<%BANNER%>

Prostaglandin Endoperoxide Synthase Types 1 and 2

Permanent Link: http://ufdc.ufl.edu/UFE0022075/00001

Material Information

Title: Prostaglandin Endoperoxide Synthase Types 1 and 2 Ontogenetic Expression and Effects of Inhibition on the Basal and Estrogen Stimulated Fetal Ovine Hypothalamus-Pituitary Adrenal Axis
Physical Description: 1 online resource (144 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: acth, adrenal, cortisol, cyclooxygenase, fetal, hpa, hypothalamus, nimesulide, ovine, parturition, pghs, pituitary, prostaglandin, resveratrol
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The mechanisms underlying initiation of parturition at the end of gestation are well studied, but not completely understood. Timing of parturition is dictated by fetal-derived signals and an intact fetal hypothalamus-pituitary-adrenal (HPA) axis is required for normal parturition timing. Activation of the axis at the end of gestation is spontaneous and induces placental estrogen production, which is thought to further stimulate the axis. Prostaglandin synthesis has been implicated as a modulator of HPA axis activity and has been shown to be affected by estrogen. Prostaglandin endoperoxide synthases (PGHS) types 1 and 2 are the rate limiting enzymes in prostaglandin production. The goal of the current study was to determine an ontogenetic expression profile of PGHS-1 and -2 in HPA axis associated brain regions, and to determine their role in modulating the basal and estrogen (ontogenetically) stimulated HPA axis. For the ontogeny expression study, ovine fetuses were sacrificed at known gestational ages and their brains were collected and processed for mRNA and protein analysis. We detected PGHS-1 and -2 in the fetal brain, notably in regions associated with the HPA axis such as the hypothalamus, hippocampus, and pituitary. Expression of both isoforms appeared to be developmentally regulated. In in vivo experiments directed to studying the basal HPA axis, one of two chronically catheterized twin fetuses received an intracerebroventricular (icv) infusion of either 1 mg/day nimesulide (high dose, ?HD?), 1mg/day resveratrol (Res), or 10 ?g/day nimesulide (low dose, ?LD?), and the other twin received vehicle. PGHS-1 and -2 mRNA were significantly reduced by 1mg/day nimesulide, while plasma estradiol increased significantly as compared to vehicle fetuses. LD nimesulide did not alter gene expression but revealed increased adrenal cortisol output as demonstrated by cortisol responses to non-experimental hypoxia absent increases in adrenocoroticotropic stimulating hormone (ACTH). Resveratrol had little effect on gene expression or HPA axis activity, suggesting that PGHS-2 is a primary inhibitory regulator of fetal basal HPA axis activity. In studying an ontogenetically stimulated HPA axis, twin fetuses each received 0.25mg/day 17?-estradiol. In one group, a twin received either LD nimesulide or vehicle, and in another one twin received 0.05mg/day indomethacin or vehicle. Estradiol administration reduced the amount of nimesulide induced PGHS-2 inhibition required prior to initiate HPA axis activation, effectively priming the HPA axis, as evidenced by significant increases in estradiol over vehicle fetuses. Adrenal cortisol output was altered in these experiments, as increases in cortisol secretion occurred absent ACTH increases, though it is possible that pro-opiomelanocortin (POMC), the precursor to ACTH, processing was involved in the stimulation of the adrenal. Indomethacin treatment substantially reduced estradiol concentrations in both fetuses, suggesting that PGHS-1 plays a large functional role in estrogen clearance or metabolism at a point central to both fetuses, such as the placenta or uterus. These results indicate that PGHS-2 negatively regulates the fetal ovine HPA axis in basal and ontogenetically stimulated states, that PGHS-1 impacts estradiol metabolism, and that models of HPA axis-prostaglandin-estrogen interaction must be revised to account for additional regulatory pathways.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Wood, Charles E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022075:00001

Permanent Link: http://ufdc.ufl.edu/UFE0022075/00001

Material Information

Title: Prostaglandin Endoperoxide Synthase Types 1 and 2 Ontogenetic Expression and Effects of Inhibition on the Basal and Estrogen Stimulated Fetal Ovine Hypothalamus-Pituitary Adrenal Axis
Physical Description: 1 online resource (144 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: acth, adrenal, cortisol, cyclooxygenase, fetal, hpa, hypothalamus, nimesulide, ovine, parturition, pghs, pituitary, prostaglandin, resveratrol
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The mechanisms underlying initiation of parturition at the end of gestation are well studied, but not completely understood. Timing of parturition is dictated by fetal-derived signals and an intact fetal hypothalamus-pituitary-adrenal (HPA) axis is required for normal parturition timing. Activation of the axis at the end of gestation is spontaneous and induces placental estrogen production, which is thought to further stimulate the axis. Prostaglandin synthesis has been implicated as a modulator of HPA axis activity and has been shown to be affected by estrogen. Prostaglandin endoperoxide synthases (PGHS) types 1 and 2 are the rate limiting enzymes in prostaglandin production. The goal of the current study was to determine an ontogenetic expression profile of PGHS-1 and -2 in HPA axis associated brain regions, and to determine their role in modulating the basal and estrogen (ontogenetically) stimulated HPA axis. For the ontogeny expression study, ovine fetuses were sacrificed at known gestational ages and their brains were collected and processed for mRNA and protein analysis. We detected PGHS-1 and -2 in the fetal brain, notably in regions associated with the HPA axis such as the hypothalamus, hippocampus, and pituitary. Expression of both isoforms appeared to be developmentally regulated. In in vivo experiments directed to studying the basal HPA axis, one of two chronically catheterized twin fetuses received an intracerebroventricular (icv) infusion of either 1 mg/day nimesulide (high dose, ?HD?), 1mg/day resveratrol (Res), or 10 ?g/day nimesulide (low dose, ?LD?), and the other twin received vehicle. PGHS-1 and -2 mRNA were significantly reduced by 1mg/day nimesulide, while plasma estradiol increased significantly as compared to vehicle fetuses. LD nimesulide did not alter gene expression but revealed increased adrenal cortisol output as demonstrated by cortisol responses to non-experimental hypoxia absent increases in adrenocoroticotropic stimulating hormone (ACTH). Resveratrol had little effect on gene expression or HPA axis activity, suggesting that PGHS-2 is a primary inhibitory regulator of fetal basal HPA axis activity. In studying an ontogenetically stimulated HPA axis, twin fetuses each received 0.25mg/day 17?-estradiol. In one group, a twin received either LD nimesulide or vehicle, and in another one twin received 0.05mg/day indomethacin or vehicle. Estradiol administration reduced the amount of nimesulide induced PGHS-2 inhibition required prior to initiate HPA axis activation, effectively priming the HPA axis, as evidenced by significant increases in estradiol over vehicle fetuses. Adrenal cortisol output was altered in these experiments, as increases in cortisol secretion occurred absent ACTH increases, though it is possible that pro-opiomelanocortin (POMC), the precursor to ACTH, processing was involved in the stimulation of the adrenal. Indomethacin treatment substantially reduced estradiol concentrations in both fetuses, suggesting that PGHS-1 plays a large functional role in estrogen clearance or metabolism at a point central to both fetuses, such as the placenta or uterus. These results indicate that PGHS-2 negatively regulates the fetal ovine HPA axis in basal and ontogenetically stimulated states, that PGHS-1 impacts estradiol metabolism, and that models of HPA axis-prostaglandin-estrogen interaction must be revised to account for additional regulatory pathways.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Wood, Charles E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0022075:00001


This item has the following downloads:


Full Text

PAGE 1

PROSTAGLANDIN ENDOPEROXIDE SYNTHASE TYPES 1 AND 2: ONTOGENETIC EXPRESSION AND EFFECTS OF INHIBITION ON THE BASAL AND ESTROGEN STIMULATED FETAL OVINE HYPOTHALAMUS-PITUITARY ADRENAL AXIS By JASON ALEXANDER GERSTING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Jason Alexander Gersting 2

PAGE 3

In loving memory of Dr. Caroline Sangwon Mah 3

PAGE 4

ACKNOWLEDGMENTS I would like express special thanks to Dr. Charles Wood, who served as my committee chair, advisor, top notch fetal surgeon, sounding board, and friend over the last seven years. From the outset, he exhibited an open mind about the career path I have chosen and has given me the freedom and flexibility to successfully navigate being a joint degree guinea pig. There were a few unexpected events that really could have derailed my entire research and education program, but when I needed help or time to address family issues, Charlie always supported me. I would also like to extend my thanks to my other committee members, Dr. Maureen Keller-Wood (the Mom of our lab who always kept us running smoothly), Dr. Peter Sayeski, Dr. Paul Oh, and Dr. Dorette Ellis. Your guidance and technical expertise is much appreciated and was key to a successful dissertation. The Wood and Keller-Wood labs operate largely in unison, and I would like to thank all the members over the years for their support and dedication. Not every lab has members willing to give up Saturday and Sunday mornings and evenings to dress up like a marshmallow and take rectal temperatures for you. In the Wood lab, Lisa Fang was instrumental in making any of my research a success. Without her technical help and managerial skills, it would all come to a screeching halt. Melanie Powers and I entered the lab about the same time and she was a fantastic co-worker and friend throughout the whole experience. No two people can prep a sheep faster! I want her to know that it was impressive to watch her grow as a student, scientist, and person. I am pleased to know she has a successful start to a career and marriage I like to think I played some small role in both of them, or not. I want her to know that I could not have made it through without her support and friendship, and I miss seeing her daily. 4

PAGE 5

There really isnt a way to properly express my gratitude to my family. My parents have always been supportive of me, even though Ive never been sure what to be when I grow up. At this point, Im not sure that they are still fully comfortable with a lawyer in the family! My brother Adam and his wife Francine have also been helpful in providing advice about the real world and also giving us an excuse for fancy Holiday dinners. Everyone can rest assured, I will continue to hold my place in the family as the fun loving, rather be on vacation person. Id also like to thank my mother and father in law, Dr. John and Mrs. Myoung Sook Mah. They have also been supportive, generous and understanding over the many years since Ive joined their family. They were invaluable when my studies required a babysitter at home for three months straight and have never hesitated to offer up their other services, such as gourmet menus on weeknights. I enjoy the company of all my family, and look forward to it in the future. Lastly, the most thanks and appreciation has to go to my daughter Samantha and my wife Cathryn. Sammie is just about the purest Daddys girl Ive ever heard of and I wouldnt have it any other way. Weve had sleepless nights, a lot of trips to the Doctor, and she knows all too well the phrase Daddy has to work. But she makes every day something new for me, and shes learning how to make a mean cup of coffee. Cathryn, as a result of an early display of my lawyerly talents, agreed to finance my education for the last six years without charging interest. She also didnt think I was crazy for doing this, has tolerated the ups and downs of both degrees and our own lives with nary a complaint. She has been a loving wife, a dedicated biking, skiing, and dining partner, an amazing mother, and someone I could not face life without. It does not get said often enough, so here it is in print, Thank you and I love you. 5

PAGE 6

TABLE OF CONTENTS Page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................9 LIST OF FIGURES .......................................................................................................................10 CHAPTER 1 INTRODUCTION..................................................................................................................15 Background and Significance.................................................................................................15 Control of Mammalian Parturition.........................................................................................15 Timing of Parturition: A Fetal Neuroendocrine Event....................................................16 The Hypothalamic-Pituitary-Adrenal (HPA) Axis..........................................................17 The hypothalamus....................................................................................................18 The pituitary.............................................................................................................19 The adrenal gland.....................................................................................................20 The Fetal HPA Axis: Additional Signals in Pregnancy..................................................20 Placental Steroidogenesis: Human vs. Sheep..................................................................21 Modulators of Fetal HPA Axis Activity..........................................................................22 Prostaglandin Synthesis..........................................................................................................25 Prostaglandin Endoperoxide G/H Synthase....................................................................25 PGHS Expression............................................................................................................26 Functional Studies Investigating the Role of PGHS Enzymes........................................28 Summary.................................................................................................................................29 Specific Aims..........................................................................................................................31 Specific Aim 1.................................................................................................................31 Specific Aim 2.................................................................................................................31 Specific Aim 3.................................................................................................................32 CHAPTER 2 ONTOGENY OF PROSTAGLANDIN G/H SYNTHASE ENZYME EXPRESSION IN THE OVINE FETAL CENTRAL NERVOUS SYSTEM AND PITUITARY......................36 Introduction.............................................................................................................................36 Materials and Methods...........................................................................................................37 Animals and Collection of Tissues..................................................................................37 RNA Isolation and Real-time RT-PCR...........................................................................38 Protein Isolation and Western Blotting...........................................................................39 Statistical Analysis..........................................................................................................41 Results.....................................................................................................................................41 Hypothalamus..................................................................................................................41 Pituitary...........................................................................................................................42 6

PAGE 7

Hippocampus...................................................................................................................43 Brainstem.........................................................................................................................43 Cortex..............................................................................................................................44 Cerebellum......................................................................................................................44 Discussion...............................................................................................................................45 CHAPTER 3 SPECIFIC INHIBITION OF PGHS-1 OR PGHS-2: EFFECTS ON PGHS EXPRESSION IN THE OVINE FETAL CNS AND PITUITARY AND ON BASAL HPA AXIS FUNCTION.........................................................................................................61 Introduction.............................................................................................................................61 Materials and Methods...........................................................................................................62 Fetal Surgery...................................................................................................................62 Post-Operative Care.........................................................................................................64 Drug Administration........................................................................................................64 Experimental Protocol and Sample Collection................................................................65 RNA Isolation and Gene Expression Analysis................................................................65 Protein Isolation and Western Blotting...........................................................................66 Plasma Assays.................................................................................................................66 ACTH.......................................................................................................................66 Cortisol.....................................................................................................................67 Pro-opiomelanocortin (POMC)................................................................................68 Estradiol...................................................................................................................68 Estradiol sulfate........................................................................................................69 Prostaglandin E 2 .......................................................................................................69 Statistical Analysis..........................................................................................................70 Results.....................................................................................................................................70 Blood Gases.....................................................................................................................70 Gene and Protein Expression in Response to Nimesulide...............................................71 Plasma Hormones in Response to Nimesulide................................................................72 Gene and Protein Expression in Response to Resveratrol...............................................72 Plasma Hormones in Response to Resveratrol................................................................73 Gene and Protein Expression in Response to LD Nimesulide........................................73 Plasma Hormones in Response to LD Nimesulide..........................................................73 Discussion...............................................................................................................................74 CHAPTER 4 PROSTAGLANDIN SYNTHASE INHIBITION IN ESTROGENIZED OVINE FETUSES: EFFECTS ON PGHS-1 AND -2 EXPRESSION IN THE OVINE FETAL CNS AND PITUITARY AND ON STIMULATED HPA AXIS FUNCTION.....................89 Introduction.............................................................................................................................89 Materials and Methods...........................................................................................................90 Fetal Surgery...................................................................................................................91 7

PAGE 8

Post-Operative Care.........................................................................................................91 Drug Administration........................................................................................................91 Experimental Protocol and Sample Collection................................................................92 RNA Isolation and Gene Expression Analysis................................................................92 Protein Isolation and Western Blotting...........................................................................92 Plasma Assays.................................................................................................................93 Statistical Analysis..........................................................................................................93 Results.....................................................................................................................................93 Blood Gases.....................................................................................................................93 Gene and Protein Expression in Response to LD Nimesulide........................................94 Plasma Hormones in Response to LD Nimesulide..........................................................94 Gene and Protein Expression in Response to Indomethacin...........................................95 Plasma Hormones in Response to Indomethacin............................................................96 Discussion...............................................................................................................................96 CHAPTER 5 CONCLUSIONS..................................................................................................................109 REFERENCE LIST.....................................................................................................................120 BIOGRAPHICAL SKETCH.......................................................................................................144 8

PAGE 9

LIST OF TABLES Table page 2-1 Distribution of samples for each tissue and age group studied by mRNA and protein analysis...............................................................................................................................52 2-2 Distribution of samples collected for protein analysis only...............................................52 2-3 Primer and probe sequences used in real-time RT-PCR....................................................53 3-1 Gene expression of hypothalamic and pituitary hormones in response to prostaglandin synthesis inhibition in the basally stimulated HPA axis.............................81 3-2 Plasma PGE2, estradiol, and estradiol-3-sulfate in vehicle and PGHS inhibitor treated fetuses.....................................................................................................................81 4-1 Gene expression of hypothalamic and pituitary hormones in response to prostaglandin synthesis inhibition in the estrogen stimulated HPA axis.........................103 4-2 Plasma PGE2, estradiol, and estradiol-3-sulfate in estrogenized vehicle and PGHS inhibitor treated fetuses....................................................................................................103 9

PAGE 10

LIST OF FIGURES Figure page 1-1 Profile of circulating plasma hormone concentrations approaching term.........................33 1-2 Schematic representation of signaling in the fetal hypothalamic pituitary adrenal axis.....................................................................................................................................34 1-3 Prostaglandin synthesis......................................................................................................35 2-1 Relative expression of PGHS-1 and PGHS-2 among brain regions..................................54 2-2 Ontogeny of hypothalamic PGHS-1 and -2 expression.....................................................55 2-3 Ontogeny of pituitary PGHS-1 and -2 expression.............................................................56 2-4 Ontogeny of hippocampal PGHS-1 and -2 expression......................................................57 2-5 Ontogeny of brainstem PGHS-1 and -2 expression ..........................................................58 2-6 Ontogeny of cerebral cortex PGHS-1 and -2 expression...................................................59 2-7 Ontogeny of cerebellar PGHS-1 and -2 expression...........................................................60 3-1 Arterial pH, pCO 2 and pO 2 in vehicle and PGHS inhibitor treated twin fetuses..............82 3-2 PGHS-1 and PGHS-2 mRNA and protein expression in the fetal brain and pituitary in response to HD nimesulide............................................................................................83 3-3 Daily plasma POMC, ACTH, and cortisol concentrations in response to HD nimesulide..........................................................................................................................84 3-4. PGHS-1 and PGHS-2 mRNA and protein expression in the fetal brain and pituitary in response to resveratrol...................................................................................................85 3-5 Daily plasma POMC, ACTH, and cortisol concentrations in response to resveratrol.......86 3-6 PGHS-1 and PGHS-2 mRNA and protein expression in the fetal brain and pituitary in response to LD nimesulide............................................................................................87 3-7 Daily plasma POMC, ACTH, and cortisol concentrations in response to LD nimesulide..........................................................................................................................88 4-1 Arterial pH, pCO 2 and pO 2 in estrogenized vehicle and PGHS inhibitor treated twin fetuses..............................................................................................................................104 4-2 PGHS-1 and PGHS-2 mRNA and protein expression in the estrogenized fetal brain and pituitary in response to LD nimesulide.....................................................................105 10

PAGE 11

4-3 Daily plasma POMC, ACTH, and cortisol concentrations in estrogenized fetuses in response to LD nimesulide...............................................................................................106 4-4 PGHS-1 and PGHS-2 mRNA and protein expression in the estrogenized fetal brain and pituitary in response to indomethacin.......................................................................107 4-5 Daily plasma POMC, ACTH, and cortisol concentrations in estrogenized fetuses in response to indomethacin.................................................................................................108 5-1 Proposed model of prostaglandin synthesis regulation of basal HPA axis activity........118 5-2 Proposed model of prostaglandin synthesis regulation of ontogenetically stimulated HPA axis activity.............................................................................................................119 11

PAGE 12

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PROSTAGLANDIN ENDOPEROXIDE SYNTHASE TYPES 1 AND 2: ONTOGENETIC EXPRESSION AND EFFECTS OF INHIBITION ON THE BASAL AND ESTROGEN STIMULATED FETAL OVINE HYPOTHALAMUS-PITUITARY ADRENAL AXIS By Jason Alexander Gersting May 2008 Chair: Charles E. Wood Major: Medical SciencesPhysiology and Pharmacology The mechanisms underlying initiation of parturition at the end of gestation are well studied, but not completely understood. Timing of parturition is dictated by fetal-derived signals and an intact fetal hypothalamus-pituitary-adrenal (HPA) axis is required for normal parturition timing. Activation of the axis at the end of gestation is spontaneous and induces placental estrogen production, which is thought to further stimulate the axis. Prostaglandin synthesis has been implicated as a modulator of HPA axis activity and has been shown to be affected by estrogen. Prostaglandin endoperoxide synthases (PGHS) types 1 and 2 are the rate limiting enzymes in prostaglandin production. The goal of the current study was to determine an ontogenetic expression profile of PGHS-1 and -2 in HPA axis associated brain regions, and to determine their role in modulating the basal and estrogen (ontogenetically) stimulated HPA axis. For the ontogeny expression study, ovine fetuses were sacrificed at known gestational ages and their brains were collected and processed for mRNA and protein analysis. We detected PGHS-1 and -2 in the fetal brain, notably in regions associated with the HPA axis such as the hypothalamus, hippocampus, and pituitary. Expression of both isoforms appeared to be developmentally regulated. 12

PAGE 13

In in vivo experiments directed to studying the basal HPA axis, one of two chronically catheterized twin fetuses received an intracerebroventricular (icv) infusion of either 1 mg/day nimesulide (high dose, HD), 1mg/day resveratrol (Res), or 10 g/day nimesulide (low dose, LD), and the other twin received vehicle. PGHS-1 and -2 mRNA were significantly reduced by 1mg/day nimesulide, while plasma estradiol increased significantly as compared to vehicle fetuses. LD nimesulide did not alter gene expression but revealed increased adrenal cortisol output as demonstrated by cortisol responses to non-experimental hypoxia absent increases in adrenocoroticotropic stimulating hormone (ACTH). Resveratrol had little effect on gene expression or HPA axis activity, suggesting that PGHS-2 is a primary inhibitory regulator of fetal basal HPA axis activity. In studying an ontogenetically stimulated HPA axis, twin fetuses each received 0.25mg/day 17-estradiol. In one group, a twin received either LD nimesulide or vehicle, and in another one twin received 0.05mg/day indomethacin or vehicle. Estradiol administration reduced the amount of nimesulide induced PGHS-2 inhibition required prior to initiate HPA axis activation, effectively priming the HPA axis, as evidenced by significant increases in estradiol over vehicle fetuses. Adrenal cortisol output was altered in these experiments, as increases in cortisol secretion occurred absent ACTH increases, though it is possible that pro-opiomelanocortin (POMC), the precursor to ACTH, processing was involved in the stimulation of the adrenal. Indomethacin treatment substantially reduced estradiol concentrations in both fetuses, suggesting that PGHS-1 plays a large functional role in estrogen clearance or metabolism at a point central to both fetuses, such as the placenta or uterus. These results indicate that PGHS-2 negatively regulates the fetal ovine HPA axis in basal and ontogenetically 13

PAGE 14

stimulated states, that PGHS-1 impacts estradiol metabolism, and that models of HPA axis-prostaglandin-estrogen interaction must be revised to account for additional regulatory pathways. 14

PAGE 15

CHAPTER 1 INTRODUCTION Background and Significance Unrecognized or unsuccessfully treated preterm labor may result in preterm parturition. While occurring in only 7 to 12 % of pregnancies, preterm parturition results in approximately 75% of neonatal morbidity and mortality (30; 146; 149). Neonates born prior to 30 weeks gestation generally have lower birth weights, less mature lungs, and are often require extensive intervention to survive (23; 78-80). Even with treatment, survival is questionable, hospital stays are extensive, and medical costs are potentially very large. Causes of pre-term labor are varied and not well defined. Pregnancy induced hypertension, intra-amniotic infection, disruptions in utero-placental blood flow, changes in maternal or fetal blood volume, and intra-uterine growth restriction are well known triggers (22; 50). However, the ability to accurately predict pre-term labor based on these symptoms is difficult if not impossible. First line treatment typically consists of tocolytic agents to reduce uterine contractions, glucocorticoids to induce fetal lung maturation, and bed-rest (149; 169). Therapy has yet to be standardized because the mechanisms regulating the process of parturition are not fully understood. In order to treat the causes of pre-mature labor and parturition, it is necessary to have an improved understanding of the biochemical events that control the timing, regulation, and final act of parturition (6). Control of Mammalian Parturition Historical observations suggested that pregnancies generally persisted for a roughly defined period of time, with some variation among individuals. A deeper investigation indicates more precise mechanisms are at work. Combined observations of livestock farmers, scientists, 15

PAGE 16

and obstetricians deduced that termination of pregnancy by parturition is an event under the control of the fetal neuroendocrine system. Timing of Parturition: A Fetal Neuroendocrine Event Experimental fetectomy was initially performed to study fetal development and manipulate the feto-maternal endocrine system. Such experiments resulted in the finding that those pregnancies that were maintained were prolonged, suggesting a fetal role in determining length of pregnancy (183; 210; 216). Many obstetrical studies of anencephalic pregnancies also indicated an extension of gestation beyond term (123; 209). Those anencephalies that did deliver at or before term were often associated with labor inducing conditions such as polyhydramnios. Likewise, consumption of the plant Veratrum californicum by pregnant sheep was noted to prolong normal gestation. Associated teratologic deformities in the lamb, such as cyclopsia, and misplaced or even absence of the pituitary gland were also observed (11; 12; 213). Such data suggested that the fetal head and endocrine system were involved in the regulation of gestation. In the 1930s, Sir Montgomery Liggins began to assemble these observations into a unified hypothesis. After experimental ablation of the ovine fetal pituitary, Liggins et al. discovered that parturition was indefinitely delayed (114). Pituitary ablation also induced physical abnormalities, similar to Veratrum californicum induced teratologic deformities (117). Liggins pituitary results were later extended by experimental hypothalamo-pituitary disconnection, which extended gestation to approximately 156 days, 8 days past the normal ovine gestation of 148 days (3). Additional studies indicated the importance of intact hypothalamo-pituitary communication in regulation of parturition. For example, disconnection at any time prior to 135 days of gestation in the fetal sheep prohibited spontaneous parturition, but disconnection occurring after 135 days had no effect on timing of parturition (55; 56). More directed studies 16

PAGE 17

indicated that specific nuclei in the hypothalamus were critical. Bilateral lesions in the paraventricular nucleus (PVN) of the hypothalamus extended gestation past normal term (126). Furthermore, ovine parturition can be delayed by fetal adrenalectomy, by virtue of removing a primary target pituitary releasing hormones (60). Additional studies were performed to determine what experimental models could mimic gestation shortened by premature parturition. Once more, Liggins et al. demonstrated that fetal infusion of ACTH, a major product of the active pituitary, induced premature parturition. As ACTH targets the adrenal gland, stimulating cortisol release, Liggins also infused fetuses with cortisol, again inducing premature parturition (112; 115). However, the same infusions into pregnant ewes did not affect gestation. Investigations in hypophysectomized fetal sheep employing ACTH or glucocorticoids replacement also resulted in parturition (99). Taken together, early observations of natural events and later directed in vivo experiments confirm that parturition is a neuroendocrine event, initiated and controlled by the fetus, and clearly requiring an intact and active fetal hypothalamic-pituitary-adrenal (HPA) axis. The Hypothalamic-Pituitary-Adrenal (HPA) Axis The HPA axis is a neuroendocrine signaling axis that functions primarily to receive, integrate, and respond to a wide variety of sensory information. Commonly known as the stress response axis, the HPA axis is activated by psychological stimuli and physical stimuli, such as rapid changes in blood pressure, blood oxygen content or volume, or reductions in cerebral blood flow (110; 229; 230; 241). The architecture and biochemical nature of each component of the axis function together to create a sensitive and highly regulated signaling unit. In general, the HPA axis consists of sensory (chemo-/baroreceptors) or endocrine input to the brainstem. The primary synapse of chemoand baroreceptors occurs in the nucleus tractus solitarius (NTS). The NTS is an integrative relay and transmits sensory stimuli via glutamatergic 17

PAGE 18

neurons to the rostral and caudal ventral lateral medulla (RVLM, CVLM) (2). The CVLM has bi-directional neural output. Synapses to the spinal cord direct autonomic responses (change in heart rate, blood pressure). Synapses to the paraventricular nucleus of the hypothalamus (PVN) initiate endocrine responses (100; 164). The hypothalamus The hypothalamus is a bilaterally symmetric, centrally located organ residing at the base of the brain and within the blood brain barrier. The posterior limits of the hypothalamus are formed by the mammallary bodies and the anterior extent is delimited by the lamina terminalis, the preoptic area, and the optic chiasm. The PVN of the hypothalamus is the control center of HPA axis activity. The PVN has three main types of efferent neuronal projections, 1) to the autonomic nervous system, 2) to the posterior pituitary, and 3) to the median eminence (106). The autonomic projections control the immediate changes in heart rate and blood pressure that are hallmarks of HPA axis activation (100). The PVN controls neuroendocrine function either directly or indirectly via one of its two distinct cell types. Magnocellular neurons of the PVN project to the posterior pituitary, and are responsible for direct control of neuroendocrine function. Stimulation of this neural type induces arginine vasopressin (AVP) release from the posterior pituitary directly into the general circulation (106). The parvocellular neurons of the PVN project to the median eminence. Stimulation of this neural type induces corticotropin releasing hormone (CRH) release into the local portal plexus of the median eminence, which drains into the anterior pituitary, thereby indirectly controlling synthesis and release of anterior pituitary hormones (179; 180). The developmental profiles of the corticotropin releasing factors, as AVP and CRH are collectively known, demonstrated the presence of both in the ovine hypothalamus as early as 70 days of gestational age (DGA) (49). Significant increases in both factors occurred between 100 18

PAGE 19

and 130 DGA (48). Additional studies at earlier ages indicated that CRH was detected in neurons and fiber tracts of the PVN as early as 50 DGA (219). While magnoand parvocellular neurons are primarily associated with AVP and CRH, respectively, their synthesis and release is not exclusive to a single neuron type. In fact, approximately 50% of CRH positive neurons also contain AVP, and the two factors have been found in the same neurosecretory vesicles in the median eminence. (220; 221) The pituitary Corticotropes, a primary cell type of the anterior pituitary, produce POMC, the precursor to a variety of neuroendocrine compounds. Enzymatic processing of POMC by the prohormone convertases 1 and 2 to produce the melanocortins (MSHs and ACTH), -endorphin, and corticotrophin-like intermediate peptide. Intermediate peptides with unknown biological function are also produced, such as and lipotrophins (131). Stimulation by AVP or CRH causes corticotropes to release stored ACTH. The magnitude of ACTH secretion by CRH or AVP is species dependant, but is most likely a combined effect from both releasing factors (177), as simultaneous release yields a synergistic stimulatory effect on the anterior pituitary (17; 143). Throughout gestation, the AVP:CRH ratio is dynamic, and decreases after approximately 130 DGA in the sheep, suggesting that CRH is the predominant corticotrophin-releasing factor in the hypothalamus during late gestation (48). Anatomical and immunohistochemical studies suggest that the pituitary may be responsive to hypothalamic endocrine stimulation fairly early in gestation. The fetal ovine pituitary contains patent vessels throughout the median eminence, pituitary stalk, and pituitary by 45 DGA (109), and is immunoreactive for POMC, and POMC derived hormones by 38 DGA (136). In addition to increasing CRH in late gestation, the pituitary becomes progressively more responsive to CRH stimulation after 100 days (31). HPA axis signaling is under tight negative 19

PAGE 20

feedback control. Lu and colleagues demonstrated the ability of AVP, CRH, and cortisol to downregulate CRH receptors, while cortisol is also able to attenuate POMC mRNA abundance (120). The adrenal gland Circulating ACTH will bind its receptor (MC2R) on the adrenal gland and induce the release of stored cortisol (174). Circulating cortisol can have widespread effects including alterations in gene expression, inflammation, renal function/water balance, responsiveness to other hormones, and stimulation of fetal maturation (8; 21; 28; 95; 154; 168). Both ACTH and cortisol exert negative feedback on the brainstem and PVN to autoregulate the activity of the HPA axis (94). The Fetal HPA Axis: Additional Signals in Pregnancy In general, the fetal HPA axis functions in the same manner as the adult, although the stimuli that drive activity of the fetal axis can arise from transferred maternal stressors, directly from the fetus itself, or from a maternal source stimulated by the fetus. The placenta and a dynamic hormonal environment provide an additional subunit and regulators for the fetal HPA axis. HPA axis triggers acting at the hypothalamus still include not only acute stimuli, but also ontogenetic drive. This is the fetus derived, gestational-age based activation of the fetal HPA axis which is responsible for the initiation of parturition in the sheep (222). Through approximately 80% of gestation, fetal plasma ACTH and cortisol are maintained at low concentrations due to negative feedback on ACTH secretion and the relative inactivity of the fetal adrenal (224; 236). However, as the fetal adrenal matures and becomes ACTH sensitive, spontaneous fetal HPA axis activation results in an increase in fetal circulating plasma ACTH and cortisol (227). As gestation progresses, the maturing fetal adrenal becomes more sensitive to ACTH, and negative feedback on the HPA axis decreases, yielding dramatic 20

PAGE 21

increases in fetal circulating plasma ACTH and cortisol just prior to parturition (170; 228). (See Figure 1-1) Increased fetal cortisol in late gestation acts on the placenta to induce the expression of placental cytochrome P450 C-17 (CYP450 C17 ) (68; 193). The placenta primarily secretes progesterone during early gestation, however, CYP450 C17 possesses both 17-hydroxylase and 17, 20 lyase enzymatic activities. As a result, placental progesterone is increasingly converted to estrogen as term approaches (68; 193). (See Figure 1-2) Placental Steroidogenesis: Human vs. Sheep Unlike the sheep, the primate placenta does not express CYP450 C17 ; therefore, the precursor steroids and enzymes required for biosynthesis of estrogen originate from multiple organs, known as the feto-placental unit (88; 229). The human fetal adrenal is responsive to ACTH, which stimulates two distinct regions of the adrenal cortex, the adult zone and the fetal zone. Similar to the ovine adrenal, the adult zone of the human adrenal responds to ACTH stimulation with the secretion of cortisol. However, the fetal zone does not express 3-B hydroxysteroid dehydrogenase (3B-HSD), the enzyme responsible for production of all three groups of adrenal steroids, the mineralocorticoids, sex steroids, and glucocorticoids. The fetal zone does express cytochrome P450 side chain cleavage (P450scc), P450 C17 (17a-hydroxylase), P450 17, 20 lyase, and a sulfotransferase, the enzymes needed to produce dehyroepiandrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEAS) (87; 89; 186). These two steroids are subsequently used by the human placenta as substrates for the biosynthesis of estrogen (88). While ovine steroidogenesis is under glucocorticoid control, human placental steroidogenesis is under the control of ACTH. As in the sheep, primates display the same late-gestation increases in ACTH, cortisol, and estradiol, but these increases are 21

PAGE 22

reached by mechanistically different means, though the parallels between ruminant and primates suggest a fairly well conserved final common pathway for parturition across evolution. Modulators of Fetal HPA Axis Activity Given the sensitivity of the fetal HPA axis to many stimuli, and the intrinsic ability of the axis to amplify its own output, regulation of the axis is of utmost importance. As stated above, prior to approximately 120 DGA, the ovine adrenal is relatively insensitive to fluctuations in circulating ACTH (224; 236). After this point, negative feedback effects of both ACTH and cortisol self-limit axis activity (93; 236). The ovine HPA axis clearly interacts with the placenta, as its signaling induces estrogen production (68; 193). Several lines of study have demonstrated that in turn, estrogen has the ability to modulate HPA axis activity. Significant variations in HPA axis activity exist between adult male and female rats, suggesting that the axis is affected by the distinct hormonal environment. Females displayed elevated basal circulating corticosterone, and stimulation of the HPA axis resulted in higher peak plasma values (101). Within females, axis output varied during different phases of the ovarian cycle. Plasma estrogen is elevated during proestrous, when stress responses yielded greater increases in CRH transcription, c-fos expression, and plasma ACTH and corticosterone as compared to rats in other phases of the ovarian cycle (26; 138; 139; 157; 215). Likewise, women nearing the end of the follicular phase of the menstrual cycle have elevated plasma ACTH and cortisol (70). Removal of endogenous sources of estrogen reverses these effects. For example, pre-menopausal women who have undergone ovariectomy produce markedly less ACTH and cortisol (52). The adrenal glands of oophorectomized rats generate significantly less corticosterone in vitro than their intact counterparts. However, estradiol replacement in vitro reduced the differences (70). In vivo studies reflect similar phenomena, in that ovariectomy 22

PAGE 23

reduced HPA axis activity in response to stress, but estradiol replacement restored normal activity (40; 102). Studies utilizing fetal sheep have also demonstrated a modulatory effect of estrogens on the fetal HPA axis. Fetal sheep receiving either estradiol or androstendione constantly for 5 days were subject to a pre-experimental infusion of either saline or cortisol, followed by a 10-mintue sodium nitroprusside induced hypotensive episode. As measured by plasma ACTH concentration, androstendione did not augment HPA axis activity as compared to controls. In contrast, estradiol treated fetuses pre-treated with saline displayed elevated baseline and stimulated ACTH concentrations. Those pre-treated with cortisol had lower baseline than saline fetuses, but still responded to hypotension with increases in ACTH. These data indicate that estrogen can modulate the HPA axis to allow continued, if not augmented, activity, even in the presence of cortisol induced negative feedback (176). Studies employing brachiocephalic occlusion (BCO) to reduce cerebral blood flow and stimulate the fetal HPA axis were performed to determine the site of estrogen actions within the active axis (160). Fetal sheep were treated either with estradiol or placebo for 5 days via continuous release subcutaneous pellets (0.25mg/day). Animals were subject to ten minutes of BCO. Immunohistochemistry assessing Fos expression, a marker of cellular activity (84), showed increased Fos in placebo animals receiving BCO in brain regions involved in the cardiovascular responses to alterations in blood flow, namely the NTS, PVN, CVLM, and RVLM. Estrogen treated non-BCO animals displayed increased Fos in the same brain regions, while estrogen treated animals subject to BCO exhibited a further increase, significantly above baseline and estrogen stimulated. Furthering the work of Purinton et al., Giroux et al. performed similar experiments using real time RT-PCR demonstrated alterations in gene expression in brain 23

PAGE 24

regions known to be involved in cardiovascular signaling and HPA axis activity (231). Together, these studies demonstrate the stimulatory effects of estrogen on the HPA axis at both the neural and endocrine levels. Modulation of the HPA axis is not thru estrogen alone; multiple lines of evidence also indicate that prostaglandins affect the activity of the HPA axis. Cudd et al. demonstrated the a relationship between prostanoids and the HPA axis by analyzing hallmark HPA axis responses after prostaglandin administration. They determined that infusion of PGE 2 into conscious adult ewes increased plasma ACTH and cortisol (47). Furthermore, infusion of PGE 2 into the inferior fetal vena cava also increased plasma ACTH, although the route of administration suggested an extra-pituitary source of ACTH production (46). Studies of thromboxane revealed that antagonism of a receptor for a prostaglandin synthesis intermediate, PGH 2, in adult sheep blocked the blood pressure, heart rate, and ACTH responses to mineral acid infusion, a known stimulator of the HPA axis (45). Infusions of hypertonic saline, known to increase blood pressure, heart rate, ACTH, and cortisol, failed to increase these parameters in adult sheep pre-treated with the prostaglandin synthase inhibitor flunixin (42; 45). In order to focus on the modulatory role of prostaglandins on fetal HPA axis activity, arterial or cerebral hypoperfusion were employed to determine the source of prostaglandin production. After determining that fetal prostanoid production was responsible in part for the ACTH and AVP responses to arterial hypotension (204), another series of studies revealed that indomethacin could attenuate the reduction in cerebral blood flow induced by BCO (207). Further investigation indicated that PGHS-2 was induced by BCO in hippocampus, hypothalamus, and brainstem, suggesting the prostaglandin production in regions associated with the HPA axis is a likely modulator of axis activity (202; 205; 231). 24

PAGE 25

Prostaglandin Synthesis Eicosanoids are a large class of hormonally active, oxygenated polyunsaturated fatty acid derivatives including leukotrienes, lipoxins and hepoxilins, isoprostanes, and prostanoids (more generally known as prostaglandins) (135; 178; 181; 188). Prostaglandins are formed through a three-step biosynthetic reaction, 1) substrate release, 2) committed intermediate formation, and 3) biologically active end-product formation (188). In general, stimulation of prostaglandin synthesis initiates the hydrolysis of arachidonate from membrane glycerophospholipids by phospholipase A 2 (182). Arachidonate is converted to the short lived intermediate PGH 2 by prostaglandin endoperoxide G/H synthase (PGHS, Type 1 or Type 2) (188). Subsequent conversion of PGH 2 to biologically active prostanoids such as PGH 2 PGF 2 PGI 2 (prostacyclin), or TxA 2 (thromboxane A 2 ) is performed by specific synthases (81; 90; 107; 197). These end products are transported to various locations within or outside the cell via carrier mediated processes to bind and activate nuclear receptors or G protein-linked prostanoid receptors (34; 118; 137; 196; 211). While biosynthesis of terminal prostanoids presents many possible levels of regulation, PGHS enzymes catalyze the first step of synthesis (188), making them a major target of pharmacological studies, and the primary focus of this project. Prostaglandin Endoperoxide G/H Synthase The first committed step in prostanoid biosynthesis is catalyzed by PGHS-1 or PGHS-2, each of which is encoded by a separate gene (59; 103; 105; 243). The mRNA sequences are roughly 70% identical (23). At the amino acid level the two enzymes are 60% identical, with the most marked differences in the signal peptides and membrane binding domains of the N-terminus, and the 15-20 C-terminal amino acids (134). Both PGHS-1 and -2 catalyze the same sequential two-stage reaction. The first stage is the rate-limiting cyclooxygenase reaction which converts arachidonate and two molecules of O 2 to 25

PAGE 26

PGG 2 The chemical reaction underlying this conversion is also the source of the alternate nomenclature of PGHS-1 and -2, namely cyclooxygenase-1 and -2 (Cox-1 and Cox-2). The second stage of the reaction is the peroxidase reaction, a two electron reduction of PGG 2 to form PGH 2, which serves as the substrate of terminal prostanoid synthases (188). The biochemistry of the reaction is well characterized, and indicates that both PGHS-1 and -2 are functionally self-limiting, or suicide inactivated, even in the presence of adequate substrate (191). Both cyclooxygenase and peroxidase activities are inactivated during catalysis, although in vitro studies have demonstrated that the kinetics differ for the two inactivations. PGHS Expression PGHS-1 and -2 are expressed in numerous cell and types, ranging from hematopoietic cells to neurons and reproductive tissue (4; 33; 145). Despite distinct genetic origins and signal peptide dissimilarities, PGHS-1 and -2 overlap in their tissue distribution. Developing ovine airway epithelia and smooth muscle both express PGHS-1 and -2 (14). Studies investigating human labor have detected both PGHS-1 and -2 in the myometrium (71). In fact, several studies have demonstrated that the subcellular locations of PGHS-1 and -2 also overlap. Quantitative confocal microscopy, revealed that both PGHS-1 and -2 inhabit the endoplasmic reticulum (ER) and nuclear envelope (NE) (133). Activity assays indicated a possible preference for PGHS-2 function in the NE, with apparent restrictions of PGHS-1 activity to the ER. While these data suggested discrete pools of arachidonate used by each enzyme (133; 184), a later study confirmed that both enzymes inhabited the luminal ER and NE but that the inner and outer NE contained similar proportions of the two enzymes (192). Western blotting confirmed that the expression in subcellular fractions was equivalent and products produced by each enzyme in vitro were identical. Regardless of the similarities in sequence, location, and substrate pools, the 26

PAGE 27

functional difference between the two enzymes appears to arise from differing kinetic profiles and the regulation of their expression (39; 192). Numerous studies across species have established that many tissues expressing PGHS-1 and -2 do so at different basal levels. Developing ovine airway epithelia and smooth muscle express abundant PGHS-1 protein, but no PGHS-2 (14). Feng et al. determined that normal conditions resulted in detectable PGHS-1 mRNA in most ovine tissues, with minimal PGHS-2 (66). Data of this type led to the notion of PGHS-1 as the constitutive enzyme and PGHS-2 as the inducible form and the suggestion of differing functional roles for the two isoforms. Recent evidence indicates that the classifications of the two enzymes may not necessarily apply in the central nervous system. Early studies in the developing ovine nervous system demonstrated high levels of PGHS-1 in forebrain sites such as the cortex and autonomic nervous system sites such as the hippocampus and dorsomedial nucleus of the hypothalamus (16). Later studies revealed clusters of PGHS-1 containing neurons in the NTS as well as the PVN, suggesting a role of local production of prostaglandins in respiratory control or endocrine responses to stimuli (145). Unlike most other tissues, the ovine brain has been shown to express high basal levels of PGHS-2 mRNA and protein (201). Likewise, in humans, PGHS-2 is constitutively expressed in the developing choroid plexus, albeit in different cellular compartments at different points in gestation (124). The rat brain expressed PGHS-2 in the hippocampal formation, the amygdala, the dorsal raphe nucleus of the brainstem, the PVN, the pituitary, and the adrenal gland, all of which suggest a role for PGHS-2 in autonomic and endocrine responses, particularly those involving the HPA axis (15; 39). 27

PAGE 28

It also appears that PGHS-1 and -2 expression vary over development. In developing ovine airway epithelia and smooth muscle significant increases in both PGHS-1 mRNA and protein were detected from late gestation fetuses to early newborns. Interestingly, PGHS-2 mRNA also increased, but with no concurrent protein detection, indicating cell specific expression of each of the enzymes (14). Additionally, PGHS-2 expression has been demonstrated to increase in the endometrial epithelium at various times progressing through gestation (72). Functional Studies Investigating the Role of PGHS Enzymes Functional studies have reinforced the descriptive observations and hypotheses regarding the putative roles of PGHS enzymes in the neuroendocrine system. In the sheep, intravenous administration of a cyclooxygenase inhibitor, flunixin-N-methylglucamine, prevented changes in arterial pressure, heart rate, ACTH, and cortisol, which are associated with HPA axis activity after mineral acid infusion (44). Intravenous indomethacin was later determined to significantly reduce the ACTH, AVP, and cortisol responses to arterial hypotension (204). Tong et al. also established that cerebral hypoperfusion increased immunoreactive PGHS-1, PGHS-2, and Fos in the anterior pituitary and hippocampus of the fetal sheep (203). Likewise, investigations into PGHS involvement in adrenergic stimulation of the HPA axis demonstrated that both PGHS-1 and -2 are present under normal conditions in rats. Intracerebroventricular (icv) administration of selective inhibitors blocked the ACTH and corticosterone responses normally seen with adrenergic stimulation of the HPA axis (19). Lipopolysaccharide (LPS) is a known pyrogenic stimuli involving central prostaglandin production, though the specific roles of PGHS-1 and -2 are not understood. In the rat, Zhang and colleagues determined that administration of SC-236, a selective PGHS-2 inhibitor, blocked LPS-induced fever and reduced Fos expression in the PVN, but not in the NTS or VLM. In 28

PAGE 29

contrast, SC-560, a PGHS-1 inhibitor, attenuated the LPS-induced fever and blocked Fos expression in the PVN as well as the NTS and VLM (244). Together, these studies indicate the presence and activity of both PGHS-1 and -2 in the HPA axis. While similar in structure and identical in terms of the chemical reactions catalyzed, several indications suggest that central nervous system PGHS isoforms function differently from one another. The above mentioned study by Zhang et al. indicates that there may be discrete associations between each isoform of PGHS and various brain regions (244). Similarly PGHS -2 expression in ovine fetal hippocampus, hypothalamus, and brain stem was induced by cerebral hypoperfusion. PGHS-1 was also detected but conversely, was not induced by BCO (202). In an attempt to directly address the differences each PGHS isoforms modulation of the HPA axis, Reimsnider and Wood used icv administration of specific PGHS-1 and -2 inhibitors (resveratrol and nimesulide, respectively) to study the effects of inhibition on the cardiovascular and endocrine responses to BCO (166). Interestingly, specific inhibition in this acute setting had differential effects on secretion. When administered 30 minutes prior to BCO, resveratrol delayed the hallmark ACTH increase as compared to control animals. However, the infusion of nimesulide itself appeared to stimulate ACTH release, causing a significant increase in plasma ACTH within 30 minutes of administration, prior to the inception of BCO. These results suggest that central nervous system PGHS-1 generated prostaglandins augment the activity of the HPA axis, while PGHS-2 activity inhibited ACTH secretion. Summary Integrating conclusions from these various areas of study, there is an indication of a complex array of interactions between the fetal HPA axis and several of its known modulators. Given the role of the HPA axis in development, cardiovascular and endocrine responses to intrauterine stressors, driving parturition, modulation of HPA axis activity by prostaglandins 29

PAGE 30

(and estrogen), and the variations in PGHS-1 and -2 expression in many tissues, the first objective of this dissertation was to determine the gestational profile of PGHS-1 and -2 in the ovine central nervous system and pituitary. Additional evidence exists that the two enzymes, despite their similarities in structure, location and chemistry, are functionally different than one another under basal and stimulated conditions. Thus, the second objective was to determine, under basal conditions, the effect of specific inhibition of each PGHS enzyme in the fetal brain on the gene and protein expression in the HPA axis, as well as the hormonal output (activity) of the axis. As a result of the estrogen derived feed-forward activity of the HPA axis late in gestation and the significant impact that premature delivery has on neonates, we elected to study the HPA axis under the chronic stimulation of estrogen, mimicking late gestation ontogenetic drive. It is believed that estrogen stimulates the HPA axis, and may be involved in the premature activation of the axis (229). Thus, the final objective was to determine the effect of inhibition of both PGHS enzymes on gene and protein expression in the estrogen stimulated HPA axis, as well as the activity of the axis as measured by plasma hormones. Understanding the gestational profile of PGHS enzymes, their effects on HPA axis signaling, and which isoform is predominant under basal and stimulated conditions will add to the collective knowledge of how this very important neuroendocrine axis functions, and may aid in the development of a specific and more effective treatment for premature labor and birth. The experiments reported in this dissertation project involved in vivo chronic catheterization of fetal sheep, real time reverse transcriptase polymerase chain reaction (RT-PCR), western blot analysis, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). 30

PAGE 31

Specific Aims The relationship between fetal HPA axis activation, prostaglandins, and estrogens are not completely understood. Fetal HPA axis activity is low throughout much of gestation, then spontaneously undergoes rapid increases just before term. It has been proposed that estrogen resulting from HPA axis activity positively feeds back to further activate the axis. Prior data suggests that local prostaglandin biosynthesis in HPA axis associated brain regions may play a regulatory role on the activity of the axis. The goal of this project is to further understand the role of PGHS-1 and -2 in the modulation of the basal and ontogenetically stimulated fetal HPA axis. Therefore, the following specific aims were proposed: Specific Aim 1 Establish the ontogenetic profile of PGHS-1 and PGHS-2 expression in the ovine fetal, young lamb, and adult brain. Using real-time RT-PCR and western blotting, PGHS-1 and PGHS-2 mRNA and protein expression were studied at five points throughout gestation, at one day post-partum (lambs), one-week post partum (lambs), and 1 month post-partum (adult female mothers of the lambs) in order to determine the ontogenetic (gestational and developmental) profile of PGHS-1 and -2 expression in brain regions relevant to the ovine HPA axis. Specific Aim 2 Determine the effects of specific inhibition of PGHS-1 or PGHS-2 on: 1) PGHS enzyme expression within in the basally stimulated HPA axis, and 2) activity of the basally stimulated HPA axis. The goal of this aim was to determine the contributions of each prostaglandin synthase to the basal activity of the ovine fetal HPA axis. Infusion of nimesulide (1 mg/day) directly into the lateral cerebral ventricle (intra-cerebral ventricular administration, icv) of one of two twin fetuses (the other receiving vehicle) via an osmotic mini pump was used to determine the effects of prostaglandin synthesis resulting from activity of PGHS-2 on the unstimulated 31

PAGE 32

ovine fetal HPA axis. Infusion of resveratrol (1 mg/day, icv) to one of two twin fetuses was used to determine the effects of prostaglandin synthesis resulting from activity of PGHS-1 on the unstimulated ovine fetal HPA axis. Infusion of nimesulide (10 g/day, icv) to one of two twin fetuses was used to further study prostaglandin synthesis resulting from activity of PGHS-2 on the unstimulated ovine fetal HPA axis. Throughout the infusions, plasma was collected from both fetuses in order to characterize hormonal indicators of HPA axis activity. Effects of PGHS enzyme inhibition on PGHS enzyme expression were analyzed using real-time RT-PCR (mRNA) and western blotting (protein) on brain tissue isolated from both fetuses. Expression of mRNA encoding relevant HPA axis signaling hormones, POMC mRNA in the pituitary and CRH and AVP mRNA in the hypothalamus, was performed using real-time RT-PCR on brain regions from both fetuses. Specific Aim 3 Determine the effects of specific inhibition of PGHS-2 alone or simultaneous inhibition of PGHS-1 and PGHS-2 on: 1) PGHS enzyme expression within in the estrogen stimulated HPA axis, and 2) activity of the estrogen stimulated HPA axis. Estrogen was used to stimulate the HPA axis, mimicking the late gestation increases in circulating estrogen. ICV infusion of nimesulide (10g/day) to one of two twin fetuses was used to determine the effects of prostaglandin synthesis resulting from activity of PGHS-2 on the estrogen stimulated HPA axis. ICV infusion of indomethacin (0.05 mg/day) to one of two twin fetuses was used to determine the effects of inhibiting prostaglandin synthesis on the estrogen stimulated HPA axis. Analyses of gene and protein expression and HPA axis activity were performed as in Specific Aim 2. 32

PAGE 33

Figure 1-1. Profile of circulating plasma hormone concentrations approaching term. As a function of gestational age several plasma hormones representing activity of the fetal HPA axis gradually increase approaching term. In the final days prior to term (arrow), concentrations increase at nearly an exponential rate, indicating the commencement of the parturition process. Reproduced with permission from C.E. Wood, Reference 222. 33

PAGE 34

Pituitary Adrenal Cortex Hypothalamus: PVN CRH/AVP ACTH Cortisol Placenta Induced placental 17-hydroxylase and 17,20-lyase Estrogen produced from progesterone ( E:P ratio) ? ? Ontogenetic Drive Acute Stimuli (stressors) ? ? Estrogen or Placental Hormones Figure 1-2. Schematic representation of signaling in the fetal hypothalamic pituitary adrenal axis. Various stimuli act on the hypothalamus, causing release of CRH and/or AVP. These releasing factors act on the pituitary to stimulate release of ACTH, which will subsequently stimulate the release of cortisol from the adrenal. Cortisol normally exerts negative feedback at the levels of the pituitary and hypothalamus; however, this inhibition is decreased late in gestation. Near term, cortisol induces the expression of CYP450C17 in the placenta causing an increase in estrogen synthesis at the expense of progesterone. Estrogen exerts a positive feedback effect on the ovine fetal HPA axis. 34

PAGE 35

Figure 1-3. Prostaglandin synthesis. Stimulus activation of phospholipase A2 results in liberation of arachidonic acid from membrane phospholipids. PGHS-1 and -2 both catalyze the sequential cyclooxygenase (resulting in PGG 2 ) and peroxidase (resulting in PGH 2 ) reactions. PGH 2 serves as substrate for terminal prostaglandin synthases (shown is PGE synthase) resulting in formation of bioactive prostanoids. 35

PAGE 36

CHAPTER 2 ONTOGENY OF PROSTAGLANDIN G/H SYNTHASE ENZYME EXPRESSION IN THE OVINE FETAL CENTRAL NERVOUS SYSTEM AND PITUITARY Introduction Prostaglandins are bioactive molecules which are formed as the result of the activity of prostaglandin endoperoxide H synthase type 1 or 2 (PGHS-1 or -2) (188). Sequential cyclooxygenase and peroxidase activities of PGHS-1 and -2 convert arachidonic acid into a short-lived intermediate, prostaglandin H 2 Biologically active prostanoids are then synthesized by specific terminal synthases, such as thromboxane or prostaglandin E synthase (188). PGHS-1 and -2 are encoded by different genes, though they exhibit significant amino acid homology in many species, up to 65% between isoforms within a species, and up to 90% among each isoform in different species (191). Despite that similarity, their regulation, expression and response to stimuli and/or inhibitors are quite distinct (199). It is widely considered that PGHS-1 is the constitutive form of the enzyme, maintaining basal levels of prostaglandins, while PGHS-2 is inducible, responding rapidly to acute stimuli or pathogenesis. Recently several investigators have questioned this strict categorization after demonstrating varied or stable expression of both isoforms in brain (73; 124). Prostaglandins are implicated in a variety of physiological events including inflammation, fever, vascular tone, and modulation of the hypothalamic-pituitary adrenal (HPA) axis function (132; 147; 204; 229). The HPA axis is a neuroendocrine cascade that responds to gestational cues, psychological and physical stressors (5; 13; 18; 171). In sheep, similar to other species, development of HPA axis function is essential in establishing normal timing of parturition, accelerating visceral development at the end of gestation, responding to fetal stressors in utero, and maintaining adequate cerebral blood flow during uterine contractions and delivery (225). 36

PAGE 37

Despite much study, the mechanisms of HPA axis control are not fully understood. Previous work demonstrated an association between prostaglandins and HPA axis activity (187; 204). Not only are PGHS-1 and -2 present in brain regions that influence HPA axis activity, but early studies implicated prostanoid synthesis as a regulatory point in the response to known HPA axis stimulators (16; 45; 53). Recently, we have focused on determining which enzymes in the prostaglandin synthesis cascade are involved and at what input/output level of the HPA axis (165; 202; 207). The current experiment was designed to catalogue the expression of PGHS-1 and -2 in the developing ovine fetal brain. We hypothesized that expression of PGHS-1 and/or PGHS-2 would change in the latter half of gestation due to the proposed relationship between brain prostaglandin production and the dramatic upregrulation of fetal HPA axis activity in late gestation. Materials and Methods Animals and Collection of Tissues Timed-dated (80, 96-100, 120, 130, or 142-144 days gestational age (DGA), n=4-5 per group, term=148 days, See Table 2-1) pregnant ewes, not in labor, carrying singletons or twins (one per group) were sacrificed with 20 ml Euthasol solution (7.8 g pentobarbital and 1g phenytoin sodium; Virbac AH, Inc; Fort Worth, TX) administered intravenously. An additional set of fetuses (80, 120, 145 DGA, n=3-4/group, See Table 2-2) were sacrificed specifically for protein analysis of hypothalamus and pituitary. After delivery by cesarean section, fetal cortex, cerebellum, hippocampus, hypothalamus, brainstem, and pituitary were isolated and immediately frozen in liquid nitrogen and stored at -80C. One day and one week post-partum animals, as 37

PAGE 38

well as 1-month post-delivery, nonlactating ewes were euthanized directly and tissues collected as above. RNA Isolation and Real-time RT-PCR Total RNA was isolated from tissues using Trizol reagent (Invitrogen, Carlsbad, CA) according to manufacturers directions. Briefly, 0.1-0.2g of pulverized tissue/1mL Trizol was homogenized for three, five-second pulses in a polytron homogenizer (Tekmar, Janke and Kunkel, W. Germany). Homogenates were centrifuged for 10 minutes at 12,000 x g at 4C to pellet cellular debris. 400L chloroform was added to each supernatant, mixed and incubated for five minutes at room temperature, then centrifuged for 15 minutes at 12,000 x g at 4C. Each aqueous phase was reserved and mixed with 500 L isopropanol. A 10-minute incubation at room temperature precipitated the RNA and centrifugation for 10 minutes at 12,000 x g at 4C pelleted the RNA. Each pellet was washed with 1mL of 75% ethanol and re-centrifuged. RNA pellets were air-dried for 10 minutes, resuspended in 200L RNAsecure (Ambion, Austin, TX), and incubated at 60C for 10 minutes to inactivate RNases. RNA was quantified by measuring absorbance at 260nm, and quality checked by running a denaturing agarose gel. Multiple aliquots of each sample were made and stored at -80C. Control PCR reactions were run with 100 ng of total RNA from each sample. These reactions were run using PGHS-2 primers and probe (see Table 2-3), as the sequences for this target spans an intron-exon boundary. A resulting Ct=40 indicates that RNA alone produces no signal, thereby indicating that the sample is free of carry-over contamination by genomic DNA. For each sample, 2ug of total RNA was reverse transcribed using the High Capacity cDNA kit (Applied Biosystems, Foster City, CA), according to manufacturers instructions. Reactions were performed using RNAse/DNAse free plasticware, diethylpyrocarbonate (DepC) treated 38

PAGE 39

water, and a thermal profile of 10 minutes 25C followed by 120 minutes at 37C. cDNA was stored at -20C until use in real time PCR. Real-time PCR reactions (25 l total volume) for PGHS-1 or -2 (100ng cDNA), and 18S ribosomal RNA (1ng cDNA) were performed using TaqMan Universal PCR Master Mix according to manufacturers instructions (Applied Biosystems, Foster City, CA) and probes/primers as previously described (See Table 2-3) (231). Ribosomal RNA reactions contained 100 nM forward and reverse primer, and 50 nM probe, each of which is a proprietary sequence, and was purchased from Applied Biosystems. All reactions were run in triplicate in optical grade 96-well plates and caps on an ABI 7000 thermocycler (Applied Biosystems, Foster City, CA). Relative expression levels were calculated by determining the difference in cycle number (Ct) between the PGHS-1 or PGHS-2 values and the corresponding ribosomal RNA value from the same sample. Mean Cts were calculated for triplicate reactions, and for all samples contained in a single sample age group. Ct values were adjusted by subtracting the value of the 80-day samples, resulting in a Ct value for each age group, relative to the 80-day group. Fold change expression for each group was calculated by using 2 -Ct (119) and displayed as fold change relative to 80 DGA gene expression. Protein Isolation and Western Blotting Cortex and cerebellum samples were homogenized in boiling lysis buffer containing 1% SDS, 1 mM sodium orthovanadate, and 10 mM Tris pH 7.4 (Sigma Chemical Co., St. Louis, MO). Homogenates were boiled for 5 minutes then centrifuged at 7,500 x g for 10 minutes at 4C to remove cellular debris. The resulting supernatant was assayed for protein content using the BioRad DC Protein Assay (BioRad Laboratories, Hercules, CA). Homogenates were stored at -80C. 39

PAGE 40

Brainstem, hippocampus, hypothalamus and pituitary samples require enrichment during isolation, and were homogenized in Potter-Elvehjem glass/Teflon tissue grinders (Wheaton, Millville, NJ, USA) with 5 mL of ice cold microsomal homogenization buffer (1mM EDTA, 0.32M sucrose, 0.1mM dTT, 1mM HEPES, pH 7.4) using a motor drive (Dynamix, Fisher Scientific, Pittsburgh, PA, USA) for 10-15 strokes set at speed #5. Twenty microliters of 200 mM phenylmethylsulphonylfluoride (PMSF) was added and homogenates were centrifuged for ten minutes at 550 x g at 4C. The resulting supernatants were centrifuged at for twenty minutes 20,000 x g at 4C. To isolate microsomes, the second supernatant was collected and centrifuged at 100,000 x g for one hour at 4C. The resulting pellet was resuspended in 150-200 L ice cold homogenization buffer. Protein concentration was quantified using the BioRad DC Protein Assay (BioRad Laboratories, Hercules, CA) and samples were stored at -80C. For western blotting of all samples, previously unthawed homogenates were diluted 1:1 with a denaturing loading buffer (4% SDS, 20% glycerol, 125 mM Tris pH 6.8, and 10% -mercaptoethanol) and boiled for 5 minutes. As described previously, 10-40g of each sample was separated in a 7.5% Tris-HCl SDS-polyacrylamide gel (BioRad, Hercules, CA) and transferred overnight onto nitrocellulose membranes (BioRad) (231). Membranes were immunostained using antibodies for PGHS-1 and -2 (PGHS-1: rabbit anti-ovine Cox-1 at 1:2500, cat. no.PG-16, Oxford Biomedical Research, Oxford, MI; PGHS-2: mouse anti-ovine Cox-2 at 1:1000, cat. no.160112, Cayman Chemical, Ann Arbor, MI) diluted in 2 or 3% non-fat dry milk in Tris buffered saline with 0.1% Tween-20 (PBST), respectively. Staining was visualized using peroxidase linked secondary antibodies (PGHS-1: donkey anti-rabbit at 1:3000; PGHS-2: sheep anti-mouse at 1:3000, cat. no.s NA934 and NA931, respectively, Amersham Biosciences, Piscataway, NJ, USA) and enhanced chemiluminescence (ECL, Amersham, Arlington Heights, 40

PAGE 41

IL). Images were quantified using a ChemiDoc XRS System (Bio-Rad) and band intensities were quantified using Quantity One software (BioRad). Data are expressed as mean band densities SEM in arbitrary units. Statistical Analysis Changes in mRNA or protein expression were evaluated by one-way ANOVA (gestational age) followed by Bonferroni multiple comparison post-hoc analysis at a significance level of 0.05. Data were log transformed where appropriate to reduce heteroscedacity prior to ANOVA. All tests were performed using SPSS 13.0 for Windows (SPSS Inc., Chicago, IL, USA). Results PGHS-1 and -2 mRNA were detected in every tissue at every gestational age tested. PGHS-1 mRNA was generally greatest in hippocampus and lowest in the brainstem. (Figure 2-1A). Similarly, the hippocampus clearly expressed the highest level of PGHS-2 mRNA, though hypothalamic and pituitary expression were relatively low. (Figure 2-1B). PGHS-1 and -2 protein was detected in every brain region at every age, with the exception of PGHS-2 in early gestation in brainstem, which was below the limit of detection. Hypothalamus Hypothalamic PGHS-1 mRNA expression profile varied significantly across gestational age, with an increase at 120 DGA that was significantly greater than 80, 100 DGA, and adult expression (Figure 2-2A). Levels remained significantly elevated at 130 DGA, decreased at 145 DGA and increased again at 1 week. PGHS-1 protein was analyzed at 80, 120 and 145 DGA and changed significantly as a function of gestational age (overall p=0.05), although post-hoc analysis of individual groups did not reveal specific pairwise differences (Figure 2-2C). 41

PAGE 42

Hypothalamic PGHS-2 mRNA expression increased approximately 35-fold and 8-fold over 80 DGA at 120 and 130 DGA, respectively (Figure 2-2B). Expression at 145 DGA was 5-fold over 80 DGA, although this was not significant. Early post-partum animals expressed PGHS-2 at levels significantly above 80 DGA. PGHS-2 protein was analyzed at 80, 120 and 145 DGA (Figure 2-2D). Protein expression at 80 and 120 DGA was roughly equivalent, while at 145 DGA, protein expression was significantly increased (p=0.033 v. 120 DGA). Representative western blots are shown for PGHS-1 (2-2E) and PGHS-2 (2-2F). Representative control blots are also shown for PGHS-1 (2-2G) and PGHS-2 (2-2H), though the tissues shown in those blot panels are not the ontogenetic tissues shown in the preceding panels, but are other fetal ovine brain tissue specifically used for optimization of western blots. Pituitary Pituitary levels of PGHS-1 mRNA peaked at 120 DGA and were significantly lower that 80 DGA expression from 145 DGA through adulthood. (Figure 2-3A). PGHS-1 protein was below detection limits at 80 DGA, while expression increased significantly at both 120 and 145 DGA (Figure 2-3C). PGHS-2 mRNA expression was significantly affected overall by gestational age (overall p=0.049), although post-hoc analysis of individual groups did not reveal specific pairwise differences (Figure 2-3B). However, the general trend suggested moderately higher expression at mid gestation (80-120 DGA) as compared to late gestation and post-partum levels. Pituitary PGHS-2 protein was most abundant at 80 DGA, with a significant decrease at 120 DGA (Figure 2-3D). Expression at 145 DGA was not significantly different than 80 DGA. Representative western blots are shown for PGHS-1 (2-3E) and PGHS-2 (2-3F) 42

PAGE 43

Hippocampus PGHS-1 mRNA decreased significantly in late gestation fetuses, post-partum lamb, and adult ages compared to 80 DGA fetuses (Figure 2-4A). PGHS-1 protein was relatively constant across all ages tested (Figure 2-4C). Hippocampal PGHS-2 mRNA consistently increased from early to late gestation with significant increases at 145 DGA (Figure 2-4B). Levels transiently decreased in 1-day post-partum animals, but rebounded to nearly 35-fold over 80 DGA by 1-week post-partum. PGHS-2 protein expression patterns were highly similar to the corresponding mRNA (Figure 2-4D). Expression increased gradually from early to late gestation, peaking between 130 and 145 DGA. Representative western blots are shown for PGHS-1 (2-4E) and PGHS-2 (2-4F) Brainstem In the brainstem, fetal and young post-partum PGHS-1 mRNA levels were significantly lower than adult values (Figure 2-5A). Adult expression was approximately 100-fold greater than all other ages. No other significant changes were detected throughout gestation. PGHS-1 protein expression in the brainstem was similar to mRNA expression, but without significant changes (Figure 2-5C). Brainstem PGHS-2 mRNA expression patterns are similar to PGHS-1 mRNA (Figure 2-5B). No significant changes are detected throughout gestation and early neonatal life, but adult animals express significantly higher levels of PGHS-2 compared to all other ages except 100 DGA. Brainstem PGHS-2 protein was not significantly changed at any point tested and did not appear to correspond to the mRNA pattern (Figure 2-5D). Representative western blots are shown for PGHS-1 (2-5E) and PGHS-2 (2-5F) 43

PAGE 44

Cortex In the cortex, PGHS-1 mRNA expression had no statistically significant pattern of expression throughout gestation or post-partum ages (Figure 2-6A). PGHS-1 protein expression was not significantly changed throughout gestation or after birth (Figure 2-6C). PGHS-2 mRNA expression appeared to increase during mid to late gestation, with ~7 fold increases at 120 and 145 DGA and ~11 fold increase at 130 DGA (Figure 2-6B). Post-partum animals (as early as 1 day after birth) showed robust increases in PGHS-2 expression. Peak expression occurred at 7 days after birth at nearly 200 fold the levels detected at 80 DGA. In contrast, PGHS-2 protein levels were most abundant at 80 days (Figure 2-6D). Expression was decreased significantly as early as 100 DGA and remained reduced throughout gestation and one day post-partum. Representative western blots are shown for PGHS-1 (2-6E) and PGHS-2 (2-6F) Cerebellum Cerebellar PGHS-1 mRNA changed significantly as a function of age (p=0.039); however, post-hoc analysis of individual groups did not reveal specific pairwise differences. The most prominent feature of the expression profile is a nearly 400-fold increase at 145 DGA (Figure 2-7A). PGHS-1 protein in the cerebellum exhibited a moderate increase in expression at 120 DGA (Figure 2-7C). PGHS-2 mRNA displayed an apparent biphasic expression pattern (Figure 2-7B). Levels were significantly increased at 120 and 145 DGA. Patterns of PGHS-2 protein expression in the cerebellum were markedly different from the corresponding mRNA (Figure 2-7D). While mRNA levels were lowest at 80 DGA, the protein was most abundant at that age. Expression appeared to decrease as early as 100 DGA, dropping significantly at 130 and 145 DGA, despite 44

PAGE 45

the latter group displaying a prominent increase in mRNA expression. Representative western blots are shown for PGHS-1 (2-7E) and PGHS-2 (2-7F) Discussion Prostaglandins are involved many physiological processes such as inflammation, response to pain, vascular regulation, fetal breathing movements, and modulation of the fetal HPA axis (132; 153; 204). As PGHS-1 and -2 are the rate-limiting enzymes in prostaglandin production, insight into the function of prostaglandins in growth and development of the fetal brain and neuroendocrine systems may be gained by identifying the presence and relative abundance of PGHS-1 and -2 during fetal life. The results of this study provide evidence of significant gestational changes in the expression profile of both PGHS-1 and -2, in multiple regions of the developing brain. These data should be interpreted in concert, not contradiction with other studies detailing the expression in specific neuronal populations at specific ages (16; 145; 201). The relative abundance of each isoform was compared across brain regions tested, revealing hippocampus, cerebellum and cortex to generally be the richest regions of PGHS-1 and -2 mRNA. This would suggest that as compared to brainstem, hypothalamus, or pituitary these regions posses either more active prostaglandin synthesis or reduced mRNA stability, thereby requiring a larger mRNA pool to support equivalent synthesis. Interestingly, mRNA and protein expression trends in many of the tissues analyzed did not correlate for either enzyme across the wide range of gestational and post-partum ages studied. This may reflect the high degree of varied transcriptional regulators of the enzymes in conjunction with the unique limitations on expression and activity of the proteins (73). PGHS-1 and -2 undergo suicide inactivation, where enzymatic activity results in self-inactivation, with effects on expression not yet defined (190). Thus, the abundance of mRNA or immunoreactive enzyme may not necessarily correlate with instantaneous endogenous enzymatic activity. 45

PAGE 46

Additionally, PGHS-1 and -2 are expressed on the endoplasmic reticulum and nuclear envelope of endothelial cells, as well as in the peri-nuclear region and axons of neurons (145; 192). This may indicate that some fraction of translated protein migrates away from the site of mRNA synthesis to distant brain regions via axonal transport. Discrepancies between mRNA and protein abundance may also be confounded by changes in PGHS mobility resulting from tyrosine phosphorylation or other posttranslational processing (151). The available antibodies for ovine PGHS-1 and -2 also presented some difficulty in optimization of western blotting. While we eventually developed a protocol that produced sufficient signal to noise, the more highly controlled real-time RT-PCR results perhaps present a more accurate representation of expression levels. Nevertheless, several significant expression trends were discovered throughout gestation in this study. The present study indicates that biosynthesis of prostaglandins is possible during the early phases of late ovine gestation, as PGHS-1 and -2 mRNA expression between 80 and 120 DGA is altered in nearly all brain regions studied. Extensive neuronal proliferation and synapse formation within and between many fetal brain regions, including cortical and limbic regions directly to the hypothalamus and via the brainstem, mark this period of gestation (41; 122; 141). Given that metabolites of arachidonic acid have been found to control filopodial behavior in neurons, and that we have detected significant changes in PGHS-1 and -2 on both the mRNA and protein level in many regions, we speculate that prostaglandin synthesis may be involved in directing neuronal guidance and synaptogenesis during this period of gestation (69). In addition, PGE 2 receptors have been identified in the peri-nuclear region of vascular endothelial cells suggesting a possible role of prostaglandins as paracrine signals or modulators of gene transcription (10; 16). 46

PAGE 47

Neuroendocrine development and activity are actively occurring during the latter phases of gestation (mid-late to late, or 120-145 DGA in sheep). In the sheep, it is established that a late gestation increase in fetal HPA axis activity is involved in fetal preparation for neonatal life and initiation of parturition (33; 225). We have previously demonstrated that fetal sheep between 125 and 135 DGA respond to exogenous and endogenous prostanoids with activation of the HPA axis (204). At this age, fetal adrenal maturation has begun, allowing for increased adrenal responsiveness to ACTH stimulation, resulting in increased circulating cortisol. In late gestation, elevated fetal cortisol induces placental P450 C17 (cytochrome-P450 17hydroxylase/17, 20-lyase), resulting in preferential placental biosynthesis of estrogen relative to progesterone, augmented myometrial activity and eventual labor and parturition (1; 225). A working hypothesis is that local prostaglandin synthesis in the fetal brain is involved in initiating the increase in fetal HPA axis activity (229). Based on the earlier findings of Deauseault et al., we anticipated detecting of increasing PGHS-1 and -2 protein abundance in the hypothalamus, pituitary, and brainstem (53). Such a finding would suggest an increase in prostaglandin synthesis in brain regions associated with the fetal HPA axis, supporting the involvement of prostaglandins in HPA axis activity. In general, our protein results support this hypothesis, as evidenced by significant increases in both isoforms in the hypothalamus and PGHS-1 in the pituitary. Interestingly, we detected a significant decrease in PGHS-2 protein in the 120 and 145 DGA pituitary, which is in accordance with the mRNA profile. The current results are supported by more recent immunoflourescence work from our laboratory, where it was determined that PGHS-1 appeared to be more abundant in the late gestation fetal anterior pituitary than PGHS-2 (165). As PGHS-1 and PGHS-2 have often been found to respond differently to the same stimuli, perhaps PGHS-1 plays a more important role in the late-gestation 47

PAGE 48

pituitary activity as compared to PGHS-2 (24; 203; 231). Alternatively, the expanded sample number and more even distribution across gestation in this study may provide a more accurate expression profile as compared to our initial study (53). The current study also indicates that prostaglandin synthesis may be altered during mid-late and late gestation in the hippocampus and cerebellum, regions known to influence the HPA axis (97). It has been established that induction of PGHS-2 is an established response to reduction in cerebral blood flow (160; 203; 231). While the ewes in this study were not in active labor, it is possible that unexpected, acute uterine activity or alterations in uterine blood flow altered the flow of blood and/or oxygen to the fetuses, provoking a prostaglandin-mediated response in the hippocampus. Alternatively, these changes may reflect a prostaglandin-mediated response in the hippocampus to increased cortisol. It is well established that initiation of parturition in the human and the sheep is accompanied by a characteristic late-gestation increase in circulating cortisol (32). The average age for the fetuses in this study group was 128 DGA, which is prior to the exponential cortisol increases seen in the last several days of gestation. This age is, however, within the time-frame for adrenal maturation (97), and there may have been a modest increase in adrenal cortisol output that induced a PGHS-2 expression in the hippocampus. Hippocampal serum and glucocorticoid kinase (sgk1), a marker of corticosteroid action, has also been shown to be ontogentically increased at 130 DGA, suggesting that cortisol can affect the hippocampus in this age range (97). Conversely, recent data suggest that the late-gestation hippocampus is immature and not involved in negative feedback, as sectioning of the fetal ovine fornix did not significantly change the length of gestation (125). In light of those data, the present data could be interpreted to indicate a modulatory role of PGHS-2 in the hippocampus that is distinct from 48

PAGE 49

cortisol feedback, for example prostaglandin-mediated regulation of neural connections between the hippocampus and the hypothalamus. It was also demonstrated that placental prostaglandin synthesis, PGHS-2 mRNA, and protein were upregulated in response to increases in fetal cortisol or exogenous fetal glucocorticoids (128). Thus the significant increase in PGHS-2 mRNA and apparent increase in protein in the hippocampus may be a result of increased fetal cortisol, implicating prostaglandin synthesis in the hippocampus as being involved in HPA axis activity and parturition. Furthermore, upregulation of prostaglandin synthesis in the hippocampus may promote feed-forward HPA axis activity, triggering the exponential increases in ACTH and cortisol that drive labor. The possibility that the cerebellum is associated with control of the HPA axis is intriguing. Cerebellar projections to brainstem nuclei might influence HPA axis activity. The cerebellum expresses both PGHS-1 and -2 and estrogen receptors (185; 231). It is established that estrogen can modulate both prostaglandin synthesis and fetal HPA axis activity (160; 175; 242), and it is possible that estrogen stimulation of fetal HPA activity is in part via stimulation of the cerebellum. Significantly increased PGHS-2 mRNA and reduced protein may indicate high PGHS-2 activity, subsequent turnover of the protein, and estrogen based stimulation of transcription (229). PGHS-1 and -2 expression continues to change throughout post-partum life as well, reflecting the possible involvement of prostaglandin synthesis in a multitude of post-natal processes. For example, both enzymes are significantly upregulated during post-partum life in the hypothalamus and brainstem, which may be representative of prostanoid based modulation of baroreceptor/blood pressure control (231). This is in general agreement with prior work in this 49

PAGE 50

laboratory which demonstrated increased brainstem PGHS-1 and hypothalamic PGHS-2 expression in post-natal lambs (53). Interestingly, the primary alterations in PGHS-1 and -2 mRNA in the brainstem appear to be limited to the adult animals. While it is clear that the fetal brainstem can react to acute stimuli, the ontogenetic activity of the fetal HPA axis may operate on a parallel but distinct pathway (205). Additionally, the discrete nature of brainstem nuclei may have precluded detection of significant alterations from basal levels in a tissue homogenate because expression in discrete nuclei might have been diluted by regional homogenates. Ongoing studies in our lab using immunohistochemistry will attempt to determine if alterations in earlier gestation tissues are detectable in specific HPA-axis related nuclei. Hippocampus and cortex are brain regions known to be involved in higher order neural functions (16; 156). Recent electrophysiological evidence has demonstrated that inhibition of PGHS-2, but not PGHS-1, regulates PGE 2 -based hippocampal long term plasticity (37). This may indicate that PGHS-2 is involved in developing plasticity in the week old ovine fetus. We also speculate that PGHS-2 mediated prostaglandin synthesis may be involved in cortical activity. Functional studies in adult humans have demonstrated inhibition of cortical activity after administration of PGHS-2 inhibitors (7). The early post-natal stages of life would be a time of considerable cortical signaling, and the robust increases in PGHS-2 mRNA suggest its involvement. We did not detect a coordinate increase in protein, however, which may be due to transport of the synthesized PGHS-2 protein to a different region of the cortex or suicide inactivation after high levels of prostaglandin production. In conclusion, the current study has demonstrated that PGHS-1 and -2 are expressed in the ovine fetal brain throughout mid to late gestation, and that the patterns of expression are region-specific. It is possible that the biosynthesis of prostaglandins in the fetal brain organize 50

PAGE 51

various aspects of maturation, including synaptogenesis, facilitation of specific reflex pathways, and overarching physiological processes, such as the blood pressure regulation or the timing of parturition. We suggest that, because prostaglandin biosynthetic enzymes appear to be transiently upregulated at specific times in specific brain regions, inhibition of these enzymes during the latter half of gestation is likely to alter the timecourse or perhaps the final outcome of fetal brain development. We therefore hypothesize that prostaglandin signaling in the developing brain is likely to be of fundamental importance for both brain development and for regulation of physiological processes by the brain. 51

PAGE 52

Table 2-1. Distribution of samples for each tissue and age group studied by mRNA and protein analysis. Brainstem Cerebellum Cortex Hippocampus Hypothalamus Pituitary 80 DGA 5 4 5 4 5 5 100 DGA 4 4 4 3 4 4 120 DGA 4 4 4 4 4 4 130 DGA 4 4 4 4 4 4 145 DGA 5 5 5 5 5 4 1 day lamb 4 4 4 4 4 4 1 week lamb 5 5 5 5 5 5 Post-partum maternal 4 4 4 4 4 4 Table 2-2. Distribution of samples collected for protein analysis only. Hypothalamus Pituitary 80 DGA 3 4 120 DGA 4 4 145 DGA 4 4 52

PAGE 53

Table 2-3. Primer and probe sequences used in real-time RT-PCR Target Forward (5-3) Reverse (3-5) Probe PGHS-1 GGCACCAACCTCATGTTTGC TCTTGCCGAAGTTTTGAAGA TTCTTTGCCCAACACTTCACCCATCA PGHS-2 GCACAAATCTGATGTTTGCATTCT CTGGTCCTCGTTCATATCTGCTT TGCCCAGCACTTCACCCATCAATTTT CRH TCCCATTTCCCTGGATCTCA TCAGTTAGCGCAGCAAGCTC TTCCATCTCCTCCGAGAAGTCTTGGAAAT AVP TTCCAGAACTGCCCAAGGG AGACACTGTCTCAGCTCCAGGTC Sybr Green POMC CCGGCAACTGCGATGAG GGAAATGGCCCATGACGTACT AGCCGCTGACTGAGAACCCCCG LH CCGCTCCCAGATATCCTCTTC GTCTGCTGGCTTTGGGAGTTA TCTAAGGATGCCCCACTTCAATCTCCCA FSH CCCAACATCCAGAAAGCATGT GCACAGCCAGGCACTTTCA TTCAAGGAGCTGGTGTACGAGACG Prolactin TGAGCTTGATTCTTGGGTTGCT CCCCGCACCTCTGTGACTA CTCCTGGAATGACCCTCTGTATCAC 53

PAGE 54

Figure 2-1. Relative expression of PGHS-1 and PGHS-2 among brain regions. A) Relative expression of either PGHS-1mRNA compared between brain regions tested at either 80 (black bars), 120 (light gray bars), or 145 (dark gray bars) DGA. B) Relative expression of either PGHS-2 mRNA compared between brain regions tested at either 80 (black bars), 120 (light gray bars), or 145 (dark gray bars) DGA. Data are shown as mean fold differences SEM relative to mean expression of the region with the lowest overall expression of any age group (brainstem for PGHS-1 and pituitary for PGHS-2). B rain regions are abbreviated as BS=brainstem, CB=cerebellum, CX=cortex, HIP=hippocampus, HYPO=hypothalamus, PIT=pituitary. Significance is represented alphabetically for each brain region (i.e. a= v. BS, b= v. CB, c= v. CX, d= v. HIP, e= v. HYPO, f= v. PIT, **= v. all other regions) 54

PAGE 55

Figure 2-2. Ontogeny of hypothalamic PGHS-1 and -2 expression. A) Ontogenetic changes in expression of hypothalamic PGHS-1mRNA. B) Ontogenetic changes in expression of hypothalamic PGHS-2 mRNA. mRNA data are mean fold differences SEM relative to mean expression at 80d. C) Ontogenetic changes in expression of hypothalamic PGHS-1 protein. D) Ontogenetic changes in expression of hypothalamic PGHS-2 protein. Protein data are shown as mean density SEM. Significance is represented alphabetically from young to old ages (i.e. a= v. 80 DGA, b= v. 100 DGA, c= v. 120 DGA, d= v. 130 DGA, e= v. 145 DGA, f= v. +1-D, g= v. +1-W, h= v. Adult) E) Representative western blot results for hypothalamic PGHS-1. F) Representative western blot results for hypothalamic PGHS-2. G) Representative control blot for PGHS-1. H) Representative control blot for PGHS-2. 55

PAGE 56

Figure 2-3. Ontogeny of pituitary PGHS-1 and -2 expression. A) Ontogenetic changes in expression of pituitary PGHS-1mRNA. B) Ontogenetic changes in expression of pituitary PGHS-2 mRNA. mRNA data are shown as mean fold differences SEM relative to mean expression at 80d. C) Ontogenetic changes in expression of pituitary PGHS-1 protein. D) Ontogenetic changes in expression of pituitary PGHS-2 protein. Protein data are shown as mean density SEM. Significance is represented alphabetically from young to old ages (i.e. a= v. 80 DGA, b= v. 100 DGA, c= v. 120 DGA, d= v. 130 DGA, e= v. 145 DGA, f= v. +1-D, g= v. +1-W, h= v. Adult) E) Representative western blot results for pituitary PGHS-1. F) Representative western blot results for pituitary PGHS-2. 56

PAGE 57

Figure 2-4. Ontogeny of hippocampal PGHS-1 and -2 expression. A) Ontogenetic changes in expression of hippocampal PGHS-1mRNA. B) Ontogenetic changes in expression of hippocampal PGHS-2 mRNA. mRNA data are shown as mean fold differences SEM relative to mean expression at 80d. C) Ontogenetic changes in expression of hippocampal PGHS-1 protein. D) Ontogenetic changes in expression of hippocampal PGHS-2 protein. Protein data are shown as mean density SEM. Significance is represented alphabetically from young to old ages (i.e. a= v. 80 DGA, b= v. 100 DGA, c= v. 120 DGA, d= v. 130 DGA, e= v. 145 DGA, f= v. +1-D, g= v. +1-W, h= v. Adult) E) Representative western blot results for hippocampal PGHS-1. F) Representative western blot results for hippocampal PGHS-2. 57

PAGE 58

Figure 2-5. Ontogeny of brainstem PGHS-1 and -2 expression. A) Ontogenetic changes in expression of brainstem PGHS-1mRNA. B) Ontogenetic changes in expression of brainstem PGHS-2 mRNA. mRNA data are shown as mean fold differences SEM relative to mean expression at 80d. C) Ontogenetic changes in expression of brainstem PGHS-1 protein. D) Ontogenetic changes in expression of brainstem PGHS-2 protein. Protein data are shown as mean density SEM. Significance is represented alphabetically from young to old ages (i.e. a= v. 80 DGA, b= v. 100 DGA, c= v. 120 DGA, d= v. 130 DGA, e= v. 145 DGA, f= v. +1-D, g= v. +1-W, h= v. Adult) E) Representative western blot results for brainstem PGHS-1. F) Representative western blot results for brainstem PGHS-2 58

PAGE 59

Figure 2-6. Ontogeny of cerebral cortex PGHS-1 and -2 expression. A) Ontogenetic changes in expression of cerebral cortex PGHS-1mRNA. B) Ontogenetic changes in expression of cerebral cortex PGHS-2 mRNA. mRNA data are shown as mean fold differences SEM relative to mean expression at 80d. C) Ontogenetic changes in expression of cerebral cortex PGHS-1 protein. D) Ontogenetic changes in expression of cerebral cortex PGHS-2 protein. Protein data are shown as mean density SEM. Significance is represented alphabetically from young to old ages (i.e. a= v. 80 DGA, b= v. 100 DGA, c= v. 120 DGA, d= v. 130 DGA, e= v. 145 DGA, f= v. +1-D, g= v. +1-W, h= v. Adult) E) Representative western blot results for cortex PGHS-1. F) Representative western blot results for cortex PGHS-2. 59

PAGE 60

Figure 2-7. Ontogeny of cerebellar PGHS-1 and -2 expression. A) Ontogenetic changes in expression of cerebellar PGHS-1mRNA. B) Ontogenetic changes in expression of cerebellar PGHS-2 mRNA. mRNA data are shown as mean fold differences SEM relative to mean expression at 80d. C) Ontogenetic changes in expression of cerebellar PGHS-1 protein. D) Ontogenetic changes in expression of cerebellar PGHS-2 protein. Protein data are shown as mean density SEM. Significance is represented alphabetically from young to old ages (i.e. a= v. 80 DGA, b= v. 100 DGA, c= v. 120 DGA, d= v. 130 DGA, e= v. 145 DGA, f= v. +1-D, g= v. +1-W, h= v. Adult) E) Representative western blot results for cerebellar PGHS-1. F) Representative western blot results for cerebellar PGHS-2. 60

PAGE 61

CHAPTER 3 SPECIFIC INHIBITION OF PGHS-1 OR PGHS-2: EFFECTS ON PGHS EXPRESSION IN THE OVINE FETAL CNS AND PITUITARY AND ON BASAL HPA AXIS FUNCTION Introduction Neuroendocrine development in the late gestation fetal sheep is characterized by an increase in the activity of the fetal HPA axis, known to be important in central nervous system control of cardiovascular and respiratory function, and in driving parturition at the termination of gestation (113; 116; 222). Dramatic increases in circulating end-products of the HPA axis, plasma ACTH and cortisol, result from exponential increases in axis activity (229). An intact fetal hypothalamic-pituitary signaling cascade is required, as hypophysectomy or bilateral ablation of the paraventricular nucleus (PVN) of the hypothalamus delay parturition (75; 117; 126; 127) and sinoaortic denervation reduces/eliminates the hormonal response to known activators of the HPA axis (223; 226). The critical event(s) responsible for spontaneous activation of the fetal HPA axis are not known, but multiple studies indicate central nervous system prostaglandin synthesis might influence the HPA axis (43; 44; 165; 204). The prostaglandin endoperoxide H synthases (PGHS-1 and PGHS-2) are the rate limiting enzymes in the formation of prostaglandins (189). PGHS-1 and -2 act on arachidonic acid to produce PGH 2 which is further processed by terminal prostaglandin synthases to biologically active prostanoids (192). Expression of these two enzymes is varied, both in cellular distribution and in response to stimuli. We and others have previously demonstrated the presence of both PGHS-1 and -2 in the ovine fetal brain, notably in areas involved in integration of signals for HPA axis function (see chapter 2) (16; 54; 144; 203). Inhibition of PGHS activity by indomethacin administration significantly ameliorated brachiocephalic occlusion (BCO) induced reductions in cerebral blood flow and significantly reduced the production of vasoconstrictors prostaglandin E 2 (PGE 2 ) and thromboxane B 2 (207). BCO also altered PGHS-2 expression in 61

PAGE 62

various regions of the fetal brain (202; 205). Together, such studies demonstrate a link between prostaglandin production and HPA axis function in response to various cardiovascular stimuli. There are three modes of HPA axis activity, acute stimulation, basal stimulation, and ontogenetic drive. Investigation of the relationship between prostaglandin synthesis and the basal fetal HPA axis will further the understanding of mechanisms involved in prostanoid-based activation of and/or regulation of the active fetal HPA axis. Greater knowledge of these mechanisms may help elucidate the mechanisms involved in parturition, which in turn may aid in successful diagnosis and treatment of premature labor. In the present study we attempted to define the role of prostaglandin synthesis in the basal fetal HPA axis. We employed specific pharmacologic inhibitors of each isoform of PGHS and subsequently evaluated gene/protein expression as well as HPA axis function. Based on the significant ontogenetic increases in PGHS-2 mRNA and protein in the hypothalamus (Chapter 2) and prior work associating increased PGHS-2 expression with HPA axis stimuli (205; 231), we hypothesized that inhibition of PGHS-2 would yield the greatest reductions in fetal HPA axis activity. Materials and Methods Twenty-five time dated pregnant ewes (120-135 DGA) carrying twins were used in this study. Ewes were divided into three experimental groups of (n=5 per group) with one twin randomly assigned to receive experimental drug, and the other to receive a vehicle control. The groups were as follows: nimesulide (1mg/day, High Dose or HD), resveratrol (1mg/day, Res), and nimesulide (10g/day, Low Dose or LD). Fetal Surgery Time-dated pregnant ewes carrying twins (120-135 DGA) were fasted for 24 hours prior to surgery. Each ewe was intubated and anesthetized with halothane (0.5-2.5%) in oxygen. The abdomen, left side, and foreleg were shorn and scrubbed with betadine and alcohol. An IV 62

PAGE 63

catheter was placed in the foreleg to deliver saline during surgery. Prior to the initial incision, 750 mg ampicillin (Polyflex, Fort Dodge Laboratories, Fort Dodge, IA) was administered intramuscularly. The uterus was exposed via a midline incision and one set of fetal hindlimbs was located and delivered thru a small incision. Each tibial artery was located and instrumented with a sterile polyvinylchloride catheter (0.030 i.d., 0.050 o.d.), which was advanced to the subdiaphragmatic aorta. Catheters were flushed with saline, filled with heparin to prevent clotting, and plugged with a sterile brass nail. An amniotic fluid catheter (0.05 i.d., 0.09 o.d.) was sewn to one hindlimb which was returned into the amniotic cavity. Identical procedures were performed on the hindlimbs of the second fetus. After hindlimb catheterizations, each fetal head was located and delivered through a second uterine incision. A midline incision was made at the crown of the fetal head and the skull was exposed. A small hole was made in the skull 1cm laterally and 1cm rostrally from the second cranial suture. A sterile tygon catheter (0.050 o.d., 0.030 i.d.) was cut to the depth of the lateral cerebral ventricle, as determined by visualizing cerebrospinal fluid flow through a needle. The catheter was attached to an osmotic mini pump (size 2mL2, flow rate 120ul/day, Alzet, Cupertino, CA, USA) loaded with either treatment drug or vehicle, which was then implanted subcutaneously in the nape of the neck. Veterinary superglue was used to secure the catheter to the skull. The fetal skin was closed, as was the uterus. The same procedure was performed on the second fetus. Antibiotics (750 mg ampicillin) were administered directly into the uterine space prior to closure. Fetal arterial and amniotic catheters were routed to the flank of the ewe via a trochar. Maternal incisions were closed in sequential layers, first the linea alba and peritoneum, followed 63

PAGE 64

by the maternal skin. Catheters were held in place with a cloth pocket and elastic bandage. Use of this surgical procedure is routine in our laboratory (98; 162; 163; 167; 234). Post-Operative Care After surgery was completed, Ewes were given 1 mg/kg flunixin meglumine (Webster Veterinary, Sterling, MA) for analgesia and returned to their pens where they were monitored until they could stand on their own. During the postoperative period (5 days), fetal catheters and maternal flank incisions were cleaned daily with betadine, ewes were treated twice daily with 750 mg ampicillin, intramuscularly (Polyflex, Fort Dodge, WI) and rectal temperatures of the ewes were measured for any indication of post-operative infection. Drug Administration All inhibitors of PGHS-1 and -2 were obtained from Cayman Chemical (Ann Arbor, MI, USA). Each drug was dissolved in dimethyl sulfoxide (DMSO) at 50 mg/mL, then diluted with DMSO or sterile saline appropriately for each individual experiment. Doses were calculated assuming fetal weight at this gestational age range to be approximately 3kg and an estimated 7000ul of CSF production per day (38; 76; 91). All inhibitors and vehicles were delivered via the osmotic mini-pump (size 2mL2, flow rate 120ul/day, Alzet, Cupertino, CA, USA) directed to the lateral cerebral ventricle of each fetus. Nimesulide (specific PGHS-2 inhibitor, IC 50 of 22M for ovine PGHS-1 and 0.3 M for ovine PGHS-2) was delivered to one group of animals at a dose of 1mg/day. Likewise, resveratrol (specific PGHS-1 inhibitor, ED 50 of 15M and 3.7M for cyclooxygenase and peroxidase activities, respectively) was delivered at a dose of 1 mg/day to another group. A 10 g/day dose of nimesulide, derived from the same 50mg/mL stock nimesulide, was administered to third group of animals. 64

PAGE 65

Experimental Protocol and Sample Collection Beginning on the second post-operative day, daily arterial blood samples were collected in duplicate (3mL each) into K 2 -EDTA blood collection tubes (Becton Dickinson Vacutainer Systems, Franklin Lake, NJ, USA) and stored on ice. Additionally, 1 mL of arterial blood was collected into a heparinized syringe and stored on ice for blood gas analysis. Blood volume was replaced with sterile saline. Arterial pO 2 pCO 2 and pH were measured using an ABL 77 Blood Gas analyzer (Radiometer, Copenhagen, Denmark). On the final day of the experiment (5 days post-operatively) a single blood gas sample and five serial arterial blood samples (every five minutes) were collected (4mL) into K 2 -EDTA blood collection tubes (Becton Dickinson Vacutainer Systems, Franklin Lake, NJ, USA) and stored on ice. Blood samples were centrifuged in a swinging bucket rotor at 3,000 x g for 20 minutes at 4C. Plasma was aspirated and aliquots stored at -20C until analysis of plasma hormones. Following the final blood collection, the ewes were euthanized with 20 ml Euthasol solution (7.8 g pentobarbital and 1g phenytoin sodium; Virbac AH, Inc; Fort Worth, TX) administered intravenously. Feto-maternal circulation ensures simultaneous euthanasia of the fetuses. Each fetus was delivered by cesarean section, immediately decapitated, and the brain removed. Fetal cortex, cerebellum, hippocampus, hypothalamus, brainstem, and pituitary were isolated and immediately frozen in liquid nitrogen for RNA or protein extraction. Prior to analysis, each tissue was pulverized with a pre-cooled Bio-Pulverizer, a trigger-style pestle matched to the mortar diameter (Bio-Spec Products, Bartlesville, OK). Pulverized fragments were stored at -80C. RNA Isolation and Gene Expression Analysis RNA isolation was performed using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturers recommendations as described in Chapter 2. Reverse transcription and control reactions were also done as described in Chapter 2. Real-time PCR for PGHS-1, -2, and 18S 65

PAGE 66

ribosomal RNA was performed as in Chapter 2 and previously reported (231). Relative expression levels were calculated by determining the difference in cycle number (Ct) between the PGHS-1 or PGHS-2 values and the corresponding ribosomal RNA value from the same sample. Mean Cts were calculated for triplicate reactions, and for all samples contained in an experimental group (e.g. inhibitor treated or vehicle). Ct values for inhibitor treated samples were adjusted by subtracting the value of the vehicle samples, resulting in a Ct value for each treated group relative to their corresponding vehicle twins. Fold change expression was calculated by using 2 -Ct (119) and displayed as fold change relative to vehicle treated gene expression. In addition to PGHS-1 and -2, real-time PCR reactions were performed to measure the relative abundance of arginine vasopressin (AVP), corticotropin releasing hormone (CRH), POMC, leutenizing hormone (LH), follicle stimulating hormone (FSH), and prolactin. Primer sequences can be seen in Table 2-3. Protein Isolation and Western Blotting PGHS-1 and -2 protein expression was performed by preparing lysis buffer homogenates from cortex and cerebellum as described in Chapter 2. Brainstem, hippocampus, and hypothalamus were prepared for western blotting by isolation of microsomes from each brain region, as described in Chapter 2. Plasma Assays ACTH Plasma ACTH concentrations were measured using a 2-site ACTH Immunoradiometric Assay (IRMA) specific for ACTH 1-39 according to the manufacturers protocol (DiaSorin, Stillwater, MN, USA, cat. No. 27130). Plasma samples were thawed on ice and vortexed to uniformity. Two hundred microliters of each sample was added to duplicate polypropylene tubes followed by 50ul ACTH IRMA tracer containing goat anti-ACTH 26-39 and 125 I mouse anti66

PAGE 67

ACTH 1-17 One mouse anti-goat antibody coated polystyrene bead was added to each tube. All tubes were vortexed, covered, and incubated at 25C for 24 hours, allowing only intact ACTH 1-39 to form an antibody complex. The tubes were then washed three times with the supplied 1X wash solution. Radioactivity was measured for each sample tube using a gamma counter. ACTH 1-39 (henceforth ACTH) concentration was calculated using a standard curve generated from the supplied calibrators. Cortisol Plasma cortisol concentrations were measured using a commercially available enzyme linked immunoassay (ELISA). (Oxford Biomedical Research, Oxford, MI, USA, cat. no. EA65). Ten microliters of each plasma sample was deproteinized in glass tubes with 1 ml 100% ethanol followed by thorough vortexing, centrifuging at 3000 rpm for 10 minutes, and decanting the supernatant to a clean glass tube. Supernatants were concentrated under vacuum for 45 minutes (Jouan, Thermo Electron Corporation, Milford, MA, USA). The residue was resuspended in 120 L of supplied assay buffer. Fifty microliters of supplied standards or unknowns, in duplicate, were pipetted onto the supplied antibody coated plate as well as 50 L of supplied enzyme conjugate in assay buffer. Plates were incubated for one hour at room temperature. After 3 washes with supplied wash buffer to remove unbound material, 150 L of supplied substrate was added to each well, mixed, and incubated for 30 minutes at room temperature. A microplate reader was used to measure absorbance at 650nm (Tecan Group Ltd., Salzburg, Austria) and the supplied standards were used to create a semi-logarithmic standard curve (% bound/unbound v. cortisol concentration). Cortisol concentrations were calculated for each sample, multiplied by a factor of 12 to account for dilution in deproteinizing, and then duplicates were averaged. Cross reactivity with other corticosteroids found in normal plasma is limited (47.42% for prednisolone, 15.77% for cortisone, 15.0% for 11-deoxycortisol). 67

PAGE 68

Pro-opiomelanocortin (POMC) Plasma POMC concentrations were determined using a commercially available ELISA (Immuodiagnostic Systems Limited, Boldon, United Kingdom, cat. no. AC-71F1). Briefly, 100ul of each supplied standard or plasma sample was added to the supplied antibody coated microplate in duplicate. 100ul of assay buffer was added and the plate was incubated for 24 hours at room temperature. Unbound material was removed by washing the plate three times with the supplied wash buffer. 200ul of biotin linked anti-POMC antibody was added to all wells of the plate and incubated for two hours at room temperature. Unbound antibody was removed by washing the plate three times with the supplied wash buffer. Supplied enzyme conjugate was added to all wells of the plate and incubated for 30 minutes at room temperature. Unbound enzyme conjugate was removed by washing the plate three times with the supplied wash buffer. 200ul of supplied tetra-methyl benzidine (TMB) was added to all wells of the plate and incubated for 30 minutes at room temperature. 100ul of supplied 0.5M hydrochloric acid was added to each well to stop the color development reaction. A microplate reader was used to measure absorbance at 450nm (Tecan Group Ltd., Salzburg, Austria) and the supplied standards were used to create an absorbance v. concentration standard curve. The assay has a lower limit of detection of 12 pmol/L and cross-reacts 100% with POMC and pro-ACTH, but minimally with ACTH (<3.6%). Estradiol Plasma estradiol was measured using a commercially available ELISA kit (Oxford Biomedical Research, cat. no. EA70). Estradiol was extracted in 12x75 mm glass tubes containing 200 L plasma and 2 mL hexane/ethyl acetate (3:2 vol/vol). Tubes were vortexed for 30 seconds and organic and aqueous phases were separated. The organic phase was transferred to a clean tube and evaporated under a stream of N 2 and the aqueous phase (containing 68

PAGE 69

sulfoconjugated steroids, proteins, salts, etc.) was discarded. To ensure the purity of estradiol in the samples, evaporated samples were re-extracted using the same volume of hexane/ethyl acetate, vortexed for 15 seconds, and evaporated under N 2 Samples were reconstituted in 120 L of diluted extraction buffer (provided in kit). Reconstituted samples were analyzed in 50 L duplicates and calibrated using standards provided with the kit. Absorbances were read at 450 nm after being stopped with 100 L 1N HCl. Cross reactivity with 17-estradiol, estriol, and estrone in this kit is 100%, 0.41%, and 0.10% respectively, as reported by the manufacturer. Estradiol sulfate Plasma estradiol sulfate was measured using the estradiol ELISA kit from Oxford Biomedical Research (cat. no. EA70) as previously reported (233). Estradiol sulfate was extracted from 10 L plasma using 1 mL ethanol. Extraction with ethanol deproteinizes the plasma, but the water soluble estradiol sulfate remains in solution while estradiol is precipitated. Tubes were vortexed for 30 seconds and centrifuged at 3000 x g for 10 minutes at 4C. Supernatant was transferred to a new glass tube and evaporated under vacuum (Savant Instruments, Farmingdale, NY) for 1 hour. Dried samples were reconstituted in 120 L diluted extraction buffer (provided in kit). Efficiency of this extraction has been shown to be 95-100% (233). Reconstituted samples were analyzed in 50 L duplicates and calibrated using standards provided with the kit. Absorbances were read at 450 nm after being stopped with 100 L 1N HCl. Prostaglandin E 2 Prostaglandin E 2 was extracted from plasma by first acidifying 250 L of thawed plasma with 45 L of fresh 1M citric acid. Thereafter 1 mL of ethyl acetate was added and samples were vortexed. Samples were dried under a constant flow nitrogen manifold. Samples were rehydrated overnight at 4 C using the assay buffer provided with a commercially available 69

PAGE 70

ELISA (Cayman Chemical, Ann Arbor, MI, USA cat. no. 500141 ). The assay was performed according to the manufacturers protocol. Statistical Analysis Blood gases were analyzed using two-way repeated measures ANOVA (time within groups, control v. treatment between groups). Groups were determined to be statistically different from one another when the estimated marginal mean was outside with 95% confidence interval of the comparative group (and vice versa). Changes in mRNA or protein expression were evaluated by paired t-test between control and treated twins using a significance threshold of 0.05. Plasma hormone data (ACTH, cortisol, POMC) were analyzed using two-way repeated measures ANOVA (time within groups, control v. treatment between groups). Groups were determined to be statistically different from one another when the estimated marginal mean was outside with 95% confidence interval of the comparative group (and vice versa). The remaining plasma hormones (estradiol, estradiol sulfate, and PGE 2 ) were each evaluated using a one-way ANOVA (vehicle v. treatment) using a significance threshold of 0.05. All tests were performed using SPSS 13.0 for Windows (SPSS Inc., Chicago, IL, USA). Results Blood Gases Fetal arterial blood gases and pH were measured daily for both control and experimental fetuses. Compiled data for HD nimesulide, resveratrol, and LD nimesulide groups are shown in Figure 3-1. Significance is indicated by letters associated with each day of experimental sample collection, for example an A means significant as compared to day 2 and a B means significant as compared to day 3. Uppercase letters indicate significance in the vehicle fetuses and lowercase letters indicate significance between inhibitor treated fetuses. No significant changes over time were detected in pH for any group. Though each of the inhibitor groups 70

PAGE 71

revealed a single significant change in vehicle twin P a CO 2 no defining trends were apparent in any single group. P a O 2 was unchanged over time in HD nimesulide animals and their vehicle twins. In the resveratrol group, vehicle treated fetuses had unchanged P a O 2 while the resveratrol treated fetuses showed a significantly reduced P a O 2 on day 5 (v. day 4). Likewise, in the LD nimesulide group both control and experimental fetuses experienced a graded hypoxia, as evidenced by significant decreases in P a O 2 on day 5 in control fetuses (v. day 3) and on both days 4 and 5 in treated fetuses (v. day 2). Gene and Protein Expression in Response to Nimesulide Real-time RT-PCR data are presented in Figure 3-2 for the HD nimesulide group, 3-4 for the resveratrol group, and 3-6 for the LD nimesulide group. In each figure, black bars indicate the expression level of vehicle treated fetuses, while gray bars represent expression in inhibitor treated fetuses relative to vehicle fetus expression. Significance is demonstrated by an *. Western blot results for PGHS-1 and -2 are shown in Figures 3-2 C and D, 3-4 C and D, and 3-6 C and D for nimesulide, resveratrol, and LD nimesulide, respectively. In each figure, black bars indicate the expression level of vehicle treated fetuses, while gray bars represent expression in inhibitor treated fetuses as a percentage of vehicle fetus expression. Significance is demonstrated by an *. In several brain regions, multiple immunoreactive bands were present, as reported previously (205), most often at an approximate molecular weight ranging from 140-150 kilodaltons (kDa). Unless otherwise indicated, PGHS-1 or PGHS-2 refers to the 70kDa or 72kDa, respectively, molecular weights typically seen in denaturing western blotting (189, 205). Specificity of immunoreactive bands was clarified by western blots performed in the absence the appropriate primary antibody (See Figure 2-2 G and F). Administration of nimesulide resulted in a significant (~50%) reduction in both PGHS-1 and PGHS-2 in the hypothalamus and PGHS-2 in the cerebral cortex (Figure 3-2 A and B; all 71

PAGE 72

p<0.05 by paired t-test). Expression of PGHS-1 and -2 in all other brain regions and pituitary was unaffected. Nimesulide resulted in a 24% decrease in the 140 kDa immunoreactive band in the brainstem (Figure 3-2 C; p<0.05 v. vehicle by paired t-test) and a 30% increase in expression of PGHS-2 in the hippocampus. Expression of the 140 kDa band in cerebral cortex decreased by 11% (Figure 3-2 D; p<0.05 by paired t-test). mRNA for hypothalamic AVP and CRH, pituitary POMC, leutenizing hormone (LH), follicle stimulating hormone (FSH), and prolactin were unchanged (Table 3-1). Plasma Hormones in Response to Nimesulide As shown in Figure 3-3 A, plasma POMC concentrations were highly variable, both over time and between groups. Plasma POMC concentrations in vehicle treated fetuses were significantly elevated (p<0.05 by 2-way RM ANOVA v. nimesulide treated fetuses) on days 3 and 4, then significantly decreased on day 5 (p<0.05 v. days 2-4 by 2-way RM ANOVA). Similarly, nimesulide treated fetuses had stable initial plasma POMC concentrations that were significantly reduced on day 5 (v. day 2 and 3, p<0.05 by 2-way RM ANOVA). In contrast, plasma ACTH (Figure 3-3 B) and cortisol (Figure 3-3 C) were unchanged in either twin over the course of the experiment. No statistically significant differences were detected either within or between the vehicle and nimesulide treated groups. Plasma concentrations of PGE 2 and estradiol sulfate did not reveal any significant difference between nimesulide treated and vehicle treated fetuses. However, nimesulide treatment did result in a significant increase in plasma estradiol (p<0.05 by ANOVA; Table 3-2). Gene and Protein Expression in Response to Resveratrol Treatment with resveratrol increased PGHS-2 mRNA by 1.34-fold in the cerebellum (Figure 3-4 B), but PGHS-1 and -2 were unchanged in all other regions analyzed. Resveratrol 72

PAGE 73

induced a 10% increase in the expression of PGHS-1 protein in the brainstem (Figure 3-4 C; p=0.05 by paired t-test), but no other significant changes in PGHS-1 or PGHS-2 protein expression were detected in any region. Hypothalamic AVP and CRH, pituitary POMC, LH, FSH, and prolactin were all unaffected by resveratrol treatment (Table 3-1). Plasma Hormones in Response to Resveratrol Plasma POMC, ACTH, and cortisol concentrations did not significantly change over time within either the vehicle or resveratrol treated groups. (Figure 3-5 A-C). No differences were detected between treatment groups. Additionally, administration of resveratrol did not result in any significant differences in plasma concentrations of PGE 2 estradiol, or estradiol sulfate (Table 3-2). Gene and Protein Expression in Response to LD Nimesulide Treatment of fetuses with LD nimesulide did not result in any significant changes in PGHS-1 or -2 gene expression in any brain region or the pituitary. PGHS-1 and PGHS-2 protein expression was also unaffected by LD nimesulide treatment in all brain regions analyzed (Figure 3-6). No significant changes in AVP, CRH, POMC, LH, FSH, or prolactin were detected (Table 3-1). Plasma Hormones in Response to LD Nimesulide Plasma POMC and ACTH concentrations did not significantly change over time within either the vehicle or LD nimesulide treated groups (Figure 3-7 A, B). Despite unchanging plasma POMC and ACTH, both vehicle and LD nimesulide treated fetuses exhibit significant changes in plasma cortisol concentrations within the treatment group over time (Figure 3-7 C). Cortisol concentrations in vehicle treated fetuses were initially 13.5 5.9 pg/mL on day 2, but gradually rose by day 5, to 21.9 2.6 pg/ml, which was significantly elevated compared to all prior vehicle plasma concentrations. (p<0.05 by 2-way RM ANOVA). Similarly, LD nimesulide 73

PAGE 74

treated cortisol concentrations rose from 5.8 2.3 pg/mL on day 2 to 14.3 2.7 pg/mL on day 5, which was significantly elevated compared to all prior LD nimesulide plasma concentrations (p<0.05 by 2-way RM ANOVA). The changes within each treatment group are parallel, and there were no significant differences between the treatment groups. Finally, administration of LD nimesulide did not result in any significant differences in plasma PGE 2 estradiol, or estradiol sulfate concentrations (Table 3-2). Discussion The results of this study demonstrate that 1) inhibition of PGHS-2 with HD nimesulide significantly decreased hypothalamic PGHS-1 and -2 mRNA and significantly increased hippocampal PGHS-2 protein; 2) inhibition of PGHS-2 with HD nimesulide induces an increase in plasma estradiol in the absence of effects on other plasma hormones; 3) inhibition of PGHS-1 with resveratrol does not substantially affect gene or protein expression or hormone concentrations; and 4) inhibition of PGHS-2 with LD nimesulide leads to significantly increased plasma cortisol in both twins via altered adrenal cortisol output. We hypothesized that, given the gestational age of the fetuses (~126 DGA) there would be little ontogenetic drive and no specific acute stimulators of the fetal HPA axis, PGHS-2 would likely be the primary prostaglandin synthase regulating basal HPA axis activity. We conclude, based on the above findings, that PGHS-2 is the primary prostaglandin synthase regulating the basally stimulated fetal HPA axis and that it operates by way of inhibiting HPA axis activity. Nimesulide has been used previously in our lab as a selective inhibitor of PGHS-2 (166; 167), but these are the first experiments to employ it in a long-term administration with subsequent gene and protein expression analysis. The reduction of expression of PGHS-2 in response to nimesulide is not unprecedented (64; 92). In addition to its effect on prostaglandin synthesis (167), nimesulide appears to have allo-effects, such as changes in downstream 74

PAGE 75

signaling cascades or promoter interactions that may feed back to affect PGHS-2 expression (64; 92). A likely candidate for the transcriptional modulation of hypothalamic PGHS-1 and -2 detected here is peroxisome proliferator-activated receptor gamma, which has been shown to reduce PGHS-2 expression in multiple systems, including the brain, (67; 245). Prior work in our laboratory suggested that PGHS-2 activity was inhibitory to the HPA axis (166), and the present findings further this theory. An expected result of decreased hypothalamic PGHS-2, i.e. removal of inhibition, would be increased HPA axis activity (166). Yet, in response to HD nimesulide, plasma ACTH and cortisol, hallmarks of the active axis, were unchanged. This may be partly due to the increased PGHS-2 protein detected in the hippocampus, a region suggested to be important in the glucocorticoid negative feedback that self-limits HPA axis activity (36; 96). Increased PGHS-2 protein may represent an increase in the inhibition of the HPA axis. Given that it is known that PGHS-2 is downregulated by glucocorticoids (58), it is unclear at this point what the inhibitory contribution of PGHS-2 would be in the context of increased glucocorticoids. It may be that PGHS-2 acts to maintain an inactive HPA axis in an inactive state, and that after stimulation leads to increases in glucocorticoids, the role of PGHS-2 based inhibition is lessened. It is also a possibility that PGHS-2 in the hippocampus is not related to negative feedback of the axis. As mentioned in Chapter 2, recent studies failing to show a change in gestational length after sectioning of the fetal fornix suggest that the late-gestation hippocampus is immature and that immaturity is critical in minimizing negative feedback during late ovine gestation (125). Therefore it is possible that the increases in hippocampal PGHS-2 after HD nimesulide may simply be representative of a modulatory effect of PGHS-2 on some other input to the hypothalamus that originates or passes through the hippocampus. 75

PAGE 76

Further supporting the idea that PGHS-2 activity is inhibitory to the HPA axis, we detected a significant increase in plasma estradiol in response to HD nimesulide. These results suggest that prostaglandins can affect estrogen metabolism prior to the preparturient increase in HPA axis activity. One possible mechanism of PGHS-2 inhibition on the HPA axis would be enhancement of estrogen clearance from the fetal bloodstream. High estrogen clearance would keep plasma concentrations low, perhaps preventing a shift from basal to preparturient levels of HPA axis activity. In this experiment, it appears that pharmacologic removal of the inhibitory effects of PGHS-2 reduced estrogen clearance and yielded increased plasma estradiol. Given the localization of PGHS-2 on vascular endothelial cells, and the known effects of prostaglandins on blood flow (51), it is possible that estradiol clearance is reduced via blood flow reduction through an organ of clearance. A possibility for an estradiol clearance bed that could be regulated by the effects of PGHS-2 on blood flow and vascular tone is the liver (150). To test this hypothesis, future experiments could measure blood perfusion of the fetal liver in response to prostaglandin synthase inhibition as well as measure the estradiol content of liver tissue in control and inhibitor treated fetuses. Alternatively, enzymes involved in producing estradiol from its precursors or further metabolizing estradiol to other estrogenic compounds may be affected by changes in PGHS-2 activity. Cytochrome p450 aromatase converts androstenedione and testosterone to estrone and estradiol, respectively, and has been localized in the ovine brain (172; 173). 17-hydroxysteroid dehydrogenase type 2 catalyzes conversion of estradiol to biologically inactive estrone (140) and is also expressed in the human brain (195). Significant alterations in the expression of these enzymes in endometriosis are also associated with changes in PGHS-2 expression and estrogen concentrations (20). Inhibition of PGHS-2 may also alter the metabolic production or 76

PAGE 77

degredation of estradiol. This hypothesis could be easily answered by analyzing plasma for the most likely metabolites to increase, such as androstendione or estrone. Accompanying plasma analysis could be expression studies that determine the alterations in sex steroid metabolic enzymes along the pathways that yield estradiol or use estradiol as a substrate. Finally, it is also possible that estrogen metabolism at this point in gestation is modulated by some prostaglandin derived factor that we have either not contemplated as a contributor to HPA axis-prostaglandin-estrogen interactions or was not measured in the present experiments. Of interest in the present study were the parallel patterns of P a O 2 and plasma cortisol in vehicle and LD nimesulide treated fetuses. These patterns suggest a common stimulus for both fetuses, since the transfer of nimesulide from one twin to the other is doubtful. Stimulating factors derived from the ewe could pass from the placenta through the umbilical vein to both twins simultaneously. It has been proposed that in humans, placental CRH and POMC peptides are released into both the maternal and fetal blood and stimulate fetal ACTH secretion (129; 142; 148) and the fetal adrenal, respectively (217). Data from our laboratory indicates that the ovine placenta does not possess the same components of HPA axis function, making it unlikely that such a factor is operating here (229). More probable, based on the time-dependent decline in P a O 2 and the time-dependent increase in cortisol, is that reductions in uterine blood flow led to the progressive hypoxia in both fetuses. Estrogen is known to support uterine blood flow (155), and the plasma estradiol levels in this experimental group are slightly lower than in the other inhibitor groups, especially in light of the cortisol increases (225). The estradiol levels may be too low to support sufficient local uterine blood flow to maintain normoxic conditions for the two fetuses, with the cortisol response as a predictable result (74). Additionally, the increased cortisol may have stimulated modest increases in PGF2-alpha, a stimulator of myometrial 77

PAGE 78

contraction which could further inhibit blood flow to the fetuses (200; 222). In contrast, the increased plasma estradiol of the HD nimesulide treated fetus appeared to be adequate to maintain uterine blood and fetal normoxia. Despite the cortisol increases evidencing adrenal activity in the vehicle and LD nimesulide fetuses, neither group exhibited the expected corresponding increases in plasma ACTH. Transplacental passage of maternal cortisol could account for increased fetal cortisol, as maternal cortisol can account for up to 37% of fetal cortisol in some instances (82). While we did not measure maternal cortisol, ewes displayed no observable indications of stress and sample collection was done in the early morning, when diurnal cortisol should be low (130). More likely is that the increased cortisol absent increased POMC or ACTH indicates alteration in the adrenal cortisol output in response to a certain type of stimulus (86; 159). Adrenal cortisol output could be affected by increased expression of the G-protein coupled ACTH receptors (MC2R) within the fetal adrenal. Several ontogenetic studies indicate a distinct pattern of increasing MC2R expression in ovine adrenals approaching term (121; 218). However, measurement of MC2R may not be conclusive, as Carter et al. demonstrated that increased cortisol secretion can occur absent increases in either ACTH or adrenal MC2R expression (27). Adrenal cortisol output might also be altered by increasing transport of cholesterol, the precursor molecule to steroids such as cortisol, into the adrenal via steroidogenic acute regulatory protein, or StAR (25). Finally, alterations in sympathetic activity may affect the magnitude of the response of the adrenal gland to a stimulus. Data exhibiting poor correlation between plasma ACTH and adrenal glucocorticoid response (57; 62; 63; 104; 239; 240), as in the present results, prompted morphological studies regarding adrenal inputs. The results suggested that adrenal cortical activity could be mediated by autonomic function, based on the close 78

PAGE 79

association of nerve terminals with endocrine cells in the zona fasciculata (35; 83; 85; 152). Splanchnic nerve stimulation in the conscious hypophysectomized calf nearly doubled cortisol response to exogenous ACTH (61). Altered sympathetic nerve activity in the adrenal cortex could be due to alterations in the prostaglandin environment higher along the sympathetic pathways due to the nimesulide administration (214). Further studies evaluating the expression of adrenal MC2R itself or measurement the downstream G-protein signaling elements such as cyclic AMP in the presence and absence of PGHS-2 inhibition may shed more light on the mechanisms involved in this heightened adrenal cortisol output. Likewise, StAR expression and in vitro function could be studied as well. Retrograde tracers injected into the fetal adrenal followed by immunohistochemistry for PGHS-2 might indicate more conclusively which sympathetic pathways are involved in the modification of cortisol output by the adrenal. By virtue of changes in HPA axis parameters in response to administration of both HD and LD nimesulide, we believe that PGHS-2 is the primary modulator of fetal HPA axis activity under basal conditions. Supporting this is the lack of changes when PGHS-1 is inhibited with resveratrol. It may be possible that inhibition of PGHS-2 shifts substrate flow to PGHS-1, frees PGHS-1 from negative allosteric regulation, and PGHS-1 actually accounts for the results of this study (158; 192; 198). That would be somewhat consistent with the concept of PGHS-1 acting as a constitutive enzyme, in that it would be responsible for axis activity in the absence of any acute or ontogenetic stimuli. However, this would be inconsistent with our prior data suggesting PGHS-2 functions as an negative regulator of the HPA axis (166) as well as our previous findings in this study regarding ontogenetic changes in both PGHS-1 and -2. It may be that there are independent signaling mechanisms for the three modes of HPA axis activity, acute, basal, and ontogenetic stimulation. We have designed further experiments in Chapter 4 to help address 79

PAGE 80

this question by utilizing exogenous estradiol to experimentally provide ontogenetic stimulation to the HPA axis. In conclusion, the present study has demonstrated that inhibition of PGHS-2 with different doses of nimesulide affects PGHS-1 and -2 expression, plasma estradiol concentrations, plasma cortisol concentrations, and cortisol response of the adrenal gland. Taken together, these findings indicate that the late gestation fetal HPA axis under basal stimulation is primarily influenced by the inhibitory effects of PGHS-2 activity. 80

PAGE 81

Table 3-1. Gene expression of hypothalamic and pituitary hormones in response to prostaglandin synthesis inhibition in the basally stimulated HPA axis Treatment Group Hormone Tissue 1mg/day Nimesulide Resveratrol 10g/day Nimesulide CRH Hypothalamus 5.27 3.26 0.98 0.25 .089 0.15 AVP Hypothalamus 1.25 0.91 0.88 0.31 0.72 0.17 POMC Pituitary 0.74 0.29 0.90 0.12 0.92 0.28 oLH Pituitary 1.67 0.88 1.67 0.56 1.40 0.56 oFSH Pituitary 1.05 0.18 1.81 0.88 0.85 0.21 oPRL Pituitary 0.99 0.22 0.88 0.16 1.00 0.16 Data presented as mean fold change in gene expression relative to vehicle fetus SEM. indicates p<0.05 by paired t-test. Table 3-2. Plasma PGE2, estradiol, and estradiol-3-sulfate in vehicle and PGHS inhibitor treated fetuses Treatment Group Hormone Vehicle 1 mg/day Nimesulide Vehicle Resveratrol Vehicle 10 g/day Nimesulide PGE 2 pg/ml 179 47 131 32 338 32 360 60 318 17 292 37 Estradiol, pg/mL 11.9 3.5 25.6 7.2 26.8 5.6 23.9 6.9 19.1 5.7 16.4 5.7 Estradiol-3Sulfate, ng/mL 0.61 0.07 0.62 0.09 0.44 0.08 0.38 0.09 0.14 0.05 0.30 0.08 Data presented as mean plasma hormone concentration SEM. indicates p<0.05 by paired t-test. 81

PAGE 82

Figure 3-1. Arterial pH, pCO 2 and pO 2 in vehicle and PGHS inhibitor treated twin fetuses. A) Daily arterial pH in vehicle and HD nimesulide treated twins. B) Daily arterial pH in vehicle and resveratrol treated twins. C) Daily arterial pH in vehicle and LD nimesulide treated twins. D) Daily arterial pCO 2 in vehicle and HD nimesulide treated twins. E) Daily arterial pCO 2 in vehicle and resveratrol treated twins. F) Daily arterial pCO 2 in vehicle and LD nimesulide treated twins. G) Daily arterial pO 2 in vehicle and HD nimesulide treated twins. H) Daily arterial pO 2 in vehicle and resveratrol treated twins. I) Daily arterial pO 2 in vehicle and LD nimesulide treated twins. In each panel, vehicle treated fetuses are represented by dashed lines with solid circles, while inhibitor treated fetuses are represented by solid lines with open circles. Within group significance is shown by letters, A, B, or C represent significance in the vehicle group as compared to day 2, 3, or 4 respectively. Lowercase letters indicate significance v. the same time points, within the treated group. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 82

PAGE 83

Figure 3-2. PGHS-1 and PGHS-2 mRNA and protein expression in the fetal brain and pituitary in response to HD nimesulide. A) PGHS-1 mRNA expression in treated twins relative to vehicle twins. B) PGHS-2 mRNA expression in treated twins relative to vehicle twins. Data are mean fold change SEM. Vehicle treated fetus mRNA levels are shown in black bars, and nimesulide treated fetus mRNA levels in gray bars. C) PGHS-1 protein expression in treated as compared to vehicle twins. D) PGHS-2 protein expression in treated as compared to vehicle twins. Data are mean SEM. Intensity of immunoreactive bands are shown in black bars for vehicle fetuses and light gray for nimesulide fetuses. When detected, 140 kDa bands are shown in dark gray bars for vehicle fetuses and open bars for nimesulide fetuses. Significant differences (p<0.05 by paired t-test) are indicated by an *. E) Representative western blot results indicating expression levels of the 140 kDa PGHS-1 band in the brainstem of HD nimesulide and vehicle treated fetuses. F) Representative western blot results indicating expression levels of the 72 kDa PGHS-2 band in the hippocampus of HD nimesulide and vehicle treated fetuses. 83

PAGE 84

Figure 3-3. Daily plasma POMC, ACTH, and cortisol concentrations in response to HD nimesulide. Data are shown as mean SEM. A) Plasma POMC concentrations. B) Plasma ACTH concentrations. C) Plasma cortisol concentrations. Vehicle treated fetuses are represented by dashed lines with solid circles, while nimesulide treated fetuses are represented by solid lines with open circles. Within vehicle group significance is shown by letters, A, B, or C representing a significant difference as compared to day 2, 3, or 4, respectively. Within nimesulide group significance is shown by letters, a, b, or c representing a significant difference as compared to day 2, 3, or 4, respectively. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 84

PAGE 85

Figure 3-4. PGHS-1 and PGHS-2 mRNA and protein expression in the fetal brain and pituitary in response to resveratrol. A) PGHS-1 mRNA expression in treated twins relative to vehicle twins. B) PGHS-2 mRNA expression in treated twins relative to vehicle twins. Data are mean fold change SEM. Vehicle treated fetus mRNA levels are shown in black bars, and resveratrol treated fetus mRNA levels in gray bars. C) PGHS-1 protein expression in treated as compared to vehicle twins. D) PGHS-2 protein expression in treated as compared to vehicle twins. Data are mean SEM. Intensity of immunoreactive bands are shown in black bars for vehicle fetuses and light gray for resveratrol fetuses. When detected, 140 kDa bands are shown in dark gray bars for vehicle fetuses and open bars for resveratrol fetuses. Significant differences (p<0.05 by paired t-test) are indicated by an *. E) Representative western blot results indicating expression levels of the 70 kDa PGHS-1 band in the brainstem of resveratrol and vehicle treated fetuses. 85

PAGE 86

Figure 3-5. Daily plasma POMC, ACTH, and cortisol concentrations in response to resveratrol. Data are shown as mean SEM. A) Plasma POMC concentrations. B) Plasma ACTH concentrations. C) Plasma cortisol concentrations. Vehicle treated fetuses are represented by dashed lines with solid circles, while resveratrol treated fetuses are represented by solid lines with open circles. Within vehicle group significance is shown by letters, A, B, or C representing a significant difference as compared to day 2, 3, or 4, respectively. Within resveratrol group significance is shown by letters, a, b, or c representing a significant difference as compared to day 2, 3, or 4, respectively. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 86

PAGE 87

Figure 3-6. PGHS-1 and PGHS-2 mRNA and protein expression in the fetal brain and pituitary in response to LD nimesulide. A) PGHS-1 mRNA expression in treated twins relative to vehicle twins. B) PGHS-2 mRNA expression in treated twins relative to vehicle twins. Data are mean fold change SEM. Vehicle treated fetus mRNA levels are shown in black bars, and nimesulide treated fetus mRNA levels in gray bars. C) PGHS-1 protein expression in treated as compared to vehicle twins. D) PGHS-2 protein expression in treated as compared to vehicle twins. Data are mean SEM. Intensity of immunoreactive bands are shown in black bars for vehicle fetuses and light gray for nimesulide fetuses. When detected, 140 kDa bands are shown in dark gray bars for vehicle fetuses and open bars for LD nimesulide fetuses. Significant differences (p<0.05 by paired t-test) are indicated by an *. 87

PAGE 88

Figure 3-7. Daily plasma POMC, ACTH, and cortisol concentrations in response to LD nimesulide. Data are shown as mean SEM. A) Plasma POMC concentrations. B) Plasma ACTH concentrations. C) Plasma cortisol concentrations. Vehicle treated fetuses are represented by dashed lines with solid circles, while nimesulide treated fetuses are represented by solid lines with open circles. Within vehicle group significance is shown by letters, A, B, or C representing a significant difference as compared to day 2, 3, or 4, respectively. Within nimesulide group significance is shown by letters, a, b, or c representing a significant difference as compared to day 2, 3, or 4, respectively. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 88

PAGE 89

CHAPTER 4 PROSTAGLANDIN SYNTHASE INHIBITION IN ESTROGENIZED OVINE FETUSES: EFFECTS ON PGHS-1 AND-2 EXPRESSION IN THE OVINE FETAL CNS AND PITUITARY AND ON STIMULATED HPA AXIS FUNCTION Introduction Spontaneous and dramatically increased late gestation activity from an intact fetal HPA axis are understood to be primary endocrine driving forces for parturition in the sheep (116; 127; 229). Fetal HPA axis activity is critical, as hypophysectomy, bilateral ablation of the paraventricular nucleus (PVN) of the hypothalamus, or bilateral fetal adrenalectomy delay parturition (75; 117; 126; 127). Conversely, parturition can be experimentally advanced by infusion of ACTH or cortisol (111; 235). While the mechanism(s) initiating fetal HPA axis activation are not fully understood, evidence suggests the interaction of estrogens and prostaglandin synthesis are responsible for the feed-forward increase in activity just prior to parturition (229). In sheep, changing fetal cortisol levels have a strong regulatory effect on placental estrogen biosynthesis (9; 116). In early to mid-gestation, the ovine placenta secretes primarily progesterone, due to low expression of cytochrome-P450 17-hydroxylase/17, 20 lyase (CYP17). However, the late-gestation fetal cortisol increases induce CYP17, yielding increased conversion of progesterone to androgens, which is converted to estrogens by placental aromatases (1; 77). The resulting increase in the estrogen:progesterone ratio is thought to upregulate placental prostaglandin synthesis, causing the myometrium to shift from a quiescent to an active state, culminating in parturition (29; 116; 229). Estrogenic stimulation of the HPA axis was documented in ovariectomized female adult rats, whos attenuated adrenal steroid production returned to normal levels with estradiol 89

PAGE 90

replacement (40; 102). Estrone administration to adult sheep elevates hypothalamic AVP content (238). Saoud et al. showed that exogenous estradiol elevates basal fetal ACTH and cortisol concentrations, and augmented hormonal responses to sodium nitroprusside induced hypotension (176). Exogenous estradiol also increased neuronal activity in the nucleus tractus solitarius, the rostral ventro-lateral medulla and the PVN, brain regions associated with the HPA axis (160). In conjunction with prior work linking cerebral hypoperfusion and increased PGHS expression (202; 205), experiments have also confirmed that estradiol administration augmented the hormonal responses (ACTH, cortisol, AVP) and increases in PGHS-2 expression in response to brachiocephalic occlusion (231). Together, these experiments suggest a strong link between prostaglandin synthesis and the positive effect of estrogens on fetal HPA axis activity. Thus, the ontogenetic stimulation leading to exponential increases in axis activity prior to parturition is driven by positive estrogen feedback, and may be modulated by prostaglandin synthesis. By using exogenous estradiol to stimulate the axis, the present study was designed to determine the role of prostaglandin synthesis in the activity of the ontogenetically stimulated axis. Materials and Methods Ten time dated pregnant ewes (avg. of 130 DGA) carrying twins were used in this study. Ewes were divided into two experimental groups (n=5 per group) with both twins receiving a subcutaneous constant release estrogen pellet, one twin randomly assigned to receive experimental drug, and the other to receive a vehicle control. The groups were as follows: estrogen (0.25mg/day) plus indomethacin (0.05mg/day, E2+Indo), and estrogen (0.25mg/day) plus nimesulide (10g/day, E2+LD). 90

PAGE 91

Fetal Surgery Fetal surgery using aseptic techniques was performed as outlined in Chapter 3. The exception was that during the hindlimb catheterization, estrogen pellets (Innovative Research, Sarasota, FL, USA) were implanted into the subcutaneous space of one leg of both fetuses. Post-Operative Care After surgery was completed, Ewes were given 1 mg/kg flunixin meglumine (Webster Veterinary, Sterling, MA) for analgesia and returned to their pens where they were monitored until they could stand on their own. During the postoperative period (6 days), post-operative care was performed as outlined in Chapter 3. Drug Administration All inhibitors of PGHS-1 and -2 were obtained from Cayman Chemical (Ann Arbor, MI, USA). Each drug was dissolved in dimethyl sulfoxide (DMSO) at 50 mg/mL, then diluted with DMSO or sterile saline appropriately for each individual experiment. Doses were calculated assuming fetal weight at this gestational age range to be approximately 3kg and an estimated 7000ul of CSF production per day (38; 76; 91). All inhibitors and vehicles were delivered via the osmotic mini-pump (size 2mL2, flow rate 120ul/day, Alzet, Cupertino, CA, USA) directed to the lateral cerebral ventricle of each fetus. Estradiol (17-) was delivered by a biodegradable subdermal pellet which released the hormone at a rate of approximately 0.25 mg/day (Innovative Research, Sarasota, FL, USA). This dose was previously demonstrated to significantly increase the fetal circulating estradiol levels to approximately those measured in late ovine gestation and have been used previously in this lab (231; 232). Indomethacin was infused at a dose of 0.05 mg/day, based on the effects of acute intravenous administration of this drug in prior in vivo experiments (108; 207). Nimesulide 91

PAGE 92

(specific PGHS-2 inhibitor, IC 50 Cox-1 and IC 50 Cox-2) was delivered at a dose of 10g/day based on the results of experiments outline in Chapter 3. Experimental Protocol and Sample Collection The experimental protocol and sample collection was performed as outlined in Chapter 3, with the exception that experiments ran for a total of 6 days. RNA Isolation and Gene Expression Analysis RNA isolation was performed using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturers recommendations as described in Chapter 2. Reverse transcription and control reactions were also done as described in Chapter 2. Real-time PCR for all genes analyzed and 18S ribosomal RNA was performed as in Chapters 2 and 3. Briefly, relative expression levels were calculated by determining the difference in cycle number (Ct) between the PGHS-1 or PGHS-2 values and the corresponding ribosomal RNA value from the same sample. Mean Cts were calculated for triplicate reactions, and for all samples contained in an experimental group (e.g. inhibitor treated or vehicle). Ct values for inhibitor treated samples were adjusted by subtracting the value of the vehicle samples, resulting in a Ct value for each treated group relative to their corresponding vehicle twins. Fold change expression was calculated by using 2 -Ct (119) and displayed as fold change relative to vehicle treated gene expression. Primer sequences and concentrations were utilized as described in Chapter 3 (see Table 2-3). Protein Isolation and Western Blotting PGHS-1 and -2 protein expression was performed by preparing lysis buffer homogenates from cortex and cerebellum as described in Chapter 2. Brainstem, hippocampus, and hypothalamus were prepared for western blotting by isolation of microsomes from each brain region, as described in Chapter 2. 92

PAGE 93

Plasma Assays Plasma hormone analysis of ACTH, cortisol, POMC, estradiol, estradiol sulfate, and PGE 2 were all performed as previously described in Chapter 3. Statistical Analysis Blood gases, gene and protein expression, and plasma hormone concentrations were statistically analyzed as described in Chapter 3. Results Blood Gases Fetal arterial blood gases and pH were measured daily for both vehicle and inhibitor treated fetuses. Compiled data for estrogen + LD nimesulide and estrogen + indomethacin groups are shown in Figure 4-1 A, C, E and 4-1 B, D, and F, respectively. Significance is indicated by letters associated with each day of experimental sample collection, for example an A means significant as compared to day 2 and a B means significant as compared to day 3. Uppercase letters indicate significance in the vehicle fetuses and lowercase letters indicate significance between inhibitor treated fetuses. An indicates significance between vehicle and inhibitor treated fetuses. No significant changes in pH or P a CO 2 were detected in vehicle or LD nimesulide treated fetuses, either over time, or between vehicle and treated fetuses. P a O 2 was significantly elevated on days 5 and 6 in vehicle treated fetuses (v. day 3, p<0.05 by 2-way RM ANOVA; Figure 4-1 E). Arterial pH and P a CO 2 were unchanged over time in vehicle and indomethacin treated fetuses, and no between group differences were detected. However, P a O 2 varied over time within the vehicle group; P a O 2 on day 5 was significantly reduced as compared to both days 2 and 4 93

PAGE 94

(p<0.05 by 2-way RM ANOVA; Figure 4-1 F). Additionally, P a O 2 in indomethacin treated fetuses was significantly reduced on days 3 and 5 as compared to vehicle fetuses (p<0.05 by 2-way RM ANOVA). Gene and Protein Expression in Response to LD Nimesulide Real-time RT-PCR and western blot data evaluating gene and protein expression in fetal brain regions and pituitary from estrogenized vehicle and LD nimesulide treated fetuses are presented in Figure 4-2. In each panel, black bars indicate the expression level of vehicle treated fetuses, while gray bars represent expression in inhibitor treated fetuses relative to vehicle fetus expression. Significance is demonstrated by an *. Administration of LD nimesulide to estrogenized fetuses caused a significant decrease hypothalamic PGHS-1 mRNA (Figure 4-2 A; p = 0.05). No other significant changes in PGHS-1or PGHS-2 mRNA were detected The 140kDa species of brainstem PGHS-1 protein was significantly decreased in LD nimesulide treated fetuses (Figure 4-2 C). No significant changes were detected in PGHS-2 protein levels. Hypothalamic releasing factors, AVP and CRH, as well as pituitary POMC, LH, FSH, and prolactin were unchanged in response to LD nimesulide administration. (Table 4-1). Plasma Hormones in Response to LD Nimesulide Figure 4-3 shows daily plasma POMC, ACTH, and cortisol concentrations in estrogen treated vehicle or LD nimesulide fetuses. Plasma POMC was unchanged in vehicle fetuses throughout the experiment. In contrast, LD nimesulide treated fetuses had significantly increased plasma POMC concentrations on day 6 (v. days 3 and 4 ; p<0.05 by 2-way RM ANOVA). Plasma ACTH was not significantly different either within groups over time, or between groups at any time point. Vehicle fetus cortisol concentrations declined initially, but were significantly increased on day 6 (v. days 2-5; p<0.05 by 2-way RM ANOVA). Similarly, 94

PAGE 95

LD nimesulide cortisol concentrations steadily declined through day 4. The declining trend was reversed and by day 6 plasma cortisol concentrations in LD nimesulide fetuses were 12.4 1.7 ng/mL, which was significantly higher as compared to days 3 through 5 (p<0.05 by 2-way RM ANOVA). Plasma concentrations of PGE 2 and estradiol sulfate did not reveal any significant difference between LD nimesulide treated and vehicle treated fetuses. However, nimesulide treatment did result in a significant increase in plasma estradiol (p<0.05 by ANOVA; Table 4-2). Gene and Protein Expression in Response to Indomethacin Real-time RT-PCR and western blot data evaluating gene and protein expression in fetal brain regions and pituitary from estrogenized vehicle and indomethacin treated fetuses are presented in Figure 4-4. In each panel, black bars indicate the expression level of vehicle treated fetuses, while gray bars represent expression in inhibitor treated fetuses relative to vehicle fetus expression. Significance is demonstrated by an *. Estrogen in conjunction with indomethacin administration did not significantly alter the expression of PGHS-1 or PGHS-2 mRNA in any brain regions or in the pituitary as compared to vehicle treated estrogenized fetuses (Figure 4-4 A and B). In contrast, indomethacin administration significantly reduced the 140 kDa species of cerebellar PGHS-1 protein (p=0.043 by paired t-test; Figure 4-2 C). PGHS-2 protein (72kDa) was significantly induced by indomethacin treatment in the cerebral cortex (Figure 4-4 D). Indomethacin treatment reduced hypothalamic AVP mRNA expression while hypothalamic CRH remained unchanged (Table 4-1). Other pituitary hormone mRNA levels, POMC, LH and FSH, were also unchanged. However, indomethacin induced a 1.8 fold increase in pituitary prolactin expression (p=0.004 by paired t-test; Table 4-1). 95

PAGE 96

Plasma Hormones in Response to Indomethacin Plasma POMC concentrations for both vehicle and indomethacin treated fetuses increased between experimental days 4 and 6. In vehicle treated fetuses (Figure 4-5), POMC concentrations on day 6 were significantly increased to 33.2 3.2 pM (p<0.05 versus all previous time points by 2-way RM ANOVA). No significant differences were detected between the two treatments. Plasma ACTH concentrations were constant and did not change significantly throughout the experiment in both groups. No significant differences were found between the two treatment groups at any time point. Plasma cortisol concentrations varied over time within each treatment group, but not between the groups (Figure 4-5 C). Cortisol concentrations declined through day 5 in vehicle fetuses but were significantly increased on day 6 (v. vehicle days 2-5; p<0.05 by 2-way RM ANOVA). Indomethacin treated fetuses exhibited a parallel pattern, with day 6 cortisol concentrations that were significantly elevated over days 4 and 5 (p<0.05 by 2-way RM ANOVA) No significant differences in cortisol were detected between treatments. No significant differences were detected between treatments for plasma PGE 2 estradiol, or estradiol sulfate (Table 4-2). Discussion The results of the present study indicate that, as compared to non-estrogenized animals in Chapter 3, in estrogen stimulated fetuses 1) estrogen sensitizes the HPA axis to the removal of inhibition by PGHS-2; 2) inhibition of PGHS-2 alone or in combination with PGHS-1 results in alterations in adrenal cortisol output, and 3) administration of indomethacin significantly alters estrogen metabolism at a central point that yields effects on both fetuses. Estradiol administration was designed to mimic the estrogen increases that would drive and/or result from the spontaneous ontogenetic surge in HPA axis activity (229). Exogenous estradiol may 96

PAGE 97

stimulate the basal HPA axis and provide enough positive feedback to push the axis into a self-propagating mode, rather than self-limiting mode associated with basal axis activity. These results provide further support for the conclusion of Chapter 3, that PGHS-2 activity provides negative regulation of the axis. Moreover, we interpret these data to indicate that, in an estrogenized environment, PGHS-1 serves as an indirect primary regulator of estrogenic input to the HPA axis, possibly through alteration of uterine or placental estrogen metabolism. To avoid prolonged activation to acute stimuli and prevent mistimed self-propagating activity, the fetal HPA axis is self-regulated. Self-regulation is believed to be achieved largely through cortisol negative feedback, which targets the core subunits of the axis, the hypothalamus and pituitary, as well as the hippocampus (65; 161; 212) In contrast, the transition of the HPA axis from mid-gestation basal activity levels to late gestation spontaneous ontogenetic activation must overcome these self-regulatory mechanisms. It appears that estradiol achieves this, in part, by lowering the amount of stimulation required for activation of the axis when the PGHS-2 based negative regulation of the HPA axis is reduced. In the present experiment, estradiol combined with LD nimesulide reduced hypothalamic PGHS-1 mRNA and brainstem PGHS-1 protein, just as with HD nimesulide alone (See Chapter 3, Figure 3-2). In contrast, no changes in PGHS-2 were detected; the same result as with LD nimesulide alone. Similar to the hormonal results of Chapter 3, inhibition of PGHS-2 resulted in significantly increased plasma estradiol compared to the vehicle. Interestingly, absent exogenous estradiol, the increase was detected after HD nimesulide while administration of LD nimesulide yielded the same effect in the presence of exogenous estradiol. This suggests either that the LD nimesulide dose is a more potent inhibitor of PGHS-2 or that estrogen primed (made it more ready to be activated) the HPA axis to be hypersensitive to reductions in PGHS-2 based inhibition of the axis. 97

PAGE 98

In Chapter 3, we suggested that the increased hippocampal PGHS-2 may represent increased inhibition on the HPA axis. This is consistent with the current results, as the lack of increased hippocampal PGHS-2 is accompanied by increased estradiol and cortisol, i.e. axis activation. Activation of the axis suggests that estradiol has reduced the inhibitory effect of PGHS-2 on the axis. This is also consistent with the proposed positive feedback role of estrogen on the HPA axis in the fetus (229). We believe that the current results suggest that, mechanistically, estrogen primes the HPA axis to be liberated from the negative effects of PGHS-2. In other words, the presence of estradiol has yielded responses consistent with a high dose of nimesulide (lowest level of PGHS-2 based axis inhibition) at doses of nimesulide that are 100-fold lower. This appears to prepare the axis for signaling such that lower levels of stimulation, represented here by lesser disinhibition of the axis, are required for activation. This could aid not only in the initial transition from basal activity, but also in the self-propagating increase in pre-parturient activity. Similar to the experimental results after administration of LD nimesulide alone, the current results reveal increased cortisol in the absence of increased ACTH, suggesting that variations in adrenal cortisol output sensitivity play a role in signaling through the ontogenetically stimulated HPA axis. Among other mechanisms, variations in adrenal cortisol output may be affected by increases in the MC2R receptor density on the developing adrenal (121; 218) or increased substrate supply to the adrenal via increased expression of StAR (25). Altered efferent sympathetic nerve stimulation of the adrenal (62) is also a possibility, which is made more likely by the similar patters of plasma POMC and cortisol concentrations (Figures 4-3 and 4-5). As suggested by Poore et al., POMC metabolism may be influencing adrenal responsiveness. Specifically, the increasing plasma POMC concentrations and steady ACTH concentrations 98

PAGE 99

indicate the ratio between high molecular weight ACTH-containing precursors and ACTH is increased. The high molecular weight precursors may be antagonizing the MC2R, preventing ACTH from binding and activating the receptor (159). From these data we hypothesize that the increases in cortisol despite this increased ratio support a neural mechanism for adrenal stimulation as such a mechanism could operate independently of the ACTH receptor. The current study demonstrates that simultaneous inhibition of PGHS-1 and -2 with indomethacin significantly alters a central point of estrogen metabolism capable of affecting circulating estradiol concentrations in both twin fetuses. Contrary to our expectations from prior use of subcutaneous estradiol pellets (176; 231; 237) and the plasma estradiol levels detected in the LD nimesulide arm of this study, plasma estradiol concentrations in vehicle and indomethacin treated fetuses were low. In fact, concentrations were not significantly different from those of the treatment groups in Chapter 3, where no exogenous estradiol was administered. It is unlikely that the pellets used in this group of experiments were faulty, as the same batch of pellets was used in the LD nimesulide arm of this study, which produced estradiol levels on par with what was expected (231). While the changes in estradiol in response to HD nimesulide alone or to LD nimesulide after estradiol administration likely involved alterations in clearance or metabolism of estradiol within the treated twin, such a mechanism is insufficient to explain alterations in estradiol concentrations in both fetuses. These results suggest that inhibition of PGHS-1 has dominant and opposite effects on circulating estradiol and that a central estrogen metabolism mechanism is affected by simultaneous inhibition of PGHS-1 and -2. We speculated that the increased estradiol detected in response to inhibition of PGHS-2 was likely due to alterations in clearance or metabolism of estradiol. In this instance, the same mechanisms are probably at work, though increased clearance and decreased synthesis would be 99

PAGE 100

expected. Candidate organs possessing the ability to clear estradiol or alter its synthesis and/or metabolism that could affect both twins are the uterus and the placenta. Both are highly vascularized and could greatly increase clearance of estradiol following increases in blood flow. The placenta also contains the enzymes necessary to produce estradiol from precursor substrates (229), as well as metabolize estradiol into other estrogen compounds. For the uterus or placenta to affect estradiol concentrations in both twins, a signal derived from central nervous system indomethacin action in one twin would have to impact uterine blood flow or placental sex-steroid metabolism. Our data clearly indicate that the signal is prostaglandin mediated, however, whether such a mechanism is ultimately neural in nature or endocrine related cannot be determined from the present data. We interpret the present data to support a prostaglandin mediated effect on sympathetic innervation of the adrenal, although no comparable neural pathway projects directly from the fetal central nervous system to the fetal placenta. Therefore, endocrine signals appear more likely, though our data indicate cortisol is unlikely to mediate this effect, as cortisol concentrations were similar in both treatment groups but estradiol was significantly different. Perhaps indomethacin induced decreases in hypothalamic AVP mRNA or increased prolactin mRNA is related to generation of a signal affecting the uterus. It has been proposed that endocrine actions of lactogenic hormones such as prolactin alter the secretory function of the endometrium (194). It is also possible that a mixed neural-endocrine effect generates the signal in which central nervous system prostaglandin synthesis inhibition may alter neural signaling to an endocrine tissue, which subsequently releases a factor affecting the uterus or placenta. Finally, the high rate of blood flow from the placenta to the fetus via the umbilical vein (208) and estradiol clearance capacity of the liver (150) make it feasible that a circulating factor 100

PAGE 101

derived from placenta or uterus simultaneously increases blood flow to both to both fetal livers. What is clear from our data is that the interactions between prostaglandin synthesis, the ovine fetal HPA axis, and estrogen are more complex than previously thought. It no longer appears that the ovine system is a single loop feedback system involving only prostaglandin synthesis, axis activity, and estrogen feedback (229). The present results suggest that additional constituents, such as neural control mechanisms may play a larger role than anticipated. Likewise, it appears that there are additional modes of regulation, as at times PGHS-1 and -2 appear to operate in distinct, if not opposing manners. These data may also suggest that ovine estrogen biosynthesis is more complex than previously thought, and may, similar to the primate (229) involve production of substrates at extra-placental sites (88; 89) that are directly or indirectly reduced by indomethacin and provide less estrogenic substrate to the placenta. Further studies, such as an analysis of indomethacin administration to one twin absent exogenous estradiol, are clearly necessary to elucidate the pathways and mechanisms at work. Additionally, analysis of plasma estradiol metabolites might suggest an operative pathway accounting for reduced estradiol after indomethacin. Blood flow studies and tissue estradiol concentrations may reveal the source of increased estradiol clearance capacity. Further analysis of PGHS expression directly in, or along neural pathways innervating peripheral steroidogenic tissues may provide insight into what appears to be a more complex estrogen metabolism system. In conclusion, the results of the present study suggest that under estrogen induced ontogenetic drive, PGHS-2 provides a negative regulatory influence on the HPA axis. However, it does appear that the axis is sensitized to reductions in PGHS-2 based inhibition as a result of estradiol, which is consistent with estradiol providing a positive feedback to the HPA axis. Additionally, altered adrenal cortisol output appears to continue to play a role in the 101

PAGE 102

ontogenetically stimulated HPA axis. Finally, we believe that inhibition of PGHS-1 and -2 simultaneously sets a signaling cascade in motion that modulates estrogen metabolism in a manner that results in circulating estrogen concentrations being reduced in both fetuses, though the mechanisms involved are unclear based on this study. Together, these data indicate that current models of prostaglandin-estrogen-HPA axis interactions need refinement to properly reflect the complexity of the signaling pathways. 102

PAGE 103

Table 4-1. Gene expression of hypothalamic and pituitary hormones in response to prostaglandin synthesis inhibition in the estrogen stimulated HPA axis Treatment Group Hormone Tissue Estradiol + 10g/day Nimesulide Estradiol + Indomethacin CRH Hypothalamus 1.39 0.31 1.77 0.68 AVP Hypothalamus 0.85 0.11 0.56 0.09 POMC Pituitary 1.02 0.40 0.88 0.18 oLH Pituitary 0.70 0.18 2.01 1.18 oFSH Pituitary 0.93 0.23 1.31 0.35 oPRL Pituitary 0.93 0.18 1.85 0.19 Data presented as mean fold change in gene expression relative to vehicle fetus SEM. indicates p<0.05 by paired t-test. Table 4-2. Plasma PGE2, estradiol, and estradiol-3-sulfate in estrogenized vehicle and PGHS inhibitor treated fetuses Treatment Group Hormone Estradiol + Vehicle Estradiol + 10g/day Nimesulide Estradiol + Vehicle Estradiol + Indomethacin PGE 2 pg/mL 141 27 128 28 275 59 336 41 Estradiol, pg/mL 112 19 136 14 15.8 3.99 18.3 1.97 Estradiol-3-Sulfate, ng/ml 0.16 0.09 0.18 0.09 0.15 0.05 0.17 0.02 Data presented as mean plasma hormone concentration SEM. indicates p<0.05 by paired t-test. 103

PAGE 104

Figure 4-1. Arterial pH, pCO 2 and pO 2 in estrogenized vehicle and PGHS inhibitor treated twin fetuses. A) Daily arterial pH in vehicle and LD nimesulide treated twins. B) Daily arterial pH in vehicle and indomethacin treated twins. C) Daily arterial pCO 2 in vehicle and LD nimesulide treated twins. D) Daily arterial pCO 2 in vehicle and indomethacin treated twins. E) Daily arterial pO 2 in vehicle and LD nimesulide treated twins. F) Daily arterial pO 2 in vehicle and indomethacin treated twins. In each panel, vehicle treated fetuses are represented by dashed lines with solid circles, while inhibitor treated fetuses are represented by solid lines with open circles. Within group significance is shown by letters, A, B, or C representing significance as compared to day 2, 3, or 4 respectively. Lowercase letters indicate significance v. the same timepoints, within the treated group. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 104

PAGE 105

Figure 4-2. PGHS-1 and PGHS-2 mRNA and protein expression in the estrogenized fetal brain and pituitary in response to LD nimesulide. A) PGHS-1 mRNA expression in treated twins relative to vehicle twins. B) PGHS-2 mRNA expression in treated twins relative to vehicle twins. Data are mean fold change SEM. Vehicle treated fetus mRNA levels are shown in black bars, and nimesulide treated fetus mRNA levels in gray bars. C) PGHS-1 protein expression in treated as compared to vehicle twins. D) PGHS-2 protein expression in treated as compared to vehicle twins. Data are mean SEM. Intensity of immunoreactive bands are shown in black bars for vehicle fetuses and light gray for nimesulide fetuses. When detected, 140 kDa bands are shown in dark gray bars for vehicle fetuses and open bars for nimesulide fetuses. Significant differences (p<0.05 by paired t-test) are indicated by an *. E) Representative western blot results indicating expression levels of the 140 kDa PGHS-1 band in the brainstem of estrogenized LD nimesulide and vehicle treated fetuses. 105

PAGE 106

Figure 4-3. Daily plasma POMC, ACTH, and cortisol concentrations in estrogenized fetuses in response to LD nimesulide. Data are shown as mean SEM. A) Plasma POMC concentrations. B) Plasma ACTH concentrations. C) Plasma cortisol concentrations. Vehicle treated fetuses are represented by dashed lines with solid circles, while nimesulide treated fetuses are represented by solid lines with open circles. Within vehicle group significance is shown by letters, A, B, or C representing a significant difference as compared to day 2, 3, or 4, respectively. Within nimesulide group significance is shown by letters, a, b, or c representing a significant difference as compared to day 2, 3, or 4, respectively. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 106

PAGE 107

Figure 4-4. PGHS-1 and PGHS-2 mRNA and protein expression in the estrogenized fetal brain and pituitary in response to indomethacin. A) PGHS-1 mRNA expression in treated twins relative to vehicle twins. B) PGHS-2 mRNA expression in treated twins relative to vehicle twins. Data are mean fold change SEM. Vehicle treated fetus mRNA levels are shown in black bars, and indomethacin treated fetus mRNA levels in gray bars. C) PGHS-1 protein expression in treated as compared to vehicle twins. D) PGHS-2 protein expression in treated as compared to vehicle twins. Data are mean SEM. Intensity of immunoreactive bands are shown in black bars for vehicle fetuses and light gray for indomethacin fetuses. When detected, 140 kDa bands are shown in dark gray bars for vehicle fetuses and open bars for nimesulide fetuses. Significant differences (p<0.05 by paired t-test) are indicated by an *. E) Representative western blot results indicating expression levels of the 140 kDa PGHS-1 band the cerebellum of indomethacin and vehicle treated fetuses. F) Representative western blot results indicating expression levels of the 72 kDa PGHS-2 band in the cortex of indomethacin and vehicle treated fetuses. 107

PAGE 108

Figure 4-5. Daily plasma POMC, ACTH, and cortisol concentrations in estrogenized fetuses in response to indomethacin. Data are shown as mean SEM. A) Plasma POMC concentrations. B) Plasma ACTH concentrations. C) Plasma cortisol concentrations. Vehicle treated fetuses are represented by dashed lines with solid circles, while indomethacin treated fetuses are represented by solid lines with open circles. Within vehicle group significance is shown by letters, A, B, or C representing a significant difference as compared to day 2, 3, or 4, respectively. Within indomethacin group significance is shown by letters, a, b, or c representing a significant difference as compared to day 2, 3, or 4, respectively. Between group significance is shown by an *. Significance based on p<0.05 by 2-way RM ANOVA. 108

PAGE 109

CHAPTER 5 C ONCLUSIONS The initiation of parturition has been studied in great detail and major advances have been made, both in understanding the mechanisms in a laboratory setting, as well as providing clinical treatment for premature labor. Despite all that has been learned, preterm birth remains a major source of neonatal morbidity and mortality (146). It is clear, due both to the continuing impacts of prematurity and the results of the present study, that much remains to be learned regarding the mechanisms and physiology of labor. The fetal HPA axis has long been thought to have significant hormonal interactions with the placenta and function as a primary regulator of the timing of parturition. Experimental results indicated that the fetal HPA axis must be intact for normal parturition to occur (3; 114). HPA axis activity increases dramatically just prior to parturition, with the prevailing theory suggesting that fetal HPA axis activity induces placental cytochrome P450 C-17 (68; 193), resulting in increased estrogen production close to term (68; 193), which subsequently feeds back to further stimulate the axis. (See Figure 1-2). Many studies show a modulatory effect of estrogens on activity of the fetal HPA axis (160; 176; 231). Evidence also indicates that prostaglandins might modulate activity of the HPA axis (45-47; 204; 207) and that expression of prostaglandin synthase enzymes is altered upon stimulation of the HPA axis (202; 205; 231). The present study was designed to further these results and assess the ontogenetic expression profile of the key prostaglandin synthase enzymes PGHS-1 and -2 across gestation in brain regions known to be associated with the HPA axis. After determining the ontogeny of PGHS-1 and-2, the present study assessed the role of PGHS-1 and -2 function in modulating the basal activity of the HPA axis, the low level of activity expected prior to the spontaneous ontogenetic spike in activity just prior to delivery. Building on the results of PGHS function in the basal 109

PAGE 110

HPA axis, we attempted to experimentally recreate the ontogenetic drive on the axis by administering exogenous estradiol and simultaneously evaluate the effects of PGHS inhibition. The results of the present study indicate that the prevailing model of late gestation ovine fetal HPA axis function is not sufficient to describe the true complexities of HPA axis when accounting for its modulation by prostaglandins and estrogen. The first phase of the study was directed towards determining the ontogenetic expression profile of PGHS-1 and -2 in brain regions associated with the HPA axis. Overall, we determined that PGHS-1 and -2 mRNA and protein were widely and varyingly expressed across gestation. Several tissues demonstrated expression peaks at 120 DGA, suggesting that prostaglandin synthesis may be involved in autocrine or paracrine modulators of synaptogenesis or neuronal development (69). Both hippocampal PGHS-2 mRNA and hypothalamic PGHS-2 protein were significantly upregulated at 145 DGA, which was seen as promising evidence that PGHS-2 was the primary isoform driving late gestation HPA axis activity. In light of our later results however, it is somewhat unclear what these results indicate. Our findings in Chapters 3 and 4 led to us to conclude that PGHS-2 activity negatively influences the HPA axis. Though the increased PGHS-2 expression detected at 145 DGA (Chapter 2) suggest that the axis would be inhibited, it must be kept in mind that this was designed as an expression study only and we do not have information on the hormonal milieu in these animals. It is possible that the amount of PGHS-2 detected, while significantly greater than expression at 80 DGA, is not sufficient to inhibit activation of the HPA axis or may provide only partial inhibition that prevents unchecked HPA axis activity. The discordance between mRNA and protein expression trends indicates independent transcriptional, translational, and post-translational modifications making conclusive correlations about the expression levels and axis 110

PAGE 111

activity difficult absent supporting hormone data. In future ontogenetic expression studies it would be valuable to collect plasma in order to correlate relevant hormones with gene and protein expression. Nevertheless, the initial goals of this portion of the study were accomplished and these results enabled us to proceed to the next phase of the study with confidence that PGHS-1 and -2 were likely to be involved in fetal HPA axis signaling. We believe that there are three modes of HPA axis operation, 1) acute stimulation, 2) basal stimulation, and 3) ontogenetic stimulation. Acute stimulation is the focus of other studies by members of our laboratory, so the second portion of this study focused on determining the roles of PGHS-1 and -2 in the late gestation HPA axis that was under no specific, i.e. basal, stimulation. We demonstrated that administration of HD nimesulide altered gene and protein expression, but more interestingly, induced an increase in circulating estradiol. In contrast, a lower dose of nimesulide did not affect gene expression, but clearly revealed alterations in adrenal cortisol output. We also interpreted the limited changes after administration of resveratrol as an indication that PGHS-1 does not substantially affect the basal HPA axis. We therefore concluded that PGHS-2 is the primary prostaglandin synthase regulating the HPA axis, and that it does so via an inhibitory influence. We initiated these experiments with the hypothesis that PGHS-2 was the primary modulator of HPA axis activity, based largely on our own prior work involving acute stimulation of the HPA axis (202; 206) and the generally increasing PGHS-2 expression patterns detected in the ontogeny study. The effects of nimesulide on PGHS-2 activity as well as gene expression had been reported in other experimental systems (64; 92). However, we expected inhibition of PGHS-2 to decrease axis activity, which initially correct, in light of unchanged ACTH and cortisol concentrations after HD nimesulide. However, the increased estradiol suggested that the 111

PAGE 112

axis was activated on some level. Confirming that notion, the LD nimesulide experiment demonstrated that adrenal cortisol output was altered, as cortisol levels were increased without changes in ACTH. A likely mechanism is via prostaglandin mediated modulation of sympathetic innervation. Further experiments directed to defining the types of neurons that PGHS-2 is associated with in the central nervous system would help to further understand the increased adrenal cortisol output. In the meantime, another study in our laboratory also revealed that acute inhibition of PGHS-2 had stimulatory effects on the axis, represented by increased ACTH after nimesulide. Together with the absence of significant responses to resveratrol, it became more probable that PGHS-2 serves as a primary negative regulator of the basal HPA axis. With this in mind, we set out to mimic the late gestation ontogenetic drive on the HPA axis by administration of estradiol to both twins and subsequently determine if prostaglandin synthesis also played a role in the ontogenetically stimulated axis. Interestingly, estradiol administration added an unexpected layer of complexity to the HPA axis regulatory scheme. LD nimesulide treatment in conjunction with estradiol yielded results similar in some aspects to results seen after either HD or LD nimesulide alone. It appears that, consistent with the notion that estrogen stimulates the HPA axis, estradiol administration prepared the HPA axis for release of PGHS-2 based inhibition. In other words, estradiol appears to allow HPA axis activation more readily, not by direct stimulation, but by a removal of an inhibitory regulator. This is supported by unchanged hippocampal PGHS-2 which is accompanied by increased estradiol and cortisol, i.e. axis activation. Despite the apparent stimulatory effect of estradiol on the HPA axis, there was still substantial evidence that increases in adrenal cortisol output due to non-ACTH mediated mechanisms were largely responsible for the increased plasma cortisol concentrations in 112

PAGE 113

response to LD nimesulide and indomethacin. In contrast to the results of Chapter 3, it appears that POMC or its metabolites may be playing an inhibitory role at the adrenal, thereby allowing sympathetic innervation to control cortisol levels absent significant ACTH changes. Further study into the processing of POMC in the estrogenized fetus, for example, evaluation of prohormone convertase 1 and 2 expression and activity, plasma assays for POMC metabolites, and binding analysis of POMC metabolites at the MC2R would help to determine if a POMC based mechanism is involved in altered adrenal cortisol output. Finally, indomethacin administration yielded dramatic results on estradiol metabolism. We expected the plasma estradiol levels in vehicle fetuses of both groups to be similar, however, both treated and vehicle fetuses in the indomethacin group had substantially lower plasma estradiol than expected. These data are distinct from the other groups with significant changes in estradiol, where only the treated fetus was affected. While similar mechanisms are likely involved, such as increased clearance or increased metabolism of estradiol to other estrogenic steroids, indomethacin administration to the brain of one fetus somehow affected a central location that yielded effects in both twins. Though precluded from doing so by the close of the ovine breeding season, a key experiment that has already begun to further understand these experimental results is to administer indomethacin alone to one of two twins, absent exogenous estradiol. This would help to determine what the role is for PGHS-1 in the basal state, and give a valuable point of comparison for the effects of estradiol. In light of the results of these studies, we have proposed several modifications to the signaling pathways involved in the basal and ontogenetically stimulated fetal HPA axis. Figure 5-1 represents the basally stimulated axis, which is primarily under the inhibitory control of hippocampal PGHS-2. Traditional hormonal flow through the system is present, but reduced 113

PAGE 114

(gray print), while splanchnic innervation of the adrenal is promoted to the primary mode of cortisol release (bold print). However, PGHS-2 expressed in the brain imparts a tonic negative influence on splanchnic activation. Inhibition of brain PGHS-2 appears to reduce the inhibition on the splanchnic nerve and allow production of cortisol without the traditional preceding increase in ACTH. PGHS-2 inhibition in the brain, as shown in our HD nimesulide results, initiates a mechanism that changes estrogen processing in the fetus. Reduction of the amount or efficiency of estradiol clearance, likely through a large clearance bed such as the fetal liver, is a possible mechanism. Additionally, alterations in metabolic conversion of estradiol to other estrogenic steroids, such as estrone, are possible. Such a metabolic conversion reaction could occur within the brain (gray oval) or in peripheral metabolic tissues. This model reflects one interpretation of our data, which suggests that inhibition of brain PGHS-2 in the basal state can have effects on peripheral tissues and metabolic processes, and thus necessarily involves either nervous or endocrine signaling pathways that reach distant (non-brain) tissues. Figure 5-2 is another model that is meant to reflect the possible signaling pathways involved in the ontogenetically stimulated axis. Our data suggest that PGHS-2 and PGHS-1 operate quasi-independently of one another, in that PGHS-2 seems to regulate activity moving through the axis, while PGHS-1 seems to regulate those modulators that affect the feedback effects of the axis. As shown in the basal signaling model (Figure 5-1), PGHS-2 again appears to be involved in the splanchnic regulation of adrenal cortisol output, though POMC appears to play a potential inhibitory role in the stimulation of the adrenal by ACTH. Our data do not appear to indicate a substantial hippocampal PGHS-2 based inhibition on the axis in the presence of exogenous estradiol. The presence of brain PGHS-1 along the feedback pathway for placental-derived and the stimulatory pathway of exogenous estradiol reflect the possibility that 114

PAGE 115

PGHS-1 activity promotes estrogen priming of the HPA axis. Again, similar to the basal state model in Figure 5-1, the mechanisms involved appear to be either endocrine or neural in nature, as the inhibition of PGHS-1 occurred in the brain, but the effects appear to be related to peripheral tissues. Inhibition of PGHS-1 and -2 together reduces the supporting effects of PGHS-1 on estradiol concentrations and causes increases in estradiol clearance and/or decreases in synthesis, likely occurring in major shared (between twins) clearance beds such as the uterus or placenta, as both twins are simultaneously affected. While these models are based largely on the prevailing models of ovine fetal HPA axis activity and regulation as they existed prior to these studies, the present results indicate additional complexities that were not represented in previous models. The results of this dissertation conclusively show that PGHS-1 and -2 are expressed in all brain regions analyzed, at nearly all gestational ages available. We also demonstrated that, as in acute settings, PGHS-2 inhibits the activity of the HPA axis, though not completely as both basal and ontogenetic stimulation appear to continue to drive portions of the axis, namely by increased adrenal cortisol output. Finally, PGHS-1 and -2 appear to have different functions, a stimulator and brake, respectively, and thus may independently operate on stimulatory and feedback pathways of the axis. PGHS-2 appears to regulate tonic inhibitory mechanisms while PGHS-1, at least in the estrogen derived ontogenetic stimulated state, appears to be a primary modulator of estrogen clearance and metabolism. Thus, the present experiments strongly indicate that prostaglandin synthesis does modulate HPA axis activity, though in a mechanistically unique fashion depending on the hormonal context. Testing the validity of these models could be done in a variety of experiments in the future, some simply requiring varied experimental parameters with the same basic experimental setup as 115

PAGE 116

used in the present study, while others would require more advanced preparation of reagents or methodology optimization. A simple first approach to further elucidate the roles of the two isoforms of PGHS would be to perform another twin experiment where indomethacin is administered to twins in the absence of exogenous estradiol. This would help determine if PGHS-1 was truly uninvolved in the function of the basal HPA axis, as our data suggested, or if the simultaneous inhibition of PGHS-1 and -2 would have similar effects on variables like estrogen metabolism. Another simple experiment, given the structure of the osmotic mini-pumps used, would be to extend the experimental time course and carry the experiments through delivery, and determine if the inhibition of one of the PGHS isoforms had a more profound effect on the timing of delivery. Key studies related to the estrogen clearance effects seen in the present study could be performed by instrumentation of fetuses in order to measure blood flow through clearance tissues, like the liver or placenta. Use of microspheres or radiolabeled tracers could help determine if inhibition of prostaglandin synthesis in the brain altered peripheral clearance bed blood flow. The counterpart study, as mentioned above, would be to measure expression of the key metabolic enzymes involved in the production or degradation of estradiol. Another interesting experiment to help test the proposed models would be an experimental setup which allowed direct stimulation of the splanchnic nerve. According to prior studies (61), stimulation of the splanchnic nerve should greatly augment the adrenal response to ACTH. In light of this, the results of direct stimulation in the presence and absence of PGHS inhibition would help determine if the splanchnic nerve was the actual sympathetic nervous input responsible for the increased cortisol we detected. An informative experiment would be to simultaneously inhibit PGHS-2 and stimulate the splanchnic nerve in the presence and absence 116

PAGE 117

of a specific MC2R antagonist. Such an experiment would further indicate the exact role of that neural input in adrenal stimulation. As a companion to this study, retrograde fluorescent tracers could be injected into the adrenal. After appropriate time for retrograde travel, immunohistochemistry on the spinal ganglia and HPA axis associated brain regions could be performed to co-localize PGHS-1 or -2 with the neurons innervating the adrenal. Different delivery techniques could also be performed. Using the current pharmacologic inhibitors, a more direct delivery to specific nuclei of the hypothalamus might help elucidate the site of action of nimesulide or resveratrol. Stereotactic surgery could be performed to deliver the inhibitors directly to the PVN, or regions of the hippocampus, indicating the level of the HPA axis which is most critical in controlling signaling or feedback. Additionally, more biologically advanced delivery techniques of inhibitors or stimulators could be employed. For example, siRNA specific for either PGHS-1 or PGHS-2 could be delivered to the brain via mini-pump or stereotactic microinjection. The highly specific downregulation of either isoform would help to confirm or refute the results of the present study. Moving this concept further, viral mediated delivery of the genes encoding either PGHS-1 or -2 would allow overexpression of one isoform. If a tissue specific promoter were used as well as an indicator gene, such as beta-galactosidase, the site of overexpression could be confirmed. If, for example, PGHS-2 were overexpressed and the proposed models are accurate, one would expect that the HPA axis would be inactive, perhaps even during the very final stages of gestation. Conversely, should PGHS-1 be overexpressed, one would expect quite significant alterations in estrogen metabolism. Further extension of this idea could lead to development of large animal knock-in or knock out studies. In that situation, complete absence of expression of either PGHS-1 or -2 would further the knowledge of the role of each in regulation of the late gestation ovine fetal HPA axis. 117

PAGE 118

Figure 5-1. Proposed model of prostaglandin synthesis regulation of basal HPA axis activity See text for summary. PVN= paraventricular nucleus of the hypothalamus; CRH= corticotrophin releasing hormone; AVP= arginine vasopressin; ACTH = adrenocorticotrophic stimulating hormone. 118

PAGE 119

Figure 5-2. Proposed model of prostaglandin synthesis regulation of ontogenetically stimulated HPA axis activity. See text for summary. PVN= paraventricular nucleus of the hypothalamus; CRH= corticotrophin releasing hormone; AVP= arginine vasopressin; ACTH = adrenocorticotrophic stimulating hormone; POMC = proopiomelanocortin 119

PAGE 120

REFERENCE LIST 1. Anderson AB, Flint AP and Turnbull AC. Mechanism of action of glucocorticoids in induction of ovine parturition: effect on placental steroid metabolism. J Endocrinol 66: 61-70, 1975. 2. Andresen MC, Doyle MW, Jin YH and Bailey TW. Cellular mechanisms of baroreceptor integration at the nucleus tractus solitarius. Ann N Y Acad Sci 940: 132-141, 2001. 3. Antolovich GC, Clarke IJ, McMillen IC, Perry RA, Robinson PM, Silver M and Young R. Hypothalamo-pituitary disconnection in the fetal sheep. Neuroendocrinology 51: 1-9, 1990. 4. Arosh JA, Parent J, Chapdelaine P, Sirois J and Fortier MA. Expression of cyclooxygenases 1 and 2 and prostaglandin E synthase in bovine endometrial tissue during the estrous cycle. Biol Reprod 67: 161-169, 2002. 5. Bailey TW and Dimicco JA. Chemical stimulation of the dorsomedial hypothalamus elevates plasma ACTH in conscious rats. Am J Physiol Regul Integr Comp Physiol 280: R8-15, 2001. 6. Bailit JL and Votruba ME. Medical cost savings associated with 17 alpha-hydroxyprogesterone caproate. Am J Obstet Gynecol 196: 219-7, 2007. 7. Baliki MN, Katz J, Chialvo DR and Apkarian AV. Single subject pharmacological-MRI (phMRI) study:Modulation of brain activity of psoriatic arthritis pain by cyclooxygenase-2 inhibitor. Mol Pain 1: 32, 2005. 8. Bamberger CM, Schulte HM and Chrousos GP. Molecular determinants of glucocorticoid receptor function and tissue sensitivity to glucocorticoids. Endocr Rev 17: 245-261, 1996. 9. Bedford CA, Challis JRG, Harrison FA and Heap RB. The role of oestrogens and progesterone in the onset of parturition in several species. J Reprod Fert Suppl 16: 1-23, 1972. 120

PAGE 121

10. Bhattacharya M, Peri KG, Almazan G, Ribeiro-Da-Silva A, Shichi H, Durocher Y, Abramovitz M, Hou X, Varma DR and Chemtob S. Nuclear localization of prostaglandin E2 receptors. Proc Natl Acad Sci U S A 95: 15792-15797, 1998. 11. Binns W, James LF, Shupe JL and Everett G. A congenital cyclopian-type malformation in lambs induced by maternal ingestion of a range plant, Veratrum californicum. Am J Vet Res 24: 1164-1175, 1963. 12. Binns W, Shupe JL, Keeler RF and James LF. Chronologic evaluation of teratogenicity in sheep fed Veratrum californicum. J Am Vet Med Assoc 147: 839-842, 1991. 13. Boddy K, Jones CT, Mantell C, Ratcliffe JG and Robinson JS. Changes in plasma ACTH and corticosteroid of the maternal and fetal sheep during hypoxia. Endocrinology 94: 588-591, 1974. 14. Brannon TS, MacRitchie AN, Jaramillo MA, Sherman TS, Yuhanna IS, Margraf LR and Shaul PW. Ontogeny of cyclooxygenase-1 and cyclooxygenase-2 gene expression in ovine lung. Am J Physiol 274: L66-L71, 1998. 15. Breder CD, DeWitt DL and Kraig RP. Characterization of inducible cyclooxygenase in rat brain. J Comp Neurol 355: 296-315, 1995. 16. Breder CD, Smith WL, Raz A, Masferrer J, Seibert K, Needleman P and Saper CB. Distribution and characterization of cyclooxygenase immunoreactivity in the ovine brain. J Comp Neurol 322: 409-438, 1992. 17. Brooks AN and White A. Activation of pituitary-adrenal function in fetal sheep by corticotrophin-releasing factor and arginine vasopressin. J Endocr 124: 27-35, 1990. 18. Bugajski J, Gadek-Michalska A, Glod R and Bugajski AJ. Effect of social stress on COX-1 and COX-2-induced alterations in the adrenergic agonists-evoked hypothalamic-pituitary-adrenal responses. J Physiol Pharmacol 52: 811-822, 2001. 19. Bugajski J, Glod R, Gadek-Michalska A and Bugajski AJ. Involvement of constitutive (COX-1) and inducible cyclooxygenase (COX-2) in the adrenergic-induced ACTH and corticosterone secretion. J Physiol Pharmacol 52: 795-809, 2001. 121

PAGE 122

20. Bulun SE, Zeitoun KM, Takayama K and Sasano H. Estrogen biosynthesis in endometriosis: molecular basis and clinical relevance. J Mol Endocrinol 25: 35-42, 2000. 21. Burnstein KL and Cidlowski JA. Regulation of gene expression by glucocorticoids. Annu Rev Physiol 51: 683-699, 1989. 22. Calhoun DA, Chegini N, Polliotti BM, Gersting JA, Miller RK and Christensen RD. Granulocyte colony-stimulating factor in preterm and term pregnancy, parturition, and intra-amniotic infection. Obstet Gynecol 97: 229-234, 2001. 23. Calhoun DA and Christensen RD. A randomized pilot trial of administration of granulocyte colony-stimulating factor to women before preterm delivery. Am J Obstet Gynecol 179: 766-771, 1998. 24. Candelario-Jalil E, Gonzalez-Falcon A, Garcia-Cabrera M, Alvarez D, Al-Dalain S, Martinez G, Leon OS and Springer JE. Assessment of the relative contribution of COX-1 and COX-2 isoforms to ischemia-induced oxidative damage and neurodegeneration following transient global cerebral ischemia. J Neurochem 86: 545-555, 2003. 25. Carey LC, Su Y, Valego NK and Rose JC. Infusion of ACTH stimulates expression of adrenal ACTH receptor and steroidogenic acute regulatory protein mRNA in fetal sheep. Am J Physiol Endocrinol Metab 291: E214-E220, 2006. 26. Carey MP, Deterd CH, deKonig J, Helmerhost F and DeKloet ER. The influence of ovarian steroids on hypothalamic-pituitary-adrenal regulation in the female rat. J Endocrinol 144: 311-321, 1995. 27. Carter AM, Petersen YM, Towstoless M, Andreasen D and Jensen BL. Adrenocorticotrophic hormone (ACTH) stimulation of sheep fetal adrenal cortex can occur without increased expression of ACTH receptor (ACTH-R) mRNA. Reprod Fertil Dev 14: 1-6, 2002. 28. Cato AC and Wade E. Molecular mechanisms of anti-inflammatory action of glucocorticoids. Bioessays 18: 371-378, 1996. 29. Challis JR, Sloboda DM, Alfaidy N, Lye SJ, Gibb W, Patel FA, Whittle WL and Newnham JP. Prostaglandins and mechanisms of preterm birth. Reproduction 124: 1-17, 2002. 122

PAGE 123

30. Challis JR and Smith SK. Fetal endocrine signals and preterm labor. Biol Neonate 79: 163-167, 2001. 31. Challis JRG and Brooks AN. Maturation and activation of hypothalamic-pituitary-adrenal function in fetal sheep. Endocrine Reviews 10: 182-204, 1989. 32. Challis JRG and Lye SJ. Parturition. In: The Physiology of Reproduction, edited by Knobil E and Neill J. New York: Raven Press, 1994, p. 985-1031. 33. Challis JRG, Matthews SG, Gibb W and Lye SJ. Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev 21: 514-550, 2000. 34. Chan BS, Satriano JA, Pucci M and Schuster VL. Mechanism of prostaglandin E2 transport across the plasma membrane of HeLa cells and Xenopus oocytes expressing the prostaglandin transporter "PGT". J Biol Chem 273: 6689-6697, 1998. 35. Charlton BG. Adrenal cortical innervation and glucocorticoid secretion. J Endocrinol 126: 5-8, 1990. 36. Chen C and Bazan NG. Endogenous PGE2 regulates membrane excitability and synaptic transmission in hippocampal CA1 pyramidal neurons. J Neurophysiol 93: 929-941, 2005. 37. Chen C, Magee JC and Bazan NG. Cyclooxygenase-2 regulates prostaglandin E2 signaling in hippocampal long-term synaptic plasticity. J Neurophysiol 87: 2851-2857, 2002. 38. Chodobski A, Szmydynger-Chodobska J and McKinley MJ. Cerebrospinal fluid formation and absorption in dehydrated sheep. Am J Physiol 275: F235-F238, 1998. 39. Cover PO, Slater D and Buckingham JC. Expression of cyclooxygenase enzymes in rat hypothalamo-pituitary-adrenal axis: effects of endotoxin and glucocorticoids. Endocrine 16: 123-131, 2001. 40. Coyne MD and Kitay JI. Effects of ovariectomy on pituitary secretion of ACTH. Endocrinology 85: 1097-1102, 1969. 123

PAGE 124

41. Cudd TA. Animal model systems for the study of alcohol teratology. Exp Biol Med (Maywood ) 230: 389-393, 2005. 42. Cudd TA, Purinton S, Patel NC and Wood CE. Cardiovascular, adrenocorticotropin, and cortisol responses to hypertonic saline in euvolemic sheep are altered by prostaglandin synthase inhibition. Shock 10: 32-36, 1998. 43. Cudd TA, Purinton S, Patel NC and Wood CE. Cardiovascular, adrenocorticotropin, and cortisol responses to hypertonic saline in euvolemic sheep are altered by prostaglandin synthase inhibition. Shock 10: 32-36, 1998. 44. Cudd TA and Wood CE. Prostanoid cascade inhibition prevents cardiovascular and adrenocorticotropic responses to mineral acid infusion. Am J Physiol 264: R1235-R1241, 1993. 45. Cudd TA and Wood CE. Thromboxane A2 receptor antagonism prevents hormonal and cardiovascular responses to mineral acid infusion. Am J Physiol 267: R1235-R1240, 1994. 46. Cudd TA and Wood CE. Prostaglandin E2 releases ovine fetal ACTH from a site not perfused by the carotid vasculature. Am J Physiol 263: R136-R140, 1992. 47. Cudd TA and Wood CE. Does intracarotid PGE2 increase plasma ACTH concentration in conscious adult ewes? Am J Physiol 261: E395-E401, 1991. 48. Currie IS and Brooks AN. Corticotrophin-releasing factors in the hypothalamus of the developing fetal sheep. J Dev Physiol 17: 241-246, 1992. 49. Currie IS and Brooks AN. Corticotrophin-releasing factors in the hypothalamus of the developing fetal sheep. J Dev Physiol 17: 241-246, 1992. 50. Dammann O, Leviton A, Gappa M and Dammann CE. Lung and brain damage in preterm newborns, and their association with gestational age, prematurity subgroup, infection/inflammation and long term outcome. BJOG 112 Suppl 1: 4-9, 2005. 51. Davidge ST. Prostaglandin H synthase and vascular function. Circ Res 89: 650-660, 2001. 124

PAGE 125

52. De L, V, la MA, Talluri B, D'Antona D and Morgante G. Hypothalamo-pituitary-adrenal axis and adrenal function before and after ovariectomy in premenopausal women. Eur J Endocrinol 138: 430-435, 1998. 53. Deauseault D, Giroux D and Wood CE. Ontogeny of immunoreactive prostaglandin endoperoxide synthase isoforms in ovine fetal pituitary, hypothalamus and brainstem. Neuroendocrinology 71: 287-291, 2000. 54. Deauseault, D. and Wood, C. E. Ontogeny of immunoreactive prostaglandin endoperoxide synthase-1 and -2 in ovine fetal and postnatal brainstem, hypothalamus, and pituitary. J.Soc.Gynecol.Investig. 5(supplement), 154A. 1998. Ref Type: Abstract 55. Deayton JM, Young IR, Hollingworth SA, White A, Crosby SR and Thorburn GD. Effect of late hypothalamo-pituitary disconnection on the development of the HPA axis in the ovine fetus and the initiation of parturition. J Neuroendocrinol 6: 25-31, 1994. 56. Deayton JM, Young IR and Thorburn GD. Early hypophysectomy of sheep fetuses: effects on growth, placental steroidogenesis and prostaglandin production. J Reprod Fertil 97: 513-520, 1993. 57. Dempsher DP and Gann DS. Increased cortisol secretion after small hemorrhage is not attributable to changes in adrenocorticotropin. Endocrinology 113: 86-93, 1983. 58. DeWitt DL and Meade EA. Serum and glucocorticoid regulation of gene transcription and expression of the prostaglandin H synthase-1 and prostaglandin H synthase-2 isoenzymes. Arch Biochem Biophys 306: 94-102, 1993. 59. DeWitt DL and Smith WL. Primary structure of prostaglandin G\H synthase from sheep vesicular gland determined from the complementary DNA sequence. Proc Nat Acad Sci 85: 1412-1416, 1988. 60. Drost M and Holm LM. Prolonged gestation in ewes after foetal adrenalectomy. J Endocr 40: 293-296, 1968. 61. Edwards AV and Jones CT. The effect of splanchnic nerve section on the sensitivity of the adrenal cortex to adrenocorticotrophin in the calf. J Physiol 390: 23-31, 1987. 125

PAGE 126

62. Edwards AV and Jones CT. Autonomic control of adrenal function. J Anat 183 ( Pt 2): 291-307, 1993. 63. Engeland WC, Byrnes GJ, Presnell K and Gann DS. Adrenocortical sensitivity to adrenocorticotropin (ACTH) in awake dogs changes as a function of the time of observation and after hemorrhage independently of changes in ACTH. Endocrinology 108: 2149-2153, 1981. 64. Fahmi H, He Y, Zhang M, Martel-Pelletier J, Pelletier JP and Di Battista JA. Nimesulide reduces interleukin-1beta-induced cyclooxygenase-2 gene expression in human synovial fibroblasts. Osteoarthritis Cartilage 9: 332-340, 2001. 65. Feldman S and Weidenfeld J. Glucocorticoid receptor antagonists in the hippocampus modify the negative feedback following neural stimuli. Brain Res 821: 33-37, 1999. 66. Feng L, Sun W, Xia Y, Tang WW, Chanmugam P, Soyoola E, Wilson CB and Hwang D. Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression. Arch Biochem Biophys 307: 361-368, 1993. 67. Fionda C, Nappi F, Piccoli M, Frati L, Santoni A and Cippitelli M. Inhibition of trail gene expression by cyclopentenonic prostaglandin 15-deoxy-delta12,14-prostaglandin J2 in T lymphocytes. Mol Pharmacol 72: 1246-1257, 2007. 68. France JT, Magness RR, Murry BA, Rosenfeld CR and Mason JI. The regulation of ovine placental steroid 17 alpha-hydroxylase and aromatase by glucocorticoid. Mol Endocrinol 2: 193-199, 1988. 69. Geddis MS, Tornieri K, Giesecke A and Rehder V. PLA2 and secondary metabolites of arachidonic acid control filopodial behavior in neuronal growth cones. Cell Motil Cytoskeleton 57: 53-67, 2004. 70. Genazzani AR, LeMarchand-Beraud T, Aubert ML and Felber JP. Pattern of plasma ACTH, hGH, and cortisol during menstrual cycle. J Clin Endocrinol Metab 41: 431-437, 1975. 71. Giannoulias D, Patel FA, Holloway AC, Lye SJ, Tai HH and Challis JR. Differential changes in 15-hydroxyprostaglandin dehydrogenase and prostaglandin H synthase (types I and II) in human pregnant myometrium. J Clin Endocrinol Metab 87: 1345-1352, 2002. 126

PAGE 127

72. Gibb W, Sun M, Gyomorey S, Lye SJ and Challis JR. Localization of prostaglandin synthase type-1 (PGHS-1) mRNA and prostaglandin synthase type-2 (PGHS-2) mRNA in ovine myometrium and endometrium throughout gestation. J Endocrinol 165: 51-58, 2000. 73. Gibson LL, Hahner L, Osborne-Lawrence S, German Z, Wu KK, Chambliss KL and Shaul PW. Molecular basis of estrogen-induced cyclooxygenase type 1 upregulation in endothelial cells. Circ Res 96: 518-525, 2005. 74. Giussani DA, McGarrigle HH, Moore PJ, Bennet L, Spencer JA and Hanson MA. Carotid sinus nerve section and the increase in plasma cortisol during acute hypoxia in fetal sheep. J Physiol Lond 477: 75-80, 1994. 75. Gluckman PD, Mallard C and Boshier DP. The effect of hypothalamic lesions on the length of gestation in fetal sheep. Am J Obstet Gynecol 165: 1464-1468, 1991. 76. Greenwoo PL, Hunt AS, Slepetis RM, Finnerty KD, Alston C, Beermann DH and Bell AW. Effects of birth weight and postnatal nutrition on neonatal sheep: III. Regulation of energy metabolism. J Anim Sci 80: 2850-2861, 2002. 77. Gyomorey S, Gupta S, Lye SJ, Gibb W, Labrie F and Challis JR. Temporal expression of prostaglandin H synthase type 2 (PGHS-2) and P450(C17)in ovine placentomes with the natural onset of labour. Placenta 21: 478-486, 2000. 78. Halliday HL, Ehrenkranz RA and Doyle LW. Moderately early (7-14 days) postnatal corticosteroids for preventing chronic lung disease in preterm infants. Cochrane Database Syst Rev CD001144, 2003. 79. Halliday HL, Ehrenkranz RA and Doyle LW. Delayed (>3 weeks) postnatal corticosteroids for chronic lung disease in preterm infants. Cochrane Database Syst Rev CD001145, 2003. 80. Halliday HL, Ehrenkranz RA and Doyle LW. Early postnatal (<96 hours) corticosteroids for preventing chronic lung disease in preterm infants. Cochrane Database Syst Rev CD001146, 2003. 81. Hara S, Miyata A, Yokoyama C, Inoue H, Brugger R, Lottspeich F, Ullrich V and Tanabe T. Isolation and molecular cloning of prostacyclin synthase from bovine endothelial cells. J Biol Chem 269: 19897-19903, 1994. 127

PAGE 128

82. Hennessy DP, Coghlan JP, Hardy KJ, Scoggins BA and Wintour EM. The origin of cortisol in the blood of fetal sheep. J Endocrinol 95: 71-79, 1982. 83. Hinson JP. Paracrine control of adrenocortical function: a new role for the medulla? J Endocrinol 124: 7-9, 1990. 84. Hoffman GE, McDonald T, Shedwick R and Nathanielsz PW. Activation of cFos in ovine fetal corticotropin-releasing hormone neurons at the time of parturition. Endocrinology 129: 3227-3233, 1991. 85. Holzwarth MA, Cunningham LA and Kleitman N. The role of adrenal nerves in the regulation of adrenocortical functions. Ann N Y Acad Sci 512: 449-464, 1987. 86. Jacobs RA, Young IR, Hollingworth SA and Thorburn GD. Chronic administration of low doses of adrenocorticotropin to hypophysectomized fetal sheep leads to normal term labor. Endocrinology 134: 1389-1394, 1994. 87. Jaffe RB. Endocrine physiology of the fetus and fetoplacental unit. In: Reproductive endocrinology: Physiology, pathophysiology and clinical management, edited by Yen SSC and Jaffe RB. Philadelphia: W.B. Saunders, 1986, p. 737-757. 88. Jaffe RB. Role of the human fetal adrenal gland in the initiation of parturition. Front Horm Res 27: 75-85, 2001. 89. Jaffe RB, Seron-Ferre M, Crickard K, Koritnik D, Mitchell BF and Huhtaniemi IT. Regulation and function of the primate fetal adrenal gland and gonad. Rec Prog Horm Res 37: 41-97, 1981. 90. Jakobsson PJ, Thoren S, Morgenstern R and Samuelsson B. Identification of human prostaglandin E synthase: a microsomal, glutathione-dependent, inducible enzyme, constituting a potential novel drug target. Proc Natl Acad Sci U S A 96: 7220-7225, 1999. 91. Jensen E, Wood CE and Keller-Wood M. Chronic alterations in ovine maternal corticosteroid levels influence uterine blood flow and placental and fetal growth. Am J Physiol Regul Integr Comp Physiol 288: R54-R61, 2005. 92. Kalajdzic T, Faour WH, He QW, Fahmi H, Martel-Pelletier J, Pelletier JP and Di Battista JA. Nimesulide, a preferential cyclooxygenase 2 inhibitor, suppresses peroxisome proliferator-activated receptor induction of cyclooxygenase 2 gene 128

PAGE 129

expression in human synovial fibroblasts: evidence for receptor antagonism. Arthritis Rheum 46: 494-506, 2002. 93. Kaneko M and Hiroshige T. Fast, rate-sensitive corticosteroid negative feedback during stress. Am J Physiol 254: R39-R45, 1978. 94. Keller WM. Inhibition of stimulated and basal ACTH by cortisol during ovine pregnancy. Am J Physiol 271: R130-R136, 1996. 95. Keller-Wood M. Effects of a simulated estrous cycle on sodium, volume, ACTH, and AVP in sheep. Domest Anim Endocrinol 18: 31-40, 2000. 96. Keller-Wood M and Dallman MF. Corticosteroid inhibition of ACTH secretion. Endocrine Reviews 5: 1-22, 1984. 97. Keller-Wood M, Powers MJ and Gersting JAANWCE. A Genomic Analysis of the Neuroendocrine Development of the Fetal Brain-Pituitary-Adrenal Axis in Late Gestation. Physiological Genomics In press: 2005. 98. Keller-Wood M and Wood CE. Corticotropin-releasing factor in the ovine fetus and pregnant ewe: role of placenta. Am J Physiol 261: R995-1002, 1991. 99. Kendall JZ, Challis JRG, Hart IC, Jones CT, Mitchell MD, Ritchie JWK, Robinson JS and Thorburn GD. Steroid and prostaglandin concentrations in the plasma of pregnant ewes during infusion of adrenocorticotropin or dexamethasone to intact or hypophysectomized foetuses. J Endocrinol 75: 59-71, 1977. 100. Kiss JZ. Dynamism of chemoarchitecture in the hypothalamic paraventricular nucleus. Brain Res Bull 20: 699-708, 1988. 101. Kitay JI. Sex differences in adrenal cortical secretion in the rat. Endocrinology 68: 818-824, 1961. 102. Kitay JI. Pituitary-adrenal function in the rat after gonadectomy and gonadal mormone replacement. Endocrinology 73: 253-260, 1963. 129

PAGE 130

103. Kraemer SA, Meade EA and DeWitt DL. Prostaglandin endoperoxide synthase gene structure: identification of the transcriptional start site and 5'-flanking regulatory sequences. Arch Biochem Biophys 293: 391-400, 1992. 104. Kreiger DP. Plasma ACTH and corticosteroids. In: Endocrinology, edited by L.J Groot GFCLMDHNWDOeal. New York: Grune & Stratton, 1979, p. 1139-1156. 105. Kujubu DA and Herschman HR. Dexamethasone inhibits mitogen induction of the TIS10 prostaglandin synthase/cyclooxygenase gene. J Biol Chem 267: 7991-7994, 1992. 106. Kupferman I. Hypothalamus and Limbic System: Pertidergic Neurons, Homeostasis, and Emotional Behaviour. In: Princeples of Neural Science, Norwalk, CT: Appleton & Lange, 1991, p. 735-749. 107. Kuwamoto S, Inoue H, Tone Y, Izumi Y and Tanabe T. Inverse gene expression of prostacyclin and thromboxane synthases in resident and activated peritoneal macrophages. FEBS Lett 409: 242-246, 1997. 108. Lakhdir FR, Tong H and Wood CE. Baroreceptor and prostanoid control of fetal renal cortical blood flow and plasma renin activity. Reprod Fertil Dev 13: 119-124, 2001. 109. Levidiotis ML, Wintour EM, McKinley MJ and Oldfield BJ. Hypothalamic-hypophyseal vascular connections in the fetal sheep. Neuroendocrinology 49: 47-50, 1989. 110. Liggins GC. Adrenocortical-related maturational events in the fetus. Am J Obstet Gynecol 126: 931-941, 1976. 111. Liggins GC. Premature parturition after infusion of corticotrophin or cortisol into foetal lambs. J Endocr 42: 323-329, 1968. 112. Liggins GC. Premature delivery of foetal lambs infused with glucocorticoids. J Endocrinol 45: 515-523, 1969. 113. Liggins GC, Fairclough RJ, Grieves SA, Kendall JZ and Knox BS. The mechanism of initiation of parturition in the ewe. Recent Prog Horm Res 29: 111-159, 1973. 130

PAGE 131

114. Liggins GC, Holm LW and Kennedy PC. Prolonged pregnancy following surgical lesions of the foetal lamb pituitary. J Reprod Fertil 12: 419, 1966. 115. Liggins GC and Kennedy PC. Effects of electrocoagulation of the foetal lamb hypophysis on growth and development. J Endocrinol 40: 371-381, 1968. 116. Liggins GC, Kennedy PC and Holm LW. Failure of initiation of parturition after electrocoagulation of the pituitary of the fetal lamb. Am J Obstet Gynecol 98: 1080-1086, 1967. 117. Liggins GC, Kennedy PC and Holm LW. Failure of initiation of parturition after electrocoagulation of the pituitary of the fetal lamb. Am J Obstet Gynecol 98: 1080-1086, 1967. 118. Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, Dubois RN, Trzaskos JM and Dey SK. Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta. Genes Dev 13: 1561-1574, 1999. 119. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408, 2001. 120. Lu F, Yang K and Challis JR. Regulation of ovine fetal pituitary function by corticotropin-releasing hormone, arginine vasopressin and cortisol in vitro. J Endocrinol 143: 199-208, 1994. 121. Maia M, Vivier J, Hue D, Durand P, Feige JJ and Defaye G. Expression of the melanocortin receptors MC2-R (ACTH-receptor) and MC5-R during embryonic development of ovine adrenals. Endocr Res 28: 631-635, 2002. 122. Makarenko IG, Ugrumov MV and Calas A. Axonal projections from the hypothalamus to the pituitary intermediate lobe in rats during ontogenesis: DiI tracing study. Brain Res Dev Brain Res 155: 117-126, 2005. 123. Malpas P. Postmaturity and malformations of the foetus. J Obstet Gynecol Brit Cwlth 40: 1046-1053, 1933. 124. Maslinska D, Kaliszek A, Opertowska J, Toborowicz J, Deregowski K and Szukiewicz D. Constitutive expression of cyclooxygenase-2 (COX-2) in developing brain. A. Choroid plexus in human fetuses. Folia Neuropathol 37: 287-291, 1999. 131

PAGE 132

125. McDonald TJ, Li C, Vincent SE and Nijland MJ. Fetal fornix transection and gestation length in sheep. Exp Neurol 200: 532-537, 2006. 126. McDonald TJ and Nathanielsz PW. Bilateral destruction of the fetal paraventricular nuclei prolongs gestation in sheep. Am J Obstet Gynecol 165: 764-770, 1991. 127. McDonald TJ, Rose JC, Figueroa JP, Gluckman PD and Nathanielsz PW. The effect of hypothalamic paraventricular nuclear lesions placed at 108-110 days gestational age on plasma ACTH concentrations in the fetal sheep. J Dev Physiol 10: 191-200, 1988. 128. McLaren WJ, Young IR, Wong MH and Rice GE. Expression of prostaglandin G/H synthase-1 and -2 in ovine amnion and placenta following glucocorticoid-induced labour onset. J Endocrinol 151: 125-135, 1996. 129. McLean M, Bisits A, Davies J, Woods R, Lowry P and Smith R. A placental clock controlling the length of human pregnancy. Nat Med 1: 460-463, 1995. 130. McMillen IC, Thorburn GD and Walker DW. Diurnal variations in plasma concentrations of cortisol, prolactin, growth hormone and glucose in the fetal sheep and pregnant ewe during late gestation. J Endocrinol 114: 65-72, 1987. 131. Millington GW. The role of proopiomelanocortin (POMC) neurones in feeding behaviour. Nutr Metab (Lond) 4: 18, 2007. 132. Morita I. Distinct functions of COX-1 and COX-2. Prostaglandins Other Lipid Mediat 68-69: 165-175, 2002. 133. Morita I, Schindler M, DeWitt D, Murota S and Smith W. A novel method for prostaglandin endoperoxide H synthase activity in individual intact cells. Adv Exp Med Biol 407: 521-524, 1997. 134. Morita I, Schindler M, Regier MK, Otto JC, Hori T, DeWitt DL and Smith WL. Different intracellular locations for prostaglandin endoperoxide H synthase-1 and -2. J Biol Chem 270: 10902-10908, 1995. 135. Morrow JD, Zackert WE, Yang JP, Kurhts EH, Callewaert D, Dworski R, Kanai K, Taber D, Moore K, Oates JA and Roberts LJ. Quantification of the major urinary metabolite of 15-F2t-isoprostane (8-iso-PGF2alpha) by a stable isotope dilution mass spectrometric assay. Anal Biochem 269: 326-331, 1999. 132

PAGE 133

136. Mulvogue HM, McMillen IC, Robinson PM and Perry RA. Immunocytochemical localization of pro-gamma-MSH, gamma-MSH, ACTH, and beta-endorphin/beta-lipotropin in the fetal sheep pituitary: an ontogenetic study. J Dev Physiol 8: 355-368, 1986. 137. Murata T, Ushikubi F, Matsuoka T, Hirata M, Yamasaki A, Sugimoto Y, Ichikawa A, Aze Y, Tanaka T, Yoshida N, Ueno A, Oh-ishi S and Narumiya S. Altered pain perception and inflammatory response in mice lacking prostacyclin receptor. Nature 388: 678-682, 1997. 138. Nappi RE, Bonneau MJ and Rivest S. Influence of the estrous cycle on c-fos and CRH gene transcription in the brain of endotoxin-challenged female rats. Neuroendocrinology 65: 29-46, 1997. 139. Nappi RE and Rivest S. Ovulatory cycle influences the stimulatory effect of stress on the expression of corticotropin-releasing factor receptor messenger ribonucleic acid in the paraventricular nucleus of the female rat hypothalamus. Endocrinology 136: 4073-4083, 1995. 140. Narasaka T, Moriya T, Endoh M, Suzuki T, Shizawa S, Mizokami Y, Matsuoka T and Sasano H. 17Beta-hydroxysteroid dehydrogenase type 2 and dehydroepiandrosterone sulfotransferase in the human liver. Endocr J 47: 697-705, 2000. 141. Nelson PG, Fields RD and Liu Y. Neural activity, neuron-glia relationships, and synapse development. Perspect Dev Neurobiol 2: 399-407, 1995. 142. Nodwell A, Carmichael L, Fraser M, Challis J and Richardson B. Placental release of corticotrophin-releasing hormone across the umbilical circulation of the human newborn. Placenta 20: 197-202, 1999. 143. Norman LJ and Challis JRG. Synergism between systemic corticotropin-releasing factor and arginine vasopressin on adrenocorticotropin release in vivo varies as a function of gestational age in the ovine fetus. Endocrinology 120: 1052-1058, 1987. 144. Norton JL, Adamson SL, Bocking AD and Han VK. Prostaglandin-H synthase-1 (PGHS-1) gene is expressed in specific neurons of the brain of the late gestation ovine fetus. Brain Res Dev Brain Res 95: 79-96, 1996. 133

PAGE 134

145. Norton JL, Adamson SL, Bocking AD and Han VK. Prostaglandin-H synthase-1 (PGHS-1) gene is expressed in specific neurons of the brain of the late gestation ovine fetus. Brain Res Dev Brain Res 95: 79-96, 1996. 146. Norwitz ER and Robinson JN. A systematic approach to the management of preterm labor. Semin Perinatol 25: 223-235, 2001. 147. Novy MJ and Liggins GC. Role of prostaglandins, prostacyclin, and thromboxanes in the physiologic control of the uterus and in parturition. Semin Perinatol 4: 45-66, 1980. 148. Okamoto E, Takagi T, Azuma C, Kimura T, Tokugawa Y, Mitsuda N and Tanizawa O. Expression of the corticotropin-releasing hormone (CRH) gene in human placenta and amniotic membrane. Horm Meta Res 22: 394-397, 1990. 149. Olson DM. The promise of prostaglandins: have they fulfilled their potential as therapeutic targets for the delay of preterm birth? J Soc Gynecol Investig 12: 466-478, 2005. 150. Pardridge WM. Transport of protein-bound hormones into tissues in vivo. Endocr Rev 2: 103-123, 1981. 151. Parfenova H, Balabanova L and Leffler CW. Posttranslational regulation of cyclooxygenase by tyrosine phosphorylation in cerebral endothelial cells. Am J Physiol 274: C72-C81, 1998. 152. Parker TL, Kesse WK, Mohamed AA and Afework M. The innervation of the mammalian adrenal gland. J Anat 183 ( Pt 2): 265-276, 1993. 153. Patrick J, Challis JRG, Cross J, Olson DM, Lye SJ and Turliuk R. The relationship between fetal breathing movements and prostaglandin E2 during ACTH-induced labour in sheep. J Dev Physiol 9: 287-294, 1987. 154. Penhoat A, Jaillard C and Saez JM. Synergistic effects of corticotropin and insulin-like growth factor I on corticotropin receptors and corticotropin responsiveness in cultured bovine adrenocortical cells. Biochem Biophys Res Commun 165: 355-359, 1989. 155. Pepe GJ and Albrecht ED. Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev 16: 608-648, 1995. 134

PAGE 135

156. Peris J, Anderson KJ, Vickroy TW, King MA and Walker DW. Neurochemical basis of disruption of hippocampal long term potentiation by chronic alcohol exposure. Front Biosci 2: d309-d316, 1997. 157. Pollard I, White BM, Bassett JR and Cairncross KD. Plasma glucocorticoid elevation and desynchronization of the estrous cycle following unpredictable stress in the rat. Behav Biol 14: 103-108, 1975. 158. Poole MD and Pillsbury HC, III. Prostaglandins and other metabolites of arachidonic acid. An overview for the otolaryngologist. Arch Otolaryngol 111: 317-321, 1985. 159. Poore KR, Young IR, Canny BJ and Thorburn GD. Studies on the role of ACTH in the regulation of adrenal responsiveness and the timing of parturition in the ovine fetus. J Endocrinol 158: 161-171, 1998. 160. Purinton SC and Wood CE. Oestrogen augments the fetal ovine hypothalamuspituitary-adrenal axis in response to hypotension. J Physiol 544: 919-929, 2002. 161. Raff H. Glucocorticoid inhibition of neurohypophysial vasopressin secretion. Am J Physiol 252: R635-R644, 1987. 162. Raff H, Kane CW and Wood CE. Arginine vasopressin responses to hypoxia and hypercapnia in late-gestation fetal sheep. Am J Physiol 260: R1077-R1081, 1991. 163. Raff H and Wood CE. Effect of age and blood pressure on the heart rate, vasopressin, and renin response to hypoxia in fetal sheep. Am J Physiol 263: R880-R884, 1992. 164. Reichlin S. The hypothalamus: introduction. Res Publ Assoc Res Nerv Ment Dis 56: 1-14, 1978. 165. Reimsnider S.K. and Wood CE. Colocalisation of Prostaglandin Endoperoxide Synthase and Immunoreactive Adrenocorticotropic Hormone in Ovine Foetal Pituitary. J Endocr 180: 303-310, 2004. 166. Reimsnider S and Wood CE. Differential modulation of ovine fetal ACTH secretion by PGHS-1 and PGHS-2. Neuroendocrinology 83: 4-11, 2006. 135

PAGE 136

167. Reimsnider SK and Wood CE. Does reduction of circulating prostaglandin e(2) reduce fetal hypothalamic-pituitary-adrenal axis activity? J Soc Gynecol Investig 12: e13-e19, 2005. 168. Richards EM, Hua Y and Keller-Wood M. Pharmacology and physiology of ovine corticosteroid receptors. Neuroendocrinology 77: 2-14, 2003. 169. Rodts-Palenik S and Morrison JC. Tocolysis: an update for the practitioner. Obstet Gynecol Surv 57: S9-34, 2002. 170. Rose JC, Meis PJ, Urban RB and Greiss FC. In vivo evidence for increased adrenal sensitivity to adrenocorticotropin-(1-24) in the lamb fetus late in gestation. Endocrinology 111: 80-85, 1982. 171. Rose JC, Morris M and Meis PJ. Hemorrhage in newborn lambs: effects on arterial blood pressure, ACTH, cortisol, and vasopressin. Am J Physiol 240: E585-E590, 1981. 172. Roselli CE, Stormshak F and Resko JA. Distribution and regulation of aromatase activity in the ram hypothalamus and amygdala. Brain Res 811: 105-110, 1998. 173. Roselli CE, Stormshak F and Resko JA. Distribution of aromatase mRNA in the ram hypothalamus: an in situ hybridization study. J Neuroendocrinol 12: 656-664, 2000. 174. Saez JM, Durand P and Cathiard AM. Ontogeny of the ACTH receptor, adenylate cyclase, and steroidogenesis in the adrenal. Mol and Cell Endocrinol 38: 93-102, 1984. 175. Saoud CJ and Wood CE. Modulation of ovine fetal adrenocorticotropin secretion by androstenedione and 17beta-estradiol. Am J Physiol 272: R1128-R1134, 1997. 176. Saoud CJ and Wood CE. Modulation of ovine fetal adrenocorticotropin secretion by androstenedione and 17beta-estradiol. Am J Physiol 272: R1128-R1134, 1997. 177. Saoud CJ and Wood CE. Ontogeny and molecular weight of immunoreactive arginine vasopressin and corticotropin-releasing factor in the ovine fetal hypothalamus. Peptides 17: 55-61, 1996. 178. Sarau HM, Ames RS, Chambers J, Ellis C, Elshourbagy N, Foley JJ, Schmidt DB, Muccitelli RM, Jenkins O, Murdock PR, Herrity NC, Halsey W, Sathe G, Muir AI, 136

PAGE 137

Nuthulaganti P, Dytko GM, Buckley PT, Wilson S, Bergsma DJ and Hay DW. Identification, molecular cloning, expression, and characterization of a cysteinyl leukotriene receptor. Mol Pharmacol 56: 657-663, 1999. 179. Sawchenko PE and Swanson LW. Localization, colocalization, and plasticity of corticotropin-releasing factor immunoreactivity in rat brain. Fed Proc 44: 221-227, 1985. 180. Schally AV. Aspects of hypothalamic regulation of the pituitary gland. Its implications for the control of reproductive processes. Mater Med Pol 12: 9-27, 1980. 181. Serhan CN, Takano T and Maddox JF. Aspirin-triggered 15-epi-lipoxin A4 and stable analogs on lipoxin A4 are potent inhibitors of acute inflammation. Receptors and pathways. Adv Exp Med Biol 447: 133-149, 1999. 182. Shinohara H, Balboa MA, Johnson CA, Balsinde J and Dennis EA. Regulation of delayed prostaglandin production in activated P388D1 macrophages by group IV cytosolic and group V secretory phospholipase A2s. J Biol Chem 274: 12263-12268, 1999. 183. Shintani S, Glass LE and Page EW. Studies of induced malignant tumors of placental and uterine origin in the rat. I. Survival of placental tissue following fetectomy. Am J Obstet Gynecol 95: 542-549, 1966. 184. Shitashige M, Morita I and Murota S. Different substrate utilization between prostaglandin endoperoxide H synthase-1 and -2 in NIH3T3 fibroblasts. Biochim Biophys Acta 1389: 57-66, 1998. 185. Sholl SA and Kim KL. Estrogen receptors in the rhesus monkey brain during fetal development. Brain Res Dev Brain Res 50: 189-196, 1989. 186. Simpson ER. Cholesterol side-chain cleavage, chyochrome P450, and the control of steroidogenesis. Molecular and Cellular Endocrinology 13: 213-227, 1979. 187. Sirko S, Bishai I and Coceani F. Prostaglandin formation in the hypothalamus in vivo: effect of pyrogens. Am J Physiol 256: R616-R624, 1989. 188. Smith WL, DeWitt DL and Garavito RM. Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 69: 145-182, 2000. 137

PAGE 138

189. Smith WL, Garavito RM and DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 271: 33157-33160, 1996. 190. Smith WL and Lands WEM. Oxygenation of polyunsaturated fatty acids during prostaglandin biosynthesis by sheep vesicular gland. Biochemistry 11: 3276-3285, 1972. 191. Smith WL and Song I. The enzymology of prostaglandin endoperoxide H synthases-1 and -2. Prostaglandins Other Lipid Mediat 68-69: 115-128, 2002. 192. Spencer AG, Woods JW, Arakawa T, Singer II and Smith WL. Subcellular localization of prostaglandin endoperoxide H synthases-1 and -2 by immunoelectron microscopy. J Biol Chem 273: 9886-9893, 1998. 193. Steele PA, Flint APF and Turnbull AC. Activity of steroid C-17,20 lyase in the ovine placenta: Effect of exposure to foetal glucocorticoid. J Endocr 69: 239-246, 1976. 194. Stewart MD, Johnson GA, Gray CA, Burghardt RC, Schuler LA, Joyce MM, Bazer FW and Spencer TE. Prolactin receptor and uterine milk protein expression in the ovine endometrium during the estrous cycle and pregnancy. Biol Reprod 62: 1779-1789, 2000. 195. Stoffel-Wagner B, Watzka M, Steckelbroeck S, Schramm J, Bidlingmaier JF and Klingmuller D. Expression of 17beta-hydroxysteroid dehydrogenase types 1, 2, 3 and 4 in the human temporal lobe. J Endocrinol 160: 119-126, 1999. 196. Sugimoto Y, Segi E, Tsuboi K, Ichikawa A and Narumiya S. Female reproduction in mice lacking the prostaglandin F receptor. Roles of prostaglandin and oxytocin receptors in parturition. Adv Exp Med Biol 449: 317-321, 1998. 197. Suzuki T, Watanabe K, Kanaoka Y, Sato T and Hayaishi O. Induction of hematopoietic prostaglandin D synthase in human megakaryocytic cells by phorbol ester. Biochem Biophys Res Commun 241: 288-293, 1997. 198. Swinney DC, Mak AY, Barnett J and Ramesha CS. Differential allosteric regulation of prostaglandin H synthase 1 and 2 by arachidonic acid. J Biol Chem 272: 12393-12398, 1997. 199. Tanabe T and Tohnai N. Cyclooxygenase isozymes and their gene structures and expression. Prostaglandins Other Lipid Mediat 68-69: 95-114, 2002. 138

PAGE 139

200. Thorburn GD, Harding R, Jenkin G, Parkington H and Sigger JN. Control of uterine activity in the sheep. J Dev Physiol 6: 31-43, 1984. 201. Thore CR, Beasley TC and Busija DW. In vitro and in vivo localization of prostaglandin H synthase in fetal sheep neurons. Neurosci Lett 242: 29-32, 1998. 202. Tong H, Dhillon H and Wood CE. Induction of PGHS-2 mRNA in response to cerebral hypoperfusion in lategestation fetal sheep. Prostaglandins Other Lipid Mediat 62: 165-172, 2000. 203. Tong H, Gridley KE and Wood CE. Induction of immunoreactive prostaglandin H synthases 1 and 2 and fos in response to cerebral hypoperfusion in late-gestation fetal sheep. J Soc Gynecol Investig 9: 342-350, 2002. 204. Tong H, Lakhdir F and Wood CE. Endogenous prostanoids modulate the ACTH and AVP responses to hypotension in late-gestation fetal sheep. Am J Physiol 275: R735-R741, 1998. 205. Tong H, Richards E and Wood CE. Prostaglandin endoperoxide synthase-2 abundance is increased in brain tissues of late-gestation fetal sheep in response to cerebral hypoperfusion. J Soc Gynecol Investig 6: 127-135, 1999. 206. Tong, H. and Wood, C. E. Expression of Prostaglandin endoperoxide synthase-2 in Response to Cerebral Hypoperfusion in Late-Gestation Fetal Sheep. J. Soc. Gynecol. Investig. 5: 66A, 1998. 207. Tong H and Wood CE. Indomethacin attenuates the cerebral blood flow response to hypotension in late-gestation fetal sheep. Am J Physiol 277: R1268-R1273, 1999. 208. Townsend SF, Rudolph CD and Rudolph AM. Changes in ovine hepatic circulation and oxygen consumption at birth. Pediatr Res 25: 300-304, 1989. 209. Turnbull AC and Anderson AB. Evidence of a foetal role in determining the length of gestation. Postgrad Med J 45: 65-67, 1969. 210. Umezaki H, Valenzuela GJ, Hess DL and Ducsay CA. Fetectomy alters maternal endocrine and uterine activity rhythms in rhesus macaques during late gestation. Am J Obstet Gynecol 169: 1435-1441, 1993. 139

PAGE 140

211. Ushikubi F, Segi E, Sugimoto Y, Murata T, Matsuoka T, Kobayashi T, Hizaki H, Tuboi K, Katsuyama M, Ichikawa A, Tanaka T, Yoshida N and Narumiya S. Impaired febrile response in mice lacking the prostaglandin E receptor subtype EP3. Nature 395: 281-284, 1998. 212. van Haarst AD, Oitzl MS and De Kloet ER. Facilitation of feedback inhibition through blockade of glucocorticoid receptors in the hippocampus. Neurochem Res 22: 1323-1328, 1997. 213. Van Kampen KR and Ellis LC. Prolonged gestation in ewes ingesting Veratrum californicum: morphological changes and steroid biosynthesis in the endocrine organs of cyclopic lambs. J Endocrinol 52: 549-560, 1972. 214. Vanegas H and Schaible HG. Prostaglandins and cyclooxygenases [correction of cycloxygenases] in the spinal cord. Prog Neurobiol 64: 327-363, 2001. 215. Viau V and Meaney MJ. Variations in the hypothalamic-pituitary-adrenal response to stress during the estrous cycle in the rat. Endocrinology 129: 2503-2511, 1991. 216. Waddell BJ, Benediktsson R, Brown RW and Seckl JR. Tissue-specific messenger ribonucleic acid expression of 11beta-hydroxysteroid dehydrogenase types 1 and 2 and the glucocorticoid receptor within rat placenta suggests exquisite local control of glucocorticoid action. Endocrinology 139: 1517-1523, 1998. 217. Waddell BJ and Burton PJ. Release of bioactive ACTH by perifused human placenta at early and late gestation. J Endocrinol 136: 345-353, 1993. 218. Wang JJ, Valego NK, Su Y, Smith J and Rose JC. Developmental aspects of ovine adrenal adrenocorticotropic hormone receptor expression. J Soc Gynecol Investig 11: 27-35, 2004. 219. Watabe T, Levidiotis ML, Oldfield B and Wintour EM. Ontogeny of corticotrophin-releasing factor (CRF) in the ovine fetal hypothalamus: use of multiple CRF antibodies. J Endocrinol 129: 335-341, 1991. 220. Whitnall MH, Mezey E and Gainer H. Co-localization of corticotropin-releasing factor and vasopressin in median eminence neurosecretory vesicles. Nature 317: 248-250, 1985. 140

PAGE 141

221. Whitnall MH, Smyth D and Gainer H. Vasopressin coexists in half of the corticotropin-releasing factor axons present in the external zone of the median eminence in normal rats. Neuroendocrinology 45: 420-424, 1987. 222. Wood CE. Control of parturition in ruminants. J Reprod Fertil Suppl 54: 115-126, 1999. 223. Wood CE. Sinoaortic denervation attenuates the reflex responses to hypotension in fetal sheep. Am J Physiol 256: R1103-R1110, 1989. 224. Wood CE. Sensitivity of cortisol-induced inhibition of ACTH and renin in fetal sheep. Am J Physiol 250: R795-R802, 1986. 225. Wood CE. Control of parturition in ruminants. J Reprod Fertil Suppl 54: 115-126, 1999. 226. Wood CE. Baroreflex and chemoreflex control of fetal hormone secretion. Reprod Fertil Dev 7: 479-489, 1995. 227. Wood CE. The function of the fetal pituitary-adrenal system. In: Textbook of Fetal Physiology, edited by Thorburn GD and Harding R. Oxford: Oxford University Press, 1994, p. 351-358. 228. Wood CE. Insensitivity of near-term fetal sheep to cortisol: possible relation to the control of parturition. Endocrinology 122: 1565-1572, 1988. 229. Wood CE. Estrogen/hypothalamus-pituitary-adrenal axis interactions in the fetus: The interplay between placenta and fetal brain. J Soc Gynecol Investig 12: 67-76, 2005. 230. Wood CE and Cudd TA. Development of the hypothalamus-pituitary-adrenal axis of the equine fetus: a comparative review. Equine Vet J Suppl 74-82, 1997. 231. Wood CE and Giroux D. Central nervous system prostaglandin endoperoxide synthase-1 and -2 responses to oestradiol and cerebral hypoperfusion in late-gestation fetal sheep. J Physiol 549: 573-581, 2003. 232. Wood CE, Giroux D and Gridley K. Fetal brain regional responses to cerebral hypoperfusion: modulation by estrogen. Brain Res 993: 84-89, 2003. 141

PAGE 142

233. Wood CE, Gridley KE and Keller-Wood M. Biological activity of 17beta-estradiol-3-sulfate in ovine fetal plasma and uptake in fetal brain. Endocrinology 144: 599-604, 2003. 234. Wood CE, Kane C and Raff H. Peripheral chemoreceptor control of fetal renin responses to hypoxia and hypercapnia. Circ Res 67: 722-732, 1990. 235. Wood CE and Keller-Wood M. Induction of parturition by cortisol: effects on negative feedback sensitivity and plasma CRF. J Dev Physiol 16: 287-292, 1991. 236. Wood CE and Rudolph AM. Negative feedback regulation of adrenocorticotropin secretion by cortisol in ovine fetuses. Endocrinology 112: 1930-1936, 1983. 237. Wood CE and Saoud CJ. Influence of estradiol and androstenedione on ACTH and cortisol secretion in the ovine fetus. J Soc Gynecol Investig 4: 279-283, 1997. 238. Wood CE, Saoud CJ, Stoner TA and Keller-Wood M. Estrogen and androgen influence hypothalamic AVP and CRF concentrations in fetal and adult sheep. Regul Pept 98: 63-68, 2001. 239. Wood CE, Shinsako J and Dallman MF. Comparison of canine corticosteroid responses to mean and phasic increases in ACTH. Am J Physiol 242: E102-E108, 1982. 240. Wood CE, Shinsako J, Keil LC, Ramsay DJ and Dallman MF. Apparent dissociation of adrenocorticotropin and corticosteroid responses to 15 ml/kg hemorrhage in conscious dogs. Endocrinology 110: 1416-1421, 1982. 241. Wood CE and Tong H. Central nervous system regulation of reflex responses to hypotension during fetal life. Am J Physiol 277: R1541-R1552, 1999. 242. Wu WX, Ma XH, Zhang Q, Buchwalder L and Nathanielsz PW. Regulation of prostaglandin endoperoxide H synthase 1 and 2 by estradiol and progesterone in nonpregnant ovine myometrium and endometrium in vivo. Endocrinology 138: 4005-4012, 1997. 243. Zhang V, O'Sullivan M, Hussain H, Roswit WT and Holtzman MJ. Molecular cloning, functional expression, and selective regulation of ovine prostaglandin H synthase-2. Biochem Biophys Res Commun 227: 499-506, 1996. 142

PAGE 143

244. Zhang YH, Lu J, Elmquist JK and Saper CB. Specific roles of cyclooxygenase-1 and cyclooxygenase-2 in lipopolysaccharide-induced fever and Fos expression in rat brain. J Comp Neurol 463: 3-12, 2003. 245. Zhao Y, Patzer A, Herdegen T, Gohlke P and Culman J. Activation of cerebral peroxisome proliferator-activated receptors gamma promotes neuroprotection by attenuation of neuronal cyclooxygenase-2 overexpression after focal cerebral ischemia in rats. FASEB J 20: 1162-1175, 2006. 143

PAGE 144

BIOGRAPHICAL SKETCH Jason Alexander Gersting was born in Indianapolis, IN and was raised there until high school age. In his sophomore year, he transferred to Hilo High School in Hilo, HI. After graduating in 1993, he returned to the Midwest to attend Purdue University in West Lafayette, IN. In 1996, he received a Bachelor of Science in biology/neuroscience and an English minor. In 1997, he began graduate school at the Indiana University School of Medicine in Indianapolis, IN. He graduated in 1999 with a Master of Science in pharmacology. He relocated to Gainesville, Florida in 1999 and worked for three years as a Biological Scientist in the University of Florida in the Department of Pediatrics. In 2002, he began a joint J.D./Ph.D. program in the University of Florida College of Medicine Interdisciplinary Program and University of Florida Levin College of Law. His dissertation was completed in the lab of Dr. Charles. E. Wood in the Department of Physiology and Functional Genomics, where he studied the role of prostaglandin synthesis in the ovine fetal hypothalamus-pituitary adrenal axis. Jason was supported in his graduate studies by a Pre-doctoral Fellowship for the Florida/Puerto Rico affiliate of the American Heart Association. He received both his Ph.D. in medical sciences and his J.D. in May of 2008 and practices intellectual property law in southern California. 144