<%BANNER%>

Diagnostic Tools and Genetic Susceptibility Factors Associated with Bovine Paratuberculosis Infection

Permanent Link: http://ufdc.ufl.edu/UFE0022315/00001

Material Information

Title: Diagnostic Tools and Genetic Susceptibility Factors Associated with Bovine Paratuberculosis Infection
Physical Description: 1 online resource (246 p.)
Language: english
Creator: Pinedo, Pablo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: card15, cattle, genetic, ifng, mycobacterium, paratuberculosis, slc11a1, susceptibility, tlr4
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Our first objective (Studies 1-2) was to analyze the association among results of five different diagnostic tests for detection of paratuberculosis infection in cattle. Our second objective (Studies 3-4) was to characterize the distribution of polymorphisms in four immune related genes and test their association with susceptibility to paratuberculosis infection in cattle. In Study 1, results of a serum ELISA, fecal culture, and nested PCR tests on milk, blood, and feces for Mycobacterium paratuberculosis (MAP) detection were analyzed to determine associations and levels of agreement between pairs of tests. The agreement between results was poor, slight and fair in two, five and three of the ten possible combinations. Fecal culture and fecal PCR resulted in the highest kappa coefficient (fair agreement). Combined use of ELISA and fecal PCR has the potential to increase the overall sensitivity for the diagnosis of paratuberculosis. In Study 2, the association between ELISA seroreactivity and MAP presence in milk, as detected by nested PCR was analyzed. An irregular pattern of detection was observed for PCR outcomes along with fluctuations in serial ELISA results. Kappa coefficient indicated a slight agreement between both tests, suggesting that the ability of serum ELISA, as indicator of the likelihood of milk shedding of MAP in dairy cows, is questionable. In Studies 3 and 4, polymorphisms in four candidate genes related to the immune function; caspase recruitment domain 15 gene (CARD15), interferon gamma (BoIFNG), toll-like receptor 4 (TLR4), and solute carrier family 11 member 1 (SLC11A1), were analyzed. Significant differences were found in allelic frequencies between cases and controls for CARD15 SNP2197/C733R, BoIFNG-SNP2781 and SLC11A1 microsatellites. In the analysis of genotypes, a significant association was found between infection status and CARD15 SNP2197/C733R, BoIFNG SNP2781 and SLC11A1-275-279-281 microsatellites. When variables breed and age were included in the multivariate logistic regression analysis, the only statistically significant effect was for CARD15 SNP2197/C733R polymorphism. The estimated odds of infection for heterozygous cows were 3.35 times the odds of infection of cows homozygous for the major genotype. Results suggest a role for CARD15 gene in the susceptibility of cattle to paratuberculosis infection.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Pablo Pinedo.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Rae, Darrell O.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022315:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022315/00001

Material Information

Title: Diagnostic Tools and Genetic Susceptibility Factors Associated with Bovine Paratuberculosis Infection
Physical Description: 1 online resource (246 p.)
Language: english
Creator: Pinedo, Pablo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: card15, cattle, genetic, ifng, mycobacterium, paratuberculosis, slc11a1, susceptibility, tlr4
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Our first objective (Studies 1-2) was to analyze the association among results of five different diagnostic tests for detection of paratuberculosis infection in cattle. Our second objective (Studies 3-4) was to characterize the distribution of polymorphisms in four immune related genes and test their association with susceptibility to paratuberculosis infection in cattle. In Study 1, results of a serum ELISA, fecal culture, and nested PCR tests on milk, blood, and feces for Mycobacterium paratuberculosis (MAP) detection were analyzed to determine associations and levels of agreement between pairs of tests. The agreement between results was poor, slight and fair in two, five and three of the ten possible combinations. Fecal culture and fecal PCR resulted in the highest kappa coefficient (fair agreement). Combined use of ELISA and fecal PCR has the potential to increase the overall sensitivity for the diagnosis of paratuberculosis. In Study 2, the association between ELISA seroreactivity and MAP presence in milk, as detected by nested PCR was analyzed. An irregular pattern of detection was observed for PCR outcomes along with fluctuations in serial ELISA results. Kappa coefficient indicated a slight agreement between both tests, suggesting that the ability of serum ELISA, as indicator of the likelihood of milk shedding of MAP in dairy cows, is questionable. In Studies 3 and 4, polymorphisms in four candidate genes related to the immune function; caspase recruitment domain 15 gene (CARD15), interferon gamma (BoIFNG), toll-like receptor 4 (TLR4), and solute carrier family 11 member 1 (SLC11A1), were analyzed. Significant differences were found in allelic frequencies between cases and controls for CARD15 SNP2197/C733R, BoIFNG-SNP2781 and SLC11A1 microsatellites. In the analysis of genotypes, a significant association was found between infection status and CARD15 SNP2197/C733R, BoIFNG SNP2781 and SLC11A1-275-279-281 microsatellites. When variables breed and age were included in the multivariate logistic regression analysis, the only statistically significant effect was for CARD15 SNP2197/C733R polymorphism. The estimated odds of infection for heterozygous cows were 3.35 times the odds of infection of cows homozygous for the major genotype. Results suggest a role for CARD15 gene in the susceptibility of cattle to paratuberculosis infection.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Pablo Pinedo.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Rae, Darrell O.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022315:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101107_AAAABI INGEST_TIME 2010-11-07T14:04:32Z PACKAGE UFE0022315_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 50775 DFID F20101107_AAAXNV ORIGIN DEPOSITOR PATH pinedo_p_Page_118.pro GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
58c9dff4441a8ad5aef6c37829d1c807
SHA-1
e3981cdfec6ec9f3ea82e134fcfe626cab25bf64
7710 F20101107_AAAYKO pinedo_p_Page_171.QC.jpg
6852ba09d6773dddecf135dfc53bf541
a7cbd7ce1c85d796aee8a0e4048642a5368314b6
25271604 F20101107_AAAXAK pinedo_p_Page_010.tif
9df59fe2ba001110684797eeee919766
2a14921c2b64a3553c231ea4cdde0973dc0b2bd5
53273 F20101107_AAAXNW pinedo_p_Page_119.pro
37ba2e13493adee379d430b750d97dc0
5074124ddaf84ae2e7c85a9d3dec8ec3f9704f69
34545 F20101107_AAAYKP pinedo_p_Page_182.QC.jpg
f8551bad526f258c8a3cf465d871fb2d
0436945276c9113bd172ded91cffa8a32fcdfb9c
F20101107_AAAXAL pinedo_p_Page_011.tif
213cb76d1cedb62347fea7af93ad891b
41e6cb8664467e3ae66e2b43153649099fb355ce
53363 F20101107_AAAXNX pinedo_p_Page_120.pro
a6ff1cb1d8c308ec207d70c54f88f870
0721517bc5e0a0ea9644ff00be5b7e2618fdb46f
8341 F20101107_AAAYKQ pinedo_p_Page_088thm.jpg
ea6ad69512778b4cb83b4222f08d6fe4
d6db27472c371f43d619bfa6ece5b71ac8ffb734
F20101107_AAAXAM pinedo_p_Page_012.tif
85511c191359eb4e668b4203de87b273
66c1e846d5280073f7c19d2f66710147d423af76
52205 F20101107_AAAXNY pinedo_p_Page_121.pro
ca813364a2acb22815e05ccd169a8586
2d0441ed4d30899aa9e809c7001c8ecbad19c1d1
1908 F20101107_AAAYKR pinedo_p_Page_172thm.jpg
67267f395bade68387d195c17942a1ed
631d47f774afe75033a7d53861974fbda784fb56
F20101107_AAAXAN pinedo_p_Page_013.tif
07a1d203ec8ab27f1f3a4f9b3975dc9d
b053716cc56ad6dacfe504836ecf8b081824ff7b
50686 F20101107_AAAXNZ pinedo_p_Page_123.pro
5239a47476669bb5eb60b7977a752d98
9b177d6f13dfa037aa45c58dc697a8196f9901e6
9301 F20101107_AAAYKS pinedo_p_Page_219thm.jpg
47712348efe7792969aad215b5605207
02bee12b9211b24a27342bc54c779278ec3b6e3c
F20101107_AAAXAO pinedo_p_Page_014.tif
957ca12d4dc30e048d1b405995bc8dc2
618c5ee4ab2fe396000f06914a9c7ae422cf9c31
35722 F20101107_AAAYKT pinedo_p_Page_051.QC.jpg
5795c6f428573bd7009d2734d6e431aa
5ae8f52a45ad6ce95da4b0a16a74bb52e9cc8a32
F20101107_AAAXAP pinedo_p_Page_015.tif
8a4a8cb2ffb5166f8a350ef575ea5c7f
39ce8b36bc8918ed3027e52424861b8833985d7c
37113 F20101107_AAAYKU pinedo_p_Page_116.QC.jpg
257fcb8cca2e92faa2d495573ccfe65a
efa8bce79db81b863891c787e41b26aa300583ac
1051977 F20101107_AAAWWA pinedo_p_Page_139.jp2
c4786a9d2b4a1505d673857d4da4418c
511079781bada50ec3c845e0527e02f34439d38e
F20101107_AAAXAQ pinedo_p_Page_016.tif
70a6aabac3f5dcc175060bfe43c95250
4c8c91732c3b5d0d537f01f569d2c6f2b114bfce
9208 F20101107_AAAYKV pinedo_p_Page_218thm.jpg
09443efce6d5f62cdd2a00f0744da639
ee7f3ffab7d61f0929953c248c79d5c39ea39428
1051970 F20101107_AAAWWB pinedo_p_Page_140.jp2
62281756ea8ba3265b8f0236c7d845ee
d4cb0b55018f4815c967a257377f00d44ee8aaf3
F20101107_AAAXAR pinedo_p_Page_017.tif
ca1f7e82cfb7845b1c94329e3c6e7825
c2de646829a33e0e65c5f700fb4fb11bdd735b8b
29968 F20101107_AAAYKW pinedo_p_Page_071.QC.jpg
2e36144e76fd77e2817a07c857c0d602
28ac2e6ebbf5bb692d5765a58d32a220d328441c
1051980 F20101107_AAAWWC pinedo_p_Page_141.jp2
7313bc3466b735803c194dbbaa22150e
3c8d5f38f12afaa69cfd049d12b148d49df046bf
F20101107_AAAXAS pinedo_p_Page_018.tif
fa267d99ef52dc93c355ed25228b14d8
eb944481ab6a6ab4863bf8b9f2ea0ffb8db2039e
8713 F20101107_AAAYKX pinedo_p_Page_089thm.jpg
317da77c0d0401ddf4cb43e414864745
18b3a5875c217db79ec2f73c5466bfaf30fc06f6
1019436 F20101107_AAAWWD pinedo_p_Page_142.jp2
e75d2cbf33add66eecc35b04ca119351
f9948e781d8f1761eb536b71bd43bacc4fffa449
F20101107_AAAXAT pinedo_p_Page_019.tif
0acc6c075b784c5555ba899bb2588ad7
b5c3b9f99deafb81197b61dbb4294a2e74dd7f82
8441 F20101107_AAAYKY pinedo_p_Page_186thm.jpg
2bd195d03c39cdefe21ba83357e598a2
a3d8995ec04909212ea6c320547ed92578f4e0ff
1051986 F20101107_AAAWWE pinedo_p_Page_143.jp2
7c1a488993989164cbe490f0f737ef41
adba7334b3aa0a0314a4688939ef56170953b15f
8706 F20101107_AAAYKZ pinedo_p_Page_106thm.jpg
70d46f8fffe2c090e4db18b8bce71171
81605e20daf34369b39b64163f2aecec06ff85d4
1051959 F20101107_AAAWWF pinedo_p_Page_144.jp2
a7eca277614fa52111d821690dd9c4e2
029864f091e75c9157314319c27e2f0bf666504b
F20101107_AAAXAU pinedo_p_Page_020.tif
2ab7b38d82b808cf8421ad774819cb84
42660907d1d5984e7763a31b612e5bcb750391f2
1051966 F20101107_AAAWWG pinedo_p_Page_145.jp2
69caf653dcd6a13a863cd113d402fa86
011f61a96d2704a7324f78bea46c71357b49655b
F20101107_AAAXAV pinedo_p_Page_021.tif
7c47e1f81700aa8ba06e7b67054dbde7
2d6a7f74ec0ab8208ed0e1db33f296f2336c20c6
1780 F20101107_AAAXTA pinedo_p_Page_010.txt
92bf84860b85a131295edc9806972c99
6ebe8f69711a46f70a3a8e1a146f628811ad8b2b
F20101107_AAAWWH pinedo_p_Page_146.jp2
1b53a1460ea343a6b12726a0c13d73a0
ca12c9b6c80d665108078afa224f67cae1a9ad9b
F20101107_AAAXAW pinedo_p_Page_022.tif
3f21b4c56f0908a4bfff1e43372c3e82
cbef6d684985bcac9ae2de20fe6b47c19e15e0cd
847 F20101107_AAAXTB pinedo_p_Page_011.txt
1f75c1c3b694380dd77bf326a94d6245
828e78ae3e3ce2291bb477c0a7c57626078d8119
F20101107_AAAWWI pinedo_p_Page_147.jp2
f5f5ecd2a1995f58e10c0d08b065a8e8
e447b95479f8674638cbe258f5f04011c0258630
F20101107_AAAXAX pinedo_p_Page_023.tif
90d7808ce84e34c3f27b77bd924bda6c
175c14b090de74cae77ffb490daa91973cce5847
1243 F20101107_AAAXTC pinedo_p_Page_012.txt
dc7394b9712762ddd5988e6273f3b1f2
0814f076ce590625a212fac855d30d1fe596928c
1051956 F20101107_AAAWWJ pinedo_p_Page_148.jp2
718e2e3ea19d6cbcbe6350e3427aeb91
d016bdb4341666a5e0fc82101435afb40250a4ea
F20101107_AAAXAY pinedo_p_Page_024.tif
8706c44b4647598cefa1f56842a51bdc
82aadfc8148f0d887f5f76b90ee4e19c15d6f6a1
416 F20101107_AAAXTD pinedo_p_Page_013.txt
ea71f048b69768dfaf495c2a96c856ba
687745bd31cfc06745a285340e2234abfb9fd1cd
1051972 F20101107_AAAWWK pinedo_p_Page_149.jp2
f5cf21fc564e19b8ccfc3771f45933ed
3078b3a62f331b8bfad1508937fcdeee9058984e
F20101107_AAAXAZ pinedo_p_Page_025.tif
6461fe1aa9a6c6b931133a536e062d7a
11ff717c310f823bc0889ace144a7ea09287c566
2025 F20101107_AAAXTE pinedo_p_Page_014.txt
01b2f3d9ed5fd12c4d14072b4da6fcfb
b5db406748cd65f17ea189c815510eb911a50bfc
1056 F20101107_AAAXTF pinedo_p_Page_015.txt
8dec019a1e760e8bcf8a890030f9a059
fd1c4466da11c7a1af3d84dd4be4c0d370ae0989
98423 F20101107_AAAWJA pinedo_p_Page_037.jpg
c2500c89b44d8b377c9cad0a04a41093
400f975ce4c90af3a5e60a6e7d3faf9606c24402
F20101107_AAAWWL pinedo_p_Page_150.jp2
e064382ee99b15588c2e60e56ed4108d
e10732f69056a3cecdbb7bd802243058dda948d2
2111 F20101107_AAAXTG pinedo_p_Page_017.txt
7f02c57e5f23f81cd7687de319790617
259cdaea564fcfe30d31c91693c69c7974d0403c
107205 F20101107_AAAWJB pinedo_p_Page_038.jpg
b22632add8ea8b8df47d7eabf0601cc0
53194ef12d4e7bffe6442edbc631880beb0110b0
920775 F20101107_AAAWWM pinedo_p_Page_151.jp2
ea5ca5c186638647abb1631a6e7da67b
1663e69f14fb82d7e9fcc4be0306c3a17d95a8fc
35486 F20101107_AAAYQA pinedo_p_Page_075.QC.jpg
0f9caa73b64691a591372cc6942466f3
047c0ee3adbc8cc8a215d12d261617df1a75bdf1
102251 F20101107_AAAWJC pinedo_p_Page_039.jpg
cc0e554e630f10777a850c0e409c188d
a0d7303d4fcc95545b5b32cde7927f78970c0b44
337912 F20101107_AAAWWN pinedo_p_Page_152.jp2
35cb2babb475634305a322b6f79d20c4
759e2b207aba2459a78de683ffad2a7e616d4ca3
1694 F20101107_AAAXTH pinedo_p_Page_018.txt
ba430230fe6cc6191df57d2e3b93f5e6
8888ba65c053e5c7810488d8e004ad9b1b539413
35216 F20101107_AAAYQB pinedo_p_Page_076.QC.jpg
81062156ecb3782ac176cfb05600755c
cf8e99a923279b2152b7e8d95b477f923f86d03c
99544 F20101107_AAAWJD pinedo_p_Page_040.jpg
e631c88eba15856e6231f2dfd8c4f2d1
38d0cbadd98315dd6da5c8a07737abc569c181b5
206971 F20101107_AAAWWO pinedo_p_Page_153.jp2
425fd3761e4705f8167f74b5523f766d
08a9a9dd1715a3bda2a0193e58cb132821ea4b28
1814 F20101107_AAAXTI pinedo_p_Page_019.txt
616747f038cdc9a1944a2ed8a783dde7
4a849253053264ece85bb9d8fd572f4202c1d1d4
32276 F20101107_AAAYQC pinedo_p_Page_078.QC.jpg
eaf0fea2ba9d9c1c05776f2208604b0c
cf0124b1e1a074607a9810fb4ec3c42fbccb32f6
105815 F20101107_AAAWJE pinedo_p_Page_041.jpg
b88fcd410129d73ae4e0b1155d136060
8faae1c02199e17a5574771ffe1a17b5fa0f0602
165764 F20101107_AAAWWP pinedo_p_Page_154.jp2
ca1de9f25ac133bc504ba80314b50e71
fb7104595e98965febca17a0190b68d0b05e1aaf
2039 F20101107_AAAXTJ pinedo_p_Page_020.txt
2cf4e863f9aa87997f30ae2c517c9f1f
fe5da04d329f687aef48c5d6347a6ed2032d6dd4
103694 F20101107_AAAWJF pinedo_p_Page_042.jpg
dc9c0fb63ce639e5b9cb20f10efb2f65
5ff563ca7568d86002c4d79d8b5ac5745c99ee65
286332 F20101107_AAAWWQ pinedo_p_Page_155.jp2
2e5206cfa02d6c4065bb1330354e3c52
b96f041de8bb86371923a25f915d1c3bcd9b2651
2139 F20101107_AAAXTK pinedo_p_Page_021.txt
86125d6f3287827004232347d6715340
8061133b977b3da30b281069c4c7338c4fd6e188
8061 F20101107_AAAYQD pinedo_p_Page_080thm.jpg
fb336e17d1c3f6892da865e7344a1bf3
7969b7e7840fea5fb235228846be0a029d6d2136
105463 F20101107_AAAWJG pinedo_p_Page_043.jpg
4d82019559035f49a05a9c9f27d08e14
7078b4c87ba7f5a2d08c34195691b682467f589c
405711 F20101107_AAAWWR pinedo_p_Page_156.jp2
3a57623a04b50e48809092f958ab9b96
cbf7a097009427dba7ed7bcc5161714fcd64acbe
2047 F20101107_AAAXTL pinedo_p_Page_022.txt
0ede7ed52733d39bb5d19aa2a2bc6f1f
48ca7157b75222eb8efe61ba17d17c5b6d405ad5
35736 F20101107_AAAYQE pinedo_p_Page_082.QC.jpg
340981c58609310389f53e664107f6c8
63ae2d932c9cdac6bc3eed9055234e5a661059ea
108783 F20101107_AAAWJH pinedo_p_Page_044.jpg
a4e6f733b2d34175ed0a1fd0fadcfbc9
1e2381da00dad945a1a194bc45b49bf00c7688a4
F20101107_AAAXGA pinedo_p_Page_158.tif
d7377bed44803567674a7a8c44272764
b14ab932ad1a4d2bf90c86ab6444a996be806695
226479 F20101107_AAAWWS pinedo_p_Page_157.jp2
f422810472944d04f6a2c15c1213e28e
330cbee70b0749f42d890cbba38029c0e5b2ad38
2123 F20101107_AAAXTM pinedo_p_Page_023.txt
95e37acbf2fd11415004ed5a78d862af
44cde14369b606f6a7eac7ef3b2bdd0cbfcadd70
32616 F20101107_AAAYQF pinedo_p_Page_084.QC.jpg
a4b046efdc65240c88275861aea368d3
ba4edf659869d2c835fc05df88aafcab31090f07
98791 F20101107_AAAWJI pinedo_p_Page_045.jpg
eb74849ca1ebe2c2938e30e573bd7bce
ffa36afecfda22308405809bc5aaca7f2f9a1c3c
F20101107_AAAXGB pinedo_p_Page_159.tif
2d5081b07ed3db04d6ef90e68f178024
7a82c3c93de821506ae31006c87d9b83025ab527
277101 F20101107_AAAWWT pinedo_p_Page_158.jp2
499f54824be6059dc7b3e9191753f2ba
d7d3ddaeb7e7fffb66c1c1715c40fbed58ee11d3
2120 F20101107_AAAXTN pinedo_p_Page_024.txt
3d70ea4607b87a741874d881f4f671ab
743491bf53af19ce88a9cd137fcc2a3a174fb2ec
9023 F20101107_AAAYQG pinedo_p_Page_086thm.jpg
4c7c63efe25c4b63f36c3d279640401a
d8e7dcd4341394b250f8c21f5f48dd2ca82b48b4
101331 F20101107_AAAWJJ pinedo_p_Page_046.jpg
6a11be15669a9a29bcc40152dd61f531
f07971c8cb0006d4a06d344597b0d7b0354fd014
F20101107_AAAXGC pinedo_p_Page_160.tif
b564aebb0715093320f03fbe1882a796
2499035a4f50325f6064ab166a1a608a5d931505
331041 F20101107_AAAWWU pinedo_p_Page_159.jp2
052f9bcd5ed924ee60d911481b812d17
4aeaa6fc054704c164f439cea49309c7b8f36946
2106 F20101107_AAAXTO pinedo_p_Page_025.txt
152c2828b454dcac867de22753050bba
4465da5d8ed5d342de1c78e0e81f74315f9bb9e5
35517 F20101107_AAAYQH pinedo_p_Page_087.QC.jpg
92c1f1788f71016adec62522812945c9
e746b42bec23107615e0888dc8367bd0059a9f8d
104331 F20101107_AAAWJK pinedo_p_Page_047.jpg
49c046d1902df12c7dd66eac837a6a16
8eb9bafdb6c64ea51e77a48e134d12ee6a56ecb1
F20101107_AAAXGD pinedo_p_Page_161.tif
62ac6ac0ab32cabdc14a695f12be4257
b01c697711c6ddf36316ea6f4d10ae6467213ccd
1051908 F20101107_AAAWWV pinedo_p_Page_160.jp2
50584a2144ff37461c3aa4148d41969a
be06cce5068e443b464e8376560536c02a28c639
2185 F20101107_AAAXTP pinedo_p_Page_026.txt
3b99b6c53588901680387547b44105a7
2f8c9f9e07ae02d74c5cca620344569b2e29df0d
8619 F20101107_AAAYQI pinedo_p_Page_087thm.jpg
5652a3ab8ba87789b0906a297bfbb8ae
ef9a3cb648a479b9f51db1c5e84340e9317c16e9
99203 F20101107_AAAWJL pinedo_p_Page_048.jpg
b29bbc383c5b21c16fb0a05553dcc105
7d6af423b73c3daebfc5a6c11379aa80ec201a90
F20101107_AAAXGE pinedo_p_Page_162.tif
00aab3885b28cba58eea2db801547c9a
301f017c948bb7fb0817d8929196cd7d2408ae62
1051969 F20101107_AAAWWW pinedo_p_Page_161.jp2
f71dcbff00fa37c0b423cc5de1f76d2c
8bac3c611d439fa9c9c2f3915e01d01bba696e48
1870 F20101107_AAAXTQ pinedo_p_Page_027.txt
3d3a2ea6923e8dae546d85c7d072488e
0f1d3bdf669a669d2f47fb39bd7bf491136e481c
33271 F20101107_AAAYQJ pinedo_p_Page_089.QC.jpg
8d13dfa6a27c9afe4d2b5edaba7f65bc
122953d8816df4b62bfe5971c0224bcaa0c370f2
99109 F20101107_AAAWJM pinedo_p_Page_049.jpg
43c0848100fd0bae54c5a40cd52d3a6b
efb5c6043a4fb57a9bc2ad663b8412248a68aef1
F20101107_AAAXGF pinedo_p_Page_163.tif
40182b065991a39a29436de9564ba0d0
f0e961ddef032e8a9be62a888420ebdec053283e
1051950 F20101107_AAAWWX pinedo_p_Page_162.jp2
b09969f1bf0a397b38929fd78f1fa630
5238b5d212eea6583ef051b4791b210837cba412
1972 F20101107_AAAXTR pinedo_p_Page_028.txt
29930e88b8d182240385f55539ccf26b
fe47aa8bc100b2650ede888a23259230320053a2
33420 F20101107_AAAYQK pinedo_p_Page_091.QC.jpg
e10ea8f5f43c438175effe7f0a63dc47
251009b4cb7b9e210d5d191ad20cd1f9368696f7
107085 F20101107_AAAWJN pinedo_p_Page_050.jpg
1a909d629b302f346ee303236ffbaedc
eac909bc589f7e20168b006d5d3be701e0615ef7
F20101107_AAAXGG pinedo_p_Page_164.tif
13dfe4b5e3c5023f0c50e2c96e5c701f
dd70ff91120bab369dc728ea655604e9d13bc4c9
1051927 F20101107_AAAWWY pinedo_p_Page_163.jp2
4bc8267173e9f32c03198bbc0c9c62e9
f3443aca0bdbfc91a7566228e0614846217802e7
8375 F20101107_AAAYDA pinedo_p_Page_194thm.jpg
5c6ea67fa865c04d6ac78fa3a0b641d9
2f8b290bf1667c7c69763bf68b93e4253454c486
2083 F20101107_AAAXTS pinedo_p_Page_029.txt
7011befe3463c66bda273e7f6ee3e00d
bc508aeac87ac68f2ad1f276b28682f15218e544
8204 F20101107_AAAYQL pinedo_p_Page_095thm.jpg
9942fe49484cc8b33559871888208036
7062ee486cf086443c642be37b424d87bc346a72
110180 F20101107_AAAWJO pinedo_p_Page_051.jpg
05b8fe3f38378ab96e04cf38cd3053d5
7b0beab071ccd42983932737fd240c723dcf02fc
F20101107_AAAXGH pinedo_p_Page_165.tif
657bd1047c62383a485a4f4d4830a555
9bf3f2b6322f1a59e623164dab3cc3b4ccb9fb68
1051897 F20101107_AAAWWZ pinedo_p_Page_164.jp2
9fed699e4eaa43b56c099d5a06a19d1a
298471e836a49a560ea0e5359d90eece098c53c3
2046 F20101107_AAAXTT pinedo_p_Page_030.txt
ffa3b381ed76816600cf739366ac281c
bac4ca330326290c48d9ff27eef9ea6295c6cfeb
33918 F20101107_AAAYQM pinedo_p_Page_097.QC.jpg
d616520857c7cb376fecdd31a60f1304
c24bb0b877c07440e7e238a53bf407caa1dcdb71
103663 F20101107_AAAWJP pinedo_p_Page_052.jpg
4f952da46b20e74af34edd741e4f384b
bfbc10f2d79b8be77ebaba7008a747bc38c80d57
F20101107_AAAXGI pinedo_p_Page_166.tif
ce110a1034a77044f2d99d5e69f2c550
369cfe572171f4ee553ec1fd7aff56de740e32eb
8302 F20101107_AAAYDB pinedo_p_Page_181thm.jpg
8cce5bd003c2342f9b2c6a7ab9b89a5a
1a0de172ec738ec2de835485d34daf049148ed54
2036 F20101107_AAAXTU pinedo_p_Page_031.txt
250aa560cae6a7e3315d7df401069b8b
19808f8abcf4c6debb073d8f462980eec8889f29
8386 F20101107_AAAYQN pinedo_p_Page_097thm.jpg
fb0bfcf34bae22b7a5ef85db7b04b0ba
6b45c36c81c0de8cffc189b8bae3756074d564c5
106557 F20101107_AAAWJQ pinedo_p_Page_053.jpg
7777b6991365418ea7c826a240ccf0b2
9b06431bccc6de8c189880189c981bbe021b02d0
F20101107_AAAXGJ pinedo_p_Page_167.tif
fbff50613e11552b4116f46f2e17a2fa
5a8a8b4aa5200afe5928af2048935075bcbac062
35029 F20101107_AAAYDC pinedo_p_Page_017.QC.jpg
69107caf625af1ee5f1611becec5b1d6
180422deddb7e7e574de1a017dc80111f03c575e
2079 F20101107_AAAXTV pinedo_p_Page_032.txt
28568c10ed288b47f4edaeec9cdab99f
126ad4771d755f71e15f094224e421661e55023a
8670 F20101107_AAAYQO pinedo_p_Page_099thm.jpg
7f4fe16604d08c67ca1ed24127da6acf
6eda002e6f2f34588630d5ecbf15833dd4e240d9
110426 F20101107_AAAWJR pinedo_p_Page_054.jpg
acf1596b32eb6050e91dc6cbe68e1561
18c134a0bf39a1b663a21bfa60d39b94648964c3
F20101107_AAAXGK pinedo_p_Page_168.tif
e3caadf9697a4c6362d14561697bcc50
58ac3c9baeb5b240fc816f578565608787eeaeed
5829 F20101107_AAAYDD pinedo_p_Page_246thm.jpg
ec4b37c001ea38cb5fc98b5f8593cea7
b9fc1528fe11b40b8df1fd56fff71a034d40d19d
2164 F20101107_AAAXTW pinedo_p_Page_033.txt
7604d4bdf75337b55a285b94e7b41f76
7fb2f23b96c16351109c2c5c57701e41fbdd2d2a
33119 F20101107_AAAYQP pinedo_p_Page_100.QC.jpg
bb21ed0f400977cb00870b9124a3c60e
90392861fc24397a57bc28e44309ef32af137def
104055 F20101107_AAAWJS pinedo_p_Page_055.jpg
9fba331e19577b1659d485ce67935d99
db2f09cbe26cbc5ba0b6a7ead4f925244627ee1c
F20101107_AAAXGL pinedo_p_Page_169.tif
fa60da6740b324dde96b0e44173d9d51
4031665fc490ed74ad02dab7212469834bbad7eb
34706 F20101107_AAAYDE pinedo_p_Page_090.QC.jpg
4057c8f5b5525f3be02a6387ecf69c7f
ff44a5fcc6f9383e1bb58b10dc819ab3cfb326ee
2070 F20101107_AAAXTX pinedo_p_Page_034.txt
5a1b891a5d6153bdf13423e7c82bd510
bee0aa25912e8a94edeb54a8dd5e83ca79c1bd1c
36800 F20101107_AAAYQQ pinedo_p_Page_102.QC.jpg
b6f682547c6f528ffa0a0578df5fd229
6b06c624f2fd448c47ea1cd28df40b04f9251da0
109321 F20101107_AAAWJT pinedo_p_Page_056.jpg
67970fdec5c4d8e9533903ce68b17c1c
3f1110ee98ebe7318320bddd8ddaa1925316efb6
F20101107_AAAXGM pinedo_p_Page_170.tif
55023a7006edeb1fac1653c28009b3a7
72a0e353a98fe18e6c3c2a11e35e5eed086b5338
8556 F20101107_AAAYDF pinedo_p_Page_043thm.jpg
32b82870f260de43b9c203c077e9581a
803c3af04a6b589ce391894bff1b2d16a042d432
2137 F20101107_AAAXTY pinedo_p_Page_035.txt
df220cf06a75985c30b694881088fb32
6fc06913d9942e116725e70ac807640b1487fdbb
8986 F20101107_AAAYQR pinedo_p_Page_102thm.jpg
b9f7e45e803119a657ec63c8f6bd8388
aa032c74d7fae4dff9403599413bfc6a62ea93c0
104606 F20101107_AAAWJU pinedo_p_Page_057.jpg
3167dcd59edfc9974adc4048f74d17b3
88bae3f19ac8f4542260ee6d8985d3da2c695e7b
F20101107_AAAXGN pinedo_p_Page_171.tif
1e0010ea123eb05ebf2a449581b3e553
64cebc627838bd4857acc29f9a0c1b04f1828f72
8725 F20101107_AAAYDG pinedo_p_Page_042thm.jpg
f5c7e533f3885137499e2ed52a817fbc
0e3f9f25b521bf0dbc6fef508e530f4eb6f0ee50
2159 F20101107_AAAXTZ pinedo_p_Page_036.txt
c050b4bed947cdfb914eba56eabc4675
ef33d301c46fc3ff006c2a3e421454ddb793ebb1
36911 F20101107_AAAYQS pinedo_p_Page_105.QC.jpg
6fa270c50ccda30954b3d26ce42412af
825bb38cb9b71be8caa5736037db6b929a9ad6dd
107233 F20101107_AAAWJV pinedo_p_Page_058.jpg
bd6c09b366091815dab14749314cab81
68f82c54c2014b6f6daa0f7d76436b698e187a69
F20101107_AAAXGO pinedo_p_Page_172.tif
16ffb3798addf6bb59acf5a2f23dbabf
1ed4448d0f76e73c305c3b370e7170ccc2f1563d
2685 F20101107_AAAYDH pinedo_p_Page_192thm.jpg
16e434d58d8fe5d42a82ee42b81ba99e
b42028bacb40ecae23bf7695e4815e1f94177d17
34916 F20101107_AAAYQT pinedo_p_Page_106.QC.jpg
50d55e07ed0ccbe311f78a675ef87ebb
246858f5979a27ec250984b29f74846813172cd6
99489 F20101107_AAAWJW pinedo_p_Page_059.jpg
fa5b4dc6cb9345a8620aca3ab6de0b06
a54f86f3a388af6e7002bb857b14b5479b2dacad
F20101107_AAAXGP pinedo_p_Page_173.tif
9d7c0d85c3c8a703634ecde739ada343
a006d04a8f9173bc88988e312905cdc4678f7109
8166 F20101107_AAAYDI pinedo_p_Page_203thm.jpg
441775aedbda2a0a3e55bab0efc9c68c
6a00613c556a3c8900d7eaf3a71e08c4257ed3ba
34082 F20101107_AAAYQU pinedo_p_Page_108.QC.jpg
5d46a83bac323068e57179dcf552d169
3557487d85596f61019e70753fb07c243c39dc52
99403 F20101107_AAAWJX pinedo_p_Page_060.jpg
d4448c54efbf660484f5a4ad8de197a3
c0a2c52d9271084b81c24cc560a3b84d4c46358b
F20101107_AAAXGQ pinedo_p_Page_174.tif
c4d438e6b4709b4b30b08fcd20efb7be
f006e98e4ee7c721ae8046ffba15d2898fc485fd
34957 F20101107_AAAYDJ pinedo_p_Page_104.QC.jpg
4ab4af341b46adc1dc7a146978eeb692
3202f0df6085e7a7e8d99c702d995ab9c9c8095d
8980 F20101107_AAAYQV pinedo_p_Page_110thm.jpg
a33f249488972be10071ebefca700da6
f92df13b7f7146b85d8cde3c39b0cf9ae40010e4
104389 F20101107_AAAWJY pinedo_p_Page_061.jpg
5b3ef78b6716c73d8d82d0f522359a4a
c970c26309e390a4d8c9ca6d5c042373efe62a62
F20101107_AAAXGR pinedo_p_Page_175.tif
ef30c13ec701341d1f2da3631412f217
b66d3931ad8c402d6d6fabfdec3c3adefcc155bb
40261 F20101107_AAAYDK pinedo_p_Page_226.QC.jpg
c8b0a87d36f53667e9d113e23f90c4c8
a08e03e7004ba8dda6f6c8a3beb906b1e84cebbb
8603 F20101107_AAAYQW pinedo_p_Page_111thm.jpg
3592e2bdac1c12b1d346d1d0f3f670db
6a8e22156cc762332dcc2422a76322b7426fe897
100368 F20101107_AAAWJZ pinedo_p_Page_062.jpg
619588a2febcab7d11bd359c474b6204
e47d779daa2e78779a6eca9ae081d45fddf967bb
F20101107_AAAXGS pinedo_p_Page_176.tif
4fbaf7f6c5b91dfad0a719ba1371cdf3
73532d73db6f16d97bbe380224782975c2b73e8e
9598 F20101107_AAAYDL pinedo_p_Page_009thm.jpg
4f80ba70a0349a0b13bb909e4c848ad8
1478228354299851b4512b60f4d1272af05dc15a
33142 F20101107_AAAYQX pinedo_p_Page_112.QC.jpg
a764463d523c994a7440acc14934271d
27c25c352d3a9d8048d7dfdd311be007fd0f5536
F20101107_AAAXGT pinedo_p_Page_177.tif
61d3d2c239c906a48b84d1e2fc51fb57
ac6a575904ec58e78aae52246f6c6417a70a0706
32622 F20101107_AAAYDM pinedo_p_Page_179.QC.jpg
5cde1fe2344521ef6248b602604a4840
5e2ef64974cf1a5c14dbeff594b7a96a265284d3
8130 F20101107_AAAYQY pinedo_p_Page_112thm.jpg
2d5c1e66c44457d18cd6a15eec22bfb2
2fce365459ac15c6e496650ffd18affc24db9e1b
F20101107_AAAXGU pinedo_p_Page_178.tif
96699fca1d101e8c3995779bfd082cf1
bfb90a1eaf28ea674b2648251931ba7fe68ad0f3
31819 F20101107_AAAYDN pinedo_p_Page_109.QC.jpg
20fb038d5ed2499b63835a020d776ba5
0bcb5e0fb90496bbc1b6a265a3249e8dac6083fd
8008 F20101107_AAAYQZ pinedo_p_Page_113thm.jpg
94984998615acb6cebaaba79dc3f4f21
66fb5d738fd73f8cac616828c2cd0910a9a1f1a8
F20101107_AAAXGV pinedo_p_Page_179.tif
70c5e334e943181b2512b0a912fd4e69
b63c769e89d47321bd3d90653cc2331d21f0dac3
8849 F20101107_AAAYDO pinedo_p_Page_105thm.jpg
ac1e01e8ac0ae9bfff0a4c458b0d8bd8
0fa39ffa121f5a85f10a2b4bcaf3d0403869d7ee
F20101107_AAAXGW pinedo_p_Page_180.tif
8546e44eed8c12b38388e9604e018676
d498087bbfd09a9f290545a0d64d1fbb89beae9f
32308 F20101107_AAAYDP pinedo_p_Page_198.QC.jpg
cb69fd90824af1f6a88cbd6a7ebfb3ac
4721a67311cadd8f737747923f0c2ad43c447f30
F20101107_AAAXGX pinedo_p_Page_181.tif
80fac6ce4ce00f036e4bb328c9e6b7ba
9ddc20b349a052393de720581a721f036d78f2d0
990 F20101107_AAAXZA pinedo_p_Page_173.txt
dd648edb912ba3861fe166bbb648b4ef
e7f0380235f05222c6500511df7428585515a199
32134 F20101107_AAAYDQ pinedo_p_Page_046.QC.jpg
5ac89b835d62199a46f404e54a2f246a
47351138d38c0e5dc55f8af07a8f0d67d339e7e5
F20101107_AAAXGY pinedo_p_Page_182.tif
4d0c139627845d02690fef2aa7b73c00
a560c4572c0c61378ce6ee5eaba4fa2b0bf2c6f8
567 F20101107_AAAXZB pinedo_p_Page_174.txt
d72c050b109fe5a23ffb23acd13ec068
8dfb94e9e9676037b9fe7ce62b9fcf94d49987bd
8168 F20101107_AAAYDR pinedo_p_Page_074thm.jpg
e192545053e20857bb63bd6a314c187d
4ddf19152dfe921abf24724a9654d783c807772d
F20101107_AAAXGZ pinedo_p_Page_183.tif
3777bfa9697967babb4ebbb89e198e7f
d95067937b8c5d454f948ea89870121a55e052ad
834 F20101107_AAAXZC pinedo_p_Page_175.txt
dbdf3e051dd38efa60977fcb4060c12d
49c037dc1ab86f64e25b748df6fbbd6bb3c74c2e
34854 F20101107_AAAYDS pinedo_p_Page_088.QC.jpg
fdee3d977f770a7e1244b1493e194c80
c648e733d943be7d17f5f484e549152ac766019e
2138 F20101107_AAAXZD pinedo_p_Page_176.txt
c6bde8b5addee645f423eba5e4ac8b2b
5ba71e0b7c0247f00e28355bfec13702d7e0e2f0
9500 F20101107_AAAYDT pinedo_p_Page_237thm.jpg
6eba675c262578d283c76a035d218015
0503a9c561c30ffecf4f14ec1b63563182a0b3fe
95308 F20101107_AAAWPA pinedo_p_Page_197.jpg
2ad05253db391031d9a64df825125381
11bbbc58651ff041d823c6d80e38bbb8888214d3
2198 F20101107_AAAXZE pinedo_p_Page_177.txt
807c9c7ed09f0997d21c7a6e6f8e1ef7
ddf4a18fbf6cec50a4d6956b9c8a5f5ee2ceef22
39916 F20101107_AAAYDU pinedo_p_Page_219.QC.jpg
d7828eda604ced455b7512656f54757a
bc5e64642645429493be867ce62add0a021a742f
99329 F20101107_AAAWPB pinedo_p_Page_198.jpg
9cfefe200d850c770cbc59cf79796510
a11f3efab4acb41633a5086da5470f6e4eb332d3
2027 F20101107_AAAXZF pinedo_p_Page_178.txt
e60357e54af001ddd793133e8b565973
808f2a4923fd27b7310b88bf191670e1e2141206
8689 F20101107_AAAYDV pinedo_p_Page_120thm.jpg
bb412e369179a96203c2165e5ddda079
6920c0582a5243d368b0c106322f2e8517bc4d60
106760 F20101107_AAAWPC pinedo_p_Page_199.jpg
f01f318337410bb811546797422f5e6c
9de010e5e6b5ee7c865394b6d8185ed3dec79233
1831 F20101107_AAAXZG pinedo_p_Page_179.txt
14ca7be956bd6e46f3e4724b1260f2b6
ed078b968ea3c02603e2289ccf51e7fcf08dd712
109561 F20101107_AAAWPD pinedo_p_Page_200.jpg
7c7a5e37842548368c3e25ed25cd37e8
863d4a1042546b3d71c13a9d3cd0731742fea5af
1926 F20101107_AAAXZH pinedo_p_Page_180.txt
c2a885cb016427d9d5bc1e9c037bca22
f093df20014f3f3b4310a6fb150d090cfc6d7cd9
35245 F20101107_AAAYDW pinedo_p_Page_204.QC.jpg
3c894d9b839e70dfc91c288aa7e9d4fa
d7f37a194d9cd2b0758496eebf6a390842d543c7
2060 F20101107_AAAXZI pinedo_p_Page_182.txt
2ed3ba46dec3a7dde9bef762c3585312
59188171c29bc60ad5003277fabf9bf79315a2d9
35798 F20101107_AAAYDX pinedo_p_Page_030.QC.jpg
b99a57c69625d22ad5511c547a88adfd
87a85141185b9133d1881c04b93efd02b309e405
90042 F20101107_AAAWPE pinedo_p_Page_201.jpg
85ba6c385449b25ac2211f6b99f4625d
b870123e1e08ecae7ef860c3d9df65edc7b5a2b7
2222 F20101107_AAAXZJ pinedo_p_Page_183.txt
0a4e9f19ed087603b554de024d5c6f31
4785848a772ab03d87e8503525a263d60067ba7b
8413 F20101107_AAAYDY pinedo_p_Page_093thm.jpg
7dea0378bb7a12e3bcf33a04b9268233
a5201f147e8007d877adfec33653be1cb3ba9d84
97723 F20101107_AAAWPF pinedo_p_Page_202.jpg
9ed065f83f1c8675c930ae7f662cee2d
0063bf8ddec10c2acbc56877de373d7befbb960f
2023 F20101107_AAAXZK pinedo_p_Page_184.txt
b405fc6a0eb91482e3abcc7c32531b0d
ca9810b1946faf3bf009a09e301ffa818f0547b3
31723 F20101107_AAAYDZ pinedo_p_Page_059.QC.jpg
66bb8bd6ee469f5214a13d95e81cc56d
30207b0a7410d3ca7507caea9c95060b9ddc2816
101267 F20101107_AAAWPG pinedo_p_Page_203.jpg
fafaae871125706fce36783044a62cb6
cb95743af4cda9553570f0ec1117a4b47f0347d1
F20101107_AAAXZL pinedo_p_Page_185.txt
9227f0aa40b674cfb3767285e1011f45
a3a706ab5e4c4e2ccc4905a7f4101f4128b91630
105719 F20101107_AAAWPH pinedo_p_Page_204.jpg
81eab3f20b0211007ab6a33f82a4f0fe
23d1ba87717b3db5c52e115c40a4bad9b2422b24
44165 F20101107_AAAXMA pinedo_p_Page_071.pro
af8a66f81d2eb84a2ce967cc9f624805
c26b04264e632df53402dafda71f6841fc22c3fd
2066 F20101107_AAAXZM pinedo_p_Page_186.txt
a2ee2f56c5c5b5175b7946e780afb195
775e6373c75632b309f75f195a16895bdcc92b23
90220 F20101107_AAAWPI pinedo_p_Page_205.jpg
166bfc30f580e8c78852a63880b7edc7
dee99159373b1c870fef5511246c0843048a7f82
46575 F20101107_AAAXMB pinedo_p_Page_072.pro
e894e85dd893d054ff8fbb8a4f678764
ec22e9f3eecadec22c91b51ff9a877e9ffe9a4bf
57947 F20101107_AAAWPJ pinedo_p_Page_206.jpg
d663bd0fa54e4a16587f3f3c0b67a3ea
04955e42718618d8a7efdf7c63ec17222162d410
51690 F20101107_AAAXMC pinedo_p_Page_073.pro
802c1561407ff5f8967640604acd91bf
a2aeef4b68defa5520b97d2695a02a1d247f13ea
121 F20101107_AAAXZN pinedo_p_Page_187.txt
43e38444a4f286beaa7ffd4058845a8f
1357ac298a9d22917472594bd4124c454cc62877
69113 F20101107_AAAWPK pinedo_p_Page_207.jpg
3dadbb01174cdc476f3075b69a3e3bc0
41098d8e957981b858ad3e2a3267506f68c42c94
50781 F20101107_AAAXMD pinedo_p_Page_074.pro
6f50e06948c5c2b8993bd02b6ebf1dd8
2a5027481f844b02bc51925aa2b9ef0a6e26a8e7
547 F20101107_AAAXZO pinedo_p_Page_188.txt
7a3ce9dc4da94ceb153d467af87e4dfa
2f1a820aa452dc3353be5e20a8d30a372c67b95d
35911 F20101107_AAAWPL pinedo_p_Page_209.jpg
602aacc9fb0017c72863431d103a4fd5
ec6cd43f1bc5c4290f2090000393b921b51bedf4
53542 F20101107_AAAXME pinedo_p_Page_075.pro
21901fa9261f5818f7743f0943b63005
08aa48a69719ca736ab6b92196b131aa8b9d5e67
631 F20101107_AAAXZP pinedo_p_Page_189.txt
89ad6e589a8f155f7a1c977aa50178be
d49f856baacde78ad4911b978824c0ad189c0b03
33222 F20101107_AAAWPM pinedo_p_Page_210.jpg
fd0563f62cd6342ee0c3a95ef2f7de36
9a2f832035d92a3aef8d64675ba69e9c65606ad0
52379 F20101107_AAAXMF pinedo_p_Page_076.pro
5b3148d0cdbcee340a2738172ebb5757
941b31b5b5bc033f07eb5b3d7f9be2700d222714
645 F20101107_AAAXZQ pinedo_p_Page_190.txt
3134339ca0126905b4680a8eff144ef1
ef2bac86816c00072643a65f352366e01917d8a6
33470 F20101107_AAAWPN pinedo_p_Page_211.jpg
1cdca398bfad34a36d35f08e86389e76
b2af21aefee0289e48515504ebc5d55cee8dc025
53160 F20101107_AAAXMG pinedo_p_Page_077.pro
332c56abfc5d980067a3e7cd793d35bf
d833d5bbb38754d4f14b963850e59628fa9e3d4a
1476 F20101107_AAAXZR pinedo_p_Page_191.txt
28a1ac13c78fcd3416df4d91c35f56eb
52716ced99d73de80b6be88729046ce42e6db321
44521 F20101107_AAAWPO pinedo_p_Page_212.jpg
fb345da466d43ade593b2a3f3b004c09
538d5707302914cf28db762b82cf09db17019920
48225 F20101107_AAAXMH pinedo_p_Page_078.pro
0b446586d4843a9409a1ddcfcfa447c0
bb21ab5a1664f9ccb01458c6e6debacb5ab48d43
8506 F20101107_AAAYJA pinedo_p_Page_182thm.jpg
eb08fbfde47927f4672c65800a5eaae2
45a83326047eb108140df4d7bf4a57260d0125b1
779 F20101107_AAAXZS pinedo_p_Page_192.txt
a589c64503f4436a9bef54a6ac5bf48a
aa2cb898c9ba61e13336a80f50131f7e4d7d2b73
130062 F20101107_AAAWPP pinedo_p_Page_213.jpg
8ab996de1534d7eeff64cfb660a60db8
8cda4c16634700e178e0aaf582b6c6c8c594a47d
48370 F20101107_AAAXMI pinedo_p_Page_079.pro
2ce45517fbc8bf04893acc50ac16da79
4504cdfdd3982080a4159e6953af32db0261bf56
8685 F20101107_AAAYJB pinedo_p_Page_023thm.jpg
425bd7a70eaed1b6512a948403a277ed
5568ba1cb529fc7f79d8d6308c8ee841dec78b47
360 F20101107_AAAXZT pinedo_p_Page_193.txt
a52dacd6c3f53b3c4a7f8f94ef256309
4ca7675e50cc824b05731c916088328b61551159
143938 F20101107_AAAWPQ pinedo_p_Page_214.jpg
557e6d30d4dbfda1ad44b23fda138caf
72ca7fb9dcd33afebe4d6d1669738c4e68eeff91
49646 F20101107_AAAXMJ pinedo_p_Page_080.pro
13a2aa35b666483c93d9137f2ba54f90
9fab1361eec03b8f2f55395a69d07bc2d2cd3777
38293 F20101107_AAAYJC pinedo_p_Page_230.QC.jpg
c266ae94b77c48382cfc460b96820a44
8dc8a7dae805145a96ffb3827f4a0d3c5a266b30
2157 F20101107_AAAXZU pinedo_p_Page_194.txt
f01f45008126df15569669c2c1b34091
db0a3a965b868a5e0cfddd17400ef7acfb37c167
133737 F20101107_AAAWPR pinedo_p_Page_215.jpg
de294cc694ec39658c1a2c5e3fc1b536
f5f6ea1f5e61fee76900d7ae734ed906f35962c9
50756 F20101107_AAAXMK pinedo_p_Page_081.pro
98d2a1d5f7bdb22825f0c3e20c474172
0b895d141f885c7f4b56cf700a04030c974330e2
8172 F20101107_AAAYJD pinedo_p_Page_091thm.jpg
740d130ba6ee6e76a743038b2b34665d
96e91b6589b7ac0bfb6df3797803981cddb5de13
2091 F20101107_AAAXZV pinedo_p_Page_195.txt
353ad1a927ae985eed5d711c534ffb1c
338ec9efe124e42c6aa11cbf92d4fcd1eea24737
127807 F20101107_AAAWPS pinedo_p_Page_216.jpg
60458ecd868a652aead0ac987899f184
7539853ccc00c71056421fca9d427aa79d5f4ba0
54308 F20101107_AAAXML pinedo_p_Page_082.pro
7e88b967d7f3a881037bcd299509c818
44d6c557ce1e6f1a24f6bbed3673c84d3cab3b7e
14978 F20101107_AAAYJE pinedo_p_Page_191.QC.jpg
07842140960b0d4ca8c91bf25fd018f5
f31810b907f661625ee6ae232878646367b806a0
2094 F20101107_AAAXZW pinedo_p_Page_196.txt
e910a75f5add60758dd5214c4081d6a5
74b4a83427bf822f63268ac6b557bd870d3535bc
137117 F20101107_AAAWPT pinedo_p_Page_217.jpg
cb755d6d282eeea771a5d78db0afacc4
058eb130321706588dc5ced88cf8ae5801aabefc
54059 F20101107_AAAXMM pinedo_p_Page_083.pro
34113d10809f6234a29a488d657fa97c
65772328c360a350fa199ea8d107ee01efc8e0ef
35697 F20101107_AAAYJF pinedo_p_Page_043.QC.jpg
1325db689106e7a0cdc4289b412311f3
1537d2abb55dd816a2e591ef05857918aebe8304
1761 F20101107_AAAXZX pinedo_p_Page_197.txt
9130ec59ae3b3e1c5d641af06b39aef7
0ad57c90ebb5fa64b8f64eeecb3a45fac0b33e7a
142769 F20101107_AAAWPU pinedo_p_Page_218.jpg
8aa380c1546d460f3677cfeb1ac3b640
c5235576b3662a8929fb312a98f0f43976a9ca77
50051 F20101107_AAAXMN pinedo_p_Page_084.pro
1a9312d650bfc678637f2632cb44b8f1
1b7e84794c158cd4f2d2665e482b159b3787a336
554 F20101107_AAAYJG pinedo_p_Page_003thm.jpg
8f96865f6db392741cf05702c8eef77f
6d0286d1b33c15542974da2c0da318ff5059a692
1669 F20101107_AAAXZY pinedo_p_Page_198.txt
b4f2441ec72e830f320aa540165a9934
f2b87132a69fcefec18cfa09fb50bd7e5dbaede2
141919 F20101107_AAAWPV pinedo_p_Page_219.jpg
d53d66de358be5842462131e7a4aac43
b1ad16420b975f55ab4ef2ba0d94eaa2b59dea71
52047 F20101107_AAAXMO pinedo_p_Page_085.pro
305a9c646c10535aa7e57b5aeee88e7a
31ababf9d268f5346992694dd3566184179e5d11
6806 F20101107_AAAYJH pinedo_p_Page_018thm.jpg
8d4b272198a6db415ea2bdf6f62d7c40
6a7f155470308a0fec87a5f871071cf0c0c0270b
1903 F20101107_AAAXZZ pinedo_p_Page_199.txt
6658455eb7198997e548be0832159120
f3abe244fce4519eca430eed8dfc1eb74f4b220d
140261 F20101107_AAAWPW pinedo_p_Page_220.jpg
cc0837f7e01f71b8228cdf4ed00b5666
fb0103f26cb1880f489536dc48c7e226cf21630b
54858 F20101107_AAAXMP pinedo_p_Page_086.pro
ede5f4aead8ddfd17bdcb14931e1661e
c7a76eb53159c6b97ff9d260f519f544991eff3c
32273 F20101107_AAAYJI pinedo_p_Page_160.QC.jpg
39f590f7fe7caa870615aea6de97e982
70f4ef529f3d35f4606147152e39da221c290702
140685 F20101107_AAAWPX pinedo_p_Page_221.jpg
17648d5e798605dd2626ae9683a46336
727781465e9124e7e7a633aca1c62e55b6064ae5
53216 F20101107_AAAXMQ pinedo_p_Page_087.pro
1dbe1368b86c6b3e43aff546c02015f0
a345df5e3fab96b34b636b1c5e67d6416f0d440f
1998 F20101107_AAAYJJ pinedo_p_Page_170thm.jpg
c146e045209d87b061dcc338e0cbf32e
3e6c5790d938ba4e14cdd503be0d8edca9fff3be
153725 F20101107_AAAWPY pinedo_p_Page_222.jpg
a5cba29ebcd9304b3d91cf5f52f979bf
f98f39eb9604c154b0c54c5767e63d95e863ad3e
51338 F20101107_AAAXMR pinedo_p_Page_088.pro
be33c02af539e929a7fe13055ae9cddf
f70cd6144ce58e8ff30b31c943c5ffceb69dafa9
8332 F20101107_AAAYJK pinedo_p_Page_115thm.jpg
1e86f962642145fe5a49fc454f772b75
085eb9f8e83ce45c37b08d60262e6bb693c9c88a
136555 F20101107_AAAWPZ pinedo_p_Page_223.jpg
f4ceb12e73852fae5c5f6238e00b177e
1c1d8f41def3bdf18601678c1e6e7e41b1c60967
50019 F20101107_AAAXMS pinedo_p_Page_089.pro
da2cd11e74f8ba22ae409158d976425a
2fd6cef201e75ef7981f312a66ea6654b80ae69c
8699 F20101107_AAAYJL pinedo_p_Page_100thm.jpg
fc5b48aa83a1c4ac46cbeca84c418e19
72e9b56d082740a417f4313ce5009af43dbb2d60
51564 F20101107_AAAXMT pinedo_p_Page_090.pro
e96b5d6f37a0cb1e3f69e71a528a1c3a
48391e651ed14e9f94d2f5ec45022ffc73f2736b
8629 F20101107_AAAYJM pinedo_p_Page_131thm.jpg
ae2dc2f8480eac8128ec78007290b8a0
948045c3f340f357e6955a52c71e61dcd2b7c243
50691 F20101107_AAAXMU pinedo_p_Page_091.pro
0a8c21c32af64d6e4524bd24ad4ec586
a2e46bf47c3976d017f85e0bcc2fefc576145ada
32296 F20101107_AAAYJN pinedo_p_Page_045.QC.jpg
a1801c18eac5cf8a31b631b3547dffb3
077be435f4e175e62ac2d49f4f94a1ce7f2b6ff6
52287 F20101107_AAAXMV pinedo_p_Page_092.pro
3e14f2ce4775118bc734853c8cf24961
0e5b132dfaf5407f8b969a6d3de5a457598db62c
7963 F20101107_AAAYJO pinedo_p_Page_143thm.jpg
7db8b8cb15e6ee08a6532d099b70927b
704262e4907da9ba674cb440c725d9677243bd40
50038 F20101107_AAAXMW pinedo_p_Page_093.pro
59cff7aaebe0e4360e4d9799edbde3f8
23b8d94c819fa3e80bc7e10cd0d5246731e4bc8f
31072 F20101107_AAAYJP pinedo_p_Page_072.QC.jpg
09ba334c3b09e48f1313a4490ba486d8
27aa06ee3d2cc5058053d7a0340763e3885b4301
45910 F20101107_AAAXMX pinedo_p_Page_094.pro
bf5f0801a9fb38d53e2c0369a3eb7f5f
08b48fd38edbcbce8d37f14b64e69e85edf717fc
38703 F20101107_AAAYJQ pinedo_p_Page_223.QC.jpg
862dece99bcf5f4fea46abe4baf7859d
f5ecc2339eb80a8a0acae4744a62d86e373a013f
48082 F20101107_AAAXMY pinedo_p_Page_095.pro
10687fa5b9ab1eef95d9ba9df3530a2f
c8e17fbb56286438bd90776416d7c1621392a2c6
6809 F20101107_AAAYJR pinedo_p_Page_151thm.jpg
bc4a4572f784cc530db5145d8e3fe202
4c6cc45add0b89ad04792a212069594572dae461
52579 F20101107_AAAXMZ pinedo_p_Page_096.pro
570ed635b92bdb837947d53d3abf7da3
8a3fdbed740ba2e7f406930bb1d1481fd33d4170
8694 F20101107_AAAYJS pinedo_p_Page_022thm.jpg
6c83ce42f85d7ca4f018457f377ed27f
76937d2ef3d5f3420f1155220564d031ff5fe10b
37406 F20101107_AAAYJT pinedo_p_Page_183.QC.jpg
42a8f9bd62dfc0aec9da135cc3ae95da
d057f09fd453d6556a5586d3832e3fa2092c58a7
1147 F20101107_AAAYJU pinedo_p_Page_002.QC.jpg
7d8e2e3cd324deebcd4a0bd4655a9114
d70a6738691afac4ff9a8f922ce53680df45809f
1051971 F20101107_AAAWVA pinedo_p_Page_113.jp2
fc8a493cd133677f6b16f4f6d32b22bf
48677b8e084c05e1d6805ad6ace20303498072f0
9254 F20101107_AAAYJV pinedo_p_Page_233thm.jpg
f2c56b63d04e5c56f9a8a35cdc88c2a7
ba470425e84e1d0d13e6d023882fb849fc7d9aa2
1051955 F20101107_AAAWVB pinedo_p_Page_114.jp2
6c3a7b1d780ac81d4679b57edd7be09d
94936872a9948478e0d09b42d0152380ec0e7a48
8880 F20101107_AAAYJW pinedo_p_Page_032thm.jpg
c7f165f7a967d76ce975c74180911a6b
738822e8ad25832de8478239638868be34f41282
1051942 F20101107_AAAWVC pinedo_p_Page_115.jp2
0604e9f383fe968de867ef1167d6eebe
b3ff1f2362db30ce7d5d8cb8e6d597de2695add6
8870 F20101107_AAAYJX pinedo_p_Page_119thm.jpg
d1548c9a038c7b01aee3b54047905fa3
7efe18c11b84e9a8b7405e0ba630d14548444f43
1051979 F20101107_AAAWVD pinedo_p_Page_116.jp2
7c7479c4829bfd34f0410942982d94d2
5ef635bc5d0092151b7fed2af4c6db283e94eeb0
8649 F20101107_AAAYJY pinedo_p_Page_068thm.jpg
db81c0dd666fd9e49840f0d3747637dc
88dffff5bf1a95f48d431cbe91d6c62bd14b369a
1051983 F20101107_AAAWVE pinedo_p_Page_117.jp2
c0ecb2ecd4aa2905d336e3d1b79fb74a
1aab623dfbe958d3780f5063ea4d10d5f24d060f
24563 F20101107_AAAYJZ pinedo_p_Page_005.QC.jpg
d18a1896740c6d288e8bec42214bb561
3b11cc8eb2c8487134b2912dc7178a0231299f73
1051930 F20101107_AAAWVF pinedo_p_Page_118.jp2
7aec268f04a05ec31b8179ef33132e51
7af13c2970ed60a95007cde03db1f840758a08de
F20101107_AAAWVG pinedo_p_Page_119.jp2
b8c8d039851da7913ac11744281e6cbc
9c4ab10480dd6c6cc666ee7c02ebda260a7f23af
68408 F20101107_AAAXSA pinedo_p_Page_230.pro
b7ecbd2af5647fd5cc835412b33aa327
dffa9d28906d269ffc77fe24cc5850cdbf23b6cb
F20101107_AAAWVH pinedo_p_Page_120.jp2
2d0e56f449763dd2d9b5f71e2d958f00
22321d3f4755e898a54f83a55dbfd6211aceddcb
65095 F20101107_AAAXSB pinedo_p_Page_231.pro
f0d49d81c9a1405cee5fb4cf0711a39b
84b21a1c47b2b551aeea7e67d3925be715b64616
1051976 F20101107_AAAWVI pinedo_p_Page_121.jp2
50c1607bdc29fb0e3dd431308fb0f09a
0f873f58e729b0f324e38ce59cbef459f7fa3426
68483 F20101107_AAAXSC pinedo_p_Page_232.pro
fe11b8c8766ee69f5ad533d567e0889a
4a94ee446abaf0ba81b3cfac43c1746e92cd0ba6
1051945 F20101107_AAAWVJ pinedo_p_Page_122.jp2
04ab50ace0f6cfa90631356e659c5295
de3faa4370dc60bbd3a5c3195a656b20c3b9369e
66945 F20101107_AAAXSD pinedo_p_Page_233.pro
9e08ed507e8b228717cd8d1646736b78
b1cb6f0066b8dc5656e5381317a64b03bbb3ee52
72114 F20101107_AAAXSE pinedo_p_Page_234.pro
fe9f6dd7d79d709b3b96b467523e2592
ef567311ddf6e6f00eb60908b26565bb7fb3816e
1051954 F20101107_AAAWVK pinedo_p_Page_123.jp2
a2b723bf2f2dc92f6299c97dc6cd1568
db79c03efb4ba82b9c585c62d393a1849037b1e7
70078 F20101107_AAAXSF pinedo_p_Page_235.pro
6dcfbcc50a1d4e64c47fedf82f7b537f
82d8b79feb864860919a3a7fa53c776c4ff5afde
90647 F20101107_AAAWIA pinedo_p_Page_010.jpg
47cc8a30a4592ead6467b690c47d1071
f61e708b60c71974581b0837fcb9617235944d42
F20101107_AAAWVL pinedo_p_Page_124.jp2
45e7a4461bc41edead01b8e1c1a56c0b
19cdf8a7dc90327cc58c40c6dce2c36d51a678d4
25602 F20101107_AAAWIB pinedo_p_Page_011.jpg
6d4edeb75668d4852e43f82121f5ad66
45b511623401d333b0b115849f6a260e18ec91f1
F20101107_AAAWVM pinedo_p_Page_125.jp2
059c47fdb3d2ac9ba68d24a669b842f5
cd804a64d6df590e46739342839694ae470b36aa
72053 F20101107_AAAXSG pinedo_p_Page_236.pro
d9f5dcbdd02d976e90cb073e33df2065
bf4a55cc03f1d6d449b136ef0e6c4870b3c39cd4
8624 F20101107_AAAYPA pinedo_p_Page_029thm.jpg
584b9261ebfac9a4cf24002e93456565
db1fafb6dfadeecc22f08b0e9324fd44eba50136
50696 F20101107_AAAWIC pinedo_p_Page_012.jpg
ddee39ff2b8f560670d775fe8b36ca6d
28b4697f688999a2b7725f15cc890bfb17bd8076
1051965 F20101107_AAAWVN pinedo_p_Page_126.jp2
f87df60fdff9a68011263f77047b8429
6dc1a05634d3c96ce12966bbcbc21662feee2f8f
73903 F20101107_AAAXSH pinedo_p_Page_237.pro
510ffd469fa2ef76bae10b072fc8aead
1df7df8c4bb009030c74acc16c28dbab5b48fc17
37263 F20101107_AAAYPB pinedo_p_Page_033.QC.jpg
860fda0084b811d6718a3fc1d280d558
1da0e7c639eceb1e01066868fe203fc65fc366e6
98059 F20101107_AAAWID pinedo_p_Page_014.jpg
14c19be2aecb07cf71473ba72600824b
0f805b73edf5077a6f89187988cca62f17dd3aa8
1051962 F20101107_AAAWVO pinedo_p_Page_127.jp2
d52596cb967c0467fbb911c02e13a31b
b841f26d06ae2447559a3e43b8663add2f22bb77
67862 F20101107_AAAXSI pinedo_p_Page_238.pro
005239fce99455a00a577b833519c9ef
85c2e833eada9e451ad6efb4c08b2b964db00182
59429 F20101107_AAAWIE pinedo_p_Page_015.jpg
e597f5db11e5a23867187f95aa2c2340
05461e7d4312c83157e073eada9a9f872117d805
F20101107_AAAWVP pinedo_p_Page_128.jp2
cbcec6b1e5a935dfe43c0e83acc01dd7
527efdc8cceb1c646adc2cb0b3adcb1e094f19a4
67926 F20101107_AAAXSJ pinedo_p_Page_239.pro
dc9460d42041cc904bdae862ca052a6c
462cf680243e23d94803055a7852e55347177302
8751 F20101107_AAAYPC pinedo_p_Page_035thm.jpg
a83031c9df2f0d67b947f8b7ef14632b
b48af292a4d0ea1eb6b898543e12c7737660e497
99241 F20101107_AAAWIF pinedo_p_Page_016.jpg
9646db70829b8d4698068d126ded76c4
ab4643fa63e61d6fd97c5a77e69de3ed713891cd
F20101107_AAAWVQ pinedo_p_Page_129.jp2
50759a279922f715689804d51ebe9f55
b2c2cea05dbf2c9c735bb787904ed925abd23942
69030 F20101107_AAAXSK pinedo_p_Page_240.pro
472a9a671777ddd7fbcf282c2a80992e
27d283af55d8a7c5bf640afaa8bf51a7b7319945
8882 F20101107_AAAYPD pinedo_p_Page_036thm.jpg
8763c1483fb95731f8d9c7d5e76b0628
511573c21338eacbb94a9a92a0ce7462ea0fce67
108911 F20101107_AAAWIG pinedo_p_Page_017.jpg
83536902f7687ece332d57762643e3ae
ce39e13750dce8e01e069b5c7891c678ea711ecb
F20101107_AAAWVR pinedo_p_Page_130.jp2
f9eb3a41b59fee49f4e72f3b91ba0557
de2b78c3c6b61115d69cd52b076fcbb51fc8f560
71732 F20101107_AAAXSL pinedo_p_Page_241.pro
0c1b89d481d17535cc23fce0aa2730cf
de7b30b888826f2f71fdd694ac2cde0b2cdd0d41
8339 F20101107_AAAYPE pinedo_p_Page_037thm.jpg
c1a217b0971192e22b69939afbfb97f1
416022efb0c443546af189764722cf24fa961fd9
86820 F20101107_AAAWIH pinedo_p_Page_018.jpg
3f7e2bcec8f423bc1640ab78d990714b
9dedbcd3a41ca5a3576cee316bf015c1aab37e35
F20101107_AAAXFA pinedo_p_Page_131.tif
990f55f26ab0574fe245231a14bdbd43
a6f725c1897deb8d744713f08d814ccf14d1e0fd
1051981 F20101107_AAAWVS pinedo_p_Page_131.jp2
35503c018869b2577b6dab450ee60c77
11b7a7982a819e42f8c581aa622d6de83ab4668f
67777 F20101107_AAAXSM pinedo_p_Page_242.pro
27d407c970a3b468f630784eedc2ffd1
13e0fd7e5f6a12ad6f29a874f14bd5560a26daa8
34288 F20101107_AAAYPF pinedo_p_Page_038.QC.jpg
997af8c730dfa68904a3f6723bb340aa
6a5d1b8eba3f6fdca22e1380251f3029471e0f9a
87528 F20101107_AAAWII pinedo_p_Page_019.jpg
c5a3e68b94bdfab8bd74ee38a6374561
f9bdb568d21c3f3e1df91305f0b8d85808eadaa4
F20101107_AAAXFB pinedo_p_Page_132.tif
40ea6f07c1271ac5c36755366448d477
be00d28aa8c290d7bc28c3ccfc4d4737323ecdd7
1051946 F20101107_AAAWVT pinedo_p_Page_132.jp2
5564f2bd18c956099ec219246bcf1301
a9f75b08fa83f156004a987a701acb071c21945b
74764 F20101107_AAAXSN pinedo_p_Page_243.pro
9f33bd0ee147a07c597b7aee882719c0
0335d28dacf4348bcb7abc068800301852c6bb94
8444 F20101107_AAAYPG pinedo_p_Page_038thm.jpg
7390b9ad52f124a78213635b3d6ac041
bf6d8170adef9547d2582ab3ccfce4851f31e113
106037 F20101107_AAAWIJ pinedo_p_Page_020.jpg
1f3125f92b81d9aa1158a2821dcf906f
7482c1c6f0a9fbe8778b7116e2596e268d818687
F20101107_AAAXFC pinedo_p_Page_133.tif
d35290abb2b077597d7daa1cc048416b
1da4ab19f7970bbe556836574fad84d5842ac17e
F20101107_AAAWVU pinedo_p_Page_133.jp2
f0132ee56167579923106826452a134a
7236256ea94909f267f16219189180d4782b647b
68933 F20101107_AAAXSO pinedo_p_Page_244.pro
9531b9f95d44f38b292bcc4202026db9
cfbefcc8acb2c4cc057b783f442f743951fcc1ec
34218 F20101107_AAAYPH pinedo_p_Page_041.QC.jpg
3e6dd285bae1e5b98108beb70d3b415d
b478e5085bc62c0198a5cd354b20c4860bd4d866
109581 F20101107_AAAWIK pinedo_p_Page_021.jpg
a9d6435ec0c688d7f81783f76ccf8163
4e1e95ed0afe44b2f4eb325ad28938df83468ebf
F20101107_AAAXFD pinedo_p_Page_134.tif
a17a2c37fd5800e1c3caec43fda042a0
752d00bfba5fad3a46ad4f96889a15d74b259ddc
767091 F20101107_AAAWVV pinedo_p_Page_134.jp2
daf2490bff13351b4c4146710eab1993
fe50bca6148df1bdae7e69244860a350bcb42c29
8366 F20101107_AAAXSP pinedo_p_Page_245.pro
2c4c6eda2004e3a372ac26ba1f23b530
dd1b84654ea176a611c6ee60d4244f0f8b67605a
34982 F20101107_AAAYPI pinedo_p_Page_044.QC.jpg
12872e58a4a2c901479be022ee81b06f
f5443da809ffdc2d6fe651477d544be23c76edc7
105256 F20101107_AAAWIL pinedo_p_Page_022.jpg
ff10637e1385d75a08015de472458e05
48953399507c36fb898fc546a48a9c3595389f7f
F20101107_AAAXFE pinedo_p_Page_135.tif
69fcc29462260b0632dd7b0789870447
2c12e8a74e3efa87ef574d188bf518c4238d4d62
F20101107_AAAWVW pinedo_p_Page_135.jp2
d3ec1fa77bd4baf918cab9350c795f83
218b1b5fde42e97330704c044721fa7f71a6f42e
33336 F20101107_AAAXSQ pinedo_p_Page_246.pro
413a2dbdcf94992e99c6a78ccbba0385
ec0068bf71bab4fe82387fd1509995c4c3e0435c
8076 F20101107_AAAYPJ pinedo_p_Page_048thm.jpg
9ebdc3e830b86af859696aec24095e21
a4d9baa2bfad5ba9c98a037d9efdd6906d5ce8b8
108712 F20101107_AAAWIM pinedo_p_Page_023.jpg
24d58e59ea867613b94560570116a65c
c60449870885c0cf155e4f671aa0c3c0e0840b17
F20101107_AAAXFF pinedo_p_Page_136.tif
f83514491b84367f14f9a4decc1ae76e
b069be6b471841204bf84a41ebdd9d3e24612569
F20101107_AAAWVX pinedo_p_Page_136.jp2
edfd98d99f16d9642a7f0e269b200439
381cc87ee3adb3a938222ee80718b12245174f6e
507 F20101107_AAAXSR pinedo_p_Page_001.txt
97027fe5cfd8bb4d99ff9ac36dffa830
5c21f27b3e75d15882ae932ec9e3b103fa22c027
8099 F20101107_AAAYPK pinedo_p_Page_049thm.jpg
dea6ea387497b42d5a6601599b5a5c03
917763da457065c0ef6f39361af6a57fc0598aab
108910 F20101107_AAAWIN pinedo_p_Page_024.jpg
ce47c95d129da2cb13e9127ed2f1aa34
d503696cde3fe4cd1a9c704ca5abeea6ed72031d
F20101107_AAAXFG pinedo_p_Page_137.tif
f4b8ffda302e4c65b6703b00eb8454ab
ebbd79ac4d7fd3360374c0bd870efcda3b2bc5cd
1051952 F20101107_AAAWVY pinedo_p_Page_137.jp2
93a636fa4e263808e1f0e86c05e702c6
80ac46a97b31f143862165c49deaca3c158c58de
33832 F20101107_AAAYCA pinedo_p_Page_139.QC.jpg
e55964b55f569c61ffd199e5c470d2c8
66cd463924c92c2c81d454e3dce7ecce9f70fd5a
91 F20101107_AAAXSS pinedo_p_Page_002.txt
80bc507cce1fe11d053156a99faa74b2
b377c4f4ed8c7020ebe3de649346b7f4af568bc7
34737 F20101107_AAAYPL pinedo_p_Page_050.QC.jpg
b4193ab3350a2e0b5fba30e49bd37de5
ff58f54b969324f27c87e492983e734bf31cdb52
109214 F20101107_AAAWIO pinedo_p_Page_025.jpg
2b9be814b2e5016108b4f68be44cabbf
9e559be0249c6a2a288ad53902f8e5f2e4056fd2
F20101107_AAAXFH pinedo_p_Page_138.tif
22cb7f91318fb55474a6f72e667ba313
7930685931c65551960176da53197edb05656ef3
1051982 F20101107_AAAWVZ pinedo_p_Page_138.jp2
7d434d956cd00c985f4f8042297d19ec
7387ff5792069efb13fda4893458e03c822d10fb
8888 F20101107_AAAYCB pinedo_p_Page_033thm.jpg
9c5d205fce1cfe6b18d239d24e23708b
66b8c2bc3e3ff555d8b84fb4093bea19b154a439
97 F20101107_AAAXST pinedo_p_Page_003.txt
12e6876e98a2876990f65b72760599a1
8a1843ad0944583fc49947da8d2586038fd8179d
8403 F20101107_AAAYPM pinedo_p_Page_052thm.jpg
2b4544606c6f56f70ff678654aafc857
68821bfcfcfee08bb3c5f379882a79dd2dff78c5
111686 F20101107_AAAWIP pinedo_p_Page_026.jpg
642d498f505386377b0bddade087c651
5838a6e5e685cf4c2e0179557491e57c009a971f
F20101107_AAAXFI pinedo_p_Page_139.tif
becc82685e464c6f35d2ef5e581f42db
a90713da0da418251453fce4eb10cb9de487fb96
34889 F20101107_AAAYCC pinedo_p_Page_022.QC.jpg
b0dd04e51533f7ecf7cb73eeb7d02bac
52aced903bf0c0dd6111c67ff3c2bfa5eede8e61
2064 F20101107_AAAXSU pinedo_p_Page_004.txt
0666d38de76b48c3a522573396b1d6a6
bfce13e595c735d087b4a0bd597fab1af999df80
8746 F20101107_AAAYPN pinedo_p_Page_056thm.jpg
d5e8a21ebacbc6a29cabb14406d272f8
6a6568aaf147373622279993ac85b459b978b746
99584 F20101107_AAAWIQ pinedo_p_Page_027.jpg
1e16cde664fd2640fe4e71a3b86012ca
2a3f99da6e08b8ba6dd9ea83b42cc7db24cd0178
F20101107_AAAXFJ pinedo_p_Page_140.tif
71d6ab4e67d41a29e05ed67419529776
045ea05a88c666bc4d4daa1a628cc357096a60f8
42139 F20101107_AAAYCD pinedo_p_Page_222.QC.jpg
47dc2e6c21d79299dc93989a1a2b5955
085d7b438b740c540b7bd616f99efedeaa4fe7ad
4225 F20101107_AAAXSV pinedo_p_Page_005.txt
223b5846a104002c856d3ee9a310dd67
38c944a66afc5ce1fdfc3ebc6ce49ab1666890e3
8504 F20101107_AAAYPO pinedo_p_Page_057thm.jpg
850ceffaf625845c28571ba11ca9b71f
d8975ec5bb39161f14cffb040f62997e08f13a3f
103244 F20101107_AAAWIR pinedo_p_Page_028.jpg
4aa769c7920397a5f2771a04c91a18ea
b23988c1063300c5931e2124d9e3bbc0ce5e7263
F20101107_AAAXFK pinedo_p_Page_141.tif
3803da0d128ebf533a70c0fe9e6bdb69
0035404de37606dfd3d551fa5b1464971094acd8
32711 F20101107_AAAYCE pinedo_p_Page_137.QC.jpg
430bc51e9e11889330bdb1675e0b1974
b1dfe2436ddc91932f944f3760096f1caf3083be
5022 F20101107_AAAXSW pinedo_p_Page_006.txt
aea9479e9ea15ac792f7beeb406c9d23
83ed3ccd652d79d85dbe7089155d390c89787ee9
35628 F20101107_AAAYPP pinedo_p_Page_058.QC.jpg
f1924769db814e19a16bbae0288a5d4b
ac37bc620b89c20908bbc8bdff214766b2fcd9e0
108864 F20101107_AAAWIS pinedo_p_Page_029.jpg
7d0f3f331eff4fc2149fe77e7a68776e
9887ca6f37aaabb567e5cd1a8db8ed28741841fd
F20101107_AAAXFL pinedo_p_Page_142.tif
63b34ba312094207076e654b525603d5
da7cd1758c218d11b799da0b819ff63a679ba53f
38355 F20101107_AAAYCF pinedo_p_Page_215.QC.jpg
25d73618ac0145da57a3b8e8f78b313e
bcacebca27e299d795688745ee352a53d23d4b31
4368 F20101107_AAAXSX pinedo_p_Page_007.txt
006c3507dddf5b70ee6d27a9fa809e5b
3b119c198183a7ffb740d0ae992b4eeeb88c924e
8775 F20101107_AAAYPQ pinedo_p_Page_058thm.jpg
9edb26257b6858a115a29f830948e683
2219a5a11e003502e3d6708eee0890ebd58331c3
107857 F20101107_AAAWIT pinedo_p_Page_030.jpg
a8b5f636e8d892e7d3c512c9c1451ef4
e021dc6946f198e7f9eb73d76f909c80d455dab1
F20101107_AAAXFM pinedo_p_Page_143.tif
cd0a8e7ccd92c73767469c956938c51a
450ab1a98779237a3036355e10edc25ce84ae900
8734 F20101107_AAAYCG pinedo_p_Page_163thm.jpg
c56bb1d860b37f5b11f210bd637aa3c1
01fb44e8a55c47547dd187ba640a51757e7e2317
3387 F20101107_AAAXSY pinedo_p_Page_008.txt
f834c9ef71871ee927b79f2bb70b6cda
5b70085904d271019d50efdc2d1e105b56ca00bb
8507 F20101107_AAAYPR pinedo_p_Page_059thm.jpg
a111fb45915edc50f5e18f0f318b0570
d6f5cb0a844db4d2c7821a2789cb86f2bd3c453e
102001 F20101107_AAAWIU pinedo_p_Page_031.jpg
a82d2ea4ab2a6468fa1eb35bf3a0ab91
568b1107b32f215ef2dfcb0be919d0474419bd47
F20101107_AAAXFN pinedo_p_Page_144.tif
0f0007db58cbe86a6cb338ab9ac855cc
c79f74b5fba3ac69faf9be8974c646450b78ad13
8714 F20101107_AAAYCH pinedo_p_Page_047thm.jpg
6fe121ad6e13ca47041c952f171a40af
acbcd562d120fcfb042def4be4cd27f45120375d
3046 F20101107_AAAXSZ pinedo_p_Page_009.txt
537063a120eeb8b582bff0bd90ec07f9
0dd8076b34b5e8de8b9d67988367f69b18f038f9
32100 F20101107_AAAYPS pinedo_p_Page_060.QC.jpg
89a34823a5322a0e7b37345b03fcb167
62604e6e5f5554bb89836184167cc2c4b8c9f315
107127 F20101107_AAAWIV pinedo_p_Page_032.jpg
715e62a5840a09ab7b3ade8f5f70d92a
4f9b29986da9e1b4643446ad498842883c0364f3
F20101107_AAAXFO pinedo_p_Page_145.tif
4611d997a540fc4d335d43abf5cd5384
de52c3e23d3945c4265025faed838b6d81d323a0
2169 F20101107_AAAYCI pinedo_p_Page_190thm.jpg
ca867aa78d8b9a89b10176398a19b99b
503424819bd788c6782fc26e8a716d4a3029784e
34151 F20101107_AAAYPT pinedo_p_Page_061.QC.jpg
e06128a708b9c631c0e4fb58feac2d58
e434770955a59e2c15a255b934e17fb48ef4965c
113727 F20101107_AAAWIW pinedo_p_Page_033.jpg
8852a313aeb1df066f0092d542c773d7
2ef573efacad2f1d6a8b68c30c01d08169d12873
F20101107_AAAXFP pinedo_p_Page_146.tif
58a04bf43a3938d010e0409bd6033867
aa37dc3549d610f4e87587d32328f7d48e76a533
17668 F20101107_AAAYCJ pinedo_p_Page_206.QC.jpg
7eaf14e38ce4ac32d12a0ad38a8e5c12
49089e88a7b1b1b009bee3ae17604d1dde1b6bed
32469 F20101107_AAAYPU pinedo_p_Page_062.QC.jpg
a864bbcaa2b3214d66238ef0ff7af54f
9c6a141c1f2f4644adcd73d3b302a05dd74b6a35
104661 F20101107_AAAWIX pinedo_p_Page_034.jpg
686c39265963f5eed85dba1dcf919893
da7e678b024f6f3cb3086d42a396732c79261414
F20101107_AAAXFQ pinedo_p_Page_147.tif
70eb24ecf9f52dace97ef7656121ff81
4819bea6c320f6de34448dd47d7430ad95680f60
9483 F20101107_AAAYCK pinedo_p_Page_220thm.jpg
d6a3df8f7a8d2743ef835c5eabe9f586
8221e6f26e81050903a73cf06a5adbb3063a4f01
36783 F20101107_AAAYPV pinedo_p_Page_063.QC.jpg
a9c18b6f34b5bf4ac43709c914f929ac
56c3aa129854f66d0729dedc8a931ae35070aad1
108206 F20101107_AAAWIY pinedo_p_Page_035.jpg
f1f55733dea846586533804990bc4850
82e587e13571a223a10686613aa493fa5a195256
F20101107_AAAXFR pinedo_p_Page_148.tif
380bd0f8ab7b58fd86d4afcd136e8e63
a9b04ae2903c7681871e7dc6bfbeb1124680905c
34810 F20101107_AAAYCL pinedo_p_Page_077.QC.jpg
96da363adaff1c9e617c64a8bf543325
9d1cb1f93dcb31897407af8e3503fe1ea0d67927
9061 F20101107_AAAYPW pinedo_p_Page_063thm.jpg
516a0dc13f7742e960be6c69d2311187
41125c1fc13fad3611415e8ce95ce34f3d44b8e1
111004 F20101107_AAAWIZ pinedo_p_Page_036.jpg
ff6756cd3613436472da71351ff74333
346cbf3ec0d009e1c1fd9fd9b0294b9af5ea1b6f
F20101107_AAAXFS pinedo_p_Page_149.tif
2314208aa1a5cd06e34693700bfa5760
aefd94b476f95bfce3671128c862ca7537921e93
34295 F20101107_AAAYCM pinedo_p_Page_103.QC.jpg
3670f63b7f62e97e6436a3927e9028f4
e01cadeff3ce7afb8ba24b93f675531d64a5de72
37070 F20101107_AAAYPX pinedo_p_Page_066.QC.jpg
5e7226e69f003e710f531b95f12c5e60
aea1382412c190a1fd50ebf53f3d8eef06121424
F20101107_AAAXFT pinedo_p_Page_150.tif
afd0d323451da7d229423a9734c980e3
0e67e84098f066aec7e402358451a74b7151611f
8763 F20101107_AAAYPY pinedo_p_Page_069thm.jpg
b29a532069e2c96acba4540b05879ac3
6c85c4a3556927f2905a8317ab9432118284863a
F20101107_AAAXFU pinedo_p_Page_151.tif
5b8009536d1388845f35563b3ed1fd90
0d1d239f5d54e04fc73f6b4742919c521cdc4b75
8854 F20101107_AAAYCN pinedo_p_Page_064thm.jpg
2ab624803a8520a517269dab9b4319c1
a8963166a195783a9d0d52c36c0a9396e82ae11f
35920 F20101107_AAAYPZ pinedo_p_Page_070.QC.jpg
ff2dcfbd241d98df1a6b353b13145160
54ebe501b03a1e55dab706b1ee70df7155934a87
F20101107_AAAXFV pinedo_p_Page_152.tif
7b4ca50441cea19c3fa0dca3ddfb7090
bb4bed28d140d05143966a93f486846d2b4014f2
33643 F20101107_AAAYCO pinedo_p_Page_042.QC.jpg
0f8443ddc473a81df1e39ca8e004aaeb
dc3f76552731e44c83724fb13dc9ff90e43b9546
F20101107_AAAXFW pinedo_p_Page_153.tif
378075b0637d98bf94abfc38c173ff7b
3003c76dfc6383e2a689802306c79492f9e9a621
8210 F20101107_AAAYCP pinedo_p_Page_079thm.jpg
2586d5e45fef7eebd9a680a2d01c3b76
a484933eb1579cd49aa3bc82205d2652b9ef8c89
F20101107_AAAXFX pinedo_p_Page_154.tif
85c29916fa91383d691bd4ba6e01f2f1
5f227756f299b9e335c1e16503a3c892080f3250
2245 F20101107_AAAXYA pinedo_p_Page_145.txt
6aef684f2d5e11ee58bb152587bbc0c0
a54bd946363cdb7543e2c7ec6732f7751b58403c
36796 F20101107_AAAYCQ pinedo_p_Page_054.QC.jpg
e49cbc8aa8cfa4d22bc700d064fd46b2
649cc172416b9f46c74137d962ac9419b913cf3d
F20101107_AAAXFY pinedo_p_Page_156.tif
780a58876217c1bf52a267dbfea0dc99
74fae26abb5bf51e3f1088f183533b990961647e
2158 F20101107_AAAXYB pinedo_p_Page_146.txt
3866472f26219942392f80acccd58693
21fb99ffe0443eb4a1fb06ebdad4d644375bec85
31776 F20101107_AAAYCR pinedo_p_Page_065.QC.jpg
ced255a42113955989ddfc2d60fe3ea3
2e3197f248afba330cb67ea136d3b2a17e802af5
2103 F20101107_AAAXYC pinedo_p_Page_147.txt
4bd3a5b428e37cdcb69c279a18941e6f
306a351a3ebd1cfb74e0c2119de87331a1879e25
11506 F20101107_AAAYCS pinedo_p_Page_173.QC.jpg
e43a0e333d6f3458abddb9544e669496
0d5495807401a6733b3f5ade61cf07da83df8e55
F20101107_AAAXFZ pinedo_p_Page_157.tif
ce1693007b1e9b3a0aceb504c1652f76
c210bb548dd71f59e2a01f122b2847a1c2a8ea0f
2077 F20101107_AAAXYD pinedo_p_Page_148.txt
2fe1b8faa9028037a770d70331283a43
07c7dc9bd3704ed42b522726b0f3da4b5233b862
35321 F20101107_AAAYCT pinedo_p_Page_083.QC.jpg
63b17e7f71b9cc7b995e226847b73168
8de18f982f7b0ece26c294d4496c013094afcb05
24046 F20101107_AAAWOA pinedo_p_Page_171.jpg
8acfefd14599313e22c8c9fc024d7cdf
ed89e39eafcb1d3ef2c5f57fe7ba67ee805c0c22
2220 F20101107_AAAXYE pinedo_p_Page_149.txt
cc46f3670de53eccbf142eb3ac7e7bab
8937d686a0a9486bdd974f4b6e371fe79e791bed
8625 F20101107_AAAYCU pinedo_p_Page_067thm.jpg
47b48e2eca00e0723581c0c30620de73
bff9091223a3b1895da9c9a4f683f82b450221eb
22793 F20101107_AAAWOB pinedo_p_Page_172.jpg
41d5a50668b391a835a0b6e2e2f2e3c1
84c2709c57d721d3a2a21a24b7f99d76d265d426
2193 F20101107_AAAXYF pinedo_p_Page_150.txt
eb68f2f90ef3063f81f11ba0c653fb2a
74b0ae9864bc80b2c967abc5e3880bce36b9c89f
32529 F20101107_AAAWOC pinedo_p_Page_173.jpg
b33d2ae6faeb3d1424634b85de26a628
9e70167830f3cbbcada7ea0502ec4486d1a7be8b
1644 F20101107_AAAXYG pinedo_p_Page_151.txt
02bf16bbfc69972bf5a47aae8674ea93
648a42b6343dc40bb623f44d0aad3ffc21d6617e
35129 F20101107_AAAYCV pinedo_p_Page_120.QC.jpg
70f9a422d36cb5c9163c83f7cf1f8074
7b80403ecebc21ff146b7a4bea27566ccefc9c4e
785 F20101107_AAAXYH pinedo_p_Page_152.txt
6bfaee56e89633ed035b6f9f38b765d8
133035a3641aab71bd1a332304f49e16f10cf3eb
8498 F20101107_AAAYCW pinedo_p_Page_098thm.jpg
d67d4f1b4abeb3063e2d3390774f445a
fe32d757a878ab9aa07a7a18030bd7e75b817784
23290 F20101107_AAAWOD pinedo_p_Page_174.jpg
22883e613db04a34726e2b8bc82229b9
f489d938c412627c5c0cd479a61bde68c2067419
666 F20101107_AAAXYI pinedo_p_Page_153.txt
9b11d0a35e100bee7f5f9ada34a3f431
6a7988217be442849c3488c9be660aa20df6860b
8548 F20101107_AAAYCX pinedo_p_Page_077thm.jpg
5e6b0578f9bf4197903d2a158ded174d
f3c483310356be3b8794cfca2f2f7d1a31b99e0c
30029 F20101107_AAAWOE pinedo_p_Page_175.jpg
ccf11a8ccd4361bfa5b7672a6cc76a1a
e59a31b75463b5df73aa855defd5a661983cdb14
510 F20101107_AAAXYJ pinedo_p_Page_154.txt
bc93a48830507eb071a95077a5e594ba
b13f43f2a1abf4141aee92f77fd412353c02ebe6
34561 F20101107_AAAYCY pinedo_p_Page_092.QC.jpg
600e3df23f08727817088d40069d4113
fa26c9ecdaf2dd2633c7fd922db9eea10735e0b2
109366 F20101107_AAAWOF pinedo_p_Page_176.jpg
bb5b1bf441abab6657f43216e09b9678
2c0649544f6fd5c022942cfc0e36e59c6d249a11
694 F20101107_AAAXYK pinedo_p_Page_155.txt
ef7c3e2534bc7c09ca698f3c436a0b3b
bc382ffa0a221d7cbc7da141e506723a0859c2d4
9252 F20101107_AAAYCZ pinedo_p_Page_229thm.jpg
b73e3cd106d79424a850b2cf44ef3cfe
242817d7bfdb40552e390244be59f2db6b5d2951
112576 F20101107_AAAWOG pinedo_p_Page_177.jpg
69d62e66c7b2ea24896fc9eda21b515f
1bb999ebaf39e408d2604f07e30340515448c31f
954 F20101107_AAAXYL pinedo_p_Page_156.txt
08861853a19d38801c80cf7eac3330f0
aeda74bd06879d77d67552571b5fb8f9caaa650f
101683 F20101107_AAAWOH pinedo_p_Page_178.jpg
32fa45c66461f121334b981ba1508a96
11ab1b8eaafbf4f6d14b6b69bb6145eb37880e30
47517 F20101107_AAAXLA pinedo_p_Page_045.pro
c1be74b5796b7e38cd6c37a250e9d8b8
1ed74528ba1e26285216fcc95b3552e18e8e8034
94304 F20101107_AAAWOI pinedo_p_Page_179.jpg
84e9fd96133956962609015c1c145135
68bb496f33c62804a82d569b7d370297ad1ba28a
49300 F20101107_AAAXLB pinedo_p_Page_046.pro
aca98e48fd053d6b757b6f61b7623f0e
5e752615bdd617ac84838239bec10ed38c974269
599 F20101107_AAAXYM pinedo_p_Page_157.txt
4adec252379520865cd022cccaa7aa1b
f8bf7afd507b24e754ca79a005fac18e8f55f6a3
103099 F20101107_AAAWOJ pinedo_p_Page_180.jpg
f17ea97613a3bafdc184910d7abfb493
48c22019426a96bc797069c0d685cee218acdf7e
52005 F20101107_AAAXLC pinedo_p_Page_047.pro
2c0f5f63a5c54ad75785790307504055
2397658decce6bbc6d1969998ca55d4a8cdef560
736 F20101107_AAAXYN pinedo_p_Page_158.txt
23c8220a0f9d7f77b871f9f791dbe9b1
e1f2f6daf0e40e87eca09ece9736a7a450447ff9
100434 F20101107_AAAWOK pinedo_p_Page_181.jpg
eefdd80ec9fb4b7ad59aac34373796cf
2c9008316560d985c861bc6f006a10fcf8e6d51b
48276 F20101107_AAAXLD pinedo_p_Page_048.pro
c8615cf220ba28ce05ab9fe53cf03fd0
768d782d4d4ac03d5b0c62da73688e3fe7533622
2125 F20101107_AAAXYO pinedo_p_Page_160.txt
70c417009500f7efd35291c9570cfa1c
0c013ceaf76f23c500833bc4a6e1c591e9bbceec
106296 F20101107_AAAWOL pinedo_p_Page_182.jpg
0747f2d3a25ee7bd2059070ecd4494e3
312dab5b2dd20889f841475ac3ced56012d8acf6
49341 F20101107_AAAXLE pinedo_p_Page_049.pro
b9f8b362dad945852e1119c6324d0a91
32a474f739ea32e7ba811789209d4b1ba2114473
2148 F20101107_AAAXYP pinedo_p_Page_161.txt
d0826af95d4869f0ab11f656ec014dc9
391eb17bad3ed4014f0fdc22dab842c5bd087d22
111902 F20101107_AAAWOM pinedo_p_Page_183.jpg
c02299698264525df6ecd0f8cc2318c3
21d4ee47ad0040cf6ccf191207ac0b3c11c5dd39
52178 F20101107_AAAXLF pinedo_p_Page_050.pro
756599f75e54b5e02307e9b2e85a1d4d
a5370116547910b5dee4870ede5d39762b488c78
F20101107_AAAXYQ pinedo_p_Page_162.txt
b6c1fa97df4a9c0c743e28ac6eb5f299
37be0c88a5c5f6a2e03304e2a8031b165638eb6c
102758 F20101107_AAAWON pinedo_p_Page_184.jpg
5490fe2ae0703baf77b6b84e7a5239ce
ddc9ee95b7abefaa62d77e54725f29b39c24b75b
54154 F20101107_AAAXLG pinedo_p_Page_051.pro
b65d706ac61bdda2e97f8bdfba78906a
61330962022a45631cece2a6b91135b0251c9d8e
1944 F20101107_AAAXYR pinedo_p_Page_163.txt
285c77763fdf5b01d8bc1e1f89b0aa88
4b1cf2fd88f6c6dfb0ed71529c862c47532f24d8
104259 F20101107_AAAWOO pinedo_p_Page_185.jpg
da47d7c3b2967c6647216252fd165a30
93e8fd68671b3fc5a242a4d62d56b4685b133e30
51228 F20101107_AAAXLH pinedo_p_Page_052.pro
832efd11df8af9327b43fcbf59a42d31
167e3cff6399642e00fe0e7a50155a8ab1233dcc
32669 F20101107_AAAYIA pinedo_p_Page_006.QC.jpg
f3959a799b2d89e2a36d817e6ec4c446
a46674e43757d75c8ea5a78782d9c45b71506799
2146 F20101107_AAAXYS pinedo_p_Page_164.txt
ec6950e77af34558521bba566decb9d8
3d47bb3bf0d9339cb188e3e4dbe0b724f451d865
107050 F20101107_AAAWOP pinedo_p_Page_186.jpg
1dd1ff7d0a0e8753f1013b3a845b38d8
1e926cbf7278b9de0734ae8a2421610ec186c766
51324 F20101107_AAAXLI pinedo_p_Page_053.pro
f998ff7395b95d36b37083d6b2c323f2
a6deffe50c6edde113d7789d0e910a2057d95f68
36632 F20101107_AAAYIB pinedo_p_Page_141.QC.jpg
362ecd8f21d654d5ea79efda2b073996
5a91861b399dcefe4b3f21eb7a8c2b34c43b7ea9
1948 F20101107_AAAXYT pinedo_p_Page_165.txt
6a5487053a5d6a42da22e43f874f822d
8238cbf68f98b608e1c8213adf3981c4966d2a89
8368 F20101107_AAAWOQ pinedo_p_Page_187.jpg
2359f04c1cdac6d365e52ea48ed16da4
ab84e94b4d9584bd648b789815af4a554e362e21
52857 F20101107_AAAXLJ pinedo_p_Page_054.pro
9e1a07d7767156e9002253b496f86137
99ea5c17d74da4ba5e4cf761a10c7e21b182597f
36604 F20101107_AAAYIC pinedo_p_Page_149.QC.jpg
4de36743c5402976547fe7fb5e63984c
b91215e7d33133d2dcbcb2b25b1db703ab97b9b7
2110 F20101107_AAAXYU pinedo_p_Page_166.txt
708c29b6014b73acc7cea27c36362ea0
d797c4368facba8e656b26013ffe11d425ba9cff
22211 F20101107_AAAWOR pinedo_p_Page_188.jpg
8ff3341b63481a303d64ad3b957634a2
04b62b95271711ba9c102ceae0a749c500018562
50798 F20101107_AAAXLK pinedo_p_Page_055.pro
63e237694b976d713a0039cf5cc8cc9c
ce3027c94afbaef6a795a1fad3afc6791115514f
7487 F20101107_AAAYID pinedo_p_Page_094thm.jpg
b40f6b9fc0abad188f41c28d413b0c13
affc4a25d53b7e2b765000eec7d7e58a65bfcd2c
2150 F20101107_AAAXYV pinedo_p_Page_167.txt
b8b872b98d7a24569307d55685b06f86
4d227756b329e6a0bebe6a2aa189edefc6e8ddbe
24379 F20101107_AAAWOS pinedo_p_Page_189.jpg
b26d1da743949b60cc8bd60020254a4f
2380d146e598e1a9942be9f10aaaa102f857e85e
52520 F20101107_AAAXLL pinedo_p_Page_056.pro
d9de881a50a71b4106d38dae6081f70c
64f1b9ec858b4fbe543e8ed6088bd923f2b6f635
9104 F20101107_AAAYIE pinedo_p_Page_054thm.jpg
5c3ec1be4c528622d5b8fb5aaaa302b2
a2b8c6971138902b7f7134149501f4d2f3642462
2040 F20101107_AAAXYW pinedo_p_Page_168.txt
52efcadb863f7de4c237efa784b6f9db
1e751c0ea1487af845710c01ce8e3ef65e301385
25412 F20101107_AAAWOT pinedo_p_Page_190.jpg
053a66baccbdd0f646249254ef041936
bd6ea0f0d6001961bf478a08bae621afee9e6a9d
49336 F20101107_AAAXLM pinedo_p_Page_057.pro
fd6618c487de41516486ba937a496a56
61b471dce09747565b3fa099386de155e109837e
7108 F20101107_AAAYIF pinedo_p_Page_172.QC.jpg
22e6c75a8d31bed093329cbaa83798ba
a1177b9fa43055e0c6ae707002b4bcb010fd1f26
F20101107_AAAXYX pinedo_p_Page_170.txt
23fd59a2e8db20fe2ecb63a2783ad2fd
657c425a8348e0be19e14f16558569e436db0365
49225 F20101107_AAAWOU pinedo_p_Page_191.jpg
dd2e1e34b5010aca4662fd8612433d09
8699b3d561a26f1172d68cc82cc064101d3bed98
52145 F20101107_AAAXLN pinedo_p_Page_058.pro
4e032bdb029f90af26cdc6f365b1c3fc
7fe12a5f24ea11cc82f98849ccf6b0d3ca46d5bc
30958 F20101107_AAAYIG pinedo_p_Page_007.QC.jpg
d948cbeec15b62ba69b431bf3d4108f4
de929c8d60c457eaa989da518c575d436c8cc022
622 F20101107_AAAXYY pinedo_p_Page_171.txt
976fc5cafc27fa12b30f73926364e1a8
3dee3f57be04debf2751d2ea76687d2fec0a3adb
33915 F20101107_AAAWOV pinedo_p_Page_192.jpg
76ecbabf0aeadd8822feeb149277d9d2
75a242a2f923347b327e533e9dc4087549808424
47837 F20101107_AAAXLO pinedo_p_Page_059.pro
7dc50fca36da277f493690b99ead8dc0
5f9cc7f34d4801c916f501e2f713609b1f10ff17
35488 F20101107_AAAYIH pinedo_p_Page_127.QC.jpg
210af35c3149507c539484d6490505ee
85b91018ffd89f1434f0fad8d2290e13ad202028
669 F20101107_AAAXYZ pinedo_p_Page_172.txt
0aade0854c562ff044794c9103712b01
35ca85ab04e2b177a4a7fd8280839ef02c94813d
90877 F20101107_AAAWOW pinedo_p_Page_193.jpg
88c86d6320f07089dda1123276f2cfa4
bdd3afeb2ffba8cc90bbf561fef662432ca37f03
47750 F20101107_AAAXLP pinedo_p_Page_060.pro
8b69701b520578c32cf7509734b9046e
69d75e5b57b685a58fde95af0ff021089ed95130
35250 F20101107_AAAYII pinedo_p_Page_147.QC.jpg
5751a889650ccc0bb64190e6161cffb4
e45f11cd38bdfda96b07ad57e729a0b929191041
107634 F20101107_AAAWOX pinedo_p_Page_194.jpg
8bd7d9b051e8ab14be92689b0164c7da
ed41f00531b9bc01d6c2acd5ccd3515685d53bc8
50074 F20101107_AAAXLQ pinedo_p_Page_061.pro
9ffae4e939c1485289b49a7b28f05b17
d40296f4f50affccab5bbdca9377af35d44e766a
9817 F20101107_AAAYIJ pinedo_p_Page_222thm.jpg
a473677dbb1fd67918f0e04bb55b5c48
df34f060d8d350d9381f5a4ab7c7d9bda894ea8e
107600 F20101107_AAAWOY pinedo_p_Page_195.jpg
f53abc91d7fff07294b00e6283955d75
d739fabef9e602ab0c235b583e94f3c8be958e89
49091 F20101107_AAAXLR pinedo_p_Page_062.pro
1f8163f8377e0bf3c9c97fab8b6052d7
8364f886e3f54a9d8f81faf3b6f2816d4847a04c
7246 F20101107_AAAYIK pinedo_p_Page_153.QC.jpg
173695f32104d36ddf802d3e46340d33
8c4b8ca725ab4494046f5111dada11092e73b168
105591 F20101107_AAAWOZ pinedo_p_Page_196.jpg
4a89a613a490c3f46278893d8264cde1
bcbbc86ab58f4f9955053a3da30d039cd145751b
54311 F20101107_AAAXLS pinedo_p_Page_063.pro
4b691fcad33fc27ab48fb6281e90dc25
5cc59d7c19c9e71f1cdadbd1dfcaacf95dcf02fc
8451 F20101107_AAAYIL pinedo_p_Page_126thm.jpg
9508e36493d39f8e283fd8be5fccc279
d9bfdaf11a440f390ae4c3c43fcf1c5b01aa0b20
55163 F20101107_AAAXLT pinedo_p_Page_064.pro
a366937d41325dbb43529073859e7d50
cb105e1775029c32c8f7b619c7020a05b3668f8e
2289 F20101107_AAAYIM pinedo_p_Page_189thm.jpg
bf1ffb2ab30de3237e0c30b9b595030d
d1e05085d5f7d7fb5ac4e17c2a360c0d51f99915
47050 F20101107_AAAXLU pinedo_p_Page_065.pro
969764da89a38afdbfd719c17a9d3d4b
03f2cfadf5ba1884795a681426977c214280d554
34269 F20101107_AAAYIN pinedo_p_Page_020.QC.jpg
8bd6bbf1d80259c55d2d8d3a2d7528c1
d6fc7c4436a87c2430116ffe80a861c5e0b87f70
54774 F20101107_AAAXLV pinedo_p_Page_066.pro
beb8e4599e1ad7bb2879515d2126325e
5c463ac67d6660d231de9ddc3391d0ac9c0c43d3
9616 F20101107_AAAYIO pinedo_p_Page_234thm.jpg
d70a72710fc70e52ba3747ddaed83985
b2f598cb20b049c107cf99999975654ac2330077
49538 F20101107_AAAXLW pinedo_p_Page_067.pro
76f1148665dccab588fe1b6987e391f7
0090ff5335b6fb9910381d3997dbd30bc879f50c
8640 F20101107_AAAYIP pinedo_p_Page_020thm.jpg
a981949566b25e60bcaca34ae2690ad2
b39b8645e9cd270e8231988a602957ebfe5e7b06
49552 F20101107_AAAXLX pinedo_p_Page_068.pro
a743dc6f85ff7a6f49456d1097caf3d2
0a20b3ecce0a8c17d0adaab272eb02afdb609f28
8242 F20101107_AAAYIQ pinedo_p_Page_190.QC.jpg
170b23e1161169ec1e401cfe8ea6a499
c41f8d38dfd862e5570ab09fe21517ed438009b6
54631 F20101107_AAAXLY pinedo_p_Page_069.pro
7608f67e1dbf74858a2b61dfe261fb0a
e4c29919431f9a2a744485d1de6e941e2b424dab
38722 F20101107_AAAYIR pinedo_p_Page_244.QC.jpg
81e204cd6a7e8c19fda83d99367762f8
f51441a10ddc3065a841772ef01b0aab022d3858
53078 F20101107_AAAXLZ pinedo_p_Page_070.pro
67253909ce0a20ebef4577ec61c59290
2769f9a432aaf8decc17ff9a1e26def9d95357e2
F20101107_AAAYIS pinedo_p_Page_098.QC.jpg
e9e0748914b21c76bb33080e9be40c7e
9ceafa0428605a6f4db1f5381781c8d0c131d7ab
39748 F20101107_AAAYIT pinedo_p_Page_220.QC.jpg
476e8fe911c3d9d08d1235ecd21869e8
f7660f6cd72565e19f7ef763cc14b811993f66af
1051938 F20101107_AAAWUA pinedo_p_Page_087.jp2
ec1d267b448b34bda3d540704ac3b10d
c1008ac38079f07442a465d016e1c13a3ab76132
7962 F20101107_AAAYIU pinedo_p_Page_078thm.jpg
60a0c313307d5391c54fd121a089ab49
f84346c0a5bd96c1b71bc978349b81804e6a793e
F20101107_AAAWUB pinedo_p_Page_088.jp2
9cbe846b54bc89dc6588a340665e0ec5
350a527180fc78e640c5bdbc47b430f848b04b9a
8695 F20101107_AAAYIV pinedo_p_Page_092thm.jpg
7fd21d9ced63e6ad4de0244d72ae39ca
858c58c6e7ffc7d02e6cf4a0ddf2eb837b998dd7
F20101107_AAAWUC pinedo_p_Page_089.jp2
a28d24487e2b096a42050f86ddd05bed
cde9049075324247825d6ff030f0fc39e1436e68
35567 F20101107_AAAYIW pinedo_p_Page_136.QC.jpg
4ee83dd56000ca9653cfb7c63f925ffe
7aaee30cbd4616193cdfd635b01ca73624136ebe
1051948 F20101107_AAAWUD pinedo_p_Page_090.jp2
f1b0fb877cba4c35d0768a1da22d5f14
fae30f941504353ebbbf8def32eda71db9c241a1
30571 F20101107_AAAYIX pinedo_p_Page_014.QC.jpg
d9510b29071df4eb97548fac63de7058
07a04e43b5d8af2171ddf5367985b2d59113c84a
F20101107_AAAWUE pinedo_p_Page_091.jp2
d0706220d46c59b2447d961050720226
c3333f6098d3d09ae7ea1918127811649c031f06
5900 F20101107_AAAYIY pinedo_p_Page_005thm.jpg
0e0481d8a241a68bb0a0641717cae9bb
410f9af1138e32b9e1f931e6110571c601cfa03f
36078 F20101107_AAAYIZ pinedo_p_Page_021.QC.jpg
b159906d12cfbfd556ee95d7e4e4e34c
d7229e29455983589d7018c95ef287a614351f36
1051978 F20101107_AAAWUF pinedo_p_Page_092.jp2
c0a257de14ea03f16ceea2546a5256f4
791a8d02f22e311bc06048f3041b4436428e3fae
F20101107_AAAWUG pinedo_p_Page_093.jp2
e44452551f5c3ea96f8fefc91beec510
225ca6b9e9963098f8c244f32e8127e81f131309
52066 F20101107_AAAXRA pinedo_p_Page_204.pro
dbada842030252381b4766e446129d57
f02d3e91e547c6007b75ff1b528df1ca8f25897f
1031707 F20101107_AAAWUH pinedo_p_Page_094.jp2
ef021f24166de1e4a2a712472c71baa7
7c4e986cfb4d732b5748e0f7f5afeff870c794e7
43992 F20101107_AAAXRB pinedo_p_Page_205.pro
76f4b678d5b26e1cc96292f189e19255
4b50d795864e80ea99048938dad44f7a9188b2d9
1051985 F20101107_AAAWUI pinedo_p_Page_095.jp2
ed414badd3e28d0df9b202d6d48bf8dd
408f644d3d97cae6bdd6c5f41f52b20783762b73
31967 F20101107_AAAXRC pinedo_p_Page_206.pro
8db5c9e0298380fffb6bf426a56ddd3a
4484e94ed5a6f066f6f7ea0cf6ef9e81eddf6405
38756 F20101107_AAAXRD pinedo_p_Page_207.pro
31eb6679f4652bbc426763d2bc4f0dbc
9385ba9aa6b8cf3ff99b87bf9dbbf357d910a634
F20101107_AAAWUJ pinedo_p_Page_096.jp2
779d65ee14c35254d96e568cd38fce8e
a150e94abec864632960093b9a922597e85873a0
28541 F20101107_AAAXRE pinedo_p_Page_208.pro
0338968e3b2b7964c3d6100fb2d4e4e9
2eed027f162a16b71e68b25c42dc280c900bf28d
F20101107_AAAWUK pinedo_p_Page_097.jp2
2da75f373fcde70e3e6429fa8b96d4b1
1a99c26f0c3467194a889547264bf588b17245e4
F20101107_AAAWHA pinedo_p_Page_093.tif
279417e3ee53b50ef53c9935dd7c59a7
df031b2a7aa570d322da151e78a86a73d19432fa
F20101107_AAAWUL pinedo_p_Page_098.jp2
310fd373237d9d8164c61162424d7ddd
d26828a5cf4a844ad1e4efb331160a1e37cb4371
19047 F20101107_AAAXRF pinedo_p_Page_209.pro
cd29e5694c386d0e80317d3bad924964
3733b5c988196060d30c4ca2ab42abc235bd9c93
50565 F20101107_AAAWHB pinedo_p_Page_039.pro
a63158043e059662bfc17d4e96ae5a84
f8b2351c5bed449e1ef82c29f1effba639eb3488
F20101107_AAAWUM pinedo_p_Page_099.jp2
362257510ed99bc9226824cc44b63037
db6aeea7dba17281fe701be09b9b3b52fce94eae
16013 F20101107_AAAXRG pinedo_p_Page_210.pro
665637f0c7625b23f223c2f3d1d5ac98
5f7f7228f6aedca67b6042d23d5f0e1abc20c120
35227 F20101107_AAAYOA pinedo_p_Page_196.QC.jpg
11c711b66a3edab6bbb1121063f15317
69685c8d0c12f62cfc70e296c644bd8e25656ce3
F20101107_AAAWHC pinedo_p_Page_010.jp2
a727780d51fcf6d768739124564e99a9
1b0433f086947749b6e68d7e0854055c0a20e78e
1051960 F20101107_AAAWUN pinedo_p_Page_100.jp2
7e25b2ed255ab11cf285d7926810ebde
9e40722e28d9453c5f9bb6d50ecdd6574d3e0eb3
16056 F20101107_AAAXRH pinedo_p_Page_211.pro
571c367549f659467eb49f541bea8117
de16f30b9901bd5cb4cde90f6a0f2b4bea4fd6f3
32788 F20101107_AAAWHD pinedo_p_Page_169.jpg
f86fe40cc1e2c5b3bbcc38379d6554c4
c0b8f038f5bbc40689264c4a4a54396d1f657cdb
1051915 F20101107_AAAWUO pinedo_p_Page_101.jp2
f42193178222685b11e8fdb052aa6ffa
9fbab18ca1bd63923a775a1260bf5dec6322998e
23495 F20101107_AAAXRI pinedo_p_Page_212.pro
a080f2e2c3972329988afedeba36aaba
226bf213867792d3100d7ad82b11d2a71f4c8a35
8214 F20101107_AAAYOB pinedo_p_Page_065thm.jpg
9fa876fc1295c095d19b1639a3244806
bbbb9b2f05aeb03413559a279b1f9f3f9b8c426f
1996 F20101107_AAAWHE pinedo_p_Page_016.txt
440f2fbe8e128344211fb89ad9f33aac
22d805ec95201fbcb111b7c92b20650c8f742f2c
1051932 F20101107_AAAWUP pinedo_p_Page_102.jp2
dcafa29b900e520ca259dc24bc158dcc
672be33585ccdc79de4265588a53d4c9c1366343
69129 F20101107_AAAXRJ pinedo_p_Page_213.pro
24239f186dde78072ceaebe0fb81347a
0e66c1c7573f7579920022aa5c4fede2485ed779
37472 F20101107_AAAYOC pinedo_p_Page_233.QC.jpg
9ef50b3c12b7d996f47dce5789b0e6f5
ff18a27d3afffefd4c32cb76fd1cf7d743919255
8715 F20101107_AAAWHF pinedo_p_Page_168thm.jpg
61c77d7b21b08e6bf997238ae770e86c
6564ffa47380de321afd4ef3a7a4cfdfadf73936
1051984 F20101107_AAAWUQ pinedo_p_Page_103.jp2
4ca0c943802966609f43b0466ca57d17
cfaac761eded1250b600b8ce82ec9014048cd9e3
73505 F20101107_AAAXRK pinedo_p_Page_214.pro
b544f57953e970cfede8f8015fb0bb62
8634b344b5cffa7c06711ac7933c06847e425fe2
7984 F20101107_AAAYOD pinedo_p_Page_060thm.jpg
30f140fa4f37abbefd46d0064a14080a
ed7333659ece3f28eb92887cbfdc5822302de75d
1999 F20101107_AAAWHG pinedo_p_Page_139.txt
0ff96f077833c7504d430a7fe253fa26
b56bc6507e51577c0b3c85c54e01ee3357403d62
F20101107_AAAWUR pinedo_p_Page_104.jp2
49a2e3de1b3e824bbb438404430e4169
c764540cff1fa4cb31eab8e9685995203ee323ca
68473 F20101107_AAAXRL pinedo_p_Page_215.pro
337fc7e17c15ebf16b8088972735b587
afaf65249895c2a7d3cd6755fab3c031505943b8
8661 F20101107_AAAYOE pinedo_p_Page_196thm.jpg
baa68da97eb9b7c97d924d31b7394547
48941c20d37cebab8574b7e80cddc39654efe746
48437 F20101107_AAAWHH pinedo_p_Page_016.pro
ef7c0d160459e48f85ffb66454dcea13
f3f83c9059336c6de24c05200db0073b3d613f8f
F20101107_AAAXEA pinedo_p_Page_105.tif
754129718868e45927af27b333beeb10
d62da7953f2fc9c42dd787ebf7518a51c4836ece
F20101107_AAAWUS pinedo_p_Page_105.jp2
ff119b10dad6b1c0d428717c1f206b09
bb8a28857ae9b8eb2e99cde3fc174ca90b188010
65490 F20101107_AAAXRM pinedo_p_Page_216.pro
2b9f38169295ca4b12336ae92155ffb0
7c019781495c388ffa49dc0d90c1da7531f21dd7
33842 F20101107_AAAYOF pinedo_p_Page_095.QC.jpg
f118864707df09be146a625b86f0d4ee
200747dc53fc6dad8e8dc9acbdb7875b2734663a
104488 F20101107_AAAWHI pinedo_p_Page_131.jpg
13eb9909c352b643d98ec77f67feb4bb
e6b1dd726ed008faa2c97743ca61d6a274733c40
F20101107_AAAXEB pinedo_p_Page_106.tif
bc53077652f1c4220fb64fd3532e51d6
4f1b14f37b993963bdd40b012213d18a94af34b4
F20101107_AAAWUT pinedo_p_Page_106.jp2
1127b0bb0a0a11c7041529077115cbee
70433247a8db393eca59990d61f4c0e60eca7ca3
70015 F20101107_AAAXRN pinedo_p_Page_217.pro
473a9094ef9bed9206e45b19d48eb3d1
1c80aec9c791f3be17c4b6d2c5f0d9b86c39dbd0
8766 F20101107_AAAYOG pinedo_p_Page_161thm.jpg
d60cf5501ed943cd5900da303f2040ff
7cbf59e7621a43bb42400cd78879d51fb6e2357d
142025 F20101107_AAAWHJ pinedo_p_Page_226.jpg
f9b5b29fe6732ad1ecba7744e89411dc
9f6dd5789dc35a23cb936fe6f3792e33c1312780
F20101107_AAAXEC pinedo_p_Page_107.tif
778e36f3bc7e55ad4f3f4d77c6146152
c311411ca96c0eaa417baf3741c0c5682ae072cc
1051910 F20101107_AAAWUU pinedo_p_Page_107.jp2
150d0302aba5306254c7aa55f2307f57
d0014ab3953334580056c8d0ad5935232a19cb69
68253 F20101107_AAAXRO pinedo_p_Page_218.pro
937bf3c4117f86d3861eb46ae9bd8a21
c3d6c71a5afc7f467bd119b7c47e0e45e37bac64
10327 F20101107_AAAYOH pinedo_p_Page_210.QC.jpg
86d3bb5f48789ac9dfca15fe4133f1b9
5929a6dcdb968b871eded2c917d29921ed9fb535
8756 F20101107_AAAWHK pinedo_p_Page_123thm.jpg
bdea05a914ff88e36f5776be2aeb2e06
cb098132101367c8aa903551b8281d4619ee7cd5
F20101107_AAAXED pinedo_p_Page_108.tif
8b4a5e4ec4b1055e736f4c554a392b72
b5428bccf3f0e05f780569837fbbe8c8b10cb35a
F20101107_AAAWUV pinedo_p_Page_108.jp2
b3d397b5c9924b64886d42a1144a2556
b01c2782577c6667fe23b283ba7deb02fca983a4
72715 F20101107_AAAXRP pinedo_p_Page_219.pro
2de248c95bc4f75bc5f7cf0275c31dcd
45c05a1c3f4f8dae730b62f187006f0463604d72
365943 F20101107_AAAYOI UFE0022315_00001.xml FULL
f0574e7bfdd491d1154fbd83c3d82473
37c9089f0c71153d639f41213e4cfa33fb87432a
F20101107_AAAWHL pinedo_p_Page_096thm.jpg
911b4f1de76ca9fe80e3b7272e805a3c
e1d72dfb75767f0ca96946cb1315d7cb89549fa8
F20101107_AAAXEE pinedo_p_Page_109.tif
3f9b22bf25a8aaf2398a75d8e2f6593f
3609fb701757ed37ca8cdd26ebacdd99c7d428d4
F20101107_AAAWUW pinedo_p_Page_109.jp2
f6800f27607c0f09ce14689440c595fc
fdfb5ede77a35c9260942b008be5e9423bc4ffa1
71491 F20101107_AAAXRQ pinedo_p_Page_220.pro
1c0b20cfe5fbeba45f18f488e69ae3bf
008074206703c3a77590a9de7ad8d830ec61d4fe
1235 F20101107_AAAYOJ pinedo_p_Page_003.QC.jpg
44df9cca3c28b045c9ba8c58c925020b
51f277b3cd23accf8957f26b9c39b573a5f2647a
8955 F20101107_AAAWHM pinedo_p_Page_044thm.jpg
177cc1860ff6f8b7381e724dcf74bc61
08305eeace870b13811f37cdb85ce6bf497251fb
F20101107_AAAXEF pinedo_p_Page_110.tif
8a7d63c1685188c240d083947ea06c4f
2689bbdfcfb3bfb52da8973a21f7b7f134b2cd25
F20101107_AAAWUX pinedo_p_Page_110.jp2
f91eabeb25b4cc458f7b85d397bf60bc
92d740ec2a20010678d688d1eb21e87246e2111f
72971 F20101107_AAAXRR pinedo_p_Page_221.pro
319e041e05b009f3908ffdcd9913545f
74cc5d7b6872ed154b9dfc8eb4dbf5a0c6f386cd
8601 F20101107_AAAYOK pinedo_p_Page_004thm.jpg
c9fb837479fdf1fab660c7954d6ef9e0
7bc671c982ab1e8afeeac6878f5afc2063a90bf1
36106 F20101107_AAAWHN pinedo_p_Page_056.QC.jpg
7c77b6dc60ac55075a660b77c70b078e
3891ed24882b1c451496d3caf9c8d904e34d8f75
F20101107_AAAXEG pinedo_p_Page_111.tif
12c1c61871fbbbc682c9120afd5ade1a
1e1cb3c1235be0a96640fb2e5ba7662da3d68048
1051939 F20101107_AAAWUY pinedo_p_Page_111.jp2
877d06e761efff978cbe8c5ac546c7c6
8dfc666ccee86beee18da92196925c0f9496f170
2977 F20101107_AAAYBA pinedo_p_Page_226.txt
ba7338ce6cbd7488bc9cce653dc97aac
8be1d476d3252667948ec766e2ab62adedb64c93
79472 F20101107_AAAXRS pinedo_p_Page_222.pro
8faa7e677cdc5af58170807d50b3a101
e3e08ff8e78f2e55898bc75ff654c745c572ec93
7442 F20101107_AAAYOL pinedo_p_Page_006thm.jpg
86a3c278551ce78929e3386aaba7c890
8f53de0485732a512d99a771274c4a3973e370de
282530 F20101107_AAAWHO UFE0022315_00001.mets
b39a504ce53d590407af2248743bee58
2929efc62ef577b1ff66642ad831e36f6fccb037
F20101107_AAAXEH pinedo_p_Page_112.tif
940deea82cdbdbdd93c6c737a884e06a
3c85fcb51ce69c8aadb949fa0fab22adf7fbdfdf
F20101107_AAAWUZ pinedo_p_Page_112.jp2
086f2103711361537344f8903eeadae6
db66d05f301a09a40d7e2c2a5775c9b17994f771
2913 F20101107_AAAYBB pinedo_p_Page_227.txt
24693f4d27d15ee6058d117b3113694d
75a60ed39bc7d6aae0ae55b275e0be723e10f548
70498 F20101107_AAAXRT pinedo_p_Page_223.pro
819acc6e1af2cf5fa41e56f9a967ebdc
18044e4b8c6b63ce63f6af9e219a248667d478f7
7485 F20101107_AAAYOM pinedo_p_Page_007thm.jpg
53261f1b4040bb6cbdc58cf50322fa4c
3c237040651f3723e44729236178a83303c44dcb
F20101107_AAAXEI pinedo_p_Page_113.tif
f36548454c1e0ffc095a9cbbe10e8674
0fe9a8b98121dd437e4555ef3caa555fa147d7fd
2992 F20101107_AAAYBC pinedo_p_Page_228.txt
4ce6fccd0126dbbfca801647bc3fe0c8
873d259ead47396dba683a0affbb541112ccc09e
67123 F20101107_AAAXRU pinedo_p_Page_224.pro
44de7b38a94f10dc0bf944389d7c3046
e89eb02f867fe6dbaed016ba06024f7714b9ac39
21205 F20101107_AAAYON pinedo_p_Page_008.QC.jpg
8657a65338cda0424d4e1a4dc0f5131d
451b9bb87bd445020b4dbeaf3e97801ae2e7c481
F20101107_AAAXEJ pinedo_p_Page_114.tif
8e542e6509ddee85bdf46525b24b13eb
2eb8196839d2e0f0aa22709ec37e63528204bfd3
2710 F20101107_AAAYBD pinedo_p_Page_229.txt
957b6b6bedf0c82737f2eb4bd4e831b8
52b94f38315901d0a162e44eba17c7dbe6c3307c
73419 F20101107_AAAXRV pinedo_p_Page_225.pro
04cdad2a093004cf69bb9ca33eeb79b5
651864ae559521e63bfa2e0eed2c50e5d567ff46
5093 F20101107_AAAYOO pinedo_p_Page_008thm.jpg
66df14882d29a46d884f0e5e37368322
355ae36d3421d63a54b95a1081fdd54bb03b1259
27313 F20101107_AAAWHR pinedo_p_Page_001.jpg
d2a8e80d5fe0d2ff07a7ffe5d98b394a
6de4b2cf0841789a6a7d177c8420301f128d19f9
F20101107_AAAXEK pinedo_p_Page_115.tif
adf8cc00a450794cddffb37785ffb77b
e6cf6df4c1fef43d03ba98c43032cf4ed8c91d55
2764 F20101107_AAAYBE pinedo_p_Page_230.txt
46b53ca755e33a363e872651c6c0c0c5
9dff613af1c29d3416635f06df2136ad5604f12a
74275 F20101107_AAAXRW pinedo_p_Page_226.pro
49ca5f92e9eae2767d0d7a219f826c7d
547596114263182529f999cf3a05f8fa39dce358
40332 F20101107_AAAYOP pinedo_p_Page_009.QC.jpg
f54e1eae414306726027583af38eb405
572c6fc3e4d22f3028eba691da04d1e3af631c48
3842 F20101107_AAAWHS pinedo_p_Page_002.jpg
521640bbbc8531c2612fab327e71fbf7
9b32f6f66332c7df806449cb5338b7e7aac2f9dd
F20101107_AAAXEL pinedo_p_Page_116.tif
c36e8a9c10540a995c8d48345be0d9ec
f4a1b0f2d2ad3b6d9f223fd04a7b0908548a4be5
2627 F20101107_AAAYBF pinedo_p_Page_231.txt
80007aade8551dd74affbf15fffa0dce
d14801d6a6160b8d140b47b7ab3075db32572e5d
72348 F20101107_AAAXRX pinedo_p_Page_227.pro
d03a731c8989de4af81a845ce0b3be40
ef96034d9ad94a333a9c67d2cb0c20fd13f7f5d2
F20101107_AAAYOQ pinedo_p_Page_011thm.jpg
650ed78c0fe6dc38d1409dfb79429c2c
c99e992f0b6e8341304b1379b1304981e742781d
4229 F20101107_AAAWHT pinedo_p_Page_003.jpg
08be33f920ec6bb6d8213fc2eed75407
8d77e5d808448a0d29437bd455cb597d1cd65700
F20101107_AAAXEM pinedo_p_Page_117.tif
18d1b134fc7cddffbc53025431b8f563
5fe3c302af6c4af56dc312cf9c153cef8a4467c5
2773 F20101107_AAAYBG pinedo_p_Page_232.txt
c928aee8754b0a4fa0cc1aea4a034a95
61f2c29e0e48eb0ee298a6868ea9ffb42bbb1a73
74161 F20101107_AAAXRY pinedo_p_Page_228.pro
5b974f1c337c9b883e341f129bc50b79
cf955c5c6763fd8f7dec03e9c66c6f46da6e6a7c
17634 F20101107_AAAYOR pinedo_p_Page_012.QC.jpg
89930e11c1b688c6cc3ce5ce519b46c2
10885a22888e3bbf115ad34a8db361c67e8d094a
106065 F20101107_AAAWHU pinedo_p_Page_004.jpg
995b2634cdf360b5103d66067a93f908
0277d99f313e3648d9cd118b5f101516f3060ece
F20101107_AAAXEN pinedo_p_Page_118.tif
085283c1060562c1b6459ee79bad06de
e8ba405b998d11e4a30d6bab7fc2e6fb69f61ce2
2693 F20101107_AAAYBH pinedo_p_Page_233.txt
1a8eed8a335aee27ad9c66a8a83e3c95
327b616f4c1a28d5e65f55a363c9c98c72a8b6c6
66640 F20101107_AAAXRZ pinedo_p_Page_229.pro
5e58c97b3cc7ce4dad16cf12b1b0cdae
3084f043b657b1ea64b5dc736ad366b9765b31d0
19737 F20101107_AAAYOS pinedo_p_Page_015.QC.jpg
77f6b75523b93af9c3ac5f803ea930c7
50ab2d9bf361890d4485329169163f8001255f1d
116924 F20101107_AAAWHV pinedo_p_Page_005.jpg
de66080bad161566e04758bfe06bc517
98faabf23d3e35d22b1a94d718158ef156237cac
F20101107_AAAXEO pinedo_p_Page_119.tif
b561188b590bd014c364bca657269d3d
499bffc165d5253b81e319321dc3471b3134fb5c
2899 F20101107_AAAYBI pinedo_p_Page_234.txt
6677e1b73f07237c14987df7b7655eca
2299802bf6570f1064f3643d881aa62da86326bf
31837 F20101107_AAAYOT pinedo_p_Page_016.QC.jpg
9f9367a42060c2a78941afbc14f013fb
9f0ecff0818e99e0e3a7bea1eaa718380f49a1cf
155284 F20101107_AAAWHW pinedo_p_Page_006.jpg
8332c0f0bb10ef0d5ffaba3c3fb9ef82
d8857cede77a07d8e4d27d20c4320b462c06cf02
F20101107_AAAXEP pinedo_p_Page_120.tif
ec478f43a52bad6205f81dd8f7f47f89
5a68ad76b514050a729e0c6f76bfe4367af05080
2822 F20101107_AAAYBJ pinedo_p_Page_235.txt
92e3e10a52bd6d1566e4274ed0c96a5c
2bd745652fdfe2a938e93c3ea70d0f87264c5f49
F20101107_AAAYOU pinedo_p_Page_016thm.jpg
c3d757f259d7bbb5fb2d388d613fd96c
a4fe79f670f50ae15f262edc9df516eac5c27b1d
142633 F20101107_AAAWHX pinedo_p_Page_007.jpg
330850bb94acc8be0f660b267ae0a36b
f3c6d2a4fdf11214920356f9c78069b077dbf344
F20101107_AAAXEQ pinedo_p_Page_121.tif
c5c524365a0f737556f75c9470a95e8e
91110ac570d30c9fa8c4a6ceb766eace2a050bb6
2890 F20101107_AAAYBK pinedo_p_Page_236.txt
8394e598c21b21e36942e79c688d73d9
4051aa8c5941721980f08f3bdd1905a6ba39d038
F20101107_AAAYOV pinedo_p_Page_017thm.jpg
c1cc0169ac5af4865ab96d2f1d80a11a
3d567e22589d47ad955a4c551686f643dc32b042
96383 F20101107_AAAWHY pinedo_p_Page_008.jpg
e9c6e14189a132dc05d9d7a257520330
87866a777af255f4f0e856a8b812a4e54be4d8d1
F20101107_AAAXER pinedo_p_Page_122.tif
cc5fa49bedb18583f2843db98bcd6e24
5e59d0d9e99241936db3ca8e1eccc91dbf207b66
2962 F20101107_AAAYBL pinedo_p_Page_237.txt
8e6241e0d051610d85506fd03f147ce7
678dd5d27ed2a28185ebdd15745aae973232e321
36014 F20101107_AAAYOW pinedo_p_Page_024.QC.jpg
62aa8348870d8d3e24d810a9f48db92d
03ae8d6e72832c7fc34b386272ec9c551cacefdb
147841 F20101107_AAAWHZ pinedo_p_Page_009.jpg
ef5f847283016b4cc9df31ed8dda7bac
22b3118a193ccc67443832b91b66657dc07e8baf
F20101107_AAAXES pinedo_p_Page_123.tif
4535eb7bec21aecce55cee266361817e
2c5df560bb9a4d0e9d1f0901a625d6bcfe78c9c5
2719 F20101107_AAAYBM pinedo_p_Page_238.txt
c0cdabc631f58d4bba24b5cb186eb6eb
40efb9b955f9f2d595fbafdbcc805db7bc86d8c8
35754 F20101107_AAAYOX pinedo_p_Page_025.QC.jpg
d0e22681cbee1fd5476110bce656b6f0
d5eb11db406486d72f97944d7a605256a7a15530
F20101107_AAAXET pinedo_p_Page_124.tif
d652438da7099f9981caac4a63501407
475edb9ef43272820dd7803c62cf983cd8f96d02
2745 F20101107_AAAYBN pinedo_p_Page_239.txt
7fa22fad66dccf1425d29cc929276985
4adbfce57b407faa591c6733e20ceb179e6cfdbf
34059 F20101107_AAAYOY pinedo_p_Page_028.QC.jpg
2a6be9d8561e8ba8e4033814b4117026
cc372ca1743f2b02b6acc803447257e97c3ba97b
F20101107_AAAXEU pinedo_p_Page_125.tif
38f2263bd8045ee14b698166432d6921
569989b29f191bb9d8a3f33a1ba1efb68d61bb6c
2774 F20101107_AAAYBO pinedo_p_Page_240.txt
1bcec277ce1562cb2b3e2e8974804f82
57d452b0c8247b57dbe8cc74921cb98395541876
34590 F20101107_AAAYOZ pinedo_p_Page_029.QC.jpg
f8e2a9e919728cee473b9b55a323f235
dda95573867a22a5b779091f15eb8c446ee0cca4
F20101107_AAAXEV pinedo_p_Page_126.tif
3ba6df307d384ae2423f145ccbed566f
4e0c7ece74e2f034ae3bf1227bf984d890ab06ef
2891 F20101107_AAAYBP pinedo_p_Page_241.txt
ec25b9a8c7172bcb462e7148f3c17668
1992fb715fd8cabc34fe2dc14d3b9168a7345e17
F20101107_AAAXEW pinedo_p_Page_127.tif
a052ea3c394abe743df17ef6c731f644
5f51178702b523dab9be2b7fda99323ebac5f249
2007 F20101107_AAAXXA pinedo_p_Page_118.txt
9810ca5c0c4cf5560c809aa5d1fe326e
c8b103a44f88eff428523f9c9127c3c099812fe7
2735 F20101107_AAAYBQ pinedo_p_Page_242.txt
af4d7451523918620ff35d22cd168722
64503e66569432d4147c321d68797ed538920be7
F20101107_AAAXEX pinedo_p_Page_128.tif
e06bdb3dd10023e7545c5094f00c385c
00735cfb4f261745f155af88d5d05d34d19845c6
2088 F20101107_AAAXXB pinedo_p_Page_119.txt
e619a58155fc015d678295b8a08e8a87
339cb76cde9ef9bba5e59999275ba7c9b1e66729
2999 F20101107_AAAYBR pinedo_p_Page_243.txt
8e51cad4ad9366989eae163c5222c669
37652392f5be8e98298d288666049b0c3efca34b
F20101107_AAAXXC pinedo_p_Page_120.txt
74d57c82f970d79e0ec87e894d57de99
7aa6c901573d143a67889dc933745a54e386d6ab
2777 F20101107_AAAYBS pinedo_p_Page_244.txt
28da6a535e3e3e80c788fef40dc7ddf7
3315741147036962c75894fe829abb1a198a402f
F20101107_AAAXEY pinedo_p_Page_129.tif
d2b1eec19874de6255233115e330de91
2f8b67fc0f836582dca0c6c7a7dbde033d81de36
2065 F20101107_AAAXXD pinedo_p_Page_121.txt
a6ba5e116a91152b202a0870d4ddd235
97e0b92cc4bc2dcdad4f47b035896d531e19989a
341 F20101107_AAAYBT pinedo_p_Page_245.txt
554bc08143e17037a9e542fff8b47164
dd173a3212f93183e439e14b754c5a67b416920b
F20101107_AAAXEZ pinedo_p_Page_130.tif
fc05b7b45f69fe6aa000dee8d167cc4f
f7f18cfcdd9befe2fbd61998bcb64112ef6225ce
2013 F20101107_AAAXXE pinedo_p_Page_122.txt
40ba9ff171d21374c478045bda011bc1
25e1888cb41d01c4e69bee4270b602e1d74ba68f
102012 F20101107_AAAWNA pinedo_p_Page_144.jpg
892e9156e63721a743cd6501a2267188
17121aa5656f5c4ec82c448a6b93368b3f7df991
2001 F20101107_AAAXXF pinedo_p_Page_123.txt
5ad818f1c53de8a06dca3acf4b051dd2
21064b563ea517f0228db4c4b289be6c572f0a51
1359 F20101107_AAAYBU pinedo_p_Page_246.txt
9ce53085a6892f17c7ff626922bd4541
c78d117f7ef5bad6e2b32a1659a84aae7b2ab493
111759 F20101107_AAAWNB pinedo_p_Page_145.jpg
7b30a25ffcde1c251197ec3369ba4f79
b9e05d68baf6db428f127de02bb547e01c47bbd0
2018 F20101107_AAAXXG pinedo_p_Page_124.txt
f77c1aeb970440b1324ad2cc67efb78f
270aaacddbe5d57732d8ee4438fcb6eade3e7cf6
F20101107_AAAYBV pinedo_p_Page_001thm.jpg
5b74d4df545a3e01fbffee3f09c5085f
e9e71c12e7a988d0d389dd1e42423c9f12201742
1051335 F20101107_AAAYBW pinedo_p.pdf
0e8b767950b067437979cba8bde7717f
71699b52f038745f1ae508d693f205816855389e
111088 F20101107_AAAWNC pinedo_p_Page_146.jpg
6793a6ab7b6520bf6a44c20ae4e35c99
6781f02982aaa21ea7ad81cebc4189ae4b8b99bb
2019 F20101107_AAAXXH pinedo_p_Page_125.txt
37731692d710b7e38fb99a8c72744895
608b34527c57627f35a3a8139d4b714448cfa6d9
8316 F20101107_AAAYBX pinedo_p_Page_061thm.jpg
6888cdf3fb935ec9665967bd6b1be6a5
f0b81372e881c74c15444a542997532ca4b025bd
109782 F20101107_AAAWND pinedo_p_Page_147.jpg
d445c06c73057501de31c8874e420269
3a22faca67db09a064deb4d20f820f072ff0b921
2002 F20101107_AAAXXI pinedo_p_Page_126.txt
a2717e2ef1d233b47e3bbb66dbe045d4
426fd4df4913c7d7d1f2c65204d069cf55419ad7
107292 F20101107_AAAWNE pinedo_p_Page_148.jpg
92e1f2d85f9799cf1b5f2e34225fed26
6ee7035ba7a659a4a5829988151d27e62179bff8
F20101107_AAAXXJ pinedo_p_Page_127.txt
7d692df750a8bb6d83d06616883d8ae1
24a3bf9eaea9289a7ccd0fadc8d9c4451375255a
8389 F20101107_AAAYBY pinedo_p_Page_081thm.jpg
d083f3e096df0df6743d69a8bdbe5fca
f151a0ef2458840212b716edf3ccc2d6d656a1b5
F20101107_AAAWNF pinedo_p_Page_149.jpg
cc6bb4a187bba8d2555ffe1795538b82
fb3c572b6d927578caa2dcf05dc55c5e35013808
2049 F20101107_AAAXXK pinedo_p_Page_128.txt
8c1a410f876e1c15442cdc6f04025e5a
3b55cd61b1ed948a8dfc6cb819793afc036b8395
9105 F20101107_AAAYBZ pinedo_p_Page_238thm.jpg
92bc3e7ad7d20a426606344f405f6911
64165339bf405a829e4b67b8e005d91619bdac1f
112621 F20101107_AAAWNG pinedo_p_Page_150.jpg
349c78a156d5ab37c5194f738592c5f8
c827ddf539d90db5e1a70cd586648cc34791301a
83878 F20101107_AAAWNH pinedo_p_Page_151.jpg
01f3f93574683ae7364ca756fb851df1
54c9fed07bcfe2ac1ccb74b4dfab2c9b25fe6b75
42288 F20101107_AAAXKA pinedo_p_Page_018.pro
f67b83c6393ddeb6bd334da6244acdaa
362945e6c2b49515b508160a326486cce42c943b
1962 F20101107_AAAXXL pinedo_p_Page_129.txt
d6abbfe333a4a317351bf051eac284a8
00966ee2cde2ce779b42833752eb7ee9c77f762a
36551 F20101107_AAAWNI pinedo_p_Page_152.jpg
da58e1fbbdd4e05b95caeae091406db3
7a1890244e255f9c6af89330e21a652b4f317349
42544 F20101107_AAAXKB pinedo_p_Page_019.pro
54e20f42e05aed0fca4ed3075eb71e4d
983dc75e920f9ea772881d857ba1c85d9d617c40
2114 F20101107_AAAXXM pinedo_p_Page_130.txt
233e1c5fe1ee6306f925cb5fada2e9ab
6a20ef63543f9bcc7718bba4a159b152ed03e282
23658 F20101107_AAAWNJ pinedo_p_Page_153.jpg
56b8305d018c737cabd331b9c568b71b
bef7b1d53d57845eba25fb6c81200108fcc9ac22
51542 F20101107_AAAXKC pinedo_p_Page_020.pro
9b32c90e2783d80e7ef7c81f206b6c76
f28c6c41b1cfc7508b00df89da4037322bd67470
2016 F20101107_AAAXXN pinedo_p_Page_131.txt
b473aacac8357b9e8cc4ce3758de182c
53b7159557802b276ecde175a7e48f36c5e66431
19656 F20101107_AAAWNK pinedo_p_Page_154.jpg
5513e89b9513a6eecc32fd89be473346
068a8def849cee27a15969c8ef53124f8aa07676
54510 F20101107_AAAXKD pinedo_p_Page_021.pro
e53750f945a403c867851f51cbeeafd5
6eb472bb6fba6dc058deb685953b4c05fbac1cb5
F20101107_AAAXXO pinedo_p_Page_132.txt
b153ab4fac7cce1d148e112235be050f
c1f4acb2e82658eeb612d8d5957f6b7533f903a2
31485 F20101107_AAAWNL pinedo_p_Page_155.jpg
c5d2cc6f45be1cc54938aca7a6390b5f
1bf144da8e24ddd71822353e45853907c898c0b9
51410 F20101107_AAAXKE pinedo_p_Page_022.pro
30f996505b43b9354ebd26c0b6202a98
b16c679038f2bf77a61fef50172a3f448b73fc68
1952 F20101107_AAAXXP pinedo_p_Page_133.txt
2af28042049ac09e64a4a367dd3cc1cd
169c11315c663d2c519906663fa6732f3dc0a5e8
40632 F20101107_AAAWNM pinedo_p_Page_156.jpg
dffd9d3ac513576c6d40a13ad7447a73
a9ce9e5404dbfc4f565c3070caeb69f4dc0c52d1
53670 F20101107_AAAXKF pinedo_p_Page_023.pro
ae6dd63ee06ff79df2104db7b8d52223
516fa14617a27fe14be7fc0c22a22d4f99a40203
1367 F20101107_AAAXXQ pinedo_p_Page_134.txt
8d8ed61bb49b333d805be75e82a62a39
43bf3deefaccc49eded26ee04959c21c3e8e386f
24210 F20101107_AAAWNN pinedo_p_Page_157.jpg
3d725dbb6cd8ca589ace2dc96dddfbef
59ec34daad9a35761ba47f47649221dc2997bca9
53675 F20101107_AAAXKG pinedo_p_Page_024.pro
dd634c830357bf716a09e16a44fc6c19
c2b6afc4b03ca0cadb503c469dfdcca677f17a73
942 F20101107_AAAXXR pinedo_p_Page_135.txt
eff8f0559d707f42fbc8aad51aebc51c
9cddfd6ab9beb229c52d2f5df767889f75c0e265
28459 F20101107_AAAWNO pinedo_p_Page_158.jpg
ccec1a05d30bcfe3bff779ac3fc6b10d
415b6991ee15a393f62cf331085d47d597e44876
53333 F20101107_AAAXKH pinedo_p_Page_025.pro
15713e30676b0222fc739d60f197f2cf
afa25af01f76ad88e472fde101c191d6fcf8ecf6
36449 F20101107_AAAYHA pinedo_p_Page_110.QC.jpg
719026b88b1d573b3d1d1a8458faa27b
82fe69bfcc1c80a3a886769a16bf0d2aee22cdee
2275 F20101107_AAAXXS pinedo_p_Page_136.txt
def10fbe7d4952f63b29126248c0208a
a14e7d8b3a7aa6bf85fc896dfcd3aa6cf2aaf371
27203 F20101107_AAAWNP pinedo_p_Page_159.jpg
56c00255c886fceb6e6e0fb1a2d0a1bd
c98360689ed3e69e4ea799f34a99c502f00869b0
55721 F20101107_AAAXKI pinedo_p_Page_026.pro
cc6ba4875d5c7fd3dfee270869f28cdc
ca0b845b81dc155dede478c1dca3e51597eecf74
32995 F20101107_AAAYHB pinedo_p_Page_067.QC.jpg
7f2cec0b617792148ef6e3a050bc0602
730abf2171d084c64814c700392673bbd76ba671
2053 F20101107_AAAXXT pinedo_p_Page_137.txt
a7bfbeceef0eb2b5a0d64c128ce485da
af4f70d31115015bb30765f99248b9c80aca57e8
101088 F20101107_AAAWNQ pinedo_p_Page_160.jpg
5b04d09224e0dbc8219b7835b65a3a4d
404d5f478f0d2e2dab18cfd60826d1e61405f003
47023 F20101107_AAAXKJ pinedo_p_Page_027.pro
4f18a5250eb2f6c74af3ed2a2ea29eca
56b5713fed0892a84e68a7b08ce9d4080a4de44e
8768 F20101107_AAAYHC pinedo_p_Page_200thm.jpg
e836212c0aff958b92815237916719ac
1054554136f1ab43ca64fb6f64600b2948b897e6
2226 F20101107_AAAXXU pinedo_p_Page_138.txt
218049911a5421d733ed00f42c14bcdc
80e5b55090a2d08c9392051e55b7264033ddaa26
109942 F20101107_AAAWNR pinedo_p_Page_161.jpg
489e70958286c4055ffdd7ea967826c0
3b09a2a72f2458a72cd6cb27650cd95b0951971b
49683 F20101107_AAAXKK pinedo_p_Page_028.pro
cc7250dcd483e67fc80085ae1a59398a
de061287bd7c16c340642b3ea91a541677ef027b
40660 F20101107_AAAYHD pinedo_p_Page_237.QC.jpg
3e04c32ceebb27bf5fa7f288db33c28b
26f63cdf428350a2fbd581eb7a96dc0d96aea755
1936 F20101107_AAAXXV pinedo_p_Page_140.txt
f398e8387fd7cfd2c9bb161ddaccef67
00440802136511128b4024bd4a25275c222b8a9c
110586 F20101107_AAAWNS pinedo_p_Page_162.jpg
450b974e757debff64670b5e81647e8f
26a9095edbb44095577fd404dfbb7ba7abfae708
52841 F20101107_AAAXKL pinedo_p_Page_029.pro
73312a92d1baaa8b81991345e055da4e
c0c870055a007063877596743e12dedb998d92b8
4623 F20101107_AAAYHE pinedo_p_Page_015thm.jpg
1f928f57a5c12a57f0ace7803598b2c2
668dc482c767e8b7e317c856e0d6ca6bb2680a36
2078 F20101107_AAAXXW pinedo_p_Page_141.txt
d19c29efcfa848d41f53f6977b9348fa
c2bd12447377bbf1ed28b01a33a0fb5f08f06e42
104214 F20101107_AAAWNT pinedo_p_Page_163.jpg
3a00c3db324e6cb2fa5513289c8fe50b
51ffe27e8fb8f72f6922888ec27477b65a7eb904
51749 F20101107_AAAXKM pinedo_p_Page_030.pro
52275af51e0ff4323493573a091b1608
23ca93ace99b4269a7267f3f4055daaca3c8f676
7021 F20101107_AAAYHF pinedo_p_Page_205thm.jpg
63f2f9b313fc0de4011f60a932e112c9
6dcdb705479a050f5656ce2c4f8bbdfd6b106da1
1770 F20101107_AAAXXX pinedo_p_Page_142.txt
31ac0f2a23f632ee8552a8c34b9726c7
a8552cf7365d1ce053fed5613171403f78e83b84
113812 F20101107_AAAWNU pinedo_p_Page_164.jpg
9f04999eccb1910032a1a5bcdeb5e2b4
538d45991bdd4a6420a14efa3f8f593070e9901f
50498 F20101107_AAAXKN pinedo_p_Page_031.pro
ffa289e9b96ebe7836c25c05b1376fcd
d11ff97e7bcabcbc7033b2c60194667cc814f019
7688 F20101107_AAAYHG pinedo_p_Page_174.QC.jpg
8e3497bdcbd3e24a5cd909ef2fff0c1f
3003d001a1c7c36d7f6aebbd5df8e3cf8529bb04
1918 F20101107_AAAXXY pinedo_p_Page_143.txt
79291a8a6bc123a7b611775a06b4f405
2c97774b06dd5668c16da07f700864ffda874e68
100503 F20101107_AAAWNV pinedo_p_Page_165.jpg
6e5e15e8edc1c10a7e2795ea67763ddc
967c7c7a93e6aa11ae3371cc38e99ae7e64b7612
52739 F20101107_AAAXKO pinedo_p_Page_032.pro
405499ea6d13ab7477a468bc28308776
9f957c0e8c53aaaf5e3520bec8f4596a21156062
24916 F20101107_AAAYHH pinedo_p_Page_010.QC.jpg
9ee0be7566ca7ee36f34ded9c74b961b
aff74805aab86f79764607bc96c512d4eb8ebc5e
1992 F20101107_AAAXXZ pinedo_p_Page_144.txt
57b330af889e6c2263840631ea96d33b
7f5f91bcede96e36b684960086d6a7079fd844e4
105673 F20101107_AAAWNW pinedo_p_Page_166.jpg
92359e351c54179b7eb15c799d478b56
da5d43bf9839555470fd29b50382c2ccb898d356
55105 F20101107_AAAXKP pinedo_p_Page_033.pro
f9f3d2f445fed5df229aebffb1a3ae0e
d19a35623cb2e21073d73494d07d4e0748ef9b54
9323 F20101107_AAAYHI pinedo_p_Page_223thm.jpg
03af1cba82da4557268e42f09a534f65
ae1ef2925c771d62267761f166d91ee1f26acf24
109872 F20101107_AAAWNX pinedo_p_Page_167.jpg
e900129cfa9d2bf6abce2e6fd70d9cd5
dca8fc3750099d95723ac85403b9595ecbb3b57e
52349 F20101107_AAAXKQ pinedo_p_Page_034.pro
ee412d68b26a6495e33875309b096971
a30be9fff8b44934433e8b8eb57f319443f67e6a
8333 F20101107_AAAYHJ pinedo_p_Page_055thm.jpg
8b8f52ecbfc339a6157aaf34d7428d8b
7f89191e9fca3ca915bb8d401b6db57f98db7733
105519 F20101107_AAAWNY pinedo_p_Page_168.jpg
fbdc3cb929e848492758173206dfb5ba
3a8adfcc32cfa94367f6f6cccec7341b04cb7f21
54302 F20101107_AAAXKR pinedo_p_Page_035.pro
fe8595d02764eec8f952cbb84b7c7612
1b6017d2130ed1b5af95e58ba4dfa2c7307d3467
8352 F20101107_AAAYHK pinedo_p_Page_075thm.jpg
0c9042253ca74d7dd6e2953fe8b30bb4
b5b40a50f9dc598146502d687542af103fa90be6
21176 F20101107_AAAWNZ pinedo_p_Page_170.jpg
83df38732896388b76149e4b0b528c22
f2db5e69bb8cb127e396d13efb3d6269b150d8ff
54697 F20101107_AAAXKS pinedo_p_Page_036.pro
298370fc18b3c8cab49efd5a54be9b9a
2fe68f4fef1995c8ad0701dd98a3b26087e4d2d5
7247 F20101107_AAAYHL pinedo_p_Page_170.QC.jpg
3f125ac2c7faa456807a4c2b6a2fbd3a
3ff838d3e0878e6ca0f903bea714d2a528f1ee23
49523 F20101107_AAAXKT pinedo_p_Page_037.pro
f4f8d8a1716489028bf3fb72e518e9a4
21598f0e3f4eceb744af5e259ef6d8e9ba8db895
8238 F20101107_AAAYHM pinedo_p_Page_031thm.jpg
b253df50643291f2d42e448e6a94c53a
b6afecf6d04758442ec5035732413bdce52b43d2
52803 F20101107_AAAXKU pinedo_p_Page_038.pro
a329edfea9744868c61af4ed5414e81a
5f951273f64a7cb56823801fcc9ddc260f072966
36022 F20101107_AAAYHN pinedo_p_Page_177.QC.jpg
8f53fa5313be1236f4f20891a22933a4
a74d1e8e32b61881618d5083bfccb46f5c680710
48581 F20101107_AAAXKV pinedo_p_Page_040.pro
c7d9871bacc8192dde7c8982e95359f7
4ebbd982ee8c104409b7844747d67c95583df492
7174 F20101107_AAAYHO pinedo_p_Page_157.QC.jpg
df064849c3ee7619df60cd397969bcbd
e25b29add8311ae26e8d963f52df50d9c2a4560a
51211 F20101107_AAAXKW pinedo_p_Page_041.pro
2989d218809e073c76ed55358bec75ad
a769e4545bf083b22d77557508d1bedf43225fdd
9450 F20101107_AAAYHP pinedo_p_Page_227thm.jpg
b7b93b027907b3ce10403a2b72897c4b
eee9ba29b1589a66d3ace909d99d39416015e860
51348 F20101107_AAAXKX pinedo_p_Page_042.pro
3a8b13d6d1dc2d486f5265ead23d8cd3
a9d240b826dea536206ae222820b5b6987ddfe65
8490 F20101107_AAAYHQ pinedo_p_Page_177thm.jpg
5fd9e5cc8c2f3e48b2828b26b2dbf1f6
9566c665d24205aae41138b5e48523b1d5c681df
52696 F20101107_AAAXKY pinedo_p_Page_043.pro
c733dccc771f86ba0caa57a1007ac8eb
9c50de9c55f03afb7f2e3d281440f0ddbeff7aff
35568 F20101107_AAAYHR pinedo_p_Page_216.QC.jpg
0dc14eae0675db6249e7b07e7ad09442
274b3f49cf5c26c246f938ec924081e4727f2b65
53477 F20101107_AAAXKZ pinedo_p_Page_044.pro
e14fe281b059e4bc4e0251f0ac035739
0945a4777a3f668b33ba740d49d3e1b201bcb5a2
10332 F20101107_AAAYHS pinedo_p_Page_211.QC.jpg
edcbe63648ccba9291efedef8532fcba
4247a8a9766dd506f970ec9ecc67e7b4f7b6290f
9063 F20101107_AAAYHT pinedo_p_Page_232thm.jpg
64ca6f8853447bd6790e2333790d0be9
6a5a47be3504bbd471a8fcfda9db7295fc3d714e
F20101107_AAAWTA pinedo_p_Page_060.jp2
c3f2b760766101712be3409091131dd1
d7ffb6bb694d82a35a57f5360c5db51ad3c36330
8484 F20101107_AAAYHU pinedo_p_Page_028thm.jpg
ad0df236e5f35f59e7bbb6dcf04f3b5d
6eb08abe2fef3da94793059da954b1ec2a99f4e0
1051917 F20101107_AAAWTB pinedo_p_Page_061.jp2
d608e0643e9b67944bf18b24a05d57df
960be0a0dfd68a4499b2fd20d48c2be08e0698ed
8613 F20101107_AAAYHV pinedo_p_Page_136thm.jpg
66b0f55b464c45eee4b55958e7839cb7
a8116f9bd7286b0e1e077dca7f59588dc0450bb6
F20101107_AAAWTC pinedo_p_Page_062.jp2
225255c623abd032ad4f0c385c1a98e4
fe0005ccc3971ddaff2d542980f4c55ad1634868
39421 F20101107_AAAYHW pinedo_p_Page_214.QC.jpg
c468889ecc208024c92f65f312d25b47
d6a3192f35b46086e3fc80b38066b32037c2bc35
F20101107_AAAWTD pinedo_p_Page_063.jp2
7f46429b19d97b5ba24edbee80ddc275
a7a2a7a4dc95e4e3a3b83b3ec89f9b4a35562f65
8256 F20101107_AAAYHX pinedo_p_Page_062thm.jpg
b287c55091b35ce4db0b3623e9c7e1f6
1815a2d7482790fd9b018d60d99ead5d1f60e5b1
F20101107_AAAWTE pinedo_p_Page_065.jp2
17ecd22ccd6619ec7e85d4a0afd45876
24edfb77e741c8498d6f0ad03425493d219cefdd
6567 F20101107_AAAYHY pinedo_p_Page_013.QC.jpg
ad705bc907ab7ccae2ac9f121ce470a0
1a45d282d7fb42cdf49294608d382eafcb844055
F20101107_AAAWTF pinedo_p_Page_066.jp2
1e475b0f8a5f4af7af4eccc2f23f2239
a68ed096d9820ec2f90069474c7ee5ceb8c2bd4c
32286 F20101107_AAAYHZ pinedo_p_Page_144.QC.jpg
2ca5fa8063533a0b2fcb94d51916af40
593121b033eb5f5a94d9fb0ee7dce164ca783b18
F20101107_AAAWTG pinedo_p_Page_067.jp2
43990976add2a016457036617c9c087a
de6c7fdbdc7bce8d9142af24a2f1301a733dc5a7
1051968 F20101107_AAAWTH pinedo_p_Page_068.jp2
f5debd62c8585b71762e8a3c4ac450ff
66d2d01a270a7a4d87ef93c6d6d7d824354a9ee6
54801 F20101107_AAAXQA pinedo_p_Page_177.pro
64ce0c36c5043d0a0a8fbcb5c5558317
5935933064c7ad3b5af94599466147ee5ea299a9
50214 F20101107_AAAXQB pinedo_p_Page_178.pro
458aaf4b79184711377a2e6ea36d6221
e5afcbb38ea2f29112d4cce59f3312835fbd5d89
F20101107_AAAWTI pinedo_p_Page_069.jp2
d1eb712ad31c0356f3b7fda31d378ed9
734d31850e1f2823d90f37fcb16069529dba0a4f
45693 F20101107_AAAXQC pinedo_p_Page_179.pro
1dbea41da6d3a4bfbc9642faaf0a8521
408ba0e4ffde5df0f3cdea4a93e0be926d15b0de
1051974 F20101107_AAAWTJ pinedo_p_Page_070.jp2
34bc33438fdc52ac0fe6aa0592cfe2c2
f588100e93b7b47bc40a91c9466d231bb63ae69b
48563 F20101107_AAAXQD pinedo_p_Page_180.pro
e91ef3f9fca3e5c657696bb12a126f39
83955e484ea35dc7461d569dfa3dc94c0b1cdd94
1002859 F20101107_AAAWTK pinedo_p_Page_071.jp2
5e86a8da5baf89b4f8c84df3266d9126
385e30b761555e7905753ebdfc66dcbd43a99524
1042836 F20101107_AAAWTL pinedo_p_Page_072.jp2
70c0feb1573eda7f2eca603c7cd5039f
e5adb1e678e46f74e66fba445905aa4491e01a94
48711 F20101107_AAAXQE pinedo_p_Page_181.pro
d6e69adda17543ceb2313a91fd070095
ae23b3520caed81084a1fad92ebbfe11798cb735
7577 F20101107_AAAWGA pinedo_p_Page_019thm.jpg
239b292eb8ea0f31134e908c228cd1cd
503b2f40aecbd0b74bd54f6bc1fe6b8d2dae8fac
1051940 F20101107_AAAWTM pinedo_p_Page_073.jp2
84961095445084572d2aef63f3a418e8
90ee20c85ee39ea71edc5bcd8f26f92eef858768
55559 F20101107_AAAXQF pinedo_p_Page_183.pro
c02c7c1a879e87715e9c47bf720a84c0
5abd1a04a5f73d2df8b3745cfc197d8ef934ea55
8701 F20101107_AAAWGB pinedo_p_Page_021thm.jpg
cf9d4aa8082bbe7211fdb4132c6b14ba
5a57c3631aae9cb541176fff4bfa7931bd6a2674
1051903 F20101107_AAAWTN pinedo_p_Page_074.jp2
ae5a4e9ebe695991e5f8271b64db3eea
a2b895bf4c23ca9a9aa52480210e68bbff7bbb73
51117 F20101107_AAAXQG pinedo_p_Page_184.pro
069e3a84d7d3b2b67c0044e113fcac86
ace01ee582d1decb2f107df56b8233032e097f4c
8964 F20101107_AAAWGC pinedo_p_Page_230thm.jpg
c7c1a4c15fdaa15aa6a53bc05662d6de
c307c8f40a0d59d7dad54190889b586be1add616
F20101107_AAAWTO pinedo_p_Page_075.jp2
65d5281d93e101787e24a407df2055d8
c83b506032250e98336f9b46d7c9fd3d3eef40e1
51364 F20101107_AAAXQH pinedo_p_Page_185.pro
0d8ca09b7a7166200eb1986b7d31907d
b3895e759161810a2fe562095f4f83a0cd94ecdd
32195 F20101107_AAAYNA pinedo_p_Page_114.QC.jpg
315d145c19227dfb17ba6daf2b7c42c6
6a84debd3077fa4af5a5a7c9580a0bdf88c5014c
145930 F20101107_AAAWGD pinedo_p_Page_228.jpg
86d6071cbd2a0380e1b3467f5314811d
52a5b3058af444deedb2f2c9cd9973a1920d14c1
F20101107_AAAWTP pinedo_p_Page_076.jp2
2088b53a3f3b8637c93772b66af1f526
4d78c2ffc1e37dbe26373e8d0ff239380cba670d
52299 F20101107_AAAXQI pinedo_p_Page_186.pro
6b7d9dd46c33eba3b4f3ff280d3302c4
2eb1e7be31764cf7ed3b401dbdea4c4bb48550d8
34415 F20101107_AAAYNB pinedo_p_Page_039.QC.jpg
f05ce50de706d10769effba0fec4a6ca
12a0f4e20fc3dd0c31a302825fb94f2750cb5e49
2136 F20101107_AAAWGE pinedo_p_Page_083.txt
28a48408c18057a2804a896cc2ad0388
1a739153c147436d53b7d13f4e33de53dca86564
2928 F20101107_AAAXQJ pinedo_p_Page_187.pro
510f7cf21e6e8c9d97e3624cc6ea52aa
c87bed06cdd518a44f21fd59388b58633d76bb85
34065 F20101107_AAAYNC pinedo_p_Page_068.QC.jpg
3e4cb7b14cd44f09371d14df12a9a44c
7d646b10b19d791cdfc686ae0099518402af5fbd
8804 F20101107_AAAWGF pinedo_p_Page_104thm.jpg
12907918036454979afadd99953971ce
27fafec8ce6aca9d90c9138c9a9e66bb75fed65d
1051975 F20101107_AAAWTQ pinedo_p_Page_077.jp2
2822645d584bee93008b353db4a0c7e5
8c7ec1c9a4845e229a2a6a28b0924323e4bc262c
10577 F20101107_AAAXQK pinedo_p_Page_188.pro
71720a032c0b498c661d69f68a8dbab5
0d313941b9dfd118867fe57b40f7121895883b54
6087 F20101107_AAAYND pinedo_p_Page_010thm.jpg
a0c81b8fa90b9d1df62f79e4a7114973
4a96c200b9315413090962c09bbf1f47b7308a22
197 F20101107_AAAWGG pinedo_p_Page_159.txt
6918e5996481862d3685b2a4c22f710b
a94101f5eef91d0e185b9ae75ff0bf2a01fa7557
1051922 F20101107_AAAWTR pinedo_p_Page_078.jp2
6f76609c2592ca5184a5283507c79fdb
e562e6eaa71a440bfef2b0b30be24e80ee33d097
12512 F20101107_AAAXQL pinedo_p_Page_189.pro
6672bed58bab23c7da750bfa34f1dcc8
99c04e53874a4606edbbb88b89c211e724733928
9558 F20101107_AAAYNE pinedo_p_Page_214thm.jpg
dec5742293a0ba547b01fc2be40ed1d4
54019c9332964aa9e87aa555e0d41715b939dbb0
9137 F20101107_AAAWGH pinedo_p_Page_164thm.jpg
5435788bd0959b78991b3cab06f9e1a4
b21ed56af20e16f27391bb3c9c3553986058a7a3
F20101107_AAAXDA pinedo_p_Page_078.tif
7e889dde5e73988a357bd0391da4bbf4
f50a5bd9a2e247b4016cd6bf76836027ee9cbcd8
1051964 F20101107_AAAWTS pinedo_p_Page_079.jp2
5c2f1a0d7f77e3dcb37d21d22a4be74a
96223bf867fe7af74f33c1c5bb40b6a5e3913330
13110 F20101107_AAAXQM pinedo_p_Page_190.pro
da2bb6f903974662b1c999eee3b5d1c6
0b82c23a160415238630e19caebe5583b4bc017d
31770 F20101107_AAAYNF pinedo_p_Page_094.QC.jpg
89b6914c6027246fd70a6e5d5c486831
badb0bd011c72585141c8c5c93a23c0614b28839
26700 F20101107_AAAWGI pinedo_p_Page_135.QC.jpg
8bcc479244d2237e6687c115e8d8f344
218428bf8e228bb6a4c0983922e0cc434cdeea3f
F20101107_AAAXDB pinedo_p_Page_079.tif
eafe8d4eb7b2742b60efb8c9dda237b1
f999a7fb2d56f174887a5caa3f93749b013448c6
F20101107_AAAWTT pinedo_p_Page_080.jp2
a8c54c46322d66974225a4f77344efbc
8af42aacfce1f3a6665cf8d5abed3eb8dc187e29
28209 F20101107_AAAXQN pinedo_p_Page_191.pro
1a37bc1686e8564788e49771e2cb6395
176d416fed2308c0a8fea578f41c7b8626d89555
34273 F20101107_AAAYNG pinedo_p_Page_126.QC.jpg
c392c91f6d640cfa05c62a5d763d135d
b99d3a72b637142201f838b6e68d61f5ef80ec29
54731 F20101107_AAAWGJ pinedo_p_Page_208.jpg
8062f2878a2d027da0a56ee930e4b7d3
62ba2e65eb3519619c187ef6aa59513916bc4ea8
F20101107_AAAXDC pinedo_p_Page_080.tif
9339d492095cd60cd7b0fc6ecc34aab9
a863abd302567577cf57b631052d078a8d9a3f6b
1051889 F20101107_AAAWTU pinedo_p_Page_081.jp2
07190b1e1f8ae03c63349bde87ba86df
2e2911c551016081263a8aba108046ccee1a33db
16123 F20101107_AAAXQO pinedo_p_Page_192.pro
5dc359ffde967e6105a93669082e49d4
d1e2e4d1e169825c89e091f9f2a7a1c5c09cd6ea
33294 F20101107_AAAYNH pinedo_p_Page_074.QC.jpg
4a2c9637f4d5acf858de14f1db140483
159d9c5ed50a9acff5e8ec80f938f73064431663
9059 F20101107_AAAWGK pinedo_p_Page_231thm.jpg
72bbe97a83641fe33e8bc193e831badd
773275afa7682f7ffff5813935f9e968f50628af
F20101107_AAAXDD pinedo_p_Page_081.tif
9bb2a4e8f1df48cfba77ffaf2abcf409
32c664eb1fb3d2940145e1ad12fab6a0ff7a758a
F20101107_AAAWTV pinedo_p_Page_082.jp2
ef97acf4b8cb6f39e62b5a9b34130e91
2ff4f89751ff1436b851f9244fba3a42138cab15
7436 F20101107_AAAXQP pinedo_p_Page_193.pro
0d250ec111c012b8fef188cb0bca1bc1
92d0feb725c4b0afa63c3121be272d4385df2108
8457 F20101107_AAAYNI pinedo_p_Page_185thm.jpg
2915cba6d0b9eac03a6a604bbd6110ca
4dca42ef7131a54beff401cb55793b4ce3bbf91b
8835 F20101107_AAAWGL pinedo_p_Page_026thm.jpg
f293c08139e193703cd42167b9ec2eb6
2a0c79e472ad628cfdaaafe5444c76ea3af275c0
F20101107_AAAXDE pinedo_p_Page_082.tif
8f3554ad122d4c0098e1b5c7758ef06d
949698d30872b1ebc3dfe66a231e0efa8b478e2f
F20101107_AAAWTW pinedo_p_Page_083.jp2
9ef9bb224c255de2331c59f07eff973a
267300119926d1d4c9fbb75f3ef3c7219381bbb1
51532 F20101107_AAAXQQ pinedo_p_Page_194.pro
e6afdee5b7fa591af907da04ae5af9fe
c61c4bd45a5c016d6b5b332fc6ddde86e5b82cc3
7742 F20101107_AAAYNJ pinedo_p_Page_109thm.jpg
8f89ec354e0e7e974d7782f783bb48f0
3c5fb78e7b7a1c576d2a058c5be49f0fa3cc2343
F20101107_AAAWGM pinedo_p_Page_242.jp2
e6a9532641ca95160d6d5564c875aa3e
456d73b1f921c26cfe9a711b993e46cee273e39b
F20101107_AAAXDF pinedo_p_Page_083.tif
4ff9079d6ab6937dfbdc303314c0e60d
3b0332ed8c5e47e4f0f62f40e384a8eed6224050
F20101107_AAAWTX pinedo_p_Page_084.jp2
05d05042cd73b5433f2d3cac4cf99c52
0e819aaf1d2bc1c1e0bc7471880092380af8bc74
53093 F20101107_AAAXQR pinedo_p_Page_195.pro
648295e41f6182cd107a305c9da2adc4
9286b165589bb96235fad3310c1e31621852f261
8014 F20101107_AAAYNK pinedo_p_Page_197thm.jpg
a80ed0e47a01f3417109df603cc5e2b5
ad438cdedbfd3fddf302012198f716872a2ac8d3
112978 F20101107_AAAWGN pinedo_p_Page_069.jpg
db9d4ea89481385074a2fb3df9846907
0a1c3fc7a5546ffdc79fd7ced5fa53b7172d432c
F20101107_AAAXDG pinedo_p_Page_084.tif
8d5ec59b84eb139a916fd9b43a801434
d218206414a5d34eaf43a658e96dc553a302870d
1051891 F20101107_AAAWTY pinedo_p_Page_085.jp2
861510d374baca3a56835693cac6cfea
5896fa80e1d716bdb46c7879998c6685c60c94f8
2096 F20101107_AAAYAA pinedo_p_Page_200.txt
9365712ace834a03e7599ffa41a65a0e
3db058715a7eb5c6969bf6053149f9ff32a948a8
52045 F20101107_AAAXQS pinedo_p_Page_196.pro
ea91ffda30a1e971fb931a2ceb502776
2b6a5886e86979289771335b2ce6ea9f53c393e7
33547 F20101107_AAAYNL pinedo_p_Page_185.QC.jpg
e457025fcf7fccf026a2778db9a81f49
d92fff6159085d22f1768460b27886ae6375026c
8908 F20101107_AAAWGO pinedo_p_Page_025thm.jpg
ab1e3dcdb9b6897a4b64714648846881
2c30d745f1362f66c910b133ed204c3fd6246678
F20101107_AAAXDH pinedo_p_Page_085.tif
2738df3afec4419a6b147dbc5acd0f35
5156b672e569e00a005eb147a55c818c68054c83
F20101107_AAAWTZ pinedo_p_Page_086.jp2
1d69d658ee52e0932b92aea4bc0c31fe
50a69a388efa957525d78c2a3776264c18e975e9
1781 F20101107_AAAYAB pinedo_p_Page_201.txt
cceaabc0273459ed0a38f64cdf648b20
c621cd6dab06b0cc130ba17671e743eb39ebde1f
44058 F20101107_AAAXQT pinedo_p_Page_197.pro
f78e2feefaf5763642513daaf0d323c6
a4effdb1d7003df195cf1eeb8d0fa753631f95f7
37813 F20101107_AAAYNM pinedo_p_Page_164.QC.jpg
0dcdf79e52e9587a091002e2806548bf
5640798f68fa0ae91f7f3daa1ce7825832bc241b
1051949 F20101107_AAAWGP pinedo_p_Page_064.jp2
ad46f1c996765fa3a7513446fc56295e
05a0098d7a7e0a0e26d414ae4d7b0ecd0162c57a
F20101107_AAAXDI pinedo_p_Page_086.tif
13d8449228faa98764999a1872195cb6
48eeed3bc3b6777dc9ec17fe9c2286618ffcca78
1851 F20101107_AAAYAC pinedo_p_Page_202.txt
d7f6a7e5481cca5e7c4745dd15b1eec5
ae79f679b774ff63a1b015382305aa635fc0aa78
41509 F20101107_AAAXQU pinedo_p_Page_198.pro
7db8b673e4e6dc0329761b8e2311b3bf
8ba9ba9a44b04d669a08def0850f1d5c3f53d082
34720 F20101107_AAAYNN pinedo_p_Page_081.QC.jpg
8675d63e85bcd567413742f313fec220
07c92f6278ad2696fd9d997e00c862ce9c5e5434
36440 F20101107_AAAWGQ pinedo_p_Page_121.QC.jpg
dad88291509f25058528452c7d78ced8
58dd8ba4658c6a0b9c6354ff2757d83d03980f87
F20101107_AAAXDJ pinedo_p_Page_087.tif
32facccaeeb52f7cbf6455e5f62e25c6
772ca014b7cbdf7a4447dec8d218dff7d58ef7d0
F20101107_AAAYAD pinedo_p_Page_203.txt
3513b6567c7afe1e2287c26bef4f8fe8
79a27b8e7406ea78204a89d8ee6bff317053ca99
47878 F20101107_AAAXQV pinedo_p_Page_199.pro
ad903eb996cc5e56fc808b0e3892637f
3d26db07334a8464a7563ca4f53a254e92ac5e26
9462 F20101107_AAAYNO pinedo_p_Page_225thm.jpg
4d7c6806607b6b1088a6816b728118f0
04a7357e139714f9664cf0792e2a46cfc1d53c71
1051929 F20101107_AAAWGR pinedo_p_Page_185.jp2
92115d6d7f5893dec8933c1da62a007e
8854aa9b7dd0e994af7d9892cd0fb1bddc6b5742
F20101107_AAAXDK pinedo_p_Page_088.tif
1e754a006cbdaeb5a59767b49d41b4dc
424f5ba7d7f4423710f65676e70e6aff31a731a9
F20101107_AAAYAE pinedo_p_Page_204.txt
d22cb232ec2eac850d9f9802f7be59c3
bfa03885076a45c9d7508c2f5522db704b498acc
53212 F20101107_AAAXQW pinedo_p_Page_200.pro
6ae7a98a501214f26804ef72296761a8
7a5881dbfe3c63d717c7b28a8df96251c600604a
8622 F20101107_AAAYNP pinedo_p_Page_116thm.jpg
14484cdd125bf2f3c520fa58d2cf091c
ff2e574d7cf0fb1ef64c36d00faf5848a5c3c98d
18300 F20101107_AAAWGS pinedo_p_Page_013.jpg
42fcce5311697bd944ea5622f750f933
fe4e3438eb68b55bd06e35a0b2635e0252bbb44f
F20101107_AAAXDL pinedo_p_Page_089.tif
854ce60f67716eaaaa3c51e7484d3316
b271d0b1fe76f8179140fa3fa5524e18cc7b2b91
1767 F20101107_AAAYAF pinedo_p_Page_205.txt
704d43c3cbfe2f044e9b96db8d97c9e3
6aa429b99301f36268f945a30e497b3cb43dc84b
43526 F20101107_AAAXQX pinedo_p_Page_201.pro
41c473f0a3419255146da1987d834cfd
10a76a2e32f6b9d0bde5f0f75a186012ff47cf4e
F20101107_AAAYNQ pinedo_p_Page_199thm.jpg
68801f478557a85001eb2963fb0f23eb
733f12c2429abb97ad94f2401f6cb964a7e77778
F20101107_AAAWGT pinedo_p_Page_096.txt
868fa674866072a9277ce6a7adb576fa
55e8e5ca5163d2206ad40ae82901f447b363c2ea
F20101107_AAAXDM pinedo_p_Page_090.tif
09fc57007fdbf8c0b050f328c1cfdad8
6ae7873075155d4a08477d6b2ef027c49666a933
2074 F20101107_AAAYAG pinedo_p_Page_206.txt
9e3d268a6a9fb946e8b8ba1171d3fe3e
44c7b2130bb900503c21df3a67e1bf5e12009031
46284 F20101107_AAAXQY pinedo_p_Page_202.pro
8d5a13d5b5ad4cb4470aceb72626ceb5
b099b242948d2a83b3c089f04b31545a9e6b89ca
8615 F20101107_AAAYNR pinedo_p_Page_183thm.jpg
ca1597c82dceb9d8cd509b68eb3bdfc0
d9314a3ed843044874100c423a612e8730365a94
8456 F20101107_AAAWGU pinedo_p_Page_122thm.jpg
87fa981938b8acc8d5c6f9a3997abbd0
6ffd63c7d0dc1cd531444e312058a67862d9bfda
F20101107_AAAXDN pinedo_p_Page_091.tif
2a8c538a5f0232910dfe3594101c1c95
fc4ed03fa9e057fc71e3e0fa9ebf7807038a2d1c
F20101107_AAAYAH pinedo_p_Page_207.txt
d279b6a94b6eced2b97b15c97ed3e748
d79790ec25f2d9cb915f9182d8d4afeb697fc012
49284 F20101107_AAAXQZ pinedo_p_Page_203.pro
4bb86b23798c030300d9cb4bb60436a7
7a1438bc14933c749738562c6c624eb4c35ca978
7619 F20101107_AAAYNS pinedo_p_Page_135thm.jpg
a0df005e138b27b20d48b72a11ea53db
24e08af38cbbae9fe24e2d02a431fd79137cfad4
54427 F20101107_AAAWGV pinedo_p_Page_167.pro
3abc115ac4a7a86c184a08112e465468
b9de1216f2a9169e06f4c1a515a0bf046a090e2d
F20101107_AAAXDO pinedo_p_Page_092.tif
1a720b065b966b81b3c05874dcf77ae2
7813f8f796a0cb96f32711d799bad329b21e0340
1161 F20101107_AAAYAI pinedo_p_Page_208.txt
0313139dbf2eb533abb8a2bfb236bfe1
bbfaade782652f661001d24fe0b1b321922de162
8572 F20101107_AAAYNT pinedo_p_Page_130thm.jpg
94587d78186728fab9e602e679253596
6149b3cc3007630e4a4d14d1649d4aa47ae87a23
1051947 F20101107_AAAWGW pinedo_p_Page_218.jp2
2d8c52c003ea1b0d7eebcc5b1908811c
d0f56c3f45bd52694b2067e658773e3d379dcf90
F20101107_AAAXDP pinedo_p_Page_094.tif
479aef0f481966d545cbeaeeaf90b740
cc14fbb9bb7bd426d9cd1f3e18e25df93e501f7f
974 F20101107_AAAYAJ pinedo_p_Page_209.txt
256ddabb8df4fc438d95a6baf95937cb
38a3a36eb076b9a543bae69308f0e557c2b2a884
4679 F20101107_AAAYNU pinedo_p_Page_012thm.jpg
f1bcffffc23b0237ca06326d084c1603
69df41dd618305828db1021365083877ada6ce23
34090 F20101107_AAAWGX pinedo_p_Page_184.QC.jpg
a328b4795205b384cd2b8c1c735d596b
4de3a9d82735dee3763d645ec6ac64e35d6b16fc
F20101107_AAAWZA pinedo_p_Page_219.jp2
9c33275d0eb3e7fb49c0eab081e55b2b
e5f31deebe879db0d16aad17fc0d5e0bd5eadc79
F20101107_AAAXDQ pinedo_p_Page_095.tif
f8e670ab87f4578bd0dccc9095f2dc81
159371450f9401462a24095d9769d9aecaed7d19
842 F20101107_AAAYAK pinedo_p_Page_210.txt
7afdce64a4332916811eab435bedf1ec
965bef790b5f9140c482b983a6909e218d3d1920
36895 F20101107_AAAYNV pinedo_p_Page_026.QC.jpg
2418a5c67bb42dabdb80d5d75f6e1613
0b13a9dfe810889511a045d6444eb50791189d98
9056 F20101107_AAAWGY pinedo_p_Page_195thm.jpg
237b94e5c9864ee32af18d4720adfdf4
ce46bdbe5452a36b5bfa6c5919684d7595afe6ca
1051928 F20101107_AAAWZB pinedo_p_Page_220.jp2
4e89d65b20bc3a052ed646a62cb580a4
c98ca0650181592d6746230607cbb7060e732e8a
F20101107_AAAXDR pinedo_p_Page_096.tif
76a2f2350c1785d7ae4cd2bcf5b1e075
a6e90dec3b8ec6d25678b1dd1d46c6904d7eb9ea
831 F20101107_AAAYAL pinedo_p_Page_211.txt
09f0f10fc5d1e505414fae22c607c8e9
b917d3a331ea1b6328799177d15b5fb3b0c75010
27873 F20101107_AAAYNW pinedo_p_Page_151.QC.jpg
746f7ba1dea083cdb153ef618ee02148
b109761d8f7f724c9941e86db708c368cd96fe19
1051944 F20101107_AAAWGZ pinedo_p_Page_028.jp2
25063b9d3011421a8052d1b95d00c6e5
3ce5459ef5971e8ac78b820b17a54dff40aac62f
1051961 F20101107_AAAWZC pinedo_p_Page_221.jp2
2051413edafd3a114b9796cb0003d368
78e2312921f12b8946fce69960e75afb1a41579d
F20101107_AAAXDS pinedo_p_Page_097.tif
5f035cebb98625f1f09a45283f00357a
3c83e753be3231b611879167991c480424856ff2
1227 F20101107_AAAYAM pinedo_p_Page_212.txt
5d39b1d94fc13b00851973e6f972c3a2
cfb33bf7f67a71b9fa630e0c2955349b79a31217
35740 F20101107_AAAYNX pinedo_p_Page_085.QC.jpg
4ba2043097d925a1a5ab944bf099dd20
cc57dccaa6ee9d8840a42ac03e7c8bfe47b97642
F20101107_AAAWZD pinedo_p_Page_222.jp2
3ffafab41b968e3ad95077ca7b7fad62
a5e570e42805d4f47b3ab40b48d3a752e04c84f6
F20101107_AAAXDT pinedo_p_Page_098.tif
ab386674b45f9734615229ab1438ad0c
6ee046b7eb2718a6ac24c6ed6adc3eb50ce5dc52
F20101107_AAAYAN pinedo_p_Page_213.txt
dcada4e308a546c1479dd095bab28d0c
ca0e04f1712c8e9e1adfceda4bd932dac6c34f26
F20101107_AAAYNY pinedo_p_Page_030thm.jpg
017366d390bec96b150a6b6d75db7140
be859de975c7542656d5b9cdd84db0acee2de46f
F20101107_AAAWZE pinedo_p_Page_223.jp2
c4a184620c136ee2bdf9734540ddc469
6a9d3ad3be5ed1ab96c9f87c2187ae42aeabb1ac
F20101107_AAAXDU pinedo_p_Page_099.tif
06b86cc875fc72e51a881707139a051a
43aca86fa428bdd55eff1222fe8d30dda49a6fe9
2971 F20101107_AAAYAO pinedo_p_Page_214.txt
47e1e1c6f77155480ce5edf80e0bc2b5
0dce8edfdcf793d90c55ad92a525e04a248aa5ab
7780 F20101107_AAAYNZ pinedo_p_Page_072thm.jpg
5f9b49ecec851f421d6f20d16b1015bb
4d414dc57a4478d4ce10de5cbbc6c57a22cc5524
F20101107_AAAWZF pinedo_p_Page_224.jp2
83b94799dc4fd0608c8ed741aa62b910
fb759b16fbb1e1dcdf0b935057b01992ecbba5f6
F20101107_AAAXDV pinedo_p_Page_100.tif
02d3b52588ee2c34bbe64888b0ae61c9
cd8648f0b8ebef0078202f6d28840a3b5813a35e
2755 F20101107_AAAYAP pinedo_p_Page_215.txt
91b06e49ad2f85b078d52a4a8060e076
100ca325d032cdae787b52b03c6e95b81d838790
1051890 F20101107_AAAWZG pinedo_p_Page_225.jp2
5c5cf8c6d52d91c7100cc94f085ffce3
ec21aecc17190bdb2a0cecc38ab344cb5856e59d
F20101107_AAAXDW pinedo_p_Page_101.tif
956c7d20d3340e7f13680e71daf59a70
d481853d53d36f222c7946265fd088113414dbc3
2010 F20101107_AAAXWA pinedo_p_Page_091.txt
09fc50a3389a34347731dfe6e94b4f4e
12b98a4430bba0e12e848846074f79f3cb9fca2b
2656 F20101107_AAAYAQ pinedo_p_Page_216.txt
57bbda2f59a1828621960d63d15737a4
1484d9ec2770bcb5b046b10e9e2569083f53d511
1051943 F20101107_AAAWZH pinedo_p_Page_226.jp2
d6551eef4d598124158f85ed1cc0e80e
28a2dd3a2bd2b90c0300fe92e1fbdb74b55b6213
F20101107_AAAXWB pinedo_p_Page_092.txt
1a9bda022c565071159b60933a78acac
ef949250d60a4e67cbf9167a854c49ee88672d0e
F20101107_AAAYAR pinedo_p_Page_217.txt
eeeb8e6ba063d7ffcffc86d9d56313c4
06dd105195e13067582ab394c42a0036e83daf2c
F20101107_AAAWZI pinedo_p_Page_227.jp2
0d706527666efcc6337e2767bd2ceb3a
fa91bb1048be844a287d5908dbc95832977aa412
F20101107_AAAXDX pinedo_p_Page_102.tif
2a4e635a995067731d8ca825704b0cec
bb448ee55cc0dde16b03ed1c2f093ee3fb26c4c9
2008 F20101107_AAAXWC pinedo_p_Page_093.txt
effce152ceb4ba0e139e4dad0e78338d
895fe41dc744b0dca410c92d7d79da9a33728720
2747 F20101107_AAAYAS pinedo_p_Page_218.txt
955f436d0600cad5c89e458810cfdd53
03598a3176842758e3a0d14d1e74203511b0fdb0
F20101107_AAAWZJ pinedo_p_Page_228.jp2
9fa097e09d74627a90af1fe90201be85
9065c8ca2cfff985efb763493f4fa9f0a0a04e0b
F20101107_AAAXDY pinedo_p_Page_103.tif
f9d08ebe9a68abfe4f008cebd9e2367b
24df946b8080faf8493988e72d52b4d5312682a5
1830 F20101107_AAAXWD pinedo_p_Page_094.txt
d81f33c46f53358bb2c03aa8fcfbeefb
d2e4ad7859b4bb9a5e61681fc0f46da942be4d5e
F20101107_AAAWZK pinedo_p_Page_229.jp2
9a0efaf11b5707c24fdfbc27912f7dcf
95f6e1231542b91b3c68941b71be4f0d0a93aeae
F20101107_AAAXDZ pinedo_p_Page_104.tif
c30f563644f5ef1d83233fdc2d7389db
d65e273f47a993498db994ca03457df5ec39b679
F20101107_AAAXWE pinedo_p_Page_095.txt
b275ae32b2abe198b022f5e45face051
4f919ccc508d885233ac3f7ce4b0ca73b2c0adc0
2923 F20101107_AAAYAT pinedo_p_Page_219.txt
b07555399bc6caeb916ba55cc96dc708
4c4b27e970691091db78cc3cb84ae41fde7afed9
110599 F20101107_AAAWMA pinedo_p_Page_117.jpg
5a2b9671573fe6806c00e4f2ea3fdaec
384484ae03e4f50db14bff901b0f535426a796be
F20101107_AAAWZL pinedo_p_Page_230.jp2
7e66001c7464d634cee8759e8c9f6330
c663da7ba52addb00bd3868ce0ed98a555e24152
2051 F20101107_AAAXWF pinedo_p_Page_097.txt
e12a99f83a1c1d6ca22535098261f774
fd13c5a376f5a3ccf2783bb5d8878121c1b70eeb
2875 F20101107_AAAYAU pinedo_p_Page_220.txt
abdb3bc355ed1002cf4d7ff46023a314
5ec3bc8f0e18a7a7a54af860f275f427c998feb0
1051935 F20101107_AAAWZM pinedo_p_Page_231.jp2
f195d852f65a63828171ce547bda8a75
fe205a1496636b834efc357c3e76836edbdcf8d5
F20101107_AAAXWG pinedo_p_Page_098.txt
4be64577eaa89dd7028a766099b71bf9
03263fe9cd7387e4d93e9fe8154c5aae2ec9b90a
2942 F20101107_AAAYAV pinedo_p_Page_221.txt
bc838ea65d60a9633d4d0e5a74af8bec
019da211ad94aa6b396520e05ed6d1aec521ae16
103808 F20101107_AAAWMB pinedo_p_Page_118.jpg
775e9b57880e0c6f4ea4bfbe512c6400
7637f829e5872c07c6e2ac5d464699a2e8319a40
1051967 F20101107_AAAWZN pinedo_p_Page_232.jp2
2851e184ec091dbfddd49ec62cb4f247
cce1aea709f33f78ff9296c4d9b75d72ae34edba
29935 F20101107_AAAYTA pinedo_p_Page_201.QC.jpg
3fe4c763f4b1f51a5b850470094cde5d
ddf9335c3d9977a1d48ae2b9c8e2c0b09ff7a338
2104 F20101107_AAAXWH pinedo_p_Page_099.txt
856dfce3d96d0d239fee215d2515e6b1
7dd01c598c2054774162ecdcb99ea8e1c0584966
3194 F20101107_AAAYAW pinedo_p_Page_222.txt
18bfb03426aa7e7b4cb2ece26dbfb9fa
57cd42e71cee5144a5ee2d9756f796e4239abe36
109027 F20101107_AAAWMC pinedo_p_Page_119.jpg
1cf43c2a90d06197b7090055f55d03ae
75852c47649376dc5f70fd70759cd1a2381f8f4f
7356 F20101107_AAAYTB pinedo_p_Page_201thm.jpg
92ef0c7ba449751d0cf62f8abbf192b3
b7244c25a2c3056ec74a2b5f2aaa987b2f2cdc19
1976 F20101107_AAAXWI pinedo_p_Page_100.txt
f5e5bdb645e41dcc8fbf1d88764a8710
500db8e988f716c9bd93643bb51253555d1be754
2839 F20101107_AAAYAX pinedo_p_Page_223.txt
3e2862861b7ca8223b5f26d0112be1dd
206fa20a92addcb91035dd1b1a092021f91bc49f
108304 F20101107_AAAWMD pinedo_p_Page_120.jpg
630e61a87f034c8da8f5a46679d2072a
b50f65d0bf6574cf11ae8e140cc7fbfd0da8f515
F20101107_AAAWZO pinedo_p_Page_233.jp2
3affb449668ed7f6e0f221284e439d21
f3ab3f2c1bb8aa5146dadbb9f7f3e99e775ed2a3
31752 F20101107_AAAYTC pinedo_p_Page_202.QC.jpg
26573c8f9f2516d65878d1747b0327df
31d0ebc54aef9b8d1ca9779ffc2f2c107ec32ec5
1951 F20101107_AAAXWJ pinedo_p_Page_101.txt
8f8bf92abb7290a3829664630e40891b
7077b7ae374da9e9d7b228039bf1b20168a82edd
2712 F20101107_AAAYAY pinedo_p_Page_224.txt
f50a2126603575d9395a5b38c57ee998
6da738ad9557b219f6cb4ded7c6078eb5ca1141d
107530 F20101107_AAAWME pinedo_p_Page_121.jpg
1f7889b94a51ca197fbc713030c5b68b
7fc783cf2a2b2dc331daa4ed6ec74f108c790843
F20101107_AAAWZP pinedo_p_Page_234.jp2
51f0d701d77ccfc5a299bc1812765ac9
da9b19650aeddc0eaaa53273dc4037ca3a99edb8
8092 F20101107_AAAYTD pinedo_p_Page_202thm.jpg
59948ee38310a116c15406c0a8801ae2
756e0d14af68043d8adc8d9078757f38324a0a0e
2949 F20101107_AAAYAZ pinedo_p_Page_225.txt
b0b7229ca5ee3ed60e2e49e83de85220
ce5280d9a30e5473b4edd6c49ed27f3b7f5dde88
105863 F20101107_AAAWMF pinedo_p_Page_122.jpg
997f399e5e916ae6cd9c200ea242c265
72ce7fbb7e792c01d60f94b8b56fc404c561386a
F20101107_AAAWZQ pinedo_p_Page_235.jp2
58125db4b0f9cccbb427156964306ec8
d2c45210e0b444e2f1afcad090ad83043091f4dc
29320 F20101107_AAAYTE pinedo_p_Page_205.QC.jpg
dd8a34ea23e596ab8f72bc58222844cd
8de9994c6c8ab89798349da14e1db1be69ccb5dc
2144 F20101107_AAAXWK pinedo_p_Page_102.txt
5e7fcbbdca6bb03f90b21fecc20e731a
6b9bf407c47a55e26e959d4f66b56f2d1a2d815a
106265 F20101107_AAAWMG pinedo_p_Page_123.jpg
14b311b894c900a1ca1d5aee9e316dcb
1ce90be4adddaec517efb4c3da67287fe3f90c0e
F20101107_AAAWZR pinedo_p_Page_236.jp2
8d35a3a898d0306d6e173f739108ad41
608266d414e2ec1fd1d67d7a21b598a9b1ef26e3
21659 F20101107_AAAYTF pinedo_p_Page_207.QC.jpg
800f6534b82a5b206f3f49f703365f87
e9c5ad0b80798ae15b6e7856167e8dba3860415f
2030 F20101107_AAAXWL pinedo_p_Page_103.txt
2947b7387eac25474d9dbeac9f47a0b6
e8a9cf61daddc9386f394524daf76d77f81b37ab
104246 F20101107_AAAWMH pinedo_p_Page_124.jpg
9065585ebfc465a235a45e491eeb60f7
1e86d6728b35087019036b3d7c0d9fb1ead6cf3b
F20101107_AAAXJA pinedo_p_Page_236.tif
8c92af8abf8679161267ffd696a9e913
6117e970d23f81d4a2b9765c332c156bdfa9ae02
F20101107_AAAWZS pinedo_p_Page_237.jp2
4543fe615f3ddcee8df221822b72e152
4c353e452c4a5705d94479834241513da12cfb56
2087 F20101107_AAAXWM pinedo_p_Page_104.txt
a85da7a3d022df031eb387a03547e42a
aeea7c6fce2f3f7243968c6868eb2b6d1346e8b3
104714 F20101107_AAAWMI pinedo_p_Page_125.jpg
004ed6975150300a049c217b6ac54d57
cacdcdadb217c07f9cdb00452e17b42b27731c0a
F20101107_AAAXJB pinedo_p_Page_237.tif
ab176235d1f072da2108e22081e0666e
807709b6c416c711a513b946187725d59408cd6e
1051914 F20101107_AAAWZT pinedo_p_Page_238.jp2
b547b9f688c742514e4ea02f595504a5
9c6115554648df6262b40648368671a74ca99e7e
4094 F20101107_AAAYTG pinedo_p_Page_208thm.jpg
5be79f4945743e94b65ef4694e6671f2
511b29ca7bd2401d75c1fb78fc733924a6b3be35
F20101107_AAAXWN pinedo_p_Page_105.txt
4ec0325e154497535d91bf456258558a
61a433582cb33b77a702e27ee70ac68ca4d28fa5
107219 F20101107_AAAWMJ pinedo_p_Page_126.jpg
b759863db1fbcf4c0fca3315e5640c23
114c7222a23331a13393e5a9231380e1f8c52028
F20101107_AAAXJC pinedo_p_Page_238.tif
abe6d083d4a356ccc96147f3833bc9c7
44ec055791357f0f375b8ad63bb1a62d309a06de
F20101107_AAAWZU pinedo_p_Page_239.jp2
20a959b2a9a9e27155c6252de9acb4ab
6c2c725037ec8abc641c43adf9995c0f6f13232f
2640 F20101107_AAAYTH pinedo_p_Page_211thm.jpg
0d4523c4d767cbd2766052562f5556e7
ad30947c026d62a0d72a1fc63635003d78d3fe8e
F20101107_AAAXWO pinedo_p_Page_106.txt
db5b171a5f32064833acbc69115e6dd5
554c1ce4e6838925b4dd822a2bc94fed60d71617
108901 F20101107_AAAWMK pinedo_p_Page_127.jpg
2aa1dbbbbaf988ece8d322c251a960f4
2376ffb8906d20e83b89abeadea764d2105ffc6c
F20101107_AAAXJD pinedo_p_Page_239.tif
a7b88245f1336b6feb8ecc7e2e2f881a
59324f01379e0f91006d1b8ea9875ac133de1810
F20101107_AAAWZV pinedo_p_Page_240.jp2
b2690dabebc43da70c0b01123b7a6d2d
29857e982e3d7af4a8dc88f9c69a11b0b80d64f0
13884 F20101107_AAAYTI pinedo_p_Page_212.QC.jpg
8ddf49a9df27f35e60d4ac5f8f408baf
30bd220a7b50cd78b01b23a0bcacdcb0384f7c75
F20101107_AAAXWP pinedo_p_Page_107.txt
431279075c61bfd5c56649abfad6732a
724229816214f534c7e47035331c4b95b00ca164
107328 F20101107_AAAWML pinedo_p_Page_128.jpg
d36b0687c0b36094ca740052ec40d64c
3436cb97c3ad34e7847db01c21eed81cd3c01d4e
F20101107_AAAXJE pinedo_p_Page_240.tif
b59654f5eeba966a47c5428755101eab
3391698dfb7d0ba85de646d59e2ecca6f7633948
F20101107_AAAWZW pinedo_p_Page_241.jp2
95f1d011406962fd7b36c4e10b746266
d605351ae13c0d26fe100de937a2efa632eaf425
9086 F20101107_AAAYTJ pinedo_p_Page_213thm.jpg
48fcc99d41009063118ba84488cdbaf7
d2005cb8158e25d20f7aa0d0e59cf69440780734
2054 F20101107_AAAXWQ pinedo_p_Page_108.txt
a9373b01912729da1bd68669d32df192
98aa59106363b094758c9070b83b3167856a5149
99339 F20101107_AAAWMM pinedo_p_Page_129.jpg
fdf7c806d7dd760ede5148548d36a66f
7deb9caca5131c96f49e394f823bdfd99a8433eb
F20101107_AAAXJF pinedo_p_Page_241.tif
170d2cb8a04c8a26ef5d06bff731f03f
7ce285998e750fea98cf0fdbfdbc8de22f5d13e5
1051973 F20101107_AAAWZX pinedo_p_Page_243.jp2
289932d819f4c1131b1416005d926312
67db47867a49bd4f5a014c50af7eb6cc593310bc
8936 F20101107_AAAYTK pinedo_p_Page_216thm.jpg
e96a12da96fe91e104565564754dfb52
75d83dec081332284eaab41d3402118ae74c2728
1915 F20101107_AAAXWR pinedo_p_Page_109.txt
15212dd59f21725405b2d98e4ba02e5d
48ba667cce6fbbfc4aff05c9539b8fdee99ba3e6
108726 F20101107_AAAWMN pinedo_p_Page_130.jpg
ab824d5a70cb864c84a071480341ff8f
d5d4cdd1e7358003d5077eacde14a874c2b2ce00
F20101107_AAAXJG pinedo_p_Page_242.tif
caad897ff0f73dbf0ad5c5ca50613e09
05b574a93d2b955551f86d1e7219b344159fb6be
F20101107_AAAWZY pinedo_p_Page_244.jp2
58cd33625455940900cdc11f0f5a50b0
df82b2f04e1604b6e0b73b139547b2519fbe37d5
9282 F20101107_AAAYTL pinedo_p_Page_217thm.jpg
aaa7d873dee1912036cb137aceac4b2a
a9bb1a0b4749e8b027b052f25bfce7b550301a47
99324 F20101107_AAAWMO pinedo_p_Page_132.jpg
5247f6ef6d11b09c126bdc9de7ed749b
7096d7749af5ededc85760ffa26f6435497e9c1a
F20101107_AAAXJH pinedo_p_Page_243.tif
570d5c4820b38b442036677e81fe6935
3a581aade7cc4e931112781be325895f80960311
186643 F20101107_AAAWZZ pinedo_p_Page_245.jp2
81d851fdecf201edc62cf20ebe13ed5f
8938af2c895e56e8c9634b3e12d0e59d5d497534
F20101107_AAAYGA pinedo_p_Page_188thm.jpg
163250ba6a4b86209e5d0f8fafdfd5a3
369b9620c06cd02d8a3b16364b6d5242301d6545
2205 F20101107_AAAXWS pinedo_p_Page_110.txt
1617211080b2213d51b9624c51185c79
02b2b17bbcdcbca1d135d6ec44795a9b1853b59e
39282 F20101107_AAAYTM pinedo_p_Page_221.QC.jpg
d570aef591f445d6626fc4bda5e44461
77aba0a14f9f98b786f553c69e5a8d22bfd9f644
99794 F20101107_AAAWMP pinedo_p_Page_133.jpg
90afd04bf4e8db1fa503becd72404716
c9e7ed9a5514641bb12358a6f1ed1968ace3b8f0
F20101107_AAAXJI pinedo_p_Page_244.tif
d4b265e2b94986f70780347341f861ef
b8c1c0d925ca08ca928908244755310b33d3a5be
9114 F20101107_AAAYGB pinedo_p_Page_149thm.jpg
097f4efa0c2df373555b2ddab7635269
aba3e8c06c6ca2d74bf7b2c027d78d36e37089f9
2062 F20101107_AAAXWT pinedo_p_Page_111.txt
db33ebe6133136469dedc10f2d8ce181
ac1b0be58a200bc5ca1ce5c77794cc07eda95f8e
36617 F20101107_AAAYTN pinedo_p_Page_224.QC.jpg
7c98ff1b9f4a28513c9d672a365b9cba
adaa8b1cf0ecfb09f51536066d1247202c64935b
70317 F20101107_AAAWMQ pinedo_p_Page_134.jpg
7e542cfef6d4556404a3b6f9bf2d6c39
f7532c5d8484e617215b691a75e91457c96279ab
F20101107_AAAXJJ pinedo_p_Page_245.tif
a2c844de5274e93e1ae6a3c0e08ec2a1
68376e201f9bddfa74da039ad27fa85b60558b1e
33238 F20101107_AAAYGC pinedo_p_Page_031.QC.jpg
07a748fe6f44de0cca3930700195e8ef
187774ff75643a113750cfef84b60911503c719a
1913 F20101107_AAAXWU pinedo_p_Page_112.txt
390800c1dda996782dfabbc4f2795ae7
94011df646a921f493d2cf2ec85cb62450c5a363
9102 F20101107_AAAYTO pinedo_p_Page_224thm.jpg
a2c1de86fc1dc238ef98b4569d5fcbeb
b8991208e81da3aaca0461a79b26243edd6d0ec6
90141 F20101107_AAAWMR pinedo_p_Page_135.jpg
64c65678ae7ce00a87914479d2e76411
0f3aef5899da0041c40bdf5a6e84bb6ec460105a
F20101107_AAAXJK pinedo_p_Page_246.tif
ea1ca32a3843912251a4f5ec5f11e73b
c92ebfef377ef66261c74c2e0b6d07afac6302d6
9241 F20101107_AAAYGD pinedo_p_Page_240thm.jpg
9087ce0d7a54ce803908224d831e3517
71651a3bd57b05d8a6b4a162af15e9364e9e6c65
1955 F20101107_AAAXWV pinedo_p_Page_113.txt
818648b6e5faa3db61442d6df8d3e83e
68a975c07d3bcb8f212227cd3112aff02dfcf65b
9531 F20101107_AAAYTP pinedo_p_Page_226thm.jpg
9bfd89ea66a184a0029e516668d3ceb0
4a9c0575bb9bc89fda19e38f0defb382e8a658a2
111915 F20101107_AAAWMS pinedo_p_Page_136.jpg
c4600c2f0624e76f91642d0c8fd45de2
e6f1096a1246ef41f888bda2fce162217e50bdfb
8667 F20101107_AAAXJL pinedo_p_Page_001.pro
0557f6923f0558be25b250cb155d123c
0d8071c78cf0048e99ea0f334b9d6714a892c3d5
8922 F20101107_AAAYGE pinedo_p_Page_024thm.jpg
2fe6fa84e7331355b16c36f4d689dc38
a86f829c4467d9434a334f0a9a6cfbc9ababb060
1928 F20101107_AAAXWW pinedo_p_Page_114.txt
329eb83cf2c1dbfffd739acd6acb8ec5
02c1f51141c6dd98bcab320850ca27dae9094a28
39255 F20101107_AAAYTQ pinedo_p_Page_227.QC.jpg
b305c9f1e3026b0b665e35510761fa3b
f503f781acc3be5f626d42239f5e92bb39c9374c
102812 F20101107_AAAWMT pinedo_p_Page_137.jpg
613fbeaebfecb995e80031668bfb128a
15254f41fe31580630b4c6d0142f44ea4c2d33ab
861 F20101107_AAAXJM pinedo_p_Page_002.pro
02957301296bafa3462e279ce3aefef9
106a3ccbc8364f1559ea9d28ba914762c22162fb
8229 F20101107_AAAYGF pinedo_p_Page_101thm.jpg
04eb9a48aa260bcc63cb5ca7b5172d5f
09ea53cb92d2c55742e25f64fb3b908376b77789
F20101107_AAAXWX pinedo_p_Page_115.txt
82604453152e3a656bbb09f6a3be8688
981fb1f8d8eb4f5f699bcc432b6e88b52b2ad8b1
9362 F20101107_AAAYTR pinedo_p_Page_228thm.jpg
49deb59b4ce8d17c2a138bc044cd8fa8
6ac99d6c73a8cfa92f80289dbbcdac1eace3f59c
114330 F20101107_AAAWMU pinedo_p_Page_138.jpg
7b510805a46cc94cc30a8e279486ddef
5a74a80f46f7299bc714f131b7c8d80422aaeb16
1067 F20101107_AAAXJN pinedo_p_Page_003.pro
ad42095a2503da734f4c1968205b3ca0
e75968de1afd8e6f0aaa03f484d1c54757930a6b
8277 F20101107_AAAYGG pinedo_p_Page_076thm.jpg
8c3b2daee678654b292701165527fd9e
a6854036f82dd36dcf2a9aed600b276a369a18eb
2113 F20101107_AAAXWY pinedo_p_Page_116.txt
77ad02b07ee2b01a5a9c07f0f0138620
49765f8d511932661aa688546944078e21c29080
37888 F20101107_AAAYTS pinedo_p_Page_231.QC.jpg
5a635874162af524cfb115229d517e97
e39f8144cd68beab5678aec0540bb014c45e1b2d
102817 F20101107_AAAWMV pinedo_p_Page_139.jpg
40f1ee335a6e202cc72fb1b4c6b5eda2
a798742cf53848727460587252bc56224710ade8
51337 F20101107_AAAXJO pinedo_p_Page_004.pro
1a89610017e8ebee6f3144d5b71beac1
3f075d8373342b47cec7d8eb7c5e7ddc31e29ad0
31728 F20101107_AAAYGH pinedo_p_Page_142.QC.jpg
8d98d3d3f74e70498d504dbcaedd0680
8a1c75eb9cb0846867c0d918e6d8bc22611dd04f
2108 F20101107_AAAXWZ pinedo_p_Page_117.txt
31714bbfa2363c2d9204a8018511dd21
c0fed3288b7c5eb0ed9205adb3bdd2584b137ee9
9054 F20101107_AAAYTT pinedo_p_Page_236thm.jpg
4ded3fbd28422d9a0211db98d99f6499
439ec111f03ce06d4374404c9d63857f28a6d200
102508 F20101107_AAAWMW pinedo_p_Page_140.jpg
738be79bc164194f07704192506212c9
aa32afe9b8dfe874726a753e322475c80230de18
100767 F20101107_AAAXJP pinedo_p_Page_005.pro
71d27511ff888890b40eaa97879dd4ff
d362a6f7ec0a798510083802545ded324786b964
32934 F20101107_AAAYGI pinedo_p_Page_049.QC.jpg
1b16aa831fc5149719e874d23ebac14e
998644daa39f6aa3050b85d6b7647255c2070c66
37787 F20101107_AAAYTU pinedo_p_Page_239.QC.jpg
07d88bb08b72b4a401d5da1f8be8501c
3626d376363521c00620eb0a0900090476948f47
110364 F20101107_AAAWMX pinedo_p_Page_141.jpg
f81dc9f49c83e75f5e76febc75ef4a89
7ee0181d0479425539039aa4117c717baba43600
107647 F20101107_AAAXJQ pinedo_p_Page_007.pro
3e2cb3882ba9ff2be93f608079a83243
8e6ad7b380b869946206ead0301513abe86b2661
35587 F20101107_AAAYGJ pinedo_p_Page_176.QC.jpg
843f0046426edc155991b22b9d0069e5
7dd94277eae86fecd15fcef205c2247c09ea9024
9096 F20101107_AAAYTV pinedo_p_Page_239thm.jpg
59d7811473f52ddf6376c0b3df543483
5693775851553debd233bf3685902736ca1626ab
92874 F20101107_AAAWMY pinedo_p_Page_142.jpg
d8d83ebf0afadce4b8b68c0ee81ea7fe
e67a02d6611bf90b6ee299d785d4e9ba3ea5efe5
80221 F20101107_AAAXJR pinedo_p_Page_008.pro
2d78c75c4327ed7089a8a7e5ec7d0b1c
55d7bba858c996c6dd5c56b3a6eecb5188dc9ade
3045 F20101107_AAAYGK pinedo_p_Page_169thm.jpg
0695987c3c9b969a657fbbe12fb68d9a
6cb196448bb005c6940d2e6949c033dbef085ac2
37490 F20101107_AAAYTW pinedo_p_Page_240.QC.jpg
d4bdc84616c681f15d03ba68428f60a0
9cd2f2091e5efb89235571cec12b66c15a2f5e38
97512 F20101107_AAAWMZ pinedo_p_Page_143.jpg
fd984e5b29b1e0dba88a9cca167ba11b
661a4d05699295f5146dd31b155393f6fd9240fa
74920 F20101107_AAAXJS pinedo_p_Page_009.pro
ae0a04226189a108ef6956abe6e91127
7bb26df3f614cec3dcde93db3150367351d88bee
36028 F20101107_AAAYGL pinedo_p_Page_036.QC.jpg
28d5f3522f207891490ff9d8cbbf990b
4adcbecdb8919f3f13cb690be0ad731012631d8e
9467 F20101107_AAAYTX pinedo_p_Page_243thm.jpg
3805a93004093b7798000c1f6493046f
710056fb7c257038215af0d90834c2ae28646f1d
43569 F20101107_AAAXJT pinedo_p_Page_010.pro
3ca74d4785546b1b8fcd5fcf9fb756f4
b76edc6157e50f37fcc38c5ac02ebb34e9b453a5
39536 F20101107_AAAYGM pinedo_p_Page_218.QC.jpg
51fba369dda348fbab30e35d3a68621a
cd443f4d44ef89b96db37d0912cf2ae590a847a4
F20101107_AAAYTY pinedo_p_Page_244thm.jpg
b70533b68519b5714e5a362cbf815c40
ee760ad472c24a36475d218f5775a97e7384b709
16061 F20101107_AAAXJU pinedo_p_Page_011.pro
2d2e197b3f5dd513430d0f3e34183def
630a83218e13c0d24be0c42a16f6ada2064913ee
5369 F20101107_AAAYGN pinedo_p_Page_207thm.jpg
65abdcd5bd22318b05a66fb567eed76d
49e5d44614b5fe5d2993abbcdc6756602126e4d5
25800 F20101107_AAAXJV pinedo_p_Page_012.pro
4f28e641518416852ed1a8a15980ed3b
70db45bb1ac0d251f161d33e2a7d388461b28957
38716 F20101107_AAAYGO pinedo_p_Page_235.QC.jpg
b73beca4f389c03bca0c5b5069fe8dfa
cc1256b7cd72b936dbba22f3f24fed1171e9c0aa
8620 F20101107_AAAXJW pinedo_p_Page_013.pro
2eb587031041ded57d6fe29be3671c67
fe1e82d3506f68f17609a6f4c540adbe64f9e5a4
1833 F20101107_AAAYGP pinedo_p_Page_013thm.jpg
f4c9d558bfeaf51e2dde8180bdcc0d85
022f4213304f83a10c0db8a435b185cb636559f1
46349 F20101107_AAAXJX pinedo_p_Page_014.pro
d61579c8e6a93e3a22fe56d160f025fa
1a5e3edd4402e49c95bc382dd13fb71ebe6669ca
39835 F20101107_AAAYGQ pinedo_p_Page_228.QC.jpg
787fae1d3b7b53d1440d59b2a1b36111
7c6999d963f565ad801c0f769296b7bbd82c00b9
26453 F20101107_AAAXJY pinedo_p_Page_015.pro
ccdcabeb8e08ced64de6710bba6e6434
0c0e7b5336b3d41d6d070a5182bc3eb33552aa05
8121 F20101107_AAAYGR pinedo_p_Page_040thm.jpg
286dc2f804bfd6198d098fc90ad15bbd
932daaced4b212952e08d74e06b9a4b949712e39
53436 F20101107_AAAXJZ pinedo_p_Page_017.pro
1e20532d991b3ccd3fc9c49830f595fb
cf0167cf45d9c1aaba0e3aa9923e793b429f1654
7494 F20101107_AAAYGS pinedo_p_Page_011.QC.jpg
2c92db24adcff2e4d4d2c0fb0449c6d9
483ed332348a9f4ee5aef8edae1a4ad836de76c0
2868 F20101107_AAAYGT pinedo_p_Page_209thm.jpg
9bbe785667c0fcfa9e693a7be51df26e
0c7c83ea65df3ce12e78bddcec80da9d763e4f6f
F20101107_AAAWSA pinedo_p_Page_034.jp2
303e78230af97baf16d7bd6b7e6c0ac9
030c02cd8002122af24071ef4ef315e2ef47673b
33179 F20101107_AAAYGU pinedo_p_Page_052.QC.jpg
213148e6bf6a086dab898d2b235f5b6e
90572a09c6ebd03be475e55ec2e09bdb0e6c903e
1051916 F20101107_AAAWSB pinedo_p_Page_035.jp2
612d83a6710c008363e251720f7fc24c
0507879b5a4cf260e83d89e20b23bbae33ab60c3
37617 F20101107_AAAYGV pinedo_p_Page_242.QC.jpg
751bbeeed9366dfa77acfe67daf508c3
6d3fbd9107cd950c5da6cd1d526e02c57703af9f
1051875 F20101107_AAAWSC pinedo_p_Page_036.jp2
fbd68f99d43eb4d8982835ccf64a9a9d
c61affa4850f11af6b41eff438cc9f1d2dee6337
10045 F20101107_AAAYGW pinedo_p_Page_175.QC.jpg
f721571e61950247dafb1f0c59d5998c
49a40fe4957ed7c95808437813e57674ce5f4869
F20101107_AAAWSD pinedo_p_Page_037.jp2
1eb9234754c11c189927be2be07b70a5
6c4f7c453e86b74eb0f50c5e5374f99d8fe9193b
34702 F20101107_AAAYGX pinedo_p_Page_186.QC.jpg
6e9e06a7d64931b45edac56c8e45bb93
ab97e62688fe7133d95438fd33f48a07112eb61e
1051924 F20101107_AAAWSE pinedo_p_Page_038.jp2
10d201aaf5d82cb35c8d1672a3328fad
2c9a6f410535dd6e177946883472a840949aba9f
12023 F20101107_AAAYGY pinedo_p_Page_169.QC.jpg
66e10212f7d3ff5e7b8be9ffe9f3510a
61f2550a9bec04709fc2a1d01cc37d5d293c7618
1051936 F20101107_AAAWSF pinedo_p_Page_039.jp2
02cae9a0ecbfe76f4cc38c7aaf501ffe
30a79d3f8a4b6376575e58e6fd16cc25f9926382
F20101107_AAAWSG pinedo_p_Page_040.jp2
c10a5c6ab42113a11c7abf7e6f52302c
6ada8da9aac74b4a7aa4970a07af13ee347a54a8
8494 F20101107_AAAYGZ pinedo_p_Page_121thm.jpg
2c455856cf3004a82cf08aadd034c81c
83a5bea17763c0fd513c338cb0e3430fc23944e1
56032 F20101107_AAAXPA pinedo_p_Page_150.pro
54c920501d90b270ce9872ab9f87b877
3ec29351fef9efc2fcc1d79b4cefbeddf72656dd
F20101107_AAAWSH pinedo_p_Page_041.jp2
039e6b908abb9843d4eae782acf49389
79c51bac7023aa6378a70392d7a4e58661cdefe5
41426 F20101107_AAAXPB pinedo_p_Page_151.pro
b4d08afdbf8884676b5c05c5e5b76d9f
35bebd8b711ac0493ad090d2fbf71d063f99c9ff
F20101107_AAAWSI pinedo_p_Page_042.jp2
06a6c8a13a6e9c12a9f6cc0a47b31bc7
128e8806b3ad19eb1de147c8148704ddb3969795
16617 F20101107_AAAXPC pinedo_p_Page_152.pro
4bf9f40014a10a137f832f0bf0f3368c
1b167da6e26fbeae080d1e18caa4f77aa8181d54
F20101107_AAAWSJ pinedo_p_Page_043.jp2
7304ef6d1167dc2c2c7e24f5e5a8cd62
f0e9a78bed0699ef284a1e475a00c1d56e40fad1
F20101107_AAAWSK pinedo_p_Page_044.jp2
3477fe5dc3383c20d3cc85ceab5bbd10
73fa8dd675a7f73421fdd310b4a93c29a1fcecc5
12434 F20101107_AAAXPD pinedo_p_Page_153.pro
e925a4b56d08693a735262801f7d5e5b
2eb8277248e81c68e6e064c40f6009d93d122299
F20101107_AAAWSL pinedo_p_Page_045.jp2
bcbf5d893f5eafb6046930f0c5344194
b413676a1b64e76dc9519454b1dc227e340af386
9539 F20101107_AAAXPE pinedo_p_Page_154.pro
d4cfd8bd200360da3fb22926b1824575
3939d1f9c09723b756dcd1fa675775bc6d099669
F20101107_AAAWSM pinedo_p_Page_046.jp2
eb9d80c007cffdc5e117ce17bc43eed0
1d67452f209f6e8953fab6a7ed4f9670646baefb
14060 F20101107_AAAXPF pinedo_p_Page_155.pro
5ca872ef5a85710a70e2e300b74bfc72
7126aae3a12afea4bf7ecccca13cd8b7aee64299
F20101107_AAAWSN pinedo_p_Page_047.jp2
14850480468361cd70e24d61ee06467e
c8b8d3a9597a8a40db12bd3529390849819978aa
20597 F20101107_AAAXPG pinedo_p_Page_156.pro
352d90d0df4420f41965413496377607
31cb774025b92946387ffdaf1f56cad85ebae50e
F20101107_AAAWSO pinedo_p_Page_048.jp2
dc597ddbb6d87c9cc5a8c22053ce018f
10ee43061c6ab5ec9faa24fb79b94ac9c48d8353
13022 F20101107_AAAXPH pinedo_p_Page_157.pro
0689bdb8dbc11b81ef5c21ac29694867
7659417f06ddac6cce02daba0e1c608ca92d970a
8317 F20101107_AAAYMA pinedo_p_Page_107thm.jpg
280513c53e24f98d9edca8ce04b9100b
bf55eb8f3809439e2fc52d53c216ca4515de5573
1051941 F20101107_AAAWSP pinedo_p_Page_049.jp2
5617c0cffcda682fd2178957627b565d
9cd41c38f4b01da75aa6d93d1d8ac295fd53829c
14617 F20101107_AAAXPI pinedo_p_Page_158.pro
430d5bf26683cd954fe5b1a41bae183c
e3754f6bc580ef469a4e99a88e7b50833dbeb45b
8792 F20101107_AAAYMB pinedo_p_Page_041thm.jpg
39ad9e8d5f222f9f70c10c0de5e6e901
ed882df9f88cde43b53a74d257bf4829c1792517
F20101107_AAAWSQ pinedo_p_Page_050.jp2
938c240982614312b698347d3068d5a6
3cadd18a3ba9bb52b7bd472b98bf948fd8d5bc2d
4072 F20101107_AAAXPJ pinedo_p_Page_159.pro
583342d3d69fcc261bf8e8da18a659c7
f1a3106eea8f5e457ce9393e6efc7ba3577f357b
8698 F20101107_AAAYMC pinedo_p_Page_103thm.jpg
0732cc89f2b31b10f90344abb76bb1b5
a23b60fcb4af5bf49b1079f87a23b58ab8d8cae3
F20101107_AAAWSR pinedo_p_Page_051.jp2
73543df273ccb8c7a4403e61081d438a
fc3439ac23be7768476b43d9eefdaa5015f20d7b
50592 F20101107_AAAXPK pinedo_p_Page_160.pro
f0fe0ab6630d60218575ff269f0ebde1
711ee312eae88ad6d8466d500ae909379006f594
36621 F20101107_AAAYMD pinedo_p_Page_150.QC.jpg
e28d1cb23bedb6ba60ff0464591accaa
0e1fef4c5d9ca047c0d5ab2c7e12a4ca1686da03
1051876 F20101107_AAAWSS pinedo_p_Page_052.jp2
67c5acf63e510b5e7996180f1b93135f
875036daa76bb25a4bc03d187a3c630a67a5868d
53412 F20101107_AAAXPL pinedo_p_Page_161.pro
513a481eae82d53f2822b1feb26d7f18
3f1617b21a42946351d29825f836aaf3bf3b0c03
40294 F20101107_AAAYME pinedo_p_Page_225.QC.jpg
a2f320ed02e761025820d8a348fe36f2
ae0b221bcc29cc1a3b11f15a8f703d0af654044e
F20101107_AAAXCA pinedo_p_Page_052.tif
edfbfe703207eb02ccc6fcd9f29a0f7d
dbe109d724dbcd984fc14fb6e059bae40e0555e3
1051905 F20101107_AAAWST pinedo_p_Page_053.jp2
96ba3d36f6e7fc55da692f18474deb0c
de357c92303a69c26e00f2feac3e7deb2aeb9fbd
53514 F20101107_AAAXPM pinedo_p_Page_162.pro
df8ddcff6ba84817a26ab5c139592d82
9cbe5db612b2c8b92a3faa1508e859f2d5eedfff
8492 F20101107_AAAYMF pinedo_p_Page_050thm.jpg
a5b343330886d033d02174bbc618f1ea
53dab2891d1c89be9f4f52043147098a691dfc79
F20101107_AAAXCB pinedo_p_Page_053.tif
195aeb2bbaa6ab1e9689be700ef09a52
829367ff082ee9d8c26e799b479cea7cecf9afd2
F20101107_AAAWSU pinedo_p_Page_054.jp2
8980f20973251c33362b1ca041226af3
489a16f362e4ce4e83fc386d83ce5d34e22391e9
49152 F20101107_AAAXPN pinedo_p_Page_163.pro
1a1ef5c4532150100b3964fa939b99fa
8bf3e821c5c0c6092aec005ad6329c96dc400764
36573 F20101107_AAAYMG pinedo_p_Page_229.QC.jpg
d94b789eb601d35e7f85e2b0d328e797
46d148e89740f968d8e17b32328bb32f08681caf
F20101107_AAAXCC pinedo_p_Page_054.tif
1041e5e40a8ef2587df70d7f807ceb8b
7fea3ab3e1452fd89c2de74800dab0a2bb5cbf0b
1051937 F20101107_AAAWSV pinedo_p_Page_055.jp2
724cda65b744dc870e9ed26f2b741765
1ebef3d4953ffc9678a5b974a27bf8fc1be40839
54689 F20101107_AAAXPO pinedo_p_Page_164.pro
8fb8901570bb025b19a0e9335decd50c
da6eedf0d98bd70c5ffce1fc7dbcdbf39d601288
F20101107_AAAYMH pinedo_p_Page_188.QC.jpg
9f977c14a4e75a65716d425c84b69426
083a83b48ff592b8fa5489ac8294e3b8ea6d9342
F20101107_AAAXCD pinedo_p_Page_055.tif
2a3a06bfd27470190f5e80cd2b9a886f
61eff0a3570ecba65232e1bc78fdda0036359bf9
F20101107_AAAWSW pinedo_p_Page_056.jp2
02567f99f56b31f314151de1b2d0d8bf
0f2a1e20601c46495f6315fc714272f77aa6223b
47823 F20101107_AAAXPP pinedo_p_Page_165.pro
68d0c0dc7776eb84f9dc6778d4df0fa6
24c0052ec5523e668349776549c52fe7f33eda20
33711 F20101107_AAAYMI pinedo_p_Page_040.QC.jpg
b7ae9bb6aae99563e5b08eb402b308c4
cc194de43c61ec9ab05a0c854a8ec24d765ea331
F20101107_AAAXCE pinedo_p_Page_056.tif
356a770a64a28ef3ae35b23f645680b5
b231eab7cf97e6114e325fdd97c2f58b3252be61
F20101107_AAAWSX pinedo_p_Page_057.jp2
180bf90566e1745a327022e17ada9272
cd1b02b9e6ae328d96a5fce8bd37d7f91d4a129b
52091 F20101107_AAAXPQ pinedo_p_Page_166.pro
5128f7c843c2e9c5d9a11317bf42afa3
1361bfcce42049f1d594de2151636f1d494ccea2
8924 F20101107_AAAYMJ pinedo_p_Page_141thm.jpg
1e078d9525a470a6da2f0945fcf5bf4d
34ab9a7f44d25d9336282997f558e24f94af03d5
F20101107_AAAXCF pinedo_p_Page_057.tif
7bf310a910ba9da9f13f255871e2fa67
081cfa29677c839021fc3ce920c1afe17eba1cdd
F20101107_AAAWSY pinedo_p_Page_058.jp2
4147c4f8e295a6caeef3af6da7fd39ba
cebfea754d12fa8f4b98ad33931bf5068fa4911a
51746 F20101107_AAAXPR pinedo_p_Page_168.pro
0915e45713dc8a7c4682d0516fb4eeec
c5370cf64b85a81cabf449dca21ecf5070f08b4d
7981 F20101107_AAAYMK pinedo_p_Page_193thm.jpg
4aa78ad623f1e34059b52b18db0f3d65
c416885d034bf1ad0bb3d93d262c2e990f1d4b12
F20101107_AAAXCG pinedo_p_Page_058.tif
4adaac67988b1cdf1f183413fea116c5
cd81243641978ca35098de1e73f4152d78ba55bb
1051934 F20101107_AAAWSZ pinedo_p_Page_059.jp2
326b74b4f7267268eea2a262d4c934b7
b36fa7979c2fb699fe32c4472b8b0f2bd4cb57ce
14651 F20101107_AAAXPS pinedo_p_Page_169.pro
782a16ed5593d4015947d763888e36d6
989c428b55ce3fe1d2a4d3e244040e2371098b3b
36696 F20101107_AAAYML pinedo_p_Page_115.QC.jpg
86b9ddfa78ec81566dd36ff752a9f580
dc3a432491f5b1f7889db2fe7eab987f37579be6
9028 F20101107_AAAWFO pinedo_p_Page_066thm.jpg
c3bcf0e5fd3ab50fe17c6bf029bda069
96330a2d8c39c4aa3f2597543889bcbddda26926
F20101107_AAAXCH pinedo_p_Page_059.tif
6d104b54b0afec2f8cc0c644150597b7
41772c130d3bdff69075b456a3ee743b2f5d4444
10334 F20101107_AAAXPT pinedo_p_Page_170.pro
a4232f07de2ee0a1ec76fcf6ffffb764
e4ac9ae1687bec618718d748abdcdc260d259994
31878 F20101107_AAAYMM pinedo_p_Page_133.QC.jpg
eb28f9545b20c7b21c289dd8e529fe5b
fec6d1ae2b310de008daed73dc2e1986504c2194
8573 F20101107_AAAWFP pinedo_p_Page_176thm.jpg
e5d56998ba5c0666f587a99007ee06d1
b1161e9e85465d8ef2de8bcce82de6b411714f4f
F20101107_AAAXCI pinedo_p_Page_060.tif
019e8991d729f164fb6d9f007492ca50
176e05d64b8da1789aafda64dc1237eee2c8999b
11748 F20101107_AAAXPU pinedo_p_Page_171.pro
59f9a3364950617c6885f7ee3d1e11c7
3430e60d46104a138e5e4111338453ccecee87b1
37450 F20101107_AAAYMN pinedo_p_Page_069.QC.jpg
f1c57aa32be2b72ec06d4b08470cff3b
d90acc25b34fcd993fd30b8af9cfc09c2be66278
9288 F20101107_AAAWFQ pinedo_p_Page_215thm.jpg
4e30a2cdd75f015a6475299cf7be1506
d910a269207c68d3d0cd5e85b1e6e369226815a0
F20101107_AAAXCJ pinedo_p_Page_061.tif
1a58713b93b761f0e47bf99a0f1b1262
4d573a4c944809ac4bf4c6a7179348b198c1d889
11766 F20101107_AAAXPV pinedo_p_Page_172.pro
2acd83fbf99e87ceddbc8e61a0220be3
0c99583ed6396bae6f77d3ff55bcdd995b220912
31850 F20101107_AAAYMO pinedo_p_Page_079.QC.jpg
1d42e8c80eef4544132baf55751c8a85
3de79ea69099fcbba9563ee603b31c1974052569
34229 F20101107_AAAWFR pinedo_p_Page_034.QC.jpg
f0d5c6a4c53a645452b18f099ca1cc0e
385477595d26d2827e051012de0ca442f44f08fe
F20101107_AAAXCK pinedo_p_Page_062.tif
8a0b4bf1996aaad3a9ff60e1d91aa294
6e2b2475b2ef564a4fbc43b0c034035124f588f9
12101 F20101107_AAAXPW pinedo_p_Page_173.pro
bc32a9a364c5fa8ac76d6126da092ff5
46fae01eda9a699e4eae0abe8a0a7fa00f1ee2d1
8577 F20101107_AAAYMP pinedo_p_Page_204thm.jpg
6f56344d8e3bced6fe83ae8150b98095
6d3fb7299c7cc26e32c66380ccc097ce5f1214d4
123884 F20101107_AAAWFS pinedo_p_Page_006.pro
59fbc5c08f31c0d6cc336ca36e2a1968
6e8fadc9bd4e08c5d7fb524cd513dcf98f6ec427
F20101107_AAAXCL pinedo_p_Page_063.tif
db09bc874ba5bad02e2c7579a714e441
6f4fe38e6a9dedae08615c1ca86ff04e985e3363
10591 F20101107_AAAXPX pinedo_p_Page_174.pro
ea8b428e687077937798b9e722c04aa3
53cedd61a204b50b79123b7ab615025b12076fd9
912 F20101107_AAAYMQ pinedo_p_Page_187thm.jpg
6cd2d3c876efee547ea26cddb534340a
bbdfdb058dae872dff42e27aaa99fe289d852b71
F20101107_AAAWFT pinedo_p_Page_181.txt
882721d6a213d6219d382b2080b27f09
87485c82d4120aec8d93576ce6eaa21e03ef44b2
F20101107_AAAXCM pinedo_p_Page_064.tif
0076361202f1d96355f74af868f990dc
fcdf4ff0f270a2c9ed71f826db23f17a0089044a
15782 F20101107_AAAXPY pinedo_p_Page_175.pro
e2b156a5750a96cfa43c10ecbe1a99e1
f68876703efaafe1fce91c9c2edda0276f831619
32186 F20101107_AAAYMR pinedo_p_Page_037.QC.jpg
ba13dfa5e268657512efd450995772fe
49e54772de2b582880c80a47eb85881752ceb195
F20101107_AAAWFU pinedo_p_Page_155.tif
e54a8467d9a1c4d4130bebcf4bad8558
b0de5e55a799dfa5c604bdaa0a89a311c71997fd
F20101107_AAAXCN pinedo_p_Page_065.tif
a98fb5a31717292f32cbf76fdb6aa3bb
8052c5202b4f012e282915759011e9b6b81a79b0
51869 F20101107_AAAXPZ pinedo_p_Page_176.pro
bfd2d96979404bc83f6e79545880ba3b
10a6064a889035ed3f9705be9d0c673dadab7b03
31885 F20101107_AAAYMS pinedo_p_Page_143.QC.jpg
998b692d6ac6672f2e25056daae9f635
6353c7ef21f1a1e068b610c7b5e260a6fb53e297
52010 F20101107_AAAWFV pinedo_p_Page_182.pro
a80d6adbf2622bd8b8c62a8a2335a3d7
2edb13822998991dad4957410894fe65deb716e0
F20101107_AAAXCO pinedo_p_Page_066.tif
c42b8caa5efa9c5700681533d7bdb696
363dd7b5fd570e675ef6dd4a4a662f163a376cce
33218 F20101107_AAAYMT pinedo_p_Page_047.QC.jpg
0ae927b1d9282994e6057af0ee392ad8
970d5ad3a7b99676a34dece143c1091832a8a19c
2132 F20101107_AAAWFW pinedo_p_Page_051.txt
0f30fdac0179399b141ab135a7622c0d
b489ba128110f36558b0c2748e797286e9ce842f
F20101107_AAAXCP pinedo_p_Page_067.tif
dffe0e3781f133f04c55efef6bc70370
36189c3b19bb2bf94b2a94f58b0389d47815ff07
8631 F20101107_AAAYMU pinedo_p_Page_034thm.jpg
ba4d79ad5c7165affca4c9051f982a6a
d4ad84ad946cc2ff402c405588e1e7003efea80f
51094 F20101107_AAAWFX pinedo_p_Page_122.pro
37a17857451e7a760a41844baf01534a
a19d78ec8df98fe1cbabd010107e3545e91938b3
316742 F20101107_AAAWYA pinedo_p_Page_192.jp2
e08e46f127dfdd66901cc2d7a024cb61
d60919491a96ced8bd3f4c9d83e70bf98553123c
F20101107_AAAXCQ pinedo_p_Page_068.tif
ca623534d4be32c91425255c2e367013
af94327a763092f9ba605b3f89f79e02b84d9c01
36340 F20101107_AAAYMV pinedo_p_Page_119.QC.jpg
8a6f45d013cbff3016fa9805fb13b435
a27ee2d590b4dba5054bc9456672b4713f6ca269
105223 F20101107_AAAWFY pinedo_p_Page_088.jpg
65471c60316b1218c2b5f45310ce95e7
4a2434ac13f277e07e6100a17ee6893e5cd8d71a
F20101107_AAAWYB pinedo_p_Page_193.jp2
4b2ff695ec0aa6e37ac28f014d42b03e
d93e604a6968916341590fe7330f1fbfd9d0eb06
F20101107_AAAXCR pinedo_p_Page_069.tif
554029a246ae8102760cd720596e98d4
77041e660b971f9937cea2624fdcaa7b7ac89cbb
2433 F20101107_AAAYMW pinedo_p_Page_158thm.jpg
ffdf525df25f0572b99722474491a635
1c23866175c6e8a52b6b2921a7e55989c2e8fe89
596 F20101107_AAAWFZ pinedo_p_Page_169.txt
59aaab71de62c17ea8c9b28e42452696
5d39890ce8274652f467671ce74760e5a3f07e98
F20101107_AAAWYC pinedo_p_Page_194.jp2
990b4f4b02af100cc7c933e03500b88e
df2b1e636d8d3ef86e93b60628c73f68f0deabbb
F20101107_AAAXCS pinedo_p_Page_070.tif
a57957e5788c9eb50d540cb73a9ed1c3
1fd81cd5ce75b8a62b1053ef141b9a4816e096d3
9464 F20101107_AAAYMX pinedo_p_Page_155.QC.jpg
85d769d83563665d1c39f1839f7c4c10
a59d8c1dde54170f6fdbc9e7d1eb97ac2b6c1228
F20101107_AAAWYD pinedo_p_Page_195.jp2
0ee325f09e885c08d674109c176b58f5
de7be670e194bbdff820cd5435bf4054bf4d2787
F20101107_AAAXCT pinedo_p_Page_071.tif
7976738557394633a10b4269b2e7a1c3
60f7bf6969bedfa91168ee99d29871721fe03bc9
9405 F20101107_AAAYMY pinedo_p_Page_158.QC.jpg
70d174b66677d036c7d11efc310e93a8
f9c9c42ddb9a95397a1f27dc32d4ebd12707b914
F20101107_AAAWYE pinedo_p_Page_196.jp2
4f4942277d3fe2c685d468b028622560
a4e81af084bc5b9129518c947369f6ffb366d4eb
F20101107_AAAXCU pinedo_p_Page_072.tif
4198bffeccf2310fbf7828bafa78752c
4db24a2cc1cb70a08dd4aba5e9c1cd710bbfd369
37300 F20101107_AAAYMZ pinedo_p_Page_064.QC.jpg
9636518ebc80155e3ea73b30c54d6d93
d72a522cc0d7b84dca14d57c88cd6b90a9475903
1039803 F20101107_AAAWYF pinedo_p_Page_197.jp2
b75953e02eb953cb7ee1b0d457b66d0f
cae366b74cd8357a37d22677a03295086ff0712c
F20101107_AAAXCV pinedo_p_Page_073.tif
bef8556a7ce4976c173b2103af7e1cbc
6c74c6413f4fd7d10fc64d0673a2d8f6b04372c2
F20101107_AAAWYG pinedo_p_Page_198.jp2
73ebe7c134c99e4ebe83fdd0f94ea2e3
7d5d16c8ddd0671124817122497c12e40478dcf0
2167 F20101107_AAAXVA pinedo_p_Page_064.txt
8313ee0be00893f3b73aef582b70c6c1
8e6a98b52b552482e55d7777757b50e602ac25a3
1051920 F20101107_AAAWYH pinedo_p_Page_199.jp2
d582d93a6316c3bf7015433f77e27fd1
1fde4994fccb2dd485c4efd8a41932b1422db291
F20101107_AAAXCW pinedo_p_Page_074.tif
7ba26b4fe99fc40b12803b75c199f197
cef44d8b7dd21c2dccd6e21cbfa4df922f61f5de
1867 F20101107_AAAXVB pinedo_p_Page_065.txt
168a268a47df59f25651be0ef3bfc073
9fc7f3799e02a3077daf73cbeacd3b836bd61cf3
F20101107_AAAWYI pinedo_p_Page_200.jp2
794888bedcae08472785918260999324
5ee971de38a5e1b02a2f1b7e679ffa4c4e81e680
F20101107_AAAXCX pinedo_p_Page_075.tif
070f813ca7b00158a53d56f142cdbbfd
19026ff8c14ae870b1ca2943666db32606a1ae2d
2160 F20101107_AAAXVC pinedo_p_Page_066.txt
9f29ad2851c95a9718fbdfe52856e1d9
d6cd8929f786e0614b4afc8581764c7147a7c130
993457 F20101107_AAAWYJ pinedo_p_Page_201.jp2
7d6b1a7342d2f1758752e3d287e39899
82e528a491a46dea7872d9c0e05141bc54bdc258
F20101107_AAAXCY pinedo_p_Page_076.tif
2c8a683212064becd07175ebed5d251c
9c5b9ffc75881454c76d82605e6aaf9c9a8e4827
1968 F20101107_AAAXVD pinedo_p_Page_067.txt
c0487a7a418ce9e0ef7eac66bb7ac15d
e2d1e26f91e4827a606825f0e81875b65e08312e
F20101107_AAAWYK pinedo_p_Page_202.jp2
1b3451e1213de6bab19ac88ed3ffa32c
b7a4f08be7c0b18b351c94659aa6adb8f35445b8
F20101107_AAAXCZ pinedo_p_Page_077.tif
39c172dfb48ea50502dfeab83e8e4d4c
11ced81780394449a781e24c4c79b7930a82b8d4
1965 F20101107_AAAXVE pinedo_p_Page_068.txt
bb30b0c9c13b24a6c2c9bbab6c7c3576
9b66d4b205e8885147155e404af49098af4805ed
F20101107_AAAWYL pinedo_p_Page_203.jp2
e18d7629db386636f6d1267d3cdc3410
94feeb141d885ca57ab2e19cb4f67e69ed47b572
2161 F20101107_AAAXVF pinedo_p_Page_069.txt
ee9ce501a41b57a54e0ac3608dfdde4e
42969db24035f0cfa7c4e1a16da7487b7906657a
103143 F20101107_AAAWLA pinedo_p_Page_091.jpg
db96ece92fc7816f76311d8b8c7856e0
baf295935ba473674641364476b5039d3739c540
F20101107_AAAWYM pinedo_p_Page_204.jp2
1e992579b99d3c8256a3cbc70311b207
0c70401959a1a5ed142d8d991183a6a49db90f9c
2092 F20101107_AAAXVG pinedo_p_Page_070.txt
1934ce925be6700a11317dc284439631
a8026aa9507174d36aa30e9d0e0eff32a05afc03
106460 F20101107_AAAWLB pinedo_p_Page_092.jpg
41bd6b0cef732e8065ebbffe82796c8b
72c97e1906016ef1280c2f932eabf9eaae804c94
1760 F20101107_AAAXVH pinedo_p_Page_071.txt
b9d421875bd2bedc72513848c2272cc9
328eaa6e66d7fe38bf6977bf6aab8c49b107bf18
2965 F20101107_AAAYSA pinedo_p_Page_156thm.jpg
6dc1e556cf379da0df3594d0b85c4324
fd304f6a6664224972f024dfe2a4a3d29b698ed7
104527 F20101107_AAAWLC pinedo_p_Page_093.jpg
ce7e34dec69be8abaa20dbdab8932506
7d6194ab0425eaa1a1de77327a4d1a90be1cd74e
993776 F20101107_AAAWYN pinedo_p_Page_205.jp2
8515de1e19a1cdc23e41155f5b93cacc
faf25b8181b0bbb1feefe40ffea01f1b8ee7644e
1852 F20101107_AAAXVI pinedo_p_Page_072.txt
de41b18a9c6109e63a559df6705251a1
8d0d34ecb04ae7616fee4bd0548741cecf17af7a
1969 F20101107_AAAYSB pinedo_p_Page_157thm.jpg
9c70df2d49ea95589e1cad366e1cb706
5fae239fad02deba1521841b73d128a11554ddd1
95375 F20101107_AAAWLD pinedo_p_Page_094.jpg
88439a138d9aa6e104afee066fcaf68b
ae6df4e25fd2e14b203b095b1186c81f33967a2a
576430 F20101107_AAAWYO pinedo_p_Page_206.jp2
b873ee9380fbe009bdb5ac094e0fb8db
fd7c92cdc930ef988997b637fcf99ca87ad678dd
8935 F20101107_AAAYSC pinedo_p_Page_159.QC.jpg
5885487fa2634b7b1dc313bb7e37cd58
70638cc7417e18951f313b450a0fff7526a63729
99435 F20101107_AAAWLE pinedo_p_Page_095.jpg
1825857f28e1c0ae1724799473cf2f94
aeafb75ac0b51e791e24667c13f512ff267b8868
711798 F20101107_AAAWYP pinedo_p_Page_207.jp2
86f27a560d3c2ab04f02d84df7cb5cea
4c98f43ff857ed8e0c0545cdd3d88521b41eabd5
2044 F20101107_AAAXVJ pinedo_p_Page_073.txt
052bd0f69590a2cd29dd5226cc86bebe
6834f3084901a802abb269339b52ccd406127ce9
37274 F20101107_AAAYSD pinedo_p_Page_161.QC.jpg
983681d826b26302d4a6b774f23f078f
2e929c9c5ca39b45f0d417848d69933bdc285a6e
109136 F20101107_AAAWLF pinedo_p_Page_096.jpg
6df966cb2b2e677a09a33414fa8bf6ab
e38719a801a3e75a1b9e7435d76bb4b4379fd2c5
557614 F20101107_AAAWYQ pinedo_p_Page_208.jp2
20c2e5d787e61306e7a902f127423dda
3ec8e81bde1a490b8f4a0c9c63b666b5a9db0ee3
2011 F20101107_AAAXVK pinedo_p_Page_074.txt
6050db29c8cf261d90cd416623895f5a
f5eaf1983a3473a7f655593be04c01b914ef68df
37421 F20101107_AAAYSE pinedo_p_Page_162.QC.jpg
21a0555343d8c0fa20b0a58150e848b1
882b742aa88848ed4be0a04dfe807b470c6c90a1
106588 F20101107_AAAWLG pinedo_p_Page_097.jpg
d9fcb37135a88b17cfa50f944c36d087
2c6c9538dbb82e635f97ceb60e0435f69ba93f18
366239 F20101107_AAAWYR pinedo_p_Page_209.jp2
9a7528dc60718fd3c62ed093ac1615d7
2f385e7c42baaca5ab9409a3d56c1ee57e22acbc
2107 F20101107_AAAXVL pinedo_p_Page_075.txt
595094da654c934368e9b4c8f10cfdea
a892c488470df6a722ab2685b186adc213780d5d
108582 F20101107_AAAWLH pinedo_p_Page_098.jpg
c5a36a0fe2cb0cd812c4481aedf2c1f7
98cd51d5066de4ea9cc39efd050fbea4658ace55
F20101107_AAAXIA pinedo_p_Page_210.tif
15afef2b4a8570932dc576038e0a413b
0a73eb83256d4527d4cdf33f626fc18ace9f8876
314977 F20101107_AAAWYS pinedo_p_Page_210.jp2
00347ac38259e2d4b1fb524447763265
592b0ca5b3c906b808e515c7afe1baada96423df
F20101107_AAAXVM pinedo_p_Page_076.txt
0b12ef97edc656ecf47bde25e4ccc132
f076255b3a78b06076fa4f265dfd0ecaf4e15ccb
9043 F20101107_AAAYSF pinedo_p_Page_162thm.jpg
984ca3544f802f95f64513d6d7af0e6e
049e67df256a8453ce9db5973ab64ab75fac40a3
109624 F20101107_AAAWLI pinedo_p_Page_099.jpg
29270c5f0b283e3028d1254beee658c5
17b1bb9f48e9188226feb16992bb9aa6d9616221
F20101107_AAAXIB pinedo_p_Page_211.tif
f14a318d79de456683fdd9f268872b1a
976d6e7918a2372fc84a62a52df67d385351b3d0
316621 F20101107_AAAWYT pinedo_p_Page_211.jp2
50cbff7ca0f4832050637b3d6a8ea20c
284d85795a5ce769258f8bc0def022fd55196176
2093 F20101107_AAAXVN pinedo_p_Page_077.txt
bf16c4eebdada1a04f624ab8c625e70e
72f8c13808fffd5770e37d0594128bfe2f3bb32e
8662 F20101107_AAAYSG pinedo_p_Page_165thm.jpg
567b1671aad66215d4b102b5f1bac08b
96da18eddf32b0c5cf707f952078bcda02a2e343
103559 F20101107_AAAWLJ pinedo_p_Page_100.jpg
6c5f6f49601ba71ac1f1f9e5d5873e7a
edb27a8bed8c38aa8a55840a71c728ca1e3f557d
F20101107_AAAXIC pinedo_p_Page_212.tif
d94884e4559c153c7700bab3fba7eceb
63448c8ea03ca22b6c689faf1d7d0187bf74912e
441403 F20101107_AAAWYU pinedo_p_Page_212.jp2
c440453c3c5a519e7b18498e954ce236
63c14368d3264073f362d42fc11a773ac1682bcf
1920 F20101107_AAAXVO pinedo_p_Page_078.txt
a28a33e2f43863ec9c72c208787620fb
42dbc6ac2841694cfc30d34c63750a05ee718719
34992 F20101107_AAAYSH pinedo_p_Page_166.QC.jpg
7bd40aa9849007e197337c2f52e69529
4ab0355c59e38dcccb27647700b3dab9d9b06bf4
101697 F20101107_AAAWLK pinedo_p_Page_101.jpg
63acc467485edf1189e9ac52338e99b1
c2f87b9bc66206bd040be68a999510bfb41992ac
F20101107_AAAXID pinedo_p_Page_213.tif
1a40c192a7dd458d4bd48c9a65f958d1
832ef66ef48668d09cc8ba402e10092569982609
F20101107_AAAWYV pinedo_p_Page_213.jp2
42f5d5cde62a044f50b437eae50cc2c4
562f0622145cf530a50594263eff009a12b4da9e
1943 F20101107_AAAXVP pinedo_p_Page_079.txt
e58385fe61ce989eb934e5548e405d83
5467a4b3c7f8a8ccf62881590b4082855233ced2
8669 F20101107_AAAYSI pinedo_p_Page_166thm.jpg
6e71af0c98b95a21a26fcb1ded4ee78b
d4f489666c2975d574bf021340770561268ee59e
112142 F20101107_AAAWLL pinedo_p_Page_102.jpg
e5b938a1954d920b38ebb0883d04e80a
465a1a893ed4cf347f105cb3a8460bc9205518f1
F20101107_AAAXIE pinedo_p_Page_214.tif
4080d98e5cb33cf0f8824747059d523a
7b763347cbf06269633b9b918f7f34edbf367979
F20101107_AAAWYW pinedo_p_Page_214.jp2
c5f069aa0b2d6d7fe6f97447e6719764
381dd0d50a31b3ba8c9fc9780508dfddee89e505
F20101107_AAAXVQ pinedo_p_Page_080.txt
c798847b4f88c0c64c734b424bea8bba
cd4fab58cd1098cb3441f61f2e503061dc958f3b
36087 F20101107_AAAYSJ pinedo_p_Page_167.QC.jpg
5157666272580b2faad09438f3e9cfcc
47ab71cc6566d8de9d4829b569799fbb37709700
106802 F20101107_AAAWLM pinedo_p_Page_103.jpg
4c6b691e3a51f7471a39e6dc08cc4cf9
c791b6eb99d28e177e0318f2f62662eca214ffb8
F20101107_AAAXIF pinedo_p_Page_215.tif
f08d4d0820dbd838c9d335841fb9ade8
17316710e83209c2547ce636dc777eadff74cfe1
F20101107_AAAWYX pinedo_p_Page_215.jp2
fc973680b8a91ae6be3b27032e477de6
da385303ec9fa8328a515253132274c0e3a8edcc
F20101107_AAAXVR pinedo_p_Page_081.txt
3ce568645013da0314d4a9f8158545a5
ad5b333a63510c2385cc14d9e373b22ba73416c1
8840 F20101107_AAAYSK pinedo_p_Page_167thm.jpg
5a8ee24e415a69d1de92c0735ed918bb
626370dd071051f8c05917358eec489af3861aee
106925 F20101107_AAAWLN pinedo_p_Page_104.jpg
8e040e0b74f3e0c4192f8703f29154f4
fde2f8c3bf16eefc899aee4dd7279346c27db413
F20101107_AAAXIG pinedo_p_Page_216.tif
9d8f06d3998d3ae194115b121bf5637c
db0db27e93966a7a815815ae67fd25790c5dfec9
F20101107_AAAWYY pinedo_p_Page_216.jp2
4b91c7fa4d4174ea5c9e07c592de5f38
72162d187b6124df5fd84c82817fc9a1d5701abf
2140 F20101107_AAAXVS pinedo_p_Page_082.txt
26eeac2b0f729eaac063dea18a9cac31
30321b49eb9ac027255f123d0e4e37516ab2ce3b
3449 F20101107_AAAYSL pinedo_p_Page_173thm.jpg
97f3be15f3979f8612ab8946c454a289
ced6306ee34be01ce994c4b739a8067a24759a88
110847 F20101107_AAAWLO pinedo_p_Page_105.jpg
1693edaa263da020d6fd8b42f43283e8
f99f9467ba89330cf3f9d0e471dee2653acc6b23
F20101107_AAAXIH pinedo_p_Page_217.tif
f40206c473294252b0594d9466c2782e
322e129fb675e54a3b4571750ee60e244eb6cff8
1051923 F20101107_AAAWYZ pinedo_p_Page_217.jp2
b627f3221a235539561c439db2a19361
84c07c7ff4f37e80746ae9c05bfa5a2d3eda7863
35257 F20101107_AAAYFA pinedo_p_Page_117.QC.jpg
8b56daf737af5176f43d8d98cd9918ac
086f9c659a437295f9e60c8e50c1325618c13c21
1975 F20101107_AAAXVT pinedo_p_Page_084.txt
872f6947b2d307b10e9918db4e4688da
7ebb1a648349bd3f1d18a6e72e853fcb44d6e312
2694 F20101107_AAAYSM pinedo_p_Page_175thm.jpg
bab7e516c25235458d97b7f6af25c73a
de0373b53fca7c56269af321d383d15178ff837f
106989 F20101107_AAAWLP pinedo_p_Page_106.jpg
977e3253f5a96b796999177fdd73999e
ed5ee0400bf0befb919596c8ba90a49d9e031617
F20101107_AAAXII pinedo_p_Page_218.tif
5359e7ddbb86c8d80e0c55ab7d2778ad
95e43a73567110aeaffc03d8daef5512b728b79c
38984 F20101107_AAAYFB pinedo_p_Page_241.QC.jpg
7900444e93a3c5cc06ccec2504d91a2c
bb4e9203756ab2a7d58adfcfe3ec5bcf61f48c34
2050 F20101107_AAAXVU pinedo_p_Page_085.txt
b2f4de524f52e6c38baad40dc4ba5fa1
371337064fee95777cf1a54cd132ba119cde9d14
33564 F20101107_AAAYSN pinedo_p_Page_178.QC.jpg
0c4f85d5ece7cef7cc145a3ccffacdee
6b221984f616fcb6b412d8b9fce0c49f5aa15278
101602 F20101107_AAAWLQ pinedo_p_Page_107.jpg
9f709372e0d9385822dfcc5da938c3ab
d89a75032489d3eaf10f25f13303ec55467636c1
F20101107_AAAXIJ pinedo_p_Page_219.tif
8594c000ecc12b943d0b44527087103b
90447621bb7b1a6421800c1deaa34aa445f7cfd9
34806 F20101107_AAAYFC pinedo_p_Page_123.QC.jpg
652d549efd40d0d1667e766be31740b0
38f542101d248bfca5981d436aba71b66ecb7c5d
2179 F20101107_AAAXVV pinedo_p_Page_086.txt
a3a0414a337ebd7aa7e2559a01b2a09d
89efc2f59e54991a34d9b44fc20f626dec5799f6
7664 F20101107_AAAYSO pinedo_p_Page_179thm.jpg
a1a13f956c9089084fe1da531915dc45
4a4a6777bbbed4f8d97da9d9c352b493f08a0f4c
104828 F20101107_AAAWLR pinedo_p_Page_108.jpg
e0e5af4b3587ead4ced669f746c3eb07
9ddd0e50bd93eb2d0263f7ad0fe6081d4263fded
F20101107_AAAXIK pinedo_p_Page_220.tif
cd70a6ea0c796e085726dca545f65c49
f125069384e5a1a639b2e9793cf410f783d3526d
F20101107_AAAYFD pinedo_p_Page_127thm.jpg
64613ce6951cf6804b62425cfa348c67
6bc17a1a9c59aa41228c7ce04e1929ede3c0a288
2098 F20101107_AAAXVW pinedo_p_Page_087.txt
a3f0a6c739decd0ece42f7a31057ea8a
40e05798fbc20bd1123676e77183e9555f29214e
32971 F20101107_AAAYSP pinedo_p_Page_180.QC.jpg
9b2c0ec390b519203badfb583a0abf66
4974c0e5e5053cb6db4a47f630611277cd08ddc7
97183 F20101107_AAAWLS pinedo_p_Page_109.jpg
3793a5bd87fa6161a8ed833707dd15c8
8384693df3c29bd75ffcc877cacc5369133fff8b
F20101107_AAAXIL pinedo_p_Page_221.tif
a9e7598f7233084acdacef59d97674f9
f90899e509e122a30b17051c00de1413fdc10fbe
8913 F20101107_AAAYFE pinedo_p_Page_051thm.jpg
39976318d8ba4bf525abd34457658f83
9848bb0d9f380a71a39c6d5b4a7b3464f236f17c
2035 F20101107_AAAXVX pinedo_p_Page_088.txt
5ba4eb90c8225365eb0176c842fe51ce
5011accc7fac997fd0afbb41817aab658daf048e
8211 F20101107_AAAYSQ pinedo_p_Page_180thm.jpg
d33249232cf2ece6a7a8b0410132a344
da15d1b8bfdceebf30133d8c3c9b4d65032c18be
113522 F20101107_AAAWLT pinedo_p_Page_110.jpg
9aa314948441513b5d461a7749aa7dec
d952338efacf04551b24ae94b954f96b7b332627
F20101107_AAAXIM pinedo_p_Page_222.tif
021dfd2cc84dfeace2b8999955cb0263
945172778b83b9b016ecc4f91ef19cf2939f8386
8144 F20101107_AAAYFF pinedo_p_Page_045thm.jpg
00a7335ca0ec0082ed4796e2741e23bb
ac6726a8601e731bb17a4ba648210486a6cfd610
F20101107_AAAXVY pinedo_p_Page_089.txt
507f037f13cacaac7e79d48c384515db
8e3535927bce591015c6eb42bc2e714598637f89
3203 F20101107_AAAYSR pinedo_p_Page_187.QC.jpg
2a90b2e29e7c8c1d4c98007646df1043
6209e2586c9c33589f9ed90d6dcd5a4e5c339d75
105693 F20101107_AAAWLU pinedo_p_Page_111.jpg
bc3e49ef399de7fb774c48f9bc0a7f0a
5594b00efa034a5b522bad51f7136b556921809c
F20101107_AAAXIN pinedo_p_Page_223.tif
5ce256060768b61ce650b3889c40dc57
08abdfa76004640cded9b32c8a152719e7ca6539
35166 F20101107_AAAYFG pinedo_p_Page_195.QC.jpg
48c1cd225730a0b0ac8c8386771320e5
236676b2cac3cf435f8a21ccb18ae8a19debdb2a
2037 F20101107_AAAXVZ pinedo_p_Page_090.txt
1fb0b6139456dc59e69aae71358cb104
6ccb8a593b7367fadbfa2a222a329f9dc051a246
F20101107_AAAYSS pinedo_p_Page_189.QC.jpg
bf41a3650d3512942405aa32d0bc0d21
708062b1d081d49b1a25151b222daac69d38f747
99907 F20101107_AAAWLV pinedo_p_Page_112.jpg
f3e3a0550551c0c01131ced28727ba86
31a8662b43fbd024250f1e3d5a5471b8a7f7ff75
F20101107_AAAXIO pinedo_p_Page_224.tif
696ea86c0b5a79f9c18f3bf01ecee251
01e245de289a9bfa4693e71d06c238ecee715775
8495 F20101107_AAAYFH pinedo_p_Page_073thm.jpg
8ce6b5b4d7f1218015484e10280d9e68
b66a74a2bac7b4ca1c3fe146a4e431b1fcefade9
3825 F20101107_AAAYST pinedo_p_Page_191thm.jpg
499ea1a7496eb7370e98965183a218f7
4a1c52b793d73c6d1dd39a4b3a44d33e4da6f7e1
102304 F20101107_AAAWLW pinedo_p_Page_113.jpg
97b7b0be680ab20a4302f5ec6a9f4202
e9c2aa851e30078c2fbf77a7a4034817ac16134b
F20101107_AAAXIP pinedo_p_Page_225.tif
fa8e8d06f5c4578554c801e228f6e382
4cba575b1e9170d96ca047f4396c6869e51c0a88
34496 F20101107_AAAYFI pinedo_p_Page_004.QC.jpg
6e99b899f057d26a484ae781c52aa05b
816c91abc61685ee9f6e7f74afe17ee09102176a
10187 F20101107_AAAYSU pinedo_p_Page_192.QC.jpg
7ee67bb086d77cb110dc119a22614410
efc1f78747b273e2bc2e1a650c61acf749a01a66
100590 F20101107_AAAWLX pinedo_p_Page_114.jpg
1472a10ebec7801621f592df298e4b85
68c00bc8181b89ff9a540b4549c1b6740aeb7725
F20101107_AAAXIQ pinedo_p_Page_226.tif
7a8ad6fd646105d9c9fbd16783ca12d2
ae328ac8dbee74dbc7a5b653e0a8902224c1d45b
F20101107_AAAYFJ pinedo_p_Page_039thm.jpg
bdccab8ef7e3b13c3778fc4862d1f3e1
107662dc6d23426f0645b0f107a038b05da36349
28664 F20101107_AAAYSV pinedo_p_Page_193.QC.jpg
72282f0615a2de16c32badd488a7a22a
cd062a2c32593b0088da68c8bdd1157171dc9780
111514 F20101107_AAAWLY pinedo_p_Page_115.jpg
e19acab1ecf82f361189484b629d02da
81679b40488a4b7f7b772eb6a2f2df6e9e99f683
F20101107_AAAXIR pinedo_p_Page_227.tif
c0efae60de0e269002b32233310b1f0d
3799534dd22ac1e62406023fdafa2798df5eb7a2
F20101107_AAAYFK pinedo_p_Page_171thm.jpg
55ba9584216c6e130ddec4a48d25c538
7e4ff79665cbf6d88637869f9c50b428a14ac871
34480 F20101107_AAAYSW pinedo_p_Page_194.QC.jpg
4fc50d6cb82b91751bb8e6a8237ba217
0a1c473dd287f2fa9d36cec6037d9d6cf00fa6fb
109735 F20101107_AAAWLZ pinedo_p_Page_116.jpg
04a740863bd1416743c051cbb88718e9
c4f37755b400f2631cd5e1c249be6039e2a19615
F20101107_AAAXIS pinedo_p_Page_228.tif
f19fdf56c2dc81007457030f04071cb2
df9610f8b6f34dfafe3e379bbea549246f19dc6d
33938 F20101107_AAAYFL pinedo_p_Page_168.QC.jpg
cf39d99f069e44448fcc992a3d3923db
ff2e49e1e3d453e59a24af1ded450e307f73250d
31685 F20101107_AAAYSX pinedo_p_Page_197.QC.jpg
e94d1b58cb5d65941d16025cca21381a
f8d9d2fafd3a5ce91cc89bedcae5595e40b7f6e8
F20101107_AAAXIT pinedo_p_Page_229.tif
9eb9e3fbc083c30a375524ed4c791f49
85da37bad6798a80bfcd42ce9b892338417ac0bd
7948 F20101107_AAAYFM pinedo_p_Page_132thm.jpg
c344add89ee4b97ade56d538834f767d
98c692e15f58b5eb6222ae9009dcaf3f4a199f2f
7752 F20101107_AAAYSY pinedo_p_Page_198thm.jpg
705cc0c46d3cbd7b57b61ff76b1182e8
f263f7b0d05c32ec4f504da96a69a83479c32298
F20101107_AAAXIU pinedo_p_Page_230.tif
5d863856df51b30f8e5736f87352df0b
df0a75100ad79e064d8cbfbbf825a2d4ee46c6e2
39456 F20101107_AAAYFN pinedo_p_Page_234.QC.jpg
a2b71b537623b646f3b67637cb380e1e
13a31b25ae0d52eec68ed06632841e971cdf26bf
35145 F20101107_AAAYSZ pinedo_p_Page_199.QC.jpg
846263b1222180bf7c909159965649cf
e35fc02cd1ddb298614cb31d7cfc4b917be62e64
F20101107_AAAXIV pinedo_p_Page_231.tif
90a2bc87940124d121ebe77a1c5eb5f3
7f76545a611b720b7fd6b833ddf6469776bd69a8
9493 F20101107_AAAYFO pinedo_p_Page_221thm.jpg
cc2d56300f27b8ea6ef5b6cf4755cb83
0811545aba10251a5d83fdb37bb55e0eabd4811d
F20101107_AAAXIW pinedo_p_Page_232.tif
a7fcf95ea21e834f1c084bb28bbb0400
d942111014615ef6c8951768807367b3520e36da
9433 F20101107_AAAYFP pinedo_p_Page_241thm.jpg
e1597a1a93c9863f2cc7efd0d7927801
be051f528d3dcbb1fda54a6acbc017ac43410166
F20101107_AAAXIX pinedo_p_Page_233.tif
dc2b7defffb368ebf703b259fc5ba637
0ab84db015f94ce124c8128c251478bdaa45927d
532 F20101107_AAAYFQ pinedo_p_Page_002thm.jpg
b6606ee306593916da5e8a277c792bae
412f2b7eda178561aab5491e8800829b8381513e
F20101107_AAAXIY pinedo_p_Page_234.tif
9b2dc650cfa43d60ad8f6e1f1da0a105
26fec98e3cd1e36d6f59972a398d7d6496ddfc3f
8554 F20101107_AAAYFR pinedo_p_Page_084thm.jpg
6f5496dc97771131098ad637ed70cd8e
c4d5ab5f20030f4d1adb013f827d5cd15033bf3b
F20101107_AAAXIZ pinedo_p_Page_235.tif
3e47744b195da78bb4f6be8b246b5ad4
d997670f38bec494c134d63819df388565ab8ea4
36165 F20101107_AAAYFS pinedo_p_Page_023.QC.jpg
821870e65a2b4408f19106ea117bed66
0b2e9575e2d68daac6a8fa1049b0e2bb51b770c3
7583 F20101107_AAAYFT pinedo_p_Page_014thm.jpg
ab67d7a76bb735ba749edbece2d50cd2
52f5e79a3278ef2f5724ea6936f9cf1282558821
F20101107_AAAWRA pinedo_p_Page_006.jp2
980b9021dc1148970862bcfbdd2fbac3
dbe4f7a56d43b97d9a9c9de56aa8681d8e50ac59
8832 F20101107_AAAYFU pinedo_p_Page_070thm.jpg
a0ccbd94e63bf2aab4383d73138c25e8
745dd5d92ac2054bbad29f84468ae64fad005563
F20101107_AAAWRB pinedo_p_Page_007.jp2
953be1ce975d261be4e65356b4509b99
b74049246d1d37c871e47487d160d7af2683a241
8084 F20101107_AAAYFV pinedo_p_Page_137thm.jpg
4fa09f6fc213fdbb216be1bedfffb1ac
1d6c8a940454677265ef752a2e44589da9cd1859
F20101107_AAAWRC pinedo_p_Page_008.jp2
765c320c8776bb96ee977a2cf1bfa8c6
0fb2220ca69835eb0ca9a47cc5d1be82aa92d0b9
33372 F20101107_AAAYFW pinedo_p_Page_101.QC.jpg
6b6c794573ad186a3fc0262cfa18a4a1
df9f501cf9ff36a8ef05c0143d24079e082de3ba
F20101107_AAAWRD pinedo_p_Page_009.jp2
8c0164406bf2e2f0ddc88c0f0bdd7c9d
34eb19217e67bc32ed46af8ed751dc3557acf959
33755 F20101107_AAAYFX pinedo_p_Page_131.QC.jpg
137a7f2228ec67524a08f3916fc20f45
41fca337cd127559c7943dd27fc383e15f7fd35e
403428 F20101107_AAAWRE pinedo_p_Page_011.jp2
c3a0fa966170aa2a215c105d979cc1cb
32a29b8c834356a87a7f049ab46048f3a3d98ac3
535377 F20101107_AAAWRF pinedo_p_Page_012.jp2
9aca7cffc3373077b683ca2fdc66187d
ba8be671a117771fab92779b9d9ee2275972ce02
36420 F20101107_AAAYFY pinedo_p_Page_099.QC.jpg
0b8769c19f731ee4b38bbec5ce4303f2
cc933f5094efce6324e864439bcb60e21a642d1c
6160 F20101107_AAAYFZ pinedo_p_Page_154.QC.jpg
e23c56aa199497ee1e9f8513b6d778cf
fbf420639fa74864c5b9418aa2e0cb805e0e566b
174217 F20101107_AAAWRG pinedo_p_Page_013.jp2
addb6a89ebf4ab6631bf0878cc921f32
4ec3584e73278de5e49eddd9778bd873b20ba803
50881 F20101107_AAAXOA pinedo_p_Page_124.pro
b96601ee4d738b804ccb499122a79902
e098412e3e389e0c55e3a88450b9162e676d16fe
F20101107_AAAWRH pinedo_p_Page_014.jp2
c1be4cbd9fb4712ce68b646ddba35b1b
8aae1be139e187836d1e8aa148492a150272022b
51050 F20101107_AAAXOB pinedo_p_Page_125.pro
05350e09797b0fbdf4ad1aba221a53bf
bcdff2ea7fe91f9c03279e39160b62ddaa03cea3
634872 F20101107_AAAWRI pinedo_p_Page_015.jp2
8d11fbfc1b2de88843611fa908a1ec8a
0a04d81966f93ec771998b417cf26505cf08ed97
F20101107_AAAWRJ pinedo_p_Page_016.jp2
6c85167b76e6df5e389a3b05ec29d3df
38e028d8004dcf6badf278a872f0b58f625d89af
50917 F20101107_AAAXOC pinedo_p_Page_126.pro
b6b6f95f84bd3c06644a4db754ff2ea9
d2edc88c4ddde8614e6935c283298373bf6d9998
F20101107_AAAWRK pinedo_p_Page_017.jp2
349c47b261be626d9d1e891640943bd5
d94a88ea2517f9f3d88e8ce8202160b6d97a3485
53054 F20101107_AAAXOD pinedo_p_Page_127.pro
90b44bdbbae1e8ceba0be250d81af20f
dbee4d8001c9e707640322329adfd31d5d35bc02
951383 F20101107_AAAWRL pinedo_p_Page_018.jp2
116a29630ece9f3aeb0dea519a389cc4
8343c06e65158a54646db507749feca2e3a2eb37
51901 F20101107_AAAXOE pinedo_p_Page_128.pro
572c1ba831000704c590aa232746530e
564e6edacb3e621fbd1f30c36cf9774bcc90ea57
990514 F20101107_AAAWRM pinedo_p_Page_019.jp2
0cb03f7d57bc5b9bd3d369eb89c5feef
cdc579aebc37dfd17d312649aea0d0b02402c27a
48675 F20101107_AAAXOF pinedo_p_Page_129.pro
77d0591ecb9e90d4dff31b510c74a225
d818a749caf479b4a36552c18e0a0d51f617565f
F20101107_AAAWRN pinedo_p_Page_020.jp2
ab5014e596a941dd4cf7ed98a5316ebe
fe3caf36d037b26c71c340f3331530c3c98b3f9e
53835 F20101107_AAAXOG pinedo_p_Page_130.pro
160a8235afef82ce9423253029460128
fd385a726a87a9732b2030748e60adaf5cbb5530
F20101107_AAAWRO pinedo_p_Page_021.jp2
0cf35654348abb959034f8e3fd77a922
a2787bd76804143a00944d3a89c4bdedb7a5c93d
51104 F20101107_AAAXOH pinedo_p_Page_131.pro
42c075a9d0e62fad1791b2c8e92318c7
a96f9032054406432987a48da98151ee8b61267a
8722 F20101107_AAAYLA pinedo_p_Page_083thm.jpg
c356f273c83edb9e288124040c4b02f1
61ab074de3960b7ce33790778b73eb3d89a00c6a
F20101107_AAAWRP pinedo_p_Page_022.jp2
84aa6d07e9f5c1c9f660c77132589854
501419c2232ac0c0c6aded400cae1fc16176d260
48510 F20101107_AAAXOI pinedo_p_Page_132.pro
bf6315e62bc69f88859f6435e5c87b5d
4b1f3dad08841f7fb09f2e2f70bf5c2c7389b496
32985 F20101107_AAAYLB pinedo_p_Page_073.QC.jpg
c0c87ae249533053d86c3ae376211eb2
f69fbf1f0479c39cd0be7e3246c9e5301c814002
F20101107_AAAWRQ pinedo_p_Page_023.jp2
5189b171552c4bfe2a46c73cd20999f4
ac3f899b12d914859f07c8eebe8af0f652d177b4
49318 F20101107_AAAXOJ pinedo_p_Page_133.pro
ad0b53174d7e56944ac430d376c4367c
1cee0340d95eb9728534c9cb27d500a59f0b7f4a
7782 F20101107_AAAYLC pinedo_p_Page_142thm.jpg
7ef9ac1ebefb487e7c3587b44de975b8
197e2e91171b2672731eaf128122a83cec10d42e
1051921 F20101107_AAAWRR pinedo_p_Page_024.jp2
94eebadb33291baf5757f37be235262c
2465ea7e7cdbbc32931c7b8e302a55abcfd4681c
34038 F20101107_AAAXOK pinedo_p_Page_134.pro
09a91db736123edf9d81a649bfe5a709
c53b4ab56b02b329942502ebf98d8ecd09f987ae
7971 F20101107_AAAYLD pinedo_p_Page_071thm.jpg
5e270b9b1dd34c97106d285d9cf878b2
646813350f17d16428995a0892973870ae3793f0
F20101107_AAAWRS pinedo_p_Page_025.jp2
45755a54d74925d51f594f3ae6d5b0da
bbb97f460d29a13ffb286bdc5e72db99bfdf3d71
15626 F20101107_AAAXOL pinedo_p_Page_135.pro
e81d647c87bc5c3ed0ec5ce4601401ad
e96412f8f0262323ac7028078edefb9f474145e9
8575 F20101107_AAAYLE pinedo_p_Page_053thm.jpg
7c01484407063000af1eab938a1475b9
9b441d871888565b4a891b8d6d9a61ebc20936e2
F20101107_AAAXBA pinedo_p_Page_026.tif
efc297d2cf5f8a9930d529d3665f04c3
c9dfb17d169cdccc89464a29da859367fd112770
F20101107_AAAWRT pinedo_p_Page_026.jp2
2ecf2495131763b063ec7cde46f73550
ac9b693dbf6b1f5688202eee7980556d267ab014
55433 F20101107_AAAXOM pinedo_p_Page_136.pro
69666121852778c93ae0db03f86826a0
eb0c58363267645c28106646a24d0f1ce1122141
17145 F20101107_AAAYLF pinedo_p_Page_208.QC.jpg
6f84b726a7bdcedfc0bef8887cd9ec23
3281cbfb50169c1c02de64198d1a02323b0756d0
F20101107_AAAXBB pinedo_p_Page_027.tif
3438f68259e8d8be3cff1c3de78e6de6
4d2c5df393c20b1b2b10eaaf7021e3baf4b839db
F20101107_AAAWRU pinedo_p_Page_027.jp2
fcd501ce875c9b72064932437112c29f
ff5a671805c6d4369578e702177783c2f4b34875
50913 F20101107_AAAXON pinedo_p_Page_137.pro
1e910dbfd7e7878b3fc908d3e8a9df11
d83e3eadbe8088d913a540c9c06178e54ee1ed0b
8587 F20101107_AAAYLG pinedo_p_Page_001.QC.jpg
076c91df413cddda9f375f3d1558da75
6df4ed3df59da77563eae9ef036139af08500b68
F20101107_AAAXBC pinedo_p_Page_028.tif
8f136c237468a9e4f5b391e615abac12
9a8368f2d9e73a81b21b2ed592074cf7f9b83fce
1051963 F20101107_AAAWRV pinedo_p_Page_029.jp2
9b4733d9705ed394e3d289b896cc8b20
9e81ca0cd8376334500b2d405d3bea28616e8edf
56599 F20101107_AAAXOO pinedo_p_Page_138.pro
b044334a9e6483f8180a2a38f2276535
cbb53ab576b9636ddc47e1f28326727225c59fc1
35369 F20101107_AAAYLH pinedo_p_Page_096.QC.jpg
a67f70016717140d2e0f4fa184d166b1
c8dadda906a7f1845545924a44823a74a5060c25
F20101107_AAAXBD pinedo_p_Page_029.tif
ad973049a9f01e10060e049b34f4bca2
45aa13ad2cc225627cc2933fe93b2706bb635049
1051958 F20101107_AAAWRW pinedo_p_Page_030.jp2
f2ebdbcf672177a9a1c40f5fd20e076c
55adf05b8eb909f79fc63b1e0edd307a6b7bbfd0
50045 F20101107_AAAXOP pinedo_p_Page_139.pro
83465eeed8fd4ce471f78b1be8467ecf
48aef74a42e1c97130c6a4123bf3c6d029eae378
37255 F20101107_AAAYLI pinedo_p_Page_213.QC.jpg
735649dd9ec2bca9ba042abaaa495ea2
abbff22570589fd2116fe4fd9e76bad503489568
F20101107_AAAXBE pinedo_p_Page_030.tif
cc4ca1d540e3e7b473a79476948cf844
e4212fcd1161170b456d2955d1db03bcd4d9c5df
F20101107_AAAWRX pinedo_p_Page_031.jp2
43785659cf51cb39c382694396603f1c
a8fba6d729d36bf807140190e3dfc8b4b6031a08
48833 F20101107_AAAXOQ pinedo_p_Page_140.pro
ee83a4685e63831c12391e1b53674fc6
d441268966c75c2fd75cd5a26f5dc99f1f98d8bb
8140 F20101107_AAAYLJ pinedo_p_Page_118thm.jpg
adcff43c0108032acba9e7582c3d81da
5c6795a78ccb6d62fc5023ad8fe0b55ea31bba63
F20101107_AAAXBF pinedo_p_Page_031.tif
946b68c68d7cf2b313a13af0ce47a20e
020942c16b45973e2a7491dbf6b214913d4c4ad3
F20101107_AAAWRY pinedo_p_Page_032.jp2
6c3d82975699b86869e73e4002538a1e
a3f2d6fd08637557bd16760ea765563abb0cc2c2
53049 F20101107_AAAXOR pinedo_p_Page_141.pro
3a25ec7f33d8b8375a43da4e5483b8f8
b10af02f16b4fc16a62ae74210f90c48ec0a12de
31843 F20101107_AAAYLK pinedo_p_Page_165.QC.jpg
43a1feeddccc3c9f03a845d35a1f374c
2f5898b9e8954832e90d7b4cb2f8078fb9603317
F20101107_AAAXBG pinedo_p_Page_032.tif
216f89114f92ac1557fcefc266056ff9
182ed40cba37aaf79876d8855ed909e4679f04d0
F20101107_AAAWRZ pinedo_p_Page_033.jp2
3f035755bf2429d11d8fb2981936e456
bd0a5985b813c4b5ce2a43ea5040b09eef4734ad
44471 F20101107_AAAXOS pinedo_p_Page_142.pro
938970dcee1494a82f13a716c7a5e311
109b5422b98b8eae0c675711b60e081108fa18f9
8519 F20101107_AAAYLL pinedo_p_Page_184thm.jpg
8e8b29ddf67b36a6f32aba3f366a1c40
149967f7e1558be8ef56300928a93865c871a32d
F20101107_AAAXBH pinedo_p_Page_033.tif
5a0cc4cae36523abd352ecbd904605dd
567921d0325577d11ea729ebf2202e28d1e04de6
48010 F20101107_AAAXOT pinedo_p_Page_143.pro
dbf490d00a91c382f5583e8370ec5414
1835976f05f1760c5c271839b4e209cf660f3872
33345 F20101107_AAAYLM pinedo_p_Page_093.QC.jpg
fa96774f5bbc2d8f70a2802f1dae227a
42d0be6704d5471eb059d4b4553ca395138fc00d
F20101107_AAAXBI pinedo_p_Page_034.tif
6f44383b8bd3b91dc26f33bb808830aa
06886e948ad3f82f777206a9a0f4b643dc9befd1
49172 F20101107_AAAXOU pinedo_p_Page_144.pro
b6188ca0e5a8d34cfb9ced4e9a778a35
155cdd85548d92ad5016719f89becae7398fbd09
33760 F20101107_AAAYLN pinedo_p_Page_048.QC.jpg
69faee69c179f784ea06ac2113add3f2
50d49fd0556ad16ba15e79e15e4baf91b7efa772
F20101107_AAAXBJ pinedo_p_Page_035.tif
ffb59e4d1b724995f7ba803dad01ddd8
dbca6392a3a774b5a87daab66b56232458eb4966
56129 F20101107_AAAXOV pinedo_p_Page_145.pro
f69cb389fb9aa6502a55fd7c27afca38
3cd67ff509bd075d1bf16c78cab8dac84c345e8c
F20101107_AAAYLO pinedo_p_Page_108thm.jpg
a72f2262a3d858dcae99162400cb2559
2fbd206c3460cedad98829ca521b35273e864138
F20101107_AAAXBK pinedo_p_Page_036.tif
4b36e26bce572cf7ab07379a31fb6f28
af85e50777e9dcb80b6018e17977333df5cca1d2
55007 F20101107_AAAXOW pinedo_p_Page_146.pro
c72b6e1c49578cf2b5d29940d2e5c16c
4eec127ed278c7d5f844236ced45779025fa1f98
39443 F20101107_AAAYLP pinedo_p_Page_236.QC.jpg
1c3872fa01f6dd2a0e47090c98ba4b01
aaaddf5d60b0abe4ea622fd830f737f2250536ed
F20101107_AAAXBL pinedo_p_Page_037.tif
9113458bd5994e410621c6c9f3e60f4e
fa402bd6d51875ecad35fcf1eb1fc51d2fdbefa0
53426 F20101107_AAAXOX pinedo_p_Page_147.pro
2f07d39bf38f4653e21e3f42e764ab02
b159dd25c36f343c8ba90dc7c3096b376609e97c
8944 F20101107_AAAYLQ pinedo_p_Page_150thm.jpg
96810f066e7b9266dbc2472e15804228
6e7af431686c7a9d09a73e285f58cd3a9b76e9b0
F20101107_AAAXBM pinedo_p_Page_038.tif
e154fe4c2acecd801651b996a0c8e331
96bd476c03e0c796dd83211a7336dda55f3cb126
52764 F20101107_AAAXOY pinedo_p_Page_148.pro
934730851345c6aad643201af82e61b9
47bd518b7423113721f45eb2830417ce335c5f14
9002 F20101107_AAAYLR pinedo_p_Page_242thm.jpg
05ba21838c9cc9583d834fdba20a26f6
3d357bd347105777bcff31d08d4a782f09ebf2c0
F20101107_AAAXBN pinedo_p_Page_039.tif
3fa1a9c821d85e2c75807a0d0bcbc45c
78d3c5968629905a70abb03ee202ee134865c65e
56461 F20101107_AAAXOZ pinedo_p_Page_149.pro
d2207f5c9f59534bb85f706ec9316fac
eb6df8522c7e6145bf7c5099e00518339611575d
1701 F20101107_AAAYLS pinedo_p_Page_154thm.jpg
10981160d7d7bb6ce5c4e3f645fc8cff
afc200c4fc624d7a008423959bbdac747ba1ee80
F20101107_AAAXBO pinedo_p_Page_040.tif
17c068ecd7da8a233796ad05195e5e91
8f546eb554493a2ab70f606fe73cc261612fce5b
34508 F20101107_AAAYLT pinedo_p_Page_111.QC.jpg
3754c7eec1297e2e5fb6919c870df177
996ac26b783a7da916dcf2a74dce6e789d5fbf4f
F20101107_AAAXBP pinedo_p_Page_041.tif
f9dd69a5c2adee39cf5dd91fa4642cc8
b83762d68e08ebabda7067ce972847aaf8f75bf9
8057 F20101107_AAAYLU pinedo_p_Page_160thm.jpg
4892543a92ec0dc96ed64d90bfd0e642
6f0aa9c9805b0f97d25a373b29362fbfd08777ca
F20101107_AAAWXA pinedo_p_Page_165.jp2
00617ee838f040a98bffa95b9a23c1df
768ab4a202f7b217922c3c05415e22393a8874cb
F20101107_AAAXBQ pinedo_p_Page_042.tif
3eb27cfc7bf8f1643d281a43d24afce0
2a058e175e609e03987bb68edfd767213c4c5648
1941 F20101107_AAAYLV pinedo_p_Page_153thm.jpg
cfb44318ea1363ccc55b30d151b0a84d
da1cb9307807af83b32879cc736a5413bb268631
F20101107_AAAWXB pinedo_p_Page_166.jp2
a72bad0292f8ed2445c3a695b391b39d
3ccdc86c512e83075d673f3e5e6c9d8f2b3b3aff
F20101107_AAAXBR pinedo_p_Page_043.tif
30a78209d09571748a6268ec8b8fc7fd
bec1f5198f3da1a2151455fc0eb5056872d77756
32592 F20101107_AAAYLW pinedo_p_Page_129.QC.jpg
ba6d543c0563724bd5b5cf6afd719936
de71146369191304e37bf5ef309e31691f4192a1
F20101107_AAAWXC pinedo_p_Page_167.jp2
c27db9e1cc87a5bdd007f5778211157f
b34b657e3585d0452cd7612264ec38fa58e9ae89
F20101107_AAAXBS pinedo_p_Page_044.tif
bf1a1f1509310d68d014d7a5bf00ae76
804f236ac7444cb4f8301ddb960fb5910faeea3d
F20101107_AAAYLX pinedo_p_Page_082thm.jpg
7983db808728d17d7ad82ff6724c6345
50a20234a16fdc67800cc75c9bc14752350bca27
F20101107_AAAWXD pinedo_p_Page_168.jp2
906b3c041456fbcd30c7d1746e9c3472
2b0eb44cb081a5cb4620accba49a58fd3ac3cb95
F20101107_AAAXBT pinedo_p_Page_045.tif
967cce77ed801e5b885b53d3a68589ec
7862b770e7793b0b150c491e6a89544fbaf8f057
33632 F20101107_AAAYLY pinedo_p_Page_055.QC.jpg
5e832303e7ec73bbdd418b7a027da51d
f157708c2d40ed29d348157f4442124b1e5179c6
338648 F20101107_AAAWXE pinedo_p_Page_169.jp2
a3a521b3a986573635d6b68f0ed32d34
7e31252e58e751a92b9056ce37b1e06e3453eb17
F20101107_AAAXBU pinedo_p_Page_046.tif
51508bb90048a7667edb77c3a71aca04
6ee8d10ccace8e2e7779ebcbe2770375be9b94ea
37878 F20101107_AAAYLZ pinedo_p_Page_238.QC.jpg
506876d029eccefd35ed27ca556f11ff
8491bac84a65b2e991652f50f83a19fe9ebcac5a
190417 F20101107_AAAWXF pinedo_p_Page_170.jp2
0dae266e9cd9347e3c024aa8f0a5ef97
cc11ec953af3f1cb75b8c189958a9de255a9c8d6
219094 F20101107_AAAWXG pinedo_p_Page_171.jp2
91a19ab229b30a8de1cedc7f1517c799
9ddd90acd9f80b7e0921f3bbd9e4b3a9bae9021d
F20101107_AAAXBV pinedo_p_Page_047.tif
ce4e4776f0a73fa405f9a3b5705f6089
94e76a86089c31672ece65c24072089a6f394652
1958 F20101107_AAAXUA pinedo_p_Page_037.txt
931e8b226308b05eb788a7618fb6078f
e885c417268c11f6ad37768368a01e9059c87fea
196084 F20101107_AAAWXH pinedo_p_Page_172.jp2
29e0d85938b1c57f0c3b0571cf4e786a
80b955742af0468a0157dd830ca326ecd5ef1a15
F20101107_AAAXBW pinedo_p_Page_048.tif
ef31e95070949308b688edefcebfebb7
8590f5bdef098316b5fb057e00532a1ac35d80ba
2082 F20101107_AAAXUB pinedo_p_Page_038.txt
30d70a2dd8ba6e71d9344e87223b1503
2a777349d5d8d20c7a2b2ef0d290fc458ca2b607
273817 F20101107_AAAWXI pinedo_p_Page_173.jp2
c31535a9cf7a5ce7c0d57c5295dd72c0
f5b07dc6271501fc786d3e47802f7eea5d3e8677
F20101107_AAAXBX pinedo_p_Page_049.tif
b95afa0f76fad2396357e0dc9d24685f
7ccf79c347582af546f7e5f2e795656dd3462c4d
2000 F20101107_AAAXUC pinedo_p_Page_039.txt
75d517bc0639ce76040cbf18aaf28daa
53e95db81bff2d290e2e772d1ce6ffde66bfbf24
207421 F20101107_AAAWXJ pinedo_p_Page_174.jp2
64e765b75c6f18fbf73b5a7928d1c570
d3ec7b49c5cf14f21d77d8a79d2d09582276afd4
F20101107_AAAXBY pinedo_p_Page_050.tif
007d5e93a4429213d3de8a19652ac999
1be88c26e3a2f301aa6ca83bdb8a93300d9ff9d1
F20101107_AAAXUD pinedo_p_Page_040.txt
58039e4c4d3a418947ec7eb430eacc36
9fc29f0e678c8a426515b7d28a00368da187330a
262154 F20101107_AAAWXK pinedo_p_Page_175.jp2
caf9a018a4cc55c95b6cc2e06e952bd3
a6f171e3e5e1b13a45b43102040ab52a6de50318
F20101107_AAAXBZ pinedo_p_Page_051.tif
e3a3efaaaa42b9b7f0ae53169ebbe46f
e40cd0b0d9adebda63c4ee5e780f5836ccf75429
2032 F20101107_AAAXUE pinedo_p_Page_041.txt
b2fc89d8b6f39c8eb1ca0c943e9871e6
478927352f75603f437083f2f5dc2cc6cf34b1e3
F20101107_AAAWXL pinedo_p_Page_176.jp2
ff5207038cc30d9bd787350fc7c5b4d0
c5125a07974db98fbbcac5c41af5436244753d63
F20101107_AAAXUF pinedo_p_Page_042.txt
e0af48e25c512c9acccfb4c11398f996
38e6754513286b8c74b06813e1edf0cd30a07946
110441 F20101107_AAAWKA pinedo_p_Page_063.jpg
881c1fc2f66a913f53c278a9a895c76a
ad6ff3a61788458b6c91c44d21947929adc3f6d2
F20101107_AAAXUG pinedo_p_Page_043.txt
f02a8cf8d06928626e46c033c830f0d5
37d29cf336c487b55689fbc673cd70b46a1248f4
112170 F20101107_AAAWKB pinedo_p_Page_064.jpg
6537dcfe7df83c98f3eb77d5401a58d6
512546fdfbf3ae4ebafdb23c4a6bf86fc00010a6
F20101107_AAAWXM pinedo_p_Page_177.jp2
11fcdb89b77af08aa0a077af3f1cc38c
64bd4c29b88a96238f7cefea02e9fcbffb48597f
F20101107_AAAXUH pinedo_p_Page_044.txt
ddd0d1d11f224a70387bcc94fda50d55
8fc7108848e76a52cffad1fa8e369088fdee77ca
33956 F20101107_AAAYRA pinedo_p_Page_122.QC.jpg
f65f6ffe2fbbe218b2d03e31d78eba7e
e912fecc96e0b473394c4cb48fa801e2aa71e3eb
94761 F20101107_AAAWKC pinedo_p_Page_065.jpg
1b125a80d36ad5e212626defb222bda3
2df6cbdde6dd204db492dc29434bb960edcad057
1051913 F20101107_AAAWXN pinedo_p_Page_178.jp2
3bd1868f6c2c0ffcf566d7ced70d5ea2
c5a97dd6beccd4a0af4c0f0424bd71d9c46a8a51
8407 F20101107_AAAYRB pinedo_p_Page_124thm.jpg
b5917cdf29e42589a02b95c40e393c08
7f9098b3c76df42ad77f3591447ccf059816dba2
113581 F20101107_AAAWKD pinedo_p_Page_066.jpg
e3aa85927db069d82898c2dbc045e8e2
fed78f8a4dbcd0b467b1b1bb6074c6f3ec78515c
1034594 F20101107_AAAWXO pinedo_p_Page_179.jp2
36b9db4320b962c9ce854f5129268d8a
aa4631e046f54b0accc572e5f84e2920403db668
1889 F20101107_AAAXUI pinedo_p_Page_045.txt
f6af674a26e5386ecf9e2cff56ea4fe5
74e620a31bab737ceee5e4ad86769c2c460ff532
35346 F20101107_AAAYRC pinedo_p_Page_125.QC.jpg
ba3cf3c659dbb80a6b1c98abbbcf64b1
219d768a8d9321bddfc51e5a9d001c69d59256ba
101999 F20101107_AAAWKE pinedo_p_Page_067.jpg
4d699b330619c92e9c7ac3e6ec3e07df
d2056da1fdbbb54d4cd82d0ceb32471d31e76215
F20101107_AAAWXP pinedo_p_Page_180.jp2
a4e0294e8aec3570bb88a735f71912c6
929a13b9e60106a335ee0e54c63b205bc2b42826
1961 F20101107_AAAXUJ pinedo_p_Page_046.txt
b3bc5f1f4889bac1932c47a5b521e84d
7423befbdc559464b61fb31960d86255272422f6
F20101107_AAAYRD pinedo_p_Page_125thm.jpg
078ff0d32ae9b05c07abc28d10adfc1b
90147947169ac22ffcd3e37fa691aa93933179a3
101965 F20101107_AAAWKF pinedo_p_Page_068.jpg
f865028423c11f123f80c9bf1fa339a2
d9a60f05f80896a85c4a7654ea2ab113cbcc8deb
F20101107_AAAWXQ pinedo_p_Page_181.jp2
c74316da71c8c96921e869a9f8047a71
51e56c38bfc413c728c83e12582c17c1bf6787fa
F20101107_AAAXUK pinedo_p_Page_047.txt
d8804339f087b3de880d90ed85353c78
79c064b7180e8bf8a83cf75836425ba9331778e9
110359 F20101107_AAAWKG pinedo_p_Page_070.jpg
bb011282bb872baf3435a74289175478
9f4463779e334af4980c353db76805f848019a44
F20101107_AAAWXR pinedo_p_Page_182.jp2
db3752678fff873c90811ceb315609d3
695f2d26cf22978bb7d10695a0274a98358b01aa
1954 F20101107_AAAXUL pinedo_p_Page_048.txt
bbb8e3b6a51022e457f51ecfbeeefb22
e5d21329c550bfee041c2419a1b4e9fb44e7caab
33965 F20101107_AAAYRE pinedo_p_Page_128.QC.jpg
7ddcea73649c083bd5b8740d1cd8532c
18bc53f77c3e583ce00714595fafbfdf783f362d
92382 F20101107_AAAWKH pinedo_p_Page_071.jpg
52746c7fd1e0b24cac4d70550fd139c0
76ed1396f8a8f342a51a8fc988c712a3579cb751
F20101107_AAAXHA pinedo_p_Page_184.tif
f3ded2641ad81aa757e9785a68152241
57f832020ed5ac980b738f661bcec3b02c6727cf
F20101107_AAAWXS pinedo_p_Page_183.jp2
69acb767d83d481481964ee1b7370e18
ba2703dacbb2afcfae7fdd21e0d9f788778a0549
1963 F20101107_AAAXUM pinedo_p_Page_049.txt
e67a72b4fa34bda7f4f7a16bffead13e
487274c6bf510751dc2d34c817072c89f0bb63f7
8810 F20101107_AAAYRF pinedo_p_Page_128thm.jpg
8c1464693d602a0f4cce5ff9fe6e4f80
908a0d7e01d264cd18404706ddad6b7a0bb7e1c8
94727 F20101107_AAAWKI pinedo_p_Page_072.jpg
8450d2900462ae083dd62135085d732d
674a02c398a0f7d696fffd5bfee8166dbb9aea23
F20101107_AAAXHB pinedo_p_Page_185.tif
d6782ce6d2fbaf07bcf84dfe43926035
764ed4e345ee81eed470623501ae117b66c8df83
F20101107_AAAWXT pinedo_p_Page_184.jp2
0c6b3bfeeea11d56aafa4864f24ff036
deb24a7955e89785fe28aa50be2a99b44a355d66
F20101107_AAAXUN pinedo_p_Page_050.txt
5d43458a10c616da67c6eeccb52ee191
54c9aca830b72ee9ddad0642cf2177680601a9c2
8161 F20101107_AAAYRG pinedo_p_Page_129thm.jpg
1c359a116c2286783ae7d108b0f34194
d70e360badca0d9785003e0ad2ab859d28248c5d
103870 F20101107_AAAWKJ pinedo_p_Page_073.jpg
e4d297da3f7b00d2acba8377b8f54b19
c8ef23a4aa790b1709afbb199d151b3e514a2079
F20101107_AAAXHC pinedo_p_Page_186.tif
4c7df719623f13e8db559fb4a2eda77a
e2e299c6ee758c1194430da6925cd84cb3732471
F20101107_AAAWXU pinedo_p_Page_186.jp2
2e867613e6695a83555feebd8a0d2935
c9d7cd24f0334e11991f2ba208c1fa88b532b50c
F20101107_AAAXUO pinedo_p_Page_052.txt
db685e379a628749b0db03696566923b
bd26ed6190e74db057598b1549a4d89fc1341fd3
35289 F20101107_AAAYRH pinedo_p_Page_130.QC.jpg
d1519c117d6d3e7b9389d939301a9799
0ffbfa9f7c71de6bc9991a4faabb22630f551c7e
104336 F20101107_AAAWKK pinedo_p_Page_074.jpg
af5308985f7fc25f7a9a4e51c6822b19
7556d04f69421f5de8a733d9bb8f55bef1f51986
F20101107_AAAXHD pinedo_p_Page_187.tif
14cad71d3872593da2821b95252e52a1
dfa6f56d85b9ddd62e959af3d0cecadac0c67729
72057 F20101107_AAAWXV pinedo_p_Page_187.jp2
38d714a006869fbb9b714f28e6167a1a
5427d0fae9437338eabe4a52b11e4afddd49f235
F20101107_AAAXUP pinedo_p_Page_053.txt
d83ae8a4c02d8b0a97910ab4d82f76ad
d86302b60d29b4cc4cc2943f1158d88975a6eea5
31254 F20101107_AAAYRI pinedo_p_Page_132.QC.jpg
9d78a6130fca45f0e11feb3b3e36bc36
bf5c0ecddc43770a65f92cdf639ce429b7d3bb25
107047 F20101107_AAAWKL pinedo_p_Page_075.jpg
a00b2b8bf0a2ce28042d429e94dced65
9c2123a1e7d68fcb563cb43032a49f5fc3e3d53d
F20101107_AAAXHE pinedo_p_Page_188.tif
5584a712cbf3e7c4b9d4dff6de475728
5a1603a3d50609943b64c4fbbe4431c8882e2419
195252 F20101107_AAAWXW pinedo_p_Page_188.jp2
1d0618e7d6a8c245d6faeb01ac2a4528
e904385627a48b7ef9dd6d2c9d406281106491e1
F20101107_AAAXUQ pinedo_p_Page_054.txt
429be68796aafc661cc44bcb95f656c9
af0614785a2c29e117e237e93ea44030a6e440a1
22948 F20101107_AAAYRJ pinedo_p_Page_134.QC.jpg
fd791cf63c33eb6aa5395b63607faaba
bd8cdfd0c4d0c5cf00b3d86e7b508b3192922614
106393 F20101107_AAAWKM pinedo_p_Page_076.jpg
a941c3349d3dd8785c7cc0d76beeebf3
f7dc96b59ec99822872e90e598e161854f88743f
F20101107_AAAXHF pinedo_p_Page_189.tif
d7e672197549ff78c8dd97721a15ea57
9c66d3e0e365612427b125cb0900097317f733b8
230090 F20101107_AAAWXX pinedo_p_Page_189.jp2
95e13bd3b60d07cad6cb78acaf9f5884
b556d3cd6541d11f9f860ccce5bfc462ea0f50ee
2015 F20101107_AAAXUR pinedo_p_Page_055.txt
7fe13ed881f3e5e916b042fc6e240734
75432fc4253cbb21d9d468d6bc28cedaa46ba359
36990 F20101107_AAAYRK pinedo_p_Page_138.QC.jpg
89183ceddfc2eca5515a04393adcd73a
2d794f033bc2045beed9f5d7f5ba1d79ff8f763d
108260 F20101107_AAAWKN pinedo_p_Page_077.jpg
6c03d9dffd1adb3141b3de5b7c9710cf
addf04dfa9e2b963a5b2ddb27d214965f4286c49
F20101107_AAAXHG pinedo_p_Page_190.tif
afb727c8dbcbed30cff469e3094c669e
725c61a9a131286320b567ca413f2dcc304171f4
239154 F20101107_AAAWXY pinedo_p_Page_190.jp2
ab2ac3ee4375f58b28485f6cc36481df
5c2e2f8b157db5d8ea2e1f60183e02ad64c2ca53
2073 F20101107_AAAXUS pinedo_p_Page_056.txt
cecccad8f6985f9d288c6664d8663e3e
e0cd97139f65eba233ea1b8a62f2ed665a03f7cb
9010 F20101107_AAAYRL pinedo_p_Page_138thm.jpg
1b42f5f8948d4fd9efe3d705224fe093
d458d9c1fc35f74cf16b1a8e30045b7a0027aa14
98358 F20101107_AAAWKO pinedo_p_Page_078.jpg
394da8e421325fba8e70353b43b1e8f7
3065ad6edad9f743958ce2ff426933ce86188e1e
F20101107_AAAXHH pinedo_p_Page_191.tif
b23fe0e91f5459e3c80703e2eb23a137
9fcdda85022b40173916e0d97fba479423ce3bc9
499229 F20101107_AAAWXZ pinedo_p_Page_191.jp2
6fbc50c138d55a0839f419dbce4bdc4e
d663574fd50e92e6c577328d4b8b2718acf933fe
37096 F20101107_AAAYEA pinedo_p_Page_200.QC.jpg
2dbf99a9973d1e521631413b1cb9fe78
81c072fdc1645b7cbba753c9e541b8bb2ebb25ff
1950 F20101107_AAAXUT pinedo_p_Page_057.txt
af92c67f3919909de4db59e4e2a3b850
06453338e903119f7f93443a3420d800ec4cb967
8579 F20101107_AAAYRM pinedo_p_Page_139thm.jpg
c127479d35840dcb6ea1f54bb00933c9
d2b0d851475d78b9008ddb6e30cbcd20da1192ca
98036 F20101107_AAAWKP pinedo_p_Page_079.jpg
e9e3c48088ca09f34b5426a2f9471302
738db59050b852358d85abb7bc89bb18548ae3dd
F20101107_AAAXHI pinedo_p_Page_192.tif
55920614b3b5a3d93c58216e92a91b26
31a025cf3308ff47999caf6392a9f86e222db7ac
34016 F20101107_AAAYEB pinedo_p_Page_124.QC.jpg
ce1495393b290f5c443079a9f37de07b
43665b547ab2bf19bd67d9b3b1a03730a78318c5
F20101107_AAAXUU pinedo_p_Page_058.txt
6338060e45e1f0a881b401fd4c2469ad
d2a7b3eb2bbc0f1dc241a18d707b0fb2a93ba175
35016 F20101107_AAAYRN pinedo_p_Page_140.QC.jpg
5af0f35d9a2ecf9b6d33222126ac0c0c
f35a5d41875186ebfd5cd6068bde8f3ad8cb72f3
97446 F20101107_AAAWKQ pinedo_p_Page_080.jpg
461f0c035ae7d3722a2578c4fff172d7
7584d4e51b8346c42976cdf4b2ae633d0e85653e
F20101107_AAAXHJ pinedo_p_Page_193.tif
be4e37729e7f68121d60d9dc9866df4d
83fa2a44c205f09ea7b2605cd4a92cc2c63ba51e
2625 F20101107_AAAYEC pinedo_p_Page_210thm.jpg
a8363ddbcf354572e4f0853d8a7ac472
6f9eeffb13c932b7efc9b8f75cfec842c538e0da
1893 F20101107_AAAXUV pinedo_p_Page_059.txt
e3b3feaf233355a35b7b283b2b984540
c7628d19253bddf66c2de84b6a4639e5ac708a77
8468 F20101107_AAAYRO pinedo_p_Page_140thm.jpg
6d740603a12168914174ddcaffd1678c
f9c02bf9c155c2e06f41562f72615c6d2933915d
105290 F20101107_AAAWKR pinedo_p_Page_081.jpg
39eedbecf2e72c2e5ac5b05b3c426a9e
8d8f07d99de54a54fa7489f39446777d65418763
F20101107_AAAXHK pinedo_p_Page_194.tif
5355aa299894f2be13556f02ec78c7d7
b1f3575e84c7b92db490889df5e894bfc12a5ce0
3489 F20101107_AAAYED pinedo_p_Page_212thm.jpg
ae3dd6c9753437f0c9bb5a9250382714
33a5186d36c46491d154d25d0b3bbc8f873c3ef8
1897 F20101107_AAAXUW pinedo_p_Page_060.txt
8841ab1841cd1161533d311041adb19e
d7f87c03b5029689fb55a8d229ff0d1c43c9217c
8292 F20101107_AAAYRP pinedo_p_Page_144thm.jpg
04e13489ae5951ccc2b93f308cd7bb72
9793d1c656902916a64d159898873318b474bc5c
108908 F20101107_AAAWKS pinedo_p_Page_082.jpg
20556b81e55cfc99e4ce373790d9fb2f
87853643927fc1c19c1c4522b5526a92ee79a7f3
F20101107_AAAXHL pinedo_p_Page_195.tif
7ad22172d2d80c4d4bb498dd68ca377d
b80df668d2773ba3e9fe82c2cd850d10823c8915
8131 F20101107_AAAYEE pinedo_p_Page_114thm.jpg
1fe7e4fc4c9e7a1f258781d23a2320e9
eda5b7c292de19c0ce9409d283d4e8e68b30229c
1982 F20101107_AAAXUX pinedo_p_Page_061.txt
3707df9df9a87ae5f18113271601af60
8b12ec07dc6b81f8985b57b44710d4bda76d24f3
37153 F20101107_AAAYRQ pinedo_p_Page_145.QC.jpg
c20f211b01d7873636bec9412f3bc486
75e1e39e30f1833a65e0ee9fbc03582c93bd5974
107644 F20101107_AAAWKT pinedo_p_Page_083.jpg
0221e01990cb4e6fe5b4a79cb732266e
0374ce03eaf3b34c1597cb842b9929acd4b3b687
F20101107_AAAXHM pinedo_p_Page_196.tif
227b0728fdd52fffbb797c16a53b1db6
5467c978afdec94a2e57579a33773236e206a3da
8088 F20101107_AAAYEF pinedo_p_Page_046thm.jpg
d0eccdf47752699c49de9d1fbc72fd3c
92d5f614a6fdd8e3c349a3937ba1c77e0ba7058c
1942 F20101107_AAAXUY pinedo_p_Page_062.txt
11de5fe8a67d6b2942261b9f84eb717c
3e44fc66e53746d3b6c974cb600035fe82d295f1
8546 F20101107_AAAYRR pinedo_p_Page_145thm.jpg
03ec66fe330f23cca6eabc3f1f3ec861
b5a91563f6b59cd0cdab3b96fb5488b5af50ff25
101028 F20101107_AAAWKU pinedo_p_Page_084.jpg
fe2309f6e1d3099c82623b1f70f560f5
f92e34a6dde2365a63503c0f85ad1b11d7cbdf18
F20101107_AAAXHN pinedo_p_Page_197.tif
d74bfb8bf65ccbca8285a435802556d1
5e8f7ce64d7821a5e4d9c880f0d725b52daddba2
38705 F20101107_AAAYEG pinedo_p_Page_217.QC.jpg
1bd19538aa3a024a550b91fa5eb133d5
58b807555c100be755fea431740ae32c760aaeeb
2141 F20101107_AAAXUZ pinedo_p_Page_063.txt
1a8e877a570c916578599bbef160529b
f615330ae527e144de902e150f8177f5d186dd1c
36361 F20101107_AAAYRS pinedo_p_Page_146.QC.jpg
d38f46b907286f2b0b2ef14233c6caee
fc99ab9b968c2f5a95e36e8dc668e85efcb4562b
F20101107_AAAWKV pinedo_p_Page_085.jpg
ce8925843201208c58a408303f0a4331
4f232093eb24edc6acb256ede2c1402025ab2e4f
F20101107_AAAXHO pinedo_p_Page_198.tif
943a8f2197933dc8800569aadfa2e91c
0a275722b7fabd58cf4737c3ac558f9297c81196
23464 F20101107_AAAYEH pinedo_p_Page_246.QC.jpg
c16e34ab8209d902a5413f33856e4d6d
fecd8da4ab0367c427795d1fdc53589cc356b721
9267 F20101107_AAAYRT pinedo_p_Page_146thm.jpg
adde6b94b6d81708c8a90a6f0f60e40c
a79fe2ced7ace42bf07c865450ba1541e3568b08
111660 F20101107_AAAWKW pinedo_p_Page_086.jpg
c7124eb645263ac9e6ae2bf943c44208
b89cb5174aa994816206441cbc468015d7b06f75
F20101107_AAAXHP pinedo_p_Page_199.tif
48031b561eda35ea70dc494d7b847197
4eb969ff1315b6798291d2cb28c1eb27fe61d889
8570 F20101107_AAAYEI pinedo_p_Page_090thm.jpg
d4560acabea8a3f2087fa3d87f4a2910
7d304ffd3f9ca0eed48f06841b44da6b6104c709
8718 F20101107_AAAYRU pinedo_p_Page_147thm.jpg
35f7efcea6437e347e684d96a916cb78
5f47f0371a1f0a513e3ab8bf45b72aa95a5c04ce
109866 F20101107_AAAWKX pinedo_p_Page_087.jpg
ddfb2c6a8c18fafd0f53d52431f47793
10a955184d1d15c86cb1cbfa84284a575ed49857
F20101107_AAAXHQ pinedo_p_Page_200.tif
a6c3c97d3fe00c128e971967e877e754
8aa092162dc25d7d0d7eba05c53d647bbaf1115c
7931 F20101107_AAAYEJ pinedo_p_Page_027thm.jpg
ae2791f3c176235bf51f35f3f6d49932
7895ee0134d8d084705b58822a6ebfc0f7ff3c83
34147 F20101107_AAAYRV pinedo_p_Page_148.QC.jpg
e8aa392b2a23f8ef1b32d65c92f38984
e4178180bdb4ffad9eb9b4f663f29ec57306197d
102423 F20101107_AAAWKY pinedo_p_Page_089.jpg
f5c701b90e968ad3e706195870fbd7b5
b7a3cbffd4fd228f2696e435083644dde0978b48
F20101107_AAAXHR pinedo_p_Page_201.tif
7937b67d67c74c637685fb96ad014778
843886a0a56cfaa93d5cf9028d626170e6ff3661
30227 F20101107_AAAYEK pinedo_p_Page_019.QC.jpg
fc4c28698986d9e86109b14f80ab0379
e1f96cb4a756ce5058d13ece77061c73a49b4c04
8663 F20101107_AAAYRW pinedo_p_Page_148thm.jpg
6f6ec12815565d57e30d23f3464e3fd3
62252ce5a7b1737d00e1c718e64bb6f0f8084683
105904 F20101107_AAAWKZ pinedo_p_Page_090.jpg
2723858578c89898a39b22a308c2f89c
a81c055114dc92170eefd56c71f990554d5c103e
F20101107_AAAXHS pinedo_p_Page_202.tif
c26838e8f3bd1fbddbb328e6519b2f60
b0d453f31d65f83656a227b889f1ee0daa35d7df
34598 F20101107_AAAYEL pinedo_p_Page_057.QC.jpg
8b1be9582c8d1badc5c9a0386783fed1
83576c9fb6b974ed889fded915e361636603ca54
11643 F20101107_AAAYRX pinedo_p_Page_152.QC.jpg
03e5b7b0b5f69f49b3d96d1c14772ed6
b6419cb9943aedf9450fd5bc04239b98661be8b1
F20101107_AAAXHT pinedo_p_Page_203.tif
dd5ccc7d7db45523afc97b8d5957dba4
6e40158a13a03d100fcfd0d0f7d2e9b6ab0e7077
37571 F20101107_AAAYEM pinedo_p_Page_086.QC.jpg
83ed62e3ac0a365da08eabbcf75cdeff
f96f2da52314ea5bdca3c17545e9a146034b66b9
2241 F20101107_AAAYRY pinedo_p_Page_155thm.jpg
6bc3187d74f6742cd62ec8e006ebdbbe
8c1fc608f6e86e9f8bd493714a280b4f4e328ea1
F20101107_AAAXHU pinedo_p_Page_204.tif
9ab796dd8311064ec3c93d91d68c9135
7b97a521b0b236e8a26e7c09fcfefe82258fee1e
8098 F20101107_AAAYEN pinedo_p_Page_133thm.jpg
683c56d4a69e07e1b8caa7903d518e27
53d6a83d77f4756bbbb640c42b522777c3168eaf
12275 F20101107_AAAYRZ pinedo_p_Page_156.QC.jpg
686d7bdbc869ede948d389dd7d17eba3
12bab3720d66aa77ae2e19f5585c6031a7e71795
F20101107_AAAXHV pinedo_p_Page_205.tif
454fa09216a6a6902bedddca75eb9a08
fb0c018bcc9d49e35b374565437ab60bacf96a1b
6049 F20101107_AAAYEO pinedo_p_Page_245.QC.jpg
ea313fe83218025eae7070b7079c2b2b
58fd9477ba7ce0feac755b460ca1da763264ec53
F20101107_AAAXHW pinedo_p_Page_206.tif
5fc02ec988eceace4108e182534a9108
ebddabd34883b72a62c19191915b46cbea0d4fcb
32575 F20101107_AAAYEP pinedo_p_Page_027.QC.jpg
446d4021da9ded1ee3fee3a7b16b2fa1
eb66808bf0f47ca4e428f3224efa0d9f129b3f5e
F20101107_AAAXHX pinedo_p_Page_207.tif
0eb7154603032a080872bb40c5a0b356
2b447f784d308b9cda3be9987b73b41e8637ee25
32661 F20101107_AAAYEQ pinedo_p_Page_107.QC.jpg
4e94cc3b52f14a5b7046e96eec0ec908
fb34e0d3d1a3123687bb9d1bb406e86b3601c10f
F20101107_AAAXHY pinedo_p_Page_208.tif
30074c26897859c8b07cceb0172671dd
dbd923daa8289fbd8e9924a8256bf22bc339fd30
5717 F20101107_AAAYER pinedo_p_Page_134thm.jpg
5b739aeef99a1464ea29fd0b7882d8c7
12d3a1ab1bff8719d37558850ad7b435cb8125c6
F20101107_AAAXHZ pinedo_p_Page_209.tif
1c5b801265df0d69d79ff0fea3b95a9d
72ce8b2838fee8e6de8754e2ec1e163004793d25
35288 F20101107_AAAYES pinedo_p_Page_053.QC.jpg
442ce239e09b95cf7ecaf93da087e6dd
03442615c84efcee57afa6e34c6c38355ebe5637
33356 F20101107_AAAYET pinedo_p_Page_113.QC.jpg
ea6a5329d45179021492fca04e6d8669
4e99de31944c60bba93db7505b97fa7f75cc7871
127630 F20101107_AAAWQA pinedo_p_Page_224.jpg
a174a04614d0229092993a7c18a32d63
9d47c2281a02bbcd615e1b0de82e7f80f4343ab7
5249 F20101107_AAAYEU pinedo_p_Page_206thm.jpg
9f4b226b8422291e13035b679a9da8ae
5fd6ed1a793c2bf1d3292ad267f71dc783cc4958
144697 F20101107_AAAWQB pinedo_p_Page_225.jpg
7258ef94738c79c24c0303d82e8f1848
0def3d10bd11c7550371b73e6521ea44e9d91426
33551 F20101107_AAAYEV pinedo_p_Page_163.QC.jpg
db6c7f220c81f92e1d5c197e415f56f3
2a8a43ecf654d42e809284353b406134e6c391c0
141126 F20101107_AAAWQC pinedo_p_Page_227.jpg
1d74035b282946015081b70de247ae27
ba01f311aa1f2dca3b0ad86ebee0d88ad852bfa6
29114 F20101107_AAAYEW pinedo_p_Page_018.QC.jpg
284b3eef26b85168b34128ebb00c6cf4
b044e4b82506d2d893434f55eb3f2c599fc5ff7e
127119 F20101107_AAAWQD pinedo_p_Page_229.jpg
997241b5583b3b3b869f68d98289bb59
9226b7b89444a14fadebaf1e21ee617929675e0a
136632 F20101107_AAAWQE pinedo_p_Page_230.jpg
0f86d586ba866a337475960f051f7005
fc5b8fbd329cbc8f07fc99803890f3eb0c083c56
35179 F20101107_AAAYEX pinedo_p_Page_032.QC.jpg
6f7dffe5480e389df3d2ec62e695c620
4d531193d7264788993e73cb9bbf5fc6251a162c
1769 F20101107_AAAYEY pinedo_p_Page_245thm.jpg
efa1e35ee9bc042708242ea09f3dfb0c
f966e532d8dcc8465473464da68be77f8ccc0187
132709 F20101107_AAAWQF pinedo_p_Page_231.jpg
0f4b3f754130f7f999a47a51852f6a5b
1aa7fe3efecd4629c0937a97bbff1079d3032a72
33439 F20101107_AAAYEZ pinedo_p_Page_118.QC.jpg
d8f70e3307cb3badc2952ffbb4c8228d
7e1056527f9d63b3e175b6ad38872b32ae27e713
129454 F20101107_AAAWQG pinedo_p_Page_232.jpg
04f7675db2d6b6291c845dd434880930
350619be08fbb68a9bd4354502ad3c33aea150e7
51857 F20101107_AAAXNA pinedo_p_Page_097.pro
a2c05880832737078543523d45e1977f
344e8560b10a37b4ae9a09e2647d4006bf96c3f8
132181 F20101107_AAAWQH pinedo_p_Page_233.jpg
4c221b1604939d0620c3ec6c8d624e78
6f53f0adecfee455e995a46d9f9e3469d942bd33
140736 F20101107_AAAWQI pinedo_p_Page_234.jpg
72fa377f8f8a7dd5bf5be5607f8e6d3e
e8bec417a235fd0c1808a15ae6f20d99fa069f0e
52409 F20101107_AAAXNB pinedo_p_Page_098.pro
83a6586bb3c79c044efbcbc570d181f8
d6596c62774467e732a0a8d0c95040ab13b0db5c
138234 F20101107_AAAWQJ pinedo_p_Page_235.jpg
eb706e72f6a0bb334e63505015b996a1
ad01529795c7e068962b73459f69416f1d3dda1d
53188 F20101107_AAAXNC pinedo_p_Page_099.pro
8aec8530dc50ab9dda7e6b40a6f27dd1
0b5342c513b2517f9299e4b2298f8d62938c5dd1
138593 F20101107_AAAWQK pinedo_p_Page_236.jpg
4a2ff5910b6e38e5edb2f195765052d6
e8cffb912dba3e93050b03f4f5e1b2e67891d3b2
50044 F20101107_AAAXND pinedo_p_Page_100.pro
6a79a391e96ea8bea0926ebd8cf1e118
61a76612753e297c74ee28ec07cc9bbe4938c042
147380 F20101107_AAAWQL pinedo_p_Page_237.jpg
710c96ed3623f39798b3457968536276
dd5bd4fd0f07708d320e223c5996aaf2ce0bd0be
49160 F20101107_AAAXNE pinedo_p_Page_101.pro
7671e4ae4c3a3e4f50ae4771cbd54d9b
4323ab44a9de4a383e64a06c1256241fbdcf6373
130510 F20101107_AAAWQM pinedo_p_Page_238.jpg
d416d924c185daca8b34f72b220fae42
f7f3ce955c67b3c3be797b703c55ffc2f06122ec
54286 F20101107_AAAXNF pinedo_p_Page_102.pro
5a3c6f3ed978ce34fe2cefe4e9ccca2d
28bf24671cb74df7065c07cb3bfa228679941f2f
132882 F20101107_AAAWQN pinedo_p_Page_239.jpg
41d5474e3e9f393f967784989cfd96ef
0938d9ba77333a53c55b4bc1f69ce6dc2c19d27d
51513 F20101107_AAAXNG pinedo_p_Page_103.pro
44ae627b275059f266fdb9b065fa1da1
38f582aff0b99509a329b7efa40757a329efef6d
131183 F20101107_AAAWQO pinedo_p_Page_240.jpg
6f7b6e36b9666abc88ec3c7fdf176808
e0ad9c4a06fa9add0ed12764d21693987d9903a3
52623 F20101107_AAAXNH pinedo_p_Page_104.pro
0c440ba114585b1172066a03baa4edec
7b885d563937a30597652adbc6c55f56012b43af
36635 F20101107_AAAYKA pinedo_p_Page_232.QC.jpg
9e83836b35af1600d4436bd35e45281d
bb8d6b5ea2a66d11f6fa2500721fa521e29e9271
138532 F20101107_AAAWQP pinedo_p_Page_241.jpg
d16bce7064d253258d37b20f2692993e
ce9338288dd9d5d468d886ba34faaf2490abf0c6
54309 F20101107_AAAXNI pinedo_p_Page_105.pro
03482b2c4451f09291219dfb25fa7336
e44843a926809244108bf5d7b01bf086d81f7289
35857 F20101107_AAAYKB pinedo_p_Page_035.QC.jpg
27abf939e725f87afc41df0ca70dd343
2085c1c08ca09420d6330659eaeea36b64529aac
133455 F20101107_AAAWQQ pinedo_p_Page_242.jpg
8a7d881f255faf9951a4955fd504040d
0ca6ae97bee8528f4e59a557617994c91da8a221
53805 F20101107_AAAXNJ pinedo_p_Page_106.pro
8baf6414d6c92437dec7460ac913cde1
122c1ab1780beb4d813e4b291a0d76f1b1ec0561
2081 F20101107_AAAYKC pinedo_p_Page_174thm.jpg
ca124cf9daca0795b01a2ccdb2d04b0a
eed2b38c4deddcb2217064529a3fe00ad51ac82b
149909 F20101107_AAAWQR pinedo_p_Page_243.jpg
015bbc9b19acee395848ab9e23912ea2
0aad2cdeecd91cd5fb458f342d4f7fb6a7a98987
50425 F20101107_AAAXNK pinedo_p_Page_107.pro
acc4a6d623947b4a40470abc91fa231b
cb34d94ccc0f7fff722b43ae1b1269001251315a
32978 F20101107_AAAYKD pinedo_p_Page_203.QC.jpg
55b8ed6ed7a233c985932626785ee253
a7f010f567413b3166c1f044252707312173890c
141133 F20101107_AAAWQS pinedo_p_Page_244.jpg
564095bed476dae690cf2d9abb241389
195ea3769634d78f304ee8150ca1a471ef24fa3f
51937 F20101107_AAAXNL pinedo_p_Page_108.pro
fa7dcab0b06ad99a66529a27c165d199
37ba3cdd4878bac6edba48dc1c80ca487f509835
9136 F20101107_AAAYKE pinedo_p_Page_235thm.jpg
cae14d86d78c48a0bef1324e75f31ae8
ab825dc1b6155264fa83435af1c6685605d93751
761569 F20101107_AAAXAA pinedo_p_Page_246.jp2
8d3187096ddc86acbc599966db019333
251d47a076083346e31156a8491ff6d7ed344b16
20091 F20101107_AAAWQT pinedo_p_Page_245.jpg
1a1f06862f734a9888357e071e8510b5
1b17fa29b814245f49d0db1027b8da6635a77e9a
48242 F20101107_AAAXNM pinedo_p_Page_109.pro
992edc7ee74662c5a777e90d49baec57
07a2bb445151e4ec3f9a76cabee715f43e5f7bf2
8071 F20101107_AAAYKF pinedo_p_Page_178thm.jpg
b434b21ee2d59881976744dd2d48b351
b42428413aba33f75e8997d87073435be0782b9e
F20101107_AAAXAB pinedo_p_Page_001.tif
0b4ce5c25ff1d4498dc4f609a5c866ca
07c18f9bcea9ca79640cd8cdcd5549f7708eb05d
71584 F20101107_AAAWQU pinedo_p_Page_246.jpg
d5123026da5d28e94eab15e05b9ca4ee
e9be24bc64aa523e5a2b960a95bb9d2258979333
55863 F20101107_AAAXNN pinedo_p_Page_110.pro
a730b83d84279a7ff103c067bad2d7dc
f17667867e0ee8d25d24a84a23eb3a009cd22a4d
8255 F20101107_AAAYKG pinedo_p_Page_085thm.jpg
29da10d959d3fce8354078a3d94e5856
514b434c2e354fc8c4562318b7e3fb347846b97c
F20101107_AAAXAC pinedo_p_Page_002.tif
55f4dece17af7efaa899651d946c3586
dc02ebef68cabafd20af7338750b20c77a522092
262072 F20101107_AAAWQV pinedo_p_Page_001.jp2
cd4c3c575dda94a8188aa927b03f9e1d
316bb8724d23ad4f282c715ba8b2d4818e4f8b2f
52141 F20101107_AAAXNO pinedo_p_Page_111.pro
95666f0c7a2c7b6f39e301bce363c369
1f7fdb4393250a3d5bd738ff9a21cf4dfcd8c15d
33419 F20101107_AAAYKH pinedo_p_Page_181.QC.jpg
6ae68181de63e2d40836600b3b759706
6237fab32afc9815f8672097856beb22606821b0
F20101107_AAAXAD pinedo_p_Page_003.tif
a1a5d87ce9e0455c9ad136324f167a62
71d3c979bdc7269b64ce9368b6da62a51026b2c0
24470 F20101107_AAAWQW pinedo_p_Page_002.jp2
6d147841ca27cf30381a7548d170e809
46b06f106c6f1e7f9178bb58632e8fec5d254daf
47574 F20101107_AAAXNP pinedo_p_Page_112.pro
faa34fb27aaf24dc759643c198eae64a
0f96dd8f1d7d46ac93f04d80e6df2f3210b5734a
31056 F20101107_AAAYKI pinedo_p_Page_080.QC.jpg
6d36cce37a26e4aa6872dddaf3c2d77d
bdf939ea796527812c5d23274cbce7ef375eacff
F20101107_AAAXAE pinedo_p_Page_004.tif
2672a2ab0d0d0f3a55d0c8550c663eca
e6034ff341124af8d4346b0908f55fdc6aea3471
28954 F20101107_AAAWQX pinedo_p_Page_003.jp2
b857a1ac327845b3d1064a05e66a9092
0618594ec4e930e09e5d787ae09b273da9f756cf
49211 F20101107_AAAXNQ pinedo_p_Page_113.pro
4e62cb97f08db9ff436409bb1a0d9cbd
4b9c3390a6a06011561001c099bb28cc6ae0ce07
11290 F20101107_AAAYKJ pinedo_p_Page_209.QC.jpg
32555de8062a4478daf36d239700e762
21c276a245784a9bcd93cb2d98f238c3adb56db6
F20101107_AAAXAF pinedo_p_Page_005.tif
7b3c7f5bd8dd9f764b8226a60e3545ce
32795cc5c1b3bead398c99a016ca421a88bce949
1051919 F20101107_AAAWQY pinedo_p_Page_004.jp2
d8e4af497a23c90e76e56439cc48a17b
6ee51937fa39509d290e7fb202b0282d52ba7d50
48689 F20101107_AAAXNR pinedo_p_Page_114.pro
18529bbb8746fcafe80c36ea2e1261ef
978ea7bd19eade342452ea2cfb9895c491bd556d
F20101107_AAAYKK pinedo_p_Page_117thm.jpg
d3ddac25008dd99e8611709f4a1227ec
8d84c373398e670870025ef3af72c70c84dd00eb
F20101107_AAAXAG pinedo_p_Page_006.tif
50bb9b5a90253265eb09ffa0bce42bba
750615b5cb7eb9af06882071390d5b6c15deec7a
F20101107_AAAWQZ pinedo_p_Page_005.jp2
ac40a7f797b8ac638dd889930a017adb
fbac1cefd4ee2e3c421c81b96f5de6c241319b1e
53137 F20101107_AAAXNS pinedo_p_Page_115.pro
0bbe6e1306dbb7cf77eb2f02ae30f304
709d786ecdad7bd0888b45270e871869635a1f8e
41007 F20101107_AAAYKL pinedo_p_Page_243.QC.jpg
b9715a4eb19d4ea70ee8dc5850debca9
bb9f36468e2bb843813ee8b2933c6f95d1b161d5
F20101107_AAAXAH pinedo_p_Page_007.tif
7e6b3bdc68f3ec9227a7767ef2b2b117
c8b063304c5d3dd868673a858c4c344cf7889d4d
53816 F20101107_AAAXNT pinedo_p_Page_116.pro
9d17e85c60cf1f923fc15e50da626295
588a243a8a2fff6ba12713c93d5bf2b84b7ba2a7
2929 F20101107_AAAYKM pinedo_p_Page_152thm.jpg
c6af3288a5cd91c62e01bc7e918d06a2
0d0935126b4fce7554450018415176b19cc25cd8
F20101107_AAAXAI pinedo_p_Page_008.tif
e30542e979beba0f2965ace02a80e00f
91f2d01334c9e35c0b94d08f3cc79b2f951d0591
53473 F20101107_AAAXNU pinedo_p_Page_117.pro
04730b5c4e7409d1f763f385c9888214
d311ca91bfccfbbcecb481d19e4e52874755d57b
3305 F20101107_AAAYKN pinedo_p_Page_159thm.jpg
aa32a04a7820a37a1f324928f08eec51
f509ef5be19b548cd3ad400e463a6e4b20f897ec
F20101107_AAAXAJ pinedo_p_Page_009.tif
52630bb276aed03bfe791dc687bad9de
fc294cface27114fef09a2530549f89921af3808







DIAGNOSTIC TOOLS AND GENETIC SUSCEPTIBILITY FACTORS ASSOCIATED WITH
BOVINE PARATUBERCULOSIS INFECTION




















By

PABLO J. PINEDO


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008


































2008 Pablo J. Pinedo


































To Pilar, Pablito and Santiago









ACKNOWLEDGMENTS

Several people have been instrumental in the completion of this project. Foremost, I desire

to express my special gratitude to the members of my advisory committee: Dr. Owen Rae, Chair

of my committee, for his constant support and advice and for his permanent willingness to

discuss and exchange ideas about this project; Dr. Claus Buergelt for generously sharing with me

his invaluable experience and knowledge in Johne's disease and for his permanent help in

seeking out opportunities to enrich my training; Dr. Art Donovan for his support as a member of

my committee and for his key comments during the analysis of our data; Dr. Pedro Melendez for

his support, friendship and help during the research process; and Dr. Laurence Morel for her help

as an external member of my committee.

I owe my gratitude to Dr. Louis Archbald for his ongoing interest, strong support and good

advice. I thank also Elliot Williams for his friendship and his tremendous help with the

laboratory procedures. I am grateful to Dr. Taimour Langaee and Dr. Rongling Wu for their

technical support in the genotyping process and in the statistical analysis. I thank also my

colleagues and fellow graduate students from FARMS for their friendship and valuable

suggestions. I am thankful for the financial support received from the Florida Dairy Farmers

Association through the Florida Dairy Check-Off Program and the 2007 University of Florida,

College of Veterinary Medicine Spring Consolidated Faculty Research Development Award

Grant Competition. I also thank INSECABIO (Chile) for its strong support during this process.

I thank my parents for my education, their support and guidance, and my boys Pablito and

Santiago for bringing me back to the real world every evening.

But, above all, I owe my gratitude to my wife Pilar who left her own interests aside and

postponed her professional development to live this adventure with me.









TABLE OF CONTENTS


page

A C K N O W L E D G M E N T S ..............................................................................................................4

LIST O F TA B LE S ............................................................................................. .............

LIST O F FIG U R E S ........................................ ............ ............................. .. 11

L IST O F A B B R E V IA T IO N S ......... ............... .......................................................... 12

A B S T R A C T ......... ....................... ............................................................ 14

CHAPTER

1 INTRODUCTION ............... .......................................................... 16

2 L ITE R A TU R E R E V IE W ......................................................................... ........................ 19

T h e A g e n t ................................................................................ 1 9
G enu s M y cobacterium .............. ........................................................ ....................... 19
Mycobacterium Paratuberculosis Characteristics........... ......................21
Environmental Ubiquity and Physical Resiliency.........................................................22
S train s ................................ ...............................................................2 4
Mycobacterium Paratuberculosis Genome ................... ........... ...............26
G enom e sequence............ ... .......................................................... .......... ...... 27
Insertion sequences ........................................ ... .... ........ ......... 27
Insertion sequence 900 ............ ............... ..................................... .......................29
A n tig e n s ........................................................................... 3 0
Johne's D isease............................................................. ...................3. .. 31
D definition ...................................................... 3 1
Spectrum in A nim al Species ........................................ ............................................32
P ath o lo g y .................................3................... .........3
Stages of the D disease ................................ ......................... ........... 37
Stage 1, silent infection ............................ ...................... .... ....... .... ..... ...... 37
Stag e 2 sub clinical disease ........................................................... .....................37
Stage 3, clinical disease............ ........................................................ .... .... ..... 38
Stage 4, advanced clinical disease....................................... ......................... 38
E pidem biology .........................................39
P rev alence and risk factors............................................................ .....................39
Transm mission of infection ............................................................ ............... 43
Im m une R response to M A P .............................................................................. ............45
D diagnostics ......................... ....................... .......................................48
Tests B ased on A gent D etection........................................................... ............... 49
Fecal sm ear and acid-fast stain...................... .... ............................ .. ............. 49
B acteriologic culture in feces ...................... ................................. ............... 49









A utom ated system s ............................... ..... .. ..... ....... .... .............. 53
Polym erase chain reaction (PCR) ........................................ ........................ 54
PCR on milk ...... ........... .... ......... ....... ...............57
PCR on feces ................................................. 58
Detection of Host Response to Infection................... .............................61
Clinical signs, gross and microscopic pathology ............................................. 61
Cellular immune response .......... ... ................ ............... 62
Interferon gam m a assay (IFN -g) ............................................................... ......... 62
H ypersensitivity reaction (Skin test) ........................................ .......................... 63
Lymphocyte proliferation.......................................................... 64
Humoral immune response..................... ..... ........ ...............65
Complement fixation and agar gel immunodiffusion (AGID).............................65
Enzyme-linked immunosorbent assay (ELISA)............... ........... ............... 65
A greem ent am ong serum ELISA kits ........................................... .....................69
M ilk/serum E L ISA ......... ........... .......................................................... 71
D disease C ontrol..........................................................72
E pidem biological Factors in C ontrol..................................................................... ...... 72
H o st fact rs ....................................................................................................... 7 2
Natural reservoirs and environmental factors .................................. ............... 73
Population factors .............................................................. .... ........75
Control Programs............ ......... .................... .......76
Ju stification ................................................................... 78
M anagem ent practices...................................................... ............. ............... 79
Testing and diagnostics in control programs......................................................80
V vaccination .................................................................................................... ......82
Treatment ............................ ...............................85
Productive and Economic Impact of Johne's Disease.........................................................86
C ro h n 's D ise a se .......................................................................................................9 3
T h e D ise a se ..............................................................................9 3
E tio lo g y .........................................................................9 5
Crohn's Disease and CARD15/NOD2 Gene ............... ............................................95
Mycobacterium Paratuberculosis and Crohn's Disease ...........................................99
G genetics in A nim al Production...................... ........................................................... 105
Genetic Basis of Disease Resistance and Susceptibility ............... ....... ............105
Genetic Component in Mycobacterial Infection ................................. ...............107
G enetics and Paratuberculosis ......................................................... .............. 108
C candidate G enes .....................................................................................................111
C candidate G enes in Study.................................................................................... ..............112
Caspase Recruitment Domain 15 gene (CARD15, formerly NOD2) ............................112
Solute Carrier 11Al (SLC11A1), Formerly Natural Resistance Associated
Macrophage Protein 1 (NRAMPI) .......................... ......... .................... 112
R ole in im m u nity ......... ................................................................... .... 113
Role in inflam m atory bowel disease .................................................. ............... 115
Association with disease susceptibility in cattle ............. .................................... 116
Interferon G am m a .................. ................................. ........ .. ........ .... 119
Toll-Like R eceptors ..................................................... ........ .. ...... ... 121



6









R ole of T L R s ............................................................................................ ........123
T oll-like receptor 4 gene ............................................... ............................. 125
Case Control Genetic A association Studies ........................................ ....................... 129
Genetic Epidemiology .............................. ....... ..... ................................ 129
Population Candidate Gene Association Studies .................................. ...............131

3 ASSOCIATION AMONG RESULTS OF SERUM ELISA, FECAL CULTURE, AND
NESTED PCR ON MILK, BLOOD, AND FECES FOR THE DETECTION OF
PARATUBERCULOSIS IN DAIRY COWS ........................................... .....................136

S u m m ary ................... ...................1...................3.........6
In tro du ctio n ................... ...................1.............................7
M materials an d M eth od s .............................................................................. ..................... 139
Stu dy P population ...............................................................139
Sam ple H handling ...................................................... ...... .... .. ...... ... 139
M ilk sa m p le s .................................................................................................... 1 3 9
E xtraction of D N A on m ilk ........................................................................ .. .... 140
B lo o d sam p les .................................................................... 14 0
Extraction of D N A on blood ............................................................................... 140
Enzyme-Linked Immunosorbent Assay ............................................. ............... 140
F ecal C u ltu re ........................................................................... 14 1
E xtraction of D N A on F eces ........................................................................... ... .... 142
N ested Polym erase Chain Reaction......................................... .......................... 142
S statistic al A n aly sis .................................................................................................. 14 3
R e su lts ................... ...................1.............................4
D iscu ssio n ................... ...................1.............................5

4 Mycobacteriumparatuberculosis SHEDDING INTO MILK: ASSOCIATION OF
ELISA SEROREACTIVITY WITH DNA DETECTION IN MILK................................160

S u m m ary ................... ...................1...................6.........0
In tro d u ctio n ................... ...................1.............................0
M materials and M methods .................................... ... .. .......... ....... .... 161
Stu dy P population ...............................................................16 1
Sam ple H handling, M ilk Sam ples....................................................................... ..... 162
B lo o d S am p le s ..................................................................... .. 16 2
Nested Polymerase Chain Reaction (PCR) ....................................... ............... 163
Enzyme-Linked Immunosorbent Assay ............................................. ............... 163
A n a ly sis .........................................................................................1 6 4
R e su lts ................... ...................1.............................5
D iscu ssio n ................... ...................1.............................6

5 ASSOCIATION BETWEEN CARD15 GENE POLYMORPHISMS AND
PARATUBERCULOSIS INFECTION IN FLORIDA CATTLE ............. .... ...............176

S u m m ary ........................ ......................................... ...............................17 6
Introduction ............... ...... ...........................................177









M materials an d M eth od s .............................................................................. ..................... 17 8
Study Population ..................................... .. .... ...... .. ............178
D ia g n o sis .........................................................................................1 7 9
G e n o ty p in g .................. ........... ...................................................................1 7 9
Extraction of DNA ........ ............. ........ ...................... 179
A llele determ nation ....... .. .............. .. ... ............. ...... ....... .... .. 180
S statistic al A n aly sis .................................................................................................. 1 8 0
R e su lts .......................................................................................................... 1 8 1
D iscu ssion .......... ..... .... ............. ............................................183

6 ANALYSIS OF THE ASSOCIATION BETWEEN THREE CANDIDATE GENES
(BOIFNG, TLR4, SLCllA1) AND PARATUBERCULOSIS INFECTION IN CATTLE..194

Sum m ary ......... ......... .................................. ......... ................................ 194
Introduction .................................................................................................................194
M material an d M eth od s ........................ ................ ................................................ 196
Stu dy P population ...............................................................196
D diagnosis .............. ......................................................................... ............197
G e n o ty p in g .....................................................................................................1 9 7
Allele determination ................................................................ ........ 197
Bovine IFNG and TLR4 genes ............................................ 197
M icrosatellite analysis for SLC1 A1 gene ............................................................199
S statistical A n aly sis .................................................................................................. 2 0 0
R esu lts ......... .... ... ...... ................. .................................. 2 0 1
B o vin e IF N G G en e .................................................................................................. 2 0 1
Toll-L ike R ecep tor 4 G ene....................................................................................... 202
Solute Carrier Family 11 Member 1 Gene ............................ ................ 203
D isc u ssio n ........................ ............................................................................................... 2 0 3

L IST O F R E F E R E N C E S ...............................................................................................2 13

BIOGRAPHICAL SKETCH ................................................ ...................246




















8









LIST OF TABLES


Table page

3-1 Number and proportion of positive results for ELISA, nested PCR on milk, blood
and feces, and for fecal culture among 328 dairy cattle in four herds...........................152

3-2 Cross classification of number of positive results for the five tests (above the
diagonal). The diagonal shows the number of positive animals for each test (n=328) ...153

3-3 Maximum possible agreement beyond chance for each combination of test pairs (%)...154

3-4 Kappa coefficient asymmetric standard error (above diagonal) and agreement
interpretation (below diagonal) for each combination of test pairs. ............. ...............155

3-5 Right-sided P > F for Fisher's Exact Test for each combination of test pairs (above
the diagonal). P > S for McNemar's Test for each combination of test pairs (bellow
th e d iag o n al)....................................................... ................ 15 6

3-6 Odds ratios (95% CI) for positive results in pairs of tests. ....... .... ..... .................. 157

3-7 Complementary sensitivity (CS) for each test when combined with a different test
(% ) ............................................. ............. 158

4-1 DNA detection of MAP in milk by nested PCR grouped by ELISA result categories
(number and % of animals, n: 98 cows). .............................................. ............... 170

4-2 ELISA results and DNA detection of MAP in milk by nested PCR ..........................171

4-3 Results for 21 serial testing (9 months) in cow Id#3900. Milk and blood PCR results
are given relevant to ELISA categories in concurrent testing. ......................................172

4-4 Serial results for milk PCR, and serum ELISA in a group of five individuals..............173

4-5 Cows that were positive to MAP DNA by PCR detection in milk are grouped by
their corresponding serum ELISA status ........................................................................ 174

4-6 Serial results for cow Id#6142 tested by MAP PCR on individual quarter milk
samples and concurrent serum ELISA ......... ........... ........ ......... ................... 175

5-1 Alleles: Cross classification of number (%) of cases (+) and controls (-) and alleles
for SN P 1 and SN P2. ......................... ...... .................... .. .... ................. 188

5-2 Genotypes: Cross classification of number (%) of cases (+) and controls (-) and
genotypes for SNP1 and SNP2. ..... ........................... .......................................189

5-3 Complete genotypes: Cross classification of number (%) of cases (+) and controls (-)
and genotypes combining SNP1 and SNP2. .............. ............................ ............... 190









5-4 Univariate analysis of the individual animal odds of paratuberculosis infection
among dairy and beef cattle in Florida. ............. ..... ........................................... 190

5-5 Multivariate analysis of the individual animal odds of paratuberculosis infection
among dairy and beef cattle in Florida. ............. ..... ........................................... 192

6-1 Frequency of cases per genotype and significance for the association between
genotype and infection status (BolFNG, TLR4 and SLC]A1] genes). ............................206

6-2 Bovine IFNG and TLR4 genes: Univariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida.............................207

6-3 Univariate analysis of the individual animal odds of paratuberculosis infection
among dairy and beef cattle in Florida (SLC11A1 gene) ...........................................208

6-4 Bovine IFNG: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida.............................209

6-5 Allele SLC1lAl-275: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida.............................210

6-6 Allele SLC11A1-279: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida...............................211

6-7 Allele SLC11A1-281: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida (). ...........................212









LIST OF FIGURES

Figure page

2 -1 C lin ical cases ...............................................................13 5

2-2 Variation in ELISA optical density in two Holstein cows ........................... ...........135

3-1 Diagnostic tests.. ........................ ..... ........ .... ......... .........159

5-1 Beef cattle population. .............. .................. ..................... ..... .......... 193

5-2 D airy cattle population ............................................................................ ................... 193









































11









LIST OF ABBREVIATIONS

AGID Agar gel immunodiffusion

bp Base pairs

BolFNG Bovine Interferon gamma

CARD15 Caspase recruitment domain family, member 15

CS Complementary sensitivity

CD Crohn's disease

CFU Colony-forming units

DNA Deoxyribonucleic acid

ELISA Enzyme-linked immunosorbent assay

ER ELISA ratio

IBD Inflammatory bowel disease

IFN-g Interferon gamma

IL Interleukin

IS Insertion sequence

JD Johne's disease

MAC Mycobacterium avium complex

MAP Mycobacterium avium subspecies paratuberculosis

MHC Major histocompatibility complex

NF-Kb nuclear factor-kappa B

NOD2 Nucleotide-binding oligomerization domain containing 2

NRAMP1 Natural resistance-associated macrophage protein 1

ORF Open reading frame

PCR Polymerase chain reaction

PFGE Pulsed field gel electrophoresis









REA Restriction endonuclease analysis

RNA Ribonucleic acid

RFLP Restriction fragment length polymorphism

SLC11A1 Solute carrier family 11, member 1,

SNP Single nucleotide polymorphism

TLR Toll-like receptor

TNF Tumor necrosis factor

UC Ulcerative colitis









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

DIAGNOSTIC TOOLS AND GENETIC SUSCEPTIBILITY FACTORS ASSOCIATED WITH
BOVINE PARATUBERCULOSIS INFECTION

By

Pablo J. Pinedo

August 2008

Chair: Owen Rae
Major: Veterinary Medical Sciences

Our first objective (Studies 1-2) was to analyze the association among results of five

different diagnostic tests for detection of paratuberculosis infection in cattle. Our second

objective (Studies 3-4) was to characterize the distribution of polymorphisms in four immune

related genes and test their association with susceptibility to paratuberculosis infection in cattle.

In Study 1, results of a serum ELISA, fecal culture, and nested PCR tests on milk, blood,

and feces for Mycobacterium paratuberculosis (MAP) detection were analyzed to determine

associations and levels of agreement between pairs of tests. The agreement between results was

poor, slight and fair in two, five and three of the ten possible combinations. Fecal culture and

fecal PCR resulted in the highest kappa coefficient (fair agreement). Combined use of ELISA

and fecal PCR has the potential to increase the overall sensitivity for the diagnosis of

paratuberculosis.

In Study 2, the association between ELISA seroreactivity and MAP presence in milk, as

detected by nested PCR was analyzed. An irregular pattern of detection was observed for PCR

outcomes along with fluctuations in serial ELISA results. Kappa coefficient indicated a slight

agreement between both tests, suggesting that the ability of serum ELISA, as indicator of the

likelihood of milk shedding of MAP in dairy cows, is questionable.









In Studies 3 and 4, polymorphisms in four candidate genes related to the immune function;

caspase recruitment domain 15 gene (CARD15), interferon gamma (BolFNG), toll-like

receptor-4 (TLR4), and solute carrier family 11 member 1 (SLC11A1), were analyzed. Significant

differences were found in allelic frequencies between cases and controls for

CARD15-SNP2197/C733R, BolFNG-SNP2781 and SLC11A1 microsatellites. In the analysis of

genotypes, a significant association was found between infection status and

CARD15-SNP2197/C733R, BolFNG SNP2781 and SLC11A 1-2 75-2 79-281 microsatellites.

When variables breed and age were included in the multivariate logistic regression analysis, the

only statistically significant effect was for CARD15-SNP2197/C733R polymorphism. The

estimated odds of infection for heterozygous cows were 3.35 times the odds of infection of cows

homozygous for the major genotype. Results suggest a role for CARD15 gene in the

susceptibility of cattle to paratuberculosis infection.









CHAPTER 1
INTRODUCTION

Paratuberculosis (Johne's disease) is a chronic, infectious disease of ruminants caused by

Mycobacterium avium subsp. paratuberculosis (MAP), and characterized by progressive weight

loss and profuse diarrhea (Chiodini et al., 1984). The disease has a worldwide distribution and is

categorized by the Office International Des Epizooties as a list B disease, which is a serious

economic or public health concern (OIE, 2004).

Most cattle with Johne's disease are infected as calves by fecal-oral transmission, and in

utero transmission has also been reported (Seitz et al., 1989; Whitlock and Buergelt, 1996).

However, young animals manifest no clinical signs and the incubation period is variable, ranging

from 2 to 10 years (Bassey and Collins, 1997; Whitlock et al., 2000; Stabel and Ackerman,

2002).

Diagnosis of paratuberculosis is hampered by a lack of accurate tests. Available methods

fail to identify all infected animals (false negative results), and some produce substantial

numbers of false positives (Chiodini et al., 1984). Tests for detection of antibodies to MAP, such

as enzyme-linked immunosorbent assays (ELISA) present the major disadvantage of moderate to

low sensitivity. The usefulness of serological tests is compromised by the variability of the

immune response depending on the stage of disease. For this reason, it is generally accepted that

their sensitivity in detecting infected animals is only about 30% (Collins et al., 2006), and the

ELISA test rarely gives a positive result in animals under 2 years of age, and frequently fails to

detect individuals in the early phases of infection (Juste et al., 2005). Despite these

disadvantages, ELISA testing of sera is still the method of choice for epidemiological studies and

herd-based diagnosis (Bottcher and Gangl, 2004).









Tests based on the detection of the agent likewise present the problem of low sensitivity.

The shedding of MAP organisms in feces can be intermittent and detection by culture is

imperfect, especially because of contamination, and when few organisms are shed in feces. It has

been estimated that fecal culture detects only about 50% of cattle infected with MAP (Stabel,

1997). The introduction of diagnostic methods based on specific bacterial DNA sequences has

allowed fastidious microorganisms, such as MAP, to be rapidly identified. Polymerase chain

reaction (PCR) tests based on the insertion element IS900 have been the most widely used for

MAP identification (Harris and Barleta, 2001). However, the detection of the etiologic agent is

limited by the presence of inhibitory substances, and the frequency and number of organisms that

are present in the body fluid or tissue being tested. The isolation of MAP from sites other than

the intestinal tract, such as udder, kidney, liver, male reproductive tract and blood, have

suggested active dissemination of the bacteria and opens the possibility for detection of the agent

by PCR in fluids such as milk and blood of suspicious animals (Buergelt and Williams, 2004).

A combination of independent tests is a common method to improve reliability of

laboratory diagnostic tools. As a result of the setbacks of MAP diagnosis, such strategies have

already been implemented by using a combination of bacterial fecal culture and PCR or

serological screening and bacterial fecal culture (Collins et al., 2006). Moreover, a combination

of tests with different sensitivities and specificities allows a classification of animals and herds

relative to the probability of MAP infection (Bottcher and Gangl, 2004).

A broader knowledge of the behavior and association between different diagnostic tests is

desirable for the implementation of strategies based on the combination of different tests, which

could be a useful approach to improve the sensitivity of MAP detection.









In another front, the use of host genetic resistance to disease is an attractive option as a

component of livestock disease control. Genetic factors have been associated with differences in

host susceptibility to bovine paratuberculosis, and estimations indicate a range of moderate

values for heritability of infection (Koets et al., 2000; National Research Council, 2003;

Mortensen et al., 2004, Gonda et al., 2006). Research has also been aimed at detecting

associations between susceptibility differences and polymorphisms in candidate genes with no

definite results (Hinger et al., 2007; Taylor et al., 2006; Gonda et al., 2005, 2007). A candidate

gene case-control study aimed at immune related genes is a practical approach for testing the

involvement of host genetics in paratuberculosis infection.

The hypothesis of studies 1 and 2 was that different degrees of association exist among

tests detecting MAP infection. Our objective was to analyze the association among results of a

serum ELISA, fecal culture, and nested PCR on milk, blood, and feces for MAP detection in

dairy cows.

The central hypothesis of studies 3 and 4 was that a combination of particular alleles in

four candidate genes would be present in higher frequency in case individuals compared to

controls, suggesting a role in susceptibility to infection. The objective of this candidate gene

case-control study was to characterize the distribution of polymorphisms in the bovine CARD15,

BolFNG, TLR4 and SLC11A1 genes and test their association with susceptibility to

paratuberculosis infection in Florida dairy and beef cattle.









CHAPTER 2
LITERATURE REVIEW

The Agent

Genus Mycobacterium

Mycobacteria are members of the taxonomic group that includes the genera

Corynebacterium, Mycobacterium, and Nocardia (CMN group) and the genus Rhodococcus

(Cocito et al., 1994).

Mycobacteria are non-motile and non-sporulated rods and are grouped in the supra-generic

rank of Actinobacteria with a high content (61-71%) of guanine plus cytosine (G+C) in the

genomic DNA, and high lipid content in the wall, probably the highest among all bacteria. They

also present several mycolic acids in the envelope structure that distinguish the genus (Palomino

et al., 2007).

These acid-fast organisms include a number of major human and animal pathogens,

comprising over 100 species of obligate parasites, saprophytes, or opportunistic pathogens.

Mycobacteria are structurally more closely related to Gram-positive bacteria; however, the genus

does not fit into this category given that cell wall molecules are lipids rather than proteins or

polysaccharides (Palomino et al., 2007).

Based on genomic analysis, this genus has been divided into two separate clusters,

corresponding to the traditional fast-growing mycobacteria, represented by nonpathogenic

environmental isolates, and the slow-growing mycobacteria, containing most of the overt

pathogens (Harris and Barleta, 2001).

Slow-growing mycobacteria of importance in veterinary medicine are found in two major

complexes; M. tuberculosis and M. avium. The M. tuberculosis complex includes M.

tuberculosis, M. bovis, and M microti. M. tuberculosis causes tuberculosis in man, primates,









dogs and other animals. M. bovis causes tuberculosis in cattle, domestic and wild ruminants, man

and other primates, and swine and other animals (Eglund, 2002). On the other hand, the

Mycobacterium avium complex (MAC) consists of genetically similar bacteria including M

avium subsp. avium, M. avium subsp. paratuberculosis, M. avium subsp. silvaticum,M avium

subsp. hominis, and M intracellulare. MAC organisms are opportunistic pathogens present in

multiple locations; although human exposure to MAC is ubiquitous, most individuals rarely

develop infection (St. Amand et al., 2005). M. avium causes avian tuberculosis, and M

intracellulare rarely causes disease in birds, but causes severe pulmonary diseases in man and

can be isolated from swine and cattle. M. silvaticum (wood-pigeon Mycobacterium) is an

obligate pathogen for birds, and MAP, a pathogen for ruminants, is an obligate parasite unable to

replicate in the environment (Eglund, 2002).

Another classification of mycobacteria relates to its ability to replicate in the environment.

Environmental opportunistic mycobacteria are distinguished from the members of the M

tuberculosis complex by the fact that they are not obligate pathogens but are true inhabitants of

the environment, exhibiting a notorious hardiness, an acid-fast cell wall containing mycolates,

and intracellular pathogenicity (National Animal Monitoring System, 1997).

The subspecies designation ofM avium is based on DNA-DNA hybridization studies and

numerical taxonomy analysis (Biet et al., 2005). At the subspecies level, MAP can be

differentiated phenotypically from the other MAC members by its dependence on mycobactin

and, genotypically, by the presence of multiple copies of an insertion element, IS900 (Harris and

Barletta, 2001).

An exclusive feature of mycobacteria is the structure and composition of their cell

envelope, with an inner layer composed of peptidoglycan linked to arabinogalactan









polysaccharides which are esterified with high-molecular weight mycolic acids, and an outer

stratum composed of lipids. A notorious molecule of the cell envelope is a lipopolysaccharide,

lipoarabinomannan, with properties comparable to those of the O-antigenic lipopolysaccharide of

Gram-negative bacteria (Weigand and Goethe, 1999). The waxy coat confers the distinctive

characteristics of the genus: acid fastness, extreme hydrophobicity, resistance to environmental

exposure, and distinctive immunological properties. It probably also contributes to the slow

growth rate of some species by restricting the uptake of nutrients (Palomino et al., 2007).

Mycobacterium Paratuberculosis Characteristics

Mycobacterium avium subsp. paratuberculosis is a small, facultative intracellular, acid-fast

bacillus, occurring in clumps entangled with one another by a network of intracellular filaments

(Chiodini et al., 1984). The main distinguishing feature of this subspecies is its need for

exogenous mycobactin for in vitro growth. Mycobactin is an iron chelating agent produced by

almost all mycobacteria and MAP, in particular, is unable to produce this element in laboratory

culture (Chiodini et al., 1984; Li et al., 2005). This siderophore is responsible for the transport of

iron into cells, and is a high-molecular-weight complex lipid, containing a core to which Fe is

coordinately linked. While a dependence on metals for growth is common to all bacteria, the iron

requirement of pathogenic mycobacteria is peculiar in that an organic source of this metal is

needed for its uptake and utilization (Cocito et al., 1994). Iron plays a key role in both electron

transport and composition of metabolic enzymes, and the ability to acquire iron from various

sources is crucial for bacteria (Li et al., 2005). Mycobactin is unique to mycobacteria and

nocardiae, but mycobactin dependence is no longer considered pathognomonic for identification

of MAP, since mycobactin-dependent M silvaticum and M avium strains have been identified

(Cocito et al., 1994).









MAP is an obligate parasite of animals; the only place it can multiply in nature is in a

susceptible host, within a macrophage. Out of the host it can survive for extended periods, but it

is unable to multiply. Accordingly, the primary source of infection with MAP is an infected

animal; though, there is evidence that MAP can exist in vegetative, cell wall deficient and

dormant forms (Grant, 2005).

MAP cell wall is acid-fast and resists decolorization with acidified alcohol because of the

presence of a waxy material that makes the cells difficult to disrupt. Under the microscope MAP

cells appear as rods 1-2 .im in length, which typically occur as clumps of up to several hundred

bacterial cells (Grant, 2005).

Environmental Ubiquity and Physical Resiliency

Environmental mycobacteria are normal inhabitants of a wide variety of environmental

reservoirs, including water, soil, and aerosols. Water is likely the primary source of MAC

infection in humans and environmental mycobacteria are capable of biofilm formation.

Environmental mycobacteria also have an extraordinary ability to survive starvation, persisting

despite low nutrient levels, and extreme temperature. M. avium and M intracellulare have an

acidic pH optimum for growth between 4.5 and 5.5, and have been recovered in large numbers

from waters and soils of low oxygen levels (National Animal Monitoring System, 1997).

MAP's cell wall enables the organism to persist in the environment and contributes to its

resistance to low pH, high temperature, and chemical agents (Manning, 2001).

Resistance to disinfection: Although the effects of chlorine and phenolic compounds on

MAP are unknown, M. avium is more resistant to free chlorine than are most other bacteria

(Manning, 2001).

Survival in water, soil, and manure: As reviewed by Manning (2001), in a 1944 study,

MAP survived up to 246 days in manure outdoors. In water of pH 7.0, MAP has been recovered









up to 17 months post-inoculation. A pH above 7.0 and low iron content may reduce viability, as

may soil drying and exposure to sunlight. However, in another study survival time was not

affected by ultraviolet light. A lower positive serology rate for MAP infection in dairy cattle was

associated with the application of lime to pastures, although a direct association between soil pH

and MAP survival has not been established. Von Reyn et al. (1993) cultured 91 water samples

from environmental sites and piped water supply systems in the United States, Finland, Zaire,

and Kenya, and MAC was isolated from all geographic areas and from 22 of 91 (24%) samples.

Whittington et al. (2005), studied the survival of MAP in dam water and sediment in either

a semi exposed or in a shaded location, compared to survival in fecal material and soil in a

shaded location. Survival of MAP in water and/or sediment in the shade was up to 48 weeks

compared to 36 weeks in the semi exposed location. Survival in soil and fecal material in the

terrestrial environment in the shaded location was only 12 weeks, suggesting that water may be a

significant reservoir of MAP infection.

Finally, in another study (Ward and Perez, 2004), the survival of MAP was analyzed by

culture of fecal material sampled from soil and grass in pasture plots and boxes. Survival for up

to 55 weeks was observed in a dry fully shaded environment. The organism survived for up to 24

weeks on grass that germinated through infected fecal material in completely shaded boxes and

for up to 9 weeks on grass in 70% shade (Ward and Perez, 2004).

Thermal tolerance: MAP is more thermo-resistant than M avium, M. chelonae, M. phlei,

M. scrofulaceum, and M xenopi. This heat tolerance decreases the effectiveness of pasteurization

for killing organisms in the milk of infected animals.

It has been suggested that the heat-resistance of MAP may be influenced by its tendency to

occur as clumps of cells. Bacteria in the center of large clumps may be protected, or









alternatively, because the clumps contain up to 10,000 cells, a proportion of the cells will survive

a non-sterilizing heat treatment (Grant et al., 2005).

In testing units of whole pasteurized milk from retail outlets throughout central and

southern England, it was found that, over three month periods, up to 25% of commercial units

sampled were affected by the presence of MAP DNA (Millar et al., 1996). In a study in the

Czech Republic, MAP was cultured from 1.6% of commercially pasteurized retail milk (Ayele et

al., 2005). A US' study found viable MAP in 2.8% of milk samples taken from grocery stores in

three states (Ellingson et al., 2005). In Britain, viable M. paratuberculosis was found in 1.9% of

raw and 2.1% of pasteurized milk samples, suggesting that some MAP cells may survive

pasteurization and can possibly be consumed by humans (Manning, 2001).

Resistance to ultraviolet light: Most bacteria and viruses are sensitive to ultraviolet (UV)

light, but the pH, hardness, turbidity, and biologic oxygen demand in water can significantly alter

the UV dose needed for inactivation. Laboratory trials with distilled water show that MAP is as

susceptible to UV inactivation as other bacteria. In contrast, UV light may have minimal effect

on the organism's viability in MAP spiked soil (Manning, 2001).

Strains

Different strains of MAP have been determined, however, isolates of MAP from different

clinical sources have few distinguishing phenotypic characteristics. The main features that

differentiate strains of MAP in culture are the rate at which they grow and, sometimes, variations

in colony pigmentation. However, several methods have been developed to discriminate closely

related strains (National Research Council, 2003).

As presented by the National Research Council (2003), non-molecular methods are based

on serology, differences in biochemical properties, antimicrobial susceptibility, and phage

typing. Molecular-strain typing has had a great influence on studies of MAP. Among the









techniques used are restriction fragment length polymorphism (RFLP) analysis of DNA, pulsed-

field gel electrophoresis of DNA, and multiplex PCR typing. RFLP has been used most

extensively. Sequences from IS900 are the most widely used probe in RFLP analysis of MAP.

At the present, the main MAP strains have been classified into three groups (cattle, sheep

and intermediate types), based on RFLP, analysis coupled with hybridization to the insertion

sequence IS900 (IS900-RFLP) and culture characteristics. However, other strains affecting bison

(Bison bison) and differentiated by typing of IS1311 polymorphisms have also been reported

(Whittington et al., 2001),

The cattle type (C), the most common in Europe, has been isolated primarily from cattle

and other domestic and wild ruminants, non-ruminant species, and also humans.

The sheep (S) type strains are extremely slow growers and in this group are included: (i)

pigmented and non-pigmented strains isolated from sheep in Morocco, Scotland, Iceland, South

Africa, Australia and New Zealand; (ii) strains isolated from cattle from Australia and Iceland;

(iii) strains isolated from goats from New Zealand. The intermediate group has been described in

a few ovine isolates from South Africa, Canada and Iceland as well as caprine isolates from

Spain (Stehman, 1996; de Juan et al., 2006).

A similar division of strains has been achieved by characterization by pulsed field gel

electrophoresis (PFGE). PFGE allows the division of MAP isolates into three main groups:

Types I, II and III, which would correspond with the sheep, cattle and intermediate groups,

respectively. PCR-based techniques, requiring lower amounts of high quality DNA divide the

MAP strains in two main groups that would correspond with the cattle or Type II, and the sheep

or Types I/III (de Juan et al., 2006). The capacity to differentiate individual strains of MAP is

essential for evaluating routes of transmission and characteristics of pathogenesis. It is important









also, for livestock producers to be able to identify the source of a new infection because that

information often will dictate corrective action. Different control strategies depend on whether a

new infection results from introducing livestock from another herd or is attributable to animal

contact with something in the farm environment, such as contaminated pasture (National

Research Council, 2003). On the other hand, different strains present different exigencies for

culture and that is a point that should be considered to evaluate the possibility of false negatives

results.

Species specificity among strains has been suggested and separate strains of MAP may be

isolated from various ruminant species and may account for some of the differences in culture

diagnosis. Observations indicate that the ovine strain is unlikely to be transmitted to cattle.

However, the occurrence of a sheep strain in cattle has been reported, indicating that interspecies

transmission can not be ruled out (Motiwala et al., 2003) and, probably, most strains can infect

across ruminant species lines and should be regarded as infectious to ruminant species other than

the species of origin (Stehman, 1996). A final point refers to the hypothesis that different strains

of MAP vary in their ability to attach to different regions of the intestinal tract at different rates.

However, Schleig et al. (2005) reported significant differences in strains ability to attach, but not

in attachment among different regions of intestine.

Mycobacterium Paratuberculosis Genome

The size of the MAP genome has been estimated to be 4.4 to 4.7 Mbp. Compared to other

mycobacteria, this is similar to theM tuberculosis genome (4.41 Mbp) and theM bovis genome

(4.4 Mbp) but slightly larger than the estimated size of the genome ofM. leprae (3.3 Mbp). MAP

DNA has a base composition of 66 to 67% G+C, similar to M tuberculosis and M bovis (Harris

and Barleta, 2001). Recent work in mycobacterial genomics has revealed large sequence

polymorphisms as the major contributor of genetic diversity (Sohala et al., 2007).









Genome sequence

Recently, the complete genome sequence of MAP was reported (Li et al., 2005). The strain

used was MAP K-10 which is a virulent, low passage clinical strain isolated from a dairy herd in

Wisconsin. MAP K-10 has a single circular sequence of 4,829,781 base pairs, with a G+C

content of 69.3%. Approximately 1.5% (or 72.2 kb) of the MAP genome is comprised of

repetitive DNA like insertion sequences, multigene families, and duplicated housekeeping genes

(Li et al., 2005).

Seventeen copies of the insertion sequence IS900, seven copies of IS1311, and three copies

ofISMav2, with a total of 16 additional MAP insertion sequence elements have been identified.

Li et al. (2005) determined that K-10 genome contains 4,350 ORFs with lengths ranging from

114 bp to 19,155 bp, which, in sum, account for 91.5% of the entire genome.

A cluster of 10 genes in Mycobacterium tuberculosis has been shown to be responsible for

the production of mycobactin and the transport of iron. Homologs to this cluster were identified

in the MAP genome. However, a direct comparison of the cluster in MAP with those of

Mycobacterium avium and Mycobacterium tuberculosis show significant differences in primary

structure of this region (Li et al., 2005).

Insertion sequences

Insertion sequences (IS) are relatively short DNA segments capable of transposing within

and between prokaryotic genomes, often causing insertional mutations and chromosomal

rearrangements. Use of IS as probes provides discrimination due to the tendency of these

transposable elements to insert randomly and occupy multiple sites in the genome. The discovery

of insertion sequences in mycobacteria has provided an approach for characterizing MAC

isolates (Bhide et al., 2006; Motiwala et al., 2006).









The first MAC insertion sequence, IS900, was identified in MAP cultures and was

determined to be a unique characteristic of this subspecies (Collins et al., 1989; Green et al.,

1989). IS900 elements are found in multiple copies per genome and provide the diagnostic

advantage of improved sensitivity for MAP detection in PCR procedures. The closely related

insertion sequences, IS901 and IS902 were discovered subsequently, and more recently, IS1245

and IS1311 have been identified in MAC isolates (Motiwala et al., 2006).

Insertion sequence 1245 is present in M avium subsp. avium and M avium subsp.

silvaticum, but was recently demonstrated not to be present in the MAP genome (Johansen et al.,

2005). A closely related IS element, IS1311, shows 85% sequence identity with IS1245 at the

DNA level. It is present in M avium subsp. avium and MAP and has been detected in strains of

M. intracellulare, Mycobacterium malmoense, and Mycobacterium scrofulaceum.

Whittington et al. (1998), found 7-10 copies of IS1311 in strains of MAP. With a given

restriction enzyme, the RFLP patterns obtained from isolates of MAP from cattle were all

identical, but they differed from those of isolates from sheep. Restriction endonuclease analysis

(REA) of the PCR product was used to distinguish isolates of MAP from M. avium, in addition

to the conventional test for IS900. In isolates of MAP from cattle the IS1311 gene was

polymorphic at position 223, which enabled isolates from sheep and cattle to be distinguished by

PCR-REA.

Other possible target elements in MAP include the F57, ISMav2, and Hsp X sequences.

The F57 and Hsp X sequences are present as single copies, while three or more copies of ISMav2

are present in the MAP genome (Tasara and Stephan, 2005). Although these markers may not be

as sensitive as the multi-copy IS900 elements, they are highly specific for MAP.









Insertion sequence 900

IS900 was discovered in MAP independently by two groups in 1989 (Collins et al., 1989;

Green et al., 1989; Eglund, 2002). This 1,451 bp element lacks inverted terminal repeats and

does not generate direct repeats in target DNA. IS900 is a member of the IS116 family of

insertion sequences present in actinomyces and other bacteria. This group includes IS901, IS902,

ISO110 and IS1643 in M. avium, all of which share between 60-80% identity with IS900

(Cousins et al., 1999). IS900 exists in 14-18 copies in the genome of MAP and encodes a 399

amino acids putative transposase, p43, on one strand and a predicted protein, Hed, of unknown

function on the opposite strand. IS900 inserts in one direction into a consensus target sequence at

highly conserved loci within the MAP genome. The insertion sites of different copies of IS900

are similar and share a common consensus sequence (Bull et al., 2000).

PCR targeting the 5' end of IS900 has been considered specific for identification of MAP

and is frequently applied to confirm the presence of the organism in the diagnosis of Johne's

disease (JD). However, the specificity of such procedure has been put into question over the past

few years (Green et al., 1989; Cousins et al., 1999; Tasara and Stephan, 2005). Sequences that

are highly homologous to MAP IS900 have been found in other environmental Mycobacterium

species. Those elements have been described for strains isolated from bovine feces which are

positive with most of the current IS900 PCR systems used for standard M. avium subsp.

paratuberculosis detection (Bull et al., 2000).

Cousins et al. (1999) reported the finding ofMycobacterium spp. isolated from the feces of

3 clinically normal animals in Australia that appeared not to be MAP but were positive by IS900

PCR. The isolates were characterized using mycobactin dependency, biochemical tests, IS900

and 16 S rRNA sequencing and restriction fragment length polymorphism (RFLP), and showed









between 71% and 79% homology with MAP in the region ofIS900 amplified, appearing to be

most related to Mycobacterium scrofulaceum.

Antigens

Several antigens have been identified in mycobacteria, particularly in Mycobacterium

tuberculosis, but few have been identified in MAP. In the early eighties, the use of a

protoplasmic antigen for immunoglobulin G1 detection by ELISA was proposed (Yokomizo et

al., 1983). This antigen is the basis for some ELISA in use at the present.

Among the more recently reported antigens are the highly antigenic and conserved heat

shock proteins GroES and GroEL, 2 alkyl hydroperoxide reductases, a serine protease,

superoxide dismutase, and 11 other proteins of unknown function that are named on the basis of

their sizes in kilodaltons (Bannantine et al., 2004). Other immunoreactive proteins of MAP

include a 32-kDa secreted protein with fibronectin binding properties implicated in protective

immunity and a 34-kDa cell wall antigenic protein homologous to a similar protein in M leprae.

The M paratuberculosis GroEL protein is homologous to similar proteins of M tuberculosis

(93%), M. leprae (89%), and M avium (98%) (Bannantine et al., 2004).

The alkyl hydroperoxide reductases C and D (AhpC and AhpD) are recently characterized

immunogenic proteins of MAP. AhpC is the larger of the two proteins and appears to exist as a

homodimer in its native form since it migrates at both 45 and 24 kDa under denaturing

conditions. In contrast, AhpD is a smaller monomer, with a molecular mass of about 19 kDa.

Other putative MAP-specific antigenic proteins have been described in the literature. These

include a cellular antigen of 34.5 kDa, a 42-kDa protein of unknown function, and a 44.3-kDa

antigen (Harris and Barleta, 2001).

Paustian et al. (2004) reported the identification of 13 open reading frames with no

identifiable homologs. These MAP genes were cloned into Escherichia coli expression vectors,









and nine were successfully expressed as recombinant fusion proteins. Five of these proteins were

purified in sufficient amounts to allow immunoblot analyses of their reactivity with sera from

naturally infected cattle as well as mice and rabbits exposed to MAP. Fusion proteins

representing MAP0862, MAP3732c, and MAP2963c were recognized by nearly all of the sera

tested, including those from cattle in the clinical stages of disease, and four proteins were

variably recognized by sera from MAP-infected cattle.

In another study, Leroy et al. (2007) presented a post-genomic analysis of MAP proteins

where 25 candidate diagnostic antigens were identified as specific antigens that could improve

the diagnosis of paratuberculosis.

Some of the antigens recognized at the present are promissory, but none has been

incorporated as a routine diagnostic tool according to the published literature and available

commercial tests. This may be due, at least in part, to the presence of these antigens in other

mycobacterial species (Bannantine et al., 2004).

Johne's Disease

Definition

Paratuberculosis (Johne's disease) is a chronic infectious disease of domesticated and wild

ruminants, recognized throughout the world since it was first described in 1895. As presented by

Kreeger (1991), at that time, Johne and Frothingham described the disease and identified the

presence of acid-fast organisms in the granulomatous lesions of the intestine, considering the

disease an atypical form of ruminant tuberculosis. In 1910 the organism was first isolated and

received the name Mycobacterium enteriditis chronicae txeudotuberculosae bovisjohne, which

later would be renamed Mycobacterium avium subspecies paratuberculosis.

The macroscopic and histological lesions of paratuberculosis remain confined to the

intestine, mesenteric and ileocecal lymph nodes (Buergelt et al., 1978), and the disease is









characterized by granulomatous enteritis, which leads to chronic, unresponsive diarrhea and

progressive emaciation. Most often, the infection is acquired by the young and after a prolonged

incubation phase, lasting 2 to 3 years in cattle, the infection results in disease (Chiodini et al.,

1984).

Paratuberculosis has a worldwide distribution and is categorized by the Office

International Des Epizooties as a list B disease, which is a serious economic or public health

concern (OIE, 2004). In spite of efforts directed towards the understanding of the disease, at the

present, many questions related to paratuberculosis remain unanswered (Kreeger, 1991).

Spectrum in Animal Species

Paratuberculosis causes enteritis primarily in cattle, goat and sheep, but the infection also

occurs in other ruminants and wildlife (Eglund, 2002). MAP also multiplies in horses and mules,

which become asymptomatic shedders, and laboratory animals and birds replicate experimentally

injected MAP (Cocito et al., 1994). The importance of wildlife reservoirs of MAP in the

transmission cycle remains undetermined, and some investigations have examined the role of

wildlife in the epidemiology of paratuberculosis (Alifiya et al., 2004; Motiwala, 2004). Among

the wild species in which MAP has been reported are ruminants, such as deer (Stehman, 1996),

bison (Buergelt et al., 2000, Ellingson et al., 2005a), and elk, as well as non-ruminants, such as

wild rabbits (Greig et el., 1997), their predators, including foxes and stoats, and primates, such as

mandrills and macaques (Zwick et al., 2002), indicating a wide host range.

A study performed in Scotland (Beard et al., 2001) investigated 18 non-ruminant wildlife

species for evidence of paratuberculosis. Using culture and histopathological analysis, fox, stoat,

weasel, crow, rook, jackdaw, rat, wood mouse, hare, and badger were found to harbor MAP.

Similarly, a survey of wild rabbits in Scotland revealed that 67% were infected with MAP,









raising the possibility that rabbits and other wildlife may play a role in the epidemiology of

paratuberculosis, with important implications for the control of the disease (Greig et al., 1997).

Surveys for MAP infection in free-ranging mammals and birds were also conducted on

nine dairy and beef cattle farms in Wisconsin and Georgia (Corn et al., 2005). Specimens were

collected from 774 animals representing 25 mammalian and 22 avian species. MAP was cultured

from tissues and feces from 39 samples from 30 animals representing nine mammalian and three

avian species. The prevalence of infected wild animals by premises ranged from 2.7 to 8.3% in

Wisconsin and from 0 to 6.0% in Georgia, and fecal shedding was documented in seven (0.9%)

animals. Finally, a recent study in south central Wisconsin detected MAP specific DNA in 81 of

212 (38%) scavenging mammals, in 98 of the 472 (21%) tissues; viable MAP was cultured from

one coyote's ileum and lymph node tissue (Anderson et al., 2007).

Pathology

Entry of MAP in the host mainly occurs via the fecal-oral route, through ingestion of fecal

contaminants, milk or colostrum. Viable bacilli have also been isolated from reproductive organs

of infected animals and fetuses of infected cows. Thus, intrauterine transmission is possible,

though its significance in natural infection and spread of the disease remains to be fully

elucidated (Seitz et al., 1989; Valentin-Weigand and Goethe, 1999; Buergelt et al., 2006;

Wittington and Winsor, 2007).

Ingested MAP enter the intestinal wall through the small intestinal mucosa, primarily in

the region of the ileum, via M cells residing in the Peyer's patches (Momotani et al., 1988).

Bacilli are resistant to intracellular degradation, and are eventually phagocytosed by subepithelial

macrophages (Valentin-Weigand and Goethe, 1999; Koets et al., 2002; Tiwari et al., 2006).

Subsequently, the infected macrophages migrate into local lymphatics spreading the infection to

regional lymph nodes, stimulating inflammatory and immunological responses. MAP proliferates









slowly in the ileal mucosa and regional lymph nodes, and stressors such as poor nutrition,

transport, parturition, and immunosuppression have been proposed as precipitating the start of

the clinical phase of infection (Tiwari et al., 2006).

It takes years from the time of infection until development of clinical signs. Experimental

infections carried out in cattle revealed that orally administered MAP were detectable in

intestinal macrophages within a few hours after infection. The first granulomatous lesions were

seen in the interfollicular regions of Peyer's patches and mesenteric lymph nodes three months

after infection, lesions extended into the intestinal mucosa several months later

(Valentin-Weigand and Goethe, 1999).

Granulomatous lesions present in the disease have been classified into two types;

tuberculoid and lepromatous. Tuberculoid-type lesions, which occur in the early stages of

paratuberculosis, consist of small numbers of epithelioid cells and many lymphocytes, plasma

cells, eosinophils, and macrophages, with limited numbers of MAP (paucibacillary). These

lesions are associated with strong cell-mediated immune responses on which resistance to

paratuberculosis is dependent (Tanaka et al., 2005).

In contrast, lepromatous-type lesions, more common in the terminal stage of the disease, are

composed mainly of macrophages and epithelioid cells bearing large numbers of mycobacteria

(pluribacillary). Lepromatous-type lesions are associated with strong humoral immune responses

in conjunction with weak cell-mediated immunity resulting in progression of the disease, with a

reduction in Thl response and the induction Th2 induced humoral immunity by the

anti-inflammatory cytokines interleukin-4 (IL-4), IL-5, IL-6, and IL-10 (Tanaka et al., 2005).

In naturally infected animals, gross lesions typical of chronic enteritis are most notably

found in the distal ileum. Histological lesions include macrophages with different amounts of









intracellular mycobacteria. Although the severity of intestinal lesions often does not correlate

with occurrence of clinical signs, an association of clinical cases with a high mycobacterial load

of macrophages in affected areas has been found in experimental infections. MAP has also been

demonstrated in the mononuclear cell fraction of blood and tissue fluid from infected cattle,

supporting the idea that macrophages may function as vehicles in dissemination of the organisms

from infected sites (Valentin-Weigand and Goethe, 1999, Buergelt and Williams, 2004).

The physiological mechanism for development of diarrhea is thought to be related to

antigen-antibody reactions in infected tissue, with subsequent release of histamine, and different

cytokines. Macroscopic lesions are found primarily in the intestine and mesenteric lymph nodes,

specifically in the region of the ileum, although they can occur throughout the whole length of

the intestinal tract. The intestinal wall is thickened and edematous, and the mucosa has transverse

folds and the serosal and mesenteric lymphatic vessels are dilated and thickened (Tiwari et al.,

2006).

The intracellular destiny of MAP remains unclear, with an intra-phagosome localization of

MAP in infected tissues being most likely. A work based on the mouse model demonstrated that

MAP can persist in macrophages in vitro for several weeks without significant loss of viability,

but the extent of intracellular multiplication under different conditions has not been clarified

(Valentin-Weigand and Goethe, 1999).

Some experiments, using a large single oral dose suggested tonsils as the primary portal of

entry following oral inoculation, with intestinal lesions developing later. However, other authors

using smaller repeated doses showed the small intestine to be the most likely portal of entry, with

no evidence for entry of infection via the tonsils (Sweeney et al., 2006). M cells have been

considered as an important component in the uptake of MAP after oral inoculation (Momotani et









al., 1988). Sweeney et al. (2006), using small oral doses, produced infection in Holstein calves

detectable 3 weeks after infection, with culture positive sites restricted to intestinal or mesenteric

lymph nodes, and with only two calves showing culture positive samples of spleen and tonsils.

In another work, Wu et al. (2006) described a surgical approach employed to characterize

the early stages of infection of calves with MAP. After inoculation in the ileum, the bacteria

were able to cross the intestinal tissues within 1 hour of infection, reaching the liver and lymph

nodes. Both the ileum and the mesenteric lymph nodes were persistently infected for months

despite a lack of fecal shedding of mycobacteria. During the first 9 months of infection, the

levels of cytokines detected in the ileum and the lymph nodes indicated the presence of a

Thl-type-associated cellular responses but not Th2-type-associated humoral responses.

A recent study focused on characterizing MAP disseminated infection in dairy cattle and

on determining the role of ELISA test in detection of cattle with this condition. Disseminated

infection was diagnosed when MAP was isolated in tissues other than the intestines or their

associated lymph nodes and was distinguished from infection found only in the gastrointestinal

tissues and from absence of infection. Of the 40 cows in the study, 21 had MAP disseminated

infection. Results showed that 57% of cows with disseminated infection had average to high

body condition and no diarrhea. Cows with disseminated infection had no to minimal gross

pathologic evidence of infection in 37% of cases. Only 76% of cows with disseminated infection

had positive historical ELISA results and only 62% had a positive ELISA at slaughter (Antognoli

et al., 2008).

Another study (Brady et al., 2008) analyzed the relationship between clinical signs,

pathological changes and tissue distribution of MAP in 21 cows from herds affected by JD. The

bacterium was isolated from 17 individuals, all exhibiting macroscopic lesions. However, with









the exception of diarrhea and lesions in the large intestine, there was little correlation between

the presence or absence of clinical signs and the lesions associated with JD. The distribution of

MAP in tissue was poorly correlated with either the clinical signs or the lesions and the

bacterium was widely distributed in the tissues of some clinically normal animals.

Stages of the Disease

Whitlock and Buergelt (1996) proposed the following four categories of the disease,

differentiated according to the severity of clinical signs, shedding of bacteria into the

environment, and the possibility of infection to be detected using laboratory methods.

Stage 1, silent infection

In this stage, animals typically exhibit no overt evidence of infection with MAP. Stage 1 is

typically found in calves and heifers, most immature young stock, and many adult cattle. No

routine or special clinicopathologic tests or serology will detect disease in these animals. Only

postmortem tissue culture or, less often, histopathology can detect infection at this early stage of

disease.

Stage 2, subclinical disease

Most animals in stage 2 are adults that are carriers of MAP. The animals do not exhibit

clinical signs typical of paratuberculosis, but they sometimes have detectable antibodies or

exhibit altered cellular immune responses. Many are fecal-culture negative, although they

intermittently shed low numbers of organisms in feces. In a small percentage (15-25%), disease

can be detected by fecal culture, by altered cellular immune response, by serum antibodies, or by

histopathology. An unknown proportion of stage 2 animals progress slowly to clinical disease,

but because so many are culled from herds for other reasons and before clinical signs typical of

paratuberculosis are recognized, the magnitude of the MAP infection within a herd can be

obscured.









Stage 3, clinical disease

The clinical signs characteristic of stage 3 typically develop only after some years of MAP

incubation. The initial signs are subtle; they include a drop in milk production, roughening of the

hair coat, and gradual weight loss despite an apparently normal appetite. Over a period of several

weeks, diarrhea (often intermittent at first) develops. In the absence of a history of herd infection,

clinical diagnosis is difficult because other conditions can result in similar signs. Because

paratuberculosis diagnosis based on clinical signs is challenging, the first cases in a herd often

are misdiagnosed (Whittington and Sergeant, 2001).

Histopathological lesions can occasionally be found in the intestinal tract, with the most

common site being the terminal ileum. Serum and plasma biochemical changes are predictable

and characteristic of the clinical signs, but they are not specific enough to be of use in diagnosis

of JD. Most animals test positive on fecal culture for MAP and have detectable concentrations of

antibodies on commercial ELISA and agar gel immunodiffusion tests. A few unusual cases will

regress to Stage 2 and remain there for an indeterminate period.

Stage 4, advanced clinical disease

Animals can progress from stage 3 to stage 4 in a few weeks, and their health deteriorates

rapidly. They become increasingly lethargic, weak, and emaciated as the disease progresses to

Stage IV. Intermandibular edema due to hypoproteinemia, cachexia, and profuse diarrhea

characterize stage 4. Dissemination of MAP throughout the tissues can occur. Although the

organism can sometimes be cultured from sites distant from the gastrointestinal tract, extra-

intestinal lesions are rarely detected. When extra-intestinal lesions are present, the liver, other

parts of the intestinal tract and the lymph nodes are the most common sites. At this stage, most

animals are culled from the herd because of decreased milk production or severe weight loss.









Death from JD is often the result of the severe dehydration and cachexia (Whitlock and Buergelt,

1996).

The distribution of these four stages in the population is described as "iceberg" effect; for

every advanced clinical case of JD in a farm, as many as 25 other animals are expected to be

infected. Only 15% to 25% of these infected animals will be detected during one test period

(Whitlock and Buergelt, 1996). At any given time in an infected herd, the majority of infected

animals will be in stages 1 and 2, with relatively few animals exhibiting clinical signs of disease

i.e. stages 3 and 4 (Eglund, 2002; National Research Council, 2003; Whitlock and Buergelt,

1996).

In agreement, in a study presented by Toman et al. (2003), cows in a MAP infected herd

were clinically and microbiologically monitored for 4 to 7 years resulting in three groups of

animals showing different courses of the infection. One group (non-shedders) included animals

negative by fecal culture throughout the monitoring period. A second group (low shedders) shed

sporadically small quantities of mycobacteria, remaining clinically healthy throughout the

monitoring period. A third group (high shedders) included animals shedding repeatedly large

quantities of MAP (>10 CFU) with a progressive deterioration of the state of health in most of

them. Animals with specific antibodies were found in all groups, but the percentage of

serologically positive animals was significantly higher in the group of high shedders. Specific

cell-mediated immunity was demonstrated in the group of low shedders.

Epidemiology

Prevalence and risk factors

Various surveys have been conducted to establish disease incidence and prevalence in

different areas of the United States. In a review presented by Kreeger et al. (1991) results from a

1983 abattoir survey of 1,000 Wisconsin cattle indicated histological lesions compatible with









paratuberculosis in 11% of the animals examined. Subsequent studies across the US reported

paratuberculosis seroprevalences among dairy cattle (year 1996) and beef cattle in (1997) of

2.5% and 0.4%, respectively, with at least 22% of dairy herds and 7.8% of beef herds having at

least 1 seropositive animal (NAHMS, 1997; Dargatz et al., 2001a).

In an extensive survey which included 32 states and Puerto Rico, lymph nodes were

examined from 7,540 animals by culture techniques and an overall prevalence of 1.6% was

found. Prevalence rates for 1983-84 in dairy and beef cattle were 2.9% and 0.8%, respectively

(Merkal et al., 1987).

Braun et al. (1990), in a survey conducted from 1986 through 1987, found 8.6% and 17.1%

prevalence for MAP infection in Florida in beef and dairy cattle, respectively (ELISA test). In a

later study, Keller et al. (2004) found, in a population of 32,011 cattle from 75 herds in Florida,

an overall prevalence for a commercial ELISA of 6.5% (7.4% and 6.3% on beef and dairy cattle,

respectively).

A New England-based study showed a prevalence rate of 18% combining culture

techniques and histological evaluation (Chiodini and van Kruiningen, 1986), and in a 16-year

survey the National Veterinary Services Laboratory found a disease prevalence rate, as

determined by culture techniques, of 7.9% of the 12,917 samples submitted from 44 states,

Puerto Rico, and Canada (Kreeger et al. 1991).

An absorbed ELISA (Thorne and Hardin, 1997) was performed on serum samples from

1,954 Missouri cattle, representing 89 herds randomly selected from samples submitted for

brucellosis testing. The apparent seroprevalence of paratuberculosis in dairy cattle (8%) was

similar to that in beef cattle (5%). When herds were classified as dairy or beef, 74% of dairy

herds and 40% of beef herds were positive.









Dargatz et al. (2001a) estimated the prevalence of paratuberculosis infection among cows

on beef operations in the US, based on a convenience sample of 380 herds in 21 states. Serum

samples were obtained from 10,371 cows and tested with a commercial ELISA. They reported

that 7.9% of the herds had 1 or more animals with ELISA positive result; 0.4% of the cow

samples yielded positive results.

The prevalence of MAP in culled dairy cattle in Eastern Canada and Maine was determined

to be 16.1% based on a systematic random sample of abattoir cattle (McKenna et al., 2004). In

total, 8.5% of 984 cows had positive mesenteric lymph node or ileum cultures.

Hirst et al. (2004) estimated the seroprevalence of MAP infection among adult dairy cows

in Colorado and determined herd-level factors associated with the risk that individual cows

would be seropositive. The study comprised 10,280 adult dairy cows in 15 herds, and the serum

samples were tested with a commercial ELISA. Overall, 4.12% cows were seropositive.

Within-herd prevalence of seropositive cows ranged from 0% to 7.82%. Infection was confirmed

in 11 dairies. Annual importation rate, herd size, and whether cows in the herd had clinical signs

typical of MAP infection were associated with the risk that individual cows would be

seropositive for MAP infection.

In another study (Adaska et al., 2003), 1,950 serum samples from 65 dairy herds in

California, USA were tested for the presence of antibodies to MAP using a commercial ELISA

kit. The seroprevalence among cows was 6.9% in the northern region of the state, 3.7% in the

central region and 5.2% in the southern region (overall 4.6%).

Beef and dairy cattle serum samples, collected during 2000 at sale barns throughout

Georgia, were used to conduct a retrospective epidemiological study (Pence et al., 2003).

Statistical samplings of 5,307 sera, from over 200,000 sera, were tested for antibodies to MAP,









using a commercial ELISA kit. An overall period seroprevalence was 4.73%. The period

seroprevalence in dairy cattle was 9.58%, in beef cattle it was 3.95%, and in cattle of unknown

breed it was 4.72%.

Some studies analyze the association between prevalence of infection and risk factors.

Roussel et al. (2005) working with 4,579 purebred cattle from 115 beef ranches in Texas found

positive ELISA results for 137 of the 4,579 (3.0%) cattle, and 50 of the 115 (43.8%) herds had at

least 1 seropositive animal. Results of mycobacterial culture were positive for 7.3% of

seropositive cattle, and 18% of seropositive herds had at least 1 animal for which results of

mycobacterial culture were positive. Risk factors for seropositivity included water source, use of

dairy-type nurse cows, previous clinical signs of paratuberculosis, species of cattle (Bos taurus

vs. Bos indicus), and location.

Another study presented results for a random sample of Wisconsin dairy herds (158 herds

and 4,990 cattle) analyzed by an absorbed ELISA procedure. Fifty percent of herds and 7.29% of

cattle had positive test results. The only management factor found to be significantly associated

with herd prevalence was housing of calves after weaning. Unexpectedly, herds with higher

prevalence were associated with use of calf barns and hutches for calves after weaning rather

than pens in the cow barn (Collins et al., 1994). In another work, Goodger et al. (1996) found

that factors such as environmental conditions, newborn calf care, grower calf care, bred heifer

care, and manure handling were significantly associated with paratuberculosis prevalence in

Wisconsin dairy herds.

Cetinkaya et al. (1997) analyzed the relationships between the presence of clinical JD and

farm and management factors in England. Two binary outcomes (case reported in 1993, case

reported in 1994) and 27 predictor variables were considered. Farms on which Jersey and









Guernsey or their cross were predominant were associated with an increased risk of reporting

disease (odds ratios from 10.9 to 12.9). The presence of farmed deer on the farm also increased

the risk of reporting disease.

In a cross-sectional study (Jakobsen et al., 2000) using milk samples from 1,155 cows from

22 Danish dairy herds, several risk factors for paratuberculosis were identified. Eight point eight

percent (8.8%) of the animals were ELISA positive, and 19 out of the 22 dairy herds had >1

test-positive cows. The significant risk factors were: Jersey versus large breeds, high parity, the

first month after calving, and large herd size.

Nielsen and Toft (2007) studied management-related risk factors for within-herd

transmission of MAP in 97 Danish dairy herds. Four significant risk factors were identified:

housing of cows in bed stalls compared to housing in tie stalls; low level of hygiene in the

feeding area of calving areas; low amounts of straw in the bedding of the calving area; high

animal density among young stock >12 months of age.

In a study from Muskens et al. (2003), 370 randomly selected Dutch dairy farms with >20

dairy cows were surveyed. All cattle aged >3 years were serologically tested for paratuberculosis

using an ELISA. Significant factors associated with seropositive animals were herd size,

presence of cows with clinical signs of paratuberculosis, prompt selling of clinically diseased

cattle and feeding milk replacer.

Transmission of infection

There is agreement on the role of the fecal-oral route as the main entry of MAP in the host

through ingestion of fecal contaminants, milk or colostrum (Chiodini et al., 1984; Whitlock and

Buergelt, 1996), and additional intrauterine transmission has been suggested. Seitz et al. (1989)

obtained tissue specimens at a packing plant from pregnant dairy cows and their fetuses and from

cows with clinical signs of paratuberculosis and from their fetuses. Of 407 lymph nodes from









cows, 8.4% were culture positive for MAP; 26.4% of these culture-positive cows had fetuses

from which specimens were also culture positive. The results estimated the risk of fetal infection

with MAP to be 26.4%.

Buergelt et al. (2006) reported that, in a group of 11 pregnant MAP infected Holstein

cows, tissues or fluid from fetuses were positive on 36% of the pregnancies and 2 of 4

placentomes tested and 9% of allantoic fluids resulted on positive PCR reaction products.

In another study, Aly et al. (2005) estimated the extent to which MAP infection in a large

herd was attributable to the infection status of the respective dams. Serologic test results were

compared between cows and their dams. Cows with seropositive dams were 6.6 times as likely to

be seropositive, compared with cows of seronegative dams. For seropositive cows born to

seropositive dams, 84.6% of seropositivity was attributable to being born to a seropositive dam.

For the herd as a whole, the seropositive status in 34% of seropositive cows was attributable to

being born to a seropositive dam. The explanation is based on the subsequent transmission of

MAP from infected dams to their daughters, either congenitally or via exposure to feces and

colostrum of the dam shortly after birth.

A meta-analysis (Whittington and Windsor, 2007) suggested that about 9% (95% CI

6-14%) of fetuses from subclinically infected cows and 39% (20-60%) from clinically affected

cows were reported infected with MAP (p < 0.001). The estimated incidence of calf infection

derived via the in utero route depends on within-herd prevalence and the ratio of sub-clinical to

clinical cases among infected cows. Assuming a rate of 80:20 for this ratio, estimates of

incidence were in the range 0.44-1.2 infected calves per 100 cows per year in herds with within-

herd prevalence of 5%, and 3.5-9.3 calves in herds with 40% prevalence. Contrarily, Kruip et al.

(2003) investigated whether cows shedding MAP possessed oocytes and early embryos that were









carriers of the bacterium. The results suggested that neither in vivo embryos nor oocytes are

carriers of the bacteria and do not form an extra risk at embryo transfer.

Immune Response to MAP

The immune response to mycobacteria is a complex sequence of coordinated events,

leading to clearance of the pathogen but more likely to adequate control of infection. The loss of

control observed in some hosts may be due to genetic factors or may be caused by exogenous

stressors such as parturition, malnutrition, or secondary viral or bacterial infections (Tiwari et al.,

2006).

The precise mechanism of acquired resistance to disease is unknown but may involve

maturation of the immune system, including the balance between various T-cell subsets and the

specific tissue distribution of immune cells (Coussens, 2001).

The events that determinate whether cattle eliminate the infection or become permanently

infected remain unclear. In vitro studies have shown that MAP organisms proliferate within

bovine macrophages. This may be, in part, due to inhibition of phagosome acidification and

phagosome-lysosome fusion. Cytokines appear to regulate killing of the organisms in

macrophages, and pretreatment of monocytes with IFN-g, granulocyte macrophage

colony-stimulating factor, or high doses of tumor necrosis factor-a (TNF-a) restricted MAP

growth in vitro (Weiss et al., 2004; Woo and Czuprynski, 2008).

The first line of defense against invading MAP in the ruminant gut involves M cells and

phagocytic macrophages. M cells most likely pass MAP on to naive immune cells located

beneath the surface of the intestinal epithelial cells. MAP readily infects unactivated intestinal

macrophages, and non-opsonized MAP is readily phagocytosed by bovine macrophages in vitro

(Coussens, 2001).









MAP, as an intracellular parasite, remains within the phagocytic vacuole, and therefore,

immunology to paratuberculosis is dependent on cell mediated immune responses; humoral

immune factors have little or no protective value (Chiodini and Davis, 1993). Major

histocompatibility complex (MHC) class II antigen presentation occurs predominantly when

bacteria reside within the phagosome. Here, the cellular immune response to the pathogen

depends on MHC II antigen presentation to lymphoid cells which produce IFN-g in response to

antigen recognition (Kaufmann and Kaplan, 1996).

Development of immunity to facultative intracellular organisms in general involves the

co-operative action of T lymphocytes as specific inducers and macrophages as non-specific

effector cells. Cellular and humoral responses work in a reciprocal fashion through T helper

type-1 and type-2 cells, with several immune cells falling into a ThO classification characterized

by production of both Thl and Th2 cytokines. The clinical stages of bovine paratuberculosis,

characterized by large numbers of bacilli, high antibody levels, and diminished cellular responses

to specific and non specific antigens suggest a shift in the immune response from a primarily pro

inflammatory and cytotoxic response (Thl-like) to an antibody-based response (Th2-like)

(Chiodini and Davis, 1993; Coussens et al., 2004a).

It is, however, unlikely that this is a sharp transition; rather, there is a slow progression

along the classical Thl-Th2 line. The same shift in immune responses is associated with

development of clinical disease in human tuberculosis and other mycobacterial diseases

(Coussens et al., 2004a).

The main cytokines implicated in the protective response are IFN-g and TNF-ac. IL-2 plays

a central role in priming T cells and NK to secrete higher levels of IFN-g, increasing the Thl









response. 11-10 is the cytokine which down regulates the protective response in these atypical

mycobacterial infections (Kaufmann and Kaplan, 1996).

The mechanism responsible for loss or reduction of type 1-like responses to MAP are not

well understood but may be related to undefined host genetic factors, constant exposure of

immune cells to antigen released from infected macrophages, the type of antigen presenting cell,

the cytokine environment, the antigen dose and affinity for the cell receptor, the timing and the

level of co-stimulatory signals delivered by both the antigen presenting cells to the T cell, and by

the T cell to the antigen presenting cells during priming and secondary responses, or to the

development of antigen-specific or general regulatory cell populations (Brown et al., 1998;

Coussens, 2004).

Intermittent destruction of infected macrophages within granulomas could account for the

sporadic bacterial shedding observed in fecal cultures from subclinically infected animals, and

infrequent shedding of MAP also leads to continuous low level stimulation of the humoral

immune response. As a result of this stimulation, detectable levels of antibody return in the mid

to late stages of subclinical infections (Coussens, 2001).

In a study from Stabel and Ackermann (2002), the role of ap and y6 T cells in resistance to

MAP infection was investigated. Results suggested that ap T cells play a major role in resistance

to infection with MAP and that y6 T cells may play a lesser role and potentially confound

protective immune responses.

However, human y6 T cells are activated directly by various mycobacterial super antigens

as a critical component of the host's early defense against mycobacterial infections, including

MAP. Given the large proportion of T cells in calves that bear y6 receptors and their propensity

to localize to the intestinal epithelium, these cells could be an important source of IFN-g, TNF-ac









and perhaps other cytokines during early stages of MAP infection. Early release of significant

amounts of IFN-g, TNF-a by antigen activated y6 T cells could protect many bovine gut

macrophages by activating them before actual infection (Coussens, 2001).

Weiss et al. (2005) evaluated the role of interleukin (IL)-10 in the inability of monocyte-

derived bovine macrophages to kill MAP organisms in vitro. Neutralization of IL-10 enabled

macrophages to kill 57% of MAP organisms within 96 hours. It also resulted in an increase in

expression of TNF-c, IL-12, IL-8, MHC class II, and vacuolar H+ ATPase; increase in

acidification of phagosomes; apoptosis of macrophages; and production of nitric oxide.

Diagnostics

Diagnostic tests for paratuberculosis can be divided into two categories: those detecting the

organism and those that evaluate the host response to infection. The first category includes fecal

smear and acid-fast stain, bacteriologic culture (from fecal or tissue specimens), and polymerase

chain reaction test (PCR). The second category, detection of host response, includes clinical

signs in combination with gross and microscopic pathology and detection of immune response to

infection, which comprise cellular immune response (increased IFN-g production, delayed type

hypersensitivity reaction, lymphocyte proliferation), and humoral (antibody) response to MAP

(National Research Council, 2003).

However, despite the availability of different tests, ante mortem diagnosis of

paratuberculosis has been characterized by inaccuracy due to the lack of sensitivity (in most of

the cases) or specificity of the current diagnostic tools. This is of special importance during the

earlier stages of infection where a single effective diagnostic tool has not yet been identified

(Stabel and Bannantine, 2005).









With the idea of comparing among available tests, four stages of the disease presented by

Whitlock and Buergelt (1996) will be used. Briefly, stage I corresponds to silent infection in

young cattle; stage II is the subclinical disease with carrier adults; stage III is clinical disease

and, finally, stage IV is advanced clinical disease. As an attribute upon which to compare

different tests, sensitivity of a test is defined as its ability to detect diseased (infected) animals,

i.e. the proportion of the diseased (infected) animals that test positive. Specificity of the test is its

ability to detect non-diseased (non-infected) animals and is defined as the proportion of non-

diseased (non-infected) animals that test negative (Martin et al., 1987).

Tests Based on Agent Detection

Fecal smear and acid-fast stain

Fecal smear is used to screen feces for acid-fast staining microorganisms. The main

disadvantage of this procedure is its low sensitivity due to the irregular shedding pattern and the

variability in MAP concentration in feces.

The acid-fast stain procedure utilizes the physical property of some mycobacteria to resist

decolorization by acids during staining procedures. The most common staining technique used to

identify acid-fast bacteria is the Ziehl-Neelsen stain, in which the bacteria are stained bright red

and stand out clearly against a blue background (National Animal Monitoring System, 1997;

Palomino et al., 2007). Acid-fast staining is also used to detect the bacteria in tissue samples

through an impression smear made from ileum, mesenteric lymph nodes or other specimens.

Bacteriologic culture in feces

Detection of MAP by cultivation from fecal or tissue specimens has been the basis of

paratuberculosis diagnosis for a century and remains one of the most widely used diagnostic test

for the infection (Collins, 1996).









However, MAP culture is insidious and requires long incubation (8-16 weeks),

decontamination of the specimen to selectively kill faster growing non-mycobacterial organisms,

and concentration of organisms before inoculation of the medium (National Research Council,

2003). Conventional fecal culture involves monitoring for at least 16 weeks and PCR can be used

to confirm positive results. Radiometric systems (BACTEC), based on detection ofC14 labeled

CO2, can reduce the monitoring time to half, and non-radiometric automated culture systems,

recording differences in oxygen and CO2 pressure, are now available with similar time

requirements (National Research Council, 2003).

Specificity of fecal culture has widely been reported as nearly 100%, but the possibility of

pass-though of orally ingested organisms by uninfected cattle does exist. Research has shown

that cattle may ingest fecal matter loaded with MAP and become transiently fecal culture

positive (Whitlock et al., 2000). This condition was reported by Sweeney et al. (1992) who

recovered MAP from feces in heifers orally infected with contaminated feces. MAP was detected

18 hours after entry up to day seven. All heifers remained seronegative and had negative results

to the intradermal Johnin test. After necropsy, MAP was not isolated from mesenteric lymph

nodes, but was recovered from ileal mucosal samples from each heifer.

One of the main limitations of fecal culture is its sensitivity that has been reported ranging

from 23% to 74% depending on the method and stage of infection (Nielsen and Toft, 2008). The

test has no ability to detect animals in stage I of disease, but sensitivity increases going from

disease stage II to IV (Whitlock et al., 2000; National Research Council, 2003). Shedding of

MAP organisms in feces can be intermittent and detection by culture is complicated by

contamination with other microorganisms, and especially when few MAP specimens are shed in

the feces.









As an example, one study by Whitlock et al. (2000) examined the sensitivity and

specificity of fecal culture for MAP from seven dairy herds. A cohort of 954 cattle, cultured

every 6 months and followed over 4 years was the basis to determine the test sensitivity. For all

animals, the sensitivity of fecal culture to detect infected cattle on the first sampling was 38%,

while sensitivity was 42% for a cohort of parturient cattle.

Because of the moderate sensitivity of conventional fecal culture, and because MAP grows

very slowly on artificial media, different procedures have been successively proposed (National

Research Council, 2003). The double-incubation method (Cornell method) is commonly used for

decontamination and includes a pre-incubation step with brain-heart infusion medium that

initiates germination of bacterial and fungal spores, followed by centrifugation, and then a

second step with the addition of antibiotics (amphotercin B, vancomycin, and nalidixic acid) to

kill the spores that subsequently germinate (Whitlock et al., 1991). Subsequent centrifugation

leads to an increase in sensitivity of the process. Solid media supplemented with mycobactin J

are most commonly used for inoculation (Herrold's egg yolk medium, modified

Lowenstein-Jensen medium). Some modifications to this method have been introduced

subsequently to improve the test performance in the Cornell modified decontamination and

inoculation method (Whitlock and Rosenberger, 1990).

Stabel (1997) proposed a modified method for MAP fecal culture based on centrifugation

of the total fecal sample supernatant and the use of a 2-step decontamination protocol. The

growth rate of MAP and contamination rate of cultures when using this method were compared

to 3 other published methods: sedimentation, centrifugation, and Cornell. Sensitivity was lowest

for the Cornell method; however, contamination was not observed. Contamination was the most

severe in the centrifugation and the sedimentation method. The authors stated that the proposed









method was 10-fold more sensitive for detection of MAP colonies and contamination was

significantly reduced compared to other 3 methods.

The association between fecal culture performance and other diagnostic tests is not well

established. Muskens et al. (2003a), working with fecal samples of 422 ELISA-positive cattle

cultured for the presence of MAP, found that the percentage of samples with positive culture

results was 17.3%. Of the positive cultures, the number of colonies varied from 1-10 (22% of

cultures), 11-100 (22%), to more than 100 (55%).

In a study by Nielsen and Toft (2006) during a period of 3 years, repeated sampling of

milk and feces was performed in a total of 1,985 Danish dairy cows. Milk samples were analyzed

using an ELISA, and fecal samples were analyzed by culture. The results of the study indicated

that the ability of both tests to detect infection increased almost linearly from 2 to 5 yr of age.

Nielsen et al. (2002b) evaluated two ELISA and a fecal culture using maximum-likelihood

estimation of sensitivity and specificity. The authors concluded that sensitivity of the fecal

culture was 20-25% when used for screening in a population with an intermediate level of

infection. However, sensitivity increased to the range of 60-70% if fecal culture was used as a

confirmatory test on cows with a high ELISA reading.

Recently, pooled fecal culture from several animals within a herd has been suggested as a

screening tool (Kalis et al., 2004). Strategic pooling of fecal samples would increase diagnostic

sensitivity, would decrease the costs, and would be valuable when a herd is suspected to be

negative.

Wells et al. (2003) determined the sensitivity of bacteriologic culture of pooled fecal

samples in detecting MAP, compared with bacteriologic culture of individual fecal samples in 24

dairy cattle herds. Ninety four and 88% of pooled fecal samples that contained feces from at least









1 animal with high (> 50 colonies/tube) and moderate (10 to 49 colonies/tube) concentrations of

MAP, respectively, were identified by use of bacteriologic culture of pooled fecal samples.

Prevalence of paratuberculosis determined by bacteriologic culture of pooled and individual

fecal samples were highly correlated (r=0.96).

In another study (Wells et al., 2002), the sensitivity of different methods of bacteriologic

culture of pooled bovine fecal samples for MAP detection was compared. The homogeneity in

number of MAP in pooled fecal samples was also evaluated. The authors reported that, compared

with concurrent bacterial culture of individual infected samples, 37 to 44% of pooled samples

with low bacterial concentrations (mean <2.5 CFU/tube) yielded positive culture results and 94%

of pooled samples with high bacterial concentrations (mean >10 CFU/tube), yielded positive

results.

Automated systems

BACTEC system (Becton Dickinson Laboratories, Sparks, Maryland, USA) is a modified

mycobacterial radiometric culture devise designed for human clinical laboratories. It is an

automated, faster, and more sensitive method, and requires the use of radioisotopes (C14-labeled

palmitic acid). The instrumentation detects the C14-labeled CO2 that is produced by metabolism

of the labeled palmitic acid, and IS900 PCR is required to confirm positive results (National

Research Council, 2003).

Non-radiometric automated systems are currently available and offer a reduction in the

detection time for positive specimens (BACTEC MGIT series). The systems require special,

defined media and incorporate a detector system that reacts to alterations in oxygen, C02, or

pressure within a sealed tube (Hanna et al., 1999; Nielsen et al., 2001).

Five methods for whole herd fecal culture were compared in three herds by Eamens et al.

(2000). These included two methods based on primary culture on Herrold's egg yolk medium









with mycobactin J (HEYM): conventional (1) decontamination with sedimentation and primary

culture on HEYM; Whitlock decontamination and culture on HEYM (2). The remaining three

methods were based on radiometric (BACTEC) culture: decontamination and filtration to

BACTEC medium (3); modified Whitlock decontamination to BACTEC medium (4) and

Whitlock decontamination to BACTEC medium (5). For BACTEC cultures, two methods were

compared as confirmatory tests for MAP: mycobactin dependence on conventional subculture to

HEYM and IS900 PCR analysis of radiometric media. In identifying shedder cattle, method 5

was the most sensitive, followed by methods 2, 4, 1, and 3. The number of BACTEC cultures

confirmed by mycobactin dependence or PCR was similar.

Polymerase chain reaction (PCR)

The introduction of diagnostic probes based on specific bacterial DNA sequences has

allowed fastidious microorganisms, such as MAP, to be rapidly identified. In 1989, a novel DNA

insertion sequence (IS900) in MAP was reported (Collins et al., 1989; Green et al., 1989;

Eglund, 2002). IS900 is present in multiple copies (14-18) in MAP genome and consists of 1,451

base pairs (bp) of which 66% is G + C showing a degree of target sequence specificity (Green et

al., 1989).

Polymerase chain reaction tests based on this insertion element have been the most widely

used for MAP identification (Harris and Barletta, 2001). However, the detection of the etiologic

agent is limited by the frequency and number of the organism that are present in the body fluid or

tissue being tested. In the case of fecal detection, contamination, which inhibits PCR, has been a

strong limitation to date. Many efforts are focused at the present on an effective method for DNA

purification from feces that allows the use of PCR.

The isolation of MAP from sites distant to the intestinal tract, such as udder, fetus, kidney,

liver, male reproductive tract and blood, have suggested active dissemination of MAP. This









opens the possibility for detection of the agent by PCR in fluids such as milk and blood of

suspicious animals.

The PCR test is considered a useful test in detection of animals in stages II to IV of

disease. Of the currently available methods for detection of MAP, PCR-based assays have the

highest potential analytic sensitivity. Equally important as a test's analytic sensitivity is the

sample that is to be tested. Especially important is the ability of the sample to have a high

likelihood of containing MAP or leucocytes infected with MAP in early-stage animals, and to be

devoid of factors that inhibit PCR, such as those found in feces (Buergelt and Williams, 2004).

Sensitivity of PCR is difficult to determine because PCR is almost certainly more sensitive

than the great majority of existing diagnostic tests, making a gold standard impractical to

establish (Kelly et al., 2005). One study has reported PCR sensitivity for fecal, blood, milk, and

liver samples in advanced subclinically MAP infected cows as 87%, 40%, 96% and 93%

respectively (Barrington et al., 2003).

Although specificity of IS900 based PCR is considered nearly 100%, recent studies

suggest that insertion sequences similar to IS900 would be present in other mycobacterial species

and such sequences would also be positive in most of the current IS900 PCR systems (Cousins et

al. 1999; Tasara and Stephan, 2005). Another concern, because of the high analytical sensitivity

of PCR, is the possibility of false positive results arising from cross contamination of samples.

Several molecular targets, other than IS900, (HspX, L1/L9 integration sequences, ISMav2,

and F57) have been evaluated for MAP detection (Rajeev et al., 2005). The F57 and HspX

sequences occur as single copies, while at least three copies of ISMav2 are present in the MAP

genome (Tasara and Stephan, 2005) and has no similarity to known mycobacterial IS elements









although it shows more than 50% identity to a non-composite transposon of Streptomyces

coelicolor at the DNA and protein level (Strommenger et al., 2001).

Tasara et al. (2005) developed a multiplex PCR system designed to enhance specificity for

MAP detection in a single PCR reaction. Multiplex PCR is a variant of PCR which enables

simultaneous amplification of many targets of interest in one reaction by using more than one

pair of primers. This PCR assay co-amplifies the Mycobacterium species 16S rRNA gene, MAP

IS900 and F57 sequences. The multiplex PCR assay was highly specific, but the nested PCR

system was also positive for several other Mycobacterium species.

Li et al. (2005), working with a common clone of MAP, strain K-10, identified 17 copies

of the previously described insertion sequence IS900, seven copies of IS1311, and three copies

ofISMav2 in the K-10 genome. A total of 16 additional MAP insertion sequence elements were

identified in the analysis, totaling 19 different insertion sequences with 58 total copies in the

K-10 genome.

Bhide et al. (2006) presented a PCR-based detection of IS900, from the buffy coat of cattle

(n=262) and sheep (n=78), and direct genotyping by single strand conformational polymorphism

(SSCP). A total of 30 cattle and one sheep were positive for MAP-IS900. SSCP analysis grouped

the MAP-IS900 into four distinct clusters based on different band patterns. Nucleotide sequence

variability between MAP detected from sheep and cattle was noticed in the study.

Real-time sequence detection methods based on two different chemistries were presented

by Ravva and Stanker (2005). One was based on the detection of SYBR Green bound to PCR

products and the second more specific method, detected the cleavage of a fluorogenic (TaqMan)

probe bound to a target sequence during primer extension phase. Novel primers and probes that

amplify small fragments (<80 bp) of the MAP specific insertion sequence, IS900, were designed.









Both the SYBR green and TaqMan assays are able to detect 3 to 4 fg of DNA extracted from

MAP strain ATCC19698 (0.6 to 0.8 cells per assay). Both SYBR Green and TaqMan assays

were highly specific for the detection of MAP.

PCR on milk

Pillai and Jayarao (2002) evaluated the application of IS900 PCR for the detection of MAP

from raw milk. This assay was based on IS900 PCR detection including DNA extraction and

PCR assay using commercially available kits. Detection of MAP by IS900 PCR was consistent

when about 100 CFU/ml were present, whereas detection was variable at concentrations as low

as 10 CFU/ml. IS900 PCR was also evaluated with pooled quarter milk samples from 211 cows

from five herds with known history of JD. Out of 211 animals examined, 4% and 33% were

positive for MAP by milk culture and IS900 PCR from milk, respectively. A total of 20 bulk

tank milk sample aliquots were also examined, of which 50% were positive for MAP by IS900

PCR. By contrast, only 5% bulk tank milk sample aliquots were positive by culture.

Rodriguez-Lazaro et al. (2005) presented a real-time PCR assay for quantitative detection

of MAP amplifying IS900 insertion. The assay detected <3 genomic DNA copies with a 99%

probability. Using prior centrifugation, the assay was able to detect 102 MAP cells in 20 ml

artificially contaminated drinking water. With a detergent and enzymatic sample pretreatment

before centrifugation and nucleic acid extraction, the assay was able to consistently detect 102

MAP in 20 ml artificially contaminated semi-skimmed milk.

Tasara and Stephan (2005) developed a light cycler-based real-time PCR assay amplifying

the F57 sequence of MAP, including an internal amplification control template. The assay had a

reproducible detection limit of about 10 MAP cells per ml, starting with a sample volume of 10

ml of MAP-spiked milk.









Jayarao et al. (2004), evaluated sensitivity, specificity, and predictive value ofIS900-PCR

for MAP detection in pooled quarter milk and bulk tank milk. Culture analysis resulted in 10.9%,

2.8%, and 20.6% of fecal, pooled quarter milk and bulk tank samples positive for MAP,

respectively. While 13.5% and 27.5% of pooled quarter milk samples and bulk tanks were

positive by IS900 PCR, respectively. The IS900 PCR assay using pooled quarter milk samples

had a sensitivity, specificity and positive predictive value of 87%, 95% and 71%, respectively.

The IS900 PCR assay using bulk tank milk had poor sensitivity (21%), specificity (50%) and

predictive value (60%).

In another study (Giese and Ahrens, 2000), milk and fecal samples from cows with clinical

signs of paratuberculosis were tested by culture and PCR to determine the presence of MAP. The

bacteria were cultivated from feces or intestinal mucosa in eight of 11 animals. A few colonies

were cultivated (<100 CFU per ml) in milk from five fecal culture positive cows. Milk samples

from two cows were PCR positive (both animals positive for fecal culture, and one positive for

culture in milk). One cow was culture negative on intestinal mucosa, but culture positive in milk,

and two cows were negative in culture and PCR from both feces and milk.

PCR on feces

Different methods have been proposed for PCR detection of MAP in feces, but the high

analytical sensitivity of this test is seldom achieved on fecal specimens. Possible causes of this

problem include nonspecific DNA derived from the host or other microbes, presence of

inhibitory substances, and quality of the genomic DNA preparation (Khare et al., 2004).

Vary et al. (1990) presented the results obtained by DNA probes that hybridize IS900.

Tests were found to be highly specific for MAP. The authors report that direct detection of MAP

DNA in feces from infected cattle was highly specific, with a sensitivity equal to or greater than









that obtained by standard culture techniques with an important reduction in time to results when

compared to culture.

Van der Giessen et al. (1992) presented three assays for MAP detection on fecal samples of

dairy cattle, using dot spot hybridization of PCR products. The first two tests used PCR primers

and a DNA probe derived from MAP-specific sequences of the 16S rRNA gene and insertion

element IS900, respectively. The 16S rRNA test was able to detect 107 bacteria per g of feces,

and the IS900 test detected 104 to 105 per g of feces. These two tests and a commercially

available test (IDEXX Corp.) were used twice with an interval of 3 months on fecal samples of

87 cows from two dairy herds with a history of JD. Results were compared with those of

culturing. The tests showed a high specificity (89 100%) but the sensitivity ranged from 3 to

23%.

Khare et al. (2004) proposed a method based on immuno-magnetic bead separation

coupled with bead beating and real-time PCR for the isolation, separation, and detection of MAP

from milk and/or fecal samples from cattle. The authors report that by conventional and real-time

IS900-based PCR, 10 or fewer MAP organisms were consistently detected in milk (2-ml) and

fecal (200-mg) samples.

In another work (Tadei et al., 2004), three commercially available assays for IS900-PCR

on fecal samples were compared with a conventional culture method. Sixty seven percent of 80

culture-positive samples were positive for an assay that detects MAP DNA by dot spot

hybridization of PCR products (IDEXX Laboratories, ME), 60% were positive by an assay using

ethidium bromide staining for agar gel visualization of amplification products (Adiavet paratub

PCR, France), and 61.3% were positive by an assay with a colorimetric detection system (Institut









Pourquier, France). Specificity was 100% based on results from 20 culture-negative samples

from a MAP-free herd.

Fang et al. (2002) reported an automated fluorescent PCR for detection of MAP in bovine

feces. When the PCR was compared with culture of fecal samples, kappa scores of 0.94 to 0.96,

a sensitivity of 93 to 96%, and a specificity of 92% were obtained. Results were quantified by

use of a standard curve derived from a plasmid containing IS900 and a minimum quantity of 1.7

x 10-4 pg of DNA, correlating to 1 to 8 CFU, was detected.

Another study reported a comparison between a real-time PCR and fecal culture (Bogli-

Stuber et al., 2005). In fecal samples derived from 13 dairy herds in Switzerland real-time PCR

identified 31 of 310 animals as positive within this population whereas culture identified 20

positive animals. The observed agreement of the two tests used in the study was 91.3%, whereas

the kappa-value was 42%.

A high-throughput TaqMan PCR assay for MAP detection, targeted to Mav2 insertion

sequence was evaluated by use of fecal samples from naturally infected herds and herds

considered free of paratuberculosis (Wells et al., 2006). Fecal, blood, and milk samples were

subjected to the PCR-based assay, three different fecal culture procedures for MAP, two

ELISAs, and one milk ELISA. Results showed that specificity of the PCR assay was 99.7%.

Twenty-three percent of the dairy cows that were fecal culture positive by at least one of the

three methods were positive by the PCR assay.

In another study, using Bayesian non-"gold standard" analysis methods, the TaqMan PCR

assay had a higher specificity than serum ELISAs (99.3%) and sensitivity similar to that of the

serum ELISAs (29%). By classical methods, the estimated relative sensitivity of the fecal PCR









assay was 4% for light and moderate fecal shedders (compared to 12 to 13% for the ELISAs) and

76% for heavy fecal shedders (compared to 67% for the milk ELISA).

Detection of Host Response to Infection

Clinical signs, gross and microscopic pathology

Clinical signs appear in the stage III of paratuberculosis and include gradual weight loss in

spite of a normal appetite. With the progress of disease, manure consistency becomes more fluid

and diarrhea may be intermittent. Serum and biochemical changes include low concentration of

total protein, albumin, triglycerides and cholesterol. Muscle enzymes levels increase as a result

of muscle wasting. However these changes are not specific enough to be useful as diagnostic

tests. During stage IV animals become increasingly lethargic, weak, and emaciated. Most

animals are culled before this stage because of reduced milk production or severe weight loss.

Intermandibular edema, cachexia and persistent diarrhea characterize the terminal stage

(Whitlock and Buergelt, 1996).

Gross lesions are confined to the terminal portion of the small intestine and associated

lymph nodes. Lymph nodes are enlarged and edematous and sub-serosal lymphatics appear

tortuous, dilated and thickened, and intestinal mucosa becomes thickened and corrugated.

Pathognomonic cellular changes include clustered epithelioid macrophages and /or

inflammatory giant cells of Langhans' type and subtle histopathological alterations can be found

even during stage I of the disease. Ziehl-Neelsen staining technique is the traditional method to

demonstrate the presence of MAP in the tissues (Whitlock and Buergelt, 1996). At present, the

gold standard for paratuberculosis diagnosis is necropsy followed by extensive culture and

histological examination of multiple sections of lower small intestine and associated lymph

nodes (National Research Council, 2003).









Cellular immune response

Because cell-mediated immune (CMI) responses are the first and strongest host response to

mycobacterial infections, CMI tests may be useful for early detection of MAP infection

(Robbe-Austerman et al., 2007).

Interferon gamma assay (IFN-g)

A method of measuring CMI response is the gamma interferon (IFN-g) assay, a laboratory

test initially developed for the diagnosis of tuberculosis, but also available for the diagnosis of

paratuberculosis (Kalis et al., 2003). The test is based on production and release of IFN-g by

sensitized bovine lymphocytes in response to in vitro stimulation with a series of mycobacterial

antigens. Because cellular immunity is developed soon after infection, this test is considered the

most sensitive during early infection, and is deemed useful in detection of animals in stages II

and III (Billman-Jacobe et al., 1992; Collins, 1996, 2003; Stabel, 2001). To improve diagnostic

specificity, IFN-g levels released in response to bovis purified protein derivative (PPD) are

compared with IFN-g levels released in response to avium-PPD and IFN-g levels in

non-stimulated samples (Kalis et al., 2003). Reported sensitivities range from 72% to 99% for

subclinical cases, without and with fecal shedding, respectively (National Research Council,

2003).

However, the disadvantage of IFN-g assay is its low specificity. The test is subject to cross

reactivity with other mycobacteria (Huda et al., 2003), and specificity values are controversial,

ranging from 26 to 97.6% (Kalis et al., 2003). These authors re-examined CMI specificity. The

IFN-g assay specificity was estimated in 35 uninfected dairy herds by use of a newly developed

algorithm, resulting in 93.6%. When interpreted according to two alternative algorithms the

assay had specificities of 66.1 and 67.0% (Kalis et al., 2003).









In another work (Stabel, 2001), blood samples were obtained from infected dairy herds and

tested by a modified IFN-g analysis. Blood samples were incubated alone (non-stimulated), with

concanavalin A, and with M avium PPD, M. bovis PPD, or a whole cell sonicate of MAP for

18 h to elicit antigen-specific IFN-g production. After incubation, plasma was analyzed for

IFN-g by ELISA. Values for IFN-g for non-stimulated blood samples were consistently low. In

contrast, concanavalin A stimulation of blood samples evoked a significant secretion of IFN-g

regardless of infection status. Antigen-specific IFN-g results were positively correlated with

MAP infection status. Accuracy of the IFN-g assay for correctly predicting infection status of

individual cows in the herds with low levels of infection ranged from 50 to 75% when used as a

single test.

Huda et al. (2004) presented a study based on repeated blood and fecal sampling for

culture of feces, assessment of IFN-g secreted by MAP antigen stimulated whole-blood

lymphocytes, and measurement of antibody responses against MAP in serum and milk by

ELISA. The IFN-g test diagnosed higher proportions of infected and exposed animals than the

antibody ELISAs. The highest sensitivity of IFN-g test was in infected cattle 2 or more years of

age. IFN-g test had a better performance than antibody tests of animals of 1 and 2 years of age,

with a similar performance for animals of 3 or more years old.

Hypersensitivity reaction (Skin test)

A well-known CMI test for mycobacterial infections is the intradermal skin test which

measures delayed type of hypersensitivity to mycobacterial antigens. The swelling formed three

days after injection of a mycobacterial PPD (Johnin PPD) is measured using callipers to

determine the increase of skin thickness (Colins, 2003; Kalis et al., 2003).

In spite of successful application of the skin test in the control of bovine tuberculosis, it is

only occasionally used in the control of paratuberculosis because its specificity has been reported









to be low. Sensitivity of this test has been reported to be close to IFN-g assay; however,

specificity is lower because MAP shares antigens with environmental mycobacteria resulting in

numerous cross reactions (Collins, 1996). However, a study (Kalis et al. 2003) reported a

specificity of 93.5% for the skin test and a fair agreement (K = 0.41) between skin test and IFN-g

assay based on the analysis of 1631 animals.

In another study, Jungersen et al. (2002) estimated specificities from 95 to 99% by Johnin

PPD stimulation, irrespective of interpretation relative to bovine PPD or no-antigen stimulation

alone. For a limited number of test-positive animals, no change in the test results could be

observed with increasing antigen concentrations but IFN-g responses were significantly reduced.

In both MAP-free and MAP-infected herds, false positives were observed when the test was

applied to calves less than 15 months of age.

Lymphocyte proliferation

The lymphocyte transformation test is an in vitro test based on the fact that lymphocytes,

previously sensitized by an antigen, transform into blasts and proliferate when they are again

exposed to this antigen. This proliferation is determined by measurement of the incorporation of

H3-thymidine or bromodeoxyuridine into replicating DNA. The assay for paratuberculosis

detection uses antigen Johnin PPD to stimulate lymphocytes co-incubated with radio-labeled

deoxiuridine to measure the rate of DNA synthesis (Buergelt et al., 1977, National Research

Council, 2003). Although sensitivity is acceptable, like the previous test, it suffers from

specificity problems related to exposure to other mycobacteria. Another concern is the use and

disposal of radioisotopes, the expensive instrumentation and the large volume of blood required.

De Lisle and Duncan (1981) reported a whole blood lymphocyte transformation test to

examine cattle infected with MAP. Minimally infected animals responded to Johnin PPD in the

lymphocyte transformation test but did not routinely react on serological and/or skin testing.









Heavily infected animals showed considerable variation in their lymphocyte transformation

responses to antigen and some of them were consistently unresponsive. Antigen induced

lymphocyte transformation reactions were recorded in 7.6 to 41.5% of animals whose negative

infection status was determined by bacteriology and/or histopathology.

Humoral immune response

Given that antibody response occurs late in the course of infection, pathobiology of

paratuberculosis limits the ability of tests for serum antibodies to detect animals in the early

stages of infection (Collins, 1996).

Complement fixation and agar gel immunodiffusion (AGID).

Complement fixation was one of the earliest serologic tests for paratuberculosis but in the

present is not widely used because of its moderate sensitivity and low specificity. Agar gel

immunodiffusion test was developed as a quick test for animals showing clinical signs. Positive

results correlate well with clinical signs, but failure to detect subclinical infection is the main

limitation. Sensitivity and specificity have been reported as 18.9 and 99.4% for the detection of

subclinically infected animals (Sherman et al., 1984). AGID test is considered useful in detection

of animals in stages III and IV.

Enzyme-linked immunosorbent assay (ELISA)

Most ELISA tests in current use are modifications of the method developed by Yokomizo

et al. (1983) who developed an ELISA for MAP detection in cattle sera. The aim was to

minimize the nonspecific reactions caused by IgM by measuring only IgG1 against a bacterial

protoplasmic antigen. The sensitivity reported for this assay was 58% of cattle positive to fecal

culture. The authors reported 4% of the sera from fecal culture negative animals giving a false

positive result.









Three years later the same group reported that pre-absorption treatment of sera with

Mycobacterium phlei increased the specificity of the ELISA test by removal of cross-reacting

antibodies (Yokomizo, 1986). At present, ELISA test kits or services are commercially available

from a number of sources (IDEXX, Portland, Maine, USA; Allied Monitor, Fayette, Missouri,

USA; Synbiotics, San Diego, California, USA; Biocor Animal Health, Inc., Omaha, Nebraska,

USA; CSL, Parkville, Victoria, Australia; Pourquier, Institut Pourquier, Montpellier, France),

and sensitivity and specificity of ELISA for MAP detection have been described in numerous

published reports (National Research Council, 2003). ELISA sensitivity is usually reported in

reference to fecal culture. In the decade since the absorbed ELISA was introduced, the reported

sensitivity has gradually decreased from 57% (Milner et al., 1990) to a more current estimate of

45% (Sweeney et al., 1995). Despite the fact that commercial kits are marketed as herd-level

diagnostic tools, they are commonly used as cow-level tests. Because of its moderate sensitivity,

the ELISA test rarely gives a positive result in animals under 2 years of age and frequently fails

to detect individuals in the early phases of infection (Juste et al., 2005). Regardless of these

disadvantages, ELISA testing of sera is still the method of choice for epidemiological studies and

herd-based diagnosis (Bottcher and Gangl, 2004).

There are multiple estimations for ELISA sensitivity and specificity. Bech-Nielsen et al.

(1992) reported an increase in pre-absorbed ELISA response for animals with heavy MAP fecal

shedding when compared with the response in low shedders or culture negative animals. The

specificity reported for this pre-absorbed ELISA in two fecal culture negative herds was 100%

compared with 62.9% when the sera was not pre-absorbed.

In another study, two commercial ELISAs (Allied Laboratories, [Glenwood Springs,

Colorado, USA] and the CSL, Limited, [Parkville, Victoria, Australia]) were evaluated (Sockett









et al., 1992). A subclinical case of bovine paratuberculosis was defined as the isolation of MAP

from fecal samples or internal organs of cattle without diarrhea or weight loss. The Allied

ELISA, and the CSL ELISA had sensitivities of 58.8, and 43.4%, respectively, and specificities

of 95.4, and 99.0%, respectively. The Allied ELISA, and the CSL ELISA detected 65.7%, and

56.5% of the MAP fecal shedders, respectively.

In a review from Collins and Sockett (1993) the limitations of ELISA were presented. The

authors stated that sensitivity is a direct function of the infection stages in the tested population,

with a better ability for detection in the advanced stages of the infection. In this review, the

estimates of sensitivity range from 24.6% to 88.2%, for stages 1 and 3 of infection, respectively,

with a combined estimation of 45.5%. The specificity reported is 99.7% for pre-absorbed

ELISA.

Whitlock et al. (2000) examined the sensitivity and specificity of the ELISA and fecal

culture tests for paratuberculosis in dairy cattle. Infected dairy herds tested concurrently with

both fecal culture and ELISA resulted in more than double positive animals by culture compared

to ELISA. ELISA had a higher sensitivity in animals with a heavier bacterial load (75%)

compared to low shedders (15%).

Another study reported sensitivity for ELISA of 45% for a group of 1146 cows, with

values ranging from 15% to 87% as the disease progressed to clinical stages (Thorne and Hardin,

1997). On the other hand, sensitivities between 15.4 to 88.1% were presented by Dargatz et al.

(2001) for serum ELISA, depending on the clinical stage and bacterial shedding status of the

cattle.

It has been suggested that the measurable humoral immune response to MAP in subclinical

cows can even vary widely from day to day (Barrington et al., 2003). It is suspected that this









variation in ELISA results is due to fluctuation in antibody production, variable losses by way of

the gastrointestinal tract, or a combination of both (Buergelt and Williams, 2004).

Gasteiner et al. (2000) tested two ELISA-methods (A-ELISA, Allied Monitors; H-ELISA,

Veterinary University Hannover) with serum samples from healthy, infected and diseased cattle

as well as positive and negative reference sera. In both ELISA-methods total agreement between

antibody detection and shedding of MAP was found for diseased animals. Reference serum

samples of culturally negative cattle were negative in 98% by H-ELISA and in 82% by

A-ELISA, and those of positive animals were positive in 59% by H-ELISA and in 82% by

A-ELISA.

Jubb et al. (2004) estimated the sensitivity of a serum ELISA (Parachek, CSL, Parkville) in

dairy herds participating in a control program in Australia. Values reported are 16.1%, 14.9%

and 13.5% for herds with 5, 6 and 7 annual tests, respectively.

In another work, Nielsen et al. (2002) studied the ELISA response to MAP by cow

characteristics and stage of lactation. The results showed that the probability of being

ELISA-positive was 2 to 3 times lower for cows in first parity relative to cows in other parities

(milk and serum). The probability of a positive result was higher at the beginning of the lactation

for milk ELISA, but for serum ELISA the odds of being positive was higher at the end of the

lactation.

Van Schaik et al. (2005) presented a kinetic ELISA with multiple cutoff values to detect

fecal shedding of MAP. The sensitivity and specificity relative to culture reported were 67% and

95%, 31% and 99.7%, and 11% and 99.9% for three different cutoff values respectively. The

authors suggested that cutoff values for this kinetics ELISA should be determined based on the

apparent within herd prevalence of infection.









In a recent review, Nielsen and Toft (2008) examined multiple studies reporting sensitivity

values for serum multiple ELISA with values ranging from 7% to 94%, depending on the

particular test under analysis and the group reporting the results.

However, the high specificity of ELISA has been questioned by some recent works.

Osterstock et al. (2007) evaluated the effect of exposure to environmental mycobacteria on

results of 2 commercial ELISAs (A: HerdCheck, IDEXX laboratories Inc and B: ParaCheck,

CSL Biocor). Weaned crossbred beef calves were inoculated with 1 of 5 mycobacterial isolates

derived from herds with high proportions of false-positive serologic reactions for

paratuberculosis, MAP, or mineral oil. By use of ELISA-A, >1 false-positive reaction over time

was detected in 2, 3, 3, and 1 of the 3 calves injected with Mycobacterium avium,

Mycobacterium intracellulare, Mycobacterium scrofulaceum, or Mycobacterium terrae,

respectively. By use of ELISA-B, only M scrofulaceum induced false-positive reactions.

In a subsequent study, Roussel et al. (2007) evaluated the seroprevalence of

paratuberculosis by use of the 2 previously cited commercial ELISAs (A,B) in association with

prevalence of fecal shedding of mycobacteria within beef cattle herds in 6 affected beef herds

and 3 geographically matched herds without high seroprevalence of paratuberculosis. Cattle from

affected herds were 9.4 times as likely to have environmental mycobacteria isolated from feces.

The authors suggested that beef herds with persistently high rates of false positive ELISA results

may be associated with recovery of environmental mycobacteria from feces.

Agreement among serum ELISA kits

Inter-laboratory reproducibility of an absorbed ELISA kit for detection MAP serum

antibodies (Johne's Absorbed EIA, CSL Limited, Parkville, Australia) was evaluated by

Collins et al. (1993). A panel of bovine sera was tested in triplicate microtiter wells at 8 different

laboratories. Between-well CVs averaged 6.7% + 2.8% (mean standard deviation), and









between-day CVs averaged 14.5% + 9.8% among laboratories. Among 1392 assays in 7

laboratories, 98.6% were in agreement indicating that the absorbed ELISA kit provided

reproducible results within and between laboratories.

However, strong discrepancies between different commercial ELISAs when performed

concomitantly on the same animal have been reported. McKenna et al. (2006) presented a range

of kappa coefficients for combinations of three different commercial ELISA tests from 0.18 to

0.33, which is slight and fair agreement, respectively.

Five diagnostic ELISA tests were evaluated by using individual serum or milk samples

from cattle in paratuberculosis-free and infected dairy herds (Collins et al., 2005). The specificity

of three ELISAs (two on serum, one on milk) was >99.8%. The specificity of the remaining two

ELISAs, (serum), was 94.9 and 84.7%. Four of the five ELISAs evaluated produced similar

sensitivity in detecting fecal culture-positive cattle (27.8 to 28.9%). One serum ELISA had the

lowest specificity (84.7%) and the highest sensitivity (44.5%). Assay agreement (kappa

coefficient) ranged from 0.47 to 0.85 for categorical assay interpretations (positive or negative),

but linear regression of quantitative results showed low correlation coefficients (r=0.40 to 0.68).

In a recent study, three different commercially available serum-ELISA (Svanovir-ELISA,

Svanova, Uppsala, Sweden; IDEXX-ELISA, IDEXX Laboratories, Maine, USA;

Pourquier-ELISA, Institut Pourquier, Montpellier, France) and two milk ELISA (Svanovirm-

ELISA Svanova, Uppsala, Sweden; Pourquier-ELISA, Institut Pourquier, Montpellier, France)

were compared. Blood-, milk- and faecal samples were monthly taken from 63 selected animals.

The highest number of blood- and milk samples with a detectable antibody-level was found by

the Svanovir-ELISA. There was a significant correlation between serum- and milk- Svanovir-

ELISA results, whereas the agreement between ELISA and faecal culture/PCR was low.









Significant correlations between Svanovir-serum-ELISA results and milk somatic cell counts

were estimated (Geisbauer et al., 2007)

Milk/serum ELISA

Sensitivity and specificity for milk ELISA has been reported in a range from 21%-61%

and 83%-100%, respectively (Nielsen and Toft, 2008). Hardin and Thorne (1996) compared milk

and serum ELISA for MAP detection, using concurrent samples, and estimating the correlation

between milk and serum tests. McNemar's chi square were significant (p = 0.05), but analysis of

correlation and regression analysis were low (r2=0.02), indicating a low association between both

tests results.

Milk and serum samples from 35 dairy herds in the US were evaluated for cow- and

herd-level MAP antibody test agreement (Lombard et al., 2006). Evaluation of 6,349 samples

suggested moderate agreement between milk and serum ELISA results, with a kappa value of

0.50. Cow-level sensitivity for 18 dairy operations with 1.921 animals was evaluated relative to

fecal culture results, with values of 21.2 and 23.5% for the milk and the serum ELISA,

respectively.

Stabel et al. (2002) reported that from a population of 651 cows, only 25% of animals with

fecal-culture positive results tested positive for milk ELISA and over 6% of cows that were

fecal-culture negative tested ELISA-positive. ELISA for bulk-tank milk also has been developed

for estimating the level of paratuberculosis infection in dairy cattle (Nielsen et al., 2001). Those

authors describe a sensitivity of 97% and specificity of 83%. However, the number of infected

animals that must be present in the herd to result in a positive bulk-tank sample is apparently

unknown.









Disease Control


Epidemiological Factors in Control

Host factors

Transmission of paratuberculosis is mainly via ingestion of MAP in colostrum or milk,

exposure of young to infected feces, or through in utero infection of calves (Seitz et al., 1989;

Valentin-Weigand and Goethe, 1999; Buergelt et al., 2006; Mitchell et al., 2008; Wittington and

Winsor, 2007). Level of exposure (dose of organisms) and age at the time of exposure are major

factors in determining whether an animal eventually becomes infected with MAP (McKenna et

al., 2006). Infection is believed to occur mainly in young individuals, with age-resistance

occurring later (Nielsen and Toft, 2007). It is suspected that, on rare occasions, certain animals

that are exposed to MAP can generate a protective immune response resulting in full clearance of

the bacteria (Buergelt et al., 2004a; McKenna et al., 2006).

On the other hand, genetic factors have been associated with differences in host

susceptibility to infection with MAP and subsequent disease. Estimations indicate a range of

moderate heritability values for susceptibility to infection (Koets et al., 2000; National Research

Council, 2003; Mortensen et al 2004, Gonda et al., 2006). Research has recently been aimed at

detecting associations between susceptibility differences and polymorphisms of candidate genes,

with no definitive results (Hinger et al., 2007; Taylor et al., 2006; Gonda et al., 2005, 2007).

A breed effect has been proposed in some studies with Jersey and Shorthorn cows having a

higher susceptibility for paratuberculosis infection (Cetinkaya et al., 1999; Jakobsen et al., 2000).

However, confounding variables such as different husbandry practices could have played a role

in the reported differences.









Natural reservoirs and environmental factors

One important threat to paratuberculosis control programs is infection in feral maintenance

hosts that cannot be controlled and could potentially reintroduce infection in livestock (Biet et

al., 2005). There are many studies reporting the presence of MAP infection in non-domestic

animal populations. Among the wild species in which paratuberculosis has been reported are

other ruminants, such as deer (Stehman, 1996), bison (Buergelt et al., 2000, Ellingson et al.,

2005a), and elk, as well as non-ruminants, such as wild rabbit (Greig et el., 1997), rat, wood

mouse, hare, their predators, including fox and stoat, weasel, and primates, such as mandrill and

macaque (Beard et al., 2001; Zwick et al., 2002), indicating a wide host range (Alifiya et al.,

2004).

Analysis of the molecular diversity and comparative molecular pathology of MAP would

help to establish the degree of heterogeneity in strains isolated from a variety of host species.

The extent of strain sharing across a variety of hosts would reflect the degree of interspecies

transmission (Motiwala et al., 2003, 2004).

MAP is primarily transmitted by the fecal-oral route with the bacteria shed in the feces of

infected individuals and then ingested by susceptible animals. The level of transmission of MAP

by indirect contact depends on the number of organisms shed in the feces and the organism's

survival characteristics in the environment (National Research Council, 2003).

While MAP is unable to replicate in the environment, some characteristics, such as a

peculiar lipid-rich cell wall, enable the organism to persist in the environment and contribute to

its resistance to low pH, high temperature, and chemical agents (Manning, 2001). The

relationship between MAP and the environment is complex, involving factors such as the

physical characteristics of the substrate material (feces, water, milk, manure slurry, dust,









environmental surface, dirt), temperature, pH, water activity or content, and competing

microorganisms (National Research Council, 2003).

Raizman et al. (2004) characterized the distribution of MAP in the environment of infected

and uninfected Minnesota dairy farms. Eighty infected and 28 uninfected herds were sampled.

Two environmental samples were obtained from each farm from various locations, and samples

were tested using bacterial culture for MAP. Environmental samples were cultured positive in

78% of the infected herds, and one negative herd had one positive environmental sample. The

study results indicated that targeted sampling of cow alleyways and manure storage areas appears

to be an alternative strategy for herd screening and Johne's infection status assessment.

Lombard et al. (2006a) studied the distribution of MAP in the environment and assessed

the relationship between the culture status of the bacteria in the farm environment and herd

infection status. A total of 483 environmental samples were collected, and 218 (45.1%) were

culture-positive for MAP. Positive environmental cultures resulted from parlor exits (52.3%),

floors of holding pens (49.1%), common alleyways (48.8%), lagoons (47.4%), manure spreaders

(42.3%), and manure pits (41.5%). Sixty-nine of the 98 operations (70.4%) had at least one

environmental sample that was culture-positive. Of the 50 herds classified as infected by fecal

culture, 76.0% were identified by environmental culture. Of the 80 operations classified as

infected based on serum ELISA-positive results, 76.3% were identified as

environmental-positive, whereas 20 of the 28 operations identified as infected based on milk

ELISA were detected by environmental sampling.

Due to the particular characteristics of its cell wall, along with the clumping behavior of

this bacteria, MAP appears to be more thermal resistant than other mycobacteria, making









pasteurization of milk and milk products somewhat problematic (Chiodini et al., 1984; Lund et

al., 2000; Grant et al., 2001).

MAP DNA and viable bacteria has been reported on commercially pasteurized retail milk

(Millar, 1996; Ayele et al., 2005; Ellingson et al., 2005), calling into question the validity of

feeding pasteurized milk products to calves as a possible means of lowering the risk of MAP

infection (McKenna et al., 2006).

Population factors

Different models have been proposed to explain the transmission and persistence of MAP

within dairy herds, considering variables such as prevalence in different categories of animals,

and taking into account that susceptibility decreases with age. In general terms, three adult-

shedding categories (low, high and clinical) are usually considered, and risk factors are

established according to the level of exposure as a result of environmental contamination. In

these models the probability of a successful infectious contact increases as animals advance in

subsequent stages of disease. In a study by Mitchell et al. (2008), it was concluded that in all

models high-shedding animals have an important impact on prevalence of MAP infection in a

herd. However, these animals were not the only ones responsible for disease persistence and

infection in a low-prevalence herd, actively managing shedding animals. Infection could be

maintained by other factors, such as dam-to-daughter and calf-to-calf transmission. A recent

simulation model proposed by Nielsen et al. (2007) indicated the need of adjusting by covariates

such as mean prevalence in the herd, the age adjusted prevalence of the herd, the rank of the age

adjusted prevalence, and a threshold-based prevalence.

From the diagnosis point of view, a study presented by Kudahl et al. (2007) predicted that

an increase in milk-ELISA sensitivity, used in a "test-and-cull" strategy would result in a more

effective reduction of MAP prevalence, with a milk production level comparable to a non-









infected herd if initial prevalence was moderate (25%) or an increased milk production, if initial

prevalence was high (80%). However, it was predicted that after 10 years, a persistent high

replacement rate would limit progress because of a restricted replacement base.

Control Programs

In general, disease control programs have 3 main objectives: decrease the number of new

infections; decrease the number of clinically diseased or shedding animals; and decrease the

duration of disease or its infective period (McKenna et al., 2006a).

In the past, almost all of the JD control programs worldwide have been based on early

identification and rapid elimination of clinically infected animals, and the implementation of

preventive measures (Benedictus and Khalis, 2003). However, many of them have been

ineffective in the reduction of the disease prevalence (Groenendaal et al., 2003), and numerous

programs based only on test and cull have been terminated because of their high costs and

because success or failure can only be demonstrated over a long period of time (Whitlock et al.,

1994).

Groenendaal and Galligan (2003) presented a simulation model for paratuberculosis

control on midsize dairy herds in the US. The results suggested that test-and-cull strategies alone

do not reduce the prevalence of paratuberculosis in cattle and are costly for producers to pursue.

Vaccination did not reduce the prevalence but was economically attractive. Finally, improved

calf-hygiene strategies were found to be critically important and economically attractive in every

paratuberculosis control program.

To quote some examples, The Netherlands started a national control program in 1998

based on repeated herd fecal cultures combined with sanitary and zootechnical management

methods. France started a control program combining culture of feces and management strategies

and Australia and some states of USA have started voluntary control programs, based on various









diagnostic methods bacteriologicall and serological) supplemented with management

recommendations to prevent the further spread of MAP within and between herds (Benedictus

and Khalis, 2003). The voluntary program in Australia, modified in 2003, protects the status of

non-infected herds and regions, reducing the social, economic and trade impact of JD at herd,

regional and national levels. This program has been based on the introduction of a herd scoring

system related to the risk of JD in a herd, thus facilitating trade of dairy cattle in a less regulated

environment and providing a pathway for herds to progress with JD control.

In general, control programs have relied on management techniques to identify infected

herds and then clear those herds of infection, and results of vaccination strategies have been

controversial (Khalis et al., 2001; Muskens et al., 2002). In addition, because of the long

subclinical phase and the limited sensitivity of diagnostics, eradication programs require a long

term commitment (National Research Council, 2003). In New Zealand voluntary vaccination is

practiced in infected herds. However, although vaccination reduces the incidence of clinical

disease in cattle, it does not prevent infection and transmission (Benedictus and Khalis, 2003).

Israel started a voluntary control program in 2003 aimed at detecting infected herds and

providing management approaches for the reduction or prevention of herd infection. The

program is based on ELISA testing and fecal culture of positive cows together with management

practices focused on maternity hygiene, colostrum use, culling of fecal shedders, and

categorization of herds according to their infectious status (Koren et al., 2005).

Many attempts have been made in the past decade to establish a nationwide management

program in the US. At present, there is a national program designed as a model for improving the

equivalency of state control and herd certification programs. The program is voluntary, so









producer incentive for participation relies on the potential for the added market value associated

with products from known-status herds.

In April 2002, the US Department of Agriculture, Veterinary Services section, published

the Uniform Program Standards for the Voluntary Bovine Johne's Disease Control Program.

This program recommended an advisory committee in each state to assist the state veterinarian in

establishing and operating a JD program.

The structure of the program has 3 parts. Part 1 is education of the producers, part 2 is an

assessment of on-farm risk and herd management plans, and part 3 involves herd testing and

classification into 4 levels. Testing in the initial stage is done by ELISA on 30 randomly selected

animals 36 month of age or older. Program levels are reached by successive testing of statistical

subsets of second- or higher- lactation animals within a specific time frame (National Research

Council, 2003)

Justification

Bovine paratuberculosis causes serious economic losses to the cattle industry worldwide

and could become an important threat to international commerce.

From the point of view of public health, numerous studies have suggested an association

between MAP and Crohn's disease in humans (Chiodini, 1989; Sechi et al., 2005; Shanahan and

O'Mahony, 2005). However, presently, there is insufficient evidence to prove or disprove that

MAP is the cause of even some of the cases of Crohn's disease in humans (National Research

Council, 2003; Sartor, 2005). An additional concern is the fact that MAP is becoming more

widespread in the environment and in the food chain.

Finally, the fact that MAP host range includes ruminant and non ruminant wildlife (Greig

et al., 1999) raises the concern that the spread of the infection could alter wildlife populations,









and, if wildlife reservoirs become established, it could limit the ability to control or eradicate JD

in domesticated livestock.

Management practices

Control principles are divided into three categories. First, management practices preventing

or reducing the likelihood of highly susceptible newborn and young animals from ingesting

manure from infected animals. Second, reducing infections by colostrum and milk management,

and third, reducing farm contamination with MAP by management of infected animals.

Test-and-cull strategies are not likely, by themselves, to be effective in herd MAP control, and

hygiene and management practices should be included.

According to the previous statements, most control measures fall into one of three referred

categories of MAP control (National Research Council, 2003); protection of calves, management

of milk and colostrum, and reduction of MAP load in the farm.

The protection of young stock from older animals and from feces-contaminated feed and

water considers the following measures:

* Cleaning and disinfection of maternity and calf pens after each use.

* Maintaining dedicated, clean, and dry maternity pens.

* Removal of calves immediately after birth to clean, dry calf pens, stalls, or hutches.

* Raising calves separate from the adult herd for at least the first year of life.

* Use of separate equipment for handling feed and manure.

* Design and maintenance of feed-bunks and waterers to minimize risk of contamination
with manure.

* Applying manure from the adult herd only to cropland or to pasture grazed by adult stock.

* Not allowing shared feed or water between adults and young stock; nor offering feed
refusals from adult cattle to young stock.

* Avoiding vehicular and human traffic from adult animal areas to young stock areas.









* Testing and managing test-positive cows at dry-off, before introduction to the maternity
pen.

The reduction of infections by colostrum and milk management includes the following

points:

* Feeding colostrum only from test-negative cows.

* Not colostrum pooling.

* After colostrum feeding, use of pasteurized milk or milk replacer.

Finally, the reduction of total farm exposure to the organism is based on:

* Immediately culling of all animals with clinical signs of JD.

* Cull culture-positive animals as soon as possible; for cows with low or moderate fecal
culture colony counts, removal at the end of lactation may be acceptable.

* Test adult cattle at least annually by serum or fecal tests; positive serum test results should
be confirmed by fecal culture.

* Consider calves from test-positive cows to be high risk individuals for later developing the
disease, and consider culling recent offspring of test-positive cows.

* Purchase replacement animals from test-negative herds.

Testing and diagnostics in control programs

The control and eradication of JD is severely impaired by imperfect diagnostic tests,

prolonged incubation time, the presence of undetected subclinical cases, and the lack of

knowledge of strain diversity (Kudahl et al., 2007; Motiwala et al., 2003).

Tests for detection of antibodies to MAP, such as ELISA present the major disadvantage of

moderate to low sensitivity, and the usefulness of serologic tests is compromised by the

variability of the immune response, depending on the stage of disease (Collins et al., 2006). The

ELISA test infrequently detects infected animals less than 2 years of age and frequently fails to

detect individuals in the early phases of infection (Juste et al., 2005). Low agreement between

results from different commercially available ELISA kits is another drawback of this test









(McKenna et al., 2006). However, ELISA testing of sera is still the most common method used

in epidemiological studies and herd-based diagnosis (Bottcher and Gangl, 2004).

Tests based on the detection of the agent, likewise, present the problem of a low

sensitivity, and it has been estimated that fecal culture detects only about 50% of cattle infected

with MAP (Stabel, 1997). New methods detecting specific bacterial DNA sequences have

allowed a more rapid identification of MAP. Polymerase chain reaction (PCR) tests based on the

insertion element IS900 have been widely used for MAP identification (Harris and Barleta,

2001).

A combination of independent tests is a common method to improve reliability of

laboratory diagnostic tools. As a result of the limitations of MAP diagnosis, such strategies have

already been implemented by using a combination of bacterial fecal culture and PCR or

serological screening and bacterial fecal culture (Collins et al., 2006). Moreover, a combination

of tests with different sensitivities and specificities allows a better classification of animals and

herds relative to the probability of MAP infection (Bottcher and Gangl, 2004).

Delayed detection of infected cows was investigated by Nielsen and Ersboll (2006). They

analyzed the age at which cows tested positive by ELISA and fecal culture (FC) by use of

time-to-event analyses. Repeated ELISA testing detected 98 and 95% of cows classified as high

and low shedders, respectively, suggesting that most infected cows develop antibodies. Among

the high shedders, 50% were positive before 4.3 yr of age. Repeated FC detected only 72% of the

cows that were ELISA-positive, and 50% of the ELISA-positive cows were detected by FC at 7.6

years of age. The highest probability of testing positive by ELISAwas from 2.5 to 4.5 yr of age,

and the highest probability of testing positive by FC was from 2.5 to 5.5 yr of age.









For control programs, and from and epidemiological stand point, it is important to make

the distinction between test performance at the individual animal level and test performance at

the herd level. The ELISA is a valuable screening test for control programs. Although the test

has relatively low sensitivity at the individual animal level, it exhibits fairly good sensitivity at

the herd level. It also has significant advantages over fecal culture for screening, which is

important in large-scale control programs. These advantages include relatively low cost,

simplicity, and rapid results (National Research Council, 2003).

On the other hand, recently, pooled fecal culture from several animals within a herd has

been suggested as a cost effective screening tool (Kalis et al., 2004). Strategic pooling of fecal

samples would increase diagnostic sensitivity and would be valuable when a herd is suspected to

be negative.

Vaccination

Vaccination against paratuberculosis was first described in 1926, at which time live

vaccines were used. Conventional veterinary vaccines against MAP have generally comprised

killed organisms in oil injected subcutaneously in young animals. Field vaccination is effective

in decreasing the incidence of clinical disease and attenuating pre-existing infection, irrespective

of whether live or killed vaccines are used (Khalis et al., 2001).

The currently available vaccines consist of a range of variations of whole bacterins with

adjuvants and have shown a variable efficacy in field studies. Current vaccine prevents the

occurrence of the clinical stage of the disease to a high degree, thereby limiting a substantial

amount of the direct economical damage (Koets et al. 2006). In cattle, however, the vaccine does

not prevent infection and subclinically infected animals shed bacteria in their feces

intermittently. Another major drawback of the whole bacterin vaccines is the interference with

tuberculosis and paratuberculosis diagnostics; about half of the animals receiving whole killed









MAP vaccines become false positive using the conventional tuberculin skin test diagnostic for

bovine tuberculosis (Khalis et al., 2001; Muskens et al., 2002). A third weakness is that some

vaccines cause substantial local tissue reaction, resulting in prolonged swelling and granuloma

formation at the site of injection (Huntley et al., 2005; Koets et al. 2006).

Koets et al. (2006) reported the use of a recombinant MAP Hsp70 as a subunit vaccine in

cattle experimentally infected with MAP. In previous studies, this subunit vaccine has been

shown to produce a cell mediated immune response. The results of the study showed that

recombinant MAP Hsp70 significantly reduced shedding of bacteria in feces during the first 2

years following experimental infection.

Vaccination is available on a limited basis in the US. The vaccine that has been in use in

US is an oil suspension of killed Strain-18 organisms, a closely related strain ofM avium. The

efficacy of vaccination has been questioned, and the current consensus is that vaccination may

reduce the incidence of clinical disease, and to a lesser extent the prevalence of infection, but

vaccinates are not fully protected from infection (Uzonna et al., 2003).

In a study by Uzonna et al. (2003), vaccination induced a persistent serologic, non-

protective humoral response in 90% of animals within 6 months. The poor success of vaccination

might be related to the inability of the vaccine to induce a protective Thl response, mediating

resistance against the disease, instead of an apparent induction of cell-mediated immunity as

measured by intradermal testing, lymphocyte proliferation and cytokine assays.

A study from Spangler et al. (1991) documented the effect of calf vaccination for MAP on

a serologic ELISA. Fifteen calves vaccinated with a killed paratuberculosis vaccine and 5

unvaccinated control calves were tested by serum ELISA from the first through the fifteenth

month of life. All calves were ELISA-negative prior to vaccination. Thirteen of 15 vaccinated









calves became ELISA-positive between 2 and 6 months after vaccination indicating that the use

of vaccine may interfere with diagnosis of paratuberculosis and with control programs based on

serologic tests.

Kalis et al. (2001) analyzed whether vaccination with a killed vaccine prevented fecal

shedding of MAP, and compared effectiveness of a culture and cull program in vaccinated and

non-vaccinated herds, on 58 commercial Dutch dairy herds. Differences were not detected

among the 25 herds that were vaccinated; culture results were positive for MAP in 4.4% of

herds. In 29 herds that had not been vaccinated, culture results were positive in 6.7%. The

authors concluded that vaccination of calves with a killed vaccine did not prevent transmission of

MAP.

In another study (Kohler et al., 2001), after immunization of four calves with a live

modified MAP vaccine (Neoparasec, Rhone-Merieux, Lyon, France), the humoral and

cell-mediated immune reactions were studied during 2-years. The possibility of shedding of the

vaccine strain and the influence of the vaccination on the tuberculin skin test were determined. A

cell-mediated immune reaction developed much earlier than humoral immunity, with a transient

increase in antibody titers. Cell-mediated immunity remained detectable until the end of the

study period. Fecal shedding of the vaccine strain was not detected. Positive or inconclusive skin

reactions against a M. bovis PPD reflected the possible interference with diagnosis of bovine

tuberculosis.

In the past decades, vaccination against paratuberculosis in cattle was performed in The

Netherlands only on a limited scale (Muskens et al., 2002); vaccination was restricted to herds

with a high prevalence of clinical cases of paratuberculosis. This author reported a study

designed to evaluate the immune response resulting from vaccination with a heat-killed









paratuberculosis vaccine. Over a period of 12-14 years, data showed a marked and prolonged

effect of the vaccination on both cellular and humoral immune responses. It is concluded that a

long lasting interference is to be expected with the available immunodiagnostic methods for both

bovine tuberculosis and paratuberculosis.

DNA vaccines can offer an alternative approach that may be safer and elicit more

protective responses. A genomic DNA expression library was generated and subdivided into

pools of clones to determine DNA vaccine efficacy by immunizing mice via gene gun delivery

and challenging them with live, virulent MAP. Four clone pools resulted in a significant

reduction in the amount of MAP recovered from mouse tissues compared to mice immunized

with other clone pools and non-vaccinated, infected control mice. Comparison of the protective

clone array sequences implicated 26 antigens that may be responsible for protection in mice

(Huntley et al., 2005).

Treatment

Treatment for paratuberculosis is rarely indicated; however, it may be considered for

animals of genetic value or companion animals. St-Jean and Jernigan (1991) presented in a

review some antibiotics for the treatment of paratuberculosis including isoniazid, rifampin,

streptomycin, amikacin, clofazimine, and dapsone. They reported that treatment of

paratuberculosis requires daily medication for extended periods and results in palliation of the

disease rather than a definitive cure. The recommended treatment for paratuberculosis is based

on isoniazid, rifampin, and an aminoglycoside.

Monensin sodium is a polyether ionophore with a broad spectrum of antimicrobial activity

that includes several gram-positive bacteria. Hendrick et al. (2006) studied the role of monensin

sodium in protecting cows from being milk-ELISA positive for paratuberculosis in Ontario,

Canada dairy herds. In total, 4,933 dairy cows from 94 herds were enrolled in a cross-sectional









study. Composite milk samples were collected from all lactating cows and tested with a

milk-ELISA for antibodies to MAP. In 48 herds in which paratuberculosis had not been

diagnosed previously, the use of calf hutches and monensin in milking cows were both

associated with reduced odds of a cow testing positive (OR=0.19 and 0.21, respectively). In 46

herds with a prior history of paratuberculosis, feeding monensin to the breeding-age heifers was

associated with decreased odds of a cow testing positive (OR=0.54).

In another report, Hendrick et al. (2006a) enrolled 228 cows from 13 herds into a

randomized clinical trial. Fecal culture and PCR were used to identify 114 cows as potential

fecal shedders, while 114 cows were enrolled as ELISA negative, herd and parity matched

controls. Cows received either a monensin controlled release capsule or a placebo capsule. Serial

fecal culture and serum ELISA was performed over a 98-day period. On day 98 of the study,

treatments were switched and cows were followed for another 98 days with a similar sampling

protocol. During the first 98 days of the study, cows treated with a monensin were found to shed

3.4 CFU per tube less than placebo treated cows (p = 0.05). Treatment with monensin did not

reduce the odds of testing positive on serology, and only cows shedding MAP on day 0 were

found to have a reduced odds of testing positive on fecal culture when treated with monensin

(OR=0.27; p 0.03).

In another study, Brumbaugh et al. (2000) analyzed histopathological findings on 19 adult

cows naturally infected with paratuberculosis. Thirteen cows were treated with monensin sodium

and six remained untreated. Monensin had a beneficial effect in the ileum (p = 0.07), liver (p =

0.03) and rectal mucosa (p = 0.05), but not in mesenteric lymph nodes (p = 0.35).

Productive and Economic Impact of Johne's Disease

Paratuberculosis contributes both to direct and indirect losses in the cattle industry due to

reduced milk production, premature culling, additional losses from higher cow replacement costs









and lower cull cow revenues (Bennett et al., 1999, National Research Council, 2003). The

disease also involves losses due to potential limitations in domestic and international trade

(National Research Council, 2003). In an early work, Buergelt and Duncan (1978) analyzed age

and milk production data from Holstein cows reporting a significantly shorter life expectancy

and reduced milk production of MAP infected cows when compared with non-infected herd

mates. Benedictus et al., in 1987, reported a decrease in milk production of 19.5% compared

with the lactation two years before culling of animals showing clinical signs of paratuberculosis.

The reduction in production was 5% when compared to the previous lactation.

In another study, Collins and Nordlund (1991) compared the milk production (mature

equivalent at 305 days, ME305) for ELISA positive cows with their test negative herdmates,

with 5.36% less production for infected cows. This effect was significant in lactation number

three or greater. Test positive cows produced less protein ME305 and fat ME305. The net

economic effect on productivity of cows increased with each lactation reaching over $200/test

positive cow by lactation number three.

Nordlund et al. (1996), in a cross-sectional epidemiologic survey in 23 dairy herds in

Wisconsin found that ELISA-positive cows had a ME milk production of 376 kg/lactation less

than that for ELISA-negative herdmates. However, significant difference was not found in

lactation average percentages of fat and protein, or somatic cell count (SCC) linear score.

Subclinical paratuberculosis infections were associated with a 4% reduction in milk yield.

In a study by Baptista et al. (2008), the association between the presence of antibodies to

MAP and SCC was analyzed. A causal relationship between high SCC and antibodies to MAP

was not found, but the results suggested a strong association and a potentially increased risk of

MAP transmission when milk with high SCC is fed to calves.









Vanleeuwen et al. (2001) estimated the impact of subclinical infection in dairy cattle in 90

randomly selected herds in Canada. Milk production for ELISA-seropositive cows was lower

than that for seronegative cows; in their 1st and 5th lactations, ELISA-seropositive animals

produced 573 and 1273 kg less than seronegative cows, respectively.

Gonda et al. (2007) estimated the effect of MAP infection on milk, fat, and protein yield

deviations, pregnancy rate, lactation somatic cell score, and projected total months in milk

(productive life). A serum ELISA and fecal culture for MAP were performed on 4,375 Holsteins

in 232 DHIA herds throughout the US. Infected cows (ELISA or fecal culture positive) produced

303.9 kg less milk/lactation, 11.46 kg less fat/lactation, and 9.49 kg less protein/lactation

(p<0.003) and had higher pregnancy rates (1.39% greater, p = 0.03) and lower productive life

(2.85 months less, p<0.0001). Somatic cell score was not affected. The fecal culture-positive

population of cows had larger effects on all traits than ELISA-positive population of cows.

In a longitudinal study Lombard et al. (2005) determined the effects on production and risk

of removal related to MAP infection at the individual animal level (serum ELISA) in dairy cattle.

A total of 7,879 dairy cows from 38 herds in 16 states were analyzed. Cows with strong positive

results had ME305 milk production, ME305 maximum milk production, and total lifetime milk

production that were significantly lower than cows in other categories. No differences were

observed for ME305-day fat and protein percentages, age, lactation, and lactation mean linear

somatic cell count score between cows with strong positive results and those with negative

results. After accounting for lactation number and relative herd-level milk production, cows with

strong positive results were significantly more likely to have been removed by 1 year after

testing.









Alternatively, some studies (Johnson-Ifearulundu et al., 2001) also reported non significant

differences in production between infected and non-infected cows. These could be reflected in a

difference of diagnostic tests used, average lactation number for the herds under study, or an

effect of average lactation of the herds under analysis.

Johnson-Ifearulundu et al. (2001) measured the effect of subclinical infection on ME milk,

protein, and fat production in a sample of Michigan dairy herds. Subclinical paratuberculosis

test-positive status (fecal culture) had no statistically significant effect on ME milk, fat, or

protein production. This is in agreement with results from Hendrick et al. (2005) where no

difference in 305-day milk or fat production was detected in cows with positive results of serum

ELISA, compared with seronegative cows.

Tiwari et al. (2005) reported that for cows culled for all reasons in four Canada provinces,

MAP-seropositive cows had a 1.38 (1.05-1.81, 95% CI) times increased hazard of being culled

compared to MAP-seronegative cows. Among cows that were culled because of either decreased

reproductive efficiency or decreased milk production or mastitis, MAP-seropositive cows were

associated with 1.55 (1.12-2.15, 95% CI) times increased hazard compared to MAP-seronegative

cows.

In a review by McKenna et al. (2006a) it was stated that there was a 2.4 times increase in

the risk of their being culled for cattle positive by ELISA, with a decrease in ME305 milk

production by at least 370 kg. Host level factors included age, level of exposure and source of

exposure, such as manure, colostrum, or milk. Agent factors involved the dose of infectious

agent and strains of bacteria.

An epidemiological study in Ontario, Canada, based on 304 dairy herds analyzed the

association between production and MAP serological status (lipoarabinomannan









enzyme-immunoassay). MAP positive status was associated with higher somatic cell counts at

herd and individual levels, but no association was found with calving interval and milk

production (McNab et al., 1991).

In another study, the effect of MAP infection on the shape of lactation curves was reported

(Kudahl et al., 2004). Milk samples from 6,955 cows in 108 Danish dairy herds were tested with

ELISA. The lactation curves after peak yield were significantly less persistent in young infected

cows, where an increase of one standardized optical density (OD) unit was associated with a

depression of the milk yield per day of 3.7 kg of fat corrected milk in first parity and 2.7 kg in

second parity. In third and older parities, the model indicated exponentially increased losses with

increased ODs. This study showed significant correlations between antibody response to MAP in

milk and milk production, and it links infection to poor persistency and considerable milk loss.

Johnson-Ifearulundu et al. (2000), based on a prospective cohort study design, evaluated

the impact of subclinical MAP infection on days open in dairies in Michigan. ELISA-positive

cows had a 28-day increase in days open when compared to ELISA-negative cows. The authors

concluded that reduced estrus expression or an increased post-partum anestrous period would

occur in the subclinically infected ELISA-positive animals, probably due to a negative energy

balance associated with MAP infection.

Hendrick et al. (2005) determined the effect of paratuberculosis on culling, milk

production, and milk quality in infected dairy herds using a cross-sectional design. Results

showed that cows positive for bacteriologic culture of feces and milk ELISA produced less milk,

fat, and protein, compared with herd mates with negative results. The survival analyses indicated

that cows with positive results of each test were at higher risk of being culled than cows with









negative results. Paratuberculosis status was not associated with milk somatic cell count linear

score.

A study by Raizman et al. (2007) evaluated the lactation performance of cows shedding

MAP in feces before calving and of cows culled with clinical signs consistent with JD during the

subsequent lactation. Fecal culture was performed in 1,052 cows before calving. Signs of clinical

disease (milk fever, retained placenta, metritis, ketosis, displaced abomasum, lameness, mastitis,

pneumonia, and JD), and production and reproduction data were recorded for each cow. In 8% of

cows fecal samples were positive for MAP. In multivariable analysis, light, moderate, and heavy

fecal shedding cows produced on average 537, 1,403, and 1,534kg, respectively, less milk per

lactation than fecal negative cows. Fecal culture positive cows were less likely to be bred and

conceive. In the multivariable analysis the 56 cows culled with presumed JD produced

approximately 1,500kg/lactation or 5kg/day less than all other cows.

Diverse estimations of the economic losses due to paratuberculosis have been presented by

different authors.

Chiodini et al. (1984) estimated that JD produced an annual loss in New England of $15.4

million and cost the Wisconsin dairy industry $54 million per year. The cost suffered by

chronically infected herds would reach an annual economic loss of $75-100 per adult animal.

Braun et al. (1990), based on the prevalence of infection and extrapolating data from previous

studies, calculated a net loss due to JD of $9 million annually in Florida. In another study, Stabel

(1998) estimated that the economic impact of paratuberculosis on the US national cattle industry

was over $1.5 billion per year.

In a study by Losinger (2005) the analysis of the economic impacts of JD indicated that

reduced milk production, associated with the determination of dairy operations as JD-positive,









reduced consumer surplus by $770 million $690 million, and resulted in a total loss of $200

million $160 million to the US economy in 1996.

The USDA National Animal Health Monitoring System's (NAHMS) 1996 national dairy

study analyzed the impact of paratuberculosis on herd productivity and economy in US dairy

herds. Positive herds experienced a loss of almost $100 per cow when compared to JD-negative

herds due to reduced milk production and increased cow-replacement costs (Ott et al., 1999).

Herds reporting at least 10% of their cull cows as having clinical signs consistent with JD, had

losses over $200 per cow. These herds experienced reduced milk production of 700 kg per cow,

culled more cows with lower cull-cow revenues, and had greater cow mortality than JD-negative

herds. Averaged across all herds, JD costs the US dairy industry, in reduced productivity, $22 to

$27 per cow or $200 to $250 million annually.

Economic losses attributed to paratuberculosis in herds with a disease control program

were estimated by Groenendaal and Galligan (2003) by use of the simulation model. Mean loss

increased considerably from $35/cow/y in year 1 to > $72/cow/y in year 20. Lower milk

production accounted for 11% of the total loss attributable to paratuberculosis, and 12% of the

loss resulted from a lower slaughter value of culled infected cattle and treatment costs of

clinically affected cows. Finally, most of the loss (77%) attributable to paratuberculosis was

categorized as loss of future income as a result of suboptimal culling.

One study in the Maritime Provinces of Canada (Chi et al., 2002) estimated an annual cost

due to paratuberculosis for an average, infected, 50 cow herd of $2,472. This estimation

considers direct production losses and treatment costs.

Elzo et al. (2006) evaluated cow and calf genetic and environmental factors for their

association with ELISA scores for paratuberculosis in a multi-breed population of beef cattle.









Regressions indicated that poorer maintenance of cow weights was associated with higher

ELISA scores. The data also indicated that cows with greater ELISA scores tended to produce

lighter calves at birth and/or calves with slower pre-weaning growth. These results suggest that

subclinical paratuberculosis may be negatively affecting cows and their offspring.

Crohn's Disease

The Disease

Inflammatory bowel disease (IBD) comprises a group of chronic, relapsing, idiopathic,

inflammatory illnesses of the gastrointestinal tract usually presenting as Crohn's disease (CD) or

ulcerative colitis (UC), which predominantly affect the colon (CD and UC) and /or the distal

small intestine (CD) in either a superficial (UC) or transmural (CD) manner (Blumberg et al.,

1999). Both disease entities primarily affect young adults and are often accompanied by

extra-intestinal manifestations such as arthritis, uveitis or primary sclerosing cholangitis, as well

as associated illnesses (e.g. osteoporosis or secondary colon carcinoma) (Hoffmann et al., 2002-

2003).

CD was recognized as a distinct entity 75 years ago (Economou and Pappas, 2007) and,

although CD and UC share many clinical and pathological characteristics, they also have some

different features suggesting that the main pathological processes in these two diseases are

distinct (Bouma and Stober, 2003). Epidemiological and clinical observations point toward a

multi-factorial model, where clinical disease is trigged by the association of multiple elements

involving genetic, immune-related, environmental, and infectious factors (Bouma et al., 1997;

Selby, 2000; Gazouli et al., 2005; Trinh and Rioux, 2005; Economou and Pappas, 2007).

However, one of the hallmarks of the disease is the activation of nuclear factor kappa B (NF-kB)

that drives the increased expression of pro-inflammatory cytokines (Schreiber, 2005).









Crohn's disease is a chronic, relapsing inflammatory condition affecting any part of the

human gastrointestinal tract, with the distal ileum most commonly involved. It is characterized

by transmural inflammation with deep ulceration, thickening of the bowel wall and fistula

formation, and non-caseating granuloma. Clinical presentation depends upon the site of the

inflammation, and it includes general malaise, chronic weight loss, abdominal pain, and diarrhea.

Extraintestinal manifestations develop in up to 25% of patients and perianal disease is also

frequent (Selbi, 2000; Sechi et al., 2005).

Uzoigwe et al. (2007) reviewed some aspects of CD epidemiology. The disease occurs

throughout the world, it is most prevalent in Europe and North America. It exhibits a prevalence

of 161-319 cases/100,000 people in Canada and affects between 400,000 and 600,000 people in

North America alone. Prevalence estimates for Northern Europe have ranged from

27-48/100,000, with around 13 people per 100,000 reported for the population in the UK (Sechi

et al., 2005, Uzoigwe et al., 2007).

The incidence of CD in North America has been estimated at 6/100,000 per year, and is

thought to be similar in Europe, but lower in Asia and Africa. The incidence of CD in

industrialized parts of the world has been reported to be increasing, and the disorder occurs most

frequently among people of European origin, and has been reported to be 2-4 times more

common among those of Jewish descent than among non-Jews. The disease appears in

individuals of any age, but commencement between 15 and 30 years of age is more common, and

it can also occur in early childhood or later in life. (Sugimura et al., 2003; Sechi et al., 2005;

Uzoigwe et al., 2007).









The course of clinical disease is chronic and intermittent and treatment includes anti-

diarrheal and anti-inflammatory agents to treat symptoms, immunosuppressive drugs aimed at

disease remission, and surgery (Sechi et al., 2005).

Etiology

The precise causes of CD remain unknown. Hypotheses include an aberrant or

autoimmune host inflammatory response to undefined antigens, infectious etiology, including

MAP, and aberrant immune response to a specific infectious agent, but consensus has not been

achieved (National Research Council, 2003).

Other causes of CD have been proposed including chronic ischemia and micro-infarction,

persistent measles infection, chronic viral infection, infection with pathogenic E. coli, abnormal

response to a dietary component, and abnormal inflammatory response to normal intestinal micro

flora, or components of the flora, in genetically predisposed individuals (National Research

Council, 2003). Various polymorphisms of a human gene, caspase recruitment domain 15 gene

(CARD15, former NOD2), that confers increased susceptibility to CD, have been reported, and

the role of this gene, which may function as an apoptosis regulator, is currently unclear.

Crohn's Disease and CARD15/NOD2 Gene

It has long been suspected that certain individuals may be genetically predisposed to

developing CD (Newman and Siminovitch, 2005; Grant, 2005; King et al., 2006). As early as

1934, CD was recognized as a familial disorder. This observation was further confirmed by

many groups (Hugot, 2006), with a proportion of familial aggregations of 8% to 10% on average.

In a review by Tysk (1998), population based studies were presented showing that the

relative risk of IBD is increased 10-20 times in first-degree relatives of the proband with CD,

with the highest risk in siblings.









Research has confirmed that as many as 50% of monozygotic twins are affected by CD

whereas the dizygotic-twin concordance is not significantly different from that for all siblings.

Reported concordance rates for ulcerative colitis are seen in approximately 6-17% and 0-5% for

monozygotic and dizygotic twins, respectively (Tysk, 1998; Bouma and Strober, 2003; Lakatos

et al., 2006). A high heritability index close to 1.0 was presented for CD, and this estimation

remained high after correction for shared environmental factors (Tysk, 1998).

Linkage studies have revealed a number of putative IBD-susceptibility loci, suggesting that

several genes are involved in predisposition to IBD.

In 2001, three research groups independently reported an association between mutations in

a gene on chromosome 16, (CARD15/NOD2 gene) and CD (Hampe et al., 2001; Hugot et al.,

2001; Ogura et al., 2001). Mutations increasing susceptibility to CD up to 40 times were mapped

to this locus (Maeda et al., 2005). A recent meta-analysis analyzed the disease risk associated to

CARD15/NOD2 mutations providing odds ratios for CD in mutation carriers equal to 2.2 (95%

CI: 1.84-2.62), 2.99 (95% CI: 2.38-3.74), and 4.09 (95% CI: 3.23-5.18) for the three main

mutations R702W, G908R, and 1007fs. In addition, the odds ratio for double mutants was

estimated to be 17.1 (95% CI: 10.7-27.2, Economou et al., 2004).

In European populations, having one copy of the risk alleles confers a 2-4-fold risk for

developing CD, whereas double-dose carriage increases the risk 20-40-fold. Carriage of

CARD15/NOD2 risk alleles is associated with ileal location, earlier disease onset, and structuring

phenotype (Bonen and Cho, 2003).

The product of CARD15/NOD2 gene is an intracellular element responsible for the indirect

recognition of bacterial peptidoglycan through the binding of muramyl dipeptide, a component

of both Gram negative and positive bacterial cell walls in monocytes, macrophages and dendritic









cells, where it is mainly expressed (Ogura et al., 2001a; Maeda et al., 2005). The protein is a

member of the Ced4-APAF1 protein super family and is expressed in cells such as monocytes,

dendritic cells, Paneth cells and intestinal epithelial cells. Structurally, CARD15/NOD2 is

composed of three segments: the first being composed of two NH2-terminal caspase recruitment

domains (CARD units), the central portion consisting of nucleotide-binding domain and finally,

a leucine-rich repeat (LRR) region as is found in toll like receptors (Hugot, 2006; Lakatos et al.,

2006).

The binding of CARD 15/NOD2 to this bacterial motif causes its binding to a second

CARD 15/NOD2 molecule, thus forming a dimmer. Further interaction with other cytosolic

proteins leads to the ultimate activation of NF-kB, eliciting pro-inflammatory reactions (Ogura et

al., 2001a). NF-kB is nuclear transcription factor that regulates expression of a large number of

genes that are critical in ruling apoptosis, viral replication, tumor genesis, inflammation, and

autoimmune diseases. It is still unclear whether NF-kB expression is elevated or depressed in CD

due to conflicting observations and studies. In vitro experiments demonstrated that the declining

activity of this protein indicates a loss-of-function effect (Lakatos et al., 2006).

The LRRs are involved in the interaction with infecting bacterial lipopolysaccharides

(LPS) and peptidoglycan, whereas the CARDs enable the protein to induce apoptosis and the

NF-kB signaling pathways (Lesage et al., 2002). NOD2 variations identified so far are evenly

distributed along the entire coding sequence except in its 5' portion encoding the first CARD

domain.

The three main mutations of NOD2 (R702W, G908R and L1007fsinsC), including a frame

shift mutation encoding a truncated protein, occur in the LRR domain or in its vicinity,

suggesting that they alter the recognition of the bacterial LPS. This hypothesis has been









supported by functional experiments that have demonstrated that the 1007fs mutation decreased

the NF-kB activation by the LPS (Lesage et al., 2002; Bonen et al., 2003). Two other members

of the NOD-LRR family have been experimentally demonstrated to serve a role in resistance to

bacterial pathogens: NOD1 for Helicobacter pylori and Naip5/Bircle for Legionella

pneumophila (Behr and Schurr, 2006). This theory, also, would support the controversial role of

MAP infection in patients with CD.

Evidence suggests that the CD-associated mutations result in a loss of functional

phenotype (Behrn and Schurr, 2006). However, variant CARD 15/NOD2 proteins apparently

present inflammation-promoting functions. Two main hypotheses provide an explanation for this

apparently contradictory point. The first advocates that mutant CARD15/NOD2 is defective in

performing critical functions required for limiting inflammation (loss-of-function). The second

proposes that the variant proteins directly activate pro-inflammatory signaling pathways

(gain-of-function). The hypotheses are not contradictory and may be a valid combination

(Zelinkova et al., 2005).

Cells of healthy persons and CD patients harboring mutant CARD15/NOD2 alleles do not

respond to muramyl dipeptide ex vivo, pointing to a loss-of-function phenotype even in people

without disease. Therefore, an important etiological consideration is whether only a subset of

persons with susceptible alleles experience specific microbial exposures or whether additional

compensatory mechanisms are ineffective in these patients (Behrn and Schurr, 2006).

An estimation of the proportion of cases of CD that could be attributed to CARD15/NOD2

mutations has been proposed at 15-30%, leaving space for a number of other factors in the

pathogenesis of CD. The association of gene polymorphisms to an increased susceptibility to

develop disease does not preclude the possibility that the disease may be infectious in etiology,









and CD could result from bacterial insult in genetically susceptible individuals (Van Heel et al.,

2001; Newman and Siminvitch, 2003).

In three works (Hampe et al., 2001; Hugot et al., 2001; Ogura et al., 2001) it was

determined that the CARD15/NOD2 mutant (L1007fsinsC) found in CD patients was inefficient

in killing bacteria, when compared with wild-type CARD15/NOD2, supporting the proposed link

between bacterial detection and bacterial killing. Taken together studies on CARD15/NOD2

provide a conceptual link between CD and bacterial sensing.

Some works provide more evidence of the link between bacterial infection, gene

polymorphisms, and CD. Sechi et al. (2005a) analyzed the proportion of people in Sardinia with

or without CD that were infected with MAP and had allelic variants of CARD15/NOD2. The

results showed that more than 70% of CD affected individuals carried at least one of the

CARD15/NOD2 alleles associated with susceptibility and were also infected with MAP.

In one study (Heresbach et al., 2004) the association of CARD15/NOD2 mutations with

CD in different subsets of CD phenotypes was studied. Carriers of at least one CARD15/NOD2

variant were significantly more frequent in CD than in controls, and were significantly associated

with ileal involvement, and structuring evolution. Granuloma formation was found to be

associated with the mutant R702W allele.

Mycobacterium Paratuberculosis and Crohn's Disease

In the early part of the 20th century, the similarities between this human intestinal disease

and JD in cattle were identified. JD in cattle shares some similarities with human CD as diarrhea,

wasting, and a predilection for the ileum (Chiodini, 1989; Bernstein et al., 2004).

CD and JD have been compared clinically and pathologically, but the similarity of the two

diseases has been exaggerated in some cases. Some differences include an extra-intestinal

manifestation in CD, but not in JD, and macroscopic features such as fistulas and pseudo polyps









in CD. Similarities and differences have been interpreted by experts both in favor of and in

opposition to the view that MAP is a cause of CD (Selby, 2000; National Research Council,

2003).

Chiodini et al. (1984a) reported a previously unrecognized Mycobacterium species isolated

from two patients with CD. The organism was an acid-fast, mycobactin-dependent

Mycobacterium with unique particularities. The bacterium was pathogenic for mice, and a goat

inoculated orally developed both humoral and cell-mediated immunologic responses and

granulomatous disease of the distal small intestine, with noncaseating, tuberculoid granulomas.

These findings raised the possibility that a Mycobacterium could play an etiologic role in at least

some cases of CD. Few years later MAP was isolated for the first time from a CD patient

(Chiodini, 1989).

Shanahan and O'Mahony (2005) suggested supporting observations of a causal link

between MAP and CD. They presented Helicobacterpylori, as an example of an infectious agent

contributing to peptic ulcer and gastric cancer. Also, genetic and patho-physiologic indication of

heterogeneity of CD, suggest distinct deficiencies leading to a similar clinical manifestation. This

would imply that a subset of disease might have an infectious basis. Monozygotic twin studies,

with concordance rate of only about 50%, indicate an environmental contribution to the

pathogenesis of CD, and the increasing incidence, particularly in developed nations is consistent

with an environmental influence.

In general terms, evidence supporting a link between MAP and CD includes: clinical and

pathological similarities between JD and CDs; higher detection rates of MAP by PCR and

culture in gut samples from Crohn's patients compared with controls; demonstration of a

serological response to MAP antigens in Crohn's patients; and anti-MAP antibiotic therapy









resulting in remission, or improvement in disease condition; presence of MAP in food chain

(milk, meat) and water supplies, and detection of MAP in human breast milk by culture and PCR

(Naser et al., 2000; Grant, 2005; Sartor, 2005; Bernstein et al., 2007).

In recent years, the idea of a link between both diseases has been supported by reports of

MAP detected in tissues of patients with CD by culture and by molecular methods (Sechi et al.,

2005). In addition, detection of MAP DNA in milk has been stated as a plausible transmission

via cattle to human and raises concerns about public health safety (Shanahan and O'Mahony et

al., 2005).

Detection of MAP by molecular techniques in human intestine tissue has produced

variable results; the majority of studies have detected MAP DNA or cultured the bacteria in

higher frequency from tissues of CD affected individuals than from controls, although the

reported frequency of recovery of MAP in CD and ulcerative colitis have ranged from 0% to

100%. However, this opens the possibility that this organism may selectively colonize the

ulcerated mucosa of CD patients but not initiate or perpetuate intestinal inflammation (Sartor,

2005).

Naser et al. (2004) tested for MAP by PCR and culture in buffy coat preparations from

individuals with CD, with UC, and without IBD. MAP DNA in uncultured buffy coats was

identified by PCR in 13 (46%) individuals with CD, four (45%) with ulcerative colitis, and three

(20%) without inflammatory bowel disease. Viable MAP was cultured from the blood of 14

(50%) patients with CD, two (22%) with ulcerative colitis, and none of the individuals without

inflammatory bowel disease.

In another study, Sechi et al. (2005) found that twenty-five patients (83.3%) with CD and 3

control patients (10.3%) were IS900 PCR positive in intestinal mucosal biopsies. MAP was









cultured from 19 Crohn's patients (63.3%) and from 3 control patients (10.3%). The finding of

the organism colonizing a proportion of people without CD would be consistent with what

occurs in other conditions caused by a primary bacterial pathogen in susceptible hosts.

Ghadiali et al. (2004), reported two alleles found by analysis of short sequence repeats of

MAP isolated from CD patients. Both of these alleles clustered with strains derived from animals

with JD. Identification of a limited number of genotypes among human strains could imply the

existence of human disease-associated genotypes and strain sharing with animals.

Autschbach et al. (2005) examined IS900 in a large number of gut samples from patients

with CD and UC, and in non-inflamed control tissues. IS900 PCR detection rate was

significantly higher in CD tissue samples (52%) than in UC (2%) or control (5%) specimens

(p < 0.0001). In CD patients, IS900 DNA was detected in samples from both diseased small

bowels (47%) as well as from the colon (61%). No association between MAP specific IS900

detection rates and clinical phenotypic characteristics in CD was established.

Collins et al. (2000) analyzed results of multiple diagnostic tests (PCR, ELISA, and IFN-g

tests) for MAP in IBD patients and controls. Most assays were adaptations of diagnostic tests for

this infection performed routinely on animals. The authors concluded that MAP, or other

mycobacterial species, infect at least a subset of IBD patients.

Abubakar et al. (2008) presented a meta-analysis of studies using nucleic acid-based

techniques to detect MAP in patients with CD compared with controls. Based on 47 studies, the

pooled estimate of risk difference in the detection of MAP in CD patients compared with non-

IBD controls from all studies was 0.23 using a random effects model. Similarly, MAP was

detected more frequently from patients with CD compared with those with ulcerative colitis (risk

difference 0.19). The data confirms that MAP is detected more frequently among CD patients









compared with controls, but the pathogenic role of this bacterium in the gut remains uncertain.

The analysis suggested an association between MAP and CD, but this association remained

inconclusive, and its strength and consistent detection of MAP DNA does not prove causation.

Bernstein et al. (2004) had as an objective to determine whether CD subjects were more

likely to be MAP seropositive than controls in a sample from Manitoba population (Canada).

Using an ELISA for serum antibodies to MAP, initially developed for cattle but adapted for

human use, the rate of positive ELISA results there was no different in MAP seropositivity rate

among CD patients (37.8%), UC patients (34.7%), healthy controls (33.6%), and non-affected

siblings (34.1%). In the same population, another study could not find an interaction between the

NOD-2 genotype and MAP serology in relationship to CD or ulcerative colitis (Bernstein et al.,

2007).

Effectiveness of anti-mycobacterial drugs to control CD as a factor of association with

MAP is controversial. However, disease remission following antibiotic therapy has been

reported. Chamberlin et al. (2007) presented a case of a 63 years old patient tested previously

positive for MAP in blood, that after antibiotic treatment showed a complete remission with

accompanying negative results for MAP detection by PCR on blood. Another case of a man who

had persistently active CD that was not responding to medical therapy was reported (Behr et al.,

2004). Tissue from mesenteric lymph nodes was examined by IS900 PCR and MAP DNA was

detected. After anti-MAP antibiotic therapy the patient's condition markedly improved within a

few months. The man was found to possess the susceptibility alleles of the CARD15/NOD2 gene.

Recently, an altered T cell function associated with the presence of MAP in CD patients was

reported. Higher levels of IL-4 and IL-2 were found in these patients when compared to MAP









negative CD cases, indicating a skewed Th2 immune response and providing a new antecedent

for the link between MAP detection and CD (Ren et al., 2008).

Some of the evidence against the causal association between MAP and CD is based on the

information presented by different authors. CD is less common in rural areas and it is not known

to be an occupational hazard of farming; Johnes et al. (2006) found no association between CD

prevalence in dairy farmers and exposure to clinical cases of bovine paratuberculosis.

Sartor (2005) enumerated some other points such as: lack of epidemiological support of

transmissible infection; lack of epidemiological evidence of transmission from water or milk

products; no evidence of transmission to humans in contact with animals infected with MAP;

genotypes of CD and bovine origin MAP isolates are not similar, and variability in detection of

MAP by PCR and serological testing. Environmental conditions such as poor sanitization and

overcrowding which should favor transmission of infection appears to protect against CD.

On the other hand, there is no evidence for vertical or horizontal transmission of CD, and

sustained clinical responses to immunosuppressive drugs and to antitumor necrosis factor-alpha

seem to be at variance with a chronic infection. Disseminated MAP in CD has not been reported

associated with immunosuppression due to drugs used in therapy (Shanahan and O'Mahony,

2005).

Another point relates to the fact that detection of bacterial DNA in the granuloma of

intestinal CD is not specific to MAP; other forms of bacterial DNA are also present, which could

reflect disturbed host-flora interactions in patients with CD and is consistent with other

observations of increased mucosal bacteria in CD (National Research Council, 2003).

A systematic review (Feller et al., 2007) presented 28 case-control studies comparing MAP

in patients with CD with individuals free of inflammatory bowel disease or patients with









ulcerative colitis. The authors concluded that the analysis assessed the evidence for an

association between MAP and CD. Some possible confounding and bias on some of the studies

considered in the review were; different source populations for controls and cases; higher

propensity of inflamed tissue to become infected with MAP, no MAP-specific test validated for

human beings is available. In this meta-analysis, the pooled odds ratio of MAP presence for

individuals suffering IBD from studies using PCR in tissue samples was 7.01 (95% CI 3.95-12.4)

and was 1.72 (1.02-2.90) in studies using ELISA in serum. The association of MAP with CD

appeared to be specific, but its role in the etiology of CD remains unclear.

Although there is indication of an association between MAP and CD, to date the evidence

appears to be insufficient to either establish or refute a causal connection between JD and CD.

The available scientific evidence has been reviewed by a number of expert groups in recent

years. The consensus opinion, at present, is that the available information is insufficient to prove

or disprove that MAP is a cause of CD, but the hypothesis is still plausible (National Research

Council, 2003; Vinh and Bersrtein, 2005). The discovery of a susceptibility gene in Crohn's

patients, CARD15/NOD2, does not preclude a role for MAP in the pathogenesis of at least some

cases of CD, as the function of this gene is bacterial sensing in the gut. If MAP does contribute

to the causation of CD then it may not be acting as a conventional infectious agent (Grant, 2005).

Genetics in Animal Production

Genetic Basis of Disease Resistance and Susceptibility

Host-pathogen relationships are shaped by co-evolutionary mechanisms between host

defense mechanisms and pathogen genetic diversity (Detilleux, 2001). The animal genome

influences susceptibility to disease, however because of the vast variety of pathogens and

complex host defense mechanisms involved, the understanding of this interplay is very complex

(Adams and Templeton, 1998).









Cattle show considerable variability in their response to a wide range of disease challenges,

and much of the variability is genetic (Morris, 2007). The improvement and utilization of host

genetic resistance to disease is an attractive option as a component of livestock disease control in

a wide range of situations. The main requisites for a successful intervention are: sufficient

genetic variation for disease resistance, economic and social benefits, and the option of using

other complementary methods of disease control (Gibson and Bishop, 2005).

A distinction is important in the defense against pathogenic organisms. Resistance refers to

the ability to limit infection and tolerance to the ability to limit the disease severity induced by a

given agent. Therefore, selecting the host for resistance would reduce disease transmission but

possibly impose selective pressure upon the pathogen (Rdberg et al., 2007).

Resistance to pathogens based on innate immunity includes the following elements:

impenetrable barriers, absence of appropriate receptors in cellular membranes, failure to survive

after entrance, inability to replicate in the host, and elimination by host defense mechanisms

phagocytess). On the other hand, the resistance by adaptive immunity involves

lymphocyte-mediated host responses, (cytotoxic T cells, helper T cells, and B cells), natural

killer cells and macrophage-mediated phagocytosis, humoral-mediated responses (including

antibodies and complement), and production and regulation by cytokines (Adams and

Templeton, 1998).

Justifications for including disease resistance in a breeding program include the constraints

on productivity from monetary losses, unfavorable genetic correlation between productivity and

disease, increased demand by consumers for animal products of high quality from healthy

animals, increased resistance to antimicrobial drugs, loss of biodiversity in naive populations,

and positive epidemiological response due to a decreased disease transmission when the









proportion of resistant animals increases in the population (Stear et al., 2001; Detilleux, 2001;

Detilleux, 2002).

As presented by Morris (2007), multiple cases of a genetic effect on disease susceptibility

have been previously reported in livestock including mastitis, nematode parasites, external

parasites, eye diseases such as keratoconjunctivitis and squamous cell carcinoma, respiratory

disorders, tuberculosis and brucellosis.

Under current animal production systems and consumer demand for healthy foods, genetic

selection for better resistance to infectious disease may become an alternative or an

accompanying measure to already existing prophylactic measures (Detilleux, 2001).

Genetic Component in Mycobacterial Infection

At the present, there is considerable evidence that host genome is important in determining

the outcome of infection (Veazeyet al., 1995; Mallard, 1999; Bellamy, 2003; Vergne et al., 2004;

Morris, 2007). Genetic factors have long been suspected of determining susceptibility and

resistance to mycobacterial infection. As a comparison with a close relative of MAP, a high

proportion of the world human population has been exposed to Mycobacterium tuberculosis, but

not all individuals in contact with the bacteria become infected, and only a fraction of infected

individuals develop clinical disease. Both infection and clinical tuberculosis result from

interactions between the infectious agent, environmental factors, and the host. Recent

population-based studies have reported associations between some candidate genes and clinical

tuberculosis, but the molecular basis of the genetic control of disease progression remains

unclear (Bellamy, 2003; Vergne et al., 2004).

Studies on animal models for mycobacterial infection have also found evidence that

genetic factors influence disease susceptibility. In the 1940s, it was established that inbred strains









of rabbits, designated resistant and susceptible, exhibited two patterns of disease following

infection with virulent M. bovis (Bellamy and Hill, 1998; Bellamy, 2003).

In a study by Mackintosh et al. (2000), testing the genetic resistance to experimental

infection with M. bovis in red deer (Cervus elaphus), strong evidence was found for a genetic

basis to resistance to tuberculosis heritabilityy of 0.48).

In successive studies, some candidate genes have been proposed for mycobacterial

resistance. Solute Carrier 11Al gene (SLC11A1, formerly NRAMP1) has been associated with

innate resistance to Salmonella typhimurium, Leishmania donovani or Mycobacterium bovis

BCG infection. Also a mutation was identified in the gene encoding interferon-gamma receptor

type 1 (IFNGR1) as the cause for a homozygous recessive genetic disorder causing increased

susceptibility to atypical mycobacterial infection (Blackwell, 2001).

The identification of families with increased susceptibility to mycobacterial infection, and

the association of gene mutations (IFN-g and interleukin-12 receptor) with individuals having

this condition indicate that these alterations would generate partial dysfunction of macrophage

pathways (Levin and Newport, 1999).

Genetics and Paratuberculosis

Bovine paratuberculosis has largely been suspected to have a genetic component.

Estimations indicate a range of moderate values for heritability to infection (Koets et al., 2000;

Elzo et al., 2006; Gonda et al., 2006a). Roussel et al. (2005), working with pure breed beef cattle

from 115 beef ranches in Texas, found an increased risk to be seropositive to MAP associated

with the Brahman breed or Bos indicus cattle. Cattle from Bos indicus-based herds were more

than 17 times as likely to be seropositive as were cattle Bos taurus-based herds, and cattle from

interspecies-based herds were 3.6 times as likely to be seropositive as were cattle from Bos

taurus-based herds.









In another study, Centinkaya et al. (1997) evaluating the relationship between the presence

of JD and farm management factors in dairy cattle in England reported that farms on which

Channel Island breeds (Jersey and Guernsey) were predominant were associated with an

increased risk of reporting disease; odd ratios ranged from 10.9 to 12.9 relative to Friesian or its

crosses and other breeds. It has been suggested that this susceptibility may be related to increased

exposure rather than to increased susceptibility or may be confounded by some factors that play

an important role in the development of clinical disease such as lower culling rate in Channel

Island breeds.

Koets et al. (2000), working with Dutch dairy cattle, report an estimated heritability of

susceptibility to MAP infection of 0.06 for a population composed of vaccinated and non

vaccinated animals. In the subpopulation of vaccinated animals the estimated heritability was

0.09. This provides evidence for the presence of genetic variation in the susceptibility of cattle to

paratuberculosis (diagnoses based on postmortem examinations at slaughter house). The

estimated heritabilities for susceptibility of cattle to MAP are comparable to many other diseases

traits.

In general, the genetic control of disease and resistance is polygenic, and several

quantitative trait loci (QTL) will be responsible for the genetic component of variation in

individual resistance to infectious disease. Candidate genes involved in QTL may be the bovine

major histocompatibility antigens and genes involved in innate resistance, such as natural

resistance associated with macrophage growth (SLC11A1 gene). The SLC11A1 gene has been

shown to be linked to resistance to mycobacterial infection, including murine models of

paratuberculosis (Koets et al., 2000).









Mortensen et al. (2004) estimated the genetic variation and the heritability of antibody

production against MAP in a population of 11,535 Danish Holstein cows in 99 herds. The model

based on antibody (IgG) levels in milk determined using an ELISA and measuring optical

density (OD) values, showed a significant heritability of 0.102 and a genetic variance of 0.054.

When a sire model was used, considering only the pedigree of sires of the cows rather than the

entire pedigree, the estimated heritability was 0.091. This suggests that the genes influence the

shift to the undesirable humoral immune response where the infection is out of control.

A study from Nielsen et al. (2002a) aimed at determining the proportion of transmission of

paratuberculosis in dairy cattle attributable to the dam with emphasis on vertical transmission,

including in utero transmission, direct contact of dam with the newborn, and through milk and

colostrum consumed. This study found for 1,056 pairs of dam-daughter Danish dairy cows, using

the level of antibodies to MAP in milk, an effect explained by the sire of 6.35% and an effect

from dam-daughter pairs of 7.7% (p < 0.05). These results suggest that the parental contribution

was significant and both heritability of susceptibility and vertical transmission should be

considered in any control program of paratuberculosis in cattle.

A longitudinal study (Aly and Thurmond, 2005) based on pairs of dam-daughter dairy

cows found that daughters born to MAP seropositive dams were 3.6 to 6.6 times more likely to

be seropositive than those born to seronegative dams. Excluding involvement of vertical and

horizontal transmission, a possible explanation for some of these results could be a genetic

predisposition to postnatal infection with MAP in which the higher risk of infection for daughters

of seropositive cows would be related to an inherited susceptibility to infection.

Gonda et al. (2007a) analyzed twelve paternal half-sib families with the aim of identifying

QTL affecting susceptibility to MAP infection in US Holsteins. Serum and fecal samples from









4,350 daughters of these 12 sires were obtained for disease testing. Case definition for an

infected cow was a positive ELISA, a positive fecal culture or both. Infected cows were matched

with two of their non-infected herd-mates in the same lactation to control for herd and age

effects. Eight chromosomal regions putatively linked with susceptibility to MAP infection were

identified, using a Z-test (p < 0.01).

Probability of infection based on both diagnostic tests was estimated for each individual

and used as the dependent variable for interval mapping. Based on this analysis, evidence for the

presence of a QTL segregating within families on Bos taurus (BTA) chromosome 20 was found.

Recently, familial aggregation of paratuberculosis was described in beef cattle by use of

pedigree information and microsatellite markers. In one study significant associations between

ancestors and offspring ELISA status were reported. The results in a second study reported

increased odds of having at least one positive paratuberculosis test result for two out of nine

clusters compared to the cluster with the lowest proportion of positive paratuberculosis test

results after conditioning on herd (Osterstock et al., 2007a, 2008).



Candidate Genes

The development of mycobacterial diseases is the result of a complex interaction between

the host and pathogen influenced by environmental factors. Numerous host genes are likely to be

involved in this process. However, only a small part of the total familial clustering observed in

tuberculosis can be explained by the host genes identified to date (Bellamy, 2003). Susceptibility

to infectious disease is influenced by multiple host genes, most of which are low penetrance

QTLs that are difficult to map (Lipoldova and Demant, 2007).

At present, some studies have explored the association between paratuberculosis

susceptibility and candidate host genes. Those few have not succeeded in finding conclusive









associations (Taylor et al., 2006; Hinger et al., 2007), likely due to limitations in sample size and

sensitivity of the diagnostic test used. However, nine chromosomal regions putatively associated

with MAP infection have been documented based on quantitative trait loci mapping (Gonda et

al., 2005, Gonda et al., 2006b). As for susceptibility to many infectious diseases that are

probably not controlled at the genetic level by a single gene, variation in susceptibility to bovine

paratuberculosis is likely controlled by a group of genes, or many genes (multifactorial

inheritance).

Coussens et al. (2001) reported the identification of a collection of over 40 genes whose

expression in bovine peripheral blood mononuclear cells (PBMC) from a Johne's afflicted

animal appears to be specifically repressed by MAP. Tentative gene identities have been

assigned to many of these transcription units, based on basic local alignment search tool

(BLAST) analysis against the Genbank database. The activity is focused on identifying these

genes and their protein products.

Candidate Genes in Study

Caspase Recruitment Domain 15 gene (CARD15, formerly NOD2)

Details on this gene are presented in Chapter 2 section "Crohn's Disease and

CARD15/NOD2 Gene".

Solute Carrier 11A1 (SLC11A1), Formerly Natural Resistance Associated Macrophage
Protein 1 (NRAMP1)

Solute Carrier family 11 (proton-coupled divalent metal ion transporters) member Al gene

(SLC11A1) codes for an integral membrane protein, which is expressed exclusively in

macrophage/monocytes and polymorphonuclear leukocytes. The protein is localized to the

endosomal/lysosomal compartment of the macrophage and is rapidly recruited to the membrane

of the particle-containing phagosome upon phagocytosis (Govoni and Gross, 1998).









This protein/divalent cation transporter regulates iron homeostasis in macrophages, and

plays a crucial role in macrophage activation altering the microenvironment of the phagosome to

affect microbial killing.

SLC11A1 gene was originally mapped and positionally cloned on the basis of its ability to

regulate resistance and susceptibility to a range of intramacrophage pathogens, including

Salmonella, Leishmania, and Mycobacterium bovis (Feng et al., 1996; Li et al., 2006; Stober et

al., 2007).

SLC]HAlgene is highly conserved in many mammalian species and it shows considerable

correspondence in structure between mice and humans. In human beings, the SLC11A1 gene is

located on chromosome region 2q35, and it encodes an integral membrane protein of 550 amino

acids. Several polymorphisms have been described in the human SLC11A1 gene facilitating

studies on the relevance of this gene to mycobacteria susceptibility in human populations

(Bellamy, 2003; Sechi et al., 2006).

The bovine homolog to this gene was mapped to BTA 2 (2q43-q44). It is expressed

primarily in macrophages in liver, spleen, and lung, and is presumed to encode a protein with 12

trans-membrane segments, with one hydrophilic amino-terminal region containing a

SH3-binding motif located at the cytoplasmic surface (Feng et al., 1996). Bovine SLC11A1

intron sizes show a considerable degree of conservation when compared to murine and human

SLC11A1 introns (Coussens et al., 2004).

Role in immunity

It has been proposed in numerous reports that SLC11A1 polymorphisms play a role in

susceptibility to infection by intracellular bacteria, including mycobacteria (Sechi et al., 2006). It

has been reported that in the mouse, resistance or susceptibility to infection with pathogens such

as Salmonella, Mycobacterium and Leishmania is controlled by this gene located on









chromosome 1, influencing the rate of intracellular replication of these organisms in

macrophages (Govoni and Gros, 1998; Gruenheid and Gros, 2000). A glycine and aspartic acid

substitution at position 169 of the mouse SLC 11Al protein is invariably associated with the

resistant and susceptible phenotypes, respectively (Ables et al., 2002). In the mouse, the

progression of the Mycobacterium avium infection has also been reported to be highly dependent

on the SLC]]Algene (Gomes and Appelberg, 1998). A recent study reported that different

inbred mouse strains infected with MAP exhibited differences in bacterial replication associated

to SLC11A1 polymorphisms. This was also associated to differences in time and magnitude in

IFN-g production (Roupie et al., 2008)

Case-control studies in human have confirmed the importance of this gene in susceptibility

to mycobacteria (Govoni and Gross, 1998). Genetic studies have found that allelic variants at the

human SLC11A1 gene are associated with susceptibility to leprosy (Mycobacterium leprae) and

tuberculosis (M tuberculosis) and possibly with the onset of rheumatoid arthritis (Govoni and

Gross, 1998; Skamene et al., 1998; Stokkers et al., 1999; Ables et al., 2002; Awomoyi et al.,

2002).

Some research indicates a role of the SLC11A1 product as an iron pump that depletes the

phagosomal compartments of this nutrient and leads to starvation of the pathogen of this

essential cation as a way to control mycobacterial proliferation (Gomes and Appelberg, 1998;

Govoni and Gross, 1998; Coussens et al., 2001).

SLC11 defines a novel family of functionally related membrane proteins including

SLC11A2, which was recently shown to be the major transferrin-independent uptake system of

the intestine in mammals. This observation supports the hypothesis that the phagocyte-specific









SLC11A1 protein may regulate the intraphagosomal replication of antigenically unrelated

bacteria by controlling divalent cation concentrations at that site (Govoni and Gross, 1998).

SLC11A1 expression has an effect on phagosomes during M. bovis (BCG) infection.

Phagosomes containing mycobacteria retain the ability to fuse with early endosomes but are

unable to fuse with lysosomes. The mycobacterial capacity to inhibit phagosome-lysosome

fusion is reduced if not abrogated in the presence of a functional host cell SLC11A1 (Gruenhei

and Gros, 2000).

Several approaches have been used to analyze how expression of SLC11A1 at the

phagosomal membrane may influence survival ofMycobacterium avium and affect its ability to

modulate the fusogenic properties of the phagosome in which it resides. SLC11A1 expression

appears to have a bacteriostatic effect and abrogation of SLC11A1 restores the bacteria's capacity

to replicate within macrophages. (Frehel et al., 2002).

Role in inflammatory bowel disease

Recently, Sechi et al. (2006) reported a strong association between Crohn's disease and

polymorphisms at the 823C/T and 1729 + 55de14 loci in the SLC11A1 gene in the Sardinian

population. Although previous studies have suggested that SLC11A1 mutations may favor

microbial survival, the study failed to find any association between SLC11A1 polymorphisms

and MAP infection. Kojima et al. (2001) investigated the association of IBD with three different

SLC11A1 alleles found in a Japanese population. The allele frequency of one allele was

significantly higher in patients with Crohn's disease (11.1%) and ulcerative colitis (11.2%) than

those in the healthy control group (4.5%). The results suggest that the novel promoter

polymorphism of the SLC11A1 gene may influence susceptibility to IBD in this population.

However, in another study no difference was found in allele frequencies of SLC11A1

promoter alleles between healthy donors and CD patients in a population of Ashkenazi Jews,









indicating that differences in SLC11A1 promoter polymorphism play no role in CD in that

population (Chermesh et al., 2007).

Association with disease susceptibility in cattle

Nucleotide sequence polymorphism due to a variation in the number of GT dinucleotide

repeats has been reported in the 3' untranslated region (nucleotide positions 1781-1804) of the

bovine SLC11A1 gene (Feng et al., 1996; Horin et al., 1999). The association of SLC1A1 gene

polymorphisms with disease in cattle has been mainly focused on this single microsatellite.

Coussens et al. (2004) report the nearly complete structure of the bovine SLC11A1 gene,

including sizes and positions of 13 introns relative to the bovine SLC11A1 gene coding sequence

and the DNA sequence of intron-exon junctions. Comparison of the bovine, murine and human

SLC11A1 gene structures revealed a high degree of conservation in intron placement (Coussens

et al., 2004).

Ables et al. (2002) aimed at detecting polymorphisms in the SLC11A1 gene from different

cattle and buffalo breeds. Five breeds of cattle and four breeds of buffalo were used in the study.

Sequencing showed two nucleotide substitutions and one amino acid substitution that was

observed at nucleotide position 1202 in exon V of the Japanese black Angus, Philippine and

Bangladesh swamp-type buffaloes which coded for threonine. On the other hand, the Korean

cattle, Holstein, African N'dama, and buffalo had isoleucine, at this position.

Research analyzing the role of SLC11A1 gene in resistance to disease in cattle has been

contradictory. In recent works, an association between bovine SLC11A1 gene polymorphism and

susceptibility to diseases such as brucellosis and mastitis in cattle has been reported (Adams and

Templeton, 1998; Joo et al., 2003; Ganguly et al., 2007). Mastitis-resistant cows were reported

producing more SLC11A1-mRNA than the susceptible cattle, and ratios of NRAMPl:p-actin

expression were higher in resistant cows (Joo et al., 2003). Ganguly et al. (2007) screened a









population of Murrah breed of buffalo (Bubalus bubalis) to identify polymorphism at 3'UTR of

SLC11A1 gene and evaluate their association with the macrophage function. Four allelic variants

(GT13, GT14, GT15 and GT16) were identified. Macrophages, after maturation, were

challenged with Brucella LPS to assay the macrophage function in terms of H202 and NO

production. The (GT)13 allele was significantly (p < 0.01) associated with increased production

of H202 and NO, indicating a significant association with the improved macrophage function in

buffalo. These results are in agreement with previous results from Qureshi et al. (1996) who

found that the macrophages from cattle resistant to in vivo challenge with Brucella abortus were

significantly superior (p < 0.05) in controlling intracellular growth ofB. abortus, M. bovis BCG

and Salmonella dublin than macrophages from susceptible animals.

In another study, Reddacliff et al. (2005) reported possible associations of particular

SLC11A1 protein and MHC alleles with susceptibility or resistance to JD in sheep. Adult sheep

were phenotypically classified as having severe, mild or no disease on the basis of clinical,

pathological and cultural tests for paratuberculosis, and as positive or negative in tests for

humoral or cell mediated immunity. Correlations with phenotype were found for particular

SLC11A1 and MHC alleles.

A case-control study in a naturally infected herd analyzed the association of 3 polymorphic

markers for the SLC11A1 gene with susceptibility to JD. Only one polymorphism at the 3'-UTR

microsatellite showed a different frequency between cases and control groups. These results

suggest that SLC11A1 is involved in lesion progression (Estonba, 2006).

On the other hand, there are some reports that are unable to determine an association

between the gene and particular diseases in cattle. One report did not find associations between

resistance and susceptibility to infection with M bovis and polymorphism in the SLC11A1 gene,









or between the magnitude of the lesions and various RFLP types ofM. bovis isolates. The study

concluded that the SLC11A1 gene does not determine resistance and susceptibility to infection

with M bovis in cattle (Barthel et al., 2000). In another study, Estrada-Chavez et al. (2001)

demonstrated, by Western blotting, a high-level expression of SLC11A 1 proteins in peripheral

blood cells and granulomas ofMycobacterium bovis-infected bovines. Immunohistochemistry of

granulomatous lesions showed heavily labeled epithelioid macrophages and Langhans cells,

suggesting that M bovis infection enhances NRAMP1 expression and that active tuberculosis can

occur despite this response.

In another work (Kumar et al., 2005), the presence of (GT)13 allele in SLC11A11 gene even

in a homozygous condition could not provide enough resistance to brucellosis in a naturally

infected herd. Kumar et al. (1999), testing the association between polymorphisms and variation

in susceptibility to tuberculosis in cattle, did not find differences in the frequency of the alleles

between the infected and random groups questioning the role of a specific SLC11A11 sequence

on tuberculosis resistance/susceptibility in bovines.

In another study, no association was found between the SLClJAl-resistant alleles and the

resistant phenotype in either experimental or naturally occurring brucellosis. Bacterial

intracellular survival was assessed in bovine monocyte-derived macrophages from cattle with

either the resistant or susceptible genotype, but no difference was observed in the rates of

intracellular survival of B. abortus (Paixdo et al., 2007).

Finally, Hinger et al. (2007) tested the association between a set of microsatellites in

different candidate genes and MAP antibody response in Holstein cows. The authors reported an

inability of the test to demonstrate an effect of polymorphisms in SLC11All, given that the study









population showed only 3 alleles, 2 of which displayed very low frequency and were therefore

not informative.

Interferon Gamma

Host defense against intracellular pathogens such as mycobacteria depends on effective

cell-mediated immunity (CMI), in which interactions between T cells and macrophages are

crucial (Frucht and Holland, 1996, Shtrichman and Samuel, 2001). A major effector mechanism

of CMI is the activation of infected macrophages by type 1 cytokines, particularly interferon

gamma (IFN-g). The IFN-g protein is produced by antigen-specific type 1 helper T cells (Thl

cells) and natural killer (NK) cells, and binds to IFN-g-receptor (R) R1/R2 complexes at the

macrophage surface. Interferon-g, in conjunction with tumor necrosis factor- alpha (TNF-a), has

been also demonstrated as an element activating anti-mycobacterial microbicidal mechanisms in

mouse macrophages (Ottenhoff et al., 2002), and cytotoxic T cells as well as B cell

differentiation (Schmidt et al., 2002). Concurrently, suppression of Th2 effector cell functions

induced by IFN-g stimulates cellular Thl responses and Thl-mediated autoimmunity. These

diverse effects place IFN-g in a key position in the regulation of the immune system (Schmidt et

al., 2002).

Interferon gamma alone, or in conjunction with lipopolysaccharide or TNF-a, can activate

murine macrophages to kill or inhibit mycobacteria by the induction of nitric oxide, however,

according to the study presented by Zhao et al. (1997), the amount of nitric oxide (NO) produced

by activated bovine monocytes in vitro may be insufficient to kill or inhibit intracellular MAP.

This suggested that production of nitric oxide by activated bovine mononuclear phagocytes

might not be a major anti-mycobacterial mechanism against MAP infection. On the other hand,

Cooper et al. (2002) proposed that the acquired cellular response plays a double role in

mycobacterial disease. On the one side, it is required to limit bacterial growth, yet on the other it









must itself be limited to reduce damaging inflammatory responses. This dichotomy could

contribute to the chronicity of mycobacterial infections. The authors suggest that for chronic

mycobacterial infection, IFN-g and NO exert a negative-feedback regulatory effect on the

cellular and inflammatory response.

This regulatory role is supported by the results of studies, such as those with IFN-g

knockout mice, where invasion by different pathogens caused dramatic increases in mortality

(Schmidt et al., 2002). Reports of familial clusters of disseminated Mycobacterium avium

complex infections in humans have suggested that the activation pathways leading to the

generation of IFN-g are critical to effective protection against this intracellular pathogen; in these

instances susceptible patients had a defect in IFN-g production (Frucht and Holland, 1996).

In humans INF-g genetic deficiency is associated to mutations in IFN-g receptor. This is a

heterogeneous syndrome with different clinical, genetic, immunological and histopathological

types. Complete deficiency in IFN-g receptor is associated with severe or fatal outcomes after

infection with non-tuberculous mycobacteria or M bovis BCG, and is accompanied by poor

granuloma formation, multibacillary lesions and progressive infection, often despite intensive

antibiotic treatment. In contrast, individuals with partial deficiency in IFN-g receptor often

develop milder, though still severe, infections (Huang et al., 1998, Ottenhoff et al., 2002).

However, a 40-year-old woman with disseminating M. avium infection has been reported with an

acquired deficiency in IFN-g resulting from the presence of serum auto-antibodies that

specifically neutralized IFN-g (Ottenhoff et al., 2002).

Denis et al. (2005) analyzed the impact of INF-g on Mycobacterium bovis replication,

cytokine release and macrophage apoptosis. The authors concluded that virulent M bovis is a

major determinant of release of pro-inflammatory cytokines by macrophages, and IFN-g









amplifies the macrophage cytokine release in response to M. bovis. Induction of apoptosis is

closely linked to the emergence of macrophage resistance to M. bovis replication, which is

dependent on endogenous TNF-a release.

Moreover, an association study on susceptibility to nematode parasites in sheep suggested

that a polymorphic gene conferring increased resistance to gastrointestinal nematode parasites is

located at or near the interferon gamma gene, supporting previous reports which have mapped a

quantitative trait locus (QTL) for resistance to this region in domestic sheep (Coltman et al.,

2001).

IFN-g gene maps to a single locus located on the long arm of chromosome 12 in the

human, chromosome 10 in the mouse, and chromosome 5 in cattle. Transcripts of the IFN-g gene

possess four exons and three introns. Mature IFN-g mRNA is -1.2 kb and encodes a protein of

-17 kDa. IFN-g functions as an N-glycosylated homodimer (Shtrichman and Samuel, 2001).

The organization of the IFN-g gene into four exons is evolutionarily highly conserved, as

has been proven for humans, for experimental model animals, and for domestic animals, such as

the sheep, horse, pig, and chicken. The most prominent sequence variations within the IFN-g

genes described to date are polymorphic intronic microsatellites, as demonstrated for humans,

cattle, sheep, and pigs (Shtrichman and Samuel, 2001). Schmidt et al. (2002) analyzed

polymorphisms in the bovine IFN-g gene reporting four distinct series of single nucleotide

polymorphisms found in functionally important regions of BolFNG. The region between the two

intron 1 microsatellites contained the highest density of SNPs in Bos taurus breeds.

Toll-Like Receptors

Innate immune responses to pathogens are mainly coordinated by

monocytes/macrophages, granulocytes, and dendritic cells, which act as a first line of defense

against invading microorganisms. Discrimination of non-self from self is achieved by numerous









host proteins equipped with the ability to recognize structures or molecular patterns, present on

foreign organisms. One major group of proteins is the Toll-like receptor family (TLR), also

referred to as pattern recognition receptors (PRRs) (Underhill et al., 1999; Schroder and

Schumann, 2005). These recognition receptors of the innate immune system have been

conserved in both the invertebrate and vertebrate lineages, and recognize a variety of endogenous

and exogenous ligands; many of the latter are conserved molecules essential for pathogen

survival (Roach et al., 2005).

Ligation of TLRs by pathogen-specific receptors initiates a signal transduction pathway in

the host cell that culminates in the activation of NF-kB and the induction of cytokines and

chemokines that are crucial to eliciting the adaptive immune response against the pathogen

(Wang et al., 2002; Werling et al., 2006). Consequently, activation of TLR is an important link

between innate cellular response and the subsequent activation of adaptive immune defense

against microbial pathogens (Bhatt and Salgame, 2007).

The involvement of the Toll receptors in innate immunity was first described in

Drosophila. Drosophila Toll was originally identified as a type I trans-membrane receptor

required for the establishment of dorso-ventral polarity in the developing embryo and in the

induction of an antifungal response in adult flies (Wang et al., 2002; Takeda et al., 2003;

Schroder and Schumann, 2005). Soon after the discovery of the role of the Drosophila Toll in the

host defense against fungal infection, a mammalian homologue of the Drosophila Toll was

identified. Subsequently, a family of proteins structurally related to Drosophila Toll was

identified, collectively referred to as the Toll-like receptors. The TLR family is known to consist

of 13 members characterized structurally by the presence of a leucine rich repeat (LRR) domain









in their extracellular domain and a Toll/Interleukin 1 receptor homology (TIR) domain in their

intracellular region (Wang et al., 2002; Takeda et al., 2003; Quesniaux et al., 2004).

Role of TLRs

Ectopic over-expression of TLR4, the first mammalian TLR identified, was shown to

cause induction of the genes for several inflammatory cytokines and co-stimulatory molecules.

Therefore, it was anticipated that the TLRs might be involved in immune responses, especially in

the activation of innate immunity (Takeda et al., 2003). The TLRs are capable of recognizing

several classes of pathogens and coordinating appropriate immune responses, involving both

innate and adaptive immunity (Takeda et al., 2003).

Lipoproteins in which the N-terminal cysteine is triacylated are recognized by TLR2 in

combination with TLR1. Diacylated lipoproteins are recognized by TLR2 in combination with

TLR6. Double-stranded RNA is recognized by TLR3. Lipopolysaccharide is recognized by

TLR4. Flagellin is recognized by TLR5. Cyclic compounds such as nucleic acids and heme are

recognized by the family consisting of TLR7-9 (Wang et al., 2000).

TLR2 has been implicated in the activation of NF-kB following interaction of

macrophages with lipoproteins from pathogens such as Gram-negative bacteria, Mycoplasma and

spirochetes, peptidoglycan and lipoteichoic acid from Gram-positive bacteria,

lipoarabinomannan from mycobacteria, glycoinositolphospholipids from Trypanosoma cruzi, a

phenol-soluble modulin from Staphylococcus epidermidis, zymosan from fungi, glycolipids from

Treponema maltophilum, and porins that constitute the outer membrane of Neisseria.

Furthermore, TLR2 recognizes several atypical types of lipopolysaccharides (LPS) from

Leptospira interrogans and Porphyromonas gingivalis, in contrast to TLR4, which recognizes

LPS from enterobacteria such as Escherichia coli and Salmonella spp. TLR2 and TLR4 may









differentially recognize these structural variations in LPS (Wang et al., 2002; Takeda et al., 2003,

Arko-Mensah et al., 2007).

In addition to controlling the development of adaptive immunity, activation of TLRs

appears to be directly involved in induction of antimicrobial activity, and TLR2 activation leads

to nitric oxide-dependent and -independent killing of intracellular Mycobacterium tuberculosis

in mouse and human macrophages, respectively (Takeda et al., 2003).

A study from Swiderek et al. (2006) that analyzed the association between TLR

polymorphisms and natural bacterial infections in the mammary gland in sheep reported 6

different alleles for TLR2 and a protective association for one allele in relation to bacterial

infection. Numerous studies in vitro and in vivo have shown that whole mycobacteria or

mycobacterial components act as agonists for TLRs. Recent studies show that certain TLR

knockout mice are more susceptible than wild-type mice at an early stage of respiratory tract

infection; in particular, TLR2-/- mice are more susceptible than wild type mice. In addition,

defective capability of intracellular killing was correlated with impaired production of TNF-a,

which is vital for containment of mycobacterial infections (Jo et al., 2007).

Underhill et al. (1999) showed that TLR are required for the induction of TNF-a in

macrophages by Mycobacterium tuberculosis. Expression of a dominant negative form of

myeloid differentiation primary-response protein 88 (MyD88) in a mouse macrophage cell line

blocks TNF-a production induced by M. tuberculosis. TLR2 was identified as the specific TLR

required for this induction.

According to Quesniaux et al. (2004), the present in vivo evidence suggests that TLR

signaling has only a modest effect on acute mycobacterial infection and the generation of

adaptive immunity, but may be more relevant for the long-term control of infection.









In a recent work, Sweet and Schorey (2006) found that glycopeptidolipids, which are

highly expressed surface molecules on M. avium, can stimulate the nuclear factor-kB pathway

and production of pro-inflammatory cytokines when added to murine bone marrow-derived

macrophages. This stimulation was dependent on TLR2 and MyD88, indicating that

glycopeptidolipids can function as TLR2 agonists and promote macrophage activation in a

MyD88-dependent pathway.

Toll-like receptor 4 gene

In 1998, TLR4 was shown to be involved in the recognition of LPS, a major cell wall

component of Gram-negative bacteria. Subsequently, other members of the TLRs family were

shown to be essential for the recognition of a range of microbial components. The structural

similarity of TLRs seems to reflect their common function in the recognition of microbial

components (Takeda et al., 2003).

The Toll-like receptor 4 gene codifies for a type I transmembrane protein with an

extracellular domain consisting of a leucine-rich repeat region (LRR) and an intracellular domain

homologous to that of the human interleukin-1 receptor. It mainly recognizes conserved

pathogenic motifs of Gram-negative bacteria, activating the nuclear factor NF-kB (Browning et

al., 2007). Other ligands for TLR4 are structures such as respiratory syncytial virus, human heat

shock protein 60 (hsp60), and fibrinogen. Expression of TLRs is modulated by a variety of

factors such as microbial invasion, microbial components, and cytokines. Infection by

Mycobacterium avium induces variation in TLR4 mRNA expression in macrophages and leads to

chromatin remodeling (Takeda et al. 2003).

In recent years TLR2, TLR4 and latterly, TLR1/TLR6 that heterodimerise with TLR2,

have been implicated in the recognition of mycobacterial antigens (Quesniaux et al., 2004;

Yadav et al., 2006, Weiss et al., 2008). In a work by Ferwerda et al. (2005), it was reported that









CARD 15 and TLRs are two non-redundant recognition mechanisms ofM. tuberculosis. Chinese

hamster ovary fibroblast cell lines transfected with human TLR2 or TLR4 were responsive to M

tuberculosis. TLR4-defective mice released 30% less cytokines after stimulation with

mycobacteria, compared to controls. These results indicated that CARD15 and TLR pathways are

non-redundant recognition mechanisms of M tuberculosis that synergize for the induction of

pro-inflammatory cytokines.

In a second study, Ferwerda et al. (2007) showed that TLR2, TLR4, and CARD15 are

pattern recognition receptors for M paratuberculosis, mediating cytokine production and

stimulation of host defense. In the study, it was demonstrated that murine and human TLR2

recognize sonicated MAP. However, the role of TLR4 becomes apparent if human mononuclear

cells are infected with live M paratuberculosis, as under these conditions, cytokine responses

were reduced by inhibition of TLR4. In addition, in this study it was demonstrated that TLRs,

such as TLR2 and TLR4, as well as CARD15 are independent recognition systems of M

paratuberculosis.

In a recent work by Mendez-Samperio et al. (2008) it was proposed that CXCL8

chemokine, which has an important role in mediating the inflammatory conditions following

invasion of M tuberculosis, is activated through the ERK1/2 MAPK pathway induced by TLR2

and TLR4. In another study, Fremond et al. (2003) infected with BCG TLR4 mutant C3H/HeJ

and control C3H/HeOUJ. TLR4 mutant mice experienced an arrest of body weight gain and

showed signs of increased inflammation, with persistent splenomegaly, increase in granuloma

number and augmented neutrophil infiltration. TLR4 mutant mice show normal macrophage

recruitment and activation, granuloma formation and control of the BCG infection, but this is

associated with persistent inflammation. The authors suggested that TLR4 signaling is not









essential for early control of BCG infection, but it may have a critical function in fine tuning of

inflammation during chronic mycobacterial infection.

Branger et al. (2004) intranasally infected TLR4 mutant (C3H/HeJ) and wild-type

(C3H/HeN) mice with live Mycobacterium tuberculosis. TLR4 mutant mice were more

susceptible to pulmonary tuberculosis, as indicated by a reduced survival and an enhanced

mycobacterial outgrowth, suggesting that TLR4 may be involved in the generation of acquired T

cell-mediated immunity. These results would indicate that TLR4 plays a protective role in host

defense against lung infection by M. tuberculosis.

A study by Abel et al. (2002) reported that TLR4 mutant mice had a reduced capacity to

eliminate mycobacteria from the lungs, spread the infection to spleen and liver, at higher levels

than the wild-type mice and succumbed within 5-7 months, whereas most of the wild-type mice

controlled infection. The lungs of TLR4 mutant mice showed chronic pneumonia with increased

neutrophil infiltration, reduced macrophages recruitment, and abundant acid-fast bacilli. The

purified mycobacterial glycolipid, phosphatidylinositol mannosides, induced signaling in both a

TLR2- and TLR4-dependent manner. Macrophage recruitment and the proinflammatory

response to M tuberculosis would be weakening in TLR4 mutant mice, resulting in chronic

infection with impaired elimination of mycobacteria. This indicates that TLR4 signaling is

required to mount a protective response during chronic M tuberculosis infection.

In a study by Reiling et al. (2002), mice defective in CD14, TLR2, or TLR4 were infected

with M tuberculosis by aerosol. Following infection with mycobacteria, either mutant strain was

as resistant as congenic control mice. Granuloma formation, macrophage activation, and

secretion of pro-inflammatory cytokines in response to low-dose aerosol infection were identical

in mutant and control mice. However, high-dose aerosol challenge with 2000 CFUM









tuberculosis revealed TLR2-, but not TLR4-defective mice to be more susceptible than control

mice. In conclusion, while TLR2 signaling contributes to innate resistance against M.

tuberculosis in borderline situations, its function, and that of CD14 and TLR4, in initiating

protective responses against naturally low-dose airborne infection is redundant (Reiling et al.

2002).

However, there is also conflicting information about the role of TLR4 in susceptibility of

mice to M. tuberculosis infection, as presented by Shim et al. (2003). Their results indicated that

infection of TRL4-competent and TLR4-deficient mice on the C3 H inbred mouse strain

background had similar outcomes, measured in terms of the course of the disease, cell

accumulation patterns in the lungs, and lung histopathology.

Toll-like receptor 4 maps to human chromosome 9q32-33, while it has been mapped to the

distal end of bovine chromosome 8 (McGuire et al., 2006). White et al. (2003b) analyzed the

structure of TLR4 in bovine, and comparative analyses show gene order conservation between

the bovine chromosome 8 region and human chromosome 9. The coding sequence of bovine

TLR4 is divided into three exons, with intron-exon boundaries and intron sizes similar to those of

human TLR4 transcript variant 1. White et al. (2003a) amplified each exon in 40 individuals

from 11 breeds and screened the sequence for single nucleotide polymorphisms (SNPs). Thirty

two SNPs were identified, 28 of which are in the coding sequence, for an average of one SNP per

90 bp of coding sequence. Eight SNPs were non-synonymous and potentially alter specificity of

pathogen recognition or efficiency of signaling.

The association between TLR4 and disease in bovine has been scarcely studied. Sharma et

al. (2006) analyzed the association between polymorphisms in the TLR4 gene and somatic cell

score and lactation persistency in the Canadian Holstein bull population. A total of 3 single









nucleotide polymorphisms (SNP) of TLR4 were detected, and one was found to be associated

with higher lactation persistency and lower somatic cell scores.

Goldammer et al. (2004) demonstrated that mastitis strongly increased (4- to 13-fold) the

mRNA abundances of all of TLR2 and TLR4 genes. The number of TLR2 copies correlated well

with those of TLR4, indicating coordinated regulation of these two PRRs during infection of the

udder.

In another study, Yang et al. (2008) demonstrated that bovine TLR2 and TLR4 receptors

recognize this S. aureus strain resulting in enhanced activation of NF-kB factors in these cells,

similar in strength to that in response to E. coli and LPS.

Case Control Genetic Association Studies

Genetic Epidemiology

Genetic epidemiology investigates the role of genetic determinants in the causation of

complex diseases. This is a discipline related to traditional epidemiology that focuses on the

familial, and in particular genetic, determinants of disease and the joint effects of genes and

non-genetic determinants (Burton et al., 2005).

Until the last decade, association between genetics and disease had been mainly restricted

to the study of relatively rare familial diseases controlled by a single major gene. However,

studies of animal models and epidemiological studies in humans have shown that many

apparently non-hereditary diseases, including infectious diseases, develop predominantly in

genetically predisposed individuals, and that this predisposition is caused by multiple genes

(Lipoldova and Demant, 2006).

The principal distinction between simple monogenic diseases and complex genetic diseases

is that the latter do not exhibit classical Mendelian patterns of inheritance and are likely

influenced by multiple genetic and environmental factors (Silverman and Palmer, 2000).









Complex diseases are most likely influenced by genetic heterogeneity (multiple genetic causes

leading to the same disease), environmental phenocopies (purely environmental forms of the

disease), incomplete penetrance (subjects inheriting a disease gene but not developing the

disease), genotype-by-environment interactions (non-additivity of genetic and environmental

influences on disease development), and multi-locus effects (more than one gene influences

disease development) (Silverman and Palmer, 2000).

Identification of low-penetrance genes may be useful in the identification of individuals at

high risk of disease, it would increase the understanding of the molecular mechanisms that

underlie disease, and it would help to identify therapeutic targets. In the case of infectious

disease, the mapping of low-penetrance disease-susceptibility genes is difficult, not only by the

heterogeneity of populations, but also by differences in environment and lifetime exposure to

infections, which obscure the already relatively weak individual effects of these genes

(Lipoldova and Demant, 2006).

Genetic variants-or polymorphisms-arise from new mutations. The simplest type of

polymorphism is a single base mutation, which substitutes one nucleotide for another, referred to

as a single nucleotide polymorphism (SNP). Insertions of additional sequences or deletions can

also occur and these range in size from one to several thousand base pairs (Daly and Day, 2001).

SNPs do not necessarily have any relevance to disease or outcome; they can be anonymous

variants within or between genes, or could be functional, causal mutations. In general,

functionally significant effects associated with genetic polymorphisms are most likely when they

are associated with an amino acid substitution in the gene product, when a deletion or insertion

results in a frame shift in the coding region, when a gene is completely deleted or when the

polymorphism directly affects gene transcription, RNA splicing, mRNA stability or mRNA









translation. More SNPs are thought to exist in the human genome than any other type of

polymorphism (Daly and Day, 2001; Cardon and Palmer, 2003).

The arrangement of genetic polymorphisms within a single chromosome in an individual

is known as a haplotype. Frequently certain haplotypes are more common as a result of linkage

than would be expected if each polymorphism was inherited randomly. Two genetic loci are

linked if they are transmitted together from parent to offspring more often than expected under

independent inheritance. They are in linkage disequilibrium if, across the population as a whole,

they are found together on the same haplotype more often than expected (Daly and Day, 2001;

Teare and Barrett, 2005).

Population Candidate Gene Association Studies

The alternative to family studies and to population approaches that rely on linkage

disequilibrium is to perform population candidate gene association studies. Genetic association

studies aim at detecting association between one or more genetic polymorphisms and a trait,

which might be some quantitative characteristic or a discrete attribute or disease (Cordell and

Calayton, 2005). In other terms, their aim is to determine if there is a statistical relation between

genomic variation at one or more sites and phenotypic variation, usually represented by the

presence or absence of a disease or by levels of a disease related trait (Hattersley and McCarthy,

2005).

Some advantages to this approach include the fact that such studies may provide adequate

power to detect relative risks as low as 1.5 which is usually not possible in familial studies. In

addition, as most candidate gene studies are focusing directly on a single gene and frequently

look directly at functionally significant polymorphisms, concerns about the extent of linkage

disequilibrium and the adequacy of SNP markers to detect associations are not primordial. It has









also been discovered that the issue of population stratification and spurious association can be

manageable through design and data analysis (Li, 2008).

In population candidate gene association studies, DNA samples from cases and population

controls are genotyped for polymorphisms situated in or close to a gene which prior knowledge

suggests might play a role in the pathogenesis of the disease of interest, based on a comparison

of unrelated affected and unaffected individuals from a population (Lander and Schork, 1994;

Blackwell, 2001; Daly and Day, 2001; Li, 2008).

Two types of association are explored in these studies. The first of these forms of

association is termed direct association, and target polymorphisms, which are themselves

putative causal variants. This type of study is the easiest to analyze and the most powerful, but

the difficulty is the identification of candidate polymorphisms. In the second type of association,

the polymorphism is a surrogate for the causal locus and this type of association allows searching

for causal genes in indirect association studies. However, indirect associations are even weaker

than the direct associations they reflect, and it will usually be necessary to type several

surrounding markers to have a high chance of picking up the indirect association (Cordell and

Clayton, 2005).

If a mutation increases disease susceptibility, then it can be expected to be more frequent

among affected individuals (cases) than among unaffected individuals (controls) (Pritchard and

Donnelly, 2001).

There are a number of important issues to consider in the design of case-control studies of

this type. These include: choice of candidate gene and polymorphism for study, sample size

requirements, genotyping quality, recruitment methods, matching of cases and controls, number









of subjects to be studied, and data analysis and interpretation (Daly and Day, 2001; Hattersley

and McCarthy, 2005).

Even if case-control association studies have some weaknesses with regard to potential

confounding factors such as population stratification, they remain an important tool in genetic

epidemiology and are often preferred to family-based studies (Burton et al., 2005; Guedj et al.,

2007).

Tests of association are used as a first step in the analysis process. Various tests are

proposed based on either genotypes, such as the genotypic, Hardy-Weinberg equilibrium or

Cochran-Armitage tests, or alleles, such as the allelic test (Zheng and Tian, 2005). The basic aim

of the association-study design is to correlate genotypes and disease phenotypes that are obtained

from a sample of individuals (Zondervan and Cardon, 2004). In a case-control study, the

objective is to compare exposure to risk factors (environmental or genetic) between affected

individuals and unaffected controls, which have been selected from the same population as cases,

to find associations between risk factors and disease. In these association studies the

susceptibility or causal alleles are themselves evaluated (Zondervan and Cardon, 2004). The

standard measure of effect in the case-control study is the odds ratio (OR), defined as the odds of

exposure among cases divided by the odds of exposure among controls (Clayton and

McKeingue, 2001; Zondervan and Cardon, 2004).

A key issue in case-control association studies is how the case subject met the criteria for

the affectation phenotype, but in practice, diagnostic error may be present when an imperfect

gold standard or reference test is used instead of a definitive diagnosis. Also, control subjects

must clearly represent the opposite end of the phenotypic expression of disease (Weiss et al.,

2001).









Positive results in a case-control association study may be due to a direct effect of the

polymorphism in question, linkage disequilibrium, or population stratification (artifact of

population admixture), a spurious association due to differences in allele frequency between

poorly matched cases and controls, resulting from differences in ethnic origins (Lander and

Schork, 1994; Weiss et al., 2001). Confounding, in al aspects of epidemiology, raises the

possibility both of generating false findings (positive confounding) or obscuring true causal

associations (negative confounding) (Cordell and Clayton, 2005).

Procedures that account for population stratification consist in matching cases and controls

for ethnicity or use of multiple unlinked markers. Another way of tackling this problem is to

collect data about ethnicity from the members of the sampled group and then stratify the analysis

according to reported ethnicity (Pritchard and Donnelly, 2001).

An additional criterion for evaluation of the quality of the case-control study is assessment

of Hardy-Weinberg equilibrium in the markers studied within the control group. This provides a

check to ensure that genotyping errors, mutation, or population stratification do not explain the

observed results (Weiss et al., 2001).









































D e D


Figure 2-1. Clinical cases. A & B) Two adult females affected by paratuberculosis showing a
deteriorated body condition (courtesy of Dr. Owen Rae),C) monocyte containing
MAP bacilli (courtesy of Dr. Claus Buergelt), D) section of an affected ileum
exhibiting a thickened and corrugated mucosa (courtesy of Dr. Owen Rae).



5


4


" 3


2
0
O


4K
U.


0
0 1--------------------
1 2 3 4 5 6 7 8 9 10

Frequency ID3525
--- -- ID5455

Figure 2-2. Variation in ELISA optical density in two Holstein cows (Data provided by Dr. C.D.
Buergelt).









CHAPTER 3
ASSOCIATION AMONG RESULTS OF SERUM ELISA, FECAL CULTURE, AND NESTED
PCR ON MILK, BLOOD, AND FECES FOR THE DETECTION OF PARATUBERCULOSIS
IN DAIRY COWS

Summary

Paratuberculosis is a chronic, infectious disease of ruminants that entails a serious concern

for the cattle industry. One of the main issues relates to the inefficiency of diagnosis of

subclinically infected animals. The objective of this field study was to analyze the association

among results of a serum ELISA, fecal culture, and nested PCR tests on milk, blood, and feces

for Mycobacterium avium subsp. paratuberculosis detection in dairy cows. Feces, blood and

milk samples were collected from 328 lactating dairy cows in four known infected herds. Results

were analyzed to determine associations and levels of agreement between pairs of tests. A total

of 61 animals (18.6%) tested positive when all the tests were interpreted in parallel. The

agreement between results in different pairs of tests was poor, slight and fair in two, five and

three of the ten possible combinations, respectively. Fecal culture and fecal PCR resulted in the

highest kappa coefficient (0.39; fair agreement), with the lowest agreement being for ELISA and

blood PCR (-0.036; poor agreement). Fisher's Exact Test resulted in statistically significant

associations (P< 0.05) between the following test pairs; ELISA:fecal culture; ELISA:fecal PCR;

milk PCR:fecal PCR, blood PCR:fecal PCR and fecal culture:fecal PCR. ELISA showed the

highest complementary sensitivity (CS) values for all the possible two-test combinations,

followed by fecal PCR. The combined use of ELISA and fecal PCR displayed the highest

potential to increase the overall sensitivity for the diagnosis of paratuberculosis infection.

Reprinted with permission from Pinedo, P.J., Rae, D.O., Williams, J.E., Donovan, A., Melendez, P., Buergelt, C.D.,
2008. Association among results of serum ELISA, fecal culture, and nested PCR on milk, blood, and feces for the
detection of paratuberculosis in dairy cows. Transboundary and Emerging Diseases. 55, 125-133.









Introduction

Paratuberculosis is a chronic, infectious disease of ruminants caused by Mycobacterium

avium subsp. paratuberculosis, and characterized by progressive weight loss and profuse

diarrhea (Chiodini et al., 1984). The disease has a worldwide distribution and is categorized by

the Office International Des Epizooties as a list B disease, which is a serious economic or public

health concern (OIE, 2004).

Most cattle with JD are infected as calves by fecal-oral transmission, and in utero

transmission has also been reported (Seitz et al., 1989; Whitlock and Buergelt, 1996). However,

young animals manifest no clinical signs and the incubation period is variable, ranging from 2 to

10 years (Bassey and Collins, 1997; Whitlock et al., 2000; Stabel and Ackerman, 2002).

The diagnosis of paratuberculosis is hampered by a lack of accurate tests. Available

methods fail to identify all infected animals (false negative results), and some produce

substantial numbers of false positives (Chiodini et al., 1984). Tests for detection of antibodies to

MAP, such as enzyme-linked immunosorbent assays (ELISA) present the major disadvantage of

moderate to low sensitivity. The usefulness of serological tests is compromised by the variability

of the immune response depending on the stage of disease. For this reason, it is generally

accepted that their sensitivity in detecting infected animals is only about 30% (Collins et al.,

2006), and the ELISA test rarely gives a positive result in animals under 2 years of age. It

frequently fails to detect individuals in the early phases of infection (Juste et al., 2005). Low

agreement between results from different commercially available ELISA kits is another

drawback of this test (McKenna et al., 2006). Despite these disadvantages, ELISA testing of sera

is still the method of choice for epidemiological studies and herd-based diagnosis (Bottcher and

Gangl, 2004).









Tests based on the detection of the agent likewise present the problem of low sensitivity.

The shedding of MAP organisms in feces can be intermittent and detection by culture is

imperfect, especially because of contamination, and when few organisms are shed in feces. It has

been estimated that fecal culture detects only about 50% of cattle infected with MAP (Stabel,

1997). The advent of diagnostic methods based on specific bacterial DNA sequences has allowed

fastidious microorganisms, such as MAP, to be rapidly identified. Polymerase chain reaction

(PCR) tests based on the insertion element IS900 have been the most widely used for MAP

identification (Harris and Barleta, 2001). However, the detection of the etiologic agent is limited

by the presence of inhibitory substances, and the frequency and number of organisms that are

present in the body fluid or tissue being tested. The isolation of MAP from sites other than the

intestinal tract, such as udder, kidney, liver, male reproductive tract and blood, have suggested

active dissemination of the bacteria and opens the possibility for detection of the agent by PCR

in fluids such as milk and blood of suspicious animals (Buergelt and Williams, 2004).

A combination of independent tests is a common method to improve reliability of

laboratory diagnostic tools. As a result of the setbacks of MAP diagnosis, such strategies have

already been implemented by using a combination of bacterial fecal culture and PCR or

serological screening and bacterial fecal culture (Collins et al., 2006). Moreover, a combination

of tests with different sensitivities and specificities allows a classification of animals and herds

relative to the probability of MAP infection (Bottcher and Gangl, 2004).

A broader knowledge of the behavior and association between different diagnostic tests is

desirable for the implementation of strategies based on the combination of different tests, which

could be a useful approach to improve the sensitivity of MAP detection. The hypothesis of this

study was that different degrees of association exist among tests detecting MAP infection. Our









objective was to analyze the association among results of a serum ELISA, fecal culture, and

nested PCR on milk, blood, and feces for MAP detection in dairy cows.

Materials and Methods

Study Population

Blood, milk and fecal samples were collected from 328 lactating dairy cows in four herds

near Gainesville, Florida, USA. Dairies A, B and C were composed by 70, 500 and 600 Holstein

cows, respectively, while dairy D was a 100 cow Jersey herd. The four herds had a past history

of clinical and ELISA positive paratuberculosis cases, with some individuals confirmed by

necropsy in herds B and C (submitted to the College of Veterinary Medicine, University of

Florida). Fifty six (56), 122, 100 and 50 cows were sampled from herds A, B, C, and D,

respectively. No formal randomization in the selection of animals was attempted, and the

inclusion criteria for the animals was that they be lactating, without any clinical sign of

paratuberculosis at the time of collection (diarrhea and/or weight loss). Each animal was sampled

only once during the study to avoid the effect of correlation among repeated measures within the

same individual in the statistical analysis. A maximum of 10 animals was sampled in each farm

visit and all samples were collected between December 2004 and December 2006.

Sample Handling

Milk samples

Before collection, the teats were cleansed with alcohol to avoid sample contamination from

skin. Milk (30-40 ml) was collected in a sterile 50 ml centrifuge tube from the four quarters by

hand milking. The first 10-15 ml of milk were discarded. The milk samples were centrifuged at

1,000 g for 15 min and the supernatant discarded. The resultant pellet was washed thrice in

phosphate buffered saline (PBS, pH 7.3) and centrifuged at 500 g for 15 min. The pellet was

resuspended in 1 ml of PBS, centrifuged and resuspended in 100 [tl of 0.2 N NaOH.









Extraction of DNA on milk

Extraction was performed by heating the resuspended pellet at 110C for 20 min, followed

by centrifugation at 500 g for 3 min. The final product was stored at -200C for subsequent PCR.

Blood samples

After cleansing with alcohol, 10 ml of blood per cow were collected from the coccygeal

vein into Vacutainer tubes (Becton Dickinson, Franklin Lakes, NJ, USA) with and without

EDTA. For the blood PCR procedure, 3 ml of EDTA blood was added to 4 ml of Ficoll-

Isopaque Plus Gradient (Amersham Pharmacia, Piscataway, NJ, USA, density 1.078 g/ml) and

centrifuged for 40 min at 500 g at 180C. The buffy coat was collected, then washed twice with

PBS, and centrifuged at 500 g for 15 min. Cells from the pellet were counted with a

hemocytometer, resuspended in 100 [tl of 0.2 N NaOH.

Extraction of DNA on blood

Extraction was performed by heating the resuspended pellet at 110C for 20 min, followed

by centrifugation at 500 g for 3 min. Neutralization was not attempted. The final product was

stored at -200C for subsequent PCR.

Enzyme-Linked Immunosorbent Assay

Serotesting of samples was done by use of the ELISA developed by Allied laboratories

Inc. (Ames, Iowa, USA) with crude, soluble M. paratuberculosis strain 18 protoplasmic antigen

(Allied Monitor Missouri, MO, USA), based on the protocol of Braun et al. (1990). Antigen was

diluted to a concentration of 0.1 mg/ml in 0.05M sodium carbonate buffer at pH 9.6. This

dilution (100 [tl per well) was incubated over night at 40C. A suspension ofMycobacterium phlei

was prepared by adding 5 g of dry, heat-killed M phlei to 1 L of phosphate buffered saline

solution containing 1% gelatin and 0.05% Tween 80 (PBS-TG). Three ml of this base suspension

were added to 97 ml of 0.85% NaCl solution for use. Test sera (200 1tl) including positive and









negative controls were pre-absorbed over night with this suspension (200 ptl) to reduce

nonspecific reactions. Samples were centrifuged at 600 g for 10 min and 20 dtl of supernatant

were added to 1 ml of PBS-TG. The sensitized plates were washed 3 times with a 0.85% saline

solution containing 0.05% Tween 80, allowing 3 minutes/wash. Diluted samples (100 tl) were

added to three wells followed by incubation at room temperature (2 h). The wells were then

washed 3 times with PBSS-TG as before. Horseradish peroxidase conjugated with antibovine

IgG was diluted to 1:2,000 in PBS-TG. Diluted conjugate (Kirkegaard & Perry Laboratories,

Inc., Gaithersburg, MD, USA) (100 tl) was added to each well followed by incubation at room

temperature (2 h). The wells were washed 3 times with PBS-TG and 100 [tl substrate added to

each well. The latter was prepared by adding 125 [tl of a 40 mM solution of

2,2'-azino-bis(3-ethilbenzthiazolinesulfonic acid) and 100 [tl of a 1M solution of hydrogen

peroxidase to 25 ml of citrate buffer (10.5 g of citric acid monohydrate/1, adjusted to pH 4.0 with

NaOH). ELISA results were calculated as ELISA ratios (ER) from wavelength readings (optical

density, OD, at 405 nm) in triplicates as sample OD divided by a value equivalent to 14 of the

OD of the positive control. This value was typically in the range of 0.13 to 0.14. Results were

recorded as negative (<1.5), suspicious (1.5 to 1.9), low positive (2.0 to 2.5), and high positive

(>2.5) as reported previously (Buergelt and Williams, 2003, 2004).

Fecal Culture

Culture of MAP was accomplished using Herrold's egg-yolk method with sedimentation

(modified from Whitlock and Rosenberger, 1990). Briefly, 2 grams of fecal matter were

suspended in 35 mL of sterile distilled water and shaken for 30 minutes. After allowing the

sample to precipitate for 30 minutes, the 5 top mL of supernatant were transferred into 25 ml of

HPC/BHI broth and allowed to stand undisturbed overnight at 35-370C. Samples were









centrifuged for 30 min at 900 g at 100C. The pellet was suspended in 1 mL antibiotic brew and

incubated 12 hours at 35-370C. An aliquot (0.25 ml) of sediment was distributed over each of

four commercial medium slants (BD BBLTM, Becton, Dickinson and Company, USA). Three of

the slants contained mycobactin, and one was prepared without mycobactin. Results were

evaluated weekly up to 16 weeks of incubation. Positive cultures were confirmed by PCR

analysis (IS900) of the growing colonies, following the same protocol described for blood, milk

and feces.

Extraction of DNA on Feces

A sub sample consisting of 0.25 g of feces was prepared for PCR analysis using a

commercial kit (PowerSoilTM DNA Isolation Kit, MO BIO Laboratories Inc, USA) following the

manufacturer's instructions.

Nested Polymerase Chain Reaction

After DNA extraction, 1 [tl (milk, blood) and 5 dtl (feces) of the previously described

product was submitted for PCR. A commercial reaction mix (Hot Master Mix, Eppendorf

North America, Westbury, NY, USA) was used according to the manufacturer's specifications.

Samples were tested in a nested PCR. The first reaction was based on primers P90 and P91

which target a 413 bp sequence of IS900 in MAP. The second reaction used 1 pl of amplified

product and primers J1 and J2 which overlap and span a 333 bp region within the insertion

sequence (Vary et al., 1990; Gwozdz et al., 1997; Buergelt and Williams, 2003). The protocol for

the first stage PCR was 35 cycles at 940C for 30 sec, at 580C for 15 sec and at 720C for 60 sec.

The protocol for the second stage (nested reaction) consisted of 36 cycles of 30 sec at 940C, 15

sec at 630C and 60 sec at 720C.









A volume of 10 [tl of the PCR product was run on 1.5% agarose gel by electrophoresis in

TAE running buffer (Continental Lab Products, CA, USA). Extracted DNA from an isolate

previously obtained from a clinically affected cow confirmed at necropsy by histopathology and

culture was used as positive control and sterile water was used as negative control for the PCR

assay and included in each of the reactions.

Gel inspection was done using ultraviolet light and recorded with a computerized digital

camera (UVP Transilluminator System).

Statistical Analysis

Results for the five diagnostic tests were analyzed to establish associations between all the

possible combinations of test pairs. Maximum possible agreement beyond chance level, and

Cohen's kappa coefficient were used as a measure of agreement between each pair of tests.

The following ranges were considered for interpretation of the kappa coefficient (Landis

and Koch, 1977); poor agreement: less than 0.00; slight agreement: 0.00-0.20; fair agreement:

0.21 to 0.40; moderate agreement: 0.41 to 0.60; substantial agreement: 0.61 to 0.80; very good:

0.81 to 1.00.

Fisher's Exact Test was used to test whether there was any non-random association

between both variables (tests results). This test was chosen because in some cases the 2x2

contingency tables were highly imbalanced (low values in the "+" cell for both tests). The

right-sided probability value was used considering the alternative hypothesis of a positive

association between both tests results (observations tending to lie in upper left and lower right

cells of the 2x2 contingency table).

McNemar's Test was used to test significant differences in the proportion of positive

results between each pair of tests, and crude odds ratios were estimated between pairs of tests to









determine the effect of a positive result in one test to the odds of a positive result in a different

test.

Complementary sensitivity (CS) was estimated for each pair of tests as presented by Juste

et al. (2005). For tests A and B, CS for test A corresponds to the ratio of the number of positive

results only in test A (negative for B) to the total number of positive results in test B, expressed

as a percentage. This variable represents the additional detection efficacy of one method over the

other, assuming that both are highly specific (Sockett et al., 1992).

Data were analyzed using the SAS statistical package for Windows (SAS Systems for

Windows Version 9.00, SAS Institute Inc. Cary, NC, USA) using the PROC FREQ, PROC

GENMOD and the CHISQ EXACT procedure. Values ofP < 0.05 were considered significant

for all tests.

Results

A total of 61 animals (18.6%) in the overall population were positive in at least one of the

five tests being analyzed. By herd, 26.8%, 18%, 19%, and 10% positive animals were detected in

herds A, B, C and D, respectively. The ELISA produced the highest number of positive results

(33 animals), followed by fecal PCR (27 animals), while the lowest number of positive results

was for blood PCR (7 animals) (Table 3-1). A cross-classification of the number of positive

animals for the five tests is presented in Table 3-2. The maximum possible agreement beyond

chance level for all tests combinations is shown in Table 3-3, with values ranging from 5.3%

(blood PCR:fecal culture and blood PCR:fecal PCR) to 16.6% (ELISA:fecal PCR).

Kappa coefficients for the agreement of results in test pairs ranged from -0.036 0.01 (poor

level of agreement) to 0.39 0.10 (fair level of agreement), for ELISA:blood PCR and fecal

culture:fecal PCR, respectively (Table 3-4). Fisher's Exact Test, applied to test the null









hypothesis of no association between outcomes in each pair of tests (10 possible combinations),

resulted in no significant values for 5 of the possible combinations. On the other hand,

significant association was found for the test pairs ELISA:fecal culture; ELISA:fecal PCR; milk

PCR:fecal PCR, blood PCR:fecal PCR and fecal culture:fecal PCR (Table 3-5). Results for

McNemar's Test for differences in proportion of positive results are presented in Table 3-5.

Estimations of the odds of a positive result in a test given a positive result in a different test

are provided in Table 3-6. The odds ratios were greater than one for most of the combinations (9

out of 10 pairs), indicating that a positive result in one test increased the odds of a positive result

in a different test. Estimated complementary sensitivity for each test, when combined with the

results of a different test (20 combinations) is provided in Table 3-7. Estimated values indicate

diverse magnitudes in the additional percentage of infected individuals detected when the

complementary test is added. The highest value corresponded to ELISA when combined with

blood PCR (471%).

Discussion

The total of cows that tested positive for MAP infection by herd ranged from 10 to 26.8%,

when the five tests were interpreted in parallel. Since the cows were not selected by a formal

random process, the proportion of reactors may not represent the true prevalence of infection in

the herds studied. These values are probably affected by factors such as involuntary biases in the

selection of tested animals, the sensitivity of the tests when used in different stages of the

disease, and the application of different tests in parallel as was done in this work.

Considering the proportion of reactive animals by test, the greatest number of positive

results corresponded to the only test in the study that is based on the host response to the

infection (33 cows for ELISA), followed by fecal PCR (27 cows). It was not the purpose of this

study to determine differences in sensitivity and specificity for the five tests under analysis, but









to establish the association in their respective outcomes. The lack of an in vivo gold standard

makes the estimation of a test's accuracy beyond the scope of this study. However, the limitation

in sensitivity of available diagnostic tests for the detection of subclinical stages of MAP infection

was one of the challenges motivating this work.

Estimated agreements between ELISA and three other tests (milk and blood PCR and fecal

culture) were low, including a negative value for the kappa coefficient for blood PCR. In rare

situations, kappa can be negative demonstrating an agreement between results less than that

expected by chance. In this case, because the value is very close to zero, it would simply indicate

very low agreement. On the other hand, the kappa coefficient for agreement between ELISA and

fecal PCR was fair (0.303+0.08), which could be an indication of higher sensitivity of fecal PCR

when compared to fecal culture.

The ability of IS900 PCR to detect MAP in milk has been analyzed in raw bulk tank milk

and in individual cows. Pillai and Jayarao (2002) reported a detection limit for bulk tank milk of

10 to 100 CFU/ml of MAP, which is in agreement with values reported by Giese and Ahrens

(2000) for cows exhibiting clinical signs. In the same study (Pillai and Jayarao, 2002), MAP was

detected in 4% of pooled quarter milk samples by culture and 33% by IS900 PCR, from

individuals in infected herds. According to these authors, the variation in the detection ability of

these tests for low MAP concentrations could be due to loss of some organisms in the cream

fraction after centrifugation of milk. This could also be the explanation for some of our PCR

negative results in cows testing positive by other tests. Our results, indicating poor association

between ELISA and blood PCR, are in agreement with a previous study (Juste et al., 2005) that

reported kappa values for the association between these two tests of -0.36, 0.44 and -0.166 for

cows, heifers and both, respectively. One possible interpretation is that each method detects









different populations or stages of MAP infection because their respective targets (bacteria and

antibodies) do not have parallel dynamics. Two tests with relatively high specificities might have

a low kappa value because they detect different populations of infected animals and this could be

the explanation for low kappa values reported in the present study.

The low percentage of positive blood and milk PCR results compared to ELISA positives

in the present study differs from previous results (Buergelt and Williams, 2004). In the referred

study, working with clinically and subclinically infected dairy cows, the combination of blood

and milk PCR was able to detect animals at least to the same level of detection as the ELISA. In

that study, while the number of clinically infected animals detected was similar with PCR on

blood and milk or ELISA methodologies, subclinically infected animals gave positive PCR

signals in subgroups when the ELISA reading was negative or suspicious. This finding was

interpreted to be a likely indicator of early infection. If the association between PCR and ELISA

results shows that each method is detecting different stages of infection, the complementary use

of both tests could result in an increase of the overall sensitivity.

Considering the fact that the immune response to MAP infection is characterized by an

initial cell-mediated response followed by humoral immunity, with the former fading during the

course of the disease, the efficacy of ELISA in a population would depend on the prevalence of

individual animals among each stage of disease (Whitlock and Buergelt, 1996). After initial

MAP infection, most animals begin to develop a type 1-like T-cell response (Thl), characterized

by release of pro-inflammatory cytokines such as gamma interferon, as a key factor in

controlling mycobacterial infections (Coussens, 2004; Coussens et al., 2004a). Following a

variable period post infection, the host immune system shifts to a Th2-like response, that elicits









non-protective immunoglobulin G1 antibody production from B cells (Coussens et al., 2002;

Whittington and Sergeant, 2001).

The later (clinical) stages of bovine paratuberculosis are characterized by a predominance

of Th2 activity, with high antibody levels, large numbers of bacilli and diminished cellular

responses to specific and non-specific antigens (Chiodini and Davis, 1993; Bassey and Collins,

1997). According to this immunologic dynamics, sensitivity of tests measuring MAP-specific

antibodies in the first subclinical stages would be relatively low. ELISA sensitivity has been

estimated at 9 to 17% in subclinically infected animals shedding low numbers of MAP detectable

by fecal culture (Jubb et al., 2004; Whitlock et al., 2000). Values ranging from 15% to 88% are

reported as the disease progresses to clinical stages with increasing levels of fecal shedding

(Dargatz et al., 2001; Sweeney et al., 1995).

Fecal culture, which is considered as the most specific test for paratuberculosis diagnosis,

showed strong discrepancies with some of the other tests in this study (kappa coefficient: -0.027

to 0.39, Table 3-4). One of the main limitations of this type of test is its moderate sensitivity that

in general has been reported ranging from 30% to 55%, again depending on the stage of infection

(Whitlock and Buergelt, 1996; Buergelt and Williams, 2004). Whitlock et al. (2000) followed a

cohort of 954 cattle cultured every 6 months over a period of 4 years, and reported a sensitivity

of 38% for fecal culture. Eamens et al. (2000) using five different fecal culture methods reported

sensitivities from 26% to 89%. Research on subclinically infected cows showed the existence of

daily variation in fecal shedding determined by conventional fecal culture techniques (Barrington

et al., 2003). These results suggest caution when interpreting negative results from a single fecal

culture. Cows in the first stages of infection would intermittently shed low numbers of the









bacteria in feces, and only 15-25% of these animals could be detected by fecal culture on a single

test (Buergelt and Williams, 2004).

In the present study some variation in levels of fecal shedding is suspected given the fact

that only 11 fecal cultures were positive. This could also be explained by low sensitivity of the

method used for culture or a low rate of animals in advanced stages of the infection. Our values

for the association between ELISA and fecal culture are in agreement with data presented by

other authors, where results from cows concomitantly tested by both tests showed low agreement

(Sweeney et al., 1995; Nielsen et al., 2002b; Muskens et al., 2003a).

In our study, fecal culture also exhibited poor agreement and lack of association with PCR

on milk and blood. MAP has been reported in different organs and tissues such as blood, milk,

semen, lymph nodes and fetuses (Seitz et al., 1989; Buergelt and Williams, 2003; Buergelt et al.,

2004; Juste et al., 2005). This suggests that intermittent bacteremia occurs and readily obtainable

samples as blood and milk could be used to examine for the presence of the bacteria. However,

at the present, there is insufficient information regarding the occurrence and duration of these

events in the course of the infection. Further analysis should determine the likelihood of

intermittent haematogenous spread of MAP and the variation in presentation of the agent in milk.

Our data is not sufficient to clarify if the lack of agreement between fecal culture and the

other tests was due to low sensitivity of this method or to low specificity (false positives) of the

other four tests in the study. In the overall population, only 3.4% of animals tested positive for

fecal culture. As could be expected, the agreement between the results of fecal culture and fecal

PCR was the highest (kappa coefficient=0.39) among all tests combinations. Our estimation is in

agreement with results of an earlier study yielding kappa values ranging from 0.38-0.45 for three

different fecal PCR methods when compared to fecal culture (Taddei et al., 2004). A plausible









explanation would be that both tests have a similar target, and the detection differences only

depend on each test's sensitivity in detecting the presence of MAP. In this regard, the higher

proportion of reactors in fecal PCR would suggest a higher sensitivity when compared to fecal

culture, which requires viable bacteria in numbers of 102 CFU/g of faeces (Halld6rsd6ttir et al.,

2002). Of the currently available methods for detection of MAP, PCR-based assays have the

highest potential analytic sensitivity. Equally important to a test's analytic sensitivity is the

sample that is to be tested. Especially crucial is the ability of the sample to have a high likelihood

of containing MAP (or leucocytes infected with the agent) in early-stage animals, and to be

devoid of factors that inhibit PCR, such as those found in feces (Barrington et al., 2003). The

sensitivity of PCR is difficult to determine because PCR has higher analytical sensitivity than

most existing tests (Kelly et al., 2005). The diagnostic sensitivity of a nested PCR for fecal,

blood, milk, and liver samples in cows with advanced subclinical paratuberculosis was found to

be 87%, 40%, 96% and 93%, respectively (Barrington et al., 2003) but sensitivity in early stage

disease is unknown.

The concept of complementary sensitivity (CS) applied in this study, as previously

reported (Juste et al., 2005), seems a useful tool when a gold standard is not available in practical

terms. Complementary sensitivity provides a measure of the efficiency of combining two

methods with high specificity to increase sensitivity in MAP detection. In this case, the requisite

for specificity is accomplished with high values for ELISA and PCR reported by several studies

(Sockett et al., 1992; Sweeney et al., 1995; Whitlock et al., 2000; Buergelt and Williams, 2004),

although some caution is suggested by those studies reporting the presence of IS900 in

mycobacteria other than MAP (Cousins et al., 1999). The CS values for the tests ranged from 4

to 471% (Table 3-7), indicating, in some cases, a significant improvement in the percentage of









infected cows detected when two different tests were combined. These results, combined with

considerations such as sensitivity, specificity and cost of particular tests, provide antecedents for

the application of test combinations on field. In our study ELISA showed the highest CS values

for all the possible two tests combinations, followed by fecal PCR. Considering that both tests

detected the highest number of infected animals, this appears to be the best combination for

diagnostic applications. The reported high specificity of all the tests analyzed in this study was

an assumption in the estimation of CS. However, there is no absolute certainty that extra positive

animals detected for one method over the other are not actually false positives. Recently some

studies have presented evidence of the contribution of environmental mycobacteria to

false-positive results in a commercially available serum ELISA kit (Osterstock et al., 2007).

Accordingly, the main limitation for our study was the lack of a practical gold standard to

determine the real status and stage of infection of the animals in the study.

In conclusion, the low agreement and the lack of association between results in most of the

tests presented, together with the CS values estimated in this study, provide information for the

possible use of different test combinations in the detection of different stages of infection.

According to our results, the combined use of ELISA and fecal PCR has the potential to increase

the overall sensitivity for the diagnosis of paratuberculosis infection.









Table 3-1. Number and proportion of positive results for ELISA, nested PCR on milk, blood and
feces, and for fecal culture among 328 dairy cattle in four herds.
Herd A (%) Herd B (%) Herd C (%) Herd D (%) Total (%)
ELISA 7 (12.5) 13 (10.6) 12 (12.0) 1 (2.0) 33 (10.0)
Milk PCR 4(7.1) 5(4.0) 4(4.0) 0(0.0) 13(3.9)
Blood PCR 2(3.5) 1(0.8) 3 (3.0) 1(2.0) 7(2.1)
Fecal culture 0(0.0) 7(5.7) 1 (1.0) 3 (6.0) 11(3.4)
Fecal PCR 4(7.1) 12(9.8) 7(7.0) 4(8.0) 27(8.2)
All tests in
parallel 15 (26.8) 22 (18.0) 19 (19.0) 5 (10.0) 61(18.6)









Table 3-2. Cross classification of number of positive results for the five tests (above the
diagonal). The diagonal shows the number of positive animals for each test (n=328)
ELISA Milk PCR Blood PCR Fecal culture Fecal PCR
ELISA 33 2 0 3 11
Milk PCR 13 1 1 4
Blood PCR 7 0 6
Fecal culture 11 8
Fecal PCR 27









Table 3-3. Maximum possible agreement beyond chance for each combination of test pairs (%).
ELISA Milk PCR Blood PCR Fecal culture Fecal PCR
ELISA 13.2 11.8 12.7 16.6
Milk PCR 5.9 7.1 11.5
Blood PCR 5.3 5.3
Fecal culture 11.0
Fecal PCR









Table 3-4. Kappa coefficient asymmetric standard error (above diagonal) and agreement
interpretation (below diagonal) for each combination of test pairs.
ELISA Milk PCR Blood PCR Fecal culture Fecal PCR
ELISA 0.032 0.05 -0.036 0.01 0.138 0.07 0.303 0.08
Milk PCR slight 0.074 0.09 0.048 0.08 0.154 0.08
Blood PCR poor slight -0.027 0.01 0.330 + 0.10
Fecal culture slight slight poor 0.390 0.10
Fecal PCR fair slight fair fair









Table 3-5. Right-sided P > F for Fisher's Exact Test for each combination of test pairs (above the
diagonal). P > S for McNemar's Test for each combination of test pairs (bellow the
diagonal).
ELISA Milk PCR Blood PCR Fecal culture Fecal PCR
ELISA 0.38 1.00 0.017 < 0.001
Milk PCR 0.002 0.24 0.36 0.016
Blood PCR <0.0001 0.15 1.00 < 0.001
Fecal culture 0.0002 0.67 0.34 < 0.001
Fecal PCR 0.33 0.01 <0.0001 0.0006
For Fisher Exact Test values equal to or less than 0.05 indicate significant association between
test results. For McNemar's Test values equal to or less than 0.05 indicate significant difference
in the proportion of positive results between test pairs.









Table 3-6. Odds ratios (95% CI) for positive results in pairs of tests.
ELISA Milk PCR Blood PCR Fecal culture Fecal PCR
ELISA 1.66 (0.35-7.8) 0.57 (0.03-10.2) 5.67 (1.56-20.54)t 8.65 (3.5 -20.9)
Milk PCR 4.29 (0.47-38.5) 2.54 (0.3-21.49) 5.60 (1.6-19.5)
Blood PCR 1.80 (0.09-33.46) 85.14 (9.8-740)
Fecal culture 41.54 (10.1-169)
Fecal PCR
SSignificant at 95% confidence level.









Table 3-7. Complementary sensitivity (CS) for each test when combined with a different test
(%).
ELISA Milk PCR Blood PCR Fecal culture Fecal PCR
ELISA 33 21 21 48
Milk PCR 238 46 77 177
Blood PCR 471 171 157 300
Fecal culture 264 109 64 173
Fecal PCR 81 33 4 11
Presented values correspond to CS of the test indicated at the top of each column when combined
with the corresponding test indicated at the left of each row.





















Figure 3-1. Diagnostic tests. A) MAP colonies in positive samples for fecal culture. B) Positive
PCR results for standard (a) and nested (b) PCR.









CHAPTER 4
Mycobacterium paratuberculosis SHEDDING INTO MILK: ASSOCIATION OF ELISA
SEROREACTIVITY WITH DNA DETECTION IN MILK

Summary

The objective of this study was to analyze the association between ELISA seroreactivity

and Mycobacterium avium subspecies paratuberculosis DNA presence in bovine milk as

detected by nested PCR. An irregular pattern of detection was observed for milk PCR outcomes

along with fluctuations in serial ELISA results. Cows testing positive by milk PCR had negative

and inconclusive ELISA results in 23.5% and 11.8% of the cases, respectively. A kappa

coefficient of 0.012 indicated a slight agreement between both tests; Fisher's Exact Test did not

indicate a significant association between test outcomes (p = 0.55). Ability of serum ELISA as

indicator of the likelihood of milk shedding of Mycobacterium paratuberculosis in dairy cows is

questionable.

Introduction

Mycobacterium avium subspecies paratuberculosis is the cause of a chronic

granulomatous intestinal disease (Johne's disease) in ruminants, characterized by progressive

weight loss and profuse diarrhea (Whitlock and Buergelt, 1996). Paratuberculosis represents a

significant problem for the dairy industry, and one of the main issues relates to the efficiency of

subclinical diagnosis.

MAP isolation from milk was first reported in 1935, in association with advanced clinical

paratuberculosis (Taylor et al., 1981). More recent studies have found MAP isolation rates in

milk of up to 45% in clinically affected animals (Giese and Ahrens, 2000) and of up to 22% in

colostrum or 8% in milk in subclinical cases (Streeter et al., 1995).

Reprinted with permission from Pinedo, P.J., Buergelt, C.D., Monif, R.G., Williams, J.E., Rae, 0. Mycobacterium
avium subspecies paratuberculosis shedding into milk: Correlation of Serum ELISA Titers with DNA Detection in
Milk. J Appl Res Vet Med. In press.









The concern about MAP in milk and milk products centers on its apparent heat resistance

and in the controversial role that the bacteria could play in Crohn's disease in human (Naser et

al., 2004; Grant et al., 2005). In testing units of whole pasteurized milk from retail outlets

throughout central and southern England, it was found that, over three month periods, up to 25%

of commercial units sampled were affected by the presence of MAP DNA (Millar et al., 1996).

In a study in the Czech Republic, MAP was cultured from 1.6% of commercially pasteurized

retail milk (Ayele et al., 2005). A United States' study found viable MAP in 2.8% of milk

samples taken from grocery stores in three states (Ellingson et al., 2005).

ELISA testing for MAP has been used as a herd tool from which producers could make

management decisions (Whitlock et al., 2000). Using nested PCR, Buergelt and Williams (2004),

showed a positive correlation between high MAP ELISA readings in blood and increased

probability of detection of MAP DNA in milk of clinical cows. However, a clear association was

not found when comparing a sub group of subclinically infected animals. These latter findings

bring into question whether detection of subclinical infection by ELISA is an effective tool for

identification of cows shedding MAP into milk as a first step of protecting the food chain.

The purpose of this report was to analyze the association between ELISA seroreactivity

and the presence of MAP DNA in milk based upon a nested PCR. The information reported here

is retrospective and based on data from dairy cows tested concurrently by serum ELISA and milk

PCR, or with prolonged serial observations to detect MAP DNA in milk.

Materials and Methods

Study Population

Blood and milk samples were derived from cows belonging to the University of Florida's

Dairy Research herd (USA), composed of 500 Holstein cows, and known to be infected with

MAP. As a routine, cows were tested for MAP by serum ELISA annually and, in some cases,









milk samples were obtained for PCR analysis. Research data on 98 adult cows, tested during

2003 and 2004, were selected on the sole basis of their having had a PCR analysis for MAP in

milk concurrent with the routine ELISA test. No formal randomization in the selection of

animals was attempted and the samples analyzed do not represent a particular status of

paratuberculosis infection. Thirteen animals were considered for the serial analysis. One

particular animal (cow Id#3900) was successively tested for ELISA and milk and blood PCR for

about nine months and finally submitted for necropsy. All the procedures involving animal

handling were in agreement with the animal care protocols of the University of Florida.

Sample Handling, Milk Samples

Before collection, the teats were thoughtfully cleansed with alcohol to avoid sample

contamination from skin. Milk (30-40 ml) was collected in a sterile 50 ml centrifuge tube from

the four quarters by hand milking, discarding the first 10-15 ml. The milk samples were

centrifuged at 1,000 g for 15 min and the supernatant discarded. The resultant pellet was washed

thrice in phosphate buffered saline (PBS, pH 7.3) and centrifuged at 500 g for 15 min. The pellet

was resuspended in 1 ml of PBS, centrifuged and resuspended in 100 [tl of 0.2 N NaOH. After

boiling at 1100C for 20 min to extract DNA, the material was centrifuged at 500 g for 3 min. The

final product was stored at -200C for subsequent PCR.

Blood Samples

After cleansing with alcohol, 10 ml of blood per cow were collected from the coccygeal

vein into Vacutainer tubes (Becton Dickinson, NJ, USA) with and without EDTA. For the

blood PCR procedure (cow Id#3900), 3 ml of EDTA blood was added to 4 ml of

Ficoll-Isopaque Plus Gradient (Amersham Pharmacia, NJ, USA) and centrifuged for 40 min at

500 g at 18C. The buffy coat was collected, then washed twice with PBS, and centrifuged at 500

g for 15 min. Cells from the pellet were resuspended in 100 [tl of 0.2 N NaOH, boiled at 110C









for 20 min to extract DNA, and centrifuged at 500 g for 3 min. The final product was stored at -

20C for subsequent PCR.

Nested Polymerase Chain Reaction (PCR)

After DNA extraction, 1 [tl of the previously described product (milk and blood) was

submitted for PCR. A commercial reaction mix (Hot Master Mix, Eppendorf North America,

NY, USA) was used according to the company's specification. Samples were tested with primers

P90, P91 for IS900, which specifically recognize a 413 bp sequence of MAP. The reaction was

followed by the nested PCR, where lul of previously amplified product was tested with second

set of primers J1, J2 overlapping and spanning a 333 base pair region within the insertion

sequence (Vary et al., 1990; Gwozdz et al., 1997; Buergelt and Williams, 2004).

A volume of 10 [l of the PCR product was run on 1.5% Agarose gel by electrophoresis in

TAE running buffer (Continental Lab Products, CA, USA). Extracted DNA from the laboratory

strain #295 was used as positive control and sterile water was used as negative control for the

PCR assay. Gel inspection was done using ultraviolet light and recorded with a computerized

digital camera (UVP Transilluminator System). Positive and negative controls were used in each

of the reactions.

Enzyme-Linked Immunosorbent Assay

Serotesting of samples was done by use of the ELISA developed by Allied laboratories

Inc. (Ames, Iowa, USA) with crude, soluble M. paratuberculosis 18 protoplasmic antigen

(Allied Monitor Missouri, MO, USA), based on a previously documented protocol (Braun et al.,

1990). Antigen was diluted to a concentration of 0.1 mg/ml in 0.05M sodium carbonate buffer at

pH 9.6. This dilution (100 [tl per well) was incubated over night at 40C. A suspension of

Mycobacterium phlei was prepared by adding 5 g of dry, heat-killed M phlei to 1 L of phosphate









buffered saline solution containing 1% gelatin and 0.05% Tween 80 (PBS-TG). Three ml of this

base solution were added to 97 ml of 0.85% NaCl solution for use. Test sera (200 ptl) including

positive and negative controls were pre-absorbed over night with this suspension (200 tl) to

reduce nonspecific reactions. Samples were centrifuged at 2,000 rpm for 10 min and 20 [tl of

supernatant were added to 1 ml of PBS-TG. The sensitized plates were washed 3 times with a

0.85% saline solution containing 0.05% Tween 80, allowing 3 minutes/wash. Diluted samples

(100 tl) were added to three wells followed by incubation at room temperature (2 h). The wells

were then emptied and washed 3 times with PBSS-TG as before. Horseradish peroxidase

conjugated with antibovine IgG was diluted to 1:2,000 in PBS-TG. Diluted conjugate (100 tl)

was added to each well followed by incubation at room temperature (2 h). The wells were then

emptied and washed 3 times with PBS-TG as before. Substrate was prepared by adding 125 [tl of

a 40 mM solution of 2,2'-azino-bis(3-ethilbenzthiazolinesulfonic acid) and 100 ml of a 1M

solution of hydrogen peroxidase to 25 ml of citrate buffer (10.5 g of citric acid monohydrate/1).

Substrate (100 [tl) was added to each well. ELISA results were calculated as ELISA ratios (ER)

from wavelength readings (optical density, OD, at 405 nm) in triplicates as sample OD divided

by a value equivalent to 14 of the OD of the positive control (Bech-Nielsen et al., 1992). This

value was typically in the range of 0.13 to 0.14. This value was typically in the range of 0.13 to

0.14. Results were recorded as negative (<1.5), suspicious (1.5 to 1.9), low positive (2.0 to 2.5),

and high positive (>2.5) as reported previously (Buergelt and Williams, 2004).

Analysis

Results are presented in tables to demonstrate the association between the different tests.

For the statistical analysis kappa coefficient was used as a measure of agreement between the

two tests. The following ranges were considered for interpretation of the kappa coefficient; poor









agreement: less than 0.00; slight agreement: 0.00-0.20; fair agreement: 0.21-0.40; moderate

agreement: 0.41-0.60; substantial agreement: 0.61-0.80; almost perfect: 0.80-1.00 (Landis and

Koch, 1977).

Fisher's Exact Test was used to test whether there was a non-random association between

either variable (respective tests results). For both methods of analysis, inconclusive results

(suspicious category) for the ELISA test were not considered and ELISA categories "strong" and

"low positive" were deemed as one group (positive).

Data were analyzed using the PROC FREQ procedure of the SAS statistical package for

Windows (SAS Systems for Windows Version 9.00, SAS Institute Inc., NC, USA).

Results

Cows tested by serum ELISA and the nested PCR in milk were grouped by ELISA

categories in Table 4-1. For ELISA categories negative and high positive 16.6% and 77.5% of

the results were in disagreement with PCR test respectively. A total of 23.5%, and 11.8% of the

individuals that had evidence of MAP DNA in milk were negative or inconclusive for ELISA

outcomes respectively (6 animals).

Results for ELISA and milk PCR from 83 cows were the basis for the statistical analysis

and are presented in a two by two contingency table (Table 4-2).

There was agreement between ELISA and milk PCR in 31 of the 83 animals (37.3%)

included in the analysis. Four cows were positive for PCR, but negative for ELISA and 48 were

positive for ELISA but PCR negative. The kappa coefficient (1.96 asymmetric standard error)

for the association of both tests was 0.012 (0.059) which is a slight level of agreement.

Fisher's Exact Test did not resulted in significant values (p = 0.55), indicating that there

was not sufficient evidence to reject the null hypothesis of no association between test outcomes.









Serial samples taken for individual cows evidenced a variable pattern of MAP shedding

into milk, measured as the presence of bacterial DNA by nested PCR. Table 4-3 presents serial

results for a particular cow tested during 9 months (21 times), and confirmed as a clinical case by

necropsy. An irregular pattern of detection can be observed for milk and blood PCR results,

along with fluctuations in ELISA readings.

Serial results for serum ELISA and milk PCR in a different group of 5 cows with

fluctuations in the milk shedding status are presented in Table 4-4. For this group, as shown for

cow Id#3900, data suggest a poor association between detection of the bacteria in milk and

serum ELISA results.

Cows that tested positive for milk DNA had a variable pattern for ELISA ODs over time.

ELISA test results from 29 cows that tested positive for milk PCR are summarized in Table 4-5.

The data suggests that ELISA seroreactivity may have a negative status despite the fact that the

cow is shedding the bacteria in milk, as shown by PCR detection.

Cow Id#6142 was tested by milk PCR using samples taken from separate quarters on six

different occasions. While milk from all four quarters was demonstrated to be positive on two

instances, milk from three of the four quarters in a given test was negative on two occasions, and

from two or one quarter in one sampling each (Table 4-6), indicating that not pooling milk from

all four quarters increases the risk of obtaining a false-negative result for the animal.

Discussion

Serologic tests for MAP are most useful in establishing the herd prevalence infection, for

presumptive identification of infected animals, and for confirming the diagnosis of JD in animals

presenting compatible clinical signs (Nielsen et al., 2001).

ELISA testing has been advocated as a herd tool from which individual producers could

make management decisions, though, the ELISA for MAP has the disadvantage of moderate to









low sensitivity in cows shedding low numbers of bacteria (Whitlock et al., 2000). There are

multiple commercial MAP ELISA tests available and, despite the fact they are marketed as

herd-level diagnostic tools, they are commonly used as cow level (McKenna et al., 2006).

Considering that one of the aims of diagnostic tests in animal production is to help to control the

introduction of potential pathogens into the human food chain, the ability of serologic tests as

ELISA to detect individuals that are more likely to shed MAP into milk is crucial. However,

from the data presented, it can be stated that a given ELISA outcome is not conclusive as to

whether or not a given cow is shedding MAP into its milk (Table 4-1).

It has been suggested that the measurable humoral immune response to MAP in subclinical

cows can vary widely over time, even from day to day (Barrington et al., 2003). This information

is in agreement with our findings (Figure 2-2, Tables 4-3 and 4-4). It is suspected that this

variation in ELISA results is due to fluctuation in antibody production, protein enteropathy,

variable losses by way of the gastrointestinal tract, or a combination of these.

Further, strong discrepancies between different commercial ELISAs when performed

concomitantly on the same animal were found by McKenna et al. (2006). In their study, the

highest and lowest kappa coefficients for combinations of three different commercial ELISA

tests were 0.33 and 0.18, which is fair and slight agreement, respectively.

MAP has been reported in different tissues and fluids such as blood, milk, semen, lymph

nodes and fetuses suggesting that intermittent bacteremia occurs accompanied by dissemination

of MAP to body fluids like milk (Taylor et al., 1981; Juste et al., 2005).

The ability of IS900 PCR to detect MAP in milk has been analyzed in raw bulk tank milk

and in individual cows. Pillai and Jayarao (2002) reported a detection limit for bulk tank milk of

10 to 100 CFU/ml of MAP, which is in agreement with values reported by Giese and Ahrens









(2000) for cows exhibiting clinical signs. In the same study, MAP was detected in 4% and 33%

of pooled quarter milk samples, in individuals from infected herds, by culture and IS900 PCR,

respectively (Pillai and Jayarao, 2002). According to these authors, the variation in the detection

ability for low MAP concentration could be due to loss of some organisms in the cream fraction

after centrifugation of milk. This could also be the explanation for some of our PCR negative

results in cows previously positive or exhibiting high ELISA values.

Because of the apparent intermittent pattern of MAP dissemination, shedding into milk

may not be ascertained from a single milk sample. As Tables 4-3 and 4-4 evidence, MAP

shedding appears to be irregular over an extended period of time and herd management decisions

based upon a single analysis of milk can not rule out MAP shedding into milk at another point in

time.

Poor agreement between ELISA results and bacterial DNA detection in blood was

previously reported, with kappa values for serum ELISA vs. blood PCR results of -0.36, 0.44 and

-0.166 for cows, heifers and the two combined, respectively, suggesting a poor to moderate

agreement between tests (Juste et al., 2005). The interpretation offered is that each method

detects different populations, or stages of MAP infection, because their respective targets might

not have parallel dynamics. This explanation may apply to our results as well (Table 4-3), based

on the possibility of different temporal patterns for the humoral immune response to MAP and

the presence of MAP in milk. A higher number of individuals positive for MAP PCR detection

in milk would be desirable in our study to determine, more accurately, the likelihood of having

an accompanying negative result for the serum ELISA. One limitation of this study, because of

the retrospective nature of the analysis, is that this condition was restricted to only 17

individuals.









An additional factor governing the presence or absence of MAP in milk is the means by

which a sample is obtained. As demonstrated in Table 4-6, in order for a milk sample to be

deemed adequate for analysis, the milk should be obtained from all four quarters (pooled

sample).

Based on the results of this study, it is concluded that MAP shedding in milk, as detected

by PCR, has a slight association with the concurrent ELISA seroreactivity; ability of serum

ELISA as indicator of the likelihood of milk shedding of MAP in dairy cows is questionable.










Table 4-1. DNA detection of MAP in milk by nested PCR grouped by ELISA result categories
(number and % of animals, n: 98 cows).
ELISA ratio and interpretation
High positive Low positive Suspicious Negative Total
Milk PCR + (%) 9 (52.9) 2 (11.8) 2 (11.8) 4 (23.5) 17
Milk PCR 31 17 13 20 81
Total 40 19 15 24 98









Table 4-2. ELISA results and DNA detection of MAP in milk by nested PCR.
ELISA ratio and interpretation
Positive (> 2.0) Negative (< 1.5) Total
Milk PCR + (%) 11 (73.3) 4 (26.7) 15
Milk PCR 48 20 68
Total 59 24 83
Inconclusive ELISA results were removed, and low and strong positive categories are presented
as positive (number and % of animals).









Table 4-3. Results for 21 serial testing (9 months) in cow Id#3900. Milk and blood PCR results
are given relevant to ELISA categories in concurrent testing.
ELISA ratio and interpretation
Negative Suspicious Low positive High positive
Milk PCR + 0 1 0 5
Milk PCR 0 3 2 10
Blood PCR + 0 3 0 3
Blood PCR 0 1 2 12










Table 4-4. Serial results for milk PCR, and serum ELISA in a group of five individuals.

Days from previous


Cow Id tests Milk n


3475


+


3763


3838


3976


6044


TELISA categories:
positive (>2.5).


27
35 +
negative (<1.5); suspicious (1.5


ested PCR ELISA ratio
1.7
4.6
1.8
1.5
<1.5
<1.5
<1.5
1.6
5.6
5.8
3.6
4.9
4.9
4.9
4.9
2.6
<1.5
<1.5
<1.5
1.7
<1.5
to 1.9); low positive (2.0 to 2.5); high









Table 4-5. Cows that were positive to MAP DNA by PCR detection in milk are grouped by their
corresponding serum ELISA status.
Number of
ELISA Category test results# ELISA ratio range
negative 7 0.5-1.4
suspicious 8 1.5-1.9
low positive 2 2.2-2.5
high positive 18 2.2-3.9
Six animals with multiple testing.









Table 4-6. Serial results for cow Id#6142 tested by MAP PCR on individual quarter milk
samples and concurrent serum ELISA.
PCR on milk by quarter
Sample date RF LF RR LR ELISA ratio
9/24/2002 + + 2.9
12/10/2002 + -- 1.5
12/30/2002 + + + 2.0
1/21/2003 + + + + 2.6
1/28/2003 + + + + 2.5
2/4/2003 n.a.* -- 2.3
* No milk was obtained from RF quarter. tRF= right front, LF= left front, RR= right rear, LR=
left rear.









CHAPTER 5
ASSOCIATION BETWEEN CARD15 GENE POLYMORPHISMS AND
PARATUBERCULOSIS INFECTION IN FLORIDA CATTLE

Summary

Paratuberculosis represents a major problem in farmed ruminants and at the present is

considered a potential zoonosis. The disease is caused by Mycobacterium avium subsp.

paratuberculosis, and susceptibility to infection is suspected to have a genetic component.

Caspase recruitment domain 15 (CARD15) gene encodes for a cytosolic protein implicated in

bacterial recognition during innate immunity. Crohn's disease is an idiopathic inflammatory

bowel disease in humans comparable in many features to bovine paratuberculosis involving an

abnormal mucosal immune response. The association between mutations in the CARD15 gene

and increased risk of Crohn's disease has been described. The objective of this candidate gene

case-control study was to characterize the distribution of three polymorphisms in the bovine

CARD15 gene and test their association with paratuberculosis infection in Florida cattle. Three

previously reported single nucleotide polymorphisms (E2[-32] intron 1; 2197/C733R and

320/Q1007L) were screened for the study population (431 adult cows). The statistical analysis

resulted in significant differences in allelic frequencies between cases and controls for

SNP2197/C733R (p < 0.001), indicating a significant association between infection and variant

allele. In the analysis of genotypes, a significant association was also found between

SNP2197/C733R and infection status (p < 0.0001); cows with the heterozygous genotype were

3.35 times more likely to be infected than cows with the reference homozygous genotype (p =

0.01). Results suggest a role for CARD15 gene in the susceptibility of cattle to paratuberculosis

infection. These data contribute to the understanding of paratuberculosis, suggest new

similarities with Crohn's disease and provide new information for the control of bovine

paratuberculosis.









Introduction

Paratuberculosis (Johne's disease) is a chronic, infectious disease of ruminants caused by

Mycobacterium avium subsp. paratuberculosis (MAP), and characterized by progressive weight

loss and profuse watery diarrhea (Chiodini et al., 1984). The disease has a worldwide distribution

and is categorized by the Office International Des Epizooties as a list B disease, which is a

serious economic or public health concern (OIE, 2004).

Crohn's disease (CD) is a chronic idiopathic inflammatory bowel disease in humans

similar in many features to bovine paratuberculosis and involves an aberrant mucosal immune

response in genetically susceptible individuals (National Research Council, 2003; Scanu et al.,

2007). The association between mutations in the caspase recruitment domain 15 gene (CARD15,

formerly NOD2) and increased risk of CD has been described in different geographical

populations (Hugot et al., 1996, 2001; Ogura et al., 2001a; Hugot 2006).

CARD 15 is an intracellular element responsible for the indirect recognition of bacterial

peptidoglycan through the binding of muramyl dipeptide, a component of both Gram negative

and positive bacterial cell walls in monocytes, macrophages, dendritic cells, and intestinal

epithelial cells, where it is mainly expressed (Ogura et al., 2001). Structurally, CARD15 is

composed of three segments: NH2-terminal caspase recruitment domains (two CARD units), a

nucleotide-binding domain (central portion), and finally, a leucine-rich repeat (LRR) region as is

found in toll-like receptors (Hugot 2006; Lakatos et al., 2006).

Three main mutations of CARD15 have been found to be associated with an increased risk

of CD. These mutations occur in the LRR domain or in its vicinity, suggesting an alteration in

the recognition of the bacterial components (Lesage et al., 2002). Research suggests that the CD-

associated mutations result in a "loss of function" phenotype, however, variant CARD 15 proteins

apparently present inflammation-promoting functions. A possible explanation suggested that









CARD15 is defective in performing critical functions required for limiting inflammation (loss-

of-function) and the variant proteins directly activate pro-inflammatory signaling pathways

(gain-of-function) (Zelinkova et al., 2005).

Johne's disease is considered a potential zoonosis. A role for MAP, the causal agent of JD,

in the etiology of CD has been repeatedly suggested and, while an association between MAP and

CD has been documented in diverse studies (Sechi et al., 2005, 2005a; Scanu et al., 2007), a

causal link has not been proven or shown (Feller et al., 2007).

Genetic factors have also been associated with differences in susceptibility to bovine

paratuberculosis, and estimations indicate a range of moderate values for heritability of infection

(Koets et al. 2000; Elzo et al., 2006; Gonda et al., 2006a). The function of CARD15 in the

coordination of immunity against bacteria, the similarities shared by JD in cattle and CD in

human, and the controversial role of MAP in this disease make this gene a good candidate to test

the role of genetics in the susceptibility to bovine paratuberculosis.

The central hypothesis of this study was that a combination of particular alleles in the

candidate gene would be present in higher frequency in case individuals compared to controls,

suggesting a role in susceptibility to infection. The objective of this candidate gene case-control

study was to characterize the distribution of three polymorphisms in the bovine CARD15 gene

and test their association with paratuberculosis infection in Florida dairy and beef cattle.

Materials and Methods

Study Population

The study sample size was estimated based on an exposure rate for the controls of 15% for

the allele related to higher susceptibility. An odds ratio value of 2.0 was established as a

threshold for significance, with a ratio for cases and controls of 1:2 (power=80%,









confidence=95%). Based on these parameters, the required number of cases and controls was

119 and 239 cows respectively for a one-tailed analysis (Win Episcope 2.0).

Consequently, 431 adult cows, consisting of 299 Holstein, 50 Jersey and 82

Brahman-Angus crosses were selected for this study. The population was recruited from three

Holstein and one Jersey dairy herds, and one Brahman-Angus cow-calf herd near Gainesville,

Florida, USA. The five herds had a past history of clinical paratuberculosis cases, with some

individuals confirmed by necropsy examination (submitted to the College of Veterinary

Medicine, University of Florida).

A case-control design was used based on the infection status of the animals following

multiple tests. MAP infection was determined by parallel interpretation of five diagnostic tests

(serum ELISA, milk PCR, blood PCR, fecal PCR and fecal culture) or by necropsy examination

(gross pathology, histopathology and PCR on tissues). The infection status of 402 cows was

established by using the in vivo tests, whereas 29 cows were evaluated by necropsy.

In determining the case-control sub-populations, a case was defined as an animal being

positive for any of the tests, considered in parallel, and a control was defined as an individual

negative to all the tests that it was subjected to. As a result, the final population consisted of 126

cases and 305 controls (1:2.4 ratio).

Diagnosis

Refer to chapter 3 for details in diagnostic procedures.

Genotyping

Extraction of DNA

DNA from the study population was extracted from whole blood or tissues using the

QIAamp DNA Blood Mini Kit (Qiagen Inc., CA, USA), according to the manufacturer's

directions and stored at -200C before use.









Allele determination

Three previously reported single nucleotide polymorphisms (SNPs) within the bovine

CARD15 gene were tested (designated as SNPo, SNP1, and SNP2) (Taylor et al., 2006). SNPo

[SNP E2 (-32) G>A] is located in the intron 1, positioned 32 bp upstream of the first base of the

second coding exon, and is considered a putative regulatory region identified by homology

across seven animal species (Taylor et al., 2006). SNP1 [2197, T>C (C733R)] is situated in the

leucine-rich repeat domain and is responsible for an amino acid substitution (cysteine to

arginine). SNP2 [3020 A>T (Q1007L)] is located outside the last domain and is also responsible

for an amino acid substitution (glutamine to leucine) (Taylor et al., 2006).

The bovine CARD15 gene was genotyped by using the fluorescence-based TaqMan

allelic discrimination genotyping method (Applied Biosystems, Foster City, USA), via the

Applied Biosystems 7900 HT SNP genotyping platform. Five ul reactions in 384-well plate were

prepared using Eppendorf epMotion 5070 (Eppendorf North America, Inc., Westbury, NY,

USA), and Packard Multi Probe II HT Systems (PerkinElmer Las, Inc., Shelton, CT, USA),

liquid handling/sample processing robotics and the assays were performed and analyzed

according to the manufacture's recommendations. All the genotyping was performed in the

laboratories of the University of Florida Center for Pharmacogenomics.

Statistical Analysis

Genotype frequencies were tested for departure from Hardy-Weinberg equilibrium (HWE)

by using Fisher Exact Test and Chi-square test with one degree of freedom. Both tests were also

used to check whether there was any non-random association between allele or genotype

frequencies versus infection status of the cows. The analysis was performed for each SNP and

combination of polymorphisms.









The univariable analysis for logistic regression considered the infection status as response

variable and included 5 possible explanatory variables; SNPs, breed, herd and age. Multivariable

logistic regression models were proposed to estimate the odds of infection for "susceptibility

allele" carriers compared to non allele carriers, controlling for possible confounding variables.

The models considered the infection status as response variable (yes/no), and included genotypes

(based on alleles provided by different SNP's), breed, herd and age as explanatory variables.

Genotypes were analyzed as ordinal variables [major homozygous (0); heterozygous (1); minor

homozygous (2)] and as class variables with the major homozygous genotype deemed as

baseline. Breed and herd were considered as class variables, and age (months) was considered as

an ordinal variable with three levels demarcated by the mean + one standard deviation.

The complete model was tested by backward elimination procedure to determine the

variables to be included in the final model based on the deviance value.

Data were analyzed using the SAS statistical package for Windows (SAS Systems for

Windows Version 9.00, SAS Institute Inc. Cary, NC, USA) using the PROC FREQ, PROC

GENMOD and the CHISQ EXACT procedure. Values ofP < 0.05 were considered significant

for all tests.

Results

The resultant ratio of cases to controls was 1:2.4 (126 cases vs. 305 controls) with an

average age for cases and controls of 64 and 65 months, respectively (p = 0.7). No variation was

found in the population for SNPo, with all the population containing the G allele, and

consequently, this SNP was removed from the analysis. From a total of 431 individuals

submitted for the genotyping analysis, 5 and 4 samples failed to provide a result for SNP1 and

SNP2 respectively.









Frequencies for the major allele in SNP1 (Ai) and SNP2 (B1) were 0.94 and 0.54,

respectively (variant alleles for SNP1 and SNP2 were denominated A2 and B2, respectively).

Values for the coefficient of linkage disequilibrium (LD), normalized LD, and correlation

between the two SNPs were -0.027, 1.0, and -0.23, respectively, and Chi-square test indicated

that SNP1 and SNP2 were in linkage disequilibrium (p < 0.001). The same analysis, performed

for each herd separately, indicated also that both polymorphisms were in linkage disequilibrium.

The genotype frequencies of SNP2 did not deviate from HWE; however the distributions of SNPi

did not fit HWE in our control population.

The statistical analysis resulted in significant differences in allelic frequencies between

cases and controls for SNPi (p < 0.0001) indicating an association between infection and variant

allele. The frequency for the variant allele was 11.4% and 3.8% in cases and controls,

respectively (p = 0.002). However, no association was found between SNP2 and infection status

(p = 0.10) (Table 5-1). In the analysis of genotypes, a significant association was only found

between SNP1 and infection status (p < 0.0001) (Table 5-2). A significant association between

allele combinations and infection status was found (p < 0.0001) when both SNPs were

considered simultaneously in the genotype (Table 5-3).

This connection was also tested within the Brahman-Angus subpopulation, where the

highest proportion of the variant allele was found, resulting in a significant value for Fisher's

Exact Test (p = 0.02) and, consequently, supporting the role of this polymorphism in

susceptibility to infection.

Estimated odd ratios (OR) for the univariable logistic regression models are presented in

Table 5-4. The models tested the effect of each of the explanatory variables on the individual

animal odds of paratuberculosis infection dichotomouss variable; yes/no). The analysis indicated









significant ORs for SNP1 when considered as ordinal (p = 0.0009), and class variable [genotype

A1A2 referred to the major genotype A1A1 (p < 0.0001)]. Genotype A2A2, however, resulted in a

not significant OR (p = 0.37) when the variable was considered as class. Breed effect was

significant for all the classes. No statistical significance was found for variables SNP2 and age.

Different models for multivariable logistic regression were tested in the aim of controlling

for potential confounding variables such as breed, herd, and age. The intension was,

consequently, to isolate the effect of our variables of interest (SNPi and SNP2). The final model

for multivariable logistic regression is presented in Table 5-5. The model includes SNP1

genotype (class) as an explanatory variable of interest, controlling for breed and age. The

analysis indicated that, after controlling for breed and age, the effect of SNPi was significant,

and the estimated odds of infection for cows with the AiA2 genotype were 3.35 times the

estimated odds of cows with the major (AiAi) genotype (p = 0.01).

Discussion

Genetic factors have long been suspected in association with susceptibility and resistance

to mycobacterial infection, including bovine paratuberculosis (Abel and Casanova, 2000; Koets

et al., 2000). Several studies report a breed effect in the variation in susceptibility to

paratuberculosis (Cetinkaya et al., 1997; Roussel et al., 2005; Elzo et al., 2006) and estimations

of heritability to MAP infection ranging from 0.06 to 0.159 have been reported (Koets et al.,

2000; Mortensen et al., 2004; Gonda et al., 2006a).

At present, few studies have explored the association between paratuberculosis

susceptibility and candidate host genes. Some of them have not succeeded in finding strong

associations (Taylor et al., 2006; Hinger et al., 2007), likely due to limitations in sample size and

sensitivity of the diagnostic test used. However, nine chromosomal regions putatively associated

with MAP infection have been documented based on quantitative trait loci mapping (Gonda et









al., 2005, 2006b). As for susceptibility to many infectious diseases that are probably not

controlled at the genetic level by a single gene, variation in susceptibility to bovine

paratuberculosis is likely controlled by a group of genes, or many genes (multifactorial

inheritance).

The present results indicate a significant association between a polymorphism in the

CARD15 gene and paratuberculosis infection in the cattle population under study.

CARD15 has been mapped to the bovine chromosome 18 (BTA18) and its transcript is

5105 bp long and the protein comprises 1013 amino acids. This compares to human and murine

CARD15 with transcript lengths of 4485 bp and 4585 bp, respectively (Taylor et al., 2006).

The role of CARD15 in innate immunity as an intracellular bacterial receptor could provide

a biological explanation for the observed association. The function of this gene was first

appreciated in human by its identification as a locus linked to Crohn's disease. Defects in the

CARD15 gene have been shown to disturb the expression of the cytokines necessary to

coordinate the balance between immune suppression and activation. Disturbances in this

equilibrium, required for healthy functioning of the adaptive immune system in the intestine,

lead to a dysfunctional inflammatory reaction accompanied by epithelial injury (Maeda et al.,

2005; Strober et al., 2006; Fishbein et al., 2008).

In the present study, the mutation associated with a higher susceptibility to

paratuberculosis infection (C733R) is found in the leucine rich repeats (LRR) domain,

responsible for the interaction with the bacterial cell wall component peptidoglycan.

Coincidently, one of the three most common genetic variants in CARD15 is the insertion

frameshift mutation at nucleotide 3020 (3020insC), leading to truncation of the C terminal 33

amino acids in the LRR region (Ogura et al., 2001a). This mutation is associated with









hyporesponsiveness to peptidoglycan and attenuated NF-kB activation, and leads to a

overexpression of the CARD15 protein accompanied by a diminished antibacterial defense

function in epithelial cells (Strober et al., 2006).

To the authors knowledge, this is the first large scale study taking into account the serious

limitations affecting the performance of paratuberculosis diagnosis, and showing an association

between CARD15 and paratuberculosis infection in cattle. One of the potential limitations in a

case control study is that the diagnosis of paratuberculosis may be hampered by a lack of test

accuracy. Available methods fail to identify all infected animals (Chiodini et al., 1984). These

potential false negative results raise the concern of misclassification of cases and controls. To

address this limitation, parallel interpretation of multiple diagnostic tests was used as a means to

improve overall sensitivity. The procedure considered five highly specific diagnostic tests to

avoid a potential increase of non-specific results (false positives), producing clearly determined

subpopulations of cases and controls. Another important aspect of candidate gene case control

studies is the need to achieve a study population large enough to allow multiple statistical tests to

establish significant findings. According to our sample size estimations, this requisite was

achieved in this study.

The failure in fitting the assumption of HWE for SNP1 could be explained by the fact that

domestic populations are likely to be under inbreeding conditions and suffer assortative mating.

This constitutes a limitation for this study, however, the possibility of population stratification is

low as indicated by the absence of association with paratuberculosis infection in other unlinked

markers analyzed (data not presented). This concern is also reduced, given that cases and

controls were matched from the same subpopulations.









The present study was not designed to determine the effect of breed in susceptibility, but

this variable was by necessity considered in the analysis. Furthermore, the fact that the variant

allele for SNP1 (2197, T>C) was found mainly in the Brahman-Angus subpopulation raised the

concern of breed as a potential confounding factor. Two tests were performed to clarify this

point; logistic regression analysis with a model controlling for breed (Table 5-5) and Fisher's

Exact Test within the Brahman-Angus subpopulation. Both analyses resulted in significant

associations between this polymorphism and the infection status of the cows (OR=3.35, p

0.01;p = 0.02, respectively).

Variables included in the final logistic regression model were SNP1, breed and age.

Although this last variable was not significant in the univariable model, because of its biological

relevance, it was maintained in the final model. According to the analysis, cows with the A1A2

genotype were 3.35 times more likely to be infected than cows with the A1A1 genotype

(p = 0.01). However, the resulting odds of infection for cows with the A2A2 genotype relative to

the reference were not significant (p = 0.97). A possible explanation for this lack of significance

could reside in the small number of animals carrying this variant genotype (11 cows).

It is concluded that amino acid substitution C733R (SNP1) appears to be associated with

susceptibility to paratuberculosis infection in this population of Florida cattle. The information

presented in this study adds new evidence relative to the potential association of bovine

paratuberculosis and Crohn's disease. According to the conclusions of the Committee on

Diagnosis and Control of Johne's Disease (National Research Council, 2003), the identification

of a common susceptibility gene for paratuberculosis in animals and CD in humans would offer a

moderate evidence of causation for the role of MAP in CD. These data also contribute to the









understanding of this disease and present new information for the control of bovine

paratuberculosis.









Table 5-1 Alleles: Cross classification of number (%) of cases (+) and controls (-) and alleles for
SNP1 and SNP2.
Infection status
Alleles + P value
SNP1
A1 209 (89%) 592 (96%) <0.001t
A2 27 (11%) 24 (4%)
SNP2
B1 140 (59%) 324 (53%) 0.1
B2 98 (41%) 292 (47%)
Significant atp < 0.05.









Table 5-2. Genotypes: Cross classification of number (%) of cases (+) and controls (-) and
genotypes for SNP1 and SNP2.
Infection status
Genotype + P value
SNP1
A1A1 95 (81%) 291 (95%) <0.0001
A1A2 19(16%) 10(3%)
A2A2 4 (3%) 7 (2%)
SNP2
B1BI 38 (32%) 83 (27%) 0.19
BiB2 64 (54%) 158(51%)
B2B2 17 (14%) 67 (22%)
Significant atp < 0.05.









Table 5-3. Complete genotypes: Cross classification of number (%) of cases (+) and controls (-)
and genotypes combining SNP1 and SNP2.
Infection status
Genotype + -P value
AiA1 B1Bi 24 (20%) 66 (22%) <0.0001t
AiA1 BIB2 53 (45%) 156 (51%)
AiA1 B2B2 17(15%) 67 (22%)
AIA2 BiB1 10(9%) 9 (3%)
AIA2 BIB2 9 (8%) 1 (0.3%)
A2A2 BIB31 4 (3%) 7 (2%)
Significant atp < 0.05.









Table 5-4. Univariate analysis of the individual animal odds of paratuberculosis infection among
dairy and beef cattle in Florida.


Odds
Variable Type ratio
SNP1 Ordinal# 2.32t
SNP2 Ordinal## 1.30
SNP1 Class A2A2vs A1A1 1.76
A1A2vs.A1A1 5.87t
SNP2 Class B2B2vs B1iB 0.55
BiB2 vs. B1B1 0.83
Breed Class## BAvsH 2.67t
JvsH 0.32t
Herd Class 1 vs 5 0.90
2 vs 5 2.32t
3 vs 5 0.70
4 vs 5 0.28t
Age Ordinal"""" 1.28
A# Ai(0); AiA2(1); A2A2(2). BBi(0); B1B2(1)
H: Holstein (Herds 1,2,5); J: Jersey (Herd 4). ####
Significant atp < 0.05


95% Confidence
interval P value
1.41 3.83 0.0009
0.56- 1.05 0.10
0.51-6.17 0.37
2.63 13.0 <0.0001
0.28- 1.07 0.08
0.51- 1.36 0.47
1.59 4.47 0.0002
0.12-0.98 0.02
0.44- 1.84 0.77
1.30-4.13 0.004
0.38- 1.27 0.24
0.10-0.77 0.01
0.88- 1.86 0.18
; B2B2(2). ### BA: Brahman x Angus (Herd 2);
Age ranges: Low (0); Medium (1); High (2). ?









Table 5-5. Multivariate analysis of the individual animal odds of paratuberculosis infection
among dairy and beef cattle in Florida.
Variable Type Odds ratio 95% Confidence interval P value
SNP1 Class A2A2vs A1A1 0.97 0.24 -3.90 0.97
AlA2 vs. A1A1 3.357 1.25 -9.01 0.01
Breed Class BAvs H 1.65 0.81 -3.38 0.17
Jvs H 0.327 0.12 -0.84 0.02
Age Ordinal### 1.14 0.76 1.71 0.51
SAAi(0); AIA2(1); A2A2(2). BA: Brahman x Angus; H: Holstein; J: Jersey. Age ranges:
Low (0); Medium (1); High (2). t Significant atp < 0.05.






























Figure 5-1. Beef cattle population. A-D) Series
herd under analysis (courtesy of Dr.


of individuals from the Brahman-Angus cow-calf
Owen Rae).


* .fflflIf


Figure 5-2. Dairy cattle population A-B) Series of individuals from the UF dairy research unit
under analysis.









CHAPTER 6
ANALYSIS OF THE ASSOCIATION BETWEEN THREE CANDIDATE GENES (BOIFNG,
TLR4, SLC11A1) AND PARATUBERCULOSIS INFECTION IN CATTLE

Summary

Paratuberculosis represents a major problem in the world dairy and beef industry and at

the present is considered a potential zoonosis. The disease is caused by Mycobacterium avium

subsp. paratuberculosis, and susceptibility to infection is suspected to have a genetic component.

The objective of this candidate gene case-control study was to characterize the distribution of

polymorphisms in three candidate genes related to the immune function; BolFNG, TLR4, and

SLC11A1 genes and test their association with paratuberculosis infection in a cattle population.

The statistical analysis demonstrated significant differences in allelic frequencies between cases

and controls for BolFNG SNP12781 (p = 0.006) and SLC11A1 microsatellites, indicating a

significant association between infection and variant alleles. In the analysis of genotypes, a

significant association was also found between infection status and BolFNG SNP12781 (p =

0.03) and SLC11A1-275-279-281 microsatellites (p = 0.04, p = 0.018, andp = 0.001,

respectively). However, when variables breed and age were included in the multivariate logistic

regression analysis, the statistical significance of polymorphisms in the odds of infection

disappeared, leaving in question the role of these candidate genes in host susceptibility to

paratuberculosis.

Introduction

Paratuberculosis is an economically significant, chronic, infectious disease of ruminants

caused by Mycobacterium avium subsp. paratuberculosis, and characterized by progressive

weight loss and a nonresponsive, persistent or intermittent diarrhea (Chiodini et al., 1984).

Genetic factors have been associated with differences in host susceptibility to bovine

paratuberculosis, and estimations indicate a range of moderate values for heritability of infection









(Koets et al., 2000; National Research Council, 2003; Mortensen et al 2004, Gonda et al 2006).

Research has also been aimed at detecting associations between susceptibility differences and

polymorphisms at candidate genes with no definite results (Hinger et al., 2007; Taylor et al.,

2006; Gonda et al., 2005, 2007).

Interferons constitute a multi-gene family of inducible cytokines. A member of this group,

interferon gamma (IFN-g), plays a crucial role in the innate host response to intracellular

bacteria, including mycobacteria (Huang et al., 1993; Shtrichman et al., 2001). Release of IFN-g

after the initial MAP entry into the host, as part of a protective type 1-like T-cell response, has

been claimed as a key factor in the control of infection and disease manifestation (Coussens,

2004; Coussens et al., 2004a).

Toll-like receptors (TLR) are a family of trans-membrane structures capable of recognizing

several classes of pathogens and responsible for coordination of appropriate innate and adaptive

immune responses (Wang et al., 2002; Kiyoshi et al., 2003, Quesniaux et al., 2004). One member

of this family, TLR4 has been implicated in the recognition of mycobacterial antigens

(Quesniaux et al., 2004; Yadav and Schorey; 2006, Weiss et al., 2008) mediating cytokine

production and stimulation of host defense (Ferwerda et al., 2007).

The SLC11A1 solutee carrier family 11 member 1) gene (coding for natural resistance-

associated macrophage protein 1, NRAMP1) is associated with natural resistance against

intracellular pathogens as Mycobacterium sp., Salmonella sp., and Leishmania in the mouse, and

plays an important role in innate immunity, preventing bacterial growth in macrophages during

the initial stages of infection (Paixao et al., 2007). The role of polymorphisms within the (GT)n

microsatellite of the SLC11A1 gene in natural resistance against Brucella abortus in cattle is

controversial (Feng et al., 1996; Paixao et al., 2007) and two studies reported possible









associations of particular SLC11A1 alleles with susceptibility or resistance to Johne's disease in

sheep (Reddacliff et al., 2005) and with lesion progression in affected cattle (Juste et al., 2005).

The critical function ofBolFNG, TLR4 and SLC11A1 genes in the coordination of

immunity against bacteria suggest a potential involvement of these candidate genes in the

variation in bovine paratuberculosis susceptibility.

The central hypothesis of this study was that different arrangements of particular alleles in

three candidate genes would predominate in case compared to control populations, suggesting a

role in susceptibility to infection. The objective of this candidate gene case-control study was to

characterize the distribution of polymorphisms in three candidate genes; BolFNG, TLR4, and

SLC11A1 genes and test their association with paratuberculosis infection in cattle.

Material and Methods

Study Population

The same population of cattle presented in Chapter 5 was considered in this study. Briefly,

431 adult cows, consisting of 299 Holstein, 50 Jersey and 82 Brahman-Angus crosses were

included in the analysis. Animals were recruited from three Holstein and one Jersey dairy herds,

and one Brahman-Angus cow-calf herd near Gainesville, Florida, USA.

A case-control design was used based on the infection status of the animals following

multiple tests to reduce misclassification of individuals. MAP infection was determined by

parallel interpretation of five diagnostic tests (serum ELISA, milk PCR, blood PCR, fecal PCR

and fecal culture) or by necropsy examination (gross pathology, histopathology and PCR on

tissues). In determining the case-control sub-populations, a case was defined as an animal being

positive for any of the tests, considered in parallel, and a control was defined as an individual

negative to all the tests that it was subjected to. As a result, the final population consisted of 126

cases and 305 controls.









Diagnosis

Diagnostic procedures were performed as reported in chapter 5.

Genotyping

DNA extraction: DNA from the study population was extracted from whole blood or

tissues using the QIAamp DNA Blood Mini Kit (Qiagen Inc., CA, USA), according to the

manufacturer's directions and stored at -200C before use.

Allele determination

Bovine IFNG and TLR4 genes

Two previously reported single nucleotide polymorphisms (designated here as SNP1 and

SNP2) within the bovine IFNG gene were tested (Schmidt et al., 2002). The SNP1 [2781, G/T

(G134V)] is situated in the coding region of exon 1, position 134 ofBolFNG cDNA, and causes

an amino acid change from glycine to valine in the signal peptide of the BoIFN pre-protein. The

SNP2 [6811 G/A] is located in the coding region of exon 4 (Schmidt et al., 2002).

Three previously reported single nucleotide polymorphisms (named here as SNP3, SNP4,

and SNP5) within the bovine TLR4 gene were tested (White et al., 2003). The SNP3 [1040, C/A

(A347E)] is responsible for an amino acid substitution (alanine to glutamic acid) located in the

extracellular domain of the protein (White et al., 2003). The SNP4 [1142 A/G (K381R)] is

responsible for an amino acid substitution (lycine to arginine) situated in the extracellular

domain. The SNP5 [2021 C/T (T674I)] is also responsible for an amino acid substitution

threoninee to isoleucine) situated in the transmembrane/cytoplasmic domain of the receptor

(White et al., 2003).

The PCR and sequencing primers used for the BolFNG exoni SNP12781G/T were;

Forward: 5'- CGATTTCAACTACTCCGGCCTAAC -3'; Reverse:

5'-Biotin-GGCCATAAGAACCAGAAAAACCC -3'; Forward sequencing primers:









5'-TCTTAGCTTTACTGCTCTGT -3'. The sequence to analyze for BoIFNG exoni

SNP12781G/T was: GG/TGCTTTT GGGTTTTTCT.

The PCR and sequencing primers used for the BolFNG exon 4 SNP26811 G/A were;

Forward: 5'- Biotin-GATCCAGCGCAAAGCCATA -3'; Reverse:

5'-TCTCTTCCGCTTTCTGAGGTTAG -3'; Reverse sequencing primers:

5'-GCTTTCTGAGGTTAGATTTT -3'. The sequence to analyze for BolFNG exon 4 SNP26811

G/A was: GGC/TGACAG GTCATTCATC.

The PCR and sequencing primers used for the bovine TLR4 cSNPs 1040C/A, and 1142

A/G were; Forward: 5'-GGATAGCGTACTTGGACAAA-3'; Reverse: 5'-Biotin-

CCCAAAATCAGTGTGAGAACAGC-3'; Forward sequencing primers for SNP31040C/A:

5'-TGACTTTGACAAGTTTCC-3', and Forward sequencing primers for SNP41142 A/G:

5'-AAGCCTTCAGTATCTAGATC-3'. The sequence to analyze for SNP31040C/A, and

SNP41142 A/G were TGC/AATTGA AGCTCAGTTC and TCAA/GAAGA AATCACT,

respectively.

The PCR conditions for pyrosequencing were; 95 C for 2 min, 45 cycles consisting of,

denaturation at 94 C for 30 s, annealing at 56 C for 30 s (for BolFNG exon 4 SNP26811 G/A

and bovine TLR4 cSNPs 1040 C/A and 1142 A/G, and at 58C for 30 s (for BolFNG exoni

SNP12781G/T), and extension at 72 C for 1 min, followed by final extension at 72 C for 7 min.

The PCR products were processed and prepared for genotyping.

Genotyping was performed in the laboratories of the University of Florida Center for

Pharmacogenomics. Genotypes were determined by either pyrosequencing (Biotage, Uppsala,

Sweden) or by use of the fluorescence-based TaqMan platform (Applied Biosystems, Foster

City, USA).









Genotyping for, BoIFNG exoni SNP12781G/T; BoIFNG exon4 SNP26811 G/A; bovine

TLR4 cSNPs 1040C/A; and 1142 A/G was performed by pyrosequencing and according to the

published protocol (Langaee and Ronaghi, 2005).

The TLR4 gene SNP52021 C/T was genotyped using TaqMan allelic discrimination

genotyping method (Applied Biosystems, Foster City, USA), sing the Applied Biosystems 7900

HT SNP genotyping platform. Five [tL reactions in 384-well plate were prepared using

Eppendorf epMotion 5070 (EppendorfNorth America, Inc., Westbury, NY, USA), and Packard

Multi Probe II HT Systems (PerkinElmer Las, Inc., Shelton, CT, USA), liquid handling/sample

processing robotics and the assays were performed and analyzed according to the manufacture's

recommendations.

Microsatellite analysis for SLC11A1 gene

A region corresponding to 275 bp, targeting the 3'UTR of bovine SLC11A1 gene

(GenBank Acc. No. U12862) was PCR amplified using primer pairs

(N15'-GCCACGGGTGGAATGAGT-3', N25'- TGAGCTAGGAAATAGCAGG-3'). This

region contains different numbers of the microsatellite repeat (GT). Polymerase chain reaction

(PCR) was carried out in a final volume of 2 pl reaction mixture, PCR assay buffer [10 mM

Tris-HCl (pH 8.8 at 250C), 50 mM KC1, 0.8% Nonidet P40], 2.0 mM of Mg2+, 200 mM dNTPs

except dATP, 160 mM of dATP, 0.25 ml of a35SdATP, 10 pM of each primer and 2.0 U of Taq

DNA polymerase.

PCR conditions were: initial denaturation consisting in three cycles of 940C for 3 m, 55C

for 20 s, and 720C for 10 s; followed by 31 cycles of 940C for Im, 500C for 40s, and 720C for

20s, and a final extension of 720C for 5 m.

In order to detect the length variations of (GT)n repeats, amplicons were subjected to

analysis in the University of Florida Interdisciplinary Center for Biotechnology Research, using









a DNA sequence analyzer from Amersham (MegaBACE1000 and 4500), combining 1 il of PCR

product sample with 5.86 pl of 0.1% Tween and 0.14ul of ET Rox550 size standard. Data were

analyzed using GeneMarker v 1.4 (SoftGenetics, LLC, State college, PA 16803)

Statistical Analysis

Genotype frequencies were tested for departure from Hardy-Weinberg equilibrium (HWE)

by using Fisher Exact Test and Chi-square test. Both tests were also used to check whether there

was any non-random association between allele or genotype frequencies versus infection status

of the cows. The analysis was performed for all the polymorphisms in each of the study genes.

Three genotypes per polymorphism were considered in the analysis for BolFNG and TLR4

[major homozygous (0); heterozygous (1); minor homozygous (2)]. Given that SLC11A1 gene

presented more than two alleles, three categories for each of the alleles were set for the genotype

analysis [non allele carrier homozygous (0); heterozygous (1); homozygous for the particular

allele (2)]

The univariable analysis for logistic regression considered the infection status as

categorical response variable (yes/no), and polymorphism (SNPs, microsatellite), breed, herd and

age were included as possible explanatory variables. Multivariable logistic regression models

were proposed to estimate the odds of infection for "susceptibility allele" carriers compared to

non allele carriers, controlling for possible confounding variables. The models considered the

infection status as response variable, and included genotypes (based on alleles provided by the

analyzed polymorphisms), breed, herd and age as explanatory variables. Genotypes were

considered as ordinal variables (as previously described; 0, 1, and 2) and as class variables with

the major homozygous genotype deemed as baseline. Breed and herd were considered as class

variables, and age (months) was considered as an ordinal variable with three levels demarcated

by the mean + one standard deviation.









The complete model was tested by backward elimination procedure to determine the

variables to be included in the final model based on the deviance value.

Data were analyzed using the SAS statistical package for Windows (SAS Systems for

Windows Version 9.00, SAS Institute Inc. Cary, NC, USA) using the PROC FREQ, PROC

GENMOD and the CHISQ EXACT procedure. Values ofP < 0.05 were considered significant

for all tests.

Results

The ratio of cases to controls was 1:2.4 (126 cases vs. 305 controls) with an average age

for cases and controls of 64 and 65 months, respectively (p = 0.7). From a total of 431

individuals submitted for the genotyping analysis, 2, 7, 1, 0, 15 and 19 failed to provide a result

for SNP1, SNP2, SNP3, SNP4, SNP5, and SLC11A1 microsatellite, respectively.

Bovine IFNG Gene

Frequencies for the major allele in SNP1 and SNP2 were 0.95 and 0.66, respectively.

Values for the coefficient of linkage disequilibrium (LD), normalized LD, and correlation

between the two SNPs were -0.015, 0.02, and -0.15, respectively, and Chi-square test indicated

that SNPi and SNP2 were in linkage disequilibrium (p < 0.001). The genotype frequencies of

SNP2 did not deviate from HWE; however the distributions of SNPi did not fit HWE in our

control population.

The statistical analysis resulted in significant differences in allelic frequencies between

cases and controls for SNPi (p = 0.006) indicating an association between infection and variant

allele. The frequency for the variant allele was 7.98% and 3.54% in cases and controls,

respectively. However, no association was found between SNP2 and infection status (p = 0.63).









Significant differences in genotype frequencies between the 2 groups of individuals testing

positive or negative for paratuberculosis infection were found only for BolFNG2781G/T

polymorphism (SNP1) (p = 0.036, Table 6-1).

Estimated ORs for the univariable logistic regression models are presented in Table 6-2.

The analysis indicated significant ORs for SNP1 when considered as ordinal (p = 0.0193), and

class variable [genotype A1A2 referred to the major genotype A1A1 (p < 0.03)]. However, when

SNP1 was included in the final model for multivariable logistic regression, controlling for breed

and age (Table 6-4) the significance for this effect was lost (p = 0.97 andp = 0.85 for SNP1

when considered as ordinal or class variable, respectively).

Toll-Like Receptor 4 Gene

Frequencies for the major allele in SNP3, SNP4 and SNP5 were 0.98, 0.98, and 0.86,

respectively. Values for the coefficient of linkage disequilibrium (LD), normalized LD, and

correlation between the SNP3 and SNP5 were -0.002, 0.003, and -0.849, respectively, and Chi-

square test indicated that SNP3 and SNP5 were in linkage disequilibrium (p = 0.03). The

genotype frequencies of SNP4 and SNP5 did not deviate from HWE; however the distributions of

SNP3 did not fit HWE in our control population.

The statistical analysis resulted in no significant differences in allelic frequencies between

cases and controls for SNP3, SNP4, and SNP5 (p = 0.07,p = 0.06, andp = 0.7, respectively).

No significant differences in genotype frequencies between the cases and controls were

found in the three TLR4 polymorphisms under analysis (Table 6-1). The univariable logistic

regression analysis did not result in significant values for any of the polymorphisms analyzed

(Table 6-2).









Solute Carrier Family 11 Member 1 Gene

The microsatellite analysis resulted in five different alleles (sizes 273bp, 275bp, 277bp,

279bp, and 281bp) with frequencies 0.074, 0.567, 0.288, 0.044, and 0.027 respectively. None of

the genotype frequencies fit HWE in our control population.

The statistical analysis resulted in significant differences in allelic frequencies between

cases and controls for SLC11A1 microsatellite (p = 0.002) indicating an association between

infection and SLC11A1 alleles.

Significant differences between genotype frequencies between the case and control groups

were found for SLC11A1-275, 279 and 281 microsatellite alleles (p = 0.04, p = 0.018, and

p = 0.0017, respectively, Table 6-1).

Estimated ORs for the univariable logistic regression models are presented in Table 6-3.

The analysis indicated significant ORs for SLC11A1-275, 279, and 281 when considered as class

variables [genotype Allele275,279,281/* referred to the major genotype */* (p = 0.027, p = 0.007,

andp = 0.004, respectively)]. However, when SLC11A1-275, 279, and 281 microsatellite alleles

were included in the final model for multivariable logistic regression the significance for these

effects was lost (Tables 6-5 to 6-7). The final models included genotype (class) as an explanatory

variable of interest, controlling for breed and age.

Discussion

Numerous studies have reported a role for genetics in determining differences on

susceptibility and resistance to mycobacterial infection including bovine paratuberculosis

(Cetinkaya et al., 1997; Abel and Casanova, 2000; Koets et al., 2000; Mortensen et al., 2004;

Roussel et al., 2005; Elzo et al., 2006; Gonda et al., 2006). Some authors have focused on the

participation of candidate host genes with discordant results (Gonda et al., 2005, 2007; Taylor et

al., 2006; Hinger et al., 2007).









In our study allele frequencies for SNP1 (IFNG gene) and for (GT)n microsatellite of the

SLC11A1 gene were significantly different for our population of cases and controls (p = 0.006

andp = 0.002, respectively), indicating a potential association between infection status and the

referred polymorphisms. This finding is in agreement with the results presented by Estonba et al.

(2005), where one (GT)n microsatellite allele of the SLC11A1 gene had a frequency significantly

higher in the ELISA seronegative (0.22) than in the seropositive (0.07) group. However,

converse results were presented by Hinger et al. (2007) who did not find a significant association

between paratuberculosis infection status (based on serum ELISA) and both SLC11A1, and

INFG gene polymorphisms.

Our results in the univariate logistic regression indicated a significant effect on the

individual animal odds of paratuberculosis infection for BolFNG SNP1 (expressed as ordinal and

class variable) and for SLC11A1 275-allele (class variable), 279-allele (class variable), and

281-allele (ordinal and class variable).

In the analysis, variables herd and breed were also significant, indicating differences in

prevalence in the herds and, consequently, in the breeds included in this study. However, due to

the case-control nature of the design, conclusions can not be derived relative to differences in

breed susceptibility and, consequently, the analysis for the variables of interest polymorphismss)

must control for these possible confounders.

The effect of the previously significant polymorphisms appears to be clarified in the

multivariate analysis. After the backward elimination procedure, when variables breed and age

are incorporated in the final model, the significant effect ofBolFNG gene and SLC11A1 gene

polymorphisms (as genotypes) was lost (P >0.05). Only one genotype (the heterozygous for

SLC11A1-275) indicated a tendency to significance with a P value of 0.09.









One of the potential limitations in a case control study is the misclassification of

individuals in these categories. This is especially important for paratuberculosis given the lack of

accurate in vivo diagnostic tests (Chiodini et al., 1984). In this study, parallel interpretation of

multiple diagnostic tests was used as a mean to improve overall sensitivity. The procedure

considered five highly specific diagnostic tests to avoid a potential increase of non-specific

results (false positives), producing a more clearly determined subpopulations of cases and

controls.

Some of the polymorphisms under study failed in fitting the assumption of HWE, and this

could be explained by the fact that domestic populations are likely to be under inbreeding

conditions and suffer assortative mating. This constitutes a limitation for this study; however, the

possibility of population stratification is low as indicated by the absence of association with

paratuberculosis infection in other unlinked markers analyzed concurrently. This concern is also

reduced, given that cases and controls were matched from the same subpopulations.

Although some of the analyses in this study suggest a potential connection between

polymorphisms in BolFNG and SLC]]AI genes and paratuberculosis, subsequent examination

controlling for potential confounding dismissed this association. Further analysis including a

larger population and different polymorphisms in these two genes is warranted.

It is concluded that the present study could not demonstrate a definitive association

between paratuberculosis infection in cattle and the proposed candidate genes (IFNG, TLR4, and

SLC11AI genes).









Table 6-1. Frequency of cases per genotype and significance for the association between
genotype and infection status (BolFNG, TLR4 and SLC11A1 genes).
Polymorphism Genotype Infected (%) Total (n) P value
IFNG2781G/T (SNP1) GG 26.1 394 0.0361
GT 44.8 29
TT 50.0 6
IFNG6811G/A (SNP2) GG 27.6 192 0.87
GA 27.0 178
AA 24.1 54
TLR4 1040 C/A (SNP3) CC 27.0 415 0.18
CA 46.2 13
AA 50.0 2
TLR4 1142 A/G (SNP4) AA 27.3 422 0.07
AG 55.6 9
GG 0.0 0
TLR4 2021 C/T (SNP5) CC 29.5 315 0.43
CT 22.8 92
TT 22.2 9
SLC11A1-273 */* 28.7 359 0.19
273/* 31.1 45
273/273 0.0 8
SLC11A1-275 */* 27.7 141 0.041
275/* 40.0 75
275/275 24.5 196
SLCllA1-277 */* 28.5 284 0.86
277/* 33.3 18
277/277 27.3 110
SLCllA1-279 */* 27.3 388 0.0181
279/* 66.7 12
279/279 25.0 12
SLCIIAI-281 */* 26.7 393 0.00171
281/* 62.5 16
281/281 66.7 3
#Chi square and Fisher's Exact Test. T Significant atp < 0.05.









Table 6-2. Bovine IFNG and TLR4 genes: Univariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida.
Odds 95% Confidence
Variable Type ratio interval P value
BolFNG
SNP1 Ordinal# 1.98 1.11 -3.51 0.01931
SNP2 Ordinal# 0.93 0.68 1.28 0.645
SNP1 Class A2A2 vs A1A 2.85 0.56- 14.1 0.207
A1A2 vs. A1A1 2.29 1.06 4.90 0.031
SNP2 Class B2B2vsBiBg 0.83 0.41 1.67 0.6
B1B2 vs. B1B1 0.96 0.61 1.53 0.89
TLR4
SNP3 Ordinal# 2.03 0.83 -4.92 0.11
SNP4 Ordinal# 3.33 0.88 12.6 0.07
SNP5 Ordinal# 0.73 0.46 1.17 0.2
SNP3 Class A2A2 vs A1A 2.69 0.16 43.5 0.48
A1A2 vs. A1A1 2.31 0.76 7.02 0.13
SNP4 Class B2B2vsBiB1 n.a. n.a. n.a.
BiB2 vs. BiB1 3.33 0.88- 12.6 0.07
SNP5 Class C2C2vsC1C1 0.68 0.13 -3.34 0.63
C1C2 vs. C1C1 0.7 0.41 1.21 0.2
Other
Breed Class# BAvs H 2.49 1.49 -4.12 0.00041
JvsH 0.32 0.12-0.84 0.021
Herd Class 1vs 5 3.28 1.09 9.85 0.031
2vs 5 7.76 2.79-21.5 <0.001t
3 vs 5 2.44 0.86 6.88 0.09
4vs5 3.59 1.33 -9.67 0.011
Age Ordinal### 1.26 0.87-1.84 0.2
non allele carrier homozygous (0); heterozygous (1); homozygous (2). BA: Brahman x
Angus; H: Holstein; J: Jersey. Age range: Low (0); Medium (1); High (2). ? Significant atp <
0.05. n.a.: Not available.










Table 6-3. Univariate analysis of the individual animal odds of paratuberculosis infection among


dairy and beef cattle in Florida (SLC11A1


Variable
SLCl1A1-273
SLC1]A1- 275
SLCl1A1-277
SLCl1A1-279
SLC11A1-281
SLCl1A1-273

SLC1]A1- 275

SLC11A1-277

SLCl1A1-279

SLC11A1-281


Type
Ordinal
Ordinal#
Ordinal#
Ordinal#
Ordinal#


gene).
Odds
ratio
0.77
0.89
0.97
1.35
3.56


Class 273/273 vs */* n.a.
273/* vs. */* 1.12
Class 275/275 vs */* 0.85
275/* vs. */* 2.01
Class 277/277 vs */* 0.93
277/* vs. */* 1.25
Class 279/279 vs */* 0.88
279/* vs. */* 5.31
Class 281/281 vs */* 5.48
281/* vs. */* 4.54


#non allele carrier homozygous (0); heterozygous
n.a.: Not available.


95% Confidence
interval
0.44- 1.36
0.71 1.13
0.76- 1.24
0.79 2.3
1.52-8.24
n.a.
0.57-2.18
0.52- 1.36
1.08-3.76
0.57- 1.53
0.45-3.44
0.23 -3.32
1.56- 17.9
0.49 60.9
1.62- 12.8


(1); homozygous (2). Significant at p < 0.05.


P value
0.37
0.37
0.84
0.27
0.00321
n.a.
0.73
0.49
0.0271
0.8
0.66
0.85
0.0071
0.16
0.0041









Table 6-4. Bovine IFNG: Multivariate analysis of the individual animal odds of paratuberculosis
infection among dairy and beef cattle in Florida.
Odds 95% Confidence
Variable Type ratio interval P value
SNP1 Ordinal 0.98 0.49- 1.97 0.97
SNP1 Class A2A2 vsA1A1 1.11 0.20-6.04 0.9
AlA2 vs. A1A1 0.91 0.36 2.31 0.85
Breed Class# BAvs H 2.45 1.31 -4.75 0.005t
JvsH 0.32 0.12 0.83 0.02t
Age Ordinal# 1.09 0.73- 1.62 0.66
non allele carrier homozygous (0); heterozygous (1); homozygous (2). BA: Brahman x
Angus; H: Holstein; J: Jersey. # Age range: Low (0); Medium (1); High (2). ? Significant atp <
0.05.









Table 6-5. Allele SLCllAl-275: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida.
95% Confidence
Variable Type Odds ratio interval P value
SLCllA1-275 Class 275/275 vs*/* 0.90 0.54 -1.50 0.7
275/* vs. */* 1.73 0.91 -3.32 0.09
Breed Class# BAvs H 2.72 1.54 4.78 0.0005t
JvsH 0.34 0.13 -0.91 0.03
Age Ordinal## 1.08 0.72- 1.63 0.68
SBA: Brahman x Angus; H: Holstein; J: Jersey. Age range: Low (0); Medium (1); High (2). ?
Significant atp < 0.05.









Table 6-6. Allele SLCllA1-279: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida.
95% Confidence
Variable Type Odds ratio interval P value
SLCllA1-279 Class 279/279 vs*/* 0.38 0.09- 1.57 0.18
279/* vs. */* 2.63 0.73 -9.48 0.14
Breed Class# BAvs H 2.84 1.57 5.10 <0.001W
JvsH 0.31 0.12 -0.82 0.01O
Age Ordinal## 1.12 0.74 1.69 0.58
BA: Brahman x Angus; H: Holstein; J: Jersey. Age range: Low (0); Medium (1); High (2). ?
Significant atp < 0.05.









Table 6-7. Allele SLC11A1-281: Multivariate analysis of the individual animal odds of
paratuberculosis infection among dairy and beef cattle in Florida ().
95% Confidence
Variable Type Odds ratio interval P value
SLCllA]-281 Ordinal" 1.85 0.75 4.4 0.18
Breed Class"" BAvs H 2.43 1.32- 4.43 0.004O
Jvs H 0.31 0.12 0.83 0.01O
Age Ordinal ###1.08 0.72- 1.62 0.69
SLC1IA1-281 class# 281/281 vs */* 2.32 0.19-27.1 0.5
281/* vs. */* 2.07 0.67 6.42 0.2
Breed Class# BAvs H 2.39 1.29 4.39 0.0051
J vs H 0.31 0.12 0.82 0.01O
Age Ordinal^## 1.08 0.72- 1.63 0.68
non allele carrier homozygous (0); heterozygous (1); homozygous (2). BA: Brahman x
Angus; H: Holstein; J: Jersey. ## Age range: Low (0); Medium (1); High (2). ? Significant atp <
0.05.









LIST OF REFERENCES


Abel, B., Thieblemont, N., Quesniaux, V.J., Brown, N., Mpagi, J., Miyake, K., Bihl, F., Ryffel,
B., 2002. Toll-like receptor 4 expression is required to control chronic Mycobacterium
tuberculosis infection in mice. J. Immunol. 169, 3155-3162.

Abel, L., Casanova, J.L., 2000. Genetic predisposition to clinical tuberculosis: bridging the gap
between simple and complex inheritance. Am. J. Hum. Genet. 67, 274-277.

Ables, G.P., Nishibori, M., Kanemaki, M., Watanabe, T., 2002. Sequence analysis of the
NRAMP1 genes from different bovine and buffalo breeds. J. Vet. Med. Sci. 64, 1081-1083.

Abubakar, I., Myhill, D., Aliyu, S.H., Hunter, P.R., 2008. Detection of Mycobacterium avium
subspecies paratuberculosis from patients with Crohn's disease using nucleic acid-based
techniques: A systematic review and meta-analysis. Inflamm. Bowel Dis. 14, 401-410.

Adams, L.G., Templeton, J.W., 1998. Genetic resistance to bacterial diseases of animals.
Rev.-Off. Int. Epiz. 17, 200-219

Adaska, J.M., Anderson, R.J., 2003. Seroprevalence of Johne's disease infection in dairy cattle in
California, USA. Prev. Vet. Med. 60, 225-261.

Aly, S.S., Thurmond, M.C., 2005. Evaluation of Mycobacterium avium subsp paratuberculosis
infection of dairy cows attributable to infection status of the dam. J. Am. Vet. Med. Assoc.
227, 450-454.

Anderson, J.L., Meece, J.K., Koziczkowski, J.J., Clark, D.L. Jr., Radcliff, R.P., Nolden, C.A.,
Samuel, M.D., Ellingson, J.L., 2007. Mycobacterium avium subsp. paratuberculosis in
scavenging mammals in Wisconsin. J. Wildl. Dis. 43, 302-308.

Antognoli, M.C., Garry, F.B., Hirst, H.L., Lombard, J.E., Dennis, M.M., Gould, D.H., Salman,
M.D., 2008. Characterization ofMycobacterium avium subspecies paratuberculosis
disseminated infection in dairy cattle and its association with ante mortem test results. Vet.
Microbiol., 127, 300-308.

Arko-Mensah, J., Julian, E., Singh, M., Fernandez, C., 2007. TLR2 but not TLR4 signalling is
critically involved in the inhibition of IFN-y-induced killing of mycobacteria by murine
macrophages. Scand. J. Immunol. 65, 148-157.

Autschbach, F., Eisold, S., Hinz, U., Zinser, S., Linnebacher, M., Giese, T., Loffler, T., Buchler,
M.W., Schmidt, J., 2005. High prevalence of Mycobacterium avium subspecies
paratuberculosis IS900 DNA in gut tissues from individual with Crohn's disease. Gut. 54,
944-949.

Awomoyi, A.A., Marchant, A., Howson, J.M., McAdam, K.P., Blackwell, J.M., Newport, M.J.,
2002. Interleukin-10, polymorphism in SLC11Al (formerly NRAMP1), and susceptibility
to tuberculosis. J. Infect. Dis. 186, 1808-1814.









Ayele, W.Y., Svastova, P., Roubal, P., Bartos, M., Pavlik, I., 2005. Mycobacterium avium
subspecies paratuberculosis cultured from locally & commercially pasteurized cow's milk
in the Czech Republic. Appl. Environ. Microbiol. 71, 1210-1214.

Bannantine, J.P., Hansen, J.K., Paustian, M.L., Amonsin, A., Li, L.L., Stabel, J.R., Kapur, V.,
2004. Expression and immunogenicity of proteins encoded by sequences specific to
Mycobacterium avium subsp. paratuberculosis. J. Clin. Microbiol. 42, 106-114.

Baptista, F.M., Nielsen, S.S., Toft, N., 2008. Association between the presence of antibodies to
Mycobacterium avium subspecies paratuberculosis and somatic cell count. J. Dairy Sci.
91:109-118.

Barrington, G.M., Gay, J.M., Eriks, I.S., Davis, W.C., Evermann, J.F., Emerson, C., O'Rourke,
J.L., Hamilton, M.J., Bradway, D.S., 2003. Temporal patterns of diagnostic results in serial
samples from cattle with advanced paratuberculosis infection. J. Vet. Diagn. Invest. 15,
195-200.

Barthel, R., Piedrahita, J.A., McMurray, D.N., Payeur, J., Baca, D., Suarez Guemes, F.,
Perumaalla, V.S., Ficht, T.A., Templeton, J.W., Adams, L.G., 2000. Pathologic findings
and association ofMycobacterium bovis infection with the bovine NRAMP1 gene in cattle
from herds with naturally occurring tuberculosis. Am. J. Vet. Res. 61, 1140-1144.

Bartos, M., Hlozek, P., Svastova, P., Dvorska, L., Bull, T., Matlova, L., Parmova, I., Kuhn, I.,
Stubbs, J., Moravkova, M., Kintr, J., Beran, V., Melicharek, I., Ocepek, M., Pavlik, I.,
2006. Identification of members ofMycobacterium avium species by Accu-Probes,
serotyping, and single IS900, IS901, IS1245 and IS901-flanking region PCR with internal
standards. J. Microbiol. Methods 64, 333-345.

Bassey, E.O., Collins, M.T., 1997. Study of T-lymphocyte subsets of healthy and
Mycobacterium avium subsp. paratuberculosis-infected cattle. Infect. Immun. 65,
4869-4872.

Beard, P.M., Daniels, M.J., Henderson, D., Pirie, A., Rudge, K., Buxton, D., Rhind, S., Greig,
A., Hutchings, M.R. Mckendrick, I., Stevenson, K., Sharp, J.M., 2001. Paratuberculosis
infection of non-ruminant wildlife in Scotland. J. Clin. Microbiol. 39, 1517-1521.

Bech-Nielsen, S., Jorgensen, J.B., Ahrens, P., Feld, N.C., 1992. Diagnostic accuracy of a
Mycobacterium phlei-absorbed serum enzime-linked immunosorbent assay for diagnosis
of bovine paratuberculosis in dairy cows. J. Clin. Microbiol. 30, 613-618.

Behr, M.A., Schurr, E., 2006. Mycobacteria in Crohn's disease: a persistent hypothesis. Inflamm.
Bowel. Dis. 12, 1000-1004.

Behr, M.A., Semret, M., Poon, A., Schurr, E., 2004. Crohn's disease, mycobacteria, and NOD2.
Lancet Infect. Dis. 4, 136-137.

Bellamy, R., 2003. Susceptibility to mycobacterial infections: the importance of host genetics.
Genes Immun. 4, 4-11.









Bellamy, R., Hill, A.V., 1998. Genetic susceptibility to mycobacteria and other infectious
pathogens in humans. Curr. Opin. Immunol. 10, 483-487.

Benedictus, G., Dijkhuizen, A.A., Stelwagen, J., 1987. Economic losses due to paratuberculosis
in dairy cattle. Vet. Rec. 121, 142-146.

Benedictus, G., Kalis, C.J.H., 2003. Paratuberculosis: eradication, control and diagnostic
methods. Act. Vet. Scan. 44, 231-241.

Bennett, R., Christiansen, K., Clifton-Hadley, R., 1999. Preliminary estimates of the direct costs
associated with endemic diseases of livestock in Great Britain. Prev. Vet. Med. 39,
155-171.

Bernstein, C.N., Blanchard, J.F., Rawsthorne, P., Collins, M.T., 2004. Population-based case
control study of seroprevalence ofMycobacterium paratuberculosis in patients with
Crohn's disease and ulcerative colitis. J. Clin. Microbiol. 42, 1129-1135.

Bernstein, C.N., Wang, M., Sargent, M.H., Brant, S.R., Collins, M.T., 2007. Testing the
interaction between NOD-2 status and serological response to Mycobacterium
paratuberculosis in cases of inflammatory bowel disease. J. Clin. Microbiol. 45, 968-971.

Bhatt K, Salgame P., 2007. Host innate immune response to Mycobacterium tuberculosis. J.
Clin. Immunol. 27, 347-362.

Bhide, M., Chakurkar, E., Tkacikova, L., Barbuddhe, S., Novak, M., Mikula, I., 2006.
IS900-PCR-based detection and characterization of Mycobacterium avium subsp.
paratuberculosis from buffy coat of cattle and sheep. Vet. Microbiol. 112, 33-41.

Biet, F., Boschiroli, M.L., Thorel, M.F., Guilloteau, L.A., 2005. Zoonotic aspects of
Mycobacterium bovis and Mycobacterium avium-intracellulare complex (MAC). Vet. Res.
36, 411-436.

Billman-Jacobe, H., Carrigan, M., Cockram, F., Corner, L.A., Gill, I.J., Hill, J.F., Jessep, T.,
Milner, A.R., Wood, P.R., 1992. A comparison of the interferon gamma assay with the
absorbed ELISA for the diagnosis of Johne's disease in cattle. Aust. Vet. J. 69, 25-28.

Blackwell, J.M., 2001. Genetics and genomics in infectious disease susceptibility. Trends. Mol.
Med. 7, 521-526.

Blumberg, R.S., Saubermann, L.J., Strober, W., 1999. Animal models of mucosal inflammation
and their relation to human inflammatory bowel disease. Curr. Opin. Immunol. 11, 648-
656.

Bogli-Stuber, K., Kohler, C., Seitert, G., Glanemann, B., Antognoli, M.C., Salman, M.D.,
Wittenbrink, M.M., Wittwer, M., Wassenaar, T., Jemmi, T., Bissig-Choisat, B., 2005.
Detection of Mycobacterium avium subspecies paratuberculosis in Swiss dairy cattle by
real-time PCR and culture: a comparison of the two assays. J. Appl. Microbiol. 99,
587-597.









Bonen, D.K., Cho, J.H., 2003. The genetics of inflammatory bowel disease. Gastroenterology.
124, 521-536.

Bonen, D.K., Ogura, Y., Nicolae, D.L., Inohara, N., Saab, L., Tanabe, T., Chen, F.F., Foster,
S.J., Duerr, R.H. Brant, S.R., Cho, J.H., Nufiez, G., 2003. Crohn's disease-associated
NOD2 variants share a signaling defect in response to lipopolysaccharide and
peptidoglycan. Gastroenterology. 124, 140-146.

Bottcher, J., Gangl, A., 2004: Mycobacterium avium ssp. paratuberculosis-combined serological
testing and classification of individual animals and herds. J. Vet. Med. B Infect. Dis. Vet.
Public Health. 51:443-448.

Bouma, G., Oudkerk Pool, M., Crusius, J.B., Schreuder, G.M., Hellemans, H.P., Meijer, B.U.,
Kostense, P.J., Giphart, M.J., Meuwissen, S.G., Pena, A.S., 1997. Evidence for genetic
heterogeneity in inflammatory bowel disease (IBD); HLA genes in the predisposition to
suffer from ulcerative colitis (UC) and Crohn's disease (CD). Clin. Exp. Immunol. 109,
175-179.

Bouma, G., Strober, W., 2003. The immunological and genetic basis of inflammatory bowel
disease. Nat. Rev. Immunol. 3, 521-533.

Brady, C., O'Grady, D., O'Meara, F., Egan, J., Basset, H., 2008. Relationships between clinical
signs, pathological changes and tissue distribution of Mycobacterium avium subspecies
paratuberculosis in 21 cows from herds affected by Johne's disease. Vet. Rec. 162,
147-152.

Branger, J., Leemans, J.C., Florquin, S., Weijer, S., Speelman, P., Van Der Poll, T., 2004. Toll-
like receptor 4 plays a protective role in pulmonary tuberculosis in mice. Int. Immunol. 16,
509-516.

Braun, R.K., Buergelt, C.D., Littell, R.C., Linda, S.B., Simpson, J.R., 1990. Use of an enzyme-
linked immunosorbent assay to estimate prevalence of paratuberculosis in cattle of Florida.
J. Am. Vet. Med. Assoc. 196, 1251-1254.

Brown, W.C., Rice-Ficht, A.C., Estes, D.M., 1998. Bovine type 1 and type 2 responses. Vet.
Immunol. Immunopathol. 63, 45-55.

Browning, B.L., Huebner, C., Petermann, I., Gearry, R.B., Barclay, M.L., Shelling, A.N.,
Ferguson, L.R., 2007. Has Toll-like receptor 4 been prematurely dismissed as an
inflammatory bowel disease gene? Association study combined with meta-analysis shows
strong evidence for association. Am. J. Gastroenterol. 102, 2504-2512.

Brumbaugh, G.W., Edwards, J.F., Roussel, A.J. Jr., Thomson, T.D., 2000. Effect of monensin
sodium on histological lesions of naturally occurring bovine paratuberculosis. J. Comp.
Pathol. 123, 22-28.









Buergelt, C.D., Donovan, G.A., Williams, J.E., 2004. Identification ofMycobacterium avium
subsp paratuberculosis by polymerase chain reaction in blood and semen of a bull with
clinical paratuberculosis. Intern. J. Appl. Res. Vet. Med. 2, 130-134.

Buergelt, C.D., Duncan, J.R., 1978. Age and milk production data of cattle culled from a dairy
herd with paratuberculosis. J. Am. Vet. Med. Assoc. 173, 478-480.

Buergelt, C.D., Hall, C.E., McEntee, K., Duncan, J.R., 1978. pathological evaluation of
paratuberculosis in naturally infected cattle. Vet. Pathol. 15, 196-207.

Buergelt, C.D., Hall, C.E., Merkal, R.S., Whitlock, R.H., Duncan, J.R., 1977. Lymphocyte
transformation: an aid in the diagnosis of paratuberculosis. Am. J. Vet. Res. 38,
1709-1715.

Buergelt, C.D., Layton, A.W., Ginn, P.E., Taylor, M., King, J.M., Habecker, P.L., Mauldin, E.,
Whitlock, R., Rossiter, C., Collins, M.T., 2000. The pathology of spontaneous
paratuberculosis in the North American bison (Bison bison). Vet. Pathol. 37, 428-438.

Buergelt, C.D., Williams, J.E., 2003. In utero infection of pregnant cattle by Mycobacterium
avium subspecies paratuberculosis detected by nested polymerase chain reaction. Intern. J.
Appl. Res. Vet. Med. 1, 279-284.

Buergelt, C.D., Williams, J.E., 2004. Nested PCR on blood and milk for the detection of
Mycobacterium avium subsp paratuberculosis DNA in clinical and subclinical bovine
paratuberculosis. Aust. Vet. J. 82, 497-503.

Buergelt, C.D., Williams, J.E., Monif, G.R.G., 2004a. Spontaneus clinical regression of Johne's
disease in a Holstein cow. Intern. J. Appl. Res. Vet. Med. 2, 126-129.

Buergelt, C.D., Williams, J.E., Monif, G.R.G., Pinedo, P., Decker, J.H., 2006. Nested
polymerase chain reaction and prenatal detection of Mycobacterium avium subspecies
paratuberculosis (MAP) in bovine allantoic fluid and fetuses. Intern. J. Appl. Res. Vet.
Med. 4, 232-238.

Bull, T.J., Hermon-Taylor, J., Pavlik, I., El-Zaatari, F., Tizard, M., 2000. Characterization of
IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex
PCR typing. Microbiology 146, 2185-2197.

Burton, P.R., Tobin, M.D., Hopper, J.L., 2005. Key concepts in genetic epidemiology. Lancet.
366, 941-951.

Cardon, L.R., Palmer, L.J., 2003. Population stratification and spurious allelic association.
Lancet. 361, 598-604.

Carpenter T.E., Gardner, I.A., Collins, M.T., Whitlock, R.H., 2004. Effects of prevalence and
testing by enzyme-linked immunosorbent assay and fecal culture on the risk of
introduction of Mycobacterium avium subsp. paratuberculosis-infected cows into dairy
herds. J. Vet. Diagn. Invest. 16, 31-38.









Cetinkaya, B., Erdogan, H.M., Morgan, K.L., 1997. Relationship between the presence of
Johne's disease and management factors in dairy cattle in England. Prev. Vet. Med. 32,
253-266.

Chamberlin, W., Ghobrial, G., Chehtane, M., Naser, S.A., 2007. Successful treatment of a
Crohn's disease patient infected with bacteremic Mycobacterium paratuberculosis. Am J.
Gastroenterol. 102, 689-691.

Chermesh, I., Azriel, A., Alter-Koltunoff, M., Eliakim, R., Karban, A., Levi, B.Z., 2007.
Crohn's disease and SLC11A1 promoter polymorphism. Dig. Dis. Sci. 52, 1632-1635.

Chi, J., VanLeeuwen, J.A., Weersink, A., Keefe, G.P., 2002. Direct production losses and
treatment costs from bovine viral diarrhoea virus, bovine leukosis virus, Mycobacterium
avium subspecies paratuberculosis, and Neospora caninum. Prev. Vet. Med. 55, 137-153.

Chiodini, R.J., 1989. Crohn's disease and the mycobacterioses: a review and comparison of two
disease entities. Clin. Microbiol. Rev. 2, 90-117

Chiodini, R.J., Davis, W.C., 1993. The cellular immunology of bovine paratuberculosis:
immunity may be regulated by CD4+ helper and CD8+ immunoregulatory T lymphocytes
which down-regulate gamma/delta+ T-cell cytotoxicity. Microb. Pathog. 14, 355-367.

Chiodini, R.J., Van Kruiningen, H.J., 1986. The prevalence of paratuberculosis in culled New
England cattle. Cornell Vet. 76, 91-104

Chiodini, R.J., Van Kruiningen, H.J., Merkal, R.S., 1984. Ruminant paratuberculosis (Johne's
disease): the current status and future prospects. Cornell Vet. 74, 218-262.

Chiodini, R.J., Van Kruiningen, H.J., Thayer, W.R., Merkal, R.S., Coutu, J.A., 1984a. Possible
role of mycobacteria in inflammatory bowel disease. I. An unclassified Mycobacterium
species isolated from patients with Crohn's disease. Dig. Dis. Sci. 29, 1073-1079

Clayton, D., McKeigue, P.M., 2001. Epidemiological methods for studying genes and
environmental factors in complex diseases. Lancet 358, 1356-1360.

Cocito, C., Gilot, P., Coene, M., De Kesel, M., Poupart, P., Vannuffel, P., 1994.
Paratuberculosis. Clin. Microbiol. Rev. 7, 328-345

Collins, M.T., 1996. Diagnosis of paratuberculosis (Including pathology). Vet. Clin. North Am.
Food Anim. Pract. 12, 357-371.

Collins, M.T., 2003. Paratuberculosis: Review of present knowledge. Acta Vet. Scand. 44,
217-221.

Collins, M.T., Angulo, A., Buergelt, C.D. Hennager, S.G., Hietala, S.K., Jacobson, R.H.,
Whipple, D.L., Whitlock, R.H., 1993. Reproducibility of a commercial enzyme-linked
immunosorbent assay for bovine paratuberculosis among eight laboratories. J. Vet. Diagn
Invest. 5, 52-55.









Collins, D.M., Gabric, D.M., De Lisle, G.W., 1989. Identification of a repetitive DNA sequence
specific to Mycobacterium paratuberculosis. FEMS Microbiol. Lett. 51, 175-178.

Collins, M.T., Gardner, I.A., Garry, F.B., Roussel A.J., Wells, S.J., 2006. Consensus
recommendations on diagnostic testing for the detection of paratuberculosis in cattle in the
United States. J. Am. Vet. Med. Assoc. 229, 1912-1219.

Collins, M.T., Lisby, G., Moser, C., Chicks, D., Christensen, S., Reichelderfer, M., Hoiby, N.,
Harms, B.A., Thomsen, O.O., Skibsted, U., Binder, V., 2000. Results of multiple
diagnostic tests for Mycobacterium avium subsp. paratuberculosis in patients with
inflammatory bowel disease and in controls. J. Clin. Microbiol. 38, 4373-4381.

Collins, M.T., Nordlund, K., 1991. Milk production levels in cows ELISA positive for serum
antibodies to M. paratuberculosis. In: Chiodini, R.J., Kreeger, J. (Eds.), Proceedings of the
Third International Colloquium on Paratuberculosis, Orlando, FL, USA, pp. 401-409.

Collins, M.T., Sockett, D.C., 1993. Accuracy and economics of the USDA-licensed enzyme-
linked immunosorbent assay for bovine paratuberculosis. J. Am. Vet. Med. Assoc. 203,
1456-1463.

Collins, M.T., Sockett, D.C., Goodger, W.J., Conrad, T.A., Thomas, C.B., Carr, D.J., 1994. Herd
prevalence and geographic distribution of, and risk factors for, bovine paratuberculosis in
Wisconsin. J. Am. Vet. Med. Assoc. 204, 636-641.

Collins, M.T., Wells, S.J., Petrini, K.R., Collins, J.E., Schultz, R.D., Whitlock, R.H., 2005.
Evaluation of five antibody detection tests for diagnosis of bovine paratuberculosis. Clin.
Diagn. Lab. Immunol. 12, 685-692.

Coltman, D.W., Wilson, K., Pilkington, J.G., Stear, M.J., Pemberton, J.M., 2001. A
microsatellite polymorphism in the gamma interferon gene is associated with resistance to
gastrointestinal nematodes in a naturally-parasitized population of Soay sheep.
Parasitology. 122, 571-582.

Cooper, A., Adams, L.B., Dalton, D.K., Appelberg, R., Ehlers, S., 2002. IFN-y and NO bacterial
disease: newjobs for old hands. Trends. Microbiol. 10, 221-226.

Cordell, H.J., Clayton, D.G., 2005. Genetic association studies. Lancet. 366, 1121-1131.

Corn, J.L., Manning, E.J., Sreevatsan, S., Fischer, J.R., 2005. Isolation ofMycobacterium avium
subsp. paratuberculosis from free-ranging birds and mammals on livestock premises.
Appl. Environ. Microbiol. 71, 6963-6967.

Cousins, D.V., Whittington, R., Marsh, I., Masters, A., Evans, R.J., Kluver, P., 1999.
Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from
the faeces of ruminants possess IS900-like sequences detectable by IS900 polymerase
chain reaction: implications for diagnosis. Mol. Cell. Probes 13, 431-442.









Coussens, P.M., 2001. Mycobacterium paratuberculosis and the bovine immune system. Anim.
Health Res. Rev. 2, 141-161.

Coussens, P.M., 2004. Model for immune responses to Mycobacterium avium subspecies
paratuberculosis in cattle. Infect. Immun. 72, 3089-3096.

Coussens, P.M., Colvin, C.J. Wiersma, K., Abouzied, A., Sipkovsky, S., 2002. Gene expression
profiling of peripheral blood mononuclear cells from cattle infected with Mycobacterium
paratuberculosis. Infect. Immun. 70, 5494-5502.

Coussens, P.M., Coussens, M.J., Tooker, B.C., Nobis, W., 2004. Structure of the bovine natural
resistance associated macrophage protein (NRAMP1) gene and identification of a novel
polymorphism. DNA Seq. 15, 15-25.

Coussens, P.M., Tooker, B., Nobis, W., Coussens, M., 2001. Genetics and genomics of
susceptibility to mycobacterial infections in cattle. J. Dairy Sci. 84(Suppl. 1): 57.

Coussens, P.M., Verman, N., Coussens, M.A., Elftman, M.D., McNulty, A.M., 2004a. Cytokine
gene expression in peripheral blood mononuclear cells and tissues of cattle infected with
Mycobacterium avium subsp. paratuberculosis: evidence for an inherent proinflammatory
gene expression pattern. Infect. Immun. 72, 1409-1422.

Crossley, B.M., Zagmutt-Vergara, F.J., Fyock, T.L., Whitlock, R.H., Gardner, I.A., 2005. Fecal
shedding of Mycobacterium avium subsp. paratuberculosis by dairy cows. Vet. Microbiol.
107, 257-263.

Daly, A.K., Day, C.P., 2001. Candidate gene case-control association studies: advantages and
potential pitfalls. Br. J. Clin. Pharmacol, 52, 489-499.

Dargatz, D.A., Byrum, B.A., Barber, L.K., Sweeney, R.W., Whitlock, R.H., Shulaw, W.P.,
Jacobson, R.H., Stabel, J.R., 2001. Evaluation of a commercial ELISA for diagnosis of
paratuberculosis in cattle. J. Am. Vet. Med. Assoc. 218, 1163-1166.

Dargatz, D.A., Byrum, B.A., Hennager, S.G., Barber, L.K., Kopral, C.A., Wagner, B.A., Wells,
S.J., 2001a. Prevalence of antibodies against Mycobacterium avium subsp paratuberculosis
among beef cow-calf herds. J. Am. Vet. Med. Assoc. 219, 497-501.

de Juan, L., Alvarez, J., Aranaz, A., Rodriguez, A., Romero, B., Bezos, J., Mateos, A.,
Dominguez, L., 2006. Molecular epidemiology of Types I/III strains of Mycobacterium
avium subspecies paratuberculosis isolated from goats and cattle. Vet. Microbiol. 115,
102-110.

de Lisle, G.W., Duncan, J.R, 1981. Bovine paratuberculosis III. An evaluation of a whole blood
lymphocyte transformation test. Can. J. Comp. Med. 45, 304-309.

Denis, M., Wedlock, D.N., Buddle, B.M., 2005. IFN-gamma enhances bovine macrophage
responsiveness to Mycobacterium bovis: Impact on bacterial replication, cytokine release
and macrophage apoptosis. Immunol. Cell Biol. 83, 643-650.









Detilleux, J.C., 2001. Genetic improvement of resistance to infectious diseases in livestock. J.
Dairy Sci. 84(E. Suppl.): E39-E46.

Detilleux J.C., 2002. Genetic factors affecting susceptibility of dairy cows to udder pathogens.
Vet. Immunol. Immunopathol. 88, 103-110.

Eamens, G.J., Whittington, R.J., Marsh, I.B., Turner, M.J., Saunders, V., Kemsley, P.D.,
Rayward, D., 2000. Comparative sensitivity of various faecal culture methods and ELISA
in dairy cattle herds with endemic Johne's disease. Vet. Microbiol. 77, 357-367.

Economou, M., Pappas, G., New global map of Crohn's disease: Genetic, environmental, and
socioeconomic correlations. Inflamm. Bowel Dis. 2007, doi 10.1002/ibd.20352.

Economou, M., Trikalinos, T.A., Loizou, K.T., Tsianos, E.V., loannidis, J.P., 2004. Differential
effects of NOD2 variants on Crohn's disease risk and phenotype in diverse populations: a
metaanalysis. Am J Gastroenterol. 99, 2393-2404.

Eglund, S., 2002. Molecular biology techniques as a tool for detection and characterization of
Mycobacterium avium subsp. paratuberculosis. Doctoral dissertation, Dept. of Veterinary
Microbiology, SLU. Acta Universitatis agricultural Sueciae. Veterinaria vol. 123. ISSN
1401-6257, ISBN 91-576-6366-1.

Ellingson, J.L., Anderson, J.L., Koziczkowski, J.J., Radcliff, R.P., Sloan, S.J., Allen, S.E.,
Sullivan, N.M., 2005. Detection of viable Mycobacterium avium subsp. paratuberculosis
in retail pasteurized whole milk by two culture methods and PCR. J. Food Prot. 68,
966-972.

Ellingson, J.L., Stabel, J.R., Radcliff, R.P., Whitlock, R.H., Miller, J.M., 2005a. Detection of
Mycobacterium avium subspecies paratuberculosis in free-ranging bison (Bison bison) by
PCR. Mol. Cell. Probes. 19, 219-225

Elzo, M.A., Rae, D.O., Lanhart, S.E., Wasdin, J.G., Dixon, W.P., Jones, J.L., 2006. Factors
associated with ELISA scores for paratuberculosis in an Angus-Brahman multibreed herd
of beef cattle. J. Anim. Sci. 84, 41-48.

Estes, D.M., Brown, W.C., 2002. Type 1 and Type 2 responses in regulation of Ig isotype
expression in cattle. Vet. Immunol. Immunopathol. 90, 1-10.

Estonba, A., Iriondo, M., Oyanguren, O., Garrido, J.M., Geijo, M.V., Sevilla, I. Juste, R.A.,
2006. Bovine 3'-UTR (GT1 1) variant of the NRAMP1 gene under-represented among
paratuberculosis seropositive cattle. In: Manning, E.J.B., Nielsen, S.S., (Eds.), Proceedings
of the Eighth International Colloquium on Paratuberculosis, Copenhagen, Denmark, pp.
150.

Estrada-Chivez, C., Pereira-Suirez, A.L., Meraz, M.A., Arriaga, C., Garcia-Carranci, A.,
Sinchez-Rodriguez, C., Mancilla, R., 2001. High-level expression of NRAMP1 in
peripheral blood cells and tuberculous granulomas from Mycobacterium bovis-infected
bovines. Infect. Immun. 69, 7165-7168.









Fang, Y., Wu, W., Pepper, J.L., Larsen, J.L., Marras, S.A.E., Nelson, E.A., Epperson, W.B.,
Christopher-Hennings, J., 2002. Comparison of real-time, quantitative PCR with molecular
beacons to nested PCR and culture methods for detection ofMycobacterium avium subsp.
paratuberculosis in bovine fecal samples. J. Clin. Microbiol, 40, 287-291.

Feller, M., Huwiler, K., Stephan R., Altpeter, E., Shang, A., Furrer, H., Pfyffer, G.E., Jemmi, T.,
Baumgartner, A., Egger, M., 2007. Mycobacterium avium subspecies paratuberculosis and
Crohn's disease: a systematic review and meta-analysis. Lancet Infect Dis. 7, 607-613

Feng, C.G., Scanga, C.A., Collazo-Custodio, C.M., Cheever, A.W., Hieny, S., Caspar, P., Sher,
A., 2003. Mice lacking myeloid differentiation factor 88 display profound defects in host
resistance and immune responses to Mycobacterium avium infection not exhibited by Toll-
Like Receptor 2 (TLR2)- and TLR4-deficient animals. J Immunol. 171, 4758-4764.

Feng, J., Li, Y., Hashad, M., Schurr, E., Gros, P., Adams, L.G., Templeton, J.W., 1996. Bovine
natural resistance associated macrophage protein 1 (NRAMP1) gene. Genome Res. 26,
956-964.

Ferwerda, G., Girardin, S.E., Kullberg, B.J., Le Bourhis, L., de Jong, D.J., Langenberg, D.M.,
van Crevel, R., Adema, G.J., Ottenhoff, T.H., Van der Meer, J.W., Netea, M.G., 2005.
NOD2 and Toll-like receptors are non-redundant recognition systems of Mycobacterium
tuberculosis. PLoS. Pathog. 1, 279-285.

Ferwerda, G., Kullberg, B.J., de Jong, D.J., Girardin, S.E., Langenberg, D.M., van Crevel, R.,
Ottenhoff, T.H., Van der Meer, J.W., Netea, M.G., 2007. Mycobacteriumparatuberculosis
is recognized by Toll-like receptors and NOD2. J. Leukoc. Biol. 82, 1011-1018.

Fishbein, T., Novitskiy, G., Mishra, L., Matsumoto, C., Kaufman, S., Goyal, S., Shetty, K.,
Johnson, L., Lu, A., Wang, A., Hu, F., Kallakury, B., Lough, B., Zasloff, M., 2008.
NOD2-expressing bone marrow-derived cells appear to regulate epithelial innate immunity
of the transplanted human small intestine. Gut. 57, 232-330.

Frehel, C., Canonne-Hergaux, F., Gros, P., De Chastellier, C., 2002. Effect of NRAMPI on
bacterial replication and on maturation of Mycobacterium avium-containing phagosomes in
bone marrow-derived mouse macrophages. Cell Microbiol. 4, 541-556.

Fremond, C.M., Nicolle, D.M., Torres, D.S., Quesniaux, V.F., 2003.Control of Mycobacterium
bovis BCG infection with increased inflammation in TLR4-deficient mice. Microbes
Infect. 5, 1070-1081.

Frucht, D.M., Holland, S.M., 1996. Defective monocyte costimulation for IFN-gamma
production in familial disseminated Mycobacterium avium complex infection: abnormal
IL-12 regulation. J. Immunol. 157, 411-416.

Ganguly, I., Sharma, A., Singh, R., Deb, S.M., Singh, D.K., Mitra, A., 2007. Association of
microsatellite (GT)(n) polymorphism at 3'UTR of NRAMPI with the macrophage function
following challenge with Brucella LPS in buffalo (Bubalus bubalis). Vet. Microbiol. 2007
doi:10.1016/j.vetmic.2007.10.033.









Gasteiner, J., Awad-Masalmeh, M., Baumgartner, W., 2000. Mycobacterium avium subsp.
paratuberculosis infection in cattle in Austria, diagnosis with culture, PCR and ELISA.
Vet. Microbiol. 77, 339-349.

Gazouli, M., Mantzaris, G., Archimandritis, A.J., Nasioulas, G., Anagnou, N.P., 2005. Single
nucleotide polymorphisms of OCTN1, OCTN2, and DLG5 genes in Greek patients with
Crohn's disease. World J Gastroenterol. 11, 7525-7530.

Geisbauer, E., Khol, JL., Wassertheurer, M., Damoser, J., Osterreicher, E., Dinser, M.,
Revilla-Fernandez, S., Baumgartner. W., 2007. Longterm investigation in an Austrian
dairy herd with low prevalence of paratuberculosis detection of antibodies in blood and
milk. Vet. Q. 29, 138-148.

Ghadiali, A.H., Strother, M., Naser, S.A., Manning, E.J.B., Sreevatsan, S., 2004. Mycobacterium
avium subsp. paratuberculosis strains isolated from crohn's disease patients and animal
species exhibit similar polymorphic locus patterns. J. Clin. Microbiol. 42, 5345-5348.

Gibson, J.P., Bishop, S.C., 2005. Use of molecular markers to enhance resistance of livestock to
disease: a global approach. Rev.-Off Int. Epiz., 24, 343-353.

Giese, S.B., Ahrens, P., 2000. Detection of Mycobacterium avium subsp. paratuberculosis in
milk from clinically affected cows by PCR and culture. Vet. Microbiol. 77, 291-297.

Goldammer, T., Zerbe, H., Molenaar, A., Schuberth, H.J., Brunner, R. M., Kata, S. R., Seyfert,
H.M., 2004. Mastitis increases mammary mRNA abundance of 1-defensin 5, Toll-like-
receptor 2 (TLR2), and TLR4 but not TLR9 in cattle. Clin. Diagn. Lab. Immunol. 11,
174-185.

Gomes, M.S., Appelberg, R., 1998. Evidence for a link between iron metabolism and NRAMP1
gene function in innate resistance against Mycobacterium avium. Immunology. 95,
165-168.

Gonda, M.G., Chang, Y.M., Shook, G.E., Collins, M.T., Kirkpatrick, B.W., 2006a. Genetic
variation of Mycobacterium avium ssp. paratuberculosis infection in US Holsteins. J.
Dairy Sci. 89, 1804-1812

Gonda, M.G., Chang, Y.M., Shook, G.E., Collins, M.T., Kirkpatrick, B.W., 2007. Effect of
Mycobacterium paratuberculosis infection on production, reproduction, and health traits in
US Holsteins. Prev. Vet. Med. 80, 103-119.

Gonda, M.G., Kirkpatrick, B.W., Shook, G.E., Collins, M.T., 2007a. Identification ofa QTL on
BTA20 affecting susceptibility to Mycobacterium avium ssp. paratuberculosis infection in
US Holsteins. Anim. Genet. 38, 389-396.

Gonda, M.G., Shook, G.E., Kirkpatrick, B.W., Collins, M.T., 2005. Mapping quantitative trait
loci affecting Mycobacterium paratuberculosis infection in cattle. In: Proc. Plant and
Animal Genome Conference XIV, San Diego, Ca, USA, 234.









Gonda, M.G., Shook, G.E., Kirkpatrick, B.W., Collins, M.T., 2006b. Quantitative trait locus
affecting susceptibility to Mycobacterium paratuberculosis infection identified on BTA 20
in US Holsteins. In: Proc. 30th Intern. Conf. Anim. Genet., Int. Soc. Anim. Genet. (Eds.),
Porto Seguro, Brazil.

Goodger, W.J., Collins, M.T., Nordlund, K.V., Eisele, C., Pelletier, J., Thomas, C.B., Sockett,
D.C., 1996. Epidemiologic study of on-farm management practices associated with
Mycobacteriumparatuberculosis infection in dairy cattle. J. Am. Vet. Med. Assoc. 208,
1877-1881.

Govoni, G., Gros, P., 1998. Macrophage NRAMP1 and its role in resistance to microbial
infections. Inflamm. Res. 47, 277-284.

Grant, I.R., 2005. Zoonotic potential of Mycobacterium avium ssp. paratuberculosis: the current
position. J. Appl. Microbiol. 98, 1282-1293.

Grant, I.R., Rowe, M.T., Dundee, L., Hitchings, E., 2001. Mycobacterium avium ssp.
paratuberculosis: its incidence, heat resistance and detection in milk and dairy products.
Int. J. Dairy Tech. 54, 2-13.

Grant, I.R., Williams, A.G., Rowe, M.T., Muir, D.D., 2005. Efficacy of various pasteurization
time-temperature conditions in combination with homogenization on inactivation of
Mycobacterium avium subsp. paratuberculosis in milk. Appl. Environ. Microbiol. 71,
2853-2861.

Green, E.P., Tizard, M.L., Moss, M.T., Thompson, J., Winterbourne, D.J., McFaddenn, J.J.,
Hermon-Taylor, J., 1989. Sequence and characteristics of IS900, an insertion element
identified in a human Crohn's disease isolate ofMycobacterium paratuberculosis. Nucleic
Acids Res. 17, 9063-9073.

Greig, A., Stevenson, K., Henderson, D., Perez, V., Hughes, V., Pavlik, I., Hines, M.E. 2nd.
McKendrick, I., Sharp, J.M., 1999. Epidemiological study of paratuberculosis in wild
rabbits in Scotland. J. Clin. Microbiol. 37, 1746-1751.

Greig, A., Stevenson, K., Perez, V., Pirie, A.A., Grant, J.M., Sharp J.M., 1997. Paratuberculosis
in Wild Rabbits (Oryctolagus cuniculus). Vet. Rec. 140, 141-143.

Groenendaal, H., Galligan, D.T., 2003. Economic consequences of control programs for
paratuberculosis in midsize dairy farms in the United States. J. Am. Vet. Med. Assoc. 223,
1757-1763.

Groenendaal, H., Nielen, M., Hesselink, J.W., 2003. Development of the Dutch Johne's disease
control program supported by a simulation model. Prev. Vet. Med. 60, 69-90.

Gruenheid, S., Gros P., 2000. Genetic susceptibility to intracellular infections: NRAMP1,
macrophage function and divalent cations transport. Curr. Opin. Microbiol. 3, 43-48.









Guedj, M., Della-Chiesa, E., Picard, F., Nuel, G., 2007. Computing power in case-control
association studies through the use of quadratic approximations: application to meta-
statistics. Ann. Hum. Genet. 71, 262-270.

Gwozdz, J.M., Reichel, M.P., Murray, A., Manktelow, W., West, D.M., Thompson, K.G., 1997.
Detection ofMycobacterium avium subsp. paratuberculosis in ovine tissues and blood by
the polymerase chain reaction. Vet. Microbiol. 51, 233-244.

Halld6rsd6ttir, S., Englund, S., Nilsen, S.F., Olsaker, I., 2002. Detection of Mycobacterium
avium subsp. paratuberculosis by buoyant density centrifugation, sequence capture PCR
and dot blot hybridisation. Vet Microbiol. 87, 327-340.

Hampe, J., Cuthbert, A., Croucher, P., Mirza, M., Mascheretti, S., Fisher, S., Frenzel, H., King,
K., Hasselmeyer, A., MacPherson, A., 2001. Association between insertion mutation in
NOD2 gene and Crohn's disease in German and British populations. Lancet 357,
1925-1928.

Hanna, B.A. Ebrahimzadeh, A., Elliott, L.B., Morgan, M.A., Novak, S.M., Rusch-Gerdes, S.,
Acio, M., Dunbar, D.F., Holmes, T.M., Rexer, C.H., Savthyakumar, C., Vannier, A.M.,
1999. Multicenter evaluation of the BACTEC MGIT 960 system for recovery of
mycobacteria. J. Clin. Microbiol. 37, 748-752

Hardin, L.E., Thorne, J.G., 1996. Comparison of milk with serum ELISA for the detection of
paratuberculosis in dairy cows. J. Am. Vet. Med. Assoc. 209, 120-122.

Harris, N.B., Barleta, R.G., 2001. Mycobacterium avium subsp. paratuberculosis in veterinary
medicine. Clin. Microbiol. Rev. 14, 489-512.

Hattersley, A.T., McCarthy, M.I., 2005. What makes a good genetic association study? Lancet.
366, 1315-1323.

Hendrick, S.H., Duffield, T.F., Leslie, K.E., Lissemore, K.D., Archambault, M., Bagg, R., Dick,
P., Kelton, D.F., 2006. Monensin might protect Ontario, Canada dairy cows from
paratuberculosis milk-ELISA positivity. Prev. Vet. Med. 76, 237-248.

Hendrick, S.H., Kelton, D.F., Leslie, K.E., Lissemore, K.D., Archambault, M., Bagg, R., Dick,
P., Duffield, T.F. 2006a. Efficacy of monensin sodium for the reduction of fecal shedding
of Mycobacterium avium subsp. paratuberculosis in infected dairy cattle. Prev. Vet. Med.
75, 206-220.

Hendrick, S.H., Kelton, D.F., Leslie, K.E., Lissemore, K.D., Archambault, M., Duffield T.F.,
2005. Effect of paratuberculosis on culling, milk production, and milk quality in dairy
herds. J. Am. Vet. Med. Assoc. 227, 1302-1308.

Heresbach, D., Gicquel-Douabin, V., Birebent, B., D'halluin, P.N., Heresbach-Le Berre, N.,
Dreano, S., Siproudhis, L., Dabadie, A., Gosselin, M., Mosser, J., Semana, G., Bretagne,
J.F., Yaouanq, J., 2004. NOD2/CARD15 gene polymorphisms in Crohn's disease: a
genotype-phenotype analysis. Eur. J. Gastroenterol. Hepatol. 16, 55-62.









Hinger, M., Brant, H., Homer, S., Erhardt, G., 2007. Short communication: Association analysis
of microsatellites and Mycobacterium avium subspecies paratuberculosis antibody
response in German Holsteins. J. Dairy Sci. 90,1957-61.

Hirst, H.L., Garry, F.B., Morley, P.S., Salman, M.D., Dinsmore, R.P., Wagner, B.A.,
McSweeney, K.D., Goodell, G.M., 2004. Seroprevalence ofMycobacterium avium subsp
paratuberculosis infection among dairy cows in Colorado and herd-level risk factors for
seropositivity. J. Am. Vet. Med. Assoc. 225, 97-101.

Hoffmann, J.C., Pawlowski, N.N., Kuhl, A.A., Hohne, W., Zeitz, M., 2002-2003. Animal models
of inflammatory bowel disease: an overview. Pathobiology. 70, 121-130.

Horin, P., Rychlik, I., Templeton, J.W., Adams, L.G., 1999. A complex pattern of microsatellite
polymorphism within the bovine NRAMP1 gene. Eur. J. Immunogenet. 26, 311-313.

Huang, J.H., Oefner, P.J., Adi, V., Ratnam, K., Ruoss, S.J., Trako, E., Kao, P.N., 1998. Analyses
of the NRAMP1 and IFN-gammaRl genes in women with Mycobacterium avium-
intracellulare pulmonary disease. Am. J. Respir. Crit. Care Med. 157, 377-381.

Huang, S., Hendriks, W., Althage, A., Hemmi, S., Bluethmann, H., Kamijo, R., Vilcek, J.,
Zinkemagel, R.M., Aguet, M., 1993. Immune response in mice that lack the
interferon-gamma receptor. Science. 259, 1742-1745.

Huda, A., Jungersen, G., Chistoffersen, A.B., Lin, P., 2003. Diagnosis of bovine paratuberculosis
by interferon gamma (IFN-gamma) test. Acta Vet. Scand. 44, 281.

Huda, A., Jungersen, G., Lind, P., 2004. Longitudinal study of interferon-gamma, serum
antibody and milk antibody responses in cattle infected with Mycobacterium avium subsp.
paratuberculosis. Vet. Microbiol. 104, 43-53.

Hugot, J.P., 2006. CARD15/NOD2 mutations in Crohn's disease. Ann. NY. Acad. Sci. 1072,
9-18.

Hugot J.P., Chamaillard, M., Zouali, H., Lesage, S., Cezard, J.P., Belaiche, J., Almer, S., Tysk,
C., O'Morain, C.A., Gassull, M., Binder, V., Finkel, Y., Cortot, A., Modigliani, R.,
Laurent-Puig, P., Gower-Rousseau, C., Macry, J., Colombel, J.F., Sahbatou, M., Thomas,
G., 2001. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's
disease. Nature. 411, 599-603.

Hugot, J.P., Laurent-Puig, P., Gower-Rousseau, C., Olson, J.M., Lee, J.C., Beaugerie, L., Naom,
I., Dupas, J.L., Van Gossum, A., Orholm, M., Bonaiti-Pellie, C., Weissenbach, J., Mathew,
C.G., Lennard-Jones, J.E., Cortot, A., Colombel, J.F., Thomas, G., 1996. Mapping of a
susceptibility locus for Crohn's disease on chromosome 16. Nature. 379, 821-823.

Huntley, J.F. Stabel, J.R., Paustian, M.L., Reinhardt, T.A., Bannantine, J.P., 2005. Expression
library immunization confers protection against Mycobacterium avium subsp.
paratuberculosis infection. Infect Immun. 73, 6877-6884.









Jakobsen. M.B., Alban, L., Nielsen, S.S., 2000. A cross-sectional study of paratuberculosis in
1155 Danish dairy cows. Prev. Vet. Med. 46, 15-27.

Jayarao, B.M., Pillai, S.R., Wolfgang, D.R., Griswold, D.R., Rossiter, C.A., Tewari, D., Bums,
C.M., Hutchinson, L.J., 2004. Evaluation of IS900-PCR assay for detection of
Mycobacterium avium subspecies paratuberculosis infection in cattle using quarter milk
and bulk tank milk samples. Foodbome Pathog. Dis. 1, 17-26.

Jo, E., Yang, C.S. Choi, C.H., Harding, C.V., 2007. Intracellular signaling cascades regulating
innate immune responses to mycobacteria: branching out from Toll-like receptors. Cell.
Microbiol. 9, 1087-1098.

Johansen, T.B., Djonne, B., Jensen, M.R., Olsen, I., 2005. Distribution of IS1311 and IS1245 in
Mycobacterium avium subspecies revisited. J. Clin. Microbiol. 43, 2500-2502.

Johnes, P.H., Farver, T.B., Beaman, B., Cetinkaya, B., Morgan, K.L., 2006. Crohn's disease in
people exposed to clinical cases of bovine paratuberculosis. Epidemiol. Infect. 134, 49-56.

Johnson-Ifearulundu, Y.J. Kaneene, J.B. Gardiner, J. C. Lloyd, J. W. Sprecher, D. J. Coe, P. H.,
2001. The effect of subclinical Mycobacterium paratuberculosis infection on milk
production in Michigan dairy cows. J. Dairy Sci. 84, 2188-2194.

Johnson-Ifearulundu, Y.J., Kaneene, J.B. Sprecher, D.J. Gardiner, J.C. Lloyd, J.W., 2000. The
effect of subclinical Mycobacterium paratuberculosis infection on days open in Michigan,
USA, Dairy Cows. Prev. Vet. Med. 46, 171-181.

Joo, Y.S., Moon, J.S., Suh, G.H., Kwon, N.H., Kim, S.H., Park, Y.H., 2003. Comparison of
natural resistance-associated macrophage protein (NRAMP-1) expression between cows
with high and low milk somatic cells counts. Asian-Australian J. of Animal Sci. 16,
1830-1836.

Jubb, T.F., Sergeant, E., Callinan, A., Galvin, J.W., 2004. Estimate of the sensitivity of an
ELISA used to detect Johne's disease in Victorian dairy cattle herds. Aust. Vet. J. 82,
569-573.

Jungersen, G., Huda, A., Hansen, J.J., Lind, P., 2002. Interpretation of the gamma interferon test
for diagnosis of subclinical paratuberculosis in cattle. Clin. Diagn. Lab. Immunol. 9,
453-460.

Juste, R.A., Garrido, J.M., Geijo, M., Elguezbal, N., Arduriz, G., Atxaerandio, R., Sevilla, I.,
2005. Comparison of blood polymerase chain reaction and enzyme-linked immunosorbent
assay for detection ofMycobacterium avium subsp. paratuberculosis infection in cattle and
sheep. J. Vet. Diagn. Invest. 17, 354-359.

Kalis, C.H., Collins, M.T., Barkema, H.W., Hesselink, J.W., 2004. Certification of herds as free
of Mycobacterium paratuberculosis infection: actual pooled faecal results versus
certification model predictions. Prev. Vet. Med. 65, 189-204.









Kalis, C.H., Collins, M.T., Hesselink, J.W., Barkema, H.W., 2003. Specificity of two tests for
the early diagnosis of bovine paratuberculosis based on cell-mediated immunity: the
Johnin skin test and the gamma interferon assay. Vet. Microbiol. 97, 73-86.

Kalis, C.H., Hesselink, J.W., Barkema, H.W., Collins, M.T., 2001. Use of long-term vaccination
with a killed vaccine to prevent fecal shedding ofMycobacterium avium subsp
paratuberculosis in dairy herds. Am. J. Vet. Res. 62, 270-274.

Kaufmann, S.H.E., Kaplan, G., 1996. Immunity to intracellular bacteria. Res. Immunol. 147,
487-489.

Keller, L.L., Harrell, C.D., Loerzel, S.M., Rae, D.O., 2004. Johne's disease: seroprevalence of
Mycobacterium avium subspecies paratuberculosis in Florida beef and dairy cattle. Bovine
Practitioner. 38, 135-141.

Kelly, P., Pereira-Maxwell, F., Carnaby, S., White, I., 2005. Confidence in polymerase chain
reaction diagnosis can be improved by Bayesian estimation of post-test disease probability.
J. Clin. Epidemiol. 58, 252-260.

Khare, S., Ficht, T.A., Santos, R.L., Romano, J., Ficht, A.R., Zhang, S., Grant, I.R., Libal, M.,
Hunter, D., Adams, L.G., 2004. Rapid and sensitive detection ofMycobacterium avium
subsp. paratuberculosis in bovine milk and feces by a combination of immunomagnetic
bead separation-conventional PCR and real-time PCR. J. Clin. Microbiol. 42, 1075-1081.

King, K., Sheikh, M.F., Cuthbert, A.P., Fisher, S.A., Onnie, C.M., Mirza, M.M., Pattni, R.C.,
Sanderson, J., Forbes, A., Mansfield, J., Lewis, C.M., Roberts, R.G., Mathew, C.G., 2006.
Mutation, selection, and evolution of the Crohn's disease susceptibility gene CARD15.
Hum. Mutat. 27, 44-54.

Koets, A., Adugna, G., Janss, L.L., van Weering, H.J., Kalis, C.H., Wentink, G.H., Rutten, V.P.,
Schukken, Y.H., 2000. Genetic variation of susceptibility to Mycobacterium avium subsp.
paratuberculosis infection in dairy cattle. J. Dairy Sci. 83, 2702-2708.

Koets, A., Hoek, A., Langelaar M., Overdijk, M., Santema, W., Franke, P., van Edenb, W.,
Rutten, V., 2006. Mycobacterial 70 kD heat-shock protein is an effective subunit vaccine
against bovine paratuberculosis. Vaccine. 24, 2550-2559.

Koets, A., Rutten, V., Hoek, A., van Mil, F., Muller, K., Bakker, D., Gruys, E., van Eden, W.,
2002. Progressive bovine paratuberculosis is associated with local loss of CD4(+) T cells,
increased frequency of gamma delta T cells, and related changes in T-cell function. Infect.
Immun. 70, 3856-3864.

Kohler, H., Gyra, H., Zimmer, K., Drager, G., Burkert, B., Lemser, B., Hausleithner, D., Cubler,
K., Klawonn, W., Heb, G., 2001. Immune reactions in cattle after immunization with a
Mycobacterium paratuberculosis vaccine and implications for the diagnosis of M.
paratuberculosis and M bovis infections. J. Vet. Med. B. 48, 185-195.









Kojima, Y., Kinouchi, Y., Takahashi, S., Negoro, K., Hiwatashi, N., Shimosegawa, T., 2001.
Inflammatory bowel disease is associated with a novel promoter polymorphism of natural
resistance-associated macrophage protein 1 (NRAMP1) gene. Tissue Antigens. 58,
379-384.

Koren, O., Elad, E., Shafer, M., Garazi, S., Meltser, R., Klement, E., 2005. Proc. Johne's disease
control programs in Israeli dairy herds. In: Manning, E.J.B., Nielsen, S.S., (Eds.),
Proceedings of the Eighth International Colloquium on Paratuberculosis, Copenhagen,
Denmark, pp. 26-29.

Kreeger, J.M., 1991. Ruminant paratuberculosis -a century of progress and frustration. J. Vet.
Diagn. Invest. 3, 373-383.

Kruip, T.A., Muskens, J., van Roermund, H.J., Bakker, D., Stockhofe-Zurwieden, N., 2003. Lack
of association ofMycobacterium avium subsp. paratuberculosis with oocytes and embryos
from moderate shedders of the pathogen. Theriogenology 59, 1651-1660.

Kudahl, A.B., Nielsen, S.S., Sorensen, J.T., 2004. Relationship between antibodies against
Mycobacterium avium subsp. paratuberculosis in milk and shape of lactation curves. Prev.
Vet. Med. 62, 119-134.

Kudahl, A.B., Sorensen, J.T., Nielsen, S.S., Ostergaard, S., 2007. Simulated economic effects of
improving the sensitivity of a diagnostic test in paratuberculosis control. Prev. Vet. Med.
78, 118-129.

Kumar, N., Govindiah, M.G., Nagaraj, C.S., Bindu, A., Rasool, T.J., 1999. Does the natural
resistance associated macrophage protein (NRAMP) gene confer resistance/susceptibility in
bovines against mycobacterial infection? Curr. Sci. 77, 809-812.

Kumar, N., Mitra, A., Ganguly, I., Singh, R., Deb, S.M., Srivastava, S.K., Sharma, A., 2005.
Lack of association of brucellosis resistance with (GT)13 microsatellite allele at 3'UTR of
NRAMP1 gene in Indian zebu (Bos indicus) and crossbred (Bos indicus x Bos taurus)
cattle. Vet. Microbiol. 111, 139-143.

Lakatos, P., Fischer, S., Lakatos, L., Gal, I., Papp, J., 2006. Current concept on the pathogenesis
of inflammatory bowel disease-crosstalk between genetic and microbial factors:
pathogenic bacteria and altered bacterial sensing or changes in mucosal integrity take
"toll"? World J. Gastroenterol. 12, 1829-1841.

Lander, E.S., Schork, N.J., 1994. Genetic Dissection of Complex Traits. Science. 265,
2037-2048

Landis, J.R., Koch, G.G., 1977. The measurement of observer agreement for categorical data.
Biometrics. 33, 159-174.

Langaee, T., Ronaghi, M., 2005. Genetic variation analyses by pyrosequencing. Mutat. Res. 573,
96-102.









Leroy, B., Roupie, V., Noel-Georis, I., Rosseels, V., Walravens, K., Govaerts, M., Huygen, K.,
Wattiez, R., 2007. Antigen discovery: a postgenomic approach to paratuberculosis
diagnosis. Proteomics. 7, 1164-76

Lesage, S., Zouali, H., Cezard, J.P., Colombel, J.F., Belaiche, J., Almer, S., Tysk, C., O'Morain,
C., Gassull, M., Binder, V., Finkel, Y., Modigliani, R., Gower-Rousseau, C., Macry, J.,
Merlin, F., Chamaillard, M., Jannot, A.S., Thomas, G., Hugot, J.P., EPWG-IBD Group,
EPIMAD Group, GETAID Group., 2002. CARD15/NOD2 mutational analysis and
genotype-phenotype correlation in 612 patients with inflammatory bowel disease. Am. J.
Hum. Genet. 70, 845-857.

Levin, M., Newport, M., 1999. Understanding the genetic basis of susceptibility to mycobacterial
infection. Proc. Assoc. Am. Physicians. 111, 308-312.

Li, H-T., Zhang, T-T., Zhou, Y-Q., Huang, Q-H., Huang, J., 2006. SLC11A1 (formerly
NRAMP1) gene polymorphisms and tuberculosis susceptibility: a meta-analysis. Int. J.
Tuberc. Lung Dis.10, 3-12.

Li, L., Bannantine, J.P., Zhang, Q., Amonsin, A., May, B., Alt, D., Benerji, N., Kanjilal, S.,
Kapur, V., 2005. The complete genome sequence ofMycobacterium avium subspecies
paratuberculosis. Proc. Natl. Acad. Sci. US A. 102, 12344-12349.

Li, W., 2008.Three lectures on case-control genetic association analysis. Brief Bioinform. 9,
1-13.

Lipoldova, M., Demant, P., 2006. Genetic susceptibility to infectious disease: lessons from
mouse models of leishmaniasis. Nat. Rev. Genet. 7, 294-305.

Lombard, J.E., Byrem, T.M., Wagner, B.A., McCluskey, B.J., 2006. Comparison of milk and
serum enzyme-linked immunosorbent assays for diagnosis ofMycobacterium avium
subspecies paratuberculosis infection in dairy cattle. J. Vet. Diagn. Invest. 18, 448-458.

Lombard, J.E., Garry, F.B., McCluskey, B.J., Wagner, B.A., 2005. Risk of removal and effects
on milk production associated with paratuberculosis status in dairy cows. J. Am. Vet. Med.
Assoc. 227, 1975-1981.

Lombard, J.E., Wagner, B.A., Smith, R.L., McCluskey, B.J., Harris, B.N., Payeur, J.B., Garry,
F.B., Salman, M.D., 2006a. Evaluation of environmental sampling and culture to
determine Mycobacterium avium subspecies paratuberculosis distribution and herd
infection status on US dairy operations. J. Dairy Sci. 89, 4163-4171.

Losinger, W., 2005. Economic impact of reduced milk production associated with Johne's
disease on dairy operations in the USA. J. Dairy Res. 72, 425-432.

Lund, B.M., Donnelly, C.W., Rampling, A., 2000. Heat resistance of Mycobacterium
paratuberculosis. Lett. Appl. Microbiol. 31, 184-185.









Mackintosh, C.G., Quereshi, T., Waldrup, K., Labes, R., Dodds, K., Griffin, F.T., 2000. Genetic
resistance to experimental infection with Mycobacterium bovis in red deer (Cervus
elaphus). Infect. Immun. 68, 1620-1625.

Maeda, S., Hsu, L.C., Liu, H., Bankston, L.A., limura, M., Kagnoff, M.F., Eckmann, L., Karin,
M., 2005. NOD2 mutation in Crohn's disease potentiates NF-kappa B activity and IL-10
processing. Science. 307, 734-738.

Manning, E.J., 2001. Mycobacterium avium subspecies paratuberculosis: a review of current
knowledge. Zoo Wild Med. 32, 293-304.

Martin, S.W., Meek, A.H., Willeberg. P., 1987. Veterinary Epidemiology. Principles and
Methods. Iowa State University Press, pp. 63-67.

McGuire, K., Jones, M., Werling, D., Williams, J.L., Glass, E.J., Jann, 0., 2005. Radiation
hybrid mapping of all 10 characterized bovine Toll-like receptors. Anim. Genet. 37, 47-50.

McKenna, S.L., Barkema, H.W., Keefe, G.P., Sockett, D.C., 2006. Agreement between three
ELISAs for Mycobacterium avium subsp. paratuberculosis in dairy cattle. Vet. Microbiol.
31, 285-291.

McKenna, S.L., Dohoo, I.R., 2006. Using and interpreting diagnostic Tests. Vet. Clin. Food
Anim. 22, 195-205.

McKenna, S.L., Keefe, G.P., Barkema, H.W., McClure, J., VanLeeuwen, J.A., Hanna, P.,
Sockett, D.C., 2004. Cow-level prevalence of paratuberculosis in culled dairy cows in
Atlantic Canada and Maine. J. Dairy Sci. 87, 3770-3777.

McKenna, S.L., Keefe, G.P., Barkema, H.W., Sockett, D.C., 2005. Evaluation of three ELISAs
for Mycobacterium avium subsp. paratuberculosis using tissue and fecal culture as
comparison standards. Vet. Microbiol. 30, 105-111.

McKenna, S.L., Keefe, G.P., Tiwari, A., VanLeeuwen, J., Barkema, H.W., 2006a. Johne's
disease in Canada part II: disease impacts, risk factors, and control programs for dairy
producers. Can. Vet. J. 47, 1089-1099.

McNab, W., Mek, A., Martin, S., Duncan, R., 1991. Associations between dairy production
indices and lipoarabinomannan Enzyme-immunoassay results for paratuberculosis. Can. J.
Vet. Res. 55, 356-361.

Mendez-Samperio, P., Belmonta, L., Miranda, E., 2008. Mycobacterium bovis BCG toll-like
receptors 2 and 4 cooperation increases the innate epithelial immune response. Arch.
Med.Res. 39, 33-39.

Merkal, R.S., Whipple, D.L., Sacks, J.M., Snyder, G.R., 1987. Prevalence of Mycobacterium
paratuberculosis in ileocecal lymph nodes of cattle culled in the United States. J. Am. Vet.
Med. Assoc. 190, 676-680.









Millar, D., Ford, J., Sanderson, J., Withey, S., Tizard, M., Doran, T., Hermon-Taylor, J., 1996.
IS900 PCR to detect Mycobacterium paratuberculosis in retail supplies of whole
pasteurized cows' milk in England and Wales. Appl. Environ. Microbiol. 62, 3446-3452.

Milner, A.R., Mack, W.N., Coates, K.J., Hill, J., Gill, I., Sheldrick, P., 1990. The sensitivity and
specificity of a modified ELISA for the diagnosis of Johne's disease from a field trial in
cattle. Vet. Microbiol. 25, 193-198.

Mitchell, R.M., Whitlock, R.H., Stehman, S.M., Benedictus, A., Chapagain, P.P., Grohn, Y.T.,
Schukken, Y.H., 2007. Simulation modeling to evaluate the persistence of Mycobacterium
avium subsp. paratuberculosis (MAP) on commercial dairy farms in the United States.
Prev. Vet. Med. 83, 360-380.

Momotani, E., Whipple, D.L., Thiermann, A.B., Cheville, N.F., 1988. Role of M cells and
macrophages in the entrance of Mycobacterium paratuberculosis into domes of ileal
Peyer's patches in calves.Vet. Pathol. 25, 131-137.

Morris, C.A., 2007. A review of genetic resistance to disease in Bos taurus cattle. Vet. J. 174,
481-491.

Mortensen, H., Nielsen, S.S., Berg, P., 2004. Genetic variation and heritability of the antibody
response to Mycobacterium avium subspecies paratuberculosis in Danish Holstein cows. J.
Dairy Sci. 87, 2108-2113.

Motiwala, A.S., Amonsin, A., Strother, M., Manning, E.J., Kapur, V., Sreevatsan, S., 2004.
Molecular epidemiology ofMycobacterium avium subsp. paratuberculosis isolates
recovered from wild animal species. J. Clin. Microbiol. 42, 1703-1712.

Motiwala, A.S., Lingling, L., Kapur, V., Sreevatsan, S., 2006. Current understanding of the
genetic diversity ofMycobacterium avium subsp. paratuberculosis. Microbes Infect. 8,
1406-1418.

Motiwala, A.S., Strother, M., Amonsin, A., Byrum, B., Naser, S.A., Stabel, J.R., Shulaw, W.P.,
Bannantine, J.P., Kapur, V., Sreevatsan, S., 2003. Molecular epidemiology of
Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain
sharing, and identification of unique targets for diagnosis. J. Clin. Microbiol. 41,
2015-2026.

Muskens, J., Elbers, A.R., van Weering, H.J., Noordhizen, J.P., 2003. Herd management
practices associated with paratuberculosis seroprevalence in Dutch dairy farms. J. Vet.
Med. B Infect. Dis. Vet. Public Health. 50, 372-377.

Muskens, J., Mars, M.H., Elbers, A.R.W., van Maanen, K., Bakker, D., 2003a. The results of
using fecal culture as confirmation test of paratuberculosis-seropositive dairy cattle. J. Vet.
Med. B. Infect. Dis. Vet. Public Health. 50, 231-234.









Muskens, J., van Zijderveld, F., Eger, A., Bakker, D., 2002. Evaluation of the long-term immune
response in cattle after vaccination against paratuberculosis in two Dutch dairy herds. Vet.
Microbiol. 86, 269-278.

Naser, S.A., Ghobrial, G., Romero, C., Valentine, J.F., 2004. Culture ofMycobacterium avium
subsp. paratuberculosis from the blood of patients with Crohn's disease. Lancet. 364,
1039-1044.

Naser, S.A., Shafran, I., Schwartz D., 2000. Isolation of Mycobacterium avium subsp
paratuberculosis from breast milk of Crohn's disease patients. Am. J. Gastroenterol. 95,
1094-1095.

National Animal Health Monitoring System. Johne's Disease on U.S. Dairy Operations, 1997.
Fort Collins, CO: United States Department of Agriculture, Animal and Plant Health
Inspection Service; Veterinary Services; Centers for Epidemiology and Animal Health,
#N245.1097.

National Research Council, 2003. Committee on Diagnosis and Control of Johne's Disease.
Diagnosis and control of Johne's disease. National Academies Press, Washington, DC.

Newman, B., Siminovitch, K.A., 2005. Recent advances in the genetics of inflammatory bowel
disease. Curr. Opin. Gastroenterol. 21, 401-407.

Newport, M., Levin, M., 1999. Genetic susceptibility to tuberculosis. J Infect Dis. 39, 117-121.

Nielsen, S.S., Enevoldsen, C., Grohn, Y.T., 2002. The Mycobacetrium avium subsp.
paratuberculosis ELISA response by parity and stage of lactation. Prev. Vet. Med. 54,
1-10.

Nielsen, S.S., Ersboll, A.K., 2006. Age at occurrence of Mycobacterium avium subspecies
paratuberculosis in naturally infected dairy cows. J. Dairy Sci. 89, 4557-4566.

Nielsen, S.S., Grohn, Y.T., Quaas, R.L., Agger, J.F., 2002. Paratuberculosis in dairy cattle:
variation of the antibody response in offspring attributable to the dam. J. Dairy Sci. 85,
406-412.

Nielsen, S.S., Gronbaek, C., Agger, J.F., Houe, H., 2002. Maximum-likelihood estimation of
sensitivity and specificity of ELISAs and faecal culture for diagnosis of paratuberculosis.
Prev. Vet. Med. 53, 191-204.

Nielsen, S.S., Nielsen, K.K., Huda, A., Condron, R., Collins, M.T., 2001. Diagnostic techniques
for paratuberculosis. Bull. Int. Dairy Fed. 362, 5-17.

Nielsen, S.S., Toft, N., 2006. Age-specific characteristics of ELISA and fecal culture for
purpose-specific testing for paratuberculosis. J. Dairy Sci. 89, 569-579.

Nielsen, S.S., Toft, N, 2007. Assessment of management-related risk factors for paratuberculosis
in Danish dairy herds using Bayesian mixture models. Prev. Vet. Med. 81, 306-317.









Nielsen, S.S., Toft, N., 2008. Ante mortem diagnosis of paratuberculosis: A review of accuracies
of ELISA., interferon-gamma assay and faecal culture techniques. Vet. Microbiol.
doi:10.1016/j.vetmic.2007.12.011.

Nielsen, S.S., Toft, N., Jorgensen, E., Bibby, B.M., 2007. Bayesian mixture models for
within-herd prevalence estimates of bovine paratuberculosis based on a continuous ELISA
response. Prev. Vet. Med. 81, 290-305.

Nordlund, K.V., Goodger, W.J., Pelletier, J., Collins, M.T., 1996. Associations between
subclinical paratuberculosis and milk production, milk components, and somatic cell
counts in dairy herds. J. Am. Vet. Med. Assoc. 208, 1872-1876.

Office International Des Epizooties (OIE), 2004. Manual of Diagnostic Tests and Vaccines for
Terrestrial Animals. Part II. World Animal Health (Eds.), 12, rue de Prony -75017 Paris,
France.

Ogura, Y., Bonen, D.K., Inohara, N., Nicolae, D.L., Chen, F.F., Ramos, R., Britton, H., Moran,
T., Karaliuskas, R., Duerr, R.H., Achkar, J.P., Brant, S.R., Bayless, T.M., Kirschner, B.S.,
Hanauer, S.B., Nufiez, G., Cho, J.H., 2001. A frameshift mutation in NOD2 associated
with susceptibility to Crohn's disease. Nature. 411, 603-606.

Ogura, Y., Inohara, N., Benito, A., Chen, F.F., Yamaoka, S., Nunez, G., 2001a. Nod2, a
Nodl/Apaf-1 family member that is restricted to monocytes and activates NF-kappa B. J.
Biol. Chem. 276, 4812-4818.

Osterstock, J.B., Fosgate, G.T., Cohen, N.D., Derr, J.N., Manning, E.J., Collins, M.T., Roussel,
A.J., 2007a. Familial associations with paratuberculosis ELISA results in Texas Longhorn
cattle. Vet. Microbiol. doi: 10.1016/j.vetmic.2007.10.027.

Osterstock, J.B., Fosgate, G.T., Derr, J.N., Cohen, N.D., Roussel, A.J., 2008. Assessing familial
aggregation of paratuberculosis in beef cattle of unknown pedigree. Prev. Vet. Med. 84,
121-34.

Osterstock, J.B., Fosgate, G.T., Norby, B., Manning, E.J.B., Collins, M.T., Roussel, A.J., 2007.
Contribution of environmental mycobacteria to false-positive serum ELISA results for
paratuberculosis. J. Am. Vet. Med. Assoc. 230, 896-901.

Ott, S.L., Wells, S.J., Wagner, B.A., 1999. Herd-level economic losses associated with Johne's
disease on US dairy operations. Prev. Vet. Med. 40, 179-192.

Ottenhoff, T.H., Verreck, F.A., Lichtenauer-Kaligis, E.G., Hoeve, M.A., Sanal, 0., van Dissel,
J.T., 2002. Genetics, cytokines and human infectious disease: lessons from weakly
pathogenic mycobacteria and salmonellae. Nat. Genet. 32, 97-105.

Paixdo, T.A. Poester, F.P., Carvalho Neta, A.V., Borges, A.M., Lage, A.P., Santos, R.L., 2007.
NRAMP1 3' Untranslated Region Polymorphisms Are Not Associated with Natural
Resistance to Brucella abortus in Cattle. Infect. Immun. 75, 2493-2499.









Palomino, J.C., 2007. Tuberculosis 2007. From basic science to patient care. In: Palomino, J.C.,
Leao, S.C., Ritacco, V., (Eds.), www.TuberculosisTextbook.com. First Edition, pp 93-105.

Paustian, M.L., Amonsin, A., Kapur, V., Bannantine, J.P., 2004. Characterization of novel
coding sequences specific to Mycobacterium avium subsp. paratuberculosis: implications
for diagnosis of Johne's Disease. J. Clin. Microbiol. 42, 2675-2681.

Pence, M., Baldwin, C., Black 3rd, C.C., 2003. The seroprevalence of Johne's disease in Georgia
beef and dairy cull cattle. J. Vet. Diagn. Invest. 15, 475-477.

Pillai, S.R. Jayarao, B.M., 2002. Application of IS900 PCR for detection of Mycobacterium
avium subsp. paratuberculosis directly from raw milk. J. Dairy Sci. 85, 1052-1057.

Pritchard, J.K., Donnelly, P., 2001. Case-control studies of association in structured or admixed
populations. Theor. Popul. Biol. 60, 227-237.

Quesniaux, V., Fremond, C., Jacobs, M., Parida, S., Nicolle, D., Yeremeev, V., Bihl, F., Erard,
F., Botha, T., Drennan, M., Soler, M., Le Bert, M., Schnyder, B., Ryffel, B., 2004. Toll-
like receptor pathways in the immune responses to mycobacteria. Microbes Infect. 6,
946-959.

Qureshi, T., Templeton, J.W., Adams, L.G., 1996. Intracellular survival of Brucella abortus,
Mycobacterium bovis (BCG), Salmonella dublin and Salmonella typhimurium in
macrophages from cattle genetically resistant to Brucella abortus. Vet. Immunol.
Immunopathol. 50, 55-66.

Raberg, L.,Sim, D., Read, A.F., 2007. Disentangling genetic variation for resistance and
tolerance to infectious diseases in animals. Science. 318, 812-814.

Raizman, E.A., Fetrow, J., Wells, S.J., Godden, S.M., Oakes, M.J., Vazquez, G., 2007. The
association between Mycobacterium avium subsp. paratuberculosis fecal shedding or
clinical Johne's disease and lactation performance on two Minnesota, USA dairy farms.
Prev. Vet. Med. 78, 179-195.

Raizman, E.A., Wells, S.J., Godden, S.M., Bey, R.F., Oakes, M.J., Bentley, D.C., Olsen, K.E.,
2004. The distribution of Mycobacterium avium ssp. paratuberculosis in the environment
surrounding Minnesota Dairy farms. J. Dairy Sci. 87, 2959-2966.

Rajeev, S., Zhang, Y., Sreevatsan, S., Motiwala, A.S., Byrum, B., 2005. Evaluation of multiple
genomic targets for identification and confirmation of Mycobacterium avium subsp.
paratuberculosis isolates using real-time PCR. Vet. Microbiol. 105, 215-221.

Ravva, S.V., Stanker, L.H., 2005. Real-time quantitative PCR detection of Mycobacterium avium
subsp. paratuberculosis and differentiation from other mycobacteria using SYBR Green
and TaqMan assays. J. Microbiol. Methods. 63, 305-317.









Reddacliff, L.A., Beh, K., Mc Gregor, H., Whittington, R.J., 2005. A preliminary study of
possible genetic influences on the susceptibility of sheep to Johne's disease. Aust. Vet. J.
83, 435-441.

Reiling, N., Holscher, C., Fehrenbach, A., Kroger, S., Kirschning, C.J., Goyert, S., Ehlers, S.,
2002. Cutting edge: Toll-like receptor (TLR)2- and TLR4-mediated pathogen recognition
in resistance to airborne infection with Mycobacterium tuberculosis. J. Immunol. 169,
3480-3484.

Ren, Z., Turton., J., Borody, T., Pang, G., Clancy, R., 2008. Selective Th2 pattern of cytokine
secretion in Mycobacterium avium subsp. paratuberculosis infected Crohn's disease. J.
Gastroenterol Hepatol. 23, 310-314.

Roach, J.C., Glusman, G., Rowen, L., Kaur, A., Purcell, M.K., Smith, K.D., Hood, L.E.,
Aderem, A., 2005. The evolution of vertebrate Toll-like receptors. PNAS. 102, 9577-9582.

Robbe-Austerman, S., Stabel, J.R., Morrical, D.G., 2007. Skin test and gamma interferon
enzyme-linked immunosorbent assay results in sheep exposed to dead Mycobacterium
avium subspecies paratuberculosis organisms. J. Vet. Diagn. Invest. 19, 88-90.

Rodriguez-Lazaro, D., D'Agostino, M., Herrewegh, A., Pla, M., Cook, N., Ikonomopoulos, J.,
2005. Real-time PCR-based methods for detection ofMycobacterium avium subsp.
paratuberculosis in water and milk. Int. J. Food Microbiol. 101, 93-104

Roupie, V., Rosseels, V., Piersoel, V., Zinniel, DK., Barletta, R.G., Huygen, K., 2008. Genetic
resistance of mice toM. avium subsp. paratuberculosis is influenced by SLC11A1 at early
but not at late stage of infection. Infect. Immun. doi:10.1128/IAI.01137-07.

Roussel, A.J., Fosgate, G.T., Manning, E.J.B., Collins, M.T., 2007. Association of fecal shedding
of mycobacteria with high ELISA-determined seroprevalence for paratuberculosis in beef
herds. J. Am. Vet. Med. Assoc. 230, 890-895.

Roussel, A.J., Libal, M.C., Whitlock, R.L., Hairgrove, T.B., Barling, K.S., Thompson, J.A.,
2005. Prevalence of and risk factors for paratuberculosis in purebred beef cattle. J. Am.
Vet. Med. Assoc. 226, 773-778.

Sartor, R.B., 2005. Does Mycobacterium avium subspecies paratuberculosis cause Crohn's
disease? Gut. 54, 896-898

Scanu, A.M., Bull, T.J., Cannas, S., Sanderson, J.D., Sechi, L.A., Dettori, G., Zanetti, S.,
Hermon-Taylor, J.H., 2007. Mycobacterium avium subspecies paratuberculosis infection
in cases of irritable bowel syndrome and comparison with Crohn's disease and Johne's
disease: common neural and immune pathogenicities. J. Clin. Microbiol. 45, 3883-3890.

Schaid, D.J., Jacobsen, S.J., 1999. Biased tests of association: comparisons of allele frequencies
when departing from Hardy-Weinberg proportions. Am. J. Epidemiol. 149, 706-711.









Schleig, P.M., Buergelt, C.D., Davis, J.K., Williams, E., Monif, G.R., Davidson, M.K., 2005.
Attachment ofMycobacterium avium subspecies paratuberculosis to bovine intestinal
organ cultures: Method development and strain differences. Vet. Microbiol. 108, 271-279.

Schmidt, P., Kuhn, C., Maillard, J.C., Pitra, C., Tiemann, U., Weikard, R., Schwerin, M., 2002.
A comprehensive survey for polymorphisms in the bovine IFN-gamma gene reveals a
highly polymorphic intronic DNA sequence allowing improved genotyping of Bovinae. J.
Interferon Cytokine Res. 22, 923-934.

Schreiber, S., 2005. Of mice and men: What to learn about human inflammatory bowel disease
from genetic analysis of murine inflammation. Gastroenterology 129, 1782-1784.

Schroder, N.W.J., Schumann, R.R., 2005. Single nucleotide polymorphisms of Toll-like
receptors and susceptibility to infectious disease. Lancet Infect. Dis. 5, 156-164.

Sechi, L.A., Gazouli, M., Ikonomopoulos, J., Lukas, J.C., Scanu, A.M., Ahmed, N., Fadda, G.,
Zanetti, S., 2005a. Mycobacterium avium subsp. paratuberculosis, genetic susceptibility to
crohn's disease, and Sardinians: the way ahead. J. Clin. Microbiol. 43, 5275-5277.

Sechi, L.A., Gazouli, M., Sieswerda, L.E., Molicotti, P., Ahmed, N., Ikonomopoulos, J., Scanu,
A.M., Paccagnini, D., Zanetti, S., 2006. Relationship between Crohn's disease, infection
with Mycobacterium avium subspecies paratuberculosis and SLC 11Al gene
polymorphisms in Sardinian patients. World J. Gastroenterol 12, 7161-7164.

Sechi, L.A., Scanu, M., Molicotti, P., Cannas, S., Mura, M., Dettori, G., Fadda, G., Zanetti, S.,
2005. Detection and isolation of Mycobacterium avium subspecies paratuberculosis from
intestinal mucosal biopsies of patients with and without Crohn's disease in Sardinia. Am. J.
Gastroenterol 100, 1529-1536.

Seitz, S.E., Heider, L.E., Heuston, W.D., Bech-Nielsen, S., Rings D.M., Spangler, L., 1989.
Bovine fetal infection with Mycobacterium paratuberculosis. J. Am. Vet. Med. Assoc.
194, 1423-1426.

Selby, W., 2000. Pathogenesis and therapeutic aspects of Crohn's disease. Vet. Microbiol. 77,
505-511.

Shanahan, F., O'Mahony, J., 2005. The mycobacteria story in Crohn's disease. Am. J.
Gastroenterol. 100, 1537-1538.

Sharma, B.S., Leyva, I., Schenkel, F., Karrow, N.A., 2006. Association of Toll-like receptor 4
polymorphisms with somatic cell score and lactation persistency in Holstein bulls. J. Dairy
Sci. 89, 3626-3635.

Sherman, D.M., Markham, R.J., Bates, F., 1984. Agar gel immunodiffusion test for diagnosis of
clinical paratuberculosis in cattle. J. Am. Vet. Med. Assoc. 185, 179-182.

Shim, T.S., Turner, O.C., Orme I.M., 2003. Toll-like receptor 4 plays no role in susceptibility of
mice to Mycobacterium tuberculosis infection. Tuberculosis (Edinb). 83, 367-371.









Shtrichman, R., Samuel, C.E., 2001. The role of gamma interferon in antimicrobial immunity.
Curr. Opin. Microbiol. 4, 251-259

Silverman, E.K., Palmer, L.J., 2000. Case-control association studies for the genetics of complex
respiratory diseases. Am. J. Respir. Cell Mol. Biol., 22, 645-648.

Skamene, E., Schurr, E., Gros, P., 1998. Infection genomics: NRAMP1 as a major determinant of
natural resistance to intracellular infections. Annu. Rev. Med. 49, 275-287.

Sockett, D.C., Conrad, T.A., Thomas, C.B., Collins, M.T., 1992. Evaluation of four serological
tests for bovine paratuberculosis. J. Clin. Microbiol. 30, 1134-1139.

Sohala, J.S., Singha, S.V., Subodhc, S., Sheoranb, N., Narayanasamyb, K., Singha, P.K., Singha,
A.V., Maitrad, A., 2007. Mycobacterium avium subspecies paratuberculosis diagnosis and
geno-typing: Genomic insights. Microbiol. Res. doi:10.1016/j.micres. 2007.03.005.

Spangler, E., Heider, L.E., Bech-Nielsen, S., Dor, C.R., 1991. Serologic enzyme-linked
immunosorbent assay responses of calves vaccinated with a killed Mycobacterium
paratuberculosis vaccine. Am. J. Vet. Res. 52, 1197-1200.

St. Amand, A.L., Frank, D.N., De Groote, M.A., Pace, N.R., 2005. Use of specific rRNA
oligonucleotide probes for microscopic detection ofMycobacterium avium complex
organisms. J. Clin. Microbiol. 43, 1505-1514.

Stabel, J.R., 1997. An improved method for cultivation ofMycobacterium paratuberculosis from
bovine fecal samples and comparison to three other methods. J. Vet. Diagn. Invest. 9,
375-380.

Stabel, J.R., 1998. Johne's disease: A hidden threat. J. Dairy Sci. 81, 283-288.

Stabel, J.R., 2001. An evaluation of a modified interferon-gamma assay for the detection of
paratuberculosis in dairy herds. Vet. Immunol. Immunopathol. 79, 69-81.

Stabel, J.R., Ackerman M.R., 2002. Temporal Mycobacterium paratuberculosis infection in
T-cell receptor (TCR)-alpha and TCR-delta deficient mice. Vet. Immunol. Immunopathol.
89, 127-132.

Stabel, J.R., Bannantine, J.P., 2005. Development of a nested PCR method targeting a unique
multicopy element, ISMAP02, for detection of Mycobacterium avium subsp.
paratuberculosis in fecal samples. J. Clin. Microbiol. 43, 4744-4750.

Stabel, J.R., Wells, S.J., Wagner, B.A., 2002. Relationships between fecal culture, ELISA, and
bulk tank milk test results for Johne's disease in US dairy herds. J. Dairy Sci. 85, 525-531.

Stear, M.J., Bishop, S.C., Mallard, B.A., Raadsma, H., 2001. The sustainability, feasibility and
desirability of breeding livestock for disease resistance. Res. Vet. Sci. 71, 1-7.









Stehman, S.M., 1996. Paratuberculosis in small ruminant, deer, and South American camelids.
Vet. Clin. North Am. Food Anim. Pract. 12, 441-455.

St-Jean, G., Jemigan, A.D., 1991. Treatment ofMycobacterium paratuberculosis infection in
ruminants. Vet. Clin. North Am. Food Anim. Pract. 7, 793-804.

Stober, C.B., Brode, S., White, J.K., Popoff, J.F., Blackwell, J.M., 2007. SLC11A1, formerly
NRAMP1, is expressed in dendritic cells and influences major histocompatibility complex
class ii expression and antigen-presenting cell function. Infect. Immun. 75, 5059-5067.

Stokkers, P.C., de Heer, K., Leegwater, A.C, Reitsma, P.H., Tytgat, G.N., van Deventer, S.J.,
1999. Inflammatory bowel disease and the genes for the natural resistance-associated
macrophage protein-1 and the interferon-gamma receptor 1. Int. J. Colorectal Dis. 14,
13-17.

Streeter, R.N., Hoffsis, G.F., Bech-Nielsen, S., Shulaw, W.P., Rings, D.M., 1995. Isolation of
Mycobacterium paratuberculosis from colostrum and milk of subclinically infected cows.
Am. J. Vet. Res. 56, 1322-1324.

Strober, W., Murray, P.J., Kitani, A., Watanabe, T., 2006. Signalling pathways and molecular
interactions of NOD] and NOD2. Nat. Rev. Immunol. 6, 9-20.

Strommenger, B., Stevenson, K., Gerlach, G.F., 2001. Isolation and diagnostic potential of
ISMav2, a novel insertion sequence-like element from Mycobacterium avium subspecies
paratuberculosis. FEMS Microbiol. Lett. 196, 31-37.

Sugimura, K., Taylor, K.D., Lin, Y., Hang, T., Wang, D., Tang, Y., Fischel-Ghodsian, N.,
Targan, S.R., Rotter, J.I., Yang, H., 2003. A Novel NOD2/CARD15 haplotype conferring
risk for Crohn's disease in Ashkenazi Jews. Am. J. Hum. Genet. 72, 509-518.

Sweeney, R.W., Whitlock, R.H., Buckley, C.L., Spencer, P.A., 1995. Evaluation of a
commercial enzyme-linked immunosorbent assay for the diagnosis of paratuberculosis in
dairy cattle. J. Vet. Diagn. Invest. 7, 488-493.

Sweeney, R.W., Whitlock, R.H., Hamir, A.N., Rosenberger, A.E., Herr, S.A., 1992. Isolation of
Mycobacterium paratuberculosis after oral inoculation in uninfected cattle. Am. J. Vet.
Res. 53, 1312-1314.

Sweeney, R.W., Uzonna, J., Whitlock, R.H., Habecker, P.L., Chilton P., Scott, P., 2006. Tissue
predilection sites and effect of dose on Mycobacterium avium subs. paratuberculosis
organism recovery in a short-term bovine experimental oral infection model. Res. Vet. Sci.
80, 253-259.

Sweet, L., Schorey, J.S., 2006. Glycopeptidolipids from Mycobacterium avium promote
macrophage activation in a TLR2- and MyD88-dependent manner. J. Leukoc. Biol. 80,
415-423.









Swiderek, W.P., Bhide, M.R., Gruszczynska, J., Soltis, K., Witkowska, D., Mikula, I., 2006.
Toll-like receptor gene polymorphism and its relationship with somatic cell concentration
and natural bacterial infections of the mammary gland in sheep. Folia Microbiol. (Praha).
51, 647-652.

Taddei, S., Robbi, C., Cesena, C., Rossi, I., Schiano, E., Arrigoni, N., Vicenzoni, G., Cavirani,
S., 2004. Detection ofMycobacterium avium subsp. paratuberculosis in bovine fecal
samples: comparison of three polymerase chain reaction-based diagnostic tests with a
conventional culture method. J. Vet. Diagn. Invest. 16, 503-508.

Takeda, K., Kaisho, T., Akira, S., 2003. Toll-like receptors. Annu. Rev. Immunol. 21, 335-376.

Tanaka S., Sato, M., Onitsuka, T., Kamata, H., Yokomizo, Y., 2005. Inflammatory cytokine gene
expression in different types of granulomatous lesions during asymptomatic stages of
bovine paratuberculosis. Vet. Pathol. 42, 579-588.

Tasara, T., Hoelzle, L.E., Stephan, R., 2005. Development and evaluation of a Mycobacterium
avium subspecies paratuberculosis (MAP) specific multiplex PCR assay. Int. J. Food
Microbiol. 104, 279-287.

Tasara, T., Stephan, R., 2005. Development of an F57 Sequence-based real-time PCR assay for
detection of Mycobacterium avium subsp. paratuberculosis in milk. Appl. Environ.
Microbiol. 71, 5957-5968.

Taylor, K.H., Taylor, J.F., White, S.N., Womack, J.E., 2006. Identification of genetic variation
and putative regulatory regions in bovine CARD15. Mamm. Genome. 17, 892-901.

Taylor, T.K., Wilks, C.R., McQueen, D.S., 1981. Isolation ofMycobacterium paratuberculosis
from the milk of a cow with Johne's disease. Vet. Rec. 109, 532-533.

Teare, M.D., Barrett, J.H., 2005. Genetic linkage studies. Lancet. 366, 1036-1044.

Thorne, J.G., Hardin, L.E., 1997. Estimated prevalence of paratuberculosis in Missouri, USA
cattle. Prev. Vet. Med. 31, 51-57.

Tiwari, A., VanLeeuwen, J.A., Dohoo, I.R., Stryhn, H., Keefe, G.P. Haddad, J.P., 2005. Effects
of seropositivity for bovine leukemia virus, bovine viral diarrhoea virus, Mycobacterium
avium subspecies paratuberculosis, and Neospora caninum on culling in dairy cattle in
four Canadian provinces. Vet. Microbiol. 109, 147-158.

Tiwari, A., VanLeeuwen, J.A., McKenna, S.L., Keefe, G.P., Barkema, H.W., 2006. Johne's
disease in Canada Part I: Clinical symptoms, pathophysiology, diagnosis, and prevalence
in dairy herds. Can. Vet. J. 47, 874-882.

Toman, M., Faldyna, M., Pavlik, I., 2003. Immunological characteristics of cattle with
Mycobacterium avium subsp. paratuberculosis infection. Vet. Med-Czech. 48, 147-154.









Trinh, T.T., Rioux, J.D., 2005. Understanding the association and causality in the genetic studies
of inflammatory bowel disease. Gastroenterology. 129, 2106-2110.

Tysk, C., 1998. Genetic susceptibility in Crohn's disease-review of clinical studies. Eur. J. Surg.
164, 893-896.

Underhill D.M., Ozinsky, A., Smith, K.D., Aderem, A., 1999. Toll-like receptor-2 mediates
mycobacteria-induced proinflammatory signaling in macrophages. Proc. Natl. Acad. Sci. U
S A. 96, 4459-4463.

Uzoigwe, J.C., Khaitsa, M.L. Gibbs, P.S., 2007. Epidemiological evidence for Mycobacterium
avium subspecies paratuberculosis as a cause of Crohn's disease. Epidemiol. Infect. 135,
1057-1068.

Uzonna, J.E., Chilton, P., Whitlock, R.H., Habecker P.L., Scott, P., Sweeney, R.W., 2003.
Efficacy of commercial and field-strain Mycobacterium paratuberculosis vaccinations with
recombinant IL-12 in a bovine experimental infection model. Vaccine. 21, 3101-3109.

Valentin-Weigand P., Goethe, R., 1999. Pathogenesis of Mycobacterium avium subspecies
paratuberculosis infections in ruminants: still more questions than answers. Microbes
Infect. 1, 1121-1127.

Van der Giessen, J.W., Haring, R.M., Vauclare, E., Eger, A., Haagsma, J., van der Zeijst, B.A.,
1992. Evaluation of the abilities of three diagnostic tests based on the polymerase chain
reaction to detect Mycobacterium paratuberculosis in cattle: application in a control
program. J. Clin. Microbiol. 30, 1216-1219.

Van Heel, D.A., McGovern, D.P.B., Jewell, D.P., 2001. Crohn's disease: genetic susceptibility,
bacteria, and innate immunity. Lancet. 357, 1902-1904.

Van Schaik, G., Rossiter, C.R., Stehman, S.M., Shin, S.J., Schukken, Y.H., 2003. Longitudinal
study to investigate variation in results of repeated ELISA and culture of fecal samples for
Mycobacterium avium subsp paratuberculosis in commercial dairy herds. Am. J. Vet. Res.
64, 479-484.

Van Schaik, G., Stehman, S.M., Jacobson, R.H., Schukken, Y.H., Shin, S.J., Lein, D.H., 2005.
Cow-level evaluation of a kinetics ELISA with multiple cutoff values to detect fecal
shedding of Mycobacterium avium subspecies paratuberculosis in New York State dairy
cows. Prev. Vet. Med. 72, 221-236.

Vanleeuwen, J.V., Keefe, G.P., Tremblay, R., Power, C., Wichtel, J.J., 2001. Seroprevalence of
infection with Mycobacterium avium subspecies paratuberculosis, bovine leukemia virus,
and bovine viral diarrhea virus in maritime Canada dairy cattle. Can. Vet. J. 42, 193-198.

Vary. P.H., Andersen, P.R., Green, E., Hermon-Taylor, J., McFadden, J.J., 1990. Use of highly
specific DNA probes and the polymerase chain reaction to detect Mycobacterium
paratuberculosis in Johne's disease. J. Clin. Microbiol. 28, 933-937.









Veazey, R.S., Horohov, D.W., Krahenbuhl, J.L., Taylor, H.W., Oliver III, J.L., Snider III, T.G.,
1995. Comparison of the resistance of C57BL/6 and C3H/He mice to infection with
Mycobacterium paratuberculosis. Vet. Microbiol. 47, 79-87.

Vergne, I., Chua, J., Sigh, S.B., Deretic, V., 2004. Cell biology of Mycobacterium tuberculosis
Phagosome. Annu. Rev. Cell. Dev. Biol. 20, 367-394

Vinh, D., Bersrtein, C., 2005. Crohn's Disease and M. paratuberculosis: Where's the beef?
Inflamm. Bowel Dis.11, 1025-1027.

Von Reyn, C.F., Waddell, R.D., Eaton, T., Arbeit, R.D., Maslow, J.N., Barber, T.W., Brindle,
R.J., Gilks, C.J., Lumio, J., Lahdevirta, J., Ranki, A., Dawson, D., Falkinham, J.O., 1993.
Isolation ofMycobacterium avium complex from water in the United States, Finland,
Zaire, and Kenya. J. Clin. Microbiol. 31, 3227-3230.

Wang, T., Lafuse, W.P., Takeda, K., Akira, S., Zwillin, B.S., 2002. Rapid chromatin remodeling
of toll-like receptor 2 promoter during infection of macrophages with Mycobacterium
avium. J. Immunol. 169, 795-801.

Ward, M.P., Perez, AM., 2004. Association between soil type and paratuberculosis in cattle
herds. Am. J. Vet. Res. 65, 10-14.

Weiss, D.J., Evanson, O.A., Deng, M., Abraham, M.S., 2004. Gene expression and antimicrobial
activity of bovine macrophages I response to Mycobacterium avium subsp.
paratuberculosis. Vet. Pathol. 41, 326-337.

Weiss, D.J., Evanson, O.A., Souza, C.D., Abrahamsen. M.S., 2005. A critical role of
interleukin-10 in the response of bovine macrophages to infection with Mycobacterium
avium subsp. paratuberculosis. Am. J. Vet. Res. 66, 721-726.

Weiss, S.T., Silverman, E.K., Palmer, L.J., 2001. Case-Control Association Studies in
Pharmacogenetics. Pharmacogenomics J. 1, 157-158.

Weiss, D.J., Souza, C.D., Evanson, O.A., Sanders, M., Rutherford, M., 2008. Bovine monocyte
TLR2 receptors differentially regulate the intracellular fate ofMycobacterium avium
subsp. paratuberculosis and Mycobacterium avium subsp. avium. J. Leukoc. Biol. 83,
48-55.

Wells, S.J. Collins, M.T., Faaberg, K.S., Wees, C., Tavompanich, S., Petrini, K.R. Collins, J.E.,
Cemicchiaro, N., Whitlock, R.H., 2006. Evaluation of a rapid fecal PCR test for detection
of Mycobacterium avium subsp. paratuberculosis in dairy cattle. Clin. Vaccine Immunol.
13, 1125-1130.

Wells, S.J., Godden, S.M., Lindeman, C.J., Collins, J.E., 2003. Evaluation of bacteriologic
culture of individual and pooled fecal samples for detection of Mycobacterium
paratuberculosis in dairy cattle herds. J. Am. Vet. Med. Assoc. 223, 1022-1025.









Wells, S.J., Whitlock, R.H., Lindeman, C.J., Fyock, T., 2002. Evaluation of bacteriologic culture
of pooled fecal samples for detection ofMycobacterium paratuberculosis. Am. J. Vet. Res.
63, 1207-1211.

Werling, D., Piercy, J., Coffey, T.J., 2006. Expression of TOLL-like receptors (TLR) by bovine
antigen-presenting cells-potential role in pathogen discrimination? Vet. Immunol.
Immunopathol. 112, 2-11.

White, S.N., Kata, S.R., Womack, J.E., 2003a. Comparative fine maps of bovine Toll-like
receptor 4 and Toll-like receptor 2 regions. Mamm. Genome. 14, 149-155.

White, S.N., Taylor, K.H., Abbey, C.A., Gill, C.A., Womack, J.E., 2003b. Haplotype variation in
bovine Toll-like receptor 4 and computational prediction of a positively selected
ligand-binding domain. Proc Natl Acad Sci U S A. 100, 10364-10369.

Whitlock, R.H., Buergelt, C.D., 1996. Preclinical and clinical manifestations of paratuberculosis
(Including pathology). Vet. Clin. North Am. Food Anim. Pract. 12, 345-56.

Whitlock, R.H., Buskirk, M., Sweeney, R.H., Hutchinson, L.T., 1994. Pennsylvania Johne's
disease control program (1973-1993): a review of the twenty years program. In: Chiodini,
R.J., Collins, M.T., Bassey, E.O.E. (Eds.), Proceedings of the Fourth International
Colloquium on Paratuberculosis, Cambridge, United Kingdom, pp. 102-110.

Whitlock, R.H., Rosenberger, A.E., 1990. Fecal culture protocol for Mycobacterium
paratuberculosis. A recommended procedure. Proc. Ann. Meeting US Anim. Hlth. Assoc.
94, 280-285.

Whitlock, R. H., Rosenberger, A.E., Sweeney, R.W., Hutchinson, L.J., 1991. Culture techniques
and media constituents for the isolation ofMycobacterium paratuberculosis from bovine
fecal samples. In: Chiodini, R.J., Kreeger, J. (Eds.), Proceedings of the Third International
Colloquium on Paratuberculosis, Orlando, FL, USA, pp. 94-111.

Whitlock, R.H., Wells, S.J., Sweeney, R.W., Van Tiem, J., 2000. ELISA and fecal culture for
paratuberculosis (Johne's disease): sensitivity and specificity of each method. Vet.
Microbiol. 77, 387-398.

Whittington, R.J., Marsh, I., Choy, E., Cousins, D., 1998. Polymorphisms in IS1311, an insertion
sequence common to Mycobacterium avium and M avium subsp. paratuberculosis, can be
used to distinguish between and within these species. Mol. Cell Probes. 12, 349-358.

Whittington, R.J., Marsh, I.B., Reddacliff, L.A., 2005. Survival of Mycobacterium avium subsp.
paratuberculosis in dam water and sediment. Appl. Environ. Microbiol. 71, 5304-5308.

Whittington, R.J., Marsh, I.B., Whitlock, R.H., 2001. Typing of IS1311 polymorphisms confirms
that bison (Bison bison) with paratuberculosis in Montana are infected with a strain of
Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and
other domesticated livestock. Mol. Cell. Probes. 15,139-145.









Whittington, R.J., Sergeant, E.S.G., 2001. Progress towards understanding the spread, detection
and control ofMycobacterium avium subspecies paratuberculosis in animal populations.
Aust. Vet. J. 79, 267-278.

Whittington, R.J., Windsor, P.A., 2007. In utero infection of cattle with Mycobacterium avium
subsp. paratuberculosis: A critical review and meta-analysis. Vet. J.
doi:10.1016/j.tvjl.2007.08.023

Wilkie, B., Mallard, B., 1999. Selection for high immune response: an alternative approach to
animal maintenance? Vet. Immunol. Immunopathol. 72, 231-235.

Womack, J.E., 2005. Advances in livestock genomics: Opening the barn door. Genome Res. 15,
1699-1705.

Woo, S.R., Czuprynski, C.J., 2008. Tactics ofMycobacterium avium subsp. paratuberculosis for
intracellular survival in mononuclear phagocytes. J. Vet. Sci. 9, 1-8.

Wu, C.W., Livesey, M., Schmoller, S.K., Manning, E.J., Steinberg, H., Davis, W.C., Hamilton,
M.J., Talaat, A.M., 2007. Invasion and persistence of Mycobacterium avium subsp.
paratuberculosis during early stages of Johne's disease in calves. Infect. Immun. 75,
2110-2119.

Yadav, M., Schorey, J.S., 2006. The P-glucan receptor Dectin-1 functions together with TLR2 to
mediated macrophage activation by mycobacteria. Blood. 108, 3168-3175.

Yang, W., Zerbe, H., Petzl, W., Brunner, R.M., Ginther, J., Draing, C., von Aulock, S.,
Schuberth, H.J., Seyfert, H,M., 2008. Bovine TLR2 and TLR4 properly transduce signals
from Staphylococcus aureus and E. coli, but S. aureus fails to both activate NF-kappaB in
mammary epithelial cells and to quickly induce TNF alpha and interleukin-8 (CXCL8)
expression in the udder. Mol. Immunol. 45, 1385-1397.

Yokomizo, Y.,1986. Evaluation on an enzyme-linked immunosorbent assay (ELISA) using
Mycobacterium phlei-absorbed serum for the diagnosis of bovine paratuberculosis in a
field study. Jpn. Ag. Res. Q. 20, 60-67.

Yokomizo, Y., Merkal, R.S., Lyle, P.A.S., 1983. Enzyme-linked immunosorbent assay for
detection of bovine immunoglobulin G1 antibody to a protoplasmic antigen of
Mycobacteriumparatuberculosis. Am. J. Vet. Res. 44, 2205-2206.

Zelinkova, Z., Stokkers, P., Hommes, D.W., 2005. NOD2 in Crohn's disease-loss or gain of
function mutations? Neth. J. Med. 63, 286-7.

Zhao, B., Collins, M.T., Czuprynski, C.J., 1997. Effects of gamma interferon and nitric oxide on
the interaction of Mycobacterium avium subsp. paratuberculosis with bovine monocytes.
Infect. Immun. 65, 1761-1766.

Zheng, G., Tian, X., 2005. The impact of diagnostic error on testing genetic association in case-
control studies. Statist. Med. 24, 869-882.









Zondervan, K.T., Cardon, L.R., 2004. The complex interplay among factors that influence allelic
association. Nat. Rev. Genet. 5, 89-100.

Zwick, L.S., Walsh, T.F., Barbiers, R., Collins, M.T., Kinsel, M.J., Murnane, R.D., 2002.
Paratuberculosis in a mandrill (Papio sphinx). J. Vet. Diagn. Invest. 14, 326-328.









BIOGRAPHICAL SKETCH

Pablo J. Pinedo was born in 1967 in Santiago de Chile, where he was raised, enjoying a

childhood surrounded by family and friends. In 1987 he enrolled in the College of Veterinary

Medicine in the Universidad de Chile where he graduated with honors. He moved to an

agricultural region in the south of Chile, and started working at a dairy cooperative, focusing on

cattle genetics and dairy record management. During this time he met Pilar and they were

married three years later. After some years, two of the most important events in his life occurred:

the arrival of his two sons, Santiago and Pablo (today 5 and 7 years old). After 10 years

practicing veterinary medicine, the opportunity of continuing his education by pursuing a PhD

presented itself when he was awarded the UF College of Veterinary Medicine Alumni

Fellowship. Leaving behind a structured life, Pilar and Pablo decided to face this new adventure

and the family flew to Gainesville, Florida. Since fall 2004, he has been in the Doctor of

Philosophy program in the Large Animal Clinical Sciences Department of the College of

Veterinary Medicine at the University of Florida under the supervision of Dr. Owen Rae,

working on diagnostics and genetics of bovine paratuberculosis.





PAGE 1

1 DIAGNOSTIC TOOLS AND GENETIC SUSCEPTI BILITY FACTORS ASSOCIATED WITH BOVINE PARATUBERCULOSIS INFECTION By PABLO J. PINEDO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Pablo J. Pinedo

PAGE 3

3 To Pilar, Pablito and Santiago

PAGE 4

4 ACKNOWLEDGMENTS Several people have been instrumental in the completion of this project. Foremost, I desire to express my special gratitude to the members of my advisory committee: Dr. Owen Rae, Chair of my committee, for his constant support a nd advice and for his permanent willingness to discuss and exchange ideas about this project; Dr Claus Buergelt for generously sharing with me his invaluable experience and knowledge in J ohne’s disease and for hi s permanent help in seeking out opportunities to enrich my training; Dr. Art Donovan fo r his support as a member of my committee and for his key comments during the analysis of our data; Dr. Pedro Melendez for his support, friendship and help dur ing the research process; and Dr. Laurence Morel for her help as an external member of my committee. I owe my gratitude to Dr. Louis Archbald for his ongoing interest, strong support and good advice. I thank also Elliot Williams for his fr iendship and his tremendous help with the laboratory procedures. I am grateful to Dr. Taimour Langaee and Dr. Rongling Wu for their technical support in the genotyping process and in the statistical analysis. I thank also my colleagues and fellow graduate students from FARMS for their friendship and valuable suggestions. I am thankful for the financial s upport received from the Florida Dairy Farmers Association through the Florida Dairy Check-Off Program and th e 2007 University of Florida, College of Veterinary Medici ne Spring Consolidated Facult y Research Development Award Grant Competition. I also thank INSECABIO (Ch ile) for its strong support during this process. I thank my parents for my education, their support and guidance, and my boys Pablito and Santiago for bringing me back to the real world every evening. But, above all, I owe my gratitude to my wi fe Pilar who left her own interests aside and postponed her professional developmen t to live this adventure with me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES................................................................................................................ .......11 LIST OF ABBREVIATIONS........................................................................................................12 ABSTRACT....................................................................................................................... ............14 CHAPTER 1 INTRODUCTION................................................................................................................. .16 2 LITERATURE REVIEW.......................................................................................................19 The Agent...................................................................................................................... .........19 Genus Mycobacterium .....................................................................................................19 Mycobacterium Paratuberculosis Characteristics...........................................................21 Environmental Ubiquity and Physical Resiliency...........................................................22 Strains........................................................................................................................ ......24 Mycobacterium Paratuberculosis Genome.....................................................................26 Genome sequence.....................................................................................................27 Insertion sequences..................................................................................................27 Insertion sequence 900 .............................................................................................29 Antigens...................................................................................................................30 Johne’s Disease................................................................................................................ .......31 Definition..................................................................................................................... ....31 Spectrum in Animal Species...........................................................................................32 Pathology...................................................................................................................... ...33 Stages of the Disease.......................................................................................................37 Stage 1, silent infection............................................................................................37 Stage 2, subclinical disease......................................................................................37 Stage 3, clinical disease............................................................................................38 Stage 4, advanced clinical disease............................................................................38 Epidemiology..................................................................................................................3 9 Prevalence and risk factors.......................................................................................39 Transmission of infection.........................................................................................43 Immune Response to MAP..............................................................................................45 Diagnostics.................................................................................................................... .........48 Tests Based on Agent Detection......................................................................................49 Fecal smear and acid-fast stain.................................................................................49 Bacteriologic culture in feces...................................................................................49

PAGE 6

6 Automated systems..................................................................................................53 Polymerase chain reaction (PCR)............................................................................54 PCR on milk.............................................................................................................57 PCR on feces............................................................................................................58 Detection of Host Response to Infection.........................................................................61 Clinical signs, gross a nd microscopic pathology.....................................................61 Cellular immune response........................................................................................62 Interferon gamma assay (IFN-g)..............................................................................62 Hypersensitivity reaction (Skin test)........................................................................63 Lymphocyte proliferation.........................................................................................64 Humoral immune response.......................................................................................65 Complement fixation and agar gel immunodiffusion (AGID).................................65 Enzyme-linked immunosorbent assay (ELISA).......................................................65 Agreement among serum ELISA kits......................................................................69 Milk/serum ELISA...................................................................................................71 Disease Control................................................................................................................ .......72 Epidemiological Factors in Control.................................................................................72 Host factors..............................................................................................................72 Natural reservoirs and environmental factors..........................................................73 Population factors.....................................................................................................75 Control Programs.............................................................................................................76 Justification..............................................................................................................78 Management practices..............................................................................................79 Testing and diagnostics in control programs............................................................80 Vaccination...............................................................................................................82 Treatment.................................................................................................................85 Productive and Economic Impact of Johne’s Disease............................................................86 Crohn’s Disease................................................................................................................ ......93 The Disease.................................................................................................................... .93 Etiology....................................................................................................................... ....95 Crohn’s Disease and CARD15/NOD2 Gene....................................................................95 Mycobacterium Paratuberculosis and Crohn’s Disease.................................................99 Genetics in Animal Production.............................................................................................105 Genetic Basis of Disease Re sistance and Susceptibility...............................................105 Genetic Component in My cobacterial Infection...........................................................107 Genetics and Paratuberculosis.......................................................................................108 Candidate Genes............................................................................................................111 Candidate Genes in Study.....................................................................................................11 2 Caspase Recruitment Domain 15 gene ( CARD15 formerly NOD2 )............................112 Solute Carrier 11A1 ( SLC11A1), Formerly Natural Resistance Associated Macrophage Protein 1 ( NRAMP1 ).............................................................................112 Role in immunity....................................................................................................113 Role in inflammatory bowel disease......................................................................115 Association with disease susceptibility in cattle....................................................116 Interferon Gamma.........................................................................................................119 Toll-Like Receptors.......................................................................................................121

PAGE 7

7 Role of TLRs..........................................................................................................123 Toll-like receptor 4 gene........................................................................................125 Case Control Genetic Association Studies...........................................................................129 Genetic Epidemiology...................................................................................................129 Population Candidate Gene Association Studies..........................................................131 3 ASSOCIATION AMONG RESULTS OF SERUM ELISA, FECAL CULTURE, AND NESTED PCR ON MILK, BLOOD, AND FECES FOR THE DETECTION OF PARATUBERCULOSIS IN DAIRY COWS......................................................................136 Summary........................................................................................................................ .......136 Introduction................................................................................................................... ........137 Materials and Methods.........................................................................................................1 39 Study Population...........................................................................................................139 Sample Handling...........................................................................................................139 Milk samples..........................................................................................................139 Extraction of DNA on milk....................................................................................140 Blood samples........................................................................................................140 Extraction of DNA on blood..................................................................................140 Enzyme-Linked Immunosorbent Assay........................................................................140 Fecal Culture.................................................................................................................1 41 Extraction of DNA on Feces.........................................................................................142 Nested Polymerase Chain Reaction...............................................................................142 Statistical Analysis........................................................................................................143 Results........................................................................................................................ ...........144 Discussion..................................................................................................................... ........145 4 Mycobacterium paratuberculosis SHEDDING INTO MILK: ASSOCIATION OF ELISA SEROREACTIVITY WITH DNA DETECTION IN MILK...................................160 Summary........................................................................................................................ .......160 Introduction................................................................................................................... ........160 Materials and Methods.........................................................................................................1 61 Study Population...........................................................................................................161 Sample Handling, Milk Samples...................................................................................162 Blood Samples...............................................................................................................162 Nested Polymerase Chain Reaction (PCR)...................................................................163 Enzyme-Linked Immunosorbent Assay........................................................................163 Analysis....................................................................................................................... ..164 Results........................................................................................................................ ...........165 Discussion..................................................................................................................... ........166 5 ASSOCIATION BETWEEN CARD15 GENE POLYMORPHISMS AND PARATUBERCULOSIS INFECTION IN FLORIDA CATTLE........................................176 Summary........................................................................................................................ .......176 Introduction................................................................................................................... ........177

PAGE 8

8 Materials and Methods.........................................................................................................1 78 Study Population...........................................................................................................178 Diagnosis...................................................................................................................... .179 Genotyping....................................................................................................................1 79 Extraction of DNA.................................................................................................179 Allele determination...............................................................................................180 Statistical Analysis........................................................................................................180 Results........................................................................................................................ ...........181 Discussion..................................................................................................................... ........183 6 ANALYSIS OF THE ASSOCIATION BETWEEN THREE CANDIDATE GENES (BOIFNG, TLR4, SLC11A1 ) AND PARATUBERCULOSIS INFECTION IN CATTLE..194 Summary........................................................................................................................ .......194 Introduction................................................................................................................... ........194 Material and Methods........................................................................................................... 196 Study Population...........................................................................................................196 Diagnosis...................................................................................................................... .197 Genotyping....................................................................................................................1 97 Allele determination...............................................................................................197 Bovine IFNG and TLR4 genes................................................................................197 Microsatellite analysis for SLC11A1 gene.............................................................199 Statistical Analysis........................................................................................................200 Results........................................................................................................................ ...........201 Bovine IFNG Gene........................................................................................................201 Toll-Like Receptor 4 Gene.............................................................................................202 Solute Carrier Family 11 Member 1 Gene....................................................................203 Discussion..................................................................................................................... ........203 LIST OF REFERENCES............................................................................................................. 213 BIOGRAPHICAL SKETCH.......................................................................................................246

PAGE 9

9 LIST OF TABLES Table page 3-1 Number and proportion of positive resu lts for ELISA, nested PCR on milk, blood and feces, and for fecal culture among 328 dairy cattle in four herds.............................152 3-2 Cross classification of number of positive results for the five tests (above the diagonal). The diagonal shows the number of positive animals for each test (n=328)...153 3-3 Maximum possible agreement beyond chance fo r each combination of test pairs (%)...154 3-4 Kappa coefficient asymmetric standa rd error (above diagonal) and agreement interpretation (below diagonal) for each combination of test pairs.................................155 3-5 Right-sided P F for Fisher’s Exact Test for each combination of test pairs (above the diagonal). P S for McNemar’s Test for each co mbination of test pairs (bellow the diagonal).................................................................................................................. ...156 3-6 Odds ratios (95% CI) for posit ive results in pairs of tests...............................................157 3-7 Complementary sensitivity (CS) for each te st when combined with a different test (%)............................................................................................................................ ........158 4-1 DNA detection of MAP in milk by nest ed PCR grouped by ELISA result categories (number and % of animals, n: 98 cows)..........................................................................170 4-2 ELISA results and DNA detection of MAP in milk by nested PCR...............................171 4-3 Results for 21 serial testing (9 months) in cow Id#3900. Milk and blood PCR results are given relevant to ELISA cate gories in concurrent testing.........................................172 4-4 Serial results for milk PCR, and seru m ELISA in a group of five individuals................173 4-5 Cows that were positive to MAP DNA by PCR detection in milk are grouped by their corresponding serum ELISA status.........................................................................174 4-6 Serial results for cow Id#6142 tested by MAP PCR on individual quarter milk samples and concurrent serum ELISA.............................................................................175 5-1 Alleles: Cross classificati on of number (%) of cases (+) and controls (-) and alleles for SNP1 and SNP2.........................................................................................................188 5-2 Genotypes: Cross classifi cation of number (%) of cases (+) and controls (-) and genotypes for SNP1 and SNP2........................................................................................189 5-3 Complete genotypes: Cross classification of number (%) of cases (+) and controls (-) and genotypes combining SNP1 and SNP2.....................................................................190

PAGE 10

10 5-4 Univariate analysis of the individual animal odds of paratuberculosis infection among dairy and beef cattle in Florida............................................................................190 5-5 Multivariate analysis of the individual animal odds of paratuberculosis infection among dairy and beef cattle in Florida............................................................................192 6-1 Frequency of cases per genotype and significance for the association between genotype and infection status ( BoIFNG, TLR4 and SLC11A1 genes).............................206 6-2 Bovine IFNG and TLR4 genes: Univariate analysis of the individual animal odds of paratuberculosis infection among da iry and beef cattle in Florida..................................207 6-3 Univariate analysis of the individual animal odds of paratuberculosis infection among dairy and beef cattle in Florida ( SLC11A1 gene).................................................208 6-4 Bovine IFNG : Multivariate analysis of th e individual animal odds of paratuberculosis infection among da iry and beef cattle in Florida..................................209 6-5 Allele SLC11A1 -275: Multivariate analysis of the individual animal odds of paratuberculosis infection among da iry and beef cattle in Florida..................................210 6-6 Allele SLC11A1 -279: Multivariate analysis of the individual animal odds of paratuberculosis infection among da iry and beef cattle in Florida..................................211 6-7 Allele SLC11A1 -281: Multivariate analysis of the individual animal odds of paratuberculosis infection among dair y and beef cattle in Florida ()..............................212

PAGE 11

11 LIST OF FIGURES Figure page 2-1 Clinical cases............................................................................................................. ......135 2-2 Variation in ELISA optical de nsity in two Holstein cows...............................................135 3-1 Diagnostic tests........................................................................................................... .....159 5-1 Beef cattle population..................................................................................................... .193 5-2 Dairy cattle population.................................................................................................... .193

PAGE 12

12 LIST OF ABBREVIATIONS AGID Agar gel immunodiffusion bp Base pairs BoIFNG Bovine Interferon gamma CARD15 Caspase recruitment domain family, member 15 CS Complementary sensitivity CD Crohn’s disease CFU Colony-forming units DNA Deoxyribonucleic acid ELISA Enzyme-linked immunosorbent assay ER ELISA ratio IBD Inflammatory bowel disease IFN-g Interferon gamma IL Interleukin IS Insertion sequence JD Johne’s disease MAC Mycobacterium avium complex MAP Mycobacterium avium subspecies paratuberculosis MHC Major histocompatibility complex NF-Kb nuclear factor-kappa B NOD2 Nucleotide-binding oligomeri zation domain containing 2 NRAMP1 Natural resistance-associ ated macrophage protein 1 ORF Open reading frame PCR Polymerase chain reaction PFGE Pulsed field gel electrophoresis

PAGE 13

13 REA Restriction endonuclease analysis RNA Ribonucleic acid RFLP Restriction fragment length polymorphism SLC11A1 Solute carrier family 11, member 1, SNP Single nucleotide polymorphism TLR Toll-like receptor TNF Tumor necrosis factor UC Ulcerative colitis

PAGE 14

14 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DIAGNOSTIC TOOLS AND GENETIC SUSCEPTI BILITY FACTORS ASSOCIATED WITH BOVINE PARATUBERCULOSIS INFECTION By Pablo J. Pinedo August 2008 Chair: Owen Rae Major: Veterinary Medical Sciences Our first objective (Studies 1-2) was to an alyze the association among results of five different diagnostic tests for de tection of paratuberculosis in fection in cat tle. Our second objective (Studies 3-4) was to characterize th e distribution of polymor phisms in four immune related genes and test their associ ation with susceptibility to paratu berculosis infection in cattle. In Study 1, results of a serum ELISA, fecal cu lture, and nested PCR tests on milk, blood, and feces for Mycobacterium paratuberculosis (MAP) detection were analyzed to determine associations and levels of agr eement between pairs of tests. Th e agreement between results was poor, slight and fair in two, five and three of the ten possible combinations. Fecal culture and fecal PCR resulted in the highest kappa coeffici ent (fair agreement). Combined use of ELISA and fecal PCR has the potential to increase th e overall sensitivity for the diagnosis of paratuberculosis. In Study 2, the association between ELISA se roreactivity and MAP presence in milk, as detected by nested PCR was analyzed. An irregu lar pattern of detecti on was observed for PCR outcomes along with fluctuations in serial ELISA results. Kappa coefficient indicated a slight agreement between both tests, s uggesting that the abil ity of serum ELISA, as indicator of the likelihood of milk shedding of MAP in dairy cows, is questionable.

PAGE 15

15 In Studies 3 and 4, polymorphisms in four candi date genes related to the immune function; caspase recruitment domain 15 gene (CARD15) interferon gamma (BoIFNG), toll-like receptor-4 (TLR4) and solute carrier family 11 member 1 (SLC11A1) were analyzed. Significant differences were found in allelic freque ncies between cases and controls for CARD15SNP2197/C733R, BoIFNG -SNP2781 and SLC11A1 microsatellites. In the analysis of genotypes, a significant association wa s found between infection status and CARD15SNP2197/C733R, BoIFNG SNP2781 and SLC11A1-275-279-281 microsatellites. When variables breed and age were included in th e multivariate logistic regression analysis, the only statistically significant effect was for CARD15SNP2197/C733R polymorphism The estimated odds of infection for heterozygous cows were 3.35 times the odds of infection of cows homozygous for the major genotype. Results suggest a role for CARD15 gene in the susceptibility of cattle to paratuberculosis infection.

PAGE 16

16 CHAPTER 1 INTRODUCTION Paratuberculosis (Johne’s diseas e) is a chronic, infectious disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), and characterized by progressive weight loss and profuse diarrhea (Chiodini et al., 1984). The disease has a worldwide distribution and is categorized by the Office International Des Epizoo ties as a list B disease, which is a serious economic or public health concern (OIE, 2004). Most cattle with Johne’s dis ease are infected as calves by fecal-oral transmission, and in utero transmission has also been reported (Sei tz et al., 1989; Whitlock and Buergelt, 1996). However, young animals manifest no clinical signs and the incubation period is variable, ranging from 2 to 10 years (Bassey and Collins, 1997; Whitlock et al., 2000; Stabel and Ackerman, 2002). Diagnosis of paratuberculosis is hampered by a lack of accurate tests. Available methods fail to identify all infected animals (false negative results), and some produce substantial numbers of false positives (Chiodi ni et al., 1984). Tests for detect ion of antibodies to MAP, such as enzyme-linked immunosorbent assays (ELISA) present the major disadvantage of moderate to low sensitivity. The usefulness of serological te sts is compromised by the variability of the immune response depending on the stage of disease. For this reason, it is generally accepted that their sensitivity in detecting in fected animals is only about 30 % (Collins et al., 2006), and the ELISA test rarely gives a positive result in animal s under 2 years of age, and frequently fails to detect individuals in the early phases of infection (Juste et al., 2005). Despite these disadvantages, ELISA testing of sera is still th e method of choice for epidemiological studies and herd-based diagnosis (Bottcher and Gangl, 2004).

PAGE 17

17 Tests based on the detection of the agent like wise present the problem of low sensitivity. The shedding of MAP organisms in feces can be intermittent and detection by culture is imperfect, especially because of contamination, and when few organi sms are shed in feces. It has been estimated that fecal culture detects only ab out 50% of cattle infect ed with MAP (Stabel, 1997). The introduction of diagnostic methods ba sed on specific bacterial DNA sequences has allowed fastidious microorganisms, such as MAP, to be rapidly identified. Polymerase chain reaction (PCR) tests based on the insertion element IS 900 have been the most widely used for MAP identification (Harris and Barleta, 2001). Howe ver, the detection of the etiologic agent is limited by the presence of inhibitory substances, and the frequency and number of organisms that are present in the body fluid or tissue being test ed. The isolation of MA P from sites other than the intestinal tract, such as udder, kidney, liver, male reproductive tract and blood, have suggested active dissemination of the bacteria and opens the possibility for detection of the agent by PCR in fluids such as milk and blood of su spicious animals (Buergelt and Williams, 2004). A combination of independent tests is a common method to improve reliability of laboratory diagnostic tools. As a result of the se tbacks of MAP diagnosis, such strategies have already been implemented by using a combina tion of bacterial fecal culture and PCR or serological screening and bacterial fecal culture (Collins et al., 2006). Moreover, a combination of tests with different sensitivities and specificiti es allows a classification of animals and herds relative to the probabili ty of MAP infection (B ottcher and Gangl, 2004). A broader knowledge of the behavior and asso ciation between different diagnostic tests is desirable for the implementation of strategies ba sed on the combination of different tests, which could be a useful approach to improve the sensitivity of MAP detection.

PAGE 18

18 In another front, the use of hos t genetic resistance to diseas e is an attractive option as a component of livestock disease control. Genetic f actors have been associated with differences in host susceptibility to bovine pa ratuberculosis, and estimations indicate a range of moderate values for heritability of infection (Koets et al., 2000; National Research Council, 2003; Mortensen et al., 2004, Gonda et al., 2006). Rese arch has also been aimed at detecting associations between susceptibility differences and polymorphisms in candidate genes with no definite results (Hinger et al ., 2007; Taylor et al., 2006; Gonda et al., 2005, 2007). A candidate gene case-control study aimed at immune related genes is a pract ical approach for testing the involvement of host genetics in paratuberculosis infection. The hypothesis of studies 1 and 2 was that di fferent degrees of a ssociation exist among tests detecting MAP infection. Ou r objective was to analyze the association among results of a serum ELISA, fecal culture, and nested PCR on milk, blood, and feces for MAP detection in dairy cows. The central hypothesis of studies 3 and 4 was th at a combination of pa rticular alleles in four candidate genes would be present in high er frequency in case individuals compared to controls, suggesting a role in su sceptibility to infection. The ob jective of this candidate gene case-control study was to characterize the di stribution of polymorphisms in the bovine CARD15, BoIFNG, TLR4 and SLC11A1 genes and test their association with susceptibility to paratuberculosis infection in Florida dairy and beef cattle.

PAGE 19

19 CHAPTER 2 LITERATURE REVIEW The Agent Genus Mycobacterium Mycobacteria are members of the taxonomic group that includes the genera Corynebacterium, Mycobacterium and Nocardia (CMN group) and the genus Rhodococcus (Cocito et al., 1994). Mycobacteria are non-motile a nd non-sporulated rods and ar e grouped in the supra-generic rank of Actinobacteria with a high content (61-71%) of gua nine plus cytosine (G+C) in the genomic DNA, and high lipid content in the wall probably the highest among all bacteria. They also present several mycolic acids in the envelope structure that distingu ish the genus (Palomino et al., 2007). These acid-fast organisms include a number of major human and animal pathogens, comprising over 100 species of obligate parasite s, saprophytes, or opportunistic pathogens. Mycobacteria are structurally more closely related to Gram-positive bacteria; however, the genus does not fit into this category gi ven that cell wall molecules are li pids rather than proteins or polysaccharides (Palomino et al., 2007). Based on genomic analysis, this genus has b een divided into two separate clusters, corresponding to the traditional fast-growing mycobacteria, represented by nonpathogenic environmental isolates, and the slow-growing mycobacteria, containing most of the overt pathogens (Harris and Barleta, 2001). Slow-growing mycobacteria of importance in veterinary medicine are found in two major complexes; M. tuberculosis and M. avium. The M. tuberculosis complex includes M. tuberculosis, M. bovis, and M. microti. M. tuberculosis causes tuberculosis in man, primates,

PAGE 20

20 dogs and other animals. M. bovis causes tuberculosis in cattle, domestic and wild ruminants, man and other primates, and swine and other an imals (Eglund, 2002). On the other hand, the Mycobacterium avium complex (MAC) consists of genetically similar bacteria including M. avium subsp. avium M. avium subsp. paratuberculosis M. avium subsp. silvaticum M. avium subsp. hominis and M. intracellulare MAC organisms are opportunistic pat hogens present in multiple locations; although human exposure to MAC is ubiqu itous, most individuals rarely develop infection (St. Amand et al., 2005). M. avium causes avian tuberculosis, and M. intracellulare rarely causes disease in birds, but causes severe pulmonary diseases in man and can be isolated from swine and cattle. M. silvaticum (wood-pigeon Mycobacterium ) is an obligate pathogen for birds, and MAP, a pathogen for ruminants, is an obligate parasite unable to replicate in the environment (Eglund, 2002). Another classification of mycobact eria relates to its ability to replicate in the environment. Environmental opportunistic mycobacteria ar e distinguished from the members of the M. tuberculosis complex by the fact that th ey are not obligate pathogens but are true inhabitants of the environment, exhibiting a notorious hardiness, an acid-fast cell wall containing mycolates, and intracellular pathogeni city (National Animal Monitoring System, 1997). The subspecies designation of M. avium is based on DNA-DNA hybrid ization studies and numerical taxonomy analysis (Biet et al ., 2005). At the subspecies level, MAP can be differentiated phenotypically from the other MAC members by its dependence on mycobactin and, genotypically, by the presence of multiple copies of an insertion element, IS 900 (Harris and Barletta, 2001). An exclusive feature of mycobacteria is the structure and com position of their cell envelope, with an inner layer composed of peptidoglycan linked to arabinogalactan

PAGE 21

21 polysaccharides which are esterified with highmolecular weight mycolic acids, and an outer stratum composed of lipids. A notorious molecule of the cell envelope is a lipopolysaccharide, lipoarabinomannan, with properties comparable to those of the O-antigenic lipopolysaccharide of Gram-negative bacteria (Weigand and Goethe, 1999). The waxy coat confers the distinctive characteristics of the genus: acid fastness, extreme hydrophobicity, resistance to environmental exposure, and distinctive immunol ogical properties. It probably al so contributes to the slow growth rate of some species by restricting the uptake of nutri ents (Palomino et al., 2007). Mycobacterium Paratuberculosis Characteristics Mycobacterium avium subsp paratuberculosis is a small, facultative intracellular, acid-fast bacillus, occurring in clumps entangled with one another by a network of intracellular filaments (Chiodini et al., 1984). The main distinguishing feature of this subspecies is its need for exogenous mycobactin for in vitro growth. Mycobactin is an ir on chelating agent produced by almost all mycobacteria and MAP, in particular, is unable to pr oduce this element in laboratory culture (Chiodini et al., 1984; Li et al., 2005). This siderophore is responsible for the transport of iron into cells, and is a high-mo lecular-weight complex lipid, cont aining a core to which Fe is coordinately linked. While a dependence on metals for growth is common to all bacteria, the iron requirement of pathogenic mycobact eria is peculiar in that an or ganic source of this metal is needed for its uptake and utilization (Cocito et al., 1994). Iron plays a key role in both electron transport and composition of meta bolic enzymes, and the ability to acquire iron from various sources is crucial for bacteria (Li et al., 2005) Mycobactin is unique to mycobacteria and nocardiae, but mycobactin dependence is no long er considered pathognom onic for identification of MAP since mycobactin-dependent M. silvaticum and M. avium strains have been identified (Cocito et al., 1994).

PAGE 22

22 MAP is an obligate parasite of animals; the only place it can multiply in nature is in a susceptible host, within a macropha ge. Out of the host it can survive for extended periods, but it is unable to multiply. Accordingly, the primary s ource of infection with MAP is an infected animal; though, there is evidence that MAP can exist in vegeta tive, cell wall deficient and dormant forms (Grant, 2005). MAP cell wall is acid-fast and resists decolori zation with acidified alcohol because of the presence of a waxy material that makes the cell s difficult to disrupt. Under the microscope MAP cells appear as rods 1–2 m in length, which typically occur as clumps of up to several hundred bacterial cells (Grant, 2005). Environmental Ubiquity and Physical Resiliency Environmental mycobacteria are normal inhab itants of a wide variety of environmental reservoirs, including water, soil, and aerosols. Water is likely the primary source of MAC infection in humans and environmental myc obacteria are capable of biofilm formation. Environmental mycobacteria also have an extrao rdinary ability to surv ive starvation, persisting despite low nutrient levels, and extreme temperature. M. avium and M. intracellulare have an acidic pH optimum for growth between 4.5 and 5.5, and have been recovered in large numbers from waters and soils of low oxygen levels (National Animal Monitoring System, 1997). MAP’s cell wall enables the organism to persis t in the environment and contributes to its resistance to low pH, high temperature, and chemical agents (Manning, 2001). Resistance to disinfection: Although the effects of chlori ne and phenolic compounds on MAP are unknown, M. avium is more resistant to free chlorine than are most other bacteria (Manning, 2001). Survival in water, soil, and manure: As reviewed by Manning (2001), in a 1944 study, MAP survived up to 246 days in manure outdoors. In water of pH 7.0, MAP has been recovered

PAGE 23

23 up to 17 months post-inoculation. A pH above 7.0 and low iron content may reduce viability, as may soil drying and exposure to sunlight. Howe ver, in another study survival time was not affected by ultraviolet light. A lower positive sero logy rate for MAP infection in dairy cattle was associated with the application of lime to past ures, although a direct asso ciation between soil pH and MAP survival has not been established. Vo n Reyn et al. (1993) cult ured 91 water samples from environmental sites and piped water supply systems in the United States, Finland, Zaire, and Kenya, and MAC was isolated from all geogra phic areas and from 22 of 91 (24%) samples. Whittington et al. (2005), studied th e survival of MAP in dam water and sediment in either a semi exposed or in a shaded location, compared to survival in fecal material and soil in a shaded location. Survival of MAP in water and/or sediment in the shade was up to 48 weeks compared to 36 weeks in the semi exposed location. Survival in soil and fecal material in the terrestrial environment in the shaded location was only 12 weeks, suggesting that water may be a significant reservoir of MAP infection. Finally, in another study (Ward and Perez, 2004), the survival of MAP was analyzed by culture of fecal material sampled from soil and grass in pasture plots and boxes. Survival for up to 55 weeks was observed in a dry fully shaded environment. The organism survived for up to 24 weeks on grass that germinated through infected fecal material in completely shaded boxes and for up to 9 weeks on grass in 70% shade (Ward and Perez, 2004). Thermal tolerance: MAP is more thermo-resistant than M. avium M. chelonae M. phlei M. scrofulaceum and M. xenopi This heat tolerance decreases th e effectiveness of pasteurization for killing organisms in the milk of infected animals. It has been suggested that the heat-resistance of MAP may be influenced by its tendency to occur as clumps of cells. Bact eria in the center of large clumps may be protected, or

PAGE 24

24 alternatively, because the clumps contain up to 10,000 cells, a proportion of the cells will survive a non-sterilizing heat treatm ent (Grant et al., 2005). In testing units of whole pasteurized m ilk from retail outlets throughout central and southern England, it was found that, over three month periods, up to 25% of commercial units sampled were affected by the presence of MA P DNA (Millar et al., 1996). In a study in the Czech Republic, MAP was cultured from 1.6% of comm ercially pasteurized re tail milk (Ayele et al., 2005). A US’ study found viable MAP in 2.8% of milk samples taken from grocery stores in three states (Ellingson et al ., 2005). In Britain, viable M. paratuberculosis was found in 1.9% of raw and 2.1% of pasteurized milk samples, suggesting that some MAP cells may survive pasteurization and can possibly be consumed by humans (Manning, 2001). Resistance to ultraviolet light: Most bacteria and viruses are sensitive to ultraviolet (UV) light, but the pH, hardness, turbidity, and biolog ic oxygen demand in water can significantly alter the UV dose needed for inactivation. Laboratory trials with distilled water show that MAP is as susceptible to UV inactivation as other bacteria. In contrast, UV light may have minimal effect on the organism’s viability in MAP spiked soil (Manning, 2001). Strains Different strains of MAP have been determined, however, isolates of MAP from different clinical sources have few dis tinguishing phenotypic ch aracteristics. The main features that differentiate strains of MAP in culture are the rate at which th ey grow and, sometimes, variations in colony pigmentation. However, several methods have been developed to discriminate closely related strains (National Research Council, 2003). As presented by the National Research C ouncil (2003), non-molecular methods are based on serology, differences in biochemical proper ties, antimicrobial susceptibility, and phage typing. Molecular-strain typing has had a great influence on studies of MAP Among the

PAGE 25

25 techniques used are restricti on fragment length polymorphism (RFLP) analysis of DNA, pulsedfield gel electrophoresis of DNA, and multip lex PCR typing. RFLP has been used most extensively. Sequences from IS 900 are the most widely used probe in RFLP analysis of MAP. At the present, the main MAP strains have been classified into three groups (cattle, sheep and intermediate types), based on RFLP, analysis coupled with hybridizat ion to the insertion sequence IS 900 (IS 900 -RFLP) and culture characteristics. Ho wever, other strains affecting bison ( Bison bison ) and differentiated by typing of IS 1311 polymorphisms have also been reported (Whittington et al., 2001), The cattle type (C), the most common in Europe has been isolated primarily from cattle and other domestic and wild ruminants, non-ruminant species, and also humans. The sheep (S) type strains are extremely slow growers and in this group are included: (i) pigmented and non-pigmented strains isolated fr om sheep in Morocco, Scotland, Iceland, South Africa, Australia and New Zealand; (ii) strains is olated from cattle from Australia and Iceland; (iii) strains isolated from goats from New Zeal and. The intermediate group has been described in a few ovine isolates from South Africa, Canada and Iceland as well as caprine isolates from Spain (Stehman, 1996; de Juan et al., 2006). A similar division of strains has been achie ved by characterization by pulsed field gel electrophoresis (PFGE). PFGE allo ws the division of MAP isolates into three main groups: Types I, II and III, which woul d correspond with the sheep, catt le and intermediate groups, respectively. PCR-based techniques, requiring lower amounts of high quality DNA divide the MAP strains in two main groups that would corre spond with the cattle or Type II, and the sheep or Types I/III (de Juan et al., 2006). The capacity to differentiate individu al strains of MAP is essential for evaluating routes of transmission and characteristics of pathogenesis. It is important

PAGE 26

26 also, for livestock producers to be able to identi fy the source of a new infection because that information often will dictate corr ective action. Different control strategies depend on whether a new infection results from introduc ing livestock from another herd or is attributable to animal contact with something in the farm environmen t, such as contaminated pasture (National Research Council, 2003). On the other hand, differe nt strains present different exigencies for culture and that is a point that should be consider ed to evaluate the possibility of false negatives results. Species specificity among strains has been s uggested and separate st rains of MAP may be isolated from various ruminant species and may account for some of the differences in culture diagnosis. Observations indicate that the ovine st rain is unlikely to be transmitted to cattle. However, the occurrence of a sheep strain in cat tle has been reported, indi cating that interspecies transmission can not be ruled out (Motiwala et al., 2003) and, probably, most strains can infect across ruminant species lines and sh ould be regarded as infectious to ruminant species other than the species of origin (Stehman, 1996). A final point refers to the hypothesis that different strains of MAP vary in their ability to attach to different regions of the intestinal tract at different rates. However, Schleig et al. (2005) repo rted significant differences in st rains ability to attach, but not in attachment among different regions of intestine. Mycobacterium Paratuberculosis Genome The size of the MAP genome has been estimated to be 4.4 to 4.7 Mbp. Compared to other mycobacteria, this is similar to the M. tuberculosis genome (4.41 Mbp) and the M. bovis genome (4.4 Mbp) but slightly larger than the estimated size of the genome of M. leprae (3.3 Mbp). MAP DNA has a base composition of 66 to 67% G+C, similar to M. tuberculosis and M. bovis (Harris and Barleta, 2001). Recent work in mycobact erial genomics has revealed large sequence polymorphisms as the major contributor of genetic diversity (S ohala et al., 2007).

PAGE 27

27 Genome sequence Recently, the complete genome sequence of MA P was reported (Li et al., 2005). The strain used was MAP K-10 which is a virule nt, low passage clinical strain isolated from a dairy herd in Wisconsin. MAP K-10 has a single circul ar sequence of 4,829,781 base pairs, with a G+C content of 69.3%. Approximately 1.5% (or 72.2 kb) of the MAP genome is comprised of repetitive DNA like insertion sequences, multigen e families, and duplicated housekeeping genes (Li et al., 2005). Seventeen copies of the insertion sequence IS 900 seven copies of IS 1311 and three copies of IS Mav2 with a total of 16 additional MAP insertion sequence elements have been identified. Li et al. (2005) determined that K-10 genome contains 4,350 ORFs with lengths ranging from 114 bp to 19,155 bp, which, in sum, account for 91.5% of the entire genome. A cluster of 10 genes in Mycobacterium tuberculosis has been shown to be responsible for the production of mycobactin and the transport of iron. Homologs to this cluster were identified in the MAP genome. However, a direct comp arison of the cluster in MAP with those of Mycobacterium avium and Mycobacterium tuberculosis show significant differences in primary structure of this region (Li et al., 2005). Insertion sequences Insertion sequences (IS) are relatively short DNA segments capable of transposing within and between prokaryotic genomes, often causi ng insertional mutations and chromosomal rearrangements. Use of IS as probes provides discrimination due to the tendency of these transposable elements to insert randomly and o ccupy multiple sites in th e genome. The discovery of insertion sequences in myc obacteria has provided an approach for characterizing MAC isolates (Bhide et al., 20 06; Motiwala et al., 2006).

PAGE 28

28 The first MAC insertion sequence, IS 900 was identified in MAP cultures and was determined to be a unique characteristic of th is subspecies (Collins et al., 1989; Green et al., 1989). IS 900 elements are found in multiple copies per genome and provide the diagnostic advantage of improved sensitivity for MAP detection in PCR procedur es. The closely related insertion sequences, IS 901 and IS 902 were discovered subsequently, and more recently, IS 1245 and IS 1311 have been identified in MAC is olates (Motiwala et al., 2006). Insertion sequence 1245 is present in M. avium subsp. avium and M. avium subsp. silvaticum but was recently demonstrated not to be present in the MAP genome (Johansen et al., 2005) A closely related IS element, IS 1311 shows 85% sequence identity with IS 1245 at the DNA level. It is present in M. avium subsp. avium and MAP and has been detected in strains of M. intracellulare Mycobacterium malmoense and Mycobacterium scrofulaceum Whittington et al. (1998), found 7–10 copies of IS 1311 in strains of MAP. With a given restriction enzyme, the RFLP patterns obtained from isolates of MAP from cattle were all identical, but they differed from those of isolat es from sheep. Restric tion endonuclease analysis (REA) of the PCR product was used to distinguish isolates of MAP from M. avium in addition to the conventional test for IS 900 In isolates of MAP from cattle the IS 1311 gene was polymorphic at position 223, which enabled isolates from sheep and cattle to be distinguished by PCR-REA. Other possible target elements in MAP include the F57, IS Mav2 and Hsp X sequences. The F57 and Hsp X sequences are present as sing le copies, while three or more copies of IS Mav2 are present in the MAP genome (Tasara and Stephan, 2005). A lthough these markers may not be as sensitive as the multi-copy IS 900 elements, they are highly specific for MAP.

PAGE 29

29 Insertion sequence 900 IS 900 was discovered in MAP independently by tw o groups in 1989 (Collins et al., 1989; Green et al., 1989; Eglund, 2002). This 1,451 bp el ement lacks inverted terminal repeats and does not generate direct repeats in target DNA. IS 900 is a member of the IS 116 family of insertion sequences present in actinomyces and other bacteria. This group includes IS 901 IS 902 IS 1110 and IS 1643 in M. avium all of which share between 60-80% identity with IS 900 (Cousins et al., 1999). IS 900 exists in 14-18 copies in the genome of MAP and encodes a 399 amino acids putative transposase, p43, on one strand and a predicted protein, Hed, of unknown function on the opposite strand. IS 900 inserts in one direction into a consensus target sequence at highly conserved loci within the MAP genome. The insertion sites of different copies of IS 900 are similar and share a common cons ensus sequence (Bull et al., 2000). PCR targeting the 5’ end of IS 900 has been considered specific for identification of MAP and is frequently applied to confirm the presence of the organism in the diagnosis of Johne’s disease (JD). However, the specificity of such pr ocedure has been put into question over the past few years (Green et al., 1989; Cousins et al., 1999; Tasara and Stephan, 2005). Sequences that are highly homologous to MAP IS 900 have been found in other environmental Mycobacterium species. Those elements have been described fo r strains isolated from bovine feces which are positive with most of the current IS 900 PCR systems used for standard M. avium subsp. paratuberculosis detection (Bull et al., 2000). Cousins et al. (1999) re ported the finding of Mycobacterium spp. isolated from the feces of 3 clinically normal animals in Australia that appeared not to be MAP but were positive by IS 900 PCR. The isolates were characterized using mycobactin dependency, biochemical tests, IS 900 and 16 S rRNA sequencing and restriction fragment length polymorphism (RFLP), and showed

PAGE 30

30 between 71% and 79% homology w ith MAP in the region of IS 900 amplified, appearing to be most related to Mycobacterium scrofulaceum Antigens Several antigens have b een identified in mycobacteria, particularly in Mycobacterium tuberculosis but few have been identified in MAP. In the early eighties, the use of a protoplasmic antigen for immunoglobulin G1 de tection by ELISA was proposed (Yokomizo et al., 1983). This antigen is the basis for some ELISA in use at the present. Among the more recently reported antigens are the highly antigenic and conserved heat shock proteins GroES and GroEL, 2 alkyl hyd roperoxide reductases a serine protease, superoxide dismutase, and 11 ot her proteins of unknown function th at are named on the basis of their sizes in kilodaltons (B annantine et al., 2004). Other immunoreactive proteins of MAP include a 32-kDa secreted prot ein with fibronectin binding properties implicated in protective immunity and a 34-kDa cell wall antigenic pr otein homologous to a similar protein in M. leprae The M. paratuberculosis GroEL protein is homologous to similar proteins of M. tuberculosis (93%), M. leprae (89%), and M. avium (98%) (Bannantine et al., 2004). The alkyl hydroperoxide reductases C and D (AhpC and AhpD) are r ecently characterized immunogenic proteins of MAP. AhpC is the larger of the two proteins and appears to exist as a homodimer in its native form since it mi grates at both 45 and 24 kDa under denaturing conditions. In contrast, AhpD is a smaller mono mer, with a molecular mass of about 19 kDa. Other putative MAP-specific anti genic proteins have been desc ribed in the literature. These include a cellular antigen of 34.5 kDa, a 42kDa protein of unknown function, and a 44.3-kDa antigen (Harris and Barleta, 2001). Paustian et al. (2004) reported the identif ication of 13 open reading frames with no identifiable homologs. These MAP genes were cloned into Escherichia coli expression vectors,

PAGE 31

31 and nine were successfully expressed as recombin ant fusion proteins. Five of these proteins were purified in sufficient amounts to allow immunoblot analyses of their react ivity with sera from naturally infected cattle as well as mice a nd rabbits exposed to MAP. Fusion proteins representing MAP0862, MAP3732c, and MAP2963c we re recognized by nearly all of the sera tested, including those from cattle in the clinical stages of disease, and four proteins were variably recognized by sera fr om MAP-infected cattle. In another study, Leroy et al. (2007) presented a post-genomic analysis of MAP proteins where 25 candidate diagnostic antig ens were identified as specific antigens that could improve the diagnosis of paratuberculosis. Some of the antigens recognized at the pr esent are promissory, but none has been incorporated as a routine diagnostic tool accord ing to the published literature and available commercial tests. This may be due, at least in part, to the presence of these antigens in other mycobacterial species (B annantine et al., 2004). Johne’s Disease Definition Paratuberculosis (Johne’s disease) is a chronic infectious dise ase of domesticated and wild ruminants, recognized throughout the world since it was first de scribed in 1895. As presented by Kreeger (1991), at that time, Johne and Frothingham described the disease and identified the presence of acid-fast organisms in the granulom atous lesions of the intestine, considering the disease an atypical form of rumi nant tuberculosis. In 1910 the or ganism was first isolated and received the name Mycobacterium enteriditis chronica e txeudotuberculosae bovis johne, which later would be renamed Mycobacterium avium subspecies paratuberculosis The macroscopic and histological lesions of paratuberculosis remain confined to the intestine, mesenteric and ile ocecal lymph nodes (Buergelt et al., 1978), and the disease is

PAGE 32

32 characterized by granulomatous enteritis, which leads to chronic, unres ponsive diarrhea and progressive emaciation. Most often, the infectio n is acquired by the young and after a prolonged incubation phase, lasting 2 to 3 years in cattle, th e infection results in di sease (Chiodini et al., 1984). Paratuberculosis has a worldwide distri bution and is categorized by the Office International Des Epizooties as a list B disease, which is a se rious economic or public health concern (OIE, 2004). In spite of efforts directed to wards the understanding of the disease, at the present, many questions related to paratube rculosis remain unanswered (Kreeger, 1991). Spectrum in Animal Species Paratuberculosis causes enteritis primarily in cattle, goat and sheep, but the infection also occurs in other ruminants and wildlife (Eglund, 2002). MAP also multiplies in horses and mules, which become asymptomatic shedders, and laborato ry animals and birds replicate experimentally injected MAP (Cocito et al., 1994). The importa nce of wildlife reser voirs of MAP in the transmission cycle remains undetermined, and some investigations have examined the role of wildlife in the epidemiology of paratubercul osis (Alifiya et al., 2004; Motiwala, 2004). Among the wild species in which MAP ha s been reported are ruminants, such as deer (Stehman, 1996), bison (Buergelt et al., 2000, Ellingson et al., 2005a), and elk, as well as non-ruminants, such as wild rabbits (Greig et el., 1997), their predators, including foxes a nd stoats, and primates, such as mandrills and macaques (Zwick et al., 2002), indicating a wide host range. A study performed in Scotland (Beard et al., 2001) investigated 18 non-ruminant wildlife species for evidence of paratuberculosis. Using cu lture and histopathological analysis, fox, stoat, weasel, crow, rook, jackdaw, rat, wood mouse, hare, and badger were found to harbor MAP. Similarly, a survey of wild rabbits in Scotland revealed that 67% were infected with MAP,

PAGE 33

33 raising the possibility that rabb its and other wildlife may play a role in the epidemiology of paratuberculosis, with important implications fo r the control of the dise ase (Greig et al., 1997). Surveys for MAP infection in free-ranging mammals and birds were also conducted on nine dairy and beef cattle farms in Wisconsin and Georgia (Corn et al., 2005). Specimens were collected from 774 animals representing 25 mammalian and 22 avian species. MAP was cultured from tissues and feces from 39 samples from 30 animals representing nine mammalian and three avian species. The prevalence of infected wild animals by premises ranged from 2.7 to 8.3% in Wisconsin and from 0 to 6.0% in Georgia, and fecal shedding was documented in seven (0.9%) animals. Finally, a recent study in south central Wisconsin detect ed MAP specific DNA in 81 of 212 (38%) scavenging mammals, in 98 of the 472 ( 21%) tissues; viable MA P was cultured from one coyote’s ileum and lymph node tissue (Anderson et al., 2007). Pathology Entry of MAP in the host mainly occurs via th e fecal-oral route, through ingestion of fecal contaminants, milk or colostrum. Viable bacilli have also been isolated from reproductive organs of infected animals and fetuses of infected co ws. Thus, intrauterine tr ansmission is possible, though its significance in natural infection and spread of the disease remains to be fully elucidated (Seitz et al., 1989; Valentin-Wei gand and Goethe, 1999; Buergelt et al., 2006; Wittington and Winsor, 2007). Ingested MAP enter the intestinal wall through the small intestinal mucosa, primarily in the region of the ileum, via M cells residing in the Peyer’s patches (Momotani et al., 1988). Bacilli are resistant to intracellular degradation, and are eventually phago cytosed by subepithelial macrophages (Valentin-Weigand and Goethe, 1999; Koets et al., 2002; Ti wari et al., 2006). Subsequently, the infected macrophages migrate in to local lymphatics spre ading the infection to regional lymph nodes, stimulating inflammatory a nd immunological responses. MAP proliferates

PAGE 34

34 slowly in the ileal mucosa and regional ly mph nodes, and stressors such as poor nutrition, transport, parturition, and imm unosuppression have been proposed as precipitating the start of the clinical phase of inf ection (Tiwari et al., 2006). It takes years from the time of infection until development of clinical signs. Experimental infections carried out in cattle revealed that orally administ ered MAP were detectable in intestinal macrophages within a few hours after infection. The firs t granulomatous lesions were seen in the interfollicular regi ons of Peyer’s patches and mese nteric lymph nodes three months after infection, lesions exte nded into the intestinal mu cosa several months later (Valentin-Weigand and Goethe, 1999). Granulomatous lesions present in the diseas e have been classified into two types; tuberculoid and lepromatous. Tube rculoid-type lesions, which o ccur in the early stages of paratuberculosis, consist of sm all numbers of epithelioid cells and many lymphocytes, plasma cells, eosinophils, and macrophages, with limite d numbers of MAP (paucibacillary). These lesions are associated with strong cell-mediated immune res ponses on which resistance to paratuberculosis is dependent (Tanaka et al., 2005). In contrast, lepromatous-type le sions, more comon in the terminal stage of the disease, are composed mainly of macrophages and epithelioid cells bearing large numbers of mycobacteria (pluribacillary). Lepromatous-type lesions are as sociated with strong humoral immune responses in conjunction with weak cell-mediated immunity re sulting in progression of the disease, with a reduction in Th1 response and the inducti on Th2 induced humoral immunity by the anti-inflammatory cytokines inte rleukin-4 (IL-4), IL-5, IL-6, and IL-10 (Tanaka et al., 2005). In naturally infected animals, gross lesions typical of chronic ente ritis are most notably found in the distal ileum. Hist ological lesions include macrophage s with different amounts of

PAGE 35

35 intracellular mycobacteria. Although the severity of inte stinal lesions often does not correlate with occurrence of clinical signs, an association of clinical cases with a high mycobacterial load of macrophages in affected areas has been found in experimental infections. MAP has also been demonstrated in the mononuclear cell fraction of blood and tissue fluid from infected cattle, supporting the idea that macrophages may function as vehicles in dissemination of the organisms from infected sites (Valentin-Weigand and Goethe, 1999, Buergelt and Williams, 2004). The physiological mechanism for development of diarrhea is thought to be related to antigen-antibody reactions in infected tissue, with subsequent release of histamine, and different cytokines. Macroscopic lesions are found primarily in the intest ine and mesenteric lymph nodes, specifically in the region of the ileum, although they can occu r throughout the whole length of the intestinal tract. The intestinal wall is thic kened and edematous, and the mucosa has transverse folds and the serosal and mesenter ic lymphatic vessels are dilate d and thickened (Tiwari et al., 2006). The intracellular destiny of MAP remains unclear, with an intra-phagosome localization of MAP in infected tissues being most likely. A wo rk based on the mouse model demonstrated that MAP can persist in macrophages in vitro for seve ral weeks without signif icant loss of viability, but the extent of intracellula r multiplication under different cond itions has not been clarified (Valentin-Weigand and Goethe, 1999). Some experiments, using a large single oral dose suggested tonsils as the primary portal of entry following oral inoculation, with intestinal lesions developing later. However, other authors using smaller repeated doses showed the small inte stine to be the most likely portal of entry, with no evidence for entry of infection via the tons ils (Sweeney et al., 2006). M cells have been considered as an important component in the upt ake of MAP after oral inoculation (Momotani et

PAGE 36

36 al., 1988). Sweeney et al. (2006), using small oral doses, produced infection in Holstein calves detectable 3 weeks after infection, with culture pos itive sites restricted to in testinal or mesenteric lymph nodes, and with only two calves showing cultu re positive samples of spleen and tonsils. In another work, Wu et al. (2006) described a surgical approach employed to characterize the early stages of infection of calves with MAP. After inoculation in the ileum, the bacteria were able to cross the intestinal tissues within 1 hour of infection, reach ing the liver and lymph nodes. Both the ileum and the mesenteric lymph nodes were persistently infected for months despite a lack of fecal shedding of mycobacter ia. During the first 9 months of infection, the levels of cytokines detected in the ileum and the lymph node s indicated the presence of a Th1-type-associated cellular responses but not Th2-type-associated humoral responses. A recent study focused on characterizing MAP di sseminated infection in dairy cattle and on determining the role of ELISA test in detec tion of cattle with this condition. Disseminated infection was diagnosed when MAP was isolated in tissues other than th e intestines or their associated lymph nodes and was di stinguished from infection found only in the gastrointestinal tissues and from absence of infection. Of the 40 cows in the study, 21 had MAP disseminated infection. Results showed that 57% of cows w ith disseminated infection had average to high body condition and no diarrhea. Cows with dissem inated infection had no to minimal gross pathologic evidence of infection in 37% of cases Only 76% of cows with disseminated infection had positive historical ELISA results and only 62% had a positive ELISA at slaughter (Antognoli et al., 2008). Another study (Brady et al., 2008) analyzed the relationship between clinical signs, pathological changes and tissue distribution of MAP in 21 cows from herds affected by JD. The bacterium was isolated from 17 individuals, all exhibiting macroscopic lesions. However, with

PAGE 37

37 the exception of diarrhea and lesi ons in the large intestine, ther e was little correlation between the presence or absence of clinic al signs and the lesions associat ed with JD. The distribution of MAP in tissue was poorly correlated with either the clinical signs or the lesions and the bacterium was widely distributed in the tissues of some clinically normal animals. Stages of the Disease Whitlock and Buergelt (1996) proposed the fo llowing four categories of the disease, differentiated according to the se verity of clinical signs, sh edding of bacteria into the environment, and the possibil ity of infection to be dete cted using laboratory methods. Stage 1, silent infection In this stage, animals typically exhibit no overt evidence of in fection with MAP. Stage 1 is typically found in calves and heifers, most immature young stock, and many adult cattle. No routine or special clinicopathologic tests or sero logy will detect disease in these animals. Only postmortem tissue culture or, less often, histopathology can detect in fection at this early stage of disease. Stage 2, subclinical disease Most animals in stage 2 are adults that ar e carriers of MAP. The animals do not exhibit clinical signs typical of paratu berculosis, but they sometimes have detectable antibodies or exhibit altered cellular immune responses. Many are fecal-culture negative, although they intermittently shed low numbers of organisms in feces. In a small percentage (15–25%), disease can be detected by fecal culture by altered cellular immune res ponse, by serum antibodies, or by histopathology. An unknown proportion of stage 2 anim als progress slowly to clinical disease, but because so many are culled from herds for othe r reasons and before clin ical signs typical of paratuberculosis are recognized, the magnitude of the MAP inf ection within a herd can be obscured.

PAGE 38

38 Stage 3, clinical disease The clinical signs characteristic of stage 3 t ypically develop only af ter some years of MAP incubation. The initial signs are subtle; they in clude a drop in milk production, roughening of the hair coat, and gradual weight loss despite an apparently normal appetite. Over a period of several weeks, diarrhea (often intermittent at first) develo ps. In the absence of a history of herd infection, clinical diagnosis is difficult because other c onditions can result in similar signs. Because paratuberculosis diagnosis based on clinical signs is ch allenging, the first cas es in a herd often are misdiagnosed (Whittington and Sergeant, 2001). Histopathological lesions can occasionally be fo und in the intestinal tr act, with the most common site being the terminal ileum. Serum a nd plasma biochemical changes are predictable and characteristic of the clinical signs, but they are not specific enough to be of use in diagnosis of JD. Most animals test positive on fecal culture for MAP and have detectable concentrations of antibodies on commercial ELISA and agar gel immunodiffusion tests. A few unusual cases will regress to Stage 2 and remain th ere for an indeterminate period. Stage 4, advanced clinical disease Animals can progress from stage 3 to stage 4 in a few weeks, and their health deteriorates rapidly. They become increasingly lethargic, we ak, and emaciated as the disease progresses to Stage IV. Intermandibular edema due to hypopr oteinemia, cachexia, and profuse diarrhea characterize stage 4. Dissemina tion of MAP throughout the tissu es can occur. Although the organism can sometimes be cultured from sites di stant from the gastrointestinal tract, extraintestinal lesions are rarely detected. When extr a-intestinal lesions are present, the liver, other parts of the intestinal tract a nd the lymph nodes are the most comm on sites. At this stage, most animals are culled from the herd because of d ecreased milk production or severe weight loss.

PAGE 39

39 Death from JD is often the result of the seve re dehydration and cachexia (Whitlock and Buergelt, 1996). The distribution of these four stages in the population is described as “iceberg” effect; for every advanced clinical case of JD in a farm, as many as 25 other animals are expected to be infected. Only 15% to 25% of these infected animals will be detected during one test period (Whitlock and Buergelt, 1996). At any given time in an infected herd, the majority of infected animals will be in stages 1 and 2, with relativel y few animals exhibiting cl inical signs of disease i.e. stages 3 and 4 (Eglund, 2002; National Re search Council, 2003; Whitlock and Buergelt, 1996). In agreement, in a study presented by Toman et al. (2003), cows in a MAP infected herd were clinically and microbiologically monitored fo r 4 to 7 years resulting in three groups of animals showing different courses of the inf ection. One group (non-shedde rs) included animals negative by fecal culture throughout the monitori ng period. A second group (low shedders) shed sporadically small quantities of mycobacteria remaining clinically healthy throughout the monitoring period. A third group (h igh shedders) included animal s shedding repeatedly large quantities of MAP ( 10 CFU) with a progressive deterioration of the state of health in most of them. Animals with specific antibodies were found in all groups, but the percentage of serologically positive animals was significantly higher in the group of high shedders. Specific cell-mediated immunity was demonstrat ed in the group of low shedders. Epidemiology Prevalence and risk factors Various surveys have been conducted to esta blish disease incidence and prevalence in different areas of the United States. In a review presented by Kreeger et al (1991) results from a 1983 abattoir survey of 1,000 Wisc onsin cattle indicated histologi cal lesions compatible with

PAGE 40

40 paratuberculosis in 11% of the animals examin ed. Subsequent studies across the US reported paratuberculosis seroprevalences among dairy cattl e (year 1996) and beef cattle in (1997) of 2.5% and 0.4%, respectively, with at least 22% of dairy herds and 7.8% of beef herds having at least 1 seropositive animal (NAHM S, 1997; Dargatz et al., 2001a). In an extensive survey which included 32 states and Puerto Rico, lymph nodes were examined from 7,540 animals by culture techniqu es and an overall prevalence of 1.6% was found. Prevalence rates for 1983–84 in dairy and b eef cattle were 2.9% and 0.8%, respectively (Merkal et al., 1987). Braun et al. (1990), in a survey conduc ted from 1986 through 1987, found 8.6% and 17.1% prevalence for MAP infection in Fl orida in beef and dairy cattle, respectively (ELISA test). In a later study, Keller et al. (2004) found, in a population of 32,011 cattle from 75 herds in Florida, an overall prevalence for a commercial ELISA of 6.5% (7.4% and 6.3% on beef and dairy cattle, respectively). A New England-based study showed a preval ence rate of 18% combining culture techniques and histological ev aluation (Chiodini a nd van Kruiningen, 1986), and in a 16-year survey the National Veterinary Services La boratory found a disease prevalence rate, as determined by culture techniques, of 7.9% of the 12,917 samples submitted from 44 states, Puerto Rico, and Canada (Kreeger et al. 1991). An absorbed ELISA (Thorne and Hardin, 1997) was performed on serum samples from 1,954 Missouri cattle, representing 89 herds randomly selected from samples submitted for brucellosis testing. The apparent seroprevalence of paratuberculosis in dairy cattle (8%) was similar to that in beef cattle (5%). When herds were classified as dairy or beef, 74% of dairy herds and 40% of beef herds were positive.

PAGE 41

41 Dargatz et al. (2001a) estimated the prevalen ce of paratuberculosis infection among cows on beef operations in the US, based on a conveni ence sample of 380 herds in 21 states. Serum samples were obtained from 10,371 cows and tested with a commercial ELISA. They reported that 7.9% of the herds had 1 or more animal s with ELISA positive result; 0.4% of the cow samples yielded positive results. The prevalence of MAP in culled dairy ca ttle in Eastern Canada and Maine was determined to be 16.1% based on a systematic random sample of abattoir cattle (McK enna et al., 2004). In total, 8.5% of 984 cows had positive mese nteric lymph node or ileum cultures. Hirst et al. (2004) estimated the seropreval ence of MAP infection among adult dairy cows in Colorado and determined herd-l evel factors associated with the risk that individual cows would be seropositive. The study comprised 10,280 adult dairy cows in 15 herds, and the serum samples were tested with a commercial ELI SA. Overall, 4.12% cows were seropositive. Within-herd prevalence of seropositive cows rang ed from 0% to 7.82%. Infection was confirmed in 11 dairies. Annual importation rate, herd size, a nd whether cows in the he rd had clinical signs typical of MAP infection were associated w ith the risk that indi vidual cows would be seropositive for MAP infection. In another study (Adaska et al., 2003), 1,950 serum samples from 65 dairy herds in California, USA were tested fo r the presence of antibodies to MAP using a commercial ELISA kit. The seroprevalence among cows was 6.9% in the northern regi on of the state, 3.7% in the central region and 5.2% in the southern region (overall 4.6%). Beef and dairy cattle serum samples, co llected during 2000 at sale barns throughout Georgia, were used to conduct a retrospect ive epidemiological study (Pence et al., 2003). Statistical samplings of 5,307 sera, from over 200,000 sera, were tested for antibodies to MAP,

PAGE 42

42 using a commercial ELISA kit. An overall period seroprevalence was 4.73%. The period seroprevalence in dairy cattle was 9.58%, in beef cattle it wa s 3.95%, and in cattle of unknown breed it was 4.72%. Some studies analyze the association between prevalence of infection and risk factors. Roussel et al. (2005) working with 4,579 purebre d cattle from 115 beef ranches in Texas found positive ELISA results for 137 of the 4,579 (3.0%) ca ttle, and 50 of the 115 (43.8%) herds had at least 1 seropositive animal. Results of myc obacterial culture were positive for 7.3% of seropositive cattle, and 18% of seropositive herd s had at least 1 animal for which results of mycobacterial culture were positive. Risk factors for seropositivity included water source, use of dairy-type nurse cows, previous clinical signs of paratuberculosis, species of cattle ( Bos taurus vs. Bos indicus ), and location. Another study presented results for a random sample of Wisconsin dairy herds (158 herds and 4,990 cattle) analyzed by an absorbed ELISA pr ocedure. Fifty percent of herds and 7.29% of cattle had positive test results. The only manageme nt factor found to be significantly associated with herd prevalence was housing of calves af ter weaning. Unexpectedly, herds with higher prevalence were associated with use of calf ba rns and hutches for calves after weaning rather than pens in the cow barn (Collins et al., 1994). In another work, Goodger et al. (1996) found that factors such as environmental conditions, ne wborn calf care, grower calf care, bred heifer care, and manure handling were significantly asso ciated with paratuberculosis prevalence in Wisconsin dairy herds. Cetinkaya et al. (1997) analyzed the relationships between the presence of clinical JD and farm and management factors in England. Two binary outcomes (case reported in 1993, case reported in 1994) and 27 predic tor variables were considere d. Farms on which Jersey and

PAGE 43

43 Guernsey or their cross were predominant were associated with an increased risk of reporting disease (odds ratios from 10.9 to 12.9). The presen ce of farmed deer on the farm also increased the risk of reporting disease. In a cross-sectional study (J akobsen et al., 2000) using milk samples from 1,155 cows from 22 Danish dairy herds, several risk factors for pa ratuberculosis were iden tified. Eight point eight percent (8.8%) of the animals were ELISA positive, and 19 out of the 22 dairy herds had 1 test-positive cows. The significant risk factors we re: Jersey versus large breeds, high parity, the first month after calving, and large herd size. Nielsen and Toft (2007) studied manageme nt-related risk factors for within-herd transmission of MAP in 97 Danish dairy herds. Four significant risk factors were identified: housing of cows in bed stalls compared to hous ing in tie stalls; low level of hygiene in the feeding area of calving areas; lo w amounts of straw in the bedd ing of the calving area; high animal density among young stock >12 months of age. In a study from Muskens et al. (2003), 370 ra ndomly selected Dutch dairy farms with 20 dairy cows were surveyed. All cattle aged 3 years were serologically te sted for paratuberculosis using an ELISA. Significant factors associated with seropositive animals were herd size, presence of cows with clinical signs of paratuberculos is, prompt selling of clinically diseased cattle and feeding milk replacer. Transmission of infection There is agreement on the role of the fecal-oral route as the main entry of MAP in the host through ingestion of fecal contaminants, milk or colostrum (Chiodini et al., 1984; Whitlock and Buergelt, 1996), and additional intrauterine tran smission has been suggested. Seitz et al. (1989) obtained tissue specimens at a packing plant from pregnant dairy cows and their fetuses and from cows with clinical signs of paratuberculosis and from their fetuses. Of 407 lymph nodes from

PAGE 44

44 cows, 8.4% were culture positive for MAP; 26.4% of these culture-positive cows had fetuses from which specimens were also cu lture positive. The results estimated the risk of fetal infection with MAP to be 26.4%. Buergelt et al. (2006) reported that, in a group of 11 pregna nt MAP infected Holstein cows, tissues or fluid from fetuses were pos itive on 36% of the pr egnancies and 2 of 4 placentomes tested and 9% of allantoic fluids resulted on positive PCR reaction products. In another study, Aly et al. (2005) estimated the extent to wh ich MAP infection in a large herd was attributable to the inf ection status of the respective da ms. Serologic test results were compared between cows and their dams. Cows w ith seropositive dams were 6.6 times as likely to be seropositive, compared with cows of ser onegative dams. For seropositive cows born to seropositive dams, 84.6% of seropositivity was attr ibutable to being born to a seropositive dam. For the herd as a whole, the seropositive status in 34% of seropositive cows was attributable to being born to a seropositive dam. The explanatio n is based on the subsequent transmission of MAP from infected dams to their daughters, e ither congenitally or vi a exposure to feces and colostrum of the dam shortly after birth. A meta-analysis (Whittington and Windsor, 20 07) suggested that about 9% (95% CI 6-14%) of fetuses from subclinical ly infected cows and 39% (2060%) from clinically affected cows were reported infected with MAP ( p < 0.001). The estimated incidence of calf infection derived via the in utero route depends on within-h erd prevalence and the ratio of sub-clinical to clinical cases among infected cows. Assuming a rate of 80:20 for this ratio, estimates of incidence were in the range 0.44-1.2 infected calves per 100 cows pe r year in herd s with withinherd prevalence of 5%, and 3.5-9.3 ca lves in herds with 40% preval ence. Contrarily, Kruip et al. (2003) investigated whether cows shedding MAP possessed oocytes and early embryos that were

PAGE 45

45 carriers of the bacterium. The results suggested that neither in vivo embryos nor oocytes are carriers of the bacteria and do not form an extra risk at embryo transfer. Immune Response to MAP The immune response to mycobacteria is a complex sequence of coordinated events, leading to clearance of the pathogen but more likel y to adequate control of infection. The loss of control observed in some hosts may be due to genetic factors or may be caused by exogenous stressors such as parturition, mal nutrition, or secondary viral or bact erial infections (Tiwari et al., 2006). The precise mechanism of acquired resistan ce to disease is unknown but may involve maturation of the immune system, including the balance between various T-cell subsets and the specific tissue distribution of immune cells (Coussens, 2001). The events that determinate whether cattle e liminate the infection or become permanently infected remain unclear. In vitro studies have shown that MAP organi sms proliferate within bovine macrophages. This may be, in part, due to inhibition of phagosome acidification and phagosome-lysosome fusion. Cytokines appear to regulate killing of the organisms in macrophages, and pretreatment of monocyt es with IFN-g, granulocyte macrophage colony-stimulating factor, or high doses of tumor necrosis factor(TNF) restricted MAP growth in vitro (Weiss et al., 2004; Woo and Czuprynski, 2008). The first line of defense against invading MA P in the ruminant gut involves M cells and phagocytic macrophages. M cells most likely pass MAP on to nave immune cells located beneath the surface of the intestinal epithelial cell s. MAP readily infects unactivated intestinal macrophages, and non-opsonized MAP is readily phagocytosed by bovine macrophages in vitro (Coussens, 2001).

PAGE 46

46 MAP, as an intracellular parasi te, remains within the phagocy tic vacuole, and therefore, immunology to paratuberculosis is dependent on cell mediated immune responses; humoral immune factors have little or no protective value (Chi odini and Davis, 1993). Major histocompatibility complex (MHC) class II antigen presentation occurs predominantly when bacteria reside within the phagosome. Here, the cellular immune re sponse to the pathogen depends on MHC II antigen presen tation to lymphoid cells which produce IFN-g in response to antigen recognition (Kaufmann and Kaplan, 1996). Development of immunity to facultative in tracellular organisms in general involves the co-operative action of T lymphocytes as speci fic inducers and macrophages as non-specific effector cells. Cellular and humoral responses wo rk in a reciprocal fashion through T helper type-1 and type-2 cells, with se veral immune cells falling into a Th0 classification characterized by production of both Th1 and Th2 cytokines. The clinical stages of bovine paratuberculosis, characterized by large numbers of bacilli, high antibody levels, and diminished cellular responses to specific and non specific antigen s suggest a shift in the immune response from a primarily pro inflammatory and cytotoxic response (Th1-li ke) to an antibody-based response (Th2-like) (Chiodini and Davis, 1993; Coussens et al., 2004a). It is, however, unlikely that th is is a sharp transition; rath er, there is a slow progression along the classical Th1-Th2 line. The same shift in immune re sponses is associated with development of clinical disease in human t uberculosis and other mycobacterial diseases (Coussens et al., 2004a). The main cytokines implicated in th e protective response are IFN-g and TNF. IL-2 plays a central role in priming T cells and NK to s ecrete higher levels of IFN-g, increasing the Th1

PAGE 47

47 response. Il-10 is the cytokine which down regul ates the protective resp onse in these atypical mycobacterial infections (Kaufmann and Kaplan, 1996). The mechanism responsible for loss or reducti on of type 1-like responses to MAP are not well understood but may be related to undefined hos t genetic factors, c onstant exposure of immune cells to antigen released from infected macrophages, the type of antigen presenting cell, the cytokine environment, the antigen dose and a ffinity for the cell receptor, the timing and the level of co-stimulatory signals de livered by both the antigen presenting cells to the T cell, and by the T cell to the antigen presenting cells duri ng priming and secondary responses, or to the development of antigen-specific or general re gulatory cell populations (Brown et al., 1998; Coussens, 2004). Intermittent destruction of infected macrophage s within granulomas could account for the sporadic bacterial shedding observed in fecal cult ures from subclinically infected animals, and infrequent shedding of MAP also leads to co ntinuous low level stimul ation of the humoral immune response. As a result of this stimulation, detectable levels of antibody return in the mid to late stages of subclinical infections (Coussens, 2001). In a study from Stabel and Ackermann (2002), the role of and T cells in resistance to MAP infection was investigated. Results suggested that T cells play a major role in resistance to infection with MAP and that T cells may play a lesser role and potentially confound protective immune responses. However, human T cells are activated directly by various mycobacterial super antigens as a critical component of the host’s early de fense against mycobacterial infections, including MAP. Given the large proportion of T cells in calves that bear receptors and their propensity to localize to the intestinal epithelium, these ce lls could be an important source of IFN-g, TNF

PAGE 48

48 and perhaps other cytokines during early stages of MAP infection. Early release of significant amounts of IFN-g, TNFby antigen activated T cells could protect many bovine gut macrophages by activating them before actual infection (Coussens, 2001). Weiss et al. (2005) evaluated the role of in terleukin (IL)-10 in the inability of monocytederived bovine macrophages to kill MAP organisms in vitro. Neutralization of IL-10 enabled macrophages to kill 57% of MAP organisms within 96 hours. It also resulted in an increase in expression of TNF, IL-12, IL-8, MHC class II, and v acuolar H+ ATPase; increase in acidification of phagosomes; apoptosis of macr ophages; and production of nitric oxide. Diagnostics Diagnostic tests for paratubercul osis can be divided into two categories: those detecting the organism and those that evaluate the host respon se to infection. The first category includes fecal smear and acid-fast stain, bacteriologic culture (from fecal or tissue specimens), and polymerase chain reaction test (PCR). The second category, de tection of host response includes clinical signs in combination with gross and microscopi c pathology and detection of immune response to infection, which comprise cellular immune res ponse (increased IFN-g production, delayed type hypersensitivity reaction, lymphocyte proliferati on), and humoral (antibody) response to MAP (National Research Council, 2003). However, despite the availability of diffe rent tests, ante mortem diagnosis of paratuberculosis has been characterized by inaccur acy due to the lack of sensitivity (in most of the cases) or specificity of the current diagnostic tools. This is of special importance during the earlier stages of infection wher e a single effective di agnostic tool has not yet been identified (Stabel and Bannantine, 2005).

PAGE 49

49 With the idea of comparing among available test s, four stages of the disease presented by Whitlock and Buergelt (1996) will be used. Briefl y, stage I corresponds to silent infection in young cattle; stage II is the subclinical disease with carrier adults; stage II I is clinical disease and, finally, stage IV is advanced clinical di sease. As an attribute upon which to compare different tests, sensitivity of a test is defined as its ability to detect di seased (infected) animals, i.e. the proportion of the diseased (infected) animals that test positive. Specificity of the test is its ability to detect non-diseased (non-infected) animal s and is defined as the proportion of nondiseased (non-infected) animals that test negative (Martin et al., 1987). Tests Based on Agent Detection Fecal smear and acid-fast stain Fecal smear is used to screen feces for acid-fast staining microorganisms. The main disadvantage of this procedure is its low sensitivity due to the irregular shedding pattern and the variability in MAP con centration in feces. The acid-fast stain procedure utilizes the physical property of some myc obacteria to resist decolorization by acids during stai ning procedures. The most common staining technique used to identify acid-fast bacteria is the Ziehl-Neelsen st ain, in which the bacteria are stained bright red and stand out clearly against a blue backgr ound (National Animal Monitoring System, 1997; Palomino et al., 2007). Acid-fast staining is also us ed to detect the bact eria in tissue samples through an impression smear made from ileum, me senteric lymph nodes or other specimens. Bacteriologic culture in feces Detection of MAP by cultivation from fecal or tissue specimens has been the basis of paratuberculosis diagnosis for a century and remain s one of the most widely used diagnostic test for the infection (Collins, 1996).

PAGE 50

50 However, MAP culture is insidious a nd requires long incubation (8–16 weeks), decontamination of the specimen to selectively kill faster growing non-my cobacterial organisms, and concentration of organisms before inoculat ion of the medium (National Research Council, 2003). Conventional fecal culture involves monitori ng for at least 16 weeks and PCR can be used to confirm positive results. Radiometric systems (BACTEC), based on detection of C14 labeled CO2, can reduce the monitoring time to half, an d non-radiometric automated culture systems, recording differences in oxygen and CO2 pressure, are now available with similar time requirements (National Re search Council, 2003). Specificity of fecal culture has widely been re ported as nearly 100%, but the possibility of pass-though of orally ingested organisms by uninf ected cattle does exist. Research has shown that cattle may ingest fecal matter loaded w ith MAP and become transiently fecal culture positive (Whitlock et al., 2000). This conditi on was reported by Sweeney et al. (1992) who recovered MAP from feces in heif ers orally infected with contaminated feces. MAP was detected 18 hours after entry up to day seven. All heifers remained seronegative and had negative results to the intradermal Johnin test. After necropsy, MAP was not isol ated from mesenteric lymph nodes, but was recovered from ileal mucosal samples from each heifer. One of the main limitations of fecal culture is its sensitivity that has been reported ranging from 23% to 74% depending on the method and st age of infection (Nielsen and Toft, 2008). The test has no ability to detect animals in stage I of disease, but sensitivity increases going from disease stage II to IV (Whitlock et al., 2000; National Research Council, 2003). Shedding of MAP organisms in feces can be intermittent and detection by culture is complicated by contamination with other microorganisms, and es pecially when few MAP specimens are shed in the feces.

PAGE 51

51 As an example, one study by Whitlock et al. (2000) examined the sensitivity and specificity of fecal culture for MAP from seve n dairy herds. A cohort of 954 cattle, cultured every 6 months and followed over 4 years was the ba sis to determine the test sensitivity. For all animals, the sensitivity of fecal culture to de tect infected cattle on the first sampling was 38%, while sensitivity was 42% for a cohort of parturient cattle. Because of the moderate sensitivity of conve ntional fecal culture, and because MAP grows very slowly on artificial media, different procedures have been successively proposed (National Research Council, 2003). The doubl e-incubation method (Cornell method) is commonly used for decontamination and includes a pre-incubation st ep with brain-heart infusion medium that initiates germination of bact erial and fungal spores, followe d by centrifugation, and then a second step with the addition of antibiotics (am photercin B, vancomycin, and nalidixic acid) to kill the spores that subsequently germinate (Whitlock et al., 1991). Subsequent centrifugation leads to an increase in sensitivity of the proce ss. Solid media supplemented with mycobactin J are most commonly used for inoculation (Herrold’s egg yolk medium, modified Lowenstein-Jensen medium). Some modificatio ns to this method have been introduced subsequently to improve the test performance in the Cornell modified decontamination and inoculation method (Whitlo ck and Rosenberger, 1990). Stabel (1997) proposed a modi fied method for MAP fecal cu lture based on centrifugation of the total fecal sample supe rnatant and the use of a 2-step decontamination protocol. The growth rate of MAP and contamination rate of cultures when using this method were compared to 3 other published methods: sedimentation, cen trifugation, and Cornell. Sensitivity was lowest for the Cornell method; however, contamination was not observed. Contamination was the most severe in the centrifugation and the sedimentatio n method. The authors stated that the proposed

PAGE 52

52 method was 10-fold more sensitive for detec tion of MAP colonies and contamination was significantly reduced compared to other 3 methods. The association between fecal culture perfor mance and other diagnostic tests is not well established. Muskens et al. (2003a), working wi th fecal samples of 422 ELISA-positive cattle cultured for the presence of MAP, found that th e percentage of samples with positive culture results was 17.3%. Of the positive cultures, the nu mber of colonies varied from 1–10 (22% of cultures), 11–100 (22%), to more than 100 (55%). In a study by Nielsen and Toft (2006) during a period of 3 years, repeated sampling of milk and feces was performed in a total of 1,985 Danish dairy cows. Milk samples were analyzed using an ELISA, and fecal samples were analyzed by culture. The results of the study indicated that the ability of both tests to detect infection increased almost linearly from 2 to 5 yr of age. Nielsen et al. (2002b) evalua ted two ELISA and a fecal culture using maximum-likelihood estimation of sensitivity and specificity. The authors concluded that sensitivity of the fecal culture was 20-25% when used for screening in a population with an in termediate level of infection. However, sensitivity increased to the ra nge of 60-70% if fecal culture was used as a confirmatory test on cows with a high ELISA reading. Recently, pooled fecal culture from several anim als within a herd has been suggested as a screening tool (Kalis et al., 2004). Strategic poo ling of fecal samples wo uld increase diagnostic sensitivity, would decrease the costs, and would be valuable when a herd is suspected to be negative. Wells et al. (2003) determined the sensitivity of bacteriologic culture of pooled fecal samples in detecting MAP, compared with bacterio logic culture of individual fecal samples in 24 dairy cattle herds. Ninety four and 88% of pooled fecal samples that contained feces from at least

PAGE 53

53 1 animal with high ( 50 colonies/tube) and moderate (10 to 49 colonies/tube) concentrations of MAP, respectively, were identified by use of b acteriologic culture of pooled fecal samples. Prevalence of paratuberculosis determined by bacteriologic culture of pooled and individual fecal samples were highly correlated (r=0.96). In another study (Wells et al., 2002), the sensi tivity of different methods of bacteriologic culture of pooled bovine fecal samples for MA P detection was compared. The homogeneity in number of MAP in pooled fecal samples was also evaluated. The authors reported that, compared with concurrent bacterial culture of individual infected samples, 37 to 44% of pooled samples with low bacterial concentrati ons (mean <2.5 CFU/tube) yielded positive culture results and 94% of pooled samples with high bacterial concentr ations (mean >10 CFU/tube), yielded positive results. Automated systems BACTEC system (Becton Dickin son Laboratories, Sparks, Ma ryland, USA) is a modified mycobacterial radiometric culture devise designe d for human clinical laboratories. It is an automated, faster, and more sensitive met hod, and requires the use of radioisotopes (C14-labeled palmitic acid). The instrumentation detects the C14-labeled CO2 that is produced by metabolism of the labeled palmitic acid, and IS 900 PCR is required to confirm positive results (National Research Council, 2003). Non-radiometric automated systems are curren tly available and offer a reduction in the detection time for positive specimens (BACTEC MG IT series). The systems require special, defined media and incorporate a detector sy stem that reacts to alterations in oxygen, CO2, or pressure within a sealed tube (Ha nna et al., 1999; Nielsen et al., 2001). Five methods for whole herd fecal culture were compared in three herds by Eamens et al. (2000). These included two methods based on pr imary culture on Herrold's egg yolk medium

PAGE 54

54 with mycobactin J (HEYM): conventional (1) decontamination with sedimentation and primary culture on HEYM; Whitlock decont amination and culture on HEYM (2). The remaining three methods were based on radiomet ric (BACTEC) culture: decont amination and filtration to BACTEC medium (3); modified Whitlock decontamination to BACTEC medium (4) and Whitlock decontamination to BACTEC medium (5). For BACTEC cultures, two methods were compared as confirmatory tests for MAP: myc obactin dependence on conventional subculture to HEYM and IS900 PCR analysis of radiometric media. In iden tifying shedder cattle, method 5 was the most sensitive, followed by methods 2, 4, 1, and 3. The number of BACTEC cultures confirmed by mycobactin dependence or PCR was similar. Polymerase chain reaction (PCR) The introduction of diagnostic probes base d on specific bacterial DNA sequences has allowed fastidious microorganisms, such as MA P, to be rapidly identified. In 1989, a novel DNA insertion sequence (IS 900 ) in MAP was reported (Collins et al., 1989; Green et al., 1989; Eglund, 2002). IS 900 is present in multiple copies (14-18) in MAP genome and consists of 1,451 base pairs (bp) of which 66% is G + C showing a degree of target sequence specificity (Green et al., 1989). Polymerase chain reaction tests based on this in sertion element have been the most widely used for MAP identification (Har ris and Barletta, 2001). However, the detection of the etiologic agent is limited by the frequency and number of the organism that are present in the body fluid or tissue being tested. In the case of fecal detection, contamination, which inhibits PCR, has been a strong limitation to date. Many efforts are focuse d at the present on an effective method for DNA purification from feces that allows the use of PCR. The isolation of MAP from sites distant to the in testinal tract, such as udder, fetus, kidney, liver, male reproductive tract and blood, have suggested active dissemination of MAP. This

PAGE 55

55 opens the possibility for detecti on of the agent by PCR in fluids such as milk and blood of suspicious animals. The PCR test is considered a useful test in detection of animals in stages II to IV of disease. Of the currently available methods for detection of MAP, PCR-based assays have the highest potential analytic sensi tivity. Equally important as a test ’s analytic sensitivity is the sample that is to be tested. Especially importa nt is the ability of th e sample to have a high likelihood of containing MAP or leuc ocytes infected with MAP in ea rly-stage animals, and to be devoid of factors that inhibit PCR, such as those found in feces (Buergelt and Williams, 2004). Sensitivity of PCR is difficult to determine because PCR is almost certainly more sensitive than the great majority of existing diagnostic tests, making a gold standard impractical to establish (Kelly et al., 2005). One study has repo rted PCR sensitivity for fecal, blood, milk, and liver samples in advanced subclinically MA P infected cows as 87%, 40%, 96% and 93% respectively (Barring ton et al., 2003). Although specificity of IS 900 based PCR is considered nearly 100%, recent studies suggest that insertion sequences similar to IS 900 would be present in ot her mycobacterial species and such sequences would also be positive in most of the current IS 900 PCR systems (Cousins et al. 1999; Tasara and Stephan, 2005). Another concern, because of the high analytical sensitivity of PCR, is the possibility of false positive results arising from cross contamination of samples. Several molecular targets, other than IS 900 (HspX, L1/L9 integration sequences, IS Mav2 and F57) have been evaluated for MAP det ection (Rajeev et al., 2005). The F57 and HspX sequences occur as single copies, while at least three copies of IS Mav2 are present in the MAP genome (Tasara and Stephan, 2005) and has no sim ilarity to known mycobacterial IS elements

PAGE 56

56 although it shows more than 50% identity to a non-composite transposon of Streptomyces coelicolor at the DNA and protein leve l (Strommenger et al., 2001). Tasara et al. (2005) developed a multiplex PCR system designed to enhance specificity for MAP detection in a single PCR reaction. Multiplex PCR is a variant of PCR which enables simultaneous amplification of many targets of in terest in one reaction by using more than one pair of primers. This PCR assay co-amplifies the Mycobacterium species 16S rRNA gene, MAP IS 900 and F57 sequences. The multiplex PCR assay was highly specific, but the nested PCR system was also positive for several other Mycobacterium species. Li et al. (2005), working with a common clone of MAP, strain K-10, identified 17 copies of the previously descri bed insertion sequence IS 900 seven copies of IS 1311 and three copies of IS Mav2 in the K-10 genome. A total of 16 additional MAP insertion sequence elements were identified in the analysis, totaling 19 different in sertion sequences with 58 total copies in the K-10 genome. Bhide et al. (2006) presented a PCR-based detection of IS 900 from the buffy coat of cattle (n=262) and sheep (n=78), and direct genotyp ing by single strand conformational polymorphism (SSCP). A total of 30 cattle and one sheep were positive for MAP-IS 900 SSCP analysis grouped the MAP-IS 900 into four distinct clusters based on different band patterns Nucleotide sequence variability between MAP detected from sh eep and cattle was noticed in the study. Real-time sequence detection methods based on two different chemistries were presented by Ravva and Stanker (2005). One was based on the detection of SYBR Green bound to PCR products and the second more specific method, dete cted the cleavage of a fluorogenic (TaqMan) probe bound to a target sequence during primer ex tension phase. Novel primers and probes that amplify small fragments (<80 bp) of th e MAP specific insertion sequence, IS 900 were designed.

PAGE 57

57 Both the SYBR green and TaqMan assays are able to detect 3 to 4 fg of DNA extracted from MAP strain ATCC19698 (0.6 to 0.8 cells per assay). Both SY BR Green and TaqMan assays were highly specific for th e detection of MAP. PCR on milk Pillai and Jayarao (2002) eval uated the application of IS 900 PCR for the detection of MAP from raw milk. This assay was based on IS 900 PCR detection including DNA extraction and PCR assay using commercially ava ilable kits. Detection of MAP by IS 900 PCR was consistent when about 100 CFU/ml were present, whereas dete ction was variable at concentrations as low as 10 CFU/ml. IS 900 PCR was also evaluated with pooled quarter milk samples from 211 cows from five herds with known history of JD. Out of 211 animals examined, 4% and 33% were positive for MAP by milk culture and IS 900 PCR from milk, respectively. A total of 20 bulk tank milk sample aliquots were also examin ed, of which 50% were positive for MAP by IS 900 PCR. By contrast, only 5% bul k tank milk sample aliquot s were positive by culture. Rodriguez-Lazaro et al. (2005) presented a r eal-time PCR assay for quantitative detection of MAP amplifying IS 900 insertion. The assay detected <3 genomic DNA copies with a 99% probability. Using prior centrifugation, the assay was able to detect 102 MAP cells in 20 ml artificially contaminated drinking water. With a detergent and enzymatic sample pretreatment before centrifugation and nucleic acid extraction, the assay was able to consistently detect 102 MAP in 20 ml artificially cont aminated semi-skimmed milk. Tasara and Stephan (2005) developed a light cycler-based real-time PCR assay amplifying the F57 sequence of MAP, includi ng an internal amplification control template. The assay had a reproducible detection limit of about 10 MAP cells per ml, starting with a sample volume of 10 ml of MAP-spiked milk.

PAGE 58

58 Jayarao et al. (2004), evaluated sensitivit y, specificity, and predictive value of IS 900 -PCR for MAP detection in pooled quart er milk and bulk tank milk. Cultu re analysis resulted in 10.9%, 2.8%, and 20.6% of fecal, pooled quarter m ilk and bulk tank samples positive for MAP, respectively. While 13.5% and 27.5% of pooled quarter milk samples and bulk tanks were positive by IS 900 PCR, respectively. The IS 900 PCR assay using pooled quarter milk samples had a sensitivity, specificity and positive pred ictive value of 87%, 95% and 71%, respectively. The IS 900 PCR assay using bulk tank milk had poor sensitivity (21%), sp ecificity (50%) and predictive value (60%). In another study (Giese and Ahrens, 2000), milk and fecal samples from cows with clinical signs of paratuberculosis were tested by culture and PCR to dete rmine the presence of MAP. The bacteria were cultivated from feces or intestinal mucosa in eight of 11 animals. A few colonies were cultivated (<100 CFU per ml) in milk from five fecal culture positive cows. Milk samples from two cows were PCR positive (both animals positive for fecal culture, and one positive for culture in milk). One cow was culture negative on intestinal mucosa, but culture positive in milk, and two cows were negative in culture and PCR from both feces and milk. PCR on feces Different methods have been proposed for P CR detection of MAP in feces, but the high analytical sensitivity of this test is seldom achieved on fecal specimens. Possible causes of this problem include nonspecific DNA derived from the host or other microbes, presence of inhibitory substances, and qua lity of the genomic DNA preparation (Khare et al., 2004). Vary et al. (1990) presented the results obtained by DNA probes that hybridize IS 900 Tests were found to be highly specific for MAP. The authors report that di rect detection of MAP DNA in feces from infected cattle was highly specific with a sensitivity equal to or greater than

PAGE 59

59 that obtained by standard culture techniques with an important reduction in time to results when compared to culture. Van der Giessen et al. (1992) presented three a ssays for MAP detection on fecal samples of dairy cattle, using dot spot hybr idization of PCR products. The fi rst two tests used PCR primers and a DNA probe derived from MA P-specific sequences of the 16S rRNA gene and insertion element IS 900 respectively. The 16S rRNA test was able to detect 107 bacteria per g of feces, and the IS 900 test detected 104 to 105 per g of feces. These two tests and a commercially available test (IDEXX Corp.) were used twice with an interval of 3 months on fecal samples of 87 cows from two dairy herds with a history of JD. Results were compared with those of culturing. The tests showed a high specificity (89 – 100%) but the sensitivity ranged from 3 to 23%. Khare et al. (2004) proposed a method based on immuno-magnetic bead separation coupled with bead beating and real-time PCR for the isolation, separation, and detection of MAP from milk and/or fecal samples from cattle. The authors report that by co nventional and real-time IS 900 -based PCR, 10 or fewer MAP organisms were consistently detected in milk (2-ml) and fecal (200-mg) samples. In another work (Tadei et al., 2004), th ree commercially available assays for IS 900 -PCR on fecal samples were compared with a convent ional culture method. Sixty seven percent of 80 culture-positive samples were positive for an assay that detects MAP DNA by dot spot hybridization of PCR products (IDEXX Laboratories, ME), 60% were positive by an assay using ethidium bromide staining for agar gel visualiza tion of amplification products (Adiavet paratub PCR, France), and 61.3% were positive by an assay with a colorimetric detection system (Institut

PAGE 60

60 Pourquier, France). Specificity was 100% base d on results from 20 culture-negative samples from a MAP-free herd. Fang et al. (2002) reported an automated fluor escent PCR for detection of MAP in bovine feces. When the PCR was compared with culture of fecal samples, kappa scores of 0.94 to 0.96, a sensitivity of 93 to 96%, and a specificity of 92% were obtained. Results were quantified by use of a standard curve derived from a plasmid containing IS 900 and a minimum quantity of 1.7 x 10-4 pg of DNA, correlating to 1 to 8 CFU, was detected. Another study reported a comparison between a real-time PCR and fecal culture (BogliStuber et al., 2005). In fecal samples derived fr om 13 dairy herds in Switzerland real-time PCR identified 31 of 310 animals as positive within this population whereas culture identified 20 positive animals. The observed agreement of the two tests used in the study was 91.3%, whereas the kappa-value was 42%. A high-throughput TaqMan PCR assay for MAP detection, targeted to Mav2 insertion sequence was evaluated by use of fecal sample s from naturally infected herds and herds considered free of paratuberculosis (Wells et al., 2006). Fecal, blood, and milk samples were subjected to the PCR-based assay, three differe nt fecal culture pro cedures for MAP, two ELISAs, and one milk ELISA. Results showed that specificity of the PCR assay was 99.7%. Twenty-three percent of the dairy cows that were fecal culture positive by at least one of the three methods were positive by the PCR assay. In another study, using Bayesian non-“gold st andard” analysis methods, the TaqMan PCR assay had a higher specificity than serum ELISAs (99.3%) and sensitivity si milar to that of the serum ELISAs (29%). By classical methods, the es timated relative sensitivity of the fecal PCR

PAGE 61

61 assay was 4% for light and moderate fecal shedde rs (compared to 12 to 13% for the ELISAs) and 76% for heavy fecal shedders (compa red to 67% for the milk ELISA). Detection of Host Response to Infection Clinical signs, gross and microscopic pathology Clinical signs appear in the st age III of paratuberculosis and include gradual weight loss in spite of a normal appetite. With the progress of disease, manure consistency becomes more fluid and diarrhea may be intermittent. Serum and biochemical changes include low concentration of total protein, albumin, triglycerid es and cholesterol. Muscle enzymes levels increase as a result of muscle wasting. However these changes are no t specific enough to be useful as diagnostic tests. During stage IV animals become incr easingly lethargic, weak, and emaciated. Most animals are culled before this stage because of reduced milk production or severe weight loss. Intermandibular edema, cachexia and persistent diarrhea characterize the terminal stage (Whitlock and Buergelt, 1996). Gross lesions are confined to the terminal po rtion of the small intestine and associated lymph nodes. Lymph nodes are enlarged and ed ematous and sub-serosal lymphatics appear tortuous, dilated and thickened, and intestinal mucosa becomes thickened and corrugated. Pathognomonic cellular changes include cl ustered epithe lioid macrophages and /or inflammatory giant cells of Langhans’ type and s ubtle histopathological alterations can be found even during stage I of the disease. Ziehl-Neelse n staining technique is the traditional method to demonstrate the presence of MAP in the tissues (Whitlock and Buergelt, 1996). At present, the gold standard for paratuberculosis diagnosis is necropsy followed by extensive culture and histological examination of multiple sections of lower small intestine and associated lymph nodes (National Research Council, 2003).

PAGE 62

62 Cellular immune response Because cell-mediated immune (CMI) responses are the first and str ongest host response to mycobacterial infections, CMI tests may be useful for early detection of MAP infection (Robbe-Austerman et al., 2007). Interferon gamma assay (IFN-g) A method of measuring CMI response is the gamma interferon (IFN-g) assay, a laboratory test initially developed for the di agnosis of tuberculosis, but also available for the diagnosis of paratuberculosis (Kalis et al., 2003). The test is based on production and release of IFN-g by sensitized bovine lymphocytes in response to in vitro stimulation with a series of mycobacterial antigens. Because cellular immunity is developed soon after infecti on, this test is considered the most sensitive during early infection, and is deem ed useful in detection of animals in stages II and III (Billman-Jacobe et al., 1992; Collins, 1996, 2003; Stabel, 2001). To improve diagnostic specificity, IFN-g levels releas ed in response to bovis purifie d protein derivative (PPD) are compared with IFN-g levels released in response to avium-PPD and IFN-g levels in non-stimulated samples (Kalis et al., 2003). Repor ted sensitivities range from 72% to 99% for subclinical cases, without and with fecal shed ding, respectively (Nati onal Research Council, 2003). However, the disadvantage of IFN-g assay is its low specificity. The test is subject to cross reactivity with other mycobacteria (Huda et al., 2003), and specificity valu es are controversial, ranging from 26 to 97.6% (Kalis et al., 2003). Th ese authors re-examined CMI specificity. The IFN-g assay specificity was estimated in 35 uninf ected dairy herds by use of a newly developed algorithm, resulting in 93.6%. When interprete d according to two altern ative algorithms the assay had specificities of 66.1 and 67.0% (Kalis et al., 2003).

PAGE 63

63 In another work (Stabel, 2001), blood samples were obtained from infected dairy herds and tested by a modified IFN-g analysis. Blood sample s were incubated alone (non-stimulated), with concanavalin A, and with M. avium PPD, M. bovis PPD, or a whole cell sonicate of MAP for 18 h to elicit antigen-specific IFN-g production. After incubation, plasma was analyzed for IFN-g by ELISA. Values for IFN-g for non-stimulated blood samples were consistently low. In contrast, concanavalin A stimulation of blood samples evoked a significant secretion of IFN-g regardless of infection status. Antigen-specific IFN-g results were positively correlated with MAP infection status. Accuracy of the IFN-g assa y for correctly predictin g infection status of individual cows in the herds with low levels of infection ranged from 50 to 75% when used as a single test. Huda et al. (2004) presented a study base d on repeated blood and fecal sampling for culture of feces, assessment of IFN-g secret ed by MAP antigen stimulated whole-blood lymphocytes, and measurement of antibody responses against MAP in serum and milk by ELISA. The IFN-g test diagnosed higher proportions of infected and exposed animals than the antibody ELISAs. The highest sensitivity of IFN-g test was in infected cattle 2 or more years of age. IFN-g test had a better performance than an tibody tests of animals of 1 and 2 years of age, with a similar performance for animals of 3 or more years old. Hypersensitivity reaction (Skin test) A well-known CMI test for mycobacterial infect ions is the intradermal skin test which measures delayed type of hypersensitivity to mycobacterial antigens. The swelling formed three days after injection of a my cobacterial PPD (Johnin PPD) is measured using callipers to determine the increase of skin thickne ss (Colins, 2003; Kalis et al., 2003). In spite of successful ap plication of the skin test in the c ontrol of bovine tube rculosis, it is only occasionally used in the control of paratuberc ulosis because its specif icity has been reported

PAGE 64

64 to be low. Sensitivity of this test has been reported to be close to IFN-g assay; however, specificity is lower because MAP shares antigens with environmental mycobacteria resulting in numerous cross reactions (Collins, 1996). Ho wever, a study (Kalis et al. 2003) reported a specificity of 93.5% for the skin test and a fair agreement ( = 0.41) between skin test and IFN-g assay based on the analysis of 1631 animals. In another study, Jungersen et al. (2002) esti mated specificities from 95 to 99% by Johnin PPD stimulation, irrespective of interpretation relative to bovine PPD or no-antigen stimulation alone. For a limited number of test-positive animal s, no change in the test results could be observed with increasing antigen concentrations but IFN-g respons es were significantly reduced. In both MAP-free and MAP-infected herds, fals e positives were observed when the test was applied to calves less than 15 months of age. Lymphocyte proliferation The lymphocyte transformation test is an in vitro test based on the fact that lymphocytes, previously sensitized by an antig en, transform into blasts and pr oliferate when they are again exposed to this antigen. This proliferation is de termined by measurement of the incorporation of H3-thymidine or bromodeoxyuridine into repli cating DNA. The assay for paratuberculosis detection uses antigen Johnin PPD to stimulate lymphocytes co-incubated with radio-labeled deoxiuridine to measure the rate of DNA synt hesis (Buergelt et al., 1977, National Research Council, 2003). Although sensitivit y is acceptable, like the prev ious test, it suffers from specificity problems related to exposure to othe r mycobacteria. Another concern is the use and disposal of radioisotopes, the expensive inst rumentation and the large volume of blood required. De Lisle and Duncan (1981) reported a whol e blood lymphocyte transformation test to examine cattle infected with MAP. Minimally in fected animals responded to Johnin PPD in the lymphocyte transformation test but did not routin ely react on serological and/or skin testing.

PAGE 65

65 Heavily infected animals showed considerable variation in their lymphocyte transformation responses to antigen and some of them were consistently unrespons ive. Antigen induced lymphocyte transformation reacti ons were recorded in 7.6 to 41.5% of animals whose negative infection status was determined by bacteriology and/or histopathology. Humoral immune response Given that antibody response occurs late in the course of infec tion, pathobiology of paratuberculosis limits the ability of tests for serum antibodies to detect animals in the early stages of infection (Collins, 1996). Complement fixation and agar ge l immunodiffusion (AGID). Complement fixation was one of the earliest sero logic tests for paratube rculosis but in the present is not widely used because of its mode rate sensitivity and low specificity. Agar gel immunodiffusion test was developed as a quick test for animals showing clinical signs. Positive results correlate well with clinical signs, but failu re to detect subclinical infection is the main limitation. Sensitivity and specificity have been reported as 18.9 and 99.4% for the detection of subclinically infected animals (She rman et al., 1984). AGID test is considered useful in detection of animals in stages III and IV. Enzyme-linked immunosorbent assay (ELISA) Most ELISA tests in current use are modifications of the method developed by Yokomizo et al. (1983) who developed an ELISA for MAP detection in cattle sera. The aim was to minimize the nonspecific reactions caused by Ig M by measuring only IgG1 against a bacterial protoplasmic antigen. The sensitiv ity reported for this assay was 58% of cattle positive to fecal culture. The authors reported 4% of the sera from fecal culture negative animals giving a false positive result.

PAGE 66

66 Three years later the same group reported th at pre-absorption treatment of sera with Mycobacterium phlei increased the specificity of the ELI SA test by removal of cross-reacting antibodies (Yokomizo, 1986). At present, ELISA test kits or services are commercially available from a number of sources (IDEXX, Portland, Ma ine, USA; Allied Monitor, Fayette, Missouri, USA; Synbiotics, San Diego, California, USA; Bi ocor Animal Health, Inc., Omaha, Nebraska, USA; CSL, Parkville, Victoria, Australia; Pourquier, Institut P ourquier, Montpellier, France), and sensitivity and specificity of ELISA for MA P detection have been described in numerous published reports (National Research Council, 2 003). ELISA sensitivity is usually reported in reference to fecal culture. In the decade since the absorbed ELISA was introduced, the reported sensitivity has gradually decrease d from 57% (Milner et al., 1990) to a more current estimate of 45% (Sweeney et al., 1995). Despite the fact that commercial kits are marketed as herd-level diagnostic tools, they are commonly used as cow-le vel tests. Because of it s moderate sensitivity, the ELISA test rarely gives a pos itive result in animals under 2 y ears of age and frequently fails to detect individuals in the ear ly phases of infection (Juste et al., 2005). Regardless of these disadvantages, ELISA testing of sera is still th e method of choice for epidemiological studies and herd-based diagnosis (Bottcher and Gangl, 2004). There are multiple estimations for ELISA sensiti vity and specificity. Bech-Nielsen et al. (1992) reported an increase in pre-absorbed ELISA response for animals with heavy MAP fecal shedding when compared with the response in lo w shedders or culture negative animals. The specificity reported for this pre-absorbed ELISA in two fecal culture negative herds was 100% compared with 62.9% when the sera was not pre-absorbed. In another study, two commercial ELISAs (Allied Laboratories, [Glenwood Springs, Colorado, USA] and the CSL, Limited, [Parkville, Vi ctoria, Australia]) were evaluated (Sockett

PAGE 67

67 et al., 1992). A subclinical case of bovine paratube rculosis was defined as the isolation of MAP from fecal samples or internal organs of ca ttle without diarrhea or weight loss. The Allied ELISA, and the CSL ELISA had sensitivities of 58.8, and 43.4%, respectively, and specificities of 95.4, and 99.0%, respectively. The Allied ELISA, and the CSL ELISA detected 65.7%, and 56.5% of the MAP fecal shedders, respectively. In a review from Collins and Sockett (1993) th e limitations of ELISA were presented. The authors stated that sensitivity is a direct function of the infection stages in the tested population, with a better ability for detection in the advan ced stages of the infec tion. In this review, the estimates of sensitivity range from 24.6% to 88.2%, for stages 1 and 3 of infection, respectively, with a combined estimation of 45.5%. The spec ificity reported is 99.7% for pre-absorbed ELISA. Whitlock et al. (2000) examined the sensitiv ity and specificity of the ELISA and fecal culture tests for paratuberculosis in dairy cattle Infected dairy herds tested concurrently with both fecal culture and ELISA resulted in more than double positive animals by culture compared to ELISA. ELISA had a higher sensitivity in an imals with a heavier bacterial load (75%) compared to low shedders (15%). Another study reported sensitivity for ELI SA of 45% for a group of 1146 cows, with values ranging from 15% to 87% as the disease pr ogressed to clinical stag es (Thorne and Hardin, 1997). On the other hand, sensitivities between 15.4 to 88.1% were presented by Dargatz et al. (2001) for serum ELISA, depending on the clinical stage and bacterial sh edding status of the cattle. It has been suggested that the measurable hum oral immune response to MAP in subclinical cows can even vary widely from day to day (Ba rrington et al., 2003). It is suspected that this

PAGE 68

68 variation in ELISA results is due to fluctuation in antibody produc tion, variable losses by way of the gastrointestinal tract, or a combin ation of both (Buergelt and Williams, 2004). Gasteiner et al. (2000) tested two ELISAmethods (A-ELISA, Allied Monitors; H-ELISA, Veterinary University Hannover) with serum sample s from healthy, infected and diseased cattle as well as positive and negative reference sera. In both ELISA-methods total agreement between antibody detection and shedding of MAP was fo und for diseased animals. Reference serum samples of culturally negative cattle were negative in 98% by H-ELISA and in 82% by A-ELISA, and those of positive animals were positive in 59% by H-ELISA and in 82% by A-ELISA. Jubb et al. (2004) estimated the sensitivity of a serum ELISA (Parachek, CSL, Parkville) in dairy herds participating in a control program in Australia. Values reported are 16.1%, 14.9% and 13.5% for herds with 5, 6 and 7 annual tests, respectively. In another work, Nielsen et al. (2002) studied the ELISA response to MAP by cow characteristics and stage of l actation. The results showed th at the probability of being ELISA-positive was 2 to 3 times lower for cows in first parity relative to cows in other parities (milk and serum). The probability of a positive re sult was higher at the beginning of the lactation for milk ELISA, but for serum ELISA the odds of being positive was higher at the end of the lactation. Van Schaik et al. (2005) presen ted a kinetic ELISA with multiple cutoff values to detect fecal shedding of MAP. The sensi tivity and specificity relative to culture reported were 67% and 95%, 31% and 99.7%, and 11% and 99.9% for three different cutoff values respectively. The authors suggested that cutoff values for this ki netics ELISA should be determined based on the apparent within herd prevalence of infection.

PAGE 69

69 In a recent review, Nielsen and Toft (2008) ex amined multiple studies reporting sensitivity values for serum multiple ELISA with values ranging from 7% to 94%, depending on the particular test under analysis a nd the group reporting the results. However, the high specificity of ELISA ha s been questioned by some recent works. Osterstock et al. (2007) evalua ted the effect of exposure to environmental mycobacteria on results of 2 commercial ELISAs (A: HerdChec k, IDEXX laboratories Inc and B: ParaCheck, CSL Biocor). Weaned crossbred beef calves were inoculated with 1 of 5 mycobacterial isolates derived from herds with high proportions of false-positive sero logic reactions for paratuberculosis, MAP, or mineral oil. By use of ELISA-A, 1 false-positive reaction over time was detected in 2, 3, 3, and 1 of the 3 calves injected with Mycobacterium avium Mycobacterium intracellulare Mycobacterium scrofulaceum or Mycobacterium terrae respectively. By use of ELISA-B, only M. scrofulaceum induced false-positive reactions. In a subsequent study, Roussel et al. (2007) evaluated the seroprevalence of paratuberculosis by use of the 2 previously c ited commercial ELISAs (A,B) in association with prevalence of fecal shedding of mycobacteria with in beef cattle herds in 6 affected beef herds and 3 geographically matched herds without high seroprevalence of paratuberculosis. Cattle from affected herds were 9.4 times as likely to have environmental mycobacteria isolated from feces. The authors suggested that beef herds with persis tently high rates of false positive ELISA results may be associated with recovery of e nvironmental mycobacteria from feces. Agreement among serum ELISA kits Inter-laboratory reproducibility of an absorbed ELISA kit for detection MAP serum antibodies (Johne’s Absorbed EIA, CSL Limite d, Parkville, Australi a) was evaluated by Collins et al. (1993). A panel of bovine sera was test ed in triplicate microtiter wells at 8 different laboratories. Between-well CVs averaged 6.7% 2.8% (mean standard deviation), and

PAGE 70

70 between-day CVs averaged 14.5% 9.8% among laboratories. Among 1392 assays in 7 laboratories, 98.6% were in agreement indicat ing that the absorbed ELISA kit provided reproducible results within and between laboratories. However, strong discrepancies between di fferent commercial ELISAs when performed concomitantly on the same animal have been re ported. McKenna et al. (2006) presented a range of kappa coefficients for combinations of th ree different commercial ELISA tests from 0.18 to 0.33, which is slight and fair agreement, respectively. Five diagnostic ELISA tests were evaluated by us ing individual serum or milk samples from cattle in paratuberculosis-f ree and infected dairy herds (Co llins et al., 2005). The specificity of three ELISAs (two on serum, one on milk) wa s >99.8%. The specificity of the remaining two ELISAs, (serum), was 94.9 and 84.7%. Four of the five ELISAs evaluated produced similar sensitivity in detecting fecal culture-positive ca ttle (27.8 to 28.9%). One serum ELISA had the lowest specificity (84.7%) and the highest se nsitivity (44.5%). Assay agreement (kappa coefficient) ranged from 0.47 to 0.85 for categorical assay interpretations (positive or negative), but linear regression of quantitativ e results showed low correlati on coefficients (r=0.40 to 0.68). In a recent study, three different commercia lly available serumELISA (Svanovir-ELISA, Svanova, Uppsala, Sweden; IDEXX-ELISA, IDEXX Laboratories, Maine, USA; Pourquier-ELISA, Institut Pourquier, Montpel lier, France) and two milk ELISA (SvanovirmELISA Svanova, Uppsala, Sweden; Pourquier-ELISA Institut Pourquier, Montpellier, France) were compared. Blood-, milkand faecal samples we re monthly taken from 63 selected animals. The highest number of bloodand milk sample s with a detectable an tibody-level was found by the Svanovir-ELISA. There was a significant corr elation between serumand milkSvanovirELISA results, whereas the agreement betw een ELISA and faecal culture/PCR was low.

PAGE 71

71 Significant correlations between Svanovir-serumELISA results and milk somatic cell counts were estimated (Geisbauer et al., 2007) Milk/serum ELISA Sensitivity and specificity for milk ELISA has been reported in a range from 21%-61% and 83%-100%, respectively (Nielsen and Toft, 2008). Hardin and Thorne (1996) compared milk and serum ELISA for MAP detection, using concu rrent samples, and estimating the correlation between milk and serum tests. McNe mar’s chi square were significant ( p = 0.05), but analysis of correlation and regression analysis were low (r2=0.02), indicating a low as sociation between both tests results. Milk and serum samples from 35 dairy herds in the US were evaluated for cowand herd-level MAP antibody test agreement (Lom bard et al., 2006). Evaluation of 6,349 samples suggested moderate agreement between milk a nd serum ELISA results, with a kappa value of 0.50. Cow-level sensitivity for 18 dairy operations with 1.921 animals was evaluated relative to fecal culture results, with values of 21.2 and 23.5% for the milk and the serum ELISA, respectively. Stabel et al. (2002) reported that from a population of 651 cows, only 25% of animals with fecal-culture positive results tested positive for milk ELISA and over 6% of cows that were fecal-culture negative tested ELISA-positive. ELISA for bulk-tank milk also has been developed for estimating the level of paratuberculosis infect ion in dairy cattle (Niels en et al., 2001). Those authors describe a sensitivity of 97% and specificity of 83%. However, the number of infected animals that must be present in the herd to re sult in a positive bulk-tank sample is apparently unknown.

PAGE 72

72 Disease Control Epidemiological Factors in Control Host factors Transmission of paratuberculosis is mainly via ingestion of MAP in colostrum or milk, exposure of young to infected feces, or through in utero infection of calves (Seitz et al., 1989; Valentin-Weigand and Goethe, 1999; Buergelt et al., 2006; Mitchell et al., 2008; Wittington and Winsor, 2007). Level of exposure (dose of organisms) and age at the time of exposure are major factors in determining whether an animal eventu ally becomes infected with MAP (McKenna et al., 2006). Infection is believed to occur main ly in young individuals, with age-resistance occurring later (Nielsen and Toft 2007). It is suspected that, on rare occasions, certain animals that are exposed to MAP can generate a protecti ve immune response resulti ng in full clearance of the bacteria (Buergelt et al ., 2004a; McKenna et al., 2006). On the other hand, genetic factors have b een associated with differences in host susceptibility to infection with MAP and subsequent disease. Es timations indicate a range of moderate heritability values for suscep tibility to infection (Koets et al., 2000; National Research Council, 2003; Mortensen et al 2004, Gonda et al., 2006). Research has recently been aimed at detecting associations between susceptibility di fferences and polymorphisms of candidate genes, with no definitive results (Hinger et al., 2007; Taylor et al., 2006; Gonda et al., 2005, 2007). A breed effect has been proposed in some studi es with Jersey and Shorthorn cows having a higher susceptibility for paratuberculosis infectio n (Cetinkaya et al., 1999; Jakobsen et al., 2000). However, confounding variables such as different husbandry practices could have played a role in the reported differences.

PAGE 73

73 Natural reservoirs and environmental factors One important threat to paratuberculosis control programs is infection in feral maintenance hosts that cannot be controlled and could potentially re introduce infect ion in livestock (Biet et al., 2005). There are many studies reporting the presence of MA P infection in non-domestic animal populations. Among the wild species in which paratubercul osis has been reported are other ruminants, such as deer (Stehman, 1996) bison (Buergelt et al., 2000, Ellingson et al., 2005a), and elk, as well as non-ruminants, such as wild rabbit (Greig et el., 1997), rat, wood mouse, hare, their predators, including fox and st oat, weasel, and primates, such as mandrill and macaque (Beard et al., 2001; Zwick et al., 2002), indicating a wide host range (Alifiya et al., 2004). Analysis of the molecular diversity and comparative molecular pathology of MAP would help to establish the degree of heterogeneity in strains isolated from a variety of host species. The extent of strain sharing across a variety of hosts would reflect the degree of interspecies transmission (Motiwala et al., 2003, 2004). MAP is primarily transmitted by the fecal-oral rout e with the bacteria shed in the feces of infected individuals and then ingested by susceptib le animals. The level of transmission of MAP by indirect contact depends on the number of or ganisms shed in the feces and the organism’s survival characteristics in the enviro nment (National Research Council, 2003). While MAP is unable to replicate in the envi ronment, some characteristics, such as a peculiar lipid-rich cell wall, enab le the organism to persist in th e environment and contribute to its resistance to low pH, high temperature, and chemical agents (Manning, 2001). The relationship between MAP and the environment is complex, involving factors such as the physical characteristics of the substrate materi al (feces, water, milk, manure slurry, dust,

PAGE 74

74 environmental surface, dirt), temperature, pH, water activity or content, and competing microorganisms (National Research Council, 2003). Raizman et al. (2004) char acterized the distribution of MAP in the environment of infected and uninfected Minnesota dairy farms. Eighty in fected and 28 uninfected herds were sampled. Two environmental samples were obtained from each farm from various locations, and samples were tested using bacterial cu lture for MAP. Environmental samples were cultured positive in 78% of the infected herds, and one negative herd had one positive environmental sample. The study results indicated th at targeted sampling of cow alleyways and manure storage areas appears to be an alternative strategy for herd screening and Johne’s infection status assessment. Lombard et al. (2006a) studied the distribution of MAP in the environment and assessed the relationship between the cultur e status of the bacteria in the farm environment and herd infection status. A total of 483 environmenta l samples were collected, and 218 (45.1%) were culture-positive for MAP. Positive environmenta l cultures resulted from parlor exits (52.3%), floors of holding pens (49.1%), common alleyway s (48.8%), lagoons (47.4 %), manure spreaders (42.3%), and manure pits (41.5%). Sixty-nine of the 98 operations (70.4%) had at least one environmental sample that was culture-positive. Of the 50 herds classified as infected by fecal culture, 76.0% were iden tified by environmental culture. Of the 80 operations classified as infected based on serum ELISA-positive results, 76.3% were identified as environmental-positive, whereas 20 of the 28 ope rations identified as in fected based on milk ELISA were detected by environmental sampling. Due to the particular characteristics of its cell wall, along with the clumping behavior of this bacteria, MAP appears to be more thermal resistant than other mycobacteria making

PAGE 75

75 pasteurization of milk and milk products somewhat problematic (Chiodini et al., 1984; Lund et al., 2000; Grant et al., 2001). MAP DNA and viable bacteria has been repo rted on commercially pasteurized retail milk (Millar, 1996; Ayele et al., 2005; Ellingson et al., 2005), calling into quest ion the validity of feeding pasteurized milk products to calves as a possible means of lowering the risk of MAP infection (McKenna et al., 2006). Population factors Different models have been proposed to expl ain the transmission and persistence of MAP within dairy herds, considering variables such as prevalence in different categories of animals, and taking into account that sus ceptibility decreases with age. In general terms, three adultshedding categories (low, high and clinical) ar e usually considered, and risk factors are established according to the level of exposure as a result of environmental contamination. In these models the probability of a successful infectious contact increases as animals advance in subsequent stages of disease. In a study by Mitc hell et al. (2008), it was concluded that in all models high-shedding animals have an important impact on prevalence of MAP infection in a herd. However, these animals were not the only ones responsible for disease persistence and infection in a low-prevalence herd, actively ma naging shedding animals. Infection could be maintained by other factors, such as dam-to -daughter and calf-to-calf transmission. A recent simulation model proposed by Nielsen et al. (2007) indicated the need of adjusting by covariates such as mean prevalence in the herd, the age adjusted prevalence of the herd, the rank of the age adjusted prevalence, and a threshold-based prevalence. From the diagnosis point of view, a study pres ented by Kudahl et al. (2007) predicted that an increase in milk-ELISA sensitivity, used in a “test-and-cull” strategy would result in a more effective reduction of MAP prevalence, with a milk production leve l comparable to a non-

PAGE 76

76 infected herd if initial prevalence was moderate (25%) or an increased m ilk production, if initial prevalence was high (80%). However, it was pred icted that after 10 years, a persistent high replacement rate would limit progress becau se of a restricted replacement base. Control Programs In general, disease control programs have 3 main objectives: decrease the number of new infections; decrease the number of clinically diseased or shedding animals; and decrease the duration of disease or its infectiv e period (McKenna et al., 2006a). In the past, almost all of the JD control programs worldwide have been based on early identification and rapid elimination of clinically infected animals, and the implementation of preventive measures (Benedictus and Khalis 2003). However, many of them have been ineffective in the reduction of the disease prevalence (Groene ndaal et al., 2003), and numerous programs based only on test and cu ll have been terminated b ecause of their high costs and because success or failure can only be demonstr ated over a long period of time (Whitlock et al., 1994). Groenendaal and Galligan (2003) presented a simulation model for paratuberculosis control on midsize dairy herds in the US. The results suggested that test-and-cull strategies alone do not reduce the prevalence of para tuberculosis in cattle and are costly for producers to pursue. Vaccination did not reduce the prevalence but wa s economically attractive. Finally, improved calf-hygiene strategies were found to be critically important and economically attractive in every paratuberculosis control program. To quote some examples, The Netherlands started a national c ontrol program in 1998 based on repeated herd fecal cultures combined with sanitary and zootechnical management methods. France started a control program combini ng culture of feces and management strategies and Australia and some states of USA have st arted voluntary control programs, based on various

PAGE 77

77 diagnostic methods (bacteriological and se rological) supplemented with management recommendations to prevent the further spread of MAP within and between herds (Benedictus and Khalis, 2003). The voluntary program in Australia modified in 2003, protects the status of non-infected herds and regions, reducing the soci al, economic and trade impact of JD at herd, regional and national levels. This program has b een based on the introducti on of a herd scoring system related to the risk of JD in a herd, thus fa cilitating trade of dairy cattle in a less regulated environment and providing a pathway for herds to progress with JD control. In general, control programs have relied on management techniques to identify infected herds and then clear those herds of infection, a nd results of vaccination strategies have been controversial (Khalis et al., 2001; Muskens et al., 2002). In addition, because of the long subclinical phase and the limited sensitivity of di agnostics, eradication programs require a long term commitment (National Research Council, 2 003). In New Zealand voluntary vaccination is practiced in infected herds. However, although vaccination reduces the incidence of clinical disease in cattle, it does not prevent infection and transmission (Benedictus and Khalis, 2003). Israel started a voluntary cont rol program in 2003 aimed at de tecting infected herds and providing management approaches for the reduc tion or prevention of herd infection. The program is based on ELISA testing and fecal culture of positive cows together with management practices focused on maternity hygiene, colostrum use, culling of fecal shedders, and categorization of herds according to their in fectious status (Koren et al., 2005). Many attempts have been made in the past decade to establish a nationwide management program in the US. At present, there is a nati onal program designed as a model for improving the equivalency of state control and herd certification programs. The program is voluntary, so

PAGE 78

78 producer incentive for participati on relies on the potential for the added market value associated with products from known-status herds. In April 2002, the US Department of Agricult ure, Veterinary Serv ices section, published the Uniform Program Standards for the Volunt ary Bovine Johne’s Disease Control Program. This program recommended an advisory committee in each state to assist the state veterinarian in establishing and opera ting a JD program. The structure of the program has 3 parts. Part 1 is education of the pr oducers, part 2 is an assessment of on-farm risk and herd management plans, and part 3 i nvolves herd testing and classification into 4 levels. Testing in the initi al stage is done by ELISA on 30 randomly selected animals 36 month of age or older. Program levels are reached by successive testing of statistical subsets of secondor higherl actation animals within a specific time frame (National Research Council, 2003) Justification Bovine paratuberculosis causes serious econom ic losses to the cattle industry worldwide and could become an important threat to international commerce. From the point of view of public health, num erous studies have suggested an association between MAP and Crohn’s disease in humans (Chi odini, 1989; Sechi et al., 2005; Shanahan and O'Mahony, 2005). However, presently, there is insuffi cient evidence to prove or disprove that MAP is the cause of even some of the cases of Crohn’s disease in humans (National Research Council, 2003; Sartor, 2005). An additional concern is the fact that MAP is becoming more widespread in the environment and in the food chain. Finally, the fact that MAP hos t range includes ruminant and non ruminant wildlife (Greig et al., 1999) raises the concern th at the spread of the infection could alter wild life populations,

PAGE 79

79 and, if wildlife reservoirs become established, it could limit the ability to control or eradicate JD in domesticated livestock. Management practices Control principles are divided into three categories. First, management practices preventing or reducing the likelihood of highly suscepti ble newborn and young animals from ingesting manure from infected animals. Second, reducing in fections by colostrum and milk management, and third, reducing farm contamination with MAP by management of infected animals. Test-and-cull strategies are not likely, by themselves, to be effective in herd MAP control, and hygiene and management practices should be included. According to the previous statements, most c ontrol measures fall into one of three referred categories of MAP control (National Research Co uncil, 2003); protection of calves, management of milk and colostrum, and reduc tion of MAP load in the farm. The protection of young stock fr om older animals and from feces-contaminated feed and water considers the following measures: Cleaning and disinfection of maternity and calf pens after each use. Maintaining dedicated, clean, and dry maternity pens. Removal of calves immediately after birth to clean, dry calf pens, stalls, or hutches. Raising calves separate from the adult herd for at least the first year of life. Use of separate equipment for handling feed and manure. Design and maintenance of feed-bunks and wate rers to minimize risk of contamination with manure. Applying manure from the adult herd only to cr opland or to pasture grazed by adult stock. Not allowing shared feed or water between adults and young stock; nor offering feed refusals from adult cattle to young stock. Avoiding vehicular and human traffic from adult animal areas to young stock areas.

PAGE 80

80 Testing and managing test-positive cows at dr y-off, before introduction to the maternity pen. The reduction of infections by colostrum and milk management includes the following points: Feeding colostrum only from test-negative cows. Not colostrum pooling. After colostrum feeding, use of pa steurized milk or milk replacer. Finally, the reduction of total farm ex posure to the organism is based on: Immediately culling of all animal s with clinical signs of JD. Cull culture-positive animals as soon as possible; for cows with low or moderate fecal culture colony counts, removal at the end of lactation may be acceptable. Test adult cattle at leas t annually by serum or fecal tests; positive serum test results should be confirmed by fecal culture. Consider calves from test-positive cows to be high risk individuals for later developing the disease, and consider culling recen t offspring of test-positive cows. Purchase replacement animals from test-negative herds. Testing and diagnostics in control programs The control and eradication of JD is severely impaired by imperfect diagnostic tests, prolonged incubation time, the pr esence of undetected subclinical cases, and the lack of knowledge of strain diversity (Kudahl et al., 2007; Motiwal a et al., 2003). Tests for detection of antibodies to MAP, such as ELISA present the major disadvantage of moderate to low sensitivity, and the usefulne ss of serologic tests is compromised by the variability of the immune response, depending on the stage of disease (Collins et al., 2006). The ELISA test infrequently detects infected animals less than 2 years of age and frequently fails to detect individuals in the early phases of infection (Juste et al., 2005). Low agreement between results from different commercia lly available ELISA kits is a nother drawback of this test

PAGE 81

81 (McKenna et al., 2006). However, ELISA testing of sera is still the most common method used in epidemiological studies and herd-bas ed diagnosis (Bottcher and Gangl, 2004). Tests based on the detection of the agent, likewise, pr esent the problem of a low sensitivity, and it has been estimated that fecal cu lture detects only about 50 % of cattle infected with MAP (Stabel, 1997). New methods dete cting specific bacterial DNA sequences have allowed a more rapid identification of MAP. Po lymerase chain reaction (PCR) tests based on the insertion element IS 900 have been widely used for MAP identification (Harris and Barleta, 2001). A combination of independent tests is a common method to improve reliability of laboratory diagnostic tools. As a result of the lim itations of MAP diagnosis, such strategies have already been implemented by using a combina tion of bacterial fecal culture and PCR or serological screening and bacterial fecal culture (Collins et al., 2006). Moreover, a combination of tests with different sensitivities and specificiti es allows a better classification of animals and herds relative to the prob ability of MAP infection (Bottcher and Gangl, 2004). Delayed detection of infected cows was inve stigated by Nielsen and Ersbll (2006). They analyzed the age at which cows tested positive by ELISA and fecal culture (FC) by use of time-to-event analyses. Repeated ELISA testing detected 98 and 95% of cows classified as high and low shedders, respectively, suggesting that most infected cows develop antibodies. Among the high shedders, 50% were pos itive before 4.3 yr of age. Repeated FC detected only 72% of the cows that were ELISA-positive, and 50% of the ELISA-positive cows were detected by FC at 7.6 years of age. The highest probability of testing positive by ELISA was from 2.5 to 4.5 yr of age, and the highest probability of testing positive by FC was from 2.5 to 5.5 yr of age.

PAGE 82

82 For control programs, and from and epidemiologi cal stand point, it is important to make the distinction between test performance at the individual animal level an d test performance at the herd level. The ELISA is a valuable screening test for c ontrol programs. Although the test has relatively low sensitivity at the individual an imal level, it exhibits fairly good sensitivity at the herd level. It also has significant advant ages over fecal culture for screening, which is important in large-scale contro l programs. These advantages include relatively low cost, simplicity, and rapid results (Na tional Research Council, 2003). On the other hand, recently, pooled fecal culture from several animals within a herd has been suggested as a cost effective screening to ol (Kalis et al., 2004). St rategic pooling of fecal samples would increase diagnostic se nsitivity and would be valuable when a herd is suspected to be negative. Vaccination Vaccination against paratuberc ulosis was first described in 1926, at which time live vaccines were used. Conventional veterinary vaccines against MAP have generally comprised killed organisms in oil injected subcutaneously in young animals. Field vaccination is effective in decreasing the incidence of clin ical disease and attenu ating pre-existing in fection, irrespective of whether live or killed vaccine s are used (Khalis et al., 2001). The currently available vaccines consist of a ra nge of variations of whole bacterins with adjuvants and have shown a variable efficacy in field studies. Current vaccine prevents the occurrence of the clinical stage of the disease to a high de gree, thereby limiting a substantial amount of the direct economical damage (Koets et al. 2006). In cattle, however, the vaccine does not prevent infection and subclinically infect ed animals shed bacteria in their feces intermittently. Another major draw back of the whole bacterin v accines is the interference with tuberculosis and paratuberculosis diagnostics; about half of the animals receiving whole killed

PAGE 83

83 MAP vaccines become false positive using the conve ntional tuberculin skin test diagnostic for bovine tuberculosis (Khalis et al., 2001; Muskens et al., 2002). A third weakness is that some vaccines cause substantial local tissue reacti on, resulting in prolonged swelling and granuloma formation at the site of injection (H untley et al., 2005; Ko ets et al. 2006). Koets et al. (2006) reported the use of a r ecombinant MAP Hsp70 as a subunit vaccine in cattle experimentally infected wi th MAP. In previous studies, this subunit vaccine has been shown to produce a cell mediated immune res ponse. The results of the study showed that recombinant MAP Hsp70 significantly reduced she dding of bacteria in feces during the first 2 years following experimental infection. Vaccination is available on a limited basis in th e US. The vaccine that has been in use in US is an oil suspension of killed Strain18 organisms, a closely related strain of M. avium The efficacy of vaccination has been questioned, and th e current consensus is that vaccination may reduce the incidence of clinical disease, and to a lesser extent the prevalence of infection, but vaccinates are not fully protected from infection (Uzonna et al., 2003). In a study by Uzonna et al. (2003), vaccina tion induced a persistent serologic, nonprotective humoral response in 90% of animals w ithin 6 months. The poor success of vaccination might be related to the inability of the vaccine to induce a protective Th1 response, mediating resistance against the disease, instead of an a pparent induction of cellmediated immunity as measured by intradermal testing, lymphocyt e proliferation and cytokine assays. A study from Spangler et al. (1991) documented the effect of calf vaccination for MAP on a serologic ELISA. Fifteen calves vaccinated wi th a killed paratuberculosis vaccine and 5 unvaccinated control calves were tested by seru m ELISA from the first through the fifteenth month of life. All calves were ELISA-negative prior to vaccin ation. Thirteen of 15 vaccinated

PAGE 84

84 calves became ELISA-positive between 2 and 6 mont hs after vaccination indicating that the use of vaccine may interfere with di agnosis of paratuberculosis and with control programs based on serologic tests. Kalis et al. (2001) analyzed whether vaccina tion with a killed vaccine prevented fecal shedding of MAP, and compared effectiveness of a culture and cull program in vaccinated and non-vaccinated herds, on 58 commercial Dutch da iry herds. Differences were not detected among the 25 herds that were vaccinated; cultu re results were positive for MAP in 4.4% of herds. In 29 herds that had not been vaccina ted, culture results were positive in 6.7%. The authors concluded that vaccination of calves with a killed vaccine did not prevent transmission of MAP. In another study (Kohler et al., 2001), after immunization of four calves with a live modified MAP vaccine (Neoparasec, R hone-Merieux, Lyon, France), the humoral and cell-mediated immune reactions were studied duri ng 2-years. The possibility of shedding of the vaccine strain and the influence of the vaccination on the tuberculin skin test were determined. A cell-mediated immune reaction developed much ea rlier than humoral imm unity, with a transient increase in antibody titers. Cell-mediated immun ity remained detectable until the end of the study period. Fecal shedding of the vaccine strain wa s not detected. Positive or inconclusive skin reactions against a M. bovis PPD reflected the possible interf erence with diagnosis of bovine tuberculosis. In the past decades, vaccinati on against paratuberculosis in cattle was performed in The Netherlands only on a limited scale (Muskens et al., 2002); vaccination was restricted to herds with a high prevalence of clinic al cases of paratuberculosis This author reported a study designed to evaluate the immune response re sulting from vaccination with a heat-killed

PAGE 85

85 paratuberculosis vaccine. Over a period of 12–14 years, data showed a marked and prolonged effect of the vaccination on both cellular and humo ral immune responses. It is concluded that a long lasting interference is to be expected with the availabl e immunodiagnostic methods for both bovine tuberculosis a nd paratuberculosis. DNA vaccines can offer an alternative appro ach that may be safer and elicit more protective responses. A genomic DNA expression library was generated and subdivided into pools of clones to determine DNA vaccine e fficacy by immunizing mice via gene gun delivery and challenging them with live, virulent MAP. Four clone pools resulted in a significant reduction in the amount of MAP recovered from mouse tissues compared to mice immunized with other clone pools and non-vaccinated, infect ed control mice. Comparison of the protective clone array sequences implicated 26 antigens that may be responsible for protection in mice (Huntley et al., 2005). Treatment Treatment for paratuberculosis is rarely indicated; however, it may be considered for animals of genetic value or companion animals. St-Jean and Jernigan (1991) presented in a review some antibiotics for the treatment of paratuberculosis includi ng isoniazid, rifampin, streptomycin, amikacin, clofazimine, and daps one. They reported that treatment of paratuberculosis requires daily medication for ex tended periods and result s in palliation of the disease rather than a definitive cure. The reco mmended treatment for paratuberculosis is based on isoniazid, rifampin, and an aminoglycoside. Monensin sodium is a polyether ionophore with a broad spectrum of antimicrobial activity that includes several gram-positive bacteria. Hendri ck et al. (2006) studied the role of monensin sodium in protecting cows from being milk-ELISA positive for paratuberculosis in Ontario, Canada dairy herds. In total, 4,933 dairy cows fro m 94 herds were enrolled in a cross-sectional

PAGE 86

86 study. Composite milk samples were collected fr om all lactating cows and tested with a milk-ELISA for antibodies to MAP. In 48 herd s in which paratuberculosis had not been diagnosed previously, the use of calf hutches and monensin in m ilking cows were both associated with reduced odds of a cow testing positive (OR=0.19 and 0.21, respectively). In 46 herds with a prior history of paratuberculosis, feeding monensin to the breeding-age heifers was associated with decreased odds of a cow testing positive (OR=0.54). In another report, Hendrick et al. (2006a ) enrolled 228 cows from 13 herds into a randomized clinical trial. Fecal culture and P CR were used to identify 114 cows as potential fecal shedders, while 114 cows were enrolled as ELISA negative, herd and parity matched controls. Cows received either a monensin controlle d release capsule or a placebo capsule. Serial fecal culture and serum ELISA was performed over a 98-day period. On day 98 of the study, treatments were switched and cows were followe d for another 98 days with a similar sampling protocol. During the first 98 days of the study, cows treated with a monensin were found to shed 3.4 CFU per tube less than placebo treated cows ( p = 0.05). Treatment with monensin did not reduce the odds of testing positive on serol ogy, and only cows shedding MAP on day 0 were found to have a reduced odds of testing positive on fecal culture when treated with monensin (OR=0.27; p = 0.03). In another study, Brumbaugh et al. (2000) anal yzed histopathological findings on 19 adult cows naturally infected with para tuberculosis. Thirteen cows were treated with monensin sodium and six remained untreated. Monensin ha d a beneficial effect in the ileum ( p = 0.07), liver ( p = 0.03) and rectal mucosa ( p = 0.05), but not in mesenteric lymph nodes ( p = 0.35). Productive and Economic Im pact of Johne’s Disease Paratuberculosis contributes both to direct and indirect losses in the cattle industry due to reduced milk production, premature culling, additi onal losses from higher cow replacement costs

PAGE 87

87 and lower cull cow revenues (Bennett et al., 1999, National Research Council, 2003). The disease also involves losses due to potential limitations in domestic and international trade (National Research Council, 2003). In an early work, Buergelt a nd Duncan (1978) analyzed age and milk production data from Holstein cows repo rting a significantly s horter life expectancy and reduced milk production of MAP infected co ws when compared with non-infected herd mates. Benedictus et al., in 1987, reported a decrease in milk production of 19.5% compared with the lactation two years befo re culling of animals showing clin ical signs of paratuberculosis. The reduction in production was 5% when compared to the previous lactation. In another study, Collins and Nordlund (1991) compared the milk production (mature equivalent at 305 days, ME305) for ELISA positive cows with their test negative herdmates, with 5.36% less production for inf ected cows. This effect was si gnificant in lactation number three or greater. Test positive cows produced less protein ME305 and fat ME305. The net economic effect on productivity of cows increas ed with each lactati on reaching over $200/test positive cow by lactation number three. Nordlund et al. (1996), in a cr oss-sectional epidemiologic survey in 23 dairy herds in Wisconsin found that ELISA-positive cows had a ME milk production of 376 kg/lactation less than that for ELISA-negative herdmates. Howe ver, significant difference was not found in lactation average percentages of fat and prot ein, or somatic cell count (SCC) linear score. Subclinical paratuberculosis infections were a ssociated with a 4% re duction in milk yield. In a study by Baptista et al. (2008), the associ ation between the presence of antibodies to MAP and SCC was analyzed. A causal relationshi p between high SCC and antibodies to MAP was not found, but the results suggest ed a strong association and a potentially increased risk of MAP transmission when milk with high SCC is fed to calves.

PAGE 88

88 Vanleeuwen et al. (2001) estimated the impact of subclinical infection in dairy cattle in 90 randomly selected herds in Canada. Milk pr oduction for ELISA-seropositive cows was lower than that for seronegative cows; in their 1st and 5th lactations, ELISA-seropositive animals produced 573 and 1273 kg less than seronegative cows, respectively. Gonda et al. (2007) estimated th e effect of MAP infection on milk, fat, and protein yield deviations, pregnancy rate, lact ation somatic cell score, and pr ojected total months in milk (productive life). A serum ELISA and fecal culture for MAP were performed on 4,375 Holsteins in 232 DHIA herds throughout the US. Infected cows (ELISA or fecal culture positive) produced 303.9 kg less milk/lactation, 11.46 kg less fat/lact ation, and 9.49 kg less protein/lactation ( p 0.003) and had higher pregna ncy rates (1.39% greater, p = 0.03) and lower productive life (2.85 months less, p 0.0001). Somatic cell score was not affected. The fecal culture-positive population of cows had larger e ffects on all traits than ELISApositive population of cows. In a longitudinal study Lombard et al. (2005) determined the effects on production and risk of removal related to MAP infection at the indivi dual animal level (serum ELISA) in dairy cattle. A total of 7,879 dairy cows from 38 herds in 16 states were analyzed. Cows with strong positive results had ME305 milk production, ME305 maximu m milk production, and total lifetime milk production that were significantly lower than co ws in other categories. No differences were observed for ME305-day fat and protein percentage s, age, lactation, and lactation mean linear somatic cell count score between cows with strong positive results and those with negative results. After accounting for lactation number a nd relative herd-level milk production, cows with strong positive results were significantly more likely to have been removed by 1 year after testing.

PAGE 89

89 Alternatively, some studies (J ohnson-Ifearulundu et al., 2001) also reported non significant differences in production between infected and no n-infected cows. These c ould be reflected in a difference of diagnostic tests us ed, average lactation number for the herds under study, or an effect of average lactation of the herds under analysis. Johnson-Ifearulundu et al. (2001) measured the effect of subc linical infection on ME milk, protein, and fat production in a sample of Michig an dairy herds. Subclin ical paratuberculosis test-positive status (fecal culture ) had no statistically significan t effect on ME milk, fat, or protein production. This is in agreement with results from Hendrick et al. (2005) where no difference in 305-day milk or fat production was de tected in cows with positive results of serum ELISA, compared with seronegative cows. Tiwari et al. (2005) reported th at for cows culled for all reasons in four Canada provinces, MAP-seropositive cows had a 1.38 (1.05-1.81, 95% C I) times increased hazard of being culled compared to MAP-seronegative cows. Among cows th at were culled because of either decreased reproductive efficiency or decreased milk produc tion or mastitis, MAP-seropositive cows were associated with 1.55 (1.12-2.15, 95% CI) times incr eased hazard compared to MAP-seronegative cows. In a review by McKenna et al. (2006a) it was stated that th ere was a 2.4 times increase in the risk of their being culled for cattle pos itive by ELISA, with a decrease in ME305 milk production by at least 370 kg. Host level factors in cluded age, level of exposure and source of exposure, such as manure, colostrum, or mil k. Agent factors involved the dose of infectious agent and strains of bacteria. An epidemiological study in Ontario, Cana da, based on 304 dairy herds analyzed the association between production and MAP serological status (lipoarabinomannan

PAGE 90

90 enzyme-immunoassay). MAP positive status was a ssociated with higher somatic cell counts at herd and individual levels, but no associati on was found with calving interval and milk production (McNab et al., 1991). In another study, the effect of MAP infection on the shape of lactation curves was reported (Kudahl et al., 2004). Milk samples from 6,955 cows in 108 Danish dairy herds were tested with ELISA. The lactation curves after peak yield were significantly less persistent in young infected cows, where an increase of one standardized opt ical density (OD) unit was associated with a depression of the milk yield per day of 3.7 kg of fa t corrected milk in firs t parity and 2.7 kg in second parity. In third and older parities, the mo del indicated exponentially increased losses with increased ODs. This study showed significant co rrelations between antib ody response to MAP in milk and milk production, and it li nks infection to poor persistency and considerable milk loss. Johnson-Ifearulundu et al. (2000), based on a prospective cohort study design, evaluated the impact of subclinical MAP infection on da ys open in dairies in Michigan. ELISA-positive cows had a 28-day increase in days open when compared to ELISA-negative cows. The authors concluded that reduced estrus expression or an increased post -partum anestrous period would occur in the subclinically infected ELISA-posit ive animals, probably due to a negative energy balance associated with MAP infection. Hendrick et al. (2005) determined the effect of paratuberculosis on culling, milk production, and milk quality in infected dairy herds using a cross-sectional design. Results showed that cows positive for bacteriologic cultu re of feces and milk ELISA produced less milk, fat, and protein, compared with herd mates with negative results. The surviv al analyses indicated that cows with positive results of each test were at higher risk of being culled than cows with

PAGE 91

91 negative results. Paratuberculosis status was not associated with milk somatic cell count linear score. A study by Raizman et al. (2007) evaluated th e lactation performan ce of cows shedding MAP in feces before calving and of cows culled with clinical signs consistent with JD during the subsequent lactation. Fecal cult ure was performed in 1,052 cows before calving. Signs of clinical disease (milk fever, retained placenta, metritis, ketosis, displaced abomasum, lameness, mastitis, pneumonia, and JD), and production and reproduction data were recorded for each cow. In 8% of cows fecal samples were positive for MAP. In mu ltivariable analysis, light, moderate, and heavy fecal shedding cows produced on average 537, 1,403, and 1,534kg, respectively, less milk per lactation than fecal negative cows. Fecal culture positive cows were less likely to be bred and conceive. In the multivariable analysis the 56 cows culled with presumed JD produced approximately 1,500kg/lactation or 5kg/ day less than all other cows. Diverse estimations of the economic losses due to paratuberculosis have been presented by different authors. Chiodini et al. (1984) estimat ed that JD produced an annua l loss in New England of $15.4 million and cost the Wisconsin dairy industry $54 million per year. The cost suffered by chronically infected herds would reach an annual economic loss of $75-100 per adult animal. Braun et al. (1990), based on the prevalence of in fection and extrapolating data from previous studies, calculated a net loss due to JD of $9 million annually in Florida. In another study, Stabel (1998) estimated that the economic impact of paratuberculosis on the US national cattle industry was over $1.5 billion per year. In a study by Losinger (2005) the analysis of the economic impacts of JD indicated that reduced milk production, associated with the de termination of dairy operations as JD-positive,

PAGE 92

92 reduced consumer surplus by $770 million $690 m illion, and resulted in a total loss of $200 million $160 million to the US economy in 1996. The USDA National Animal Health Monito ring System's (NAHMS) 1996 national dairy study analyzed the impact of paratuberculosis on herd productivity and economy in US dairy herds. Positive herds experien ced a loss of almost $100 per cow when compared to JD-negative herds due to reduced milk production and incr eased cow-replacement costs (Ott et al., 1999). Herds reporting at least 10% of their cull cows as having clinical signs consistent with JD, had losses over $200 per cow. These he rds experienced reduced milk production of 700 kg per cow, culled more cows with lower cull-cow revenues, and had greater cow mortality than JD-negative herds. Averaged across all herds, JD costs the US dairy industr y, in reduced productivity, $22 to $27 per cow or $200 to $250 million annually. Economic losses attributed to paratuberculosis in herds w ith a disease control program were estimated by Groenendaal and Galligan (20 03) by use of the simulation model. Mean loss increased considerably from $35/cow/y in year 1 to > $72/cow/y in year 20. Lower milk production accounted for 11% of the total loss attr ibutable to paratuberc ulosis, and 12% of the loss resulted from a lower slaughter value of culled infected cattle and treatment costs of clinically affected cows. Finally, most of the loss (77%) attributable to paratuberculosis was categorized as loss of future income as a result of suboptimal culling. One study in the Maritime Provin ces of Canada (Chi et al., 2 002) estimated an annual cost due to paratuberculosis for an average, infected, 50 cow herd of $2,472. This estimation considers direct production lo sses and treatment costs. Elzo et al. (2006) evaluated cow and calf ge netic and environmental factors for their association with ELISA scores for paratuberculosis in a multibreed population of beef cattle.

PAGE 93

93 Regressions indicated that poor er maintenance of cow weights was associated with higher ELISA scores. The data also indicated that co ws with greater ELISA scores tended to produce lighter calves at birth and/or ca lves with slower pre-weaning gr owth. These results suggest that subclinical paratuberculosis may be nega tively affecting cows and their offspring. Crohn’s Disease The Disease Inflammatory bowel disease (IBD) comprises a group of chronic, relapsing, idiopathic, inflammatory illnesses of the gastrointestinal tr act usually presenting as Crohn’s disease (CD) or ulcerative colitis (UC), which predominantly aff ect the colon (CD and UC) and /or the distal small intestine (CD) in either a superficial (U C) or transmural (CD) manner (Blumberg et al., 1999). Both disease entities primarily aff ect young adults and are often accompanied by extra-intestinal manifestations such as arthritis uveitis or primary sclerosing cholangitis, as well as associated illnesses (e.g. osteoporosis or s econdary colon carcinoma) (Hoffmann et al., 20022003). CD was recognized as a distinct entity 75 years ago (Economou and Pappas, 2007) and, although CD and UC share many clinical and patholog ical characteristics, they also have some different features suggesting th at the main pathological proce sses in these two diseases are distinct (Bouma and Stober, 2003) Epidemiological and clinical observations po int toward a multi-factorial model, where clinical disease is trigged by the association of multiple elements involving genetic, immune-related, environm ental, and infectious factors (Bouma et al., 1997; Selby, 2000; Gazouli et al., 2005; Trinh and Rioux, 2005; Economou and Pappas, 2007). However, one of the hallmarks of the disease is the activation of nuclear factor kappa B (NF-kB) that drives the increased expression of pr o-inflammatory cytoki nes (Schreiber, 2005).

PAGE 94

94 Crohn's disease is a chronic, relapsing inflammatory conditio n affecting any part of the human gastrointestinal tract, with the distal ileum mo st commonly involved. It is characterized by transmural inflammation with deep ulcerati on, thickening of the bowel wall and fistula formation, and non-caseating granuloma. Clinical presentation depends upon the site of the inflammation, and it includes general malaise, chr onic weight loss, abdomin al pain, and diarrhea. Extraintestinal manifestations develop in up to 25% of patients and peri anal disease is also frequent (Selbi, 2000; Sechi et al., 2005). Uzoigwe et al. (2007) reviewed some aspects of CD epidemiology. The disease occurs throughout the world, it is most pr evalent in Europe and North Amer ica. It exhibits a prevalence of 161–319 cases/100,000 people in Canada an d affects between 400,000 and 600,000 people in North America alone. Prevalence estimates for Northern Europe have ranged from 27-48/100,000, with around 13 people per 100,000 re ported for the population in the UK (Sechi et al., 2005, Uzoigwe et al., 2007). The incidence of CD in North America has been estimated at 6/100,000 per year, and is thought to be similar in Europe, but lower in Asia and Africa. The incidence of CD in industrialized parts of the world ha s been reported to be increasi ng, and the disorder occurs most frequently among people of European origin, an d has been reported to be 2-4 times more common among those of Jewish descent than among non-Jews. The disease appears in individuals of any age, but commencement between 15 and 30 years of age is more common, and it can also occur in ear ly childhood or later in life. (Sugimu ra et al., 2003; Sechi et al., 2005; Uzoigwe et al., 2007).

PAGE 95

95 The course of clinical disease is chronic and intermittent and treatment includes antidiarrheal and anti-infla mmatory agents to treat symptoms immunosuppressive drugs aimed at disease remission, and surgery (Sechi et al., 2005). Etiology The precise causes of CD remain unknown. Hypotheses include an aberrant or autoimmune host inflammatory response to unde fined antigens, infectious etiology, including MAP, and aberrant immune response to a specific infectious agent, but consensus has not been achieved (National Research Council, 2003). Other causes of CD have been proposed in cluding chronic ischemia and micro-infarction, persistent measles infecti on, chronic viral infection, in fection with pathogenic E. coli abnormal response to a dietary component, and abnormal infl ammatory response to normal intestinal micro flora, or components of the flor a, in genetically predisposed individuals (National Research Council, 2003). Various polymorphisms of a huma n gene, caspase recruitment domain 15 gene ( CARD15 former NOD2 ), that confers increased susceptibility to CD, have been reported, and the role of this gene, which may function as an apoptosis regulator, is currently unclear. Crohn’s Disease and CARD15/NOD2 Gene It has long been suspected th at certain individuals may be genetically predisposed to developing CD (Newman and Simi novitch, 2005; Grant, 2005; Ki ng et al., 2006). As early as 1934, CD was recognized as a familial disorder This observation was further confirmed by many groups (Hugot, 2006), with a proportion of fam ilial aggregations of 8% to 10% on average. In a review by Tysk (1998), population based studies were presented showing that the relative risk of IBD is increased 10–20 times in first-degree relatives of the proband with CD, with the highest risk in siblings.

PAGE 96

96 Research has confirmed that as many as 50% of monozygotic twins are affected by CD whereas the dizygotic-twin concorda nce is not significantly different from that for all siblings. Reported concordance rates for ulce rative colitis are seen in a pproximately 6-17% and 0-5% for monozygotic and dizygotic twins, respectively (Tysk, 1998; Bouma and Strober, 2003; Lakatos et al., 2006). A high heritability index close to 1.0 was presented for CD, and this estimation remained high after correction for shared environmental factors (Tysk, 1998). Linkage studies have revealed a number of put ative IBD-susceptibility loci, suggesting that several genes are involved in predisposition to IBD. In 2001, three research groups independently re ported an association between mutations in a gene on chromosome 16, ( CARD15/NOD2 gene) and CD (Hampe et al., 2001; Hugot et al., 2001; Ogura et al., 2001). Mutations increasing susceptibility to CD up to 40 times were mapped to this locus (Maeda et al., 2005). A recent meta-analysis analyzed th e disease risk associated to CARD15/NOD2 mutations providing odds ratios for CD in mutation carriers equal to 2.2 (95% CI: 1.84-2.62), 2.99 (95% CI: 2.38-3.74), and 4.09 (95% CI: 3.23-5.18) for the three main mutations R702W, G908R, and 1007fs. In a ddition, the odds ratio for double mutants was estimated to be 17.1 (95% CI: 10.7-27.2, Economou et al., 2004). In European populations, having one copy of the risk alleles confers a 2-4-fold risk for developing CD, whereas double-dos e carriage increases the risk 20-40-fold. Carriage of CARD15/NOD2 risk alleles is associated with ileal lo cation, earlier disease onset, and structuring phenotype (Bonen and Cho, 2003). The product of CARD15/NOD2 gene is an intracel lular element responsible for the indirect recognition of bacterial pepti doglycan through the binding of mu ramyl dipeptide, a component of both Gram negative and positive bacterial cell walls in monoc ytes, macrophages and dendritic

PAGE 97

97 cells, where it is mainly expre ssed (Ogura et al., 2001a; Maeda et al., 2005). The protein is a member of the Ced4-APAF1 protein super family a nd is expressed in cell s such as monocytes, dendritic cells, Paneth cells and intestinal epithelial cells. Structurally, CARD15/NOD2 is composed of three segments: the first being co mposed of two NH2-terminal caspase recruitment domains (CARD units), the centr al portion consisting of nucleot ide-binding domain and finally, a leucine-rich repeat (LRR) region as is found in toll like receptors (H ugot, 2006; Lakatos et al., 2006). The binding of CARD15/NOD2 to this bacter ial motif causes its binding to a second CARD15/NOD2 molecule, thus forming a dimmer Further interaction with other cytosolic proteins leads to the ultimate activation of NF-kB, eliciting pro-inflammato ry reactions (Ogura et al., 2001a). NF-kB is nuclear transc ription factor that regulates e xpression of a large number of genes that are critical in ruli ng apoptosis, viral re plication, tumor genesis, inflammation, and autoimmune diseases. It is still unclear whether NF-kB expression is elevated or depressed in CD due to conflicting observations and studies. In vitro experiments demonstrated that the declining activity of this prot ein indicates a loss-o f-function effect (Lakatos et al., 2006). The LRRs are involved in the interaction with infecting bacterial lipopolysaccharides (LPS) and peptidoglycan, whereas the CARDs enab le the protein to i nduce apoptosis and the NF-kB signaling pathways (Lesage et al., 2002). NOD2 variations identified so far are evenly distributed along the entire coding sequence except in its 5’ portion encoding the first CARD domain. The three main mutations of NOD2 (R702W, G908R and L1007fsi nsC), including a frame shift mutation encoding a truncated protein, occu r in the LRR domain or in its vicinity, suggesting that they alter th e recognition of the bacterial LPS. This hypothesis has been

PAGE 98

98 supported by functional experiment s that have demonstrated that the 1007fs mutation decreased the NF-kB activation by the LPS (Lesage et al., 2002; Bonen et al., 2003). Two other members of the NOD-LRR family have been experimentally demonstrated to serve a role in resistance to bacterial pathogens: NOD1 for Helicobacter pylori and Naip5/Birc1e for Legionella pneumophila (Behr and Schurr, 2006). This theory, also, would support the controversial role of MAP infection in patients with CD. Evidence suggests that the CD-associated mu tations result in a loss of functional phenotype (Behrn and Schurr, 2006). However, variant CARD15/NOD2 proteins apparently present inflammation-promoting f unctions. Two main hypotheses provide an explanation for this apparently contradictory point. The first advocates that mutant CARD15/NOD2 is defective in performing critical functions required for lim iting inflammation (loss-of-function). The second proposes that the variant prot eins directly activate pro-in flammatory signaling pathways (gain-of-function). The hypothese s are not contradict ory and may be a valid combination (Zelinkova et al., 2005). Cells of healthy persons and CD patients harboring mutant CARD15/NOD2 alleles do not respond to muramyl dipeptide ex vivo, pointing to a loss-of-function phenotype even in people without disease. Therefore, an important etiological consideration is whet her only a subset of persons with susceptible alleles experience speci fic microbial exposures or whether additional compensatory mechanisms are ineffective in these patien ts (Behrn and Schurr, 2006). An estimation of the proportion of cases of CD that could be attributed to CARD15/NOD2 mutations has been proposed at 15–30%, leavi ng space for a number of other factors in the pathogenesis of CD. The associat ion of gene polymorphisms to an increased susceptibility to develop disease does not preclude th e possibility that the disease may be infectious in etiology,

PAGE 99

99 and CD could result from bacterial insult in gene tically susceptible indivi duals (Van Heel et al., 2001; Newman and Siminvitch, 2003). In three works (Hampe et al., 2001; Hugot et al., 2001; Ogura et al., 2001) it was determined that the CARD15/NOD2 mutant (L1007fsinsC) found in CD patients was inefficient in killing bacteria, when compared with wild-type CARD15/NOD2 supporting the proposed link between bacterial detection and bacteria l killing. Taken together studies on CARD15/NOD2 provide a conceptual link between CD and bacterial sensing. Some works provide more evidence of th e link between bacterial infection, gene polymorphisms, and CD. Sechi et al. (2005a) analyzed the proporti on of people in Sardinia with or without CD that were infected with MAP and had allelic variants of CARD15/NOD2 The results showed that more than 70% of CD aff ected individuals carried at least one of the CARD15/NOD2 alleles associated with susceptibility and were also infected with MAP. In one study (Heresbach et al., 2004) the association of CARD15/NOD2 mutations with CD in different subsets of CD phenotypes was studied. Carriers of at least one CARD15/NOD2 variant were significan tly more frequent in CD than in cont rols, and were significantly associated with ileal involvement, and st ructuring evolution. Granuloma formation was found to be associated with the mutant R702W allele. Mycobacterium Paratuberculosis and Crohn’s Disease In the early part of the 20th century, the similarities between this human intestinal disease and JD in cattle were identified. JD in cattle shares some similarities with human CD as diarrhea, wasting, and a predilection for the ileum (Chiodini, 1989; Bernst ein et al., 2004). CD and JD have been compared clinically and pathologically, but the similarity of the two diseases has been exaggerated in some cases. Some differences include an extra-intestinal manifestation in CD, but not in JD, and macrosco pic features such as fi stulas and pseudo polyps

PAGE 100

100 in CD. Similarities and differences have been in terpreted by experts both in favor of and in opposition to the view that MAP is a cause of CD (Selby, 2000; National Research Council, 2003). Chiodini et al. (1984a) reporte d a previously unrecognized Mycobacterium species isolated from two patients with CD. The organism was an acid-fast, mycobactin-dependent Mycobacterium with unique particularities. The bact erium was pathogenic for mice, and a goat inoculated orally developed both humoral and cell-mediated immunologic responses and granulomatous disease of the distal small inte stine, with noncaseating, tuberculoid granulomas. These findings raised the possibility that a Mycobacterium could play an etiol ogic role in at least some cases of CD. Few years later MAP was isolated for th e first time from a CD patient (Chiodini, 1989). Shanahan and O’Mahony (2005) suggested s upporting observations of a causal link between MAP and CD. They presented Helicobacter pylori, as an example of an infectious agent contributing to peptic ulcer and gastric cancer. Also, genetic and patho-ph ysiologic indication of heterogeneity of CD, suggest distin ct deficiencies leading to a sim ilar clinical manifestation. This would imply that a subset of disease might have an infectious basis. Monozygotic twin studies, with concordance rate of only about 50%, i ndicate an environmental contribution to the pathogenesis of CD, and the increasing incidence, pa rticularly in developed nations is consistent with an environmental influence. In general terms, evidence supporting a link between MAP and CD in cludes: clinical and pathological similarities between JD and CD s; higher detection rates of MAP by PCR and culture in gut samples from Crohn’s patients co mpared with controls ; demonstration of a serological response to MAP antigens in Crohn’ s patients; and anti-M AP antibiotic therapy

PAGE 101

101 resulting in remission, or improvement in diseas e condition; presence of MAP in food chain (milk, meat) and water supplies, and detection of MAP in human breast milk by culture and PCR (Naser et al., 2000; Grant, 2005; Sa rtor, 2005; Bernstein et al., 2007). In recent years, the idea of a link between both diseases has been supported by reports of MAP detected in tissues of patient s with CD by culture and by mo lecular methods (Sechi et al., 2005). In addition, detection of MAP DNA in milk has been stated as a plausible transmission via cattle to human and raises concerns about public health safety (Shanahan and O’Mahony et al., 2005). Detection of MAP by molecular techniques in huma n intestine tissue has produced variable results; the majority of studies have detected MAP DNA or cultured the bacteria in higher frequency from tissues of CD affected individuals than from controls, although the reported frequency of recovery of MAP in CD and ulcerative colitis have ranged from 0% to 100%. However, this opens the possibility that this organism may selectively colonize the ulcerated mucosa of CD patients but not initiate or perpetuate intestinal inflammation (Sartor, 2005). Naser et al. (2004) tested for MAP by PCR and culture in bu ffy coat preparations from individuals with CD, with UC and without IBD. MAP DNA in uncultured buffy coats was identified by PCR in 13 (46%) individuals with CD four (45%) with ulcerative colitis, and three (20%) without inflammatory bowel disease. Viable MAP was cultured from the blood of 14 (50%) patients with CD, two ( 22%) with ulcerative co litis, and none of the individuals without inflammatory bowel disease. In another study, Sechi et al. (2005) found that twenty-five patients (83.3%) with CD and 3 control patients (10.3%) were IS 900 PCR positive in intestinal mucosal biopsies. MAP was

PAGE 102

102 cultured from 19 Crohn's patients (63.3%) and fro m 3 control patients (10.3%). The finding of the organism colonizing a proportion of people without CD would be consistent with what occurs in other conditions caused by a prim ary bacterial pathogen in susceptible hosts. Ghadiali et al. (2004), reported two alleles found by analysis of short sequence repeats of MAP isolated from CD patients. Both of these alleles clustered with strains derived from animals with JD. Identification of a limited number of genotypes among human strains could imply the existence of human disease-associated genot ypes and strain sharing with animals. Autschbach et al. (2005) examined IS 900 in a large number of gut samples from patients with CD and UC, and in non-inflamed control tissues. IS 900 PCR detection rate was significantly higher in CD tissue samples (52%) than in UC (2%) or control (5%) specimens ( p < 0.0001). In CD patients, IS 900 DNA was detected in sample s from both diseased small bowels (47%) as well as from the colon ( 61%). No association between MAP specific IS 900 detection rates and clinical phenotypic ch aracteristics in CD was established. Collins et al. (2000) analyzed results of mu ltiple diagnostic tests (PCR, ELISA, and IFN-g tests) for MAP in IBD patients and controls. Most assays were adaptations of diagnostic tests for this infection performed routin ely on animals. The authors co ncluded that MAP, or other mycobacterial species, infect at least a subset of IBD patients. Abubakar et al. (2008) presented a meta-analy sis of studies using nucleic acid-based techniques to detect MAP in patients with CD compared with controls Based on 47 studies, the pooled estimate of risk differe nce in the det ection of MAP in CD patients compared with nonIBD controls from all studies was 0.23 using a random effects model. Similarly, MAP was detected more frequently from patients with CD compared with those with ulcerative colitis (risk difference 0.19). The data confirms that MAP is detected more freque ntly among CD patients

PAGE 103

103 compared with controls, but the pathogenic role of th is bacterium in the gut remains uncertain. The analysis suggested an asso ciation between MAP and CD, but this association remained inconclusive, and its strength and consistent detection of MAP DNA does not prove causation. Bernstein et al. (2004) had as an objective to determine whether CD subjects were more likely to be MAP seropositive than controls in a sample from Manitoba population (Canada). Using an ELISA for serum antibodies to MAP, initially developed for cattle but adapted for human use, the rate of positive ELISA results there was no different in MAP seropositivity rate among CD patients (37.8%), UC pa tients (34.7%), hea lthy controls (33.6%), and non-affected siblings (34.1%). In the same population, anothe r study could not find an interaction between the NOD-2 genotype and MAP serology in relationship to CD or ulcerative colitis (Bernstein et al., 2007). Effectiveness of anti-mycobacterial drugs to co ntrol CD as a factor of association with MAP is controversial. However, disease re mission following antibiotic therapy has been reported. Chamberlin et al. (2007) presented a case of a 63 years old patient tested previously positive for MAP in blood, that after antibiotic treatment showed a complete remission with accompanying negative results for MAP detecti on by PCR on blood. Another case of a man who had persistently active CD that was not respondin g to medical therapy was reported (Behr et al., 2004). Tissue from mesenteric lymph nodes was examined by IS 900 PCR and MAP DNA was detected. After anti-MAP antibiotic therapy the patient’s condition markedly improved within a few months. The man was found to possess the susceptibility alleles of the CARD15/NOD2 gene. Recently, an altered T cell functi on associated with the presen ce of MAP in CD patients was reported. Higher levels of IL-4 and IL-2 were found in these patients when compared to MAP

PAGE 104

104 negative CD cases, indicating a skewed Th2 im mune response and providing a new antecedent for the link between MAP detectio n and CD (Ren et al., 2008). Some of the evidence against the causal associ ation between MAP and CD is based on the information presented by different authors. CD is less common in rural areas and it is not known to be an occupational hazard of farming; Johne s et al. (2006) found no a ssociation between CD prevalence in dairy farmers and exposure to clinical cases of bovine paratuberculosis. Sartor (2005) enumerated some other points such as: lack of epidemiological support of transmissible infection; lack of epidemiologi cal evidence of transmission from water or milk products; no evidence of transmission to humans in contact with animals infected with MAP; genotypes of CD and bovine origin MAP isolates are not similar, and variability in detection of MAP by PCR and serological testi ng. Environmental conditions su ch as poor sanitization and overcrowding which should favor transmission of infection appears to protect against CD. On the other hand, there is no evidence for vert ical or horizontal tr ansmission of CD, and sustained clinical responses to immunosuppressive drugs and to antitumor necrosis factor-alpha seem to be at variance with a chronic infection. Disseminated MAP in CD has not been reported associated with immunosuppression due to dr ugs used in therapy (Shanahan and O'Mahony, 2005). Another point relates to the fact that detection of bact erial DNA in the granuloma of intestinal CD is not specific to MAP; other fo rms of bacterial DNA are also present, which could reflect disturbed host-flora intera ctions in patients with CD and is consistent with other observations of increased muco sal bacteria in CD (Nati onal Research Council, 2003). A systematic review (Feller et al., 2007) presented 28 casecontrol studies comparing MAP in patients with CD with individuals free of inflammatory bowel disease or patients with

PAGE 105

105 ulcerative colitis. The authors concluded that the analysis assessed the evidence for an association between MAP and CD. Some possibl e confounding and bias on some of the studies considered in the review were; different sour ce populations for controls and cases; higher propensity of inflamed tissue to become infected with MAP, no MAP-specific test validated for human beings is available. In this meta-ana lysis, the pooled odds ratio of MAP presence for individuals suffering IBD from studies using PCR in tissue samples was 7.01 (95% CI 3.95-12.4) and was 1.72 (1.02–2.90) in studies using ELISA in serum. The associati on of MAP with CD appeared to be specific, but its role in the etiology of CD remains unclear. Although there is indication of an association between MAP and CD, to date the evidence appears to be insufficient to either establish or refute a causal connect ion between JD and CD. The available scientific evidence has been revi ewed by a number of expert groups in recent years. The consensus opinion, at present, is that the available information is insufficient to prove or disprove that MAP is a cause of CD, but the hypothesis is still plausi ble (National Research Council, 2003; Vinh and Bersrtein, 2005). The disc overy of a susceptibility gene in Crohn’s patients, CARD15/NOD2 does not preclude a role for MAP in the pathogenesis of at least some cases of CD, as the function of this gene is ba cterial sensing in the gut If MAP does contribute to the causation of CD then it may not be acti ng as a conventional infectious agent (Grant, 2005). Genetics in Animal Production Genetic Basis of Disease Re sistance and Susceptibility Host-pathogen relationships are shaped by co-evolutionary mechanisms between host defense mechanisms and pathogen genetic dive rsity (Detilleux, 2001). The animal genome influences susceptibility to disease, however because of the vast variety of pathogens and complex host defense mechanisms involved, the unders tanding of this interplay is very complex (Adams and Templeton, 1998).

PAGE 106

106 Cattle show considerable variability in their re sponse to a wide range of disease challenges, and much of the variability is genetic (Morris, 2007). The improvement and utilization of host genetic resistance to disease is an attractive option as a component of livestock disease control in a wide range of situations. Th e main requisites for a successf ul intervention are: sufficient genetic variation for disease resistance, economic and social benefits, and the option of using other complementary methods of dis ease control (Gibson and Bishop, 2005). A distinction is important in the defense agai nst pathogenic organisms. Resistance refers to the ability to limit infection and tolerance to the ability to limit the disease severity induced by a given agent. Therefore, selec ting the host for resistance would reduce disease transmission but possibly impose selective pressure upon the pathogen (Rberg et al., 2007). Resistance to pathogens based on innate immunity includes th e following elements: impenetrable barriers, absence of appropriate rece ptors in cellular membra nes, failure to survive after entrance, inability to replicate in the host, and elimination by host defense mechanisms (phagocytes). On the other hand, the re sistance by adaptive immunity involves lymphocyte-mediated host responses, (cytotoxic T cells, helper T cells, and B cells), natural killer cells and macrophage-m ediated phagocytosis, humoral-mediated responses (including antibodies and complement), and production and regulation by cytokines (Adams and Templeton, 1998). Justifications for including di sease resistance in a breeding pr ogram include the constraints on productivity from monetary losses, unfavorab le genetic correlation between productivity and disease, increased demand by consumers for an imal products of high quality from healthy animals, increased resistance to antimicrobial drugs, loss of biodiversit y in nave populations, and positive epidemiological response due to a decreased disease tr ansmission when the

PAGE 107

107 proportion of resistant animals in creases in the populat ion (Stear et al., 2001; Detilleux, 2001; Detilleux, 2002). As presented by Morris (2007), multiple cases of a genetic effect on disease susceptibility have been previously reported in livestock in cluding mastitis, nematode parasites, external parasites, eye diseases such as keratoconjunctivitis and squa mous cell carcinoma, respiratory disorders, tuberculosis and brucellosis. Under current animal production systems and consumer demand for healthy foods, genetic selection for better resistance to infectious disease may become an alternative or an accompanying measure to already existing prophylactic measures (Detilleux, 2001). Genetic Component in My cobacterial Infection At the present, there is considerable evidence that host genome is important in determining the outcome of infection (Veazeyet al., 1995; Ma llard, 1999; Bellamy, 2003; Vergne et al., 2004; Morris, 2007). Genetic factors have long been suspected of determining susceptibility and resistance to mycobacterial infection. As a comparison with a close relative of MAP, a high proportion of the world human population has been exposed to Mycobacterium tuberculosis but not all individuals in contact w ith the bacteria become infecte d, and only a fraction of infected individuals develop clin ical disease. Both infection and clinical tuberculosis result from interactions between the infectious agent, environmental factors, and the host. Recent population-based studies have repo rted associations between some candidate genes and clinical tuberculosis, but the molecular basis of the genetic control of dis ease progression remains unclear (Bellamy, 2003; Vergne et al., 2004). Studies on animal models for mycobacteria l infection have also found evidence that genetic factors influence disease susceptibility. In the 1940s, it was es tablished that inbred strains

PAGE 108

108 of rabbits, designated resistant and susceptible, exhibited two patterns of disease following infection with virulent M. bovis (Bellamy and Hill, 1998; Bellamy, 2003). In a study by Mackintosh et al. (2000), tes ting the genetic resist ance to experimental infection with M. bovis in red deer ( Cervus elaphus ), strong evidence was found for a genetic basis to resistance to tubercul osis (heritability of 0.48). In successive studies, some candidate gene s have been proposed for mycobacterial resistance. Solute Carrier 11A1 gene ( SLC11A1 formerly NRAMP1 ) has been associated with innate resistance to Salmonella typhimurium Leishmania donovani or Mycobacterium bovis BCG infection. Also a mutation was identified in the gene encoding interferon-gamma receptor type 1 (IFNGR1) as the cause for a homozygous recessive genetic disorder causing increased susceptibility to atypical mycob acterial infection (Blackwell, 2001). The identification of families with increased su sceptibility to mycobacterial infection, and the association of gene mutations (IFN-g and interleukin-12 receptor) with individuals having this condition indicate that these alterations would genera te partial dysfunction of macrophage pathways (Levin and Newport, 1999). Genetics and Paratuberculosis Bovine paratuberculosis has largely been suspected to have a genetic component. Estimations indicate a range of m oderate values for heritability to infection (Koets et al., 2000; Elzo et al., 2006; Gonda et al., 2006a). Roussel et al. (2005), working with pure breed beef cattle from 115 beef ranches in Texas, found an increased risk to be seropositive to MAP associated with the Brahman breed or Bos indicus cattle. Cattle from Bos indicus -based herds were more than 17 times as likely to be seropositive as were cattle Bos taurus -based herds, and cattle from interspecies-based herds were 3.6 times as li kely to be seropositive as were cattle from Bos taurus -based herds.

PAGE 109

109 In another study, Centinkaya et al. (1997) ev aluating the relationship between the presence of JD and farm management factors in dairy cattle in England reported that farms on which Channel Island breeds (Jersey and Guernsey) we re predominant were associated with an increased risk of reporting disease; odd ratios ra nged from 10.9 to 12.9 rela tive to Friesian or its crosses and other breeds. It has be en suggested that this susceptibil ity may be related to increased exposure rather than to increased susceptibility or may be conf ounded by some factors that play an important role in the development of clinical disease such as lower culling rate in Channel Island breeds. Koets et al. (2000), working with Dutch dairy ca ttle, report an estimat ed heritability of susceptibility to MAP infection of 0.06 for a population composed of vaccinated and non vaccinated animals. In the subpopulation of vacci nated animals the estimated heritability was 0.09. This provides evidence for the presence of geneti c variation in the suscep tibility of cattle to paratuberculosis (diagnoses based on postmor tem examinations at slaughter house). The estimated heritabilities for susceptibility of cattl e to MAP are comparable to many other diseases traits. In general, the genetic control of diseas e and resistance is polygenic, and several quantitative trait loci (QTL) will be responsible for the genetic component of variation in individual resistance to infectious disease. Candidate gene s involved in QTL may be the bovine major histocompatibility antigens and genes involved in innate resistance, such as natural resistance associated wi th macrophage growth ( SLC11A1 gene). The SLC11A1 gene has been shown to be linked to resistance to mycobact erial infection, including murine models of paratuberculosis (Koets et al., 2000).

PAGE 110

110 Mortensen et al. (2004) estimated the geneti c variation and the he ritability of antibody production against MAP in a populat ion of 11,535 Danish Holstein cows in 99 herds. The model based on antibody (IgG) levels in milk determ ined using an ELISA and measuring optical density (OD) values, showed a significant heri tability of 0.102 and a ge netic variance of 0.054. When a sire model was used, cons idering only the pedigree of sire s of the cows rather than the entire pedigree, the estimated heritability was 0.0 91. This suggests that the genes influence the shift to the undesirable humoral immune res ponse where the infection is out of control. A study from Nielsen et al. (2002a) aimed at determining the proportion of transmission of paratuberculosis in dairy cattle attributable to the dam with emphasis on vertical transmission, including in utero transmission, direct contact of dam with the newborn, and through milk and colostrum consumed. This study found for 1,056 pair s of dam-daughter Danish dairy cows, using the level of antibodies to MAP in milk, an effect explained by the sire of 6.35% and an effect from dam-daughter pairs of 7.7% ( p < 0.05). These results suggest th at the parental contribution was significant and both heritability of suscep tibility and vertical transmission should be considered in any control program of paratuberculosis in cattle. A longitudinal study (Aly and Thurmond, 2005) based on pairs of dam-daughter dairy cows found that daughters born to MAP seropositive dams were 3.6 to 6.6 times more likely to be seropositive than those born to seronegativ e dams. Excluding involveme nt of vertical and horizontal transmission, a possible explanation for some of thes e results could be a genetic predisposition to postnatal infec tion with MAP in which the higher risk of infection for daughters of seropositive cows would be related to an inherited susceptib ility to infection. Gonda et al. (2007a) analyzed twelve paternal half-sib families with the aim of identifying QTL affecting susceptibility to MAP infection in US Holsteins. Serum and fecal samples from

PAGE 111

111 4,350 daughters of these 12 sires were obtained fo r disease testing. Case definition for an infected cow was a positive ELISA, a positive fecal culture or both. Infected cows were matched with two of their non-infected herd-mates in th e same lactation to control for herd and age effects. Eight chromosomal regions putatively linke d with susceptibility to MAP infection were identified, using a Z-test ( p < 0.01). Probability of infection base d on both diagnostic tests was es timated for each individual and used as the dependent variable for interval mapping. Based on this analysis, evidence for the presence of a QTL segregating within families on Bos taurus (BTA) chromosome 20 was found. Recently, familial aggregation of paratuberculos is was described in beef cattle by use of pedigree information and microsatellite markers. In one study significan t associations between ancestors and offspring ELISA status were re ported. The results in a second study reported increased odds of having at least one positive para tuberculosis test result for two out of nine clusters compared to the cluster with the lo west proportion of positive paratuberculosis test results after conditioning on herd (Osterstock et al., 2007a, 2008). Candidate Genes The development of mycobacterial diseases is the result of a complex interaction between the host and pathogen influenced by environmental factors. Numerous host genes are likely to be involved in this process. However, only a small pa rt of the total familial clustering observed in tuberculosis can be explained by the host genes identified to da te (Bellamy, 2003) Susceptibility to infectious disease is influenced by multiple host genes, most of which are low penetrance QTLs that are difficult to map (Lipoldov and Demant, 2007). At present, some studies ha ve explored the associati on between paratuberculosis susceptibility and candidate host genes. Those few have not succeeded in finding conclusive

PAGE 112

112 associations (Taylor et al., 2006; Hinger et al., 2007), likely due to limitations in sample size and sensitivity of the diagnostic test used. However, nine chromosomal regions putatively associated with MAP infection have been documented ba sed on quantitative trait loci mapping (Gonda et al., 2005, Gonda et al., 2006b) As for susceptibility to many in fectious diseases that are probably not controlled at the genetic level by a si ngle gene, variation in susceptibility to bovine paratuberculosis is likely controlled by a gr oup of genes, or many genes (multifactorial inheritance). Coussens et al. (2001) reporte d the identification of a collection of over 40 genes whose expression in bovine peripheral blood mononuclear cells (PBMC) from a Johne’s afflicted animal appears to be specifically repressed by MAP. Tentative gene identities have been assigned to many of these transcription units, based on basic local alignment search tool (BLAST) analysis against the Genbank database. The activity is focused on identifying these genes and their protein products. Candidate Genes in Study Caspase Recruitment Domain 15 gene ( CARD15 formerly NOD2 ) Details on this gene are presented in Chapter 2 section “Crohn’s Disease and CARD15/NOD2 Gene”. Solute Carrier 11A1 ( SLC11A1 ), Formerly Natural Resistance Associated Macrophage Protein 1 ( NRAMP1 ) Solute Carrier family 11 (proton-coupled divale nt metal ion transporters) member A1 gene ( SLC11A1 ) codes for an integral membrane prot ein, which is expressed exclusively in macrophage/monocytes and polymorphonuclear leukoc ytes. The protein is localized to the endosomal/lysosomal compartment of the macrophage and is rapidly recruited to the membrane of the particle-containing phagosome upon phagocytosis (Govoni and Gross, 1998).

PAGE 113

113 This protein/divalent cation transporter regulates iron homeostasis in macrophages, and plays a crucial role in macrophage activation al tering the microenvironment of the phagosome to affect microbial killing. SLC11A1 gene was originally mapped and positionally cloned on the basis of its ability to regulate resistance and susceptibil ity to a range of intramacrophage pathogens, including Salmonella Leishmania and Mycobacterium bovis (Feng et al., 1996; Li et al., 2006; Stober et al., 2007). SLC11A1 gene is highly conserved in many mammalia n species and it shows considerable correspondence in structure between mice and humans. In human beings, the SLC11A1 gene is located on chromosome region 2q35, and it encodes an integral membrane protein of 550 amino acids. Several polymorphisms have been described in the human SLC11A1 gene facilitating studies on the relevance of this gene to myc obacteria susceptibility in human populations (Bellamy, 2003; Sechi et al., 2006). The bovine homolog to this gene was mappe d to BTA 2 (2q43-q44) It is expressed primarily in macrophages in liver, spleen, and lung, and is presumed to encode a protein with 12 trans-membrane segments, with one hydr ophilic amino-terminal region containing a SH3-binding motif located at the cytopl asmic surface (Feng et al., 1996). Bovine SLC11A1 intron sizes show a considerable degree of cons ervation when compared to murine and human SLC11A1 introns (Coussens et al., 2004). Role in immunity It has been proposed in numerous reports that SLC11A1 polymorphisms play a role in susceptibility to infection by intr acellular bacteria, including myc obacteria (Sechi et al., 2006). It has been reported that in the mouse, resistance or susceptibility to infect ion with pathogens such as Salmonella Mycobacterium and Leishmania is controlled by this gene located on

PAGE 114

114 chromosome 1, influencing the rate of intr acellular replication of these organisms in macrophages (Govoni and Gros, 1998; Gruenheid a nd Gros, 2000). A glycine and aspartic acid substitution at position 169 of the mouse SLC11A1 protein is i nvariably associated with the resistant and susceptible phenot ypes, respectively (Ables et al., 2002). In the mouse, the progression of the Mycobacterium avium infection has also been repo rted to be highly dependent on the SLC11A1 gene (Gomes and Appelberg, 1998). A recent study reported that different inbred mouse strains infected w ith MAP exhibited differences in bacterial replication associated to SLC11A1 polymorphisms. This was also associated to differences in time and magnitude in IFN-g production (Roupi e et al., 2008) Case-control studies in human ha ve confirmed the importance of this gene in susceptibility to mycobacteria (Govoni and Gross, 1998). Genetic studies have found that allelic variants at the human SLC11A1 gene are associated with susceptibility to leprosy ( Mycobacterium leprae ) and tuberculosis ( M. tuberculosis ) and possibly with the onset of rheumatoid arthritis (Govoni and Gross, 1998; Skamene et al., 1998; Stokkers et al., 1999; Ables et al ., 2002; Awomoyi et al., 2002). Some research indicates a role of the SLC11A1 product as an iron pum p that depletes the phagosomal compartments of this nutrient and leads to starvation of the pathogen of this essential cation as a way to control mycobact erial proliferation (Gom es and Appelberg, 1998; Govoni and Gross, 1998; Coussens et al., 2001). SLC11 defines a novel family of functionally related membrane proteins including SLC11A2 which was recently shown to be the majo r transferrin-independ ent uptake system of the intestine in mammals. This observation supports the hypothesi s that the phagocyte-specific

PAGE 115

115 SLC11A1 protein may regulate the intraphagosomal replication of antigenically unrelated bacteria by controlling divalent cation concentrations at that site (Govoni and Gross, 1998). SLC11A1 expression has an effect on phagosomes during M bovis (BCG) infection. Phagosomes containing mycobacteria retain the ability to fuse with early endosomes but are unable to fuse with lysosomes. The mycobact erial capacity to inhibit phagosome–lysosome fusion is reduced if not abrogated in the presence of a functional host cell SLC11A1 (Gruenhei and Gros, 2000). Several approaches have been used to analyze how expression of SLC11A1 at the phagosomal membrane may influence survival of Mycobacterium avium and affect its ability to modulate the fusogenic properties of the phagosome in which it resides. SLC11A1 expression appears to have a bacteriostat ic effect and abrogation of SLC11A1 restores the bacteria's capacity to replicate within macropha ges. (Frehel et al., 2002). Role in inflammatory bowel disease Recently, Sechi et al. (2006) reported a st rong association between Crohn’s disease and polymorphisms at the 823C/T and 1729 + 55del4 loci in the SLC11A1 gene in the Sardinian population. Although previous stud ies have suggested that SLC11A1 mutations may favor microbial survival, the study failed to find any association between SLC11A1 polymorphisms and MAP infection. Kojima et al. (2001) investigat ed the association of IBD with three different SLC11A1 alleles found in a Japanese population. Th e allele frequency of one allele was significantly higher in patients w ith Crohn’s disease (11.1%) and ul cerative colitis (11.2%) than those in the healthy control group (4.5%). Th e results suggest that the novel promoter polymorphism of the SLC11A1 gene may influence susceptibili ty to IBD in this population. However, in another study no differen ce was found in allele frequencies of SLC11A1 promoter alleles between healthy donors and CD patients in a populati on of Ashkenazi Jews,

PAGE 116

116 indicating that differences in SLC11A1 promoter polymorphism play no role in CD in that population (Chermesh et al., 2007). Association with disease susceptibility in cattle Nucleotide sequence polymorphism due to a variation in the number of GT dinucleotide repeats has been reported in the 3’ untransl ated region (nucleotide positions 1781–1804) of the bovine SLC11A1 gene (Feng et al., 1996; Horin et al., 1999). The association of SLC11A1 gene polymorphisms with disease in cattle has been mainly focused on this single microsatellite. Coussens et al. (2004) report the near ly complete structure of the bovine SLC11A1 gene, including sizes and positions of 13 introns relative to the bovine SLC11A1 gene coding sequence and the DNA sequence of intron-exon junctions. Comparison of the bovine, murine and human SLC11A1 gene structures revealed a high degree of conservation in intron placement (Coussens et al., 2004). Ables et al. (2002) aimed at detecting polymorphisms in the SLC11A1 gene from different cattle and buffalo breeds. Five breeds of cattle an d four breeds of buffalo were used in the study. Sequencing showed two nucleotide substitutions and one amino acid substitution that was observed at nucleotide position 1202 in exon V of the Japanese black Angus, Philippine and Bangladesh swamp-type buffaloes which coded fo r threonine. On the other hand, the Korean cattle, Holstein, African N' dama, and buffalo had isoleucine, at this position. Research analyzing the role of SLC11A1 gene in resistance to di sease in cattle has been contradictory. In recent works, an association between bovine SLC11A1 gene polymorphism and susceptibility to diseases such as brucellosis a nd mastitis in cattle has been reported (Adams and Templeton, 1998; Joo et al., 2003; Ganguly et al., 2007). Mastitis-resistant cows were reported producing more SLC11A1 -mRNA than the susceptible cattle, and ratios of NRAMP1 : -actin expression were higher in resistant cows (Joo et al., 2003). Ganguly et al. (2007) screened a

PAGE 117

117 population of Murrah breed of buffalo ( Bubalus bubalis ) to identify polymorphism at 3’UTR of SLC11A1 gene and evaluate their association with the macrophage function. F our allelic variants (GT13, GT14, GT15 and GT16) were identifi ed. Macrophages, after maturation, were challenged with Brucella LPS to assay the macrophage function in terms of H2O2 and NO production. The (GT)13 allele was significantly ( p < 0.01) associated wi th increased production of H2O2 and NO, indicating a signifi cant association with the improved macrophage function in buffalo. These results are in agreement with pr evious results from Qureshi et al. (1996) who found that the macrophages from cattle resistant to in vivo challenge with Brucella abortus were significantly superior (p < 0.05) in c ontrolling intrace llular growth of B. abortus M. bovis BCG and Salmonella dublin than macrophages from susceptible animals. In another study, Reddacliff et al. (2005) re ported possible associat ions of particular SLC11A1 protein and MHC alleles with susceptibility or resistance to JD in sheep. Adult sheep were phenotypically classified as having severe, mild or no disease on the basis of clinical, pathological and cultural tests for paratubercul osis, and as positive or negative in tests for humoral or cell mediated immunity. Correlati ons with phenotype were found for particular SLC11A1 and MHC alleles. A case-control study in a naturally infected he rd analyzed the association of 3 polymorphic markers for the SLC11A1 gene with susceptibility to JD. On ly one polymorphism at the 3'-UTR microsatellite showed a different frequency between cases and control groups. These results suggest that SLC11A1 is involved in lesion pr ogression (Estonba, 2006). On the other hand, there are some reports th at are unable to determine an association between the gene and particular diseases in ca ttle. One report did not fi nd associations between resistance and susceptibility to infection with M. bovis and polymorphism in the SLC11A1 gene,

PAGE 118

118 or between the magnitude of the le sions and various RFLP types of M. bovis isolates. The study concluded that the SLC11A1 gene does not determine resistan ce and susceptibility to infection with M. bovis in cattle (Barthel et al., 2000). In an other study, Estrada-Chavez et al. (2001) demonstrated, by Western blotti ng, a high-level expression of SL C11A11 proteins in peripheral blood cells and granulomas of Mycobacterium bovis -infected bovines. Immunohistochemistry of granulomatous lesions showed heavily labele d epithelioid macrophages and Langhans cells, suggesting that M. bovis infection enhances NRAMP1 expression and that ac tive tuberculosis can occur despite this response. In another work (Kumar et al ., 2005), the presence of (GT)13 allele in SLC11A11 gene even in a homozygous condition could not provide eno ugh resistance to brucellosis in a naturally infected herd. Kumar et al. ( 1999), testing the association betw een polymorphisms and variation in susceptibility to tuberculosis in cattle, did no t find differences in the frequency of the alleles between the infected and random groups questioning the role of a specific SLC11A11 sequence on tuberculosis resistance/susceptibility in bovines. In another study, no associat ion was found between the SLC11A1 -resistant alleles and the resistant phenotype in either e xperimental or naturally occu rring brucellosis. Bacterial intracellular survival was assessed in bovine mo nocyte-derived macrophages from cattle with either the resistant or suscep tible genotype, but no difference was observed in the rates of intracellular survival of B. abortus (Paixo et al., 2007). Finally, Hinger et al. (2007) tested the association between a set of microsatellites in different candidate genes and MAP antibody respons e in Holstein cows. The authors reported an inability of the test to demonstrate an effect of polymorphisms in SLC11A11, given that the study

PAGE 119

119 population showed only 3 alleles, 2 of which displaye d very low frequency and were therefore not informative. Interferon Gamma Host defense against intracellular pathogens such as mycobacteria depends on effective cell-mediated immunity (CMI), in which inte ractions between T ce lls and macrophages are crucial (Frucht and Holland, 1996, Shtrichman a nd Samuel, 2001). A major effector mechanism of CMI is the activati on of infected macrophages by type 1 cytokines, particularly interferon gamma (IFN-g). The IFN-g protei n is produced by antigen-specifi c type 1 helper T cells (Th1 cells) and natural killer (NK) cells, and binds to IFN-g-receptor (R) R1/R2 complexes at the macrophage surface. Interferon-g, in conjunction with tumor necrosis factoralpha (TNF), has been also demonstrated as an element activating anti -mycobacterial microbicidal mechanisms in mouse macrophages (Ottenhoff et al., 2002), and cytotoxic T cells as well as B cell differentiation (Schmidt et al., 2002). Concurrent ly, suppression of Th2 ef fector cell functions induced by IFN-g stimulates cellular Th1 res ponses and Th1-mediated autoimmunity. These diverse effects place IFN-g in a key position in the regulation of the immune system (Schmidt et al., 2002). Interferon gamma alone, or in conjunction with lipopolysaccharide or TNF, can activate murine macrophages to kill or inhibit mycobacteria by the induction of nitric oxide, however, according to the study presented by Zhao et al. (1997), the amount of nitric oxide (NO) produced by activated bovine monocytes in vitro may be insufficient to kill or inhibit intracellular MAP. This suggested that production of nitric ox ide by activated bovine mononuclear phagocytes might not be a major anti-mycobacterial mechanism against MAP infection. On the other hand, Cooper et al. (2002) proposed that the acqui red cellular response plays a double role in mycobacterial disease. On the one side, it is requ ired to limit bacterial growth, yet on the other it

PAGE 120

120 must itself be limited to reduce damaging infl ammatory responses. This dichotomy could contribute to the chronicity of mycobacterial infections. The au thors suggest that for chronic mycobacterial infection, IFN-g and NO exert a negative-feedback regu latory effect on the cellular and inflammatory response. This regulatory role is supported by the resu lts of studies, such as those with IFN-g knockout mice, where invasion by different pathoge ns caused dramatic increases in mortality (Schmidt et al., 2002). Reports of familial clusters of disseminated Mycobacterium avium complex infections in humans have suggested that the activation pathways leading to the generation of IFN-g are critical to effective prot ection against this intracellular pathogen; in these instances susceptible patients had a defect in IFN-g production (Frucht and Holland, 1996). In humans INF-g genetic deficiency is associated to mutations in IFN-g receptor. This is a heterogeneous syndrome with different clinical genetic, immunologica l and histopathological types. Complete deficiency in IFN-g receptor is associated with severe or fatal outcomes after infection with non-tuberc ulous mycobacteria or M. bovis BCG, and is accompanied by poor granuloma formation, multibacillary lesions and pr ogressive infection, often despite intensive antibiotic treatment. In contrast, individuals wi th partial deficiency in IFN-g receptor often develop milder, though still severe, infecti ons (Huang et al., 1998, Ottenhoff et al., 2002). However, a 40-year-old woman with disseminating M. avium infection has been reported with an acquired deficiency in IFN-g resulting from the presence of serum auto-antibodies that specifically neutralized IF N-g (Ottenhoff et al., 2002). Denis et al. (2005) analyzed the impact of INF-g on Mycobacterium bovis replication, cytokine release and macrophage apoptosis The authors concl uded that virulent M. bovis is a major determinant of release of pro-inflam matory cytokines by macrophages, and IFN-g

PAGE 121

121 amplifies the macrophage cytoki ne release in response to M. bovis Induction of apoptosis is closely linked to the emergen ce of macrophage resistance to M. bovis replication, which is dependent on endogenous TNFrelease. Moreover, an association study on susceptibility to nematode parasites in sheep suggested that a polymorphic gene conferring increased resist ance to gastrointestinal nematode parasites is located at or near the interferon gamma gene, supporting previous reports which have mapped a quantitative trait locus (QTL) for resistance to th is region in domestic sheep (Coltman et al., 2001). IFN-g gene maps to a single locus located on the long arm of chromosome 12 in the human, chromosome 10 in the mouse, and chro mosome 5 in cattle. Transcripts of the IFN-g gene possess four exons and three introns. Mature IFN-g mRNA is ~1.2 kb and encodes a protein of ~17 kDa. IFN-g functions as an N -glycosylated homodimer (Shtrichman and Samuel, 2001). The organization of the IFN-g gene into four exons is evolut ionarily highly conserved, as has been proven for humans, for experimental m odel animals, and for domestic animals, such as the sheep, horse, pig, and chicken. The most prominent sequence variations within the IFN-g genes described to date are polymorphic intronic microsatellites, as demonstrated for humans, cattle, sheep, and pigs (Shtrichman and Sa muel, 2001). Schmidt et al. (2002) analyzed polymorphisms in the bovine IFN-g gene reporting four distinct series of single nucleotide polymorphisms found in functiona lly important regions of Bo IFNG The region between the two intron 1 microsatellites contained the highest density of SNPs in Bos taurus breeds. Toll-Like Receptors Innate immune responses to pat hogens are mainly coordinated by monocytes/macrophages, granulocytes and dendritic cells, which act as a first line of defense against invading microorganisms. Discrimination of non-self from self is achieved by numerous

PAGE 122

122 host proteins equipped with the ab ility to recognize structures or molecular patterns, present on foreign organisms. One major group of proteins is the Toll-like receptor family (TLR), also referred to as pattern recognition receptor s (PRRs) (Underhill et al., 1999; Schrder and Schumann, 2005). These recognition receptors of the innate immune system have been conserved in both the invertebra te and vertebrate lin eages, and recognize a variety of endogenous and exogenous ligands; many of the latter ar e conserved molecules essential for pathogen survival (Roach et al., 2005). Ligation of TLRs by pathogen-specific receptors initiates a signal transduction pathway in the host cell that culminat es in the activation of NF-kB and the induction of cytokines and chemokines that are crucial to eliciting the adaptive immune response against the pathogen (Wang et al., 2002; Werling et al., 2006) Consequently, activation of TLR is an important link between innate cellular respons e and the subsequent activatio n of adaptive immune defense against microbial pathogens (Bhatt and Salgame, 2007). The involvement of the Toll receptors in innate immunity was first described in Drosophila Drosophila Toll was originally identified as a type I trans-membrane receptor required for the esta