<%BANNER%>

Daxx and Rassf1 Define a Novel Mitotic Stress Checkpoint That Is Critical for Cellular Taxol Response

Permanent Link: http://ufdc.ufl.edu/UFE0021973/00001

Material Information

Title: Daxx and Rassf1 Define a Novel Mitotic Stress Checkpoint That Is Critical for Cellular Taxol Response
Physical Description: 1 online resource (89 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: daxx, mitosis, rassf1, taxol
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Taxanes, a family of compounds which includes taxol, are powerful chemotherapy agents used for breast cancer treatment. Large numbers of patients, however, are resistant to these drugs for unknown reasons. Taxol binds and hyper-stabilizes microtubules, but mutations or alterations in tubulin occur very rarely in cancers and cannot itself explain the majority of Taxol-resistance observed in patients. Currently, it is thought that defects in mitotic proteins may affect Taxol sensitivity in cells. Here, Daxx and Rassf1 are identified as novel regulators of cellular Taxol response. Daxx is a ubiquitously expressed and highly conserved nuclear protein with enigmatic roles in transcription and apoptosis. Increased prometaphase index in Daxx deficient embryos and aneuploidy of Daxx knockout cells was observed which suggested a potential function of Daxx in mitosis and cell division. During interphase, Daxx remains a strictly nuclear associated protein localized to PML bodies or heterochromatin. Upon nuclear envelope breakdown, Daxx was found to co-localize and interact with Rassf1 at mitotic spindles. Rassf1 is a cytoplasmic, microtubule-associated protein that is important for normal mitotic progression and cell division. Daxx was also shown to be important for the proper timing and progression of early mitosis. Together, Daxx and Rassf1 define a novel mitotic stress checkpoint that enables cells to efficiently exit mitosis (and eventually die) when encountered with specific stress stimuli during mitosis, including Taxol. In the absence of Daxx or Rassf1, cells treated with Taxol remain arrested in mitosis due to a sustained mitotic spindle checkpoint. Upon Taxol decay or removal, these cells can resume mitosis and complete cell division: thus being Taxol resistant. Inhibition of the spindle checkpoint using Aurora Kinase inhibitors efficiently abolished Taxol resistance in Daxx and Rassf1 depleted cells. Deregulation of most known mitotic proteins leads to enhanced Taxol response. Absence or depletion of Daxx and Rassf1, in contrast, results in increased drug resistance. In the future, Daxx and Rassf1 may be useful predictive markers for the proper selection of patients for taxane chemotherapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Ishov, Alexander M.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021973:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021973/00001

Material Information

Title: Daxx and Rassf1 Define a Novel Mitotic Stress Checkpoint That Is Critical for Cellular Taxol Response
Physical Description: 1 online resource (89 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: daxx, mitosis, rassf1, taxol
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Taxanes, a family of compounds which includes taxol, are powerful chemotherapy agents used for breast cancer treatment. Large numbers of patients, however, are resistant to these drugs for unknown reasons. Taxol binds and hyper-stabilizes microtubules, but mutations or alterations in tubulin occur very rarely in cancers and cannot itself explain the majority of Taxol-resistance observed in patients. Currently, it is thought that defects in mitotic proteins may affect Taxol sensitivity in cells. Here, Daxx and Rassf1 are identified as novel regulators of cellular Taxol response. Daxx is a ubiquitously expressed and highly conserved nuclear protein with enigmatic roles in transcription and apoptosis. Increased prometaphase index in Daxx deficient embryos and aneuploidy of Daxx knockout cells was observed which suggested a potential function of Daxx in mitosis and cell division. During interphase, Daxx remains a strictly nuclear associated protein localized to PML bodies or heterochromatin. Upon nuclear envelope breakdown, Daxx was found to co-localize and interact with Rassf1 at mitotic spindles. Rassf1 is a cytoplasmic, microtubule-associated protein that is important for normal mitotic progression and cell division. Daxx was also shown to be important for the proper timing and progression of early mitosis. Together, Daxx and Rassf1 define a novel mitotic stress checkpoint that enables cells to efficiently exit mitosis (and eventually die) when encountered with specific stress stimuli during mitosis, including Taxol. In the absence of Daxx or Rassf1, cells treated with Taxol remain arrested in mitosis due to a sustained mitotic spindle checkpoint. Upon Taxol decay or removal, these cells can resume mitosis and complete cell division: thus being Taxol resistant. Inhibition of the spindle checkpoint using Aurora Kinase inhibitors efficiently abolished Taxol resistance in Daxx and Rassf1 depleted cells. Deregulation of most known mitotic proteins leads to enhanced Taxol response. Absence or depletion of Daxx and Rassf1, in contrast, results in increased drug resistance. In the future, Daxx and Rassf1 may be useful predictive markers for the proper selection of patients for taxane chemotherapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Ishov, Alexander M.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021973:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101111_AAAABY INGEST_TIME 2010-11-11T19:06:33Z PACKAGE UFE0021973_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1053954 DFID F20101111_AABKPZ ORIGIN DEPOSITOR PATH lindsay_c_Page_47.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
8e92d684070923d1be7c6e9f407f3c9e
SHA-1
756567fcabb616c837ea0722bbebdd69e33d5a2b
48112 F20101111_AABKRC lindsay_c_Page_17.pro
58c7fe8ffb968f2bb41c0d3d08db8b31
b309cc42b8782991120eadc0751071ec252b68c2
F20101111_AABKQN lindsay_c_Page_76.tif
f29936e9f402c6290921e922e0bafca1
75cfecfba53edea791d98e529260f36aa0b7f498
51280 F20101111_AABKRD lindsay_c_Page_19.pro
2629d74937d46534620273d2ad0fc458
13e2f35fb62416e078507c08dd84913de7aab1ef
25271604 F20101111_AABKQO lindsay_c_Page_77.tif
63c821f9282d87e522c6ff0eed043306
d8ec6935d8f6e9b0f1ca69d5ae6d054e9477d7da
55531 F20101111_AABKRE lindsay_c_Page_20.pro
4a9053b91d4ed3de64d87fbf04678587
13c2d6e316006f701155a8019a43de19dffa3819
F20101111_AABKQP lindsay_c_Page_80.tif
4e236084248ea070004f1d62c5ca1107
f0440ed142dc4385ea6af1d9a02756846d2f79bd
53323 F20101111_AABKRF lindsay_c_Page_21.pro
598c591c2fbad762dd6e96af15d70aac
419b66fc96020e4df7787983115fba0611eba25f
F20101111_AABKQQ lindsay_c_Page_81.tif
73998cf4e0f67361017bd072bdcddced
7494ae15900ebc4814f850de259c8df2f591da4e
52283 F20101111_AABKRG lindsay_c_Page_22.pro
3141c8eaf949c659e19e099b851f5449
497e363d11774f84f59930d59891ea9182e53c79
F20101111_AABKQR lindsay_c_Page_83.tif
4a1120e54e34b03f0f2be17d711f8e23
9635201d2c751933bc6f0a4e098ea2f9146555cb
55754 F20101111_AABKRH lindsay_c_Page_26.pro
15f66c84e408ef30bafe2802643d0621
74b2da35cf0c43e2bad2e56026c3b1a527cf893f
F20101111_AABKQS lindsay_c_Page_88.tif
88c895b156e00a18d8f429e6b81399ef
3587629c3767d2d8b433b7394719646abaefb1b5
53380 F20101111_AABKRI lindsay_c_Page_28.pro
eee1ac086b2bcfb7af0a6624c5328e25
01b759532ab889b0ddcd85f16b6c3c5578603dea
861 F20101111_AABKQT lindsay_c_Page_02.pro
5e558a5f664af62747d3cb75c69e8ccb
110b552c7d8082a46f4c9f26cd2aa122363d67ba
39134 F20101111_AABKRJ lindsay_c_Page_30.pro
c476e406704a1370217ad15b48d5d915
ea1e34d9e5c37312d660fce0fb1c119e90bf8c19
9655 F20101111_AABKQU lindsay_c_Page_04.pro
3cab60ffac3667660b6b70fd6f55fd3b
5d9c771a0dd04fb8474e5effca83c1ad12c079f6
41411 F20101111_AABKRK lindsay_c_Page_33.pro
f93305b5d8ba773d0963212de3208abb
c01e2f00764fb92b961806e9baf51288ade1c120
113745 F20101111_AABKQV lindsay_c_Page_05.pro
966359e1c5020fbfc39802bf06273d44
4e1eb6eefcac01ef1293e28d809ec5fa64130f56
41546 F20101111_AABKRL lindsay_c_Page_34.pro
c1c1f48a85bc82e3a7d8edc67da348a9
cec0480764758a74bc2f9fce77b1429bfb40e3cd
68917 F20101111_AABKQW lindsay_c_Page_08.pro
4aad47b284fbc8eb6056850f235a6c07
f6551e6348e6c229ed98e16e9ce09f6cc9e82cd2
56014 F20101111_AABKSA lindsay_c_Page_58.pro
95843173dabbdbdc38c30d0dd4c58c84
885d47bf4feb70d692050de4d7b32d373dd15c30
17719 F20101111_AABKQX lindsay_c_Page_09.pro
9268482843683cf15d241a30c7b08222
0bba8bfb064200f434c9250bd5e4f2e671a86696
55816 F20101111_AABKSB lindsay_c_Page_61.pro
0f0cee80fb324a73abe9be73f7430c3d
dd8ceb9426d3b62a98dbb27de16e6c6017950b8b
45868 F20101111_AABKRM lindsay_c_Page_35.pro
4855359f7a94e37658d9ca8cc693317e
29df9ae074bce458cf417b7be4dfd1ff55eb5864
46055 F20101111_AABKQY lindsay_c_Page_12.pro
93f291ead8f5ad7afe12053fd769d83d
adbf52933bddb49c0df90aa629811c1bb290f726
56512 F20101111_AABKSC lindsay_c_Page_62.pro
788095cb187254bfb00a0a24e959cecd
ccb4b2a51e3056dc44ce12e1b6b0acb5f9a43bca
46461 F20101111_AABKRN lindsay_c_Page_36.pro
a3b1cc26e883927326eddd5dadb52238
fa08f8fe98070a268e6addccf943a5019dcf9d1f
52753 F20101111_AABKQZ lindsay_c_Page_14.pro
b35c1a76bfa1eaef9ac9b8e95d53bfac
470098cd72ce708c2b9e2ab349048795ed4d1ca1
53183 F20101111_AABKSD lindsay_c_Page_63.pro
d34e60f88ebd393076d1e8d6c049efab
64e073f65077361c2e6b641741e5ecaa2e435742
43248 F20101111_AABKRO lindsay_c_Page_37.pro
7e3ccbec4e83ecf624c54cea3668e1a9
c4033876912c2273cdab88debe3def168cc5bf73
37053 F20101111_AABKSE lindsay_c_Page_64.pro
4d9bee482e5679997888c857a7b2ddd4
db8fb341511a33fcb7475043a0acd7ff314cddf2
42350 F20101111_AABKRP lindsay_c_Page_41.pro
b31064d33d3fa2fc0ed1f3d5b802d657
8281afd0c363551b3560fd5f87641ba8dac04f3f
52085 F20101111_AABKSF lindsay_c_Page_66.pro
3df5c18b314fea4ab3d726f519bbee25
7999ad279c62eb5265eaeb78dd3f9efac685967f
29446 F20101111_AABKRQ lindsay_c_Page_42.pro
aab8c4ee751cb0583e9252bb9c2eaa44
aefad68e1baa487b14884757379cea92f548c9a7
19081 F20101111_AABKSG lindsay_c_Page_67.pro
07c4f1bae9aecfabe08c485d46b7fdb5
b5af68237fcf95f777d4b3a3375e8e13797a249e
23643 F20101111_AABKRR lindsay_c_Page_45.pro
4bc83d86dd73c50567db120f2bbae93a
a7b809aea832d78f918cc5e204ca40eb95f6182c
10309 F20101111_AABKSH lindsay_c_Page_68.pro
7e772f2c0f0971118d765c69e0cab08d
d506fb2eefb7d365942f44cbcbca82d70d5ac809
57498 F20101111_AABKRS lindsay_c_Page_47.pro
b42514bb6d6c6a498caa88373fd3314d
6a901103e0c76c3003c9f471122e430b00e1552d
56914 F20101111_AABKRT lindsay_c_Page_48.pro
aad27c28c2114b381fd68d192215dffe
90037622969814f2493fd1cf4388197986356623
22093 F20101111_AABKSI lindsay_c_Page_69.pro
7bdea6e28af3b8f436b065fb9c442da0
de86fe34a48920ac1edd41dd625b857fd2fc7436
57431 F20101111_AABKRU lindsay_c_Page_49.pro
e817e79cef7249a44c3f0691d86a359b
6504fcbeb7a70b5c0a28c3111008b0835c57fefa
21503 F20101111_AABKSJ lindsay_c_Page_70.pro
cbadb30649f9e7c8610191b46278d949
dcefe01af20f652b7679370982309fa8eec471d7
24694 F20101111_AABKRV lindsay_c_Page_51.pro
03cd4b36910c6314af8d4394db5eb862
221acb4c9bb96960f4879cc7f682e8fd91e068f4
54584 F20101111_AABKSK lindsay_c_Page_72.pro
72651e228093b616ae07308fcfba3170
1a08b9c6f541129a52e5a250dac95f0ea141f10e
20432 F20101111_AABKRW lindsay_c_Page_52.pro
1cdc51076db1f0c3e68819803b875d17
88e557fd924c09274570ca2e41bc80e23688eb76
57286 F20101111_AABKSL lindsay_c_Page_73.pro
e4b9bfc0dca04e8af40f7f209f2e955d
7a3b13357516bb0cacca4760f076828f7650c9b8
34867 F20101111_AABKRX lindsay_c_Page_53.pro
6b7ffd8718f85463e7778744db1c51e7
0c467852ff5f9772a781d0ae299eb078aa79826e
422 F20101111_AABKTA lindsay_c_Page_04.txt
e6b2ca0f5a4c2df60811ed1c08e9d4c0
2676e90ab72a97e2257c85e4d2f26a408533030e
55670 F20101111_AABKSM lindsay_c_Page_74.pro
f88d6856a32ec05f40edc4a34f15efe4
80b0f8e476a680a49a028baabfcf4a4374637b94
23634 F20101111_AABKRY lindsay_c_Page_54.pro
5eace3739962e108475d679772821203
1d119c0f9ab360e6de029ea54793b55cbae2e7f7
4622 F20101111_AABKTB lindsay_c_Page_05.txt
377a17d0da34a1625530190d62a65d4c
f06d35fd26d17b385e09b0be78236601983b913a
18026 F20101111_AABKRZ lindsay_c_Page_55.pro
1c15317e416df400e35a1a1da8565335
99ed1a7f83616ffd351b7485c8ae1123bf5eb1df
592 F20101111_AABKTC lindsay_c_Page_07.txt
b34311e3e04813f14c43f3ca58ccf267
1e8bb8934e5250897e5861729286bc0238f9c5c0
56840 F20101111_AABKSN lindsay_c_Page_75.pro
6e5a1fe3ee28232571b08a34ddbaa4e8
3e6f3947618646f65f80cdf8ae79535fbe186d5d
2771 F20101111_AABKTD lindsay_c_Page_08.txt
caf6906e1f95b28591eedb41e7f51b7e
3b0d5825dc3ad515ea930cd0bdefdee2534d5edc
24882 F20101111_AABKSO lindsay_c_Page_76.pro
6ac9abd318ccaa4aedd9804960e8ff6c
37ebcbaf3bae1a23782f131d44ab3f78afbafd8a
723 F20101111_AABKTE lindsay_c_Page_09.txt
e74122075c6f217ca60d9964559e9111
af22ed39aa5aa88729b25679719b850c001d28ba
26711 F20101111_AABKSP lindsay_c_Page_78.pro
f53b041a249be13234244fda17adfe72
305376e42551b261f6d45b3f7f1ed97b6b1d1ca6
850 F20101111_AABKTF lindsay_c_Page_11.txt
abc59d806691492511fde55967c0386b
7f199780bc84d0b523692410872001f56b247d4d
66061 F20101111_AABKSQ lindsay_c_Page_79.pro
055ec44837967635e22fd479457c1bf2
d7e2cf4f5367552a3d2d8932396b6ea5cafb87fe
1923 F20101111_AABKTG lindsay_c_Page_12.txt
139260e7079148082d606bdec794feea
4a0f0fa4711c2812a7fae0c21be4692d0a7ec205
71246 F20101111_AABKSR lindsay_c_Page_81.pro
5218ccd4a1d320d92d87fd758d1178ba
c2e887d681fbba3b6153a04f13673129ebb6314d
2208 F20101111_AABKTH lindsay_c_Page_13.txt
00e3017d7bb8f967082a56f18e68314c
a3407e10a9559f772d20f1e9c8a4be5b96a14cf7
74972 F20101111_AABKSS lindsay_c_Page_82.pro
ebf4ededce189beb2dda1be98704bc9d
763126641b3b78d55ec6a92f4c367df669a11f2b
2069 F20101111_AABKTI lindsay_c_Page_14.txt
1f0e7707a59e9e8c75652d4c12e7d356
efd42cab0be6dfee919541d34a6754537c5c1cd1
72584 F20101111_AABKST lindsay_c_Page_83.pro
c5a7f6d4872e4a06dae74da2eadbf7b1
e7c6dc4fb2817b5f34faa190c8d1c9558b96f5df
2049 F20101111_AABKTJ lindsay_c_Page_16.txt
753875859d96519e9cf8739847177cc9
f178c62ca90e5e3fb96671b197ec0f4195feb6c8
65340 F20101111_AABKSU lindsay_c_Page_84.pro
0a4b7f17e70dd078246e4f9bb424de60
f3bf3c61fdb2b446c83cc728b5577abb020f93d9
1977 F20101111_AABKTK lindsay_c_Page_17.txt
02ef8a349dc28b9bf447cc83fcbff5e8
d5d3051538054e07098d23d0d6f8a743cce970f5
68136 F20101111_AABKSV lindsay_c_Page_85.pro
2ec16e7552e5596495c37fbbfe58cc46
129d882b0b600e21d22ade269fdab9af235a5fc2
2138 F20101111_AABKTL lindsay_c_Page_21.txt
92190423fe33b697b159fea633d28e97
76911fff9a4cd72406ab322fef978957a74f76aa
65549 F20101111_AABKSW lindsay_c_Page_86.pro
f8a089baed7b218a89f7a5f8c9bce054
c301920498a922937115911f298275c5645d3b99
2107 F20101111_AABKUA lindsay_c_Page_59.txt
1e09efe546ccb155f18f984ca40622a0
b1072f63c1e6bb01bb7407590eb5e8cfbf6a5eb2
2238 F20101111_AABKTM lindsay_c_Page_23.txt
d310643cc145a8bdcb7ec4e51d4260db
737dc02b1865741394ab1d2c90ec6584f3480500
5829 F20101111_AABKSX lindsay_c_Page_88.pro
51ebd4018b2f5303b312e534212b012f
0a69d7ed570e0eaf62e40a0f0716c5a41ed613b0
2192 F20101111_AABKUB lindsay_c_Page_60.txt
3c4a3368a4785aa5db11b292cf523946
af24de6033a146d7acde9cf7a341a979789c20da
1899 F20101111_AABKTN lindsay_c_Page_30.txt
852c4aa660c6ec0913fe8ada26b42eb0
414c525a12dd30ccf53a869ab84d11d12aab6536
51120 F20101111_AABKSY lindsay_c_Page_89.pro
878a5b4570457b48b6934165285a7ace
228ecd4e883ca91fc3249d463afef21d8d8a2265
2211 F20101111_AABKUC lindsay_c_Page_62.txt
262c5a82ce3531eb96a1d735c8cfacff
4d8c6d5adc9cc90a5da6d732a510da4e1d52de7a
497 F20101111_AABKSZ lindsay_c_Page_01.txt
cf460617ff07de6abbc32f0f1b320682
23ce5f97ddb2be7b0efd8d685bd29cf0fbf4f7fe
999 F20101111_AABKUD lindsay_c_Page_67.txt
dba45c8cb39250035b50afa05ffabb10
9c253a066d01d18d144cfe351db8a5a6215d214c
1658 F20101111_AABKTO lindsay_c_Page_33.txt
e8158133bcd39ecf47a0c507a3e3344e
efe723694e5518f73c22513597dbf918cb767663
503 F20101111_AABKUE lindsay_c_Page_68.txt
4bd5034c239d55dbdee30d13d0a27e36
3783d8f49aeed753602ae683bbb6c82fb4f85c9b
1816 F20101111_AABKTP lindsay_c_Page_35.txt
0233987eb7ec8b7ca41692e1f9aa8061
bb976f549a305811c9531a8226a9e71395b1b7e2
997 F20101111_AABKUF lindsay_c_Page_69.txt
86e995cf9397bfc5757770fb2d8fe843
6b6b1c299655545bceed988cf44c0e092a960dc4
1875 F20101111_AABKTQ lindsay_c_Page_36.txt
ba3970e46c01234270738d91d768c984
bb7181ce420542e69423f245511bc34e3f3c06ee
1053 F20101111_AABKUG lindsay_c_Page_70.txt
113ce1c98af11166c44c3193abf13338
77ebbe8be4fc7cecb44472b799d9a91e33cc8db9
2080 F20101111_AABKTR lindsay_c_Page_38.txt
2c26a9a16600e75f22462ee553c740b6
d81ccd3fbe4528c724f83a8ec58ee6d7ddae2a4d
2239 F20101111_AABKUH lindsay_c_Page_73.txt
0499c5397f5e8be8f2e001d15b7185fd
c0c81821ee59cb9748a8544b3940f3bad1bed5d4
2171 F20101111_AABKTS lindsay_c_Page_40.txt
729157ea60545e049b2a90caf7190505
bac79889cb857ea60ec6a2ad1ffb865d12116d55
2220 F20101111_AABKUI lindsay_c_Page_75.txt
20e6b103602c7b47ac4c6c161ac8d3e7
c1f12f496ab3b9d43be83c146b3aefec5908ceec
1680 F20101111_AABKTT lindsay_c_Page_41.txt
556deeb8f0aef7858eacb19d698ddd81
23004bda41f338097bf29dc8545e8bb2933beca4
1466 F20101111_AABKUJ lindsay_c_Page_76.txt
409a99d72ad682937cf10b326a52a3cf
8f4d55ca6a626c1066dfb22686ce5085013c7c26
816 F20101111_AABKTU lindsay_c_Page_43.txt
77648d97d8e0f9dae6c92e88d41d8da5
afb8ef24b6631c0c42679d0eb00c566256f56b0b
1323 F20101111_AABKUK lindsay_c_Page_78.txt
f28d09390ab7a29ad0609688506b4d78
c2cc214eeca27cfb9f0e1a8294fc78c9730ec7fd
1109 F20101111_AABKTV lindsay_c_Page_45.txt
8410bf98cdf682b9440b0c4d5310070a
aed3bf8804bcd645e9f7f5082f5deba0ecc7aada
2553 F20101111_AABKUL lindsay_c_Page_79.txt
5d6838adfba756c2ddbbb04d894215be
49eed47aa1737ce21c7a858d10b0c038d47dfd45
2326 F20101111_AABKTW lindsay_c_Page_47.txt
eee2dec592cd98ac4a4b5b3220472e17
fdd95f0ecc02d2b89e1aca0dc2c40aeedd4e53c7
2748 F20101111_AABKUM lindsay_c_Page_81.txt
18c5e9268b06e51a0773d03a1b4a4b1d
c9dcda305318e2f6751b6b3cacba2ecf4da44c8f
2225 F20101111_AABKTX lindsay_c_Page_48.txt
922a1e1f7d6175367ce923e9342a1955
9c63e3d47456e29421ae053e20102237c0cfb2af
3540 F20101111_AABKVA lindsay_c_Page_11thm.jpg
3beefec56e892f65ed56ab89ac9c3243
874752bcdb4b606796ea856afc65761911472fc0
2805 F20101111_AABKUN lindsay_c_Page_83.txt
7aeafdb550b11de70b3648f6131368b9
714e054db85dbcd606d296505489cfcead00c727
2051 F20101111_AABKTY lindsay_c_Page_50.txt
6577055b0bf8c94adbc3d7e7a33e2b90
900a194808d532f9a01e31e1782613399909cb5c
21793 F20101111_AABKVB lindsay_c_Page_12.QC.jpg
624387cca9c4d5653c172e5d3a88b644
7deca2d3736b2b43c5e59404bb3486c83af55767
2515 F20101111_AABKUO lindsay_c_Page_87.txt
9a783a8cc4a292808b8c1d3efce71609
b476123c050d056fb3465bb10a78a37888a37293
1139 F20101111_AABKTZ lindsay_c_Page_51.txt
a4d6b06f5a9e2ee4c75cac3f998e6e15
66ab29dcb3b3a85447c80af7a722e4b2030c2a9f
6182 F20101111_AABKVC lindsay_c_Page_12thm.jpg
59bf5d7d757ca495566ff20412e3df8b
3f888801ac3ed4e167a8c857a23b1dd6a5a3b585
7032 F20101111_AABKVD lindsay_c_Page_13thm.jpg
6bc2312920b003ae9bdc4b02f4b7cf84
76f4243a3b7dfdeffdfb3fdbfebcb8407823f2dd
231 F20101111_AABKUP lindsay_c_Page_88.txt
752c0200f4dca1d443ca934d0d961400
8020a6f6891ce98ebb6417f64004f87d3a6d16b4
6635 F20101111_AABKVE lindsay_c_Page_14thm.jpg
052ac01ff559c52f0f6d20465ac25ea8
0404df9a9a70a70f7ddb0fdc227ea0d7d020bf05
2050 F20101111_AABKUQ lindsay_c_Page_89.txt
e1be30474e99c6b79ec562f9fca6033f
a63d94277d64bdb4a8e608711aa9bd746b257f88
25013 F20101111_AABKVF lindsay_c_Page_15.QC.jpg
a31c4c8de62faed6ca86b685febd55b4
b976b3966e49bd6aacbaba561f66cf595ad234ec
7578 F20101111_AABKUR lindsay_c_Page_01.QC.jpg
7be7c02d5b1b8854c11b68e8587baa30
ff8a62bb1370a7b5b42ee184a71e22bcdf8dafe2
6919 F20101111_AABKVG lindsay_c_Page_15thm.jpg
80ba96f5a8d15deb3d56196e91b9a541
071ee64c4b3d5209ea4b38ebe2675a3956137437
3065 F20101111_AABKUS lindsay_c_Page_02.QC.jpg
2f0c010da4f2a20b1fb99376b3973820
2a564ae887b5706f0d4d995beb762dbdd72a4791
24464 F20101111_AABKVH lindsay_c_Page_16.QC.jpg
bbb97105fc83cdbc785b55f7f0d48c0d
a2304d8ebdbd1b191939b3e80a4b3a2a0e5ce84f
1403 F20101111_AABKUT lindsay_c_Page_02thm.jpg
4733e378034fc7cc6264dc55a3523e07
eecf307e10e2f453cf10a9bcbfdb82d01e54ca3b
6799 F20101111_AABKVI lindsay_c_Page_16thm.jpg
e9a4476b8b56264fcbb832cbb8264605
057e4bd6241cdadbffe92a198da18d1763138b0c
5777 F20101111_AABKUU lindsay_c_Page_05thm.jpg
cb879df4b2235c104c547eb6ba9eee68
cbea8171316782b23582d69dd170a890a49c4f09
25983 F20101111_AABKVJ lindsay_c_Page_18.QC.jpg
8796e1e37157b3c3d2b42b25938d49a4
0e8e2ec88ea06a72210ff35d9f499b6e88cf0370
10648 F20101111_AABKUV lindsay_c_Page_06.QC.jpg
dd8536b466e2a31c2f2510df8a68f3f8
045208572ddc06c4bd3894f3deb0681ba339b1da
6804 F20101111_AABKVK lindsay_c_Page_18thm.jpg
fe93fdf8cff308dd07fb6bd19b400300
49831f6e599b2446fd6d525ff111e24921323aaa
3446 F20101111_AABKUW lindsay_c_Page_06thm.jpg
127aaf61ac7d7e342e59b4aa334f2a62
7d6eed91b9df71d655334aab9cde7819d1a3234d
6950 F20101111_AABKVL lindsay_c_Page_19thm.jpg
98e767fa0a0fcdce7e994944ddd55618
9b46b858a7225af8d8f3cd2d274462f246b190bd
6589 F20101111_AABKUX lindsay_c_Page_07.QC.jpg
92868a3c6487d0b2d7b0c304d82fc1a9
cbce6cc1859d70301c3c22038851d7414b7cd44a
18679 F20101111_AABKWA lindsay_c_Page_30.QC.jpg
6c63adc25db21b7e54146b9570e6569d
a64206869422a46c58039c837b7a70430f4570fd
26302 F20101111_AABKVM lindsay_c_Page_20.QC.jpg
d248f98f932eb0e2e5aa421d431468f7
8e43b88fe1115c78220f3a269454bbb7501e2408
2612 F20101111_AABKUY lindsay_c_Page_09thm.jpg
91910b02e58efd4d95088bb9216e56c9
a2eb840830f72f0e9192d50cda06a4bf586e4747
22942 F20101111_AABKWB lindsay_c_Page_31.QC.jpg
8994bc3388bec017f96fa00d5b968158
33a7f9a52012eaa0f4437097d3d766806818783f
25123 F20101111_AABKVN lindsay_c_Page_21.QC.jpg
ae28b66f7edbd7da476ed12320854a9a
91e3d3370ae3fb223fe5346507f7c509d499f095
22456 F20101111_AABKUZ lindsay_c_Page_10.QC.jpg
310df15fbddb4ec2cac10c44c8aa605e
451e518a0839235f11fe99aea6120302253a19c3
6320 F20101111_AABKWC lindsay_c_Page_31thm.jpg
4d5b33cb83cfb79818f1a5c51c2fa40b
bb90b1fc02f945d085ee1482a9288190866b1e5d
6858 F20101111_AABKVO lindsay_c_Page_21thm.jpg
57dca0f5030bfcca424c9fb30420044d
972e55ad4c53c520eddb2858737757e985a8c92a
19690 F20101111_AABKWD lindsay_c_Page_32.QC.jpg
14c15b5cacad92e4ee37e6ec70819928
220090866be9288e6454b06a3303dc8939babb48
6874 F20101111_AABKVP lindsay_c_Page_22thm.jpg
4c2248e5abf36e6f3c99917de30b299b
61f3a87f3c982e90cdedf3650950e25c742a2858
6078 F20101111_AABKWE lindsay_c_Page_33thm.jpg
1f3ec99bb7b72e4b940e381c129860e3
17c5d3ee70bda92d1f9ec4e65cb5c7eeff106f4f
20931 F20101111_AABKWF lindsay_c_Page_34.QC.jpg
f8d7e20a860c84fa7d9b1f2340b043f0
17d1a6cf9f717e4c05d7aa2eb068c681e04987dd
26524 F20101111_AABKVQ lindsay_c_Page_23.QC.jpg
b54807d8f39580910d0a43061028955f
4576c0250d5cc70329e9a477f21a55555ade5ad9
5929 F20101111_AABKWG lindsay_c_Page_34thm.jpg
636a5865d7d4e2ea2d050b0c51703a49
ed284ea1bc78fc58cd4906391166eb222218e262
7083 F20101111_AABKVR lindsay_c_Page_23thm.jpg
5a9114cd4b83f9751b113296631582d9
07f10e910fcfa5f7d7a4fd9f2a50c64d4279d866
6181 F20101111_AABKWH lindsay_c_Page_35thm.jpg
2b43f6532b6844d53aa6b17a6aa10f91
2e812d801eaf3acab9f2ecbb8559a3f3cfaf70ff
21416 F20101111_AABKVS lindsay_c_Page_24.QC.jpg
01f16bc39c319eca8692a093e7dadba8
c93b84385875da3c500de552bf8b969b285d6524
25290 F20101111_AABKWI lindsay_c_Page_36.QC.jpg
3457477a95b9fd2cec011f8f2004253a
5df5497ac4ff19791489b401825497921cecb368
6653 F20101111_AABKVT lindsay_c_Page_25thm.jpg
fb3f0a8b1e52dceae22b06251e9638e3
d603f33eb4df75ee837e1cfb08330f67510fbd69
23248 F20101111_AABKWJ lindsay_c_Page_38.QC.jpg
893154870857865945c779c9bc12dee5
c17654daf06c6b23576de3d1db9403e9bbf3843b
25939 F20101111_AABKVU lindsay_c_Page_26.QC.jpg
b16fbd264dfb4acbe0f951fa1f6efb99
117cae4597b9e1c116d766100b7c6c6cbac8743d
6574 F20101111_AABKWK lindsay_c_Page_38thm.jpg
aa2eb9c4e81e1437c4eb62d96323b8f5
0a5497130b71b6fd8a6a357c8265b25bdc6a6b26
26360 F20101111_AABKVV lindsay_c_Page_27.QC.jpg
ce72669a4edfa117e31b534e12f361e0
c330996668e4836964d9313ddb082c396de264d1
7075 F20101111_AABKWL lindsay_c_Page_39thm.jpg
c1600e54024f51cd722596f5b9ad65ba
1c2311732741eb71d36007378a3fa6d9f9b7dae2
7065 F20101111_AABKVW lindsay_c_Page_27thm.jpg
e40db0b38db9b0f2d111071f6bc5b126
4b6df46f23d9d73ce4d46f4a98cbad0309844235
19717 F20101111_AABKXA lindsay_c_Page_51.QC.jpg
c752047f73a19ee2716407072a04a826
da3b167b9adaf730498c07178166004845c0d15e
26409 F20101111_AABKWM lindsay_c_Page_40.QC.jpg
a433631dee4139e2dc0ea2f06367c2e7
3c8f8fee048dc96c5e2149f99e85aa650b64cd28
25136 F20101111_AABKVX lindsay_c_Page_28.QC.jpg
60d72c4aaaf079aa9ed0fe00f5c783e1
f731144267f9313ba9ce2f009e375074cda43f5d
13408 F20101111_AABKXB lindsay_c_Page_52.QC.jpg
647761fc8d06325aab29264f2fde46a2
08799597549a0415044ae3796446cd189e66d223
7098 F20101111_AABKWN lindsay_c_Page_40thm.jpg
46a837dfb0655496c523bccc2d0d2f3a
8d97fdf2a57e8f2f75312dbdef615588e61d47ed
25268 F20101111_AABKVY lindsay_c_Page_29.QC.jpg
025dfd5d5620638cd966ed06e38ab287
3a064ff4c75e52f860b039adabc59f310603b58d
4085 F20101111_AABKXC lindsay_c_Page_52thm.jpg
72d7b0204c10a2b74bf57872ef897c0b
c271d7bef4cf31fc274953ac04051331474e517d
5547 F20101111_AABKWO lindsay_c_Page_42thm.jpg
9fda7411e4eba4d559c4a926a2994cc2
9c0111875332382a65932d7e4c7796d1ce0f5967
6600 F20101111_AABKVZ lindsay_c_Page_29thm.jpg
b88327bf237fd856f861ff94770d6c67
dbc33cd9af7abffa20d93b299e801395b70fed0c
24924 F20101111_AABKXD lindsay_c_Page_53.QC.jpg
5470df9a93462f257a52b0f4b1aac1e3
705b2fad7b8222afb86aaf30ff66f56c1b188da7
6062 F20101111_AABKWP lindsay_c_Page_43thm.jpg
3de43e1031261c76bc107ef026221205
fb39fe066cda0018305304339beece3753de7dc1
14174 F20101111_AABKXE lindsay_c_Page_54.QC.jpg
5dc3b35c2e3e5eb23ba570a244f34bfd
95cd8aec5db2d5cfbbba74e4ccd400767773e81d
18846 F20101111_AABKWQ lindsay_c_Page_44.QC.jpg
f9b0d338255851ec65b14d9161c078eb
960aa47374c479ab88405cd0bde39f97a591226c
3949 F20101111_AABKXF lindsay_c_Page_55thm.jpg
a088a87cd830052d9aaa7c04b18a3217
e63d0fca46972266f40d8b004eb9baf7c28f220e
5668 F20101111_AABKWR lindsay_c_Page_44thm.jpg
cbe3ecad05c713614b28b6c15248e48c
78b7e4237142f9d209048eeeaceb213fc077e810
22225 F20101111_AABKXG lindsay_c_Page_56.QC.jpg
1792204f6afccaaac96d9856efb94208
b6a55565e62840804c624d11b06a84a2806eef85
23145 F20101111_AABKWS lindsay_c_Page_45.QC.jpg
8b9a2a0a329da5b907155e6552278c86
52cb45c0f02b90f8004a0f3fec8c84d9b1c7d0a9
6007 F20101111_AABKXH lindsay_c_Page_56thm.jpg
330737381cf78faee7df44b726dd4a7e
f7063ffb73c6f56b2c2360ca374c66e5bebe4c78
21824 F20101111_AABKWT lindsay_c_Page_46.QC.jpg
d3974040d13ac7639b204c1765d17cdd
237c9d9e1ba34f70ac67eccdec4d378df9ea924d
5935 F20101111_AABKXI lindsay_c_Page_57thm.jpg
5ead9e7426bc7ec75cf6b533976a22f9
eeb20a960b42663dcea0d0c356cdfecbc2be6596
7079 F20101111_AABKWU lindsay_c_Page_47thm.jpg
d07bad682d695a12a2225dfaf4bfd249
09a0099e4d658a10854b372b6cf3200813410d40
26107 F20101111_AABKXJ lindsay_c_Page_58.QC.jpg
f5cc1d6741d622dd3811bd34bb74c86d
ccff30966cb6a77dde55b885e93271320a2d642c
26555 F20101111_AABKWV lindsay_c_Page_48.QC.jpg
c3ab943de170e8062b55d312769e91a0
127a76d4e5531e9f44d8482a79904afd60605e0e
6939 F20101111_AABKXK lindsay_c_Page_58thm.jpg
53ab95e3befa33dc1a6a407837c8a720
e4053cf8f6878f29f9d20b9a5983f25b8388f9b0
7061 F20101111_AABKWW lindsay_c_Page_48thm.jpg
5c1bb868af578a20fefee5d325d1162b
98eb09dc8ac9a894ccc0ac64eb6558bc3268be80
26995 F20101111_AABKXL lindsay_c_Page_60.QC.jpg
b5222bf6f5cd3aeb34f2a160b7bcbb31
b99390b76c9346a0b5f35526d1d452507d098b21
27039 F20101111_AABKWX lindsay_c_Page_49.QC.jpg
9836873eac5d93232b5ccef8bc8cb634
d5e370fa890258755d156217ec4957addd8709cf
26666 F20101111_AABKYA lindsay_c_Page_73.QC.jpg
25e29d94cb2f8a9df0456bfb064eec92
55bd74ac5dc7f17090b34c83c3c3670d99d62efc
7206 F20101111_AABKXM lindsay_c_Page_60thm.jpg
8687a9ec3d0486ff8a5f03e6402bef6e
992faaeaab59355081498b920f45ccb41cbaf767
7108 F20101111_AABKWY lindsay_c_Page_49thm.jpg
a09ff750e362d1249f039807a367219d
3650fc9f6b3bcbaa3b6e299df7d7f2ac085ccf65
6951 F20101111_AABKYB lindsay_c_Page_74thm.jpg
5805dd34da413fbbf7c9e9802ebf7e83
85257cd2f35b239bc7cbeb96ca463f9f430a6b1f
26698 F20101111_AABKXN lindsay_c_Page_61.QC.jpg
0d401a29b3315e39ebb47c2bdf8e93d7
2f41c736036008464622f51b4318c1be4d95b702
6887 F20101111_AABKWZ lindsay_c_Page_50thm.jpg
6f307e525a572096970e3ac7c1d2ddd3
2329e7a1da211a01131657b9faeb9310cb440709
F20101111_AABKYC lindsay_c_Page_75thm.jpg
454c4c3240629c34756f9d6dc0b6be0f
5b7c8a82fb2ddbd1d670982627b083b81dc44de1
25863 F20101111_AABKXO lindsay_c_Page_62.QC.jpg
d2fa9f6c919d189a0f62757be0bc2655
8445ea324594b0432934d3ed1fcfa23dbb6c31c9
12815 F20101111_AABKYD lindsay_c_Page_76.QC.jpg
e01e5e263a8bce1482c2a2a20460b1a6
aa6856c1c64053adad1343b7d53443d7fe48e7dc
6839 F20101111_AABKXP lindsay_c_Page_62thm.jpg
9c22e3386f48845a98aad76c6851a8be
5940ffbbfc8c8c08342430ff694da22ab9ac6f55
3665 F20101111_AABKYE lindsay_c_Page_76thm.jpg
eac85faaa189aaa77c8ceb16d9b4d35e
6ab5126a8854848dbf8e6948d2448aa483646238
6857 F20101111_AABKXQ lindsay_c_Page_63thm.jpg
89355efb0af38b3e74b2990e111736aa
9a18cfccdd4acf87b698b7e468ebdf7cb22f7bec
4106 F20101111_AABKYF lindsay_c_Page_77thm.jpg
f10b4461dd371eaecd5a65eeb61b1215
3f4f182e0302c618f144471d0473a0d3de607ee4
17497 F20101111_AABKXR lindsay_c_Page_64.QC.jpg
bc0c806af94072b276061bcbe7652702
598690631ac7021a12f0cd3fb934de14a5948451
5384 F20101111_AABKYG lindsay_c_Page_78thm.jpg
0dede7fc8b92fe14ccf49659dbb4003a
59a88478168c71f2763a98c28a46a308365ae097
28679 F20101111_AABKYH lindsay_c_Page_81.QC.jpg
3204f35dc61bce27e85b0e3c646c7c04
aa57c7faabc14ccef33d3e76513180eec0dcca0b
4927 F20101111_AABKXS lindsay_c_Page_64thm.jpg
034b858e9a9edd527d57aaff8e9cf760
1cec8b968c72e042f7ed12dedb288f3dd7a3a18f
29760 F20101111_AABKYI lindsay_c_Page_82.QC.jpg
1ebe7063ef0af2ec165e61328b7a37d2
4b27ad98bf5a06f3a9fc6033b8299828e510a55d
2810 F20101111_AABKXT lindsay_c_Page_65thm.jpg
8da3677d8e9d26c95fb55ba2581e5d18
29d7f450d3cd28986f471d20380dd4eb9f86c50e
96889 F20101111_AABKBA lindsay_c_Page_80.jpg
d0c687ee76d2c85c188b9e22e16f3fb3
5a4bf6cbdf579cbd45fdfd9d36b84360f7a3ad65
102257 F20101111_AABKAN lindsay_c_Page_37.jp2
680ce2bc077e1933450298032096e87e
695f1adbe9ac59960ca42f814e4c984da036c459
7522 F20101111_AABKYJ lindsay_c_Page_82thm.jpg
82cf8bd9686a380ae76d17d23eb0b425
b66278fd9edb903198e51c53e100a6b113daa7d5
23007 F20101111_AABKXU lindsay_c_Page_66.QC.jpg
ee989ec9ec54e0e402eed9cd12efd9ac
e04e25a432973a1435c7423785b158d16f3232b6
6984 F20101111_AABKBB lindsay_c_Page_04.QC.jpg
b109494c95cae0e124e309327cd558ce
385a3740e8f376edcd5afbdb597bea04ce58d7fc
1051944 F20101111_AABKAO lindsay_c_Page_67.jp2
ecbeeceedb03f41fd447bdbd310bd058
4227b6535354e13d0219307d9f2dc21ff017400f
7525 F20101111_AABKYK lindsay_c_Page_83thm.jpg
ac47099dc8b7c903caaf522fae877425
22d1e73f3a463475870831d142c77bd6239a64bd
17607 F20101111_AABKXV lindsay_c_Page_67.QC.jpg
b8f35aa9e9895e3e74edf2f29264ebe7
7547815a11c65360555b3a6f3eedac446538e4c6
2062 F20101111_AABKBC lindsay_c_Page_19.txt
6df0bfae0f26f8d63d7f4b271ee1477c
063b18db1266affe1625d3c89156faf8b4f680d9
12594 F20101111_AABKAP lindsay_c_Page_07.pro
f9842131b7dc9be92a242561b907939a
dc948122d226e0939d878c792ffdc3b70f90a37f
7313 F20101111_AABKYL lindsay_c_Page_84thm.jpg
edacfbb108f8fa12e97aa2654410d790
d53a0c6cc54a2200109665b97e34267c7e139333
16533 F20101111_AABKXW lindsay_c_Page_69.QC.jpg
dcf78ddfbda114c8fc3b0b64806255e2
e3ca84b5abbba81e615d37c2daf6f1df01eb686c
F20101111_AABKBD lindsay_c_Page_10.tif
f9ad439d98b14c2a544ab8f0aa5c9c2f
f32d92da1d775a570ac1e167a785de40f151a612
F20101111_AABKAQ lindsay_c_Page_16.tif
dac96dd734117ebcf9c3417bcc5936e6
ed601ab5aeab24adc5fd5975abf6257a781d4942
27764 F20101111_AABKYM lindsay_c_Page_86.QC.jpg
b39cf694521a5a6b082548ff643a0672
3dae2a713d6c0055cc2ea25bda71c489776bbfde
4659 F20101111_AABKXX lindsay_c_Page_69thm.jpg
d73773b02a969cf2164fcc091fa71297
4935c5dd4e7bf4d472b9d680a9b24a384790917a
25372 F20101111_AABKBE lindsay_c_Page_01.jpg
6534ef147688c66178ac22e24cae1013
6f159446327a7778533f5bf4745c7b804d1f6495
94507 F20101111_AABKAR lindsay_c_Page_34.jp2
e275c8701a37f8b946a73327609de0b6
037511b4023d26fc64f68ec20493c4d16f24581e
5134 F20101111_AABKYN lindsay_c_Page_88.QC.jpg
d8b30e1cecced0d5b409d10396c2fcb2
9e8184150f056daff231d85c950eeb064e602cae
5240 F20101111_AABKXY lindsay_c_Page_70thm.jpg
40a2d98cd9f977605d100b8b905cb04d
a9fd7d8f353c19c24e0f52fb9ebde586dfa6ac5c
7356 F20101111_AABKBF lindsay_c_Page_86thm.jpg
145fbea6facf73b953760fabe5c900f2
f99fb6ec07dc8bf9808d6a24b8bca7ac726f9728
7007 F20101111_AABKAS lindsay_c_Page_73thm.jpg
74699aa55879a5dbc39cccf51e1fd3be
d6a06fb8d585f77f9a305a79822b8dd79e0c5637
1738 F20101111_AABKYO lindsay_c_Page_88thm.jpg
84ac18f4538cbd264c03df978af7816d
a7db9e690b16ffd1dd8fab3035ae7531aa95b58b
25495 F20101111_AABKXZ lindsay_c_Page_72.QC.jpg
d2eb589e266aead66327689b271aae10
7adfa692d01884f0b518b109e35fe824721c3f9a
96 F20101111_AABKBG lindsay_c_Page_03.txt
4c0a688ceb3b3b9539d946d490ad7a93
05050ec0563c61c137c676878dc21a881b0938a9
26069 F20101111_AABKAT lindsay_c_Page_59.QC.jpg
866656a812f2de2dae9bc76f0a7c1d2b
a2855a1ad8b2c9a5cbea28d1f1e02d89145e06c1
24695 F20101111_AABKYP lindsay_c_Page_89.QC.jpg
9a34143be9137ff8e55844e5bca16c6d
e300cf26a0f2cae2e4e96ee0fd39a96392c5660d
121376 F20101111_AABKBH lindsay_c_Page_58.jp2
761fe77421b06ab601ea125c87dc7a9c
5b9f4d3bac69346270268f78948096e33a7bc106
17295 F20101111_AABKAU lindsay_c_Page_43.pro
23dda701cfef08b9f72adea30f91c9fe
88f2376471fd438247bc825fab2597e5814f3a8d
104255 F20101111_AABKYQ UFE0021973_00001.mets FULL
fd393a82808152771023374747a1a77c
dd6a839f05a004b6a4b937cee31ac92949e761a6
10176 F20101111_AABKBI lindsay_c_Page_03.jpg
be6bb53022dd791e31408be65e07a008
80157adccb247bd18ca2c64ce95688c24716d9f5
94951 F20101111_AABKAV lindsay_c_Page_85.jpg
e3ed4ac1542d70302d8da36ffa5c0d71
c78f8b547719ddc88165ae1f3083703009292ce9
F20101111_AABKBJ lindsay_c_Page_30.tif
bb3f319f380bbedcac0d2bf7873c6123
1c03719cf132d8f4e0991d1cd3ebdeeb5c0758fb
24248 F20101111_AABKAW lindsay_c_Page_50.QC.jpg
10315e54a44bb64a02d8f0ffe2263d9d
b16369e60a4b2525bb6901801776bffec2b6be8e
2760 F20101111_AABKBK lindsay_c_Page_80.txt
5d841ab879d40adb3a4c00600876a915
672a32bd17237630c3a4e82d2dd9815bb9ec903c
2089 F20101111_AABKAX lindsay_c_Page_63.txt
bcc06e1ab5e1d61565aa1059c4a245ef
e088a6e520f080b1757f55e6c9cbb0ebfe890411
6964 F20101111_AABKBL lindsay_c_Page_72thm.jpg
9c27d474094a1fc5885f63a432703c40
9ba886035531e383aa37293e62f88868cee99318
7334 F20101111_AABKAY lindsay_c_Page_79thm.jpg
ad74eea4550d417bbb43a3129a04bf14
29218258dcd711a1dec11355a54fd70c46ca4741
77000 F20101111_AABKCA lindsay_c_Page_56.jpg
e710e1cae866cd9ee3e1bdc70427fba9
192adbab8a32c6f513ec3b732152045cb5704b59
6810 F20101111_AABKBM lindsay_c_Page_28thm.jpg
c069ce072f313f2139f2be76882a083f
1a47b2aee15d4c032d36ec1c4672deaedcca8efd
1051983 F20101111_AABKAZ lindsay_c_Page_53.jp2
79cf8f77967e39cbe5a4b6e1bd934384
6355a868381f7ce9752899a1d2159ff13fa19994
13201 F20101111_AABKCB lindsay_c_Page_77.QC.jpg
68179052a7f24e9e7aea3be1cd96796a
a55e16f37d48b5895d9b88d7ec2e1d4ed9ec77b5
49023 F20101111_AABKBN lindsay_c_Page_11.jp2
47219c0efccaa2b13174ad7671e780fa
73a1f44a4ede15e2207956f9792156da6a524392
79598 F20101111_AABKCC lindsay_c_Page_40.jpg
1cff124410994cc485f9e36648842522
f1067da1437657e664d7191863a3df5bf88c113d
3016374 F20101111_AABKBO lindsay_c.pdf
86cd79bcd6512d0e6551bdc1f0cece4d
4430415434bc40fa5cf96cf479e39f2a1464ee14
45990 F20101111_AABKCD lindsay_c_Page_52.jpg
72293a1205b9709c838ae233dadfe3f3
ab0c46d09abb59be3de0d52fe7ad44b7bde2852d
1407 F20101111_AABKBP lindsay_c_Page_03thm.jpg
aeb9064e5f367a2e64de9c2257eb0ca7
c817fece148d531c68a5ad662864b59844c08dc6
774854 F20101111_AABKCE lindsay_c_Page_70.jp2
5b2112194442b1f315b59a628ce4ce03
e2ccc9325544e282709ca90a5cc710565c319546
F20101111_AABKBQ lindsay_c_Page_74.tif
6a808e409ee6af8fb09f5b39480bad5f
b230071c025f2c913f3f902a5a044449ccd80b22
7010 F20101111_AABKCF lindsay_c_Page_20thm.jpg
b0f7201423f0ea1fa7b2ac6740806098
3fe845dea33474aa9411299fb5b663b86647e3d1
97193 F20101111_AABKBR lindsay_c_Page_84.jpg
8fb0378b9755f29aa0d1b1b9af727d7b
37cf1331a3ef30854e3744228f9b980dd1efceba
1769 F20101111_AABKCG lindsay_c_Page_24.txt
28bc4accd93fdeae0109c4e7eab5c523
2e0982e25bfc5c840349ecd45aee79693cee104d
6281 F20101111_AABKBS lindsay_c_Page_10thm.jpg
585266c8a50fc9c258ecd4db7b28f33f
592bcd2285ab29518d7ace072ac991826f0158cc
498590 F20101111_AABKCH lindsay_c_Page_71.jp2
7e05e06e19f20547797426a9c2ffb0d1
e91f4aa91cf54e80ae0d44def3c4a197fb475d37
F20101111_AABKBT lindsay_c_Page_11.tif
f0f71d438ad5fbfa9849e742dc3a17bb
258033cf8024d2d03d7145382f1a69978d9eab2a
5400 F20101111_AABKCI lindsay_c_Page_30thm.jpg
85c5aabbd9180d2f76d872f58f99443d
217bea5832fc6bd7af25d1cb21746199b397dcef
1462 F20101111_AABKBU lindsay_c_Page_42.txt
fcf0a56242a9bc3efc104ed175995977
8b16a2bec88e66b6be3c645d5eeaa7f75e2444ec
679477 F20101111_AABKCJ lindsay_c_Page_52.jp2
082732fb4a6704616caca018063d118d
a67f0468130185f6dd9eaf296a4eecc51e8e2552
F20101111_AABKBV lindsay_c_Page_51.tif
4c4ef009dfea5d09c98bb7d6f5477f34
9db1f1f74202c1c45995f847e8a40dba3c41c4ca
1563 F20101111_AABKCK lindsay_c_Page_32.txt
c5aa4585c62a366dfa3b0ab1c94dc064
59b93fbb7d0377203a616bb71f9e7d8ba25ff4ed
74964 F20101111_AABKBW lindsay_c_Page_21.jpg
374b4c1db42dcc88a59182066816c751
dfdbca581fdc44066e40b41f710c407e8fa165f4
121622 F20101111_AABKCL lindsay_c_Page_75.jp2
77b9d3de229d465ca79e34b21767508f
f7bc92e9cd59c34164fd28725fc484e31e348bfe
12759 F20101111_AABKBX lindsay_c_Page_68.QC.jpg
1bc9450b3fede8b0842ff8a803034cda
5584a074ad9eee60fed6ddff7278218fa1f8c980
7348 F20101111_AABKDA lindsay_c_Page_85thm.jpg
d19ae2f769b9915640448ea240e76a20
5f00f279fee670a8415e49bfce0bcd9d141c4b20
134508 F20101111_AABKCM lindsay_c_Page_87.jp2
886b232d054b32b1febc401f2f18d471
b39e56fc40ccfab68d6d5302f41968de7cae1e78
5851 F20101111_AABKBY lindsay_c_Page_51thm.jpg
6a038ea33f1049ead4d6c1608fa83100
93f4c7fb4498f806c94d3e3e130397cba8d0930b
1353 F20101111_AABKDB lindsay_c_Page_03.pro
7c083fb24ce40bdf2ccef27128d1546a
cd657fb005a8d7163161a8289cc3183444c49e7f
4075 F20101111_AABKCN lindsay_c_Page_65.pro
54175d1cc4c1c04c8774e332a7b54d7a
596fe582d304eb27edd1a535fba26c0f81e7d5ad
2048 F20101111_AABKBZ lindsay_c_Page_22.txt
854a4118146d48ce13dfb6241156fb03
1af5b5ad9cf682c576e5343360b5e0f9de4ab6be
26401 F20101111_AABKDC lindsay_c_Page_13.QC.jpg
292b0030bb2575f95b592affced540a0
b8489eaeeb614f6e10e0a475334ed0e6ff90cd4d
79854 F20101111_AABKCO lindsay_c_Page_75.jpg
930b5e20df2c1d7315f881c8d059706b
407a723282fee53e277f01e0aafb61587dd05345
118859 F20101111_AABKDD lindsay_c_Page_18.jp2
fb49eb36f4e29a605218f595465fae11
c6d03c09c3295b94c1ba3ade6553ce7b6b52beb7
F20101111_AABKCP lindsay_c_Page_82.tif
e5219c729aa53401bac2df89e50ff960
e42ecdba0bd77250aa39fe278a9f929ec65b3f0b
2199 F20101111_AABKDE lindsay_c_Page_27.txt
1ce35e6305bb63f34d9bb4882dc07045
6d248f788daedc68b796f9cf630da897252debae
70529 F20101111_AABKCQ lindsay_c_Page_31.jpg
ac5da4b251eab3247de10bfb4c9897ff
fd1125b7f6dc91e5d733fcf06f8225bb1cb489c0
24832 F20101111_AABKDF lindsay_c_Page_08.QC.jpg
d3f85b5a4a5f92a498e245549001ff3b
a13d84187af838c5047f686bc4439afbf917ce4a
18222 F20101111_AABKCR lindsay_c_Page_42.QC.jpg
b963f83ef958c7522c4ab04e1bcb2aa6
acec29f3b6bac11fd40ea4282afdd1d20efad3f0
25934 F20101111_AABKDG lindsay_c_Page_74.QC.jpg
c53bc66895f2bc63ad8fd32a21a7f6d8
39e81ee7edbb90eb9d3d808a0df67d856954915b
F20101111_AABKCS lindsay_c_Page_75.tif
f0b7734d326c5591c5add0cccbf7ee18
823ecce14257d6c99da801fd225c1e043ad4e3be
2176 F20101111_AABKDH lindsay_c_Page_39.txt
c24a6171b39af32351429e0ed6a2eb99
a9dc507fceb60d8652bf2c933f6ed031ed5951d6
7321 F20101111_AABKCT lindsay_c_Page_80thm.jpg
9ea664ed96859dce446024f07b001fb3
2e353dc1e0a54dd3c0395ce5db9aa5e0a7eaab20
1236 F20101111_AABKDI lindsay_c_Page_54.txt
4836f88c82707f10b60bcd0a789dd299
23a012414104d579b075e6d0205162140461822e
2068 F20101111_AABKCU lindsay_c_Page_29.txt
40f3cdea65242d12c147eb7c701a32d8
303c3483b025e5509f85b6d179cefbff827471f2
19924 F20101111_AABKDJ lindsay_c_Page_43.QC.jpg
5241c6393f6a0eefb397440e98b55443
c599a3086f08977c48f490aa47df7046f05bed54
24584 F20101111_AABKCV lindsay_c_Page_22.QC.jpg
acc86458a416b6efd198e6c1b2f35e60
a8f29696a0b8e759c0204ac699e8ae1ea033f3bb
F20101111_AABKDK lindsay_c_Page_15.tif
7280406f50ce186f5e0013063a0beb1f
1c815350003a57cf7d68ebd3a34cc9ee49cc848b
12555 F20101111_AABKCW lindsay_c_Page_71.QC.jpg
c5fd484a0413ea404cb816c0c6fdf8cd
82fcb7cf7f6fc9c3a23e405efbafcaac41146d41
54502 F20101111_AABKDL lindsay_c_Page_18.pro
2cdaee296b91e35806bfbec07564371a
90ecb328f95a49f63d6a93590b04a74046517cf8
6958 F20101111_AABKCX lindsay_c_Page_59thm.jpg
5820d0e7a9348ab5d4d2335a045f7b76
13627d47b86c1fa2726f7deb0d5654633ea01a87
47811 F20101111_AABKDM lindsay_c_Page_10.pro
d19efe869aa918bda4c46b317ba62483
5afb70eb10a475a23002a67ee1277ca5909293d6
8264 F20101111_AABKCY lindsay_c_Page_65.QC.jpg
1468f8c9492ef5f3b4ef8b249fe049bc
ac115dd8d474f5eda4b5317d519427da82fb5359
4136 F20101111_AABKEA lindsay_c_Page_68thm.jpg
5c4a8d4ad9252b7e15ee4e7be9a33320
1d64c03fbefcc2826f39ea7589deaa50cb526fbd
6660 F20101111_AABKDN lindsay_c_Page_17thm.jpg
98e2ad30c1b22b06648190c4d0d63a43
1438a914ff42ebbaba9b00ba0d92ad17cff2db4b
1656 F20101111_AABKCZ lindsay_c_Page_34.txt
c6ff59b0fe3be5df63411b62e3483c6a
1d2a5bd974edde594847213c56435f7b9ca757f8
26500 F20101111_AABKEB lindsay_c_Page_47.QC.jpg
043155081d6678075ff9a0c246d9e24f
9441257b2aa2a7c82a38c148f792dc8af9de7230
3299 F20101111_AABKDO lindsay_c_Page_03.QC.jpg
d201ba7d037e3ba65765ccee62a7aed4
eae7607c43bf01c17267bc50ca97c1729bb8c342
25145 F20101111_AABKEC lindsay_c_Page_19.QC.jpg
c8e680231e5f611101c14410f4f6450b
ff8292e208e2dc235f2cfc3d4ace597c6724d8ab
77270 F20101111_AABKDP lindsay_c_Page_15.jpg
b52077064b7d71552e1b9430a3c408f7
8d4dadcdc3b25c921e613ce595666b001f2e4f67
73745 F20101111_AABKED lindsay_c_Page_25.jpg
38f5c77fae3af87209ac1690eb391a54
a5e78d896e685b7fb32e04246a5f33183823fdd9
F20101111_AABKEE lindsay_c_Page_84.tif
c4d0ad8e43c9847cf8c5c97347bb4ec3
0889405a1db7837f0d86fb513f3ca08a74d6fdb9
2111 F20101111_AABKDQ lindsay_c_Page_64.txt
fee6bf137ca09faf0d90ebd65a4fb2ad
366ad52db4ee18fc1ce4078ae44541f04de76d8e
F20101111_AABKEF lindsay_c_Page_60.tif
63c2e1ca3371b1234c719f34e8ff5d3c
295d33a346738c6ad9c6f46d9f8535ef00c760b1
52529 F20101111_AABKDR lindsay_c_Page_29.pro
4309d041966fd9b9a9535eddf317b23d
98edc0547609e8ba1d89d793c4b04db123a87a91
938364 F20101111_AABKEG lindsay_c_Page_06.jp2
2ff95f09337fdca18b22bcaef0969797
256cbf036d4b6b0b5c9c729a2d90db14960d5bb7
24684 F20101111_AABKDS lindsay_c_Page_14.QC.jpg
e59f6ebbf69e111d3316bf75c19609bb
3dca91394378d0e36cb705d0fc3a8800587ed03f
819 F20101111_AABKEH lindsay_c_Page_55.txt
eba92ae0d8da76497c5d918257e43bec
fbed8f57d6bd3a9ae82a0714222c12943ad69e17
6895 F20101111_AABKDT lindsay_c_Page_53thm.jpg
48f45db211abf5a2aec5901f509724ad
16d4be603d649a8b4224bfbbe107b3f44beeb282
62013 F20101111_AABKEI lindsay_c_Page_43.jpg
7333125671e16c3c5fb632cefac0571d
5d69f092ac29324100d4dbb47dd09bd17b1e90d7
F20101111_AABKDU lindsay_c_Page_23.tif
ea216b6e9994d03f8ebeb9ead2277709
098b1bf105173d2743c9789d948e7c38d0635b7c
1853 F20101111_AABKEJ lindsay_c_Page_56.txt
4ae8b309d44fb9bce6cb3ed62e6c52a4
e89748bae3e123bb54251e9b912a3d54cdb16e04
F20101111_AABKDV lindsay_c_Page_53.tif
98ca5e3f684438e9239ab4f40dba8240
70bee9f71005e6e6ba9af5b6bf06fa994661b1e8
17849 F20101111_AABKEK lindsay_c_Page_70.QC.jpg
3cb210799cefbd51d3fbcd8e672b7590
5f1e4b04a6474aad67d0fc846428f0454a2b35e5
122048 F20101111_AABKDW lindsay_c_Page_47.jp2
8275f39377edebb4c0a363b7788c339b
413be0278412b5242e32e79daa883def6d2ccb7a
112938 F20101111_AABKEL lindsay_c_Page_19.jp2
87b40d9663ed81361b0da7f19daf8085
e7b2feb14f65e45b9b63e016671e7a6fdf9ff063
120649 F20101111_AABKDX lindsay_c_Page_26.jp2
2f33f954bca1336b179ab4a6848d50a5
1d51be71cb69ffd3fdfdd907381cf244e270b35e
2065 F20101111_AABKFA lindsay_c_Page_10.txt
c1d86f29704b5936df6887f51e23dffe
e2747b6eef21aff242eebc9fe6a448f54df22e96
F20101111_AABKEM lindsay_c_Page_85.tif
8626793b49293e7475874aa2cc1ff990
33065d4b1fe4778b08e11f6e7c2c1dac56c28798
1715 F20101111_AABKDY lindsay_c_Page_37.txt
1026e2663cddcbb377622ef8862e4098
65eff9d0931b603e91116083c9d53f5be6ff18e9
59123 F20101111_AABKFB lindsay_c_Page_64.jpg
891f0aa3b677ce0bbcfa661e30a464fe
d6892edb845974744e25bafa426af78b93181852
F20101111_AABKEN lindsay_c_Page_49.tif
5c9519819187aae5583c168ea8365ec4
bf05355e86377b8d8a35266b3cd863767dcb2f0c
27774 F20101111_AABKDZ lindsay_c_Page_85.QC.jpg
ab822536dff6204802b7176e0b7f9074
03d431c59e55bd85693e787565c436a140266bf9
965 F20101111_AABKFC lindsay_c_Page_71.txt
0e58af36cb5c9e8ab2b5f9cdb2249a34
2ba4881d1d718fb8974d2b57b4a7f3afde0e52ec
102550 F20101111_AABKEO lindsay_c_Page_31.jp2
78f7ba3eac3d6920a4cdeff79d141ea1
c88f6c8f8b0b9e480dbf16ea63c95a07c5b76a98
2182 F20101111_AABKFD lindsay_c_Page_26.txt
c81d94236b4e3679261bfbd1853bd9af
5789fcc1ee1dbdb940e1de38625d2040287ccc56
18561 F20101111_AABKEP lindsay_c_Page_78.QC.jpg
6e89ea780408a277a352c4f585530b91
bec4a33af69ebe37aa9fda88b9ae5cffe11a7e67
F20101111_AABKFE lindsay_c_Page_56.tif
43fa824ea8cc5cec6a21c3dd4e0c6c67
87692173bcdcaadfcf45abc1388888928a15ca7c
6097 F20101111_AABKEQ lindsay_c_Page_24thm.jpg
0120aca7a866438b53792de8789af8f8
0318c49453de037603b7b48e4a1e89126241bd8e
1317 F20101111_AABKFF lindsay_c_Page_44.txt
dbdb9473bc53e102affc3526a04c93b3
037b5fce3fd568c994d52325cda24f4584d64cd7
44216 F20101111_AABKER lindsay_c_Page_55.jpg
1a005bf2f0a383bf97e343a45d1a7e4c
78338cdd11af8f35152a237b1e491eb965a940c1
79743 F20101111_AABKFG lindsay_c_Page_26.jpg
cc3adcbebe0d723e0553b6af4e7c6f8e
e5b7e0ab8c0735e8d91fbeedaf86f8817f769210
56556 F20101111_AABKES lindsay_c_Page_13.pro
734cbb0bf934f38b47bd38398c391a09
ba8481bb1aee1d75ea142fa54dac7fefd221059d
20798 F20101111_AABKFH lindsay_c_Page_33.QC.jpg
60bace61168eb163993d96b7efe28ff5
1fa3565c7a6171e03ee8bcab8ba76624190c6584
11645 F20101111_AABKET lindsay_c_Page_11.QC.jpg
1b74b3b2953a9101fa6b71506c83351f
cd488855ecc430ce3f33e719fe94b40695e7dbb2
79984 F20101111_AABKFI lindsay_c_Page_13.jpg
335ab4b05e9210859498d0733200eaf1
5c76c177c69ae9c3b5eb0640359ba0d4037f707a
F20101111_AABKEU lindsay_c_Page_42.tif
a859be43a1a07545a0a40d5d538d272f
8260b68134677957cb1a6fa46a030d2d86c229e2
44833 F20101111_AABKFJ lindsay_c_Page_46.pro
a8d9267cde17882792021f4421d4fd99
ae1a7c2c6fce402b52e74007cd123926c43565e1
2254 F20101111_AABKEV lindsay_c_Page_01thm.jpg
a32e8446c52a76af09cb8cad311cfa43
339be0f5f8098cdba1a7a6f5a0d6497e7bec10d3
2633 F20101111_AABKFK lindsay_c_Page_85.txt
5b848d6220477927945533c4c408001b
2a0325fed9e345c86f55cc79c6452e637a8e3f7d
120289 F20101111_AABKEW lindsay_c_Page_40.jp2
a0e92cba058c10652feffcde19238102
211288a093552c45af9b350d4a7e9a03abf925a2
76554 F20101111_AABKFL lindsay_c_Page_63.jpg
2b6cc44c3f8bb4691da45242fd4e0cd4
510cc3ff3a7b260533f05289625d249a8777459b
28845 F20101111_AABKEX lindsay_c_Page_80.QC.jpg
9e97d0f0617772d3b58451f34ba076bc
29a79024259d2fcf7bd16d860a7254668cd4eee9
660333 F20101111_AABKGA lindsay_c_Page_09.jp2
046ae7f11d76b0361605b6b2b8cdffd7
7afccb10ae171fb0ca9bfff4ab5f4ccd38f04625
2067 F20101111_AABKFM lindsay_c_Page_25.txt
2686c560309f30402f59a9efef4b4865
9b30d3a317f9618d284a61cfebc9a10bb2443216
88517 F20101111_AABKEY lindsay_c_Page_79.jpg
0a1c0bf4b0dfb79733fcff8959cb9fe6
e827bbfe812ccea15fdb4d4a1911d28dd4700c15
838754 F20101111_AABKFN lindsay_c_Page_42.jp2
4f8204cb2914de29751fdf4fa1e66618
019891db1043de38da4c96844c71bc7d1c69c765
F20101111_AABKEZ lindsay_c_Page_41.tif
712bcfeb3a060060466def159c6145ee
f335e71399a99a7f63c77b18c43524380ce68208
5548 F20101111_AABKGB lindsay_c_Page_67thm.jpg
10a480a47316c86d8fe044aa9b3e9be7
9472fc014d3da9c8dcbecfc4f8b1517cf2d98aca
1051898 F20101111_AABKFO lindsay_c_Page_36.jp2
43e29b0c4cafb662396caff6e2f12b84
821ebe32b85f547010c5aeb84601098407c665f9
81415 F20101111_AABKGC lindsay_c_Page_60.jpg
fb28d8a0d7739aafb454f93f79677c8e
53f609095486eebd3bb11edda34bd8c72e56184a
34485 F20101111_AABKFP lindsay_c_Page_06.pro
1e4fba980684ad6ea712c817952986d5
79638f1adca2977060c9b8844f576098841bfb2c
52058 F20101111_AABKGD lindsay_c_Page_50.pro
39c7a5f5299c73ec7698a7db5005fee0
238517b7af4290e7b48148ed6e6c785e9b2fae80
F20101111_AABKFQ lindsay_c_Page_52.tif
9956fb4d4b96c430cb5c65a3885c94d7
31e84a915bec1ec93b7397cc68e416ceba9dd44b
7338 F20101111_AABKGE lindsay_c_Page_81thm.jpg
373596387afef09a7d1a5d4ed9644d1e
a97476ff753160c5b3df172ee91500d9afbba9b1
26170 F20101111_AABKFR lindsay_c_Page_75.QC.jpg
5b6836073fc0a079ce6790dffc51ca3e
26805de6a8e11a51edc3b04d390c227c20d83f6e
2889 F20101111_AABKGF lindsay_c_Page_82.txt
67594c5ab10f7c8b45f39c315a9b907f
bbc8b7b6ee2e6d0825fb4373812e26103b459b4d
F20101111_AABKFS lindsay_c_Page_63.tif
762b47a256f20be5b8a25aeceb60b41d
20b6eca4d00fdc4f43ff0ccff74f28d9488e4b56
68791 F20101111_AABKGG lindsay_c_Page_37.jpg
85d8edfa5893375485b72d9c4fa656f0
f4da35e4c5d66b99ec5d71d466b996e972235be5
49231 F20101111_AABKFT lindsay_c_Page_38.pro
62f5af43c50417271f7302c6b3b267de
3e4aa50a38d43aea9d3464d1308ecaa4a714e91a
2125 F20101111_AABKGH lindsay_c_Page_15.txt
addc48a2cb13242944aaadbe6f48b272
2f97ba3eddcf0dad7bccdafc38131f967c30681a
F20101111_AABKFU lindsay_c_Page_39.tif
e419427c453762b09829fdffecb4eb59
f5a71df532f45f433e62efc1bb3f809113e05222
5563 F20101111_AABKGI lindsay_c_Page_41thm.jpg
9046b1b64a832ac0190d383b00343ff1
a052ba94208df9b74430d668e9f7b6131ecce917
78683 F20101111_AABKFV lindsay_c_Page_59.jpg
962509967326c0adb036a0bffbbb5847
952da7709e6f9d22ded2b36d61dbd54777eaa7b2
80005 F20101111_AABKGJ lindsay_c_Page_20.jpg
e377f473d3c8401085c5b33a63fb0ef9
89fa66d933e51278624b561b5a0f5218b07d5f94
F20101111_AABKFW lindsay_c_Page_48.tif
7823afadfc86a6bcc34f0d852b5bda14
54c2c7906a4c4d685b2447df9c82018e7387a687
F20101111_AABKGK lindsay_c_Page_62.tif
e83913a9f506b11bae9d05404a6867f2
f0a48f936861e05d2d781dc04d1c3d72b8daa8cb
8423998 F20101111_AABKFX lindsay_c_Page_54.tif
a36387749d9e3763e0c3c1188afa7dbd
b1f94151a0eb39e49b435ceff3652afaa4c16487
12995 F20101111_AABKHA lindsay_c_Page_55.QC.jpg
74be66bf72bbacd068e1e574bdcb2df1
b64ebe94413a88458fb136a8e1da67f4b8aa5dde
23736 F20101111_AABKGL lindsay_c_Page_05.QC.jpg
a21d35d2e78a0988702ba8de0d911828
dd0f91c6cd9bd2b5650b5352a19f23a6c183f228
F20101111_AABKFY lindsay_c_Page_89.tif
28f3da31fede08b8dcda3701381f5207
0cd20ad32675322f9d7b1fa0910f0c0d9d9afa96
22983 F20101111_AABKHB lindsay_c_Page_17.QC.jpg
bc5a91c0b116192e3dadfa3c707b067e
8f4b1481a90fd230c165f1433d0a28dde01fff30
F20101111_AABKGM lindsay_c_Page_06.tif
d95d118af26811c28352f0916247fa9f
cb56400fca80cff481803fec3a7b90acd4307d2f
22076 F20101111_AABKFZ lindsay_c_Page_04.jpg
cbba50bbd1a836006ee01cc98e4ffd52
4a77b87ecf4a1ab4dff929e3b1a352da6a747fbd
79028 F20101111_AABKGN lindsay_c_Page_74.jpg
46899727e46fd0d6a9018dc1c935dd2f
ce84d041b616df0e7434965ad559ce4a8e59e690
8767 F20101111_AABKHC lindsay_c_Page_01.pro
7d795a3763eb9033d67da2f14b313c4a
6423ec7957b1f26364ef9cef31ce96dca541c451
38832 F20101111_AABKGO lindsay_c_Page_32.pro
6e96dde8f7fb04cd282d8a28d5d41b5d
a8d7e6e5acdeac5abf2b492abccf1441ba7d5217
53596 F20101111_AABKHD lindsay_c_Page_59.pro
1f90f100ef9e7ee5c6c3c96850bc951a
3a379ea032ca734043df4a18cffe090450d40298
98299 F20101111_AABKGP lindsay_c_Page_57.jp2
e0f357498c53877d2dfb338dfcde9ec5
a3a725a11b1696e688ff23f7dca5b6567ac1a1c9
22811 F20101111_AABKHE lindsay_c_Page_37.QC.jpg
acd1a03dbf5f257e06d63f34598edef9
3fd88ec49d611196d41e617516d12986b27a7222
40939 F20101111_AABKGQ lindsay_c_Page_76.jpg
4bedb6ba68367cdf2eb54d2d21943a2e
f293faa01bac7132f88c9d3e21f4deeea0239761
6875 F20101111_AABKHF lindsay_c_Page_36thm.jpg
d4e2918a2714bcfd2edf169e3c02baa0
993448cfc26bb3fec1bc84b08ecd874a71c7dce7
56025 F20101111_AABKGR lindsay_c_Page_60.pro
0aea5ec60a852310a54532cdae2c0fa2
5d1ac64fd6c783b0eead4666d67686c84120ad2f
2175 F20101111_AABKHG lindsay_c_Page_20.txt
801771709c41d8c4ac9972d6f45470a2
7d54574feead0ee7f29a6ca5031c20373c9892fb
40377 F20101111_AABKGS lindsay_c_Page_56.pro
951e4ec5dd9fae135a91faeb241dd9e6
a8090830891e4ea572fd6142f8e331a57c3b8d1a
7037 F20101111_AABKHH lindsay_c_Page_61thm.jpg
a8f22e9d4b1e5d1d8f3fe2073fc966fe
85975f5b40693d2ac36c6fc76a96b9b6cc8d62ea
79305 F20101111_AABKGT lindsay_c_Page_62.jpg
0be508e7a942a2590198a0f3776f662f
02a7096cadeb9215ed21d9037da5f36527462937
F20101111_AABKHI lindsay_c_Page_09.tif
0096c9e0265451c5fac446c06d7a9742
d33b26d4c867d8120342ea0e51ed6c957b08b6d2
8350 F20101111_AABKGU lindsay_c_Page_09.QC.jpg
6754f7d5405fecb9540b389292e0291c
a3e109b75d78436e5b98cf512dc5596ea7f28e8d
F20101111_AABKHJ lindsay_c_Page_28.tif
4557b34c7653fce41fda69cebb27516e
142eec898122fd0dbb63ecec2ef5e2de97309867
2200 F20101111_AABKGV lindsay_c_Page_04thm.jpg
692558b328e9712cbf452a2f149a8d49
7e1ea8f4c183965efa79ad318b2c471b0bb0f31f
2538 F20101111_AABKHK lindsay_c_Page_86.txt
d45b0c5c722c0bb8394f119e253897a2
ddb11d4fb6fb9a27f4bd4232476dd552f39adbc5
266 F20101111_AABKGW lindsay_c_Page_65.txt
8eb25d8098b3b3a93e78a48374fb1a12
47d89ecbc0babfe1b65d563d23953181ad0eb3a3
952354 F20101111_AABKIA lindsay_c_Page_30.jp2
84d7bbf14e6d0aad428fd378f44f4475
dd385bed528e84a33e109923b32c687077e924d0
24984 F20101111_AABKHL lindsay_c_Page_63.QC.jpg
b9bf67fcfcb9a263118ff1b82a01befb
aec72787b16333121ed98ff17d67a651695307a0
57234 F20101111_AABKGX lindsay_c_Page_23.pro
f1b8da850e8ddca4ab747f4ec4e135ee
42315b5c3a30d0fe463633a7c42ebe690a0f9c24
117556 F20101111_AABKIB lindsay_c_Page_72.jp2
2c2860eab8e9ac6c67a8f7827aeb2867
6c62477f94d7bd39e58044691601dcb6a5a8dd66
2381 F20101111_AABKHM lindsay_c_Page_66.txt
a538a10607c9b537ff3a0441334b2c6d
cba232e9d8d4ca042d12054e34211d4c2cc02d16
54921 F20101111_AABKGY lindsay_c_Page_27.pro
2b13abd9512b7c23d83b9dd61c919c25
31dece2275b170fcb16f53985496304b949e3d65
26688 F20101111_AABKIC lindsay_c_Page_39.QC.jpg
07e08959583244a33d52d82a5d22f339
ef138d0fee566e19ac7e66aadaf2c047ba5b9250
103269 F20101111_AABKHN lindsay_c_Page_35.jp2
01f960768cc2ab3c50e057bbab319bc6
31710fc914b197bca6580a167549a132f4f38673
27969 F20101111_AABKGZ lindsay_c_Page_84.QC.jpg
82712a107b554930f5b7c307f87ece9c
7010c6f5c36189771373c11614329b7090c7cec1
1874 F20101111_AABKHO lindsay_c_Page_46.txt
248b9c1883b9721bdbeb9a9182f3962b
2acb5fc439cee4c0a8dfc911da67ef09511db57b
2541 F20101111_AABKID lindsay_c_Page_84.txt
544890b1aa2eff6509c0d0b1d222cafb
ab16442c6b1a182e7774979a5d270e5662e9ed77
12671 F20101111_AABKHP lindsay_c_Page_77.pro
d7eda23840c1fa721cfe9783ccb3a475
becd5a91bc70b06b527a8c94be028226de832d8c
6665 F20101111_AABKIE lindsay_c_Page_89thm.jpg
cbd548d1285c7006555b1de67e596c0e
33f16f94488001a9f91d9e854ebd24a136f346f5
114515 F20101111_AABKHQ lindsay_c_Page_21.jp2
1d20d1169576c3b767f5a6ed68e5d566
700560976ad53d97dacc6d5d762ef1365cba990d
71396 F20101111_AABKIF lindsay_c_Page_80.pro
186afcf8f22d3cf2d2e28521ddcc5880
8e7cf2ac9fecbcdddf7fa34c23c8ca0a6cc07ed3
F20101111_AABKHR lindsay_c_Page_79.tif
8ba2f0b67061bde8bf87e60a1a54185d
7b4d0e51f93dac088c5803b2877348aaff0edbda
21441 F20101111_AABKIG lindsay_c_Page_11.pro
64edc21c63e863d5b7ab558441ed48d3
606a43a7e37c247c94dafe599642dffdc011a176
7354 F20101111_AABKHS lindsay_c_Page_87thm.jpg
a6e864c58e0eb6687874a902fdd1e1b3
5316f83a01da86a59671fc9d5805b02ce05bbffa
59241 F20101111_AABKIH lindsay_c_Page_42.jpg
72b2fcde4be0ecc7bfe77050d06f54e7
e291607a4fa842e585f241326391d714a5348ea0
24575 F20101111_AABKHT lindsay_c_Page_25.QC.jpg
d66f48f65da78f310f585603158b8d7d
5f65e1cea2b34ad2cb0a6f9b9402a1f580469260
F20101111_AABKII lindsay_c_Page_78.tif
54a4ce7cf0deec9841a9acaa93c32ad5
e95937b856dc241ca656aa4641cc6c65ef1c371c
70489 F20101111_AABKHU lindsay_c_Page_38.jpg
7c555d9a874a31dfbba10de934778c1d
b0b2662c38cb4c56dce829db2bf5a5a499f07857
2177 F20101111_AABKIJ lindsay_c_Page_74.txt
2b393ced38b9f25950e12dda1416b2f1
d969f60b97338679a8f31d9726f617d41aec6e6a
44867 F20101111_AABKHV lindsay_c_Page_31.pro
74ab5b18668862bc820ec1cc04b281be
cf458a248131bed82f502e2c01da91fdfad6e4c3
F20101111_AABKIK lindsay_c_Page_87.tif
bc47d84a2c1cd2a54fc5901fa5c27e40
072e44b66b5bf65d6ee3ef48dce8a4926ac5c08d
25876 F20101111_AABKHW lindsay_c_Page_01.jp2
0b1eda612228cc899ed0e6ebc0b42315
b55dcb394def3ae3b7f74a587e2a15c976e06669
55609 F20101111_AABKIL lindsay_c_Page_39.pro
8855e7fc5c5792154788dc69cb3eed8a
dd4ef258c59b216c9d9f6f6d022c9a676e82e9e8
113861 F20101111_AABKHX lindsay_c_Page_89.jp2
39ac1b9ad831e5a2d419ce3e3d77f4d4
0c5b40cb8f797bcb630756ce0b40f1ed1ba39542
6295 F20101111_AABKJA lindsay_c_Page_66thm.jpg
9623f4d5e1d331c6e608f5cb8052c4d4
835bb2f8d105140bca927c0e87a0ca33f38b5a58
F20101111_AABKIM lindsay_c_Page_69.tif
d51125f37cf5096d86d1e606e5c06b09
5724707d6e23f902161d92497869d4b43b0067ea
F20101111_AABKHY lindsay_c_Page_01.tif
ab61b43f1ee6459f910883e99c824798
b6d8ac7a8983b6bf2924f87ea84d0b13eb0b289a
49543 F20101111_AABKJB lindsay_c_Page_54.jpg
fbf478d22e87dffcd40230bf5ca51811
5b58001cf06652ecbb9b69be2d3b8d3dfd9750f0
112853 F20101111_AABKHZ lindsay_c_Page_50.jp2
09b8db406e16c68ed2cd3f6eb7f93f7e
4c2f0216182674f2266844bf86c1c2358c52ac0e
3656 F20101111_AABKJC lindsay_c_Page_71thm.jpg
07235e5dd1a3170f997eb991b96bd980
66569b4033353902049da32716eec8059a68a2e0
42608 F20101111_AABKIN lindsay_c_Page_71.jpg
0e44408cd96d7074a6bdea249cfee2ea
25f699a43c8e55c65d7de45f75333be59bc38ef8
76340 F20101111_AABKJD lindsay_c_Page_22.jpg
834c4822c014773aad06ab61bffc7f06
4d1e2178bbbef2d45b82e45ba7157f1dda6a4b45
22757 F20101111_AABKIO lindsay_c_Page_35.QC.jpg
25de664df5e785928f64ab300034b589
76f000955e103d383fbe82d45a77fb8e9f12a014
F20101111_AABKIP lindsay_c_Page_57.tif
96d7580f16ee364e1f328333ba82ba3a
b4dc17ad636b7556c57f7f0167e5c1aa32021731
61576 F20101111_AABKJE lindsay_c_Page_51.jpg
9313a824343b1ac0582ffacaa7a3996f
8e795414ee017b28d3407f62a49d7b3a3c992497
F20101111_AABKIQ lindsay_c_Page_61.txt
c5b6d00ed3e8fee1c40afe57011caade
6c231ca39dc87fc4c95d9509b460a8508e4594e7
116721 F20101111_AABKJF lindsay_c_Page_63.jp2
21d737dbb0a1db747a13244080da66e8
807d2f38d35d5e39da1fa74e344c0e1c555e3c1a
80768 F20101111_AABKIR lindsay_c_Page_73.jpg
934162751bece1cce65253fa5bd2ab0c
0b06f3b6bc247615a8210c47c9fee11fb84e07e9
111957 F20101111_AABKJG lindsay_c_Page_25.jp2
bac89e881ccba38c6404b786b0c49160
fdc3c552e51d53906537dd6d9e063889d356073a
106116 F20101111_AABKIS lindsay_c_Page_17.jp2
906f138f61a3edfc6c2ecdab965af0ca
ed20e8d7e6aa1fe32d785d84249f90a92be79adb
18548 F20101111_AABKJH lindsay_c_Page_71.pro
2301d8895dcfab25395138ef6aecb602
78c9e7c9ba4f11ae74dc3c6aff386b25c0e09461
74577 F20101111_AABKIT lindsay_c_Page_45.jpg
daf0ed112f87986f7bf13c0c932dc4c4
c8f8fbff9f46070e73cfb93f6a00810d729c6cae
5957 F20101111_AABKJI lindsay_c_Page_46thm.jpg
cc0bd31e98d43fc79b19f9b679912a05
1d2582c8d566579a69eb96f00f7a3065287bbe75
610 F20101111_AABKIU lindsay_c_Page_77.txt
eb1a33d70f16049cbc1131509200c09d
6ca1bd332f2d3c79f01c9234a034d9b15e13cc18
27169 F20101111_AABKJJ lindsay_c_Page_87.QC.jpg
c621fe5e33840bd1aaca3b013b00dfa8
50554758260d52395d498077a99820648d9aa94f
74702 F20101111_AABKIV lindsay_c_Page_19.jpg
247521c64015eced3bec3bf4e5840a99
e7db7a83f0a3f95cdae4d57b843197d5c320bcac
F20101111_AABKJK lindsay_c_Page_72.tif
17091e5beed31a87a3d9e4172ff6c8e4
866b1d296fc8c73f820a8ebe26016640979dec21
1122 F20101111_AABKIW lindsay_c_Page_52.txt
88032d4a48b821e1c5c446642ea713ec
7d6644764d2c571d3e1cc9286d02b4070582db6b
103459 F20101111_AABKKA lindsay_c_Page_82.jpg
aa57314ebdaa906a214e249dcd620f9c
197ea98dcf17ad4ac4d9db6ca37615ed134c5e3e
1865 F20101111_AABKJL lindsay_c_Page_57.txt
4737f182d729a1901db1fe9c950d72ce
9816fec468b1cf30699c1730057dc0d9ed43fd39
476673 F20101111_AABKIX lindsay_c_Page_77.jp2
c5e56e96dbf78e28484eb2de0e820fef
9a8f504b259c5c5e54bd2182b92f4764eb396a92
65091 F20101111_AABKKB lindsay_c_Page_87.pro
12346f382d0d421b520c7b1213f153aa
59d4d98536386dc1a4587150f007c450d857b875
F20101111_AABKJM lindsay_c_Page_13.tif
0ea66ee0456724bb7da0717d6ee30cb7
7e5b92104fbc7a1ca75879fba14eb74f2b55df28
5713 F20101111_AABKIY lindsay_c_Page_32thm.jpg
2feb77a3fc272a2892b0d68dbd12b03c
fa0d3f057de28d68a56e62752050e4a592a80f6d
37732 F20101111_AABKKC lindsay_c_Page_06.jpg
c550b689e1d33406f138a03026665a61
05bfdbcd43494b15375ab5d054c9eba067fb7688
643245 F20101111_AABKJN lindsay_c_Page_69.jp2
3e28aa00677d5c09680f716c90048f1f
77dca30fff582eaa7526cecc0b49001a5120e1ca
71906 F20101111_AABKIZ lindsay_c_Page_10.jpg
1cec7f42f0f738e54b2def9f835d4a2d
26f894840cc0320d95e6e2e39987a8094fc08f5a
140312 F20101111_AABKKD lindsay_c_Page_85.jp2
3acb7d123ed5a5ddeaca0d8e6a39e44b
c8cf78bba5be54e1b3cedc367967946077baef30
F20101111_AABKJO lindsay_c_Page_21.tif
ecea5d9f85913ef3d1cfbd2329c9e289
2e482b3a23c5fd1eb8c06dfb8b83a247b0f321a6
58111 F20101111_AABKKE lindsay_c_Page_70.jpg
5ccab7d002900301f9aa6e4f68dedc4c
226e0cd192bcf5d1f3be48951040df91ae079d1a
26266 F20101111_AABKJP lindsay_c_Page_79.QC.jpg
cde4da371aefece7bd409c3bdc65bb5c
0f0d612eb2386d1fc905f3ccc09627dc4eecfdec
63382 F20101111_AABKJQ lindsay_c_Page_33.jpg
5f3988c207bcb6627d87da8a15e93e4b
d702cf6b3b00fd0c1ca7ccc991af7b7353adbbe4
6420 F20101111_AABKKF lindsay_c_Page_37thm.jpg
c5b878f156b358d0cc8abacf574d64ba
438a4263b2fb86310748234f131760224b9ac4b5
F20101111_AABKJR lindsay_c_Page_37.tif
da7221ad55a5bd52ad42b5f962727700
f470e50d2aac53623c247164f1f8fbaf507b0366
43944 F20101111_AABKKG lindsay_c_Page_57.pro
3087801b87900f70ca5541aadd6f5a16
e3be5d3487bad2ec1899d54191813b0dc140b768
80644 F20101111_AABKJS lindsay_c_Page_23.jpg
a6bce69e2eafcd89226db20b2d9f1052
1d8caf7adfa42eeda50c6faf41a9d5b306b108c1
87017 F20101111_AABKKH lindsay_c_Page_32.jp2
d53c483a2ef513d967e68969f209f1d8
c535046013faa5ba86c009f385b65f5a39fe61e0
134868 F20101111_AABKJT lindsay_c_Page_79.jp2
6ae22dc28f2247f9a91bf152192782a5
c5d1a1bf7955243b7e422764c4ca263c73879368
2205 F20101111_AABKKI lindsay_c_Page_72.txt
e33456f920b6f1d7bccce21b347664a3
11d4782ca31d98628bbd6fd5bb534597ec180e22
51204 F20101111_AABKJU lindsay_c_Page_25.pro
62f56c179b2166dbdbb94d806146f81d
6f2d3b014734a1a5c13a6c09a00c6862848d913c
3965 F20101111_AABKKJ lindsay_c_Page_54thm.jpg
d1f27cc2bce280c9a52d21f939362fe5
d51c1cd683ca4778dc51f4c7c2ee5d0ff42f6fb0
136217 F20101111_AABKJV lindsay_c_Page_84.jp2
a78e6e0ff4133dac5c61f66882913e28
b3a79bc7192302e2868c94e897f7b1e1d4928226
44119 F20101111_AABKKK lindsay_c_Page_24.pro
a12071597a0ad76434a7d39df2b0dc03
c56e599ebae4eaeb088628b0ba41eb43e8b34eac
25991 F20101111_AABKJW lindsay_c_Page_65.jpg
3d58f28ac656b9dbeb5ca30bc68d828f
17c9b82a03bfc08e820be21b027d7eda2c5f4dea
1871 F20101111_AABKKL lindsay_c_Page_53.txt
b4bf28c9b143e53461c96cd9da9483f7
9f360b7608e945cb87536a55bd2e0a61143556d2
1441 F20101111_AABKJX lindsay_c_Page_06.txt
78ba85c375fce52615b49f92daacecbc
14911293fd3e8456a354115ea6b382f92a4087b8
24685 F20101111_AABKLA lindsay_c_Page_44.pro
d35681717fccdc08826c8eae4e20e7d9
d434153a5e2753a2bf0d55b6a2ecdabc7c76da8a
93 F20101111_AABKKM lindsay_c_Page_02.txt
082bbf04d9021ff82ab8072cb28af3aa
93735850c6641e6ceba526c50b0aab0bc45efbd2
F20101111_AABKJY lindsay_c_Page_86.tif
5cdc2d7284b3e1022ed5aa4ea055cc2c
a28c5f40bc9d7859ee95b75a539b376e2c4f350f
28646 F20101111_AABKLB lindsay_c_Page_83.QC.jpg
990a966eac0d50aa6eca26e7282a3851
8d4a79a8b3266805580fc805d37d43fb56c4a3ba
6744 F20101111_AABKKN lindsay_c_Page_45thm.jpg
00a53c4a56736d8764fd56a7e02028f3
82901f826d41c19d42ecf18a095e5e5afa9b4af5
1877 F20101111_AABKJZ lindsay_c_Page_31.txt
ed3524daeeb9213f137033ef24957240
4c227463cf02da1e24f2ad8f0139d668390092d9
F20101111_AABKLC lindsay_c_Page_44.tif
9055d420bf436089614f8b3637c78b4e
daf4a35a9b32b0236680623ab4cd7bcdfa3386a6
2193 F20101111_AABKKO lindsay_c_Page_58.txt
5c9352a1b9b3a18638225f03ee6ed996
5cb5c119b0c0f72d6368c7a47039b9581d4954aa
134773 F20101111_AABKLD UFE0021973_00001.xml
9ba289995c718d6c4e56c36560fff48d
8c408cc2965f80b3efc67f0d81d1867e51de67fd
6691 F20101111_AABKKP lindsay_c_Page_08thm.jpg
65a31e34f696861b5f9173653049bfd4
630ea25bcc52ed9cf3c570c4091118ee91c86aeb
20462 F20101111_AABKKQ lindsay_c_Page_41.QC.jpg
b64d56f110ed858d9a231f92655c46f1
1d0a717fb2aae2446c7df696c91c39c924e6cf09
7003 F20101111_AABKKR lindsay_c_Page_26thm.jpg
df830e23198a49ed921cdc6d8a5c083e
929ec40e05f797502e67112411b1334734e34071
2242 F20101111_AABKKS lindsay_c_Page_49.txt
a93dac473062239b9c17bc270d1aaee2
dacfd28263c5fb26429de17aaee6a641d8f4433a
9792 F20101111_AABKLG lindsay_c_Page_02.jpg
da906416baec710aec7efb4ffb61779b
6d9d2e91d2e88610fa70821688df00052fc40388
2131 F20101111_AABKKT lindsay_c_Page_28.txt
55393ec4161dbfc28dd941f854808067
d25600cbebaef54975668d46e635ddabada0afbd
94216 F20101111_AABKLH lindsay_c_Page_05.jpg
80dfeaf40f9bd6b7c286f6163df594ca
82305be9016420f0ad9686b75a3c8da69cf47b60
2152 F20101111_AABKKU lindsay_c_Page_07thm.jpg
88529a260217b8dc37567663b31c207a
5e7e902988abd8cf58702aab1ce756ea56f8d6d6
22143 F20101111_AABKLI lindsay_c_Page_07.jpg
a9fed6f1a5953df9d15614676711979b
a4abdc5f8716febbf29e079efbee24815d6dda1c
35479 F20101111_AABKKV lindsay_c_Page_11.jpg
ca0855ac93af278604779752d9af0eb1
b8bebdd765a115d8f44a67e58155389828d31889
85155 F20101111_AABKLJ lindsay_c_Page_08.jpg
6df06f8d4e6d7670b5929d012d1b2670
cda31fb5fd75f50b9afe988c73d98ea295b8d623
144451 F20101111_AABKKW lindsay_c_Page_81.jp2
cdcc6681a29c37c5c4f8fd8b975856a5
2117110c2308f3a7c0f68ed685871f4f558b8164
28725 F20101111_AABKLK lindsay_c_Page_09.jpg
bf62ba805ce400f47299966c0cab66e9
f900621f64ed22f7eba37b205213a9c36d4679ad
2134 F20101111_AABKKX lindsay_c_Page_18.txt
dd24cc52912650b6f1ee398dd46288c3
963a929ed000da672abc49decb4099986e6671b0
62749 F20101111_AABKMA lindsay_c_Page_41.jpg
6dd116434f6be74f9375041409ce6cdb
aa463c340edee894d85d4694fcce8f2f439d4b49
67547 F20101111_AABKLL lindsay_c_Page_12.jpg
2db864402d159727ca27d6d0cdb20fc1
e37be35babf56554770389f597fb93548d81f948
21555 F20101111_AABKKY lindsay_c_Page_57.QC.jpg
00f584353f41161ae07c6987213ffcf6
247c0980f96577cb5dc38c628f8ff9ffc388ab25
60403 F20101111_AABKMB lindsay_c_Page_44.jpg
8c7bdec18692589103e09ec4ceb681a9
f549d04c217e0fd648bf580ac8e07412b64382ab
75769 F20101111_AABKLM lindsay_c_Page_14.jpg
7de71e918dcd854330140eef86c2452f
3c4e12a746ca8d682916f3b42d6b0e39c600d935
55407 F20101111_AABKKZ lindsay_c_Page_40.pro
ed66ef565b228e9065f811e7e1d3abce
31d5fa8cc1050ea89427e7fb453b7be71e845f07
66369 F20101111_AABKMC lindsay_c_Page_46.jpg
4e03c2e8657889258f34674b79f8388c
e60e0b242c1a81f6001a39b3dac2e688118f4588
75347 F20101111_AABKLN lindsay_c_Page_16.jpg
3499d26a8e2953b0225efeb94cc302f3
bf2f590722cc69757ceb1f449ddc1efcd10417e9
80691 F20101111_AABKMD lindsay_c_Page_47.jpg
63b19861086585174ac94cdaf73acb24
825eeb17ad7214e6a8acf6b28f7f98515fb8be27
70648 F20101111_AABKLO lindsay_c_Page_17.jpg
1ba3eea24896740cd35009f79f203012
73213bd8b75063f53a8042da0b238aba4e395a49
80842 F20101111_AABKME lindsay_c_Page_48.jpg
d1697ade8580ed188c6b93ae97138b6b
c1b6a3d6a51c9bbd486d83eef6645d99227c2956
78866 F20101111_AABKLP lindsay_c_Page_18.jpg
f0292f41ee8d498ccbcf8b2ed870098f
1b9ec5d02aa49f34a019edfb275f7bdf340fd4da
82149 F20101111_AABKMF lindsay_c_Page_49.jpg
08d33d036fb71497ebce5c30c2719c35
9ba45120323f45b524b0af58fff5166791c495d7
65771 F20101111_AABKLQ lindsay_c_Page_24.jpg
bc5643e855abbebddc3e584c08a528b2
563908d66bccebfeccc668fe9a824628f09e6dd2
74431 F20101111_AABKMG lindsay_c_Page_50.jpg
80479c5c724fd22fc6eae79b0f434cc8
c67241e4e5f130b0befa5f9afca63bee00251993
77851 F20101111_AABKLR lindsay_c_Page_27.jpg
2353c74c65e40570b77db38653a6ae5f
695ea9164c49ac6411b3b3b2de3e6aec0d6f85cf
76759 F20101111_AABKLS lindsay_c_Page_28.jpg
c3ffe34655beae7d2cad2003fb1de412
c9088e4b2849fb7cfebc8a506a017d3824751a00
86119 F20101111_AABKMH lindsay_c_Page_53.jpg
c6a0ca324d8adf248fc65da42673a567
04cf64f07800563cdeec616b44f7c11f971ca5be
76576 F20101111_AABKLT lindsay_c_Page_29.jpg
2af3b8ff8503d8c6b057ccf6eeede573
6dc7883c73fbf1eb6bcd92fbf44f81e7b428da06
65513 F20101111_AABKMI lindsay_c_Page_57.jpg
28914b653e6bf4f24c73899f061ae11d
4c41e84f590a5e095d895244ec716891fff71787
66596 F20101111_AABKLU lindsay_c_Page_30.jpg
0a21ba40d8f88d07f110591c71afc375
dec0e65d39ef965c8de1f5e5ba5049664c064b10
79942 F20101111_AABKMJ lindsay_c_Page_58.jpg
92a909529f6b4cbf902798e7ce946565
ef0db4c11f04e15b6dfa951a80670acc99e9d637
61394 F20101111_AABKLV lindsay_c_Page_32.jpg
aae6f3dd357c4d6c41a8b1916cf58f23
ed5fa74b1adc1014eddd892fa8818b2cda918aca
80217 F20101111_AABKMK lindsay_c_Page_61.jpg
4f82534e9711421a69fcd2e756fd9544
412bfe4a6e46d3f058376ceb5faea57d6b19ac00
61741 F20101111_AABKLW lindsay_c_Page_34.jpg
f05c00b94d83a3093f0b07cc2f857951
3ca393e89648c77cd91b0d193e27f6264394ec00
25361 F20101111_AABKNA lindsay_c_Page_04.jp2
e791dffe8e62204d4fd6fade36ba0bd6
6ce8f321b8b5dbd3c7d5fa32562deb6165183018
82179 F20101111_AABKML lindsay_c_Page_66.jpg
4d0198fa84c4337f73a3e10856647351
ad8a5b05b82f2df27a16a17b1a760b95a7b0ef21
69833 F20101111_AABKLX lindsay_c_Page_35.jpg
348e9a3692b10cf5ad6e1017473250ac
65f5c1e030511038adc24079c16ef99cea0f15c2
1051977 F20101111_AABKNB lindsay_c_Page_05.jp2
a644802073e47fd9a596507b4074e7c6
190c3f3f9deb88d17e8637a6081df525cc47407b
57524 F20101111_AABKMM lindsay_c_Page_67.jpg
ad8de7cc5438d6009a9b784c403a6770
56cab29ea8060eb8a5d520198625950a77447abf
81387 F20101111_AABKLY lindsay_c_Page_36.jpg
2e46ba94a5ebc133825e112b8604e296
b79b9128c059c93de5caec9e2460851efeefcc2f
367053 F20101111_AABKNC lindsay_c_Page_07.jp2
07a626f68f32b243153e4c71982c6b2e
eba012428b4e0bd742dc2293a7107d4f97b8e0b5
38370 F20101111_AABKMN lindsay_c_Page_68.jpg
f7f816bc3e6f5beb7942f55b5282fb59
cad43c3e7c9148092839442f0f2213a2ea5f656d
80955 F20101111_AABKLZ lindsay_c_Page_39.jpg
35dfdfff3cfe6eeee2c265a1f7d85cb1
4aab22a3b0ca50ec3c78ecd6f958a77e2d4a0677
1051979 F20101111_AABKND lindsay_c_Page_08.jp2
470bb998c58e5b0ba7f1ac9a6973513e
67cd77f70c92522b4de33dfdfa35c46458c6c365
54535 F20101111_AABKMO lindsay_c_Page_69.jpg
985aba51a735a4e54c6244660eed7d41
948eda61aa88c91e344acfab6fbcd92f11a3efca
104347 F20101111_AABKNE lindsay_c_Page_10.jp2
ce6d40e073ebf072322bc42d046c4a11
c3b43b6a0f8af1609e46b915418a16308f921089
77766 F20101111_AABKMP lindsay_c_Page_72.jpg
8d3310891224e8851f7eb517d06b5658
3256a7dca1f07c2bc3f7aa9960da208c0306416f
102477 F20101111_AABKNF lindsay_c_Page_12.jp2
a223e5e5e5bd508d79cb11b7f27459f4
683d9253d66acf73066be80d2493a9be1e075ff8
42840 F20101111_AABKMQ lindsay_c_Page_77.jpg
0f43236f2c0b021a457382a03e7a695c
07281eed23ebce87847319de0f9669a31792e1b0
121804 F20101111_AABKNG lindsay_c_Page_13.jp2
fc5e13b9b6e525b945ed6f02515e7607
693f260830661dfab70fc8943774abf13963a5d8
63445 F20101111_AABKMR lindsay_c_Page_78.jpg
82e737d6e9ce82b1b5c6462e321b6bd6
0d00cc86b09fb7dfccfa1166cb9d94d2a5662a81
113525 F20101111_AABKNH lindsay_c_Page_14.jp2
f113858dfb3f5221020a65b14f5e9e82
320aa9a04cb02bfef01e810b24b74d6361563a4a
101739 F20101111_AABKMS lindsay_c_Page_81.jpg
d66fd0f503b0a8bb1cc75f738fb1569e
c85b9a68f801b41785aca98d1417abfe94b70179
99224 F20101111_AABKMT lindsay_c_Page_83.jpg
ad422c10c3544672acf761e0028182f8
4bc692db42cadd846c14a82c6ad0d1eb67b6e7bc
116795 F20101111_AABKNI lindsay_c_Page_15.jp2
7f4ea925c97c81919f4b4dd0bfb5e586
94adc7598b40a089fcd4ef8da70a234202cc747c
92740 F20101111_AABKMU lindsay_c_Page_86.jpg
5160f600a87c7fa27e06045e9486f0a3
6fb20a0f98091bd61a46e74e28801efb819d7c97
114175 F20101111_AABKNJ lindsay_c_Page_16.jp2
4532070ce801a3f6e5cc90fd2a156f52
ec028825118e39b2c20f8d5567efcfd40e741ca3
93242 F20101111_AABKMV lindsay_c_Page_87.jpg
9ec822873b6b8bc123f31de540d66f93
0e2f3d841d1bcd22eff22af5a91901a084c36720
16444 F20101111_AABKMW lindsay_c_Page_88.jpg
7f1293c964b4e16a6808c81910e50e9b
0f90781507ec1500e13e5e0a6f4a537795574a5f
120596 F20101111_AABKNK lindsay_c_Page_20.jp2
ef8fe4d08b8502eb2064b779a86b765c
3226d4b86e7931e487e17b33893ed18aeffa8cdf
76157 F20101111_AABKMX lindsay_c_Page_89.jpg
c43bb66579683919137b314b35dcda61
e448ce806c801de46316aa75fdb8634f1a24d453
124172 F20101111_AABKOA lindsay_c_Page_49.jp2
f75163e5366167518ae07c56490c0885
e633e9ba5b0be859fdb0a6d542bc3553763a55d5
114693 F20101111_AABKNL lindsay_c_Page_22.jp2
a6af451f8695c59859d8aa6de3bfe8ca
8fb6b02b030a7a8fbc39b7f8e54a9a29673caa82
5279 F20101111_AABKMY lindsay_c_Page_02.jp2
088d71b8b85901464669fe0a89795b57
e797292d9379214377dae2509d60cfb038a14478
1051980 F20101111_AABKOB lindsay_c_Page_51.jp2
a24e389ba6da61fec0befd822657957b
9bcb6ff6ee20fc3259bc36cac266e68c28673944
123127 F20101111_AABKNM lindsay_c_Page_23.jp2
88dc90fec751ecc186a6fc92f934b078
606821cd260952f60bf8d1635e4807c72c0c4a9b
6493 F20101111_AABKMZ lindsay_c_Page_03.jp2
4454dbc2eee1d07cfaf42c12cb137507
0b431b9b73ffdc81839463a185062cfa0697c66d
600182 F20101111_AABKOC lindsay_c_Page_54.jp2
e150cd1d6d81267037e63df7155eee8a
49995fbade4af55d2f37434529e1a6a2da782aeb
99324 F20101111_AABKNN lindsay_c_Page_24.jp2
dff08d8b09a1cda7e2b0aa6f3401c372
68817874701d7696d4afbaf12852b5f5d499c19d
498339 F20101111_AABKOD lindsay_c_Page_55.jp2
6ce8ab515c0e4ae8b84499ebefda8a77
2bd5ca8bfc08e426120200fa23538e46734e4939
117557 F20101111_AABKNO lindsay_c_Page_27.jp2
f6bbde038540362befcfe6127ae5edce
5518b350c200f81ee530d2a01ed5db8d1b971e78
1051986 F20101111_AABKOE lindsay_c_Page_56.jp2
e89e75d2219f232e9477f97849ec7e7f
5ac8d9e635834d73b8aa086f879b15d210ab2ea5
116012 F20101111_AABKNP lindsay_c_Page_28.jp2
ae9508ca81bb4b6710454e5134e0315c
dc7d36dcac27332fc5f45e8e7159e72d9b004144
117770 F20101111_AABKOF lindsay_c_Page_59.jp2
530fdbee73835e28ddc3f24c7d35447b
cbc7e1c252e78711675980b41d275fbb4f283a28
115662 F20101111_AABKNQ lindsay_c_Page_29.jp2
65502d4f7afc1344ce95bd2152b4668b
9042b4952138c1d5959bd8fef85d92183e645286
123080 F20101111_AABKOG lindsay_c_Page_60.jp2
06418c35314e8040396e36082afb13c0
f4b634eefd5ca8df047c47cdeb3a4dfe410a99e6
93882 F20101111_AABKNR lindsay_c_Page_33.jp2
7a90c0c05af3983f262cdcff20108db3
1bc524128d17ed89a3cf6c87e411804db14eedb5
121594 F20101111_AABKOH lindsay_c_Page_61.jp2
c23691fad63435555e47cb7285b10426
549b224077ec72d7fd68937ee37dae9a3a8ec8f8
107022 F20101111_AABKNS lindsay_c_Page_38.jp2
9daa2b78a6f2730df8742c52e61ef706
7d06250401438937014345ba3775132fc3132e43
120644 F20101111_AABKOI lindsay_c_Page_62.jp2
1294486ab85912c051abe3ffad92eef6
1561c52ae944c5fa6b595e1e9c7dd831e1a3209f
122771 F20101111_AABKNT lindsay_c_Page_39.jp2
1d1de272fd2b61890a692adbc141ca72
b80b4ff682459544aa15fdf36a596b00b19eabbe
93796 F20101111_AABKNU lindsay_c_Page_41.jp2
fa25598ad157a068744c05c11b51c472
42c47160653b8a1d39accdd199411d64637aa936
802411 F20101111_AABKOJ lindsay_c_Page_64.jp2
3ad8afc2ec3c30b70ee258bcd2999928
274eafeac395d9a42f1cf7bbf65a49f681d5720a
1000312 F20101111_AABKNV lindsay_c_Page_43.jp2
a7173187feee6ce17220e9a4492b0184
4a42fef833d930f4b2919a7b4c330e6cc4378481
420929 F20101111_AABKOK lindsay_c_Page_65.jp2
dc84bdb467487ca91f028afa89bd022e
9a6bd39d2db6e3770f1794fddc4e4f07c8c8b66d
815364 F20101111_AABKNW lindsay_c_Page_44.jp2
51127c52cf3f426064cd53096b2190e1
a930684533c9e5a2dbe20447a3f76d47b6011c8c
F20101111_AABKPA lindsay_c_Page_07.tif
54fc446f916566532e0a66b151129d9e
06b94c5642288880bc3cdce05ee87a647e5bc49e
1051971 F20101111_AABKOL lindsay_c_Page_66.jp2
4af35c7957e75783137a97b478cbc5ec
d80d5b91c5ed8aeb4c1de6dc4fbbd9a1a343a1ca
F20101111_AABKNX lindsay_c_Page_45.jp2
2d036c24b149aa60daeba3d45cc4d236
e3555028cff546f37d707d4c3b683d00f5b6644f
F20101111_AABKPB lindsay_c_Page_08.tif
f834c32eacb6d2c800f6147e36960191
e0e2e1a82c2b2cf7665cdd3296184e298f3c8fbe
663332 F20101111_AABKOM lindsay_c_Page_68.jp2
9b1b3fbde46fe634713491e2cff0fbc0
2e3ea99d021de7c72d666626a41edb9c1a1151e3
98823 F20101111_AABKNY lindsay_c_Page_46.jp2
3ca0738404660a87d9e631a16d1a6537
41850bc8709780d51856868d179307c3b65af794
F20101111_AABKPC lindsay_c_Page_12.tif
ec9247f3abf72481baf0ecea3743ed80
cee773fc01dd138063d225d8a63c7dbbf759ed48
122521 F20101111_AABKON lindsay_c_Page_73.jp2
13d86bd678f0b270be7677d99e4fb6f2
d99e96a3a8e75a5aca069cb576836ec341285807
122725 F20101111_AABKNZ lindsay_c_Page_48.jp2
b61e0a855cf0203df62eace1d42ed80b
25f75c2c7024af97ad81670d317186a3a5f92383
F20101111_AABKPD lindsay_c_Page_14.tif
63881b4d901905b93bae4b938a29aa45
3385c545f5c37e3f526b5cfe0cb94c7c32087b06
120835 F20101111_AABKOO lindsay_c_Page_74.jp2
027a336bbe53e4350b6d56adaa766df9
8f96e89e8cd64325a3a897c48c44c705f6d82b53
F20101111_AABKPE lindsay_c_Page_17.tif
92465e2a07c55e12a453430112d17ccd
596e0e39b252768205372aa1472416545e62b9ef
55026 F20101111_AABKOP lindsay_c_Page_76.jp2
22043ce72f57ca1da90a7aec42ee39cb
6dec583b79f7017720119dfc2cde3187fa447043
F20101111_AABKPF lindsay_c_Page_18.tif
8f343b2d66302ccd4cc8797ea2ab93af
51c56ceec0ce561cd2c3a967657d60a51c82d96d
947191 F20101111_AABKOQ lindsay_c_Page_78.jp2
1ec4f11860912cc61584575f24ed038c
cc8e946d84bf5844d8d6e9800441be37f0640635
F20101111_AABKPG lindsay_c_Page_19.tif
7c0179345f4b55987816bec979b46e3e
6d182a16ffac402be3cc6094e346988efeeaab49
143578 F20101111_AABKOR lindsay_c_Page_80.jp2
58364fc346978b803c0c5dda661a67af
f2dc8cd2b2e8e68c50aac0d513db3bb029a6af7e
F20101111_AABKPH lindsay_c_Page_20.tif
65ec18c68e3d249d6cf3b7e8b408f3db
3f2166a0be996185d8dc936167ae8c15738822c0
151597 F20101111_AABKOS lindsay_c_Page_82.jp2
fd3bceae1e772cec9900b44f290496cb
44e1dfd11dc0baec91a6304e0ac41ea7b4d891a0
F20101111_AABKPI lindsay_c_Page_22.tif
d45ed30775a1a3ff2178c4087ac57cb1
4790317aadb4d562c92d8e5238c2e4ef8910e482
148009 F20101111_AABKOT lindsay_c_Page_83.jp2
470053347893f96af3498ff23ff36d34
7b7429536c13daa4e9794f1c6d04afb75961082f
F20101111_AABKPJ lindsay_c_Page_24.tif
8e9dada4144b02bef2bd1f25413604fc
ee67e14ad60043076190e51125c72a3206de8e84
136790 F20101111_AABKOU lindsay_c_Page_86.jp2
7486b278ee53656f60eeaa60098fba65
62783447a14205f65f61afb3894b20899ea0c806
15550 F20101111_AABKOV lindsay_c_Page_88.jp2
04f3c3a5c5b9dd5887442f2ad36c5817
874d18fa974640ec83596478dd9ff70efb96196a
F20101111_AABKPK lindsay_c_Page_25.tif
ab0ec4359666ce9e019059c4449461b8
9a87f57acbc451ca0880930c639ad7c655aa447c
F20101111_AABKOW lindsay_c_Page_02.tif
9562782f833818331296b814e913d76a
f0ba03b54053ad03612e8e3038a23bee191d4bcd
F20101111_AABKPL lindsay_c_Page_26.tif
bb0b393cd094ec80fa2cd850c5c1a744
e7a4265ec6e5888cea209cb544fac65b4f832df6
F20101111_AABKOX lindsay_c_Page_03.tif
bf91ae9a2dd667cde1199fb67451a745
4a6565f02d557674422a9483215609961e74eadf
F20101111_AABKQA lindsay_c_Page_50.tif
5ca57f42d2ba83a2beeb2cbeb4c1a056
6700a7c9fbc9a704308f83ba2b7a8d51797b003c
F20101111_AABKPM lindsay_c_Page_27.tif
85f26105c3ae4158b7b207ecc7084e2a
ba0ef362feb4e164d0b0b8363465c654b4124ae6
F20101111_AABKOY lindsay_c_Page_04.tif
a8a86ed0d3312fd415bc22d406cda527
ae6d195d258b80beeab36d10d0c3f7b8c74b8d08
F20101111_AABKQB lindsay_c_Page_55.tif
84b06bc7d6048c50f9f70ea163c064ee
7b2195ade0d425e38e0f9ffeb1050039d681de87
F20101111_AABKPN lindsay_c_Page_29.tif
2b760be950dfaf9635b75d35cfe9b940
42ff70d7ce00b8155673ab4b4145c368691bf2a4
F20101111_AABKOZ lindsay_c_Page_05.tif
c1810c61ab5cc09f851a398e8559f378
6c5968aa4327a9fd773bc798f6908b3304247110
F20101111_AABKQC lindsay_c_Page_58.tif
482d80feed5a81e56c6ff3b114ea4881
9c72d790ae6802a9e7176faca0f2f3bcc815ecb9
F20101111_AABKPO lindsay_c_Page_31.tif
b4ecc10235f16faccb69281f8a7d271b
7e6c6cef11ca7d354c7507d7c66cd2e461ebd7ba
F20101111_AABKQD lindsay_c_Page_59.tif
8cae41b9efe51dcd145c4776b500aa11
2d46814b4dbee5952abbf9a2a0e31315f8ec269e
F20101111_AABKPP lindsay_c_Page_32.tif
9d24a7ecb01dea42cefffe224f677df2
e19867b17e95c2916511da3629e93b2c20878969
F20101111_AABKQE lindsay_c_Page_61.tif
a4f6a865ed2f3c989aa40eb8f599110f
81b8e1fc6082fa3e3f4361ce5aea7577efa913bb
F20101111_AABKPQ lindsay_c_Page_33.tif
dfcc570d776a7a145316f03c171de09d
711442f70c4d99ec86355406acc2d83823321c20
F20101111_AABKQF lindsay_c_Page_64.tif
be5c0d9c05c3fbedf627d13aa63f6b36
a717392ab09104cde57565a12aa36c28dbe71d0b
F20101111_AABKPR lindsay_c_Page_34.tif
d0c250123fd77007a2890a96d6d84e98
c355f8ac009368d7ea0df313fca922e513dd242b
F20101111_AABKQG lindsay_c_Page_65.tif
c7f51c66de0b304a30397d68f753b8f4
19fc73f8ae51a7a9244b958316de88072dd54730
F20101111_AABKPS lindsay_c_Page_35.tif
cc12c4aca2864a05c9abcc20f1f84ec7
daf76988e3b6dc891623e53984bce956f4c5541a
F20101111_AABKQH lindsay_c_Page_66.tif
98535c95bda56cc0c9c0b413d5bf2896
39a8a99ee0a166d3c8d7ad3bb0d5653509ca48fc
F20101111_AABKPT lindsay_c_Page_36.tif
dac8d00097b92e9b7c3f7b4611630f02
fdf1c853e9d2bf977e13c2aae61f49ffd338e5f4
F20101111_AABKQI lindsay_c_Page_67.tif
eef3a0b0787ed44e7d3f9a4bb1bcd3d9
26eb3f6f873fe0549d75e9edaddb0e9ca05bb76e
F20101111_AABKPU lindsay_c_Page_38.tif
1a79d744c9528d07493240e41628baeb
b3959151a64da1de68563249ae216af7096253b7
F20101111_AABKQJ lindsay_c_Page_68.tif
f2868fca8c36daabe6389b7e6aae0810
ceeb0b546aa02d112bc3582d6c89a003e07b4e5b
F20101111_AABKPV lindsay_c_Page_40.tif
5d79c2e3a2ab85f91a668cc21baa466b
ce50439bd6b6ff2beb812f07964d7293d40f694f
F20101111_AABKQK lindsay_c_Page_70.tif
205090eb47485527a9f02ba417d0e272
68fc8c28d152a7b265d4e7a1045e73da302f20cd
F20101111_AABKPW lindsay_c_Page_43.tif
1d1f4684964f4b4bbbb9972807adbfc9
8ec5fe70a60a3464b27aed3c86567683f5ae7eb3
F20101111_AABKPX lindsay_c_Page_45.tif
3881f334fb5c7d7cd56c9c1973bc6c0b
68509edb0b052b90b8edf16c9e5ab48537e8a191
54161 F20101111_AABKRA lindsay_c_Page_15.pro
7f62876dfab2d0213e1db4df74c316d3
ae507e0eab52b858f7a310ccc82e90fa82390b30
F20101111_AABKQL lindsay_c_Page_71.tif
eeb24414d3575db43353b39ab3bf5a88
6a02a384a7dbd1dc100b1c8c16988cd853795f90
F20101111_AABKPY lindsay_c_Page_46.tif
d0449d76d4c4a42eed3d74344482f8ff
b4638b1d6662bf0a57c8e6141c6173161f58c8b2
52235 F20101111_AABKRB lindsay_c_Page_16.pro
b0031b568a683a749ec7ffea03c2e600
3521a93611001dcc4b68db3c7f7c34982bce71ce
F20101111_AABKQM lindsay_c_Page_73.tif
92bb4108bcbb3852f60836904e3e8284
f820b0d88577b175505647ac51a7272db990453f







DAXX AND RASSF1 DEFINE A NOVEL MITOTIC STRESS CHECKPOINT THAT IS
CRITICAL FOR CELLULAR TAXOL RESPONSE




















By

CORY R. LINDSAY


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008



































2008 Cory R. Lindsay




























To my parents Archie and Virginia Lindsay









ACKNOWLEDGMENTS

I thank my parents Archie and Virginia for always providing the love, support and

encouragement I have needed to pursue my dreams. I thank Mr. Ed Brogie, Dr. Ed Rosa-

Molinar and Dr. Russ Rassmussen who, knowingly or not, motivated, inspired and challenged

me. I thank Dr. Alexander Ishov for his excellent mentorship, guidance and knowledge.









TABLE OF CONTENTS

A CK N O W LED G M EN T S .............................................................................. ................... 4

L IS T O F T A B L E S ...................................... ..................................... ................ .. 7

LIST OF FIGURES .................................. .. ..... ..... ................. .8

1 INTRODUCTION ............... ............................ .............................. 12

Breast Cancer and Chemotherapy Resistance ............................................. ............... 12
T axanes and their A activity .............................................................................. ........ 12
Taxanes and M itotic Checkpoints ..............................................................................14
Cancer Cell Line Response to Taxane Treatment ..........................................................15
Predictive M arkers for Taxane Treatment.................................................................... 15
Daxx: The Story of an Enigmatic Protein.................................................... ................17
D axx and A poptosis .................................. .. .......... .. ............17
D axx and Transcription ............................................................ .................... 19
Cellular Localization of Daxx .......................................................... ............... 21
Ras-Association Domain Family-1 (Rassfl) and Cancer.....................................................24
Preferential Alteration of RassflA in Cancer.....................................................25
RassflA and Cell Cycle Control .................................. .....................................25
Cellular Localization of R assflA ................... ....... .............................................. 27
Functions of R assflC .............................................. ... .... ........ ......... 28
Cellular Localization of R assflC ............................ ......................... ............... 29

2 M A TER IA L S A N D M ETH O D S ........................................ .............................................31

A n tib o d ie s .................................................................................................................. 3 1
P-G al R reporter A ssay ................................................. ........ .. ........ .... 31
B iochem ical F ractionation ...................................................................... ...................32
C ell Culture and Transfections......... .................. .................................. ............... 32
C ell C ycle Synchronization ......... ................. ................. ................... ............... 33
Colony Form action A ssay ......... ........................................................ .................... 33
Confocal Microscopy and Subcellular Localization ................................................. 33
D ru g T re atm e n t ...............................................................................................................3 3
E m bryo Isolation and C culture .............................................................. .....................34
F A C S A naly sis .......................................................................... 34
Fluorescence Tim e-Lapse M icroscopy....................................... ......................... 34
Im m unofluorescence ............................................ .. .. ........... ......... 35
In vitro Pull-dow n A ssay ........................................................... .. ............... 35
Plasm id Constructs ................................... ..... .. ...... ............... 36
Stable siR N A Infection ........... .............................................................. .................. 36
W western B lotting................................................... 37
Y east T w o-H ybrid A ssay ........................................................................ .................. 37

3 D A X X FU N C TIO N IN M ITO SIS .............................................................. .....................38









In tro d u c tio n ............................................................................................................................. 3 8
R e su lts an d D iscu ssio n .................................................................................. ................ .. 3 8

4 DAXX IS A TRIGGER OF CELLULAR TAXOL RESPONSE .......................................46

In tro d u c tio n ............................................................................................................................. 4 6
Discussion and Results .................... ........................... ........ 47

5 DAXX INTERACTS WITH RAS-ASSOCIATION DOMAIN FAMILY 1 (RASSF1)
WHICH COOPERATE IN CELLULAR TAXOL RESPONSE....................................57

Introduction ..... ........................................................57
Discussion and Results .................... ........................... ........ 57

6 SUMMARY AND CONCLUSIONS.......................................................... ............... 72

R E F E R E N C E S ..........................................................................79

B IO G R A PH IC A L SK E T C H ............................................................................... .....................89


































6











LIST OF TABLES

Table Page

3-1 Statistical analysis of mitotic progression in control- and Daxx-depleted H3-GFP-
H E p 2 c e lls ...................................... ..................................... ................ 4 2

6-1 Alteration of several known mitotic proteins and resultant cellular paclitaxel
respond se........ ................................ ................................................76









LIST OF FIGURES


Figure Page

1-1 Dynamics of paclitaxel action in cells.. ............................. ...... ............... 30

1-2 Localization of Daxx throughout the cell cycle ................................................30

3-1 Characterization of Daxx- mouse embryos and cells ............................................... 42

3-2 Western blot analysis of Daxx protein level in HEp2-H3-GFP cells expressing
control-siRNA or Daxx-siRNA. ................................. ....................................... 43

3-3 Fluorescence time-lapse microscopy images of HEp2-H3-GFP cells expressing
either control-siRNA or Daxx-siRNA.. ....................................................... ....................43

3-4 Daxx depletion stabilizes cyclin B during mitosis................................. ............... 44

3-5 Western blot analysis of mitotic proteins in wild type (parental), control-siRNA and
tw o independent D axx-siRN A cell lines....................................... ......................... 44

3-6 Western blot analysis of Daxx protein levels throughout the cell cycle. ..........................45

3-7 Dynamics of Daxx localization in mitotic MPEF cells. ..................................................45

4-1 Differential response of Daxx/+ and Daxx-/- MEFs to microtubule inhibitors
nocodazole and paclitaxel ........................................... ....................51

4-2 Colony formation of breast cancer cells after paclitaxel treatment is Daxx-dependent. ...52

4-3 Response to paclitaxel treatment in breast cancer cell lines with different Daxx level.....53

4-4 Response of MDA MB 468 and T47D breast cancer cell lines to increased
concentration of paclitaxel........................................................... .. ............... 54

4-5 FACS analysis of cell cycle distribution after paclitaxel treatment..............................55

4-6 Paclitaxel response is Daxx-dependent..................... ...... ........................... 56

5-1 Daxx interacts with tumor suppressor Rassfl in yeast. ...........................................64

5-2 M apping of D axx-R assfl interaction..................................................................... ...... 66

5-3 Cellular distribution of Daxx and Rassfl during interphase..............................67

5-4 Co-localization of endogenous Daxx and Rassfl during mitosis in HEp2 cells ...............68

5-5 Depletion of Daxx or RassflA desensitizes cells to paclitaxel..............................69









5-6 Cyclin B levels are stabilized in Daxx- and RassflA-depleted cells treated with
tax ol ........... ................................................. .................... ........ ...... 70

5-7 Inactivation of the mitotic spindle checkpoint using Aurora kinase inhibitors
abolishes taxol resistance in Daxx-and RassflA-depleted cells ..................................71

6-1 Dynamics of Daxx-Rassfl interaction throughout the cell cycle .................................77

6-2 Model depicting Daxx-Rassfl-mediated mitotic stress checkpoint during pro-
m e ta p h a se .......................................................................... .. 7 8









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

DAXX AND RASSF1 DEFINE A NOVEL MITOTIC STRESS CHECKPOINT THAT IS
CRITICAL FOR CELLULAR TAXOL RESPONSE

By

Cory R. Lindsay

May 2008

Chair: Alexander Ishov
Major: Medical Sciences-Molecular Cell Biology


Taxanes, a family of compounds which includes taxol, are powerful chemotherapy agents used

for breast cancer treatment. Large numbers of patients, however, are resistant to these drugs for

unknown reasons. Taxol binds and hyper-stabilizes microtubules, but mutations or alterations in

tubulin occur very rarely in cancers and cannot itself explain the majority of Taxol-resistance

observed in patients. Currently, it is thought that defects in mitotic proteins may affect Taxol

sensitivity in cells. Here, Daxx and Rassfl are identified as novel regulators of cellular Taxol

response. Daxx is a ubiquitously expressed and highly conserved nuclear protein with enigmatic

roles in transcription and apoptosis. Increased prometaphase index in Daxx deficient embryos

and aneuploidy of Daxx knockout cells was observed which suggested a potential function of

Daxx in mitosis and cell division. During interphase, Daxx remains a strictly nuclear associated

protein localized to PML bodies or heterochromatin. Upon nuclear envelope breakdown, Daxx

was found to co-localize and interact with Rassfl at mitotic spindles. Rassfl is a cytoplasmic,

microtubule-associated protein that is important for normal mitotic progression and cell division.

Daxx was also shown to be important for the proper timing and progression of early mitosis.

Together, Daxx and Rassfl define a novel mitotic stress checkpoint that enables cells to









efficiently exit mitosis (and eventually die) when encountered with specific stress stimuli during

mitosis, including Taxol. In the absence of Daxx or Rassfl, cells treated with Taxol remain

arrested in mitosis due to a sustained mitotic spindle checkpoint. Upon Taxol decay or removal,

these cells can resume mitosis and complete cell division-thus being Taxol resistant. Inhibition

of the spindle checkpoint using Aurora Kinase inhibitors efficiently abolished Taxol resistance in

Daxx and Rassfl depleted cells. Deregulation of most known mitotic proteins leads to enhanced

Taxol response. Absence or depletion ofDaxx and Rassfl, in contrast, results in increased drug

resistance. In the future, Daxx and Rassfl may be useful predictive markers for the proper

selection of patients for taxane chemotherapy.









CHAPTER 1
INTRODUCTION

Breast Cancer and Chemotherapy Resistance

Breast cancer is the most frequently diagnosed malignancy for women in the United States.

In 2005, an estimated 211,000 new cases of invasive breast cancer were expected to occur

(Cancer Facts and Figures 2005, American Cancer Society). The mortality rate from breast

cancer declined approximately 2.3% per year from 1990 to 2001, mostly due to earlier detection

and improved therapies. Nonetheless, an estimated 40,000 women would die of breast cancer in

the United States in 2005 (Cancer Facts and Figures 2005, American Cancer Society).

Chemotherapy is a very popular treatment option for many breast cancer patients. There are a

number of agents used in adjuvant therapy with established cytotoxic activity, with the taxanes

considered some of the most active (O'Shaughnessy, 2005).



Taxanes and their Activity

Taxanes, the group of cytotoxic drugs that includes paclitaxel (taxol) and docetaxol

(taxotere), are among the most powerful anticancer agents for breast cancer chemotherapy.

Increasing numbers of patients have been treated with these drugs along, or in combination, with

other chemotherapeutic agents. The successful entry of paclitaxel into clinical trials in 1986

boosted an interest in understanding the mechanism of taxane-induced cell death and in studying

pathways and proteins targeted by this treatment, including tubulin as an immediate target

(Schiff et al., 1979) and downstream targets of taxanes, including mitotic proteins (Wood et al.,

2001).

Although taxanes are successful in selective killing of tumor cells in clinical settings,

current understanding of the molecular basis of this therapy is controversial and incomplete. For









a long time, apoptosis was considered the main mechanism of cell death in response to taxane

treatment. Currently, a more distinct model of therapy response is considered, wherein different

modes of tumor cell death are likely determined by drug concentration and genetic background

of the cells within a tumor (Morse et al., 2005). At pharmacological concentrations, taxanes

reversibly bind to tubulin heterodimers that form microtubules-this accelerates polymerization

and inhibits depolymerization of tubulin, thus disrupting microtubule dynamics. This event, in

turn, activates the spindle checkpoint, which invokes mitotic arrest that in normal, untreated

conditions ensures proper chromosomal attachment and alignment and ensures faithful

chromosomal segregation preventing aneuploidy (Chan and Yen, 2003; Cleveland et al., 2003).

This mitotic arrest does not persist indefinitely. After some period of time, cells usually undergo

an aberrant exit from mitosis, characterized by the lack of metaphase, anaphase and cytokinesis.

The nuclear envelope is reformed around individual or groups of chromosomes producing large

nonviable cells with multiple micronuclei, which are easily distinguishable morphologically

from apoptotic cells. Apoptotic cells will have small, highly condensed chromatin with

fragmented nuclei and a diminished cytoplasm, whereas micronucleated cells are much larger

with uncondensed chromatin in a pattern reminiscent of normal nuclei. This type of cell death

which results in micronucleated cells is known as mitotic catastrophe and is activated during

mitosis as a result of deranged spindle formation coupled with blocks of different checkpoint

mechanisms that activate aberrant chromosome segregation and nuclear fragmentation (Kroemer

and Martin, 2005). Taxane-sensitive human breast cancer cells are blocked in mitosis only

transiently, followed by nuclear fragmentation and mitotic catastrophe, while resistant breast

cancer cells have more prolonged mitotic block and continue proliferation after drug decay and

microtubule dynamics restoration, thus surviving chemotherapy (Figure 1-1).











Taxanes and Mitotic Checkpoints

Several mitotic checkpoint proteins, including MPS1, Survivin, Chfr, and members of Mad

and Bub protein families (Madl, Mad2, Mad3 (or BubR1) Bub 1, Bub3), sense improper tension

between kinetochores and microtubules of the mitotic spindle and transmit a signal to inhibit

mitotic progression. Inactivation of most of these checkpoint proteins increases sensitivity to

taxane treatment (Carvalho et al., 2003; Lee et al., 2004; Lens et al., 2003). The factors that

determine prolongation of mitotic block and, thus, resistance to treatment by taxanes, remain

incompletely characterized. To date, only few examples are known when inactivation of mitotic

checkpoint proteins leads to reduced sensitivity to taxanes. Inactivation of Chfr, a mitotic-

associated E3 ubiquitin ligase (Bothos et al., 2003; Chaturvedi et al., 2002; Kang et al., 2002)

which degrades the mitotic kinase Aurora A (Yu et al., 2005) leads to decreased sensitivity to the

microtubule depolymerizing drug nocadozole (Scolnick and Halazonetis, 2000). Down-

regulation of breast cancer susceptibility gene 1 (BRCA1) by siRNA leads to increased taxane

resistance in breast cancer cell line MCF-7 (Chabalier et al., 2006). Another report describes

nocodazole-induced delay in mitotic exit upon depletion of p31comet in HeLa cells. p31comet acts

in mitosis by counteracting spindle checkpoint function of Mad2 (Xia et al., 2004). Thus, recent

efforts have started to link sensitivity of tumor cells to taxane treatment with genetic defects in

the cell cycle checkpoints in association with cancer chemotherapy. It has been suggested that

inactivation of mitotic checkpoint proteins can contribute to the selective response of taxane

treatment in vivo (Wassmann and Benezra, 2001). However, mutations in known checkpoint

proteins occur rather rarely (Cahill et al., 1998; Haruki et al., 2001); thus broader studies are

necessary to search for novel molecular targets of taxane therapy.









Cancer Cell Line Response to Taxane Treatment

Breast cancers are often resistant to the therapeutic induction of apoptosis which is likely

due to inactivation of apoptotic pathways (Brown and Wouters, 1999). Therefore, therapies that

promote other types of death, such as mitotic catastrophe, may be preferential for use in treating

breast cancer. Apoptosis was commonly regarded as the major mechanism of cell death in

response to taxanes (Wang et al., 1999); lately, both paclitaxel and docetaxel are observed to

induce dose- and cell line-specific apoptotic or mitotic cell death (Roninson et al., 2001). In

breast cancer cells and non-small cell lung carcinoma cell lines, each of which originate from

supposedly primary targets of taxane therapy in vivo-paclitaxel has a concentration-dependent,

biphasic response. At low, pharmacologically relevant concentrations, mitotic catastrophe is

observed, whereas at high concentrations terminal cell cycle arrest followed by necrosis are

documented (Yeung et al., 1999). Taxane-sensitive human breast cancer cells are blocked in

mitosis only transiently, followed by nuclear fragmentation and mitotic catastrophe, while

resistant breast cancer cells have more prolonged mitotic block and continue proliferation after

drug decay and restoration of microtubule dynamics, thus surviving chemotherapy. The factors

that determine prolongation of mitotic block and, thus, resistance to treatment by taxanes, still

need to be characterized (Wood et al., 2001).


Predictive Markers for Taxane Treatment

Significant numbers of patients are resistant to taxanes or become resistant to this therapy

during treatment. The response rate of docetaxel is -50% even in the first-line chemotherapy and

it decreases to 20-30% in the second- or third-line therapy (Bonneterre et al., 1999; Crown et al.,

2004; Ravdin et al., 2003). Together with side effects, which includes peripheral neurotoxicity

(Rowinsky et al., 1993), it is of vital importance to select responsive patients using prognosis and









predictive markers. Overcoming resistance or incomplete response to these agents would

represent a major advantage in the clinical treatment of breast cancer (Aapro, 2001; Henderson et

al., 2003).

A number of studies have been carried out to determine a genomic profile that could be

predictive for taxane treatment. In 2003, the group of Dr. Chang published a study of gene

expression profiles of 24 patients before and after four cycles of docetaxel treatment in

correlation with differential response to chemotherapy (Chang et al., 2003). They observed a

differential pattern of 92 genes correlating with docetaxel response allowing the predictive

classification of tumor sensitivity. Later this group observed, in the same cohort of patients,

chemotherapy-driven positive selection of resistant cells populated by genes involved in G2/M

arrest (Chang et al., 2005b). Dr. Kato's group performed a similar study analyzing the expression

profile of 44 breast tumor specimens before treatment with docetaxel in combination with

clinical response to therapy, and developed a diagnostic algorithm to differentiate between

responders and non-responders. They also described elevated expression of redox controlling

genes in non-responding patients (Iwao-Koizumi et al., 2005). The same group described down-

regulation of aromatase in docetaxel response patients thus connecting this type of chemotherapy

with suppression of intra-tumoral estradiol synthesis (Miyoshi et al., 2004). A study comparing

gene profiles before and after chemotherapy by either doxorubicin/cyclophosphamide or

doxorubicin/docetaxel treatment could not detect a significant profile for the prediction analysis

of this combination of chemotherapies probably due to a relatively small group of patients

involved (Hannemann et al., 2005). Despite extensive studies trying to identify predictive

markers for taxane treatment, the clinical application of results have, so far, been limited, partly









due to uncertainties about the reproducibility of methods between several groups (Mauriac et al.,

2005).



Daxx: The Story of an Enigmatic Protein

Daxx and Apoptosis

Daxx is a 120 kDa ubiquitously expressed protein with a high degree of similarity

between mice and humans (72% identical by amino acid sequence) (Kiriakidou et al., 1997).

Daxx was initially identified through yeast two-hybrid screens as a Fas-interacting protein (Yang

et al., 1997). In this initial study, mouse Daxx was found to potentiate apoptosis through a novel

pathway involving activation of the jun N-terminal kinase (JNK) and not through an interaction

with the Fas-associated death domain (FADD). A follow-up investigation published a year later,

showed mDaxx could activate the JNK kinase kinase (ASK1) by binding ASK1 and

subsequently relieving an inhibitory intramolecular interaction between the N & C-termini of the

protein (Chang et al., 1998).

Through these first two studies, ideas towards the role of Daxx were predominately

shifted towards activation of apoptosis and promoting cell death. Perlman et al. (2001) were able

to add further weight to the notion of Daxx as a pro-apoptotic molecule by showing it could both

physically and biochemically interact with transforming growth factor- P receptor (TGF-P) and

aid its apoptotic response by inducing JNK activation. Correspondingly, when antisense Daxx

oligo-nucleotides were transfected into AML-12 cells, subsequent TGF-P treatment did not

induce apoptosis (Perlman et al., 2001).

Seemingly contradictory evidence towards the role of Daxx in vivo began accumulating a

couple of years after its initial discovery. The Leder group developed a Daxx knockout showing

a phenotype of extensive apoptosis and lethality by embryonic day 8.5-9, rather than a mouse

17









with proliferation abnormalities indicative of a pro-apoptotic gene (Michaelson et al., 1999).

These results suggested that Daxx supported a role in an anti-apoptotic function. Indeed,

knockdown of Daxx expression by RNA interference revealed increased levels of apoptosis as

measured by FACS analysis (Michaelson and Leder, 2003). Conversely, it had been known for

years that over-expression of Daxx would lead to induction of apoptosis as well (Torii et al.,

1999; Yang et al., 1997). What could be the true function of Daxx, in relation to apoptosis, in

vivo?

Stronger evidence towards the role Daxx could be playing in apoptosis came from studies

focusing on the endogenous localization of Daxx in cells. Ishov and colleagues and other groups

afterwards (Croxton et al., 2006; Ishov et al., 1999; Ishov et al., 2004; Zhong et al., 2000), found

Daxx to interact with the promyelocytic leukemia (PML) tumor suppressor protein and could be

subsequently recruited to sub-nuclear domains called ND 10 (PML bodies, PODs, or Kraemer

bodies) upon sumoylation of PML. An apparent nuclear localization of Daxx, as would be

consistently shown by biochemical fractionation and immunofluoresence experiments, raised

concern on how Daxx could be involved in Fas-induced apoptosis ifFas was anchored to the cell

membrane. A study published shortly after the discovery of a Daxx/PML interaction and ND10

localization showed that human Daxx, although a potent enhancer of Fas-induced apoptosis

when over-expressed, did not associate with human Fas in cells and maintained its nuclear

localization (at ND10) even upon stimulation of Fas-induced apoptosis (Torii et al., 1999).

Moreover, the localization of Daxx to ND10 seemed to be critical for enhancing apoptosis as a

Daxx mutant lacking its nuclear localization sequence (and hence its association with PML) was

not as effective at promoting cell death (Torii et al., 1999). Zhong and colleagues also supported

this claim by showing a larger induction of apoptosis (as measured by TUNEL assay) by Daxx in









PML++ compared to PML- cells (Zhong et al., 2000). Thus, the localization of Daxx to ND10

and not to the cytoplasm was critical for Daxx-enhanced apoptosis.



Daxx and Transcription

The identification of PML interacting with and sequestering Daxx into nuclear domains

would become as important a discovery as any study demonstrating the functionality of Daxx.

Ishov and colleagues showed that in situations where PML was absent, Daxx would be relocated

to condensed heterochromatin where it could potentially be involved in some biochemical

function (Ishov et al., 2004). Subsequent studies provided some evidence of what Daxx could be

doing at these sites by showing it could interact not only with core histones, but histone

deacetylase II (HDACII), Dek (Hollenbach et al., 2002) and the SWI/SNF chromatin remodeling

protein ATRX (Xue et al., 2003). These interactions, among others, brought forth the idea that

Daxx could be acting as a regulator of transcription, not only on the level of repression but

activation as well. Among a few of the many genes Daxx has been implicated in regulating

include p53 target genes (Gostissa et al., 2004; Zhao et al., 2004), Pax transcription factor family

members (Emelyanov et al., 2002; Hollenbach et al., 2002; Lehembre et al., 2001) and Smad4

(Chang et al., 2005a)

A more dynamic role of Daxx became appreciated when Ishov and colleagues showed a

cell cycle dependent localization of Daxx between ND 10 and heterochromatin (Figure 1-2)

(Ishov et al., 2004). They found that during G1 and G2 phase, Daxx could be found in its

characteristic location at ND10, while during S phase, Daxx would relocate to condensed

heterochromatin. Interestingly during mitosis, ND10 is disassembled, PML de-sumoylated and

Daxx no longer associated with the remnants of these nuclear domains (Ishov et al., 2004). What

became the fate of Daxx after this set of events was not addressed.

19









From the cell cycle-dependent localization of Daxx model which Ishov and colleagues

proposed, ND10 could be considered a site of inactivation of Daxx function-a potential

"storage depot" for Daxx and numerous other proteins until specific times when they are needed

and become active again (Ishov et al., 2004). Although at the time this was not a novel concept,

a study conducted by (Li et al., 2000) and similarly by (Lin et al., 2003) suggested this notion

showing that when Daxx was bound to increasing amounts of PML, the transcriptional

repression activity of Daxx-as measured by a luciferase reporter assay-was relieved. A

possible mechanism which could regulate the localization of Daxx to ND10 or to

heterochromatin was shown by Ecsedy and colleagues when they demonstrated a physical

interaction between Daxx and the serine/threonine kinase HIPK1 (Ecsedy et al., 2003). This

interaction was capable of displacing Daxx from PML and re-localizing it elsewhere in the

nucleus. In addition, the Ecesedy group found that upon phosphorylation of Daxx by HIPK1,

Daxx transcriptional repression activity was modified (Ecsedy et al., 2003). The investigators

could not, however, definitively show a relocalization of Daxx to heterochromatin but rather an

association with HDAC1. Additionally, they showed that phosphorylation of Daxx by HIPK1

diminished the transcriptionally repressive activity of Daxx rather than enhanced it. Other

studies, which focused on the condition-dependent localization of Daxx (and other nuclear body

associated proteins) were found to be dependent on the sumoylation status of PML as well as

cellular stresses such as heat shock and heavy metal exposure (Nefkens et al., 2003). The small

ubiquitin-like modifier (SUMO), moreover, is a post-translational modification added to proteins

which affects their function and localization. SUMO bears a 20% identity to ubiquitin and is

covalently linked to a wide range of proteins whose functions are commonly implicated in

chromatin organization, transcription and genomic stability (Hay, 2005). Although other









conditions may be found to regulate Daxx localization, it remains intuitive that cellular factors)

and protein modifications play an important role in the regulation of Daxx inside of the nucleus.

To date, Daxx is a protein that has been identified numerous times through yeast two-

hybrid screens with various other proteins both as "prey" or "bait." A list of proteins which have

been found or used in this way is steadily growing. In some instances, this may be an indication

that Daxx could be a false positive of the experimental system. Yet the truly diverse function of

Daxx-mediated protein interactions has made elucidating the role of Daxx and its biological

significance difficult. The first Daxx-deficient mouse model developed by Michaelson and

colleagues still showed the transcription of a mutant form of Daxx, specifically the C-terminal

479 amino acids of the protein (Michaelson et al., 1999). At least theoretically, this C terminal

fragment could be responsible for the observed levels of apoptosis and other phenomenon

associated with Daxx-deficiency. A more comprehensive Daxx knockout was generated by the

Ishov Lab, however, which showed a similar phenotype (Ishov et al., 2004). By embryonic day

8, Daxx-'/ mice were developmentally retarded and by day 11.5-12.5, embryos distenegrated

completely (Ishov et al., 2004). As we continue to learn more of Daxx biology, we will

continually add more to what we already know as a truly unique protein with diverse cellular

functions.



Cellular Localization of Daxx

The sub-cellular localization of Daxx has been a controversy since it was discovered as a

factor involved in Fas-induced apoptosis. Daxx was identified via yeast-two hybrid screening

using Fas as "bait." While Daxx was not completely characterized from this screening, these

findings thrust forward the ideology that Daxx would be found as a cytoplasmic-oriented protein

near the cell membrane. A subsequent paradox would ensue when Daxx was discovered as a

21









predominately nuclear protein. Beginning with the study by Pluta and colleagues, which

characterized the interaction between centrosome component CENP-C and the human form of

Daxx from HeLa cells, large-scale biochemical separation into cytosolic, nuclear and mitotic

chromosome fractions would show that Daxx was a protein associated largely with nuclear

isolated fractions. Immunofluorescence of endogenous Daxx was described as a "punctuate

staining pattern" in interphase nuclei (Pluta et al., 1998). This characteristic Daxx-staining

pattern emphasizes its association with PML bodies. Subsequent studies would attempt to

validate Daxx interaction with apoptosis signal-regulating kinase 1 (ASK1) and show co-

localization and interaction of the two proteins in the cytoplasm, but the bulk of these

experiments were based on transient over-expression and this may not necessarily represent the

behavior of endogenous proteins (Ko et al., 2001). One report by Lalioti et al. showed very

detailed cellular fractionation of NIH-3T3 fibroblasts into nuclear, cytosolic, low-density

microsome, high-density microsome and plasma membrane fractions, with the majority of Daxx

accumulating in the nuclear fraction and a small percentage appearing in low-density

microsomes (Lalioti et al., 2002). Using human Daxx antibody directed against endogenous

protein, the Lalioti group observed along with nuclear staining, a very faint speckle-like

cytoplasmic Daxx pattern in human fibroblasts which presumed there may be two intracellular

pools of Daxx that exist in cells. Strong endogenous interaction between Daxx and other

nuclear-associated proteins including chromatin remodeling proteins ATRX and HDACII,

nuclear sub-domain constituent PML, nuclear protein kinase HIPK1 among others, suggests

Daxx is predominately a nuclear protein. In the absence of PML, the major Daxx housing

domain in interphase, Daxx adopts a primarily chromatin-based localization in the nucleus









(Ishov et al., 2004). Thus, if Daxx protein resides in the cytoplasm at any period of time, it

would most likely occur as a result of specific relocation as part of signaling pathways.

Several reports describe detailed mechanisms of Daxx re-localization under various stress

conditions (Jung et al., 2008; Jung et al., 2007; Junn et al., 2005; Karunakaran et al., 2007; Song

and Lee, 2003). In many cases, this change in distribution of Daxx was shown to be critical for

cell survival under stress. During glucose deprivation, Daxx is re-located from the nucleus to the

cytoplasm (Song and Lee, 2003, 2004). Mutation of Trpytophan 621 and Serine 667 of human

Daxx, moreover, was sufficient to block nuclear export in these stress conditions, which relied

on stable adenoviral expression of Daxx in adenocarcinoma DU-145 cells. Chemical hypoxia-

induced Daxx relocalization to the cytoplasm was eloquently shown by (Jung et al., 2008) using

detailed confocal imaging analysis of endogenous Daxx in Chinese hamster ovary cell line

PS120. Oxidative stress was also reported to influence the localization of Daxx to the cytoplasm

in DU-145 cells, while over-expression of catalase inhibited nuclear export of Daxx and its

glucose deprivation-induced cytotoxicity (Song and Lee, 2003). A contradictory report by

(Khelifi et al., 2005) however, showed via biochemical separation that Daxx remains in the

nucleus after exposure to hydrogen peroxide or UV treatment. In the majority of studies,

however, the primary means of determining stress induced Daxx localization was accomplished

by immunofluorescence staining of transiently over-expressed protein. In some cases, these

localization patterns may be a result of artifacts-created either by conditions of treatment or

methods of fixing and staining of cells. Alternatively, many observed properties of Daxx in

response to stress stimuli may be cell-line specific. Can stress-induced Daxx re-localization be

explained by the shuttling of other nuclear proteins into the cytoplasm? To date, few studies

have effectively incorporated these controls into their investigations. If a general re-distribution









of nuclear proteins is observed in these cases, it is possible that these phenomena are less

attributable to Daxx function and more explainable as a general cellular stress response. Reports

such as (Nefkens et al., 2003) for example, may describe more functional stress-induced Daxx

redistribution in that the activity of several nuclear- and ND 10-associated proteins were

documented in parallel after response to specific stress stimuli. Specifically, Daxx and Spl00

but not PML would disperse from ND10 into the nucleoplasm due to rapid desumoylation of

PML during heat shock, while heavy metal exposure would release Daxx and PML with Spl00

retained at ND10 (Nefkens et al., 2003). While there is some tantalizing evidence to suggest

existence and function of Daxx in the cytoplasm, more extensive studies of endogenous protein

trafficking are required.



Ras-Association Domain Family-1 (Rassfl) and Cancer

The Rassfl gene locus comprises approximately 11,151 base pairs of the human genome

and consists of eight exons (Agathanggelou et al., 2005). It is found on the short arm of human

chromosome 3 (3p21.3). Differential promoter use and alternative splicing creates seven

transcripts RassflA-RassflG. Of these transcripts, isoforms RassflA and RassflC are

predominately expressed in all tissues while RassflB is expressed in the hemopoeitic system

only, and RassflD or RassflE expression is restricted to cardiac or pancreatic cells, respectively.

Homologues of RassflA exist in rodents, fish, nematodes and fruit flies ranging from 38% to

85% identity (Agathanggelou et al., 2005). A RassflC homologue exists in Xenopus with no

apparent homologue for RassflA.









Preferential Alteration of RassflA in Cancer

Allelic loss of the short arm of human chromosome 3 (3p) is one of the most frequently

occurring events in lung cancers (90% of small cell lung cancers 50-80% of non-small cell lung

cancers) (Dammann et al., 2000). Specifically, the region 3p21.3, where the Rassfl locus

resides, displays regular loss of heterozygosity and homozygous deletions in cancer cells.

Promoter methylation and loss of protein expression have been directly correlated specifically to

RassflA in many different tumor cell lines and this methylation has been confirmed in at least 37

different tumor types (Agathanggelou et al., 2005). Methylation of the RassflA promoter does

not affect expression of RassflC and in numerous instances RassflC is used as a control for

RNA integrity and loading when studying RassflA expression. Therefore, epigenetic

inactivation of RassflC is much rarer than that of RassflA. In one study, RassflA promoter

methylation occurred with a frequency of 62% in forty-five breast carcinomas that were analyzed

and in many instances treatment of cells with the DNA methylation inhibitor 5-aza-2'-

deoxycytidine reactivated RassflA transcript expression (Dammann et al., 2001). Because of

this very strong correlation between loss of RassflA expression and tumor-specific cell lines it is

highly regarded as a candidate molecular marker for tumor diagnosis. Differential loss of

RassflC expression, however, has been documented in some tumor cell lines and may be

regulated by more significant post-transcriptional mechanisms than RassflA (Donninger et al.,

2007).



RassflA and Cell Cycle Control

Because of the intense focus of RassflA inactivation in cancers, the majority of functional

studies about Rassfl have swayed largely to the A isoform of Rassfl because of its potential

tumor suppressor roles. Indeed, a seminal observation that has been repeatedly confirmed for

25









RassflA as a tumor suppressor is the reintroduction of the protein by over-expression reduces

colony formation in soft agar assays, suppresses growth and reduces independence of anchorage-

free cell growth (Burbee et al., 2001; Dammann et al., 2000). Along with reports of growth

regulation was the first observations that RassflA could block cell cycle progression. Over-

expression of RassflA was found not to impact apoptosis, but to block cells strongly in the G1

stage of interphase and inhibit accumulation of cyclin Dl (Shivakumar et al., 2002).

Importantly, these findings also showed that RassflA transcript variants (identified from breast

and lung tumor samples) could not block cells in G1 compared to wild-type RassflA

(Shivakumar et al., 2002). Supporting the evidence of RassflA function in Gl-arrest was a study

by the Fenton group showing interaction of p20E4F with RassflA that was necessary for G1-

arrest (Fenton et al., 2004). Furthermore, this function became even more intricate when Song

and colleagues described a dynamic cell cycle-dependent regulation of RassflA protein levels by

Skp2 ubiquitin ligase complex (Song et al., 2007). When RassflA levels were degraded by

targeted ubiquitination, it was shown that cells were able to sufficiently progress through G1 into

S phase. Subsequent studies would also begin to analyze sub-cellular localization of RassflA

and associate its localization in cells with function.

The Pfeifer group were the first to describe RassflA as a protein that co-localizes with

microtubules during interphase and associates with the spindle apparatus during mitosis (Liu et

al., 2003). By using Rassfl-/- cells and over-expression studies, it was shown that RassflA

provided stability to microtubules and the region of tubulin interaction was mapped to a specific

169 amino acid stretch of the carboxy-terminus of RassflA (Liu et al., 2003). The Vos and

Dallol groups would confirm RassflA-association with microtubules and microtubule-associated

proteins and that these interactions were important for microtubule stability, dynamics and









preventing genome instability (Dallol et al., 2004; Vos et al., 2004). Liu and colleagues also

described that overexpression of RassflA induced aberrant mitotic arrest at metaphase in a

similar manner to the microtubule stabilizing drug taxol and how it affects cells (Liu et al.,

2003). This became the first study to link RassflA to possible mitotic functions in cells.

Additional insight into the role of RassflA function in mitosis and cell cycle progression

came in the seminal study by (Song et al., 2004). RassflA was shown to influence the stability

of both Cyclin A and Cyclin B as a result of direct interaction with Cdc20 and negative

regulation of the anaphase promoting complex (APC). Without RassflA, cells were proven to

progress through early mitosis (specifically pro-metaphase) faster as a result of premature

activation of APC. Absence of RassflA by siRNA depletion also caused centrosome

abnormalities and multipolar spindles. Details of interaction of RassflA with Cdc20 would later

become a subject of controversy as Liu and colleagues showed that RassflA was not capable of

interacting with Cdc20 in vitro and immunoprecipitation of Cdc20 with RassflA could not be

detected in synchronous or asynchronous cells (Liu et al., 2007). In the future, additional studies

into the precise role of RassflA regulation of mitosis will be required.



Cellular Localization of RassflA

Not until the Pfeifer group described co-localization of RassflA with microtubules did the

scientific community know about the distribution of the protein in cells (Liu et al., 2003). While

this study showed ample evidence of the microtubule-associated network that over-expressed

RassflA will form in cells, the Vos group were the first to describe the endogenous interaction of

RassflA with polymerized tubulin (Vos et al., 2004). Depolymerized tubulin was unable to

interact with RassflA. The same group performed a yeast two-hybrid screen using RassflA as

"bait" and identified and confirmed several known microtubule-associated proteins as interacting

27









partners ofRassflA, including microtubule associated protein 1A (MAP1A), MAP1B and

C190RF5 (Dallol et al., 2004). Several reports have shown because of the direct interaction

between RassflA, tubulin and tubulin-related proteins, it served to stabilize microtubules under

stress conditions (i.e. nocodazole treatment) (Liu et al., 2003; Rong et al., 2004). During mitosis,

over-expressed RassflA was observed to co-localize with centrosomes and microtubules during

prophase, the spindle apparatus (spindle poles and spindle fibers) during prometaphase,

metaphase and anaphase and microtubules as they reformed in divided daughter cells (Liu et al.,

2003; Song et al., 2004). The minimal interaction domain that is responsible for RassflA

binding to microtubules and for association with the spindle apparatus was mapped to amino

acids 120-288 of RassflA (Liu et al., 2003).



Functions of RassflC

While extensive studies on the epigenetic regulation of RassflA have been performed

coupled with essential studies into the function of RassflA and its importance in tumor

progression, very little is known about RassflC biology. Armesilla et al. (2004) used a yeast

two-hybrid screen to find novel interactors of plasma membrane Ca2+ pump 4b (PMCA4b)

which identified RassflC. The interaction between RassflC and PMCA4b was narrowed down

to a region that is common to both RassflC and RassflA, presumably showing that this

interaction is shared between both isoforms although this data was not shown. Potential tumor

suppressor functions of RassflC were first described by Li and colleagues demonstrating that

RassflC could substantially reduce anchorage independent growth of tumor cells and elicit cell

cycle arrest similar to RassflA (Li et al., 2004). Amaar et al. performed a similar investigation

showing that upon depletion of RassflC protein in H1299 cells that lack RassflA expression, it

caused a significant decrease in cell proliferation (Amaar et al., 2006). Upon over-expression of

28









RassflC, however, cell proliferation was actually increased compared to cells over-expressing

RassflA. This became some of the first tantalizing evidence to suggest that RassflA and

RassflC could have different effector targets. The microtubule binding and stabilizing functions

of RassflC were also characterized and shown to have identical properties to RassflA-mediated

microtubule stability, although these findings were largely an oversight (Rong et al., 2004)

Interestingly, a study purporting the interaction of RassflC and Daxx in the nucleus was

described by (Kitagawa et al., 2006). This study suggested that upon degradation of Daxx,

RassflC would be released from the nucleus where it can activate the SAPK/JNK pathway to

trigger apoptosis during stress conditions. If proven correct, this evidence and others like it

(Amaar et al., 2006) suggest that although RassflA and RassflC have several properties in

common they may also have many divergent roles in the cell.



Cellular Localization of RassflC

The localization of RassflC in cells has not been a subject of critical attention. Several

reports suggested microtubule-associated localization of over-expressed RassflC was similar to

RassflA localization although these similarities were not emphasized (Liu et al., 2002; Liu et al.,

2003; Vos et al., 2004). Some reports have suggested over-expressed RassflC adopts a nuclear

localization, perhaps in an effort to separate the tumor suppressor-based roles of RassflA from

its lesser isoform (Song et al., 2004). Moreover, the description of both over-expressed and

endogenous RassflC as a component of PML bodies was described by Kitagawa, et al. (2006).

In this study, RassflC was shown to be exported from the nucleus when Daxx was degraded by

ubiquitination or siRNA depletion, implying a Daxx-dependent nuclear localization of RassflC

(Kitagawa et al., 2006). More extensive studies into the partitioning of RassflC inside of the cell

are required.















-..Petaas
Prometaphase


Prometaphase
Block


sensitive cells
______ cell
death

Milotic Catastrophe:
Micronuclei Fornation
paclitaxel
decay!/ithdrawat


resistant cells


Prometaphase
Block (prolongated)


completion
- of mitosis,
cell division


inhibition of microtubule dynamics
by paclitaxel


recovery of microtubule dynamics


Figure 1-1. Dynamics of Paclitaxel Action in Cells. At pharmacological concentrations,
paclitaxel reversibly inhibits microtubule dynamics blocking cells in pro-metaphase.
Cells that are sensitive to paclitaxel activate mitotic block only transiently, followed
by micronucleation (mitotic catastrophe) and cell death, while resistant cells have a
more prolonged pro-metaphase block and continue proliferation after drug decay/
withdrawal and microtubule dynamics restoration-thus surviving chemotherapy.


r


GI Phase
At ND10PML bodies
-mteractiHn with PML F1


t


S-Phase
At lsn lrma
-inkraction with ATR
(Activew)


tin



G2 Phase
AtN-mVMMrWs
-ina~eracti with PMLSM
(Inative)


I


Mitosis
Disaaemby ofNDIO
-deSUMOlatin of PML
Function ?
Figure 1-2. Localization of Daxx Throughout the Cell Cycle. During Gl and G2 phase, Daxx is
localized to PML bodies where it is presumably inactive. During S phase, Daxx
relocates from PML to condensed chromatin where it interacts with ATRX. The fate
and function of Daxx during mitosis (M phase) is not documented.


Prophase










CHAPTER 2
MATERIALS AND METHODS

Antibodies

Antibodies to Daxx (M112), BubR1 (8G1), Bubl (14H5), Cdc20 (H-175), Cdc27 (AF3.1),

Cyclin B (GNS1) and Mad2 (17D10) were from Santa Cruz Biotechnology; GST monoclonal

antibody was from Sigma; 6X His monoclonal antibody was from Invitrogen; RassflC mouse

polyclonal antibody was from UT Southwestern; RassflA monoclonal antibody was from

Abcam; RassflA/C polyclonal antibody was a gift from Dae Sik Lim, Korea Advanced Institute

of Technology; PML rabbit polyclonal antibody was from Gerd Maul, Wistar Institute; Phospho

Histone H3 (SerlO) rabbit polyclonal antibody was from Upstate; a-Tubulin monoclonal

antibody was from Sigma; Daxx monoclonal antibody 514 and rabbit polyclonal antibody

2133/2134 were developed as described in (Ishov et al., 2004).



P-Gal Reporter Assay

Starter cultures of yeast were grown overnight in CM selective media and OD600 readings

were measured the next day. Cells were resuspended in breaking buffer (100 mM Tris-HCl pH

8.0, 1 mM DTT, 10% glycerol, 40 mM PMSF) and glass beads were added and suspensions were

vortexed for approximately 5 min at 40C. After pelleting cell debris, a 1:10 mixture of

superatant/Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KC1, 1 mM MgSO4) was

made and incubated for 5 min at 280C. 200 [tL ONPG (Sigma) was added to the mixtures and

the time taken for reactions to turn yellow was recorded. Afterwards, 400 [iL of Na2CO3 was

added to stop reactions. P-Gal activity was measured at OD420 by making 1:10 mixtures of

ONPG reaction/water and recording spectrophotometer readings. Protein concentration was

determined by OD595 spectrophotemeter readings afterterwards.

31











Biochemical Fractionation

HEp2 cells were separated into nuclear and cytosolic fractions using a biochemical

fractionation buffer consisting of 250 mM sucrose, 20 mM HEPES-KOH pH 7.4, 10 mM KC1,

1.5 mM MgC12, 1 mM EDTA, 1 mM EGTA. Cells were grown on 100 mm dishes and washed

2X with PBS and then placed on ice. Ice cold fractionation buffer was immediately added to

dishes and cells were incubated at 4C with gentle rocking for 15 minutes. Cells were then

collected into tubes and dounced five times with a B-type pestle. Afterwards, cell extract was

collected into microcentrifuge tubes and centrifuged for 2-3 min at 800 RPM to separate intact

nuclei from soluble cytoplasm fraction. Nuclei were washed 2X with fractionation buffer and

resuspended in 1 mL fractionation buffer. 5 M NaCl was then added to the buffer to reach a final

concentration of 450 mM NaC1. Nuclei were then placed at 4C and subjected to gentle

inverting for 5-10 minutes. Nuclear extract was then centrifuged at 13,000 RPM for 5 minutes at

4C to pellet insoluble nuclear material.



Cell Culture and Transfections

Daxx +/+ MEFs, Daxx -/- MEFs, HEp2, MDA MB 468 and T47D cells were maintained in

Dulbecco's Modified Eagle's Medium with 10% fetal bovine serum and 1% penicillin/

streptomycin and maintained in 5% CO2 at 37C. For transient transfection in mammalian cells,

all cDNAs were transfected using the Lipofectamine protocol (Invitrogen) according to the

manufacturer's instructions.









Cell Cycle Synchronization

HEp2 and MDA MB 468 cells were synchronized at G1/S using a standard double

thymidine block protocol. Briefly, asynchronous cells were set up at 20-30% confluency and

treated with 2 mM thymidine for 18-20 hrs, washed 2X with PBS and released into normal

media without thymidine for 6 hrs. 2 mM thymidine was then added for an additional 18-20 hrs

and cells were washed 2X with PBS and released from G1/S block for experiments.



Colony Formation Assay

Treated and non-treated cells were set up for colony formation using a series of cell

dilutions ranging from 1:100 to 1:1000 to optimize colony growth. On average, cells were

grown for 5-7 days after set up. Colonies were then washed, fixed with methanol and stained

with crystal violet (Fisher) in order to visibly count colonies. Each colony formation assay was

set up in triplicate in order to obtain representable statistics for each drug treatment and its

duration of exposure to cells.



Confocal Microscopy and Subcellular Localization

HEp2 cells were cultured on cover dishes for 24 hrs and then transfected with GFP-Daxx,

GFP-RassflA, or GFP-RassflC. 24-48 hrs later, live cell confocal images were taken using a

Leica TCS SP5 microscope and chamber and Leica imaging software.



Drug Treatment

Standard concentration of paclitaxel (Calbiochem) used throughout these studies is 10 nM,

unless noted otherwise. Paclitaxel was used to treat both asynchronously and synchronously

growing cells. Standard concentration of nocodazole (Calbiochem) was 10 pM and was used to









treat both asynchronously and synchronously growing cells. Standard concentration of Aurora

kinase inhibitors ZM447439 (Tocris Bioscience) and Aurora kinase inhibitor III (Calbiochem)

was 10 aM. Aurora kinase inhibitors were used to treat only synchronously growing cells.



Embryo Isolation and Culture

Daxx +/+ and Daxx -/- embryos were collected at E9.5 from timed matings of Daxx +/-

mice. Presence of a sperm plug was designated as +0.5 days. Approximately nine days later,

female mice were euthanized and embryos (if present) were collected from the uterus. E9.5

embryos were cultured on glass coverslips for immunostaining or paraffin-embedded for tissue

sectioning. In each case, material from individual embryos was collected for genotyping to

confirm presence or absence of Daxx alleles.



FACS Analysis

Cells were trypsonized and re-suspended in DMEM + 10% FBS + 1% penicillin/

streptomycin, centrifuged and washed 2X with PBS and then fixed in 95% ethanol. After

fixation, cells were treated with 0.5 [tg/mL RNase for 20 minutes and propidium iodide was

added to a final concentration of 20 ag/mL afterwards. Cells were then analyzed via flow

cytometry for cell cycle distribution.



Fluorescence Time-Lapse Microscopy

Control and Daxx-depleted HEp2 cells stably transfected with GFP-Histone H3 (gift from

Duane Compton, Dartmouth University) were cultured on cover dishes for 24 hrs and then

grown at 37C in a microscope chamber supplying 5% CO2. Mitotic cells were imaged using a

confocal Leica TCS SP5 microscope and Leica imaging software.











Immunofluorescence

Cells were cultured on glass coverslips in 24-well plates (Corning), washed with KM

buffer (100 mM MES, 100 mM NaC1, 120 mM MgCl2, 50% glycerol) and fixed with 1%

paraformaldehyde or ice cold methanol at room temperature for 20 min. After treatment with

0.4% Triton X-100 in PBS (paraformaldehyde-fixed cells only), the cells were incubated with

primary antibody for 1 hr at room temperature and then washed 2X with PBS and secondary

antibodies (FITC or Texas Red-conjugated, Vector Labs) were then applied sequentially for 45

min each at room temperature in the dark. Cells were then stained with HOECHST (Vector

Labs) and mounted on slides using Fluormount G (Southern Biotech), dried and analyzed using a

Leica fluorescent microscope and imaged using Openlab software.



In vitro Pull-down Assay

Daxx and Rassfl constructs were cloned into pGEX-2T (Invitrogen), pGEX-4T3

(Invitrogen), and pQE-30 (Qiagen) plasmids, respectively. Constructs were then transformed

into a Rosetta strain of E. coli. Protein expression was induced using 50 mM IPTG (Fisher)

(Daxx constructs) and 100 mM IPTG (Rassfl contracts) at room temperature for 6 hrs (Daxx) or

18 C overnight (Rassfl). Cells were then pelleted and lysed using a lysis buffer consisting of

0.1% Triton X-100, 2 mM phenyl-methyl-sulfonyl fluoride (PMSF) (Calbiochem), 1 [tg/mL

aprotinin (Sigma), 1 [tg/mL leupeptin (Sigma), 1 [tg/mL pepstatin (Sigma) and 50 [tg/mL 2-

mercapto-ethanol (Sigma) in TBS. A GST- and 6X-His pulldown kit (Pierce Biotechnology)

was then used to determine binding capability as per the manufacturer's instructions. Protein

samples were analyzed on 4-20% Tris-HC1, sodium dodecyl sulfate (SDS)/arcrylamide gels

(Biorad).











Plasmid Constructs

GFP-hDaxx wt and deletion mutants were cloned into the BamHI site of pEGFP-C1.

GST-hDaxx wt and deletion mutants were cloned into the BamHI site of pGEX-2T and pGEX-

4T3. pEGFPC2-hRassflC was a gift from Gerd Pfeifer, Beckman Research Institute. RFP-

mRassflC wt and deletion mutants were cloned into the EcoRI/HindIII site of pDS-RedN1.

6His-mRassflC was cloned into pQE-30. GFP-hRassflA was a gift from Dae Sik Lim, Korea

Advanced Institute of Technology. RFP-hRassflA wt and deletion mutants were cloned into the

EcoRI/HindIII site of pDS-RedN1. GST-hRassflA wt and deletion mutants were cloned into the

BamHI site of pGEX-2T and pGEX-4T3.



Stable siRNA Infection

MDA MB 468 and HEp2 cells were transduced with recombinant lentivirus supernatants

encoding hairpin siRNA hDaxx, hRassflA and control expression constructs which were

collected from -5 x 104 transfected 293T cells used for multiple rounds of infection in the

presence of 4 ug/ml polybrene. The lentiviral expression system was provided by Peter M.

Chumakov (Lerner Research Institute, Cleveland; (Sablina et al., 2005). This lentiviral system

comprises a targeting envelope expression vector pCMV-VSV-G, a generic packaging

expression vector pCMV-deltaR8.2 and the expression cassette for custom siRNA pLSL-GFP

that contains a minimal histone H4 promoter that drives transcription of a GFP gene allowing

fluorescent cell sorting. Candidate siRNAs for Daxx were designed according to the Dharmacon

siDESIGN algorithm (http://www.dharmacon.com/sidesign/). Anti-Daxx siRNA 1 was targeted

against base pairs 1552-1570 of hDaxx (sense CTACAGATCTCCAATGAAA; anti-sense

TTTCATTGGAGATC TGTAG); anti-Daxx siRNA 2 was targeted against base pairs 100-118 of

36









hDaxx (sense GATGAAGCAGCTGCTCAGC; anti sense GCTCAGCAGCTGCTTCATC);

control siRNA was directed against base pairs 1262-1284 of SETDB1 (sense

TCCTCTTTCTTATCCTCGTATGT, anti-sense ACATACGAGGATAAGAAAGAGGA).



Western Blotting

Cell and protein extracts were ran on pre-made 4-20% Tris-HC1, SDS/Acrylamide gels

(Biorad), separated by electrophoresis and transferred onto nitrocellulose and PVDF membranes

(Biorad). Membranes were then blocked using 3% milk in 0.1% PBS-Tween for 30 minutes at

room temperature. Primary antibodies were added and incubated overnight at 4C. The next

day, membranes were washed 3X with 0.1% PBS-Tween and secondary antibodies (mouse and

rabbit HRP conjugates, Cell Signaling Technologies) were added and membranes were incubated

at room temperature for 1 hr. After 3X wash in PBS-Tween, membranes were then exposed with

ECL (Amersham) and developed.



Yeast Two-Hybrid Assay

The bait vector pGBDC1-mDaxx wt, -mDaxx C term and -mDaxx AC were transformed

into yeast strain PJ-69a and PJ-69 alpha along with mouse E11.5 cDNA library plasmid cloned

into pGADC1. Briefly, frozen yeast competent cells were vortexed until melted completely and

then incubated at room temperature for 45 min in 1 mL solution B (40% polyethylene glycol

1000, 200 mM bicine pH 8.35). After pelleting cells, supernatant was removed and cells were

resuspended in 1 mL solution C (150 mM NaC1, 10 mM bicene pH 8.35) and repeated with a

second wash in solution C. Cells were then resuspended in 100 pL solution C and plated on

selective media (CM media tryptophan,- leucine and CM media tryptophan,- leucine,-

histidine).









CHAPTER 3
DAXX FUNCTION IN MITOSIS

Introduction

Components of the mitotic spindle checkpoint, as well as factors involved in the controlled

regulation of the spindle checkpoint and other mitotic processes, are necessary for proper

partitioning of chromosomes into daughter cells. In the absence of such factors, cells can

mishandle proper chromosomal alignment and segregation during metaphase and anaphase,

resulting in lagging chromosomes and aneuploidy (Ikui et al., 2005). Proper timing and the rate

of mitotic progression can also be affected in the absence of one or more mitotic proteins. For

this reason, the cell cycle has been compared to a series of molecular timers: "clocks" that

control the average duration of each cycle, and "dominoes" that make each step dependent on the

proper completion of a prior step (Meraldi et al., 2004). Cyclin B and Securin are two of the

primary mitotic substrates that drive entry into and exit from mitosis (Pines, 2006). Using

biochemical analysis of the relative stability of these proteins it is possible to measure the

duration of mitosis and cell division. Along with the targeted depletion of proteins and time-

lapse microscopy, many mitotic factors have been shown to affect timing and rate of mitotic

progression-adding leverage to their already established roles as mitotic regulators and adding

the possibility of uncovering novel proteins that may also influence cell cycle progression.



Results and Discussion

Originally identified as a pro-apoptotic Fas-interacting protein and later demonstrated to have

anti-apoptotic activity (Michaelson, 2000), Daxx is a ubiquitously expressed and highly

conserved nuclear protein that is also implicated in transcription regulation. As an almost

exclusively nuclear protein during interphase, Daxx interacts with intrinsic kinetochore protein









CENP-C (Pluta et al., 1998); depletion of Ams2, a Daxx-like motif-containing GATA factor in S.

pombe results in chromosome mis-segregation (Chen et al., 2003). Extensive aneuploidy was

also observed in Daxx-- MEFs, a typical manifestation of chromosomal mis-segregation in cells

(Figure 3-1, bottom). This condition was observed in three independent Daxx-- MEF cell lines,

suggesting Daxx may be important for accurate chromosomal separation and/or cell division.

Furthermore, upon paraffin-sectioning of E9.5 Daxx-deficient embryos and HOECHST staining

of cells, an increased number of Daxx-deficient cells were observed in early mitosis, specifically

pro-metaphase (Figure 3-1, top). In contrast, a smaller number of cells were observed in later

stages of mitosis anaphasee, telophase and cytokinesis) compared to corresponding wild type

Daxx embryos. These findings suggest a potential involvement of Daxx in mitosis progression.

To understand the extent of Daxx influence on the rate and timing of mitosis, the effect of

Daxx-depletion on mitosis progression was analyzed on HEp2 cells which were stably

transfected with GFP-Histone H3 and a control siRNA (mouse Daxx) or human Daxx siRNA

using fluorescence time-lapse microscopy. Cells expressing human Daxx siRNA were

efficiently depleted of Daxx-protein levels, compared to control (Figure 3-2). Photo-toxicity

associated with fluorescence microscopy limited the time interval of movies to one frame every 2

minutes. Using the precedent of Meraldi and colleagues, key events in mitosis were monitored

and timed based on chromosome condensation to nuclear envelope breakdown prophasee to pro-

metaphase), nuclear envelope breakdown to central chromosome alignment (pro-metaphase to

metaphase) and chromosome segregation anaphasee) (Meraldi et al., 2004). Results of this

analysis are formulated in Table 3-1. Extending from the beginning of chromosomal

condensation to nuclear envelope breakdown, completion of prophase in Daxx-depleted cells

was on average 31.4% faster (7.05 min +/- 2.64 min in Daxx siRNA, compared to 10.2 min +/-









2.3 min in control siRNA) than control cells (Figure 3-3). Overall, condensation of

chromosomes in Daxx-depleted cells occurred more rapidly and the onset of pro-metaphase

occurred sooner. The transition from nuclear envelope break down to chromosome segregation

in anaphase was also 20.5% slower in Daxx-depleted cells (37.6 min +/- 10.36 min for Daxx

siRNA, 31.2 min +/- 7.9 min for control siRNA) (Figure 3-3). Hence, absence of Daxx

significantly influences the rate of early mitosis progression in HEp2 cells which emphasizes

initial observations of increased pro-metaphase index in Daxx knockout embryos.

To confirm that Daxx protein has a direct effect on cell cycle progression, HEp2 cells stably

expressing control or Daxx siRNA were synchronized using a double thymidine block and then

released to allow cells to progress through mitosis synchronously so mitotic cyclin B levels could

be analyzed. Defective mitotic progression was seen in Daxx-depleted cells as cyclin B levels

were consistently sustained longer than wild-type (parental) or control siRNA cells (Figure 3-4).

Specifically, during the time point of 9-9.5 hr release from thymidine block in wild type and

control siRNA cells the majority of Cyclin B levels are destroyed, however, Cyclin B stability is

preserved in Daxx siRNA cells past this time point until 10-10.5 hrs after thymidine release.

These data implicate Daxx in the regulation of mitotic progression, either directly as a regulatory

mitotic protein or indirectly through other mechanisms.

To rule out possible indirect mechanisms of Daxx regulation of mitosis, protein expression of

several known mitotic proteins, including Mad2, a key mitotic checkpoint protein; Cdc20 the

activator of the anaphase promoting complex (APC)/cyclosome and Cdc27, a major subunit of

the APC was analyzed and compared in control- and two independent Daxx-depleted HEp2 cell

lines (Fig 3-5). By comparison, no significant changes in protein expression were observed in

the presence or absence of Daxx, which supports microarray analysis from Daxx++ and Daxx-/-









embryos which showed no apparent changes in mitotic protein expression (data not shown).

Thus, there is little evidence to suggest Daxx can regulate transcription of known mitotic

proteins. The expression of Daxx protein throughout different stages of the cell cycle was also

analyzed and found to change insignificantly (Figure 3-6). Thus, Daxx is a very stable protein

throughout the cell cycle that has direct involvement in the regulation of mitotic progression.

Cell cycle-dependent protein localization of endogenous Daxx was analyzed in Daxx+

MEFs as they progressed into and through mitosis (Figure 3-7). A striking mitotic spindle-like

association of Daxx was consistently observed in Daxx+/+ MEFs which was not present in Daxx/-

cells beginning in pro-metaphase, upon nuclear envelope breakdown. Daxx was observed to

localize in the nucleus in prophase typically at PML bodies, but by early pro-metaphase, Daxx

protein localization was redistributed to spindle structures as they were being formed (Figure 3-

7). By late pro-metaphase, the majority of Daxx was distributed to the spindle apparatus, away

from PML. Biochemically, it is known that during mitosis, PML bodies are de-sumoylated and

the bulk of PML-associated proteins, including Daxx, leave during this time (Dellaire et al.,

2006; Ishov et al., 2004). The spindle-like localization of Daxx is maintained through

metaphase, but by the later stages of mitosis anaphasee to cytokinesis) this association is absent.

Thus, Daxx is a spindle associated protein that is important for the correct timing of early mitosis

progression in cells.









Table 3-1. Statistical Analysis of Mitotic Progression in Control- and Daxx-Depleted H3-GFP-
HEp2 Cells. Peak time designates the most frequently occurring time of completion
for each stage of mitosis.
Peak Standard
Stage RNAi Average time deviation Min Max
Prophase


Control 10.2 min 10 min 2.3 min


Daxx


7.5 min 6 min


6 min 18 min


2.64 min 2 min 14 min


Prometaphase-
anaphase


Control
Daxx


31.2 min
37.6 min


28 min
32 min


7.9 min
10.36 min


22 min
22 min


58 min
78 min


A










B
Daxx+/+ Daxx-/-
I 1 It 11 1111 "uli II ei iii
U Ei |( |t aia fI |I| 1Wt at:| *,I

ii i I .. t ta <. aa ,


Figure 3-1. Characterization of Daxx- Mouse Embryos and Cells. A) HOECHST
immunohistochemical staining of Daxx and Daxx E9.5 mouse embryos. Mitotic
stages are marked with small arrows. P/M=pro-metaphase, M=metaphase,
A=anaphase, T=telophase. Apoptotic cells are marked with large arrowheads. B)
Karyotype analysis of Daxx and Daxx MPEFs generated from E9.5 embryos.
Daxx- MPEFs exhibit aneuploidy.















Daxx a I



Figure 3-2. Western blot Analysis of Daxx Protein Level in HEp2-H3-GFP Cells Expressing
Control-siRNA or Daxx-siRNA. Note efficient depletion of Daxx using Daxx-
specific siRNAs compared to control siRNAs.


A




ontrol-siRNA or Daxx-siRNA. A) Prophase progression in control and Daxx-





B

C *ol





siBNA

Figure 3-3. Fluorescence time-lapse microscopy images of HEp2-H3-GFP cells expressing either
control-siRNA or Daxx-siRNA. A) Prophase progression in control and Daxx-
depleted cell lines. B) Mitotic progression from nuclear envelope break-down (pro-
metaphase) to chromosomal segregation anaphasee).











Cydin B
Aclr



Cydin B
Actin


HED2 (parental
T 6hr 7hr hr 8.5 hr 9 h 95 hr 10hr 105hr 11 hr
i _


Control siRNA
T 6hr 7 hr 8 hr 85 hr 9h 95 hr 10hr 10.5 hr 11 hr
wo-o


Daxx siRNA
DT 6 hr 7 hr 8 hr 8.5hr 9hr 9.5hr 10 hr 10.5 hr 11 hr
CydinB -
Actin r
Figure 3-4. Daxx depletion stabilizes Cyclin B during mitosis. Mitotic progression of
synchronized wild type (parental) HEp2 cells, control-siRNA and Daxx-siRNA cell
lines. Cells were synchronized using a double thymidine block and released and
probed for Cyclin B protein levels at the indicated time points.




^' ^


Cdc27

Cdc20


Mad2 aO

Actin a e em* 1

Figure 3-5. Western Blot Analysis of Mitotic Proteins in Wild type (Parental), Control-siRNA
and Two independent Daxx-siRNA Cell Lines. Protein expression did not differ
significantly in the presence or absence of Daxx.











Roleire from tlJeAmidn
DT <6 7 1fhr r 8 IV 1t0 r llhf
Danxr





Figure 3-6. Western Blot Analysis of Daxx Protein Levels Throughout the Cell Cycle. HEp2
cells were synchronized in G1/S using a double thymidine block (DT) and then
released from thymidine block for the indicated times. Daxx protein levels change
insignificantly throughout each cell cycle stage.

A














B


. xI


Figure 3-7. Dynamics of Daxx Localization in Mitotic MPEF Cells. A) Localization of Daxx in
prophase (at PML), pro-metaphase (spindles), metaphase (spindles) and anaphase-
cytokinesis (no association). B) Change in localization of Daxx during early pro-
metaphase (top picture) from PML bodies to the forming spindle apparatus. By late
pro-metaphase (bottom picture), the majority of Daxx is localized to the spindle
apparatus.


x ,x IDNA1




early proJ~fmetaphm









CHAPTER 4
DAXX IS A TRIGGER OF CELLULAR TAXOL RESPONSE

Introduction

The mitotic spindle checkpoint is a very fluid and dynamic apparatus designed to monitor

microtubule-kinetochore attachment and proper microtubule tension. In the event of an error

occurring during pro-metaphase and metaphase, the spindle checkpoint will elicit a "wait" signal

that stalls chromosomal segregation and anaphase onset until errors are corrected. Microtubule-

inhibiting drugs such as taxol and nocodazole (among others) can initiate a prolonged "wait"

signal that if uncorrected, initiates micronucleation (mitotic catastrophe) and cell death (Jiang et

al., 2006; Mansilla et al., 2006a; Mansilla et al., 2006b; Ricci and Zong, 2006). Thus, sub-

populations of cancer cells with deranged regulation of mitotic spindle checkpoint proteins and

other associated factors can respond differently to these compounds offering a therapeutic

molecular target for treating cancers. However, in most instances, inactivation or down-

regulation of mitotic checkpoint proteins leads to increased sensitivity to microtubule inhibiting

drugs. In cases of BubR1 or Mad2 depletion, cells treated with taxol respond in a much stronger

and robust way: the number of cells arrested in mitosis dramatically decreased and cell death

was more rapid (Sudo et al., 2004). Cells lacking Madl, an important factor involved in the

assembly of the spindle checkpoint, also exhibit increased sensitivity to taxol, however cells

treated with nocodazole became more resistant (Kienitz et al., 2005). Thus, identification of

novel regulators of taxol sensitivity-which may alter cellular response to these drugs by

increasing resistance-is required.









Discussion and Results

Compounds that affect the mitotic spindle apparatus, including microtubule inhibitors such as

paclitaxel (taxol) and nocodazole, are known to differentially affect cells that lack one or more

mitotic spindle associated proteins compared to wild type cells. To further explore the potential

role(s) of Daxx in mitosis and cell division, the microtubule inhibitor taxol, which is a

microtubule hyper-stabilizing compound and the tubulin-destabilizing drug nocodazole were

used to examine response of Daxx+/+ and Daxx-/- MEFs. A very striking and divergent response

was observed between Daxx+/+ and Daxx-- mouse fibroblasts treated with taxol and nocodazole

(Figure 4-1), which was not recapitulated when cells were treated with drugs such as roscovitine,

adriamycin and etoposide (data not shown). The number of mitotic cells in Daxx+/+ MEFs was

much lower compared to Daxx-/- MEFs. Conversely, the occurrence of micronucleated cells in

Daxx+/+ mouse fibroblasts was much higher in comparison to Daxx-deficient cells. This evidence

implies a Daxx-specific function which is inhibited when cells are treated with taxol or

nocodazole. The decrease in micronuclei and elevated mitotic index also correlated with cell

survival in Daxx deficient cells, producing 90% of colonies after 24h of taxol treatment

compared to untreated control, while the survival rate of Daxx+/+ cells was only 15%--

approximately 6 times lower compared to Daxx-/- cells (Figure 4-1). Given the similar time of

cell cycle progression for both cell lines (not shown), the difference in colony formation most

likely reflects a differential survival rate of cells upon drug exposure.

Given that taxol is a very potent chemotherapy agent used to treat breast cancers and other

malignancies, the role of taxol-induced cell death in breast cancer cells was examined with how

this may correlate with the level of protein Daxx. High heterogeneity of Daxx protein level

among breast cancer cell lines was observed (Figure 4-2, normalized on actin). Daxx is a nuclear

protein with obvious ND10/PML body association in interphase cells (Ishov et al., 1999); despite

47









high variety in Daxx protein level, intracellular distribution of Daxx is similar in all breast cancer

cell lines tested, showing Daxx co-localizing with PML (not shown). To study a correlation

between Daxx and cellular response to paclitaxel, cell lines with extreme level of Daxx were

chosen: T47D (low level of Daxx, Daxx/actin = 1.0) and MDA MB 468 (high level of Daxx,

Daxx/actin = 14.0) and tested for paclitaxel induced cell death measured by colony formation

assay. Increased survival of T47D cells was observed compared to MDA MB 468 cells (Figure

4-2). 24h of treatment reduces the survival of MDA MB 468 cells almost three fold, and at 48h

of treatment very few colonies formed. 24h treatment had almost no effect on T47D cell survival

rate and 48h treatment reduced the number of colonies only by 30%. Thus, low level of Daxx

correlates with increased resistance to paclitaxel treatment in these breast cancer cell lines.

To address the mechanism of cell death and differential survival of breast cancer cell lines

T47D and MDA MB 468 upon paclitaxel treatment, morphological changes that occurred with

nuclei were observed at different times of drug addition, which is effective means for

discriminating between apoptosis and micronucleation. Cells were categorized based on the

nuclear morphology (Figure 4-2). In mock-treated conditions (control, Figure 4-3) the majority

of cells were in interphase. The rate of accumulation in mitosis at 12h is similar for both cell

lines (Figure 4-3) that reflects almost an identical time of cell cycle progression. Already at 12h

of treatment, 27% of micronucleated cells appear in MDA MB 468 cells and reaches 60% and

79% at 24h and 36h correspondingly (Figure 4-3, top graph), while only small portion of cells

(20 and 8%) remains blocked in mitosis (Figure 4-3, middle graph). An insignificant number of

T47D cells are micronucleated at 12h and 24h, reaching only 22% by 36h of treatment; most

cells remain blocked in pro-metaphase during the course of treatment. The level of apoptosis in

both cell lines was negligible, reaching a maximum of 2% and 7% correspondingly in T47D and









MDA MB 468 after 36h of treatment (Figure 4-3, bottom graph); thus, apoptosis is not the main

mechanism of cell death for these cell lines at this drug concentration. Indeed, the process of

apoptosis may occur as a secondary event or be more prominent (and is sometimes observed) in

larger paclitaxel concentrations-but this may be outside of any clinical relevance (Hernandez-

Vargas et al., 2006; Wang et al., 1999). Furthermore, upon exposure of MDA MB 468 and

T47D cells to increased paclitaxel concentrations (100 nM and greater) sizeable increase in

apoptotic levels or change in mitotic index/micronucleation could not be detected (Figure 4-4).

This is in contrast to some reports showing that larger paclitaxel concentrations induce a more

prominent mitotic checkpoint arrest and hence a stronger mitotic block in other cell lines

(Giannakakou et al., 2001; Ikui et al., 2005). Similar results were observed by FACS analysis

(Figure 4-5): the majority of T47D cells accumulate in G2/M at 24h and 36h of treatment, while

MDA MB 468 produce an extensive sub-G1 population. Unfortunately, FACS does not allow

discrimination between apoptotic and micronucleated cells as clearly as microscopic analysis

because both types of cell death result in fragmentation of the nucleus (recognized as a sub-G1

population by FACS and thus counted together). Therefore, microscopy was the most useful

approach to determine type of cell death after paclitaxel treatment. Thus, a major difference in

paclitaxel response between these cell lines is the ability to maintain prometaphase block-

which is extended in T47D, but is brief in MDA MB 468 and is followed by micronucleation.

Daxx was recently shown to interact with and regulate stability of p53, one of the key players

in cell growth arrest and apoptosis (Tang et al., 2006; Zhao et al., 2004). Moreover, Daxx seems

to differentially regulate p53 dependent transcription under DNA damage conditions in transient

transfection assay, thus affecting the balance between cell cycle arrest and apoptosis (Gostissa et

al., 2004). Stability of p53 and p53-dependent transcription regulation, however, were unaffected









in primary human fibroblasts depleted of Daxx and seems to be influenced instead by the JNK

pathway during UV and H202 treatment (Khelifi et al., 2005). Both T47D and MDA-MB 468

express mutant, transcriptionally inactive p53 (Concin et al., 2003); thus, differences in

paclitaxel response between these cell lines are most likely p53-independent.

To further confirm Daxx dependent cell survival upon paclitaxel treatment, Daxx protein

levels were depleted in MDA MB 468 breast cancer cells, in HEp2 human epithelial carcinoma

cells (Figure 4-6) and in human fibroblast cell line WI38 by stable expression of anti-Daxx

siRNA (data not shown). In the case of both anti-Daxx siRNA, we observed a marked decrease

and slower rate of micronucleation and an increase in mitotic index (Figure 4-6). In all cases, the

levels of apoptosis throughout this ongoing process were negligible (data not shown).

Importantly, the decline in micronucleation and increase of mitotic index observed in anti-Daxx

siRNA cell lines correlated with an increased survival of cells under colony formation conditions

(Figure 4-6). Thus, depletion of Daxx by siRNAs targeted against Daxx message in a variety of

human cell lines reproduces the original finding that level of Daxx is critical for paclitaxel

response.

The combination of these data allows the proposition of a model in which cells follow one

of two paths in response to taxol and which is dependent on Daxx protein level: Daxx positive

and taxol-sensitive cells will block in mitosis only transiently, followed by micronucleation,

while Daxx deficient and taxol-resistant cells have prolonged mitotic block and continue

proliferation after drug decay and microtubule dynamics restoration, thus surviving

chemotherapy. This model emphasizes Daxx as a trigger for cellular taxol response-particularly

in apoptosis-reluctant cells; cells lacking a functional Daxx protein display an increased

resistance to taxane exposure.

















]A-

No Treatment 10 uM Noc 10 nM Pac
O Daxx +/+ 0 Daxx -/-


100%
80%
60%
40%
20%
0%
No Treatment 10uMNoc 10 nM Pac
O Daxx +/+ 0 Daxx -/-


U.sh-H N


Phnsphn-H3 ONA
0



Da)cx+/+ control





Daxx+/+ paditaxel





Daxx-/- control


Figure 4-1. Differential Response of Daxx+ and Daxx-- MEFs to Microtubule Inhibitors
Nocodazole and Paclitaxel. A) Mitotic index of MEFs treated with 10 M nocodazole
or 10 nM paclitaxel for 24 hrs. Cells were fixed and stained with phospho-H3
antibody to characterize mitosis. B) Corresponding percentage of micronuclei
formation in cells treated with nocodazole or paclitaxel for 24 hrs. C)
Immunostaining of Daxx+/+ and Daxx-- MEFs treated with paclitaxel using mitotic
markers phospho-H3 and lamin. Note occurrence of mitotic cells (big arrowheads) in
Daxx- cells and micronuclei (small arrows) in Daxx++ cells.


60%
50%
40%
30%
20%
10%
0%



C








MDA MDA
T47D SKBR3 BT-20 MB 231 MB468 MCF7





actin .
Daxx/actin 1.0 1.6
B control 2,


0Il


5.4 1.1 14.0 5.1


cel 48h of oa


mmm
C
120%
on 100% 100%,-


t 40%3
1.5%
MDA MB-468 T47D
Control M 24h pachtaxel d48h paclitaxel
Figure 4-2. Colony Formation of Breast Cancer Cells After Paclitaxel Treatment is Daxx-
Dependent. A) differential Daxx expression among breast cancer cell lines. Daxx
accumulation normalized by actin (bottom). B) & C): MDA MB 468 (high Daxx) and
T47D (low Daxx) were treated with 10 nM paclitaxel for 24h or 48h. Colonies were
fixed and stained with crystal violet and calculated 5 days after drug withdrawal.
Note differential taxol response (% of survival) between MDA MB 468 and T47D.


Daxx


-- 0













A B


% of Micronuclei
90% Q Q-----------L0!.
80% 7 *
90%
70%0 60"00 .-
60%
50%
40% *
30% -
20% 0' "I
0%



-- T47D- MDA-MB 468

% of Mitotic Cells
70% 62%5
60%
50% 3
40%
30% .
20% -''
100 i3 .20".- '*4-
0%



-- T47D MDA-MB 468

% of Apoptotic Cells


0 -ouce


10
7% -


2%
1% 0




-*T47D -MDA-MB 468

Figure 4-3. Response to Paclitaxel Treatment in Breast Cancer Cell Lines with Different Daxx
Level. MDA MB 468 (high Daxx) and T47D (low Daxx) were treated with 10 nM
paclitaxel for 12h, 24h or 36h or mock-treated (control). DNA was stained with
HOECHST 33342. A) Cells were categorized as interphase, mitotic, micronucleated,
and apoptotic based on the nuclear morphology. B) Mitotic cells in control: asterisks;
micronucleated cells: big arrowheads; pro-metaphase cells: arrows; apoptotic cells:
small arrowheads. While micronuclei appear in MDA MB 468 already after 12h of
treatment, majority of T47D cells remain in pro-metaphase after 36h of treatment. C)
Relative accumulation of mitotic cells, micronucleated and apoptotic cells in MDA
MB 468 and T47D cells. The majority of MDA MB 468 cells execute
micronucleation, while T47D are accumulated in pro-metaphase. For each time point
one thousand cells were counted.




































Apoptosis

25%

20%

15%
10%

5%
0%

Oh 12h 24h 36h

--MDAMB468 0 T47D

Figure 4-4. Response of MDA MB 468 and T47D Breast Cancer Cell Lines to Increased
Concentration ofPaclitaxel. MDA MB 468 and T47D cell lines were treated with
100 nM paclitaxel for 12h, 24h and 36h or mock treated (control). A) DNA was
stained with HOECHST 33342 and cells were characterized as being mitotic, B)
micronuclei or C) apoptotic, based on nuclear morphology. Cellular response to
paclitaxel between these two cell lines remained relatively unchanged despite
increased paclitaxel concentrations. Note: apoptosis does not significantly increase
with elevated concentrations of paclitaxel.


Mitotic Cells

70%
60% -
50%
40%
30%
20% -
10%
0%
Oh 12h 24h 36h

-*-MDAMB468 I T47D


Micronuclei

70%
60% -
50% -
40%
30%
20%
10% -
0% --
Oh 12h 24h 36h

-*-MDAMB468 I T47D













MDA-MB 468


100%


80%


60%


40%


20%


I I I


o 0 "
(P-


OG1
OS
*l G2/M
OAp/Mic


100%


80%


60%


40%


20%


, In I- I I- -


OG1
OS
* G2/M
SAp/Mic


Figure 4-5. FACS Analysis of Cell Cycle Distribution after Paclitaxel Treatment. A) T47D and
B) MDA MB 468 cells were treated with 10nM paclitaxel for the indicated time and
sorted as G1 phase, S phase, G2/M phase, and apoptotic + micronucleated (Ap/Mic).
While the majority of T47D cells accumulate in G2/M after 36h of treatment, MDA-
MB 468 cells are mostly apoptotic + micronucleated at this time point. Unfortunately,
FACS does not allow discrimination between apoptotic and micronucleated cells.


T47D













MDA MB 468









% of Daxx 100% 3% 4% 112%
onrmalized
on acin


Microulel MDA MB 468


untlad 12itM 15B 244h
-*-MDA MB 46 -U-Convh imNRA ziRNA 1 sRnA 2


HEp3

"- *






lc n I f sI i 7I- I
100% S% 5% 1297%'


Mitotic C4bll HEp2



0% O -----C=-- J --



Lnlread'd 1"n IIll "*h
-- HEp2 --ConMral siLA siNAh1 iNA2


Mironuclei HEp2


4D%



LWSPWA i 2h 18h 241


-HW-Ep2 --Co ntrld sRMA


untreated 12h 18h 24h umnreared 12h ISh 24h
--Mn Us4Ea --CaWMri iRNA sJrWA I sRNA2 [-4-Epa-Contsd iRMA iRNA 1 sIMA 2
Figure 4-6. Paclitaxel Response is Daxx-Dependent. A) Western blot analysis of Daxx depletion
in MDA MB 468 and HEp2 cells. B) Mitotic index of parental MDA MB 468 (left)
and HEp2 cells (right) expressing two independent anti-Daxx siRNAs or control
siRNA which were synchronized via double thymidine block and then released and
treated with 10 nM paclitaxel for 12, 18 and 24 hrs. C) Same as (B) except
micronucleated cells are shown. D) Reduction of Daxx increases cell survival during
paclitaxel treatment. Cells treated in (B) and (C) were set up for colony formation
assay and allowed to grow for 5 days. Colonies were then counted after fixation and
staining with crystal violet. Apoptosis, as a result of paclitaxel exposure, was
negligible across all of these different cell lines (data not shown).


Mitotic Cells MDA MB 468







nrftell 12h 14h 24h
6,-MDA MB 48 -a- Co-IMo ainA siRNA 1 a*RNA 2


siRNAI sIRNA2










CHAPTER 5
DAXX INTERACTS WITH RAS-ASSOCIATION DOMAIN FAMILY 1 (RASSF1) WHICH
COOPERATE IN CELLULAR TAXOL RESPONSE



Introduction

Several lines of evidence suggest Daxx is important for proper timing of mitotic

progression and that paclitaxel (taxol) resistance can be dependent on the level of Daxx protein

in cells. Firstly, cells generated from Daxx-deficient embryos exhibit genomic instability while

tissue sectioning of E9.5 Daxx-deficient mouse embryos shows an accumulation of cells in early

mitosis (specifically pro-metaphase). Targeted depletion of Daxx also results in alteration of

mitotic progression during prophase and the pro-metaphase to anaphase transitions.

Additionally, proper degradation of Cyclin B in synchronized Daxx-depleted cells is altered.

Importantly, cells that are deficient or depleted of Daxx was proven to provide resistance to the

microtubule inhibiting drug taxol by arresting cells in mitosis; cells with a functional Daxx

protein have a shortened mitotic arrest resulting in micronucleation and cell death (Lindsay et al.,

2007).



Discussion and Results

To further investigate Daxx mitotic function and to study the potential mechanism by which

Daxx regulates taxol response during mitosis a search for Daxx-interacting proteins using Daxx

as "bait" in a yeast two-hybrid screen was performed. Several yeast two-hybrid screens have

been used in the past using Daxx as both "bait" and "prey." The majority of these screens have

used, or have identified through their screens, the carboxyl-terminal region of Daxx

(corresponding with PML- and Fas-interacting domains) which also contains a region of Daxx









known to interact with sumoylated proteins (Pluta et al., 1998; Yang et al., 1997). Since yeast

themselves frequently use sumoylation for protein-protein interactions, this can potentially

explain the frequent occurrence of Daxx-false positives from yeast two hybrid screens

(Michaelson, 2000). For this analysis, the amino-terminal region of Daxx was used which has

previously not been adapted for yeast two-hybrid screens. This novel approach identified several

proteins with functional implications in the regulation of cell division and mitosis. Sequence

analysis of two particularly strong interaction clones revealed homology with amino acids 5-270

and 30-270 of mouse RAS associated domain family 1 splice form C (RassflC) (Figure 5-1).

Retransformation and P-gal reporter assay confirmed the specificity of this interaction in yeast,

pointing at the amino -terminus of Daxx as a potential region of Rassfl interaction (Figure 5-1).

DMAP1 (DNA methyltransferase associated protein 1) that was recently shown to interact with

Daxx (Muromoto et al., 2004) was used as positive control in these experiments. Rassfl is a

highly conserved throughout species and its locus is frequently altered in human cancer. Among

several alternative splice forms, RassflA and RassflC are the most abundantly expressed. Both

RassflA and RassflC are tubulin-associated proteins which influence the overall stability and

dynamics of microtubules (Liu et al., 2003). While RassflC function is relatively unknown,

RassflA has recently been shown to regulate early mitosis progression, particularly during

prometaphase (Song et al., 2004). In addition, RassflA over-expression leads to mitotic arrest

and inhibition of colony growth (Liu et al., 2003).

Daxx-'/ embryos showed an increased accumulation of cells in pro-metaphase, suggesting

that Daxx could cooperate with RassflA function during pro-metaphase. In light of the known

properties of both RassflA and RassflC on the influence of microtubules, the potential interplay

of Daxx and Rassfl binding could also partially explain alterations in sensitivity of Daxx-









depleted cells to taxol, a known microtubule-interfering compound. Interaction mapping

between Daxx, RassflC and RassflA and deletion mutants was analyzed with proteins in vitro

using a pull-down assay and by co-localization of GFP and RFP fusion proteins in cells (Figure

5-2). Interaction between Daxx and Rassfl was tested by incubation of immobilized 6His-fusion

RassflC with GST-Daxx and GST alone (Figure 5-2). RassflC associates only with GST-Daxx

and does not associate with GST control that indicates specificity of RassflC-Daxx interaction.

All truncation mutants of Daxx, including first 142 amino acids of protein, were co-purified with

RassflC wt suggesting that region of Rassfl interaction is located at the amino terminus of the

Daxx protein, thus confirming yeast two-hybrid data (Figure 5-2). Co-localization was observed

between RassflC-RFP and GFP-fused Daxx wt and Daxx amino terminal deletion mutants but

not with a carboxyl terminus mutant of Daxx (amino acids 625-740), further pointing at the

amino terminus of Daxx as the minimal Rassfl interacting domain.

GFP-Daxx does not co-localize with RFP-RassflA wt or with a RassflA mutant that covers

aa 120-340 which is homologous between RassflA and RassflC, but GFP-Daxx co-localizes

with the first 50 amino acids of RFP-RassflC that are unique for this splice variant. Moreover,

the first 142 amino acids of Daxx can also co-localize with this domain of RassflC. In

conclusion, the interaction between Rassfl and Daxx is facilitated by the first 50 unique amino

acids of RassflC; in combination with a minimal clone purified in a yeast two-hybrid analysis

(which encodes amino acids 30 to 270 of RassflC) the potential minimal region of interaction

can likely be narrowed down to amino acids 30-50 of RassflC. Therefore, Daxx interacts with

RassflC, but not RassflA.

Considering these data, it was hypothesized that Daxx may cooperate with RassflA

functioning in mitosis via an interaction with RassflC. This model assumes that two alternative









spliced proteins, RassflA and RassflC, can interact with each other and have similar localization

during mitosis or throughout the cell cycle. It was found that GST-RassflA could bind 6His-

RassflC in a pull-down assay (Figure 5-2B). Furthermore, a RassflA mutant (aa 194-340) could

still efficiently bind RassflC (Figure 5-2B). Additional evidence of interaction was obtained by

co-localization of GFP- and RFP-fused RassflA/RassflC. Co-localization between RassflC and

amino acids 194-258 of RassflA indicates smallest region of interaction. Fluorescence time-

lapse microscopy of HEp2 cells expressing GFP-RassflA wt or GFP-RassflC wt also revealed

similar localization throughout the cell cycle implying a potentially constant association of

RassflA-RassflC proteins (data not shown). Thus, the minimal amino acids necessary for

RassflA-RassflC interaction likely resides within the common Ras-Association (RA) domain

shared by both splice forms of Rassfl, which confirms hetero-dimer formation of RassflA and

RassflC and also opens the possibility of homo-dimer formation between each of these isoforms.

To confirm the endogenous interaction of Daxx and Rassfl, double immunofluorescent

staining of Daxx and RassflC was performed in HEp2 cells where these two proteins were found

to be distinctly separated during interphase (Figure 5-3) with Daxx staining relegated strictly to

the nucleus (at PML bodies) and RassflC staining localized strictly to a microtubule-network

pattern. This is in contrast to some reports suggesting RassflC is a nuclear protein that may

interact with Daxx at PML (Kitagawa et al., 2006). To confirm the differential localization of

Daxx and Rassfl in cells, biochemical separation of HEp2 cells into nuclear and cytosolic

fractions was performed as well as 3D-confocal imaging of transiently over-expressed GFP-

RassflA, GFP-RassflC and GFP-Daxx (Figure 5-3 B & C). Daxx was found to be largely a

nuclear associated protein while RassflA appeared strictly in the cytosolic fraction by

biochemical separation. Three-dimensional confocal analysis ofDaxx and Rassfl cellular









localization showed Daxx to be a strictly nuclear associated protein, as expected. In stark

contrast, both GFP-RassflA and GFP-RassflC displayed cytoplasmic distribution in a

microtubule-like network with no GFP-fluorescence emanating from the nucleus. Thus, Daxx

and Rassfl are compartmentally separated proteins during interphase. Co-localization of

endogenous Daxx and Rassfl, however, was observed in HEp2 cells progressing through

mitosis-demonstrating the cell cycle regulated interaction between these proteins (Figure 5-4).

Co-localization of Daxx and Rassfl was observed beginning in pro-metaphase and metaphase,

but by later stages of mitosis this association could not be detected.

To understand the cell cycle regulated interaction of Daxx and Rassfl during mitosis and

cellular paclitaxel response, stable expressing RassflA-siRNA was introduced into HEp2 cells

which efficiently deplete RassflA protein level (Figure 5-5). While RassflA-depleted cells

could be easily generated, over-expression of RassflA leads to cell toxicity and inhibition of cell

proliferation independent of RassflA-functioning in cells. Therefore these studies focused

primarily on protein-depleted cell lines. In combination with control and anti-Daxx siRNA HEp2

lines, anti-RassflA siRNA HEp2 cells were exposed to 10 nM paclitaxel for 6-18 hrs and then

related for colony formation assay (Figure 5-5). Strikingly, in the case of both Daxx- and

RassflA-depleted cells, paclitaxel resistance was similar. Both cell lines exhibited a strong

paclitaxel resistant phenotype with the majority of treated cells (75-80%) capable of dividing and

forming colonies after removal of taxol. To gain a biochemical understanding of how mitotic

cells respond to paclitaxel in the absence of Daxx or RassflA, control-, Daxx- and RassflA-

depleted cells were synchronized using a double thymidine block and then released and exposed

to taxol for 6-18 hrs and collected for Western-blot evaluation of Cyclin B protein levels (Figure

5-6). Wild type (parental) and control-siRNA cells revealed an accumulation of Cyclin B as









cells entered mitosis, but a marked drop-off in Cyclin B protein level ensued indicating cell exit

from mitosis in the later stages of paclitaxel treatment. In contrast, Daxx- and RassflA-siRNA

cells showed a similar accumulation of Cyclin B but these levels were maintained throughout the

course of the experiment, indicating cells were still arrested in mitosis. Thus, Daxx and RassflA

are necessary for efficient cellular response to paclitaxel which includes entry into and exit from

mitosis during treatment.

Sustained Cyclin B protein levels in response to mitotic stresses like paclitaxel is an

indication of prolonged spindle checkpoint activation (Musacchio and Salmon, 2007). During

normal cellular response to paclitaxel, cells will transiently arrest in mitosis due to an activated

spindle checkpoint but will exit mitosis by degrading mitotic substrates (i.e. Cyclin B) because

taxol-generated errors (i.e. microtubular tension, unattached kinetechores) cannot be corrected.

In the absence of Daxx or RassflA, cells remain in a prolonged mitotic block as evidenced by

sustained Cyclin B protein levels. Many different regulatory proteins are involved in proper

spindle checkpoint operation, including the Aurora kinases, a family of serine/threonine kinases

that are highly conserved phylogenetically. Specifically, Aurora A and Aurora B are involved in

the proper placement and localization of key mitotic checkpoint proteins (Ditchfield et al., 2003)

and absence or depletion of Aurora kinases causes spindle checkpoint-override (Fu et al., 2007).

Therapeutically, it would be advantageous to target Aurora kinases in tumors because Aurora A

and Aurora B are frequently up-regulated in cancers (Keen and Taylor, 2004). As a result,

several Aurora kinase inhibitors are in phase I & II clinical trials to evaluate their efficacy as

chemotherapeutic agents (Agnese et al., 2007; Keen and Taylor, 2004). Clinical strategies for

enhancing paclitaxel response are continuously being studied and developed and one potential

method involves the use of taxol in combination with Aurora kinase inhibitors (Malumbres,









2006). Current compounds, including ZM447439, hesperadin and VX680, have been engineered

to target the ATP binding site of Aurora kinases which abolishes their kinase activity. In

addition to paclitaxel, using these compounds has been shown in cell-based assays to alter taxol

response, even when spindle checkpoint proteins were absent (Morrow et al., 2005). Thus, the

potentials of abrogating taxol resistance in combination with other compounds which target the

mitotic spindle checkpoint are promising.

In order to determine if Daxx- and RassflA-mediated taxol response can be altered by

inhibition of Aurora kinase activity, control-, Daxx- and RassflA-depleted HEp2 cells were

treated with taxol in combination with two independent Aurora kinase inhibitors (Figure 5-7).

Compounds used in this study were ZM447439, which targets Aurora A and Aurora B kinase

activity and Aurora kinase inhibitor III, which targets Aurora A kinase activity. After

synchronization with a double thymidine block and a six hour release, control and experimental

cell lines were exposed to paclitaxel alone or paclitaxel in combination with ZM447439 or

Aurora kinase inhibitor III for a period of six hours. After completion of drug exposure, cells

were then related for colony formation assay. Treatment of Daxx- or RassflA-depleted HEp2

cells with paclitaxel alone typically resulted in a very robust taxol resistance, as evidenced by the

75-80% survival rate of these cell lines compared to only 46% of control cells (Figure 5-7).

Strikingly, however, taxol resistance was abolished in Daxx- or RassflA-depleted HEp2 cells

when treated in combination with ZM447439 or Aurora kinase inhibitor III, resulting in

comparable cell survival with control cells (Daxx-siRNA 31%-42%, RassflA siRNA 38%-40%

and control siRNA 29%-37%). Thus, in the absence of Daxx or RassflA, functional inactivation

of the mitotic spindle checkpoint using Aurora kinase inhibitors can change cellular taxol

response and abolish resistance.









A Transcriptlron factors bindlng
Fas. PML (ND10) binding
Daxx
aal 177 91 625 7/40 (74
ATRX MtlerolcTiro rnan asoiabon
SRA domain SA RAH domain

S00 94-. R assflA
C,20 DAG M I (rowih uleFas5o.o ati on
1 7
R assf lC
aal 0 124 21B 240R,7tA
I I
S lhred inndl ogy

Yeast Two-Hybr id CI ons
RassfIC Clow I
Rassf10 CCon2 aa30 270
aa30 270
Figure 5-1. Daxx Interacts with Tumor Suppressor Rassfl in Yeast. A) Schematics ofDaxx and
Rassfl isoforms RassflA and RassflC along with mapping of clones identified
through yeast two hybrid screening (RassflC clone 1 corresponding to amino acids
(aa) 5-270 of mouse RassflC, RassflC clone 2 corresponding to aa 30-270).
Homology between RassflA and RassflC is also shown. B) Retransformation assay
of Daxx and RassflC constructs. 1 = RassflC + pGBDC1 (empty vector), 2 =
RassflC + Daxx wt, 3 = RassflC + Daxx C term, 4 = RassflC + Daxx AC. C) P-Gal
reporter assay measuring strength of interaction between individual Rassfl clones and
Daxx wt and deletion mutants. Strong interaction between Rassfl clone 2 is
observed. DMAP (positive control for Daxx interaction) was used as an evaluation
for strength of interaction in this system.












clone 1 clone 2 C
C
0

I



t
0







Figure 5-1. Continued.


jlo


RAsUNfCkne I Rms CIrne 2 DIAPi:marn.i
*lecor II2axx WT Man G C130ax c














Daxx Truncation Mutant



41R !
p.....


s Rassil Tnmcation Mutauts
DwK WT (1-740B
Dwu 1-142
Dan 1-2-900
D1K 1-407 -
Dax 1-625
Dax t625-740


RassflA 22O34M
RtMlA 194-3411
RNtiC WFT (I-27O)
LrnC 5-50


(i)
iapuls. 10'i
oiMr GOSTC 2S
RasdlCDau


6XMis Puldown
fo Rassfl C
GST- GST 65hk
Danx RaadIC
I----I IalI


Inputs. 2%
SHin- GST- OST- 0W1-
Ra*iC -a.x DOa= Da= OST
1-142 1-290 1-407


6X-His Pulldown for RafiC
S!T GST OST F 6 -r
Doan DOa Da GST RasfiC
1-142 1-20 1407


(iii)

U OS1- WST- OST- GST-
ns- RaSntARsiA Raln A DMco GST
RaniC if-3M IN-3 1-i14


SX-FIn Pulidown foE Ra rIC
GST- GiT- 6ST- Q$T- C,,p
RWalA RMaUA RaelA Da ST 0 R BlI
12H-340 lu3a 1-14W


Rlfl Dx DID Dn DR= DLa Dun
F!.':Pdhlmi 1-40 1-142 1-290 -40-n 1425 62 -740




RuaflA
120-340 -1ND -dND -ND -dND -ND JND
RamIC
1-270 *i.'* *.'t* I*/ *'. 'ND -lND

I 50 +'-* *4**. **/. *-JND .ID

Figure 5-2. Mapping of Daxx-Rassfl Interaction. A) Diagram of human Daxx, RassflA and
RassflC constructs used for mapping interaction by co-localization (GFP and RFP)
and in vitro pull down assay (GST and 6His). B) (i) 6xHis pull down assay of GST-
Daxx wt and 6xHis-RassflC wt. Immobilized 6xHis-RassflC wt was incubated with
either GST or GST-Daxx wt. GST-Daxx wt but not GST alone binds 6xHis-RassflC
wt. (ii) In similar experimental settings, all Daxx amino terminal constructs including
aa 1-142 retain capacity to bind 6His-RassflC wt. (iii) 6His pull down assay of GST-
RassflA wt and mutants using immobilized 6His-RassflC wt. GST-RassflA wt/
mutants, GST-Daxx 1-142 and GST alone were incubated with 6His-RassflC wt.
GST-Daxx 1-142, GST-RassflA wt and mutants 120-340 and 194-340 bind to
RassflC, while GST does not. C) Table summarizing interaction (+, -, or ND for not
determined) tested by co-localization of GFP and RFP fusions or in vitro pull down
assay (right in cell).




















B













Y XZ Y XZ Y XZ




X





YZ YZ YZ
GFP-RasfD A GFP-Ras sC GFP-Da
Tub uIhi| Tub ui~in














GFP-RasEsfA GFP-R3af1C GFP-Daxx
Figure 5-3. Cellular Distribution ofDaxx and Rassfl During Interphase. A) Immunostaining of
endogenous RassflC and Daxx in interphase HEp2 cells. B) Biochemical separation
of nuclear and cytosolic fractions from HEp2 cells. Note nuclear association of Daxx
and cytosolic association of RassflA. C) 3D confocal imaging of transiently over-
expressed GFP-RassflA (far left), GFP-RassflC (middle) and GFP-Daxx (far right).
Note the compartmentally separated expression of Daxx and Rassfl.

















B







C







Figure 5-4. Co-localization of Endogenous Daxx and Rassfl During Mitosis in HEp2 Cells.
HEp2 cells were immunostained with monoclonal Daxx 514 antibody and polyclonal
Rassfl antibody which detects both endogenous RassflA and RassflC. Rassfl and
Daxx co-localized during pro-metaphase and metaphase A) & B). C) By anaphase
and later stages of mitosis, this association is absent.




















RassfA -
Actin~


100%


75%


50%


25%


0%


HEp2
(parental)


Control Daxx siRNA RassflA
siRNA siRNA


m No Treatment i 6 hr Taxol m 12 hr Taxol Ei 18 hr Taxol

Figure 5-5. Depletion ofDaxx or RassflA Desensitizes Cells to Paclitaxel. A) Stable expression
of anti-RassflA siRNA in HEp2 cells. Note depletion of RassflA protein compared
to parental cell lines. B) Percentage of colonies formed from parental, control, Daxx-
and RassflA-depleted HEp2 cells which were synchronized using a double thymidine
block and then released and exposed to paclitaxel for the indicated time periods (6,
12, 18hrs). After treatment, cells were related for colony formation assay. Note
increased survival (paclitaxel resistance) ofDaxx- and RassflA-depleted cells
compared to control and parental cell lines.


r
r
















Cyclr B-


HEp2 parentala) Control siRNA

Release into Taxol Release into Taxol




Cydr B ---- 81 s-t % ry -aft,


anti-Daxx siRNA ant-RassflA siRNA
Figure 5-6.Cyclin B Levels are Stabilized in Daxx- and RassflA-Depleted Cells Treated with
Taxol. Wild type (parental) HEp2, control and Daxx- and RassflA-depleted cell lines
were synchronized with a double thymidine block, released and then exposed to taxol
for 6-18hrs. Cells were harvested at the indicated time points and probed for Cyclin
Bl levels using anti-Cyclin B antibody (Santa Cruz). Protein levels were
normalized within each siRNA cell line. Note increased relative stability of cyclin B
(normalized to actin) in both Daxx and RassflA-depleted cell lines.


Release into Taxol


Release into Taxol













100%


80%

60% -

40%1

20%

0%
Daxx siRNA RassflA siRNA Control siRNA

Taxol D Taxol + ZM i Taxol + AKIII

Figure 5-7. Inactivation of the Mitotic Spindle Checkpoint Using Aurora Kinase Inhibitors
Abolishes Taxol Resistance in Daxx-and RassflA-Depleted Cells. Percentage of
colonies that were formed from control, Daxx- and RassflA-depleted HEp2 cells
which were synchronized using a double thymidine block, released and exposed to
taxol alone, or taxol in combination with ZM447439 (ZM) or Aurora kinase inhibitor
III (AKIII) for six hours is shown. Note taxol resistance is abolished in Daxx- and
RassflA-depleted cells treated in combination with taxol and Aurora kinase
inhibitors.









CHAPTER 6
SUMMARY AND CONCLUSIONS

Taxane chemotherapy is considered among the most active treatment options for many breast

cancer patients, either alone or as adjuvant in combination with anthracyclins (O'Shaughnessy,

2005). Nevertheless, a large number of patients are resistant to taxanes or become resistant to

this therapy during treatment. The response rate of docetaxel is -50% even after the first-line

chemotherapy administration and it decreases to 20-30% in the second- or third-line

administration (Bonneterre et al., 1999; Crown et al., 2004). A number of studies have been

carried out to determine a genomic profile that could be predictive to taxane treatment (Chang et

al., 2003; Chang et al., 2005b; Iwao-Koizumi et al., 2005; Mauriac et al., 2005; Miyoshi et al.,

2004). However, an alternative approach to understand selective resistance to taxane treatment

is to study mechanisms by which cells can respond to these drugs. Several molecular targets

were reported, starting with mutations in a- and P-tubulin that affect drug binding, increased

expression of tubulin genes, and changes in the synthesis or activity of tubulin interacting

proteins (Hari et al., 2003a; Hari et al., 2003b; Wang and Cabral, 2005). Recently, a new class

of potential targets are being studied after it was suggested that inactivation of mitotic proteins

can contribute to the selective response of taxane treatment in vivo (Wassmann and Benezra,

2001). Thus, development of new genomic prognosis factors and in-depth understanding of drug

activity on both a cellular and organismal level are needed for optimization of adjuvant therapy

and proper patient stratification.

To this end, Daxx was identified as a novel regulator of paclitaxel response in cell culture

conditions. Primary mouse and human fibroblasts with experimentally regulated levels of Daxx

show both strong and divergent responses to taxol (Figure 4-1). In the absence of Daxx, cells

remain in a prolonged mitotic block, while wild type cells undergo a transient arrest in mitosis









that is soon followed by micronucleation and cell death. Importantly, these observations were

also recapitulated in MDA MB 468 and T47D breast cancer cell lines with contrasting levels of

Daxx expression (Figure 4-3). These divergent responses in taxol response are usually seen in

cells deficient in mitotic checkpoint proteins or other regulators of cell division and until these

current studies, Daxx has not been implicated as a regulatory protein of cell cycle progression.

Table 6-1 summarizes a growing list of mitotic proteins and the cellular response to taxol when

these proteins are absent or deregulated in cells. To date, loss of function of the majority of

mitotic proteins, including Madl, Mad2, Bub and BubR1, has shown enhanced response to

paclitaxel in cell culture conditions. Identification of factors which may increase drug resistance

are largely uncharacterized. Among the conclusions of this study is that early mitosis

progression is altered in cells lacking a functional Daxx protein. These observations came from

tissue sectioning of Daxx-/- mouse embryos showing an increased number of cells in early

mitotic stages (Figure 3-1) and were manifested from time-lapse microscopy studies analyzing

mitotic progression in Daxx-depleted cell lines (Figure 3-3, Table 3-1) and Cyclin B protein

stability studies showing an altered rate of cyclin degradation in anti-Daxx siRNA cells (Figure

3-4). Theoretically, alterations of this kind in cell cycle progression could, in part, explain the

genomic instability that is observed in Daxx-deficient mouse cells (Figure 3-1) as improper

mitosis frequently leads to unfaithful chromosome segregation (Chi and Jeang, 2007).

Daxx localization is already understood to be a very dynamic process during the cell cycle.

During G1 and G2, Daxx localizes to PML bodies, while during S phase, it relocates to

condensed heterochromatin where it interacts with ATRX, a chromatin remodeling protein. To

accompany this dynamic protein trafficking, these studies have also revealed that Daxx, a known

transcriptional regulator, can associate with the mitotic spindle apparatus during mitosis (Figure









3-7). Accruing evidence suggests that the tight orchestration of events during mitosis combines

seemingly unrelated factors at critical junctures during cellular division (Tsai et al., 2006). A

number of essential interactions occur during pro-metaphase when the nuclear envelope

disintegrates and no longer compartmentalizes the nucleus and cytoplasm. During this time,

Daxx is released from the nucleus where it is associated with ND10/PML bodies and

accumulates at the mitotic spindle apparatus. It is at this spatiotemporal point that Daxx interacts

with Rassfl (Figure 5-4, Figure 6-1 summary). Future studies will reveal whether Daxx

association with the spindle apparatus is dependent on presence of Rassfl.

To accompany observations of Daxx-dependent paclitaxel response, Rassfl was identified as

a novel Daxx-interacting protein that was also confirmed to be important for cellular taxol

response (Figure 5-5). This interaction was mapped to the C spliceform of Rassfl (RassflC) and

interaction between RassflA and RassflC by dimerization was also confirmed (Figure 5-2).

These novel interactions are thought to form a complex during mitosis and may perform critical

regulatory processes including proper cellular response to mitotic stresses such as paclitaxel,

nocodazole and other microtubule inhibiting compounds. These chemicals, moreover, can

induce mitotic stress in several ways, depending on the stage of mitosis in which the stress is

applied. Proper separation of the centrosomes during prophase, correct alignment of

chromosomes during metaphase and faithful segregation of chromosomes during anaphase are

all processes which can be altered or affected when external stress (i.e. paclitaxel) is applied.

Together, Daxx and Rassfl define a unique mitotic stress checkpoint during pro-metaphase

(Figure 6-2, summary). Cells lacking Daxx or RassflA arrest in pro-metaphase during taxol

treatment. From time-lapse studies, it is suggested that Daxx-depleted cells have chromosomes

that remain unable to properly align at the metaphase plate under treatment conditions, thus









remaining in pro-metaphase by definition. In contrast, with normal primary cells and some

tumor cell lines, Daxx and RassflA may be essential for proper mitotic exit in response to

uncorrectable errors during pro-metaphase. This is suggested by the very robust response of

wild type cells which only transiently arrest in pro-metaphase and then undergo micronucleation

leading to cell death (Figure 4-3, Figure 4-6). One example of a mitotic stress checkpoint is

already known with a protein named checkpoint with FHA and ring finger (CHFR). In the

presence of CHFR, wild type cells exhibit a transient prophase arrest which temporarily prevents

cells from entering metaphase under mitotic stress (Scolnick and Halazonetis, 2000). Cells that

do not have a functional CHFR protein were shown to enter metaphase without delay and

exhibited problems in proper centrosome separation. Thus, CHFR defines a prophase-specific

mitotic stress checkpoint at a stage in mitosis earlier than Daxx and Rassfl.

Evidence accumulated in these studies suggests Daxx and Rassfl are triggers for cellular

taxol response. In the future, Daxx and Rassfl may serve as ideal molecular markers for the

proper selection of breast cancer patients (and other malignancies) for taxane chemotherapy. In

order to achieve this goal, clinical studies will be required examining the status of Daxx and

Rassfl expression in tumors before and after taxane chemotherapy as well as in patients with an

established history of taxane resistance. Altered Daxx or Rassfl expression may be reminiscent

of the differential protein expression that may exist in the original tumor cells from which each

cell line was derived. It is already known that Daxx expression in some breast cancer cell lines

is quite variable (Figure 4-1), but the extent of Daxx down-regulation or mutation in tumor cell

lines has not been addressed. RassflA expression in tumor cell lines, conversely, has been

extensively studied and shown to be altered in a majority of cases (Agathanggelou et al., 2005).

Ultimately, these studies have established new roles for Daxx as a mitotic regulator that also









serves as a trigger for cellular taxol response in combination with Rassfl which adds to our

understanding of mechanisms linking cell division, genome instability and breast cancer

progression.



Table 6-1. Alteration of Several Known Mitotic Proteins and Resultant Cellular Paclitaxel
Response. Most mitotic proteins, when mutated or down-regulated in cells, display
increased sensitivity to paclitaxel. In the absence ofDaxx or Rassfl, cells display
increased drug resistance.
Protein Paclitaxel Response
Bub 1 Increased Sensitivity
(Lee et al., 2004; Sudo et al., 2004)
BubR1 Increased Sensitivity
(Lee et al., 2004; Sudo et al., 2004)
CHFR Increased Sensitivity
(Satoh et al., 2003)
Madl Increased Sensitivity
(Kienitz et al., 2005)
Mad2 Increased Sensitivity
(Niikura et al., 2007)
Survivin Increased Sensitivity
(Carvalho et al., 2003)
Daxx Increased Resistance
(Lindsay et al., 2007)
Rassfl Increased Resistance








Inberphase & Pro ph ie Prretaphase
Cytoplasm



*t--
RRaflCD3








Nucleus NE breakdown
Figure 6-1. Dynamics of Daxx-Rassfl Interaction Throughout the Cell Cycle. During interphase
and beginning of mitosis prophasee), Daxx and Rassfl are compartmentally separated
in the cytoplasm and nucleus. After nuclear envelope (NE) breakdown, Daxx and
Rassfl can interact through RassflC. This association is maintained through
metaphase, but by late stages of mitosis, is absent.










Wild type,'" Mitotic Sbrs

cells ,, (ii Taxel

Daxx E ONE 0 0 IN
Rassfl EU EK

Uncorredable errors.
Mitosis aborted, micronulede
formahon

Cancer ,.
cellsMi,osis abrtedie Sb










Figure 6-2. Model Depicting Daxx-Rassfl-Mediated Mitotic Stress Checkpoint During Pro-
metaphase. In wild type cells upon mitotic stress (i.e. taxol or nocodazole) the
spindle checkpoint will be activated. In rare cases, the cell may correct these errors,
complete mitosis and resume cell proliferation. In most cases, however, these errors
are uncorrected and the cell aborts mitosis, undergoes micronuclei formation and cell
death. In subpopulations of cancer cells which encounter mitotic stress and which do
not have a functional Daxx or Rassfl protein, these cells remain in a prolonged
mitotic block, unable to efficiently abort mitosis, and remain in pro-metaphase until
drug removal or decay. This model may partially explain inherent and acquired taxol
resistance in some breast tumors.









REFERENCES


Aapro, M.S. (2001). Neoadjuvant therapy in breast cancer: can we define its role? Oncologist 6
Suppl 3, 36-39.

Agathanggelou, A., Cooper, W.N., and Latif, F. (2005). Role of the Ras-association domain
family 1 tumor suppressor gene in human cancers. Cancer Res 65, 3497-3508.

Agnese, V., Bazan, V., Fiorentino, F.P., Fanale, D., Badalamenti, G., Colucci, G., Adamo, V.,
Santini, D., and Russo, A. (2007). The role of Aurora-A inhibitors in cancer therapy. Ann Oncol
18 Supply 6, vi47-52.

Amaar, Y.G., Minera, M.G., Hatran, L.K., Strong, D.D., Mohan, S., and Reeves, M.E. (2006).
Ras association domain family 1C protein stimulates human lung cancer cell proliferation. Am J
Physiol Lung Cell Mol Physiol 291, L1185-1190.

Bonneterre, J., Spielman, M., Guastalla, J.P., Marty, M., Viens, P., Chollet, P., Roche, H.,
Fumoleau, P., Mauriac, L., Bourgeois, H., et al. (1999). Efficacy and safety of docetaxel
(Taxotere) in heavily pretreated advanced breast cancer patients: the French compassionate use
programme experience. Eur J Cancer 35, 1431-1439.

Bothos, J., Summers, M.K., Venere, M., Scolnick, D.M., and Halazonetis, T.D. (2003). The Chfr
mitotic checkpoint protein functions with Ubcl3-Mms2 to form Lys63-linked polyubiquitin
chains. Oncogene 22, 7101-7107.

Brown, J.M., and Wouters, B.G. (1999). Apoptosis, p53, and tumor cell sensitivity to anticancer
agents. Cancer Res 59, 1391-1399.

Burbee, D.G., Forgacs, E., Zochbauer-Muller, S., Shivakumar, L., Fong, K., Gao, B., Randle, D.,
Kondo, M., Virmani, A., Bader, S., et al. (2001). Epigenetic inactivation ofRASSF1A in lung
and breast cancers and malignant phenotype suppression. J Natl Cancer Inst 93, 691-699.

Cahill, D.P., Lengauer, C., Yu, J., Riggins, G.J., Willson, J.K., Markowitz, S.D., Kinzler, K.W.,
and Vogelstein, B. (1998). Mutations of mitotic checkpoint genes in human cancers. Nature 392,
300-303.

Carvalho, A., Carmena, M., Sambade, C., Earnshaw, W.C., and Wheatley, S.P. (2003). Survivin
is required for stable checkpoint activation in taxol-treated HeLa cells. J Cell Sci 116, 2987-
2998.

Chabalier, C., Lamare, C., Racca, C., Privat, M., Valette, A., and Larminat, F. (2006). BRCA1
downregulation leads to premature inactivation of spindle checkpoint and confers paclitaxel
resistance. Cell Cycle 5, 1001-1007.

Chan, G.K., and Yen, T.J. (2003). The mitotic checkpoint: a signaling pathway that allows a
single unattached kinetochore to inhibit mitotic exit. Prog Cell Cycle Res 5, 431-439.









Chang, C.C., Lin, D.Y., Fang, H.I., Chen, R.H., and Shih, H.M. (2005a). Daxx mediates the
small ubiquitin-like modifier-dependent transcriptional repression of Smad4. J Biol Chem 280,
10164-10173.

Chang, J.C., Wooten, E.C., Tsimelzon, A., Hilsenbeck, S.G., Gutierrez, M.C., Elledge, R.,
Mohsin, S., Osborne, C.K., Chamness, G.C., Allred, D.C., and O'Connell, P. (2003). Gene
expression profiling for the prediction of therapeutic response to docetaxel in patients with breast
cancer. Lancet 362, 362-369.

Chang, J.C., Wooten, E.C., Tsimelzon, A., Hilsenbeck, S.G., Gutierrez, M.C., Tham, Y.L.,
Kalidas, M., Elledge, R., Mohsin, S., Osborne, C.K., et al. (2005b). Patterns of resistance and
incomplete response to docetaxel by gene expression profiling in breast cancer patients. J Clin
Oncol 23, 1169-1177.

Chaturvedi, P., Sudakin, V., Bobiak, M.L., Fisher, P.W., Mattern, M.R., Jablonski, S.A., Hurle,
M.R., Zhu, Y., Yen, T.J., and Zhou, B.B. (2002). Chfr regulates a mitotic stress pathway through
its RING-finger domain with ubiquitin ligase activity. Cancer Res 62, 1797-1801.

Chen, E.S., Saitoh, S., Yanagida, M., and Takahashi, K. (2003). A cell cycle-regulated GATA
factor promotes centromeric localization of CENP-A in fission yeast. Mol Cell 11, 175-187.

Chi, Y.H., and Jeang, K.T. (2007). Aneuploidy and cancer. J Cell Biochem 102, 531-538.

Cleveland, D.W., Mao, Y., and Sullivan, K.F. (2003). Centromeres and kinetochores: from
epigenetics to mitotic checkpoint signaling. Cell 112, 407-421.

Concin, N., Zeillinger, C., Tong, D., Stimpfl, M., Konig, M., Printz, D., Stonek, F.,
Schneeberger, C., Hefler, L., Kainz, C., et al. (2003). Comparison of p53 mutational status with
mRNA and protein expression in a panel of 24 human breast carcinoma cell lines. Breast Cancer
Res Treat 79, 37-46.

Crown, J., O'Leary, M., and Ooi, W.S. (2004). Docetaxel and paclitaxel in the treatment of breast
cancer: a review of clinical experience. Oncologist 9 Suppl 2, 24-32.

Croxton, R., Puto, L.A., de Belle, I., Thomas, M., Torii, S., Hanaii, F., Cuddy, M., and Reed, J.C.
(2006). Daxx represses expression of a subset of antiapoptotic genes regulated by nuclear factor-
kappaB. Cancer Res 66, 9026-9035.

Dallol, A., Agathanggelou, A., Fenton, S.L., Ahmed-Choudhury, J., Hesson, L., Vos, M.D.,
Clark, G.J., Downward, J., Maher, E.R., and Latif, F. (2004). RASSF1A interacts with
microtubule-associated proteins and modulates microtubule dynamics. Cancer Res 64, 4112-
4116.

Dammann, R., Li, C., Yoon, J.H., Chin, P.L., Bates, S., and Pfeifer, G.P. (2000). Epigenetic
inactivation of a RAS association domain family protein from the lung tumour suppressor locus
3p21.3. Nat Genet 25, 315-319.









Dammann, R., Yang, G., and Pfeifer, G.P. (2001). Hypermethylation of the cpG island of Ras
association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21.3
locus, occurs in a large percentage of human breast cancers. Cancer Res 61, 3105-3109.

Dellaire, G., Eskiw, C.H., Dehghani, H., Ching, R.W., and Bazett-Jones, D.P. (2006). Mitotic
accumulations of PML protein contribute to the re-establishment of PML nuclear bodies in G1. J
Cell Sci 119, 1034-1042.

Ditchfield, C., Johnson, V.L., Tighe, A., Ellston, R., Haworth, C., Johnson, T., Mortlock, A.,
Keen, N., and Taylor, S.S. (2003). Aurora B couples chromosome alignment with anaphase by
targeting BubR1, Mad2, and Cenp-E to kinetochores. J Cell Biol 161, 267-280.

Donninger, H., Vos, M.D., and Clark, G.J. (2007). The RASSF1A tumor suppressor. J Cell Sci
120, 3163-3172.

Ecsedy, J.A., Michaelson, J.S., and Leder, P. (2003). Homeodomain-interacting protein kinase 1
modulates Daxx localization, phosphorylation, and transcriptional activity. Mol Cell Biol 23,
950-960.

Emelyanov, A.V., Kovac, C.R., Sepulveda, M.A., and Birshtein, B.K. (2002). The interaction of
Pax5 (BSAP) with Daxx can result in transcriptional activation in B cells. J Biol Chem 277,
11156-11164.

Fenton, S.L., Dallol, A., Agathanggelou, A., Hesson, L., Ahmed-Choudhury, J., Baksh, S.,
Sardet, C., Dammann, R., Minna, J.D., Downward, J., et al. (2004). Identification of the E1A-
regulated transcription factor p120 E4F as an interacting partner of the RASSF1A candidate
tumor suppressor gene. Cancer Res 64, 102-107.

Fu, J., Bian, M., Jiang, Q., and Zhang, C. (2007). Roles of Aurora kinases in mitosis and
tumorigenesis. Mol Cancer Res 5, 1-10.

Giannakakou, P., Robey, R., Fojo, T., and Blagosklonny, M.V. (2001). Low concentrations of
paclitaxel induce cell type-dependent p53, p21 and G1/G2 arrest instead of mitotic arrest:
molecular determinants of paclitaxel-induced cytotoxicity. Oncogene 20, 3806-3813.

Gostissa, M., Morelli, M., Mantovani, F., Guida, E., Piazza, S., Collavin, L., Brancolini, C.,
Schneider, C., and Del Sal, G. (2004). The transcriptional repressor hDaxx potentiates p53-
dependent apoptosis. J Biol Chem 279, 48013-48023.

Hannemann, J., Oosterkamp, H.M., Bosch, C.A., Velds, A., Wessels, L.F., Loo, C., Rutgers, E.J.,
Rodenhuis, S., and van de Vijver, M.J. (2005). Changes in gene expression associated with
response to neoadjuvant chemotherapy in breast cancer. J Clin Oncol 23, 3331-3342.

Hari, M., Wang, Y., Veeraraghavan, S., and Cabral, F. (2003a). Mutations in alpha- and beta-
tubulin that stabilize microtubules and confer resistance to colcemid and vinblastine. Mol Cancer
Ther 2, 597-605.









Hari, M., Yang, H., Zeng, C., Canizales, M., and Cabral, F. (2003b). Expression of class III beta-
tubulin reduces microtubule assembly and confers resistance to paclitaxel. Cell Motil
Cytoskeleton 56, 45-56.

Haruki, N., Saito, H., Harano, T., Nomoto, S., Takahashi, T., Osada, H., and Fujii, Y. (2001).
Molecular analysis of the mitotic checkpoint genes BUB1, BUBR1 and BUB3 in human lung
cancers. Cancer Lett 162, 201-205.

Henderson, I.C., Berry, D.A., Demetri, G.D., Cirrincione, C.T., Goldstein, L.J., Martino, S.,
Ingle, J.N., Cooper, M.R., Hayes, D.F., Tkaczuk, K.H., et al. (2003). Improved outcomes from
adding sequential Paclitaxel but not from escalating Doxorubicin dose in an adjuvant
chemotherapy regimen for patients with node-positive primary breast cancer. J Clin Oncol 21,
976-983.

Hernandez-Vargas, H., Palacios, J., and Moreno-Bueno, G. (2006). Molecular profiling of
docetaxel cytotoxicity in breast cancer cells: uncoupling of aberrant mitosis and apoptosis.
Oncogene.

Hollenbach, A.D., McPherson, C.J., Mientjes, E.J., Iyengar, R., and Grosveld, G. (2002). Daxx
and histone deacetylase II associate with chromatin through an interaction with core histones and
the chromatin-associated protein Dek. J Cell Sci 115, 3319-3330.

Ikui, A.E., Yang, C.P., Matsumoto, T., and Horwitz, S.B. (2005). Low concentrations oftaxol
cause mitotic delay followed by premature dissociation ofp55CDC from Mad2 and BubR1 and
abrogation of the spindle checkpoint, leading to aneuploidy. Cell Cycle 4, 1385-1388.

Ishov, A.M., Sotnikov, A.G., Negorev, D., Vladimirova, O.V., Neff, N., Kamitani, T., Yeh, E.T.,
Strauss, J.F., 3rd, and Maul, G.G. (1999). PML is critical for ND10 formation and recruits the
PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J Cell Biol
147, 221-234.

Ishov, A.M., Vladimirova, O.V., and Maul, G.G. (2004). Heterochromatin and ND10 are cell-
cycle regulated and phosphorylation-dependent alternate nuclear sites of the transcription
repressor Daxx and SWI/SNF protein ATRX. J Cell Sci 117, 3807-3820.

Iwao-Koizumi, K., Matoba, R., Ueno, N., Kim, S.J., Ando, A., Miyoshi, Y., Maeda, E., Noguchi,
S., and Kato, K. (2005). Prediction of docetaxel response in human breast cancer by gene
expression profiling. J Clin Oncol 23, 422-431.

Jiang, N., Wang, X., Yang, Y., and Dai, W. (2006). Advances in mitotic inhibitors for cancer
treatment. Mini Rev Med Chem 6, 885-895.

Jung, Y.S., Kim, H.Y., Kim, J., Lee, M.G., Pouyssegur, J., and Kim, E. (2008). Physical
interactions and functional coupling between Daxx and sodium hydrogen exchanger 1 in
ischemic cell death. J Biol Chem 283, 1018-1025.

Jung, Y.S., Kim, H.Y., Lee, Y.J., and Kim, E. (2007). Subcellular localization of Daxx
determines its opposing functions in ischemic cell death. FEBS Lett 581, 843-852.









Junn, E., Taniguchi, H., Jeong, B.S., Zhao, X., Ichijo, H., and Mouradian, M.M. (2005).
Interaction of DJ-1 with Daxx inhibits apoptosis signal-regulating kinase 1 activity and cell
death. Proc Natl Acad Sci U S A 102, 9691-9696.

Kang, D., Chen, J., Wong, J., and Fang, G. (2002). The checkpoint protein Chfr is a ligase that
ubiquitinates Plkl and inhibits Cdc2 at the G2 to M transition. J Cell Biol 156, 249-259.

Karunakaran, S., Diwakar, L., Saeed, U., Agarwal, V., Ramakrishnan, S., Iyengar, S., and
Ravindranath, V. (2007). Activation of apoptosis signal regulating kinase 1 (ASK1) and
translocation of death-associated protein, Daxx, in substantial nigra pars compact in a mouse
model of Parkinson's disease: protection by alpha-lipoic acid. FASEB J 21, 2226-2236.

Keen, N., and Taylor, S. (2004). Aurora-kinase inhibitors as anticancer agents. Nat Rev Cancer
4, 927-936.

Khelifi, A.F., D'Alcontres, M.S., and Salomoni, P. (2005). Daxx is required for stress-induced
cell death and JNK activation. Cell Death Differ 12, 724-733.

Kienitz, A., Vogel, C., Morales, I., Muller, R., and Bastians, H. (2005). Partial downregulation of
MAD1 causes spindle checkpoint inactivation and aneuploidy, but does not confer resistance
towards taxol. Oncogene 24, 4301-4310.

Kiriakidou, M., Driscoll, D.A., Lopez-Guisa, J.M., and Strauss, J.F., 3rd (1997). Cloning and
expression of primate Daxx cDNAs and mapping of the human gene to chromosome 6p21.3 in
the MHC region. DNA Cell Biol 16, 1289-1298.

Kitagawa, D., Kajiho, H., Negishi, T., Ura, S., Watanabe, T., Wada, T., Ichijo, H., Katada, T.,
and Nishina, H. (2006). Release of RASSFIC from the nucleus by Daxx degradation links DNA
damage and SAPK/JNK activation. EMBO J 25, 3286-3297.

Ko, Y.G., Kang, Y.S., Park, H., Seol, W., Kim, J., Kim, T., Park, H.S., Choi, E.J., and Kim, S.
(2001). Apoptosis signal-regulating kinase 1 controls the proapoptotic function of death-
associated protein (Daxx) in the cytoplasm. J Biol Chem 276, 39103-39106.

Kroemer, G., and Martin, S.J. (2005). Caspase-independent cell death. Nat Med 11, 725-730.

Lalioti, V.S., Vergarajauregui, S., Pulido, D., and Sandoval, I.V. (2002). The insulin-sensitive
glucose transporter, GLUT4, interacts physically with Daxx. Two proteins with capacity to bind
Ubc9 and conjugated to SUMO1. J Biol Chem 277, 19783-19791.

Lee, E.A., Keutmann, M.K., Dowling, M.L., Harris, E., Chan, G., and Kao, G.D. (2004).
Inactivation of the mitotic checkpoint as a determinant of the efficacy of microtubule-targeted
drugs in killing human cancer cells. Mol Cancer Ther 3, 661-669.

Lehembre, F., Muller, S., Pandolfi, P.P., and Dejean, A. (2001). Regulation ofPax3
transcriptional activity by SUMO-1-modified PML. Oncogene 20, 1-9.









Lens, S.M., Wolthuis, R.M., Klompmaker, R., Kauw, J., Agami, R., Brummelkamp, T., Kops,
G., and Medema, R.H. (2003). Survivin is required for a sustained spindle checkpoint arrest in
response to lack of tension. Embo J 22, 2934-2947.

Li, H., Leo, C., Zhu, J., Wu, X., O'Neil, J., Park, E.J., and Chen, J.D. (2000). Sequestration and
inhibition of Daxx-mediated transcriptional repression by PML. Mol Cell Biol 20, 1784-1796.

Li, W., Zhu, T., and Guan, K.L. (2004). Transformation potential ofRas isoforms correlates with
activation of phosphatidylinositol 3-kinase but not ERK. J Biol Chem 279, 37398-37406.

Lin, D.Y., Lai, M.Z., Ann, D.K., and Shih, H.M. (2003). Promyelocytic leukemia protein (PML)
functions as a glucocorticoid receptor co-activator by sequestering Daxx to the PML oncogenic
domains (PODs) to enhance its transactivation potential. J Biol Chem 278, 15958-15965.

Lindsay, C.R., Scholz, A., Morozov, V.M., and Ishov, A.M. (2007). Daxx shortens mitotic arrest
caused by paclitaxel. Cell Cycle 6, 1200-1204.

Liu, L., Amy, V., Liu, G., and McKeehan, W.L. (2002). Novel complex integrating mitochondria
and the microtubular cytoskeleton with chromosome remodeling and tumor suppressor RASSF 1
deduced by in silico homology analysis, interaction cloning in yeast, and colocalization in
cultured cells. In Vitro Cell Dev Biol Anim 38, 582-594.

Liu, L., Baier, K., Dammann, R., and Pfeifer, G.P. (2007). The tumor suppressor RASSF1A does
not interact with Cdc20, an activator of the anaphase-promoting complex. Cell Cycle 6, 1663-
1665.

Liu, L., Tommasi, S., Lee, D.H., Dammann, R., and Pfeifer, G.P. (2003). Control of microtubule
stability by the RASSF1A tumor suppressor. Oncogene 22, 8125-8136.

Malumbres, M. (2006). Therapeutic opportunities to control tumor cell cycles. Clin Transl Oncol
8, 399-408.

Mansilla, S., Bataller, M., and Portugal, J. (2006a). Mitotic catastrophe as a consequence of
chemotherapy. Anticancer Agents Med Chem 6, 589-602.

Mansilla, S., Priebe, W., and Portugal, J. (2006b). Mitotic catastrophe results in cell death by
caspase-dependent and caspase-independent mechanisms. Cell Cycle 5, 53-60.

Mauriac, L., Debled, M., and MacGrogan, G. (2005). When will more useful predictive factors
be ready for use? Breast 14, 617-623.

Meraldi, P., Draviam, V.M., and Sorger, P.K. (2004). Timing and checkpoints in the regulation
of mitotic progression. Dev Cell 7, 45-60.

Michaelson, J.S. (2000). The Daxx enigma. Apoptosis 5, 217-220.









Michaelson, J.S., Bader, D., Kuo, F., Kozak, C., and Leder, P. (1999). Loss of Daxx, a
promiscuously interacting protein, results in extensive apoptosis in early mouse development.
Genes Dev 13, 1918-1923.

Michaelson, J.S., and Leder, P. (2003). RNAi reveals anti-apoptotic and transcriptionally
repressive activities ofDAXX. J Cell Sci 116, 345-352.

Miyoshi, Y., Kim, S.J., Akazawa, K., Kamigaki, S., Ueda, S., Yanagisawa, T., Inoue, T.,
Taguchi, T., Tamaki, Y., and Noguchi, S. (2004). Down-regulation of intratumoral aromatase
messenger RNA levels by docetaxel in human breast cancers. Clin Cancer Res 10, 8163-8169.

Morrow, C.J., Tighe, A., Johnson, V.L., Scott, M.I., Ditchfield, C., and Taylor, S.S. (2005).
Bub 1 and aurora B cooperate to maintain BubRI-mediated inhibition of APC/CCdc20. J Cell Sci
118, 3639-3652.

Morse, D.L., Gray, H., Payne, C.M., and Gillies, R.J. (2005). Docetaxel induces cell death
through mitotic catastrophe in human breast cancer cells. Mol Cancer Ther 4, 1495-1504.

Muromoto, R., Sugiyama, K., Takachi, A., Imoto, S., Sato, N., Yamamoto, T., Oritani, K.,
Shimoda, K., and Matsuda, T. (2004). Physical and functional interactions between Daxx and
DNA methyltransferase 1-associated protein, DMAP1. J Immunol 172, 2985-2993.

Musacchio, A., and Salmon, E.D. (2007). The spindle-assembly checkpoint in space and time.
Nat Rev Mol Cell Biol 8, 379-393.

Nefkens, I., Negorev, D.G., Ishov, A.M., Michaelson, J.S., Yeh, E.T., Tanguay, R.M., Muller,
W.E., and Maul, G.G. (2003). Heat shock and Cd2+ exposure regulate PML and Daxx release
from ND10 by independent mechanisms that modify the induction of heat-shock proteins 70 and
25 differently. J Cell Sci 116, 513-524.

O'Shaughnessy, J. (2005). Extending survival with chemotherapy in metastatic breast cancer.
Oncologist 10 Suppl 3, 20-29.

Perlman, R., Schiemann, W.P., Brooks, M.W., Lodish, H.F., and Weinberg, R.A. (2001). TGF-
beta-induced apoptosis is mediated by the adapter protein Daxx that facilitates JNK activation.
Nat Cell Biol 3, 708-714.

Pines, J. (2006). Mitosis: a matter of getting rid of the right protein at the right time. Trends Cell
Biol 16, 55-63.

Pluta, A.F., Earnshaw, W.C., and Goldberg, I.G. (1998). Interphase-specific association of
intrinsic centromere protein CENP-C with HDaxx, a death domain-binding protein implicated in
Fas-mediated cell death. J Cell Sci 111 (Pt 14), 2029-2041.

Ravdin, P., Erban, J., and Overmoyer, B. (2003). Phase III comparison of docetaxel and
paclitaxel in patients with metastatic breast cancer. Eur J Cancer suppll:32.









Ricci, M.S., and Zong, W.X. (2006). Chemotherapeutic approaches for targeting cell death
pathways. Oncologist 11, 342-357.

Rong, R., Jin, W., Zhang, J., Sheikh, M.S., and Huang, Y. (2004). Tumor suppressor RASSF1A
is a microtubule-binding protein that stabilizes microtubules and induces G2/M arrest. Oncogene
23, 8216-8230.

Roninson, I.B., Broude, E.V., and Chang, B.D. (2001). If not apoptosis, then what? Treatment-
induced senescence and mitotic catastrophe in tumor cells. Drug Resist Updat 4, 303-313.

Rowinsky, E.K., Eisenhauer, E.A., Chaudhry, V., Arbuck, S.G., and Donehower, R.C. (1993).
Clinical toxicities encountered with paclitaxel (Taxol). Semin Oncol 20, 1-15.

Sablina, A.A., Budanov, A.V., Ilyinskaya, G.V., Agapova, L.S., Kravchenko, J.E., and
Chumakov, P.M. (2005). The antioxidant function of the p53 tumor suppressor. Nat Med 11,
1306-1313.

Schiff, P.B., Fant, J., and Horwitz, S.B. (1979). Promotion of microtubule assembly in vitro by
taxol. Nature 277, 665-667.

Scolnick, D.M., and Halazonetis, T.D. (2000). Chfr defines a mitotic stress checkpoint that
delays entry into metaphase. Nature 406, 430-435.

Shivakumar, L., Minna, J., Sakamaki, T., Pestell, R., and White, M.A. (2002). The RASSF1A
tumor suppressor blocks cell cycle progression and inhibits cyclin Dl accumulation. Mol Cell
Biol 22, 4309-4318.

Song, J.J., and Lee, Y.J. (2003). Role of the ASK1-SEK1-JNK1-HIPK1 signal in Daxx
trafficking and ASK1 oligomerization. J Biol Chem 278, 47245-47252.

Song, J.J., and Lee, Y.J. (2004). Tryptophan 621 and serine 667 residues of Daxx regulate its
nuclear export during glucose deprivation. J Biol Chem 279, 30573-30578.

Song, M.S., Song, S.J., Ayad, N.G., Chang, J.S., Lee, J.H., Hong, H.K., Lee, H., Choi, N., Kim,
J., Kim, H., et al. (2004). The tumour suppressor RASSF1A regulates mitosis by inhibiting the
APC-Cdc20 complex. Nat Cell Biol 6, 129-137.

Song, M.S., Song, S.J., Kim, S.J., Nakayama, K., Nakayama, K.I., and Lim, D.S. (2007). Skp2
regulates the antiproliferative function of the tumor suppressor RASSF1A via ubiquitin-mediated
degradation at the G(1)-S transition. Oncogene.

Sudo, T., Nitta, M., Saya, H., and Ueno, N.T. (2004). Dependence of paclitaxel sensitivity on a
functional spindle assembly checkpoint. Cancer Res 64, 2502-2508.

Tang, J., Qu, L.K., Zhang, J., Wang, W., Michaelson, J.S., Degenhardt, Y.Y., El-Deiry, W.S.,
and Yang, X. (2006). Critical role for Daxx in regulating Mdm2. Nat Cell Biol 8, 855-862.









Torii, S., Egan, D.A., Evans, R.A., and Reed, J.C. (1999). Human Daxx regulates Fas-induced
apoptosis from nuclear PML oncogenic domains (PODs). EMBO J 18, 6037-6049.

Tsai, M.Y., Wang, S., Heidinger, J.M., Shumaker, D.K., Adam, S.A., Goldman, R.D., and
Zheng, Y. (2006). A mitotic lamin B matrix induced by RanGTP required for spindle assembly.
Science 311, 1887-1893.

Vos, M.D., Martinez, A., Elam, C., Dallol, A., Taylor, B.J., Latif, F., and Clark, G.J. (2004). A
role for the RASSF1A tumor suppressor in the regulation of tubulin polymerization and genomic
stability. Cancer Res 64, 4244-4250.

Wang, L.G., Liu, X.M., Kreis, W., and Budman, D.R. (1999). The effect of antimicrotubule
agents on signal transduction pathways of apoptosis: a review. Cancer Chemother Pharmacol 44,
355-361.

Wang, Y., and Cabral, F. (2005). Paclitaxel resistance in cells with reduced beta-tubulin.
Biochim Biophys Acta 1744, 245-255.

Wassmann, K., and Benezra, R. (2001). Mitotic checkpoints: from yeast to cancer. Curr Opin
Genet Dev 11, 83-90.

Wood, K.W., Comwell, W.D., and Jackson, J.R. (2001). Past and future of the mitotic spindle as
an oncology target. Curr Opin Pharmacol 1, 370-377.

Xia, G., Luo, X., Habu, T., Rizo, J., Matsumoto, T., and Yu, H. (2004). Conformation-specific
binding of p3 l(comet) antagonizes the function of Mad2 in the spindle checkpoint. Embo J 23,
3133-3143.

Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T.L., Sechi, S., Qin, J., Zhou, S., Higgs, D.,
and Wang, W. (2003). The ATRX syndrome protein forms a chromatin-remodeling complex
with Daxx and localizes in promyelocytic leukemia nuclear bodies. Proc Natl Acad Sci U S A
100, 10635-10640.

Yang, X., Khosravi-Far, R., Chang, H.Y., and Baltimore, D. (1997). Daxx, a novel Fas-binding
protein that activates JNK and apoptosis. Cell 89, 1067-1076.

Yeung, T.K., Germond, C., Chen, X., and Wang, Z. (1999). The mode of action of taxol:
apoptosis at low concentration and necrosis at high concentration. Biochem Biophys Res
Commun 263, 398-404.

Yu, X., Minter-Dykhouse, K., Malureanu, L., Zhao, W.M., Zhang, D., Merkle, C.J., Ward, I.M.,
Saya, H., Fang, G., van Deursen, J., and Chen, J. (2005). Chfr is required for tumor suppression
and Aurora A regulation. Nat Genet 37, 401-406.

Zhao, L.Y., Liu, J., Sidhu, G.S., Niu, Y., Liu, Y., Wang, R., and Liao, D. (2004). Negative
regulation of p53 functions by Daxx and the involvement of MDM2. J Biol Chem 279, 50566-
50579.









Zhong, S., Salomoni, P., Ronchetti, S., Guo, A., Ruggero, D., and Pandolfi, P.P. (2000).
Promyelocytic leukemia protein (PML) and Daxx participate in a novel nuclear pathway for
apoptosis. J Exp Med 191, 631-640.









BIOGRAPHICAL SKETCH

Cory Lindsay was born in Laurel, Nebraska, a small town located in northeast Nebraska

cornering Iowa and South Dakota. He is the son of Archie and Virginia Lindsay, of Laurel, and

has three siblings Lori, Scott and Michelle. Cory attended Laurel-Concord High School and

graduated in 1998. During his high school years, Cory had several outstanding teachers who

motivated and inspired him to pursue academics. His first experience with science research

came during this time when he studied meiofauna biology and won several local, regional and

national awards for his efforts. He also developed an interest in collecting and breeding snakes

and other reptiles and amphibians, a hobby which he still pursues today.

After high school, Cory pursued a Bachelor of Science degree in Biological Sciences from

Wayne State College, in Wayne, NE and graduated in 2002. While an undergraduate, Cory was

fortunate to have many opportunities to perform independent science research. He conducted

ecological research in the British West Indies studying dwarf-geckos and snakes as part of a

collaborative effort with Avila College, Kansas City, MO; identified novel genes from the

Schistosoma mansoni genome at the Whitney Laboratory, St. Augustine, FL; performed

molecular biology experiments as an intern at the Bermuda Biological Station for Research, St.

Georges, Bermuda; and deciphered genetic disease abnormalities at the world famous Cold

Spring Harbor Laboratory, Long Island, NY.

Cory joined the University of Florida's IDP graduate school program in 2003 and finished

his Ph.D work in the laboratory of Dr. Alexander Ishov studying Daxx function in cellular taxol

response and cell cycle progression. He has presented this work at several national and

international conferences and published his work summarizing these results. Cory will continue

post-doctoral work in cancer research and diagnostics.





PAGE 1

DAXX AND RASSF1 DEFINE A NOVEL MITO TIC STRESS CHECKPOINT THAT IS CRITICAL FOR CELLULAR TAXOL RESPONSE By CORY R. LINDSAY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Cory R. Lindsay 2

PAGE 3

To my parents Archie and Virginia Lindsay 3

PAGE 4

ACKNOWLEDGMENTS I thank my parents Archie and Virginia for always providing the love, support and encouragement I have needed to pursue my dreams. I thank Mr. Ed Brogie, Dr. Ed RosaMolinar and Dr. Russ Rassmussen who, knowingly or not, motivated, inspired and challenged me. I thank Dr. Alexander Ishov for his ex cellent mentorship, guidance and knowledge. 4

PAGE 5

TABLE OF CONTENTS ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 1 INTRODUCTION................................................................................................................. .12 Breast Cancer and Chemotherapy Resistance ........................................................................12 Taxanes and their Activity ...............................................................................................12 Taxanes and Mitotic Checkpoints ...................................................................................14 Cancer Cell Line Response to Taxane Treatment ...........................................................15 Predictive Markers for Taxane Treatment .......................................................................15 Daxx: The Story of an Enigmatic Protein ..............................................................................17 Daxx and Apoptosis ........................................................................................................17 Daxx and Transcription ...................................................................................................19 Cellular Localization of Daxx .........................................................................................21 Ras-Association Domain Family-1 (Rassf1) and Cancer .......................................................24 Preferential Alteration of Rassf1A in Cancer ..................................................................25 Rassf1A and Cell Cycle Control .....................................................................................25 Cellular Localization of Rassf1A ....................................................................................27 Functions of Rassf1C......................................................................................................28 Cellular Localization of Rassf1C ....................................................................................29 2 MATERIALS AND METHODS...........................................................................................31 Antibodies ........................................................................................................................31 -Gal Reporter Assay ......................................................................................................31 Biochemical Fractionation...............................................................................................32 Cell Culture and Transfections ........................................................................................32 Cell Cycle Synchronization .............................................................................................33 Colony Formation Assay .................................................................................................33 Confocal Microscopy and Subcellular Localization .......................................................33 Drug Treatment ...............................................................................................................33 Embryo Isolation and Culture .........................................................................................34 FACS Analysis ................................................................................................................34 Fluorescence Time-Lapse Microscopy ............................................................................34 Immunofluorescence .......................................................................................................35 In vitro Pull-down Assay .................................................................................................35 Plasmid Constructs ..........................................................................................................36 Stable siRNA Infection ....................................................................................................36 Western Blotting ..............................................................................................................37 Yeast Two-Hybrid Assay ................................................................................................37 3 DAXX FUNCTION IN MITOSIS.........................................................................................38 5

PAGE 6

Introduction .............................................................................................................................38 Results and Discussion ...........................................................................................................38 4 DAXX IS A TRIGGER OF CE LLULAR TAXOL RESPONSE..........................................46 Introduction .............................................................................................................................46 Discussion and Results ...........................................................................................................47 5 DAXX INTERACTS WITH RAS-ASSOCIAT ION DOMAIN FAMILY 1 (RASSF1) WHICH COOPERATE IN CELL ULAR TAXOL RESPONSE............................................57 Introduction .............................................................................................................................57 Discussion and Results ...........................................................................................................57 6 SUMMARY AND CONCLUSIONS.....................................................................................72 REFERENCES ..............................................................................................................................79 BIOGRAPHICAL SKETCH .........................................................................................................89 6

PAGE 7

LIST OF TABLES Table Page 3-1 Statistical analysis of mitotic progre ssion in controland Daxx-depleted H3-GFPHEp2 cells.. ........................................................................................................................42 6-1 Alteration of several known mitotic proteins and re sultant cellular paclitaxel response.. ............................................................................................................................76 7

PAGE 8

LIST OF FIGURES Figure Page 1-1 Dynamics of paclitaxel action in cells.. .............................................................................30 1-2 Localization of Daxx throughout the cell cycle.. ...............................................................30 3-1 Characterization of Daxx-/mouse embryos and cells. .....................................................42 3-2 Western blot analysis of Daxx protein level in HEp2-H3-GFP cells expressing control-siRNA or Daxx-siRNA. .......................................................................................43 3-3 Fluorescence time-lapse microscopy im ages of HEp2-H3-GFP cells expressing either control-siR NA or Daxx-siRNA.. .............................................................................43 3-4 Daxx depletion stabilizes cyclin B during mitosis.. ...........................................................44 3-5 Western blot analysis of mitotic proteins in wild type (parental), control-siRNA and two independent Daxx-siRNA cell lines. ...........................................................................44 3-6 Western blot analys is of Daxx protein levels throughout the cell cycle. ..........................45 3-7 Dynamics of Daxx localization in mitotic MPEF cells. ....................................................45 4-1 Differential response of Daxx+/+ and Daxx-/MEFs to microtubule inhibitors nocodazole and paclitaxel.. ................................................................................................51 4-2 Colony formation of breast cancer cells after paclitaxel treatment is Daxx-dependent. ...52 4-3 Response to paclitaxel treatment in breas t cancer cell lines with different Daxx level. ....53 4-4 Response of MDA MB 468 and T47D breast cancer cell lin es to increased concentration of paclitaxel.. ...............................................................................................54 4-5 FACS analysis of cell cycle distribution after pa clitaxel treatment. ..................................55 4-6 Paclitaxel response is Daxx-dependent ..............................................................................56 5-1 Daxx interacts with tumo r suppressor Rassf1 in yeast. .....................................................64 5-2 Mapping of Daxx-Rassf1 interaction.................................................................................66 5-3 Cellular distribution of Daxx and Rassf1 during interphase..............................................67 5-4 Co-localization of endogenous Daxx and Rassf1 during mitosis in HEp2 cells ...............68 5-5 Depletion of Daxx or Rassf1A desensitizes cells to paclitaxel. .........................................69 8

PAGE 9

5-6 Cyclin B levels are stabilized in Da xxand Rassf1A-depleted cells treated with taxol.. ..................................................................................................................................70 5-7 Inactivation of the mito tic spindle checkpoint using Aurora kinase inhibitors abolishes taxol resistance in Daxx-and Rassf1A-depleted cells ........................................71 6-1 Dynamics of Daxx-Rassf1 interaction throughout the cell cycle.. ....................................77 6-2 Model depicting Daxx-Rassf1-mediated mitotic stress checkpoint during prometaphase ...........................................................................................................................78 9

PAGE 10

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DAXX AND RASSF1 DEFINE A NOVEL MITO TIC STRESS CHECKPOINT THAT IS CRITICAL FOR CELLULAR TAXOL RESPONSE By Cory R. Lindsay May 2008 Chair: Alexander Ishov Major: Medical Sciences -Molecular Cell Biology Taxanes, a family of compounds which includes taxol, are powerful chemotherapy agents used for breast cancer treatment. Large numbers of pa tients, however, are resist ant to these drugs for unknown reasons. Taxol binds and hype r-stabilizes microtubules, but mutations or alterations in tubulin occur very rarely in cancers and cannot itself expl ain the majority of Taxol-resistance observed in patients. Currently, it is thought that defects in mitotic proteins may affect Taxol sensitivity in cells. Here, Daxx and Rassf1 are id entified as novel regulato rs of cellular Taxol response. Daxx is a ubiquitously expressed and highly conserved nuclear protein with enigmatic roles in transcription and apopt osis. Increased prometaphase index in Daxx deficient embryos and aneuploidy of Daxx knockout cells was observed which suggested a potential function of Daxx in mitosis and cell division. During interpha se, Daxx remains a strictly nuclear associated protein localized to PML bodies or heteroch romatin. Upon nuclear envelope breakdown, Daxx was found to co-localize and interact with Rassf1 at mitotic spindles. Rassf1 is a cytoplasmic, microtubule-associated protein that is important for normal mito tic progression and cell division. Daxx was also shown to be important for the prop er timing and progression of early mitosis. Together, Daxx and Rassf1 define a novel mitoti c stress checkpoint that enables cells to 10

PAGE 11

efficiently exit mitosis (and eventually die) when encountered with specific stress stimuli during mitosis, including Taxol. In the absence of Da xx or Rassf1, cells treated with Taxol remain arrested in mitosis due to a su stained mitotic spindle checkpoint. Upon Taxol decay or removal, these cells can resume mitosis and complete cell divisionthus being Taxol resistant. Inhibition of the spindle checkpoint using Aurora Kinase inhi bitors efficiently abolished Taxol resistance in Daxx and Rassf1 depleted cells. Deregulation of most known mitotic proteins leads to enhanced Taxol response. Absence or depletion of Daxx a nd Rassf1, in contrast, results in increased drug resistance. In the future, Daxx and Rassf1 may be useful predictive markers for the proper selection of patients for taxane chemotherapy. 11

PAGE 12

CHAPTER 1 INTRODUCTION Breast Cancer and Chemotherapy Resistance Breast cancer is the most frequently diagnosed malignancy for women in the United States. In 2005, an estimated 211,000 new cases of invasi ve breast cancer were expected to occur (Cancer Facts and Figures 2005, American Cancer Society). The mortality rate from breast cancer declined approximately 2.3% per year from 1990 to 2001, mostly due to earlier detection and improved therapies. Nonetheless, an esti mated 40,000 women would die of breast cancer in the United States in 2005 (Cancer Facts a nd Figures 2005, American Cancer Society). Chemotherapy is a very popular treatment option for many breast cancer patients. There are a number of agents used in adj uvant therapy with established cy totoxic activity, with the taxanes considered some of the mo st active (O'Shaughnessy, 2005). Taxanes and their Activity Taxanes, the group of cytotoxic drugs that includes paclitaxel (taxol) and docetaxol (taxotere), are among the most powerful antican cer agents for breast cancer chemotherapy. Increasing numbers of patients have been treated with these drugs along, or in combination, with other chemotherapeutic agents. The successful en try of paclitaxel into clinical trials in 1986 boosted an interest in understanding the mechanism of taxane-induced cell death and in studying pathways and proteins targeted by this treatm ent, including tubulin as an immediate target (Schiff et al., 1979) and downstream targets of ta xanes, including mitotic proteins (Wood et al., 2001). Although taxanes are successful in selective kill ing of tumor cells in clinical settings, current understanding of the molecular basis of this therapy is controversial and incomplete. For 12

PAGE 13

a long time, apoptosis was considered the main mechanism of cell death in response to taxane treatment. Currently, a more di stinct model of therapy response is considered, wherein different modes of tumor cell death are likely determin ed by drug concentrati on and genetic background of the cells within a tumor (M orse et al., 2005). At pharmacol ogical concentrations, taxanes reversibly bind to tubulin heterodimers that form microtubulesthis accelerates polymerization and inhibits depolymerization of tubulin, thus disrupting microtubule dynamics. This event, in turn, activates the spindle checkpoint, which invo kes mitotic arrest that in normal, untreated conditions ensures proper chromosomal att achment and alignment and ensures faithful chromosomal segregation preventing aneuploi dy (Chan and Yen, 2003; Cleveland et al., 2003). This mitotic arrest does not pers ist indefinitely. After some pe riod of time, cells usually undergo an aberrant exit from mitosis, characterized by th e lack of metaphase, anaphase and cytokinesis. The nuclear envelope is reformed around individual or groups of chromosomes producing large nonviable cells with multiple micronuclei, wh ich are easily distingui shable morphologically from apoptotic cells. Apoptotic cells will have small, highly condensed chromatin with fragmented nuclei and a diminished cytoplasm, whereas micronucleated cells are much larger with uncondensed chromatin in a pattern reminisc ent of normal nuclei. This type of cell death which results in micronucleated cells is known as mitotic catastrophe and is activated during mitosis as a result of deranged spindle formati on coupled with blocks of different checkpoint mechanisms that activate aberrant chromosome segregation and nuclear fragmentation (Kroemer and Martin, 2005). Taxane-sensi tive human breast cancer cells are blocked in mitosis only transiently, followed by nuclear fragmentation and mitotic cata strophe, while resistant breast cancer cells have more prolonged mitotic block a nd continue proliferation after drug decay and microtubule dynamics restoration, thus surviving chemotherapy (Figure 1-1). 13

PAGE 14

Taxanes and Mitotic Checkpoints Several mitotic checkpoint prot eins, including MPS1, Survivin, Chfr, and members of Mad and Bub protein families (Mad1, Mad2, Mad3 (or BubR1) Bub1, Bub3), sense improper tension between kinetochores and microt ubules of the mitotic spindle and transmit a signal to inhibit mitotic progression. Inactivation of most of these checkpoint proteins increases sensitivity to taxane treatment (Carvalho et al., 2003; Lee et al., 2004; Lens et al., 2003). The factors that determine prolongation of mitotic block and, thus, resistance to treatment by taxanes, remain incompletely characterized. To date, only few ex amples are known when inactivation of mitotic checkpoint proteins leads to re duced sensitivity to taxanes. Inactivation of Chfr, a mitoticassociated E3 ubiquitin ligase (Bothos et al., 2003; Chaturvedi et al., 2002; Kang et al., 2002) which degrades the mitotic kinase Aurora A (Yu et al., 2005) leads to decreased sensitivity to the microtubule depolymerizing drug nocadozole (Scolnick and Halazonetis, 2000). Downregulation of breast cancer susceptibility gene 1 (BRCA1) by siRNA leads to increased taxane resistance in breast cancer cell line MCF-7 (Chabalier et al., 2006). Another report describes nocodazole-induced delay in m itotic exit upon depletion of p31 comet in HeLa cells. p31 comet acts in mitosis by counteracting spindle checkpoint function of Mad2 (Xia et al., 2004). Thus, recent efforts have started to link sensit ivity of tumor cells to taxane tr eatment with genetic defects in the cell cycle checkpoints in association with can cer chemotherapy. It has been suggested that inactivation of mitotic ch eckpoint proteins can contribute to the selective response of taxane treatment in vivo (Wassmann and Benezra, 2001). However, mutations in known checkpoint proteins occur rather rarely (Cahill et al., 1998 ; Haruki et al., 2001); t hus broader studies are necessary to search for novel mol ecular targets of taxane therapy. 14

PAGE 15

Cancer Cell Line Response to Taxane Treatment Breast cancers are often resistant to the ther apeutic induction of apoptosis which is likely due to inactivation of apoptotic pathways (Brown and Wouters, 1999). Therefore, therapies that promote other types of death, such as mitotic catastrophe, may be preferential for use in treating breast cancer. Apoptosis was co mmonly regarded as the major mechanism of cell death in response to taxanes (Wang et al., 1999); lately, both paclitaxel and docetaxel are observed to induce doseand cell linespecifi c apoptotic or mitotic cell d eath (Roninson et al., 2001). In breast cancer cells and nonsmall cell lung carcinoma cell lines, each of which originate from supposedly primary targets of taxane therapy in vivopaclitaxel has a co ncentration-dependent, biphasic response. At low, pharm acologically relevant concentr ations, mitotic catastrophe is observed, whereas at high concentrations termin al cell cycle arrest followed by necrosis are documented (Yeung et al., 1999). Taxane-sensitive human breast cancer cells are blocked in mitosis only transiently, followed by nuclear fr agmentation and mitotic catastrophe, while resistant breast cancer cells have more prolonged mitotic block and contin ue proliferation after drug decay and restoration of microtubule dynami cs, thus surviving chemotherapy. The factors that determine prolongation of m itotic block and, thus, resistance to treatment by taxanes, still need to be characterized (Wood et al., 2001). Predictive Markers for Taxane Treatment Significant numbers of patients ar e resistant to taxanes or become resistant to this therapy during treatment. The response rate of docetaxel is ~50% even in the first-line chemotherapy and it decreases to 20-30% in the s econdor third-line th erapy (Bonneterre et al., 1999; Crown et al., 2004; Ravdin et al., 2003). Together with side e ffects, which includes pe ripheral neurotoxicity (Rowinsky et al., 1993), it is of vital importance to select responsive patients using prognosis and 15

PAGE 16

predictive markers. Overcoming resistance or incomplete response to these agents would represent a major advantage in th e clinical treatment of breast cancer (Aapro, 2001; Henderson et al., 2003). A number of studies have been carried out to determine a genomic profile that could be predictive for taxane treatment. In 2003, the group of Dr. Chang published a study of gene expression profiles of 24 patients before and af ter four cycles of do cetaxel treatment in correlation with differential response to chem otherapy (Chang et al., 2003). They observed a differential pattern of 92 genes correlating wi th docetaxel response allowing the predictive classification of tumor sensitivit y. Later this group observed, in the same cohort of patients, chemotherapy-driven positive selection of resistant cells populated by genes involved in G2/M arrest (Chang et al., 2005b). Dr. Katos group pe rformed a similar study an alyzing the expression profile of 44 breast tumor specimens before tr eatment with docetaxel in combination with clinical response to th erapy, and developed a diagnostic al gorithm to differentiate between responders and non-responders. They also descri bed elevated expressi on of redox controlling genes in non-responding patients (Iwao-Koizumi et al., 2005). The same group described downregulation of aromatase in docetax el response patients thus connec ting this type of chemotherapy with suppression of intra-tumoral estradiol synthesis (Miyoshi et al., 2004). A study comparing gene profiles before and after chemothera py by either doxorubicin/cyclophosphamide or doxorubicin/docetaxel treatment could not detect a significant profile for the prediction analysis of this combination of chemotherapies probably due to a relatively small group of patients involved (Hannemann et al., 2005). Despite exte nsive studies trying to identify predictive markers for taxane treatment, the clinical applica tion of results have, so far, been limited, partly 16

PAGE 17

due to uncertainties about the reproducibility of methods between several groups (Mauriac et al., 2005). Daxx: The Story of an Enigmatic Protein Daxx and Apoptosis Daxx is a 120 kDa ubiquitously expressed pr otein with a high degree of similarity between mice and humans (72% identical by amino acid sequence) (Kiriakidou et al., 1997). Daxx was initially identified thr ough yeast two-hybrid sc reens as a Fas-intera cting protein (Yang et al., 1997). In this initial study, mouse Da xx was found to potentiate apoptosis through a novel pathway involving activation of the jun N-terminal kinase (JNK) and not through an interaction with the Fas-associated death domain (FADD). A follow-up investigation pub lished a year later, showed mDaxx could activate the JNK kina se kinase (ASK1) by binding ASK1 and subsequently relieving an inhibitory intramolecular interaction between the N & C-termini of the protein (Chang et al., 1998). Through these first two studies, ideas toward s the role of Daxx were predominately shifted towards activation of apoptosis and promoting cell death. Perlman et al. (2001) were able to add further weight to the notion of Daxx as a pro-apoptotic mo lecule by showing it could both physically and biochemically interact with transforming growth factorreceptor (TGF) and aid its apoptotic response by inducing JNK ac tivation. Correspondingly, when antisense Daxx oligo-nucleotides were transfected into AML-12 cells, subsequent TGFtreatment did not induce apoptosis (Perlman et al., 2001). Seemingly contradictory evidence towards the role of Daxx in vivo began accumulating a couple of years after its initi al discovery. The Leder group developed a Daxx knockout showing a phenotype of extensive apoptos is and lethality by embryonic day 8.5-9, rather than a mouse 17

PAGE 18

with proliferation abnormalities indicative of a pro-apoptotic gene (Michaelson et al., 1999). These results suggested that Daxx supported a role in an an ti-apoptotic function. Indeed, knockdown of Daxx expression by RNA interference re vealed increased levels of apoptosis as measured by FACS analysis (Michaelson and Leder, 2003). Conversel y, it had been known for years that over-express ion of Daxx would lead to induction of apoptosis as well (Torii et al., 1999; Yang et al., 1997). What could be the true function of Daxx, in relation to apoptosis, in vivo ? Stronger evidence towards the role Daxx could be playing in apoptosis came from studies focusing on the endogenous localization of Daxx in cells. Ishov and colleagues and other groups afterwards (Croxton et al., 2006; Ishov et al., 1999; Ishov et al., 2004; Zhong et al., 2000), found Daxx to interact with the promyelocytic leukemi a (PML) tumor suppressor protein and could be subsequently recruited to sub-nuclear domai ns called ND10 (PML bodies, PODs, or Kraemer bodies) upon sumoylation of PML. An apparent nuclear localization of Daxx, as would be consistently shown by biochemical fractionati on and immunofluoresence experiments, raised concern on how Daxx could be involved in Fas-indu ced apoptosis if Fas was anchored to the cell membrane. A study published shortly after the discovery of a Daxx/PML interaction and ND10 localization showed that huma n Daxx, although a potent enhancer of Fas-induced apoptosis when over-expressed, did not associate with huma n Fas in cells and maintained its nuclear localization (at ND10) even upon stimulation of Fas-induced apoptosis (Torii et al., 1999). Moreover, the localization of Daxx to ND10 seemed to be critical for enhancing apoptosis as a Daxx mutant lacking its nuclear localization sequence (and hence it s association with PML) was not as effective at promoting cell death (Torii et al., 1999). Zhong and colleagues also supported this claim by showing a larger induction of apoptosis (as measured by TUNEL assay) by Daxx in 18

PAGE 19

PML +/+ compared to PML -/cells (Zhong et al., 2000). Thus the localization of Daxx to ND10 and not to the cytoplasm was critic al for Daxx-enhanced apoptosis. Daxx and Transcription The identification of PML interacting with and sequestering Daxx into nuclear domains would become as important a discovery as any study demonstrating the f unctionality of Daxx. Ishov and colleagues showed that in situations where PML was ab sent, Daxx would be relocated to condensed heterochromatin where it could potentially be involved in some biochemical function (Ishov et al., 2004). Subs equent studies provided some ev idence of what Daxx could be doing at these sites by showing it could interact not only with core histones, but histone deacetylase II (HDACII), Dek (Hollenbach et al ., 2002) and the SWI/SNF chromatin remodeling protein ATRX (Xue et al., 2003). These interact ions, among others, brought forth the idea that Daxx could be acting as a regulat or of transcription, not only on the level of repression but activation as well. Among a few of the many genes Daxx has been implicated in regulating include p53 target genes (Gostissa et al., 2004; Zhao et al., 2004), Pa x transcription factor family members (Emelyanov et al., 2002; Hollenbach et al., 2002; Lehembre et al., 2001) and Smad4 (Chang et al., 2005a) A more dynamic role of Daxx became apprec iated when Ishov and colleagues showed a cell cycle dependent localizati on of Daxx between ND10 and heterochromatin (Figure 1-2) (Ishov et al., 2004). They found that during G1 and G2 phase, Daxx could be found in its characteristic location at ND10, while during S phase, Daxx would relocate to condensed heterochromatin. Interestingly during mitosis, ND10 is disass embled, PML de-sumoylated and Daxx no longer associated with the remnants of these nuclear domains (Ishov et al., 2004). What became the fate of Daxx after this se t of events was not addressed. 19

PAGE 20

From the cell cycle-dependent localizati on of Daxx model whic h Ishov and colleagues proposed, ND10 could be considered a site of inactivation of Da xx functiona potential storage depot for Daxx and numerous other prot eins until specific times when they are needed and become active again (Ishov et al., 2004). Although at the time this was not a novel concept, a study conducted by (Li et al., 2000) and similarl y by (Lin et al., 2003) suggested this notion showing that when Daxx was bound to increa sing amounts of PML, the transcriptional repression activity of Daxxas measured by a luciferase reporter assaywas relieved. A possible mechanism which could regulate the localization of Daxx to ND10 or to heterochromatin was shown by Ecsedy and coll eagues when they demonstrated a physical interaction between Daxx and the serine/threoni ne kinase HIPK1 (Ecsedy et al., 2003). This interaction was capable of disp lacing Daxx from PML and re-localizing it elsewhere in the nucleus. In addition, the Ecesedy group f ound that upon phosphorylation of Daxx by HIPK1, Daxx transcriptional repression act ivity was modified (Ecsedy et al., 2003). The investigators could not, however, definitively show a relocalization of Daxx to heterochromatin but rather an association with HDAC1. Additionally, they sh owed that phosphorylation of Daxx by HIPK1 diminished the transcriptionally repressive activ ity of Daxx rather than enhanced it. Other studies, which focused on the condition-dependent localization of Daxx (and other nuclear body associated proteins) were found to be dependent on the sumoylation status of PML as well as cellular stresses such as heat shock and heavy metal exposure (Nefkens et al., 2003). The small ubiquitin-like modifier (SUMO), mo reover, is a post-translational modification added to proteins which affects their function and localization. SUMO bears a 20% identit y to ubiquitin and is covalently linked to a wide range of proteins whose functions are commonly implicated in chromatin organization, transcription and ge nomic stability (Hay, 2005). Although other 20

PAGE 21

conditions may be found to regula te Daxx localization, it remains in tuitive that cellular factor(s) and protein modifications play an important role in the regulati on of Daxx inside of the nucleus. To date, Daxx is a protein that has been identified numerous tim es through yeast twohybrid screens with various other proteins both as p rey or bait. A list of proteins which have been found or used in this way is steadily growin g. In some instances, this may be an indication that Daxx could be a false positive of the experime ntal system. Yet the truly diverse function of Daxx-mediated protein interactio ns has made elucidating the role of Daxx and its biological significance difficult. The fi rst Daxx-deficient mouse model developed by Michaelson and colleagues still showed the transcription of a mutant form of Daxx, specifically the C-terminal 479 amino acids of the protein (Michaelson et al., 1999). At least theoreti cally, this C terminal fragment could be responsible for the obser ved levels of apoptosis and other phenomenon associated with Daxx-deficiency. A more comprehensive Daxx knockout was generated by the Ishov Lab, however, which showed a similar phenotype (Ishov et al., 2004). By embryonic day 8, Daxx -/mice were developmentally retarded and by day 11.5-12.5, embryos distenegrated completely (Ishov et al., 2004). As we continue to learn more of Daxx biology, we will continually add more to what we already know as a truly unique protein with diverse cellular functions. Cellular Localization of Daxx The sub-cellular localization of Daxx has been a controversy since it was discovered as a factor involved in Fas-induced apoptosis. Da xx was identified via yeast-two hybrid screening using Fas as bait. While Daxx was not completely characterized from this screening, these findings thrust forward the ideology that Daxx w ould be found as a cytoplasmic-oriented protein near the cell membrane. A subsequent para dox would ensue when Daxx was discovered as a 21

PAGE 22

predominately nuclear protein. Beginning w ith the study by Pluta and colleagues, which characterized the interaction between centrosome component CENP-C and the human form of Daxx from HeLa cells, large-scale biochemical se paration into cytosolic, nuclear and mitotic chromosome fractions would show that Daxx wa s a protein associated largely with nuclear isolated fractions. Immunofluorescence of endogenous Daxx was described as a punctuate staining pattern in interphase nuclei (Pluta et al., 1998). Th is characteristic Daxx-staining pattern emphasizes its association with PML bod ies. Subsequent stud ies would attempt to validate Daxx interaction with apoptosis sign al-regulating kinase 1 (ASK1) and show colocalization and interact ion of the two proteins in the cy toplasm, but the bulk of these experiments were based on transi ent over-expression and this may not necessarily represent the behavior of endogenous pr oteins (Ko et al., 2001). One repor t by Lalioti et al. showed very detailed cellular fractionation of NIH-3T3 fibr oblasts into nuclear, cy tosolic, low-density microsome, high-density microsome and plasma me mbrane fractions, with the majority of Daxx accumulating in the nuclear fraction and a sm all percentage appearing in low-density microsomes (Lalioti et al., 2002). Using huma n Daxx antibody directed against endogenous protein, the Lalioti group observed along with nuclear staining, a very faint speckle-like cytoplasmic Daxx pattern in human fibroblasts which presumed there may be two intracellular pools of Daxx that exist in cells. Strong endogenous interaction between Daxx and other nuclear-associated proteins including chroma tin remodeling proteins ATRX and HDACII, nuclear sub-domain constituent PML, nuclear protein kinase HIPK1 among others, suggests Daxx is predominately a nuclear protein. In the absence of PML, the major Daxx housing domain in interphase, Daxx adopts a primarily chromatin-based localiz ation in the nucleus 22

PAGE 23

(Ishov et al., 2004). Thus, if Da xx protein resides in the cytopl asm at any period of time, it would most likely occur as a result of specific relocation as part of signaling pathways. Several reports describe detailed mechanisms of Daxx re-localizati on under various stress conditions (Jung et al., 2008; Jung et al., 2007; J unn et al., 2005; Karuna karan et al., 2007; Song and Lee, 2003). In many cases, this change in distribution of Daxx was shown to be critical for cell survival under st ress. During glucose deprivation, Daxx is re-located from the nucleus to the cytoplasm (Song and Lee, 2003, 2004). Mutation of Trpytophan 621 and Serine 667 of human Daxx, moreover, was sufficient to block nuclear export in these stress conditions, which relied on stable adenoviral expression of Daxx in adenocarcinoma DU-145 cells. Chemical hypoxiainduced Daxx relocalization to the cytoplasm was eloquently shown by (Jung et al., 2008) using detailed confocal imaging analysis of e ndogenous Daxx in Chinese hamster ovary cell line PS120. Oxidative stress was also reported to infl uence the localization of Daxx to the cytoplasm in DU-145 cells, while over-expression of catal ase inhibited nuclear export of Daxx and its glucose deprivation-induced cy totoxicity (Song and Lee, 2003). A contradictory report by (Khelifi et al., 2005) however, showed via bioc hemical separation that Daxx remains in the nucleus after exposure to hydrogen peroxide or UV treatment. In the majority of studies, however, the primary means of determining stress induced Daxx localization was accomplished by immunofluorescence staining of transiently over-expressed pr otein. In some cases, these localization patterns may be a result of artifacts created either by conditions of treatment or methods of fixing and staining of cells. Alte rnatively, many observed properties of Daxx in response to stress stimuli may be cell-line spec ific. Can stress-induced Daxx re-localization be explained by the shuttling of other nuclear proteins into the cytoplasm? To date, few studies have effectively incorporated these controls into their investigations. If a general re-distribution 23

PAGE 24

of nuclear proteins is observe d in these cases, it is possible that these phenomena are less attributable to Daxx function and more explainable as a general cellular stress response. Reports such as (Nefkens et al., 2003) for example, may describe more functional stress-induced Daxx redistribution in that the activity of severa l nuclearand ND10-associated proteins were documented in parallel after res ponse to specific stress stimu li. Specifically, Daxx and Sp100 but not PML would disperse from ND10 into th e nucleoplasm due to rapid desumoylation of PML during heat shock, while heavy metal e xposure would release Daxx and PML with Sp100 retained at ND10 (Nefkens et al ., 2003). While there is some ta ntalizing evidence to suggest existence and function of Daxx in the cytoplasm, more extensive studies of endogenous protein trafficking are required. Ras-Association Domain Family-1 (Rassf1) and Cancer The Rassf1 gene locus comprises approximately 11,151 base pairs of the human genome and consists of eight exons (Aga thanggelou et al., 2005). It is found on the short arm of human chromosome 3 (3p21.3). Differential promoter use and alternative sp licing creates seven transcripts Rassf1A-Rassf1G. Of these transcripts, isofor ms Rassf1A and Rassf1C are predominately expressed in all tissues while Rassf1B is expressed in the hemopoeitic system only, and Rassf1D or Rassf1E expres sion is restricted to cardiac or pancreatic cells respectively. Homologues of Rassf1A exist in rodents, fish, nematodes and fruit flies ranging from 38% to 85% identity (Agathanggelou et al., 2005). A Ra ssf1C homologue exists in Xenopus with no apparent homologue for Rassf1A. 24

PAGE 25

Preferential Alteration of Rassf1A in Cancer Allelic loss of the short arm of human chromo some 3 (3p) is one of the most frequently occurring events in lung cancers (90% of small cell lung cance rs 50-80% of non-small cell lung cancers) (Dammann et al., 2000). Specificall y, the region 3p21.3, where the Rassf1 locus resides, displays regu lar loss of heterozygosity and homoz ygous deletions in cancer cells. Promoter methylation and loss of protein expression have been dire ctly correlated specifically to Rassf1A in many different tumor cell lines and this methylation has been confirmed in at least 37 different tumor types (Agathanggelou et al., 2005) Methylation of the Rassf1A promoter does not affect expression of Rassf1C and in numerous instances Rassf 1C is used as a control for RNA integrity and loading when studying Rassf1A expression. Therefore, epigenetic inactivation of Rassf1C is much rarer than th at of Rassf1A. In one study, Rassf1A promoter methylation occurred with a frequency of 62% in forty-five breast carcinomas that were analyzed and in many instances treatment of cells with the DNA methylati on inhibitor 5-aza-2`deoxycytidine reactivated Rassf1A transcript expression (Dammann et al., 2001). Because of this very strong correlation betw een loss of Rassf1A expression and tumor-specific cell lines it is highly regarded as a candidate molecular marker for tumor diagnosis. Differential loss of Rassf1C expression, however, has been documented in some tumor cell lines and may be regulated by more significant pos t-transcriptional mechanisms than Rassf1A (Donninger et al., 2007). Rassf1A and Cell Cycle Control Because of the intense focus of Rassf1A inactiv ation in cancers, the ma jority of functional studies about Rassf1 have swayed largely to the A isoform of Rassf1 because of its potential tumor suppressor roles. Indeed, a seminal obser vation that has been repeatedly confirmed for 25

PAGE 26

Rassf1A as a tumor suppressor is the reintroduction of the pr otein by over-expression reduces colony formation in soft agar assays, suppresses growth and re duces independence of anchoragefree cell growth (Burbee et al., 2001; Dammann et al., 2000). Along with reports of growth regulation was the first observations that Ra ssf1A could block cell cy cle progression. Overexpression of Rassf1A was found not to impact a poptosis, but to block cells strongly in the G1 stage of interphase and inhibit accumulation of cyclin D1 (Shivakumar et al., 2002). Importantly, these findings also showed that Rassf1A transcript variants (identified from breast and lung tumor samples) could not block cells in G1 compared to wild-type Rassf1A (Shivakumar et al., 2002). Supporting the eviden ce of Rassf1A function in G1-arrest was a study by the Fenton group showing interaction of p120 E4F with Rassf1A that was necessary for G1arrest (Fenton et al., 2004). Furthermore, this function became even more intricate when Song and colleagues described a dynamic cell cycle-depe ndent regulation of Rassf1A protein levels by Skp2 ubiquitin ligase complex (Song et al., 2007) When Rassf1A levels were degraded by targeted ubiquitination, it was shown that cells we re able to sufficiently progress through G1 into S phase. Subsequent studies would also begin to analyze sub-cellular localization of Rassf1A and associate its localization in cells with function. The Pfeifer group were the first to describe Ra ssf1A as a protein that co-localizes with microtubules during interphase and associates with the spindle apparatus during mitosis (Liu et al., 2003). By using Rassf1 -/cells and over-expression studies it was shown that Rassf1A provided stability to microtubules and the region of tubulin interaction was mapped to a specific 169 amino acid stretch of the carboxy-terminus of Rassf1A (Liu et al., 2003). The Vos and Dallol groups would confirm Rassf 1A-association with microtubules and microtubule-associated proteins and that these intera ctions were important for microtubule stability, dynamics and 26

PAGE 27

preventing genome instability (Dallol et al., 2004 ; Vos et al., 2004). Liu and colleagues also described that overexpression of Rassf1A induced aberrant mitotic arrest at metaphase in a similar manner to the microtubule stabilizing dr ug taxol and how it affects cells (Liu et al., 2003). This became the first study to link Rassf1A to possible mitotic functions in cells. Additional insight into the role of Rassf1A function in mito sis and cell cycle progression came in the seminal study by (Song et al., 2004). Rassf1A was shown to influence the stability of both Cyclin A and Cyclin B as a result of direct interaction w ith Cdc20 and negative regulation of the anaphase promoting complex (APC). Without Rassf1A, cells were proven to progress through early mitosis (specifically prometaphase) faster as a result of premature activation of APC. Absence of Rassf1A by siRNA depletion also caused centrosome abnormalities and multipolar spindles. Details of interaction of Rassf1A with Cdc20 would later become a subject of controversy as Liu and coll eagues showed that Rassf1A was not capable of interacting with Cdc20 in vitro and immunoprecipitation of Cdc20 with Rassf1A could not be detected in synchronous or asynchronous cells (Liu et al., 2007). In the future, additional studies into the precise role of Rassf1A re gulation of mitosis will be required. Cellular Localization of Rassf1A Not until the Pfeifer group described co-locali zation of Rassf1A with microtubules did the scientific community know about the distribution of the protein in cells (Liu et al., 2003). While this study showed ample evidence of the microtubule-associated network that over-expressed Rassf1A will form in cells, the Vos group were the first to describe the endogenous interaction of Rassf1A with polymerized tubulin (Vos et al., 2004). Depolymerized tu bulin was unable to interact with Rassf1A. The sa me group performed a yeast two-hybrid screen using Rassf1A as bait and identified and confir med several known microtubule-assoc iated proteins as interacting 27

PAGE 28

partners of Rassf1A, including microtubule a ssociated protein 1A (MAP1A), MAP1B and C19ORF5 (Dallol et al., 2004). Several reports have shown because of the direct interaction between Rassf1A, tubulin and tubulin-related prot eins, it served to stabilize microtubules under stress conditions (i.e. nocodazole treatment) (L iu et al., 2003; Rong et al ., 2004). During mitosis, over-expressed Rassf1A was obser ved to co-localize with centr osomes and microtubules during prophase, the spindle apparatu s (spindle poles and spindle fibers) during prometaphase, metaphase and anaphase and microtubules as they reformed in divided daughter cells (Liu et al., 2003; Song et al., 2004). The mi nimal interaction domain that is responsible for Rassf1A binding to microtubules and for association with the spindle apparatus was mapped to amino acids 120-288 of Rassf1A (Liu et al., 2003). Functions of Rassf1C While extensive studies on the epigenetic re gulation of Rassf1A have been performed coupled with essential studies into the function of Rassf1A and its importance in tumor progression, very little is known about Rassf1C biology. Armesilla et al. (2004) used a yeast two-hybrid screen to find novel inte ractors of plasma membrane Ca 2+ pump 4b (PMCA4b) which identified Rassf1C. The interaction be tween Rassf1C and PMCA4b was narrowed down to a region that is common to both Rassf1C and Rassf1A, presumably showing that this interaction is shared between bot h isoforms although this data was not shown. Potential tumor suppressor functions of Rassf1C were first described by Li and colleagues demonstrating that Rassf1C could substantially reduce anchorage inde pendent growth of tumor cells and elicit cell cycle arrest similar to Rassf1A (Li et al., 2004). Amaar et al. performed a similar investigation showing that upon depletion of Rassf1C protein in H1299 cells that lack Rassf1A expression, it caused a significant decrease in cell proliferation (Amaar et al., 2006). Upon over-expression of 28

PAGE 29

Rassf1C, however, cell prolifera tion was actually increased comp ared to cells over-expressing Rassf1A. This became some of the first tant alizing evidence to suggest that Rassf1A and Rassf1C could have different effector targets. The microtubule binding an d stabilizing functions of Rassf1C were also characteri zed and shown to have identical properties to Rassf1A-mediated microtubule stability, although thes e findings were largely an oversight (Rong et al., 2004) Interestingly, a study purporting the interacti on of Rassf1C and Daxx in the nucleus was described by (Kitagawa et al., 2006). This study suggested that upon degradation of Daxx, Rassf1C would be released from the nucleus where it can activate the SAPK/JNK pathway to trigger apoptosis during stress conditions. If pr oven correct, this evidence and others like it (Amaar et al., 2006) suggest that although Rassf 1A and Rassf1C have several properties in common they may also have many divergent roles in the cell. Cellular Localization of Rassf1C The localization of Rassf1C in cells has not b een a subject of critic al attention. Several reports suggested microtubule-asso ciated localization of over-expressed Rassf1C was similar to Rassf1A localization although these si milarities were not emphasized (Liu et al., 2002; Liu et al., 2003; Vos et al., 2004). Some re ports have suggested over-expr essed Rassf1C adopts a nuclear localization, perhaps in an effort to separate the tumor suppressor-based roles of Rassf1A from its lesser isoform (Song et al., 2004). Moreover, the descript ion of both over-expressed and endogenous Rassf1C as a component of PML bodies was described by Kitagawa, et al. (2006). In this study, Rassf1C was shown to be exporte d from the nucleus when Daxx was degraded by ubiquitination or siRNA deplet ion, implying a Daxx-dependent nuc lear localization of Rassf1C (Kitagawa et al., 2006). More exte nsive studies into the partitioning of Rassf1C inside of the cell are required. 29

PAGE 30

Figure 1-1. Dynamics of Paclitaxel Action in Cells. At pharmacological concentrations, paclitaxel reversibly inhibits microtubule dynamics blocking cells in pro-metaphase. Cells that are sensitive to paclitaxel activ ate mitotic block only transiently, followed by micronucleation (mitotic catastrophe) and ce ll death, while resistant cells have a more prolonged pro-metaphase block and continue proliferation after drug decay/ withdrawal and microtubule dynamics re storationthus surviving chemotherapy. Figure 1-2. Localization of Da xx Throughout the Cell Cycle. Du ring G1 and G2 phase, Daxx is localized to PML bodies where it is pr esumably inactive. During S phase, Daxx relocates from PML to condensed chromatin where it interacts with ATRX. The fate and function of Daxx during mitosi s (M phase) is not documented. 30

PAGE 31

CHAPTER 2 MATERIALS AND METHODS Antibodies Antibodies to Daxx (M112), BubR1 (8G1), B ub1 (14H5), Cdc20 (H-175), Cdc27 (AF3.1), Cyclin B (GNS1) and Mad2 (17D10) were from Santa Cruz Biotechnology; GST monoclonal antibody was from Sigma; 6X His monoclonal antibody was from Invitrogen; Rassf1C mouse polyclonal antibody was from UT Southweste rn; Rassf1A monoclonal antibody was from Abcam; Rassf1A/C polyclonal antib ody was a gift from Dae Sik Li m, Korea Advanced Institute of Technology; PML rabbit polyclonal antibody was from Gerd Maul, Wistar Institute; Phospho Histone H3 (Ser10) rabbit polycl onal antibody was from Upstate; -Tubulin monoclonal antibody was from Sigma; Daxx monoclona l antibody 514 and rabbi t polyclonal antibody 2133/2134 were developed as descri bed in (Ishov et al., 2004). -Gal Reporter Assay Starter cultures of yeast were grown overnight in CM selective media and OD 600 readings were measured the next day. Cells were resu spended in breaking buffer (100 mM Tris-HCl pH 8.0, 1 mM DTT, 10% glycerol, 40 mM PMSF) and gl ass beads were added and suspensions were vortexed for approximately 5 min at 4C. Af ter pelleting cell debris, a 1:10 mixture of supernatant/Z buffer (60 mM Na 2 HPO 4 40 mM NaH 2 PO 4 10 mM KCl, 1 mM MgSO 4 ) was made and incubated for 5 min at 28C. 200 L ONPG (Sigma) was added to the mixtures and the time taken for reactions to turn yello w was recorded. Afterwards, 400 L of Na 2 CO 3 was added to stop reactions. Gal activity was measured at OD 420 by making 1:10 mixtures of ONPG reaction/water and recordi ng spectrophotometer readings. Protein concentration was determined by OD 595 spectrophotemeter read ings afterterwards. 31

PAGE 32

Biochemical Fractionation HEp2 cells were separated into nuclear a nd cytosolic fractions using a biochemical fractionation buffer consisting of 250 mM sucrose, 20 mM HEPES-KOH pH 7.4, 10 mM KCl, 1.5 mM MgCl 2 1 mM EDTA, 1 mM EGTA. Cells we re grown on 100 mm dishes and washed 2X with PBS and then placed on ice. Ice cold fractionation buffer was immediately added to dishes and cells were incubated at 4 C with gentle rocking for 15 minutes. Cells were then collected into tubes and dounced five times with a B-type pestle. Afterwards, cell extract was collected into microcentrifuge tubes and centrifuged for 2-3 min at 800 RPM to separate intact nuclei from soluble cytoplasm fraction. Nuclei were washed 2X with fractionation buffer and resuspended in 1 mL fractionation buffer. 5 M NaCl was then added to the buffer to reach a final concentration of 450 mM NaCl. Nuclei were then placed at 4 C and subjected to gentle inverting for 5-10 minutes. Nucl ear extract was then centrifuged at 13,000 RPM for 5 minutes at 4 C to pellet insoluble nuclear material. Cell Culture and Transfections Daxx +/+ MEFs, Daxx -/MEFs, HEp2, MDA MB 468 and T47D cells were maintained in Dulbeccos Modified Eagles Medium with 10% fetal bovine serum and 1% penicillin/ streptomycin and maintainted in 5% CO 2 at 37 C. For transient transfection in mammalian cells, all cDNAs were transfected using the Lipofect amine protocol (Invitrogen) according to the manufacturers instructions. 32

PAGE 33

Cell Cycle Synchronization HEp2 and MDA MB 468 cells were synchr onized at G1/S using a standard double thymidine block protocol. Briefly, asynchronous cells were set up at 20-30% confluency and treated with 2 mM thymidine for 18-20 hrs, washed 2X with PBS and released into normal media without thymidine for 6 hrs. 2 mM thym idine was then added for an additional 18-20 hrs and cells were washed 2X with PBS and released from G1/S bl ock for experiments. Colony Formation Assay Treated and non-treated cells were set up for colony formation using a series of cell dilutions ranging from 1:100 to 1:1000 to optimize colony growth. On average, cells were grown for 5-7 days after set up. Colonies were then washed, fixed with methanol and stained with crystal violet (Fisher) in order to visibly count colonies. Each colony formation assay was set up in triplicate in order to obtain represen table statistics for each drug treatment and its duration of exposure to cells. Confocal Microscopy and Subcellular Localization HEp2 cells were cultured on cover dishes fo r 24 hrs and then tran sfected with GFP-Daxx, GFP-Rassf1A, or GFP-Rassf1C. 24-48 hrs later, live cell confocal images were taken using a Leica TCS SP5 microscope and chamber and Leica imaging software. Drug Treatment Standard concentration of paclitaxel (Calbioc hem) used throughout these studies is 10 nM, unless noted otherwise. Paclitaxel was used to treat both asynchronously and synchronously growing cells. Standard concentratio n of nocodazole (Calbiochem) was 10 M and was used to 33

PAGE 34

treat both asynchronously and synchronously growing cells. Standard concentration of Aurora kinase inhibitors ZM447439 (Tocris Bioscience) and Aurora kinase inhibitor III (Calbiochem) was 10 M. Aurora kinase inhibitors were used to treat only synchronously growing cells. Embryo Isolation and Culture Daxx +/+ and Daxx -/embryos were collected at E9.5 from timed matings of Daxx +/mice. Presence of a sperm plug was designated as +0.5 days. Approximately nine days later, female mice were euthanized and embryos (if pr esent) were collected from the uterus. E9.5 embryos were cultured on glass coverslips fo r immunostaining or paraffin-embedded for tissue sectioning. In each case, mate rial from individual embryos was collected for genotyping to confirm presence or abse nce of Daxx alleles. FACS Analysis Cells were trypsonized and re-suspended in DMEM + 10% FBS + 1% penicillin/ streptomycin, centrifuged and washed 2X with PBS and then fixed in 95% ethanol. After fixation, cells were treated with 0.5 g/mL RNase for 20 minutes and propidium iodide was added to a final concentration of 20 g/mL afterwards. Cells were then analyzed via flow cytometry for cell cycle distribution. Fluorescence Time-Lapse Microscopy Control and Daxx-depleted HEp2 cells stably tr ansfected with GFP-Histone H3 (gift from Duane Compton, Dartmouth University) were cultured on cover dishes for 24 hrs and then grown at 37 C in a microscope chamber supplying 5% CO 2. Mitotic cells were imaged using a confocal Leica TCS SP5 microsc ope and Leica imaging software. 34

PAGE 35

Immunofluorescence Cells were cultured on glass coverslips in 24-well plates (Corning), washed with KM buffer (100 mM MES, 100 mM NaCl, 120 mM MgCl 2 50% glycerol) and fixed with 1% paraformaldehyde or ice cold methanol at room temperature for 20 min. After treatment with 0.4% Triton X-100 in PBS (paraformaldehyde-fixed cells only), the cells were incubated with primary antibody for 1 hr at room temperature and then washed 2X with PBS and secondary antibodies (FITC or Texas Red-conjugated, Vector Labs) were then applied sequentially for 45 min each at room temperature in the dark. Ce lls were then stained with HOECHST (Vector Labs) and mounted on slides using Fluormount G (S outhern Biotech), dried and analyzed using a Leica fluorescent microscope and imaged using Openlab software. In vitro Pull-down Assay Daxx and Rassf1 constructs were cloned into pGEX-2T (Invitrogen), pGEX-4T3 (Invitrogen), and pQE-30 (Qiagen) plasmids, resp ectively. Constructs were then transformed into a Rosetta strain of E. coli. Protein expression was induced using 50 mM IPTG (Fisher) (Daxx constructs) and 100 mM IPTG (Rassf1 contructs) at room temperature for 6 hrs (Daxx) or 18 C overnight (Rassf1). Cells were then pellet ed and lysed using a lysis buffer consisting of 0.1% Triton X-100, 2 mM phenyl-methyl-sulfonyl fluoride (PMSF) (Calbiochem), 1 g/mL aprotinin (Sigma), 1 g/mL leupeptin (Sigma), 1 g/mL pepstatin (Sigma) and 50 g/mL 2 mercapto-ethanol (Sigma) in TBS. A GSTand 6X-His pulldown kit (Pierce Biotechnology) was then used to determine binding capability as per the manufacturers instructions. Protein samples were analyzed on 4-20% Tris-HCl, sodium dodecyl sulfate (SDS)/arcrylamide gels (Biorad). 35

PAGE 36

Plasmid Constructs GFP-hDaxx wt and deletion mutants were cloned into the BamHI s ite of pEGFP-C1. GST-hDaxx wt and deletion mutants were cloned into the BamHI site of pGEX-2T and pGEX4T3. pEGFPC2-hRassf1C was a gift from Gerd Pfeifer, Beckma n Research Institute. RFPmRassf1C wt and deletion mutants were cloned into the EcoRI/HindIII site of pDS-RedN1. 6His-mRassf1C was cloned into pQE-30. GFP-hRassf1A was a gift from Dae Sik Lim, Korea Advanced Institute of Technology. RFP-hRassf1A wt and deletion mutants were cloned into the EcoRI/HindIII site of pDS-RedN1. GST-hRassf1A wt and deletion mutants were cloned into the BamHI site of pGEX-2T and pGEX-4T3. Stable siRNA Infection MDA MB 468 and HEp2 cells were transduced with recombinan t lentivirus supernatants encoding hairpin siRNA hDaxx, hRassf1A and control expression constructs which were collected from ~5 x 10 4 transfected 293T cells used for multiple rounds of infection in the presence of 4 ug/ml polybrene. The lentivir al expression system wa s provided by Peter M. Chumakov (Lerner Research Institute, Cleveland; (Sablina et al., 2005). Th is lentiviral system comprises a targeting envelope expression vector pCMV-VSV-G, a generic packaging expression vector pCMV-deltaR8.2 and the expr ession cassette for custom siRNA pLSL-GFP that contains a minimal histone H4 promoter th at drives transcription of a GFP gene allowing fluorescent cell sorting. Candidate siRNAs for Daxx were designe d according to the Dharmacon si DESIGN algorithm ( http://www.dharmacon.com/sidesign/ ) Anti-Daxx siRNA 1 was targeted against base pairs 1552-1570 of hDaxx (sense CTACAGATCTCCAATGAAA; anti-sense TTTCATTGGAGATC TGTAG); anti-Da xx siRNA 2 was targeted ag ainst base pairs 100-118 of 36

PAGE 37

hDaxx (sense GATGAAGCAGCTGCTCAGC; anti sense GCTCAGCAGCTGCTTCATC); control siRNA was directed against ba se pairs 1262-1284 of SETDB1 (sense TCCTCTTTCTTATCCTCGTATGT, anti-se nse ACATACGAGGAT AAGAAAGAGGA). Western Blotting Cell and protein extracts were ran on pre-made 4-20% Tris -HCl, SDS/Acrylamide gels (Biorad), separated by electrophores is and transferred onto nitroc ellulose and PVDF membranes (Biorad). Membranes were then blocked using 3% milk in 0.1% PBS-Tween for 30 minutes at room temperature. Primary antibodies were added and incubated overnight at 4 C. The next day, membranes were washed 3X with 0.1% PB S-Tween and secondary antibodies (mouse and rabbit HRP conjugates, Cell Signaling Technologies) were added and membranes were incubated at room temperature for 1 hr. After 3X wash in PBS-Tween, membranes we re then exposed with ECL (Amersham) and developed. Yeast Two-Hybrid Assay The bait vector pGBDC1-mDaxx wt, -mDaxx C term and -mDaxx C were transformed into yeast strain PJ-69a and PJ-69 alpha al ong with mouse E11.5 cDNA library plasmid cloned into pGADC1. Briefly, frozen yeast competent cells were vortexed unti l melted completely and then incubated at room temperature for 45 min in 1 mL solution B (40% polyethylene glycol 1000, 200 mM bicine pH 8.35). Afte r pelleting cells, supernatant was removed and cells were resuspended in 1 mL solution C (150 mM NaCl 10 mM bicene pH 8.35) and repeated with a second wash in solution C. Cells were then resuspended in 100 L solution C and plated on selective media (CM media tryptophan,leuc ine and CM media tr yptophan,leucine,histidine). 37

PAGE 38

CHAPTER 3 DAXX FUNCTION IN MITOSIS Introduction Components of the mitotic spindle checkpoint, as well as factors involved in the controlled regulation of the spindle checkpoint and other mitotic processes, are necessary for proper partitioning of chromosomes into daughter cells. In the absence of such factors, cells can mishandle proper chromosomal alignment and segregation during metaphase and anaphase, resulting in lagging chromosomes and aneuploidy (I kui et al., 2005). Proper timing and the rate of mitotic progression can also be affected in the absence of one or more mitotic proteins. For this reason, the cell cycle has been compared to a series of molecular timers: clocks that control the average duration of each cycle, and d ominoes that make each step dependent on the proper completion of a prior step (Meraldi et al., 2004). Cyclin B and Securin are two of the primary mitotic substrates that drive entry into and exit from mitosis (Pines, 2006). Using biochemical analysis of the rela tive stability of these proteins it is possible to measure the duration of mitosis and cell division. Along with the targeted depleti on of proteins and timelapse microscopy, many mitotic fact ors have been shown to affect timing and rate of mitotic progressionadding leverage to th eir already established roles as mitotic regulators and adding the possibility of uncovering novel proteins that may also influence cell cycle progression. Results and Discussion Originally identified as a pro-apoptotic Fas-inte racting protein and later demonstrated to have anti-apoptotic activity (Michaelson, 2000), Da xx is a ubiquitously expressed and highly conserved nuclear protein that is also implicated in transcription regulation. As an almost exclusively nuclear protein duri ng interphase, Daxx inte racts with intrinsic kinetochore protein 38

PAGE 39

CENP-C (Pluta et al., 1998); depletion of Ams2, a Daxx-like motif-containing GATA factor in S. pombe results in chromosome mis-segregation (C hen et al., 2003). Extensive aneuploidy was also observed in Daxx -/MEFs, a typical manifestation of ch romosomal mis-segregation in cells (Figure 3-1, bottom). This condition wa s observed in three independent Daxx -/MEF cell lines, suggesting Daxx may be important for accurate ch romosomal separation and/or cell division. Furthermore, upon paraffin-sectioning of E9.5 Daxx-deficient embryos and HOECHST staining of cells, an increased number of Daxx-deficient cells were observed in early mitosis, specifically pro-metaphase (Figure 3-1, top). In contrast, a smaller number of cells were observed in later stages of mitosis (anaphase, telophase and cyt okinesis) compared to corresponding wild type Daxx embryos. These findings suggest a potential involvement of Daxx in mitosis progression. To understand the extent of Daxx influence on the rate and timing of mitosis, the effect of Daxx-depletion on mitosis progression was an alyzed on HEp2 cells which were stably transfected with GFP-Histone H3 and a control siRNA (mouse Daxx) or human Daxx siRNA using fluorescence time-lapse microscopy. Cells expressing huma n Daxx siRNA were efficiently depleted of Daxx-prot ein levels, compared to control (Figure 3-2). Photo-toxicity associated with fluorescence microscopy limited the time interval of movies to one frame every 2 minutes. Using the precedent of Meraldi and coll eagues, key events in mitosis were monitored and timed based on chromosome condensation to nuclear envelope breakdown (prophase to prometaphase), nuclear envelope breakdown to centr al chromosome alignment (pro-metaphase to metaphase) and chromosome segregation (anaphase) (Meraldi et al., 2004). Results of this analysis are formulated in Table 3-1. Extending from the beginning of chromosomal condensation to nuclear envel ope breakdown, completion of propha se in Daxx-depleted cells was on average 31.4% faster (7.05 min +/2.64 min in Daxx siRNA, compared to 10.2 min +/39

PAGE 40

2.3 min in control siRNA) than control cells (Figure 3-3). Over all, condensation of chromosomes in Daxx-depleted cells occurred more rapidly and the ons et of pro-metaphase occurred sooner. The transition from nuclear envelope break down to chromosome segregation in anaphase was also 20.5% slower in Daxx-depleted cells (37.6 min +/10.36 min for Daxx siRNA, 31.2 min +/7.9 min for control siRNA) (Figure 3-3) Hence, absence of Daxx significantly influences the rate of early mito sis progression in HEp2 cells which emphasizes initial observations of increased pro-metaphase index in Daxx knockout embryos. To confirm that Daxx protein has a direct eff ect on cell cycle progression, HEp2 cells stably expressing control or Daxx siR NA were synchronized using a double thymidine block and then released to allow cells to progr ess through mitosis synchronously so mitotic cyclin B levels could be analyzed. Defective mitotic progression was seen in Daxx-deple ted cells as cyclin B levels were consistently sustained longer than wild-type (parental) or c ontrol siRNA cells (Figure 3-4). Specifically, during the time point of 9-9.5 hr re lease from thymidine block in wild type and control siRNA cells the majority of Cyclin B leve ls are destroyed, however, Cyclin B stability is preserved in Daxx siRNA cells past this time point until 10-10.5 hrs after thymidine release. These data implicate Daxx in the re gulation of mitotic progression, ei ther directly as a regulatory mitotic protein or indirec tly through other mechanisms. To rule out possible indirect mechanisms of Da xx regulation of mitosis, protein expression of several known mitotic proteins including Mad2, a key mitotic checkpoint protein; Cdc20 the activator of the anaphase promoting complex (APC)/cyclosome and Cdc27, a major subunit of the APC was analyzed and compared in contro land two independent Daxx-depleted HEp2 cell lines (Fig 3-5). By comparison, no significant ch anges in protein expression were observed in the presence or absence of Daxx, which supports micr oarray analysis from Daxx +/+ and Daxx -/40

PAGE 41

embryos which showed no apparent changes in mitotic protein expression (data not shown). Thus, there is little evidence to suggest Daxx can regulate transcri ption of known mitotic proteins. The expression of Daxx protein throughout different stag es of the cell cycle was also analyzed and found to change insi gnificantly (Figure 3-6). Thus, Daxx is a very stable protein throughout the cell cycle that has direct involvement in the re gulation of mitotic progression. Cell cycle-dependent protein localization of endogenous Daxx was analyzed in Daxx +/+ MEFs as they progressed into and through mitosis (Figure 3-7). A striking mitotic spindle-like association of Daxx was consistently observed in Daxx +/+ MEFs which was not present in Daxx -/cells beginning in pro-metaphase, upon nuclear envelope breakdown. Daxx was observed to localize in the nucleus in prophase typically at PML bodies, but by ear ly pro-metaphase, Daxx protein localization was redistribu ted to spindle structures as th ey were being formed (Figure 37). By late pro-metaphase, the majority of Daxx was distributed to the sp indle apparatus, away from PML. Biochemically, it is known that dur ing mitosis, PML bodies are de-sumoylated and the bulk of PML-associated proteins, including Daxx, leave during this time (Dellaire et al., 2006; Ishov et al., 2004). The spindle-like lo calization of Daxx is maintained through metaphase, but by the later stages of mitosis (anaphase to cytokinesis) this association is absent. Thus, Daxx is a spindle associated protein that is important for the correct timing of early mitosis progression in cells. 41

PAGE 42

Table 3-1. Statistical Analysis of Mitotic Pr ogression in Controla nd Daxx-Depleted H3-GFPHEp2 Cells. Peak time designates the most frequently occurring time of completion for each stage of mitosis. Stage RNAi Average Peak time Standard deviation Min Max Prophase Control 10.2 min 10 min 2.3 min 6 min 18 min Daxx 7.5 min 6 min 2.64 min 2 min 14 min Prometaphaseanaphase Control 31.2 min 28 min 7.9 min 22 min 58 min Daxx 37.6 min 32 min 10.36 min 22 min 78 min Figure 3-1. Characterization of Daxx -/Mouse Embryos and Cells. A) HOECHST immunohistochemical staining of Daxx +/+ and Daxx -/E9.5 mouse embryos. Mitotic stages are marked with small arrows. P/M=pro-metaphase, M=metaphase, A=anaphase, T=telophase. Apoptotic cells are marked with large arrowheads. B) Karyotype analysis of Daxx +/+ and Daxx -/MPEFs generated from E9.5 embryos. Daxx -/MPEFs exhibit aneuploidy. A B 42

PAGE 43

Figure 3-2. Western blot Analys is of Daxx Protein Level in HEp2-H3-GFP Cells Expressing Control-siRNA or Daxx-siRNA. Note efficient depletion of Daxx using Daxxspecific siRNAs compared to control siRNAs. A B Figure 3-3. Fluorescence time-lapse microscopy im ages of HEp2-H3-GFP cells expressing either control-siRNA or Daxx-siRNA. A) Pr ophase progression in control and Daxxdepleted cell lines. B) Mitotic progressi on from nuclear envel ope break-down (prometaphase) to chromosomal segregation (anaphase). 43

PAGE 44

Figure 3-4. Daxx depletion stabilizes Cyclin B during mitosis. Mitotic progression of synchronized wild type (parental) HEp2 cells, control-siRNA and Daxx-siRNA cell lines. Cells were synchronized using a double thymidine block and released and probed for Cyclin B protein levels at the indicated time points. Figure 3-5. Western Blot Analysis of Mitotic Proteins in Wild type (Parental), Control-siRNA and Two independent Daxx-siRNA Cell Line s. Protein expression did not differ significantly in the presence or absence of Daxx. 44

PAGE 45

Figure 3-6. Western Blot Analys is of Daxx Protein Levels Th roughout the Cell Cycle. HEp2 cells were synchronized in G1/S using a double thymidine block (DT) and then released from thymidine block for the indi cated times. Daxx pr otein levels change insignificantly throughout each cell cycle stage. A B Figure 3-7. Dynamics of Daxx Lo calization in Mitotic MPEF Cells. A) Localization of Daxx in prophase (at PML), pro-metaphase (spindles ), metaphase (spindles) and anaphasecytokinesis (no association). B) Change in localization of Daxx during early prometaphase (top picture) from PML bodies to the forming spindle apparatus. By late pro-metaphase (bottom picture), the major ity of Daxx is localized to the spindle apparatus. 45

PAGE 46

CHAPTER 4 DAXX IS A TRIGGER OF CELLULAR TAXOL RESPONSE Introduction The mitotic spindle checkpoint is a very fl uid and dynamic apparatus designed to monitor microtubule-kinetochore attachment and proper microtubule tension. In the event of an error occurring during pro-metaphase and metaphase, the spindle checkpoint will elicit a wait signal that stalls chromosomal segrega tion and anaphase onset until e rrors are corrected. Microtubuleinhibiting drugs such as taxol and nocodazole (among others) can initia te a prolonged wait signal that if uncorrected, init iates micronucleation (mitotic cata strophe) and cell death (Jiang et al., 2006; Mansilla et al., 2006a; Mansilla et al., 2006b; Ricci and Zong, 2006). Thus, subpopulations of cancer cells with deranged regulation of mitotic spindle checkpoint proteins and other associated factors can respond differen tly to these compounds offering a therapeutic molecular target for treating cancers. Howeve r, in most instances, inactivation or downregulation of mitotic checkpoint proteins leads to increased sensitivity to microtubule inhibiting drugs. In cases of BubR1 or Mad2 depletion, cell s treated with taxol re spond in a much stronger and robust way: the number of cells arrested in mitosis dramatically decreased and cell death was more rapid (Sudo et al., 2004). Cells lackin g Mad1, an important factor involved in the assembly of the spindle checkpoint, also exhib it increased sensitivity to taxol, however cells treated with nocodazole became mo re resistant (Kienitz et al., 2005). Thus, identification of novel regulators of taxo l sensitivitywhich ma y alter cellular response to these drugs by increasing resistanceis required. 46

PAGE 47

Discussion and Results Compounds that affect the mitotic spindle apparatus, including mi crotubule inhibitors such as paclitaxel (taxol) and nocodazole, are known to diffe rentially affect cells th at lack one or more mitotic spindle associated proteins compared to wild type cells. To further explore the potential role(s) of Daxx in mitosis and cell division, th e microtubule inhibitor taxol, which is a microtubule hyper-stabilizing compound and the tubulin-destabilizing drug nocodazole were used to examine response of Daxx +/+ and Daxx -/MEFs. A very striking and divergent response was observed between Daxx +/+ and Daxx -/mouse fibroblasts treated with taxol and nocodazole (Figure 4-1), which was not recapitulated when cells were treated with drugs such as roscovitine, adriamycin and etoposide (dat a not shown). The number of mitotic cells in Daxx +/+ MEFs was much lower compared to Daxx -/MEFs. Conversely, the occurrenc e of micronucleated cells in Daxx +/+ mouse fibroblasts was much higher in comp arison to Daxx-deficient cells. This evidence implies a Daxx-specific function which is inhib ited when cells are treated with taxol or nocodazole. The decrease in micronuclei and elev ated mitotic index also correlated with cell survival in Daxx deficient cells, producing 90 % of colonies after 24h of taxol treatment compared to untreated control, while the survival rate of Daxx +/+ cells was only 15%-approximately 6 times lower compared to Daxx -/cells (Figure 4-1). Given the similar time of cell cycle progression for both cell lines (not shown), the difference in colony formation most likely reflects a differential survival rate of cells upon drug exposure. Given that taxol is a very pot ent chemotherapy agent used to treat breast cancers and other malignancies, the role of taxol-i nduced cell death in breast cancer cells was examined with how this may correlate with the level of protei n Daxx. High heterogeneity of Daxx protein level among breast cancer cell lines was observed (Figure 4-2, normalized on actin). Daxx is a nuclear protein with obvious ND10/PML body association in interphase cells (Ishov et al., 1999); despite 47

PAGE 48

high variety in Daxx protein level, intracellular distribution of Daxx is similar in all breast cancer cell lines tested, showing Daxx co-localizing with PML (not shown) To study a correlation between Daxx and cellular response to paclitaxel, cell lines with extreme level of Daxx were chosen: T47D (low level of Daxx, Daxx/actin = 1.0) and MDA MB 468 (high level of Daxx, Daxx/actin = 14.0) and tested fo r paclitaxel induced cell deat h measured by colony formation assay. Increased survival of T47D cells was observed compared to MDA MB 468 cells (Figure 4-2). 24h of treatment reduces the survival of MDA MB 468 cells almost three fold, and at 48h of treatment very few colonies formed. 24h treatm ent had almost no effect on T47D cell survival rate and 48h treatment reduced the number of colonies only by 30%. Thus, low level of Daxx correlates with increased resistance to paclitax el treatment in these breast cancer cell lines. To address the mechanism of cell death and di fferential survival of breast cancer cell lines T47D and MDA MB 468 upon paclitaxel treatment, morphological change s that occurred with nuclei were observed at differe nt times of drug addition, which is effective means for discriminating between apoptosis and micronucl eation. Cells were categorized based on the nuclear morphology (Figure 4-2). In mock-treated conditions (control, Figure 4-3) the majority of cells were in interphase. The rate of accumu lation in mitosis at 12h is similar for both cell lines (Figure 4-3) that reflects almost an iden tical time of cell cycle progression. Already at 12h of treatment, 27% of micronucleated cells appe ar in MDA MB 468 cells and reaches 60% and 79% at 24h and 36h correspondingly (F igure 4-3, top graph), while only small portion of cells (20 and 8%) remains blocked in mitosis (Figure 4-3, middle graph). An insignificant number of T47D cells are micronucleated at 12h and 24h, reaching only 22% by 36h of treatment; most cells remain blocked in pro-metaphase during the course of treat ment. The level of apoptosis in both cell lines was negligible, reaching a maximu m of 2% and 7% correspondingly in T47D and 48

PAGE 49

MDA MB 468 after 36h of treatment (Figure 4-3, bottom graph); thus apoptosis is not the main mechanism of cell death for these cell lines at this drug concentration. Indeed, the process of apoptosis may occur as a secondary event or be more prominent (and is sometimes observed) in larger paclitaxel concentrationsbut this may be outside of any clini cal relevance (HernandezVargas et al., 2006; Wang et al., 1999). Furthermore, upon exposure of MDA MB 468 and T47D cells to increased paclitaxel concentra tions (100 nM and greater) sizeable increase in apoptotic levels or change in m itotic index/micronucleation could not be detected (Figure 4-4). This is in contrast to some reports showing that larger paclitaxel concentrations induce a more prominent mitotic checkpoint arrest and hence a stronger mitotic block in other cell lines (Giannakakou et al., 2001; Ikui et al., 2005). Similar results we re observed by FACS analysis (Figure 4-5): the majority of T47D cells accumula te in G2/M at 24h and 36h of treatment, while MDA MB 468 produce an extensive sub-G1 popul ation. Unfortunately, FACS does not allow discrimination between apoptotic and micronucleated cells as clea rly as microscopic analysis because both types of cell death result in fragme ntation of the nucleus (recognized as a sub-G1 population by FACS and thus counted together). Therefore, microscopy was the most useful approach to determine type of cell death after paclitaxel treatm ent. Thus, a major difference in paclitaxel response between these cell lines is the ability to maintain prometaphase block which is extended in T47D, but is brief in MDA MB 468 and is followed by micronucleation. Daxx was recently shown to interact with and regulate stability of p53, one of the key players in cell growth arrest and apoptosis (Tang et al., 2006; Zhao et al., 2004). Moreover, Daxx seems to differentially regulate p53 de pendent transcription under DNA da mage conditions in transient transfection assay, thus affecting the balance between ce ll cycle arrest and a poptosis (Gostissa et al., 2004). Stability of p53 and p53-dependent tran scription regulation, howe ver, were unaffected 49

PAGE 50

in primary human fibroblasts de pleted of Daxx and seems to be influenced instead by the JNK pathway during UV and H 2 O 2 treatment (Khelifi et al., 2005 ). Both T47D and MDA-MB 468 express mutant, transcriptionally inactive p53 (Concin et al., 2003); thus, differences in paclitaxel response between these cell lin es are most likely p53-independent. To further confirm Daxx dependent cell surv ival upon paclitaxel treatment, Daxx protein levels were depleted in MDA MB 468 breast cancer cells, in HEp2 human epithelial carcinoma cells (Figure 4-6) and in hu man fibroblast cell line WI38 by st able expression of anti-Daxx siRNA (data not shown). In the case of both anti-Daxx siRNA, we observed a marked decrease and slower rate of micronucleation and an increase in mitotic index (Figure 4-6). In all cases, the levels of apoptosis throughout this ongoing process were ne gligible (data not shown). Importantly, the decline in micronucleation and in crease of mitotic index observed in anti-Daxx siRNA cell lines correlated with an increased su rvival of cells under colony formation conditions (Figure 4-6). Thus, depletion of Daxx by siRNAs targeted against Daxx message in a variety of human cell lines reproduces the original finding th at level of Daxx is critical for paclitaxel response. The combination of these data allows the pr oposition of a model in which cells follow one of two paths in response to taxol and which is dependent on Daxx protein level: Daxx positive and taxol-sensitive cells will block in mitosis only transiently, followed by micronucleation, while Daxx deficient and taxol-resistant cells have prolonged mitotic block and continue proliferation after drug decay and microtubu le dynamics restoration, thus surviving chemotherapy. This model emphasizes Daxx as a trigger for cellular taxol responseparticularly in apoptosis-reluctant cells; cells lacking a functional Da xx protein display an increased resistance to taxane exposure. 50

PAGE 51

A B 0% 20% 40% 60% 80% 100%No Treatment10 uM Noc10 nM Pac Daxx +/+ Daxx -/0% 10% 20% 30% 40% 50% 60%No Treatment10 uM Noc10 nM Pac Daxx +/+ Daxx -/C Figure 4-1. Differen tial Response of Daxx +/+ and Daxx -/MEFs to Microtubule Inhibitors Nocodazole and Paclitaxel. A) Mitotic i ndex of MEFs treated with 10 M nocodazole or 10 nM paclitaxel for 24 hrs. Cells were fixed and stained with phospho-H3 antibody to characterize mitosis. B) Corresponding percentage of micronuclei formation in cells treated with nocodazole or paclitaxel for 24 hrs. C) Immunostaining of Daxx +/+ and Daxx -/MEFs treated with paclitaxel using mitotic markers phospho-H3 and lamin. Note occurrence of mitotic cells (b ig arrowheads) in Daxx -/cells and micronuclei (small arrows) in Daxx +/+ cells. 51

PAGE 52

Figure 4-2. Colony Formation of Breast Cancer Cells After Paclitax el Treatment is DaxxDependent. A) differential Daxx expression among breast cancer cell lines. Daxx accumulation normalized by actin (bottom). B) & C): MDA MB 468 (high Daxx) and T47D (low Daxx) were treated with 10 nM paclitaxel for 24h or 48h. Colonies were fixed and stained with crystal violet and calculated 5 days after drug withdrawal. Note differential taxol response (% of survival) between MDA MB 468 and T47D. 52

PAGE 53

C B Ainterphase metaphase micronuclei apoptosis % of Micronuclei0% 1% 4% 22% 0% 27% 60% 79%0% 10% 20% 30% 40% 50% 60% 70% 80% 90% Control 12h 24h 36h T47D MDA-MB 468 % of Mitotic Cells3% 38% 62% 59% 4% 29% 20% 8%0% 10% 20% 30% 40% 50% 60% 70% Co ntrol 12h 24h 3 6h T47D MDA-MB 468 % of Apoptotic Cells0% 0% 0% 2% 0% 3% 5% 7%0% 1% 2% 3% 4% 5% 6% 7% 8% 9% 10%Con t r o l 1 2h 24h 3 6 h T47D MDA-MB 468 Figure 4-3. Response to Paclitaxel Treatment in Breast Cancer Cell Lines with Different Daxx Level. MDA MB 468 (high Daxx) and T47D (low Daxx) were treated with 10 nM paclitaxel for 12h, 24h or 36h or mock-tr eated (control). DNA was stained with HOECHST 33342. A) Cells were categorized as interphase, mitotic, micronucleated, and apoptotic based on the nuc lear morphology. B) Mitotic cel ls in control: asterisks; micronucleated cells: big arrowheads; pro-me taphase cells: arrows ; apoptotic cells: small arrowheads. While micronuclei appear in MDA MB 468 already after 12h of treatment, majority of T47D cells remain in pro-metaphase after 36h of treatment. C) Relative accumulation of mito tic cells, micronucleated a nd apoptotic cells in MDA MB 468 and T47D cells. The majority of MDA MB 468 cells execute micronucleation, while T47D are accumulate d in pro-metaphase. For each time point one thousand cells were counted. 53

PAGE 54

A B Mitotic Cells0% 10% 20% 30% 40% 50% 60% 70% 0h12h24h36h MDA MB 468 T47D Micronuclei0% 10% 20% 30% 40% 50% 60% 70% 0h12h24h36h MDA MB 468 T47D C Apoptosis0% 5% 10% 15% 20% 25%0h12h24h36h MDA MB 468 T47D Figure 4-4. Response of MDA MB 468 and T47D Breast Cancer Cell Lines to Increased Concentration of Paclitaxel. MDA MB 468 and T47D cell lines were treated with 100 nM paclitaxel for 12h, 24h and 36h or mo ck treated (control). A) DNA was stained with HOECHST 33342 and cells were characterized as being mitotic, B) micronuclei or C) apoptotic, based on nuc lear morphology. Cellular response to paclitaxel between these two cell lines remained relatively unchanged despite increased paclitaxel concentr ations. Note: apoptosis does not significantly increase with elevated concentrations of paclitaxel. 54

PAGE 55

A B T47D0% 20% 40% 60% 80% 100%c o ntro l 12 h 24 h 36 h G1 S G2/M Ap/Mic MDA-MB 4680% 20% 40% 60% 80% 100%control 12 h 24h 3 6h G1 S G2/M Ap/Mic Figure 4-5. FACS Analysis of Ce ll Cycle Distribution af ter Paclitaxel Treatment. A) T47D and B) MDA MB 468 cells were treated with 10nM paclitaxel for the indicated time and sorted as G1 phase, S phase, G2/M phase, and apoptotic + micronucleated (Ap/Mic). While the majority of T47D cells accumu late in G2/M after 36h of treatment, MDAMB 468 cells are mostly apoptotic + micronucle ated at this time point. Unfortunately, FACS does not allow discrimination between apoptotic and micronucleated cells. 55

PAGE 56

A B C D Figure 4-6. Paclitaxel Response is Daxx-Dependent. A) Western blot analysis of Daxx depletion in MDA MB 468 and HEp2 cells. B) Mitotic index of parental MDA MB 468 (left) and HEp2 cells (right) expressing two independe nt anti-Daxx siRNAs or control siRNA which were synchronized via double th ymidine block and then released and treated with 10 nM paclitax el for 12, 18 and 24 hrs. C) Same as (B) except micronucleated cells are shown. D) Reduc tion of Daxx increases cell survival during paclitaxel treatment. Cells treated in (B ) and (C) were set up for colony formation assay and allowed to grow for 5 days. Col onies were then counted after fixation and staining with crystal violet. Apoptosis, as a result of pacl itaxel exposure, was negligible across all of these diffe rent cell lines (d ata not shown). 56

PAGE 57

CHAPTER 5 DAXX INTERACTS WITH RAS-ASSOCIATI ON DOMAIN FAMILY 1 (RASSF1) WHICH COOPERATE IN CELLULAR TAXOL RESPONSE Introduction Several lines of evidence suggest Daxx is important for proper timing of mitotic progression and that paclitaxel (taxol) resistance can be dependent on the level of Daxx protein in cells. Firstly, cells generated from Daxx-defi cient embryos exhibit genomic instability while tissue sectioning of E9.5 Daxx-deficient mouse em bryos shows an accumulation of cells in early mitosis (specifically pro-metaphase). Targeted depletion of Daxx also results in alteration of mitotic progression during prophase and the pr o-metaphase to anaphase transitions. Additionally, proper degradation of Cyclin B in synchronized Daxx-depleted cells is altered. Importantly, cells that are deficient or depleted of Daxx was proven to provide resistance to the microtubule inhibiting drug taxol by arresting cells in mitosis; cells with a functional Daxx protein have a shortened mitotic arrest resulting in mi cronucleation and cell d eath (Lindsay et al., 2007). Discussion and Results To further investigate Daxx m itotic function and to study the potential mechanism by which Daxx regulates taxol response during mitosis a s earch for Daxx-interacting proteins using Daxx as bait in a yeast two-hybrid screen was performed. Several yeast two-hybrid screens have been used in the past using Daxx as both bait and prey. The majority of these screens have used, or have identified through their sc reens, the carboxyl-terminal region of Daxx (corresponding with PMLand Fas-interacting doma ins) which also contains a region of Daxx 57

PAGE 58

known to interact with sumoylat ed proteins (Pluta et al., 1998 ; Yang et al., 1997). Since yeast themselves frequently use sumoylation for prot ein-protein interactions this can potentially explain the frequent occurrence of Daxx-fals e positives from yeast two hybrid screens (Michaelson, 2000). For this analysis, the ami no-terminal region of Daxx was used which has previously not been adapted for yeast two-hybrid screens. This novel approach identified several proteins with functional implications in the re gulation of cell division and mitosis. Sequence analysis of two particularly st rong interaction clones revealed homology with amino acids 5-270 and 30-270 of mouse RAS associated domain family 1 splice form C (Rassf1C) (Figure 5-1). Retransformation and -gal reporter assay confirmed the specifi city of this interaction in yeast, pointing at the amino -terminus of Daxx as a poten tial region of Rassf1 in teraction (Figure 5-1). DMAP1 (DNA methyltransferase associated protein 1) that was recently shown to interact with Daxx (Muromoto et al., 2004) was us ed as positive control in these experiments. Rassf1 is a highly conserved throughout specie s and its locus is frequently altered in human cancer. Among several alternative splice form s, Rassf1A and Rassf1C are the most abundantly expressed. Both Rassf1A and Rassf1C are tubulin-associated protei ns which influence the overall stability and dynamics of microtubules (Liu et al., 2003). Wh ile Rassf1C function is relatively unknown, Rassf1A has recently been shown to regulate early mitosis progression, particularly during prometaphase (Song et al., 2004). In addition, Rassf1A over-expres sion leads to mitotic arrest and inhibition of colony growth (Liu et al., 2003). Daxx -/embryos showed an increased accumulation of cells in pro-metaphase, suggesting that Daxx could cooperate with Rassf1A functi on during pro-metaphase. In light of the known properties of both Rassf1A and Rassf1C on the in fluence of microtubules, the potential interplay of Daxx and Rassf1 binding could also partially explain alterations in sensitivity of Daxx58

PAGE 59

depleted cells to taxol, a known microtubule-interfering compound. Interaction mapping between Daxx, Rassf1C and Rassf1A and deletion mutants was analyzed with proteins in vitro using a pull-down assay and by co-l ocalization of GFP and RFP fusi on proteins in cells (Figure 5-2). Interaction between Daxx and Rassf1 was tested by incubation of immobilized 6His-fusion Rassf1C with GST-Daxx and GST alone (Figure 5-2). Rassf1C associat es only with GST-Daxx and does not associate with GST control that in dicates specificity of Rassf1C-Daxx interaction. All truncation mutant s of Daxx, including first 142 amino acids of protein, were co-purified with Rassf1C wt suggesting that region of Rassf1 interaction is located at the amino terminus of the Daxx protein, thus confirming yeast two-hybrid da ta (Figure 5-2). Co-localization was observed between Rassf1C-RFP and GFP-fused Daxx wt a nd Daxx amino terminal deletion mutants but not with a carboxyl terminus mutant of Daxx (amino acids 625-740), further pointing at the amino terminus of Daxx as the minimal Rassf1 interacting domain. GFP-Daxx does not co-localize w ith RFP-Rassf1A wt or with a Rassf1A mutant that covers aa 120-340 which is homologous between Rassf1A and Rassf1C, but GFP-Daxx co-localizes with the first 50 amino acids of RFP-Rassf1C that are unique for this splice variant. Moreover, the first 142 amino acids of Daxx can also co -localize with this domain of Rassf1C. In conclusion, the interaction between Rassf1 and Da xx is facilitated by the first 50 unique amino acids of Rassf1C; in combination with a minimal clone purified in a y east two-hybrid analysis (which encodes amino acids 30 to 270 of Rassf 1C) the potential minimal region of interaction can likely be narrowed down to amino acids 30-50 of Rassf1C. Therefore, Daxx interacts with Rassf1C, but not Rassf1A. Considering these data, it was hypothesized that Daxx may coope rate with Rassf1A functioning in mitosis via an interaction with Ra ssf1C. This model assumes that two alternative 59

PAGE 60

spliced proteins, Rassf1A and Rassf1C, can interact with each other and have similar localization during mitosis or throughout the cell cycle. It was found that GST-Rassf1A could bind 6HisRassf1C in a pull-down assay (Figure 5-2B). Fu rthermore, a Rassf1A mutant (aa 194-340) could still efficiently bind Rassf1C (Figure 5-2B). A dditional evidence of inte raction was obtained by co-localization of GFPand R FP-fused Rassf1A/Rassf1C. Co-loc alization between Rassf1C and amino acids 194-258 of Rassf1A indicates smallest region of interact ion. Fluorescence timelapse microscopy of HEp2 cells expressing GFP-Ra ssf1A wt or GFP-Rassf1C wt also revealed similar localization throughout the cell cycle implying a potentia lly constant association of Rassf1A-Rassf1C proteins (dat a not shown). Thus, the minimal amino acids necessary for Rassf1A-Rassf1C interaction lik ely resides within the common Ras-Association (RA) domain shared by both splice forms of Rassf1, which conf irms hetero-dimer formation of Rassf1A and Rassf1C and also opens the possibility of homo-d imer formation between each of these isoforms. To confirm the endogenous interaction of Daxx and Ra ssf1, double immunofluorescent staining of Daxx and Rassf1C was performed in HEp2 cells where these two proteins were found to be distinctly separated during interphase (Figure 5-3) with Daxx staining relegated strictly to the nucleus (at PML bodies) and Rassf1C staining localized strictly to a microtubule-network pattern. This is in contrast to some reports suggesting Rassf1C is a nuclear protein that may interact with Daxx at PML (Kitaga wa et al., 2006). To confirm the differential localization of Daxx and Rassf1 in cells, biochemical separation of HEp2 cells into nuclear and cytosolic fractions was performed as well as 3D-confocal imaging of transiently over-expressed GFPRassf1A, GFP-Rassf1C and GFPDaxx (Figure 5-3 B & C). Daxx was found to be largely a nuclear associated protein while Rassf1A app eared strictly in the cytosolic fraction by biochemical separation. Three-dimensional c onfocal analysis of Daxx and Rassf1 cellular 60

PAGE 61

localization showed Daxx to be a strictly nuclear associated protein, as expected. In stark contrast, both GFP-Rassf1A and GFP-Rassf1C displayed cytoplasmic distribution in a microtubule-like network with no GFP-fluorescen ce emanating from the nucleus. Thus, Daxx and Rassf1 are compartmentally separated protei ns during interphase. Co-localization of endogenous Daxx and Rassf1, however, was obs erved in HEp2 cells progressing through mitosisdemonstrating the cell cycl e regulated interaction between these proteins (Figure 5-4). Co-localization of Daxx and Rassf1 was observe d beginning in pro-metaphase and metaphase, but by later stages of mitosis this association could not be detected. To understand the cell cycle regulated intera ction of Daxx and Rassf1 during mitosis and cellular paclitaxel response, stable expressing Rassf1A-siRNA was introduced into HEp2 cells which efficiently deplete Rassf1A protein level (Figure 5-5). While Ra ssf1A-depleted cells could be easily generated, over-exp ression of Rassf1A leads to cell to xicity and inhibition of cell proliferation independent of Rassf1A-functioning in cells. Therefore these studies focused primarily on protein-depleted cel l lines. In combination with control and anti-Daxx siRNA HEp2 lines, anti-Rassf1A siRNA HEp2 cells were expo sed to 10 nM paclitaxel for 6-18 hrs and then replated for colony formation a ssay (Figure 5-5). Strikingly, in the case of both Daxxand Rassf1A-depleted cells, paclitaxel resistance was similar. Both cell lines exhibited a strong paclitaxel resistant phenotype with the majority of treated cells (75-80%) capable of dividing and forming colonies after removal of taxol. To gain a biochemical unders tanding of how mitotic cells respond to paclitaxel in the absence of Daxx or Rassf1A, control-, Daxxand Rassf1Adepleted cells were synchronized using a double t hymidine block and then released and exposed to taxol for 6-18 hrs and collected for Western-blot evaluation of Cyclin B protein levels (Figure 5-6). Wild type (parental) and control-siRNA cells revealed an accumulation of Cyclin B as 61

PAGE 62

cells entered mitosis, but a marked drop-off in Cyclin B protein level ensued indicating cell exit from mitosis in the later stages of paclitaxel treatment. In contrast, Daxxand Rassf1A-siRNA cells showed a similar accumulation of Cyclin B but these levels were maintained throughout the course of the experiment, indicating cells were still arrested in mitosis. Thus, Daxx and Rassf1A are necessary for efficient cellular response to paclitaxel which in cludes entry into and exit from mitosis during treatment. Sustained Cyclin B protein leve ls in response to mitotic st resses like paclitaxel is an indication of prolonged spindle checkpoint ac tivation (Musacchio and Salmon, 2007). During normal cellular response to paclitaxel, cells will tran siently arrest in mitosis due to an activated spindle checkpoint but will exit mitosis by degradi ng mitotic substrates (i.e. Cyclin B) because taxol-generated errors (i.e. microtubular tensi on, unattached kinetechores ) cannot be corrected. In the absence of Daxx or Rassf1A, cells remain in a prolonged mitotic block as evidenced by sustained Cyclin B protein leve ls. Many different regulatory proteins are involved in proper spindle checkpoint operati on, including the Aurora kinases, a fa mily of serine/threonine kinases that are highly conserved phylogenetically. Specifically, Aurora A and Aurora B are involved in the proper placement and localizatio n of key mitotic checkpoint prot eins (Ditchfield et al., 2003) and absence or depletion of Aurora kinases cau ses spindle checkpoint-ove rride (Fu et al., 2007). Therapeutically, it would be advantageous to targ et Aurora kinases in tumors because Aurora A and Aurora B are frequently up-regulated in cancers (Keen and Taylor, 2004). As a result, several Aurora kinase inhibitors are in phase I & II clinical trials to eval uate their efficacy as chemotherapeutic agents (Agnese et al., 2007; K een and Taylor, 2004). Clinical strategies for enhancing paclitaxel response ar e continuously being studied a nd developed and one potential method involves the use of taxol in combination with Aurora kinase i nhibitors (Malumbres, 62

PAGE 63

2006). Current compounds, including ZM447439, hesp eradin and VX680, have been engineered to target the ATP binding site of Aurora kina ses which abolishes thei r kinase activity. In addition to paclitaxel, using these compounds has b een shown in cell-based assays to alter taxol response, even when spindle checkpoint proteins were absent (Morrow et al., 2005). Thus, the potentials of abrogating taxol resistance in comb ination with other compounds which target the mitotic spindle checkpoint are promising. In order to determine if Daxxand Rassf1A -mediated taxol response can be altered by inhibition of Aurora kinase activity, control, Daxxand Rassf1A-depleted HEp2 cells were treated with taxol in combination with two indepe ndent Aurora kinase inhibitors (Figure 5-7). Compounds used in this study were ZM447439, whic h targets Aurora A and Aurora B kinase activity and Aurora kinase inhi bitor III, which targets Aurora A kinase activity. After synchronization with a double thymidine block and a six hour release, cont rol and experimental cell lines were exposed to pacl itaxel alone or paclitaxel in combination with ZM447439 or Aurora kinase inhibitor III for a period of six hours. After completion of drug exposure, cells were then replated for colony formation assay. Treatment of Daxxor Rassf1A-depleted HEp2 cells with paclitaxel alone typica lly resulted in a very robust taxol resistance, as evidenced by the 75-80% survival rate of these cell lines compared to only 46% of control cells (Figure 5-7). Strikingly, however, taxol resistance was abo lished in Daxxor Rassf1A-depleted HEp2 cells when treated in combination with ZM447439 or Aurora kinase inhibito r III, resulting in comparable cell survival with control cells (Daxx-siRNA 31%-42%, Rassf1A siRNA 38%-40% and control siRNA 29%-37%). Thus, in the abse nce of Daxx or Rassf1A, functional inactivation of the mitotic spindle checkpoint using Aurora kinase inhibitors can change cellular taxol response and abolish resistance. 63

PAGE 64

Figure 5-1. Daxx Interacts with Tumor Suppressor Ra ssf1 in Yeast. A) Schematics of Daxx and Rassf1 isoforms Rassf1A and Rassf1C along with mapping of clones identified through yeast two hybrid screening (Rassf 1C clone 1 corresponding to amino acids (aa) 5-270 of mouse Rassf1C, Rassf1C clone 2 corresponding to aa 30-270). Homology between Rassf1A and Rassf1C is also shown. B) Retransformation assay of Daxx and Rassf1C constructs. 1 = Ra ssf1C + pGBDC1 (empty vector), 2 = Rassf1C + Daxx wt, 3 = Rassf1C + Daxx C term, 4 = Rassf1C + Daxx C. C) Gal reporter assay measuring strength of inte raction between individual Rassf1 clones and Daxx wt and deletion mutants. Strong interaction between Rassf1 clone 2 is observed. DMAP (positive control for Daxx in teraction) was used as an evaluation for strength of interaction in this system. 64

PAGE 65

C Figure 5-1. Continued. 65

PAGE 66

A B (i) (ii) (iii) C Figure 5-2. Mapping of Daxx-Rassf1 Interaction. A) Diagram of human Daxx, Rassf1A and Rassf1C constructs used for mapping inte raction by co-localization (GFP and RFP) and in vitro pull down assay (GST and 6His). B) ( i) 6xHis pull down assay of GSTDaxx wt and 6xHis-Rassf1C wt. Immobilized 6xHis-Rassf1C wt was incubated with either GST or GST-Daxx wt. GST-Daxx wt but not GST alone binds 6xHis-Rassf1C wt. (ii) In similar experimental settings, all Daxx amino terminal constructs including aa 1-142 retain capacity to bind 6His-Rassf1C wt. (iii) 6His pull down assay of GSTRassf1A wt and mutants using immobilized 6His-Rassf1C wt. GST-Rassf1A wt/ mutants, GST-Daxx 1-142 and GST alone we re incubated with 6His-Rassf1C wt. GST-Daxx 1-142, GST-Rassf1A wt and mutants 120-340 and 194-340 bind to Rassf1C, while GST does not. C) Table summarizing interaction ( +, or ND for not determined) tested by co-localiza tion of GFP and RFP fusions or in vitro pull down assay (right in cell). 66

PAGE 67

A B C Figure 5-3. Cellular Distribution of Daxx and Rassf1 During Interp hase. A) Immunostaining of endogenous Rassf1C and Daxx in interphase HEp2 cells. B) Biochemical separation of nuclear and cytosolic fractions from HE p2 cells. Note nuclear association of Daxx and cytosolic association of Rassf1A. C) 3D confocal imaging of transiently overexpressed GFP-Rassf1A (far left), GFP-Rassf 1C (middle) and GFPDaxx (far right). Note the compartmentally separa ted expression of Daxx and Rassf1. 67

PAGE 68

A B C d Figure 5-4. Co-localization of Endogenous Da xx and Rassf1 During Mitosis in HEp2 Cells. HEp2 cells were immunostained with monoclonal Daxx 514 antibody and polyclonal Rassf1 antibody which detects both endogenous Rassf1A and Rassf1C. Rassf1 an Daxx co-localized during pro-metaphase and metaphase A) & B). C) By anaphase and later stages of mitosis, this association is absent. 68

PAGE 69

A B 0% 25% 50% 75% 10 0% HEp2 (parental) Control siRNA Daxx siRNARassf1A siRNA No Treatment 6 hr Taxol 12 hr Taxol 18 hr Taxol Figure 5-5. Depletion of Daxx or Ra ssf1A Desensitizes Cells to Pacl itaxel. A) Stable expression of anti-Rassf1A siRNA in HEp2 cells. Note depletion of Rassf1A protein compared e to parental cell lines. B) Pe rcentage of colonies formed from parental, control, Daxxand Rassf1A-depleted HEp2 cells which were synchronized using a double thymidin block and then released and exposed to p aclitaxel for the indicated time periods (6, 12, 18hrs). After treatment, cells were replated for colony formation assay. Note increased survival (paclitaxel resistan ce) of Daxxand Rassf1A-depleted cells compared to control a nd parental cell lines. 69

PAGE 70

Figure 5-6.Cyclin B Levels are Stabilized in Daxxand Rassf1A-Depleted Cells Treated with Taxol. Wild type (parental) HEp2, control and Daxxand Rassf1A-depleted cell lines were synchronized with a double thymidine bl ock, released and then exposed to tax for 6-18hrs. Cells were harvested at the indicated time points and probed for Cyclin B1 levels using anti-Cyclin B1 antibody (Santa Cruz). Protein levels were normalized within each siRNA cell line. Note increased relative stability of cyclin B1 (normalized to actin) in both Da xx and Rassf1A-depleted cell lines. ol 70

PAGE 71

0% 20% 40% 60% 80% 100% Daxx siRNARassf1A siRNAControl siRNA Taxol Taxol + ZM Taxol + AKIII Figure 5-7. Inactivation of the Mitotic Spindle Checkpoint Using Aurora Kinase Inhibitors Abolishes Taxol Resistance in Daxx-and Ra ssf1A-Depleted Cells. Percentage of tor colonies that were formed from control, Daxxand Rassf1A-depleted HEp2 cells which were synchronized using a double t hymidine block, released and exposed to taxol alone, or taxol in combination with ZM447439 (ZM) or Aurora kinase inhibi III (AKIII) for six hours is shown. Note taxo l resistance is abolished in Daxxand Rassf1A-depleted cells treated in combin ation with taxol and Aurora kinase inhibitors. 71

PAGE 72

CHAPTER 6 SUMMARY AND CONCLUSIONS Taxane chemotherapy is c ent options for many breast can e been et lass ug ied as a novel regu lator of paclitaxel res ponse in cell culture con x onsidered among the mo st active treatm cer patients, either alone or as adjuvant in combination with anthracyclins (O'Shaughnessy, 2005). Nevertheless, a large number of patients are resistant to ta xanes or become resistant to this therapy during treatment. Th e response rate of docetaxel is ~50% even after the first-line chemotherapy administration and it decreases to 20-30% in the secondor third-line administration (Bonneterre et al., 1999; Crown et al., 2004). A number of studies hav carried out to determine a genomic profile that co uld be predictive to taxane treatment (Chang al., 2003; Chang et al., 2005b; Iwao-Koizumi et al ., 2005; Mauriac et al., 2005; Miyoshi et al., 2004). However, an alternative approach to understand selective resistance to taxane treatment is to study mechanisms by which cells can resp ond to these drugs. Several molecular targets were reported, starting with mutations in and -tubulin that affect drug binding, increased expression of tubulin genes, and changes in th e synthesis or activity of tubulin interacting proteins (Hari et al., 2003a; Ha ri et al., 2003b; Wang and Cabral 2005). Recently, a new c of potential targets are being studi ed after it was suggested that in activation of m itotic proteins can contribute to the selective response of taxane treatment in vivo (Wassmann and Benezra, 2001). Thus, development of new genomic prognosis factors and in-depth understanding of dr activity on both a cellular and organismal level are needed for optimization of adjuvant therapy and proper patient stratification. To this end, Daxx was identif ditions. Primary mouse and hum an fibroblasts with experiment ally regulated levels of Dax show both strong and divergent responses to taxol (Figure 4-1). In the absence of Daxx, cells remain in a prolonged mitotic block, while wild t ype cells undergo a transi ent arrest in mitosis 72

PAGE 73

that is soon followed by micronucleation and cell death. Importantly, these observations were also recapitulated in MDA MB 468 and T47D breas t cancer cell lines with contrasting levels of Daxx expression (Figure 4-3). These divergent responses in taxol response are usually seen in cells deficient in mitotic checkpoint proteins or other regulators of cell division and until these current studies, Daxx has not been implicated as a regulatory pr otein of cell cycle progression. Table 6-1 summarizes a growing lis t of mitotic proteins and the cellular response to taxol when these proteins are absent or deregulated in cells. To date, loss of function of the majority of mitotic proteins, including Mad1, Mad2, Bub1 and BubR1, has shown enhanced response to paclitaxel in cell culture conditi ons. Identification of factors which may increase drug resistan are largely uncharacterized. Among the conclu sions of this study is that early mitosis progression is altered in cells lacking a functional Daxx protein. These observations ca tissue sectioning of Daxx ce me from ing re cycle. Dur in. To -/mouse embryos showing an incr eased number of cells in early mitotic stages (Figure 3-1) and were manifest ed from time-lapse microscopy studies analyz mitotic progression in Daxx-depleted cell lines (Figure 3-3, Table 3-1) and Cyclin B protein stability studies showing an alte red rate of cyclin degradation in anti-Daxx siRNA cells (Figu 3-4). Theoretically, alterations of this kind in cell cycle progression coul d, in part, explain the genomic instability that is observed in Daxx-de ficient mouse cells (Figure 3-1) as improper mitosis frequently leads to unfaithful chro mosome segregation (Chi and Jeang, 2007). Daxx localization is already unde rstood to be a very dynamic process during the cell ing G1 and G2, Daxx localizes to PML bodies, while during S phase, it relocates to condensed heterochromatin where it interacts w ith ATRX, a chromatin remodeling prote accompany this dynamic protein trafficking, these st udies have also revealed that Daxx, a known transcriptional regulator, can associate with th e mitotic spindle apparatu s during mitosis (Figure 73

PAGE 74

3-7). Accruing evidence suggests that the tight orchestration of events during mitosis combines seemingly unrelated factors at cr itical junctures during cellular division (Tsai et al., 2006). A number of essential interac tions occur during pro-metaphase when the nuclear envelope disintegrates and no longer compartmentalizes the nucleus and cytoplasm. During this tim Daxx is released from the nucleus where it is associated with ND10/PML bodies and accumulates at the mitotic spindle apparatus. It is at this spatiotemporal point that Dax with Rassf1 (Figure 5-4, Figure 6-1 summary). Future studies will reveal whether Daxx association with the spi ndle apparatus is dependent on presence of Rassf1. To accompany observations of Daxx-dependent p aclitaxel response, Ras e, x interacts sf1 was identified as a no ) and al s hase are s vel Daxx-interacting protein th at was also confirmed to be important for cellular taxol response (Figure 5-5). This interaction was ma pped to the C spliceform of Rassf1 (Rassf1C interaction between Rassf1A and Rassf1C by dime rization was also confirmed (Figure 5-2). These novel interactions are thought to form a complex during mitosis and may perform critic regulatory processes including prope r cellular response to mitotic stresses such as paclitaxel, nocodazole and other microtubule inhibiting compounds. These chemicals, moreover, can induce mitotic stress in several ways, depending on the stage of mitosis in which the stress i applied. Proper separation of the centroso mes during prophase, correct alignment of chromosomes during metaphase and faithful segregation of chromosomes during anap all processes which can be altered or affected when external stress (i.e. paclitaxel) is applied. Together, Daxx and Rassf1 define a unique mitotic stress checkpoint during pro-metaphase (Figure 6-2, summary). Cells lacking Daxx or Rassf1A arrest in pro-metaphase during taxol treatment. From time-lapse studies, it is sugge sted that Daxx-depleted cells have chromosome that remain unable to properly align at the me taphase plate under treatment conditions, thus 74

PAGE 75

remaining in pro-metaphase by definition. In c ontrast, with normal primary cells and some tumor cell lines, Daxx and Rassf1A may be essen tial for proper mitotic exit in response to uncorrectable errors during prometaphase. This is suggested by the very robust response o wild type cells which only tran siently arrest in pro-metaphase and then undergo micronucleati leading to cell death (Figure 4-3, Figure 4-6). One example of a mitotic stress checkpoint is already known with a protein named checkpoint with FHA and ring finger (CHFR). In the presence of CHFR, wild type ce lls exhibit a transient prophase arrest which temporarily prev cells from entering metaphase under mitotic stress (Scolnick and Halazonetis, 2000). Cells that do not have a functional CHFR protein were shown to enter metaphase without delay and exhibited problems in proper centrosome separa tion. Thus, CHFR defines a prophase-spec mitotic stress checkpoint at a stage in mitosis earlier than Daxx and Rassf1. Evidence accumulated in these studies suggest s Daxx and Rassf1 are trig f on ents ific gers for cellular taxo In an 5). l response. In the future Daxx and Rassf1 may serve as ideal molecular markers for the proper selection of breas t cancer patients (and other malignancies) for taxane chemotherapy. order to achieve this goal, clin ical studies will be required examining the status of Daxx and Rassf1 expression in tumors before and after taxane chemotherapy as well as in patients with established history of taxane re sistance. Altered Daxx or Rassf 1 expression may be reminiscent of the differential protein expression that may ex ist in the original tumor cells from which each cell line was derived. It is alr eady known that Daxx expression in some breast cancer cell lines is quite variable (Figure 4-1), but the extent of Daxx down-regul ation or mutation in tumor cell lines has not been addressed. Rassf1A expressi on in tumor cell lines, conversely, has been extensively studied and shown to be altered in a majority of cas es (Agathanggelou et al., 200 Ultimately, these studies have established new ro les for Daxx as a mitotic regulator that also 75

PAGE 76

serves as a trigger for cellular taxol response in combination with Rassf1 which adds to our understanding of mechanisms linking cell divi sion, genome instability and breast cancer progression. Table 6-1. Alteration of Several Known Mitoti c Proteins and Resultant Cellular Paclitaxel Response. Most mitotic proteins, when mu tated or down-regulated in cells, display y increased sensitivity to paclitaxel. In the absence of Daxx or Rassf1, cells displa increased drug resistance. Protein Paclitaxel Response Bub1 Inc reased Sensitivity (Lee et al., 2004; Sud o et al., 2004) n BubR1 Increased Sensitivity (Lee et al., 2004; Sudo et al., 2004) CHFR Increased Sensitivity (Satoh et al., 2003) Mad1 Increased Sensitivity (Kienitz et al., 2005) Mad2 Increased Sensitivity (Niikura et al., 2007) Survivi Increased Sensitivity (Carvalho et al., 2003) Daxx Increased Resistance (Lindsay et al., 2007) Rassf1 Increased Resistance 76

PAGE 77

Figure 6-1. Dynamics of Daxx-Rassf 1 Interaction Throughout the Cell Cycle. During interphase and beginning of mitosis (prophase), Daxx and Rassf1 are compartmentally separated in the cytoplasm and nucleus. After nuc lear envelope (NE) breakdown, Daxx and Rassf1 can interact throu gh Rassf1C. This associa tion is maintained through metaphase, but by late stages of mitosis, is absent. 77

PAGE 78

Figure 6-2. Model Depicting Daxx-Rassf1-Medi ated Mitotic Stress Checkpoint During Prometaphase. In wild type cells upon mitoti c stress (i.e. taxol or nocodazole) the spindle checkpoint will be act ivated. In rare cases, the cell may correct these errors, complete mitosis and resume cell prolifera tion. In most cases, however, these errors are uncorrected and the cell aborts mitosi s, undergoes micronuclei formation and cell death. In subpopulations of cancer cells which encounter mitotic stress and which do not have a functional Daxx or Rassf1 prot ein, these cells remain in a prolonged mitotic block, unable to efficiently abort m itosis, and remain in pro-metaphase until drug removal or decay. This model may partially explain inherent and acquired taxol resistance in some breast tumors. 78

PAGE 79

REFERENCES Aapro, M.S. (2001). Neoadjuvant th erapy in breast cancer: can we define its role? Oncologist 6 Suppl 3, 36-39. Agathanggelou, A., Cooper, W.N., and Latif, F. (2005). Role of the Ras-association domain family 1 tumor suppressor gene in human cancers. Cancer Res 65, 3497-3508. Agnese, V., Bazan, V., Fiorentino, F.P., Fanale, D., Badalamenti, G., Colucci, G., Adamo, V., Santini, D., and Russo, A. (2007). The role of Au rora-A inhibitors in cancer therapy. Ann Oncol 18 Suppl 6, vi47-52. Amaar, Y.G., Minera, M.G., Hatran, L.K., Str ong, D.D., Mohan, S., and Reeves, M.E. (2006). Ras association domain family 1C protein stimul ates human lung cancer cell proliferation. Am J Physiol Lung Cell Mol Physiol 291, L1185-1190. Bonneterre, J., Spielman, M., Guastalla, J.P., Marty, M., Viens, P., Chollet, P., Roche, H., Fumoleau, P., Mauriac, L., Bourgeois, H. et al. (1999). Efficacy and safety of docetaxel (Taxotere) in heavily pretreated advanced brea st cancer patients: the French compassionate use programme experience. Eur J Cancer 35, 1431-1439. Bothos, J., Summers, M.K., Venere, M., Scolnic k, D.M., and Halazonetis, T.D. (2003). The Chfr mitotic checkpoint protein functions with Ub c13-Mms2 to form Lys63-linked polyubiquitin chains. Oncogene 22, 7101-7107. Brown, J.M., and Wouters, B.G. (1999). Apoptosis p53, and tumor cell sensitivity to anticancer agents. Cancer Res 59, 1391-1399. Burbee, D.G., Forgacs, E., Zochbauer-Muller, S., Shivakumar, L., Fong, K., Gao, B., Randle, D., Kondo, M., Virmani, A., Bader, S. et al. (2001). Epigenetic inac tivation of RASSF1A in lung and breast cancers and malignant phe notype suppression. J Natl Cancer Inst 93, 691-699. Cahill, D.P., Lengauer, C., Yu, J., Riggins, G.J ., Willson, J.K., Markowitz, S.D., Kinzler, K.W., and Vogelstein, B. (1998). Mutations of mito tic checkpoint genes in human cancers. Nature 392 300-303. Carvalho, A., Carmena, M., Sambade, C., Earnsh aw, W.C., and Wheatley, S.P. (2003). Survivin is required for stable checkpoint activati on in taxol-treated HeLa cells. J Cell Sci 116 29872998. Chabalier, C., Lamare, C., Racca, C., Privat, M ., Valette, A., and Larminat, F. (2006). BRCA1 downregulation leads to premat ure inactivation of spindle ch eckpoint and confers paclitaxel resistance. Cell Cycle 5, 1001-1007. Chan, G.K., and Yen, T.J. (2003). The mitotic checkpoint: a signaling pathway that allows a single unattached kinetoc hore to inhibit mitotic exit. Prog Cell Cycle Res 5, 431-439. 79

PAGE 80

Chang, C.C., Lin, D.Y., Fang, H.I., Chen, R.H., and Shih, H.M. (2005a). Daxx mediates the small ubiquitin-like modifier-dependent transc riptional repression of Smad4. J Biol Chem 280, 10164-10173. Chang, J.C., Wooten, E.C., Tsimelzon, A., Hils enbeck, S.G., Gutierrez, M.C., Elledge, R., Mohsin, S., Osborne, C.K., Chamness, G.C., A llred, D.C., and O'Connell, P. (2003). Gene expression profiling for the prediction of therapeutic response to docetaxel in patients with breast cancer. Lancet 362, 362-369. Chang, J.C., Wooten, E.C., Tsimelzon, A., Hils enbeck, S.G., Gutierrez, M.C., Tham, Y.L., Kalidas, M., Elledge, R., Mohsin, S., Osborne, C.K. et al. (2005b). Patterns of resistance and incomplete response to docetaxel by gene expressi on profiling in breast cancer patients. J Clin Oncol 23, 1169-1177. Chaturvedi, P., Sudakin, V., Bobiak, M.L., Fisher P.W., Mattern, M.R., Jablonski, S.A., Hurle, M.R., Zhu, Y., Yen, T.J., and Zhou, B.B. (2002). Chfr regulates a mitotic stress pathway through its RING-finger domain with ubiquiti n ligase activity. Cancer Res 62, 1797-1801. Chen, E.S., Saitoh, S., Yanagida, M., and Takaha shi, K. (2003). A cell cycle-regulated GATA factor promotes centromeric localization of CENP-A in fission yeast. Mol Cell 11, 175-187. Chi, Y.H., and Jeang, K.T. (2007). Aneuploidy and cancer. J Cell Biochem 102, 531-538. Cleveland, D.W., Mao, Y., and Sullivan, K.F. (2003). Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 112 407-421. Concin, N., Zeillinger, C., Tong, D., Stimpf l, M., Konig, M., Printz, D., Stonek, F., Schneeberger, C., Hefler, L., Kainz, C. et al. (2003). Comparison of p53 mutational status with mRNA and protein expression in a panel of 24 human breast carcinoma cell lines. Breast Cancer Res Treat 79 37-46. Crown, J., O'Leary, M., and Ooi, W.S. (2004). Docetax el and paclitaxel in th e treatment of breast cancer: a review of clinical experience. Oncologist 9 Suppl 2 24-32. Croxton, R., Puto, L.A., de Belle, I., Thomas, M., Torii, S., Hanaii, F., Cuddy, M., and Reed, J.C. (2006). Daxx represses expression of a subset of antiapoptotic genes regu lated by nuclear factorkappaB. Cancer Res 66, 9026-9035. Dallol, A., Agathanggelou, A., Fenton, S.L., Ahmed-Choudhury, J., Hesson, L., Vos, M.D., Clark, G.J., Downward, J., Maher, E.R., a nd Latif, F. (2004). RASSF1A interacts with microtubule-associated prot eins and modulates microt ubule dynamics. Cancer Res 64 41124116. Dammann, R., Li, C., Yoon, J.H., Chin, P.L., Bate s, S., and Pfeifer, G. P. (2000). Epigenetic inactivation of a RAS associati on domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet 25, 315-319. 80

PAGE 81

Dammann, R., Yang, G., and Pfeife r, G.P. (2001). Hypermethylation of the cpG island of Ras association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21.3 locus, occurs in a large percentage of human breast cancers. Cancer Res 61 3105-3109. Dellaire, G., Eskiw, C.H., Dehghani, H., Ching, R.W., and Bazett-Jones, D.P. (2006). Mitotic accumulations of PML protein contribute to the re -establishment of PML nuclear bodies in G1. J Cell Sci 119 1034-1042. Ditchfield, C., Johnson, V.L., Tighe, A., Ellston, R., Haworth, C., Johnson, T., Mortlock, A., Keen, N., and Taylor, S.S. (2003). Aurora B couples chromosome alignment with anaphase by targeting BubR1, Mad2, and Cenp-E to kinetochores. J Cell Biol 161, 267-280. Donninger, H., Vos, M.D., and Clark, G.J. ( 2007). The RASSF1A tumor suppressor. J Cell Sci 120, 3163-3172. Ecsedy, J.A., Michaelson, J.S., and Leder, P. (2003). Homeodomain-interac ting protein kinase 1 modulates Daxx localization, phosphorylation, an d transcriptional activity. Mol Cell Biol 23, 950-960. Emelyanov, A.V., Kovac, C.R., Sepulveda, M.A., a nd Birshtein, B.K. (2002). The interaction of Pax5 (BSAP) with Daxx can resu lt in transcriptional activation in B cells. J Biol Chem 277, 11156-11164. Fenton, S.L., Dallol, A., Agathanggelou, A., Hesson, L., Ahmed-Choudhury, J., Baksh, S., Sardet, C., Dammann, R., Minna, J.D., Downward, J. et al. (2004). Identification of the E1Aregulated transcription factor p120 E4F as an interacting partner of the RASSF1A candidate tumor suppressor gene. Cancer Res 64 102-107. Fu, J., Bian, M., Jiang, Q., and Zhang, C. (2007) Roles of Aurora kinases in mitosis and tumorigenesis. Mol Cancer Res 5, 1-10. Giannakakou, P., Robey, R., Fojo, T., and Blagosklonny, M.V. (2001). Low concentrations of paclitaxel induce cell type-dependent p53, p21 a nd G1/G2 arrest instead of mitotic arrest: molecular determinants of paclita xel-induced cytotoxicity. Oncogene 20, 3806-3813. Gostissa, M., Morelli, M., Mantovani, F., Guida, E., Piazza, S., Collavin, L., Brancolini, C., Schneider, C., and Del Sal, G. (2004). The tr anscriptional represso r hDaxx potentiates p53dependent apoptosis. J Biol Chem 279, 48013-48023. Hannemann, J., Oosterkamp, H.M., Bosch, C.A., Veld s, A., Wessels, L.F., Loo, C., Rutgers, E.J., Rodenhuis, S., and van de Vijver, M.J. (2005). Changes in gene expression associated with response to neoadjuvant chemothera py in breast cancer. J Clin Oncol 23, 3331-3342. Hari, M., Wang, Y., Veeraraghavan, S., and Cabral F. (2003a). Mutations in alphaand betatubulin that stabilize microtubules and confer resistance to colcem id and vinblastine. Mol Cancer Ther 2, 597-605. 81

PAGE 82

Hari, M., Yang, H., Zeng, C., Canizales, M., and Ca bral, F. (2003b). Expression of class III betatubulin reduces microtubule assembly and c onfers resistance to paclitaxel. Cell Motil Cytoskeleton 56, 45-56. Haruki, N., Saito, H., Harano, T., Nomoto, S., Ta kahashi, T., Osada, H., and Fujii, Y. (2001). Molecular analysis of the m itotic checkpoint genes BUB1, BU BR1 and BUB3 in human lung cancers. Cancer Lett 162, 201-205. Henderson, I.C., Berry, D.A., Demetri, G.D., Ci rrincione, C.T., Goldstein, L.J., Martino, S., Ingle, J.N., Cooper, M.R., Hayes, D.F., Tkaczuk, K.H., et al. (2003). Improved outcomes from adding sequential Paclitaxel but not from escalating Doxor ubicin dose in an adjuvant chemotherapy regimen for patients with node-p ositive primary breast cancer. J Clin Oncol 21, 976-983. Hernandez-Vargas, H., Palacios, J., and Moreno-Bueno, G. (2006). Molecular profiling of docetaxel cytotoxicity in breas t cancer cells: un coupling of aberrant mitosis and apoptosis. Oncogene. Hollenbach, A.D., McPherson, C.J., Mientjes, E.J., Iyengar, R., and Grosveld, G. (2002). Daxx and histone deacetylase II associate with chromatin through an interaction with core histones and the chromatin-associated protein Dek. J Cell Sci 115, 3319-3330. Ikui, A.E., Yang, C.P., Matsumoto, T., and Horwitz S.B. (2005). Low concentrations of taxol cause mitotic delay followed by premature disso ciation of p55CDC from Mad2 and BubR1 and abrogation of the spindle checkpoint leading to aneuploidy. Cell Cycle 4 1385-1388. Ishov, A.M., Sotnikov, A.G., Negorev, D., Vladimir ova, O.V., Neff, N., Kamitani, T., Yeh, E.T., Strauss, J.F., 3rd, and Maul, G.G. (1999). PML is critical for ND10 form ation and recruits the PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J Cell Biol 147, 221-234. Ishov, A.M., Vladimirova, O.V., and Maul, G.G. (2004). Heterochromatin and ND10 are cellcycle regulated and phosphorylati on-dependent alternate nuclear sites of the transcription repressor Daxx and SWI/SNF protein ATRX. J Cell Sci 117, 3807-3820. Iwao-Koizumi, K., Matoba, R., Ueno, N., Kim, S.J., Ando, A., Miyoshi, Y., Maeda, E., Noguchi, S., and Kato, K. (2005). Prediction of docetaxel response in human breast cancer by gene expression profiling. J Clin Oncol 23, 422-431. Jiang, N., Wang, X., Yang, Y., and Dai, W. (2006). Advances in mitotic in hibitors for cancer treatment. Mini Rev Med Chem 6, 885-895. Jung, Y.S., Kim, H.Y., Kim, J., Lee, M.G., Pouyssegur, J., and Kim, E. (2008). Physical interactions and functional coupling between Daxx and sodi um hydrogen exchanger 1 in ischemic cell death. J Biol Chem 283, 1018-1025. Jung, Y.S., Kim, H.Y., Lee, Y.J., and Kim, E. (2007). Subcellular localization of Daxx determines its opposing functions in ischemic cell death. FEBS Lett 581, 843-852. 82

PAGE 83

Junn, E., Taniguchi, H., Jeong, B.S., Zhao, X., Ichijo, H., and Mouradian, M.M. (2005). Interaction of DJ-1 with Daxx inhibits apoptosis signal-regulating kina se 1 activity and cell death. Proc Natl Acad Sci U S A 102, 9691-9696. Kang, D., Chen, J., Wong, J., and Fang, G. (2002). The checkpoint protein Chfr is a ligase that ubiquitinates Plk1 and inhibits Cdc2 at the G2 to M transition. J Cell Biol 156, 249-259. Karunakaran, S., Diwakar, L., Saeed, U., Agar wal, V., Ramakrishnan, S., Iyengar, S., and Ravindranath, V. (2007). Activation of apoptos is signal regulating ki nase 1 (ASK1) and translocation of death-associated protein, Daxx, in substantia nigra pars compacta in a mouse model of Parkinson's disease: protection by alpha-lipoic acid. FASEB J 21 2226-2236. Keen, N., and Taylor, S. (2004). Aurora-kinase inhibitors as an ticancer agents. Nat Rev Cancer 4, 927-936. Khelifi, A.F., D'Alcontres, M.S., and Salomoni P. (2005). Daxx is required for stress-induced cell death and JNK activa tion. Cell Death Differ 12, 724-733. Kienitz, A., Vogel, C., Morales, I., Muller, R., and Bastians, H. (2005). Partial downregulation of MAD1 causes spindle checkpoint inactivation and aneuploidy, but does not confer resistance towards taxol. Oncogene 24, 4301-4310. Kiriakidou, M., Driscoll, D.A., Lopez-Guisa, J. M., and Strauss, J.F., 3rd (1997). Cloning and expression of primate Daxx cDNAs and mapping of the human gene to chromosome 6p21.3 in the MHC region. DNA Cell Biol 16 1289-1298. Kitagawa, D., Kajiho, H., Negishi, T., Ura, S., Watanabe, T., Wada, T., Ichijo, H., Katada, T., and Nishina, H. (2006). Release of RASSF1C fr om the nucleus by Daxx degradation links DNA damage and SAPK/JNK activation. EMBO J 25, 3286-3297. Ko, Y.G., Kang, Y.S., Park, H., Seol, W., Kim, J., Kim, T., Park, H.S., Choi, E.J., and Kim, S. (2001). Apoptosis signal-regulating kinase 1 co ntrols the proapoptotic function of deathassociated protein (Daxx) in the cytoplasm. J Biol Chem 276, 39103-39106. Kroemer, G., and Martin, S.J. (2005). Caspase-independent cell death. Nat Med 11, 725-730. Lalioti, V.S., Vergarajauregui, S., Pulido, D., and Sandoval, I.V. (2002). The insulin-sensitive glucose transporter, GLUT4, inte racts physically with Daxx. Two pr oteins with capacity to bind Ubc9 and conjugated to SUMO1. J Biol Chem 277, 19783-19791. Lee, E.A., Keutmann, M.K., Dowling, M.L., Harris, E., Chan, G., and Kao, G.D. (2004). Inactivation of the mitotic checkpoint as a dete rminant of the efficacy of microtubule-targeted drugs in killing human can cer cells. Mol Cancer Ther 3, 661-669. Lehembre, F., Muller, S., Pandolfi, P.P., and Dejean, A. (2001). Regulation of Pax3 transcriptional activity by SUMO-1-modified PML. Oncogene 20, 1-9. 83

PAGE 84

Lens, S.M., Wolthuis, R.M., Klompmaker, R., Ka uw, J., Agami, R., Brummelkamp, T., Kops, G., and Medema, R.H. (2003). Survivin is require d for a sustained spindle checkpoint arrest in response to lack of tension. Embo J 22 2934-2947. Li, H., Leo, C., Zhu, J., Wu, X., O'Neil, J., Par k, E.J., and Chen, J.D. (2000). Sequestration and inhibition of Daxx-mediated transcrip tional repression by PML. Mol Cell Biol 20, 1784-1796. Li, W., Zhu, T., and Guan, K.L. (2004). Transfor mation potential of Ras isoforms correlates with activation of phosphatidylinositol 3kinase but not ERK. J Biol Chem 279, 37398-37406. Lin, D.Y., Lai, M.Z., Ann, D.K., and Shih, H.M. (2003). Promyelocytic leukemia protein (PML) functions as a glucocorticoid receptor co-activator by sequest ering Daxx to the PML oncogenic domains (PODs) to enhance its trans activation potential. J Biol Chem 278, 15958-15965. Lindsay, C.R., Scholz, A., Morozov, V.M., and Ishov, A.M. (2007). Daxx shortens mitotic arrest caused by paclitaxel. Cell Cycle 6, 1200-1204. Liu, L., Amy, V., Liu, G., and McKeehan, W.L. (2002). Novel complex integrating mitochondria and the microtubular cytoskeleton with chromo some remodeling and tumor suppressor RASSF1 deduced by in silico homology analysis, interac tion cloning in yeast, and colocalization in cultured cells. In Vitro Cell Dev Biol Anim 38, 582-594. Liu, L., Baier, K., Dammann, R., and Pfeifer, G.P. (2007). The tumor suppressor RASSF1A does not interact with Cdc20, an activator of the anaphase-promoting complex. Cell Cycle 6 16631665. Liu, L., Tommasi, S., Lee, D.H., Dammann, R., and Pfeifer, G.P. (2003). Control of microtubule stability by the RASSF1A tumor suppressor. Oncogene 22, 8125-8136. Malumbres, M. (2006). Therapeutic opportunities to control tumor cell cycles Clin Transl Oncol 8, 399-408. Mansilla, S., Bataller, M., and Portugal, J. (2006a). Mitotic catastrophe as a consequence of chemotherapy. Anticancer Agents Med Chem 6, 589-602. Mansilla, S., Priebe, W., and Portugal, J. (2006b) Mitotic catastrophe re sults in cell death by caspase-dependent and caspase-independent mechanisms. Cell Cycle 5, 53-60. Mauriac, L., Debled, M., and MacGrogan, G. (2005) When will more useful predictive factors be ready for use? Breast 14 617-623. Meraldi, P., Draviam, V.M., and Sorger, P.K. (2004). Timing and checkpoints in the regulation of mitotic progression. Dev Cell 7, 45-60. Michaelson, J.S. (2000). The Daxx enigma. Apoptosis 5, 217-220. 84

PAGE 85

Michaelson, J.S., Bader, D., Kuo, F., Kozak, C., and Leder, P. (1999). Loss of Daxx, a promiscuously interacting protein, results in ex tensive apoptosis in ea rly mouse development. Genes Dev 13, 1918-1923. Michaelson, J.S., and Leder, P. (2003). RNAi reveals anti-apoptotic and transcriptionally repressive activities of DAXX. J Cell Sci 116, 345-352. Miyoshi, Y., Kim, S.J., Akazawa, K., Kamigaki S., Ueda, S., Yanagisawa, T., Inoue, T., Taguchi, T., Tamaki, Y., and Noguchi, S. (2004) Down-regulation of intratumoral aromatase messenger RNA levels by docetaxel in hum an breast cancers. Clin Cancer Res 10, 8163-8169. Morrow, C.J., Tighe, A., Johnson, V.L., Scott, M. I., Ditchfield, C., and Taylor, S.S. (2005). Bub1 and aurora B cooperate to maintain BubR 1-mediated inhibition of APC/CCdc20. J Cell Sci 118, 3639-3652. Morse, D.L., Gray, H., Payne, C.M., and Gillies, R.J. (2005). Docetax el induces cell death through mitotic catastrophe in human breast cancer cells. Mol Cancer Ther 4, 1495-1504. Muromoto, R., Sugiyama, K., Takachi, A., Imot o, S., Sato, N., Yamamoto, T., Oritani, K., Shimoda, K., and Matsuda, T. (2004). Physical and functional interactions between Daxx and DNA methyltransferase 1-associ ated protein, DMAP1. J Immunol 172, 2985-2993. Musacchio, A., and Salmon, E.D. (2007). The spi ndle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol 8 379-393. Nefkens, I., Negorev, D.G., Ishov, A.M., Michaelson, J.S., Yeh, E.T., Tanguay, R.M., Muller, W.E., and Maul, G.G. (2003). Heat shock and Cd2+ exposure regulate PML and Daxx release from ND10 by independent mechanisms that modify the induction of heat-shock proteins 70 and 25 differently. J Cell Sci 116 513-524. O'Shaughnessy, J. (2005). Extending survival with chemotherapy in metastatic breast cancer. Oncologist 10 Suppl 3 20-29. Perlman, R., Schiemann, W.P., Brooks, M.W., Lodish, H.F., and Wei nberg, R.A. (2001). TGFbeta-induced apoptosis is mediated by the adapte r protein Daxx that faci litates JNK activation. Nat Cell Biol 3, 708-714. Pines, J. (2006). Mitosis: a matte r of getting rid of the right prot ein at the right time. Trends Cell Biol 16, 55-63. Pluta, A.F., Earnshaw, W.C., and Goldberg, I.G. (1998). Interphase-specific association of intrinsic centromere protein CENP-C with HDaxx, a death domain-binding protein implicated in Fas-mediated cell death. J Cell Sci 111 ( Pt 14) 2029-2041. Ravdin, P., Erban, J., and Overmoyer, B. ( 2003). Phase III comparison of docetaxel and paclitaxel in patients with meta static breast cancer. Eur J Cancer suppl1:32 85

PAGE 86

Ricci, M.S., and Zong, W.X. (2006). Chemotherape utic approaches for targeting cell death pathways. Oncologist 11 342-357. Rong, R., Jin, W., Zhang, J., Sheikh, M.S., a nd Huang, Y. (2004). Tumor suppressor RASSF1A is a microtubule-binding protein that stabilizes microtubules a nd induces G2/M arrest. Oncogene 23, 8216-8230. Roninson, I.B., Broude, E.V., and Chang, B.D. ( 2001). If not apoptosis, then what? Treatmentinduced senescence and mitotic catastrophe in tumor cells. Drug Resist Updat 4, 303-313. Rowinsky, E.K., Eisenhauer, E.A., Chaudhry, V ., Arbuck, S.G., and Donehower, R.C. (1993). Clinical toxicities encountered with paclitaxel (Taxol). Semin Oncol 20, 1-15. Sablina, A.A., Budanov, A.V., Ilyinskaya, G.V., Agapova, L.S., Kravchenko, J.E., and Chumakov, P.M. (2005). The antioxidant func tion of the p53 tumor suppressor. Nat Med 11, 1306-1313. Schiff, P.B., Fant, J., and Horwitz, S.B. (1979). Promotion of microtubule assembly in vitro by taxol. Nature 277, 665-667. Scolnick, D.M., and Halazonetis, T.D. (2000). Chfr defines a mitotic stress checkpoint that delays entry into metaphase. Nature 406 430-435. Shivakumar, L., Minna, J., Sakamaki, T., Pest ell, R., and White, M.A. (2002). The RASSF1A tumor suppressor blocks cell cycle progression a nd inhibits cyclin D1 accumulation. Mol Cell Biol 22, 4309-4318. Song, J.J., and Lee, Y.J. (2003). Role of the ASK1-SEK1-JNK1-HIPK1 signal in Daxx trafficking and ASK1 oligomerization. J Biol Chem 278, 47245-47252. Song, J.J., and Lee, Y.J. (2004). Tryptophan 621 and serine 667 residue s of Daxx regulate its nuclear export during glucose deprivation. J Biol Chem 279, 30573-30578. Song, M.S., Song, S.J., Ayad, N.G., Chang, J.S., Lee, J.H., Hong, H.K., Lee, H., Choi, N., Kim, J., Kim, H. et al. (2004). The tumour suppressor RASSF1A regulates mitosis by inhibiting the APC-Cdc20 complex. Nat Cell Biol 6 129-137. Song, M.S., Song, S.J., Kim, S.J., Nakayama, K., Nakayama, K.I., and Lim, D.S. (2007). Skp2 regulates the antiproliferative function of th e tumor suppressor RASSF1A via ubiquitin-mediated degradation at the G(1) -S transition. Oncogene. Sudo, T., Nitta, M., Saya, H., and Ueno, N.T. (2004) Dependence of paclitaxel sensitivity on a functional spindle assembly checkpoint. Cancer Res 64, 2502-2508. Tang, J., Qu, L.K., Zhang, J., Wang, W., Michaels on, J.S., Degenhardt, Y. Y., El-Deiry, W.S., and Yang, X. (2006). Critical role for Daxx in regulating Mdm2. Nat Cell Biol 8, 855-862. 86

PAGE 87

Torii, S., Egan, D.A., Evans, R.A., and Ree d, J.C. (1999). Human Daxx regulates Fas-induced apoptosis from nuclear PML oncoge nic domains (PODs). EMBO J 18, 6037-6049. Tsai, M.Y., Wang, S., Heidinger, J.M., Shum aker, D.K., Adam, S.A., Goldman, R.D., and Zheng, Y. (2006). A mitotic lamin B matrix induced by RanGTP required for spindle assembly. Science 311, 1887-1893. Vos, M.D., Martinez, A., Elam, C., Dallol, A., Taylor, B.J., Latif, F., and Clark, G.J. (2004). A role for the RASSF1A tumor suppressor in the re gulation of tubulin poly merization and genomic stability. Cancer Res 64, 4244-4250. Wang, L.G., Liu, X.M., Kreis, W., and Budman, D.R. (1999). The effect of antimicrotubule agents on signal transduction pathways of apoptosis: a review. Cancer Chemother Pharmacol 44, 355-361. Wang, Y., and Cabral, F. (2005). Paclitaxel re sistance in cells with reduced beta-tubulin. Biochim Biophys Acta 1744 245-255. Wassmann, K., and Benezra, R. (2001). Mitotic checkpoints: from yeast to cancer. Curr Opin Genet Dev 11, 83-90. Wood, K.W., Cornwell, W.D., and Jackson, J.R. (2001) Past and future of the mitotic spindle as an oncology target. Curr Opin Pharmacol 1, 370-377. Xia, G., Luo, X., Habu, T., Rizo, J., Matsumot o, T., and Yu, H. (2004). Conformation-specific binding of p31(comet) antagonizes the function of Mad2 in the spindle checkpoint. Embo J 23, 3133-3143. Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T.L., Sechi, S., Qin, J., Zhou, S., Higgs, D., and Wang, W. (2003). The ATRX syndrome prot ein forms a chromatin-remodeling complex with Daxx and localizes in promyelocytic leuke mia nuclear bodies. Proc Natl Acad Sci U S A 100, 10635-10640. Yang, X., Khosravi-Far, R., Chang, H.Y., and Ba ltimore, D. (1997). Daxx, a novel Fas-binding protein that activates JNK and apoptosis. Cell 89 1067-1076. Yeung, T.K., Germond, C., Chen, X., and Wang, Z. (1999). The mode of action of taxol: apoptosis at low concentrati on and necrosis at high con centration. Biochem Biophys Res Commun 263, 398-404. Yu, X., Minter-Dykhouse, K., Malureanu, L., Zha o, W.M., Zhang, D., Merkle, C.J., Ward, I.M., Saya, H., Fang, G., van Deursen, J., and Chen, J. (2005). Chfr is require d for tumor suppression and Aurora A regulation. Nat Genet 37 401-406. Zhao, L.Y., Liu, J., Sidhu, G.S., Niu, Y., Liu, Y., Wang, R., and Liao, D. (2004). Negative regulation of p53 functions by Daxx and th e involvement of MDM2. J Biol Chem 279, 5056650579. 87

PAGE 88

Zhong, S., Salomoni, P., Ronchetti, S., Guo, A., Ruggero, D., and Pandolfi, P.P. (2000). Promyelocytic leukemia protein (PML) and Da xx participate in a nove l nuclear pathway for apoptosis. J Exp Med 191, 631-640. 88

PAGE 89

BIOGRAPHICAL SKETCH Cory Lindsay was born in Laurel, Nebraska, a small town located in northeast Nebraska cornering Iowa and South Dakota. He is the son of Archie and Virginia Lindsay, of Laurel, and has three siblings Lori, Scott and Michelle. Cory attended Laurel-Concord High School and graduated in 1998. During his high school years, Cory had several ou tstanding teachers who motivated and inspired him to pursue academics. His first experience with science research came during this time when he studied meiofauna biology and won several local, regional and national awards for his efforts. He also devel oped an interest in colle cting and breeding snakes and other reptiles and amphibians, a hobby which he still pursues today. After high school, Cory pursued a Bachelor of Sc ience degree in Biological Sciences from Wayne State College, in Wayne, NE and graduated in 2002. While an undergraduate, Cory was fortunate to have many opportuni ties to perform independent sc ience research. He conducted ecological research in the British West Indies studying dwarf-geckos and snakes as part of a collaborative effort with Avila College, Kans as City, MO; identified novel genes from the Schistosoma mansoni genome at the Whitney Laborat ory, St. Augustine, FL; performed molecular biology experiments as an intern at the Bermuda Biological Station for Research, St. Georges, Bermuda; and deciphered genetic dise ase abnormalities at the world famous Cold Spring Harbor Laboratory, Long Island, NY. Cory joined the University of Floridas IDP graduate school program in 2003 and finished his Ph.D work in the laboratory of Dr. Alex ander Ishov studying Daxx f unction in cellular taxol response and cell cycle progression. He has pr esented this work at several national and international conferences and published his work su mmarizing these results. Cory will continue post-doctoral work in cancer research and diagnostics. 89