<%BANNER%>

Identification and Characterization of Tmem16a in Vertebrate Development

Permanent Link: http://ufdc.ufl.edu/UFE0021990/00001

Material Information

Title: Identification and Characterization of Tmem16a in Vertebrate Development
Physical Description: 1 online resource (101 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: cartilage, development, embryo, epithelium, knockout, limb, microarray, mouse, tmem16, tmem16a, trachea, tracheomalacia
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The development of a vertebrate embryo is a complex process that requires many precisely regulated morphogenetic events. For decades, scientists have studied vertebrate development in the context of the limbs because of their accessibility for manipulations and organisms' resistance to perturbations of limb development. Two signaling centers in the vertebrate limb, the zone of polarizing activity (ZPA) and the apical ectodermal ridge (AER), were identified by classical embryo manipulations. Such manipulations provide the context into which we incorporate molecular data. It has been shown that the secreted molecule sonic hedgehog (SHH) mediates the polarizing activity of the ZPA in the limb. Deletion or misexpression of Shh results in severe patterning defects that recapitulate those observed in early embryological experiments. We are now beginning to understand the mechanisms by which SHH influences digit identity and limb outgrowth on a cellular level. To identify additional genes expressed in the ZPA, we performed a microarray screen that compared the levels of over 39,000 transcripts between the ZPA and the rest of the limb bud. From this data, we confirmed the expression of six genes in the limb bud whose expression there had not been previously reported. In situ hybridization showed that at least four of these genes were expressed in the ZPA and might influence its function. To investigate the function of one of these genes, Tmem16a, in vertebrate development, we generated a null allele of this gene in mouse embryonic stem cells. Mice homozygous for this allele do not have an apparent limb defect, but all homozygous mutants die within a month of birth. This demonstrates a requirement for Tmem16a in vertebrate development. The epithelium of the mid-gestational trachea is stratified, or multi-layered, during normal mouse development. The molecular events responsible for this stratification are currently poorly understood. We report that the epithelium of Tmem16a mutant tracheae fails to stratify and the resulting lateral arrangement of epithelial cells causes an expansion of the tracheal tube. This expansion redirects the formation of cartilage in the surrounding mesenchyme so that multiple disconnected cartilage elements form instead of C-shaped rings that keep the trachea open during respiration. Tmem16a is a member of a family of genes that comprises at least ten members in mice and humans. In support of our observation of an abnormal epithelial organization of Tmem16a mutant tracheae, two other members from this protein family have been shown to influence cellular morphology. In an attempt to better understand the functions of these proteins in vertebrate development, we have examined the in vivo expression patterns of Tmem16a and several other members of this family during mouse development. The expression of these genes is widespread during embryogenesis and, as we show for Tmem16a and Tmem16f, overlapping in a variety of tissues. The mutation of at least one member, TMEM16E, has been linked to the human disease gnathodiaphyseal dysplasia and the clinical relevance of this family is underscored by the expression of several TMEM16s in multiple types of cancer.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Harfe, Brian D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021990:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021990/00001

Material Information

Title: Identification and Characterization of Tmem16a in Vertebrate Development
Physical Description: 1 online resource (101 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: cartilage, development, embryo, epithelium, knockout, limb, microarray, mouse, tmem16, tmem16a, trachea, tracheomalacia
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The development of a vertebrate embryo is a complex process that requires many precisely regulated morphogenetic events. For decades, scientists have studied vertebrate development in the context of the limbs because of their accessibility for manipulations and organisms' resistance to perturbations of limb development. Two signaling centers in the vertebrate limb, the zone of polarizing activity (ZPA) and the apical ectodermal ridge (AER), were identified by classical embryo manipulations. Such manipulations provide the context into which we incorporate molecular data. It has been shown that the secreted molecule sonic hedgehog (SHH) mediates the polarizing activity of the ZPA in the limb. Deletion or misexpression of Shh results in severe patterning defects that recapitulate those observed in early embryological experiments. We are now beginning to understand the mechanisms by which SHH influences digit identity and limb outgrowth on a cellular level. To identify additional genes expressed in the ZPA, we performed a microarray screen that compared the levels of over 39,000 transcripts between the ZPA and the rest of the limb bud. From this data, we confirmed the expression of six genes in the limb bud whose expression there had not been previously reported. In situ hybridization showed that at least four of these genes were expressed in the ZPA and might influence its function. To investigate the function of one of these genes, Tmem16a, in vertebrate development, we generated a null allele of this gene in mouse embryonic stem cells. Mice homozygous for this allele do not have an apparent limb defect, but all homozygous mutants die within a month of birth. This demonstrates a requirement for Tmem16a in vertebrate development. The epithelium of the mid-gestational trachea is stratified, or multi-layered, during normal mouse development. The molecular events responsible for this stratification are currently poorly understood. We report that the epithelium of Tmem16a mutant tracheae fails to stratify and the resulting lateral arrangement of epithelial cells causes an expansion of the tracheal tube. This expansion redirects the formation of cartilage in the surrounding mesenchyme so that multiple disconnected cartilage elements form instead of C-shaped rings that keep the trachea open during respiration. Tmem16a is a member of a family of genes that comprises at least ten members in mice and humans. In support of our observation of an abnormal epithelial organization of Tmem16a mutant tracheae, two other members from this protein family have been shown to influence cellular morphology. In an attempt to better understand the functions of these proteins in vertebrate development, we have examined the in vivo expression patterns of Tmem16a and several other members of this family during mouse development. The expression of these genes is widespread during embryogenesis and, as we show for Tmem16a and Tmem16f, overlapping in a variety of tissues. The mutation of at least one member, TMEM16E, has been linked to the human disease gnathodiaphyseal dysplasia and the clinical relevance of this family is underscored by the expression of several TMEM16s in multiple types of cancer.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Harfe, Brian D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021990:00001


This item has the following downloads:


Full Text

PAGE 1

1 IDENTIFICATION AND CHARACTERIZATION OF Tmem16a IN VERTEBRATE DEVELOPMENT By JASON RANDALL ROCK A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Jason Randall Rock

PAGE 3

3 To my parents and my sister

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank m y parents and my sister for their love and support without which I would have failed years ago. They have celebrated each of my lifes successes and encouraged me through each of its challenges. I am forever grateful to Dr. Brian Harfe for introducing me to the field of developmental genetics and for allowing me the freedom to explore many morphogenetic events firsthand. I appreciate his support and guidance as I dealt with each of this projects surprises. I woul d also like to thank my advisory committee members, Drs. Henry Baker, Martin Cohn, and Paul Oh, for their guidance. A number of scientists have contributed to this work in many ways. Dr. Danielle Maatouk provided invaluable support and fr iendship. Dr. Amel Gritli-Linde was the source of countless transatlantic suggestions, criticisms, a nd protocols for which I am eternally grateful. Dr. Christopher Futtner performed the blastocyst injections without which much of this work would have been impossible. My labmat es, Cort Bouldin and KyungSuk Choi, are thanked for their friendshi p, support, comments, and conversations. Drs. Karen Johnstone and Jim Resnick taught me the ways of the mouse embryonic stem cell and provided unimaginable support for a fledgling laboratory. For their technical contributions, I would like to tha nk Doug Smith and M. Cecilia Lopez. I owe a great deal of gratit ude to those who recognized and nurtured my scientific proclivity early in life. Notable among th ese individuals are Dr. Dexter Easton, Tess Durant, Otto Phanstiel, and Mark Landschoot. Lastly, I would like to thank the people who have facilitated this work in the most practical sense. In particular, Joyce C onners, Michele Ramsey and Jenneene Spencer have made certain that I was well equippe d and prepared for my graduate studies.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 LIST OF ABBREVIATIONS........................................................................................................ 10 ABSTRACT...................................................................................................................................12 CHAP TER 1 INTRODUCTION..................................................................................................................14 Limb Deve lopm ent............................................................................................................... ..14 Identifying Additional Genes Expresse d During Mouse Limb Developm ent........................16 The Role of TMEM16A in Vertebrate Developm ent..............................................................16 The TMEM16 Family of Proteins.......................................................................................... 18 2 IDENTIFICATION OF GENES EXPRESSE D IN THE MOUSE LIMB USING A NOVE L ZPA MICROARRAY APPROACH........................................................................ 20 An in vivo Screen to Identify Genes Expressed in the Mouse ZPA....................................... 20 In vivo Validation of Novel Gene s Identified in the ZPA ............................................... 21 Identification of Genes Expressed Outsid e the Z PA in the E10.5 Mouse Limb Bud..... 22 Genes with Expression in the ZPA......................................................................................... 22 Tcfap2b ............................................................................................................................22 Hlxb9 ...............................................................................................................................23 EST BI734849.................................................................................................................24 Tmem16a .........................................................................................................................25 Tcfap2b, Hlxb9 EST BI734840, and Tmem16a Are Expressed in Shh Null Lim b Buds.............................................................................................................................26 Tmem16a Expression in the Lim b is Bmp -Independent but Requires Ectodermal Fgf Expression.............................................................................................................26 Experimental Procedures........................................................................................................ 27 Fluorescence-Activated Cell Sorting of GFP-Posi tive Cells from the E10.5 Limb Bud...............................................................................................................................27 Microarray Target Prepar ation, GeneChip Hybridization, and Data Analysis................ 28 Whole Mount RNA in situ Hybridization and Generation of Mutant Em bryos............. 28 rtPCR Analysis of Gene Expression................................................................................29 3 DEFECTIVE TRACHEAL CARTILAGE RING FORMATION CAUSED BY DELETION OF THE TRANSMEM BRANE PROTEIN TMEM16A...................................37

PAGE 6

6 Introduction................................................................................................................... ..........37 Results.....................................................................................................................................39 Tmem16a Is Expressed in the Tracheal Epithelium ........................................................ 39 Tmem16a Null Mice Fail to Thrive During Postnatal L ife............................................. 40 Tmem16a M utants Exhibit Defects in Tr acheal Cartilage Ring Formation.................... 41 Chondrogenic Cells Are Present in the Ventral Mesenchym e of Tmem16a Mutants..... 42 Increased Tracheal Circumference in Tmem16a Null Mice ............................................ 43 Ciliated Cells Are Absent from Evaginated Regio ns of the Tracheal Epithelium.......... 43 Embryonic Tracheal Epithelium St ratification Is Lost in Tmem16a Mutants ................. 45 Discussion...............................................................................................................................45 Abnormal Morphogenesis of the Tracheal Epithelium in Tmem16a Mutants................ 45 A Novel Etiology for Tracheomalacia in a Murine Model............................................. 46 Experimental Procedures........................................................................................................ 48 Generation of a Null Allele of Tmem16a ........................................................................48 Alcian Blue Staini ng of Cartilage ....................................................................................48 RNA in situ Hybridization ...............................................................................................49 Immunohistochemistry a nd Imm unofluorescence..........................................................49 Image Acquisition and Measuremen t of Lum inal Circumference.................................. 49 4 THE TMEM16 FAMILY OF PROTEINS............................................................................. 55 Invertebrate TMEM16 Proteins.............................................................................................. 55 Vertebrate TMEM16 Proteins................................................................................................ 56 Tmem16a .........................................................................................................................56 TMEM16A in cancer .................................................................................................56 Expression of murine Tmem16a ...............................................................................57 Tmem16c ..........................................................................................................................58 Tmem16e ..........................................................................................................................59 Tmem16f ..........................................................................................................................60 A gene trap allele of Tmem16f .................................................................................60 RNA in situ hybridization analysis of Tmem16f expression .................................... 63 Tmem16g .........................................................................................................................63 Experimental Procedures........................................................................................................ 64 RNA in situ Hybridization ...............................................................................................64 Generation of Tmem16fRRF355/+ mice...............................................................................64 X-gal Visualization of -galactosidase ...........................................................................65 5 IMPAIRED POSTNATAL LUNG DEVEL OPMENT IN TMEM16A MUTANT MICE..... 71 Introduction................................................................................................................... ..........71 Results.....................................................................................................................................72 Tmem16a is Expressed in a Dyna mic Pattern in the Developing Murine Lung............. 72 Tmem16a M utant Lungs Fail to Develop Alveoli........................................................... 73 Differentiation Is Not Affected in Tmem16a Mutant Lungs ...........................................73 Discussion...............................................................................................................................76 Experimental Procedures........................................................................................................ 77 Sample Collection and Preparation................................................................................. 77

PAGE 7

7 RNA in situ Hybridization ...............................................................................................77 Histology, Immunohistochemistry and Immunofluorescence .........................................77 6 CONCLUDING REMARKS.................................................................................................. 85 APPENDIX A Oligonucleotides used as genotyping prim ers........................................................................ 88 B Expression of TMEM16 family member s in craniofacial developm ent................................89 C Probes used for RNA in situ hybridizations ...........................................................................90 LIST OF REFERENCES...............................................................................................................91 BIOGRAPHICAL SKETCH.......................................................................................................101

PAGE 8

8 LIST OF TABLES Table page 2-1 Partial list of genes identified as enrich ed in the ZPA or outside of the Z PA in the E10.5 limb bud................................................................................................................. ..34 2-2 Genes previously described in th e limb identified by the ZPA screen. ............................. 35 A-1 Primers used to genotype Tmem16a and Tmem1 6f alleles................................................88 C-1 Probes used for RNA in situ hybridizations. .....................................................................90

PAGE 9

9 LIST OF FIGURES Figure page 2-1 Analysis of gene expression in Shh-expressing cells of the Z PA and the rest of the E10.5 limb bud................................................................................................................. ..30 2-2 RNA in situ hybridization confirm ed expression of four novel genes in the ZPA............31 2-3 Further characteriza tion of microarray data....................................................................... 32 2-4 Tmem16a e xpression in the limb is Bmp -independent but requires ectodermal Fgf expression..........................................................................................................................33 3-1 Tmem16a is expressed in the deve loping tracheal epithelium ........................................... 51 3-2 Tmem16a null m ice die within the first mont h of life and do not complete normal tracheal development......................................................................................................... 52 3-3 Tracheal lumen expansion in Tmem16a m utants redirects chondrogenesis in the surrounding mesenchyme.................................................................................................. 53 3-4 Tmem16a mutant epithelium contains Clara, basal, and ciliated cells, but lacks embryonic stratification..................................................................................................... 54 4-1 Tmem16a is widely expressed during m ouse development...............................................66 4-2 Tmem16c is expressed in the m ouse embryo..................................................................... 67 4-3 Tmem16fRRF355/+ is a gene trapped allele of Tmem16f .......................................................68 4-4 X-gal staining of Tmem16fRRF355/+ embryos at E14.5........................................................ 69 4-5 Tmem16f expression in the m ouse embryo detected by RNA in situ hybridization.......... 70 5-1 Tmem16a is expressed in the developing lung .................................................................. 79 5-2 Alveolar septation defect in Tmem16a-/mice................................................................... 80 5-3 Type II alveolar epithelial cells in Tmem16a m utant lungs............................................... 81 5-4 Type I alveolar epithelial cells in Tmem16a m utant lungs................................................ 82 5-5 Nkx2.1 marks distal epithelia l cells in wild type and Tmem1 6a mutant lungs.................. 83 5-6 Other markers of differentiation in T mem16a mutant lungs.............................................. 84 B-1 Summary of Tmem16a, Tmem16c Tmem16f Tmem16h and Tmem16k expression in the nervous system and cr aniofacial structures.................................................................. 89

PAGE 10

10 LIST OF ABBREVIATIONS AER apical ectodermal ridge AMV avian myelobastosis virus BMP bone morphogenetic protein BSA bovine serum albumin cDNA complimentary deoxyribonucleic acid cRNA complimentary ribonucleic acid DNA deoxyribonucleic acid E embryonic day EDTA ethylenediaminetetraacetic acid ES embryonic stem EST expressed sequence tag FACS fluorescence activated cell sorting FGF fibroblast growth factor GFP green fluorescent protein GIST gastrointestinal stromal tumor HH Hamburger and Hamilton chick stage IVT in vitro transcription kb kilobases ng nanogram OSCC oral squamous cell carcinoma PBS phosphate buffered saline PCR polymerase chain reaction PFA paraformaldehyde RA retinoic acid

PAGE 11

11 RACE rapid amplification of cDNA ends RNA ribonucleic acid rpm revolutions per minute rRNA ribosomal ribonucleic acid rtPCR reverse transcription polymerase chain reaction SHH sonic hedgehog ug microgram ZPA zone of polarizing activity

PAGE 12

12 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IDENTIFICATION AND CHARACTERIZATION OF Tmem16a IN VERTEBRATE DEVELOPMENT By Jason Randall Rock May 2008 Chair: Brian D. Harfe Major: Medical Sciences Genetics The development of a vertebrate embryo is a complex process that requires many precisely regulated morphogenetic events. For decades, scientists have studied vertebrate development in the context of the limbs because of their a ccessibility for manipulations and organisms resistance to perturbations of limb development. Two signaling centers in the vertebrate limb, the zone of polarizing activity (Z PA) and the apical ectodermal ridge (AER), were identified by classical embryo manipulations. Such manipul ations provide the context into which we incorporate molecular data. It has been shown that the secreted mo lecule sonic hedgehog (SHH) mediates the polarizing activity of the ZPA in the limb. Deletion or misexpression of Shh results in severe patterning defects that recapitula te those observed in early embr yological experiments. We are now beginning to understand the mechanisms by wh ich SHH influences digit identity and limb outgrowth on a cellular level. To identify additional genes expressed in the ZPA, we performed a microarray screen that compared the levels of over 39,000 transcripts between the ZPA and the rest of the limb bud. From this data, we confirmed the expression of six genes in the limb bud whose expression there

PAGE 13

13 had not been previously reported. RNA in situ hybridization showed that at least four of these genes were expressed in the ZPA and might influence its function. To investigate the function of one of these genes, Tmem16a, in vertebrate development, we generated a null allele of this gene in mouse embryonic stem cells. Mice homozygous for this allele do not have an apparent limb defect, but all homozygous mutants die within a month of birth. This demonstrates a requirement for Tmem16a in vertebrate development. The epithelium of the mid-gestational trachea is stratified, or multi-layered, during normal mouse development. The molecular events respon sible for this stratificat ion are currently poorly understood. We report th at the epithelium of Tmem16a mutant tracheae fails to stratify and the resulting lateral arrangement of epithelial cells ca uses an expansion of the tracheal tube. This expansion redirects the formation of cartilage in the surrounding mesenchyme so that multiple disconnected cartilage elements form instead of C-shaped rings that keep the trachea open during respiration. Tmem16a is a member of a family of genes that comprises at least ten members in mice and humans. In support of our observation of an abnormal epithe lial organization of Tmem16a mutant tracheae, two other members from this protein family have been shown to influence cellular morphology. In an attempt to better und erstand the functions of these proteins in vertebrate development, we have examined the in vivo expression patterns of Tmem16a and several other members of this family during mous e development. The expression of these genes is widespread during embryoge nesis and, as we show for Tmem16a and Tmem16f overlapping in a variety of tissues. The muta tion of at least one member, TMEM16E has been linked to the human disease gnathodiaphyseal dysplasia and th e clinical relevance of this family is underscored by the expression of several TMEM16s in multiple types of cancer.

PAGE 14

14 CHAPTER 1 INTRODUCTION Limb Development For decades scien tists have investigated the complex mechanisms that regulate the development of the vertebrate limb. In a fo rtuitous experiment, John Saunders and Mary Gasseling grafted a population of mesenchymal cells from the posterior of one chick limb bud to the anterior of a recipien t chick limb bud (Saunders JW and Gasseling, MT. 1968). This manipulation resulted in supernum erary digits that were patterned so that those closest to the anterior site of the graft assu med a more posterior identity. In this manner, the zone of polarizing activity, or ZPA, was identified as a signaling center that is necessary for the normal anteroposterior pa tterning of the vertebrate limb. The ZPA was hypothesized to function by secr eting a morphogen th at established a gradient along the anteroposterior axis with different concentrations of the unidentified morphogen specifying digit identities (Wolpert, 1969). It was later discovered that retinoic acid (RA) was capable of inducing mirror-image dupli cations (Tickle et al., 1982) and that these duplications were dose-dependant (Tickle et al., 1985). Howeve r, the concentration of RA necessary to induce and pattern ec topic digits elicited responses in the anterior of the limb that were not observed in the endogenous ZPA (Noji et al., 1991). Care ful study demonstrated that RA functions upstream of the ZPA (Wanek et al ., 1991) but does not directly polarize the limb. Sonic hedgehog, a homolog of Drosophila hedgehog, was identified as the ZPA morphogen (Riddle et al., 1993). Shh expression in the limb is confined to the domain shown to possess polarizing activity in ZPA grafting expe riments. Furthermore, when fibroblasts expressing Shh were transplanted to the anterior of the limb, mirror-image duplications reminiscent of those seen in ZPA grafts were observed. Genetic knockout in mice demonstrated

PAGE 15

15 that SHH functions not only to pa ttern the anteroposterior axis of the limb bud, but also plays a role in regulating the outgrowth of the limb (Chiang et al., 1996). In addition to the ZPA, a second signaling center, the apical ectodermal ridge (AER), is necessary for the outgrowth of th e limb (Saunders JW, 1948). Fi broblast growth factors (FGFs) expressed in the AER are necessary for the maintenance of Shh expression in the ZPA (Niswander et al., 1994). Conversely, S HH in the ZPA is capable of regulating Fgf4 expression and functions in a positive feedback loop that promotes the outgrowth of the limb (Laufer et al., 1994; Niswander et al., 1994). The bone morpho genetic protein (BMP) antagonist gremlin is induced in the limb bud mesenchyme in response to low levels of BMP2 (Nissim et al., 2006) and prevents the Bmp -mediated regression of th e AER (Ganan et al., 1998) It has recently been shown that descendants of Shh-expressing cells do not express gremlin (Scherz et al., 2004). As the limb bud grows, a wedge of grem lin-negative cells forms between the Shh-expressing cells of the ZPA and the Fgf -expressing cells of the AER. This results in the eventual breakdown of the ShhFgf feedback loop and the termination of limb outgrowth. By irreversibly marking the descendants of Shh-expressing cells using the Shhgfpcre allele (Harfe et al., 2004) and a lacZ reporter allele (Soriano, 1999), we have previously shown that the most posterior digits arise from cells that expressed Shh in the ZPA (Harfe et al., 2004). The identities of digit 4 and digit 5, which are comp letely derived from cells that have expressed Shh, are specified by the duration of thei r exposure to SHH. Cells giving rise to digit 5 are exposed to high concentrations of SHH for a longer period of time than those giving rise to digit 4. In contrast, specification of digit 2 is determined only by the concentration of SHH that has diffused across the limb field. Digit 3 is composed of a mixture of cells, some of which have actively expressed Shh and some that have only responded to SHH protein (Harfe et al., 2004).

PAGE 16

16 Consistent with the data from Shh null mice (Chiang et al., 1996) digit 1 specification is Shhindependent. Identifying Additional Genes Expre ssed During Mouse Limb Development To date, Shh is the only gene known to be specif ically expressed in the ZPA of the verteb rate limb. Initially, this work focuses on the identification of other genes expressed in the ZPA. These factors might be invo lved in the secretion or recep tion of SHH, serve as a cellular memory of previous exposure to SHH, regulate prol iferation and/or differentiation in the limb or function in other unforeseen pathways. To identify additional genes expressed in the ZPA, we used the Shhgfpcre allele (Harfe et al., 2004) in combination with fluorescence-act ivated cell sorting (F ACS) to purify two populations of cells from the mouse limb: one fr om the ZPA and one from the rest of the limb bud. From these populations, labeled cRNA was synthesized and hybridiz ed to Affymetrix GeneChips to identify genes differentially expres sed between the ZPA and the rest of the limb. Analysis of the microarray data identified a num ber of genes that might have higher levels of expression in the ZPA compared to the rest of the limb bud. From this list, we confirmed the expression of six genes with pr eviously unidentified expression in the mouse limb bud (Rock et al., 2007). The Role of TMEM16A in Vertebrate Develop ment One of the genes identified by this screen, Tmem16a, is a member of the evolutionarily conserved TMEM16 family of genes. The human ortholog, TMEM16A (other published names for this gene include TAOS2 FLJ10261, DOG1 ), is overexpressed in a variety of cancers including gastrointestinal stromal tumors (GIS Ts) and oral squamous cell carcinomas (OSCCs) (West et al., 2004) (Huang et al., 2006). The mouse ortholog of Tmem16a was identified on chromosome 7, but had not prev iously been characterized in vivo (Katoh and Katoh, 2003).

PAGE 17

17 We took a reverse genetics approach to elucidate the normal function of Tmem16a in vertebrate development by generating a null mouse allele in embryonic stem (ES) cells. All mice homozygous for this mutation die within one month of birth suggesting that Tmem16a is essential for normal development. Widespread embryonic expression of Tmem16a implies that a number of developmental proces ses might not occur normally in Tmem16a mutants; however, we focused on characterizing one defect in mice homozygous for this allele. C-shaped rings of hyaline car tilage normally surround the trachea and prevent its collapse during respiration. Reverse gene tic experiments in mice have de monstrated the involvement of several molecules in the developmen t of the cartilage rings including Shh (Miller et al., 2004), Traf4 (Regnier et al., 2002), FoxF1 (Mahlapuu et al., 2001) and retinoic acid (Mendelsohn et al., 1994; Vermot et al., 2003). Tracheal cartilage de fects in these models are accompanied by other defects and have not been investigated in detail. Therefore, the embryology of the tracheal cartilage is not well understood. We found that all Tmem16a mutant mice exhibit a severe disruption in the normal pattern of the cartilage rings that extends th e entire length of the trachea. Careful examination revealed that this disruptio n occurs as the result of a mechanical force exerted on the developing cartilage condensations from the tracheal epithelium that they encircle. In normal mouse development, the cells of the embryonic trach eal epithelium undergo stratification so that the epithe lium is 2-3 cell layers thick at E15.5 (Daniely et al., 2004). In Tmem16a mutants, the epithelium does not stratify pr operly and is instead only 1-2 cell layers thick. One consequence of this stratification defect is that the diameter of the tracheal tube is expanded and the epithelium evaginates into the surrounding mesenchyme. The aberrant epithelial evagination in Tmem16a mutants divides the normal ventrolateral population of

PAGE 18

18 chondrocytes into discontinuous populations that contribute to disrupted cartilage elements instead of rings. The TMEM16 Family of Proteins A single TMEM16 hom olog, IST2, is f ound in the genome of the budding yeast Saccharomyces cerevisiae. This protein has been found to sort asymmetrically during cell division and has been implicated in maintain ing osmotic homeostasis (Takizawa et al., 2000) (Entian et al., 1999). There ex ist in mice and humans 10 paralogs in the TMEM16 family of proteins (Katoh and Katoh, 2005) (Mizuta et al ., 2007). Very little data concerning the in vivo expression patterns and functions fo r these genes has been reported. We have investigated in deta il the expression pattern of Tmem16a during vertebrate development. We report that Tmem16a is expressed in tissues derived from all three germ layers. Examples of mesoderm-d erived tissues that express Tmem16a are the trachealis muscle dorsal to the trachea and the ZPA in the lim b. Endoderm-dervived tissues that express Tmem16a include the epithelia of th e trachea and lung. We also detected expression of Tmem16a in ectodermal derivatives including the skin and sensory epithelia of the re tina, inner ear, and olfactory epithelium. Tmem16a is expressed in a number of branched organs including the lung, submandibular salivary gla nds and lacrimal glands. A second signaling center in the limb bud, the apical ectodermal ridge, secretes members of the fibroblast growth factor family of proteins and is essential for outgrowth of the limb (Sun et al., 2002). We detected expres sion of a TMEM16 family member, Tmem16c specifically in the AER of the mouse limb. Gene trapped alleles are randomly generated in sertions of a selecti on cassette into the genome. We identified and obtai ned a gene trapped allele of Tmem16f a paralog of Tmem16a. We generated mice heterozygous for this allele, Tmem16fRRF355/+ and used expression of the -

PAGE 19

19 geo reporter construct under th e control of the endogenous Tmem16f regulatory elements to indirectly visualize expression of Tmem16f during mouse development. We observed galactosidase activity (and presumably expression of Tmem16f ) in bones developing via both intramembranous and endochondral ossi fication. We also performed RNA in situ hybridization to detect Tmem16f in a variety of embryonic tissues, ma ny of which overlapped with sites of Tmem16a expression. The expression of members of the TMEM16 fa mily of proteins is widespread during vertebrate development. In addition, orthologs of this family are conserved in organisms ranging from S. cerevisiae to humans. Together with the perinatal lethality observed in our Tmem16a mutants, this is strong ev idence that members of this family ar e essential to the development of a variety of structures during embr yogenesis. We have shown that Tmem16a might have a function in regulating cell morphology or cell:ce ll contacts in the embr yonic tracheal epithelium and two other family members, Tmem16e and Tmem16g, have been shown to influence cellular morphology as well (Tsutsumi et al., 2004) (Das et al., 2007).

PAGE 20

20 CHAPTER 2 IDENTIFICATION OF GENES EXPRESSED IN THE MOUSE LIMB USING A NOVEL Z PA MICROARRAY APPROACH One well-studied signaling center in the developing vertebrate limb, the zone of polarizing activity (ZPA), produces the morphogen sonic hedgehog ( Shh ) that is necessary for normal growth and pattern formation. To identify additional f actors expressed in th e ZPA of the mouse limb bud, the Shhgfpcre allele was used to purify ZPA cells using fluorescence-activated cell sorting. Microarray technology wa s then used to identify gene s whose expression was elevated in the ZPA compared to the rest of the limb. RNA in situ hybridization confir med the expression of two known transcription factors, Hlxb9 and Tcfap2b, an uncharacterized EST, and a transmembrane protein of unknown function in do mains overlapping the ZPA. The expression of two other genes was confirmed by rtPCR. An in vivo Screen to Identify Genes Expressed in the Mouse Z PA To purify ZPA cells from the lim b, limb buds were dissected from Shhgfpcre-heterozygous embryos (Figure 2-1). Mice heterozygous for this allele appear wild type and express green fluorescent protein (GFP) as well as the bacterial recombinase Cre in all cells that express Shh (Harfe et al., 2004). After dissociating the limbs into single cells, GFP-positive cells (the ZPA) and GFP-negative cells (the rest of the limb) were purified using fluorescence-activated cell sorting (FACS). Biotin-labeled cRNA was synthesized from each population of cells and hybridized to Affymetrix GeneChips. Analysis of the microarray data identified a number of genes that were differentially expressed in the ZP A and the rest of the limb (Table 2-1, Table 22, and data not shown). The raw data is ava ilable from the Gene Expression Omnibus of the National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/geo/ accession num ber GSE7598).

PAGE 21

21 Since our screen was designed to identify ge nes whose expression was enriched in the ZPA, we expected that Shh would be detected at higher levels in the GFP-positive cells. Indeed, this was the case; our array data indicated that Shh transcripts were more than 20 times as abundant in the ZPA cells than in the rest of the limb (Table 2-2). Other genes previously described as being present in the ZPA were al so identified by our screen. For example, Gli1 Bmp2 and Hand2 were all detected at highe r levels in the ZPA than in the rest of the limb. Our microarray data analysis of genes previously described as being expressed in the ZPA is summarized in Table 2-2. The identification of th ese genes suggested that our ZPA array screen might be capable of identifying novel genes expr essed in this specific region of the limb bud. In vivo Validation of Novel Gene s Identified in the Z PA To confirm in vivo that genes identified in our ZPA array screen were expressed in the limb bud, we performed whole mount RNA in situ hybridization for nine genes from our list of potential ZPA-specific genes (Table 2-1). None of these genes ha d been previously described in the embryonic day (E) 10.5 limb bud. Whole mount RNA in situ hybridization confirmed that four of these nine genes were expressed in dom ains overlapping the ZPA (Figure 2-2). For three of these genes, RNA in situ hybridization did not detect expr ession in the limb bud at E10.5, the stage at which the ZPA screen was performed (F igure 2-2F,J,N). Instead, for these genes, expression was first detected at E11.5 (Figure 2-2G,K,O). It is possible that these genes were expressed in the ZPA at E10.5 but were pres ent below the level of detection of RNA in situ hybridization. A second possibili ty was that some of the embryos pooled to generate cRNA might have been slightly older than E10.5 (see Experimental Procedures). Of the nine potentially ZPA-enriched gene s for which we performed whole mount RNA in situ hybridization, we were unable to detect th e expression of five in the limb bud. One explanation is that these genes were expressed in the limb bud, but present at levels below the

PAGE 22

22 detection limit of RNA in situ hybridization. It was also possibl e that these five genes were false positives. To determine if these genes were expressed in the limb bud, we performed rtPCR using RNA isolated from E10.5 forelimbs as star ting material. For two of these five genes, Ppp1cb and Ywhaz we detected transcription in the E10.5 limb bud (Table 2-1). Identification of Genes Expressed Outs ide the Z PA in the E10.5 Mouse Limb Bud In addition to identifying genes expressed at elevated levels within the ZPA, the ZPA screen also identified genes expr essed at higher levels outside of the ZPA. This list of genes contained some genes that had been previous ly characterized in the limb bud, for example gremlin (Zuniga et al., 1999), netrin (Puschel, 1999) and Sox9 (Asou et al., 2002) (Table 2-2), as well as genes that were not previously describe d in the E10.5 limb bud (Table 2-1 and data not shown). We confirmed by RNA in situ hybridization the expression of netrin and an EST selected at random from this class of genes (E ST BF583715; Figure 2-3A,B). In this report, we have focused on characterizing genes expressed in the ZPA. Our raw data, describing the entire transcriptome of the E10.5 mouse limb bud, has been made available from the Gene Expression Omnibus of the National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/geo/ accession number GSE7598). Genes with Expression in the ZPA Tcfap2b Analysis of the expression da ta ind icated that the gene Tcfap2b was expressed at levels nearly four times higher in the ZPA than in the rest of the limb (Table 2-1). Tcfap2b encodes a member of the AP-2 family of transcription fa ctors (Moser et al., 1997b) and had not previously been described in the limb. To confirm that the e xpression of this gene was elevated in the ZPA, we performed whole mount RNA in situ hybridization with an antisense probe homologous to the 3 end of the Tcfap2b transcript. Using this a pproach we first detected Tcfap2b transcripts in

PAGE 23

23 the distal posterior of the limb bud at E11.5 in a region that overlapped the ZPA (Figure 2-2G). The domain of Tcfap2b expression at E11.5 extended much more anteriorly than that of Shh in the distal mensenchyme of th e limb bud. Transcription of Tcfap2b continued until E12.5 with expression restricted to a very narrow posterior domain immediately ad jacent to the overlying ectoderm (Figure 2-2H). At this later stage (E12.5), Shh is no longer expressed in the limb (Figure 2-2D). Mice homozygous for a null allele of Tcfap2b have been generated. Tcfap2b homozygotes do not exhibit limb defects but di e shortly after birth w ith polycystic kidney disease (Moser et al., 1997a). Hlxb9 The gene Hlxb9 encodes the hom eodomain protein HB9. Transcription factors belonging to this family have a conserved DNA binding doma in and are involved in the regulation of many genes that control a number of cellular functions (Cillo et al., 2001). Homeodomain transcription factors have been well studied in normal development and in disease (reviewed in (Manak and Scott, 1994; Samuel and Naora, 2005)). HB9 has been shown to play essential roles in mouse pancreatic development (Harrison et al., 1999) and the establishment of motor neuron identity (Thaler et al., 1999). In our screen, Hlxb9 transcripts were detected at levels four times greater in the ZPA than in the rest of the limb (Table 2-1). Hlxb9 expression had not previously been reported during any stage of limb development. To confirm that Hlxb9 was expressed in the ZPA, we performed whole mount RNA in situ hybridization using an antisense probe with homology to the 5 end of the Hlxb9 transcript. RNA in situ hybridization confirmed that Hlxb9 expression was restricted to the pos terior of the limb at E11.5 in a domain indistinguishable from that of Shh (Figure 2-2K). Hlxb9 transcripts were not detected in the limb bud before (E10.5) or after (E12.5) by RNA in situ hybridization (Figure 2-2J,L).

PAGE 24

24 A targeted deletion of Hlxb9 in mouse embryonic stem cells has been generated (Thaler et al., 1999). Mice homozygous for this deletion are smaller than littermates, have a curled appearance, and die at birth of respiratory failure due to improper motor neuron specification (Thaler et al., 1999). These mice also exhibit de fects in pancreatic development, but have no reported limb abnormalities (Harrison et al., 1999; Thaler et al., 1999). In both mice and humans, Hlxb9 is located abou t 100kb upstream of Lmbr1 Intron 5 of Lmbr1 contains an enhancer element that is responsible for driving expression of Shh in the ZPA (Lettice et al., 2003). It is not known if this enhancer is also responsible for Hlxb9 expression in the ZPA. EST BI734849 A num ber of previously uncha racterized mouse expressed sequence tags (ESTs) were identified in our ZPA array screen. One of these, BI734849, was detected by RNA in situ hybridization at E11.5 in a narrow region of the posterior limb mese nchyme (Figure 2-2O). This expression domain did not extend to the anterior limit of the ZPA. An EST that partially overlapped with BI734849 but extended further 5 (AI853140) showed identical expression to BI734849 at E11.5 (data not shown). Expression of both ESTs persisted until E12.5 in a small domain in the proximal posterior of the deve loping autopod (Figure 2-2P). Although no protein product is reported from this locus, in silico translation yielded a protei n with weak similarity to murine axonemal dynein heavy chains (~65% cons ervation across 60 amino acids). The syntenic locus in humans encodes the putative non-coding RNA NCRMS (Chan et al., 2002). In addition, we have found that the microRNA miR-135-a2 lies within an intron of this transcript. Whether or not miR-135a-2 is expressed in the ZPA remains to be determined.

PAGE 25

25 Tmem16a Tmem16a encodes one m ember of a recently identified family of eight-pass transmembrane proteins (reviewed in (Galindo and Vacquier, 2005)). In addition to the nine reported members of this protein family, Tmem16aTmem16h and Trp53i5 (Katoh and Katoh, 2005), we have noted the existen ce of a tenth family member, Tmem16k (NM_133979). Although the TMEM16 family is highly conserved with homologs found in organisms ranging from S. cerevisiae to humans, the cellular functions of the 10 mammalian TMEM16 proteins are not known in any species. In our ZPA screen, Tmem16a transcript levels were elev ated 40 times higher in the ZPA than in the rest of the limb (Table 2-1). Whole mount RNA in situ hybridization confirmed that Tmem16a was expressed in the posterior foreand hindlimb mesenchyme at E10.5 and E11.5 (Figure 2-2R,S). The expression domains of Tmem16a and Shh partially overlapped at these stages in the limb bud, but Tmem16a expression was restricted to a more proximal and posterior domain than Shh. Tmem16a expression was not observed at E9.5 in the limb (when Shh is first detected) or at E12.5 (Figure 2-2Q,T). In addition to Tmem16a expression in the posterior limb bud mesenchyme, RNA in situ hybridization detected Tmem16a expression in a variety of embryonic structures (see Chapters 3, 4, and 5). Since TMEM16A is highly conserved at the pr otein level across species, it was of interest to determine if its expression pattern was also co nserved. A search of the chicken EST database for Tmem16a indicated that there was an ortholog of this gene in chickens. RNA in situ hybridization using a cTmem16a probe indicated that, similarly to the expression pattern in mice, cTmem16a was expressed in the chicken forelimb ZP A (Figure 2-3C). However, unlike the situation in mice, cTmem16a was not detected in the chick hindlimb.

PAGE 26

26 A previous cDNA microarray experiment identified the human ortholog of TMEM16A as a transcript expressed at elevated levels in gastrointestinal stroma l tumors (GISTs) (Nielsen et al., 2002). Human TMEM16A is on chromosome 11q13, a region fr equently amplified in esophageal cancer, bladder tumors, breast cancer (Katoh and Katoh, 2003), and oral squamous cell carcinomas (Huang et al., 2006). Murine Tmem16a was previously identif ied as the ortholog of human TMEM16A but its in vivo expression had not previously been investigated (Katoh and Katoh, 2003). Tcfap2b, Hlxb9 EST BI734840, and Tmem16a Are Expressed in Shh Null Limb Buds After identifying genes with expression dom ains overlapping the ZPA, we used rtPCR to determine if their expression was Shh-dependent or Shh-independent. cDNA was synthesized from E11 wild type and Shh null limb buds and used as template to amplify fragments of Tcfap2b, Hlxb9 EST BI734840, and Tmem16a. All four transcripts were amplified from wild type and Shh null limb bud cDNA (Figure 2-3D). These data suggest that transcription of Tcfap2b, Hlxb9 EST BI734840, and Tmem16a is independent of Shh signaling. Tmem16a E xpression in the Limb is Bmp-Independent but Requires Ectodermal Fgf Expression Members of the bone morphogenetic protein (B MP) family are essential for a number of developmental processes (Hogan, 1996). Recently, the removal of Bmp2 and Bmp4 from the limb mesenchyme was shown to result in soft tissue syndactyly and the loss of posterior digits in the forelimb (Bandyopadhyay et al., 2006). To determine if Tmem16a expression in the limb bud required BMPs, we analyzed expression of Tmem16a in limb buds in which both Bmp2 and Bmp4 had been removed from the mesenchyme. Tmem16a expression in Bmp2c/c;Bmp4c/c;Prx1-cre limbs was indistinguishable from the expression pattern observed in wild type littermates (Figure 2-4A,B).

PAGE 27

27 Two fibroblast growth factors, Fgf4 and Fgf8 are necessary for the initiation and outgrowth of the vertebrate limb (Boulet et al., 2004). Mice lacking both Fgf4 and Fgf8 in the AER were created using conditional alleles of Fgf4 and Fgf8 in conjunction w ith the ectodermspecific cre allele Msx2-cre (Sun et al., 2002). Mi ce that lack both Fgf4 and Fgf8 in the ectoderm fail to develop hindlimbs Interestingly, removal of these factors from the AER resulted in a complete loss of Tmem16a expression in the under lying hindlimb mesenchyme (Figure 2-4C,D). It has been shown that Msx2-cre expression in the forelimb occurs after expression of Fgf8 has been initiated and that deletion of Fgf8 with this cre allele leads to precocious expression of Fgf4 (Sun et al., 2002). We observed a wild type expression pattern of Tmem16a in Fgf4c/c;Fgf8c/c;Msx2-cre forelimbs (data not shown). Experimental Procedures Fluorescence-Activated Cell Sorting of GFPP ositive Cells from the E10.5 Limb Bud Mice heterozygous for the Shhgfpcre allele (Harfe et al., 2004) were crossed to wild type mice to generate heterozygous offspring. The morning a vaginal plug was found was considered E0.5. At E10.5, dams were sacrif iced by cervical dislocation and the embryos harvested in icecold phosphate buffered saline (PBS). Shhgfpcre heterozygotes expressi ng green fluorescent protein (GFP) in the ZPA were identified using a fluorescent dissection microscope. Forelimbs and hindlimbs from heterozygous embryos were dissected from the body, pooled and placed in 0.05% trypsin at 37C for 5 minutes. The limbs we re then triturated usi ng a Pasteur pipette to obtain a single-cell suspension. The cells were centrifuged at 1,800 rpm for 2 minutes and resuspended in 0.5 uM EDTA, 0.05% BSA in PBS for sorting. GFP-positive and GFP-negative cells were collected using a FACS Vantage SE TurboSort (BD Biosciences, San Jose, CA). Approximately 1,000 GFP-positive (ZPA) cells were obtained from each limb bud which corresponded to ~3% of the cells sorted. A total of four cell sorts were performed to produce

PAGE 28

28 four independent GFP-positive (ZPA cells) and GFP-negative (cells outside the ZPA) cell samples. Microarray Target Preparation, GeneChip Hybridization, and Data Analysis From each independent population of sorted cells, total RNA was isolated using the RNeasy Mini Kit (QIAGEN, Inc., Valencia, CA ) according to the manufacturers protocol. Sample integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA) to compare the relative amount s of 18S and 28S rRNA. For each sample, 50 ng of total RNA was used as the starting materi al in the Affymetrix Two-Cycle cDNA Synthesis kit according to the Affymetrix Eukaryotic Ta rget Preparation Manual (Affymetrix, Inc., Santa Clara CA). Following cleanup, biotin-labeled cRNA was synthesized using the Affymetrix GeneChip IVT Labeling Kit. For each samp le, 15 ug of labeled cRNA was fragmented and hybridized to an Affymetrix Mouse Genome 430 2.0 GeneChip at 45C for 16 hours. The GeneChips were washed and stained with a Gene Chip Fluidics Station 450 according to protocol EukGE Wsv4_450. A GeneChip Scanner 3000 was used to collect data into the GeneChip Operating Software (v1.3) using default parameters and global scaling as the normalization protocol. The trimmed mean target intensity wa s arbitrarily set at 500 for each GeneChip. This data has been made available from the Gene Expression Omnibus of the National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/geo/ accession num ber GSE7598). To identify genes differentially expressed between the ZPA and the rest of the limb bud, we carried out a modified t-test on log transformed expr ession values using a random variance model as implemented in BRB ArrayTools developed by Richard Simon and Amy Peng Lam. Whole Mount RNA in situ Hybr idization and Genera tion of Mutant Embryos Embryos were collected from tim ed matings for analysis by RNA in situ hybridization on E9.5, E10.5, E11.5, or E12.5. Embryos were fixed ove rnight at 4C in 4% paraformaldehyde in

PAGE 29

29 PBS. RNA in situ hybridization was performed as de scribed (Wilkinson, 1992). To analyze cTmem16a expression, HH19-24 chick embryos were harvested, fixed, and processed in an identical manner. The expressed sequence tags (ESTs) used to generate antisens e riboprobes for RNA in situ hybridizations can be found in Table 2-1. The plasmid used to generate the Shh riboprobe has been described previously (Echelard et al., 1993 ). The chicken EST chEST561F4 was used to generate a cTmem16a antisense riboprobe. Generation of conditional alleles of Bmp2 (Tsuji et al., 2006) and Bmp4 (Liu et al., 2004) has been reported. To analyze Tmem16a expression in limbs lacking mesenchymal Bmp2 and Bmp4, we crossed mice heterozygous for both conditional alleles that also carried a Prx1-cre transgene (Logan et al., 2002) to generate Bmp2c/c;Bmp4c/c;Prx1-cre offspring. Embryos were harvested at E10.5, genotyped as previously de scribed for each allele, and fixed for RNA in situ hybridization. Fgf4c/c;Fgf8c/c;Msx2-cre embryos, which lack Fgf4 and Fgf8 expression in the AER, were a kind gift from Xin Sun (University of Wisconsin, Madison, WI). rtPCR Analysis of Gene Expression To confirm the expression of genes from Ta ble 2-I we were unable to confirm by RNA in situ hybridization in the limb, wild type forelimbs were dissected into ice-cold TRIzol reagent (Invitrogen, Carlsbad, CA). RNA was isolated according to the manufacturers protocol. cDNA was synthesized using AMV reverse transcriptase (Roche Applied Science, Indianapolis, IN), oligo dT oligonucleotides, and 5 ug of total RNA. Oligonucleotid es used as PCR primers are listed in Table 2-3. To verify gene expression in Shh null embryos, forelimb buds were dissected from wild type or Shh null E11.0 embryos and cDNA was synthesized as above. Oligonucleotides used as PCR primers are listed in Table 2-3.

PAGE 30

30 Figure 2-1. Analysis of gene expression in Shh-expressing cells of the ZPA and the rest of the E10.5 limb bud. Limbs were dissected from E10.5 Shhgfpcre heterozygous embryos and dissociated into single cells (see Experimental Proce dures). GFP-positive (ZPA) and GFP-negative (rest of the limb) cell popu lations were purified by FACS. From these populations, labeled cRNA was synthesized and hybridized to Affymetrix GeneChips to compare whole-genome expr ession between cells of the ZPA and the cells of the rest of the limb. A total of ei ght GeneChips were used : four with purified ZPA cells and four with cells fr om the rest of the E10.5 limb bud.

PAGE 31

31 Figure 2-2. RNA in situ hybridization confirmed expression of four novel genes in the ZPA. Limbs from E9.5, E10.5, E11.5, and E12.5 wild type embryos were hybridized with probes corresponding to the list of genes w hose expression is enriched in the ZPA from Table 2-1. Shh expression data is shown for comparison (A-D). Tcfap2b (G and H) and BI734849 (O and P) transcript s were detected on E11.5 and E12.5. Hlxb9 expression was only observed on E11.5 (K). Expression of Tmem16a in the limb bud was observed in E10.5 and E11.5 limb buds (R and S).

PAGE 32

32 Figure 2-3. Further characteriza tion of microarray data. RNA in situ hybridization detected transcripts of netrin (A) and the EST BF583715 (B) in the E11.5 limb bud. Consistent with the microarray data, thes e transcripts were de tected in the limb bud but not in the ZPA. (C) cTmem16a expression was observed in the ZPA of chicken forelimbs (HH19 shown), but not in the hind limbs at any stage examined (HH19-24). (D) rtPCR demonstrated that expression of Tcfap2b, Hlxb9 EST BI734849, and Tmem16a occurs in both wild type and Shh null forelimbs from E11.0 embryos.

PAGE 33

33 Figure 2-4. Tmem16a expression in the limb is Bmp -independent but requires ectodermal Fgf expression. RNA in situ hybridization showed that the pattern of Tmem16a expression was not changed in E10.5 Bmp2c/c;Bmp4c/c;Prx1-cre (B) forelimbs when compared to wild type littermates (A). In contrast, Tmem16a expression was lost from the hindlimb AER in Fgf4c/c;Fgf8c/c;Msx2-cre embryos (D).

PAGE 34

34Table 2-1. Partial list of genes iden tified as enriched in the ZPA or out side of the ZPA in the E10.5 limb bud. Affymetrix Probe Set ID Annotation Geometric mean of intensities (GFP-negative/GFP-positive) p-value Probe Confirmed by in situ Confirmed by rtPCR Genes enriched in ZPA 1419473_a_at Cck 0.044 5.09E-05 BU560753 No 1459713_s_at Tmem16a 0.024 2.52E-03 BC006062 Yes 1436981_a_at Ywhaz 0.114 5.74E-03 BQ044210 No Yes 1420784_at Scn11a 0.11 7.15E-03 BG694370 No 1437418_at Ncrms 0.157 5.42E-02 BI734849, AI853140 Yes 1435670_at Tcfap2b 0.26 8.77E-02 AI585585 Yes 1436450_at D11Bwg0517e 0.313 1.12E-01 BU563678 No 1460299_at Hlxb9 0.223 1.27E-01 BE648171 Yes 1431328_at Ppp1cb 0.509 1.67E-01 CB723562 No Yes Genes enriched outside the ZPA 1424214_at 9130213B05Rik14.705 3.01E-03 BF583715 Yes Analysis of the array data resulted in the identification of a large number of genes differentially expressed between the ZPA a nd the rest of the limb bud. From this list, we chose 9 genes that were enriched in the ZPA and 1 ge ne that was enriched in the rest of the limb to confirm by RN A in situ hybridization. These genes were ranked by the probability that each is differentially expressed between the two cell populations (p-value). For those genes enriched in the ZPA, ratios of geometric means closest to zero suggest hi ghest expression levels in the ZPA compared to the rest of the limb. The ESTs use d to generate in situ riboprobes are shown.

PAGE 35

35 Table 2-2. Genes previously described in the limb identified by the ZPA screen. Affymetrix Probe Set ID Annotation Geometric mean of intensities (GFP-negative/GFP-positive) p-value Probe Genes enriched in ZPA 1422912_at Bmp4 0.125 2.22E-04 1436869_at Shh 0.047 4.46E-04 1422545_at Tbx2 0.25 8.14E-04 1450584_at Hoxd11 0.278 3.65E-03 1446812_at Hand2 0.388 1.78E-02 1439663_at Ptch1 0.187 2.44E-02 1422239_at Hoxd13 0.176 6.24E-02 1423635_at Bmp2 0.214 1.27E-01 1449058_at Gli1 0.636 2.56E-01 Genes enriched outside the ZPA 1454974_at Ntn1 66.635 3.80E-06 BE196965 1424950_at Sox9 18.883 6.26E-03 1425357_a_at Grem1 2.781 3.34E-02

PAGE 36

36 Table 2-3. Oligonucleotide primers used for rtPCR. Tcfap2b F 5'-CACTAACAGGCACACGTCTG-3' R 5'-CGTCTCAGTCAACCAGCTCTC-3' Hlxb9 F 5'-ATTTGGTTCCAGAACCGCCGAATG-3' R 5'-TGGTTGTCTCCAAAGGAGGGTTCA-3' BI734849 F 5'-CCAGAATGACTGTGTAGCTC-3' R 5'GAAGGATCTGCCAAGCTCAC-3' Tmem16a F 5' CAAGTTTGTGAACTCTTA R 5' TCGGGCGTGAGGCCGGCGAAAG Ppp1cb F 5' GAACGTGGACAGCCTCATCAC R 5' GATGCTAGCACACTCATG Ywhaz F 5' GACGCCGAGCTCGCGACTGG R 5' CATAACTGGATATTCTGTGTCC

PAGE 37

37 CHAPTER 3 DEFECTIVE TRACHEAL CARTILAGE RING FORM ATION CAUSED BY DELETION OF THE TRANSMEMBRANE PROTEIN TMEM16A Pathological collapsibility of the upper airways, known as tracheomalacia in humans, can occur either independently or in combination with other anomalies. Depending on its etiology and severity, the symptoms of tracheomalacia ra nge from respiratory stridor to fatal airway obstruction. Since the clinical pr esentations of tracheomalacia are so diverse, the condition is often misdiagnosed or not diagnosed at all and it s true incidence is not known. We determined that Tmem16a, a member of an uncharacterized evolut ionarily conserved family of predicted transmembrane proteins, is expressed in the epithe lium of the developing trac hea. To investigate the role of Tmem16a in tracheal development, we generated a null allele of this gene in mice. All mice homozygous for this null allele exhibited severe tracheomalacia with gaps in the tracheal cartilage rings along the entire length of the trachea. We show that the embryonic tracheal epithelium was im properly stratified in Tmem16a mutants and this caused an expansion of the tracheal lumen. The expanded epithelial tu be displaced chondrogenic condensations in the surrounding mesenchyme and caused the malformati on of the tracheal ca rtilage rings. These data identify Tmem16a as a novel regulator of epithelial organization in murine tracheal development. Furthermore, this mutant, th e first knockout of a vert ebrate TMEM16 family member, provides a mouse model of tracheomalacia. Introduction The m urine respiratory system is first recogn izable as two primary lung buds emerge from the ventral foregut endoderm on embryonic day (E) 9.5 (reviewed in (Cardoso and Lu, 2006)). These buds elongate and branch in a reiterative process, known as branching morphogenesis, to generate the distal respiratory tr ee. The foregut endoderm rostral to the site of the primary lung buds gives rise to two epitheli al tubes: the esophagus and trachea. The mechanisms governing

PAGE 38

38 the separation of these two tubes are not entirely cl ear, but errors in this process carry significant clinical implications in the form s of tracheoesophageal fistula a nd esophageal atresia (Que et al., 2006). C-shaped rings of hyaline cartil age encircle the ventrolateral surfaces of the mature trachea and prevent its collapse during re spiration. In humans, structural weakness of the trachea, known as tracheomalacia, results in collapse of the airway during respir ation (for reviews see (Carden et al., 2005; McNamara and Crabbe, 2004 )). Depending on the degree of tracheal collapse, symptoms range from respiratory stridor to fatal airway obstruction. The true incidence of tracheomalacia is not known because many of its symptoms overlap with those of other pulmonary disorders and it is often misdiagnosed ; however, estimates range from 1 in 2,600 to 1 in 1,445 births (Boogaard et al., 2005; Carden et al., 2005). In some instances, tracheomalacia arises through developmental malformation of the trachea itself; this conge nital form is known as primary trachemalacia (reviewed in (Carden et al ., 2005)). Examples of primary tracheomalacia include defects in cartilage matrix production or the shortened cartilage elements observed in patients with tracheoesophageal fistula. In other cases, classified as secondary tracheomalacia, the cause of tracheal collapse is extrinsic to the trachea. Exam ples of secondary tracheomalacia include trauma and external pressure on the trachea from adjacent organs. In mice, the tracheal cartilage rings develop in the splanchnic me senchyme surrounding the trachea between embryonic day (E) 13.5 and E15.5 (Mille r et al., 2004). Very little is currently known about the embryology of the tracheal cartilag e rings, but reverse genetic experiments in mice have identified several genes that affect their development. These include Shh (Miller et al., 2004), Hoxa-5 (Aubin et al., 1997), Traf4 (Regnier et al., 2002), FoxF1 (Mahlapuu et al., 2001), Raldh2 (Vermot et al., 2003) and various retinoi c acid receptors (Mendelsohn et al.,

PAGE 39

39 1994). Unfortunately, the characterizations of th ese mutants have focused on other defects and the mechanisms underlying their tracheal cartilage malformations have not been investigated in detail. Tmem16a is a member of the TMEM16 family of proteins with ort hologs in organisms ranging from Saccharomyces cerevisiae to humans (Entian et al., 1999) (Katoh and Katoh, 2003). Human TMEM16A (other published names for this protein include DOG1 TAOS2 and FLJ10621) is amplified in a number of cancers in cluding oral squamous cell carcinoma and gastrointestinal stromal tumors (Huang et al., 2006) (West et al., 2004). Despite this evolutionary conservation and potential clinical significance, th e functions of the vertebrate TMEM16 proteins are unknown. We report that murine Tmem16a is expressed in the epithelium of the developing trachea and that mice homozygous for a null allele of Tmem16a failed to thrive during postnatal life. These mice exhibited severe primar y tracheomalacia with ventral ga ps in the tracheal rings along the entire rostrocaudal axis of the trachea. The cells of the tracheal epithelium in Tmem16a mutants were improperly organized during em bryogenesis and the trachea expanded into the surrounding mesenchyme. This abnormal expansion of the trachea partitioned the normal chondrogenic C-shaped rings into multiple chondrogenic condensations in Tmem16a mutants. This phenotype resulted in symptoms that mi mic those in humans with tracheomalacia. Results Tmem16a Is Expressed in the Tracheal Epithelium We perfor med whole mount and section RNA in situ hybridizations with an antisense riboprobe to detect Tmem16a transcripts during murine trach eal development. At E10.5 we observed Tmem16a expression throughout the epithelia of the foregut and primary lung buds (Figure 3-1A). Tmem16a expression continued in the proxi mal airway epithelium (trachea and

PAGE 40

40 conducting airways of the lung) at E11.5 and E12.5, but was absent from the distal tips of peripheral lung epithe lium at these stages (Figure 3-1B,C,D). At E14.5 and E16.5 Tmem16a expression was detected in cells of the trachea l epithelium (Figure 3-1E ,F). In addition to epithelial expression, intense si gnal was observed in the mese nchyme dorsal to the trachea (Figure 3-1D,E,F). This dorsal mesenchyme do es not form cartilage but instead forms the trachealis muscle which bridges the gaps in the cartilage rings. Tmem16a expression was not detected in the chondrogenic mesenchyme of the ventrolateral trachea at any stage examined (E10.5-E18.5). Tmem16a N ull Mice Fail to Thrive During Postnatal Life To investigate the functions of Tmem16a in vertebrate development, we generated a null allele of this gene by homologous recombination in murine embryonic stem (ES) cells (Figure 32A). Our targeting strategy removed 53 ami no acids of the second (of eight) predicted transmembrane domains and the extracellular loop between the first and second transmembrane domains. This strategy also induced a frameshift mutation 3 of the deletion, which resulted in the creation of a termination codon 40 amino aci ds downstream of the deletion. One correctly targeted ES cell clone was identif ied by Southern blot and these cells were used to generate chimeric animals by blastocyst injection. Germline transmission of this allele, Tmem16atm1Bdh, was confirmed by polymerase chain r eaction (PCR). Mice heterozygous for Tmem16atm1Bdh had no apparent phenotype and were mated to generate homozygous offspring. Greater than 90% of Tmem16atm1Bdh/tm1Bdh pups (hereafter referred to as Tmem16a mutants) died within the first nine days of postnatal life and no Tmem16a mutants survived longer than 30 days postpartum (Figure 3-2B and data not shown). Tmem16a mutants were born with the expected Mendelian frequency (19/81 or 27%) and newborn mutants had a body weight similar to that of wild type and heterozygous litte rmates (Figure 3-2C). However, Tmem16a null

PAGE 41

41 animals did not gain weight at the same rate as their littermates (Figure 32C). Three days after parturition, Tmem16a mutants weighed only ~65% as much as their littermates. Tmem16a nulls that survived 21 days postpartum weighed less than half as much as wild type littermates. Milk was observed in the stomachs of Tmem16a null pups suggesting that these pups were able to locate nipples and initiate suckling behavior. A portion of Tmem16a null pups developed grossly dist ended bellies within the first postnatal week. Varying amounts of air were encountered in the esophagi, stomachs, and intestines of all Tmem16a null pups upon sacrifice and subseque nt dissection (data not shown). This aerophagia was frequently a ssociated with a cyanotic appearance prior to sacrifice and suggested a defect in the development of the upper respiratory and/or digestive tracts in Tmem16a mutants. Neither gross no r histological examination of craniofacial development revealed any obvious patterning defects of the palate, tongue, larynx, or crania of Tmem16a null pups (data not shown). Tmem16a Mutants Exhibit Defects in Trache al Cartilage Ring Formation Because Tmem16a was expressed in the developing trachea and the m utant phenotype was consistent with an upper airway an omaly, tracheae were dissected from Tmem16a mutants and littermates and stained with alcian blue to examine cartilage elements. Ventral gaps were observed along the entire rostocaudal axis of mutant tracheae and the cartilage plates on the bronchi were also abnormally patterned (Figure 3-2D and data not shown). This phenotype was 100% penetrant in Tmem16a mutants; however, the pattern of rudimentary cartilage elements was variable. Transverse sections of Tmem16a mutant tracheae stained with alcian blue and eosin demonstrated multiple lateral cartilage condensations with intervening epithelial evaginations (compare Figure 3-2E and F). Development of the thyroid and cricoid cartilages was not disrupted (Figure 3-2D and data not shown).

PAGE 42

42 Chondrogenic Cells Are Present in the Ventral Mesenchyme of Tmem16a Muta nts Tracheal cartilage rings develop in the sp lanchnic mesenchyme surrounding the trachea between E13.5 and E15.5 (Miller et al., 2004). Expression of Sox9 a high mobility group transcription factor, has been re ported in cells fated to form cartilage in the peritracheal mesenchyme beginning at E9.0 (Elluru and Whitsett, 2004). Immunohistochemistry and RNA in situ hybridization revealed that Sox9 positive cells were present in the ventrolateral tracheal mesenchyme of both wild type and Tmem16a mutant embryos at E12.5 and E13.5 (Figure 33A,B,D,E and data not shown). This suggested that, similar to the situation in wild type, the ventral mesenchymal cells in Tmem16a mutants were specified to undergo chondrogenesis. However, at E14.5 the tracheal epithelium was no ticeably thinner and had evaginated into the ventrolateral mesenchyme of Tmem16a mutants. This evagination aberrantly partitioned the Sox9 positive cells into sepa rate populations (compare Figure 3-3C and F). The evagination of the tracheal epithe lium and disruption of the mesenchymal chondrogenic condensations was not due to ectopic cell death or cell proliferation. TdTmediated dUTP nick end labeling (TUNEL) did not reveal any apopto tic nuclei in mutant tracheae at any stage examined (data not shown) In addition, 5-bromo-2-deoxyuridine (BrdU) incorporation did not reveal a ch ange in the proliferative indice s of mutant tracheal mesenchyme (or epithelium) at E13.5 or E14.5 (data not shown). Sox9 has been shown to directly activate tr anscription of genes encoding cartilage components such as Col2a1 (Lefebvre et al., 1997) and aggre can (Sekiya et al ., 2000). In E15.5 wild type embryos, immunohistochemistry rev ealed a single population of type II collagen positive chondrocytes in a C-shaped ventrolateral ring (Figure 3-3G). In stark contrast, two or more type II collagen positive condensations we re observed at this stage in mutants with intervening epithelial evaginations (Figure 33H). These data together suggested that

PAGE 43

43 prechondrocytes were present in the mutant ve ntral tracheal mesenchyme but ultimately were redirected by an abnormal epithelium to c ontribute to disconnected lateral chondrogenic condensations. Increased Tracheal Circumference in Tmem16a Null Mice Epithelial ev aginations occurred alon g the entire rostrocaudal axis of Tmem16a mutant tracheae (Figures 3-2D,F and 3-3) and we reasoned this could result from an increase in the circumference of the epithelial tube. In additi on, the lumens of mutant tracheae appeared dilated in comparison to those of wild type tracheae (see Figures 3-3 and 3-4). To quantify this defect, we photographed transverse histolog ical sections of tracheae from Tmem16a mutants and littermates at E13.5 and E14.5 at the same rela tive rostrocaudal location. For each image, the luminal circumference of the trach ea was measured by outlining the ap ical surface of the tracheal epithelium using image analysis software (see E xperimental Procedures). At E13.5, the luminal circumference was nearly 40% greater in mutant s (n=2) than in wild type and heterozygous controls (n=2) (Figure 3-3I). This defect was even more se vere in E14.5 embryos where the epithelial circumference of Tmem16a mutants (n=2) was nearly 75% larger than heterozygous littermates (n=2) (Figure 3-3I). Ciliated Cells Are Absent from Evaginate d Regions of the Tracheal Epithelium The disorganization of Tmem16a mutant tracheal epithelium might have been attributable to abnormal differentiation of ep ithelial cell types. Ciliated co lumnar cells and non-ciliated secretory Clara cells are abundant in the mature tracheal epithelium of the mouse (Rawlins and Hogan, 2006). Although a population of p63-expressing cells is found in the wild type embryonic tracheal epithelium, mature basal cells are not establishe d until late gestation (Daniely et al., 2004). To assess differentiation, we immunol ocalized markers of ep ithelial cell types in mutant and wild type newborn tracheae.

PAGE 44

44 Acetylated a-tubulin is localized to the cilia on the apical surfaces of epithelial cells in the trachea (Gomperts et al., 2004). Immunofluorescence on newborn w ild type trachea sections revealed an even distribution of ciliated cells around the tracheal epithelium (Figure 3-4A). In Tmem16a mutant trachea, we observed ciliated cells in the tracheal epithelium with a relatively normal distribution (Figure 3-4B); the one exception was the evaginated epithelium that persisted until birth. These regions of the mutant tracheae were conspicuously devoid of ciliated cells (arrow in Figure 3-4B). Since ciliated cells were present throughout most of the mutant trachea, we propose that this is the result of the juxtapos ition of two apical surf aces and not a defect in specification of the ciliated lineage. Apical lo calization of ezrin, a memb er of the ERM (ezrin, radixin, moesin) protein family, precedes the formation of cilia in tracheal epithelium in airliquid interface conditions (Huang et al., 2003). We observed normal apical distribution of ezrin in ciliated cells of Tmem16a mutants (data not shown). Clara cells of the murine tracheal epithelium can be identified by the presence of the secretoglobin Scgb1a1 (Perl et al., 2005). We detected Clara cells throu ghout the tracheal epithelium of newborn wild type and Tmem16a mutant pups (Figure 3-4A,B). In particular, we detected Scgb1a1 -expressing cells in regions of trachea that had unde rgone abnormal epithelial evagination. In the mature pseudostratified epithelium of the mouse trachea, a popul ation of basal cells can be identified by their expres sion of the transcription factor p63 (Daniely et al., 2004). As a multipotent progenitor cell type of the proximal airways, basal cel ls are capable of restoring tracheal epithelial cell diversity following injury (Hong et al., 2004). In newborn mice, we observed a normal distribution of p63+ basal cells in Tmem16a mutant tracheal epithelium (Figure 3-4C,D).

PAGE 45

45 Embryonic Tracheal Epithelium Stratification Is Lost in T mem16a Mutants Since we did not observe a change in proliferation, apoptosis or differentiation in Tmem16a mutant tracheal epithelium, we reasoned that the luminal expansion could result from an abnormal arrangement of epith elial cells. The mid-gestatio nal tracheal epithelium of the mouse is reported to comprise 2 to 3 cell la yers (Daniely et al., 2004). To assess tracheal epithelium organization in Tmem16a mutants, we performed immunofluorescence on transverse sections of Tmem16a mutant and wild type trachea with a Cdh1 antibody to iden tify basolateral epithelial cell plas ma membranes. Sections were c ounterstained with 4',6-Diamidino-2'phenylindole (DAPI) to reveal nuclei. In contra st to the stratified epithelium of the E14.5 wild type trachea, a majority of the nuclei in the mutant tracheae were located adjacent to the basement membrane (Figure 3-4E-H). As a resu lt of this lateral arrangement of cells, the epithelium was observably thinner. These da ta support a mechanism in which the embryonic epithelium of Tmem16a mutants fails to achieve proper stratifi cation and, as a result, an increase in epithelial circumference and expa nsion of the tracheal lumen occurs. Discussion Abnormal Morphogenesis of the Tracheal Epithelium in Tmem16a Mutants We report th at mice lacking the transmembran e protein TMEM16A demonstrate defects in organization of the tracheal epithelium during embryogenesis. The cells of the epithelium fail to stratify and most nuclei are located in close proximity to the basement membrane. The defective stratification is not the result of a global loss in apicobasal polarity or improper localization of proteins to the apical surf ace; in ciliated cells of Tmem16a mutant tracheae, both the cilia and the cytoskeletal linker protein ezrin we re properly localized to the apic al surface. Furthermore, we demonstrated normal differentiation of Clara cells ciliated cells, and basal cells in mutant tracheae.

PAGE 46

46 Previous experiments have shown that or iented and asymmetric cell divisions are necessary for stratification of the skin (Lechler a nd Fuchs, 2005). One possibility is that similar asymmetric cell divisions are also necessary fo r tracheal epithelial stra tification and require TMEM16A. In support of this hypothesis, IST 2, the only TMEM16 orthol og identified in the yeast Saccharomyces cerevisiae has been shown to sort asymmetrically during budding (Takizawa et al., 2000). This protein, however, is distantly related to TMEM16A and does not necessarily share the same function or distribution. One vertebrate paralog of TMEM16A, TM EM16E, has been localized primarily to intracellular membranes in cultures of myot ubes (Mizuta et al., 2007). For the paralog TMEM16G (also known as NGEP), one splice isoform has been reported in tracellularly while a second isoform has been identified on the plas ma membrane (Bera et al., 2004). These data suggest that TMEM16A may functi on either at an intracellular membrane and/or at the plasma membrane. If TMEM16A does function at the plasma membrane, it is possi ble that this protein plays a role in mediating cell-cell contacts or intercellular communication. Interestingly, the paralog TMEM16G has been shown to promote a dhesion between LNCaP cells in culture where it is localized to the apical a nd lateral surfaces (Das et al., 200 7). A loss of adhesion between Tmem16a mutant cells could explain the lateral arrange ment of cells and lack of stratification of Tmem16a mutant trachea epithelium. A Novel Etiology for Tracheomalacia in a Murine Model The for mation of tracheal cartilage rings norma lly occurs in the ventrolateral mesenchyme around the tracheal epithelium during mid-embryoge nesis. One consequence of the improper organization of Tmem16a mutant tracheal epithelium was an expansion of the epithelial circumference. This, in turn, caused evaginati ons of the tracheal epith elium into the surrounding mesenchyme that disrupted the chondrogenic condensations of the tracheal cartilage rings.

PAGE 47

47 Instead of the C-shaped rings required to prevent the trachea from co llapsing during normal respiration, multiple cartilaginous rudiments formed along the entire length of the trachea. This abnormal arrangement of tracheal cartilage contribut ed to the aerophagia, cy anosis, and failure to thrive of postnatal Tmem16a mutants. In humans, tracheoma lacia is exacerbated by esophageal expansion during feeding and can lead to a failure to thrive similar to what we observed in Tmem16a mutant mice (Ahel et al., 2003). In mice, previous reports have concluded th at deletion of factors from the tracheal epithelium can result in malformation of the tr acheal cartilage rings by disrupting paracrine signaling to the surrounding mesenchyme (Miller et al., 2004; Regnier et al., 2002). We propose that in addition to this established role of paracrine signaling between the epithelium and mesenchyme, the physical interact ion of these two tissues also drastically affects tracheal development. We propose that tracheomalacia in Tmem16a mutants is the result of mechanical force exerted by an abnormal epithe lial tube during development of the tracheal cartilage rings in the surrounding mesenchyme. In humans, the diagnosis of tracheomalacia is complicated because its symptoms overlap with those of other pulmonary di sorders and there is no single etiology for this condition. In many cases of tracheomalacia, the condition is self-limiting and conservative treatment is favored (Carden et al., 2005; Green holz et al., 1986). In more se vere cases, treatment including ventilation and surgery are required. In addition to identifying a novel etiology for tracheomalacia, the Tmem16a mutant mice provide a murine model of severe primary tracheomalacia that could be used to aid in the diagnosis and treatm ent of this condition. Currently, very little is known about th e embryology and molecular biology of normal tracheal development. We demonstrate that ther e is a requirement for stratification of the mid-

PAGE 48

48 gestational tracheal epithelium in normal development and identify Tmem16a as a novel mediator of this process. Furthermore, we show that TMEM16A is required for normal development of the tracheal cartilage rings and that loss of this protein results in tracheomalacia. Experimental Procedures Generation of a Null Allele of Tmem16a Ar ms of homology flanking exon 12 of Tmem16a were PCR amplified from CJ.7 ES cell genomic DNA and cloned into an ES cell targeti ng vector containing a fl oxed PGK-neo cassette. The linearized targeting construct was electropo rated into 129S1/SvImj derived CJ.7 ES cells (Swiatek and Gridley, 1993) and targeted clones were enriched for by selection with Geneticin (Invitrogen, Carlsbad, CA) and FIAU (Moravek Bi ochemicals, Brea, CA). Southern blotting confirmed the correct targeting of one ES cell line that was used to generate chimeras by blastocyst injections. Germline transmission of the correctly ta rgeted allele was confirmed by PCR. All experiments were approved by and pe rformed according to the regulations of the Institutional Animal Care and Use Comm ittee of the University of Florida. Dams or pups were sacrificed by cervical location or carbon dioxide asphyxiation, respectively, and embryos or tracheae were isolated in PBS prior to fixati on overnight at 4C in 4% paraformaldehyde. Samples were dehydrat ed, infiltrated with HistoWax (Leica Microsystems, Bannockburn, IL), and embedded in pa raffin. 7m sections were cut on a rotary microtome. Alcian Blue Staining of Cartilage Whole trach eae or dewaxed and rehydrated 7m paraffin sections were stained in 0.03% alcian blue (Fisher Scientific, Pittsburgh, PA) in 25% glacial acetic acid in ethanol. Whole mount samples were cleared by immersion in KOH and gl ycerol. Sections we re counterstained in eosin, dehydrated, and mounted.

PAGE 49

49 RNA in situ Hybridiz ation RNA in situ hybridizations were performed on whole lungs or 14m cryosections according to an adapted standard protocol (Nieto et al., 1996). The plasmid used to generate antisense probe for Tmem16a has been described previ ously (Rock et al., 2007). Immunohistochemistry and Immunofluorescence Sections were dewaxed and rehydrated. Antig en retrieval was perf orm ed by microwaving slides for 20 minutes in 10mM citric acid (pH6.0) with 0.05% Tween-2 0 (Fisher Scientific, Pittsburgh, PA). Primary antibodies were from Santa Cruz Biotechnologies (Santa Cruz, CA) and were used at the following concentrations : Rabbit anti-Sox9 at 1:200 (sc-20095), goat antiCollagen Type II at 1:200 (sc-7764 ), goat anti-CC10 at 1:100 (s c-9772) (CC10 is also known as Scgb1a1), mouse anti-p63 at 1:200 (sc-8431). Other primary antibodies used included the following: rat anti-Cdh1 at 1:200 (U3254, Sigma, St. Louis, MO) and mouse anti-acetlyated atubulin at 1:100 (Ab24610, Abcam, Cambridge, MA). p63 was visualized using the MOM kit and Sox9 and Collagen Type II were visualized us ing VectaStain ABC kits (Vector Laboratories, Burlingame, CA) and metal-enhanced DAB (Pie rce Biotechnology, Rockford, IL). Sections were counterstained with eosin or Richards ons Azure II. Sec ondary antibodies for immunofluorescence were: Cy2-co njugated donkey anti goat, Cy3conjugated donkey anti-rat, and Cy3-conjugated donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA). 4',6Diamidino-2'-phenylindole (DAPI, Pierce Biotechnology, Rockford, IL) was used as counterstain. Image Acquisition and Measurement of Luminal Circumference Im ages were acquired using a Lecia DFC 300 FX camera or Leica TCS SP2 confocal system (Leica Microsystems, Bannockburn, IL). For luminal measurement, images of histological sections of wild type and Tmem16a mutant tracheae were visualized in ImageJ

PAGE 50

50 (National Institutes of Health). The apical epithelial surface for each image was traced and converted from pixels to m by measuring a micr ometer in an identical manner. Single litters were analyzed to minimize variation due to stag ing and processing. Data shown is average +/s.e.m.

PAGE 51

51 Figure 3-1. Tmem16a is expressed in the developing tracheal epithelium. A. RNA in situ hybridization on wild type E 10.5 cryosection demonstrated Tmem16a expression throughout the foregut endoderm and pr imary lung buds. Whole mount RNA in situ hybridization showed Tmem16a expression persisted in the epithelium of the trachea and conducting airways of the lung at E11.5 (B) and E12.5 (C). D. Section RNA in situ hybridization showed Tmem16a expression in the tracheal epithelium and the mesenchyme dorsal to the trachea (ast erisk in D) at E12.5. Expression of Tmem16a in the tracheal epithelium continue d at E14.5 (E) and E16.5 (F). Robust Tmem16a expression was also observed in the devel oping trachealis muscle at these stages (E,F). Tmem16a expression was also observed in the esophagus, aorta and thymus (D, E and data not shown). Abbreviations: Tr, trachea; Lb, lung bud; Es, esophagus; Ao, aorta; Th, thymus; Te, tracheal ep ithelium; Tm, trachealis muscle. Scale bars=100m.

PAGE 52

52 Figure 3-2. Tmem16a null mice die within the first mont h of life and do not complete normal tracheal development. A. Exon 12 of Tmem16a was replaced with a PGK-neo cassette by homologous recombination in embr yonic stem cells. XbaI cleavage sites are marked by an X. Red line indicates pr obe used for Southern blotting to assess targeting of ES cell colonies. Properly targeted ES cells generated a 9.5kb XbaI fragment; the wild type XbaI fragment was 12.5kb. B. Greater than 90% of Tmem16a null pups died within 9 days of birth. Tmem16a+/+ n=19, Tmem16a+/n=40, Tmem16a-/n=22. C. Tmem16a null pups failed to thrive in the postnatal period. Data shown is mean weight +/SEM. Tmem16a+/+ n=7, Tmem16a+/n=19, Tmem16a/n=8. D. Ventral view of whole mount tracheae from 3 day-old (P3) wild type and Tmem16a-/pups stained with alcian blue to reveal tracheal ca rtilage rings. Gaps are observed along the ventral aspect of mutant tracheae. Transverse sections of newborn Tmem16a-/trachea stained with alcian blue and eosin demonstrated multiple lateral cartilage elements with intervening epithelial evaginations instead of a single ventrolateral cartilage ring (compare E and F). Bar=100m.

PAGE 53

53 Figure 3-3. Tracheal lumen expansion in Tmem16a mutants redirects chondrogenesis in the surrounding mesenchyme. At E12.5 and E13.5, Sox9-expressing cells encircled the ventrolateral aspect of wild type (A,B) and Tmem16a mutant (D,E) tracheae. This distribution persisted in wild type tracheae at E14.5 (C). At E14.5, the epithelium of Tmem16a mutant trachea was thinner and evaginated into the surrounding mesenchyme (F, arrows mark evag inations disrupting mesenchymal Sox9 -positive condensations). A single population of chondr ocytes is present in the ventrolateral mesenchyme of the while type trachea on E15.5 as demonstrated by type II collagen immunohistochemistry (G). At E15.5, multiple chondrocyte populations were separated by epithelial evaginations in Tmem16a mutant tracheae (H). I. The tracheal lumen was expanded in Tmem16a mutants when compared to control lumens at E13.5 ( Tmem16a+/-) or E14.5 ( Tmem16a+/and Tmem16a+/+ combined). Data shown is average of two measurements +/s.e.m. for each data point. Scale bars=100m.

PAGE 54

54 Figure 3-4. Tmem16a mutant epithelium contains Clara, basal, and ciliated cells, but lacks embryonic stratification. A. Acetylated -tubulin and Scgb1a1 reveal distribution of ciliated (red) and Clara cells (green) resp ectively in wild type newborn tracheal epithelium. B. Ciliated (red) and Clara cells (green) were present in Tmem16a mutant tracheal epithelium. However, only Clara cells a nd no ciliated cells were found in regions of epithelial evagination (arrow). C and D. Basal cells are identified by p63 immunohistochemistry in the epithelium of newborn wild type (C) and Tmem16a mutant (D) tracheae. E. Cdh1 immunofluorescence and DAPI revealed epithelial cell membranes and nuclei, respectively, in wild type tracheal epithelium at E14.5. G. In wild type, the epithelium comprised 2-3 layers of cells. F. Cdh1 immunofluorescence reveals a thinner epithelium in Tmem16a mutant tracheae at E14.5 with aberrant stratification (1-2 ce ll layers thick) and an expanded tracheal lumen. G and H are increased magnification of E and F. Dashed lines delineate the epithelial layer. Scale bars A-D=50m; E,F=48m; G-H=16m.

PAGE 55

55 CHAPTER 4 THE TMEM16 FAMILY OF PROTEINS Mem bers of the TMEM16 family of proteins characteristically contain eight predicted transmembrane domains with Cand N-termini f acing the cytoplasm and a C-terminal domain of unknown function (DUF590 InterPro accession number IPR007632) (Katoh and Katoh, 2005) (Mizuta et al., 2007). One exception m ight be TMEM16G that is predicted to have 7 transmembrane domains (Bera et al., 2004). Very little is known about the in vivo expression patterns and functions of these ge nes. We have generated expr ession data for several murine TMEM16 genes and that data is reported here. Interestingly, we show that the expression of Tmem16a and Tmem16g overlap in multiple tissues. Although the precise functions of these proteins are unknown, at least th ree of the members of this family, TMEM16A, TMEM16E and TMEM16G, have influences on cell morphology (see Ch apter 3 of this dissertation, (Tsutsumi et al., 2004), and (Das et al., 2007)). Invertebrate TMEM16 Proteins A single homolog, IST2, is found in the genom e of the budding yeast Saccharomyces cerevisiae. In a high throughput screen of single gene mutations, IST2 mutants were shown to have a slightly increased toleran ce to elevated concentrations of environmental NaCl (Entian et al., 1999). IST2 transcripts (and mRNAs from at least 23 other genes) are transported to the daughter cell during budding (Takizaw a et al., 2000). In the daughter cell, IST2 is incorporated into the plasma membrane inde pendently of the classical secretory pathway (Takizawa et al., 2000). An ancestral form of TMEM16 might ther efore function at the plasma membrane to maintain osmotic homeostasis and is distri buted asymmetrically during cell division. Axs is one of four TMEM16 homologs reported in Drosophila melanogaster (Kramer and Hawley, 2003). AXS localizes to the endoplasmic reticulum and is recruited to the assembling

PAGE 56

56 spindle microtubules of female meiotic germ ce lls. Furthermore, females expressing a mutant Axs cDNA in the germline exhibit abnormal spindl e formation and an increase in the frequency of X chromosome nondisjunction (Kramer and Hawley, 2003). Vertebrate TMEM16 Proteins Ten paralogs of the TMEM16 fa mily are predicted in humans and mice: Tmem16a-h Tmem16k and Trp53i5 (Tmem16h is identified in (Kat oh and Katoh, 2005) and others are reviewed in (Galindo and Vacquier, 2005)). The remainder of this chapter will summarize what is known about the expression and functions of the vertebrate TMEM16 family members. In collaboration with Amel Gritli-Linde (Departmen t of Oral Biochemistry, Sahlgrenska Academy at Gteborg University, Sweden), we have characterized expression of Tmem16a, Tmem16c Tmem16f Tmem16h and Tmem16k during craniofacial development. This data is summarized in Appendix B but is not part of this dissertation. Tmem16a TMEM16A in cancer Gastrointestinal strom al tumors are currently diagnosed based on ac tivating mutations in the KIT tyrosine kinase receptor (West et al., 2004) These tumors are responsive to treatment with the receptor tyrosine kinase inhibitor ima tinib mesylate. Unfortuna tely, a portion of GISTs is not immunoreactive for KIT despite oncogenic mutations therein. In addition, some GISTs harbor mutations in the PDGFRA and might also respond to ima tinib mesylate treatment, but cannot be diagnosed by KIT immunoreactivity. Human TMEM16A was first identified in a cDNA microarray designed to characterize the expr ession profiles of different soft tissue tumors (Nielsen et al., 2002). In a subsequent tissue microarray study, 98% of GISTs were positively identified with a TMEM16A antiserum ( TMEM16A was named DOG1 in this study, Discovered on GIST-1) (West et al., 2004). Even those GI STs immunonegative for KIT were identified by

PAGE 57

57 TMEM16A immunoreactivity and so TMEM16A is cu rrently under investigat ion as a diagnostic and therapeutic tool for GI STs (Espinosa et al., 2008). Human TMEM16A is found at chromosomal location 11q13, a region frequently amplified in a variety of carcinomas incl uding those of the mouth, head, neck, esophagus, lung, bladder, and breast (Huang et al., 2006). Historically, 11q13 studies focused on two genes, cyclin D1 and cortactin, because of their known cellular functi ons and high levels of expression in tumors (Schuuring, 1995). The upregulation of TMEM16A expression has recently been shown to precede the amplification of this region in many oral squamous cell carcinoma primary tumors and cell lines, indicating that this gene might also have a function in the progression of 11q13 amplified tumors (Huang et al., 2006). Expression of murine T mem16a Despite the clinical relevance of TMEM16A very little is known about the mouse ortholog of this gene. We identified murine Tmem16a as a gene expressed spec ifically in the zone of polarizing activity during mouse limb development (Chapter 2 of this dissertation)(Rock et al., 2007). Another microarray experiment demonstrated a downregulation of Tmem16a in Runx2 null humeri at E14.5 (Hecht et al., 2007). That study also showed Tmem16a expression in the periosteum of the humeri of wild type mice. We performed RNA in situ hybridizations on cryosections and whole mouse embryos at various developmental stages to determine the in vivo expression pattern of Tmem16a. Tmem16a was widely expressed at all stages examined (E10.5-E18.5) and there is no apparent bias of Tmem16a expression toward cells of any particular origin or fate. At E10.5, Tmem16a expression was detected in the fo regut endoderm (Figure 3-1A), and the mesenchyme of the midand hindgut (data not shown). At E12.5, expression was robust in the mesenchyme of the developing stomach (Fig ure 4-1A) and the mesenchyme surrounding the

PAGE 58

58 esophagus (Figures 3-1D and 4-1A). This mesenchymal esophageal expression continued on E14.5 (Figure 4-1B,C), E15.5 (Figure 4-1D) a nd E16.5 (Figue 4-1H). Lower levels of Tmem16a expression were detected in the esopha geal epithelium at E16.5 (Figure 4-1H). Other sites of epithelial Tmem16a expression included the lung (Figures 3-1B,C, 4-1H, and 5-1), trachea (Figures 3-1, 4-1, and 5-1A,B), thym us (Figure 4-1C), vibr issae (Figure 4-1G), submandibular salivary gland (Fig ure 4-1J) and the lacrimal gla nds (Figure 4-1K). It is interesting to note that several of these epithelial structures are branched. In addition, specialized sensory epithelia expressed Tmem16a. These sites of expression included the retina (Figure 41E), the inner ear in the presum ptive organ of Corti (Figure 4-1F ), and the olfactory epithelium (data not shown). Tmem16a expression was previously reported in the periosteum of the humerus at E14.5 (Hecht et al., 2007). We detected Tmem16a expression in the periostea of a number of bones including the basioccipital at E15.5 (Figure 4-1D) and the scapul a and vertebrae at E16.5 (Figure 4-1I). The mesenchyme around the la rynx and rostral trachea expressed Tmem16a at E14.5 (Figure 4-1B,D). This mesenc hyme undergoes chondrogenesis to fo rm the persistent cricoid and thyroid cartilages. Also of mesodermal origin, the walls of blood vessels, including the aorta, expressed Tmem16a (Figure 4-1A,C,H). Tmem16c The apical ectoderm al ridge (AER) of the ve rtebrate limb bud produces members of the fibroblast growth family of protei ns that are essential for outgrow th of the limb (Boulet et al., 2004; Sun et al., 2002). We generate d an antisense probe to detect Tmem16c transcripts in mouse embryos. Expression of Tmem16c was observed specifically in the AER of the mouse limb by whole mount RNA in situ hybridization. Tmem16c expression was also detected in the somites at E10.5 by whole mount RNA in situ hybridization. Pr eliminary section RNA in situ

PAGE 59

59 hybridizations suggest that Tmem16c is expressed in the epitheliu m of the gut at E12.5, but the specificity of this result must be confirmed. Tmem16e Gnathodiaphyseal dysplasia is a hum an dis ease characterized by bone fragility and cemento-osseous lesions of the jawbone (Tsutsumi et al., 2004). TMEM16E was identified as a potential genetic determinant of gnathodiaphyseal dysplasia by li nkage analysis (TMEM16E is also called GDD1 gnathodiaphyseal dysplasia 1). Initiall y, two affected families with missense mutations in a cons erved cysteine of TMEM16E were characterized (Tsutsumi et al., 2004). This is the only member of the TMEM family that has been associated with a human disease other than cancer. An initial characterization of expression in adult mouse and human tissues demonstrated highest levels of TMEM16E expression in skeletal muscle and several bones including the calveria, femur, and mandible (Tsutsum i et al., 2004). Expression of murine Tmem16e was shown to increase during skeletal muscle differe ntiation in culture and de crease during osteoblast differentiation from a mesenchymal precursor cell line (Tsutsumi et al., 2005). Transfection of an epitope-tagged hTMEM16E construct resulted in localization of the tag to the endoplasmic reticulum. Interestingly, tr ansfection of the tagged gnathodia physeal dysplasia-causing (mutant) alleles resulted in an abnormal rounded cell morp hology and a decrease in adhesion (Tsutsumi et al., 2004). The expression of Tmem16e was recently characterized in detail during mouse development (Mizuta et al., 2007). Between E9.5 and E11.5, Tmem16e expression was reported in the myotomal compartment of the somite. At E12.5, expression was detected in skeletal muscle progenitors in the limb bud and the perichondrium of the vertebral bodies. In addition, Tmem16e expression was detected in the intervertebral disks along the entire rostrocaudal axis.

PAGE 60

60 At E14.5, Tmem16e expression was detected in the perichon dria of the developing tarsals/carpals and phalanges. Immunohistochemistry with an antibody recognizing TMEM16E demonstrated protein in the long bones of the limbs that was not detected at the R NA level. Hypertrophic chondrocytes, osteoblasts, and articula r chondrocytes demonstrated TMEM16E immunoreactivity in adult mice, but TMEM16E was restricted to prehypertrophic chondrocytes in late embryonic bones (Mizuta et al., 2007). This antibody also showed the presence TMEM16E in differentiated, multi-nucleated myotubes but not in mononuclear myoblasts in cu lture. Furthermore, increased levels of TMEM16E were detected in the skeletal muscle s of mice deficient for dystrophin (Mizuta et al., 2007). In cardiac muscle, TMEM16E was f ound in both the cytoplasm and within the sarcolemma. Fractionation experiments with this antibody demonstrated highest levels of TMEM16E protein in intracellular membranes of cultured myotubes (Golgi apparatus, secretory vesicles, endosomes, endoplasmic reticulum and trans-Golgi network) with lower levels on the plasma membrane (Mizuta et al., 2007). Tmem16f A gene trap allele of T mem16f In contrast to targeted deletions made in embryonic stem (ES) cells such as the one we constructed for Tmem16a, mutations generated by random insertions in ES cells are now available from public resources for a number of gene s. This approach is known as gene trapping. To generate a gene trapped ES cell line, an ES cell culture is either electroporated with a promoterless selection cassette (s uch as neomycin resistance) or transduced with a retrovirus carrying a selection cassette. In both cases, random integr ation of the transgenic construct into the genome will render its expression under the c ontrol of the endogenous cis-acting elements. Translation will fuse the transgene with any ups tream gene product from the endogenous locus.

PAGE 61

61 In some instances, depending on the location of insertion within a gene, this will produce hypomorphic (less functional) or nu ll (nonfunctional) alle le of the gene in which the insertion took place. The sites of such integrations are usually determined by 5 RACE and published in databases for distribution ( http://www.genetrap.org/ ). We obtained a gene trap ped allele of murine Tmem16f Tmem16fRRF355 (Figure 4-3A,B). Southern blot of ES genomic DNA confirmed integration of a -galactosidase/neomycin fusion construct ( -geo) had occurred in an intron of Tmem16f (Figure 4-3C). These cells were injected into blastocysts to generate chimeric animals. Germline transmission of the gene trapped allele was confirmed by PCR on tail DNA samples from the progeny of these chimeras. Embryos heterozygous for the gene trapped allele ( Tmem16fRRF355/+) were generated by breeding chimeras to wild type mice and sacrificing dams during pregnancy. The expression of -galactosidase is presumably under the control of the Tmem16f promoter and enhancer elements in Tmem16fRRF355/+ mice. Therefore, visualizing galactosidase distribution in these embryos is an indirect method of detecting the temporospatial pattern of Tmem16f expression. Using the chromogenic su bstrate X-gal, we determined the distribution of -galactosidase in E14.5 Tmem16fRRF355/+ mice. Developmentally speaking, bones arise by one of two mechanisms (reviewed in (de Crombrugghe et al., 2001)). During intramembr anous ossification, which occurs in many bones of the head, mesenchymal condensat ions differentiate di rectly into osteoblasts and deposit bone matrix. Endochondral ossification produces most bones of the body including the long bones of the limbs. In this process, mesenchymal conensations differentiate into cartilage intermediates that ultimately die and are invaded by osteoblas ts and vascularized (reviewed in (Provot and Schipani, 2005)).

PAGE 62

62 X-gal staining Tmem16fRRF355/+ embryos on E14.5 suggested that Tmem16f was expressed in a number of developing bones of the head including the maxilla, mandible, parietal, and zygomatic bones (Figure 4-4A). These bones arise from intramembranous ossification and do not involve a cartilage intermediate. Also in the head, X-gal staining was detected in the mesenchymal component of the submandibular gland (where we previously detected transcription of Tmem16a (Figures 4-4A and 4-1J). Interestingly, the centers of ossification in the long bones of the foreand hindlimbs also exhibited -galactosidase activity on E14.5 (Figure 44B). These bones arise by the process of endochondral ossification. Expression of Tmem16f was also detected in the developing ribs on E14.5 (Figure 4-4C). Tmem16f expression in the submandibula r gland and both types of bones, those arising by intramembranous ossificati on as well as those arising by endochondral ossification, suggests that Tmem16f might have a general role in mesenchymal organization or differentiation. Many bones did not exhibit Tmem16f expression detectable by X-gal staining (e.g. the phalanges) but might express other memb ers of the TMEM16 family of proteins with similar functions (Figure 44B and data not shown). It is not known if Tmem16fRRF355 is a null or hypomorphic allele of Tmem16f This is a possibility since th e insertion of the -galactosidase transgenic construct includes a termination codon and polyadenylation sequence 3 of -geo (Figure 4-3B). Inse rtion of this construct should result in the term ination of translation before 6 out of the 8 predicted transmembrane domains of TMEM16F. This termination is also 5 of the DUF590 domain that is conserved in all of the TMEM16 proteins. In the future, this a llele might be used to determine the function of Tmem16f in vertebrate development by generating Tmem16fRRF355/RRF355 mice.

PAGE 63

63 RNA in situ hybridiz ation analysis of Tmem16f expression We performed section RNA in situ hybridizations on mouse cryosections to further characterize the expression of Tmem16f in vivo. Interestingly, Tmem16f expression overlapped in a number or sites with the expression of Tmem16a. On embryonic day 16.5, expression of Tmem16f was detected in the periosteum of the vertebral bodies (Figure 4-5A). This expression has been described for Tmem16a (Figure 4-1I) and Tmem16e (Mizuta et al., 2007). Another si te of overlapping expression of Tmem16f and Tmem16a was the submandibular gland (compare figures 4-5B and 4-1J). The epithelium and lamina propria of the larynx expressed moderate levels of Tmem16f at this stage as did the epithelium and developing muscularis externa of the esophagus (Figure 4-5A). The dorsal root ganglia expressed high levels of Tmem16f at E16.5 (Figure 4-5A). A number of skeletal muscles and a subset of cells in the ve ntral spinal cord demonstrated Tmem16f expression at E16.5 (Figure 4-5A). Tmem16f expression was detected by RNA in situ hybridization on E14.5 in the epithelium of the lung and at lower levels in the mesenchyme of the lung (F igure 4-5C). At this stage, Tmem16a expression is apparently more proximally biased in the epithe lium of the lung while Tmem16f expression is detected more distally (compare Figures 5-1E,F and 4-5C). Tmem16f transcripts were also detected in the periostea of the vertebra l bodies at E14.5 (Figure 4-5C). Tmem16g A m icroarray screen (Kiess ling et al., 2005) and an in silico screen (Bera et al., 2004), both designed to identify prostate-sp ecific transcripts, identified TMEM16G (named D-TMPP and NGEP) as a gene transcribed specif ically in the prostate. One group went on to characterize two transcripts in both normal and cancerous prostate epithelial tissue and cell lines (Bera et al., 2004). Interestingly, they showed that a short transcript was localized intracellularly while a

PAGE 64

64 longer transcript was localized to the plasma me mbrane. In contrast to the eight predicted transmembrane domains of other TMEM16 family members, TMEM16G is predicted to comprise seven. This arrangement necessita tes that one terminus be extracellular. A polyclonal TMEM16G antibody was generated and used to localize TMEM16G to the plasma membranes of cancer cells (LNCaP) transf ected with a cDNA construct of the long TMEM16G transcript (Das et al., 2007) TMEM16G was also detected with this antibody in the epithelia of normal and malignant prostates. The plasma membrane localization of TMEM16G was most intense at regions of cell:cell contract. When TMEM16G was transfected into LNCaP cells, large clumps of cells formed and the cellu lar morphology of those cells not in clumps was drastically altered (cells became round and less spread out) (Das et al., 2007). Experimental Procedures RNA in situ Hybridiz ation RNA in situ hybridizations were performed according to an adapted standard protocol (Nieto et al., 1996). The genera tion of the antisense riboprobes used is summarized in Appendix C. Generation of Tmem16fRRF355/+ mice Gene trapped embryonic stem cell clone RRF355 was purchased from Bay Genomics (San Francisco, CA http://www.genetrap.org/ ). These cells were expanded according to standard culture technique. Targeting of the Tm em16f locus was confirme d by Southern blot. Briefly, RRF355 and wild type CJ-7 ES cell genomic DNA preparations were independently digested with EcoRV or XbaI and electrophoresed on agar ose gels. The digested genomes were then transferred to nitrocellulose membranes and prob ed with a radioactive probe corresponding to a region of the Tmem16f genomic sequence near the reported si te of insertion (synthesized from Harfe lab plasmid BH198).

PAGE 65

65 Once insertion of the transgenic construct into Tmem16f was confirmed, RRF355 ES cells were injected into blastocysts to generate chimer ic offspring. These chimeras were bred to wild type females to generate Tmem16fRRF355/+ mice that were identified by PCR using the oligonucleotides listed in Appendix A. X-gal Visualization of -galactosidase To perform X-gal visualization -galactosidase distribution in vivo, embryos were isolated on E14.5 and fixed overnight at 4C in 0.2% PFA. Embryos were washed in PBS and concentrated lacZ rinse buffer prior to staining in X-gal according to standard protocol at room temperature for 16 hours.

PAGE 66

66 Figure 4-1. Tmem16a is widely expressed during mouse development. Abbreviations: Es, esophagus; Tr, trachea; Ao, aorta; St, stom ach; UR, urogenital ridge; LC, laryngeal cartilages; Th, thymus; Ph, pharynx; Bo, basi occipital bone; Re, retin a; IE, inner ear; RS, root sheath; Lu, lung; At, atrium; Sc, scapula; Ve, vertebra; SG, submandibular gland; LG, lacrimal gland. Scale ba rs: A-E,H=100m, F,G,J,K=50m, I=200m.

PAGE 67

67 Figure 4-2. Tmem16c is expressed in the mouse embryo. A. Whole mount RNA in situ hybridization showing Tmem16c expression in the apical ectodermal ridge at E10.5 B. RNA in situ hybridization showing Tmem16c expression in the somites and neural tube on E10.5. Abbreviations: A, anterior ; P, posterior; R, rostral; C, caudal.

PAGE 68

68 Figure 4-3. Tmem16fRRF355/+ is a gene trapped allele of Tmem16f A. A portion of the endogenous murine Tmem16f locus. B. Gene trapped allele Tmem16fRRF355/+ showing insertion of -geo in the intron between exons 12 and 13. C. Southern blot of wild type (CJ.7) and Tmem16fRRF355/+ embryonic stem cell genomic DNA digested with EcoRV or XbaI and probed with p robe 1. A second, smaller band in the Tmem16fRRF355/+ lane digested with EcoRV sugge sted the introduction of an EcoRV cleavage site in this fragment by insertion of the -geo cassette. Probe 1 is Harfe lab plasmid BH198. Primers used to genotype al leles are shown by arrows and listed in Appendix A. Abbreviations: X, XbaI clea vage site; RV, EcoRV cleavage site; B, BamHI cleavage site; En2, engrailed 2 intron sequence included in selection cassette; SA-geo, splice acceptor and fusion of coding sequences of neomycin resistance and -galactosidase; p-a d, poly-adenylation.

PAGE 69

69 Figure 4-4. X-gal staining of Tmem16fRRF355/+ embryos at E14.5. A. -galactosidase activity was detected in bones of the head forming via intramembranous ossification and the submandibular gland. B. -galactosidase activity was detected in the radius, ulna, and humerus developing via endochondral ossification. C. The ribs of E14.5 Tmem16fRRF355/+ demonstrated -galactosidase activity at E14.5. Abbreviations: par, parietal; max, maxilla; zyg, zygomatic; man, mandible; smg, submandibular gland; hu, humerus; ra, radius; ul, ulna; r, rib.

PAGE 70

70 Figure 4-5. Tmem16f expression in the mouse embryo detected by RNA in situ hybridization. A. Tmem16f expression in a transverse cryosec tion of an E16.5 mouse embryo. B. Cryosection of mouse submandibular gland on E16.5 showing expression Tmem16f C. Tmem16f expression at E14.5. Abbreviations : Ve, vertebral body; DRG, dorsal root ganglion; Es, esophagus; La, larynx; SG, submandibular gland; Lu, lung; At, atrium. Scale bars A=200m, B,C=100m.

PAGE 71

71 CHAPTER 5 IMPAIRED POSTNATAL LUNG DEVEL OPMENT IN TMEM16A MUTANT MICE Introduction The m ammalian lung is intricately patterned during development as one strategy to efficiently exchange the volumes of gases necess ary to support metazoan life on land. In mice, lung development is initiated a pproximately 9.5 days after con ception and conti nues well into postnatal life as the surface area for gas exchange increases through the process of alveolarization and the lung re sponds to environmental cues (Warburton et al., 2000) (Burri, 2006). Two epithelial buds evaginate from the ventral foregut endoderm and grow into the surrounding splanchnic mesenchyme around embr yonic day (E) 9.5 (Warburton et al., 2000). These epithelial buds and surrounding mesenchyme signal to one anothe r in a series of iterative branching events during the pseudoglandular stag e of lung development (E9.5-E16.5) that result in a tree-like organ with larger conducting airway s rostrally and successively smaller airways at the periphery. Branching morphogenesis continue s in mice until the most distal epithelial buds dilate into terminal saccules during the canalic ular and saccular stages of lung development (E16.5-E17.5 and E15.7-P5, respectively). The mesenchyme is reduced and the epithelium flattens in intimate juxtaposition to a capillary ne twork to facilitate gas ex change. In both mice and humans alveolarization occurs postnatally (P5-P30 in mice) as septae subdivide these terminal saccules into hundreds of millions of alveoli (Burri, 2006). The cyanotic appearance of Tmem16a null embryos and the expression of Tmem16a in the developing lung led us to speculate that there might be a lung defect in Tmem16a mutants (see Chapter 3 of this dissertation). We found that Tmem16a mutant lungs failed to complete the process of alveolariza tion after birth. By P3, those mu tants surviving demonstrated an

PAGE 72

72 emphysematous phenotype characterized by distal ai rway enlargement. However, malnutrition has been reported to cause emphysema in humans and animal models (reviewed in (Kalenga, 1997)) and so the emphysema observed in Tmem16a mutants might be a consequence of their failure to thrive. We did not obser ve any defects in differentiation in Tmem16a mutant lungs. Results Tmem16a is Expressed in a Dynamic Pattern in the Developing Murine Lung As described previously in this di ssertation, whole m ount and section RNA in situ hybridizations detected Tmem16a expression in the epithelium of the trachea and the primary lung buds from E10.5-E12.5 (Figures 3-1 and 51A,B). Expression was observed in the proximal conducting airways at E11.5 and E12.5, but was absent from the distal tips of the epithelial buds. Whole mount RNA in situ hybridization revealed a similar pattern of Tmem16a expression in E13.5 lungs (Figure 5-1C,D). To determine the expression pattern of Tmem16a in highly branched E14.5 lungs, we performed RNA in situ hybridization on cryosec tions of wild type lungs. At this stage, Tmem16a expression was detected most strongly in the epithelium of branchpoints and the epithelium between branchpoints and the most dist al epithelium of the buds (Figure 5-1E,F). Low levels of Tmem16a expression were occasionally obser ved in the epithelium of more proximal conducting airways but expression was ne ver observed in the most distal dilated terminal buds. In stark contrast to earlier stages of development, RNA in situ hybridization on E18.5 lung cryosections revealed Tmem16a expression biased to the most di stal epithelium (Figure 5-1G,H). At high magnification, it is apparent that a subset of distal epit helial cells expresses Tmem16a at high levels (Figure 5-1I). Tmem16a expression was not detected in the mesenchyme of the lung at any stage examined.

PAGE 73

73 Tmem16a Mutant Lungs Fail to Develop Alveoli After birth, the term inal saccules of the l ung undergo the process of alveolarization in order to increase the surface area available for gas exchange (Prodhan and Kinane, 2002) (Burri, 2006). At birth, the lungs from Tmem16a mutants were histologically indistinguishable from those of wild type animals (compare Figure 52 A and D). This suggested that branching morphogenesis and the formation of terminal sa cs had occurred normally in the absence of Tmem16a. At P3, we noticed a thinning of the parenchyma in the lungs of Tmem16a mutants accompanied by a decrease in the number of septae (compare Figure 5-2B and E). Although most Tmem16a mutants die within 9 days of birth (see Chapter 3), those surviving 21 days exhibited a severe disruption in alveolar formation (compare Figur e 5-2C and F). To determine the cause of this defect, we characte rized apoptosis and proliferation in Tmem16a mutants before birth (at E18.5), but were unabl e to identify any change from the wild type condition. We observed an increase in apoptosis at P3 in mutant lungs, but reasoned that this might be secondary to their failure to thri ve (data not shown). Caloric re striction in mice has been shown to trigger cell death in alve oli via a variety of pathwa ys (Massaro et al., 2004). Differentiation Is Not Affected in Tmem16a Mutant Lungs The m ature lung is reported to comprise at least 40 morphologically distinct cell types (Warburton et al., 1998). To further characterize the emphysem atous defect we observed in Tmem16a mutant lungs, we immunohi stologically characterized differentiation of the major cellular constituents of the lung. In the most dist al airways of the lung, th e alveoli, there exist two epithelial cell types. The squamous type I alveolar epithelial cells (AEC) are the primary sites of gas exchange and cover 95% of the alve olar surface area (Berthiaume et al., 2006). The cuboidal type II AECs, among othe r functions, synthesize and secr ete pulmonary surfactant that

PAGE 74

74 is essential to the normal physiology of the l ung (Fehrenbach, 2001). In addition, at least a subpopulation of type II AECs is a progenito r population in the mature lung capable of transdifferentiation into type I AECs in response to injury (Evans et al., 1975). To determine if type II AECs had a normal distribution in the lungs of Tmem16a mutants, we performed RNA in situ hybridizations with a riboprobe to th e surfactant associated protein C ( Sftpc ) (Warburton et al., 2000). Newborn Tmem16a mutant and wild type lungs had similar distributions of Sftpc -expressing cells at all stages examined (Figure 5-3A-F). As alveolarization proceded, Sftpc -expressing cells in wild type and mutant lungs became localized to the corners of alveoli, consistent with published type II AE C distribution (Bhaskaran et al., 2007). Although the number of type II AECs at P8 and P15 is apparently lower in Tmem16a mutant lungs than wild type, this was possibly a function of a general decrease in pa renchyma rather than a type II AEC-specific defect (Figure 5-3E,F). To addre ss this possibility, we performed Northern blots with RNA from postnatal wild type and Tmem16a mutant lungs and did not observe a reduction in the amount of Sftpc RNA (data not shown). T1 (also known as glycoprotein 38 or GP38) is a glycoprotein expres sed at high levels on the membranes of type I AECs (Eblaghie et al., 2006). We used an antibody to T1 in order to identify this cell type. Type I AECs visualized by this method lined the lungs of both wild type and mutant newborn lungs (Figure 5-4A,B). Nkx2.1 (also known as Titf1 or Ttf-1) is a homed omain transcription factor expressed in the lung and thyroid (both foregut endoderm deriva tives) and parts of the brain (Minoo et al., 1999). Late in gestation and postn atally, Nkx2.1 is detected in the nuclei of distal epithelial cells of the lung (type I and type II AECs). We detected Nkx2.1 positive cells by immunohistochemistry in control and Tmem16a mutant lungs at E18.5 w ith similar distributions

PAGE 75

75 and abundances (Figure 5-5A,B). Notably, the Nkx2.1 labeled nuclei in Tmem16a mutants were rounder than the oblong nuclei labeled in the wild type sample (compare Figure 5-5A and B). It is not presently clear if this is an artifact of tissue proces sing (i.e. infla tion fixation, see Experimental Procedures) or a real consequence of TMEM16A de ficiency in distal epithelial cells. The latter is an attractive possibility gi ven the effect of TMEM16A on tracheal epithelial morphology (see Chapter 3) and the influence of TMEM16E and TMEM16G on cellular morphology (Das et al., 2007) (Tsutsumi et al., 2004) At P3, we detected fewer Nkx2.1 positive cells in the lungs of Tmem16a mutants (Figure 5-5C.D). Simila rly to type II AECs, it is possible that this difference is attributable to a general decrease in lung parenchym a and is not specific to Nkx2.1-positive cells. During the alveolar stage of lung developm ent, a population of smooth muscle cells migrates into the nascent alveoli and synthe sizes elastin, the prim ary component of the pulmonary extracellular matrix (Lin dahl et al., 1997). The failure of this process in the absence of the PDGFRA results in a failure of alveolar septation. To localize this population of cells during terminal lung development of Tmem16a mutants, we performed RNA in situ hybridization with a probe for tropoelastin at P15. Although already emphysematous, tropoelastin-expressing cells were found in the alveoli of Tmem16a mutant lungs with relatively normal distribution (Figure 5-6B). Gas exchange in the lung necessitates an inti mate association between the alveoli and the capillary network. We used an antibody agains t PECAM-1 (platelet-endothelial cell adhesion molecule-1 or CD31) to immunofluorescently label endothelial cells in the lungs of Tmem16a mutants and wild type pups. The distribution of endothelial cells in the walls of the alveoli of Tmem16a mutants resembled that observed in wild type lungs at P7 (Figure 5-6C,D).

PAGE 76

76 More proximally in the lung, other types of epit helial cells are found. These include the non-ciliated secretory Clara cells and ciliated columnar epith elial cells (Rawlins and Hogan, 2006). We observed a normal distribution of Clara cells in the proximal airways of Tmem16a mutants by immunolocalizing the most abunda nt secretoglobin they synthesize, Scgb1a1 (also known as CC10 or CCSP) (Figure 5-6EF). Discussion Mamm alian lung development occurs in four di stinct stages (revie wed in (Warburton et al., 2000)). The rapid generation of millions of alveoli occurs primarily after birth in mice and humans and is essential to support life on land. A better understanding of this process will yield therapies for premature infants and might re veal unrecognized regenerative potential for emphysematous patients. Tmem16a mutant mice surviving into the postnatal alveolar stage of lung development do not complete alveolar septation. This septati on defect is not coupled with any defect in differentiation that we observed. Furthermore, we did not detect a prenatal change in proliferation or apoptosis of mutant lungs. It is possible that the postnatal failure to thrive of Tmem16a mutants contributes to their pulmonary emphysema. During World War II, physicians documented emphysema in starved humans a nd this phenomenon has been validated by a number of animal models (Kal enga, 1997). If the emphysema in Tmem16a mutants is coupled to their failure to thrive in the postnatal period, it is obvious that a number of other mutants with a similar combination of phenotypes warrant reevaluation. The emphysema observed in Tmem16a mutants might be a direct consequence of (or at least partly attributable to) the removal of Tmem16a from the lung. One way to assess this possibility is through the genera tion of a conditional allele of Tmem16a. Using a pulmonary epithelium-specific Cre (Perl et al., 2002) in co mbination with such a conditional allele would

PAGE 77

77 ablate Tmem16a specifically from the lung. Any defect observed in these animals would be the direct result of Tmem16a -deficiency in the lung; Tmem16a would be normally expressed in other tissues. It is worth noting that at least one other member of the TMEM16 family of proteins, TMEM16F, is expressed in the developing lung (F igure 4-5C). In the future, mice lacking multiple members of this family (that might have the same or similar functions) might contribute to the understanding of their functions in locations where they are coexpressed. Experimental Procedures Sample Collection and Preparation The generation of Tmem16a m utants was described previous ly (see Chapter 3). Following sacrifice, lungs were dissected from wild type or Tmem16a mutant embryos or pups. For histological and immunohist ochemical specimens, lungs were inflated with 4% paraformaldehyde to a transpul monary pressure of 20cm H2O for 30 minutes before fixation overnight at 4C in PFA and s ubsequent paraffin embedding accord ing to a standard protocol. Samples used for RNA in situ hybridizations were harvested in DEPC-treated PBS, fixed in 4% PFA overnight at 4C, and embedded for cryos ectioning according to a standard protocol. Samples used for PECAM immunofluorescence were fixed in a commercial zinc fixative (BD Biosciences, San Jose, CA) instead of PFA ove rnight at 4C prior to embedding in paraffin. RNA in situ Hybridiz ation RNA in situ hybridizations were performed according to an adapted standard protocol (Nieto et al., 1996). The genera tion of the antisense riboprobes used is summarized in Appendix C. Histology, Immunohistochemist ry and Immunofluorescence 7m sections were dewaxed and rehydrated. Hematoxylin and eosin was performed according to a standard protocol.

PAGE 78

78 For immunohistochemistry and immunofluoresce nce, antigen retrieval was performed by microwaving samples in 10mM citric acid pH 6.0 for 20 minutes. For immunohistochemistry, endogenous peroxidases were blocke d in 3% hydrogen peroxide. Primary antibodies used were: hamster anti-T1 (Developmental Studies Hybridoma Bank, used at 1:100), mouse anti-Nkx2.1 (Thermo Scientific, used at 1:50), rat anti-PECAM (BD Pharmi ngen, used at 1:500), and goat anti-CC10 (Santa Cruz Biot echnology, used at 1:100). T1 was visualized with TSA kit (Perkin Elmer) and metal-enhanced DAB (Pierce). Nkx2.1 was visualized w ith MOM kit (Vector Laboratories) and metal-enhanced DAB. S econdary antibodies used for immunofluorescence were Cy3-conjugated donkey anti-rat and Cy3-conjugated donkey anti-goat (Jackson Immunoresearch). Counterstains used were Richardsons Azure II (for T1 immunohistochemistry), eosin (for Nkx2.1 immunohistochemistry), and DAPI (Pierce Biotechnology, for immunofluorescence). Imag es were acquired using a Lecia DFC300 FX camera.

PAGE 79

79 Figure 5-1. Tmem16a is expressed in the developing lung. Whole mount RNA in situ hybridizations showing Tmem16a expression at A. E11.5, B. E12.5, and C. and D. E13.5. Notice expression of Tmem16a in the proximal, conducting airway epithelium but not in the most distal tip epithelia. E. Section RNA in situ hybridization showing expression of Tmem16a in the lung epithelium but not in the most distal epithelium. F. Higher magnification of E. G. Expression of Tmem16a in the distal epithelium of E18.5 lungs. H. Higher magnification of G. I. Higher magnification of H.

PAGE 80

80 Figure 5-2. Alveolar septation defect in Tmem16a-/mice. A-C. Paraffin sections from wild type or Tmem16a-/+ lungs stained at A. P0, B. P3, and C. P21 with hematoxylin and eosin to demonstrate normal alveolar se ptation. D. Histol ogical sections of Tmem16a-/lungs at P0 demonstrate normal prenat al lung development. At E. P3 and F. P21, the lung parenchyma was much thinner in Tmem16a mutants and the distal airways were larger, suggesting a failure in the septation of alveoli. Scale bar=50m.

PAGE 81

81 Figure 5-3. Type II alveol ar epithelial cells in Tmem16a mutant lungs. A-C. RNA in situ hybridization using a Sftpc probe identifies the normal di stribution of type II AECs at A. P0, B. P8, and C. P15. D-F. Sftpc -expressing type II AECS are found in the lungs of Tmem16a mutants at D. P0, E. P8, and F. P15.

PAGE 82

82 Figure 5-4. Type I alveol ar epithelial cells in Tmem16a mutant lungs. A. Immunohistochemistry shows the glycoprotein T1 on the membranes of type I AECs in wild type newborn lungs. B. A similar distribution of T1 in Tmem16a mutant newborn lungs suggests normal development of type I AECs had occurred. Scale bar=100m.

PAGE 83

83 Figure 5-5. Nkx2.1 marks distal epit helial cells in wild type and Tmem16a mutant lungs. A. Nkx2.1 immunohistochemistry reveals nuclei of distal epithelial cells in wild type lungs at E18.5. B. Nkx2.1-positive cells have a normal distribution in Tmem16a mutant lungs at E18.5. Notice their rounded morphology (see text). C. Nkx2.1positive cells in wild type lung at P3. D. Nkx2.1-positive cells in Tmem16a mutant lung at P3 with distribution similar to that of wild type lung. Notice the enlarged distal airways and the thin parenchyma of the mutant lung. Scale bars=100m.

PAGE 84

84 Figure 5-6. Other markers of differentiation in Tmem16a mutant lungs. Tropoelastin-expressing myofibroblasts identified by RNA in situ hybridization in A. wild type and B. Tmem16a mutant lungs at P15. PECAM immunofluorescence revealed the endothelium of the capillary netw ork in C. wild type and D. Tmem16a mutant lungs at P7. Scgb1a1 immunofluorescence revealed Clar a cells in the conducting airways of E. wild type and F. Tmem16a mutant lungs at P19. Scale bars=200m.

PAGE 85

85 CHAPTER 6 CONCLUDING REMARKS By com bining two powerful techniques, targeted transgenesis of the mouse genome and microarray technology, we were able to identify si x genes expressed in the mouse limb that had not been previously reported (Chapter 2). At le ast four of these genes are expressed in domains that overlap with the ZPA, but their functions there remain unknown. To investigate the function of Tmem16a in vertebrate development, we generated a null mouse allele of this gene (Chapter 3). Tmem16a null mice (as well as mice null for Tcfap2b and Hlxb9 other genes identified by our screen) did not exhibit patterning defects of the limb. It is possible that this is attributable to compensati on by other members of these gene families. In Chapter 4 of this dissertation, we sh owed that the expression patterns of Tmem16a and Tmem16f overlapped in a number of developing tissu es including the vertebral periostea, the submandibular salivary glands, the muscularis externa of the esophagus, and the lung epithelium. Given the degree of conservation between these proteins (~40% identical at the amino acid level), the mutation of one might be compensated for by the function of another in sites where they are coexpressed. To further characterize the functions of this family in the future, it might be necessary to delete combinations of multiple family members. We have demonstrated that the mid-gestational epithelium of Tmem16a mutant tracheae fails to stratify (see Chapter 3). We current ly propose that epithelial cells from which Tmem16a has been deleted do not correctly form the cell:ce ll contacts required to achi eve stratification. In support of this hypothesis, transfectio n of the related family member TMEM16G (that localizes to sites of cell:cell contact) in to an epithelial cancer cell line alters their morphology and causes aberrant clumps of cells (Tsutsumi et al., 2004). This suggests that members of this family can promote intercellular adhesion. Another possibility is that asymmetric cell divisions that self-

PAGE 86

86 renew the basal layer and generate suprabasal cells required for stratification are aberrant in Tmem16a mutant tracheal epithelium (for an ex ample of asymmetric cell divisions in stratification, see (Lech ler and Fuchs, 2005)). The single homolog of Tmem16a in yeast, IST2 has been shown to sort asymmetrically dur ing budding (Takizawa et al., 2000). A final possibility is that deletion of Tmem16a interferes with the cytoskeleton of the tracheal epithelium and so cells do not have the proper structur al support to achieve stratification. A Drosophila homolog, AXS, has been shown to associate with the meiotic spindle (Kramer and Hawley, 2003). Despite its etiology, the failure of the embryonic tracheal ep ithelium to stratify in Tmem16a mutants causes it to expand and drastically in fluence the fate of the mesenchymal cells that surround it. Instead of forming a single Cshaped cartilaginous ring, multiple cartilaginous elements form around the trachea of Tmem16a mutants. In humans, ma lformation of the tracheal cartilage is known as tracheomalacia (McN amara and Crabbe, 2004). The symptoms of tracheomalacia worsen during periods of feeding, leading us to speculate that the failure of Tmem16a mutants to thrive postnatally is at least pa rtly attributable to the malformation of the cartilage rings. It is likely that many other defects exist in Tmem16a mutants; however, any defect that is observed in the postnatal period will need to be meticulously investigated since these animals fail to thrive and might show signs of generalized distress. The emphysema we characterized in Tmem16a mutants might be a secondary defect of this nature. One reagent that will be extremely helpful in the further characterization of Tmem16a is a conditional null allele with which an investigator could ablate this gene in a tissue-specific manner. Another reagent that will be necessary to continue this work is an antibody that specifically rec ognizes and binds murine

PAGE 87

87 TMEM16A. This would allow the subcellular lo calization of the prot ein and might provide insights into its function. The expression of TMEM16A in many human cancers, its widespread developmental expression in mice, and the postnatal lethality as sociated with its deleti on in mice suggest that this gene carries significant implications for both the clinic and for basic science. Furthermore, the conservation of TMEM16 orthologs in organisms as distantly related to humans as S. cerevisiae indicates that the acquisiti on of TMEM16 function occurred early in evolutionary history. An integrative approach combining the scant experimental data from all TMEM16 homologs will be required as we attempt to incorporate these molecules into our understanding of development and disease.

PAGE 88

88 APPENDIX A OLIGONUCLEOTIDES USED AS GENOTYPING PRIMERS Table A-1. Prim ers used to genotype Tmem16a and Tmem16f alleles. Tmem16a wild type F: pTKO18F2 5'CCTATGACTGCCAGGGACGCCC R: pTKO18R2 5'TGTTCCTGTCCCTGCAATGCGG mutant F: pTKOneogenoF 5'GACGCCCTCCATTGACCC R: neoR1(Frt) 5'GGAGTAGAAGGTGGCGCGAAG Tmem16f (RRF355) wild type F: Tmem16f ABF2 5'GTGTAGTTGCTGCATGGTCC R: wtTMEM16F-R 5'CAGATCTCATTACAGATGGTTG mutant F: Tmem16f-F4 5'GTCACGCTGTGTGCGAGCG R: En2-R 5'CGACTTCCGGAGCGGATCTC

PAGE 89

89 APPENDIX B EXPRESSION OF TMEM16 FAMILY MEMBERS IN C RANIOFACIAL DEVELOPMENT Figure B-1. Summary of Tmem16a, Tmem16c Tmem16f Tmem16h and Tmem16k expression in the nervous system and cranio facial structures. Abbrev iations: Virtually absent transcripts (-), expression at slightly above background levels (+), moderate expression levels (++), robust expression levels (+++). Nd, not determined. (*), possible presence of transcripts that may be masked by ubiquitous expression in the core mesenchyme. **, expression in the tota lity of the connec tive tissue underlying the olfactory epithelium and thus, may also include the olfactory ensheathing cells. (***), possible expression that may be mask ed by the signal w ithin the periodontal ligament. Tmem 16aTmem 16cTmem 16fTmem 16hTmem 16k Tmem 16aTmem 16cTmem 16fTmem 16hTmem 16k Brain Cartila g e neuroepitheliumVentral (+++). Dorsal ( + ) (++)(+++)(++)(++)proliferating chondroc y te s (-) (+) (+) (+) (++) subventricular la y e r (+++) (+++) (+++) (+++) (-) prehypertrophic chondroc y te s (+) (+++) (++) (+) (++) differentiating fields (++) (+++) (+++) (+++) (+++) hypertrophic chondroc y te s (+++) (+++) (+++) (+) (+) S p inal cor d perichondrium(+++) (+) (+++) (+) (+) neuroepithelium(+) (+) (++) (+) (+) Bone marginal layer(+) (+++)motor neuron area ( +++ ) (+++) (+++) differentiating osteoblasts (+++) (++) (++) (+) (+) roof plate(+++ ) at E12.5(+) (+) (+) (+) osteoblasts (+++) (+++) (+++) (+) (+) E y e Ski n outer retinal cell la y ers (+++)(+)(+) (+)(+)epidermissuprabasal layers ( +++ ) suprabasal layers ( +++ ) (++) (+)suprabasal layers ( +++ ) retinal ganglionic cell layer (++)(+++)(+++)(+++)(+++)dermis(+++) at E13.5. (++) at later stages (+) (+++) (+) (+) lens epithelium(+++)(+) at E12.5. Absent at later stages (-) (-)(++) up to E14.5 hair follicles (+) (-) (+) (+) (+) hyaloid vascular p lexus (+++)(-)(+++)(++)(+) Tooth ocular mesenchyme corneal mesenchyme (+++) up to E145 (-)periocular mesenchyme (++) periocular mesenchyme (+) periocular mesenchyme (+) early dental epithelium E11.5) (+)(+++) nested(+)(+)(+) Inner ear early dental mesenchyme (E11.5) (+++) broad domain (+++) nested(+) (+) (+) epithelium(-)(-)(++)(++)Before E18.5 (++). After E18.5 ( + ) enamel knot (-) (+++) (+) (+) (+) neurosensory patches (+++) (-)similar to the rest of epithelium similar to the rest of epithelium similar to the rest of epithelium inner enamel epithelium (IEE) incisors (+++), (+) molars, (+++) cervical loops (-) (-) (+) (++) organ of Corti(+++) (-)idem aboveidem aboveidem above outer enamel e p itheliu m (+) (-) (-) (+) (+) Reissner's membrane (-) (-) (+++) (+) (-) dental papilla mesenchyme-cap stage (++) (+++) (+) (+) (+) membranous labyrinth (+) (-) (+) (+) (-) dental papilla mesenchyme bellstage (+++) in nasecnt cusps. (+) in developedcusps (+++) (++) Nd (+++) stria vascularis(+++) (-) (+++) (+) (+) dental sac mesenchyme (+)(+++) at the cap stage. (-) at later stages (+) Nd (+) Pituitary (+++) (+) (+++) (+++) (++) preodontoblasts(+) (+++) (+++) Nd (+++) Cranial nerve ganglia (+++). Also in cells along the trigeminalaxons (+++) (+++) (+++) (+++) differentiating odontoblasts (+++) (+++) (+++) Nd (+++) Develo p in g le p tomenin g e s (+++) (+) (+++) (+) (++) odontoblasts(++) (++) (+) Nd (++) Walls of craniofacial vessels (+++) (-) (*) (*) (*) preameloblasts(+++) (-) (++) Nd (+) Olfactory epithelium (+++)Before E18.5.(+) after E18.5 (-) (++) (++) (++) secretory ameloblasts (+) (-) (+++) Nd (+) Olfactory ensheathing cells (+++) (-) (+++)** (++)** (+)** maturation stage ameloblasts (-) (-) (+++) Nd Nd Nasal respiratory epithelium (+++) (+) (+++) (++) (++) stratum intermedium (+) (-) (++) Nd (+) Epithelium of the nasal septum (-) before E14. (+++)after E14 (-)(++)(+)(+)papillary layer(-)(-)(+++)NdNd Tongue cemetoblasts(-)(+++)(***)NdNd epithelium(++)(-)(++)(+)(+)periodontal li g amen t (-) (-) (+++) Nd Nd mesenchyme(+++)before E14.5. (+++) nestedatE14.5 nested (+++)(++) (+) (++) Salivar y g lands lingual vessels(+++)(-)(*)(*)(*)epithelium(+++)(+) (+)(+)(+) Palate mesenchyme(+)(+)(+)(+)(+) shelf epithelium(++) before E13.5, (+) at E13.5 (+) at E12.5; (-) after E12.5 (++)(++)(++)submandibular ganglion (-)(+++)(+++)(-)(-) shelf mesench y m e (-)(++) at E12.5. (-) after E12.5 (++)(++)(++) medial edge e p itheliu m (+) at E13.5 ( +++ ) at E14.5 (-)(++)(++)(++) medial epithelial sea m (+++) (-) (++) (++) (++)

PAGE 90

90 APPENDIX C PROBES USED FOR RNA IN SITU HYB RIDIZATIONS Table C-1. Probes used for RNA in situ hybridizations. Gene Name Plasmid Number Accession Number Antisense Enzyme Antisense Polymerase Tmem16a BH1 BC006062 SalI T7 Tmem16c BH119 BM936471 XhoI T3 Tmem16f BH118 BU705523 SalI T3 Tmem16h* BH116 BE571138 SalI T7 Tmem16k* BH117 BF780617 KpnI T7 Sftpc BH177 NcoI SP6 Tropoelastin BH176 NotI T3 Shh BH39 HindIII T3 cTmem16a** BH166 BU248576 NotI T3 *=probe not used in this dissertation. **=chicken EST (all others are mouse)

PAGE 91

91 LIST OF REFERENCES Ahel, V., Banac, S., Roz manic, V., Vukas, D., Drescik, I. and Ahel, V. A., Jr. (2003). Aortopexy and bronchopexy for the management of severe tracheomalacia and bronchomalacia. Pediatr Int 45 104-6. Asou, Y., Nifuji, A., Tsuji, K., Shinomiya, K. Olson, E. N., Koopman, P. and Noda, M. (2002). Coordinated expression of scleraxis a nd Sox9 genes during embryonic development of tendons and cartilage. J Orthop Res 20, 827-33. Aubin, J., Lemieux, M., Tremblay, M., Berard, J. and Jeannotte, L. (1997). Early postnatal lethality in Hoxa-5 mutant mice is attributable to respiratory tract defects. Dev Biol 192 432-45. Bandyopadhyay, A., Tsuji, K., Cox, K., Harf e, B. D., Rosen, V. and Tabin, C. J. (2006). Genetic Analysis of the Roles of BMP2, BMP4, and BMP7 in Limb Patterning and Skeletogenesis. PLoS Genet 2, e216. Bera, T. K., Das, S., Maeda, H., Beers, R., Wolfgang, C. D., Kumar, V., Hahn, Y., Lee, B. and Pastan, I. (2004). NGEP, a gene encoding a membrane protein detected only in prostate cancer and normal prostate. Proc Natl Acad Sci U S A 101, 3059-64. Berthiaume, Y., Voisin, G. and Dagenais, A. (2006). The alveolar type I cells: the new knight of the alveolus? J Physiol 572, 609-10. Bhaskaran, M., Kolliputi, N., Wang, Y., Gou, D., Chintagari, N. R. and Liu, L. (2007). Trans-differentiation of alveolar epithelial type II cells to type I cells involves autocrine signaling by transforming growth factor beta 1 through the Smad pathway. J Biol Chem 282, 3968-76. Boogaard, R., Huijsmans, S. H., Pijnenburg, M. W., Tiddens, H. A., de Jongste, J. C. and Merkus, P. J. (2005). Tracheomalacia and bronchomalaci a in children: incidence and patient characteristics. Chest 128 3391-7. Boulet, A. M., Moon, A. M., Arenkiel, B. R. and Capecchi, M. R. (2004). The roles of Fgf4 and Fgf8 in limb bud initiation and outgrowth. Dev Biol 273, 361-72. Burri, P. H. (2006). Structural aspects of postnatal lung development alveolar formation and growth. Biol Neonate 89, 313-22.

PAGE 92

92 Carden, K. A., Boiselle, P. M., Waltz, D. A. and Ernst, A. (2005). Tracheomalacia and tracheobronchomalacia in children and adults: an in-depth review. Chest 127 984-1005. Cardoso, W. V. and Lu, J. (2006). Regulation of early lung morphogenesis: questions, facts and controversies. Development 133, 1611-24. Chan, A. S., Thorner, P. S., Squire, J. A. and Zielenska, M. (2002). Identification of a novel gene NCRMS on chromosome 12q21 with differe ntial expression between rhabdomyosarcoma subtypes. Oncogene 21, 3029-37. Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and defective axial patt erning in mice lacking Sonic hedgehog gene function. Nature 383, 407-13. Cillo, C., Cantile, M., Faiella, A. and Boncinelli, E. (2001). Homeobox genes in normal and malignant cells. J Cell Physiol 188, 161-9. Daniely, Y., Liao, G., Dixon, D., Linnoila, R. I., Lori, A., Randell, S. H., Oren, M. and Jetten, A. M. (2004). Critical role of p63 in the de velopment of a normal esophageal and tracheobronchial epithelium. Am J Physiol Cell Physiol 287, C171-81. Das, S., Hahn, Y., Nagata, S., Willingham, M. C., Bera, T. K., Lee, B. and Pastan, I. (2007). NGEP, a prostate-specific plasma membrane prot ein that promotes the association of LNCaP cells. Cancer Res 67, 1594-601. de Crombrugghe, B., Lefebvre, V. and Nakashima, K. (2001). Regulatory mechanisms in the pathways of cartilage and bone formation. Curr Opin Cell Biol 13, 721-7. Eblaghie, M. C., Reedy, M., Oliver, T., Mishina, Y. and Hogan, B. L. (2006). Evidence that autocrine signaling through Bmpr1a regulates th e proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol 291, 67-82. Echelard, Y., Epstein, D. J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J. A. and McMahon, A. P. (1993). Sonic hedgehog, a member of a fa mily of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75, 1417-30. Elluru, R. G. and Whitsett, J. A. (2004). Potential role of Sox9 in patterning tracheal cartilage ring formation in an embryonic mouse model. Arch Otolaryngol Head Neck Surg 130, 732-6.

PAGE 93

93 Entian, K. D., Schuster, T., Hegemann, J. H ., Becher, D., Feldmann, H., Guldener, U., Gotz, R., Hansen, M., Hollenberg, C. P., Jansen, G. et al. (1999). Functional analysis of 150 deletion mutants in Saccharomyces cer evisiae by a systematic approach. Mol Gen Genet 262, 683-702. Espinosa, I., Lee, C. H., Kim, M. K., Rous e, B. T., Subramanian, S., Montgomery, K., Varma, S., Corless, C. L., Heinrich, M. C., Smith, K. S. et al. (2008). A Novel Monoclonal Antibody Against DOG1 is a Sensitive and Speci fic Marker for Gastrointestinal Stromal Tumors. Am J Surg Pathol 32, 210-218. Evans, M. J., Cabral, L. J., Stephens, R. J. and Freeman, G. (1975). Transformation of alveolar type 2 cells to type 1 cells following exposure to NO2. Exp Mol Pathol 22, 142-50. Fehrenbach, H. (2001). Alveolar epithelial type II cell: defender of the alveolus revisited. Respir Res 2 33-46. Galindo, B. E. and Vacquier, V. D. (2005). Phylogeny of the TMEM16 protein family: some members are overexpressed in cancer. Int J Mol Med 16, 919-24. Ganan, Y., Macias, D., Basco, R. D., Merino, R. and Hurle, J. M. (1998). Morphological diversity of the avian foot is related with the pattern of msx gene expr ession in the developing autopod. Dev Biol 196, 33-41. Gomperts, B. N., Gong-Cooper, X. and Hackett, B. P. (2004). Foxj1 regulates basal body anchoring to the cytosk eleton of ciliated pulm onary epithelial cells. J Cell Sci 117, 1329-37. Greenholz, S. K., Karrer, F. M. and Lilly, J. R. (1986). Contemporary surgery of tracheomalacia. J Pediatr Surg 21, 511-4. Harfe, B. D., Scherz, P. J., Nissim, S., Ti an, H., McMahon, A. P. and Tabin, C. J. (2004). Evidence for an expansion-based temporal Shh grad ient in specifying vertebrate digit identities. Cell 118, 517-28. Harrison, K. A., Thaler, J., Pfaff, S. L., Gu, H. and Kehrl, J. H. (1999). Pancreas dorsal lobe agenesis and abnormal islets of La ngerhans in Hlxb9-deficient mice. Nat Genet 23, 71-5. Hecht, J., Seitz, V., Urban, M., Wagner, F., Robinson, P. N., Stiege, A., Dieterich, C., Kornak, U., Wilkening, U ., Brieske, N. et al. (2007). Detection of nove l skeletogenesis target genes by comprehensive analysis of a Runx2(-/-) mouse model. Gene Expr Patterns 7, 102-12.

PAGE 94

94 Hogan, B. L. (1996). Bone morphogenetic proteins: mu ltifunctional regulators of vertebrate development. Genes Dev 10, 1580-94. Hong, K. U., Reynolds, S. D., Watkins, S., Fuchs, E. and Stripp, B. R. (2004). In vivo differentiation potential of tracheal basal cells: evidence for multipotent and unipotent subpopulations. Am J Physiol Lung Cell Mol Physiol 286, L643-9. Huang, T., You, Y., Spoor, M. S., Richer, E. J., Kudva, V. V., Paige, R. C., Seiler, M. P., Liebler, J. M., Zabner, J., Plopper, C. G. et al. (2003). Foxj1 is required for apical localization of ezrin in airway epithelial cells. J Cell Sci 116, 4935-45. Huang, X., Godfrey, T. E., Gooding, W. E., McCarty, K. S., Jr. and Gollin, S. M. (2006). Comprehensive genome and transcriptome analysis of the 11q13 amplicon in human oral cancer and synteny to the 7F5 amplic on in murine oral carcinoma. Genes Chromosomes Cancer 45, 1058-69. Kalenga, M. (1997). Lung growth and development during experimental malnutrition. Pediatr Pulmonol Suppl 16, 165-6. Katoh, M. and Katoh, M. (2003). FLJ10261 gene, located w ithin the CCND1-EMS1 locus on human chromosome 11q13, encodes the eight-tra nsmembrane protein homologous to C12orf3, C11orf25 and FLJ34272 gene products. Int J Oncol 22, 1375-81. Katoh, M. and Katoh, M. (2005). Identification and charac terization of TMEM16H gene in silico. Int J Mol Med 15 353-8. Kiessling, A., Weigle, B., Fuessel, S., Ebner, R., Meye, A., Rieger, M. A., Schmitz, M., Temme, A., Bachmann, M., Wirth, M. P. et al. (2005). D-TMPP: a novel androgen-regulated gene preferentially expressed in prostate and pr ostate cancer that is the first characterized member of an eukaryotic gene family. Prostate 64 387-400. Kramer, J. and Hawley, R. S. (2003). The spindle-associated transmembrane protein Axs identifies a new family of transm embrane proteins in eukaryotes. Cell Cycle 2, 174-6. Laufer, E., Nelson, C. E., Johnson, R. L., Morgan, B. A. and Tabin, C. (1994). Sonic hedgehog and Fgf-4 act through a signaling cascade and feedback loop to integrate growth and patterning of the developing limb bud. Cell 79, 993-1003.

PAGE 95

95 Lechler, T. and Fuchs, E. (2005). Asymmetric cell divisi ons promote stratification and differentiation of mammalian skin. Nature 437, 275-80. Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. and de Crombrugghe, B. (1997). SOX9 is a potent activator of the chondrocytespecific enhancer of th e pro alpha1(II) collagen gene. Mol Cell Biol 17, 2336-46. Lettice, L. A., Heaney, S. J., Purdie, L. A., Li L., de Beer, P., Oostra, B. A., Goode, D., Elgar, G., Hill, R. E. and de Graaff, E. (2003). A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum Mol Genet 12, 1725-35. Lindahl, P., Karlsson, L., Hellstrom, M., Gebre-Medhin, S., Willetts, K., Heath, J. K. and Betsholtz, C. (1997). Alveogenesis failure in PDGF-A-defic ient mice is coupled to lack of distal spreading of alveolar smooth muscle cell progenitors during lung development. Development 124, 3943-53. Liu, W., Selever, J., Wang, D., Lu, M. F., Mose s, K. A., Schwartz, R. J. and Martin, J. F. (2004). Bmp4 signaling is required for outflow-tract septation and branchial-arch artery remodeling. Proc Natl Acad Sci U S A 101, 4489-94. Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N. and Tabin, C. J. (2002). Expression of Cre Recombinase in the developi ng mouse limb bud driven by a Prxl enhancer. Genesis 33, 77-80. Mahlapuu, M., Enerback, S. and Carlsson, P. (2001). Haploinsufficiency of the forkhead gene Foxf1, a target for sonic hedgehog signaling, causes lung and foregut malformations. Development 128, 2397-406. Manak, J. R. and Scott, M. P. (1994). A class act: conser vation of homeodomain protein functions. Dev Suppl, 61-77. Massaro, D., Massaro, G. D., Baras, A., Hoffman, E. P. and Clerch, L. B. (2004). Calorierelated rapid onset of alveolar loss, regeneration, and changes in mouse lung gene expression. Am J Physiol Lung Cell Mol Physiol 286, L896-906. McNamara, V. M. and Crabbe, D. C. (2004). Tracheomalacia. Paediatr Respir Rev 5 147-54.

PAGE 96

96 Mendelsohn, C., Lohnes, D., Decimo, D., Lufkin, T., LeMeur, M., Chambon, P. and Mark, M. (1994). Function of the retinoi c acid receptors (RARs) duri ng development (II). Multiple abnormalities at various stages of or ganogenesis in RAR double mutants. Development 120, 2749-71. Miller, L. A., Wert, S. E., Clark, J. C ., Xu, Y., Perl, A. K. and Whitsett, J. A. (2004). Role of Sonic hedgehog in patterning of tracheal-bronchial cartilage and the peripheral lung. Dev Dyn 231, 57-71. Minoo, P., Su, G., Drum, H., Bringas, P. and Kimura, S. (1999). Defects in tracheoesophageal and lung morphogenesis in Nkx2.1(-/-) mouse embryos. Dev Biol 209, 60-71. Mizuta, K., Tsutsumi, S., Inoue, H., Sakamot o, Y., Miyatake, K., Miyawaki, K., Noji, S., Kamata, N. and Itakura, M. (2007). Molecular characteriza tion of GDD1/TMEM16E, the gene product responsible for autosomal dominant gnathodiaphyseal dysplasia. Biochem Biophys Res Commun 357 126-32. Moser, M., Pscherer, A., Roth, C., Becker, J., Mucher, G., Zerres, K., Dixkens, C., Weis, J., Guay-Woodford, L., Buettner, R. et al. (1997a). Enhanced apoptot ic cell death of renal epithelial cells in mice lacking transcription factor AP-2beta. Genes Dev 11, 1938-48. Moser, M., Ruschoff, J. and Buettner, R. (1997b). Comparative analysis of AP-2 alpha and AP-2 beta gene expression during murine embryogenesis. Dev Dyn 208, 115-24. Nielsen, T. O., West, R. B., Linn, S. C., Al ter, O., Knowling, M. A., O'Connell, J. X., Zhu, S., Fero, M., Sherlock, G., Pollack, J. R. et al. (2002). Molecular character isation of soft tissue tumours: a gene expression study. Lancet 359, 1301-7. Nieto, M. A., Patel, K. and Wilkinson, D. G. (1996). In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods Cell Biol 51, 219-35. Nissim, S., Hasso, S. M., Fallon, J. F. and Tabin, C. J. (2006). Regulation of Gremlin expression in the posterior limb bud. Dev Biol 299 12-21. Niswander, L., Jeffrey, S., Ma rtin, G. R. and Tickle, C. (1994). A positive feedback loop coordinates growth and pattern ing in the vertebrate limb. Nature 371, 609-12.

PAGE 97

97 Noji, S., Nohno, T., Koyama, E., Muto, K., Oh yama, K., Aoki, Y., Tamura, K., Ohsugi, K., Ide, H., Taniguchi, S. et al. (1991). Retinoic acid induces pola rizing activity but is unlikely to be a morphogen in the chick limb bud. Nature 350, 80-6. Perl, A. K., Wert, S. E., Loudy, D. E., Sha n, Z., Blair, P. A. and Whitsett, J. A. (2005). Conditional recombination reveals distinct subset s of epithelial cells in trachea, bronchi, and alveoli. Am J Respir Cell Mol Biol 33 455-62. Perl, A. K., Wert, S. E., Nagy, A., Lobe, C. G. and Whitsett, J. A. (2002). Early restriction of peripheral and proximal cell lineage s during formation of the lung. Proc Natl Acad Sci U S A 99, 10482-7. Prodhan, P. and Kinane, T. B. (2002). Developmental paradigms in terminal lung development. Bioessays 24, 1052-9. Provot, S. and Schipani, E. (2005). Molecular mechanisms of endochondral bone development. Biochem Biophys Res Commun 328, 658-65. Puschel, A. W. (1999). Divergent properties of mouse netrins. Mech Dev 83, 65-75. Que, J., Choi, M., Ziel, J. W., Klingensmith, J. and Hogan, B. L. (2006). Morphogenesis of the trachea and esophagus: current player s and new roles for noggin and Bmps. Differentiation 74, 422-37. Rawlins, E. L. and Hogan, B. L. (2006). Epithelial stem cells of the lung: privileged few or opportunities for many? Development 133, 2455-65. Regnier, C. H., Masson, R., Kedinger, V., Textoris, J., Stoll, I., Chenard, M. P., Dierich, A., Tomasetto, C. and Rio, M. C. (2002). Impaired neural t ube closure, axial skeleton malformations, and tracheal ring disruption in TRAF4-deficient mice. Proc Natl Acad Sci U S A 99, 5585-90. Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C. (1993). Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75, 1401-16. Rock, J. R., Lopez, M. C., Baker, H. V. and Harfe, B. D. (2007). Identification of genes expressed in the mouse limb using a novel ZPA microarray approach. Gene Expr Patterns 8, 1926.

PAGE 98

98 Samuel, S. and Naora, H. (2005). Homeobox gene expression in cancer: insights from developmental regulation and deregulation. Eur J Cancer 41, 2428-37. Saunders JW, J. (1948). The proximo-distal sequence of the origin of the parts of the chick wing and the role of the ectoderm. The Journal of Experimental Zoology 108, 363-403. Saunders JW, J. and Gasseling, MT. (1968). Ectodermal-mesodermal interactions in the origin of limb symmetry. In Epithelial-Mesenchymal Interactions (ed. F. R and B. RE), pp. 78-97. Baltimore: Willilams &Wilkins. Scherz, P. J., Harfe, B. D., McMahon, A. P. and Tabin, C. J. (2004). The limb bud Shh-Fgf feedback loop is terminated by expansion of former ZPA cells. Science 305 396-9. Schuuring, E. (1995). The involvement of the chromosome 11q13 region in human malignancies: cyclin D1 and EMS1 are two new candidate oncogenes--a review. Gene 159, 8396. Sekiya, I., Tsuji, K., Koopman, P., Watanabe, H., Yamada, Y., Shinomiya, K., Nifuji, A. and Noda, M. (2000). SOX9 enhances aggrecan gene promoter/enhancer activity and is upregulated by retinoic acid in a cartilage-derived cell line, TC6. J Biol Chem 275, 10738-44. Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21, 70-1. Sun, X., Mariani, F. V. and Martin, G. R. (2002). Functions of FGF signalling from the apical ectodermal ridge in limb development. Nature 418 501-8. Swiatek, P. J. and Gridley, T. (1993). Perinatal lethality and defects in hindbrain development in mice homozygous for a targeted mutation of the zinc finger gene Krox20. Genes Dev 7, 207184. Takizawa, P. A., DeRisi, J. L., Wilhelm, J. E. and Vale, R. D. (2000). Plasma membrane compartmentalization in yeast by messenger R NA transport and a sept in diffusion barrier. Science 290, 341-4. Thaler, J., Harrison, K., Sharma, K., Lettieri, K., Kehrl, J. and Pfaff, S. L. (1999). Active suppression of interneuron programs within deve loping motor neurons revealed by analysis of homeodomain factor HB9. Neuron 23, 675-87.

PAGE 99

99 Tickle, C., Alberts, B., Wolpert, L. and Lee, J. (1982). Local application of retinoic acid to the limb bud mimics the action of the polarizing region. Nature 296, 564-6. Tickle, C., Lee, J. and Eichele, G. (1985). A quantitative analysis of the effect of all-transretinoic acid on the pattern of chick wing development. Dev Biol 109, 82-95. Tsuji, K., Bandyopadhyay, A., Harfe, B. D., Cox, K., Kakar, S., Gerstenfeld, L., Einhorn, T., Tabin, C. J. and Rosen, V. (2006). BMP2 activity, although di spensable for bone formation, is required for the init iation of fracture healing. Nat Genet 38 1424-9. Tsutsumi, S., Inoue, H., Sakamoto, Y., Mizuta, K., Kamata, N. and Itakura, M. (2005). Molecular cloning and characteri zation of the murine gnathod iaphyseal dysplasia gene GDD1. Biochem Biophys Res Commun 331, 1099-106. Tsutsumi, S., Kamata, N., Vokes, T. J., Ma ruoka, Y., Nakakuki, K ., Enomoto, S., Omura, K., Amagasa, T., Nagayama, M., Saito-Ohara, F. et al. (2004). The novel gene encoding a putative transmembrane protein is mutate d in gnathodiaphyseal dysplasia (GDD). Am J Hum Genet 74, 1255-61. Vermot, J., Niederreither, K., Garnier, J. M., Chambon, P. and Dolle, P. (2003). Decreased embryonic retinoic acid synthesis results in a DiGeorge syndrome phenotype in newborn mice. Proc Natl Acad Sci U S A 100, 1763-8. Wanek, N., Gardiner, D. M., Muneoka, K. and Bryant, S. V. (1991). Conversion by retinoic acid of anterior cells into ZPA cells in the chick wing bud. Nature 350, 81-3. Warburton, D., Schwarz, M., Tefft, D., Flores-Delgado, G., Anderson, K. D. and Cardoso, W. V. (2000). The molecular basis of lung morphogenesis. Mech Dev 92, 55-81. Warburton, D., Wuenschell, C., Flores-Delgado, G. and Anderson, K. (1998). Commitment and differentiation of lung cell lineages. Biochem Cell Biol 76, 971-95. West, R. B., Corless, C. L., Chen, X., Rubin, B. P., Subramanian, S., Montgomery, K., Zhu, S., Ball, C. A., Nielsen, T. O., Patel, R. et al. (2004). The novel marker, DOG1, is expressed ubiquitously in gastrointestinal stromal tumors irrespective of KIT or PDGFRA mutation status. Am J Pathol 165, 107-13. Wilkinson, D. (1992). Whole mount in situ hybridi zation to vertebrate embryos. In Situ Hybridization: A Practical Approach (ed. D. Wilkinson), pp. 75-83. Oxford: IRL Press.

PAGE 100

100 Wolpert, L. (1969). Positional information and the spatial pattern of cellular differentiation. J Theor Biol 25 1-47. Zuniga, A., Haramis, A. P., McMa hon, A. P. and Zeller, R. (1999). Signal relay by BMP antagonism controls the SHH/FGF4 fee dback loop in vertebrate limb buds. Nature 401 598-602.

PAGE 101

101 BIOGRAPHICAL SKETCH Jason Randall Rock was born March 19, 1981 in Ta llahassee, Florida to parents Harry and Glenda Rock. His sister, Sandra, and he were ra ised in J acksonville, FL with the exception of two years spent in Knoxville, TN. From an early age, Jason was extremely intere sted in science, math, and music. During middle and high school, he participated in activ ities including Odyssey of the Mind, Science Olympiad, and Brain Brawl. In 1999, Jason re ceived an International Baccalaureate diploma from Stanton College Preparatory High School in Jacksonville, FL. Jason graduated magna cum laude with a Bachelor of Scie nce from the Florida State University in 2002. As an undergraduate student he performed a directed individual study under the tutelage of Dr. Dexter Easton with whom he also instructed an experimental physiology course. These experiences were instrumental in Jasons decision to pursue a career in academic research. During this time, his interest in natu ral history and education were exercised as an educator at the Tallahassee Museum of History and Natural Science. In August of 2003, Jason entered the Interdiscip linary Program in Biomedical Sciences in the College of Medicine at the University of Fl orida. During the course of laboratory rotations, he developed an intense interest in developmenta l genetics and became the first graduate student in the laboratory of Dr. Brian Harfe. Following graduation, Jason will join the lab of Dr. Brigid Hogan at Duke University as a postdoctoral associate.