<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2010-05-31.

Permanent Link: http://ufdc.ufl.edu/UFE0022079/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2010-05-31.
Physical Description: Book
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Burke, Brian E.
Electronic Access: INACCESSIBLE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022079:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022079/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2010-05-31.
Physical Description: Book
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Burke, Brian E.
Electronic Access: INACCESSIBLE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022079:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE LINC COMPLEX AND NUCLEO -CYTOPLASMIC COUPLING By MELISSA LYNN CRISP A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Melissa Lynn Crisp

PAGE 3

3 To my parents and to my brother, for thei r unconditional love and support throughout the years

PAGE 4

4 ACKNOWLEDGMENTS First and forem ost, I would like to thank my mentor, Dr. Brian Burke, who has provided me with an unforgettable gradua te experience, which I will draw from throughout my career. I have come to respect Brians brilliance as a sc ientist as well as his knowledge and understanding of things beyond. He carries with him a great sens e of humor that has made graduate school such a fun experience and helped me to see the light si de of things even when the load was heavy. I especially appreciate th e immense patience he has exercised with me through the years and the support he has offered as an advisor and friend. I would like to also thank Kyle, for whom I have gained a great deal of respect, regardless of his obsession with the avian flu. No t only has he injected his own humor into our lab, but he has also been a remarkable teacher, leader and motivator to me. I have learned so much from him. Thank you Kyle, for caring about my future. I would also like to thank my committee members (Steve Sugrue, John Aris and Peggy Wallace) for offering their expertise, suggestions and support through my graduate experience. I would especially like to acknowledge to Dr. Sugrue, who has served as an exceptional chair to our department and challenged each of us through his vision and leader ship. I am also grateful to Peter Sayeski for his advice, inpu t and providing a listening ear. I would like to thank the S ugrue, and LuValle labs for c onstant exchange and use of equipment and reagents as well as many hours of valuable discussion. I am grateful for all the support and guidance I have received from everyone in the open lab, especially Davide (for teaching me the ropes and for his friendship), Peter, Qian (for being a good friend and co-worker), Mo, Mich, Roma and Gus (for their constant vocal entertainment), Dustin (for mutual support both in and out of the lab), Ja net, Caitlin, Debra (for always offering her guidance with a smile), Lisa, Rachael, Todd (for his computer assistance, friendship and for

PAGE 5

5 maintaining a constant supply of Reeses Pieces), Lynda (for always keeping things in order), Kim (for her help and wonderful friendship), Mary, PJ and also Susan Gardner, who seems to be able to solve any problem anyone else cant. Final thanks go to my close friends and family. I thank Barb, for her undying support and friendship through all of this a nd for the last 20+ years. I th ank Dana and Deana for always listening. I thank Fred, for his amazing friendshi p, input, and Nip/Tuck nights. To Jose, for always being a rebel and for keep ing me in shape. To all my roommates, Jen, Melvin, Monica, Cristina and Vanda, who I have been incredibly lucky to have lived with and to whom I attribute the preservation of my sanity. To G, for the constant encouragement and for making it worthwhile in the end. Most importantly, I cannot express gratitude e nough for my parents and my brother, Jeff, for always being there. I could never have come this far without them.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES ................................................................................................................. ..........8 LIST OF FI GURES.........................................................................................................................9 LIST OF ABBRE VIATIONS........................................................................................................ 11 ABSTRACT ...................................................................................................................................15 CHAP TER 1 INTRODUCTION................................................................................................................. .17 Introduction................................................................................................................... ..........17 The Nuclear Envelope ............................................................................................................17 The Nuclear Lam ina...............................................................................................................18 Inner Nuclear Mem brane Proteins.......................................................................................... 22 The Nuclear Envelope and Disease ........................................................................................ 25 The Structural Hypothesis ...............................................................................................26 The Gene Expression Model ........................................................................................... 28 Nesprin Targeting and S UN Domain Proteins.......................................................................31 2 COUPLING OF THE NUCLEUS AND CYTOPLASM: ROLE OF THE LINC COMPLEX.............................................................................................................................48 Note .........................................................................................................................................48 Abstract ....................................................................................................................... ............48 Introduction................................................................................................................... ..........48 Results.....................................................................................................................................52 Discussion ...............................................................................................................................62 Materials and Methods ...........................................................................................................67 Cell Culture ................................................................................................................... ..67 Antibodies ..................................................................................................................... ...67 Immunofluorescence Microscopy ................................................................................... 68 Electron Microscopy ....................................................................................................... 69 siRNA Methods ...............................................................................................................69 Immunoblotting and Gel Electrophoresis ........................................................................ 69 Immunoprecipitations ......................................................................................................70 In vitro Translations ........................................................................................................71 Plasm ids...........................................................................................................................71 Transfections ...................................................................................................................73 Preparation of Glutathione Stransferase Fusion Proteins ............................................... 74 In vitro Pulldown with GST Fusion Proteins ..................................................................75

PAGE 7

7 Northern Blot Analysis.................................................................................................... 75 3 NESPRIN 4: A NOVEL EPITHELIAL SPECIFIC MEMBER OF THE NESPRIN FAMILY OF PROTEINS.......................................................................................................86 Abstract ....................................................................................................................... ............86 Introduction................................................................................................................... ..........86 Results.....................................................................................................................................91 Discussion ...............................................................................................................................97 Materials and Methods .........................................................................................................101 Cell Culture and Transfections ......................................................................................101 Generation of Stable Cell Lines .................................................................................... 101 Histology .......................................................................................................................102 Antibodies ..................................................................................................................... .102 Immunofluorescence Microscopy ................................................................................. 103 Immunoblots and Imm unoprecipitations.......................................................................104 Plasm ids.........................................................................................................................104 4 CONCLUSI ON................................................................................................................... ..123 Overview of Findings ...........................................................................................................123 The LINC Com plex Provides a Mechanism for Nucleo-cytoplasmic Communication.......................................................................................................... 123 Nesprin 4 P ositions the Nucleus in Polarized Epithelial Cells...................................... 124 Significance ................................................................................................................... .......125 The LINC Com plex and Mechanotransduction............................................................ 125 Lam inopathies and the LINC Complex......................................................................... 126 The LINC and Regulation .............................................................................................127 Specialization of Nesprins .............................................................................................127 Unique Qualities of Nesprin 4 .......................................................................................128 Future Directions ..................................................................................................................129 Mechanical Coupling of the Nucleus and Cytoplasm ................................................... 129 Nesprin 4 .......................................................................................................................130 LIST OF REFERENCES .............................................................................................................133 BIOGRAPHICAL SKETCH .......................................................................................................154

PAGE 8

8 LIST OF TABLES Table page 1-1 Properties of Representative I nner Nuclear Membrane Proteins....................................... 44 1-2 Nuclear Envelope Associated Diseases.............................................................................45 1-3 Outer Nuclear Membra ne Localized Proteins.................................................................... 47

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Current overview of nuclear envelope orga nization in a eukaryo tic interphase cell......... 40 1-2 Lamin A Processing. Lamin A is synthesi zed as the precursor protein prelaminA.......... 41 1-3 Proposed model for outer nuclear membrane protein localization in C. elegans ..............42 1-4 Mammalian SUN protein family.......................................................................................43 2-1 Sun1 is a ubiquitously expressed NE protein featuring a conserved COOH-terminal SUN domain.......................................................................................................................77 2-2 Sun1 is a transmembrane protein with a lumenal COOH-terminal domain...................... 78 2-3 The SUN domain of Sun1 is located within the PNS, whereas the NH2-terminal domain is exposed to the nucleoplas.................................................................................. 79 2-4 Interactions between the nucleoplasmic dom ains of Sun1 and 2 with A-type lamins....... 80 2-5 A-type lamin independent retention of SUN domain prot eins at the NE.......................... 81 2-6 Retention of nesp2G at the ONM requires the expression of SUN domain proteins........ 82 2-7 A soluble form of the Sun1 lumenal doma in causes a loss of nesp2G from the ONM..... 83 2-8 The nesp2G KASH domain interact s with the Sun1 lumenal domain............................... 84 2-9 Identification of an in vitro interaction between KASH and SUN domains......................85 3-1 Nesprin 4 is a novel member of the ne sprin family of KASH domain proteins.............. 107 3-2 Nesprin 4 is a nucle ar envelope protein...........................................................................108 3-3 Nesprin 4 localizes to the outer nuclear membrane......................................................... 109 3-4 The C-terminal KASH domain is sufficien t to target nesprin 4 to the nuclear envelope...........................................................................................................................110 3-5 Nesprin 4 can be displaced by GFP-KASH2 but is preferentially eliminated by GFPKASH4.............................................................................................................................111 3-6 A soluble form of the Sun1 lumenal do main causes a loss of GFP-KASH4 from the ONM............................................................................................................................ ....112 3-7 Nesprin 4 is expressed in secretory epithelial cells......................................................... 113

PAGE 10

10 3-8 Nesprin 4 expression is upregulated in HC11 cells when induced to differentiate......... 114 3-9 Nesprin 4 interacts wi th kinesin I (Kif5B)....................................................................... 115 3-10 HA-nesprin 4 adopts a polarized distribut ion in human salivary gland (HSG) cells....... 116 3-11 Nuclear membrane folding that accompanie s nesprin 4 polarization can be abrogated by disrupting microtubules.............................................................................................. 117 3-12 Nesprin 4 expression in HeLa cells detatches centrosomes from the nuclear envelope...........................................................................................................................118 3-13 Expression of nesprin 4 in HeLa cells leads to significant mislocalization of the Golgi apparatus................................................................................................................ 119 3-14 Nesprin 4 exhibits a di stribution pattern within the NE similar to Sun2......................... 120 3-15 Model for nuclear-centrosome separati on induced by nesprin 4 in HeLa cell................121 3-16 Model for nuclear posit ioning in epithelial cells............................................................. 122

PAGE 11

11 LIST OF ABBREVIATIONS aa Amino acids ABD Actin binding domain AD-EDMD Autsomal dominant EDMD ANC-1 Abnormal nuclear anchorage ARCA Autosomal recessive cerebellar ataxia type 1 BAF Barrier-to-autointegration factor bp Base pairs C. `elegans Caenorhabditis elegans CH Calponin homology CMT2B1 Charcot-Marie-To oth type 2B1 disorder D. melanogaster Drosophila melanogaster DCM-CD1 Dilated cardiomyopat hy with conduction defects DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid DTT 1,4-dithiothreitol EDMD Emery-Dreifuss Muscular Dystrophy FBS Fetal Bovine Serum FPLD2 Dunnigan-type familial partial lipodystrophy FRAP Fluorescence recovery after photobleaching GCL Germ cell-less GFP Green fluorescence protein GST Glutathione S transferase HGPS Hutchinson-Gilfor d progeria syndrome

PAGE 12

12 HP1 Heterochromatin protein 1 HRP Horse radish peroxidase IF Intermediate filament INM Inner nuclear membrane IPTG Iso-propylth io-galactopyranoside KASH Klarsicht, ANC-1, Syne homology kD Kilodalton LAP Lamin A polypeptide LBR Lamin B receptor LEM LAP, emerin, MAN1 LGMD1B Limb-girdle musc ular dystrophy type 1B LINC Linker of nucleoskeleton and cytoskeleton MAD Mandibuloacral dysplasia MDa Megadalton MEF Mouse embryonic fibroblasts MSP Muscle specific protein MT Microtubules MTOC Microtubule organizing center MuSK Muscle specific tyrosine kinase Myne Myocyte nuclear envelope NE Nuclear envelope Nesp Nesprin NespG Nesprin giant

PAGE 13

13 Nesprin Nuclear envelope spectrin repeat NET Nuclear envelope transmembrane protein NLS Nuclear localization signal NMJ Neuromuscular junction NPC Nuclear pore complex NUANCE Nucleus and actin connecting element Nup Nucleoporin ONM Outer nuclear membrane PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline PCR Polymerase chain reaction PFA Paraformaldehyde PNS Perinuclear space PRD Plakin repeat domain P-sites Phosphoacceptor sites RD Restrictive dermopathy rER Rough endoplasmic reticulum RNA Ribonucleic acid RNAi RNA interference SDS Sodium dodecyl sulphate SPAG Sperm associated antigen SPAG4L Spag4-like SR Spectrin repeat

PAGE 14

14 SREBP1 Sterol response element binding protein 1 SUN Sad1p,Unc-84 SUNC Sad1 and UNC-84 domain containing Syne Synaptic nuclear envelope TCA Trichloracetic acid TM Transmembrane Tris Tris-(hydroxymethyl) aminomethane TX-100 Triton X-100 WS Werner's syndrome WT Wild type X-EDMD X-linked EDMD Zmpste24 Zinc Metalloproteinase STE24

PAGE 15

15 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE LINC COMPLEX AND NUCLEO-CYTOPLASMIC COUPLING By Melissa Lynn Crisp May 2008 Chair: Brian Burke Major: Medical Sciences--Molecular Cell Biology The nuclear envelope (NE) defines the interface between nuclear and cytoplasmic compartments. It features bot h inner and outer nuclear memb ranes (INM and ONM), separated by a narrow lumen, the perinuclear space (PNS). Th e INM contains a unique array of integral proteins, including the SUN do main proteins, Sun1 and Sun2. While the ONM is continuous with the ER, it nevertheless cont ains several resident proteins of the nesprin family. These ubiquitous proteins interact with the cytoskeleton via their NH2-terminal domains. Nesprin 1Giant (Nesp1G) and nesprin 2Gia nt (Nesp2G) are actin -binding pr oteins while nesprin 3 binds plectin, a link to the intermediate filament system. The unique localization of nesprins in the ONM raised the question of how these proteins are anchored in the NE. Based on models proposed for homologues in C.elegans we hypothesized that the SUN domain proteins in the INM tether Nesp2G (as well as Nesp1G and Nesp3) within the ONM by forming a trans-lumenal link that spans the PNS. We demonstrate here that actin-associated Nesp2G is tethered in the ONM through trans-lumenal interactions between the Nesp2G KASH domain and INM-lo calized Sun1 and Sun2. Sun1 and 2 in turn, interact with the nuclear lamina. Theses molecu les, therefore, represen t links in a molecular chain that connects the cytoskel eton to the nuclear lamina and other nuclear components. We

PAGE 16

16 now refer to this molecular chain as the LINC (linker of nucleoskeleton and cytoskeleton) complex. Various isoforms of the LINC complex a ppear to be essential for the maintenance of NE integrity as well as nuclear positioning and may integrate the NE into a system that transmits mechanical signals from the cell su rface to the nuclear interior. Based upon homology with the Nesp2 KASH dom ain, we identified a novel epithelialspecific protein, nesprin 4 (Nesp4) Nesp4 is functionally similar to other nesprins in that it depends on its KASH domain to localize to the ONM and forms connections to cytoskeletal structures, in this case, microt ubules, via the plus-end directed mo tor protein, kinesin I (Kif5B). Like other nesprins, Nesp4 relies on SUN domain proteins for its localization. Introduction of the exogenous Nesp4 protein into HeLa cells lead s to the detachment and separation of the centrosome and Golgi apparatus from the nucleus. Given the lateral arrange ment of microtubules in epithelial cells, these clues ha ve led us to propose a model fo r an alternate mode of nuclear positioning in epithelial cells. In this scenari o, movement of the nucleus towards the basal surface of the cell is mediated by Nesp4-associated kinesin I. This thesis has defined a novel protein complex that for the first time provides a molecular mechanism for the coupling of the nucleus a nd cytoplasm. Furthermore it has provided new insight into nesprin function and localizati on. Through the discovery of Nesp4, we have uncovered a specialized role for nesprins in epithelial nuclear positioni ng. This discovery has laid the foundation for future inve stigations into the role of Nesp4 in epithelial morphogenesis and provided insights into the complex functi ons of the NE in defining not only nuclear architecture, but also that of the cytoplasm.

PAGE 17

17 CHAPTER 1 INTRODUCTION Introduction By def inition, the eukaryotic cell partitions its genetic material into a separate compartment, the nucleus. It has become increas ingly obvious that the nu cleus has an elaborate organization that is key to maintaining many of its major functions. Several dynamic domains or subnuclear bodies serve as sites of pre-mRNA splicing and transcription while the nucleolus is involved in ribosome biosynthesis (Handwerger a nd Gall, 2006; Raska et al., 2006a; Raska et al., 2006b). The most obvious architectural component is the nuclear envelope (NE) (Figure 1-1). The NE comprises a double membrane that delin eates the nucleus and serves as a selective barrier between nuclear and cy toplasmic components. Protei n components of the nuclear membranes and the underlying scaffold appear to be important in the regulation of gene expression by providing anchoring sites for chro mosome territories. Cert ain nuclear membrane proteins that are components of nuclear pore co mplexes (NPCs) are invol ved in the control of nucleo-cytoplasmic transport of macromolecules. Members of the newly identifie d nesprin and SUN protein fa mily members are now shown to be involved in the integrati on of the nuclear and cytoplasmic compartments of the cell. This finding has implicated the NE in more global functions, including the organization of the cytoskeleton and participation in nuclear positioning. We are onl y scratching the surface of the NE with such findings, as the discovery of at least 60 additional integral proteins of the NE (Schirmer et al., 2005) leaves us with a spectrum of functions still to be explored. The Nuclear Envelope In the 1950s, the application of the electron micr oscope to investigate the fine structure of isolated interphase nuclei revealed that the nuclear envelope (N E) is composed of two concentric

PAGE 18

18 lipid bilayers, the inner and outer nuclear membranes (INM and ONM, respectively) (Callan and Tomlin, 1950; Hartmann, 1953). The INM and ONM are separated by a fairly uniform lumen, between 20-40 nm wide, known as the perinuclea r space (PNS) (Watson, 1955). Periodic annular junctions between the INM and ON M create aqueous channels that traverse the NE and are occupied by nuclear pore complexes (NPCs) NPCs, numbering between 1,000 and 10,000 in a vertebrate somatic cell, are massive (~60 MD a) multi-protein complexes that dictate the bidirectional passage of macromolecules acro ss the NE (Burke, 2006; Watson, 1955). Ions and small molecules can diffuse freely through pores while larger molecules (>40kD proteins) require more complex mechanisms of active trans port to cross the NE (Stewart, 2007). Models for the pathways involved in nucleo-cytoplasmic transport are constantly being refined and are the subject of extensive reviews described elsewhere (Burke, 2006; Fried and Kutay, 2003; Pemberton and Paschal, 2005; Peters, 2006; Stewar t, 2007; Tran and Wente, 2006; Weis, 2003). Despite their connections at the peri phery of each NPC, the INM and ONM are biochemically distinct. The INM contains its own unique repertoire of integral membrane proteins, is ribosome free and maintains clos e contacts with chromatin (Wiese and Wilson, 1993). The ONM, the cytoplasmically opposed me mbrane, is continuous with the rough endoplasmic reticulum (rER) and, like the rER, is studded with ribosomes. In effect, the cisternal space of the ER communicates directly with the PNS. Only in recent years has it been established that proteins, some as big as 1000kD, reside in the ONM, but not in the peripherial ER (Padmakumar et al., 2004; Zhen et al., 2002). The Nuclear Lamina Underlying the INM is the nuclear lam ina, the ma jor structural element of the NE. It plays a critical role in maintaining interphase nuc lear morphology by providing mechanical stability and determining the spatial arra ngement of NPCs in the NE (Aebi et al., 1986; Gerace and

PAGE 19

19 Burke, 1988; Liu et al., 2000; Mounkes et al., 2003; Ris, 1997; Schirmer and Gerace, 2004; Stuurman et al., 1998). The nuclear lamina has also been shown to be an important determinant in DNA replication, transcription, chromatin organization and apoptosis (Burke, 2001; Glass et al., 1993; Goldman et al., 2002; Gruenbaum et al ., 2000; Lazebnik et al., 1995; Liu et al., 2000; Starr and Han, 2002; Starr et al ., 2001; Zastrow et al., 2004). Many functions of the lamina involve interactions with INM pr oteins and a provision for anc horing chromatin at the nuclear periphery (Gerace and Burke, 1988). The lamina a ppears as a dense meshwork of intermediatelike filaments (IF) ranging in si ze from 10-20nm and, like cytoplas mic IF meshworks, is highly resistant to biochemical extraction (Aebi et al., 1986; Mounkes et al., 2003; Stuurman et al., 1998). The major components of the lamina are type V IF family members known as lamins (Moir et al., 2000; Stuurman et al., 1998). Like all IFs, lamins ha ve a central alpha-helical rod domain of about 40kD fla nked by globular head (NH2-terminal) and tail (COOH-terminal) domains (Fisher et al., 1986; McKe on et al., 1986). The core of the lamin tail consists of a hydrophobic Ig-fold (Krimm 2002). The central r od domain enables lamin monomers to intertwine with one another as coiled-coil homod imers in a parallel, unstaggered fashion. These structures can then assemble into head-to-tail lin ear polymers that can in turn associate laterally to form higher order 10 nm filamentous structur es that make up the lamina meshwork. Features that distinguish lamins from other IFs include a basic domain nuclear localization signal (NLS) and highly conserved phosphoacceptor sites (P-sit es) in the head and tail domains (Haas and Jost, 1993; Loewinger and McKeon, 1988). P-sites act as substrates for a protein kinase which phosphorylates lamins at the end of prophase a nd promotes nuclear lamina disassembly in mitosis (Dessev et al., 1990; Gerace and Blobel, 1980).

PAGE 20

20 Lamins, classified generally as A-type or B-type, are found only in metazoans. The lamin isoforms are products of thr ee genes in vertebrates: LMNA, LMNB1 and LMNB2. Alternate splicing of a single LMNA transcript yields at least f our variants: lamins A, C, A 10 and C2 (Goldman et al., 2002; Lin and Worman, 1993; Mounkes et al., 2001). The two major B-type lamins (B1 and B2) are encoded by LMNB1 and LMNB2, respectively. Lamin B3 is expressed as a minor splice variant of LMNB2 (Goldman et al., 2002; Mounkes et al., 2003) The two major A-type lamins A and C are identical for the fi rst 566 amino acids (Zastrow et al., 2004). While lamin C has a unique six residue COOH-termin al tail, lamin A has a 98 amino acid COOHterminal extension and includes a CaaX box (whe re C=cystine, a=aliphatic amino acid, X=any amino acid; methionine in vertebrate lamins) at its C-terminus. The CaaX motif is common to all lamins except lamin C and lamin C2 and is subject to a series of post-tran slational modifications to generate the mature proteins (Zastrow et al., 2004) (Figure 12). Shortly after synthesis, all CaaX motif lamins (prelamin A or B) are farnesylated on Cys, pr oteolytically cleaved to remove the aaX sequence and then carboxymethylated (Kitten and Nigg, 1991). The prelamin A is then imported through NPCs into the nuclear interior by means of a nuclear lo calization signal (NLS). Farnesylation is apparently required for the de livery of lamin A to the NE, but the mechanism by which lamin A maintains stable associations w ith the nuclear periphery is not yet clearly understood. After assembly into the lamina, prel amin A undergoes a second cleavage catalyzed by endoprotease Zmpste24 (also called FACE-1), re leasing 15 extra residues (Bergo et al., 2002). Lamin B does not undergo the second cleava ge by Zmpste24 and, therefore, retains its farnesylated tail which mediates its interaction with the INM (Navarro et al., 2006). Defects in lamin A processing lead to progeri a, a severe disease phenotype th at resembles premature aging.

PAGE 21

21 Lamins are classified by biochemical properties, expression pattern and sequence homology (Broers et al., 1997; Gr uenbaum et al., 2000). A-type lamins have a neutral isoelectric point and are temporally expressed upon differe ntiation in a tissue-specific manner (MattoutDrubezki and Gruenbaum, 2003; Rober et al., 1989; Zastrow et al., 2004). Interestingly, a recent study suggests that lamins are also expressed transiently during embryogenesis, through the eight-cell stage in porcine embryos, but apparen tly not in mice (Foster et al., 2007; Stewart and Burke, 1987). Lamina enriched in lamin A (an A-t ype variant) are the most stable and require harsh conditions to be solubilized (Schirmer and Gerace, 2004). A-type lamins can also be found freely distributed in the nuclear in terior or associated with intranuclear foci. B-type lamins, on the other hand, are characterized by an acidic isoele ctric point and are nearly ubiquitous, with at least one B-type lamin being expressed at all stages of differentiation in mammalian somatic cells (Burke et al., 2001; Gerace and Burke, 1988; Mounkes et al., 2003; Nigg, 1989). Moreover, B-type lamins are crucial for cell survival at th e organismal level (Sullivan et al., 1999), whereas A-type lamins have been identi fied as non-essential in mouse embryos and in HeLa cells which have been depleted of lamin A by RNAi (Harborth et al., 2001; Sullivan et al., 1999). Some cells types, such as stem cells of the immune and he matopoetic systems, never express A-type lamins (Guilly et al., 1990; Rober et al., 1990). However, A-type lamins are not entirely dispensable, as postnatal growth is severely compromised in Lmna-/mice lacking lamins A and C. These animals invariably develop musc ular dystrophy and die within eight weeks of birth (Raharjo et al., 2001; Sullivan et al., 1999). Recent research suggests the functional redundancy of lamins A and C, as lamin-C only mice ( LmnaLCO/LCO) maintain phenotypes indi stinguishable from wildtype mice (Fong et al., 2006)

PAGE 22

22 Inner Nuclear Membrane Proteins Most, if not all, integral me mbrane proteins of the INM in teract with lamins and/or chromatin. For instance, lamin B receptor (LBR) indirectly associates with chromatin through lamin linkages and also forms complexes with DNA, chromatin-associated HA95, heterochromatin protein 1 (HP1) and histone H3 /H4 (Gruenbaum et al., 2005). The LEM domain proteins, named for lamin-associat ed polypeptide-2 family members (L AP 2 LAP2 ,LAP2 and LAP2 ) e merin and M AN1, share a common nucleoplasmic mo tif that confers direct binding to BAF (barrier-to-autointegr ation factor) (Lee and Wilson, 2004; Lin et al., 2000). BAF is an essential DNA and lamin-binding protein that may provi de a link between the LEM proteins and chromatin (Lin et al., 2000; Segura-Totten and Wilson, 2004). LAP1 family members, which lack a LEM domain, interact with all three lamins (A,B and C) and may serve as lamin anchors. Several INM proteins may be involved in signaling networks. Vi rtually all the INM proteins characterized to date bind to regulatory molecules (Stewart et al., 2007). A prime example is MAN1, which antagonizes TGF /activin and bone morphogenetic protein (BMP) signaling pathways by virtue of its binding to re gulatory SMADS (Lin et al., 2005; Osada et al., 2003; Pan et al., 2005; Raju et al., 2003). Until recently, only about a dozen integral membra ne proteins were known to reside in the nuclear envelope. In 2003, a subtractive prot eomics study of purified nuclear envelopes uncovered a catalogue of at least 50 additional putative NE transmembrane proteins (NETs) (Schirmer et al., 2005), the bulk of which appear to be enriched w ithin the INM. Certain of these novel proteins have been identified as poten tial disease candidates by genetic mapping (Wilkie and Schirmer, 2006). The known properties of severa l INM proteins are summarized in Table 11.

PAGE 23

23 Targeting of Integral Membrane Proteins to the INM: After mitosis, the interphase nuclear envelope continues to increase in su rface area, achieving expansion by the continual addition of membranes. This is concomitant with the insertion of additional NPCs and the accumulation of newly synthesized integral membrane proteins at the INM (Prunuske and Ullman, 2006). One model proposed to explain the mechanism of transit of integral membrane proteins to the INM involves a process of selective retention that depends on the interconnected nature of ER, ONM and INM membranes (Gerace and Burk e, 1988; Newport and Forbes, 1987). Newly synthesized integral proteins move into the ONM by lateral diffusion and gain access to the INM via membrane continuities of the nuclear pore co mplexes. Those proteins that are capable of binding to stable nuclear liga nds are subsequently concen trated within the INM. Several lines of evidence are consistent w ith the selective retention model of targeting. Nucleoplasmic domains that are essential for bi nding the nuclear lamina or chromatin domains have been defined for several INM localized pr oteins, including emerin, MAN1, LAP2 and LBR (Furukawa et al., 1995; Ohba et al., 2004; Ostlund et al., 1999; Sm ith and Blobel, 1993; Soullam and Worman, 1995; Wu et al., 2002). It appears that it is this binding affinity for nuclear components and not a specific sor ting signal that is required fo r proper targeting to the INM. Fusing a nuclear localizati on signal to LBR, for example, is insufficient for access to the NE (Soullam and Worman, 1995). This mechanism of localization predicts a considerable reduction in mobility of INM proteins in the NE relative to the ER. Indeed, quantitative fluore scence recovery after photobleaching (FRAP) of INM proteins fused to GFP demonstrate a significant difference in mobility of INM proteins in ER and NE membrane pools. Recovery kinetics indicate that GFP-

PAGE 24

24 LBR and GFP-emerin in the ER diffuse with unres tricted mobility in interphase cells while the large fraction localized to the INM is virtually immobilized (Ellenberg and Lippincott-Schwartz, 1999; Ostlund et al., 1999). Similar results have been obtained for other INM proteins using this approach (Ellenberg and Lippincott-Schwartz, 1 999; Ohba et al., 2004; Wu et al., 2002). In addition, loss of a ligand will also alter mobilit y. FRAP experiments showed that emerin and MAN1 experience increases in mobility at the NE of Lmna -/cells, while LBR is not affected, indicating at least a partial dependence of MAN1 and emerin on lamin A for retention at the INM (Ostlund et al., 2006). The size restriction imposed by the NPC s upports a function as a conduit for integral membrane protein movement through its channels. Extension of the nucleoplasmic domain of an INM resident, LBR, to 70kD prevents the chimeric protein from accessing the INM entirely (Soullam and Worman, 1995). It is remarkable that the nucleoplasmic domains of all known INM proteins fall below 60 kD (Burke, 1990; Holmer and Worman, 2001; Ostlund et al., 1999; Powell and Burke, 1990; Wu et al., 2002). Furthermore, the passage of integral proteins to the INM is strongly hindered by antibodies to th e cytoplasmic domain of the pore protein, gp210, likely due to a steric impediment (Ohba et al., 2004). Gp210 is one of three transmembrane components of NPCs thought to facilitate te thering of the NPC to the pore membrane. Interestingly, antibodies to the gp210 tail i nhibits overall nuclear expansion (Drummond and Wilson, 2002). Perhaps this suggests a flow of membranes from the ER and ONM through pores to achieve growth. Recent work demonstrates both an ener gy and temperature requirement for INM targeting. This study found that in vitro depletion of ATP or cooling to 20oC strongly inhibited movement of a reporter from th e ER to the INM (Ohba et al., 2004). This does not necessarily

PAGE 25

25 pose a challenge to the diffusion model, but may indicate an additional element of regulation. The authors propose that targeti ng requires an energy-dependent re structuring of the NPC that involves the reorganization or conf ormational changes in NPC proteins, thus allowing for lateral diffusion of integral membrane proteins betw een the ONM and INM via pore membranes (Ohba et al., 2004). Others studies that suggest a role for the nuclear import receptor, karyopherin/importin in INM protein transit also supports the existence an active transport pathway in addition to passive diffusion (King et al., 2006; Sa ksena et al., 2006). The Nuclear Envelope and Disease To date, at least 18 hum an diseases and s yndromes with wide-ranging phenotypes have been linked to a plet hora of inherited or de novo defects in proteins of the NE (Worman and Bonne, 2007), more than half of wh ich arise from mutations in the LMNA gene alone (detailed in Table 1-2). The first of these to be demonstrat ed as linked to NE-specific defects was EmeryDreifuss Muscular Dystrophy (EDMD). In 1994, Bione et al showed that defects in a nearly ubiquitous INM protein, emerin, was responsible for X-linked EDMD (B ione et al., 1994). Emerin mutations associated with X-EDMD consistently result in a loss of emerin from the NE. The disease is characterized by muscle atrophy, flexion deformities of the elbows, and cardiac conduction defects (Emery, 1987). At the time it was discovered, the link between muscular dystrophy and a NE protein came as a surprise as the majority of dystrophies up to that point had been linked to deficiencies in either cytoskelet al or structural proteins (Maidment and Ellis, 2002). Interestingly, a phenotypically indistinguish able autosomal dominant form of EDMD (ADEDMD) was later mapped to mutations in the LMNA gene (Bonne et al., 1999). Multiple diseases caused by defects in the LMNA gene, specifically referred to as laminopathies, have since been

PAGE 26

26 described. These include dilated cardiomyopathy with conduction defects (DCM-CD1) (Fatkin et al., 1999), limb-girdle muscular dystrophy type 1B (LGMD1B) (Muchir et al., 2000), Dunnigantype familial partial lipodystrophy (FPLD2) (Cao and Hegele, 2000; Shackleton et al., 2000; Speckman et al., 2000), mandibuloacral dysplas ia (MAD) (Novelli et al., 2002), autosomal recessive Charcot-Marie-Tooth type 2B1 disorder (CMT2B1) (De Sandre-Giovannoli et al., 2002), Hutchinson-Gilford progeria syndrome (H GPS) (De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003), restrictive dermopathy (RD) (Navarro et al., 2004) and atypical Werners syndrome (WS) (Chen et al., 2003). The wide variety in clinical presentation of LMNA -associated diseases has raised the question of how multiple mutations in a single gene can generate such a diverse range of diseases. Equally perplexing is that LMNA is expressed in most so matic cells, but frequently yields tissue-specific pathologies To date, over 200 different LMNA mutations have been identified in patients with a variety of laminopa thies (Broers et al., 2006). This seemingly multifaceted paradox has been addressed by two major theories, which are not necessarily mutually exclusive, as it is becoming increasingly apparent that multiple mechanisms are involved in laminopathy pathogenesis (Worman and Courvalin, 2004). The Structural Hypothesis One m echanism proposed to explain the pleiotro py of laminopathies highlights the lamina and nuclear envelope as an archite ctural unit, important for maintain ing the structural integrity of the nucleus. Mutations in the LMNA gene are frequently manifested as defects in nuclear morphology, including irregular shape and lobulations. Fibroblasts derive ,d from Lmna-/mice exhibit herniations in which the ONM and INM se parate and INM proteins, B-type lamins, NPCs and chromatin are withdrawn from one pole of th e nucleus (Roux and Burke, 2006; Sullivan et al., 1999). The structural hypothe sis posits that abnormalities in the nucleus account for greater

PAGE 27

27 nuclear fragility. Given that skel etal and cardiac muscle are esp ecially subject to mechanical stress, damage to these particular cell types seen in EDMD, DCM and LGMD1B are likely to occur in the event that the supportive nuclear structure is disrupted (Broers et al., 2004). Along those lines, studies using biomechanic al techniques demonstrated that embryonic fibroblasts (MEFs) from Lmna-/mice, as opposed to Lmna+/+ littermates, show increased nuclear deformation, decreased mechanical st iffness, impaired mechanotransduction and increased susceptibility to nucle ar rupturing when subjected to mechanical loads (Broers et al., 2004; Lammerding et al., 2004a). Emerin-/MEFs exhi bit similar, but milder nuclear distortions and mechanical weakness (Lammerding et al., 2005) Emerin deficiency also results in decreased nuclear elasticity, a probable cause for the fr agmented nuclear envelopes observed in X-EDMD patients (Rowat et al., 2006). On an molecular level, mutations in LMNA that encode residues that are part of the Igfold within the COOH-terminal domain can a ffect higher order lamin assembly or disrupt interactions with other proteins Mutations that cause FPLD are cl ustered tightly within the Igfold and tend to segregate spatially from t hose causing muscular dys trophies (Dhe-Paganon et al., 2002). FPLD mutations, such as R482W/Q, do not affect the structure, but due to changes in surface charge, are known to reduce the affinity of lamin A for the adipocyte differentiation factor, SREBP1 and DNA (Lloyd et al., 2002; Stierle et al., 2003) On the other hand, mutations associated with EDMD, LGMD1B and DCM cause general destabilizati on of the Ig domain (Krimm et al., 2002). Disrupted inte ractions with lamins due to mu tations in partner proteins are thought to be the causative link to so me disease phenotypes. The R690C LAP2 mutation, found in patients with dilated cardiomyopathy, has been shown to significantly compromise the in vitro interaction of LAP2 with the prelamin A tail (Taylor et al., 2005).

PAGE 28

28 On a larger scale, disruption of the lamina leads to disorganization of the cytoskeleton and deformation of the cell as a whole (Broers et al., 2004). Pretreatment of chondrocytes with cytochalasin D causes the nuclei to respond diffe rently to compression, indicating a connection between actin and the nucleus (Guilak, 1995). Furthermore, Lmna -/cells display abnormal actin networks, suggestive of a link between ac tin and the nucleus. Vimentin filaments and microtubules, also important for cellular resilience a nd cytoskeletal stiffness, are disorganized in Lmna -/cells, with the most obvious impact on vimentin (Broers et al., 2004). Desmin, an intermediate filament protein specific to muscle cells, is disorganized and detached from the nucleus in cardiomyocytes of Lmna-/mice (Piercy et al., 2007). The observation that the rigidity of the cytoskeleton is im pacted by nuclear stability points to potential interactions at the nuclear surface. The large isoforms of the nesprins (discussed in the following section), a new family of nuclear e nvelope proteins with act in binding domains, are likely candidates for completing links with the actin cytoskeleton (Zhang et al., 2002). In muscle cells, actin and desmin filaments are linked to the dystrophin-dystr oglycan complex. This complex connects to the extracel lular matrix through laminins a nd is thought to stabilize the sarcolemma during contraction. Mutations that disrupt the dystrophin-dystroglycan complex can result in Duchenne muscular dystrophy and seve ral recessive forms of limb girdle muscular dystrophy (Ehmsen et al., 2002). This points to the po ssibility that mechanical stress effected by muscle contraction is impacting interconnected nuclear and cytoskeletal components. The Gene Expression Model The structural m odel presents a strong case for striated muscle diseases, but does not entirely support a mechanism for laminopathies w ith other phenotypes. Mutations in lamina proteins are also proposed to affect chromatin organization and alter ce ll-type specific gene expression patterns. A recent in vivo study in D. melanogaster showed that B-type lamins bind to

PAGE 29

29 some 500 genes. These genes are tr anscriptionally silent late replicating, lack active histone marks, and cluster within the genome (Picke rsgill et al., 2006). Spatial repositioning of chromatin to central regions of the nucleus typica lly correlate with loss of gene repression and, in fact, induction of gene expression is consistently associated with the reduction in lamin binding (Feuerbach et al., 2002). Altered heterochromatin distributio n has been identified in emerin associated X-EDMD as well as LMNA-linked laminopathies, includ ing AD-EDMD, LGMD1B, FPLD, MAD and HGPS (Maral di et al., 2006). Evidence suggests that the nuclear lamina can function on a direct leve l by interacting with specific gene regulatory proteins or with the RNA transcriptional machinery. Lamins form complexes with integral inner nuclear membrane proteins that may immobilize transcription factors and other gene regulat ory proteins such as re tinoblastoma protein (pRb), heterochromatin protein 1 (HP1), sterol res ponse element binding protein (SREBP1), germ cellless (GCL), Oct1, YT521-B, c-fos and MOK2 (reviewed in Worman, 2005). pRb is a tumor suppressor protein involved in th e repression of cell cycle genes and regulation of differentiation. Lamin A complexed with LAP2 binds to the hypophosphorylated form of pRb and serves to retain it in the nucleus and pr otect it from degradation. Throu gh this interaction, the lamin A/CLAP2 complex not only contributes to the repressive role of p RB, but its function may extend to the control of cell cycle progression and di fferentiation by sequesteri ng proteins such as PCNA, p21, CDK4, and cyclin D3 (Dorne r et al., 2006; Pe kovic et al., 2007). Apart from the lamins, other NE proteins part icipate in gene regulatory functions. Emerin and MAN1 have been reported to bind to gene repressors GCL and Btf and emerin appears to attenuate both Lmo7 and -catenin mediated gene expression (Holaska et al., 2006; Holaska and Wilson, 2007). By directly bindi ng to Yt521-B, emerin can influence mRNA splicing in vivo

PAGE 30

30 (Wilkinson et al., 2003). One compelling study supporting the gene expression theory showed that the loss of emerin, wh ich exhibits no overt pathology in mice, leads to defective differentiation during muscle regeneration, due to the perturbation of the Rb1/E2F and MyoD transcriptional pathways (Cohen et al., 2007). Some recent findings can reconcile aspects of both models. Lammerding et al. demonstrated that the mechanosensitive genes egr1and iex-1 in response to mechanical stimulation was impaired in Lmna / fibroblasts (Lammerding et al., 2004b). Additionally, the activity of NFB, a transcription factor that normally protects the cell from stress by responding to mechanical or cytokine stimulation, is reduced in Lmna -/mouse fibroblasts, and thus contributes to the cells susceptibility to mechanical strain (Lammerding et al., 2004b). Deficiency in A-type lamins is associated both with reduced viability, defective nuclear mechanics and impaired mechanically activated gene transcription. The ambiguities on the etiology and tissue spec ificity of various laminopathies may be explained by the functional intera ctions between proteins concentr ated within the NE. It is striking that mutations in two ge nes, encoding NE components known to interact, separately give rise to virtually the same dis ease. EDMD can be linked to mutations in both emerin and lamin A; defects in Lap2 and lamin A lead to DCM (Bione et al., 1994; Bonne et al ., 1999; Fatkin et al., 1999; Taylor et al., 2005). A recent study demonstrated that variations in genes encoding nesprin 1 and nesprin 2 which bind to both emerin and la min A, were shown to be involved in the pathogenesis of EDMD, even in the absence of mutations in either EMD (which encodes emerin) or LMNA (Zhang et al., 2007a). Furthermore, the se verity of diseases may be affected by other genetic or environmental factors. One indicator of this comes from a study in C.elegans in which depletion of emerin yielded no detectable phenotype, but was found to be synthetic lethal

PAGE 31

31 with the depletion of MAN1 (Brachner et al., 2005; Liu et al., 2003). MAN1 and emerin bind directly to lamin and to each other and are partially mi slocalized from the NE when lamin A is lost from the NE (Clements et al., 2000; Li u et al., 2003; Mansharamani and Wilson, 2005; Ostlund et al., 2006). The apparent interconnectedness of proteins in the NE and eff ects of external strain on the nucleus give us some clues about the m echanisms involved in mechanotransduction (Lammerding et al., 2004b). It seem s that defects of any of the interacting partne rs involved in mechanical coupling at the NE could impair m echanotransduction to va rying degrees depending on the particular interactions th at are disrupted as a result. Taken together, evidence gleaned from human diseases and animal models suggests there are complex inter actions at the nuclear periphery involving not only nuc lear proteins but cytoplasmic components as well. Nesprin Targeting and SUN Domain Proteins The recen t identification of ONM-specific integral membrane proteins (summarized in Table 1-3) has raised the question of how these proteins are anc hored in the NE (Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). Assigning the same mode of selective retention applied to INM proteins is insufficient to ex plain the mechanism of ONM protein localization. The problem still remains: given that the ONM and ER membranes are contiguous, what prevents ONM proteins from simply drifting into the peripheral ER? This issue was originally addressed in C. elegans when the localization of ANC-1, a la rge type II ONM protein implicated in actin-dependent nuclear positioning, was found to be depe ndent on the presence of Unc-84, an integral membrane protein of the INM. (Starr and Han, 2002). Localization of Unc-84 itself was found to be dependent upon the single C. elegans lamin, a practical example of selective retention (Lee et al., 2002). Based upon these findings, Starr, Han, Gruenbaum and colleagues proposed a novel model in which Unc-84 would f unction as a trans-lumenal tether for ANC-1.

PAGE 32

32 This would be accomplished through interactions between their respective lumenal domains, whether directly or indirectly, across the PNS (Lee et al., 2002; Starr and Han, 2003) (Figure 13). ANC-1, Drosophila msp-300, and mammalian nesprin 1 (S yne-1) and nesprin 2 (Syne-2) contain a motif that is highly conser ved within the C-terminus of the Drosophila klarsicht protein. This 60 residue sequence, known as the KASH domain (for K larsicht, A NC-1 and S yne h omology), comprises a single transmembrane spanning sequence and a small lumenal domain which projects into the PNS. The KAS H domain has consistently been shown as necessary and sufficient for targeting to the NE. Other proteins, such as C. elegans Unc-83 and Zyg-12 also contain KASH domains. The large NH2-terminal domains of ONM localized KASH proteins are central in bridging the communication gap between the nucleus and cytoskeletal components, namely actin, microtubules (MT) and intermediate filaments (I F), and play an important role in nuclear anchorage and positioning. Positioning of the nucleus is crucial for many cellular events such as cell migration, differentiation, po larization and mitosis. ANC1, Unc-83 and the INM protein, Unc-84, were originally isolated in genetic screens for nuclear positioning mutants in the syncytial hypodermis of worms. It follows that nuclei that are normally spaced apart float freely and aggregate in clusters in anc-1 mutants (Starr and Han, 2002). Similarly, developing oocytes in germ-line msp-300 null flies have a strong du mping phenotype caused by a lack of nurse cell nuclear anchorage (Yu et al., 2006). During the late stages of oogenesis, nurse cells within the egg chamber contract and dump their conten ts through narrow rings canals into oocytes. An array of actin bundles that normally extend from the plasma membrane to nurse cell nuclei shorten during this dumping process, pulling the nuc lei away from the canals (Guild et al., 1997).

PAGE 33

33 Yu et al. hypothesized that msp-300 might serve as a mediator between the actin cytoskeleton and nuclei and demonstrated that nurse cell nuclei become detached in msp-300 null mutants. These mispositioned nuclei can enter the oocyte or obstruct the ring canal during cytoplasmic flow, resulting in smaller eggs. The single oocyte nucleus in msp300 null flies is also mispositioned. Msp300 was first found associated with actin in embryonic fly muscle, where it is required for normal myogenesis (Rosenberg-Hasson et al., 1996; Volk, 1992). Both ANC-1 and msp-300 anchor nuclei through associations with actin (Starr and Han, 2002; Volk, 1992; Yu et al., 2006). Gomes et al showed that moveme nt of the nucleus is coupled to actin retrograde flow in migrating cells. In this scenari o, the nucleus itself is reoriented while the microtubule organizing center (MTOC) remains stationary (Gomes et al., 2005). This fi nding would serve to reinforce the physiological significance of actin-binding KASH domain prot eins in nuclear positioning. Both the Drosophila Klarsicht and C. elegans ZYG-12 are known to link the nucleus and centrosome. Klarsicht is involved in proper nucle ar positioning in the developing compound eye. Nuclei in klarsicht mutants fail to migrate toward the apical edge of the eye imaginal disc and results in distorted photoreceptor morphology (Patterson et al., 2004). The NH2-terminus of klarsicht attaches to microtubules, likely via th e motor protein dynein, to ultimately associate with the centrosome (Fischer et al., 2004). Isoforms of ZYG-12 contain degenerate KASH domains to anchor them to the ONM and are thought to dimerize with a KASH-less form, ZYG12A, via a coiled-coil domain at the centrosom e (Malone et al., 2003). ZYG-12 interacts with a subunit of dynein and so may link to centrosomes in this way as well. Inte restingly, defects in a dynein regulator, LIS1, are associated with lis sencephaly, a condition in which neurons fail to properly migrate to the cortex of the brain (Gleeson et al., 1998; Keays et al., 2007; Reiner et al.,

PAGE 34

34 1993; Vallee and Tsai, 2006). Lissencephaly, which litera lly means smooth brain, is characterized by generalized agyria (the absen ce of convolutions over the surface of the brain), severe mental retardation and seizures (Wynshaw-Boris, 2007). Recent data suggests that LIS1 is important for nuclear movement during neuronal migration. Neurons from LIS1+/mice display increased nuclear-centrosomal spacing and slowed migration while inhibition of dynein produces a similar phenotype (Tanaka et al., 2004). Thus, LIS1 is thought to function with dynein to mediate the coupling of the nucleus to the cen trosome through MTs. LIS1 is also known to regulate nuclear positioning in Drosophila and fungi (Lei and Wa rrior, 2000; Morris, 2000; Swan et al., 1999). Mammalian orthologs of ANC-1 and msp-300 are two giant actin-binding proteins, recently identified as type II integral membra ne proteins of the ONM Because they were discovered in independent laboratories, th ey are variously termed nesprin 1 giant (Nesp1G)/Enaptin/Syne-1/Myne-1 and nesprin 2 Giant (Nesp2G)/NUANCE/S yne-2. (Apel et al., 2000; Mislow et al., 2002a; Padmakumar et al ., 2004; Zhang et al., 2001 ; Zhen et al., 2002). Nesp1G and Nesp2G have predicted sizes of 1.1 MDa and 796 kD, respectively. The giant nesprin (n uclear e nvelope sp ectrin r epeat) proteins feature a pa ired calponin homology (CH) actin binding domain (ABD), a large cytoplasmic domain containing multiple dystrophin related spectrin repeats, and a COOH-terminal KASH doma in. The cytoplasmic domains of these large proteins could extend 300-500 nm into the cy toplasm (Starr and Fischer, 2005). Nesp1G and Nesp2G contain 46 and 18 spectrin repeats (SR) respectively (Wa rren et al., 2005). Each repeat is composed of a bundle of three -helices and may govern the length of the SR containing domain or confer elastic properties to the protein (Djinovic-Ca rugo et al., 2002; Grum et al., 1999; Lenne et al., 2000). They are often found in structures that endure extensive mechanical

PAGE 35

35 stress, particularly red blood cells, the muscle sarcomere and stress fi bers (Djinovic-Carugo et al., 2002). As the principal component of the er ythrocyte cytoskeleton, spectrins maintain the biconcave shape of the cells and enable them to withstand the stress on the membranes as they are forced through narrow capillaries (Bennett an d Gilligan, 1993; Elgsaeter et al., 1986). SRs are found in a diverse number of proteins and have various sp ecialized functions, such as forming homoand heterotypic dimers or regul ating interactions with multiple proteins (Djinovic-Carugo et al., 2002). The giant nesprins arise from the nesprin 1 and nesprin 2 genes that encode a vast array of isoforms brought about by alternative initiation and termination of transc ription, as well as by alternative splicing (Starr and Han, 2002; Zh ang et al., 2001; Zhen et al., 2002). About 20 isoforms have been identified, ranging in size from 40kD to 1.1 MDa. Immunogold EM has given us indications that nesp rins are localized to both the INM and ONM (Zhang et al., 2005; Zhang et al., 2001). Some of the smaller isoforms, such as nesprin 1 nesprin 2 and nesprin 2 likely localize to the INM, given that they are known to bind to emerin and lamin A/C (Mislow et al., 2002a; Mislow et al., 2002b; Zhang et al., 2005). Both nesprins 1 and 2 are ubiquitously expressed, although some transcripts ar e more highly expressed in cardiac, skeletal and smooth muscle (Zhang et al., 2005; Zh ang et al., 2001; Zhen et al., 2002). Nesprin 1 (originally named syne-1 for sy naptic n uclear e nvelope) was first identified in a yeast two-hybrid screen as a bind ing partner for muscle-specific ty rosine kinase (MuSK), a core component of the post-synaptic membrane at th e neuromuscular junction (NMJ) (Apel et al., 2000). Vertebrate skeletal muscle fibers are s yncytial; each fiber form s from the fusion of hundreds of myoblasts and therefore contains hundreds of nuclei (Englander and Rubin, 1987). Most nuclei are evenly spaced throughout the fi ber with the exception of 3-6 nuclei, which

PAGE 36

36 aggregate beneath the postsynaptic membrane at the NMJ (Sanes and Lichtman, 2001). Apel et al. showed that nesprin 1 is associated with th e envelopes of myonuclei, with significantly higher levels in synaptic versus nonsyna ptic nuclei. This led the auth ors to speculate on a role for nesprin 1 in anchorage of synap tic nuclei (Apel et al., 2000). Subsequent studies revealed this nesprin to be a smaller, specia lized isoform among the many tran scripts encoded by the nesprin 1 gene (Zhang et al., 2001). Nespri n 2 was described as a homolog of nesprin 1 with a distinct but overlapping expression profile. (Apel et al., 2000; Zhang et al., 2001). Two recent studies have begun to delve into the functions of nesprins 1 and 2 at both cellular and organismal levels. Gr ady et al. tested the notion th at nesprin 1 anchors synaptic nuclei at the NMJ using transgen ic mice overexpressing a dominant -negative form of nesprin 1 consisting of only the conserved KASH domain (Grady et al., 2005). The dominant negative approach displaced endogenous KASH containing isoforms of nesprin 1 and resulted in a substantial decrease in nuclei beneath the NMJ in transgenic muscles with no effect on extrasynaptic nuclei. However, no severe physiological defects were cited. Overexpression of the nesprin 2 KASH domain displayed a similar effect (Zhang et al., 2007b). Zhang et al. later created mice in which the KASH domains of ne sprin 1 and/or nesprin 2 were knocked out, leading to a deficiency in KASH containing nesprins (Zhang et al ., 2007b). Depletion of nesprin 1 abolished nuclei clustering unde r the NMJ and disrupted the organization of non-synaptic nuclei in skeletal muscle. Depletion of nespri n 2 showed no apparent effect on positioning of myonuclei. Although depletion of ei ther nesprin 1 or 2 had no e ffect on viability or fertility, double depletion of both proteins proved lethal within 20 minutes of birth due to respiratory failure. Of note, non-synaptic nuclei were occasiona lly seen in the center of a cross-section of a

PAGE 37

37 myotube depleted of nesprin 1, a phenotype associated with regeneration and disease pathology (Starr, 2007; Zhang et al., 2007b). Because of the preponderance of nesprins in cardiac and skeletal muscle, it is not surprising that nesprin gene variants are li nked to EDMD pathology. Knockdown of either nesprin in normal fibroblasts recapitulate s the same nuclear morphological changes and mislocalization of emerin and Sun1 observed in fibroblasts of EDMD patient s that tested positive for nesprin 1 or 2 missense mutations (Zhang et al., 2007a). A new study cites mutations in nesprin 1 as the causative link to the neurodegenerative disease, autosomal recessive cerebellar ataxia type 1 (ARCA1) (GrosLouis et al., 2007). It follows that synaptic nuclei were mispositioned at neuromuscular junctions in ARCA1. A similar phenotype has been observed in skeletal muscle of mice in which nesprin 1 was depleted or displaced through a dominant negative approach (Grady et al., 2005; Zhang et al., 2007b). In mammalian cells, the giant nesprins coul d be anchored at the ONM in a manner analogous to ANC-1 in the suggested C. elegans model, thus linking the actin cytoskeleton to the NE. Thus, a role for a mammalian homol og to Unc-84 would be in order. One of the defining features of Unc-84 is a region of homology, consisting of about 200 amino acids, with Sad1p, an S. pombe protein that is associated with the spindle pole body (Hagan and Yanagida, 1995). This region of homology is known as the SUN domain (for S ad1p, UN c-84) and is believed to extend into the PNS. In all cases studied thus far, SUN domain proteins contain at least one pr edicted transmembrane (TM) domain and most localize to the NE (Dreger et al., 2001; Hagan and Yanagida, 1995; Hodzic et al., 2004; Malone et al., 1999; Malone et al., 2003). SUN domain proteins are found across all e ukaryotes, conserved from rice and protozoa to humans (Jaspersen et al., 2006; Shao et al., 1999). The C. elegans Unc-84 is

PAGE 38

38 required for the proper localizat ion of both ANC-1 and Unc-83 to the NE (McGee et al., 2006; Starr and Han, 2002). A second germline specifi c SUN domain protei n, Matefin/Sun-1 is required for proper NE localization of Zyg-12 (F ridkin 2004). In contrast to Unc-84, matefin localization to the INM is not dependent on the presence of the C. elegans lamin (Fridkin et al., 2004; Lee et al., 2002). Mammalian cells are known to contain as leas t five SUN domain prot eins (described in Figure 1-4) : Suns 1-2, Sunc1 (Sun3), Spag4 (Sun4) and Spag4-like (Sun5). Suns 3-5, of which little are known, are testis speci fic (Shao et al., 1999; Xing et al., 2003). Suns 1 and 2, on the other hand, show ubiquitous gene expression patterns in both mouse and humans (Ding et al., 2007). Human Sun2 has been shown to be a type ll membrane protein (like Sad1 and Unc84) that resides within the INM (Hodzic et al., 2004). A limited mutagenesis study has revealed that appropriate localization of Sun2 requires only the transmembr ane and cytoplasmic (nucleoplasmic) domain s (Hodzic et al., 2004). Evidently the SUN domain, which resides within the PNS, is dispensable with respect to targeting. While A-type lamins have been suggest ed as binding partners for Sun2, they are not absolutely required for Sun2 localization within the INM (Hodzic et al., 2004). The orientation and localization of Sun2 would be consistent with a role for these protei ns as tethers for ONM proteins, particularly the giant nesprins, as pr oposed in the model of Starr and Han (2003). Due to its significant homology to Sun2, Sun1, which ex ists as multiple spliced isoforms, may well function in a similar manner. Since the discovery of Nesp1G and Nesp2G, other mammalian nesprins have since been identified. Nesprin 3 (Nesp3), like nesprins 1 and 2, also resides on the ONM, anchored by a KASH domain, and contains a cytoplasmic domain with spectrin repeats (Wilhelmsen et al.,

PAGE 39

39 2006). Nesp3 was found to bind to the actin-bindi ng domain (ABD) of plectin in a yeast twohybrid screen, suggesting a novel role for ONM nesprins in linking intermediate filament networks to the nucleus (Wilhelmsen et al., 2005). Plectin is a cytoskeletal crosslinker protei n known to interconnect intermediate filaments (IFs) and to tether the cytoskel eton to certain membrane structur es (Sonnenberg et al., 2007). It has a tripartite structure, consisting of an NH2-terminal ABD domain, a long coiled-coil domain and a COOH-terminal linker preceded by a plakin repeat domain (PRD). The PRD confers binding to IFs and has been found to contain spectr in repeats, which may contribute to the elastic properties of the protein (Sonnenberg et al., 2007 ). The ABD can alterna tively interact with integrin 4 at the plasma membrane (Borradori and Sonnenberg, 1999). This, along with recent evidence showing that nesprin 3 can compete with integrin for binding to plectin, suggests a continuous protein scaffold that extends from the extracellular matrix to the nuclear membranes (Wilhelmsen et al., 2005). Due to the existence of a KASH domain, we su spect nesprin 3 would also be anchored in the same manner suggested by the ANC-1 model. If this scaffold exists, nesprin 3 may be an important component of a specialized mechanical signaling pathway. Interestingly, no obvious adverse phenotype ha s been observed in nesprin 3 knockout mice (personal communication, Colin Stewart). There were two major aims for this thesis. The first goal was to determine the precise mechanism by which nesprins are anchored in the ONM. In the course of this investigation, we identified a novel mammalian protein that c ontains a KASH domain. Our second objective, therefore, was to characterize this protein, nespri n 4, as the fourth member of the nesprin family of proteins.

PAGE 40

40 (Stewart CL, Roux KJ and Burke B. Science. 2007; 318:1408-12) Figure 1-1. Current overview of nuclear envelope organization in a eukaryotic interphase cell. Some selected INM proteins, including la mina-associated polypeptides 1 and 2 (LAP1 and LAP2) and LBR, are shown; these proteins interact with HP1 and BAF and provide links to chromatin. The nuclear lamina, composed of A-type and B-type lamins, is thought to provide a structural framework for the NE. The INM and ONM are joined at the periphery of each NPC w ith the ONM being continuous with the ER, forming a continuous membrane system. Consequently, the PNS and ER lumen are continuous. The ONM is characterized by cy toskeleton-associated nesprin proteins that are tethered by SUN domain proteins in the INM.

PAGE 41

41 Figure 1-2. Lamin A Processing. Lami n A is synthesized as the pr ecursor protein prelamin A. Prelamin A contains a C-terminal CaaX motif that accepts a farnesyl group added by the action of the enzyme, protein farnesyltran sferase. Following farnesylation, the last three amino acids (-AAX) of prelamin A are cleaved by the endoprotease Zmpste24 and the newly exposed cysteine is carboxyl-methylated. Subsequently, the terminal 15 amino acids of the maturing lamin A are cleaved by Zmpste24 and degraded, releasing the mature lamin A. Arro ws indicate cleavage sites.

PAGE 42

42 Figure 1-3. Proposed model for outer nucle ar membrane protein localization in C. elegans. The conserved KASH domain of ANC-1 (gr een) is targeted to the ONM through interactions with the SUN domain of th e INM protein, UNC-84. These interactions could occur directly (A) or i ndirectly (B) through an intermediate protein or complex across the PNS. ANC-1 binds actin in the cytoplasm and UNC-84 binds A-type lamins on the nuclear face of the NE. Thus an argument could be made for a translumenal bridge that c onnects cytoskeletal and nuclear components.

PAGE 43

43 Figure 1-4. Mammalian SUN prot ein family. Sun1 features four hydrophobic sequences, H1H4, each of roughly 20 amino acid residues. It s membrane-spanning domain is contained within the H2H4 region. The Sun1 N-terminus, including H1, is nucleoplasmic. The C-terminal SUN domain reside s in the PNS. Murine but not primate Sun1 contains a predicted C2H2 zinc nger. Several splice isoforms of mouse Sun1 have been identified that feature th e loss of sequences encoded by exons 6, including H1. Four other mammalian SUN proteins are know n. Sun2 is ubiquitously expressed and localizes to the INM. Sun3 (SUNC1), Sun4 (SPAG4), and Sun5 ( SPAG4L) appear to be expressed primarily in testis (unpublis hed data). When expressed in HeLa cells, Sun3 localizes to the NE (Liu et al, 2 007), whereas Sun4 (Hasan et al., 2006) and Sun5 (unpublished data) localize primarily to the ER.

PAGE 44

44Table 1-1 Properties of Representative Inner Nuclear Membrane Proteins Name Size Lamin binding Chromatin interactions Other properties LAP1A 75kD A/B-type lamins LAP1B 68kD A/B-type lamins Splice variant of LAP1A LAP1C 57kD A/B-type lamins ? Type 2 membrane protein. 173 residue lumenal domain, 311 residue nucleoplasmic domain. Splice variant of LAP1A LAP2 50kD B-type lamins BAF, HA95 Type 2 membrane protein. Large 410 residue nucleoplasmic domain. LEM domain. LAP2 38,43,46 kD Most likely B-type lamins Probable chromatin binding via BAF Type 2 membrane proteins. Splice variants of LAP2 Two other splice variants, LAP2 are soluble proteins. LBR 71kD B-type lamins HP1, HA95 Multi-spanning protein. St erol C-14 reductase activity. Emerin 29kD A-type lamins lamin B1 BAF Defects in emerin linked to Emery-Dreifuss muscular dystrophy. LEM domain. Nurim 29kD Multi-spanning membrane protein MAN1 82kD A/B type lamins Probable chromatin binding via BAF LEM domain; attenuates TGF signaling Otefin 47kD Drosophila Dm lamin YA LEM domain LUMA 45kD Multi-spanning Lem2 56kD A/B-type lamins BAF LEM domain

PAGE 45

45Table 1-2. Nuclear Envelope Associated Diseases Disease Representative Mutations Description Striated Muscle Disorders Emery Dreifuss Muscular Dystrophy, Xlinked (X-EDMD) EMD (P183H, Q43X, P183T) Nesp1 (R257H), Nesp2 (T89M) Progressive atrophy and weakne ss of skeletal muscles; flexion deformities; cardiac conduction defects Emery Dreifuss Muscular Dystrophy, Autosomal Dominant (AD-EDMD) LMNA (H222P, R527P, E112del, R249Q, 261del, R453W, T528R) Progressive atrophy and weakne ss of skeletal muscles; flexion deformities; cardiac conduction defects Emery Dreifuss muscular dystrophy, autosomal recessive (AR-EDMD) LMNA (H22Y, E358K/ R624H) Progressive atrophy and weakne ss of skeletal muscles; flexion deformities Dilated cardiomyopathy with conduction defects (DCM-CD1) LMNA (N195K, E161K) R60G, R571S) LAP2 (R690C) Enlarged heart; reduc ed systolic function Limb-girdle muscular dystrophy type 1B (LGMD1B) LMNA (R377H, delK208, E536fsX571) Age-related atrioventricular cardiac conduction disturbances and dysrhythmias; absence of early contractures. Lipodystrophies Dunnigan-type familial partial lipodystrophy (FPLD2) LMNA (R482W, R482Q, R482L, R62G) Accumulation of fat in neck and face; adipocyte degeneration in limbs and trunk after puberty; often associated with insulin resistance and dyslipidaemia Lipoatrophy with insulin -resistant diabetes, leukomelanodermic papules, liver steatosis and hyperthrophic cardiomyopathy (LIRLLC) LMNA (R133L, T10I) Loss of subcutaneous fat; insulin-resistant diabetes; hypertriglyceridemia; hepatic steatosis; hypertrophic cardiomyopathy with valvular involvement; disseminated papules Mandibuloacral dysplasia (MAD) LMNA (R527H, K542N, A529V, R527C/R471C) ZMPSTE24 (W340R, F361fsX379) Postnatal growth retardation; craniofacial anomalies; skeletal malformations; mottled cutaneous pigmentation; lipodystrophy

PAGE 46

46Table 1-2. (continued) Barraquer-Simons acquired partial lipodystrophy (APL) LMNB2 (R215Q, A407T) Progressive lipodystroph y, predominantly in females; fat loss limited to the face, trunk, and upper extremities; fat hypertrophy in lower extremities; may develop nephropathies Neuropathies Autosomal recessive Charcot-Marie-Tooth type 2B1 disorder (CMT2B1) LMNA (R298C) Reduced axon density; de myelinated axons; pelvic girdle weakness Autosomal dominant leukodystrophy (ADLD) LMNB1 duplication Progressive symmetrical widespread myelin loss in the CNS; cerebellar, pyramidal, and autonomic abnormalities Cerebellar Ataxia Nesprin 1 (R2609X, Q7640X) Late-onset cerebellar ataxia; dysarthria; dysmetria; occasional brisk lower-extremity tendon reflexes Progeroid Syndromes Hutchinson-Gilford pr ogeria syndrome (HGPS) LMNA (G608G, G608S, E145K) Symptoms of premature aging (alopecia, loss of subcutaneous fat, reduced bone density); death in second decade due to coronary artery disease or stroke Restrictive dermopathy (RD) LMNA (splicing mutation with loss of exon 11) ZMPSTE24 (frameshift with premature stop codon) Intrauterine growth retardation; tight skin with hyperkeratosis; dysplastic cl avicles; mineralization defects; multiple joint contractures, early neonatal death Atypical Werners syndrome (WS) LMNA (A57P, R133L, L140R) Premature aging beginning in the second decade; cataracts, sclerodermatous skin; premature atherosclerosis; ca ncer predisposition Skeletal Diseases Pelger-Hut anomaly (PHA) LBR (P119L, splicing mutations) Benign in heterozygotes w ith abnormal nuclear shape and chromatin organization in neutrophils; homozygotes can exhibit variable degrees of epilepsy, developmental delay and skeletal abnormalities Greenberg skeletal dysplasia (HEM) LBR (7 bp substitution resulting in premature stop) Lethal moth-eaten skeletal dysplasia; fetal hydrops; short limbs; abnormal chondro-osseous calcification Osteopoikilosis LEMD3 (loss-of-function mutation) spotted bones-circumscribe d sclerotic areas occuring near the ends of bones; spotty skin lesions

PAGE 47

47Table 1-3. Outer Nuclear Membrane Localized Proteins Name Cytosk mutation)eletal Interaction Proposed SUN Interaction Proposed nevi Function References C. elegans ANC-1 Actin UNC-84 Nuclear positioning and migration; mitrochrondrial positioning (Starr and Han, 2002; Starr and Han, 2003) UNC-83 Microtubules ? UNC-84 Nuclear positioning and migration (Lee et al., 2002; McGee et al., 2006; Starr et al., 2001) Zyg-12 Dynein/Centrosomes Matefin/Sun 1 Nuclear migration; centrosome/NE attachment (Gonczy, 2004; Malone et al., 2003; Penkner et al., 2007) D. melanogaster Klarsicht Dynein/Centrosomes Kl aroid Nuclear positioning in eye development; centrosome/NE attachment (Fischer et al., 2004; Kracklauer, 2007; Patterson et al., 2004) MSP-300 Actin CG18584 Nuclear positioning/anchorage (Starr and Han, 2003; Yu et al., 2006) Mammals Nesprin 1G ENAPTIN Actin Sun1/2? Nuclear anchorage; actin/NE tethering (Padmakumar et al., 2004) Nesprin 2G NUANCE Actin Sun1/2 Nuclear Anchorage; actin/NE tethering (Zhen et al., 2002) Nesprin 3 Plectin Sun1/2 IF/NE connection; sequestration of plectin (Ketema et al., 2007; Wilhelmsen et al., 2005) Nesprin 4 ? ? unknown

PAGE 48

48 CHAPTER 2 COUPLING OF THE NUCLEUS AND CYTOPL ASM: ROLE OF THE LINC COM PLEX Note Reproduced from The Journal of Cell Biology, 2006, 172: 41-53. Copyright 2006 The Rockefeller University Press. Abstract The nuclear envelope (NE) de fines the barrier between the nucleus and cytoplasm and features inner and outer membranes (INM and ONM) separated by a perinuclear space (PNS). The INM contains specific integral proteins that include Sun1 and Sun2. While the ONM is continuous with the ER, it is nevertheless enrich ed in several integral membrane proteins, including nesprin 2 Giant (Nes p2G), an 800kD protein featuri ng an N-terminal actin-binding domain. Recently Padmakumar et al. (2005, J. Cell Sci. 118:3419-30) have shown that localization of Nesp2G to the ONM is dependent upon an interaction with Sun1. Here we confirm and extend these results by demonstrating that both Sun1 and Sun2 contribute to Nesp2G localization. Co-depletion of both of these proteins in HeLa cells leads to loss of ONMassociated Nesp2G, as does overexpression of th e Sun1 lumenal domain. Either treatment results in expansion of the PNS. These data, together with those of Padmakumar et al. (2005) support a model in which Sun proteins tether nesprins in the ONM via interactions spanning the PNS. In this way, Sun proteins and nesp rins form a complex that li nks the n ucleoskeleton and c ytoskeleton (the LINC complex). Introduction The existence of distinct nuclear and cytoplasm ic compartments is dependent upon the presence of a selective barrier, th e nuclear envelope (NE). The NE consists of several structural elements (Burke and Stewart, 2002; Gruenbaum et al., 2005), the most prominent of which are

PAGE 49

49 the inner and outer nuclear me mbranes (INM and ONM respectively). In most cells, these two membranes are separated by a regular gap of ~50nm known as the peri nuclear space (PNS). Periodic annular junctions betw een the two membranes form a queous channels between the nucleus and the cytoplasm that accommodate nuclear pore complexes (NPCs), and which therefore permit the movement of macromolecules across the NE. In addition to its connections to the INM at the periphery of each NPC, the ONM also exhibits numerous continuities with the ER, to which it is functionally related. In this way, the INM, ONM and ER form a single continuous memb rane system. Similarly, the PNS represents a perinuclear extension of the ER lumen. The final major structural feature of the NE is the nuclear lamina. This is a relatively thin (~50nm) protein meshwork associated with the nuclear face of the INM. The major components of the lamina are the Aand B-type lamins (Ger ace et al., 1978). These are members of the larger intermediate filament (IF) family and like all IF proteins feature a centra l coiled-coil flanked by non helical head and tail domains (Gerace and Burke, 1988). The lamins are known to interact with components of the INM as we ll as with chromatin proteins. In this way the lamina provides anchoring sites at the nuclear peripher y for higher order chromatin domains. In mammalian somatic cells there are two majo r A-type lamins, lamins A and C, encoded by a single gene, Lmna (in mice). The B-type lamins, B1 and B2, are encoded by two separate genes (Hoeger et al., 1988; Hoeger et al., 1990; Lin and Worman, 1993; Lin and Worman, 1995). While B-type lamins are found in all cell types, expression of A-type lamins is developmentally regulated (Roeber et al., 1989; Stewart and Burk e, 1987). Typically, A-type lamins are found in most adult cell types, but are absent from those of early embryos. Mutations in the LMNA gene have been linked to a variety of human diseases (Burke and Stewart, 2002), many of which are

PAGE 50

50 associated with large-scale perturbations in nuclear organization. Th ese observations have reinforced the view that the lamina is an importa nt determinant of nuclear architecture and has an essential role in the maintenance of NE integrity. Despite their numerous connections, the IN M and ONM are biochemically distinct. Proteomic studies have revealed the existence of at least 50 integral memb rane proteins that are enriched in NEs. Many of these appear to reside within the INM (Schirme r et al., 2003). Proteins become localized to the INM via a process of selective retenti on (Ellenberg et al., 1997; Powell and Burke, 1990; Soullam and Worman, 1995). In th is scheme, membrane proteins synthesized on the peripheral ER or ONM may gain acce ss to the INM by lateral diffusion via the continuities at the periphery of each NPC, utilizi ng an energy dependent mechanism (Ohba et al., 2004). However, only those proteins that can interact with nucl ear or INM/lamina components are retained and concentrated. The recent identification of ONM-specific integral membrane proteins has raised some puzzling issues (Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). In particular, what prevents ONM proteins from simply driftin g off into the peripheral ER? This question was originally addressed in C. elegans where the localization of An c-1, a very large type II ONM protein involved in actin-depe ndent nuclear positioning, was s hown to be dependent upon Unc84, an INM protein (Starr and Han, 2002). Loca lization of Unc-84 itself was found to be dependent upon the single C. elegans lamin (Lee et al., 2002). Based upon these findings, Starr, Han, Gruenbaum and colleagues proposed a novel model in which Unc-84 and Anc-1 would interact across the PNS via thei r respective lumenal domains (L ee et al., 2002; Starr and Han, 2003). In this way, Unc-84 would act as a tether for Anc-1.

PAGE 51

51 In mammalian cells two giant (up to 1MDa) act in binding proteins have been identified (variously termed NUANCE, nesprin 2 Giant (Nesp2G), nesprin 1, enaptin, Syne 1, Syne 2, myne 1) as integral proteins of the ONM (Ape l et al., 2000; Mislow et al., 2002; Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). These belong to a ve ry large family of proteins encoded by the nesprin 1 and nesprin 2 genes (Zhang et al., 2001) and consist of a bewildering variety of alternatively spliced isoforms. The nesprins are related to Anc-1, as well as to a Drosophila ONM protein, Klarsicht (Mosley-Bishop et al., 1999; Welte et al., 1998), in the possession of a 60 amino acid C-terminal KASH domain (K larsicht, A nc-1, S yne H omology). This domain comprises a single transmembrane anc hor and a short segment of about 40 residues that resides within the PNS. One of the defining features of Unc-84 is a region of homology, consisting of about 200 amino acids, with Sad1p, an S. pombe protein th at is associated with the spindle pole body (Hagan and Yanagida, 1995). This region of homology is known as the SUN domain (for S ad1p, UN c-84) and is believed to extend into the PN S. Mammalian cells also contain several SUN domain proteins. At least one of these, Sun2 ha s been shown to be an INM protein with the appropriate topology in which the S UN domain is localized in the PN S (Hodzic et al., 2004). It is tempting to speculate, based upon the model of St arr and Han (2003), that SUN domain proteins function as tethers for ONM-associated nesprins in mammalian cells. Recently Padmakumar et al. (2005) have shown that localization of Nesp2G to the ONM is dependent upon an interaction with another mammalian SUN domain protein, Sun1. In this manuscript we provide evidence that Sun1 is insert ed into the INM in su ch a way that its SUN domain, like that of Sun2 faces the PNS. In this way we can conclusively demonstrate that Sun1 does indeed have the appropriate orientation, as assumed by Padmakumar et al (2005), for its C-

PAGE 52

52 terminal domain to interact with the Nesp2G KASH domain. The N-terminal region of both Sun1 and Sun2 face the nucleoplasm and interact w ith lamins. Surprisingly, our results indicate that Sun1 has a very strong preference for prelamin A. Sun1 is the only nuclear membrane protein described to date that exhibits such binding activity. This raises the distinct possibility that Sun1 may be involved in the targeting and assembly of newly synthesized lamin A. Finally we demonstrate that Sun1 and Sun2 share some degree of functional red undancy, and that both of these proteins cooperate in tethering Nesp2G in the ONM This tethering involves the establishment of molecular interactions that sp an the PNS and contributes to the remarkably regular spacing that is observed between the ONM and INM. Based upon our findings and upon those of Padmakumar et al. (2005) we are able to conclude that Sun1 and Sun2 function as key links in a molecular chain that connects the ac tin cytoskeleton, via giant nesprin proteins, to nuclear lamins and other components of the nuclear interior. We now refer to this assembly as the LINC complex (for LI nker of N ucleoskeleton and C ytoskeleton). Results We have previously shown that Sun2 is an in ner nuclear m embrane pr otein featuring an Nterminal nucleoplasmic domain and a significantly larger C-terminal domain that is localized within the PNS (Hodzic et al., 2004). This lumenal region of Sun2 contains a C-terminal SUN domain that is also found in C. elegans Unc-84. The SUN domain is found in at least two additional mammalian proteins (Figure 2-1A) Sun1 (Accession numb er: BC048156) and Sun3 (Accession number: BC026189). Sun1 transcripts are present in a variety of tissues and cell ty pes (Figure 2-1B). Comparison of Sun1 sequences in Genbank reveal that it exists in multiple alternatively spliced isoforms. This conclusion is supported by the north ern blot analysis, which reveals at least four or five discrete Sun1 transcripts in different tissues. We have not however, surveyed these tissues

PAGE 53

53 for Sun1 isoforms. Immunofluorescence experi ments employing a polyclonal antibody raised against recombinant human Sun1 suggests that like Sun2, Sun1 is localized largely if not exclusively to the nuclear envelo pe (Figure 2-1C). This is cons istent with the appearance of Sun1, as well as Sun2, in a proteomic screen for NE specific membrane proteins (Schirmer et al., 2003). To further address the issue of Sun1 localization we fused an HA epitope to the N-terminus of the largest isoform of m ouse Sun1. Following transfection in to HeLa cells, the exogenous protein was found by immunofluorescence microscopy to be enriched at the nuclear envelope (Figure 2-1D). At high expressi on levels, while still concentrat ed in the NE, HA-Sun1 began to appear in the peripheral ER (F igure 2-1D). Taken together, thes e observations confirm that Sun1 is a nuclear membrane protein. Similar e xperiments with HA-tagged Sun3, revealed a distribution that was more typical of an ER protein (data not s hown). Furthermore, northern blot analysis suggests that Sun3 is found primarily in testis (data not shown). Consequently, all of our subsequent experiments focused on Sun1 and Sun2. The primary structure of mouse Sun1 reveal s no N-terminal signal sequence. However, two distinct hydrophobic domains, H1 and H2, ar e present (Figure 2-2A ). H1 lies between residue 241-258 while the second and larger, H2, lies between re sidues 356-448. The presence of extended hydrophobic regions clearly raises ques tions concerning the to pology of Sun1 within the nuclear membranes. Earlier work on Sun2 has shown that the SUN domain resides within the PNS (Hodzic et al., 2004). Is this also th e case for Sun1? To address this, we used in vitro transcription/transl ation of Sun1 (tagged an untagged) bot h in the presence and absence of microsomes (Figure 2-2B). Digestion of Sun1 tr anslation products with proteinase K revealed the existence of a 65-70kD protected fragment in samples containing microsomes. Proteinase K

PAGE 54

54 digestion in the presence of Triton X-100 to pe rmeabilize the microsomal membranes resulted in the complete loss of the protected fragment. Give n the size of this protected fragment and the location of potential transmembrane domains, the most reasonable orie ntation for Sun1 would place its C-terminus, including its SUN domain, w ithin the microsome lumen. By extension the Sun domain should thus reside within the PNS in vivo This orientation is supported by additional experiments described below. In order to examine the roles of the two hydrophobic segments in Sun1 membrane anchoring, we took advantage of naturally occurring sp lice isoforms. Searches of Genbank reveal several mammalian Sun1 cDNAs lacking sequences within the N-terminal domain. Comparison with genomic sequences indicate that at least one splice isoform of Sun1 lacks exons 6 through 8, corresponding to a deletion of residues 222-343 (Figure 2-2C). Th is particular Sun1 isoform is missing the first hydrophobic segment, H1. When this isoform (Sun1 6-8) was tagged with HA and transfected into HeLa cells, its localization at the NE was f ound to be indistinguishable from full length Sun1 (Figure 2-2D ). Translation of Sun1 6-8 in vitro in the presence of microsomes revealed a protease resistant fragment identical in size with that derived from full length Sun1 (Figure 2-2C). This finding presents us with two conclusions. Firstly, it proves that the protected fragment must be derived from the C-terminal portion of the molecule. Secondly, if this first hydrophobic segment in Sun1 were to represent a transmembrane domain, then its removal should logically alter the topology of the subseque nt membrane spanning sequences of Sun1 (i.e. H2) within the ER or nuclear membranes. This mi ght potentially lead to the flipping of lumenal segments of newly synthesized S un1 to the cytoplasmic aspect of the ER membrane or failure to insert H2 sequences into the membrane. Evidently this does not happen in any detectable way. Our conclusion therefore is that given this first hydrophobic sequence in Sun1 is dispensable

PAGE 55

55 with respect to membrane insertion, it does not function as an obligate membrane spanning domain. Further secondary stru cture analyses of Sun1 usi ng HMMTOP (Tusnady and Simon, 2001) indicate that the larger hydrophobic segment, H2, is capable of spanning the ER/nuclear membranes three times. While this conformation for H2 still requires biochemical confirmation, it suggests that Sun1 is a multispanning protein in which the N-terminal domain faces the cytoplasm while the C-terminal domain (including the SUN domain) is localized to the lumenal space. To further examine Sun1 distribution and orientation in vivo we prepared a form of mouse Sun1 that was tagged with an HA epitope at the Nterminus and a Myc epitope at the C-terminus (HASun1Myc, Figure 2-3). These analys es took advantage of the fact that low concentrations of digitonin can be used to selectively permeabilize the plasma membrane of cells while leaving the nuclear membranes and ER intact (Adam et al ., 1990). For these experiments, HeLa cells expressing HASun1Myc were fixed with formaldehyde and then permeabilized on ice for 15min with 0.003% digitonin. The cells were then labeled with either rabbit anti-Myc or rabbit anti-HA. Following PBS washes to remove unbound antibodies the cells were refi xed, permeabilized with Triton X-100 and then further incubated with mouse antibodies against either HA or Myc. In this way, the first tag could be assayed for accessibility at the nuclear surf ace while the second tag could be used to define the localization and expression level of HASun1Myc. As shown in Figure 2-3 the Myc tag was never visible at the nuclear surfa ce (or at any other location) following digitonin permeabilization, regardless of the expressi on level of HASun1Myc. The HA tag was also undetectable at the nuclear surface following digitonin permeabilization of cells expressing low levels of HASun1Myc. At hi gh expression levels, however, the tag was detectable at the nuclear surface as well as asso ciated with a cytoplasmic reticular structure

PAGE 56

56 corresponding to the peripheral ER. Clearly ER-a ssociated Sun1 has its Nterminal domain, but not its C-terminal domain, exposed to the cy toplasm. Taken together, these findings are consistent with the view that Sun1 is a compone nt of the INM and that its C-terminal domain resides with the PNS. The data described above, as well as our pr eviously published work (Hodzic et al., 2004), indicate that the N-terminal domains of Sun1 and Sun2 are exposed to the nucleoplasm and consequently are accessible for interaction with nuclear components. Given the role that such interactions play in the appropriate targeting of inner nuclear membrane proteins, it is not surprising then that the lumena l domain of Sun1 is entirely di spensable with respect to Sun1 localization (Figure 2-4A). In this respect Sun1 mimics Sun2 (Hodzic et al., 2004). Additional experiments suggest that Sun1 and Sun2 share ov erlapping interactions. Overexpression of HASun1 in HeLa cells causes displacement of e ndogenous Sun2 from the NE (Figure 2-4B). The converse, however, is not the case (M. Crisp and B. Burke, data not shown). The implication is that Sun1 and Sun2 share a subset of interacti ons that are required for Sun2 localization. Sun1 retention, however, must be dependent upon additional binding partners. With what proteins might the Sun1and Sun2 nucleoplasmic domains in teract? Our initial thoughts were that the Sun proteins might associat e with lamina components. To address this, we first adopted an in vitro approach to determine whether Aan d B-type lamins could interact with the N-terminal domain of either protein. We prep ared a GST fusion protein containing the first 165 amino acids of the Sun2 sequence (Sun2 N165). This represents most of the Sun2 nucleoplasmic domain. A similar although slightly larger (the first 222 amino acids) fusion protein was also prepared using Sun1 sequen ces that encompassed the bulk of the nonalternatively spliced region of the nucleopl asmic domain (Sun1N222). This region of Sun1

PAGE 57

57 exhibits significant sequence similarity to the N-terminal domain of S un2 over a region of about 120 residues (Figure 2-4C), although Sun1 doe s display a unique 50 residue N-terminal extension. Both of these fusion proteins, as we ll as a GST control, were employed in pull down experiments using in vitro translated lamins as targets. Four lamin species were employed in these ex periments (Figure 2-4D); lamin B1 (LaB1), lamin C (LaC) full length lamin A (FL LaA) and ma ture lamin A. FL LaA contains a CaaX motif and should be farnesylated in the reticulocyte lysate (Vorburger et al., 1989). It does not, however undergo detectable C-terminal proteolysis since the microsome-free in vitro translation mix lacks the appropriate processing enzymes. The mature lamin A cDNA contains a premature stop codon at position 647. In this way it mimics processed (i.e. mature) lamin A. As shown in Figure 2-4D, GST-Sun2N165 bound all four lamin sp ecies, although the interaction with lamins B1 and C appeared barely more than the b ackground observed with GST alone. Similarly, GSTSun1N220 was also found to interact with all four lamin species. As was the case with Sun2N165, the interactions with lamins B1 and C were relatively weak. However, Sun1N220 showed a very strong preference for unproce ssed (FL-lamin A) versus mature lamin A. To determine whether these in vitro interactions might have any relevance in vivo we prepared HA tagged versions of both Sun1N 220 and Sun2N165. Upon introduction into HeLa cells both proteins accumulated within the nuc leoplasm (Figure 2-4E), although a significant cytoplasmic pool was always present. We also pr epared a form of lamin A (pre-LaA) containing a L647R mutation. This lamin A mutant is cl eavage resistant and th erefore retains its farnesylated C-terminal peptide. Co-transfection of HeLa cells with pre-LaA along with either HA-Sun1N220 or HA-Sun2N165 lead to a dramatic decline in the nucleoplasmic concentration of both Sun protein fragments coincident with re cruitment to the nuclear periphery. Lamin B1 on

PAGE 58

58 the other hand had no such effect. These results indicate that the S un proteins do indeed have the capacity to interact with lamin A in vivo To determine whether this inte raction with lamin A is requi red for Sun2 retention at the NE, we first performed immuno fluorescence experiments on fibrobl asts derived from both wild type and Lmna null mouse embryos (MEFs). While Sun2 was detected at the NE of all wild type cells, in the majority of Lmna null MEFs, Sun2 was dispersed throughout cytoplasmic membranes (Figure 2-5A). At first sight these re sults do indeed implicate A-type lamins in the appropriate localization of Sun2 within the INM. However, th ere is clearly a minority of Lmna null cells in which Sun2 is fully retained at th e NE (Figure 2-5A inset). Furthermore, loss of Sun2 from the INM is not reversed simply by in troducing lamin A and/or C by transfection into Lmna null MEFs (data not shown). Evidently, while A-type lamins could contribute to Sun2 localization they are not the only determinants. This suggestion is reinforced by experiments in HeLa cells where we eliminated A-type lamins by RNA interference. Following 48-72h of RNAi treatment lamin A/C was undetectable in many ce lls. However, the NE localization of Sun2 was barely affected (Figure 2-5C). In contrast to Sun2, we could find no ev idence whatsoever for any lamin dependent localization of Sun1. We took the approach of introducing HA-S un1 into both wild type and Lmna null MEFs. In either case, exogenous Sun1 was always found at the nuclear periphery (Figure 2-5B). Similarly, in HeLa cells depleted of A-type lamins by RNA interference, endogenous Sun1 always remained concentrated at the NE (Figure 2-5C). Regardless of A-type lamin content, we have never observed cells in which Sun1 is substantially mislocalized. Thus while Sun proteins demonstrably interact with A-type lamins, this interaction is not required for their localization in the INM.

PAGE 59

59 Studies in C. elegans have shown that the prototype SUN domain protein, Unc-84, is required for the appropriate local ization of Anc-1 in the ONM (L ee et al., 2002; Starr and Han, 2002). Giant nesprin family members are also kno wn to localize to the ONM (Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002) and like Anc-1 feature a C-terminal KASH domain. We therefore examined the role that ma mmalian SUN domain proteins might play in the localization of one of these nesprin proteins, Nesp2G (~800kD). To accomplish this we raised an antibody against the N-terminal actin-binding domain (ABD) of Nesp2G. The affinity purified anti body recognized a very large (>400kD) protein on western blots of HeLa cell lysates (Figure 26A). At longer exposure times lower molecular weight bands appeared, possibl y corresponding to smaller nesprin 2 isoforms (Zhang et al., 2001) or to degradation products. Immunof luorescence microscopy employing digitonin permeabilization revealed that the anti-Nesp2G antibody decorated the cytoplasmic surface of the NE (Figure 2-6B, Mock). Th is labeling pattern was abolishe d by RNAi treatment of cells using nesprin 2-specific SmartPool oligonucleo tides. Clearly our antibody recognizes a very large ONM-associated nesprin 2 isoform, almo st certainly Nesp2G. Permeabilization of nonRNAi-treated cells with Triton X-100 yielded additional intranuclear labeling (data not shown). This confirms previous studies suggesting that smaller nesprin 2 variants reside within the nucleus (Zhang et al., 2005). For all of our subs equent experiments we employed the digitonin permeabilization to ensure that we were looking ex clusively at Nesp2G that was localized in the ONM. To explore the roles of Sun1 and Sun2 in Nes p2G localization we first adopted an RNAibased approach. When we depleted HeLa cells of either Sun1 or Sun2 (Figure 2-6C, D) we could find little effect on the localizat ion of Nesp2G at the ONM (F igure 2-6C, E). However, co-

PAGE 60

60 depletion of Sun1 and Sun2 led to the elimina tion of Nesp2G from the ONM (Figure 2-6C, E). Quantitative analysis indicated an 80% reduction in the number of cells with detectable NEassociated Nesp2G following co-depletion of Sun1 and Sun2 versus mock RNAi treatment (Figure 2-6E). Ultrastructural an alyses revealed changes in NE morphology in cells co-depleted of both Sun proteins. Mocked treated cells di splayed the usual uniform spacing between the ONM and INM of ~50nm. In the double RNAi treated cells however, the ONM was clearly dilated with obvious expansion of the PNS to 100nm or more (Figure 2-6F). If SUN and KASH domain proteins form a molecular li nk across the PNS (Starr and Han, 2003) then it should be possible to use a dominant negative approach to break this linkage. In this strategy we used almost the entire lumenal domain of Sun1, tagged at its N-terminus with HA (HASun1L), which we introduced in soluble fo rm into the lumen of the ER and PNS (Figure 2-7A). To accomplish this we fused the signal sequence and signal peptidase cleavage site of human serum albumin onto the N-terminus of the HASun1L to yield SS-HASun1L. To prevent its secretion, we fused a KD EL tetrapeptide to the C-terminus of SS-HASun1L forming SSHASun1L-KDEL (Figure 2-7A). Synthe sis of this chimeric protein in vitro in the presence of microsomes yielded a protein product of the appropr iate size, which was re sistant to digestion by proteinase K (Figure 2-7B). Clearly the signal sequence dire cts HASun1L to the microsome lumen. The shift up in molecular weight of latent HASun1L-KDEL is likely due to N-linked glycosylation (Sun1 has two poten tial glycosylation sites in its lumenal domain). Upon transfection into HeLa cells HASun1L-KDEL was f ound to accumulate intracellularly within the peripheral ER and PNS. Examinati on of the distribution of Nesp2G in transfected cells revealed that it was completely eliminated from the ONM (Figure 2-7C). EM analysis of these cells exposed clear dilation of the ONM and expansion of the PNS (Figure 2-7D). This phenotype is

PAGE 61

61 indistinguishable from that associated with Sun1/2 co-depletion by RNA interference (Figure 26F). In experiments we took advantage of a cDNA en coding a chimeric protein in which GFP is fused to the N-terminus of the nesprin 2 KASH domain (Zhang et al., 2001). This fusion protein localizes to the NE with the GFP exposed to the cytoplasm/nucleoplasm. The KASH domain is integrated into the NE with its 40 residue Cterminal domain residing within the PNS. We prepared a HeLa cell line harboring GFP-KASH under the control of a tetracycline inducible promoter (HeLaTR GFP-KASH). In the absence of tetracycline, GFP-KASH is present at low levels and localizes exclusively to the NE (Figure 2-8A, -Tet). Following tetracycline induction, large amounts of GFP-KASH may be observed in both the NE a nd the peripheral ER (Figure 28A, +Tet). Introduction of SS-HASu n1-KDEL into these cells leads to the complete loss of NEassociated GFP-KASH. Indeed all of the GFP-KA SH, regardless of expression level, appears to be recruited into vesicular structures, potentially as a prelude to degradation (Figure 2-8B, top row, arrows). Conversely, when full length Sun1 is introduced into tetr acycline induced cells, it leads to the recruitment of GFP-KASH from th e peripheral ER to the NE (Figure 2-8B, middle and bottom row, arrows). This is exactly what one would predict if Sun proteins function as tethers for KASH domain protei ns. A similar effect was al so observed when HA-Sun2 was introduced into the tetracycline-induced cells (F igure 2-8C), with GFP-KASH recruited to and stabilized at the NE. Taken altogether, these resu lts can only be interpreted in terms of lumenal interactions between SUN domain and KASH domain proteins. Furt hermore, they suggest that both Sun1 and Sun2 can interact in vivo with the nesprin 2 KASH domain, consistent with our RNAi results indicating that both SUN domain proteins contribute to Nesp2G anchoring.

PAGE 62

62 To further define Sun1/2-KASH interactions we set out to identif y Sun-KASH complexes both in vivo and in vitro For the former we carried out im munoprecipitation analyses of Sun2. As shown in Figure 2-9B a high molecular we ight protein recognized by our antibody against Nesp2G was found to co-immunoprecipitate with Sun2 from HeLa cell lysates. As a complement to these experiments we synthe sized SS-HASun1-KDEL and GFP-KASH in vitro Interactions between these proteins were then analyzed by immunoprecipitation empl oying antibodies against GFP. As revealed in Figure 2-9A, only when the SUN and KASH domain proteins were cosynthesized in vitro in the presence of microsomes could we detect HASun1-KDEL in immunoprecipitates performed with the anti-GFP antibody. Taken together, all of these data provide strong evidence for the interaction, eith er direct or indire ct, between Sun1/2 and Nesp2G. Such an interaction spanning the PN S provides an obvious mechanism for the Sun1/2 dependent tethering of Nesp2G in the ONM. Discussion We have shown that Sun1 is an inner nucle ar m embrane protein with an N-terminal nucleoplasmic domain of about 350 amino acids and a larger C-terminal domain of ~500 amino acids, including the SUN domain, that resides in the PNS. In this way, the topology of Sun1 matches that of another INM protein Sun2 to which it is related. Based upon structural predictions it is likely that Sun1 possesses th ree closely spaced transmembrane domains between residues 356-448. A separate hydroph obic region, H1, that is situated closer to the N-terminus does not appear to function as a membrane anch or. This conclusion based upon the behavior of naturally occurring splice isofor ms that lack this hydrophobic se quence. A third mammalian Sun protein, Sun3, is also an integral membrane protein with a lume nal C-terminal SUN domain and a relatively small cytoplasmic N-terminal domain (M. Crisp and B. Burke unpublished

PAGE 63

63 observations). In this way Sun3 conforms to th e general topological or ganization of other SUN family members. The organization of the lumenal domains of Sun 1 and 2, bears some comment. The membrane proximal sequences of both proteins is predicted to form a coiled coil. The implication is that these proteins may form ho modimers. Given the number of residues within the Sun1 coiled-coil region this could potential ly project approximately 25-30nm into the PNS and would terminate in a pair of globular SUN do mains. The coiled-coil domain of Sun2 is of a similar size. In both cases, the overall conformati on of the Sun protein lumenal domain would be that of a flower on a stalk, which could potentially bridge the gap between the lumenal faces of the INM, and ONM. The exact mechanism by which Sun1 and Sun2 ar e localized to the INM has yet to be resolved, although it is likely to involve the type of selective retention that has been observed for other INM proteins. What is clear is that th e lumenal domain of both proteins is entirely dispensable for appropriate localization. This is exactly the reverse of what is observed for nesprin proteins (including Nesp2G) of th e ONM where the lumenal and transmembrane domains (comprising the KASH domain) are essentia l for their retention at the nuclear periphery (Zhang et al., 2001). On the nucleoplasmic side of the INM the S un1 and 2 N-terminal do mains contain regions of similarity within th e first ~200 amino acid residues. This common N-terminal region interacts, to a greater or lesser ex tent, with A-type lamins. In the case of Sun2 there is some evidence that A-type lamins might contribute to Sun2 localization in the INM. However, whether this requires a direct interaction with A-type lamins is less clear. Certainly concentration of Sun2 in the INM is A-type lamin independent in so me cells. Furthermore, even in Lmna null MEFs where Sun2 is

PAGE 64

64 mislocalized, mere re-introduction of A-type lamins fails to recruit Sun2 to the INM, at least within a period of ~24h (data not shown). It seems more likely to us that A-type lamins may have indirect effects on Sun2, perh aps by altering the accessibility of chromatin proteins with which Sun2 might interact. In the case of Sun1, there is no evidence that la mins play any role in its localization to the INM. However, Sun1 displays an extremely ro bust interaction with pre-lamina A. Newly synthesized lamin A undergoes extensive C-termin al processing (Sinensky et al., 1994). This involves farnesylation of the C-terminal CaaX (si ngle letter code, where C is cysteine, a is any amino acid with an aliphatic side chain and X is any amino acid) motif followed by endoproteolysis to remove the aaX residues and carboxy methylation of the farnesyl cysteine. Once incorporated into the nuclear lamina a second cleavage event afte r Y646 yields mature lamin A (Weber et al., 1989). This cleavage of pre-lamin A at Y646 abolishes any strong interaction with Sun1. Since pre-la min A exists only transiently in normal cells, it seems unlikely that its interaction with Sun1 could contribute to Sun1 localiza tion. In our opinion it is more likely that Sun1 might function in the organiza tion of newly synthesized lamin A within the nuclear lamina. This suggestion is currently under investigation. (Starr and Han, 2002), have shown that the C. elegans SUN domain protein, Unc-84, is required for the localization of Anc-1 in the ONM. They have proposed a model in which the lumenal domain of Unc-84, which itself is retain ed in the INM through interactions with the single C. elegans lamin, forms a complex with the lumenal KASH domain of Anc-1. In this way Unc-84 and Anc-1 would provide links in a molecu lar chain that spans the PNS and connects the actin cytoskeleton to the nuclear lamina. Sin ce similar SUN and KASH domain molecules are widely represented in the animal kingdom we a ttempted to determine whether the Unc-84/Anc-1

PAGE 65

65 paradigm was applicable in mammalian systems. We used a combination of RNA interference and a dominant negative form of Sun1 to test this model. We found th at both Sun1 and Sun2 contribute to the tetherin g of Nesp2G in the ONM. Elimination of either Sun protein by RNAi had little or no effect on Nesp2G localization in HeLa cells. Ho wever, co-depletion of Sun1 and Sun2 leads to loss of Nesp2G from the ONM. This was accompanied by separation of the ONM and INM leading to expansion of the PNS. The im plication here is that links between the Sun proteins in the INM and KASH pr oteins in the ONM help to maintain the remarkably regular spacing of the nuclear membranes. This view wa s reinforced by the findings that overexpression of a soluble form of the lumenal domain of Sun1 (SS-HASun1L-KDEL) induced essentially the same phenotype: loss of Nesp2G from the ONM and expansion of the PNS. In a complementary series of experiments, SS-HASun1L-KDEL expression was also found to lead to loss of GFP-KASH from the nuclear e nvelopes of HeLa cells. This effect can only be accounted for by perturbation of lumenal interactions. Conversely, overexpression of full length Sun1 (or Sun2) leads to the re cruitment of GFP-KASH to the NE. All of these results are predictable on the basis of SUN domain proteins func tioning as trans-lumenal tethers for KASH domain proteins. Our final experiments demonstrated th e existence of Sun/KASH complexes. Immunoprecipitates of Sun2 from HeLa extracts were found to contain Nesp2G. Similarly in vitro translation of SS-HASun1L -KDEL and GFP-KASH lead to the formation of HASun1LKDEL/GFP-KASH complexes provided that microsomes were present in the translation mix. While this manuscript was in preparation, Kara kesisoglou and colleague s published a study that demonstrated a similar interaction between SUN domain and KAS H domain proteins (Padmakumar et al., 2005). Their results suggest, however, that rath er than interacting with the

PAGE 66

66 SUN domain itself, the KASH domain actually bound to a region of the polypeptide chain that is proximal to the SUN domain. This region is present in our Sun1L based dominant negative mutant. All of our data suggests that it is the two Sun proteins that are the key to the appropriate localization of Nesp2G in the ONM. In contrast to previously published findings (Libotte et al., 2005), we could find no evidence of a role for A-type lamins. This is not surprising given that in our HeLa cells the localization of Sun1 and Sun2 appear relatively insensitive to A-type lamin expression (or depletion). Padmakumar and collea gues reached exactly the same conclusion with respect to Sun1 (Padmakumar et al., 2005). However, in Lmna null MEFs Sun2 is frequently lost from the NE. Given that expressi on levels of Sun1 appear to va ry somewhat between different tissues, it is conceivable that in at least some cells types Nesp2G locali zation to the ONM might be sensitive to A-type lamin expression. Taken together, our findings, and those of Noegal, Karakesisoglou and colleagues (Padmakumar et al., 2005) are en tirely consistent with the model proposed by (Starr and Han, 2003) in which SUN and KASH doma in proteins form a link acro ss the PNS (Figure 2-9C). In addition, in C. elegans a similar mechanism may well operate in the tethering of Zyg-12, a NE protein that is required for dynein-mediated cen trosome positioning (Malone et al., 2003). As well as tethering ONM proteins our data would suggest that SUN-KASH linkages further contribute to the structural integrity of the NE in maintaining the precise separation of the two nuclear membranes. Furthermore, given that th e giant nesprins are actin binding proteins the SUN-KASH links provide direct molecular connections between th e actin cytoskeleton and the nuclear interior. We now refer to this molecular chain as the LINC complex (LI nker of N ucleoskeleton and C ytoskeleton).

PAGE 67

67 Numerous studies have documented mechan ical coupling between the nucleus and the cytoplasm. Maniotis et al. (1997) used microneedle mediated deformation of the cytoplasm of cultured cells to demonstrate mechanical connecti ons between integrins, cytoskeletal filaments, and nucleoplasm. More recently Lammerding et al. (2004) were able to show that fibroblasts derived from Lmna null mouse embryos have impaired mechanically activated gene transcription. In related studies, Broers et al. (2004) have shown that these same cells exhibited reduced mechanical stiffness and perturbations in the organization of the cytoskeleton. The existence of the LINC complex provides a basis for these various observations in that it may integrate the nucleus into a prot ein matrix that includes the cyto skeleton, extracellular matrix and cell-cell adhesion complexes. This mechanical link not only provides structural continuity within and between cells, it also allows for a direct phys ical signaling pathway fr om the cell surface to the nucleus, potentially f acilitating rapid and regiona lized gene regulation. Materials and Methods Cell Culture HeLa cells and m ouse embryoni c fibroblasts (MEFs, both Lmna +/+ and Lmna -/-) (Sullivan et al., 1999) were maintained at 7.5% CO2 and 37 0C in DMEM (GIBCO BRL Gaithersberg, MD) plus 10% fetal bovi ne serum ( Hyclone, Logan UT), 10% penicillin/streptomycin (GIBCO BRL) and 2mM glutamine Antibodies The following antibodies were used in this study. The m onoclonal an tibody against lamins A and C (XB10) has been described previ ously (Raharjo et al., 2001). The monoclonal antibodies 9E10 and 12CA5 against the Myc and HA epitope tags were obtained from the ATCC and Covance (Berkeley CA) respectively. Rabbit antibodies against the same epitopes were obtained from AbCam (Cambridge UK). Rabbit antibodies against Sun1 and Sun2 were raised

PAGE 68

68 against GST fusion proteins as previously desc ribed (Hodzic et al., 2004). The chicken antibody against the actin binding domain (ABD) of nesp rin 2 Giant was raised against an ABD-GST fusion protein by Aves Labs Inc (Tigard, OR). Affinity purification of the IgY was carried out in two stages. In the first step an affinity co lumn was prepared cons isting of glutathione-Stransferase (GST) cross-linked to glutathione agarose (Sigma, St. Louis MO) using 40mM dimethyl pimelimidate in 0.2M borate buffer pH9.0 for 1h at 4 C. 5ml IgY solution was passed over this column (1ml bed volume) and the flow through collected. This flow through was applied to a second 1ml column prepared from ABD-GST, also crosslinked to glutathione agarose. Antibody bound to the column was eluted at pH2.8 in 0.2M glycine HCl. The antibody eluate was neutralized with 3M Tris pH8.8 and stored at 4 C with 1mM sodium azide. Secondary antibodies, conjugated with Alexa dyes, were fr om Molecular Probes (Eugene OR). Peroxidase conjugated secondary antibodies were obtained from Biosource International (Camarillo CA) Immunofluorescence Microscopy Cells were grown on glass coverslips and fi xed in 3% form aldehyde (prepared in PBS from paraformaldhyde powder) for 10 min follo wed by a 5min permeabilization with 0.2%TX100. The cells were then labeled with the appropriat e antibodies plus the DNA-specific Hchst dye 33258. For experiments involving selective perm eabilization, the cells were first fixed in 3% formaldehyde. This was followed by permeabiliza tion in 0.003% digitonin in PBS on ice for 15min (Adam et al., 1990). The cells were then labeled with appropriate primary and secondary antibodies. For certain double label experi ments, a single primary antibody was applied following the digitonin permeabilization. Afte r removal of unbound antibody with three PBS washes, the cells were refixed for 5min (in 3% formaldehyde) and subjected to a further permeabilization step in 0.2% Triton X-100. The second primary antibody was then applied, followed by appropriate secondary antibodies. Specimens were observed using a Leica DMRB

PAGE 69

69 microscope. Images were collected using a Phot ometrics CoolSnap HQ CDC camera linked to an Apple Macintosh G4 computer running IP Lab Spectrum software (Scanalytics Inc. Fairfax, VA). Electron Microscopy Cells grown in 35mm petri dishes were fixed in 3% glutaraldehyde and 0.2% tannic acid in 200 m M sodium cacodylate buffer for 1 hour at room temperature. Postfixation was in 2% OsO4 for 20 min. The cells were dehydrated in ethanol, lifted from the culture dish using propylene oxide, and then infiltrated with Polybed 812 resin. Polymerization was carried out at 600 C for 24 hr. Silver-gray sections were cut using a Leica ultramicrotome equipped with a diamond knife. The sections were stained with ur anyl acetate and lead citrate and examined in a Hitachi electron microscope. siRNA Methods HeLa cells were depleted of Sun1, Sun2, nesprin 2 and lam ins using appropriate SmartPool oligonucleotide duplexes (Dharmacon Lafayette CO). Cells were exposed to each siRNA in the presence of Oligofectamine (Invitrogen, Carlsbad CA) precisely as recommended by the manufacturer. Cells were subjected to si RNA treatment for periods up to four days However, most of our analyses were car ried out following 2-3 day treatments. Immunoblotting and Gel Electrophoresis Cells (siRNAor m ock-treated) grown in 35mm tissue culture dishes were washed once in PBS and then lysed in a buffer containing 50mM Tris.HCl pH 7.4, 500mM NaCl, 0.5% Triton X-100, 1mM DTT, 1mM PMSF and 1:1000 CLAP (10mg/ml in DMSO of each of the following, chymostatin, leupeptin, antipain and pepstatin, CLAP ). The lysate was centrifuged for 5min in an Eppendorf centrifuge at 4 C. Proteins in the supernatant we re precipitated by the addition of trichloroacetic acid (TCA) to a final concentr ation of 10%. The precipitate was washed with

PAGE 70

70 ethanol/ether and then solubilized in SDS-PAGE sample bu ffer. Protein samples were fractionated on polyacrylamide ge ls (7.5%, 10%, or 4-15% gradie nt, as appropria te) (Laemmli, 1970) and then transferred onto ni trocellulose filters, usually BA85 from Schleicher and Schuell (Keene, NH), employing a semi-dry blotting ap paratus manufactured by Hoeffer Scientific Instruments Inc. (San Francisco CA). Filters we re blocked, labeled with primary antibodies and peroxidase conjugated secondary antibodies exactly as previous ly described (Burnette, 1981). Blots were developed using ECL (Amersham Biosciences, Piscataway NJ) and exposed to XOMAT film (Kodak Inc., Rochester NY) for appropriate periods of time. Immunoprecipitations For Sun2/Nesp2G co-immunoprecipitations, th ree subconfluent 35mm dishes of HeLa cells were each extracted with 1ml each of PBS containing 0.1% Triton X-100, 1:1000 CLAP, 2.5mM sodium pyrophosphate, 1mM b-glycerophosphate and 1mM sodium vanadate. The dishes were rocked at 4 C for 15 min and then the cell lysates centrifuged for 10min at maximum speed and at 4 C in a microcentrifuge. The pellets were then extracted in a tota l volume of 3ml RIPA buffer for 15min also at 4 C. Following centrifugation at 4 C for 10min the supernatants were pooled and then divided into 500l aliquots. Ea ch aliquot was then incubated for 14h at 4 C with appropriate combinations of immune and pre-i mmune sera and protein A-Sepharose beads. At the end of this period the beads were collected by brief centrifugation, washed three times in PBS containing 0.1% Triton X-100 and once in PBS alone. Finally the beads were suspended in SDS-PAGE sample buffer, heated to 95 C for 5min and then analyzed by SDS-PAGE and western blot. All other immunoprecipitations were carried out in TNX (50mM Tris.HCl, pH7.4, 100mM NaCl and 0.5% Triton X-100) containing 1:1000 CLAP. Incubation with antibodies and protein A-Sepharose beads was for 1h at 4 C with continuous gentle mixi ng. At the end of this period

PAGE 71

71 the beads were collected by brief centrifugation, washed three times in TNX and once in 50mM Tris.HCl, pH7.4. Finally the beads were pro cessed for electrophoresis as described above. In vitro Translations In vitro translations were carried out in 25l reaction volum es employing the T7 TNT coupled transcription translation system (Promega Inc., Madison WI). Each translation reaction contained 20l of TNT master mix and was programmed with 1l plasmid DNA at a concentration of 0.1g/l. Labeling of transl ation products was accomplished by inclusion of 10Ci 35S Translabel (MP Biolabs, Irvine CA). Where appropriate, up to 3l of canine pancreatic microsomes (Promega) was also included in each reaction. Tran slation reactions were assembled on ice prior to incubation at 30 C for 90min. At the end of this period, translation mixes were further processed for in vitro binding studies (below) or were subjected to digestion with proteinase K in order to define Sun prot ein topology. Proteinase K di gestions were carried out on ice for periods of up to 1h. Each digestion mix (10l tota l volume) contained 5l of the complete in vitro translation reac tion, 1l of proteinase K (from a 1mg/ml stock so lution), 1l of 10X compensation buffer (containing 0.5M sucr ose, 50mM Tris.HCl pH7.6, 200mM potassium acetate) and where appropriate, 1l of a 10% so lution of Triton X-100. Termination of digestion was accomplished by the addition 100l of 10% tr ichloroacetic acid (TCA) to precipitate the proteins. Precipitates were wash ed in ethanol/ether, air dried a nd then dissolved in 25l of SDSPAGE sample buffer by incubation at 37 C. Plasmids A m ouse Sun1 cDNA (IMAGE clone ID: 5321879) was obtained from Invitrogen Inc. (Carlsbad, CA). To generate Sun1 tagged at th e N-terminus with an HA epitope, Sun1 cDNA flanked by 5Sal1 and 3Afl2 restriction sites was amplified by PCR using primers 5GAACGTCGACTTTTCTCGGCTGCA CACGTACACC-3 and 5-

PAGE 72

72 CTGGCTTAAGCTACTGGATGGGCTCT CCG-3. The PCR product was digested with Sal1 and Afl2 and inserted downstream of an HA tag sequence in the vector pCDNA3.1(-). This vector was prepared from pcDNA3.1(-) containing HA-lamin A (Raharjo et al., 2001) by digestion with Xho1 and Afl2. The resulting plasmid was pcDNA3.1(-)HASun1. pcDNA3.1(-)HASun1 was used as a template for generating further Sun1 constructs. The Sun1 splice isoform 6-8 was created by inverse PCR using primers 5CGTGGTTTGAGAGTCCTGTCTCTGG-3 and 5GACCTCTTGGTTCAAGCACTGCGAAGG-3 to amplif y the entire plasmid outside of the deleted region. The PCR product wa s digested with the Klenow fragment of DNA polymerase and then circularized by ligation. A double epitope tagged Sun1 constuct, HASun1myc, was made by PCR using primers (5-GCATCTGAAGACCAGCTGAG-3 and TAAACTTAAGCTAGAGATCCTCTTCTGA GATGAGTTTTTGTTCCTCAGCCTGGATGG GCTCTCCGTGGACTCG-3 to insert a 3 myc ta g followed by an AflII restriction site. The fragment was then cloned back into the Hind III/AflII site of the original template. In order to prepare a form of EG FP-KASH that could be translated in vitro, the BamHI/Nhe1 digested fragment of pEGFP-KASH, was subcloned into the BamHI/Nhe1 site of pCDNA3.1(-) to yield pcDNA3.1EGFP-KASH. EGFP-KASH was al so inserted in to the tetracycline-inducible expression vector pc DNA4TO. This was accomplished by amplifying EGFP-KASH by PCR using the primers 5TAAACTTAAGCACCATGGTGAGCAA GGGCGAGGAGC-3 and 5TAAAGCGGCCGCCTATGT GGGGGGTGGCCCATTGGTGTA CC-3. The 1003bp product was cut with Afl2 and Not1 and then ligated into similarly cut pcDNA4TO.

PAGE 73

73 The soluble Sun1 lumenal domain construct, SS-HASun1L-KDEL, that was targeted to the ER and PNS, was prepared in three stages. The first step involved ligation of a double stranded oligonucleotide encoding the entire N-terminal signal sequence of human serum albumin, was ligated in to pcDNA3.1(-) between Nhe1 and Ap a1 sites to yield pcDNA3.1SS. In the second intermediate step, the 5end of HA-lamin A was amplified by PCR using the pair of primers 5AATTGGGCCCGCTTACCCTTACGATGTACCG-3 and 5ATATCTTAAGCAGCGCAT CCGCCAGCCGGCTC-3. The 787bp PCR product was ligated downstream of the signal sequence in pcDNA3.1SS between the Apa1 and Afl2 sites to yield pcDNA3.1SS-HALaA5. For the final step, the lami n A sequences were ex cised using Xho1 and Afl2. To prepare the Sun1 lumenal domain sequence incorporating a KDEL motif, PCR was carried out using mouse Sun1 cDNA as template and using the primers 5AGAGGGTCGACGATTCCAAGGGCATGCATAG-3 and 5CTGGCTTAAGCTACAACTCATCTTTCTGGATGGGC TCTCCGTGGAC-3. The resultant 1403bp product was cut with Sal1 and Afl2 and then ligated into the Xho1/Afl2 cut vector. The resulting plasmid was pcDNA3.1SS-HASun1L-KDEL. All enzymes were obtained from New England Biolabs (Ipswich MA) Transfections Plasm ids were introduced into HeLa cells us ing the Polyfect reagent as described by the manufacturer (Qiagen, Valencia CA). Transfections were normally carried out in 6-well plates. Briefly, 1.5g plasmid DNA were combined wi th 100l of serum free medium and 12l Polyfect. After a 10min room temperature incuba tion this mixture was co mbined with 600l of complete medium. The entire volume was then pl aced on the cells with an additional 1.5ml of complete medium. The cells were then returned to the tissue culture incu bator 12-24h. At the end of this period the cells we re processed as appropriate.

PAGE 74

74 Preparation of Glutathione S -transferase Fu sion Proteins GST-Sun1 and Sun2 fusion proteins were prepared using the plasmids pGEX4T3Sun1N220 and pGEX-4T3Sun2NP. These plasmids were created by amplifying 5 sequences of Sun1 and Sun2 by PCR. The S un1 PCR product encoded the fi rst 222 amino acids of the Nterminal domain while the Sun2 sequences enco ded the bulk of N-terminal domain of 165 amino acids. These PCR products were inserted into pGEX4T3 (Amersham Biosciences, Piscataway NJ) between BamHI and EcoRI sites. The primers used for Sun1 were 5CGCGGATCCGACTTTTCTCGGCTGCAC-3 5CCGGAATTCTTAGCGTGGTTTGAG AGTCCT-3, while the Sun2 pr imer pair consisted of 5-CGCGGATCCTCCCCGAAGAAGCCAGCGCCTCACG-3 and 5CCGGAATTCTTAGGAGCCCGCCCGTG AGACGGC-3. A single colony of Bl-21 cells transformed with either plasmid was grown overnight in 10ml LB containing 100g/ml Ampicillin and induced with 0.1m M IPTG (isopropyl -D-thiogalac topyranoside) for 4 hours at 37 C. The cells were harvested by 15min centrifugation at 4 C and at 3200 x g in an Eppendorf table top centrifuge. The bacterial pellets were resuspended by trit uration in 1ml of a lysis buffer consisting of STE (150mM NaCl, 10mM Tris pH8.0, 1mM EDTA) containing 5mM DTT and 0.25% sarkosyl (N-laurylsarcosine). The suspension was sonicated to achieve maximum cell breakage and then centrifuged at maximum sp eed in microcentrifuge for 10 min at 4 C. The supernatant was then transferred to a fresh microcentrifuge tube containing 30l of a 50% suspension, in PBS, of swollen gl utathione agarose beads. The clea red bacterial ly sate and beads were then incubated with continuous mixing at 4 C for 1 hour. At the end of this period the beads were washed 3-5 times with ice-cold STE and then twice with ice-cold Binding Buffer (50mM Tris pH 7.4, 100mM NaCl, 0.1% TritonX-100, 1mM DTT).

PAGE 75

75 In vitro Pulldow n with GST Fusion Proteins 1.5g of plasmid DNA (pcDNA3.1HA-lamin A, -m ature lamin A, -lamin B1, -lamin C) were each included in 25l of TNT coupled tr anscription/translation mixes containing 10Ci 35S Trans Label and incubated at 30 C for 90 min. 1ul of each reaction was retained for the analysis of total translation products while the remainder was incubated with 10ul of GST-agarose beads in 600l Binding Buffer (containing 10g/ml of chymostatin, leupeptin, antipain, pepstatin and 1mM PMSF) for 30 min at room temperature with constant mixing. After a low speed centrifugation at 800g, the supernatan t was split into 3 tubes cont aining 5ul GST-agarose beads, GST-Sun1N220-beads or GST-Sun2NP-beads. The suspensions were then incubated for 45min at room temperature with consta nt mixing. Finally the beads were 3-5 times with Binding Buffer containing 1mM DTT. After the final wash the Binding Buffer was replaced with 20l of SDSPAGE sample buffer. The samples were subsequently fractionated by SDS-PAGE. The gels were stained with Coomassie blue R-250, impregnated with Amplify (Amersham Biosciences, Piscataway NJ), dried and exposed to Kodak X-OMAT film. Northern Blot Analysis Double stranded DNA p robes consisting of the 5 (650bp) and 3 (860bp) fragments of mSun1 and the full length human Sun3 (1050bp) we re generated by PCR. Incorporation of 32PdCTP into the PCR products was accomplished by random priming using the Rediprime II Random Primer Labeling System (Amersham Bios ciences, Piscataway NJ) using 15ng (in 45l TE buffer) denatured DNA. A mouse multiple tissu e northern blot (BLOT-2, Sigma) containing 2 ug of polyA+ (per lane) RNA isolated from 10 different mouse organs (brain, heart, liver, kidney, spleen, testis, lung, thymus, placenta and sk eletal muscle tissues of BALB/c mice) was hybridized independently with each of th e prepared probes, including one against glyceraldehyde-3-phosphate dehydrogenase (1.4ng/ml in 6ml PerfectHyb Plus hybridization

PAGE 76

76 buffer) for 17 hours (Sigma, St Louis MO). Between each hybridization, the blot was stripped of the probe according to manufacturers instructions.

PAGE 77

77 Figure 2-1. Sun1 is a ubiquitously expressed NE protein featuring a conserved COOH-terminal SUN domain. (A) ClustalW alignment of the COOH-terminal region of human Sun1 3 and C. elegans Unc-84 reveals the ho mology of the SUN domains. (B) Northern blot analysis of mRNA from multiple mouse ti ssues illustrates widespread expression of Sun1. A GAPDH probe was used as a loadi ng control. (C) The NE localizations of Sun1 and 2 were determined by immunofluorescence microscopy using rabbit antibodies raised against recombinant Sun proteins. (D, left) HeLa cells transiently transfected with HA-tagged Sun1 confirm the predominant NE localization. HA-Sun1 was detected using an anti-HA monoclona l antibody. (D, right) Upon overexpression, HA-Sun1 is also detected in the ER. In each case, Sun protein localization is shown in red, whereas DNA, visualized using Hchst dye 33258, appears in blue.

PAGE 78

78 Figure 2-2. Sun1 is a transmembrane protein with a lumenal COOH-terminal domain. (A) Hydropathy plot (Sweet and Eisenberg, 1983) of Sun1 reveals two hydrophobic domains (H1 and H2) upstream of the COOH-terminal coiled-coil and SUN domain. (B) When translated in vitro either in the presence or absence of microsomes, HAtagged mouse Sun1, labeled with [35S]methionine/cysteine, ap pears as a 100-kD band, as revealed by SDS-PAGE. S ubsequent proteinase K dige stion of HA-Sun1 that had been translated in the presence of mi crosomes lead within 30 min to the quantitative loss of the full-length HA-Sun1 and the appearance of a 65kD protected fragment (arrowhead). Inclusion of Triton X-100 in the digest to permeabilize the microsomes leads to the complete degradation of HA-Sun1 within 60 min. (C) An alternatively spliced isoform of Sun1 ( 6) lacks the first hydrophobic domain (H1). When translated in vitro in either the presence or absence of microsomes, HA-Sun1 6 appears as a band that is predictably smaller than the full-length protein. However, both full-length HA-Sun1 and HA-Sun1 6 that were translated in the presence of microsomes a nd subjected to digestion with proteinase K yield identically sized protected fragment s (arrowhead). Inclusion of Triton X-100 in the digestion reaction resu lts in degradation of both proteins. (D) Immunofluorescence microscopy of HeLa cells transfected with HA-Sun1 6 reveals that the exogenous protein is localized at the NE. In this respect, HA-Sun1 6 is indistinguishable from full-length HA-Sun1. HA-Sun1 6 is detected with an antiHA monoclonal antibody. The corresponding field labeled with Hchst dye to reveal cell nuclei is also shown.

PAGE 79

79 Figure 2-3 The SUN domain of Sun1 is located within the PNS, whereas the NH2-terminal domain is exposed to the nucleoplasm. To examine the orientation of Sun1, HA and myc epitope tags were placed at the NH2 and COOH termini, respectively. HeLa cells were transfected with the double-tagged construct and processed for immunofluorescence microscopy after 24 h. After fixation, the cells were permeabilized with 0.003% digitonin and inc ubated with an anti-epitope tag antibody (mouse monoclonal). Subsequently, the cells were refixed and permeabilized with Triton X-100 to expose the lumenal comp artment to a second anti-epitope tag antibody (rabbit polyclonal). Neither epitope tag was significantly detectable after digitonin permeabilization in HeLa cells expressing low to moderate levels of HASun1myc. After Triton X-100 permeabiliz ation, both myc and HA were readily detected at the NE. In HeLa cells with elevated expression of HA-Sun1myc, the HA but not myc epitope tag was detected at the ER after digitonin permeabilization. Both myc and HA tags were identifiable afte r treatment with Triton X-100. These data indicate that the NH2and COOH-terminal domains of Sun1 reside on opposite sides of the INM, with the COOH-terminal domain located in the PNS.

PAGE 80

80 Figure 2-4. Interactions between the nucleoplasmi c domains of Sun1 and 2 with A-type lamins. (A) An HA-Sun1 L construct lacking the SUN domain and most of the lumenal coiled coil localizes to the NE in a manner similar to the full-length protein. Anti-HA labeling is in red, whereas DNA, visualiz ed with Hchst dye, is in blue. (B) Overexpression of HA-Sun1 leads to the loss of endogenous Sun2 in HeLa cells, suggesting that these two proteins share common binding partners. (C) A ClustalW alignment of the NH2-terminal sequences of mouse Sun1 and 2 identifies multiple clusters of homologous amino acids within a region of 120 residues. Sun1 exhibits a unique NH2-terminal extension of 50 amino acid residues. (D) The first 222 residues of Sun1 or the fi rst 165 residues of Sun2 (this represents the entire nucleoplasmic domain of the latter) were fused to GST and, with GST alone (Coomassie stain, bottom), we re used to pull down 35S-labeled, in vitro translated lamins B1, C, mature A, and full-lengt h (FL) A (Total). Unlike GST alone, Sun1N220 and Sun2N165 pulled down lamins B 1, C, and mature A at similar levels. However, Sun1N222 displayed a higher affi nity for FL LaA than did Sun2N165. Evidently, Sun1 has a very strong preferen ce for full-length (or pre) lamin A over mature lamin A (or full-length lamins C and B1). (E) An HA tag was inserted at the NH2 terminus of the same nucleoplasmic se gments of both Sun1 and 2 (as described in D), and the tagged proteins were expre ssed in HeLa cells. Both of these exogenous proteins appear enriched in the nucleoplasm (top). As observed by deconvolution microscopy, cotransfection of the myc-tagg ed full-length lamin A (green) with HASun1N222 or HA-Sun2N165 (red) resulted in the recruitment of both HA-Sun proteins to the NE (middle). Myclamin B 1, in contrast, fails to produce such an effect. Evidently, the nucleoplasmic domains of Sun1 and 2 can interact with lamin A in vivo

PAGE 81

81 Figure 2-5. A-type lamin independe nt retention of SUN domain proteins at the NE. (A) Endogenous Sun2 is frequently, but not always (inset), lost from the NE in Lmna-null MEFs. In wild-type MEFs, Sun2 is always found at the NE. (B) When HA-Sun1 was introduced by transfection into either w ild-type or Lmna-null MEFs, it was always found to localize appropriately to the NE. (C) Depletion of HeLa cells of A-type lamins by RNAi had no significant effect on endogenous Sun1 or 2 localization. In the merged images, Sun protein localization is shown in red, A-type lamin localization (lamin A/C) is shown in gree n, and nuclei are rev ealed in blue using Hchst dye. The inference is that A-type la mins have, at best, a limited role in the retention of Sun2 at the NE and no significant role at a ll in the retention of Sun1.

PAGE 82

82 Figure 2-6. Retention of Nesp2G at the ONM requires the expression of SUN domain proteins. (A) Western blot of a HeLa lysate fracti onated by SDSPAGE and probed with an affinity-purified antibody raised against the ABD of human Nesp2G identifies a very large (400 kD) protein. (B) Immunofl uorescence microscopy of digitoninpermeabilized HeLa cells using the an ti-ABD antibody reveals labeling of the cytoplasmic face of the NE. Depletion of nesp rin 2 (all splice isoforms) in HeLa cells by RNAi leads to a loss of ONM labeling in the majority of cells (bottom). These data are consistent with the r ecognition of Nesp2G by the anti-ABD antibody. (C) The reduction of either Sun1 or 2 levels by R NAi had only a marginal effect on Nesp2G localization. However, the combined deplet ion of both Sun1 and 2 induced a dramatic loss of Nesp2G from the ONM (arrowheads). Overall, we observed an 80% decline in the number of cells exhibiting NE-associa ted Nesp2G (E). In total, 100 cells were scored for each category in three sepa rate experiments. Error bars represent SEM. (D) Western blot analysis reveals that both Sun1 and 2 RNAi treatments lead to a substantial decline in Sun1 and 2 protein levels. The same blots were probed with an anti-actin antibody to c onfirm equal loading. (F) Thin section EM of cells subjected to the double (Sun1 and 2) RNAi tr eatment revealed frequent expansion of the PNS and increased separation of the IN M and ONM (arrowheads). No such effect was observed in mock-treated cells. The nuc lear interior (N) a nd cytoplasm (Cy) is indicated in each panel.

PAGE 83

83 Figure 2-7. A soluble form of the Sun1 lumenal domain causes a loss of nesp2G from the ONM. (A) A signal sequence (SS), HA tag, a nd KDEL motif were added to the NH2 and COOH termini, respectively, of the Sun1 lumenal domain (SSHA-Sun1LKDEL). (B) SSHA-Sun1LKDEL, when translated in vitro in the presence of microsomes, is completely resistant to digestion by proteina se K. If Triton X-100 is included in the digestion reaction to permeabilize the microsomes, the 50kD SSHA-Sun1LKDEL translation product (arrow) is completely degraded. These data de monstrate that the signal sequence is fully functional in di recting HA-Sun1LKDEL to the microsomal lumen. (C) When introduced by transfec tion into HeLa cells, the SSHA-Sun1L KDEL localizes both to the peripheral ER and to the PNS, which is revealed by immunolabeling with an anti-HA mo noclonal antibody. Cells expressing SSHASun1L-KDEL (red in merged images) exhib it a very obvious loss of Nesp2G (green in merged images) from the ONM. (D) Thin section EM of HeLa cells expressing SSHA-Sun1LKDEL (Transf.) revealed increased separation between the INM and ONM and expansion of the PNS (arrowheads). This effect was not observed in nontransfected cells (NT). The effect s of SSHA-Sun1LKDEL expression were identical to those observed after codepl etion of Sun1 and 2 by RNAi (Fig. 6).

PAGE 84

84 Figure 2-8. The nesp2G KASH do main interacts with the Sun1 lumenal domain. (A) Fluorescence microscopy of HeLa cells expressing a tetracycline-inducible GFPKASH fusion protein (HeLaTR GFP-KASH). In the absence of tetracycline (Tet), GFP-KASH is expressed at lo w levels and is localized exclusively to the NE. After induction with tetracycline for 24 h ( +Tet), GFP-KASH is found throughout the peripheral ER as well as the NE. Expressi on levels of GFP-KA SH within the cell population are extremely uniform both before and after induction. (B) Transfection of SSHA-Sun1KDEL into the HeLaTR GFP-KASH cells after tetracycline induction resulted in the complete loss of GFP-KASH from the NE. This was accompanied by the formation of cytoplasmic aggregates (arrows, top). Conversely, introduction of full-length HA-Sun1 into these cells resulted in the recruitment of GFP-KASH to the NE (arrows, middle and bottom). (C) HA-Sun2 was found to have a similar effect (arrows). In the merged images in B and C, GFP-KASH is presented in green, whereas HA-Sun is shown in red.

PAGE 85

85 Figure 2-9. Identification of an in vitro inte raction between KASH and SUN domains. (A) GFPKASH, SSHA-Sun1KDEL, or bot h proteins was translated in reticulocyte lysate containing [35S]methionine/cysteine in either the presence or absence of microsomes (Totals). Anti-GFP immunoprecipitation of a fraction of each sample revealed the pull-down of SSHA-Sun1KDEL by GFPKASH when both proteins were cotranslated in the presence of microsomes (arrow). A slightly faster migrating band (asterisk) was detected in the absence of microsomes. However, th is band originates in the GFP-KASH translation and is unr elated to HA-Sun1LKDEL. Molecular masses are indicated in kD (B) Immunoprecipitation of HeLa cell lysates with antiSun2 antibodies coprecipitates a very la rge anti-Nesp2G immunoreactive protein (arrow). HC indicates the position of immunoglobulin heavy chains. These data suggest a significant interaction between KASH and Sun proteins that must involve their lumenal domains. These findings allo w us to propose a model for the LINC complex (C) in which nuclear components including lamins, bind to the INM SUN domain proteins. They, in turn, bind to the KASH domain of the actin-associated giant nesprins on the ONM. Thus, the LINC complex establishes a physical connection between the nucleoske leton and the cytoskeleton..

PAGE 86

86 CHAPTER 3 NESPRIN 4: A NOVEL EPITHELIAL SPECIFIC MEMBER OF THE NESPRIN FAMILY OF PROTEINS Abstract The nuclear envelope (NE) de lin eates the cell nucleus and serves as a barrier between nuclear and cytoplasmic components. It consists of a pair of membranes, the inner and outer nuclear membranes, separated by a thin lumen. The outer nuclear membrane (ONM) is known to accommodate three related members of the nesprin ( nuclear envelope spectr in repeat) family of proteins. These proteins are ubi quitously expressed and interact with cytoskeletal components through their NH2-terminal domains. Nesprins 1 and 2 connect to the actin cytoskeleton through their actin-binding domains and nesprin 3 contains a plectin-binding domain that links it to the intermediate filament system. We have now identified a fourth ONM localized nesprin family member, which we call nesprin 4. This 42kD protei n is unique in its sp ecific expression in secretory epithelial cells and preferential binding to the mi crotubule motor protein, kinesin I. Nesprin 4 is noticeably upregulat ed when the HC11 mammary epithe lial cell line is induced to differentiate in culture. When expressed exogen ously, it exhibits a polari zed distribution pattern within the NE and results in a significant sepa ration of centrosomes fr om the nucleus. Thus, a specialized process involving Nesprin 4 could be suggested for proper positioning of the nucleus in secretory epithelial cells. Introduction The nuclear envelope serves as a selective barrier between the nucleus and cytoplasm Several structural features (Bur ke and Stewart, 2002; Gruenbaum et al., 2005) make up the NE, the most prominent being a pair of lipid bilaye rs, the inner and outer nuclear membranes (ONM and INM, respectively). The ONM and INM are separated by a thin, uniform lumen of about 50nm. Periodically, channels which traverse both membrane s allow the INM and ONM to

PAGE 87

87 become continuous at these junctions. These ch annels are occupied by nuclear pore complexes (NPCs), which serve as molecular sieves for controlling the trafficking of molecules between the nucleus and cytoplasm (Tran and Wente, 2006). Despite connections at the periphery of NPCs, the INM and ONM are biochemically distinct. The ONM is continuous with the ER, to which it is functionally similar. The INM contains it own unique set of integral membrane proteins, including the SUN domain proteins, Sun1 and Sun2. The ONM, INM and ER are all in terconnected, and so, form a single continuous membrane system. Underlying the INM is an intermediate fila ment meshwork compos ed of A-type and Btype lamins known as the nuclear lamina (Gerace et al., 1978). The nuclear lamina is thought to provide the structural framework for the NE and to provide anchoring sites for chromatin domains at the nuclear periphery. The lamins ar e known to interact with integral membrane proteins of the INM as well as soluble nuclear proteins and claim many functions, including nuclear envelope assembly (Shumaker et al., 2005), nuclear size and shape, DNA replication, and cell signaling (Stewart et al., 2007). Defects in the LMNA gene, which encodes A-type lamins, have been implicated several diseases that fr equently result in misshapen nuclei, nuclear herniations and increased nuclear fragility (B roers et al., 2004; Lammerding et al., 2004). In recent years, a handful of related inte gral membrane proteins, known as the nesprins, have been identified as residents specific to th e ONM in vertebrate cells. These include two large actin-binding proteins, Nesprin 1 Giant (nesp1G) and Nesprin 2 Giant (Nesp2G) with molecular masses of 1.1 MD and 796kD respectively (Apel et al., 2000; Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). Nesprin 3 (108 kD), on the other hand, binds to the plakin family member plectin, a cytoskeletal linker that can as sociate with the intermediate filament system

PAGE 88

88 (Wilhelmsen et al., 2005). These nesprins share common characteristics. Nesprins are type II membrane proteins which feature a cytoplasmic do main containing multiple spectrin repeats, and a highly conserved COOH-termin al (KASH) domain. The KASH ( Klarsicht Anc-1, and Syne homology) domain comprises a si ngle transmembrane anchor and a short lumenal segment of about 40 residues that extends into the PNS. Several nesp rin relatives, including the Caenorhabditis elegans ANC-1, Unc-83 and Zyg-12 and Drosophila melanogaster klarsicht and msp-300, share similar KASH domains that anchor them in th e ONM (Fischer et al., 2004; McGee et al., 2006; Starr and Fischer, 2005; Starr and Han, 2002; Zhang et al., 2002). We previously presented evidence that Nes p2G is tethered to the ONM through translumenal interactions between the Nesp2G KASH domain and INM-localized proteins, Sun1 and Sun2 (Crisp et al., 2006). Nesp2G forms an essential part of the LINC (li nker of n ucleoskeleton and c ytoskeleton) complex, a molecular chain form ed when actin-associated nesprin proteins form links across the PNS by virtue of interac tions between the nesprin KASH domain and the lumenal SUN domains of Sun1 a nd Sun2. SUN domain proteins, in turn, interact with the nuclear lamina, completing the nucleo-cytoplasmi c connection (Crisp et al., 2006; Liu et al., 2007). A subsequent study found that the mechan ism for targeting nesp rin 3 to the nuclear envelope is mediated in the same manner (Ket ema et al., 2007). The LINC complex was based on a model in C.elegans which suggested that the nesprin homolog, ANC-1, is tethered in the ONM through interactions with the SUN domain protein, Unc84 (Lee et al., 2002; Starr and Han, 2002). Unc-84 is now known to tether another KASH domain protein, Unc-83, within the ONM (McGee et al., 2006). The NH2-terminal cytoplasmic domains of KASH domain containing proteins associate with cytoskeletal networks. The presence of an actin-binding do main (ABD) in some nesprins

PAGE 89

89 has implicated them in actin-based nuclear positioning. Positioning of the nucleus is crucial for many cellular events such as cell migration, diffe rentiation, polarization and mitosis. The nesprin homolog, ANC-1 is required for proper anchorage and uniform spacing of nuclei in the syncytial hypodermis of worms (Starr and Han, 2002). In mi ce, the disruption or depletion of the KASH domains of nesprins 1 and 2 misplaces synapt ic nuclei that are normally clustered beneath neuromuscular junctions and sometimes disrupts the organization of non -synaptic nuclei in skeletal muscle (Grady et al., 2005; Zhang et al., 2007). Both D. melanogaster klarsicht and C. elegans Zyg-12 link the nucleus to centrosomes by attaching to microtubules, likely through the microtubule motor, dynein (Fischer et al., 2004; Malone et al., 2003). Nesprin 1 has also been c ited as an important player in cytokinesis by functioning with the motor protei n, kinesin II, to carry and asse mble vesicles at the spindle midbody (Fan and Beck, 2004). Several unpublished repor ts suggest that nesprins associate with microtubules by binding to kinesins and kinesin-associated proteins (H. Peters en et al., 2007; M. Schneider et al., 2007). In most cells, a radial array of polar microt ubules is nucleated at the centrosome or MTOC at their minus ends so that the plus ends grow outward toward the cell periphery (Vorobjev and Nadezhdina, 1987) These astral microtubules serve as tracks for the movement of molecular motors such as dynein or any of a number of kinesins. The conventional kinesin motor is a protein homodimer consisting of two heavy chai ns, a central coiled-coiled region and a cargobinding domain associated with light chains (Woehlke and Schliwa, 2000). The globular NH2terminal region of the heavy chains comprises the motor domain. The motor domain binds microtubules and contains an ATP binding site. The hydrolysis of ATP changes the conformation of the motor domain and orients th e molecule, allowing the kinesin to walk

PAGE 90

90 along the microtubule, while transporting its atta ched cargo (Mather and Fox, 2006; Rice et al., 1999; Schnitzer and Block, 1997). Typically, kinesins travel unidirectionally toward the plus ends of polar microtubules, which, in most cases, direct cargo toward the periphery of the cell. Minus-end directed kinesins do exist but are less common. Microtubules networks differ in polarized ep ithelial cells in that most microtubules are non-centrosomal and align along the apical-basal ax is of the cell (Bre et al., 1990). They create asymmetry by orienting their minus ends at the apical membrane a nd the plus ends at the basal surface (Musch, 2004). This arrangement is quite suitable for the columnar morphology of this cell type and has been shown to be essential for proper sorting of membrane components and directing of vesicle traffi c (Keating and Borisy, 1999). We now have identified a fourth member of the nesprin family of proteins that localizes at the ONM. Nesprin 4 is detected specifically in secretory epithelial cells in vivo and becomes upregulated when epithelial cells are induced to differentiate in vitro. This protein contains a single spectrin repeat, a predic ted leucine zipper and a COOH-t erminal KASH domain that is necessary and sufficient to target it to th e NE. Preliminary evidence suggests SUN domain proteins may be involved in the anchorage of Ne sprin 4 at the ONM in a manner similar to other KASH domain nesprins. Surprisingl y, when the protein is introduced into certain cell types, it adopts a polarized distribution within a region of th e nuclear envelope that is most distant to the centrosome and leads to the di ssociation of the centrosome and Golgi apparatus from the nucleus. An association of nespri n 4 with the microtubule network could explain this. Indeed, the nesprin 4 cytoplasmic domain was found in a complex with the heavy chai n of the conventional plus end directed motor protein, kinesin I (Kif5B), in an in vivo pull-down assay. Furthermore, a yeast two-hybrid (Y2H) screen using the nesprin 4 cytoplasmic do main revealed that Nesprin 4

PAGE 91

91 binds directly to kinesin I lig ht chains. These findings suggest that Nesprin 4, through its association with kinesin I, may be involved in the basal positioni ng of the nucleus in polarized epithelial cells by guidi ng it to the minus ends of microtubules. Results Our initial aim was to ide ntify other possible members of the nesprin protein family. To accomplish this we carried out a BLAST search employing the KASH domain of mouse nesprin 2 (KASH2) as a probe. This search identified a single uncharacterized protein (AI428936) of 388 amino acid residues and predicted molecular wei ght of 42kDa (Fig 3-1A). Examination of both cDNA (accession number BC004761) and genomic se quences (NC_000073.5) suggest that this represents the full-length prot ein. The region of homology w ith KASH2 resides at the Cterminus, as would be expected for a KASH domain protein, and overall displays 38% identity. For comparison the KASH domains of Nesprins 13 display identities of 64-79% in pair-wise alignments. Thus this novel protein contains wh at appears to be a degenerate C-terminal KASH domain (Fig 3-1B). Like all KASH domains it features a putative tran smembrane sequence. Further sequence analysis of AI428936 revealed little similarity with other proteins, although it does feature a single spectrin repeat. There is also a shor t leucine zipper or coiled-coil sequence that could potentially me diate dimerization (Fig 3-1C). The absence of an N-terminal signal sequence coupled with the presence of the C-terminal KASH do main suggests that AI428936, like nesprins 1-3, is a type II membrane protein. We obtained a full-length cDNA encodi ng AI428936 through the IMAGE consortium (Clone ID 5036575). We subsequently expressed a version of AI428936 b earing an N-terminal HA epitope tag in either HeLa or human sa livary gland (HSG) cells. Immunofluorescence microscopy employing an anti-HA antibody, in conj unction with antibodies against either Sun2 or the NPC protein Nup153, revealed localization of AI428936 to the NE (Fig 3-1). Given this

PAGE 92

92 localization, combined with the presence of both a spectrin repeat and a C-terminal KASH domain, we propose that AI428936 represents a fourth member of the mammalian nesprin protein family. We now refer to it as nesprin 4 (Nesp4). The Nesp1G, Nesp2G and Nesp3 pr oteins are each tethered in the ONM. Is the same true of Nesp4? As a first approach to address this question we prepared a stable HSG cell line that constitutively expresses HA-Nes p4 (HSG-HAN4). We then took advantage of the fact that low concentrations of digitonin will selectively perm eabilze the plasma membrane but will leave the nuclear membranes intact. Immunoflurescence microscopy of HSG-HAN4 permeabilized with digitonin versus Triton X-100 revealed that th e N-terminal domain of HA-Nesp4 must be exposed on the cytoplasmic face of the NE and therefore that HA-Nesp4 behaves as an ONM protein (Fig 3-3). Localization of Nesp4 to the ONM, as is th e case with other members of the nesprin family, appears to be KASH-dependent. Transfect ion of a GFP fused version of Nesp4 in which the KASH domain is deleted (Nesp4 KASH-GFP) leads to a diffuse cytoplasmic and nuclear localization in HeLa cells (Fig 3-4B). Replacem ent of the lumenal portion of the KASH domain with GFP to yield Nesp4 Lum-GFP also results in loss of asso ciation with the NE (Fig3-4C). In this case however, the mutant protein beco mes distributed throughout what appears to be membranes of the peripheral ER. Conversely, fu sion of KASH4 to the C-terminus of GFP is sufficient to recruit GFP to the ONM (Fig3-4D ). Overexpression of GFP-KASH4 will displace HA-Nesp4 as well as endogenous Nesp2G from the ONM (Fig 3-5A; Kyle Roux, personal communication). Similarly, overexpression of G FP-KASH2 will also displace HA-Nesp4 from the ONM (Fig3-5B). Evidently, the localizati on of Nesp4 within the ONM shares a common mechanism with Nesp2G, and in all lik elihood other nesprin family members.

PAGE 93

93 Localization of GFP-KASH4 to the ONM can be inhibited by overexpression of a Sun protein dominant negative mutant (SS-HASunLKD EL) (Fig. 3-6B). This mutant (Fig. 3-6A) consists of the Sun1 lumenal domain bearing an N-terminal HA tag as well as the signal sequence of human serum albumin to direct it in to the ER/PNS. Retenti on and concentration in the ER/PNS system is mediated by a C-termin al KDEL tetrapeptide. This soluble protein competes with endogenous INM localized Sun1 and Sun2 for interactions with KASH domain proteins and in this way preven ts their tethering within the ONM The inference is that Nesp4, like other nesprin family members is tethered in the ONM by SUN-KASH interactions that span the PNS. We raised polyclonal antibodies against a mouse Nesp4-GST fusion protein. While this antibody detected HA-Nesp4 expressed in HeLa cells immunofluorescence microscopy and western blot (Fig. 3-7A,B), it could not dete ct endogenous Nesp4 in any common tissue culture cell line. We therefore decided to survey multip le mouse tissues for Nesp4 expression. This was accomplished by immunofluorescence microscopy of mouse tissue cryosections. To our surprise, the vast majority of mouse tissues displayed little evidence of Nesp4 expression. However, strong Nesp4 labeling of NEs was observed in salivary gland (parotid and submaxillary), exocrine pancreas, bulbourethral gland (Cowpers gland in humans) and mammary tissue (Fig. 37C,D). Taken together, these data suggest that in the mouse, Nesp4 expre ssion is restricted to secretory epithelial cells. Based upon these findings, we examined Ne sp4 expression in the mouse mammary cell line HC-11. Following appropriate hormonal inducti on, HC-11 cells will differentiate to yield cells that secrete milk protei ns. Immunofluorescence microscopy reveals that in undifferentiated HC-11 cultures only a few cells appear positive for Nesp4 expression. However, during the 1-2

PAGE 94

94 week differentiation process Nesp4 positive cells accumulate until they represent 40-50% of the population. In all of these positive cells, Nesp4 is localized exclusively at the NE (Fig. 3-8). Immunoprecipitation analysis of HC-11 cells confirmed that the endogenous Nesp4 is similar in size to the recombinant HA-Nesp4 (p ersonal communication, Kyle Roux). Other members of the mammalian nesprin family interact with cytoskeletal proteins; actin in the case of Nesp1 and Nesp2, and plectin in the case of Nesp3. However, with the exception of its single spectrin repeat, Ne sp4 displays no obvious cytoskelet al binding features. To identify proteins that might interact with Nesp 4 we adopted an approach based upon coimmunoprecipitation. To circumvent problems associated with insolubility of full-length Nesp4 we fused the coding sequence for the Nesp4 cytopl asmic domain to the 5 end of the GFP coding sequence. The resultant fusion protein, Nesp4 KASH-GFP was expressed in HEK293 cells employing a retroviral vector. The fusion protein was subsequently recovered by immunoprecipitation using an anti-GFP antibody and the immunoprecipitates analysed by SDS polyacrylamide gel electrophoresis. In pilot expe riments employing 35S-labeled cells, a faint band of ~120kD was consistently observed in GFP-Nesp4 KASH immunoprecipitates. This band was absent from control GFP immunopreciptates. These experiments were subsequently scaled up and the 120kD protein band excised from silver stained SDS polyacrylamide gels. Analysis by mass spectrometry revealed that th e 120kD band contained Kif5B, the conventional kinesis 1 heavy chain. A parallel yeast two hybrid analysis employing part of the Nesp4 cy toplasmic domain as bait was carried out by Myriad Genetics Inc. This screen revealed kinesin light chains 1, 2 and 3 as a possible Nesp4 binding partners. Taken together, the co-immunoprecipitation and two hybrid data strongly imply that Nesp4 is a kinesin binding protei n. To confirm this we carried

PAGE 95

95 out transient transfections of HeLa cells w ith two different Nes p4 cytoplasmic domain constructs. The first was Nesp4 KASH-GFP while the second c ontained an additional module consisting of glutathione-S-tr ansferase (GST) located betwee n GFP and the Nesp4 sequence (Nesp4 KASH-GST-GFP). In contrast to Nesp4 KASH-GFP, this second fusion protein is located exclusively within the cytoplasm. Presum ably its additional bulk prevents nuclear entry. As before, GFP alone functioned as a negative control. Transfected cell extracts were processed for immunoprecipitation employing an anti-GFP antibody. Immunoprecipitates were fractionated by SDS-PAGE and then analyzed by western blot using an anti-Ki f5B antibody. Figure 3-9 clearly shows that kinesin heavy chain is f ound in a complex with the Nesp4 cytoplasmic domain. In all likelihood, complex formation is mediated by the kinesin light chains given the two-hybrid interaction. Can kinesin binding be linked to Nesp4 function in vivo? KASH domain proteins have well documented functions in nuclear positioning or anchoring. We speculate that Nesp4 could have a role in nuclear positioning in secretory epithelial cells. Epithelial cells typically contain bundles of non-centrosomal microtubules that exte nd from the apical to the basal surface and which are organized along the lateral membrane s. These microtubule bundles are oriented with their plus ends directed towards the basal membra ne. Recruitment of kinesin, a plus end directed motor protein, to the nuclear surface by Nesp4 woul d be predicted to cause the nucleus to move towards the base of the cell (Figure 3-16). While we do not at present have a suitable epithelial cell system in which to examine the function of Nesp4, we can employ non-polarized cells to determine how Ne sp4 might affect the interaction of the nucleus with microtubules. When expressed in HSG cells, both HA-Nesp4 and GFP-Nesp4 usually display a uniform distributi on about the nuclear surf ace (Figs. 3-2 and 3-

PAGE 96

96 4A). However, in a minority of cells, particularly those at the periphery of epithelial-like islands, HAand GFP-tagged Nesp4 tends to accumulate at one pole of the nucleus (Fig. 3-10). This Nesp4 positive pole is invariably distal to the centrosome. Polari zation of Nesp4 in this way is frequently accompanied by elongation of the nucle us and the adoption of a wrinkled appearance. These latter effects may be ab rogated by brief treatment with nocodazole (Fig. 3-11). The appearance of polarized nuclei is far more prevalent in HeLa cells expressing HAor GFP-tagged Nesp4. As was the case with the HSG cells, Nesp4 accumulated at a pole of the nucleus that is distal to the centrosomes (Fig 3-12A). Since mi crotubules are anchored at the centrosome by their minus ends, the polarization of Nesp4 could be explained by its kinesin mediated movement away from the centrosome. Sun proteins, the tether s for nesprins, are known to be relatively immobile. Consequently the polar distribution of Nesp4 w ould be relatively slow to dissipate upon treatmen t of the cells with nocodazole. Ap parently, treatment of HeLa cells with nocodazole during transfecti on with HAor GFP-Nesp4 prevents Nesp4 polarization from occuring (Kyle Roux, personal communication). If the nucleus is engaged with centrosomeattached microtubules via Nesp4 and kinesin, a c onsequence of this should be separation of the nucleus from the centrosome (Figure 3-15). This in fact is what occurs (Fig. 3-12A). In nontransfected HeLa cells or in HeLa cells expr essing GFP-KASH4, the centrosome is located on average less than 2m from the nuclear surface (Fig. 3-12B). In cells expressing Nesp4, the average separation is ap proximately 11m. As sh own in Figure 3-12B, centrosomes have been measured almost 50m from the nucleus in the presence of Nesp4. Such a separation is never observed in control cells. Based upon the results in Figure 3-12, we would predict that Nesp4 should induce a similar relocalization of the Golgi apparatus, which is anchored at the centrosome. In nontransfected or

PAGE 97

97 GFP-KASH4 transfected HeLa cells the Golgi a pparatus resides immediately adjacent to the nucleus in association with th e centrosomes (Fig. 3-13A). Expression of Nesp4 results in the movement of the Golgi apparatus away from the nucleus (Fig 313B). As is the case with the centrosome, separation of the Golgi apparatus and the nucleus may be on the order of 20-30m or more. Indeed,we have observed Nesp4 expre ssing cells in which the Golgi apparatus is adjacent to the plasma membrane in cell processes or pseudopods (data not shown). Evidently expression of a single ONM protein, Nesp4, can induce a drastic change in the cytoplasmic organization of non-polarized cells. These effects would be consistent with major role for Nesp4 in secretory epithelial morphogenesis. Note: I would like to acknowledge Kyle R oux, Ph.D who conducted many of the later experiments presented in this chapter pertai ning to the Nesp4-kinesin I interaction and polarization of Nesp4 in HeLa cells. This work has helped to advance our understanding of Nesprin 4 function in the cell. Discussion Several p roteins that localize to the ONM of the nuclear envelope have been identified, including the mammalian nesprin 1G, nesprin 2G and nesprin 3. We have now identified and characterized nesprin 4 (Nesp4) as the fourth member of the ONM -localized nesprin family of proteins. This 42kD protein has several struct ural features in comm on with nesprins 1-3, including a cytoplasmic domain containing a single spectrin re peat and a degenerate COOHterminal KASH motif. Nesprins 1-3 are all type II integral membrane proteins which contain a single transmembrane domain within the KASH sequence followed by a small luminal segment. We show here that the KASH domain is required to target exogenously expressed Nesp4 to the ONM. In all likelihood, Nesp4 adopts the same t opology as other nesprins in which the short NH2-terminal KASH domain projects into the PNS.

PAGE 98

98 The KASH domain has been shown to be necess ary and sufficient for targeting nesprins 13 to the ONM (Apel et al., 2000; Crisp et al., 2006; Ketema et al., 2007; Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). The same appears to be true for Nesp4 as well. The Nesp4 KASH segment fused to GFP will localize appropriately to the NE. Conversely, Nesp4 fragments lacking the KASH domain (Nesp4 KASH-GFP) no longer associate with the NE and become dispersed in the cytoplasm. Deleti on of only the COOH-terminal luminal segment ( Nesp4 Lum-GFP) leads to the dispersal to what appears to be the peripheral ER. This is likely the case because the transmembrane domain is still intact. Previously, we demonstrated that Nesp2G is tethered to the ONM through transluminal interactions between the KASH do main of Nesp2G and the SUN domains of INM proteins, Sun1 and Sun2, as part of an assembly known as the LINC complex (Crisp et al., 2006). Nesprin 3 and the C.elegans KASH domain protein, Unc-83, have since been shown to localize to the ONM in a similar manner (Ketema et al., 2007; McG ee et al., 2006). The exact mechanism whereby Nesp4 is tethered to the ONM is unknown, but prelim inary data point to SUN domain proteins as a possible link. The expression of a dominant -negative form of Sun1, SS-HA-Sun1L-KDEL, leads to the displacement of G FP-KASH4 from the NE to the pe ripheral ER. However, the INM protein, Sun1, is not the primary determinant of Nesp4 localization. Our recent publication showed that the SUN domain proteins, Sun1 and S un2 are spatially separate d within the NE (Liu et al., 2007). Sun2 displays a roughly uniform dist ribution while Sun1 is c oncentrated at NPCs. We have observed that Nesp4 doe s not co-localize with NPCs, but instead assumes a distribution pattern more similar to that of Sun2 (Figure 314). This data, along with the necessity for the KASH domain in Nesp4 anc horing, lends weight toward the noti on that Nesp4 is tethered in the ONM through similar mechanisms represented by the Nesp2G LINC complex. Further work,

PAGE 99

99 including RNAi of the SUN proteins and co-imm unoprecipitation assays will need to be done to properly assess Nesp4 tethering. We observed that both GFP-KASH2 and G FP-KASH4 displaces stably expressed HANesp4 from the NE. However, what struck us wa s that the GFP-KASH4 was far more efficient in doing so, sometimes resulting in the complete ob literation of the full-length Nesp4. One could speculate that the proper dimer-/oilgomerization of Nesp4 is required to create a stable tertiary structure or else the pr otein is marked for degradation. Ol igomerization could potentially be achieved through the coiled-coil mo tif of the leucine zipper pr edicted to occupy the Nesp4 NH2terminus or via the membrane-spanning domain. It may be that oligomer formation is initially facilitated by the KASH domain and later st abilized through associations between Nesp4 cytoplasmic domains. Nesprins are renowned for their role in nucle ar positioning. Several lines of evidence point to a specialized positioning role for Nesp4 in epithelial cells. Our discove ry that Nesp4 binds to the plus-end directed motor ki nesin I (Kif5B), allows for the attachment of Nesp4 to microtubules. Given that microtubul e plus ends typically termin ate at the basal surface of epithelial cells, it is possible that kinesin I mediates the movement of the nucleus in this direction to achieve the typical cellular organization characteristic of epithelial cells, with the centrosome located between the nucleus and the apical me mbrane (Figure 3-16). One indication of this movement is that we are able to bring about an extensive separation of the both the centrosome and Golgi apparatus from the nucleus by introd ucing exogenous Nesp4 into fibroblasts. The effect is quite dramatic, with an average separation of 11 m. Gomes et al. (2005) demonstrated that during centrosomal polarization in fibroblasts, the nucleus was repositioned while the centrosomes remained stationary. This mechanism may apply here as well.

PAGE 100

100 In some fibroblasts transiently transfect ed with tagged Nesp4 constructs, Nesp4 accumulates in one pole of the NE furthest from the centrosome. Apparently, treatment of cells with nocodazole during the transfection pro cess precludes Nesp4 pol arization (Kyle Roux, personal communication), pointing to a role for microtubules in this phenomenon. In HSG cells that stably express Nesprin 4, Ne sp4 itself becomes polarized in cells found at the periphery of HSG epithelial islands. This occurs after a fe w days in culture and is perhaps linked to morphological changes in the cells. The polariza tion of Nesp4 appears to occur more frequently in HeLa cells as opposed to epithelial cultures. The ability of exogenous Nesp4 to polarize in cell-types which normally do not express the prot ein is almost certainly related to kinesin binding properties of Nesp4. The lack of a direct epithelia l system severely limits the extent of understanding Nesp4 in culture. Studies are currently underway em ploying Nesp4 knockout mice (Colin Stewart, personal communication). Comparativ e studies against wild type mice on the organismal, tissue and cellular levels may help us to gain treme ndous insight into Nesp4 function. We predict that the secretory function in Nesp4 expressing ti ssues (mammary, salivary, bulbourethral and exocrine pancreas) may be hindered. Furtherm ore, following mammary gland development in theses mice during pregnancy could prove usef ul for understanding the role of Nesp4 in epithelial morphogenesis. Nesprin 4 appears to be functionally similar to other nesprins in that it localizes to the ONM and binds to the cytoskeleton. Unlike othe r nesprins, which are generally ubiquitous, Nesp4 is expressed only in epithelial cells. We ha ve extracted strong clues as to how this protein functions uniquely in epitheli al cells by observing the peculia r effects the exogenous protein exerts on cells that do not normally express Nesp 4. This suggests roles for Nesp4 in proper

PAGE 101

101 positioning of the nucleus in epithelial cells a nd, through interactions with microtubules, may implicate Nesp4 in epithelial morphogenesis. More importantly, our findings emphasize the increasingly complex and specialized roles that are being attributed to nesprins and further highlights the NE, that was previously viewed as simply an architectural barrier for the nucleus, as an important multi-functional organelle within the cell. Materials and Methods Cell Culture and Transfections HeLa, HSG, and HEK293 cells were m aintained in 6.0% CO2 and at 37oC in DMEM plus 10% FBS, 10% penicillin/streptomycin and 2 mM L-glutamine. Cells were transfected with Lipofectamine 2000 as previously described for 6-well plates (L iu et al., 2007) HC-11 cells (a gift from Kermit Caraway, Univ ersity of Miami) were grown in RPMI 1640 medium containing 10% fetal bovine serum, 1X ITS media supplement (Sigma) containing 10 g/ml insulin, 10 ng/ml EGF, 2 mM L-glutamine and 10% penicillin/streptomycin. To promote differentiation, the cells were grown to conf luence and rendered competent for hormonal induction by cultivation in medium lacking in sulin for 4 days after reaching confluency. Subsequently the cells were induced by incubati on for 4 days in a medium containing 1 M dexamethasone (Sigma), 10 g/ml insulin, and 5 g/ml prolactin (Sigma). Differentiation was monitored by following the formation of blister-l ike structures or "domes" that appear in confluent cultures. Generation of Stable Cell Lines Chosen cell lines (HSG or HEK293) were transfected with plasm ids containing a neomycin resistance gene. Twenty-four hours post -transfection, these were selected with ~600 g/ml G418 Sulfate (Invitrogen). Growth medium was replaced with fresh medium containing G418 every 2 to 3 days to maintain the concen tration of active G418. Af ter 10 to 12 days of

PAGE 102

102 G418 selection, individual surviv ing clones were isolated with cloning cylinders and expanded in six-well dishes and checked by fluorescence microscopy. If needed, the G418-resistant clones were subjected to another round of selection, in which clones that expressed moderate levels (resembling endogenous levels observed elsewhere) of the protein of interest were preferentially selected for further analysis. St ably transfected clones were ma intained in medium containing 600g/ml G418. Histology Mice were s acrificed by CO2 overdose and rapidly dissecte d. Extracted tissues were frozen in 2-methyl butane, and stor ed at -80 C. Serial sections (~10 m) were cut through the tissues with a cryostat microtome. Slide mounted tissue sections were fixed with 3% PFA for 10 minutes, washed with PBS and permeabilized for 10 minutes with 0.2% Triton X-100. The coverslips were then blocked in PBS contai ning 10% adult bovine serum for 30 minutes. The sections were then labeled with the appropriate primary and secondary antibodies diluted in blocking buffer for one hour each plus the DNA-specific Hchst dye 33258. The slides where then evaluated using a Zeiss confocal laser microscope. Antibodies The following antibodies were used in this study: the monoclonal an tibody against lamins A and C (XB10) has been described previously (Raharjo et al., 2001). The monoclonal mouse antibody 12CA5 against the HA epitope tag was obtained from Covance. A polyclonal rabbit antibody against the same epitope was obtained from AbCam. Rabbit antibodies against Sun 2 were raised against GST fusion pr oteins as described by Hodzic et al. (2004). Mouse monoclonal anti-nup153 (clone SA1) used to detect NPCs was described prev iously (Pante et al., 1994; Bodoor et al., 1999). The mouse monoclonal anti body 53FC3 to mannosidase II (Burke et al. 1982) was used to detect Golgi membranes. Both and -tubulin were obtained from AbCam.

PAGE 103

103 Polyclonal antibodies against GFP and Kif5B and the monoclonal antibody to -actin were also obtained from AbCam. Secondary antibodies co njugated with AlexaFlu or dyes were obtained from Invitrogen. Peroxidase-conjugated seconda ry antibodies were obtained from Biosource International. A rabbit poloyclonal specific to GST-Nesp4( 1-90) was raised against a Nesp4-GST fusion protein by Rockland Immunochemicals. Affinity purification was perfor med as described in Crisp et al. (2006). Immunofluorescence Microscopy Cells were grown on glass coverslips and fi xed in 3% form aldehyde (prepared in PBS from PFA powder) for 10 min followed by a 5min permeabilization with 0.2% Triton X-100. The cells were then labeled with the appropria te antibodies plus the DNA-specific Hchst dye 33258. For experiments involving sel ective permeabilizati on, the cells were first fixed in 3% formaldehyde. This was followed by permeabilizati on in 0.003% digitonin in PBS on ice for 15 min (Adam et al., 1990). The cells were then labeled with appropriate primary and secondary antibodies. Specimens were observed using a mi croscope (model DMRB; Leica) set to either phase contrast or fluorescence illumination. Im ages were collected using a CDC camera (CoolSNAP HQ; Photometrics) linked to a Maci ntosh G4 computer running IPLab Spectrum software (Scanalytics). For assessing detachment of the centrosome/Golgi apparatus, images of transfected cells were taken at 63X. The distance from the centrosome to the nearest point on the nucleus was measured using IPLab software calibrated to the 63X objective with a stage micrometer. Centrosomes that appeared to overl ap with the nucleus were excluded for this analysis.

PAGE 104

104 Immunoblots and Immunoprecipitations For immunoblots, cells were lysed with SDS sample buffer. Proteins were separated by SDS-PAGE and analyzed by W estern blot as described in Liu et al., 2007. For immunoprecipitations, 10cm2 plate of HEK293 cells stably expressing either Nesp GFP or GFP alone were lysed in 1ml of buffer (50mM NaCl, 50mM Tris pH 7.4, 2.5mM MgCl2, 0.5% TX-100, 1mM DTT, 1:1000 CLAP and 1:200 PMSF) before being passed 10 times through a 21-gauge needle and centrifuged 16000xG for 10 min at 4oC. The supernatants were rotated for 4 h at 4oC with protein A Sepharose beads coupled to rabbit anti-GFP. Following centrifugation (800xG) the beads were washed 3X with lysis buffer prior to suspension in SDS sample buffer for SDS-PAGE an alysis (Liu et al., 2007). Bands unique to the Nesp KASH-GPF IP were excised and submitted to the University of Floridas ICBR proteomics laboratory for mass spectrometry analysis. Plasmids A m ouse nesprin 4 cDNA (clone ID 5036575) was obtained through the IMAGE Consortium To generate nesprin4 tagged at the NH2 terminus with an HA epitope, nesprin 4 cDNA flanked by 5 XhoI and 3 AflII restriction site s was amplified by PCR using primers 5AATTCTCGAGCTGGTTCCACCTCTTGGCCG-3 and 5-GATGCTTAAGTCAGATTGG AGGGAGACCATTG-3. The PCR produc t was digested with XhoI and AflII and inserted downstream of an HA tag sequence in the vector pCDNA3.1(-). This vector was prepared from pcDNA3.1(-) containing HAlamin A (Raharjo et al.,2001) by digestion with Xho1 and Afl2. The resulting plasmid was pcDNA3.1(-)HA-Nesp4. The following GFP-tagged constructs were made using nesprin 4 cDNA as a template and primers were constructed to cont ain flanking restriction sites corre sponding to sites indicated in

PAGE 105

105 the vector. To prepare EGFP-KASH4, the KASH domain of nesprin 4 using primers 5TTGCTCGAGGGACCATGGTCCCAGCTCCTGCAT CC-3 and 5-ATGGGATCCTCAGATT GGAGGGAGACCATTGAC-3. This product was digested with BamHI and XhoI and ligated into expression vector pEGFP-C1 between Ba mHI and XhoI sites to yield pEGFP-KASH4. Nesp4 Lum was PCR amplified using primers 5AATTCTCGAGACCATGGCCCTGGTTCCA CC-3 and 5-TAAAGCTTGGAGACC CCCGACAA-3 and ligated into XhoI and HindIII sites of the EGFP-N1 vector to yield Nesp4 Lum-GFP. EGFP-Nesp4 was made using primers 5AATTGCTCGAGTTCCACCTC TTGGCCG-3 and 5GATGAAGCTTTCAGATTGGAG GGAGACCATTG-3 and ligated into the XhoI and HindIII sites of the EGFP-C1 vector. Nesp4 KASH-EGFP was generated by PCR amplifying Nesp4 KASH from HA-Nesp4 with primers 5AATTCTCGAGACCATGGCCCTGGTTCCACC-3 and 5-AATTGGATCC GCAGGAGCTGGGACCCC-3 that incorporated fl anking BamHI and XhoI restriction sites. The PCR product was digested and cloned into the XhoI and BamHI sites of Sun1N220-GFP (Liu et al., 2007). To generate Nesprin4-GST, Nesp4 flanked by 5 BamHI and 3 XhoI was amplified from Nesp4 cDNA using PCR primers 5TTCCGGATCCCCACCTC TTGGCCGTGAATTTCC-3 and 5-AATTCTCGAGTCAACTGTCCTGTTCAGC TTC-3followed by ligation into the BamHI and XhoI sites of the PGEX 4-T3 vector. To make Nesprin4(1-90)-GST Nesp4 flanked by 5 BamHI and 3 XhoI was amplified from Nesp4 cDNA using PCR primers 5was generated by 5-TTCCGGATCCCCACCTC TTGGCCGTGAATTTCC-3 AND 5-AATTCTCGAGTCAACTGTCCTGTTCAGCTTC-3

PAGE 106

106 Nesp4-GST-GFP was made by amplifying GST fr om the PGEX 4-T4 vector using primers 5-ATTAGGATCCTATACTAGGTTAT-3 and 5-TTAAAACCGGTACCAGATCCGA-3and ligating the product into the Ba mHI and AgeI sites of Nesp4 KASH-EGFP. GFP-KASH2 was a gift from Catherine Shanahan, University of Cambridge.

PAGE 107

107 Figure 3-1. Nesprin 4 is a novel member of the ne sprin family of KASH do main proteins. (A) A BLAST search against the KASH domain of nesprin 2 identified a novel 388 residue nesprin homolog, nesprin 4. (B) ClustalW alig nment of the nesprin 4 C-terminus with the KASH domains of C.elegans ANC-1 and mammalian nesprin proteins 1-3 generated a degenerate KASH domain. Hydropathy plots (not shown) predict a single hydrophobic region that corresponds to a traditional transmembrane domain contained within KASH motifs. (C) In addition to the C-terminal KASH domain, nesprin 4 features a single spectrin repeat and predicted leucine zipper in the Nterminal domain.

PAGE 108

108 Figure 3-2. Nesprin 4 is a nuclear envelope protein. Full length ne sprin 4 with an N-terminal HA epitope tag localizes to the NE where it co localizes with other NE proteins, Sun2 and Nup153. HA-Nesp4 was detected with a monoclonal mouse antibody (upper panel) or a polyclonal rabbit antibody (lower panel) to the HA epitope tag.

PAGE 109

109 Figure 3-3. Nesprin 4 localizes to the outer nuclear membrane. HSG cells stably expressing HAnesprin 4 were processed for immuno fluorescence microscopy by selective permeabilization of the plasma membrane with .003% digitonin. Nesprin 4 was detected at the ONM by a polyclonal antibody raised against nesprin 4 or by an antiepitope tag antibody (not shown). Lamin A/ C was not accessible to antibodies on the nucleoplasmic side of the nuclear en velope until the NE was completely permeabilized with Triton X-100. Actin served as a positive control in all cases.

PAGE 110

110 Figure 3-4. The C-terminal KASH domain is suffi cient to target Nesp rin 4 to the nuclear envelope. Various nesprin 4 constructs fuse d to GFP were prepared and transfected into HeLa cells to determine the role of the KASH domain in nesprin 4 localization. (A) Full-length GFP-Nesp4, like HA-Nesp4, lo calizes to the NE. (B) Removal of the KASH domain (Nesp4 KASH-GFP) results in the di ffuse dispersal of Nesp4 throughout the cytoplasm. (C) Deletion of only the lumenal portion of the KASH domain, with the transmembrane region is retained (Nesp4 Lum-GFP), results in the dual localization of Nesp4 at the NE and the peripherial ER. (D) The nesprin 4 KASH domain alone (GFP-KASH4) is targeted to the nuclear envelope in a manner comparable to that of full-length nesprin 4.

PAGE 111

111 Figure 3-5. Nesprin 4 can be displaced by GFP-KASH2 but is preferentially eliminated by GFPKASH4. HSG cells stably expressing HA-Ne sp 4 were transfected with GFP fusion proteins (green in merged images) consisting of the KASH domains of (A) nesprin 4 (GFP-KASH4) or (B) nesprin 2 (GFP-KASH2). HA-Nesp 4 localization is detected by a monoclonal antibody to the HA epitope tag (red in merged images). Nuclei are counterstained with a DNAspecific Hchst dye 33258.

PAGE 112

112 Figure 3-6. A soluble form of the Sun1 lumenal domain causes a loss of GFP-KASH4 from the ONM. (A) A signal sequence (SS), HA tag, and KDEL motif were added to the NH2 and COOH termini, respectively, of the Sun1 lumenal domain (SSHA-Sun1L KDEL). (B) When introduced by transfec tion into HeLa cells, the SSHA-Sun1L KDEL localizes both to the peripheral ER and to the PNS, which is revealed by immunolabeling with an anti-HA mo noclonal antibody. Cells expressing SSHASun1LKDEL (red in merged images) exhi bit a very obvious loss of GFP-KASH4 (green in merged images) from the ONM.

PAGE 113

113 Figure 3-7. Nesprin 4 is expresse d in secretory epithe lial cells. (A,B)An antibody directed to an N-terminal epitope of nesprin 4 recogni zes the exogenous protein. (A) A 42 kD band corresponding to HA-Nesprin 4 is detected by the mouse anti-nesprin 4 antibody on a western blot from a HSG stable line. (B ) HA-Nesprin 4 stably expressed in HSG labeled with DNA-specific Hchst dye 33258 (first panel), monoclonal antibody 12CA5 against the HA epitope tag and anti-nesprin 4. (C) Cryosections from the indicated tissues of adult Balb/c mice were stained with mouse anti-nesprin 4 antibody (panels on right) and counterstai ned with DNA-specific Hchst dye 33258 (left column). Sections were imaged by confocal microscopy. (D) At least 17 different tissues were tested for nesprin 4 expression.

PAGE 114

114 Figure 3-8. Nesprin 4 expression is upregulated in HC11 cells when induced to differentiate. HC11 mammary epithelial cells differentiate in response to lactogenic hormones. Cells were fixed and stained with anti-nespr in 4 upon full confluency (left panel) in culture and at four days post induction (right panel).

PAGE 115

115 Figure 3-9. Nesprin 4 interacts with kinesin I (Kif5B). He La cells transfected with Nesp4 KASH-GFP, Nesp4 KASH-GST-GFP, or GFP alone were lysed and immunoprecipitated with anti-GFP. Western Blot with anti-GFP indicates that the proteins were successfully expressed and retrieved from whole cell lysates (left panel). A 120 kD protein recognized by the anti-Kif5B antibody was found to coimmunoprecipitate with both Nesp4 KASH-GFP and Nesp4 KASH-GST-GFP (right panel), indicati ng that Nesp4 can be found in a complex with Kinesin I. GFP alone served as a negative control.

PAGE 116

116 Figure 3-10. HA-Nesprin 4 adopts a polarized distribution in hu man salivary gland (HSG) cells. (A) Clustered growth of HSG cells stably expressing HA-nesprin 4 with polarization of HA-nesprin 4 in peripheral cells as detected by a monoclonal anti-nesprin 4 antibody. Polarization is accompanied by membra ne folding. See inset for 20X view of HSG islands. (B) Immunofluorescence of polarized nesprin 4 with (B) corresponding phase-contrast image. (B) Me rged image shows relative position of nesprin 4 (red) within the cell.

PAGE 117

117 Figure 3-11. Nuclear membrane folding that accompanies Nesprin 4 polarization can be abrogated by disrupting microtubules. HSG cells stably expressing Nesp4 were grown on coverslips for 2-3 days until Nes p4 was observed to polarize within the NE and the nuclear membranes took on a wrinkled appearance. At this point, the cells were treated with 3 /ml nocodazole and processed fo r microscopy at the following time points: 0h, 2h, 3.5h, 4.5h, 6.5h, and 9h. All cel ls were stained antibodies to Nesp4 and tubulin (not shown). Some repres entative time points are depicted above. After 9 hours of treatment, the foldi ng phenotype was completely abolished in contrast to untreated cells, which experienced no change (first panel). Some nuclei still retained a polar distribu tion of Nesp4 at this point.

PAGE 118

118 Figure 3-12. Nesprin 4 expression in HeLa cells detaches cen trosomes from the nuclear envelope. (A) HeLa cells transfected with GFP-Nesp4 were labeled with an antibody to -tubulin to detect centros ome location (red in the merged images). Nuclei, pictured in blue, are counterstained w ith a DNA-specific Hchst dye 33258. A wide separation between the nucleus and centrosome is observed in these cells in contrast to the close association seen in non-transfected cells (nuc lei without green labeling) (B) HeLa cells were transf ected with GFP-Nesp4 or GFP-KASH4. Non-transfected cells served as a control. For each, distan ces between the centrosome and the closest point on the nucleus were measured for at l east 45 cells. The top panel illustrates this separation (scale is in microns ), for each cell measured (represented by a red dot). GFP-Nesp4 expression resulted in distances up to ~50 m with an average distance of 11 m (lower panel). Introduction of G FP-KASH4, which lacks a cytoplasmic attachment site for kinesin I, had little effect on centrosome proximity to the nucleus. Mean distances for both GFP-KASH4 expres sing cells and control cells were ~2 m.

PAGE 119

119 Figure 3-13. Expression of Nesprin 4 in HeLa cel ls leads to significant mislocalization of the Golgi apparatus. (A,B) GFP-KASH4 or GFP-Nesp4 transfected HeLa cells were immunolabeled with monoclonal Golgi antibody, 53FC3 (red in merged images). Nuclei (blue in merged images), were counterstained with a DNA-specific Hchst dye 33258. (A) The Golgi apparatus is closel y associated with the nucleus in both nontransfected cells (without green labeling) and GFP-KASH4 transfected HeLa cells (B) Expression of GFP-Nesp4 results in a considerable sepa ration of the Golgi apparatus and nucleus, consistent with the effect on centrosome proximity. To illustrate this phenomenon, yellow arrows indicate the nucleus and corresponding Golgi apparatus in a cell transfected with GFP-Nesp4.

PAGE 120

120 Figure 3-14. Nesprin 4 exhibits a distribution pattern within th e NE similar to Sun2. (A,B) Sun1 and Sun2 are segregated within the plane of the NE. Immuno uorescence microscopy of HeLa cells stably expressing mouse Sun1-GFP or human Sun2-GFP using antiNUP153 (SA1) and anti-SUN protein antibodie s. (A) Images of the nuclear surface reveal Sun1-GFP colocalization with Nup153. (B) In contrast, the more diffuse Sun2GFP is found in NPC-free regions. (C) Immunof luorescence of cells stably expressing HA-Nesprin4 using anti-epitope tag a nd anti-nucleoporin (NUP153) antibodies reveals that HA-Nesp4, like Sun2, is found in NPC-free regions.

PAGE 121

121 Figure 3-15. Model for nuclear-centrosome se paration induced by Nesprin4 in HeLa cells. Nesprin 4 (pink) frequently becomes polari zed within the NE and guides the nucleus (blue) to the plus-ends of centrosomal microtubules (green) th rough its association with kinesin I (Kif5B).

PAGE 122

122 Figure 3-16. Model for nuclear positioning in ep ithelial cells. Nesprin 4 (pink) expression in epithelial cells allows for the association of the nucleus (blue) with lateral microtubules (light green) through an inter action with kinesin I (Kif5B). Kinesin I walks toward the plus-ends of the microt ubules, pulling the nucleu s to the epithelial basal domain.

PAGE 123

123 CHAPTER 4 CONCLUSION Overview of Findings W ithin the past decade, the discovery of KASH domain proteins in multiple species has generated a great deal of research pertai ning to the mechanisms by which membrane-bound organelles are linked to cytosk eletal components. At the time these studies began, only two mammalian KASH domain pr oteins, Nesp1G and Nesp2G were known to associate with both the actin cytoskeleton and the nuclear periphery (P admakumar et al., 2004; Zh en et al., 2002). More recently a third KASH domain protein, nesprin 3, was found to link the nucleus to the intermediate filaments through interactions with plectin (Wilhelmsen et al., 2005). The attachment of KASH domain proteins to cytoskelet al structures have implicated them in an array of functions related to nucl ear anchoring and positioning. The finding that Nesp2G distinguished the ONM from the ER, unlike other proteins detected in the ONM, raised the question of a unique tethering mechanis m for nesprins. NPCs were quickly ruled out as anchors due to lack of colocalization. Howe ver, clues provided by homologous systems led us to propose a tetherin g mechanism for mammalian nesprins (Lee et al., 2002; Starr and Han, 2003). The data presented in this thesis represents two major contributions to our understanding of nesprin tethering and function. The LINC Complex Provides a Mechanism fo r Nucleo-cy toplasmic Communication First, this work has resulted a working model, named the LINC (li nker of n ucleoskeleton and c ytoskeleton) complex, which provides a mech anism for mechanical coupling between the nucleus and cytoplasm. The LINC complex is a molecular chain that forms when actinassociated Nesp2G forms links across the PNS by virtue of interactions between the nesprin

PAGE 124

124 KASH domain and the lumenal SUN domains of Sun1 and Sun2 at the INM. SUN domain proteins, in turn, interact with the nuclear lamina completing the nucleo-cytoplasmic connection (Lee et al., 2002; Starr and Han, 2003). Our data confirmed the KASH-SUN interaction originally proposed for related proteins in a C.elegans model (Lee et al., 2002; Starr and Han, 2003). At the same time this work was published, Pa dmakumar et al. (2005) released a paper that reached the same conclusions involving Sun1, thus validating this work. Later manuscripts revealed that similar mechanisms are utilized in tethering other KASH domain proteins to the NE, including C.elegans Unc-83 and a recently identified ma mmalian protein, nesprin 3 (Ketema et al., 2007; McGee et al., 2006). Due to th e high conservation among KASH and SUN sequences, it is possible that the LINC comple x provides a general model that applies to all KASH domain protei ns on the ONM. Nesprin 4 Positions the Nucleus in Polariz ed Epithelial Cells Second, this work has extended the nesprin family of proteins to include nesprin 4 (Nesp4), a KASH containing protein that is found exclusively in secretory (exocrine) epithelial cells and which is upregulated in differentiating mammary epithelial cell s. Polarized epithelial cells have a specific internal organization. The nu cleus is positioned near the basal domain while the centrosome lies between the nucleus and Go lgi apparatus. The pos itioning of the Golgi apparatus might facilitate the e ffective delivery of secretory pr oteins to the apical surface. Microtubules typically ali gn along the apico-basolatera l axis with plus ends oriented toward the basal surface. We have observed a polarized distribution of exoge nous Nesp4 in fibroblasts that coincides with a dramatic separation of the cen trosome and Golgi apparatus from the nucleus. We have also shown that Nesp4 binds to the plus-end directed microt ubule motor, kinesin I (Kif5B). Taken together, these da ta have led us to suggest a mechanism for nuclear positioning in polarized epithelial cells by which Nesp4 direct s the nucleus to the plus ends of microtubules

PAGE 125

125 in a kinesin I dependent fashion. Thus, it app ears that Nesp4 appears plays a role in the maintenance of nuclear positioning relative to the centrosome. Significance The LINC Complex and Mechanotransduction As discussed earlier (chapt er 1), m echanical coupling between the nucleus and the cytoplasm has been documented in many studies. Ma niotis et al. (1997) fi rst demonstrated this by showing that the micromanipulation of in tegrins at the plasma membrane engaged cytoskeletal filaments in transmitting force to the nucleus. Broers and Lammerding went on to show that the integrity of this system is disrupted in Lmna -/cells (Broers et al., 2004; Lammerding et al., 2004). Not only are cytoskeletal rigidity and nuclear integrity impacted in these cells, but the transcription of mechanosensitive genes is impaired as well. The LINC complex may explain theses observations by inte grating the nucleus into a continuous protein matrix that extends from the cell surface to the nuclear interior via cytoskeletal components. Such a complex would serve several purposes. It would first allow for a direct signaling mechanism to the nuclear interior, which would f acilitate rapid gene tran scription and regulation. For example, re-positioning of the nucleus may o ccur in response to extracellular or cell surface events, such as the establishment of focal adhesions in a migrating cell. My prediction is that nuclear positioning is much more highly regulated than what current data reveals. Additionally, it also provides a solid anchor at the nuclear envelope that can withstand exterior forces when the nucleus must be repositioned inside the cell. It likely stabilizes the re gular spacing between the INM and ONM and preserves the NE in such cases. In support of this, our work showed that breakage of the SUN-KASH interaction resulted in a dramatic dilation of the ONM (Crisp et al., 2006). Also, in accordance with the Lmna -/experiments described above, the LINC complex likely plays an essential role in allowing the cell as a whole to cope with stress. If this were the

PAGE 126

126 case, disruption of key interactio ns anywhere along the LINC asse mbly would result in the same stress-induced cytoskeletal instability observed in Lmna-/ fibroblasts. Possibly, the reverse may be true if a cytoskeletal break increases nuclear fragility. However, this notion must be tested. In all likelihood, studies testing th e effects of nesprin deficiency or disruption of the KASH-SUN linkage are currently underway. Laminopathies and the LINC Complex The LINC com plex may provide some insight to understanding the peculiar pleiotropy of the LMNA gene. Over a dozen different lami nopathies arise from defects in the LMNA gene alone. In all likelihood, what we are observing is the downstream effects of LMNA mutations on associated partners. Defects in both A-type lamins and emerin l ead to emery-dreifuss muscular dystrophy (EDMD). Interestingly, nesprins 1 an d 2, which are predominant in cardiac and skeletal muscle, have also been linked to EDMD pathology (Zhang et al., 2007). Additionally, knockdown of nesprins in normal fibroblasts can recapitulate the EDMD phenotype on a subcellular level (refer to chapter 1). The gi ant nesprins, which contain numerous spectrin repeats, are well equipped to withstand the extensive mechanical stress experienced by contracting muscles. Thus, a disruption in Nesp1G or Nesp2G may weaken the overall cytoskeletal structure and help to explain the muscle deterioration observed in EDMD patients. The interconnected nature of NE proteins re presented by the LINC complex may tell us that mutations in the LMNA gene may not only affect the A-t ype lamins but may result in the disruption of other partner proteins or regulat ory molecules, as of yet unknown, that may act on LINC complex proteins. Additionally, signal transmission thr ough the LINC complex may be hampered if any components are affected. The downstream effect, manifested as a laminopathy, may depend on the particular functions of prot eins within this complex. As we now know,

PAGE 127

127 nesprins assume many roles through their interactions with an increasing repertoire of cytoplasmic partners. The LINC and Regulation The LINC com plex gives us a general model w ith which to build on. The extent and nature of the interactions within the LINC complex rema in to be elucidated and very likely involve other regulatory components. A recent report pres ented data that shows that the AAA+ ATPase, Torsin A, functions with LAP1 to maintain Ne sp2G in the NE of fibroblasts (Luxton et al., 2007). Loss of Torsin A results in impeded cell migration, nuclear movement and centrosome polarization (Luxton et al., 2007). Additionally, Tors in A was also reported to bind to Nesp3 (Nery et al., 2007). As a soluble pr otein, Torsin A could act as an intermediate prot ein within the PNS that regulates SUN-KASH interactions. As the field uncovers more potential binding pa rtners for LINC complex constituents, we are developing a more complex view of mechani cal coupling and discover ing added layers of regulation, such as with Torsin A. This may help to explain specialized nesprins or nesprins with multiple functions and help to elucidate the diverse phenotypes observed for laminopathies. Specialization of Nesprins The discovery of m ultiple splice isoforms of nesprins 1 and 2 s uggests that different species are specialized for discre et functions. This notion has been reinforced by the isolation of Nesp3, which forms connections to the intermediate filament system, and now Nesp4, which provides links to microtubules. Nesp4 is the first mammalian nesprin shown to interact exclusively with a motor protei n, although kinesin binding had been reported for Nesp2G (Fan and Beck, 2004). It is yet to be determined how interactions between kinesin and Nesp4 are regulated. There is the issue that some microtubules are in fact orie nted with their plus ends at the apical domain in polarized epithelial cells.

PAGE 128

128 One could also argue that nesprin structure play s an important role in function as well. For example, the largest nesprins, Nesp1G and Nesp2G contain actin-binding domains. Zhen et al. (2002) created a chimera by deleting the large central region of Nesp2G between the actinbinding domain (ABD) and the KASH mo tif. Transfection of this construct into cells resulted in the ectopic recruitment of actin to the nuclear membrane, s uggesting that there is a selective advantage in spatially separating the ABD from the nuclear surface (Starr and Han, 2003). The backbone of Nesp1G and Nesp2G also accommodates a large number of spectrin repeats. Given that spectrins are known to confer elasticity to a protein, the large size of the nesprins may also allow for flexibility. How this relates to function remains to be seen. In the same vein, the small size of Nesp4 may limit its flexibil ity. This would be a sensible characteristic, as a more rigid linkage could potentially facilitate movement of the nucleus with motor proteins. Thus, it could be presumed that nesprin struct ure is also tailored to meet th e needs of a cell-type specific function. Unique Qualities of Nesprin 4 Certain global aspects of mammalian nesprins pertaining to general structure, anchorage, topology and localization have been described. Functionally, nesprins are known for their role in nuclear positioning. However, it ap pears that Nesp4 employs a distinct mechanism for nuclear positioning in epithelial cells. Also, the extent to which Nesp4 perturbs the separation of the nucleus and centrosome has never been demonstrat ed before. Given what is known about nuclear position relative to the centrosome and Golgi apparatus in epithelial cells, we could predict that Nesp4 plays a role in ep ithelial morphogenesis. The identification of nesprins has completely changed our view of the nuclear envelope. Not only is it involved in organi zing and maintaining nuclear archit ecture but it has become clear that it is important in cytoplasmi c organization as well. In partic ular, the interaction between the

PAGE 129

129 SUN and KASH domains within the LINC complex appears to be critical to achieving those functions and represents an evolutionarily conserved strategy shared among multiple species. Future Directions Mechanical Coupling of the Nucleus and Cytoplasm Several approaches will need to be take n to fully understand the nucleo-cytoplasm ic connection at the NE. First determine the comple xity of the LINC complex. A prerequisite to understanding the function of a prot ein is to specify and characteri ze its interactions. This could serve several purposes: Identification of nesprin and SUN binding partners will help to uncover possible mechanisms of regulation. In the case of nesprins that have the capacity to bind to multiple cytoskeletal components this could expose spatial and temporal cues that may direct the function of a nesprin protein toward a particular function. For example, Nesp2G is now known to bind both to actin and kinesn I (M. Schneider et al., 2007; Zhen et al., 2002). This may imply that Nesp2G may require a regulatory switch to sh ift between mechanical signaling and nuclear positioning functions. Given that there are other nesprin isoforms a nd KASH domain proteins that associate with other organelles, such as the Golgi, centrosome or mitochondria (Gough et al., 2003; Hedgecock and Thomson, 1982; Malone et al., 2003), defining a specific sequence that targets ONMlocalized nesprins to the NE would be useful in predicting the localizations of as yet uncharacterized nesprins. Our work has shown that SUN domain proteins are involved in the localization of Nesp2G and possibly Nesp4 to the ONM. It would be intere sting to determine if all nesprins do indeed share a common tethering mechan ism. Although recent studies consistently define SUN domain

PAGE 130

130 proteins as nesprin tethers, th e extent of those interactions and involvement of other minor players has not been determined. Studies that perturb nesp rin and SUN proteins both in vitro and in vivo would give us more insight into their function. To confirm those findings, it would be useful to reintroduce wild type genes into cells to determine if the phenot ype cause by those pertur bations can be rescued. Given that nesprin genes encode a large number of isoforms, experiments that target only the giant nesprins, for example, would require careful design if indeed they are even feasible. Another useful goal for the field in general would be to determine the role of nesprins and SUNS in disease pathology. One way to approach this would be to perform mutation screening of patients with known laminopathy syndromes. Alternatively, one could observe effects on nesprins, or other LINC complex constituents in mous e models bred to replicate theses diseases. Nesprin 4 Nesprin 4 has proven to be a surprising and ve ry interesting discovery and opens a door to understanding the broad scope of fu nctions nesprins play in the cel l. Overall, it seem s that the functions of nesprins stem from the fundament al and necessary positioning of the nucleus in multiple cell and tissue contexts. We want to und erstand more clearly what makes this event unique to epithelial cells and how it actually takes place. Our work in fibroblasts has given us many clues about nesprin 4. However, since it is found only in epithelial cells in situ, this gives us only an indi rect look at Nesp4 function. Unfortunately, an appropriate epithelial cell system does not currently exist. Many approaches can be taken to circumvent this problem. First of all, we plan to explore the physiological significance of Nesp4 by making use of Nesp4 null mice that have recently been bred. Homozygotes from this line are viab le and show no overt pathology (Colin Stewart, personal communication). However, studies of comparative histol ogy of mice with and without

PAGE 131

131 Nesp4 have yet to be performed. Given that we have found Nesp4 expression only in pancreas, salivary, bulbourethral and mammary glands of mice, we would suspect that changes in these tissues might be apparent. Perhaps reduced enzyma tic secretion may be detected in the pancreas and mouth or pregnant females may produce less milk. A very useful application offered here is to explore the possible role of Nesp4 in epithelial morphogenesis, and mammary morphogenesis in part icular. Some preliminar y data has indicated that Nesp4 may be upregulated at the onset of pregnancy in mice. Thus, the progression of mammary development, including normal milk production, could be assessed for normal and Nesp4 null mice. In all cases we would observe the Nesp4 func tion at cell and tissue levels. If cells are properly polarized within a tissue with no advers e effects on cytoskeletal arrangements, Nesp4 may only be responsible for movement of the nuc leus and may not be responsible for inducing global changes as epithelial cells differentiate and polarize. Our suspicion is that Nesp4 does play an important role in the induc tion of cellular changes associated with cell polarization. We observed the asymmetric distri bution of Nesp4 in the NE in fibroblasts after transient tr ansfected with HA-Nesp4. Likewi se, human salivary gland (HSG) cells stably expressing HA-Nesp4 exhibit a similar polarized phenot ype in cells located at the periphery of HSG islands which form after a few days in culture. The best approach would be to observe cells stably expressi ng a GFP-tagged Nesp4 construct or cells transiently transfected with GFP-Nesp4 in real-time. This would allow us to determine the course of nuclear movement as cells polarize. RFP labeling of other components, such as tubulin, could give us an indication as to the effects of Nesp4 expression on cytoskeletal organization, for example.

PAGE 132

132 We have traditionally viewed the nuclear envelope simply as a container for the genome. This view is slowly being changed, as the appe arance of the nesprins has revealed that NE function is far more complicated than originally thought. Nesprins may enable the NE to serve as a conduit for the transmission of mechanical signal s, a stabilizer of cellular integrity and a dock for cytoplasmic components that determine the pos ition of the organelles within the cell. Besides the nesprins, only a dozen or so INM proteins have been characterized and only recently have we seen that some may serve more functions beyond ar chitectural scaffolding. Given that at least 60, mostly uncharacterized, integral membrane prot eins are now known to reside in the NE, it is clear that we are only starting to scratch the surf ace in understanding the comp lexity of the NE. It seems we have our work cut out for us for many years to come.

PAGE 133

133 LIST OF REFERENCES Ada m, S.A., R.E. Sterne-Marre, and L. Gerace. 1990. Nuclear protein import in permeabilized mammalian cells requires sol uble cytoplasmic factors. J. Cell Biol. 111:807-816. Aebi, U., J. Cohn, L. Buhle, and L. Gerace. 1986. The nuclear lamina is a meshwork of intermediate-type filaments. Nature. 323:560-4. Apel, E.D., R.M. Lewis, R.M. Grady, and J.R. Sanes. 2000. Syne-1, a dystrophinand Klarsichtrelated protein associated with synap tic nuclei at the neuromuscular junction. J Biol Chem 275:31986-95. Ash, J.F., D. Louvard, and S.J. Singer. 1977. An tibody-induced linkages of plasma membrane proteins to intracellular actomyosin-contai ning filaments in cultured fibroblasts. Proc. Natl. Acad. Sci. USA. 74:5584-5588. Bennett, V., and D.M. Gilligan. 1993. The spectri n-based membrane skeleton and micron-scale organization of the plasma membrane. Annu Rev Cell Biol 9:27-66. Bergo, M.O., B. Gavino, J. Ross, W.K. Schmidt, C. Hong, L.V. Kendall, A. Mohr, M. Meta, H. Genant, Y. Jiang, E.R. Wisner, N. Van Bruggen, R.A. Carano, S. Michaelis, S.M. Griffey, and S.G. Young. 2002. Zmpste24 defi ciency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect. Proc Natl Acad Sci U S A 99:13049-54. Bione, S., E. Maestrini, S. Rivella, M. Manc ini, S. Regis, G. Romeo, and D. Toniolo. 1994. Identification of a novel X-linked gene re sponsible for Emery-Dreifuss muscular dystrophy. Nat Genet. 8:323-7. Blobel, G., and B. Dobberstein. 1975. Transfer of proteins across membranes II. Reconstitution of functional rough microsomes fr om heterologous components. J. Cell Biol. 67:852-862. Bonne, G., M.R. Di Barletta, S. Varnous, H.M. Becane, E.H. Hammouda, L. Merlini, F. Muntoni, C.R. Greenberg, F. Gary, J.A. Urtizberea, D. Duboc, M. Fardeau, D. Toniolo, and K. Schwartz. 1999. Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nat Genet. 21:285-8. Borradori, L., and A. Sonnenberg. 1999. Structure and function of hemidesmosomes: more than simple adhesion complexes. J Invest Dermatol. 112:411-8. Brachner, A., S. Reipert, R. Foisner, a nd J. Gotzmann. 2005. LEM2 is a novel MAN1-related inner nuclear membrane protein a ssociated with A-type lamins. J Cell Sci 118:5797-810. Bray, J.D., V.M. Chennathukuzhi, and N.B. Hech t. 2002. Identification and characterization of cDNAs encoding four novel proteins that inte ract with translin associated factor-X. Genomics 79:799-808.

PAGE 134

134 Bre, M.H., R. Pepperkok, A.M. Hill, N. Levilliers, W. Ansorge, E.H. Stelzer, and E. Karsenti. 1990. Regulation of microtubule dynamics and nucleation during polarization in MDCK II cells. J Cell Biol 111:3013-21. Broers, J.L., B.M. Machiels, H.J. Kuijpers, F. Smedts, R. van den Kieboom, Y. Raymond, and F.C. Ramaekers. 1997. Aand B-type lamins are differentially expressed in normal human tissues. Histochem Cell Biol 107:505-17. Broers, J.L., E.A. Peeters, H.J. Kuijpers, J. Endert, C.V. Bouten, C.W. Oomens, F.P. Baaijens, and F.C. Ramaekers. 2004. Decreased mechanical stiffness in LMNA-/cells is caused by defective nucleo-cytoskeletal integrity: implications for the development of laminopathies. Hum Mol Genet 13:2567-80. Broers, J.L., F.C. Ramaekers, G. Bonne, R.B. Yaou, and C.J. Hutchison. 2006. Nuclear lamins: laminopathies and their role in premature ageing. Physiol Rev 86:967-1008. Burke, B. 2001. Lamins and apoptosis: a two-way street? J Cell Biol 153:F5-7. Burke, B. 2006. Cell biology. Nuclear pore complex models gel. Science. 314:766-7. Burke, B., G. Griffiths, H. Reggio, D. Louvard, and G. Warren. 1982. A monoclonal antibody against a 135k Golgi membrane protein. EMBOJ. 2:1621-1628. Burke, B., L.C. Mounkes, and C.L. Stewart. 2001. The nuclear envelope in muscular dystrophy and cardiovascular diseases. Traffic 2:675-83. Burke, B., and C.L. Stewart. 2002. Life at the edge: the nuclear envelope and human disease. Nat Rev Mol Cell Biol 3:575-85. Burnette, W.N. 1981. 'Western blotting': electrop horetic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and ra dioiodinated protein A. Anal. Biochem. 112:195-203. Callan, H.G., and S.G. Tomlin. 1950. Experimental studies on amphibian oocyte nuclei. I. Investigation of the struct ure of the nuclear membrane by means of the electron microscope. Proc R Soc Lond B Biol Sci 137:367-78. Cao, H., and R. Hegele. 2000. Nuclear lamin A/C R482Q mutation in cana dian kindreds with Dunnigan-type familial partial lipodystrophy. Hum Mol Genet 9 109-12. Chen, L., L. Lee, B.A. Kudlow, H.G. Dos Santos, O. Sletvold, Y. Shafeghati, E.G. Botha, A. Garg, N.B. Hanson, G.M. Martin, I.S. Mi an, B.K. Kennedy, and J. Oshima. 2003. LMNA mutations in atypical Werner's syndrome. Lancet 362:440-5. Clements, L., S. Manilal, D.R. Love, and G.E. Morris. 2000. Direct inte raction between emerin and lamin A. Biochem Biophys Res Commun 267:709-14.

PAGE 135

135 Cohen, T.V., O. Kosti, and C.L. Stewart. 2007. The nuclear envelope pr otein MAN1 regulates TGFbeta signaling and vasculogene sis in the embryonic yolk sac. Development 134:1385-95. Crisp, M., Q. Liu, K. Roux, J.B. Rattner, C. Shanahan, B. Burke, P.D. Stahl, and D. Hodzic. 2006. Coupling of the nucleus and cytopl asm: role of the LINC complex. J Cell Biol 172:41-53. De Sandre-Giovannoli, A., R. Bernard, P. Cau, C. Navarro, J. Amiel, I. Boccaccio, S. Lyonnet, C.L. Stewart, A. Munnich, M. Le Merre r, and N. Levy. 2003. Lamin a truncation in Hutchinson-Gilford progeria. Science 300:2055. De Sandre-Giovannoli, A., M. Chaouch, S. Kozlov, J.M. Vallat, M. Tazir, N. Kassouri, P. Szepetowski, T. Hammadouche, A. Vandenberghe, C.L. Stewart, D. Grid, and N. Levy. 2002. Homozygous defects in LMNA, encoding lamin A/C nuclear-envelope proteins, cause autosomal recessive axonal neuropathy in human (Charcot-Marie-Tooth disorder type 2) and mouse. Am J Hum Genet 70:726-36. Dessev, G.N., C. Iovcheva-Dessev, and R.D. Goldman. 1990. Lamin dimers. Presence in the nuclear lamina of surf clam oocytes a nd release during nuclear envelope breakdown. J Biol Chem 265:12636-41. Dhe-Paganon, S., E.D. Werner, Y.I. Chi, and S. E. Shoelson. 2002. Structure of the globular tail of nuclear lamin. J Biol Chem 277:17381-4. Ding, X., R. Xu, J. Yu, T. Xu, Y. Zhuang, a nd M. Han. 2007. SUN1 is required for telomere attachment to nuclear envelope and gametogenesis in mice. Dev Cell 12:863-72. Djinovic-Carugo, K., M. Gautel, J. Ylanne, and P. Young. 2002. The spectrin repeat: a structural platform for cytoskelet al protein assemblies. FEBS Lett 513:119-23. Dorner, D., S. Vlcek, N. Foeger, A. Gajewski, C. Makolm, J. Gotzmann, C.J. Hutchison, and R. Foisner. 2006. Lamina-associated polypeptide 2alpha regulates cell cycle progression and differentiation via the re tinoblastoma-E2F pathway. J Cell Biol 173:83-93. Dreger, M., L. Bengtsson, T. Schoneberg, H. Otto, and F. Hucho. 2001. Nuclear envelope proteomics: novel integral membrane prot eins of the inner nuclear membrane. Proc Natl Acad Sci U S A 98:11943-8. Drummond, S.P., and K.L. Wilson. 2002. Interfer ence with the cytoplasmic tail of gp210 disrupts "close apposition" of nuclear membranes and blocks nuclear pore dilation. J Cell Biol 158:53-62. Ehmsen, J., E. Poon, and K. Davies. 2002. Th e dystrophin-associated protein complex. J Cell Sci 115:2801-3.

PAGE 136

136 Elgsaeter, A., B. Stokke, A. Mikkelsen, and D. Branton. 1986. The molecular basis of erythrocyte shape. Science 234:1217-23. Ellenberg, J., and J. Lippincott-Schwartz. 1999. Dynamics and mobility of nuclear envelope proteins in interphase and m itotic cells revealed by green fluorescent protein chimeras. Methods. 19:362-72. Ellenberg, J., E.D. Siggia, J.E. Moreira, C. L. Smith, J.F. Presley, H.J. Worman, and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and reassembly in living cells: targeting of an inner Nucl ear membrane protein in interphase and mitosis. J. Cell Biol. 138:1193-1206. Emery, A.E. 1987. X-linked muscular dystrophy with early contractures and cardiomyopathy (Emery-Dreifuss type). Clin Genet 32:360-7. Englander, L.L., and L.L. Rubin. 1987. Acetylcho line receptor clustering and nuclear movement in muscle fibers in culture. J Cell Biol 104:87-95. Eriksson, M., W.T. Brown, L.B. Gordon, M.W. Glynn, J. Singer, L. Scott, M.R. Erdos, C.M. Robbins, T.Y. Moses, P. Berglund, A. Dutra, E. Pak, S. Durkin, A.B. Csoka, M. Boehnke, T.W. Glover, and F.S. Collins. 2003. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 423:293-8. Fan, J., and K.A. Beck. 2004. A role for the spectrin superfamily member Syne-1 and kinesin II in cytokinesis. J Cell Sci 117:619-29. Fatkin, D., C. MacRae, T. Sasaki, M.R. Wolff, M. Porcu, M. Frenneaux, J. Atherton, H.J. Vidaillet, Jr., S. Spudich, U. De Girolami J.G. Seidman, C. Seidman, F. Muntoni, G. Muehle, W. Johnson, and B. McDonough. 1999. Missense mutations in the rod domain of the lamin A/C gene as causes of di lated cardiomyopathy and conduction-system disease. N Engl J Med 341:1715-24. Feuerbach, F., V. Galy, E. Trelles-Sticken, M. Fromont-Racine, A. Jacquier, E. Gilson, J.C. Olivo-Marin, H. Scherthan, and U. Nehrbass. 2002. Nuclear architecture and spatial positioning help establish transcriptiona l states of telomeres in yeast. Nat Cell Biol 4:214-21. Fischer, J.A., S. Acosta, A. Kenny, C. Cater, C. Robinson, and J. Hook. 2004. Drosophila klarsicht has distinct subcellular localiz ation domains for nuclear envelope and microtubule localiza tion in the eye. Genetics 168:1385-93. Fisher, D.Z., N. Chaudhary, and G. Blobel. 1986. cDNA sequencing of nuclear lamins A and C reveals primary and secondary structural homology to intermediate filament proteins. Proc Natl Acad Sci U S A 83:6450-4.

PAGE 137

137 Fong, L.G., J.K. Ng, J. Lammerding, T.A. Vickers, M. Meta, N. Cote, B. Gavino, X. Qiao, S.Y. Chang, S.R. Young, S.H. Yang, C.L. Stewart, R.T. Lee, C.F. Bennett, M.O. Bergo, and S.G. Young. 2006. Prelamin A and lamin A appe ar to be dispensable in the nuclear lamina. J Clin Invest. 116:743-52. Foster, H.A., P. Stokes, K. Forsey, H.J. Lees e, and J.M. Bridger. 2007. Lamins A and C are present in the nuclei of early porcine embryos, with lamin A being distributed in large intranuclear foci. Chromosome Res 15:163-74. Frangioni, J.V., and B.G. Neel 1993. Solubilization and purificat ion of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal Biochem 210:179-87. Fridkin, A., E. Mills, A. Margalit, E. Neufeld, K.K. Lee, N. Feinstein, M. Cohen, K.L. Wilson, and Y. Gruenbaum. 2004. Matefin, a Caenorhabditis elegans germ line-specific SUNdomain nuclear membrane protein, is essential for early embryonic and germ cell development. Proc Natl Acad Sci U S A 101:6987-92. Fried, H., and U. Kutay. 2003. Nucleocytoplasmic transport: taking an inventory. Cell Mol Life Sci 60:1659-88. Funabiki, H., I. Hagan, S. Uzawa, and M. Yanagida. 1993. Cell cycle-dependent specific positioning and clustering of centromeres and telomeres in fission yeast. J Cell Biol 121:961-76. Furukawa, K., N. Pante, U. Aebi, and L. Gerace. 1995. Cloning of a cDNA for lamina-associated polypeptide 2 (LAP2) and identification of regi ons that specify targeting to the nuclear envelope. Embo J 14:1626-36. Gerace, L., and G. Blobel. 1980. The nuclear enve lope lamina is reversibly depolymerized during mitosis. Cell 19:277-87. Gerace, L., A. Blum, and G. Blobel. 1978a. I mmunocytochemical localization of the major polypeptides of the nuclear complex-lamina fraction: interphase and mitotic distribution. J. Cell Biol. 79:546-566. Gerace, L., A. Blum, and G. Blobel. 1978b. I mmunocytochemical localization of the major polypeptides of the nuclear pore complex-lamina fraction. Interphase and mitotic distribution. J Cell Biol 79:546-66. Gerace, L., and B. Burke. 1988a. Functiona l organization of the nuclear envelope. Annu Rev Cell Biol 4:335-74. Gerace, L., and B. Burke. 1988b. Functional organization of the nuclear envelope. Ann. Rev. Cell Biol. 4:335-374.

PAGE 138

138 Gerace, L., C. Comeau, and M. Benson. 1984. Orga nization and modulation of nuclear lamina structure. J Cell Sci Suppl 1:137-60. Glass, C.A., J.R. Glass, H. Ta niura, K.W. Hasel, J.M. Blevit t, and L. Gerace. 1993. The alphahelical rod domain of human lamins A and C contains a chromatin binding site. Embo J 12:4413-24. Gleeson, J.G., K.M. Allen, J.W. Fox, E.D. Lamperti S. Berkovic, I. Scheffer, E.C. Cooper, W.B. Dobyns, S.R. Minnerath, M.E. Ross, and C.A. Walsh. 1998. Doublecortin, a brainspecific gene mutated in human X-linked lis sencephaly and double cortex syndrome, encodes a putative signaling protein. Cell 92:63-72. Goldman, R.D., Y. Gruenbaum, R.D. Moir, D. K. Shumaker, and T.P. Spann. 2002. Nuclear lamins: building blocks of nuclear architecture. Genes Dev. 16:533-47. Gomes, E.R., S. Jani, and G.G. Gunderse n. 2005. Nuclear movement regulated by Cdc42, MRCK, myosin, and actin flow establishes MTOC polariza tion in migrating cells. Cell 121:451-63. Gough, L.L., J. Fan, S. Chu, S. Winnick, and K. A. Beck. 2003. Golgi localization of Syne-1. Mol Biol Cell. 14:2410-24. Grady, R.M., D.A. Starr, G.L. Ackerman, J.R. Sanes, and M. Han. 2005. Syne proteins anchor muscle nuclei at the neuromuscular junction. Proc Natl Acad Sci U S A 102:4359-64. Gros-Louis, F., N. Dupre, P. Dion, M.A. Fox, S. Laurent, S. Verreault, J.R. Sanes, J.P. Bouchard, and G.A. Rouleau. 2007. Mutations in SYNE1 lead to a newly discovered form of autosomal recessive cerebellar ataxia. Nat Genet 39:80-5. Gruenbaum, Y., A. Margalit, R.D. Goldman, D.K. Shumaker, and K.L. Wilson. 2005. The nuclear lamina comes of age. Nat Rev Mol Cell Biol 6:21-31. Gruenbaum, Y., K.L. Wilson, A. Harel, M. Goldberg, and M. Cohen. 2000. Review: nuclear lamins--structural proteins with fundamental functions. J Struct Biol 129:313-23. Grum, V.L., D. Li, R.I. MacDonald, and A. Mondragon. 1999. Structures of two repeats of spectrin suggest models of flexibility. Cell 98:523-35. Guilak, F. 1995. Compression-induced changes in the shape and volume of the chondrocyte nucleus. J Biomech 28:1529-41. Guild, G.M., P.S. Connelly, M.K. Shaw, and L.G. Tilney. 1997. Actin filament cables in Drosophila nurse cells are composed of modules that slide passively past one another during dumping. J Cell Biol 138:783-97.

PAGE 139

139 Guilly, M.N., J.P. Kolb, F. Gosti, F. Godeau, and J.C. Courvalin. 1990. Lamins A and C are not expressed at early stages of human lymphocyte differentiation. Exp Cell Res 189:145-7. H. Petersen, M. Meyerzon, and D.A. St arr. 2007. Nuclear Envelope Components and Coordination of Microtubule Mo tors during Nuclear Positioning. The American Society for Cell Biology Meeting Abstracts [on CD-ROM] :Abstract #714. Haas, M., and E. Jost. 1993. Functional analys is of phosphorylation sites in human lamin A controlling lamin disassembly, nuclear transport and assembly. Eur J Cell Biol. 62:23747. Hagan, I., and M. Yanagida. 1990. Novel potential mitotic motor pr otein encoded by the fission yeast cut7+ gene. Nature 347:563-6. Hagan, I., and M. Yanagida. 1992. Kinesin-related cut7 protein associates with mitotic and meiotic spindles in fission yeast. Nature. 356:74-6. Hagan, I., and M. Yanagida. 1995. The product of th e spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J Cell Biol 129:1033-47. Hagan, I., and M. Yanagida. 1997. Evidence for cel l cycle-specific, spindle pole body-mediated, nuclear positioning in the fission yeast Schizosaccharomyces pombe. J Cell Sci. 110 ( Pt 16):1851-66. Handwerger, K.E., and J.G. Gall. 2006. Subnuclear organelles: new insights into form and function. Trends Cell Biol. 16:19-26. Haque, F., D.J. Lloyd, D.T. Smallwood, C.L. Dent C.M. Shanahan, A.M. Fry, R.C. Trembath, and S. Shackleton. 2006. SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to provide a physical connection between the nuclear lamina and the cytoskeleton. Mol Cell Biol. 26:3738-51. Harborth, J., S.M. Elbashir, K. Bechert, T. Tuschl, and K. Weber. 2001. Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Sci 114:4557-65. Hartmann, J.F. 1953. An electron optical study of sections of central nervous system. J Comp Neurol 99:201-49. Hasan, S., S. Guttinger, P. Muhlhausser, F. Anderegg, S. Burgler, and U. Kutay. 2006. Nuclear envelope localization of human UNC84A does not require nuclear lamins. FEBS Lett 580:1263-8. Hedgecock, E.M., and J.N. Thomson. 1982. A ge ne required for nuclear and mitochondrial attachment in the nematode Caenorhabditis elegans Cell 30:321-30.

PAGE 140

140 Hellemans, J., O. Preobrazhenska, A. Willaert, P. Debeer, P.C. Verdonk, T. Costa, K. Janssens, B. Menten, N. Van Roy, S.J. Vermeulen, R. Savarirayan, W. Van Hul, F. Vanhoenacker, D. Huylebroeck, A. De Paepe, J.M. Naeyaert, J. Vandesompele, F. Speleman, K. Verschueren, P.J. Coucke, and G.R. Mortier. 2004. Loss-of-function mutations in LEMD3 result in osteopoikilosis, Buschke -Ollendorff syndrome and melorheostosis. Nat Genet 36:1213-8. Hodzic, D.M., D.B. Yeater, L. Bengtsson, H. Otto, and P.D. Stahl. 2004. Sun2 is a novel mammalian inner nuclear membrane protein. J Biol Chem 279:25805-12. Hoeger, T.H., G. Krohne, and W.W. Franke 1988. Amino acid sequence and molecular charactarization of murine lamin B as deduced from cDNA clones. Eur. J. Cell Biol. 47:283-290. Hoeger, T.H., K. Zatloukal, I. Waizenegger, and G. Krohne. 1990. Characterization of a second highly conserved B-type lamin present in cells previously thought to contain only a single B-type lamin. Chromosoma 99:379-390. Holaska, J.M., S. Rais-Bahrami, and K.L. W ilson. 2006. Lmo7 is an emerin-binding protein that regulates the transcription of emerin and many other muscle-relevant genes. Hum Mol Genet 15:3459-72. Holaska, J.M., and K.L. Wilson. 2007. An emerin "proteome": purification of distinct emerincontaining complexes from HeLa cells s uggests molecular basis for diverse roles including gene regulation, mRNA splicing, signaling, mechanosensing, and nuclear architecture. Biochemistry 46:8897-908. Holmer, L., and H.J. Worman. 2001. Inner nuclear membrane proteins: functions and targeting. Cell Mol Life Sci 58:1741-7. Holtz, D., R.A. Tanaka, J. Hartwig, and F. McKeon. 1989. The CaaX Motif of lamin A functions in conjunction with the nuclear localization si gnal to target assembly to the nuclear envelope. Cell 59:969-977. Horton, H., I. McMorrow, and B. Burke. 1992. I ndependent expression and assembly properties of heterologous lamins A and C in embryonal carcinomas. Eur. J. Cell Biol. 57:172-183. Jaspersen, S.L., A.E. Martin, G. Glazko, T.H. Gi ddings, Jr., G. Morgan, A. Mushegian, and M. Winey. 2006. The Sad1-UNC-84 homology domain in Mps3 interacts with Mps2 to connect the spindle pole body with the nuclear envelope. J Cell Biol 174:665-75. Jaulin, F., X. Xue, E. Rodriguez-Boulan, and G. Kreitzer. 2007. Polarization-dependent selective transport to the apical membrane by KIF5B in MDCK cells. Dev Cell 13:511-22.

PAGE 141

141 Keating, T.J., and G.G. Borisy. 1999. Cent rosomal and non-centrosomal microtubules. Biol Cell 91:321-9. Keays, D.A., G. Tian, K. Poirier, G.J. Huang, C. Siebold, J. Cleak, P.L. Oliver, M. Fray, R.J. Harvey, Z. Molnar, M.C. Pinon, N. Dear, W. Valdar, S.D. Brown, K.E. Davies, J.N. Rawlins, N.J. Cowan, P. Nolan, J. Chelly, and J. Flint. 2007. Mutations in alpha-tubulin cause abnormal neuronal migration in mice and lissencephaly in humans. Cell 128:4557. Ketema, M., K. Wilhelmsen, I. Kuikman, H. Janssen, D. Hodzic, and A. Sonnenberg. 2007. Requirements for the localization of nesprin-3 at the nuclear envelope and its interaction with plectin. J Cell Sci 120:3384-94. King, M.C., C.P. Lusk, and G. Blobel. 2006. Kar yopherin-mediated import of integral inner nuclear membrane proteins. Nature 442:1003-7. Kitten, G.T., and E.A. Nigg. 1991. The CaaX motif is required for isoprenylation, carboxyl methylation, and nuclear membra ne association of lamin B2. J Cell Biol 113:13-23. Krimm, I., C. Ostlund, B. Gilquin, J. Couprie, P. Hossenlopp, J.P. Mornon, G. Bonne, J.C. Courvalin, H.J. Worman, and S. Zinn-Just in. 2002. The Ig-like structure of the Cterminal domain of lamin A/C, mutated in muscular dystrophies, cardiomyopathy, and partial lipodystrophy. Structure. 10:811-23. Krohne, G., I. Waizenegger, and T.H. Hoeger. 1989. The conserved carboxy-terminal cysteine of nuclear lamins is essential for asso ciation with the nuclear envelope. J. Cell Biol. 109:2003-2011. Laemmli, U.K. 1970. Cleavage of structural pr oteins during assembly of the head of bacteriophage T4. Nature. 227:680-685. Lammerding, J., J. Hsiao, P.C. Schulze, S. Kozlov, C.L. Stewart, and R.T. Lee. 2005. Abnormal nuclear shape and impaired mechanotra nsduction in emerin-deficient cells. J Cell Biol 170:781-91. Lammerding, J., R.D. Kamm, and R.T. Lee. 2004a. Mechanotransduction in cardiac myocytes. Ann N Y Acad Sci 1015:53-70. Lammerding, J., P.C. Schulze, T. Takahashi, S. Kozlov, T. Sullivan, R.D. Kamm, C.L. Stewart, and R.T. Lee. 2004b. Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J Clin Invest 113:370-8. Lazebnik, Y.A., A. Takahashi, R.D. Moir, R.D. Goldman, G.G. Poirier, S.H. Kaufmann, and W.C. Earnshaw. 1995. Studies of the lamin proteinase reveal multiple parallel biochemical pathways during apoptotic execution. Proc Natl Acad Sci U S A 92:9042-6.

PAGE 142

142 Lee, K.K., D. Starr, M. Cohen, J. Liu, M. Han, K.L. Wilson, and Y. Gruenbaum. 2002. Lamindependent localization of UNC-84, a protein required for nuclear migration in Caenorhabditis elegans. Mol Biol Cell 13:892-901. Lee, K.K., and K.L. Wilson. 2004. All in the family: evidence for four new LEM-domain proteins Lem2 (NET-25), Lem3, Lem4 and Lem5 in the human genome. Symp Soc Exp Biol :329-39. Lei, Y., and R. Warrior. 2000. The Drosophila Li ssencephaly1 (DLis1) ge ne is required for nuclear migration. Dev Biol 226:57-72. Lenne, P.F., A.J. Raae, S.M. Altmann, M. Saraste, and J.K. Horber. 2000. States and transitions during forced unfolding of a single spectrin repeat. FEBS Lett 476:124-8. Libotte, T., H. Zaim, S. Abraham, V.C. Padm akumar, M. Schneider, W. Lu, M. Munck, C. Hutchison, M. Wehnert, B. Fahrenkrog, U. Sauder, U. Aebi, A.A. Noegel, and I. Karakesisoglou. 2005. Lamin A/C-dependent localiz ation of Nesprin-2, a giant scaffolder at the nuclear envelope. Mol Biol Cell 16:3411-24. Lin, F., D.L. Blake, I. Callebaut, I.S. Sker janc, L. Holmer, M.W. McBurney, M. PaulinLevasseur, and H.J. Worman. 2000. MAN1, an inner nuclear membrane protein that shares the LEM domain with lamina-associated polypeptide 2 and emerin. J Biol Chem 275:4840-7. Lin, F., J.M. Morrison, W. Wu, and H.J. Worma n. 2005. MAN1, an integral protein of the inner nuclear membrane, binds Smad2 and Smad3 and antagonizes transforming growth factorbeta signaling. Hum Mol Genet 14:437-45. Lin, F., and H.J. Worman. 1993. Structural orga nization of the human gene encoding nuclear lamin A and nuclear lamin C. J Biol Chem 268:16321-6. Lin, F., and H.J. Worman. 1995. Structural orga nization of the human gene (LMNB1) encoding nuclear lamin B1. Genomics. 27:230-6. Liu, J., K.K. Lee, M. Segura-Totten, E. Neuf eld, K.L. Wilson, and Y. Gruenbaum. 2003. MAN1 and emerin have overlapping function(s) esse ntial for chromosome segregation and cell division in Caenorhabditis elegans. Proc Natl Acad Sci U S A 100:4598-603. Liu, J., T. Rolef Ben-Shahar, D. Riemer, M. Tr einin, P. Spann, K. Weber, A. Fire, and Y. Gruenbaum. 2000. Essential roles for Caenorhabditis elegans lamin gene in nuclear organization, cell cycle progression, and spatia l organization of nuclear pore complexes. Mol Biol Cell 11:3937-47. Liu, Q., N. Pante, T. Misteli, M. Elsagga, M. Crisp, D. Hodzic, B. Burke, and K.J. Roux. 2007. Functional association of Sun1 with nuclear pore complexes. J Cell Biol 178:785-98.

PAGE 143

143 Lloyd, D.J., R.C. Trembath, and S. Shackleton. 2002. A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies. Hum Mol Genet 11:769-77. Loewinger, L., and F. McKeon. 1988. Mutations in th e nuclear lamin proteins resulting in their aberrant assembly in the cytoplasm. Embo J 7:2301-9. Luxton, G.W.G., W.T. Dauer, and G.G. Gunders en. 2007. TorsinA Maintain s Nesprin-2G in the Nuclear Envelope to Allow for Nuclear M ovement and Centrosome Polarization in Migrating Cells. The American Society for Cell Biol ogy Meeting Abstracts [on CDROM] :Abstract #1252. M. Schneider, S. A. Neumann, A. A. Noegel, and I. Karakesisoglou. 2007. Kinesin Light Chain 1 a New Binding Partner of Nesprin-2. The American Soceity for Cell Biology Meeting Abstracts [on CD-ROM] :Abstract #2732. Magee, A.I., and M. Hanley. 1988. Sticky fingers and CAAX boxes. Nature. 335:114-115. Maidment, S.L., and J.A. Ellis. 2002. Musc ular dystrophies, dilated cardiomyopathy, lipodystrophy and neuropathy: the nuclear connection. Expert Rev Mol Med 4:1-21. Malone, C.J., W.D. Fixsen, H.R. Horvitz, a nd M. Han. 1999. UNC-84 localizes to the nuclear envelope and is required for nucl ear migration and anchoring during C. elegans development. Development 126:3171-81. Malone, C.J., L. Misner, N. Le Bot, M.C. Tsai J.M. Campbell, J. Ahringer, and J.G. White. 2003. The C. elegans hook protein, ZYG-12, mediates th e essential attachment between the centrosome and nucleus. Cell 115:825-36. Maniotis, A.J., C.S. Chen, and D.E. Ingber. 1997. Demonstration of mechanical connections between integrins, cytoskeletal filament s, and nucleoplasm that stabilize nuclear structure. Proc Natl Acad Sci U S A 94:849-54. Mansharamani, M., and K.L. Wilson. 2005. Direct binding of nuclear membrane protein MAN1 to emerin in vitro and two modes of bi nding to barrier-to-autointegration factor. J Biol Chem 280:13863-70. Maraldi, N.M., G. Lattanzi, C. Capanni, M. Colu mbaro, E. Mattioli, P. Sabatelli, S. Squarzoni, and F.A. Manzoli. 2006. Laminopathies: a chromatin affair. Adv Enzyme Regul. 46:3349. Mather, W.H., and R.F. Fox. 2006. Kinesin's biased stepping mechanism: amplification of neck linker zippering. Biophys J 91:2416-26. Mattout-Drubezki, A., and Y. Gruenbaum. 2003. Dynamic interactions of nuclear lamina proteins with chromatin and transcriptional machinery. Cell Mol Life Sci 60:2053-63.

PAGE 144

144 McGee, M.D., R. Rillo, A.S. Anderson, and D.A. Starr. 2006. UNC-83 IS a KASH protein required for nuclear migration and is recr uited to the outer nuclear membrane by a physical interaction with the SUN protein UNC-84. Mol Biol Cell 17:1790-801. McKeon, F. 1991. Nuclear lamin proteins: domains required for nuclear targeting, assembly, and cell-cycle-regulated dynamics. Curr Opin Cell Biol 3:82-6. Mislow, J.M., J.M. Holaska, M.S. Kim, K.K. Lee, M. Segura-Totten, K.L. Wilson, and E.M. McNally. 2002a. Nesprin-1alpha self-associates and binds directly to emerin and lamin A in vitro. FEBS Lett 525:135-40. Mislow, J.M., M.S. Kim, D.B. Davis, and E.M. McNally. 2002b. Myne-1, a spectrin repeat transmembrane protein of the myocyte inne r nuclear membrane, interacts with lamin A/C. J Cell Sci 115:61-70. Moir, R.D., and R.D. Goldman. 1993. Lamin dynamics. Curr Opin Cell Biol 5:408-11. Morris, N.R. 2000. Nuclear migration. From fungi to the mammalian brain. J Cell Biol 148:1097-101. Mosley-Bishop, K.L., Q. Li, L. Patterson, and J. A. Fischer. 1999. Molecu lar analysis of the klarsicht gene and its role in nuclear migration within differentiating cells of the Drosophila eye. Curr Biol 9:1211-20. Mounkes, L., S. Kozlov, B. Burke, and C.L. St ewart. 2003. The laminopathies: nuclear structure meets disease. Curr Opin Genet Dev 13:223-30. Mounkes, L.C., B. Burke, and C.L. Stewart. 2001. The A-type lamins: nuclear structural proteins as a focus for muscular dystrophy and cardiovascular diseases. Trends Cardiovasc Med 11:280-5. Muchir, A., G. Bonne, A.J. van der Kooi, M. van Meegen, F. Baas, P.A. Bolhuis, M. de Visser, and K. Schwartz. 2000. Identification of muta tions in the gene encoding lamins A/C in autosomal dominant limb girdle muscular dystrophy with atri oventricular conduction disturbances (LGMD1B). Hum Mol Genet 9:1453-9. Musch, A. 2004. Microtubule organization and function in ep ithelial cells. Traffic 5:1-9. Navarro, C.L., P. Cau, and N. Levy. 2006. Mo lecular bases of progeroid syndromes. Hum Mol Genet 15 Spec No 2:R151-61.

PAGE 145

145 Navarro, C.L., A. De Sandre-Giovannoli, R. Bern ard, I. Boccaccio, A. Boyer, D. Genevieve, S. Hadj-Rabia, C. Gaudy-Marqueste, H.S. Smitt, P. Vabres, L. Faivre, A. Verloes, T. Van Essen, E. Flori, R. Hennekam, F.A. Beemer, N. Laurent, M. Le Merrer, P. Cau, and N. Levy. 2004. Lamin A and ZMPSTE24 (FACE-1) de fects cause nuclear disorganization and identify restrictive dermopat hy as a lethal neonatal laminopathy. Hum Mol Genet 13:2493-503. Nery, F.C., J. Zeng, B.P. Niland, J. Hewett, Y. Li, G. Wiche, A. Sonnenberg, and X.O. Breakefield. 2007. TorsinA Participates in Linki ng the Nuclear Envelope to Intermediate Filaments. The American Soceity for Cell Bi ology Meeting Abstracts [on CDROM] :Abstract #1376. Newport, J.W., and D.J. Forbes. 1987. The nucleus: structure, function, and dynamics. Annu Rev Biochem 56:535-65. Nigg, E.A. 1989. The nuclear envelope. Curr Opin Cell Biol. 1:435-40. Novelli, G., A. Muchir, F. Sangiuolo, A. Helblin g-Leclerc, M.R. D'Apice, C. Massart, F. Capon, P. Sbraccia, M. Federici, R. Lauro, C. Tudi sco, R. Pallotta, G. Scarano, B. Dallapiccola, L. Merlini, and G. Bonne. 2002. Mandibuloacr al dysplasia is caused by a mutation in LMNA-encoding lamin A/C. Am J Hum Genet 71:426-31. Ohba, T., E.C. Schirmer, T. Nishimoto, a nd L. Gerace. 2004. Energyand temperaturedependent transport of integral proteins to the inner nuclear membrane via the nuclear pore. J Cell Biol. 167:1051-62. Osada, S., S.Y. Ohmori, and M. Taira. 2003. XMAN1, an inner nuclear membrane protein, antagonizes BMP signaling by interacti ng with Smad1 in Xenopus embryos. Development. 130:1783-94. Ostlund, C., J. Ellenberg, E. Hallberg, J. Lippincott-Schwartz, and H.J. Worman. 1999. Intracellular trafficking of emerin, the Emery-Dreifuss muscular dystrophy protein. J Cell Sci 112 ( Pt 11):1709-19. Ostlund, C., T. Sullivan, C.L. Stewart, and H. J. Worman. 2006. Dependence of diffusional mobility of integral inner nuclear membrane proteins on A-type lamins. Biochemistry 45:1374-82. Padmakumar, V.C., S. Abraham, S. Braune, A.A. Noegel, B. Tunggal, I. Karakesisoglou, and E. Korenbaum. 2004. Enaptin, a giant actin-binding protein, is an element of the nuclear membrane and the actin cytoskeleton. Exp Cell Res 295:330-9. Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abraham, A.A. Noegel, J. Gotzmann, R. Foisner, and I. Karakesisoglou. 2005. The inne r nuclear membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nuclear envelope. J Cell Sci 118:3419-30.

PAGE 146

146 Pan, D., L.D. Estevez-Salmeron, S.L. Stroschei n, X. Zhu, J. He, S. Zhou, and K. Luo. 2005. The integral inner nuclear membrane protein MAN1 physically interacts with the R-Smad proteins to repress signaling by the transforming growth f actor-{beta} superfamily of cytokines. J Biol Chem 280:15992-6001. Patterson, K., A.B. Molofsky, C. Robinson, S. Acosta, C. Cater, and J.A. Fischer. 2004. The functions of Klarsicht and nucle ar lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol Biol Cell 15:600-10. Pekovic, V., J. Harborth, J.L. Broers, F.C. Ramaekers, B. van Engelen, M. Lammens, T. von Zglinicki, R. Foisner, C. Hutchison, and E. Markiewicz. 2007. Nucleoplasmic LAP2{alpha}-lamin A complexes are required to maintain a proliferative state in human fibroblasts. J Cell Biol 176:163-72. Pemberton, L.F., and B.M. Paschal. 2005. Mechanis ms of receptor-mediated nuclear import and nuclear export. Traffic 6:187-98. Pendas, A.M., Z. Zhou, J. Cadinanos, J.M. Freije, J. Wang, K. Hultenby, A. Astudillo, A. Wernerson, F. Rodriguez, K. Tryggvason, a nd C. Lopez-Otin. 2002. Defective prelamin A processing and muscular and adipocyte alterations in Zmpste24 metalloproteinasedeficient mice. Nat Genet. 31:94-9. Peters, R. 2006. Introduction to nucleocytoplas mic transport: molecules and mechanisms. Methods Mol Biol 322:235-58. Pickersgill, H., B. Kalverda, E. de Wit, W. Talhout, M. Fornerod, and B. van Steensel. 2006. Characterization of the Drosophila mela nogaster genome at the nuclear lamina. Nat Genet 38:1005-14. Piercy, R.J., H. Zhou, L. Feng, A. Pombo, F. Muntoni, and S.C. Brown. 2007. Desmin immunolocalisation in autosomal domin ant Emery-Dreifuss muscular dystrophy. Neuromuscul Disord 17:297-305. Powell, L., and B. Burke. 1990a. Internuclear exchange of an inner nuc lear membrane protein (p55) in heterokaryons: in vivo evidence fo r the interaction of p55 with the nuclear lamina. J Cell Biol 111:2225-34. Powell, L., and B. Burke. 1990b. Internuclear exhc hange of an inner nuclear membrane protein (p55) in heterokaryons: in vivo evidence fo r the association of p55 with the nuclear lamina. J. Cell Biol. 111:2225-2234. Prunuske, A.J., and K.S. Ullman. 2006. The nuclear envelope: form and reformation. Curr Opin Cell Biol. 18:108-16.

PAGE 147

147 Raharjo, W.H., P. Enarson, T. Sullivan, C.L. Stew art, and B. Burke. 2001a. Nuclear envelope defects associated with LMNA mutations causing dilated cardiomyopathy and EmeryDreifuss muscular dystrophy. J. Cell Sci. In press. Raharjo, W.H., P. Enarson, T. Sullivan, C.L. St ewart, and B. Burke. 2001b. Nuclear envelope defects associated with LMNA mutations cause dilated cardiomyopathy and EmeryDreifuss muscular dystrophy. J Cell Sci 114:4447-57. Raju, G.P., N. Dimova, P.S. Klein, and H.C. Huang. 2003. SANE, a novel LEM domain protein, regulates bone morphogenetic protein signaling through interaction with Smad1. J Biol Chem 278:428-37. Raska, I., P.J. Shaw, and D. Cmarko. 2006a. Ne w insights into nucleol ar architecture and activity. Int Rev Cytol 255:177-235. Raska, I., P.J. Shaw, and D. Cmarko. 2006b. Stru cture and function of the nucleolus in the spotlight. Curr Opin Cell Biol. 18:325-34. Reiner, O., R. Carrozzo, Y. Shen, M. Wehnert, F. Faustinella, W.B. Dobyns, C.T. Caskey, and D.H. Ledbetter. 1993. Isolation of a Miller -Dieker lissencephaly gene containing G protein beta-subunit-like repeats. Nature. 364:717-21. Rice, S., A.W. Lin, D. Safer, C.L. Hart, N. Na ber, B.O. Carragher, S.M. Cain, E. Pechatnikova, E.M. Wilson-Kubalek, M. Whittaker, E. Pate, R. Cooke, E.W. Taylor, R.A. Milligan, and R.D. Vale. 1999. A structural change in the kinesin motor protein that drives motility. Nature. 402:778-84. Ris, H. 1997. High-resolution field-emission s canning electron microscopy of nuclear pore complex. Scanning. 19:368-75. Rober, R.A., H. Sauter, K. Weber, and M. Osborn. 1990. Cells of the cellular immune and hemopoietic system of the mouse lack lamins A/C: distinction versus other somatic cells. J Cell Sci 95 ( Pt 4):587-98. Rober, R.A., K. Weber, and M. Osborn. 1989. Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 105:365-78. Roeber, R.-A., K. Weber, and M. Osborn. 1989. Di fferential timing of lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development. 105:365-378. Rosenberg-Hasson, Y., M. Renert-Pasca, and T. Volk. 1996. A Drosophila dystrophin-related protein, MSP-300, is required for embryonic muscle morphogenesis. Mech Dev 60:8394.

PAGE 148

148 Roux, K.J., and B. Burke. 2006. From pore to kinetochore and back: regulating envelope assembly. Dev Cell 11:276-8. Rowat, A.C., J. Lammerding, and J.H. Ipsen. 2006. Mechanical properties of the cell nucleus and the effect of emerin deficiency. Biophys J 91:4649-64. Saksena, S., M.D. Summers, J.K. Burks, A.E. Johnson, and S.C. Braunagel. 2006. Importinalpha-16 is a translocon-associat ed protein involved in sorting membrane proteins to the nuclear envelope. Nat Struct Mol Biol 13:500-8. Sanes, J.R., and J.W. Lichtman. 2001. Inducti on, assembly, maturation and maintenance of a postsynaptic apparatus. Nat Rev Neurosci 2:791-805. Schirmer, E.C., L. Florens, T. Guan, J.R. Yates, 3rd, and L. Gerace. 2003. Nuclear membrane proteins with potential disease lin ks found by subtractive proteomics. Science. 301:13802. Schirmer, E.C., L. Florens, T. Guan, J.R. Yate s, 3rd, and L. Gerace. 2005. Identification of novel integral membrane proteins of the nuclear envelope with potentia l disease links using subtractive proteomics. Novartis Found Symp 264:63-76; discussion 76-80, 227-30. Schirmer, E.C., and L. Gerace. 2004. The stability of the nuclear lamina polymer changes with the composition of lamin subtypes according to their individual binding strengths. J Biol Chem 279:42811-7. Schnitzer, M.J., and S.M. Block. 1997. Kinesin hydrolyses one ATP per 8-nm step. Nature. 388:386-90. Segura-Totten, M., and K.L. Wilson. 2004. BAF: ro les in chromatin, nuclear structure and retrovirus integration. Trends Cell Biol 14:261-6. Shackleton, S., D.J. Lloyd, S.N. Jackson, R. Evans, M.F. Niermeijer, B.M. Singh, H. Schmidt, G. Brabant, S. Kumar, P.N. Du rrington, S. Gregory, S. O'Rahilly, and R.C. Trembath. 2000. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat Genet. 24:153-6. Shao, X., H.A. Tarnasky, J.P. Lee, R. Oko, and F.A. van der Hoorn. 1999. Spag4, a novel sperm protein, binds outer dense-fiber protein Odf1 and localizes to microtubules of manchette and axoneme. Dev Biol. 211:109-23. Shumaker, D.K., R.I. Lopez-Soler, S.A. Adam, H. Herrmann, R.D. Moir, T.P. Spann, and R.D. Goldman. 2005. Functions and dysfunctions of the nuclear lamin Ig-fold domain in nuclear assembly, growth, and Em ery-Dreifuss muscular dystrophy. Proc Natl Acad Sci U S A. 102:15494-9. Sinensky, M., K. Fantle, M. Trujillo, T. McLain, A. Kupfer, and M. Dalton. 1994. The processing pathway of prelamin A. J Cell Sci 107 ( Pt 1):61-7.

PAGE 149

149 Smith, S., and G. Blobel. 1993. The first membrane spanning region of the lamin B receptor is sufficient for sorting to the inner nuclear membrane. J Cell Biol 120:631-7. Sonnenberg, A., A.M. Rojas, and J.M. de Pe reda. 2007. The structure of a tandem pair of spectrin repeats of plectin reveals a modular organizati on of the plakin domain. J Mol Biol 368:1379-91. Soullam, B., and H.J. Worman. 1995a. Signals an d structural features involved in integral membrane protein targeting to the inner nuclear membrane. J Cell Biol 130:15-27. Soullam, B., and H.J. Worman. 1995b. Signals and structural features involved in integral membrane protein targeting to the inner nuclear membrane. J. Cell Biol. 130:15-27. Speckman, R.A., A. Garg, F. Du, L. Bennett, R. Veile, E. Arioglu, S.I. Taylor, M. Lovett, and A.M. Bowcock. 2000. Mutational and haplotype an alyses of families with familial partial lipodystrophy (Dunnigan variety) reveal recurrent missense mu tations in the globular Cterminal domain of lamin A/C. Am J Hum Genet 66:1192-8. Starr, D.A. 2007. Communication between the cytosk eleton and the nuclear envelope to position the nucleus. Mol Biosyst 3:583-9. Starr, D.A., and J.A. Fischer. 2005. KASH 'n Ka rry: the KASH domain family of cargo-specific cytoskeletal adaptor proteins. Bioessays 27:1136-46. Starr, D.A., and M. Han. 2002. Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science 298:406-9. Starr, D.A., and M. Han. 2003. ANChors away: an actin based mechanism of nuclear positioning. J Cell Sci 116:211-6. Starr, D.A., and M. Han. 2005. A genetic approa ch to study the role of nuclear envelope components in nuclear positioning. Novartis Found Symp 264:208-19; discussion 219230. Starr, D.A., G.J. Hermann, C.J. Malone, W. Fi xsen, J.R. Priess, H.R. Horvitz, and M. Han. 2001. unc-83 encodes a novel component of the nuclear envelope and is essential for proper nuclear migration. Development 128:5039-50. Stewart, C., and B. Burke. 1987a. Teratocarcinom a stem cells and early mouse embryos contain only a single major lamin polypept ide closely resembling lamin B. Cell 51:383-92. Stewart, C., and B. Burke. 1987b. Teratocarcinom a stem cells and early mouse embryos contain only a single major lamin polypept ide closely resembling lamin B. Cell 51:383-392.

PAGE 150

150 Stewart, C.L., K.J. Roux, and B. Burke. 2007. Blurring the boundary: the nuclear envelope extends its reach. Science 318:1408-12. Stewart, M. 2007. Molecular mechanism of the nuclear protein import cycle. Nat Rev Mol Cell Biol Stierle, V., J. Couprie, C. Ostlund, I. Krimm, S. Zinn-Justin, P. Hossenlopp, H.J. Worman, J.C. Courvalin, and I. Duband-Goulet. 2003. The carboxyl-terminal region common to lamins A and C contains a DNA binding domain. Biochemistry. 42:4819-28. Stuurman, N., S. Heins, and U. Aebi. 1998. Nuclear lamins: their structure, assembly, and interactions. J Struct Biol 122:42-66. Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, C.L. Stewart, and B. Burke. 1999. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J Cell Biol 147:913-20. Swan, A., T. Nguyen, and B. Suter. 1999. Drosophila Lissencephaly-1 functions with Bic-D and dynein in oocyte determination and nuclear positioning. Nat Cell Biol 1:444-9. Sweet, R.M., and D. Eisenberg. 1983. Correla tion of sequence hydrophobicities measures similarity in three-dimens ional protein structure. J Mol Biol 171:479-88. Tanaka, T., F.F. Serneo, C. Higgins, M.J. Ga mbello, A. Wynshaw-Boris, and J.G. Gleeson. 2004. Lis1 and doublecortin function with dynein to mediate coupling of the nucleus to the centrosome in neuronal migration. J Cell Biol 165:709-21. Taylor, M.R., D. Slavov, A. Gajewski, S. Vlcek, L. Ku, P.R. Fain, E. Carniel, A. Di Lenarda, G. Sinagra, M.M. Boucek, J. Cavanaugh, S.L. Graw, P. Ruegg, J. Feiger, X. Zhu, D.A. Ferguson, M.R. Bristow, J. Gotzmann, R. Foisner, and L. Mestroni. 2005. Thymopoietin (lamina-associated polypeptide 2) gene mutation associated with dilated cardiomyopathy. Hum Mutat 26:566-74. Tran, E.J., and S.R. Wente. 2006. Dynamic nuclear pore complexes: life on the edge. Cell 125:1041-53. Tusnady, G.E., and I. Simon. 1998. Principles g overning amino acid composition of integral membrane proteins: appli cation to topology prediction. J Mol Biol. 283:489-506. Tusnady, G.E., and I. Simon. 2001. The HMMTOP transmembrane topology prediction server. Bioinformatics. 17:849-50. Vallee, R.B., and J.W. Tsai. 2006. The cellular role s of the lissencephaly gene LIS1, and what they tell us about brain development. Genes Dev. 20:1384-93.

PAGE 151

151 Volk, T. 1992. A new member of the spectrin supe rfamily may participate in the formation of embryonic muscle attachments in Drosophila. Development 116:721-30. Vorburger, K., G.T. Kitten, and E.A. Nigg. 1989. Modification of nuclear lamin proteins by a mevalonic acid derivative occurs in reticulocyte lysates and requires the cysteine residue of the C-terminal CXXM motif. EMBOJ 8:4007-4013. Vorobjev, I.A., and E.S. Nadezhdina. 1987. The cen trosome and its role in the organization of microtubules. Int Rev Cytol 106:227-93. Warren, D.T., Q. Zhang, P.L. Weissberg, and C.M. Shanahan. 2005. Nesprins: intracellular scaffolds that maintain cell architecture and coordinate cell function? Expert Rev Mol Med 7:1-15. Watson, M.L. 1955. The nuclear envelope: its struct ure in relation to cy toplasmic membranes. J Biophys Biochem Cytol. 1:257-70. Weber, K., U. Plessmann, and P. Traub. 1989. Maturation of nuclear lamin A involves a specific carboxy-terminal trimming, which removes th e polyisoprenylation site from the precursor; implications for the st ructure of the nuclear lamina. FEBS Letts. 257:411-414. Weis, K. 2003. Regulating access to the genome: nucleocytoplasmic transport throughout the cell cycle. Cell 112:441-51. Welte, M.A., S.P. Gross, M. Postner, S.M. Block, and E.F. Wieschaus. 1998. Developmental regulation of vesicle transport in Dr osophila embryos: forces and kinetics. Cell 92:54757. Wiese, C., and K.L. Wilson. 1993. Nuclear membrane dynamics. Curr Opin Cell Biol 5:387-94. Wilhelmsen, K., M. Ketema, H. Truong, and A. Sonnenberg. 2006. KASH-do main proteins in nuclear migration, anchorage and other processes. J Cell Sci 119:5021-9. Wilhelmsen, K., S.H. Litjens, I. Kuikman, N. Ts himbalanga, H. Janssen, I. van den Bout, K. Raymond, and A. Sonnenberg. 2005. Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin. J Cell Biol 171:799-810. Wilkie, G.S., and E.C. Schirmer. 2006. Guilt by asso ciation: the nuclear envelope proteome and disease. Mol Cell Proteomics 5:1865-75. Wilkinson, F.L., J.M. Holaska, Z. Zhang, A. Sharma, S. Manilal, I. Holt, S. Stamm, K.L. Wilson, and G.E. Morris. 2003. Emerin interacts in vi tro with the splicing-associated factor, YT521-B. Eur J Biochem 270:2459-66. Woehlke, G., and M. Schliwa. 2000. Directi onal motility of kinesin motor proteins. Biochim Biophys Acta 1496:117-27.

PAGE 152

152 Worman, H.J. 2005. Inner nuclear me mbrane and signal transduction. J Cell Biochem 96:118592. Worman, H.J., and G. Bonne. 2007. "Laminopathie s": a wide spectrum of human diseases. Exp Cell Res 313:2121-33. Worman, H.J., and J.C. Courvalin. 2004. How do mutations in lamins A and C cause disease? J Clin Invest 113:349-51. Wu, W., F. Lin, and H.J. Worma n. 2002. Intracellular trafficking of MAN1, an integral protein of the nuclear envelope inner membrane. J Cell Sci 115:1361-71. Wynshaw-Boris, A. 2007. Lissencephaly and LIS1: insights into the molecular mechanisms of neuronal migration and development. Clin Genet 72:296-304. Xing, X.W., L.Y. Li, J.J. Fu, W. B. Zhu, G. Liu, S.F. Liu, and G. X. Lu. 2003. [Cloning of cDNA of TSARG4, a human spermatogenesis related gene]. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35:283-8. Yu, J., D.A. Starr, X. Wu, S.M. Parkhurst, Y. Zhuang, T. Xu, R. Xu, and M. Han. 2006. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev Biol. 289:336-45. Zastrow, M.S., S. Vlcek, and K.L. Wilson. 2004. Pr oteins that bind A-type lamins: integrating isolated clues. J Cell Sci 117:979-87. Zhang, Q., C. Bethmann, N.F. Worth, J.D. Davies, C. Wasner, A. Feuer, C.D. Ragnauth, Q. Yi, J.A. Mellad, D.T. Warren, M.A. Wheeler, J.A. Ellis, J.N. Skepper, M. Vorgerd, B. Schlotter-Weigel, P.L. Weissberg, R.G. R oberts, M. Wehnert, and C.M. Shanahan. 2007a. Nesprin-1 and -2 are involved in the pathogenesis of Emery Dreifuss muscular dystrophy and are critical for nuclear envelope integrity. Hum Mol Genet 16:2816-33. Zhang, Q., C. Ragnauth, M.J. Greener, C.M. Sh anahan, and R.G. Roberts. 2002. The nesprins are giant actin-binding protei ns, orthologous to Drosophila melanogaster muscle protein MSP-300. Genomics 80:473-81. Zhang, Q., C.D. Ragnauth, J.N. Skepper, N.F. Worth, D.T. Warren, R.G. Roberts, P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2005. Nesprin-2 is a multi-isomeric protein that binds lamin and emerin at the nuclear envelope and forms a subcellular network in skeletal muscle. J Cell Sci. 118:673-87. Zhang, Q., J.N. Skepper, F. Yang, J.D. Davies, L. Hegyi, R.G. Roberts, P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2001. Nesprins: a nov el family of spectrin-repeat-containing proteins that localize to the nucle ar membrane in multiple tissues. J Cell Sci 114:448598.

PAGE 153

153 Zhang, X., R. Xu, B. Zhu, X. Yang, X. Ding, S. Duan, T. Xu, Y. Zhuang, and M. Han. 2007b. Syne-1 and Syne-2 play crucial roles in myonuclear anchorage and motor neuron innervation. Development. 134:901-8. Zhen, Y.Y., T. Libotte, M. Munck, A.A. Noeg el, and E. Korenbaum. 2002. NUANCE, a giant protein connecting the nucl eus and actin cytoskeleton. J Cell Sci 115:3207-22.

PAGE 154

154 BIOGRAPHICAL SKETCH Born and raised in the sm all town of Bryson City, NC, Melissa Lynn Crisp is the daughter of Ward and Wanda Crisp. She graduated from Swain County High School (Bryson City, NC) as valedictorian of her class. Sh e then went on to study biology at Western Carolina University where she received a Bachelor of Science de gree in 1998. After graduating, she moved to Winston-Salem, NC. While there, she became a cl aims examiner for the Veterans Adminstration and then joined the lab of Greg Shelness at Wa ke Forest University Baptist Medical Center, where she worked for two years. During the summer prior to beginning her graduate studies, she traveled to Nice, France to study French langua ge and culture. In the fall of 2002, Melissa entered the Interdisciplinary Program for Biomedical Sciences at the University of Florida where she later joined the lab of Brian Burke in the Department of Anatomy and Cell Biology to pursue her doctoral degree. She plans to take a postdoctora l position at the Scripps Research Institute in Jupiter, FL, after graduating.