<%BANNER%>

Timing, Duration, and Diurnal Distribution of Supraoptimal Temperatures Affect Floral Initiation of Poinsettia

University of Florida Institutional Repository
Permanent Link: http://ufdc.ufl.edu/UFE0022326/00001

Material Information

Title: Timing, Duration, and Diurnal Distribution of Supraoptimal Temperatures Affect Floral Initiation of Poinsettia
Physical Description: 1 online resource (123 p.)
Language: english
Creator: Schnelle, Rebecca
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: euphorbia, heat, pulcherrima
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: High temperature delay in flowering of poinsettia termed ?heat delay? can cause a poinsettia crop to reach a marketable stage of floral development too late for holiday sales leading to serious economic losses. First, the range of high temperature sensitivity in modern poinsettia cultivars was investigated. Plants were exposed to either a high (29??2?C day /24??2?C night) or low (24??2?C day/21??2?C night) temperature treatment for 28 days. There were significant delays in floral initiation and anthesis between the high and low temperature treatment for all cultivars tested. The delay in floral initiation ranged from 10 days in 'Freedom Early Red' to 19 days in ?Prestige Red?. Closely related cultivars showed similar delays in floral initiation. Three experiments were designed to determine the effects of timing and duration of high temperature exposure on heat delay. High temperature treatments (29?2?C day / 24?2?C night) were applied for 7 to 28 days at designated times. Seven days of high temperatures had no effect on flowering time. Twenty-eight days of high temperature exposure caused plants to reached anthesis 12 to 14 days later than the cool temperature control. Fourteen days of high temperature exposure before floral initiation led to a delay in anthesis of 5 to 7 days. High temperatures following floral initiation produced no delay in anthesis. These results indicate that the timing of high temperature exposure determines if heat delay will occur and the duration of high temperatures affects the magnitude of the delay. The roles of supraoptimal night, day, or mean diurnal temperature were investigated. In growth chambers, delays in floral initiation were observed when the supraoptimal temperatures were imposed during the day or night. Greenhouse experiments were conducted utilizing temperature treatments with identical daytime high and overnight low temperatures but divergent diurnal mean temperatures. Floral initiation in ?Red Velvet? was delayed by 6 to 8 days with a mean temperature of 27?2?C compared to plants grown with 21?2?C or 24?2?C mean diurnal temperatures, respectively. These data indicate that high temperature delay in floral initiation of poinsettia is the result of exposure to supraoptimal mean diurnal temperatures.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rebecca Schnelle.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Barrett, James E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022326:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022326/00001

Material Information

Title: Timing, Duration, and Diurnal Distribution of Supraoptimal Temperatures Affect Floral Initiation of Poinsettia
Physical Description: 1 online resource (123 p.)
Language: english
Creator: Schnelle, Rebecca
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: euphorbia, heat, pulcherrima
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: High temperature delay in flowering of poinsettia termed ?heat delay? can cause a poinsettia crop to reach a marketable stage of floral development too late for holiday sales leading to serious economic losses. First, the range of high temperature sensitivity in modern poinsettia cultivars was investigated. Plants were exposed to either a high (29??2?C day /24??2?C night) or low (24??2?C day/21??2?C night) temperature treatment for 28 days. There were significant delays in floral initiation and anthesis between the high and low temperature treatment for all cultivars tested. The delay in floral initiation ranged from 10 days in 'Freedom Early Red' to 19 days in ?Prestige Red?. Closely related cultivars showed similar delays in floral initiation. Three experiments were designed to determine the effects of timing and duration of high temperature exposure on heat delay. High temperature treatments (29?2?C day / 24?2?C night) were applied for 7 to 28 days at designated times. Seven days of high temperatures had no effect on flowering time. Twenty-eight days of high temperature exposure caused plants to reached anthesis 12 to 14 days later than the cool temperature control. Fourteen days of high temperature exposure before floral initiation led to a delay in anthesis of 5 to 7 days. High temperatures following floral initiation produced no delay in anthesis. These results indicate that the timing of high temperature exposure determines if heat delay will occur and the duration of high temperatures affects the magnitude of the delay. The roles of supraoptimal night, day, or mean diurnal temperature were investigated. In growth chambers, delays in floral initiation were observed when the supraoptimal temperatures were imposed during the day or night. Greenhouse experiments were conducted utilizing temperature treatments with identical daytime high and overnight low temperatures but divergent diurnal mean temperatures. Floral initiation in ?Red Velvet? was delayed by 6 to 8 days with a mean temperature of 27?2?C compared to plants grown with 21?2?C or 24?2?C mean diurnal temperatures, respectively. These data indicate that high temperature delay in floral initiation of poinsettia is the result of exposure to supraoptimal mean diurnal temperatures.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Rebecca Schnelle.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Barrett, James E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022326:00001


This item has the following downloads:


Full Text





TIMING, DURATION, AND DIURNAL DISTRIBUTION OF SUPRAOPTIMAL
TEMPERATURES AFFECT FLORAL INITIATION OF POINSETTIA




















By

REBECCA ANNE SCHNELLE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008


































2008 Rebecca Anne Schnelle
































To my loving family for all the support that kept me on track and my friends for the distractions
that kept me sane through it all. Thank You.









ACKNOWLEDGMENTS

First I wish to acknowledge my undergraduate advisor, Dr. Terry Ferriss. Her guidance

and encouragement led me to graduate study. I thank my supervisory committee for their

support. In particular I would like to thank my advisor, Dr. Jim Barrett, for designing a perfect

graduate experience for me. The hands-off advising approach allowed me to build the

confidence I need to go on to a faculty position. Thanks go to Dr. Barrett for going above and

beyond the call of duty with his generous support of my travels. I would like to express my

gratitude to Dr. Kevin Folta for use of his lab space and materials and for his tireless enthusiasm.

He introduced me to a part of plant science I would not otherwise have known. I thank Carolyn

Bartuska for her invaluable statistical assistance and listening to all my gripes with a laugh and a

smile. Also, thanks to Bob Weidman for greenhouse assistance. For generously providing plant

material and monetary support of my project I thank Paul Ecke Ranch. Also, I would like to

express my appreciation to Ruth Kobayashi for all of her insights and thought provoking

questions. Her input always reinvigorated my research. Finally, thanks go to my husband Dan

for his love and devotion.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

L IS T O F T A B L E S ................................................................................................. ..................... 8

LIST OF FIGURES ............................................. .. ......... ............................ 11

A B S T R A C T .......................................................................................................... ..................... 12

CHAPTER

1 R E V IEW O F L ITER A TU R E .. .......................................................................... ............... 14

Mechanisms of Photoperiodic Flowering...................................................................... 14
Photoperiodic Photoreceptors................ ...................................................... ............... 15
Circadian Clock Function and Entrainment ............................................................... 17
Additional Environmental Cues Affecting Photoperiodic Flowering ............................. 19
Biochemical and Physiological Mechanisms of Photoperiodic Flowering .........................21
Physiological Studies of the Floral Signal..................................................................21
Biochemical Studies of the Photoperiodic Floral Induction Pathway in Arabidopsis ....23
Biochemical Studies of Floral Induction in Rice .......................................................26
Floral Initiation and Development in Poinsettia................................................................27
O rigin of the Poinsettia...................................................... ................. ............... 27
Poinsettia Floral Initiation, Development, and Morphology......................................29
Night-Length Effects on Floral Initiation and Development of Poinsettia ..................31
Ambient Temperature Effects on Flowering of Poinsettia and Chrysanthemum................ 33
Effects of Supraoptimal Temperatures on Floral Initiation and Development ...............34
Temperature and Photoperiod Interaction..................................................................34
Effects of Duration and Timing of Supraoptimal Temperatures................................36
Effects of Supraoptimal Day, Night, and Diurnal Mean Temperatures....................... 37
Temperature Effects on the Development of the Poinsettia Floral Display .................41
O bj ectiv es ............................................................................................................. ....... .. 4 3

2 HEAT DELAY IN MODERN POINSETTIA CULTIVARS...........................................44

In tro d u c tio n ............................................................................................................................. 4 4
M materials and M methods .............. .............................................................................. 47
D ata C o lle ctio n ............................................................................................................... 4 8
E x p e rim e n t 1 ................................................................................................................. .. 4 9
E x p e rim e n t 2 ................................................................................................................. .. 4 9
E x p e rim e n t 3 ................................................................................................................. .. 5 0
E x p e rim e n t 4 ................................................................................................................. .. 5 0
R results and D iscu ssion .............. .............................................................................. 50
E x p e rim e n t 1 ................................................................................................................. .. 5 0









E xperim ent 2 .............. ......................................................................... . ......51
E xperim ent 3 .............. ......................................................................... . ......53
E xperim ent 4 .............. ......................................................................... . ......54
Conclusions ................................................. ............................. 55

3 TIMING AND DURATION OF HIGH TEMPERATURE EXPOSURE .............................66

In tro d u c tio n ............................................................................................................................. 6 6
M materials and M methods .................................................................................................... 68
D ata C o lle ctio n ................................................................................................................6 9
E xperim ent 1 .............. ......................................................................... . ......69
E x p erim en ts 2 an d 3 ........................................................................................................7 0
R results and D discussion .................................................................................................... 70
E xperim ent 1 .............. ......................................................................... . ......70
E x p e rim e n t 2 ...................................................................................................................7 1
E xperim ent 3 .............. ......................................................................... . ......74
Conclusions ...................................................... .................. 76

4 DAY, NIGHT, AND DIURNAL MEAN TEMPERATURES .............. ...............83

In tro d u c tio n ............................................................................................................................. 8 3
M materials and M methods ........................................................................... ................. . 85
G row th C ham ber Experim ents ................................................................... ............... 86
G reenhouse Experim ents ...........................................................................................87
D ata C o lle ctio n ................................................................................................................8 7
R results and D discussion .................................................................................................... 88
E xperim ent 1 .............. ......................................................................... . ......88
E xperim ent 2 .............. ......................................................................... . ......88
E xperim ent 3 .............. ......................................................................... . ......89
E xperim ent 4 .............. ......................................................................... . ......90
E xperim ent 5 .............. ......................................................................... . ......90
E xperim ent 6 .............. ......................................................................... . ......91
Conclusions .............................................................................. 93

5 E A T D ELA Y M E CH A N ISM S ....................... ............................................. ................ 101

Introduction .............................................. .............. .................. 101
M materials and M ethods ......................................................................................................... 104
In itia tio n D atin g .............................................................................................................1 0 4
Tissue Collection for RNA Extraction .................. .......................... ............... 105
Extraction of RNA and Gel-Blot Creation.................................105
P robe H ybridization ............. .. .................. ................ ........................... ............... 106
R results and D discussion ................ .. .................. .................. .......................... .. ............... 107
Conclusions ...................................... ..................... 109






6










6 R E SE A R C H SU M M A R Y ......................................................................... ..................... 112

L IST O F RE F E R E N C E S ....................................................... ................................................ 116

B IO G R A PH IC A L SK E T C H .................................................... ............................................. 123

















































7









LIST OF TABLES


Table page

2-1. Night length during Expts. 1-4 calculated from civil twilight at 29040'N latitude
(U united States N aval Observatory, 2007) .................................................... ................ 58

2-2. Number of days to first color, visible bud, and anthesis from the onset of natural days
(30 Sept. 2004) with high (292C day /242C night) or low (242C
day/21+2C night) tem perature treatm ents.. ............................................... ................ 58

2-3. Days to first color, visible bud, and anthesis from pinching (1 Sept. 2005) with high
(292C day /242C night) or low (242C day/21+2C night) temperature
treatm ents........................................................................................................ ....... .. 59

2-4. Number of days to 50% floral initiation from pinching (1 Sept. 2005) with high
(292C day /242C night) or low (242C day/21+2C night) temperature
treatm ents ........................................................................................................ ....... .. 59

2-5. Pairwise comparison of T50 values in Table 2-4 (Expt. 2) .............................................59

2-6. Natural-day night lengths for the initiation dates of 'Autumn Red' and Red Velvet'
with high (29+2C day /24+2C night) or low (24+2C day/21+2C night)
temperature treatments calculated from civil twilight times.........................................60

2-7. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2006)
for high (292C day /242C night) and low (242C day/21+2C night)
tem perature treatm ents ........... .. ................... .................. ............ .... .. ....... ............... 60

2-8. Days to 50% floral initiation from pinching (1 Sept. 2006) with high (292C day
/242C night) or low (242C day/21+2C night) temperature treatments .............61

2-9. Natural-day night lengths for initiation dates with high (292C day /242C night)
or low (242C day/21+2C night) temperature treatments calculated from civil
tw ilig h t tim e s. ................................................................................................................ ... 6 1

2-10. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2007)
with high (292C day /242C night) or low (242C day/21+2C night)
temperature treatments ..................... .. ........... ............................. 62

2-11. Days to 50% floral initiation from pinching (1 Sept. 2007) with high (292C day
/242C night) or low (242C day/21 2C night) temperature treatments .............62

2-12. Natural-day night lengths for initiation dates with high (292C day /242C night)
or low (242C day/21+2C night) temperature treatments calculated from civil
tw ilig h t tim e s ................................................................................................................. ... 6 3









3-1. Number of days to visible bud and anthesis in 'Prestige Red'from the onset of 12-hour
d ark p erio d s ...................................................................................................... ........ .. 7 9

3-2. Number of days to first color, visible bud, and anthesis from pinching (Sept. 1, 2006)
in 'Autumn Red' with high temperatures (292C day /242C night) applied for
listed d in te rv a ls. ................................................................................................................. .. 7 9

3-3. Number of days to 50% floral initiation in 'Autumn Red'from pinching (1 Sept. 2006)
with high temperatures (292C day /242C night) applied for listed intervals.............80

3-4. Pairwise comparison of T50 values from Table 3-3 (Expt. 2). .......................................80

3-5. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2007)
with high temperatures (292C day /242C night) applied for listed intervals .............81

3-6. Days to 50% floral initiation in 'Autumn Red'from pinching (1 Sept. 2007) with high
temperatures (292C day /242C night) applied for the listed intervals. ....................81

3-7. Pairwise comparison of T50 values from Table 3-6......................................... ................ 82

4-1. Temperature treatments for greenhouse experiments....................................... ................ 94

4-2. Number of days to 50% floral initiation in 'Red Velvet' from the onset of 12-hour dark
periods with day/night temperatures of 26/182C, 26/212C, or 26/242C .............95

4-4. Days to 50% floral initiation for 'Red Velvet' from the onset of 12-hour dark periods
with day/night temperatures of 26/232C, 29/242C, or 29/182C ........................95

4-5. Student t-test pairwise comparison of T50 values in Table 4-4. .....................................95

4-6. Days to 50% floral initiation from the onset of 12-hour dark periods with day/night
temperatures of 24/292C, 24/242C, or 29/242C.. .............................................96

4-7. Student t-test pairwise comparison of T50 values in Table 4-6. .....................................96

4-8. Days to T50 initiation from the onset of 12-hour dark periods with day/night
temperatures of 21/272C, 27/212C, or 27/272C. ..............................................97

4-9. Student t-test pairwise comparison of T50 values in Table 4-8. ......................................97

4-10. Number of days to first color, visible bud, and anthesis from the onset of 12-hour dark
periods in 'Prestige Red' with mean diurnal temperatures of 212C, 242C, or
2 7 2 0C ......................................................................................................... . ....... .. 9 8

4-11. Days to 50% floral initiation from the onset of 12-hour dark periods for 'Prestige Red'
with mean diurnal temperatures of 21, 24, or 2720C. ............ ....................98

4-12. Student t-test pairwise comparison of T50 values in Table 4-11 ...................................98









4-13. Number of days to first color, visible bud, and anthesis from the onset of 12-hour dark
periods with mean diurnal temperatures of 21, 24, or 272C.....................................99

4-14. Days to 50% floral initiation from the onset of 12-hour dark periods with mean
diurnal tem peratures of 21, 24, or 272C ................................................... ................ 99

4-15. Student t-test pairwise comparison of T50 values in Table 4-14 .................................100

5-1. Primers used for tracking expression of CAB and CO in 'Red Velvet'. .......................... 110

5-2. Number of days to 50% floral initiation from the onset of 12-hour dark periods in 'Red
Velvet' with day/night temperatures of 24/212C or 29/242C...............................110









LIST OF FIGURES


Figure page

5-1. Expression patterns of CAB and CO with 242C day/21+2C night temperatures and
12-hour dark periods ............ .. .................... ................ .......................... ............ .. 110

5-2. Expression patterns of CAB and CO with 292C day/24+2C night temperatures and
12-hour dark periods ...... .. ..................................... .................................................. 111









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

TIMING, DURATION, AND DIURNAL DISTRIBUTION OF SUPRAOPTIMAL
TEMPERATURES AFFECT FLORAL INITIATION OF POINSETTIA

By

Rebecca Anne Schnelle

August 2008

Chair: James E. Barrett
Major: Horticultural Science

High temperature delay in flowering of poinsettia termed "heat delay" can cause a

poinsettia crop to reach a marketable stage of floral development too late for holiday sales

leading to serious economic losses. First, the range of high temperature sensitivity in modern

poinsettia cultivars was investigated. Plants were exposed to either a high (292C day

/242C night) or low (242C day/21+2C night) temperature treatment for 28 days. There

were significant delays in floral initiation and anthesis between the high and low temperature

treatment for all cultivars tested. The delay in floral initiation ranged from 10 days in 'Freedom

Early Red' to 19 days in 'Prestige Red'. Closely related cultivars showed similar delays in floral

initiation.

Three experiments were designed to determine the effects of timing and duration of high

temperature exposure on heat delay. High temperature treatments (292C day / 242C night)

were applied for 7 to 28 days at designated times. Seven days of high temperatures had no effect

on flowering time. Twenty-eight days of high temperature exposure caused plants to reached

anthesis 12 to 14 days later than the cool temperature control. Fourteen days of high temperature

exposure before floral initiation led to a delay in anthesis of 5 to 7 days. High temperatures

following floral initiation produced no delay in anthesis. These results indicate that the timing of









high temperature exposure determines if heat delay will occur and the duration of high

temperatures affects the magnitude of the delay.

The roles of supraoptimal night, day, or mean diurnal temperature were investigated. In

growth chambers, delays in floral initiation were observed when the supraoptimal temperatures

were imposed during the day or night. Greenhouse experiments were conducted utilizing

temperature treatments with identical daytime high and overnight low temperatures but divergent

diurnal mean temperatures. Floral initiation in 'Red Velvet' was delayed by 6 to 8 days with a

mean temperature of 272C compared to plants grown with 212C or 242C mean diurnal

temperatures, respectively. These data indicate that high temperature delay in floral initiation of

poinsettia is the result of exposure to supraoptimal mean diurnal temperatures.









CHAPTER 1
REVIEW OF LITERATURE

Mechanisms of Photoperiodic Flowering

Photoperiodism is the control of physiological and developmental responses by sensing of

the relative length of light and dark periods. Photoperiodism was first described by Garner and

Allard (1920, 1923) in a study classifying plants as either long day or short day plants for

flowering. In short-day plants a night length greater than the critical night length promotes floral

induction and in some cases development (Vince-Prue, 1975). Hamner and Bonner (1938)

conducted a study with the short day plant Xanthium to determine that short day plants respond

to night length as opposed to day length. Xanthium was exposed to both light interruptions of the

dark period and dark interruptions of the light period. They found that a light interruption of the

dark period inhibited the flowering response while a dark interruption of the light period did not

affect the flowering response. These results indicate that the short-day response is a result of

exposure to a period of uninterrupted darkness. Obligate short-day plants will not flower until

the night length reaches the critical night length. Facultative short day plants will flower in non

inductive photoperiods in response to temperature or other developmental signals although floral

induction is accelerated by inductive photoperiodic conditions. The inverse is true for both

facultative and obligate long-day plants.

Understanding of day-length sensing and photoperiodic responses is the focus of ongoing

research. Several models have been proposed over the years to reconcile these phenomena. The

model that is currently most accepted is the external coincidence model. As early as 1936 Edwin

Biunning proposed that an endogenous timekeeper controls light mediated responses by

promoting these responses when the day-length signal occurs during the most sensitive phase of

the internal rhythm. In recent years the external coincidence model has been modified in









response to newly emerging data from the model plant system, arabidopsis [Arabidopsis thaliana

(L.) Heynh.]. Currently, the external coincidence model asserts that light serves to reset entrainn)

the circadian clock which drives the cyclic expression of numerous plant genes involved in many

physiological processes. In addition, key regulatory elements linked to floral induction in long-

day plant arabidopsis peak in the late afternoon coinciding with light more during long-days that

in short-days. This indicates that the light input must be present when the transcripts or proteins

necessary to begin the signaling pathway leading to floral initiation are above a certain critical

threshold. Also a dual function of such factors has been shown in short-day plants in which they

act as repressors to flowering (Imazumi and Kay, 2006). In laboratory and many natural

conditions this scenario for light signaling seems very plausible. As previously described,

classical studies of photoperiodic plants indicate that photoperiodic responses are controlled by

the dark period rather than the light period. In fact, a study on arabidopsis showed that wild-type

and mutant plants flowered more quickly in short days when a light break was given during the

long night period (Goto et al., 1991). Similarly, in short-day plant rice (Oryza sativa) it was

recorded that a night break of as little as 10 minutes significantly delayed flowering in short-day

conditions. Ishikawa et al. (2005) found that a single incident of a night break strongly

suppressed mRNA of clock-regulated floral promoter Hd3a, inhibiting flowering. These results

reinforce the conclusions from the classical studies and show that the external coincidence model

while useful is far from fully explaining the mechanisms of photoperiodic flowering in plants.

Photoperiodic Photoreceptors

Photoreceptors are plant pigments capable of sensing discrete wavelengths of light and

influencing plant developmental processes. There are at least three main classes of these

photoreceptors: the phytochromes, cryptochromes, and LOV domain family proteins

(phototropins). The latter two groups of photoreceptors respond to blue and UV-A light; the









phytochromes are red and far red light responsive (Yanovsky and Kay, 2006). The

phytochromes have been determined to be the major photoreceptors in plants involved in the

photoperiodic floral induction process. Phytochromes form chromoproteins (proteins linked to

chromophores) that allow the unit to act as a photoreceptor. The chromoprotein oscillates

between two forms (Pfr and Pr) in response to light quality or the absence of light. The Pfr form

absorbs primarily at 730 nm and secondarily at 400 nm. The Pr form shows peak absorption at

665nm. With exposure to red light, Pr converts to Pfr which is the biologically active form.

During the dark period or when exposed to far-red light, Pfr reverts to Pr (Thomas and Vince-

Prue, 1997). Classical studies with night interruption lighting have shown that phytochrome

sensing is far red, red reversible with the last exposure determining the nature of the response

(Borthwick, 1964).

In recent years the action of phytochromes has been characterized with increased precision.

In model long-day plant arabidopsis, five phytochrome chromoproteins have been identified each

encoded by a separate genes named PHYTOCHROME (PHY) A, B, C, D, and E (Quail, 2002).

Phytochromes are divided into two types, phytochrome A is type I (light labile) and

phytochromes B, D, and E are type II (light stable) (Thomas and Vince-Prue, 1997). The

functions of these genes have been tested in arabidopsis with mutant types not producing one or

more of the phytochromes. These studies have shown that the light-stable phytochromes are

involved in red light responses where phytochrome A acts to distinguish far-red light from

darkness (Yanovsky and Kay, 2006). Arabidopsis mutants lacking phytochrome A flower

slightly later than the wild-type in long days created with incandescent lights rich in red light.

This indicates that the mutant type plants are unable to distinguish the light produced by the

incandescent bulbs from darkness so the night-length is not sensed correctly (Johnson et al.,









1994). However, in short-day plant rice phytochrome A mutants flower with wild-type plants

(Takano, 2001). Rice plants lacking the chromophore necessary for the functionality of all

phytochromes is insensitive to photoperiod all together causing it to flower early regardless of

photoperiod imposed (Oikawa, et al., 2000). There is also evidence in rice that the effect of a

night break is phytochrome B mediated. Ishikawa et al. (2005) found that mutant rice lacking

phytochrome B did not show a delay in flowering following night break treatments in short-day

conditions. This experimental evidence indicates that the light stable phytochromes play a more

important role in flowering time than phytochrome A in short-day plants.

Photoreceptors do not act independently, but as links in a light sensing network.

Experiments with mutant arabidopsis indicated the participation of other photoreceptors like blue

light absorbing cryptochromes and phototropins in the floral induction process (Halliday et al.,

2003). In addition, protein-protein interactions between the phytochromes themselves may play

a role in phytochrome mediated responses. Recent studies have shown phytochromes in the type

II group (B-E) form a wide variety of heterodimers, which would allow an additional level of

regulation in phytochrome action (Spalding and Folta, 2005). Some of the implications of these

recent findings will be discussed in relation to ambient temperature effects in a subsequent

section.

Circadian Clock Function and Entrainment

The circadian clock and its role in seasonal responses such as flowering, dormancy, and

carbohydrate storage have been recognized for many years (Vince-Prue, 1975). Circadian

rhythms have been observed on many levels within the plant from leaf movement, CO2

assimilation, and gene transcription. Recent studies have found the output signals from the

circadian clock regulate physiological processes in the plant including flowering. Expression

and stability of the photoreceptors themselves is circadian clock regulated. Both the









phytochromes and cryptochromes show strong diurnal oscillations (Yanovsky and Kay, 2006).

In arabidopsis expression of floral promoter CONSTANS (CO) is clock regulated also (Mouradov

et al., 2002). This endogenous oscillator responds to environmental stimuli transmitted by the

photoreceptors to establish the 24 hour circadian rhythm.

The circadian oscillator is the core mechanism for day-length measurement. In arabidopsis,

the central circadian oscillator has been well described. The oscillator consists of at least two

negative regulatory elements: CIRCADIAN CLOCK ASSOCIATED PROTEIN 1 (CCA1) And

LATE ELONGATED HYPOCOTYL (LHY) and one positive element TIMING OF CAB

EXPRESSION 1 (TOC1). These elements are linked in a negative feedback regulatory loop

(Increase in TOC1 suppresses CCA1 and LHY and vice versa) (Salome and McClung, 2005).

CCA1 and LHY are both MYB-related transcription factors that show peak levels of expression at

both the mRNA and protein levels at dawn. Mutants over-expressing either show general

arrhythmia due to a negative feedback reduction in the functions of both CCA1 and LHY. This

indicates that these are partially redundant in their functions to generate and sustain the circadian

rhythm. Conversely, TOC1 expression peaks at dusk. All TOC1 mutants with reduced or no

TOC1 expression have all shown shortened periods. While plants over-expressing TOC1 show

extended periods, but if TOC1 is constitutively expressed arrhythmia results. The structure of

TOC1 indicates that it too has a role in transcription regulation. These newly elucidated

processes show an elegant negative feed-back loop with TOC1 down regulating its own

expression by promoting the expression of its negative regulators CCA1 and LHY (Yanovsky and

Kay, 2006). In addition, new clock associated proteins are being discovered by ongoing

research. Four pseudo-response regulators have been described. These proteins are referred to

as PSUEDO RESPONSE REGULATOR (PRR) 3, 5, 7, and 9 and are all homologs of TOC1.









They form the regulatory loops that control the expression of the clock proteins in the CCA1-

LHY circuit (Imazumi and Kay, 2006).

Circadian clock entrainment occurs primarily in response to phytochrome and

cryptochrome mediated light signals but temperature cycles also play a critical role. Light

entrainment involves several mechanisms. Boss et al. (2004) stated that phytochrome interacting

factor 3 (PIF3), zeitlupe (ZTL), LOV kelch protein 2 (LKP2), and flavin-binding kelch repeat F-

box 1 (FKF1) are all putative photoreceptors involved in circadian clock entrainment. PIF3, a

helix-loop-helix transcription factor, up-regulates CCA1 and LHY. Mutations in ZTL and LKP2

cause increases in period length and late flowering in inductive photoperiods. In addition, four

newly discovered homologues of TOC1 which peak at different times during the 24-hour cycle

may also plant an integral role in clock function and/or entrainment (Yanovsky and Kay, 2006).

The circadian clock is temperature compensated, however temperature and pulses do effect

entrainment. In arabidopsis, temperature cycles as little as 40C can entrain circadian cotyledon

movements although the sensing mechanism is unknown (McClung, 2001). Expression of the

clock genes is entrained by thermocylces as well as light and dark cycles. The level of control of

this entrainment (transcriptional or further downstream) is currently unknown. Both advances

and delays in the phase of the circadian rhythm have been detected following temperature pulses

during different portions of the period. Advance in phase was observed with a four hour cold

temperature pulse of 100C in the evening but a delay in phase occurred following a similar cold

temperature pulse in the morning (Salome and McClung, 2005).

Additional Environmental Cues Affecting Photoperiodic Flowering

The variety of photoperiodic responses in plants indicates that there are many levels of

control involved in the floral induction process. It seems intuitive that plants have evolved a

wide variety of mechanisms for sensing and integrating signals from many environmental cues.









Research has indicated that in addition to light signals other environmental cues such as ambient

temperature, nutrient status, and carbohydrate status alter the flowering response of

photoperiodic plants (Bernier et al., 1993; Mouradov et al., 2002).

The importance of temperature in photoperiodic responses has been studied primarily in

reference to vernalization. The requirement for specific number of chilling hours to allow floral

induction to proceed is well known in many plants. However, ambient temperature has also been

shown to have profound effects on flowering. In arabidopsis, slight increases in ambient

temperature can accelerate flowering. Increases in spring temperatures in temperate climates

lead to early flowering in wild populations of arabidopsis despite identical photoperiodic

conditions (Blazquez et al., 2003). In fall-flowering plants such as chrysanthemum and

poinsettia, the inverse effect has been observed (Barrett, 2003; Cathey, 1960; Larson and

Langhans, 1960; Weiland, 1998). This response will be discussed in the temperature effects

section.

Evidence suggests that phytochrome is essential for controlling flowering in response to

relatively small changes in ambient temperature. The hierarchy and the functional relationships

of the phytochrome species is modified by ambient temperature alterations. In arabidopsis the

phytochrome B response is altered by adjusting ambient temperatures from 16 to 220C. In short-

day conditions at 160C the Phytochrome B mutant flowers at the same time as the wild-type but

at 220C the mutant type flowers early. Phytochrome D and E mutants also show early flowering

in short days regardless of temperature. This indicates that at different ambient temperatures, the

phytochrome species that has the most effect on flowering time can change (Halliday and

Whitelam, 2003). This relationship between ambient temperature and photoperiodic responses









illustrates another level on which plants can sense changes in the environment and suggests

mechanisms for finer control of flowering time by integrating light and temperature signals.

Long day plant Sinapsis alba flowers only after the completion of a complex signaling

loop that appears to allow the plant to integrate both nutrient and carbohydrate status inputs with

the day-length signal. In response to an inductive long-day, sucrose and isopentenyladenine are

exported from the leaves to the roots which export cytokinins and nitrate back to the leaves. The

cytokinins are metabolized but the imported nitrates are converted to glutamine which is later

exported back into the phloem where it appears to play a role in translocating the floral signal to

the apical meristem (Bernier and Perilleux, 2004). This long distance signaling appears to allow

the plant to integrate the carbohydrate and nutrient status signals before floral induction can

continue. These findings illustrate other mechanisms by which plants can combine multiple

environmental cues to determine the most favorable time to flower.

Biochemical and Physiological Mechanisms of Photoperiodic Flowering

The origin and nature of the floral signal has fascinated researchers for decades.

Historically, the model for floral initiation has relied upon a chain of linear events set into

motion by the photoreceptors and leading to the release of a specific hormone, the hypothetical

compound "florigen". Recent studies suggest that photoperiodic floral induction is the result of

network of biochemical events initiated by the phytochrome photoreceptors (Valverde et al.,

2004)

Physiological Studies of the Floral Signal

Grafting experiments indicate that the floral induction signals originate in the leaf and are

then translocated to the apical meristem. In some species the roots contribute essential

compounds to the floral signal as with Sinapsis alba (Bernier et al., 1993). The rate of movement

of the floral stimulus also varies widely among plant species (Thomas and Vince-Prue, 1997).









This may partially account for the variety of response times. The inductive floral signal moves

mainly in the phloem and often with assimilate flow. Grafting experiments confirmed that the

phloem is the primary means of transport but some movement also occurs in the mesophyll

(Thomas and Vince-Prue, 1997). Stem girdling has been shown to block floral induction in

Sinapsis alba (Bernier et al., 1993) but to actually promote flowering in Chenopodium rubrum

(Vondrakova, et al., 1998). Upon reaching the apical meristem the signal initiates meristem

differentiation and floral evocation. There is also evidence suggesting that there are floral

inhibitory compounds which serve to suppress flowering in non inductive photoperiods. Thus

removal of these inhibitory compounds leads to floral induction (Thomas and Vince-Prue, 1997).

Bernier, et al. (1993) proposed the theory of"multifactorial control" indicating that numerous

hormones and other signaling compounds participate in the floral induction process. This theory

allows for the presence of both promoting and inhibiting compounds suggesting that interactions

between the two groups determine floral initiation. Recent studies on a cellular level lend more

credibility to this theory.

Much of the early search for the elusive florigen focused on plant hormones as some

studies indicated hormonal control of flowering. There is much evidence supporting the

conclusion that plant hormones also play a role in the floral induction process in certain plants.

Researchers have compared the phloem exudates of plants in induced and non induced states to

determine the involvement of plant hormones in the floral transition (Bernier et al., 1993;

Corbesier et al., 2003; Vondrakova et al., 1998). In Sinapsis alba an increase in cytokinin levels

coincides with the onset of flowering (Bernier et al., 1993) while in Chenopodium rubrum

cytokinin levels drop and giberellin levels increase (Vodrakova et al., 1998). Exogenous

application of gibberellins also promote flowering in many species including the short-day plant









Pharbitis nil (Kulikowska et al., 2002), but not in others like Sinapsis alba. In this case, the

application of exogenous cytokinin caused the meristem to initiate the floral induction process

(Bernier et al., 1993). Calcium and caffeine applied exogenously have also been shown to

promote flowering in Pharbitis nil (Tretyn et al., 1994). This wide variety of experimental

results led to the conclusion that there is no one florigen or a single plant hormone responsible

for driving the floral transition. As more studies attempted to describe the signaling network, the

more contributing factors were found verifying the multifactorial control theory. While there are

clearly many systems for regulating flowering time at work across the plant kingdom, studying

all of them in detail in impractical. Model plant systems have been selected to elucidate the

genetic and biochemical basis of the floral signal and the transition from the vegetative to

reproductive states.

Biochemical Studies of the Photoperiodic Floral Induction Pathway in Arabidopsis

In recent years extensive work on the genetic and biochemical aspects of the floral signal

in the model plant system arabidopsis has allowed a more detailed understanding of the process

that occurs following integration of the light signal. Arabidopsis is a facultative long-day plant

with several floral induction pathways that have been studied. This model system has been

utilized for the most detailed studies of photoperiodic floral induction in plants (Mouradov, et al.,

2002). For this reason, the current understanding of this pathway is summarized below.

Current research has led to a much more detailed understanding of the nature of this

flowering signal and how it moves within the plant. The first step in the photoperiodic flowering

process is activation of the phytochrome chromoproteins. As previously described, these

proteins are the core of the day-length sensing complex in plants. These photoreceptors have

also been shown to regulate the expression of the genes that are responsible for the change in

meristem identity from vegetative to reproductive (Imazumi and Kay, 2006; Yanovsky and Kay,









2006). Light dependent partitioning of phytochrome and signaling intermediates between the

nucleus and cytoplasm has led to the suggestion that early signaling events originate in the

nucleus. The localization of these molecules may be a signaling control point. Experiments with

green fluorescent protein markers have shown that phytochromes A and B accumulate in the

nucleus in response to red wavelengths of light (Spalding and Folta, 2005). Also, proteosome-

mediated degradation of signaling intermediates may interact with these localization patterns to

form a checkpoint for the further cascade of floral signaling before it is carried beyond the cell.

These results indicate that essential components of the phytochrome signal originate in separate

organelles and are then integrated to ensure an accurate response to stimuli from the light

environment (Moller et al., 2002).

Numerous genes that play vital roles in photoperiodic floral induction have been identified

in arabidopsis. One of the best understood is CONSTANS (CO) which encodes a zinc-finger

protein that promotes transcription of downstream flowering genes. It is now well known that

CO acts as a transcription factor; however the CO protein does not have a typical DNA binding

domain. The mechanism of CO action is not completely understood. It has been suggested that

CO may act in concert with additional transcription factors to upregulate floral gene expression

(Imaizumi and Kay, 2006). CONSTANS expression is regulated by the circadian clock with peak

expression occurring during the dark period in short-day conditions (Suarez and Lopez, 2001).

In long day-lengths high levels of CO expression occur at dawn and dusk. CONSTANS protein

stability is enhanced by high far-red to red light ratios indicating CO plays a role in sensing light

quality as well as day-length (Valverde et al., 2004). In long day conditions this means that CO

protein stability is greatest in the late afternoon and probably regulated by phytochrome signals

(Imaizumi and Kay, 2006).









CONSTANS may influence the expression of a number of genes that ultimately impact

flowering time, but the best documented are SUPPRESSOR OVEREXPRESSION CO 1 (SOC1)

and FLOWERING LOCUS T (FT). The SOC1 transcript acts downstream of FTin the apical

meristem; its function is not completely understood. However, mutation studies indicate that

SOC1 expression is necessary for floral induction (Corbesier and Coupland, 2006). The gene FT

encodes a transcription factor that promotes the expression of the MADS-box genes which

control the change in meristem identity and determine the identity of the floral organs (Buchanen

et al., 2000). Levels of FTprotein have been shown to determine flowering in response to all of

the known floral induction pathways in arabidopsis. Recent studies have shown that FT may be

the part of the photoperiodic flowering signal that moves from the leaf tissue, where

physiological studies indicate the floral signal originates, to the shoot apical meristem where the

flowering transition occurs (Hailong et al., 2004). The function of FTis related to an interacting

protein FLOWERING LOCUS D (FD), a bZIP transcription factor. When these two transcription

factors occur together they begin the gene expression processes of floral induction by

upregulating meristem-identity genes including APETALA1 (API), FRUITFULL (FUL), and

LEAFY (LHY) at the shoot apical meristem (Abe et al., 2005). The FT gene is expressed

primarily in leaf and phloem tissue, but not in the apical meristem where FD is expressed only in

the apical meristem. So it is necessary for FT protein to move from its location of synthesis to

the apical meristem for the floral transition to occur (Corbesier et al., 2007).

There have been antagonistic factors identified that can also play a role in the

photoperiodic floral induction pathway. FLOWERING LOCUS C (FLC) is a MADS box

transcription factor that represses flowering by down-regulating FT, SOC1, and LFY. FLC is

most commonly observed in Arabidopsis genotypes that require vernalization. Expression of









FLC is essentially eliminated by a vernalization treatment, so its likely function is to prevent

flowering in response to inductive day-length in the fall season (Boss et al., 2004).

In conclusion, the current understanding of photoperiodic floral induction in Arabidopsis

indicates that the process begins with light activation of CO in the leaves which induces FT

expression. Next, FT protein moves to the shoot apical meristem where in conjunction with FD

stimulates expression of SOC1 and API expression, which in turn initiates the transition in

meristem identity from vegetative to reproductive (Corbesier and Coupland, 2006).

Biochemical Studies of Floral Induction in Rice

Rice is commonly used as a model system for photoperiodic flowering in short-day plants.

The genes and biochemical processes involved in photoperiodic floral induction in short-day

plants have not been documented to the extent as those of long-day model plant arabidopsis

(Searle and Coupland, 2004). Several genes in rice have been identified that relate to the

circadian clock and photoperiodic flowering. HEADING DATE (HD) 1, HD3a, and HD6 have

all been characterized as quantitative trait loci which play roles in determining critical night

length. HD1 protein is a functional ortholog of CO protein in arabidopsis. Expression of HD1

affects HD3a which is similar to arabidopsis FT protein. Through mutation studies, both HD1

and HD3a have been demonstrated to be necessary for successful photoperiodic floral induction

in rice (Yano et al., 2001). However, the ways in which these homologous genes react to light

signals is not similar to Arabidopsis. In rice, the expression of HD3a is only activated by HD1

during the dark period and further represses HD3a in response to phytochrome light signals

(Izawa et al., 2002). Also the relationship between the relative abundance of HD1 and HD3a

appears to be opposite of that in arabidopsis CO and FT. An increase in the expression of HD1

causes a reduction in HD3a abundance. This indicates that HD1 represses flowering in long-day

conditions through HD3a. The molecular mechanisms for this change in function of the CO -









like gene in rice is not known, however it may lie in the fact that CO alone does not act as a

transcription factor but rather in concert with other transcription factors which have not yet been

characterized (Cremer and Coupland, 2003). The similarity in the structures of these

orthologous genes indicates that there may be similar mechanisms for photoperiod sensing and

signaling between rice and Arabidopsis with divergent functional relationships (Searle and

Coupland, 2004). These findings also suggest that the genes involved in the photoperiodic floral

induction pathway may be well conserved in the plant kingdom.

Floral Initiation and Development in Poinsettia

Poinsettia (Euphorbiapulcherrima, Willd. Ex Koltz.) is a facultative short-day and

temperature-sensitive plant for both floral initiation and development. Many studies over the

decades have shown that poinsettias flower faster with increased night lengths and temperatures

within the optimum range. The development of the poinsettia inflorescence and the factors that

affect it will be discussed. While there has been extensive research on the roles of environmental

factors in the reproductive development of poinsettia, there has been considerably more research

focused on chrysanthemum (Dendranthema xgrandiflorum) especially pertaining to elevated

ambient temperature. Chrysanthemum is a major flowering potted crop with a similar pattern of

photoperiodic flowering in which ambient temperature strongly effects the timing of floral

initiation and development. Extensive research has been done characterizing the flowering

response of chrysanthemum, so it will be reviewed herein although these findings are not

necessarily directly applicable to poinsettia research.

Origin of the Poinsettia

The poinsettia is native to the Sierra Madre mountain range of Western Mexico and

Guatemala. Poinsettias were introduced to the United States in 1825 by Joel Robert Poinsett.

While serving as the United States ambassador to Mexico, Poinsett observed the use of poinsettia









inflorescences by the local people in winter ceremonies, indicating that plants normally bloom in

December in their native range. Poinsett collected numerous specimens near the town of Taxco

de Alarcon, Mexico. These specimens were distributed among the horticultural community.

Current data suggest modem poinsettia cultivars are descendants of these Mexican accessions

(Ecke et al., 12004). This narrow genetic base may explain why there is little variation in critical

night length present among poinsettia cultivars.

To fully understand a plant's physiological response to the environment it is necessary to

consider the conditions present during the plant's evolution. The locality of the original

poinsettia collections near Taxco de Alarcon is at an elevation of 1780 meters above sea level

with the coordinates 180 32' North by 990 26' West (AllRefer.com Gazetteer, 2004). The

average monthly temperatures in Taxco de Alarcon vary little over the course of the year.

Average high temperatures range from 230C to 27C and overnight lows from 8C to 130C. So

in its natural range the poinsettia is rarely exposed to temperatures over 27C, unlike the

conditions in modem greenhouses where daytime temperatures regularly exceed 320C.

Temperatures drop slightly in October when floral induction must occur for late December

blooming.

The other key aspect of the environment is the natural day-length variation throughout the

year. Based on civil twilight times the night length at Taxco de Alarcon ranges from 10 hours 59

minutes to 13 hours 1 minute as recorded by the US Naval Observatory (2007). This relatively

small change in day-length most likely accounts for the range of critical night lengths seen in

modern poinsettia cultivars. This also explains why poinsettia responds so strongly to very small

changes in photoperiod which will be discussed below in detail.









Poinsettia Floral Initiation, Development, and Morphology

The poinsettia inflorescence consists of a dichasial cluster of cyathia. Each cyathium is

enveloped by a symmetrical, uniserate involucre which bears one nectary. A variable number of

staminate flowers circle a single pistillate flower in the center of the cyathium. (Rao, 1971).

Larson and Langhans (1963c) first quantified the stages of floral initiation and

development in poinsettias through microscopic observation of the apical meristem. In the

vegetative state the apex was about 120 microns in length and flat in appearance. At initiation the

apex elongates to 135 microns and is visibly domed. Differentiation of floral bud primordia is

visible 7 days later when the apex reaches 150 microns. The poinsettia inflorescence follows a

predictable development pattern as first described in a study conducted by Struckmeyer and Beck

(1960). This study found that the primary cyathium primordium is the first to differentiate once

the meristem has changed from the flat vegetative state to the domed shape indicative of the shift

to reproductive development. In the cultivar 'Ruth Ecke' this change in the meristem was

detected after 20 short-days. Within the cyathium primordium, involucre and staminate flower

primordia can be detected. Around this early stage of development, the primordium of the first

order branches of the inflorescence become visible as small dome-shaped structures around the

primary cyathium primordia. Ten days later, the primary cyathium showed both staminate and

pistillate flower primordia and the involucre was elongating. The second order cyathia had also

begun to visibly differentiate from the meristem including the bracteal primordial associated with

each. Following another five days of development, the third order cyathia showed the same level

of differentiation as the second order had five days earlier. Development of the subsequent

cyathium orders continued for another 25 days following this pattern. Pollen shed anthesiss) was

reached on the primary cyathium after 60 short-days.









Grueber and Wilkins (1994) formulated a linear model of inflorescence development for

experimental use through electron microscopy. Twenty-seven discernable stages of development

were identified from vegetative meristem through anthesis. As previously noted the poinsettia

inflorescence requires about 60 days for development from short-days to anthesis, so this model

assumes that each stage is about two days in length. The most notable stages for experimental

study are three, fifteen, and twenty-seven. Stage three is the first stage in which the meristem

has visibly changed from the vegetative to reproductive state. This stage has been used to define

floral initiation (Wang, 2001). At stage fifteen, the primary bracts unfold from the apex. This

stage is commonly referred to as 'visible bud' for both commercial and experimental purposes

(Ecke et al., 2004). Stage twenty-seven is marked by pollen shed from the primary cyathium.

For experimental purposes, this stage is used to mark the completion of reproductive

development (Wang, 2001; Weiland, 1998).

The dates of visible bud and anthesis can be easily documented without disturbing the

plants being studied where the date of floral initiation can not. In this case microscopic

observation is needed which necessitates the removal of sample shoot tips on a regular basis to

determine when the population of plants reaches floral initiation. To analyze initiation date in

poinsettia, previous studies have used nonlinear analysis (SAS Proc Nonlin) with the logistic

equation y = (100/1+exp(-k*(x-b)), where y=percent of meristems that have undergone floral

initiation, k=slope of the curve at the midpoint, x=number of days after a defined time point, and

b=day at 50% (T50) initiation (Wang, 2001; Weiland, 1998). This model generates a nonlinear

curve that predicts the time at which 50% of a population has reached a specified state that can

not be directly defined such as floral initiation (Ratkowsky, 1990).









Night-Length Effects on Floral Initiation and Development of Poinsettia

Obligate short-day plants require a critical night length for floral initiation. Night lengths

shorter than the critical night length or light interruption of the dark period will inhibit the

flowering response. In facultative short-day plants, increased night-lengths promote or enhance

flowering (Thomas and Vince-Prue, 1997). The poinsettia and chrysanthemum are both

classified as facultative and temperature sensitive short day plants. To maintain vegetative

growth, night-interruption lighting with incandescent bulbs from 22:00 to 02:00 is recommended

(Ecke et al., 2004). The timing of the night break is significant as described in previous sections.

As a facultative short-day plant the poinsettia will eventually flower in long day conditions when

the meristem reaches a critical node number. Evans et al. (1992) concluded that long day

initiation occurred in a cultivar specific manner in response to the ontogenetic age of the

meristem which can be measured by the number of nodes produced.

For decades it has been well documented that poinsettias are facultative short day plants

for floral initiation, and flower more rapidly with increasing night length. Experiments by

Garner and Allard (1923) showed that poinsettia 'Barbara Ecke Supreme' flowered more rapidly

with a 14-hour night than a 12-hour night. These results were confirmed by additional research.

Larson and Langhans (1963 a) found that floral initiation in 'Barbara Ecke Supreme' occurred in

14, 16, 18, and 30 days with 16, 15, 14, and 12-hour nights, respectively. Flowers did not initiate

within the experimental period with 11 hour nights. A study by Miller and Kiplinger (1962)

produced similar results with treatments of 14, 13, 12, 11 and 10-hours dark. 'Barbara Ecke

Supreme' initiated flowers in 15, 17, and 33 days in 14, 13, and 12-hour night lengths,

respectively, but did not initiate at 10 and 11-hour nights during the 67 day study. More recently

Weiland (1998) evaluated 'Lilo Red', 'Freedom Red', and 'Success Red' with 11.5, 12, and

12.5-hour night lengths. All three cultivars showed floral initiation earliest with the 12.5 hour









dark period. With a 12-hour dark period each cultivar showed visible floral initiation one to

three days later than with a 12.5-hour dark period. However, with a dark period of 11 hours

floral initiation in cultivar 'Lilo Red' was delayed by over 10 days when compared to the 12 and

12.5-hour dark periods. 'Success Red' and 'Freedom Red' did not undergo floral initiation

during the experimental period with 11-hour dark periods.

The previous studies indicate that the critical night length for floral initiation in most

poinsettia cultivars may be around 11 hours; however all the studies discussed used a fixed

photoperiod through the course of the experiment which is not representative of natural growing

conditions. Studies have been conducted with natural day-length conditions at various latitudes

for a true assessment of critical night length.

The critical night length required for floral initiation and development is cultivar specific.

Early research observing the apical meristem has shown that for most poinsettia cultivars in

natural day-length conditions visible initiation occurs between September 25 and October 19.

This corresponds to night lengths ranging from 11 hours 45 minutes to 13 hours and 8 minutes at

the individual research locations (Adams et al., 2001; Gartner and McIntyre, 1957; Goddard

1961; Post, 1937). It is important to note that the cultivars used in these studies are no longer

utilized for commercial production at the present date. The general trend in poinsettia breeding

has been to move towards cultivars with shorter critical night lengths and more rapid floral

development to allow earlier flowering in natural day-length production (Ecke et. al., 1990).

Photoperiod also affects floral development in poinsettia. Greuber and Wilkins (1994)

reported that early floral development up to stage fifteen (visible bud) was hastened by

increasing the night length from 12 hours dark to 15 hours dark. However, once the plants had

reached stage fifteen, 12 hour dark periods hastened development compared to 15 hours dark.









This change in the response of development rate to the length of the photoperiod is probably due

to the increase in photosynthetic activity coupled by the increase in daily light integral rather

than to the photoperiod length in of itself.

Ambient Temperature Effects on Flowering of Poinsettia and Chrysanthemum

Floral induction in poinsettias occurs primarily in response to photoperiod and

temperature. The number of days to floral initiation at a given night length is affected by the

ambient temperature and the cultivar. Studies have shown that the optimum temperature for

rapid floral initiation and development is between 16 and 220C for most poinsettia cultivars

(Evans et al., 1992; Larson and Langhans, 1963). Delays in photoperiodic flowering at low

temperatures have been documented for many species (Roberts and Struckmeyer, 1938).

However, delay in floral initiation at high temperatures is more unusual. This type of delay in

the flowering response due to supraoptimal ambient temperature in termed "heat delay'. Delay

in floral photoperiodic floral initiation in response to elevated temperature has been reported in

other crop species, chrysanthemum being the most relevant. It is important to note that only

selected chrysanthemum cultivars show a pattern of heat delay similar to poinsettia and many of

these heat-sensitive cultivars are no longer used in commercial production for this reason

(Anderson and Ascher, 2001; 2004). However, the literature on the heat delay response of heat-

sensitive chrysanthemum cultivars can be helpful in hypothesizing about the nature of the

poinsettia heat delay response as much more detailed research has been conducted with

chrysanthemum. Pearson et al. (1993) reviewed temperature effects on chrysanthemum. Their

research indicates that the optimum temperature for flowering in chrysanthemum is between

180C and 210C.









Effects of Supraoptimal Temperatures on Floral Initiation and Development

There have been many studies in which delays in flowering time have been documented in

response to elevated ambient temperatures. Frequently the assumption has been that the

observed delay in the flowering process is the result of a delay in floral induction and initiation

rather than floral development. However, there are some examples of elevated ambient

temperature slowing developmental processes (Gartner and McIntyre, 1958; Grueber and

Wilkins, 1994; Kristoffersen, 1969; Langhans and Larson, 1960; Langhans and Miller, 1960;

Miller and Kiplinger, 1962).

It has been demonstrated that the heat delay effect in poinsettia involves floral initiation as

well as floral development. Weiland (1998) found that raising the temperature from 24/18C

day/night to 29/240C caused a delay of four days in transition of the meristem from vegetative to

reproductive. Grueber and Wilkins (1994) observed that at 240C constant temperature early

floral development was delayed compared to plants grown at 210C. However once the primary

cyathium had emerged from the bracts (stage fifteen), development to anthesis was hastened by

the 240C but was not sufficient to overcome the delay in early development.

Temperature and Photoperiod Interaction

For the cultivar Barbara Ecke Supreme, floral initiation occurred at 160C and 11 hour night

length but at 21C an 11.5 hour night length was necessary to induce floral initiation within the

experimental period. This trend continued with 270C in which case plants failed to initiate

flowers with 12-hour night, instead a 15-hour night was required to induce floral initiation

(Larson and Langhans, 1963b). There have been many more studies investigating the flowering

responses in numerous poinsettia cultivars with various photoperiod and temperature

combinations. The results of these studies confirm the trends described; above the optimum

temperature for a cultivar floral initiation and/or early development is measurably delayed.









However, the findings in many of these studies are not consistent and frequently contradictory

with regard to the effect of specific temperatures or photoperiods (Gartner and McIntyre, 1958;

Grueber and Wilkins, 1994; Kristoffersen, 1969; Miller and Kiplinger, 1962; Langhans and

Larson, 1960; Langhans and Miller, 1960). This is likely due to inconsistencies in experimental

and data analysis procedures. For example, in some studies only the night temperature is

reported and the day or mean temperatures are not. The results of these studies will be discussed

in more detail in subsequent sections. Over the years following these studies, considerable

breeding progress has been made and new cultivars of poinsettia introduced. These new

cultivars show different plant architecture and tend to flower much earlier in natural days than

their predecessors (Ecke et al., 2004). New studies to characterize the flowering traits of these

cultivars are necessary.

Studies with modern cultivars show a similar pattern of temperature and photoperiod

interaction in floral initiation. Barrett (2004) tested 7 modern poinsettia cultivars at three

temperature regimens: cool (230C day /210C night), medium (250C day /220C night), and high

temperatures (290C day /230C night) at 12 and 13-hour night lengths. The date of visible red

coloration of the bracts, visible bud (stage 15), and anthesis (stage 27) were recorded. At 12-

hour nights, cultivar 'Orion' reached anthesis at all three temperature regimens within 5 days of

each other. When compared to the cool and medium temperature treatments, 'Red Velvet',

'Victory', and 'Prestige Red' plants in the high temperature treatment reached anthesis 14, 20,

and 18 days later, respectively. With 13-hours dark, each of the seven cultivars in each

temperature treatment reached anthesis within 3 days. Also, with 13-hours dark, each cultivar

reached anthesis an average of 15 days sooner than with 12-hours dark. This study confirms that









modern poinsettia cultivars follow the same high temperature response pattern as earlier cultivars

even though many respond very differently to a given temperature and photoperiod combination.

These results indicate that at a marginal photoperiod the floral stimulus or the plant's

physiological response to it is significantly affected by temperature. However, with longer night

lengths this influence is diminished. The mechanism of this interaction remains unknown;

however the observed delay in floral initiation is likely the result of an adjustment of critical

night length by elevated ambient temperature coupled with a reduction in the rate of early

inflorescence development.

Effects of Duration and Timing of Supraoptimal Temperatures

Many of the studies that uncovered the heat-delay response utilized fixed temperature

treatments throughout the experimental period. However, in commercial poinsettia production

temperature is often varied through the production cycle which necessitates understanding which

stages of reproductive development are sensitive to high temperature conditions and the duration

of high temperatures necessary to produce the observed delay in flowering. Little research has

been conducted addressing these issues in poinsettias. The research that has been done with

varying duration of high temperature exposure was in concert with varying duration of short-day

photoperiods (Langhans and Miller, 1960; Miller and Kiplinger, 1962).

The impact of the timing and duration of high temperature exposure has been addressed in

greater detail with heat-sensitive chrysanthemum cultivars. Whealy et al. (1987) exposed

chrysanthemum 'Orange Bowl' to fourteen different high temperature treatments. These

treatments consisted of 2, 4, 6, 8, or 10 weeks of high temperatures (300C/260C day/night)

beginning either the first, third, fifth, or seventh week following the onset of short-days. The

plants were grown under optimum development temperatures all other times (220C/18C

day/night). Treatments beginning the first or third week of short-days had the greatest effect on









the number of days to open flower. Two weeks of high temperatures beginning the first week of

short-days had no effect on time to flower, but two weeks of high temperatures beginning the

third week caused about one week of delay in flowering time. The treatment with six weeks of

high temperatures beginning the first week produced the same delay in flowering time as a four

week treatment beginning the third week. These results indicate that the floral development

process may not have begun until two weeks following the onset of short-days. Two, four or six

weeks of high temperatures beginning the fifth week caused only a small delay in flowering time

(three days or less). Finally, high temperatures applied for two or four weeks beginning the

seventh week of short-days had no effect on days to open flower. These results clearly indicate

that some stages of reproductive development in chrysanthemum are sensitive to high

temperatures while others are not. However, in other chrysanthemum cultivars this pattern does

not hold. Karlsson et al. (1989) found that in 'Bright Golden Anne', a temperature treatment of

300C significantly delayed development during all stages of floral development compared to

plants grown at 200C.

Effects of Supraoptimal Day, Night, and Diurnal Mean Temperatures

Elevated day and night temperatures in combination have been demonstrated to cause heat

delay in modern poinsettia cultivars (Barrett, 2004; Weiland, 1998). In both poinsettias and

chrysanthemums, heat delay has been attributed to high night temperatures. Many of the early

studies focused on temperature effects on poinsettia investigated night temperatures only. This is

likely due to the prevailing belief at the time that the flowering response of short-day plants

occurred during the inductive night leading to the conclusion that night temperatures would have

more impact on flowering. As discussed in the mechanisms of photoperiodic flowering section,

modern studies have shown that floral induction is a highly integrated process based on the

convergence of many signals.









Roberts and Struckmeyer (1938) reported that poinsettia (cultivar not indicated) failed to

flower when the minimum night temperature was 210C. In this study plants grown with 160C or

180C minimum night temperatures flowered normally. In contrast, Miller and Kiplinger (1962)

found no delay in flowering or initiation in 'Barbara Ecke Supreme' with 210C minimum night

temperatures compared to 160C or 180C with night lengths of 12 to 15 hours. In fact those plants

receiving a 210C minimum night temperature reached visible bud stage in 28 days compared to

32 days, 36 days, and 47 days with 180, 150, and 130C minimum night temperature, respectively.

Langhans and Larson (1960) investigated temperatures effects on 'Barbara Ecke Supreme' with

15-hour night lengths. In this study both day and night temperatures were reported. Treatments

with night temperatures of 27C reached visible bud 11 to 18 days later than treatments receiving

21 C night temperatures regardless of day temperature. However, considering the night

temperatures were imposed for 15 hours per day, it would be expected that the night temperature

would have a greater influence on the overall flowering response. A study by Langhans and

Miller (1960) investigated the effects of constant temperature on flowering in 'Barbara Ecke

Supreme'. Plants grown with 16-hour night length and 27C constant temperature reached

visible bud only 5 days later than those grown at 21C. These results are in contrast the results

of Langhans and Larson (1960). The cause of the variability in the results of these studies

despite the use of the same cultivar is unclear.

Similar experimental results have been reported with heat-sensitive chrysanthemum

cultivars. Cultivar 'Miros' was grown with 16-hour nights and 250C day temperatures. With

night temperatures of 240C, anthesis was delayed by 10 days when compared with plants grown

in 210C or 180C night temperatures (Langhans and Larson, 1963b). It was concluded in this

study that the night temperature was the cause of the delay. Cathey (1954) also concluded that









the increase in time to flowering observed in chrysanthemum 'Encore' was influenced more

strongly by night temperature. As in the poinsettia studies the night lengths during the

experimental period were significantly longer than the day lengths so it is unclear if the apparent

influence of night temperature is in fact due to the elevated night temperature or change in the

diurnal mean temperature.

Pearson et al. (1993) reanalyzed previously published data addressing the relative roles of

day, night, and mean temperature in chrysanthemum floral development. This analysis led to the

formulation of a model for the effect of mean diurnal temperature on the time to flower in

chrysanthemum. This model indicates that the reciprocal of time to flower is linearly related to

increase in the mean diurnal temperature when temperatures are below or within the optimum

range with the following equation: 1/f = a+ bT ((f) days from the start of short-days to flowering;

(T) mean diurnal temperature). Variables (a) and (b) are genotype specific constants. Above the

optimum temperature range the reciprocal of time to flower shows a negative linear correlation

to increase in mean diurnal temperature.

Application of this model to the data from Cathey (1954) showed a highly significant

positive linear correlation between the reciprocal of days to flower and mean diurnal temperature

up to about 210C. Temperature above 210C showed no significant correlation indicating that the

optimum temperature had been reached for the cultivar 'Encore'. It is important to note that

'Encore' is not a high temperature sensitive cultivar and no increase in time to flower was

observed with diurnal mean temperatures ranging from 210C to 27C (Cathey, 1954). This

model also accurately predicts the response of high temperature sensitive cultivars to elevated

temperature. When the model was applied to the data from Whealy et al. (1987) a strong

negative correlation was found between the reciprocal of days to flower and increase in mean









diurnal temperature from 210C to 27C. Pearson et al. (1993) also stressed the importance of

effective temperature. When a single temperature treatment includes temperatures well above

and well below the optimum for the cultivar, the linear relationship between the reciprocal of

days to flower and mean diurnal temperature breaks down. In this case the effective temperature

must be calculated before the model can be applied to the data.

This model system for illustrating the effects of temperature on time to flower has been

widely accepted by researchers studying chrysanthemum. For example, by applying this model

Willits and Bailey (2000) determined that in chrysanthemum 'Iridon', the time to flower

increased 4.2 days with each IC increase in mean temperature above 230C. No published work

has addressed the possibility of this model accurately describing the response of poinsettia to

temperatures. In fact, the prevailing belief among poinsettia producers is that night temperature

above 230C is the main cause of heat delay (Ecke et al., 2004). When data from Langhans and

Larson (1960) was re-plotted in accordance with the model proposed by Pearson et al. (1993) the

reciprocal of the days to flower showed a strong linear correlation to the mean diurnal

temperature (linear regression with the formula y= 0.002 + 0.0007x and an R2 value of 0.89). In

this case the two treatments with mean diurnal temperatures above 24C were excluded. If the

two data points generated by temperature treatments above the apparent optimum were included

in the regression, the linear relation between the reciprocal of time to flower and mean diurnal

temperature is lost. The data points at 250C and 270C show a divergence from the linear

relationship between reciprocal of days to flower and increasing mean diurnal temperature since

there is an increase in days to flower with temperature increase at these temperatures while at the

cooler temperatures an increase in temperature produced a decrease in the time to flower. This is

a mathematical illustration of the observed delay in flowering time reported in poinsettia crops









grown under very warm conditions. There is not enough data available in the literature to

thoroughly test the applicability of this model to flowering time in poinsettia.

Temperature Effects on the Development of the Poinsettia Floral Display

As previously described, the inflorescence of poinsettia consists of several orders of

cyathia. However, the marketable floral display consists mainly of the bracts associated with the

cyathia. The poinsettia bract is a modified leaf carrying excess anthocyanin pigments

accompanied with a lack of chlorophyll (Kannangara and Hansson, 1998). Bracts are

differentiated from leaves by the lack of a palisade layer and pigment accumulation in enlarged

vacuoles in both upper and lower epidermal cells (Stewart and Arisumi, 1966). The majority of

poinsettia cultivars produce red bracts resulting from anthocyanin accumulation in all three

histogenic layers of the bract. Pink and white cultivars are produced when pigment is lost in one

or more of these layers. Bract color development in poinsettias occurs following floral initiation.

Development of color in the bracts occurs as a separate but parallel process with floral

development.

Photoperiod and temperature have been shown to effect bract development altering the

number, size, and color intensity of the bracts. Langhans and Miller (1960) rated poinsettias as

salable or not salable at the time of anthesis. This rating was based on the overall floral

presentation taking bract number and color intensity into consideration. They found that when

'Barbara Ecke Supreme' was grown at 210C or 27C with a 12-hour night length plants were not

salable, but were salable at 14 and 16-hour night lengths. In this study, three temperature

treatments were also used: 160C, 210C, and 27C constant temperature. In 'Barbara Ecke

Supreme', all plants grown at 160C were salable at all night lengths; however at 210C plants

grown with 12-hour night lengths were not salable and at 27C only plants grown with 16-hour

night lengths were salable.









Struckmeyer and Beck (1960) found that color development in poinsettia required short

days and an increase in the number of shorts days increased the number of colored bracts

produced. The effects of temperature and photoperiod on the number of colored bracts were

investigated in detail by Kristoffersen (1969) with cultivar 'Viking' grown at 150C, 180C, or

210C. Increasing night length increased the number of bracts developing color across the

temperature treatments and cultivars in this study. At all temperatures, 'Viking' did not produce

any colored bracts with a 10.5-hour night length. Plants grown with 13.5-hour nights produced

the highest number of colored bracts. Plants grown with 11.5 or 12.5-hour night length

illustrated the effect of temperature. At both photoperiods, the highest number of bracts was

produced on the group grown at a constant 180C compared to those grown at 150C or 210C. This

study also showed that there is a strong genetic component affecting the number of bracts

produced and the relative color intensity displayed at various temperature and photoperiodic

conditions. In the cultivar 'Paul Mikkelsen' the bract number response was very different. In

this case the optimum temperature to maximize colored bract number appears to lie above the

temperature range used in the study as the number of bracts increased as temperature increased.

Marousky (1968) studied the pigment content of bracts of poinsettia 'Indianapolis Red' at

130C, 17C, and 210C. At a constant temperature of 210C, the anthocyanin content of the bracts

was significantly lower than at 17C and 130C. These findings were representative of the

observed red color intensity of the bracts. This experiment was not repeated with any other

cultivars so it is not implied that temperatures above 17C reduce anthocyanin concentration in

the bracts of all poinsettia cultivars. Also, in all of these studies it is important to note that the

highest temperature treatments are well below the range of temperatures causing heat delay in

modern poinsettia cultivars grown in the southern United States.









Objectives

The present series of studies were designed to advance the current understanding of the

poinsettia flowering process in modem cultivars under supraoptimal temperatures. The

interaction of temperature and photoperiod affects the time to flower for all poinsettia cultivars to

some extent and in specific cultivars, high temperatures at the inductive stage cause significant

heat delay (increase in time from beginning of inductive photoperiod to full floral display)

(Barrett, 2004). The physiology of this interaction and its impact on the floral induction process

is not fully understood.

The first step in dissecting the mechanism will be to quantify the delay in floral induction

relative to ambient temperature and photoperiodic response. Microscopic examination of

meristem sections at the beginning of the inductive night and at regular intervals thereafter will

be used to pinpoint the time of visible initiation under varied temperature regimes. The

temperature treatments will test the effects of night and day temperatures during various stages

of the floral induction process. The effect of the duration of high night and day temperatures will

also be tested. Analysis of the data collected will elucidate the effect of ambient temperature

elevation of the physiological process of floral initiation in short-day temperature-sensitive

plants. Greater knowledge of the heat-delay effect will allow more detailed study of the role of

temperature in the floral induction pathway of poinsettia. Examination of the closely related

cultivars will allow a comparison of heat delay and response time with little genetic variability.

Variation in heat delay between these closely related cultivars will allow future studies to access

the mechanism of this effect on a more detailed level.









CHAPTER 2
HEAT DELAY IN MODERN POINSETTIA CULTIVARS

Introduction

Poinsettia is a facultative short-day and temperature-sensitive plant with regard to floral

initiation and development. Floral initiation is hastened by a dark period longer than the critical

night length with moderate ambient air temperatures up to 24C (Langhans and Larson, 1960).

High temperatures, especially in combination with a marginally inductive photoperiod, may

significantly delay floral initiation and color development. This results in a later crop finish time

and is termed "heat delay". However, high temperatures accelerate the floral development

process (Miller and Kiplinger, 1962).

Floral initiation occurs in response to photoperiod and temperature once the meristem has

reached the proper developmental age (Larson and Langhans, 1963a; 1963b; Evans et al., 1992).

The number of days to floral initiation at a given night length is affected by the ambient

temperature and varies with cultivar. Miller and Kiplinger (1962) found that night temperatures

below 160C and above 210C delay floral initiation. Under a 15-hour night length, Wieland

(1998) observed a 3 to 4-day delay in floral initiation in 'Success Red' between 24/180C and

29/240C average day/night temperature regimes. In another study with 'Success Red' at

moderate (262C day /21+2C night) and high (30+2C day /23+2C night) temperature

regimes, flowering was delayed by 12 days between the moderate and high temperature

treatments with natural day conditions, but with 13-hour night lengths there was no difference in

flowering time between the two treatments (Barrett, 2003). In this same study, other cultivars

followed a similar pattern. In 'Prestige Red' there was a 14 day delay in flowering with the high

temperature treatment compared to the moderate temperature treatment in natural days and no

delay with 13-hour dark periods. This indicates that high temperatures may be causing a shift in









the plants' critical night length for flowering. Increasing the night length to 13-hours would then

prevent a delay in floral initiation due to an adjusted critical night length assuming that the

controlled dark period is longer than the adjusted critical night length. In chrysanthemum it has

been well documented that heat delay is in fact the result of a delay in floral initiation due to an

adjustment in critical night lengths at supraoptimal temperatures (Anderson and Ascher, 2001).

Poinsettia has very similar photoperiodic flowering response to chrysanthemum so it is

reasonable to hypothesize that heat delay in the two species have similar mechanisms.

The majority of poinsettia flowering studies utilized controlled photoperiods. In the period

when these studies were conducted poinsettia crops were frequently produced with black-cloth

controlled photoperiods. In recent decades poinsettia production has shifted to primarily natural-

day flowering for a number of reasons. The average producer of blooming poinsettias is growing

a much larger number of pots than in the past. It is impractical and uneconomical to use black-

cloth to cover the larger growing ranges necessary for producing large crops of potted plants.

Studying flowering responses in natural photoperiods presents a challenge, as it is impossible to

precisely measure the length of natural light and dark periods sensed by the plants. There have

been a few studies investigating exactly when during dusk and dawn that plants sense the shift

from dark to light and vise versa. However, the findings were highly variable. The light

quantity and quality present at the exact delineation between dark and light varies between

species and even cultivars (Vince-Prue and Heath, 1983). A study investigating the light

quantity needed for night interruption lighting to prevent flowering in poinsettia found variations

between cultivars (Wang, 2001). With these two pieces of information it is reasonable to deduce

that the delineation between natural dark and light periods is probably cultivar specific in

poinsettia. To simplify the situation and compare studies, civil twilight times have been the









accepted measure of natural photoperiods for decades (Rohwer and Heins, 2007; Russel, 1960).

There is no definitive evidence that the light level and quality at civil twilight does in fact

distinguish the light from dark periods in poinsettia plants. This measure is an approximation

used for the sake of discussion and comparison.

High temperature delay in flowering is a problem for poinsettia production in warm

temperate to tropical climates. These regions may experience temperatures in excess of 290 C

during the floral initiation period. Since the work cited above was preformed, many

commercially important cultivars have been introduced. In addition, poinsettia production has

shifted from primarily small growers supplying local areas to larger growers shipping greater

distances. To reduce the cost of input, these larger growers are located in areas that allow

outdoor or partially protected culture. As mentioned earlier, these larger producers are not able

to control photoperiod with black-cloth. Also, to facilitate long distance shipping poinsettia

breeders have developed new varieties with superior plant architecture and post harvest

longevity. 'Prestige Red' is the most notable cultivar which exhibits these characteristics.

Unfortunately, growers have observed significant heat delay in 'Prestige Red'. So, with the

adoption of this new market model and new cultivars, the economic impact of heat delay has

increased dramatically in recent years.

The recommended technique that growers use to achieve consistent scheduling of

poinsettia crops is termed the 'lights-out' method. This entails the use of night interruption

lighting from 22:00-02:00 to prevent premature floral initiation. The lighting is discontinued at

the scheduled time to produce a blooming crop for the desired time window (Ecke et al., 2004).

With this type of production scheduling, growers have reported consistent flowering in early

season cultivars such as 'Freedom Red' and 'Autumn Red', but not later cultivars such as









'Prestige Red' and Red Velvet'. This is most likely due to the adjustment of critical night length

as discussed earlier. The natural photoperiod at the lights-out date is likely longer than the

adjusted critical night length for the early season cultivars but not the later blooming cultivars.

However, this is only hypothetical as the exact critical night lengths are not known.

The first part of this study was conducted to determine the relative heat delay sensitivity of

16 modern poinsettia cultivars since it has not been previously documented. The first

experiment utilizes a 'lights-out' production schedule typical for poinsettia production in warm

climates such as Florida (Ecke et al., 2004). The latter three studies utilize 'natural-day'

flowering. This experimental procedure was implemented to determine if the observed delay in

flowering is a result of a delay in floral initiation due to an adjustment in critical night length by

the supraoptimal temperature treatment. Three sets of closely related cultivars were used in the

natural day experiments to determine if heat delay sensitivity is conserved among closely related

cultivars.

Materials and Methods

Uniform cultural practices were used for each experiment and all four experiments were

conducted in glass-glazed greenhouses located in Gainesville, Florida (29040'N latitude)

equipped with fan and pad cooling. Rooted cuttings were received from Paul Ecke Ranch

(Encinitas, CA) and planted in 105 cm3 pots containing Fafard 2 growing medium (Fafard,

Anderson, S.C.), which consists of 6.5 sphagnum peat: 2 perlite : 1.5 vermiculite (v/v).

Incandescent night interruption lighting (22:00-02:00) was used to prevent floral initiation

prior to transplant. Following the termination of night interruption lighting, plants were exposed

to natural photoperiodic conditions as shown in Table 2-1. One week after planting, all cutting

were pinched to five nodes. From planting through 1 Oct., all plants were fertilized with Peters

(The Scotts Company, LLC., Marysville, OH) 20N-4.4P-16K supplying Nitrogen at 300 mg-L-1.









From 1 Oct. through anthesis fertilization was adjusted to constant liquid feed of Peters 15N-

2.2P-8K supplying 250 mg-L-1 Nitrogen. Plant growth retardants (PGRs), which are a part of

standard commercial cultural practices, were not used for size control as their impact on

flowering time is not fully understood in poinsettia.

All four experiment utilized the same temperature treatments: high (292C day /242C

night) and low (242C day/21+2C night). From planting to the beginning of temperature

treatments and following temperature treatments through anthesis, all plants were grown with a

moderate temperature regime (262C day /21+2C night).

Data Collection

T50 floral initiation dates were calculated for experiments 3, 4, and 5 as determined by

SAS Proc Nonlin (SAS Inst. Cary, NC) with the equation y = (100/1+exp(-k*(x-b)) using the

following method. Shoot tips were sampled from one lateral in six plants per treatment at 2-day

intervals and examined with a Fisher Stereomaster 45X dissecting scope (Fisher Scientific, Inc.,

Pittsburgh, PA) to determine the development stage of the meristem. The stages were rated as

described by Grueber and Wilkins (1994) with stages one and two rated as not initiated and

stages three or above rated as initiated meristems. These data were used to calculate a T50 for

the number of days from pinching to 50% floral initiation.

Twenty-four pots per treatment were used, 12 pots were used for destructive harvest of

shoot tips to determine T50 initiation dates as previously described and the remaining 12 pots

were grown to anthesis. The dates of first visible bract color (first color), unfolding of the

primary bracts to reveal the primary cyathium (visible bud), and anther dehiscence anthesiss)

were recorded for each plant not used for shoot tip sampling. Average days for first color,

visible bud, and anthesis were calculated in SAS and the Waller-Duncan procedure used for

mean separation. Terms of the model were judged to be significant or nonsignificant based on a









comparison ofF values at P < 0.05. Each of the five experiments utilized split-plot designs with

temperature treatment as the main-plot and cultivar as the sub-plot. Within the plots, a

randomized complete block design was used. There were no significant effects caused by these

blocks in any of the experiments, so data were pooled for each treatment.

Experiment 1

This experiment utilized 19 cultivars that are currently used for commercial poinsettia

production. The large number of cultivars was used to determine the range of heat delay in

modern poinsettia cultivars. Rooted cuttings of each of 19 cultivars were planted on 2 Sept.

2004, pinched on 15 Sept. 2004, and night interruption lighting was used until 30 Sept. 2004.

This lights out date is typical for commercial poinsettia production. At this time, temperature

treatments were imposed and all plants were shifted to natural photoperiods (Table 2-1). Plants

were grown with the high or low temperature regime from 30 Sept. 2004 through 28 Oct. 2004.

Following the treatment period all plants were grown to anthesis at the moderate temperature

regime.

Experiment 2

Experiment 2 utilized only two cultivars to allow a more precise investigation of floral

initiation. 'Autumn Red' is an irradiation-induced early flowering time mutant from 'Red

Velvet'. Rooted cuttings were planted on 18 Aug. 2005 and pinched to five nodes on 2 Sept.

2005. Night interruption lighting was discontinued at pinching to allow true natural day floral

initiation in both cultivars. High or low temperature treatments were imposed from 8 Sept. 2005

through 27 Oct. 2005. Following this treatment period, all remaining plants were grown to

anthesis at the moderate temperature regime.









Experiment 3

This experiment utilized a second pair of closely related cultivars: 'Prestige Early Red',

and 'Prestige Red' in addition to 'Autumn Red' and 'Red Velvet'. Freedom Red' was also

included because it a commercially important cultivar in warm climate production. Rooted

cuttings of each cultivar were planted on 18 Aug. 2006 and pinched to five nodes on 1 Sept.

2006. Plants were exposed to the high or low temperature regime from 8 Sept. 2006 through 27

Oct. 2006. As in the previous experiment, night interruption lighting was discontinued at

pinching and the moderate temperature regime was used from the termination of temperature

treatments through anthesis.

Experiment 4

In addition to the 5 cultivars used in Expt. 3, this experiment included 'Freedom Early

Red' which is an early flowering time mutant from 'Freedom Red'. Rooted cuttings of the 6

cultivars were planted on 23 Aug. 2007 and pinched to five nodes on 1 Sept. 2007 at which time

night interruption lighting was discontinued. Plants were exposed to either the high or low

temperature treatment from 9 Sept. 2007 through 28 Oct. 2007. All remaining plants were

grown to anthesis under the moderate temperature regime.

Results and Discussion

Experiment 1

Delays in anthesis between plants in the low and high temperature treatments ranged from

0 to 19 days (Table 2-2). Analysis of variance revealed that the effects of temperature treatment,

cultivar, and the interaction of temperature and cultivar on the number of days from pinching to

first color, visible bud, and anthesis were significant at the 0.05 level. In general, the later a

cultivar reached anthesis under low temperatures, the greater the amount of delay observed with

high temperatures. Normally late flowering or 'late season' cultivars 'Prestige Red' and









'Success Red' flowered 15 and 18 days later, respectively, when exposed to 28 days of high

temperatures (Table 2-2). However, the high temperatures did not cause a delay in flowering in

the naturally early flowering cultivars 'Early Freedom Red' and 'Orion'. Wieland (1998)

observed that early flowering cultivar 'Freedom Red' had a shorter critical night length for floral

initiation than the later flowering cultivar 'Success Red'. This difference in the critical night

length causes a particular cultivar to be later flowering than another in natural photoperiod

conditions.

The moderate and late flowering cultivars also showed significant delay in time of bract

color formation due to the high temperature treatments. The development of bract coloration is

vital to produce a plant of acceptable quality. This effect is likely due to a delay and overall

reduction in anthocyanin accumulation as observed previously in poinsettias under elevated

temperatures (Marousky, 1968).

The high temperatures did not cause a delay in flowering for the earliest flowering

cultivars. This lack of delay may have been due to the natural night lengths at start of treatments

being long enough for floral initiation of plants in both the high and low temperatures soon after

start of treatments. These results are consistent with the observed delay in flowering reported by

commercial growers in Florida utilizing the lights-out method for flowering control (Barrett,

2003).

Experiment 2

Experiment 2 utilized natural-day conditions from planting through anthesis in contrast to

the lights-out method in Expt. 1. For this first experiment utilizing the natural-day model, only

two cultivars were used: 'Red Velvet' and 'Autumn Red' which is an irradiation induced

flowering time mutant of 'Red Velvet' (personal communication, Ruth Kobayashi, Paul Ecke

Ranch). Based on information from the breeder (Paul Ecke Ranch Poinsettia Fast Fax, 1999)









'Autumn Red' is expected to flower about three weeks before 'Red Velvet' with natural-days.

Personal communication with commercial growers indicated that 'Red Velvet' shows significant

heat delay in the typical lights-out production schedule while 'Autumn Red' does not. So, this

experiment is the first test of the critical night-length hypothesis outlined earlier.

Analysis of variance revealed that the effects of temperature treatment, cultivar, and the

interaction of temperature and cultivar on the number of days from pinching to T50 initiation,

first color, visible bud, and anthesis were all significant at the 0.05 level (Tables 2-3 to 2-6).

Both 'Autumn Red' and 'Red Velvet' in the low temperature treatment reached anthesis within

the range of dates provided by the breeder as the expected market ready date. In 'Autumn Red'

floral initiation was 14.4 days later and anthesis was 16.6 days later in the high temperature

treatment compared to the low temperature treatment. In 'Red Velvet' floral initiation was 12.3

days later and anthesis was 12.2 days later in the high temperature treatment than the low

temperature treatment. The delays in first color and visible bud also correspond to the delay in

floral initiation. This indicates that delay in floral initiation is in fact the cause of the observed

delays in flowering. These results indicate that early flowering cultivars such as 'Autumn Red'

are subject to heat delay in floral initiation as well as the naturally later flowering cultivars such

as 'Red Velvet' and 'Prestige Red'.

To address the issue of adjustment in critical night lengths, the night lengths were

calculated from civil twilight times for each floral initiation date (Table 2-6). In the case of

'Autumn Red' the 14.4 day delay in T50 floral initiation corresponds to 26 additional minutes of

dark on the date of T50 floral initiation in the high temperature treatment compared to the low

temperature treatment. The T50 date for the low temperature treatment is 25 Sept. 2005 and the

civil twilight dark period on this date is 11 h 10 min compared to the T50 date of 10 Oct. 2005









for the high temperature treatment when the night length is 11 h 36 min. For 'Red Velvet' the

12.3 day delay in T50 floral initiation (4 Oct. 2005 to 16 Oct. 2005) translates to a 20 minute

difference in civil twilight dark period. The fact that the changes in night length at initiation

between the temperature treatments were very similar among closely related cultivars indicates

that this response may be linked to shared genetic traits. To further explore this possibility,

Expts. 3 and 4 utilize additional pairs of closely related cultivars.

Experiment 3

Five cultivars were used in this experiment; three early flowering cultivars ('Autumn Red',

'Freedom Red' and 'Prestige Early Red') and two later flowering cultivars ('Red Velvet' and

'Prestige Red'). As implied by the cultivar epithets, 'Prestige Early Red' is an early flowering

time mutant from 'Prestige Red'. In addition to 'Autumn Red' and 'Red Velvet', 'Freedom Red'

was included in this experiment. 'Freedom Red' has been one of the most widely produced early

flowering poinsettia cultivars in the southern U. S. for over 10 years (personal communication,

Paul Ecke Ranch). Analysis of variance revealed that the effects of temperature treatment,

cultivar, and the interaction of temperature and cultivar on the number of days from pinching to

T50 initiation, first color, visible bud, and anthesis were all significant at the 0.05 level (Tables

2-7 to 2-9).

Delay in T50 floral initiation ranged from 12.5 to 20.5 days (Table 2-8 and 2-13) and delay

in anthesis ranged from 7.0 to 22.7 days (Table 2-7). For each individual cultivar the number of

days delay in initiation predicted the number of days delay in anthesis between the high and low

temperature treatment to within + 4 days. For example 'Prestige Red' plants reached T50 floral

initiation 20.5 days later and anthesis 22.3 days later with the high temperature treatment

compared to those plants exposed to the low temperature regime. This correlation indicates that

the delay in anthesis is a result of a delay in floral initiation.









As in Expt. 2, the night length at T50 initiation was calculated from the civil twilight times

provided by the US Naval Observatory (Table 2-9). The change in night lengths at T50 initiation

was very similar within the pairs of closely related cultivars but not between the pairs This

change in 'Autumn Red' and 'Red Velvet' was 21 and 25 minutes, respectively which is very

similar to the change in critical night length observed in these two cultivars in Expt. 2 (20 and 26

minutes, respectively). The change in night length for 'Prestige Early Red' and 'Prestige Red' at

T50 initiation was 32 minutes for both cultivars. These finding support the hypothesis that

change in critical night length in response to supraoptimal temperatures is cultivar specific but

similar in closely related cultivars.

Experiment 4

Experiment 4 utilized the five cultivars from Expt. 3 with the addition of 'Freedom Early

Red'. This cultivar is an early flowering time mutation of 'Freedom Red'. Analysis of variance

revealed that the effects of temperature treatment, cultivar, and the interaction of temperature and

cultivar on the number of days from pinching to T50 initiation, first color, visible bud, and

anthesis were all significant at the 0.05 level (Tables 2-10 to 2-12).

The delay in T50 floral initiation ranged from 9.7 to 17.0 days (Table 2-11 and 2-14) and

the delay in anthesis ranged from 5.8 to 16.8 days (Table 2-10). Again, the delay in T50

initiation reflects the number of days delay in anthesis between the high and low temperature

treatments within +4 days. The consistency of this correlation between experiments conducted at

different times conclusively indicates that the delay in anthesis is due to delay in floral initiation

and not development.

As in the previous two experiments, the night lengths at T50 floral initiation were

calculated for each cultivar. Again, the differences in night lengths between the high and low

temperature treatments were similar within the pairs of closely related cultivars but not between









the pairs. For 'Red Velvet and 'Autumn Red' the difference in civil twilight night lengths at T50

initiation between the high and low temperature treatment was 26 and 25 minutes, respectively

(Table 2-12). For 'Prestige Red' and 'Prestige Early Red' the difference in night lengths was 32

and 29 minutes, respectively and 14 and 11 minutes for 'Freedom Red' and 'Freedom Early

Red', respectively. The data show that the change in critical night length with supraoptimal

temperatures is similar in closely related cultivars but varies between unrelated cultivars.

Conclusions

The results of these studies showed that there is a wide range of heat delay sensitivity in

poinsettia cultivars. In each case where the floral initiation date was recorded this date

forecasted the date of anthesis which indicates that the observed delay in flowering is a result of

a delay in floral initiation and not development. However, the rate of floral development does

vary between cultivars. For example, regardless of temperature in 'Freedom Red' and its sport

'Freedom Early Red', development from T50 initiation to anthesis took place in 403 days while

in 'Prestige Red' and 'Prestige Early Red' floral development took 462 days.

The heat delay response is cultivar specific but very similar in closely related cultivars. Of

the three pairs of cultivars studied 'Freedom Early Red' and 'Freedom Red' showed the least

delay in floral initiation at high temperatures, 'Prestige Early Red' and 'Prestige Red' delayed

the most and 'Red Velvet' and Autumn Red' were intermediate. In each of the pairs, one

cultivar is the parental form and the other is a flowering time sport. With the industry standard

lights-out production scheduling 'Autumn Red' does not exhibit heat delay while its parental

form, 'Red Velvet' does. So, 'Autumn Red' was popularly considered to be less heat delay

sensitive than 'Red Velvet'. However, these observations are the result of the lights-out

scheduling used to produce these crops rather than a difference in heat sensitivity. The night

length at the lights-out date is long enough to allow quick floral initiation even if the critical









night length is adjusted by supraoptimal temperatures in an early cultivar like 'Autumn Red', but

not the later flowering parental form 'Red Velvet'. In natural day-length conditions it is clear

that the heat delay sensitivity is conserved between the flowering time mutant and parental form.

The heat delay sensitivity is conserved in each set of flowering time sports, indicating that these

genotypes arose from mutations altering the critical night length for flowering and not heat

sensitivity. The degree of heat delay measured as either the days of delay in floral initiation or

the minutes of increase in critical night length at high temperatures support the conclusion that

closely related cultivars have similar heat delay sensitivity.

It is important for growers to understand how their poinsettia crops respond to temperature

to allow precise scheduling regardless of year to year variations in weather. In each of the three

years that 'Autumn Red' and 'Red Velvet' were grown in natural-day conditions, the degree of

heat delay was remarkably similar while the actual dates of the developmental stages varied.

The reason for this variation is not completely clear since the astronomically observed

photoperiod on any given date is nearly identical year to year. However, studies on plant

perception of natural day length offer a possible solution. It has been documented that

atmospheric conditions such as cloud cover at dawn and dusk can affect the exact timing of the

delineation between natural dark and light sensation by plants (Vince-Prue and Heath, 1983).

There is some antidotal evidence for such effects on poinsettia crops. Poinsettia growers have

reported abnormally early poinsettia flowering when hurricanes occur around the time of

initiation (J. Barrett, personal communication). It was assumed that this was the result of cooler

temperatures during the overcast days around the storm, but it possible that what actually

occurred in these situations is the result of a shift in the time that plants are sensing dark. This is

an extreme example with extreme consequences, but it is possible that the years in which there









are more evening and morning cloud cover during the period when the plants are sensing short-

days and undergoing floral initiation, that initiation may occur sooner than years with more clear

days. This would be a fascinating avenue for future study of the nuances of photoperiodic

flowering.

In addition to the delay in inflorescence development in Expts. 2, 3 and 4, significant

delays in first bract coloration were recorded for plants of each cultivar in the high temperature

treatment compared to the low temperature treatment. It is important to note that color

development in poinsettia bracts parallel but separate from the floral development process. Bract

color development is of course vital to producing a marketable crop. Ambient temperature and

photoperiod effect bract coloration (Miller and Kiplinger, 1962). Marousky (1968) reported that

night temperatures above 210C delayed and reduced final anthocyanin accumulation in poinsettia

bracts. Additional studies on the bract coloration process would also be an interesting choice for

future research applicable to poinsettia production in warm climates.

In conclusion, the results of this series of experiments show that the delay in flowering at

high temperatures is the result of a delay in floral initiation due to adjustments of the critical

night length. Moreover, the adjustment in critical night length that determines the heat delay

sensitivity is cultivar specific and genetically linked so that closely related cultivars exhibit

similar differences in critical night length between high and low temperatures. Since there is a

range of heat delay sensitivity among current poinsettia cultivars, it may be possible through

breeding efforts to produce increasingly heat insensitive cultivars with the goal of eventually

eliminating problematic heat delay from poinsettia as has been accomplished with

chrysanthemum.









Table 2-1. Night length during Expts. 1-4 calculated from civil twilight at 29040'N latitude
(United States Naval Observatory, 2007).
Night lengths (h, min)
Date
Year 22 Sept. 29 Sept 10 Oct. 13 Oct. 20 Oct. 27 Oct. 3 Nov. 10 Nov.
2004 11,05 11,17 11,30 11,42 11,53 12,04 12,14 12,24
2005 11,04 11,16 11,32 11,40 11,52 12,02 12,13 12,23
2006 11,04 11,16 11,32 11,40 11,52 12,02 12,13 12,23
2007 11,05 11,17 11,30 11,42 11,53 12,04 12,14 12,24

Table 2-2. Number of days to first color, visible bud, and anthesis from the onset of natural days
(30 Sept. 2004) with high (292C day /242C night) or low (242C
day/21+2C night) temperature treatments. Analysis of variance revealed that the
effects of temperature treatment, cultivar, and the interaction of temperature and
cultivar on the number of days from the onset of natural days to first color, visible
bud, and anthesis were significant at the 0.05 level so the sub effects are shown here
(Expt. 1).
Days to first color Days to visible bud Days to anthesis
24/210C
Early Freedom Red 15.2 gZ 27.5 h 50.0 j
Freedom Red 24.6 e 28.2 gh 51.5 ij
Orion 21.4 f 29.8 gh 50.3 j
Autumn Red 22.4 f 29.4 gh 53.3 hi
Velveteen 22.0 f 31.7 fg 55.9 gh
Christmas Feelings 25.3 e 35.2 e 61.4 ef
Mars 29.6 d 35.8 e 62.6 ef
Red Velvet 30.3 cd 36.5 e 62.3 ef
Silent Night 25.9 e 36.6 e 62.7 ef
Prestige Red 36.3 b 38.2 de 63.5 e
Success Red 38.6 b 40.6 d 66.8 d
29/240C
Early Freedom Red 15.0 g 28.5 h 49.2 j
Freedom Red 25.6 e 30.6 fg 54.6 gh
Orion 22.3 f 30.3 fg 53.8 hi
Autumn Red 23.1 ef 32.1 f 56.2 g
Velveteen 27.8 de 36.7 e 60.8 f
Christmas Feelings 32.9 c 44.8 c 73.2 c
Mars 38.4 b 45.3 c 69.5 d
Red Velvet 44.6 a 50.7 b 78.2 b
Silent Night 32.2 c 43.9 c 70.9 cd
Prestige Red 46.1 a 53.4 a 78.0 b
Success Red 45.8 a 55.7 a 84.2 a
ZMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)










Table 2-3. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2005)
with high (29020C day /24020C night) or low (24020C day/21020C night)
temperature treatments. Analysis of variance revealed that the effects of temperature
treatment, cultivar, and the interaction of temperature and cultivar on the number of
days from pinching to T50 initiation, first color, visible bud, and anthesis were
significant at the 0.05 level (Expt. 2).
Days to first color Days to visible bud Days to anthesis
24/210C
Autumn Red 38.3 cz 46.8 c 67.8 c
Red Velvet 57.7 b 61.3 b 87.3 b
29/240C
Autumn Red 55.6 b 59.8 b 85.4 b
Red Velvet 70.3 a 75.7 a 99.5 a
ZMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)

Table 2-4. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2005) with
high (29020C day /24020C night) or low (24020C day/21020C night) temperature
treatments (Expt. 2).
Days to T50 Initiation 95% Confidence Interval
24/210C
Autumn Red 24.3 22.8 25.8
Red Velvet 33.6 32.5 34.7
29/240C
Autumn Red 39.2 38.0 40.4
Red Velvet 45.9 44.5 47.4
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 2-5. Pairwise comparison of T50 values in Table 2-4 (Expt. 2).
24/210C 29/240C
Autumn Red Red Velvet Autumn Red Red Velvet
24/210C
Autumn Red
Red Velvet *
29/240C
Autumn Red *
Red Velvet *
NS, Nonsignificant and significant at P=.05, respectively









Table 2-6. Natural-day night lengths calculated for the initiation dates of 'Autumn Red' and Red
Velvet' with high (292C day /242C night) or low (242C day/21+2C
night) temperature treatments from civil twilight times (US Naval Observatory)
(Expt. 2).
T50 initiation date Night length (h, min)
24/210C
Autumn Red 25 Sept. 2005 11, 10
Red Velvet 4 Oct. 2005 11,26
29/240C
Autumn Red 10 Oct. 2005 11,36
Red Velvet 16 Oct. 2005 11,46

Table 2-7. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2006)
for high (292C day /242C night) and low (242C day/21+2C night)
temperature treatments. Analysis of variance revealed that the effects of temperature
treatment, cultivar, and the interaction of temperature and cultivar on the number of
days from pinching to T50 initiation, first color, visible bud, and anthesis were
significant at the 0.05 level (Expt. 3).
Days to first color Days to visible bud Days to anthesis
24/210C
Autumn Red 35.8 f 43.0 g 63.7 g
Red Velvet 49.5 d 53.8 e 78.2 d
Prestige Early Red 46.7 d 47.2 f 67.5 f
Prestige Red 57.5 c 56.8 d 79.8 d
Freedom Red 46.0 d 49.3 f 71.8 e
29/240C
Autumn Red 39.8 e 49.0 f 70.7 ef
Red Velvet 56.9 c 69.8 b 92.3 b
Prestige Early Red 63.5 b 65.6 c 90.3 b
Prestige Red 72.3 a 80.3 a 102.2 a
Freedom Red 58.5 c 66.2 c 87.5 c
ZMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)









Table 2-8. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2006) with
high (292C day /242C night) or low (242C day/21+2C night) temperature
treatments (Expt. 3).
Days to T50 Initiation 95% Confidence Interval


24/210C
Autumn Red
Red Velvet
Prestige Early Red
Prestige Red
Freedom Red
29/240C


24.5
35.8
26.2
37.2
30.0


23.7
34.8
25.1
35.6
29.7


Autumn Red 37.0
Red Velvet 50.8
Prestige Early Red 45.5
Prestige Red 57.5
Freedom Red 48.7
zT50 is the predicted value for the number of days to
Nonlin with the equation y=(100/1+e(-k*(x-b)).


25.3
36.8
27.2
38.7
30.3


35.3 38.8
50.0 51.6
44.1 46.8
56.1 58.9
45.6 51.8
50% initiation determined by SAS Proc


Table 2-9. Natural-day night lengths calculated for initiation dates with high (292C day
/242C night) or low (242C day/21+2C night) temperature treatments from
civil twilight times (US Naval Observatory) (Expt. 3).
T50 initiation date Night length (h, min)


24/210C
Autumn Red
Red Velvet
Prestige Early Red
Prestige Red
Freedom Red
29/240C
Autumn Red
Red Velvet
Prestige Early Red
Prestige Red
Freedom Red


26 Sept. 2006
7 Oct. 2006
27 Sept. 2006
8 Oct. 2006
1 Oct. 2006

8 Oct. 2006
22 Oct. 2006
16 Oct. 2006
28 Oct. 2006
20 Oct. 2006


11, 11
11,30
11, 13
11,32
11,20

11,32
11, 55
11,45
12, 04
11,52









Table 2-10. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2007)
with high (292C day /242C night) or low (242C day/21+2C night)
temperature treatments. Analysis of variance revealed that the effects of temperature
treatment, cultivar, and the interaction of temperature and cultivar on the number of
days from pinching to T50 initiation, first color, visible bud, and anthesis were
significant at the 0.05 level (Expt. 4).
Days to first color Days to visible bud Days to anthesis
24/210C
Autumn Red 30.8 iz 41.5 h 64.8 g
Red Velvet 60.7 d 64.7 c 89.8 c
Prestige Early Red 54.5 e 50.8 g 74.8 f
Prestige Red 62.1 cd 64.0 c 87.2 cd
Freedom Early Red 37.7 h 51.8 g 74.5 f
Freedom Red 48.5 f 52.2 g 75.7 f
29/240C
Autumn Red 37.8 h 54.0 f 76.3 f
Red Velvet 69.3 b 76.8 b 98.8 b
Prestige Early Red 63.3 c 66.7c 88.3c
Prestige Red 78.3 a 82.7 a 103.2 a
Freedom Early Red 41.8 g 58.2 e 79.5 e
Freedom Red 55.7 e 63.3 d 84.8 d
zMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)

Table 2-11. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2007) with
high (292C day /242C night) or low (242C day/21+2C night) temperature
treatments (Expt. 4).
Days to T50 initiation 95% Confidence interval
24/210C
Autumn Red 23.6 21.7 25.6
Red Velvet 42.3 40.7 43.8
Prestige Early Red 27.7 26.2 29.3
Prestige Red 42.2 41.3 43.0
Freedom Early Red 31.8 31.0 32.7
Freedom Red 32.5 31.7 33.3
29/240C
Autumn Red 36.2 35.3 37.0
Red Velvet 56.5 55.7 57.3
Prestige Early Red 43.2 42.1 44.3
Prestige Red 59.2 58.1 60.3
Freedom Early Red 41.5 40.7 42.3
Freedom Red 44.7 43.6 45.8
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).









Table 2-12. Natural-day night lengths for initiation dates with high (29020C day /24020C
night) or low (24020C day/21020C night) temperature treatments calculated from
civil twilight times (US Naval Observatory) (Expt. 4).
T50 initiation date Night length (h, min)


24/210C
Autumn Red
Red Velvet
Prestige Early Red
Prestige Red
Freedom Early Red
Freedom Red
29/240C
Autumn Red
Red Velvet
Prestige Early Red
Prestige Red
Freedom Early Red
Freedom Red


24 Sept. 2007
13 Oct. 2007
28 Sept. 2007
13 Oct. 2007
2 Oct. 2007
3 Oct. 2007

7 Oct. 2007
27 Oct. 2007
14 Oct. 2007
30 Oct. 2007
12 Oct. 2007
15 Oct. 2007


11,07
11,36
11, 14
11,36
11,23
11,25

11,32
12, 02
11,37
12, 08
11,34
11,39









Table 2-13. Pairwise comparison of T50 values in Table 2-8 (Expt. 3).
Autumn Red Red Velvet Prestige Early Red Prestige Red Freedom Red
24/210C 29/240C 24/210C 29/240C 24/210C 29/240C 24/210C 29/240C 24/210C 29/240C
Autumn 24/210C
Red 29/240C *
Red 24/210C NS
Velvet 29/240C *
Prestige 24/210C NS *
Early Red 29/240C *
Prestige 24/210C NS NS *
Red 29/240C *
Freedom 24/210C *
Red 29/240C NS *
NS, Nonsignificant and significant at P=.05, respectively










Table 2-14.


Pairwise comparison of T50 values in Table 2-11 (Expt. 4).


Autumn Red Red Velvet Prestige Early Red Prestige Red Freedom Early Red Freedom Red
24/210C 29/240C 24/210C 29/240C 24/210C 29/240C 24/210C 29/240C 24/210C 29/240C 24/210C 29/240C
Autumn 24/210C
Red 29/240C *
Red Velvet 24/210C *
29/240C *
Prestige 24/210C *
Early Red 29/240C NS *
Prestige 24/210C NS NS
Red 29/240C *
Freedom 24/210C *
Early Red 29/240C NS NS NS *
Freedom 24/210C NS *
Red 29/240C NS NS NS *
NS, Nonsignificant and significant at P=.05, respectively









CHAPTER 3
TIMING AND DURATION OF HIGH TEMPERATURE EXPOSURE

Introduction

In the poinsettia heat delay problem, timing and duration of the high temperature episode

during development have not been investigated in detail. Previous studies found that sustained

supraoptimal temperatures (over 260C for 28 days) around the time of floral initiation caused

delays in observed flowering of up to 20 days (Barrett, 2003; Schnelle, et al., 2005). However,

Miller and Kiplinger (1962) reported that sustained elevated temperatures later in the floral

development process accelerated floral development. Many of the studies that uncovered the

heat-delay response utilized fixed temperatures throughout crop development and those which

used varying durations of high temperatures were in concert with varying durations of short days

(Langhans and Miller, 1960; Miller and Kiplinger, 1962). Since most modern commercial

poinsettia production is conducted under natural photoperiods and temperatures can vary widely

through the production period, a more complete understanding of the effects of timing and

duration of high temperature incidence in the natural photoperiod flowering process is needed.

An understanding of which stages of reproductive development are sensitive to high

temperatures and the duration of high temperature exposure necessary to produce a delay in

flowering will allow more precise crop scheduling.

The impact of timing and duration of high temperature exposure has been addressed in

greater detail with heat-sensitive chrysanthemum cultivars, but again these studies utilized

controlled photoperiods (Cockshull and Kofranek, 1993; Karlsson, 1989; Whealy et al., 1987).

However, since heat sensitive chrysanthemum cultivars show very similar high temperature

responses to poinsettia, and more precise data is available, these studies were used to aid in the

design of this poinsettia study. Whealy et al. (1987) exposed chrysanthemum 'Orange Bowl' to









fourteen different high temperature treatments. These treatments consisted of 2, 4, 6, 8, or 10

weeks of high temperatures (300C day /260C night) beginning either the first, third, fifth, or

seventh week following the onset of short-days. The plants were grown under optimum

development temperatures all other times (220C day /18C night). Treatments beginning the first

or third week of short-days had the greatest effect on the number of days to open flower. Two

weeks of high temperatures beginning the first week of short-days had no effect on time to

flower, but two weeks of high temperatures beginning the third week caused about one week of

delay in flowering time. The treatment with six weeks of high temperatures beginning the first

week produced the same delay in flowering time as a four week treatment beginning the third

week. These results indicate that the floral initiation process may not have begun until two

weeks following the onset of short-days. Two, four or six weeks of high temperatures beginning

the fifth week caused only a small delay in flowering time (three days or less). Finally, high

temperatures applied for two or four weeks beginning the seventh week of short-days had no

effect on days to open flower. These results clearly indicate that some stages of reproductive

development in chrysanthemum are sensitive to high temperatures while others are not.

However, in other chrysanthemum cultivars this pattern does not hold. Karlsson et al. (1989)

found that in cultivar Bright Golden Anne a temperature treatment of 300C significantly delayed

development during all stages of floral development compared to plants grown at 200C.

Previous studies utilized controlled photoperiod treatments primarily as a technique to

reduce experimental variability. To more clearly understand the cause of heat delay in modern

natural-day poinsettia production it is necessary to determine the effects of timing and duration

of high temperature exposure in photoperiod and temperature conditions that mimic those of

commercial cultivation. The following series of studies was designed to address this need.









Given the variability in the chrysanthemum studies, high temperature effects on all stages of

floral initiation and development were investigated. Three experiments were conducted. The

first used controlled photoperiods and the other two natural photoperiods. Single cultivars were

used for each experiment as the number of treatments was large enough to make a cultivar

factorial impractical. Also, the results of previous natural photoperiod studies indicate that all

poinsettia cultivars tested exhibit a very similar pattern in their response to high temperatures so

multiple cultivars were deemed unnecessary. For the natural day experiments 'Autumn Red'

was selected as it shows average heat delay sensitivity (Chapter 2).

Materials and Methods

Consistent cultural practices were used for each experiment. All three experiments were

conducted in glass-glazed greenhouses located in Gainesville, Florida (29040'N latitude)

equipped with fan and pad cooling. Rooted cuttings were received from Paul Ecke Ranch

(Encinitas, CA) and planted in 105 cm3 pots containing Fafard 2 growing medium (Fafard,

Anderson, S.C.), which consists of 6.5 sphagnum peat: 2 perlite : 1.5 vermiculite (v/v).

Incandescent night interruption lighting from 22:00 through 02:00 was applied from

planting to prevent premature floral initiation. Following the termination of night interruption

lighting, plants were exposed to natural photoperiodic conditions in Expts. 2 and 3 and 12-hour

dark periods in Expt. 1. One week after planting, all cuttings were pinched to five nodes. For

the first eight weeks following transplant, plants were fertilized at each irrigation with Scotts

(The Scotts Company, LLC., Marysville, OH) 20N-4.4P-16K supplying 300 mg-L-1 Nitrogen.

From that point through anthesis fertilization at each irrigation was with Scotts (The Scotts

Company, LLC., Marysville, OH) 15N-2.2P-8K supplying 250 mg-L-1 Nitrogen. Plant growth

retardants were not used.









All three experiments utilized the same temperature treatments. The daytime temperature

regime was initiated daily at 07:00 and the nighttime temperature regime at 19:00. Plants were

maintained at 242C day/21+2C night (low temperature treatment) except when exposed to

the high temperature treatment (292C day /242C night).

Data Collection

Each of the three experiments utilized a randomized complete block design with three

blocks and four pots per replication. Those treatments for which T50 dates were calculated

included an additional four pots per replication that were used for destructive harvest of shoot

tips. There was no significant effect of replication in any of the experiments, so data were

pooled for each treatment. The dates of first visible bract color (first color), unfolding of the

primary bracts to reveal the primary cyathium (visible bud), and anther dehiscence anthesiss)

were recorded for those plants not used for shoot tip sampling. Average days for first color,

visible bud, and anthesis were calculated in SAS (SAS Institute, Cary, NC) and the Waller-

Duncan procedure used for mean separation. Terms of the model were judged to be significant or

nonsignificant and included in the final model based on a comparison ofF values at P < 0.05.

T50 floral initiation dates were calculated for each treatment in Expts. 2 and 3 using the method

described in Chapter 2.

Experiment 1

Rooted cuttings of poinsettia 'Prestige Red' were planted on 8 Feb. 2005 and pinched on

15 Feb. 2005. Plants were shifted to 12-hour dark periods on 1 March 2005 and high

temperature treatments were applied for the designated time periods (Table 3-1). Expt. 1 was

designed to be a preliminary study investigating the response of poinsettia to 7 or 21 days of high

temperature exposure at different stages between the onset of short days through early floral









development. This experiment utilized a fixed photoperiod as the combination of 12-hour days

and high temperatures have been shown to cause heat delay (Chapter 2).

Experiments 2 and 3

Rooted cuttings of Poinsettia 'Autumn Red' were planting on 18 Aug. 2006 (Expt. 2) or 23

Aug. 2007 (Expt. 3) and pinched on 1 Sept. 2006 (Expt. 2) or 1 Sept. 2007 (Expt. 3). Night

interruption lighting was discontinued at pinching and which time all plants were moved to

natural photoperiods for the remainder of the experiments. The high temperature treatments

were applied for the designated time periods (Tables 3-2; 3-6). These two experiments were

designed to more closely simulate the conditions present in poinsettia production in warm

climates. The high temperature treatments were applied for 14 to 35 days at various stages from

pinching through anthesis to uncover the effects of varying durations of high temperature

exposure throughout the crop production cycle.

Results and Discussion

Experiment 1

Analysis of variance revealed that the effects of temperature treatment on the number of

days from pinching to visible bud and anthesis were significant at the 0.05 level. The Waller-

Duncan mean separation procedure was used to determine which treatment means are

significantly different (Table 3-1). Plants in Treatment 1, maintained at the low temperatures,

reached anthesis an average of 64 days after the onset of 12-hour dark periods. Plants in

Treatment 2 were exposed to high temperatures for 28 days beginning at the onset of 12-hour

dark periods. This treatment was a heat delay control based on results of previous experiments

and anthesis in Treatment 2 plants occurred 14 days later than in Treatment 1 plants. Treatments

3, 4 and 5 were each exposed to 7 days of high temperatures starting at day 1, 7 or 14,

respectively, and the time to visible bud and time to anthesis were not significantly different for









plants in these treatments compared to the low temperature control plants. This indicates that

one week of high temperature exposure is not sufficient to produce a significant delay in

flowering time.

High temperatures in Treatment 6 were from day 7 to 28 and plants reached visible bud

and anthesis in 54 and 76 days, respectively. These results are similar to plants in the heat delay

control (Treatment 2) which were exposed to the high temperature regime from days 1 to 28.

This indicates that temperatures in the first week after the onset of short-days did not contribute

to heat delay.

Treatments 7 and 8 also received 21 days of high temperatures during the first 28 days

after start of short days, like Treatment 6, except that high temperature exposure was interrupted

by 7 days of cooler temperatures. These treatments were included as high temperature exposure

in a commercial greenhouse situation would not necessarily be contiguous. Visible bud and

anthesis in both Treatments 7 and 8 plants were delayed compared to Treatment 1, but not

delayed to the extent of plants in Treatment 2. The number of days to visible bud and anthesis

were not significantly different between plants in Treatments 7 and 8. The data from Treatments

7 and 8 support the indication from Treatment 6 that the first 7 days after the start of short-days

have little impact on heat delay. These results also indicate that there is a critical period for high

temperature sensitivity in the floral initiation and development process and that the magnitude of

the delay in flowering may be linked to the duration of high temperature exposure. The next two

experiments investigated this possibility in more detail.

Experiment 2

Expt. 2 utilized natural photoperiods and included data on T50 floral initiation for

Treatments 1 to 6 (Table 3-2). T50 initiation data were not taken for the other treatments as the

high temperature exposure designated by these treatments occurred after floral initiation. Since









it is not possible to determine the exact date of the onset of short-days with natural photoperiods

as discussed in Chapter 2, the number of days to initiation, first color, visible bud, and anthesis

are calculated from the date on which all plants were pinched (1 Sept.). Also the treatments are

described by day numbers starting from the date of pinch with 1 Sept. 2006 as Day 1.

The ten treatments in this experiment consisted of either 14 or 28 days of high

temperatures at various stages of the floral initiation and development. Treatment 1 was a

control treatment which was not exposed to high temperatures. Treatment 2 was designed as a

heat delay control with 28 days of high temperatures which induced heat delay in every cultivar

tested in the previous experiments (Chapter 2). The chronological timing of the treatments was

determined with natural-day flowering data from the two previous fall seasons for 'Autumn

Red'. The average T50 initiation date (25 Sept.) and the average anthesis date (12 Nov) were

used as the predicted initiation and anthesis dates for this and the subsequent experiment. The

treatments were designed to expose the plants to high temperatures for a portion of the period

beginning 14 days before predicted T50 initiation though the predicted anthesis date. For

example Treatment 4 was designed to give the plants 14 days of high temperature exposure for

the 14 days prior to expected T50 floral initiation which is Days 11 to 25 (11 to 25 Sept.).

Analysis of variance revealed that the effects of temperature treatment on the number of

days from pinching to T50 initiation, first color, visible bud, and anthesis were significant at the

0.05 level and the Waller-Duncan mean separation procedure revealed which treatment means

were significantly different (Table 3-2 and 3-4).

The low temperature control (Treatment 1) reached T50 floral initiation in 25.5 days

(Table 3-3), visible bud in 43.9 days, and anthesis in 65.9 days (Table 3-2). The heat delay

control (Treatment 2) reached T50 initiation in 36.8 days, visible bud in 53.4 days, and anthesis









in 73.9 days. This treatment received high temperatures from Days 11 through 39 which is 14

days before through 14 days after the expected low temperature initiation date for 'Autumn Red'.

The parallel in the delay in initiation, visible bud, and anthesis indicates that the delay in

flowering is the result of a delay in floral initiation which is most likely a result of adjustment in

critical night length as discussed in Chapter 2.

Treatments 4 through 6 each received 14 days of high temperatures around the time of

expected T50 initiation (Table 3-3). Plants in Treatments 4 and 5 reached T50 floral initiation in

about 30 days (5 days later than treatment 1) which translated to a 4-6 day delay in anthesis

compared to Treatment 1 plants (Table 3-2). For these two treatments the delays in both

initiation and anthesis compared to treatment 1 were about half of that of treatment 2; 4-6 days

versus 11 days. Plants in Treatment 6 reached T50 floral initiation in 27 days which is not

significantly later than the low temperature control. Plants in this treatment reached anthesis

about 2.5 days later than the control which is significant statistically but would not impact the

marketability of poinsettia crop.

Treatments 7 through 10 were exposed to 14 days of high temperatures after the expected

floral initiation date to determine if high temperatures later in production affect the rate of floral

development, so initiation data was not deemed necessary. For Treatments 7, 8, and 9 there are

no significant differences in the time to visible bud or anthesis compared to the low temperature

control. Treatment 10 received the high temperature treatment between the time of visible bud

and anthesis. Plants in this treatment reached visible bud in 34.4 days, which is not significantly

different from the control plants. However, Treatment 10 plants reached anthesis about 3 days

earlier than the control plants which is significant but again would not impact the marketability

of the crop. These data support previous studies that have found high temperatures during the









later stages of poinsettia floral development can accelerate the process to some extent (Miller and

Kiplinger, 1962). Imposing high temperatures late in a poinsettia crop to accelerate development

would not be an acceptable technique to mitigate the heat delay effect as high temperatures have

been shown to inhibit bract color development (Ecke et al., 2004; Marousky, 1968).

Treatment 3 received high temperatures from Day 25 (the day of expected floral initiation)

through Day 53. As expected T50 initiation did take place around Day 25, Day 26.5 to be exact.

However, there was a delay of 3 to 4 days in visible bud and anthesis in Treatment 3 plants

compared with the control. This shows that there is a potential for a slight delay in floral

development before visible bud under supraoptimal temperatures.

Experiment 3

Expt. 3 utilized the same design as the previous experiment. 'Autumn Red' was grown in

natural photoperiods with a variety of 14 and 21-day high temperature treatments or control

treatments. Day numbers are again counted from pinching and T50 initiation data was taken for

those treatments that were applied before or around the time of floral initiation. Analysis of

variance revealed that the effects of temperature treatment on the number of days from pinching

to T50 initiation, first color, visible bud, and anthesis were significant at the 0.05 level (Tables 3-

5 and 3-7). The Waller-Duncan mean separation procedure was used to compare individual

treatment means.

Treatments 1 and 2 are the control groups as in the previous experiment. Treatment 1

received no high temperatures and Treatment 2 received 28 days of high temperatures beginning

two weeks before the expected T50 initiation date. In this experiment the plants in the low

temperature control reached T50 initiation Day 26.9 and the high temperature control reached

T50 initiation in 39.2 days (Table 3-6). This delay in initiation translated to a 13.2-day delay in









anthesis (Table 3-5). These data indicate that both control groups showed the expected

flowering times and again the delay in observed flowering is the result of a delay in initiation.

Plants in Treatments 3 to 6 were each exposed to 21 days of high temperatures.

Treatments 3 and 4 were exposed to 21 days of constant high temperatures starting on day 11 in

Treatment 3 and day 18 in treatment 4. There was no significant difference in days to T50

initiation, visible bud, and anthesis between plants in Treatments 3 and 4 and the high

temperature control. These results show that 21 days of high temperatures around the time of

floral initiation is sufficient to produce a delay in flowering of a degree that would seriously

effect crop scheduling. Plants in Treatments 5 and 6 also received 21 days of high temperatures,

but these two temperature treatments were interrupted with 7 days at the cool temperature

regime. The net effect of the scheduling of these treatments is that only 14 of the 21 days of high

temperatures occur before the initiation. Plants in both treatments reached T50 floral initiation in

about 30 days compared to 26 days in the low temperature control. This delay in initiation

paralleled the delay in anthesis indicating that the 7 days of high temperature exposure following

floral initiation did not produce any additional delay in visible bud or anthesis.

Treatments 7-10 each received high temperatures for 14 straight days. The assigned period

of high temperatures began on Day 4 in Treatment 7, Day 11 for Treatment 8, Day 18 for

Treatment 9, and Day 25 for Treatment 10 (Table 3-6). The plants in Treatments 4 and 10

showed no significant delay in T50 floral initiation, visible bud or anthesis compared with the

control plants. Since the treatment ended 7 days before the expected and observed initiation

dates this data indicated that high temperatures this early in production will not cause a delay in

floral initiation or visible flowering. In the case of Treatment 10, the high temperature treatment









began following T50 initiation so as with Treatments 5 and 6 the data indicate that high

temperatures following initiation do not cause delay in flowering.

Treatments 11 through 13 each received 14 days of high temperatures interrupted with 7

days at the cool temperature regime as outlined in Table 3-5. There was no delay in T50

initiation, visible bud, or anthesis in Treatment 12 and 13 plants compared to the low

temperature control plants (Table 3-5). Plant in both treatments received only 7 days of high

temperatures prior to T50 initiation. This result is consistent with the results of the previous

experiments, indicating that high temperatures following initiation or 7 days of high

temperatures before initiation are not sufficient to produce a significant delay in flowering.

In Treatments 14 through 17 the high temperature exposure occurred following floral

initiation to confirm the finding from Expt. 2 which indicated that high temperature exposure

during floral development does not cause major delays in flowering. Each of the treatments was

exposed to the high temperature regime beginning on Day 32. Treatment 14 remained at the

high temperature regime for 14 days, Treatment 15 for 21 days, Treatment 16 for 28 days, and

Treatment 17 for 35 days. There were not significant differences in the time to visible bud of

anthesis for the plants in any of these treatments compared to the low temperature control.

However the plants in Treatments 14-17 all reached first color significantly later than the low

temperature control. These findings support the previous studies that have shown that high

temperatures during poinsettia floral development delay bract coloration (Marousky, 1968)

Conclusions

The results of this series of experiments show that the timing of high temperature exposure

determines whether or not heat delay will occur and the duration of high temperature exposure

determines the magnitude of the delay. High temperatures ending more than 14 days before or

starting more than 14 days after T50 initiation did not contribute to the heat delay effect. This









means that there is an approximately 28 day window in which the plant is susceptible to heat

delay. High temperatures throughout this entire period can produce a delay in anthesis in

'Autumn Red' of up to 14 days. In some cases 21 days of high temperatures within the 28-day

window produced the full heat delay effect as seen in Expt. 3. Plants exposed to treatments with

a contiguous 21 days at the high temperature regime during the 28-day window and the other 7

days at the low temperature regime reached anthesis within 3 days of those plants receiving the

full 28 days of high temperatures. However, when the high temperature treatment was

interrupted with 7 days at the cool temperature regime, initiation and thusly anthesis were

delayed only slightly compared to the low temperature control. This supports the hypothesis that

heat delay in natural photoperiods occurs as a result of the adjustment of critical night length by

supraoptimal temperatures which is discussed in detail in Chapter 2. The time at the low

temperature regime likely allowed the floral initiation process to proceed to a point where the

meristem is committed to flowering and floral development to continue even when the

temperatures were returned to the high temperature regime.

Shorter durations of high temperature exposure did produce some delay but not to the

extent of the 21 and 28-day high temperature treatments. In no case did 7 days of high

temperatures produce any significant delay in anthesis. However, 14 days of high temperatures

before or around the time of floral initiation did significantly delay floral initiation and anthesis

in both natural day experiments. In Expt. 3, 14 days of high temperatures starting 14 or 7 days

before the expected T50 initiation date both caused a delay of about 5 days in initiation and

anthesis. However if the 14 days of high temperatures began 21 days before or at any point after

T50 initiation, there were no delays in initiation or anthesis compared to the low temperature









control. These results support the conclusion from Chapter 2 that heat delay in poinsettia is the

result of a delay in floral initiation.

High temperature exposure later in floral development had a minor effect on the timing of

anthesis in these studies. Previous studies found that elevated temperatures after the visible bud

stage accelerate development (Langhans and Miller, 1960; Miller and Kiplinger, 1962). In Expt.

2, high temperatures imposed between the time of visible bud and anthesis accelerated floral

development causing the plants to reach anthesis about 3 days before the low temperature

control.

The fact that high temperatures before the initiation date cause a delay in flowering brings

up an important issue. T50 initiation is recorded when the meristem has already begun the

flowering process and this change is visible at a microscopic level. The processes of floral

induction and initiation would have been underway for some time at this point, so it is intuitive

that high temperatures during the period before observed initiation could effect this process.

Unfortunately, it is not possible at the present time to determine exactly when the poinsettia plant

begins the process of floral induction in response to day length. In previous studies with

controlled photoperiods, it has been found that the T50 date occurs no sooner than 8 days

following the onset of 15-hour dark periods or 10 days with 12-hour dark periods (Weiland,

1998). But again these data can't be directly applied to natural-day flowering so at the present

time it can only be estimated when the plant actually begins the transition from the vegetative to

reproductive state. Research at the molecular level could further elucidate this process.











Table 3-1. Number of days to visible bud and anthesis in 'Prestige Red'
hour dark periods (Expt. 1).


from the onset of 12-


Treatment number Days at 290/240C Day to visible bud Days to anthesis
1 None 42 cz 64 c
2 Days 1-28 54 a 78 a
3 Days 1-7 43 c 62 c
4 Days 7-14 42 c 64 c
5 Days 14-21 44 c 65 c
6 Days 7-28 54 a 76 a
7 Days 1-7, 14-28 50 b 72 b
8 Days 1-14, 21-28 50 b 74 ab
ZMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)

Table 3-2. Number of days to first color, visible bud, and anthesis from pinching (Sept. 1, 2006)
in 'Autumn Red' with high temperatures (292C day /242C night) applied for
listed intervals (Expt. 2).
Treatment Days at 29/240C Days to first color Days to visible Days to anthesis
number bud
1 None 36.3 bz 43.9 c 65.9 de
2 Days 11-39 40.8 a 53.4 a 73.9 a
3 Days 25-53 36.5 b 47.7 b 69.8 bc
4 Days 11-25 41.5 a 47.7 b 69.3 bc
5 Days 18-32 42.5 a 50.3 b 72.5 ab
6 Days 25-39 35.0 b 44.5 c 68.2 c
7 Days 32-46 36.3 b 44.5 c 65.5 def
8 Days 39-53 35.2 b 43.5 c 66.5 cd
9 Days 46-60 35.4 b 43.0 c 62.8 ef
10 Days 53-68 34.4 b 42.8 c 62.4 f
zMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)










Table 3-3. Number of days to 50% floral initiation (T50)from pinching (1 Sept. 2006) z in
'Autumn Red' with high temperatures (292C day /242C night) applied for listed
intervals (Expt. 2).
Treatment Days at Days to T50 95% Confidence interval
number 290/240C initiation
1 None 25.5 23.1 28
2 Days 11-39 36.8 34.7 38.8
3 Days 25-53 26.5 25.7 27.3
4 Days 11-25 30.5 29.8 31.2
5 Days 18-32 30.3 28.8 31.9
6 Days 25-38 27.0 24.6 29.4
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 3-4. Pairwise comparison of T50 values from Table 3-3 (Expt. 2).
Treatment 1 2 3 4 5 6
1
2 *
3 NS *
4 *
5 NS
6 NS NS *
NS, Nonsignificant and significant at P=.05, respectively










Table 3-5. Number of days to first color, visible bud, and anthesis from pinching (1 Sept. 2007)
with high temperatures (292C day /242C night) applied for listed intervals (Expt.
3).
Treatment Days at 290/240C Days to first Days to visible Days to anthesis
number color bud
1 None 33.8 dz 41.5 cd 64.8 c
2 Days 11-39 48.6 a 55.7 a 78.0 a
3 Days 11-32 47.3 a 53.5 a 75.8 a
4 Days 18-39 49.1 a 55.3 a 77.3 a
5 Days 11-18; 25-39 39.8 c 49.8 b 72.0 b
6 Days 11-25; 32-39 40.0 bc 48.2 b 70.3 b
7 Days 4-18 34.2 d 42.7 cd 63.7 c
8 Days 11-25 41.7 bc 48.8 b 71.3 b
9 Days 18-32 42.3 b 50.0 b 72.0 b
10 Days 25-39 35.0 d 42.7 cd 66.0 c
11 Days 11-18; 25-32 42.3 b 49.3 b 72.3 b
12 Days 11-18; 32-39 35.7 d 43.8 c 65.0 c
13 Days 18-25; 32-39 33.7 d 42.5 cd 65.2 c
14 Days 32-46 38.3 c 40.8 cd 62.5 c
15 Days 32-53 37.2 c 40.3 d 62.0 c
16 Days 32-60 39.7 c 41.2 cd 63.5 c
17 Days 32-68 38.7 c 42.3 cd 64.0 c
zMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)

Table 3-6. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2007) in
'Autumn Red' with high temperatures (292C day /242C night) applied for the listed
intervals (Expt. 3).
Treatment Days at 290/240C Days to T50 95% Confidence interval
number initiation
1 None 26.9 26.7 27.2
2 Days 11-39 39.2 38.1 40.3
3 Days 11-32 36.3 34.7 37.8
4 Days 18-39 39.5 38.7 40.3
5 Days 11-18; 25-39 30.8 29.7 31.9
6 Days 11-25; 32-39 30.7 29.6 31.8
7 Days 4-18 25.5 24.2 26.8
8 Days 11-25 30.5 29.7 31.3
9 Days 18-32 31.7 30.2 33.3
10 Days 25-39 24.8 23.7 25.9
11 Days 11-18; 25-32 30.7 29.6 31.8
12 Days 11-18; 32-39 24.8 23.7 25.9
13 Days 18-25; 32-39 27.5 26.7 28.3
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).











Table 3-7. Pairwise comparison of T50 values from Table 3-6 (Expt. 3).
Treatment 1 2 3 4 5 6 7 8 9 10 11 12 13
1
2 *
3 *
4 NS *
5 *
6 NS
7 NS *
8 NS NS *
9 NS NS NS
10 NS *
11 NS NS NS NS *
12 NS NS *
13 NS NS NS *
NS, Nonsignificant and significant at P=.05, respectively









CHAPTER 4
DAY, NIGHT, AND DIURNAL MEAN TEMPERATURES

Introduction

Elevated day and night temperatures in combination have been demonstrated to cause

delay in the flowering response of poinsettia (Barrett, 2004; Weiland, 1998). A similar pattern

was observed in certain chrysanthemum cultivars (Cathey, 1954; Larsen, 1982; Whealy et al.,

1987). In both poinsettia and chrysanthemum, heat delay has been attributed to high night

temperatures. Some of the foundation poinsettia temperature studies investigated and in fact

reported night temperatures alone with no record of either daytime or diurnal mean temperatures

(Langhans and Miller, 1960; Miller and Kiplinger, 1962; Roberts and Struckmeyer, 1938).

Roberts and Struckmeyer (1938) reported that poinsettia (cultivar not indicated) failed to flower

when the minimum night temperature was 21 C while those grown with 16C or 18C minimum

night temperatures flowered normally. In contrast, Miller and Kiplinger (1962) found no delay in

flowering or initiation in 'Barbara Ecke Supreme' with 210C minimum night temperatures

compared to 160C or 180C with night lengths of 12 to 15 hours.

Langhans and Larson (1960) investigated temperature effects on 'Barbara Ecke Supreme'

with 15-hour night lengths and reported both day and night temperatures. Treatments with night

temperatures of 27C reached visible bud 11 to 18 days later than treatments receiving 21C

night temperatures regardless of day temperature. The results of these studies led to a long

standing belief that elevated night temperature regardless of day temperature determines heat

delay in poinsettia which can be found in more recent publications (Ecke et al., 2004; Erwin,

2005).

Similar experimental results have been reported with heat-sensitive chrysanthemum

cultivars. Chrysanthemum 'Miros' was grown with 16-hour nights and 250C day temperatures.









With night temperatures of 240C, anthesis was delayed 10 days compared with plants grown in

210C or 180C night temperatures (Larsen, 1982). It was concluded in this study that the night

temperature was the cause of the delayed flowering. Cathey (1954) also concluded that the

increase in time to flowering observed in chrysanthemum 'Encore' was influenced more strongly

by night temperature. As in the poinsettia studies cited above, the night lengths in these

chrysanthemum studies were significantly longer than the day lengths so it is unclear if the

apparent influence of night temperature is in fact due to the elevated night temperature or change

in the diurnal mean temperature.

Pearson et al. (1993) reanalyzed previously published data addressing the relative roles of

day, night, and diurnal mean temperature in chrysanthemum floral initiation and development.

This analysis led to the formulation of a model for the effect of mean diurnal temperature on the

time to flower in chrysanthemum. This model indicates that the reciprocal of time to flower is

linearly related to increase in the mean diurnal temperature when temperatures are below or

within the optimum range. Above the optimum temperature range the reciprocal of time to

flower shows a negative linear correlation to increase in mean diurnal temperature. Application

of this model to the data from Cathey (1954) showed a highly significant positive linear

correlation between the reciprocal of days to flower and mean diurnal temperature up to about

210C in the heat insensitive cultivar 'Encore'. This model also accurately predicts the response

of high temperature sensitive cultivars to elevated temperature. When the model was applied to

the data from Whealy et al. (1987) a strong negative correlation was found between the

reciprocal of days to flower and increase in mean diurnal temperature from 210C to 290C.

This model system for illustrating the effects of temperature on time to flower has been

widely accepted by researchers studying chrysanthemum, but has not been investigated in









poinsettia. For example, by applying this model Willits and Bailey (2000) determined that in

chrysanthemum 'Iridon', the time to flower increased 4.2 days with each IC increase in mean

diurnal temperature above 230C. No published work has addressed the possibility of this model

accurately describing the response of poinsettia to temperatures. In fact, the prevailing belief

among poinsettia producers is that night temperature above 230C is the main cause of heat delay

(Ecke et al., 2004; Erwin, 2005).

The present study was designed to advance the current understanding of the role of

supraoptimal temperature in the time to flower in modern poinsettia cultivars. First, a series of

growth chamber experiments was designed to address the roles of specific day, night, and diurnal

mean temperatures. However, in this case as with all growth chamber experiments, the

conditions do not simulate those found in greenhouse or nursery production. To more

conclusively determine if heat delay in modern poinsettia production is the result of elevated

night temperatures or diurnal mean temperatures as discovered in the case of chrysanthemum,

two greenhouse experiments were designed. These experiments utilized temperature

combinations that are more likely to occur in greenhouses or outdoor growing ranges in warm

climates. Each temperature combination had the same daytime high temperature and overnight

low temperature, but variable mean diurnal temperatures (Table 4-1).

Materials and Methods

For each experiment, rooted cuttings were received from Paul Ecke Ranch (Encinitas, CA)

and planted in 105 cm3 pots containing Fafard 2 growing medium (Conrad Fafard, Anderson,

S.C.), which consists of 6.5 sphagnum peat : 2 perlite : 1.5 vermiculite (v/v). Plants were

initially grown at 260+2 day /21+2C night temperatures with incandescent night interruption

lighting from 22:00 to 02:00 daily. From planting through the completion of the experiments, all

plants received fertilizer at each irrigation of Peters 20N-4.4P-16K supplying 300 mg-L-1









Nitrogen. Approximately one week after planting, all cuttings were pinched to five nodes. No

plant growth retardants were used. Three cultivars were used: 'Prestige Red', 'Red Velvet', and

'Barbara Ecke Supreme'. 'Prestige Red' and 'Red Velvet' are widely used in modern poinsettia

production. Both of these cultivars have been documented to exhibit heat delay. 'Barbara Ecke

Supreme' is no longer used in commercial production. However, this cultivar was the subject of

many of the foundation temperature studies so it was included to allow comparison with these

studies.

Growth Chamber Experiments

Four separate experiments were conducted in walk-in growth chambers measuring 3.7 m

by 3.7 m each and equipped with twelve 1,000-watt high pressure sodium lamps which produce

580 mrol m-2s-1 PAR and six 60-watt incandescent lamps (one 1.4 m on either side of the

chamber).

Two weeks after pinching, plants were transferred to the growth chambers and allowed to

acclimatize for one week with continued night interruption lighting. Following the

acclimatization period, the photoperiod was set to 12-hours. The high pressure sodium lamps

were set with digital timers to run from 23:30 to 10:30 and incandescent lighting demarcated the

light period (23:00-24:00 and 10:00-11:00). The treatment temperatures were imposed until all

plants were determined to have undergone floral initiation using the T50 floral initiation method

as described in Chapter 2. Each experiment utilized a completely randomized design with 12

plants per treatment.

Rooted cuttings of poinsettia 'Red Velvet' were planted on 12 Jan. 2005 (Expt. 1) or 28

Feb. 2005 (Expt. 2). Rooted cuttings of 'Prestige Red' and 'Red Velvet' were planted on 5 Mar.

2007 (Expt. 3) or 28 May 2007 (Expt. 4). All plants were pinched to five nodes on 25 Jan. 2005,

7 Mar. 2005, 13 Mar. 2007, or 3 June 2007 then moved into the growth chambers on 9 Feb.









2005, 21 Mar. 2005, 27 Mar, 2007, or 18 June 2007 for Expts. 1 through 4, respectively. The

temperature treatments for Expts. 1 through 4 are outlined in Tables 4-2; 4-4, 4-6 and 4-8,

respectively. These temperature treatments were applied from 17 Feb. 2005 through 18 Mar.

2005, 28 Mar. 2005 through 28 Apr. 2005, 4 Apr. 2007 through 5 May 2007, and 25 June 2007

through 27 July 2007 in each of the 4 experiments respectively. Data were collected as

described below.

Greenhouse Experiments

The two greenhouse experiments utilized a completely randomized design with 24 plants

per treatment. Twelve of the pots were destructively harvested as described below to determine

floral initiation and the other 12 plants were grown to anthesis. Following pinching, night

interruption lighting was continued for two weeks at which time 12-hour dark periods and the

designated temperature treatments were imposed. The 12-hour dark periods were provided by

covering the greenhouse benches with black cloth from 17:00 through 08:00 and then using

incandescent lights (60 watt bulbs spaced at 1.2 m) to set the dark period.

For Expt. 5 rooted cuttings of 'Prestige Red' were planted on 10 Feb. 2006 and pinched to

five nodes on 20 Feb. 2006. For Expt. 6 rooted cuttings of 'Red Velvet', 'Prestige Red', and

'Barbara Ecke Supreme' were planted on 22 Dec. 2006 and pinched to five nodes on 5 Jan. 2007.

Treatments consisted of temperature combinations as outlined in Table 4-1 applied from 6 Mar.

2006 (Expt. 5) or 31 Jan. 2007 through initiation 6 Apr. 2006 (Expt. 5) or 2 Mar. 2007 (Expt. 6).

From initiation though anthesis all plants were grown with moderate day/night temperatures of

26 20C /21 20C. Data were collected as described below.

Data Collection

T50 floral initiation was determined for all experiments using the method described in

Chapter 2. In addition, for Expts. 5 and 6 the dates of first visible bract color, unfolding of the









primary bracts to reveal the primary cyathium (visible bud), and anther dehiscence were recorded

for each plant not used for shoot tip sampling. Average days for first color, visible bud, and

anthesis were calculated in SAS and the Waller-Duncan procedure was used for mean separation.

Terms of the model were judged to be significant or nonsignificant based on a comparison ofF

values at P < 0.05.

Results and Discussion

Experiment 1

'Red Velvet' plants grown with 12-hour dark periods, night temperatures of 180C, 210C, or

240C in combination with 260C daytime temperatures all reached floral initiation in 15 to 16

days (Table 4-2). There are no significant differences in T50 initiation dates between the three

treatments (Table 4-3). These results indicate that for. These findings are in contrast with those

reported in earlier poinsettia flowering studies which reported delays in floral initiation with

night temperatures of over 21C (Miller and Kiplinger, 1962). The studies of Miller and

Kiplinger (1962) utilized 15-hour dark periods compared to 12-hour dark periods in the present

study. The longer dark periods mean that the temperature during the dark period has more

impact on the diurnal mean temperature than the temperature during the light period simply

because the night temperatures are applied for a longer period of time. This difference in the

relative contribution of the day and night temperature to the diurnal mean likely led to the

conclusion that night temperature is of greater influence in the heat delay effect than day

temperature.

Experiment 2

Expt. 2 was designed with three treatments, two of which had the same diurnal mean

temperature utilizing different day and night temperature combinations. The third treatment used

a day and night temperature combination shown to illicit the heat delay response in previous









studies. Floral initiation occurred 6 and 7 days later with the 29/240C day/night temperature

regime when compared with 29/180C and 26/230C temperature combinations, respectively

(Table 4-4). The delay in floral initiation with 29/240C in comparison to 29/180C indicates that

elevated daytime temperatures alone do not result in heat delay. However, it can not be

concluded that the night temperature is the cause of this delay as the diurnal mean temperature

also varies between these two temperature regimes (27C Vs. 240C). The difference in the T50

days between the plants grown at 29/240C and 26/230C indicate that the delay in floral initiation

can not be attributed to night temperature alone. The number of days to T50 initiation with

29/180C and 26/230C were not significantly different (Table 4-5). These data indicate that the

heat delay effect may be more closely linked to the diurnal mean temperature which is 240C for

both treatments. To investigate this theory further, two additional experiments were designed to

isolate the effects of day and night temperature and extend the investigation to include additional

commercially important cultivars.

Experiment 3

Two cultivars were used to investigate possible genotype specificity of the heat delay

response. Expt. 3 was designed to determine if elevated day or night temperatures are more

influential in determining the heat delay effect that is observed at 27C mean diurnal

temperatures. 'Red Velvet' plants grown at 24/240C reached T50 initiation in 17.7 days

compared to 25.5 days at 24/290C and 25.4 days at 29/240C (Table 4-6). These results indicate

that a day or night temperature of 290C will cause a similar delay in floral initiation compared

with 240C. For each of the three temperature combinations, there was no significant difference

in the number of days to T50 initiation between cultivars 'Red Velvet' and 'Prestige Red' (Table

4-7). This indicates that the response to these temperature combinations is not specific to









cultivar 'Red Velvet'. As in the previous experiments, the data support the conclusion that heat

delay may result from elevated diurnal mean temperatures.

Experiment 4

Expt. 4 utilized two temperature treatments with a diurnal mean temperature of 240C. One

treatment had a day/night temperature regime of 21/27C and the other 27/210C. These

treatments were designed to show if warm temperatures during the night would illicit the heat

delay effect preferentially to day temperatures as seen in earlier studies. 'Red Velvet' reached

T50 initiation in 19.4 or 19.5 days with 21/27C or 27/210C temperature combinations while

those grown at 27/27C reached T50 initiation after 23.0 days (Table 4-8). As in the previous

experiment, cultivars 'Red Velvet' and Prestige Red' were included. Again, there were no

significant differences in the number of days to T50 initiation between the cultivars with each

temperature regime (Table 4-9). These data indicate that elevated night or day temperature alone

will not cause a delay in floral initiation while sustained elevated temperatures do cause

significant delay.

The growth chambers are very useful for their ability to maintain specific temperature

treatments during both the light and dark period. This allows temperature combinations to be

utilized that are not possible with greenhouse systems. However, the fact that these temperature

regimes could not occur in a greenhouse setting creates a need to test the theories produced from

these data to be tested in more normal conditions if these theories are to be applied to

commercial greenhouse production. To address this situation, two greenhouse experiments were

conducted.

Experiment 5

The two greenhouse experiments were designed to simulate daily temperature fluctuations

that may occur in a commercial greenhouse environment. The temperature treatments for Expt.









5 are shown in Table 4-1 and the dates of first color, visible bud, and anthesis are shown in Table

4-10. 'Prestige Red' plants that were grown with mean diurnal temperatures of 210C and 24C

reached T50 initiation in 14.1 and 15.0 days. However, Plants grown with a mean diurnal

temperature of 27C reached T50 initiation in 22.0 days (Table 4-11). Following the initiation

period the plants were moved to a single greenhouse and grown to anthesis with a mean diurnal

temperature of 240C.. The delay in initiation paralleled the delay in visible bud and anthesis

(Table 4-10). Plants receiving 210C and 240C treatments reached T50, visible bud, and anthesis

7 to 9 days before those plants grown at 27C (Table 4-12). These data indicate that the

observed delay in the flowering process is the result of a delay in floral initiation and that this

delay is due to an increase in mean diurnal temperature.

Experiment 6

Expt. 6 utilized the same treatments as Expt. 5 with the addition of a forth treatment (Table

4-1). This additional treatment has average day, average night, and mean diurnal temperature of

240C while maintaining the standard high and low temperatures. This treatment also has the

same night temperature regime of the 27C mean temperature treatment. This temperature

regime was included to verify that the delay in floral initiation seen in the 27C mean

temperature treatment is not in response to the 240C average night temperature, but the mean

diurnal temperature. Cultivars 'Red Velvet' and 'Prestige Red' were included in this experiment

with the addition of 'Barbara Ecke Supreme'. 'Barbara Ecke Supreme' is a cultivar that was

grown commercially when many of the foundation studies on the poinsettia flowering response

were conducted and it was used in many of these studies. This cultivar was included in this

experiment to determine if the heat delay response in poinsettia has changed with new cultivar

development over the past 40 years.









Dates of floral initiation, first color, visible bud, and anthesis vary between cultivars and

treatments (Table 4-13). Plants of cultivars 'Red Velvet' and Prestige Red' receiving

temperature treatments of 23/290C, 26/220C, or 24/240C all reached T50 initiation between 17.4

and 18.5 days following the onset of 12-hour dark periods (Table 4-14). Those grown at

29/240C reached T50 initiation in 25.0 days for plants of 'Red Velvet' and 21.8 days for

'Prestige Red' plants. These T50 dates are significantly later than those recorded in the previous

temperature treatments for each cultivar (Table 4-15). These data are consistent with those from

the previous experiments. The 24/240C and 29/240C temperature treatment both utilize 24C

average night temperatures. So the difference in days to initiation between these two treatments

can not be attributed to the warm night temperature. These data form the strongest evidence that

the delay in flowering observed in poinsettia crops is in fact the result of diurnal mean

temperatures of 27C or higher and not the result of night temperatures of 230C or above as

indicated by the Ecke Poinsettia Manual (Ecke et al., 2004).

Plants of 'Barbara Ecke Supreme' reached T50 initiation in only 13.4 days with 26/22C

temperatures and 16.0 days with both 23/290C and 24/240C temperatures (Table 4-14). The

reason for this cultivar to undergo floral initiation earlier than the modem cultivars is not clear.

However, with the 29/240C temperature combination plants of 'Barbara Ecke Supreme' did

show the expected delay in initiation, reaching T50 initiation in 21.7 days. Dates of first color,

visible bud, and anthesis (Table 4-13) indicate that the visible delay in flowering is due to the

delay in floral initiation for 'Barbara Ecke Supreme' also. The fact that 'Barbara Ecke Supreme'

shows a very similar pattern of heat delay casts doubt on the theory that breeding progress has

changed the manner in which poinsettia plants respond to elevated temperatures.









Conclusions

The results of this study show that the heat delay effect as observed in modern poinsettia

production is the result of elevated mean temperatures and not night temperatures alone. The

growth chamber experiments demonstrated in a theoretical context that high temperature delay in

poinsettia is the result of mean diurnal temperatures of 27C. These experiments which rely on

inversion of day/night temperature regimes are very useful to demonstrate the response of plants

to thermal conditions at various phases of the diurnal cycle. However, such inverted

thermoperiods would not be allowed to occur in greenhouse crop production so the data

generated in this way can not be directly used to conclude that observed responses in these crops

result from a certain phase of the experimental thermoperiod. In general, temperature controlled

greenhouses utilize daytime temperatures about 5-100C above overnight temperatures. Many of

the foundation studies investigating the response of poinsettia floral initiation and development

to temperature utilized growth chamber experiments with thermoperiod inversion treatments

(Langhans and Miller, 1960; Miller and Kiplinger, 1962). The data generated in these studies,

which linked heat delay with night temperatures, has long been used to explain heat delay in

poinsettia. In fact, one of the most prominent poinsettia production manuals advises growers that

night temperatures above 230C will lead to heat delay in their poinsettia crops. (Ecke et al.,

2004). As discussed earlier these studies utilized short-day photoperiods with night lengths

longer than day lengths so the night temperature contributed more heavily to the mean diurnal

temperature. This is in contrast with Expts. 1-6 which utilized even day and night lengths. In

this case, the data from the greenhouse experiments support the conclusion that the observed

delay in floral initiation is the result of diurnal mean temperatures.

The conclusion that heat delay in poinsettia is the result of supraoptimal mean diurnal

temperatures will allow growers to utilize a new temperature managing technique called









temperature averaging or temperature integration to manage this production problem in warm

climates. With this method, growers allow temperatures to rise above traditional set-points

during and day and fall below them overnight resulting in greater diurnal temperature fluctuation

but similar diurnal mean temperatures. Studies to determine the feasibility of this technique have

shown that the rate of many important physiological processes including photosynthesis and leaf

unfolding rates can be correlated to diurnal mean temperature (Korner, et al., 2004; Langton and

Horridge, 2006; Lentz, 1998). This allows growers to reduce energy used for heating and

cooling without losing the ability to precisely schedule their crops which is important for

poinsettia as it requires highly precise scheduling to meet a very short market window. In

addition, as a commodity crop, the profit margins on poinsettia crops can be very slim so

efficient use of energy is vital. Future studies will be necessary to confirm that temperature

integration will not adversely affect other aspects of poinsettia production. However, it appears

that this technique has real promise to improve poinsettia production efficiency in warm

climates.

Table 4-1. Temperature treatments for greenhouse experiments (Expt. 5 and 6).
Expt. 5 Expt. 6
treatment temperatures (2C) treatment temperatures (2C)
Time 1 2 3 1 2 3 4
02:00-06:00 18 18 18 18 18 18 18
06:00-10:00 18 21 29 18 21 18 29
10:00-14:00 21 27 29 21 27 24 29
14:00-18:00 29 29 29 29 29 29 29
18:00-22:00 21 27 28 21 27 28 28
22:00-02:00 18 21 26 18 21 26 26
Diurnal mean 21 24 27 21 24 24 27
temperature
Average day
temperature 23 26 29 23 26 24 29
(06:00-18:00)
Average night
temperature 19 22 24 19 22 24 24
(18:00-06:00)










Table 4-2. Number of days to 50% floral initiation (T50)z in 'Red Velvet' from the onset of 12-
hour dark periods with day/night temperatures of 26/182C, 26/212C, or
26/242C (Expt. 1).
Day /night temperature (2C) Days to T50 initiation 95% confidence interval
26/18 15.5 14.72 16.19
26/21 15.1 14.13 16.08
26/24 15.6 14.87 16.42
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 4-3. Student t-test pairwise comparison of T50 values in Table 4-2 (Expt. 1).
26/ 180C 26/210C 26/240C
26/180C
26/210C NS
26/240C NS NS
NS, Nonsignificant and significant at P=.05, respectively

Table 4-4. Number of days to 50% floral initiation (T50)z for 'Red Velvet' from the onset of 12-
hour dark periods with day/night temperatures of 26/2320C, 29/2420C, or
29/1820C (Expt. 2).
Day /Night Mean temperature T50 initiation 95% confidence interval
temperature (20C) (20C) (Days)
26/23 24 16.2 14.19 18.22
29/24 27 23.0 23.00 23.00
29/18 24 17.5 16.51 18.50
ZT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 4-5. Student t-test pairwise comparison of T50 values in Table 4-4 (Expt. 2).
26/230C 29/240C 29/180C
26/230C
29/240C *
29/180C NS *
NS, Nonsignificant and significant at P=.05, respectively









Table 4-6. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark
periods with day/night temperatures of 24/292C, 24/242C, or 29/242C.
Analysis of variance revealed that the effects of temperature treatment, cultivar, and
the interaction of temperature and cultivar on the number of days to T50 initiation
were significant at the 0.05 level (Expt. 3).
Cultivar Day /Night Mean temperature T50 initiation 95% Confidence Interval
temperature (2C) (Days)
(+20C)
Red 24/29 27 25.5 23.18 27.73
Velvet 24/24 24 17.7 16.58 18.75
29/24 27 25.4 22.49 28.41
Prestige 24/29 27 23.2 22.32 24.01
Red 24/24 24 18.3 17.25 19.41
29/24 27 24.5 23.72 25.33
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 4-7. Student t-test pairwise comparison of T50 values in Table 4-6 (Expt. 3).
Red Velvet Prestige Red
24/290C 24/240C 29/240C 24/290C 24/240C 29/240C
Red Velvet
24/29C
Red Velvet
24/240C *
Red Velvet
29/240C NS *
Prestige Red
24/290C NS NS
Prestige Red
24/240C NS *
Prestige Red
29/240C NS NS NS *
NS, Nonsignificant and significant at P=.05, respectively










Table 4-8. Number of days to T50z initiation from the onset of 12-hour dark periods with
day/night temperatures of 21/272C, 27/212C, or 27/272C. Analysis of
variance revealed that the effects of temperature treatment, cultivar, and the
interaction of temperature and cultivar on the number of days to T50 initiation were
significant at the 0.05 level (Expt. 4).
Cultivar Day /night Mean T50 initiation 95% Confidence Interval
temperature temperature (Days)
(+2C) (2C)
Red 21/27 24 19.4 19.12 19.65
Velvet 27/21 24 19.5 18.80 20.18
27/27 27 23.0 22.52 23.48
Prestige 21/27 24 19.2 18.32 20.01
Red 27/21 24 18.5 17.72 19.33
27/27 27 24.0 23.31 24.69
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 4-9. Student t-test pairwise comparison of T50 values in Table 4-8 (Expt. 4).
Red Velvet Prestige Red
21/270C 27/210C 27/270C 21/270C 27/210C 27/270C
Red Velvet
21/270C
Red Velvet
27/210C NS
Red Velvet
27/270C *
Prestige Red
21/270C NS NS *
Prestige Red
27/210C NS NS NS
Prestige Red
27/270C NS *
NS, Nonsignificant and significant at P=.05, respectively










Table 4-10. Number of days to first color, visible bud, and anthesis from the onset of 12-hour
dark periods in 'Prestige Red' with mean diurnal temperatures of 212C, 242C, or
272C. Analysis of variance revealed that the effects of temperature treatment on
the number of days to first color, visible bud, and anthesis were significant at the 0.05
level (Expt. 5).
Day /night Mean temperature Days to first Days to visible Days to
temperature (2C) (2C) color bud anthesis
23/19 21 30.2 bz 34.6 b 54.2 b
26/22 24 29.2 b 34.0 b 53.6 b
29/24 27 43.6 a 42.8 a 65.2 a
zMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)

Table 4-11. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark
periods for 'Prestige Red' with mean diurnal temperatures of 21, 24, or 272C.
Analysis of variance revealed that the effects of temperature treatment, cultivar, and
the interaction of temperature and cultivar on the number of days to T50 initiation
were significant at the 0.05 level (Expt. 5).
Day /night Mean temperature T50 initiation 95% Confidence Interval
temperature (2C) (2C) (Days)
23/19 21 14.1 13.38 14.84
26/22 24 15.0 14.77 15.22
29/24 27 22.0 21.96 21.96
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).

Table 4-12. Student t-test pairwise comparison of T50 values in Table 4-11 (Expt. 5)
23/190C 26/220C 29/240C
23/190C
26/220C NS
29/240C *
NS, Nonsignificant and significant at P=.05, respectively









Table 4-13. Number of days to first color, visible bud, and anthesis from the onset of 12-hour
dark periods with mean diurnal temperatures of 21, 24, or 272C. Analysis of
variance revealed that the effects of temperature treatment, cultivar, and the
interaction of temperature and cultivar on the number of days to first color, visible
bud, and anthesis were significant at the 0.05 level (Expt. 6).
Cultivar Day /night Days to first Days to visible Days to anthesis
temperature (2C) color bud
Red Velvet 23/19 25.5 ef 33.7 cd 55.7 c
26/22 24.8 f 32.3 de 52.2 ef
24/24 26.5 e 32.8 cd 54.3 d
29/24 33.8 b 45.2 a 65.3 a
Prestige Red 23/19 28.2 d 33.7 c 53.2 e
26/22 25.8 ef 31.0 fg 50.3 g
24/24 29.7 cd 32.3 de 52.2 fg
29/24 33.7 b 40.3 b 62.1 b
Barbara Ecke 23/19 32.5 b 33.3 cd 51.8 f
Supreme 26/22 29.7 cd 31.3 ef 50.2 g
24/24 30.5 c 29.8 g 51.2 fg
29/24 53.3 a 44.7 a 66.0 a
ZMean values followed by different lowercase letters represent significant differences by Waller-
Duncan K-ratio t Test (P<0.05; n=10)

Table 4-14. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark
periods with mean diurnal temperatures of 21, 24, or 272C (Expt. 6).
Cultivar Day /Night T50 Initiation 95% Confidence Interval
temperature (2C) (Days)
Red Velvet 23/19 18.5 17.82 19.20
26/22 17.5 16.08 18.82
24/24 18.5 16.71 20.28
29/24 25.0 23.80 26.20
Prestige Red 23/19 17.5 16.80 18.18
26/22 17.4 17.12 17.66
24/24 17.8 17.22 18.39
29/24 21.8 20.81 22.88
Barbara Ecke 23/19 16.0 16.00 16.00
Supreme 26/22 13.4 13.12 13.65
24/24 16.0 14.43 17.57
29/24 21.7 20.82 22.51
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).









Table 4-15. Student t-test pairwise comparison of T50 values in Table 4-14 (Expt. 6).
Red Velvet Prestige Red


Barbara Ecke Supreme


23/ 26/ 24/ 29/ 23/ 26/ 24/ 29/ 23/ 26/ 24/ 29/
190C 220C 240C 240C 190C 220C 240C 240C 190C 220C 240C 240C
Red Velvet 23/190C
26/220C NS
24/240C NS NS
29/240C *
Prestige Red 23/190C NS NS NS *
26/220C NS NS NS
24/240C NS NS NS NS NS
29/240C *
Barbara Ecke 23/190C *
Supreme 26/220C *
24/240C NS NS NS NS NS NS *
29/240C NS *
NS, Nonsignificant and significant at P=.05, respectively









CHAPTER 5
HEAT DELAY MECHANISMS

Introduction

The mechanisms of photoperiodic flowering have been studied in detail in model plant

systems such as arabidopsis and rice. At this stage of plant physiology research, the information

gained from the model systems can be applied to other crops of economic importance such as

poinsettia. This type of research, now referred to as translational research, seeks to extend

findings from models to systems where greater impact may be realized. The current study is

designed to uncover the mechanism responsible for the heat delay effect observed in the previous

experiments.

Photoperiodic tendencies are rooted in the ability of an organism to tell time, indicating the

presence of an internal oscillator that operates independently from acute environmental input.

The circadian oscillator, or clock, is such a mechanism. The circadian clock is the time keeping

mechanism in both plants and animals. This well conserved mechanism is composed of several

elements. The circadian oscillator is the core mechanism that conditions the internal

environment to anticipate or adapt to diurnal fluctuations in environmental conditions. In

arabidopsis, the circadian oscillator has been well described. The central oscillator consists of at

least two negative regulatory elements: CIRCADIAN CLOCK ASSOCIA TED PROTEIN 1

(CCA1) and LATE ELONGATED HYPOCOTYL (LHY) and one positive element TIMING OF

CAB EXPRESSION 1 (TOC1). These elements are linked in a negative feedback regulatory loop

in which increased expression of TOC1 suppresses CCA1 and LHY expression and vice versa

(Salome and McClung, 2005). As the name suggests TOC1 controls the cyclic expression of

CHOROPHYLL A/B BINDING PROTIEN (CAB) also referred to as LIGHT HARVESTING,

CHLOROPHYLL-BINDING PROTEIN (LCHB). The expression of this gene under constant









light or constant darkness following light-dark entrainment provides an indication of the period

of the circadian oscillator. By monitoring the expression pattern of CAB, alterations in circadian

rhythm can be detected.

In long-day plant arabidopsis the photoperiodic floral initiation process is well

documented. CONSTANS (CO), a gene encoding for a transcription factor, plays a vital role in

arabidopsis floral induction. Expression of CO is regulated by the circadian clock with peak

expression occurring during the dark period in short-day conditions. In long day-lengths high

levels of CO expression occur at dawn and dusk (Yanovsky and Kay, 2006). CONSTANS

protein stability is enhanced by high far-red to red light ratios indicating this gene plays a role in

sensing light quality as well as day-length. In long day conditions this means that CO protein

stability is greatest in the late afternoon and regulated by phytochrome signals (Imaizumi and

Kay, 2006). The floral induction process begins with CO expression in the leaves coinciding

with the proper light environment which induces FLOWERING LOCUS T (FT) expression

followed by FT protein movement to the shoot apical meristem where in conjunction with

FLOWERING LOCUS D (FD) stimulates expression of SUPPRESSOR OF OVEREXPRESSION

OF CO 1 (SOC1) and APETALA 1 (API) which in turn upregulates a number of well known

meristem identity genes initiating the transition from a vegetative to reproductive meristem

(Corbesier and Coupland, 2006). Of course photoperiodic floral induction in short-days plants

may not follow the same pathway.

Rice is commonly used as a model system for photoperiodic flowering in short-day plants.

However, the genes and biochemical processes involved in photoperiodic floral induction in

short-day plants have not been documented to the extent as those of long-day model plant

arabidopsis (Searle and Coupland, 2004). Several genes in rice have been identified that relate to









the circadian clock and photoperiodic flowering. HEADING DATE 1 (HD1), HEADING DATE

3 (HD3a), and HEADING DATE 6 (HD6), have all been characterized as quantitative trait loci

that play roles in determining critical night length. The protein encoded by HD1 is a functional

ortholog of CO protein in arabidopsis which effects expression of HD3a which is analogous to

the arabidopsis FTprotein (Yano, et. al., 2001). However, the ways in which these homologous

genes react to light signals is not similar to arabidopsis. In rice, the expression of HD3a is only

activated by HD1 during the dark period (Izawa, et. al., 2002). Also the relationship between the

relative abundance of HD1 and HD3a appears to be opposite of that in arabidopsis CO and FT.

An increase in the expression of HD1 causes a reduction in HD3a abundance. This indicates that

HD1 represses flowering in long-day conditions through HD3a. The mechanism for this change

in function of the CO-like gene in rice is not known (Cremer and Coupland, 2003). The

similarity in the structures of these orthologous genes indicates that there may be similar

mechanisms for photoperiod sensing and signaling between rice and Arabidopsis with divergent

functional relationships (Searle and Coupland, 2004). These findings also suggest that the genes

involved in the photoperiodic floral induction pathway may be well conserved in the plant

kingdom.

Given this extensive study of the photoperiodic flowering pathway in model systems, it is

now practical to utilize this knowledge to address practical problems such as heat delay in

poinsettia production. To test the effect of heat delay in floral initiation via interaction with the

photoperiod pathway a study was designed to described how light and clock regulated genes

were affected by heat in poinsettia. Monitoring clock output and accumulation of CO transcripts

may provide a starting point for unveiling the molecular mechanisms) that underlie heat delay.









Materials and Methods

Rooted cuttings were received from Paul Ecke Ranch (Encinitas, CA) and planted in 96

cm3 pots containing Fafard 2 growing medium (Conrad Fafard, Anderson, S.C.), which consists

of 6.5 sphagnum peat: 2 perlite : 1.5 vermiculite (v/v). Plants were initially grown at average

day/night temperatures of 262C day /21 2C night with incandescent night interruption

lighting (22:00-02:00). From planting through the completion of the experiment, all plants

received fertilizer at each irrigation of Peters 20N-4.4P-16K supplying 300 mg-L-1 Nitrogen. No

plant growth retardants were used.

The experiment was conducted in walk-in growth chambers measuring 3.7 m by 3.7 m

each and equipped with twelve 1,000-watt high pressure sodium lamps which produce 580 itmol

m-2s-1 PAR and six 60-watt incandescent lamps (one every 1.4 m on either side of the chamber).

Rooted cuttings of poinsettia 'Red Velvet' were potted on 6 April 2005 and pinched to five

nodes on 19 April 2005. Plants were transferred to the growth chambers on 1 May 2005and

allowed to acclimatize for eleven days with continued night interruption lighting (22:00-02:00).

On 11 May 2005, the photoperiod was set to 12-hours. The high pressure sodium lamps were set

with digital timers to run from 23:30 to 10:30 and incandescent lighting demarcated the light

period (23:00-24:00 and 10:00-11:00). At the onset of 12-hour dark periods, either the high

(292C day /242C night) or low (242C day/21+2C night) temperature treatment was

imposed. These treatment temperatures were maintained until all plants were determined to have

undergone floral initiation as described below (11 June 2005). A completely randomized design

with 12 plants per treatment was used.

Initiation Dating

T50 floral initiation dates were determined by SAS Proc Nonlin (SAS Inst., Cary, NC)

with the equation y=(100/l+e(-k*(x-b)) using the following method. Shoot tips were collected









from one lateral on six plants per treatment every 2 days and examined with a Fisher

Stereomaster 45X dissecting scope (Fisher Scientific, Inc., Pittsburgh, PA) to determine the

development stage of each meristem. The stages were rated as described by Grueber and

Wilkins (1994). Meristems rated as stage three or above were considered initiated. These data

were used to calculate a T50 for the number of days from the onset of 12-hour dark periods to

50% floral initiation.

Tissue Collection for RNA Extraction

Tissue collections were carried out beginning on the projected T50 date of the low

temperature, 12-hour dark-period treatment (17 days after the onset of 12-hour dark periods).

Partially expanded leaves were collected from 6 plants per treatment every 4 h for 48 h

beginning of the onset of the light period on day 17. Immediately after the tissue was harvested

it was frozen with liquid nitrogen and transferred to a freezer set to -80C.

Extraction of RNA and Gel-Blot Creation

RNA was isolated from the young leaf tissue using a modified cetyltrimethylammonium

bromide (CTAB) extraction protocol (Chang, et al., 1993). Frozen tissue was ground into a

powder then mixed with an extraction buffer (2% CTAB, 2% PVP, 100 mM Tris-HCl, 25 mM

EDTA, 2.0 M NaCl, 0.5 g-L-1 spermidine, 2% 2-mercaptoethanol) at 10 ml per 1 g of tissue. The

mixture was incubated at 65C for 10 min, cooled to room temperature, followed by extraction

with an equal volume of 24 chloroform : 1 isoamyl alcohol (v/v). The mixture was centrifuged

for 10 min at 8,000 xg. Following centrifugation the aqueous phase (top phase) was transferred

to a clean 15 ml tube and extracted a second time with chloroform:isoamyl. The mixture was

centrifuged once again for 10 min at 8000 xg. Following the second centrifugation the RNA was

precipitated on ice overnight in 0.25 volume of 10 M LiC1. RNA was pelleted by centrifugation

at 10,000 xg for 30 min at 4C. The RNA pellets were then resuspended in 500 [tl of SSTE (1M









NaCi, 0.5% SDS, 10mM Tris, 1mM EDTA) then extracted with an equal volume of 24

chloroform : 1 isoamyl alcohol (v/v). Following centrifugation, the supernatant was transferred

to a clean 1.5 ml centrifuge tube and the RNA was precipitated in 2 volumes of EtOH at -70C

for 30 min. The RNA was pelleted again using the previously described centrifugation technique

then washed with 500 pl of wash solution (76% EtOH, 0.3 M NaOAC treated with DEPC). The

pellets were dried at room temperature then resuspended in 50 .il an RNA resuspension buffer

(10mM Tris, 2.5mM EDTA) for storage.

The RNA was separated on agarose gels containing 1.5% agarose and 5.0% formaldehyde

(v/v) with 10 pg of RNA per lane. The RNA was transferred to a GeneScreen nylon membrane

(Schlicher and Schuell, Keene, NH) with capillary blotting with lOx SSC overnight. The blots

were rinsed in lx SSC and then UV crosslinked.

Probe Hybridization

Transcripts of interest were detected using radiolabeled probes. The DNA templates for

labeling were generated by PCR against cDNA from strawberry (Fragaria vesca and Fragaria x

ananassa) and Arabidopsis thaliana using the primers listed in Table 5-1. Products were

generated representing light-harvesting, chlorophyll-binding protein (CAB), the 18S ribosomal

DNA and CO. The products were radio-labeled with 32P dCTP by random priming using the

Prime-a-Gene kit following manufacturer's instructions (Promega Inc; Madison, WI).

Unincorporated nucleotides were removed using Sephadex G-50 spin columns. The radio-

labeled probes were denatured at 950C for 5 min before addition to the hybridization solution.

The blots were pre-hybridized for at least 2 h in Church and Gilbert Buffer (Church and

Gilbert, 1984), and then the denatured probe was added to the hybridization solution. The blots

were hybridized in a hybridization oven at 650C for 16 h. Following hybridization the blots were

washed three times in successive solutions of lx SSC, 0.1% SDS, the first one at 37C and the









last two at 600C. The blots were air dried for 5 min and then wrapped in plastic wrap before

autoradiography.

Results and Discussion

Plants in the low temperature treatment reached T50 initiation in 17.6 days compared to

25.1 days in high temperature treatment (Table 5-2). The difference is the number of days to

T50 initiation is significant at the 0.05 level. These data indicate that the plants in the low

temperature treatment were indeed in the midst of the shift from vegetative to reproductive

growth during the tissue sampling period during days 17 and 18 while plants in the high

temperature treatment were not.

The autoradiographic images generated from the RNA blots for each treatment are shown

in figures 5-1 and 5-2. Lane 1 on the left side of each image contains the RNA extracted from

tissue collected at time point 0 which is the beginning of the light period on day 17. Each

subsequent lane contains the RNA from the next time point which is 4 h later. Since both

treatments were exposed to 12-h dark periods, time point 12 is the beginning of dark period, and

time point 24 is the beginning of the light period of day 18.

The cyclic expression of CAB is similar in both the high and low temperature treatments

(Fig. 5-1). Expression peaks during the light hours and there is essentially no expression during

the dark hours. The fact that there is not a discernable difference in the expression patterns

between the high and low temperature treatment indicates that the circadian clock or its

entrainment is not altered by the supraoptimal temperature conditions. These results indicate that

the mechanism for heat delay must be occurring later in the floral induction signaling cascade

since floral initiation is taking place during the sampling period in the low temperature treatment

but not in the high temperature treatment.









However, in contrast to the patterns of CAB gene expression CO transcript cycling is

affected by the high temperature treatment (Fig. 5-2). In the low temperature treatment, CO

expression is fairly constant while in the high temperature treatment there is considerable

variations in expression level across the time points. Expression levels increase late in the night

through the morning hours and are lower in the afternoon and overnight hours. Since the T50

initiation data show that the high temperature treatment is not undergoing floral initiation during

the sampling period, the peak in CO around the end of the dark hours may be inhibiting floral

initiation. In short-day plant rice, a CO homolog is known to act as a repressor of flowering in

non-inductive photoperiods. An alternative, and perhaps more likely, explanation is consistent

with the "External Coincidence Model" of photoperiodic flowering (Yanofsky and Kay, 2003).

In this model the accumulation of CO protein based on internal cues would coincide with

external environmental signals, namely light. In arabidopsis, the light quality at the end of the

day is the external cue that dictates if flowering will occur. In low temperature poinsettia CO

transcripts are present at all time points. If protein accumulation follows transcript

accumulation, then it would be expected that CO would be present and the flowering could

commence, consistent with observations. However, if supraoptimal temperatures cause CO to

initiate robust cycling where it is absent during this critical period, as in figure 5-2, then plants

would not be expected to flower.

The alternative explanation makes a hazardous assumption- that protein levels mirror

steady-state transcript levels. Elegant studies by Valverde et al., (2004) show that CO

accumulation is carefully controlled by light quality by degradation and even strong constitutive

expression of CO transcript cannot override posttranslational effects on protein stability.

However, the CO antibodies do not work well outside of arabidopsis (K. Folta, pers. comm.) so









the transcript accumulation levels are the best gauge available. The heat-dependent variations

observed herein are novel and strongly suggest that heat can affect the accumulation of

transcripts directly relevant to photoperiodic flowering, and delineate an area for future inquiry.

Conclusions

This experiment indicates that the underlying mechanism of heat delay in poinsettia may

occur at the CO expression stage of the photoperiodic floral initiation pathway. Of course,

additional research will be necessary to validate this hypothesis. Understanding the mechanism

of this physiological phenomenon could lead to new methods to detect a delay in floral initiation

at an earlier stage of development than currently possible. Currently, poinsettia growers must

wait until floral development and bract coloration are visible which occurs 2 to 3 weeks after

floral initiation depending on conditions. Determining that the crop will be delayed at initiation

would leave growers with more options to overcome the potential problem of late blooming such

as contracting with other growers or adjusting the schedule of another group of plants to fill the

gap.

The study also suggests that it may be possible to override temperature cues by simply

overexpressing CO. It may be of interest to test wild accessions or other cultivars to identify CO

overexpressors or even engineer new cultivars with overexpressing, arrhythmic CO gene

constructs. Based on the preliminary findings in this study both approaches may provide a

means to mitigate the effects of heat on flowering, leading to an increase in profitable production

for growers and better quality, possibly ever-blooming seasonal plants for consumers.









Table 5-1. Primers used for tracking expression of CAB and CO in 'Red Velvet'.
Gene 5' 3'
CAB (A. thaliana) ATGGCCGCCTCAACAATGGC CCGGGAACAAAGTTGGTGGC
CO (A. thaliana) ATGTTGAAACAAGAGAGTAAC TCAGAATGAAGGAACAATCC
CO (F. vesca) TCAGAATGAAGGAACAATCC AGCAAAGTTATGATATTGCTG
Table 5-2. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark
periods in 'Red Velvet' with day/night temperatures of 24/212C or 29/242C.
Day /night temperature (2C) Days to T50 initiation 95% confidence interval
24/21 17.6 16.40 18.60
29/24 25.1 24.13 26.08
zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc
Nonlin with the equation y=(100/1+e(-k*(x-b)).


Time (Hours)


0 4 8 12


p4


16 20 24 28 32 36 40 44


*9~*


Figure 5-1. Expression patterns of CAB and CO with 24020C day/21020C night temperatures
and 12-hour dark periods.


CO




CAB








Time (hours)


0 4 8 12 16 20 24 28 32 36 40 44


CO



CAB


Figure 5-2. Expression patterns of CAB and CO with 292C day/24+2C night temperatures
and 12-hour dark periods.


Pr"









CHAPTER 6
RESEARCH SUMMARY

In a 4-year series of studies, the nature and mechanisms of high temperature delay in

poinsettia flowering were investigated. Experiments were designed to elucidate the effects of

supraoptimal temperatures as well as the timing, duration, and diurnal distribution of the

supraoptimal temperatures on the photoperiodic flowering response of modern poinsettia

cultivars and the underlying mechanism for these effects. Standard temperature treatments were

used throughout the course of the study: high (292C day /242C night) and low (242C

day/21+2C night) with the exception of the experiments designed to investigate the effect of

diurnal distribution of supraoptimal temperatures which utilized a variety of temperature

treatments.

First, several experiments were conducted including a variety of commercially important

poinsettia cultivars to determine the range of the heat delay sensitivity present in modern

cultivars. All cultivars tested did experience some delay in flowering at the high temperature

treatment compared to the low temperature treatment in natural day length conditions. However,

the magnitude of this delay varied by cultivar. Examination of shoot tips at the microscopic

level revealed that the delay in flowering time was a direct result of a delay in floral initiation

rather than floral development.

Several pairs of closely related cultivars were exposed to the high and low temperature

treatments and it was noted that within the pairs the number of days of delay in floral initiation

were almost identical. Between pairs the degree of delay was not similar. This indicates that

there is a range of heat delay sensitivity linked to the plant's genotype so there is a possibility for

breeding progress to reduce or eliminate the problems in poinsettia production caused by heat

delay.









The next phase of the study consisted of identifying the effects of the timing and duration

of high temperature exposure on the degree of heat delay that occurs. Cultivar 'Autumn Red'

was selected for these studies as its heat delay sensitivity was average among the cultivars tested.

Results showed that both the timing and duration of high temperature exposure had significant

effects on the timing of floral initiation in natural day conditions. The timing of high

temperature exposure is the key to whether or not a delay in initiation occurs. There is a window

of time in which the plant is susceptible to heat delay which begins about 14 days before

microscopically visible floral initiation and continues though about 14 days following this stage.

High temperatures exposure before or after this 28-day window does not cause any delay in

floral initiation or development. During the time window, the duration of high temperature

exposure determines the number of days delay in floral initiation. At least 14 days of high

temperatures is required to produce a significant delay in floral initiation, and increasing the

exposure time up to 28 days increases the number of days of delay in floral initiation compared

to low temperature control plants. This information will allow poinsettia producers to predict

early in the production cycle whether or not their crops will be impacted by heat delay. The

ability to predict the delay in flowering before the plants show visible floral development will

leave growers with more viable options to overcome the problem.

The next studies investigated the role of diurnal distribution of the high temperature

exposure. There is a long standing belief among poinsettia growers that high night temperatures

of 23C or higher are the cause of heat delay which is based on data from studies conducted

several decades ago. Recent research on chrysanthemum has found that the diurnal mean

temperature is more strongly linked to heat delay in that species. The current studies in both

growth chambers and greenhouse compartments showed that heat delay in poinsettia is also the









result of elevated mean diurnal temperatures of 26C or above. This knowledge also allows

growers to more accurately predict when heat delay will affect their crops by measuring diurnal

mean temperature rather than relying on overnight low temperature to indicate the possibility of

heat delay.

Finally, an attempt was made to uncover the underlying mechanism of the heat delay effect

on poinsettia. RNA was extracted from leaf tissue sampled at 4 h intervals when the plants in the

low temperature treatment were undergoing floral initiation. Meristem examination revealed that

the plants in the low temperature treatment were in fact undergoing floral initiation during the

sampling period and those in the high temperature treatment were not. Cyclic expression

patterns were monitored for 2 transcripts which are associated with light sensing (CAB) and

photoperiodic floral induction (CO) in arabidopsis. The results showed no change in expression

of CAB between the high and low temperature treatments, but a difference was observed in CO

expression. With high temperatures there were greater daily fluctuations in CO which may be

causing an inhibition in flowering as the CO expression peaks just before dawn. Additional

study is necessary to confirm this hypothesis.

This series of studies yielded several valuable insights on the effects of supraoptimal

temperatures on poinsettia that are directly applicable to poinsettia production in Florida and

other warm climates around the world. With this new information poinsettia producers will be

able to accurately predict when heat delay will impact theirs crops early enough in the

production schedule to have viable options to overcome the looming problem. Also, the

information generated by cultivar comparison gives the poinsettia breeders insight into the

genetic component of heat delay sensitivity to enable future breeding progress to work towards

the eventual mitigation of heat delay in poinsettias. Finally exploring the expression of genes









involved in the heat delay effect are representative of an important stage of molecular biology

that is beginning today and will lead to many future discoveries. The knowledge and techniques

generated in the model systems such as arabidopsis are now sufficiently developed to allow

application to more economically important crops such as poinsettia.









LIST OF REFERENCES


Abe, M. 2005. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the
shoot apex. Science 309:1052-1056.

Adams, S. R., S. Pearson, and P. Hadley. 2001. Improving quantitative flowering models through
a better understanding of the phase of photoperiod sensitivity. J. Exp. Bot. 52: 665-662.

Anderson, N. 0., and P. D. Ascher. 2001. Selection of Day Neutral, Heat Delay Insensitive
Dendranthema xgrandiflorum Genotypes. J. Amer. Soc. Hort. Sci. 126(6): 710-721.

Anderson, N. 0., and P. D. Ascher. 2004. Inheritance of Seed Set, Germination, and Day
Neutrality/Heat Delay Insensitivity of Garden Chrysanthemums (Dendranthema
xgrandiflora) under Glasshouse and Field Conditions. J. Amer. Soc. Hort. Sci. 129(4):
509-516.

Anonymous. 1999. Poinsettia FASTFAX. www.ecke.com/html/fastfax. Paul Ecke Ranch

Anonymous. 2004. North American Gazetteer. AllRefer.com Reference.
http://reference.allrefer.com/gazeteer

Anonymous. 2007. Astronomical Applications Department, United States Naval Observatory.
http://aa.usno.navy.mil/

Barrett, J.E. 2004. Heat Delay in Poinsettias. Greenhouse Product News 14(8): 16-19. And
Unpublished Data from 2003 Heat Delay Studies.

Bernier, G., A. Havelange, C. Houssa, A. Petitjean, and P. Lejune. 1993. Physiological Signals
That Induce Flowering. The Plant Cell 5:1147-1155.

Bernier, G., L. Corbeiser, and C Perilleux. 2002. The Flowering process: On the Track of
Controlling Factors in Sinapsis alba. Russian Journal of Plant Physiology 49(4): 445-450

Blazquez, M.A., J.H. Ahn, and D. Weigel. 2003. A thermosensory pathway controlling flowering
time in Arabidopsis thaliana. Published online. Doi:10.1038/ngl085.

Borthwick, R.A. 1964. Phytochrome action and its time displays. The American Naturalist.
902:347-357.

Boss, P.K., R.M. Bastow, J.S. Myline, and C. Dean. 2004. Multiple Pathways in the Decision to
Flower: Enabling, Promoting, and Resetting. Plant Cell 16(S):S18-S31.

Cathey, H.M. 1954. Chrysanthemum Study. C. The effect of night, day, and mean temperature
upon the flowering of chrysanthemum morifolium. Proc. Amer. Soc. Hort. Sci. 64:499-
502.









Cathey, H.M. 1963. Chrysanthemum temperature study. F. The effect of temperature on the
critical photoperiod necessary for the initiation and development of flowers of
Chrysanthemum morifolium. Proc. Amer. Soc. Hort. Sci. 69:485-491.

Carre, Isabelle A. 2002. ELF3: a circadian safeguard to buffer effects of light. Trends in Plant
Science 7(1):4-6.

Chang, S., J. Puryear, and J. Cairney. 1993. A simple and efficient method for isolating RNA
from pine trees. Plant Mol. Biol. Rpt. 11:113-116.

Church, G.M. and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci.81:1991-1995.

Cockshull, K.E. and Kofranek, A.M. 1993. High night temperatures delay flowering, produce
abnormal flowers and retard stem growth of cut-flower chrysanthemums. Scientia
Horticulturae 56(3):217-234.

Corbesier, L., E. Prinsen, A. Jacqmard, P. Lejune, H. Van Onckelen, C. Perilleux, and G.
Bernier. 2003. Cytokinin Levels in Leaves, Leaf Exudate, and Shoot Apical Meristem of
Arabidopsis thaliana during floral transition. J. Exper. Bot. 54(392):2511-2517.

Corbesier, L. and G. Coupland. 2006. The quest for florigen: a review of recent progress. J.
Exper. Bot. 57(13):3395-3403.

Corbesier, L, C. Vincent, J. Seonghoe, F. Fornara, Q. Fan, I. Searle, A.Giakountis, S. Farrona, L.
Gissot, C. Turnbull, G. Coupland. 2007. FT protein movement contributes to long-distance
signaling in floral induction of arabidopsis. Science 319:1030-1033.

Cremer, F. and G. Coupland. 2003. Distinct photoperiodic responses are conferred by the same
genetic pathway in Arabidopsis and rice. Trends in Plant Science 8(9):405-407.

Ecke, P. Jr., O.A. Matkin, and D. E. Hartley. 1990. The Poinsettia Manual Third Edition. Paul
Ecke Poinsettias, Encinitas, California.

Ecke, P. III., J.E. Faust, A. Higgins, and J. Williams. 2004. The Ecke Poinsettia Manual. Ball
Publishing, Batavia, IL.

Erwin, J. 2005. Factors affecting flowering in ornamental plants. Flower Seeds: Biology and
Technology, eds. M. B. McDonald and Francis Y. Kwong. CAB International. Chapter 6,
pp. 87-115.

Evans, M.R., H.F. Wilkins, and W.P. Hackett. 1992. Meristem Ontogenetic Age as the
controlling factor in long-day initiation in Poinsettia. J. Amer. Soc. Hort. Sci. 117(6):961-
965.

Foyer, C.H., M. Parry, and G. Noctor. 2003. Markers and Signals associated with nitrogen
assimilation in higher plants. J Exper. Bot. 54 (382): 585-593.









Gamini-Kannangara, C. and Mats Hansson. 1998. Arrest of chlorophyll accumulation prior to
anthocyanin formation in Euphorbia pulcherrima. Plant Physiol. Biochem. 36:843-848.

Garner, W.W. and H.A. Allard. 1920. Effect of the relative length of day and night and other
factors of the environment on growth and reproduction in plants. J. Agr. Res. 18:553-606.

Garner, W.W. and H.A. Allard. 1923. Further studies on photoperiodism, the response of plants
to relative length of night and day. J. Agr. Res. 23:871-920.

Gartner, J.B. and M.L. McIntyre. 1957. Effect of day-length and temperature on time of
flowering in Euphorbia pulcherrima (poinsettia). Proc. Amer. Soc. Hort. Sci.. 69:492-497

Goddard, G.B. 1961. Flower initiation and development in poinsettia (Euphorbia pulcherrima
Willd.). Proc. Amer. Soc. Hort. Sci. 77:564-574.

Grueber, K.L. and H.F. Wilkins. 1994. Inflorescence initiation and development. The Scientific
Basis of Poinsettia Production. Agricultural University of Norway, Aas, Norway.

Hailong A., C. Roussot, P. Suarez-L6pez, L. Corbesier, C. Vincent, M. Pifieiro, S. Hepworth, A.
Mouradov, S. Justin, C. Turnbull and G. Coupland. 2004. CONSTANS acts in the phloem
to regulate a systemic signal that induces photoperiodic flowering of Arabidopsis.
Development 131:3615

Halliday, K. J., and G. C. Whitelam 2003. Changes in Photoperiod or Temperature Alter the
Functional Relationships between Phytochromes and Reveal Roles for phyD and phyE.
Plant Physiol. 131:913-1920.

Halliday, K. J., M. G. Salter, E. Thingnaes, and G. C. Whitelam. 2003. Phytochrome Control of
Flowering is Temperature Sensitive and Correlates with Expression of the Floral Integrator
FT. Plant Journal 33(5):875-881.

Hamner, K.C. and J. Bonner. 1938. Photoperiodism in the relation of plant hormones as factors
in floral initiation and development. Bot. Gaz. 100:388-431.

Hek, J. 1993. Influence of duration and placement of a high night temperature on morphogenesis
of Dendranthema grandiflora. Sciencia Horticulturae 54(4):327-335.

Imaizumi, T. and S.A. Kay. 2006. Photoperiodic control of flowering: not only by coincidence.
Trends in Plant Science 11(11):550-558.

Izawa, T., T. Oikawa, S. Tokutomi, K. Okuno, and K. Shimamoto. 2000. Phytochromes confer
the photoperiodic control of flowering in rice (a short day plant). Plant J. 22:391-399.

Izawa, T. 2002. Phytochrome mediates the external light signal to repress FT orthologs in
photoperiodic flowering of rice. Genes Dev. 16:2006-2020

Jackson, S. and B. Thomas. 1997. Photoreceptors and signals in the photoperiodic control of
development. Plant, Cell and Environment 20(6):790-795.









Johnson, E., M. Bradley, N.P. Harbred, G.C. Whitelam. 1994. Photoresponses of light-grown
phyA mutants of Arabidopsis. Phytochrome A is required for the perception of daylength
extensions. Plant Physiology 105:141-149.

Kannangara, C.G. and M. Hansson. 1998. Arrest of chlorophyll accumulation prior to
anthocyanin formation in Euphorbia pulcherrima. Plant Physiol. Biochem. 36(12):843-848.

Karlsson, M.G., J.E. Heins, J.E. Erwin, and R.D. Berghage. 1989. Development rate during four
phases of chrysanthemum growth as determined by preceding and prevailing temperatures.
J. Amer. Soc. Hort. Sci. 114(2):234-240.

Korner, 0. M., J. Bakker and E. Heuvelink. 2004. Daily Temperature Integration: a Simulation
Study to quantify Energy Consumption. Biosystems Engineering. 87(3):333-343.

Kristoffersen, T. 1969. Influence of day-length and temperature on growth and development in
poinsettia. Acta Hortic. 14:73-89.

Kulikowska-Gulewska, H., and J. Kopcewicz. 2002. The involvement of gibberellins in
phytochrome controlled flowering in Pharbitis nil. Acta Soc. Bot. Pol. 71(1):23-27.

Langhans, R.W. and R.O. Miller. 1960. Influence of day-length, temperature and number of
short days on the flowering of poinsettia (Euphorbia pulcherrima Willd.). Proc. Amer. Soc
Hort. Sci. 75:753-760.

Langhans, R.W. and R.A. Larson. 1960. The influence of day and night temperatures on the
flowering of poinsettia (Euphorbia pulcherrima). Proc. Amer. Soc. Hort. Sci. 75:748-752.

Langhans, R.W. and R.A. Larson. 1960. Influence of day length, temperature, and the number of
short days on the flowering of poinsettia (Euphorbia pulcherrima). Proc. Amer. Soc. Hort.
Sci. 75:753-760.

Langton, F.A. and J.S. Horridge. 2006. The effects of averaging sub- and supra-optimal
temperatures on the flowering of Chrysanthemum morifolium. Journal of Horticultural
Science and Biotechnology. 81(3):335-340

Larsen, R. 1982. The effect of night temperature on flower initiation and early differentiation of
Chrysanthemum morifolium. Swedish J. Agric. Res. 12:95-102.

Larson, R.A., and R.W. Langhans. 1963a. The influence of photoperiod on flower bud initiation
in poinsettias (Euphorbia pulcherrima Willd.). Proc. Amer. Soc. Hort. Sci. 82:547-551.

Larson, R.A., and R.W. Langhans. 1963b. The influence of temperature on flower bud initiation
in poinsettias (Euphorbia pulcherrima Willd.). Proc. Amer. Soc. Hort. Sci. 82:552-546.

Larson, R.A., and R.W. Langhans. 1963c. Quantitative measurements of the morphological
changes in the shoot apex of poinsettias (Euphorbia pulcherrima Willd.) in the transition
from the vegetative to the reproductive state. Proc. Amer. Soc. Hort. Sci. 82:541-546.









Lentz, E. 1998. Model applications in horticulture: a review. Scientia Horticulturae. 74:151-174.

Marousky, F.J. 1968. Effects of temperature on anthocyanin content and color of poinsettia
bracts. Proc. Amer. Soc Hort. Sci. 92:678-680.

McClung, R. C. 2001. Circadian Rhythms in Plants. Plant Physiol. Plant Mol. Biol. 52:139-162

Miller, R. 0. and D.C. Kiplinger. 1962. Two Year Study on Poinsettia Habits. Flor. Rev.
131(3390):59-60; 108-113

Moller, S. G., P. J. Ingles and G. C. Whitelam. 2002. The cell biology of phytochrome signaling.
New Phytologist 154:553-590.

Mouradov, A., F. Cremer, and G. Coupland. 2002. Control of flowering time: interacting
pathways as a basis for diversity. Plant Cell 16(S):S111-S130.

Niu, G., R. D. Heins, A. Cameron, and W. Carlson. 2001. Temperature and Daily Light Integral
Influence plant Quality and Flower Development of Campanula carpatica 'Blue Clips',
'Deep Blue Clips', and Campanula 'Birch Hybrid'. HortScience 36(4):664-668.

Pearson, S., P. Hadley, and A.E. Wheldon. 1993. A reanalysis of the effects of temperature and
irradiance on the time to flowering in chrysanthemum (Dendranthema xgrandiflora).
Journal of Horticultural Science 68(1):89-97.

Post, K. 1937. The determination of normal date of bud formation of short day plants. Proc.
Amer. Soc. Hort. Sci. 34:618-620.

Quail, P.H. 2002. Phytochrome photosensory signaling networks. Nature Rev. Mol. Cell Biol.
3:85-93.

Rao, C.V. 1971. Anatomy of the inflorescence of some Euphorbiaceae with a discussion on the
phylogeny and evolution of the inflorescence including the cyathium. Bot. Notiser. 124:39-
64.

Ratkowsky, D.A. 1990. Handbook of Non-Linear Regression Models. Marcel Dekker, New
York, NY.

Reeves, P. H., and G. Coupland. 2000. Responses of plant development to environment: control
of flowering by day-length and temperature. Current opinions in Plant Biology 3(1):37-42.

Roberts, R.H. and B.E. Struckmeyer. 1938. The effects of temperature and other environmental
factors upon the photoperiodic responses of some of the higher plants. J. Agric. Research.
56(9):633-677.

Rohwer, C.L. and R.A. Heins Daily light integral, prevernalization photoperiod and temperatures
and duration control flowering of easter cactus. HortScience. 42(7): 1596-1604.









Russell, N.H. 1960. Studies in the photoperiodic responses of violets (Viola). The Southwestern
Naturalist. 5(4):177-186.

Searle, I. and G. Coupland. 2004. Induction of flowering by seasonal changes in photoperiod.
The EMBO Journal 23:1217-1222.

Simpson, G.G. and C. Dean. 2002. Arabidopsis, the Rosetta Stone of Flowering Time? Science
296(5566):285-289.

Spalding, E.P. and Folta, K.M. 2005. Illuminating topics in plant photobiology. Plant, Cell &
Environment 28(1):39-53.

Stewart, R.N. and T. Arisumi. 1966. Genetic and histogenic determination of pink bract color in
poinsettia. Journal of Heredity 57(6):217-222.

Struckmeyer, B.E. and G.E. Beck. 1960. Flower bud initiation and development in poinsettia
(Euphorbia pulcherrima Willd.). Proc. Amer. Soc Hort. Sci. 75:730-738.

Suarez-L6pez P., K. Wheatley, F. Robson, H. Onouchi, F. Valverde, and G. Coupland. 2001.
CONSTANS mediates between the circadian clock and the control of flowering in
Arabidopsis. Nature 410: 1116-1120.

Taiz, L., and E. Zeiger. 2002. Plant Physiology: Third Edition. Sinauer Associates, Inc.
Sunderland MS. Chapter 24:386-387.

Takano, M. 2001. Isolation and characterization of rice phytochrome A mutants. Plant Cell.
13:521-534.

Thomas, B., and D. Vince-Prue. 1997. Photoperiodism in Plants, second edition. Academic
Press. San Diego, California.

Tretyn, A., J. Czaplewska, M. Cymerski, J. Kopcewicz, and K.E. Kendrick. (1994). The
mechanism of calcium action on flower induction in Pharbitis nil. J. of Plant Physiol. 144
(4-5):562-568.

Valverde, F., A. Mouradov, W. Soppe, D. Ravenscroft, A. Samach, G. Coupland. 2004.
Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303:
1003-1007.

Vince-Prue, D. 1975. Photoperiodism in Plants. McGraw-Hill Book Company (UK) Limited.

Vince-Prue, D. and O.V.S. Heath. 1983. The perception of light-dark transition. Philosophical
Transactions of the Royal Society of London. Series B, Biological Sciences.
303(1116):523-536.

Vondrakova, Z., J. Krekule, and I. Machackova. (1998). Is the root effect on flowering of
Chenopodium rubrum mediated by cytokinins? J. Plant Growth Regul. 17:115-119









Wang, N. 2001. An examination of poinsettia cultivar differences in response to photoperiod and
light during the dark period. Master's thesis, University of Florida

Whealy, C.A., T.A. Nell, J.E. Barrett, and R.A. Larson. 1987. High Temperature Effects on
Growth and Floral Development in Chrysanthemum. J. Amer. Soc. Hort. Sci. 112:464-468.

Wieland, C.E. 1998 An examination of night length effects on differences in floral initiation and
development for poinsettia cultivars under high temperatures. Master's thesis, University
of Florida.

Willits, D.H. and D.A. Bailey. 2000. The effect of night temperature on chrysanthemum
flowering: heat-tolerant versus heat-sensitive cultivars. Scientia Horticulturae 83 (3-
4):325-330.

Wu, X., Weigel D., and P. Wigge. 2002. Signaling in plants by intercellular RNA and protein
movement. Genes and Development 16:151-158.

Yano, M. 2003. Hdl, a major photoperiod sensitivity quantitative trait locus in rice, is closely
related to the Arabidopsis flowering time gene CONSTANS. Plant Cell 12:2473-2484

Yanovsky, M.C. and S.A. Kay. 2003. Living by the calendar: how plants know when to flower.
Molecular Cell Biology 4:265-275.









BIOGRAPHICAL SKETCH

Rebecca Schnelle earned her bachelor of science in horticulture from the University of

Wisconsin-River Falls. She has been involved in the floriculture industry in several capacities

including as an assistant perennial grower and salesperson. Rebecca is currently a graduate

research fellow in the Environmental Horticulture department at the University of Florida where

she specializes in the impact of physiological issues on production of floriculture crops. Rebecca

has published several articles in scientific journals and trade journals, and has also presented

research results at academic and industry meetings. She is an active member and former

president of the Environmental Horticulture Graduate Student Association. Rebecca plans to

continue her contribution to horticulture through academic pursuits.





PAGE 1

1 TIMING, DURATION, AND DIURNAL DIST RIBUTION OF SUPRAOPTIMAL TEMPERATURES AFFECT FLORAL INITIATION OF POINSETTIA By REBECCA ANNE SCHNELLE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Rebecca Anne Schnelle

PAGE 3

3 To my loving family for all the support that kept me on track and my friends for the distractions that kept me sane through it all. Thank You.

PAGE 4

4 ACKNOWLEDGMENTS First I wish to acknowledge m y undergraduate advisor, Dr. Terry Ferriss. Her guidance and encouragement led me to graduate study. I thank my supervisory committee for their support. In particular I would like to thank my advisor, Dr. Jim Barrett, for designing a perfect graduate experience for me. The hands-off a dvising approach allowed me to build the confidence I need to go on to a faculty positi on. Thanks go to Dr. Barrett for going above and beyond the call of duty with his generous support of my travels. I woul d like to express my gratitude to Dr. Kevin Folta for use of his lab space and materials a nd for his tireless enthusiasm. He introduced me to a part of plant science I would not otherwise have known. I thank Carolyn Bartuska for her invaluable statis tical assistance a nd listening to all my gripes with a laugh and a smile. Also, thanks to Bob Weidman for greenhouse assistance. For generously providing plant material and monetary support of my project I thank Paul Ecke Ranch. Also, I would like to express my appreciation to Ruth Kobayash i for all of her insights and thought provoking questions. Her input always rei nvigorated my research. Finally, thanks go to my husband Dan for his love and devotion.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.......................................................................................................................11 ABSTRACT...................................................................................................................................12 CHAP TER 1 REVIEW OF LITERATURE.................................................................................................14 Mechanisms of Photoperiodic Flowering............................................................................... 14 Photoperiodic Photoreceptors..........................................................................................15 Circadian Clock Function and Entrainment.................................................................... 17 Additional Environmental Cues Aff ecting Photoperiodic Flowering .............................19 Biochemical and Physiological Mechan ism s of Photoperiodic Flowering............................ 21 Physiological Studies of the Floral Signal....................................................................... 21 Biochemical Studies of the Photoperiodic Floral Induction Pathway in Arabidopsis .... 23 Biochemical Studies of Fl oral Induction in Rice ............................................................26 Floral Initiation and Development in Poinsettia..................................................................... 27 Origin of the Poinsettia.................................................................................................... 27 Poinsettia Floral Initiation, Development, and Morphology...........................................29 Night-Length Effects on Floral Initia tion and Developm ent of Poinsettia..................... 31 Ambient Temperature Effects on Floweri ng of Poinsettia and Chrysanthemum ................... 33 Effects of Supraoptimal Temperatures on Floral Initiation and Developm ent............... 34 Temperature and Photoperiod Interaction....................................................................... 34 Effects of Duration and Timing of Supraoptim al Temperatures..................................... 36 Effects of Supraoptimal Day, Night and Diurnal Mean Tem peratures.......................... 37 Temperature Effects on the Development of the Poinsettia Floral Display .................... 41 Objectives...............................................................................................................................43 2 HEAT DELAY IN MODERN POI NSETTIA CULTIVARS................................................ 44 Introduction................................................................................................................... ..........44 Materials and Methods...........................................................................................................47 Data Collection................................................................................................................48 Experiment 1................................................................................................................... 49 Experiment 2................................................................................................................... 49 Experiment 3................................................................................................................... 50 Experiment 4................................................................................................................... 50 Results and Discussion......................................................................................................... ..50 Experiment 1................................................................................................................... 50

PAGE 6

6 Experiment 2................................................................................................................... 51 Experiment 3................................................................................................................... 53 Experiment 4................................................................................................................... 54 Conclusions.............................................................................................................................55 3 TIMING AND DURATION OF HI GH TEMPERAT URE EXPOSURE............................. 66 Introduction................................................................................................................... ..........66 Materials and Methods...........................................................................................................68 Data Collection................................................................................................................69 Experiment 1................................................................................................................... 69 Experiments 2 and 3........................................................................................................ 70 Results and Discussion......................................................................................................... ..70 Experiment 1................................................................................................................... 70 Experiment 2................................................................................................................... 71 Experiment 3................................................................................................................... 74 Conclusions.............................................................................................................................76 4 DAY, NIGHT, AND DIURNAL MEAN TEMPERATURES.............................................. 83 Introduction................................................................................................................... ..........83 Materials and Methods...........................................................................................................85 Growth Chamber Experiments........................................................................................86 Greenhouse Experiments................................................................................................. 87 Data Collection................................................................................................................87 Results and Discussion......................................................................................................... ..88 Experiment 1................................................................................................................... 88 Experiment 2................................................................................................................... 88 Experiment 3................................................................................................................... 89 Experiment 4................................................................................................................... 90 Experiment 5................................................................................................................... 90 Experiment 6................................................................................................................... 91 Conclusions.............................................................................................................................93 5 HEAT DELAY MECHANISMS......................................................................................... 101 Introduction................................................................................................................... ........101 Materials and Methods.........................................................................................................104 Initiation Dating.............................................................................................................104 Tissue Collection for RNA Extraction..........................................................................105 Extraction of RNA and Gel-Blot Creation .................................................................... 105 Probe Hybridization.......................................................................................................106 Results and Discussion......................................................................................................... 107 Conclusions...........................................................................................................................109

PAGE 7

7 6 RESEARCH SUMMARY.................................................................................................... 112 LIST OF REFERENCES.............................................................................................................116 BIOGRAPHICAL SKETCH.......................................................................................................123

PAGE 8

8 LIST OF TABLES Table page 2-1. Night length during Expts. 1-4 calculated from civil twilight at 29' N latitude (United States Naval Observatory, 2007).......................................................................... 58 2-2. Number of days to first color, visible bud, and anthesis from the onset of natural days (30 Sept. 2004) with high (29C day /24C night) or low (24C day/21C night) temperature treatments...................................................................... 58 2-3. Days to first color, visible bud, and an thesis from pinching (1 Sept. 2005) with high (29C day /24C night) or low ( 24C day/21C night) temperature treatments..................................................................................................................... ......59 2-4. Number of days to 50% floral initiation from pinc hing (1 Sept. 2005) with high (29C day /24C night) or low ( 24C day/21C night) temperature treatm ents..................................................................................................................... ......59 2-5. Pairwise comparison of T50 values in Table 2-4 (Expt. 2)................................................... 59 2-6. Natural-day night lengths for the initia tion dates of Autumn Red and Red Velvet with high (29C day /24C night ) or low (24C day/21C night) tem perature treatments calculate d from civil twilight times.............................................. 60 2-7. Number of days to first color, visible bud, and anthesis from pi nching (1 Sept. 2006) for high (29C day /24C night) and low (24C day/21C night) temperature tr eatments....................................................................................................... 60 2-8. Days to 50% floral initiation from pinchi ng (1 Sept. 2006) with high (29C day /24C night) or low (24C day/21 C night) tem perature treatments................ 61 2-9. Natural-day night lengths f or initiation dates with high (29C day /24C night) or low (24C day/21C night) temper ature treatments calculated from civil twilight times.....................................................................................................................61 2-10. Number of days to first color, visibl e bud, and anthesis from pinching (1 Sept. 2007) with high (29C day /24C night ) or low (24C day/21C night) temperature tr eatments....................................................................................................... 62 2-11. Days to 50% floral initiation from pinching (1 Sept. 2007) with high (29C day /24C night) or low (24C day/ 21C night) tem perature treatments................ 62 2-12. Natural-day night lengths for initiation dates with high (29C day /24C night) or low (24C day/21C night) temper ature treatments calculated from civil twilight times.....................................................................................................................63

PAGE 9

9 3-1. Number of days to visible bud and anthes is in Prestige Redfrom the onset of 12-hour dark periods........................................................................................................................79 3-2. Number of days to first color, visible bud, and anthesis from pi nching (Sept. 1, 2006) in Autumn Red with high temperatures (29C day /24C night) applied for listed intervals....................................................................................................................79 3-3. Number of days to 50% floral initiation in Autum n Re dfrom pinching (1 Sept. 2006) with high temperatures (29C day /24 C night) applied for listed intervals............. 80 3-4. Pairwise comparison of T50 va lues from Table 3-3 (Expt. 2).............................................. 80 3-5. Number of days to first color, visible bud, and anthesis from pi nching (1 Sept. 2007) with high temperatures (29C day /24 C night) applied for listed intervals............. 81 3-6. Days to 50% floral initiation in Aut um n Redfrom pinching (1 Sept. 2007) with high temperatures (29C day /24C night ) applied for the li sted intervals.......................81 3-7. Pairwise comparison of T50 values from Table 3-6.............................................................. 82 4-1. Temperature treatments for greenhouse experiments............................................................ 94 4-2. Number of days to 50% fl oral initiation in Red Velvet from the onset of 12-hour dark periods with day/night temp eratures of 26/18C, 26/21C, or 26/24C............. 95 4-4. Days to 50% floral initiation for Red Velvet from the onset of 12-hour dark periods with day/night temperatures of 26/23C, 29/24C, or 29/18C...........................95 4-5. Student t-test pairwise compar ison of T50 values in Table 4-4. ........................................... 95 4-6. Days to 50% floral initiation from the onset of 12-hour dark periods with day/night tem peratures of 24/29C, 24/24C, or 29/24C....................................................96 4-7. Student t-test pairwise compar ison of T50 values in Table 4-6. ........................................... 96 4-8. Days to T50 initiation from the onset of 12-hour dark periods with day/night temperatures of 21/27C, 27/21C, or 27/27C....................................................97 4-9. Student t-test pairwise compar ison of T50 values in Table 4-8. ........................................... 97 4-10. Number of days to first color, visible bud, and anthesis from the onset of 12-hour dark periods in Prestige Red with mean diur nal temperatures of 21C, 24C, or 27C...............................................................................................................................98 4-11. Days to 50% floral initiation from the ons et of 12-hour dark periods for Prestige Red with m ean diurnal temperatures of 21, 24, or 27C. ................................................... 98 4-12. Student t-test pairwise compar ison of T50 values in Table 4-11 ........................................ 98

PAGE 10

10 4-13. Number of days to first color, visible bud, and anthesis from the onset of 12-hour dark periods with mean diurnal temp eratures of 21, 24, or 27C.......................................... 99 4-14. Days to 50% floral initiation from th e onset of 12-hour dark periods with m ean diurnal temperatures of 21, 24, or 27C........................................................................ 99 4-15. Student t-test pairwise compar ison of T50 values in Table 4-14 ...................................... 100 5-1. Primers used for tracking expression of CAB and CO in Red Velvet. ............................. 110 5-2. Number of days to 50% fl oral initiation from the onset of 12-hour dark periods in Red Velvet with day/night temperatur es of 24/21C or 29/24C. ................................ 110

PAGE 11

11 LIST OF FIGURES Figure page 5-1. Expression patterns of CAB and CO with 24C day/21C night tem peratures and 12-hour dark periods........................................................................................................ 110 5-2. Expression patterns of CAB and CO with 29C day/24C night tem peratures and 12-hour dark periods........................................................................................................ 111

PAGE 12

12 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TIMING, DURATION, AND DIURNAL DIS TRIBUTION OF SUPRAOPTIMAL TEMPERATURES AFFECT FLORAL INITIATION OF POINSETTIA By Rebecca Anne Schnelle August 2008 Chair: James E. Barrett Major: Horticultural Science High temperature delay in flowering of poi nsettia termed heat delay can cause a poinsettia crop to reach a marketable stage of floral development too late for holiday sales leading to serious economic losses. First, the range of high temperature sensitivity in modern poinsettia cultivars was investigated. Plants were exposed to either a high (29C day /24C night) or low (24C day/21C ni ght) temperature treatment for 28 days. There were significant delays in floral initiation a nd anthesis between the high and low temperature treatment for all cultivars tested. The delay in fl oral initiation ranged fr om 10 days in Freedom Early Red to 19 days in Prestig e Red. Closely related cultivars showed similar delays in floral initiation. Three experiments were designed to determin e the effects of timing and duration of high temperature exposure on heat delay. High temper ature treatments (29C day / 24C night) were applied for 7 to 28 days at designated times. Seven days of high te mperatures had no effect on flowering time. Twenty-eight days of high temperature exposure caused plants to reached anthesis 12 to 14 days later than the cool temperat ure control. Fourteen days of high temperature exposure before floral initiation led to a delay in anthesis of 5 to 7 days. High temperatures following floral initiation produced no delay in anthesis. These re sults indicate that the timing of

PAGE 13

13 high temperature exposure determines if heat delay will occur and the duration of high temperatures affects the magnitude of the delay. The roles of supraoptimal night, day, or mean diurnal temperature were investigated. In growth chambers, delays in floral initiation we re observed when the supraoptimal temperatures were imposed during the day or night. Gr eenhouse experiments were conducted utilizing temperature treatments with identical daytime hi gh and overnight low temp eratures but divergent diurnal mean temperatures. Flor al initiation in Red Velvet wa s delayed by 6 to 8 days with a mean temperature of 27C compared to plan ts grown with 21C or 24C mean diurnal temperatures, respectively. These data indicate that high temperature delay in floral initiation of poinsettia is the result of exposure to supraoptimal mean diurnal temperatures.

PAGE 14

14 CHAPTER 1 REVIEW OF LITERATURE Mechanisms of Photoperiodic Flowering Photoperiodism is the control of physiological and developmen tal responses by sensing of the relative length of light and dark periods. Photoperiodism was first described by Garner and Allard (1920, 1923) in a study classifying plants as either long day or short day plants for flowering. In short-day plants a night length greater th an the critical night length promotes floral induction and in some cases development (Vince-Prue, 1975). Hamner and Bonner (1938) conducted a study with the short day plant Xanthium to determine that short day plants respond to night length as opposed to day length. Xanthium was exposed to both light interruptions of the dark period and dark interruptions of the light period. They found that a light interruption of the dark period inhibited the flowering response while a dark interruption of the light period did not affect the flowering response. These results indi cate that the short-day response is a result of exposure to a period of uninterrupted darkness. Obligate short-day plants will not flower until the night length reaches the critical night lengt h. Facultative short day plants will flower in non inductive photoperiods in response to temperature or other deve lopmental signals although floral induction is accelerated by inducti ve photoperiodic conditions. The inverse is true for both facultative and obligate long-day plants. Understanding of day-length sensing and photoperiodic responses is the focus of ongoing research. Several models have been proposed ov er the years to reconcil e these phenomena. The model that is currently most accepted is the exte rnal coincidence model. As early as 1936 Edwin Bnning proposed that an endogenous timekeeper controls light mediated responses by promoting these responses when the day-length si gnal occurs during the mo st sensitive phase of the internal rhythm. In recent years the exte rnal coincidence model has been modified in

PAGE 15

15 response to newly emerging data from the model plant system, arabidopsis [ Arabidopsis thaliana (L.) Heynh.]. Currently, the external coincidence model asserts that light serves to reset (entrain) the circadian clock which drives the cyclic expression of numerous plant genes involved in many physiological processes. In addi tion, key regulatory elements linke d to floral induction in longday plant arabidopsis peak in th e late afternoon coinciding with lig ht more during long-days that in short-days. This indicates that the light input must be present when the transcripts or proteins necessary to begin the signaling pa thway leading to floral initiation are above a certain critical threshold. Also a dual function of such factors has been shown in short-day plants in which they act as repressors to flowering (Imazumi and Kay, 2006). In laboratory and many natural conditions this scenario for light signaling seems very plausible. As previously described, classical studies of photoperiodic plants indicate that photoperiod ic responses are controlled by the dark period rather than the light period. In fact, a study on arabidopsis showed that wild-type and mutant plants flowered more quickly in sh ort days when a light break was given during the long night period (Goto et al., 1991). Similarly, in short-day plant rice ( Oryza sativa ) it was recorded that a night break of as little as 10 minutes significantly delayed flowering in short-day conditions. Ishikawa et al. (2005) found that a single inci dent of a night break strongly suppressed mRNA of clock-regulated floral promoter Hd3a, inhibiting flowering. These results reinforce the conclusions from the classical studie s and show that the exte rnal coincidence model while useful is far from fully explaining the m echanisms of photoperiodi c flowering in plants. Photoperiodic Photoreceptors Photorecep tors are plant pigments capable of sensing discrete wavelengths of light and influencing plant developmental processes. Th ere are at least three main classes of these photoreceptors: the phytochromes, cryptochromes, and LOV domain family proteins (phototropins). The latter two groups of photoreceptors respo nd to blue and UV-A light; the

PAGE 16

16 phytochromes are red and far red light responsive (Yanovsky and Kay, 2006). The phytochromes have been determined to be the major photoreceptors in plants involved in the photoperiodic floral induc tion process. Phytochromes form chromoproteins (proteins linked to chromophores) that allow the unit to act as a photoreceptor. The chromoprotein oscillates between two forms (Pfr and Pr) in response to ligh t quality or the absence of light. The Pfr form absorbs primarily at 730 nm and secondarily at 400 nm. The Pr form shows peak absorption at 665nm. With exposure to red light, Pr converts to Pfr which is the biol ogically active form. During the dark period or when exposed to farred light, Pfr reverts to Pr (Thomas and VincePrue, 1997). Classical studies with night inte rruption lighting have shown that phytochrome sensing is far red, red reversible with the last exposure determining the nature of the response (Borthwick, 1964). In recent years the action of phytochromes has been characterized with increased precision. In model long-day plant arabidops is, five phytochrome ch romoproteins have b een identified each encoded by a separate genes named PHYTOCHROME ( PHY ) A, B, C, D, and E (Quail, 2002). Phytochromes are divided into two types, phytochrome A is type I (light labile) and phytochromes B, D, and E are type II (light stable) (Thomas and Vince-Prue, 1997). The functions of these genes have been tested in ar abidopsis with mutant t ypes not producing one or more of the phytochromes. These studies have shown that the light-stable phytochromes are involved in red light responses where phytochr ome A acts to distinguish far-red light from darkness (Yanovsky and Kay, 2006). Arabidopsis mutants lacking phytochrome A flower slightly later than the wild-type in long days cr eated with incandescent lig hts rich in red light. This indicates that the mutant type plants ar e unable to distinguish the light produced by the incandescent bulbs from darkness so the night-length is not sens ed correctly (Johnson et al.,

PAGE 17

17 1994). However, in short-day plant rice phytochr ome A mutants flower w ith wild-type plants (Takano, 2001). Rice plants lacking the chrom ophore necessary for the functionality of all phytochromes is insensitive to photoperiod all to gether causing it to flow er early regardless of photoperiod imposed (Oikawa, et al., 2000). There is also evidence in rice that the effect of a night break is phytochrome B mediat ed. Ishikawa et al. (2005) found that mutant rice lacking phytochrome B did not show a delay in flowerin g following night break tr eatments in short-day conditions. This experimental evidence indicates that the light stable phytochromes play a more important role in flowering time than phytochrome A in short-day plants. Photoreceptors do not act independently, but as links in a light sensing network. Experiments with mutant arabidopsis indicated th e participation of other photoreceptors like blue light absorbing cryptochromes and phototropins in the floral induction process (Halliday et al., 2003). In addition, protein-protein interactions between the phytochromes themselves may play a role in phytochrome mediated responses. Recent studies have shown phytochromes in the type II group (B-E) form a wide variety of heterodime rs, which would allow an additional level of regulation in phytochrome action (Spalding and Folta 2005). Some of the implications of these recent findings will be discussed in relation to ambient temperature effects in a subsequent section. Circadian Clock Function and Entrainment The circadian clock and its ro le in seasonal responses such as flowering, dorm ancy, and carbohydrate storage have been recognized for many years (V ince-Prue, 1975). Circadian rhythms have been observed on many levels within the plant from leaf movement, CO2 assimilation, and gene transcription. Recen t studies have found the output signals from the circadian clock regulate physiological processes in the plant including flowering. Expression and stability of the photoreceptors themselves is circadian clock regulated. Both the

PAGE 18

18 phytochromes and cryptochromes show strong di urnal oscillations (Yanovsky and Kay, 2006). In arabidopsis expression of floral promoter CONSTANS ( CO ) is clock regulated also (Mouradov et al., 2002). This endogenous oscillator responds to environm ental stimuli transmitted by the photoreceptors to establish th e 24 hour circadian rhythm. The circadian oscillator is the core mechanis m for day-length measurem ent. In arabidopsis, the central circadian oscillator has been well described. The oscillator consists of at least two negative regulatory elements: CIRCADIAN CLOCK ASSOCIATED PROTEIN 1 ( CCA1 ) And LATE ELONGATED HYPOCOTYL ( LHY ) and one positive element TIMING OF CAB EXPRESSION 1 ( TOC1 ). These elements are linked in a negative feedback regulatory loop (Increase in TOC1 suppresses CCA1 and LHY and vice versa) (Salome and McClung, 2005). CCA1 and LHY are both MYB -related transcription factors that s how peak levels of expression at both the mRNA and protein levels at dawn. Mutants over-expressing either show general arrhythmia due to a negative feedback reduction in the functions of both CCA1 and LHY This indicates that these are partially redundant in their functions to ge nerate and sustain the circadian rhythm. Conversely, TOC1 expression peaks at dusk. All TOC1 mutants with reduced or no TOC1 expression have all shown shortened pe riods. While plants over-expressing TOC1 show extended periods, but if TOC1 is constitutively expressed arrhythmia results. The structure of TOC1 indicates that it too has a ro le in transcription regulati on. These newly elucidated processes show an elegant ne gative feed-back loop with TOC1 down regulating its own expression by promoting the expr ession of its negative regulators CCA1 and LHY (Yanovsky and Kay, 2006). In addition, new clock associated proteins are bei ng discovered by ongoing research. Four pseudo-response regulators have been described. These proteins are referred to as PSUEDO RESPONSE REGULATOR ( PRR ) 3, 5, 7, and 9 and are all homologs of TOC1

PAGE 19

19 They form the regulatory loops that control the expression of the clock proteins in the CCA1LHY circuit (Imazumi and Kay, 2006). Circadian clock entrainment occurs pr imarily in response to phytochrome and cryptochrome mediated light signal s but temperature cycles also play a critical role. Light entrainment involves several mechanisms. Boss et al. (2004) stated that phytochrome interacting factor 3 ( PIF3 ), zeitlupe ( ZTL ), LOV kelch protein 2 ( LKP2 ), and flavin-binding kelch repeat Fbox 1 ( FKF1) are all putative photoreceptors involv ed in circadian clock entrainment. PIF3, a helix-loop-helix transcrip tion factor, up-regulates CCA1 and LHY Mutations in ZTL and LKP2 cause increases in period length and late flowering in inductive photoperiods. In addition, four newly discovered homologues of TOC1 which peak at different times during the 24-hour cycle may also plant an integral role in clock func tion and/or entrainment (Yanovsky and Kay, 2006). The circadian clock is temperature compensate d, however temperature and pulses do effect entrainment. In arabidopsis, temperature cycles as little as 4C can en train circadian cotyledon movements although the sensing mechanism is unknown (McClung, 2001). Expression of the clock genes is entrained by thermocy lces as well as light and dark cy cles. The level of control of this entrainment (transcriptional or further dow nstream) is currently unknown. Both advances and delays in the phase of the circadian rhythm have been det ected following temperature pulses during different portions of the period. Advance in phase was observed with a four hour cold temperature pulse of 10C in the evening but a de lay in phase occurred following a similar cold temperature pulse in the morn ing (Salome and McClung, 2005). Additional Environmental Cues A ffecting Photoperiodic Flow ering The variety of photoperiodic responses in plants indicates that ther e are many levels of control involved in the floral i nduction process. It seems intuit ive that plants have evolved a wide variety of mechanisms for sensing and inte grating signals from many environmental cues.

PAGE 20

20 Research has indicated that in addition to light signals other environmental cues such as ambient temperature, nutrient status, and carbohydrat e status alter the flowering response of photoperiodic plants (Bernier et al ., 1993; Mouradov et al., 2002). The importance of temperature in photoperiodi c responses has been studied primarily in reference to vernalization. The requirement for specific number of chilling hours to allow floral induction to proceed is well known in many plants. However, ambient temperature has also been shown to have profound effects on flowering. In arabidopsis, slight increases in ambient temperature can accelerate flowering. Increases in spring temperatures in temperate climates lead to early flowering in w ild populations of arabidopsis despite identical photoperiodic conditions (Blazquez et al., 2003) In fall-flowering plants such as chrysanthemum and poinsettia, the inverse effect has been obser ved (Barrett, 2003; Cathey, 1960; Larson and Langhans, 1960; Weiland, 1998). This response will be discussed in the temperature effects section. Evidence suggests that phytochrome is essential for controlling flow ering in response to relatively small changes in ambient temperature. The hierarchy and the functional relationships of the phytochrome species is modified by ambient temperature alterations. In arabidopsis the phytochrome B response is altered by adjusting ambi ent temperatures from 16 to 22C. In shortday conditions at 16C the Phytochrome B mutant fl owers at the same time as the wild-type but at 22C the mutant type flowers early. Phytochrome D and E muta nts also show early flowering in short days regardless of temperature. This in dicates that at different ambient temperatures, the phytochrome species that has the most effect on flowering time can change (Halliday and Whitelam, 2003). This relationship between am bient temperature and photoperiodic responses

PAGE 21

21 illustrates another level on which plants can sense changes in the environment and suggests mechanisms for finer control of flowering tim e by integrating light a nd temperature signals. Long day plant Sinapsis alba flowers only after the comple tion of a complex signaling loop that appears to allow the pl ant to integrate both nutrient a nd carbohydrate status inputs with the day-length signal. In res ponse to an inductive long-day, su crose and isopentenyladenine are exported from the leaves to the roots which export cytokinins and ni trate back to the leaves. The cytokinins are metabolized but the imported nitrat es are converted to glutamine which is later exported back into the phloem where it appears to pl ay a role in translocating the floral signal to the apical meristem (Bernier a nd Perilleux, 2004). This long dist ance signaling ap pears to allow the plant to integrate the carbohydr ate and nutrient status signals before floral induction can continue. These findings illustrate other mechanisms by which plants can combine multiple environmental cues to determine th e most favorable time to flower. Biochemical and Physiological Mechan isms of Photoperiodic Flow ering The origin and nature of the floral signal has fascinated researchers for decades. Historically, the model for flor al initiation has relied upon a ch ain of linear events set into motion by the photoreceptors and leading to the re lease of a specific hormone, the hypothetical compound florigen. Recent studies suggest that photoperiodic floral induction is the result of network of biochemical events initiated by th e phytochrome photorecepto rs (Valverde et al., 2004) Physiological Studies of the Floral Signal Grafting exp eriments indicate that the floral i nduction signals originate in the leaf and are then translocated to the apical meristem. In some species the roots contribute essential compounds to the floral signal as with Sinapsis alba (Bernier et al., 1993). The rate of movement of the floral stimulus also varies widely among plant species (Thomas and Vince-Prue, 1997).

PAGE 22

22 This may partially account for the variety of resp onse times. The inductive floral signal moves mainly in the phloem and often with assimilate flow. Grafting experiments confirmed that the phloem is the primary means of transport but some movement also occurs in the mesophyll (Thomas and Vince-Prue, 1997). Stem girdling ha s been shown to block floral induction in Sinapsis alba (Bernier et al., 1993) but to actually promote flowering in Chenopodium rubrum (Vondrakova, et al., 1998). Upon reaching the apical meristem the signal initiates meristem differentiation and floral evocat ion. There is also evidence su ggesting that there are floral inhibitory compounds which serve to suppress fl owering in non inductive photoperiods. Thus removal of these inhibitory compounds leads to floral induction (Thomas and Vince-Prue, 1997). Bernier, et al. (1993) proposed the theory of multif actorial control indi cating that numerous hormones and other signaling compounds participate in the floral induction process. This theory allows for the presence of both promoting and inhibiting compounds suggesting that interactions between the two groups determine floral initiation. Recent studies on a cellular level lend more credibility to this theory. Much of the early search for the elusive florigen focused on plant hormones as some studies indicated hormonal control of flower ing. There is much evidence supporting the conclusion that plant hormones also play a role in the floral induc tion process in certain plants. Researchers have compared the phloem exudates of plants in induced and non induced states to determine the involvement of plant hormones in the floral transition (B ernier et al., 1993; Corbesier et al., 2003; Vondr akova et al., 1998). In Sinapsis alba an increase in cytokinin levels coincides with the onset of flower ing (Bernier et al., 1993) while in Chenopodium rubrum cytokinin levels drop and giberellin levels increase (Vodrakova et al., 1998). Exogenous application of gibberellins also promote flowerin g in many species including the short-day plant

PAGE 23

23 Pharbitis nil (Kulikowska et al., 2002), but not in others like Sinapsis alba. In this case, the application of exogenous cytokinin caused the meri stem to initiate the floral induction process (Bernier et al., 1993). Calcium and caffeine applied exogenously have also been shown to promote flowering in Pharbitis nil (Tretyn et al., 1994). This wide variety of experimental results led to the conclusion that there is no one florigen or a single plant hormone responsible for driving the floral transition. As more studies attempted to describe the signaling network, the more contributing factors were found verifying th e multifactorial control th eory. While there are clearly many systems for regulat ing flowering time at work across the plant kingdom, studying all of them in detail in impractical. Model pl ant systems have been selected to elucidate the genetic and biochemical basis of the floral signal and the tran sition from the vegetative to reproductive states. Biochemical Studies of the Photoperiodic Floral Induction Pathw ay in Arabidopsis In recent years extensive work on the genetic and biochemical aspects of the floral signal in the model plant system arabidopsis has allowe d a more detailed understanding of the process that occurs following integration of the light sign al. Arabidopsis is a facultative long-day plant with several floral induction pa thways that have been studied. This model system has been utilized for the most detailed studies of photoperi odic floral induction in pl ants (Mouradov, et al., 2002). For this reason, the current understandin g of this pathway is summarized below. Current research has led to a much more de tailed understanding of the nature of this flowering signal and how it moves w ithin the plant. The first st ep in the photoperiodic flowering process is activation of the phytochrome chromoproteins. As previously described, these proteins are the core of the day-length sensing complex in plants. These photoreceptors have also been shown to regulate the expression of the genes that are responsible for the change in meristem identity from vegetative to repr oductive (Imazumi and Kay, 2006; Yanovsky and Kay,

PAGE 24

24 2006). Light dependent partitioning of phytochrom e and signaling intermediates between the nucleus and cytoplasm has led to the suggestion that early signaling events originate in the nucleus. The localization of these molecules may be a signaling control point. Experiments with green fluorescent protein markers have shown that phytochromes A and B accumulate in the nucleus in response to red wavelengths of light (Spalding and Folta, 2005). Also, proteosomemediated degradation of signaling intermediates ma y interact with these localization patterns to form a checkpoint for the further cascade of floral signaling before it is ca rried beyond the cell. These results indicate that essential components of the phytochrom e signal originate in separate organelles and are then integrated to ensure an accurate response to stimuli from the light environment (Moller et al., 2002). Numerous genes that play vital roles in photoperiodic floral induction have been identified in arabidopsis. One of the best understood is CONSTANS ( CO ) which encodes a zinc-finger protein that promotes tr anscription of downstream flowering genes. It is now well known that CO acts as a transcription factor; however the CO protein does not ha ve a typical DNA binding domain. The mechanism of CO action is not completely underst ood. It has been suggested that CO may act in concert with additional transcription factors to upregulate floral gene expression (Imaizumi and Kay, 2006). CONSTANS expression is regulated by the circadian clock with peak expression occurring during the da rk period in short-day conditi ons (Suarez and Lopez, 2001). In long day-lengths high levels of CO expression occur at dawn and dusk. CONSTANS protein stability is enhanced by high far-r ed to red light ratios indicating CO plays a role in sensing light quality as well as day-length (Valverde et al., 20 04). In long day conditions this means that CO protein stability is greatest in the late afternoon and probably regulated by phytochrome signals (Imaizumi and Kay, 2006).

PAGE 25

25 CONSTANS may influence the expression of a numbe r of genes that ultimately impact flowering time, but the best documented are SUPPRESSOR OVEREXPRESSION CO 1 ( SOC1 ) and FLOWERING LOCUS T ( FT). The SOC1 transcript acts downstream of FT in the apical meristem; its function is not completely unders tood. However, mutation studies indicate that SOC1 expression is necessary for floral induction (C orbesier and Coupland, 2006). The gene FT encodes a transcription factor that promotes the expression of the MADS-box genes which control the change in meristem identity and dete rmine the identity of the floral organs (Buchanen et al., 2000). Levels of FT protein have been shown to determine flowering in response to all of the known floral induction pathways in arab idopsis. Recent studies have shown that FT may be the part of the photoperiodic flowering signal that moves from the leaf tissue, where physiological studies indicate the fl oral signal originates, to the shoot apical meristem where the flowering transition occurs (Hail ong et al., 2004). The function of FT is related to an interacting protein FLOWERING LOCUS D ( FD ), a bZIP transcription factor. When these two transcription factors occur together they begin the gene expression processes of floral induction by upregulating meristem-ide ntity genes including APETALA1 ( AP1), FRUITFULL ( FUL ), and LEAFY ( LHY ) at the shoot apical merist em (Abe et al., 2005). The FT gene is expressed primarily in leaf and phloem tissue, but not in the apical meristem where FD is expressed only in the apical meristem. So it is necessary for FT protein to move from its location of synthesis to the apical meristem for the floral transition to occur (Corbesi er et al., 2007). There have been antagonistic factors identified that can also play a role in the photoperiodic floral i nduction pathway. FLOWERING LOCUS C ( FLC ) is a MADS box transcription factor that repr esses flowering by down-regulating FT, SOC1 and LFY. FLC is most commonly observed in Arabidopsis genotypes that require vernal ization. Expression of

PAGE 26

26 FLC is essentially eliminated by a vernalization treatment, so its likely function is to prevent flowering in response to induc tive day-length in the fall season (Boss et al., 2004). In conclusion, the current unde rstanding of photoperiodic flor al induction in Arabidopsis indicates that the process begi ns with light activation of CO in the leaves which induces FT expression. Next, FT protein moves to the shoot apical meristem where in conjunction with FD stimulates expression of SOC1 and AP1 expression, which in turn initiates the transition in meristem identity from vegetative to repr oductive (Corbesier and Coupland, 2006). Biochemical Studies of Fl oral Induction in Rice Rice is com monly used as a model system for photoperiodic flowering in short-day plants. The genes and biochemical processes involved in photoperiodic floral induction in short-day plants have not been documented to the extent as those of long-day model plant arabidopsis (Searle and Coupland, 2004). Severa l genes in rice have been iden tified that relate to the circadian clock and photoperiodic flowering. HEADING DATE ( HD) 1 HD3a and HD6 have all been characterized as quantit ative trait loci which play role s in determining critical night length. HD1 protein is a func tional ortholog of CO protein in arabidopsis. Expression of HD1 affects HD3a which is similar to arabidopsis FT protein. Through mutation studies, both HD1 and HD3a have been demonstrated to be necessary for successful photoperi odic floral induction in rice (Yano et al., 2001). However, the ways in which these homologous genes react to light signals is not similar to Arabidops is. In rice, the expression of HD3a is only activated by HD1 during the dark period and further represses HD3a in response to phytochrome light signals (Izawa et al., 2002). Also the relationship between the relative abundance of HD1 and HD3a appears to be opposite of that in arabidopsis CO and FT. An increase in the expression of HD1 causes a reduction in HD3a abundance. This indicates that HD1 represses flowering in long-day conditions through HD3a The molecular mechanisms for this change in function of the CO -

PAGE 27

27 like gene in rice is not known, howev er it may lie in the fact that CO alone does not act as a transcription factor but rather in concert with ot her transcription factors which have not yet been characterized (Cremer and Coupland, 2003). The similarity in the structures of these orthologous genes indicates that there may be similar mechan isms for photoperiod sensing and signaling between rice and Arabidopsis with di vergent functional rela tionships (Searle and Coupland, 2004). These findings also suggest that the genes involved in the photoperiodic floral induction pathway may be well c onserved in the plant kingdom. Floral Initiation and Development in Poinsettia Poinsettia ( Euphorbia pulcherrima W illd. Ex Koltz.) is a facultative short-day and temperature-sensitive plant for both floral initia tion and development. Many studies over the decades have shown that poinsettias flower faster with increased night lengths and temperatures within the optimum range. The development of the poinsettia inflorescence and the factors that affect it will be discussed. While there has been extensive research on the roles of environmental factors in the reproductive develo pment of poinsettia, there has been considerably more research focused on chrysanthemum ( Dendranthema xgrandiflorum ) especially pertaining to elevated ambient temperature. Chrysanthemum is a major flowering potted crop with a similar pattern of photoperiodic flowering in which ambient temperat ure strongly effects the timing of floral initiation and development. Ex tensive research has been done characterizing the flowering response of chrysanthemum, so it will be re viewed herein although these findings are not necessarily directly applicab le to poinsettia research. Origin of the Poinsettia The poinsettia is n ative to the Sierra Madr e mountain range of Western Mexico and Guatemala. Poinsettias were in troduced to the United States in 1825 by Joel Robert Poinsett. While serving as the United States ambassador to Mexico, Poinsett observed the use of poinsettia

PAGE 28

28 inflorescences by the local people in winter ceremonies, indicating that plants normally bloom in December in their native range. Poinsett collect ed numerous specimens near the town of Taxco de Alarcon, Mexico. These specimens were distributed among the horticultural community. Current data suggest modern poinsettia cultivars are descendants of th ese Mexican accessions (Ecke et al., 12004). This narrow ge netic base may explain why there is little variation in critical night length present amo ng poinsettia cultivars. To fully understand a plants physiological respon se to the environment it is necessary to consider the conditions present during the plan ts evolution. The local ity of the original poinsettia collections near Taxco de Alarcon is at an elevatio n of 1780 meters above sea level with the coordinates 18 32 North by 99 26 West (AllRefer.com Gazetteer, 2004). The average monthly temperatures in Taxco de Alarcon vary little over the course of the year. Average high temperatures range from 23C to 27 C and overnight lows from 8C to 13C. So in its natural range the poinsettia is rarely exposed to temperatures over 27C, unlike the conditions in modern greenhouses where daytim e temperatures regularly exceed 32C. Temperatures drop slightly in October when fl oral induction must occur for late December blooming. The other key aspect of the environment is the natural day-length variation throughout the year. Based on civil twilight times the night le ngth at Taxco de Alarcon ranges from 10 hours 59 minutes to 13 hours 1 minute as recorded by the US Naval Observatory (2007). This relatively small change in day-length most likely accounts fo r the range of critical night lengths seen in modern poinsettia cultivars. This also explains why poinsettia responds so strongly to very small changes in photoperiod which will be discussed below in detail.

PAGE 29

29 Poinsettia Floral Initiation, Development, and Morphology The poinsettia inflorescence consis ts of a dichas ial cluster of cyathia. Each cyathium is enveloped by a symmetrical, uniser ate involucre which bears one nect ary. A variable number of staminate flowers circle a single pistillate flower in the center of the cyathium. (Rao, 1971). Larson and Langhans (1963c) first quantified the stages of floral initiation and development in poinsettias through microscopic observation of the apical meristem. In the vegetative state the apex was about 120 microns in length and flat in appearance. At initiation the apex elongates to 135 microns and is visibly dome d. Differentiation of fl oral bud primordia is visible 7 days later when the apex reaches 150 microns. The poinsettia inflorescence follows a predicable development pattern as first descri bed in a study conducted by Struckmeyer and Beck (1960). This study found that the primary cyathium primordium is the first to differentiate once the meristem has changed from the flat vegetative state to the domed shape indicative of the shift to reproductive development. In the cultivar Ruth Ecke this change in the meristem was detected after 20 short-days. Within the cyathi um primordium, involucre and staminate flower primordia can be detected. Around this early stag e of development, the primordium of the first order branches of the inflores cence become visible as small do me-shaped structures around the primary cyathium primordia. Ten days later, the primary cyathium showed both staminate and pistillate flower primordia and the involucre was elongating. The second order cyathia had also begun to visibly differentiate from the meristem including the bracteal primo rdial associated with each. Following another five days of development, the third order cyathia showed the same level of differentiation as the second order had five days earlier. Developm ent of the subsequent cyathium orders continued for another 25 days fo llowing this pattern. Pollen shed (anthesis) was reached on the primary cyathium after 60 short-days.

PAGE 30

30 Grueber and Wilkins (1994) formulated a lin ear model of inflorescence development for experimental use through electr on microscopy. Twenty-seven disc ernable stages of development were identified from vegetative meristem through anthesis. As previously noted the poinsettia inflorescence requires about 60 days for developmen t from short-days to anthesis, so this model assumes that each stage is about two days in le ngth. The most notable stages for experimental study are three, fifteen, and twenty -seven. Stage three is the firs t stage in which the meristem has visibly changed from the vegetative to reproductiv e state. This stage has been used to define floral initiation (Wang, 2001). At stage fifteen, the primary bracts unfold from the apex. This stage is commonly referred to as visible bud for both commerci al and experimental purposes (Ecke et al., 2004). Stage twenty -seven is marked by pollen shed from the primary cyathium. For experimental purposes, this stage is us ed to mark the completion of reproductive development (Wang, 2001; Weiland, 1998). The dates of visible bud and anthesis can be easily documented without disturbing the plants being studied where the da te of floral initiation can no t. In this case microscopic observation is needed which nece ssitates the removal of sample shoot tips on a regular basis to determine when the population of plants reaches floral initiation. To analyze initiation date in poinsettia, previous studies have used nonlinear analysis (SAS Proc Nonlin) with the logistic equation y = (100/1+exp(-k*(x-b)), where y=percent of meristem s that have undergone floral initiation, k=slope of the curve at the midpoint, x= number of days after a defined time point, and b=day at 50% (T50) initiation (Wang, 2001; Weila nd, 1998). This model generates a nonlinear curve that predicts the time at which 50% of a population has reached a sp ecified state that can not be directly defined such as floral initiation (Ratkowsky, 1990).

PAGE 31

31 Night-Length Effects on Floral Initiation and Development of Poinsettia Obligate short-day plants require a critical night length for fl oral initiation. Night lengths shorte r than the critical night length or light interruption of the dark period will inhibit the flowering response. In faculta tive short-day plants, increased night-lengths promote or enhance flowering (Thomas and Vince-Prue, 1997). The poinsettia and chrysanthemum are both classified as facultative and temperature sensit ive short day plants. To maintain vegetative growth, night-interruptio n lighting with incandescent bulbs from 22:00 to 02:00 is recommended (Ecke et al., 2004). The timing of th e night break is significant as de scribed in previous sections. As a facultative short-day plant the poinsettia w ill eventually flower in long day conditions when the meristem reaches a critical node number. Evans et al. (1992) concluded that long day initiation occurred in a cultivar specific manne r in response to the ontogenetic age of the meristem which can be measured by the number of nodes produced. For decades it has been well documented that poinsettias are facultative short day plants for floral initiation, and flower more rapidl y with increasing night length. Experiments by Garner and Allard (1923) showed that poinsettia Barbara Ecke Supreme flowered more rapidly with a 14-hour night than a 12-hour night. These results were confirmed by additional research. Larson and Langhans (1963a) found that floral initiation in Barbara Ecke Supreme occurred in 14, 16, 18, and 30 days with 16, 15, 14, and 12-hour night s, respectively. Flow ers did not initiate within the experimental peri od with 11 hour nights. A study by Miller and Kiplinger (1962) produced similar results with treatments of 14, 13, 12, 11 and 10-hours dark. Barbara Ecke Supreme initiated flowers in 15, 17, and 33 days in 14, 13, and 12-hour night lengths, respectively, but did not initiat e at 10 and 11-hour nights during th e 67 day study. More recently Weiland (1998) evaluated Lilo Red, Free dom Red, and Success Red with 11.5, 12, and 12.5-hour night lengths. All three cultivars showed floral initiation earliest with the 12.5 hour

PAGE 32

32 dark period. With a 12-hour dark period each cu ltivar showed visible fl oral initiation one to three days later than with a 12.5-hour dark period. However, with a dark period of 11 hours floral initiation in cultivar L ilo Red was delayed by over 10 days when compared to the 12 and 12.5-hour dark periods. Success Red and Fre edom Red did not undergo floral initiation during the experimental peri od with 11-hour dark periods. The previous studies indicate that the critical night length for flor al initiation in most poinsettia cultivars may be around 11 hours; however all the studies discussed used a fixed photoperiod through the course of th e experiment which is not repr esentative of natural growing conditions. Studies have been c onducted with natural day-length conditions at various latitudes for a true assessment of critical night length. The critical night length required for floral in itiation and development is cultivar specific. Early research observing the apical meristem ha s shown that for most poinsettia cultivars in natural day-length conditions visible initiation occurs between September 25 and October 19. This corresponds to night lengths ranging from 11 hours 45 minutes to 13 hours and 8 minutes at the individual research locations (Adams et al., 2001; Gartner and McIntyre, 1957; Goddard 1961; Post, 1937). It is important to note that the cultivars used in these studies are no longer utilized for commercial production at the present date. The gene ral trend in poinsettia breeding has been to move towards cultiv ars with shorter critical night lengths and more rapid floral development to allow earlier flowering in na tural day-length produc tion (Ecke et. al., 1990). Photoperiod also affects flor al development in poinsettia. Greuber and Wilkins (1994) reported that early floral development up to stage fifteen (visible bud) was hastened by increasing the night length from 12 hours dark to 15 hours dark. However, once the plants had reached stage fifteen, 12 hour dark periods hasten ed development compared to 15 hours dark.

PAGE 33

33 This change in the response of development rate to the length of the phot operiod is probably due to the increase in photosynthetic ac tivity coupled by the increase in daily light integral rather than to the photoperiod length in of itself. Ambient Temperature Effects on Flowering of Poinsettia a nd Chrysanthemum Floral induction in poinse ttias occurs primarily in response to photoperiod and temperature. The number of days to floral ini tiation at a given night length is affected by the ambient temperature and the cultivar. Studies have shown that the optimum temperature for rapid floral initiation and development is betw een 16 and 22C for most poinsettia cultivars (Evans et al., 1992; Larson a nd Langhans, 1963). Delays in p hotoperiodic flowering at low temperatures have been documented for ma ny species (Roberts and Struckmeyer, 1938). However, delay in floral initiati on at high temperatures is more unus ual. This type of delay in the flowering response due to supraoptimal ambien t temperature in termed heat delay. Delay in floral photoperiodic floral init iation in response to elevated temperature has been reported in other crop species, chrysanthemum being the most re levant. It is importa nt to note that only selected chrysanthemum cultivars show a pattern of h eat delay similar to poinsettia and many of these heat-sensitive cultivar s are no longer used in commer cial production for this reason (Anderson and Ascher, 2001; 2004). However, the lite rature on the heat delay response of heatsensitive chrysanthemum cultiv ars can be helpful in hypothesi zing about the nature of the poinsettia heat delay response as much more detailed research has been conducted with chrysanthemum. Pearson et al. (1993) reviewed temperature e ffects on chrysanthemum. Their research indicates that the optimum temperature for flowering in chrysanthemum is between 18C and 21C.

PAGE 34

34 Effects of Supraoptimal Temperatures on Floral Initiation and Development There have been m any studies in which delays in flowering time have been documented in response to elevated ambient temperatures. Frequently the assumption has been that the observed delay in the flowering process is the re sult of a delay in floral induction and initiation rather than floral development. However, there are some examples of elevated ambient temperature slowing developmental processes (Gartner and McIntyre 1958; Grueber and Wilkins, 1994; Kristoffersen, 1969; Langhans and Larson, 1960; Langhans and Miller, 1960; Miller and Kiplinger, 1962). It has been demonstrated that the heat delay effect in poinsetti a involves floral initiation as well as floral development. Weiland (1998) f ound that raising the temperature from 24/18C day/night to 29/24C caused a delay of four days in transition of th e meristem from vegetative to reproductive. Grueber and Wilkins (1994) observe d that at 24C constant temperature early floral development was delayed compared to pl ants grown at 21C. However once the primary cyathium had emerged from the bracts (stage fifteen), development to anthesis was hastened by the 24C but was not sufficient to overco me the delay in early development. Temperature and Photoperiod Interaction For the cultivar Barbara Ecke Suprem e, floral initiation occurred at 16C and 11 hour night length but at 21C an 11.5 hour night length was necessary to induce floral initiation within the experimental period. This trend continued with 27C in which case plan ts failed to initiate flowers with 12-hour night, instead a 15-hour ni ght was required to i nduce floral initiation (Larson and Langhans, 1963b). There have been ma ny more studies inves tigating the flowering responses in numerous poinsettia cultivar s with various photoperiod and temperature combinations. The results of these studies c onfirm the trends described; above the optimum temperature for a cultivar floral initiation and/or early development is measurably delayed.

PAGE 35

35 However, the findings in many of these studies ar e not consistent and frequently contradictory with regard to the effect of specific temperatures or photoperiods (Gartner and McIntyre, 1958; Grueber and Wilkins, 1994; Kristoffersen, 1969; Miller and Kiplinge r, 1962; Langhans and Larson, 1960; Langhans and Miller, 1960). This is likely due to in consistencies in experimental and data analysis procedures. For example, in some studies only the night temperature is reported and the day or mean temperatures are not. The results of these studies will be discussed in more detail in subsequent sections. Over the years following these studies, considerable breeding progress has been made and new cultivars of poinsettia introduced. These new cultivars show different plant arch itecture and tend to flower much earlier in natural days than their predecessors (Ecke et al., 2004 ). New studies to characterize the flowering traits of these cultivars are necessary. Studies with modern cultivars show a sim ilar pattern of temperature and photoperiod interaction in floral initiation. Barrett (2004 ) tested 7 modern poinsettia cultivars at three temperature regimens: cool (23C day /21C ni ght), medium (25C day /22C night), and high temperatures (29C day /23C ni ght) at 12 and 13-hour night lengt hs. The date of visible red coloration of the bracts, visible bud (stage 15), and anthesis (sta ge 27) were recorded. At 12hour nights, cultivar Orion reache d anthesis at all thr ee temperature regimens within 5 days of each other. When compared to the cool and medium temperature trea tments, Red Velvet, Victory, and Prestig e Red plants in the high temperat ure treatment reac hed anthesis 14, 20, and 18 days later, respectively. With 13-hours dark, each of the seven cultivars in each temperature treatment reached anthesis within 3 days. Also, with 13-hours dark, each cultivar reached anthesis an average of 15 days sooner than with 12-hours dark. This study confirms that

PAGE 36

36 modern poinsettia cultivars follow the same high temperature response pattern as earlier cultivars even though many respond very differently to a given temperature and p hotoperiod combination. These results indicate that at a marginal photoperiod the flor al stimulus or the plants physiological response to it is sign ificantly affected by temperature. However, with longer night lengths this influence is diminished. The m echanism of this intera ction remains unknown; however the observed delay in floral initiation is likely the result of an adjustment of critical night length by elevated ambient temperature co upled with a reduction in the rate of early inflorescence development. Effects of Duration and Timi ng of Supraoptimal Temperatures Many of the studies that uncovered the heat-d elay response utilized fixed tem perature treatments throughout the experimental period. However, in commercial poinsettia production temperature is often varied through the producti on cycle which necessitates understanding which stages of reproductive development are sensitiv e to high temperature conditions and the duration of high temperatures necessary to produce the obser ved delay in flowering. Little research has been conducted addressing these i ssues in poinsettias. The res earch that has been done with varying duration of high temperat ure exposure was in concert with varying duration of short-day photoperiods (Langhans and Miller, 1960; Miller and Kiplinger, 1962). The impact of the timing and duration of high temperature exposure has been addressed in greater detail with heat-sensitive chrysanthe mum cultivars. Whealy et al. (1987) exposed chrysanthemum Orange Bowl to fourteen different high temperature treatments. These treatments consisted of 2, 4, 6, 8, or 10 weeks of high temperatures (30C/26C day/night) beginning either the first, third, fifth, or seventh week following the onset of short-days. The plants were grown under optimum development temperatures all other times (22C/18C day/night). Treatments beginning th e first or third week of shortdays had the grea test effect on

PAGE 37

37 the number of days to open flower. Two weeks of high temperatures beginning the first week of short-days had no effect on time to flower, but two weeks of high temperatures beginning the third week caused about one week of delay in fl owering time. The treatm ent with six weeks of high temperatures beginning the first week produced the same delay in flowering time as a four week treatment beginning the thir d week. These results indicate that the floral development process may not have begun until two weeks following the onset of short-days. Two, four or six weeks of high temperatures beginning the fifth w eek caused only a small delay in flowering time (three days or less). Finall y, high temperatures applied for two or four weeks beginning the seventh week of short-days had no effect on days to open flower. These re sults clearly indicate that some stages of reproductive development in chrysanthemum are sensitive to high temperatures while others are not. However, in other chrysanthemum cultivars this pattern does not hold. Karlsson et al. (1989) found that in Bright Golden Anne, a temperature treatment of 30C significantly delayed development during all stages of floral development compared to plants grown at 20C. Effects of Supraoptimal Day, Night, and Diurnal Mean Temperatures Elevated day and night tem peratures in combin ation have been demonstrated to cause heat delay in modern poinsettia cu ltivars (Barrett, 2004; Weiland, 1998). In both poinsettias and chrysanthemums, heat delay has been attributed to high night temperatur es. Many of the early studies focused on temperature effects on poinsettia investigated night temper atures only. This is likely due to the prevailing belief at the time th at the flowering response of short-day plants occurred during the inductive night leading to the conclusion that night temperatures would have more impact on flowering. As discussed in th e mechanisms of photoperiodic flowering section, modern studies have shown that floral inducti on is a highly integrated process based on the convergence of many signals.

PAGE 38

38 Roberts and Struckmeyer (1938) reported that po insettia (cultivar not indicated) failed to flower when the minimum night temperature was 21C. In this study plants grown with 16C or 18C minimum night temperatures flowered normally. In contra st, Miller and Kiplinger (1962) found no delay in flowering or in itiation in Barbara Ecke Supr eme with 21C minimum night temperatures compared to 16C or 18C with night lengths of 12 to 15 hours. In fact those plants receiving a 21C minimum night te mperature reached visible bud st age in 28 days compared to 32 days, 36 days, and 47 days with 18, 15, and 13C minimum night temp erature, respectively. Langhans and Larson (1960) inves tigated temperatures effects on Barbara Ecke Supreme with 15-hour night lengths. In this study both day an d night temperatures we re reported. Treatments with night temperatures of 27C reached visible bud 11 to 18 days later than treatments receiving 21C night temperatures regardless of day temp erature. However, considering the night temperatures were imposed for 15 hours per day, it would be expected that the night temperature would have a greater influence on the overall flowering response. A study by Langhans and Miller (1960) investigated the e ffects of constant temperature on flowering in Barbara Ecke Supreme. Plants grown with 16-hour night length and 27C constant temperature reached visible bud only 5 days later than those grown at 21C. These resu lts are in contrast the results of Langhans and Larson (1960). The cause of the variability in the resu lts of these studies despite the use of the same cultivar is unclear. Similar experimental results have been reported with heat-sensitive chrysanthemum cultivars. Cultivar Miros was grown with 16-hour nights and 25C day temperatures. With night temperatures of 24C, anthesis was delaye d by 10 days when compared with plants grown in 21C or 18C night temperatures (Langhans and Larson, 1963b). It was concluded in this study that the night temperature was the cause of the delay. Cathey (1954) also concluded that

PAGE 39

39 the increase in time to flowering observed in chrysanthemum Encore was influenced more strongly by night temperature. As in the poi nsettia studies the ni ght lengths during the experimental period were significantly longer than the day lengths so it is unclear if the apparent influence of night temperature is in fact due to the elevated night temperature or change in the diurnal mean temperature. Pearson et al. (1993) reanalyzed previously published data a ddressing the relative roles of day, night, and mean temperature in chrysanthemum floral development. This analysis led to the formulation of a model for the e ffect of mean diurnal temperat ure on the time to flower in chrysanthemum. This model indicat es that the reciprocal of time to flower is linearly related to increase in the mean diurnal temperature when temperatures are below or within the optimum range with the following equation: 1/f = a+ bT ((f) days from the start of s hort-days to flowering; (T) mean diurnal temperature). Variables (a) and (b) are genotype specific constants. Above the optimum temperature range the r eciprocal of time to flower s hows a negative linear correlation to increase in mean diurnal temperature. Application of this model to the data from Cathey (1954) showed a highly significant positive linear correlation between the reciprocal of days to flower and mean diurnal temperature up to about 21C. Temperature above 21C showed no significant correlation indicating that the optimum temperature had been reached for the cultiv ar Encore. It is important to note that Encore is not a high temperat ure sensitive cultivar and no increase in time to flower was observed with diurnal mean temperatures ra nging from 21C to 27C (Cathey, 1954). This model also accurately predicts the response of high temperature se nsitive cultivars to elevated temperature. When the model was applied to the data from Whealy et al. (1987) a strong negative correlation was found between the reciprocal of days to flower and increase in mean

PAGE 40

40 diurnal temperature from 21C to 27C. Pearson et al. (1993) also stre ssed the importance of effective temperature. When a single temperat ure treatment includes temperatures well above and well below the optimum for the cultivar, the linear relationship between the reciprocal of days to flower and mean diurnal temperature brea ks down. In this case the effective temperature must be calculated before the model can be applied to the data. This model system for illustrating the effects of temperature on time to flower has been widely accepted by researchers studying chrysanthemum. For example, by applying this model Willits and Bailey (2000) determined that in chrysanthemum Iridon, the time to flower increased 4.2 days with each 1C increase in mean temperature above 23C. No published work has addressed the possibility of this model accurately describing the response of poinsettia to temperatures. In fact, the prevailing belief amon g poinsettia producers is that night temperature above 23C is the main cause of heat delay (Eck e et al., 2004). When data from Langhans and Larson (1960) was re-plotted in accordance with the model proposed by Pearson et al. (1993) the reciprocal of the days to flower showed a strong linear correlation to the mean diurnal temperature (linear regression with the formula y= 0.002 + 0.0007x and an R2 value of 0.89). In this case the two treatments with mean diurnal temperatures above 24C were excluded. If the two data points generated by temperature treatments above the apparent optimum were included in the regression, the linear relation between the reciprocal of time to flower and mean diurnal temperature is lost. The data points at 25 C and 27C show a divergence from the linear relationship between reciprocal of days to flower and increasing mean diurnal temperature since there is an increase in days to flower with temper ature increase at these te mperatures while at the cooler temperatures an increase in temperature pr oduced a decrease in the time to flower. This is a mathematical illustration of the observed dela y in flowering time repor ted in poinsettia crops

PAGE 41

41 grown under very warm conditions. There is no t enough data available in the literature to thoroughly test the applicabil ity of this model to flow ering time in poinsettia. Temperature Effects on the Development of the Poinsettia Floral Display As previously described, the inflorescence of poinsettia consists of several orders of cyathia. However, the m arketable floral display consists mainly of the bracts associated with the cyathia. The poinsettia bract is a modified leaf carryi ng excess anthocyanin pigments accompanied with a lack of chlorophyll (K annangara and Hansson, 1998). Bracts are differentiated from leaves by the lack of a pa lisade layer and pigment accumulation in enlarged vacuoles in both upper and lower epidermal cells (S tewart and Arisumi, 1966). The majority of poinsettia cultivars produce red bracts resulti ng from anthocyanin accumulation in all three histogenic layers of the bract. Pink and white cul tivars are produced when pigment is lost in one or more of these layers. Bract color development in poinsettias occurs following floral initiation. Development of color in the bracts occurs as a separate but paralle l process with floral development. Photoperiod and temperature have been shown to effect bract development altering the number, size, and color intensity of the bracts. Langhans and Miller (1960) rated poinsettias as salable or not salable at the time of anthesis This rating was base d on the overall floral presentation taking bract number and color intens ity into consideration. They found that when Barbara Ecke Supreme was grown at 21C or 27 C with a 12-hour night length plants were not salable, but were salable at 14 and 16-hour night lengths. In this study, three temperature treatments were also used: 16C, 21C, and 27 C constant temperature. In Barbara Ecke Supreme, all plants grown at 16C were salabl e at all night lengths; however at 21C plants grown with 12-hour night lengths were not sala ble and at 27C only plan ts grown with 16-hour night lengths were salable.

PAGE 42

42 Struckmeyer and Beck (1960) found that colo r development in poinsettia required short days and an increase in the number of shorts days increased the num ber of colored bracts produced. The effects of temperature and photop eriod on the number of colored bracts were investigated in detail by Kristoffe rsen (1969) with cultivar Vik ing grown at 15C, 18C, or 21C. Increasing night length increased the number of bracts developing color across the temperature treatments and cultivars in this study At all temperatures, Viking did not produce any colored bracts with a 10.5-hour night length. Plants grow n with 13.5-hour nights produced the highest number of colored bracts. Pl ants grown with 11.5 or 12.5-hour night length illustrated the effect of temperature. At bot h photoperiods, the highest number of bracts was produced on the group grown at a constant 18C comp ared to those grown at 15C or 21C. This study also showed that there is a strong genetic component aff ecting the number of bracts produced and the relative color intensity disp layed at various temp erature and photoperiodic conditions. In the cultivar Pau l Mikkelsen the bract number re sponse was very different. In this case the optimum temperature to maximize colored bract number appears to lie above the temperature range used in the study as the numbe r of bracts increased as temperature increased. Marousky (1968) studied the pigment content of bracts of poinsettia Indianapolis Red at 13C, 17C, and 21C. At a constant temperatur e of 21C, the anthocyani n content of the bracts was significantly lower than at 17C and 13C. These findings were representative of the observed red color intensity of the bracts. This experiment was not re peated with any other cultivars so it is not implied that temperatur es above 17C reduce anthocyanin concentration in the bracts of all poinsettia cultivars. Also, in al l of these studies it is important to note that the highest temperature treatments are well below th e range of temperatures causing heat delay in modern poinsettia cultivars grown in the southern United States.

PAGE 43

43 Objectives The present series of studies were designed to ad vance the current understanding of the poinsettia flowering process in modern cultivars under supraoptimal temperatures. The interaction of temperature and photoperiod affects the time to flower for a ll poinsettia cultivars to some extent and in specific cultivars, high temp eratures at the inductive stage cause significant heat delay (increase in time from beginning of inductive photoperiod to full floral display) (Barrett, 2004). The physiology of this interaction and its impact on the floral induction process is not fully understood. The first step in dissecting the mechanism will be to quantify the delay in floral induction relative to ambient temperature and photoperi odic response. Microscopic examination of meristem sections at the beginning of the inductiv e night and at regular in tervals thereafter will be used to pinpoint the time of visible ini tiation under varied temperature regimes. The temperature treatments will test the effects of night and day temperatures during various stages of the floral induction process. The effect of the duration of high night and day temperatures will also be tested. Analysis of th e data collected will elucidate th e effect of ambient temperature elevation of the physiological process of floral initiation in short-day temperature-sensitive plants. Greater knowledge of the heat-delay effect will allow more detailed study of the role of temperature in the floral inducti on pathway of poinsettia. Exam ination of the closely related cultivars will allow a comparison of heat delay and response time with little genetic variability. Variation in heat delay between these closely re lated cultivars will allow future studies to access the mechanism of this effect on a more detailed level.

PAGE 44

44 CHAPTER 2 HEAT DELAY IN MODERN POI NSETTIA CULTIVARS Introduction Poinsettia is a f acultative short-day and temper ature-sensitive plant with regard to floral initiation and development. Floral initiation is hastened by a dark period longer than the critical night length with moderate ambient air temperat ures up to 24C (Langhans and Larson, 1960). High temperatures, especially in combinati on with a marginally inductive photoperiod, may significantly delay floral initiation and color development. This results in a later crop finish time and is termed heat delay. However, high te mperatures accelerate the floral development process (Miller and Kiplinger, 1962). Floral initiation occurs in response to photoperiod and temp erature once the meristem has reached the proper developmental age (Larson and Langhans, 1963a; 1963b; Evans et al., 1992). The number of days to floral initiation at a given night length is a ffected by the ambient temperature and varies with cultivar. Miller and Kiplinger (1962) found that night temperatures below 16C and above 21C delay floral initia tion. Under a 15-hour night length, Wieland (1998) observed a 3 to 4-day delay in floral initiation in Success Red between 24/18C and 29/24C average day/night temperature regimes. In another study with Success Red at moderate (26C day /21C night) and hi gh (30C day /23C night) temperature regimes, flowering was delayed by 12 days between the moderate and high temperature treatments with natural day condi tions, but with 13-hour night le ngths there was no difference in flowering time between the two treatments (Barrett, 2003). In this same study, other cultivars followed a similar pattern. In Prestige Red th ere was a 14 day delay in flowering with the high temperature treatment compared to the moderate temperature treatment in natural days and no delay with 13-hour dark periods. This indicates that high temperat ures may be causing a shift in

PAGE 45

45 the plants critical night length for flowering. Increasing the ni ght length to 13-hours would then prevent a delay in floral initia tion due to an adjusted critical night length assuming that the controlled dark period is longer th an the adjusted critical night length. In chrysanthemum it has been well documented that heat delay is in fact th e result of a delay in fl oral initiation due to an adjustment in critical night lengths at supra optimal temperatures (Anderson and Ascher, 2001). Poinsettia has very similar photoperiodic flow ering response to chrysanthemum so it is reasonable to hypothesize that heat delay in the two species have similar mechanisms. The majority of poinsettia flow ering studies utilized controlle d photoperiods. In the period when these studies were conducted poinsettia cr ops were frequently produced with black-cloth controlled photoperiods. In recent decades poinse ttia production has shifte d to primarily naturalday flowering for a number of reasons. The av erage producer of blooming poinsettias is growing a much larger number of pots than in the past. It is impractical and un economical to use blackcloth to cover the larger growing ranges necessa ry for producing large crops of potted plants. Studying flowering responses in natural photoperiods presents a challenge, as it is impossible to precisely measure the length of natural light and dark periods sensed by the plants. There have been a few studies investigating exactly when dur ing dusk and dawn that plants sense the shift from dark to light and vise versa. However, the findings were highly variable. The light quantity and quality present at the exact delineation between da rk and light varies between species and even cultivars (Vince-Prue and Heath, 1983). A study investigating the light quantity needed for night interruption lighting to pr event flowering in poinsettia found variations between cultivars (Wang, 2001). With these two pieces of information it is reasonable to deduce that the delineation between natural dark and li ght periods is probably cultivar specific in poinsettia. To simplify the situation and compar e studies, civil twilight times have been the

PAGE 46

46 accepted measure of natural photoperiods for decades (Rohwer and Heins, 2007; Russel, 1960). There is no definitive evidence that the light leve l and quality at civil twilight does in fact distinguish the light from dark periods in poinsettia plants. This measure is an approximation used for the sake of discussion and comparison. High temperature delay in flowering is a problem for poinsettia production in warm temperate to tropical climates. These regions ma y experience temperatures in excess of 29 C during the floral initiation period. Since the work cited above was preformed, many commercially important cultivars have been in troduced. In addition, poi nsettia production has shifted from primarily small growers supplying lo cal areas to larger gr owers shipping greater distances. To reduce the cost of input, these larger growers ar e located in areas that allow outdoor or partially protected cultu re. As mentioned earlier, thes e larger producers are not able to control photoperiod with black -cloth. Also, to facilitate long distance shipping poinsettia breeders have developed new varieties with superior plant archite cture and post harvest longevity. Prestige Red is the most notable cu ltivar which exhibits th ese characteristics. Unfortunately, growers have obser ved significant heat delay in P restige Red. So, with the adoption of this new market model and new culti vars, the economic impact of heat delay has increased dramatically in recent years. The recommended technique that growers use to achieve consistent scheduling of poinsettia crops is termed the lights-out method. This entail s the use of night interruption lighting from 22:00-02:00 to preven t premature floral initiation. The lighting is discontinued at the scheduled time to produce a blooming crop fo r the desired time window (Ecke et al., 2004). With this type of production scheduling, growers have reported consistent flowering in early season cultivars such as Freedom Red and Autumn Red, but not later cultivars such as

PAGE 47

47 Prestige Red and Red Velvet. This is most lik ely due to the adjustment of critical night length as discussed earlier. The natural photoperiod at the lights-out date is likely longer than the adjusted critical night length for the early season cultivars but not the later blooming cultivars. However, this is only hypothetical as th e exact critical night lengths are not known. The first part of this study was conducted to de termine the relative heat delay sensitivity of 16 modern poinsettia cultivars since it has not been previously documented. The first experiment utilizes a lightsout production schedule typical for poinsettia production in warm climates such as Florida (Eck e et al., 2004). The latter thr ee studies utilize natural-day flowering. This experimental procedure was imple mented to determine if the observed delay in flowering is a result of a delay in floral initiation due to an adjustment in critical night length by the supraoptimal temperature treatment. Three sets of closely related cul tivars were used in the natural day experiments to determine if heat de lay sensitivity is conserved among closely related cultivars. Materials and Methods Unifor m cultural practices were used for each experiment and all four experiments were conducted in glass-glazed greenhouses located in Gainesville, Florida (29'N latitude) equipped with fan and pad cooling. Rooted cut tings were received from Paul Ecke Ranch (Encinitas, CA) and planted in 105 cm3 pots containing Fafard 2 growing medium (Fafard, Anderson, S.C.), which consists of 6.5 sphagnum peat : 2 perlite : 1.5 vermiculite (v/v). Incandescent night interruption li ghting (22:00-02:00) was used to prevent floral initiation prior to transplant. Fo llowing the termination of night interruption lighting, plants were exposed to natural photoperiodic conditions as shown in Table 2-1. One week af ter planting, all cutting were pinched to five nodes. From planting through 1 Oct., all plants were fertilized with Peters (The Scotts Company, LLC., Marysville, OH) 20N-4.4P-16K supplyi ng Nitrogen at 300 mgL-1.

PAGE 48

48 From 1 Oct. through anthesis fert ilization was adjusted to consta nt liquid feed of Peters 15N2.2P-8K supplying 250 mgL-1 Nitrogen. Plant growth retardan ts (PGRs), which are a part of standard commercial cultural practices, were not used for size control as their impact on flowering time is not fully understood in poinsettia. All four experiment utilized the same temper ature treatments: high (29C day /24C night) and low (24C day/21C night). Fr om planting to the beginning of temperature treatments and following temperature treatments through anthesis, all plants were grown with a moderate temperature regime ( 26C day /21C night). Data Collection T50 f loral initiation dates were calculated for experiments 3, 4, and 5 as determined by SAS Proc Nonlin (SAS Inst. Cary, NC) with the equation y = (100/1+ex p(-k*(x-b)) using the following method. Shoot tips were sampled from one lateral in six plants per treatment at 2-day intervals and examined with a Fisher Stereomast er 45X dissecting scope (Fisher Scientific, Inc., Pittsburgh, PA) to determine the development stage of the meristem. The stages were rated as described by Grueber and Wilkin s (1994) with stages one and tw o rated as not initiated and stages three or above rated as in itiated meristems. These data we re used to calculate a T50 for the number of days from pinching to 50% floral initiation. Twenty-four pots per treatment were used, 12 pots were used for destructive harvest of shoot tips to determine T50 init iation dates as previously desc ribed and the remaining 12 pots were grown to anthesis. The dates of first vi sible bract color (first color), unfolding of the primary bracts to reveal the primary cyathium (v isible bud), and anther dehiscence (anthesis) were recorded for each plant not used for shoot tip sampling. Average days for first color, visible bud, and anthesis were calculated in SAS and the Waller-Duncan procedure used for mean separation. Terms of the model were judged to be significant or nonsignificant based on a

PAGE 49

49 comparison of F values at P 0.05. Each of the five experiment s utilized split-p lot designs with temperature treatment as the main-plot and cul tivar as the sub-plot. Within the plots, a randomized complete block design was used. Ther e were no significant effects caused by these blocks in any of the experiments, so da ta were pooled for each treatment. Experiment 1 This exper iment utilized 19 cultivars that ar e currently used for commercial poinsettia production. The large number of cultivars was us ed to determine the range of heat delay in modern poinsettia cultivars. Rooted cuttings of each of 19 cultivars were planted on 2 Sept. 2004, pinched on 15 Sept. 2004, and night interrup tion lighting was used until 30 Sept. 2004. This lights out date is typical for commercial po insettia production. At this time, temperature treatments were imposed and all plants were shif ted to natural photoperiods (Table 2-1). Plants were grown with the high or low temperatur e regime from 30 Sept. 2004 through 28 Oct. 2004. Following the treatment period all plants were grown to anthesis at the moderate temperature regime. Experiment 2 Experim ent 2 utilized only tw o cultivars to allow a more pr ecise investigation of floral initiation. Autumn Red is an irradiation-induced early flowering time mutant from Red Velvet. Rooted cuttings were planted on 18 Aug. 2005 and pinched to five nodes on 2 Sept. 2005. Night interruption lighting was discontinued at pinching to allow true natural day floral initiation in both cultivars. High or low temp erature treatments were imposed from 8 Sept. 2005 through 27 Oct. 2005. Following this treatment pe riod, all remaining plants were grown to anthesis at the moderate temperature regime.

PAGE 50

50 Experiment 3 This experim ent utilized a second pair of clos ely related cultivars: Prestige Early Red, and Prestige Red in addition to Autumn Red and Red Velvet. Freedom Red was also included because it a commercially important cu ltivar in warm climate production. Rooted cuttings of each cultivar were planted on 18 Aug. 2006 and pinched to five nodes on 1 Sept. 2006. Plants were exposed to the high or low temperature regime from 8 Sept. 2006 through 27 Oct. 2006. As in the previous experiment, ni ght interruption lighting was discontinued at pinching and the moderate temperature regime wa s used from the termination of temperature treatments through anthesis. Experiment 4 In addition to the 5 cultivars used in Expt 3, this experim ent included Freedom Early Red which is an early flowering time mutant from Freedom Red. Rooted cuttings of the 6 cultivars were planted on 23 Aug. 2007 and pinche d to five nodes on 1 Sept. 2007 at which time night interruption lighting was discontinued. Plants were exposed to either the high or low temperature treatment from 9 Sept. 2007 thr ough 28 Oct. 2007. All remaining plants were grown to anthesis under the moderate temperature regime. Results and Discussion Experiment 1 Delays in an thesis between plants in the lo w and high temperature treatments ranged from 0 to 19 days (Table 2-2). Analysis of variance re vealed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days from pinching to first color, visible bud, and anthes is were significant at the 0.05 le vel. In general, the later a cultivar reached anthesis under low temperatures, the greater th e amount of delay observed with high temperatures. Normally late flowering or late season cultivars Prestige Red and

PAGE 51

51 Success Red flowered 15 and 18 days later, respectively, when exposed to 28 days of high temperatures (Table 2-2). However, the high temp eratures did not cause a delay in flowering in the naturally early flowering cultivars Early Freedom Red and O rion. Wieland (1998) observed that early flowering cultivar Freedom Red had a shorter critical night length for floral initiation than the later flowering cultivar Succes s Red. This difference in the critical night length causes a particular cultiv ar to be later flowering than another in natural photoperiod conditions. The moderate and late flowering cultivars also showed significant de lay in time of bract color formation due to the high temperature treatm ents. The development of bract coloration is vital to produce a plant of acceptable quality. Th is effect is likely due to a delay and overall reduction in anthocyanin accumulation as observe d previously in poinsettias under elevated temperatures (Marousky, 1968). The high temperatures did not cause a delay in flowering for the earliest flowering cultivars. This lack of delay may have been due to the natural night lengths at start of treatments being long enough for floral initiati on of plants in both the high and low temperatures soon after start of treatments. These results are consistent with the observed delay in flowering reported by commercial growers in Florida ut ilizing the lights-out method fo r flowering control (Barrett, 2003). Experiment 2 Experim ent 2 utilized natural-day conditions fr om planting through anthesis in contrast to the lights-out method in Expt. 1. For this first experiment utilizing the natural-day model, only two cultivars were used: Red Velvet and A utumn Red which is an irradiation induced flowering time mutant of Red Velvet (personal communication, Ruth Kobayashi, Paul Ecke Ranch). Based on information from the breeder (Paul Ecke Ranch Poinsettia Fast Fax, 1999)

PAGE 52

52 Autumn Red is expected to flower about thr ee weeks before Red Velv et with natural-days. Personal communication with commercial growers i ndicated that Red Velv et shows significant heat delay in the typical light s-out production schedule while Aut umn Red does not. So, this experiment is the first test of the criti cal night-length hypothesis outlined earlier. Analysis of variance revealed that the eff ects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days from pinching to T50 initiation, first color, visible bud, and anthes is were all significant at the 0.05 level (Tables 2-3 to 2-6). Both Autumn Red and Red Velvet in the low temperature treatment reached anthesis within the range of dates provided by th e breeder as the expected market ready date. In Autumn Red floral initiation was 14.4 days la ter and anthesis was 16.6 days later in the high temperature treatment compared to the low temperature treatme nt. In Red Velvet floral initiation was 12.3 days later and anthesis was 12.2 days later in the high temper ature treatment than the low temperature treatment. The dela ys in first color and visible b ud also correspond to the delay in floral initiation. This indicates that delay in flor al initiation is in fact the cause of the observed delays in flowering. These resu lts indicate that early flowering cultivars such as Autumn Red are subject to heat delay in floral initiation as well as the naturally later flowering cultivars such as Red Velvet and Prestige Red. To address the issue of adjustment in cri tical night lengths, th e night lengths were calculated from civil twilight times for each floral initiation date (Table 2-6). In the case of Autumn Red the 14.4 day delay in T50 floral initiation corresponds to 26 additional minutes of dark on the date of T50 floral initiation in the high temperature treatment compared to the low temperature treatment. The T50 date for the low temperature treatment is 25 Sept. 2005 and the civil twilight dark period on th is date is 11 h 10 min compared to the T50 date of 10 Oct. 2005

PAGE 53

53 for the high temperature treatment when the night length is 11 h 36 min. For Red Velvet the 12.3 day delay in T50 floral initiation (4 Oct. 2005 to 16 Oct. 2005) translates to a 20 minute difference in civil twilight dark period. The fact that the chan ges in night length at initiation between the temperature treatments were very si milar among closely rela ted cultivars indicates that this response may be linked to shared genetic traits. To further explore this possibility, Expts. 3 and 4 utilize additional pairs of closely related cultivars. Experiment 3 Five cultivars were used in this experim en t; three early flowering cultivars (Autumn Red, Freedom Red and Prestige Early Red) and tw o later flowering cultivars (Red Velvet and Prestige Red). As implied by the cultivar epithet s, Prestige Early Red is an early flowering time mutant from Prestige Red. In addition to Autumn Red and Red Velvet, Freedom Red was included in this experiment. Freedom Red has been one of the most widely produced early flowering poinsettia cultivars in the southern U. S. for over 10 years (personal communication, Paul Ecke Ranch). Analysis of variance reveal ed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days from pinching to T50 initiation, first color, visi ble bud, and anthesis were all si gnificant at the 0.05 level (Tables 2-7 to 2-9). Delay in T50 floral initiati on ranged from 12.5 to 20.5 days (Table 2-8 and 2-13) and delay in anthesis ranged from 7.0 to 22.7 days (Table 2-7) For each individual cultivar the number of days delay in initiation predicted the number of days delay in an thesis between the high and low temperature treatment to within 4 days. For ex ample Prestige Red plants reached T50 floral initiation 20.5 days later and anthesis 22.3 days later with the high temperature treatment compared to those plants exposed to the low temp erature regime. This correlation indicates that the delay in anthesis is a result of a delay in floral initiation.

PAGE 54

54 As in Expt. 2, the night length at T50 initiati on was calculated from th e civil twilight times provided by the US Naval Observatory (Table 2-9). The change in night lengths at T50 initiation was very similar within the pairs of closely re lated cultivars but not between the pairs This change in Autumn Red and Red Velvet wa s 21 and 25 minutes, respectively which is very similar to the change in critical night length observed in these two cultivars in Expt. 2 (20 and 26 minutes, respectively). The change in night length for Prestige Ea rly Red and Prestige Red at T50 initiation was 32 minutes for both cultivar s. These finding support the hypothesis that change in critical night length in response to supraoptimal temperatures is cultivar specific but similar in closely related cultivars. Experiment 4 Experim ent 4 utilized the five cultivars from Expt. 3 with the addition of Freedom Early Red. This cultivar is an early flowering time mu tation of Freedom Red. Analysis of variance revealed that the effects of temperature treatment cultivar, and the inter action of temperature and cultivar on the number of days from pinching to T50 initiation, first color, visible bud, and anthesis were all significant at th e 0.05 level (Tables 2-10 to 2-12). The delay in T50 floral initiation ranged fr om 9.7 to 17.0 days (Table 2-11 and 2-14) and the delay in anthesis ranged from 5.8 to 16.8 days (Table 2-10). Again, the delay in T50 initiation reflects the number of days delay in anthesis betw een the high and low temperature treatments within days. The consistency of this correlation between experiments conducted at different times conclusively indicates that the delay in anthesis is due to delay in floral initiation and not development. As in the previous two experiments, the ni ght lengths at T50 floral initiation were calculated for each cultivar. Again, the differenc es in night lengths between the high and low temperature treatments were similar within the pa irs of closely related cultivars but not between

PAGE 55

55 the pairs. For Red Velvet and Autumn Red the difference in civil twili ght night lengths at T50 initiation between the high and low temperature treatment was 26 and 25 minutes, respectively (Table 2-12). For Prestige Red and Prestige Early Red the difference in night lengths was 32 and 29 minutes, respectively and 14 and 11 minu tes for Freedom Red and Freedom Early Red, respectively. The data show that the change in critical night length with supraoptimal temperatures is similar in closely related cu ltivars but varies between unrelated cultivars. Conclusions The results of these stud ies showed that there is a wide range of heat delay sensitivity in poinsettia cultivars. In each case where the fl oral initiation date was recorded this date forecasted the date of anthesis which indicates that the observed delay in flowering is a result of a delay in floral initiation and not development. However, the rate of floral development does vary between cultivars. For ex ample, regardless of temperature in Freedom Red and its sport Freedom Early Red, development from T50 initia tion to anthesis took place in 40 days while in Prestige Red and Pre stige Early Red floral development took 46 days. The heat delay response is cultivar specific but ve ry similar in closely re lated cultivars. Of the three pairs of cultivars studi ed Freedom Early Red and Freedom Red showed the least delay in floral initiation at high temperatures, Prestige Early Red and Prestige Red delayed the most and Red Velvet and Autumn Red were intermediate. In each of the pairs, one cultivar is the parental form and the other is a flowering time s port. With the industry standard lights-out production scheduling A utumn Red does not exhibit heat delay while its parental form, Red Velvet does. So, Autumn Red was popularly consid ered to be less heat delay sensitive than Red Velvet. However, thes e observations are the re sult of the lights-out scheduling used to produce these crops rather than a difference in heat sensitivity. The night length at the lights-out date is long enough to allow quick floral in itiation even if the critical

PAGE 56

56 night length is adjusted by supraoptimal temperatures in an early cultiv ar like Autumn Red, but not the later flowering parental form Red Velvet In natural day-length conditions it is clear that the heat delay sensitivity is conserved between the flowering ti me mutant and parental form. The heat delay sensitivity is conserved in each se t of flowering time sports indicating that these genotypes arose from mutations al tering the critical night length for flowering and not heat sensitivity. The degree of heat de lay measured as either the days of delay in floral initiation or the minutes of increase in critical night length at high temperatures suppo rt the conclusion that closely related cultivars have similar heat delay sensitivity. It is important for growers to understand how their poinsettia crops re spond to temperature to allow precise scheduling regardless of year to year vari ations in weather. In each of the three years that Autumn Red and R ed Velvet were grown in natu ral-day conditions, the degree of heat delay was remarkably similar while the actu al dates of the developmental stages varied. The reason for this variation is not comple tely clear since the astronomically observed photoperiod on any given date is nearly identical year to year. However, studies on plant perception of natural day length offer a possi ble solution. It has been documented that atmospheric conditions such as cloud cover at da wn and dusk can affect the exact timing of the delineation between natural dark and light sens ation by plants (Vince-Prue and Heath, 1983). There is some antidotal evidence for such effects on poinsettia crops. Poinsettia growers have reported abnormally early poinsettia floweri ng when hurricanes occu r around the time of initiation (J. Barrett, personal commun ication). It was assumed that this was the result of cooler temperatures during the overcast days around the storm, but it possible that what actually occurred in these situations is the result of a shift in the time that plants are sensing dark. This is an extreme example with extreme consequences, but it is possible that the years in which there

PAGE 57

57 are more evening and morning cloud cover during the period when the plants are sensing shortdays and undergoing floral initia tion, that initiation ma y occur sooner than y ears with more clear days. This would be a fascinating avenue for future study of the nuances of photoperiodic flowering. In addition to the delay in inflorescence deve lopment in Expts. 2, 3 and 4, significant delays in first bract coloration we re recorded for plants of each cultivar in the high temperature treatment compared to the low temperature treat ment. It is important to note that color development in poinsettia bracts parallel but separate from the fl oral development process. Bract color development is of course vital to producing a marketable crop. Ambient temperature and photoperiod effect bract coloration (Miller and Kiplinger, 1962). Marousky (1968) reported that night temperatures above 21C de layed and reduced final anthocya nin accumulation in poinsettia bracts. Additional studies on the bract coloration process would also be an interesting choice for future research applicable to poi nsettia production in warm climates. In conclusion, the results of this series of e xperiments show that the delay in flowering at high temperatures is the result of a delay in floral initiation due to adjustments of the critical night length. Moreover, the adjustment in critic al night length that dete rmines the heat delay sensitivity is cultivar specific and genetically linked so that closely re lated cultivars exhibit similar differences in critical night length between high and low te mperatures. Since there is a range of heat delay sensitivity among current poinsettia cultivars, it may be possible through breeding efforts to produce increasingly heat inse nsitive cultivars with the goal of eventually eliminating problematic heat delay from poinsettia as has been accomplished with chrysanthemum.

PAGE 58

58 Table 2-1. Night length during Expts. 1-4 calculated from civil twilight at 29'N latitude (United States Naval Observatory, 2007). Night lengths (h, min) Date Year 22 Sept. 29 Sept 10 Oct. 13 Oct. 20 Oct. 27 Oct. 3 Nov. 10 Nov. 2004 11,05 11,17 11,30 11,42 11,53 12,04 12,14 12,24 2005 11,04 11,16 11,32 11,40 11,52 12,02 12,13 12,23 2006 11,04 11,16 11,32 11,40 11,52 12,02 12,13 12,23 2007 11,05 11,17 11,30 11,42 11,53 12,04 12,14 12,24 Table 2-2. Number of days to fi rst color, visible bud, and anthesis from the onset of natural days (30 Sept. 2004) with high (29C day /24C night) or low (24C day/21C night) temperature treatments. Analysis of variance revealed that the effects of temperature treatment, cultivar and the interaction of temperature and cultivar on the number of days from the onset of natural days to first color, visible bud, and anthesis were significant at the 0.05 level so the sub effects are shown here (Expt. 1). Days to first color Days to visible bud Days to anthesis 24/21C Early Freedom Red 15.2 gz 27.5 h 50.0 j Freedom Red 24.6 e 28.2 gh 51.5 ij Orion 21.4 f 29.8 gh 50.3 j Autumn Red 22.4 f 29.4 gh 53.3 hi Velveteen 22.0 f 31.7 fg 55.9 gh Christmas Feelings 25.3 e 35.2 e 61.4 ef Mars 29.6 d 35.8 e 62.6 ef Red Velvet 30.3 cd 36.5 e 62.3 ef Silent Night 25.9 e 36.6 e 62.7 ef Prestige Red 36.3 b 38.2 de 63.5 e Success Red 38.6 b 40.6 d 66.8 d 29/24C Early Freedom Red 15.0 g 28.5 h 49.2 j Freedom Red 25.6 e 30.6 fg 54.6 gh Orion 22.3 f 30.3 fg 53.8 hi Autumn Red 23.1 ef 32.1 f 56.2 g Velveteen 27.8 de 36.7 e 60.8 f Christmas Feelings 32.9 c 44.8 c 73.2 c Mars 38.4 b 45.3 c 69.5 d Red Velvet 44.6 a 50.7 b 78.2 b Silent Night 32.2 c 43.9 c 70.9 cd Prestige Red 46.1 a 53.4 a 78.0 b Success Red 45.8 a 55.7 a 84.2 a zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10)

PAGE 59

59 Table 2-3. Number of days to first color, vi sible bud, and anthesis from pinching (1 Sept. 2005) with high (29C day /24C night ) or low (24C day/21C night) temperature treatments. Analysis of varian ce revealed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days from pinching to T50 initiation, firs t color, visible bud, and anthesis were significant at the 0.05 level (Expt. 2). Days to first color Days to visible bud Days to anthesis 24/21C Autumn Red 38.3 cz 46.8 c 67.8 c Red Velvet 57.7 b 61.3 b 87.3 b 29/24C Autumn Red 55.6 b 59.8 b 85.4 b Red Velvet 70.3 a 75.7 a 99.5 a zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10) Table 2-4. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2005) with high (29C day /24C night) or low (24C day/21C night) temperature treatments (Expt. 2). Days to T50 Initiation 95% Confidence Interval 24/21C Autumn Red 24.3 22.8 25.8 Red Velvet 33.6 32.5 34.7 29/24C Autumn Red 39.2 38.0 40.4 Red Velvet 45.9 44.5 47.4 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 2-5. Pairwise comparison of T50 values in Table 2-4 (Expt. 2). 24/21C 29/24C Autumn Red Red Velvet Autumn Red Red Velvet 24/21C Autumn Red Red Velvet 29/24C Autumn Red Red Velvet NS, Nonsignificant and significant at P =.05, respectively

PAGE 60

60 Table 2-6. Natural-day night lengt hs calculated for the initiation dates of Autumn Red and Red Velvet with high (29C day /24C night) or low (24C day/21C night) temperature treatments from civil twilight times (US Naval Observatory) (Expt. 2). T50 initiation date Night length (h, min) 24/21C Autumn Red 25 Sept. 2005 11, 10 Red Velvet 4 Oct. 2005 11,26 29/24C Autumn Red 10 Oct. 2005 11, 36 Red Velvet 16 Oct. 2005 11,46 Table 2-7. Number of days to first color, vi sible bud, and anthesis from pinching (1 Sept. 2006) for high (29C day /24C night) and low (24C day/21C night) temperature treatments. Analysis of varian ce revealed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days from pinching to T50 initiation, firs t color, visible bud, and anthesis were significant at the 0.05 level (Expt. 3). Days to first color Days to visible bud Days to anthesis 24/21C Autumn Red 35.8 fz 43.0 g 63.7 g Red Velvet 49.5 d 53.8 e 78.2 d Prestige Early Red 46.7 d 47.2 f 67.5 f Prestige Red 57.5 c 56.8 d 79.8 d Freedom Red 46.0 d 49.3 f 71.8 e 29/24C Autumn Red 39.8 e 49.0 f 70.7 ef Red Velvet 56.9 c 69.8 b 92.3 b Prestige Early Red 63.5 b 65.6 c 90.3 b Prestige Red 72.3 a 80.3 a 102.2 a Freedom Red 58.5 c 66.2 c 87.5 c zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10)

PAGE 61

61 Table 2-8. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2006) with high (29C day /24C night) or low (24C day/21C night) temperature treatments (Expt. 3). Days to T50 Initiation 95% Confidence Interval 24/21C Autumn Red 24.5 23.7 25.3 Red Velvet 35.8 34.8 36.8 Prestige Early Red 26.2 25.1 27.2 Prestige Red 37.2 35.6 38.7 Freedom Red 30.0 29.7 30.3 29/24C Autumn Red 37.0 35.3 38.8 Red Velvet 50.8 50.0 51.6 Prestige Early Red 45.5 44.1 46.8 Prestige Red 57.5 56.1 58.9 Freedom Red 48.7 45.6 51.8 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 2-9. Natural-day night le ngths calculated for initiation dates with high (29C day /24C night) or low (24C day/21C night) temperature treatments from civil twilight times (US Nava l Observatory) (Expt. 3). T50 initiation date Night length (h, min) 24/21C Autumn Red 26 Sept. 2006 11, 11 Red Velvet 7 Oct. 2006 11, 30 Prestige Early Red 27 Sept. 2006 11, 13 Prestige Red 8 Oct. 2006 11, 32 Freedom Red 1 Oct. 2006 11, 20 29/24C Autumn Red 8 Oct. 2006 11, 32 Red Velvet 22 Oct. 2006 11, 55 Prestige Early Red 16 Oct. 2006 11, 45 Prestige Red 28 Oct. 2006 12, 04 Freedom Red 20 Oct. 2006 11, 52

PAGE 62

62 Table 2-10. Number of days to first color, vi sible bud, and anthesis from pinching (1 Sept. 2007) with high (29C day /24C night ) or low (24C day/21C night) temperature treatments. Analysis of varian ce revealed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days from pinching to T50 initiation, firs t color, visible bud, and anthesis were significant at the 0.05 level (Expt. 4). Days to first color Days to visible bud Days to anthesis 24/21C Autumn Red 30.8 iz 41.5 h 64.8 g Red Velvet 60.7 d 64.7 c 89.8 c Prestige Early Red 54.5 e 50.8 g 74.8 f Prestige Red 62.1 cd 64.0 c 87.2 cd Freedom Early Red 37.7 h 51.8 g 74.5 f Freedom Red 48.5 f 52.2 g 75.7 f 29/24C Autumn Red 37.8 h 54.0 f 76.3 f Red Velvet 69.3 b 76.8 b 98.8 b Prestige Early Red 63.3 c 66.7c 88.3c Prestige Red 78.3 a 82.7 a 103.2 a Freedom Early Red 41.8 g 58.2 e 79.5 e Freedom Red 55.7 e 63.3 d 84.8 d zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10) Table 2-11. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2007) with high (29C day /24C night) or low (24C day/21C night) temperature treatments (Expt. 4). Days to T50 initiation 95% Confidence interval 24/21C Autumn Red 23.6 21.7 25.6 Red Velvet 42.3 40.7 43.8 Prestige Early Red 27.7 26.2 29.3 Prestige Red 42.2 41.3 43.0 Freedom Early Red 31.8 31.0 32.7 Freedom Red 32.5 31.7 33.3 29/24C Autumn Red 36.2 35.3 37.0 Red Velvet 56.5 55.7 57.3 Prestige Early Red 43.2 42.1 44.3 Prestige Red 59.2 58.1 60.3 Freedom Early Red 41.5 40.7 42.3 Freedom Red 44.7 43.6 45.8 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)).

PAGE 63

63 Table 2-12. Natural-day night le ngths for initiation dates with high (29C day /24C night) or low (24C day/21C night) temperature treatments calculated from civil twilight times (US Nava l Observatory) (Expt. 4). T50 initiation date Night length (h, min) 24/21C Autumn Red 24 Sept. 2007 11, 07 Red Velvet 13 Oct. 2007 11, 36 Prestige Early Red 28 Sept. 2007 11, 14 Prestige Red 13 Oct. 2007 11, 36 Freedom Early Red 2 Oct. 2007 11, 23 Freedom Red 3 Oct. 2007 11, 25 29/24C Autumn Red 7 Oct. 2007 11, 32 Red Velvet 27 Oct. 2007 12, 02 Prestige Early Red 14 Oct. 2007 11, 37 Prestige Red 30 Oct. 2007 12, 08 Freedom Early Red 12 Oct. 2007 11, 34 Freedom Red 15 Oct. 2007 11, 39

PAGE 64

64Table 2-13. Pairwise comparison of T50 values in Table 2-8 (Expt. 3). Autumn Red Red Velvet Prestige Early Red Prestige Red Freedom Red 24/21C 29/24C 24/21C 29/24C 24/21 C 29/24C 24/21C 29/24C 24/21C 29/24C 24/21C Autumn Red 29/24C 24/21C NS Red Velvet 29/24C 24/21C NS Prestige Early Red 29/24C * 24/21C NS NS Prestige Red 29/24C * 24/21C * * Freedom Red 29/24C * NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 65

65Table 2-14. Pairwise comparison of T 50 values in Table 2-11 (Expt. 4). Autumn Red Red Velvet Prestige Early Red Prestige Red Freedom Early Red Freedom Red 24/21C 29/24C 24/21C 29/24C 24/21C 29/24C 24/21C 29/24C 24/21C 29/24C 24/21C 29/24C 24/21C Autumn Red 29/24C 24/21C Red Velvet 29/24C 24/21C * Prestige Early Red 29/24C NS 24/21C NS NS Prestige Red 29/24C * 24/21C * * Freedom Early Red 29/24C NS NS NS 24/21C * * NS Freedom Red 29/24C NS NS NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 66

66 CHAPTER 3 TIMING AND DURATION OF HIGH TEMP ERATURE EXPOSURE Introduction In the poinsettia heat delay problem timing and duration of the high temperature episode during development have not been investigated in detail. Previous stud ies found that sustained supraoptimal temperatures (over 26C for 28 da ys) around the time of flor al initiation caused delays in observed flowering of up to 20 days (Barrett, 2003; Schnelle, et al., 2005). However, Miller and Kiplinger (1962) reported that sustained elevated temperatures later in the floral development process accelerated floral development. Many of the studies that uncovered the heat-delay response utilized fixed temperatures throughout cr op development and those which used varying durations of high temp eratures were in concert with varying durations of short days (Langhans and Miller, 1960; Miller and Kiplinger, 1962). Si nce most modern commercial poinsettia production is conducted un der natural photoperiods and te mperatures can vary widely through the production period, a more complete understanding of the effects of timing and duration of high temperature inci dence in the natural photoperiod flowering process is needed. An understanding of which stages of repr oductive development are sensitive to high temperatures and the duration of high temperat ure exposure necessary to produce a delay in flowering will allow more precise crop scheduling. The impact of timing and duration of high te mperature exposure has been addressed in greater detail with heat-sensitive chrysanthemu m cultivars, but again these studies utilized controlled photoperiods (Cocks hull and Kofranek, 1993; Karlss on, 1989; Whealy et al., 1987). However, since heat sensitive chrysanthemum cultivars show very similar high temperature responses to poinsettia, and more pr ecise data is available, these st udies were used to aid in the design of this poinsettia study. Whealy et al. (1987) exposed chrysanthemum Orange Bowl to

PAGE 67

67 fourteen different high temperat ure treatments. These treatments consisted of 2, 4, 6, 8, or 10 weeks of high temperatures (30C day /26C night) beginning either the first, third, fifth, or seventh week following the onset of short-da ys. The plants were grown under optimum development temperatures all other times (22C da y /18C night). Treatments beginning the first or third week of short-days had the greatest e ffect on the number of days to open flower. Two weeks of high temperatures beginning the first week of short-days had no effect on time to flower, but two weeks of high temperatures begi nning the third week caused about one week of delay in flowering time. The treatment with si x weeks of high temperatur es beginning the first week produced the same delay in flowering time as a four week treatment beginning the third week. These results indicate th at the floral initiation proce ss may not have begun until two weeks following the onset of short-days. Two, four or six weeks of high temperatures beginning the fifth week caused only a small delay in flow ering time (three days or less). Finally, high temperatures applied for two or four weeks beginning the seventh week of short-days had no effect on days to open flower. These results cl early indicate that some stages of reproductive development in chrysanthemum are sensitive to high temperatures while others are not. However, in other chrysanthemum cultivars this pattern does not hold. Karlsson et al. (1989) found that in cultivar Bright Go lden Anne a temperature treatm ent of 30C significantly delayed development during all stages of floral deve lopment compared to plants grown at 20C. Previous studies utilized c ontrolled photoperiod treatments pr imarily as a technique to reduce experimental variability. To more clearly understand the cause of heat delay in modern natural-day poinsettia production it is necessary to determine the effects of timing and duration of high temperature exposure in photoperiod a nd temperature conditions that mimic those of commercial cultivation. The following series of studies was designed to address this need.

PAGE 68

68 Given the variability in the chrysanthemum studi es, high temperature effects on all stages of floral initiation and development were investig ated. Three experiments were conducted. The first used controlled photoperiods and the other two natural phot operiods. Single cultivars were used for each experiment as the number of treatments was large enough to make a cultivar factorial impractical. Also, the results of previous natural phot operiod studies indicate that all poinsettia cultivars tested exhibit a very similar pattern in their response to high temperatures so multiple cultivars were deemed unnecessary. Fo r the natural day experiments Autumn Red was selected as it shows average h eat delay sensitivity (Chapter 2). Materials and Methods Consisten t cultural practices were used for each experiment. All three experiments were conducted in glass-glazed greenhouses located in Gainesville, Florida (29'N latitude) equipped with fan and pad cooling. Rooted cut tings were received from Paul Ecke Ranch (Encinitas, CA) and planted in 105 cm3 pots containing Fafard 2 growing medium (Fafard, Anderson, S.C.), which consists of 6.5 sphagnum peat : 2 perlite : 1.5 vermiculite (v/v). Incandescent night interruption lighting from 22:00 through 02:00 was applied from planting to prevent premature fl oral initiation. Following the te rmination of night interruption lighting, plants were exposed to natural photoperiodic conditions in Expts. 2 and 3 and 12-hour dark periods in Expt. 1. One week after planting, all cuttings were pinche d to five nodes. For the first eight weeks following transplant, plants were fertilized at each irrigation with Scotts (The Scotts Company, LLC., Marysvill e, OH) 20N-4.4P-16K supplying 300 mgL-1 Nitrogen. From that point through anthesis fertilization at each irrigation was with Scotts (The Scotts Company, LLC., Marysville, OH) 15N-2.2P-8K supplying 250 mgL-1 Nitrogen. Plant growth retardants were not used.

PAGE 69

69 All three experiments utilized the same temper ature treatments. The daytime temperature regime was initiated daily at 07: 00 and the nighttime temperature regime at 19:00. Plants were maintained at 24C day/21C night (low temperature treatment) except when exposed to the high temperature treatment (29C day /24C night). Data Collection Each of the three experim ents utilized a ra ndomized complete block design with three blocks and four pots per repli cation. Those treatments for which T50 dates were calculated included an additional four pots pe r replication that were used for destructive harvest of shoot tips. There was no significant effect of replica tion in any of the experiments, so data were pooled for each treatment. The dates of first visible bract color (first co lor), unfolding of the primary bracts to reveal the primary cyathium (v isible bud), and anther dehiscence (anthesis) were recorded for those plants not used for shoot tip sampling. Average days for first color, visible bud, and anthesis were calculated in SAS (SAS Institute, Cary, NC) and the WallerDuncan procedure used for mean separation. Terms of the model were judged to be significant or nonsignificant and included in the final model based on a comparison of F values at P 0.05. T50 floral initiation dates were calculated for ea ch treatment in Expts. 2 and 3 using the method described in Chapter 2. Experiment 1 Rooted cuttings of poinsettia Prestige Red were planted on 8 Feb. 2005 and pinched on 15 Feb. 2005. Plants were shifted to 12-hour dark periods on 1 March 2005 and high tem perature treatments were applied for the de signated time periods (Tab le 3-1). Expt. 1 was designed to be a preliminary study investigating the response of poi nsettia to 7 or 21 days of high temperature exposure at different stages between the onset of short days thr ough early floral

PAGE 70

70 development. This experiment utilized a fixe d photoperiod as the combination of 12-hour days and high temperatures have been show n to cause heat delay (Chapter 2). Experiments 2 and 3 Rooted cuttings of Poinsettia Autum n Re d were planting on 18 Aug. 2006 (Expt. 2) or 23 Aug. 2007 (Expt. 3) and pinched on 1 Sept. 2006 (Expt. 2) or 1 Sept. 2007 (Expt. 3). Night interruption lighting was discontinued at pinching and which time all plants were moved to natural photoperiods for the remainder of the ex periments. The high temperature treatments were applied for the designated time periods (Tab les 3-2; 3-6). These two experiments were designed to more closely simu late the conditions present in poinsettia production in warm climates. The high temperature treatments were a pplied for 14 to 35 days at various stages from pinching through anthesis to uncover the effects of varying durations of high temperature exposure throughout the crop production cycle. Results and Discussion Experiment 1 Analysis of varian ce revealed that the eff ects of temperature treatment on the number of days from pinching to visible bud and anthesis we re significant at the 0.05 level. The WallerDuncan mean separation procedure was used to determine which treatment means are significantly different (Table 3-1) Plants in Treatment 1, maintained at the low temperatures, reached anthesis an average of 64 days after th e onset of 12-hour dark periods. Plants in Treatment 2 were exposed to high temperatures for 28 days beginning at the onset of 12-hour dark periods. This treatment was a heat delay control based on results of previous experiments and anthesis in Treatment 2 plan ts occurred 14 days later than in Treatment 1 plants. Treatments 3, 4 and 5 were each exposed to 7 days of high temperatures starting at day 1, 7 or 14, respectively, and the time to visible bud and time to anthesis were not significantly different for

PAGE 71

71 plants in these treatments compared to the low temperature control plants This indicates that one week of high temperature exposure is not sufficient to produce a significant delay in flowering time. High temperatures in Treatment 6 were from day 7 to 28 and plants reached visible bud and anthesis in 54 and 76 days, re spectively. These results are similar to plants in the heat delay control (Treatment 2) which were exposed to th e high temperature regime from days 1 to 28. This indicates that temperatures in the first week after the onset of short-days did not contribute to heat delay. Treatments 7 and 8 also received 21 days of high temperatures during the first 28 days after start of short days, like Treatment 6, excep t that high temperature exposure was interrupted by 7 days of cooler temperatures. These treatme nts were included as high temperature exposure in a commercial greenhouse situation would not necessarily be contiguous. Visible bud and anthesis in both Treatments 7 and 8 plants were delayed compared to Treatment 1, but not delayed to the extent of plants in Treatment 2. The number of days to visible bud and anthesis were not significantly different between plants in Treatments 7 and 8. The data from Treatments 7 and 8 support the indication from Treatment 6 that the first 7 days after th e start of short-days have little impact on heat delay. These results also indicate that there is a critical period for high temperature sensitivity in the floral initiation an d development process and that the magnitude of the delay in flowering may be linked to the dura tion of high temperature e xposure. The next two experiments investigated this possibility in more detail. Experiment 2 Expt. 2 utilized natural photoperiods and in cluded data on T 50 floral initiation for Treatments 1 to 6 (Table 3-2). T50 initiation data were not taken for the other treatments as the high temperature exposure designat ed by these treatments occurred af ter floral initiation. Since

PAGE 72

72 it is not possible to determine the exact date of the onset of short-days with natural photoperiods as discussed in Chapter 2, the number of days to initiation, first color, visible bud, and anthesis are calculated from the date on which all plants we re pinched (1 Sept.). Also the treatments are described by day numbers starting from the da te of pinch with 1 Sept. 2006 as Day 1. The ten treatments in this experiment c onsisted of either 14 or 28 days of high temperatures at various stages of the floral initiation and development. Treatment 1 was a control treatment which was not ex posed to high temperatures. Treatment 2 was designed as a heat delay control with 28 days of high temperatures which induced heat delay in every cultivar tested in the previous experime nts (Chapter 2). The chronological timing of the treatments was determined with natural-day flowering data from the two previous fall seasons for Autumn Red. The average T50 initiation date (25 Sept.) and the average anthesis date (12 Nov) were used as the predicted initiation and anthesis date s for this and the subsequent experiment. The treatments were designed to expose the plants to high temperatures for a portion of the period beginning 14 days before predicted T50 initia tion though the predicted anthesis date. For example Treatment 4 was designed to give the pl ants 14 days of high temperature exposure for the 14 days prior to expected T 50 floral initiation which is Days 11 to 25 (11 to 25 Sept.). Analysis of variance revealed that the eff ects of temperature treatment on the number of days from pinching to T50 initiation, first color, visible bud, and anthesis we re significant at the 0.05 level and the Waller-Duncan m ean separation procedure revealed which treatment means were significantly different (Table 3-2 and 3-4). The low temperature control (Treatment 1) reached T50 floral initiation in 25.5 days (Table 3-3), visible bud in 43.9 days, and anthesis in 65.9 days (Table 3-2). The heat delay control (Treatment 2) reached T 50 initiation in 36.8 days, visibl e bud in 53.4 days, and anthesis

PAGE 73

73 in 73.9 days. This treatment received high temp eratures from Days 11 through 39 which is 14 days before through 14 days after the expected low temperature initi ation date for Autumn Red. The parallel in the delay in in itiation, visible bud, and anthesis indicates that the delay in flowering is the result of a delay in floral initiation which is most likely a result of adjustment in critical night length as discussed in Chapter 2. Treatments 4 through 6 each received 14 days of high temperatures around the time of expected T50 initiation (Table 3-3). Plants in Tr eatments 4 and 5 reached T50 floral initiation in about 30 days (5 days later than treatment 1) wh ich translated to a 4-6 day delay in anthesis compared to Treatment 1 plants (Table 3-2). For these two treatments the delays in both initiation and anthesis compared to treatment 1 were about half of that of treatment 2; 4-6 days versus 11 days. Plants in Treatment 6 reached T50 floral initiation in 27 days which is not significantly later than the low temperature control. Plants in this treatment reached anthesis about 2.5 days later than the cont rol which is significant statis tically but would not impact the marketability of poinsettia crop. Treatments 7 through 10 were exposed to 14 days of high temperatures after the expected floral initiation date to determine if high temperat ures later in production affe ct the rate of floral development, so initiation data was not deemed necessary. For Treatments 7, 8, and 9 there are no significant differences in the time to visible bud or anthesis compared to the low temperature control. Treatment 10 received the high temper ature treatment between the time of visible bud and anthesis. Plants in this treatment reached visible bud in 34.4 days, which is not significantly different from the control plants. However, Tr eatment 10 plants reached anthesis about 3 days earlier than the control plants which is significant but again would not impact the marketability of the crop. These data support previous studies that have fo und high temperatures during the

PAGE 74

74 later stages of poinsettia floral development can accelerate the pro cess to some extent (Miller and Kiplinger, 1962). Imposing high temperatures late in a poinsettia crop to accelerate development would not be an acceptable technique to mitigate th e heat delay effect as high temperatures have been shown to inhibit bract color deve lopment (Ecke et al., 2004; Marousky, 1968). Treatment 3 received high temperatures from Da y 25 (the day of expect ed floral initiation) through Day 53. As expected T50 initiation did take place around Day 25, Day 26.5 to be exact. However, there was a delay of 3 to 4 days in visible bud and anthesis in Treatment 3 plants compared with the control. This shows that th ere is a potential for a slight delay in floral development before visible bud und er supraoptimal temperatures. Experiment 3 Expt. 3 utilized the same design as the previous experim ent. Autumn Red was grown in natural photoperiods with a variety of 14 and 21-day high temperature treatments or control treatments. Day numbers are again counted from pinching and T50 initiation data was taken for those treatments that were applied before or ar ound the time of floral initiation. Analysis of variance revealed that the effects of temperatur e treatment on the number of days from pinching to T50 initiation, first color, vi sible bud, and anthesis were sign ificant at the 0.05 level (Tables 35 and 3-7). The Waller-Duncan mean separation procedure was used to compare individual treatment means. Treatments 1 and 2 are the control groups as in the previous experiment. Treatment 1 received no high temperatures and Treatment 2 received 28 days of high temperatures beginning two weeks before the expected T50 initiation date In this experiment the plants in the low temperature control reached T50 initiation Da y 26.9 and the high temperature control reached T50 initiation in 39.2 days (Table 3-6). This de lay in initiation translated to a 13.2-day delay in

PAGE 75

75 anthesis (Table 3-5). These data indicate th at both control groups showed the expected flowering times and again the delay in observed fl owering is the result of a delay in initiation. Plants in Treatments 3 to 6 were each exposed to 21 days of high temperatures. Treatments 3 and 4 were exposed to 21 days of constant high temperatures starting on day 11 in Treatment 3 and day 18 in treatment 4. There was no significant differe nce in days to T50 initiation, visible bud, and anthes is between plants in Treatments 3 and 4 and the high temperature control. These re sults show that 21 da ys of high temperatures around the time of floral initiation is sufficient to produce a delay in flowering of a degree that would seriously effect crop scheduling. Plants in Treatments 5 a nd 6 also received 21 days of high temperatures, but these two temperature treatments were inte rrupted with 7 days at the cool temperature regime. The net effect of the scheduling of these treatments is that only 14 of the 21 days of high temperatures occur before the ini tiation. Plants in both treatments reached T50 floral initiation in about 30 days compared to 26 days in the low te mperature control. Th is delay in initiation paralleled the delay in anthesis indicating that the 7 days of high temperature exposure following floral initiation did not produce any additional delay in visible bud or anthesis. Treatments 7-10 each received high temperatures for 14 straight days. The assigned period of high temperatures began on Day 4 in Tr eatment 7, Day 11 for Treatment 8, Day 18 for Treatment 9, and Day 25 for Treatment 10 (Table 3-6). The plants in Treatments 4 and 10 showed no significant delay in T50 floral initiation, vi sible bud or anthesis compared with the control plants. Since the treatm ent ended 7 days before the expected and observed initiation dates this data indicated that high temperatures this early in production will not cause a delay in floral initiation or visible flowering. In the case of Treat ment 10, the high temperature treatment

PAGE 76

76 began following T50 initiation so as with Treatments 5 and 6 the data indicate that high temperatures following initiation do not cause delay in flowering. Treatments 11 through 13 each received 14 days of high temperatures interrupted with 7 days at the cool temperature regime as outlined in Table 3-5. There was no delay in T50 initiation, visible bud, or anthesis in Treatme nt 12 and 13 plants compared to the low temperature control plants (Table 3-5). Plant in both treatments received only 7 days of high temperatures prior to T50 initiati on. This result is consistent w ith the results of the previous experiments, indicating that high temperatures following in itiation or 7 days of high temperatures before initiation are not suffici ent to produce a significant delay in flowering. In Treatments 14 through 17 the high temper ature exposure occurred following floral initiation to confirm the finding from Expt. 2 which indicated that hi gh temperature exposure during floral development does not cause major dela ys in flowering. Each of the treatments was exposed to the high temperature regime begi nning on Day 32. Treatment 14 remained at the high temperature regime for 14 days, Treatment 15 for 21 days, Treatment 16 for 28 days, and Treatment 17 for 35 days. There were not signifi cant differences in the time to visible bud of anthesis for the plants in any of these treatments compared to the low temperature control. However the plants in Treatments 14-17 all reached first color significantly later than the low temperature control. These findings support the previous studies that have shown that high temperatures during poinsettia floral devel opment delay bract coloration (Marousky, 1968) Conclusions The results of this series of experim ents show that the timing of high temperature exposure determines whether or not heat delay will occu r and the duration of hi gh temperature exposure determines the magnitude of the delay. High temperatures ending more than 14 days before or starting more than 14 days after T 50 initiation did not contribute to the heat delay effect. This

PAGE 77

77 means that there is an approximately 28 day window in which the plant is susceptible to heat delay. High temperatures throughout this enti re period can produce a delay in anthesis in Autumn Red of up to 14 days. In some cases 21 days of high temperatures within the 28-day window produced the full heat delay effect as seen in Expt. 3. Plants exposed to treatments with a contiguous 21 days at the hi gh temperature regime during the 28-day window and the other 7 days at the low temperature regime reached anthesis within 3 days of those plants receiving the full 28 days of high temperatures. However, when the high temperature treatment was interrupted with 7 days at the cool temperat ure regime, initiation and thusly anthesis were delayed only slightly compared to the low temperat ure control. This sup ports the hypothesis that heat delay in natural photoperiods occurs as a re sult of the adjustment of critical night length by supraoptimal temperatures which is discussed in detail in Chapter 2. The time at the low temperature regime likely allowed the floral ini tiation process to proceed to a point where the meristem is committed to flowering and floral development to continue even when the temperatures were returned to the high temperature regime. Shorter durations of high temperature exposure did produce some delay but not to the extent of the 21 and 28-day high temperature treatments. In no case did 7 days of high temperatures produce any significan t delay in anthesis. However, 14 days of high temperatures before or around the time of floral initiation did significantly delay floral initiation and anthesis in both natural day experiments. In Expt. 3, 14 days of high temperatures starting 14 or 7 days before the expected T50 initiation date both caus ed a delay of about 5 days in initiation and anthesis. However if the 14 days of high temperat ures began 21 days before or at any point after T50 initiation, there were no delays in initiation or anthesis compared to the low temperature

PAGE 78

78 control. These results support the conclusion from Chapter 2 that heat delay in poinsettia is the result of a delay in floral initiation. High temperature exposure later in floral development had a minor effect on the timing of anthesis in these studies. Prev ious studies found that elevated temperatures after the visible bud stage accelerate development (Langhans and Miller, 1960; Miller and Kiplinger, 1962). In Expt. 2, high temperatures imposed between the time of visible bud and anthesis accelerated floral development causing the plants to reach anthes is about 3 days before the low temperature control. The fact that high temperatures before the init iation date cause a dela y in flowering brings up an important issue. T50 initiation is reco rded when the meristem has already begun the flowering process and this change is visible at a microscopic le vel. The processes of floral induction and initiation would have been underway fo r some time at this point, so it is intuitive that high temperatures during the period before observed initiation could effect this process. Unfortunately, it is not possible at the present time to determine exactly when the poinsettia plant begins the process of floral i nduction in response to day lengt h. In previous studies with controlled photoperiods, it has b een found that the T50 date occurs no sooner than 8 days following the onset of 15-hour dark periods or 10 days with 12-hour dark periods (Weiland, 1998). But again these data cant be directly applied to natural-day flowering so at the present time it can only be estimated when the plant actually begins the transition from the vegetative to reproductive state. Research at the molecular level could furthe r elucidate this process.

PAGE 79

79 Table 3-1. Number of days to visible bud and anthesis in Pres tige Red from the onset of 12hour dark periods (Expt. 1). Treatment number Days at 29/24C Day to visible bud Days to anthesis 1 None 42 cz 64 c 2 Days 1-28 54 a 78 a 3 Days 1-7 43 c 62 c 4 Days 7-14 42 c 64 c 5 Days 14-21 44 c 65 c 6 Days 7-28 54 a 76 a 7 Days 1-7, 14-28 50 b 72 b 8 Days 1-14, 21-28 50 b 74 ab zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10) Table 3-2. Number of days to first color, vi sible bud, and anthesis from pinching (Sept. 1, 2006) in Autumn Red with high temperatures (29C day /24C night) applied for listed intervals (Expt. 2). Treatment number Days at 29/24C Days to first color Days to visible bud Days to anthesis 1 None 36.3 bz 43.9 c 65.9 de 2 Days 11-39 40.8 a 53.4 a 73.9 a 3 Days 25-53 36.5 b 47.7 b 69.8 bc 4 Days 11-25 41.5 a 47.7 b 69.3 bc 5 Days 18-32 42.5 a 50.3 b 72.5 ab 6 Days 25-39 35.0 b 44.5 c 68.2 c 7 Days 32-46 36.3 b 44.5 c 65.5 def 8 Days 39-53 35.2 b 43.5 c 66.5 cd 9 Days 46-60 35.4 b 43.0 c 62.8 ef 10 Days 53-68 34.4 b 42.8 c 62.4 f zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10)

PAGE 80

80 Table 3-3. Number of days to 50% floral initiation (T50)from pinching (1 Sept. 2006) z in Autumn Red with high temperatures (29C day /24C night) applied for listed intervals (Expt. 2). Treatment number Days at 29/24C Days to T50 initiation 95% Confidence interval 1 None 25.5 23.1 28 2 Days 11-39 36.8 34.7 38.8 3 Days 25-53 26.5 25.7 27.3 4 Days 11-25 30.5 29.8 31.2 5 Days 18-32 30.3 28.8 31.9 6 Days 25-38 27.0 24.6 29.4 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 3-4. Pairwise comparison of T 50 values from Table 3-3 (Expt. 2). Treatment 1 2 3 4 5 6 1 2 3 NS 4 5 NS 6 NS NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 81

81 Table 3-5. Number of days to first color, visi ble bud, and anthesis from pinching (1 Sept. 2007) with high temperatures (29C day /24C night) applied for listed intervals (Expt. 3). Treatment number Days at 29/24C Days to first color Days to visible bud Days to anthesis 1 None 33.8 dz 41.5 cd 64.8 c 2 Days 11-39 48.6 a 55.7 a 78.0 a 3 Days 11-32 47.3 a 53.5 a 75.8 a 4 Days 18-39 49.1 a 55.3 a 77.3 a 5 Days 11-18; 25-39 39.8 c 49.8 b 72.0 b 6 Days 11-25; 32-39 40.0 bc 48.2 b 70.3 b 7 Days 4-18 34.2 d 42.7 cd 63.7 c 8 Days 11-25 41.7 bc 48.8 b 71.3 b 9 Days 18-32 42.3 b 50.0 b 72.0 b 10 Days 25-39 35.0 d 42.7 cd 66.0 c 11 Days 11-18; 25-32 42.3 b 49.3 b 72.3 b 12 Days 11-18; 32-39 35.7 d 43.8 c 65.0 c 13 Days 18-25; 32-39 33.7 d 42.5 cd 65.2 c 14 Days 32-46 38.3 c 40.8 cd 62.5 c 15 Days 32-53 37.2 c 40.3 d 62.0 c 16 Days 32-60 39.7 c 41.2 cd 63.5 c 17 Days 32-68 38.7 c 42.3 cd 64.0 c zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10) Table 3-6. Number of days to 50% floral initiation (T50)z from pinching (1 Sept. 2007) in Autumn Red with high temperatures (29 C day /24C night) applied for the listed intervals (Expt. 3). Treatment number Days at 29/24C Days to T50 initiation 95% Confidence interval 1 None 26.9 26.7 27.2 2 Days 11-39 39.2 38.1 40.3 3 Days 11-32 36.3 34.7 37.8 4 Days 18-39 39.5 38.7 40.3 5 Days 11-18; 25-39 30.8 29.7 31.9 6 Days 11-25; 32-39 30.7 29.6 31.8 7 Days 4-18 25.5 24.2 26.8 8 Days 11-25 30.5 29.7 31.3 9 Days 18-32 31.7 30.2 33.3 10 Days 25-39 24.8 23.7 25.9 11 Days 11-18; 25-32 30.7 29.6 31.8 12 Days 11-18; 32-39 24.8 23.7 25.9 13 Days 18-25; 32-39 27.5 26.7 28.3 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)).

PAGE 82

82 Table 3-7. Pairwise comparison of T 50 values from Table 3-6 (Expt. 3). Treatment 1 2 3 4 5 6 7 8 9 10 11 12 13 1 2 3 4 NS 5 * 6 * NS 7 NS * 8 * NS NS 9 * NS NS NS 10 * NS 11 * NS NS NS NS 12 * NS NS 13 NS * NS NS * NS, Nonsignificant and significant at P =.05, respectively

PAGE 83

83 CHAPTER 4 DAY, NIGHT, AND DIURNAL MEAN TEMPERATURES Introduction Elevated day and night tem peratures in comb ination have been demonstrated to cause delay in the flowering response of poinsettia (Barrett, 2004; Weiland, 1998) A similar pattern was observed in certain chrysanthemum cultivar s (Cathey, 1954; Larsen, 1982; Whealy et al., 1987). In both poinsettia and chrysanthemum, h eat delay has been attr ibuted to high night temperatures. Some of the foundation poinsettia temperature studies inves tigated and in fact reported night temperatures alone with no record of either daytim e or diurnal mean temperatures (Langhans and Miller, 1960; Miller and Kiplinger, 1962; Robe rts and Struckmeyer, 1938). Roberts and Struckmeyer (1938) report ed that poinsettia (cultivar not indicated) fail ed to flower when the minimum night temperature was 21C while those grown with 16C or 18C minimum night temperatures flowered normally. In contra st, Miller and Kiplinger (1962) found no delay in flowering or initiation in Barbara Ecke S upreme with 21C minimum night temperatures compared to 16C or 18C with night lengths of 12 to 15 hours. Langhans and Larson (1960) investigated temp erature effects on Barbara Ecke Supreme with 15-hour night lengths and reported both day a nd night temperatures. Treatments with night temperatures of 27C reached visible bud 11 to 18 days later than treatments receiving 21C night temperatures regardless of day temperature. The results of these studies led to a long standing belief that elevated night temperature regardless of day temperature determines heat delay in poinsettia which can be found in mo re recent publications (Ecke et al., 2004; Erwin, 2005). Similar experimental results have been reported with heat-sensitive chrysanthemum cultivars. Chrysanthemum Miros was grown with 16-hour nights and 25 C day temperatures.

PAGE 84

84 With night temperatures of 24C, anthesis was delayed 10 days compared with plants grown in 21C or 18C night temperatures (Larsen, 1982). It was concluded in this study that the night temperature was the cause of the delayed flower ing. Cathey (1954) also concluded that the increase in time to flowering observed in chrysanthemum Encore was influenced more strongly by night temperature. As in the poinsettia st udies cited above, the night lengths in these chrysanthemum studies were signi ficantly longer than the day lengt hs so it is unclear if the apparent influence of night temperature is in fact due to the elevated night temperature or change in the diurnal mean temperature. Pearson et al. (1993) reanalyzed previously published data a ddressing the relative roles of day, night, and diurnal mean temperature in chrysa nthemum floral initiation and development. This analysis led to the formulation of a model for the effect of mean diurnal temperature on the time to flower in chrysanthemum. This model indi cates that the reciprocal of time to flower is linearly related to increase in the mean diurna l temperature when temperatures are below or within the optimum range. A bove the optimum temperature range the reciprocal of time to flower shows a negative linear correlation to increase in mean di urnal temperature. Application of this model to the data from Cathey (1954) showed a highly significant positive linear correlation between the reciprocal of days to flower and mean diurnal temperature up to about 21C in the heat insensitive cultivar Encore. This model also accuratel y predicts the response of high temperature sensitive cultivars to elevated temperature. When the model was applied to the data from Whealy et al. (1987) a strong negative correlation was found between the reciprocal of days to flower and increase in mean diurnal temperature from 21C to 29C. This model system for illustrating the effects of temperature on time to flower has been widely accepted by researchers studying chrysanthemum, but has not been investigated in

PAGE 85

85 poinsettia. For example, by applying this mode l Willits and Bailey (2000) determined that in chrysanthemum Iridon, the time to flower incr eased 4.2 days with each 1C increase in mean diurnal temperature above 23C. No published work has addressed the possibility of this model accurately describing the response of poinsettia to temperatures. In fact, the prevailing belief among poinsettia producers is that night temperature above 23C is the main cause of heat delay (Ecke et al., 2004; Erwin, 2005). The present study was designed to advance th e current understanding of the role of supraoptimal temperature in the time to flower in modern poinsettia cultivars First, a series of growth chamber experiments was designed to addr ess the roles of specifi c day, night, and diurnal mean temperatures. However, in this case as with all growth chamber experiments, the conditions do not simulate those found in greenhouse or nursery production. To more conclusively determine if heat delay in modern poinsettia production is th e result of elevated night temperatures or diurnal m ean temperatures as discovered in the case of chrysanthemum, two greenhouse experiments were designed. These experiments utilized temperature combinations that are more likely to occur in greenhouses or outdoor growing ranges in warm climates. Each temperature combination had the same daytime high temperature and overnight low temperature, but variable mean diurnal temperatures (Table 4-1). Materials and Methods For each ex periment, rooted cuttings were received from Paul Ecke Ranch (Encinitas, CA) and planted in 105 cm3 pots containing Fafard 2 growing medium (Conrad Fafard, Anderson, S.C.), which consists of 6.5 sphagnum peat : 2 perlite : 1.5 vermiculite (v/v). Plants were initially grown at 26 day /21C night te mperatures with incandescent night interruption lighting from 22:00 to 02:00 daily. From planting through the completion of the experiments, all plants received fertilizer at each irriga tion of Peters 20N-4.4P-16K supplying 300 mgL-1

PAGE 86

86 Nitrogen. Approximately one week after planting, a ll cuttings were pinched to five nodes. No plant growth retardants were used. Three cultivars were used: P restige Red, Red Velvet, and Barbara Ecke Supreme. Prest ige Red and Red Velvet are wi dely used in modern poinsettia production. Both of these cultivars have been documented to exhibit heat delay. Barbara Ecke Supreme is no longer used in commercial production. However, this cultivar was the subject of many of the foundation temperature studies so it was included to allow comparison with these studies. Growth Chamber Experiments Four separate experim ents were conducted in walk-in growth cham bers measuring 3.7 m by 3.7 m each and equipped with twelve 1,000-wa tt high pressure sodium lamps which produce 580 mol m-2s-1 PAR and six 60-watt incandescent lamp s (one 1.4 m on either side of the chamber). Two weeks after pinching, plants were transferred to the growth chambers and allowed to acclimatize for one week with continued ni ght interruption lighting. Following the acclimatization period, the photoperiod was set to 12-hours. The high pressure sodium lamps were set with digital timers to run from 23:30 to 10:30 and incandescent lighting demarcated the light period (23:00-24:00 and 10:00-11:00). The tr eatment temperatures were imposed until all plants were determined to have undergone floral initiation using the T50 floral initiation method as described in Chapter 2. Each experiment utilized a completely randomized design with 12 plants per treatment. Rooted cuttings of poinsettia Red Velvet were planted on 12 Jan. 2005 (Expt. 1) or 28 Feb. 2005 (Expt. 2). Rooted cuttings of Prestige Red and Red Velvet were planted on 5 Mar. 2007 (Expt. 3) or 28 May 2007 (Expt. 4). All plan ts were pinched to five nodes on 25 Jan. 2005, 7 Mar. 2005, 13 Mar. 2007, or 3 June 2007 then moved into the growth chambers on 9 Feb.

PAGE 87

87 2005, 21 Mar. 2005, 27 Mar, 2007, or 18 June 2007 fo r Expts. 1 through 4, respectively. The temperature treatments for Expts. 1 through 4 are outlined in Tables 4-2; 4-4, 4-6 and 4-8, respectively. These temperature treatments were applied from 17 Feb. 2005 through 18 Mar. 2005, 28 Mar. 2005 through 28 Apr. 2005, 4 Apr. 2007 through 5 May 2007, and 25 June 2007 through 27 July 2007 in each of the 4 experiments respectively. Data were collected as described below. Greenhouse Experiments The two greenhouse experim ents utilized a comp letely randomized design with 24 plants per treatment. Twelve of the pots were destruc tively harvested as described below to determine floral initiation and the other 12 plants were grown to anthesis. Following pinching, night interruption lighting was continued for two week s at which time 12-hour dark periods and the designated temperature treatments were impose d. The 12-hour dark periods were provided by covering the greenhouse benches with black cloth from 17:00 through 08:00 and then using incandescent lights (60 watt bulbs spaced at 1.2 m) to set the dark period. For Expt. 5 rooted cuttings of Prestige Re d were planted on 10 Feb. 2006 and pinched to five nodes on 20 Feb. 2006. For Expt. 6 rooted cuttings of Red Velvet, Prestige Red, and Barbara Ecke Supreme were planted on 22 D ec. 2006 and pinched to five nodes on 5 Jan. 2007. Treatments consisted of temperature combinations as outlined in Table 4-1 applied from 6 Mar. 2006 (Expt. 5) or 31 Jan. 2007 through initiation 6 Apr. 2006 (Expt. 5) or 2 Mar. 2007 (Expt. 6). From initiation though anthesis all plants were gr own with moderate day/night temperatures of 26 C /21 C. Data were collected as described below. Data Collection T50 floral initiation was determ ined for al l experiments using the method described in Chapter 2. In addition, for Expts. 5 and 6 the dates of first visible bract color, unfolding of the

PAGE 88

88 primary bracts to reveal the prim ary cyathium (visible bud), and anther dehiscence were recorded for each plant not used for shoot tip sampling. Average days for first color, visible bud, and anthesis were calculated in SAS and the WallerDuncan procedure was used for mean separation. Terms of the model were judged to be significa nt or nonsignificant based on a comparison of F values at P 0.05. Results and Discussion Experiment 1 Red Velvet plants grown with 12-hour dark pe riods, night tem peratures of 18C, 21C, or 24C in combination with 26C daytime temperatur es all reached floral initiation in 15 to 16 days (Table 4-2). There are no si gnificant differences in T50 initiation dates between the three treatments (Table 4-3). These results indicate that for. These findings are in contrast with those reported in earlier poinsettia flow ering studies which reported dela ys in floral initiation with night temperatures of over 21C (Miller and Kiplinger, 1962). The studies of Miller and Kiplinger (1962) uti lized 15-hour dark periods compared to 12-hour dark periods in the present study. The longer dark periods mean that the temperature during the dark period has more impact on the diurnal mean temperature than the temperature during the light period simply because the night temperatures are applied for a longer period of time. This difference in the relative contribution of the day and night temper ature to the diurnal mean likely led to the conclusion that night temperature is of greater influence in th e heat delay effect than day temperature. Experiment 2 Expt. 2 was designed with three treatm ents, two of which had the same diurnal mean temperature utilizing different da y and night temperature combinations. The third treatment used a day and night temperature combination shown to illicit the heat dela y response in previous

PAGE 89

89 studies. Floral initiation occu rred 6 and 7 days later with the 29/24C day/night temperature regime when compared with 29/18C and 26/23C temperature combinations, respectively (Table 4-4). The delay in flor al initiation with 29/24C in co mparison to 29/18C indicates that elevated daytime temperatures alone do not resu lt in heat delay. However, it can not be concluded that the night temperat ure is the cause of this delay as the diurnal mean temperature also varies between these two temperature regi mes (27C Vs. 24C). The difference in the T50 days between the plants grown at 29/24C and 26/23C indicate that the delay in floral initiation can not be attributed to night temperature alone The number of days to T50 initiation with 29/18C and 26/23C were not signifi cantly different (Table 4-5). These data indicate that the heat delay effect may be more closely linked to the diurnal mean temperature which is 24C for both treatments. To investigate this theory furt her, two additional experi ments were designed to isolate the effects of day and ni ght temperature and extend the inve stigation to include additional commercially important cultivars. Experiment 3 Two cultiva rs were used to investigate possible genotype specificity of the heat delay response. Expt. 3 was designed to determine if elevated day or night temperatures are more influential in determining the heat delay e ffect that is observed at 27C mean diurnal temperatures. Red Velvet plants grown at 24/24C reached T50 initiation in 17.7 days compared to 25.5 days at 24/29C and 25.4 days at 29/24C (Table 4-6). Th ese results indicate that a day or night temperature of 29C will cause a similar delay in floral initiation compared with 24C. For each of the three temperature co mbinations, there was no significant difference in the number of days to T50 in itiation between cultivars Red Ve lvet and Prestige Red (Table 4-7). This indicates that the response to thes e temperature combinations is not specific to

PAGE 90

90 cultivar Red Velvet. As in the previous expe riments, the data support the conclusion that heat delay may result from elevated diurnal mean temperatures. Experiment 4 Expt. 4 utilized two tem perature treatments with a diurnal mean temperature of 24C. One treatment had a day/night temperature regime of 21/27C and the other 27/21C. These treatments were designed to show if warm temp eratures during the night would illicit the heat delay effect preferentially to da y temperatures as seen in earlie r studies. Red Velvet reached T50 initiation in 19.4 or 19.5 days with 21/27 C or 27/21C temperature combinations while those grown at 27/27C reached T50 initiation after 23.0 days (Table 4-8). As in the previous experiment, cultivars Red Ve lvet and Prestige Red were included. Again, there were no significant differences in the number of days to T50 initiation between the cultivars with each temperature regime (Table 4-9). These data indicate that elevated night or day temperature alone will not cause a delay in floral initiation while sustained elevated temperatures do cause significant delay. The growth chambers are very useful for th eir ability to maintain specific temperature treatments during both the light a nd dark period. This allows te mperature combinations to be utilized that are not possible w ith greenhouse systems. However, the fact that these temperature regimes could not occur in a greenhouse setting creat es a need to test the theories produced from these data to be tested in more normal conditions if these theories are to be applied to commercial greenhouse production. To address this situation, tw o greenhouse experiments were conducted. Experiment 5 The two greenhouse experim ents were designed to simulate daily temperature fluctuations that may occur in a commercial greenhouse environm ent. The temperature treatments for Expt.

PAGE 91

91 5 are shown in Table 4-1 and the dates of first co lor, visible bud, and anthesis are shown in Table 4-10. Prestige Red plants that were grown w ith mean diurnal temperatures of 21C and 24C reached T50 initiation in 14.1 and 15.0 days. However, Plants grown with a mean diurnal temperature of 27C reached T50 initiation in 22.0 days (Table 4-11). Following the initiation period the plants were moved to a single greenho use and grown to anthesis with a mean diurnal temperature of 24C.. The delay in initiation paralleled the delay in visible bud and anthesis (Table 4-10). Plants receiving 21C and 24C tr eatments reached T50, visible bud, and anthesis 7 to 9 days before those plants grown at 27C (Table 4-12). These data indicate that the observed delay in the flowering process is the resu lt of a delay in floral initiation and that this delay is due to an increase in mean diurnal temperature. Experiment 6 Expt. 6 utilized the same treatm ents as Expt. 5 with the addition of a forth treatment (Table 4-1). This additional treatment has average day, average night, and mean diurnal temperature of 24C while maintaining the standard high and low temperatures. This treatment also has the same night temperature regime of the 27C mean temperature treatment. This temperature regime was included to verify that the delay in floral initiation seen in the 27C mean temperature treatment is not in response to th e 24C average night temperature, but the mean diurnal temperature. Cultivars R ed Velvet and Prestige Red were included in this experiment with the addition of Barbara Ecke Supreme. B arbara Ecke Supreme is a cultivar that was grown commercially when many of the foundation studies on the poinsettia flowering response were conducted and it was used in many of these studies. This cultivar was included in this experiment to determine if the heat delay res ponse in poinsettia has changed with new cultivar development over the past 40 years.

PAGE 92

92 Dates of floral initiation, firs t color, visible bud, and anthesis vary between cultivars and treatments (Table 4-13). Plants of cultivars Red Velvet and Prestige Red receiving temperature treatments of 23/29C, 26/22C, or 24/24C all reached T 50 initiation between 17.4 and 18.5 days following the onset of 12-hour dark periods (Table 4-14). Those grown at 29/24C reached T50 initiation in 25.0 days fo r plants of Red Velvet and 21.8 days for Prestige Red plants. These T50 dates are signifi cantly later than those recorded in the previous temperature treatments for each cultivar (Table 415). These data are consistent with those from the previous experiments. The 24/24C and 29/24C temperature treatment both utilize 24C average night temperatures. So the difference in days to initiation betw een these two treatments can not be attributed to the warm night temperatur e. These data form the strongest evidence that the delay in flowering observed in poinsettia crops is in fact the result of diurnal mean temperatures of 27C or higher a nd not the result of night temp eratures of 23C or above as indicated by the Ecke Poinsettia Manual (Ecke et al., 2004). Plants of Barbara Ecke Supreme reached T50 initiation in only 13.4 days with 26/22C temperatures and 16.0 days with both 23/29C a nd 24/24C temperatures (Table 4-14). The reason for this cultivar to undergo fl oral initiation earlier than the modern cultivars is not clear. However, with the 29/24C temperature combination plants of Barbara Ecke Supreme did show the expected delay in initiation, reaching T 50 initiation in 21.7 days. Dates of first color, visible bud, and anthesis (Table 413) indicate that the visible dela y in flowering is due to the delay in floral initiation for Bar bara Ecke Supreme also. The f act that Barbara Ecke Supreme shows a very similar pattern of heat delay cast s doubt on the theory that breeding progress has changed the manner in which poinsettia pl ants respond to elevated temperatures.

PAGE 93

93 Conclusions The results of this study show that the heat delay effect as observed in modern poinsettia production is the result of elevated m ean temper atures and not night temp eratures alone. The growth chamber experiments demonstrated in a th eoretical context that high temperature delay in poinsettia is the result of mean diurnal temperatures of 27C. These experiments which rely on inversion of day/night temperature regimes are very useful to dem onstrate the response of plants to thermal conditions at various phases of th e diurnal cycle. However, such inverted thermoperiods would not be allowed to o ccur in greenhouse crop production so the data generated in this way can not be directly used to conclude that observed responses in these crops result from a certain phase of the experimental thermoperiod. In general, temperature controlled greenhouses utilize daytime temperatures about 5-10C above overnight te mperatures. Many of the foundation studies inve stigating the response of poinsettia floral initiation and development to temperature utilized growth chamber experiments with ther moperiod inversion treatments (Langhans and Miller, 1960; Mill er and Kiplinger, 1962). The da ta generated in these studies, which linked heat delay with night temperatures, has long been us ed to explain heat delay in poinsettia. In fact, one of the most prominent poinsettia production manuals advises growers that night temperatures above 23C will lead to heat delay in their poinsettia crops. (Ecke et al., 2004). As discussed earlier thes e studies utilized short-day ph otoperiods with night lengths longer than day lengths so the ni ght temperature contributed more heavily to the mean diurnal temperature. This is in contrast with Expts. 1-6 which utilized even day and night lengths. In this case, the data from the greenhouse experi ments support the conclusion that the observed delay in floral initiation is the re sult of diurnal mean temperatures. The conclusion that heat delay in poinsettia is the result of supraoptimal mean diurnal temperatures will allow growers to utilize a new temperature managing technique called

PAGE 94

94 temperature averaging or temperature integration to manage this production problem in warm climates. With this method, growers allow temp eratures to rise above traditional set-points during and day and fall below them overnight resu lting in greater diurnal temperature fluctuation but similar diurnal mean temperatur es. Studies to determine the feasibility of this technique have shown that the rate of many important physiolo gical processes including photosynthesis and leaf unfolding rates can be correlated to diurnal mean temperature (Krner, et al., 2004; Langton and Horridge, 2006; Lentz, 1998). This allows gr owers to reduce energy used for heating and cooling without losing the ability to precisely schedule their crops which is important for poinsettia as it requires highly pr ecise scheduling to meet a very short market window. In addition, as a commodity crop, the profit margin s on poinsettia crops can be very slim so efficient use of energy is vital. Future studies will be necessary to confirm that temperature integration will not adversely affect other asp ects of poinsettia production. However, it appears that this technique has real promise to impr ove poinsettia production efficiency in warm climates. Table 4-1. Temperature treatments for greenhouse experiments (Expt. 5 and 6). Expt. 5 treatment temperatures (C) Expt. 6 treatment temperatures (C) Time 1 2 3 1 2 3 4 02:00-06:00 18 18 18 18 18 18 18 06:00-10:00 18 21 29 18 21 18 29 10:00-14:00 21 27 29 21 27 24 29 14:00-18:00 29 29 29 29 29 29 29 18:00-22:00 21 27 28 21 27 28 28 22:00-02:00 18 21 26 18 21 26 26 Diurnal mean temperature 21 24 27 21 24 24 27 Average day temperature (06:00-18:00) 23 26 29 23 26 24 29 Average night temperature (18:00-06:00) 19 22 24 19 22 24 24

PAGE 95

95 Table 4-2. Number of days to 50% floral initiation (T50)z in Red Velvet from the onset of 12hour dark periods with day/night temper atures of 26/18C, 26/21C, or 26/24C (Expt. 1). Day /night temperature (C) Days to T50 initiation 95% confidence interval 26/18 15.5 14.72 16.19 26/21 15.1 14.13 16.08 26/24 15.6 14.87 16.42 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 4-3. Student t-test pa irwise comparison of T50 valu es in Table 4-2 (Expt. 1). 26/ 18C 26/21C 26/24C 26/18C 26/21C NS 26/24C NS NS NS, Nonsignificant and significant at P =.05, respectively Table 4-4. Number of days to 50% floral initiation (T50)z for Red Velvet from the onset of 12hour dark periods with day/night temper atures of 26/23C, 29/24C, or 29/18C (Expt. 2). Day /Night temperature (C) Mean temperature (C) T50 initiation (Days) 95% confidence interval 26/23 24 16.2 14.19 18.22 29/24 27 23.0 23.00 23.00 29/18 24 17.5 16.51 18.50 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 4-5. Student t-test pa irwise comparison of T50 valu es in Table 4-4 (Expt. 2). 26/23C 29/24C 29/18C 26/23C 29/24C 29/18C NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 96

96 Table 4-6. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark periods with day/night te mperatures of 24/29C, 24/24C, or 29/24C. Analysis of variance revealed that the e ffects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days to T50 initiation were significant at the 0.05 level (Expt. 3). Cultivar Day /Night temperature (C) Mean temperature (C) T50 initiation (Days) 95% Confidence Interval 24/29 27 25.5 23.18 27.73 Red Velvet 24/24 24 17.7 16.58 18.75 29/24 27 25.4 22.49 28.41 24/29 27 23.2 22.32 24.01 Prestige Red 24/24 24 18.3 17.25 19.41 29/24 27 24.5 23.72 25.33 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 4-7. Student t-test pa irwise comparison of T50 valu es in Table 4-6 (Expt. 3). Red Velvet Prestige Red 24/29C 24/24C 29/24C 24/29C 24/24C 29/24C Red Velvet 24/29C Red Velvet 24/24C Red Velvet 29/24C NS Prestige Red 24/29C NS NS Prestige Red 24/24C NS Prestige Red 29/24C NS NS NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 97

97 Table 4-8. Number of days to T50z initiation from the onset of 12-hour dark periods with day/night temperatures of 21/27C, 27/ 21C, or 27/27C. Analysis of variance revealed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days to T50 initiation were significant at the 0.05 level (Expt. 4). Cultivar Day /night temperature (C) Mean temperature (C) T50 initiation (Days) 95% Confidence Interval 21/27 24 19.4 19.12 19.65 Red Velvet 27/21 24 19.5 18.80 20.18 27/27 27 23.0 22.52 23.48 21/27 24 19.2 18.32 20.01 Prestige Red 27/21 24 18.5 17.72 19.33 27/27 27 24.0 23.31 24.69 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 4-9. Student t-test pa irwise comparison of T50 valu es in Table 4-8 (Expt. 4). Red Velvet Prestige Red 21/27C 27/21C 27/27C 21/27C 27/21C 27/27C Red Velvet 21/27C Red Velvet 27/21C NS Red Velvet 27/27C Prestige Red 21/27C NS NS Prestige Red 27/21C NS NS NS Prestige Red 27/27C NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 98

98 Table 4-10. Number of days to first color, vi sible bud, and anthesis from the onset of 12-hour dark periods in Prestige Red with mean diurnal temperatures of 21C, 24C, or 27C. Analysis of variance revealed th at the effects of te mperature treatment on the number of days to first color, visible bud, and anthesis were si gnificant at the 0.05 level (Expt. 5). Day /night temperature (C) Mean temperature (C) Days to first color Days to visible bud Days to anthesis 23/19 21 30.2 bz 34.6 b 54.2 b 26/22 24 29.2 b 34.0 b 53.6 b 29/24 27 43.6 a 42.8 a 65.2 a zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10) Table 4-11. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark periods for Prestige Red with mean diur nal temperatures of 21, 24, or 27C. Analysis of variance revealed that the e ffects of temperature treatment, cultivar, and the interaction of temperature and cultivar on the number of days to T50 initiation were significant at the 0.05 level (Expt. 5). Day /night temperature (C) Mean temperature (C) T50 initiation (Days) 95% Confidence Interval 23/19 21 14.1 13.38 14.84 26/22 24 15.0 14.77 15.22 29/24 27 22.0 21.96 21.96 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Table 4-12. Student t-te st pairwise comparison of T50 va lues in Table 4-11 (Expt. 5) 23/19C 26/22C 29/24C 23/19C 26/22C NS 29/24C NS, Nonsignificant and significant at P =.05, respectively

PAGE 99

99 Table 4-13. Number of days to first color, vi sible bud, and anthesis from the onset of 12-hour dark periods with mean diurnal temperatur es of 21, 24, or 27C. Analysis of variance revealed that the effects of temperature treatment, cultivar, and the interaction of temperature and cultivar on th e number of days to first color, visible bud, and anthesis were significant at the 0.05 level (Expt. 6). Cultivar Day /night temperature (C) Days to first color Days to visible bud Days to anthesis Red Velvet 23/19 25.5 efz 33.7 cd 55.7 c 26/22 24.8 f 32.3 de 52.2 ef 24/24 26.5 e 32.8 cd 54.3 d 29/24 33.8 b 45.2 a 65.3 a Prestige Red 23/19 28.2 d 33.7 c 53.2 e 26/22 25.8 ef 31.0 fg 50.3 g 24/24 29.7 cd 32.3 de 52.2 fg 29/24 33.7 b 40.3 b 62.1 b 23/19 32.5 b 33.3 cd 51.8 f Barbara Ecke Supreme 26/22 29.7 cd 31.3 ef 50.2 g 24/24 30.5 c 29.8 g 51.2 fg 29/24 53.3 a 44.7 a 66.0 a zMean values followed by different lowercase le tters represent significant differences by WallerDuncan K-ratio t Test ( P <0.05; n=10) Table 4-14. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark periods with mean diurnal temperat ures of 21, 24, or 27C (Expt. 6). Cultivar Day /Night temperature (C) T50 Initiation (Days) 95% Confidence Interval Red Velvet 23/19 18.5 17.82 19.20 26 /22 17.5 16.08 18.82 24/24 18.5 16.71 20.28 29/24 25.0 23.80 26.20 Prestige Red 23/19 17.5 16.80 18.18 26 /22 17.4 17.12 17.66 24/24 17.8 17.22 18.39 29/24 21.8 20.81 22.88 23/19 16.0 16.00 16.00 Barbara Ecke Supreme 26 /22 13.4 13.12 13.65 24/24 16.0 14.43 17.57 29/24 21.7 20.82 22.51 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)).

PAGE 100

100Table 4-15. Student t-test pa irwise comparison of T50 values in Table 4-14 (Expt. 6). Red Velvet Prestige Red Barbara Ecke Supreme 23/ 19C 26/ 22C 24/ 24C 29/ 24C 23/ 19C 26/ 22C 24/ 24C 29/ 24C 23/ 19C 26/ 22C 24/ 24C 29/ 24C Red Velvet 23/19C 26/22C NS 24/24C NS NS 29/24C Prestige Red 23/19C NS NS NS 26/22C NS NS NS 24/24C NS NS NS NS NS 29/24C * 23/19C * * Barbara Ecke Supreme 26/22C * * 24/24C NS NS NS NS NS NS 29/24C * NS NS, Nonsignificant and significant at P =.05, respectively

PAGE 101

101 CHAPTER 5 HEAT DELAY MECHANISMS Introduction The m echanisms of photoperiodic flowering have been studied in detail in model plant systems such as arabidopsis and rice. At this stage of plant physiology research, the information gained from the model systems can be applied to other crops of economic importance such as poinsettia. This type of re search, now referred to as translational research seeks to extend findings from models to system s where greater impact may be re alized. The current study is designed to uncover the mechanism responsible for th e heat delay effect obs erved in the previous experiments. Photoperiodic tendencies are rooted in the abil ity of an organism to tell time, indicating the presence of an internal oscillator that opera tes independently from acute environmental input. The circadian oscillator, or clock, is such a mechanism. The circadian clock is the time keeping mechanism in both plants and animals. This well conserved mechanism is composed of several elements. The circadian oscillator is the core mechanism that conditions the internal environment to anticipate or ad apt to diurnal fluctu ations in environmental conditions. In arabidopsis, the circadian oscillator has been well described. The cen tral oscillator consists of at least two negative re gulatory elements: CIRCADIAN CLOCK ASSO CIATED PROTEIN 1 ( CCA1 ) and LATE ELONGATED HYPOCOTYL ( LHY ) and one positive element TIMING OF CAB EXPRESSION 1 ( TOC1 ). These elements are linked in a negative feedback regulatory loop in which increased expression of TOC1 suppresses CCA1 and LHY expression and vice versa (Salome and McClung, 2005). As the name suggests TOC1 controls the cyclic expression of CHOROPHYLL A/B BINDING PROTIEN ( CAB ) also referred to as LIGHT HARVESTING, CHLOROPHYLL-BINDING PROTEIN ( LCHB ). The expression of this gene under constant

PAGE 102

102 light or constant darkness fo llowing light-dark entrainment provi des an indication of the period of the circadian oscillator. By monitoring the expression pattern of CAB, alterations in circadian rhythm can be detected. In long-day plant arabidopsis the photope riodic floral initia tion process is well documented. CONSTANS ( CO), a gene encoding for a transcrip tion factor, plays a vital role in arabidopsis floral i nduction. Expression of CO is regulated by the circadian clock with peak expression occurring during the da rk period in short-day conditi ons. In long day-lengths high levels of CO expression occur at dawn a nd dusk (Yanovsky and Kay, 2006). CONSTANS protein stability is enhanced by high far-red to red li ght ratios indicating this gene plays a role in sensing light quality as well as day-length. In long day conditions this means that CO protein stability is greatest in the late afternoon a nd regulated by phytochrome signals (Imaizumi and Kay, 2006). The floral induc tion process begins with CO expression in the leaves coinciding with the proper light environment which induces FLOWERING LOCUS T ( FT) expression followed by FT protein movement to the shoot apical meristem where in conjunction with FLOWERING LOCUS D ( FD ) stimulates expression of SUPPRESSOR OF OVEREXPRESSION OF CO 1 ( SOC1 ) and APETALA 1 ( AP1) which in turn upregulates a number of well known meristem identity genes initiating the transition from a vegetative to reproductive meristem (Corbesier and Coupland, 2006). Of course photoperiodic floral induc tion in short-days plants may not follow the same pathway. Rice is commonly used as a model system for photoperiodic flowering in short-day plants. However, the genes and biochemical processes involved in photoperiodic floral induction in short-day plants have not been documented to the extent as those of long-day model plant arabidopsis (Searle and Coupland, 2004) Several genes in rice have been identified that relate to

PAGE 103

103 the circadian clock and photoperiodic flowering. HEADING DATE 1 ( HD1), HEADING DATE 3 ( HD3a ), and HEADING DATE 6 ( HD6 ), have all been characterized as quantitative trait loci that play roles in determining critical night length. The protein encoded by HD1 is a functional ortholog of CO protein in arabidopsis which effects expression of HD3a which is analogous to the arabidopsis FT protein (Yano, et. al., 2001) However, the ways in which these homologous genes react to light signals is not similar to arabidopsis. In ri ce, the expression of HD3a is only activated by HD1 during the dark period (Izawa, et. al., 2002 ). Also the relationship between the relative abundance of HD1 and HD3a appears to be opposite of that in arabidopsis CO and FT. An increase in the expression of HD1 causes a reduction in HD3a abundance. This indicates that HD1 represses flowering in long-day conditions through HD3a The mechanism for this change in function of the CO-like gene in rice is not known (Cremer and Coupland, 2003). The similarity in the structures of these orthol ogous genes indicates that there may be similar mechanisms for photoperiod sensing and signaling between rice and Arabi dopsis with divergent functional relationships (Searle and Coupland, 2004). These findings also suggest that the genes involved in the photoperiodic flor al induction pathway may be well conserved in the plant kingdom. Given this extensive study of the photoperiodic flowering pathway in model systems, it is now practical to utilize this knowledge to address practical problems such as heat delay in poinsettia production. To test the e ffect of heat delay in floral in itiation via interaction with the photoperiod pathway a study was designed to desc ribed how light and clock regulated genes were affected by heat in poinsettia. Monitoring clock output and accumulation of CO transcripts may provide a starting point for unveiling the molecu lar mechanism(s) that underlie heat delay.

PAGE 104

104 Materials and Methods Rooted cuttings were received from Paul Ec ke Ranch (Encinitas, CA) and planted in 96 cm3 pots containing Fafard 2 growing medium (Conrad Fafard, Anderson, S.C.), which consists of 6.5 sphagnum peat : 2 perlite : 1.5 vermiculite (v /v). Plants were initially grown at average day/night temperatures of 26C day /21C night with incandescent night interruption lighting (22:00-02:00). From pl anting through the completion of the experiment, all plants received fertilizer at each irrigation of Peters 20N-4.4P-16K supplying 300 mgL-1 Nitrogen. No plant growth retardants were used. The experiment was conducted in walk-in growth chambers m easuring 3.7 m by 3.7 m each and equipped with twelve 1,000-watt high pr essure sodium lamps which produce 580 mol m-2s-1 PAR and six 60-watt incandescent lamps (one ev ery 1.4 m on either side of the chamber). Rooted cuttings of poinsettia Red Velvet were potted on 6 April 2005 and pinched to five nodes on 19 April 2005. Plants were transfer red to the growth chambers on 1 May 2005and allowed to acclimatize for eleven days with c ontinued night interrupti on lighting (22:00-02:00). On 11 May 2005, the photoperiod was set to 12-hours. The high pressure sodium lamps were set with digital timers to run from 23:30 to 10:30 and incandescent lighting demarcated the light period (23:00-24:00 and 10:00-11:00). At the onset of 12-hour dark periods, either the high (29C day /24C night) or low (24C day/21C night) temperature treatment was imposed. These treatment temperatures were maintained until all plants were determined to have undergone floral initiation as described below (11 June 2005). A completely randomized design with 12 plants per treatment was used. Initiation Dating T50 floral initiation dates were determ ined by SAS Proc Nonlin (SAS Inst., Cary, NC) with the equation y=(100/1+e(-k*(x-b)) using th e following method. Shoot tips were collected

PAGE 105

105 from one lateral on six plants per treatment every 2 days and examined with a Fisher Stereomaster 45X dissecting scope (Fisher Scie ntific, Inc., Pittsburgh, PA) to determine the development stage of each meristem. The stag es were rated as described by Grueber and Wilkins (1994). Meristems rated as stage three or above were considered initiated. These data were used to calculate a T50 fo r the number of days from the onset of 12-hour dark periods to 50% floral initiation. Tissue Collection for RNA Extraction Tissue co llections were carri ed out beginning on the projected T50 date of the low temperature, 12-hour dark-period treatment (17 da ys after the onset of 12-hour dark periods). Partially expanded leaves were collected from 6 plants per treatment every 4 h for 48 h beginning of the onset of the light period on day 17. Immediately after the tissue was harvested it was frozen with liquid nitrogen and transferred to a fr eezer set to -80C. Extraction of RNA and Gel-Blot Creation RNA was isolated from the young leaf tissue using a modified cet yltrimethylammonium bromide (CTAB) extraction protocol (Chang, et al., 1993). Frozen tissue was ground into a powder then mixed with an extract ion buffer (2% CTAB, 2% PVP, 100 mM Tris-HCl, 25 mM EDTA, 2.0 M NaCl, 0.5 gL-1 spermidine, 2% 2-mercaptoethanol) at 10 ml per 1 g of tissue. The mixture was incubated at 65C for 10 min, cooled to room temperature, followed by extraction with an equal volume of 24 chloroform : 1 isoamy l alcohol (v/v). The mixture was centrifuged for 10 min at 8,000 xg. Following centrifugation th e aqueous phase (top phase) was transferred to a clean 15 ml tube and extracted a second ti me with chloroform:isoamyl. The mixture was centrifuged once again for 10 min at 8000 xg. Following the second centr ifugation the RNA was precipitated on i ce overnight in 0.25 volume of 10 M LiCl. RNA was pelleted by centrifugation at 10,000 xg for 30 min at 4C. The RNA pellets were then resuspended in 500 l of SSTE (1M

PAGE 106

106 NaCl, 0.5% SDS, 10mM Tris, 1mM EDTA) then extracted with an equal volume of 24 chloroform : 1 isoamyl alcohol (v/v). Following centrifugation, the supern atant was transferred to a clean 1.5 ml centrifuge tube and the RNA was precipitated in 2 volumes of EtOH at -70C for 30 min. The RNA was pelleted again using the previously de scribed centrifugation technique then washed with 500 l of wash solution (76% EtOH, 0.3 M NaOAC treated with DEPC). The pellets were dried at room temperature then re suspended in 50 l an RNA resuspension buffer (10mM Tris, 2.5mM EDTA) for storage. The RNA was separated on agarose gels cont aining 1.5% agarose and 5.0% formaldehyde (v/v) with 10 g of RNA per lane. The RNA wa s transferred to a Gene Screen nylon membrane (Schlicher and Schuell, Keene, NH) with capillary blotting with 10x SSC overnight. The blots were rinsed in 1x SSC and then UV crosslinked. Probe Hybridization Transcripts of interest were detected using radiolabeled probes. The DNA tem plates for labeling were generated by PCR ag ainst cDNA from strawberry ( Fragaria vesca and Fragaria x ananassa) and Arabidopsis thaliana using the primers listed in Table 5-1. Products were generated representing light-harves ting, chlorophyll-binding protein ( CAB), the 18S ribosomal DNA and CO The products were radio-labeled with 32P dCTP by random priming using the Prime-a-Gene kit following manufacturers inst ructions (Promega Inc; Madison, WI). Unincorporated nucleotides were removed us ing Sephadex G-50 spin columns. The radiolabeled probes were denatured at 95C for 5 mi n before addition to the hybridization solution. The blots were pre-hybridized for at least 2 h in Church and Gilbert Buffer (Church and Gilbert, 1984), and then the dena tured probe was added to the hybr idization solution. The blots were hybridized in a hybridizati on oven at 65C for 16 h. Follow ing hybridization the blots were washed three times in successive solutions of 1x SSC, 0.1% SDS, the first one at 37C and the

PAGE 107

107 last two at 60C. The blots we re air dried for 5 min and then wrapped in plastic wrap before autoradiography. Results and Discussion Plants in the low tem perature treatment reach ed T50 initiation in 17.6 days compared to 25.1 days in high temperature treatment (Table 52). The difference is the number of days to T50 initiation is significant at the 0.05 level. These data indicate that the plants in the low temperature treatment were indeed in the midst of the shift from vegetative to reproductive growth during the tissue sampling period duri ng days 17 and 18 while plants in the high temperature treatment were not. The autoradiographic images generated from the RNA blots for each treatment are shown in figures 5-1 and 5-2. Lane 1 on the left side of each image contains the RNA extracted from tissue collected at time point 0 which is the beginning of the light period on day 17. Each subsequent lane contains the RNA from the next time point which is 4 h later. Since both treatments were exposed to 12-h dark periods, time point 12 is the beginning of dark period, and time point 24 is the beginning of the light period of day 18. The cyclic expression of CAB is similar in both the high a nd low temperature treatments (Fig. 5-1). Expression peaks dur ing the light hours and there is essentially no expression during the dark hours. The fact that there is not a discernable difference in the expression patterns between the high and low temperature treatment indicates that the circadian clock or its entrainment is not altered by the supraoptimal temp erature conditions. These results indicate that the mechanism for heat delay must be occurring later in the floral i nduction signaling cascade since floral initiation is taking place during the sampling period in the low temperature treatment but not in the high temperature treatment.

PAGE 108

108 However, in contrast to the patterns of CAB gene expression CO transcript cycling is affected by the high temperature treatment (Fi g. 5-2). In the low temperature treatment, CO expression is fairly constant while in the hi gh temperature treatment there is considerable variations in expression level ac ross the time points. Expression le vels increase late in the night through the morning hours and are lower in the afternoon and overnight hours. Since the T50 initiation data show that the hi gh temperature treatment is not undergoing floral initiation during the sampling period, the peak in CO around the end of the dark hours may be inhibiting floral initiation. In short-day plant rice, a CO homolog is known to act as a repressor of flowering in non-inductive photoperiods. An alte rnative, and perhaps more likel y, explanation is consistent with the External Coincidence Model of phot operiodic flowering (Yanofsky and Kay, 2003). In this model the accumulation of CO protein based on internal cues would coincide with external environmental signals, namely light. In arabidopsis, the light qua lity at the end of the day is the external cue that dictates if flow ering will occur. In low temperature poinsettia CO transcripts are present at all time points. If protein accumulation follows transcript accumulation, then it would be expected that CO would be present and the flowering could commence, consistent with observations. Howe ver, if supraoptimal temperatures cause CO to initiate robust cycling where it is absent during this critical pe riod, as in figure 5-2, then plants would not be expected to flower. The alternative explanation makes a hazardous assumptionthat protein levels mirror steady-state transcript levels Elegant studies by Valver de et al., (2004) show that CO accumulation is carefully controlled by light qual ity by degradation and even strong constitutive expression of CO transcript cannot override posttransl ational effects on protein stability. However, the CO antibodies do not work well outside of arabidopsis (K. Folta, pers. comm.) so

PAGE 109

109 the transcript accumulation levels are the best gauge available. The heat-dependent variations observed herein are novel and strongly suggest that heat can affect the accumulation of transcripts directly relevant to pho toperiodic flowering, and delineate an area for future inquiry. Conclusions This experim ent indicates that the underlyi ng mechanism of heat de lay in poinsettia may occur at the CO expression stage of the photoperiodic fl oral initiation pathway. Of course, additional research will be necessary to validat e this hypothesis. Understanding the mechanism of this physiological phenomenon coul d lead to new methods to detect a delay in floral initiation at an earlier stage of developm ent than currently possible. Currently, poinsettia growers must wait until floral development and bract coloration are visible whic h occurs 2 to 3 weeks after floral initiation depending on conditions. Determin ing that the crop will be delayed at initiation would leave growers with more options to overc ome the potential problem of late blooming such as contracting with other growers or adjusting th e schedule of another group of plants to fill the gap. The study also suggests that it may be possi ble to override temperature cues by simply overexpressing CO. It may be of interest to test wild accessions or other cultivars to identify CO overexpressors or even engineer new cultivars with overexpressing, arrhythmic CO gene constructs. Based on the preliminary findings in this study both approaches may provide a means to mitigate the effects of heat on flowering, leading to an increase in profitable production for growers and better quality, possibly ever -blooming seasonal plants for consumers.

PAGE 110

110 Table 5-1. Primers used fo r tracking expression of CAB and CO in Red Velvet. Gene 5 3 CAB (A. thaliana) ATGGCCGCCTCAACAATGGC CCGGGAACAAAGTTGGTGGC CO (A. thaliana) ATGTTGAAACAAGAGAGTAAC TCAGAATGAAGGAACAATCC CO (F. vesca ) TCAGAATGAAGGAACAATCC AGC AAAGTTATGATATTGCTG Table 5-2. Number of days to 50% floral initiation (T50)z from the onset of 12-hour dark periods in Red Velvet with day/night te mperatures of 24/21C or 29/24C. Day /night temperature (C) Days to T50 initiation95% confidence interval 24/21 17.6 16.40 18.60 29/24 25.1 24.13 26.08 zT50 is the predicted value for the number of days to 50% initiation determined by SAS Proc Nonlin with the equation y=(100/1+e(-k*(x-b)). Figure 5-1. Expression patterns of CAB and CO with 24C day/21C night temperatures and 12-hour dark periods.

PAGE 111

111 Figure 5-2. Expression patterns of CAB and CO with 29C day/24C night temperatures and 12-hour dark periods.

PAGE 112

112 CHAPTER 6 RESEARCH SUMMARY In a 4-year series of studies, the nature and m echanisms of high temperature delay in poinsettia flowering were investigated. Experime nts were designed to elucidate the effects of supraoptimal temperatures as well as the ti ming, duration, and diurna l distribution of the supraoptimal temperatures on the photoperiodi c flowering response of modern poinsettia cultivars and the underlying mechanism for these eff ects. Standard temperature treatments were used throughout the course of the study: high (2 9C day /24C night) and low (24C day/21C night) with the exception of the expe riments designed to investigate the effect of diurnal distribution of supraoptimal temperatur es which utilized a va riety of temperature treatments. First, several experiments were conducted in cluding a variety of co mmercially important poinsettia cultivars to determine the range of th e heat delay sensitivity present in modern cultivars. All cultivars tested did experience so me delay in flowering at the high temperature treatment compared to the low temperature treatme nt in natural day length conditions. However, the magnitude of this delay varied by cultivar Examination of shoot tips at the microscopic level revealed that the delay in flowering time was a direct result of a de lay in floral initiation rather than floral development. Several pairs of closely related cultivars we re exposed to the high and low temperature treatments and it was noted that within the pairs the number of days of delay in floral initiation were almost identical. Between pairs the degree of delay was not similar. This indicates that there is a range of heat delay se nsitivity linked to the plants genotype so there is a possibility for breeding progress to reduce or eliminate the problems in poinsettia production caused by heat delay.

PAGE 113

113 The next phase of the study consisted of iden tifying the effects of the timing and duration of high temperature exposure on th e degree of heat delay that o ccurs. Cultivar Autumn Red was selected for these studies as its heat delay sensitivity was average among the cultivars tested. Results showed that both the timing and duration of high temperature exposure had significant effects on the timing of floral initiation in natural day conditions. The timing of high temperature exposure is the key to whether or not a delay in initiation occurs. There is a window of time in which the plant is susceptible to heat delay which begins about 14 days before microscopically visible floral in itiation and continues though about 14 days following this stage. High temperatures exposure before or after this 28-day window does not cause any delay in floral initiation or developmen t. During the time window, the duration of high temperature exposure determines the number of days delay in floral initiation. At least 14 days of high temperatures is required to produce a significant delay in floral initia tion, and increasing the exposure time up to 28 days increases the number of days of delay in floral initiation compared to low temperature control plants. This info rmation will allow poinsettia producers to predict early in the production cycle whethe r or not their crops will be impacted by heat delay. The ability to predict the delay in flowering before the plants show visible floral development will leave growers with more viable options to overcome the problem. The next studies investigated the role of diurnal distribution of the high temperature exposure. There is a long standing belief among poinsettia growers that high night temperatures of 23C or higher are the cause of heat delay which is based on data from studies conducted several decades ago. Recent research on chry santhemum has found that the diurnal mean temperature is more strongly linked to heat delay in that species. The current studies in both growth chambers and greenhouse compartments showed that heat delay in poinsettia is also the

PAGE 114

114 result of elevated mean diurnal temperatures of 26C or above. This knowledge also allows growers to more accurately predic t when heat delay will affect their crops by measuring diurnal mean temperature rather than relying on overnight low temperature to indicate the possibility of heat delay. Finally, an attempt was made to uncover the und erlying mechanism of th e heat delay effect on poinsettia. RNA was extracted from leaf tissue sa mpled at 4 h intervals when the plants in the low temperature treatment were undergoing floral in itiation. Meristem examination revealed that the plants in the low temperature treatment were in fact undergoing flor al initiation during the sampling period and those in the high temperat ure treatment were not. Cyclic expression patterns were monitored for 2 transcripts wh ich are associated w ith light sensing ( CAB ) and photoperiodic floral induction ( CO) in arabidopsis. The results s howed no change in expression of CAB between the high and low temperature tr eatments, but a difference was observed in CO expression. With high temperatures ther e were greater daily fluctuations in CO which may be causing an inhibition in flowering as the CO expression peaks just before dawn. Additional study is necessary to confirm this hypothesis. This series of studies yielded several valu able insights on the eff ects of supraoptimal temperatures on poinsettia that are directly appl icable to poinsettia production in Florida and other warm climates around the world. With th is new information poinsettia producers will be able to accurately predict when heat delay will impact theirs crops early enough in the production schedule to have viable options to overcome the looming problem. Also, the information generated by cultivar comparison gi ves the poinsettia breeders insight into the genetic component of heat delay sensitivity to en able future breeding progress to work towards the eventual mitigation of heat delay in poinset tias. Finally exploring the expression of genes

PAGE 115

115 involved in the heat delay effect are representative of an important stage of molecular biology that is beginning today and will lead to many future discoveries. The knowledge and techniques generated in the model systems such as arabi dopsis are now sufficiently developed to allow application to more economically im portant crops such as poinsettia.

PAGE 116

116 LIST OF REFERENCES Abe, M. 2005. FD, a bZIP protein m ediating signals from the floral pathway integrator FT at the shoot apex. Science 309:1052-1056. Adams, S. R., S. Pearson, and P. Hadley. 2001. Improving quantitative flow ering models through a better understanding of the phase of photope riod sensitivity. J. Exp. Bot. 52: 665-662. Anderson, N. O., and P. D. Ascher. 2001. Selec tion of Day Neutral, Heat Delay Insensitive Dendranthema xgrandiflorum Genotypes. J. Amer. Soc. Hort. Sci. 126(6): 710-721. Anderson, N. O., and P. D. Ascher. 2004. Inheritance of Seed Set, Germination, and Day Neutrality/Heat Delay Insensitivity of Garden Chrysanthemums (Dendranthema xgrandiflora) under Glasshouse and Field Conditions. J. Amer. Soc. Hort. Sci. 129(4): 509-516. Anonymous. 1999. Poinsettia FASTFAX. www.ecke.com/html/fastfax. Paul Ecke Ranch Anonym ous. 2004. North American Gaze tteer. AllRefer.com Reference. http://reference.allrefer.com/gazeteer Anonym ous. 2007. Astronomical App lications Department, United States Naval Observatory. http://aa.usno.navy.mil/ Barrett, J.E. 2004. Heat Delay in Poinsettia s. Greenhouse Product News 14(8):16-19. And Unpublished Data from 2 003 Heat Delay Studies. Bernier, G., A. Havelange, C. Houssa, A. Pe titjean, and P. Lejune. 1993. Physiological Signals That Induce Flowering. The Plant Cell 5:1147-1155. Bernier, G., L. Corbeiser, and C Perilleux. 2002. The Flowering process: On the Track of Controlling Factors in Sinapsis alba. Russi an Journal of Plant Physiology 49(4): 445-450 Blazquez, M.A., J.H. Ahn, and D. Weigel. 2003. A thermosensory pathway controlling flowering time in Arabidopsis thaliana. Published online. Doi:10.1038/ng1085. Borthwick, R.A. 1964. Phytochrome action and its time displays. The American Naturalist. 902:347-357. Boss, P.K., R.M. Bastow, J.S. Myline, and C. Dean. 2004. Multiple Pathways in the Decision to Flower: Enabling, Promoting, and Resetting. Plant Cell 16(S):S18-S31. Cathey, H.M. 1954. Chrysanthemum Study. C. The e ffect of night, day, and mean temperature upon the flowering of chrysanthemum morifoliu m. Proc. Amer. Soc. Hort. Sci. 64:499502.

PAGE 117

117 Cathey, H.M. 1963. Chrysanthemum temperature study. F. The effect of temperature on the critical photoperiod necessary for the ini tiation and developmen t of flowers of Chrysanthemum morifolium. Proc. Amer. Soc. Hort. Sci. 69:485-491. Carre, Isabelle A. 2002. ELF3: a circadian safeguar d to buffer effects of light. Trends in Plant Science 7(1):4-6. Chang, S., J. Puryear, and J. Cairney. 1993. A si mple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rpt. 11:113-116. Church, G.M. and W. Gilbert. 1984. Genomi c sequencing. Proc. Natl. Acad. Sci.81:1991-1995. Cockshull, K.E. and Kofranek, A.M. 1993. High night temperatures delay flowering, produce abnormal flowers and retard stem growth of cut-flower chrysanthemums. Scientia Horticulturae 56(3):217-234. Corbesier, L., E. Prinsen, A. Jacqmard, P. Lejune, H. Van Onckele n, C. Perilleux, and G. Bernier. 2003. Cytokinin Levels in Leaves, L eaf Exudate, and Shoot Apical Meristem of Arabidopsis thaliana during floral transition. J. Exper. Bot. 54(392):2511-2517. Corbesier, L. and G. Coupland. 2006. The quest fo r florigen: a review of recent progress. J. Exper. Bot. 57(13):3395-3403. Corbesier, L, C. Vincent, J. Seonghoe, F. Fornara, Q. Fan, I. Searle, A.Giakountis, S. Farrona, L. Gissot, C. Turnbull, G. Coupland. 2007. FT prot ein movement contributes to long-distance signaling in floral induction of arabidopsis. Science 319:1030-1033. Cremer, F. and G. Coupland. 2003. Distinct photope riodic responses are c onferred by the same genetic pathway in Arabidopsis and rice. Trends in Plant Science 8(9):405-407. Ecke, P. Jr., O.A. Matkin, and D. E. Hartley. 1990. The Poinsettia Manual Third Edition. Paul Ecke Poinsettias, Encinitas, California. Ecke, P. III., J.E. Faust, A. Higgins, and J. Williams. 2004. The Ecke Poinsettia Manual. Ball Publishing, Batavia, IL. Erwin, J. 2005. Factors affecting flowering in ornamental plants. Flower Seeds: Biology and Technology eds. M. B. McDonald and Francis Y. Kwong. CAB International. Chapter 6, pp. 87-115. Evans, M.R., H.F. Wilkins, and W.P. Hack ett. 1992. Meristem Ontogenetic Age as the controlling factor in long-day initiation in Poinsettia. J. Amer. Soc. Hort. Sci. 117(6):961965. Foyer, C.H., M. Parry, and G. Noctor. 2003. Mark ers and Signals associated with nitrogen assimilation in higher plants. J Exper. Bot. 54 (382): 585-593.

PAGE 118

118 Gamini-Kannangara, C. and Mats Hansson. 1998. A rrest of chlorophyll ac cumulation prior to anthocyanin formation in Euphorbia pulcherrima. Plant Physiol. Biochem. 36:843-848. Garner, W.W. and H.A. Allard. 1920. Effect of the relative length of day and night and other factors of the environment on growth and repr oduction in plants. J. Agr. Res. 18:553-606. Garner, W.W. and H.A. Allard. 1923. Further studi es on photoperiodism, the response of plants to relative length of night and day. J. Agr. Res. 23:871-920. Gartner, J.B. and M.L. McIntyre. 1957. Effect of day-length and te mperature on time of flowering in Euphorbia pulcherri ma (poinsettia). Proc. Amer. Soc. Hort. Sci.. 69:492-497 Goddard, G.B. 1961. Flower initiation and develo pment in poinsettia (Euphorbia pulcherrima Willd.). Proc. Amer. Soc. Hort. Sci. 77:564-574. Grueber, K.L. and H.F. Wilkins. 1994. Inflorescence initiation and develo pment. The Scientific Basis of Poinsettia Production. Agricultura l University of Norway, Aas, Norway. Hailong A., C. Roussot, P. Surez-Lpez, L. Corbesier, C. Vincent, M. Pieiro, S. Hepworth, A. Mouradov, S. Justin, C. Turnbull and G. C oupland. 2004. CONSTANS acts in the phloem to regulate a systemic signal that indu ces photoperiodic flowering of Arabidopsis. Development 131:3615 Halliday, K. J., and G. C. Whitelam 2003. Change s in Photoperiod or Temperature Alter the Functional Relationships between Phytochr omes and Reveal Roles for phyD and phyE. Plant Physiol. 131:913-1920. Halliday, K. J., M. G. Salter, E. Thingnaes, a nd G. C. Whitelam. 2003. Phytochrome Control of Flowering is Temperature Sensitive and Correlates with Expression of th e Floral Integrator FT. Plant Journal 33(5):875-881. Hamner, K.C. and J. Bonner. 1938. Photoperiodism in the relation of plant hormones as factors in floral initiation and deve lopment. Bot. Gaz. 100:388-431. Hek, J. 1993. Influence of duration and placement of a high night temperature on morphogenesis of Dendranthema grandiflora. Sc iencia Horticulturae 54(4):327-335. Imaizumi, T. and S.A. Kay. 2006. Photoperiodic cont rol of flowering: not only by coincidence. Trends in Plant Sc ience 11(11):550-558. Izawa, T., T. Oikawa, S. Tokutomi, K. O kuno, and K. Shimamoto. 2000. Phytochromes confer the photoperiodic control of flowering in ri ce (a short day plant) Plant J. 22:391-399. Izawa, T. 2002. Phytochrome medi ates the external light signal to repress FT orthologs in photoperiodic flowering of rice. Genes Dev. 16:2006-2020 Jackson, S. and B. Thomas. 1997. Photoreceptors and signals in the ph otoperiodic control of development. Plant, Cell and Environment 20(6):790-795.

PAGE 119

119 Johnson, E., M. Bradley, N.P. Harbred, G.C. Whitelam. 1994. Photoresponses of light-grown phyA mutants of Arabidopsis. Phytochrome A is required for the perception of daylength extensions. Plant Physiology 105:141-149. Kannangara, C.G. and M. Hansson. 1998. Arrest of chlorophyll accumulation prior to anthocyanin formation in Euphorbia pulcherri ma. Plant Physiol. Biochem. 36(12):843-848. Karlsson, M.G., J.E. Heins, J.E. Erwin, and R.D. Berghage. 1989. Development rate during four phases of chrysanthemum growth as determined by preceding and prevailing temperatures. J. Amer. Soc. Hort. Sci. 114(2):234-240. Krner, O. M., J. Bakker and E. Heuvelink. 2004. Daily Temperature Integration: a Simulation Study to quantify Energy Consumption. Biosystems Engineering. 87(3):333-343. Kristoffersen, T. 1969. Influence of day-length and temperature on growth and development in poinsettia. Acta Hortic. 14:73-89. Kulikowska-Gulewska, H., and J. Kopcewicz. 2002. The involvement of gibberellins in phytochrome controlled floweri ng in Pharbitis nil. Acta Soc. Bot. Pol. 71(1):23-27. Langhans, R.W. and R.O. Miller. 1960. Influen ce of day-length, temperature and number of short days on the flowering of poinsettia (Euphorbia pulcherrima Willd.). Proc. Amer. Soc Hort. Sci. 75:753-760. Langhans, R.W. and R.A. Larson. 1960. The influe nce of day and night temperatures on the flowering of poinsettia (Euphor bia pulcherrima). Proc. Amer. Soc. Hort. Sci. 75:748-752. Langhans, R.W. and R.A. Larson. 1960. Influence of day length, temperature, and the number of short days on the flowering of poinsettia (Euphorbia pulcherrima). Proc. Amer. Soc. Hort. Sci. 75:753-760. Langton, F.A. and J.S. Horridge. 2006. The effe cts of averaging suband supra-optimal temperatures on the flowering of Chrysanthe mum morifolium. Journal of Horticultural Science and Biotechnology. 81(3):335-340 Larsen, R. 1982. The effect of night temperature on flower initia tion and early differentiation of Chrysanthemum morifolium. Swed ish J. Agric. Res. 12:95-102. Larson, R.A., and R.W. Langhans. 1963a. The infl uence of photoperiod on flower bud initiation in poinsettias (Euphorbia pulcherrima Willd.) Proc. Amer. Soc. Hort. Sci. 82:547-551. Larson, R.A., and R.W. Langhans. 1963b. The influen ce of temperature on flower bud initiation in poinsettias (Euphorbia pulcherrima Willd.) Proc. Amer. Soc. Hort. Sci. 82:552-546. Larson, R.A., and R.W. Langhans. 1963c. Quantita tive measurements of the morphological changes in the shoot apex of poinsettias (E uphorbia pulcherrima Will d.) in the transition from the vegetative to the reproductive st ate. Proc. Amer. Soc. Hort. Sci. 82:541-546.

PAGE 120

120 Lentz, E. 1998. Model applicati ons in horticulture: a review. Sc ientia Horticulturae. 74:151-174. Marousky, F.J. 1968. Effects of temperature on an thocyanin content and color of poinsettia bracts. Proc. Amer. Soc Hort. Sci. 92:678-680. McClung, R. C. 2001. Circadian Rhythms in Plants. Plant Physiol. Plant Mol. Biol. 52:139-162 Miller, R. O. and D.C. Kiplinger. 1962. Tw o Year Study on Poinsettia Habits. Flor. Rev. 131(3390):59-60; 108-113 Moller, S. G., P. J. Ingles and G. C. White lam. 2002. The cell biology of phytochrome signaling. New Phytologist 154:553-590. Mouradov, A., F. Cremer, and G. Coupland. 20 02. Control of flowering time: interacting pathways as a basis for divers ity. Plant Cell 16(S):S111-S130. Niu, G., R. D. Heins, A. Cameron, and W. Carl son. 2001. Temperature and Daily Light Integral Influence plant Quality and Fl ower Development of Campan ula carpatica Blue Clips, Deep Blue Clips, and Campanula Bir ch Hybrid. HortScience 36(4):664-668. Pearson, S., P. Hadley, and A.E. Wheldon. 1993. A r eanalysis of the effects of temperature and irradiance on the time to flowering in chrysanthemum (Dendranthema xgrandiflora). Journal of Horticultural Science 68(1):89-97. Post, K. 1937. The determination of normal date of bud formation of short day plants. Proc. Amer. Soc. Hort. Sci. 34:618-620. Quail, P.H. 2002. Phytochrome photosensory sign aling networks. Nature Rev. Mol. Cell Biol. 3:85-93. Rao, C.V. 1971. Anatomy of the inflorescence of some Euphorbiaceae with a discussion on the phylogeny and evolution of the inflorescence in cluding the cyathium. Bot. Notiser. 124:3964. Ratkowsky, D.A. 1990. Handbook of Non-Linear Re gression Models. Marcel Dekker, New York, NY. Reeves, P. H., and G. Coupland. 2000. Responses of plant development to environment: control of flowering by day-length and temperature. Current opinions in Plant Biology 3(1):37-42. Roberts, R.H. and B.E. Struckmeyer. 1938. The e ffects of temperature and other environmental factors upon the photoperiodic responses of some of the higher plants. J. Agric. Research. 56(9):633-677. Rohwer, C.L. and R.A. Heins Da ily light integral, prevernaliza tion photoperiod and temperatures and duration control flowering of east er cactus. HortScie nce. 42(7):1596-1604.

PAGE 121

121 Russell, N.H. 1960. Studies in the photoperiodic res ponses of violets (Viola). The Southwestern Naturalist. 5(4):177-186. Searle, I. and G. Coupland. 2004. Induction of flowering by seasonal changes in photoperiod. The EMBO Journal 23:1217-1222. Simpson, G.G. and C. Dean. 2002. Arabidopsis, the Rosetta Stone of Flowering Time? Science 296(5566):285-289. Spalding, E.P. and Folta, K.M. 2005. Illuminating topics in plant photobiology. Plant, Cell & Environment 28(1):39-53. Stewart, R.N. and T. Arisumi. 1966. Genetic and histogenic determination of pink bract color in poinsettia. Journal of Heredity 57(6):217-222. Struckmeyer, B.E. and G.E. Beck. 1960. Flower bud initiation and development in poinsettia (Euphorbia pulcherrima Willd.). Proc Amer. Soc Hort. Sci. 75:730-738. Surez-Lpez P., K. Wheatley, F. Robson, H. Onouchi, F. Valverde, and G. Coupland. 2001. CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature 410: 1116-1120. Taiz, L., and E. Zeiger. 2002. Plant Physiology: Third Edition. Sinauer Associates, Inc. Sunderland MS. Chapter 24:386-387. Takano, M. 2001. Isolation and characterization of rice phytochrome A mutants. Plant Cell. 13:521-534. Thomas, B., and D. Vince-Prue. 1997. Photoperiodism in Plants, second edition. Academic Press. San Diego, California. Tretyn, A., J. Czaplewska, M. Cymerski, J. Kopcewicz, and K.E. Kendrick. (1994). The mechanism of calcium action on flower induction in Pharbitis nil. J. of Plant Physiol. 144 (4-5):562-568. Valverde, F., A. Mouradov, W. Soppe, D. Ravenscroft, A. Samach, G. Coupland. 2004. Photoreceptor regulation of CONSTANS prot ein in photoperiodic flowering. Science 303: 1003-1007. Vince-Prue, D. 1975. Photoperiodi sm in Plants. McGraw-Hill Book Company (UK) Limited. Vince-Prue, D. and O.V.S. Heath. 1983. The perc eption of light-dark transition. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 303(1116):523-536. Vondrakova, Z., J. Krekule, and I. Machackova. (1998). Is the root e ffect on flowering of Chenopodium rubrum mediated by cytoki nins? J. Plant Growth Regul. 17:115-119

PAGE 122

122 Wang, N. 2001. An examination of poinsettia cultiv ar differences in response to photoperiod and light during the dark period. Masters thesis, University of Florida Whealy, C.A., T.A. Nell, J.E. Barrett, and R.A. Larson. 1987. High Temperature Effects on Growth and Floral Development in Chrysanthemum. J. Amer. Soc. Hort. Sci. 112:464-468. Wieland, C.E. 1998 An examination of night length effects on differences in floral initiation and development for poinsettia cultivars under high te mperatures. Masters thesis, University of Florida. Willits, D.H. and D.A. Bailey. 2000. The effect of night temperature on chrysanthemum flowering: heat-tolerant versus heat-sensitive cultivars. Scientia Horticulturae 83 (34):325-330. Wu, X., Weigel D., and P. Wigge. 2002. Signaling in plants by intercellular RNA and protein movement. Genes and Development 16:151-158. Yano, M. 2003. Hd1, a major photoperiod sensitivity qu antitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONST ANS. Plant Cell 12:2473-2484 Yanovsky, M.C. and S.A. Kay. 2003. Living by the calendar: how plants know when to flower. Molecular Cell Biology 4:265-275.

PAGE 123

BIOGRAPHICAL SKETCH Rebecca Schnelle earned her bachelor of scienc e in horticulture from the University of Wisconsin-River Falls. She has been involved in the floriculture industry in several capacities including as an assistant perennial grower a nd salesperson. Rebecca is currently a graduate research fellow in the Environmental Horticulture department at the University of Florida where she specializes in the im pact of physiological issues on producti on of floriculture crops. Rebecca has published several articles in scientific jour nals and trade journals, and has also presented research results at academic and industry meetings. She is an active member and former president of the Environmental Horticulture Graduate Student Association. Rebecca plans to continue her contribution to horti culture through academic pursuits.