphinus delphis <1:100 V2814 MML006 Serum Mote Marine Lab 20-Feb-00 Kogia breviceps <1:100 V2815 MML008 Serum Mote Marine Lab 7-Mar-00 Tursiops truncatus <1:100 V2816 MML009 Serum Mote Marine Lab 13-Mar-00 Kogia breviceps <1:100 V2818 MML017 Serum Mote Marine Lab 2-Oct-00 Kogia breviceps <1:100 V2820 "Jack"-MML334 Serum Mote Marine Lab 19-Jan-04 Tursiops truncatus <1:100 V2821 "Toro"-MML0403 Serum Mote Marine Lab 15-Mar-04 Tursiops truncatus 1:100 V2823 "Val"-MML0605 Serum Mote Marine Lab 3-May-06 Tursiops truncatus <1:100 V2861 Pygmy Killer Whale Serum Gulfport, MS 19-Apr-08 Feresa attenuata <1:100

PAGE 105

105 Table 3-2. Continued ID Animal ID Sample Location Date Collected Species Titer V2035 Pygmy Sperm Whale Serum GA Dept Natl Res July-2005 Kogia breviceps 1:100 KB0111 Serum Mote Marine Lab 23-Mar-01 Kogia breviceps 1:100 V2825 "Castaway"MML0624 Serum Mote Marine Lab 8-Jan-07 Tursiops truncatus <1:100 V2939 MML0329 Serum Mote Marine Lab 13-Aug-03 Grampus griseus 1:100 V2827 "Filly"-MML0701 Serum Mote Marine Lab 23-Mar-07 Tursiops truncatus <1:100 V2829 "Dancer"-MML0705 Serum Mote Marine Lab 23-Apr-07 Tursiops truncatus <1:100

PAGE 106

106Table 3-3. Manatee sera iELISA results showing the absorbance values against purified DMV-N antigen ID Animal ID Sample Location Date Collected Species Titer V2068 Betsy Serum Crystal River, FL 9-Jul-98 Trichechus manatus latirostris <1:100 V2877 Betsy Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris <1:100 V2070 Holly Serum Crystal River, FL 22-Aug-02 Trichechus manatus latirostris 1:100 V2072 Oakley Serum Crystal River, FL 20-Jun-02 Trichechus manatus latirostris <1:100 V2075 Willoughby Serum Crystal River, FL 25-Feb-99 Trichechus manatus latirostris <1:100 V2080 Amanda Serum Crystal River, FL 13-Jan-00 Trichechus manatus latirostris 1:100 V2873 Amanda Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris 1:100 V2081 Lorelei Serum Crystal River, FL 13-Jan-00 Trichechus manatus latirostris 1:1600 V2082 "Lorelei" Serum Crystal River, FL 20-Jun-02 Trichechus manatus latirostris 1:800 V2875 "Lorelei" Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris 1:1600

PAGE 107

107Table 3-3. Continued ID Animal ID Sample Location Date Collected Species Titer V2083 Ariel serum Crystal River, FL 20-Feb-01 Trichechus manatus latirostris <1:100 V2874 "Ariel" Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris <1:100 V2876 "Electra" Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris <1:100 V2872 Rosie Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris 1:400 V2084 Star Serum 9-Jul-98 Trichechus manatus latirostris 1:400 V2840 CSW035 Serum 30-Jan-01 Trichechus manatus latirostris <1:100 V2841 Serum May-01 Trichechus manatus latirostris <1:100 V2842 CWS084 Serum Jan-01 Trichechus manatus latirostris <1:100 V2843 Ttb065 Serum 27-Feb-01 Trichechus manatus latirostris 1:100

PAGE 108

108Table 3-3. Continued ID Animal ID Sample Location Date Collected Species Titer V2844 LC210320 Serum 4-May-01 Trichechus manatus latirostris <1:100 V2844 LC210320 Serum 4-May-01 Trichechus manatus latirostris <1:100 V2845 1348 Serum 4-May-01 Trichechus manatus latirostris <1:100 V2846 Playton Serum 26-Feb-01 Trichechus manatus latirostris <1:100 V2847 CSW037 Serum Southwest,FL31-Jan-01 Trichechus manatus latirostris <1:100 V2848 CSW036 Serum Southwest,FL30-Jan-01 Trichechus manatus latirostris 1:100 V2849 TTB061 Serum Tampa Bay, FL 23-Feb-01 Trichechus manatus latirostris <1:100 V2850 TNP-11 Serum 21-Jan-01 Trichechus manatus latirostris <1:100 V2851 12 Serum Trichechus manatus latirostris <1:100

PAGE 109

109Table 3-3. Continued ID Animal ID Sample Location Date Collected Species Titer V2852 FSW031 Serum 30-Jan-01 Trichechus manatus latirostris 1:100 V2853 TNP-21 Serum 21-Mar-01 Trichechus manatus latirostris <1:100 V2854 TSW-033 Serum Southwest,FL30-Jan-01 Trichechus manatus latirostris <1:100 V2855 TSW-034 Serum Southwest,FL31-Jan-01 Trichechus manatus latirostris 1:100 V2856 LP2101357 Cupid Serum Trichechus manatus latirostris <1:100 V2857 TNP-10 Serum 20-Mar-01 Trichechus manatus latirostris <1:100 V2858 220962813a Serum 16-May-01 Trichechus manatus latirostris <1:100 V2860 620410078 Serum 16-May-01 Trichechus manatus latirostris <1:100 V2090 BZ03F28 Serum Belize 19-Apr-05 Trichechus manatus manatus 1:100

PAGE 110

110 Table 3-4. Pinniped sera iELISA results showing the absorbance values against purified DMV-N antigen ID Animal ID Sample Location Date Collected Species Titer V2645 SWO-70313 Serum Sea World San Diego Jun-07 Zalophus californianus 1:100 V2619 "Rueben"CSC6934 Serum Apr-07 Zalophus californianus 1:400 V2613 "Lenora"CSC6933 Serum Apr-07 Zalophus californianus 1:100 V2608 "RSQ Virginia"CSL7018 Serum Apr-07 Zalophus californianus 1:100 SSL2004504SE Serum Southeast Alaska 19-Aug-04 Eumetopias jubatus <1:100 SSL2004505SE Serum Southeast Alaska 19-Aug-04 Eumetopias jubatus 1:100 SSL2005594AL Serum Aleutian Islands, AL 19-Aug-05 Eumetopias jubatus <1:100 SSL595AL Serum Aleutian Islands, AL 19-Aug-05 Eumetopias jubatus <1:100

PAGE 111

111Table 3-5. Sera samples that were positive in an iELISA a ssay with their corresponding vi rus neutralization (VN) titers ID Animal ID Sample Location Date Collected Species iELISA Titer VN Titer Rb MV Serum Moyer Lab, Univ of Florida Aug-05 Polyclonal 1:400 1:128 MV487 Serum Moyer Lab, Univ of Florida Aug-05 Homo sapiens 1:100 1:64 MV1231 Serum Moyer Lab, Univ of Florida Aug-05 Homo sapiens 1:12800 1:256 MV784 Serum Moyer Lab, Univ of Florida Aug-05 Homo sapiens 1:100 1:64 "Cassie" Serum Gaskin Lab, Univ of Florida Oct-05 Canis familiaris 1:400 1:32 "CoCo" Serum Gaskin Lab, Univ of Florida Oct-05 Canis familiaris 1:100 1:32 Porpoise 16 Serum University of GA, Athens Oct-05 Phocoena phocoena 1:100 1:16 V2810 "Armand"MML0234 Serum Mote Marine Lab 13-Jan-03 Kogia breviceps 1:100 1:8 V2821 "Toro"MML0403 Serum Mote Marine Lab 15-Mar-04 Tursiops truncatus 1:100 1:16 V2065 Harbor Porpoise Serum Alaska Aug-05 Phocoena phocoena 1:100 1:16 V2035 Pygmy Sperm Whale Serum Mote Marine Lab Jul-05 Kogia breviceps 1:100 1:16 KB0111 Serum Mote Marine Lab 23-Mar-01 Kogia breviceps 1:100 1:16 V2939 MML0329 Serum Mote Marine Lab 13-Aug-03 Grampus griseus 1:100 1:64 (N/A): Indicates that a VN assay was not performed with this serum sample.

PAGE 112

112 Table 3-5. Continued ID Animal ID Sample Location Date Collected Species iELISA Titer VN Titer V2070 Holly Serum Crystal River, FL 22-Aug-02 Trichechus manatus latirostris 1:100 1:16 V2080 Amanda Serum Crystal River, FL 13-Jan-00 Trichechus manatus latirostris 1:100 1:16 V2873 "Amanda" Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris 1:100 N/A V2081 Lorelei Serum Crystal River, FL 13-Jan-00 Trichechus manatus latirostris 1:1600 1:64 V2082 "Lorelei" Serum Crystal River, FL 20-Jun-02 Trichechus manatus latirostris 1:800 1:32 V2875 "Lorelei" Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris 1:1600 N/A V2872 "Rosie" Serum Crystal River, FL 16-May-08 Trichechus manatus latirostris 1:400 N/A V2084 Star Serum 9-Jul-98 Trichechus manatus latirostris 1:400 1:32 V2843 Ttb065 Serum 27-Feb-01 Trichechus manatus latirostris 1:100 1:8 V2848 CSW036 Serum 30-Jan-01 Trichechus manatus latirostris 1:100 1:8 (N/A): Indicates that a VN assay was not performed with this serum sample.

PAGE 113

113 Table 3-5. Continued ID Animal ID Sample Location Date Collected Species iELISA Titer VN Titer V2852 FSW031 Serum 30-Jan-01 Trichechus manatus latirostris 1:100 1:8 V2855 TSW-034 Serum 31-Jan-01 Trichechus manatus latirostris 1:100 1:8 V2090 BZ03F28 Serum Belize 19-Apr-05 Trichechus manatus manatus 1:100 1:8 V2645 SWO-70313 Serum Sea World, San Diego Jun-07 Zalophus californianus 1:100 1:4 V2619 "Rueben"CSC6934 Serum Sausalito, CA Apr-07 Zalophus californianus 1:400 1:8 V2613 "Lenora"CSC6933 Serum Sausalito, CA Apr-07 Zalophus californianus 1:100 1:4 V2608 "RSQ Virginia"CSL7018 Serum Sausalito, CA Apr-07 Zalophus californianus 1:100 1:4 SSL2004505SE Serum Southeast Alaska 19-Aug-04 Eumetopias jubatus 1:100 N/A (N/A): Indicates that a VN assay was not performed with this serum sample.

PAGE 114

114 Figure 3-1. Supernatant collecte d, post-transfection, during da ys 1 through 9. With the addition of -galactocidase, the intensity of the blue increased daily, which correlated with replication of recombinant DMV-N baculovirus. Figure 3-2. Plaque assay with a blue plaque representative of a recombinant DMV-N baculovirus, compared to an uninfected control dish. Day 1 Day 3 Day 5 Day 7 Day 9 Recombinant Control

PAGE 115

115 Figure 3-3. Agarose gel electrophoresis showi ng PCR results from DNA extracted from insect cells that were infected with s upernatant from recombinant viral plugs. The ~1.6-Kbp (N) fragment depicts amplification of the N gene and the 839bp (W.T) fragments represent wild-type contamination in those same recombinant viral plugs. The negative control (-ve) is also labeled. Figure 3-4. Gel electrophoresis showing RT-PCR results fr om RNA that was extracted from insect cells that were infected with supernatant from recombinant viral plugs (3.1, 4.1, 4.2, 2.1). The ~1.6-Kbp bands represent mRNA transcription of the N gene in those samples where superscript was added (SS), compared to the same samples where superscrip t was not added (NS) in the reverse transcription reaction. All RNA samples were treated with DNase prior to the reverse transcription reaction. 123456789 10111213 ve -veNS-ve SS+ve3.1 SS 3.1 NS 4.1 NS 4.2 SS 2.1 SS 2.1 NS 4.1 SS 4.2 NS -veNS-ve SS+ve3.1 SS 3.1 NS 4.1 NS 4.2 SS 2.1 SS 2.1 NS 4.1 SS 4.2 NSDMVmRNA N N W.T DMV-N Recombinants

PAGE 116

116 Figure 3-5. SDS-PAGE followed by western blot analysis of crude lysates from infected insect cells at 72 hpi. The DMV-N reco mbinant protein is ~57kDa. Lane 1Measles virus positive control (N pr otein is 60kDa); Lane 2DMV-N recombinant infected at MOI 5; Lane 3DMV-N recombinant infected at MOI 10; Lane 4DMV-N recombinant in fected at MOI 20; Lane 5DMV-N recombinant infected at MOI5 from 1 L experiment; Lane 6Uninfected Vero cell control; Lane 7Sf-9 ce ll control; Lane 8wild-type baculovirus control. Figure 3-6. Transmission electron microscopy of the recombinant nucleocapsid particles from crude lysate from a 1 L infection assay with infection at an MOI 5 and collection at 72 hpi. Arrows indicate herring-bone like st ructures of the recombinant nucleocapsid particle that has fully assembled in both A and B. A B 60-kDa 1 2 3 4 5 6 7 8

PAGE 117

117 Figure 3-7. Transmission electron microscopy of DMV-N infected lysate that was purified by sucrose cushion (A and B) a nd CsCl gradient (C and D). Arrows indicate structures that are fully assembled NLPs with herring-bone morphology in A and B and then stru ctures that look similar to the herringbone morphology of NLPs in C and D. The NLPs in A and B had diameters of 20-22 nm diameters and the structures in C and D had diameters ~5 nm. A B D C

PAGE 118

118 Figure 3-8. Visible bands, indi cated by arrow, from a CsCl gradient using clarified cell lysates that were first pelleted in a su crose cushion. Bands were collected and tested in western blot and TEM after dialysis against PBS. Figure 3-9. SDS-PAGE followed by western blot analysis fr om dialyzed CsCl bands. DMV-N protein is ~57-kDa. Lane 1protein ladder; Lane 1Measles virus positive control (N is ~60-kDa); Lane 2CsCl sample 1, cell pellets were not sonicated; Lane 3CsCl sample 2, cell pellets were sonicated; Lane 4CsCl sample 3, cell pellets were not sonicated; Lane 5CsCl sample 4, cell pellets were sonicated and the observed band was low in the CsCl gradient; Lane 6Sf-9 uninfected cell control; Lane 7wild-type inf ected control. 1 2 3 4 5 6 7 8 60kDa

PAGE 119

119 Bradford Assayy = 0.0083x + 0.2419 R2 = 0.9979 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 020406080100 Standard (ug/ml)ABS Figure 3-10. Standard curve of the generated absorbance values for the BSA standards as they compare to the concentration of BSA in each sample. The generated R2 value was 0.9979 and is representative of a 99% confidence in the BSA standard dilutions. Figure 3-11. Cell lysates from infected in sect larvae collected on various days postinoculation. Larvae were lysed in e ither Ripa (R) buffer or BaculoGold insect lysis buffer. Lane 1MV positive control; Lanes 2 & 3larvae collected 120 hpi; Lanes 4 & 5larvae collected 96 hpi; Lanes 6 & 7-larvae collected 72 hpi; Lane 8Uninfected cont rol larvae collected 120 hpi; Lane 9wild-type infected larvae collected 120 hpi. 60kDa 45kDa 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9R BG R BG R BG R R 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9R BG R BG R BG R R

PAGE 120

120 CHAPTER 4 EXPRESSION OF THE NUCLEOCAPSID GENE OF DOLPHIN M ORBILLIVIRUS IN YEAST ( Kluyveromyces lactis ) Introduction Dolphin m orbillivirus (DMV ) is a member of the Morbillivirus genus in the family, Paramyxoviridae. DMV is a respiratory virus that can cause upper respiratory distress and neurological disease in cetaceans that ultimately can lead to st randing and death. DMV was first isolated in 1990 from striped dolphins ( Stenella coeruleoalba ) that had stranded and died along the Spanish Mediterranean coast (Domingo et al., 1990). During 1991, DMV infection rapidly spread to other countries along the Mediterranea n Sea like France, Italy, Greece, and Turkey and France where it was also isolated from striped do lphins (Di Guardo et al ., 1992; Di Guardo et al., 1995; Domingo et al., 1992; Osterhaus et al., 19 95). More recently, star ting in July 2007 over 100 striped dolphins were reported to have stranded in these same waters and RT-PCR results and sequencing confirmed that these animals had been infected with a similar strain of DMV (Raga et al., 2008). Also, in January 2007 a white beaked dolphin ( Lagenorhynchus albirostris ) was found stranded along the North Friesian coas t of Germany where it had to be humanely euthanized (Wohlsein et al., 2007). RT-PCR an d immunohistochemistry results were positive for a morbillivirus having nucleot ide homologies of 99% to the N gene and 98% to the P gene of a strain of DMV that was previously isolated from Mediterranean stripe d dolphins (Wohlsein et al., 2007). DMV infection is not restricted to European waters. DMV has been retrospectively linked to the mass die-off of bottlenose dolphins ( Tursiops truncatus ) along the Atlantic coast of the U.S. during 1987-1988 and reportedly continued to a ffect this same species of dolphin down to the Gulf of Mexico through 1994 (Krafft et al., 1 995; Lipscomb et al., 19 94; Taubenberger et al., 1996). Over the last 21 years, DMV has been an infectious viral pathogen of cetaceans and it is

PAGE 121

121 important that diagnostic assays keep progressing to efficiently identify these cetacean morbilliviruses. Here we report the expression of the nucleocapsid (N) gene of DMV in yeast ( Kluyveromyces lactis ) expression system as a means of producing non-infectious, durable, viral protein for use as antigen in serological detection assays. Since yeasts are eukaryotic, they have the added benefit of performing necessary post-tr anslational modifications like protein folding and glycosylation compared to prokaryotic systems. Additionally, unlike other eukaryotic expression systems, yeast can be grown to very high densities with pr oduction durable strains and low overall production costs (Slibinskas et al., 2004). Using recombinant yeast strains to express morbillivirus proteins has only been described for measles virus (MV), which infects humans, and rinderpest virus (RPV), which infects large ruminants, and not for any of the marine morbilliviruses (Samuel et al., 2003; Shaji and Sh aila, 1999; Slibinskas et al., 2004). In this particular study, we inserted the nucleocapsi d gene of a dolphin morbillivirus into two recombinant yeast strains. The first recombinant yeast strain contained an -mating factor secretion domain (DMV), which had the potential to allow secretion of the protein into the yeast medium. The second recombinant yeast strain did not contai n the secretion domain (DMV-I), therefore, it only had the potential to express the protein intracellularly. Materials and Methods Amplification of the Nucleocapsid Gene Total RNA was extra cted from Vero cell cultures that had been infected with dolphin morbillivirus (DMV), using Trizol Reagent (Invitrogen, CA, USA), following the manufacturers protocol. Approximately 1g of each RNA was reverse transcribed (RT) using SuperScript II (Invitrogen) in a final reaction volume of 20 l containing: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol (DTT), 0.5 mM of dNTP mix, 75 ng of random primers, 2 U RNaseOut (Invitrogen), and 5 U M-MLV reverse transcriptase. The RT reaction

PAGE 122

122 was performed at 42 C for 1 hr followed by inactivation of the reverse transcriptase enzyme by heating at 70 C for 15 min. Previous sequences published for the N gene were retrieved from the GenBank database to design primer sets to speci fically amplify the complete open reading frame (ORF) of DMV. Conserved upstream and downs tream sequences of the N gene ORF were identified after multiple nucleotide sequen ce alignments using the DNASTAR Lasergene MegAlign function (DNASTAR Inc., Madison, WI, USA). For DMV (GenBank accession no. AJ608288 ), the following primers were designed with the -MF domain sequence and XhoI (forward primer) and NotI (reverse primer) restriction sites: N-FP1 5CTCGCGGCCGCGCTCAGAATGGGT CCTTTTGTTTA-3; N-RP 5CTCGCGGCCGCGCTCAGAGTGGATCCTTTTGTTC A-3 (Integrated DNA Technologies, Inc., IA, USA). Another forward prim er (N-FP2) was desi gned, without the -MF domain and containing the HindIII restriction s ite, that could be used with the reverse primer N-RP described above: N-FP2 5-CTCAAGCTTATGGCGAC ACTTCTTCGG-3 (Integrated DNA Technologies, Inc.). Amplification reactions were set-up in 50 l final volumes containing: 400 M of each dNTP, 800 nM of one forward (N-FP1 or N-FP2) and reverse (N-RP) primer, 0.05 U Platinum Pfx DNA polymerase (Invitrogen), 2 mM MgCl2, 10 mM Pfx Enhancer (Invitrogen), 1x Pfx amplification buffer (Invitrogen), and 3 l of cDNA. PCR assays were performed in the PTC-100 thermocycler (MJ Re search, Inc., MA, USA) as follows: initial denaturation at 94 C for 2 min followed by 39 cycles of three steps each; 94 C for 15 sec, 55oC for 30 sec and 68 C for 2 min and 30 sec. A final amplification step of 94C for 15 sec, 55 C for 1 min and 68 C for 7 min completed the cycling. Amp lified fragments of the expected size, approximately 1.6-Kbp, were resolved after ag arose gel electrophoresis (Figure 4-1). PCR products were purified with the QIAquick PC R purification kit (Qiagen Inc., CA, USA),

PAGE 123

123 following the manufacturers protocol, a nd quantitated using the Ultraspec 3000 spectrophotometry (GE Healthcare Bi o-Sciences Corp., NJ, USA). Cloning of DMV-N into pKLAC1 Vector Approxim ately 1g of DMV DNA and 0.5g of pKLAC1 plasmid vector (New England Biolabs, Ipswich, MA, USA) were digested for 4 hr at 37C in 30 l volumes containing 16 U of XhoI and 10 U of NotI with NEB Buffer 3 (DMV-N gene amplified with -MF domain) or 10 U of HindIII and NotI with NEB Buffer 2 (DMV-N gene amplified without the -MF domain). The digests were purified using the QIAquick PCR purification kit (Qiagen Inc.), following the manufacturers protocol, a nd quantitated by spectrophotometry (GE Healthcare Bio-Sciences Corp.) An overnight ligation was set-up in the Mi croCooler II (Boekel Scientific, PA, USA) at 16C in a 20 l volume containing: approximate ly 3 g of DMV-N digested DNA, 1g of digested pKLAC1 DNA, 1 U of T4 DNA Ligase (Invitrogen), 4 l of 5x T4 Ligase Buffer (250 mM Tris-HCl (pH 7.6), 50 mM MgCl2, 5 mM ATP, 5 mM DTT, 25% (w/v) polyethylene glycol8000) (Invitrogen). All 20 l of the overnight ligation reaction were used to transform Top 10 competent bacteria (Invitrogen). Individua l bacterial colonies were expande d as overnight minicultures (3 ml volumes) and plasmid DNA was extracted from these cultures using a 10 min protocol (Zhou et al., 1990) and the correct recombinant plasmids were identified by restriction digest for 1 hr at 37C with endonucleases XhoI and No tI (DMV-N amplified with the -MF domain) or HindIII and NotI (DMV-N amplified without the -MF domain), as previously described, followed by agarose gel electrophoresis. Purified plasmi d DNA for sequencing was obtained from the remaining bacterial mini-cultures of plasmids know n to carry an insert of the correct size using the Aurum Plasmid Mini DNA Kit (Bio-Rad, CA, USA). The cloned N gene insert was fully sequenced using the CEQ2000XL sequencing instru ment (Beckman Coulter Inc., CA, USA) and

PAGE 124

124 sequencing primers for the N gene containing the -MF domain (S-FP1 and S-RP1) and the N gene not containing this doma in (S-FP2 and S-RP1) that were designed following the K. lactis Expression Kit (New England Biolabs) manual: S-FP1 5-GAAGAAGCCTTGATTGGA-3; SFP2 5-GCGGATAACAAGCTCAAC-3; S-RP1 5-TTATCGCACAAGACAATC3(Integrated DNA Technologies, Inc.). The gene rated sequences were compared with other published DMV-N morbillivirus genes using th e BLAST function on the NCBI database and aligned using the MegAlign function of the La sergene software (DNASTAR Inc., WI, USA). Linearization of Recombinant pKLAC1 Plas mid for Integrative Transformation of K. lact is Two pKlac1 recombinants containing the N ge ne insert (one recombinant with and one without the -MF domain) were linearized to allow for its insertion into the K. lactis genome at the LAC4 locus. Briefly, 2 g of recombin ant pKLAC1 plasmid DNA wa s digested at 37C for 6 hr in a 50 l volume using 20 U of SacII re striction endonuclease and containing 1x NEBuffer 4 (New England Biolabs). The digests were purified with QIAquick PCR purification kit (Qiagen Inc.) following the manufacturers protoc ol. The purified digest was quantitated by the Ultraspec 3000 spectrophotometry (GE Healthcare Bio-Sciences Corp.) and approximately 5 l were analyzed by endonuclease digestion followed by gel electrophoresis in 1% agarose (data not shown). A vial of K. lactis competent cells (New England Biolabs) were thawed on ice and 620 l of Yeast transformation reagent (New England Biolabs) was added to the vial and inverted to mix. A sterile loop wa s used to streak a plate with unt ransfected cells to be used as negative controls. Approximately 1 g of lin earized recombinant pKLAC1 DNA was added to the competent cells and the vial was inverted to mix before bei ng incubated at 30C for 30 min. After incubation, cells were microcentrifuged at 7,000 g for 2 min and then the supernatant was removed and replaced with 1 ml of sterile water. This last step was repeated two times before

PAGE 125

125 final resuspension in 1 ml of sterile YP Glucose medium (New England Biolabs). The cell suspension was transferred to a gl ass culture tube and incubated at 30C for 30 min with shaking at 250 rpm. The cell suspension was then transf erred to a 1.5 ml Eppendo rf tube, centrifuged at 7,000 g for 2 min and the supernatant was replaced with 1 ml of sterile deionized water. Three volumes consisting of 100 l, 50 l, and 10 l were spread on YCB Agar Medium (New England Biolabs) plates containing 5 mM acetamid e and incubated for 4 d at 30C. After this incubation, approximately 10 indivi dual colonies were streaked onto fresh YCB Agar Medium plates containing 5 mM acetamide and incubated for another 2 d at 30C and screened by PCR for integration. PCR Screening to Test Transformants for Integration and Multi-copy Integration Using 200 l sterile pipette tips, a transfor mant from each of the 10 plates was picked from an area approximately 2 mm2 and resuspended in 25 l of 1 M sorbitol containing 10 mg/ml of Lyticase (Sigma-Aldrich, MO, USA), mixed by vortexing, and incubated at 30C for 1 hr. About 5 l of Lyticase-treated ce lls were used as a template in a 100 l PCR reaction with final concentrations consisting of: 400 M of each dN TP, 800 nM of primer, 2.5 U of Taq polymerase (New England Biolabs), 2 mM MgCl2, 2 mM KCl, 0.02 mM DTT, 0.002 mM EDTA, 0.01% Nonidet P40 (v/v), 0.01% Tween 20 (v/v), and 1% glycerol (v/v). PCR assays were performed in the PTC-100 thermocycler (MJ Research, Inc., MA, USA) as follows: initial denaturation at 94 C for 2 min followed by 40 cycles of three steps each; 94 C for 1 min, 60 C for 1 min and 72 C for 2 min. A final elongation step of 72 C for 7 min completed the cycling. Primer sequences to test for integration and multi-copy integration were supplied by the K. Lactis Protein Expression Kit (New E ngland Biolab, Inc.) and were as follows for transformants containing the DMVrecombinants: IFP-1 5-TACCGACGTATATCAAGCCCA -3; IRP-1 5-ATCATCCTTGTCAGCGAAAGC-3 (Integrated DNA Technologies, Inc.) (F igure 4-2). To

PAGE 126

126 screen DMV-I transforma nts, not containing the -MF domain for integration, the following primers were used: IFP-1; IRP-2 5 AGGATCCAAATTTGTGCAAG-3. Transformants containing the properly integrated expression fragment at the LAC4 locus amplified fragments 1.9-Kbp in length (Figure 4-2 and Figure 4-3). To screen for multi-copy integration, approximately 2 mm2 of yeast colony was incubated with 25 l of Lyticase (Sigma-Aldrich), and PCR reactions were set-up as described above with different primer sets. To screen for multi-copy integration with DMVtransformants the following primer sets were used: IRP2; IFP-2 5-CAGTGAT TACATGCATATTGT-3 (Integrated DNA Technologies, In c.) (Figure 4-4). To screen DMV-I transformants for multicopy integration IFP-2 and IRP-2 were used (Figure 4-4). Growth of DMVRecombinant Yeast Strains Approxim ately 3 ml of YPGlu media (New E ngland Biolabs) were placed in individual glass test tubes. Two transformants that tested positive for integration and multi-copy integration were chosen and inoculated into individual test tubes using a sterile loop. The third test tube with media was inoculated with untransfected yeast cells. Tubes were placed on a slant and incubated at 30C for 3 d with shaking at 250 rp m. On day three, 300 ml of YPGlu medium were placed in three 500 ml flas ks and inoculated with the 3 ml of culture that had been previously growing for three days. The 500 ml fl asks were incubated at 30C with shaking at 250 rpm for 16 days with daily collections of 50 ml of cell suspension from each flask and replacement of 50 ml of fresh YPGlu medium (New England Biol abs). Cell suspensions were immediately pelleted by centrifuga tion at 3,000 g for 3 min at 4 C and the pellets were resuspended with 1 ml of 30 mM NaPO4 containing 10 mg/ml of Lyticase (Sigma-Aldrich). Yeast cells were lysed by treating with an equal volume of 1 ml of 30 mM NaPO4 containing 1 mg/ml of zymolyase (Sigma-Aldrich) for 2 hr at 30C. After incubation, cells were then

PAGE 127

127 vortexed with acid-washed glass beads (w/v) (Sig ma-Aldrich) for a total of 15 min consisting of 30 sec of vortexing followed by 30 sec on ice. Cells were viewed by light microscopy to check for complete lysis. Growth of DMV-I Recombinant Yeast Stra ins for Expression of DMV-N Protein A 30 m l YPGlu shaker flask was inoculated with a recombinant yeast strain, which was positive for integration by PCR analysis (Figure 4-3), and incubated at 30 C for 72 hr with shaking at 250 rpm. Approximately 10 ml of yeast culture was coll ected every 24 hr up to 72 hr. Upon the removal of 10 ml of y east culture, 10 ml of fresh YPGl u medium were added back to the culture. The yeast cells were pelleted for 3 min at 4 C at 10,000 g and incubated for 1.5 hr with 1 ml of zymolyase (Sigma-Alrich) cont aining Complete Mini EDTA-free protease inhibitor cocktail (Roche Diagnos tics, IN, USA). After incubation, cells were frozen and thawed at least 3 times and then vortexed with acid-wash ed glass beads (w/v) (Sig ma-Aldrich) for a total of 15 min consisting of 30 sec of vortexing follo wed by 30 sec on ice. Cells were viewed by light microscopy to check for complete lysis. Pellets that were not completely lysed were subjected to sonication using SONICATOR unltr asonic liquid processo r (Misonix, Inc., NY, USA) consisting of four cycles of 30 sec of sonication and 1 min on ice. Samples were immediately analyzed by SD S-PAGE and western blot. Immunoprecipitation of DMVRecombinant Yeast Lysate A 1:100 dilu tion of rabbit anti-MV polyclonal antibody was added to 50 l of each sample and incubated overnight at 4C with slow rocking. Approximately 20 l of Protein G Sepharose-4B beads (Sigma-Aldrich) were used per sample and prior to incubation were washed three times as follows: suspension of the beads in 1 ml of PBS, centrifugation for 1 min at 14,000 g, and removal of PBS. The process wa s repeated two more times. The washed beads were resuspended in PBS and used at 20 l vol umes per sample already containing the primary

PAGE 128

128 antibody and incubated for 2 hr at room temper ature with slow rocking. Following incubation, each sample was washed three times with PBS as described above. After washing, the samples were resuspended with SDS-PAGE sample loading solution containing -mercaptoethanol (Sigma-Aldrich) and heated at 96C for 5 min in a dry block to denatu re and prepare for SDSPAGE and western blot analysis. Western Blot Detection of DMV-N Expressed Protein from DMVand DMV-I Recombinant Yeast Str ains Following lysis, pellets were centrifuged at 10,000 g at 4 C for 3 min to clarify the sample from residual debris and 20 l of supernatant we re loaded into sodium dodecyl sufate (SDS) 10% Bis-Tis minigels (Invitrogen) gel, resolved by electrophoresis and transferred onto a polyvinylidene difluoride membrane (PVDF) (Inv itrogen). Non-specific binding sites were blocked with 5% (wt/vol) non-fat powdered milk in Tris-buffered salin e (TBS) containing 0.1% (vol/vol) Tween 20 (TBS-T) overnight at 4 C with slow rocking. The membrane was probed with a 1:1,000 dilution of rabb it anti-measles virus polyclonal antibody in TBS-T containing 5% (wt/vol) non-fat powdered milk for 1 hr at room temperatur e with slow rocking. After four washes, which consisted of 10 ml of TBS-T with fast rocking for approximately 8 min, the membrane was probed with the secondary re agent, ImmunoPure protein G alkaline phosphatase (Pierce Biotechnology, IL, USA), whic h was diluted 1:60,000 in TBS-T containing 5% non-fat milk for 1 hr at room temperature with slow rocking. The membrane was washed four times, as described above before a dding substrate. Approximately 1 ml of Chemiluminescent AP substrate (Millipore, MA, USA) was used in the chromogenic reaction and the membrane was exposed to Lumi-Film Chemiluminescent detection film (Roche Diagnostics, IN, USA) for 1 hr (Figure 4-5 and Figure 4-6).

PAGE 129

129 Transmission Electron Microcopy Two sa mples were submitted for transmission electron microscopy (TEM), which represented clarified cell lysa tes from yeast infection assays performed with a recombinant containing the -MF domain and a recombinant without this domain. Samples were prepared for TEM by negative stain. Briefl y, a 10 l suspension was deposited onto a 400 mesh carbonformvar coated grid. The grid containing the sample was then floate d onto a droplet of 2% aqueous uranyl acetate for 30 sec. Excess stai n was removed and the sample was air-dried. The stained sample was examined and photogra phed with a Hitachi H-7000 TEM (Hitachi High Technologies America, Inc., CA, USA) at 75 kV and photographed with Soft-Imaging Systems MegaView III (Olympus SIS, CO, USA) dig ital camera (Figure 4-7 and Figure 4-8). Results Synthesis of DMV-N in Yeast K. lac tis The DMV-N genes containing the -MF domain and not containing the -MF domain were amplified by RT-PCR (Figure 4-1) and cloned into pKLAC1 plasmid vector. Recombinant plasmids were then integrated into the yeast genome and screened by PCR. All transformants screened by PCR, DMVand DMV-I recombinants, were positive for integration (Figure 4-2 and Figure 4-3) and positive for multi-copy in tegration (Figure 4-4). Therefore, two recombinant yeast strains from each group were chosen to be grown in larger volumes to determine expression of the N protein. Detection of N Protein Proteins contained in yeast cell lysates were resolved af ter im munoprecipitation followed by SDS-PAGE and western bl ot analysis for the DMVrecombinant. Detection with a polyclonal antibody (rabbit anti-measles virus) revealed the 57-kDa band by western blotting, with the strongest bands observe d at day 9 and 11 d post-inoculation (Figure 4-5). No protein

PAGE 130

130 band of a similar size was detected in the uninf ected yeast cell control compared to the MV positive control (~60-kDa band). When the DMV-I recombinant yeast lysate was not immunoprecipitated prior to SDS-PAGE, the western blot analysis revealed a faint protein band of the expected size (57-kDa) that was detected in the second DMV-I recombinant strain tested from cell lysates collected 72 hpi. This band wa s similar in size to the bands produced by the MV positive control and purified baculovirus ex pressed recombinant DMV-N positive control band (Figure 4-6). Transmission Electron Microscopy (TEM) Negative staining of a crude lysate from the DMVrecombinant yeast strain did not reveal nucleocapsid-like particles (NLPs). Howeve r, the crude lysate derived from the DMV-I yeast recombinant that did not carry the secret ory domain contained large amounts of NLPs as determined by transmission electron microscopy (F igure 4-7 and Figure 4-8). Therefore, even though the N protein was present in the yeast lysates of both the DMVand DMV-I recombinant yeasts as determined by western blot analysis, assembled pr otein in the form of herring-bone structures was only seen in the ca se of the DMV-I recombinant, after negative staining and transmission electron microscopy. Discussion Here, we report the expression of the nucleocapsid protein of DMV in the yeast Kluyveromyces lactis E xpression of these nucleocapsi d-like particles (NLPs) with a characteristic herring-bone stru cture has been described for the nucleocapsid protein from other members of the genus Morbillivirus like MV and RPV; however, ot her species of yeast were used (Samuel et al., 2003; Shaji and Shaila, 1999; Slibinskas et al., 2004). The K. lactis expression kit (New England Biolabs) was utili zed for this project and the DMV N gene was inserted into two expression cassettes, one containing the -MF domain and the second devoid of

PAGE 131

131 this domain. The apparent advantage of the -MF domain was its reported ability to transport the protein through the yeast secretory pathway, where it would be sequentially processed and secreted in its native form into the surrounding growth medium. Having the protein secreted, as opposed to being retained in the cellular environment of the yeast cell, would be highly advantageous because yeast cell walls are extremel y hard to permeate and therefore, lyse. More importantly, the N protein of DMV is a naturally intracellular protein, ma king its secretion even more desirable. After cloning the N ge ne into the pKLAC1 vectors the DMVclone having the N gene located downstream of the -MF domain and the DMV-I cl one containing the N gene upstream of the -MF domain, the N genes were fully sequenced and the nucleotide sequences obtained faithfully translated the open reading frame. Also, PCR analysis showed both the DMVand DMV-I recombinant yeast strains we re positive for single-copy and multi-copy integration into the yeast genome. By immunoprecipitation and west ern blot, the N protein was not detected in the supernatan t (data not shown), but was dete cted by SDS-PAGE and western blot analysis in the cell lysate of the recombinant yeast containing the -MF domain (Figure 45). The N protein was also detected in the crud e lysate from the DMV-I recombinant yeast strain lacking the -MF domain (Figure 4-6). Interestingly, TEM did not reveal fully assembled N protein in the yeast crude lysa te inoculated with the DMVrecombinant, but assembled N proteins were visualized in the DMV-I recombin ant yeast crude lysate (Figure 4-8). It is speculated that the DMV-N protein may have be en exported to the Golg i apparatus, somehow impeding its ability to fully assemble into NL Ps or its native conformation. In contrast, expressing the protein without the -MF domain may have allowed the protein to fully assemble in the cytoplasm of the yeast cell, providing impr oved stability in its native conformation, despite the intense methods used to lyse the yeast cells. Upon purificati on of the NLPs, this protein has

PAGE 132

132 the potential to be used as antigen for the det ection of morbillivirus antibodies in serological assays. Overall, the yeast expression system used in this study was easy to use and protein expression was efficient and stable when the recombinant yeast strain did not contain the -MF secretion domain. Perhaps when a naturally intr acellular protein is transported through the yeast secretory pathway the protein ca nnot properly assemble into its native conformation. Therefore, the protein most likely accumulated in the endoplasmic reticulum or the Golgi apparatus. In contrast, when the protein was not transpor ted through the yeast secretory pathway, and remained in the cytoplasm, the protein could properly fold and assemble. In terms of technical skill, the most impeding factor with this particular strain of yeast, K. lactis was the ability to lyse the yeast cells. Ho wever, once complete lysis was attained the protein could be easily identified in crude lysate by TEM (Figure 48). Therefore, we report the first expression of DMV-N protein in the yeast K. lactis expression system. This expression system seems highly efficient and has the ability to produce durabl e recombinant yeast strains at low production costs. The generated recombinant N protein is anticipated to be highly antigenic and utilized as a tool in the development of improved serological assays for the detection of serum antibodies against marine morbilliviruses. In this respect, the ELI SA platform seems an ideal diagnostic tool for the detection of mo rbillivirus antibodies in large numbers of serum samples.

PAGE 133

133 Figure 4-1. Agarose gel electrophoresis of th e two DMV-N genes amplified by RT-PCR with one gene containing the -MF domain (lane 2) and one without this domain (lane 3). Amplified products were ~1.6-Kbp in lengt h (as indicated by the arrow) and the molecular size ladder is depicted in lane 1. Figure 4-2. Transformants containing the -MF domain: Ten yeast transformants were screened for integration of the DMV-N gene by PCR. Lane 1 represents the molecular size ladder. All ten recombinant transformants were positive (lanes 2-11) producing fragments ~1.9-Kbp in length compared to the uninfected yeast cell negative control (lane 12). 1 2 3 1.9-Kbp 1 2 3 4 5 6 7 8 9 10 11 12

PAGE 134

134 Figure 4-3. Six DMV-I yeast transforma nts (lanes 2-7), not containing the -MF domain, screened for integration of the DMV-N gene by PCR. Lane 1 is the molecular size marker and all six transformants (lanes 2-7) were positive for integration, including the positive control (lane 8). The nega tive control (lane 9) corresponded to nontransformed yeast cells. Figure 4-4. Five yeast DMV(lanes 1-5) and DMV-I (lanes 6-10) transformants screened for multi-copy integration of the DMV-N gene by PCR. All ten recombinant transformants were positive, producing frag ments 2.3-Kbp in length compared to the negative untransformed control yeast cells (lane 11) and the positive control yeast cells supplied by New England Biolabs, Inc. (lane 12). 1.9-Kbp 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 10 11 12 2.3-Kbp

PAGE 135

135 Figure 4-5. SDS-PAGE and western blot analysis of a lysate from a DMVrecombinant yeast strain tested for N protein expression. The day the supernatant was harvested or number of days in culture after inoculation, is above the respectiv e lane, with days 9 and 11 post-infection having the best expression. MV is measles virus infected culture lysate. The negative control is designated by cc. Figure 4-6. Clarified lysate from DMV-I tran sformants analyzed by SDS-PAGE and western blot analysis. Lane 1MV positive contro l (~60-kDa); Lane 2recombinant 1 at 24 hpi; Lane 3-recombinant 1 at 48 hpi; Lane 4recombinant 1 at 72 hpi; Lane 5recombinant 2 at 24 hpi; Lane 6recombinan t 2 at 48 hpi; Lane 7recombinant 2 at 72 hpi; Lane 8purified recombinant DMV-N expressed in a baculovirus; Lane 9non-transformed negative control yeast. MV 16d 15 13 11 9 8 6 2d cc 60-kDa 60 kDa 1 2 3 4 5 6 *7 8 9

PAGE 136

136 Figure 4-7. Transmission electron micrographs of crude lysate from recombinant yeast containing the -MF domain. No NLPs were viewed in the sample except long filamentous strands as indicated by the arrows. Characteristic NLPs will have diameters approximately 22 nm in length, while these NLPs did not. Figure 4-8. Crude lysate from a DMV-I r ecombinant collected 72 hpi and viewed by transmission electron microscopy. As indicated by the arrows, fully assembled NLPs were present and had diameters of ~22 nm.

PAGE 137

137 CHAPTER 5 CONCLUSIONS Marine m orbilliviruses are highly infectious agents that can cause upper respiratory distress and neurological disease in infected cet aceans and pinnipeds that ultimately may lead to stranding and death. Over the last 20 years, marine morbilliviruses have been isolated or detected molecularly and serologically from mari ne mammals that inhabit most of the worlds major oceans. Therefore, improved detection sy stems that are more rapid and still accurate would benefit stranding centers and diagnostic laboratories that receive samp les from wild cetacean and pinniped populations, but they could also be used by the military and companies with private stocks of these animals. The various goals of this project can be broken into three differe nt specific aims that focus on the development of molecular and serological detection systems. The first specific aim was to develop novel real-time RT-PCR assays that could rapidly and specifically differentiate between the four known marine morbilliviruses: DMV, PMV, PDV, and CDV. All four assays had individual primer sets and probe s designed to target a hypervariable region of the nucleocapsid (N) gene that is divergent among the different species of morbilliviruses, but still conserved among the different strains within the viral species. Using to tal RNA extracted from DMV, PMV, PDV, and CDV-infected cell culture s, these assays had cycle threshold (CT) values after the 17th, 25th, 17th, and 16th cycles, respectively, indicating high sensitivity. Also, these assays incorporated a fifth system to detect the quality of the extracted RNA that used the glyceraldehyde 3-phosphate dehydrogenase (GAP DH) gene as target. The GAPDH assay was designed using known primers and a newly devel oped consensus GAPDH probe that reacted in a real-time RT-PCR assay with tissues of 11 diffe rent marine mammal species. The observed positive CT values for the GAPDH assay ranged from about the 21st cycle to the 37th cycle for the

PAGE 138

138 different cetacean and pinniped tissues used. In addition, a sixth generic morbillivirus assay was developed that did not discriminate between th e marine and terrestrial morbilliviruses. The generic real-time morbillivirus assay that targeted a conserved region within the N gene detected DMV, PMV, CDV, PDV, rinderpest virus (RPV) and measles virus (MV). Refinement of the real-time assays may be needed in the future, as more isolates of these marine morbilliviruses are obtained and sequenced, as there are very few published sequences for these marine morbilliviruses currently available. In summar y, rtRT-PCR assays have been developed for the rapid, sensitive and specific differential detection of currently circulating strains of DMV, PMV, PDV, and CDV in cetacean and pinniped tissues. These assays also allow for the quantitation of viral loads in clinical samples. The second specific aim was to express th e N protein of DMV in a baculovirus (Autographa californica ) expression system. These recombin ant nucleocapsid-like structures (NLPs) were used as antigen in an indirect ELI SA assay to specifically detect serum antibodies in marine mammals. Similarly, the third and fina l specific aim was to express the N protein of DMV in a yeast ( Kluyveromyces lactis ) expression system and compare it to the baculovirus expression system in terms of efficiency, cost, and ease of use. The expressed N protein of DMV in a baculovirus ( A. californica ) and a yeast ( K. lactis ) expression system was determined to be ~57kDa by western blot analysis. On ly fully assembled baculovirus expressed nucleocapsid-like particles (NLPs) were detected by transmission electron microscopy. Further, the purified DMV-N protein was used as antige n in an iELISA assay for the detection of antibodies in sera collected from several free-ranging marine mammal species, humans, and domestic dogs. Sera were considered positive for morbillivirus antibodies when the iELISA titers were 1:100 or higher. Une xpectedly, purification of the NLPs expressed in the baculovirus

PAGE 139

139 system disassembled the protein from its na tive conformation. Even though these DMV-N proteins were no longer fully assembled nucleocap sids, their antigenicity was not lost and they were highly reactive with morbilliv irus antibodies detected in sera from several different animal species. Expression of the N protein in r ecombinant yeast containing the -MF secretory domain did not result in properly assembled NLPs, while those recombinants not containing the secretion domain did fully assemble the DMV-N protein. For the yeast recombinants containing the -MF domain, it is thought that because the secreti on domain transported the N protein through the yeast secretory pathway, where the protein di d not actually get secreted, the protein was somehow impeded in its ability to fully assemble into its native confor mation. Naturally, the N protein is an intracellular protein so it is possi ble that the conditions in the yeast secretory pathway were not ideal for proper protein folding and secretion of an in tracellular protein. The formation of yeast expressed recombinant NLPs ha s been previously reported for other members of the genus Morbillivirus like MV, CDV, and RPV (Fooks et al., 1993; Hummel et al., 1992; Ismail et al., 1994; Spehner et al., 1991). Sim ilar to the baculovirus expressed DMV-N protein, it is anticipated that these NLPs can be used as antigen in serological assays for the detection of morbillivirus antibodies in marine mammal sera. Future studies may involve careful purification of the yeast expressed NLPs, like using a lower c oncentration of CsCl in the final purification step, to help resolve some of the questions ar ising about the instability of the baculovirus expressed DMV-N protein. Also, it would be interesting to co mpare the antigenicity of the baculovirus expressed NLPs and the yeast NLPs by testing similar marine mammal, human, and dog sera in the iELISA assays. Ultimately, if the yeast NLPs survive purification fully assembled, comparisons could be drawn between the antigenicity between unassembled and

PAGE 140

140 assembled DMV-N protein by comparing the baculovirus and yeast DMV-N protein titers in the iELISA. In summary, it is anticipated that the molecular and serological diagnostic assays, described in this dissertation, will be beneficial to clinicians and researchers in the marine mammal field who need to screen animals for current and previous infections for these deadly and highly contagious viruses. The molecular a nd serological diagnostic systems described in this dissertation are intended to improve upon what is currently avai lable for the marine morbillivirus diagnostic field, whic h is in urgent need of more sensitive and specific detection assays

PAGE 141

141 LIST OF REFERENCES Aversa, G., Carballido, J., Punnonen, J., Chang, C.C., Hause r, T., Cocks, B.G. and De Vries, J.E., 1997a. SLAM and its role in T cell ac tivation and Th cell re sponses. Immunol. Cell Biol. 75, 202-5. Bankamp, B., Horikami, S.M., Thompson, P.D., H uber, M., Billeter, M. and Moyer, S.A., 1996. Domains of the measles virus N protein re quired for binding to P protein and selfassembly. Virology 216, 272-7. Banyard, A.C., Grant, R.J., Romero, C.H. and Barrett, T., 2008. Sequence of the nucleocapsid gene and genome and antigenome promoters for an isolate of porpoise morbillivirus. Virus Res. 132, 213-9. Barrett, T., 1999. Morbillivirus infections, with special emphasis on morbilliviruses of carnivores. Vet. Microbiol. 69, 3-13. Barrett, T., Pastoret, P.P. and Taylor, W.P., 2006. Rinderpest a nd Peste des Petits Ruminants: Virus Plagues of Large and Sma ll Ruminants. Elsevier, London. Barrett, T., Visser, I.K., Mamaev, L., Goatley, L. van Bressem, M.F. and Osterhaus, A.D., 1993. Dolphin and porpoise morbilliviruses are ge netically distinct from phocine distemper virus. Virology 193, 1010-2. Bartz, R., Brinckmann, U., Dunster, L.M., Rima, B., Ter Meulen, V. and Schneider-Schaulies, J., 1996. Mapping amino acids of the measles virus hemagglutinin responsible for receptor (CD46) downregulation. Virology 224, 334-7. Bellini, W.J., Englund, G., Richardson, C.D., Rozenblatt, S. and Lazzarini, R.A., 1986. Matrix genes of measles virus and canine distemper virus: cloning, nucleotide sequences, and deduced amino acid sequences. J. Virol. 58, 408-16. Bengtson, J.L., 1991. Antibodies to canine distempe r virus in antartic seals. Marine Mammal Science 71, 85-87. Bhella, D., Ralph, A., Murphy, L.B., Yeo, R.P ., 2002. Significant differences in nucleocapsid morphology within the Paramyxoviridae. J. Gen. Virol. 83, 1831-1839. Blixenkrone-Moller, M., Bolt, G., Dannemann Jensen, T., Harder, T.C., Svansson, V., 1996. Comparative analysis of the attachment prot ein gene (H) of dolphin morbillivirus. Virus Res. 40, 47-56. Blixenkrone-Moller, M., Bolt, G., Gottschalck, E. and Kenter, M., 1994. Co mparative analysis of the gene encoding the nucleocapsid protein of dolphin morbillivirus reveals its distant evolutionary relationship to measles virus a nd ruminant morbilliviruses. J. Gen. Virol. 75 ( Pt 10), 2829-34.

PAGE 142

142 Bolt, G. and Blixenkrone-Moller, M., 1994. Nucleic acid hybridization an alyses confirm the presence of a hitherto unknown morbillivirus in Mediterranean dolphins. Vet. Microbiol. 41, 363-72. Bostock, C.J., Barrett, T. and Crowther, J.R ., 1990. Characterisation of the European seal morbillivirus. Vet. Microbiol. 23, 351-60. Brown, D.D., Rima, B.K., Allen, I.V., Baron, M. D., Banyard, A.C., Barrett, T. and Duprex, W.P., 2005. Rational attenuation of a morbillivirus by modul ating the activity of the RNA-dependent RNA polymerase. J. Virol. 79, 14330-8. Bchen-Osmond, C. 1992. International Commi ttee on the Taxonomy of Viruses Database (ICTVdB). Buchholz, C.J., Spehner, D., Drillien, R., Ne ubert, W.J. and Homann, H.E., 1993. The conserved N-terminal region of Sendai virus nucleocapsi d protein NP is required for nucleocapsid assembly. J. Virol. 67, 5803-12. Buckland, R. and Wild, T.F., 1997. Is CD46 the cellu lar receptor for measles virus? Virus Res. 48, 1-9. Burek, K.A., Gulland, F.M.D., Sheffield, G., Beck men, K.B., Keyes, E., Spraker, T.R., Smith, A.W., Skilling, D.E., Evermann, J.F., Stott, J.L., Saliki, J.T., Trites, A.W., 2005. Infectious disease and the d ecline of Stellar sea lions ( Eumetopias jubatus ) in Alaska, USA: Insights from serologic data J. Wildl. Dis. 41(3), 512-524. Bush, M., Montali, R.J., Brownstein, D., Jame s, A.E.Jr., Appel, M.J., 1976. Vaccine-induced canine distemper in a lesser panda. J. Am. Vet. Assoc. 1;69(9), 959-60. Carpenter, J.W., Appel, M.J., Erickson, R.C. and Novilla, M.N., 1976. Fatal vaccine-induced canine distemper virus infection in black-f ooted ferrets. J. Am. Vet. Med. Assoc. 169, 961-4. Castaneda, S.J., Wong, T.C., 1990. Leader sequen ce distinguishes between translatable and encapsidated measles virus RNAs. J. Virol. 64(1). 222-230. Cathomen, T., Mrkic, B., Spehner, D., Drillien, R., Naef, R., Pavl ovic, J., Aguzzi, A., Billeter, M.A. and Cattaneo, R., 1998. A matrix-less m easles virus is inf ectious and elicits extensive cell fusion: consequences for propagation in the brain. EMBO. J. 17, 3899-908. Center for Disease Control (CDC). 2007. Measles Vaccination Information On-line. < http://www.cdc.gov/vaccines/vpd-vac/measles/default.html > Cocks, B.G., Chang, C.C., Carballido, J.M., Ysse l, H., de Vries, J.E. and Aversa, G., 1995. A novel receptor involved in T-cell activation. Nature 376, 260-3.

PAGE 143

143 Compans, R.W., Mountcastle, W.E. and Choppi n, P.W., 1972. The sense of the helix of paramyxovirus nucleocapsids. J Mol Biol 65, 167-9. Cook, A.J., 1989. Morbillivirus infecti ons in seals. Vet. Rec. 125, 465. Cosby, S.L., McQuaid, S., Duffy, N., Lyons, C ., Rima, B.K., Allen, G.M., McCullough, S.J., Kennedy, S., Smyth, J.A., McNeilly, F., Crai g, C. and Orvell, C., 1988. Characterization of a seal morbillivirus. Nature 336, 115-6. Curran, J., Marq, J.B. and Kolakofsky, D., 1992. The Sendai virus nonstructural C proteins specifically inhibit viral mRNA synthesis. Virology 189, 647-56. Curran, J., Marq, J.B. and Kolakofsky, D., 1995. An N-terminal domain of the Sendai paramyxovirus P protein acts as a chaperone for the NP prot ein during the nascent chain assembly step of genome replication. J. Virol. 69, 849-55. de Swart, R.L., Harder, T.C., Ross, P.S., Vos, H.W. and Osterhaus, A.D., 1995. Morbilliviruses and morbillivirus diseases of marine mammals. Infect. Agents Dis. 4, 125-30. Deem, S.L., Spelman, L.H., Yates, R.A. and Mont ali, R.J., 2000. Canine distemper in terrestrial carnivores: a review. J. Zoo Wildl. Med. 31, 441-51. Di Guardo, G., Agrimi, U., Amaddeo, D., McA liskey, M. and Kennedy, S., 1992. Morbillivirus infection in a striped dolphin ( Stenella coeruleoalba ) from the coast of Italy. Vet. Rec. 130, 579-80. Di Guardo G, A.U., Morelli L, Cardeti G, Terracciano G, Kennedy S, 1995. Post mortem investigations on cetaceans found stranded on the coasts of Italy between 1990 and 1993. Vet. Rec. 136, 439-42. Dietz, R., Ansen, C.T., Have, P. and Heide-Jorg ensen, M.P., 1989. Clue to seal epizootic? Nature 338, 627. Domingo, M., Ferrer, L., Pumarola, M., Marco, A ., Plana, J., Kennedy, S., McAliskey, M. and Rima, B.K., 1990. Morbillivirus in dolphins. Nature 348, 21. Domingo, M., Vilafranca, M., Visa J., Prats, N., Trudgett, A., Visser, I., 1995. Evidence for chronic morbillivirus infection in Mediterranean striped dolphin ( Stenella coeruleoalba ). Vet. Microbiol. 44(2-4), 229-39. Domingo, M., Visa, J., Pumarola M., Marco, A.J., Ferrer, L ., Rabanal, R., Kennedy, S., 1992. Pathologic and immunocytochemical studies of morbillivirus infection in striped dolphin ( Stenella coeruleoalba ). Vet. Pathol. 29(1), 1-10.

PAGE 144

144 Duignan, P.J., House, C., Geraci, J.R., Duffy, N., Rima, B.K., Walsh, M.T., Early, G., St Aubin, D.J., Sadove, S., Koopman, H. and et al., 1995. Mo rbillivirus infection in cetaceans of the western Atlantic. Ve t. Microbiol. 44, 241-9. Duignan, P.J., Nielsen, O., House, C., Kovacs, K. M., Duffy, N., Early, G., Sadove, S., St Aubin, D.J., Rima, B.K. and Geraci, J.R., 1997. Epizoot iology of morbillivirus infection in harp, hooded, and ringed seals from the Canadian Arct ic and western Atlantic. J. Wildl. Dis. 33, 7-19. Elia, G., Decaro, N., Martella, V., Campolo, M. Desario, C., Lorusso, E., Cirone, F. and Buonavoglia, C., 2006. Detection of equine herpesvirus type 1 by real time PCR. J. Virol. Methods 133, 70-5. Enders, J.F. and Peebles, T.C., 1954. Propagation in tissue cultures of cytopathogenic agents from patients with measles. Proc. Soc. Exp. Biol. Med. 86, 277-86. Fernandez, J.A., Real, C., Couto, J.A., Aboal, J.R. and Carballeira, A., 2005. The effect of sampling design on extensive bryomonitoring surv eys of air pollution. Sci. Total Environ. 337, 11-21. Follmann, E.H., Garner, G.W., Evermann, J.F., McKeirnan, A.J., 1996. Serological evidence of morbillivirus infection in polar bears ( Ursus maritimus ) from Alaska and Russia. Vet. Rec. 138(25), 615-618. Fooks, A.R., Stephenson, J.R., Warnes, A., Dows ett, A.B., Rima, B.K. and Wilkinson, G.W., 1993. Measles virus nucleocapsid protein expr essed in insect cells assembles into nucleocapsid-like structures. J. Gen. Virol. 74 ( Pt 7), 1439-44. Forsyth, M.A. and Kennedy, S.e.a., 1998. Canine Distemper virus in Caspian seal. Vet. Rec. 143, 662-4. Galinski, M.S., 1991. Paramyxoviridae: transcri ption and replication. Adv. Virus Res.. 39, 12962. Galvani, A.P. and Slatkin, M., 2004. Intense sele ction in an age-structured population. Proc. Biol. Sci. 271, 171-6. Garcin, D., Latorre, P. and Kolakofsky, D., 1999. Sendai virus C proteins counteract the interferon-mediated induction of an antiviral state. J. Virol. 73, 6559-65. Goodman, S.J., 1998. Patterns of extensive genetic differentiation and variation among European harbor seals ( Phoca vitulina vitulina ) revealed using microsat ellite DNA polymorphisms. Mol. Biol. Evol. 15, 104-18.

PAGE 145

145 Grachev, M.A., Kumarev, V.P., Mamaev, L., Zo rin, V.L., Baranova, L.V., Denikina, N.N., Belikov, S.I., Petrov, S.I., Kolesnik, V.S., Ko lesnik, R.S., Dorofeev, V.M., Beim, A.M., Kudelin, V.N., Magieva, F.G. and Sidorov, V. N., 1989. Distemper virus in Baikal seals. Nature 338, 209-10. Graves, M., Griffin, D.E., Johnson, R.T., Hirsch, R.L., de Soriano, I.L., Roedenbeck, S. and Vaisberg, A., 1984. Development of antibody to measles virus polypeptides during complicated and uncomplicated measles virus infections. J. Virol. 49, 409-12. Haas, L., Subbarao, S.M., Harder, T., Liess, B. and Barrett, T., 1991. Detection of phocid distemper virus RNA in seal tissues using slot hybridization and the polymerase chain reaction amplification assay: genetic evidence that the vi rus is distinct from canine distemper virus. J. Gen. Virol. 72 ( Pt 4), 825-32. Hall, W.C., Kovatch, R.M., Herman, P.H. and Fox, J.G., 1971. Pathology of measles in rhesus monkeys. Vet. Pathol. 8, 307-19. Halpin, K., Bankamp, B., Harcourt, B.H., Be llini, W.J. and Rota, P.A., 2004. Nipah virus conforms to the rule of six in a minigenom e replication assay. J. Gen. Virol. 85, 701-7. Hamaguchi, M., Yoshida, T., Nishikawa, K., Naruse, H. and Nagai, Y., 1983. Transcriptive complex of Newcastle disease virus. I. Both L and P proteins are requi red to constitute an active complex. Virology 128, 105-17. Hammond, J.A., Pomeroy, P.P., Hall, A.J. and Sm ith, V.J., 2005. Identification and real-time PCR quantification of phocine distemper virus fr om two colonies of Scottish grey seals in 2002. J. Gen. Virol. 86, 2563-7. Harkonen, T., Dietz, R., Reijnders, P., Teilmann, J ., Harding, K., Hall, A., Brasseur, S., Siebert, U., Goodman, S.J., Jepson, P.D., Dau Rasm ussen, T. and Thompson, P., 2006. A review of the 1988 and 2002 phocine distemper virus epid emics in European harbour seals. Dis Aquat. Organ. 68, 115-30. Heaney, J., Barrett, T. and Cosby, S.L., 2002. Inhi bition of in vitro leuko cyte proliferation by morbilliviruses. J. Virol. 76, 3579-84. Heggeness, M.H., Scheid, A. and Choppin, P.W., 1981. the relationship of conformational changes in the Sendai virus nucleocapsid to pr oteolytic cleavage of the NP polypeptide. Virology 114, 555-62. Henderson, G., Trudgett, A., Lyons, C. and Rona ld, K., 1992. Demonstration of antibodies in archival sera from Canadian seals reactive wi th a European isolate of phocine distemper virus. Sci. Total Environ. 115, 93-8. Hilleman, M.R., 1994. Vaccinology, immunology, and comparative pathogenesis of measles in the quest for a preventative against AIDS AIDS Res. Hum. Retroviruses 10, 3-12.

PAGE 146

146 Homann, H.E., Hofschneider, P.H. and Neubert W.J., 1990. Sendai virus gene expression in lytically and persistently in fected cells. Virology 177, 131-40. Horikami, S.M., Curran, J., Kolakofsky, D. and Moyer, S.A., 1992. Complexes of Sendai virus NP-P and P-L proteins are required for defec tive interfering particle genome replication in vitro. J. Virol. 66, 4901-8. Hsu, C.H. and Kingsbury, D.W., 1982. Topography of phosphate residues in Sendai virus proteins. Virology 120, 225-34. Hsu, E.C., Sarangi, F., Iorio, C., Sidhu, M.S., Ud em, S.A., Dillehay, D.L., Xu, W., Rota, P.A., Bellini, W.J. and Richardson, C.D., 1998. A single amino acid change in the hemagglutinin protein of measles virus dete rmines its ability to bind CD46 and reveals another receptor on marmoset B cells. J. Virol. 72, 2905-16. Hummel, K.B., Erdman, D.D., Heat h, J. and Bellini, W.J., 1992. Baculovirus expression of the nucleoprotein gene of measles virus and utility of the recombinant protein in diagnostic enzyme immunoassays. J. Clin. Microbiol. 30, 2874-80. Inderwies, T., Pfaffl, M.W., Meyer, H.H., Bl um, J.W. and Bruckmaier, R.M., 2003. Detection and quantification of mRNA expression of al phaand beta-adrenergic receptor subtypes in the mammary gland of dairy cows. Domest. Anim. Endocrinol. 24, 123-35. Ismail, T., Ahmad, S., D'Souza-Ault, M., Bassiri M., Saliki, J., Mebus, C. and Yilma, T., 1994. Cloning and expression of the nucle ocapsid gene of virulent Kabete O strain of rinderpest virus in baculovirus: use in differential diagnosis between vaccinated and infected animals. Virology 198, 138-47. Jacobson, S., Sekaly, R.P., Jacobson, C.L., et al., 1989. HLA class II-restri cted presentation of cytoplasmic measles virus antigens to cytotoxic T cells. J. Virol. 63. 1756-1762. Jauniaux, T., Boseret, G., Desmecht, M., Haelters, J., Manteca, C., Tavernier, J., van Gompel, J. and Coignoul, F., 2001. Morbillivirus in common seals stranded on the coasts of Belgium and northern France during summer 1998. Vet. Rec. 148, 587-91. Jauniaux, T., Charlier, G., Desmecht, M., Haelters J., Jacques, T., Losson, B., Van Gompel, J., Tavernier, J. and Coignoul, F., 2000. Pat hological findings in two fin whales ( Balaenoptera physalus ) with evidence of morbillivirus infection. J. Comp. Pathol. 123, 198-201. Jensen, T., van de Bildt, M., Dietz, H.H., Andersen, T.H., Hammer, A.S., Kuiken, T. and Osterhaus, A., 2002. Another phocine distem per outbreak in Europe. Science 297, 209.

PAGE 147

147 Jepson, P.D., Bennett, P.M., Allchin, C.R., Law, R.J., Kuiken, T., Baker, J.R., Rogan, E. and Kirkwood, J.K., 1999. Investigating potential as sociations between chronic exposure to polychlorinated biphenyls and infectious di sease mortality in ha rbour porpoises from England and Wales. Sci. Total Environ. 243-244, 339-48. Karlin, D., Ferron, F., Canard, B. and Longhi S., 2003. Structural disorder and modular organization in Paramyxovirinae N and P. J. Gen. Virol. 84, 3239-52. Kennedy, S., Kuiken, T., Jepson, P.D., Deaville, R., Forsyth, M., Barrett, T., van de Bildt, M.W., Osterhaus, A.D., Eybatov, T., Duck, C., Kydyrmanov, A., Mitrofanov, I. and Wilson, S., 2000. Mass die-off of Caspian seals caused by cani ne distemper virus. Emerg. Infect. Dis. 6, 637-9. Kennedy, S., Smyth, J.A., Cush, P.F., McCulloug h, S.J., Allan, G.M. and McQuaid, S., 1988a. Viral distemper now found in porpoises. Nature 336, 21. Kennedy, S., Smyth, J.A., McCullough, S.J., Allan, G.M., McNeilly, F. and McQuaid, S., 1988b. Confirmation of cause of recen t seal deaths. Nature 335, 404. Kingsbury, D.W. and Darlington, R.W., 1968. Isolation and propert ies of Newcastle disease virus nucleocapsid. J. Virol. 2, 248-55. Kingston, R.L., Hamel, D.J., Gay, L.S., Dahlquist F.W., Matthews, B.W., 2004. Structural basis for the attachment of a paramyxoviral polymerase to its template. Proc. Natl. Acd. Sci. 101, 8301-8306. Knipe, D.M. and Howley, P.M., 2001. Fundamental Virology, Fourth Edition, Vol. 1 and 2. Lippencott Williams and Wilkins, Philadelphia. Kobune, F., Takahashi, H., Terao, K., Ohkawa, T., Ami, Y., Suzaki, Y., Nagata, N., Sakata, H., Yamanouchi, K. and Kai, C., 1996. Nonhuman pr imate models of measles. Lab. Anim. Sci. 46, 315-20. Kolakofsky, D., Pelet, T., Garcin, D., Hausmann, S., Curran, J. and Roux, L., 1998. Paramyxovirus RNA synthesis and the requireme nt for hexamer genome length: the rule of six revisited. J. Virol. 72, 891-9. Kolakofsky, D., Roux, L., Garcin, D. and Ruig rok, R.W., 2005. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe : a hypothesis. J. Gen. Virol. 86, 1869-77. Koller, L.D. and Thigpen, J.E., 1973. Biphenyl-exposed rabbits. Am. J. Vet. Res. 34, 1605-6. Kondratov, I.G., Denikina, N.N., Belikov, S.I., Durymanova, A.A., Ustinova, E.N. and Shestopalov, A.M., 2003. Mollusks as a natural reservoir of morbilliviruses. Dokl. Biol. Sci.. 389, 154-6.

PAGE 148

148 Krafft, A., Lichy, J.H., Lipscomb, T.P., Klaunbe rg, B.A., Kennedy, S. and Taubenberger, J.K., 1995. Postmortem diagnosis of morbillivir us infection in bottlenose dolphins ( Tursiops truncatus ) in the Atlantic and Gulf of Mexico epizootics by polymerase chain reactionbased assay. J. Wildl. Dis. 31, 410-5. Kuiken, T., Kennedy, S., Barrett, T., Van de Bild t, M.W., Borgsteede, F.H., Brew, S.D., Codd, G.A., Duck, C., Deaville, R., Eybatov, T., Fo rsyth, M.A., Foster, G., Jepson, P.D., Kydyrmanov, A., Mitrofanov, I., Ward, C.J., Wilson, S. and Osterhaus, A.D., 2006. The 2000 canine distemper epidemic in Caspian seals ( Phoca caspica ): pathology and analysis of contributory f actors. Vet. Pathol. 43, 321-38. Laine, D., Trescol-Biemont, M.C, Longhi, S., Libeau, G., Marie, J.C., Vidalain, P. O., Azocar, O., Diallo, A., Canard, B., & other author s, 2003. Measles virus (MV) nucleoprotein binds to a novel cell surface receptor distinct from Fc RII via its C-terminal domain: role in MV-induced immunosuppres sion. J. Virol. 77, 11332-11346. Lamb, C.R., Berg, J. and Bengtson, A.E., 1990. Preoperative measurement of canine primary bone tumors, using radiography and bone scintigraphy. J. Am. Vet. Med. Assoc. 196, 1474-8. Laws, D. and Taylor, R.J.F., 1957. A mass dying of crabeater seals, Lobodon carcinophagus (Gray). Proc Zool. Soc. Lond. 129, 315-24. Lecouturier, V., Fayolle, J., Caballero, M., Ca rabana, J., Celma, M.L., Fernandez-Munoz, R., Wild, T.F. and Buckland, R., 1996. Identif ication of two amino acids in the hemagglutinin glycoprotein of measles viru s (MV) that govern hemadsorption, HeLa cell fusion, and CD46 downregulation: phenotypic markers that differentiate vaccine and wild-type MV strains. J. Virol. 70, 4200-4. Likhoshway Ye, V., Grachev, M.A., Kumarev, V. P., Solodun Yu, V., Goldberg, O.A., Belykh, O.I., Nagieva, F.G., Nikulina, V.G. and Kolesnik, B.S., 1989. Baikal seal virus. Nature 339, 266. Lipscomb, T.P., Kennedy, S., Moffett, D., Krafft, A., Klaunberg, B.A., Lichy, J.H., Regan, G.T., Worthy, G.A. and Taubenberger, J.K., 1996. Mo rbilliviral epizootic in bottlenose dolphins of the Gulf of Mexico. J. Vet. Diagn. Invest. 8, 283-90. Lipscomb, T.P., Schulman, F.Y., Moffett, D. and Kennedy, S., 1994. Morbillivirus disease in Atlantic bottlenose dolphins ( Tursiops truncatus ) from the 1987-1988 epizootic. J. Wildl. Dis. 30, 567 571. Liszewski, M.K., Post, T.W., Atkinson, J.P., 1991. Membrane cofactor protein (MCP or CD46): newest member of the regulators of complement activation gene cluster. Annu. Rev. Immunol. 9, 431-55.

PAGE 149

149 Mahy, B.W.J., Barrett, T., Evans, S., Anderson, E.C. and Bostock, C.J., 1988. Characterisation of a seal morbillivirus. Nature 336, 115. McChesney, M.B., Miller, C.J., Rota, P.A., Zhu, Y.D., Antipa, L., Lerche N.W., Ahmed, R. and Bellini, W.J., 1997. Experimental measles. I. Pathogenesis in the normal and the immunized host. Virology 233, 74-84. McCullough, S.J., McNeilly, F., Allan, G.M., Kennedy, S., Smyth, J.A., Cosby, S.L., McQuaid, S. and Rima, B.K., 1991. Isolation and charac terisation of a porpoise morbillivirus. Arch. Virol. 118, 247-52. McLellan, W.A., Friedlaender, A.S., Mead, J., G ., Potter, C.W., Pabst, D.A., 2002. Analysing 25 years of bottlenose dolphin ( Tursiops truncatus ) strandings along the Atlantic coast of the USA: do historic records support the coas tal migratory stock hypothesis? J. Cetacean Res. Manage. 4, 297-304. Montie, E.W., Schneider, G.E., Ketten, D.R., Marino, L., Touhey, K.E. and Hahn, M.E., 2007. Neuroanatomy of the subadult and fetal br ain of the Atlantic white-sided dolphin ( Lagenorhynchus acutus ) from in situ magnetic resonance images. Anat. Rec. (Hoboken) 290, 1459-79. Mountcastle, W.E., Compans, R.W., Lackla nd, H. and Choppin, P.W., 1974. Proteolytic cleavage of subunits of the nucleocapsid of the paramyxovirus simian virus 5. J. Virol. 14, 1253-61. Muller, G., Wunschmann, A., Ba umgartner, W., Birkun, A., Koma khidze, A., Stanev, T. and Joiris, C.R., 2002. Immunohistological and sero logical investigations of morbillivirus infection in Black Sea harbour porpoises ( Phocoena phocoena ). Vet. Microbiol. 87, 18390. Naniche, D., Varior-Krishnan, G., Cervoni, F., Wild, T.F., Rossi, B., Rabourdin-Combe, C. and Gerlier, D., 1993. Human membrane cofactor pr otein (CD46) acts as a cellular receptor for measles virus. J. Virol. 67, 6025-32. Ngichabe, C.K., Wamwayi, H.M., Ndungu, E.K., Mirangi, P.K., Bostock, C.J., Black, D.N. and Barrett, T., 2002. Long term immunity in Afri can cattle vaccinated with a recombinant capripox-rinderpest virus vaccine. Epidemiol. Infect. 128, 343-9. Nielsen, O., Stewart, R.E.A., Measures, L ., Duignan, P., House, C., 2000. A morbillivirus antibody survey of Atlantic walrus, narwhal a nd beluga in Canada. J. Wildl. Dis. 36(3), 508-517. Nielsen, L., Blixenkrone-Moller, M., Thylstrup, M., Hansen, N.J. and Bolt, G., 2001. Adaptation of wild-type measles virus to CD46 r eceptor usage. Arch. Virol. 146, 197-208.

PAGE 150

150 Norrby, E. and Gollmar, Y., 1972. Appearance and persistence of antibodies against different virus components after regular measle s infections. Infect. Immun. 6, 240-7. Ono, N., Tatsuo, H., Hidaka, Y., Aoki, T., Minagawa, H. and Yanagi, Y., 2001. Measles viruses on throat swabs from measles patients us e signaling lymphocytic activation molecule (CDw150) but not CD46 as a cellular receptor. J. Virol. 75, 4399-401. Osterhaus, A., 1989. A morbillivirus causing ma ss mortality in seals. Vaccine 7, 483-4. Osterhaus, A.D., de Swart, R.L., Vos, H.W ., Ross, P.S., Kenter, M.J. and Barrett, T., 1995. Morbillivirus infections of aquatic mammals: newly identified members of the genus. Vet. Microbiol. 44, 219-27. Osterhaus, A.D., Groen, J., Spijkers, H.E., Br oeders, H.W., UytdeHaag, F.G., de Vries, P., Teppema, J.S., Visser, I.K., van de Bildt, M.W. and Vedder, E.J., 1990. Mass mortality in seals caused by a newly discovered mo rbillivirus. Vet. Microbiol. 23, 343-50. Osterhaus, A.D. and Vedder, E.J., 1988. Identifica tion of virus causing recen t seal deaths. Nature 335, 20. Parks, C.L., Lerch, R.A., Walpita, P., Wang, H. P., Sidhu, M.S. and Udem, S.A., 2001a. Analysis of the noncoding regions of measles virus stra ins in the Edmonston vaccine lineage. J. Virol. 75, 921-33. Parks, C.L., Lerch, R.A., Walpita, P., Wa ng, H.P., Sidhu, M.S. and Udem, S.A., 2001b. Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage. J. Virol. 75, 910-20. Paterson, R.G. and Lamb, R.A., 1990. RNA editing by G-nucleotide insertion in mumps virus Pgene mRNA transcript s. J. Virol. 64, 4137-45. Permar, S.R., Moss, W.J., Ryon, J.J., Monze, M ., Cutts, F., Quinn, T.C. and Griffin, D.E., 2001. Prolonged measles virus shedding in human i mmunodeficiency virus-infected children, detected by reverse transcriptase-polymeras e chain reaction. J. Infect. Dis. 183, 532-8. Polack, F.P., Auwaerter, P.G., Lee, S.H., N ousari, H.C., Valsamakis, A., Leiferman, K.M., Diwan, A., Adams, R.J. and Griffin, D.E., 1999. Production of atypical measles in rhesus macaques: evidence for disease mediated by immune complex formation and eosinophils in the presence of fusion-inhibiting antibody. Nat. Med. 5, 629-34. Polack, F.P., Hoffman, S.J., Crujeiras, G. a nd Griffin, D.E., 2003. A role for nonprotective complement-fixing antibodies with low avidity for measles virus in atypical measles. Nat. Med.. 9, 1209-13.

PAGE 151

151 Raga, J.A., Banyard, A., Domingo, M., Corteyn, M., Van Bressem, M.F., Fernandez, M., Aznar, F.J. and Barrett, T., 2008. Dolphin morbillivir us epizootic resurgence, Mediterranean Sea. Emerg. Infect. Dis. 14, 471-3. Reidarson, T.H., McBain, J., House, C., King, D.P ., Stott, J.L., Krafft, A., Taubenberger, J.K., Heyning, J. and Lipscomb, T.P., 1998. Morbil livirus infection in stranded common dolphins from the Pacific Ocean. J. Wildl. Dis. 34, 771-6. Rima, B.K. and Duprex, W.P., 2006. Morbilliviruses and human disease. J. Pathol. 208, 199-214. Rima, B.K., Wishaupt, R.G., Welsh, M.J. and Earle, J.A., 1995. The evolution of morbilliviruses: a comparison of nucleocap sid gene sequences including a porpoise morbillivirus. Vet. Microbiol. 44, 127-34. Robinson, W.S., 1971. Sendai virus RNA synthesis a nd nucleocapsid formation in the presence of cycloheximide. Virology 44, 494-502. Roelke-Parker, M.E., Munson, L., Packer, C., Kock, R., Cleaveland, S., Carpenter, M., O'Brien, S.J., Pospischil, A., Hofmann-Lehmann, R., Lutz, H., et al., 1996. A canine distemper virus epidemic in Serengeti lions (Panthera leo ). Nature. 1;379(6564), 400-1. Ross, P.S., Visser, I.K., Broeders, H.W., van de Bildt, M.W., Bowen, W.D. and Osterhaus, A.D., 1992. Antibodies to phocine distemper virus in Canadian seals. Vet. Rec. 130, 514-6. Rota, J.S., Wang, Z.D., Rota, P.A. and Bellini, W. J., 1994. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Res. 31, 317-30. Ryan, K.W., Portner, A. and Murti, K.G., 1993. Antibodies to paramyxovirus nucleoproteins define regions important for immunogenici ty and nucleocapsid assembly. Virology 193, 376-84. Sakaguchi, M., Yoshikawa, Y., Yamanouchi, K., Takeda, K. and Sato, T., 1986. Characteristics of fresh isolates of wild meas les virus. Jpn. J. Exp. Med. 56, 61-7. Saliki, J.T., Cooper, E.J. and Gustavson, J.P., 2002. Emerging morbillivirus infections of marine mammals: development of two diagnostic a pproaches. Ann. N Y Acad. Sci. 969, 51-9. Saliki, J.T. and Lehenbauer, T.W., 2001. Monocl onal antibody-based competitive enzyme-linked immunosorbent assay for detection of morbill ivirus antibody in marine mammal sera. J. Clin. Microbiol. 39, 1877-81. Sampson, J.H., Archer, G.E., Ashley, D.M., Fuchs, H.E., Hale, L.P., Dranoff, G. and Bigner, D.D., 1996. Subcutaneous vaccination with ir radiated, cytokine-producing tumor cells stimulates CD8+ cell-mediated immunity ag ainst tumors located in the "immunologically privileged" central nervous system. Proc. Natl. A cad. Sci.. U S A 93, 10399-404.

PAGE 152

152 Samuel, D., Sasnauskas, K., Jin, L., Gedvilaite, A., Slibinskas, R., Beard, S., Zvirbliene, A., Oliveira, S.A., Staniulis, J., Cohen, B. and Brown, D., 2003. Development of a measles specific IgM ELISA for use with serum a nd oral fluid samples using recombinant measles nucleoprotein produced in Saccharomyces cerevisiae. J. Clin. Virol. 28, 121-9. Santibanez, S., Niewiesk, S., Heider, A., Schne ider-Schaulies, J., Berbers, G.A., Zimmermann, A., Halenius, A., Wolbert, A ., Deitemeier, I., Tischer, A. and Hengel, H., 2005. Probing neutralizing-antibody responses against emerging measles viruses (MVs): immune selection of MV by H protein-specific antibodies? J. Gen. Virol. 86, 365-74. Scagliarini, A., McInnes, C.J., Gallina, L., Dal Pozzo, F., Scagliarini, L., Snoeck, R., Prosperi, S., Sales, J., Gilray, J.A. and Nettlet on, P.F., 2007. Antiviral activity of HPMPC (cidofovir) against orf virus infect ed lambs. Antiviral Res.. 73, 169-74. Schmitt, A.P., He, B. and Lamb, R.A., 1999. Involvement of the cytoplasmic domain of the hemagglutinin-neuraminidase protein in assemb ly of the paramyxovirus simian virus 5. J. Virol. 73, 8703-12. Schneider-Schaulies, J., Schnorr, J.J., Brinckman n, U., Dunster, L.M., Baczko, K., Liebert, U.G., Schneider-Schaulies, S. and ter Meule n, V., 1995. Receptor usage and differential downregulation of CD46 by measles virus wild-type and vaccine strains. Proc. Natl. Acad. Sci. U S A 92, 3943-7. Shaji, D. and Shaila, M.S., 1999. Domains of Rinderpest virus phosphoprotein involved in interaction with itself and the nucleocapsid protein. Virology 258, 415-24. Shibahara, K., Hotta, H., Katayama, Y. and Homma, M., 1994. Increase d binding activity of measles virus to monkey red blood cells after lo ng-term passage in Vero cell cultures. J. Gen. Virol. 75 ( Pt 12), 3511-6. Sidorenko, S.P. and Clark, E.A., 1993. Characterization of a cell surface glycoprotein IPO-3, expressed on activated human B and T lymphocytes. J. Immunol. 151, 4614-24. Slibinskas, R., Samuel, D., Gedvilaite, A., Staniulis, J. and Sasnauskas, K., 2004. Synthesis of the measles virus nucleoprotein in yeast Pichia pastoris and Saccharomyces cerevisiae J. Biotechnol. 107, 115-24. Spehner, D., Kirn, A. and Drillien, R., 1991. Assemb ly of nucleocapsidlike structures in animal cells infected with a vaccinia virus recombinant encoding the measles virus nucleoprotein. J. Virol. 65, 6296-300. Tahara, M., Takeda, M., Seki, F., Hashiguchi T. and Yanagi, Y., 2007. Multiple amino acid substitutions in hemagglutinin are necessary for wild-type measles virus to acquire the ability to use receptor CD46 efficiently. J. Virol. 81, 2564-72.

PAGE 153

153 Talpalar, A.E. and Grossman, Y., 2005. Sonar versus whales: noise may disr upt neural activity in deep-diving cetaceans. Unde rsea. Hyperb. Med. 32, 135-9. Tatsuo, H., Ono, N., Tanaka, K. and Yanagi, Y., 2000a. [The cellular receptor for measles virus: SLAM (CDw 150)]. Uirusu 50, 289-96. Tatsuo, H., Ono, N., Tanaka, K. and Yanagi, Y ., 2000b. SLAM (CDw150) is a cellular receptor for measles virus. Nature 406, 893-7. Taubenberger, J.K., Tsai, M., Krafft, A.E., Lichy, J.H., Reid, A.H., Schulman, F.Y. and Lipscomb, T.P., 1996. Two morbilliviruses imp licated in bottlenose dolphin epizootics. Emerg. Infect. Dis. 2, 213-6. Taubenberger, J.K., Tsai, M.M., Atkin, T.J., Fanning, T.G., Krafft, A.E., Moeller, R.B., Kodsi, S.E., Mense, M.G. and Lipscomb, T.P., 2000. Molecular genetic evidence of a novel morbillivirus in a long-finned pilot whale ( Globicephalus melas ). Emerg. Infect. Dis. 6, 42-5. Ugozzoli, L.A., Latorra, D., Puckett, R., Ar ar, K. and Hamby, K., 2004. Real-time genotyping with oligonucleotide probes containing lo cked nucleic acids. Anal. Biochem. 324, 14352. van Bressem, M., Waerebeek, K.V., Jepson, P.D ., Raga, J.A., Duignan, P.J., Nielsen, O., Di Beneditto, A.P., Siciliano, S., Ramos, R., Kant, W., Peddemors, V., Kinoshita, R., Ross, P.S., Lopez-Fernandez, A., Evans, K., Cres po, E. and Barrett, T., 2001. An insight into the epidemiology of dolphin morbillivirus worldwide. Vet. Microbiol. 81, 287-304. van Bressem, M.F., Van Waerebeek, K., Fleming, M. and Barrett, T., 1998. Serological evidence of morbillivirus infection in small cetaceans from the southeast Pacific. Vet. Microbiol. 59, 89-98. van Bressem, M.F., Visser, I.K., De Swart, R.L., Orvell, C., Stanzani, L., Androukaki, E., Siakavara, K. and Osterhaus, A.D., 1993. Dolphin morbillivirus infection in different parts of the Mediterranean Sea. Arch. Virol. 129, 235-42. van Bressem, M.F., Visser, I.K., Van de Bildt, M.W., Teppema, J.S., Raga, J.A. and Osterhaus, A.D., 1991. Morbillivirus infection in Mediterranean striped dolphins (Stenella coeruleoalba ). Vet. Rec. 129, 471-2. van de Bildt, M.W., Kuiken, T. and Osterhaus, A.D., 2005. Cetacean morbilliviruses are phylogenetically divergent. Arch. Virol. 150, 577-83. Visser, I.K., Kumarev, V.P., Orvell, C., de Vries, P., Broeders, H. W., van de Bildt, M.W., Groen, J., Teppema, J.S., Burger, M.C., UytdeHaag, F.G. and et al., 1990. Comparison of two morbilliviruses isolated from seals during out breaks of distemper in north west Europe and Siberia. Arc h. Virol. 111, 149-64.

PAGE 154

154 Visser, I.K., van Bressem, M.F., Barrett, T. and Osterhaus, A.D., 1993a. Mo rbillivirus infections in aquatic mammals. Vet. Res. 24, 169-78. Visser, I.K., van Bressem, M.F., de Swart, R. L., van de Bildt, M.W., Vos, H.W., van der Heijden, R.W., Saliki, J.T., Orvell, C., K itching, P., Kuiken, T. and et al., 1993b. Characterization of morbillivir uses isolated from dolphins and porpoises in Europe. J. Gen. Virol. 74 ( Pt 4), 631-41. Visser, I.K., van Bressem, M.F., van de Bildt, M.W., Groen, J., Orvell, C., Raga, J.A. and Osterhaus, A.D., 1993c. Prevalence of mo rbilliviruses among pinniped and cetacean species. Rev. Sci. Tech. 12, 197-202. Vongpunsawad, S., Oezgun, N., Braun, W. and Ca ttaneo, R., 2004. Selectiv ely receptor-blind measles viruses: Identification of residues necessary for SLAMor CD46-induced fusion and their localization on a new hemagglutinin structural model. J. Virol. 78, 302-13. von Messling, V., Milosevic, D., Cattaneo, R., 2004. Tropism illuminated: lymphocyte-based pathways blazed by lethal morbillivirus through the host immune system. Proc. Natl. Acad. Sci. 101(39), 14216-21. Vulliemoz, D. and Roux, L., 2001. "Rule of six": how does the Sendai virus RNA polymerase keep count? J. Virol. 75, 4506-18. Watanabe, M., Tanabe, S., Tatsukawa, R., Amano, M., Miyazaki, N., Petrov, E.A. and Khuraskin, S.L., 1999. Contamination levels and specific accumulation of persistent organochlorines in Caspian seal ( Phoca caspica ) from the Caspian Sea, Russia. Arch. Environ. Contam. Toxicol. 37, 396-407. Welsh, M.J., Lyons, C., Trudgett, A., Rima, B.K., McCullough, S.J., Orvell, C., 1992. Characteristics of a cetacean morbillivirus isolated from a porpoise ( Phocoena phocoena). Arch. Virol. 125(1-4), 305-11. Wohlsein, P., Puff, C., Kreutzer, M., Sieber t, U., Baumgartner, W., 2007. Distemper in a dolphin. Emerg. Infect. Dis. 13, 1959-1961. Woodroffe, S.B., Hamilton, J. and Garnett, H. M., 1997. Comparison of the infectivity of the laboratory strain AD169 and a clinical isol ate of human cytomegalovirus to human smooth muscle cells. J. Virol. Methods 63, 181-91. WHO, 1998. Expanded programme on immunization (EPI). Standardi zation of the nomenclature for describing the genetic characteristics of wild-type measles viruses. Wkly. Epidemiol. Rec. 73, 265-272.

PAGE 155

155 Xie, M., Tanaka, K., Ono, N., Minagawa, H. a nd Yanagi, Y., 1999. Amino acid substitutions at position 481 differently affect the ability of the measles virus hemagglutinin to induce cell fusion in monkey and marmoset cells co -expressing the fusion pr otein. Arch. Virol. 144, 1689-99. Yanagi, Y., Takeda, M. and Ohno, S., 2006. Meas les virus: cellular receptors, tropism and pathogenesis. J. Gen. Virol. 87, 2767-79. Yang, W.C., Chou, L.S., Jepson, P.D., Brownell, R. L., Jr., Cowan, D., Chang, P.H., Chiou, H.I., Yao, C.J., Yamada, T.K., Chiu, J.T., Wang, P.J. and Fernandez, A., 2008. Unusual cetacean mortality event in Ta iwan, possibly linked to naval activities. Vet. Rec. 162, 184-6. Zhou, C., Yang, Y., Jong, A.Y., 1990. Mini-prep in ten minutes. Biotechniques. 8(2), 172-3. Zvirbliene, A., Kucinskaite, I., Sezaite, I., Sa muel, D., Sasnauskas, K., 2007. Mapping of B cell epitopes in measles virus nucleocapsid protein. Arc. Vir. 152(15), 25-39.

PAGE 156

156 BIOGRAPHICAL SKETCH Rebecca Jean Grant was born in W illingbor o, New Jersey, in 1981. She moved to Lansdale, Pennsylvania, at the age of six. For the next 12 years she grew up in Lansdale and attended North Penn Highscool, where she par ticipated in swimming and water polo. Rebecca graduated from University of Delaware in 2004 w ith a B.S. in animal science and a minor in biology. She graduated with dist inction by completing an undergra duate thesis that focused on the Regional Distribution of Proand Anti-Infl ammatory Cytokines and Growth Factors of the Sensitive Lamina of the Bovine Claw. Rebecca enrolled in the Ph.D. program in the department of Infectious Diseases and Pathology the College of Veteri nary Medicine at the University of Florida in August 2004. Her dissertation research focused on developing molecular and serological diagnostic assays fo r marine mammal morbilliviruses. Rebecca hopes to continue her career as a virologist and find a postdocto ral position focusing on molecular diagnostics.