<%BANNER%>

Inter-Kingdom Signaling and Characterization of a Coral White Pox Pathogen, Serratia marcescens

Permanent Link: http://ufdc.ufl.edu/UFE0022380/00001

Material Information

Title: Inter-Kingdom Signaling and Characterization of a Coral White Pox Pathogen, Serratia marcescens
Physical Description: 1 online resource (148 p.)
Language: english
Creator: Krediet, Cory
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: coral, marcescens, mucus, pox, serratia, white
Interdisciplinary Ecology -- Dissertations, Academic -- UF
Genre: Interdisciplinary Ecology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The surface mucopolysaccharide layer (SML) secreted by corals is a rich environment where bacteria proliferate. The activities required for SML colonization by bacterial pathogens and commensals are unknown. Serratia marcescens is an opportunistic pathogen that causes white pox disease of Acropora palmata. To characterize mechanisms of SML colonization by S. marcescens PDL100, its ability for carbohydrate catabolism was characterized. A complement of enzymatic activities induced by growth on coral mucus was identified using defined chromogenic (p-Nitrophenyl) substrates. Pathogenic and environmental isolates of S. marcescens induced a suite of catabolic enzymes during growth on coral mucus. The characterization of glycosidases induced during growth on coral mucus demonstrates that Serratia marcescens relies on specific catabolic genes for its colonization of acroporid SML. Induction of these specific enzymes also provides insight into the types of bonds found in coral mucus. BIOLOG EcoPlates were used to characterize the ability of several isolates of S. marcescens to catabolize model carbon sources. Serratia marcescens PDL100 showed high correlation to other pathogenic isolates as compared to environmental isolates of S. marcescens and native coral-associated bacteria, suggesting that this coral pathogen may have originated from anthropogenic sources. Coral larvae prefer to settle on substrates that are colonized by coralline algae or by biofilms formed by coralline algae and associated microbes, however, the perceived cue is unknown. Both bacteria and eukaryotes produce vitamin signals with newly discovered functions in QS and host-microbial interactions. The hypothesis that known signals commonly associated with microbial biofilms may function as settlement cues for larvae of stony corals was tested. These settlement experiments involved C14-homoserine lactone, 3-oxo-C6-homoserine lactone, lumichrome and riboflavin, each compound functions in bacterial cell-to-cell communication and contribute to settlement of marine organisms. Presence of AHLs, lumichrome and riboflavin in coral-associated microbes and in coralline algae was investigated. Transgenic microbial biofilms expressing AHL-lactonase were constructed to test the consequences of AHL hydrolysis in larval settlement. Chemicals were also impregnated onto C18-bonded silica resin to simulate biologically relevant release rates of the compounds into the medium during settlement experiments. Acropora palmata larvae appear to respond to AHLs and coralline algae, however, trends remain unclear.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Cory Krediet.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Teplitski, Max.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022380:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022380/00001

Material Information

Title: Inter-Kingdom Signaling and Characterization of a Coral White Pox Pathogen, Serratia marcescens
Physical Description: 1 online resource (148 p.)
Language: english
Creator: Krediet, Cory
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: coral, marcescens, mucus, pox, serratia, white
Interdisciplinary Ecology -- Dissertations, Academic -- UF
Genre: Interdisciplinary Ecology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The surface mucopolysaccharide layer (SML) secreted by corals is a rich environment where bacteria proliferate. The activities required for SML colonization by bacterial pathogens and commensals are unknown. Serratia marcescens is an opportunistic pathogen that causes white pox disease of Acropora palmata. To characterize mechanisms of SML colonization by S. marcescens PDL100, its ability for carbohydrate catabolism was characterized. A complement of enzymatic activities induced by growth on coral mucus was identified using defined chromogenic (p-Nitrophenyl) substrates. Pathogenic and environmental isolates of S. marcescens induced a suite of catabolic enzymes during growth on coral mucus. The characterization of glycosidases induced during growth on coral mucus demonstrates that Serratia marcescens relies on specific catabolic genes for its colonization of acroporid SML. Induction of these specific enzymes also provides insight into the types of bonds found in coral mucus. BIOLOG EcoPlates were used to characterize the ability of several isolates of S. marcescens to catabolize model carbon sources. Serratia marcescens PDL100 showed high correlation to other pathogenic isolates as compared to environmental isolates of S. marcescens and native coral-associated bacteria, suggesting that this coral pathogen may have originated from anthropogenic sources. Coral larvae prefer to settle on substrates that are colonized by coralline algae or by biofilms formed by coralline algae and associated microbes, however, the perceived cue is unknown. Both bacteria and eukaryotes produce vitamin signals with newly discovered functions in QS and host-microbial interactions. The hypothesis that known signals commonly associated with microbial biofilms may function as settlement cues for larvae of stony corals was tested. These settlement experiments involved C14-homoserine lactone, 3-oxo-C6-homoserine lactone, lumichrome and riboflavin, each compound functions in bacterial cell-to-cell communication and contribute to settlement of marine organisms. Presence of AHLs, lumichrome and riboflavin in coral-associated microbes and in coralline algae was investigated. Transgenic microbial biofilms expressing AHL-lactonase were constructed to test the consequences of AHL hydrolysis in larval settlement. Chemicals were also impregnated onto C18-bonded silica resin to simulate biologically relevant release rates of the compounds into the medium during settlement experiments. Acropora palmata larvae appear to respond to AHLs and coralline algae, however, trends remain unclear.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Cory Krediet.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Teplitski, Max.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022380:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101221_AAAAAG INGEST_TIME 2010-12-21T07:17:40Z PACKAGE UFE0022380_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 8434 DFID F20101221_AAAFPB ORIGIN DEPOSITOR PATH krediet_c_Page_018thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
f8b1e1c6980b01c24c8bfd069cac7513
SHA-1
657ad58b0bcf957e1c9abefe928d21bb19f43376
1071 F20101221_AAAFNY krediet_c_Page_127.txt
717cec6c3c30d54f6bd03134c6c86b51
3aa9a2dec45d6b3478c574cec6f9190791f66851
48596 F20101221_AAAEKW krediet_c_Page_047.pro
dc129376063bd3095dc0fe2320c908df
e3eff6072f43371b4f279b891d12d436d2436c2d
8685 F20101221_AAAFPC krediet_c_Page_020thm.jpg
6084b639747e7a9c28b36c7be5178262
38f19e17799d4e03d98d7a0d9ad62a5e61aaf99f
3506 F20101221_AAAFON krediet_c_Page_003.QC.jpg
78611567511355d9349b9215dcb72de0
6d44ca07d99f9a3f764163cf645d4b2f9d039e98
2542 F20101221_AAAFNZ krediet_c_Page_128.txt
b8d4ede3be601930bfc8dd4ecb9cd58c
a67d7982fffb393c06d090fb18d3e7e7d8845d13
74566 F20101221_AAAEMA krediet_c_Page_005.pro
8c4c7a6711dd4ba2f9728a650c3bec73
74c6d2934ca345163ca38094ba9b018603d80460
83822 F20101221_AAAELL krediet_c_Page_036.jpg
9f8c3fcaa8160e95aa37482c7f7f607d
b273f628407c3955617f0e7756a4f1a3a3f8bec1
1051970 F20101221_AAAEKX krediet_c_Page_132.jp2
3813d703a2552fad7703b0859cd05ce3
2786d812c8d1fd8c43428cee616ab6ae07a45e5f
36779 F20101221_AAAFPD krediet_c_Page_021.QC.jpg
b47d9637b8877c293aa745eb4af327b5
7d73d359aadfaccdd5d50e580e9c811cc4b8495e
12452 F20101221_AAAFOO krediet_c_Page_004.QC.jpg
1232b60310435bcffc0e1f58fe3fc0dd
1d3d62d091f3f2d1b8c06f180f347e6791e2de01
2071 F20101221_AAAEMB krediet_c_Page_027.txt
100314734d1a54ba1e9336526544bc5b
0b90c59f9da22ab042868ca337278fb2a3e77b0b
1051979 F20101221_AAAELM krediet_c_Page_022.jp2
4501b64379263241f9b50bb85cbb4346
487077453cf4aa4f4373c9c3fb8a935b2bcdd13f
25271604 F20101221_AAAEKY krediet_c_Page_104.tif
05dbd6cfe3270a3af9f9fea60cbaa8e5
c60f407fd713e52827390f26a6752a3ca2a58e62
8951 F20101221_AAAFPE krediet_c_Page_021thm.jpg
1ea28e0e8c95d77fe50d15b85cc6c30d
4c716ef02b6f1e4b8f6e924b69ac1522d8a23328
3265 F20101221_AAAFOP krediet_c_Page_004thm.jpg
0b1d1ac13dc2c009b4378b39cb897b03
0af47d0a674e23ff3a211fcaf1acc29b769677e1
9003 F20101221_AAAEMC krediet_c_Page_038thm.jpg
720d3dfe98a1f498b3e948cb02332b84
8a6553e096f042295988b70d733122ae603f14e6
1051966 F20101221_AAAELN krediet_c_Page_040.jp2
0bd1cf85c5599753edca2839cf298e4f
ba9a3a945bc520a447bd4587a0916b3b5c42b66c
16049 F20101221_AAAEKZ krediet_c_Page_094.QC.jpg
9ee684e82de77ec10b3270027a16428d
139be89eb80f6bdeda837909d3f0bd2532261e0e
37515 F20101221_AAAFPF krediet_c_Page_022.QC.jpg
7dfce22f83650737a932f0062296ac18
9ffd40c3d67cdcb95ecd67dcfdb133347dda88a9
6834 F20101221_AAAFOQ krediet_c_Page_005thm.jpg
c49b204acb5378949bcee775ed5684aa
41b6da7ee119a7cca358bd9043ada98ce3bf780f
55139 F20101221_AAAEMD krediet_c_Page_064.pro
2df53ef72c125a3c4ca5a4cae4ce1012
f906a0ec9c39a27455f0d7f828b8497181bc6326
54077 F20101221_AAAELO krediet_c_Page_078.jpg
fde03b09c20e858fd7314d458c53f553
c2d525718675355ad69637cc5ab3e29068627f30
8864 F20101221_AAAFPG krediet_c_Page_022thm.jpg
5fd1ba36b2f0aeb51e504db87b34b7ae
48a037dbc5485d78a9feb256c2755a86ca26e578
1925 F20101221_AAAFOR krediet_c_Page_008thm.jpg
1d8ede72f7488afa89897ac67bd0d730
2a347cca9825a971e728c577f991d706b1a6f3ae
52870 F20101221_AAAEME krediet_c_Page_084.pro
fe405fd995c0bd9513fb0321a60c4610
7a2d6aa6d30ed40ae2a2160a4d2761bfffa56868
131028 F20101221_AAAELP krediet_c_Page_145.jpg
5af71e305c575fa572bcfacf38083850
d00de51d95d0f14e9209232ad2ef4e0ffbf12018
36612 F20101221_AAAFPH krediet_c_Page_024.QC.jpg
e9e0760b8c290b31e0335a489ec191e8
cab2e9b1ecd9d19acd1bd13ebbfb23ebd33592e6
8987 F20101221_AAAFOS krediet_c_Page_009thm.jpg
62ffed7a8f1bc9c02945261f6f6ad192
90534ada7c52646da0796843408b21cda1764b56
54998 F20101221_AAAEMF krediet_c_Page_090.pro
a118a6acc817387ea5a1f41fc77e3235
a5c7212949fd12abf04c620a626f992196dbb208
F20101221_AAAELQ krediet_c_Page_033.tif
3751012343cc25f830a4420f8a63c329
e09b69764f91c43b19eff797c01cfcf60bc55519
36681 F20101221_AAAFPI krediet_c_Page_025.QC.jpg
b6f01872991f18d9d7c7425c6ac34083
81b50858fe76de3c0e40276a4a0a0fd0ba30cec4
31118 F20101221_AAAFOT krediet_c_Page_010.QC.jpg
6de0148104a48ab0efaac159f77228f9
1f17d0a0869874b731071fa3ebed5c2d86a6c545
20625 F20101221_AAAEMG krediet_c_Page_072.QC.jpg
ee553636c3d20df8c6e8591a34a8c77e
eeef45c799da3d765432ee905c4c7dea82b42aac
116338 F20101221_AAAELR krediet_c_Page_015.jpg
e8d8dfdce53230743a0c1df3ee7af83f
385b29b35b911cabfce0fec6adc15300244810a5
8807 F20101221_AAAFPJ krediet_c_Page_025thm.jpg
f568bd3b4d16b988e21e75c1a3a3a9fb
7f321293b2136285b14832558c5b4940928dc5f9
21976 F20101221_AAAFOU krediet_c_Page_011.QC.jpg
daedb4d6e74761064c1d533e9cf52b49
f4fc6cdada84dfa42d28a509df3a15f4f96384f3
1051937 F20101221_AAAEMH krediet_c_Page_102.jp2
37281fbb4e585cd946b3634f92919c31
40715e3410686a0bc0dae95796f1af896563c4e9
1051962 F20101221_AAAELS krediet_c_Page_006.jp2
654d9fcd0f495edf185be41fc6449546
70d01e1254fdc046e44149cd35f0e796ea7815ad
36488 F20101221_AAAFPK krediet_c_Page_026.QC.jpg
bf519c958cf61f78cded3bb830063e59
3dfd71b0552ba2b968563952f9cb6e0c890cc272
5389 F20101221_AAAFOV krediet_c_Page_011thm.jpg
e3299aae34ac2f1c025f1504c609a584
c115c22ac66adb4828e7953a73acd8a1cfb80bf6
F20101221_AAAEMI krediet_c_Page_053.tif
7ff0a68154e1a9ea8cf84179b34cd13e
a76550a384986e4e86e6c4b2d2e58dd9b0af590b
38841 F20101221_AAAELT krediet_c_Page_131.QC.jpg
506b4a94a8dc2b6e13f70c95f0ffe684
aebb5600703fb75ebd4ffe55aa591052494d9669
8783 F20101221_AAAFPL krediet_c_Page_027thm.jpg
4f8dcd760a8e8510bb2d2b325d7dff57
bcd3add10ec617270032463c9650f3833f6da51c
8267 F20101221_AAAFOW krediet_c_Page_012thm.jpg
84744a0453006db40fd2b83162bcc84b
97bf25645924df9f1486b94be58e20bc689de664
1051946 F20101221_AAAEMJ krediet_c_Page_139.jp2
ff034bc14a8dda7830334fb129546e14
4bbf0462dd3e7abc56d9623a327b8667beba42a5
6460 F20101221_AAAELU krediet_c_Page_036thm.jpg
a6ab2f8cd4e06b5a581351c3e53cf080
56ee9078af1cc38adb7f5215a03312461f430201
37403 F20101221_AAAFQA krediet_c_Page_046.QC.jpg
6b1bbde150d880a35c4a1a30a6888a7b
2a40f3d02bc8cd410d89c5f57ccc75e27ba44593
37710 F20101221_AAAFPM krediet_c_Page_029.QC.jpg
feffa141527442c487917a09f1a5bc51
506932c9c0f982431c42631cc6fc21226d6edb8b
8937 F20101221_AAAFOX krediet_c_Page_013thm.jpg
26965f5701459b239cb5619c9c336174
d89e871ec33dc3df57d8f7d86df1fde790ff3236
9300 F20101221_AAAEMK krediet_c_Page_131thm.jpg
0c6ea4daaa66466973ac550a208ed46a
2ffa8a929724b0bc49a55588a0a7013493e4a821
53928 F20101221_AAAELV krediet_c_Page_111.pro
1ce76719f182518b7ae4fa0d30ca2c07
f2aa1df0b6a8b13356fa8d976b9f0be12a88fb01
8959 F20101221_AAAFQB krediet_c_Page_046thm.jpg
b4af1b4b32de215c2573d6a90d8f4e3e
7d1b2b05b9c317ffb936de92270c3a08c6353602
34226 F20101221_AAAFPN krediet_c_Page_031.QC.jpg
cad781c25420d2d5a6dd465439fa85d4
2f9a0338c0cfc76e1792cbca47f6be48f50c41df
36042 F20101221_AAAFOY krediet_c_Page_014.QC.jpg
f5e214980f595446f17fc69b20b19d6b
19c737b5e6d79c1c79d532828dad6bb4cf1042a7
112145 F20101221_AAAEML krediet_c_Page_041.jpg
10cecff2b3e1f0cde8d31b437bf6fa60
e4f5dc1ed216589d9ca969a55881d7451b97effa
2183 F20101221_AAAELW krediet_c_Page_041.txt
5055fa330522ae60b72a8f33bebeff7b
b909da616bbf853fd0459d7726f07d79eae1e714
33047 F20101221_AAAFQC krediet_c_Page_047.QC.jpg
acef260e077d8a8ea807c46d74822a9a
f80057002c654471fd753c74f89162313a6312f6
38407 F20101221_AAAFOZ krediet_c_Page_015.QC.jpg
3a2b869b168d8b94d396a581259cf0bc
aeb9c93ae817f0824b4ab610391ea51d93ca0498
111447 F20101221_AAAELX krediet_c_Page_064.jpg
98216480c0be13c5e1efda836b5c2b28
b11179c55bc9051c7a2f041a9850c422e99af89e
109320 F20101221_AAAENA krediet_c_Page_084.jpg
3cd75592ea19660d1ef99f400b9f0ea2
229972c04b71c4d6833353602375a5c64d424184
5774 F20101221_AAAFQD krediet_c_Page_049.QC.jpg
a856b2ffa73d2d2da707f6b188cdd567
f834d553186c17cd07508aa000a7894a6bc5336d
8083 F20101221_AAAFPO krediet_c_Page_031thm.jpg
2c238a25933e6d750b8af1dcdabf83b6
71d9032e520cfbc50bad3da48cacbe8fd8e0ea99
F20101221_AAAEMM krediet_c_Page_083.tif
aa2d1c269919f93dab3fc5bc5e65abf0
cfd1e101ea6bad36c664e3cba7440226d0431123
34577 F20101221_AAAELY krediet_c_Page_069.QC.jpg
7ebd44a6c885381ea4a186c16eb0a2b7
2010669cb6c31f9dcd42de13438a451bc73f970f
F20101221_AAAENB krediet_c_Page_021.tif
684d77b165d55681807a7913faad58bd
397d7d8e2ea70318489f2e6073a72ea747b627b1
12649 F20101221_AAAFQE krediet_c_Page_050.QC.jpg
a27a297ac73ce93d21fe13b158a328fe
b8012b95c0b433943c41d5e51cb6e998c2decda2
8748 F20101221_AAAFPP krediet_c_Page_034thm.jpg
f39812c41876079c1b0221ca4aaa48c1
f780d4c5dc9506ae52ec658c8d383c7f70d5cb8e
2193 F20101221_AAAEMN krediet_c_Page_026.txt
0c6e5dfab4fa0027542ca066e9d5b892
6a68d5cf7e7ab11f48636c9e47214adac23a96c7
8894 F20101221_AAAELZ krediet_c_Page_111thm.jpg
8e7cff7b95a9da9685d01ab891531c98
985a0f12c4609fe030cec82ee09f08aba5c7b745
51071 F20101221_AAAENC krediet_c_Page_018.pro
56b52bc8794d997cee7c9897342be8cc
cf46fe69431a1c094f4468259b46a0905fe2a9b6
6766 F20101221_AAAFQF krediet_c_Page_051thm.jpg
f5393029d46db9a8c1c4bb43bc1e306b
9388b4dfff79f9d54533318f1d9a2b56192b5048
37890 F20101221_AAAFPQ krediet_c_Page_039.QC.jpg
f1b83e0cf3fbb16412559f657d7b6771
ef2f7c1e4eae9f6e3602b4f17cea8714cb344937
F20101221_AAAEMO krediet_c_Page_091.tif
ee3d7290af82efddadb2dcf5c5ec0ee8
d81585e9592b50dda1ace4f225c01b1f06634b70
35392 F20101221_AAAEND krediet_c_Page_034.QC.jpg
2b39153a36f17ec88d20c4b950916571
bea768f47ac60c7b14b21aedef35227c23753447
37060 F20101221_AAAFQG krediet_c_Page_052.QC.jpg
f32fa6ce84d658c2e8ae72bab6cda7c9
14a7212147aae477dfedfaf3062d416985fd3879
37565 F20101221_AAAFPR krediet_c_Page_040.QC.jpg
b98ea2e4db58853e441d6b00343147ea
9b0147119a2acc707b05a79c13fc62b9ab1f4901
112621 F20101221_AAAEMP krediet_c_Page_102.jpg
1c627216ea2d68d8426a53939e944645
aae4fa23d1f197290609ab957067e6394ae92eb4
F20101221_AAAENE krediet_c_Page_121.tif
a1fff556d0b0784ac930cfd530293f62
cb013fd70f38422c82dec0392f2e371e8bbfce44
9008 F20101221_AAAFQH krediet_c_Page_054thm.jpg
8cde21406ddc2e8b30e90de8341b5df3
64db2982c07864f4acee53de8f287e565e7668d5
8994 F20101221_AAAFPS krediet_c_Page_040thm.jpg
d5b9557bf2815c937c0d50b4e71c627a
ae6509e82bcc85c238161207b3f29fdf87a59c1b
14649 F20101221_AAAEMQ krediet_c_Page_076.QC.jpg
50f46178cdf9cacf33536437784ff0b6
b21c4e0968b0453ffecfc0c6ec86de46499c3d5c
8278 F20101221_AAAENF krediet_c_Page_001.QC.jpg
e79eccd52f1e16f19d5cdddb72575b19
79bda4f69669caf61b155a0cca51f11125e5aaec
32640 F20101221_AAAFQI krediet_c_Page_055.QC.jpg
66fb6898ef7ece960ff22a25a557b93d
c686c07bcdc646b1b58bf1ae679a0a8d533b1eba
36978 F20101221_AAAFPT krediet_c_Page_041.QC.jpg
c6ef99ce597effb6ffa22f2b7de21715
bef112fb3f5fc9c79d218da5acfb52886740afab
1051954 F20101221_AAAEMR krediet_c_Page_066.jp2
b47ec797473d8e4962dd59707c8f794a
dd7350fc19bab859723fded6d2a2f6efa5760eed
36300 F20101221_AAAENG krediet_c_Page_059.QC.jpg
89f1df7622d6bbe0546fbaeecd758f5d
7a7463c297611f03112623b54e569a9409fb8daa
36625 F20101221_AAAFQJ krediet_c_Page_056.QC.jpg
ec8665f16703f7709f42a697abc0edd5
754efd00cf884217e035e4debe6cacea7ffdccae
38305 F20101221_AAAFPU krediet_c_Page_042.QC.jpg
08e42c9d286a87db00cd008f9f27a254
5a476d7e4799d7d6ebf7e3b5b6cedaf3fb6960da
138349 F20101221_AAAEMS krediet_c_Page_129.jpg
9d79539c9c6771d1c3929b9279c3f360
0946a5adeed35a311694bdd45f197c195bc66451
53659 F20101221_AAAENH krediet_c_Page_115.pro
701082f823b8d1d8bc31ee7ad2470822
89427fd5e7865b9105cfa1834d89af45d51f6661
38371 F20101221_AAAFQK krediet_c_Page_057.QC.jpg
3c03fd6a92ee7d9063631c1889715fca
564460a7b936860c2e1f561af778efa152730778
9220 F20101221_AAAFPV krediet_c_Page_042thm.jpg
118f4eb00f9ad71296c6719abf842e66
7bd0be806078d8961d2df63602824a1dd70327d9
53922 F20101221_AAAEMT krediet_c_Page_091.pro
0b8074a172789aada84421a002b0f287
f2703ff35efdb07e2582da8ec40955455b96aeed
2161 F20101221_AAAENI krediet_c_Page_064.txt
5ad78d35565a7e804d49d676d198f213
27e48dcfaff64ebb964961d9c2f6eb6d8799e84d
9157 F20101221_AAAFQL krediet_c_Page_057thm.jpg
07ea411703948e6230927b508f97e303
82982100525d1faebbfb67533cb02ec6d01aa709
35973 F20101221_AAAFPW krediet_c_Page_043.QC.jpg
cb712b8c9e7d3f21d0ff6ef1c1351af5
418f3186937d5ad9b3553e206112ea85e4a6cd8c
7060 F20101221_AAAEMU krediet_c_Page_121thm.jpg
1301cdfbe6b05b0b2c1508cc55dfceb9
a46c5f17ae6ca2091e3ad94f43117496ffb14357
36440 F20101221_AAAENJ krediet_c_Page_093.QC.jpg
aa253689fe4db5243234ed129371d5cd
4815b34b28679ade63a58a109beea1464369a937
7598 F20101221_AAAFRA krediet_c_Page_071.QC.jpg
a9833480ff8ff1c7f77a97396deb4089
953494362f9ba386a4b0bcb2710a7f7e7d579a67
37154 F20101221_AAAFQM krediet_c_Page_058.QC.jpg
ea1871b7aceaf8f78b71f7a091ddca74
b064798bfd4a541df861f9e7850a3a780a0858cf
8919 F20101221_AAAFPX krediet_c_Page_043thm.jpg
1695ab9525b7030b24f5f3f11f8f8478
9699b1623fdc597a62c3a683197eb818ef760483
969 F20101221_AAAEMV krediet_c_Page_070.txt
306b2a045c004b896a771a3c19c63783
3ed9e03d316613f05e1a3d6da1654c32a76abb8f
F20101221_AAAENK krediet_c_Page_010.tif
2c96a33a4bcaaf025e12153398da62f4
9d2181d7d817aef5cb3b1f53e4585314bca3b345
2000 F20101221_AAAFRB krediet_c_Page_071thm.jpg
52039a375d08ea2cfe5ca4b981adf0ec
fd6bc3e73bde763c72f4ae7bde5d4fd015354059
8877 F20101221_AAAFQN krediet_c_Page_059thm.jpg
7783d83e169a2a7fea23c64bc41a7691
a68f674ff9fdb93f2552dafae8f3bd781e0f8282
8832 F20101221_AAAFPY krediet_c_Page_044thm.jpg
061f75a165937e438da8d62b57286ea1
2748bc6ff245259c021b5fa94159eaf38294a6e9
F20101221_AAAEMW krediet_c_Page_057.tif
9c8531972f0932b5cc534943553d57cd
d5c57cd9d5b1b46eb8cdd774de8a7f88199939c6
9018 F20101221_AAAENL krediet_c_Page_102thm.jpg
8cad5519e72a1447ac65bc221dc35730
666ce672902e465cf3fb16184da400639c9a3daf
6026 F20101221_AAAFRC krediet_c_Page_072thm.jpg
03f801dc8a95542318ba9c60fbe026cb
223dfd9ce21c530deceece0cd17977b1467812b2
8778 F20101221_AAAFQO krediet_c_Page_060thm.jpg
9740277e498630718a5f2bcb923679e9
f4a46f0614ba91d241fc2016a84a0aafbdab03bc
9024 F20101221_AAAFPZ krediet_c_Page_045thm.jpg
30d1c2ae9ea800998955161db96ca5a4
3926ba144307b6f2d8afc3de2b29c0732ee896f9
F20101221_AAAEMX krediet_c_Page_046.txt
076a7a4ebbeab68b474e55f19eeab790
aa08e60e7c3462572111adf81898384346e95dbc
105370 F20101221_AAAEOA krediet_c_Page_060.jpg
d68b9bb6fb8170a185ef7b7bdcd43154
23b7f073361be6e658456e0522b7a2386b980645
F20101221_AAAENM krediet_c_Page_087.tif
8fa177dff9e9ca9289fad57cd5921347
98ad496c922bb6888e49972ffbfc395f62600977
15654 F20101221_AAAFRD krediet_c_Page_073.QC.jpg
9a1e90bfb2e22ab002d9c571717cc05b
9f848756577f759305a7830b1f7fc5c18db1aab6
37393 F20101221_AAAEMY krediet_c_Page_092.QC.jpg
fb3a635407804758db4bb9232d5f7ee5
de769975a8cd72995c01f089220082f270ee493d
6491 F20101221_AAAEOB krediet_c_Page_008.QC.jpg
e0fd8d1916f9465072a82efbb15b042f
55eeb42d9cdb8df261d8138ee3606367bf0fd105
18270 F20101221_AAAFRE krediet_c_Page_074.QC.jpg
711d175339fe25330b3a18f717cd5cfe
5a3d89f9efcf1965d976218c49e2d521bec8eaa4
34619 F20101221_AAAFQP krediet_c_Page_061.QC.jpg
f0a89165cd814fc09634ae6d745be275
28bd81900563793edbf79f6309a854e9d4dc697e
2771 F20101221_AAAEMZ krediet_c_Page_134.txt
05607a34471259fe7507d58454da7d72
06e5960fbb0c61e50db6b238b24fee122de17cbd
1935 F20101221_AAAEOC krediet_c_Page_082.txt
43363bcd89fb48389095ca0e95303ee4
b3827be14fd9aa78433784d349a6ebef3cca7e83
112991 F20101221_AAAENN krediet_c_Page_026.jpg
68b945bff12536eaab5debb5f583d5c3
fc65baff9c461db433bf04ec90f9204fa7ad16f8
5580 F20101221_AAAFRF krediet_c_Page_074thm.jpg
5aa44c345053feb8dfc3913cf746b98e
1a5d08d9fbdcd139ea5dc911586e7840dc57e850
8856 F20101221_AAAFQQ krediet_c_Page_062thm.jpg
fff76682828ed4bfd7d47d3070ab8795
cea6db8d7d912189ec5397d9d508e591fa784e47
124054 F20101221_AAAEOD krediet_c_Page_005.jpg
90db01cf78296ad9fd3c9a3d113a07a7
cba3b5d814e9254b35a5253a57d3120e786c7e68
F20101221_AAAENO krediet_c_Page_041.tif
536599255699edef669b21575531f592
bd15bfa4da8075f06983e350a6e0d881f0940775
4341 F20101221_AAAFRG krediet_c_Page_076thm.jpg
af465a2f8e0b193751caf99f833fddd8
6d70abc9891ee1f7fc5b6ee1e2c523d9dd603730
35728 F20101221_AAAFQR krediet_c_Page_063.QC.jpg
210cb200ac02fe157534d43e1ff3852b
8dd8fd31cc530247d3db2525390b9ead9e152c35
40132 F20101221_AAAEOE krediet_c_Page_004.jpg
05e493dcf291e6936cd834a4b4c6b57a
5e0efbb9efba4a2100cf89574f9351e58d0ec648
8980 F20101221_AAAENP krediet_c_Page_083thm.jpg
5f707541ffbe820b4e771dc58e280759
aa598669499b13c50b8bd398c2987249c3318095
4353 F20101221_AAAFRH krediet_c_Page_077thm.jpg
2e01cecb177cdd52e87c1d27260a5e73
971e61e7a3217540758fcc71de763db8618f4695
36108 F20101221_AAAFQS krediet_c_Page_064.QC.jpg
63acf0b95d7618403b1acee4b1a344f8
e69314bdf5d5ec1bb674d88644437dc93714cc43
53941 F20101221_AAAEOF krediet_c_Page_123.pro
f33c4508e80d85c7073a34105e45ddbc
8fe8a586d75aade2d11bef2b45ea6574b70368c5
54385 F20101221_AAAENQ krediet_c_Page_034.pro
7712d88369161e7297fc391527fcd670
215e0f771ee2a66ceb7f63cafcd4afe06840b836
5434 F20101221_AAAFRI krediet_c_Page_078thm.jpg
3cfc8fb30f891325efb02d8d5fa2ea7a
f649111199ed9b1045e3e4112c3a45c66a845b3a
36255 F20101221_AAAFQT krediet_c_Page_065.QC.jpg
d2ef2d8d587eec7d3e644db3aa538857
f4fcd09d55606ddcf8a5010dc0829b7b7703f8a6
2164 F20101221_AAAEOG krediet_c_Page_043.txt
570194c63cf89c0556a8d7d91584ed75
71391a5415935e29820bf326ac6458364160dbd8
583 F20101221_AAAENR krediet_c_Page_049.txt
506041f80ef5d0c6138bf3132b13f2e2
9fbcd077876e0af2e2f68036239b16a832a69639
4977 F20101221_AAAFRJ krediet_c_Page_079thm.jpg
e184ba15fb2811be26c1e614e6bcb4f7
20b581c9dbf4e7e45fc487d68cd3b713b2407b5f
8946 F20101221_AAAFQU krediet_c_Page_065thm.jpg
d22f1026d0407e6e4ab9a466c8e664fe
6470cfc5e3f5ecab991a12a2d5d6d7c80dd34c62
F20101221_AAAEOH krediet_c_Page_062.tif
3c1ef4a81b3f03ea6d7b4bc9b4074928
5a3942711dfc16547e3797b4ae0a5c973bfe2ffa
32145 F20101221_AAAENS krediet_c_Page_011.pro
ab8abde775edaae2ec57e1b5fd423e1f
66ae0b9f7a8099c44cb1cbca32e7020eca87ee81
8664 F20101221_AAAFRK krediet_c_Page_080thm.jpg
8a46dcc3fda22c1cb6a5aa4eb3ce9da6
4074a1c0a5e72030b718c590927ff5b0d5f21f94
36692 F20101221_AAAFQV krediet_c_Page_066.QC.jpg
2968ec9c5d7929357908e22a27583720
f5c84c9f1752d6a264671fc82fdcd79a05296622
108274 F20101221_AAAEOI krediet_c_Page_034.jpg
09cdfc63db7afd11b95eea5a5b369342
4e5190e0247abe49db8bb717af94b5b9c305c0b6
1051983 F20101221_AAAENT krediet_c_Page_065.jp2
f041dc59a341e242b5bf112598555f23
0d554a7730e0ee4c590f6f06df14837ff24d8178
33116 F20101221_AAAFRL krediet_c_Page_082.QC.jpg
81e0a137d39cdc2ad6636033073cfb41
93ca197f812189cdd33f72d902b0b66f13bcc964
8984 F20101221_AAAFQW krediet_c_Page_067thm.jpg
95e3a06ccda7440de6f559c6088923dc
21386d86edd10388d8803f4e6765abeba6bac8ab
54575 F20101221_AAAEOJ krediet_c_Page_079.jpg
4a4cbca7a8b4459274da81d5adf03a9a
f2709df04cf505bd123cc2771e8b4e453c91d5e7
2113 F20101221_AAAENU krediet_c_Page_115.txt
71573785a3da82e49132896ee439791b
7df903079ed1797e3105e9b732012746038f7610
16508 F20101221_AAAFSA krediet_c_Page_100.QC.jpg
9f2e9f75c9f9f4e848b2312f0d397681
2cefaace696e93428b8d07ca3eef2d8d15a89ab3
8010 F20101221_AAAFRM krediet_c_Page_082thm.jpg
3225714289731821420369a3e0a34341
59aa219f188f2732bcbcf56ca99b1a9a99b96611
9041 F20101221_AAAFQX krediet_c_Page_068thm.jpg
17ebcde337e432d6aa5eac7a262233cb
243613aa01d838279e00f49c3423474ee13e0df0
8573 F20101221_AAAEOK krediet_c_Page_056thm.jpg
4ed7c92016c16a31da91af72ef5aa7d1
6db61903cbad8c8163fdc14c821287a54987745f
54722 F20101221_AAAENV krediet_c_Page_052.pro
09c3ab2fa829da3c085b81c138cfec31
c6bc144fdbac04d0855b5ea909e11b3b28f1ca04
5384 F20101221_AAAFSB krediet_c_Page_100thm.jpg
6aca3bc09093a440f83a77395de3affc
0092452777be7bf4795bde92ed87ef80df831ec2
37192 F20101221_AAAFRN krediet_c_Page_083.QC.jpg
1641123035d32966d12714e724651812
29edbeb9b9aa7919f0459632ea1dbdb62d73264f
17104 F20101221_AAAFQY krediet_c_Page_070.QC.jpg
ac18efc183421c4a187c7f6066cf7ee0
87264aa2c7ee95d8c184daa83ed21cd6f0df8165
F20101221_AAAEOL krediet_c_Page_118.tif
0339e7d94afd4711c8419174fe58870e
0933037640fe755fe9f746141341774147b22bb7
113146 F20101221_AAAENW krediet_c_Page_023.jpg
29505070548d04fd50a321ff011388b8
7cb69cd4fb9d9a0b99924d4a07d4cea040572601
36943 F20101221_AAAFSC krediet_c_Page_101.QC.jpg
3219e5674435beb5b8f3013aca016f95
7795d61e94b902fba24bb77c0cb690117cc99e87
8815 F20101221_AAAFRO krediet_c_Page_084thm.jpg
00278f0bc31ea8ed7eb60d2d0a220021
12cec5960c1b65b11f2a6f00518c4ca56605dc43
4277 F20101221_AAAFQZ krediet_c_Page_070thm.jpg
d92c2e8c8188a2967368046737cc8f5d
9243baccb1676e56e1990a12333ed7ee1a27f504
F20101221_AAAEPA krediet_c_Page_042.tif
71b2afffa71b630d22782509ffc4d1bd
5bb36ceb80cae527739f68f539e2b092796ffd14
54862 F20101221_AAAEOM krediet_c_Page_065.pro
3ba8934ea78b565b4b32d3779c4c4624
4b342bae8abd082c9839298c9131da64a2302e88
38279 F20101221_AAAENX krediet_c_Page_124.QC.jpg
bb5dfd8ad79ca9cad09d0bf2c0516a9a
520a88b573c5861f7779db56bb117aa880dbcf63
36923 F20101221_AAAFSD krediet_c_Page_102.QC.jpg
29e5c8fc6915993e8bb44fa179c07e46
c81da3028a3e0860fbbba17c2586b1ddcf5f6672
36644 F20101221_AAAFRP krediet_c_Page_085.QC.jpg
9de542776b27933d517986fc5213cdd8
9fbd48669f9bf96f0ce9be2c6c58421848ebd743
592744 F20101221_AAAEPB krediet_c_Page_098.jp2
6dbd0965928638a93f79b2aa0fb926d4
b27342cb79f712c3a2664f93d9f7e64fa3c6a657
37392 F20101221_AAAEON krediet_c_Page_132.QC.jpg
1b50aba768b32c075a131bf564469647
005d12f09329fa12753e6d598794610d8c6aaac8
54881 F20101221_AAAENY krediet_c_Page_037.jpg
bc86905f6105016786eaad94e883c34f
3af2085bfc11dff23848ffd7524c1d628839ab23
36793 F20101221_AAAFSE krediet_c_Page_103.QC.jpg
10ebeaadc155b6da2581e25ef697ca43
c5dd2e040f4d168692e557820a9ce4a610200bae
35609 F20101221_AAAEPC krediet_c_Page_060.QC.jpg
3683b8a10ca645d0ae48e3151930de0c
d956ed9fb0b9d803e9586b9055b72993444af24a
2798 F20101221_AAAENZ krediet_c_Page_140.txt
f6dde252f322d23deb435d3cb5ca42ea
7f7ac9eba91497a1103e94651e2a86fbf0c640b8
36323 F20101221_AAAFSF krediet_c_Page_104.QC.jpg
fd1d26d106f2b9c452d9c85126ca1d5f
69a9e6ed62ac7109048bebb6e5060bb4d2045105
8639 F20101221_AAAFRQ krediet_c_Page_087thm.jpg
8d9d5eeb032a63c6c6d92c55f83948fe
b77a0da8bbe8e0eb33d65704d1d013384c3797f8
8491 F20101221_AAAEPD krediet_c_Page_035thm.jpg
e36a43ad951aabf072b0ecd9411ab09c
5037d8af76708b4fbf2ef23afc3da628ce6e95c5
54792 F20101221_AAAEOO krediet_c_Page_085.pro
6f5521217c928f9f6ffb1a73ea054fa5
8432d1fa0a5a61de52de8c74c41ea55437c7768a
8983 F20101221_AAAFSG krediet_c_Page_104thm.jpg
03e31a25d509475e0f66d443c620e5d4
f7e3ede9814d27906ca2ad4b727f775e71ac84b0
8833 F20101221_AAAFRR krediet_c_Page_088thm.jpg
9f892b99fb2280c878562a304d5dd509
782a8bc0ed91bc240dcb0ea4fe083a2dd06ee81f
870 F20101221_AAAEPE krediet_c_Page_100.txt
520e46232705312d21889f6b56af0f72
e6169429f716f743c61bacddf3b16feb09378878
37664 F20101221_AAAEOP krediet_c_Page_032.QC.jpg
1bb65b633357d4b79bd005d8bf10ef04
f8a19ca31887572de2b80a5b49265cf03c3f9014
35655 F20101221_AAAFSH krediet_c_Page_105.QC.jpg
d5a26bf7622191d2a0edafbb32544af6
acabddcc2332a70020334a7997b1055174fb5db1
36186 F20101221_AAAFRS krediet_c_Page_089.QC.jpg
cf90a3f54c1bf59da2cbdaac728a87a8
a86398c6289ea99f3ec8b8728195cb761cabf17c
1051926 F20101221_AAAEPF krediet_c_Page_124.jp2
eafd4cfa28e3fea080bc7b8b882730d9
12b6870c1b7994ea426359f05e04aecf85fec614
2507 F20101221_AAAEOQ krediet_c_Page_146.txt
64578418a2472ee858974f887a783243
a76df06766e6f274b84b2792bba6796442df9195
36483 F20101221_AAAFSI krediet_c_Page_106.QC.jpg
f9c90369417fa411d2b4b126b825cdf4
6b651e2f7887b2ee67e39803758322869e402d74
36510 F20101221_AAAFRT krediet_c_Page_090.QC.jpg
3f74996e3a1c4d65f4d5975fe648a111
b77834f2a3cc0a7c9fbeb5ce499c9db5d69c9d73
24765 F20101221_AAAEPG krediet_c_Page_071.jpg
4ca44d00c75d8d0102be4185121112fc
aa677b22438362995bfcc1cf19065b6f94b70a7f
F20101221_AAAEOR krediet_c_Page_105.tif
4e3bc1ba9174f9758a02fac434699c67
fc22f68b2052b54da01812ba45f8722bf18f989d
F20101221_AAAFSJ krediet_c_Page_107thm.jpg
a84d9b76a04751c6a67266dc0b8108f1
e874cdf8e3038a771acca9357798794bfc9b2199
8867 F20101221_AAAFRU krediet_c_Page_090thm.jpg
40556e65abaa0848d3821b677e44c1ad
df5379a1928c278f9aab3d56129188e9d61f5e11
F20101221_AAAEPH krediet_c_Page_086.tif
7bd4af547468726f70c7d8c8f142b9c3
9088e4e71fb387a02381f2a9ffe8910fb0ace60b
53127 F20101221_AAAEOS krediet_c_Page_035.pro
25055ad56a900b7ba5bcdc19251dfb18
b4c19ef372937fbab30962bf180ba6f2763ca3a7
36118 F20101221_AAAFSK krediet_c_Page_108.QC.jpg
3c643dde76089958480befa1a4e3dde7
5008790ba81e16273587fc2fe930c6ccf0c36dea
35774 F20101221_AAAFRV krediet_c_Page_091.QC.jpg
3596c13fdd58a01581d8e096a2e56d64
2fee383e95dbcbee4589d829c831d22f67f90e93
17003 F20101221_AAAEPI krediet_c_Page_004.pro
4c5a414e29d56aa4f711f384137745c4
74bff752a982b2e2708778f359677d28bbdf0f86
57188 F20101221_AAAEOT krediet_c_Page_030.pro
7b137fea7b0288dd013a6f986ebb737c
3327330e6ed5088e099a340d64a9e46f5d99a975
8841 F20101221_AAAFSL krediet_c_Page_109thm.jpg
fbb5d7d271444b74d55a644227a271ee
fe91592e798e2d6a696b2994468e31f58b85e1c8
4278 F20101221_AAAFRW krediet_c_Page_094thm.jpg
818b8a899da5e6371a7c5f34aa1ba94c
b07f31c434b32192ec659f6f9ab99d4732a50f24
8161 F20101221_AAAEPJ krediet_c_Page_055thm.jpg
15cefb8bce808b05fd9c7d34c31adb85
8022d9df19cd3b291e4fd37a673faf94278fa0b9
F20101221_AAAEOU krediet_c_Page_116.tif
2e0f06c15d1db2d03f51fa1702f0d23a
e45093431274517fce52f27887a376a9a49d691d
4578 F20101221_AAAFTA krediet_c_Page_127thm.jpg
bc9af61a0a2f75b996b0479b5391c876
4eec86c6e03fef8a11df9af01bc2dd76fa8729b5
37427 F20101221_AAAFSM krediet_c_Page_110.QC.jpg
f08d2af5424be4d9dbd4f91040da1427
358896c03366c4c2d64651c4d24e78626c03c5f1
6298 F20101221_AAAFRX krediet_c_Page_095thm.jpg
75d8dfa8231f65116cca86a8cf66d3ce
247c01487ebbb5e1580a55705aca83e58bbdf813
1051968 F20101221_AAAEPK krediet_c_Page_107.jp2
04715562b605a8480609d5c27fd6d93b
0a143104f01c54840ac12b96960a7561ad57ebc5
F20101221_AAAEOV krediet_c_Page_019.tif
7c4255781f849286536c93a047cd68cb
7bc0b2a09cc3ce307f5d131fe1cd85fa3f87d14e
9082 F20101221_AAAFTB krediet_c_Page_128thm.jpg
7748ff49271c7e4a14f1a0929b7eb5a2
ea4d899fa90e7ab523134a4339065edcd83288bb
35117 F20101221_AAAFSN krediet_c_Page_112.QC.jpg
4760aa5acb4448c036750e6c24912032
db601b81f5fdb8f75db106b8de63c53b253ef87d
9429 F20101221_AAAFRY krediet_c_Page_097.QC.jpg
462b2b26c61dd2f61f5f30e776aed4dc
3f5b54d632fe337daf3432972f9151b31fead073
114182 F20101221_AAAEPL krediet_c_Page_096.jpg
7f55ff3027344b1564a686175cf40261
e62ae8b21a6eefe4b2785a5d4a3fbba697f4d35e
F20101221_AAAEOW krediet_c_Page_132.tif
cdbd46e522fa62a6c5aef7c8b1de85c9
d0a944fbcc697c6a2d4b175f45cd421291ae8127
38355 F20101221_AAAFTC krediet_c_Page_129.QC.jpg
c95d4f11ae4c722c23ab7a943076a4ae
f5e2123f1c877965f739f83096f2a40585c5b264
34621 F20101221_AAAFSO krediet_c_Page_113.QC.jpg
20a5b867ef5b4455ea97a2ae8cab7f3f
ccd4f0412f42680559ab9897179daee473cf7d92
2780 F20101221_AAAFRZ krediet_c_Page_097thm.jpg
ac25ebae420e59cfa5f6bde9950d5b4e
92e0afdcd912888b27b3993604e3e1e73ba0ae24
2045 F20101221_AAAEPM krediet_c_Page_069.txt
f99680ec15bbe601df8ab4d1d0b9f98c
cd5849570c4bf38c7faccc3ab4a27e81ad73500c
54481 F20101221_AAAEOX krediet_c_Page_088.pro
3fc7871e449bcd52f775d137ba2b6edd
e6795a503bd8a8d89ace01726112d6e9de42b4fb
55218 F20101221_AAAEQA krediet_c_Page_126.pro
b1557f2646d161023acabab53c6e80cd
d02d82f1b6430f1cb24b86aa37b8a26af7a544b3
9176 F20101221_AAAFTD krediet_c_Page_129thm.jpg
770a2c26df94914a4d6c8d9c321ae91c
24cb8c19c5fff1b34c03ea40813191295a7bef53
8674 F20101221_AAAFSP krediet_c_Page_115thm.jpg
76817bde0edbaa88ef84a5bbac6081e8
c6ccb4809f6e5d5754e70bcd8533f2de7b3d78fe
51342 F20101221_AAAEPN krediet_c_Page_073.jpg
8a9d320d6ec5c1ecb9f709218abca50b
d2c43d8a0e992a09f7f3be33660c4a8c840e7b3f
9065 F20101221_AAAEOY krediet_c_Page_086thm.jpg
51fee156dea6f4c17bc8c6fc98455553
fb1f6692592ebd4e719d5e765abaa4626cb9e2f2
2797 F20101221_AAAEQB krediet_c_Page_133.txt
5ea04586a71d59dc8d764229eaf3c16d
ae52330e154163d5e36260fceb0c8125b330b3af
37841 F20101221_AAAFTE krediet_c_Page_130.QC.jpg
bec4f0f2ee63413931601f7540142eac
785497a83600fcf7c0594146cc11067b18b5b08e
8811 F20101221_AAAFSQ krediet_c_Page_116thm.jpg
c881942eba7587a59992bc0414ae3c48
55dcb81fafadce493b798aee57a111cf1aebfad5
25265604 F20101221_AAAEPO krediet_c_Page_097.tif
f966b348c2c7c5c3bc18894c7ffd0392
90b35418a2cee7828425a93c44b6ed13165c1fcf
36103 F20101221_AAAEOZ krediet_c_Page_006.QC.jpg
429cc93097e87c23d7e82f8d60ad63de
8d76a1d4d736ce96a5bc23cceaabf519d16caa1d
F20101221_AAAEQC krediet_c_Page_107.tif
fde2a55a988ca074f2b45884d869f907
d9a1db51dd3ed08253794b74612ce2eb7a905da3
9348 F20101221_AAAFTF krediet_c_Page_132thm.jpg
d9f9afb1ffb00a06bf522c5172a5abd1
68df42b975d9ae248cf78fafa2c4b83523ce77df
765639 F20101221_AAAEQD krediet_c_Page_119.jp2
66e934b2a54e0b0e0352b9ba0360febc
314574534ac52a97766d48959d2da8a84a7d44a3
9214 F20101221_AAAFTG krediet_c_Page_134thm.jpg
f9564df326eb22484974e16f9ba1d892
185b6a1ab02c52285b7938c7fbd2faf3e85ff062
36475 F20101221_AAAFSR krediet_c_Page_117.QC.jpg
cb6fba6a5218937557816be357c611ed
9ca050f4b4b11905caefeb029dbbfe14844d7cd9
9143 F20101221_AAAEPP krediet_c_Page_028thm.jpg
2284866d9278e453deaecd9065c52564
cf8e7d144b3a375a0d026952e480ac521aca5c9b
35286 F20101221_AAAEQE krediet_c_Page_027.QC.jpg
ec16ebadfae6dcfed9706bfe026a4806
4ae420987af8cbd6b31bc872938a8026f466f4fd
38604 F20101221_AAAFTH krediet_c_Page_135.QC.jpg
1232179ff503903cd76ecabf6cc94386
d48613203fb00727008d1e5fca629c21c94d0bc4
8866 F20101221_AAAFSS krediet_c_Page_117thm.jpg
4b4a19ed2c977c733cb95be961297e56
9e524675819d85b3eb9a50372adba2a5f80adbee
489093 F20101221_AAAEQF krediet_c_Page_073.jp2
a43095540fe2d238b143a764a00bcb0c
cc484572a28491197057f495495eb9abeae97514
113284 F20101221_AAAEPQ krediet_c_Page_024.jpg
83ca09b313b8ecaa707d5b38c9ad7039
ecae3f29bbdb665cf42e000a0071a356a57788d0
9112 F20101221_AAAFTI krediet_c_Page_135thm.jpg
bc222a15de2d65b3b87e1e6b82a4ef92
8ed90e024b31cee76312cec19501fd087575fd08
19940 F20101221_AAAFST krediet_c_Page_118.QC.jpg
7679fd97f42f4e230d7f29752a6a77a1
f4eecf55ce5c981efa6c5deddee0627dafdc7dcd
8902 F20101221_AAAEQG krediet_c_Page_101thm.jpg
c819478f6ffbd127dd21bf5c44b4e625
d66f635072d92ae8df88a84bba5d52129104b9b4
1051932 F20101221_AAAEPR krediet_c_Page_069.jp2
c54014ea67f1ae3e6cfa7f5d238a3649
3cf0a9e6ab81085f8c4e2f46509cda55a6fdf63a
35528 F20101221_AAAFTJ krediet_c_Page_136.QC.jpg
5d3fbef150324b7a5107a7d705d1190e
be3541da5d4b691f7ad4c42f0e69647170b74fc8
23842 F20101221_AAAFSU krediet_c_Page_121.QC.jpg
5e8a713b5beae0e30b550b35d0e641ba
6e6c4496cf8bfb762c8a868c75e8c07f5e5a49fc
2115 F20101221_AAAEQH krediet_c_Page_107.txt
42e1c74349197da07da81449330c604d
b256196f7875dce35ba350bb200f0adcb64e85c1
53138 F20101221_AAAEPS krediet_c_Page_063.pro
61e8480c6fcdcb69fa7d111e3e186a31
763b74cc41e9d330b7923928fb64403a2319b9d0
8843 F20101221_AAAFTK krediet_c_Page_137thm.jpg
de74511e4ed28c675005c8c914cd59fe
c9186646f017834cefd3f4aa0833e91c8e7934ee
8506 F20101221_AAAFSV krediet_c_Page_122thm.jpg
7de75f9e2981da8053101fa005e2dd6e
78fe6c482f8cea1ce5565848d2f4bb29c89d6b9f
89112 F20101221_AAAEQI krediet_c_Page_006.pro
251ad6b6a4fd5e7cba7abcf63fe2e84d
15a9d7d78fda3e56a41f425e1cd89217f230e97a
55093 F20101221_AAAEPT krediet_c_Page_043.pro
49f4590f785c325b5e4d03968aa82153
cedf2a42b8ac933145208ec456598a68c5ece2d3
9273 F20101221_AAAFTL krediet_c_Page_138thm.jpg
87d78490781c9297ddd957bb8ee2ca1d
1e672459d9fcff17d68ca4398ea1c9c66c541a12
9034 F20101221_AAAFSW krediet_c_Page_124thm.jpg
b565b0336f5bb53e14c8066d2bf93d2a
95327e5dd277728a6665a61342d0d07fa423eb0b
2144 F20101221_AAAEQJ krediet_c_Page_110.txt
225ed3d213813c78cd0135cc4f7104cc
74ebdc1bc3539a3cb910d9187adccd19042b17a1
2180 F20101221_AAAEPU krediet_c_Page_068.txt
a9e737e024f61bfb6be62d9fd9c6f56f
e4455e1194279d20286ce2a54eec84d85cbbd4c2
9288 F20101221_AAAFTM krediet_c_Page_139thm.jpg
cd3400dc6c1d5949a62e0ae889825ab8
68d8577cf7c4c7c85e9e99b7dd6d835acf995c77
37475 F20101221_AAAFSX krediet_c_Page_126.QC.jpg
fd9bff1e39cfba6fe78713adeff849f9
0d5cfc46d821e378e52a52f7ae86ebc623c83038
F20101221_AAAEQK krediet_c_Page_143.tif
dacd2cfbd1b36c2f4ea590404b84bd01
0fdcca7a4d35ae0a57604a2c9acdec53eaa33145
34936 F20101221_AAAEPV krediet_c_Page_128.QC.jpg
cf62cd4c1672d2735a6420cc57861bf4
b95b4cb3478ec26a9adb0d9896d119cbfcb7e544
35822 F20101221_AAAFTN krediet_c_Page_141.QC.jpg
e5b880f7d8dceb12c464b069838531d8
82f4c40b81348bba51dab559ba91c0ae2904e506
9005 F20101221_AAAFSY krediet_c_Page_126thm.jpg
e3bd1804d6c3f8d1809afd125c83b3a5
ece803aa3f6c3ad8f10fd952bf5da079ae4b6827
115629 F20101221_AAAEQL krediet_c_Page_083.jpg
b7948236c5411b5b57adc173181bfb6b
f163c806ed4e0fd6dbc10cb8f417de135aacdc7b
9019 F20101221_AAAEPW krediet_c_Page_093thm.jpg
09e82d9d69ecb5cf7cabab1dee47444b
c3e3f4a24438276df7bd0344c450aaa3dcd42d62
9146 F20101221_AAAFTO krediet_c_Page_141thm.jpg
6af9b2a79a77752a5f0c1cb61f2f538f
3ea7390a0f85e5e04115c98d7956d7c9e91b1b9a
19206 F20101221_AAAFSZ krediet_c_Page_127.QC.jpg
27baa5958bbb877043119b27518ac504
454e7c1ef6ecff561181fb0f396b5d14358b330f
729544 F20101221_AAAERA krediet_c_Page_007.jp2
d84480450266ea5268e0fd0fb8f21b9e
5cab865b696621cf011f30001936ad3a71302508
1051953 F20101221_AAAEQM krediet_c_Page_106.jp2
9d4d3128664de2ed786852310a94b761
ac669a88e141784ff22b4c987d08ddf2a7432059
6813 F20101221_AAAEPX krediet_c_Page_119thm.jpg
39a7e8fe1bb1b53c11e8a8ea2e4c2a4f
1ce0b5ee26ca39421da5f09a44c20825372e008b
36858 F20101221_AAAFTP krediet_c_Page_142.QC.jpg
f98f676a6d8e1f12c175c790309bf2c1
eaa43e87268a07f488c7082dc2717daba27e4472
F20101221_AAAERB krediet_c_Page_020.tif
4365b67ae971f8e124972c0df5be1503
c41955e797d763360290f312fcdd91371a1f2081
F20101221_AAAEQN krediet_c_Page_001.tif
6fa5ad67d3b902f1171fd0fe51d4eb98
af7cb93c53d836b20ad6a74806f6f670e8f78e3d
118326 F20101221_AAAEPY krediet_c_Page_128.jpg
0dd41410791205f9e1f6ec5196d92537
5ddd52ec82bc1f9a04a02921ad035fe8e49e1062
9235 F20101221_AAAFTQ krediet_c_Page_142thm.jpg
122093eaaf9324ebcb7d0a92b4f65966
518592883cb862dec47606ccad09ca3f5c3f3cca
37209 F20101221_AAAERC krediet_c_Page_088.QC.jpg
a328fa9ea629f7db9ff2a2f7b18dccc8
2e0625b8aa000202c60c82b7ab0baaceca58cfe5
F20101221_AAAEQO krediet_c_Page_046.tif
71ceb06b6fc6984b30289e5c48b0991f
af58c6d18b3b90a2b5e4b6c0503c9524d9a8efab
106817 F20101221_AAAEPZ krediet_c_Page_035.jpg
8e0a17c7e7453a27a57c4a689579098b
6c3de1c2a1e623b3a7c7f68074f4aaa5c9516350
8886 F20101221_AAAFTR krediet_c_Page_143thm.jpg
64c6b99c29e065af2b8a13fe11c1df01
ef38f179120827ff6bce77b863138899ae70d3ba
F20101221_AAAERD krediet_c_Page_106.tif
df1fa3e3a2f0138f722c1c1358a8b409
a8894cd4cb9f21c7d7f024c2796528b18405dab9
1051977 F20101221_AAAEQP krediet_c_Page_129.jp2
4f34f28353184e992f72f65a3fd1566c
112efb60cc116745488a1030b418625c93f429f3
2745 F20101221_AAAERE krediet_c_Page_007thm.jpg
be2948780f331ad6c41036fd019b14f8
e1cfc711bd1b68eff1d5fcaaac7c08e7d6c7cd92
9168 F20101221_AAAFTS krediet_c_Page_144thm.jpg
0b0dc4c21243985ce086120287da37c2
4f22431620d8a198218cf17b3cb9f68991b256ae
F20101221_AAAERF krediet_c_Page_081.tif
8e8c4004e7151ee3e0b64b2e31442018
6d3b28a114668de5cb9e11ef1873c310506f9989
4804 F20101221_AAAEQQ krediet_c_Page_075thm.jpg
4e2e6671674cc36ce9e4b293e176635a
759ae50fcfa171d58cd330f15d7b1234b627b8b2
37417 F20101221_AAAFTT krediet_c_Page_145.QC.jpg
3f9704b0e7d0f669e5ab4c8be02198d3
d2de5400de4d10313ddcef0cc36645adde483718
1051980 F20101221_AAAERG krediet_c_Page_082.jp2
7d9f910ae8b9119b175dbe7c4254f26d
0ef09bbf949b01e8bcdc1891d396eff0d4ade4a3
982 F20101221_AAAEQR krediet_c_Page_099.txt
ad2190f4475a8683bace22117c307daa
9339bfc1ccc6e833627ad610f78857e33d67e4fa
8734 F20101221_AAAFTU krediet_c_Page_146thm.jpg
39a9194f631b999a910b4fb9cc42261b
73b69361a393a04a5be0d1adf1cfb4f4bde270e5
110895 F20101221_AAAERH krediet_c_Page_025.jpg
18f1bf343672cbe260bafc6198424f28
ceeeba3dbccfd3db5027b46e8bf316b492357f19
113586 F20101221_AAAEQS krediet_c_Page_092.jpg
e68cbbcad26b49605d0176bc11e9ee07
f4c237614a476582e42967156c83a5df0f8021ab
5433 F20101221_AAAFTV krediet_c_Page_148thm.jpg
2f6616e4dc95a34ae120cd04f4710ca7
23ecc3cb62abd3f126c51b4b7c50b816032687b0
45766 F20101221_AAAERI krediet_c_Page_099.jpg
1891ed86729a7b5018d90385f281589a
6056a3b4691ef8424fb2853d331b49a10b7aaf5f
57256 F20101221_AAAEQT krediet_c_Page_042.pro
8eb29361b561d1302f020fb27966ca01
9612c65a7100e3e020cdde3de060dd94a59f9aaf
171985 F20101221_AAAFTW UFE0022380_00001.mets FULL
89921f1c1c0987098c2267c4a7c8ed5d
78eca402c15f45b54b78f9c49b0bcdac44d4561a
1051973 F20101221_AAAERJ krediet_c_Page_142.jp2
f739beae451f7abbce4975f77969218b
82809a1cc9fdcd39d49bef33d932351ad032001c
21067 F20101221_AAAEQU krediet_c_Page_148.QC.jpg
7f0325c51f5bc8ae247f7baca3fca518
a32f007748e4ac1bc8bb2d065ba8db456f2e126f
34594 F20101221_AAAERK krediet_c_Page_122.QC.jpg
68dd07ba2fe1ae2d22b88e5e8b2bb637
07cd834250d1b0b83812a75e2dc81982b6c8817c
36008 F20101221_AAAEQV krediet_c_Page_115.QC.jpg
f4d46c94ea0cd95185b1412ce4f88403
284a5a8a0e6fb8ab51ce3a3e70900f4d8ebb83a9
903848 F20101221_AAAERL krediet_c_Page_095.jp2
31da8e356b868d323f1d66e138b784b9
b25759356e451fdbf868acfcd80d2138246f4880
F20101221_AAAEQW krediet_c_Page_079.tif
a515bd467c6a66bb07363c786ae5b253
37156dd34ce96a76fe9fcc6bd912b1b660c5d249
37191 F20101221_AAAERM krediet_c_Page_114.QC.jpg
f1ea0bb9abfbfb0984926054440d3de3
45af62c7c3b7856dd187297adcee5db9b5900374
F20101221_AAAEQX krediet_c_Page_030thm.jpg
b2cb22de0f1bd09dd766b277fb643f42
cd640c51afe303c87d115326fa8eaab0fc17bbf5
3290 F20101221_AAAESA krediet_c_Page_003.pro
e91b1dac55e66d8f29940fe460cf792a
d67609eec73e08571eed317e73ae601e1968a274
45924 F20101221_AAAERN krediet_c_Page_010.pro
2f3cfca95aaeae8e49e193f07af9e1e4
fc5ccf36ce9f77b04319ef65a58dba10d452e4c2
F20101221_AAAEQY krediet_c_Page_013.tif
4ca72b876e8bf6c35954e0c3b3e0ac3e
8204c8001db28fab1f2729375836d0c105b62b0c
36434 F20101221_AAAESB krediet_c_Page_067.QC.jpg
70968f0b50479cddcc728962e50d5fcf
f83e10c32f6d798b992086417fe62769297a8831
53919 F20101221_AAAERO krediet_c_Page_107.pro
4c858f0dd3b5daac0ff860f91520a0ec
111c3aa1005ad62d861482e606d8442d70db5c5c
F20101221_AAAEQZ krediet_c_Page_008.tif
a3d30ed2530a5ec52d32b009dc7abc29
9fe36b339fe83b93be563b02b68eb509cf6714d6
38096 F20101221_AAAESC krediet_c_Page_030.QC.jpg
3e31f3184ff1f0b0fe00bb788813dd19
58197d2fa38efa8397c6767706293ac0a1b348e9
1051939 F20101221_AAAERP krediet_c_Page_108.jp2
bd3762a224f2822953c8138c76258231
50f4f548bf7d2d03e99b489ee15d19ed0539dc40
553944 F20101221_AAAESD krediet_c_Page_070.jp2
b8605a450eaf94c25151a4ab670c98a8
cf66d0002ffc90dc5bf4968a839d55de4f85c015
1867 F20101221_AAAERQ krediet_c_Page_096.txt
940a129d8a7f9c4a7cca23cc26a0d3bc
3e8b26f1698a3588d2f31d77280be53e2058915b
37150 F20101221_AAAESE krediet_c_Page_020.QC.jpg
db838a72d05bdf7290e9dffa78811aed
15fb7609e286340c125f5e604452b3f4518a795b
952 F20101221_AAAESF krediet_c_Page_098.txt
325619158553536f28d008529e8e4165
38d87fdd44973cd7490a532dc436023e809da4ff
34541 F20101221_AAAERR krediet_c_Page_016.QC.jpg
8f26f8f3b988a303f19f655bff37db52
c7d6f2f9bd5592f350897e901470bf89ed2f1f7d
112411 F20101221_AAAESG krediet_c_Page_104.jpg
ec99c254320183b4e87595de09bcfdaf
a1267bc3bb32f8dfc5fee65b0b9392997c536715
1051924 F20101221_AAAERS krediet_c_Page_067.jp2
0e538ef6e02f92cc7271bbc3566a0b55
f9901cd3e6958ea16bab208bd4268018e5009fb5
7820 F20101221_AAAESH krediet_c_Page_096thm.jpg
53b2c8e29e9c44bf9637a0b140472c2d
159a058b6a850d99539eb49fd4d29970e695b316
2709 F20101221_AAAERT krediet_c_Page_145.txt
78f0ef467df124643fc5aaeae7c9e82a
61873d691e6489563f88a845e2ffdb21d9eff573
1051978 F20101221_AAAESI krediet_c_Page_138.jp2
1a83b99686da11ee95f8008f3db551ce
a66996c047c095e9cccdcb2c86c2e814f6645339
2185 F20101221_AAAERU krediet_c_Page_022.txt
c6bd0bce5fbe029feb624b6ba0a15c74
4ff7feceb0886b5ffcd58d14cbdee942f4a10f83
F20101221_AAAESJ krediet_c_Page_045.tif
41d2cc3d5caec6af8305508dcd49bb12
bc62628a055dd8faebbba21ca8d1a3f67e350f92
1039673 F20101221_AAAERV krediet_c_Page_051.jp2
96c776a38ea3ef790e7c3e9cad2f6a93
eb1e1e68573809fb26eaddef2d769111d1001950
8873 F20101221_AAAESK krediet_c_Page_091thm.jpg
a73d3ee2f143b3534f4dd745347d6eba
796fb6a59d439b69a2d715d03de2d55c59513736
113449 F20101221_AAAERW krediet_c_Page_038.jpg
0a3e57a7e8c5d2115c67d5dcb0907bd7
f5dcf0f1b527367943277a579f02e9da4ad8da74
F20101221_AAAESL krediet_c_Page_022.tif
d7f5bec728535eea9b6d4f65d390481f
fb3183cc14c7efa2a67ae1585863d4cdc104cd1b
1616 F20101221_AAAERX krediet_c_Page_049thm.jpg
de495c130f941d1d4b1e5cd5da219162
702300ead22354e33f2b791b0cd407d4162f0d7f
F20101221_AAAETA krediet_c_Page_142.tif
d1c86440e75fc4c11bd210a83d8cd731
060b2a5be6ff0cbf2669c3fd0f3a48f6d53df380
2231 F20101221_AAAESM krediet_c_Page_124.txt
b75e06131452b09dcfd5507e2f17a2ed
e6aa979822ca279aaaf0908c269623e1c8958cc4
36301 F20101221_AAAERY krediet_c_Page_019.QC.jpg
9a9b057be59895d81139ad44427654a9
7d6d9904aa7ee8eed90f248fec11edd8dbb67b0d
1051971 F20101221_AAAETB krediet_c_Page_057.jp2
db8bba8e6f5fcb97e833b57043062176
2c5593b8413d18346f791d2feb760f533f22e15d
20491 F20101221_AAAESN krediet_c_Page_075.pro
39634c8100ace0b57108824dbaf913d6
b4e0aa0464499ef7ea3faa3cdc0959e0279a8af0
F20101221_AAAERZ krediet_c_Page_012.tif
586c06004f75118d4383f99680e17c34
fc0da3fe2b429a69c9966cc62bf99e4fee4d24aa
F20101221_AAAETC krediet_c_Page_049.tif
858233da5ff07333406f62e97098668a
e07172e94d0ffd0a1997c16cec286942b5e5f7f1
4425 F20101221_AAAESO krediet_c_Page_037thm.jpg
a258dbb318f817f2d0a06e21d38fdc7a
222818730a583c571580da0894c09abb40be614c
8931 F20101221_AAAETD krediet_c_Page_123thm.jpg
67c2189bfdc59750d32081d8bdd185fb
bd82d1bc584c7f93b7c81e3d419e809905ce5ea0
F20101221_AAAESP krediet_c_Page_038.txt
58f7da45ab5b26a7064e8f98b85c4885
64732f00e7f62b55f7127f005e1224c5b83be047
F20101221_AAAETE krediet_c_Page_054.tif
b16baff81c9478d6e543879f33574672
b5dc9db22382181f22aa679e1923e107788b394e
1051911 F20101221_AAAESQ krediet_c_Page_005.jp2
ed93c53fe32fa8619d52d88b82942a26
8929dfbd5970e94b25d4432a67fa1b797a375ca0
33861 F20101221_AAAETF krediet_c_Page_037.pro
e1dddea6ccb485c18c0a0558bea53852
3f45b0c5d33e2dba7198a6129b950708d0f73ac4
17219 F20101221_AAAESR krediet_c_Page_078.QC.jpg
91d3ca5677bf063338de2830ebc67cf5
0a2885b7768ef8ce464e1f108a0a9b305f37bd1c
F20101221_AAAETG krediet_c_Page_089thm.jpg
f64c1c72c9700786c38e3b5be7ba9f40
80f0b29585f71c8d6db64e80f69ac5929af60fb3
8344 F20101221_AAAETH krediet_c_Page_069thm.jpg
c616499c4aea248c1ca9a223e058c2ae
ab897e889d4d5c94a8dfb4d6d24877e98bd03224
F20101221_AAAESS krediet_c_Page_126.tif
77b710125564cf6e8092c5593d630d44
5f11d42e775b6289b941a9f375eb10bfbe320f04
77400 F20101221_AAAETI krediet_c_Page_119.jpg
e4c2cc9f6caffefda4811dbbad0306e6
96d0e1b8d8fd605d7960ce10adf38eb9c587febe
54121 F20101221_AAAEST krediet_c_Page_093.pro
3ca6391e55d7aeecae575d12f737f286
6e60519afc24fc82757613093939bb599fc8b3bf
2010 F20101221_AAAETJ krediet_c_Page_010.txt
4ddd7b83aee56ff364d9c4885b118ede
65430811151c2f4523549aa99a407e6a2579f4e9
F20101221_AAAESU krediet_c_Page_125.jp2
62db58f731fbe2fb720cfc8aa3b8d043
d969bc36ad1b959d2a99d506256537ffb836c1a2
13699 F20101221_AAAETK krediet_c_Page_077.QC.jpg
d9277454048934c3c00494d5a7ab27b5
f586a212742433bd7e4afc81860438a1f5689b86
2725 F20101221_AAAESV krediet_c_Page_139.txt
eda79b18d67bf71ce21b5972ac8b1c9b
aa29d5e3ec62da236ee56e4a60bfe500d07d19f1
1051967 F20101221_AAAETL krediet_c_Page_044.jp2
c5616ef3bd180ec8eba738ba2f49cd85
bd71d6ae88034c677c5d288159adcf5ca382b677
36926 F20101221_AAAESW krediet_c_Page_068.QC.jpg
d48e90bd7c3a0c6ef806c242db1db4d1
f0f631215d53a70c03d166c805e74e9da97a9f29
36465 F20101221_AAAEUA krediet_c_Page_087.QC.jpg
1cb20ff710662b4ac539d07e9c0774f5
b17537875c7792bc315f53c7596b7fe23ae2e633
F20101221_AAAETM krediet_c_Page_098.tif
8ade465479cec6fc95de882ab95526c7
a9ae04674f60d8ba716488273b72fcf64f4a9f9e
2194 F20101221_AAAESX krediet_c_Page_023.txt
3740a714af0adf43fec07f3f0da0a108
e62cd0e7e5e882dcb128a09bda4ced5f47e97748
35824 F20101221_AAAEUB krediet_c_Page_084.QC.jpg
a9ea913bcb3ee7c953d3b5dee9b670b1
1ed86d99bae2a95598eb4720d11bb17a58ad7ba5
F20101221_AAAETN krediet_c_Page_018.tif
c42c8407a79c5c143fd53b19916b443f
70b8ca36124149899ee6ba04d45f51a13a5d9ac6
F20101221_AAAESY krediet_c_Page_017.tif
a70be354f0290379b8c4061808091c94
cf9aebe2dd0f92c9bbdec58f3ecff6f4aada49d5
1051965 F20101221_AAAEUC krediet_c_Page_112.jp2
ef6e2a8e7008442eb4abeb7eca94b6ad
17731c432f379fc1a7cfde9805935848101746c1
1942 F20101221_AAAETO krediet_c_Page_047.txt
a7ca9b578d15e676161b9630fd1e129d
bb3b5d5178f63af3f1366840a99c5328f90fc223
F20101221_AAAESZ krediet_c_Page_023thm.jpg
8dbec31ccdc9d9692b72b45bb52c6fe9
ce79400534ba452ea30dc50e4e3a150f91c88a13
713 F20101221_AAAEUD krediet_c_Page_004.txt
a936a7960aefdd84e715a727409dd9f8
f4cbd370a2755324bc4a566224b14f1781981aca
F20101221_AAAETP krediet_c_Page_120.tif
af9baad2d1c9efb1c6427d9aa6314c70
808b0e4f04d76c3db14643e848d450bbc106edf1
56510 F20101221_AAAEUE krediet_c_Page_044.pro
f8f68f88a5c84011dff9ecdd2687c91b
f9fd42e25cf9b63ecce119adc582e0fcc0252c9b
113415 F20101221_AAAETQ krediet_c_Page_068.jpg
4a4ef9340d36eec05cd9f2feb84bd1f9
7d871ab3439c098a054980097d4991de422da2fa
8196 F20101221_AAAEUF krediet_c_Page_047thm.jpg
dd7459a6ed591dfa87b57759f3ce4063
a0d3f7bfa2c8702101dfc5d5385b0725db458dc3
106674 F20101221_AAAETR krediet_c_Page_125.jpg
2d20dad7311348af593964e2c7117e26
57724145c281430849b9cac6f20c3e0da4ec0e4c
36346 F20101221_AAAEUG krediet_c_Page_138.QC.jpg
a6696d53d09fb95fa8c59962f32dc724
d5d799b977a2c917249e8dc7777714db36080ee9
52732 F20101221_AAAETS krediet_c_Page_080.pro
941cf95a3816abc9591ebbb1801336c8
b6e1af33599dd0702de7efa28c37a3bda0599bc9
112038 F20101221_AAAFAA krediet_c_Page_043.jpg
510c9326b56bed1d7e547d6061cad546
e2bed7489004c658e4092daefc6f45ccda05c809
113413 F20101221_AAAEUH krediet_c_Page_103.jpg
cdfcd5de921927713deeac8ed598eac9
072c2fd372dcf997264462f9062794a492898547
59370 F20101221_AAAFAB krediet_c_Page_048.jpg
f9b4552d5ab44e6141cae8b6644256b3
e366f2536dce56ef38e376ea276fdde76c2a6e34
F20101221_AAAEUI krediet_c_Page_066thm.jpg
3a9eac8175fdb1f812d570c85e12d96a
d94448104e710ff0ed34b31a1421839240447762
1629 F20101221_AAAETT krediet_c_Page_036.txt
bfafe55cce2a7d22818a92f8bff36478
dacb02e291fc41d231818b81a2eda17a0bb0f5b3
5448 F20101221_AAAFAC krediet_c_Page_099thm.jpg
5a1402bf6b6d8b33c1ae464e704547f3
05ec5d81dea5c2a102c64799f92ad5b6a9c51996
F20101221_AAAEUJ krediet_c_Page_113.tif
50d6c4196ca7b8fa5b20bd0100f50348
521098179a8f88ec51fdd99a66ec474d235ced02
104358 F20101221_AAAETU krediet_c_Page_122.jpg
480ce5239c388ae78d514043479d2513
99f71b4a352990b12d6dfae124d5c8c26bc40ddb
2229 F20101221_AAAFAD krediet_c_Page_044.txt
f104c2fc41c4d8bad06eed371934f7f6
7a00970f4cb05e597f282420391c062d4146beca
F20101221_AAAEUK krediet_c_Page_130thm.jpg
d7f38cfd7820ee98497715974c025ce6
1771703e5baca22d5d1d2874e6d6bb72a5ab8d93
27961 F20101221_AAAETV krediet_c_Page_005.QC.jpg
c400effc0cfe9f9fd6c41c38f0e00ca9
6d27a8c65817c353e5cd0d37877f83527ffb42e1
2116 F20101221_AAAFAE krediet_c_Page_084.txt
6c7f7d5486a21121bae08ee7d1802755
0e23bc942359209be0964535211a493bd2d5918f
54863 F20101221_AAAEUL krediet_c_Page_108.pro
c2a47b4886b6c6a704a9885a42c778d8
dcc8a1668f7372f154aa9f242ab2cf528d36a894
42305 F20101221_AAAETW krediet_c_Page_007.jpg
0ed25eebb970f142fe4cd3f0482dd7bb
fc8d6a7ddc14c1bf4db4f7c6d8169c8b9004b6a3
F20101221_AAAFAF krediet_c_Page_017.jp2
e90a3f0851f420ebbf5c492d944c90d6
b3018e4877c18df2943f854a8f99f9a325eaa3d5
819 F20101221_AAAEUM krediet_c_Page_079.txt
61803418447252689dd880d41ea6323f
2030f1a30af948812eed599d971588c6fc6457ed
4302 F20101221_AAAETX krediet_c_Page_073thm.jpg
7d11e7d55d8ffe82d219a2b5aed66f69
9b773f56b3f28537dcc92a2675c86cb73bdffcd8
36276 F20101221_AAAFAG krediet_c_Page_062.QC.jpg
8abdd69f8b783972414d36b6ec6f61fb
5ea838b9bce094ff0604dda3fca54b53f3dca6d8
2196 F20101221_AAAEVA krediet_c_Page_102.txt
720299311eb209edc46b2379df589869
538b7d94ddf7721610a0c2e59086a8dc84138cbf
51920 F20101221_AAAEUN krediet_c_Page_122.pro
0e00d0a79038e470dcb825885ea9e764
f0d9c8f1af191b68bea4f3bba3eb3e695cfe979b
F20101221_AAAETY krediet_c_Page_024.jp2
9caa69e45dd4bf6fd023ae47eeeefc20
41817652963a544f5dc5d88e5bfc91e9d670cbad
21240 F20101221_AAAFAH krediet_c_Page_095.QC.jpg
73842cb950e0b7994c314838891f59a4
146ac898f8f7f1a14c32337fc53e8b0a381bb9a8
1051889 F20101221_AAAEVB krediet_c_Page_047.jp2
c8a50d251cae2fba02eabe81430e6da4
de1d41c51fd1ad21d203bfd2bf980c60bd85874b
20153 F20101221_AAAETZ krediet_c_Page_007.pro
ce023eb9098253cacb5ecadde2d74665
590fa2272b520fbc0edf9fc138b5bb1b8d4d28fd
F20101221_AAAFAI krediet_c_Page_007.tif
7795e2b1573ec0cba448242907754d05
d182c03e502721341fd5632ce70d73dc43591049
64513 F20101221_AAAEVC krediet_c_Page_132.pro
1f6fcdb8be73b77db7ae82d4560ed5b3
082f832acdfea094c366d10e39d83c7ff03849b3
F20101221_AAAEUO krediet_c_Page_050.tif
563ef234beca991fda4d3f3c969a8808
b866b03717215cc56bc240b45d6e5edd02160397
2277 F20101221_AAAFAJ krediet_c_Page_057.txt
a0483659428a5371e0fced38f6805064
9225d1e8f0cd54299e3ad3ded4df9e066d332a8d
2213 F20101221_AAAEVD krediet_c_Page_086.txt
5f476f8bee343d7565b64d29891f726b
4404637ace71617eec0d556e16a3d46fe1ff24be
35633 F20101221_AAAEUP krediet_c_Page_080.QC.jpg
6547f1f49765ad463f80e935fd4d3fe4
b507a7dae8bd432205d14f4750264f9114cf3f07
109552 F20101221_AAAFAK krediet_c_Page_065.jpg
b55ae0b31e2630c97d4d043e8c0e3326
501bb9bea100edf1e84a5fdbd811038ec5176fd9
112988 F20101221_AAAEVE krediet_c_Page_126.jpg
42f46b47b4f548ec7c4c5d972ae66388
f7478836b9ac91e7e685ebf6752b8aa2954a9a91
51088 F20101221_AAAEUQ krediet_c_Page_113.pro
1b853bd958c8183ed96a1395e23be118
dfa3dc24cc739ada89a8232328d1117c6d5d1401
112396 F20101221_AAAFAL krediet_c_Page_088.jpg
c67a1c14893fb3b33f6d57eaab515071
232465fbcf54337230d0ba87d839b97f77b9ff98
2123 F20101221_AAAEVF krediet_c_Page_111.txt
b8a5f37706aa5dd62ce7c58dd344eb3d
c48733c14d4fcb8bf7affb3ed0cefc5b70082088
F20101221_AAAEUR krediet_c_Page_090.jp2
d53950a19ab9762ceac15615c8fbdc9b
7a2c23b08f94ebd9545b76ebe970787cdfefe43e
63991 F20101221_AAAFBA krediet_c_Page_141.pro
84687fd1b59ca116b974ca8bbb0743a8
e52b31290b2f688aed1f4cf0eaa15c8046c507c8
F20101221_AAAFAM krediet_c_Page_014.txt
fc416d54db33fd3618465585e9ed1771
23309490582ad70fb32c9ca79edd776316d10866
26626 F20101221_AAAEVG krediet_c_Page_036.QC.jpg
b0044879269a7d9be4abdbd23191ccd7
bf1d1e07ed5d8b58a923aaf4f36c282fa61942d1
2015 F20101221_AAAEUS krediet_c_Page_001thm.jpg
46d6bb2385ac109064d38bccb1f41f51
3976ae74ccaebd492e85f8515e4e08cd98d39532
2173 F20101221_AAAFBB krediet_c_Page_066.txt
9fa8aad3376b212ceb4d55cc9a7f76fa
251706052c9ea003213b6b08b747ca7ee94c5508
95496 F20101221_AAAFAN krediet_c_Page_147.jpg
f6ec8d9d17ea1e2f5265b4052462daee
9d18fd6d9b8cd8437dbb50c3d5bd8f78f5ade7b7
54418 F20101221_AAAEVH krediet_c_Page_110.pro
31444f2347ccd2205d7e1d2187e0b708
617fac9869f861eccf9824d8778f8e2b8c537715
36854 F20101221_AAAEUT krediet_c_Page_009.QC.jpg
0a56acd15192bc52449b7eaabc33405a
fe6543c18fef6011ca09377adbc68fa7017c1670
20861 F20101221_AAAFBC krediet_c_Page_049.jpg
d1c1663d019fc08a17b8324a8bad9e0f
c6db3f666b5d926a012ee8d335b37e349ac9f0c1
F20101221_AAAFAO krediet_c_Page_073.tif
294a19f3585315bf6e48860ec6a6ffd4
fc806bca0f83ad0f428757265cb192b54f8204f8
108981 F20101221_AAAEVI krediet_c_Page_014.jpg
ba5cf316e2a6841669cb95d86797602f
a51422a5aa9998a9bf82c580355ec6dcebcfed5a
9028 F20101221_AAAFBD krediet_c_Page_092thm.jpg
78cf18a55740c1ff1eed5b8f02a8893f
cccdb2a46e64bdb9ed9a85dbd423bd2add7e9b35
8406 F20101221_AAAFAP krediet_c_Page_113thm.jpg
7239a3ec411787376b993d67fd53ec4c
c65abe7d22cbf41c12aec0fb37cbf117bf34ed0e
2120 F20101221_AAAEVJ krediet_c_Page_116.txt
ef2cd1ed44bf56486dfc725fe8f3b401
ff540deec8d1edb4cc7536f1f36fc014df9ca46b
57044 F20101221_AAAEUU krediet_c_Page_029.pro
fa06b76ca664ab61638c6dba26f39d7f
c567090f234b9a008106b1731f18ffc2b77876cf
16170 F20101221_AAAFBE krediet_c_Page_048.QC.jpg
b001e77e93b5db6e5a8db44731ec383c
0dd2235641403fba3ffe9dd79ff41f606307956b
115079 F20101221_AAAFAQ krediet_c_Page_124.jpg
8a0d5e7d8edd01d0c2fc91d5b841f0bd
41ba26082598126f53a368b38af9b63a78c4f4fb
8530 F20101221_AAAEVK krediet_c_Page_063thm.jpg
00001126ab2354cc2b275b9fc5242949
e5b7b4fd48b70d685278e5d2671567edf5139b9f
116580 F20101221_AAAEUV krediet_c_Page_057.jpg
2198a4ac61bf0b80dff01ed383820e6e
46a5718921654b9bfe2d281d981d7cef41dc1f34
2633 F20101221_AAAFBF krediet_c_Page_141.txt
2aa0c51bb9ec37c434b7a1368a041843
8da26050db1639b799c2bc0a051f34d361fc33e1
63745 F20101221_AAAFAR krediet_c_Page_142.pro
d658ef81bd5623403a9b91507b124cc8
ba1724d2b693c29238fc86ccb627f8adf597ca3b
405257 F20101221_AAAEVL krediet_c_Page_004.jp2
fa777d204d13500ca284380861ed445d
514f1b78162f3ccbd384f3e69d999311fdf2bc35
18671 F20101221_AAAEUW krediet_c_Page_050.pro
044371b770716be7cfed4c16e5be4300
e1388dd99f15ad1facfced6164d65925ccb94e2c
1051938 F20101221_AAAFBG krediet_c_Page_010.jp2
8ae596a4f5c4b313ca6a0b0e8a151e13
07e339e4cd308e98437648a70f5d18dbc7acc656
2222 F20101221_AAAEWA krediet_c_Page_126.txt
4bfc25462311b32d0000658c1dc9a79b
48d7a0618ac634242223ac79e92214a4a2340322
F20101221_AAAFAS krediet_c_Page_084.jp2
75489a8dcb650e839ff98e07800f0256
e8bc7dc7566a3252200664de28ddb4bb70496e12
F20101221_AAAEVM krediet_c_Page_136.tif
5d1fa7b82ce68c18d779e4fc1b66658c
8a5f36bfa36fe934a1b9783b3d0c44e98105e3cb
38214 F20101221_AAAEUX krediet_c_Page_133.QC.jpg
012ee286359f0da7eec6bd4a996ce3ae
c899c60f1fd99162b6ef81b8a20595f61a135a44
34358 F20101221_AAAFBH krediet_c_Page_035.QC.jpg
154411cc6f35ff775a72e7c29b8aa31d
d6ce62568717fd0e4d580cbde35b0b1d4d31e1b3
2247 F20101221_AAAEWB krediet_c_Page_083.txt
9eb3bdf0ca347d147312381b4bc5e542
593e2cefa3a903e50c33956d49f03fda5f1a53b5
37708 F20101221_AAAFAT krediet_c_Page_086.QC.jpg
eda94909cd0545a49f864597eff15881
14a38a8a788676c22be5c1167aa7dbf1b10a07e2
60347 F20101221_AAAEVN krediet_c_Page_009.pro
480ff81e01590c44769f4abd30462b33
ae00a2502e0a0822df52ff3c98c0d7b5294e56ff
8733 F20101221_AAAEUY krediet_c_Page_033thm.jpg
d5ddef1d65d95fa29703630e8a618bb4
9f3b9b142c7a53f6b2331a578b63b769d811c3e2
F20101221_AAAFBI krediet_c_Page_021.jp2
fc1d200f6971bdcd206526f8addd1746
9df3e109b78fff086a1db834b88aa11e0f71992b
37227 F20101221_AAAEWC krediet_c_Page_045.QC.jpg
ad46ae5d656cfc7a5d6bbe0a6f6303d7
c05eb4ff0ba77c813bd55fcb672f4660727aeb57
F20101221_AAAFAU krediet_c_Page_115.jp2
1bffbf15cd442f0ede3decffd9bb6762
ddb45a4d5c2dbda0c19ea4add54438d248a02c08
883 F20101221_AAAEVO krediet_c_Page_094.txt
f02855a86b7b2eac0a042701162b7caa
f442fa46cb9179c833cfc9f86a095e0be9d40f3f
54469 F20101221_AAAEUZ krediet_c_Page_062.pro
2d8a74af4f829ab5b7703145a254be8c
da1180d28c43d6f76bb845bd88811498cf2a0f96
F20101221_AAAFBJ krediet_c_Page_035.tif
6e822dfcebaacd7863b646f35ead8ab8
980bff9a6c322abbf81c306ef17c7b95e15f10f7
9014 F20101221_AAAEWD krediet_c_Page_024thm.jpg
eaa735386984c8d1f0113e535e314446
aadd99890ff225d6c5bbe0d816d548ccdcfce74e
F20101221_AAAFAV krediet_c_Page_053.jp2
f74f9654f49bea6980adf130463d37e4
a645fef25c52866745f715e5afd7e8455aca40b5
F20101221_AAAEVP krediet_c_Page_080.tif
c38943ab257f2c144712b7a2cfd92aba
b8f0b2b937a15483804e144fcd816db6cde4796d
112338 F20101221_AAAFBK krediet_c_Page_052.jpg
d3138cccd2f533f58c733088c38c7598
27bfb93d1945ee5ef30901979495819d887ef179
F20101221_AAAEWE krediet_c_Page_051.tif
a9cdf5a3881da8ccaadc57ecff9b2f4f
3df5cd0fd8c90645ec01641eaf3927215158a49c
1051944 F20101221_AAAFAW krediet_c_Page_025.jp2
3ee3416f4030bd858f67f9404e24ea33
0dd22dbb3e7d3c2c720aff5932fdec14d18d9fd5
737685 F20101221_AAAEVQ krediet_c_Page_011.jp2
cbe9d600acba79fe456e36e3792220a7
cb9c61ffa67c2845bcc8333e0465ce0224af6031
F20101221_AAAEWF krediet_c_Page_123.tif
679790f38df20d7849620ccbb651feb4
da81041ba742e9b2fe185528285e9557ec9b371d
F20101221_AAAFAX krediet_c_Page_102.tif
80d6413856e39b7046f0df99e2b79794
8dcaa8ba08b949757e6eb029ad856ad99d2b99dc
2256 F20101221_AAAEVR krediet_c_Page_052.txt
e52c1e5ddc19f3f645f94e71127f2d48
010310f52dede2555ba1bc3f8b63377724972a6a
110094 F20101221_AAAFCA krediet_c_Page_021.jpg
36a03569a63fb9d92b2bef8796f8295a
ccff8f4ec3755c550bff6188efdda4e756217cbf
35114 F20101221_AAAFBL krediet_c_Page_146.QC.jpg
e6b608cc0c391a7ea81819eb4c93c0e3
86f2118717372edf5ce2f3aeb4600a4a1473eacb
102692 F20101221_AAAEWG krediet_c_Page_055.jpg
c713503bd100b8f6ad97e21cacf47445
a492dc4a7daccf1c5ad957122a75e7366040a579
9102 F20101221_AAAFAY krediet_c_Page_015thm.jpg
c64bcb3e129f74db73c3cd607530b4e2
4682c77f864edaec71297f9623ed740db9e86be1
111925 F20101221_AAAEVS krediet_c_Page_085.jpg
8429487242273c94f5e150ce1c3ca1ee
1929e0e8de763e44abb4eacbf81b0b21b403998f
222682 F20101221_AAAFBM UFE0022380_00001.xml
4d8c709294f5f3a303bd14d8608bc246
528f1c73817b9df26fb8062906f4d705fd9da0c2
109333 F20101221_AAAEWH krediet_c_Page_059.jpg
692153ea692bcf93f115b3299c7b2bac
99cc00daabbf9414af345628198eaa15844e477e
37171 F20101221_AAAFAZ krediet_c_Page_023.QC.jpg
8d6da8622908fef3ff45773f333c3605
a703efd3b264faad52e9ee1d11a9e1967bf95963
1051956 F20101221_AAAEVT krediet_c_Page_013.jp2
76c8c93071fd1bbc5fbb766f4505b776
25d77bb1d550679b8fc08eae9618526494e37956
115433 F20101221_AAAFCB krediet_c_Page_029.jpg
ba7b426d04c0fc42c3703592a600c12e
a3014d94c15ddb520aa985b3e6bc922949c006ec
126202 F20101221_AAAEWI krediet_c_Page_142.jpg
a104f18e06c08ee5963496db025d0ad3
e9df7e70785fc7ea803dc4caa67d532370f7678e
22050 F20101221_AAAEVU krediet_c_Page_094.pro
3692d4c21e20d8bea5c2c4e076e03021
bd39a2c45cc944840ec368cabe5f2e2b5eac8323
114048 F20101221_AAAFCC krediet_c_Page_039.jpg
5e692151ff73cca8c53c2e268e510cb0
093fc9feb915dccaaa852be0609b94aa54801858
54616 F20101221_AAAEWJ krediet_c_Page_089.pro
e0542f93cb9f351f2ea5aa9b7063f969
beb6f99579c867bf2166be409aa54153f8c2f448
112530 F20101221_AAAFCD krediet_c_Page_040.jpg
16ac580576a24845ba6954d923fb0808
8f2d0dba8c72064c6dfd6a5c46a7502bf199e6bc
25438 F20101221_AAAFBP krediet_c_Page_001.jpg
ed74a77b9ab7f752f26f606eb40630c1
b5fa2cb5042332b4d5727e241e3d7f37e465f980
9080 F20101221_AAAEWK krediet_c_Page_064thm.jpg
537e5e896270eb629f08f1bf065a32a3
03d4d4821248657450af709fcdb237e5a2e1c133
6757 F20101221_AAAEVV krediet_c_Page_147thm.jpg
747baef0d55cd9b16e06aa20a64b9293
9a69e5b6901fa615e419624338b35380a14972b8
116802 F20101221_AAAFCE krediet_c_Page_042.jpg
2e4ea213622e88609632406423967c20
9e802900f43b95c8f1594ad769640a58d1d5eb26
127626 F20101221_AAAFBQ krediet_c_Page_009.jpg
84a9f28500f42388553e46377fe1e43a
7bc00ec00a751961cc8035d7604980517e6885f1
F20101221_AAAEWL krediet_c_Page_039.tif
5e80da851a37fb28f560e5dc27aeb370
e21ac504391c30b4142a065c179dda9632c1a054
24605 F20101221_AAAEVW krediet_c_Page_074.pro
e2a95da7f5acf61ad5db2042eb615b54
6186c5bf225661e047c4d4289324cc9f68c57ed1
114652 F20101221_AAAFCF krediet_c_Page_044.jpg
35561b855ea6d9a3b439061fdd01f038
004cb4384655c0b83df6b1046e068e11423b6fef
97632 F20101221_AAAFBR krediet_c_Page_010.jpg
32597ea30d755ed7f4189e8eca7d3bed
07efa3646e49f1e16953c6958a9870f221b791e3
8790 F20101221_AAAEWM krediet_c_Page_125thm.jpg
2c994b410189526af215e06d918f8d37
e661803df5b2c3727ad6a42ff5ea3a41e80f193c
F20101221_AAAEVX krediet_c_Page_084.tif
98dd88ba2fcda4bf220d508cc5d8af07
7b0840b420391ebee84fa081450f909f7c0d0594
111218 F20101221_AAAFCG krediet_c_Page_045.jpg
aea17c25bd5842f0f0653ca943c18265
478e4c3ed16ddf59b7c60f5161f52c82c90f5e24
9060 F20101221_AAAEXA krediet_c_Page_019thm.jpg
bbf2cfdf06528e5f6fd8d20957a1e42b
51b4632fd8fd3809351a97780e706f93da5494e7
67738 F20101221_AAAFBS krediet_c_Page_011.jpg
232a8d0c0016a48be5d6db12b46883c7
78ef80e361bb64c9738c46cd3a5206fd161b3456
52108 F20101221_AAAEWN krediet_c_Page_087.pro
afad5d4118d6542d941207e791e53215
41c56972cceecc1465e291cb268ca587b563e6dd
16727 F20101221_AAAEVY krediet_c_Page_075.QC.jpg
85f5eaeb9e7d94aa18c2d8b131f0e629
d1adc6e0677c1cfee1ecd2050c0580a7aaf3302e
101136 F20101221_AAAFCH krediet_c_Page_047.jpg
601c41a2ad0c4776ae88084004658e65
4427782dbd010bfa5b3d44d7151c90cfc839d1ea
702855 F20101221_AAAEXB krediet_c_Page_148.jp2
4b3709ce241c899b3d0e793188474d93
c0be7b1fdbfd7ba98701c1341c46ab37cca23b83
103565 F20101221_AAAFBT krediet_c_Page_012.jpg
0199d27ff5b31c2b267d683cce8a5720
7636d936718b79f8d4d0ba2ba7754c7b59f99a7b
2055 F20101221_AAAEWO krediet_c_Page_060.txt
7777722b17d31ba4cd7ba606ca209878
21e270cec714e0156b3cf5c11cd86360ddca83f9
21211 F20101221_AAAEVZ krediet_c_Page_120.QC.jpg
25c324001b3c02291492833458a7b144
4c5bce9d83ecda96226410f6be38e4c6bb8211f0
43368 F20101221_AAAFCI krediet_c_Page_050.jpg
742e3adf49601e6cfb8cadde060d46bd
14f5e36ee7cd70650e5ddbbd9d1af8c0fc3dce18
54145 F20101221_AAAEXC krediet_c_Page_109.pro
33f9ca4aa5cb52f7a7cdb17021a66930
88951c992db3c92616937da87713aa2aa9e408dc
109895 F20101221_AAAFBU krediet_c_Page_013.jpg
11b0a30795fcd91005452d2c21864839
254ed3c72cfdb1451264b44566d9cb8c50653188
10075 F20101221_AAAEWP krediet_c_Page_007.QC.jpg
1d88098cd02db201aa0dd92c40de3f2c
c3b71aad06f62f496d43e1cdbb679883b183017f
83363 F20101221_AAAFCJ krediet_c_Page_051.jpg
04eedcff5b05c776a8728c51e8fa2a80
3ba6b0b6dd15bcd823e98d6994f48d4a07a93a35
2149 F20101221_AAAEXD krediet_c_Page_089.txt
5c0902ca389893d57e1ea207eebd0136
d1bbb65209cac13a44ea96b8a56fe26e7570486a
103973 F20101221_AAAFBV krediet_c_Page_016.jpg
22844ecde35126bac312ad59326993a0
27c051cff20482ee0e6aa14d2cba3c95475819b6
F20101221_AAAEWQ krediet_c_Page_015.tif
93b0c754fe46386cb9eb140fb7f6817c
65df615d16e006467ed4a74828073c57dfe99ff1
112427 F20101221_AAAFCK krediet_c_Page_054.jpg
0836b334b911a9e7571e081374acdd93
937de39a447f91f24abf1e039ea7c74042c6e982
133243 F20101221_AAAEXE krediet_c_Page_137.jpg
1d1cadfc79329a65b6183305411ee449
b9ee60c37577b0479d7fd87e853d2319b802a6ec
107180 F20101221_AAAFBW krediet_c_Page_017.jpg
9bf87d8e816ea2fb768cb1d3016cd392
64f88660c2ce5603ceaad64625e6cb14ab6b3e71
9467 F20101221_AAAEWR krediet_c_Page_133thm.jpg
de5656028388d89e1aec3a7bdc691ed7
7d86d69a46cf6505409fdc873eb487d035ce1c00
109683 F20101221_AAAFDA krediet_c_Page_093.jpg
392b33576c93b63e16c3904957657e35
9ae45829f4b378211bb4210fe0a94de1da994ddc
111017 F20101221_AAAFCL krediet_c_Page_056.jpg
b8fe12e0b72c0a6bea0be8ae3398fedc
006346504490bef1c121099c8e1e84e9ad090c52
60689 F20101221_AAAEXF krediet_c_Page_146.pro
b05daa2d696bd1ae024e3370c6429e0c
45f14d4da969e69606e828a25a0c34427ba40bfc
103355 F20101221_AAAFBX krediet_c_Page_018.jpg
09273b4453f6f349d46b2935e7a0576e
37e22b2ae97e7a99418c9a15e23824e8241e685a
1051913 F20101221_AAAEWS krediet_c_Page_104.jp2
3c8702e68a99cb52ef6fb362c29b1daa
85e750fc4f08186291210c8e709c6bc9368aac74
48862 F20101221_AAAFDB krediet_c_Page_094.jpg
645bb3d45e90de1d7f734ed4b41436dc
f78552befc425873f9859c8d3792f5f189f53343
107983 F20101221_AAAFCM krediet_c_Page_061.jpg
8ed97d3c65442a4c844f2faf0f649a29
ca8ee1fbeb17ed81fefc7b0249b0f769aa9d549f
53539 F20101221_AAAEXG krediet_c_Page_106.pro
92fbb1cd1287d4926a57f35ba3febf0d
89e41515dec0608baabc223de1cd61b421d32cc8
111786 F20101221_AAAFBY krediet_c_Page_019.jpg
97e15d3b3703529f2e76fb415f05a220
de9253556eb8d154fc8056f70c7edd5dcb5ae049
52007 F20101221_AAAEWT krediet_c_Page_069.pro
4807b7b16440b32a926ab173b420c678
cf6acfc1c58470a5ee6fb9fefb3a6b8aae46b0f6
109321 F20101221_AAAFCN krediet_c_Page_062.jpg
cb7d5beac31a9d50cc4cd8ce07d583b7
cf2dcc4e1af776657dec12e0f262fd34c1be4893
1173 F20101221_AAAEXH krediet_c_Page_074.txt
94bc8302b6e3a3014be8b4d0ffeba68c
82239ec58151ff4316e3c214cffe94af861a7940
112137 F20101221_AAAFBZ krediet_c_Page_020.jpg
ab8fdf7b2ce44d2cd4c6532cfc0dd6b8
b0545cb4d34492d15127e8c8b17777ed3ef9a3f9
68323 F20101221_AAAEWU krediet_c_Page_140.pro
3866971b69b60ac082aae32a6e9b4a63
97abcc4aaa82c71414a0b9b32ff2a97d06ba3437
64950 F20101221_AAAFDC krediet_c_Page_095.jpg
83e53b923939af50da68403362e7ddbf
9d04392e629ffaa964516fc40120686749cf3235
105156 F20101221_AAAFCO krediet_c_Page_069.jpg
901c9f25cab4957db77107ab050c8cf1
5eb0a9190635af633f9c72d7267853342380faa6
F20101221_AAAEXI krediet_c_Page_093.tif
07e1d9e00b92fcdfe7ae2146416e04b3
97ad055a3c1dd41ca10c6d1ac765888ce1e9daad
53924 F20101221_AAAEWV krediet_c_Page_059.pro
00931adadff365ea5356b403407f47f2
f24d7fadf61d37f904610308740f20c8132a6801
27984 F20101221_AAAFDD krediet_c_Page_097.jpg
45d8034b196dd19a2f0a84d963d2f5de
8b2e51cd37da670ee20756d47b421d8dd4343f92
52738 F20101221_AAAFCP krediet_c_Page_070.jpg
cbb0b4ff59fbf77aed3dc9dd33ea5abe
e2aab629293fac49c9bd6237c859e2cf8a7847d9
52862 F20101221_AAAEXJ krediet_c_Page_061.pro
e50ca9a8970e019c7592d66ca8ec2084
e378fe9710faaf6ab220262b6f1ac5af501045d0
49078 F20101221_AAAFDE krediet_c_Page_098.jpg
61befcac152bb0c1b952b02d5cf8b7b6
53d3b7cbf893ddb3003bd6aafecde05d7a930cc4
65110 F20101221_AAAFCQ krediet_c_Page_072.jpg
fb5192ff03ddb2d20149f7c726d42751
ade574ee39474eb7c4dcff04ba41f487b76182ef
38142 F20101221_AAAEXK krediet_c_Page_140.QC.jpg
f3192f9910423b2be366e564f8001142
f9c7a6a1f52bdb2f6162c156e18a3f4aedd8405d
8763 F20101221_AAAEWW krediet_c_Page_105thm.jpg
abc0390cd47ad9bdec978ba37dfbeae8
c53476b6f1280d2d8ab6f3084c7b1876a5c64085
47187 F20101221_AAAFDF krediet_c_Page_100.jpg
25c9aaf42a7bcfb5a9ab37961031abe5
126a9587dda09525abd8e046e15d194ccca405cc
57289 F20101221_AAAFCR krediet_c_Page_075.jpg
3912485dca91aed73294749080feb430
b6a5a9b7ec9b32bce517412bd7f4418a9aa04498
F20101221_AAAEXL krediet_c_Page_145thm.jpg
37833af72856f36d0645f8160768cd91
d07fea66e9c74a8f12f0d2bfbe34a7245597bfa3
1525 F20101221_AAAEWX krediet_c_Page_037.txt
65ed92a4df5962f4d233277a9e8d74e4
254ac9fdcce6eb43a35d134af5164152a1e719d5
111361 F20101221_AAAFDG krediet_c_Page_101.jpg
a27dc5a06e167961f8e85cc2d0b8817b
f95f8faa5380c60a618d4af99f938b01e6e7c03a
F20101221_AAAEYA krediet_c_Page_109.tif
6a6b9d060c8d2e29cabe14bebd6c4e39
5c68e0f97b5ec69affd24bb93fbf700ae3010d41
41296 F20101221_AAAFCS krediet_c_Page_076.jpg
1dd58c04f4919e63dc35b4efa165bc4d
2cf1a4b9b6b9efa54120f2009ac5f832b68ba763
18717 F20101221_AAAEXM krediet_c_Page_072.pro
2fe142fec7e999c969c897813191a1bd
ac2a724dd4e345680066719bbcfbffed58c49fe6
F20101221_AAAEWY krediet_c_Page_115.tif
f6f6934a42e7132ca2fcdb5f63b9c76f
fa3dc293d6c7705ca5e1e6cf50660f58c545bd65
110014 F20101221_AAAFDH krediet_c_Page_105.jpg
6db5db9fde5adce766fce12050222ff8
9f60f5d72f415483ae69dd197fa17fcff1444824
3871 F20101221_AAAEYB krediet_c_Page_048.txt
bd04736aee95ab6d0447b40f9caebf91
b484b54c88a2e8045d8883c40fc7345893fc83e4
106960 F20101221_AAAFCT krediet_c_Page_080.jpg
e324babbb22a2e4adecd31ee8c958ac4
ee0fe37deb3104173a0976c520c9a725f91cbec8
15239 F20101221_AAAEXN krediet_c_Page_037.QC.jpg
c534c4a4da8b4a076655216fa8e747aa
f484212792097476cb612e1748a85a7d064a661a
F20101221_AAAEWZ krediet_c_Page_018.jp2
67d3f54692911fb215aa5108c855d2c2
725d15160ceb1a63dc4fca084790c7a1628f755b
111637 F20101221_AAAFDI krediet_c_Page_108.jpg
f04925ed3b456ce07f13b34669e0d68d
176acd7c3837f4bc710af3c35176a9c90d7fcb4c
F20101221_AAAEYC krediet_c_Page_024.tif
87a3f638d45493cde2bd2e1d1a5a6cee
a7c3a992b5c6c1d71d133e68f9483730300ad549
100904 F20101221_AAAFCU krediet_c_Page_082.jpg
fd2db2913f5f71144415232d86c3c3b4
aaeb5dc54d05be1868b4820f4b02429dce936dd0
108737 F20101221_AAAEXO krediet_c_Page_066.jpg
30f3e49c95eaa09cac9ecba05394fa2d
8e689cb195f9c99750441131179c0d5eb0f8fa7b
110303 F20101221_AAAFDJ krediet_c_Page_109.jpg
e8e9fc3cbd7e374291f89c6535454629
a26c515e1ffc0744694c1f49b9569f9994e014c3
F20101221_AAAEYD krediet_c_Page_071.tif
13745c2bfe293949dc8271c4aeaffdfc
83cb829afb9af5af35ca14fe6afc88581ee8312e
110330 F20101221_AAAFCV krediet_c_Page_086.jpg
874e99b07aa0718e617b974faea4eebf
6a7392dff706a80d220c6812762b9c38d50454da
1051923 F20101221_AAAEXP krediet_c_Page_083.jp2
23642d9b916d59b62bea095c22b5494d
524ef3bc88933cb645a3bbc72f579ef09f31a7db
110258 F20101221_AAAFDK krediet_c_Page_110.jpg
9c1326895799ebbf25aa9b75ed012236
0ba37b88351c08949299fb50dfbabcc2bcbafa88
1051975 F20101221_AAAEYE krediet_c_Page_113.jp2
3b7549652c9a1e62605ca5a165ef1f25
96379efdf72fd5a15f96bb1e1f21b6551fee4f85
108051 F20101221_AAAFCW krediet_c_Page_087.jpg
5fa99505cfc546e42a4258f5dbcc118b
043b3a104d969439f8b99c9b99ab16728bcdd1b3
F20101221_AAAEXQ krediet_c_Page_044.tif
09092cb7396bbfa09e956c526e038c88
d83f357ffd8403981e6f63319b971c5dec146f1e
111199 F20101221_AAAFDL krediet_c_Page_111.jpg
eee85a1d36e984e558f403be31caa51c
66cecead63743043320cd665c681feeeafa41c4a
104491 F20101221_AAAEYF krediet_c_Page_031.jpg
a45803544cfc54bc2b4ea180851cc9d1
e7ce4c894ac6f97f99b7cc71a9d90c8c116513b9
111690 F20101221_AAAFCX krediet_c_Page_089.jpg
344358ceed793b326073bed8297683ed
816ca78ab89c654be488487738d7a07ca2f02218
916580 F20101221_AAAEXR krediet_c_Page_036.jp2
4433995c4655b6297858c25b048fff8d
76d1c35b5c0b2895536c1a02ecfdc57d92c29f51
136769 F20101221_AAAFEA krediet_c_Page_135.jpg
b84489b78e88b9c37ec7e7f24b63b082
ad09036cb03d17484b83362ac7ec6247d68d69c7
107715 F20101221_AAAFDM krediet_c_Page_112.jpg
4ba3717a995b03108ebcaa0c89f73db0
ad758f486fd96675dbe5905b69551f1f1cf50a1f
3848 F20101221_AAAEYG krediet_c_Page_002.jpg
032bc02075302c6afaf68a89ddefe9df
3561cd80cebff03ee19e1b4bc73190f830a89244
110023 F20101221_AAAFCY krediet_c_Page_090.jpg
a5530526e8d07d3e160c655e025d2307
92af35cb192951da335b31edf730e33e722fcef9
68758 F20101221_AAAEXS krediet_c_Page_120.jpg
3503da7ab59dc201c655f3450e59950f
db9d3dba2d60ea8d2503e3144cb4d2cc3067fdf9
134956 F20101221_AAAFEB krediet_c_Page_139.jpg
b1cd14888f794ea5cb0de840652674e3
d59340dfc8c9dde1eb7e30afd03ead6e55007976
103931 F20101221_AAAFDN krediet_c_Page_113.jpg
108a168d5a099204c7024928bc794da1
b31006e831e71a9ce2320059cfb4a1a2bbfc215b
F20101221_AAAEYH krediet_c_Page_027.tif
780ef89d6e964faecf1714e2ab09f948
11aea84762f56d7e49ec1abc6bf1e397b941d40c
110940 F20101221_AAAFCZ krediet_c_Page_091.jpg
cdb87e3efaa4b03d4be6f6add1b37c09
15e0bf3ed3bcd4346fb52776c14a01ada82dc144
36305 F20101221_AAAEXT krediet_c_Page_054.QC.jpg
eea9c56eab12c788de15dbd4a5dcdda5
30d276bd073861be1d34e8e944665c4ea4a5fd4b
138990 F20101221_AAAFEC krediet_c_Page_140.jpg
74b16fb0a3842666f8998918492145a4
eb129113311ba0bbed2b3b6d2563cb03632b395d
111835 F20101221_AAAFDO krediet_c_Page_114.jpg
c77549945c2780cc25a156bce3ffc618
16f6df520e26b99b894219f1525780efa11a984d
2163 F20101221_AAAEYI krediet_c_Page_122.txt
04dba9dfeee73323832cc74234dc2b02
4945b1a83d0ba6723778b2500c61d3c54a705da1
38034 F20101221_AAAEXU krediet_c_Page_044.QC.jpg
48ee3d3256652ea1cb230b95e9930988
1ee6c6048ee5197372fdae2c5530c05e31217dd3
108402 F20101221_AAAFDP krediet_c_Page_116.jpg
8bb41532537f607491ed5bb3551bc7bf
e1c4bcd9ef07f83eda5f738eed7cdeb633de0341
867 F20101221_AAAEYJ krediet_c_Page_007.txt
a5455240073121174fb26edebe7c7346
c5939b6a2bd063fb7a6df1e485583866a04216e3
55817 F20101221_AAAEXV krediet_c_Page_054.pro
f3139885e724f84a16f07a33c293d9ae
9c3175438430bf1fd01aa089b90e6726580a977e
127634 F20101221_AAAFED krediet_c_Page_141.jpg
43c10a80bf043fd96306459a82810db0
edbc2f5b022ba68d703c2cd0ac95706567c80e93
113217 F20101221_AAAFDQ krediet_c_Page_117.jpg
5c93f9f689ee47d8041c4622720c22fe
01d18fcd40a2b99e83f212c4ba2baf18b66764c0
F20101221_AAAEYK krediet_c_Page_128.tif
37ad9e8ac4c771a6bc5de8a01833f72d
8b14c645180ff166cf074ad89553eb49586a208f
155741 F20101221_AAAEXW krediet_c_Page_006.jpg
882d227223042469f5343cdb499b55a1
c817257e9b981593a46e69e31b3dff22d7eab8a0
135999 F20101221_AAAFEE krediet_c_Page_144.jpg
6981439c8046ce0e49d3d0d178c449f3
176488f329018324e7c4d17ddf692d83f3317897
61001 F20101221_AAAFDR krediet_c_Page_118.jpg
3906c57018906524dd3e37599d065237
135821285ccda2e449c1b561b0916e1543ee265e
2110 F20101221_AAAEYL krediet_c_Page_017.txt
e9d333e2dd51791f4515c5da3cb0f30f
8fc3abf3cdc77a70cd18187b0365a2899533ac20
118024 F20101221_AAAFEF krediet_c_Page_146.jpg
0002fd1722cdcb394d08d9283c108e9a
8a2d55917193480569030e85ee2340710194058e
8546 F20101221_AAAEZA krediet_c_Page_017thm.jpg
deebaa6d9761739a401d854383cf4159
bc8032ec6b8b7cd4aa697846a6840adc6be43e58
79399 F20101221_AAAFDS krediet_c_Page_121.jpg
e6bb69b402681a014c5f55808a4dcaf8
f3c1272ef9cd05d3da14633aa62878195a33d99a
2154 F20101221_AAAEYM krediet_c_Page_090.txt
ef2716a7377a85e218f7eda081b37a65
b32ffa5d4af62c41499674ae453cbf2a291b47ae
13408 F20101221_AAAEXX krediet_c_Page_076.pro
f870ce94932b67405c05ece933cf02c5
f20874172ed48ff7b87f48cb106c15cc625d3109
247681 F20101221_AAAFEG krediet_c_Page_001.jp2
a92f0d999cf4e372be76a96190dd9d96
73196f22282c943220928d3259dc16f04b75ade7
984879 F20101221_AAAEZB krediet_c_Page_147.jp2
71f9ab04fac62365e791db41984d9fd5
ba79d8fb0fbbc2a8dcf3712dcecc8424088c5b7b
110372 F20101221_AAAFDT krediet_c_Page_123.jpg
270cbeb0e928539fdc3c021b958f6a2c
ef365f9a61c4191e30cca639ebdf437e4338b73c
8823 F20101221_AAAEYN krediet_c_Page_052thm.jpg
2007ec160df2a1c9eeab3e1c85729a6c
d0b2e8975c26c9a1728228cee613a3d561a1013f
113840 F20101221_AAAEXY krediet_c_Page_058.jpg
7937e4c66c4cb5c571da0ea4d72bb2a2
915bc61b9a3be6fc82ae2a17366b0e18a2cef6b5
84375 F20101221_AAAFEH krediet_c_Page_003.jp2
f5b20596baa4671899b443b5734c7dc1
c34f02237638491df2e090a509b345c8ac8c45a3
55297 F20101221_AAAEZC krediet_c_Page_025.pro
a4db56d7a86ac52cc8ae6652e59d59b4
a184d3908ed04a4f57709f265d3a22fe43aa2d05
57505 F20101221_AAAFDU krediet_c_Page_127.jpg
b22d518f4013f4289aace1148b3e0076
4f83258de68504499f4acc1af5186c16453299a1
F20101221_AAAEYO krediet_c_Page_060.tif
a8f770125600e5324fcc2544b920228b
8dd1713d8acde43e1a6a27091f0a53c3958b4fc2
35447 F20101221_AAAEXZ krediet_c_Page_017.QC.jpg
44a05f4f65f2a046846c0c136ea9ed63
ab7e4c43d625afc56526c32e68b0aacbe4c00f5b
336252 F20101221_AAAFEI krediet_c_Page_008.jp2
8f70fba6045f51ac8a929d5ab0d851bb
1997a07dce88930a7279f14b6ed73878a727fa8c
F20101221_AAAEZD krediet_c_Page_133.tif
56819dcd7a2dee847f80dd4ee91610ef
c6a693557e441f9fbeeed203a734909dd0f4811b
132433 F20101221_AAAFDV krediet_c_Page_130.jpg
bf2d79e637a1fde72412d798185ed768
9baf5e61889dc6fb76037f3a4fe440feec4c7526
1051958 F20101221_AAAEYP krediet_c_Page_015.jp2
69177d987427ad81a1d1a6814b0f496f
b251dfa0570f559e93a4bf8585d8b8b707156123
F20101221_AAAFEJ krediet_c_Page_016.jp2
a9ace75d5072b98830c6617fac61c664
fe9e6dcb5954e7667154d364676f53f423301300
9933 F20101221_AAAEZE krediet_c_Page_008.pro
832c933cff3b6407878e05191a371462
33c0f523a9bcb91d61d91bc6266e82a92ee383db
139228 F20101221_AAAFDW krediet_c_Page_131.jpg
1056c1ff2d741eb13cd49dddb7856e10
e8c08515962bd7f7a83dbef2a8761f653a4ccca2
F20101221_AAAEYQ krediet_c_Page_107.jpg
4322581789a5693f0d061febd74f0d9e
8098262d71f8b55b6800ade947ace10d42ee1f70
1051985 F20101221_AAAFEK krediet_c_Page_023.jp2
c7b3fdf3d8c000193e9a5b60834d77ac
4c7b2a59241c0b2ff7597c3dc402751687e3afd2
F20101221_AAAEZF krediet_c_Page_052.tif
d47ffb107ab602f62471bc55e18c6dce
0419fd315e738bd6a4ed4d5af436448b57b7173d
127258 F20101221_AAAFDX krediet_c_Page_132.jpg
08af29369afc4746aea14064d0f8ec2f
d3591204228fbd74e2b0850190c4c7b868c160ad
37068 F20101221_AAAEYR krediet_c_Page_107.QC.jpg
ebfef353863292b05c4912bcb97b14f9
adab7558b0eaaff87804e57c922a3becd68915ad
F20101221_AAAFFA krediet_c_Page_052.jp2
16ce7a35a094845126f6a9e61c4a1872
857d9f89059f87c412f9dfcad17c5be9c5457d2a
F20101221_AAAFEL krediet_c_Page_026.jp2
f67f375a04363da8100e1061a0a7b9fa
69a63dc88d34264bfa4f0b564f22b5c07bf5f0ba
34413 F20101221_AAAEZG krediet_c_Page_143.QC.jpg
0956a9d1c72a71689851553061559820
a9370970de029cd5107507fc688d93bae4c5ec9f
134653 F20101221_AAAFDY krediet_c_Page_133.jpg
78ba1fe4b672f9a8bbd4199cee64d5b5
c7f91c5f4488101f2521bec66bec438e1f98be58
F20101221_AAAEYS krediet_c_Page_056.jp2
62f978d94233b402fa4cb73fce2ce68e
7f52482be2d7a35b07315ffb5656d1ace44cf54b
1051948 F20101221_AAAFFB krediet_c_Page_055.jp2
9c06cd40f258c7a47e0cfacbada8ea9d
7caacd06c9f495f6f0aece1609f661b557f089d0
F20101221_AAAFEM krediet_c_Page_027.jp2
007607568228b4516b0bea6fb59c1b34
6c881f059bca2c07b9b606cae3793e158910df70
53372 F20101221_AAAEZH krediet_c_Page_017.pro
efe116e2e8eb357989c11be636d3ad68
bfbc234122cd1a23e1d474d2e39190e523f4b05f
132875 F20101221_AAAFDZ krediet_c_Page_134.jpg
0baff4c07a35b911cc1a136da44df2fe
30dccf5eff3ba17e03ee370d18cdcf298fccb168
54184 F20101221_AAAEYT krediet_c_Page_056.pro
84a0c7c39c0176f030519db6bab723c7
8e46e1d2c5ce70125f938e1424d093005d9c603d
1051952 F20101221_AAAFFC krediet_c_Page_058.jp2
bb291648cdb19d1b69bc253dd6985d76
6fc7883fcf0b298e375c03e50c0ecc6209513e85
1051986 F20101221_AAAFEN krediet_c_Page_028.jp2
446d1de0637db3044b74470240b29a0b
bb26ddae33bc47ff733b3febd39d88f087dc5197
8696 F20101221_AAAEZI krediet_c_Page_110thm.jpg
a6c6ad662014b924ede76d711efd04ad
659691972ad70a37bba3182e5b5ed85439752f89
30394 F20101221_AAAEYU krediet_c_Page_096.QC.jpg
147b89c3a05e958e6a99e8c6d20d76cf
542cce5f931d4c2b6c24545ed976213720249232
1051969 F20101221_AAAFFD krediet_c_Page_059.jp2
dcdd34a514df3e7e22aaece49176fba6
c526d42756661ced099b2ee06d78101bc1f315bc
1051861 F20101221_AAAFEO krediet_c_Page_030.jp2
42bc27668e107cca2e5d444eb4988f36
63b80a7af60e5b74ca70396e6b994fa523b70964
115804 F20101221_AAAEZJ krediet_c_Page_030.jpg
0555404093d5a996e4dfd030dc4a25ba
4117c70ea6b4f4e93db3ce78c7383a9fb9a51cbf
114330 F20101221_AAAEYV krediet_c_Page_081.jpg
6f1deb0501715cdd870346d4307212ec
9be73813df74c294a45f1d0777c22becab7a5900
1051916 F20101221_AAAFEP krediet_c_Page_031.jp2
51a8443fd97082c8492dd0d427d2ae70
9be6a9c2fe12a468f09264167364a5e99c19d472
6239 F20101221_AAAEZK krediet_c_Page_120thm.jpg
091948206d789f005c1e64540fad3ea4
599c22e3d59faa48d08dc76232ff4ee2276f7d99
37045 F20101221_AAAEYW krediet_c_Page_028.QC.jpg
1af0b380b464581c1e500e133a03a266
e75e1203518b9983922026ea66d46baafc9bd693
1051981 F20101221_AAAFFE krediet_c_Page_061.jp2
e88c67fe66aae4993a5037076e23784b
005532d6cee483b1121aa1be68c4ce6c92213cbc
1051959 F20101221_AAAFEQ krediet_c_Page_032.jp2
535acc5dc2b42cde0242556a32cb4bba
2e18953c31de3ed750f4e0aebde4f79c694da840
35569 F20101221_AAAEYX krediet_c_Page_123.QC.jpg
a17c196b42482f64f4afe29eb3b74f49
7619e89cf6ae1617f4351fce495b84e6bb22e296
1051945 F20101221_AAAFFF krediet_c_Page_062.jp2
a87bd5a03d244fb5444911bb3054b06e
1ab0f50a6d0e08bfde547636a6feec04cb0021ff
F20101221_AAAFER krediet_c_Page_033.jp2
e596e61eca65d27f26a75e722580a057
5c2858ce0485ae07544f315248c9ddf74803490c
8869 F20101221_AAAEZL krediet_c_Page_114thm.jpg
021035a001bd1cdfb1d69742d98676e7
2aa97e5cc5eac4c2314a244f57accaf5fb600d5a
1051947 F20101221_AAAFFG krediet_c_Page_063.jp2
405d99299aac8179a6ceed4539635abc
540466fc5679cfd70e483f3ee69523ff31f06c7f
F20101221_AAAFES krediet_c_Page_034.jp2
e69cb1989e65019a90c59fc629265d77
701d4b224c437df48465869af0bdf311378b8753
9026 F20101221_AAAEZM krediet_c_Page_085thm.jpg
638c695903fff5c439ea5ad118c5a2ed
c244e4bbe0ddc1b3e213bb23089c7c25dda7e653
61187 F20101221_AAAEYY krediet_c_Page_143.pro
43285eba1d450388454dddb52e92442c
b66beb48e10d8be1185d4d8e391f6c4d1b3707e6
1051905 F20101221_AAAFFH krediet_c_Page_068.jp2
e25ffcb702d1ea9aa3fc07b3a8bd07a0
6ac5cf69e2b6b79f42892b1b0a1380b76ed0ab17
F20101221_AAAFET krediet_c_Page_035.jp2
f5f1d7ee88813bce63bcebfda163894a
c5a3d201fc890a840ee9fbe2e11496ee3771f273
8494 F20101221_AAAEZN krediet_c_Page_061thm.jpg
d078bd7262d4f8a43a3ab7bac493c666
e7bd302482995bd2e1e87c521cbdd4d8fe3ef84c
57371 F20101221_AAAEYZ krediet_c_Page_083.pro
2521044ec63dd65c28c1875adf0fa67f
329f99754abe6a3a50264dbaba295e527623a774
240674 F20101221_AAAFFI krediet_c_Page_071.jp2
fe14c799cb90ae969084f9446892787b
5ee2bfa75266ff8fd3436f6f87d3531f7d0cd1b7
1051951 F20101221_AAAFEU krediet_c_Page_038.jp2
76bb113a403028ff824e7a9582444d60
e28e4fff73e594d985a77a1b592003d2dd0cbc5d
8909 F20101221_AAAEZO krediet_c_Page_136thm.jpg
942b989448f7c27911c3edf1f9d44138
5b87d6b1db8649ddaa9afcd54a1b1e54ade5274b
651212 F20101221_AAAFFJ krediet_c_Page_072.jp2
e811b70ed6f20a19e7148d3bb667d995
f5aa150beef9230811f9accc726563185a9c7b27
1051972 F20101221_AAAFEV krediet_c_Page_042.jp2
0bb670895e13f0a1a2978f909dbcf848
cd88976bee13b77f4d290f3d0f8c48385e39b761
55288 F20101221_AAAEZP krediet_c_Page_086.pro
764eba24799450bd47dbca336a967417
c687cb5a27b4df8c3eae2ec2dc4ac6529bdc89e7
570377 F20101221_AAAFFK krediet_c_Page_075.jp2
eb98f191e39cd693f7a3caee15b0c63c
d936020e4e44c60cb3e8b5e41ce9d33d504e7f65
F20101221_AAAFEW krediet_c_Page_045.jp2
1087bc9a53d469d86f14a28f66f6bf4b
bd905402ef3761d8635f3a93a6b55fa104e8bbc7
2031 F20101221_AAAEZQ krediet_c_Page_016.txt
b85df73e07a9d85d0887a5babb0ff19b
a5562d3594e3721a782f3999aae31791fb037b54
1051982 F20101221_AAAFGA krediet_c_Page_117.jp2
952d3fa535737c9a85d8d8482ecb6c36
d223815af75e93ca783fdc4e128802f4e48d2c28
351656 F20101221_AAAFFL krediet_c_Page_076.jp2
c827dd678454cfc767ea1c694520a672
7bcffd451c1b1b5ddbfa432234ab13162c7254f2
1051925 F20101221_AAAFEX krediet_c_Page_046.jp2
b18344b5e44391796fe595ac2994af81
b813934b671910a23dc6882e83b8e86164b97ad2
112486 F20101221_AAAEZR krediet_c_Page_067.jpg
c5cb6b4aa977c5da27034458330b43de
f6da3030f15ab44f6ca4a11ca3fb3c9169dc8f4d
663067 F20101221_AAAFGB krediet_c_Page_118.jp2
0a496df1fd35cf38cac16573b926b47e
5ceeb1f0c4cc435a9591fcc89a1aec4351ed0a9a
351689 F20101221_AAAFFM krediet_c_Page_077.jp2
0e1aa33542b6bff712b89c71cad1672c
f24bdb13b4a63946e133aa626037dfb7e2211b66
349752 F20101221_AAAFEY krediet_c_Page_049.jp2
08fc17dfa08bd3ff754ebbcd888335fb
55d5c2c4f9be4f3f08bf03c507766b6ada722ae0
9364 F20101221_AAAEZS krediet_c_Page_140thm.jpg
4cdd7cc16d323b263af87c65d17be181
2919cad012386ec931179e46929b1a1795518468
683370 F20101221_AAAFGC krediet_c_Page_120.jp2
6112ad665eaf9d49febecce2d77862a3
189f8ce428aa94f114c5a2b4615466b7bcd8944f
531180 F20101221_AAAFFN krediet_c_Page_078.jp2
2451e137b212bd5bbc574102d94007b4
b89872ea6f23f7e1356a0525df449e835142c4ca
428211 F20101221_AAAFEZ krediet_c_Page_050.jp2
00ae897bcd6985ace542fc75c49b5a56
c5b9a2a288b4e8e946785cd976a5a49338564fac
609192 F20101221_AAAEZT krediet_c_Page_127.jp2
2b4493ad4a07372ef916a9012ce18926
95db275bbc0d7e6c77a8b0c15985ec3375c9f6ec
849692 F20101221_AAAFGD krediet_c_Page_121.jp2
684b84b2ac759ca9050e2cb009eae06c
bcaf070c6d980b4fb71f3eae6cc2cd835d7e5cdb
529227 F20101221_AAAFFO krediet_c_Page_079.jp2
c2fd82ecc40b10608061d92346b61fea
71622206863523fe636ffc05b334918e7f23aa89
F20101221_AAAEZU krediet_c_Page_146.tif
af0097449755dcc711e1c5d2d6650849
8bea8028872e8514d48481311714bc5acf464ebe
F20101221_AAAFGE krediet_c_Page_122.jp2
c4698eee3fc2fa2151b88866985f6c16
756aea494f1ed006ba5db87b9707601c70c59bd8
F20101221_AAAFFP krediet_c_Page_085.jp2
c5dfc70f3ffb31258b101314915a7d24
56e6918cbbc8370fe2e59421c8bffe52edaf247b
9451 F20101221_AAAEZV krediet_c_Page_071.pro
4706034f9526c395e4cfb880328ac1be
331d208687a1a768c88f5bee5e97e8d5cb3732f7
F20101221_AAAFFQ krediet_c_Page_087.jp2
246f733129a89dabd152731f64f9f55a
a1cc0ef26a45718e01b1e6e1a2e9b92842f80f9c
F20101221_AAAEZW krediet_c_Page_039.jp2
de0b9a03fd73c1d817a2662abfdd9a0d
02b6f8b829a99d090f9aa78599ea64211330d0a1
F20101221_AAAFGF krediet_c_Page_126.jp2
daa6ef2d9ea8051b9a8fdee94bc19025
6fb1f649e284cebea409296fdda1324f1b6ed63a
1051940 F20101221_AAAFFR krediet_c_Page_089.jp2
e11264d94a3b06b04dabb2fb114bd921
6d6af79741cb0b9ebc04a55c4065b13f1117991f
F20101221_AAAEZX krediet_c_Page_114.jp2
b6de377d82d4a3fe23bdf55bc796d5a4
99c7da4df27134df8007e160aa79ca2c8213a8ef
F20101221_AAAFGG krediet_c_Page_128.jp2
b23f68c7915533fdae493da6287b0b3c
f83133484dca6ce90aa7f311248fbdddbd3014a7
F20101221_AAAFFS krediet_c_Page_091.jp2
9a689a5fd10935985bfcc58e1a0fffed
e374095b79a3078e71338930656c923355dc2ded
2132 F20101221_AAAEZY krediet_c_Page_109.txt
b56eca9844a7ef7cf1c90de6960cba54
e43710fddb16b78e96b06c9fb00a1097cffa6b2f
F20101221_AAAFGH krediet_c_Page_130.jp2
96e019510100e65f818070a8652e2e48
998abb61d54f2f520322ff5918700da398cf615c
1051919 F20101221_AAAFFT krediet_c_Page_093.jp2
76ebe966e314108a3267f79fc8249635
da57a24827bfc51870106fb58178c0acf4a9f0f6
511063 F20101221_AAAFFU krediet_c_Page_094.jp2
44ef54ea1d0f906474512ada9f546929
e3c412190034b3555d8608619abc67a85c93c6db
F20101221_AAAEZZ krediet_c_Page_081.jp2
60f1b2b1f1fd2dc4b9acb1fbe16bbcc5
1d53f34820c076ca0af7c8559e06efb7d19cf199
1051960 F20101221_AAAFGI krediet_c_Page_131.jp2
c6445814515c5fe74d0c16d1a93291bc
caae6ebab76efe88cf022cf193a7bba779a14e5f
F20101221_AAAFFV krediet_c_Page_096.jp2
fdb49ce2256efb1834c6edf5035baa39
8db460a1958c763981ddf202c4825816cf2977fb
F20101221_AAAFGJ krediet_c_Page_134.jp2
7580f1bbf513b4b575c569cc7b771316
f4952fd0271ace5e88c1c8a6446140bdedf6a7a7
1051984 F20101221_AAAFFW krediet_c_Page_103.jp2
d35c362e75048797ab9c3dfb22540725
a97f5cd286cf3bde4cf2cc3f22b6449c15a91624
F20101221_AAAFGK krediet_c_Page_135.jp2
a467c2416e4498b47a097eb60dd28ae4
d6ed4fe91672b0caf7e86c8bee6756654a339874
F20101221_AAAFFX krediet_c_Page_105.jp2
f03182280c615b4e7fef51014aa29282
b8389ab39c858faccd55ccd241cba5850a5724ea
F20101221_AAAFHA krediet_c_Page_025.tif
12f6a262fb2832ee670636bbea7de8ab
3fcb6e8eb4f564faaf34260605193e88d0cf5d9c
1051941 F20101221_AAAFGL krediet_c_Page_136.jp2
3cdd438fdbe18ccab6c7aa6541eab413
a8ae907d6c63f191bc93b1696690d0e585ca0cdd
F20101221_AAAFFY krediet_c_Page_110.jp2
38262e00696546c5bcb5f76f0fd1112e
5aae2538a3bebb89c311e729daa40c89165c187d
F20101221_AAAFHB krediet_c_Page_028.tif
86016bbb6bee429ced1271fcc5ff53b6
dc29c666a58a7814366dcab3a74ecb1b8f6bb674
F20101221_AAAFGM krediet_c_Page_137.jp2
1a56fe4a3b98868244c31539641503de
fe49d901bbdd403fd60d225e922ca9fa55a1a3da
F20101221_AAAFFZ krediet_c_Page_116.jp2
1dca141f52878e0ba4af209cb8e22178
c55c6d6949b51737db8e19467ee9e46acf509a6d
F20101221_AAAFHC krediet_c_Page_030.tif
f3b2283666ca409b54d443205e89e6fe
a2a2d1805cf69cb264e3e3a4ecd4e4841f557a37
F20101221_AAAFGN krediet_c_Page_140.jp2
2fc435d745ac7026d25fb75670dccc7b
06fdbcf043333eb7e60467ea661a1835bc007bc3
F20101221_AAAFHD krediet_c_Page_031.tif
fdb5e13200b8a5dffc67afd5e710e8d4
585df51015a3728bcabe7afb2c9c9f4197d57854
1051950 F20101221_AAAFGO krediet_c_Page_141.jp2
bd3c2b5fca5e5aab0374aa8e41684f0f
d1bbdcddc2c28ff40bb56a5f7bfd017b1155ef8a
F20101221_AAAFHE krediet_c_Page_032.tif
c5574d360f4022dd5a179834603428ff
feec1aa57f05d7f59b5992466a7e1ec9a62b12de
F20101221_AAAFGP krediet_c_Page_143.jp2
2a9650037e18b652a86263fbd19c22cc
2ea606a03ca12053afdc2929a4988de606a370fa
F20101221_AAAFHF krediet_c_Page_036.tif
7c556a50ce202f57dd84c27f09a3c40a
343b173530be861ff4c88b2f7df7a269f8a26ea2
F20101221_AAAFGQ krediet_c_Page_144.jp2
1cc070ff5970f9a75d66738c8c9bf0ac
4a7d1fd07da665c1a118844295aaa3fe44dee188
F20101221_AAAFGR krediet_c_Page_145.jp2
b1b84ba52d367a5525af2a46d5ddcdde
eaad39c3165002200d70b79ef7bef7c10023d8ee
F20101221_AAAFHG krediet_c_Page_037.tif
f72a9a4b1d7f7ea6947b97fee2da08fe
7b14d67f8bd718d290e95678850f9caf6ab45c16
F20101221_AAAFGS krediet_c_Page_002.tif
c11c7aaa00a37732ef7ec8c4757f4f45
b5d51b10085b7e4a7e1e79598ec7092691d9e552
F20101221_AAAFHH krediet_c_Page_043.tif
4840df7ff2a3d41fff986455b4da5432
3edb1ffeef461370a88c152b17d02d8ea12054e4
F20101221_AAAFGT krediet_c_Page_003.tif
aed7e4f22e7ad04ed18415f1b91f39ca
eb9f125e93ecc332839f0287aea93e127fa7ec13
F20101221_AAAFHI krediet_c_Page_055.tif
e13541865177b27d6a4ac48000232daf
ff3adc7e915ff3c3289e9c4e2cdfd8c6da46decf
F20101221_AAAFGU krediet_c_Page_004.tif
38f9df4629de7b7cd3373558e099b9b4
b840b5728f94deee30c864553608f6042d4653c4
F20101221_AAAFHJ krediet_c_Page_056.tif
5ca26bee067cc4e25eed9aad76a397ae
c710256527131efc245bfce7754fef99abf56a57
F20101221_AAAFGV krediet_c_Page_005.tif
6ca0ab77ab2d11bdaa17c20390cb0c53
b886719df3926436f9da17adb13d341975be1c8e
F20101221_AAAFHK krediet_c_Page_058.tif
f33a802686f0f70022528f9f28e485d7
6a7c0cbab7d641f80851a40f3523caac7d6a67aa
F20101221_AAAFGW krediet_c_Page_006.tif
6c0f45f1ae46f3748535cc02d0823c82
796b737a1787af31106d744c65aae28d605b4459
F20101221_AAAFIA krediet_c_Page_089.tif
5931144300e6573b60c817bbf4b43c16
f1b8ccfecfea22892c9345d1257dfa43b889a4ae
F20101221_AAAFHL krediet_c_Page_059.tif
eb1218730ad15e3b2ca19b16e4a4d3ef
e6c6caa3e1eff49dc6e6111bb01eca5fc21ed861
F20101221_AAAFGX krediet_c_Page_009.tif
71b23db696170d407d19be1e4278012f
edbfcbce614321ea67e12e21194bbadc73c63577
F20101221_AAAFIB krediet_c_Page_092.tif
50cca0a09d91ad9fcc279dfaf1e5e72d
0cd86c9bffb0be9fa0157576f1199af0e90e49d0
F20101221_AAAFHM krediet_c_Page_061.tif
1c63df44864592432d32869f50b5e942
1ac35517c4216455a69a492fdedbc63a419c4072
F20101221_AAAFGY krediet_c_Page_011.tif
6f3dd35a1e1d35aefe353b48dbeec7ef
d9afe903302f72f875a8465fe9d0a8e4a8ab5594
F20101221_AAAFIC krediet_c_Page_094.tif
c499fadd2933692ff5e4de288178d18c
04701eb9e03eec31abc8a7e4e0f9cda130f92b83
F20101221_AAAFHN krediet_c_Page_065.tif
4fd8dcec8e77421abe28a8d89637f4fa
9562d7c29722f5bd0cc62fd79db31a23295808b9
F20101221_AAAFGZ krediet_c_Page_023.tif
a288d73b95ce3c5b219225a3632e2df0
83f604d63f3d923cdeea8f324ae333d330a0ec0d
F20101221_AAAFID krediet_c_Page_095.tif
79b3c5b230258e4b41827a6967b7e557
5126eb6b67a7472d918500efaaf2cfd09fbb850a
F20101221_AAAFHO krediet_c_Page_066.tif
3330c02548496eee7c657e9cd023daa6
5bcad6f465ad42981c4b207f731504e415790d4f
F20101221_AAAFIE krediet_c_Page_099.tif
38dc8e2afc7b6e3bf5a7eb5469ebc869
ce06a6ae5253b9158520c7faa8119f3ab733f58a
F20101221_AAAFHP krediet_c_Page_067.tif
5b5d7e42ba76143690a80e17ac05b39b
c52f63e8c57cf35f6c6bd37264d9759b616a665c
F20101221_AAAFIF krediet_c_Page_100.tif
1802a256ec42788fc209e3e91e5530af
0fd5c159c111a2f22d5121b3cc003cf30d916240
F20101221_AAAFHQ krediet_c_Page_068.tif
609772c0956c226c6cac6dd74b59d1ab
3867f1a41858a0807e50bef205ca4b3c6f95af33
F20101221_AAAFIG krediet_c_Page_101.tif
07eee3f75c14bec4db3eaf7f90b3bdbf
750022c6fd78cc2081c89f9a857a932aa10e655a
F20101221_AAAFHR krediet_c_Page_069.tif
6c2225aae48e3fdf4bc0c99dacf7caef
4f020fa77cf39b426ba24a0fcfa5804cd66136ca
F20101221_AAAFHS krediet_c_Page_070.tif
e63032855b99069eb3dacff3afdbcb2a
1ab2b769e339b21981180449bbd47c193ce039c9
F20101221_AAAFIH krediet_c_Page_103.tif
1e9c32d4cc3a2c187bd34cdfb800ce2c
854e667d8edd527edbc15cc38d4be7ca9345865f
F20101221_AAAFHT krediet_c_Page_072.tif
017d2fb09790d200b434489c72f93c38
406c12035cfdbcc3e08ebc2b880dbcf36e96ab81
F20101221_AAAFII krediet_c_Page_108.tif
978486e69b000cc7d7cd5c4369405a6e
67adf6f7c6d120fb725f6d36d85d5a9d43ef81f3
F20101221_AAAFHU krediet_c_Page_074.tif
be421a64cf905732cf9680546cb1ebe1
a4c67063e07c2837819696c9f5885792a7adc48b
F20101221_AAAFIJ krediet_c_Page_110.tif
7cf7738ff1b5bf4869b67f5912b2f35c
a71f35609c4aa83d32f7c78418ecf2657b66b7e7
F20101221_AAAFHV krediet_c_Page_075.tif
3ef271cced4c4fb520de60f7f96677c0
6bc688424c13037a0f4571462a5b77b0472ecc66
F20101221_AAAFIK krediet_c_Page_112.tif
5ef6f9e524152269dd4188570a8793ef
6ae0c2b385ba4c99f43361b194722045a683fe86
F20101221_AAAFHW krediet_c_Page_076.tif
fbe8586df990f8db3b1d674fcda54636
cf3c26ed5185a8888292bf33e961245e720e88d5
F20101221_AAAFIL krediet_c_Page_114.tif
4df4aea532bc36e374349a66840e7497
bd9910dbaccb4c57f70c494993113991a0ee2dad
F20101221_AAAFHX krediet_c_Page_078.tif
7852a9f327f29411be9a8d5c376564dd
a618f70b7b11589e04d601c3e7d3d02882b1a730
55254 F20101221_AAAFJA krediet_c_Page_014.pro
7bf10e7fbb9ac75ec59f331dfbab51e6
7dbc08977b30211059482cc4a7bc1d23f8ca62c2
F20101221_AAAFIM krediet_c_Page_119.tif
da6ccf210f1308c0ed8ccbfc6c157e6c
64e7f1f22ea60b28a47bea3b962c42128e74bb25
F20101221_AAAFHY krediet_c_Page_082.tif
b6b60a169f053c21c5da35b0c0530679
8480874770ef19f176ebe080bb55b6e81d70c91e
58117 F20101221_AAAFJB krediet_c_Page_015.pro
c4aeef7dea8be6bad32caf760541834c
3e1197b794b885ce3bc955e73bb7b83111b40d9e
F20101221_AAAFIN krediet_c_Page_122.tif
e7ded205a3bd79b3ab00698d91fd271f
b4f222416b4af5c5767fefdc3f0227a6797c162b
F20101221_AAAFHZ krediet_c_Page_085.tif
d161f44561956df456da931ee9c0e6df
1e5435c56397fe47c0f4da96db78ae16bb36d1c9
1855 F20101221_AAAEGA krediet_c_Page_147.txt
cb164da8cc69bbdb28fda2d72cd6ffb4
f5453a5fa89707c5573961a4383b4bf108036199
56919 F20101221_AAAFJC krediet_c_Page_019.pro
6461a3b547d97dc37e7cc3a3fea31101
e313ae59e40683b87bc4a920c3a376ea7ef5bbc6
F20101221_AAAFIO krediet_c_Page_124.tif
f7a3c29effa70eb554115e63afb70e14
7632962d0c4d91161edb9e23347c8444fbde064a
1051974 F20101221_AAAEGB krediet_c_Page_133.jp2
e753f43821fd57d731b1f503bf0b2e53
0217bf37ca75ef809dc6ed4ee3b8d10b102ed9f3
55647 F20101221_AAAFJD krediet_c_Page_020.pro
77e89504576d2f2548236ac0ef50f553
8d4406c54b8b74d2f349b81a6fe237f7c6cf4400
F20101221_AAAFIP krediet_c_Page_129.tif
a8a36c7b5e8b232fc061c03cd8c2615f
50593e7ab3f1c7d71fda3e597aac240982240c0a
F20101221_AAAEGC krediet_c_Page_111.tif
ac52dfc4182530e7750bf45d9911d507
4345043cf4d9a97a5c77e16de0ca751b51c02fa9
54475 F20101221_AAAFJE krediet_c_Page_021.pro
555cdc3f14dd0eb7c4cff8654653237b
44282fc95cca82ae21ade23082e9ab042cfa25e0
F20101221_AAAFIQ krediet_c_Page_134.tif
dc30e7ee2a1182fb560b9c81ef44d5e9
b2ba3922a0734aa9dfce982413ef34ae62608c62
24084 F20101221_AAAEGD krediet_c_Page_051.QC.jpg
4ca23b9902e35464b187aa40d817cc47
416ad4128d1b30bf4edee998848ad383aac4988b
56108 F20101221_AAAFJF krediet_c_Page_023.pro
fb856bdf16d10c3c478508d90d15bb58
f47c47af7161624cc7b7d3d2831c771d03f3c0db
F20101221_AAAFIR krediet_c_Page_137.tif
89ced217d9e091a9d54c4b32592da96c
94cf3ee488a67338527b346924f18e351f602ab1
F20101221_AAAEGE krediet_c_Page_048.tif
74dd714c7e5fb67571b4b2e85ff7a764
2ba36534f131274ead7a9f727b58c43a1fe7f5bf
55670 F20101221_AAAFJG krediet_c_Page_024.pro
a6229b8fbf7556b5dea5d3763c04c50e
b7bce725e1c27c31b34b178ec0169fc36c9f21b8
F20101221_AAAFIS krediet_c_Page_139.tif
c5ce11ee0f625e4197604cb86c19326d
5e64e2f29ba092979373cfef8081642ac65256c3
F20101221_AAAEGF krediet_c_Page_060.jp2
982f07084e4b2ebe6ffe8ae737071ee6
b32476a8ae4b2b714a0b67f2aa460009f826e143
52025 F20101221_AAAFJH krediet_c_Page_027.pro
9b179148c6d07268649d9a982d7d4bf8
c615b118feacf3ad6226b400b76ae967bc891b48
F20101221_AAAFIT krediet_c_Page_140.tif
80830e05300087dee325d82a42dd07ad
603aeee1b5d28a0352161fc12d7b27c5a8128956
F20101221_AAAFIU krediet_c_Page_144.tif
0355ef27d9aec0dfa3c8d19d78810909
327b28f7c4b75a88a3e85af815a1408d9e9f4eed
104549 F20101221_AAAEGG krediet_c_Page_027.jpg
569aed09a222099f5fd115bdbdbd33bb
f636d959365d07f18b02b44c06aafbeba94f5d07
56929 F20101221_AAAFJI krediet_c_Page_032.pro
0afbc9fe76a15da25cc43a9d62361cce
acdf87a9b175d2665c6b35a74169e1b91b72ee6f
F20101221_AAAFIV krediet_c_Page_147.tif
00dd74a0241c73d3839f6df7a9c91501
95a264833cf84b9becadd7c9c66f13ff93dd2232
16111 F20101221_AAAEGH krediet_c_Page_099.QC.jpg
08f44324e79e272fb1a3b2957cc14e46
3ddecfc3b2f64926625f700367e3b01df6b5de7e
56061 F20101221_AAAFJJ krediet_c_Page_033.pro
6829b081d3b5a13b2a071a627830f19e
ca21886d85646ed3a78a55ee3a5849cdf7f4de69
8361 F20101221_AAAFIW krediet_c_Page_001.pro
636415c6c798eb295825a8974689288a
f66207db69fddf2c1be65f142185c2837c0b4e3b
24507 F20101221_AAAEGI krediet_c_Page_002.jp2
e5cb3f6f9ca4b02f1f292c8959e76044
8d4b832fd4d7cd5b5c7dd505d2c84e9a3b2ee0c8
40086 F20101221_AAAFJK krediet_c_Page_036.pro
e80af6a833aabe5dde41315092893101
aa77b8a98552be6f49ed428e13517e0f49378145
857 F20101221_AAAFIX krediet_c_Page_002.pro
aade4472e6880556f4755bdeae09cfd8
6e6e348060dd7ce2b7e39dfe92ae436fd7529d60
55667 F20101221_AAAFKA krediet_c_Page_068.pro
902539fdc3990f1b859385f084c2b143
e6e2d002109b3d5e2c2d420bb34053cd011abee5
2610 F20101221_AAAEGJ krediet_c_Page_136.txt
5cc5f811c6243d63e4e3fcd585358950
cd534356754f6c51996ecab946f2ba423dcdefe3
52500 F20101221_AAAFJL krediet_c_Page_038.pro
6ce64d9801025714d0526c31ac829456
fea19c25f473a515b4837a5d6b1cf7975f3e6895
51880 F20101221_AAAFIY krediet_c_Page_012.pro
3edaf55856cebbe8988e309d61cd93eb
c0621f3ca8214acfffced44dafacffe8fcd7bf72
19228 F20101221_AAAFKB krediet_c_Page_073.pro
c411faa3c9345235bb6e14ef9d97d47c
2dee36b26b10c98ad9d1f28f726a66ad53f9bda9
1051943 F20101221_AAAEGK krediet_c_Page_054.jp2
8415823de1db68d0981aeee58394aa68
530f2936f5e37f2f152aa33e625d9ff4a00353dc
53703 F20101221_AAAFJM krediet_c_Page_039.pro
d377095bd60d43ca25979a9d6d3a8bde
9bedcb7dabe5619af0e9abe73262679b957472ee
55635 F20101221_AAAEFW krediet_c_Page_022.pro
ec93d094e8ad55311b6d8c473cc543cf
fd2e867db4eb1d8d0fcb5b51d98ea0fb6a51ff67
13771 F20101221_AAAFKC krediet_c_Page_077.pro
2934c70bd66741020c030643e91bc5e6
7af371ddcb3a08b23e9ecefbfcd9818eee064be0
55346 F20101221_AAAFIZ krediet_c_Page_013.pro
63f582ede74b8a6dc1fb73b79f9c33de
208a41619d0c57faa9bdfd204178dd5da3e477de
56038 F20101221_AAAEHA krediet_c_Page_026.pro
b2242c6b866912092b7d34b2895d7d19
5eb3c82f82577c0e15a7942c667ed003068ed2a7
F20101221_AAAEGL krediet_c_Page_108thm.jpg
aa4ab209aa925b157cb5146adfeaaf83
b473ce475dde262568d8f96ec6291ba191160b37
53964 F20101221_AAAFJN krediet_c_Page_040.pro
7e3168da2339a23075660fb17ac4b196
5d16b968eefa87473e0dc683eec2ffeb6ed62d20
36200 F20101221_AAAEFX krediet_c_Page_013.QC.jpg
81df9714ee011d152514969cb2db3c06
73e1c798039204d52d8bb1f2a07f226702f21d6c
11999 F20101221_AAAFKD krediet_c_Page_078.pro
3484b5338f00e5b3a3f90c08df47c74d
c240bc0e66f7ba29d4a85f4a6d3d968573b41e5b
F20101221_AAAEHB krediet_c_Page_103thm.jpg
026c1431a5cdc64a5abf3d9556931fc1
b7f1610ad990233b512af0f417188c68f5b1270e
F20101221_AAAEGM krediet_c_Page_032.txt
7fcfedc30573eadef2d90e77c5803b32
122f82070b463acd3c7ec35a546590f473585428
54462 F20101221_AAAFJO krediet_c_Page_041.pro
f1cb64920ceaa9b775289058ada45683
0d8c362b6c35eba49ec38f141831ae6ed8a684fb
F20101221_AAAEFY krediet_c_Page_038.tif
b7b687a2a6040610224c68c8071d4fbd
994dde8e9b03acff2338e01a6f1253f67ddfe71a
12681 F20101221_AAAFKE krediet_c_Page_079.pro
12af515da3fa424c2b2068ca5157ecb1
118ce02718b5b294e10361f38a62f17786a3e73a
65567 F20101221_AAAEHC krediet_c_Page_144.pro
2956963d8ddc739e22d3d6bb862c85f7
0a7aeedfea4fa2954d10ef835369e1c0d0f6d56c
37578 F20101221_AAAEGN krediet_c_Page_053.QC.jpg
cdbca9011c0da10b6dc530bd350d77d8
ac77f04e662a58746fbbf1d7d399d03d7d489515
53881 F20101221_AAAFJP krediet_c_Page_045.pro
be7e35fc8706e44d7bebee0e1d7d9954
ced1f7bad00341f26acfafc6f1a818bdc4bd308a
9188 F20101221_AAAEFZ krediet_c_Page_039thm.jpg
e9af9ca60eb35954e291bab60240a98f
bfa1a9fd7c753e5b0ee2a2c8e6d5cd354c8df90a
54511 F20101221_AAAFKF krediet_c_Page_081.pro
74ccb823f19ea7050526508c560255fe
961ceb3ee13c2daf91d6f9505c759a210884b83d
55937 F20101221_AAAEHD krediet_c_Page_102.pro
a49a35f56134444a8a1d0f3a6f282ee6
623040777f5952bc320507e289804eac7f46359d
115893 F20101221_AAAEGO krediet_c_Page_143.jpg
89ca400d17125a227e60773f7f64a49f
1e435b2fa93a7255c383c14af929d7b9f5824bdd
55696 F20101221_AAAFJQ krediet_c_Page_046.pro
d5749398eba6a0d9057c9651510020a7
7f8d1052b090505543aa68aa9b61926e1bd97151
48920 F20101221_AAAFKG krediet_c_Page_082.pro
0d6ec9f334b100e5354a0b29a13995ca
52c3dda156d5a88d92b702e15e496bd354ef5bc2
56729 F20101221_AAAEHE krediet_c_Page_124.pro
9a78bc54137102aaf8bb3be1e31bfed2
209b51c8c843c0672e68366437ff7407dd2a2b53
8948 F20101221_AAAEGP krediet_c_Page_026thm.jpg
ffc152b62a47b118806b082c0ceabfa1
9de6b5f729ed66302e0708a00181be921b896708
87648 F20101221_AAAFJR krediet_c_Page_048.pro
b51f9015ae4a4a7bf64b0de96a64b2d3
6e911fa44fb9334d290a4b20b8bedb3d1b232b82
56187 F20101221_AAAFKH krediet_c_Page_092.pro
32005a1e960148f37f5f1ebca1570d66
bb52330d461afba1a323493e6aa64c299303a97d
57921 F20101221_AAAEHF krediet_c_Page_074.jpg
6771fde478957c59dec7534160233061
c738f0a97cb196c79073952b8f1f13d9d86ea8ea
114898 F20101221_AAAEGQ krediet_c_Page_028.jpg
1e589aab07694c002800c26301e1eec6
1b4f93a0796ce80d44d85b246e543bab3614c0bd
14830 F20101221_AAAFJS krediet_c_Page_049.pro
bf6798fb3ad7647600f6c7d407bf3c89
681deb8e461397d7d3e2549a34b3d42d4b3adbfa
12026 F20101221_AAAFKI krediet_c_Page_095.pro
4f0297e7fe47d8f9061845be742c7e4d
ba2724efcf3ca757910812ead7dd9aef99acf392
9001 F20101221_AAAEHG krediet_c_Page_041thm.jpg
85990c978ffbe1d8017301a69d656891
bbdd4e6861bb9d2ce94c93bf3e6b8e00863e0eb0
37036 F20101221_AAAEGR krediet_c_Page_137.QC.jpg
1545aa750b17a263f54a14957cb05420
4ba0fcbe2c777b0d70b125929a0100e648733e8b
15534 F20101221_AAAFJT krediet_c_Page_051.pro
ca62dd1bdf052fac7c53f6b9ab690d8b
f7d7ec8a39bf97fa13c2d67977d4f65e34ad0424
113125 F20101221_AAAEGS krediet_c_Page_033.jpg
8beecd730d17f69eb6d88a56e09d270f
225b49aaeea1d074421ddbce3d38197ea7210956
50459 F20101221_AAAFJU krediet_c_Page_055.pro
5a0229fd1f7e59f01fa110870a5dee4e
39283a4102eabbaf02452081cc8bfa2b0a627e03
13708 F20101221_AAAFKJ krediet_c_Page_097.pro
f62218a3f11d87a1d572a27633a0e504
9c5233015518ae0a54e2b76d64aac3d53662c3b7
564680 F20101221_AAAEHH krediet_c_Page_100.jp2
34bccf677d805f4d95d40c601b50af34
9092eefb836deca1515f61b9f94d60da9a2286a9
26491 F20101221_AAAEGT krediet_c_Page_147.QC.jpg
85d0b281994bf22794e3cfd98ca6959a
07e402a05976ce5faa631c98a315f5bc4fe31465
58086 F20101221_AAAFJV krediet_c_Page_057.pro
25dec1e9ff1d9427b0b24900d6203f34
417e721648dc8fb778ffe4bb37e9b7dd70c5e2f2
15909 F20101221_AAAFKK krediet_c_Page_098.pro
e0aee2a8d20625ce140b47562d26e0d4
55b3126fa08d65000fecfaf7e604eee8fad63d77
1013385 F20101221_AAAEHI krediet_c_Page_037.jp2
a46af1b44b274182d240272c494ffc8e
58576257c91a48f097f608cf66fa89cb2da3f7af
F20101221_AAAEGU krediet_c_Page_131.tif
fdd3b4826eff2d8a0184ec3b5c7f2574
841380a3361c4a85193579c7174a23be1e9e01e8
55915 F20101221_AAAFJW krediet_c_Page_058.pro
5ecdb2df6d0116984a23fc07e9bf1eac
f8f22e2b76d7277fa93c15a0a9ab793cb17767da
66162 F20101221_AAAFLA krediet_c_Page_129.pro
aa2c12d9ee442f4d698c46238562e60f
b5a3c9f738fd6278d2306f3a12af911d48ac0b13
15723 F20101221_AAAFKL krediet_c_Page_099.pro
8690057820a3a79652209e141191b221
10107ef45a286bb67ab0b7fbd5958d9920dd853a
F20101221_AAAEHJ krediet_c_Page_146.jp2
5d64f761d77dce90055c9108d7807948
77174d7ef1a7d696af4f495728f2bdf4b4cc0737
9446 F20101221_AAAEGV krediet_c_Page_003.jpg
44cf5a80b9b03c86d83a6bfdc9f64678
b77a467439cc4a5f90814bbd06c608f9672e98ae
50834 F20101221_AAAFJX krediet_c_Page_060.pro
ce66c16a94681ab3ff1a3b1cab665b98
fbf953f3b6d17484d12e5b0c6c0acec3220815f2
67517 F20101221_AAAFLB krediet_c_Page_130.pro
0a20713f515aa54cf7ffcd5944191a27
26cf6523320abf618d784e9e3b8a3f842d8a765f
15526 F20101221_AAAFKM krediet_c_Page_100.pro
b59470015c748081d717a9cb460e0b58
26544e3baacc103dea1880c6284ad52de4e4c9ce
F20101221_AAAEHK krediet_c_Page_029.tif
a2c2d5723014441ce11f46af08df0583
9de00668d6270e7dc38abedec875d404175fe387
2076 F20101221_AAAEGW krediet_c_Page_061.txt
131909231f2da1393d7b072b32b64543
fc4eb2abeb33b3c0e16dddb576d51931684b1db7
54024 F20101221_AAAFJY krediet_c_Page_066.pro
1f2a8a62fb21c26da4bf68951da87e5f
cf0ccd34e011dc94077266c2d98dd4564e08393f
67511 F20101221_AAAFLC krediet_c_Page_134.pro
194f39592ff71b643fda434ab138d2bb
0b033d0f09b442fc7b2b259f98d6dfa2f8ef12d0
53737 F20101221_AAAFKN krediet_c_Page_101.pro
208fae2e0c79c1a543116be024d75719
3f3bc709a6162aedf2d4b9058a83b1a11289b5e2
F20101221_AAAEHL krediet_c_Page_088.jp2
9dd151e61e6849382ad2f85ffd61bbfe
bc8017865e53f500ab6dfaf615d4de253efdf6bb
532068 F20101221_AAAEGX krediet_c_Page_099.jp2
3ce4f692540bc70737fbb41b893f96e5
8a230229ff52caad08af9595d346631dfa0b455b
55985 F20101221_AAAFJZ krediet_c_Page_067.pro
7250e5f9e9789ff00fe9c3c29aee3814
ff4e37009ae92cd84b679b0d1845f55d1a7b66b8
F20101221_AAAEIA krediet_c_Page_059.txt
d2c41693758acff2685577a40e5a72f9
a9a238ddb093fdacbeacd0d50ebac4f7c361248c
68172 F20101221_AAAFLD krediet_c_Page_135.pro
1d2fec81ec669c74edba48a21edaed39
d911f35b25fa54d0b20a9e0b213af790074df655
54870 F20101221_AAAFKO krediet_c_Page_104.pro
9806830b5ea45f2f7819f8a2b3d715c1
1c5a47795d6478a9452bbf01f7935ce303a31b9e
23719 F20101221_AAAEHM krediet_c_Page_119.QC.jpg
2aa91060443560e3740132037552c1d8
8b4354913ef6a2d74905576f11f79eac2fe8aa22
F20101221_AAAEGY krediet_c_Page_048.jp2
eb0ca7134e35a36f76c9618dec6ef0d4
f9b3c36a427f1af3d7fb1cfe97e56b835df5a5f3
35449 F20101221_AAAEIB krediet_c_Page_116.QC.jpg
baaa8a2ea5f70dfdbe12bc2cf902a2d6
544720cfa4b0155b0381f336ef90a713a0ec89dc
63406 F20101221_AAAFLE krediet_c_Page_136.pro
0474a88237bf9ad8cbeeed88eaf24159
e10ae787876d7be8df7c9c8ca3f319569de248c4
54835 F20101221_AAAFKP krediet_c_Page_105.pro
d0c031c72ea57c3e32cebe7ec67ea46d
da928c3cbc4d2e02433f255f30c6ef5634d2a2e0
F20101221_AAAEHN krediet_c_Page_014.jp2
fc04db43c3e7881beffdcd3573f14dc8
3c5d472cd1f9a84fbe973390cc509cddb825d29c
F20101221_AAAEGZ krediet_c_Page_041.jp2
3996bb9542e877db6d0074703bf3eb1d
d67df8ee3ed8549b85beef08173ec1da3058a554
66436 F20101221_AAAEIC krediet_c_Page_148.jpg
bbc91bd35c993ed6ed0877dd4d3b1f9e
179b1bd17572a439a02cc904f000a6468c1b2da4
66749 F20101221_AAAFLF krediet_c_Page_137.pro
5843c8a1174a57915d780bfbb20f37c0
4f74e4501ed3c17f6e59976ec7dd7ea40b4cb7ef
52274 F20101221_AAAFKQ krediet_c_Page_112.pro
fbbfb4615c1b943eb21ec80d0668ecf8
5a629dcd63dc0b55d3834bd4595ce4854f37ad11
4023 F20101221_AAAEHO krediet_c_Page_048thm.jpg
64006aa513c6a6f8458e99383c664e4b
10d4077be5d532b11fc8f033164a85aeee6a6eed
124540 F20101221_AAAEID krediet_c_Page_136.jpg
53314f4b7bbc47ae0e83a38e335d39e7
a611205f20c5ac1d25a98c2a8a5b0fa6a5725603
60839 F20101221_AAAFLG krediet_c_Page_138.pro
91f4b1ef97b2dfda6449595fcbf82f4d
9fdb310aa4e7a3f69cf19b290a104af3cc534236
55137 F20101221_AAAFKR krediet_c_Page_114.pro
f6916c2424a7c0ab07308228e56afcdc
37f5628ae363e77ad54990703d11fa1293fbecec
8719 F20101221_AAAEHP krediet_c_Page_032thm.jpg
a56ab2ae38087b4f51bd3966da5533c3
88beea8c806bcb53140d6a08cd299774e9d5d1cd
56711 F20101221_AAAEIE krediet_c_Page_053.pro
027db82a2ee701e8533672aec36a34ae
80ec086b9e3add6571812857cd0bd5da2ac6e2c8
66562 F20101221_AAAFLH krediet_c_Page_139.pro
ce2d456d0080a9c5b2f2eb9082390dbd
8f91c4ddc160f076f175ce7c8c968a7bf9c0c9c4
F20101221_AAAFKS krediet_c_Page_116.pro
2608e5c3b80a944685baa59085529a62
e0fbed2df471f58779ca551beff7dab63e23e917
36935 F20101221_AAAEHQ krediet_c_Page_081.QC.jpg
29f60aea45095f7b604fcec6c6fe5d45
e9a2068f745b44e65de345274c4057dbf46090d3
1051933 F20101221_AAAEIF krediet_c_Page_109.jp2
482a2293b538eb543a78016a42ee2b83
fc940c783cdddd175e36fae0cd8b48cc32605841
66102 F20101221_AAAFLI krediet_c_Page_145.pro
21b3215bed5fbccd4108350be3eb5055
8101058199e83cf49be21c6c61a1a673e6bbbe19
55261 F20101221_AAAFKT krediet_c_Page_117.pro
d13a0e03658f8a8688094172b94254f5
4a764187eed7e0a8039ebc917afaa0b819b7d1ff
22281 F20101221_AAAEHR krediet_c_Page_008.jpg
ae3bc7552a3470c0e9c4a03d32e73dfb
4fbb65e7475fc1bef5e2b49d4b208b7bd9abf71f
2200 F20101221_AAAEIG krediet_c_Page_092.txt
d61dc8ba9e671b850d40692d506d1095
45ecae19d7f357879cd95580b4606c3ee8707cc9
44620 F20101221_AAAFLJ krediet_c_Page_147.pro
b11c90b939ae244802821f3a635814a7
25324b2decc14446d2859dbfab88685c65ca9829
29218 F20101221_AAAFKU krediet_c_Page_118.pro
bdbb5ef5ecfa181ad36e7de5d6eb1bab
51f0156e6acbd44665c1b0154b3a7f9cfe97e493
F20101221_AAAEHS krediet_c_Page_096.tif
1a4cc2066d548f8a6b5565871702729d
f6efe2bef5651091938f2604b4ff66b654f01ce5
36665 F20101221_AAAEIH krediet_c_Page_109.QC.jpg
af9457987f04c91d9c0c51038d5a4cca
22dc8c7df28712af160987ff3b6ceeb0f809190a
29558 F20101221_AAAFKV krediet_c_Page_119.pro
971526114add680d391cf373cc5b9c2e
656f278912681eccebba252ddc263018a94f18a7
F20101221_AAAEHT krediet_c_Page_016.tif
76acd606fa9c5a0c2f38794369d74672
9630403ae52d49ad0e36ef3bba0564b68dcaad50
29936 F20101221_AAAFLK krediet_c_Page_148.pro
f4f1758dd61a27af01db218404226d38
0632209c32facd41328a6752a1ea2c24e865c7f5
27822 F20101221_AAAFKW krediet_c_Page_120.pro
581b9a1e3fd7eaedf131fbc6bd470b25
3391fa196168add832eecd666f9544c448cbe86b
F20101221_AAAEHU krediet_c_Page_040.tif
6a74f23ef3df37627ba74c5a1ccf89ac
e54e60d6fb1f0eef276234dcccc302b33a27b6e2
1051915 F20101221_AAAEII krediet_c_Page_064.jp2
ea80f260d1c83e688ea15120769130b6
cdf54bd5c3ed2820a7e0a9dfbb59db02a3368781
2237 F20101221_AAAFMA krediet_c_Page_030.txt
1b864cc6c7c02cf6223a387db7a8acf4
b6b1ac3867f5b4814b7c14888a5f753f2071e720
499 F20101221_AAAFLL krediet_c_Page_001.txt
5b8537d09075b3ef6117fec6007f135b
5845d509d763d5278a3c3cb83d80197ded5c7143
19265 F20101221_AAAFKX krediet_c_Page_121.pro
d2e3cc1265b51a4f49e854c12b2b9336
d0297fca3e63a0446123856dc48777fc1bd46558
F20101221_AAAEHV krediet_c_Page_019.jp2
c610d9377bbbdb8a01a21a000380b4c8
7f23ee12822c07a66a12b6cd2390dd07f89af587
F20101221_AAAEIJ krediet_c_Page_009.jp2
de01cd2ac66e2128e75cfc6543e50b62
0f270b4a94909014cae1ab4bb44a364ec82c80e7
2005 F20101221_AAAFMB krediet_c_Page_031.txt
5763eee4e54901339cd8e050620b9072
e60ee203d3b679dee1ff1e39d4ab064c9f84f6ce
210 F20101221_AAAFLM krediet_c_Page_003.txt
88458627bd9317c1629de6c6ad109d48
ad0cc19aecf54a463339debb8cca831717b6927b
52543 F20101221_AAAFKY krediet_c_Page_125.pro
1f2aa573fd0aea05a6a07ee70c3b3c8c
7d1d448e6771bc928fc14e59dc59b83a43435c75
34666 F20101221_AAAEHW krediet_c_Page_125.QC.jpg
3c30aa67125fcd1c07f531743bbcf76e
c52260c8b29a4bcdd74da841d00e2401f41836c5
F20101221_AAAEIK krediet_c_Page_090.tif
9ac9947a6ab57c321189566b03bf239d
84f4ba17658087a7b30e420fa59ebbb6c61d4b22
2230 F20101221_AAAFMC krediet_c_Page_033.txt
ef3c5e413822c09b7dbc50f53ee21a4e
e2442215e6334b02753cb4d62fbefd4315080eaf
3271 F20101221_AAAFLN krediet_c_Page_005.txt
6a4fe127d53e9e2fcbd5596a49cae0ca
18e7bca2cfec474449b127da440cef03f6754ec0
61970 F20101221_AAAFKZ krediet_c_Page_128.pro
be3df958899e42a391c45b7a5ca7aa21
ec34d92d8e3571f3ce66f3e8c3ef69710721fa58
27006 F20101221_AAAEHX krediet_c_Page_127.pro
3a23f116d1ac1022b873410aefef1120
54912698f9be90207e2bca04dd03d1205a992d19
16644 F20101221_AAAEJA krediet_c_Page_079.QC.jpg
e1b63d26fc2a967746a1e9b4a7156d37
32b8896a5f8e52f2dbcde821c252f6546c3daa07
F20101221_AAAEIL krediet_c_Page_063.tif
da5dada49d1320d970011f8a45a3af75
e5255ee6f072cc07907703d4adfb6135c7aea8ce
2137 F20101221_AAAFMD krediet_c_Page_034.txt
8d49744a05670c2901f909cea8d17357
6840fec7667ae9e7934535932d22006f966ac5ac
3753 F20101221_AAAFLO krediet_c_Page_006.txt
e39c56d10dd64031695547052c3e8228
aaed786f4fbf3a3a4c8f7ef5acbfdf48abde2032
37293 F20101221_AAAEHY krediet_c_Page_038.QC.jpg
da80f940a0abe314590b3d605c8c0fd9
ec870c68883c81fbebf8892efafe83db44b31b03
F20101221_AAAEJB krediet_c_Page_130.tif
bd02c04e4cc64820541e8edd48fbb11b
a84d839039c2622836f4d3865c3d0874e4e27993
F20101221_AAAEIM krediet_c_Page_101.jp2
fe1504ceb1f7d30578af7c87086a9bde
f8cfbf0b0a4046f2e53fad0646fdce6020c18908
2089 F20101221_AAAFME krediet_c_Page_035.txt
a58d132ab3a520b3a7a274f947ab46c4
427d057a58365a19c14eeca02ab8275210fa9a19
455 F20101221_AAAFLP krediet_c_Page_008.txt
cf0f488b6f4c0996fc227101775409fc
31674cf85a2878d2e4643fb159c9e1302d37a431
F20101221_AAAEHZ krediet_c_Page_112thm.jpg
a0d01a468d2b7dcd9c1f6f20c82756ea
da7a202131bfe4b641553ddbd8283856db885cfd
34071 F20101221_AAAEJC krediet_c_Page_012.QC.jpg
51a0ff1ae4ed099a94542e9a8338ac98
4e8ea8dce3c6ce8240e0d2ec46ac15cbf93ff4bf
F20101221_AAAEIN krediet_c_Page_131.txt
2f5c9deb9ec4d2823005703d078ababf
44c45ae8de283003baccc8e5905bc819158d791d
2124 F20101221_AAAFMF krediet_c_Page_039.txt
1b29ee99f26d8865dc620deb6c8c8645
c3b59233887d9eb8a308446ae00480059c708ffb
2189 F20101221_AAAFLQ krediet_c_Page_012.txt
dc9ee8db5bdaeebe5d69f962f377b171
9b18cf8cbee8932e1026e03541ea2d663315fb15
2138 F20101221_AAAEJD krediet_c_Page_021.txt
ec608a3fdff2bac3ce7bc4f47957f8f1
b37eccc29410fb0a82ba68b08be6749b8eae097e
796 F20101221_AAAEIO krediet_c_Page_097.txt
16d93ed744695c43c0a141d35e334ede
6bf9f3ac7cb8e18f3832aef9f75dc1a0ba790f9d
2127 F20101221_AAAFMG krediet_c_Page_040.txt
530a0f5a4d596c39723a0469d9bfe84e
ee57d70c9535a691a62e0f0841f1ce873d31291e
2208 F20101221_AAAFLR krediet_c_Page_013.txt
8463896fb9a84b89bb3e42d9c6aba796
16a53f370a6db8ad4a2f3c2a0c6bc838ee7a9d05
55411 F20101221_AAAEJE krediet_c_Page_103.pro
79c5a7905d14575eaf2bd3aed4d71aba
c6bc605d91584fb1583892f0fc78909d2d8c4676
7678 F20101221_AAAEIP krediet_c_Page_010thm.jpg
00f2332360f0393510175d0e5668636f
c0e0eb9682ef1c7ed3ebcb7b715bae2b7b8ffd0f
F20101221_AAAFMH krediet_c_Page_045.txt
62f486c47dc59e7587623f013a0d6839
49f7a918dbcdbe5ac34cef47f129fb05bd1bdf59
2299 F20101221_AAAFLS krediet_c_Page_015.txt
f42ee6e1cf6130ff038e7fb09ae228a2
08a8847a7e9b7eb7473678ee9460ea70cb49c214
F20101221_AAAEJF krediet_c_Page_092.jp2
fef344f8d96959faeb5a74ae73249e97
ea9a00881f4176c48a51d3e57ad7d33e178f934d
F20101221_AAAEIQ krediet_c_Page_029.jp2
0464f3cb356a0562168df5f4990f0b1c
7e62d7da9a26f2159b59e42cd9ec8f37a6e12231
733 F20101221_AAAFMI krediet_c_Page_050.txt
e888e64fe7032cd0973322f57679a177
0941c95dd5039f46b861d1cd184c82720f2e4ab9
2016 F20101221_AAAFLT krediet_c_Page_018.txt
c23a088d03b6c5dacc67d062996b1146
c9c3fac7b910f166ba4b0eacfae483bf4ad40fe7
F20101221_AAAEJG krediet_c_Page_012.jp2
658597c28a0877a573955ba95462d2a3
e58b3b2cef2a6997fdc419ea6e5476ec8bce376c
384487 F20101221_AAAEIR krediet_c_Page_097.jp2
9d1ba24ea02a00001cfa7de754c89859
70af5740c7aae62089d54f4a16996d1d25dc644a
812 F20101221_AAAFMJ krediet_c_Page_051.txt
9b69a2d1a73508669941d765e15bbc42
4245d737041a1d9fdacdc46b75e156835571dbe4
2251 F20101221_AAAFLU krediet_c_Page_019.txt
ecdd4912bad731632706975994f0f036
e23bc6d3b76dc044f0e03a0ee211a86fd556d399
F20101221_AAAEJH krediet_c_Page_033.QC.jpg
ec603408070091096eb7cab0079294e0
0db1ee52aa53a50dcdd267aba7cfc74f190d067e
109092 F20101221_AAAEIS krediet_c_Page_115.jpg
72ecfb2d2ec33ebc93073aa74afabd29
f3e3e81fc69ab623e40ea3aa4a621cc3255bf3c2
2220 F20101221_AAAFMK krediet_c_Page_053.txt
c58eab1326182ced1a47d5cc99da5cb7
ef4f4d3a2e1501dcb64a8957b656d7866acab793
2211 F20101221_AAAFLV krediet_c_Page_020.txt
a33e241cbc2f5633319f4737f4033d3b
1e8ec5bc7a8e4ee94de0ea877368cc430b551747
F20101221_AAAEJI krediet_c_Page_047.tif
c470f8e8551adaa4f4f38e630dbe2424
d6a0ee2b66bc9fc198df78ac67a9b7c157f63c83
57185 F20101221_AAAEIT krediet_c_Page_028.pro
e1e523579bd46e13c9b3642b50454fa9
8b50e5e1ed825de36d8db7ae5e6a8eb7f17a005f
F20101221_AAAFLW krediet_c_Page_024.txt
3cc3a08688adefdb30a53ea1937383ab
ad8d39e93e2fcead4e25a5fea784d47cf8173be9
F20101221_AAAEIU krediet_c_Page_088.tif
53a09092381f00dd04a13b35377aea1b
274a6ad3bbf49ed69d9087fffe349f9997972e6f
2186 F20101221_AAAFNA krediet_c_Page_080.txt
27db39f097ca369b37d284d067045939
2ae7f6cdc48a0d4b8351b115f06a279b017348cd
F20101221_AAAFML krediet_c_Page_054.txt
6906d766887488e831897b8f7f637a36
1f468a7730b1b11a165f96e80858e8d2ec3e5fbf
2202 F20101221_AAAFLX krediet_c_Page_025.txt
24fafdf03d2797febec4796a32195d9b
fa3b79ed33c7a79d39045400f8a4cb42ef2d4e6b
2264 F20101221_AAAEJJ krediet_c_Page_042.txt
f2e86aaf6e377034da9aa9f7f4a9b972
0ffaa32ba815cfa4cdca4eb8d3a5f1503a620927
114024 F20101221_AAAEIV krediet_c_Page_046.jpg
f69ac8c6cc71011b88b4d65ce83da806
b7369dfa5789d778fc8b8aa7668beb2017c658c3
2134 F20101221_AAAFNB krediet_c_Page_081.txt
a43b61866b5afe18ab39a13dd8320cd7
eda72d5c6b82de4b574237254ce1cd5d378a0741
1999 F20101221_AAAFMM krediet_c_Page_055.txt
abb087bd3b4c85b09b697ad1663c4211
e848c24333937af905263756f4db39b6304b708e
2243 F20101221_AAAFLY krediet_c_Page_028.txt
63ca672cc215e565484aa6a87da9a153
ae46ff3e7943e682299276bf07ae495fd296dd0b
39549 F20101221_AAAEJK krediet_c_Page_096.pro
fca5968abe0ffc40a1213e64d29e0be2
cd2d0dc8b92d5d0e474f35994edc88568b199f75
8985 F20101221_AAAEIW krediet_c_Page_058thm.jpg
4a2c9e7c19575c67090da778935091c7
cd867d4aaa8a41a8d8b29140e70c9a3daff9c0da
2157 F20101221_AAAFNC krediet_c_Page_085.txt
bfd5048588d432b0031aed7eae092a55
c0451698ba1dfe2a1acfb24d9c6b6420e9c53c41
2159 F20101221_AAAFMN krediet_c_Page_056.txt
93685f6741add107d0e9db8c413a9359
109c97e44d6de284ca65a6c3ef76abdf4f4bc30a
2228 F20101221_AAAFLZ krediet_c_Page_029.txt
8bd52c91ad0e8cae903df6489552f2ef
7f14103d572843aaab6b8665be4d28247f20beef
24289 F20101221_AAAEKA krediet_c_Page_070.pro
7329e282afc8c9efbb0018aeee4d5881
7597f8a2cfe4a4ca7a4d6e578ad3e383cfa8d501
68166 F20101221_AAAEJL krediet_c_Page_133.pro
a6522bbc3917a43fbb90a86aaca50bc9
ad77b5151a0ece43cb7be9cf4ee5c43c037b7afa
68598 F20101221_AAAEIX krediet_c_Page_131.pro
0a036298e57caaa79045f14ec33e3957
b6f72fd7ea473f49a1dd3a06ae71fede77a6bb20
2068 F20101221_AAAFND krediet_c_Page_087.txt
bf0438c749d5eaf80a93d306c693599e
a9c958147a7545e1f4085a27f56ebeab56a1ed02
2191 F20101221_AAAFMO krediet_c_Page_058.txt
0341e25dace92e2606ab46b61fd48e75
ea6829f04c2f6c4bc7f0aa88ebc989b7755b5d91
38089 F20101221_AAAEKB krediet_c_Page_144.QC.jpg
9fbebd539ae56731c4744ff1d97cdaca
625c66a78bcea748ee1168ef16061d055077f5f9
F20101221_AAAEJM krediet_c_Page_020.jp2
3492b2686138ccbb850c41bcde1829e7
c14a47d1e71a3ce42be701ae151121563a4ac0e6
9022 F20101221_AAAEIY krediet_c_Page_014thm.jpg
bde398f329f6a8af633aae82ece99ee7
3a01476cfaaddabc5a879ca5dc7a4672c936979d
F20101221_AAAFNE krediet_c_Page_088.txt
2dd672dee847b6b5a704da22999b2b19
d3aacd65f4245fc451390a1f49a2451b35a58d13
2151 F20101221_AAAFMP krediet_c_Page_062.txt
424960dcbff6d72476855cb84f1a8303
e7560217dc6dbc773cf2ce44c6d1ef65e469f14f
F20101221_AAAEKC krediet_c_Page_034.tif
45c71a4a20074fa7861a1fbb3710c4ad
b9a67aadffd8969e42a76f23b705444a106edb5b
51497 F20101221_AAAEJN krediet_c_Page_016.pro
86ece61d4a1684c1afc6736e9191656a
c229a6f826e4054c496eaf31ca7e00d3484aea40
9184 F20101221_AAAEIZ krediet_c_Page_081thm.jpg
ec9dec8961cb0e6f52079abc7e04250e
21cfc0cc7a7dcebcc2877a6c0562f124f5f792f7
2119 F20101221_AAAFNF krediet_c_Page_091.txt
c36b1befd71d362bae306925f1e449d8
c8465e83c3d056cff672a8773b45b6f83ca87d5c
2091 F20101221_AAAFMQ krediet_c_Page_063.txt
9b02f4b0cd23c4971a4ff8c2924cbbd6
d90804fc0b7ffe34ea582bfcfeb1f9a4c511436f
F20101221_AAAEKD krediet_c_Page_111.jp2
7869b54d770e4d11f958ca02ae6d1cae
ff25e0c6e8f698c82315249ae02385e1aa5565b0
F20101221_AAAEJO krediet_c_Page_064.tif
0769cb482a2c919f785a53d4f2f24dc0
bf11cfa26cb64823f25706b74ee1a229c036bb72
2128 F20101221_AAAFNG krediet_c_Page_093.txt
34fea1134b14bf7701dbf7b40f129d05
3b8e41d522167ad20a06539229174fc001c3fee8
F20101221_AAAFMR krediet_c_Page_065.txt
676608e62d3c55bdd8e4b6ea35009d84
453fbaab9facf24fb3327a87881bce7e34144727
41637 F20101221_AAAEKE krediet_c_Page_077.jpg
cf3ad2c0a380c4b36542fd4e18c2b957
1f17530cd132c836d526ea5d6964774915545c97
F20101221_AAAEJP krediet_c_Page_148.tif
106e0c3ea5b322328137cf420ea7ed11
237d1dfbee83bac0e718934c19b256307f58dc6f
522 F20101221_AAAFNH krediet_c_Page_095.txt
5bff03653b06cb175dc600e12bd59838
01b12081f3528cefea4f807db6f360c8022f7dae
2195 F20101221_AAAFMS krediet_c_Page_067.txt
ce57435c62b95cab0f81223582b76bab
cc4c6c9b4f31f61c8877806cb473bf1a4c2daea4
8489 F20101221_AAAEKF krediet_c_Page_006thm.jpg
22b7faf5406a26151bc4036d75251084
926e6cc865fe8d13e08b49fa9d94ff131a5a98f6
F20101221_AAAEJQ krediet_c_Page_125.tif
330d3a986f4a568c89760ab1f2a910b6
12da89b2b606f782fdab89e0abed4cef390218d1
F20101221_AAAFNI krediet_c_Page_101.txt
ff6965be2b635a163b0aeece8b5632df
4cefee0b53fbbac9564897e9194801397de05a42
375 F20101221_AAAFMT krediet_c_Page_071.txt
62366bc8d673bd1cca3599e206a2a993
bdf8844e59477e42a1d32416bd85945d9d9350ae
F20101221_AAAEKG krediet_c_Page_077.tif
919297f9c5336c4cb50062f7930f6619
1ad6ff343ec1e02d1d79cc089332068729e92a39
50712 F20101221_AAAEJR krediet_c_Page_031.pro
1bca2db7ceebe1706521c356cf76f4b6
db14f338b46a45737da51d12c73eb0a1c9761e5a
2170 F20101221_AAAFNJ krediet_c_Page_103.txt
647a03dddd2e717727d03e4c5f185b02
3c0c234378e878e5168308cd62c15ab12ef69557
880 F20101221_AAAFMU krediet_c_Page_072.txt
fdc2c4d553d76c0662dda73099354c1e
ea26a2b24b3b03a9ac3db2e80fc70e18782ac688
8653 F20101221_AAAEKH krediet_c_Page_106thm.jpg
18aa60ee1c672e53d4f0d40c87110774
726d59769925b1a943c613239d40f32a96474823
4888 F20101221_AAAEJS krediet_c_Page_118thm.jpg
5819911fc6dde988ed304ed3ee5695cd
237098d2d9b4aa00fb020e409a9bd9eaa2169fee
F20101221_AAAFNK krediet_c_Page_104.txt
bb117696b36128813be52d9af697712e
606909df14d8388605cb5e38201688b703a90cc8
F20101221_AAAFMV krediet_c_Page_073.txt
a2c0f5e3836c4e443fc5219e6f9d9f51
a077d5620b6cf5c258d7dbe618e40da33d34591b
37152 F20101221_AAAEKI krediet_c_Page_111.QC.jpg
3cf78ea507ffed19da66fe4636992b2b
3684794597d6c5a717cd2977340a865d744d692a
F20101221_AAAEJT krediet_c_Page_127.tif
1c561e872687b4e859d00f01089b72aa
e3101e2c74db190c287ce81e6fada88a09b5fd2d
F20101221_AAAFNL krediet_c_Page_105.txt
9306e9ad5550e4d134b3b87f16e6184c
75c572d381a80f9fd6b6f7c3ce02adf65307e6a6
940 F20101221_AAAFMW krediet_c_Page_075.txt
d2d7084170de5054af040723821ac777
ae2607c6d9795a2508b2e4f31f7445df73498d32
9216 F20101221_AAAEKJ krediet_c_Page_053thm.jpg
971ee6c480ac5609b42990898381f10f
3a10de9b45c15ab67b68287786e2c7054bb91f7c
1051963 F20101221_AAAEJU krediet_c_Page_080.jp2
2122a081354ec13123c5b9101665f998
ea51f3ec4a244bc53838dfabdaa2124454326a0b
2702 F20101221_AAAFOA krediet_c_Page_129.txt
f4d02814900394a7a2379a1eeff03962
3495b92ce9bc3add76ff5183f2e70ce361c3b990
596 F20101221_AAAFMX krediet_c_Page_076.txt
2363752a6106b28c102f71c1f27384e1
9b09c9d2c673823274ea95beda6ae351e6bf0f43
1051909 F20101221_AAAEJV krediet_c_Page_043.jp2
7e9a7c6ddaae394af01242f15c1d03e2
897ffd3e79e7a5c5c9d3907f9f66ab475608a700
2770 F20101221_AAAFOB krediet_c_Page_130.txt
19423d18a625815af40ca0d5c01bb4c8
ace9b2b8ef6fc39b9473b7c5b08d01385940da4f
2136 F20101221_AAAFNM krediet_c_Page_106.txt
59233ed33ad9164615c44336bf55b71f
69d31d5e59dc83b2b8addc53f0c2706ace8437f9
977 F20101221_AAAFMY krediet_c_Page_077.txt
3fbc2e089a72e93d38ef22b2988786ff
68e132fcfbda53359afb8142ca1fd8bf8e240695
F20101221_AAAEKK krediet_c_Page_141.tif
056d7eb59c8935fbf75be5edb7723a97
6f732156942cac1b9f48b0c482b13681d3bcb8de
107148 F20101221_AAAEJW krediet_c_Page_106.jpg
e99f7c5825b1e134c1f7370ade620511
c310fb03a1e3aa8a291002087a9faa008864cf6c
2628 F20101221_AAAFOC krediet_c_Page_132.txt
b2248b9dc1b0dc9ca97348447b6cc008
2610b58676eb2713aa7ed389b3a95cf8daf8037a
F20101221_AAAFNN krediet_c_Page_108.txt
baf6f3562980fb68382bc88077c6e971
5435f0344390ab2638ff8ba331ed809de2d00283
751 F20101221_AAAFMZ krediet_c_Page_078.txt
50622cf40441cea9186908273813a544
f16ebecb751fae41bc27bc87a3b1372f7e0c2b1b
1282 F20101221_AAAEKL krediet_c_Page_011.txt
f10847e6f82481dd7f751e0f4ea0eb31
e0799d3fafb201ab0352aaf4bc353821fde1d6b8
1051961 F20101221_AAAEJX krediet_c_Page_123.jp2
b0718a35fd934d14a0cac5dd0767f84f
925f71b6dce3db473f2a66996f05f1c7787e229a
F20101221_AAAELA krediet_c_Page_117.tif
ef8ce1acdaca8a53b484d7192e39cd7a
074a3f0c9bec9ffd200f320065f320e1bb0c8958
F20101221_AAAFOD krediet_c_Page_135.txt
666c81f288415df24c6c8c98ec088bec
1b75a211f18dbdcb3d4768da0c5c4cf57689d41c
2058 F20101221_AAAFNO krediet_c_Page_112.txt
ee3f90fb59616c36353415b285bbc001
e0de3148f7339493410d9f73a72851d4bcd85def
33127 F20101221_AAAEKM krediet_c_Page_018.QC.jpg
bcded9d69581d8740140aa31d8ebb780
0d4535eb97e655de1e8b0a81bf8ac32e5a26e3b5
F20101221_AAAEJY krediet_c_Page_086.jp2
8b70515cf3dec1ef0c5392a2dbf28252
e70a35cb4c4b3d15e4e797f4826283f8bc2ec3bc
2456 F20101221_AAAELB krediet_c_Page_009.txt
a492d6abfed548911dcffed64b7f74e5
3fbbcc4649a0151d6358171be32146e162cb66bb
2748 F20101221_AAAFOE krediet_c_Page_137.txt
ac7372928d0174622617790ade8c100e
c0806a73b042afd5b9852e39403c801472fb1e5a
F20101221_AAAFNP krediet_c_Page_113.txt
b54bd85b029e0bcbc2cc2768ea057724
1a40875d85c1f59a9c5e03a138a4c45d0af502f3
114469 F20101221_AAAEKN krediet_c_Page_022.jpg
f25e0ac7e033093e1e32d121668e347d
575c16485708e13e9cfbcb2bff19ae24c70186d9
108748 F20101221_AAAEJZ krediet_c_Page_063.jpg
05fd94cb8782e2675b67e2338201f658
ced61b9f5ec38fefd0ff6c4047fe5f004d65cb63
16966 F20101221_AAAELC krediet_c_Page_098.QC.jpg
481a73be6a1353eed8f4e36b233ff47f
67f5c3c0167891b6c1336924a9ee60e40b1bed64
2502 F20101221_AAAFOF krediet_c_Page_138.txt
e67f2937c1705de822ba7d8a495024e1
4070236cc71f18e39419fa350343d898b79532e3
F20101221_AAAFNQ krediet_c_Page_114.txt
a21e501dbae3a089fe4786f54e38dd82
079c8efaa26fcbd66170f1034e7f28091c4e66ca
595036 F20101221_AAAEKO krediet_c_Page_074.jp2
da6a690fbd2d4a2dec92c1140c7a076a
b57b94dbfceaa91e9a811e2fce4e36bdfe4189ac
F20101221_AAAELD krediet_c_Page_014.tif
3467ed78a23977c7a691a755f589a580
b560433499a105d1511e463ddff9537e93c59f04
2598 F20101221_AAAFOG krediet_c_Page_142.txt
dfcf651dfe5b3d02860e77221344a06e
bc8069b08f1943ac52c0695618cb3cca18d42bad
F20101221_AAAFNR krediet_c_Page_117.txt
6d52b948d95dab05b5203cfd70524ac0
7f931f701a2e157c27286254aad23bd3c1cfc29d
8887 F20101221_AAAEKP krediet_c_Page_029thm.jpg
88318fcede395e3dc2022e8c70257376
3eb0be147a4f77939f2cc2657066e5ec725abd73
37704 F20101221_AAAELE krediet_c_Page_134.QC.jpg
8d1443f43a34c7890efd9c1f39436fe0
a19367b7cf5153fbed7467338b225cc6be8c1d41
2503 F20101221_AAAFOH krediet_c_Page_143.txt
3aeb40e4d71d951727456dc1d5f0c3f4
3657702ff8275844aa8883255bd84a1728c4df13
1166 F20101221_AAAFNS krediet_c_Page_118.txt
930f7f8d96722c8cd6556751268e5e04
b30b4f9ed3270b4b269fc26ce238eb7fc3d06875
114279 F20101221_AAAEKQ krediet_c_Page_032.jpg
3d73566d55c9c355d9e6d43dc12a1b51
6d78d3553b267e8003118a2b0ffd6dbebddc47ea
F20101221_AAAELF krediet_c_Page_135.tif
4b4e2271741e0f306ea3aaf98f1b809c
38cef8ef2a8d880b0c3c0d4ebbaae5cd16b46fbf
2679 F20101221_AAAFOI krediet_c_Page_144.txt
2bb1d6e45c0780eb44e763afae096a22
e6b92af320462efef07275571bbac1596310e408
1370 F20101221_AAAFNT krediet_c_Page_119.txt
1eeb15b6602f811b167a8895e9f7cc63
1258c82e848ee88e93b90bcd4d700cc3c0dc5406
126507 F20101221_AAAEKR krediet_c_Page_138.jpg
fbf876892742bebb36dbf8f2483eaabe
779ef88dfc80f7f4e6bb0dd1bd3e0f3f63eecd88
91 F20101221_AAAELG krediet_c_Page_002.txt
94c42e62c02e8ba1c4c4b7c328c059fa
f88e9d8f5c3f5fe3aae5f7e0bbea1f9f466bedd2
1236 F20101221_AAAFOJ krediet_c_Page_148.txt
0af060c297bbb0a89672da93d18b9dc2
b698287d1bead8fa6b25c90147041eda58fe1af7
1200 F20101221_AAAFNU krediet_c_Page_120.txt
9a46e21ce71ffe68ee720a2b53502757
e3111edef00bcea1ae45f4b3785f5751af8d1770
F20101221_AAAEKS krediet_c_Page_026.tif
3eb92cb647b420f5f3936a273e51ae3c
54acd24f884411279925c163387cf18271b55121
3045 F20101221_AAAELH krediet_c_Page_050thm.jpg
dbfa1b2a8a65af6811e2cc2ed1bb0bf3
9d2ee84207e1c2119264ed0202d6b45d06bd8bc0
786148 F20101221_AAAFOK krediet_c.pdf
0568e3afd2abd3efb07cd92d3177ae4b
4ac202edf9188960d53fa271fd48c4bbda723453
864 F20101221_AAAFNV krediet_c_Page_121.txt
1335109e0ebbe6c0d9d4c13f20959569
33df96a3a777954a791a89c5a2da993841e375d6
38264 F20101221_AAAELI krediet_c_Page_139.QC.jpg
f20032529f983025ec8c47de9846dd49
a8815a9a0bf551d23cfcb74c25a39ff3d28a5f65
5661 F20101221_AAAEKT krediet_c_Page_098thm.jpg
e283be41392bec8bc049d8ce5e7731d0
5f6e4204b0b0b9f1b1c67f88b30c3a9f23669a5d
1141 F20101221_AAAFOL krediet_c_Page_002.QC.jpg
8b3509433e4c434e0116ed6cc24c368a
0a594cacb83340301105f983f1cf0a5990522fa6
F20101221_AAAFNW krediet_c_Page_123.txt
f7ffed69572c6aa1a33768f33c3d8886
4194e4cc1a5a0f8797671fc429caaf9b719f7462
1092 F20101221_AAAELJ krediet_c_Page_003thm.jpg
63ee99c86ab707dd49631d3e133d5ce6
dbebf5deeb3d8912c03550a18858ddf6b83d81dd
F20101221_AAAEKU krediet_c_Page_145.tif
14f3b5af4c6f9a7b13da1eca9bd808b1
8e2e54d1b1050e3e62be07ed60fd0fcff566806b
8231 F20101221_AAAFPA krediet_c_Page_016thm.jpg
5b3de2c0e277784812e6a6c5441d9783
c8b6e6d3146817f6789b20d90fd9008f15486d77
543 F20101221_AAAFOM krediet_c_Page_002thm.jpg
a4a4e9df0e31987fd4cab0aaf57b5d3a
9f9e11f46ae5510b5610ae3f58214c1195a6af4d
2100 F20101221_AAAFNX krediet_c_Page_125.txt
60ff4fde462b64251d292d3ff6e9cb2c
a6422f0459caf377cfa08daa1669d29064effae4
F20101221_AAAELK krediet_c_Page_138.tif
5d89ced2ca86d9aafc69545296390b85
22860e981a94b89e8433f113c9e3ba9615af6aef
114895 F20101221_AAAEKV krediet_c_Page_053.jpg
93d815a5316a7da14c82038561c52db7
c2f297860764428d7028b4d8c0c1aaac45f9ad55







INTER-KINGDOM SIGNALING AND CHARACTERIZATION OF A CORAL WHITE POX
PATHOGEN, Serratia marcescens

















By

CORY J. KREDIET


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2008



































O 2008 Cory J. Krediet
































To my parents, who have always supported my academic and personal endeavors and have made
this achievement possible









ACKNOWLEDGMENTS

I thank my supervisory committee chair and members for their mentoring and research

support. I thank the members of my lab, especially Dr. Mengsheng Gao for her mentoring and

research guidance. I also thank Dr. Matt Cohen for valuable statistical analysis and Dr. Erin

Lipp for the use of environmental isolates of Serratia marcescens collected from the Florida

Keys. Support for this research is recognized from National Geographic Society Committee for

Exploration and Research, Lindbergh Foundation, Protect Our Reefs, UF-IFAS SNRE and UF-

IFAS SWSD. I also thank my family and friends for their continued encouragement.











TABLE OF CONTENTS


page

ACKNOWLEDGMENT S .............. ...............4.....


LI ST OF T ABLE S ................. ...............8................

LI ST OF FIGURE S .............. ...............9.....


AB S TRAC T ........._. ............ ..............._ 10...

CHAPTER


1 INTRODUCTION ................. ...............12.......... ......

1.1 Value of Coral Reefs .............. .....................12
1.2 Coral Biology............... ...............12
1.3 Coral Reef Decline ................ ......... ........ ............. .......... ................13
1.4 Anthropogenic Inputs to Coral Reefs .............. ...............15....
1.5 The Coral Holobiont .................. ........... ...............20.....
1.5.1 Symbiosis and Nutrient Exchange. .............. ...............20....._____..
1.5.2 Signal Exchange ........._... _....... .._ ...............21..
1.5.3 Other Zooxanthellate Symbioses............... ...............2
1.5.4 Coral M ucus .............. ...............23....
1.6 Coral Bleaching .............. ... .. ...............25
1.7 Coral Diseases and Management ............ ...... ..._. ...............27..
1.7. 1 Examples of Coral Diseases .............. ...............27....
1.7.2 Characterization of Coral Diseases ................. ...............29...
1.7.3 Virulence Determinants in Opportunistic Pathogens .............. ....................3
1.7.4 Disease Management ........._.._ ..... .___ ...............32..
1.8 Virulence Factors in Bacteria .............. ...............33....
1.9 Hypotheses and Goals............... ...............36.

2 MATERIALS AND METHODS .............. ...............38....


2.1 Bacterial Strains, Plasmids, and Culture Conditions. .................... ...............3
2.2 Manipulations of DNA and Plasmid Construction ................... .......... ...... .................. ....39
2.2. 1 Identification of gacA in Serratia marcescens PDL 100, White Pox Pathogen......40
2.2.2 Construction of a Plasmid that Contains Arabinose-Inducible gacA .....................40
2.3 Complementation As say ............... ...... ...__ ...... ...__ ...........4
2.4 Carbon Source Utilization Profile Using Biolog Ecoplate Assay .............. ...................41
2.5 Enzyme Induction during Growth on Coral Mucus .............. ...............42....
2.6 Proteinase Induction in Response to Coral Mucus ....._.__._ ........_. ........_._......44
2.7 Presence of Lumichrome and Riboflavin in Coralline Algae ........_.._.. ... ......_.._.. .....45












2.7. 1 Thin Layer Chromatography of Pure Compounds .........._.._.. ......._.._...........45
2.7.2 Methanol Extraction of Coralline Algae .............. ...............45...
2.7.3 Solvent Partitioning of Lumichrome and Riboflavin ................ ........._.._.......46
2.8 Induction of Coral Larvae Settlement and Metamorphosis ........._.._.. ... .._.._...........47


3 PHENOTYPIC CHARACTERIZATION OF A CORAL WHITE POX PATHOGEN,
Serratia marcescens................ .............5


3 .1 Introducti on ................. ...............52........... ...
3.2 M materials and M ethods .............. ............ .... ....... ...............5
3.2. 1 Carbon Source Utilization Profile Using Biolog Ecoplate Assay ................... .......56
3.2.2 Enzyme Induction in Response to Growth on Coral Mucus ................. ...............57
3.2.3 Protease Induction in Response to Coral Mucus ................. .........................59
3.2.4 Statistical Analysis .............. ...............60....
3.3 R esults............... ... ... .. ........ ... .... ....... .................6
3.3.1 Carbon Source Utilization Profile Using BIOLOG EcoplateTM Assay ................. .60
3.3.2 Enzyme Induction in Response to Growth on Coral Mucus ................. ...............62
3.3.3 Proteinase Induction in Response to Coral Mucus ................. .......................65
3.4 Discussion ............ ..... .._ ...............66..


4 FUNCTIONALITY OF THE RESPONSE REGULATOR gacA IN A WHITE POX
PATHOGEN, Serratia marcescens ............ .......__ ...............80..

4. 1 Introducti on ............ .......__ ...............80.
4.2 M materials and M ethods .............. ...............84....
4.3 R esults.............. ... ... .. .... ...........................8
4.3.1 Molecular Characterization of gacA in Serratia marcescens PDL 100 ........._.......86
4.3.2 Functionality of gacA Through Complementation Assay ............ ...............87
4.4 Discussion ............ .......__ ...............88.


5 BACTERIAL QUORUM SENSING SIGNALS AND SETTLEMENT OF CORAL
LARVAE ................. ...............101......... ......


5 .1 Introducti on ................. ...............101........... ...
5.2 M materials and M ethods ................ ............ ............ ........10
5.2. 1 Extraction of AHLs from Coral-Associated Bacteria ................ .........__. .....106
5.2.2 Biofilm Formation .............. ......_ .. ...............107.
5.2.3 Extraction of Coralline Algae Compounds ............... .. ...............109..
5.2.4 Thin Layer Chromatography of Coralline Algae Extracts ............. ................110
5.2.5 Induction of Coral Larvae Settlement and Metamorphosis ................. ...............11 1
5.3 R esults............... .. .. .. .............. ... ... ........1 3
5.3.1 Consequences of AHL Hydrolysis on Coral Settlement ........._._.... ......._._.....113
5.3.2 Isolation of Coralline Algae Compounds .......__. .......... ._. ........._._. ....11
5.3.3 Roles of Signaling Molecules in Coral Larvae Settlement ........._._... ...............115
5.4 Discussion ................ ........... ..116........ ....













6 SUMMARY AND CONCLUSIONS ................ ...............122...............


6.1 Value and Decline of Corals............... ....... ...........12
6.2 Characterization of a Coral White Pox Pathogen ........._.__....... ._._._ ......._._......122
6.3 Potential Regulation of Virulence Factors and Disease Management. ..........................124
6.4 Coral M ucus............... .. .. .. ...... ............2
6.5 Settlement and Metamorphosis of Coral Larvae .............. .....................126
6.6 Future Directions .............. ...............126....


LIST OF REFERENCES ............ ..... .__ ...............128...


BIOGRAPHICAL SKETCH ............ ..... .__ ...............148...











LIST OF TABLES

Table page

2-1 Bacterial strains and plasmids............... ...............48

2-2 Primers used for PCR. ........._..... ...............49..._........

2-3 Carbon substrates in Biolog EcoPlates .............. ...............50....

3-1 Chromogenic sub states ................. ...............71................










LIST OF FIGURES


FiMr page

1-1 General schematic of a coral polyp and of surface mucopolysaccharide layer (SML). ....37

2-1 Construction of an arabinose inducible complementation vector ................. .................5 1

3-1 Carbon-source utilization profiles of bacterial isolates. ............. .....................7

3-2 Correlation analysis of carbon-source utilization profiles of bacterial isolates. ................73

3-3 Average enzyme induction by Serratia marcescens and coral associated bacteria
during growth on coral mucus .............. ...............74....

3-4 Average enzyme induction by Serratia marcescens and coral associated bacteria
during growth on glucose............... ...............75

3-5 Correlation analysis of enzyme induction for all isolates during growth on coral
m ucus .............. ...............76....

3-6 Correlation analysis of enzyme induction for all isolates during growth on seawater......77

3-7 Cell-associated proteinase induction in all isolates during growth on coral mucus. ........78

3-8 Extracellular proteinase induction in all isolates during growth on coral mucus............. .79

4-1 Model of regulatory pathways leading from GacS/GacA to downstream genes. ............95

4-2 Clustal-W alignment of the GacA protein from the White Pox S. marcescens and
other characterized GacA orthologs............... ...............9

4-3 Phylogenetic tree comparison based on the gacA DNA sequence in common bacteria....97

4-4 Complementation of uvrY mutant in E. coli with Arabinose induction.............._._..........98

4-5 Complementation of uvrY mutant in E. coli with glucose repression.. ........._.... .............99

4-6 Complementation of uvrY mutant in E. coli with no sugar induction ................... .......... 100

5-1 Coral larvae settlement in response to microbial biofilms..........._.._.. ........__. ........119

5-2 Coral larvae settlement in response to the synthetic AHL 3-o-C6-HSL. ........................120

5-3 Coral settlement in response to synthetic AHLs and lumichrome/riboflavin ..................1 21

5-4 Swollen aboral ends of A. palmate larvae in response to exposure to lumichrome. .......121









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

INTER-KINGDOM SIGNALING AND CHARACTERIZATION OF A CORAL WHITE POX
PATHOGEN, Serratia marcescens

By

Cory J. Krediet

August 2008

Chair: Max Teplitski
Major: Interdisciplinary Ecology

The surface mucopolysaccharide layer (SML) secreted by corals is a rich environment

where bacteria proliferate. The activities required for SML colonization by bacterial pathogens

and commensals are unknown. Serratia marcescens is an opportunistic pathogen that causes

white pox disease ofAcropora palmata. To characterize mechanisms of SML colonization by

S. marcescens PDL100, its ability for carbohydrate catabolism was characterized. A

complement of enzymatic activities induced by growth on coral mucus was identified using

defined chromogenic (p-Nitrophenyl) substrates. Pathogenic and environmental isolates ofS.

marcescens induced a suite of catabolic enzymes during growth on coral mucus. The

characterization of glycosidases induced during growth on coral mucus demonstrates that

Serratia marcescens relies on specific catabolic genes for its colonization of acroporid SML.

Induction of these specific enzymes also provides insight into the types of bonds found in coral

mucus. BIOLOG EcoPlates were used to characterize the ability of several isolates of S.

marcescens to catabolize model carbon sources. Serratia marcescens PDL 100 showed high

correlation to other pathogenic isolates as compared to environmental isolates of S. marcescens

and native coral-associated bacteria, suggesting that this coral pathogen may have originated

from anthropogenic sources.










Coral larvae prefer to settle on substrates that are colonized by coralline algae or by

biofilms formed by coralline algae and associated microbes, however, the perceived cue is

unknown. Both bacteria and eukaryotes produce vitamin signals with newly discovered

functions in QS and host-microbial interactions. The hypothesis that known signals commonly

associated with microbial biofilms may function as settlement cues for larvae of stony corals was

tested. These settlement experiments involved C14-homoserine lactone, 3-oxo-C6-homoserine

lactone, lumichrome and riboflavin, each compound functions in bacterial cell-to-cell

communication and contribute to settlement of marine organisms. Presence of AHLs,

lumichrome and riboflavin in coral-associated microbes and in coralline algae was investigated.

Transgenic microbial biofilms expressing AHL-lactonase were constructed to test the

consequences of AHL hydrolysis in larval settlement. Chemicals were also impregnated onto

C18-bonded silica resin to simulate biologically relevant release rates of the compounds into the

medium during settlement experiments. Acropora palmata larvae appear to respond to AHLs

and coralline algae, however, trends remain unclear.









CHAPTER 1
INTTRODUCTION

1.1 Value of Coral Reefs

Coral reefs are among the most diverse and biologically complex ecosystems on Earth.

These ecosystems are found all over the world near the equator and attract people year round

with their pristine and exotic qualities. Besides the inherent value of these wonders of nature,

coral reefs are valuable to the rest of the world in a number of ways. Coral reefs have been

estimated to be annually worth $375 billion (Costanza et al. 1997). These ecosystems provide

economic and environmental services to millions of people in over 100 countries as areas of

recreation, sources of food, jobs, antibiotics, cancer-fighting medicines, novel fluorescent

proteins for biotechnological applications, and shoreline protection. Polysaccharides produced

and excreted by corals are a maj or nutrient source in reef ecosystem (Brown and Bythell 2005).

Coral reefs and the neighboring coastal areas account for 3 8 percent of the goods and services

provided by the Earth's ecosystems, which is more than terrestrial ecosystems account for

(Cooper 1999). In Florida, coral reefs contribute at least $2.9 billion to local economies annually

(Johns et al. 2001). The capitalized reef user value in southeast Florida is $8.5 billion (Johns et

al. 2001). Unfortunately, the state of coral reefs is not so positive. The world' s coral reefs

currently face degradation and destruction from naturally and human induced events and are in

desperate need of protection. Approximately 60 percent of coral reefs worldwide are currently

threatened by human activities and nearly 10 percent of the coral reefs have been severely

damaged or destroyed (Cooper 1999). Without coral reefs, the ocean's ecosystems will collapse.

1.2 Coral Biology

In order to fully understand the stressors facing coral reefs worldwide, it is necessary to

understand the basic fundamental characteristics of the corals themselves. Corals are ancient in










origin, appearing nearly 400 million years before present. They are in the class Anthozoa in the

phylum Cnidaria (Ball et al. 2002). Coral polyps are physiologically similar to hydroids and sea

anemones.

While corals themselves are quite small, colonies of reef building coral (scleractinian

corals) are able to produce massive rock-like structures with varying shapes and colors, which

act as a natural barriers to coastal degradation. The rock-like structures are actually the calcium

carbonate (CaCO3) Skeleton, which is secreted by the coral polyps. Typically the growth rate of

this skeleton is rather slow (0.5 to 2 cm per year), but times of favorable conditions lead to more

rapid growth (Edmunds et al. 2004, Edmunds 2007). Coral reefs are limited to specific

conditions (especially temperature) and are therefore only found near the equator (Nystrom et al.

2000). Generally, no one specific factor (abiotic or biotic) determines the distribution of a single

species. It has been suggested that the distribution of a species is dependent on interactions

between an abiotic gradient and biotic interactions between species (Travis et al. 2006). Such

species interactions are vital for coral recruitment. Trophic cascade interactions have been

shown to enhance recruitment rates due to grazing fish limit the amount of macro-algae and

increased substrate availability; thus facilitating coral recruitment (Mumby et al. 2007a). There

are many indicators of the specific conditions surrounding a reef and the implications of

changing conditions such as the diversity of the reef.

1.3 Coral Reef Decline

The health and success of a coral reef system are naturally maintained through occasional

natural disturbances (e.g. storms, predators, temperature fluctuations) so that it does not become

too productive. Disturbance is defined as a sudden event, which changes the nutrient status of an

ecosystem. This may be an enrichment disturbance, where additional resources remove the

limits on the carrying capacity, or a destructive disturbance, where part of the existing









community is destroyed, releasing nutrients for the remaining community (Harris et al. 2006).

Causes of extensive coral mortality may reside in a single or often many natural factors that

include low tides, volcanic eruptions, and increased temperatures. Scientists are beginning to

focus their studies on five maj or causes of natural disasters: storms and hurricanes, coral

bleaching, diseases of reef organisms, outbreaks of coral predators, and mass mortalities of reef

herbivores (Brown 1997). These sources of disturbance to coral reefs have received the most

attention because they have been found to often cause the most devastation to reef communities.

The impacts of storms and hurricanes to a reef community are determined by a number of

factors, all of which may vary with each storm and reef affected. The intensity of the

disturbance, the resilience of the system to disturbance, as well as, the history of disturbance at

the site are all important in measuring the damage and how quickly an ecosystem will recover

(Brown 1997). For example, prior to the early 1980s, Jamaican fore reefs with high coral cover

at 75% had not experienced a severe hurricane for 36 years. In 1980, coral disease and hurricane

Allen reduced coral cover to 3 8%, however, the reefs recovered due to the presence of urchins

(Mumby et al. 2007b). The long undisturbed history of these reefs and the abundance of

herbivores to combat macroalgae enhanced the resilience of the system after a relatively short,

yet intense disturbance.

The capability of ecosystems to deal with disturbance is determined by a variety of

characteristics such as genetic variability within populations, diversity within and among

functional groups (e.g. reef builders, grazers), and diversity of habitats (Nystrom et al. 2000).

Ecologists now associate stability with persistence, resilience, and resistance (Nystrom et al.

2000, Walther et al. 2002, Hughes et al. 2003, Bellwood et al. 2004) and the mechanisms by

which systems return to states of equilibrium (e.g. juvenile growth and gene flow (Edmunds










2007, Vollmer and Palumbi 2007)). Persistence simply refers to the existence of a community or

population over a time period (Karlson 1999). The definition of coral reef resilience depends on

ways of interpreting ecosystem development (Nystrom et al. 2000). Recently, ecologists have

reconsidered the role of disturbance in terms of complex systems, which include multiple-

equilibria, nonlinearity and phase shifts. Therefore, two prominent concepts of resilience have

resulted. The traditional and most widespread view concentrates on stability near a single

equilibrium state, where resistance to disturbance and the speed of return to equilibrium are

emphasized (Nystrom et al. 2000). Resilience denotes the recovery of a system towards

equilibrium after a disturbance that has physically altered the community structure. Highly

resilient communities recover from disturbances quickly but are not necessarily indicative of

high resistance. Therefore, resistance refers to the ability of the community to minimize the

impact of disturbances (Karlson 1999). The second definition focuses on ecosystems in

dynamic, non-equilibrium environments with multiple stable states where phase shifts may occur

(Holling 1996, Mumby et al. 2007b). Resilience, in this case, refers to the amount of disturbance

that can be absorbed by the system before a shift from one stable state to another occurs.

1.4 Anthropogenic Inputs to Coral Reefs

While some disturbance is essential to the maintenance of ecosystem diversity, persistent

disturbances with increasing intensity may greatly influence the ability of a system to recover.

Recently, awareness regarding human ability to alter natural disturbance regimes and thus

influence coral reefs and their potential for recovery following disturbance has increased

(Harvell et al. 1999, Nystrom et al. 2000). Human activities (both direct and indirect) often lead

to disturbances equal to those that occur naturally (e.g. tropical hurricanes). Both adult corals

and larvae are susceptible sedimentation, eutrophication and contamination from waterborne

toxins (Minton and Lundgren 2006), which consistently occur in reef ecosystems. Coral reefs










typically are able to reassemble and recover from routine disasters (Bellwood et al. 2004) but

when coupled with human disturbance, reefs show decreased resilience to disturbance. The

major difference between natural and human-induced disturbances is their continuity. Natural

disturbances tend to occur in a pulsed manner (e.g. tropical storms and coral predator outbreaks),

while human-induced disturbances tend to continue and accumulate (e.g. nutrient enrichment and

pollution) or occur so frequently that there is little time for recovery (e.g. high fishing pressure)

(Nystrom et al. 2000). Over time, even a low level of such chronic stress can have severe

impacts on coral reef ecosystems.

Ecosystems facing persistent disturbances often undergo an ecological phase shift

resulting from a loss of resilience. Many reefs that suffer reduced stocks of herbivorous fishes

and added nutrients from land-based activities have shifted from the original dominance of coral

to a preponderance of fleshy seaweed (Nystrom et al. 2000, Hughes et al. 2003, Bellwood et al.

2004). It is often difficult to predict such ecological shifts, as awareness of the full consequences

of human action lags far behind the impact (Western 2001, Wallentinus and Nyberg 2007, Mora

2008). This inability to detect and predict changes on a regional basis can be seen as an obstacle

that prevents appropriate decisions regarding management and ecological restoration efforts

(Harris et al. 2006, Vollmer and Palumbi 2007). If human modification of the marine

environment continues, diversity within and among functional groups (e.g. reef builders and

herbivorous fishes) may decrease. Coral reefs with decreased diversity within functional groups

may maintain ecological function but additional disturbances may shift those groups into another

stable state in which large-scale degradation and loss of essential ecological function may occur

(Nystrom et al. 2000).










Global climate change is regarded as one of the maj or threats to the future of coral reefs

since increases in temperature of only a few degrees induce global-scale episodes of coral

bleaching and mortality (Hughes et al. 2003, Mora 2008). Temperature is the leading cause of

coral reef decline (Hoegh-Guldberg 1999) and increases outbreaks of marine disease (Harvell et

al. 1999). If trends continue, the levels of atmospheric carbon dioxide will increase and the pH

of ocean waters will decrease (Fung et al. 2005). The increase in sea surface temperatures and

decrease of pH increase cause stress to corals and increase their susceptibility to bleaching and

disease.

Anthropogenic run-off and sewage pollution can lead to nutrient enrichment and

eutrophication of waters reaching coral reefs. Through increased human activities, corals are

exposed to growing loads of nutrients, sediments and pollutants discharged from the land

(Fabricius 2005). Increased loads of nutrients and particulates may drastically alter the dynamics

of the reef ecosystem, not only at the level of the symbiotic relationship between corals and

zooxanthellae, but also at the community level. Massive macroalgae blooms result from nutrient

enrichment of otherwise nutrient poor waters. These blooms physically outgrow sea grass and

adult corals, inhibit recruitment of juvenile corals, may lead to hypoxia and/or anoxia, as well as,

decreased fisheries and reduced biodiversity (Howarth et al. 2000, Lapointe et al. 2004). Corals

may also be out competed by other filter feeders (e.g. sponges, bivalves, ascidians, bryozoans,

and barnacles), which are more efficient at utilizing particulate organic matter (Fabricius 2005).

This may occur, however, only in areas of low light where corals lack the photosynthetic

advantage over other filter feeders.

Nutrient enrichment also directly influences the dynamics of the coral-zooxanthellae

symbiosis. Zooxanthellae densities increase in response to high concentrations of dissolved










inorganic nutrients (i.e. nitrogen and phosphorus). The algae use the increased nitrogen for their

own growth rather than growth of host tissue (Fabricius 2005). Increased densities of

zooxanthellae take up more carbon dioxide than under non-enrichment conditions. This

decreases the carbon dioxide available for calcifieation (Szmant 2002, Fabricius 2005).

Increased particulate organic matter (i.e. clay and organic particles suspended in the water) also

indirectly influence corals by reducing light penetration to the zooxanthellae. If prolonged, this

may lead to lower carbon gain by the coral from zooxanthellae photosynthesis, slower

calcifieation rates, and thinner coral tissue (Fabricius 2005).

Sewage pollution and contamination is of great concern in the Florida Keys.

Approximately 30,000 on-site sewage disposal systems (septic tanks, cesspits, and Class V

inj section wells) are dispersed throughout communities in the Florida Keys, most of them

positioned near boating canals (Lapointe et al. 2004). In the past, it was assumed that

eutrophication from anthropogenic sources would only affect near and inshore waters (Szmant

2002), however, sewage pollution contributes to the eutrophication of not only inshore and near

shore waters, but also offshore waters (Lapointe and Clark 1992, Lipp et al. 2002, Griffin et al.

2003).

Human-induced nutrient enrichment also increases the severity of diseases affecting corals.

Two Caribbean corals epizootics, aspergillosis of common sea fans and yellow band disease of

M~onta~strea spp. were shown to intensify during exponential nutrient increase (Bruno et al.

2003a). Potentially, the pathogens causing these diseases are able to utilize the excess nutrients,

thereby increasing the fitness and virulence. These results demonstrate that minimizing nutrient

pollution could be an important management tool for controlling coral epizootics (Bruno et al.

2003a).









Natural disturbances and human activities strongly impact at least 45% of the world' s

oceans (Halpern et al. 2008) and have severely damaged at least 30% of coral reefs (Hughes et

al. 2003). They alone, however, do not explain why some systems have not recovered from

disturbance but rather remain in alternate stable states (e.g. macroalgae dominant and low stony

coral abundance). Coral decline is ubiquitous (Pandolfi et al. 2003) and often leaves questions as

to how it is occurring at a regional level. Human influences do not explain all coral decline,

especially when habitat degradation occurs on remote reefs without human presence (Ryan

2001). Observations of high levels of coral disease on reefs with no human influence require

other explanations. Benchmarks, such as Caribbean-wide mortalities of acroporid corals and the

urchin Diadema~~~iiii~~~iiii~~~ antillarum~~~~1111~~~~111 and the beginning of coral bleaching coincide with years of

maximum dust influx into the Caribbean (Shinn et al. 2000).

African dust is not a new phenomenon in the Caribbean. Dust transported annually from

Africa and Asia across the Atlantic and Pacific oceans has occurred for millennia, but recently

researchers have put more stock into the role of the hundreds of millions of tons of dust in the

decline of coral reefs (Garrison et al. 2003). Dust from African Sahara and Sahel deserts is

transported to the Mediterranean, Europe and the Caribbean. Within the components of the dust,

iron (Fe), silicon (Si) and aluminosilicate clays can serve as substrates for viable spores of

numerous microbial species, especially the soil fungus, Aspergillus sydowii (Shinn et al. 2000).

This soil fungus is the known pathogen that affects sea fans (Gorgonia ventilina and G.

flabellum) Caribbean-wide. Besides the observation that dust may harbor opportunistic

pathogens, which can lead to infection and coral disease, African and Asian dust also brings

significant quantities of water-soluble nutrients to the oligotrophic waters of the Caribbean, Gulf

of Mexico, and Pacific (Garrison et al. 2003). The addition of these nutrients may not only aid









bacteria transported by dust, but also may create enhanced conditions for bacteria persisting in

the nutrient poor waters. These bacteria then may out-compete native bacteria, which may react

adversely to the influx of nutrients. The steady transport of dust throughout the world's coral

reefs may help to explain why many systems are unable to recover fully after a traumatic

disturbance due to a net influx of nutrients and non-native organisms and chemicals.

1.5 The Coral Holobiont

1.5.1 Symbiosis and Nutrient Exchange

Most coral species are involved in a symbiotic relationship with dinoflagellates

functionally defined as zooxanthellae (Belda-Baillie et al. 2002). Through coevolution with

these dinoflagellates, corals have developed an ecological relationship leading to enhanced

respiration, metabolism, waste excretion and increased growth rates in nutrient poor waters

(Stanley and Swart 1995). These relationships began to form in the middle to late Triassic

period roughly 200 mybp (million years before present) (Stanley and Swart 1995). In this

relationship, the coral provides a protected environment for the algae as well as carbon dioxide

and other wastes used in photosynthesis (Wilson and Wilson 1985). Corals are successful in

low-nutrient tropical waters due to the plasticity in the modes they utilize to obtain nutrients.

The polyp captures zooplankton through suspension feeding and translocates photosynthetic

products from the zooxanthellae (Muller-Parker and D'Elia 1997). Animal metabolic waste

products derived from holozoic feeding are retained within the coral, and provide inorganic

nutrients (i.e. nitrogen and phosphorus) required by the zooxanthellae for photosynthesis. As

autotrophs, zooxanthellae only require inorganic nutrients, carbon dioxide and light for

photosynthetic carbon fixation (Muscatine and Porter 1977, Stanley and Swart 1995, Muller-

Parker and D'Elia 1997). The zooxanthellae produce great amounts of photosynthate in excess to

that utilized by the coral for direct nutrition (Ducklow and Mitchell 1979, Wild et al. 2004). The









coral secretes the excess photosynthate in the form of mucus, which bathes the coral tissue (see

discussion of coral mucus below). Zooxanthellae may also benefit corals indirectly through the

uptake of inorganic nutrients. Some nutrients (e.g. phosphate) act as CaCO3 CryStal inhibitors

and their removal from calcification sites by the zooxanthellae promote calcification by the coral

(Muller-Parker and D'Elia 1997).

Corals are under increasing stress due to changes in their environment. This stress

increases coral's susceptibility to diseases. The zooxanthellae, Symbiodinium, are not the only

organisms with which corals are in association. Recently, research has demonstrated that corals

also contain large, diverse, and specific populations of microorganisms on their surface and

within their tissues (Ritchie and Smith 2004, Wild et al. 2004, Rosenberg et al. 2007). Some of

these microorganisms have been speculated to co-evolve with coral (Rohwer et al. 2002,

Knowlton and Rohwer 2003, Ritchie and Smith 2004) based on continual isolation from coral

and growth on mucus treated media. Those microorganisms living as part of the coral holobiont

serve important roles in maintaining a functional symbiotic relationship. Such functional roles of

microorganisms include nitrogen cycling, utilization of complex carbon compounds such as

proteins and polysaccharides, gene expression relating to stress response, DNA repair and

antibiotic resistance (Wegley et al. 2007).

1.5.2 Signal Exchange

Each partner in the coral holobiont influences the others. Corals may receive signals from

their symbiotic algae and microorganisms, as well as, the external environment (e.g. conspecifics

during spawning, macroalgae, and competing corals) during different stages of their life

histories. Elkhorn coral, Acropora palmata, reproduce during annual mass spawning events,

where gametes are synchronously released into the seawater for external fertilization and

dispersal (Babcock and Heyward 1986, Heyward and Negri 1999). The developing larvae










generally become competent, settle out of the water, and metamorphose into juvenile coral

polyps (Babcock and Heyward 1986). As energy reserves from the oocyte diminish, cilia

develop and the sensory and secretary cells of the epidermis differentiate (Heyward and Negri

1999). The onset of larval competency coincides with decreased larval buoyancy, increased

motility and sensory capability at the aboral end (Heyward and Negri 1999), which potentially

allows the larvae to "sample" the substrate and adhere to it (Edmunds et al. 2004). Often, coral

larvae may differentially select a site of permanent attachment due to external chemical cues that

potentially induce metamorphosis (Morse et al. 1994, Morse et al. 1996, Heyward and Negri

1999). Coralline algae are one of the primary sources of chemical morphogens and are thought

to produce high-molecular weight polysaccharides that are recognized by chemoreceptors of the

planula (Webster et al. 2004). However, lipophilic compounds extracted from CCA have also

been shown to induce settlement of urchin larvae (Kitamura et al. 1993).

Studies demonstrate that, in addition to coralline algae, microbial biofilms and other

chemical s induce coral larvae and other invertebrate larvae metamorphosis (Tsukamoto 1999,

Tsukamoto et al. 1999, Webster et al. 2004, Huggett et al. 2006). The chemical lumichrome, a

derivative of riboflavin (vitamin B-12) induces larval metamorphosis in the ascidian,

Halocynthia roretzi (Tsukamoto et al. 1999). Lumichrome has also demonstrated capabilities to

enhance alfalfa root respiration and shoot growth when produced by a symbiotic bacterium,

Sinorhizobium meliloti (Phillips et al. 1999).

1.5.3 Other Zooxanthellate Symbioses

Corals are not the only marine invertebrate to form a symbiosis with photosynthetic algae.

Taxonomically, zooxanthellae belong to seven different clades, and are known to form symbiotic

relationships with coral polyps, sea anemones, sea slug (Berghia verrucicornis) (Kempf 1991,

Stanley and Swart 1995, Wagele and Johnsen 2001). Many cnidarians (e.g. sea anemones) form









such relationships. These mutualistic interactions are often species specific and can even vary

with habitat location (Secord and Augustine 2000). Unlike hermatypic corals, which form

interactions with obligate symbionts of zooxanthellae, sea anemones of the genus Anthopleura

can contain both zooxanthellae and zoochlorellae. The composition of the symbiotic algae in the

sea anemone host varies with latitude and intertidal height (Secord and Augustine 2000).

Zooxanthellae are also found in symbiotic relationships with nudibranchs (Kempf 1991, Wagele

and Johnsen 2001). The exact role of the symbionts remains somewhat unclear with suggested

functions that include camouflage for the host, the photosynthetic algae may aid the host in

persisting during periods of low nutrients, and inclusion of the algae may enhance reproductive

output of the nudibranch as a result of shuttling energy from photosynthetically fixed carbon to

the eggs (Wagele and Johnsen 2001). The zooxanthellae are acquired while the nudibranch

feeds on the symbiotic sea anemone, Aipta~sia pallid. Zooxanthellae in the tissue of the

anemone are transferred to nutrient processing cells (NPCs) and are retained intracellularly in

peri-algal vacuoles (Kempf 1991). Zooxanthellae also form a type of symbiosis with the giant

clam, Tridacna gigs in which the clam houses the algae in a unique complex diverticulum of

the stomach (Lucas 1994). The ability of the giant clam to utilize both the photosynthate from

the zooxanthellae as well as the nutrients obtained from efficient filter feeding offers a growth

advantage over other heterotrophic bivalves.

1.5.4 Coral Mucus

All corals secrete mucus (Fig. 1-1). The majority of the fixed carbon found in the surface

mucopolysaccharide layer (SML) originates from the symbiotic zooxanthellae (Patton et al.

1977). Fixed carbon produced by zooxanthellae is transferred to the coral host and secreted

through epidermal mucus cells (Ritchie and Smith 2004). High arabinose contents in coral

mucus indicates that much of the fixed carbon is released as mucus since arabinose is generally









not found in animal tissue (Meikle et al. 1988). Both hard and soft corals secrete mucus

continuously and each species has a distinctive composition (Ducklow and Mitchell 1979,

Meikle et al. 1988, Ritchie and Smith 2004, Wild et al. 2004), which can vary temporally and

with depth (Crossland 1987). The basic structure of mucus is an insoluble, hydrated,

glycoprotein secreted by the coral (Ducklow and Mitchell 1979, Meikle et al. 1988). The

observation that the maj ority of fixed carbon is not utilized by the coral but rather secreted,

indicates that mucus serves a number of roles. Continuous release of mucus aids in ciliary-

mucoid feeding in the coral reef copepod Acartia negligens (Richman et al. 1975) and is

hypothesized to protect against microbial colonization, smothering by sediment, physical

damage, desiccation during air exposure at extreme low tides, space invasion by other corals, and

ultraviolet radiation damage (reviewed in (Wild et al. 2004, Brown and Bythell 2005)). Mucus

secretion may also serve as an indicator of coral health. Banin et al. (2001) showed that in the

Mediterranean coral Oculina patagonica, healthy pigmented corals secrete large amounts of

mucus compared to bleached and diseased colonies (Banin et al. 2001). Coral mucus may

enhance resistance to disease through a number of mechanisms, including antibiotic production

and inhibition of pathogenic mechanisms (Ritchie 2006). The unique composition of mucus

secreted by corals may promote coral-bacterial symbionts while inhibiting potential pathogens.

The production of mucus in vertebrates systems is well documented and several cell types

that contribute to mucus secretion have been described (Verdugo 1990). In coral tissues,

however, the limited histological and histochemical investigations describe only one type--the

mucocyte, which is found in all tissue layers (reviewed in (Brown and Bythell 2005)).

Continuous production of mucus is clearly advantageous but the rate of mucus production in

relation to environmental conditions may vary greatly. Among eight species of scleractinian









corals studied in the Red Sea, the average overall mucus rate of production was approximately

51 mg of particulate organic matter m-3 day-l (Richman et al. 1975). Other studies have

demonstrated that submerged species of Acropora released 1.7 liters of mucus m-2 dayl (Wild et

al. 2004).

Even though the exact composition of coral mucus is not certain (except for a few common

carbohydrates such as arabinose), it is obvious that the coral SML is high in organic matter.

Coral mucus, therefore, creates a nutrient rich environment for bacteria and other

microorganisms. This is in strong contrast to the surrounding bacterioplankton environment. In

fact, culturable SML bacterial populations were found to be 100 times higher than those from

surrounding water mass and many orders of magnitude more metabolically active (Ritchie et al.

1996). While, the surface mucopolysaccharide layer (SML) provides ample nutrients for

bacteria on the surface, approximately 56-80% of released coral mucus immediately dissolves

and provides a food source for the bacterioplankton environment (Wild et al. 2004).

1.6 Coral Bleaching

Among the numerous natural occurrences that influence coral reefs (e.g. tropical storms,

coral predator outbreaks, coral disease), coral bleaching is one of the most detrimental and also

most mysterious. Coral bleaching has been observed all over the world and different conditions

and factors have been attributed to these disturbances. Of all the possible causes for coral

bleaching, one that is receiving much of the credit is climate variation through El Nifio Southern

Oscillation (ENSO) events (e.g. (Stone et al. 1999)). Southern Oscillation (SO) is a dramatic

fluctuation of air pressure between the eastern and western Pacific, which is not associated with

El Nifio events (Gray Davidson 1998). Empirical evidence indicates a coral reef bleaching cycle

in which maj or episodes are synchronized with El Nifio events that occur every 3-4 years, on

average (Stone et al. 1999). Coral bleaching occurs when there is a loss of color, arising from









the partial or total elimination of the Symbiodinium population or degradation of algal pigments

(Douglas 2003). This occurs generally in times of stress, often caused by sea surface

temperatures (SST) which are much higher than the tolerance level of the coral colony (Wolanski

2001), but also is attributed to solar radiation, especially ultraviolet (UV) radiation (Stone et al.

1999). The maj ority of coral species have adapted life histories that function within a very

narrow range of conditions, which include salinity, nutrients, sediments, and temperature (Gray

Davidson 1998). There are approximately one to two million algal cells per one square

centimeter of coral which give the coral the vibrant colors that we see (Sapp 1999). Left without

their symbiotic partners, the corals appear white or colorless (the color of the calcium carbonate

skeleton) and usually die as they can not obtain the necessary nutrients without their symbionts

(Gray Davidson 1998). If, however, conditions become favorable in a relatively short time, the

corals may be able to acquire a new consortia of zooxanthellae (Douglas 2003, Reshef et al.

2006). The extreme sensitivity of corals to their surrounding temperatures makes them

especially susceptible to coral bleaching.

Coral pathogenic bacteria have also been shown as a causative agent of coral bleaching.

Oculina patagonica is a scleractinian coral found in the Mediterranean and is the only hard coral

known to have invaded a new region (Rosenberg and Falkovitz 2004). It is believed that the

coral, a known fouling organism, traveled from the Atlantic Ocean by adhering to the hull of a

ship. A pathogenic strain of Vibrio shiloi AK1 was found to be associated with bleached O.

patagonica. The bacteria were isolated from bleached coral tissue and Koch's postulates were

fulfilled, demonstrating that the pathogenic strain is a causative agent for coral bleaching

(reviewed in (Rosenberg and Falkovitz 2004)). In this model, the classical triggers of coral

bleaching (Ben-Haim et al. 2003a, Douglas 2003) are still in play as laboratory studies show O.










patagonica is more susceptible to bleaching by y. shiloi during periods of elevated seawater

temperatures (Rosenberg and Falkovitz 2004). With global climate change and elevated sea

surface temperatures (SST), coral reefs are under high levels of stress making them susceptible

to bleaching and disease.

The overwhelming evidence and support for the Oculina patagonica coral-bleaching

model have been used as a basis to propose that bacterial pathogenesis may be one cause for

global bleaching patterns. A recent study investigating the in situ involvement of bacteria in the

bleaching of O. patagonica across the Israeli coastline, substantiated evidence to dismiss the

notion that bacteria are involved in coral bleaching (Ainsworth et al. 2008). Corals were

monitored throughout an annual bleaching event and the proposed pathogen, Vibrio shiloi was

not detected in any tissue layers. This observation is consistent with experimental conditions in

support of the coral probiotic hypothesis (Reshef et al. 2006). A change in the endolithic

(natural) community of microorganisms occurs during coral bleaching (Ainsworth et al. 2008).

This shift highlights the potential importance of the diverse and complicated interactions

between the organisms that comprise the coral holobiont in terms of disease resistance and

resilience.

1.7 Coral Diseases and Management

1.7.1 Examples of Coral Diseases

Many organisms that cause coral diseases are not dedicated pathogens, but are

opportunistic ones. Opportunistic pathogens are those microorganisms that are normally found

in the environment and are generally benign. Opportunistic pathogens invade their eukaryotic

hosts only when the host' s defense systems are compromised. Opportunistic pathogens may be

introduced into a habitat by a variety of means. Recently, human influence and activities have

received a great deal of attention. Studies have demonstrated that not only human activities, but









also human waste, has been found to contribute to a high prevalence of enteric bacteria in near

shore waters and canals of the Florida Keys (Griffin et al. 1999, Nobles et al. 2000, Lipp et al.

2002). While this observation is important, conclusive evidence, that wastewater is reaching and

adversely affecting the coral reef environments along the Florida Keys is limited. One study

suggests that coral mucus may serve as a better record of fecal contamination in reef areas since

enteric bacteria are often difficult to recover from marine waters (Lipp et al. 2002).

Coral diseases caused by opportunistic pathogens are now widespread (Rosenberg and

Ben-Haim 2002, Aronson et al. 2003, Frias-Lopez et al. 2004, Sutherland and Ritchie 2004, Gil-

Agudelo et al. 2006, Weil et al. 2006). Several of these opportunistic pathogens that cause

devastating diseases of corals were recently identified: coral plague by Sphingomona~s sp.

(Richardson et al. 1998), white pox disease by Serratia marcescens (Patterson et al. 2002) (Frias-

Lopez et al. 2004), black band disease by a consortium of bacteria (Richardson et al. 1997)

(Richardson and Kuta 2003), aspergillosis disease by Aspergillus sydowii (Smith et al. 1998).

Koch's postulates have been fulfilled for white plague type II, white pox, aspergillosis, Vibrio

shiloi induced bleaching and Vibrio coralliilyticus induced bleaching and disease. Coral disease

symptoms described as black band disease, skeletal anomalies, white band type II, skeleton

eroding band, fungal-protozoan syndrome, and pink-line syndrome have hypothesized microbial

causative agents but have not been confirmed (Sutherland et al. 2004, Rosenberg et al. 2007).

Serratia marcescens is one of the better characterized opportunistic pathogens of

Caribbean corals (Patterson et al. 2002, Sutherland and Ritchie 2004). Koch's postulates were

fulfilled using 109 bacterial mll infectious dose (Patterson et al. 2002). While this infectious

dose was high, similar infection studies demonstrate at the LD5o of the pathogen was 10' bacteria

mll in mice (Carbonell et al. 2000) and as little as 1355 cells per individual larvae of C.









zealan2dica larvae (Tan et al. 2006). Serratia marcescens is associated with the appearance of

white pox disease symptoms in Acropora palmata, which progress rapidly at a rate of 2.5

cm2/day (Patterson et al. 2002). Irregularly shaped, distinct white patches, devoid of coral tissue,

characterize white pox disease. White pox disease can be distinguished from white band disease

(both of which affect A. palmate) as the potential for tissue loss (necrosis) occurs throughout the

coral colony with white pox. White band disease develops at the base of the coral branch and

progresses upward towards the branch tip in a concentric ring (Sutherland and Ritchie 2004).

The white pox pathogen is currently the major pathogen of Acropora, a threatened Caribbean

Elkhorn coral and it is closely related to other well-characterized and genomically sequenced

pathogenic Serratia spp. Some catabolic enzymes and regulatory switches required for

virulence of pathogenic Serratia in plants and animals have been characterized (Kurz et al. 2003,

Soo et al. 2005, Queck et al. 2006). Although microorganisms that are pathogenic to some corals

have been identified, the causative agents of many coral diseases remain unknown (Richardson

1998, Weil et al. 2006).

1.7.2 Characterization of Coral Diseases

The identification of coral pathogens as causative agents of disease must include

fulfillment of Koch' s postulates. To demonstrate the identity of a pathogenic microorganism, the

following must be carried out: (1) the pathogen must be found in abundance in all organisms

with disease and not in healthy organisms, (2) the pathogen must be isolated from the diseased

host and grown in pure culture under laboratory conditions, (3) the pathogen from pure culture

must cause the disease when it is inoculated into or onto a healthy animal, and (4) the pathogen

must be re-isolated from the newly diseased animal and identified as the same microorganism as

the presumptive pathogen (Tortora et al. 2002). In the past, some bacteria were accepted as the

causative agents of disease despite the fact that Koch's postulates were not fulfilled (Richardson










1998). It is important to maintain a certain level of caution when assigning a pathogen to a

specific disease based on Koch's postulates. One problem with identifying a pathogen by

Koch's postulates is that the changes in host susceptibility or pathogen virulence with changes in

the environment are not incorporated (Lesser et al. 2007). Another problem limiting the

application of Koch' s postulates is the inability to grow many potential pathogens in the

laboratory (Ritchie et al. 2001). Many bacteria, viruses, protozoa and fungi cannot be

propagated under laboratory conditions. It is therefore difficult to conclude that the disease

produced in laboratory conditions was the same present in the environment. Recent studies have

also emphasized the importance of going beyond the external macroscopic signs of coral disease

in order to accurately diagnose disease (Ainsworth et al. 2007, Lesser et al. 2007). Often,

macroscopic symptoms or signs associated with different diseases or syndromes overlap and may

lead to misdiagnosis. Utilizing other methods such as microbial diversity characteristics and

cytological observations may be useful for understanding the disease process of corals and

improving the basis on which diseases are diagnosed.

1.7.3 Virulence Determinants in Opportunistic Pathogens

It is not yet clear, however, how opportunistic pathogens colonize and infect corals

(Richardson 1998, Foley et al. 2005). The influence of host density and variability on disease

outbreak also remains unclear. Disease outbreaks could potentially increase with increased host

density (Ward and Lafferty 2004). Vibrio harveyi is a serious pathogen of marine animals, but

despite its prevalence and characterization, the mechanisms of pathogenicity have yet to be fully

elucidated (Austin and Zhang 2006). Extracellular products (e.g. cysteine protease,

phospholipase, haemolysin) may play a central role in the virulence of the pathogen (Austin and

Zhang 2006). While many coral diseases are well characterized, the mechanisms by which the

pathogens that infect them need to be elucidated before effective management can be employed.










Coral diseases caused by microorganisms generally cause one of two maj or symptoms:

tissue necrosis or bleaching. Of the pathogens known or assumed to cause the maj or necrotic

diseases (white band I & II, white plague I & II, white pox, black band and aspergillosis) only a

few pathogens have been observed to cause diseases in invertebrates besides corals (Grimont and

Grimont 1978, Rinaldi 1983, Alker et al. 2001). Aspergillus sydowii is a soil saprophytic fungus

known to occasionally act as an opportunistic pathogen of food, invertebrates and humans

(Rinaldi 1983, Alker et al. 2001). Its pathogenicity depends on the host and the duration of

exposure.

In addition to corals, Serratia nzacescens infects a wide variety of hosts and can be

viewed as a model opportunistic pathogen. Serratia nzarcescens is able to cause disease (and

often high mortality) in C. elegan2s (Kurz and Ewbank 2000, Kurz et al. 2003, Schulenburg and

Ewbank 2004), Costelytra zealan2dica (New Zealand grass grub) (Tan et al. 2006), numerous

insects, plants, vertebrates, and humans (Grimont and Grimont 1978). During infection of C.

elegan2s, S. nzarcescens is capable of killing the host by a toxin-based mechanism or following

the establishment of an infection. The bacteria are able to live within the digestive tract of the

nematode and proliferate and spread, eventually causing a systemic infection (Kurz and Ewbank

2000). In a screen of Serratia nzarcescens mutants, specific genes involved in a two-component

regulatory system, magnesium and iron transport, hemolysin production and the biosysthesis of

O-antigen and lipopolysaccharides (LPS) were found to be important to the virulence of the

pathogen (Kurz et al. 2003). A similar study investigating gene expression in Pseudonzona~s

aeruginosa during C. elegan2s infection identified similar genes (e.g. two-component global

regulation system genes) (Tan et al. 1999).









Coral pathogens can also induce bleaching during infection. The annual bleaching of the

Mediterranean coral, Oculina patagonica has been correlated with infection by Vibrio shiloi

during the warm summer months (Rosenberg and Ben-Haim 2002, Rosenberg and Falkovitz

2004, Reshef et al. 2006, Ainsworth et al. 2008). The pathogen adheres via a P-galactoside

receptor produced by the endosymbiotic zooxanthellae (Toren et al. 1998). Once the bacteria

penetrate the coral tissue they produce heat-sensitive toxins targeting the zooxanthellae and thus

inhibiting photosynthesis (Banin et al. 2001). Similarly, K. coralliilyticus induces bleaching and

tissue lysis in Pocillopora damdddddddd~~~~~~~~~icori (Ben-Haim and Rosenberg 2002, Ben-Haim et al. 2003a,

Luna et al. 2007). This gram-negative, rod-shaped, motile bacteria produces a 36 kDa

extracellular protease believed to be involved in its pathogenicity (Ben-Haim et al. 2003a, Ben-

Haim et al. 2003b). While several species of Vibrio are pathogenic to invertebrates, the unique

feature of the Vibrio induced bleaching of corals is that the pathogen targets the zooxanthellae

rather than the coral itself (Ben-Haim et al. 2003b).

1.7.4 Disease Management

Opportunistic pathogens are of tremendous threat to corals and other invertebrate hosts in

freshwater and marine systems. This threat originates in the ubiquitous nature of opportunistic

pathogens and their ability to persist in a variety of environments and cause infection in a wide

array of hosts (i.e. when host immune systems are compromised). As discussed earlier,

pathogens, especially those that co-evolved with humans (Templeton 2007), can enter marine

systems through runoff and other forms of pollution. Once introduced to marine systems, some

pathogens are able to persist and even flourish. For example, Vibrio cholerae and Escherichia

coli are able to survive at densities of 106 ml-1 for extended periods in niches within coral reef

and turtle grass ecosystems (Perez-Rosas and Hazen 1988). Vibrio cholerae demonstrated

higher survival rates and activity as compared to E. coli. This observation demonstrates how










opportunistic pathogens can easily lead to bacterial contamination for fish, shellfish and corals in

this environment. Although many pathogens are associated with human illness and disease, they

may enter a new niche in a different environment free of negative interspecific interactions

(Perez-Rosas and Hazen 1988, Bruno et al. 2003b). In these scenarios, it is often difficult to

determine whether a potential pathogen isolated from coral reefs is associated with

anthropogenic inputs to the system or if it had independently evolved in that environment (e.g.

(Patterson et al. 2002)). Survival of opportunistic pathogens in different environments and

infection of multiple hosts highlights the need to understand the mechanism of virulence and

how they are able to colonize and infect their hosts.

It is logistically impossible to "cure" coral diseases. Improvements to sewage

infrastructure in coastal communities are prohibitively expensive. Treating coral diseases with

antibiotics and pesticides is not feasible; therefore exploring biocontrol potential of native

microbial communities may offer a possibility for a new thinking about addressing the coral reef

decline. Similar biocontrol strategies have been reasonably successful in agriculture and

commercial aquaculture (Garrigues and Arevalo 1995, Nogami et al. 1997, Whipps 2001,

Chythanya et al. 2002, Raaijmakers et al. 2002, Fravel 2005, Persson et al. 2005, Balcazar et al.

2006, Rasmussen and Givskov 2006). The mechanisms of interactions between opportunistic

pathogens, beneficial bacteria and coral hosts may offer an exciting model for addressing and

managing ecosystem-wide degradation resulting from sewage pollution.

1.8 Virulence Factors in Bacteria

Bacterial pathogens often interact with a wide variety of distinct hosts, ranging from

simple invertebrates to vertebrates and mammals. Most pathogens cause disease in a single or a

restricted number of host species. The limitations observed in host ranges are primarily a result

of a long history of coevolution (Rahme et al. 2000). Pathogens must either adapt to their new









host environment or modify it to persist over the host defenses. Involved in this is the

recognition of the host, colonization and exploitation of host resources. In order to do this,

bacteria have an arsenal of virulence-related factors.

Bacterial and fungal pathogens rely on enzymatic degradation of extracellular

biopolymers for uptake of both nitrogen and carbon. This is particularly important during

infection, when microbial proteinases are virtually unregulated by host proteinase inhibitors

(Travis et al. 1995). The primary function for these proteinases is to provide a source of free

amino acids for survival and growth, however, they may also lead to tissue invasion and

destruction and evasion of host defenses (Travis et al. 1995). Other extracellular enzymes

produced by bacteria are essential to pathogenicity (e.g. phospholipase in Yersinia enterocolitica

(Young et al. 1999)). Extracellular proteins play an important role in virulence and are

transported out of the cell through various mechanisms.

Extracellular protein secretion is generally accomplished through one or more secretion

systems. There are at least six secretion systems described, three of which are well characterized

(Pugsley 1993, Aizawa 2001). Recent studies indicate that proteins secreted by the type III

secretion system (TTSS) often influence bacterial-host interactions for pathogens of plants and

animals (Hueck 1998). Conventional secretion systems may not be the only means for

pathogenic bacteria to transport proteins involved in pathogenicity to the external environment.

TTSS often functions only when the bacteria are in direct association with the host. Therefore,

proteins transported this way can be classified as contact-dependent (Young et al. 1999).

Bacteria are also able to secrete proteins extracellularly through the flagellar export apparatus,

which is similar to the TTSS. Both systems consist of homologous component proteins with

common physio-chemical properties (molecular size, isoelectric point, instability index, and










aliphatic index), suggesting that they may have evolved in parallel (Young et al. 1999, Aizawa

2001). Although the flagellar transport apparatus was thought to have a role only in organelle

biogenesis, it appears to also be required for transport of proteins to the extracellular

environment in pathogenic bacteria (Young et al. 1999). Therefore, a functional motility

apparatus is not only important for bacterial movement, but also for the secretion of virulence

factors during infection.

Despite the evolutionary gap between plants and animals, virulence factors of pathogens

appear to not be specific to one host, but rather, common to many hosts and used by diverse

bacterial species (Rahme et al. 1995, Mahajan-Miklos et al. 2000, Rahme et al. 2000). This

conclusion stems from two primary observations: (1) bacterial proteinases, serving as virulence

factors, are conserved in plants and animals (Travis et al. 1995), and (2) strains of specific

pathogenic bacterial species have been shown to infect plants and/or animals (Rahme et al.

1995). Such universal virulence factors have been termed effectors/toxins and boast a wide

range of functions including cytotoxicity, hemolysis, proteolysis, protein phosphorylation, and

protein dephosphorylation (Young et al. 1999). Effector proteins are not the only common

virulence factors. In in vivo screens of pathogen virulence factors the global response regulator,

gacA, was identified during infection of both Pseudomona~s aeruginosa and Serratia marcescens

in the nematode, C. elegan2s (Rahme et al. 2000, Kurz et al. 2003). Quorum sensing systems

controlling bacterial communication (Waters and Bassler 2005) have also been identified in P.

aeruginosa during infection of both plants and animal hosts (Rahme et al. 2000). Pathogenic

bacteria have evolved a complement of virulence factors in order to mount an attack on their

hosts and while some may be dedicated to a specific host, many are used during infection of

plant and animal hosts.









1.9 Hypotheses and Goals

In this study the general hypotheses that both corals and microorganisms perceive

chemical cues and signals from each other and that specific signaling and genetic and metabolic

pathways are involved in the settlement of coral larvae and the colonization of bacteria on coral

mucus were investigated. The experiments within this study focus on the interactions between

the coral host (Acropora palmate) and potentially beneficial bacteria associated with the coral, in

addition to pathogenic bacteria able to cause disease. These interactions comprise the metabolic

capabilities of the bacteria to utilize and grow on coral mucus, and communication via chemical

signaling between bacterial cells and between the coral and bacteria. I hypothesize that specific

metabolic pathways and regulatory cascades are required for colonization and growth on coral

mucus and that not only do the bacteria sense the coral host but that the corals respond to

chemical cues from bacteria found on coral reefs. To test these hypotheses, the metabolic

capabilities of pathogenic isolates of Serratia marcescens and three native coral-associated

(Photobacterium mandapumensis, P. leiognathi, and Halomona~s meridiana) were assayed for

carbon-source utilization and enzymatic induction. The functionality of an evolutionarily

conserved two component regulatory system, GacS/GacA, in S. marcescens was tested.

Additionally, the response of coral larvae to different bacterial and environmental cues was

investigated.











I Surface Mucopolysaccharide laye
SNet fixe (flow Microblal blomass

SOrganic ~ Secondary prodcs 0
exudates
02
Coral issue(Microaerophillic)
Bu
N2 flXation
02
mineral- decreased
Organic N ~zation I CN ratio N


Ilk water mass


Figure 1-1. General schematic of a coral polyp with subsection of surface mucopolysaccharide layer (SML). On polyp figure (1)
surface mucopolysaccharide layer (SML), which provides protection from UV, desiccation, and potentially disease
resistance, (2) gastrodermis, which houses the zooxanthellae (Symbiodinium spp.), (3) zooxanthellae, photosynthetic algae,
(4) feeding tentacle used for suspension feeding by coral. The subsection of the SML illustrates the complex environment
within the mucus layer secreted by the coral. Photosynthates produced by the zooxanthellae leads to a net outflux of fixed
carbon from the coral tissue. This and other organic exudates provide rich nutrients for the microbial population (coral
residents and visitors) in addition to oxygen, thus creating a microaerophillic environment. Within the microbial
population, some bacteria fix atmospheric nitrogen that can be used by the bacteria and the zooxanthellae. Adapted from
(Ritchie and Smith 2004), used with permission from K.B. Ritchie.









CHAPTER 2
MATERIALS AND METHODS

2.1 Bacterial Strains, Plasmids, and Culture Conditions.

Bacterial strains and plasmids used in this study are listed in Table 2-1. Unless otherwise

indicated, Escherichia coli, Serratia marcescens isolates, Agrobacterium tumefaciens and

Sinorhizobium meliloti were grown in LB broth (per liter: 1.0% tryptone; 0.5% yeast extract;

0.5% NaCl Fisher Scientific, Pittsburg, PA). The coral isolated bacteria Photobacterium

mandapamnensis, P. leiognathi, and Halomona~s meridlana were routinely grown in GASW broth

(per liter: 356 mM NaCl; 8 mM KCl; 40 mM MgSO4; 20 mM MgCl2 6H20; 60 CIM K2HPO4; 7

CIM FeSO4; 33 CIM Tris; 0.05% peptone; 0.2% yeast extract; 2.0% glycerol) or on 1.5% agar

plates (Smith and Hayasaka 1982, Smith et al. 1982). Agrobacterium tumefaciens was also

grown in AB minimal mannitol liquid media (per liter: 17 mM K2HPO4, 8.3 mM NaH2PO4, 18.7

mM NH4C1, 1.22 mM MgSO4 7H20, 1.98 mM KC1, 6.8 CIM, 8.99 CIM FeSO4 7H20, 5%

mannitol) supplemented with 1% agar (Hwang et al. 1994, Shaw et al. 1997, Cha et al. 1998).

Antibiotics were used in selection media at the following concentrations: for E. coli, Ap (100

Clg/ml); Gm (30 Clg/ml); Km (50 Clg/ml), Cb (100 Clg/ml) Tc (10Clg/ml) where appropriate; for S.

marcescens PDL100, Tc (10 Clg/ml), Ap (100 Clg/ml), for Agrobacterium tumefaciens, Gm (30

Clg/ml), and for Sinorhizobium meliloti, Sm (500 Clg/ml), Neo (50Clg/ml).

Chemically competent cells are routinely made using the Inoue Method resulting in a

transformation efficiency of 1.12 x 10s (Inoue et al. 1990). Briefly, overnight cultures ofE. coli

DH~a are grown in SOB broth (per liter: 2.0% tryptone, 0.5% yeast extract, 10 mM NaC1, 2.5

mM KC1, 10 mM MgCl2, 10 mM MgSO4, pH 6.7-7.0, Fisher Scientific, Pittsburgh, PA) to an

OD600 Of 0.3. Cells are washed twice with TB (per liter: 10 mM PIPES; 55 mM MnCl2; 15 mM

CaCl2; 250 mM KCl; pH 6.7 Fisher Scientific, Pittsburgh, PA) on ice and pelleted at 2500 x g for









10 minutes at 4oC. Cells are then resuspended in TB and DMSO (Fisher Scientific, Pittsburgh,

PA) is added to a final concentration of 7%. Cells are aliquoted and shock frozen with liquid

nitrogen and stored at -80.C.

2.2 Manipulations of DNA and Plasmid Construction

Restriction enzymes, T4 DNA ligase, and Taq Polymerase were purchased from New

England BioLabs (Ipswich, MA) and used as recommended by the supplier. Plasmid DNA was

routinely isolated using QIAprep spin mini-prep kit (Qiagen, Santa Clarita, CA). DNA

restriction fragments and PCR products were eluted in DNA grade water from agarose gels by

utilizing the Illustram'~ DNA and gel band purification kit (GE Healthcare, Buckinghamshire,

UK). All ligation reactions were conducted at 14oC for a minimum of four hours unless

otherwise specified.

Genomic DNA was prepared by standard methods as described previously (Sambrook and

Russell 2001) with the following modifications for optimization. Cells from a 5 ml overnight

culture were pelleted and washed with DNA grade water. Cell were lysed by vortexing with acid

washed glass beads (150-212 Clm in diameter, Sigma Aldrich, Atlanta, GA) with equal volumes

phosphate buffer (120 mM K2PO4, pH 8.0) and water-saturated phenol, pH 8.0 (Fisher Scientific,

Pittsburgh, PA). The mixture was vortexed for 15 seconds before centrifugation at 14, 500 ref

for 5 minutes. The aqueous phase was treated with RNAse A for 2 minutes at room temperature.

One volume of saturated phenol (pH 8.0) was mixed with the DNA and centrifuged at high speed

for 1 minute. The aqueous phase was mixed with one volume of phenol:chloroform :isoamyl

alcohol (25:25:1, pH 8.0, Fisher Scientific, Pittsburgh, PA) and centrifuged at high speed for one

minute. The aqueous phase was mixed with one volume of chloroform:isoamyl alcohol (24: 1)

and centrifuged for one minute yielding an aqueous containing protein-free DNA. 0.34 volumes

of 3.0 M sodium acetate (pH 5.2) and 3.5 volumes of isopropanol were added and inverted until









DNA was visible. DNA was spooled with a plastic pipette tip and transferred into a new

microcentrifuge tube and left to air dry. 0. 1 volumes of 3.0 M sodium acetate (pH 5.2) and 3

volumes of ice cold absolute ethanol were added to dried DNA and placed at -80.C for 30

minutes. The DNA mixture was centrifuged at 10,000 ref for 10 minutes and supernatant was

discarded. The DNA was then washed twice with ice-cold 70% ethanol in the same manner as

above. After the second wash, precipitated DNA was dried completely and was stored at -20oC

until used. Genomic DNA was reconstituted in 50-100C1L of DNA-grade water with incubation

at 50.C to solublize the DNA.

2.2.1 Identification of gacA in Serratia marcescens PDL100, White Pox Pathogen

The gacA gene was amplified from the S. marcescens genomic DNA using primers CJKl2

and CJKl8 (Table 2-2), which were designed based on the gacA sequence from S. plymuthica

(NCBI GenBank: AYO57388). PCR conditions included initial denaturation at 95oC for 7

minutes, 35 cycles (95oC, 1 minute, 53oC, 1 minute, 72oC, 2.5 min) and a Einal extension at 72oC

for 10 minutes. The resulting 957 bp product was cloned into pCR2.1 using a TOPO TA kit

(Invitrogen, Carlsbad, CA), transformed into chemically competent DH~a and sequenced

(Agencourt Bioscience Corp., Beverly, MA). A nucleotide BLAST in the NCBI database

confirmed that the amplified sequence matched that of S. plymuthica.

2.2.2 Construction of a Plasmid that Contains Arabinose-Inducible gacA

To test whether gacA of S. marcescens PDL100 is functional, its ability to complement a

gacA (uvr Y) mutation in E.coli uvr Y33::k ankkkk~~~~~~kkkkk was tested. Therefore, a complementation construct

was engineered to complement a previously engineered mutant in the uvrY gene of E. coli

through a transposon (tn5) insertion (M. Teplitski, unpublished data).

To engineer a construct to complement the uvr Y mutant in E. coli the gacA gene from

pl318 was cloned into pBAD18-Ap. Plasmid pl318 was digested with EcoRI and the resulting










fragments were sub-cloned into the EcoRI site of the arabinose-inducible promoter vector,

pBAD 18-Ap, which yielded pCJK3 and was transformed into chemically competent E. coli

DH5a. Transformants were selected on LB agar supplemented with Ap 200 Clg/ml. Orientation

of the insert was confirmed by PCR using primers MT 13 and CJKl8 (Table 2-2, Fig. 2-1).

2.3 Complementation Assay

To test the functionality of gacA in Serratia marcescens PDL100, an arabinose inducible

promoter-based complementation assay was performed. The complementation vector pCJK3

was transformed into E. coli RGl33 pMT41 by electroporation (25 CIF, 200 02, 2.5 kV, 0.2 cm

cuvette, 50 CIL cell volume) using a Bio-Rad MicroPulser (Bio-Rad Laboratories, Hercules, CA).

As vector controls, the original pBAD18-Ap vector was transformed into both the wild-type

reporter E. coli 1655 pMT41 and its isogenic uvrY33::kan derivative reporter E. coli RGl33

pMT41. Two overnight cultures of each strain were grown in LB with appropriate antibiotics at

37oC on a rotary shaker (180 rpm). Following overnight incubation, cultures were diluted 1/100

in LB and incubated at 37oC for 3 hours on a rotary shaker (180 rpm). Cultures were diluted to

an OD600 Of 0.3, and then diluted 1/25000 and aliquoted into a black polystyrene 96-well plate

(in quadruplicate). Luminescence was measured with Victor-3 (Perkin Elmer, Shelton, CT)

every hour for ten hours and the expression of the complemented mutant was compared to the

wild-type reporter strain.

2.4 Carbon Source Utilization Profile Using Biolog Ecoplate Assay

Carbon-source utilization of the white pox pathogen, Serratia marcescens PDL 100, and

fifteen other isolates of Serratia marcescens and other coral isolated bacteria was assayed using

Biolog EcoPlates. These 96-well plates are manufactured with 31 different substrates in

triplicate per plate with a water control (Table 2-3). The EcoPlates rely on the tetrazolium violet

dye redox reaction, which detects fermentation of sole carbon sources (Garland and Mills 1991,









Garland 1997). Assays were set up according to Choi and Dobbs (1999) with the following

modifications (Choi and Dobbs 1999). Isolates were grown in either 5 ml LB broth or GASW

broth overnight at 30oC with shaking. Cells were pelleted at 10,000 x g using an Eppendorf

table-top centrifuge 5415D (Eppendorf, Hamburg, Germany) and washed twice with filter

sterilized (0.22 Clm) seawater to remove any residual nutrients from the overnight media. Cells

were then resuspended in 10 ml filter sterilized seawater and starved for 24 hours at 30oC.

Following the starvation period, 100 CIL of cell suspension was inoculated into each well of the

Biolog EcoPlate. The initial A590 Of each plate was read on Victor-3 (Perkin Elmer, Shelton, CT)

and was continuously read every 24 hours for a total of 72 hours.

2.5 Enzyme Induction during Growth on Coral Mucus

While the exact composition of coral mucus is unknown, detection of specific enzymes

induced in response to growth on coral mucus can tell us certain types of bonds within the coral

mucus matrix. Enzymatic induction assays using p-nitrophenyl chromogenic substrates allow for

detection of individual specific enzymes induced in response to growth on a certain medium or

in a specific niche. In addition to identifying specific bonds in the various components of coral

mucus, the ability of different isolates and strains of bacteria to utilize the components of coral

mucus may elucidate phenotypic relatedness among bacterial species and strains.

Serratia marcescens isolates from wastewater, canal water and other environments were

compared with a pathogenic strain of the same species and three coral associated bacterial strains

isolated from Acropora palmate mucus (Table 2-1). Two overnight cultures of each isolate were

grown in 5 ml Luria-Bertani (LB) broth or in GASW broth to an approximate OD600 Of 2.0

(stationary phase), which was determined spectrophotometrically. Cells were pelleted at 10,000

ref and washed 3 times in filtered-sterilized seawater (0.22 Clm) buffered with 10 mM HEPES to

remove any residual nutrients and resuspended in 5 ml of buffered seawater. The cells were









starved in filter-sterilized seawater at 30oC while shaking for three days in order to use up any

internal resources. A three-day starvation period was found sufficient during preliminary studies

with S. marcescens PDL100. Following the three-day starvation, 1 ml of cells was added to 2 ml

of either lx coral mucus (freeze dried, UV irradiated for 20 minutes and reconstituted to original

volume (Ritchie 2006)) or 10 mM HEPES buffered seawater). Negative controls of coral mucus

alone and buffered seawater alone were performed in parallel with the experimental treatments

for each isolate. Cells were incubated in treatments for two and eighteen hours at 30oC.

Following incubation, the initial OD590 Of each treatment was determined spectrophotometrically

and recorded. Cells where then mixed with Z-buffer (1:1 v:v) and lysed with 0.1% sodium

dodecyl sulfate solution and chloroform (4:1 v:v) (Miller 1972). Cell suspension was aliquoted

into chloroform-resistant microcentrifuge tubes so to accommodate two biological and two

technical replicates per substrate per treatment. Enzymatic substrates were prepared in HPLC-

grade water and each substrate was added to the appropriate reactions to a Einal concentration of

0.8 Clg/CIL. Assays were conducted at room temperature for approximately 24 hours to allow for

maximum color development. Sodium carbonate (Na2CO3) WAS added to a Einal concentration of

416 mM to stop the reaction and to intensify the color of each reaction. Cellular debris and

unused enzymatic substrate were pelleted at 4,000 x g (16,000 ref) for two minutes. The clear

supernatant was transferred to a clear polystyrene 96-well plate and the A405 WAS measured on

Victor-3 (Perkin Elmer, Shelton, CT). Buffered seawater and coral mucus were included in each

plate as blanks.

Representative isolates from the three broad categories of Serratia marcescens isolates

examined (human isolate, Sm 43422; environmental isolate, Sm39006; and white pox pathogen,

PDL 100) were also assayed with a treatment testing whether the catabolic capabilities of the









isolates could be repressed in the presence of glucose. A minimal media consisting of 10 mM

HEPES buffered seawater supplemented with glucose (4 g/L) and Casamino Acids (0.1 g/L) as

the sole carbon and nitrogen sources was filter sterilized through a 0.22 Clm fi1ter. This

additional treatment was examined due to the observation that some enzymes appeared to be

induced during starvation stress regardless of which treatment ultimately experienced by the

cells. Glucose is a known catabolite repressor. In Enterobacteriaceae, glucose inhibits

expression of catabolic and regulatory genes required for growth on most other carbon sources;

glucose also inhibits expression of virulence genes and regulators (Ferenci 1996, Reverchon et

al. 1997, Jackson et al. 2002, Gosset et al. 2004, Teplitski et al. 2006). As controls for this

treatment, cells were also incubated with 10 mM buffered seawater supplemented with Casamino

Acids (0.1 g/L) without glucose and buffered seawater alone. The enzyme induction assay was

conducted as described above.

2.6 Proteinase Induction in Response to Coral Mucus

Acroporid coral mucus is made of a variety of carbon and nitrogen compounds and may

consist of up to 22% protein (Ducklow and Mitchell 1979). These proteins provide serve as

nutritional substrates to those bacteria able to utilize them as a food source. Therefore, it is

plausible that induction of various proteinases may occur in response to growth on coral mucus.

The production of proteinases during growth in rich medium was first investigated for both cell-

associated and extracellular proteinase production (Demidyuk et al. 2006). A volume of 0.3 ml

of either cell suspension or culture supernatant was added to 1.7 ml of azocasein solution (5

mg/ml azocasein in 0.1 M Tris Buffer pH 7.5) resulting in a solution with final azocasein

concentration of 0. 16 mg/ml. As a control, a blank of 0. 16 mg/ml azocasein solution in water

was prepared. Reactions were allowed to incubate statically at 30oC for 60 min. Following

incubation, trichloroacetic acid (TCA) was added to each reaction to a Einal concentration of









3.2% v:v to stop the enzymatic reaction and to precipitate any unhydrolyzed azocasein. Each

reaction was pelleted at 10,000 x g for 1 min to sediment the unhydrolyzed substrate. The

supernatant was carefully transferred to a new tube, to which NaOH (250 mM final

concentration) was added to intensify the color. 200 CIL of each reaction was transferred to a

clear polystyrene 96-well plate and the A405 of each reaction was read on VICTOR-3.

2.7 Presence of Lumichrome and Riboflavin in Coralline Algae

2.7.1 Thin Layer Chromatography of Pure Compounds

In order to determine the conditions necessary for pure lumichrome and riboflavin to

sufficiently migrate on the TLC plate (Whatman KC18 Silica Gel 60 with fluorescent indicator,

10 x 10 cm, 200 Clm thick), saturated solutions of lumichrome and riboflavin in methanol:HCI

(49: 1) and in pure methanol were prepared (Phillips et al. 1999). Samples were pelleted to

eliminate any particulate matter in solution as lumichrome and riboflavin have low solubility in

many solvents. A total of 3 CIL of each mix and the solvent (methanol:HC1) were spotted onto

the TLC plate. The plate was developed with a mobile phase of chloroform:methanol :water

(17.5:12.5:1.5) (Phillips et al. 1999). A total time of approximately 40 minutes was required for

the mobile phase to migrate to the top of the plate.

Dilution series of the pure samples was performed in order to optimize the concentration

for visualization on TLC plates. Using stock solutions of 2800 g/L lumichrome and riboflavin,

1, 10 and 50 CIL were spotted onto the TLC plate in addition to 50 CIL of the solvent

(methanol:HC1). The TLC was developed using the same mobile phase as above.

2.7.2 Methanol Extraction of Coralline Algae

The presence of lumichrome and riboflavin in coralline algae was tested through methanol

extraction (Phillips et al. 1999). Briefly, approximately 10 g of coralline algae, frozen in liquid

nitrogen, were ground into a paste to which pure methanol was added and transferred to a 15 ml










plastic tube. The suspension was vortexed vigorously, and allowed to settle on ice. The contents

were filtered using a Whatman 0.45 CIL filter. This extraction process was performed three

times. The methanol was rotary-evaporated at 45oC at a pressure of 337 mbar, and then at 80

mbar for five hours on a Buichi Rotavapor R-200 (Buichi Labortechnik AG, Flawil, Switzerland).

The final dried sample was reconstituted in 400 CIL of methanol:HCI (49: 1) to be used for TLC.

The methanol-extracted coralline algae samples were spotted onto the TLC plate in

volumes of 1, 5, 10, and 25 CL. Five microliters of the pure lumichrome and riboflavin stock

solutions were spotted as well as 25 CIL of the methanol:HCI solvent. The plate was developed

with chloroform:methanol :water (17.5:12.5:1. 5) for 40 minutes, allowed to dry and visualized

using a UV transluminator.

2.7.3 Solvent Partitioning of Lumichrome and Riboflavin

Due to the suspicion that chlorophyll is also extracted with methanol from the coralline

algae, solvent portioning was attempted to separate lumichrome from chlorophyll. As a

chlorophyll control, chlorophyll was extracted from grass blades with methanol. The starting

solvent was methanol, which was then mixed with either ethyl acetate, isopropanol, chloroform,

or tetrahydrofuran. If the two solvents were miscible then a 1:1 chloroform:water step was

added. The solution was vortexed and then centrifuged to separate phases. Since lumichrome

and riboflavin are yellow in solution and chlorophyll is green, simple observation on the phase

color indicated the presence of each chemical. Acid (0.05 M HC1) and base (0.05 M NaOH)

were added to each solvent mix to test the effect of pH on the partitioning.

Solvent partitioning was applied to the coralline algae extracts in order to separate

chlorophyll from lumichrome and riboflavin and therefore result in a cleaner run on the TLC.

The extracts were treated with methanol and ethyl acetate solvents mixed with chloroform and

water and treated with 0.05 M NaOH. This resulted in the yellow lumichrome in the top phase









and the green chlorophyll in the bottom phase. The top phase was transferred to a new

Eppendorf 1.5 ml tube and stored until used for TLC.

Solvent partitioned coralline algae extracts were separated TLC with both

chloroform:methanol :water (17.5:12.5:1 .5) and also methanol:water (3:2) mobile phases. The

samples were running quickly with the mobile front so a more hydrophobic mobile phase of

chloroform: methanol:water (3 5:12.5: 1.5) was used.

2.8 Induction of Coral Larvae Settlement and Metamorphosis

Acropora palmate and M\~onta;strea faviolata gametes were collected from Looe Key Reef,

FL in August 2006 and 2007 during mass spawning events. Fertilization and rearing of larvae

were conducted at Mote Marine Laboratory Tropical Research Center (Summerland Key, FL).

Settlement experiments were set up in six well Petri plates to test the effects of pure lumichrome,

riboflavin, microbial biofilms of coral-associated bacteria, and N-ac 1-homoserine lactones

(AHLs) have on the settlement and metamorphosis of coral larvae. Lumichrome and riboflavin

were used due to the observation that lumichrome induces settlement in ascidian larvae and their

involvement in inter-kingdom communication (Tsukamoto 1999, Tsukamoto et al. 1999).

N-acyl-homoserine lactones are signaling molecules and are critical components of the

communication system, quorum sensing (Waters and Bassler 2005, West et al. 2007). For this

experiment, 3-oxo-C6 homoserine lactone (a short-chain AHL) and C14 homoserine lactone (a

long-chain AHL) were used. 3-oxo-C6 HSL is a common AHL produced by bacteria involved in

quorum-sensing systems (Mohamed et al. 2008). C14 HSL was selected for these experiments

based on the observation that many marine associated alpha-proteobacteria produce long-chain

AHLs (Wagner-Dobler et al. 2005, Mohamed et al. 2008).













Table 2-1. Bacterial strains and plasmids
Strain or plasmid Relevant characteristic(s)a Source or reference


aApr, ampicillin resistance; Cmr, chloramphenicol resistance; Gmr, gentamicin resistance; Kmr, kanamycin resistance; Spr, spectinomycin resistance; Smr, streptomycin resistance; Tete, tetracycline
resistance, Nmr, neomycin resistance


E. coli hosts for cloning/construction
DH~u
S17 h-pir
Reporter strains and plasmids
Agrobactertum tumefaciens pZLR4
Sinorhlzoblum meblott MG32
E. cohMGl655 pMT41
E. cob RG133 pMT41
Serratia marcescens isolates
Serratla marcescens PDL100
Serratla marcescens MG1
Serratla marcescens ATCC# 39006
Serratla marcescens ATCC# 43422
Serratla marcescens ATCC# 43820
Serratla marcescensEL31
Serratla marcescens EL34
Serratla marcescens EL139
Serratla marcescens EL202
Serratta marcescens EL206
Serratta marcescens EL266
-A Serratta marcescens EL368
00Serratta marcescensEL402
Native coral isolates
Photobactertum mandapamensls 33-C12
Photobactertum letognath: 33-G12
Halomonas meridlan 33-E7
Plasmids
pCR2.1 TOPO TA
pCR2.1 TOPO Zero BLUNT
pZLR4
pl218
pl318
pSB401
pMT41
pBAD18-Ap


F-cp801acZAM15 A(lacZYA-argF) Ul69 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 h- thl-1 gyrA96 relA1
recA thl-1 proAB+ hsdR-M+
AHL reporter, cured of Ti plasmid, Gmr
8530 derivative, 95% slnl in frame deletion, ExpR+, sinI-, dapA fused with gus gene. Possible lumichrome reporter
Wild-type, Tete
MGl655 derivative uvrY33::Tn5, Tete, Kmr

isolated from Acropora palmata mucus, white pox pathogen, Tete, Apr, Sucroser
previously referred to as S. hlqulficians, isolated from rotten cucumber, wild type, AHL-produces, swarmer
Chesapeake channel water isolate, pigmented (prodigiosin+)
human throat isolate, pigmented (prodigiosin+)
Human urine isolate
Florida Keys wastewater isolate
Eden Pines canal water isolate (FL Keys), pigmented (prodigiosin+)
Florida Keys wastewater isolate
Higgs Beach isolate (FL Keys)
Mote Marine Tropical Research Laboratory canal water isolate (FL Keys)
Florida Keys wastewater isolate
seabird isolate (Key Largo, FL)
environmental isolate

isolated from Acropora palmata mucus, Spr, Smr, identity confirmed by 16S rDNA
isolated from Acropora palmata mucus, identity confirmed by 16S rDNA
isolated from Acropora palmata mucus, identity confirmed by 16S rDNA

cloning vector, Kmr, Apr
cloning vector, Apr
traCDG operon with its promoter region. traG is transcriptionally fused to lacZ. AHL reporter
gacA gene from S. marcescens PDL100 amplified with CJKl2 and CJKl8 cloned into pCR2.1, Apr, Kmr
gacA gene from S. marcescens PDL100 amplified with CJKl3 and CJKl8 cloned into pCR2.1, Apr, Kmr
luxRI'::1uxCDABE on pACYC (cloning vector), Tete
csrB promoter from E. cob cloned upstream of promoterless luxCDABE of pSB401, Tete
arabinose inducible promoter vector to serve as complementation vector control, Apr


Invitrogen
Invitrogen

(Shaw et al. 1997)
M. S. Gao, unpublished data
M. Teplitski, unpublished data
M. Teplitski, unpublished data


(Patterson et al. 2002)
(Eberl et al. 1999)
ATCC
ATCC
ATCC
E. Lipp (UGA)
E. Lipp (UGA)
E. Lipp (UGA)
E. Lipp (UGA)
E. Lipp (UGA)
E. Lipp (UGA)
E. Lipp (UGA)
E. Lipp (UGA)

K. B. Ritchie (Mote)
K. B. Ritchie (Mote)
K. B. Ritchie (Mote)

Invitrogen
Invitrogen
(Cha et al. 1998)
This study
This study
M. Teplitski, unpublished data
M. Teplitski, unpublished data
(Guzman et al. 1995)










Table 2-2. Primers used for PCR
Primer name Sequence Nucleotide binding site
M13F GTAAAACGACGGCCAG 443 -448 of bottom strand of pCR2.1 (EF488744)
M13R CAGGAAACAGCTATGAC 205-221 of top strand of pCR2.1 (EF488744)
CJKl2 GGAGATTTTTCCTTGATTAGCGTTCT 413-438 of top strand of S. plymuthica gacA (AYO57388)
CJKl3 ACATCTCAGGCTATAACAGAGGCTG 367-391 of top strand of S. plymuthica gacA (AYO57388)
CJKl8 TCGTCACGCAAAAGAACATTATATC 1345-1369 of bottom strand of S. plymuthica gacA (AYO57388)
MT13 ACTTTGCTATGCCATAGCATTTTTA 1200-1224 of top strand of pBAD18-Ap (X81838)










Table 2-3. Carbon substrates in Biolog EcoPlates
Polymers
a-cyclodextrin
glycogen
Tween 40
Tween 80
Carbohydrates
D-Cell0biosea
i-erythritol
D-galactonic acid y-lactone
N-acetyl-D-glUCOsamine
glucose-1-phosphate
P-methyl-D-glUCOside
DL-a-glyCeoTO phosphate
a-D-lactose
D-mannitol
D-xy osea
Carboxylic acids
y-hydroxybutyric acid
a-ketobutyric acid
D-galacturonic acid
D-glUCOsaminic acid
itaconic acid
D-malic acid
pyruvatic acid methyl ester
Amino acids
L-arginne
L-aSparagine"
glycyl-L-glutamic acid
L-phenylalanine
L-Senine
L-threonine
Amines
phenyl ethylamine
putrescine
Phenolic compounds
2-hydroxybenzoic acid
4-hydroxybenzoic acid
indicates substrates not in GN plates.










BlaBI
Clal Bael

A 8,, B.,, B
Tthl 111

Bt 7 SgrAl Ni






Psilr pCK








blam P3 promoter 1,r







% HinallI


Figure,,; 2-1.Cntrcino nrbns inuibl complemnainvetr A
Copemnato vetr pCK lsi a noae ihsnl etito
enym cu ie.gaAfo acses D10conddwsremo h
aadrrainsinuilprmtr(BGeelcrpoeiofPRogaAcoigno
pBD -A using prmes MT3adC,8(Tbe22.Lns -9aecln
PC fgc ro l1 lne noteEcR ieo pA 1-pad rnfre
into DH 0 an se~lecte nL splmnedwt m 20p/l Ln 0i
pBD8A lsi DAa epaean ae2 stePC atrmxa
neaiv onrl Positiv recion sdfrcmleetto sa idctdb()
The, DNA lade u ~sedi bFl cl Lde Fse cetiiPtsugP)









CHAPTER 3
PHENOTYPIC CHARACTERIZATION OF A CORAL WHITE POX PATHOGEN, Serratia
marcescens

3.1 Introduction

Opportunistic pathogens, such as Serratia marcescens, rely on specific metabolic

activities in order to utilize certain carbon sources present in their environment. These activities

may allow the pathogen to occupy metabolic niches within the host and promote growth and

ultimately infection (Berg et al. 2005, Munoz-Elias and McKinney 2006). Most of the metabolic

genes and pathways involved in growth and host infection by opportunistic pathogens are

uncharacterized. As most opportunistic pathogens are heterotrophs, they are capable of

metabolizing a wide variety of carbon sources such as carbohydrates, lipids, glycolipids, and

dicarboxylic and amino acids (Munoz-Elias and McKinney 2006). The ability of pathogenic

bacteria to utilize many carbon sources also contributes to their ability to persist in a wide variety

of environments and hosts. Many genera of bacteria, including Burkholderia, Enterobacter,

Herbaspirillum, Ochrobactrum, Pseudomona~s, Ralstonia, Staphylococcus and

Stenotrophomona~s, contain rhizosphere-associated bacteria that enter into interactions with

plants and humans (Berg et al. 2005). This may be attributed to the rich nutrients associated with

the rhizosphere due to high levels of root exudates (Campbell et al. 1997). The example of the

rhizosphere as an oasis of rich and available nutrients surrounded by nutrient poor bulk soil is

analogous to coral mucus surrounded by nutrient limited open water. They are able to support a

different consortium of bacteria as opposed to their surrounding environments. Opportunistic

pathogens may persist in these environments while in between hosts (Whipps 2001). A number

of potentially pathogenic organisms, including Aeromona~s, Clostridium, Klebsiella, Legionella,

Listeria, Pseudomona~s, and Vibrio are either naturally active in estuaries and oceans or able to

persist in dormant states (Grimes 1991, Harvell et al. 1999). The rich nutrients of coral mucus









may also explain the relatively high abundance of microorganisms in mucus layers of corals as

compared to the surrounding water (Lipp and Griffin 2004, Ritchie and Smith 2004). The use of

non-host environments by opportunistic pathogens provides valuable insight to their metabolic

potentials and commonalities that exist between organisms.

Many techniques are available for the identification and classification of environmental

and clinically isolated bacteria including culture-based growth media, nucleic acid isolation,

fatty-acid methyl-ester (FAME) analysis and fluorescence in situ hybridization (FISH) (rev. (Hill

et al. 2000)). Metabolic profiles generated through the use of sole carbon substrate tests provide

a relatively quick method to both identify and classify microbial organisms (Garland and Mills

1991, Garland 1997, Konopka et al. 1998, Hill et al. 2000, Preston-Mafham et al. 2002). The

BIOLOG MicroplateTM bacterial identification system was first introduced for the purpose of

assessing the functional identity of microorganisms from environmental samples (Garland and

Mills 1991). Rapid identification of individual isolates is based on sole-carbon source utilization

of 95 individual carbon sources and a water control in a 96-well plate. Plates specific to Gram-

negative and Gram-positive bacteria (GN and GP MicroPlatesTM, respectively) were developed

with appropriate carbon sources for each group (Preston-Mafham et al. 2002). Despite their

initial intentions of individual isolate characterization, GN plates were also used to analyze

bacterial communities (Konopka et al. 1998). Additional plates were developed for bacterial

diversity analysis at the community level. BIOLOG EcoPlatesTM use the same principles as GN

plates but instead of 95 individual substrates, they contain 31 substrates and a water control with

intra-plate triplication (Choi and Dobbs 1999). The EcoPlates contain some substrates in

common with the GN plates but also contain more complex and ecologically relevant substrates,

including photosynthetic exudates, which better reflect the diversity of substrates found in the









environment (Hill et al. 2000). The rapid nature of the BIOLOG plates has contributed to their

wide use, but the system is not without its limitations.

There are certain considerations that need to be accounted for when using the BIOLOG

method for analysis at both the individual and community levels. The density of the inoculum is

important and should be standardized if comparisons between isolates or samples will be made.

If the inoculum varies between plates then the resulting patterns of carbon source utilization may

be biased (Konopka et al. 1998, Hill et al. 2000, Preston-Mafham et al. 2002). Functional

diversity analysis is based on the assumption that color development is a function of the

proportion of organisms present that can utilize a specific substrate. This, however, may not be

the case. Some substrates are simply utilized more readily than others and some organisms are

more efficient at utilizing various substrates (Hill et al. 2000). A third problem associated with

using the GN plates to compare isolates from different environments is that many of the

substrates are not ecologically relevant and do not adequately reflect the diversity of substrates in

the environment (Campbell et al. 1997, Konopka et al. 1998). The GN plates are biased toward

simple carbohydrates, which are utilized by a wide variety of bacteria. This results with

metabolic redundancy during comparison of metabolic profiles (Preston-Mafham et al. 2002).

With the considerations mentioned above in mind, EcoPlates were used to compare

metabolic profiles of previously identified isolates of Serratia marcescens and coral-isolated

bacteria. The EcoPlates were used due to their inclusion of more ecologically relevant substrates

representing a variety of environments, which encompass those from which the isolates were

collected. A comparison of the resolution of both EcoPlates and GN plates showed no

significant differences in the cluster analysis (Choi and Dobbs 1999). Therefore, the lack of the

common simple carbohydrates in the EcoPlates should not influence the downstream analysis.










As discussed earlier, heterotrophic bacteria are capable of utilizing a variety of carbon

sources. One study positively identified upwards of twenty genes directly related to carbon

compound catabolism induced in E. coli by growth on murine intestinal mucus (Chang et al.

2004). Specific genes involved in catabolism of N-acetylglucosamine, pentose, fucose and

ribose were induced during initial colonization and growth on intestinal mucus as opposed to

genes involved in degradation of ethanolamine, anaerobic respiration, and the TCA cycle were

induced at a later time point (Chang et al. 2004).

Coral mucus is comprised of proteins, amino acids and carbohydrates that contain glucose,

galactose, glucosamine chitinn), galactosamine, fucose and arabinose (Ducklow and Mitchell

1979, Meikle et al. 1988), although the structure of coral mucus and chemical bonds by which

the individual components of mucus are held are not known. Catabolic enzymes, such as

chitinase, are induced during colonization of intestinal tracts and invertebrate larvae by marine

bacteria (Bassler et al. 1991, Lertcanawanichakul et al. 2004, Bhowmick et al. 2007). Chitin is

the second most abundant homopolymer (repeats of the same monomers) in nature and is

ubiquitous in the environment.

Production of proteinases also may enhance bacterial metabolism, allowing bacteria to

persist on such a wide assortment of carbon sources. Bacteria generally obtain their carbon and

nitrogen through enzymatic degradation of extracellular biopolymers by proteinases and

glycosidases (Travis et al. 1995). Often these proteinases have broad substrate specificity

(Travis et al. 1995, Ovadis et al. 2004). Serratia marcescens is known to produce both

extracellular and cell-associated proteinases, which function in catabolism and virulence

associated behaviors (Schmitz and Braun 1985, Ovadis et al. 2004). Just as catabolic enzymes









are induced by growth conditions; it is likely that opportunistic pathogens produce proteinases

during establishment and growth on a host.

In this experiment, the metabolic capabilities and enzymes involved in coral mucus

utilization of Serratia nzarcescens PDL 100, human and environmental S. nzarcescens isolates,

and coral-associated bacteria were investigated. I hypothesized that PDL100 should exhibit a

unique metabolic profile similar to coral-associated bacteria as compared to other isolates of

Serratia nzarcescens. Its ability to grow on coral mucus and cause disease may suggest that it

has "evolved" specific pathways for the utilization of the nutrients comprising coral mucus. This

hypothesis was tested through sole-carbon source utilization profiling with BIOLOG

EcoPlatesTM and enzymatic and proteinase induction by coral mucus assays. This experiment

provides useful information about the types of pathways and enzymes used by S. nzarcescens

PDL100 during growth on coral mucus and provides a foundation for the identification of

specific genes induced during colonization of the pathogen.

3.2 Materials and Methods

3.2.1 Carbon Source Utilization Profile Using Biolog Ecoplate Assay

Carbon-source utilization of the white pox pathogen, Serratia nzarcescens PDL 100, and

fifteen other isolates of Serratia nzarcescens and other coral isolated bacteria (Table 2-1) was

assayed using Biolog EcoPlates. These 96-well plates are manufactured with 31 different

substrates in triplicate per plate with a water control (Table 2-3). The EcoPlates rely on the

tetrazolium violet dye redox reaction, which detects fermentation of sole carbon sources

(Garland and Mills 1991, Garland 1997). Assays were set up according to Choi & Dobbs (1999)

with the following modifications (Choi and Dobbs 1999). Isolates were grown in either 5 ml LB

broth or GASW broth overnight at 30oC with shaking. Cells were pelleted at 10,000 x g using an

Eppendorf table-top centrifuge 5415D (Eppendorf, Hamburg, Germany) and washed twice with









filter sterilized (0.22 Clm) seawater to remove any residual nutrients from the overnight media.

Cells were then resuspended in 10 ml filter sterilized seawater and starved for 24 hours at 30oC.

Following the starvation period, 100 CIL of cell suspension was inoculated into each well of the

Biolog EcoPlate. The initial A590 Of each plate was read on Victor-3 (Perkin Elmer, Shelton, CT)

and was continuously read every 24 hours for a total of 72 hours.

3.2.2 Enzyme Induction in Response to Growth on Coral Mucus

While the exact composition of coral mucus is unknown, detection of specific enzymes

induced in response to growth on coral mucus can tell us certain types of bonds within the coral

mucus matrix. Enzymatic induction assays using chromogenic substrates allow for detection of

individual specific enzymes induced in response to growth on a certain medium or in a specific

niche. In addition to identifying specific bonds in the various components of coral mucus, the

ability of different bacterial isolates and strains of bacteria to utilize the components of coral

mucus may elucidate phenotypic relatedness among bacterial species and strains.

Serratia marcescens isolates from wastewater, canal water and other environments were

compared with a pathogenic strain of the same species and three coral associated bacterial strains

isolated from Acropora palmate mucus (Table 2-1). Two overnight cultures of each isolate were

grown in 5 ml Luria-Bertani (LB) broth or in GASW broth (Smith and Hayasaka 1982, Smith et

al. 1982) to an approximate OD600 Of 2.0 (stationary phase), which was determined

spectrophotometrically. Cells were pelleted at 10,000 ref and washed 3 times in filtered-

sterilized seawater (0.22 Clm) buffered with 10 mM HEPES to remove any residual nutrients and

resuspended in 5 ml of buffered seawater. The cells starved in filter-sterilized seawater at 30oC

while shaking for three days in order to use up any internal resources. A three-day starvation

period was found sufficient during preliminary studies with S. marcescens PDL100. Following

the three-day starvation, 1 ml of cells was added to 2 ml of either lx coral mucus (freeze dried,









UV irradiated for 20 minutes and reconstituted to original volume (Ritchie 2006)) or 10 mM

HEPES buffered seawater). Negative controls of coral mucus alone and buffered seawater alone

were performed in parallel with the experimental treatments for each isolate. Cells were

incubated in treatments for two and eighteen hours at 30oC. Following incubation, the initial

OD590 Of each treatment was determined spectrophotometrically and recorded. Cells where then

mixed with Z-buffer (1:1/v:v) and lysed with 0. 1% sodium dodecyl sulfate solution and

chloroform (4:1/v:v) (Miller 1972). Cell suspensions were aliquoted into chloroform-resistant

microcentrifuge tubes so to accommodate two biological and two technical replicates per

substrate per treatment. Enzymatic substrates were prepared in HPLC-grade water and each

substrate was added to the appropriate reactions to a final concentration of 0.8 Clg/CIL. Assays

were conducted at room temperature for approximately 24 hours to allow for maximum color

development. Sodium carbonate (Na2CO3) WAS added to a final concentration of416 mM to stop

the reaction and to intensify the color of each reaction. Cellular debris and unused enzymatic

substrate were pelleted at 4,000 x g (16,000 ref) for two minutes. The clear supernatant was

transferred to a polystyrene 96-well plate and the A405 WAS measured on Victor-3 (Perkin Elmer,

Shelton, CT). Buffered seawater and coral mucus were included in each plate as blanks.

Representative isolates from the three broad categories of Serratia marcescens isolates

examined (human isolate, Sm 43422; environmental isolate, Sm39006; and white pox pathogen,

PDL 100) were also assayed with a treatment testing whether the catabolic capabilities of the

isolates could be repressed in the presence of glucose. A minimal media consisting of 10 mM

HEPES buffered seawater supplemented with glucose (4 g/L) and Casamino Acids (0.1 g/L) as

the sole carbon and nitrogen sources was filter sterilized through a 0.22 Clm filter. This

additional treatment was examined due to the observation that some enzymes appeared to be









induced during starvation stress regardless of which treatment ultimately experienced by the

cells. Glucose is a known catabolite repressor. In Enterobacteriaceae, glucose inhibits

expression of catabolic and regulatory genes required for growth on most other carbon sources;

glucose also inhibits expression of virulence genes and regulators (Ferenci 1996, Reverchon et

al. 1997, Jackson et al. 2002, Gosset et al. 2004, Teplitski et al. 2006). As controls for this

treatment, cells were also incubated with 10 mM buffered seawater supplemented with Casamino

Acids (0.1 g/L) without glucose and buffered seawater alone. The enzyme induction assay was

conducted as described above.

3.2.3 Protease Induction in Response to Coral Mucus

Acroporid coral mucus consists of a variety of carbon and nitrogen compounds and may

contain of up to 22% protein (Ducklow and Mitchell 1979). These proteins may serve as

substrates to those bacteria able to utilize them as a food source. Therefore, it is plausible that

induction of various proteases may occur in response to growth on coral mucus. The production

of proteases during growth in rich medium was first investigated for both cell-associated and

extracellular protease production (Demidyuk et al. 2006). A volume of 0.3 ml of either cell

suspension or culture supernatant was added to 1.7 ml of water and azocasein solution (5 mg/ml

in 0. 1 M Tris Buffer pH 7.5) was added to a final concentration of 0. 16 mg/ml. As a control, a

blank of 1.6 mg/ml azocasein solution in water was prepared. Reactions were incubated

statically at 30oC for 60 min. Following incubation, trichloroacetic acid (TCA) was added to

each reaction to a final concentration of 3.2% v:v to stop the enzymatic reaction and to

precipitate any unhydrolyzed azocasein. Each reaction was pelleted at 10,000 x g for 1 min to

sediment the unhydrolyzed substrate. The supernatant was carefully transferred to a new tube, to

which NaOH (250 mM final concentration) was added to intensify the color. 200 CIL of each









reaction was transferred to a clear polystyrene 96-well plate and the A405 Of each reaction was

read on VICTOR-3 (Perkin Elmer, Shelton, CT).

3.2.4 Statistical Analysis

Carbon utilization profie data assayed with the BIOLOG EcoPlates were analyzed by

average well color development (AWCD) and principal components analysis (PCA). AWCD

was calculated as E(C- R) / n, where C is color production within each well (optical density

measurement), R is the absorbance values of the plate' s control well, and n is the number of

substrates (EcoPlates, n = 31) (Garland and Mills 1991, Choi and Dobbs 1999). Principal

components analysis was performed on transformed AWCD data after 72 hours. Values from

the wells of individual substrates (3 replicates for each substrate) were averaged and transformed

using the formula (C R) / AWCD. PCA proj ects original data onto new, statistically

independent axes (principal components). Each principal component accounts for a portion of

the variance from the original data (Garland 1997, Choi and Dobbs 1999). Relationships among

isolates were obtained by correlation analysis between the principal component values.

Enzymatic activities of each isolate were compared using correlation analysis after mean-

centering the original values. Hierarchical cluster analysis was used to generate dendograms to

correlation relationships among isolates.

Induction of both extracellular and cell-associated proteases among isolates was compared

using a one-way Analysis of Variance (ANOVA) with type I error significance level at a = 0.05.

All data were analyzed with STATISTICA software version 6.0 and/or Microsoft Excel 2003.

3.3 Results

3.3.1 Carbon Source Utilization Profile Using BIOLOG EcoplateTM Assay

The metabolic profies of Serratia marcescens PDL 100, human and environmental

Serratia marcescens isolates, and coral-associated bacteria were identified using the BIOLOG









EcoPlatesTM. The EcoPlates incorporate environmentally relevant sole-carbon substrates and

represent the diversity of the various habitats that these isolates were collected from (Hill et al.

2000). Based on the heterogeneity of environments of isolation, I hypothesized that isolates

collected from similar environments would show a similar carbon-source utilization as compared

to isolated collected from distinctly different environments. Serratia marcescens PDL100 was

expected to show a profile similar to environmental isolates and coral-associated bacteria,

distinct from the human and plant pathogenic isolates.

The average well color development (AWCD) was calculated after every 24 hour reading

and was plotted over time. The color development in the EcoPlate seeded with Serratia

marcescens PDL100 followed a linear curve through the 72-hour measurement period.

Similarly, the color development of the pathogenic isolates of S. marcescens also followed a

linear curve (Fig. 3-1A). The coral associated bacteria exhibited a rapid average well color

development, which then reached a plateau after 24 hours of incubation (Fig. 3-1B). The two

Photobacterium isolates showed the same progression of color development while the

Halomona~s showed an overall lower level of color development. The various environmental

isolates of S. marcescens revealed the greatest variety of color development (Fig. 3 -1C), which

may represent the diversity of environments from which they were isolated. The differences in

the AWCD among the Serratia isolates indicates that effectiveness of an isolate at utilizing

specific carbon sources is dependent on the environment in which it is found. The pathogenic

isolates all encounter similar nutrients during their respective host infections and therefore show

similar AWCD. The environmental isolates were isolated from diverse environments, each with

a potentially unique suite of carbon sources. This diversity between isolates shows that although









all isolates are genetically identified as S. narcescens, subtle but important differences in terms

of their metabolic potentials exist.

The average well color development for each isolate, transformed for PCA, was

compared after 72 hours of incubation. Correlation analysis was then applied to group the

isolates based on their ability to utilize the carbon sources in the EcoPlates. Isolate EL139 (FL

Keys wastewater isolate) proved to be an extreme outlier throughout all analyses and therefore

was excluded in the Einal cluster analysis. The correlation analysis indicated that PDL100 has a

similar carbon-utilization profie to many of the other isolates tested (r > 0.5; except for EL3 1, r

= 0.43). PDL100 clustered with MG1 and the other pathogenic isolates of S. narcescens (Fig. 3-

2). The environmental isolates not associated with wastewater clustered together, as did the

coral-associated bacteria. Both isolates 39006 (Chesapeake channel water) and EL31 (FL Keys

wastewater) are outliers as compared to the pool of isolates, EL31 more so than 39006. This is

in line with the observations of EL139, which is also a wastewater isolate.

3.3.2 Enzyme Induction in Response to Growth on Coral Mucus

Bacteria depend on specific catabolic enzymes for the degradation and uptake of the

carbon and nitrogen sources of a given environment. The ability of Serratia nzarcescens

PDL100 to grow on coral mucus suggests that specific enzymes may be present in PDL100,

which may not be present in other S. narcescens isolates. I hypothesized that S. narcescens

PDL100 utilizes a different suite of substrates potentially present in coral mucus as compared to

other pathogenic and human-associated isolates. PDL100 was expected to possess the same

catabolic enzymes as the three coral-associated isolates, all of which presumably have "co-

evolved" with the coral host.

In Serratia nzarcescens PDL 100, a-D-glucopyranosidase, a-L-arabinopyranosidase, N-

acetyl-p-D-gal actosaminidase (chitinase), a-L-fucopyranosi dase, and P-D-gal actopyranosidase










(Fig. 3-3A) were induced following growth on coral mucus. These enzymes, except for a-L-

fucopyranosidase, showed similar levels of activity in the seawater control. The native coral-

associated bacteria exhibited a broader range of enzymatic induction as compared to S.

marcescens PDL100 (Fig. 3-3B). These substrates in coral mucus induced a-D-

galactopyranosidase, a-D-glucopyranosidase, N-acetyl-P-D-galactosaminidase (exo-chitinase),

a-L-fucopyranosidase, P-D-fucopyranosidase, P-D-galactopyranosidase, P-D-glucopyranosidase,

and P-D-xylopyranosidase in response to growth on coral mucus. While more enzymes were

induced in these isolates, the levels of induction were lower on average than many of the other

isolates. Some of these enzymes were also induced during incubation in seawater. Overall, the

pathogenic isolates of S. marcescens (MG1, 43422, and 43 820) all enzymes tested induced more

enzymes in response to growth on coral mucus than PDL 100 and the coral-associated isolates.

Together, the three pathogenic isolates demonstrated induction of all enzymes in the assay,

although many enzymes (a-D-xylopyranosidase, a-L-arabinopyranosidase, P-D-

fucopyranosidase, P-D-glucuronidase, and P-L-arabinopyranosidase) were induced at

comparatively low levels (Fig. 3-3C). An assay was conducted in parallel with coral mucus

alone to serve as a baseline of enzyme activity present in coral mucus (Fig. 3-3D). Enzyme

activity in the coral alone mucus treatment was significantly less than the coral mucus + isolate

treatments the activities observed in the mucus alone assay were subtracted from all other

treatments with isolates grown on coral mucus. Similarly, a filter-sterilized buffered seawater

control was performed and was used as a baseline correction for the treatments with isolates

incubated in seawater.

To validate that enzymatic activity observed in response to growth on coral mucus was

indeed due to the presence of coral mucus and not simply due to constitutively produced










enzymes, enzymatic activities were assayed in response to growth on filter-sterilized buffered

seawater supplemented with glucose and casamino acids as the sole carbon/nitrogen sources. A

representative isolate from each of the maj or sub-groups of isolates was used: Serratia

nzarcescens PDL100 (coral white pox pathogen), S. narcescens 43422 (human/pathogenic), and

S. narcescens 39006 (environmental). As casamino acids contain carbon, the influence of

casamino acids on enzyme induction was accounted for. In all three isolates, enzyme activity in

response to growth on glucose was greatly attenuated (Fig. 3-4). In both nzarcescens PDL100

and S. narcescens 43422, a-D-glucopyranosidase and N-acetyl-P-D-galactosaminidase remained

active in response to glucose, while all others induced on coral mucus were repressed (Fig. 3-4A

& B). Enzyme activity was repressed in S. narcescens 39006 (Fig. 3-4C). a-D-

glucopyranosidase and N-Acetyl-P-D-galactosaminidase were not induced to the same degree in

S. narcescens 39006 in response to coral mucus. In response to growth on glucose, both of these

enzymes were greatly repressed. P-D-glucopyranosidase remained slightly active in S.

nzarcescens 39006 during growth on glucose, while it was significantly repressed (20 fold) as

compared to the isolate grown on coral mucus.

Correlation analysis was applied to the isolates based on their enzyme induction in

response to growth on coral mucus and incubation in filter-sterilized buffered seawater. After 2

hours growth on coral mucus, no clear pattern was observable as the environmental were

clustered with both the pathogenic isolates and the coral-associated bacteria (Fig. 3-5A). After

18 hours of growth on coral mucus, the isolates clustered more closely with isolates from their

respective groups. Just as the BIOLOG data indicated, Serratia nzarcescens PDL100 was most

highly correlated with S. nzacescens MG1 and the other pathogenic isolates (Fig. 3-5B). Cluster

analysis of the enzyme induction in response to incubation on filter-sterilized seawater followed









a similar pattern as induction in response to growth on coral mucus. Serratia nzarcescens

PDL100 was consistently correlated with the pathogenic isolates, and the environmental isolates

and the coral-associated isolates were highly correlated together after both 2 hours and 18 hours

of incubation (Fig. 3-6A & B).

3.3.3 Proteinase Induction in Response to Coral Mucus

Bacteria generally obtain their carbon and nitrogen through enzymatic degradation of

extracellular biopolymers by proteinases and glycosidases (Travis et al. 1995). Serratia

nzarcescens is known to produce both extracellular and cell-associated proteinases, which

function in catabolism and virulence associated behaviors (Schmitz and Braun 1985, Ovadis et

al. 2004). I hypothesized that all strains of Serratia nzarcescens, especially the pathogenic

strains, would produce proteinases in response to growth on coral mucus. I also predicted that

the coral-associated bacteria would produce proteinases due to their adapted lifestyle on coral

mucus. Production of both extracellular and cell-associated proteinases were measured after two

hours (exponential growth phase) and 18 hours (stationary growth phase) of growth on coral

mucus. Cell-associated proteinase production after two hours of growth was low in all isolates,

although statistically significant differences were found between the isolates (F15,32 = 3.4549; p =

0.0016; Fig. 3-7A). Although statistically significant, these differences may not be biologically

significant as the majority of the isolates showed similar induction. After 18 hours of growth on

coral mucus, differences in cell-associated proteinase production were statistically significant

and more pronounced (F15,32 = 5.628; p < 0.0001; Fig. 3-7B). EL139 produced the greatest

enzyme activity and S. nzarcescens PDL 100 was most similar to the pathogenic strains MG1 and

43422, as well as the coral-associated bacteria and the other S. nzarcescens isolates. 43820, the

human urine isolate clustered with a canal water isolate, EL34 and a seabird isolate, EL368.









Extracellular proteinase activity was induced at similar levels as the cell-associated

proteinase in those isolates with the ability to utilize the general proteinase substrate, azocasein.

After two hours of growth on coral mucus, isolates 43 820, EL 139 and EL368 exhibited the

highest activity, which was statistically significantly more than the other isolates (F15,32

47.4265; p < 0.0001; Fig. 3-8A). The same pattern was observed after 18 hours of growth on

coral mucus with much variability of proteinase activity within the pathogenic and

environmental isolates (F15,32 = 27.6133; p < 0.0001; Fig. 3-8B).

3.4 Discussion

This study provides a glimpse at the range of metabolic capabilities of a coral white pox

pathogen, Serratia nzarcescens PDL 100. The results present evidence as to the types of catabolic

enzymes induced during growth on coral mucus and the diversity of substrates found in nature

that S. narcescens PDL100 could utilize. Based on the carbon-source utilization profiles and the

enzyme induction assays, S. narcescens PDL100 is highly correlated with S. nzacescens MG1

and other pathogenic isolates. These findings suggest that the metabolic capabilities of

opportunistic pathogens are inherently broad so as to take advantage of different environments

and hosts when conditions are favorable. It appears that S. narcescens PDL100 does not possess

unique metabolic capabilities specific to growth on coral mucus that could have been

characteristic of a co-evolved pathogen. Native coral-associated bacteria clustered together in all

experiments and were clustered distantly from nzarcescens PDL100 (Fig. 3-2, 3-5, 3-6).

Similar clustering was also observed in the proteinase induction assays but was less conclusive

as only marginal differences between PDL 100 and the coral-associated bacteria were found (Fig.

3-7 & 3-8).

The high correlation between Serratia nzarcescens PDL100 and the other pathogenic S.

nzarcescens isolates may also suggest that the coral white pox pathogen may have originated









from anthropogenic sources, although source tracking analyses were not performed in this study.

When the etiology of white pox disease was described it was hypothesized that S. marcescens

PDL100 may be associated with pollution of fecal origin (Patterson et al. 2002). Since then,

studies have shown that enteric bacteria and viruses from human waste do not survive long in

warm, saline and transparent waters around coral reefs, but can persist in marine sediments and

in coral mucus (Lipp et al. 2002, Lipp and Griffin 2004). Enteric bacterial loads were found to

be significantly higher in coral mucus samples and sediments as compared to the surrounding

water column (Griffin et al. 2003, Lipp and Griffin 2004). The isolation of important fecal

indicator bacteria, such as Clostridium perfr~ingens from coral mucus has been attributed to

potentially low oxygen levels on coral heads (Lipp et al. 2002), however the dissolved oxygen

levels on coral heads and surrounding water were not compared. Communities in the Florida

Keys rely heavily on on-site disposal as treatment of wastewater with an estimated more than

25,000 septic tanks, cesspools and injection wells (Paul et al. 2000). Enteric bacteria and viruses

are quickly transported via water currents from canals into near shore waters and onto coral

reefs, often within 24 hours of introduction (Griffin et al. 2003). The exact origin of S.

marcescens PDL100 is yet unclear and investigations are underway (Patterson et al. 2002).

Mucus is secreted by a wide array of organisms. In humans alone, mucosal surfaces are

found wherever absorptive and excretive functions occur, primarily the gastrointestinal (GI),

respiratory, and urinogenital tracts (Pearson and Brownlee 2005). Mucus provides a rich source

of nutrients where surrounding environments may be lacking (Ritchie and Smith 2004,

Kooperman et al. 2007, Sharon and Rosenberg 2008) and may serve as an oasis until

surrounding conditions become favorable (Drake and Horn 2007). Human-derived mucus is

made up of mucins, which are glycoproteins with a central protein core attached to a









carbohydrate side chain. Up to 80% of the molecule is comprised of carbohydrate chains

including galactose, fucose and N-acetylgalactosamine, N-acetylglucosamine, sialic acid, and

mannose (Pearson and Brownlee 2005). These carbohydrates and glycoproteins are also the

main components of coral mucus (Ducklow and Mitchell 1979, Meikle et al. 1988, Ritchie and

Smith 2004). The ability of bacteria to colonize mucosal surfaces is in large part determined by

the properties of the microorganism and the conditions of the environment. Bacteria not only use

specific pathways and enzymes to grow on mucosal surfaces but also use flagella for motility

and pili and fimbriae for adhesion to the surface (Laux et al. 2005, Virji 2005). Serratia

nzarcescens 43422 was isolated from a human throat, an environment bathed by mucus

structurally similar to coral mucus (Ducklow and Mitchell 1979, Meikle et al. 1988, Pearson and

Brownlee 2005). Therefore, it may not be that surprising that S. narcescens PDL100 showed

high similarity to this human isolate and other pathogenic strains of S. narcescens. With its

ubiquitous nature, S. narcescens may have simply evolved a broad range of metabolic pathways

and enzymes in order to cope with survival in a variety of environments.

In addition to elucidating some basic metabolic capabilities of bacterial isolates during

growth on coral mucus, the enzymatic induction assays also identified some of the types of

carbohydrates and bonds/formations present in Acropora palmate coral mucus during the

summer months. All twelve substrates used in the induction assay showed induction in at least

one isolate in response to growth on coral mucus, although some were induced more than others

(Fig. 3-3). Most of the substrates were assayed in two conformations, a and P. In some cases the

alpha conformation appeared to be more abundant in coral mucus (a-L-arabinopyranosidse, a-D-

glucopyranosidase, a-L-fucopyranosidase), while in others the P form was more abundant (P-D-

galactopyranosidase, P-D-xylopyranosidase). Some enzymes appeared to be constitutively










expressed (a-D-glucopyranosidase and N-acetyl-P-D-galactosaminidase) as they were active in

both cells grown on coral mucus and cells incubated in sterile seawater with no added carbon

sources (Fig. 3-3). The fact that both a and P forms of the substrates were found in coral mucus

makes it is difficult to conclude if one conformation occurs more in nature than the other.

Surely, some organisms are better able to recognize and utilize certain conformations (e.g.

(Sexton and Howlett 2006)). The presence of these carbon sources in A. palmate mucus is in

line with previous studies regarding the composition of coral mucus. Ducklow and Mitchell

(1979) found mucus from Acropora spp. to consist of glucose, galactose, glucosamine,

galactosamine, fucose and high levels of arabinose (Ducklow and Mitchell 1979). Therefore, it

is not a stretch for all of these substrates to be found in the mucus of this species of coral. It is

worth noting, however, that different conformations of the same substrate are secreted into coral

mucus by the host. The open chain forms of monosaccharides are quite flexible around the

central carbon bonds. The reactive nature of aldehyde and ketone groups often lead to reversible

cyclization of the molecule resulting in either an alpha or beta conformation. In aqueous

solution, equilibrium between the conformations will exist (Perez et al. 1996, Farnback et al.

2008). One form may dominate over the other depending on environmental conditions such as

temperature and pH (Drickamer and Dwek 1995). These findings add to the complexity of the

composition of coral mucus and only represent mucus collected at one time point. It is possible

that the composition of coral mucus changes temporally and with changes in conditions

(Crossland 1987). While the goal of this study was not to characterize the composition of A.

palmate mucus, structural components were identified and may provide a foundation for further

characterization.









This study has also described a new potential use for BIOLOG EcoPlatesTM. Although

designed for community based analyses of bacterial diversity in different environments (Hill et

al. 2000, Preston-Mafham et al. 2002), EcoPlates were clearly able to differentiate bacterial

isolates of the same species based on their carbon-source utilization profies. EcoPlates were

used instead of the BIOLOG GN1 plates because GN1 plates are primarily used for identification

of a single isolate and contain ecologically irrelevant carbon substrates. While EcoPlates contain

fewer substrates, the substrates included better represent the diversity of substrates found in

different environments. Therefore, they may provide a means for not only characterizing the

metabolic profie of environmental isolates, but also serve as a method of comparing different

environmental isolates that are genetically identified as the same species.









Table 3-1. Chromogenic substrates
Substrate number (#) Substrate name
1 a-D-Galactopyranoside
2 a-D-Glucopyranoside
3 a-D-Xylopyranoside
4 a-L-Arabinopyranoside
5 N-Acetyl-P-D-Galactosaminide
6 a-L-Fucopyranoside
7 P-D-Fucopyranoside
8 P-D-Galactopyranoside
9 P-D-Glucuronide
10 P-D-Glucopyranoside
11 P-L-Arabinopyranoside
12 P-D-Xylopyranoside













PDL100
0. 8 MG1
-A- 43422
Fl 0.6 -1 -- 43820


0 24 48


Hours


B 1.0
PDL100
0.8 -A- 33-C12
33- E7
S0.6 33-G12


0 24 48 72


Hours


0 24 48 72


Hours

Figure 3-1. Carbon-source utilization profiles of bacterial isolates. (A) Average well color
development (AWCD) for Serratia marcescens PDL 100 and pathogenic isolates of S.
marcescens. (B) AWCD for S. marcescens PDL100 and coral-associated bacteria.
(C) AWCD for S. marcescens PDL 100 and environmental S. marcescens isolates.
AWCD = E(C R) / n where C is color production within each well (OD590), R is the
absorbance value of the plate' s control well, and n is the number of substrates (n =
3 1).










0 .05


0.30






S0.20


0.15


0.10


0 .0 5
EL_31 33-E7 33-C12 EL202 EL_34 43422 MG1
39006 33-G12 EL206 EL402 EL368 43820 PDL100

Figure 3-2. Correlation analysis of carbon-source utilization profiles of bacterial isolates.
Average well color development (AWCD) values after 72 hours of incubation were
subj ected to correlation analysis using EXCEL and cluster diagram generated in
STATISTICA. Tree-based clustering of substrate values (AWCD); [1 Pearson's r]
was used as the single linkage distance measure. Values from wells of individual
substrates (3 replicates for each substrate) were averaged after 72 hour incubation.
The averages for each substrate were then transformed for PCA analysis with the
formula (C R) /AWCD.


























4 5 6 7 8 9 10 11 12
Substrate


gMC 2hr
MC18h
aSC2 h
0 SC18 h


S350-
tj300-
S250-
cn200-
a 150 -
100 -

50 -

1 2


300
~~250
S200
rn150
a,100
50 s
-,
0
-


aMC 2 hr
MC18h
MSC2h
O SC18 h


m -
34567
Substrate


1 2


8 910


11 12


300
S250
S200
rn150
a,100
50
0o


mMC 2 hr
MC18h
MSC2h
OSC18h


1 2 3 4 5 6 7 8 9 10 11 12
Substrate


S:300
S250
S200
rn150
a,100
-
50
-,
0
-


MA 2hr
MVA 18 hr


345678
Substrate


1 2


9 1011 12


Figure 3-3. Average enzyme induction by Serratia marcescens PDL100 (A), coral-associated
bacteria (B), pathogenic Serratia marcescens (C), and coral mucus alone as a

negative control (D). Starved cultures grew on either coral mucus (freeze-dried/UV-
irradiated) or filter-sterilized buffered seawater (10 mM HEPES, pH 6.5) for 2/18
hours, blue/orange bars, respectfully. List of substrates can be found in Table 3-1.
















CM 2hr
g CM 18hr
CA 2hr
O CA 18hr


1 2


3 45 6 7
Su bstrate


8 9 10 11 12


mCM 2hr
gCM18h
gCA2h
OCA18hr


1 2 3 4 5 6 7 8 9 10 11 12
Substrate


mCM 2hr
gCM18h
gCA2h
OCA18hr


9 10 11


34 56 7 8
Substrate


Figure 3-4. Average enzyme induction by Serratia marcescens PDL100 (coral white pox
pathogen) (A), Serratia marcescens 43422 (human throat isolate) (B), and Serratia
marcescens 39006 (Chesapeake channel isolate) (C) grown on filter-sterilized
buffered seawater (10 mM HEPES, pH 6.5) supplemented with glucose (4 g/L) and
Casamino Acids (0.1 g/L) or filter-sterilized buffered seawater (10 mM HEPES, pH
6.5) supplemented with Casamino Acids (0.1 g/L) for 2/18 hours, blue/orange bars,
respectfully. List of substrates can be found in Table 3-1.





'04





0.2


0.1


0.0


33-012 EL266 33-E7 43820 43422 EL34 EL31 EL368
390006 EL206 33-C12 EL139 EL202 MG1 EL402 PDL100


1.2


1.0





'0.4


S0.2





0.0


39006 33-012 33-E7 EL368 EL139 EL34 43422 MG1
33-C12 EL206 EL402 EL266 EL202 43820 EL31 PDL100


Figure 3-5. Enzyme induction for all isolates by growth on coral mucus for 2 hours (A) and 18
hours (B). Tree-based clustering of mean-centered substrate values; [1 Pearson's r]
was used as the single linkage distance measure.


I ~n I ~1


III














A 1.2


1.0



0.8



S0.6



0.4



0.2




39006 33-C12 33-G12 EL31 EL402 EL202 43820 MG1
33-E7 EL266 EL206 EL34 EL368 EL139 43422 PDL100



B



1.2


1.0



S0.8


0.6


0.4


0.2


0.I
39006 33-C12 EL266 EL202 EL402 43820 EL31 MG1
33-E7 33-G12 EL206 EL139 EL368 EL34 43422 PDL100



Figure 3-6. Enzyme induction negative control on filter-sterilized buffered seawater (10 mM
HEPES) for 2 hours (A) and 18 hours (B). Tree-based clustering of mean centered
values; [1 -Pearson's r] was used as the single linkage distance measure.










A
S0.04-

S0.03-

0.02-








Isolate


S0.04-

S0.03-


*5 0.02-

rJ 0.01-


40



Isolate


Figure 3-7. Average cell-associated proteinase induction in all isolates by growth on coral mucus
for 2 hours (A) and 18 hours (B). Overnight cultures were grown in LB or GASW,
washed with filter-sterilized buffered seawater (10 mM HEPES, pH 6.5) and starved
for three days. Starved cells were grown on coral mucus for 2 and 18 hours before
proteinase production assay.











A
S0.07-
S0.06-
S0.05-
a 0.04-
S0.03-
S0.02-


S0.00




Isolate




Z;0.07
0.06


S0.04-
S0.03-
0.02-







Isolate


Figure 3-8. Average extracellular proteinase induction in all isolates by growth on coral mucus
for 2 hours (A) and 18 hours (B). Overnight cultures were grown in LB or GASW,
washed with filter-sterilized buffered seawater (10 mM HEPES, pH 6.5) and starved
for three days. Starved cells were grown on coral mucus for 2 and 18 hours before
proteinase production assay.









CHAPTER 4
FUNCTIONALITY OF THE RESPONSE REGULATOR gacA IN A WHITE POX
PATHOGEN, Serratia nzarcescens

4.1 Introduction

Opportunistic bacterial pathogens, including Serratia nzarcescens, can infect a wide

variety of distinct hosts ranging from plants, invertebrates, and other animals. Pathogens must

either adapt to their new host environment or modify it so that they are able to overcome the host

defenses. Involved in this is the recognition of the host, colonization, and exploitation of host

resources. In order to recognize the host, colonize and exploit host resources, bacteria rely on an

arsenal of sensors/regulators.

GacS/GacA is one of the two-component regulatory systems controlling virulence and

motility in y-proteobacteria. Orthologs of this two-component system were identified through

screening of mutants defective in aspects of virulence in Pseudonzona~s spp., Vibrio fischeri, E.

coli, Salmonella enterica, and Legionella pneuntophila (Heeb and Haas 2001, Tomenius et al.

2005, Lapouge et al. 2008). Much of the structural information about the GacS/GacA two-

component regulatory proteins have been elucidated through studies of other regulatory proteins.

UvrY, the ortholog of GacA in E. coli, has been identified as a member of the FixJ-type class of

response regulators (Pernestig et al. 2001, Pernestig et al. 2003). NarL is another FixJ response

regulator that has been used as a surrogate for the structural identification of functional aspects

of the proteins due to the availability of its crystal structure (Baikalov et al. 1996, Maris et al.

2005, Galperin 2006, Hussa et al. 2007).

The GacS/GacA-mediated signal transduction cascade begins when the linker domain of

the N-terminal part of the membrane-associated sensor kinase GacS perceives a yet-unknown

signal (Fig. 4-1). Upon interaction with the signal, a conformational change initiates an

autophosphorylation cascade of the three evolutionary conserved amino acid residues (histidine-









aspartate-histidine) (Pernestig et al. 2001, Zuber et al. 2003, Kay et al. 2005, Dubuis and Haas

2007, Lapouge et al. 2008). This cascade leads to the phosphorylation of GacA' s aspartate

residue (D54) allowing the helix-turn-helix DNA binding domain of GacA to bind to specific

promoters, such as csrB (Romeo 1998, Babitzke and Romeo 2007). The csrB gene encodes for

regulatory RNA (rRNA) and upon transcription folds creating up to 22 repeated 5' leaders of

mRNA (GGA) in and between loops. These repeated regions represent sites that sequester

RNA-binding proteins of the CsrA family (Suzuki et al. 2002, Babitzke and Romeo 2007, Storz

and Haas 2007). csrB is not the only small RNA molecule found to interact with the CsrA

family of RNA-binding proteins. In E. coli and E. carotovora, csrC and rsnzB (respectively) also

act to sequester CsrA and decrease its regulatory effects (Lapouge et al. 2008). In

pseudomonads, three small RNAs (rsnzX, rsnzY, and rsnZ) function together to ensure secondary

metabolism and biocontrol by binding multiple CsrA/RsmA molecules (Kay et al. 2005).

Similar homologs exist in Vibrio cholerae (csrB, csrC, and csrD). These three redundant RNAs

have been shown to regulate quorum sensing behaviors by suppressing the activities of CsrA

(Lenz et al. 2005, Babitzke and Romeo 2007, Storz and Haas 2007).

CsrA is an RNA (both messenger and regulatory RNA) binding protein. CsrA is

inactivated from binding to free-floating mRNA in the cell through its binding of repeated

mRNA sequences of the regulatory RNA, csrB and csrC. The small regulatory RNAs may

sequester approximately 9 CsrA dimers at one time (Babitzke and Romeo 2007). Elucidation of

the structure of CsrA through size-exclusion chromatography indicated that it functions as a

dimer (Heeb et al. 2006). Each monomer has a P-P-P-P-P-a secondary structure. The three

central strands come from one subunit and are hydrogen bonded while the two peripheral strands

are from the other subunit, which are bonded within the chain of the strands from the other









subunit. The dimer is maintained through these interchain hydrogen bonding and hydrophobic

interactions between the P-strands (Heeb et al. 2006). When not inhibited through binding of

csrB and/or csrC or other small RNA, CsrA is free to bind to other mRNAs and either stabilize

them for translation or mark them for degradation (Dubey et al. 2005). CsrA is in equilibrium

between its csrB-bound and free-floating forms (Fig. 4-1). When bound to free-floating

messages in the cell, CsrA can effectively inhibit translation by blocking the binding of the

ribosome through interactions with regions upstream or overlapping the ribosome binding site

(RBS) of the target transcript (Suzuki et al. 2002, Heeb et al. 2006). In E. coli, CsrA binds to

multiple sites near the Shine-Delgarno (SD) sequences of the transcripts of glgC (glycogen

biosynthesis) and cstA (carbon starvation) and prevents correct binding of the ribosome, thus

inhibiting translation (Baker et al. 2002, Dubey et al. 2003).

In all y-proteobacterial pathogens of plants and animals, orthologs of gacS, gacA play a

central role in host colonization and virulence (Heeb and Haas 2001, Lapouge et al. 2008). In S.

plymuthica, gacA regulates N-acyl homoserine lactone (AHL)-mediated quorum sensing,

production of exoprotease and production of chitinase (Ovadis et al. 2004). Chitinases, protease,

and AHL-mediated quorum sensing are typically associated with virulence and host colonization

in other Serratia strains (Rasmussen et al. 2000, Kurz et al. 2003, Queck et al. 2006, Wei and Lai

2006). Because chitinase (N-acetyl-galactosaminadase) is induced on coral mucus (see chapter

3), it is reasonable to expect that gacA, gacS play similarly important roles in coral colonization

and infection by the white pox S. marcescens and mutants in gacA will be unable to colonize the

coral host.









As mentioned above orthologs of the GacS/GacA two-component regulatory system is

present and evolutionarily conserved in many bacterial species Disruption of gacA reduces

virulence in Pseudomona~s aeruginosa (Tan et al. 1999, Parkins et al. 2001, Dubuis and Haas

2007), Serratia spp. (Kurz et al. 2003), E. coli (Pernestig et al. 2003) and gacA also controls the

production of N-acyl homoserine lactone (AHL) signals, pigment, and swarming motility. A

GacA ortholog in Serratia plymuthica, GrrS/GrrA, has been shown to regulate the production of

chitinase, exoprotease, pyrrolnitrin, acyl homoserine lactones (AHLs) and biocontrol activity

(Newton and Fray 2004, Ovadis et al. 2004). In many plant-associated interactions, the

GacS/GacA system controls the production of secondary metabolites, extracellular enzymes

involved in pathogenicity to plants, biocontrol of soil borne plant diseases, ecological fitness, or

tolerance to stress (Heeb and Haas 2001, Lapouge et al. 2008). This is particularly important due

to the fact that opportunistic pathogens often use a similar suit of mechanisms to invade plant

and animal hosts (Rahme et al. 1995, Rahme et al. 2000).

Orthologs of GacA are present in symbiotic as well as pathogenic y-proteobacteria. In

Vibrio fischeri, gacA is necessary for colonization of the squid host (Euprymna scolopes) and

regulates gene expression involving chemotaxis and motility (Whistler and Ruby 2003, Whistler

et al. 2007). Vibrio fischeri is a bioluminescent bacterium that colonizers the light organ of the

squid host. The light produced eliminates the shadow that the host would otherwise cast due to

the moonlight; thus reducing the threat of predation (Whistler and Ruby 2003). This binary

symbiosis between the bioluminescent bacterium and its squid host is an example of an

association leading to accommodation and homeostasis (Whistler et al. 2007). The GacA global

regulator is required for normal host tissue colonization by Vibrio fischeri and a recent study by

SAn ortholog is a gene formed in two or more species, which originated in a common ancestor, but has evolved in a
different way in each species.









Whistler et al. 2007 demonstrated that colonization of squid host tissue by gacA mutants were

highly susceptible to invasion by secondary colonizers (Whistler et al. 2007). That is, mutants in

gacA were unsuccessful in out-competing all other microorganisms colonizing the host. This

suggests that targeting GacA for mutation in Serratia marcescens PDL 100 may lead to

attenuation of disease intensity and prevalence due to the inability of mutants in gacA to

effectively establish on coral mucus.

In this experiment, a gacA homolog was identified in PDL100. The corresponding gene

was PCR-amplified, cloned and its functionality was tested in trans.t~t~rt~t~rt~t~rt~ Based on known orthologs

of gacA in other bacteria and within Serratia marcescens, I hypothesized that gacA is present in

PDL 100 and functional.

4.2 Materials and Methods

The gacA gene was amplified from the S. marcescens genomic DNA using primers CJKl2

and CJKl8 (Table 2-2), which were designed based on the gacA sequence from S. plymutica

(NCBI GenBank: AYO57388). PCR conditions included initial denaturation at 95oC for 7

minutes, 35 cycles (95oC, 1 minute, 53oC, 1 minute, 72oC, 2.5 min) and a final extension at 72oC

for 10 minutes. The resulting 957 bp product was cloned into pCR2.1 using a TOPO TA kit

(Invitrogen, Carlsbad, CA), transformed into chemically competent DH~a and sequenced

(Agencourt Bioscience Corp., Beverly, MA) using primer M13F. A nucleotide BLAST in the

NCBI database confirmed that the amplified sequence matched that of S plymuthica. The amino

acid sequence for the predicted polypeptide was generated in MacVector 8.0 (Accelrys, San

Diego, CA). Both the gene sequence and the hypothetical amino acid sequence were compared

to those of known GacA orthologs in other bacteria.

To test whether gacA of S. marcescens PDL100 is functional, its ability to complement a

gacA (uvr Y) mutation in E.coli uvr Y33::k ankkkk~~~~~~kkkkk was tested. Therefore, a construct was engineered to










complement a mutant in the uvrY gene of E. coli. To engineer a complementation construct the

gacA gene from pl318 was cloned into pBAD18-Ap. Plasmid pl318 was digested with EcoRI

and the resulting fragments were sub-cloned into the EcoRI site immediately downstream from

the arabinose-inducible promoter on pBAD18-Ap, which yielded pCJK3, which was then

transformed into chemically competent E. coli DH~a. Transformants were selected on LB agar

supplemented with Ap 200 Clg/ml. Orientation of the insert was confirmed by PCR using

primers MT13 and CJKl8 (Table 2-2, Fig. 2-1).

To test the functionality of gacA in Serratia marcescens PDL100, an arabinose induced

promoter-based complementation assay was performed. There are a wide variety of expression

vectors that have been constructed in E. coli (de Boer et al. 1983, Brosius et al. 1985, Diederich

et al. 1994). These strong inducible promoters are most often induced with a change in

temperature and some are repressed better than others (Guzman et al. 1995). Some expression

vectors produce high levels of the corresponding gene product and can even out-express the

wild-type in addition to producing substantial levels of synthesis in uninduced or repressed

conditions. In these situations, comparison to wild-type expression is difficult and evaluation of

the result of a mutant or complementation is nearly impossible. The PBAD vector utilized in this

study satisfies two maj or conditions: the synthesis of the proteins can be shut off relatively

rapidly and efficiently without changes in temperature (which can have deleterious effects on the

host cell in terms of growth and plasmid maintenance). Also, expression before depletion of the

inducer (arabinose) does not produce exceedingly high levels of protein, which in itself may give

a phenotype or influence the phenotype of the depletion (Guzman et al. 1995).

The PBAD prOmoter is regulated by the araC regulatory gene product. The AraC protein

is both a positive and negative regulator. In the presence of arabinose, transcription from the










PBAD prOmoter is initiated and in the absence of arabinose, transcription occurs at very low

levels. The un-induced levels of transcription can be further decreased through the addition of

glucose to the growth media. Glucose is a known catabolite repressor and effectively reduces the

available 3', 5'-cyclic AMP. This limits the interaction between cyclic AMP and the CAP

protein involved in the enhancement of transcription (Miyada et al. 1984).

The complementation vector pCJK3 was transformed into E. coli RGl33 pMT41 by

electroporation (25 CIF, 200 02, 2.5 kV, 0.2 cm cuvette, 50 CIL cell volume) using a Bio-Rad

MicroPulser (Bio-Rad Laboratories, Hercules, CA). As vector controls, the original pBAD18-

Ap vector was transformed into both the wild-type reporter E. coli 1655 pMT41 or its isogenic

uvrY33::k ankkkk~~~~~~kkkkk derivative reporter E. coli RGl33 pMT41. Two overnight cultures of each strain

were grown in LB with appropriate antibiotics at 37oC on a rotary shaker (180 rpm). Following

overnight incubation, cultures were diluted 1/100 in LB and incubated at 37oC for 3 hours on a

rotary shaker (180 rpm). Cultures were diluted to an OD600 Of 0.3, and then diluted 1/25000 and

aliquoted into a black polystyrene 96-well plate (in quadruplicate). Luminescence was measured

with Victor-3 (Perkin Elmer, Shelton, CT) every hour for ten hours and the expression of the

complemented mutant was compared to the wild-type reporter strain.

4.3 Results

4.3.1 Molecular Characterization of gacA in Serratia marcescens PDL100

As a first step in the characterization of the gacA gene in Serratia marcescens PDL 100,

the full gene was PCR amplified using primers designed based on the published sequence of

gacA in Serratia plymuthica (NCBI GenBank: AYO57388). The resulting gene was cloned,

sequenced, translated in silico, and compared to other known gacA orthologs at the amino acid

level (Fig. 4-2). The Clustal-W alignment of the predicted GacA protein from S. marcescens

PDL100 to other characterized GacA orthologs indicates that all GacA orthologs share the










predicted phosphorylation site at position 54. Known residues that interact with the

phosphorylation site (D54), D8-9, P58, 160, T82, E86, S103 and A107, are also conserved

among all orthologs (Fig. 4-2). The central helices a8-a9 are predicted to form a helix-turn-helix

motif of the DNA binding domain of GacA (Maris et al. 2005). These regions appear to be

conserved in the orthologs compared.

The similarity of GacA orthologs were also compared at the DNA sequence level. A

phylogenetic tree based solely on sequence maximum identity was generated using the TreeCon

software. Boot-strap analysis was implemented to determine the relative similarity between

sequences. The analysis indicated that sequence similarity is high even at the DNA level

between orthologs of GacA (Fig. 4-3). None of the species examined demonstrated sequence

differences greater than 10% based on the boot-strap analysis. The analysis did confirm that the

Gram-negative bacterium, Legionella pneumophila is distantly related to E. coli and other enteric

bacteria, in regards to the gacA gene.

Due to the high similarity between gacA of Serratia marcescens PDL 100 at the DNA and

amino acid levels to other characterized orthologs of GacA, the gene sequence was submitted to

NCBI GenBank under the Accession number EU595544.

4.3.2 Functionality of gacA Through Complementation Assay

The complementation construct consisting of an arabinose-inducible gacA gene was

compared in its ability to complement a chromosomal uvrY33 mutant in E. coli to wild-type with

a csrB::1uxCDABE fusion reporter system (pMT41).

Results of the complementation assay through expression of gacA under (1) arabinose

induction, (2) glucose repression, and (3) no-inducer induction are presented in figures 4-4

through 4-6. In each treatment, no statistically significant difference in the level of expression

between the wild type (MGl655) and the wild-type with the pBAD18-Ap vector control was









observed. Under arabinose induction (0.2% arabinose supplemented media) of the PBAD

promoter, expression of gacA in the complemented mutant was statistically significantly higher

than the uvrY mutant alone (RGl33), and the mutant strain with the pBAD 18-Ap vector control

(Fig. 4-4). A comparison of the expression as function of luminescence at three hours under the

arabinose induction treatment indicates that although the expression of the gacA complemented

mutant was lower than the wild-type, the level of expression of the complemented mutant was

statistically significantly higher than the non-complemented mutants (Fig. 4-4B).

The addition of glucose to the media was conducted to effectively shut down expression

from the PBAD prOmoter through the reduction of cyclic-AMP, which is required for

transcription. Under glucose repression (0.2% glucose supplemented media), expression of gacA

in the complemented mutant was not statistically significantly different from the uvrY mutant

alone and the mutant carrying pBAD18-Ap (Fig. 4-5A&B). Expression in each of the mutant

strains, measured as luminescence production by the reporter, remained significantly lower than

the wild-type throughout the time course.

The no-inducer induction treatment tested the leakinesss" of the PBAD expression system.

If expression of gacA occurred without arabinose induction, the results of the induction treatment

would be inaccurate in demonstrating the ability of gacA to complement the uvrY mutation. The

no-inducer effectively demonstrates the background level of expression at the PBAD prOmoter.

Similar to the glucose repression treatment, the no inducer treatment did not result in significant

expression of gacA in the complemented mutant as compared to the mutant controls. The level

of expression was consistently lower than the wild-type (Fig. 4-6).

4.4 Discussion

The GacS/GacA two-component regulatory system has been shown to control behaviors

from motility to virulence in many species of bacteria. In Serratia spp., gacA regulates N-acyl









homoserine lactone (AHL)-mediated quorum sensing, production of exoprotease and production

of chitinase (Ovadis et al. 2004). Production of chitinase enzymes was found to be a significant

component in the growth on coral mucus (see Chapter 3). Based on this observation and the

similarity of Serratia marcescens PDL 100 to other pathogenic strains of S. marcescens, the

hypothesis that gacA was not only present in this isolate of S. marcescens but was also

functionally tested. The PCR amplified product was cloned and sequenced and subjected to

BLAST yielding a 98% match to the grrA (gacA) gene from S. plymuthica. The predicted amino

acid sequence of GacA from S. marcescens PDL 100 was compared to other characterized GacA

orthologs from E. coli, P. aeruginosa, P. fluorescens, Salmonella enterica, Vibrio cholerae, y.

fischeri, S. plymuthica, and Legionella pneumophila (Fig. 4-2 & 4-3).

From the comparison of GacA orthologs at the protein level, it is clear that specific

regions and domains are well conserved. These conserved regions provide the essential

structural features of the GacS/GacA two-component system (Heeb and Haas 2001).

Comparison of gacA genes at the DNA level between enteric bacteria and pseudomonads also

indicate a high similarity between the orthologs in each organism. Boot-strap analysis

demonstrates that over a 90% similarity was found between all Gram-negative species analyzed.

Legionella pneumophila represented an out-group with the greatest dissimilarity and was most

distantly related to the other species. This supports the observation that the gacA ortholog of

Legionella was unable to complement a similar mutation in the uvrY gene in E. coli (Hammer et

al. 2002), while a similar complementation experiment demonstrated that the gacA from

Enterobacter successfully complemented a uvrY mutant (Saleh and Glick 2001).

GacS belongs to a class of histidine sensor kinases that carry a phosphoryl transmitter, a

receiver, and a histidine phosphotransfer output domain (Perraud et al. 2000, Zuber et al. 2003).









This is similar to the structures of the sensor kinases ArcB found in E. coli (Kwon et al. 2000)

and BvgS in Bordetella pertussis (Perraud et al. 2000). The N-terminal part of GacS is the

sensing domain and consists of two potential transmembrane segments separated by a

periplasmic loop. This loop is a common feature of many two-component systems involving

histidine kinases (Dutta et al. 1999, Neiditch et al. 2006). A linker domain is adjacent to the

second transmembrane domain. The linker domain contains two amphipathic sequences, which

are proposed to interact with each other in response to environmental signals. This interaction

activates the protein, causes a conformation change at the C-terminal region, which favors

autophosphorylation (Robinson et al. 2000). A primary transmitter domain with a conserved

autophosphorylatable histidine residue is important for dimerization of sensor kinases due to

alternating a-helices and P-sheets that occur in this region (Dutta et al. 1999). Sensor kinases

may function as a dimer; therefore, conservation of the primary transmitter is crucial to correct

functionality of the protein.

For GacS to function as a dimer, the substrate domain for autophosphorylation itself may

function as the dimerization domain, forming a four-helix core. Both of the catalytic CA

domains within the dimer flank this central core such that the ATP-binding pocket faces the

histidine-presenting a helix of the twin subunit (Dutta et al. 1999, Robinson et al. 2000). A

recent study measured the activity of the histidine kinase, LuxQ in Vibrio harveyi and found that

the protein functions in vivo as a dimer. LuxQ is a sensor kinase involved in quorum sensing in

Vibrio harveyi and is associated with the periplasmic binding protein, LuxP. When bound to an

environmental signal (or in this case Autoinducer-2), LuxP undergoes a conformational change

that stabilizes a quaternary structure in which two LuxPQ monomers are asymmetrically

associated. The sensor kinase, LuxQ only functions as a dimer as demonstrated by the decreased









activity of wild-type LuxQ with the coexpression of a truncated LuxQ protein (Neiditch et al.

2006).

After autophosphorylation following stimulation by an environmental signal, a phosphate

group is transferred to an aspartate residue followed by another histidine residue. This histidine

phosphotransfer (Hpt) output domain serves a secondary transmitter and transfers a phosphate

group to a conserved aspartate residue on the response regulator, GacA (Tomenius et al. 2005).

The phosphorylated GacA protein contains a helix-turn-helix DNA binding domain motif that

directly binds the promoter of small RNAs, including csrB, which encodes a global regulator

RNA (Kay et al. 2005, Babitzke and Romeo 2007). The activated GacA response regulator is

suspected to bind to a conserved upstream element termed the GacA box (consensus

TGTAAGN6 CTTACA, where N is any nucleotide) in the promoter regions of the sRNA genes

(csrB, csrC, rsnzB, rsnzX, rsnzY, rsnZ) (Lenz et al. 2005, Lapouge et al. 2008).

Essential structural features that are conserved in GacA include the active site in the N-

terminal receiver domain (residues 1-148). Within this active site lies the phosphorylatable

aspartate residue and its conserved contacts Asp-8 and Asp-9, Thr (Ser)-82, and Lys-104. The

helix-turn-helix motif of the DNA binding domain (residues 149 to end) occurs in the C-terminal

region (Heeb and Haas 2001, Maris et al. 2005). Much of the information regarding the roles of

the specific conserved regions of the response regulator, GacA, has been elucidated through

investigations of response regulator, NarL, in E. coli (Baikalov et al. 1996, Galperin 2006).

Mutations in the predicted phosphorylation site has demonstrated two distinct phenotypes. One

mutation led to a constitutive ON phenotype by mimicking the phosphorylated state of GacA,

independent of the sensor kinase (Baikalov et al. 1996, Smith et al. 2004). In most cases,

mutation of the phosphorylation site leads to an inability to accept the phosphate group (Smith et









al. 2004, Tomenius et al. 2005). Similarly, insertions or deletions of the response regulatory

genes in Vibrio fischeri resulted in null phenotypes with the regulatory proteins unable to accept

the phosphate group from the respective sensor kinase and transcription of downstream genes is

repressed (Hussa et al. 2007). This suggests that transcription of regulatory RNA genes is

dependent on the phosphorylation of GacA and will not occur without proper activation of the

protein. Mutations in the amino acid residues that are proposed to interact with the

phosphorylation site have also resulted in altered functional proteins, the maj ority leading to a

constitutively activated response regulator protein (Smith et al. 2004).

Mutations in GacS and GacA have resulted in differences in the levels of transcription of

downstream regulatory genes. While GacA is usually dependent on GacS for phosphorylation

and therefore, full functionality, recent work has demonstrated that GacA may still function

(albeit at a lower level compared to wild type) and lead to transcription of regulatory RNA genes

even if GacS is mutated. In E. coli, a mutation in BarA resulted in 40% of downstream

transcription as compared to wild-type, while a mutation in UvrY failed to produce any

downstream activation (Tomenius et al. 2005). The same observation was found in Salmonella

enterica sv. Typhimurium. Mutations in the response regulator sirA yielded less downstream

activation as compared to mutation in the sensor kinase barA (Altier et al. 2000, Lawhon et al.

2002). Similarly, in Vibrio cholerae, a mutation in the sensor kinase VarS resulted in decreased

but detectable transcription of regulatory RNA genes, while a mutation in VarA, the response

regulator resulted in a completely null phenotype (Lenz et al. 2005). These observations suggest

that GacA may have function independent of GacS and may receive a phosphate group from

elsewhere in the cell. In Pseudomona~s aeruginosa there are two sensors, RetS and LadS, in

addition to GasS that may determine the activity of GacA (Dubuis et al. 2007). RetS is thought










to act as a GacA antagonist by removing a phosphate group from the already phosphorylated

GacA, while LadS appears to activate GacA using the same type of C-terminal histidine kinase

and response regulator receiver domains as GacS (Ventre et al. 2006, Dubuis et al. 2007). It

appears that the LadS/RetS pathways function in parallel and also regulate the same small RNAs

as GacS/GacA. This overlap in function may allow for the activation/inhibition of GacA. The

demonstration that GacA remains somewhat functional after GacS mutation provides insight as

to why specific targeting of GacA for mutagenesis instead of GacS may lead to a more effective

disruption of the downstream virulence and regulatory factors controlled by the two-component

sy stem.

Activities and mechanisms within a functional domain (e.g. aspartate phosphorylation site)

are largely conserved, as are the structures themselves. The ways in which the domains interact

in terms of regulatory consequences may differ among response regulators (Gao et al. 2007b).

The genes encoding for the sensor kinase and response regulator pair of proteins are often next to

each other on the chromosome. This, however, is not the case with gacS and gacA. In many

organisms, gacA lies directly upstream of an ortholog of the E. coli uvrC gene, which is involved

in nucleotide excision repair. Despite the close proximity of gacA and uvrC, no evidence

supports that GacA contributes to UV repair (Heeb and Haas 2001).

The results of the complementation assay not only demonstrate that gacA from Serratia

marcescens PDL100 is structurally similar to uvr Y from E. coli and is able to functionally

complement the mutation, but supports the features of the PBAD expression system that are

favorable for physiological studies. The PBAD vector utilized in this study satisfies two major

conditions: the synthesis of the proteins are able to be shut off rapidly and efficiently without

changes in temperature (which can have deleterious effects to the host cell in terms of growth









and maintenance). In addition, expression before depletion does not produce exceedingly high

levels of protein, which in itself may give a phenotype or influence the phenotype of the

depletion (Guzman et al. 1995).

Based on the alignment of the GacA protein from Serratia marcescens PDL 100 with

other orthologs, comparison of gacA orthologs at the DNA level and the complementation assay,

it is reasonable to conclude that the gacA gene is not only present but functional in this white pox

pathogen. Therefore, mutations disrupting gacA will presumably attenuate the ability of the

pathogen to colonize and grow on coral mucus. The observation that GacA may remain

functional even if GasS is mutated also provides rationale for the specific targeting of GacA for

mutagenesis as opposed to other components of the regulatory system.











Activation by signal & Autophosphorylation


Figure 4-1. Model of regulatory pathways leading from GacS/GacA to downstream genes. Thick
arrows indicate direct interactions and thin arrows indicate interactions that may be
either direct or indirect. Blunt end lines (T) represent inhibitory or negative effects.
Of the behaviors/activities regulated (either directly or indirectly) by CsrA, CsrA
represses those in blue and those in red are regulated.






























G G L A I V AP V V I L I P L PA VM A GAG L GAP V I AL V A
GG1L A IV AP V V IML 1 L L PA VM AGA G L GiAA V I V A
GG6L A Ila A V IIM L V PILPIA VM AGAAG L GIAA VY AI V
GG1L A IA A T V I L V P LPIA VMr A GA G L GAAP VY AI V
GGL A IL P V VIVL 1 PP V1 AGAAG L GiAG MY a MV
GG6L A LIL VPI IIV L V PP VM AIGAG L GAAP MY AI IIV
G G L A L L P T V VAV VC P P LLI A GAG L GAG L MVY A L V


130 140 150 160 170 180





1 ~ 9 200 Ib I 10I LI


B. marcesceris PDL100 GacA
S, plymulha GacA
E, coll uvr
B. entenca SirA
V, liuben GacA
V, Stolerae VarAi
P. 11uorescerts GalcA




S, maros~8ecrs PDL100 GacA
S plymulhlca GacA
E, coll VvrY
S, enienca SirA
V IlshedlGacA
V, cholerae YarA
P.l r~escerns GEa
conlsensus


S maronsati PDL10D GaeA.
B. plymunlhca~acAl
E, coll UurY
9 oniedeaSirA
V. lishen GacA
V. GOlerae~ VarA
P iuraesorGacAI
consensus


B. marcesceris PDL100 GacA
S. plymunlhlo GacA
E call LUrY
S, enterica SirA
V. lishen QOaA
V cholera VarA
P fiuorescerts GacA
consensurs


100 110


80* 90


Figure 4-2. Clustal-W alignment of the deduced GacA protein from the white pox pathogen, S.

marcescens PDL100 (top row) and other characterized GacA orthologs. All GacA

orthologs share the predicted phosphorylation site (D54, blue arrow), residues that

interact with the phosphorylation site (D8-9, P58, G59, 160, T82, E86, S103, A107,

blue asterisks) and Il70-L175 region (green asterisks) that anchors the a8-a9 of the

helix-turn-helix DNA binding domain (Teplitski and Ahmer 2005, Tomenius et al.

2005).


I ,,,










S. ast-esces PDIL100


I ~P. floorerusen~s
100
I P. aerwginosa

I i~L. pneumPolphilar



Figure 4-3. Phylogenetic tree comparison based on the gacA DNA sequence in common bacteria. Orthologs of gacA were obtained
through a BLAST search of the NCBI GenBank database. DNA sequences were compared using TreeCon software with
Boot-strap analysis to indicate the relative similarity between sequences. The Gram-positive bacteria, Legionella
pneumophila served as an out-group to form the rooted-tree comparison.















































































uvrY::kan PARA-
gacASm csrB-
luxCDABE


I


10000000-
csrrB-luxCDABE
PPARA csrB-luxCDABE
1000000 -1 uvrY kancsrB-luxCDABE
uvrY kan PARA csrB-luxCDABE
1000 vrY kan PARA-gacASm csrB-luxCDABE


10000


1000


100


10


0 1 2 3 4 5 6 7 8 9 10


Time (hours)


1800


S1400


1200

100

80

60




S400


200


csrB-luxCDABE


PARA csrB-
luxCDABE


uvrY::kan csrB- uvrY::kan PARA
luxCDABE csrB-luxCDABE


Reporter

Figure 4-4. Complementation of uvrY mutant in E. coli by gacA with Arabinose induction of

pCJK3 compared to wild-type luminescence production (A) and average induction at
3 hr (B)















































































csrB-luxCDABE PARA csrB-
luxCDABE


I I


10000000-
-*csrB-luxCDABE
~PARA csrB-luxCDABE
1000000 -1 uvrY kan csrB-luxCDABE
uvrY kan PARA csrB-luxCDABE
~uvrY kan PARA-gacASm csrB-luxCDABE
100000-


10000-


1000-


100-


10 -n~


1 2 3 4 5 6 7 8 9 10


Time (Hours)


S1400


1200

100



60

40

2 00

0


uvrY::kan csrB- uvrY::kan PARA
luxCDABE csrB-luxCDABE


uvrY::kan PARA-
gacASm csrB-
luxCDABE


Reporter

Figure 4-5. Complementation of uvrY mutant in E. coli by gacA with glucose repression of

pCJK3 compared to wild-type luminescence production (A) and average induction at
3 hr (B)














































































I I


10000000-
cs-lu-csBlxDABE
-PARA csrB-luxCDABE
1000000 -1 uvrY kancsrB-luxCDABE
uvrY kan PARA csrB-luxCDABE

1000- -muvrY kan PARA-gacASm csrB-luxCDABE


10000


1000


100


10


1 2 3 4 5 6 7 8 9 10


Time (hours)


S1400


1200

100



6 000


20


0


csrB-luxCDABE


PARA csrB-
luxCDABE


uvrY::kan csrB- uvrY::kan PARA
luxCDABE csrB-luxCDABE


uvrY::kan PARA-
gacASm csrB-
luxCDABE


Reporter


Figure 4-6. Complemtation of uvrY mutant in E. coli by gacA with no sugar induction of pCJK3

compared to wild-type luminescence production (A) and average induction at 3 hr (B)









CHAPTER 5
BACTERIAL QUORUM SENSING SIGNALS AND SETTLEMENT OF CORAL LARVAE

5.1 Introduction

Coral exhibit a range of reproductive strategies, including both sexual and asexual

propagation. Some species of coral brood well-developed larvae after internal fertilization

throughout the year. Most corals, however, reproduce during annual mass spawning events

when gametes are synchronously released into the water column and undergo fertilization

outside of the coral polyp (Harrison and Wallace 1990, Ball et al. 2002). Larvae of broadcast

spawning scleractinian corals typically become competent to metamorphose into juvenile polyps

approximately one week after the spawning and fertilization event (Babcock and Heyward 1986,

Negri et al. 2001). Metamorphosis of coral larvae, and other Cnidarians, is naturally triggered by

the perception of external cues, both from the abiotic environment and from other organisms on

the reef (Morse et al. 1996, Webster et al. 2004, Kitamura et al. 2007).

Settlement, metamorphosis and recruitment of coral larvae are often used interchangeably,

however, each refers to different stages in the development of corals. Settlement describes the

physical process, during which larvae become pear-shaped, leave the water column, and casually

attach to the substrate at the aboral end. This process is reversible, in that coral larvae "test"

available substrates and can potentially leave unsuitable substrata and return to the water column.

Larval metamorphosis is a physiological response, during which morphological, physiological

and metabolic changes occur that are nearly always non-reversible (Negri et al. 2001, Golbuu

and Richmond 2007). Metamorphosis of acroporid corals often occurs within 12 hours of

settlement when the larvae have flattened dorsally and developed obvious septal mesenteries

radiating out from the central mouth region (Harrison and Wallace 1990, Heyward and Negri

1999). Recruitment is the combination of these two events and the continued survival of the









metamorphosed larvae into a juvenile polyp and to adulthood (Koehl and Hadfield 2004). Both

settlement and post-settlement events influence the recruitment rates of corals. Temporal and

spatial patterns combined with the innate perception of different substrata also play important

roles in the rate and efficiency of larvae recruitment.

The selectivity of coral larvae depends on both the type of larvae and the specificity for

certain environmental cues. Brooding coral species tend to be more non-selective when

determining where to settle. Often, coral larvae are selective to substrates of dead coral with the

same morphologies (i.e. branching larvae settle on dead branching corals) independent of

location and substrate availability (Norstroim et al. 2007). Coral larvae may also specifically

settle on algal species, rocks, shells and sand (Morse et al. 1988, Huggett et al. 2006). There,

however, are clear exceptions demonstrating that these species can be highly selective, such as

the brooding coral, Stylaraea punctat (Golbuu and Richmond 2007). Chemosensory cues that

induce members of the Agariciidae and Faviidae families function independent of the type of

reproduction (Morse et al. 1996), as do those of the genus Acropora (Baird and Morse 2004).

Often times, larval selectivity is related to coral habitat distribution and can be determined to

some degree by surveying adult corals (Abelson et al. 2005, Golbuu and Richmond 2007,

Norstroim et al. 2007). Two models have been used to compare coral recruitment based on larvae

selectivity (Morse et al. 1988). The "lottery" model is used to describe those non-specific corals

which settle when space becomes available, while the deterministicc" model describes selective

corals in which larvae selectivity for appropriate sub strata is important in determining spatial

patterns in recruitment (Morse et al. 1988, Golbuu and Richmond 2007).

Corals that fit the "lottery" model of recruitment may exhibit general life history strategies

relating to their success. Stlyphora pistilla~ta and other pocilloporid corals are important early









successional species in coral communities throughout the world. The dominance of these types

of species in newly available substrates is attributed to early reproduction, high fecundity, a long

breeding season and a fast growth rate. In addition, these corals demonstrate a lack of a strict

requirement for surface contact with specific chemical cues, such as crustose coralline algae

(CCA) (Baird and Morse 2004). S. pistillata is able to colonize substrata as soon as they become

available, which allows it to pre-empt some species that may be superior competitors as adults

(Baird and Morse 2004).

Many corals, including acroporid corals, do require either direct contact or perception of a

chemosensory cue in order to induce metamorphosis. Crustose coralline algae (CCA) have been

linked to the induction of metamorphosis in many coral species, including members of the genus

Acropora (Morse et al. 1994, Morse et al. 1996, Heyward and Negri 1999, Negri et al. 2001)

(Golbuu and Richmond 2007). It is thought that the coralline algae produce cell-wall-bound

polysaccharides that are recognized by chemoreceptors on the planula (Morse et al. 1996,

Kitamura et al. 2007). Biochemical purification of the compound from Pacific and Caribbean

congeners of CCA identified it as a member of a unique class of sulfated glycosaminoglycan that

is associated with the cell walls of numerous CCA species. Bacteria associated with the surface

of algal thallus may also be responsible for the polysaccharides perceived by the larvae (Negri et

al. 2001). Mixed and monospecific biofilms of the 50 bacteria isolated from Lithophyllum sp.

induced settlement and metamorphosis of Acropora and Porites spp. Both hydrophilic extracts

and fragments of CCA are able to induce metamorphosis (Golbuu and Richmond 2007, Kitamura

et al. 2007). Besides a chemosensory inducer of coral metamorphosis, CCA may also serve as

indicators of environmental conditions to the coral larvae. CCA dominate reef front areas and

their presence may indicate favorable conditions for growth and development (Golbuu and









Richmond 2007). While CCA has clearly demonstrated its influence in the settlement and

metamorphosis of coral larvae, it is not the only chemosensory cue that coral larvae respond to.

Coral larvae induce settlement in response to both biotic and abiotic cues from the

environment. Dead coral rubble and fragments have been shown to induce metamorphosis of the

coral Acropora millepora (Heyward and Negri 1999) and in both branching and massive

morphology of different coral species (Norstroim et al. 2007). Biofilms, bacteria isolated from

CCA and other substrata have also been reported to induce larval metamorphosis (Morse et al.

1988, Negri et al. 2001, Webster et al. 2004). Chemosensory cues produced by active biofilms

(e.g. extracellular polysaccharides and water soluble, stable molecules) are critical for the

settlement and attachment of larvae of the polychaete, Hydroides elegan2s and the bryozoan,

Bugula neritina (Dobretsov et al. 2007, Huang et al. 2007) and the acroporid coral Acropora

microphthalma (Webster et al. 2004).

Bacteria regulate their growth and population densities through the regulatory mechanism

named quorum sensing (QS) that consists of excreted chemical signals that either activate or de-

activate target bacterial genes involved in cell division and adhesion, thus controlling the

formation ofbiofilms (Waters and Bassler 2005, West et al. 2007). Gram-negative bacteria use

signaling molecules, N-acetyl homoserine lactones (AHLs), of different lengths for intercellular

communication (Miller and Bassler 2001). There are also chemical signals used to communicate

between bacterial populations and their eukaryotic hosts. Both riboflavin (vitamin B-12) and its

chemical derivative lumichrome have been associated with inter-kingdom signaling, and

lumichrome acts to induce settlement and metamorphosis in some marine larvae (Phillips et al.

1999, Tsukamoto 1999, Tsukamoto et al. 1999). The majority of bacteria that exhibit quorum

sensing (inclusive of Alpha-, Beta-, and Gammaproteobacteria) are typically dominant in










tropical waters (Webster et al. 2004, Wagner-Dobler et al. 2005, Huang et al. 2007). The

activities within a biofilm (whether comprised of one species or a heterogeneous population of

bacteria) are critical to induction of larval metamorphosis. A recent study treated biofilms with a

protein synthesis inhibitor at two time points. Early treatment greatly disrupted and reduced

settlement while late treatment did not influence settlement rates. This suggests that the proteins

synthesized and/or regulatory proteins involved in formation of the biofilm are important to

induction of larval settlement (Huang et al. 2007).

Just as chemical cues from the environment stimulate and enhance coral larvae settlement,

chemical signals present in the environment serve to inhibit coral metamorphosis and

recruitment. The red algae, Delisea pulchra produces furanones, which directly interfere with

QS signals mediated by AHL production (Rasmussen et al. 2000). This interference disrupts

biofilm formation and ultimately leads to decreased larval settlement observed in Hydroides

elegan2s and Bugula neritina (Dobretsov et al. 2007). Furanones are also produced by marine

bacteria, green, red and brown algae, sponges, fungi, and ascidians (Kjelleberg et al. 1997).

Triclosan (TRI) is a chlorinated aromatic compound also found in marine systems that directly

disrupts bacterial biofilms and thus decreases settlement of some pelagic larvae (Zhang and

Dong 2004, Dobretsov et al. 2007). These compounds function as anti-fouling agents against

bacteria, fungi, and other marine invertebrates.

Algae are in direct competition for space on coral reefs and any form of degradation or

disturbance of coral reefs generally results in an increased dominance by benthic algae (Birrell et

al. 2005). Algal production of anti-fouling chemicals leads to a diminished rate of coral larval

recruitment that is enhanced by anthropogenic inputs to the system in the form of terrestrial run-

off and sedimentation (Abelson et al. 2005, Birrell et al. 2005). Increased turf algae,










cyanobacteria and sedimentation greatly decreased the success of coral larvae metamorphosis

and also led to decreased survival of juvenile recruits (Birrell et al. 2005, Kuffner et al. 2006).

Many species of coral are dominant as adults but are inferior to algae as larvae or recruits. This

is predominately due to their slow growth rates as compared to algae (Kuffner et al. 2006).

Dictyota spp. are now the dominant algae in the Caribbean and reefs show upwards of 50%

Dictyota cover in the Florida Keys. Direct and indirect contact between the algae and coral

recruits resulted in increased mortality as compared to algal mimics (plastic aquarium plants),

suggesting that something more than just shading and abrasion on the part of the algae

influenced settlement and survivability of coral larvae (Kuffner et al. 2006).

In this study, the role of two signaling cues of bacterial origin in the induction of

settlement and metamorphosis of Acropora palmata and M\~onta;strea faveolata larvae was

investigated. I hypothesized that known signals commonly associated with microbial biofilms

and intercellular communication may function as settlement cues for these species of

scleractinian corals, which are the primary reef building corals found in the Florida Keys

National Marine Sanctuary. These signaling cues were chosen based on their involvement in the

induction of settlement and metamorphosis of other marine invertebrates, in addition to coral

larvae.

5.2 Materials and Methods

5.2.1 Extraction of AHLs from Coral-Associated Bacteria

Transgenic microbial biofilms were constructed using bacteria isolated from A. palmata.

Two isolates ofAgrobacterium tumefaciens and one isolate of Vibrio harveyi were selected due

to their production of typical AHL-like compounds as identified by thin layer chromatography

(TLC). Overnight cultures were grown on GASW broth and extracted with equal volumes ethyl

acetate. The organic phase was dried and resuspended in 10 Cl1 methanol. Extracts were spotted









on a TLC plate (Whatman KC18 Silica Gel 60 with fluorescent indicator, 10 x 10 cm, 200 Clm

thick) as well as standard AHLs as controls. The plate was developed with a mobile phase of

methanol:water (3:2) for approximately 30 minutes. The presence of AHLs was detected by an

Agrobacterium tumefaciens reporter strain carrying the plasmid pZLR4, which contains the

traCDG operon with its promoter region (Table 2-1). traG is transcriptionally fused to lacZ

(Cha et al. 1998). The reporter construct is stimulated during interaction with AHLs. The

reaction requires 60 Clg/ml of the substrate 5-bromo-4-chloro-3-indolyl P-galactopyranoside (X-

gal) and results in blue color production. 2 ml of overnight culture of the reporter was

subcultured into 50 ml ABM medium (per liter: 3.0 g K2HPO4, 1.0 g NaH2PO4, 1.0 g NH4C1, 0.3

g MgSO4 7H20, 0.15 g KC1, 0.01 g CaCl2, 2.5 mg FeSO4 7H20, 5% mannitol) and incubated

at 30oC for five hours (Hwang et al. 1994, Shaw et al. 1997). The reporter strain was then mixed

with 100 ml of cooled ABM agar supplemented with Gm 30, 60 Cpg/ml X-gal. The agar mixture

was slowly poured over the tiles to cover them, allowed to solidify and incubated at 30oC

overnight. After overnight growth of the reporter strain, blue color development over the test

lanes were compared to the AHL control lane.

5.2.2 Biofilm Formation

Transgenic biofilms to account for consequences of loss of AHL function were

constructed by mating the plasmid pE7-R3 into each other three coral isolated bacteria (Table 2-

1). This plasmid is an IncP broad range host cosmid vector (pLAFR3) carrying the aiiA gene

from Bacillus sp. 240B 1 which encodes for an enzyme that cleaves the lactone ring of AHLs,

rendering them functionless (Dong et al. 2000). The resulting biofilms served as the

"transgenic" biofilms. As a vector control, pLAFR3 vector alone was mated into each bacterial

isolate (Staskawicz et al. 1987). The resulting biofilms served as the "wild-type" biofilms for the

following settlement experiments.









Settlement induction experiments were set-up in plastic containers (approximately 300

ml) to measure the consequences of AHL hydrolysis in coral larval settlement. Tiles (porous

ceramic, 1 x 1 inch with 0.5 cm x 0.5 cm grid pattern) were bathed in either sterile GASW

supplemented with 5% CFA media inoculated with the wild-type (vector control) bacteria or

sterile GASW supplemented with 5% CFA inoculated with the transgenic (AHL-lactonase)

bacteria and biofilms were allowed to form on the tiles. As a control, tiles were also bathed in

sterile GASW supplemented with 5% CFA. 150 ml of filter sterilized seawater was added to

each plastic container. Before tiles were added to the container, they were washed twice with

filter sterilized seawater to remove any residual media. Settlement induced in each treatment

(tiles + wild-type, tiles + transgenic, and tiles + media alone) was measured with and without the

addition of crustose coralline algae (CCA), giving a total of eight treatments. Each treatment

was performed in triplicate. CCA was collected from a rubble zone on the west side of the Bahia

Honda Bridge and washed with running filter sterilized sea water at least 5 times or until water

ran clear. Acropora palmata gametes were collected during a mass spawning event at Looe Key

Reef, FL in August 2006. Gametes from different colonies were crossed-fertilized and larvae

were maintained in flowing seawater for eight days until they reached competency. Fertilization

took place at the Mote Marine Laboratory Tropical Research Laboratory in Summerland Key,

FL. Twenty competent A. palmate larvae were added to each container, the lids were caped and

containers were placed in a randomized pattern (to ensure blind sampling) in running seawater

raceway table to maintain temperature. Larval counts and water changes were performed daily

for a total of three days.

The effect of the presence of AHL and crustose coralline algae (CCA) on the induction of

acroporid coral larval settlement was also tested. Settlement experiments were set-up in plastic









containers as above. Sterile tiles were added to either 150 ml filter sterilized seawater or 150 ml

filter sterilized seawater supplemented with 100 nM 3-oxo-C6-Homoserine Lactone (3-o-C6-

HSL). A fragment of CCA was added to each treatment and negative controls without the

addition of CCA were included. Each treatment was performed in triplicate. Twenty competent

A. palmate larvae were added to each container, lids were capped and containers were placed in

a randomized pattern (to ensure blind sampling) in a running seawater raceway table to maintain

temperature. Larval counts and appropriate water changes were performed daily for a total of

three days.

5.2.3 Extraction of Coralline Algae Compounds

In order to determine the conditions necessary for pure lumichrome and riboflavin to

sufficiently migrate on the TLC plate (Whatman KC18 Silica Gel 60 with fluorescent indicator,

10 x 10 cm, 200 Clm thick), saturated solutions of lumichrome and riboflavin in methanol:HCI

(49: 1) and in pure methanol were prepared (Phillips et al. 1999). Samples were pelleted to

eliminate any particulate matter in solution as lumichrome and riboflavin have low solubility in

many solvents. A total of 3 CIL of each mix and the solvent (methanl:HC1) were spotted onto the

TLC plate. The plate was developed with a mobile phase of chloroform :methanol:water

(17.5:12.5:1.5) (Phillips et al. 1999). A total time of approximately 40 minutes was required for

the mobile phase to migrate to the top of the plate.

Dilution series of the pure samples was performed in order to optimize the concentration

for visualization on TLC plates. Using stock solutions of 2800 g/L lumichrome and riboflavin,

1, 10 and 50 CIL were spotted onto the TLC plate in addition to 50 CIL of the solvent

(methanol:HC1). The TLC was developed using the same mobile phase as above.

The presence of lumichrome and riboflavin in coralline algae was tested by methanol

extraction (Phillips et al. 1999, Kitamura et al. 2007). Briefly, approximately 10 g of coralline










algae, frozen in liquid nitrogen, were ground into a paste to which 100% HPLC-grade methanol

was added and transferred to a 15 ml plastic tube. The suspension was vortexed vigorously, and

allowed to settle on ice. The contents were filtered using a Whatman 0.45 CIL filter. This

extraction process was performed three times. Methanol was rotary-evaporated at 45oC at a

pressure of 337 mbar, and then at 80 mbar for five hours on a Buichi Rotavapor R-200 (Buichi

Labortechnik AG, Flawil, Switzerland). The final dried sample was reconstituted in 400 CIL of

methanol:HCI (49:1) to be used for TLC.

5.2.4 Thin Layer Chromatography of Coralline Algae Extracts

The methanol-extracted coralline algae samples were spotted onto the TLC plate in

volumes of 1, 5, 10, and 25 CL. Five microliters of the pure lumichrome and riboflavin stock

solutions were spotted as well as 25 CIL of the methanol:HCI solvent. The plate was developed

with chloroform:methanol :water (17.5:12.5:1. 5) for 40 minutes, allowed to dry and visualized

using a UV transluminator.

Due to the suspicion that chlorophyll is also extracted with methanol from the coralline

algae, solvent portioning was attempted to separate lumichrome from chlorophyll. As a

chlorophyll control, chlorophyll was extracted from grass blades with methanol. The starting

solvent was methanol, which was then mixed with either ethyl acetate, isopropanol, chloroform,

or tetrahydrofuran. If the two solvents were miscible then a 1:1 chloroform:water step was

added. The solution was vortexed and then centrifuged to separate phases. Since lumichrome

and riboflavin are yellow/orange in solution and chlorophyll is green, simple observation on the

phase color indicated the presence of each chemical. Acid (0.05 M HC1) and base (0.05 M

NaOH) were added to each solvent mix to test the effect of pH on the partitioning.

Solvent partitioning was applied to the coralline algae extracts in order to separate

chlorophyll from lumichrome and riboflavin and therefore result in a cleaner run on the TLC.










The extracts were treated with methanol and ethyl acetate solvents mixed with chloroform and

water and treated with 0.05 M NaOH. This resulted in the yellow lumichrome in the top phase

and the green chlorophyll in the bottom phase. The top phase was transferred to a new

Eppendorf 1.5 ml tube and stored until used for TLC.

Solvent partitioned coralline algae extracts were separated by TLC with both

chloroform:methanol :water (17.5:12.5:1 .5) and also methanol:water (3:2) mobile phases. The

samples were running quickly with the mobile front so a more hydrophobic mobile phase of

chloroform: methanol:water (3 5:12.5: 1.5) was used.

5.2.5 Induction of Coral Larvae Settlement and Metamorphosis

Elkhorn coral, Acropora palmata, gametes were collected from Looe Key Reef, FL in

August 2007 during a mass spawning event. Fertilization and rearing of larvae were conducted

at Mote Marine Laboratory Tropical Research Laboratory (Summerland Key, FL). Settlement

experiments were set up in six well Petri plates to test the effects of pure lumichrome, riboflavin,

and N-acyl-homoserine lactones (AHLs) have on the settlement and metamorphosis of coral

larvae. Lumichrome and riboflavin were used due to the observation that lumichrome induces

settlement in ascidian larvae (Tsukamoto 1999). Larval settlement was scored positive if the

larvae was attached at the aboral end to any part of the polystyrene well and did not detach with

gentle agitation with water. Differences among treatments were compared using ANOVA and

student' s t-test with STATISTICA software, version 6.0.

N-acyl-homoserine lactones are signaling molecules and are critical components of the

communication system, quorum sensing (Waters and Bassler 2005, West et al. 2007). For this

experiment, 3-oxo-C6 homoserine lactone (a short-chain AHL commonly produced by marine

vibrios (Taylor et al. 2004)) and C14 homoserine lactone (a long-chain AHL) were used. 3 -oxo-

C6 HSL is a common AHL produced by bacteria involved in quorum-sensing systems C14









HSL was selected for these experiments based on the observation that many marine associated

alpha- and gamma-proteobacteria produce long-chain AHLs (Wagner-Dobler et al. 2005,

Mohamed et al. 2008).

Two reporter strains were utilized in order to detect the presence of lumichrome and/or

AHLs in the methanol extracted coralline algae samples. Agrobacterium tumefaciens pZLR4

contains the traCDG operon with its promoter region. traG is transcriptionally fused to lacZ

(Cha et al. 1998). The reporter construct is stimulated during interaction with AHLs. MG32-

dapA is a strain of Sinorhizobium meliloti construct with the dapA promoter fused with a gus

reporter gene, which uses 5-bromo-4-chloro-3 -indolyl-beta-D-glucuronic acid (X-gluc) as a

substrate (25 Clg/ml). The dapA promoter activity was induced on M9 agar in response to 200

nM lumichrome in a promoter probe screen of Sinorhizobium meliloti (Gao et al., unpublished

data). Therefore, the construct was used as a potential lumichrome reporter in this experiment.

20 Cl~ of the lumichrome and riboflavin solutions (4.55 mM and 1.46 mM, respectfully) and

of each AHL tested (3.21 mM C14-HSL and 1 mM 3 -o-C6-HSL) was impregnated onto 0.002 g

C18 resin. The mixtures were allowed to dry overnight in a flow hood as the chemicals adhered

to the resin. A small amount of aquarium-grade silicone adhesive was applied to the center of a

1 x 1 inch porous ceramic tile and spread evenly with a metal spatula. The impregnated C18

resin was then spread onto the adhesive as evenly as possible for each of the four chemicals

tested. As controls, two tiles with silicone adhesive only were prepared. Tiles were allowed to

dry completely in the flow hood overnight (to effectively release acetic acid during the curing

process). Prior to the set-up of the bioassay to test for the presence of the chemicals on the tiles,

the tiles were washed in filter sterilized seawater for 3 hours and then placed in a thin layer of









distilled water. The distilled water was to allow the salt to diffuse out of the tiles so as to not

interfere with the reporter strains.

2 ml of overnight culture of each reporter (Agrobacteriunt tunrefaciens pZLR4 and

Sinorhizobium nzeliloti MG32-dapA) were subcultured into 50 ml ABM medium and incubated

at 30oC for five hours (Hwang et al. 1994, Shaw et al. 1997). Each of the washed tiles were

placed into large Petri plate (lumichrome, riboflavin and control in one plate; AHLs and control

in the other). The reporter strains were mixed with 100 ml of cooled ABM agar supplemented

with Gm 30, 60 Cpg/ml X-gal for the Agrobacteriunt reporter and 60 Cpg/ml X-gluc for the MG32

reporter. The agar mixture was slowly poured over the tiles to cover them, allowed to solidify

and incubated at 30oC overnight.

5.3 Results

5.3.1 Consequences of AHL Hydrolysis on Coral Settlement

Settlement induction experiments carried out with competent Acropora palmata coral

larvae approximately one week after fertilization to investigate the involvement in common

bacterial signaling molecules in the induction of coral larvae. Settlement in response to biofilms

of wild-type bacteria (vector control) were compared to biofilms of the same bacterial strains that

carried a plasmid-borne gene encoding for an AHL-lactonase enzyme that had developed on

ceramic tiles. Each type of biofilm tested with and without the addition of a small piece of

crustose coralline algae (CCA) and a negative control of tiles bathed in the bacterial media +/-

CCA was included.

On each of the three days that settlement was measured, the media control with CCA

resulted in the highest settlement events (Fig. 5-1A). In both the media control and the wild-type

biofilm treatments, the addition of CCA enhanced larval settlement. The transgenic biofilms and

CCA together, however, did not show enhanced settlement (Fig. 5-1A). Over the three day









settlement experiment the media control with CCA led approximately 47% of the larvae to settle

(Fig. 5-1B), which was significantly higher than all other treatments (F5, 21 = 32.6746; p <

0.0001). Exposure to wild-type biofilms with CCA resulted in settlement of approximately 13%

of the larvae added (Fig. 5-1B). Post hoc comparisons using t-tests indicated that media alone

with CCA significantly induced settlement more than wild-type biofilms with or without CCA (t

= 2.079; p = 0.0005). The transgenic biofilms did not show significant differences in settlement

in the presence or absence of CCA (p = 0.878).

Settlement induction in response to exposure to known concentrations of AHL (3-o-C6-

HSL, synthetic AHL) was also tested with Acropora palmata larvae. The hypothesis that the

AHL signal in the water would induce settlement at a higher rate than seawater alone was tested.

The addition of CCA was also predicted to enhance coral settlement. Filter sterilized seawater

supplemented with 100 nM 3-o-C6-HSL did not induce coral larvae to settle more than filter

sterilized seawater alone (Fig. 5-2; F1,16 = 0.4337; p = 0.5195). The addition of CCA, however,

to both treatments did increase settlement, although the total percentage of settlement only

reached approximately 15% (Fig. 5-2B).

5.3.2 Isolation of Coralline Algae Compounds

Thin layer chromatography (TLC) was used to first separate pure samples oflumichrome

and riboflavin. The hypothesis that lumichrome and riboflavin were present in crustose coralline

algae (CCA) was tested. Compounds from CCA were extracted with methanol and crude

extracts were separated by TLC. The crude extracts did not separate as cleanly as the pure

compounds with chloroform:methanol :water (17.5:12.5:1.5) or methanol:water (3:2). They ran

as a long smear with no distinct separation, however when viewed under UV light, regions did

fluoresce similar to the pure compounds. To eliminate potential chlorophyll contamination in the

extraction process, samples were solvent partitioned to remove chlorophyll from the










lumichrome. The extracts were treated with methanol and ethyl acetate solvents mixed with

chloroform and water, and finally treated with 0.05 M NaOH. This combination resulted in

successful separation of the lumichrome and chlorophyll standards. The solvent partitioned

samples, however, still did not show full separation as compared to the pure compounds. The

samples migrated up the plate very quickly so a more hydrophobic mobile phase was used

(chloroform:methanol :water; 35:12.5:1.5). This mobile fraction resulted in a shorter migration

by the pure compounds but the extracts still migrated as a smear.

5.3.3 Roles of Signaling Molecules in Coral Larvae Settlement

Due to limited number ofAcropora palmata collected following the spawning event,

only a preliminary pilot study investigating the effects of lumichrome on settlement could be

performed. Eight larvae were placed in each treatment well and monitored for three days. No

larvae settled in that time, although larvae in the lumichrome treatments appeared to undergo

more of a morphological change than the larvae in the other treatments. The aboral end of the

larvae was noticeably more swollen than in other treatments suggesting that larvae were

responding to lumichrome more so than seawater alone (Fig. 5-4).

Based on the limited observations of Acropora palmata larvae in response to exposure to

lumichrome, the influence on settlement of2\~onta;strea faviolata was examined. Settlement of

Monta;strea faviolata larvae in response to lumichrome, riboflavin and AHLs with acyl side

chains of different lengths was extremely low. Lumichrome, riboflavin and C14-HSL appeared

to slightly induce settlement (Fig. 5-3); however, some settlement was also observed in the

negative controls. No significant differences were observed between the treatments (F10,61

0.9564; p = 0.4899). No larvae settled in response to 3-o-C6-HSL regardless of concentration

applied. This contradicts the results observed for Acropora palmata larvae in response to this










AHL (Fig. 5-2). While lumichrome, riboflavin, and C14-HSL appear to induce settlement, the

high standard error limits potential conclusions.

5.4 Discussion

This study begins to shed light on the environmental and biological cues that Acropora

palmate and M\~onta;strea faviolata larvae perceive and respond to during their transition from

pelagic to benthic organisms. While the conclusions that can be made from these settlement

experiments are limited, there are specific trends that are both consistent with previously

conducted studies and indicative of some general cues that induced larval settlement and

metamorphosis.

Settlement in response to wild-type and transgenic biofilms of a consortia of bacteria

primarily comprised of isolates of Agrobacterium tumefaciens and Vibrio harveyi demonstrated

that larvae ofA. palmata show slightly different degrees of settlement as compared to seawater

alone. This is primarily due to the production of AHLs by the wild-type biofilms and the lack of

AHLs in the transgenic biofilms due to the aiiA gene encoding for an AHL-lactonase enzyme

that cleaves the ring of the AHL molecule, resulting in loss of function (Dong et al. 2000, Dong

et al. 2001, Gao et al. 2007a). The presence of CCA led to an increased level of settlement in

both the wild-type biofilm treatment and the negative control (> 40% settlement), while no such

increased was observed in the transgenic biofilm treatment. This increase was greatest in the

seawater negative control, suggesting that settlement may be induced by CCA more than the

presence of AHL signaling compounds produced by biofilms. This result was further supported

through the experiment using a known concentration of a synthetic AHL (3-o-C6-HSL).

Induction of settlement with and without the presence of CCA was not significantly different

from the seawater negative control with and without CCA. In the treatments with CCA,

induction of settlement was higher but similar between treatments.









Larvae used in these experiments required approximately eight days to become fully

competent. Once settled, larvae tended to begin to metamorphosize after 12-24 hours, which

supports previous studies (Negri et al. 2001). The induction of settlement in response to CCA

has been demonstrated in Pacific corals from the families Acroporidae and Faviidae (Morse et al.

1996, Baird and Morse 2004) and the results presented here suggest that acroporid corals in the

Atlantic are induced to settle after exposure to CCA cues in the environment.

Riboflavin and its derivative lumichrome are chemicals involved in the cell-to-cell

communication between bacteria and their eukaryotic host (Phillips et al. 1999). Lumichrome is

involved in the settlement and metamorphosis of sessile marine organisms such as the asicidin,

Hhalocynthia roretzi (Tsukamoto 1999, Tsukamoto et al. 1999). Therefore, it is reasonable to

hypothesize that riboflavin and lumichrome may be produced by either CCA or the bacteria

associated with it. Methanol extractions of CCA and subsequent analysis with thin layer

chromatography failed to successfully isolate both riboflavin and lumichrome from extracts of

CCA. This is not to say, however, that neither compound is present in coralline algae. CCA

does contain compounds that fluoresce similarly to pure samples of riboflavin and lumichrome

(green and blue respectfully). While the potential for numerous natural compounds to fluoresce

blue and green these results should not be discounted. Alternative separation methods may be

employed, such as high pressure liquid chromatography (HPLC) to better separate compounds

extracted from CCA. These compounds can then be screened for their involvement in the

induction of coral larvae settlement and metamorphosis. A recent study isolated a novel

compound from CCA by HPLC shown to induce metamorphosis. The natural inducer was

identified as 11l-deoxyfistularin-3, a bromotyrosine derivative (Kitamura et al. 2007). This

chemical was also isolated from marine sponges and related compounds have a wide range of









biological activities, such as antiviral, antibiotic, cytotoxic, Na /K+ ATPase inhibitory, and

anticancer (Kitamura et al. 2007).

Settlement experiments investigating the roles of lumichrome, riboflavin and short- and

long-chain AHLs in settlement induction of M~onta;strea faviolata larvae were inconclusive.

While optimization of these settlement techniques are ongoing, sub-optimal larval and settlement

conditions may have affected the outcome of the experiments. The spawning event at Looe Key

Reef, FL in August 2007 resulted in nearly non-existent acroporid coral spawning and very few

colonies of M~onta;strea faviolata that spawned. With limited competent coral larvae and adverse

environmental conditions, representing natural conditions for settlement becomes challenging.

From the limited results of this study, it appears that the presence of multiple cues enhance the

effect of each other. In order to determine if one cue is able to induce settlement alone, larvae

must be presented with a wide range of treatments and sufficient yields of competent larvae from

spawning events are required.














































WT + CCA Transgene Transgene +
CCA CCA


Day 1 Day 2 Day 3

I Media CCA Media + CCA WVT CCA O VVT + CCA AiiA CCA O AiiA + CCA


100
90
80
70
60
50
40
30
20
10
0


Media CCA Media + CCA WT -CCA


Treatment


Figure 5-1. Coral larvae settlement in response to tiles bathed in GASW media supplemented
with 5% CFA +/- either wild-type biofilm formation or transgenic biofilm formation
with strains carrying the pAiiA (AHL-lactonase gene). Panel A shows average larval
settlement measured each day. Each treatment was tested for both the ability to
induce settlement and also if settlement was enhanced with the addition of a piece of
crustose coralline algae (CCA). Panel B shows average percent of coral larvae
settlement after 3 day exposure to each treatment. A total of 20 larvae were added to
each treatment at the start of the experiment. Combined averages among treatments
were used to calculate the total percentage of larvae that settled. Settlement was
defined as adherence to any surface in the container with the aboral end of the pear-
shaped larvae.































100-
90-
80-
70-
60-
50-
40-
30-
20-
10-
0


Lm


Day 1


Day 2


Day 3


mAHL CCA m AHL + CCA m SW CCA El SW + CCA


AHL -CCA


AHL + CCA


SW -CCA


SW + CCA


Treatment


Figure 5-2. Coral larvae settlement in response to tiles bathed in filter sterilized sea water
supplemented with 100 nM 3-o-C6-HSL (AHL treatment) and filter sterilized sea
water as a control. Panel A shows average larval settlement measured each day.
Each treatment was tested for both the ability to induce settlement and also if
settlement was enhanced with the addition of a piece of crustose coralline algae
(CCA). Panel B shows average percent of coral larvae settlement after 3 day
exposure to each treatment. A total of 20 larvae were added to each treatment at the
start of the experiment. Combined averages within treatments were used to calculate
the total percentage of larvae that settled. Settlement was defined as adherence to any
surface in the container with the aboral end of the pear-shaped larvae.












0.8
0.6
0.4
0.2
0


~h~h~~ P CTreatmentf\ Xr~
Figure3 C 5-.Aeaettlcrllrve(otsrafvoaa oe i asi epnet
poenia inucrs Setemn wa codce in6wl oytrn erltswt















Figure 5-4. Swollgen toaboral endsa of A. pala;~ta lar~vaeoQ v s d in response toexouetlmihm.
Pae hwssimn larvae und o ahwelwthfler aLeriica disecwtion microslcopewth and ae
cautfloeswene efilter. Comaratvel Cmore lavrvage intheuichom treatment wr s t













exhibited swollen aboral ends than in the seawater control, potentially signaling their
readiness to settle (white arrows). Panel B depicts a close up of a larvae under dark
field microscopy with a swollen aboral end in response to lumichrome (white arrow).









CHAPTER 6
SUMMARY AND CONCLUSIONS

6.1 Value and Decline of Corals

Coral reefs are valuable ecosystems and are vital to the overall health and sustainability

of near-shore marine systems. The goods and services originating from these ecosystems

support local economies and represent a wide array of benefits to society (Johns et al. 2001).

Coral reefs, however, are facing ever increasing environmental stressors, limiting their

productivity and ultimately leading to their demise. These studies investigated how the biology

of the corals, interactions with other organisms, and environmental cues contribute to the

complexity of coral reef ecology and specifically to the study and management of coral diseases.

The environmental stressors confronting corals continues to increase as the world's

population and global demands increase (Harvell et al. 1999, Nystrom et al. 2000). Increased

nitrification and pollution run-off due to amplified farming practices and pollution from miss-

treated wastewater allow for the introduction of opportunistic pathogens into novel environments

(Lipp et al. 2002, Griffin et al. 2003). Besides the fact that anthropogenic stressors provide

opportunities for pathogens, they alter the normal ecology of coral reef systems and subj ect the

corals to conditions often well beyond their tolerance. Such conditions generally led to coral

bleaching, which may be exacerbated by the presence of pathogenic bacteria (Douglas 2003,

Hughes et al. 2003, Rosenberg and Falkovitz 2004, Ainsworth et al. 2008).

6.2 Characterization of a Coral White Pox Pathogen

The increase of these types of anthropogenic inputs in the Florida Keys is what led

researchers to suggest that the presence of Serratia marcescens PDL 100, a coral white pox

pathogen, was due to introduction via un-treated sewage effluence (Patterson et al. 2002).

Serratia marcescens is a known enterobacterium capable of causing disease in plant, vertebrate









and invertebrate animals and humans but had not been isolated from a marine invertebrate

before. The suggestion that S. marcescens PDL100 originated from human sources is reasonably

supported by this study through the comparison of the carbon utilization profiles and the

enzymatic induction of S. marcescens isolates in response to growth on coral mucus. PDL100

correlated the highest with the pathogenic Serratia marcescens isolates.

Carbohydrate utilization patterns (CUPs) are not only used to identify bacterial isolates.

These classification tools have also been applied to microbial source tracking. Identifying the

CUP of a bacterial isolate that can be compared to a database allows for source identification

with relative ease. Hagedorn and colleagues used BIOLOG GP2 plates to source track

Enterococcus fecal pollution in water and found that CUP analysis led to an average rate of

correct classification by source to be approximately 95%, well in the upper range of other

methods (Hagedorn et al. 2003). CUP mapping has also been shown effective for E. coli and

fecal streptococci resulting in a 73 and 93% average rate of correct classification (ARCC),

respectfully (Seurinck et al. 2005). Nutrient utilization profiling has proven to be effective in

source tracking E. coli in surface waters, yielding an ARCC of 89.5% using BIOLOG GN2

plates (Uzoigwe et al. 2007).

The high degree of correlation between the coral white pox pathogen and other pathogenic

isolates of Serratia marcescens tends to suggest that metabolic potentials and perhaps virulence

factors are conserved among pathogenic isolates of this species. This notion provides reason

why S. marcescens is such a successful opportunistic pathogen, and able to infect vastly different

hosts. The fundamental mechanisms that Serratia marcescens PDL 100 employs during

colonization and growth on the coral host are similar to those observed in other pathogenic S.

marcescens isolates. It appears that this coral white pox pathogen may have the necessary










machinery in place to overcome its host defenses and mount an attack leading to an infection,

provided there is an open niche or the coral is vulnerable due to other stressors. This is

suggested based on the induction of enzymatic activities and proteases during growth on coral

mucus. Both cell-associated and extracellular proteases were shown to be induced during growth

of the pathogen on coral mucus. Extracellular proteases are often associated with virulence and a

mechanism for pathogenicty (Travis et al. 1995, Young et al. 1999). Serratia nzarcescens

PDL 100 also possesses the metabolic and regulatory pathways that may be needed to colonize

and grow on coral mucus. These pathways, however, may not have specifically evolved during

the interaction between PDL100 and Acropora palmate. In fact, many of the carbon substrates

utilized by PDL100 were common to those utilized by other isolates of S. nzarcescens. Similarly,

the enzymes induced during growth on coral mucus were consistent with other pathogenic

isolates of S. nzarcescens.

6.3 Potential Regulation of Virulence Factors and Disease Management

The results of this study also indicate that Serratia nzarcescens PDL 100 possesses the

two-component regulatory system, GacS/GacA. The complementation assay demonstrated that

the GacA protein in PDL 100 is functional and therefore suggests that this pathogen may regulate

its virulence through this response regulator as do many other pathogenic y-protoebacteria

including E. coli, Salmonella enterica, Pseudonzona~s spp. and Vibrio spp. (Lapouge et al. 2008).

Potential targeting of the gacA gene for disruption or mutation may lead to a strategy for the

management of this pathogen. As discussed earlier, conventional disease treatments, such as

antibiotics are not feasible on coral reefs. By disrupting the function of gacA or another

component of the regulatory system, the pathogen will still be able to grow and proliferate,

however, virulence factors controlled by the regulator protein will not be expressed (Lapouge et

al. 2008). Another target within the regulatory system is the inhibition of the










autophosphorylatable GacS in response to an environmental stimulatory signal. Potentially, an

environmental signal or microbial isolate could be used as a biocontrol agent to inhibit GacS and

therefore, the downstream virulence gene expression. The use of probiotic bacteria to colonize a

host and provide a barrier against and/or actually inhibit pathogenic infection is routinely applied

in agriculture and commercial aquaculture to control disease in trout (Brunt et al. 2007), shrimp

(Chythanya et al. 2002, Farzanfar 2006) and other species (Balcazar et al. 2006). The

exploitation of the natural abilities of native coral-associated bacteria to combat invading

pathogens, may be a future means to manage opportunistic pathogens capable of causing coral

diseases.

6.4 Coral Mucus

Coral mucus has been shown to serve many purposes for the coral host and the

surrounding reef ecosystem. Such functions include ciliary-mucoid feeding by the copepod

Acartia negligens (Richman et al. 1975) and mucus is hypothesized to protect against fouling,

smothering by sediment, physical damage, desiccation during air exposure at extreme low tides,

space invasion by other corals, and ultraviolet radiation damage (rev. (Wild et al. 2004, Brown

and Bythell 2005)). Mucus also provides rich organic nutrients to bacteria and other

microorganisms living on the corals and in the surrounding waters (Wild et al. 2004). While the

composition of coral mucus varies among species, season and depth (Crossland 1987), certain

types of molecules are routinely present. In many cases, protein and carbohydrate polymers are

the maj or components, where as lipids are less abundant. Generally, fucose, arabinose, galactose

and N-acetyl glucosamine are present in high concentrations (Ducklow and Mitchell 1979,

Meikle et al. 1988). The enzyme induction assay presented here begins to elucidate some of the

carbon sources found in Acropora palmate mucus secreted during the summer months. While










these conclusions were deduced indirectly, the induction of the specific enzymes indicates that

these molecules were present in coral mucus.

6.5 Settlement and Metamorphosis of Coral Larvae

Settlement and metamorphosis induction experiments demonstrate that Acropora palmata

larvae appear to respond to both AHLs and cues from coralline algae. Experimental results also

demonstrate that larvae ofA. palmate induce settlement in response to microbial biofilms

comprised ofAgrobacterium and Vibrio isolates from coral mucus. The settlement cues from

CCA may either be produced by the algae or by bacteria associated with the algae (Negri et al.

2001). Lumichrome showed potential for induction of settlement in A. palmata in a pilot study

that led planktonic larvae to swell and become pear shape before those in other treatments (Fig.

5-4). However, due to limited larvae stocks, the influence of lumichrome and riboflavin in

settlement and metamorphosis in A. palmata larvae was not tested. M~onta;strea faviolata larvae

is another important reef-building coral species in the Caribbean. Settlement experiments testing

the role of lumichrome, riboflavin and short- and long-chain AHLs were conducted, but results

and conclusions were limited due to low larvae counts and unfavorable spawning conditions.

6.6 Future Directions

The mechanisms and virulence factors utilized by opportunistic pathogens remain unclear

for many pathogens, including Serratia marcescens (Patterson et al. 2002). Although well-

studied the full mechanism of Vibrio harveyi has yet to be fully elucidated (Austin and Zhang

2006). In Pseudomona~s aeruginosa, few host-specific virulence mechanisms were identified in

virulence mutant screens in insects, mice, and nematodes, suggesting extensive conservation of

virulence factors used by this pathogen (Mahajan-Miklos et al. 2000). This study begins to draw

some conclusions as to the types of capabilities and potential virulent pathways exhibited by the

coral white pox pathogen, Serratia marcescens PDL100. These conclusions were drawn from










metabolic characterization experiments in comparison to other environmental and pathogenic

isolates of S. marcescens as well as native coral bacterial isolates. The results of the metabolic

assays suggest potential genes involved in the colonization and growth of the pathogen when it

encounters coral mucus. The natural progression of research is the genetic and molecular

characterization of white pox disease. Tools to identify specific genes induced or repressed

during the colonization and infection process such as a promoter library screen will be employed.

Once these genes are clearly identified as being involved in the colonization and infection

process, they may serve as targets for disruption in order to reduce virulence in the pathogen.

Similar tools can then be applied to other coral diseases in order to better understand the

mechanism of infection. Once coral diseases are understood at the microbial level, sustainable

management practices to reduce disease and preserve coral reefs may be achievable.










LIST OF REFERENCES


Abelson, A., R. Olinky, and S. Gaines. 2005. Coral recruitment to the reefs ofEilat, Red Sea:
temporal and spatial variation, and possible effects of anthropogenic disturbances. Marine
Pollution Bulletin 50:576-582.

Ainsworth, T. D., M. Fine, G. Roff, and O. Hoegh-Guldberg. 2008. Bacteria are not the primary
cause of bleaching in the Mediterranean coral Oculina patagonica. Isme J 2:67-73.

Ainsworth, T. D., E. Kramasky-Winter, Y. Loya, O. Hoegh-Guldberg, and M. Fine. 2007. Coral
disease diagnostics: what's between a plague and a band? Appl Environ Microbiol
73:981-992.

Aizawa, S. I. 2001. Bacterial flagella and type III secretion systems. FEMS Microbiol Lett
202:157-164.

Alker, A. P., G. W. Smith, and K. Kim. 2001. Characterization of Aspergillus sydowii (Thom et
Church), a fungal pathogen of Caribbean sea fan corals. Hydrobiologia 460: 105-1 11.

Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham, and R. Maurer. 2000. Characterization of
two novel regulatory genes affecting Salmonella invasion gene expression. Mol
Microbiol 35:635-646.

Aronson, R. B., J. F. Bruno, W. F. Precht, P. W. Glynn, C. D. Harvell, L. Kaufman, C. S.
Rogers, E. A. Shinn, and J. F. Valentine. 2003. Causes of coral reef degradation. Science
302:1502-1504; author reply 1502-1504.

Austin, B., and X.-H. Zhang. 2006. Vibrio harveyi: a significant pathogen of marine vertebrates
and invertebrates. Letters in Applied Microbiology 43:119-124.

Babcock, R. C., and A. J. Heyward. 1986. Larval Development of Certain Gamete-Spawning
Scleractinian Corals. Coral Reefs 5: 111-116.

Babitzke, P., and T. Romeo. 2007. CsrB sRNA family: sequestration of RNA-binding regulatory
proteins. Curr Opin Microbiol 10:156-163.

Baikalov, I., I. Schroder, M. Kaczor-Grzeskowiak, K. Grezeskowiak, R. P. Grunsalus, and R. E.
Dickerson. 1996. Effect of phosphorylation on the interdomain interaction of the
response regulator, NarL. Biochemistry 35: 11053-11080.

Baird, A. H., and A. N. C. Morse. 2004. Induction of metamorphosis in larvae of the brooding
corals Acropora palifera and Stylophora pistillata. Marine and Freshwater Research
55:469-472.

Baker, C. S., I. Morozov, K. Suzuki, T. Romeo, and P. Babitzke. 2002. CsrA regulates glycogen
biosynthesis by preventing translation of glgC in Escherichia coli. Mol Microbiol
44:1599-1610.










Balcazar, J. L., I. de Blas, I. Ruiz-Zarzuela, D. Cunningham, D. Vendrell, and J. L. Muzquiz.
2006. The role of probiotics in aquaculture. Vet Microbiol 114: 173-186.

Ball, E. E., D. C. Hayward, J. S. Reece-Hoyes, N. R. Hislop, G. Samuel, R. Saint, P. L. Harrison,
and D. J. Miller. 2002. Coral development: from classical embryology to molecular
control. Int J Dev Biol 46:671-678.

Banin, E., T. Israely, M. Fine, Y. Loya, and E. Rosenberg. 2001. Role of endosymbiotic
zooxanthellae and coral mucus in the adhesion of the coral-bleaching pathogen Vibrio
shiloi to its host. FEMS Microbiol Lett 199:33-37.

Bassler, B. L., C. Yu, Y. C. Lee, and S. Roseman. 1991. Chitin utilization by marine bacteria.
Degradation and catabolism of chitin oligosaccharides by Vibrio furnissii. J Biol Chem
266:24276-24286.

Belda-Baillie, C. A., B. K. Baillie, and T. Maruyama. 2002. Specificity of a model cnidarian-
dinoflagellate symbiosis. Biol Bull 202:74-85.

Bellwood, D. R., T. P. Hughes, C. Folke, and M. Nystrom. 2004. Confronting the coral reef
crisis. Nature 429:827-833.

Ben-Haim, Y., and E. Rosenberg. 2002. A novel Vibrio sp pathogen of the coral Pocillopora
damdddddddd~~~~~~~~~icorns Marine Biology 141:47-55.

Ben-Haim, Y., F. L. Thompson, C. C. Thompson, M. C. Cnockaert, B. Hoste, J. Swings, and E.
Rosenberg. 2003a. Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen of
the coral Pocillopora damicornis. Int J Syst Evol Microbiol 53:309-315.

Ben-Haim, Y., M. Zicherman-Keren, and E. Rosenberg. 2003b. Temperature-regulated
bleaching and lysis of the coral Pocillopora damicornis by the novel pathogen Vibrio
coralliilyticus. Appl Environ Microbiol 69:4236-4242.

Berg, G., L. Eberl, and A. Hartmann. 2005. The rhizosphere as a reservoir for opportunistic
human pathogenic bacteria. Environ Microbiol 7: 1673-1685.

Bhowmick, R., A. Ghosal, and N. S. Chatterjee. 2007. Effect of environmental factors on
expression and activity of chitinase genes of vibrios with special reference to Vibrio
cholerae. J Appl Microbiol 103:97-108.

Birrell, C. L., L. J. McCook, and B. L. Willis. 2005. Effects of algal turfs and sediment on coral
settlement. Marine Pollution Bulletin 51:408-414.

Brosius, J., M. Erfle, and J. Storella. 1985. Spacing of the -10 and -35 regions in the tac
promoter. Effect on its in vivo activity. J Biol Chem 260:3539-3541.

Brown, B. E. 1997. Disturbances to Reefs in Recent Times.in C. Birkeland, editor. Life and
Death of Coral Reefs. Springer, New York.










Brown, B. E., and J. C. Bythell. 2005. Perspectives on mucus secretion in reef corals. Marine
Ecology Progress Series 296:291-309.

Bruno, J. F., L. E. Petes, C. Drew Harvell, and A. Hettinger. 2003a. Nutrient enrichment can
increase the severity of coral diseases. Ecology Letters 6:1056-1061.

Bruno, J. F., J. J. Stachowicz, and M. D. Bertness. 2003b. Inclusion of facilitation into ecological
theory. Trends in Ecology & Evolution 18:119-125.

Brunt, J., A. Newaj-Fyzul, and B. Austin. 2007. The development of probiotics for the control of
multiple bacterial diseases of rainbow trout, Oncorhynchus mykiss (Walbaum). Journal
of Fish Diseases 30:573-579.

Campbell, C. D., S. J. Grayston, and D. J. Hirst. 1997. Use of rhizosphere carbon sources in sole
carbon source tests to discriminate soil microbial communities. J Microbiol Methods
30:33-41.

Carbonell, G. V., H. H. M. Della Colleta, T. Yano, A. L. C. Darini, C. E. Levy, and B. A. L.
Fonseca. 2000. Clinical relevance and virulence factors of pigmented Serratia
marcescens. FEMS Immunol Med Microbiol 28:143-149.

Cha, C., P. Gao, Y. C. Chen, P. D. Shaw, and S. K. Farrand. 1998. Production of acyl-
homoserine lactone quorum-sensing signals by gram-negative plant-associated bacteria.
Mol Plant Microbe Interact 11:1119-1129.

Chang, D. E., D. J. Smalley, D. L. Tucker, M. P. Leatham, W. E. Norris, S. J. Stevenson, A. B.
Anderson, J. E. Grissom, D. C. Laux, P. S. Cohen, and T. Conway. 2004. Carbon
nutrition of Escherichia coli in the mouse intestine. Proc Natl Acad Sci U SA 101:7427-
7432.

Choi, K. H., and F. C. Dobbs. 1999. Comparison of two kinds of Biolog microplates (GN and
ECO) in their ability to distinguish among aquatic microbial communities. J Microbiol
Methods 36:203-213.

Chythanya, R., I. Karunasagar, and I. Karunasagar. 2002. Inhibition of shrimp pathogenic vibrios
by a marine Pseudomonas I-2 strain. Aquaculture 208: 1-10.

Cooper, C. R. 1999. Prepared Statement of C. Renee Cooper, Executive Director, Caribbean
Research Center.in Coral Reef Conservation and the Reauthorization of the National
Marine Sanctuaries Act. Hearing before the Subcommittees of Oceans and Fisheries and
the Committee on Commerce, Science and Transportation. United States Senate. One
Hundred Sixth Congress., Washington, D. C.

Costanza, R., R. dArge, R. deGroot, S. Farber, M. Grasso, B. Hannon, K. Limburg, S. Naeem, R.
V. ONeill, J. Paruelo, R. G. Raskin, P. Sutton, and M. vandenBelt. 1997. The value of the
world's ecosystem services and natural capital. Nature 387:253-260.










Crossland, C. J. 1987. In situ release of mucus and DOC-lipid from the corals Acropora
variabilis and Sty/lophora pistillata in different light regimes. Coral Reefs 6:35-42.

de Boer, H. A., L. J. Comstock, and L. I. Rothfield. 1983. The tac promoter: a functional hybrid
derived from the trp and lac promoters. PNAS 80:21-25.

Demidyuk, I. V., A. E. Kalashnikov, T. Y. Gromova, E. V. Gasanov, D. R. Safina, M. V.
Zabolotskaya, G. N. Rudenskaya, and S. V. Kostrov. 2006. Cloning, sequencing,
expression, and characterization of protealysin, a novel neutral proteinase from Serratia
proteamaculans representing a new group of thermolysin-like proteases with short N-
terminal region of precursor. Protein Expr Purif 47:551-561.

Diederich, L., A. Roth, and W. Messer. 1994. A versatile plasmid vector system for the regulated
expression of genes in Escherichia coli. BioTechniques 16:916-923.

Dobretsov, S., H.-U. Dahms, H. YiLi, M. Wahl, and P.-Y. Qian. 2007. The effect of quorum-
sensing blockers on the formation of marine microbial communities and larval
attachment. FEMS Microbiology Ecology 60: 177-188.

Dong, Y. H., L. H. Wang, J. L. Xu, H. B. Zhang, X. F. Zhang, and L. H. Zhang. 2001.
Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine
lactonase. Nature 411:813-817.

Dong, Y. H., J. L. Xu, X. Z. Li, and L. H. Zhang. 2000. AiiA, an enzyme that inactivates the
acylhomoserine lactone quorum-sensing signal and attenuates the virulence of Erwinia
carotovora. Proc Natl Acad Sci U SA 97:3 526-3 53 1.

Douglas, A. E. 2003. Coral bleaching--how and why? Marine Pollution Bulletin 46:385-392.

Drake, H. L., and M. A. Horn. 2007. As the worm turns: the earthworm gut as a transient habitat
for soil microbial biomes. Annu Rev Microbiol 61:169-189.

Drickamer, K., and R. A. Dwek. 1995. Carbohydrates and glycoconjugates. Current Opinion in
Structural Biology 5:589-590.

Dubey, A. K., C. S. Baker, T. Romeo, and P. Babitzke. 2005. RNA sequence and secondary
structure participate in high-affinity CsrA-RNA interaction. RNA 11:1579-1587.

Dubey, A. K., C. S. Baker, K. Suzuki, A. D. Jones, P. Pandit, T. Romeo, and P. Babitzke. 2003.
CsrA regulates translation of the Escherichia coli carbon starvation gene, estA, by
blocking ribosome access to the estA transcript. J Bacteriol 185:4450-4460.

Dubuis, C., and D. Haas. 2007. Cross-species GacA-controlled induction of antibiosis in
pseudomonads. Appl Environ Microbiol 73:650-654.

Dubuis, C., C. Keel, and D. Haas. 2007. Dialogues of root-colonizing biocontrol pseudomonads.
Eur J Plant Pathol 119:311-328.










Ducklow, H. W., and R. Mitchell. 1979. Composition of Mucus Released by Coral-Reef
Coelenterates. Limnology and Oceanography 24:706-714.

Dutta, R., L. Qin, and M. Inouye. 1999. Histidine kinases: diversity of domain organization.
Molecular Microbiology 34:633-640.

Eberl, L., S. Molin, and M. Givskov. 1999. Surface motility of Serratia liquefaciens MGl. J
Bacteriol 181:1703-1712.

Edmunds, P. J. 2007. Evidence for a decadal-scale decline in the growth rates of juvenile
scleractinian corals. Marine Ecology-Progress Series 341:1-13.

Edmunds, P. J., J. F. Bruno, and D. B. Carbon. 2004. Effects of depth and microhabitat on growth
and survivorship of juvenile corals in the Florida Keys. Marine Ecology Progress Series
278:115-124.

Fabricius, K. E. 2005. Effects of terrestrial runoff on the ecology of corals and coral reefs:
review and synthesis. Marine Pollution Bulletin 50:125-146.

Farnback, M., L. Eriksson, and G. Widmalm. 2008. Methyl 2-O-b-L-fucopyranosyl a-D-
glucopyranoside monohydrate: a synchrotron study. Acta Cryst. C64:o31-o32.

Farzanfar, A. 2006. The use of probiotics in shrimp aquaculture. FEMS Immunol Med Microbiol
48:149-158.

Ferenci, T. 1996. Adaptation to life at micromolar nutrient levels: the regulation of Escherichia
coli glucose transport by endoinduction and cAMP. FEMS Microbiol Rev 18:301-317.

Foley, J. E., S. H. Sokolow, E. Girvetz, C. W. Foley, and P. Foley. 2005. Spatial epidemiology of
Caribbean yellow band syndrome in M~ontastrea spp. coral in the eastern Yucatan,
Mexico. Hydrobiologia 548:33-40.

Fravel, D. R. 2005. Commercialization and implementation of biocontrol. Annu Rev Phytopathol
43:337-359.

Frias-Lopez, J., J. S. Klaus, G. T. Bonheyo, and B. W. Fouke. 2004. Bacterial community
associated with black band disease in corals. Appl Environ Microbiol 70:5955-5962.

Fung, I. Y., S. C. Doney, K. Lindsay, and J. John. 2005. Evolution of carbon sinks in a changing
climate. PNAS 102:11201-11206.

Galperin, M. Y. 2006. Structural Classification of Bacterial Response Regulators: Diversity of
Output Domains and Domain Combinations. J Bacteriol 188:4169-4182.

Gao, M., H. Chen, A. Eberhard, M. R. Gronquist, J. B. Robinson, M. Connolly, M. Teplitski, B.
G. Rolfe, and W. D. Bauer. 2007a. Effects of AiiA-mediated quorum quenching in
Sinorhizobium meliloti on quorum-sensing signals, proteome patterns, and symbiotic
interactions. Mol Plant Microbe Interact 20:843-856.










Gao, R., T. R. Mack, and A. M. Stock. 2007b. Bacterial response regulators: versatile regulatory
strategies from common domains. Trends in Biochemical Sciences 32:225-234.

Garland, J. L. 1997. Analysis and interpretation of community-level physiological profiles in
microbial ecology. FEMS Microbiology Ecology 24:289-300.

Garland, J. L., and A. L. Mills. 1991. Classification and Characterization ofHeterotrophic
Microbial Communities on the Basis of Patterns of Community-Level Sole-Carbon-
Source Utilization. Appl Environ Microbiol 57:23 51-23 59.

Garrigues, D., and G. Arevalo. 1995. An evaluation of the production and use of a live bacterial
isolate to manipulate the microbial flora in the commercial production ofPenaeus
vannamnei post-larvae in Ecuador. Pages 53-59 in C. L. Browdy and J. S. Hopkins,
editors. Swimming through troubled water. Proceedings of the Special Session on
Shrimp Farming, Aquaculture '95. World Aquaculture Society, Baton Rouge.

Garrison, V. H., E. A. Shinn, W. T. Foreman, D. W. Griffin, C. W. Holmes, C. A. Kellogg, M. J.
Majewski, L. L. Richardson, K. B. Ritchie, and G. W. Smith. 2003. African and Asian
dust: from desert soils to coral reefs. BioScience 53:469-480.

Gil-Agudelo, D. L., C. Myers, G. W. Smith, and K. Kim. 2006. Changes in the microbial
communities associated with Gorgonia ventalina during aspergillosis infection. Dis Aquat
Organ 69:89-94.

Golbuu, Y., and R. H. Richmond. 2007. Substratum preferences in planula larvae of two species
of scleractinian corals, Gonia~strea retiformis and Styla~raea punctata. Marine Biology
152:639-644.

Gosset, G., Z. Zhang, S. Navyar, W. A. Cuevas, and M. H. Saier, Jr. 2004. Transcriptome
Analysis of Crp-Dependent Catabolite Control of Gene Expression in Escherichia coli. J
Bacteriol 186:3516-3524.

Gray Davidson, O. 1998. The Enchanted Braid: Coming to Terms with Nature on the Coral Reef.
John Wiley & Sons, Inc., New York.

Griffin, D. W., K. A. Donaldson, J. H. Paul, and J. B. Rose. 2003. Pathogenic human viruses in
coastal waters. Clinical Microbiology Reviews 16:129-143.

Griffin, D. W., C. J. Gibson, 3rd, E. K. Lipp, K. Riley, J. H. Paul, 3rd, and J. B. Rose. 1999.
Detection of viral pathogens by reverse transcriptase PCR and of microbial indicators by
standard methods in the canals of the Florida Keys. Appl Environ Microbiol 65:41 18-
4125.

Grimes, D. J. 1991. Ecology of estuarine bacteria capable of causing human disease: a review.
Estuaries and Coasts 14:345-360.

Grimont, P. A., and F. Grimont. 1978. The genus Serratia. Annu Rev Microbiol 32:221-248.










Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation,
and high-level expression by vectors containing the arabinose PBAD promoter. J
Bacteriol 177:4121-4130.

Hagedorn, C., J. B. Crozier, K. A. Mentz, A. M. Booth, A. K. Graves, N. J. Nelson, and R. B.
Reneau. 2003. Carbon source utilization profiles as a method to identify sources of faecal
pollution in water. J Appl Microbiol 94:792-799.

Halpern, B. S., S. Walbridge, K. A. Selkoe, C. V. Kappel, F. Micheli, C. D'Agrosa, J. F. Bruno,
K. S. Casey, C. Ebert, H. E. Fox, R. Fujita, D. Heinemann, H. S. Lenihan, E. M. Madin,
M. T. Perry, E. R. Selig, M. Spalding, R. Steneck, and R. Watson. 2008. A global map of
human impact on marine ecosystems. Science 319:948-952.

Hammer, B. K., E. S. Tateda, and M. S. Swanson. 2002. A two-component regulator induces the
transmission phenotype of stationary-phase Legionella pneumophila. Mol Microbiol
44:107-118.

Harris, J. A., R. J. Hobbs, E. Higgs, and J. Aronson. 2006. Ecological restoration and global
climate change. Restoration Ecology 14: 170-176.

Harrison, P. L., and C. C. Wallace. 1990. Reproduction, dispersal and recruitment of
scleractinian corals. Pages 133-207 in Z. Dubinsky, editor. Coral Reefs (Ecosystems of
the world, Vol 25). Elsevier Science Publishing Company, New York.

Harvell, C. D., K. Kim, J. M. Burkholder, R. R. Colwell, P. R. Epstein, D. J. Grimes, E. E.
Hofmann, E. K. Lipp, A. D. Osterhaus, R. M. Overstreet, J. W. Porter, G. W. Smith, and
G. R. Vasta. 1999. Emerging marine diseases--climate links and anthropogenic factors.
Science 285: 1505-1510.

Heeb, S., and D. Haas. 2001. Regulatory roles of the GacS/GacA two-component system in
plant- associated and other gram-negative bacteria. Mol Plant Microbe Interact 14:1351-
1363.

Heeb, S., S. A. Kuehne, M. Bycroft, S. Crivii, M. D. Allen, D. Haas, M. Camara, and P.
Williams. 2006. Functional analysis of the post-transcriptional regulator RsmA reveals a
novel RNA-binding site. J Mol Biol 355: 1026-103 6.

Heyward, A. J., and A. P. Negri. 1999. Natural inducers for coral larval metamorphosis. Coral
Reefs 18:273-279.

Hill, G. T., N. A. Mitkowski, L. Aldrich-Wolfe, L. R. Emele, D. D. Jurkonie, A. Ficke, S.
Maldonado-Ramirez, S. T. Lynch, and E. B. Nelson. 2000. Methods for assessing the
composition and diversity of soil microbial communities. Applied Soil Ecology 15:25-36.

Hoegh-Guldberg, O. 1999. Climate change, coral bleaching and the future of the world's coral
reefs. Marine and Freshwater Research 50:839-866.










Holling, C. S. 1996. Engineering resilience versus ecological resilience. Pages 31-43 in P. C.
Schulze, editor. Engineering Withing Ecological Constraints. National Academy Press.

Howarth, R., D. Anderson, J. Cloern, C. Elfring, C. Hopkinson, B. Lapointe, N. Malone, K.
McGlathery, A. Sharpley, and D. Walker. 2000. Nutrient pollution of coastal rivers, bays,
and seas. Issues Ecol 7:1-15.

Huang, Y.-L., S. Dobretsov, H. Xiong, and P.-Y. Qian. 2007. Effect of Biofilm Formation by
Pseudoalteromonas spongiae on Induction of Larval Settlement of the Polychaete
Hydroides elegans. Appl Environ Microbiol 73:6284-6288.

Hueck, C. J. 1998. Type III Protein Secretion Systems in Bacterial Pathogens of Animals and
Plants. Microbiol Mol Biol Rev 62.

Huggett, M. J., J. E. Williamson, R. de Nys, S. Kjelleberg, and P. D. Steinberg. 2006. Larval
settlement of the common Australian sea urchin Heliocidaris erythrogramma in response
to bacteria from the surface of coralline algae. Oecologia 149:604-619.

Hughes, T. P., A. H. Baird, D. R. Bellwood, M. Card, S. R. Connolly, C. Folke, R. Grosberg, O.
Hoegh-Guldberg, J. B. Jackson, J. Kleypas, J. M. Lough, P. Marshall, M. Nystrom, S. R.
Palumbi, J. M. Pandolfi, B. Rosen, and J. Roughgarden. 2003. Climate change, human
impacts, and the resilience of coral reefs. Science 301:929-933.

Hussa, E. A., T. M. O'Shea, C. L. Darnell, E. G. Ruby, and K. L. Visick. 2007. Two-Component
Response Regulators of Vibrio fischeri: Identification, Mutagenesis, and
Characterization. J Bacteriol 189:5825-5838.

Hwang, I., P. L. Li, L. Zhang, K. R. Piper, D. M. Cook, M. E. Tate, and S. K. Farrand. 1994.
Tral, a Luxl homologue, is responsible for production of conjugation factor, the Ti
plasmid N-acylhomoserine lactone autoinducer. Proc Natl Acad Sci U SA 91:4639-4643.

Inoue, H., H. Nojima, and H. Okayama. 1990. High efficiency transformation of Escherichia coli
with plasmids. Gene 96:23-28.

Jackson, D. W., J. W. Simecka, and T. Romeo. 2002. Catabolite repression of Escherichia coli
biofilm formation. J Bacteriol 184:3406-3410.

Johns, G. M., V. R. Leeworthy, F. W. Bell, M. A. Bonn, F. S. U. a. N. in association with Hazen
and Sawyer Environmental Engineers and Scientists, and G. P. Yang. 2001.
Socioeconomic study of reefs in southeast Florida. Page 348 in P. B. C. Broward County,
Miami-Dade County, Monroe County, Florida Fish and Wildlife Conservation
Commission, National Oceanic and Atmospheric Administration, editor. Hazen and
Sawyer, PC.

Karlson, R. H. 1999. Dynamics of Coral Communities. Kluwer Academic Publishers, Boston.










Kay, E., C. Dubuis, and D. Haas. 2005. Three small RNAs jointly ensure secondary metabolism
and biocontrol in Pseudomonas fluorescens CHA0. Proc Natl Acad Sci US A
102:17136-17141.

Kempf, S. C. 1991. A "primitive" symbiosis between the aeolid nudibranch Berghia
verrucicornis (A. Costa, 1867) and a zooxanthella. J Molluscan Stud 57:75-85.

Kitamura, H., S. Kitahara, and H. B. Koh. 1993. The induction of larval settlement and
metamorphosis of two sea urchins, Pseudocentrotus depressus and Anthocidaris
crassispina, by free fatty acids extracted from the coralline red alga Corallina pilulifera.
Marine Biology 115:387-392.

Kitamura, M., T. Koyama, Y. Nakano, and D. Uemura. 2007. Characterization of a natural
inducer of coral larval metamorphosis. Journal of Experimental Marine Biology and
Ecology 340:96-102.

Kjelleberg, S., P. Steinberg, M. Givskov, L. Gram, M. Manefield, and R. deNys. 1997. Do
marine natural products interfere with prokaryotic AHL regulatory systems? Aquatic
Microbial Ecology 13:85-93.

Knowlton, N., and F. Rohwer. 2003. Multispecies Microbial Mutualisms on Coral Reefs: The
Host as a Habitat. The American Naturalist 162:S51-S62.

Koehl, M. A. R., and M. G. Hadfield. 2004. Soluble settlement cue in slowly moving water
within coral reefs induces larval adhesion to surfaces. Journal of Marine Systems 49:75-
88.

Konopka, A., L. Oliver, and R. F. Turco Jr. 1998. The use of carbon substrate utilization patterns
in environmental and ecological microbiology. Microb Ecol 35:103-115.

Kooperman, N., E. Ben-Dov, E. Kramarsky-Winter, Z. Barak, and A. Kushmaro. 2007. Coral
mucus-associated bacterial communities from natural and aquarium environments. FEMS
Microbiol Lett 276:106-113.

Kuffner, I. B., L. J. Walters, M. A. Becerro, V. J. Paul, R. Ritson-Williams, and K. S. Beach.
2006. Inhibition of coral recruitment by macroalgae and cyanobacteria. Mar Ecol Prog
Ser 323: 107-117.

Kurz, C. L., S. Chauvet, E. Andres, M. Aurouze, I. Vallet, G. P. Michel, M. Uh, J. Celli, A.
Filloux, S. De Bentzmann, I. Steinmetz, J. A. Hoffmann, B. B. Finlay, J. P. Gorvel, D.
Ferrandon, and J. J. Ewbank. 2003. Virulence factors of the human opportunistic
pathogen Serratia marcescens identified by in vivo screening. Embo J 22: 1451-1460.

Kurz, C. L., and J. J. Ewbank. 2000. Caenorhabditis elegans for the study of host-pathogen
interactions. Trends Microbiol 8:142-144.










Kwon, O., D. Georgellis, and E. C. C. Lin. 2000. Phosphorelay as the Sole Physiological Route
of Signal Transmission by the Arc Two-Component System of Escherichia coli. J
Bacteriol 182:3858-3862.

Lapointe, B. E., P. J. Barile, and W. R. Matzie. 2004. Anthropogenic nutrient enrichment of
seagrass and coral reef communities in the Lower Florida Keys: discrimination of local
versus regional nitrogen sources. Journal of Experimental Marine Biology and Ecology
308:23-58.

Lapointe, B. E., and M. W. Clark. 1992. Nutrient Inputs from the Watershed and Coastal
Eutrophication in the Florida Keys. Estuaries 15:465-476.

Lapouge, K., M. Schubert, F. H. T. Allain, and D. Haas. 2008. Gac/Rsm signal transduction
pathway of y-proteobacteria: from RNA recognition to regulation of social behaviour.
Molecular Microbiology 67:241-253.

Laux, D. C., P. S. Cohen, and T. Conway. 2005. Role of the mucus layer in bacterial
colonization of the intestine.in J. P. Nataro, P. S. Cohen, H. L. T. Mobley, and J. N.
Weiser, editors. Colonization of Mucosal Surfaces. ASM Press, Washington, D.C.

Lawhon, S. D., R. Maurer, M. Suyemoto, and C. Altier. 2002. Intestinal short-chain fatty acids
alter Salmonella typhimurium invasion gene expression and virulence through
BarA/SirA. Mol Microbiol 46: 1451-1464.

Lenz, D. H., M. B. Miller, J. Zhu, R. V. Kulkarni, and B. L. Bassler. 2005. CsrA and three
redundant small RNAs regulate quorum sensing in Vibrio cholerae. Molecular
Microbiology 58:1186-1202.

Lertcanawanichakul, M., C. Wiwat, A. Bhumiratana, and D. H. Dean. 2004. Expression of
chitinase-encoding genes in Bacillus thuringiensis and toxicity of engineered B.
thuringiensis subsp. aizawai toward Lymantria dispar larvae. Curr Microbiol 48:175-181.

Lesser, M. P., J. C. Bythell, R. D. Gates, R. W. Johnstone, and O. Hoegh-Guldberg. 2007. Are
infectious diseases really killing corals? Alternative interpretations of the experimental
and ecological data. J Exp Mar Biol Ecol 346:36-44.

Lipp, E. K., and D. W. Griffin. 2004. Analysis of coral mucus as an improved medium for
detection of enteric microbes and for determining patterns of sewage contamination in
reef environments. EcoHealth 1:.3 17-323 .

Lipp, E. K., J. L. Jarrell, D. W. Griffin, J. Lukasik, J. Jacukiewicz, and J. B. Rose. 2002.
Preliminary evidence for human fecal contamination in corals of the Florida Keys, USA.
Mar Pollut Bull 44:666-670.

Lucas, J. S. 1994. The biology, exploitation, and mariculture of giant clams (Trinacnidae). Rev
Fish Sci 2:181-224.










Luna, G. M., F. Biavasco, and R. Danovaro. 2007. Bacteria associated with the rapid tissue
necrosis of stony corals. Environ Microbiol 9:1851-1857.

Mahajan-Miklos, S., L. G. Rahme, and F. M. Ausubel. 2000. Elucidating the molecular
mechanisms of bacterial virulence using non-mammalian hosts. Mol Microbiol 37:981-
988.

Maris, A. E., M. Kaczor-Grzeskowiak, Z. Ma, M. L. Kopka, R. P. Gunsalus, and R. E.
Dickerson. 2005. Primary and secondary modes of DNA recognition by the NarL two-
component response regulator. Biochemistry 44:14538-14552.

Meikle, P., G. N. Richards, and D. Yellowlees. 1988. Structural investigations on the mucus
from six species of coral. Marine Biology 99: 187-193.

Miller, J. H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY.

Miller, M. B., and B. L. Bassler. 2001. Quorum sensing in bacteria. Annu Rev Microbiol 55:165-
199.

Minton, D., and I. Lundgren. 2006. Coral recruitment and sedimentation in Asan Bay and War in
the Pacific NHP, Guam.

Miyada, C. G., L. Stoltzfus, and G. Wilcox. 1984. Regulation of the araC gene of Escherichia
coli: catabolite repression, autoregulation, and effect on araBAD expression. Proc Natl
Acad Sci U SA 81:4120-4124.

Mohamed, N. M., E. M. Cicirelli, J. Kan, F. Chen, C. Fuqua, and R. T. Hill. 2008. Diversity and
quorum-sensing signal production of Proteobacteria associated with marine sponges.
Environ Microbiol 10:75-86.

Mora, C. 2008. A clear human footprint in the coral reefs of the Caribbean. Proc Biol Sci
275:767-773.

Morse, A. N. C., K. Iwao, M. Baba, K. Shimoike, T. Hayashibara, and M. Omori. 1996. An
ancient chemosensory mechanism brings new life to coral reefs. Biological Bulletin
191:149-154.

Morse, D. E., N. Hooker, A. N. C. Morse, and R. A. Jensen. 1988. Control of larval
metamorphosis and recruitment in sympatric agariciid corals. J Exp Mar Biol Ecol
116:193-217.

Morse, D. E., A. N. C. Morse, P. T. Raimondi, and N. Hooker. 1994. Morphogen-Based
Chemical Flypaper for Agaricia-Humilis Coral Larvae. Biological Bulletin 186:172-181.

Muller-Parker, G., and C. F. D'Elia. 1997. Interactions between corals and their symbiotic algae.
Pages 96-1 13 in C. Birkeland, editor. Life and Death of Coral Reefs. International
Thomson Publishing, New York.










Mumby, P. J., A. R. Harborne, J. Williams, C. V. Kappel, D. R. Brumbaugh, F. Micheli, K. E.
Holmes, C. P. Dahlgren, C. B. Paris, and P. G. Blackwell. 2007a. Trophic cascade
facilitates coral recruitment in a marine reserve. Proc Natl Acad Sci U SA 104:8362-
8367.

Mumby, P. J., A. Hastings, and H. J. Edwards. 2007b. Thresholds and the resilience of
Caribbean coral reefs. Nature 450:98-101.

Munoz-Elias, E. J., and J. D. McKinney. 2006. Carbon metabolism of intracellular bacteria. Cell
Microbiol 8:10-22.

Muscatine, L., and J. W. Porter. 1977. Reef Corals: Mutualistic Symbioses Adapted to Nutrient-
Poor Environments. BioScience 27:454-460.

Negri, A. P., N. S. Webster, R. T. Hill, and A. J. Heyward. 2001. Metamorphosis of broadcast
spawning corals in response to bacteria isolated from crustose algae. Mar Ecol Prog Ser
223:121-131.

Neiditch, M. B., M. J. Federle, A. J. Pompeani, R. C. Kelly, D. L. Swem, P. D. Jeffrey, B. L.
Bassler, and F. M. Hughson. 2006. Ligand-induced asymmetry in histidine sensor kinase
complex regulates quorum sensing. Cell 126:1095-1108.

Newton, J. A., and R. G. Fray. 2004. Integration of environmental and host-derived signals with
quorum sensing during plant-microbe interactions. Cell Microbiol 6:213-224.

Nobles, R. E., P. Brown, J. B. Rose, and E. K. Lipp. 2000. The investigation and analysis of
swimming-associated illness using the fecal indicator enterococcus in southern Florida's
marine waters. Florida J Eny Health 169:15-19.

Nogami, K., K. Hamasaki, M. Maeda, and K. Hirayama. 1997. Biocontrol method in aquaculture
for rearing the swimming crab larvae Portunus trituberculatus. Hydrobiologia 358:291-
295.

Norstroim, A., J. Lokrantz, M. Nystroim, and H. Yap. 2007. Influence of dead coral substrate
morphology on patterns of juvenile coral distribution. Marine Biology 150:1145-1152.

Nystrom, M., C. Folke, and F. Moberg. 2000. Coral reef disturbance and resilience in a human-
dominated environment. Trends in Ecology & Evolution 15:413-417.

Ovadis, M., X. Liu, S. Gavriel, Z. Ismailov, I. Chet, and L. Chernin. 2004. The Global Regulator
Genes from Biocontrol Strain Serratia plymuthica IC1270: Cloning, Sequencing, and
Functional Studies. J Bacteriol 186:4986-4993.

Pandolfi, J. M., R. H. Bradbury, E. Sala, T. P. Hughes, K. A. Bjorndal, R. G. Cooke, D.
McArdle, L. McClenachan, M. J. H. Newman, G. Paredes, R. R. Warner, and J. B. C.
Jackson. 2003. Global Traj ectories of the Long-Term Decline of Coral Reef Ecosystems.
Science 301:955-958.










Parkins, M. D., H. Ceri, and D. G. Storey. 2001. Pseudomonas aeruginosa GacA, a factor in
multihost virulence, is also essential for bioailm formation. Mol Microbiol 40:1215-1226.

Patterson, K. L., J. W. Porter, K. B. Ritchie, S. W. Poison, E. Mueller, E. C. Peters, D. L.
Santavy, and G. W. Smith. 2002. The etiology of white pox, a lethal disease of the
Caribbean elkhorn coral, Acropora palmata. Proc Natl Acad Sci U SA 99:8725-8730.

Patton, J. S., S. Abraham, and A. A. Benson. 1977. Lipogenesis in the intact coral Pocillopora
clapitata and its isolated zooxanthellae: evidence for a light-driven carbon cycle between
symbiont and host. Marine Biology 44:235-247.

Paul, J. H., M. R. McLaughlin, D. W. Griffin, E. K. Lipp, R. Stokes, and J. B. Rose. 2000. Rapid
movement of wastewater from on-site disposal systems into surface waters in the lower
Florida Keys. Estuaries 23:662-668.

Pearson, J. P., and I. A. Brownlee. 2005. Structure and function of mucosal surfaces.in J. P.
Nataro, P. S. Cohen, H. L. T. Mobley, and J. N. Weiser, editors. Colonization of Mucosal
Surfaces. ASM Press, Washington, D.C.

Perez-Rosas, N., and T. C. Hazen. 1988. In situ survival of Vibrio cholerae and Escherichia coli
in tropical coral reefs. Appl Environ Microbiol 54:1-9.

Perez, S., M. Kouwijzer, K. Mazeau, and S. B. Engelsen. 1996. Modeling polysaccharides:
Present status and challenges. Journal of Molecular Graphics 14:307-321.

Pernestig, A. K., D. Georgellis, T. Romeo, K. Suzuki, H. Tomenius, S. Normark, and O.
Melefors. 2003. The Escherichia coli BarA-UvrY two-component system is needed for
efficient switching between glycolytic and gluconeogenic carbon sources. J Bacteriol
185:843-853.

Pernestig, A. K., O. Melefors, and D. Georgellis. 2001. Identification of UvrY as the cognate
response regulator for the BarA sensor kinase in Escherichia coli. J Biol Chem 276:225-
231.

Perraud, A.-L., K. Rippe, M. Bantscheff, M. Glocker, M. Lucassen, K. Jung, W. Sebald, V.
Weiss, and R. Gross. 2000. Dimerization of signalling modules of the EvgAS and BvgAS
phosphorelay systems. Biochimica et Biophysica Acta (BBA) Protein Structure and
Molecular Enzymology 1478:341-354.

Persson, T., M. Givskov, and J. Nielsen. 2005. Quorum sensing inhibition: targeting chemical
communication in gram-negative bacteria. Curr Med Chem 12:3103-3115.

Phillips, D. A., C. M. Joseph, G. P. Yang, E. Martinez-Romero, J. R. Sanborn, and H. Volpin.
1999. Identification of lumichrome as a sinorhizobium enhancer of alfalfa root respiration
and shoot growth. Proc Natl Acad Sci U SA 96:12275-12280.










Preston-Mafham, J., L. Boddy, and P. F. Randerson. 2002. Analysis of microbial community
functional diversity using sole-carbon-source utilisation profiles a critique. FEMS
Microbiolgy Ecology 42:1-14.

Pugsley, A. P. 1993. The complete general secretary pathway in gram-negative bacteria.
Microbiological Reviews 57:50-108.

Queck, S. Y., M. Weitere, A. M. Moreno, S. A. Rice, and S. Kjelleberg. 2006. The role of
quorum sensing mediated developmental traits in the resistance of Serratia marcescens
biofilms against protozoan grazing. Environ Microbiol 8:1017-1025.

Raaijmakers, J. M., M. Vlami, and J. T. de Souza. 2002. Antibiotic production by bacterial
biocontrol agents. Antonie Van Leeuwenhoek 81:537-547.

Rahme, L. G., F. M. Ausubel, H. Cao, E. Drenkard, B. C. Goumnerov, G. W. Lau, S. Mahajan-
Miklos, J. Plotnikova, M. W. Tan, J. Tsongalis, C. L. Walendziewicz, and R. G.
Tompkins. 2000. Plants and animals share functionally common bacterial virulence
factors. Proc Natl Acad Sci U SA 97:8815-8821.

Rahme, L. G., E. J. Stevens, S. F. Wolfort, J. Shao, R. G. Tompkins, and F. M. Ausubel. 1995.
Common virulence factors for bacterial pathogenicity in plants and animals. Science
268:1899-1902.

Rasmussen, T. B., and M. Givskov. 2006. Quorum sensing inhibitors: a bargain of effects.
Microbiology-Sgm 152:895-904.

Rasmussen, T. B., M. Manefield, J. B. Andersen, L. Eberl, U. Anthoni, C. Christophersen, P.
Steinberg, S. Kjelleberg, and M. Givskov. 2000. How Delisea pulchra furanones affect
quorum sensing and swarming motility in Serratia liquefaciens MGl. Microbiology 146
Pt 12:3237-3244.

Reshef, L., O. Koren, Y. Loya, I. Zilber-Rosenberg, and E. Rosenberg. 2006. The coral probiotic
hypothesis. Environ Microbiol 8:2068-2073.

Reverchon, S., D. Expert, J. Robert-Baudouy, and W. Nasser. 1997. The cyclic AMP receptor
protein is the main activator of pectinolysis genes in Erwinia chrysanthemi. J Bacteriol
179:3500-3508.

Richardson, L. L. 1998. Coral diseases: what is really known? Trends in Ecology & Evolution
13:438-443.

Richardson, L. L., W. M. Goldberg, K. G. Kuta, R. B. Aronson, G. W. Smith, K. B. Ritchie, J. C.
Halas, J. S. Feingold, and S. L. Miller. 1998. Florida mystery coral-killer identified.
Nature 392:557-558.

Richardson, L. L., and K. G. Kuta. 2003. Ecological physiology of the black band disease
cyanobacterium Phormidium corallyticum. FEMS Microbiol Ecol 43:287-298.










Richardson, L. L., K. G. Kuta, S. Schnell, and R. G. Carlton. 1997. Ecology of the black band
disease microbial consortium. Proc 8th Int Coral Reef Symp Balboa 1:597-600.

Richman, S., Y. Loya, and L. B. Slobodkin. 1975. The rate of mucus production by corals and its
assimilation by the coral reef copepod Acartia negligens. Limnology and Oceanography
20:918-923.

Rinaldi, M. G. 1983. Invasive aspergillosis. Rev Infect Dis 5:1061-1077.

Ritchie, K. B. 2006. Regulation of microbial populations by coral surface mucus and mucus-
associated bacteria. Marine Ecology-Progress Series 322:1-14.

Ritchie, K. B., R. A. Holley, T. McGrath, and G. W. Smith. 1996. INT-linked dehydrogenase
activity in the surface mucopolysaccharide layers of Bahamian scleractinian corals. Proc
Symp Nat Hist Bahamas 6:18-27.

Ritchie, K. B., S. W. Poison, and G. W. Smith. 2001. Microbial disease causation in marine
invertebrates: problems, practices, and future prospects. Hydrobiologia 460:131-139.

Ritchie, K. B., and G. W. Smith. 2004. Microbial communities of coral surface
mucopolysaccharide layers. Pages 259-264 in E. Rosenberg and Y. Loya, editors. Coral
health and diseases. Springer-Verlag, New York.

Robinson, V. L., D. R. Buckler, and A. M. Stock. 2000. A tale of two components: a novel
kinase and a regulatory switch. Nat Struct Mol Biol 7:626-633.

Rohwer, F., V. Seguritan, F. Azam, and N. Knowlton. 2002. Diversity and distribution of coral-
associated bacteria. Mar Ecol Prog Ser 243:1-10.

Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding
RNA molecule CsrB. Mol Microbiol 29: 1321-1330.

Rosenberg, E., and Y. Ben-Haim. 2002. Microbial diseases of corals and global warming.
Environ Microbiol 4:318-326.

Rosenberg, E., and L. Falkovitz. 2004. The Vibrio shiloi/Oculina patagonica model system of
coral bleaching. Annu Rev Microbiol 58:143-159.

Rosenberg, E., O. Koren, L. Reshef, R. Efrony, and I. Zilber-Rosenberg. 2007. The role of
microorganisms in coral health, disease and evolution. Nat Rev Microbiol 5:355-362.

Ryan, J. C. 2001. The Caribbean gets dusted: spores and nutrients from Africa's Sahel may be
killing coral reefs and ocean away. BioScience 51:334-338.

Saleh, S. S., and B. R. Glick. 2001. Involvement of gacS and rpoS in enhancement of the plant
growth-promoting capabilities of Enterobacter cloacae CAL2 and UW4. Can J Microbiol
47:698-705.










Sambrook, J., and D. W. Russell. 2001. Molecular Cloning: A laboratory manual. Third edition.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Sapp, J. 1999. White is Natural? Coral Reef Crisis. Oxford University Press, New York.

Schmitz, G., and V. Braun. 1985. Cell-bound and secreted proteases of Serratia marcescens. J
Bacteriol 161:1002-1009.

Schulenburg, H., and J. J. Ewbank. 2004. Diversity and specificity in the interaction between
Caenorhabditis elegans and the pathogen Serratia marcescens. BMC Evol Biol 4:49.

Secord, D., and L. Augustine. 2000. Biogeography and microhabitat variation in temperate algal-
invertebrate symbioses: zooxanthellae and zoochlorellae in two Pacific intertidal sea
anemones, Anthopleura elegan2tissima and A. xanthogramnmica. Invertebrate Biology
119:139-146.

Seurinck, S., W. Verstraete, and S. Siciliano. 2005. Microbial Source Tracking for Identification
of Fecal Pollution. Reviews in Environmental Science and Biotechnology 4: 19-37.

Sexton, A. C., and B. J. Howlett. 2006. Parallels in fungal pathogenesis on plant and animal
hosts. Eukaryot Cell 5:1941-1949.

Sharon, G., and E. Rosenberg. 2008. Bacterial Growth on Coral Mucus. Curr Microbiol 56:481-
488.

Shaw, P. D., G. Ping, S. L. Daly, C. Cha, J. E. Cronan, Jr., K. L. Rinehart, and S. K. Farrand.
1997. Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-
layer chromatography. Proc Natl Acad Sci U SA 94:6036-6041.

Shinn, E. A., G. W. Smith, J. M. Prospero, P. Better, M. L. Hayes, V. H. Garrison, and R. T.
Barber. 2000. African dust and the demise of Caribbean coral reefs. Geophysical
Research Letters 27:3029-3032.

Smith, G. W., C. D. Harvell, and K. Kim. 1998. Response of sea fans to infection with
Aspergillus sp. (Fungi). Rev Biol Trop 46:205-208.

Smith, G. W., and S. S. Hayasaka. 1982. Nitrogenase activity associated with Zostera marina
from a North Carolina estuary. Can J Microbiol 28:448-451.

Smith, G. W., A. M. Kozuchi, and S. S. Hayasaka. 1982. Heavy metal sensitivity of seagrass
bacteria. Botanica Marina XXV: 19-24.

Smith, J. G., J. A. Latiolais, G. P. Guanga, J. D. Pennington, R. E. Silversmith, and R. B.
Bourret. 2004. A search for amino acid substitutions that universally activate response
regulators. Molecular Microbiology 51:887-901.










Soo, P. C., J. R. Wei, Y. T. Horng, S. C. Hsieh, S. W. Ho, and H. C. Lai. 2005. Characterization
of the dapA-nlpB genetic locus involved in regulation of swarming motility, cell
envelope architecture, hemolysin production, and cell attachment ability in Serratia
marcescens. Infect Immun 73:6075-6084.

Stanley, G. D., and P. K. Swart. 1995. Evolution of the coral-zooxanthellae symbiosis during the
Triassic: a geochemical approach. Paleobiology 21:179-199.

Staskawicz, B., D. Dahlbeck, N. Keen, and C. Napoli. 1987. Molecular characterization of
cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae py. glycinea. J
Bacteriol 169:5789-5794.

Stone, L., A. Huppert, B. Rajagopalan, H. Bhasin, and Y. Loya. 1999. Mass coral reef bleaching:
a recent outcome of increased El Nifio Activity? Ecology Letters 2:325-330.

Storz, G., and D. Haas. 2007. A guide to small RNAs in microorganisms. Current Opinion in
Microbiology 10:93-95.

Sutherland, K. P., J. W. Porter, and C. Torres. 2004. Disease and immunity in Caribbean and
Indo-Pacific zooxanthellate corals. Marine Ecology-Progress Series 266:273-302.

Sutherland, K. P., and K. B. Ritchie. 2004. White pox disease of the Caribbean Elkhorn coral,
Acropora palmata. Pages 289-297 in E. Rosenberg and Y. Loya, editors. Coral Health
and Disease. Springer Verlag, Berlin.

Suzuki, K., X. Wang, T. Weilbacher, A. K. Pernestig, O. Melefors, D. Georgellis, P. Babitzke,
and T. Romeo. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of
Escherichia coli. J Bacteriol 184:5130-5140.

Szmant, A. 2002. Nutrient enrichment on coral reefs: Is it a maj or cause of coral reef decline?
Estuaries and Coasts 25:743-766.

Tan, B., T. A. Jackson, and M. R. Hurst. 2006. Virulence of Serratia strains against Costelytra
zealandica. Appl Environ Microbiol 72:6417-6418.

Tan, M. W., L. G. Rahme, J. A. Sternberg, R. G. Tompkins, and F. M. Ausubel. 1999.
Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P. aeruginosa
virulence factors. Proc Natl Acad Sci U SA 96:2408-2413.

Taylor, M. W., P. J. Schupp, H. J. Baillie, T. S. Charlton, R. de Nys, S. Kjelleberg, and P. D.
Steinberg. 2004. Evidence for acyl homoserine lactone signal production in bacteria
associated with marine sponges. Appl Environ Microbiol 70:43 87-43 89.

Templeton, A. R. 2007. Shared history of humans and gut bacteria: Evolutionary togetherness:
coupled evolution of humans and a pathogen. Heredity 98:337-338.










Teplitski, M., and B. M. M. Ahmer. 2005. The control of secondary metabolism, motility, and
virulence by the two-component regulatory system BarA/SirA of Salmonella and other y-
proteobacteria. Global Regulatory Networks in Enteric Bacteria: 107-132.

Teplitski, M., R. I. Goodier, and B. M. Ahmer. 2006. Catabolite repression of the SirA
regulatory cascade in Salmonella enterica. Int J Med Microbiol 296:449-466.

Tomenius, H., A. K. Pernestig, C. F. Mendez-Catala, D. Georgellis, S. Normark, and O.
Melefors. 2005. Genetic and functional characterization of the Escherichia coli BarA-
UvrY two-component system: point mutations in the HAMP linker of the BarA sensor
give a dominant-negative phenotype. J Bacteriol 187:7317-7324.

Toren, A., L. Landau, A. Kushmaro, Y. Loya, and E. Rosenberg. 1998. Effect of Temperature on
Adhesion of Vibrio Strain AK-1 to Oculina patagonica and on Coral Bleaching. Appl
Environ Microbiol 64: 13 79-13 84.

Tortora, G. J., B. R. Funke, and C. L. Case. 2002. Microbiology. 7th edition. Benjamin
Cummings, New York.

Travis, J., J. Potempa, and H. Maeda. 1995. Are bacterial proteinases pathogenic factors? Trends
Microbiol 3:405-407.

Travis, J. M., R. W. Brooker, E. J. Clark, and C. Dytham. 2006. The distribution of positive and
negative species interactions across environmental gradients on a dual-lattice model. J
Theor Biol 241:896-902.

Tsukamoto, S. 1999. Marine natural products influencing larval settlement and metamorphosis of
marine sessile organisms. Yakugaku Zasshi 119:457-471.

Tsukamoto, S., H. Kato, H. Hirota, and N. Fusetani. 1999. Lumichrome. A larval
metamorphosis s-inducing sub stance in the ascidian Hhalocynthia roretzi. Eur J Biochem
264:785-789.

Uzoigwe, J. C., E. H. O'Brien, and E. J. Brown. 2007. Using nutrient utilization patterns to
determine the source of Escherichia coli found in surface water. African Journal of
Environmental Science and Technology 1:7-13.

Ventre, I., A. L. Goodman, I. Vallet-Gely, P. Vasseur, C. Soscia, S. Molin, S. Bleves, A.
Lazdunski, S. Lory, and A. Filloux. 2006. Multiple sensors control reciprocal expression
of Pseudomonas aeruginosa regulatory RNA and virulence genes. PNAS 103:171-176.

Verdugo, P. 1990. Goblet cells secretion and mucogenesis. Annu Rev Physiol 52:157-176.

Virji, M. 2005. Bacterial adherence and tropism in the human respiratory tract.in J. P. Nataro, P.
S. Cohen, H. L. T. Mobley, and J. N. Weiser, editors. Colonization of Mucosal Surfaces.
ASM Press, Washington, D.C.










Vollmer, S. V., and S. R. Palumbi. 2007. Restricted Gene Flow in the Caribbean Staghorn Coral
Acropora cervicornis: Implications for the Recovery of Endangered Reefs. J Hered
98:40-50.

Wagele, H., and G. Johnsen. 2001. Observations on the histology and photosynthetic
performance of "solar-powered" opisthobranchs (Mollusca, Gastropoda,
Opisthobranchia) containing symbiotic chloroplasts or zooxanthellae. Org. Divers. Evol.
1:193-210.

Wagner-Dobler, I., V. Thiel, L. Eberl, M. Allgaier, A. Bodor, S. Meyer, S. Ebner, A. Hennig, R.
Pukall, and S. Schulz. 2005. Discovery of complex mixtures of novel long-chain quorum
sensing signals in free-living and host-associ ated marine alphaproteob acteri a.
Chembiochem 6:2195-2206.

Wallentinus, I., and C. D. Nyberg. 2007. Introduced marine organisms as habitat modifiers.
Marine Pollution Bulletin 55:323-332.

Walther, G. R., E. Post, P. Convey, A. Menzel, C. Parmesan, T. J. Beebee, J. M. Fromentin, O.
Hoegh-Guldberg, and F. Bairlein. 2002. Ecological responses to recent climate change.
Nature 416:389-395.

Ward, J. R., and K. D. Lafferty. 2004. The elusive baseline of marine disease: are diseases in
ocean ecosystems increasing? PLoS Biol 2:E120.

Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria.
Annu Rev Cell Dev Biol 21:319-346.

Webster, N. S., L. D. Smith, A. J. Heyward, J. E. Watts, R. I. Webb, L. L. Blackall, and A. P.
Negri. 2004. Metamorphosis of a scleractinian coral in response to microbial bioailms.
Appl Environ Microbiol 70:1213-1221.

Wegley, L., R. Edwards, B. Rodriguez-Brito, H. Liu, and F. Rohwer. 2007. Metagenomic
analysis of the microbial community associated with the coral Porites astreoides. Environ
Microbiol 9:2707-2719.

Wei, J. R., and H. C. Lai. 2006. N-acylhomoserine lactone-dependent cell-to-cell communication
and social behavior in the genus Serratia. Int J Med Microbiol 296:117-124.

Weil, E., G. Smith, and D. L. Gil-Agudelo. 2006. Status and progress in coral reef disease
research. Dis Aquat Organ 69:1-7.

West, S. A., S. P. Diggle, A. Buckling, A. Gardner, and A. S. Griffin. 2007. The Social Lives of
Microbes. Annu Rev Ecol Evol Syst 38:53-77.

Western, D. 2001. Human-modified ecosystems and future evolution. Proc Natl Acad Sci US A
98:5458-5465.










Whipps, J. M. 2001. Microbial interactions and biocontrol in the rhizosphere. J Exp Bot 52:487-
511.

Whistler, C. A., T. A. Koropatnick, A. Pollack, M. J. McFall-Ngai, and E. G. Ruby. 2007. The
GacA global regulator of Vibrio fischeri is required for normal host tissue responses that
limit subsequent bacterial colonization. Cell Microbiol 9:766-778.

Whistler, C. A., and E. G. Ruby. 2003. GacA regulates symbiotic colonization traits of Vibrio
fischeri and facilitates a beneficial association with an animal host. J Bacteriol 185:7202-
7212.

Wild, C., M. Huettel, A. Klueter, S. G. Kremb, M. Y. Rasheed, and B. B. Jorgensen. 2004. Coral
mucus functions as an energy carrier and particle trap in the reef ecosystem. Nature
428:66-70.

Wilson, R. A., and J. Q. Wilson. 1985. Watching Fishes: Life and Behavior on Coral Reefs.
Harper & Row, New York.

Wolanski, E., editor. 2001. Oceanographic Processes of Coral Reefs: Physical and Biological
Links in the Great Barrier Reef. CRC Press, New York.

Young, G. M., D. H. Schmiel, and V. L. Miller. 1999. A new pathway for the secretion of
virulence factors by bacteria: the flagellar export apparatus functions as a protein-
secretion system. Proc Natl Acad Sci U SA 96:6456-6461.

Zhang, L. H., and Y. H. Dong. 2004. Quorum sensing and signal interference: diverse
implications. Molecular Microbiology 53:1563-1571.

Zuber, S., F. Carruthers, C. Keel, A. Mattart, C. Blumer, G. Pessi, C. Gigot-Bonnefoy, U.
Schnider-Keel, S. Heeb, C. Reimmann, and D. Haas. 2003. GacS Sensor Domains
Pertinent to the Regulation of Exoproduct Formation and to the Biocontrol Potential of
Pseudomonas fluorescens CHA0. Molecular Plant-Microbe Interactions 16:634-644.









BIOGRAPHICAL SKETCH

Cory Jon Krediet was born in 1984, in Oklahoma City, Oklahoma. The older of two

children, he grew up in Chicago, Illinois, graduating from Glenbard North High School in 2002.

He earned his B.A. in biology and German from Drew University in 2006, graduating summa

cum laud'e and with specialized honors in biology.

During his undergraduate career, Cory conducted original research as part of a Research

Experience for Undergraduates (REU) program sponsored by the National Science Foundation.

Working at Shoals Marine Laboratory in the Gulf of Maine, he investigated growth and mortality

trade-offs along a depth gradient in the Jonah crab, Cancer borealis. That project developed into

an honor' s thesis proj ect at Drew Univeristy. Cory's undergraduate experiences also led him to

study coral ecology in the Egyptian Red Sea and Belize.

Upon completion of his M. S. program, Cory will continue at the University of Florida for

his Ph.D., working with Dr. Max Teplitski to further elucidate the genetic and regulatory

pathways that allow Serratia marcescens to colonize and infect elkhorn coral, Acropora palmata.





PAGE 1

1 INTER-KINGDOM SIGNALING AND CHARACTERIZATION OF A CORAL WHITE POX PATHOGEN, Serratia marcescens By CORY J. KREDIET A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Cory J. Krediet

PAGE 3

3 To my parents, who have always supported my academic and personal endeavors and have made this achievement possible

PAGE 4

4 ACKNOWLEDGMENTS I thank m y supervisory committee chair and members for their mentoring and research support. I thank the members of my lab, especi ally Dr. Mengsheng Gao for her mentoring and research guidance. I also thank Dr. Matt Cohen for valuable statistical analysis and Dr. Erin Lipp for the use of environmental isolates of Serratia marcescens collected from the Florida Keys. Support for this research is recognized from National Geographi c Society Committee for Exploration and Research, Lindbergh Foundation, Protect Our R eefs, UF-IFAS SNRE and UFIFAS SWSD. I also thank my family and friends for their continued encouragement.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 ABSTRACT...................................................................................................................................10 CHAP TER 1 INTRODUCTION..................................................................................................................12 1.1 Value of Coral Reefs........................................................................................................12 1.2 Coral Biology.............................................................................................................. ......12 1.3 Coral Reef Decline...........................................................................................................13 1.4 Anthropogenic Inputs to Coral Reefs............................................................................... 15 1.5 The Coral Holobiont.........................................................................................................20 1.5.1 Symbiosis and Nutrient Exchange.......................................................................... 20 1.5.2 Signal Exchange..................................................................................................... 21 1.5.3 Other Zooxanthellate Symbioses............................................................................ 22 1.5.4 Coral Mucus........................................................................................................... 23 1.6 Coral Bleaching............................................................................................................ ....25 1.7 Coral Diseases and Management...................................................................................... 27 1.7.1 Examples of Coral Diseases................................................................................... 27 1.7.2 Characterization of Coral Diseases........................................................................ 29 1.7.3 Virulence Determinants in Opportunistic Pathogens............................................. 30 1.7.4 Disease Management.............................................................................................. 32 1.8 Virulence Factors in Bacteria........................................................................................... 33 1.9 Hypotheses and Goals.......................................................................................................36 2 MATERIALS AND METHODS........................................................................................... 38 2.1 Bacterial Strains, Plasmids, and Culture Conditions........................................................ 38 2.2 Manipulations of DNA and Plasmid Construction........................................................... 39 2.2.1 Identification of g acA in Serra tia marcescens PDL100, White Pox Pathogen...... 40 2.2.2 Construction of a Plasmid that Contains Arabinose-Inducible g ac A .....................40 2.3 Complementation Assay................................................................................................... 41 2.4 Carbon Source Utilization Profil e Using Biolog Ecoplate Assay .................................... 41 2.5 Enzyme Induction during Growth on Coral Mucus......................................................... 42 2.6 Proteinase Induction in Response to Coral Mucus...........................................................44 2.7 Presence of Lumichrome and Riboflavin in C oralline Algae........................................... 45

PAGE 6

6 2.7.1 Thin Layer Chromatography of Pure Compounds................................................. 45 2.7.2 Methanol Extraction of Coralline Algae................................................................45 2.7.3 Solvent Partitioning of Lumichrome and Riboflavin............................................. 46 2.8 Induction of Coral Larvae Settlement and Metamorphosis.............................................. 47 3 PHENOTYPIC CHARACTERIZATION OF A COR AL WHITE POX PATHOGEN, Serratia marcescens ................................................................................................................52 3.1 Introduction............................................................................................................... ........52 3.2 Materials and Methods.....................................................................................................56 3.2.1 Carbon Source Utilization Profile Using Biolog Ecoplate Assay ..........................56 3.2.2 Enzyme Induction in Response to Growth on Coral Mucus..................................57 3.2.3 Protease Induction in Response to Coral Mucus....................................................59 3.2.4 Statistical Analysis................................................................................................. 60 3.3 Results...............................................................................................................................60 3.3.1 Carbon Source Utilization Profile Using BIOLOG Ecoplate Assay .................. 60 3.3.2 Enzyme Induction in Response to Growth on Coral Mucus..................................62 3.3.3 Proteinase Induction in Response to Coral Mucus................................................. 65 3.4 Discussion.........................................................................................................................66 4 FUNCTIONALITY OF THE RESPONSE REGULATOR gac A IN A WHITE POX PATHOGE N, Serratia marcescens ........................................................................................80 4.1 Introduction............................................................................................................... ........80 4.2 Materials and Methods.....................................................................................................84 4.3 Results...............................................................................................................................86 4.3.1 Molecular Characterization of g acA in Serr atia marcescens PDL100.................. 86 4.3.2 Functionality of g acA Through Com plementation Assay...................................... 87 4.4 Discussion.........................................................................................................................88 5 BACTERIAL QUORUM SENSING SIGN ALS AND SETTLEMENT OF CORAL LARVAE ......................................................................................................................... .....101 5.1 Introduction............................................................................................................... ......101 5.2 Materials and Methods...................................................................................................106 5.2.1 Extraction of AHLs from Co ral-Associated Bacteria .......................................... 106 5.2.2 Biofilm Formation................................................................................................107 5.2.3 Extraction of Coralline Algae Compounds.......................................................... 109 5.2.4 Thin Layer Chromatography of Coralline Algae Extracts................................... 110 5.2.5 Induction of Coral Larvae Settlement and Metamorphosis.................................. 111 5.3 Results.............................................................................................................................113 5.3.1 Consequences of AHL Hydrolysis on Coral Settlement...................................... 113 5.3.2 Isolation of Coralline Algae Compounds.............................................................114 5.3.3 Roles of Signaling Molecules in Coral Larvae Settlement.................................. 115 5.4 Discussion.......................................................................................................................116

PAGE 7

7 6 SUMMARY AND CONCLUSIONS...................................................................................122 6.1 Value and Decline of Corals........................................................................................... 122 6.2 Characterization of a Coral White Pox Pathogen........................................................... 122 6.3 Potential Regulation of Virulenc e Factors and Disease Managem ent............................ 124 6.4 Coral Mucus....................................................................................................................125 6.5 Settlement and Metamorphosis of Coral Larvae............................................................ 126 6.6 Future Directions.......................................................................................................... ..126 LIST OF REFERENCES.............................................................................................................128 BIOGRAPHICAL SKETCH.......................................................................................................148

PAGE 8

8 LIST OF TABLES Table page 2-1 Bacterial strains and plasmids............................................................................................48 2-2 Primers used for PCR....................................................................................................... ..49 2-3 Carbon substrates in Biolog EcoPlates..............................................................................50 3-1 Chromogeni c substrates ..................................................................................................... 71

PAGE 9

9 LIST OF FIGURES Figure page 1-1 General schematic of a coral polyp a nd of surface m ucopolysaccharide layer (SML)..... 37 2-1 Construction of an arabinose inducible com plementation vector...................................... 51 3-1 Carbon-source utilization profiles of bacterial isolates. .................................................... 72 3-2 Correlation analysis of carbon-source uti lization profiles of bacterial isolates. ................ 73 3-3 Average enzyme induction by Serratia marcescens and coral associated b acteria during growth on coral mucus........................................................................................... 74 3-4 Average enzyme induction by Serratia marcescens and coral associated b acteria during growth on glucose................................................................................................... 75 3-5 Correlation analysis of enzyme induction for all isolates du ring growth on coral mucus .................................................................................................................................76 3-6 Correlation analysis of enzyme induction for all isolates during growth on seawater. .....77 3-7 Cell-associated proteinase induction in all isolates dur ing growth on coral m ucus.......... 78 3-8 Extracellular proteinase induction in all isolates du ring growth on coral m ucus.............. 79 4-1 Model of regulatory pathways leading from GacS/GacA to downstream genes. ............ 95 4-2 Clustal-W alignment of the GacA protein from the White Pox S. marcescens and other characterized GacA orthologs................................................................................... 96 4-3 Phylogenetic tree comparison based on the gacA DNA seque nce in common bacteria.... 97 4-4 Complementation of uvrY mutant in E. coli with Arabinose induction ............................ 98 4-5 Complementation of uvrY m utant in E. coli with glucose repression................................ 99 4-6 Complementation of uvrY m utant in E. coli with no sugar induction............................. 100 5-1 Coral larvae settlement in response to microbial biofilms............................................... 119 5-2 Coral larvae settlement in respons e to the synthetic AHL 3-o-C6-HSL. ........................ 120 5-3 Coral settlement in response to synthetic AHLs and lum ichrome/riboflavin.................. 121 5-4 Swollen aboral ends of A palmata larvae in response to exposure to lumichrome........ 121

PAGE 10

10 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science INTER-KINGDOM SIGNALING AND CHARACTERIZATION OF A CORAL WHITE POX PATHOGEN, Serratia marcescens By Cory J. Krediet August 2008 Chair: Max Teplitski Major: Interdisciplinary Ecology The surface mucopolysaccharide layer (SML) se creted by corals is a rich environment where bacteria proliferate. Th e activities required for SML co lonization by bacterial pathogens and commensals are unknown. Serratia marcescens is an opportunistic pathogen that causes white pox disease of Acropora palmata. To characterize mechanisms of SML colonization by S. marcescens PDL100, its ability fo r carbohydrate catabolism was characterized. A complement of enzymatic activities induced by growth on coral mucus was identified using defined chromogenic (pNitrophenyl) substrates. Pathogeni c and environmental isolates of S. marcescens induced a suite of catabolic enzyme s during growth on coral mucus. The characterization of glycosidas es induced during growth on co ral mucus demonstrates that Serratia marcescens relies on specific catabolic genes fo r its colonization of acroporid SML. Induction of these specific enzymes also provides insight into the types of bonds found in coral mucus. BIOLOG EcoPlates were used to characterize the ability of several isolates of S. marcescens to catabolize mode l carbon sources. Serratia marcescens PDL100 showed high correlation to other pathogenic isolates as compared to environmental isolates of S. marcescens and native coral-associated bacteria, suggesting that this coral pathogen may have originated from anthropogenic sources.

PAGE 11

11 Coral larvae prefer to settle on substrates that are coloni zed by coralline algae or by biofilms formed by coralline algae and associated microbes, however, the perceived cue is unknown. Both bacteria and eukaryotes produce vitamin signals with newly discovered functions in QS and host-microbial interactio ns. The hypothesis that known signals commonly associated with microbial biofilms may function as settlement cues for larvae of stony corals was tested. These settlement experiments involved C14-homoserine lactone, 3-oxo-C6-homoserine lactone, lumichrome and riboflavin, each co mpound functions in bacterial cell-to-cell communication and contribute to settlement of marine organisms. Presence of AHLs, lumichrome and riboflavin in coral-associated mi crobes and in coralline algae was investigated. Transgenic microbial biofilms expressing AHL-lactonase were constructed to test the consequences of AHL hydrolysis in larval settlement. Chemi cals were also impregnated onto C18-bonded silica resin to simulate biologically re levant release rates of the compounds into the medium during settlement experiments. Acropora palmata larvae appear to respond to AHLs and coralline algae, however, trends remain unclear.

PAGE 12

12 CHAPTER 1 INTRODUCTION 1.1 Value of Coral Reefs Coral reefs are am ong the most diverse and biologically complex ecosystems on Earth. These ecosystems are found all over the world ne ar the equator and attract people year round with their pristine and exotic qua lities. Besides the inherent va lue of these wonders of nature, coral reefs are valuable to the rest of the worl d in a number of ways. Coral reefs have been estimated to be annually worth $375 billion (Cos tanza et al. 1997). These ecosystems provide economic and environmental services to millions of people in over 100 co untries as areas of recreation, sources of food, jobs, antibiotics, cancer-fighting medi cines, novel fluorescent proteins for biotechnological a pplications, and shoreline protection. Polysaccharides produced and excreted by corals are a major nutrient source in reef ecosystem (Brown and Bythell 2005). Coral reefs and the neighboring coastal areas account for 38 per cent of the goods and services provided by the Earths ecosystems, which is mo re than terrestrial ecosystems account for (Cooper 1999). In Florida, cora l reefs contribute at least $2.9 b illion to local economies annually (Johns et al. 2001). The capitalized reef user value in southeast Florida is $8.5 billion (Johns et al. 2001). Unfortunately, the state of coral reefs is not so posi tive. The worlds coral reefs currently face degradation and de struction from naturally and hu man induced events and are in desperate need of protection. Approximately 60 percent of coral reefs worldwide are currently threatened by human activities and nearly 10 pe rcent of the coral reef s have been severely damaged or destroyed (Cooper 1999). Without coral reefs, the oceans ecosystems will collapse. 1.2 Coral Biology In order to fully understand the stressors facing coral reefs worldwide, it is necessary to understand the basic fundam ental characteristics of the corals themselves. Corals are ancient in

PAGE 13

13 origin, appearing nearly 400 million years before present. They are in the class Anthozoa in the phylum Cnidaria (Ball et al. 2002 ). Coral polyps are physiological ly similar to hydroids and sea anemones. While corals themselves are quite small, colonies of reef building coral (scleractinian corals) are able to produce massive rock-like stru ctures with varying shapes and colors, which act as a natural barriers to coas tal degradation. The ro ck-like structures are actually the calcium carbonate (CaCO3) skeleton, which is secreted by the coral polyps. Typically the growth rate of this skeleton is rather slow (0.5 to 2 cm per year), but times of favorable conditions lead to more rapid growth (Edmunds et al. 2004, Edmunds 2007). Coral reefs are limited to specific conditions (especially temperature) and are therefore only found near the equator (Nystrom et al. 2000). Generally, no one specific fact or (abiotic or biotic) determin es the distribution of a single species. It has been suggested that the distribution of a species is de pendent on interactions between an abiotic gradient and biotic interactions between speci es (Travis et al. 2006). Such species interactions are vital fo r coral recruitment. Trophic ca scade interactions have been shown to enhance recruitment rates due to gr azing fish limit the amount of macro-algae and increased substrate availability; thus facilitati ng coral recruitment (Mumby et al. 2007a). There are many indicators of the specific conditions surrounding a reef and th e implications of changing conditions such as th e diversity of the reef. 1.3 Coral Reef Decline The health and success of a coral reef syst em are naturally maintained through occasional natural disturbances (e.g. storms, predators, temperature fluctuati ons) so that it does not become too productive. Disturbance is defined as a sudden event, which changes th e nutrient status of an ecosystem. This may be an enrichment disturbance, where additional resources remove the limits on the carrying capacity, or a destructiv e disturbance, where part of the existing

PAGE 14

14 community is destroyed, releasing nutrients for the remaining community (Harris et al. 2006). Causes of extensive coral mortality may reside in a single or often many natural factors that include low tides, volcanic erup tions, and increased temperatures. Scientists are beginning to focus their studies on five major causes of natu ral disasters: storms and hurricanes, coral bleaching, diseases of reef organisms, outbreaks of coral predators, and mass mortalities of reef herbivores (Brown 1997). These sources of distur bance to coral reefs ha ve received the most attention because they have been found to often cause the most devastation to reef communities. The impacts of storms and hurricanes to a re ef community are determined by a number of factors, all of which may vary with each storm and reef affected. The intensity of the disturbance, the resilience of the system to dist urbance, as well as, the hi story of disturbance at the site are all important in measuring the da mage and how quickly an ecosystem will recover (Brown 1997). For example, prior to the early 1 980s, Jamaican fore reefs with high coral cover at 75% had not experienced a seve re hurricane for 36 years. In 1980, coral disease and hurricane Allen reduced coral cover to 38%, however, the reefs recovered due to the presence of urchins (Mumby et al. 2007b). The long undisturbed history of these reefs and the abundance of herbivores to combat macroalgae enhanced the re silience of the system after a relatively short, yet intense disturbance. The capability of ecosystems to deal with disturbance is determined by a variety of characteristics such as genetic variability within populations, dive rsity within and among functional groups (e.g. reef builders, grazers), and diversity of ha bitats (Nystrom et al. 2000). Ecologists now associate stability with persistence, resilience, and resistance (Nystrom et al. 2000, Walther et al. 2002, Hughes et al. 2003, Bellwood et al. 2004) and the mechanisms by which systems return to states of equilibrium (e.g. juvenile growth and gene flow (Edmunds

PAGE 15

15 2007, Vollmer and Palumbi 2007)). Pe rsistence simply refers to th e existence of a community or population over a time period (Karlson 1999). The de finition of coral reef resilience depends on ways of interpreting ecosystem development (Nys trom et al. 2000). Recently, ecologists have reconsidered the role of dist urbance in terms of complex systems, which include multipleequilibria, nonlinearity and phase shifts. Theref ore, two prominent concepts of resilience have resulted. The traditional and most widespread view concentrates on st ability near a single equilibrium state, where resistan ce to disturbance and the speed of return to equilibrium are emphasized (Nystrom et al. 2000). Resilience denotes the recovery of a system towards equilibrium after a disturbance that has physical ly altered the community structure. Highly resilient communities recover from disturbances quickly but are not necessarily indicative of high resistance. Therefore, resistance refers to the ability of the community to minimize the impact of disturbances (Karlson 1999). Th e second definition focuses on ecosystems in dynamic, non-equilibrium environments with multiple stable states where phase shifts may occur (Holling 1996, Mumby et al. 2007b). Resilience, in this case, refers to the amount of disturbance that can be absorbed by the system before a sh ift from one stable st ate to another occurs. 1.4 Anthropogenic Inputs to Coral Reefs While some disturbance is essential to the maintenance of ecosystem diversity, persistent disturbances with increasing intens ity may greatly influence the abil ity of a system to recover. Recently, awareness regarding human ability to alter natural disturbance regimes and thus influence coral reefs and their potential for recovery following disturbance has increased (Harvell et al. 1999, Nystrom et al 2000). Human activities (both di rect and indirect) often lead to disturbances equal to those th at occur naturally (e.g. tropical hurricanes). Both adult corals and larvae are susceptible sedimentation, eutr ophication and contamination from waterborne toxins (Minton and Lundgren 2006), which consistent ly occur in reef ecosy stems. Coral reefs

PAGE 16

16 typically are able to reassemble and recover fr om routine disasters (Be llwood et al. 2004) but when coupled with human disturbance, reefs show decreased resilience to disturbance. The major difference between natural and human-induced disturbances is their continuity. Natural disturbances tend to occur in a pulsed manner (e .g. tropical storms and co ral predator outbreaks), while human-induced disturbances tend to continue and accumulate (e.g. nut rient enrichment and pollution) or occur so frequently that there is little time for recovery (e.g. high fishing pressure) (Nystrom et al. 2000). Over time, even a low le vel of such chronic stress can have severe impacts on coral reef ecosystems. Ecosystems facing persistent disturbances often undergo an ec ological phase shift resulting from a loss of resilience. Many reefs th at suffer reduced stocks of herbivorous fishes and added nutrients from land-based activities have shifted from the original dominance of coral to a preponderance of fleshy seaweed (Nystrom et al. 2000, Hughes et al. 2003, Bellwood et al. 2004). It is often difficult to pred ict such ecological shifts, as aw areness of the full consequences of human action lags far behind the impact (W estern 2001, Wallentinus and Nyberg 2007, Mora 2008). This inability to detect and predict change s on a regional basis can be seen as an obstacle that prevents appropriate decisions regarding management and ecological restoration efforts (Harris et al. 2006, Vollmer and Palumbi 2007). If human modification of the marine environment continues, diversity within and among functional groups (e.g. reef builders and herbivorous fishes) may decrease. Coral reefs with decreased di versity within functional groups may maintain ecological function but additional disturbances may shift those groups into another stable state in which large-scale degradation a nd loss of essential ecolo gical function may occur (Nystrom et al. 2000).

PAGE 17

17 Global climate change is regarded as one of th e major threats to the future of coral reefs since increases in temperature of only a few degrees induce global-scale episodes of coral bleaching and mortality (Hughes et al. 2003, Mora 2008). Temperature is the leading cause of coral reef decline (Hoegh-Guldbe rg 1999) and increases outbreaks of marine disease (Harvell et al. 1999). If trends continue, the levels of atmo spheric carbon dioxide will increase and the pH of ocean waters will decrease (Fung et al. 2005). The increase in sea surface temperatures and decrease of pH increase cause stress to corals an d increase their susceptibility to bleaching and disease. Anthropogenic run-off and sewage pollution can lead to nutrient enrichment and eutrophication of waters reaching coral reefs. Through increased human activities, corals are exposed to growing loads of nutrients, sedime nts and pollutants discharged from the land (Fabricius 2005). Increased load s of nutrients and particulates may drastically alter the dynamics of the reef ecosystem, not only at the level of the symbiotic relationship between corals and zooxanthellae, but also at the community level. Massive macroalgae bl ooms result from nutrient enrichment of otherwise nutrient poor waters. These blooms physically outgrow sea grass and adult corals, inhibit recruitment of juvenile corals, may lead to hypoxia and/or anoxia, as well as, decreased fisheries and reduced biodiversity (Howarth et al. 2000, Lapointe et al. 2004). Corals may also be out competed by other filter feeder s (e.g. sponges, bivalves, ascidians, bryozoans, and barnacles), which are more efficient at uti lizing particulate organic matter (Fabricius 2005). This may occur, however, only in areas of lo w light where corals lack the photosynthetic advantage over other filter feeders. Nutrient enrichment also dire ctly influences the dynamics of the coral-zooxanthellae symbiosis. Zooxanthellae densities increase in response to high concen trations of dissolved

PAGE 18

18 inorganic nutrients (i.e. nitrogen and phosphorus). The algae use the increased nitrogen for their own growth rather than growth of host tissu e (Fabricius 2005). Increased densities of zooxanthellae take up more carbon dioxide th an under non-enrichment conditions. This decreases the carbon dioxide available for calcification (Szmant 2002, Fabricius 2005). Increased particulate organic matter (i.e. clay a nd organic particles suspended in the water) also indirectly influence corals by re ducing light penetration to the z ooxanthellae. If prolonged, this may lead to lower carbon gain by the cora l from zooxanthellae photosynthesis, slower calcification rates, and thinne r coral tissue (Fabricius 2005). Sewage pollution and contamination is of great concern in the Florida Keys. Approximately 30,000 on-site sewage disposal systems (septic tanks, cesspits, and Class V injection wells) are dispersed throughout communities in the Florida Keys, most of them positioned near boating canals (Lapointe et al. 2004). In the past, it was assumed that eutrophication from anthropogenic sources would only affect near and in shore waters (Szmant 2002), however, sewage pollution cont ributes to the eutrophication of not only inshore and near shore waters, but also offshore waters (Lapointe and Clark 1992, Lipp et al. 2002, Griffin et al. 2003). Human-induced nutrient enrichment also increases the severity of diseases affecting corals. Two Caribbean corals epizootics, aspergillosis of common sea fans and yellow band disease of Montastrea spp. were shown to intensify during expone ntial nutrient increase (Bruno et al. 2003a). Potentially, the pathogens causing these diseases are able to utilize the excess nutrients, thereby increasing the fitness and virulence. Th ese results demonstrate th at minimizing nutrient pollution could be an important management tool for controlling coral epizootics (Bruno et al. 2003a).

PAGE 19

19 Natural disturbances and human activities strongly impact at least 45% of the worlds oceans (Halpern et al. 2008) and have severely damaged at least 30% of coral reefs (Hughes et al. 2003). They alone, however, do not explain why some systems have not recovered from disturbance but rather remain in alternate stab le states (e.g. macroalgae dominant and low stony coral abundance). Coral decline is ubiquitous (Pandolfi et al. 2003) and often leaves questions as to how it is occurring at a regional level. Human influences do not explain all coral decline, especially when habitat degradation occurs on remote reefs without human presence (Ryan 2001). Observations of high levels of coral di sease on reefs with no human influence require other explanations. Benchmarks, such as Caribbean-wide mortalities of acroporid corals and the urchin Diadema antillarum and the beginning of coral bleaching coincide with years of maximum dust influx into the Caribbean (Shinn et al. 2000). African dust is not a new phenomenon in the Caribbean. Dust transported annually from Africa and Asia across the Atlantic and Pacific oceans has occurred for millennia, but recently researchers have put more stock into the role of the hundreds of millions of tons of dust in the decline of coral reefs (G arrison et al. 2003). Dust from Af rican Sahara and Sahel deserts is transported to the Mediterranean, Europe and the Caribbean. Within the components of the dust, iron (Fe), silicon (Si) and aluminosilicate clays can serve as substrates for viable spores of numerous microbial species, especially the soil fungus, Aspergillus sydowii (Shinn et al. 2000). This soil fungus is the known pa thogen that affects sea fans ( Gorgonia ventilina and G. flabellum ) Caribbean-wide. Besides the observa tion that dust may ha rbor opportunistic pathogens, which can lead to infection and cora l disease, African and Asian dust also brings significant quantities of water-solubl e nutrients to the oligotrophic waters of the Caribbean, Gulf of Mexico, and Pacific (Garris on et al. 2003). The addition of these nutrients may not only aid

PAGE 20

20 bacteria transported by dust, but also may create enhanced conditi ons for bacteria persisting in the nutrient poor waters. These bacteria then may out-compete na tive bacteria, which may react adversely to the influx of nutrients. The steady transport of dust throughout the worlds coral reefs may help to explain why many systems ar e unable to recover fully after a traumatic disturbance due to a net infl ux of nutrients and non-native organisms and chemicals. 1.5 The Coral Holobiont 1.5.1 Symbiosis and Nutrient Exchange Most coral s pecies are involved in a symb iotic relationship with dinoflagellates functionally defined as zooxanthe llae (Belda-Baillie et al. 200 2). Through coevolution with these dinoflagellates, corals ha ve developed an ecological rela tionship leading to enhanced respiration, metabolism, waste excretion and incr eased growth rates in nutrient poor waters (Stanley and Swart 1995). These relationships be gan to form in the middle to late Triassic period roughly 200 mybp (million years before pr esent) (Stanley and Swart 1995). In this relationship, the coral provides a protected envi ronment for the algae as well as carbon dioxide and other wastes used in photosynthesis (Wilson and Wilson 1985). Corals are successful in low-nutrient tropical waters due to the plasticity in the modes they utilize to obtain nutrients. The polyp captures zooplankton through suspensi on feeding and transloc ates photosynthetic products from the zooxanthellae (Muller-Parker and D'Elia 1997). Animal metabolic waste products derived from holozoic feeding are retained within the coral, and provide inorganic nutrients (i.e. nitrogen and phosphorus) required by the zooxa nthellae for photosynthesis. As autotrophs, zooxanthellae only re quire inorganic nutrients, carbon dioxide and light for photosynthetic carbon fixation (Muscatine and Porter 1977, St anley and Swart 1995, MullerParker and D'Elia 1997). The zooxanthellae produ ce great amounts of photos ynthate in excess to that utilized by the coral for di rect nutrition (Ducklow and Mitc hell 1979, Wild et al. 2004). The

PAGE 21

21 coral secretes the excess photosynthate in the form of mucus, which bathes the coral tissue (see discussion of coral mucus below). Zooxanthellae may also benefit corals indirectly through the uptake of inorganic nutrients. Some nutrients (e.g. phosphate) act as CaCO3 crystal inhibitors and their removal from calcificat ion sites by the zooxanthellae pr omote calcification by the coral (Muller-Parker and D'Elia 1997). Corals are under increasing stress due to ch anges in their environment. This stress increases corals susceptibility to diseases. The zooxanthellae, Symbiodinium are not the only organisms with which corals are in association. Recently, research has demonstrated that corals also contain large, diverse, and specific popul ations of microorganism s on their surface and within their tissues (Ritchie and Smith 2004, Wild et al. 2004, Rosenberg et al. 2007). Some of these microorganisms have been speculated to co-evolve with cora l (Rohwer et al. 2002, Knowlton and Rohwer 2003, Ritchie and Smith 2004) based on continual isolation from coral and growth on mucus treated media. Those micr oorganisms living as part of the coral holobiont serve important roles in maintaining a functional symbiotic relationship. Su ch functional roles of microorganisms include nitrogen cycling, util ization of complex carbon compounds such as proteins and polysaccharides, ge ne expression relating to st ress response, DNA repair and antibiotic resistance (W egley et al. 2007). 1.5.2 Signal Exchange Each partner in the coral holobi ont influences the others. Co rals m ay receive signals from their symbiotic algae and microorganisms, as well as, the external environment (e.g. conspecifics during spawning, macroalgae, and competing corals) during different st ages of their life histories. Elkhorn coral, Acropora palmata reproduce during annual mass spawning events, where gametes are synchronously released into the seawater for extern al fertilization and dispersal (Babcock and Heyward 1986, Heywar d and Negri 1999). The developing larvae

PAGE 22

22 generally become competent, settle out of the water, and metamorphose into juvenile coral polyps (Babcock and Heyward 1986). As energy reserves from the oocyte diminish, cilia develop and the sensory and secr etory cells of the epidermis di fferentiate (Heyward and Negri 1999). The onset of larval competency coinci des with decreased larv al buoyancy, increased motility and sensory capability at the aboral e nd (Heyward and Negri 1999), which potentially allows the larvae to sample th e substrate and adhere to it (E dmunds et al. 2004). Often, coral larvae may differentially select a site of permanent attachment due to external chemical cues that potentially induce metamorphosis (Morse et al. 1994, Morse et al. 1996, Heyward and Negri 1999). Coralline algae are one of the primary s ources of chemical morphogens and are thought to produce high-molecular weight polysaccharides that are recognized by chemoreceptors of the planula (Webster et al. 2004). However, lipophilic compounds ex tracted from CCA have also been shown to induce settlement of urchin larvae (Kitamura et al. 1993). Studies demonstrate that, in addition to co ralline algae, microbial biofilms and other chemical s induce coral larvae and other inve rtebrate larvae metamorphosis (Tsukamoto 1999, Tsukamoto et al. 1999, Webster et al. 2004, Huggett et al. 2006). The chemical lumichrome, a derivative of riboflavin (vitamin B-12) induces larval metamorphosis in the ascidian, Halocynthia roretzi (Tsukamoto et al. 1999). Lumichrome ha s also demonstrated capabilities to enhance alfalfa root respiration and shoot gr owth when produced by a symbiotic bacterium, Sinorhizobium meliloti (Phillips et al. 1999). 1.5.3 Other Zooxanthellate Symbioses Corals ar e not the only marine invertebrate to form a symbiosis with photosynthetic algae. Taxonomically, zooxanthellae belong to seven differe nt clades, and are known to form symbiotic relationships with coral polyps, sea anemones, sea slug ( Berghia verrucicornis ) (Kempf 1991, Stanley and Swart 1995, Wgele and Johnsen 2001). Many cnidarians (e.g. sea anemones) form

PAGE 23

23 such relationships. These mutualistic interactio ns are often species specific and can even vary with habitat location (Secord and Augustine 200 0). Unlike hermatypic corals, which form interactions with obligate symbionts of zooxanthellae, sea anemones of the genus Anthopleura can contain both zooxanthellae and zoochlorellae. The composition of the symbiotic algae in the sea anemone host varies with latitude and intertidal height (Secord and Augustine 2000). Zooxanthellae are also found in symbiotic relati onships with nudibranchs (Kempf 1991, Wgele and Johnsen 2001). The exact role of the symbio nts remains somewhat unclear with suggested functions that include camouflage for the hos t, the photosynthetic algae may aid the host in persisting during periods of low nutrients, and in clusion of the algae may enhance reproductive output of the nudibranch as a result of shuttli ng energy from photosynthe tically fixed carbon to the eggs (Wgele and Johnsen 2001). The z ooxanthellae are acquired while the nudibranch feeds on the symbiotic sea anemone, Aiptasia pallida Zooxanthellae in the tissue of the anemone are transferred to nutrient processing cell s (NPCs) and are retained intracellularly in peri-algal vacuoles (Kempf 1991). Zooxanthellae also form a type of symbiosis with the giant clam, Tridacna gigas in which the clam houses the algae in a unique complex diverticulum of the stomach (Lucas 1994). The ability of the giant clam to utilize bot h the photosynthate from the zooxanthellae as well as the nut rients obtained from efficient filter feeding offers a growth advantage over other heterotrophic bivalves. 1.5.4 Coral Mucus All corals secrete m ucu s (Fig. 1-1). The majority of the fixed carbon found in the surface mucopolysaccharide layer (SML) originates from the symbiotic zooxanthellae (Patton et al. 1977). Fixed carbon produced by zooxanthellae is transferred to the coral host and secreted through epidermal mucus cells (R itchie and Smith 2004). High ar abinose contents in coral mucus indicates that much of the fixed carbon is released as mucus since arabinose is generally

PAGE 24

24 not found in animal tissue (Meikle et al. 1988). Both hard and soft corals secrete mucus continuously and each species has a distinct ive composition (Ducklow and Mitchell 1979, Meikle et al. 1988, Ritchie and Smith 2004, Wild et al. 2004), which can vary temporally and with depth (Crossland 1987). The basic stru cture of mucus is an insoluble, hydrated, glycoprotein secreted by the co ral (Ducklow and Mitchell 1979, Meikle et al. 1988). The observation that the majority of fixed carbon is not utilized by the cora l but rather secreted, indicates that mucus serves a number of roles. Continuous release of mucus aids in ciliarymucoid feeding in th e coral reef copepod Acartia negligens (Richman et al. 1975) and is hypothesized to protect against microbial co lonization, smothering by sediment, physical damage, desiccation during air e xposure at extreme low tides, sp ace invasion by other corals, and ultraviolet radiation damage (reviewed in (Wild et al. 2004, Brown and Bythell 2005)). Mucus secretion may also serve as an in dicator of coral health. Banin et al. (2001) showed that in the Mediterranean coral Oculina patagonica healthy pigmented corals secrete large amounts of mucus compared to bleached and diseased colo nies (Banin et al. 2001). Coral mucus may enhance resistance to disease through a number of mechanisms including antib iotic production and inhibition of pathogenic mechanisms (R itchie 2006). The unique composition of mucus secreted by corals may promote coral-bacterial symbionts while inhibiting potential pathogens. The production of mucus in vertebrates system s is well documented and several cell types that contribute to mucus secretion have been described (Verdugo 1990). In coral tissues, however, the limited histological and histochemical investigations descri be only one typethe mucocyte, which is found in all tissue layers (reviewed in (Brown and Bythell 2005)). Continuous production of mucus is clearly advantageous but th e rate of mucus production in relation to environmental conditions may vary gr eatly. Among eight species of scleractinian

PAGE 25

25 corals studied in the Red Sea, the average overall mucus rate of production was approximately 51 mg of particulate organic matter m-3 day-1 (Richman et al. 1975). Other studies have demonstrated that submerged species of Acropora released 1.7 liters of mucus m-2 day-1 (Wild et al. 2004). Even though the exact composition of coral mu cus is not certain (except for a few common carbohydrates such as arabinose), it is obvious that the coral SML is high in organic matter. Coral mucus, therefore, creates a nutrient rich environment for bacteria and other microorganisms. This is in strong contrast to the surrounding bacterioplan kton environment. In fact, culturable SML bact erial populations were found to be 100 times higher than those from surrounding water mass and many orders of magnitude more metabolically active (Ritchie et al. 1996). While, the surface mucopolysaccharide layer (SML) provides ample nutrients for bacteria on the surface, approximately 56-80% of released coral mucus immediately dissolves and provides a food source for the bacteri oplankton environment (Wild et al. 2004). 1.6 Coral Bleaching Am ong the numerous natural occu rrences that influence cora l reefs (e.g. tropical storms, coral predator outbreaks, coral disease), coral bleaching is one of the most detrimental and also most mysterious. Coral bleaching has been obser ved all over the world and different conditions and factors have been attributed to these disturbances. Of all the possible causes for coral bleaching, one that is receiving much of the cred it is climate variation through El Nio Southern Oscillation (ENSO) events (e.g. (Stone et al. 1999 )). Southern Oscillation (SO) is a dramatic fluctuation of air pressure between the eastern an d western Pacific, which is not associated with El Nio events (Gray Davidson 1998). Empirical evidence indicates a coral reef bleaching cycle in which major episodes are synchronized with El Nio events that occur every 3-4 years, on average (Stone et al. 1999). Coral bleaching occurs when there is a loss of color, arising from

PAGE 26

26 the partial or total elimination of the Symbiodinium population or degradati on of algal pigments (Douglas 2003). This occurs generally in times of stress, often caused by sea surface temperatures (SST) which are much higher than th e tolerance level of the coral colony (Wolanski 2001), but also is attributed to solar radiation, especially ultraviolet (UV) radiation (Stone et al. 1999). The majority of coral species have adap ted life histories that function within a very narrow range of conditions, which include salinity, nutrients, sediments, and temperature (Gray Davidson 1998). There are approximately one to two million algal cells per one square centimeter of coral which give th e coral the vibrant colo rs that we see (Sapp 1999). Left without their symbiotic partners, the corals appear white or colorless (the color of the calcium carbonate skeleton) and usually die as they can not obtain the necessary nutrients without their symbionts (Gray Davidson 1998). If, however, conditions beco me favorable in a relatively short time, the corals may be able to acquire a new consortia of zooxanthellae (Douglas 2003, Reshef et al. 2006). The extreme sensitivity of corals to their surrounding temperatures makes them especially susceptible to coral bleaching. Coral pathogenic bacteria have also been s hown as a causative agent of coral bleaching. Oculina patagonica is a scleractinian coral found in the Me diterranean and is th e only hard coral known to have invaded a new regi on (Rosenberg and Falkovitz 2004). It is believed that the coral, a known fouling organism, traveled from the Atlantic Ocean by ad hering to the hull of a ship. A pathogenic strain of Vibrio shiloi AK1 was found to be associated with bleached O. patagonica The bacteria were isolated from bleach ed coral tissue and Kochs postulates were fulfilled, demonstrating that the pathogenic stra in is a causative agent for coral bleaching (reviewed in (Rosenberg and Falkovitz 2004)). In this model, the classical triggers of coral bleaching (Ben-Haim et al. 2003a, Douglas 2003) are still in play as laboratory studies show O.

PAGE 27

27 patagonica is more susceptible to bleaching by V. shiloi during periods of elevated seawater temperatures (Rosenberg and Falkovitz 2004). With global climate change and elevated sea surface temperatures (SST), cora l reefs are under high le vels of stress making them susceptible to bleaching and disease. The overwhelming evidence and support for the Oculina patagonica coral-bleaching model have been used as a ba sis to propose that bacterial pa thogenesis may be one cause for global bleaching patterns. A recent study investigating the in situ involvement of bacteria in the bleaching of O. patagonica across the Israeli coastline, substantiated evidence to dismiss the notion that bacteria are involved in coral bleach ing (Ainsworth et al. 2008). Corals were monitored throughout an annual bleaching event and the proposed pathogen, Vibrio shiloi was not detected in any tissue layers. This observatio n is consistent with experimental conditions in support of the coral probiotic hypo thesis (Reshef et al. 2006). A change in the endolithic (natural) community of microorga nisms occurs during coral bleaching (Ainsworth et al. 2008). This shift highlights the potenti al importance of the diverse and complicated interactions between the organisms that comprise the coral holobiont in terms of disease resistance and resilience. 1.7 Coral Diseases and Management 1.7.1 Examples of Coral Diseases Many organism s that cause coral diseases are not dedicated pathogens, but are opportunistic ones. Opportunistic pathogens are thos e microorganisms that are normally found in the environment and are generally benign. O pportunistic pathogens in vade their eukaryotic hosts only when the hosts defense systems are compromised. Opportunistic pathogens may be introduced into a habitat by a variety of means. Recently, human influence and activities have received a great deal of attention. Studies have demonstrated that not only human activities, but

PAGE 28

28 also human waste, has been found to contribute to a high prevalence of enteric bacteria in near shore waters and canals of the Fl orida Keys (Griffin et al. 1999, Nobles et al. 2000, Lipp et al. 2002). While this observation is important, conclusi ve evidence, that wast ewater is reaching and adversely affecting the coral reef environments along the Florida Keys is limited. One study suggests that coral mucus may serve as a better re cord of fecal contamination in reef areas since enteric bacteria are often diffi cult to recover from marine waters (Lipp et al. 2002). Coral diseases caused by opportunistic pat hogens are now widespread (Rosenberg and Ben-Haim 2002, Aronson et al. 2003, Frias-Lope z et al. 2004, Sutherla nd and Ritchie 2004, GilAgudelo et al. 2006, Weil et al. 2006). Several of these opportunistic pathogens that cause devastating diseases of corals were recently identified: coral plague by Sphingomonas sp (Richardson et al. 1998), white pox disease by Serratia marcescens (Patterson et al. 2002) (FriasLopez et al. 2004), black band disease by a consor tium of bacteria (Richardson et al. 1997) (Richardson and Kuta 2003), aspergillosis disease by Aspergillus sydowii (Smith et al. 1998). Kochs postulates have been fulfilled for white plague type II, white pox, aspergillosis, Vibrio shiloi induced bleaching and Vibrio coralliilyticus induced bleaching and disease. Coral disease symptoms described as black band disease, skel etal anomalies, white band type II, skeleton eroding band, fungal-protozoan syndrome, and pink-line syndrome have hypothesized microbial causative agents but have not been confirmed (Sutherland et al. 2004, Ro senberg et al. 2007). Serratia marcescens is one of the better characte rized opportunistic pathogens of Caribbean corals (Patterson et al. 2002, Sutherland and Ritchie 2004). Kochs postulates were fulfilled using 109 bacterial ml-1 infectious dose (Patterson et al 2002). While this infectious dose was high, similar infection studies demonstrate at the LD50 of the pathogen was 107 bacteria ml-1 in mice (Carbonell et al. 2000) and as litt le as 1355 cells per individual larvae of C.

PAGE 29

29 zealandica larvae (Tan et al. 2006). Serratia marcescens is associated with the appearance of white pox disease symptoms in Acropora palmata which progress rapidly at a rate of 2.5 cm2/day (Patterson et al. 2002). Irre gularly shaped, distinct white patches, devoid of coral tissue, characterize white pox disease. White pox diseas e can be distinguished from white band disease (both of which affect A. palmata ) as the potential for tissue loss (necrosis) occurs throughout the coral colony with white pox. White band disease develops at the base of the coral branch and progresses upward towards the branch tip in a concentric ring (Sutherland and Ritchie 2004). The white pox pathogen is currently the major pathogen of Acropora, a threatened Caribbean Elkhorn coral and it is closely related to othe r well-characterized a nd genomically sequenced pathogenic Serratia spp. Some catabolic enzymes a nd regulatory switches required for virulence of pathogenic Serratia in plants and animals have been characterized (Kurz et al. 2003, Soo et al. 2005, Queck et al. 2006). Although microor ganisms that are pathoge nic to some corals have been identified, the causati ve agents of many coral diseases remain unknown (Richardson 1998, Weil et al. 2006). 1.7.2 Characterization of Coral Diseases The identification of coral pathog ens as causative agents of disease must include fulfillment of Kochs postulates. To demonstrat e the identity of a pat hogenic microorganism, the following must be carried out: (1) the pathogen must be found in abundance in all organisms with disease and not in healthy organisms, (2) the pathogen must be isolated from the diseased host and grown in pure culture under laboratory conditions, (3) the pathogen from pure culture must cause the disease when it is inoculated in to or onto a healthy anim al, and (4) the pathogen must be re-isolated from the ne wly diseased animal and identified as the same microorganism as the presumptive pathogen (Tortora et al. 2002). In the past, some bacteria were accepted as the causative agents of disease despite the fact that Kochs postulates were not fulfilled (Richardson

PAGE 30

30 1998). It is important to mainta in a certain level of caution wh en assigning a pathogen to a specific disease based on Kochs postulates. One problem with identifying a pathogen by Kochs postulates is that the changes in host susc eptibility or pathogen viru lence with changes in the environment are not incorporated (Lesse r et al. 2007). Another problem limiting the application of Kochs postulate s is the inability to grow ma ny potential pathogens in the laboratory (Ritchie et al. 2001). Many bacteria, viruses, protozoa and fungi cannot be propagated under laboratory conditi ons. It is therefore difficult to conclude that the disease produced in laboratory conditions was the same present in the environment. Recent studies have also emphasized the importance of going beyond th e external macroscopic signs of coral disease in order to accurately diagnose disease (Ain sworth et al. 2007, Lesser et al. 2007). Often, macroscopic symptoms or signs associated with different diseases or s yndromes overlap and may lead to misdiagnosis. Utilizing other methods su ch as microbial diversity characteristics and cytological observations may be useful for understanding the disease pr ocess of corals and improving the basis on which diseases are diagnosed. 1.7.3 Virulence Determinants in Opportunistic Pathogens It is not yet clear, however, how opportunistic pathoge ns colonize and infect corals (Richardson 1998, Foley et al. 2005). The influen ce of host density and va riability on disease outbreak also rem ains unclear. Disease outbreaks could potentia lly increase with increased host density (Ward and Lafferty 2004). Vibrio harveyi is a serious pathogen of marine animals, but despite its prevalence and charac terization, the mechanisms of pat hogenicity have yet to be fully elucidated (Austin and Zhang 2006). Extra cellular products (e.g. cysteine protease, phospholipase, haemolysin) may play a central role in the virulence of the pathogen (Austin and Zhang 2006). While many coral diseases are well characterized, the mechanisms by which the pathogens that infect them need to be elucidated before effective management can be employed.

PAGE 31

31 Coral diseases caused by microorganisms ge nerally cause one of two major symptoms: tissue necrosis or bleaching. Of the pathogens known or assumed to cause the major necrotic diseases (white band I & II, white plague I & II, white pox, black band and aspergillosis) only a few pathogens have been observed to cause diseases in invertebrates beside s corals (Grimont and Grimont 1978, Rinaldi 1983, Alker et al. 2001). Aspergillus sydowii is a soil saprophytic fungus known to occasionally act as an opportunistic pathogen of food, invertebrates and humans (Rinaldi 1983, Alker et al. 2001). Its pathogenicity depends on the host and th e duration of exposure. In addition to corals, Serratia marcescens infects a wide variety of hosts and can be viewed as a model oppor tunistic pathogen. Serratia marcescens is able to cause disease (and often high mortality) in C. elegans (Kurz and Ewbank 2000, Kurz et al. 2003, Schulenburg and Ewbank 2004), Costelytra zealandica (New Zealand grass grub) (Tan et al. 2006), numerous insects, plants, vertebrates, and humans (Grimont and Grimont 1978). During infection of C. elegans, S. marcescens is capable of killing the host by a toxin-based mechanism or following the establishment of an infection. The bacteria ar e able to live within the digestive tract of the nematode and proliferate and spread, eventually causing a systemic infection (Kurz and Ewbank 2000). In a screen of Serratia marcescens mutants, specific genes involved in a two-component regulatory system, magnesium and iron transport, hemolysin production and the biosysthesis of O-antigen and lipopolysaccharides (LPS) were found to be important to the virulence of the pathogen (Kurz et al. 2003). A similar study investigating gene expression in Pseudomonas aeruginosa during C. elegans infection identifie d similar genes (e.g. two-component global regulation system genes) (Tan et al. 1999).

PAGE 32

32 Coral pathogens can also induce bleaching dur ing infection. The a nnual bleaching of the Mediterranean coral, Oculina patagonica has been correlate d with infection by Vibrio shiloi during the warm summer months (Rosenberg and Ben-Haim 2002, Rosenberg and Falkovitz 2004, Reshef et al. 2006, Ainsworth et al 2008). The pathogen adheres via a -galactoside receptor produced by the endosymbiotic zooxanthellae (Toren et al. 1998). Once the bacteria penetrate the coral tissue they produce heat-sensitive toxins targ eting the zooxanthellae and thus inhibiting photosynthesis (Ban in et al. 2001). Similarly, V. coralliilyticus induces bleaching and tissue lysis in Pocillopora damicornis (Ben-Haim and Rosenberg 2002, Ben-Haim et al. 2003a, Luna et al. 2007). This gram-negative, rod-shaped, motile bacteria produces a 36 kDa extracellular protease believed to be involved in its pathogenicity (Ben -Haim et al. 2003a, BenHaim et al. 2003b). While several species of Vibrio are pathogenic to inve rtebrates, the unique feature of the Vibrio induced bleaching of corals is that the pathogen targets the zooxanthellae rather than the coral itse lf (Ben-Haim et al. 2003b). 1.7.4 Disease Management Opportunistic pathogens are of trem endous threat to corals an d other invertebrate hosts in freshwater and marine systems. This threat originates in the ubiquitous nature of opportunistic pathogens and their ability to pers ist in a variety of environments and cause infection in a wide array of hosts (i.e. when host immune system s are compromised). As discussed earlier, pathogens, especially those that co-evolved w ith humans (Templeton 2007), can enter marine systems through runoff and other forms of polluti on. Once introduced to marine systems, some pathogens are able to persist a nd even flourish. For example, Vibrio cholerae and Escherichia coli are able to surviv e at densities of 106 ml-1 for extended periods in ni ches within coral reef and turtle grass ecosystems (Perez-Rosas and Hazen 1988). Vibrio cholerae demonstrated higher survival rates and activity as compared to E. coli. This observation demonstrates how

PAGE 33

33 opportunistic pathogens can easily lead to bacterial contamination fo r fish, shellfish and corals in this environment. Although many pathogens are a ssociated with human illness and disease, they may enter a new niche in a different environmen t free of negative interspecific interactions (Perez-Rosas and Hazen 1988, Bruno et al. 2003b). In these scenarios, it is often difficult to determine whether a potential pathogen isolat ed from coral reefs is associated with anthropogenic inputs to the system or if it had independently evolved in that environment (e.g. (Patterson et al. 2002)). Surviv al of opportunistic pa thogens in different environments and infection of multiple hosts highlights the need to understand the mechanism of virulence and how they are able to coloni ze and infect their hosts. It is logistically impossibl e to cure coral diseases. Improvements to sewage infrastructure in coastal communities are prohibi tively expensive. Treating coral diseases with antibiotics and pesticides is not feasible; th erefore exploring biocont rol potential of native microbial communities may offer a possibility for a new thinking about addressing the coral reef decline. Similar biocontrol strategies have been reasonably successf ul in agriculture and commercial aquaculture (Garrigues and Arevalo 1995, Nogami et al. 1997, Whipps 2001, Chythanya et al. 2002, Raaijmakers et al. 2002, Fr avel 2005, Persson et al 2005, Balcazar et al. 2006, Rasmussen and Givskov 2006). The mechanisms of interactions between opportunistic pathogens, beneficial bacteria and coral hosts may offer an exciting model for addressing and managing ecosystem-wide degradation re sulting from sewage pollution. 1.8 Virulence Factors in Bacteria Bacterial pathogens often inte ract with a wide variety of distinct hosts, ranging from simple invertebrates to vertebrates and mammals. Most pathogens cause disease in a single or a restricted number of host species. The limitations observed in host ranges are primarily a result of a long history of coevolution (Rahme et al. 2000). Pathogens mu st either adapt to their new

PAGE 34

34 host environment or modify it to persist over the host defenses Involved in this is the recognition of the host, colonizatio n and exploitation of host resources. In order to do this, bacteria have an arsenal of virulence-related factors. Bacterial and fungal pathoge ns rely on enzymatic degr adation of extracellular biopolymers for uptake of both nitrogen and carbo n. This is particularly important during infection, when microbial proteinases are virtually unregulated by host proteinase inhibitors (Travis et al. 1995). The primary function for th ese proteinases is to provide a source of free amino acids for survival and growth, however, they may also lead to tissue invasion and destruction and evasion of host defenses (Travi s et al. 1995). Other extracellular enzymes produced by bacteria are essential to pathogenicity (e.g. phospholipase in Yersinia enterocolitica (Young et al. 1999)). Extr acellular proteins play an impor tant role in virulence and are transported out of the cell through various mechanisms. Extracellular protein secretion is generall y accomplished through one or more secretion systems. There are at least six secretion systems described, three of which are well characterized (Pugsley 1993, Aizawa 2001). Recent studies indicate that proteins secreted by the type III secretion system (TTSS) often influence bacteria l-host interactions for pa thogens of plants and animals (Hueck 1998). Conven tional secretion systems may not be the only means for pathogenic bacteria to transport pr oteins involved in pathogenicity to the external environment. TTSS often functions only when the bacteria are in direct associat ion with the host. Therefore, proteins transported this way can be classified as contactdependent (Young et al. 1999). Bacteria are also able to secrete proteins extrace llularly through the flag ellar export apparatus, which is similar to the TTSS. Both systems consist of homologous component proteins with common physio-chemical properties (molecular size, isoelectric point, instability index, and

PAGE 35

35 aliphatic index), suggesting that they may have evolved in parallel (Young et al. 1999, Aizawa 2001). Although the flagellar transp ort apparatus was thought to ha ve a role only in organelle biogenesis, it appears to also be required for transport of proteins to the extracellular environment in pathogenic bacteria (Young et al. 1999). Therefore, a functional motility apparatus is not only important for bacterial move ment, but also for the secretion of virulence factors during infection. Despite the evolutionary gap be tween plants and animals, vi rulence factors of pathogens appear to not be specific to one host, but rather, common to many hosts and used by diverse bacterial species (Rahme et al. 1995, Mahajan-Mi klos et al. 2000, Rahme et al. 2000). This conclusion stems from two primary observations: (1 ) bacterial proteinases, serving as virulence factors, are conserved in plants and animals (Travis et al. 1995) and (2) strains of specific pathogenic bacterial species have been shown to infect plants and/or animals (Rahme et al. 1995). Such universal virulence factors have b een termed effectors/toxins and boast a wide range of functions including cy totoxicity, hemolysis, proteolysis, protein phosphorylation, and protein dephosphorylation (Young et al. 1999). Effector prot eins are not the only common virulence factors. In in vivo screens of pathogen virulence fact ors the global response regulator, gacA was identified during infection of both Pseudomonas aeruginosa and Serratia marcescens in the nematode, C. elegans (Rahme et al. 2000, Kurz et al. 2003). Quorum sensing systems controlling bacterial comm unication (Waters and Bassler 2005) have also been identified in P. aeruginosa during infection of both pl ants and animal hosts (Rahme et al. 2000). Pathogenic bacteria have evolved a complement of virulence factors in order to mount an attack on their hosts and while some may be dedicated to a sp ecific host, many are used during infection of plant and animal hosts.

PAGE 36

36 1.9 Hypotheses and Goals In this study the general hypotheses that both corals and microorganisms perceive chemical cues and signals from each other and th at specific signaling a nd genetic and metabolic pathways are involved in the settl ement of coral larvae and the colonization of bacteria on coral mucus were investigated. The experiments with in this study focus on th e interactions between the coral host ( Acropora palmata ) and potentially beneficial bacteria associated with the coral, in addition to pathogenic bacteria able to cause dise ase. These interactions comprise the metabolic capabilities of the bacteria to utilize and grow on coral mucus, and communication via chemical signaling between bacterial cells a nd between the coral and bacteria I hypothesize that specific metabolic pathways and regulatory cascades ar e required for colonizati on and growth on coral mucus and that not only do the bacteria sense the coral host but that the corals respond to chemical cues from bacteria found on coral r eefs. To test these hypotheses, the metabolic capabilities of pathogenic isolates of Serratia marcescens and three native coral-associated ( Photobacterium mandapumensis, P. leiognathi and Halomonas meridiana) were assayed for carbon-source utilization and enzy matic induction. The functiona lity of an evolutionarily conserved two component regula tory system, GacS/GacA, in S. marcescens was tested. Additionally, the response of co ral larvae to different bacterial and environmental cues was investigated.

PAGE 37

37 Figure 1-1. General schematic of a coral po lyp with subsection of surface mucopolysacch aride layer (SML). On polyp figure (1) surface mucopolysaccharide layer (SML), which provides prot ection from UV, desiccation, and potentially disease resistance, (2) gastrodermis, which houses the zooxanthellae (Symbiodinium spp.), (3) zooxanthellae, photosynthetic algae, (4) feeding tentacle used for suspension feeding by coral. The subsection of the SML illustrates the complex environment within the mucus layer secreted by the cora l. Photosynthates produced by the zooxanthellae leads to a net outflux of fixed carbon from the coral tissue. This and ot her organic exudates provide rich nutrien ts for the microbial population (coral residents and visitors) in a ddition to oxygen, thus creating a microaerophill ic environment. Within the microbial population, some bacteria fix atmo spheric nitrogen that can be used by the bact eria and the zooxanthellae. Adapted from (Ritchie and Smith 2004), used with permission from K.B. Ritchie. Bulk water mass Surface Mucopolysaccharidelayer Coral tissue(Microaerophillic)Organic N mineralization decreased C:N ratio O2 CO2 CO2O2 N2 N2fixationZooxanthellaeNet fixed C flowMicrobial biomassSecondary products Organic exudates 1 2 3 4 Bulk water mass Surface Mucopolysaccharidelayer Coral tissue(Microaerophillic)Organic N mineralization decreased C:N ratio O2 CO2 CO2O2 N2 N2fixationZooxanthellaeNet fixed C flowMicrobial biomassSecondary products Organic exudates 1 2 3 4

PAGE 38

38 CHAPTER 2 MATERIALS AND METHODS 2.1 Bacterial Strains, Plasmids, and Culture Conditions. Bacterial strains and plasm ids used in this study are listed in Tabl e 2-1. Unless otherwise indicated, Escherichia coli Serratia marcescens isolates, Agrobacterium tumefaciens and Sinorhizobium meliloti were grown in LB broth (per lite r: 1.0% tryptone; 0.5% yeast extract; 0.5% NaCl Fisher Scientific, Pittsburg, PA). The coral isolated bacteria Photobacterium mandapamensis P. leiognathi, and Halomonas meridiana were routinely grown in GASW broth (per liter: 356 mM Na Cl; 8 mM KCl; 40 mM MgSO4; 20 mM MgCl2 6H2O; 60 M K2HPO4; 7 M FeSO4; 33 M Tris; 0.05% peptone; 0.2% yeast ex tract; 2.0% glycerol) or on 1.5% agar plates (Smith and Hayasaka 1982, Smith et al. 1982). Agrobacterium tumefaciens was also grown in AB minimal mannitol liq uid media (per liter: 17 mM K2HPO4, 8.3 mM NaH2PO4, 18.7 mM NH4Cl, 1.22 mM MgSO4 7H2O, 1.98 mM KCl, 6.8 M, 8.99 M FeSO4 7H2O, 5% mannitol) supplemented with 1% agar (Hwang et al. 1994, Shaw et al. 1997, Cha et al. 1998). Antibiotics were used in selection media at the following concentrations: for E. coli, Ap (100 g/ml); Gm (30 g/ml); Km (50 g/ml), Cb (100 g/ml) Tc (10g/ml) where appropriate; for S. marcescens PDL100, Tc (10 g/ml), Ap (100 g/ml), for Agrobacterium tumefaciens, Gm (30 g/ml), and for Sinorhizobium meliloti Sm (500 g/ml), Neo (50g/ml). Chemically competent cells are routinely ma de using the Inoue Method resulting in a transformation efficiency of 1.12 x 108 (Inoue et al. 1990). Brie fly, overnight cultures of E. coli DH5 are grown in SOB broth (per liter: 2.0% tr yptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, pH 6.7-7.0, Fisher Scientific, Pittsburgh, PA) to an OD600 of 0.3. Cells are washed twice with TB (per liter: 10 mM PIPES; 55 mM MnCl2; 15 mM CaCl2; 250 mM KCl; pH 6.7 Fisher Scientific, Pittsburgh, PA) on ice and pelleted at 2500 x g for

PAGE 39

39 10 minutes at 4 C. Cells are then resuspended in TB and DMSO (Fisher Scientific, Pittsburgh, PA) is added to a final concentration of 7%. Cells are aliquoted and shock frozen with liquid nitrogen and stored at -80 C. 2.2 Manipulations of DNA a nd Pla smid Construction Restriction enzymes, T4 DNA ligase, and Taq Polymerase were purchased from New England BioLabs (Ipswich, MA) and used as r ecommended by the supplier. Plasmid DNA was routinely isolated using QIAprep spin mini-p rep kit (Qiagen, Santa Clarita, CA). DNA restriction fragments and PCR products were el uted in DNA grade water from agarose gels by utilizing the Illustra DNA and gel band purification kit (GE Healthcare, Buckinghamshire, UK). All ligation reac tions were conducted at 14C for a minimum of four hours unless otherwise specified. Genomic DNA was prepared by standard methods as described previously (Sambrook and Russell 2001) with the following modifications fo r optimization. Cells from a 5 ml overnight culture were pelleted and washed with DNA grade wa ter. Cell were lysed by vortexing with acid washed glass beads (150-212 m in diameter, Si gma Aldrich, Atlanta, GA) with equal volumes phosphate buffer (120 mM K2PO4, pH 8.0) and water-saturated phenol, pH 8.0 (Fisher Scientific, Pittsburgh, PA). The mixture was vortexed for 15 seconds before centrifugation at 14, 500 rcf for 5 minutes. The aqueous phase was treated with RNAse A for 2 minutes at room temperature. One volume of saturated phenol (pH 8.0) was mixe d with the DNA and centrifuged at high speed for 1 minute. The aqueous phase was mixed with one volume of phenol:chloroform:isoamyl alcohol (25:25:1, pH 8.0, Fisher Scientific, Pitts burgh, PA) and centrifuged at high speed for one minute. The aqueous phase was mixed with one volume of chloroform:isoamyl alcohol (24:1) and centrifuged for one minute yielding an aqueous containing protein-fr ee DNA. 0.34 volumes of 3.0 M sodium acetate (pH 5.2) and 3.5 volumes of isopropanol were added and inverted until

PAGE 40

40 DNA was visible. DNA was spooled with a plastic pipette tip and transferred into a new microcentrifuge tube and left to air dry. 0.1 volumes of 3.0 M sodium acetate (pH 5.2) and 3 volumes of ice cold absolute ethanol we re added to dried DNA and placed at -80 C for 30 minutes. The DNA mixture was centrifuged at 10,000 rcf for 10 minutes and supernatant was discarded. The DNA was then washed twice with ice-cold 70% ethanol in the same manner as above. After the second wash, precipitated DNA wa s dried completely and was stored at -20 C until used. Genomic DNA was reconstituted in 50-100L of DNA-grade water with incubation at 50 C to solublize the DNA. 2.2.1 Identification of g acA in Serratia mar cescens PDL100, White Pox Pathogen The gacA gene was amplified from the S. marcescens genomic DNA using primers CJK12 and CJK18 (Table 2-2), whic h were designed based on the gacA sequence from S. plymuthica (NCBI GenBank: AY057388). PCR conditions included initial denaturation at 95 C for 7 minutes, 35 cycles (95 C, 1 minute, 53 C, 1 minute, 72 C, 2.5 min) and a final extension at 72 C for 10 minutes. The resulting 957 bp product was cloned into pCR2.1 using a TOPO TA kit (Invitrogen, Carlsbad, CA), transfor med into chemically competent DH5 and sequenced (Agencourt Bioscience Corp., Be verly, MA). A nucleotide BLAST in the NCBI database confirmed that the amplifie d sequence matched that of S. plymuthica 2.2.2 Construction of a Plasmid that Contains Arabinose-Inducible g acA To test whether gacA of S. marcescens PDL100 is functional, its ability to com plement a gacA ( uvrY ) mutation in E.coli uvrY33::kan was tested. Therefore, a complementation construct was engineered to complement a previously engineered mutant in the uvrY gene of E. coli through a transposon (tn5) inserti on (M. Teplitski, unpublished data). To engineer a construct to complement the uvrY mutant in E. coli the gacA gene from p1318 was cloned into pBAD18-Ap. Plasmid p1318 wa s digested with EcoRI and the resulting

PAGE 41

41 fragments were sub-cloned into the EcoRI site of the arabinose-induc ible promoter vector, pBAD18-Ap, which yielded pCJK3 and was tr ansformed into chemically competent E. coli DH5 Transformants were selected on LB agar supplemented with Ap 200 g/ml. Orientation of the insert was confirmed by PCR using pr imers MT13 and CJK18 (Table 2-2, Fig. 2-1). 2.3 Complementation Assay To test the functionality of gacA in Serratia marcescens PDL100, an arabinose inducible promoter-based complementation assay was performed. The complementation vector pCJK3 was transformed into E. coli RG133 pMT41 by electroporation (25 F, 200 2.5 kV, 0.2 cm cuvette, 50 L cell volume) using a Bio-Rad MicroP ulser (Bio-Rad Laboratories, Hercules, CA). As vector controls, the original pBAD18-Ap v ector was transformed into both the wild-type reporter E. coli 1655 pMT41 and its isogenic uvrY33::kan derivative reporter E. coli RG133 pMT41. Two overnight cultures of each strain were grown in LB with appr opriate antibiotics at 37 C on a rotary shaker (180 rpm). Following ov ernight incubation, cultu res were diluted 1/100 in LB and incubated at 37 C for 3 hours on a rotary shaker (180 rpm). Cultures were diluted to an OD600 of 0.3, and then diluted 1/25000 and aliquoted into a black polyst yrene 96-well plate (in quadruplicate). Luminescence was measured with Victor-3 (Perkin Elmer, Shelton, CT) every hour for ten hours and the expression of th e complemented mutant was compared to the wild-type reporter strain. 2.4 Carbon Source Utilization Prof ile Using Bio log Ecoplate Assay Carbon-source utilization of the white pox pathogen, Serratia marcescens PDL100, and fifteen other isolates of Serratia marcescens and other coral isolated bacteria was assayed using Biolog EcoPlates. These 96-well plates are ma nufactured with 31 different substrates in triplicate per plate with a water control (Table 2-3). The EcoPlates rely on the tetrazolium violet dye redox reaction, which detects fermentation of sole carbon sources (Garland and Mills 1991,

PAGE 42

42 Garland 1997). Assays were set up according to Choi and Dobbs (1999) with the following modifications (Choi and Dobbs 1999). Isolates we re grown in either 5 ml LB broth or GASW broth overnight at 30 C with shaking. Cells were pelleted at 10,000 x g using an Eppendorf table-top centrifuge 5415D (Eppendorf, Hamburg, Germany) and washed twice with filter sterilized (0.22 m) seawater to remove any residual nutrients fr om the overnight media. Cells were then resuspended in 10 ml filter steri lized seawater and starved for 24 hours at 30 C. Following the starvation period, 100 L of cell su spension was inoculated into each well of the Biolog EcoPlate. The initial A590 of each plate was read on Vict or-3 (Perkin Elmer, Shelton, CT) and was continuously read every 24 hours for a total of 72 hours. 2.5 Enzyme Induction during Growth on Coral Mucus While the exact com position of coral mucu s is unknown, detection of specific enzymes induced in response to growth on coral mucus can tell us certain types of bonds within the coral mucus matrix. Enzymatic induction assays using p-nitrophenyl chromogenic substrates allow for detection of individual specific enzymes induced in response to growth on a certain medium or in a specific niche. In add ition to identifying specific bonds in the various components of coral mucus, the ability of different isolates and strain s of bacteria to utilize the components of coral mucus may elucidate phenotypic relatedne ss among bacterial species and strains. Serratia marcescens isolates from wastewater, canal water and other environments were compared with a pathogenic strain of the same sp ecies and three coral associated bacterial strains isolated from Acropora palmata mucus (Table 2-1). Two overnight cultures of each isolate were grown in 5 ml Luria-Bertani (LB) broth or in GASW broth to an approximate OD600 of 2.0 (stationary phase), which was determined spectro photometrically. Cells were pelleted at 10,000 rcf and washed 3 times in filtered-sterilized seawater (0.22 m) buffered with 10 mM HEPES to remove any residual nutrients and resuspended in 5 ml of buffered seaw ater. The cells were

PAGE 43

43 starved in filter-steri lized seawater at 30 C while shaking for three da ys in order to use up any internal resources. A three-da y starvation period was found suffici ent during preliminary studies with S. marcescens PDL100. Following the three-day starvation, 1 ml of cells was added to 2 ml of either 1x coral mucus (freeze dried, UV irradiated for 20 minutes and reconstituted to original volume (Ritchie 2006)) or 10 mM HEPES buffered seaw ater). Negative controls of coral mucus alone and buffered seawater alone were performed in parallel with the experimental treatments for each isolate. Cells were incubated in treatments for two and eighteen hours at 30 C. Following incubation, the initial OD590 of each treatment was determined spectrophotometrically and recorded. Cells where then mixed with Z-buffer (1:1 v:v) and lysed with 0.1% sodium dodecyl sulfate solution a nd chloroform (4:1 v:v) (Miller 1972 ). Cell suspension was aliquoted into chloroform-resistant microcentrifuge t ubes so to accommodate two biological and two technical replicates per substrat e per treatment. Enzymatic substrates were prepared in HPLCgrade water and each substrate was added to the a ppropriate reactions to a final concentration of 0.8 g/L. Assays were conducted at room temperature for approximately 24 hours to allow for maximum color development. Sodium carbonate (Na2CO3) was added to a final concentration of 416 mM to stop the reaction and to intensify th e color of each reaction. Cellular debris and unused enzymatic substrate were pelleted at 4,000 x g (16,000 rcf) for two minutes. The clear supernatant was transferred to a clea r polystyrene 96-well plate and the A405 was measured on Victor-3 (Perkin Elmer, Shelton, CT). Buffered seawater and coral mucus were included in each plate as blanks. Representative isolates from the three broad categories of Serratia marcescens isolates examined (human isolate, Sm 43422; environm ental isolate, Sm39006; and white pox pathogen, PDL100) were also assayed with a treatment te sting whether the catabo lic capabilities of the

PAGE 44

44 isolates could be repressed in the presence of glucose. A minimal media consisting of 10 mM HEPES buffered seawater supplemented with gluc ose (4 g/L) and Casamino Acids (0.1 g/L) as the sole carbon and nitrogen sources was filte r sterilized through a 0.22 m filter. This additional treatment was examined due to the ob servation that some enzymes appeared to be induced during starvation stress regardless of which treatment ultimately experienced by the cells. Glucose is a known catabolite repressor. In Enterobacteriaceae glucose inhibits expression of catabolic and regulat ory genes required for growth on most other carbon sources; glucose also inhibits expression of virulenc e genes and regulators (Ferenci 1996, Reverchon et al. 1997, Jackson et al. 2002, Gosse t et al. 2004, Teplitski et al. 2006). As controls for this treatment, cells were also incubated with 10 mM buffered seawater supplemented with Casamino Acids (0.1 g/L) without glucose and buffered seawater alone. The enzyme induction assay was conducted as described above. 2.6 Proteinase Induction in Response to Coral Mucus Acroporid coral mucus is made of a variety of carbon and nitrogen compounds and may consist of up to 22% protein (Ducklow and M itchell 1979). These proteins provide serve as nutritional substrates to those b acteria able to utilize them as a food source. Therefore, it is plausible that induction of various proteinases may occur in response to growth on coral mucus. The production of proteinases during growth in ri ch medium was first investigated for both cellassociated and extracellular pr oteinase production (Demidyuk et al. 2006). A volume of 0.3 ml of either cell suspension or culture supernat ant was added to 1.7 ml of azocasein solution (5 mg/ml azocasein in 0.1 M Tris Buffer pH 7.5) resulting in a solution with final azocasein concentration of 0.16 mg/ml. As a control, a blank of 0.16 mg/ml azocas ein solution in water was prepared. Reactions were allo wed to incubate statically at 30 C for 60 min. Following incubation, trichloroacetic acid (TCA) was added to each reaction to a final concentration of

PAGE 45

45 3.2% v:v to stop the enzymatic reaction and to precipitate any unhydrolyzed azocasein. Each reaction was pelleted at 10,000 x g for 1 min to sediment the unhydrolyzed substrate. The supernatant was carefully transferred to a new tube, to which NaOH (250 mM final concentration) was added to intensify the color. 200 L of each reaction was transferred to a clear polystyrene 96-well plat e and the A405 of each reactio n was read on VICTOR-3. 2.7 Presence of Lumichrome and Riboflavin in Coralline Algae 2.7.1 Thin Layer Chromatography of Pure Compounds In order to d etermine the conditions necessa ry for pure lumichrome and riboflavin to sufficiently migrate on the TLC plate (Whatman KC18 Silica Gel 60 with fluorescent indicator, 10 x 10 cm, 200 m thick), saturated solutions of lumichrome and riboflavin in methanol:HCl (49:1) and in pure methanol were prepared (Phillips et al. 1999) Samples were pelleted to eliminate any particulate matter in solution as lu michrome and riboflavin have low solubility in many solvents. A total of 3 L of each mix and the solvent (methanol:HCl) were spotted onto the TLC plate. The plate was developed with a mobile phase of chloroform:methanol:water (17.5:12.5:1.5) (Phillips et al. 1999 ). A total time of approximate ly 40 minutes was required for the mobile phase to migrate to the top of the plate. Dilution series of the pure samples was perfor med in order to optim ize the concentration for visualization on TLC plates. Using stock solutions of 2800 g/L lumichrome and riboflavin, 1, 10 and 50 L were spotted onto the TLC plate in addition to 50 L of the solvent (methanol:HCl). The TLC was developed using the same mobile phase as above. 2.7.2 Methanol Extraction of Coralline Algae The presence of lum ichrome and riboflavin in coralline algae was tested through methanol extraction (Phillips et al. 1999). Briefly, approximately 10 g of cora lline algae, frozen in liquid nitrogen, were ground into a paste to which pure methanol was added and transferred to a 15 ml

PAGE 46

46 plastic tube. The suspension was vortexed vigorously, and allowed to settle on ice. The contents were filtered using a Whatman 0.45 L filter. This extraction process was performed three times. The methanol was rotary-evaporated at 45 C at a pressure of 337 mbar, and then at 80 mbar for five hours on a Bchi Rotavapor R-200 (B chi Labortechnik AG, Flawil, Switzerland). The final dried sample was reconstituted in 400 L of methanol:HCl (49:1) to be used for TLC. The methanol-extracted coralline algae sa mples were spotted onto the TLC plate in volumes of 1, 5, 10, and 25 L. Five microliters of the pure lumichrome and riboflavin stock solutions were spotted as well as 25 L of the methanol:HCl solvent. The plate was developed with chloroform:methanol:water (17.5:12.5:1.5) fo r 40 minutes, allowed to dry and visualized using a UV transluminator. 2.7.3 Solvent Partitioning of Lumichrome and Riboflavin Due to the suspicion that chlorophyll is also extracted with m ethanol from the coralline algae, solvent portioning was attempted to se parate lumichrome from chlorophyll. As a chlorophyll control, chlo rophyll was extracted from grass blad es with methanol. The starting solvent was methanol, which was then mixed with either ethyl acetate, isopropanol, chloroform, or tetrahydrofuran. If the two solvents were miscible then a 1:1 chloroform:water step was added. The solution was vortexed and then centrifuged to separate phases. Since lumichrome and riboflavin are yellow in solution and chloro phyll is green, simple observation on the phase color indicated the presence of each chemical. Acid (0.05 M HCl) and base (0.05 M NaOH) were added to each solvent mix to test the effect of pH on the partitioning. Solvent partitioning was applied to the corallin e algae extracts in order to separate chlorophyll from lumichrome and riboflavin and therefore result in a cleaner run on the TLC. The extracts were treated with methanol and ethyl acetate solvents mixed with chloroform and water and treated with 0.05 M NaOH. This resu lted in the yellow lumichrome in the top phase

PAGE 47

47 and the green chlorophyll in the bottom phase. The top phase was transferred to a new Eppendorf 1.5 ml tube and stored until used for TLC. Solvent partitioned coralline algae extr acts were separated TLC with both chloroform:methanol:water (17.5:12.5:1.5) and also methanol:water (3:2) mobile phases. The samples were running quickly with the mobile front so a more hydrophobic mobile phase of chloroform:methanol:water (35:12.5:1.5) was used. 2.8 Induction of Coral Larvae Settlement and Metamorphosis Acropora palmata and Montastrea faviolata gam etes were collected from Looe Key Reef, FL in August 2006 and 2007 during mass spawning ev ents. Fertilization and rearing of larvae were conducted at Mote Marine Laboratory Trop ical Research Center (Summerland Key, FL). Settlement experiments were set up in six well Petri plates to test the effects of pure lumichrome, riboflavin, microbial biofilms of coral-associated bacteria, and N -a cyl-h omoserine l actones (AHLs) have on the settlement and metamorphosis of coral larvae. Lumichrome and riboflavin were used due to the observation that lumichrome induces settlement in as cidian larvae and their involvement in inter-kingdom communication (Tsukamoto 1999, Tsukamoto et al. 1999). N -acyl-homoserine lactones are signaling mol ecules and are critical components of the communication system, quorum sensing (Waters a nd Bassler 2005, West et al. 2007). For this experiment, 3-oxo-C6 homoserine lactone (a shor t-chain AHL) and C14 homoserine lactone (a long-chain AHL) were used. 3-oxo-C6 HSL is a common AHL produced by bacteria involved in quorum-sensing systems (Mohamed et al. 2008). C14 HSL was selected for these experiments based on the observation that many marine asso ciated alpha-proteobacter ia produce long-chain AHLs (Wagner-Dobler et al. 2005, Mohamed et al. 2008).

PAGE 48

48Table 2-1. Bacterial strains and plasmids Strain or plasmid Relevant characteristic(s)a Source or reference E. coli hosts for cloning/construction DH5 F80lac Z M15 ( lac ZYAarg F) U169 rec A1 end A1 hsd R17 (rk-, mk+) phoA sup E44 thi -1 gyrA96 rel A1 Invitrogen S17 -pir rec A thi -1 pro AB+ hsd R-M+
PAGE 49

49Table 2-2. Primers used for PCR Primer name Sequence Nucleotide binding site M13F GTAAAACGACGGCCAG 443-448 of bottom strand of pCR2.1 (EF488744) M13R CAGGAAACAGCTATGAC 205-221 of top strand of pCR2.1 (EF488744) CJK12 GGAGATTTTTCCTTGATTAGCGTTCT 413-438 of top strand of S. plymuthica gacA (AY057388) CJK13 ACATCTCAGGCTATAACAGAGGCTG 367-391 of top strand of S. plymuthica gacA (AY057388) CJK18 TCGTCACGCAAAAGAACATTATATC 1345-1369 of bottom strand of S. plymuthica gacA (AY057388) MT13 ACTTTGCTATGCCATAGCATTTTTA 1200-1224 of top strand of pBAD18-Ap (X81838)

PAGE 50

50 Table 2-3. Carbon substrates in Biolog EcoPlates Polymers -cyclodextrin glycogen Tween 40 Tween 80 Carbohydrates D-cellobiosea i-erythritol D-galactonic acid -lactone N-acetyl-D-glucosamine glucose-1-phosphate -methyl-D-glucoside D,L-glycerol phosphate -D-lactose D-mannitol D-xylosea Carboxylic acids -hydroxybutyric acid -ketobutyric acid D-galacturonic acid D-glucosaminic acid itaconic acid D-malic acida pyruvatic acid methyl ester Amino acids L-arginine L-asparaginea glycyl-L-glutamic acid L-phenylalanine L-serine L-threonine Amines phenyl ethylamine putrescine Phenolic compounds 2-hydroxybenzoic acida 4-hydroxybenzoic acida aIndicates substrates not in GN plates.

PAGE 51

51 Figure 2-1. Consturction of an arabinose inducible complementation vector. (A) Complementation vector, pCJK3 plasmid map annotated with single restriction enzyme cut sites. gacA from S. marcescens PDL100 cloned downstream of the arabinose inducible promoter. (B ) Gel electrophoresis of PCR of gacA cloning into pBAD18-Ap using primers MT13 and CJK18 (Table 2-2). Lanes 2-19 are colony PCR of gacA from p1318 cloned into the EcoRI s ite of pBAD18-Ap and transformed into DH5 and selected on LB supplemented with Amp 200 g/ml. Lane 20 is pBAD18-Ap plasmid DNA as a template a nd lane 21 is the PCR master mix as a negative control. Positive reactions used for complementation assay indicated by(*). The DNA ladder used is 1 Kb Full Scale Ladder (Fisher Scientif ic, Pittsburgh, PA). A B **

PAGE 52

52 CHAPTER 3 PHENOTYPIC CHARACTERIZATION OF A COR AL WHITE POX PATHOGEN, Serratia marcescens 3.1 Introduction Opportunistic pathogens, such as Serratia marcescens rely on specific metabolic activities in order to utilize certa in carbon sources present in thei r environment. These activities may allow the pathogen to occupy metabolic niches within the host and promote growth and ultimately infection (Berg et al. 2005, Munoz-Elia s and McKinney 2006). Most of the metabolic genes and pathways involved in growth and host infection by opport unistic pathogens are uncharacterized. As most opportunistic pat hogens are heterotrophs, they are capable of metabolizing a wide variety of carbon sources su ch as carbohydrates, lip ids, glycolipids, and dicarboxylic and amino acids (Munoz-Elias and McKinney 2006). The ability of pathogenic bacteria to utilize many carbon sources also contributes to their ability to persis t in a wide variety of environments and hosts. Many genera of bact eria, including Burkholderia, Enterobacter, Herbaspirillum Ochrobactrum Pseudomonas, Ralstonia Staphylococcus and Stenotrophomonas contain rhizosphere-associated bacteria that enter into interactions with plants and humans (Berg et al. 2005). This may be attributed to the rich nu trients associated with the rhizosphere due to high levels of root exudates (Campbell et al. 1997). The example of the rhizosphere as an oasis of rich and available nutrients surrounded by nutrient poor bulk soil is analogous to coral mucus surrounded by nutrient lim ited open water. They are able to support a different consortium of bacteria as opposed to their surrounding environments. Opportunistic pathogens may persist in these environments wh ile in between hosts (Whipps 2001). A number of potentially pathogenic organisms, including Aeromonas Clostridium Klebsiella Legionella Listeria Pseudomonas, and Vibrio are either naturally active in estuaries and oceans or able to persist in dormant states (Grimes 1991, Harvell et al. 1999). The rich nutrients of coral mucus

PAGE 53

53 may also explain the relatively high abundance of microorganisms in mucus layers of corals as compared to the surrounding water (Lipp and Gr iffin 2004, Ritchie and Smith 2004). The use of non-host environments by opportunistic pathogens pr ovides valuable insight to their metabolic potentials and commonalities that exist between organisms. Many techniques are available for the identi fication and classification of environmental and clinically isolated bacteria including culture-based growth media, nucleic acid isolation, fatty-acid methyl-ester (FAME) analysis and fluorescence in situ hybridization (FISH) (rev. (Hill et al. 2000)). Metabolic profiles generated through the use of sole carbon substrate tests provide a relatively quick method to both identify and cl assify microbial organisms (Garland and Mills 1991, Garland 1997, Konopka et al. 1998, Hill et al. 2000, Preston-Mafham et al. 2002). The BIOLOG Microplate bacterial identification system was first introduced for the purpose of assessing the functional identity of microorganisms from environmental samples (Garland and Mills 1991). Rapid identification of individual isolates is based on sole-carbon source utilization of 95 individual carbon sources and a water control in a 96-well plat e. Plates specific to Gramnegative and Gram-positive bacter ia (GN and GP MicroPlates, respectively) were developed with appropriate carbon sources for each group (Preston-Mafha m et al. 2002). Despite their initial intentions of individual isolate characterization, GN plates were also used to analyze bacterial communities (Konopka et al. 1998). Additional plates were developed for bacterial diversity analysis at the community level. BI OLOG EcoPlates use the same principles as GN plates but instead of 95 individual substrates, they contain 31 subs trates and a water control with intra-plate triplication (Choi and Dobbs 1999). The EcoPlates contain some substrates in common with the GN plates but also contain more complex and ecologically relevant substrates, including photosynthetic exudates, which better reflect the divers ity of substrates found in the

PAGE 54

54 environment (Hill et al. 2000). The rapid nature of the BIOLOG plates has contributed to their wide use, but the system is not without its limitations. There are certain considerati ons that need to be accounted for when using the BIOLOG method for analysis at both the individual and community levels. The density of the inoculum is important and should be standardized if comparisons between isolates or samples will be made. If the inoculum varies between plates then the resulting patterns of carbon source utilization may be biased (Konopka et al. 1998, Hill et al. 2000, Preston-Mafham et al. 2002). Functional diversity analysis is based on the assumption that color development is a function of the proportion of organisms present that can utilize a specific substrat e. This, however, may not be the case. Some substrates are simply utilized more readily than others and some organisms are more efficient at utilizing various substrates (Hill et al. 2000). A third problem associated with using the GN plates to compare isolates from different environments is that many of the substrates are not ecologically rele vant and do not adequately reflect the diversity of substrates in the environment (Campbell et al. 1997, Konopka et al. 1998). The GN plates are biased toward simple carbohydrates, which are utilized by a wide variety of bacteria. This results with metabolic redundancy during comparison of metabo lic profiles (Preston-Mafham et al. 2002). With the considerations mentioned above in mind, EcoPlates were used to compare metabolic profiles of previous ly identified isolates of Serratia marcescens and coral-isolated bacteria. The EcoPlates were used due to their in clusion of more ecologica lly relevant substrates representing a variety of environments, which encompass those from which the isolates were collected. A comparison of the resolution of both EcoPlates and GN plates showed no significant differences in the cluster analysis (Choi and Dobbs 1999). Therefore, the lack of the common simple carbohydrates in the EcoPlates should not influe nce the downstream analysis.

PAGE 55

55 As discussed earlier, heterotrophic bacteria are capable of utilizi ng a variety of carbon sources. One study positively iden tified upwards of twenty gene s directly related to carbon compound catabolism induced in E. coli by growth on murine intestinal mucus (Chang et al. 2004). Specific genes involved in catabolism of N-acetylglucosamine, pentose, fucose and ribose were induced during initia l colonization and growth on inte stinal mucus as opposed to genes involved in degradation of ethanolamine, anaerobic respiration, and the TCA cycle were induced at a later time point (Chang et al. 2004). Coral mucus is comprised of proteins, amino acids and carbohydrates th at contain glucose, galactose, glucosamine (chitin), galactosamine, fucose and arabinose (Ducklow and Mitchell 1979, Meikle et al. 1988), although the structure of coral mucus and chemical bonds by which the individual components of mucus are held are not known. Catabolic enzymes, such as chitinase, are induced during colonization of inte stinal tracts and inverteb rate larvae by marine bacteria (Bassler et al. 1991, Lertcanawanichakul et al. 2004, Bhowmick et al. 2007). Chitin is the second most abundant homopolymer (repeats of the same monomers) in nature and is ubiquitous in the environment. Production of proteinases also may enhance ba cterial metabolism, allowing bacteria to persist on such a wide assortment of carbon sources. Bacteria generally obtain their carbon and nitrogen through enzymatic degradation of ex tracellular biopolymer s by proteinases and glycosidases (Travis et al. 1995) Often these proteinases have broad substrate specificity (Travis et al. 1995, Ovad is et al. 2004). Serratia marcescens is known to produce both extracellular and cell-associat ed proteinases, which function in catabolism and virulence associated behaviors (Schmitz and Braun 1985, Ovadis et al. 2004). Just as catabolic enzymes

PAGE 56

56 are induced by growth c onditions; it is likely that opportuni stic pathogens produce proteinases during establishment and growth on a host. In this experiment, the metabolic capabil ities and enzymes involved in coral mucus utilization of Serratia marcescens PDL100, human and environmental S. marcescens isolates, and coral-associated bacteria were investigated. I hypothesized that PDL100 should exhibit a unique metabolic profile similar to coral-associated bacteria as compared to other isolates of Serratia marcescens Its ability to grow on coral mucus and cause disease may suggest that it has evolved specific pathways for the utilization of the nutrients comprising coral mucus. This hypothesis was tested through sole-carbon s ource utilization prof iling with BIOLOG EcoPlates and enzymatic and proteinase induc tion by coral mucus assays. This experiment provides useful information about the types of pathways and enzymes used by S. marcescens PDL100 during growth on coral mucus and pr ovides a foundation for the identification of specific genes induced during colonization of the pathogen. 3.2 Materials and Methods 3.2.1 Carbon Source Utilization Profile Using Biolog Ecoplate Assay Carbon-source utilization of the white pox pathogen, Serratia marcescen s PDL100, and fifteen other isolates of Serratia marcescens and other coral isolated bacteria (Table 2-1) was assayed using Biolog EcoPlates. These 96-well plates are manufactured with 31 different substrates in triplicate per plate with a water co ntrol (Table 2-3). The EcoPlates rely on the tetrazolium violet dye redox reaction, which detects fermentation of sole carbon sources (Garland and Mills 1991, Garland 1997). Assays were set up according to Choi & Dobbs (1999) with the following modifications (Choi and Dobbs 1999). Isolates were grown in either 5 ml LB broth or GASW broth overnight at 30 C with shaking. Cells were pelleted at 10,000 x g using an Eppendorf table-top centrifuge 5415D (Eppendorf, Ha mburg, Germany) and washed twice with

PAGE 57

57 filter sterilized (0.22 m) seawater to remove any residual nutri ents from the overnight media. Cells were then resuspended in 10 ml filter st erilized seawater and starved for 24 hours at 30 C. Following the starvation period, 100 L of cell su spension was inoculated into each well of the Biolog EcoPlate. The initial A590 of each plate was read on Vict or-3 (Perkin Elmer, Shelton, CT) and was continuously read every 24 hours for a total of 72 hours. 3.2.2 Enzyme Induction in Response to Growth on Coral Mucus While the exact com position of coral mucu s is unknown, detection of specific enzymes induced in response to growth on coral mucus can tell us certain types of bonds within the coral mucus matrix. Enzymatic induction assays using chromogenic substrates allow for detection of individual specific enzymes induced in response to growth on a cer tain medium or in a specific niche. In addition to identifyi ng specific bonds in the various components of coral mucus, the ability of different bacterial isol ates and strains of bacteria to utilize the components of coral mucus may elucidate phenotypic relatedne ss among bacterial species and strains. Serratia marcescens isolates from wastewater, canal water and other environments were compared with a pathogenic strain of the same sp ecies and three coral associated bacterial strains isolated from Acropora palmata mucus (Table 2-1). Two overnight cultures of each isolate were grown in 5 ml Luria-Bertani (LB) broth or in GASW broth (Smith and Hayasaka 1982, Smith et al. 1982) to an approximate OD600 of 2.0 (stationary phase), which was determined spectrophotometrically. Cells were pelleted at 10,000 rcf and washed 3 times in filteredsterilized seawater ( 0.22 m) buffered with 10 mM HEPES to remove any residual nutrients and resuspended in 5 ml of buffered seawater. The cells starved in filter-sterilized seawater at 30 C while shaking for three days in order to use up any in ternal resources. A three-day starvation period was found sufficient during preliminary studies with S. marcescens PDL100. Following the three-day starvation, 1 ml of cells was added to 2 ml of either 1x coral mucus (freeze dried,

PAGE 58

58 UV irradiated for 20 minutes and reconstituted to original volume (Ritchie 2006)) or 10 mM HEPES buffered seawater). Nega tive controls of coral mucus alone and buffered seawater alone were performed in parallel with the experiment al treatments for each isolate. Cells were incubated in treatments for two and eighteen hours at 30 C. Following inc ubation, the initial OD590 of each treatment was determined spectrophot ometrically and recorded. Cells where then mixed with Z-buffer (1:1/v:v) and lysed with 0.1% sodium dodecyl sulfate solution and chloroform (4:1/v:v) (M iller 1972). Cell suspensions were al iquoted into chloroform-resistant microcentrifuge tubes so to accommodate two biological and two tec hnical replicates per substrate per treatment. Enzymatic substrates were prepared in HPLC-grade water and each substrate was added to the appropr iate reactions to a final concen tration of 0.8 g/L. Assays were conducted at room temperature for approxi mately 24 hours to allow for maximum color development. Sodium carbonate (Na2CO3) was added to a final con centration of 416 mM to stop the reaction and to inte nsify the color of each reaction. Ce llular debris and unused enzymatic substrate were pelleted at 4,000 x g (16,000 rcf) for two minutes. The clear supernatant was transferred to a polystyrene 96-well plate and the A405 was measured on Victor-3 (Perkin Elmer, Shelton, CT). Buffered seawater and coral mu cus were included in each plate as blanks. Representative isolates from the three broad categories of Serratia marcescens isolates examined (human isolate, Sm 43422; environm ental isolate, Sm39006; and white pox pathogen, PDL100) were also assayed with a treatment te sting whether the catabo lic capabilities of the isolates could be repressed in the presence of glucose. A minimal media consisting of 10 mM HEPES buffered seawater supplemented with gluc ose (4 g/L) and Casamino Acids (0.1 g/L) as the sole carbon and nitrogen sources was filte r sterilized through a 0.22 m filter. This additional treatment was examined due to the ob servation that some enzymes appeared to be

PAGE 59

59 induced during starvation stress regardless of which treatment ultimately experienced by the cells. Glucose is a known catabolite repressor. In Enterobacteriaceae glucose inhibits expression of catabolic and regulat ory genes required for growth on most other carbon sources; glucose also inhibits expression of virulenc e genes and regulators (Ferenci 1996, Reverchon et al. 1997, Jackson et al. 2002, Gosse t et al. 2004, Teplitski et al. 2006). As controls for this treatment, cells were also incubated with 10 mM buffered seawater supplemented with Casamino Acids (0.1 g/L) without glucose and buffered seawater alone. The enzyme induction assay was conducted as described above. 3.2.3 Protease Induction in Response to Coral Mucus Acroporid coral mucus consists of a variety of carbon and nitrogen compounds and may contain of up to 22% protein (Ducklow and Mitchell 1979). These pr oteins may serve as substrates to those bacteria able to utilize them as a food source. Therefore, it is plausible that induction of various proteases may occur in re sponse to growth on coral mucus. The production of proteases during growth in rich medium was first investigated for both cell-associated and extracellular protease production (Demidyuk et al. 2006). A volume of 0.3 ml of either cell suspension or culture supernatant was added to 1.7 ml of water and azocasein solution (5 mg/ml in 0.1 M Tris Buffer pH 7.5) was added to a final concentration of 0.16 mg/ml. As a control, a blank of 1.6 mg/ml azocasein solution in wate r was prepared. Reactions were incubated statically at 30 C for 60 min. Following incubation, trichloroacetic acid (TCA) was added to each reaction to a final concen tration of 3.2% v:v to stop the enzymatic reaction and to precipitate any unhydrolyzed azocasein. Each reaction was pelleted at 10,000 x g for 1 min to sediment the unhydrolyzed substrate. The supernat ant was carefully transferred to a new tube, to which NaOH (250 mM final concentration) was added to intensify the color. 200 L of each

PAGE 60

60 reaction was transferred to a clear polystyrene 96-well plate and the A405 of each reaction was read on VICTOR-3 (Perkin Elmer, Shelton, CT). 3.2.4 Statistical Analysis Carbon utilization profile data assayed with the BIOLOG EcoPlates were analyzed by average well color developm ent (AWCD) and pr incipal components analysis (PCA). AWCD was calculated as ( C R) / n, where C is color production within each well (optical density measurement), R is the absorbance values of the plates control well, and n is the number of substrates (EcoPlates, n = 31) (Garland and Mills 1991, C hoi and Dobbs 1999). Principal components analysis was performed on transforme d AWCD data after 72 hours. Values from the wells of individual substrates (3 replicates for each substrate) were averaged and transformed using the formula ( C R ) / AWCD. PCA projects original data onto new, statistically independent axes (principal components). Each principal component accounts for a portion of the variance from the original data (Garland 1997, Choi and Dobbs 1999). Relationships among isolates were obtained by correlation analys is between the principal component values. Enzymatic activities of each isolate were comp ared using correlation analysis after meancentering the original values. Hierarchical cluste r analysis was used to generate dendograms to correlation relationships among isolates. Induction of both extracellular and cell-associ ated proteases among isolates was compared using a one-way Analysis of Variance (ANOVA) with type I error significance level at = 0.05. All data were analyzed with STATISTICA software versio n 6.0 and/or Microsoft Excel 2003. 3.3 Results 3.3.1 Carbon Source Utilization Profile Using BIOLOG Ecoplate Assay The metabolic profiles of Serratia marcescens PDL100, human and environmental Serratia marcescens isolates, and coral-associated bact eria were identified using the BIOLOG

PAGE 61

61 EcoPlates. The EcoPlates incorporate enviro nmentally relevant sole-carbon substrates and represent the diversity of the various habitats that these isolates were collected from (Hill et al. 2000). Based on the heterogeneity of environmen ts of isolation, I hypothe sized that isolates collected from similar environments would show a similar carbon-source u tilization as compared to isolated collected from distinctly different environments. Serratia marcescens PDL100 was expected to show a profile sim ilar to environmental isolates and coral-associated bacteria, distinct from the human and plant pathogenic isolates. The average well color development (AWCD) was calculated after every 24 hour reading and was plotted over time. The color development in the EcoPlate seeded with Serratia marcescens PDL100 followed a linear curve thro ugh the 72-hour measurement period. Similarly, the color development of the pathogenic isolates of S. marcescens also followed a linear curve (Fig. 3-1A). The co ral associated bacteria exhibi ted a rapid average well color development, which then reached a plateau afte r 24 hours of incubation (Fig. 3-1B). The two Photobacterium isolates showed the same progre ssion of color development while the Halomonas showed an overall lower level of color development. The various environmental isolates of S. marcescens revealed the greatest variety of color development (Fig. 3-1C), which may represent the diversity of environments from which they were isolated. The differences in the AWCD among the Serratia isolates indicates that effectiv eness of an isolate at utilizing specific carbon sources is depende nt on the environment in which it is found. The pathogenic isolates all encounter similar nutrients during th eir respective host infecti ons and therefore show similar AWCD. The environmental isolates were isolated from diverse environments, each with a potentially unique suite of carbon sources. This diversity between isolates shows that although

PAGE 62

62 all isolates are genetic ally identified as S. marcescens, subtle but important differences in terms of their metabolic potentials exist. The average well color development for each isolate, transformed for PCA, was compared after 72 hours of inc ubation. Correlation analysis wa s then applied to group the isolates based on their ability to utilize the carbon sources in the EcoPlates. Isolate EL139 (FL Keys wastewater isolate) proved to be an ex treme outlier throughout all analyses and therefore was excluded in the final cluster analysis. The correlation analysis indi cated that PDL100 has a similar carbon-utilization profile to many of the other isolates tested (r 0.5; except for EL31, r = 0.43). PDL100 clustered with MG1 and the other pathogenic isolates of S. marcescens (Fig. 32). The environmental isolates not associated with wastewater clustere d together, as did the coral-associated bacteria. Both isolates 39006 (Chesapeake channel water) and EL31 (FL Keys wastewater) are outliers as compar ed to the pool of isolates, EL31 more so than 39006. This is in line with the observations of EL139, which is also a wastewater isolate. 3.3.2 Enzyme Induction in Response to Growth on Coral Mucus Bacteria depend on specific catabolic enzymes for the degradation and uptake of the carbon and nitrogen sources of a given environment. The ability of Serratia marcescens PDL100 to grow on coral mucus suggests that specific enzymes may be present in PDL100, which may not be present in other S. marcescens isolates. I hypothesized that S. marcescens PDL100 utilizes a different suite of substrates po tentially present in cora l mucus as compared to other pathogenic and human-associated isolat es. PDL100 was expected to possess the same catabolic enzymes as the three coral-associated isolates, all of which presumably have coevolved with the coral host. In Serratia marcescens PDL100, -D-glucopyranosidase, -L-arabinopyranosidase, Nacetyl-D-galactosaminidase (chitinase), -L-fucopyranosidase, and -D-galactopyranosidase

PAGE 63

63 (Fig. 3-3A) were induced following growth on coral mucus. These enzymes, except for -Lfucopyranosidase, showed similar levels of activit y in the seawater control. The native coralassociated bacteria exhibited a broader ra nge of enzymatic induction as compared to S. marcescens PDL100 (Fig. 3-3B). These subs trates in coral mucus induced -Dgalactopyranosidase, -D-glucopyranosidase, N-acetyl-D-galactosaminidase (exo-chitinase), -L-fucopyranosidase, -D-fucopyranosidase, -D-galactopyranosidase, -D-glucopyranosidase, and -D-xylopyranosidase in response to growth on coral mucus. While more enzymes were induced in these isolates, the levels of induction were lower on average than many of the other isolates. Some of these enzymes were also induced during incubation in s eawater. Overall, the pathogenic isolates of S. marcescens (MG1, 43422, and 43820) all enzymes tested induced more enzymes in response to growth on coral mucus th an PDL100 and the coral-associated isolates. Together, the three pathogenic is olates demonstrated induction of all enzymes in the assay, although many enzymes ( -D-xylopyranosidase, -L-arabinopyranosidase, -Dfucopyranosidase, -D-glucuronidase, and -L-arabinopyranosidase) were induced at comparatively low levels (Fig. 3-3C). An a ssay was conducted in para llel with coral mucus alone to serve as a baseline of enzyme activity present in coral mucus (Fig. 3-3D). Enzyme activity in the coral alone mucus treatment was significantly less than the coral mucus + isolate treatments the activities observed in the mucus alone assay were subtracted from all other treatments with isolates grown on coral mucus. Similarly, a filter-sterilized buffered seawater control was performed and was used as a baselin e correction for the treat ments with isolates incubated in seawater. To validate that enzymatic activity observed in response to growth on coral mucus was indeed due to the presence of coral mucus and not simply due to constitutively produced

PAGE 64

64 enzymes, enzymatic activities were assayed in response to growth on filter-sterilized buffered seawater supplemented with glucose and casamino acids as the sole carb on/nitrogen sources. A representative isolate from each of the major sub-groups of isolates was used: Serratia marcescens PDL100 (coral wh ite pox pathogen), S. marcescens 43422 (human/pathogenic), and S. marcescens 39006 (environmental). As casamino acids contain carbon, the influence of casamino acids on enzyme induction was accounted for. In all three isolates, enzyme activity in response to growth on glucose was great ly attenuated (Fig. 3-4). In both S. marcescens PDL100 and S. marcescens 43422, -D-glucopyranosidase and N-acetyl-D-galactosaminidase remained active in response to glucose, while all others induced on coral mucus were repressed (Fig. 3-4A & B). Enzyme activity was repressed in S. marcescens 39006 (Fig. 3-4C). -Dglucopyranosidase and N-Acetyl-D-galactosaminidase were not induced to the same degree in S. marcescens 39006 in response to coral mucus. In respons e to growth on glucose, both of these enzymes were greatly repressed. -D-glucopyranosidase remain ed slightly active in S. marcescens 39006 during growth on glucose, while it wa s significantly repressed (20 fold) as compared to the isolate grown on coral mucus. Correlation analysis was applied to the is olates based on their enzyme induction in response to growth on coral mucus and incubation in filter-sterilized buffered seawater. After 2 hours growth on coral mucus, no clear pattern was observable as the environmental were clustered with both the pathogenic isolates and the coralassociated bacteria (Fig. 3-5A). After 18 hours of growth on coral mucus, the isolates cl ustered more closely with isolates from their respective groups. Just as the BIOLOG data indicated, Serratia marcescens PDL100 was most highly correlated with S. marcescens MG1 and the other pathogenic isolates (Fig. 3-5B). Cluster analysis of the enzyme induction in response to incubation on filter-sterilized seawater followed

PAGE 65

65 a similar pattern as induction in resp onse to growth on coral mucus. Serratia marcescens PDL100 was consistently correlate d with the pathogenic isolates, and the environmental isolates and the coral-associated isolates were highly correlated togeth er after both 2 hours and 18 hours of incubation (Fig. 3-6A & B). 3.3.3 Proteinase Induction in Response to Coral Mucus Bacteria generally obtain their carbon and nitrogen through enzym atic degradation of extracellular biopolymers by proteinases a nd glycosidases (Travis et al. 1995). Serratia marcescens is known to produce both extracellular a nd cell-associated proteinases, which function in catabolism and virulence associated behaviors (Schmitz a nd Braun 1985, Ovadis et al. 2004). I hypothesized that all strains of Serratia marcescens especially the pathogenic strains, would produce proteinases in response to growth on coral mu cus. I also predicted that the coral-associated bacteria would produce prot einases due to their adapted lifestyle on coral mucus. Production of both extracellular and cell-associated proteinases were measured after two hours (exponential growth phase) and 18 hours (stationary growth phase) of growth on coral mucus. Cell-associated proteina se production after two hours of gr owth was low in all isolates, although statistically significant differences were found between the isolates (F15,32 = 3.4549; p = 0.0016; Fig. 3-7A). Although statistically significant, these differe nces may not be biologically significant as the majority of the isolates show ed similar induction. Af ter 18 hours of growth on coral mucus, differences in cell-associated prot einase production were statistically significant and more pronounced (F15,32 = 5.628; p < 0.0001; Fig. 3-7B). EL139 produced the greatest enzyme activity and S. marcescens PDL100 was most similar to the pathogenic strains MG1 and 43422, as well as the coral-associ ated bacteria and the other S. marcescens isolates. 43820, the human urine isolate clustered w ith a canal water isolate, EL 34 and a seabird isolate, EL368.

PAGE 66

66 Extracellular proteinase activity was induced at similar levels as the cell-associated proteinase in those isolates with the ability to utilize the general proteina se substrate, azocasein. After two hours of growth on coral mucus, isolates 43820, EL139 and EL368 exhibited the highest activity, which was statistically signi ficantly more than the other isolates (F15,32 = 47.4265; p < 0.0001; Fig. 3-8A). The same patte rn was observed after 18 hours of growth on coral mucus with much variability of proteinase activity within the pathogenic and environmental isolates (F15,32 = 27.6133; p < 0.0001; Fig. 3-8B). 3.4 Discussion This study provides a glimpse at the range of metabolic capabilities of a coral white pox pathogen, Serratia marcescens PDL100. The results present eviden ce as to the types of catabolic enzymes induced during growth on coral mucus and the diversity of substrates found in nature that S. marcescens PDL100 could utilize. Based on the carbon-source utilizati on profiles and the enzyme induction assays, S. marcescens PDL100 is highly correlated with S. marcescens MG1 and other pathogenic isolates. These findings suggest that the metabolic capabilities of opportunistic pathogens are inherently broad so as to take advantage of different environments and hosts when conditions are favorable. It appears that S. marcescens PDL100 does not possess unique metabolic capabilities specific to grow th on coral mucus that could have been characteristic of a co-evolved pathogen. Native co ral-associated bacteria cl ustered together in all experiments and were clustered distantly from S. marcescens PDL100 (Fig. 3-2, 3-5, 3-6). Similar clustering was also observed in the prot einase induction assays but was less conclusive as only marginal differences between PDL100 and the coral-associated bacteria were found (Fig. 3-7 & 3-8). The high correlation between Serratia marcescens PDL100 and the other pathogenic S. marcescens isolates may also suggest that the cora l white pox pathogen may have originated

PAGE 67

67 from anthropogenic sources, although source tracking analyses were not performed in this study. When the etiology of white pox disease wa s described it was hypothesized that S. marcescens PDL100 may be associated with pollution of fecal origin (Patterson et al. 2002). Since then, studies have shown that enteri c bacteria and viruses from human waste do not survive long in warm, saline and transparent waters around coral reefs, but can persist in marine sediments and in coral mucus (Lipp et al. 2002, Lipp and Griffi n 2004). Enteric bacterial loads were found to be significantly higher in coral mucus sample s and sediments as compared to the surrounding water column (Griffin et al. 2003, Lipp and Griffin 2004). The isolation of important fecal indicator bacteria, such as Clostridium perfringens from coral mucus has been attributed to potentially low oxygen levels on coral heads (L ipp et al. 2002), however the dissolved oxygen levels on coral heads and surrounding water were not compared. Commun ities in the Florida Keys rely heavily on on-site disposal as treatmen t of wastewater with an estimated more than 25,000 septic tanks, cesspools and injection wells (Paul et al. 2000). Enteric bacteria and viruses are quickly transported via water currents from canals into near shore waters and onto coral reefs, often within 24 hours of introduction (Griffin et al. 2003). The exact origin of S. marcescens PDL100 is yet unclear and investigations are underway (Patterson et al. 2002). Mucus is secreted by a wide array of organisms. In humans alone, mucosal surfaces are found wherever absorptive and ex cretive functions occur, primar ily the gastrointestinal (GI), respiratory, and urinogenital tr acts (Pearson and Brownlee 2005). Mucus provides a rich source of nutrients where surrounding environments may be lacking (Ritchie and Smith 2004, Kooperman et al. 2007, Sharon and Rosenberg 2008) and may serve as an oasis until surrounding conditions become favorable (Drake and Horn 2007). Human-derived mucus is made up of mucins, which are glycoproteins wi th a central protein core attached to a

PAGE 68

68 carbohydrate side chain. Up to 80% of the mo lecule is comprised of carbohydrate chains including galactose, fucose and N-acetylgalact osamine, N-acetylglucosamine, sialic acid, and mannose (Pearson and Brownlee 2005). These car bohydrates and glycopro teins are also the main components of coral mucus (Ducklow and Mitchell 1979, Meikle et al. 1988, Ritchie and Smith 2004). The ability of bacteria to colonize mucosal surfaces is in large part determined by the properties of the microorganism and the conditions of the environment. Bacteria not only use specific pathways and enzymes to grow on mucosa l surfaces but also use flagella for motility and pili and fimbriae for adhesion to th e surface (Laux et al. 2005, Virji 2005). Serratia marcescens 43422 was isolated from a human throat, an environment bathed by mucus structurally similar to coral mucus (Ducklow and Mitchell 1979, Meikle et al. 1988, Pearson and Brownlee 2005). Therefore, it may not be that surprising that S. marcescens PDL100 showed high similarity to this human isol ate and other pathogenic strains of S. marcescens. With its ubiquitous nature, S. marcescens may have simply evolved a broad range of metabolic pathways and enzymes in order to cope with survival in a variety of environments. In addition to elucidating some basic metabolic capabilities of bacterial isolates during growth on coral mucus, the enzymatic induction a ssays also identified some of the types of carbohydrates and bonds/formations present in Acropora palmata coral mucus during the summer months. All twelve substrates used in the induction assay showed induction in at least one isolate in response to growth on coral mucus, although some were induced more than others (Fig. 3-3). Most of the substrates were assayed in two conformations, and In some cases the alpha conformation appeared to be more abundant in coral mucus ( L-arabinopyranosidse, -Dglucopyranosidase, -L-fucopyranosidase), while in others the form was more abundant ( -Dgalactopyranosidase, -D-xylopyranosidase). Some enzymes appeared to be constitutively

PAGE 69

69 expressed ( -D-glucopyranosidase and N-acetyl-D-galactosaminidase) as they were active in both cells grown on coral mucus and cells incuba ted in sterile seawater with no added carbon sources (Fig. 3-3). The fact that both and forms of the substrates were found in coral mucus makes it is difficult to conclude if one conformation occurs more in nature than the other. Surely, some organisms are better able to r ecognize and utilize certain conformations (e.g. (Sexton and Howlett 2006)). The presence of these carbon sources in A. palmata mucus is in line with previous studies regarding the compos ition of coral mucus. Ducklow and Mitchell (1979) found mucus from Acropora spp. to consist of glucose, galactose, glucosamine, galactosamine, fucose and high levels of arabin ose (Ducklow and Mitchell 1979). Therefore, it is not a stretch for all of these s ubstrates to be found in the mucus of this species of coral. It is worth noting, however, that different conformations of the same substrate are secreted into coral mucus by the host. The open chain forms of mo nosaccharides are quite flexible around the central carbon bonds. The reactive nature of aldehyde and ketone gr oups often lead to reversible cyclization of the molecule resu lting in either an alpha or beta conformation. In aqueous solution, equilibrium between the conformations will exist (Prez et al. 1996, Frnbck et al. 2008). One form may dominate over the other depe nding on environmental conditions such as temperature and pH (Drickamer and Dwek 1995). These findings add to the complexity of the composition of coral mucus and only represent mucus collected at one time point. It is possible that the composition of coral mucus changes temporally and with changes in conditions (Crossland 1987). While the goal of this study was not to characterize the composition of A. palmata mucus, structural components were identif ied and may provide a foundation for further characterization.

PAGE 70

70 This study has also described a new pote ntial use for BIOLOG EcoPlates. Although designed for community based analyses of bacteria l diversity in different environments (Hill et al. 2000, Preston-Mafham et al. 2002), EcoPlates were clearly able to differentiate bacterial isolates of the same species based on their car bon-source utilization profiles. EcoPlates were used instead of the BIOLOG GN1 plates because GN1 plates are primarily used for identification of a single isolate and contain ec ologically irrelevant carbon substrates. Wh ile EcoPlates contain fewer substrates, the substrates included better represent the diversity of substrates found in different environments. Therefore, they may provide a means for not only characterizing the metabolic profile of environmental isolates, but also serve as a method of comparing different environmental isolates that are geneti cally identified as the same species.

PAGE 71

71 Table 3-1. Chromogenic substrates Substrate number (#) Substrate name 1 -D-Galactopyranoside 2 -D-Glucopyranoside 3 -D-Xylopyranoside 4 -L-Arabinopyranoside 5 N-Acetyl-D-Galactosaminide 6 -L-Fucopyranoside 7 -D-Fucopyranoside 8 -D-Galactopyranoside 9 -D-Glucuronide 10 -D-Glucopyranoside 11 -L-Arabinopyranoside 12 -D-Xylopyranoside

PAGE 72

72 0.0 0.2 0.4 0.6 0.8 1.0 0244872HoursAWCD PDL100 MG1 43422 43820 0.0 0.2 0.4 0.6 0.8 1.0 0244872HoursAWCD PDL100 33-C12 33-E7 33-G12 0.0 0.2 0.4 0.6 0.8 1.0 0244872HoursAWCD PDL100 39006 EL34 EL202 EL206 EL368 Figure 3-1. Carbon-source utilizat ion profiles of bacterial isolat es. (A) Average well color development (AWCD) for Serratia marcescens PDL100 and pathogenic isolates of S. marcescens. (B) AWCD for S. marcescens PDL100 and coral-associated bacteria. (C) AWCD for S. marcescens PDL100 and environmental S. marcescens isolates. AWCD = ( C R ) / n where C is color production within each well (OD590), R is the absorbance value of the plates control well, and n is the number of substrates ( n = 31). C B A

PAGE 73

73 Figure 3-2. Correlation analysis of carbon-source utilization prof iles of bacterial isolates. Average well color development (AWCD) va lues after 72 hours of incubation were subjected to correlation analysis using EXCEL and cluster diagram generated in STATISTICA. Tree-based clustering of substrate values (AWCD); [1 Pearsons r] was used as the single linkage distance m easure. Values from wells of individual substrates (3 replicates for each substrat e) were averaged after 72 hour incubation. The averages for each substrate were then transformed for PCA analysis with the formula (C R ) / AWCD.

PAGE 74

74 Coral residents induction on coral mucus0 50 100 150 200 250 300 123456789101112SubstrateAbs(Average activity) MC 2 hr MC 18 hr SC 2 hr SC 18 hr Mucus alone induction on coral mucus0 50 100 150 200 250 300 123456789101112SubstrateAbs(Average activity) MA 2 hr MA 18 hr Pathogenic Serratia marcescens induction on coral mucus0 50 100 150 200 250 300 123456789101112SubstrateAbs(Average activity) MC 2 hr MC 18 hr SC 2 hr SC 18 hr Sm PDL100 Induction on coral mucus0 50 100 150 200 250 300 350 400 123456789101112SubstrateAbs(Average activity) MC 2 hr MC 18 hr SC 2 hr SC 18 hr Figure 3-3. Average enzyme induction by Serratia marcescens PDL100 (A), coral-associated bacteria (B), pathogenic Serratia marcescens (C), and coral mucus alone as a negative control (D). Starved cultures gr ew on either coral mucus (freeze-dried/UVirradiated) or filter-sterilized buffered s eawater (10 mM HEPES, pH 6.5) for 2/18 hours, blue/orange bars, respectfully. List of substrates can be found in Table 3-1. A D C B

PAGE 75

75 Sm43422 incubation on glucose control0 50 100 150 200 250 300 123456789101112SubstrateAbs(Average Activity ) CM 2 hr CM 18 hr CA 2 hr CA 18 hr Sm PDL100 incubation on glucose control0 50 100 150 200 250 300 123456789101112SubstrateAbs(Average activity) CM 2 hr CM 18 hr CA 2 hr CA 18 hr Sm39006 incubation on glucose control0 50 100 150 200 250 300 123456789101112SubstrateAbs(Average activity) CM 2 hr CM 18 hr CA 2 hr CA 18 hr Figure 3-4. Average enzyme induction by Serratia marcescens PDL100 (coral white pox pathogen) (A), Serratia marcescens 43422 (human throat isolate) (B), and Serratia marcescens 39006 (Chesapeake channel isolate) (C) grown on filter-sterilized buffered seawater (10 mM HEPES, pH 6.5) supplemented with glucose (4 g/L) and Casamino Acids (0.1 g/L) or filter-sterilized buffered seawater (10 mM HEPES, pH 6.5) supplemented with Casamino Acids (0.1 g/L) for 2/18 hours, blue/orange bars, respectfully. List of substrates can be found in Table 3-1. B A C

PAGE 76

76 Figure 3-5. Enzyme induction for all isolates by growth on coral mucus for 2 hours (A) and 18 hours (B). Tree-based clustering of mean-cen tered substrate values; [1 Pearsons r] was used as the single linkage distance measure. B A

PAGE 77

77 Figure 3-6. Enzyme induction negative control on filter-sterilized buffered seawater (10 mM HEPES) for 2 hours (A) and 18 hours (B). Tree-based clusteri ng of mean centered values; [1 Pearsons r] was used as the single linkage distance measure. A B

PAGE 78

78 0 0.01 0.02 0.03 0.04P D L100 MG1 39 0 06 4 342 2 4 3820 E L 31 EL34 EL139 EL202 E L 206 E L2 66 E L36 8 EL40 2 33-C12 3 3 E7 33-G12IsolateAbs(Avg Proteinase Activity) 0 0.01 0.02 0.03 0.04PDL100 M G1 3900 6 4 3 42 2 4 3 8 20 E L 31 E L 34 EL13 9 EL202 EL206 EL2 6 6 EL3 6 8 EL 40 2 3 3 C1 2 3 3 E 7 33G12IsolateAbs(Avg Proteinase Activity) Figure 3-7. Average cell-associated proteinase induction in all isol ates by growth on coral mucus for 2 hours (A) and 18 hours (B). Overnight cultures were grown in LB or GASW, washed with filter-sterilized buffered seaw ater (10 mM HEPES, pH 6.5) and starved for three days. Starved cells were grow n on coral mucus for 2 and 18 hours before proteinase production assay. B A

PAGE 79

79 0 0.01 0.02 0.03 0.04 0.05 0.06 0.07P D L100 M G 1 3900 6 43422 4 3820 E L3 1 EL34 E L139 E L2 0 2 E L2 06 EL 2 66 EL368 E L4 0 2 33C 12 33E 7 33-G12IsolateAbs(Avg Proteinase Activity) 0.00 0.01 0.02 0.03 0.04 0.05 0.06 0.07P D L100 MG 1 3 900 6 4342 2 4382 0 E L31 E L34 E L 139 E L 202 E L 206 E L 26 6 EL 3 68 EL 4 02 3 3-C12 3 3 -E7 3 3 G1 2IsolateAbs(Avg Proteinase Activity) Figure 3-8. Average extracellular proteinase induc tion in all isolates by growth on coral mucus for 2 hours (A) and 18 hours (B). Overnight cultures were grown in LB or GASW, washed with filter-sterilized buffered seaw ater (10 mM HEPES, pH 6.5) and starved for three days. Starved cells were grow n on coral mucus for 2 and 18 hours before proteinase production assay. B A

PAGE 80

80 CHAPTER 4 FUNCTIONALITY OF THE RESPONSE REGULATOR gac A IN A WHITE POX PATHOGE N, Serratia marcescens 4.1 Introduction Opportunistic bacter ial pathogens, including Serratia marcescens, can infect a wide variety of distinct hosts ranging from plants, invertebrates, and other animals. Pathogens must either adapt to their new host environment or modi fy it so that they are able to overcome the host defenses. Involved in this is the recognition of the host, colonization, and exploitation of host resources. In order to recognize the host, coloni ze and exploit host resources, bacteria rely on an arsenal of sensors/regulators. GacS/GacA is one of the two-component re gulatory systems cont rolling virulence and motility in -proteobacteria. Orthologs of this two-component system were identified through screening of mutants defective in aspects of virulence in Pseudomonas spp., Vibrio fischeri E. coli Salmonella enterica and Legionella pneumophila (Heeb and Haas 2001, Tomenius et al. 2005, Lapouge et al. 2008). Much of the structural information about the GacS/GacA twocomponent regulatory proteins have been elucidated through studies of other regulatory proteins. UvrY, the ortholog of GacA in E. coli has been identified as a memb er of the FixJ-type class of response regulators (Pernestig et al. 2001, Pernestig et al. 2003). NarL is another FixJ response regulator that has been used as a surrogate for the structural identifica tion of functional aspects of the proteins due to the availa bility of its crystal structure (Baikalov et al. 1996, Maris et al. 2005, Galperin 2006, Hussa et al. 2007). The GacS/GacA-mediated signal transduction cascade begins when the linker domain of the N-terminal part of the membrane-associat ed sensor kinase GacS perceives a yet-unknown signal (Fig. 4-1). Upon interact ion with the signal, a confor mational change initiates an autophosphorylation cascade of the three evolutionary conser ved amino acid residues (histidine-

PAGE 81

81 aspartate-histidine) (Pernestig et al. 2001, Zuber et al. 2003, Ka y et al. 2005, Dubuis and Haas 2007, Lapouge et al. 2008). This cascade leads to the phosphorylation of GacAs aspartate residue (D54) allowing the helix -turn-helix DNA binding domain of GacA to bind to specific promoters, such as csrB (Romeo 1998, Babitzke and Romeo 2007). The csrB gene encodes for regulatory RNA (rRNA) and upon tran scription folds creating up to 22 repeated 5 leaders of mRNA (GGA) in and between loops. These repe ated regions represent sites that sequester RNA-binding proteins of the CsrA family (Suzuki et al. 2002, Babitzke and Romeo 2007, Storz and Haas 2007). csrB is not the only small RNA molecule found to interact with the CsrA family of RNA-binding proteins. In E. coli and E. carotovora, csrC and rsmB (respectively) also act to sequester CsrA and d ecrease its regulatory effects (Lapouge et al. 2008). In pseudomonads, three small RNAs (rsmX rsmY, and rsmZ) function together to ensure secondary metabolism and biocontrol by binding multiple CsrA/RsmA molecules (Kay et al. 2005). Similar homologs exist in Vibrio cholerae ( csrB csrC and csrD ). These three redundant RNAs have been shown to regulate quorum sensing behaviors by suppressing th e activities of CsrA (Lenz et al. 2005, Babitzke and Romeo 2007, Storz and Haas 2007). CsrA is an RNA (both messenger and regul atory RNA) binding protein. CsrA is inactivated from binding to free-floating mRNA in the cell through its binding of repeated mRNA sequences of the regulatory RNA, csrB and csrC The small regulatory RNAs may sequester approximately 9 CsrA dimers at one time (Babitzke a nd Romeo 2007). Elucidation of the structure of CsrA through si ze-exclusion chromatography indica ted that it functions as a dimer (Heeb et al. 2006). Each monomer has a secondary structure. The three central strands come from one subunit and are hydrogen bonded while the two peripheral strands are from the other subunit, which are bonded with in the chain of the strands from the other

PAGE 82

82 subunit. The dimer is maintained through these interchain hydrogen bonding and hydrophobic interactions between the -strands (Heeb et al. 2006). When not inhibited through binding of csrB and/or csrC or other small RNA, CsrA is free to bind to other mRNAs and either stabilize them for translation or mark them for degradati on (Dubey et al. 2005). CsrA is in equilibrium between its csrB -bound and free-floating forms (Fig. 4-1). When bound to free-floating messages in the cell, CsrA can effectively inhi bit translation by bloc king the binding of the ribosome through interactions w ith regions upstream or overlapping the ribosome binding site (RBS) of the target transcript (Suzuk i et al. 2002, Heeb et al. 2006). In E. coli CsrA binds to multiple sites near the Shine-Delgarno (SD) sequences of the transcripts of glgC (glycogen biosynthesis) and cstA (carbon starvation) and prevents correct binding of the ribosome, thus inhibiting translation (Baker et al. 2002, Dubey et al. 2003). In all -proteobacterial pathogens of plan ts and animals, orthologs of gacS gacA play a central role in host colonization and virulen ce (Heeb and Haas 2001, Lapouge et al. 2008). In S. plymuthica gacA regulates N-acyl homoserine lact one (AHL)-mediated quorum sensing, production of exoprotease and production of chitinase (Ovadis et al. 2004). Chitinases, protease, and AHL-mediated quorum sensing are typically a ssociated with virulen ce and host colonization in other Serratia strains (Rasmussen et al. 2000, Kurz et al. 2003, Queck et al. 2006, Wei and Lai 2006). Because chitinase (N-acetyl-galactosaminadase) is induced on coral mucus (see chapter 3), it is reasonable to expect that gacA, gacS play similarly important roles in coral colonization and infection by the white pox S. marcescens and mutants in gacA will be unable to colonize the coral host.

PAGE 83

83 As mentioned above orthologs of the GacS/GacA two-compon ent regulatory system is present and evolutionarily cons erved in many bacterial species1. Disruption of gacA reduces virulence in Pseudomonas aeruginosa (Tan et al. 1999, Parkins et al. 2001, Dubuis and Haas 2007), Serratia spp. (Kurz et al. 2003), E. coli (Pernestig et al. 2003) and gacA also controls the production of N -acyl homoserine lactone (AHL) signals pigment, and swarming motility. A GacA ortholog in Serratia plymuthica GrrS/GrrA, has been shown to regulate the production of chitinase, exoprotease, pyrroln itrin, acyl homoserine lactones (AHLs) and biocontrol activity (Newton and Fray 2004, Ovadis et al. 2004). In many plant-associated interactions, the GacS/GacA system controls the production of secondary metabolites, extracellular enzymes involved in pathogenicity to plants biocontrol of soil borne plant di seases, ecological fitness, or tolerance to stress (Heeb and H aas 2001, Lapouge et al. 2008). This is particularly important due to the fact that opportunistic pa thogens often use a similar suit of mechanisms to invade plant and animal hosts (Rahme et al. 1995, Rahme et al. 2000). Orthologs of GacA are present in symbiotic as well as pathogenic -proteobacteria. In Vibrio fischeri gacA is necessary for coloni zation of the squid host ( Euprymna scolopes) and regulates gene expression involving chemotax is and motility (Whistler and Ruby 2003, Whistler et al. 2007). Vibrio fischeri is a bioluminescent bacterium that colonizers the light organ of the squid host. The light produced eliminates the sh adow that the host would otherwise cast due to the moonlight; thus reducing th e threat of predation (Whistler and Ruby 2003). This binary symbiosis between the bioluminescent bacteriu m and its squid host is an example of an association leading to accommoda tion and homeostasis (Whistler et al. 2007). The GacA global regulator is required for nor mal host tissue colonization by Vibrio fischeri and a recent study by 1 An ortholog is a gene formed in two or more species, which originated in a common ancestor, but has evolved in a different way in each species.

PAGE 84

84 Whistler et al. 2007 demonstrated that colonization of squid host tissue by gacA mutants were highly susceptible to invasion by secondary colonizer s (Whistler et al. 2007). That is, mutants in gacA were unsuccessful in out-competing all othe r microorganisms colonizing the host. This suggests that targeting GacA for mutation in Serratia marcescens PDL100 may lead to attenuation of disease intensity and preval ence due to the inability of mutants in gacA to effectively establish on coral mucus. In this experiment, a gacA homolog was identified in PDL100. The corresponding gene was PCR-amplified, cloned and its functionality was tested in trans Based on known orthologs of gacA in other bacteria and within Serratia marcescens I hypothesized that gacA is present in PDL100 and functional. 4.2 Materials and Methods The gacA gene was am plified from the S. marcescens genomic DNA using primers CJK12 and CJK18 (Table 2-2), whic h were designed based on the gacA sequence from S. plymutica (NCBI GenBank: AY057388). PCR conditions included initial denaturation at 95 C for 7 minutes, 35 cycles (95 C, 1 minute, 53 C, 1 minute, 72 C, 2.5 min) and a final extension at 72 C for 10 minutes. The resulting 957 bp product was cloned into pCR2.1 using a TOPO TA kit (Invitrogen, Carlsbad, CA), transfor med into chemically competent DH5 and sequenced (Agencourt Bioscience Corp., Be verly, MA) using primer M13F. A nucleotide BLAST in the NCBI database confirmed that the amplified sequence matched that of S. plymuthica The amino acid sequence for the predicted polypeptide wa s generated in MacVect or 8.0 (Accelrys, San Diego, CA). Both the gene sequence and the hypothetical amino acid se quence were compared to those of known GacA or thologs in other bacteria. To test whether gacA of S. marcescens PDL100 is functional, its ability to complement a gacA ( uvrY ) mutation in E.coli uvrY33::kan was tested. Therefore, a construct was engineered to

PAGE 85

85 complement a mutant in the uvrY gene of E. coli. To engineer a comple mentation construct the gacA gene from p1318 was cloned into pBAD18-Ap. Plasmid p1318 was digested with EcoRI and the resulting fragments were sub-cloned into the EcoRI site immedi ately downstream from the arabinose-inducible promoter on pBAD18Ap, which yielded pCJK3, which was then transformed into chemically competent E. coli DH5 Transformants were selected on LB agar supplemented with Ap 200 g/ml. Orientati on of the insert was confirmed by PCR using primers MT13 and CJK18 (Table 2-2, Fig. 2-1). To test the functionality of gacA in Serratia marcescens PDL100, an arabinose induced promoter-based complementation assay was perfor med. There are a wide variety of expression vectors that have been constructed in E. coli (de Boer et al. 1983, Bros ius et al. 1985, Diederich et al. 1994). These strong i nducible promoters are most often induced with a change in temperature and some are repressed better than others (Guzman et al. 1995). Some expression vectors produce high levels of the correspond ing gene product and can even out-express the wild-type in addition to producing substantial levels of synthe sis in uninduced or repressed conditions. In these situations, comparison to wi ld-type expression is difficult and evaluation of the result of a mutant or complement ation is nearly impossible. The PBAD vector utilized in this study satisfies two major conditions: the synthesis of the proteins can be shut off relatively rapidly and efficiently without ch anges in temperature (which can have deleterious effects on the host cell in terms of growth and plasmid maintenance). Also, expr ession before depletion of the inducer (arabinose) does not produc e exceedingly high levels of prot ein, which in itself may give a phenotype or influence the phenotype of the depletion (Guzman et al. 1995). The PBAD promoter is regulated by the araC regulatory gene product. The AraC protein is both a positive and negative regulator. In the presence of arabinose, transcription from the

PAGE 86

86 PBAD promoter is initiated and in the absence of arabinose, transcription occurs at very low levels. The un-induced levels of transcription can be further decreased through the addition of glucose to the growth media. Glucose is a know n catabolite repressor and effectively reduces the available 3, 5-cyclic AMP. This limits th e interaction between cyclic AMP and the CAP protein involved in the enhancement of transcription (Miyada et al. 1984). The complementation vector pCJK3 was transformed into E. coli RG133 pMT41 by electroporation (25 F, 200 2.5 kV, 0.2 cm cuvette, 50 L cell volume) using a Bio-Rad MicroPulser (Bio-Rad Laboratories, Hercules, CA ). As vector contro ls, the original pBAD18Ap vector was transformed into both the wild-type reporter E. coli 1655 pMT41 or its isogenic uvrY33::kan derivative reporter E. coli RG133 pMT41. Two overnight cultures of each strain were grown in LB with a ppropriate antibiotics at 37 C on a rotary shaker (180 rpm). Following overnight incubation, cultures were dilu ted 1/100 in LB and incubated at 37 C for 3 hours on a rotary shaker (180 rpm). Cultures were diluted to an OD600 of 0.3, and then diluted 1/25000 and aliquoted into a black polystyren e 96-well plate (in qua druplicate). Luminescence was measured with Victor-3 (Perkin Elmer, Shelton, CT) ever y hour for ten hours and th e expression of the complemented mutant was compared to the wild-type reporter strain. 4.3 Results 4.3.1 Molecular Characterization of g acA in Serratia mar cescens PDL100 As a first step in th e characterization of the gacA gene in Serratia marcescens PDL100, the full gene was PCR amplified using primer s designed based on the published sequence of gacA in Serratia plymuthica (NCBI GenBank: AY057388). The resulting gene was cloned, sequenced, translated in silico and compared to other known gacA orthologs at the amino acid level (Fig. 4-2). The Clustal-W alignment of the predicted GacA protein from S. marcescens PDL100 to other characterized GacA orthologs indicates that all GacA orthologs share the

PAGE 87

87 predicted phosphorylation site at position 54. Known residue s that interact with the phosphorylation site (D54), D8-9, P58, I60, T 82, E86, S103 and A107, are also conserved among all orthologs (Fig. 4-2). The central helices 89 are predicted to fo rm a helix-turn-helix motif of the DNA binding domain of GacA (Maris et al. 2005). These regions appear to be conserved in the orthologs compared. The similarity of GacA orthologs were al so compared at the DNA sequence level. A phylogenetic tree based solely on sequence maxi mum identity was generated using the TreeCon software. Boot-strap analysis was implemented to determine the relative similarity between sequences. The analysis indica ted that sequence similarity is high even at the DNA level between orthologs of GacA (Fi g. 4-3). None of the species examined demonstrated sequence differences greater than 10% base d on the boot-strap analysis. The analysis did confirm that the Gram-negative bacterium, Legionella pneumophila is distantly related to E. coli and other enteric bacteria, in regards to the gacA gene. Due to the high similarity between gacA of Serratia marcescens PDL100 at the DNA and amino acid levels to other characterized orthologs of GacA, the gene sequence was submitted to NCBI GenBank under the Accession number EU595544. 4.3.2 Functionality of g acA Throug h Complementation Assay The complementation construct consisting of an arabinose-inducible gacA gene was compared in its ability to complement a chromosomal uvrY33 mutant in E. coli to wild-type with a csrB::luxCDABE fusion reporter system (pMT41). Results of the complementat ion assay through expression of gacA under (1) arabinose induction, (2) glucose repression, and (3) no-inducer induction ar e presented in figures 4-4 through 4-6. In each treatment, no statistically significant difference in the level of expression between the wild type (MG1655) and the wild-type with the pBAD18-Ap vector control was

PAGE 88

88 observed. Under arabinose induction (0.2% arabinose supplemented media) of the PBAD promoter, expression of gacA in the complemented mutant was statistically significantly higher than the uvrY mutant alone (RG133), and the mutant st rain with the pBAD18-Ap vector control (Fig. 4-4). A comparison of the expression as function of lumi nescence at three hours under the arabinose induction treatmen t indicates that although the expression of the gacA complemented mutant was lower than the wild-type, the level of expression of the complemented mutant was statistically significantly hi gher than the non-complemented mutants (Fig. 4-4B). The addition of glucose to the media was conducted to effectively shut down expression from the PBAD promoter through the reduction of cyclic-AMP, which is required for transcription. Under glucose repression (0.2% glucose supplemented media), expression of gacA in the complemented mutant was not stat istically significantly different from the uvrY mutant alone and the mutant carrying pBAD18-Ap (Fig. 4-5A&B). Expression in each of the mutant strains, measured as lumines cence production by the reporter, rema ined significantly lower than the wild-type throughout the time course. The no-inducer inductio n treatment tested the leakiness of the PBAD expression system. If expression of gacA occurred without arabinose induction, th e results of the induction treatment would be inaccurate in demonstrating the ability of gacA to complement the uvrY mutation. The no-inducer effectively demonstrates the background level of expression at the PBAD promoter. Similar to the glucose repression treatment, the no inducer treatment did not result in significant expression of gacA in the complemented mutant as compared to the mutant controls. The level of expression was consistently lo wer than the wild-type (Fig. 4-6). 4.4 Discussion The GacS/GacA two-component regulatory system has been shown to control behaviors from motility to virulence in many species of bacteria. In Serratia spp., gacA regulates N-acyl

PAGE 89

89 homoserine lactone (AHL)-mediated quorum se nsing, production of exop rotease and production of chitinase (Ovadis et al. 2004). Production of chitin ase enzymes was found to be a significant component in the growth on coral mucus (see Chapter 3). Based on this observation and the similarity of Serratia marcescens PDL100 to other pathogenic strains of S. marcescens the hypothesis that gacA was not only present in this isolate of S. marcescens but was also functionally tested. The PCR amplified produc t was cloned and sequenced and subjected to BLAST yielding a 98% match to the grrA ( gacA ) gene from S. plymuthica The predicted amino acid sequence of GacA from S. marcescens PDL100 was compared to other characterized GacA orthologs from E. coli, P. aeruginosa, P. fluorescens, Salmonella enterica Vibrio cholerae V. fischeri, S. plymuthica and Legionella pneumophila (Fig. 4-2 & 4-3). From the comparison of GacA orthologs at th e protein level, it is clear that specific regions and domains are well conserved. Thes e conserved regions provide the essential structural features of the GacS/GacA tw o-component system (Heeb and Haas 2001). Comparison of gacA genes at the DNA level between ente ric bacteria and pseudomonads also indicate a high similarity between the orthologs in each organism. Boot-strap analysis demonstrates that over a 90% similarity was f ound between all Gram-nega tive species analyzed. Legionella pneumophila represented an out-group with the greatest dissimilarity and was most distantly related to the ot her species. This support s the observation that the gacA ortholog of Legionella was unable to complement a similar mutation in the uvrY gene in E. coli (Hammer et al. 2002), while a similar complementati on experiment demonstrated that the gacA from Enterobacter successfully complemented a uvrY mutant (Saleh and Glick 2001). GacS belongs to a class of histidine sensor kinases that carry a phosphoryl transmitter, a receiver, and a histidine phosphotra nsfer output domain (Perraud et al. 2000, Zuber et al. 2003).

PAGE 90

90 This is similar to the structures of the sensor kinases ArcB found in E. coli (Kwon et al. 2000) and BvgS in Bordetella pertussis (Perraud et al. 2000). The N-te rminal part of GacS is the sensing domain and consists of two potent ial transmembrane segments separated by a periplasmic loop. This loop is a common feat ure of many two-component systems involving histidine kinases (Dutta et al. 1999, Neiditch et al. 2006). A linker domain is adjacent to the second transmembrane domain. The linker domain contains two amphipathic sequences, which are proposed to interact with each other in respon se to environmental signals. This interaction activates the protein, causes a conformation change at the C-terminal region, which favors autophosphorylation (Robinson et al. 2000). A primary transmitter domain with a conserved autophosphorylatable histidine resi due is important for dimerizati on of sensor kinases due to alternating -helices and -sheets that occur in this region (D utta et al. 1999). Sensor kinases may function as a dimer; therefore, conservation of the primary transmitter is crucial to correct functionality of the protein. For GacS to function as a dimer, the subs trate domain for autophosphorylation itself may function as the dimerization domain, forming a fo ur-helix core. Both of the catalytic CA domains within the dimer flank this central co re such that the ATP-binding pocket faces the histidine-presenting helix of the twin subunit (Dutta et al. 1999, Robinson et al. 2000). A recent study measured the activity of the histidine kinase, LuxQ in Vibrio harveyi and found that the protein functions in vivo as a dimer. LuxQ is a sensor ki nase involved in quorum sensing in Vibrio harveyi and is associated with the periplasmi c binding protein, LuxP. When bound to an environmental signal (or in th is case Autoinducer-2), LuxP unde rgoes a conformational change that stabilizes a quaternary structure in wh ich two LuxPQ monomers are asymmetrically associated. The sensor kinase, LuxQ only functions as a dimer as demonstrated by the decreased

PAGE 91

91 activity of wild-type LuxQ with the coexpression of a truncated LuxQ protein (Neiditch et al. 2006). After autophosphorylation following stimulati on by an environmental signal, a phosphate group is transferred to an aspart ate residue followed by another hist idine residue. This histidine phosphotransfer (Hpt) output domain serves a se condary transmitter and transfers a phosphate group to a conserved aspartate residue on the re sponse regulator, GacA (Tomenius et al. 2005). The phosphorylated GacA protein contains a helix-tu rn-helix DNA binding domain motif that directly binds the promoter of small RNAs, including csrB which encodes a global regulator RNA (Kay et al. 2005, Babitzke and Romeo 2007). The activated GacA response regulator is suspected to bind to a conserved upstream element termed the GacA box (consensus TGTAAGN6 CTTACA, where N is any nuc leotide) in the promoter regions of the sRNA genes ( csrB csrC rsmB, rsmX, rsmY, rsmZ ) (Lenz et al. 2005, Lapouge et al. 2008). Essential structural features that are conser ved in GacA include the active site in the Nterminal receiver domain (residues 1-148). With in this active site lies the phosphorylatable aspartate residue and its conserved contacts Asp-8 and Asp-9, Th r (Ser)-82, and Lys-104. The helix-turn-helix motif of the DNA binding domain (resi dues 149 to end) occurs in the C-terminal region (Heeb and Haas 2001, Maris et al. 2005). Mu ch of the information regarding the roles of the specific conserved regions of the response regulator, GacA has been elucidated through investigations of response regulator, NarL, in E. coli (Baikalov et al. 1996, Galperin 2006). Mutations in the predicted phosphorylation site has demonstrated two distinct phenotypes. One mutation led to a constitutive ON phenotype by mimicking the phosphorylated state of GacA, independent of the sensor kina se (Baikalov et al. 1996, Smith et al. 2004). In most cases, mutation of the phosphorylation site leads to an inability to accept the phosphate group (Smith et

PAGE 92

92 al. 2004, Tomenius et al. 2005). Similarly, insertions or deletions of the response regulatory genes in Vibrio fischeri resulted in null phenotypes with th e regulatory proteins unable to accept the phosphate group from the respective sensor kina se and transcription of downstream genes is repressed (Hussa et al. 2007). This suggests that transcription of regulatory RNA genes is dependent on the phosphorylation of GacA and w ill not occur without prop er activation of the protein. Mutations in the amino acid residue s that are proposed to interact with the phosphorylation site have also resulted in altered functional proteins, the majority leading to a constitutively activated response re gulator protein (Smith et al. 2004). Mutations in GacS and GacA have resulted in differences in th e levels of tr anscription of downstream regulatory genes. While GacA is usually dependent on GacS for phosphorylation and therefore, full functionality, recent work has demonstrated that GacA may still function (albeit at a lower level compared to wild type) and lead to transcripti on of regulatory RNA genes even if GacS is mutated. In E. coli, a mutation in BarA result ed in 40% of downstream transcription as compared to wild-type, wh ile a mutation in UvrY failed to produce any downstream activation (Tomen ius et al. 2005). The same observation was found in Salmonella enterica sv. Typhimurium. Mutations in the response regulator sirA yielded less downstream activation as compared to mu tation in the sensor kinase barA (Altier et al. 2000, Lawhon et al. 2002). Similarly, in Vibrio cholerae a mutation in the sensor kinase VarS resulted in decreased but detectable transcription of regulatory RNA genes, while a mutation in VarA, the response regulator resulted in a complete ly null phenotype (Lenz et al. 2005). These observations suggest that GacA may have function independent of GacS and may receive a phosphate group from elsewhere in the cell. In Pseudomonas aeruginosa there are two sensors, RetS and LadS, in addition to GasS that may dete rmine the activity of GacA (Dubuis et al. 2007). RetS is thought

PAGE 93

93 to act as a GacA antagonist by removing a phosphate group from the already phosphorylated GacA, while LadS appears to activate GacA using the same type of C-terminal histidine kinase and response regulator receiver dom ains as GacS (Ventre et al 2006, Dubuis et al. 2007). It appears that the LadS/RetS pathways function in parallel and also regulate the same small RNAs as GacS/GacA. This overlap in function may al low for the activation/inhibition of GacA. The demonstration that GacA remains somewhat func tional after GacS mutation provides insight as to why specific targeting of GacA for mutagenesis instead of GacS may lead to a more effective disruption of the downstream virulence and regula tory factors controlled by the two-component system. Activities and mechanisms with in a functional domain (e.g. as partate phosphorylation site) are largely conserved, as are the structures themse lves. The ways in which the domains interact in terms of regulatory consequences may diff er among response regulators (Gao et al. 2007b). The genes encoding for the sensor kinase and respons e regulator pair of prot eins are often next to each other on the chromosome. This, however, is not the case with gacS and gacA In many organisms, gacA lies directly upstream of an ortholog of the E. coli uvrC gene, which is involved in nucleotide excision repair. Despite the close proximity of gacA and uvrC no evidence supports that GacA contributes to UV repair (Heeb and Haas 2001). The results of the complementati on assay not only demonstrate that gacA from Serratia marcescens PDL100 is structurally similar to uvrY from E. coli and is able to functionally complement the mutation, but s upports the features of the PBAD expression system that are favorable for physiological studies. The PBAD vector utilized in this study satisfies two major conditions: the synthesis of the pr oteins are able to be shut o ff rapidly and efficiently without changes in temperature (which can have deleteri ous effects to the host ce ll in terms of growth

PAGE 94

94 and maintenance). In addition, expression before depletion does not pr oduce exceedingly high levels of protein, which in itself may give a phenotype or influence the phenotype of the depletion (Guzman et al. 1995). Based on the alignment of the GacA protein from Serratia marcescens PDL100 with other orthologs, comparison of gacA orthologs at the DNA level a nd the complementation assay, it is reasonable to conclude that the gacA gene is not only present but functional in this white pox pathogen. Therefore, mutations disrupting gacA will presumably attenua te the ability of the pathogen to colonize and grow on coral mucu s. The observation that GacA may remain functional even if GasS is mutated also provides rationale for the specific targeting of GacA for mutagenesis as opposed to other co mponents of the regulatory system.

PAGE 95

95 Figure 4-1. Model of regulatory pa thways leading from GacS/GacA to downstream genes. Thick arrows indicate direct interactions and thin arrows indicate inte ractions that may be either direct or indire ct. Blunt end lines ( ) represent inhibitory or negative effects. Of the behaviors/activities regulated (either directly or indire ctly) by CsrA, CsrA represses those in blue and those in red are regulated. H D H N CGacS (senso r kinase ) Activation by signal Autophosphorylation P P P A TP A DP D P H H T GacA (response regulator) N CVirulence FactorsCsrB/CsrC GacA box sRNA gene CsrA Glycogen biosysnthesis Carbon metabolism Cell size Extracellular enzymes Quorum sensing Motility flhDC A ntifungal compounds Secondary metabolites Biofilm formation Type III Secretion System Cytoplasm Periplasmicspace H D H N CGacS (senso r kinase ) Activation by signal Autophosphorylation P P P A TP A DP D P H H T GacA (response regulator) N CVirulence FactorscsrB/csrC GacA box sRNA gene CsrA Glycogen biosysnthesis Carbon metabolism Cell size Extracellular enzymes Quorum sensing Motility flhDC A ntifungal compounds Secondary metabolites Biofilm formation Type III Secretion System Cytoplasm Periplasmicspace

PAGE 96

96 Figure 4-2. Clustal-W alignment of the deduced GacA protein from the white pox pathogen, S. marcescens PDL100 (top row) and other characte rized GacA orthologs. All GacA orthologs share the predicte d phosphorylation site (D54, bl ue arrow), residues that interact with the phospho rylation site (D8-9, P58, G59, I60, T82, E86, S103, A107, blue asterisks) and I170-L175 region (green asterisks) that anchors the 89 of the helix-turn-helix DNA binding domain (Tepli tski and Ahmer 2005, Tomenius et al. 2005). ** ****

PAGE 97

97 Figure 4-3. Phylogenetic tree comparison based on the gacA DNA sequence in common bacteria. Orthologs of gacA were obtained through a BLAST search of the NCBI GenBank database. DNA sequences were compared using TreeCon software with Boot-strap analysis to indicate the relative simila rity between sequences. The Gram-positive bacteria, Legionella pneumophila served as an out-group to form the rooted-tree comparison.

PAGE 98

98 0.1 1 10 100 1000 10000 100000 1000000 10000000 012345678910Time (hours)Average Luminescence Blank csrB-luxCDABE PARA csrB-luxCDABE uvrY::kan csrB-luxCDABE uvrY::kan PARA csrB-luxCDABE uvrY::kan PARA-gacASm csrB-luxCDABE 0 200 400 600 800 1000 1200 1400 1600 1800 csrB-luxCDABEPARA csrBluxCDABE uvrY::kan csrBluxCDABE uvrY::kan PARA csrB-luxCDABE uvrY::kan PARAgacASm csrBluxCDABEReporterAverage Luminescence Blank Figure 4-4. Complementation of uvrY mutant in E. coli by gacA with Arabinose induction of pCJK3 compared to wild-type luminescen ce production (A) and average induction at 3 hr (B) A B

PAGE 99

99 0.1 1 10 100 1000 10000 100000 1000000 10000000 012345678910Time (Hours)Average Luminescence Blank csrB-luxCDABE PARA csrB-luxCDABE uvrY::kan csrB-luxCDABE uvrY::kan PARA csrB-luxCDABE uvrY::kan PARA-gacASm csrB-luxCDABE 0 200 400 600 800 1000 1200 1400 1600 1800 csrB-luxCDABEPARA csrBluxCDABE uvrY::kan csrBluxCDABE uvrY::kan PARA csrB-luxCDABE uvrY::kan PARAgacASm csrBluxCDABEReporterAverage Luminescence Blank Figure 4-5. Complementation of uvrY mutant in E. coli by gacA with glucose repression of pCJK3 compared to wild-type luminescen ce production (A) and average induction at 3 hr (B) A B

PAGE 100

100 0.1 1 10 100 1000 10000 100000 1000000 10000000 012345678910Time (hours)Average Luminescence Blank csrB-luxCDABE PARA csrB-luxCDABE uvrY::kan csrB-luxCDABE uvrY::kan PARA csrB-luxCDABE uvrY::kan PARA-gacASm csrB-luxCDABE 0 200 400 600 800 1000 1200 1400 1600 1800 csrB-luxCDABEPARA csrBluxCDABE uvrY::kan csrBluxCDABE uvrY::kan PARA csrB-luxCDABE uvrY::kan PARAgacASm csrBluxCDABEReporterAverage Luminescence Blank Figure 4-6. Complemtation of uvrY mutant in E. coli by gacA with no sugar induction of pCJK3 compared to wild-type luminescence producti on (A) and average induction at 3 hr (B) B A

PAGE 101

101 CHAPTER 5 BACTERIAL QUORUM SENSIN G SIGNALS AND SETTLEMEN T OF CORAL LARVAE 5.1 Introduction Coral exhibit a range of reproductive stra tegies, including both sexual and asexual propagation. Som e species of coral brood welldeveloped larvae after internal fertilization throughout the year. Most corals, however, reproduce during annual mass spawning events when gametes are synchronously released into the water column a nd undergo fertilization outside of the coral polyp (Ha rrison and Wallace 1990, Ball et al 2002). Larvae of broadcast spawning scleractinian corals typi cally become competent to metamo rphose into juvenile polyps approximately one week after the spawning and fertilization event (Babcock and Heyward 1986, Negri et al. 2001). Metamorphosis of coral larvae, and other Cnidar ians, is naturally triggered by the perception of external cues, both from the abiotic environm ent and from other organisms on the reef (Morse et al. 1996, Webste r et al. 2004, Kitamura et al. 2007). Settlement, metamorphosis and recruitment of coral larvae are often used interchangeably, however, each refers to different stages in the development of co rals. Settlement describes the physical process, during which larvae become p ear-shaped, leave the water column, and casually attach to the substrate at the abor al end. This process is reversib le, in that cora l larvae test available substrates and can potentially leave unsuita ble substrata and return to the water column. Larval metamorphosis is a physiological res ponse, during which mor phological, physiological and metabolic changes occur that are nearly always non-reversible (Negri et al. 2001, Golbuu and Richmond 2007). Metamorphosis of acroporid corals often occurs within 12 hours of settlement when the larvae have flattened dor sally and developed obvious septal mesenteries radiating out from the central mouth region (Harrison and Wallace 1990, Heyward and Negri 1999). Recruitment is the combination of these two events and the continued survival of the

PAGE 102

102 metamorphosed larvae into a juve nile polyp and to adulthood (Koe hl and Hadfield 2004). Both settlement and post-settlement events influence the recruitment rates of corals. Temporal and spatial patterns combined with the innate percep tion of different substrat a also play important roles in the rate and efficiency of larvae recruitment. The selectivity of coral larvae depends on both the type of larvae and the specificity for certain environmental cues. Brooding coral species tend to be mo re non-selective when determining where to settle. Often, coral larvae are selective to substrates of dead coral with the same morphologies (i.e. branching larvae settle on dead branching corals) independent of location and substrate availability (Norstrm et al. 2007). Coral larvae may also specifically settle on algal species, rocks, shells and sand (Morse et al. 1988, Huggett et al. 2006). There, however, are clear exceptions dem onstrating that these species can be highly selective, such as the brooding coral, Stylaraea punctata (Golbuu and Richmond 2007). Chemosensory cues that induce members of the Agariciidae and Faviidae families function independent of the type of reproduction (Morse et al. 1996), as do those of the genus Acropora (Baird and Morse 2004). Often times, larval selectivity is related to coral habitat distribution and can be determined to some degree by surveying adult corals (Abelson et al. 2005, Golbuu and Richmond 2007, Norstrm et al. 2007). Two models have been us ed to compare coral recruitment based on larvae selectivity (Morse et al. 1988). The lottery mode l is used to describe those non-specific corals which settle when space becomes available, whil e the deterministic model describes selective corals in which larvae selectivity for appropriate substrata is important in determining spatial patterns in recruitment (Morse et al. 1988, Golbuu and Richmond 2007). Corals that fit the lottery model of recruitment may exhibit general life history strategies relating to their success. Stlyphora pistillata and other pocilloporid co rals are important early

PAGE 103

103 successional species in coral communities throug hout the world. The dominance of these types of species in newly available substrates is attr ibuted to early reproducti on, high fecundity, a long breeding season and a fast growth rate. In additio n, these corals demonstrat e a lack of a strict requirement for surface contact with specific chem ical cues, such as crustose coralline algae (CCA) (Baird and Morse 2004). S. pistillata is able to colonize substrata as soon as they become available, which allows it to pre-empt some speci es that may be superior competitors as adults (Baird and Morse 2004). Many corals, including acroporid corals, do require either direct contact or perception of a chemosensory cue in order to induce metamorphosis. Crustose coralline algae (CCA) have been linked to the induction of metamorphosis in many coral species, including members of the genus Acropora (Morse et al. 1994, Morse et al. 1996, Heyward and Negr i 1999, Negri et al. 2001) (Golbuu and Richmond 2007). It is thought that the corallin e algae produce cell-wall-bound polysaccharides that are recognized by chemoreceptors on the planula (Morse et al. 1996, Kitamura et al. 2007). Biochemical purification of the compound from Pacific and Caribbean congeners of CCA identified it as a member of a unique class of sulfated glycosaminoglycan that is associated with the cell walls of numerous CCA species. Bacteria asso ciated with the surface of algal thallus may also be responsible for the polysaccharides perceived by the larvae (Negri et al. 2001). Mixed and monospecific biofilm s of the 50 bacteria isolated from Lithophyllum sp. induced settlement and metamorphosis of Acropora and Porites spp. Both hydrophilic extracts and fragments of CCA are able to induce me tamorphosis (Golbuu and Richmond 2007, Kitamura et al. 2007). Besides a chemosensory inducer of coral metamorphosis, CCA may also serve as indicators of environmental conditions to the co ral larvae. CCA dominate reef front areas and their presence may indicate favorable conditi ons for growth and development (Golbuu and

PAGE 104

104 Richmond 2007). While CCA has clearly demonstr ated its influence in the settlement and metamorphosis of coral larvae, it is not the only chemosensory cue that coral larvae respond to. Coral larvae induce settlement in response to both biotic and abiotic cues from the environment. Dead coral rubble and fragments have been shown to induce metamorphosis of the coral Acropora millepora (Heyward and Negri 1999) and in both branching and massive morphology of different coral species (Norstrm et al. 2007). Biof ilms, bacteria isolated from CCA and other substrata have also been reported to induce larval metamo rphosis (Morse et al. 1988, Negri et al. 2001, Webster et al. 2004). Chemosensory cues produced by active biofilms (e.g. extracellular polysaccharides and water soluble, stable molecules) are critical for the settlement and attachment of larvae of the polychaete, Hydroides elegans and the bryozoan, Bugula neritina (Dobretsov et al. 2007, Huang et al. 2007) and the acroporid coral Acropora microphthalma (Webster et al. 2004). Bacteria regulate their grow th and population densities thr ough the regulatory mechanism named quorum sensing (QS) that consists of excret ed chemical signals that either activate or deactivate target bacterial genes involved in cell division and adhesion, thus controlling the formation of biofilms (Waters a nd Bassler 2005, West et al. 2007). Gram-negative bacteria use signaling molecules, N -acetyl homoserine lactones (AHLs), of different lengths for intercellular communication (Miller and Bassler 2001). There are also chemical signals used to communicate between bacterial populations and their eukaryotic hosts. Both riboflavin (vitamin B-12) and its chemical derivative lumichrome have been associated with inte r-kingdom signaling, and lumichrome acts to induce settlement and metamor phosis in some marine larvae (Phillips et al. 1999, Tsukamoto 1999, Tsukamoto et al. 1999). The majority of bacteria that exhibit quorum sensing (inclusive of Alpha, Beta-, and Gammaproteobacteria) are typically dominant in

PAGE 105

105 tropical waters (Webster et al. 2004, Wagner-Dobler et al. 2005, Huang et al. 2007). The activities within a biofilm (whether comprised of one species or a heterogeneous population of bacteria) are critical to inducti on of larval metamorphosis. A r ecent study treated biofilms with a protein synthesis inhibitor at tw o time points. Early treatment greatly disrupted and reduced settlement while late treatment did not influence sett lement rates. This suggests that the proteins synthesized and/or regulatory pr oteins involved in formation of the biofilm are important to induction of larval settlement (Huang et al. 2007). Just as chemical cues from the environment stimulate and enhance coral larvae settlement, chemical signals present in the environmen t serve to inhibit coral metamorphosis and recruitment. The red algae, Delisea pulchra produces furanones, whic h directly interfere with QS signals mediated by AHL pr oduction (Rasmussen et al. 2000). This interference disrupts biofilm formation and ultimately leads to decreased larval settlement observed in Hydroides elegans and Bugula neritina (Dobretsov et al. 2007). Furanon es are also produced by marine bacteria, green, red and brown algae, sponges, fungi, and ascidians (Kjelleberg et al. 1997). Triclosan (TRI) is a chlo rinated aromatic compound also found in marine systems that directly disrupts bacterial biofilms and t hus decreases settlement of so me pelagic larvae (Zhang and Dong 2004, Dobretsov et al. 2007). These compounds function as anti-fou ling agents against bacteria, fungi, and other marine invertebrates. Algae are in direct competition for space on co ral reefs and any form of degradation or disturbance of coral reef s generally results in an increased do minance by benthic algae (Birrell et al. 2005). Algal production of anti-fouling chemicals leads to a diminished rate of coral larval recruitment that is enhanced by anthropogenic inputs to the system in the form of terrestrial runoff and sedimentation (Abelson et al. 2005, Birr ell et al. 2005). Increased turf algae,

PAGE 106

106 cyanobacteria and sedimentation greatly decrea sed the success of coral larvae metamorphosis and also led to decreased surviv al of juvenile recruits (Birre ll et al. 2005, Kuffner et al. 2006). Many species of coral are dominant as adults but are inferior to algae as larvae or recruits. This is predominately due to their sl ow growth rates as compared to algae (Kuffner et al. 2006). Dictyota spp. are now the dominant algae in the Caribbean and reefs show upwards of 50% Dictyota cover in the Florida Keys. Direct and indirect contact between the algae and coral recruits resulted in increased mortality as compar ed to algal mimics (plastic aquarium plants), suggesting that something more than just sh ading and abrasion on th e part of the algae influenced settlement and survivability of coral larvae (Ku ffner et al. 2006). In this study, the role of two signaling cues of bacterial origin in the induction of settlement and metamorphosis of Acropora palmata and Montastrea faveolata larvae was investigated. I hypothesized that known signals commonly associated wi th microbial biofilms and intercellular communication may function as settlement cues for these species of scleractinian corals, which are the primary r eef building corals found in the Florida Keys National Marine Sanctuary. Thes e signaling cues were chosen ba sed on their involvement in the induction of settlement and metamorphosis of other marine invertebrates, in addition to coral larvae. 5.2 Materials and Methods 5.2.1 Extraction of AHLs from Coral-Associated Bacteria Transgenic microbial biofilms were cons tructed using bacteria isolated from A. palmata Two isolates of Agrobacterium tumefaciens and one isolate of Vibrio harveyi were selected due to their production of typical AHL-like compoun ds as identified by thin layer chromatography (TLC). Overnight cultures were grown on GASW broth and extracted with equal volumes ethyl acetate. The organic phase was dried and resuspended in 10 l methanol. Extracts were spotted

PAGE 107

107 on a TLC plate (Whatman KC18 Silica Gel 60 w ith fluorescent indicator, 10 x 10 cm, 200 m thick) as well as standard AHLs as controls. The plate was developed with a mobile phase of methanol:water (3:2) for approximately 30 minutes The presence of AHLs was detected by an Agrobacterium tumefaciens reporter strain carry ing the plasmid pZLR4, which contains the traCDG operon with its promoter region (Table 2-1). traG is transcriptionally fused to lacZ (Cha et al. 1998). The reporter construct is s timulated during interaction with AHLs. The reaction requires 60 g/ml of the substrate 5-bromo-4-chloro-3-indolyl -galactopyranoside (Xgal) and results in blue color production. 2 ml of overnight culture of the reporter was subcultured into 50 ml ABM medium (per liter: 3.0 g K2HPO4, 1.0 g NaH2PO4, 1.0 g NH4Cl, 0.3 g MgSO4 7H2O, 0.15 g KCl, 0.01 g CaCl2, 2.5 mg FeSO4 7H2O, 5% mannitol) and incubated at 30 C for five hours (Hwang et al. 1994, Shaw et al. 1997). The reporter strain was then mixed with 100 ml of cooled ABM agar supplemented with Gm 30, 60 g/ml X-gal. The agar mixture was slowly poured over the tile s to cover them, allowed to solidify and incubated at 30 C overnight. After overnight growth of the reporte r strain, blue color development over the test lanes were compared to the AHL control lane. 5.2.2 Biofilm Formation Transgenic biofilms to account for cons equences of loss of AHL function were constructed by mating the plasmid pE7-R3 into each other three cora l isolated bacteria (Table 21). This plasmid is an IncP broad range host cosmid vector (pLAFR3) carrying the aiiA gene from Bacillus sp. 240B1 which encodes for an enzyme that cleaves the lactone ring of AHLs, rendering them functionless (D ong et al. 2000). The resultin g biofilms served as the transgenic biofilms. As a vector control, pLAFR3 vector alone was mated into each bacterial isolate (Staskawicz et al. 1987). The resulting biofilms served as the wild-type biofilms for the following settlement experiments.

PAGE 108

108 Settlement induction experiments were set-up in plastic containers (approximately 300 ml) to measure the consequences of AHL hydrolysis in coral larval settl ement. Tiles (porous ceramic, 1 x 1 inch with 0.5 cm x 0.5 cm grid pattern) were bathed in either sterile GASW supplemented with 5% CFA media inoculated with the wild-type (vector control) bacteria or sterile GASW supplemented with 5% CFA inocul ated with the transgenic (AHL-lactonase) bacteria and biofilms were allowed to form on the til es. As a control, tiles were also bathed in sterile GASW supplemented with 5% CFA. 150 ml of filter sterilized seawater was added to each plastic container. Before tiles were added to the container, they were washed twice with filter sterilized seawater to remove any residual media. Settlement induced in each treatment (tiles + wild-type, tiles + transg enic, and tiles + media alone) was measured with and without the addition of crustose coralline al gae (CCA), giving a total of eigh t treatments. Each treatment was performed in triplicate. CCA was collected fr om a rubble zone on the west side of the Bahia Honda Bridge and washed with running filter ster ilized sea water at leas t 5 times or until water ran clear. Acropora palmata gametes were collected during a mass spawning event at Looe Key Reef, FL in August 2006. Gametes from different colonies were crossedfertilized and larvae were maintained in flowing seawater for eight days until they reached competency. Fertilization took place at the Mote Marine Laboratory Tropical Research Laborat ory in Summerland Key, FL. Twenty competent A. palmata larvae were added to each container, the lids were caped and containers were placed in a randomized pattern (t o ensure blind sampling) in running seawater raceway table to maintain temperature. Larval counts and water changes were performed daily for a total of three days. The effect of the presence of AHL and crus tose coralline algae ( CCA) on the induction of acroporid coral larval set tlement was also tested. Settlement experiments were set-up in plastic

PAGE 109

109 containers as above. Sterile tiles were added to either 150 ml filter steril ized seawater or 150 ml filter sterilized seawater s upplemented with 100 nM 3-oxo-C6-Homoserine Lactone (3-o-C6HSL). A fragment of CCA was added to each treatment and negative controls without the addition of CCA were included. Each treatment wa s performed in triplicate. Twenty competent A. palmata larvae were added to each container, lids were capped and containers were placed in a randomized pattern (to ensure blind sampling) in a running seawater race way table to maintain temperature. Larval counts and appropriate water changes were performed daily for a total of three days. 5.2.3 Extraction of Coralline Algae Compounds In order to d etermine the conditions necessa ry for pure lumichrome and riboflavin to sufficiently migrate on the TLC plate (Whatman KC18 Silica Gel 60 with fluorescent indicator, 10 x 10 cm, 200 m thick), saturated solutions of lumichrome and riboflavin in methanol:HCl (49:1) and in pure methanol were prepared (Phillips et al. 1999) Samples were pelleted to eliminate any particulate matter in solution as lu michrome and riboflavin have low solubility in many solvents. A total of 3 L of each mix and the solvent (methanl:HCl) were spotted onto the TLC plate. The plate was developed with a mobile phase of chloroform:methanol:water (17.5:12.5:1.5) (Phillips et al. 1999 ). A total time of approximate ly 40 minutes was required for the mobile phase to migrate to the top of the plate. Dilution series of the pure samples was perfor med in order to optim ize the concentration for visualization on TLC plates. Using stock solutions of 2800 g/L lumichrome and riboflavin, 1, 10 and 50 L were spotted onto the TLC plate in addition to 50 L of the solvent (methanol:HCl). The TLC was developed using the same mobile phase as above. The presence of lumichrome and riboflavin in coralline algae was tested by methanol extraction (Phillips et al. 1999, K itamura et al. 2007). Briefly, approximately 10 g of coralline

PAGE 110

110 algae, frozen in liquid nitrogen, were ground in to a paste to which 100% HPLC-grade methanol was added and transferred to a 15 ml plastic tu be. The suspension was vortexed vigorously, and allowed to settle on ice. The contents were filtered using a Whatman 0.45 L filter. This extraction process was performed three times. Me thanol was rotary-evapo rated at 45C at a pressure of 337 mbar, and then at 80 mbar fo r five hours on a Bchi Rotavapor R-200 (Bchi Labortechnik AG, Flawil, Switzerland). The final dried sample was reconstituted in 400 L of methanol:HCl (49:1) to be used for TLC. 5.2.4 Thin Layer Chromatography of Coralline Algae Extracts The m ethanol-extracted coralline algae sa mples were spotted onto the TLC plate in volumes of 1, 5, 10, and 25 L. Five microliters of the pure lumichrome and riboflavin stock solutions were spotted as well as 25 L of the methanol:HCl solvent. The plate was developed with chloroform:methanol:water (17.5:12.5:1.5) fo r 40 minutes, allowed to dry and visualized using a UV transluminator. Due to the suspicion that chlorophyll is also extracted with methanol from the coralline algae, solvent portioning was attempted to se parate lumichrome from chlorophyll. As a chlorophyll control, chlo rophyll was extracted from grass blad es with methanol. The starting solvent was methanol, which was then mixed with either ethyl acetate, isopropanol, chloroform, or tetrahydrofuran. If the two solvents were miscible then a 1:1 chloroform:water step was added. The solution was vortexed and then centrif uged to separate phases. Since lumichrome and riboflavin are yellow/orange in solution and chlorophyll is green, simple observation on the phase color indicated the presence of each chem ical. Acid (0.05 M HCl) and base (0.05 M NaOH) were added to each solvent mix to test the effect of pH on the partitioning. Solvent partitioning was applied to the corallin e algae extracts in order to separate chlorophyll from lumichrome and riboflavin and therefore result in a cleaner run on the TLC.

PAGE 111

111 The extracts were treated with methanol and ethyl acetate solvents mixed with chloroform and water and treated with 0.05 M NaOH. This resu lted in the yellow lumichrome in the top phase and the green chlorophyll in the bottom phase. The top phase was transferred to a new Eppendorf 1.5 ml tube and stored until used for TLC. Solvent partitioned coralline algae extr acts were separated by TLC with both chloroform:methanol:water (17.5:12.5:1.5) and also methanol:water (3:2) mobile phases. The samples were running quickly with the mobile front so a more hydrophobic mobile phase of chloroform:methanol:water (35:12.5:1.5) was used. 5.2.5 Induction of Coral Larvae Settlement and Metamorphosis Elkhorn coral, Acropora palmata gam etes were collected from Looe Key Reef, FL in August 2007 during a mass spawning event. Fertil ization and rearing of larvae were conducted at Mote Marine Laboratory Tropi cal Research Laboratory (Summerland Key, FL). Settlement experiments were set up in six well Petri plates to test the eff ects of pure lumichrome, riboflavin, and N -acyl-homoserine lactones (A HLs) have on the settlement and metamorphosis of coral larvae. Lumichrome and riboflavin were used du e to the observation that lumichrome induces settlement in ascidian larvae (Tsukamoto 1999). Larval settlement was scored positive if the larvae was attached at the aboral end to any part of the polystyrene well and did not detach with gentle agitation with water. Differences among treatments were compared using ANOVA and students t-test with STAT ISTICA software, version 6.0. N -acyl-homoserine lactones are signaling mol ecules and are critical components of the communication system, quorum sensing (Waters a nd Bassler 2005, West et al. 2007). For this experiment, 3-oxo-C6 homoserine lactone (a short-chain AHL commonly produced by marine vibrios (Taylor et al. 2004)) a nd C14 homoserine lactone (a lo ng-chain AHL) were used. 3-oxoC6 HSL is a common AHL produced by bacteria involved in quorum-sensing systems C14

PAGE 112

112 HSL was selected for these experiments based on the observation that many marine associated alphaand gamma-proteobacteria produce l ong-chain AHLs (Wagner-Dobler et al. 2005, Mohamed et al. 2008). Two reporter strains were utilized in order to detect the presence of lumichrome and/or AHLs in the methanol extracted coralline algae samples. Agrobacterium tumefaciens pZLR4 contains the traCDG operon with its promoter region. traG is transcriptionally fused to lacZ (Cha et al. 1998). The reporter construct is s timulated during interaction with AHLs. MG32dapA is a strain of Sinorhizobium meliloti construct with the dapA promoter fused with a gus reporter gene, which uses 5-bromo-4-chloro-3-i ndolyl-beta-D-glucuronic acid (X-gluc) as a substrate (25 g/ml). The dapA promoter activity was induced on M9 agar in response to 200 nM lumichrome in a promoter probe screen of Sinorhizobium meliloti (Gao et al., unpublished data). Therefore, the construct was used as a potential lumichrome reporter in this experiment. 20 l of the lumichrome and riboflavin solutions (4.55 mM and 1.46 mM, respectfully) and of each AHL tested (3.21 mM C14-HSL and 1 mM 3-o-C6-HSL) was impregnated onto 0.002 g C18 resin. The mixtures were allowed to dry ov ernight in a flow hood as the chemicals adhered to the resin. A small amount of aquarium-grade silicone adhesive was app lied to the center of a 1 x 1 inch porous ceramic tile and spread even ly with a metal spatula. The impregnated C18 resin was then spread onto the adhesive as ev enly as possible for each of the four chemicals tested. As controls, two tiles with silicone adhe sive only were prepared. Tiles were allowed to dry completely in the flow hood overnight (to e ffectively release acetic acid during the curing process). Prior to the set-up of the bioassay to test for the presen ce of the chemicals on the tiles, the tiles were washed in filter st erilized seawater for 3 hours and then placed in a thin layer of

PAGE 113

113 distilled water. The distilled water was to allow th e salt to diffuse out of the tiles so as to not interfere with the reporter strains. 2 ml of overnight culture of each reporter ( Agrobacterium tumefaciens pZLR4 and Sinorhizobium meliloti MG32-dapA) were subcultured into 50 ml ABM medium and incubated at 30 C for five hours (Hwang et al. 1994, Shaw et al. 1997). Each of the washed tiles were placed into large Petri plate (lumichrome, ribofla vin and control in one plate; AHLs and control in the other). The reporter strains were mixed with 100 ml of cooled ABM agar supplemented with Gm 30, 60 g/ml X-gal for the Agrobacterium reporter and 60 g/ml X-gluc for the MG32 reporter. The agar mixture was slowly poured ov er the tiles to cover th em, allowed to solidify and incubated at 30 C overnight. 5.3 Results 5.3.1 Consequences of AHL Hydrol ysis on Coral Settlement Settlem ent induction experiments carried out with competent Acropora palmata coral larvae approximately one week after fertiliza tion to investigate the involvement in common bacterial signaling molecules in the induction of coral larvae. Settlement in response to biofilms of wild-type bacteria (vector contro l) were compared to biofilms of the same bacterial strains that carried a plasmid-borne gene encoding for an AHL-lactonase enzyme that had developed on ceramic tiles. Each type of biofilm tested with and without the additi on of a small piece of crustose coralline algae (CCA) and a negative cont rol of tiles bathed in the bacterial media +/CCA was included. On each of the three days that settlement was measured, the media control with CCA resulted in the highest settlement events (Fig. 51A). In both the media control and the wild-type biofilm treatments, the addition of CCA enhanced larval settlement. The transgenic biofilms and CCA together, however, did not show enhanced se ttlement (Fig. 5-1A). Over the three day

PAGE 114

114 settlement experiment the media control with CCA led approximately 47% of the larvae to settle (Fig. 5-1B), which was significantly higher than all other treatments (F5, 21 = 32.6746; p < 0.0001). Exposure to wild-type biofilms with CCA resulted in settlement of approximately 13% of the larvae added (Fig. 5-1B). Post hoc comp arisons using t-tests indicated that media alone with CCA significantly induced settlement more th an wild-type biofilms w ith or without CCA (t = 2.079; p = 0.0005). The transgenic biofilms did not show significant differences in settlement in the presence or absence of CCA (p = 0.878). Settlement induction in response to exposure to known concentrati ons of AHL (3-o-C6HSL, synthetic AHL) was also tested with Acropora palmata larvae. The hypothesis that the AHL signal in the water would induce settlement at a higher rate than seaw ater alone was tested. The addition of CCA was also predicted to enhan ce coral settlement. Filte r sterilized seawater supplemented with 100 nM 3-o-C6-HSL did not indu ce coral larvae to sett le more than filter sterilized seawater alone (Fig. 5-2; F1,16 = 0.4337; p = 0.5195). The addition of CCA, however, to both treatments did increase settlement, a lthough the total percentage of settlement only reached approximately 15% (Fig. 5-2B). 5.3.2 Isolation of Coralline Algae Compounds Thin layer chromatography (TLC) was used to first separate pure samples of lumichrome and riboflavin. The hypothesis that lumichrome and riboflavin were present in crustose coralline algae (CCA) was tested. Compounds from CCA were extracted with methanol and crude extracts were separated by TLC. The crude extr acts did not separate as cleanly as the pure compounds with chloroform:methano l:water (17.5:12.5:1.5) or metha nol:water (3:2). They ran as a long smear with no distinct separation, how ever when viewed under UV light, regions did fluoresce similar to the pure compounds. To elim inate potential chlorophy ll contamination in the extraction process, samples were solvent partitioned to remove chlorophyll from the

PAGE 115

115 lumichrome. The extracts were treated with me thanol and ethyl acetate solvents mixed with chloroform and water, and finally treated with 0.05 M NaOH. This combination resulted in successful separation of the lumichrome and chlorophyll standards. The solvent partitioned samples, however, still did not show full separation as compared to the pure compounds. The samples migrated up the plate very quickly so a more hydrophobic mobile phase was used (chloroform:methanol:water; 35:12.5:1.5). This m obile fraction resulted in a shorter migration by the pure compounds but the extrac ts still migrated as a smear. 5.3.3 Roles of Signaling Molecules in Coral Larvae Settlement Due to lim ited number of Acropora palmata collected following the spawning event, only a preliminary pilot study investigating the e ffects of lumichrome on settlement could be performed. Eight larvae were pl aced in each treatment well and monitored for three days. No larvae settled in that time, although larvae in th e lumichrome treatments appeared to undergo more of a morphological change th an the larvae in the other treatme nts. The aboral end of the larvae was noticeably more swollen than in other treatments sugges ting that larvae were responding to lumichrome more so th an seawater alone (Fig. 5-4). Based on the limited observations of Acropora palmata larvae in response to exposure to lumichrome, the influence on settlement of Montastrea faviolata was examined. Settlement of Montastrea faviolata larvae in response to lumichrome, riboflavin and AHLs with acyl side chains of different lengths was extremely low. Lumichrome, riboflavi n and C14-HSL appeared to slightly induce settlement (Fig. 5-3); howev er, some settlement was also observed in the negative controls. No significant differences were observed between the treatments (F10,61 = 0.9564; p = 0.4899). No larvae settled in response to 3-o-C6-HSL regardless of concentration applied. This contradicts the results observed for Acropora palmata larvae in response to this

PAGE 116

116 AHL (Fig. 5-2). While lumichrome, riboflavin, and C14-HSL appear to induce settlement, the high standard error limits potential conclusions. 5.4 Discussion This study begins to shed light on the environmental and biological cues that Acropora palmata and Montastrea faviolata larvae perceive and respond to during their transition from pelagic to benthic organisms. While the conclusions that can be made from these settlement experiments are limited, there are specific tre nds that are both consistent with previously conducted studies and indicative of some genera l cues that induced larval settlement and metamorphosis. Settlement in response to wild -type and transgenic biofilms of a consortia of bacteria primarily comprised of isolates of Agrobacterium tumefaciens and Vibrio harveyi demonstrated that larvae of A. palmata show slightly different degrees of settlement as compared to seawater alone. This is primarily due to the production of AHLs by the wild-type bi ofilms and the lack of AHLs in the transgenic biofilms due to the aiiA gene encoding for an AHL-lactonase enzyme that cleaves the ring of the AHL molecule, resu lting in loss of function (Dong et al. 2000, Dong et al. 2001, Gao et al. 2007a). The presence of CCA led to an increased level of settlement in both the wild-type biofilm treatment and the nega tive control (> 40% settlement), while no such increased was observed in the transgenic biofilm treatment. This increase was greatest in the seawater negative control, sugge sting that settlement may be induced by CCA more than the presence of AHL signaling compounds produced by biofilms. This result was further supported through the experiment using a known concentr ation of a synthetic AHL (3-o-C6-HSL). Induction of settlement with and without the presence of CCA was not significantly different from the seawater negative control with a nd without CCA. In the treatments with CCA, induction of settlement was higher but similar between treatments.

PAGE 117

117 Larvae used in these experiments required approximately eight days to become fully competent. Once settled, larvae tended to begin to metamorphosize after 12-24 hours, which supports previous studies (Negri et al. 2001). The induction of settlement in response to CCA has been demonstrated in Pacific corals from the families Acroporidae and Faviidae (Morse et al. 1996, Baird and Morse 2004) and the results presente d here suggest that ac roporid corals in the Atlantic are induced to sett le after exposure to CCA cues in the environment. Riboflavin and its derivativ e lumichrome are chemicals involved in th e cell-to-cell communication between bacteria and their eukaryotic host (Phillips et al. 1999). Lumichrome is involved in the settlement and metamorphosis of sessile marine organisms such as the asicidin, Hhalocynthia roretz i (Tsukamoto 1999, Tsukamoto et al. 1999) Therefore, it is reasonable to hypothesize that riboflavin and lumichrome may be produced by either CCA or the bacteria associated with it. Methanol extractions of CCA and subsequent anal ysis with thin layer chromatography failed to successfully isolate both riboflavin and lumichrome from extracts of CCA. This is not to say, however, that neither compound is present in coralline algae. CCA does contain compounds that fluoresce similarly to pure samples of riboflavin and lumichrome (green and blue respectfully). While the poten tial for numerous natural compounds to fluoresce blue and green these results should not be disc ounted. Alternative se paration methods may be employed, such as high pressure liquid chromat ography (HPLC) to better separate compounds extracted from CCA. These compounds can then be screened for their involvement in the induction of coral larvae settle ment and metamorphosis. A recent study isolated a novel compound from CCA by HPLC shown to induce metamorphosis. The natural inducer was identified as 11-deoxyfistularin-3, a bromotyrosine derivative (K itamura et al. 2007). This chemical was also isolated from marine sponge s and related compounds have a wide range of

PAGE 118

118 biological activities, such as anti viral, antibiotic, cytotoxic, Na+/K+ ATPase inhibitory, and anticancer (Kitamura et al. 2007). Settlement experiments investigating the role s of lumichrome, ribof lavin and shortand long-chain AHLs in settlement induction of Montastrea faviolata larvae were inconclusive. While optimization of these settlement technique s are ongoing, sub-optimal larval and settlement conditions may have affected the outcome of the experiments. The spawning event at Looe Key Reef, FL in August 2007 resulted in nearly non-e xistent acroporid coral spawning and very few colonies of Montastrea faviolata that spawned. With limited competent coral larvae and adverse environmental conditions, representing natural c onditions for settlement becomes challenging. From the limited results of this study, it appears that the presence of multiple cues enhance the effect of each other. In order to determine if one cue is able to induce settlement alone, larvae must be presented with a wide range of treatments and sufficient yields of competent larvae from spawning events are required.

PAGE 119

119 0 2 4 6 8 10 12 14 16 Day 1 Day 2 Day 3Average number settled Media CCA Media + CCA WT CCA WT + CCA AiiA CCA AiiA + CCA 0 10 20 30 40 50 60 70 80 90 100 Media CCAMedia + CCAWT -CCAWT + CCATransgene CCA Transgene + CCATreatmentAvg. percent settled Figure 5-1. Coral larvae settlement in respons e to tiles bathed in GASW media supplemented with 5% CFA +/either wild -type biofilm formation or tr ansgenic biofilm formation with strains carrying the pAiiA (AHL-lactona se gene). Panel A shows average larval settlement measured each day. Each treatment was tested for both the ability to induce settlement and also if settlement was enhanced with the addition of a piece of crustose coralline algae (CCA). Panel B shows average percent of coral larvae settlement after 3 day exposure to each treatm ent. A total of 20 larvae were added to each treatment at the start of the experiment. Combined averages among treatments were used to calculate the total percentage of larvae that settled. Settlement was defined as adherence to any surface in the c ontainer with the abor al end of the pearshaped larvae. A B

PAGE 120

120 0 1 2 3 4 5 6 7 8 9 10 Day 1Day 2Day 3Average number settled AHL CCA AHL + CCA SW CCA SW + CCA 0 10 20 30 40 50 60 70 80 90 100 AHL CCAAHL + CCASW CCASW + CCATreatmentAvg. percent settled Figure 5-2. Coral larvae settlement in response to tiles bathed in filter sterilized sea water supplemented with 100 nM 3-o-C6-HSL (AHL treatment) and filter sterilized sea water as a control. Panel A shows averag e larval settlement measured each day. Each treatment was tested for both the ab ility to induce settlement and also if settlement was enhanced with the additi on of a piece of crustose coralline algae (CCA). Panel B shows average percent of coral larvae settlement after 3 day exposure to each treatment. A total of 20 la rvae were added to each treatment at the start of the experiment. Combined averages within treatments were used to calculate the total percentage of larvae that settled. Settlement was defined as adherence to any surface in the container with the abor al end of the pear-shaped larvae. A B

PAGE 121

121 0 0.2 0.4 0.6 0.8 1Lumichrome R i b of l avi n C6 5 nmol C 6 5 0 n m o l C6 1 umol C 1 4 5 nmo l C 14 50 nmol C14 1 umol S i licone + R esi n Silicon e S WTreatmentAvg. total settled Figure 5-3. Average total coral larvae ( Montastrea faveolata ) over six days in response to potential inducers. Settlement was conducte d in 6-well polystyren e Petri plates with 20 larvae added to each well with filter ster ilized seawater. Larval counts and water changes were performed daily. Combined av erages within treatments were used to calculate the total percentage of larvae that settled. Settlement was defined as adherence to any surface in the well with the aboral end of the pear-shaped larvae. Figure 5-4. Swollen aboral ends of A. palmata larvae in response to exposure to lumichrome. Panel A shows swimming larvae under a Leica dissection microscope with an autofluorescence filter. Comparatively mo re larvae in the lumichrome treatment exhibited swollen aboral ends than in the seawater control, poten tially signaling their readiness to settle (white arrows). Panel B depicts a close up of a larvae under dark field microscopy with a swollen aboral end in response to lumichrome (white arrow). B A B

PAGE 122

122 CHAPTER 6 SUMMARY AND CONCLUSIONS 6.1 Value and Decline of Corals Coral reefs are valuable ecosystems and are vi tal to the overall health and sustainability of near-shore marine systems. The goods and services originating from these ecosystems support local economies and represen t a wide array of benefits to society (Johns et al. 2001). Coral reefs, however, are facing ever incr easing environmental st ressors, limiting their productivity and ultimately leading to their demi se. These studies investigated how the biology of the corals, interactions with other organisms, and environm ental cues contribute to the complexity of coral reef ecology and specifically to the study and management of coral diseases. The environmental stressors confronting co rals continues to in crease as the worlds population and global demands increase (Harvell et al. 1999, Nystrom et al. 2000). Increased nitrification and pollutio n run-off due to amplified farmi ng practices and pollution from misstreated wastewater allow for th e introduction of opportunistic pat hogens into novel environments (Lipp et al. 2002, Griffin et al. 2003). Besides the fact th at anthropogenic stressors provide opportunities for pathogens, they alter the normal ecology of coral reef systems and subject the corals to conditions often well beyond their tolera nce. Such conditions generally led to coral bleaching, which may be exacerbated by the pres ence of pathogenic bacteria (Douglas 2003, Hughes et al. 2003, Rosenberg and Falkovi tz 2004, Ainsworth et al. 2008). 6.2 Characterization of a Coral White Pox Pathogen The increase of these types of anthropogenic inputs in the Florida Keys is what led researchers to suggest that the presence of Serratia marcescen s PDL100, a coral white pox pathogen, was due to introduction via un-treated sewage effluence (Patterson et al. 2002). Serratia marcescens is a known enterobacterium capable of causing disease in plant, vertebrate

PAGE 123

123 and invertebrate animals and humans but had not been isolated from a marine invertebrate before. The suggestion that S. marcescens PDL100 originated from hu man sources is reasonably supported by this study through the comparison of the carbon utiliza tion profiles and the enzymatic induction of S. marcescens isolates in response to growth on coral mucus. PDL100 correlated the highest with the pathogenic Serratia marcescens isolates. Carbohydrate utilization patterns (C UPs) are not only used to id entify bacterial isolates. These classification tools have also been appl ied to microbial source tracking. Identifying the CUP of a bacterial isolat e that can be compared to a databa se allows for source identification with relative ease. Hagedorn and colleague s used BIOLOG GP2 plat es to source track Enterococcus fecal pollution in water and found that CU P analysis led to an average rate of correct classification by source to be approximately 95%, well in the upper range of other methods (Hagedorn et al. 2003). CUP mappi ng has also been shown effective for E. coli and fecal streptococci resulting in a 73 and 93% average rate of correct classification (ARCC), respectfully (Seurinck et al. 2005) Nutrient utilization profiling has proven to be effective in source tracking E. coli in surface waters, yielding an ARCC of 89.5% using BIOLOG GN2 plates (Uzoigwe et al. 2007). The high degree of correlation between the co ral white pox pathogen and other pathogenic isolates of Serratia marcescens tends to suggest that metabolic potentials and perhaps virulence factors are conserved among pathoge nic isolates of this species. This notion provides reason why S. marcescens is such a successful opportunistic pathoge n, and able to infect vastly different hosts. The fundamental mechanisms that Serratia marcescens PDL100 employs during colonization and growth on the coral host are si milar to those observed in other pathogenic S. marcescens isolates. It appears th at this coral white pox pathogen may have the necessary

PAGE 124

124 machinery in place to overcome its host defenses and mount an attack leading to an infection, provided there is an open niche or the coral is vulnerable due to other stressors. This is suggested based on the induction of enzymatic ac tivities and proteases during growth on coral mucus. Both cell-associated and extracellular pr oteases were shown to be induced during growth of the pathogen on coral mucus. Extracellular prot eases are often associated with virulence and a mechanism for pathogenicty (Travi s et al. 1995, Young et al. 1999). Serratia marcescens PDL100 also possesses the metabolic and regulatory pathways that may be needed to colonize and grow on coral mucus. These pathways, howev er, may not have specifically evolved during the interaction be tween PDL100 and Acropora palmata In fact, many of the carbon substrates utilized by PDL100 were common to those utilized by other isolates of S. marcescens. Similarly, the enzymes induced during growth on coral mu cus were consistent with other pathogenic isolates of S. marcescens 6.3 Potential Regulation of Virulen ce Factors and Disease Management The results of this study also indicate that Serratia marcescens PDL100 possesses the two-component regulatory system GacS/GacA. The complementation assay demonstrated that the GacA protein in PDL100 is f unctional and therefore suggests that this pathogen may regulate its virulence through this response re gulator as do many other pathogenic -protoebacteria including E. coli, Salmonella enterica Pseudomonas spp. and Vibrio spp. (Lapouge et al. 2008). Potential targeting of the gacA gene for disrup tion or mutation may lead to a strategy for the management of this pathogen. As discussed ear lier, conventional disease treatments, such as antibiotics are not feasible on coral reefs. By disrupting the functi on of gacA or another component of the regulatory system, the pathogen will still be able to grow and proliferate, however, virulence factors controlled by the regu lator protein will not be expressed (Lapouge et al. 2008). Another target within the regul atory system is the inhibition of the

PAGE 125

125 autophosphorylatable GacS in response to an envi ronmental stimulatory signal. Potentially, an environmental signal or microbial isolate could be used as a bioc ontrol agent to inhibit GacS and therefore, the downstream virulen ce gene expression. The use of pr obiotic bacteria to colonize a host and provide a barrier against and/or actually inhibit pathogenic infection is routinely applied in agriculture and commercial aquaculture to contro l disease in trout (Brunt et al. 2007), shrimp (Chythanya et al. 2002, Farzanfa r 2006) and other species (Balcazar et al. 2006). The exploitation of the natural abi lities of native coral-associated bacteria to combat invading pathogens, may be a future means to manage opportunistic pathogens capable of causing coral diseases. 6.4 Coral Mucus Coral mucus has been shown to serve many purposes for the coral host and the surrounding reef ecosystem. Such functions include ciliarymucoid feeding by the copepod Acartia negligens (Richman et al. 1975) and mu cus is hypothesized to protect against fouling, smothering by sediment, physical damage, desiccati on during air exposure at extreme low tides, space invasion by other corals, and ultraviolet ra diation damage (rev. (Wild et al. 2004, Brown and Bythell 2005)). Mucus also provides rich organic nutrients to bacteria and other microorganisms living on the corals and in the su rrounding waters (Wild et al. 2004). While the composition of coral mucus varies among speci es, season and depth (Crossland 1987), certain types of molecules are routinel y present. In many cases, protein and carbohydrate polymers are the major components, where as lipids are less abundant. Generall y, fucose, arabinose, galactose and N-acetyl glucosamine are present in hi gh concentrations (Ducklow and Mitchell 1979, Meikle et al. 1988). The enzyme induction assay pr esented here begins to elucidate some of the carbon sources found in Acropora palmata mucus secreted during the summer months. While

PAGE 126

126 these conclusions were deduced indirectly, the induction of the specific enzymes indicates that these molecules were present in coral mucus. 6.5 Settlement and Metamorphosis of Coral Larvae Settlement and metamorphosis induction expe riments demonstrate that Acropora palmata larvae appear to respond to both AHLs and cues fro m coralline algae. Experimental results also demonstrate that larvae of A. palmata induce settlement in response to microbial biofilms comprised of Agrobacterium and Vibrio isolates from coral mucus. The settlement cues from CCA may either be produced by the algae or by bact eria associated with the algae (Negri et al. 2001). Lumichrome showed potential for induction of settlement in A. palmata in a pilot study that led planktonic larvae to swell and become pear shape before those in other treatments (Fig. 5-4). However, due to limited larvae stocks, the influence of lumichrome and riboflavin in settlement and metamorphosis in A. palmata larvae was not tested. Montastrea faviolata larvae is another important reef-building coral species in the Caribbean. Settlement experiments testing the role of lumichrome, ribofla vin and shortand long-chain AHLs were conducted, but results and conclusions were limited due to low larv ae counts and unfavorable spawning conditions. 6.6 Future Directions The m echanisms and virulence factors utilized by opportunistic pathogens remain unclear for many pathogens, including Serratia marcescens (Patterson et al. 2002). Although wellstudied the full mechanism of Vibrio harveyi has yet to be fully eluc idated (Austin and Zhang 2006). In Pseudomonas aeruginosa few host-specific virulence mechanisms were identified in virulence mutant screens in insects, mice, and nematodes, suggesting extensive conservation of virulence factors used by this pathogen (Mahajan -Miklos et al. 2000). This study begins to draw some conclusions as to the types of capabilities and potential virulent pathways exhibited by the coral white pox pathogen, Serratia marcescens PDL100. These conclusions were drawn from

PAGE 127

127 metabolic characterization experiments in comparison to other environmental and pathogenic isolates of S. marcescens as well as native coral bacterial isolates. The results of the metabolic assays suggest potential genes i nvolved in the colonization and growth of the pathogen when it encounters coral mucus. The natural progressi on of research is the genetic and molecular characterization of white pox dis ease. Tools to identify specif ic genes induced or repressed during the colonization and infectio n process such as a promoter library screen will be employed. Once these genes are clearly identified as being involved in the col onization and infection process, they may serve as targ ets for disruption in order to reduce virulence in the pathogen. Similar tools can then be applied to other co ral diseases in order to better understand the mechanism of infection. Once coral diseases ar e understood at the microbial level, sustainable management practices to reduce disease and preserve coral reefs may be achievable.

PAGE 128

128 LIST OF REFERENCES Abelson, A., R. Olinky, and S. Gaines. 2005. Coral r ecruitm ent to the reefs of Eilat, Red Sea: temporal and spatial variation, and possible e ffects of anthropogenic disturbances. Marine Pollution Bulletin 50:576-582. Ainsworth, T. D., M. Fine, G. Roff, and O. Ho egh-Guldberg. 2008. Bacteria are not the primary cause of bleaching in the Mediterran ean coral Oculina patagonica. Isme J 2:67-73. Ainsworth, T. D., E. Kramasky-Winter, Y. Loya O. Hoegh-Guldberg, and M. Fine. 2007. Coral disease diagnostics: what's between a pla gue and a band? Appl Environ Microbiol 73:981-992. Aizawa, S. I. 2001. Bacterial flagella and type III secretion systems. FEMS Microbiol Lett 202:157-164. Alker, A. P., G. W. Smith, and K. Kim. 2001. Characterization of Aspergillus sydowii (Thom et Church), a fungal pathogen of Caribbean sea fan corals. Hydrobiologia 460 :105-111. Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham, and R. Maurer. 2000. Characterization of two novel regulatory genes affecting Salm onella invasion gene expression. Mol Microbiol 35 :635-646. Aronson, R. B., J. F. Bruno, W. F. Precht, P. W. Glynn, C. D. Harvell, L. Kaufman, C. S. Rogers, E. A. Shinn, and J. F. Valentine. 2003. Causes of coral reef degradation. Science 302:1502-1504; author reply 1502-1504. Austin, B., and X.-H. Zhang. 2006. Vibrio harveyi : a significant pathogen of marine vertebrates and invertebrates. Letter s in Applied Microbiology 43:119-124. Babcock, R. C., and A. J. Heyward. 1986. Larval Development of Certain Gamete-Spawning Scleractinian Corals. Coral Reefs 5:111-116. Babitzke, P., and T. Romeo. 2007. CsrB sRNA family: sequestra tion of RNA-binding regulatory proteins. Curr Opin Microbiol 10:156-163. Baikalov, I., I. Schroder, M. Kaczor-Grzeskowiak, K. Grezeskowiak, R. P. Grunsalus, and R. E. Dickerson. 1996. Effect of phosphorylation on the interdomain interaction of the response regulator, NarL. Biochemistry 35:11053-11080. Baird, A. H., and A. N. C. Morse. 2004. Induc tion of metamorphosis in larvae of the brooding corals Acropora palifera and Stylophora pist illata. Marine and Fr eshwater Research 55:469-472. Baker, C. S., I. Morozov, K. Suzuki, T. Ro meo, and P. Babitzke. 2002. CsrA regulates glycogen biosynthesis by preventing translation of gl gC in Escherichia coli. Mol Microbiol 44:1599-1610.

PAGE 129

129 Balcazar, J. L., I. de Blas, I. Ruiz-Zarzuela, D. Cunningham, D. Vendrell, and J. L. Muzquiz. 2006. The role of probiotics in aquaculture. Vet Microbiol 114 :173-186. Ball, E. E., D. C. Hayward, J. S. Reece-Hoyes, N. R. Hislop, G. Samuel, R. Saint, P. L. Harrison, and D. J. Miller. 2002. Coral development: from classical embryology to molecular control. Int J Dev Biol 46:671-678. Banin, E., T. Israely, M. Fine, Y. Loya, a nd E. Rosenberg. 2001. Role of endosymbiotic zooxanthellae and coral mucus in the adhesi on of the coral-bleaching pathogen Vibrio shiloi to its host. FEMS Microbiol Lett 199 :33-37. Bassler, B. L., C. Yu, Y. C. Lee, and S. Ro seman. 1991. Chitin utiliza tion by marine bacteria. Degradation and catabolism of chitin oligosacch arides by Vibrio furnissii. J Biol Chem 266:24276-24286. Belda-Baillie, C. A., B. K. Baillie, and T. Maruyama. 2002. Specificity of a model cnidariandinoflagellate symbiosis. Biol Bull 202 :74-85. Bellwood, D. R., T. P. Hughes, C. Folke, and M. Nystrom. 2004. Confronting the coral reef crisis. Nature 429:827-833. Ben-Haim, Y., and E. Rosenberg. 2002. A novel Vibrio sp pathogen of the coral Pocillopora damicornis. Marine Biology 141:47-55. Ben-Haim, Y., F. L. Thompson, C. C. Thompson, M. C. Cnockaert, B. Hoste, J. Swings, and E. Rosenberg. 2003a. Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen of the coral Pocillopora damicornis Int J Syst Evol Microbiol 53 :309-315. Ben-Haim, Y., M. Zicherman-Keren, and E. Rosenberg. 2003b. Temperature-regulated bleaching and lysis of the coral Pocillopor a damicornis by the novel pathogen Vibrio coralliilyticus. Appl Environ Microbiol 69:4236-4242. Berg, G., L. Eberl, and A. Hartmann. 2005. The rhizosphere as a reservoir for opportunistic human pathogenic bacter ia. Environ Microbiol 7 :1673-1685. Bhowmick, R., A. Ghosal, and N. S. Chatte rjee. 2007. Effect of environmental factors on expression and activity of chitinase genes of vibrios with special reference to Vibrio cholerae. J Appl Microbiol 103:97-108. Birrell, C. L., L. J. McCook, and B. L. Willis. 20 05. Effects of algal turfs and sediment on coral settlement. Marine Pollution Bulletin 51:408-414. Brosius, J., M. Erfle, and J. Storella. 1985. Spacing of the -10 and -35 regions in the tac promoter. Effect on its in vivo activity. J Biol Chem 260:3539-3541. Brown, B. E. 1997. Disturbances to Reefs in Recent Times. in C. Birkeland, editor. Life and Death of Coral Reefs. Springer, New York.

PAGE 130

130 Brown, B. E., and J. C. Bythell. 2005. Perspectiv es on mucus secretion in reef corals. Marine Ecology Progress Series 296:291-309. Bruno, J. F., L. E. Petes, C. Drew Harvell, a nd A. Hettinger. 2003a. Nutrient enrichment can increase the severity of co ral diseases. Ecology Letters 6:1056-1061. Bruno, J. F., J. J. Stachowicz, and M. D. Bertne ss. 2003b. Inclusion of faci litation into ecological theory. Trends in Ecology & Evolution 18:119-125. Brunt, J., A. Newaj-Fyzul, and B. Austin. 2007. The development of probioti cs for the control of multiple bacterial diseases of rainbow tr out, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases 30:573-579. Campbell, C. D., S. J. Grayston, and D. J. Hirs t. 1997. Use of rhizosphere carbon sources in sole carbon source tests to discriminate soil microbial communities. J Microbiol Methods 30:33-41. Carbonell, G. V., H. H. M. Della Colleta, T. Ya no, A. L. C. Darini, C. E. Levy, and B. A. L. Fonseca. 2000. Clinical relevance and virulence factors of pigmented Serratia marcescens. FEMS Immunol Med Microbiol 28:143-149. Cha, C., P. Gao, Y. C. Chen, P. D. Shaw and S. K. Farrand. 1998. Production of acylhomoserine lactone quorum-sensing signals by gram-negative plant-associated bacteria. Mol Plant Microbe Interact 11:1119-1129. Chang, D. E., D. J. Smalley, D. L. Tucker, M. P. Leatham, W. E. Norris, S. J. Stevenson, A. B. Anderson, J. E. Grissom, D. C. Laux, P. S. Cohen, and T. Conway. 2004. Carbon nutrition of Escherichia coli in the mous e intestine. Proc Natl Acad Sci U S A 101:74277432. Choi, K. H., and F. C. Dobbs. 1999. Comparison of two kinds of Biol og microplates (GN and ECO) in their ability to distinguish among aquatic microbial communities. J Microbiol Methods 36:203-213. Chythanya, R., I. Karunasagar, and I. Karunasagar. 2002. Inhibiti on of shrimp pathogenic vibrios by a marine Pseudomonas I-2 strain. Aquaculture 208:1-10. Cooper, C. R. 1999. Prepared Statement of C. Renee Cooper, Executive Director, Caribbean Research Center. in Coral Reef Conservation and the Reauthorization of the National Marine Sanctuaries Act. Hearing before th e Subcommittees of Oceans and Fisheries and the Committee on Commerce, Science and Tran sportation. United States Senate. One Hundred Sixth Congress., Washington, D. C. Costanza, R., R. dArge, R. deGroot, S. Farber M. Grasso, B. Hannon, K. Limburg, S. Naeem, R. V. ONeill, J. Paruelo, R. G. Raskin, P. Su tton, and M. vandenBelt. 1997. The value of the world's ecosystem services and natural capital. Nature 387 :253-260.

PAGE 131

131 Crossland, C. J. 1987. In situ release of mucus and DOC-lipid from the corals Acropora variabilis and Stylophora pistillata in different light regimes. Coral Reefs 6:35-42. de Boer, H. A., L. J. Comstock, and L. I. Rothfield. 1983. The tac promoter: a functional hybrid derived from the trp and lac promoters. PNAS 80:21-25. Demidyuk, I. V., A. E. Kalashnikov, T. Y. Grom ova, E. V. Gasanov, D. R. Safina, M. V. Zabolotskaya, G. N. Rudenskaya, an d S. V. Kostrov. 2006. Cloning, sequencing, expression, and characterization of protealysin, a novel neutra l proteinase from Serratia proteamaculans representing a new group of th ermolysin-like proteases with short Nterminal region of precurs or. Protein Expr Purif 47:551-561. Diederich, L., A. Roth, and W. Messer. 1994. A vers atile plasmid vector system for the regulated expression of genes in Escherichia coli BioTechniques 16:916-923. Dobretsov, S., H.-U. Dahms, H. YiLi, M. Wahl, and P.-Y. Qian. 2007. The effect of quorumsensing blockers on the formation of ma rine microbial communities and larval attachment. FEMS Microbiology Ecology 60:177-188. Dong, Y. H., L. H. Wang, J. L. Xu, H. B. Zhang, X. F. Zhang, and L. H. Zhang. 2001. Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine lactonase. Nature 411 :813-817. Dong, Y. H., J. L. Xu, X. Z. Li, and L. H. Zhang. 2000. AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the vi rulence of Erwinia carotovora. Proc Natl Acad Sci U S A 97:3526-3531. Douglas, A. E. 2003. Coral bleaching--how and why? Marine Pollution Bulletin 46:385-392. Drake, H. L., and M. A. Horn. 2007. As the worm turns: the earthworm gut as a transient habitat for soil microbial biomes. Annu Rev Microbiol 61 :169-189. Drickamer, K., and R. A. Dwek. 1995. Carbohydrat es and glycoconjugates. Current Opinion in Structural Biology 5:589-590. Dubey, A. K., C. S. Baker, T. Romeo, and P. Babitzke. 2005. RNA sequence and secondary structure participate in high-a ffinity CsrA-RNA interaction. RNA 11:1579-1587. Dubey, A. K., C. S. Baker, K. Suzuki, A. D. Jones, P. Pandit, T. Romeo, and P. Babitzke. 2003. CsrA regulates translation of the Escher ichia coli carbon starvation gene, cstA, by blocking ribosome access to the cstA transcript. J Bacteriol 185 :4450-4460. Dubuis, C., and D. Haas. 2007. Cross-species GacA-controlled inducti on of antibiosis in pseudomonads. Appl Environ Microbiol 73:650-654. Dubuis, C., C. Keel, and D. Haas. 2007. Dialogues of root-colonizing bi ocontrol pseudomonads. Eur J Plant Pathol 119:311-328.

PAGE 132

132 Ducklow, H. W., and R. Mitchell. 1979. Co mposition of Mucus Released by Coral-Reef Coelenterates. Limnology and Oceanography 24:706-714. Dutta, R., L. Qin, and M. Inouye. 1999. Histidin e kinases: diversity of domain organization. Molecular Microbiology 34:633-640. Eberl, L., S. Molin, and M. Givskov. 1999. Surface motility of Serratia liquefaciens MG1. J Bacteriol 181 :1703-1712. Edmunds, P. J. 2007. Evidence for a decadal-scale decline in the growth rates of juvenile scleractinian corals. Mari ne Ecology-Progress Series 341:1-13. Edmunds, P. J., J. F. Bruno, and D. B. Carlon. 20 04. Effects of depth and microhabitat on growth and survivorship of juvenile corals in th e Florida Keys. Marine Ecology Progress Series 278:115-124. Fabricius, K. E. 2005. Effects of terrestrial r unoff on the ecology of cora ls and coral reefs: review and synthesis. Marine Pollution Bulletin 50 :125-146. Frnbck, M., L. Eriksson, and G. Widmalm. 2008. Methyl 2-O-bL-fucopyranosyl a-Dglucopyranoside monohydrate: a sy nchrotron study. Acta Cryst. C64 :o31-o32. Farzanfar, A. 2006. The use of probiotics in shr imp aquaculture. FEMS Immunol Med Microbiol 48:149-158. Ferenci, T. 1996. Adaptation to life at micromolar nutrient levels: the regulation of Escherichia coli glucose transport by endoinducti on and cAMP. FEMS Microbiol Rev 18:301-317. Foley, J. E., S. H. Sokolow, E. Girvetz, C. W. Foley, and P. Foley. 2005. Spatial epidemiology of Caribbean yellow band syndrome in Montastrea spp. coral in the eastern Yucatan, Mexico. Hydrobiologia 548:33-40. Fravel, D. R. 2005. Commercialization and implementation of biocontrol. Annu Rev Phytopathol 43:337-359. Frias-Lopez, J., J. S. Klaus, G. T. Bo nheyo, and B. W. Fouke. 2004. Bacterial community associated with black band disease in corals. Appl Environ Microbiol 70 :5955-5962. Fung, I. Y., S. C. Doney, K. Lindsay, and J. John. 2005. Evolution of carbon sinks in a changing climate. PNAS 102:11201-11206. Galperin, M. Y. 2006. Structural Classification of Bacterial Res ponse Regulators: Diversity of Output Domains and Domain Combinations. J Bacteriol 188 :4169-4182. Gao, M., H. Chen, A. Eberhard, M. R. Gronquist, J. B. Robinson, M. Connolly, M. Teplitski, B. G. Rolfe, and W. D. Bauer. 2007a. Eff ects of AiiA-mediated quorum quenching in Sinorhizobium meliloti on quorum-sensing signal s, proteome patterns, and symbiotic interactions. Mol Plant Microbe Interact 20:843-856.

PAGE 133

133 Gao, R., T. R. Mack, and A. M. Stock. 2007b. Bact erial response regulators: versatile regulatory strategies from common domains. Trends in Biochemical Sciences 32:225-234. Garland, J. L. 1997. Analysis a nd interpretation of community-l evel physiological profiles in microbial ecology. FEMS Microbiology Ecology 24:289-300. Garland, J. L., and A. L. Mills. 1991. Classi fication and Characteriza tion of Heterotrophic Microbial Communities on the Basis of Pa tterns of Community-Level Sole-CarbonSource Utilization. Appl Environ Microbiol 57:2351-2359. Garrigues, D., and G. Arevalo. 1995. An evaluation of the production and use of a live bacterial isolate to manipulate the microbial flora in the commercial production of Penaeus vannamei post-larvae in Ecuador. Pages 53-59 in C. L. Browdy and J. S. Hopkins, editors. Swimming through troubled water. Proceedings of the Special Session on Shrimp Farming, Aquaculture '95. Worl d Aquaculture Society, Baton Rouge. Garrison, V. H., E. A. Shinn, W. T. Foreman, D. W. Griffin, C. W. Holmes, C. A. Kellogg, M. J. Majewski, L. L. Richardson, K. B. Ritchi e, and G. W. Smith. 2003. African and Asian dust: from desert soils to coral reefs. BioScience 53:469-480. Gil-Agudelo, D. L., C. Myers, G. W. Smit h, and K. Kim. 2006. Changes in the microbial communities associated with Gorgonia ventalina during aspe rgillosis infection. Dis Aquat Organ 69:89-94. Golbuu, Y., and R. H. Richmond. 2007. Substratum preferences in planula larvae of two species of scleractinian corals, Goniastrea retiformis and Stylaraea punctata Marine Biology 152:639-644. Gosset, G., Z. Zhang, S. Nayyar, W. A. Cuevas, and M. H. Saier, Jr. 2004. Transcriptome Analysis of Crp-Dependent Catabolite Contro l of Gene Expression in Escherichia coli. J Bacteriol 186 :3516-3524. Gray Davidson, O. 1998. The Enchanted Braid: Coming to Terms with Nature on the Coral Reef. John Wiley & Sons, Inc., New York. Griffin, D. W., K. A. Donalds on, J. H. Paul, and J. B. Rose 2003. Pathogenic human viruses in coastal waters. Clinical Microbiology Reviews 16:129-143. Griffin, D. W., C. J. Gibson, 3rd, E. K. Lipp, K. Riley, J. H. Paul, 3rd, and J. B. Rose. 1999. Detection of viral pathogens by reverse transcriptase PCR a nd of microbial indicators by standard methods in the canals of the Florida Keys. Appl Environ Microbiol 65:41184125. Grimes, D. J. 1991. Ecology of estuarine bacteria capable of causing human disease: a review. Estuaries and Coasts 14:345-360. Grimont, P. A., and F. Grimont. 1978. Th e genus Serratia. Annu Rev Microbiol 32:221-248.

PAGE 134

134 Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors c ontaining the arabinose PBAD promoter. J Bacteriol 177 :4121-4130. Hagedorn, C., J. B. Crozier, K. A. Mentz, A. M. Booth, A. K. Graves, N. J. Nelson, and R. B. Reneau. 2003. Carbon source utilization profiles as a method to identify sources of faecal pollution in water. J Appl Microbiol 94:792-799. Halpern, B. S., S. Walbridge, K. A. Selkoe, C. V. Kappel, F. Micheli, C. D'Agrosa, J. F. Bruno, K. S. Casey, C. Ebert, H. E. Fox, R. Fujita, D. Heinemann, H. S. Lenihan, E. M. Madin, M. T. Perry, E. R. Selig, M. Spalding, R. Steneck, and R. Watson. 2008. A global map of human impact on marine ecosystems. Science 319 :948-952. Hammer, B. K., E. S. Tateda, and M. S. Sw anson. 2002. A two-component regulator induces the transmission phenotype of st ationary-phase Legionella pneumophila. Mol Microbiol 44:107-118. Harris, J. A., R. J. Hobbs, E. Higgs, and J. Aronson. 2006. Ecological restoration and global climate change. Restoration Ecology 14:170-176. Harrison, P. L., and C. C. Wallace. 1990. Reproduction, dispersal and recruitment of scleractinian corals. Pages 133-207 in Z. Dubinsky, editor. Coral Reefs (Ecosystems of the world, Vol 25). Elsevier Scie nce Publishing Company, New York. Harvell, C. D., K. Kim, J. M. Burkholder, R. R. Colwell, P. R. Epstein, D. J. Grimes, E. E. Hofmann, E. K. Lipp, A. D. Osterhaus, R. M. Overstreet, J. W. Porter, G. W. Smith, and G. R. Vasta. 1999. Emerging marine diseases-climate links and anthropogenic factors. Science 285 :1505-1510. Heeb, S., and D. Haas. 2001. Regulatory roles of the GacS/GacA two-component system in plantassociated and other gram-negativ e bacteria. Mol Plant Microbe Interact 14:13511363. Heeb, S., S. A. Kuehne, M. Bycroft, S. Crivii, M. D. Allen, D. Haas, M. Camara, and P. Williams. 2006. Functional analysis of the posttranscriptional regulator RsmA reveals a novel RNA-binding site. J Mol Biol 355:1026-1036. Heyward, A. J., and A. P. Negri. 1999. Natural inducers for coral larval metamorphosis. Coral Reefs 18:273-279. Hill, G. T., N. A. Mitkowski, L. Aldrich-Wolfe, L. R. Emele, D. D. Jurkonie, A. Ficke, S. Maldonado-Ramirez, S. T. Lynch, and E. B. Nelson. 2000. Methods for assessing the composition and diversity of soil microbi al communities. Applied Soil Ecology 15:25-36. Hoegh-Guldberg, O. 1999. Climate change, coral bleaching and the future of the world's coral reefs. Marine and Freshwater Research 50:839-866.

PAGE 135

135 Holling, C. S. 1996. Engineering resilience ve rsus ecological resilience. Pages 31-43 in P. C. Schulze, editor. Engineering Withing Ecological Constraints. National Academy Press. Howarth, R., D. Anderson, J. Cloern, C. Elfri ng, C. Hopkinson, B. Lapointe, N. Malone, K. McGlathery, A. Sharpley, and D. Walker. 2000. Nutrient pollution of coastal rivers, bays, and seas. Issues Ecol 7:1-15. Huang, Y.-L., S. Dobretsov, H. Xiong, and P.-Y Qian. 2007. Effect of Biofilm Formation by Pseudoalteromonas spongiae on Induction of Larval Settlement of the Polychaete Hydroides elegans. Appl Environ Microbiol 73:6284-6288. Hueck, C. J. 1998. Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants. Microbiol Mol Biol Rev 62. Huggett, M. J., J. E. Williamson, R. de Nys, S. Kjelleberg, and P. D. Steinberg. 2006. Larval settlement of the common Australian sea ur chin Heliocidaris eryt hrogramma in response to bacteria from the surface of coralline algae. Oecologia 149 :604-619. Hughes, T. P., A. H. Baird, D. R. Bellwood, M. Ca rd, S. R. Connolly, C. Folke, R. Grosberg, O. Hoegh-Guldberg, J. B. Jackson, J. Kleypas, J. M. Lough, P. Marshall, M. Nystrom, S. R. Palumbi, J. M. Pandolfi, B. Rosen, and J. Roughgarden. 2003. Climate change, human impacts, and the resilience of coral reefs. Science 301:929-933. Hussa, E. A., T. M. O'Shea, C. L. Darnell, E. G. Ruby, and K. L. Visick. 2007. Two-Component Response Regulators of Vibrio fische ri: Identification, Mutagenesis, and Characterization. J Bacteriol 189 :5825-5838. Hwang, I., P. L. Li, L. Zhang, K. R. Piper, D. M. Cook, M. E. Tate, and S. K. Farrand. 1994. TraI, a LuxI homologue, is responsible for production of conjugation factor, the Ti plasmid N-acylhomoserine lactone auto inducer. Proc Natl Acad Sci U S A 91:4639-4643. Inoue, H., H. Nojima, and H. Okayama. 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96:23-28. Jackson, D. W., J. W. Simecka, and T. Romeo. 2002. Catabolite repression of Escherichia coli biofilm formation. J Bacteriol 184 :3406-3410. Johns, G. M., V. R. Leeworthy, F. W. Bell, M. A. Bonn, F. S. U. a. N. in association with Hazen and Sawyer Environmental Engineers and Scientists, and G. P. Yang. 2001. Socioeconomic study of reefs in southeast Florida. Page 348 in P. B. C. Broward County, Miami-Dade County, Monroe County, Florida Fish and Wildlife Conservation Commission, National Oceanic and Atmosphe ric Administration, editor. Hazen and Sawyer, PC. Karlson, R. H. 1999. Dynamics of Coral Commun ities. Kluwer Academic Publishers, Boston.

PAGE 136

136 Kay, E., C. Dubuis, and D. Haas. 2005. Three sma ll RNAs jointly ensure secondary metabolism and biocontrol in Pseudomonas fluores cens CHA0. Proc Natl Acad Sci U S A 102:17136-17141. Kempf, S. C. 1991. A "primitive" symbiosis between the aeolid nudibranch Berghia verrucicornis (A. Costa, 1867) and a z ooxanthella. J Molluscan Stud 57:75-85. Kitamura, H., S. Kitahara, and H. B. Koh. 1993. The induction of larval settlement and metamorphosis of two sea urchins, Pse udocentrotus depressus and Anthocidaris crassispina, by free fatty acids extracted from the coralline red alga Corallina pilulifera. Marine Biology 115:387-392. Kitamura, M., T. Koyama, Y. Nakano, and D. Uemura. 2007. Characteri zation of a natural inducer of coral larval metamorphosis. J ournal of Experimental Marine Biology and Ecology 340 :96-102. Kjelleberg, S., P. Steinberg, M. Givskov, L. Gram, M. Manefield, and R. deNys. 1997. Do marine natural products interfere with pr okaryotic AHL regulatory systems? Aquatic Microbial Ecology 13:85-93. Knowlton, N., and F. Rohwer. 2003. Multispecies Microbial Mutualisms on Coral Reefs: The Host as a Habitat. The American Naturalist 162 :S51-S62. Koehl, M. A. R., and M. G. Hadfield. 2004. So luble settlement cue in slowly moving water within coral reefs induces larval adhesi on to surfaces. Journal of Marine Systems 49:7588. Konopka, A., L. Oliver, and R. F. Turco Jr. 1998. The use of carbon substrat e utilization patterns in environmental and ecological microbiology. Microb Ecol 35:103-115. Kooperman, N., E. Ben-Dov, E. Kramarsky-Winter, Z. Barak, and A. Kushmaro. 2007. Coral mucus-associated bacterial communities from natural and aquarium environments. FEMS Microbiol Lett 276 :106-113. Kuffner, I. B., L. J. Walters, M. A. Becerro, V. J. Paul, R. Ritson-Williams, and K. S. Beach. 2006. Inhibition of coral recru itment by macroalgae and cyan obacteria. Mar Ecol Prog Ser 323:107-117. Kurz, C. L., S. Chauvet, E. Andres, M. Aurouze, I. Vallet, G. P. Michel, M. Uh, J. Celli, A. Filloux, S. De Bentzmann, I. Steinmetz, J. A. Hoffmann, B. B. Finlay, J. P. Gorvel, D. Ferrandon, and J. J. Ewbank. 2003. Virulence factors of the human opportunistic pathogen Serratia marcescens identif ied by in vivo screening. Embo J 22:1451-1460. Kurz, C. L., and J. J. Ewbank. 2000. Caenorha bditis elegans for the study of host-pathogen interactions. Trends Microbiol 8 :142-144.

PAGE 137

137 Kwon, O., D. Georgellis, and E. C. C. Lin. 2000. Phosphorelay as the Sole Physiological Route of Signal Transmission by the Arc Two-Com ponent System of Escherichia coli. J Bacteriol 182 :3858-3862. Lapointe, B. E., P. J. Barile, and W. R. Matzie. 2004. Anthropogenic nutrient enrichment of seagrass and coral reef communities in the Lower Florida Keys: discrimination of local versus regional nitrogen sources. Journal of Experimental Marine Biology and Ecology 308:23-58. Lapointe, B. E., and M. W. Clark. 1992. Nutrie nt Inputs from the Watershed and Coastal Eutrophication in the Florida Keys. Estuaries 15 :465-476. Lapouge, K., M. Schubert, F. H. T. Allain, and D. Haas. 2008. Gac/Rsm signal transduction pathway of -proteobacteria: from RNA recognition to regulation of social behaviour. Molecular Microbiology 67:241-253. Laux, D. C., P. S. Cohen, and T. Conway. 2005. Role of the mucus layer in bacterial colonization of the intestine. in J. P. Nataro, P. S. Cohen, H. L. T. Mobley, and J. N. Weiser, editors. Colonization of Mucosal Surfaces. ASM Press, Washington, D.C. Lawhon, S. D., R. Maurer, M. Suyemoto, and C. Altier. 2002. Intestinal short-chain fatty acids alter Salmonella typhimurium invasion gene expression and virulence through BarA/SirA. Mol Microbiol 46:1451-1464. Lenz, D. H., M. B. Miller, J. Zhu, R. V. Kulkarni, and B. L. Bassler. 2005. CsrA and three redundant small RNAs regulate quorum sens ing in Vibrio cholerae. Molecular Microbiology 58:1186-1202. Lertcanawanichakul, M., C. Wiwa t, A. Bhumiratana, and D. H. Dean. 2004. Expression of chitinase-encoding genes in Bacillus thuringiensis and toxicity of engineered B. thuringiensis subsp. aizawai toward Ly mantria dispar larvae. Curr Microbiol 48:175-181. Lesser, M. P., J. C. Bythell, R. D. Gates, R. W. Johnstone, and O. Hoegh-Guldberg. 2007. Are infectious diseases really killing corals? Al ternative interpretations of the experimental and ecological data. J Exp Mar Biol Ecol 346:36-44. Lipp, E. K., and D. W. Griffin. 2004. Analysis of coral mucus as an improved medium for detection of enteric microbes and for determ ining patterns of sewage contamination in reef environments. EcoHealth 1:317-323. Lipp, E. K., J. L. Jarrell, D. W. Griffin, J. Lukasik, J. Jacukiewicz, and J. B. Rose. 2002. Preliminary evidence for human fecal contaminat ion in corals of the Florida Keys, USA. Mar Pollut Bull 44:666-670. Lucas, J. S. 1994. The biology, exploitation, and ma riculture of giant clams (Trinacnidae). Rev Fish Sci 2:181-224.

PAGE 138

138 Luna, G. M., F. Biavasco, and R. Danovaro. 200 7. Bacteria associated with the rapid tissue necrosis of stony corals. Environ Microbiol 9 :1851-1857. Mahajan-Miklos, S., L. G. Rahme, and F. M. Ausubel. 2000. Elucidating the molecular mechanisms of bacterial virulence using non-mammalian hosts. Mol Microbiol 37 :981988. Maris, A. E., M. Kaczor-Grzeskowiak, Z. Ma, M. L. Kopka, R. P. Gunsalus, and R. E. Dickerson. 2005. Primary and secondary m odes of DNA recognition by the NarL twocomponent response regulator. Biochemistry 44:14538-14552. Meikle, P., G. N. Richards, and D. Yellowlees. 1988. Structural investigations on the mucus from six species of coral. Marine Biology 99:187-193. Miller, J. H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Miller, M. B., and B. L. Bassler. 2001. Quorum sensing in bacteria. Annu Rev Microbiol 55:165199. Minton, D., and I. Lundgren. 2006. Coral recruitment and sedimentation in Asan Bay and War in the Pacific NHP, Guam. Miyada, C. G., L. Stoltzfus, and G. Wilcox. 198 4. Regulation of the araC gene of Escherichia coli: catabolite repre ssion, autoregulation, and effect on araBAD expression. Proc Natl Acad Sci U S A 81:4120-4124. Mohamed, N. M., E. M. Cicirelli, J. Kan, F. Chen, C. Fuqua, and R. T. Hill. 2008. Diversity and quorum-sensing signal production of Proteobact eria associated with marine sponges. Environ Microbiol 10 :75-86. Mora, C. 2008. A clear human foot print in the coral reefs of the Caribbean. Proc Biol Sci 275:767-773. Morse, A. N. C., K. Iwao, M. Baba, K. Shimoike, T. Hayashibara, and M. Omori. 1996. An ancient chemosensory mechanism brings new life to coral reefs. Biological Bulletin 191:149-154. Morse, D. E., N. Hooker, A. N. C. Morse, and R. A. Jensen. 1988. Control of larval metamorphosis and recruitment in sympatric agariciid corals. J Exp Mar Biol Ecol 116:193-217. Morse, D. E., A. N. C. Morse, P. T. Raimondi, and N. Hooker. 1994. Morphogen-Based Chemical Flypaper for Agaricia-Humilis Coral Larvae. Biological Bulletin 186:172-181. Muller-Parker, G., and C. F. D'Elia. 1997. Interacti ons between corals and their symbiotic algae. Pages 96-113 in C. Birkeland, editor. Life and D eath of Coral Reef s. International Thomson Publishing, New York.

PAGE 139

139 Mumby, P. J., A. R. Harborne, J. Williams, C. V. Kappel, D. R. Brumbaugh, F. Micheli, K. E. Holmes, C. P. Dahlgren, C. B. Paris, and P. G. Blackwell. 2007a. Trophic cascade facilitates coral recruitment in a marine reserve. Proc Natl Acad Sci U S A 104:83628367. Mumby, P. J., A. Hastings, and H. J. Edwa rds. 2007b. Thresholds a nd the resilience of Caribbean coral reefs. Nature 450 :98-101. Munoz-Elias, E. J., and J. D. McKinney. 2006. Carbon metabolism of intracellular bacteria. Cell Microbiol 8 :10-22. Muscatine, L., and J. W. Porter. 1977. Reef Cora ls: Mutualistic Symbioses Adapted to NutrientPoor Environments. BioScience 27 :454-460. Negri, A. P., N. S. Webster, R. T. Hill, a nd A. J. Heyward. 2001. Metamorphosis of broadcast spawning corals in response to bacteria isol ated from crustose algae. Mar Ecol Prog Ser 223:121-131. Neiditch, M. B., M. J. Federle, A. J. Pompeani, R. C. Kelly, D. L. Swem, P. D. Jeffrey, B. L. Bassler, and F. M. Hughson. 2006. Ligand-induced asymmetry in histidine sensor kinase complex regulates quorum sensing. Cell 126:1095-1108. Newton, J. A., and R. G. Fray. 2004. Integration of environmental and host-derived signals with quorum sensing during plant-microbe interactions. Cell Microbiol 6:213-224. Nobles, R. E., P. Brown, J. B. Rose, and E. K. Lipp. 2000. The investigation and analysis of swimming-associated illness us ing the fecal indicator enterococcus in southern Florida's marine waters. Florida J Env Health 169:15-19. Nogami, K., K. Hamasaki, M. Maeda, and K. Hirayama. 1997. Biocontrol method in aquaculture for rearing the swimming crab larvae Portunus trituberculatus. Hydrobiologia 358:291295. Norstrm, A., J. Lokrantz, M. Nystrm, and H. Yap. 2007. Influence of dead coral substrate morphology on patterns of juvenile coral distribution. Marine Biology 150 :1145-1152. Nystrom, M., C. Folke, and F. Moberg. 2000. Cora l reef disturbance and resilience in a humandominated environment. Trends in Ecology & Evolution 15 :413-417. Ovadis, M., X. Liu, S. Gavriel, Z. Ismailov, I. Chet, and L. Chernin. 2004. The Global Regulator Genes from Biocontrol Strain Serratia plymuthica IC1270: Cloning, Sequencing, and Functional Studies. J Bacteriol 186:4986-4993. Pandolfi, J. M., R. H. Bradbury, E. Sala, T. P. Hughes, K. A. Bjorndal, R. G. Cooke, D. McArdle, L. McClenachan, M. J. H. Newman, G. Paredes, R. R. Warner, and J. B. C. Jackson. 2003. Global Trajectories of the LongTerm Decline of Coral Reef Ecosystems. Science 301 :955-958.

PAGE 140

140 Parkins, M. D., H. Ceri, and D. G. Store y. 2001. Pseudomonas aeruginosa GacA, a factor in multihost virulence, is also essentia l for biofilm formation. Mol Microbiol 40:1215-1226. Patterson, K. L., J. W. Porter, K. B. Ritchie, S. W. Polson, E. Mueller, E. C. Peters, D. L. Santavy, and G. W. Smith. 2002. The etiology of white pox, a lethal disease of the Caribbean elkhorn coral, Acropora pa lmata. Proc Natl Acad Sci U S A 99:8725-8730. Patton, J. S., S. Abraham, and A. A. Benson. 1977. Lipogenesis in the intact coral Pocillopora clapitata and its isolated zooxanthe llae: evidence for a light-d riven carbon cycle between symbiont and host. Marine Biology 44:235-247. Paul, J. H., M. R. McLaughlin, D. W. Griffin, E. K. Lipp, R. Stokes, and J. B. Rose. 2000. Rapid movement of wastewater from on-site dispos al systems into surface waters in the lower Florida Keys. Estuaries 23:662-668. Pearson, J. P., and I. A. Brownlee. 2005. Structure and fuction of mucosal surfaces. in J. P. Nataro, P. S. Cohen, H. L. T. Mobley, and J. N. Weiser, editors. Colonization of Mucosal Surfaces. ASM Press, Washington, D.C. Perez-Rosas, N., and T. C. Hazen. 1988. In situ su rvival of Vibrio cholerae and Escherichia coli in tropical coral reefs. Appl Environ Microbiol 54 :1-9. Prez, S., M. Kouwijzer, K. Mazeau, and S. B. Engelsen. 1996. Modeling polysaccharides: Present status and challenges. Journal of Molecular Graphics 14:307-321. Pernestig, A. K., D. Georgellis, T. Romeo, K. Suzuki, H. Tomenius, S. Normark, and O. Melefors. 2003. The Escherichia coli BarA-U vrY two-component system is needed for efficient switching between glycolytic a nd gluconeogenic carbon sources. J Bacteriol 185:843-853. Pernestig, A. K., O. Melefors, and D. Georgell is. 2001. Identification of UvrY as the cognate response regulator for the Ba rA sensor kinase in Esch erichia coli. J Biol Chem 276:225231. Perraud, A.-L., K. Rippe, M. Bantscheff, M. Gl ocker, M. Lucassen, K. Jung, W. Sebald, V. Weiss, and R. Gross. 2000. Dimerization of signalling modules of the EvgAS and BvgAS phosphorelay systems. Biochimica et Biophysi ca Acta (BBA) Protein Structure and Molecular Enzymology 1478:341-354. Persson, T., M. Givskov, and J. Nielsen. 2005. Quor um sensing inhibition: targeting chemical communication in gram-negativ e bacteria. Curr Med Chem 12:3103-3115. Phillips, D. A., C. M. Joseph, G. P. Yang, E. Martinez-Romero, J. R. Sanborn, and H. Volpin. 1999. Identification of lumichrome as a sinorhiz obium enhancer of alfalfa root respiration and shoot growth. Proc Natl Acad Sci U S A 96:12275-12280.

PAGE 141

141 Preston-Mafham, J., L. Boddy, and P. F. Ra nderson. 2002. Analysis of microbial community functional diversity using sole-carbon-source utilisation profiles a critique. FEMS Microbiolgy Ecology 42:1-14. Pugsley, A. P. 1993. The complete general secretory pathway in gram-negative bacteria. Microbiological Reviews 57:50-108. Queck, S. Y., M. Weitere, A. M. Moreno, S. A. Rice, and S. Kjelleberg. 2006. The role of quorum sensing mediated developmental traits in the resistance of Serratia marcescens biofilms against protozoan grazing. Environ Microbiol 8 :1017-1025. Raaijmakers, J. M., M. Vlami, and J. T. de Souza. 2002. Antibiotic production by bacterial biocontrol agents. Antonie Van Leeuwenhoek 81:537-547. Rahme, L. G., F. M. Ausubel, H. Cao, E. Dre nkard, B. C. Goumnerov, G. W. Lau, S. MahajanMiklos, J. Plotnikova, M. W. Tan, J. Ts ongalis, C. L. Walendziewicz, and R. G. Tompkins. 2000. Plants and animals share functionally common bacterial virulence factors. Proc Natl Acad Sci U S A 97 :8815-8821. Rahme, L. G., E. J. Stevens, S. F. Wolfort, J. Shao, R. G. Tompkins, and F. M. Ausubel. 1995. Common virulence factors for bacterial pathog enicity in plants and animals. Science 268:1899-1902. Rasmussen, T. B., and M. Givskov. 2006. Quorum se nsing inhibitors: a bargain of effects. Microbiology-Sgm 152:895-904. Rasmussen, T. B., M. Manefield, J. B. Anderse n, L. Eberl, U. Anthoni, C. Christophersen, P. Steinberg, S. Kjelleberg, and M. Givskov. 2000. How Delisea pulchra furanones affect quorum sensing and swarming motility in Serratia liquefaciens MG1. Microbiology 146 Pt 12:3237-3244. Reshef, L., O. Koren, Y. Loya, I. Zilber-Rosenberg, and E. Rosenberg. 2006. The coral probiotic hypothesis. Environ Microbiol 8 :2068-2073. Reverchon, S., D. Expert, J. Robert-Baudouy, and W. Nasser. 1997. The cyclic AMP receptor protein is the main activator of pectinolysis genes in Erwinia chrysanthemi. J Bacteriol 179:3500-3508. Richardson, L. L. 1998. Coral diseases: what is really known? Trends in Ecology & Evolution 13:438-443. Richardson, L. L., W. M. Goldberg, K. G. Kuta, R. B. Aronson, G. W. Smith, K. B. Ritchie, J. C. Halas, J. S. Feingold, and S. L. Miller. 1998. Florida mystery coral-killer identified. Nature 392:557-558. Richardson, L. L., and K. G. Kuta. 2003. Ecological physiology of the black band disease cyanobacterium Phormidium corallyticum FEMS Microbiol Ecol 43:287-298.

PAGE 142

142 Richardson, L. L., K. G. Kuta, S. Schnell, a nd R. G. Carlton. 1997. Ecol ogy of the black band disease microbial consortium. Proc 8th Int Coral Reef Symp Balboa 1:597-600. Richman, S., Y. Loya, and L. B. Slobodkin. 1975. Th e rate of mucus production by corals and its assimilation by the coral reef copepod Acartia negligens Limnology and Oceanography 20:918-923. Rinaldi, M. G. 1983. Invasive aspergillosis. Rev Infect Dis 5:1061-1077. Ritchie, K. B. 2006. Regulation of microbial po pulations by coral su rface mucus and mucusassociated bacteria. Mari ne Ecology-Progress Series 322:1-14. Ritchie, K. B., R. A. Holley, T. McGrath, and G. W. Smith. 1996. INT-linked dehydrogenase activity in the surface mucopolys accharide layers of Bahamian scleractinian corals. Proc Symp Nat Hist Bahamas 6:18-27. Ritchie, K. B., S. W. Polson, and G. W. Smit h. 2001. Microbial disease causation in marine invertebrates: problems, practices, a nd future prospects. Hydrobiologia 460:131-139. Ritchie, K. B., and G. W. Smith. 2 004. Microbial communities of coral surface mucopolysaccharide layers. Pages 259-264 in E. Rosenberg and Y. Loya, editors. Coral health and diseases. Springer-Verlag, New York. Robinson, V. L., D. R. Buckler, and A. M. Stock. 2000. A tale of two components: a novel kinase and a regulatory sw itch. Nat Struct Mol Biol 7:626-633. Rohwer, F., V. Seguritan, F. Azam, and N. K nowlton. 2002. Diversity and distribution of coralassociated bacteria. Mar Ecol Prog Ser 243:1-10. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol Microbiol 29:1321-1330. Rosenberg, E., and Y. Ben-Haim 2002. Microbial diseases of corals and global warming. Environ Microbiol 4 :318-326. Rosenberg, E., and L. Falkovitz. 2004. The Vibrio shiloi/Oculina patagonica model system of coral bleaching. Annu Rev Microbiol 58:143-159. Rosenberg, E., O. Koren, L. Reshef, R. Efr ony, and I. Zilber-Rosenberg. 2007. The role of microorganisms in coral health, dise ase and evolution. Nat Rev Microbiol 5:355-362. Ryan, J. C. 2001. The Caribbean gets dusted: spor es and nutrients from Africa's Sahel may be killing coral reefs and ocean away. BioScience 51 :334-338. Saleh, S. S., and B. R. Glick. 2001. Involvement of gacS and rpoS in enhancement of the plant growth-promoting capabilities of Enterobacter cloacae CAL2 and UW4. Can J Microbiol 47:698-705.

PAGE 143

143 Sambrook, J., and D. W. Russell. 2001. Molecula r Cloning: A laboratory manual. Third edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Sapp, J. 1999. White is Natural? Coral Reef Cr isis. Oxford University Press, New York. Schmitz, G., and V. Braun. 1985. Cell-bound and secret ed proteases of Serratia marcescens. J Bacteriol 161 :1002-1009. Schulenburg, H., and J. J. Ewbank. 2004. Diversity and specificity in the interaction between Caenorhabditis elegans and the pathogen Serratia marcescens. BMC Evol Biol 4:49. Secord, D., and L. Augustine. 2000. Biogeography and microhabitat variati on in temperate algalinvertebrate symbioses: zooxanthellae and zoochlorellae in two P acific intertidal sea anemones, Anthopleura elegantissima and A. xanthogrammica Invertebrate Biology 119:139-146. Seurinck, S., W. Verstraete, a nd S. Siciliano. 2005. Microbial S ource Tracking for Identification of Fecal Pollution. Reviews in Environmental Science and Biotechnology 4:19-37. Sexton, A. C., and B. J. Howlett. 2006. Parallel s in fungal pathogenesis on plant and animal hosts. Eukaryot Cell 5 :1941-1949. Sharon, G., and E. Rosenberg. 2008. Bacteria l Growth on Coral Mucus. Curr Microbiol 56:481488. Shaw, P. D., G. Ping, S. L. Daly, C. Cha, J. E. Cronan, Jr., K. L. Rinehart, and S. K. Farrand. 1997. Detecting and characterizing N-acyl-homos erine lactone signal molecules by thinlayer chromatography. Proc Natl Acad Sci U S A 94:6036-6041. Shinn, E. A., G. W. Smith, J. M. Prospero, P. Be tzer, M. L. Hayes, V. H. Garrison, and R. T. Barber. 2000. African dust and the demise of Caribbean coral reefs. Geophysical Research Letters 27:3029-3032. Smith, G. W., C. D. Harvell, and K. Kim. 1998. Response of sea fans to infection with Aspergillus sp. (Fungi). Rev Biol Trop 46:205-208. Smith, G. W., and S. S. Hayasaka. 1982. Nitrogenase activity associated with Zostera marina from a North Carolina estuary. Can J Microbiol 28:448-451. Smith, G. W., A. M. Kozuchi, and S. S. Ha yasaka. 1982. Heavy metal sensitivity of seagrass bacteria. Botanica Marina XXV :19-24. Smith, J. G., J. A. Latiolais, G. P. Guanga, J. D. Pennington, R. E. Silversmith, and R. B. Bourret. 2004. A search for amino acid substi tutions that universally activate response regulators. Molecular Microbiology 51:887-901.

PAGE 144

144 Soo, P. C., J. R. Wei, Y. T. Horng, S. C. Hsie h, S. W. Ho, and H. C. Lai. 2005. Characterization of the dapA-nlpB genetic locus involved in regulation of swarming motility, cell envelope architecture, hemolysin producti on, and cell attachment ability in Serratia marcescens. Infect Immun 73:6075-6084. Stanley, G. D., and P. K. Swart. 1995. Evolution of the coral-zooxanthellae symbiosis during the Triassic: a geochemical approach. Paleobiology 21:179-199. Staskawicz, B., D. Dahlbeck, N. Keen, and C. Napoli. 1987. Mo lecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J Bacteriol 169 :5789-5794. Stone, L., A. Huppert, B. Rajagopalan, H. Bhasin, and Y. Loya. 1999. Mass coral reef bleaching: a recent outcome of increased El Nio Activity? Ecology Letters 2 :325-330. Storz, G., and D. Haas. 2007. A guide to small RNAs in microorganisms. Current Opinion in Microbiology 10:93-95. Sutherland, K. P., J. W. Porter, and C. Torres. 2004. Disease and immunity in Caribbean and Indo-Pacific zooxanthellate corals Marine Ecology-Progress Series 266 :273-302. Sutherland, K. P., and K. B. Ritchie. 2004. White pox disease of the Caribbean Elkhorn coral, Acropora palmata Pages 289-297 in E. Rosenberg and Y. Loya, editors. Coral Health and Disease. Springer Verlag, Berlin. Suzuki, K., X. Wang, T. Weilbacher, A. K. Pernes tig, O. Melefors, D. Georgellis, P. Babitzke, and T. Romeo. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. J Bacteriol 184 :5130-5140. Szmant, A. 2002. Nutrient enrichment on coral reefs: Is it a major cause of coral reef decline? Estuaries and Coasts 25:743-766. Tan, B., T. A. Jackson, and M. R. Hurst. 2006. Vi rulence of Serratia stra ins against Costelytra zealandica. Appl Environ Microbiol 72:6417-6418. Tan, M. W., L. G. Rahme, J. A. Sternberg, R. G. Tompkins, and F. M. Ausubel. 1999. Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P. aeruginosa virulence factors. Proc Natl Acad Sci U S A 96:2408-2413. Taylor, M. W., P. J. Schupp, H. J. Baillie, T. S. Charlton, R. de Nys, S. Kjelleberg, and P. D. Steinberg. 2004. Evidence for acyl homoserine lactone signal production in bacteria associated with marine sponges. Appl Environ Microbiol 70:4387-4389. Templeton, A. R. 2007. Shared hist ory of humans and gut bacteria : Evolutionary togetherness: coupled evolution of humans and a pathogen. Heredity 98:337-338.

PAGE 145

145 Teplitski, M., and B. M. M. Ahmer. 2005. The control of secondary metabolism, motility, and virulence by the two-component re gulatory system BarA/SirA of Salmonella and other yproteobacteria. Global Regulatory Networks in Enteric Bacteria:107-132. Teplitski, M., R. I. Goodier, and B. M. Ahmer. 2006. Catabolite repression of the SirA regulatory cascade in Salmonella enterica. Int J Med Microbiol 296:449-466. Tomenius, H., A. K. Pernestig, C. F. MendezCatala, D. Georgellis, S. Normark, and O. Melefors. 2005. Genetic and functional charact erization of the Escherichia coli BarAUvrY two-component system: point mutations in the HAMP linker of the BarA sensor give a dominant-negative phenotype. J Bacteriol 187:7317-7324. Toren, A., L. Landau, A. Kushmaro, Y. Loya, a nd E. Rosenberg. 1998. Effect of Temperature on Adhesion of Vibrio Strain AK-1 to Oculina patagonica and on Coral Bleaching. Appl Environ Microbiol 64 :1379-1384. Tortora, G. J., B. R. Funke, and C. L. Case. 2002. Microbiology. 7th edition. Benjamin Cummings, New York. Travis, J., J. Potempa, and H. Maeda. 1995. Are b acterial proteinases path ogenic factors? Trends Microbiol 3 :405-407. Travis, J. M., R. W. Brooker, E. J. Clark, and C. Dytham. 2006. The distribution of positive and negative species interactions across environmental gradients on a dual-lattice model. J Theor Biol 241 :896-902. Tsukamoto, S. 1999. Marine natural products influe ncing larval settlement and metamorphosis of marine sessile organisms. Yakugaku Zasshi 119:457-471. Tsukamoto, S., H. Kato, H. Hirota, and N. Fusetani. 1999. Lumichrome. A larval metamorphosis-inducing substance in the ascidian Hhalocynthia roretz i. Eur J Biochem 264:785-789. Uzoigwe, J. C., E. H. O'Brien, and E. J. Br own. 2007. Using nutrient utilization patterns to determine the source of Escherichia coli f ound in surface water. African Journal of Environmental Science and Technology 1:7-13. Ventre, I., A. L. Goodman, I. Vallet-Gely, P. Vasseur, C. Soscia, S. Molin, S. Bleves, A. Lazdunski, S. Lory, and A. Filloux. 2006. Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulator y RNA and virulence genes. PNAS 103:171-176. Verdugo, P. 1990. Goblet cells secretion and mucogenesis. Annu Rev Physiol 52:157-176. Virji, M. 2005. Bacterial adherence and tropism in the human respiratory tract. in J. P. Nataro, P. S. Cohen, H. L. T. Mobley, and J. N. Weis er, editors. Colonization of Mucosal Surfaces. ASM Press, Washington, D.C.

PAGE 146

146 Vollmer, S. V., and S. R. Palumbi. 2007. Restrict ed Gene Flow in the Caribbean Staghorn Coral Acropora cervicornis: Implications for th e Recovery of Endangered Reefs. J Hered 98:40-50. Wgele, H., and G. Johnsen. 2001. Observat ions on the histology and photosynthetic performance of solar-powered opisthobranchs (Mollusca, Gastropoda, Opisthobranchia) containing symbiotic chloropl asts or zooxanthellae. Org. Divers. Evol. 1:193-210. Wagner-Dobler, I., V. Thiel, L. Eberl, M. Allgaier A. Bodor, S. Meyer, S. Ebner, A. Hennig, R. Pukall, and S. Schulz. 2005. Discovery of co mplex mixtures of novel long-chain quorum sensing signals in free-living and hostassociated marine alphaproteobacteria. Chembiochem 6:2195-2206. Wallentinus, I., and C. D. Nyberg. 2007. Introduced marine organisms as habitat modifiers. Marine Pollution Bulletin 55:323-332. Walther, G. R., E. Post, P. Convey, A. Menzel, C. Parmesan, T. J. Beebee, J. M. Fromentin, O. Hoegh-Guldberg, and F. Bairlein. 2002. Ecological responses to recent climate change. Nature 416:389-395. Ward, J. R., and K. D. Lafferty. 2004. The elusive ba seline of marine dis ease: are diseases in ocean ecosystems increasing? PLoS Biol 2:E120. Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21:319-346. Webster, N. S., L. D. Smith, A. J. Heyward, J. E. Watts, R. I. Webb, L. L. Blackall, and A. P. Negri. 2004. Metamorphosis of a scleractinian coral in response to microbial biofilms. Appl Environ Microbiol 70:1213-1221. Wegley, L., R. Edwards, B. Rodriguez-Br ito, H. Liu, and F. Rohwer. 2007. Metagenomic analysis of the microbial community associated with the coral Porites astreoides. Environ Microbiol 9 :2707-2719. Wei, J. R., and H. C. Lai. 2006. N-acylhomoserin e lactone-dependent cell-to-cell communication and social behavior in the genus Serratia. Int J Med Microbiol 296:117-124. Weil, E., G. Smith, and D. L. Gil-Agudelo. 200 6. Status and progress in coral reef disease research. Dis Aquat Organ 69:1-7. West, S. A., S. P. Diggle, A. Buckling, A. Gar dner, and A. S. Griffin. 2007. The Social Lives of Microbes. Annu Rev Ecol Evol Syst 38:53-77. Western, D. 2001. Human-modified ecosystems and future evolution. Proc Natl Acad Sci U S A 98:5458-5465.

PAGE 147

147 Whipps, J. M. 2001. Microbial interactions a nd biocontrol in the rhizosphere. J Exp Bot 52:487511. Whistler, C. A., T. A. Koropatnick, A. Pollac k, M. J. McFall-Ngai, and E. G. Ruby. 2007. The GacA global regulator of Vibrio fischeri is required for nor mal host tissue responses that limit subsequent bacterial colonization. Cell Microbiol 9 :766-778. Whistler, C. A., and E. G. Ruby. 2003. GacA regulat es symbiotic colonization traits of Vibrio fischeri and facilitates a be neficial association with an animal host. J Bacteriol 185:72027212. Wild, C., M. Huettel, A. Kluete r, S. G. Kremb, M. Y. Rasheed, and B. B. Jorgensen. 2004. Coral mucus functions as an energy carrier and par ticle trap in the reef ecosystem. Nature 428:66-70. Wilson, R. A., and J. Q. Wilson. 1985. Watching Fishes: Life and Behavior on Coral Reefs. Harper & Row, New York. Wolanski, E., editor. 2001. Ocea nographic Processes of Coral R eefs: Physical and Biological Links in the Great Barrier Reef. CRC Press, New York. Young, G. M., D. H. Schmiel, and V. L. M iller. 1999. A new pathway for the secretion of virulence factors by bacteria : the flagellar export appara tus functions as a proteinsecretion system. Proc Natl Acad Sci U S A 96:6456-6461. Zhang, L. H., and Y. H. Dong. 2004. Quorum sensing and signal interference: diverse implications. Molecular Microbiology 53:1563-1571. Zuber, S., F. Carruthers, C. Keel, A. Mattar t, C. Blumer, G. Pessi, C. Gigot-Bonnefoy, U. Schnider-Keel, S. Heeb, C. Reimmann, and D. Haas. 2003. GacS Sensor Domains Pertinent to the Regulation of Exoproduct Form ation and to the Biocontrol Potential of Pseudomonas fluorescens CHA0. Molecu lar Plant-Microbe Interactions 16:634-644.

PAGE 148

148 BIOGRAPHICAL SKETCH Cory Jon Krediet was born in 1984, in Oklahom a City, Oklahoma. The older of two children, he grew up in Chicago, Illinois, graduating from Glenbard North High School in 2002. He earned his B.A. in biology and German fr om Drew University in 2006, graduating s umma cum laude and with specialized honors in biology. During his undergraduate career, Cory conducted original resear ch as part of a Research Experience for Undergraduates (REU) program sponsored by the National Science Foundation. Working at Shoals Marine Laborator y in the Gulf of Maine, he i nvestigated growth and mortality trade-offs along a depth grad ient in the Jonah crab, Cancer borealis That project developed into an honors thesis project at Drew Univeristy. Corys undergraduate experi ences also led him to study coral ecology in the E gyptian Red Sea and Belize. Upon completion of his M.S. program, Cory will continue at the University of Florida for his Ph.D., working with Dr. Max Teplitski to further elucidate the genetic and regulatory pathways that allow Serratia marcescens to colonize and in fect elkhorn coral, Acropora palmata