<%BANNER%>

Effects of Social Defeat Stress on Connexin36 Gene Expression in the Amygdala

Permanent Link: http://ufdc.ufl.edu/UFE0022224/00001

Material Information

Title: Effects of Social Defeat Stress on Connexin36 Gene Expression in the Amygdala
Physical Description: 1 online resource (45 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: connexin, defeat, gap, junction, plasticity, social, stress
Psychology -- Dissertations, Academic -- UF
Genre: Psychology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Major depression is a debilitating emotional disorder, affecting millions of Americans annually. It is characterized by the loss of interest or pleasure in nearly all activities for a period of at least two weeks. A preponderance of individuals with major depression report a considerable amount of emotional stress in their lives in the form of significant daily hassles and aversive major life events. These individuals also suffer from a variety of co-morbid disorders including Post-Traumatic Stress Disorder, anxiety disorders and eating disorders. Our current understanding of the etiology of major depression underscores the significance of emotional stress in conferring vulnerability to developing this devastating disorder. These emotional stressors are processed by limbic circuits that are capable of undergoing plastic alterations in a variety of mechanisms that determine the strength of neuronal signaling. One potential mechanism is altered gene expression of the protein sub-units of gap junctions, known as connexins. Connexin gene expression is altered by withdrawal from chronic cocaine or amphetamine self-administration. Furthermore, rats treated with a gap junction antagonist, and connexin knockout mice, both exhibit impairments in standard tests of learning and memory. In the present study, we investigated changes in connexin gene expression as a potential mechanism contributing to limbic plasticity during social defeat stress. For social defeat stress exposure, ?intruder? male rats were each subjected to a larger dominant ?resident? male rat until the intruder was defeated. This interaction proceeded for 5 min or until the intruder displayed the defeated, submissive posture three times. The intruder was then placed into a double-layered wire mesh cage and returned, in the protective cage, into the resident?s home cage. This interaction proceeded until 10 min had elapsed from the start of the social defeat session. The experimental rats were exposed to only one social defeat session (acute) or to six sessions (repeated) with a different resident for each session. Control rats were not exposed to social defeat stress. All the rats were terminated 2 hours after their final social defeat session or at an equivalent time for the unstressed controls. The brains were then dissected out and flash frozen. Punches were collected from the amygdala, homogenized, and processed by RT-PCR to assay the expression of connexin36 (Cx36) mRNA. Overall, the repeatedly stressed rats but not the acutely stressed rats exhibited an upregulation of Cx36 mRNA expression in the amygdala. This experiment provides evidence that amygdaloid Cx36 expression is implicated in the brain-altering effects of repeated emotional stress. However, further characterization will be needed to examine the impact of this altered gene regulation on protein expression and function, and to identify the potential impact of alterations of connexins in determining the affective state of the animal.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Devine, Darragh P.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022224:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022224/00001

Material Information

Title: Effects of Social Defeat Stress on Connexin36 Gene Expression in the Amygdala
Physical Description: 1 online resource (45 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: connexin, defeat, gap, junction, plasticity, social, stress
Psychology -- Dissertations, Academic -- UF
Genre: Psychology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Major depression is a debilitating emotional disorder, affecting millions of Americans annually. It is characterized by the loss of interest or pleasure in nearly all activities for a period of at least two weeks. A preponderance of individuals with major depression report a considerable amount of emotional stress in their lives in the form of significant daily hassles and aversive major life events. These individuals also suffer from a variety of co-morbid disorders including Post-Traumatic Stress Disorder, anxiety disorders and eating disorders. Our current understanding of the etiology of major depression underscores the significance of emotional stress in conferring vulnerability to developing this devastating disorder. These emotional stressors are processed by limbic circuits that are capable of undergoing plastic alterations in a variety of mechanisms that determine the strength of neuronal signaling. One potential mechanism is altered gene expression of the protein sub-units of gap junctions, known as connexins. Connexin gene expression is altered by withdrawal from chronic cocaine or amphetamine self-administration. Furthermore, rats treated with a gap junction antagonist, and connexin knockout mice, both exhibit impairments in standard tests of learning and memory. In the present study, we investigated changes in connexin gene expression as a potential mechanism contributing to limbic plasticity during social defeat stress. For social defeat stress exposure, ?intruder? male rats were each subjected to a larger dominant ?resident? male rat until the intruder was defeated. This interaction proceeded for 5 min or until the intruder displayed the defeated, submissive posture three times. The intruder was then placed into a double-layered wire mesh cage and returned, in the protective cage, into the resident?s home cage. This interaction proceeded until 10 min had elapsed from the start of the social defeat session. The experimental rats were exposed to only one social defeat session (acute) or to six sessions (repeated) with a different resident for each session. Control rats were not exposed to social defeat stress. All the rats were terminated 2 hours after their final social defeat session or at an equivalent time for the unstressed controls. The brains were then dissected out and flash frozen. Punches were collected from the amygdala, homogenized, and processed by RT-PCR to assay the expression of connexin36 (Cx36) mRNA. Overall, the repeatedly stressed rats but not the acutely stressed rats exhibited an upregulation of Cx36 mRNA expression in the amygdala. This experiment provides evidence that amygdaloid Cx36 expression is implicated in the brain-altering effects of repeated emotional stress. However, further characterization will be needed to examine the impact of this altered gene regulation on protein expression and function, and to identify the potential impact of alterations of connexins in determining the affective state of the animal.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Devine, Darragh P.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022224:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101106_AAAAEY INGEST_TIME 2010-11-06T18:37:09Z PACKAGE UFE0022224_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 25271604 DFID F20101106_AABCGG ORIGIN DEPOSITOR PATH weinstock_n_Page_02.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
0bae71b7e5f50369f1bc9e2af321685e
SHA-1
e166a6f6299986d17cfae613b0dea6d8e454caee
7199 F20101106_AABCBJ weinstock_n_Page_35thm.jpg
723dab5bc1facfb6782546d2e529fb23
f242ac82642df832712f38c71163fdbbeae896ea
6762 F20101106_AABCLD weinstock_n_Page_08thm.jpg
8e92748f87a4da18bae4ea03abccc58f
af766215e09ca36d1f7b0943f1f550fb5d0b0b00
F20101106_AABCGH weinstock_n_Page_03.tif
58024448cc7a5bf67476b06d63b7098c
cbe44611f69a0c83e1bef57f4baa04675c76a95d
21129 F20101106_AABCLE weinstock_n_Page_09.QC.jpg
95c4028292e31d2a0173183261a9436c
62122afa42ced7d05fe4b71fabee69102edc5e1b
F20101106_AABCGI weinstock_n_Page_04.tif
409b28c2e9b22080fad1736190cbaf73
e956faff1e04e4bf84bca4ae7984acdca37180d8
F20101106_AABCBK weinstock_n_Page_13.tif
7a8245424953f862fd930a2eae55b0c4
0efe4a4c64bef574138fc7dbc82b752c847a4e97
5791 F20101106_AABCLF weinstock_n_Page_09thm.jpg
23dab4307bffc01f0e26290cdcca8912
5682805d09f17e875c3ca89a1938f717cce0450e
F20101106_AABCGJ weinstock_n_Page_05.tif
512829a0bdbd352b7087e32932a60af2
39eb93d1cf0790fd54bd88046edf67f9d0d52af1
28419 F20101106_AABCBL weinstock_n_Page_20.QC.jpg
07b659e6a446c1aebb94810b00ed5a29
a7136d1ffd42e92236885083bcaba84934d19341
26186 F20101106_AABCLG weinstock_n_Page_10.QC.jpg
f2ed4a98d03fab723ad71fdb4b15fdf6
b3ad28036a1f1cb29ca1df66ba68f5045c24699d
F20101106_AABCGK weinstock_n_Page_07.tif
06c6ef91c966f688254769ef0d181f7c
262215a6168248c1a613fc5d7a177406e9ccb0b8
F20101106_AABCBM weinstock_n_Page_06.tif
29350b4124d0aa071a42dcf5ed2552a8
f7600b9e200503fc7c16bd1a406ca110810c8ff5
7034 F20101106_AABCLH weinstock_n_Page_10thm.jpg
953b84f876580cda251305e0812b6ff7
22f5e42e9342f697d2f88d9b34541e72769d1b61
F20101106_AABCGL weinstock_n_Page_09.tif
d11978c072319a8da8a61a30402a906f
bb40b4434f1a27708a79bd1fd4011788e4850e69
85932 F20101106_AABCBN weinstock_n_Page_36.jpg
e36e59709d62f0092ac177139be2f2af
c358fff58f5b85502011b12ffc95f0d8b3bffb3a
27458 F20101106_AABCLI weinstock_n_Page_12.QC.jpg
719de4af40ab784f1fd2e3282e4e2b0f
834631e42a7e06e74e8010138e828b53ae6ca3ee
F20101106_AABCGM weinstock_n_Page_10.tif
f43aee0360dbfadab6e18370590388bf
d902aaa29cdb4dc39b84ddcbb00f5171759149b2
909044 F20101106_AABCBO weinstock_n_Page_09.jp2
93958a11107ea27a46cea9887f7161e9
a44162f6c6a690edc4a2f311794361479539513a
7232 F20101106_AABCLJ weinstock_n_Page_12thm.jpg
ca8a054efa645d3e2a2951b90659c6a8
8c8f4bac113babc4a5eb32ed4e5780b191a72663
F20101106_AABCGN weinstock_n_Page_11.tif
e6c8d2ab12b351c0496de681d3f214b1
1c71b0a5a7f59e02a6269d7eca32733ae1a35dbe
56371 F20101106_AABCBP weinstock_n_Page_14.pro
9b4793518749a2752611bf464da0a730
83c01f611280223840ba99e151567de148f89cd5
26792 F20101106_AABCLK weinstock_n_Page_13.QC.jpg
d04249fa10b116f1ccfecc4670178389
86b53619d96bf96ef8c81cc3b18fe1c5d76224a2
F20101106_AABCGO weinstock_n_Page_12.tif
7dbc755767dbd52e48b6614d9b930131
c5efbd69ffaa4d278ad9612843e171707bc8154b
54111 F20101106_AABCBQ weinstock_n_Page_35.pro
fb573ce0469088926a87ab1acd81a97a
bde0f746a3572439c0efa988b5e76c5a66a9a600
7457 F20101106_AABCLL weinstock_n_Page_13thm.jpg
6038d2c33901d2f34841d690487cd8e5
f48bcc831999cdef4ac7e4841ce605d33c8cb2fd
317842 F20101106_AABCBR weinstock_n_Page_24.jp2
cf9d10c3b7f3ed73f9f8eab30b7a0dd7
5345b5bcfd4547f4d79d907bd00c0194c236b9a5
7486 F20101106_AABCLM weinstock_n_Page_14thm.jpg
aa93a0783113cefc4d34630e4655b94f
6defd879a3c1a0373c51a9d690419a853fc86d90
F20101106_AABCGP weinstock_n_Page_14.tif
7f233e3893540f6de4b92b68177f8cc7
4ab7514bc02d64eb4e371d1fe11f3e9278db76af
42877 F20101106_AABCBS weinstock_n_Page_26.jp2
c2347155dab8eb1f02e9bbc9a3afb1c6
a84bc657f8ea57914a6e9de447a8dca0b81388fe
5001 F20101106_AABCLN weinstock_n_Page_15thm.jpg
a7af1826ebe2b523f1846813e67bbefd
fb5ec71ab7dbe5bec7be348c0aad87db524a2bb3
F20101106_AABCGQ weinstock_n_Page_16.tif
d826889eab747ee81e46c4f66c8b6083
f8db97fa99a6dd5f3ec26dd492da5788838de1e6
27857 F20101106_AABCBT weinstock_n_Page_02.jp2
9e6a29edb3384fa0e911289893594bf4
e91eb7a2ae1fe7c9f84928e2780dde7108f59813
22286 F20101106_AABCLO weinstock_n_Page_16.QC.jpg
85c21eae3ee881a8850ed81d08d50b5b
ef592f9425997d7cac2c4ad43448ef9a4190b47e
F20101106_AABCGR weinstock_n_Page_17.tif
ebaea3894b4f97a690c54f79a23b46d2
bac1126ce59b8f2c0520a7e161b1b3d3c5c687bd
17566 F20101106_AABCBU weinstock_n_Page_15.QC.jpg
1f9947549ae1522d9dc3961590e5bbf4
f864dcbc759a3ef1f8611358ccf89b00b831d96e
6395 F20101106_AABCLP weinstock_n_Page_16thm.jpg
5eb3419e749918567710c702a4feb659
b2bfb17e0e6b466757d01211ddd0a427fe4253f4
F20101106_AABCGS weinstock_n_Page_18.tif
f999a6d72ae3fec52ca778dfeee8d447
ca0933f1e8cd60fab293bac9a7765e5895a610c4
25330 F20101106_AABCBV weinstock_n_Page_19.QC.jpg
013c2f55b7428395edf0e4c1abb006f0
24d903697fd27556e2ef1d0712541b3a4ade7820
25942 F20101106_AABCLQ weinstock_n_Page_17.QC.jpg
4813c2094bd361e835df4aee16a47476
686a918d2d081257634821075a45242a179379fe
F20101106_AABCGT weinstock_n_Page_19.tif
fa667b24ddaba5a0130dc9a320e97e9a
a28676e9648e5ae37b0cccbc6f343fbaadf1ec3f
7423 F20101106_AABCBW weinstock_n_Page_34thm.jpg
8f9d94c4a536261e13425c5ef6b21833
ca42d0d212317de24de2bc950e8f4d15d19c9e7a
7236 F20101106_AABCLR weinstock_n_Page_17thm.jpg
4e93e845e4039977e103f67ec8fd4334
f6382ada3aa726484261183673d151e60ac4b418
F20101106_AABCGU weinstock_n_Page_20.tif
5c78e6d26ad9d6cecb6a7d0b41b571a0
d90b5b367da47d9f4d7846bfd30d39d37513f271
22061 F20101106_AABCBX weinstock_n_Page_25.pro
86542181a3acfea6f520ba3b6d954263
dd18e1bcb82f47a8ffbf717e6554a10f4761c00c
27555 F20101106_AABCLS weinstock_n_Page_18.QC.jpg
13f0b5e1451fc531726389c786198458
0218ae0c61375faf9a97b5c3230e9b552b2cd764
F20101106_AABCGV weinstock_n_Page_21.tif
9044e87682f0cc7c1f793f755cc68f4e
e0140172817a2cbb5e7b267450059e85b64a78a7
1031 F20101106_AABCBY weinstock_n_Page_26.txt
c35e4fc19d995d06a09a23bafce10f25
6bf8c02b046ddf3a80a72864f8d52e7fbb846eb6
7627 F20101106_AABCLT weinstock_n_Page_18thm.jpg
99096c3315fcf43cbc1fa7a30177eabd
66b4fb79db7721933da3ec374a6e856edba6f928
F20101106_AABCGW weinstock_n_Page_22.tif
64038084cc4725603844b68c1c50dd16
6bc7af404c8d49e00d871e63b53376fcdb027285
7429 F20101106_AABCBZ weinstock_n_Page_39thm.jpg
64ce490b5c5abf5bad60683021e797f0
49675f7e09b897942cabc4c8c121363ce8ee2936
F20101106_AABCGX weinstock_n_Page_24.tif
f4aea17b5ae839015378ea87031046d3
560be6dbde6db72d62c11cd73116f4f722ce96d5
7238 F20101106_AABCLU weinstock_n_Page_19thm.jpg
d81b253b2713a93ca2ca1fe624acbb73
3d36ee60e464ec7bfcbdfaec3b0545e49da31725
F20101106_AABCGY weinstock_n_Page_25.tif
ec722ca31c2f04ef3772e76ccefd74d4
29d5b6da5cae29c9c701134c85055cfc6e4f2b75
7618 F20101106_AABCLV weinstock_n_Page_20thm.jpg
8124f2057e4553a6101cfa4dcce7e5ec
0a5a4903c91998ebcade2f3f2a10ba0cc6aa75b0
86651 F20101106_AABCEA weinstock_n_Page_18.jpg
8695dec579a52d55b92f91e244ab34f1
2e8df4ed99260a84365e154767c191db82c50554
1053954 F20101106_AABCGZ weinstock_n_Page_26.tif
859638d63db35cdce1180c79adc710ec
8ee4e72e1e8bdfc2a8229798006d64c35eb282b7
27853 F20101106_AABCLW weinstock_n_Page_21.QC.jpg
754162b659e16c318583eddd1e2718c2
df55755be1fa3fc31e5ae52cd7748a46ee1aa52b
80970 F20101106_AABCEB weinstock_n_Page_19.jpg
038d9c03b3197bf294b6bfbac7fdd5d7
37bcac4875dd1a3a1f32a69df666ee9f9ccc53e1
7444 F20101106_AABCLX weinstock_n_Page_21thm.jpg
60c29aacbd4868890eb1070720e4ae19
9a7a18f5cc44469dfe9ad67db8a7fc5c5ff5eca3
88501 F20101106_AABCEC weinstock_n_Page_20.jpg
51f811920ce327db02f7b6897b43c629
c7d76fd8fa38b90d9c8569fa6125693aa146b744
8253 F20101106_AABCJA weinstock_n_Page_45.pro
6b88df6b0faa66ced7a9c25ef12362a4
c95e702406ec0c0a694e3b839a034bea0f2d6063
28063 F20101106_AABCLY weinstock_n_Page_22.QC.jpg
c6751bc7eec75d1bf70b42d4f399ed57
95ef12febae2d0e5c81087228100c9b245a76ba9
86986 F20101106_AABCED weinstock_n_Page_21.jpg
206f752fe4c3d0ae778611dc6b2ccfc1
1d8ebe78289432657a8a754724e9519cf42e9872
489 F20101106_AABCJB weinstock_n_Page_01.txt
72274a7044dfb3ec0570527f75b609d6
b72071185d0027fba5368236d2acd3a2cdbd238d
7352 F20101106_AABCLZ weinstock_n_Page_22thm.jpg
3c0f27d5421ec5813c731771fdd2dee5
4a473245df40ca5fe547224736355213f5aa6a39
87638 F20101106_AABCEE weinstock_n_Page_22.jpg
3650a7589e93d62520b67e4f71b35d4d
576729fd6aa65e1c487f5320d4b6d67c9f2d470d
92 F20101106_AABCJC weinstock_n_Page_02.txt
9f3e642a3fa2f4bd64e563d304f8e220
da078982214a6329457e126320b3f0c16ad43d7b
65650 F20101106_AABCEF weinstock_n_Page_23.jpg
1c1a936990288599032d1c9ab3a1aba5
45933156d947086e6b02c32a8ffc05500d774361
96 F20101106_AABCJD weinstock_n_Page_03.txt
376fbc1b72ef25584f7e4d33215062ac
3a2d57983d4e98142051fb6bec515d65a350dd50
31857 F20101106_AABCEG weinstock_n_Page_24.jpg
51ac91f3d3fe7237ec350dead8735d88
9c5a0d08325b2f1f3b7dd87e9978a3798b66e0ae
288 F20101106_AABCJE weinstock_n_Page_04.txt
39e72d1b81ff35936e216a61daa40134
e2f36f813247613cbd2f662f09f8f8ce7d7f0446
33395 F20101106_AABCEH weinstock_n_Page_26.jpg
f17e5f6d5de1f51d3a04fc23e49b057a
6dcbe09a3df68a372cccd2c0e0ecb1c7e18f29cb
2716 F20101106_AABCJF weinstock_n_Page_05.txt
6e2f75ef63624e2187e9dfd61e6967a3
e6cbae9a335eab110bf5ca02f8da3ceb72384d36
33933 F20101106_AABCEI weinstock_n_Page_27.jpg
6ba480a2d1215a26d3d7117fcc30007d
1a26246b30075c12bfd3d1dee1046c99405ad4d7
813 F20101106_AABCJG weinstock_n_Page_07.txt
f6d19e3c803e211d276c8dd1b93ef435
ba56ded746d3ded84401126e138100f51aca9de3
34355 F20101106_AABCEJ weinstock_n_Page_28.jpg
7fbbb0bda639da5bcceaed8ca56b7848
bb79dc90858b35a5ce151c160f9868c231636dcb
2078 F20101106_AABCJH weinstock_n_Page_08.txt
5a547a58ac8263cc68592c2bdcf1ac8a
04adbc1a743b841e7f6f45bf000764c505811a33
45860 F20101106_AABCEK weinstock_n_Page_29.jpg
734b35061b1787065bb844cd991dc9eb
0d9db35e9f9f358ecbaf80ea0b137586f4a11231
1627 F20101106_AABCJI weinstock_n_Page_09.txt
4ae4dd38705f62e4d2f7f961dd98fea7
e578616559f792459a6cda6ce5ecb632bcc4eb73
26150 F20101106_AABCEL weinstock_n_Page_30.jpg
39864ddb4e974b10cffa3ecf7ed6f001
1bd35039548f2a5b1ce7b6c86005a9d09b69f757
2132 F20101106_AABCJJ weinstock_n_Page_10.txt
076c547ae6d4ed1a29ae411c970cc1fa
ec5dc426d1593c49bc0257873e42667308d78001
48926 F20101106_AABCEM weinstock_n_Page_31.jpg
dbce363a257e56943b3d1776a6fa5fb2
c294de0ce4a390ea8d14b19e7b028d716149fef3
2193 F20101106_AABCJK weinstock_n_Page_11.txt
4157c4eb9ba43871c08b0fe5e2626f37
dc5828645558361e1bc006c5f3fad64494d25634
2171 F20101106_AABCJL weinstock_n_Page_12.txt
9de28c29e4c6d60b1d8ed6678a6191ca
accf4245ac8cabfff770a05cbefa4078deb86863
30272 F20101106_AABCEN weinstock_n_Page_32.jpg
374e0cb381601ba287482889d17a8b60
3cce47929999a289d4e578bd8d5350d1c1c06049
2149 F20101106_AABCJM weinstock_n_Page_13.txt
919cbfb0260695f2cce316671faf50dc
d529e1a1448a1327c0c4d22a90005699628c15e9
81460 F20101106_AABCEO weinstock_n_Page_33.jpg
51bfdcc73d6f3c9312fdcf561d8f6657
54eb106100fee2b3a3095cd947ecdf2447395185
2205 F20101106_AABCJN weinstock_n_Page_14.txt
62d8a3093414317b43248296aa33fa6d
ace1682718aa596a1b077d6057f4fd33727f1240
87015 F20101106_AABCEP weinstock_n_Page_34.jpg
d1cd374301a464d6958fe5b10b1cd049
bd871a9d6fec47764c49d51cfa7caf94d5cd66c5
1319 F20101106_AABCJO weinstock_n_Page_15.txt
6eea9e8c1b9f91ae0873b6adbadba3be
84452573ac30d41388bc7a9fe28f1083a26df5a4
83600 F20101106_AABCEQ weinstock_n_Page_35.jpg
e73293c201154f50aee849c49d8a5158
9752e1009814af6ce77ee56e048206b0480947c4
1868 F20101106_AABCJP weinstock_n_Page_16.txt
83b6e2aad73045f7b4c18b45491fa7fb
f348e77f5e601d2091106843201263d4f482d573
25642 F20101106_AABCER weinstock_n_Page_37.jpg
145eef3cb20a87868401796358ac6b92
e152485733e514e7e48c5794666add2bb4d90698
2135 F20101106_AABCJQ weinstock_n_Page_17.txt
f145795ca883a22ce1eecd6000556cce
453a2a79428efac2b7f1af44e1d5ea979054b1d1
14765 F20101106_AABCES weinstock_n_Page_38.jpg
aa171855fb97975573c6bd7d9a488a5c
fbe2ca2c67fefaa9a586fc56cc24233e3bbef2ce
2153 F20101106_AABCJR weinstock_n_Page_19.txt
c39eb127cd1485e5337a9c5647ac2310
b366689e95f9a46d0eae881021f2cdcb2fca57bd
97795 F20101106_AABCET weinstock_n_Page_39.jpg
a8abfe12a25f2b4a83e439941a82b029
c6ade53d02da26eac364517c7b4a4258de901f6f
98332 F20101106_AABCEU weinstock_n_Page_41.jpg
a14ee85f435c9cac8d3263b5382f1180
3e42fefb17987f1bd51bafa108ec5433d02f289c
2199 F20101106_AABCJS weinstock_n_Page_20.txt
ce06b1ec7bc23bc20e5848a035621344
dab05c1340bc989af2fb8c7a2fa4fdd80843367f
101980 F20101106_AABCEV weinstock_n_Page_42.jpg
ff3754204b213f70205d083e8eeda2fc
d6119c763eb1034b4d8d74c7dd378a280e9eea50
2056 F20101106_AABCJT weinstock_n_Page_21.txt
f64897cdd0b8154ed43ede05421db054
d69808a29ddc2b0aaf6fdc53f9c3961f886cbbf0
103478 F20101106_AABCEW weinstock_n_Page_43.jpg
ab1295123a9343bc28a801d309c71bae
1694cad3712d20d989c3a9ebec51e588ccf5c957
2118 F20101106_AABCJU weinstock_n_Page_22.txt
11126d614cba643138f3ca846ab40a9e
f7d2033ebe56bdaf2784847e31a1ad24241c5755
63184 F20101106_AABCEX weinstock_n_Page_44.jpg
9475b7b5bcf55b0ee55b6c22d59e11d8
2dc4c4035a48faaab822b5d2282df1b72a42fe0b
1617 F20101106_AABCJV weinstock_n_Page_23.txt
729df3d6d84eac9609d4ca73a4ad4384
9c6ed49d063f3be1ebae32e645b3ba793528fb21
24982 F20101106_AABCCA weinstock_n_Page_33.QC.jpg
712f0808587d6f14b981b1d3c077d17e
4fdd5f6fda2529b92960797aaa0b0b3d1b5f45dd
21035 F20101106_AABCEY weinstock_n_Page_45.jpg
0783a1a811a356e9b68428dfac627726
b58094f1453fde85b30ee8a9052632cc8c9c6be2
721 F20101106_AABCJW weinstock_n_Page_24.txt
958e3147462354b0363bd487a5be3a51
ed4637d7239232838d9f8baa910acf23758208ce
66772 F20101106_AABCCB weinstock_n_Page_43.pro
12424a3e91196b2c339aec91d0062f48
257147462117127ef10dede845a48dac6652d7c5
240598 F20101106_AABCEZ weinstock_n_Page_01.jp2
c3320fb6a74ffe4007d8194687dd6a95
074ffd5517f7b7c6dbcfbdcdd043e76c8ae53686
659 F20101106_AABCJX weinstock_n_Page_27.txt
08a304b3655dbfdd2d44f75d1ef0d2aa
c89768e8a5d8894d2d0d6742b59bd14d650c484d
27950 F20101106_AABCCC weinstock_n_Page_14.QC.jpg
f7caa2a240f7a146a39f66aa333581b8
d89c866aef086bf3d6f695b1597c547e6e365097
3828 F20101106_AABCCD weinstock_n_Page_31thm.jpg
b3d54d1ddbc9a4c418db0f2155c2e964
9a5c39b83386d2b34f343fd08705ea2629cc3d70
F20101106_AABCHA weinstock_n_Page_28.tif
94764e2520dc1ded972639a6c0ed195a
2ec71210fd01dab2f9ddf9e8eb99f64a25e53d05
746 F20101106_AABCJY weinstock_n_Page_28.txt
68b268f7b4dca3151d2cd216417c229f
594a932d3aaf9cb34d70b679f55a91860a60f9dd
94060 F20101106_AABCCE weinstock_n_Page_40.jpg
4bb86ae5098c0f96905c2695a06049c3
e372eb8c6613889e9b90aefeb3356b3a873ceb14
F20101106_AABCHB weinstock_n_Page_29.tif
01bf18fb41f2938df9a7acefd3e616db
c2e76dc72aec366d01e65b4f7fb05661d475312e
585 F20101106_AABCJZ weinstock_n_Page_29.txt
76bd6ecb76b813c51f38f69dd6299865
c2377cd2e922fc3533556bec87106259dfb62c28
78041 F20101106_AABCCF weinstock_n_Page_08.jpg
5b36fcc23fe8adbcd118bf7c574dc766
45e97c6bbc16de1eef8e36b72d4e01ca77647b4f
F20101106_AABCHC weinstock_n_Page_30.tif
11d54faae06163744392165833983a59
33355fb3543be9c2025b3881b957f18fcace6ece
1051872 F20101106_AABCCG weinstock_n_Page_14.jp2
60270029143dddf514de5db2271dc591
809986e17c864fd9564c599795eaf2dd507f63c0
20623 F20101106_AABCMA weinstock_n_Page_23.QC.jpg
8af84c15eb50e056e6d38266490c17fe
db6237c421664f938d2b1931ca5865b557d8ace5
F20101106_AABCHD weinstock_n_Page_31.tif
b358c6b6917d44909624e6205112d1c6
a3ed5e96dd422a1836cd302a6d049af294f99b54
F20101106_AABCCH weinstock_n_Page_15.tif
1375b6de3a60b1f952192893c0e9bea4
ff795ea3a60028cb9337a6010d9d7d5175cb0a96
5644 F20101106_AABCMB weinstock_n_Page_23thm.jpg
68e6e47e7b4dd42279a678bf3c33b119
593d60717a8f26c68561f8b3b5b8d6bacb4b0e81
8423998 F20101106_AABCHE weinstock_n_Page_32.tif
32062f924bacc4aa6726bc6cece374ac
3372bd7725b2b2efad5fc4252b3dceee6493e4a8
1051935 F20101106_AABCCI weinstock_n_Page_18.jp2
ea01fb027cbcc0e88dac1a038d43fb4e
34925d14e9edeb4ca445c75a8c91f4c4f7a1de0a
9479 F20101106_AABCMC weinstock_n_Page_24.QC.jpg
5188789b4e1fbaab4661a934576be4b7
2c397228f749cca532b1c7348aa8f9a037a80376
F20101106_AABCHF weinstock_n_Page_33.tif
9050f6c595434e69b679a5e623fb6e7a
5d510193699d8d0105de5ceba1e4f0ba7ed36c38
1051982 F20101106_AABCCJ weinstock_n_Page_11.jp2
d05ca73d762d60caa6a0b7621b511c06
e90ec0d79862562c0eee51c281f34f64db962867
3028 F20101106_AABCMD weinstock_n_Page_24thm.jpg
8deb560c7b3c7a6bfe66010aefccd90e
502053805567e173c567c405527f9a8217fcd77e
F20101106_AABCHG weinstock_n_Page_34.tif
8abd5d5d266b70a17c04f8418986fb5c
15392f7bb2b00d12c77b0a5f56105bd15420c507
989767 F20101106_AABCCK weinstock_n_Page_16.jp2
eb30c55ec744cebb8d363237b7e4abd2
18f509f5ede3b7f2e00d73e543276cfc9a688c6b
12694 F20101106_AABCME weinstock_n_Page_25.QC.jpg
661b37123bb810773413e3d92a457957
e9d9a0c735431c825ac5c6199793762773db56b9
F20101106_AABCHH weinstock_n_Page_35.tif
e706222d9721bf96f11e85a1744c748c
c5836260f8723314b9c94f3733ae0fa2e3033b72
3863 F20101106_AABCMF weinstock_n_Page_25thm.jpg
1b1468bc657bc4e5bdbfcf301d3f8d8a
4632665b283b75e7a105e474a417b244c1f7f8fb
F20101106_AABCHI weinstock_n_Page_37.tif
900495b63cfbd38eaa60109e1f18e380
324e4c01c8a87c39c5749063dc6380150a07f6ed
10352 F20101106_AABCMG weinstock_n_Page_26.QC.jpg
cebe5b1ef37320b984addc5872c82394
ed5d3e9cc4c39505fef355b0f283c0ec04a2a3ad
F20101106_AABCHJ weinstock_n_Page_38.tif
2e07982a521b4af3583a0ad8c6fc24dc
9be2590b8bac9130d5ac277b68985d3668886863
2170 F20101106_AABCCL weinstock_n_Page_36.txt
dbea6a4322318f7432b5f66e4779a5f7
9575f82108587a51c14618b84281f1d1b0b977d4
3310 F20101106_AABCMH weinstock_n_Page_26thm.jpg
697a37a10304ffab0aca4c80ddca12b1
470134b8a6f3d98a37013eb6d1159af3fc332125
F20101106_AABCHK weinstock_n_Page_39.tif
82e75b89c4c7e36af32284eab9292125
ccc181510d7eb2edaca1cc4be3673538d0221f1d
28180 F20101106_AABCCM weinstock_n_Page_42.QC.jpg
710dc61e3f44a7a7ab1fe506c786a39a
221c72c68e8961c5aa0def7fde5e7327af2ca731
10817 F20101106_AABCMI weinstock_n_Page_27.QC.jpg
fcd1a65e9e6f64b70222d9e1a865c609
bfdd298e66cdb29cfe5e3d3e0e5f44f3b00b9b7b
F20101106_AABCHL weinstock_n_Page_40.tif
7817a750869a52324758588b6db80b42
39d300cda8eaa77d3c4073baae67f772432e18a8
F20101106_AABCCN weinstock_n_Page_42.tif
a41e43ed4c6cac0dcf29d70fbf04b09b
27dd206399254c5b928beccd27cc9cdd238325e6
3545 F20101106_AABCMJ weinstock_n_Page_27thm.jpg
982451539e3ad112184378f6b6357395
d1268757f892e9dea03902134675e7397228709f
F20101106_AABCHM weinstock_n_Page_41.tif
f92b0e41693326842e7669548aea4a23
2c5538eac41a3c445eb8e4f75cc3445ef979e959
55714 F20101106_AABCCO weinstock_n_Page_05.jpg
d1b168224bfe2c6f6842b462ad0f9e81
e021c5cf00d83e086e12294b0816866a307443a6
3304 F20101106_AABCMK weinstock_n_Page_28thm.jpg
e64c559e938454565d438017fd53929d
bcaa6ac1c39f9d5a7dbcb9f6698e857c9d7cb77c
F20101106_AABCHN weinstock_n_Page_43.tif
3ba21924300d15ccb19aa204701b2c8c
6b21e5df0e9c8a9c19993593e086bde5e1f84daf
2218 F20101106_AABCCP weinstock_n_Page_18.txt
c6d021100e2051fec801a9ba6cc9ac7a
4f265b1c4b815ce1257cc4f53c29a2a0a590eccd
13263 F20101106_AABCML weinstock_n_Page_29.QC.jpg
104d7ef3b7ac222ace5e6f2cd805e57f
b85102227e032f72572b4acedc9adf09b5df259d
F20101106_AABCHO weinstock_n_Page_44.tif
843038bd680e4875e646c87afb31b01a
c864cb01efc7ef2a20bf3de16ecfbdcff9b89e5e
55235 F20101106_AABCCQ weinstock_n_Page_12.pro
ac725cd391797d4f8e2485da1a821877
20cad5b2635ed7291f69a421f81baf601f090503
4259 F20101106_AABCMM weinstock_n_Page_29thm.jpg
fd216bb3744d4662e09414c9abeea5ef
4a228fa3515b2e59dee394cb22eb8259d41232c3
F20101106_AABCHP weinstock_n_Page_45.tif
ffa9421ec80d7d4f8be4cb540b0a2feb
b935259a790dfd77f22d806360542d5a36a0f377
28053 F20101106_AABCCR weinstock_n_Page_11.QC.jpg
ab371d325a6428208fc3b98145e2a7a2
a552dc93c2c326ade5bdfc89c24904169cc949b6
7892 F20101106_AABCMN weinstock_n_Page_30.QC.jpg
a394fa30b407ff8c99a4d270e27db844
8b57e54ff098cd82432b6edc034cb4fc080251fd
F20101106_AABCCS weinstock_n_Page_08.tif
875fc8ea87a664d6f65697372d22c68b
612479b7427c5dfd044fb7a3f31c95c34db74442
2825 F20101106_AABCMO weinstock_n_Page_30thm.jpg
1be05c15ae8e56c576cf4c3b62dc6240
c5a1a566e04d58746dd8cc66a0cd00816ae7390e
7925 F20101106_AABCHQ weinstock_n_Page_01.pro
2f9389aaa3555011fb5a76a46d7f5f97
71fd4cbbfa46f5a4d6e2c6c7f51de937f3c1f626
4283 F20101106_AABCCT weinstock_n_Page_05thm.jpg
a041973077976ba4d6bd585fe708bcc7
00b73631acab217e398d0bfa3f4b31b791017018
13022 F20101106_AABCMP weinstock_n_Page_31.QC.jpg
d98aa555ab109d72b1ef4af0ff13254d
4c39d9311dd6b2cd779612e1b9f5733f998ceded
889 F20101106_AABCHR weinstock_n_Page_02.pro
523d1c8f169e3bd4770aeb0d7a39828b
548902d2d95ace39c1f546bf5eed123eff7bb534
28240 F20101106_AABCCU weinstock_n_Page_07.jpg
73ee1f83f505f2bf738307e4d3fb3293
fdb5681d8da4a337e5c421b7fb59e87b750cd944
8696 F20101106_AABCMQ weinstock_n_Page_32.QC.jpg
bf0f35a40d0032cd04a0b418b3ff1292
944a7a367f3a8e50c6315ba15d9df1bfd75f09d8
991 F20101106_AABCHS weinstock_n_Page_03.pro
94967f3bd6665183db978ea1e148541b
ebb4a712d3184753ee8dfc2118fb96850ec2893c
745007 F20101106_AABCCV weinstock_n_Page_30.jp2
d60851c0ccadf3e30edd9eb13fd5aa60
b5018bc02608c7fafaeb9a8e2e7eed89c953d934
2576 F20101106_AABCMR weinstock_n_Page_32thm.jpg
27c89cc974dfadc4e395c66d44a60dd9
51580a4ef467bb11e25d5fb05b3571441bd06039
6288 F20101106_AABCHT weinstock_n_Page_04.pro
c6c2a4ad0ffadb505e8ea10d2e7823bb
44faafe1921359b998fff0b32ec64782ba286065
40844 F20101106_AABCCW weinstock_n_Page_25.jpg
65edf9e83490d48c241c35f91a6be9b7
0e7c2fce351e476bc75b90bd06395e1950c50809
6836 F20101106_AABCMS weinstock_n_Page_33thm.jpg
0ee40a3ff7b82f9f2d1cb6e33da27441
f8ff792aab4f9864b500853229c334e856215e40
7651 F20101106_AABCHU weinstock_n_Page_06.pro
53fe952fb3590c2b00df2e3e2e2cc7c2
a72e92987811c1d8e11fdd2228affb32996fea13
10305 F20101106_AABCCX weinstock_n_Page_28.QC.jpg
b028249380a836dc7cf5b322c5dc34e0
3f0dfa8dd1e802e9d83ad0b9e338718372573223
27595 F20101106_AABCMT weinstock_n_Page_34.QC.jpg
596c683d778fc9a04b60921d3b9e9617
4dd59cb40f7ecc353cb7b06933cf373eb1b62a84
19451 F20101106_AABCHV weinstock_n_Page_07.pro
e67925186df0ce0a8988f99ee3880474
d820c1c97d0cad0cdd491f2cbc22363d0f601eae
65297 F20101106_AABCCY weinstock_n_Page_05.pro
568153998ad89ee85303266bf22878f7
e79439fdddca4991b75555d8b74b2752ceb4d773
26311 F20101106_AABCMU weinstock_n_Page_35.QC.jpg
0dba392eb06daa6405b5b5da0410d258
ea6b32d21dd3d5ba20c510a2d894f98734075768
47304 F20101106_AABCHW weinstock_n_Page_08.pro
1daf23893d0a914dc916ea83d389a78e
63f81afe308fb917293288994e2de382d4be945e
1051922 F20101106_AABCCZ weinstock_n_Page_12.jp2
fd0dd12f26ee227a091baece35f8fd40
c13af4e4c4520bc9b360554158c0c541569bb060
40804 F20101106_AABCHX weinstock_n_Page_09.pro
754b27ff69fb0708935c43c6e25c4232
36b9847f6cc45bd89c93ebfb787df7c5cce19f7a
27848 F20101106_AABCFA weinstock_n_Page_03.jp2
06eed9feefb329bf13a82dafbb919dab
7a0425289d44bcc884282b0991335108bdbdf1fd
52349 F20101106_AABCHY weinstock_n_Page_10.pro
5ec0992b0e978acb2dc48db0990a5d8a
da1e5df45fb462ea3de784c9f020b573ca1f81fc
27593 F20101106_AABCMV weinstock_n_Page_36.QC.jpg
27041340f267ab493f665934a7baac32
595a6a2743ccff510d2cce0ddcf204dc08b79b53
158650 F20101106_AABCFB weinstock_n_Page_04.jp2
713948c8f2e88dcfaec6be651076adfd
149188f8faf274a1972aebe5e308568593f77602
56058 F20101106_AABCHZ weinstock_n_Page_11.pro
4bfe5f9a61d385bb3953b43d5e1ff736
afba7c4ff456993e7fdd8c42908167593874ff64
7246 F20101106_AABCMW weinstock_n_Page_36thm.jpg
e32fac406becd978e6744ad68d45f3d5
b2c13618dae5117b8b410547238e58d3e16107ac
1051973 F20101106_AABCFC weinstock_n_Page_05.jp2
669003ac50e016934ff5edcc6eec3984
2b004b44890a54ff5791a2ade3e7aff71bdb0da2
8213 F20101106_AABCMX weinstock_n_Page_37.QC.jpg
0cc8cbf71dadec41bf086354939758a5
dab0883b6bb5472f155bfdf777f70139b92ddb2c
242294 F20101106_AABCFD weinstock_n_Page_06.jp2
c436be0369104a4b536011a282abe3f3
d224f733c23c2e407804bbaf48060a855fd482c4
276 F20101106_AABCKA weinstock_n_Page_30.txt
668506d67cdc697602a337b4b426485c
4a37ca317426b831b5c5e5615dbe6b8300fa5d7c
2583 F20101106_AABCMY weinstock_n_Page_37thm.jpg
c5d7f3908eacd9389bb6227c6e41bc11
8c011055bf9f4682b0d07a5b7c7d74b4082007b2
616040 F20101106_AABCFE weinstock_n_Page_07.jp2
66c98b5ce5ed332d18d481f5f6560c2f
92020096da14a6051673fcccd6e1a5f7cb44b036
941 F20101106_AABCKB weinstock_n_Page_31.txt
a0eb48c80999b5cea450d72b196899f7
656c5c5559f9b74ce2a0f4d8aaf99acf97df9a5e
4542 F20101106_AABCMZ weinstock_n_Page_38.QC.jpg
877667f98f57258f209ad6fc024a1625
3e1b9aae06b8e2fde72aa4dab98e6da8560dfcc9
F20101106_AABCFF weinstock_n_Page_08.jp2
1e1729e022a738d225556988e4127020
d7e4582509ce7be7aa6803c141d53c3cb86d7101
707 F20101106_AABCKC weinstock_n_Page_32.txt
8bf795989f3a815ff4f40b8bd455c544
af3b4c8c5e2a058851005398cee62c5f8658f348
1051984 F20101106_AABCFG weinstock_n_Page_10.jp2
e495744c6280b219f78111a9b61ed060
0525f49686d8341615bbcac482be4597f7543b4e
2051 F20101106_AABCKD weinstock_n_Page_33.txt
54c68ad368c7e25842f19a0b784ab26b
3be5334a5ce6219effe0e612d88b78c7accf447c
1051986 F20101106_AABCFH weinstock_n_Page_13.jp2
dc51ed24155d94996ec4c8a3a21fee2a
0bde3063ec8309977679f75b49d4a8481bcc7c90
2188 F20101106_AABCKE weinstock_n_Page_34.txt
2b85d9494b1d37cf07bb44e8945f72aa
554b36a01a3765d824d89de8edca3f198f39a7a9
2126 F20101106_AABCKF weinstock_n_Page_35.txt
f21ea8cbfd3099566ce50593e72a16ea
23a8326eb454e1e68d156acd3b1e32390624f341
755406 F20101106_AABCFI weinstock_n_Page_15.jp2
ed86ea3e7784cccb139bbdb3c4cac247
a241b4ef3a265c3530e9fec29888f5418c4c7014
502 F20101106_AABCKG weinstock_n_Page_37.txt
855fac4637e514b574a8a0e148f4ba17
0aa0d50658ed833b7693bdbb00c20876590c85da
F20101106_AABCFJ weinstock_n_Page_17.jp2
604f3cdae4614f8818fc29185395ce1e
60a3309c0b4d218ec0081210455c5201d588b65f
299 F20101106_AABCKH weinstock_n_Page_38.txt
b1d933962ac65614e887131d617fd4ac
ad63ab16e997870365c42e3f72ee2fc3e5d3e2f9
1051957 F20101106_AABCFK weinstock_n_Page_19.jp2
77c83d3831b635adc39c44e4f5bb936e
781b1b7b8489f916dfbf1b8b4144681408216e60
2469 F20101106_AABCKI weinstock_n_Page_39.txt
b286b0edef2819c6e8befd00a9d83558
ec3fd41c375d99e5c99e6224cfca077ffa342883
1051954 F20101106_AABCFL weinstock_n_Page_20.jp2
d5453f972ae97ddda7d537685f19eef4
63ced67711885888b2eca7f5fbbf5290f755fa9e
2423 F20101106_AABCKJ weinstock_n_Page_40.txt
7be593b7e47f4092040a556119cf9703
75753641ae19c8b147b6a9d2f123432a4073f62a
1051936 F20101106_AABCFM weinstock_n_Page_22.jp2
2dff1b3db94aaca31b6d8fd05d77ac9d
21f0da193427f6801242e52591eeae3faab8dc8f
2447 F20101106_AABCKK weinstock_n_Page_41.txt
49a7fef1fce65425ca472770ad1534d2
0cca5944ad21bab5ac061569d60cbc900934ffd2
896853 F20101106_AABCFN weinstock_n_Page_23.jp2
fb8e9322b3c2559262a365d51aa47015
36aadefd28b635d1f9639a9c234e680daf8d0fd4
2663 F20101106_AABCKL weinstock_n_Page_43.txt
b9abdb1b9d88c1d55d6992ba3b328e6a
519864cc8653b125ce6cbc72ce4a188e10ed3a05
1546 F20101106_AABCKM weinstock_n_Page_44.txt
5456b42d88e5d4ee1573507c3754156c
37280983711d9b15b59a712fcea4d4620006cd0b
504245 F20101106_AABCFO weinstock_n_Page_25.jp2
7cd8edf624948ebf0f6ee9bead648776
8dcc77ed9ac36b225e92d0483e52b0a58e40a8cf
368 F20101106_AABCKN weinstock_n_Page_45.txt
18025488e933d702ae22d1feaafd2714
3990685b956d95dbed174e7d3cde0070eacb840b
359914 F20101106_AABCFP weinstock_n_Page_27.jp2
3f730242d1c42b44c552b7f0275bb599
39d611c7e545bdcc73eadd82145f55eed8cd803d
573320 F20101106_AABCKO weinstock_n.pdf
9628cf1f895fdd273ff6bf170d580444
25d4ea40c0a11c321f52ba5c4beb37a6bc0c27a1
410058 F20101106_AABCFQ weinstock_n_Page_28.jp2
cf2c213b581bd22461d73bc30a1f8e6d
ee78207f7adbf666db46f75d9201cb455786f1d4
2369 F20101106_AABCKP weinstock_n_Page_01thm.jpg
42377504221ec90628cb7ce52eb817fe
2e79095969f6400421fbfc3215f096b3217e4d5c
907408 F20101106_AABCFR weinstock_n_Page_29.jp2
b1d63c961024899a9a45d828ce5a89c3
ed8eb68f3a7bedf6891cf2fde8adeecec9f3e0d8
55614 F20101106_AABCKQ UFE0022224_00001.mets FULL
bb714c2df6bc3577475350440f2f2805
f5fa1b94086e9a712f85ad71a4a8e35245fe1925
367061 F20101106_AABCFS weinstock_n_Page_32.jp2
6e52917576512291aa916595b8bf5705
fac77cf76c10cd29469955d6e7cff167ac65af5f
7476 F20101106_AABCKR weinstock_n_Page_01.QC.jpg
8f0e146a675c0c4d1855e00af216c61c
717015e125f280de8c1c2dc3d9a536c0092e3819
1051975 F20101106_AABCFT weinstock_n_Page_33.jp2
17b0de125d36ec6e7b2b63e701864f80
d48d4eb04f224912bf7d6624e56fd192e85aa309
3107 F20101106_AABCKS weinstock_n_Page_02.QC.jpg
d199c9159618a820fceea5988b56c368
dd066213831441da247a6f201f588158e70b3f62
1051892 F20101106_AABCFU weinstock_n_Page_34.jp2
5d4a9b0bcf6401d8d11d690aa77f29d0
0926cab1da58e63ecb77ec562ecc60de8c87768e
1051981 F20101106_AABCFV weinstock_n_Page_35.jp2
aaf2acd002a2d61048df7e21814d1e85
15bc7f0494e355bbc8b2151f4b4f41c9a7d5b746
1386 F20101106_AABCKT weinstock_n_Page_02thm.jpg
f4dcbd3471d6d7cb405c76b47b7ec810
6e6653983484ff28aa8a4a1a8dd2dfa4c54169d5
1051916 F20101106_AABCFW weinstock_n_Page_36.jp2
3b146f9e221640c6399ed7ed08b5917a
3d77029ab36a733717565be3fdafc6afcf70d1a1
3123 F20101106_AABCKU weinstock_n_Page_03.QC.jpg
9cfa8b78214c35c88e4be1b4fc108113
dde1f27f8f2c1f70402c442e06c145e551219b4b
289094 F20101106_AABCFX weinstock_n_Page_37.jp2
d3a4b23a30f92255b072d06e0bb6d16c
7188d791d74a32ad80f9b0dbfeb07f6921b5f908
1373 F20101106_AABCKV weinstock_n_Page_03thm.jpg
853b8ed656a3c27526a5bce783e917f0
ee7622c9ff9b5e8169cdf2f0e9d28422fa9e7525
F20101106_AABCDA weinstock_n_Page_27.tif
19af509beb67c285f6b8bc28a6393965
005aea3181942a05662efaba318aef267193f3cf
97080 F20101106_AABCFY weinstock_n_Page_38.jp2
3d23a3fd67274e5e7e089a06220534dc
eb47703e55e13be950838aa7c0b422f0ead2ac46
5485 F20101106_AABCKW weinstock_n_Page_04.QC.jpg
75220f69cdb1232700a5cb67392754b5
d8836505eab5e0b3c31e33f1c5946f97f5cc46de
851157 F20101106_AABCDB weinstock_n_Page_31.jp2
6366539845aad6881ea76ad98a5ce88f
66eca3cc550a0ae7c56d37632ff1dd2d24c93949
1051938 F20101106_AABCFZ weinstock_n_Page_39.jp2
2de64124c2852fbcf936be0cb751b2a9
41dd52f110c8b817529c0a36e0d324d3d1d22f09
15578 F20101106_AABCKX weinstock_n_Page_05.QC.jpg
2c496ed6c39966203491b5a4e40ab59f
917ac6a887749242e1cf0601b760e5e1bb70c188
F20101106_AABCDC weinstock_n_Page_23.tif
a3487c57fdc7cbc45caefb17282c9ad2
e5d28f23b0795a8e0cd35e80b908b683c1a0b691
54773 F20101106_AABCIA weinstock_n_Page_13.pro
eba31c1fb5fcc6f811b161e867735c42
d778cfffa9b6fd33ba66acbec5d438fe111bd595
5121 F20101106_AABCKY weinstock_n_Page_06.QC.jpg
2cab0b410692958a3479190c53fc25e5
da13cd3000edac32e7d0688f95bd2f6adb27ef97
1051961 F20101106_AABCDD weinstock_n_Page_40.jp2
cd614c49932472f9a68b3300c745b8d5
217d57da56cf63825ca261ed88ad4cb091f86823
33167 F20101106_AABCIB weinstock_n_Page_15.pro
8663f6df5c5be70ea12b5c22a1bae3e7
e103efb12b709734ca72d7cb1df61ae21f91909c
1793 F20101106_AABCKZ weinstock_n_Page_06thm.jpg
d3e05792f681aeb0c2060b3de8e9afda
2630759b90fd64baceb66e83b9cc38d808839a4e
52859 F20101106_AABCDE weinstock_n_Page_19.pro
b48ff60edfc2d8e74585b7c393cdccb4
72ec90a7911822ec22c2a487e47000a378ee2eed
43060 F20101106_AABCIC weinstock_n_Page_16.pro
19e2809d316bd935fa6d92b7e2bc6d1c
48a7dc4ee125ffeb7f7ce4eeed9c4688d9c8c51f
18787 F20101106_AABCDF weinstock_n_Page_44.QC.jpg
26157425360d263e3ac61baf4d8ad460
61adfa4edc66a2c82a4fbb50b2bfc34ed9147fc0
52524 F20101106_AABCID weinstock_n_Page_17.pro
e7d2600e66d74ee9dedace6557b28fb0
1e1a9fb1d6d2bfb93febd74c7eaf73bbeb5391ab
1051985 F20101106_AABCDG weinstock_n_Page_21.jp2
1756335be19efaf81d3f5e13d0afc082
eb69ee38f8f123395240ad94e8e0c5fc13f84dc1
1738 F20101106_AABCNA weinstock_n_Page_38thm.jpg
07e0da1d49e7879e061b123c71165a4f
4b664f9521b66387d863ec820abef2544bc8e7c6
7356 F20101106_AABCDH weinstock_n_Page_11thm.jpg
13289830e60ee770566cd59e02986b16
5b6769d083b164313b3c68e07ca592e952e01cb1
27307 F20101106_AABCNB weinstock_n_Page_39.QC.jpg
071550f17dc9fc4750ca956f4fe7681d
60d78e3a374305f9f526aa08fbc06da535381734
56411 F20101106_AABCIE weinstock_n_Page_18.pro
3a04033befe5fb53f1ed815ec07368b9
5ff96a81ed8c4b108879422230996ae5b94d7c57
63993 F20101106_AABCDI weinstock_n_Page_42.pro
b3961122242fb9becdd46abc2ed71701
c8acf40857c6d9c4c5da5d5539e41bd62530b176
26901 F20101106_AABCNC weinstock_n_Page_40.QC.jpg
a1b1d696b193a99a97ce6794cdcad6c5
119e7ee665ec0b3b6d02b5d1d7aba7fd2329342b
56125 F20101106_AABCIF weinstock_n_Page_20.pro
777ee63bea5662e8ae7f431038e5487a
76f34b835584e03598b919123703293032466bfb
71486 F20101106_AABCDJ UFE0022224_00001.xml
7486542302a6c7a470e54ae15c4abba3
0cbd946c54367ba22a8eea30d8a2bf5f332e6aea
7348 F20101106_AABCND weinstock_n_Page_40thm.jpg
67b0a0002f5058288ab825cd4562a844
03864be57c6b71a1247c949b111dbebbb8dc4efe
52333 F20101106_AABCIG weinstock_n_Page_21.pro
3196329a00b8ac17f826249572492a6c
8c6ba9933bca240f4517bef0d6ee465b27b9bc34
28082 F20101106_AABCNE weinstock_n_Page_41.QC.jpg
db9fc81595f9d1c33ae7870b88985150
c2f76c069f2e8b9453213653186921b5ca13446e
54023 F20101106_AABCIH weinstock_n_Page_22.pro
481dabbfe6d4015b15eae27086b812d4
d3eab5d3c4a68065e705e8856261031a0ff9c618
7690 F20101106_AABCNF weinstock_n_Page_41thm.jpg
cd531b4e050d35167b8921ed1362213e
6c9103d9097419c53f6ab1ea84f8972b7bdaa777
39117 F20101106_AABCII weinstock_n_Page_23.pro
935cddf940e8aa3ed751a198e87a2d93
a456dd1ad0cffe65a094e8eda461bdaba1baab01
7460 F20101106_AABCNG weinstock_n_Page_42thm.jpg
5f2905fad94dbe708898ed372b1456ef
ad212eb1374a19043b919d11aa51f544586c8612
14911 F20101106_AABCIJ weinstock_n_Page_24.pro
e507107a425ebc77d20ae6241a8c0fe2
6a50efbeeb20d8c4b4e94bee5113aae75f6eec60
24229 F20101106_AABCDM weinstock_n_Page_01.jpg
341b0ecdb064def8d0057282e513c943
2fcca9b7805baf428da7968903428c82268e271d
29577 F20101106_AABCNH weinstock_n_Page_43.QC.jpg
b308576bc3a7c5f478621ed3457f7899
a0b0b8796512da78203e573ed6ddf18a207ec3ff
18891 F20101106_AABCIK weinstock_n_Page_26.pro
dfef2c0ca0b33d218d59888450b873b7
d6de6c541789059bded32ac19a73f9802f3ec00b
10106 F20101106_AABCDN weinstock_n_Page_02.jpg
c7bfda7abdfddc59773c6627e9a6047b
47209c41a4bc45e14446e37cbfbc2a70167dab0e
7978 F20101106_AABCNI weinstock_n_Page_43thm.jpg
5b712756371caacb2ae1776f8996f7d5
8f135df2cf0581280cc791725ab4f740802c820c
14360 F20101106_AABCIL weinstock_n_Page_27.pro
830ac710a0493067d2dbbb6e8be49db5
64e71b67dda69faf8d692a97fd14a9eed63f2c8f
10196 F20101106_AABCDO weinstock_n_Page_03.jpg
92f97b95926d04a2329eae905e5bbcce
d172a5d170bbdfadad9502ba173b60abab4caffb
5352 F20101106_AABCNJ weinstock_n_Page_44thm.jpg
abd046ae249bfff284c20445ae0df489
f697b3da7eb5f6b9dd2dca71ac49a73ff8bcb10d
17387 F20101106_AABCIM weinstock_n_Page_28.pro
0634daf5de5bdcc3948c27e1462377d7
d0b73eead8df7c84724eeb6fa36d40c468d369a2
18161 F20101106_AABCDP weinstock_n_Page_04.jpg
4dd8ca9b497d0c19b747b59750275922
91621e99bdfc63ead87b438f76e9a06a21163f1e
6165 F20101106_AABCNK weinstock_n_Page_45.QC.jpg
f0f109ddf2aa8c6758b74165b45ff950
ae67b0686e4e37f30b65c6e25fc27868c41b6ba2
9950 F20101106_AABCIN weinstock_n_Page_29.pro
23387e604fda52b6457b9f2b2b4bf602
26ac785fd94062f787908a31a3355fb5a6f8e1be
16222 F20101106_AABCDQ weinstock_n_Page_06.jpg
17e549182400ef383bd0901f37cbe347
47aaf2c0336217fce54625ade5690b2f86b37962
2216 F20101106_AABCNL weinstock_n_Page_45thm.jpg
c72115b8af78164f9e936f052a86a1b8
d39ec25def6c4435ddcb64461f210247e0d6b438
5805 F20101106_AABCIO weinstock_n_Page_30.pro
1e1c0bf09ea59617821d99fc31169bda
af2acb937928d5059ac52297b3abce4a838f9a80
66634 F20101106_AABCDR weinstock_n_Page_09.jpg
7f3f732786e7f19a0a8f00337d811954
04bcf9bc62b28439553d2b34fcf29e0d1ae3c2f4
14655 F20101106_AABCIP weinstock_n_Page_31.pro
f30d2cdb37e6887b97ba25adb760c4fc
b0536d28ad000c081df7c973c5685c345a18279c
83978 F20101106_AABCDS weinstock_n_Page_10.jpg
79e45f70c6f1ec9e72245f30aad08500
5221429bbbcb7c4f350c0f5ad583d463ba3c64e3
15723 F20101106_AABCIQ weinstock_n_Page_32.pro
e37ba89b9fabff4d0e8582e838baa4c1
53132aa1d75548358b787380bf26849152479f66
88485 F20101106_AABCDT weinstock_n_Page_11.jpg
35b7271fb59067adca75bc33ad2f53ea
b22f46230dca0face8ffc0ec4c13dbc5120ee645
86458 F20101106_AABCDU weinstock_n_Page_12.jpg
df52e50147efbb0adcc217fa1c8e28d4
3a15dfbee1afb14259670047cf6eb33d797da92d
49873 F20101106_AABCIR weinstock_n_Page_33.pro
e0ca305125c4b6e91f93b14208c4017a
4d3a970334362b8455dfe642969cf53c9278236a
86765 F20101106_AABCDV weinstock_n_Page_13.jpg
008acd8f0ce1952aac4960d1f6c7f805
70ef67e7c56fb9d9726957b5109ff645853d3799
55604 F20101106_AABCIS weinstock_n_Page_34.pro
7138fd80f836227b7c728365fa671b9c
ec40878ae41384d18b41a6611e5e1c317317b946
88308 F20101106_AABCDW weinstock_n_Page_14.jpg
b9677a5e76c4ff3cb07014eaf6edaf1c
599a1129f47c83a5cc8086d85845c397c37fdadc
55262 F20101106_AABCIT weinstock_n_Page_36.pro
074264f63be7848da0ad69f423e42fa0
b63d72aea8eacb820950cec58bb24468f8d7d9e7
55944 F20101106_AABCDX weinstock_n_Page_15.jpg
6fc890847e5a4f92f73be7d564a8f0f5
839a0a35e09b8507b70d615642e8d754a38540bc
12647 F20101106_AABCIU weinstock_n_Page_37.pro
9bc1470e5a73006bfd5d9aec10f8d24c
3253fe2b25544bb778872e07f0f7b8f70799216a
72795 F20101106_AABCDY weinstock_n_Page_16.jpg
95f2beba0d6dab6b62859a97043704c1
cc910556db2def70a48b0b8d9f03b2a9a5a9a385
3713 F20101106_AABCIV weinstock_n_Page_38.pro
8cdb393dde03a06995555529342f1f11
d246504e62810d342f07716aa2fa0e76dca6c4fc
82604 F20101106_AABCDZ weinstock_n_Page_17.jpg
c3005df272c5a870090942b6d7e75ac2
f89a3d747274cc6339c942db2caf6f5e3e165a1b
61794 F20101106_AABCIW weinstock_n_Page_39.pro
a2c344c80e7796ace5a97a4357bd980b
fcf6e6eaa87df4db3ce0b7b21f6d3bedd4712e4d
60444 F20101106_AABCIX weinstock_n_Page_40.pro
37a04f489592a1f14ca048e9a0052ccb
e860dbc130aeb96366aebd360e012fb61d3e5d26
1051966 F20101106_AABCGA weinstock_n_Page_41.jp2
ecfd1d232cec5843398fefc9ead169ca
5ef285ec52ce4d4a77af525449759baad7300159
61352 F20101106_AABCIY weinstock_n_Page_41.pro
3b7dd7595c5e94eca43bdc40ad929a39
311aeba2c2576856328bbe80e91a7a245983b25d
1051983 F20101106_AABCGB weinstock_n_Page_42.jp2
e4cb3d24619b574dee43eb17b7fa40a2
6af18f7cd73728aab203c041149ee3056ae41ff8
37993 F20101106_AABCIZ weinstock_n_Page_44.pro
9d083aed814d0def57c06153040b63cd
612c4f2f86ef8b17c050f9c34920c60871cacb32
2556 F20101106_AABCBE weinstock_n_Page_42.txt
235efba6deb684bb8221a9287b1f6cc7
6a798c5b48607202d105be13c0e13652874cbf97
F20101106_AABCGC weinstock_n_Page_43.jp2
c03b26eb36f7965cd723a28635597f9d
372c80ef2f548974317cdb3975d809bc1cf6f309
F20101106_AABCBF weinstock_n_Page_36.tif
24350a4e1b59e2ff953343bc9910e435
00a2d5b199a49cd1d700ea2e2e271e120a39f4d6
899108 F20101106_AABCGD weinstock_n_Page_44.jp2
3555cd67d9245cb505b8b7859a3125c9
d5044ba950d93d209cfcd85d39c4ac11feb03926
1001 F20101106_AABCBG weinstock_n_Page_25.txt
357548f3533df20034b8dcdc3c866a43
cda6bc63f74de8a2cacce5692f1c7da175c6dc25
8659 F20101106_AABCLA weinstock_n_Page_07.QC.jpg
54ebfc9ae1372e7ed83d7ead991cf936
8e4444a54587a1498f3a358c49f195b89ee7c866
201644 F20101106_AABCGE weinstock_n_Page_45.jp2
6b32b5374095a574c5aff20a452109a0
b6d612d326d105862b310c69f5f6bfedc1f2523c
2086 F20101106_AABCBH weinstock_n_Page_04thm.jpg
fa53cdb44fa7aa991964db3268c160cb
040c9f485c183a0115341d37307fb2e720a3426b
2597 F20101106_AABCLB weinstock_n_Page_07thm.jpg
f21722d6c3a9e315e4b2d0e7421eb573
68850e1780bc77b4dabb0a39970fa1a1f648987f
F20101106_AABCGF weinstock_n_Page_01.tif
95ec6f43fb2abc0d3ba66d44b94d3271
33d1adcc08afc1a32138ffd46a4fb969673dc58d
337 F20101106_AABCBI weinstock_n_Page_06.txt
8cf30c3e4f6f87f43de03e810cdecfd8
37f2059f488afe3c5d26bc1200e6eaeec94a15d1
23543 F20101106_AABCLC weinstock_n_Page_08.QC.jpg
e2d863dccee1e70b5cec0f61ac5061b4
3dd86d486ed72ca4221760c73347bbb5667cf1ba







EFFECTS OF SOCIAL DEFEAT STRESS ON CONNEXIN36 GENE EXPRESSION IN THE
AMYGDALA





















By

NATHAN WEINSTOCK


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2008


































2008 Nathan Weinstock



































To my Mom, Dad, and Sister.









ACKNOWLEDGMENTS

I would like to thank my committee members Dr. Mohamed Kabbaj, Dr. Neil Rowland,

and Dr. Sue Semple-Rowland. I would especially like to thank my advisor, Dr. Darragh Devine,

for his guidance, patience and support.









TABLE OF CONTENTS

page

A CK N O W LED G M EN T S ................................................................. ........... ............. .....

LIST OF TABLES ......... ..... .... ....................................................6

LIST OF FIGURES .................................. .. ..... ..... ................. .7

A B S T R A C T ......... ....................... .................. .......................... ................ .. 8

CHAPTER

1 INTRODUCTION ............... .............................. ............................ 10

2 M E T H O D S ...................................... ...................................................... 16

A nim als ....... ...............................................................16
D rugs..... ............................................................... 16
Surgical P procedures ................................................................17
E xperim mental P procedures .......................................................................... .........................17
Social D om finance Training ..................................... ....................... ............... 17
Social Defeat Stress Experim ent .................................. .....................................18
B behavioral A ssay s ............................................................................ 19
G ene A ssay s.......... .............................. ................................................ 19
Statistical A naly ses ...................................... ................................................. 23

3 R E S U L T S ...........................................................................................2 5

Social D defeat E xperim ent ............................................................................. ... .......... 25
G en e A ssay s.............................................................................2 8

4 D ISC U S SIO N ............................................................................... 33

APPEND IX RAW ACT V ALUES ............................................................................ ........ 38

L IST O F R E F E R E N C E S ..................................................................................... ....................39

B IO G R A PH IC A L SK E T C H .............................................................................. .....................45









LIST OF TABLES


Table page

2-1 Schedule of social defeat stress exposure by group ........................ ... ...................24

2-2 Forward and reverse primer sequences for connexin36 and GAPDH ..............................24









LIST OF FIGURES


Figure page

3-1 Social defeats per daily experimental session........................................... .................. 26

3-2 Effects of social defeat stress exposure on glandular masses..................... ..............27

3-3 Localization of amygdala micropunches. ........................................ ....... ............... 29

3-4 The RNA-denaturing formaldehyde-agarose gel.................... ....... ............... 30

3-5 A ssessm ent of prim er specificity ................. .. ..............................................................31

3-6 Social defeat stress increases expression of Cx36 mRNA in the amygdala....................32









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

EFFECTS OF SOCIAL DEFEAT STRESS ON CONNEXIN36 GENE EXPRESSION IN THE
AMYGDALA

By

Nathan Weinstock

May 2008

Chair: Darragh P. Devine
Major: Psychology

Major depression is a debilitating emotional disorder, affecting millions of Americans

annually. It is characterized by the loss of interest or pleasure in nearly all activities for a period

of at least two weeks. A preponderance of individuals with major depression report a

considerable amount of emotional stress in their lives in the form of significant daily hassles and

aversive major life events. These individuals also suffer from a variety of co-morbid disorders

including Post-Traumatic Stress Disorder, anxiety disorders and eating disorders. Our current

understanding of the etiology of major depression underscores the significance of emotional

stress in conferring vulnerability to developing this devastating disorder. These emotional

stressors are processed by limbic circuits that are capable of undergoing plastic alterations in a

variety of mechanisms that determine the strength of neuronal signaling. One potential

mechanism is altered gene expression of the protein sub-units of gap junctions, known as

connexins. Connexin gene expression is altered by withdrawal from chronic cocaine or

amphetamine self-administration. Furthermore, rats treated with a gap junction antagonist, and

connexin knockout mice, both exhibit impairments in standard tests of learning and memory. In

the present study, we investigated changes in connexin gene expression as a potential mechanism

contributing to limbic plasticity during social defeat stress.









For social defeat stress exposure, "intruder" male rats were each subjected to a larger

dominant "resident" male rat until the intruder was defeated. This interaction proceeded for 5

min or until the intruder displayed the defeated, submissive posture three times. The intruder

was then placed into a double-layered wire mesh cage and returned, in the protective cage, into

the resident's home cage. This interaction proceeded until 10 min had elapsed from the start of

the social defeat session. The experimental rats were exposed to only one social defeat session

(acute) or to six sessions (repeated) with a different resident for each session. Control rats were

not exposed to social defeat stress. All the rats were terminated 2 hours after their final social

defeat session or at an equivalent time for the unstressed controls. The brains were then

dissected out and flash frozen. Punches were collected from the amygdala, homogenized, and

processed by RT-PCR to assay the expression of connexin36 (Cx36) mRNA.

Overall, the repeatedly stressed rats but not the acutely stressed rats exhibited an

upregulation of Cx36 mRNA expression in the amygdala. This experiment provides evidence

that amygdaloid Cx36 expression is implicated in the brain-altering effects of repeated emotional

stress. However, further characterization will be needed to examine the impact of this altered

gene regulation on protein expression and function, and to identify the potential impact of

alterations of connexins in determining the affective state of the animal.









CHAPTER 1
INTRODUCTION

Major depression is a pervasive and debilitating emotional disorder, affecting 14 million

American adults annually (Kessler et al., 2003b). The fourth edition of the Diagnostic and

Statistical Manual of Mental Disorders (DSM-IV, 1994) defines major depression by the

presence of a depressed mood or loss of interest or pleasure in nearly all activities for a period of

at least two weeks. These mood alterations often occur in conjunction with severe changes in

appetite accompanied by weight disturbances, sleep abnormalities, fatigue, feelings of

worthlessness, and a diminished ability to think or concentrate. In order to be diagnosed with

major depressive disorder, the DSM-IV specifies that the patient must present with symptoms

that generate a significant amount of distress or impairment in all aspects of daily life (DSM-IV,

1994). A preponderance of these individuals with major depression also report a considerable

amount of emotional stress in their lives in the form of significant daily hassles and aversive

major life events (Cummins, 1990). These set-backs often result in considerable difficulty

functioning socially, occupationally, or in other important areas (DSM-IV, 1994). Individuals

with major depression also suffer from a variety of co-morbid disorders such as Post-Traumatic

Stress Disorder (PTSD), anxiety disorders, eating disorders, and phobias (Aina et al., 2006;

Vieweg et al., 2006; Woodside et al., 2006; Kessler et al., 2003a). Drugs that increase the levels

of serotonin and norepinephrine in the synapse can be effective for the treatment of major

depression (for review, see Nemeroff, 2007), indicating that these systems may be altered in

individuals with this disorder (for review, see Ressler and Nemeroff, 2000). From an economic

standpoint the impact of major depression is also staggering. The loss of labor attributable to

depression costs an estimated 44 billion dollars annually (Greenberg, 2005).









Since emotional stress is an important trigger for the etiology of affective disorders

(Kendler et al., 1995; for review see, Hayley et al., 2005), it is important to understand the

biochemical changes that occur during stress exposure, as these changes may play important

roles in the etiology of major depression and other related psychopathologies. Stress is defined

as the physiological reaction caused by an aversive or threatening situation (Herman and

Cullinan, 1997). One way the body responds to acute stress exposure is by increasing the

activity of the sympathetic nervous system, which is essential for the mobilization of systems

required for energy -intensive behaviors (for review, see Smith and Vale, 2006). Once the

perceived stressor has subsided, activity of the parasympathetic nervous system is increased to

help restore homeostatic balance (for review, see McEwen, 2006). Another physiological

response to stress is increased activity of the Hypothalamic Pituitary Adrenal (HPA) axis

(Herman and Cullinan, 1997) in response to inputs from the brainstem, cortex, and limbic

system. These inputs converge on the dorso-medial parvocellular neurons, within the

paraventricular nucleus of the hypothalamus (PVN), stimulating the release of corticotropin

releasing hormone (CRH). Under basal conditions a small portion of these CRH-containing

neurons express arginine vasopressin (AVP) mRNA. After repeated stress, the number of AVP-

expressing neurons is elevated so that the co-localization of CRH and AVP mRNAs increases as

much as 5-fold (Albeck et al., 1997; Amaya et al., 2000; Aubry et al., 1999; Bartanusz et al.,

1993; de Goeij et al., 1992). CRH and AVP are then co-released by the parvocellular neurons

into the hypophyseal portal system, at the median eminence, where they activate the anterior

pituitary gland (for review, see Whitnall, 1993; Herman et al., 2002). At the anterior pituitary

CRH stimulates the release of adrenocorticotropic hormone (ACTH) into the bloodstream, while

AVP serves to enhance the CRH function in a synergistic manner (Gillies et al., 1982). ACTH









then acts by stimulating the adrenal cortex to synthesize and release glucocorticoids. One

glucocorticoid (cortisol in humans and corticosterone in rats) is involved in the regulation of a

variety of bodily processes including energy allocation, digestion, and immune function.

Cortisol also activates the negative feedback regulation of the HPA axis that attenuates the

system after stimulation by stress (for review, see Whitnall, 1993).

The stressors that activate the HPA axis can be defined as systemic and processive.

Systemic stressors are those that pose an immediate physiological threat to tissue and organ

systems. Common systemic stressors are exposure to extreme temperatures and food or fluid

deprivation. Information regarding systemic stressors is relayed directly to the PVN of the

hypothalamus via brainstem catecholaminergic projections. Lesion studies have shown that

responses to this type of stressor are not affected by an insult to the limbic system. Processive

stressors are stimuli that are generally not an immediate threat to homeostasis but they require

interpretation by higher brain structures and are perceived as stressful based on comparisons to

previous experiences. Common examples of processive stressors are social instability and the

perceived loss of control over one's environment. Processive stressors are distinguished from

systemic stressors because they process signals from multiple sensory modalities. Information

regarding processive stressors is relayed indirectly to the PVN of the hypothalamus through

cortical and limbic structures such as the prefrontal cortex, amygdala, and bed nucleus of stria

terminalis. Lesion studies have shown that HPA responses to this type of stressor are affected by

an insult to the limbic system (Herman and Cullinan, 1997).

Chronic changes in HPA axis functioning are often found in individuals with major

depression and related disorders. Individuals diagnosed with major depression show increased

levels of CRH mRNA in the PVN (Arborelius et al., 1999) as well as increased levels of CRH in









the cerebrospinal fluid (Arborelius et al., 1999; Nemeroff et al., 1984). The majority of these

individuals also display elevated daily cortisol levels (Gold et al., 1986; Arborelius et al., 1999),

indicating that HPA axis activity has increased. Furthermore, individuals diagnosed with major

depression that are responsive to anti-depressant treatment frequently exhibit a return to baseline

HPA axis functioning (Gold et al., 1986; Amsterdam et al., 1988; Nemeroff et al., 1991). It has

been hypothesized that early-life stress coupled with chronic emotional stress may provide the

appropriate neuroplastic foundation for the development of HPA axis dysregulation and the

manifestation of major depression (for review, see Mello et al., 2003). Furthermore, HPA axis

dysregulation and concomitant depressive-like behaviors are seen in non-human primates who

have a history of early-life stress (Arborelius et al., 1999).

The limbic system appears to be dysregulated as a result of stress and limbic dysfunction is

thought to lead to dysregulation of the HPA axis. However, the mechanism by which emotional

stress alters specific limbic nuclei resulting in the dysregulation of this axis is unknown. One

way to examine this phenomenon is to expose rats to processive stressors. In the present study

we utilized a processive stress regimen known as social defeat stress. In the social defeat stress

procedure a young naive male rat is exposed to a larger dominant male rat until the naive male is

defeated. Social interactions such as these result in the activation of limbic structures in rats as

evidenced by increases in expression of the immediate early gene, c-fos, in the hypothalamus,

septum, and amygdala (Martinez et al., 1998; Nikulina et al., 2004; Chung et al., 1999). Social

defeat stress also activates the HPA axis of the defeated, male rats as indicated by increases in

the levels of circulating ACTH (Ebner et al., 2005) and CORT (Wommack and Delville, 2003;

Covington and Miczek, 2001) following exposure. The impact on limbic functioning coupled









with the observable changes in endocrine measures suggests that the limbic system may undergo

plastic changes as a result of exposure to repeated social defeat stress.

We are using the social defeat model to study alterations in gap junction gene expression

as a candidate mechanism for this limbic plasticity. Initially, gap junctions were known to exist

only among invertebrates and were thought to offer a mechanism of information signaling

between neurons that was primitive and much simpler than the complex chemical synapses (for

example, see Hand and Gobel, 1972; for review, see S6hl et al., 2005). Now, gap junctions have

been reported to be both present and of functional significance, throughout the mammalian brain,

in both neurons and glia (for review, see Nagy et al., 2004). Gap junctions form hydrophilic

channels that directly couple adjacent cells and allow the passage of ions, nutrients, small

intracellular metabolites, and small cell-signaling molecules, less than 1 kDa in size (for review,

see S6hl et al., 2005). Each gap junction is formed by apposing cells creating a narrow 2-3 nm

gap (Kumar and Gilula, 1996). They are composed of two-hemichannels, one pre-synaptic and

one-postsynaptic, each called a connexon. Each connexon is made up of six homomeric or

heteromeric subunits called connexins (Cx) (for review, see Hormuzdi et al., 2004). There have

been 20 distinct connexins identified in the mouse and 21 in the human genome (for review, see

Sohl and Willecke, 2003). The number of connexins in the rat is expected to be similar to that of

the mouse, although they have not been as completely catalogued. The members of this

multigene family are distinguished by their molecular mass (e.g. Cx32, Cx36, where the

molecular mass is indicated in kDa) (for review, see S6hl and Willecke, 2003). Each connexin

consists of two extracellular domains, four hydrophobic membrane-spanning domains, and three

cytoplasmic domains, as well as an intracellular loop, and amino and carboxy termini (for

review, see Wei et al., 2004). The regulation of gap junction channels is dynamic and can occur









in response to various stimuli including changes in voltage, extracellular calcium concentration,

pH, and protein phosphorylation (Harris 2001). For example, when cytoplasmic Ca2+

concentration is low the gap junction channel opens, and conversely, if cytoplasmic Ca2+

concentration is high (in the micromolar range) the gap junction channel closes (for review, see

Wei et al., 2004). Connexin gene mutations have been implicated in a variety of human diseases

including cardiovascular disorders, deafness, skin disorders, cataracts, and peripheral

neuropathies (for review, see Wei et al., 2004). The behavioral consequences of functioning gap

junctions have been studied in relation to learning and memory. The gap junction antagonist

carbenoxolone blocked learning and memory in the Morris Water Maze (Hosseinzadeh et al.,

2005) and Cx36 knockout mice were impaired in the Y-maze as well as on an object recognition

task (Frisch et al., 2005), suggesting that these channels may contribute to plasticity.

However, the role of gap junctions has not been studied in stress-induced limbic plasticity.

Therefore, we are examining the potential that altered connexin gene expression is implicated in

social defeat stress-induced changes in limbic functioning.









CHAPTER 2
METHODS

Animals

Sixteen male Long Evans (LE) rats (Harlan, Indianapolis, IN) weighing 225-250 g were

housed in a climate-controlled vivarium with a 12-hour light/dark schedule (lights on at 7 a.m.

daily). These rats were used as "intruders" (see Experimental Procedures). The rats were

allowed ad libitum access to standard laboratory chow (Lab Diet 5001) and tap water. Upon

arrival the rats were pair-housed in standard polycarbonate cages (43 x 21.5 x 25.5 cm) and

allowed to acclimate to the housing facility for 7 days before any experimental or surgical

procedures were initiated. An additional eleven male LE rats weighing 300-325 g and an

additional eleven female LE rats weighing 200-225 g were pair-housed with gender-matched

conspecifics for 7 days. These rats were later used as "residents" (see Experimental Procedures).

Four more male LE rats weighing 250-275 g were pair-housed and used as intruders to train the

resident males to exhibit dominant behavior (see Experimental Procedures). All the animal care

procedures were pre-approved by the University of Florida Institutional Animal Care and Use

Committee and were performed in accordance with the National Research Council's Guide for

the Care and Use of Laboratory Animals.

Drugs

The anesthetics ketamine, xylazine, and Aerrane (99% isoflurane) were purchased from

Henry Schein Inc. (Melville, NY). The ketamine and xylazine were combined to yield a solution

containing 83.3% ketamine : 16.7% xylazine (w/v). The analgesic Ketorolac tromethamine (30

mg/ml), a non-steroidal anti-inflammatory drug, was also obtained from Henry Schein Inc.









Surgical Procedures

The resident rats (325-355 g at the time of surgery) were vasectomized under ketamine-

xylazine anesthesia (62.5 mg/kg ketamine + 12.5 mg/kg xylazine, i.p. in a volume of 0.75

ml/kg). If supplementary anesthesia was necessary during surgery, a gauze pad was soaked with

AErrane and placed in a nose cone approximately 23 mm away from the rat's snout. Ketorolac

tromethamine (2 mg/kg s.c.), was administered for analgesia at the time of surgery.

Each anesthetized rat was shaved from the rostral edge of the scrotal area to the caudal

abdomen. Following sterilization of the surgical area a 1 cm incision was made near the midline

of the abdomen, which terminated caudally near the base of the penis. The vas deferens was

then isolated with forceps, and a 0.5 cm section was removed from each duct with the aid of a

miniature cautery utensil. The internal incision was sutured with absorbable 4-0 "Ethilon"

monofilament vicryl suture (Ethicon Inc.) and the external incision was closed with 9 mm

stainless steel wound clips (World Precision Instruments Inc.) which were then removed 7 days

subsequent to surgery. Each surgical procedure lasted 15-25 min.

Experimental Procedures

Social Dominance Training

Prior to the onset of the social defeat sessions the vasectomized resident male rats were

pair-housed with the female rats for two weeks. During this time the male residents were trained

and screened for characteristic territorial dominance behavior. At the beginning of each training

session each female resident was removed from the home cage and placed in a similar cage

nearby. Ten min after removal of the female an intruder was placed into the resident's home

cage. Each male resident was trained to exhibit characteristic dominance behavior. The

residents and intruders were allowed to interact for 5 min or until the intruder displayed a

submissive posture three times. This constituted the direct interaction phase. An intruder was









considered to be defeated when it displayed a submissive posture by lying motionless in the

supine position, with the resident on top of it, for a period of at least two sec. Precautions were

taken to ensure the safety of the intruder rats. If a resident bit the intruder, the intruder was

promptly removed and the direct interaction phase of that session was immediately terminated.

The residents that consistently defeated the intruders at least 2 times in each of the seven training

sessions were used for the experiment. From the initial eleven male residents used in the

screening procedure six were retained for use in the social defeat experiment.

Social Defeat Stress Experiment

Sixteen naive male Long Evans rats were utilized as intruders for the social defeat stress

experiment. The procedure consisted of two phases of resident-intruder interaction. The first,

the direct interaction phase, was conducted in exactly the same manner as the training sessions,

with each intruder exposed to a different resident during every social defeat session. Following

the conclusion of every direct interaction phase each intruder was removed from the home cage

of the resident, placed into a separate 10cm x 10cm x 15cm (inner dimensions) double-layered

wire mesh cage and returned, in this protective cage, into the home cage of the resident. Once

the intruder was returned to the resident's cage the second phase of the procedure, the indirect

interaction phase, was initiated. In the indirect interaction phase the intruder remained in the

stressful environment without the possibility of direct contact by the resident. The intruder was

maintained in the wire mesh cage until 10 min had elapsed from the start of the direct interaction

phase. After the entire 10 minute interaction (i.e. total of direct and indirect phases) had

concluded both the female resident and the male intruder were returned to their respective home

cages.

The social defeat stress procedure consisted of three experimental groups (Table 1). The

rats in Group 1 were unhandled, unstressed controls and were not exposed to the social defeat









stress procedure. The rats in Group 2 were unhandled for five days and were then exposed to

social defeat stress only once, on day 6 of the experiment. The rats in Group 3 were exposed to

the social defeat procedure once daily for 6 consecutive days. On day 6 of the experiment all the

intruder rats were rapidly decapitated 2 hours after the start of their social defeat stress session

(or at an equivalent time for the unstressed control group). Immediately upon termination of the

intruders, the brains were dissected and rapidly frozen in 2-methylbutane at -400 C and stored at -

80 C. At the same time, the adrenal and thymus glands were dissected out and stored at -80o C.

The glands were then weighed at a later date in order to verify the health and stress condition of

each intruder.

Behavioral Assays

Video cameras were placed in the behavioral testing room where the social defeat stress

experiment occurred. Each social defeat session was recorded and the number of defeats per

session was scored for each intruder.

Gene Assays

Each brain was removed from the -800 C freezer and incubated in 2-methylbutane at -200

C for 10 min. After the 10 min had elapsed the brain was placed into a stainless steel rat brain

matrix, with slots spaced at 1.0 mm distances in the coronal plane (Braintree Scientific, MA),

which had been stored at -200 C. All dissections were conducted under RNase-free conditions.

A standard single-edge razor blade was inserted into the most rostral slot within the matrix.

Then, the brain and the matrix were placed in a cooler lined with dry ice for 30 sec. Once the

brain and matrix were removed from the cooler two blades were inserted into the two most

caudal slots, and then the brain within the matrix was placed back into the cooler for 30 sec.

These blades anchored the brain in the matrix. Then, individual blades were placed into the

successive slots in the matrix from the rostral to caudal direction. After each blade was inserted









into the matrix, the brain and matrix were placed in the cooler for 30 sec. This procedure was

repeated until the brain was completely sectioned through the amygdala in the coronal plane.

Then, the first blade was removed with the 1 mm coronal section freeze-mounted to it. The

blade and section were placed on the dry ice, and then the brain and matrix were returned to the

dry ice for 30 sec. This procedure was repeated until all of the slices through the amygdala had

been obtained. The sections that were within the rostral-caudal extent of the amygdala (between

1.80 and 2.80 mm posterior to bregma, according to the atlas of Paxinos and Watson, 1998) were

kept on the dry ice and three bilateral micropunches (1mm in diameter) were taken using a Harris

Uni-Core (Ted Pella, CA). The micropunches from each rat were placed into individual 0.5 ml

microcentrifuge tubes, on dry ice. The micropunches from each rat were then homogenized for 5

sec in 40 .il TRI Reagent (Molecular Research Center, OH) using a Sonic Dismembrator Model

150 (Fisher Scientific, GA) set at 40. The homogenates were incubated at room temperature for

5 min and stored at -80o C (for 1-2 weeks) until the total RNA was isolated.

The homogenates were then thawed at room temperature, supplemented with 5.4 pl 1-

Bromo-3-Chloropropane (BCP) and shaken by hand vigorously for 15 sec. The resulting

mixture was then stored at room temperature for 3 min and centrifuged at 12,000 g for 15 min at

4 C. Following centrifugation, the colorless upper aqueous phase was extracted and transferred

to a fresh 0.2 ml microcentrifuge tube. The total RNA was precipitated from the aqueous phase

by adding 26.6 pl of isopropanol to the mixture. The samples were then incubated at room

temperature for 7 min and centrifuged at 12,000 g for 8 min at 40 C. The supernatant was

removed and discarded by aspiration. The RNA pellet was then washed by adding 53.4 pl of

75% ethanol, mixed by vortexing and centrifuged at 12,000 g for 15 min at 40 C. The ethanol

wash was removed by aspiration. The RNA pellet was then partially air-dried for 10 min at









room temperature and was dissolved in 10 pl diethyl pyrocarbonate (DEPC) treated water by

gently passing the solution through a pipette tip approximately 4 or 5 times. The isolated total

RNA was then incubated in a water bath for 15 min at 55 600 C.

To eliminate the possibility of contamination by genomic DNA, equal aliquots of total

RNA were treated with DNase 1 using the TURBO DNA-free kit (Ambion, TX). TURBO

DNase Buffer (.1 pl @ 10X) and TURBO DNase (1 pl) were added to the total RNA samples.

The resulting mixture was then incubated at 370 C for 30 min. Following incubation, 2 pl of

DNase Inactivation Reagent was added to each tube then intermittently vortexed at room

temperature for 2 min. The resulting mixture was centrifuged at 10,000 g for 1.5 min at room

temperature then the supernatant was transferred to a fresh tube. The concentration of total RNA

in each sample was determined by measuring absorbance of 1.5 pl of the sample at 260 nm

(OD260) in a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, DE). The purity

of each sample was determined by calculating the ratio of absorbance at 260 and 280 nm

(OD260/OD280). In order to confirm the integrity of the isolated RNA an additional 2 pl of

total RNA was loaded onto an RNA-denaturing formaldehyde-agarose gel and visualized by

staining with ethidium bromide.

The cDNA was synthesized from each total RNA sample with random hexamers and

oligo(dT)20 using the Superscript III Platinum Two-Step qRT-PCR kit (Invitrogen, CA). RT

Reaction Mix (10 pl @ 2X), RT Enzyme Mix (2 pl), and equal amounts of the total RNA

samples (1.0 pg in 1.6 3.5 pl) were combined, and then thoroughly mixed. DEPC-treated

water was added to each sample (4.5 6.3 pl) resulting in a final volume of 20 pl of the cDNA

synthesis reaction. Then, each cDNA synthesis reaction was incubated at 250 C for 10 min,

followed by 420 C for 50 min. Each reaction was terminated by incubating the mixture at 850 C









for 5 min, and then chilling on ice. E. coli RNase H (1 I l) was added to each reaction and then

the resulting mixture was incubated at 370 C for 20 min. Each cDNA synthesis reaction was

then stored at -200 C until the time of use.

Forward and reverse primer sequences were generated by inputting the GenBank

sequences for Cx36 and GAPDH (NM_019281 and NM_017008, respectively) into the

OligoPerfect Designer (Invitrogen, CA). The three primer sets that were ranked most highly for

Cx36 and for GAPDH by the OligoPerfect program were purchased, and an initial RT-PCR

screening was performed. The specificity of each primer was determined by the number of

peaks in the dissociation curve generated at the conclusion of the RT-PCR reaction. Primer sets

that produced only one peak (and therefore yielded only one amplicon) were used in this

experiment (Table 2). A dilution curve was also performed in order to ensure that a sufficient

amount of the cDNA and primers were included in each reaction. Once the appropriate

parameters were established each well was loaded with 12.5 .il Power SYBR Green PCR Master

Mix (Applied Biosystems, CA), 6.5 pl DEPC treated water, 4 pl cDNA, and 2 pl of the Cx36 or

GAPDH primers to obtain a final volume of 25 [il. The 96-well plate was then placed into the

ABI 7900HT thermal cycler (Applied Biosystems, CA). The thermal cycling was performed

with an initial denaturation at 950 C for 5 min. This was followed by 40 cycles each consisting

of 15 sec of denaturation at 950 C, 30 sec of primer annealing at 600 C, and 30 sec of template

extension at 720 C. Upon completion of all 40 cycles a dissociation curve was generated in order

to confirm the specificity of both targeted amplifications. For the dissociation curve a final

denaturing step was performed for 1 min at 950 C followed by an additional min at 550 C then,

every 10 sec the set-point temperature of the thermal cycler was increased by 0.4 C for 100

repetitions in order to determine the range of amplicon melting temperatures.









Statistical Analyses

Potential between-groups differences in the total number of defeats was analyzed using

an independent samples t-test to compare the two groups of intruders (i.e. the acutely stressed

group and the repeatedly stressed group) during their initial exposure to social defeat stress. A

one-way repeated-measures analysis of variance (ANOVA) was used to examine any potential

differences in number of defeats across experimental sessions for the repeatedly stressed group.

Potential between groups differences in adrenal and thymus gland weights were analyzed

by a one-way ANOVA.

An analysis of fold-change for both the acutely stressed and repeatedly stressed groups

was calculated by normalizing the Cx36 gene expression to the expression of the control gene

(GAPDH) using the Comparative Crossing Threshold (CT) method (Livak, 2001). In order to

ascertain whether the calculated fold-change significantly differed from 1.0, a one-way ANOVA

was performed.

Five of the 16 intruder rats were excluded from all the data analysis. Two of the rats

were excluded because they were not defeated (one rat in the acute group was not defeated, and

one rat in the repeated group was only defeated 4 times during the 6 sessions, and was not

defeated at all during the final session). The RNA extraction from 2 rats (1 control and one

repeated defeat) failed due to a procedural error. The RT-PCR for 1 rat in the acute defeat group

failed due to a procedural error (see Fig. 5).









Table 2-1. Schedule of social defeat stress exposure by group
Repeated Stress Acute Stress Kill Time
Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 2 Hours
Group 1 X X X X X X X
Group 2 X X
Group 3 X


Table 2-2. Forward and reverse primer sequences for connexin36 and GAPDH
Gene Forward primer Reverse primer
Connexin36 TAGCATGCCAGCTTTTCTTT GGCTCTACTGCAAACCTCTG
GAPDH TGTATCCGTTGTGGATCTGA GACAACCTGGTCCTCAGTGT









CHAPTER 3
RESULTS

Social Defeat Experiment

There were no significant between-groups differences in the number of defeats during the

first exposure to social defeat stress when the acutely and repeatedly stressed groups were

compared (t (6) = 1.567, p = 0.1682; Figure 3-1). The rats in the repeated stress condition

showed no significant between-groups differences in the number of defeats (F (3, 5) = 1.343, p =

0.2997; Figure 3-1) across all six experimental sessions.

There were no significant between-groups differences in thymus masses following

exposure to social defeat stress for any of the experimental conditions (F (2, 8) = 0.3129, p =

0.7398; Figure 3-2A). Similarly, the adrenal gland masses did not differ significantly (F (2, 8)

1.321, p = 0.3193; Figure 3-2B) between the rats in any of the experimental conditions.












-A- Repeated Stress
3 3.0- Acute Stress

4- 1.5-
2.0-


E 1.0-
Z 0.5-
0.0 I I I
0 1 2 3 4 5 6
Defeat Session

Figure 3-1. Social defeats per daily experimental session. The rats that were exposed to only
one social defeat session (acute stress group) experienced a similar number of defeats
(defeat session 6) as the rats in the repeated stress condition on their first exposure to
social defeat (defeat session 1). Those rats in the repeated stress group were exposed
to an equivalent number of social defeats across all 6 experimental sessions. Results
are expressed as group means + the standard error of the mean (SEM) (n = 4 rats per
group).











- 150-
o
o
-


E 100-



0)
50-

,

1- 0-


SUo
0
S15-
E
4-1
0)10-


" 5-

0-
< a L


L_


Control
Control


CIr
Control


F


Acute


Repeated


Acute Repeated


Figure 3-2. Effects of social defeat stress exposure on glandular masses. A) Thymus gland
masses, B) Adrenal gland masses showed no significant between-groups differences,
regardless of experimental condition. Results are expressed as group means + the
SEM (n = 3 rats per group for controls; n = 4 rats per group for both acute and
repeated stress groups).









Gene Assays

Representative sections demonstrating the locations from which micropunches were

extracted are shown in Figure 3-3. Representative RNA-denaturing formaldehyde-agarose gel,

indicating the integrity of the RNA as evidenced by the visible 18S and 28S bands (Figure 3-4).

When the semi-quantitative RT-PCR was run the dissociation curve generated at the

conclusion of the reaction contained only one peak for each of the primer sets for both Cx36 and

GAPDH (Figure 3-5). A significantly greater Cx36 mRNA expression was evident in the

amygdala of rats following exposure to repeated social defeat stress (F (2, 8) = 10.27, p < 0.01;

Figure 3-6).











S ; :=v---.---_---.- -\



.-... .. .
1/ 1' 1 i


K










Figure 3-3. Localization of amygdala micropunches. Rodent brain atlas figures depicting the
target sites for the three bilateral micropunches of the amygdala (Top).
Representative rodent brain slices showing the actual amygdala micropunches
(Bottom).






















Figure 3-4. The RNA-denaturing formaldehyde-agarose gel. Representative gel of RNA
isolated from six different limbic brain regions. The sharp 18S and 28S ribosomal
RNA bands indicate the presence of intact RNA.














3.900 E-1


3.400 E-1


2.900 E-1


2.400 E-1


1.900 E-1


1.400 E1


9.000 E2


4.000 E-2


-1.000 E-2 .........



60.0 65.0 70.0 75.0 80.0 85.0 90.0 95.0
60.0
Temperature (C)



Figure 3-5. Assessment of primer specificity. Dissociation curve of primers for Cx36 (blue) and
GAPDH (purple). The curve contains one peak for each primer, at the melting
temperature of each amplicon, indicating that the amplified RNA products are
specific and that the SYBR Green fluorescent signal directly measured the
exponential increase of Cx36 and GAPDH.











Cx36 Amygdala


4-






L -
1. -


Acute


*


Repeated


Figure 3-6. Social defeat stress increases expression of Cx36 mRNA in the amygdala. Cx36
mRNA was not significantly changed in the acutely stressed group compared to that
of the control group. Cx36 mRNA was significantly increased in the repeatedly
stressed group compared to that of the control group. Results are expressed as group
means + the SEM relative to the controls (dotted line) (n = 3 rats per group for
controls; n = 4 rats per group for both acute and repeated stress conditions).
*Significant at p < 0.05.


0o--









CHAPTER 4
DISCUSSION

The results of the current study demonstrate that repeated social defeat stress induces

limbic plasticity in the form of an elevation in Cx36 mRNA within the amygdala. The impact

that this change in Cx36 gene expression has on neuronal communication in the limbic system is

currently unknown. However, this effect of repeated social defeat raises the possibility that

alterations in connexin gene expression may play an important role in stress-induced changes in

limbic processing of emotional stimuli. This possibility is in line with previous reports that

amygdaloid neuroplasticity plays an important role in the effects of stress (Sigurdsson et al.,

2007), and that connexin gene expression is increased during withdrawal from psychostimulant

self-administration (Bennett et al., 1999; McCracken et al., 2005a; McCracken et al., 2005b).

Classical learning and memory mechanisms have been shown to underlie alterations in the

processing of emotionally salient stimuli within the amygdala. Amygdaloid evoked responses to

medial geniculate stimulation are increased after high-frequency stimulation of the geniculate

(Rogan and LeDoux, 1995). This effect is blocked by NMDA receptor antagonists, indicating a

role for changes in glutamate signaling (Li et al., 1995). Similar changes in amygdaloid

responsiveness are observed after associative fear conditioning to a tone, indicating that

amygdaloid processing of auditory inputs from the amygdala are enhanced by the pairing of the

auditory cue with the aversive stimulus (Rogan et al., 1997). Plasticity in amygdaloid processing

of geniculate inputs resembles glutamate-mediated alterations in hippocampal processing of

information and hippocampal plasticity is thought to model mechanisms of declarative learning

and memory (for review, see Disterhoft and De Jonge, 1987; Kemp and Manahan-Vaughan,

2007).









Limbic plasticity was also demonstrated in a study conducted by Simpkiss and Devine

(2003). Following tetanic stimulation of the bed nucleus of stria terminalis (BNST), a crucial

site of limbic convergence (Weller and Smith, 1982; Moga et al., 1989), a decrease in evoked

field potential responses was recorded in the PVN. This effect was potently blocked by the

NMDA receptor antagonist MK-801, indicating the presence of glutamate-mediated plasticity in

this limbic circuit. Plasticity in this system suggests a functional congruity between known

stress circuitry and the mechanisms thought to underlie classical learning and memory.

Limbic plasticity has also been described in rats subjected to a week of isolation housing.

Some rats exhibit increases in anxiety-related behavior after one week exposure to the stress of

social isolation (Kabbaj et al., 2000), providing further evidence that a stressor can produce

changes in limbic function. These converging lines of evidence indicate that limbic structures

are capable of plastic alterations after stimulation or stress exposure, and that these changes may

produce meaningful alterations in the processing of emotionally-salient stimuli. The findings of

the current study reveal an additional mechanism that may contribute to stress-induced

alterations in functional activity of the limbic system.

Although we demonstrated a stress-induced alteration of the limbic system we did not see

an associated change in adrenal or thymus masses. Exposure to repeated stress has been shown

to produce thymus involution and adrenal hypertrophy (Blanchard et al., 1998; Dominguez-

Gerpe and Rey-Mendez, 2001; Hasegawa and Saiki, 2002). Since we did not see a change in

thymus or adrenal gland mass this suggests that the total number of social defeat sessions should

be increased for the repeatedly stressed group in all future stress manipulations. Despite

extensive efforts to assure that the residents were well-trained and experienced, that they

significantly outweighed the intruders, and that they had established territorial dominance









through pair-housing with a female, there were some inconsistencies in the number of defeats

that the residents initiated across days and for individual intruder rats. This could have been

influenced by uncontrolled environmental factors (see Dallman et al., 1999), or by differences in

the interactions between the individual residents and intruders. In any case, the overall impact of

these individual variations is not known. On the other hand, an important variable that could

have contributed to the lack of thymus and adrenal changes is that the intruder rats were pair-

housed between defeat sessions. Ruis and colleagues (1999) found that pair-housing following

resident-intruder interactions resulted in an attenuation of the stress effects due to the formation

of a stable social relationship. Since we did not see the typical stress effects on gland masses and

we know the social defeat stress procedure is susceptible to environmental variables, including

pair-housing, we have begun to formulate a more vigorous stress regimen utilizing naturalistic

stressors, along with social defeat, in an attempt to further explore the effects of emotional stress

on connexin gene expression throughout the limbic system.

In the social defeat sessions, there were no significant differences in the number of defeats

during the first exposure to social defeat stress for both stress groups. Moreover, despite the

apparent fluctuation in the number of defeats across days in the repeatedly stressed group, there

were no statistically significant differences in the daily numbers of defeats. This may be due to

the small number of rats in this experimental group. Despite this apparent variability, the Cx36

mRNA expression was quite consistent and significantly elevated in these rats, suggesting that

the mere presence of the dominant resident serves as a stressor in intruder rats that have a history

of defeat. Thus, it is unclear if the precise number of defeats has any bearing on the emotional

and physiological state of the intruders.









In accordance with the observations of this experiment, stress-induced changes in connexin

gene expression should be further characterized. Cx36 protein expression within the amygdala

must be evaluated since connexin protein expression may not always match its gene expression

(Oguro et al., 2001; McCracken et al., 2005a; McCracken et al., 2005b; Nakata et al., 1996;

Temme et al., 1998; Matesic et al., 1994). Protein levels of the various connexins are considered

to be tightly regulated by both post-transcriptional and post-translational processes. Connexin

protein expression can be altered post-transcriptionally by decreasing protein synthesis (Nakata

et al., 1996) or post-translationally by reducing the rate of degradation (Musil et al., 2000;

VanSlyke and Musil, 2005). Furthermore, the half-life of gap junctions in cultured cells and

tissues has been reported to be less than 2 hours (Crow et al., 1990; Beardslee et al., 1998).

Therefore, the formation and turnover of gap junctions may explain the disparity between the

levels of gene and protein expression.

Additional studies must also be performed to elucidate the physiological and behavioral

roles of the changes in Cx36 gene (and potentially protein) expression. By pharmacologically

challenging connexin proteins through the administration of the gap junction antagonist

carbenoxolone or the specific Cx36 antagonist mefloquine the effects of connexin dysregulation

on limbic-mediated tasks can be assessed. Furthermore, by microinjecting viral vectors

containing the Cx36 gene into the amygdala we may be able to increase Cx36 protein expression

and examine how this impacts fear and startle responses, as well as responses on standard tests of

anxiety-related behaviors and models of major depression. Likewise, we can also examine the

potential effects of increasing Cx36 protein expression on measures of sympathetic activity,

ACTH and corticosterone, under stressed and unstressed conditions. Additionally, by

conducting a time-course study we can investigate the duration of the observed connexin









plasticity. Moreover, by conducting a series of low-density arrays exploring the gene expression

of Cxs26, 32, 43, 45, 47, and 57 we can further advance our understanding of the part other

connexins play in the limbic system's response to stress. From these analyses we should gain

substantial insight into the roles connexins may play in stress-induced plasticity, which should

lead to a greater understanding of the etiology of major depression and its related disorders.









APPENDIX
RAW ACT VALUES

Control
8.0571
9.1612
9.0994

Acute
9.3491
9.5528
8.4545
9.2418

Repeated
8.1420
7.5250
6.5152
6.6185









LIST OF REFERENCES


Aina Y and Susman JL (2006) Understanding comorbidity with depression and anxiety
disorders. JAm O.wvtpthl Assoc 106:S9-14.

Albeck DS, McKittrick CR, Blanchard DC, Blanchard RJ, Nikulina J, McEwen BS, and Sakai
RR (1997) Chronic social stress alters levels of corticotropin-releasing factor and arginine
vasopressin mRNA in rat brain. JNeurosci 17:4895-4903.

Amaya F, Tanaka M, Hayashi S, Tanaka Y, and Ibata Y (2000) Hypothalamo-pituitary-adrenal
axis sensitization after chronic salt loading. Neuroendocrinology 73:185-193.

American Psychiatric Association (1994) Diagnostic and statistical manual of mental disorders,
4th ed. American Psychiatric Association, Washington, DC.

Amsterdam JD, Maislin G, Winokur A, Berwish N, Kling M, and Gold P (1988) The CRH
stimulation test before and after clinical recovery from depression. JAffect Disord 14:213-
222.

Arborelius L, Owens MJ, Plotsky PM, and Nemeroff CB (1999) The role of corticotrophin-
releasing factor in depression and anxiety disorders. JEndocrinol 160:1-12.

Aubry JM, Bartanusz V, Jezova D, Belin D, and Kiss JZ (1999) Single stress induces long-
lasting elevations in vasopressin mRNA levels in CRF hypophysiotrophic neurones, but
repeated stress is required to modify AVP immunoreactivity. JNeuroendocrinol 11:377-
384.

Bartanusz V, Jezova D, Bertini LT, Tilders FJ, Aubry JM, and Kiss JZ (1993) Stress-induced
increase in vasopressin and corticotropin-releasing factor expression in hypophysiotrophic
paraventricular neurons. Endocrinology 132:895-902.

Beardslee MA, Laing JG, Beyer EC, and Saffitz JE (1998) Rapid turnover of connexin43 in the
adult rat heart. Circ Res 83:629-635.

Bennett SA, Arnold JM, Chen J, Stenger J, Paul DL, and Roberts DC (1999) Long-term changes
in connexin32 gap junction protein and mRNA expression following cocaine self-
administration in rats. Eur JNeurosci 11:3329-3338.

Blanchard RJ, Nikulina JN, Sakai RR, McKittrick C, McEwan B, and Blanchard DC (1998)
Behavioral and endocrine change following chronic predatory stress. PhysiolBehav 63:561-
569.

Chung KK, Martinez M, and Herbert J (1999) Central serotonin depletion modulates the
behavioral, endocrine and physiological responses to repeated social stress and subsequent
c-fos expression in the brains of male rats. Neuroscience 92:613-625.









Covington HE and Miczek KA (2001) Repeated social-defeat stress, cocaine or morphine.
Effects on behavioral sensitization and intravenous cocaine self administration "binges."
Psychopharmacology 158:388-398.

Crow DS, Beyer EC, Paul DL, Kobe SS, and Lau AF (1990) Phosphorylation of connexin43 gap
junction protein in uninfected and Rous sarcoma virus-transformed mammalian fibroblasts.
Mol Cell Biol 10:1754-1763.

Cummins R (1990) Social insecurity, anxiety, and stressful events as antecedents of depressive
symptoms. Behav Med 16:161-164.

Dallman MF, Akana AM, and Bhatnagar S (1999) Warning! Nearby construction can profoundly
affect your experiments. Endocrine 2:111-113.

de Goeij D, Jezova D, and Tilders FJ (1992) Repeated stress enhances vasopressin synthesis in
corticotropin releasing factor neurons in the paraventricular nucleus. Brain Res 577:165-
168.

Disterhoft JF and De Jonge M (1987) Associative learning and long-term potentiation: cellular
mechanisms compared. Int JNeurol 21-22:172-183.

Dominguez-Gerpe L and Rey-Mendez M (2001) Alterations induced by chronic stress in
lymphocyte subsets of blood and primary and secondary immune organs of mice. BMC
Immunol 2:7.

Ebner K, Wotjak CT, Landgraf R, and Engelmann M (2005) Neuroendocrine and behavioral
response to social confrontation: residents versus intruders, active versus passive coping
styles. Horm Behav 47:14-21.

Frisch C, De Souza-Silva MA, Sohl G, Gildenagel M, Willecke K, Huston JP, and Dere E
(2005) Stimulus complexity dependent memory impairment and changes in motor
performance after deletion of the neuronal gap junction protein connexin36 in mice. Behav
Brain Res 157:177-185.

Gillies GE, Linton EA, and Lowry PJ (1982) Corticotropin releasing activity of the new CRF is
potentiated several times by vasopressin. Nature 299:355-357.

Gold PW, Loriaux DL, Roy A, Kling MA, Calabrese JR, Kellnor CH, Nieman LK, Post RM,
Dicker D, Gallucci W, et al. (1986) Response to corticotrophin-releasing hormone in the
hypercortisolism of depression and Cushing's disease: pathophysiologic and diagnostic
implications. NEngl JMed 314:1329-1335.

Greenberg PE and Birnbaum HG (2005) The economic burden of depression in the US: societal
and patient perspectives. Expert Opin Pharmacother 6:369-376.









Hand AR and Gobel S (1972) The structural organization of the septate and gap junctions of
Hydra. J Cell Biol 52:307-408.

Harris AL (2001) Emerging issues of connexin channels: biophysics fills the gap. Q Rev Biophys
34:325-472.

Hasegawa H and Saiki I (2002) Psychological stress augments tumor development through P-
adrenergic activation in mice. Jpn J Cancer Res 93:729-735.

Hayley S, Poulter MO, Merali Z, and Anisman H (2005) The pathogenesis of clinical depression:
stressor- and cytokine-induced alterations of neuroplasticity. Neuroscience 135:659-678.

Herman JP and Cullinan WE (1997) Neurocircuitry of stress: central control of the hypothalamo-
pituitary-adrenocortical axis. Trends Neurosci 20:78-84.

Herman JP, Cullinan WE, Ziegler DR, and Tasker JG (2002) Role of the paraventricular nucleus
microenvironment in stress integration. Eur JNeurosci 16:381-385.

Hormuzdi SG, Filippov MK, Mitropoulou G, Monyer H, and Bruzzone R (2004) Electrical
synapses: a dynamic signaling system that shapes the activity of neuronal networks. Biochim
Biophys Acta 1662:113-137.

Hosseinzadeh H, Asl M, Parvardeh S, and Mansouri SM (2005) The effects of carbenoxolone on
spatial learning in the Morris water maze task in rats. Med Sci Monit 11:BR88-94.

Kabbaj M, Devine DP, Savage VR, and Akil H (2000) Neurobiological correlates of individual
differences in novelty-seeking behavior in the rat: differential expression of stress-related
molecules. JNeurosci 20:6983-6988.

Kemp A and Manahan-Vaughan D (2007) Hippocampal long-term depression: master or minion
in declarative memory processes? Trends Neurosci 30:111-118.

Kendler KS, Kessler RC, Walter EE, MacLean C, Neale MC, Heath AC, and Eaves LJ (1995)
Stressful life events, genetic liability, and onset of an episode of major depression in women.
Am JPsychiatry 152:833-842.

Kessler RC (2003a) The impairments caused by social phobia in the general population:
implications for intervention. Acta Psychiatr Scand Supp 417:19-27.

Kessler RC, Berglund P, Demler O, Jin R, Koretz Z, Merikangas KR, Rush AJ, Walters EE, and
Wang PS (2003b) The epidemiology of major depressive disorder: results from the National
Comorbidity Survey Replication (NCS-R). JAMA 289:3095-3105.

Kumar NM and Gilula NB (1996) The gap junction communication channel. Cell 84:381-388.









Li XF, Phillips R, and LeDoux (1995) NMDA and non-NMDA receptors contribute to synaptic
transmission between the medial geniculate body and the lateral nucleus of the amygdala.
Exp Brain Res 105:87-100.

Livak KJ (2001) User Bulletin #2, ABI PRISM 7700 Sequence detection system. PE applied
biosystems. [http://www.docs.appliedbiosystems.com/pebiodocs/04303859.pdf]

Martinez M, Phillips PJ, and Herbert J (1998) Adaptation in patterns of c-fos expression in the
brain associated with exposure to either single or repeated social stress in male rats. Eur J
Neurosci 10:20-33.

Matesic DF, Rupp HL, Bonney WJ, Ruch RJ, and Trosko JE (1994) Changes in gap-junction
permeability, phosphorylation, and number mediated by phorbol ester and non-phorbol-ester
tumor promoters in rat liver epithelial cells. Mol Carcinog 10:226-236.

McCracken CB, Hamby SM, Patel KM, Morgan D, Vrana KE, and Roberts D (2005a) Extended
cocaine self-administration and deprivation produces region-specific and time-dependent
changes in connexin36 expression in rat brain. Synapse 58:141-150.

McCracken CB, Patel KM, Vrana KE, Paul DL, and Roberts D (2005b) Amphetamine produces
region-specific and time-dependent changes in connexin36 expression in rat brain. Synapse
56:39-44.

McEwen BS (2006) Protective and damaging effect of stress mediators: central role of the brain.
Dialogues Clin Neurosci 8:367-381.

Mello AA, Mello MF, Carpenter LL, and Price LH (2003) Update on stress and depression: the
role of the hypothalamic-pituitary-adrenal (HPA) axis. Rev Bras Psiquiatr 25:231-238.

Moga MM, Saper CB, and Gray TS (1989) Bed nucleus of the stria terminalis: cytoarchitecture,
immunohistochemistry, and projection to the parabrachial nucleus in the rat. J Comp Neurol
283:315-332.

Musil LS, Le AC, VanSlyke JK, and Roberts LM (2000) Regulation of connexin degradation as
a mechanism to increase gap junction assembly and function. JBiol Chem 275:25207-
25215.

Nagy JI, Dudek FE, and Rash JE (2004) Update on connexins and gap junctions in neurons and
glia in the mammalian nervous system. Brain Res Rev 47:191-215.

Nakata Y, Iwai M, Kimura S, and Shimazu T (1996) Prolonged decrease in hepatic connexin32
in chronic liver injury induced by carbon tetrachloride in rats. JHepatol 25:529-537.

Nemeroff CB (2007) The burden of severe depression: a review of diagnostic challenges and
treatment alternatives. JPsychiatr Res 41:189-206.









Nemeroff CB, Bissette G, Akil H, and Fink M (1991) Neuropeptide concentrations in the
cerebrospinal fluid of depressed patients treated with electroconvulsive therapy,
corticotrophin-releasing factor, beta-endorphin and somatostatin. Br JPsychiatry 158:59-63.

Nemeroff CB, Widerlov E, Bissette G, Walleus H, Karlsson I, Eklund K, Kilts CD, Loosen PT,
and Vale W (1984) Elevated concentrations of CSF corticotrophin-releasing factor-like
immunoreactivity in depressed patients. Science 226:1342-1344.

Nikulina EM, Covington HE, Ganschow L, Hammer RP, and Miczek KA (2004) Long-term
behavioral and neuronal cross-sensitization to amphetamine induced by repeated brief social
defeat stress: Fos in the ventral tegmental area and amygdala. Neuroscience 123:857-865.

Oguro K, Jover T, Tanaka H, Lin Y, Kojima T, Oguro N, Grooms SY, Bennett MV, and Zukin
RS (2001) Global ischemia-induced increases in the gap junctional proteins connexin32
(Cx32) and Cx36 in hippocampus and enhanced vulnerability of Cx32 knock-out mice. J
Neurosci 21:7534-7542.

Paxinos G and Watson C (1998) The Rat Brain in Stereotaxic Coordinates, 4th Ed. CD-ROM:
Hulasz, P.

Ressler KJ and Nemeroff CB (2000) Role of serotonergic and noradrenergic systems in the
pathophysiology of depression and anxiety disorders. Depress Anxiety 12 (Suppl 1):2-19.

Rogan MT and Ledoux JE (1995) LTP is accompanied by commensurate enhancement of
auditory-evoked responses in a fear conditioning circuit. Neuron 15:127-136.

Rogan MT, Staubli UV, and Ledoux JE (1997) Fear conditioning induces associative long-term
potentiation in the amygdala. Nature 390:604-607.

Ruis MA, te Brake JH, Buwalda B, De Boer SF, Meerlo P, Korte SM, Blokhuis HJ, and
Koolhaas JM (1999) Housing familiar male wildtype rats together reduces the long-term
adverse behavioral and physiological effects of social defeat. Psychoneuroendocrinology
24: 285-300.

Sigurdsson T, Doyere V, Cain CK, and LeDoux JE (2007) Long-term potentiation in the
amygdala: a cellular mechanism of fear learning and memory. Neuropharmacology 52:215-
227.

Simpkiss JL, and Devine DP (2003) Responses of the HPA axis after chronic variable stress:
effects of novel and familiar stressors. Neuro Endocrinol Lett 24:75-81.

Smith SM and Vale WW (2006) The role of the hypothalamic-pituitary-adrenal axis in
neuroendocrine responses to stress. Dialogues Clin Neurosci 8:383-395.

Sohl G, and Willecke K (2003) An update on connexin genes and their nomenclature in mouse
and man. Cell Commun Adhes 10:173-180.










Sohl G, Maxeiner S, and Willecke K (2005) Expression and functions of neuronal gap junctions.
Nat Rev Neurosci 6:191-200.

Temme A, Traub 0, and Willecke K (1998) Downregulation of connexin32 protein and gap-
junctional intercellular communication by cytokine-mediated acute-phase response in
immortalized mouse hepatocytes. Cell Tissue Res 294:345-350.

VanSlyke JK and Musil LS (2005) Cytosolic stress reduces degradation of connexin43
internalized from the cell surface and enhances gap junction formation and function. Mol
Biol Cell 16:5247-5257.

Vieweg W, Julius D, Fernandez A, Beatty-Brooks M, Hettema JM, and Pandurangi AK (2006)
Posttraumatic stress disorder: clinical features, pathophysiology, and treatment. Am JMed
119:383-390.

Wei CJ, Xu X, and Lo CW (2004) Connexins and cell signaling in development and disease.
Annu Rev Cell Dev Biol 20:81 1-838.

Weller KL and Smith DA (1982) Afferent connections to the bed nucleus of the stria terminalis.
Brain Res 232:255-270.

Whitnall MH (1993) Regulation of the hypothalamic corticotropin-releasing hormone
neurosecretory system. Prog Neurobiol 40:573-629.

Wommack JC and Delville Y (2003) Repeated social stress and the development of agonistic
behavior: Individual differences in coping responses in male golden hamsters. Physiol
Behav 80:303-308.

Woodside BD and Staab R (2006) Management of psychiatric co-morbidity in anorexia nervosa
and bulimia nervosa. CNS Drugs 20:655-663.









BIOGRAPHICAL SKETCH

Nathan Weinstock received his Bachelor of Science in spring 2005 from the University of

Florida. He began his graduate education in fall 2005 working towards his Master of Science

degree in the behavioral neuroscience program in the psychology department at the University of

Florida.





PAGE 1

1 EFFECTS OF SOCIAL DEFEAT STRESS ON CONNEXIN36 GENE EXPRESSION IN THE AMYGDALA By NATHAN WEINSTOCK A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Nathan Weinstock

PAGE 3

3 To my Mom, Dad, and Sister.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank m y committee member s Dr. Mohamed Kabbaj, Dr. Neil Rowland, and Dr. Sue Semple-Rowland. I would especially like to thank my advisor, Dr. Darragh Devine, for his guidance, patience and support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........6 LIST OF FIGURES.........................................................................................................................7 ABSTRACT.....................................................................................................................................8 CHAP TER 1 INTRODUCTION..................................................................................................................10 2 METHODS.............................................................................................................................16 Animals...................................................................................................................................16 Drugs.......................................................................................................................................16 Surgical Procedures................................................................................................................17 Experimental Procedures........................................................................................................ 17 Social Dominance Training.............................................................................................17 Social Defeat Stress Experiment.....................................................................................18 Behavioral Assays.............................................................................................................. ....19 Gene Assays............................................................................................................................19 Statistical Analyses........................................................................................................... ......23 3 RESULTS...............................................................................................................................25 Social Defeat Experiment.......................................................................................................25 Gene Assays............................................................................................................................28 4 DISCUSSION.........................................................................................................................33 APPENDIX RAW CT VALUES ............................................................................................38 LIST OF REFERENCES...............................................................................................................39 BIOGRAPHICAL SKETCH.........................................................................................................45

PAGE 6

6 LIST OF TABLES Table page 2-1 Schedule of social defeat stress exposure by group. ..........................................................24 2-2 Forward and reverse primer sequences for connexin36 and GAPDH...............................24

PAGE 7

7 LIST OF FIGURES Figure page 3-1 Social defeats per daily experim ental session.................................................................... 263-2 Effects of social defeat st ress exposure on glandular masses............................................ 273-3 Localization of amygdala micropunches...........................................................................293-4 The RNA-denaturing formaldehyde-agarose gel............................................................... 303-5 Assessment of primer specificity....................................................................................... 313-6 Social defeat stress increases expr ession of Cx36 mRNA in the amygdala...................... 32

PAGE 8

8 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EFFECTS OF SOCIAL DEFEAT STRESS ON CONNEXIN36 GENE EXPRESSION IN THE AMYGDALA By Nathan Weinstock May 2008 Chair: Darragh P. Devine Major : Psychology Major depression is a debilitating emotional disorder, affecting millions of Americans annually. It is characterized by th e loss of interest or pleasure in nearly all activities for a period of at least two weeks. A preponderance of individuals with majo r depression report a considerable amount of emotional stress in their li ves in the form of signi ficant daily hassles and aversive major life events. These individuals al so suffer from a variety of co-morbid disorders including Post-Traumatic Stress Disorder, anxiet y disorders and eating disorders. Our current understanding of the etiology of major depression underscores the significance of emotional stress in conferring vulnerability to developi ng this devastating diso rder. These emotional stressors are processed by limbic circuits that ar e capable of undergoing pl astic alterations in a variety of mechanisms that determine the st rength of neuronal signaling. One potential mechanism is altered gene expression of th e protein sub-units of gap junctions, known as connexins. Connexin gene expression is alte red by withdrawal from chronic cocaine or amphetamine self-administration. Furthermore, ra ts treated with a gap junction antagonist, and connexin knockout mice, both exhibit impairments in standard tests of learning and memory. In the present study, we investigated changes in conn exin gene expression as a potential mechanism contributing to limbic plasticity during social defeat stress.

PAGE 9

9 For social defeat stress exposure, intruder male rats were each subjected to a larger dominant resident male rat until the intruder was defeated. This interaction proceeded for 5 min or until the intruder displayed the defeated, submissive posture three times. The intruder was then placed into a double-la yered wire mesh cage and returne d, in the protective cage, into the residents home cage. This interaction pro ceeded until 10 min had elapsed from the start of the social defeat session. The experimental rats were exposed to only on e social defeat session (acute) or to six sessions (repeat ed) with a different resident for each session. Control rats were not exposed to social defeat stress. All the rats were terminated 2 hours after their final social defeat session or at an equivalent time for the unstressed controls. The brains were then dissected out and flash frozen. Punches were collected from the amygdala, homogenized, and processed by RT-PCR to assay the e xpression of connexin36 (Cx36) mRNA. Overall, the repeatedly stressed rats but not the acutely stressed rats exhibited an upregulation of Cx36 mRNA expre ssion in the amygdala. This experiment provides evidence that amygdaloid Cx36 expression is implicated in the brain-altering effects of repeated emotional stress. However, further characte rization will be needed to exam ine the impact of this altered gene regulation on protein expression and function, and to identify the potential impact of alterations of connexins in determining the affective state of the animal.

PAGE 10

10 CHAPTER 1 INTRODUCTION Major dep ression is a pervasive and debilita ting emotional disorder, affecting 14 million American adults annually (Kessler et al., 2003b ). The fourth edition of the Diagnostic and Statistical Manual of Mental Disorders (D SM-IV, 1994) defines major depression by the presence of a depressed mood or lo ss of interest or pleasure in near ly all activities for a period of at least two weeks. These mood alterations ofte n occur in conjunction with severe changes in appetite accompanied by weight disturbances, sleep abnormali ties, fatigue, feelings of worthlessness, and a diminished ability to think or concentrate. In order to be diagnosed with major depressive disorder, the DS M-IV specifies that the patien t must present with symptoms that generate a significant amount of distress or impairment in all aspects of daily life (DSM-IV, 1994). A preponderance of these individuals with major depression also report a considerable amount of emotional stress in their lives in the form of significant dail y hassles and aversive major life events (Cummins, 1990). These set-ba cks often result in considerable difficulty functioning socially, occupationa lly, or in other important ar eas (DSM-IV, 1994). Individuals with major depression also suffer from a variety of co-morbid disorders such as Post-Traumatic Stress Disorder (PTSD), anxiety disorders, ea ting disorders, and phobias (Aina et al., 2006; Vieweg et al., 2006; Woodside et al., 2006; Kessler et al., 2003a). Drugs th at increase the levels of serotonin and norepinephrine in the synapse can be effective for the treatment of major depression (for review, see Nemeroff, 2007), indica ting that these systems may be altered in individuals with this disorder (for review, see Ressler and Neme roff, 2000). From an economic standpoint the impact of major depression is also staggering. The loss of labor attributable to depression costs an estimated 44 billion dollars annually (Greenberg, 2005).

PAGE 11

11 Since emotional stress is an important tri gger for the etiology of affective disorders (Kendler et al., 1995; for review see, Hayley et al., 2005), it is important to understand the biochemical changes that occur during stress exposure, as these changes may play important roles in the etiology of major de pression and other related psychopa thologies. Stress is defined as the physiological reaction caused by an aver sive or threatening situation (Herman and Cullinan, 1997). One way the body responds to acute stress exposure is by increasing the activity of the sympathetic nervous system, which is essential for the mobilization of systems required for energy -intensive behaviors (for review, see Smith and Vale, 2006). Once the perceived stressor has subsided, activity of the parasympathetic nervous system is increased to help restore homeostatic balance (for revi ew, see McEwen, 2006). Another physiological response to stress is increased activity of the Hypothalamic Pituitary Adrenal (HPA) axis (Herman and Cullinan, 1997) in response to inputs from the brainstem, cortex, and limbic system. These inputs converge on the dorso-m edial parvocellular neurons, within the paraventricular nucleus of the hypothalamus (PVN ), stimulating the rel ease of corticotropin releasing hormone (CRH). Under basal cond itions a small portion of these CRH-containing neurons express arginine vasopr essin (AVP) mRNA. After repeated stress, the number of AVPexpressing neurons is elevated so that the co-l ocalization of CRH and AVP mRNAs increases as much as 5-fold (Albeck et al., 1997; Amaya et al., 2000; Aubry et al., 1999; Bartanusz et al., 1993; de Goeij et al., 1992). CRH and AVP are then co-released by the parvocellular neurons into the hypophyseal portal system at the median eminence, where they activate the anterior pituitary gland (for review, see Whitnall, 1993; Herman et al., 2002) At the anterior pituitary CRH stimulates the release of adrenocorticotropic hormone (ACT H) into the bloodstream, while AVP serves to enhance the CRH function in a sy nergistic manner (Gillies et al., 1982). ACTH

PAGE 12

12 then acts by stimulating the adrenal cortex to synthesize and release glucocorticoids. One glucocorticoid (cortisol in humans and corticoster one in rats) is involved in the regulation of a variety of bodily processes including energy allocation, digestion, and immune function. Cortisol also activates the negative feedback regulation of the HPA axis that attenuates the system after stimulation by stress (for review, see Whitnall, 1993). The stressors that activate the HPA axis can be defined as systemic and processive. Systemic stressors are those that pose an imme diate physiological threat to tissue and organ systems. Common systemic stressors are exposur e to extreme temperatures and food or fluid deprivation. Information regarding systemic stre ssors is relayed directly to the PVN of the hypothalamus via brainstem catecholaminergic proj ections. Lesion studies have shown that responses to this type of stress or are not affected by an insult to the limbic system. Processive stressors are stimuli that are generally not an i mmediate threat to homeostasis but they require interpretation by higher brain stru ctures and are perceived as st ressful based on comparisons to previous experiences. Common exam ples of processive stressors are social instability and the perceived loss of control over ones environment. Processive stressors are distinguished from systemic stressors because they process signals from multiple sensory modalities. Information regarding processive stressors is relayed indirectly to the PVN of the hypothalamus through cortical and limbic structures such as the prefrontal cortex, amygdala, and bed nucleus of stria terminalis. Lesion studies have shown that HPA res ponses to this type of stressor are affected by an insult to the limbic system (Herman and Cullinan, 1997). Chronic changes in HPA axis functioning ar e often found in indi viduals with major depression and related disorders. Individuals diagnosed with major depression show increased levels of CRH mRNA in the PVN (A rborelius et al., 1999) as well as increased levels of CRH in

PAGE 13

13 the cerebrospinal fluid (Arbore lius et al., 1999; Nemeroff et al., 1984). The majority of these individuals also display elevated daily cortisol levels (Gold et al., 1986; Arborelius et al., 1999), indicating that HPA axis activity has increased. Furthermore, individuals diagnosed with major depression that are responsive to anti-depressant tr eatment frequently exhibit a return to baseline HPA axis functioning (Gold et al ., 1986; Amsterdam et al., 1988; Nemeroff et al., 1991). It has been hypothesized that early-life stress coupled with chronic emotional stress may provide the appropriate neuroplastic foundati on for the development of HP A axis dysregulation and the manifestation of major depression (for review, see Mello et al., 2003). Furthermore, HPA axis dysregulation and concomitant depressive-like behaviors are s een in non-human primates who have a history of early-life st ress (Arborelius et al., 1999). The limbic system appears to be dysregulated as a result of stress and limbic dysfunction is thought to lead to dysregulation of the HPA axis. However, the mechanism by which emotional stress alters specific limbic nuc lei resulting in the dysregulation of this axis is unknown. One way to examine this phenomenon is to expose rats to processive stressors. In the present study we utilized a processive stress regimen known as soci al defeat stress. In the social defeat stress procedure a young na ve male rat is exposed to a la rger dominant male rat until the na ve male is defeated. Social interactions such as these result in the activation of limbic structures in rats as evidenced by increases in expression of the im mediate early gene, c-fos, in the hypothalamus, septum, and amygdala (Martinez et al., 1998; Niku lina et al., 2004; Chung et al., 1999). Social defeat stress also activates the HPA axis of the defeated, male rats as indicated by increases in the levels of circulating ACTH (Ebner et al., 2005) and CORT (Wommack and Delville, 2003; Covington and Miczek, 2001) following exposure. The impact on limbic functioning coupled

PAGE 14

14 with the observable changes in endocrine measures suggests that the limbic system may undergo plastic changes as a result of exposure to repeated social defeat stress. We are using the social defeat model to st udy alterations in gap j unction gene expression as a candidate mechanism for this limbic plasticit y. Initially, gap junctions were known to exist only among invertebrates and were thought to o ffer a mechanism of information signaling between neurons that was primitive and much simpler than the complex chemical synapses (for example, see Hand and Gobel, 1972; for review, s ee Shl et al., 2005). No w, gap junctions have been reported to be both present and of f unctional significance, throughout the mammalian brain, in both neurons and glia (for review, see Na gy et al., 2004). Gap junc tions form hydrophilic channels that directly couple adjacent cells and allow the passage of ions, nutrients, small intracellular metabolites, and small cell-signaling mol ecules, less than 1 kDa in size (for review, see Shl et al., 2005). Each gap junction is fo rmed by apposing cells creating a narrow 2-3 nm gap (Kumar and Gilula, 1996). They are composed of two-hemichannels, one pre-synaptic and one-postsynaptic, each called a connexon. Each connexon is made up of six homomeric or heteromeric subunits called connexins (Cx) (for review, see Hormuzdi et al., 2004). There have been 20 distinct connexins identified in the m ouse and 21 in the human genome (for review, see Shl and Willecke, 2003). The numbe r of connexins in the rat is exp ected to be similar to that of the mouse, although they have not been as co mpletely catalogued. The members of this multigene family are distinguished by their molecular mass (e.g. Cx32, Cx36, where the molecular mass is indicated in kDa) (for review see Shl and Willecke, 2003). Each connexin consists of two extracellular domains, four hydrophobic membrane-spanning domains, and three cytoplasmic domains, as well as an intrace llular loop, and amino a nd carboxy termini (for review, see Wei et al., 2004). Th e regulation of gap junction ch annels is dynamic and can occur

PAGE 15

15 in response to various stimuli including changes in voltage, extracellula r calcium concentration, pH, and protein phosphorylation (Harris 2001). For example, when cytoplasmic Ca2+ concentration is low the gap junction channel opens, and conversely, if cytoplasmic Ca2+ concentration is high (in the micromolar range) th e gap junction channel closes (for review, see Wei et al., 2004). Connexin gene mutations have b een implicated in a variety of human diseases including cardiovascular disorders, deafness, skin disorders, cataracts, and peripheral neuropathies (for review, see Wei et al., 2004). The behavioral consequences of functioning gap junctions have been studied in relation to learning and memo ry. The gap junction antagonist carbenoxolone blocked learning and memory in the Morris Water Maze (Hosseinzadeh et al., 2005) and Cx36 knockout mice were impaired in th e Y-maze as well as on an object recognition task (Frisch et al., 2005), suggesting that these channels may contribute to plasticity. However, the role of gap junctions has not been studied in stress-induced limbic plasticity. Therefore, we are examining the potential that altered connexin gene expression is implicated in social defeat stress-induced changes in limbic functioning.

PAGE 16

16 CHAPTER 2 METHODS Animals Sixteen male Long Evans (LE) rats (Harla n, Indianapolis, IN) weighing 225-250 g were housed in a climate-controlled vi varium with a 12-hour light/dark schedule (lights on at 7 a.m. daily). These rats were used as intruders (see Experimental Procedures). The rats were allowed ad libitum access to standard laborator y chow (Lab Diet 5001) and tap water. Upon arrival the rats were pair-housed in standa rd polycarbonate cages (43 x 21.5 x 25.5 cm) and allowed to acclimate to the housing facility for 7 days before any expe rimental or surgical procedures were initiated. An additional eleven male LE rats weighing 300-325 g and an additional eleven female LE rats weighing 200225 g were pair-housed with gender-matched conspecifics for 7 days. These rats were later used as residents (see Experimental Procedures). Four more male LE rats weighing 250-275 g were pair-housed and used as intruders to train the resident males to exhibit dominant behavior (see Experimental Pro cedures). All the animal care procedures were pre-approved by the University of Florida Institutional Animal Care and Use Committee and were performed in accordance with the National Research Councils Guide for the Care and Use of Laboratory Animals. Drugs The anesthetics ketamine, xylazine, and Aerra ne (99% isoflurane) were purchased from Henry Schein Inc. (Melville, NY). The ketamine and xylazine were combined to yield a solution containing 83.3% ketamine : 16.7% xylazine (w/v). The analgesic Ketorolac tromethamine (30 mg/ml), a non-steroidal anti-inf lammatory drug, was also obtained from Henry Schein Inc.

PAGE 17

17 Surgical Procedures The resident rats (325-355 g at the tim e of surgery) were vasectomized under ketaminexylazine anesthesia (62.5 mg/kg ketamine + 12.5 mg/kg xylazine, i.p. in a volume of 0.75 ml/kg). If supplementary anesthesia was necessa ry during surgery, a gauze pad was soaked with AErrane and placed in a nose cone approximately 23 mm away from the rats snout. Ketorolac tromethamine (2 mg/kg s.c.), was administ ered for analgesia at the time of surgery. Each anesthetized rat was shaved from the ro stral edge of the scro tal area to the caudal abdomen. Following sterilization of the surgical area a 1 cm incision was made near the midline of the abdomen, which terminated caudally near th e base of the penis. The vas deferens was then isolated with forceps, and a 0.5 cm section was removed from each duct with the aid of a miniature cautery utensil. The internal incision was sutured with absorbable 4-0 Ethilon monofilament vicryl suture (Eth icon Inc.) and the ex ternal incision was closed with 9 mm stainless steel wound clips (World Precision Instruments Inc.) which were then removed 7 days subsequent to surgery. Each su rgical procedure lasted 15-25 min. Experimental Procedures Social Dominance Training Prior to the onset of the social defeat sessions the vasectomi zed resident male rats were pair-housed with the female rats for two weeks. During this time the male residents were trained and screened for characteristic territorial domin ance behavior. At the beginning of each training session each female resident was removed from the home cage and placed in a similar cage nearby. Ten min after removal of the female an intruder was placed into the residents home cage. Each male resident was trained to e xhibit characteristic do minance behavior. The residents and intruders were allowed to intera ct for 5 min or until the intruder displayed a submissive posture three times. This constituted the direct interaction ph ase. An intruder was

PAGE 18

18 considered to be defeated when it displayed a submissive posture by lying motionless in the supine position, with the resident on top of it, for a period of at least two sec. Precautions were taken to ensure the safety of the intruder rats. If a resident bit the intruder, the intruder was promptly removed and the direct interaction phase of that se ssion was immediately terminated. The residents that consistently defeated the intrud ers at least 2 times in each of the seven training sessions were used for the experiment. From th e initial eleven male residents used in the screening procedure six were retained fo r use in the social defeat experiment. Social Defeat Stress Experiment Sixteen nave m ale Long Evans rats were utili zed as intruders for the social defeat stress experiment. The procedure consisted of two phase s of resident-intruder interaction. The first, the direct interaction phase, wa s conducted in exactly the same manner as the training sessions, with each intruder exposed to a different resident during every social defeat session. Following the conclusion of every direct interaction phase each intruder wa s removed from the home cage of the resident, placed into a separate 10cm x 10cm x 15cm (inner dimensions) double-layered wire mesh cage and returned, in this protective cage, into the ho me cage of the resident. Once the intruder was returned to the residents cage the second phase of the procedure, the indirect interaction phase, was initiated. In the indirect interaction phase the intruder remained in the stressful environment without the possibility of direct contact by the resident. The intruder was maintained in the wire mesh cage until 10 min had elapsed from the start of the direct interaction phase. After the entire 10 minut e interaction (i.e. total of di rect and indirect phases) had concluded both the female resident and the male intruder were returned to their respective home cages. The social defeat stress procedure consisted of three experimental groups (Table 1). The rats in Group 1 were unhandled, unstressed controls and were not exposed to the social defeat

PAGE 19

19 stress procedure. The rats in Group 2 were unha ndled for five days and were then exposed to social defeat stress only once, on day 6 of the e xperiment. The rats in Group 3 were exposed to the social defeat procedure once daily for 6 consecutive days. On day 6 of the experiment all the intruder rats were rapidly decapitated 2 hours afte r the start of their social defeat stress session (or at an equivalent time for the unstressed c ontrol group). Immediatel y upon termination of the intruders, the brains were dissected and rapidly frozen in 2-methylbu tane at -40 C and stored at 80 C. At the same time, the adrenal and thymus gl ands were dissected out a nd stored at -80 C. The glands were then weighed at a later date in order to verify the health and stress condition of each intruder. Behavioral Assays Video cam eras were placed in the behavioral testing room where the social defeat stress experiment occurred. Each social defeat sess ion was recorded and the number of defeats per session was scored for each intruder. Gene Assays Each brain was rem oved from the -80 C freezer and incubate d in 2-methylbutane at -20 C for 10 min. After the 10 min had elapsed the br ain was placed into a stainless steel rat brain matrix, with slots spaced at 1.0 mm distances in the coronal plane (Bra intree Scientific, MA), which had been stored at -20 C. All disse ctions were conducted under RNase-free conditions. A standard single-edge razor blade was inserted in to the most rostral slot within the matrix. Then, the brain and the matrix were placed in a c ooler lined with dry ice for 30 sec. Once the brain and matrix were removed from the cooler two blades were inserted into the two most caudal slots, and then the brain within the matrix was placed back into the cooler for 30 sec. These blades anchored the brain in the matrix. Then, individual blades were placed into the successive slots in the matrix from the rostral to caudal direction. After each blade was inserted

PAGE 20

20 into the matrix, the brain and matrix were placed in the cooler for 30 sec. This procedure was repeated until the brain was completely sectione d through the amygdala in the coronal plane. Then, the first blade was removed with the 1 mm coronal section freeze-mounted to it. The blade and section were placed on th e dry ice, and then the brain and matrix were returned to the dry ice for 30 sec. This procedure was repeat ed until all of the slices through the amygdala had been obtained. The sections that were within th e rostral-caudal extent of the amygdala (between 1.80 and 2.80 mm posterior to bregma, according to the atlas of Paxinos and Watson, 1998) were kept on the dry ice and three bilateral micropunche s (1mm in diameter) were taken using a Harris Uni-Core (Ted Pella, CA). The micropunches from each rat were placed into individual 0.5 ml microcentrifuge tubes, on dry ice. The micropunches from each rat were then homogenized for 5 sec in 40 l TRI Reagent (Molecular Research Center, OH) using a Sonic Dismembrator Model 150 (Fisher Scientific, GA) set at 40. The homogen ates were incubated at room temperature for 5 min and stored at -80 C (for 1-2 weeks) until th e total RNA was isolated. The homogenates were then thawed at room temperature, supplemented with 5.4 l 1Bromo-3-Chloropropane (BCP) and shaken by hand vigorously for 15 sec. The resulting mixture was then stored at r oom temperature for 3 min and centrifuged at 12,000 g for 15 min at 4 C. Following centrifugation, th e colorless upper aqueous phase was extracted and transferred to a fresh 0.2 ml microc entrifuge tube. The total RNA was precipitated from the aqueous phase by adding 26.6 l of isopropanol to the mixture. The samples were then incubated at room temperature for 7 min and centrifuged at 12,000 g for 8 min at 4 C. The supernatant was removed and discarded by aspiration. The RNA pellet was then washed by adding 53.4 l of 75% ethanol, mixed by vortexing and centrifuged at 12,000 g for 15 min at 4 C. The ethanol wash was removed by aspiration. The RNA pellet was then partially air-dried for 10 min at

PAGE 21

21 room temperature and was dissolved in 10 l diethyl pyrocarbonate (DEPC) treated water by gently passing the solution through a pipette tip a pproximately 4 or 5 times. The isolated total RNA was then incubated in a water bath for 15 min at 55 60 C. To eliminate the possibility of contamination by genomic DNA, equal aliquots of total RNA were treated with DNase 1 using the TURBO DNA-free kit (Ambion, TX). TURBO DNase Buffer (1 l @ 10X ) and TURBO DNase (1 l) we re added to the total RNA samples. The resulting mixture was then incubated at 37 C for 30 min. Following incubation, 2 l of DNase Inactivation Reagent was added to each tu be then intermittently vortexed at room temperature for 2 min. The resulting mixtur e was centrifuged at 10,000 g for 1.5 min at room temperature then the supernatant was transferred to a fresh tube. The concentration of total RNA in each sample was determined by measuring ab sorbance of 1.5 l of the sample at 260 nm (OD260) in a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, DE). The purity of each sample was determined by calculati ng the ratio of absorbance at 260 and 280 nm (OD260/OD280). In order to confirm the integrit y of the isolated RNA an additional 2 l of total RNA was loaded onto an RNA-denaturi ng formaldehyde-agarose gel and visualized by staining with ethidium bromide. The cDNA was synthesized from each total RNA sample with random hexamers and oligo(dT)20 using the Superscrip t III Platinum Two-Step qRT-P CR kit (Invitrogen, CA). RT Reaction Mix (10 l @ 2X), RT Enzyme Mix (2 l), and equal amounts of the total RNA samples (1.0 g in 1.6 3.5 l) were combined, and then thoroughly mixed. DEPC-treated water was added to each sample (4.5 6.3 l) re sulting in a final volume of 20 l of the cDNA synthesis reaction. Then, each cDNA synthesis reaction was incubated at 25 C for 10 min, followed by 42 C for 50 min. Each reaction was terminated by incubating the mixture at 85 C

PAGE 22

22 for 5 min, and then chilling on ice. E. coli RNas e H (1 l) was added to each reaction and then the resulting mixture was inc ubated at 37 C for 20 min. E ach cDNA synthesis reaction was then stored at -20 C until the time of use. Forward and reverse primer sequences were generated by inputting the GenBank sequences for Cx36 and GAPDH ( NM_019281 and NM_017008, respectively) into the OligoPerfect Designer (Invitrogen, CA). The three prim er sets that were ranked most highly for Cx36 and for GAPDH by the OligoPerfect prog ram were purchased, and an initial RT-PCR screening was performed. The specificity of each primer was determined by the number of peaks in the dissociation curve ge nerated at the conclusion of the RT-PCR reaction. Primer sets that produced only one peak (a nd therefore yielded only one am plicon) were used in this experiment (Table 2). A dilution curve was also performed in order to ensure that a sufficient amount of the cDNA and primers were includ ed in each reaction. Once the appropriate parameters were established each well was load ed with 12.5 l Power SYBR Green PCR Master Mix (Applied Biosystems, CA), 6.5 l DEPC treated water, 4 l cDNA, and 2 l of the Cx36 or GAPDH primers to obtain a final volume of 25 l. The 96-well plate was then placed into the ABI 7900HT thermal cycler (Applied Biosystems, CA). The thermal cycling was performed with an initial denaturation at 95 C for 5 min. This was followed by 40 cycles each consisting of 15 sec of denaturation at 95 C, 30 sec of primer annealing at 60 C, and 30 sec of template extension at 72 C. Upon completion of all 40 cy cles a dissociation curve was generated in order to confirm the specificity of both targeted amp lifications. For the dissociation curve a final denaturing step was performed for 1 min at 95 C followed by an additional min at 55 C then, every 10 sec the set-point temperature of the thermal cycler was increased by 0.4 C for 100 repetitions in order to determine the range of amplicon melting temperatures.

PAGE 23

23 Statistical Analyses Potential between-groups differe nces in the total number of defeats was analyzed using an independent samples t-test to compare the tw o groups of intruders (i.e. the acutely stressed group and the repeatedly stressed group) during their initial exposur e to social defeat stress. A one-way repeated-measures analysis of varian ce (ANOVA) was used to examine any potential differences in number of defeats across experime ntal sessions for the repeatedly stressed group. Potential between groups differences in adre nal and thymus gland weights were analyzed by a one-way ANOVA. An analysis of fold-change for both the acu tely stressed and rep eatedly stressed groups was calculated by normalizing the Cx36 gene expre ssion to the expression of the control gene (GAPDH) using the Comparative Crossing Threshold (CT) method (Livak, 2001). In order to ascertain whether the calculated fold-change si gnificantly differed fr om 1.0, a one-way ANOVA was performed. Five of the 16 intruder rats were excluded from all the data analys is. Two of the rats were excluded because they were not defeated (one rat in the acute group was not defeated, and one rat in the repeated group was only defeated 4 times during the 6 sessions, and was not defeated at all during the final session). The RNA extraction fr om 2 rats (1 control and one repeated defeat) failed due to a procedural error. The RT-PCR for 1 rat in the acute defeat group failed due to a procedur al error (see Fig. 5).

PAGE 24

24 Table 2-1. Schedule of social defeat stress exposure by group Repeated Stress Acute Stress Kill Time Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 2 Hours Group 1 X X X X X X X Group 2 X X Group 3 X Table 2-2. Forward and reverse prim er sequences for connexin36 and GAPDH Gene Forward primer Reverse primer Connexin36 TAGCATGCCAGCTTTTC TTT GGCTCTACTGCAAACCTCTG GAPDH TGTATCCGTTGTGGATCTGA GACAACCTGGTCCTCAGTGT

PAGE 25

25 CHAPTER 3 RESULTS Social Defeat Experiment There were no significant betw een-groups differences in the number of defeats during the first exposure to social defeat stress when th e acutely and repeatedly stressed groups were compared (t (6) = 1.567, p = 0.1682; Figure 3-1). The rats in the repeated stress condition showed no significant between-group s differences in the number of defeats (F (3, 5) = 1.343, p = 0.2997; Figure 3-1) across all si x experimental sessions. There were no significant between-groups differences in thymus masses following exposure to social defeat stress for any of th e experimental conditions (F (2, 8) = 0.3129, p = 0.7398; Figure 3-2A). Similarly, the adrenal gland masses did not differ significantly (F (2, 8) = 1.321, p = 0.3193; Figure 3-2B) between the rats in any of the experimental conditions.

PAGE 26

26 0 1 2 3 4 5 6 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5Repeated Stress Acute Stress Defeat SessionNumber of Defeats Figure 3-1. Social defeats per da ily experimental session. The ra ts that were exposed to only one social defeat session (acute stress gr oup) experienced a similar number of defeats (defeat session 6) as the rats in the repeated stress conditi on on their first exposure to social defeat (defeat session 1). Those rats in the repe ated stress group were exposed to an equivalent number of social defeats across all 6 experimental sessions. Results are expressed as group means the standard error of the mean (SEM) (n = 4 rats per group).

PAGE 27

27 Control Acute Repeated 0 50 100 150Thymus Weight (mg/100g)A Control Acute Repeated 0 5 10 15 20Adrenal Weight (mg/100g)B Figure 3-2. Effects of social defeat stress exposure on glandular masses. A) Thymus gland masses, B) Adrenal gland masses showed no significant between-groups differences, regardless of experimental condition. Re sults are expressed as group means the SEM (n = 3 rats per group for controls ; n = 4 rats per group for both acute and repeated stress groups).

PAGE 28

28 Gene Assays Representative sections dem onstrating th e locations from which micropunches were extracted are shown in Figure 3-3. Representa tive RNA-denaturing formaldehyde-agarose gel, indicating the integrity of the RNA as evidence d by the visible 18S and 28S bands (Figure 3-4). When the semi-quantitative RT-PCR was r un the dissociation curve generated at the conclusion of the reaction contained only one peak for each of the primer sets for both Cx36 and GAPDH (Figure 3-5). A significantly greater Cx36 mRNA expression was evident in the amygdala of rats following exposure to repeated social defeat stress (F (2, 8) = 10.27, p < 0.01; Figure 3-6).

PAGE 29

29 Figure 3-3. Localization of amygdala micropunches. Rodent brain atlas figures depicting the target sites for the thr ee bilateral micropunches of the amygdala (Top). Representative rodent brain slices showing the actual amygdala micropunches (Bottom).

PAGE 30

30 Figure 3-4. The RNA-denaturing formaldehyde-aga rose gel. Representative gel of RNA isolated from six different limbic brain regions. The sharp 18S and 28S ribosomal RNA bands indicate the pr esence of intact RNA.

PAGE 31

31 Figure 3-5. Assessment of primer specificity. Dissociation curve of primers for Cx36 (blue) and GAPDH (purple). The curve contains one peak for each primer, at the melting temperature of each amplicon, indicating that the amplified RNA products are specific and that the SYBR Green fluor escent signal directly measured the exponential increase of Cx36 and GAPDH.

PAGE 32

32 Cx36 Amygdala Acute Repeated 0 1 2 3 4 *Fold Change Figure 3-6. Social defeat st ress increases expression of C x36 mRNA in the amygdala. Cx36 mRNA was not significantly changed in th e acutely stressed group compared to that of the control group. Cx36 mRNA was significantly increased in the repeatedly stressed group compared to that of the control group. Results are expressed as group means the SEM relative to the controls (dotted line) (n = 3 rats per group for controls; n = 4 rats per group for both acu te and repeated st ress conditions). *Significant at p < 0.05.

PAGE 33

33 CHAPTER 4 DISCUSSION The results of the current study dem onstrate th at repeated social defeat stress induces limbic plasticity in the form of an elevation in Cx36 mRNA within the amygdala. The impact that this change in Cx36 gene expression has on neuronal communication in the limbic system is currently unknown. However, this effect of repeated social def eat raises the possibility that alterations in connexin gene expr ession may play an important role in stress-induced changes in limbic processing of emotional stimuli. This possi bility is in line with previous reports that amygdaloid neuroplasticity plays an important role in the effect s of stress (Sigurdsson et al., 2007), and that connexin gene expression is increased during withdrawal from psychostimulant self-administration (Bennett et al., 1999; McCracken et al., 2005a; McCracken et al., 2005b). Classical learning and memory mechanisms have been shown to underlie alterations in the processing of emotionally salient stimuli within the amygdala. Amygdaloid evoked responses to medial geniculate stimulation are increased afte r high-frequency stimulation of the geniculate (Rogan and LeDoux, 1995). This effect is blocked by NMDA receptor antagonists, indicating a role for changes in glutamate signaling (Li et al., 1995). Similar changes in amygdaloid responsiveness are observed afte r associative fear conditioning to a tone, indicating that amygdaloid processing of auditory inputs from the amygdala are enhanced by the pairing of the auditory cue with the aversive stimulus (Rogan et al., 1997). Pl asticity in amygdaloid processing of geniculate inputs resembles glutamate-medi ated alterations in hippocampal processing of information and hippocampal plasticity is thought to model mechanisms of declarative learning and memory (for review, see Disterhoft and De Jonge, 1987; Kemp and Manahan-Vaughan, 2007).

PAGE 34

34 Limbic plasticity was also demonstrated in a study conducted by Simpkiss and Devine (2003). Following tetanic stimulation of the bed nucleus of stria terminalis (BNST), a crucial site of limbic convergence (Weller and Smith, 1982; Moga et al., 1989), a decrease in evoked field potential responses was r ecorded in the PVN. This effect was potently blocked by the NMDA receptor antagonist MK-801, indicating the pr esence of glutamate-mediated plasticity in this limbic circuit. Plasticity in this syst em suggests a functional congruity between known stress circuitry and the mechanisms thought to underlie classical learning and memory. Limbic plasticity has also been described in rats subjected to a week of isolation housing. Some rats exhibit increases in anxiety-related be havior after one week ex posure to the stress of social isolation (Kabbaj et al., 2000), providing further evid ence that a stressor can produce changes in limbic function. Thes e converging lines of evidence i ndicate that limbic structures are capable of plastic alterations after stimulation or stress expos ure, and that these changes may produce meaningful alterations in the processing of emotionally-sal ient stimuli. The findings of the current study reveal an additional mechan ism that may contribu te to stress-induced alterations in functional ac tivity of the limbic system. Although we demonstrated a stress-induced altera tion of the limbic system we did not see an associated change in adrenal or thymus masses. Exposure to repeated stress has been shown to produce thymus involution and adrenal hypertrophy (Blanchard et al., 1998; DominguezGerpe and Rey-Mendez, 2001; Hase gawa and Saiki, 2002). Since we did not see a change in thymus or adrenal gland mass this suggests that th e total number of social defeat sessions should be increased for the repeatedly stressed group in all future stress manipulations. Despite extensive efforts to assure that the resident s were well-trained and experienced, that they significantly outweighed the intruders, and that they had established territorial dominance

PAGE 35

35 through pair-housing with a female, there were so me inconsistencies in the number of defeats that the residents initiated acro ss days and for individual intruder rats. This could have been influenced by uncontrolled environmental factors (see Dallman et al., 1999), or by differences in the interactions between the indivi dual residents and intruders. In any case, the overall impact of these individual variations is not known. On the other hand, an important variable that could have contributed to the lack of thymus and adrenal changes is that the intruder rats were pairhoused between defeat sessions. Ruis and co lleagues (1999) found that pair-housing following resident-intruder interactions resu lted in an attenuation of the stress effect s due to the formation of a stable social relationship. Since we did not see the typical stress effects on gland masses and we know the social defeat stress procedure is susceptible to en vironmental variables, including pair-housing, we have begun to formulate a more vigorous stress regimen utilizing naturalistic stressors, along with social defeat, in an attempt to further explore the e ffects of emotional stress on connexin gene expression th roughout the limbic system. In the social defeat sessions, there were no si gnificant differences in the number of defeats during the first exposure to social defeat stre ss for both stress groups. Moreover, despite the apparent fluctuation in the number of defeats acr oss days in the repeatedly stressed group, there were no statistically significant differences in the daily numbers of defeats. This may be due to the small number of rats in this experimental gr oup. Despite this appare nt variability, the Cx36 mRNA expression was quite consistent and significantly elevated in these rats, suggesting that the mere presence of the dominant resident serves as a stressor in intruder ra ts that have a history of defeat. Thus, it is unclear if the precise number of defeats has any bearing on the emotional and physiological state of the intruders.

PAGE 36

36 In accordance with the observations of this e xperiment, stress-induced changes in connexin gene expression should be further characterized. Cx36 protein e xpression within the amygdala must be evaluated since connexin protein expres sion may not always match its gene expression (Oguro et al., 2001; McCracken et al., 2005a; McCracken et al., 2005b; Nakata et al., 1996; Temme et al., 1998; Matesic et al., 1994). Protein levels of the va rious connexins are considered to be tightly regulated by both post-transcriptional and post-tran slational processes. Connexin protein expression can be altere d post-transcriptionally by decreas ing protein synthesis (Nakata et al., 1996) or post-transl ationally by reducing the rate of degradation (Musil et al., 2000; VanSlyke and Musil, 2005). Furthermore, the half-life of gap junctions in cultured cells and tissues has been reported to be less than 2 hours (Crow et al., 1990; Beardslee et al., 1998). Therefore, the formation and turnover of gap junctions may explain the disparity between the levels of gene and protein expression. Additional studies must also be performed to elucidate the physiol ogical and behavioral roles of the changes in Cx36 gene (and potentia lly protein) expression. By pharmacologically challenging connexin proteins through the ad ministration of the gap junction antagonist carbenoxolone or the specific Cx36 antagonist me floquine the effects of connexin dysregulation on limbic-mediated tasks can be assessed. Fu rthermore, by microinjecting viral vectors containing the Cx36 gene into the amygdala we may be able to increase Cx36 protein expression and examine how this impacts fear and startle responses, as well as responses on standard tests of anxiety-related behaviors and models of major depression. Likewise, we can also examine the potential effects of increasing Cx36 protein e xpression on measures of sympathetic activity, ACTH and corticosterone, under stressed a nd unstressed conditions. Additionally, by conducting a time-course study we can investig ate the duration of the observed connexin

PAGE 37

37 plasticity. Moreover, by conducting a series of low-density arrays explori ng the gene expression of Cxs26, 32, 43, 45, 47, and 57 we can further a dvance our understanding of the part other connexins play in the limbic systems response to stress. From these analyses we should gain substantial insight into the roles connexins may play in stress-induced plasticity, which should lead to a greater understanding of the etiology of ma jor depression and its related disorders.

PAGE 38

38 APPENDIX RAW CT VALUES Control 8.0571 9.1612 9.0994 Acute 9.3491 9.5528 8.4545 9.2418 Repeated 8.1420 7.5250 6.5152 6.6185

PAGE 39

39 LIST OF REFERENCES Aina Y and Sus man JL (2006) Understanding comorbidity with depression and anxiety disorders. J Am Osteopath Assoc 106 :S9-14. Albeck DS, McKittrick CR, Blanchard DC, Blan chard RJ, Nikulina J, McEwen BS, and Sakai RR (1997) Chronic social stress alters levels of corticotropin-releasi ng factor and arginine vasopressin mRNA in rat brain. J Neurosci 17:4895-4903. Amaya F, Tanaka M, Hayashi S, Tanaka Y, and Ibata Y (2000) Hypothalamo-pituitary-adrenal axis sensitization afte r chronic salt loading. Neuroendocrinology 73:185-193. American Psychiatri c Association (1994) Diagnostic and statistical manual of mental disorders 4th ed. American Psychiatric Association, Washington, DC. Amsterdam JD, Maislin G, Winokur A, Berwis h N, Kling M, and Gold P (1988) The CRH stimulation test before and after clinical recovery from depression. J Affect Disord 14:213222. Arborelius L, Owens MJ, Plotsky PM, and Neme roff CB (1999) The role of corticotrophinreleasing factor in depres sion and anxiety disorders. J Endocrinol 160:1-12. Aubry JM, Bartanusz V, Jezova D, Belin D, and Kiss JZ (1999) Si ngle stress induces longlasting elevations in vasopressin mRNA levels in CRF hypophysiotrophic neurones, but repeated stress is required to modify AVP immunoreactivity. J Neuroendocrinol 11 :377384. Bartanusz V, Jezova D, Bertini LT, Tilders FJ, Aubry JM, and Kiss JZ (1993) Stress-induced increase in vasopressin and corticotropin -releasing factor expression in hypophysiotrophic paraventricular neurons. Endocrinology 132:895-902. Beardslee MA, Laing JG, Beyer EC, and Saffitz JE (1998) Rapid turnover of connexin43 in the adult rat heart. Circ Res 83:629-635. Bennett SA, Arnold JM, Chen J, Stenger J, Paul DL, and Roberts DC (1 999) Long-term changes in connexin32 gap junction protein and mRNA expression following cocaine selfadministration in rats. Eur J Neurosci 11:3329-3338. Blanchard RJ, Nikulina JN, Sakai RR, McKittri ck C, McEwan B, and Blanchard DC (1998) Behavioral and endocrine change following chronic predatory stress. Physiol Behav 63 :561569. Chung KK, Martinez M, and Herbert J (1999) Ce ntral serotonin depl etion modulates the behavioral, endocrine and physiolo gical responses to repeated social stress and subsequent c-fos expression in the brains of m ale rats. Neuroscience 92:613-625.

PAGE 40

40 Covington HE and Miczek KA (2001) Repeated so cial-defeat stress, cocaine or morphine. Effects on behavioral sensitizat ion and intravenous cocaine self administration binges. Psychopharmacology 158:388-398. Crow DS, Beyer EC, Paul DL, Kobe SS, and Lau AF (1990) Phosphorylation of connexin43 gap junction protein in uninfected and Rous sarc oma virus-transformed mammalian fibroblasts. Mol Cell Biol 10:1754. Cummins R (1990) Social insecurity anxiety, and stressful events as antecedents of depressive symptoms. Behav Med 16:161-164. Dallman MF, Akana AM, and Bhatnagar S (1999) Warning! Nearby construction can profoundly affect your experiments. Endocrine 2 :111-113. de Goeij D, Jezova D, and Tilders FJ (1992) Rep eated stress enhances va sopressin synthesis in corticotropin releasing factor neuron s in the paraventricular nucleus. Brain Res 577:165168. Disterhoft JF and De Jonge M (1987) Associative learning and long-term potentiation: cellular mechanisms compared. Int J Neurol 21-22:172-183. Dominguez-Gerpe L and Rey-Me ndez M (2001) Alterations i nduced by chronic stress in lymphocyte subsets of blood and primary a nd secondary immune organs of mice. BMC Immunol 2:7. Ebner K, Wotjak CT, Landgraf R, and Engelm ann M (2005) Neuroendocri ne and behavioral response to social confrontati on: residents versus intruders, active versus passive coping styles. Horm Behav 47:14-21. Frisch C, De Souza-Silva MA, Shl G, Gldenagel M, Willecke K, Huston JP, and Dere E (2005) Stimulus complexity dependent memory impairment and changes in motor performance after deletion of the neuronal gap junction protein connexin36 in mice. Behav Brain Res 157 :177-185. Gillies GE, Linton EA, and Lowry PJ (1982) Cortic otropin releasing activity of the new CRF is potentiated several times by vasopressin. Nature 299:355-357. Gold PW, Loriaux DL, Roy A, Kling MA, Calabrese JR, Kellnor CH, Nieman LK, Post RM, Dicker D, Gallucci W, et al. (1986) Response to corticotrophin-releasing hormone in the hypercortisolism of depression and Cushings disease: pathophysiologic and diagnostic implications. N Engl J Med 314:1329-1335. Greenberg PE and Birnbaum HG (2005) The economic burden of depression in the US: societal and patient perspectives. Expert Opin Pharmacother 6:369-376.

PAGE 41

41 Hand AR and Gobel S (1972) The structural orga nization of the septate and gap junctions of Hydra. J Cell Biol 52 :307-408. Harris AL (2001) Emerging issues of c onnexin channels: biophysics fills the gap. Q Rev Biophys 34:325-472. Hasegawa H and Saiki I (2002) Psychological stress augments tumor development through adrenergic activation in mice. Jpn J Cancer Res 93:729-735. Hayley S, Poulter MO, Merali Z, and Anisman H (2005) The pathogenesis of clinical depression: stressorand cytokine-induced alterations of neuroplasticity. Neuroscience 135:659-678. Herman JP and Cullinan WE (1997) Neurocircuitry of stress: central control of the hypothalamopituitary-adrenocortical axis. Trends Neurosci 20 :78-84. Herman JP, Cullinan WE, Ziegler DR, and Tasker JG (2002) Role of the paraventricular nucleus microenvironment in stress integration. Eur J Neurosci 16:381-385. Hormuzdi SG, Filippov MK, Mitropoulou G, Monyer H, and Bruzzone R (2004) Electrical synapses: a dynamic signaling system that sh apes the activity of neuronal networks. Biochim Biophys Acta 1662:113-137. Hosseinzadeh H, Asl M, Parvardeh S, and Mansou ri SM (2005) The effects of carbenoxolone on spatial learning in the Morris water maze task in rats. Med Sci Monit 11:BR88-94. Kabbaj M, Devine DP, Savage VR, and Akil H ( 2000) Neurobiological correlates of individual differences in novelty-seeking behavior in the rat: differential expres sion of stress-related molecules. J Neurosci 20 :6983-6988. Kemp A and Manahan-Vaughan D (2007) Hippocampa l long-term depression: master or minion in declarative memory processes? Trends Neurosci 30: 111-118. Kendler KS, Kessler RC, Walter EE, MacLean C, Neale MC, Heath AC, and Eaves LJ (1995) Stressful life events, genetic lia bility, and onset of an episode of major depression in women. Am J Psychiatry 152:833-842. Kessler RC (2003a) The impairments caused by social phobia in the general population: implications for intervention. Acta Psychiatr Scand Suppl 417:19-27. Kessler RC, Berglund P, Demler O, Jin R, Koretz Z, Merikangas KR, Rush AJ, Walters EE, and Wang PS (2003b) The epidemiology of major depre ssive disorder: results from the National Comorbidity Survey Replication (NCS-R). JAMA 289:3095-3105. Kum ar NM and Gilula NB (1996) The gap junction communication channel. Cell 84 :381-388.

PAGE 42

42 Li XF, Phillips R, and LeDoux (1995) NMDA a nd non-NMDA receptors contribute to synaptic transmission between the medial geniculate body and the lateral nucleus of the amygdala. Exp Brain Res 105:87-100. Livak KJ (2001) User Bulletin #2, ABI PRISM 7700 Sequence detection system. PE applied biosystems. [http://www.docs.appliedbiosystems.com/pebiodocs/04303859.pdf ] Martinez M, Phillips PJ, and Herb ert J (1998) Adaptation in pattern s of c-fos expression in the brain associated with exposure to either sing le or repeated social stress in male rats. Eur J Neurosci 10 :20-33. Matesic DF, Rupp HL, Bonney WJ, Ruch RJ, a nd Trosko JE (1994) Changes in gap-junction permeability, phosphorylation, and number mediated by phorbol ester and non-phorbol-ester tumor promoters in rat liver epithelial cells. Mol Carcinog 10:226. McCracken CB, Hamby SM, Patel KM, Morgan D, Vrana KE, and Roberts D (2005a) Extended cocaine self-administration and deprivation produces region-specific and time-dependent changes in connexin36 e xpression in rat brain. Synapse 58:141-150. McCracken CB, Patel KM, Vrana KE, Paul DL and Roberts D (2005b) Amphetamine produces region-specific and time-dependent change s in connexin36 expression in rat brain. Synapse 56:39-44. McEwen BS (2006) Protective and damaging effect of stress mediators: cent ral role of the brain. Dialogues Clin Neurosci 8:367-381. Mello AA, Mello MF, Carpenter LL, and Price LH (2003) Update on stress and depression: the role of the hypothalamic-p ituitary-adrenal (HPA) axis. Rev Bras Psiquiatr 25:231-238. Moga MM, Saper CB, and Gray TS (1989) Bed nucle us of the stria terminalis: cytoarchitecture, immunohistochemistry, and projection to the parabrachial nucl eus in the rat. J Comp Neurol 283:315-332. Musil LS, Le AC, VanSlyke JK, and Roberts LM (2000) Regulation of c onnexin degradation as a mechanism to increase gap junction assembly and function. J Biol Chem 275:25207 25215. Nagy JI, Dudek FE, and Rash JE (2004) Update on connexins and gap junctions in neurons and glia in the mammalian nervous system. Brain Res Rev 47:191-215. Nakata Y, Iwai M, Kimura S, and Shimazu T (1996) Prolonged decrease in hepatic connexin32 in chronic liver injury induced by carbon tetrachloride in rats. J Hepatol 25 :529. Nemeroff CB (2007) The burden of severe depre ssion: a review of diagnostic challenges and treatment alternatives. J Psychiatr Res 41:189-206.

PAGE 43

43 Nemeroff CB, Bissette G, Akil H, and Fink M (1991) Neuropeptide concentrations in the cerebrospinal fluid of depressed patients treated with electroconvulsive therapy, corticotrophin-releasing factor, beta-endorphin and somatostatin. Br J Psychiatry 158 :59-63. Nemeroff CB, Widerlov E, Bissette G, Walleus H, Karlsson I, Eklund K, Kilts CD, Loosen PT, and Vale W (1984) Elevated concentrations of CSF corticotrophin -releasing factor-like immunoreactivity in depressed patients. Science 226:1342-1344. Nikulina EM, Covington HE, Ganschow L, Hammer RP, and Miczek KA (2004) Long-term behavioral and neuronal cross-sensitization to amphetamine indu ced by repeated brief social defeat stress: Fos in the ventral tegmen tal area and amygdala. Neuroscience 123:857-865. Oguro K, Jover T, Tanaka H, Lin Y, Kojima T, Oguro N, Grooms SY, Bennett MV, and Zukin RS (2001) Global ischemia-induced increases in the gap junctional proteins connexin32 (Cx32) and Cx36 in hippocampus and enhanced vulnerability of Cx32 knock-out mice. J Neurosci 21 :7534. Paxinos G and Watson C (1998) The Rat Brain in Stereotaxic Coordinates, 4th Ed. CD-ROM: Hulasz, P. Ressler KJ and Nemeroff CB (2000) Role of serotonergic and noradrenergic systems in the pathophysiology of depression and anxiety disorders. Depress Anxiety 12 (Suppl 1) :2-19. Rogan MT and Ledoux JE (1995) LTP is accompanied by commensurate enhancement of auditory-evoked responses in a fear conditioning circuit. Neuron 15:127-136. Rogan MT, Staubli UV, and Ledoux JE (1997) Fear conditioning induces associative long-term potentiation in the amygdala. Nature 390:604-607. Ruis MA, te Brake JH, Buwalda B, De Boer SF, Meerlo P, Korte SM, Blokhuis HJ, and Koolhaas JM (1999) Housing familiar male wildtype rats together reduces the long-term adverse behavioural and physiologi cal effects of social defeat. Psychoneuroendocrinology 24: 285-300. Sigurdsson T, Doyere V, Cain CK, and LeDoux JE (2007) Long-term potentiation in the amygdala: a cellular mechanism of fear learning and memory. Neuropharmacology 52:215227. Simpkiss JL, and Devine DP (2003) Responses of the HPA axis after chronic variable stress: effects of novel and familiar stressors. Neuro Endocrinol Lett 24:75-81. Smith SM and Vale WW (2006) The role of the hypothalamic-pituitary-adrenal axis in neuroendocrine responses to stress. Dialogues Clin Neurosci 8 :383-395. Shl G, and Willecke K (2003) An update on connexin genes and their nomenclature in mouse and man. Cell Commun Adhes 10:173.

PAGE 44

44 Shl G, Maxeiner S, and Willecke K (2005) Expression and functions of neuronal gap junctions. Nat Rev Neurosci 6:191-200. Temme A, Traub O, and Will ecke K (1998) Downregulation of connexin32 protein and gapjunctional intercellular comm unication by cytokine-mediated acute-phase response in immortalized mouse hepatocytes. Cell Tissue Res 294:345. VanSlyke JK and Musil LS (2005) Cytosolic stress reduces degr adation of connexin43 internalized from the cell surface and enhances gap junction formation and function. Mol Biol Cell 16 :5247-5257. Vieweg W, Julius D, Fernand ez A, Beatty-Brooks M, Hettema JM, and Pandurangi AK (2006) Posttraumatic stress disord er: clinical features, pa thophysiology, and treatment. Am J Med 119:383-390. Wei CJ, Xu X, and Lo CW (2004) Connexins an d cell signaling in deve lopment and disease. Annu Rev Cell Dev Biol 20:811-838. Weller KL and Smith DA (1982) Afferent connections to the bed nucleus of the stria terminalis. Brain Res 232 :255-270. Whitnall MH (1993) Regulation of the hypothalamic corticotropin-releasing hormone neurosecretory system. Prog Neurobiol 40:573-629. Wommack JC and Delville Y (2003) Repeated so cial stress and the deve lopment of agonistic behavior: Individual differences in copi ng responses in male golden hamsters. Physiol Behav 80:303-308. Woodside BD and Staab R (2006) Management of ps ychiatric co-morbidity in anorexia nervosa and bulimia nervosa. CNS Drugs 20:655-663.

PAGE 45

BIOGRAPHICAL SKETCH Nathan W einstock received his Bachelor of Science in spring 2005 from the University of Florida. He began his gradua te education in fall 2005 working towards his Master of Science degree in the behavioral neuroscience program in the psychology department at the University of Florida.