<%BANNER%>

Characterization of Genes Regulated during Sclerotial Development in the Fungal Plant Pathogen Sclerotinia sclerotiorum ...

Permanent Link: http://ufdc.ufl.edu/UFE0021954/00001

Material Information

Title: Characterization of Genes Regulated during Sclerotial Development in the Fungal Plant Pathogen Sclerotinia sclerotiorum (lib.) De Bary
Physical Description: 1 online resource (124 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: development, ggt, microarray, sclerotia, sclerotinia, sclerotiniaceae, ssp1
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sclerotinia sclerotiorum (Lib.) de Bary is a devastating fungal phytopathogen with a broad host range and global distribution. The resting structures produced by this fungus, sclerotia, are crucial for survival in harsh environments and further dissemination of the fungus when environmental conditions become conducive. Sclerotia can germinate as hyphae to initiate disease directly or germinate as fruiting bodies, apothecia, to produce forcibly-discharged ascospores that act as a dispersible inoculum source. To begin a molecular genetic dissection of sclerotial developmental regulation, the first gene I chose for investigation was Ss_ssp1. The protein encoded by this gene was previously described as the major storage protein present in mature sclerotia of S. sclerotiorum. I found that ssp1 transcripts specifically accumulated in all stages of sclerotial development with peak levels in stage IV sclerotia. In contrast with the sclerotia-restricted spatial accumulation of ssp1 transcripts, Ssp1 protein accumulation was detected in all sclerotial and apothecial stages. Immunolocalization suggests the release of Ssp1 from sclerotial protein bodies and the relocation to apothecia during carpogenic germination. Contrary to our original hypothesis, Ss_ssp1 deletion does not distinctively affect sclerotial development or carpogenic germination. However, the upregulation of the Ss_ssp1 paralog, Ss_ssp2 and another 16kDa major protein in deletion mutants indicates a possible functional redundancy and compensatory role for the Ss_Ssp1 homolog and other sclerotia-accumulating proteins. To comprehensively investigate genes involved in sclerotial development, transcriptome profiling during sclerotial initiation was conducted using a genomic, long oligomer microarray. When compared to gene expression during hyphal growth, 15% of the genes from the S. sclerotiorum genome were differentially expressed (up- or down-regulated) during sclerotial initiation. Additionally, 14% or the orphan ESTs examined are predicted to be newly discovered genes on the basis of my microarray analysis and annotation. The gene encoding a gamma-glutamyl transpeptidas (Ss_ggt) was one of the genes whose expression was markedly upregulated during sclerotial initiation by microarray analysis. Gene deletion mutant of Ss_ggt resulted in distinct morphological aberrations in sclerotial morphology. In mature dry sclerotia, the cortex layer was thickened and easily peeled away with the rind from the medulla. Sclerotia of the Ss_ggt deletion mutant failed to carpogenically germinate into apothecia due to an internal breakdown of the interior sclerotial tissue during the carpogenic germination incubation period. This phenotype is attributed to poor environmental protection of the medulla, allowing the cortex to easily be separated from the rind outerlayer.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Rollins, Jeffrey A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021954:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021954/00001

Material Information

Title: Characterization of Genes Regulated during Sclerotial Development in the Fungal Plant Pathogen Sclerotinia sclerotiorum (lib.) De Bary
Physical Description: 1 online resource (124 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: development, ggt, microarray, sclerotia, sclerotinia, sclerotiniaceae, ssp1
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sclerotinia sclerotiorum (Lib.) de Bary is a devastating fungal phytopathogen with a broad host range and global distribution. The resting structures produced by this fungus, sclerotia, are crucial for survival in harsh environments and further dissemination of the fungus when environmental conditions become conducive. Sclerotia can germinate as hyphae to initiate disease directly or germinate as fruiting bodies, apothecia, to produce forcibly-discharged ascospores that act as a dispersible inoculum source. To begin a molecular genetic dissection of sclerotial developmental regulation, the first gene I chose for investigation was Ss_ssp1. The protein encoded by this gene was previously described as the major storage protein present in mature sclerotia of S. sclerotiorum. I found that ssp1 transcripts specifically accumulated in all stages of sclerotial development with peak levels in stage IV sclerotia. In contrast with the sclerotia-restricted spatial accumulation of ssp1 transcripts, Ssp1 protein accumulation was detected in all sclerotial and apothecial stages. Immunolocalization suggests the release of Ssp1 from sclerotial protein bodies and the relocation to apothecia during carpogenic germination. Contrary to our original hypothesis, Ss_ssp1 deletion does not distinctively affect sclerotial development or carpogenic germination. However, the upregulation of the Ss_ssp1 paralog, Ss_ssp2 and another 16kDa major protein in deletion mutants indicates a possible functional redundancy and compensatory role for the Ss_Ssp1 homolog and other sclerotia-accumulating proteins. To comprehensively investigate genes involved in sclerotial development, transcriptome profiling during sclerotial initiation was conducted using a genomic, long oligomer microarray. When compared to gene expression during hyphal growth, 15% of the genes from the S. sclerotiorum genome were differentially expressed (up- or down-regulated) during sclerotial initiation. Additionally, 14% or the orphan ESTs examined are predicted to be newly discovered genes on the basis of my microarray analysis and annotation. The gene encoding a gamma-glutamyl transpeptidas (Ss_ggt) was one of the genes whose expression was markedly upregulated during sclerotial initiation by microarray analysis. Gene deletion mutant of Ss_ggt resulted in distinct morphological aberrations in sclerotial morphology. In mature dry sclerotia, the cortex layer was thickened and easily peeled away with the rind from the medulla. Sclerotia of the Ss_ggt deletion mutant failed to carpogenically germinate into apothecia due to an internal breakdown of the interior sclerotial tissue during the carpogenic germination incubation period. This phenotype is attributed to poor environmental protection of the medulla, allowing the cortex to easily be separated from the rind outerlayer.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Rollins, Jeffrey A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021954:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF GENES REGULATED DURING SCLEROTIAL DEVELOPMENT IN THE FU NGAL PLANT PATHOGEN Sclerotinia sclerotiorum (Lib.) de Bary By MOYI LI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Moyi Li

PAGE 3

3 To my husband, Mr. Chao Chen, and my parents, Mr. Li Li and Ms. Fengying Guo, for their unending love, encouragement and unconditional support in all areas of my life

PAGE 4

4 ACKNOWLEDGMENTS I sincerely acknowledge the invaluable gui dan ce provided by my supervisory committee chair (Dr. Jeffrey A. Rollins) for this dissertati on. He is a patient teacher an excellent scientist and even a good example to deal with personal life and career in the future for me. I also would like to acknowledge my supervisory committ ee members, Drs. Kuang-Ren Chung, Bernard Hauser and Wen-Yuan Song, for their helpful s uggestions and critical evaluation of this dissertation. I would like to express my gratitude to the members of the Rollins lab, past and present, for selfless sharing of knowledge and skills. I especially would like to acknowledge Ulla Benny for her endeavors to provide timely and valuable support in my everyday laboratory studies whenever needed. I also want to thank the members of the plant pathology department for their gracious help during my entire doctoral study period. Special thanks go to program assistant, Ms. Gail Harris, for her effective help every time to get me out of trivial troubles that might have otherwise negatively influenced my dissertation research. Most importantly I thank my parents for their emotional and financial su pport to raise me into a scientific researcher. The endless love from my family members is always the biggest motivation in my life.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 LIST OF ABBREVIATIONS........................................................................................................ 11 ABSTRACT...................................................................................................................................13 CHAPTERS 1 LITERATURE REVIEW.......................................................................................................15 Introduction of Sclerotinia sclerotiorum (Lib.) de Bary ........................................................ 15 Taxonomy........................................................................................................................15 Economic Significance....................................................................................................15 Life Cycle........................................................................................................................16 Pathogenicity Factors and Disease Control.....................................................................17 Why Study Sclerotial Development ............................................................................ 20 Sclerotial Development......................................................................................................... .21 Sclerotial Evolution and Common Features....................................................................21 Sclerotial Developmental Stages..................................................................................... 24 Factors Involved in Sc lerotial Development................................................................... 25 Environmental factors..............................................................................................25 Oxalic acid................................................................................................................ 25 Ambient pH.............................................................................................................. 26 Oxidative stress........................................................................................................ 27 cAMP and signaling pathway..................................................................................27 Light regulation........................................................................................................29 Storage proteins........................................................................................................29 Genetic Approaches to Investigating Sclerotial Development in S. sclerotiorum .................30 Comprehensive Transcript Prof iling by Microarray Analysis........................................ 30 Deletion of Candidate G enes Involve d in Sclerotial Development................................. 31 2 REGULATION, ACCUMULATION AND TRANSLO CATION OF A SCLEROTIA DEVELOPMENT-SPECIFIC PROTEIN (Ssp1) in Sclerotinia sclerotiorum .......................32 Introduction................................................................................................................... ..........32 Materials and Methods...........................................................................................................35 Fungal Cultures and Tissue Collection............................................................................35 Apothecia Induction and Ascospore Collection.............................................................. 35 Identification of Ssp1-encoding Sequences.....................................................................36 Genomic DNA Cloning...................................................................................................36

PAGE 6

6 Multiple Sequence Alignment a nd Phenogram Construction ......................................... 37 Northern Hybridization Analysis.................................................................................... 38 Protein Extraction and Hybridization.............................................................................. 38 Two-step Semiquantitative RT-PCR and Quantitative RT-PCR (qPCR)....................... 39 Tissue Fixation, Embedding and Sectioning................................................................... 40 Immunolocalization......................................................................................................... 40 Constructing ssp1 Promoter-driven GFP E xpression System Using .............................. 41 Results.....................................................................................................................................41 Macroscopic Refinement of Sclerotial Developmental Stages....................................... 41 Gene Sequence and Computational Analysis.................................................................. 43 Ssp1 Accumulation at Differe nt Developmental Stages ................................................. 45 Developmental Accumulation of ssp1 Transcripts.......................................................... 45 Quantitative RT-PCR...................................................................................................... 45 Detection of Ss_ssp1 Transcripts as a Biomarker of Sclerotial Developm ent................ 46 Accumulation of ssp1 in Other Sclerotia-forming Species ............................................. 47 Ss_ssp2 Transcript Accumulation Pattern....................................................................... 47 The Ss_Ssp1 Immunolocalization...................................................................................48 Ss_ssp1 Promoter as a Tool fo r Heterlogous Protein Expression................................... 48 Discussion...............................................................................................................................49 3 FUNCTIONAL ANALYSIS OF A SC LEROTIA DEVELOPMENT-SPECIFIC PROTEIN (S sp1) In Sclerotinia sclerotiorum BY GENE DELETION................................. 67 Introduction................................................................................................................... ..........67 Materials and Methods...........................................................................................................69 Fungal Cultures and Maintenance................................................................................... 69 Nucleic Acid Isolation and Hybridization....................................................................... 70 Gene Replacement and Complementation...................................................................... 70 Western Hybridization a nd Immunolocalization.............................................................71 Apothecia Production and Acquisition of Ascospore Progeny....................................... 73 Two-step Semiquantitative RT-PCR...............................................................................73 Results.....................................................................................................................................74 Deletion of ssp1 Locus....................................................................................................74 Absence of Ss_Ssp1 in the Ss_ssp1 Deletion Mutant..................................................... 75 Effects of Ss_ssp1 Deletion on Sclerotial Development and Apothecia Development... 75 Ssp2 and a 15.5kDa Protein are Upregulated in the Ss_ssp1 Mutant........................... 76 Discussion...............................................................................................................................77 4 TRANSCRIPT PROFILING DURING SCLEROTIAL INITIATION BY LONGOLIGOMER MICROARRAY ANALYSIS.......................................................................... 85 Introduction................................................................................................................... ..........85 Material and Method...............................................................................................................88 Culture Growth and Harvesting....................................................................................... 88 Construction of S. sclero tiorum Oligonucleotide Microarrays.......................................88 Total RNA Extraction, Microarray H ybridization and Image Acquisition ..................... 89 Data Analysis...................................................................................................................89

PAGE 7

7 Quantitative RT-PCR...................................................................................................... 90 Constructing a -GT Gene Deletion Mutant ( ggt ) and its Genetic Comple mentation......................................................................................................... 91 Microscopy......................................................................................................................92 Apothecia Production for ggt ........................................................................................92 Results.....................................................................................................................................93 General Information of Microarray Analysis.................................................................. 93 Discovery of New Genes via Microarray Analysis.........................................................94 STEM (Short-Time Series Expression Miner) Analysis................................................. 94 Differential Expression of ggt and its Orthologs During Sclerotial Initiation................ 95 Deletion of the Ss ggt1 gene...........................................................................................96 Effects of Ss _ggt1 Deletion on Sclerotial Development and Germ ination..................... 96 Discussion...............................................................................................................................97 5 CONCLUSIONS.................................................................................................................. 110 APPENDIX GENES DOWNREGULATED IN SCLEROTIAL INITIALS............................................112 LIST OF REFERENCES............................................................................................................. 113 BIOGRAPHICAL SKETCH.......................................................................................................124

PAGE 8

8 LIST OF TABLES Table page 4-1 Summary of unigenes diffe rentially expressed on S. sclerotiorum m icroarray............... 101 4-2 Genes and primer pairs used for quantitative PCR confirmation.................................... 101 4-3 Ten genes upregulated in scleroti al initials with highest F-Va lues.................................102 4-4 Genes upregulated in sclerotial initials with highest fold changes.................................. 102 4-5 Genes downregulated in sclerotial initials with highest F-Values................................... 103 4-6 Genes downregulated in sclerotial initials with highest fold changes............................. 103 4-7 New genes found in orphan ESTs via mi croarray analysis............................................. 104

PAGE 9

9 LIST OF FIGURES Figure page 2-1. Sclerotia developmental stages.......................................................................................... 56 2-2. Mutiple sequence alignment..............................................................................................57 2-3. Phylogram of Ss_Ssp1 homologs...................................................................................... 58 2-4. Western blot, Northern blot and Semi quantitative RT-PCR analysis f or Ssp1 protein accumulation and transcripts accumulation in different developmental stages................. 59 2-5. Quantitative RT-PCR results.............................................................................................60 2-6. Semi-quantitative RT-PCR of ssp1 tr anscriptional products in different S. sclerotiorum isolates..........................................................................................................61 2-7. Northern hybridization for ssp1 transcription in other sclerotial forming species. ........... 62 2-8. Semi-quantitative RT-PCR of ssp2 tr anscriptional products in different developmental stages ......................................................................................................... 63 2-9. Immunolocalization of Ssp1 in mature sclerotium and carpogenic germinated sclerotium with apothecial stipe......................................................................................... 64 2-10. A GFP expression vector with ssp1 5 -UTR, pCT74-Pssp1. pCT74-Pssp1 derived from pCT-73 and pCT-74. ................................................................................................. 65 2-11. Fluorecent m icrograph (1-5) and Differentia l Interference Contrast micrograph (610) for GFP expression of pCT74-P ssp1 in WT vegetative hyphae and mature sclerotia..............................................................................................................................66 3-1. Split-marker strategy used for Ss_ssp1 replacement and identification .......................... 80 3-2. Transcript and protein accumulation of Ss_ssp1 in Ss_ssp1 sclerotia............................. 81 3-3 Phenotype of Ss_ssp1 sclerotia on PDA with and without hygrom ycin and apothecium of the ssp1 mutant........................................................................................ 82 3-4. SDA-PAGE and Western hybridization with sclerotial and apothecial proteins extracted f rom wild type, Ss_ssp1 and Cssp1................................................................. 83 3-5. RT-PCR detection of Ss_ssp1 and Ss_ssp2 transcript accum ulation in Ss_ssp1 stageIV sclerotia.................................................................................................................84 4-1 Heat maps built up for each functional clusters specifically upregulated during sclerotial ini tiation and the expression patte rn representing these groups....................... 105

PAGE 10

10 4-2 Heat maps built up for ribosomal proteins specifically downregulated during sclerotial ini tiation and the expression patte rn representing these genes........................ 106 4-3 The split-marker strategy used for making ggt deletion mutants and Southern hybridization for scr eening hom okaryotic ggt mutants (KO), heterokaryotic mutants (Ht), ectopic mutants (Ect.) a nd complemented strains (CO).......................................... 107 4-4 Northern hybridization analysis of ggt transcript accumulation in different wild type developm ental stages....................................................................................................... 108 4-5. Microscopic features (left two collum ns) and macroscopic features of m ature sclerotia (right collumn) harvested from WT and ggt stains.........................................109

PAGE 11

11 LIST OF ABBREVIATIONS AFS antifungal substances BCIP 5-brom o-4-chloro-3-indolyl phosphate Cys Cysteine CWDEs cell wall degrading enzyme EST expressed sequence tag GFP green fluorescent protein GGT or -GT gama-glutamyltranspeptidase GO gene ontology GSH glutathione MAPK mitogen-activated protein kinase MIPS Munich information center for protein sequence NADPH reduced form of nicotinamide adenine dinucleotide phosphate, NBT nitroblue tetrazolium PCR polymerase chain reaction PGs polygalacturonases PKA cAMP-dependent protein kinase A PVDF poly (vinylidene fluoride) ROS reactive oxygen species ROS RT-PCR reverse transcription polymerase chain reaction qPCR quantitative polymerase chain reaction SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis ssp1 sclerotia specific protein gene Ssp1 sclerotia specific protein encoded by ssp1 Ss_ssp1 S. sclerotiorum ssp1 gene

PAGE 12

12 Ss_Ssp1 S. sclerotiorum sclerotia specific protein encoded by Ss_ssp1 Ss_ggt1 S. sclerotiorum gama-glutamyltranspeptidase 1 gene Ss_Ggt1 S. sclerotiorum gama-glutamyltranspeptidase encoded by Ss_ggt1 STEM short-time series miner WT wild type diameter

PAGE 13

13 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF GENES REGULATED DURING SCLEROTIAL DEVELOPMENT IN THE FUN GAL PLANT PATHOGEN Sclerotinia sclerotiorum (Lib.) de Bary By Moyi Li May 2008 Chair: Jefferey A. Rollins Major: Plant Pathology Sclerotinia sclerotiorum (Lib.) de Bary is a devastati ng fungal phytopathogen with a broad host range and global distribution. The resting structures produced by this fungus, sclerotia, are crucial for survival in harsh environments and further dissemination of the fungus when environmental conditions become conducive. Scle rotia can germinate as hyphae to initiate disease directly or germinate as fruiting bodi es, apothecia, to produ ce forcibly-discharged ascospores that act as a dispersible inoculum source. To begin a molecular genetic dissection of sclerotial developmental re gulation, the first gene I c hose for investigation was Ss_ssp1 The protein encoded by this gene was previously described as the ma jor storage protein present in mature sclerotia of S. sclerotiorum I found that ssp1 transcripts specifically accumulated in all stages of sclerotial development with peak leve ls in stage IV sclerotia In contrast with the sclerotia-restricted spatial accumulation of ssp1 transcripts, Ssp1 protein accumulation was detected in all sclerotia l and apothecial stages. Immunolocaliz ation suggests th e release of Ssp1 from sclerotial protein bodies and the relocation to apothecia during carpogenic germination. Contrary to our original hypothesis, Ss_ssp1 deletion does not distinc tively affect sclerotial development or carpogenic germinati on. However, the upregulation of the Ss_ssp1 paralog,

PAGE 14

14 Ss_ssp2 and another 16kDa major protein in dele tion mutants indicates a possible functional redundancy and compensatory role for the Ss_S sp1 homolog and other sclerotia-accumulating proteins. To comprehensively investigate genes involved in sclerotial development, transcriptome profiling during scle rotial initiation was conducted using a genomic, long oligomer microarray. When compared to gene expression during hyphal growth, 15% of the genes from the S. sclerotiorum genome were differentially expr essed (upor dow n-regulated) during sclerotial initia tion. Additionally, 14% or the orphan ESTs examined are predicted to be newly discovered genes on the basis of my microarray analysis and annotati on. The gene encoding a gamma-glutamyl transpeptidas ( Ss_ggt ) was one of the genes whose expression was markedly upregulated during sclerotial initiation by micr oarray analysis. Gene deletion mutant of Ss_ggt resulted in distinct morphologica l aberrations in scle rotial morphology. In ma ture dry sclerotia, the cortex layer was thickened and easily p eeled away with the rind from the medulla. Sclerotia of the Ss_ggt deletion mutant failed to carpogenically germ inate into apothecia due to an internal breakdown of the interior sclero tial tissue during the carpogen ic germination incubation period. This phenotype is attributed to poor environmental protection of th e medulla, allowing the cortex to easily be separated from the rind outerlayer.

PAGE 15

15 CHAPTER 1 LITERATURE REVIEW Introduction of Sclerotinia sclerotio rum (Lib.) de Bary Taxonomy Sclerotinia s clerotiorum (Lib.) de Bary is the type speci es for the filamentous fungal genus Sclerotinia in the family Sclerotiniaceae in the or der Helotiales of the phylum Ascomycota. S. minor Jagger and S. trifoliorum Eriks are the only other valid species within this genus. The earliest description of S. sclerotiorum came from Libert (1837), who placed it within the Pizizomycetes as Peziza sclerotiorum Since, the taxonomic placement of this species has been revised several times (Wakefie ld, 1924). The current name, Sclerotinia sclerotiorum (Lib.) de Bary which was first used by Heinrich Anton de Bary in 1884 was accepted as the conserved name in 1979 (Kohn, 1979) and approved by the In ternational Botanical Congress in 1981. The family Sclerotiniaceae was erected by Whetzel (1945) as a group of fungi which produce stromata capable of germinating as stipitate apothecia bearing inoperculate asci and also produce globose, hyaline phialomicroconidia/sp ermatia on stromata and mycelia. The most important feature of members in this family is the ability to form stromata, compact masses of hyphae with a distinct medulla tissue layer contained within a continuous or discontinuous melanized rind. Economic Significance S. sclerotior um is a necrotrophic plant pathogen that can cause disease on more than 400 plant species especially dicoty ledonous crops (Boland and Hall, 1994). There are greater than 60 names used to refer to the plant diseases caused by this fungus including white mold, watery soft rot, stem rot and lettuce drop (Purdy, 1979). S. minor and S. trifoliorum are also able to infect and overlapping range of crops. However, S. minor is of agro-economic concern primarily

PAGE 16

16 on lettuce and peanut while S. trifoliorum is restricted to cause dise ase of concern on alfalfa and other forage legumes (Anonymous, 2003). According to the reports of the National Sclerotinia Initiative in 2005, collective annual losses in the United States caused by S. sclerotiorum for canola, soybeans, dry beans, sunflowers and pul se crops have been as high as 250-280 million US dollars in a single year (Anonymous, 2005a; Anonymous, 2005b), and it continues to be a very difficult pathogen to control (Anonymous, 2003). S. sclerotiorum is one of the most devastating and cosmopolitan plan t pathogens of agriculture crops. Life Cycle The long-term persistence of S. sclero tiorum in agriculture and the difficulties associated with Sclerotinia disease control can be part ially attributed to a special survival mechanism in disease life cycle, sc lerotial development. A sclerotium is a compact multihyphal aggregate (medulla) enclosed within a melanized outer-layer (rind). Ecologically, the sc lerotium is a crucial resting structure for long-term survival. Scleroti a can remain dormant and retain their viability for many years, documented up to eight years (A dams and Ayers, 1979), if the environmental conditions are unfavorable for germination. Epidemiologically, because S. sclerotiorum does not produce macroconidia (i.e. it has no functiona l asexual conidia.) and the microconidia (spermatia) produced on the su rface of mature sclerotia and some hyphae are non-propagative, sclerotia also play a key role for furthe r asexual reproduction a nd sexual reproduction to reinitiate the disease cycle. Under conditions of mild temperature (10-20C) and adequate moisture, sclerotia can either germinate into apothecia (carpogenic germination) or mycelia (myceliogenic germination) (Pohronezny and L.H., 2002). Mycelia from sclerotia can directly infect plant tissues usually from sensitive roots or wilted leaves of crops such as lettuce in contac t with the soil. The most important diseases caused by myceliogenic germination are sunflower wi lt and Sclerotinia rot of carrots (Bardin and

PAGE 17

17 Huang, 2001; Holley and Nelson, 1986). Storage rot can also occur due to the further mycelial invasion after harvest in carrots and snap beans (Lumsden, 1979). Most diseases caused by S. sclerotiorum are initiated by ascospores (Abawi and Grogan, 1979). An apothecium is a fertile structure which c onsists of a central stipe originating from the sclerotium medulla and a cupulate disc differentiated from the tip of stipe. The upper layer of the disc, the hymenium, produces millions of asci containing eight binucleate ascospores per ascus. When fully mature, ascospores are forcibly discharged from the apothecium surface into the atmosphere continuously for several days. Discha rged ascospores have to germinate and grow saprotrophically on senescent or n ecrotic tissues before hyphae are competent to infect a healthy host plant (Abawi and Grogan, 1979; Lumsden, 1979). This adaptation usually takes place on senescent flower petals or deta ched leaves that can provide primary nutrients for ascospore germination as well as chances for ascospore-germ inated mycelia to contact and invade healthy tissue (Inglis and Boland, 1990; Turkington and Morrall, 1993). Infectious hyphae penetrate healthy host tissu e through the cuticle by forming multicellular melanized infection cushions (Lumsden and Dow, 1973) or directly en ter plant tissue through open stomata via deregulating guard cells with se creted oxalic acid (Guimares and Stotz, 2004). Further hyphal growth and ramification leads to the complete collapse of host cells and eventually sclerotial formation on the surf ace of or within the dead plant tissue. Pathogenicity Factors and Disease Control S. sclerotior um is a necrotrophic plant pathogen. As su ch, it kills host cells in advance of colonization. It exhibits little tissue specifi city within a host and under conducive conditions infections give rise non-delimited host tissue maceration. Cell wall degrading enzymes (CWDEs) and the secondary metabolite produced by this fu ngus, oxalic acid, are tho ught to be the main factors facilitating hyphal penetration and col onization of hosts. Since pectin is a major

PAGE 18

18 constituent of the dicotyledonous plant cell wall, various pect inolytic enzymes (primarily polygalacturonases, PGs) secreted by S. sclerotiorum are the most comprehensively studied CWDEs though other non-pectinolytic CWDEs have also been characterized in this fungus (Bolton et al ., 2006). Physiological evidence has indi cated that these CWDEs might work collaboratively and synergistically with oxalic acid to function in a dynamic pH ambient environment and respond to various carbon/nitrog en sources or even host-specific factors to bring about symptom development.(Alghisi and Favaron, 1995; Bateman and Beer, 1965; Kars et al ., 2005; Kasza et al ., 2004). For example, S. sclerotiorum is able to secret several different molecular forms (isozymes) of PGs that exhibit similar enzymatic activities. Some have different isoelectric points with a similar molecular weights due to the differential glycosylation (Fraissinet-Tachet et al 1995). Another example comes from a closely related necrotrophic plant pathogen Botrytis cinerea (Kars et al ., 2005). Five endoPGs recently found in this fungus display different biochemical properties and necrotizing activ ity on different hosts. This variability is speculated to conf er flexibility and adaptability to a pathogen with such a broad host range (Bolton et al 2006). The production and secretion of oxalic acid is a factor thought to be critical for pathogenicity of S. sclerotiorum Evidence for such involvement was first provided by de Bary (1887) by recovery of oxalic acid from S. sclerotiorum -infected tissue and the demonstration that exogenously applied oxalic acid killed host cells. Numerous contemporary studies have strengthened this correlation by associating concentrations of oxalate in the host with the extent of symptom development (Marciano et al ., 1983; Maxwell and Lumsden, 1970) and by reproducing disease-like symptoms by dir ect injection of oxalate into plants (Maxwell and Lumsden, 1970; Noyes and Hancock, 1981). Using a UV mutagenesis approach, Godoy et al. (1990) demonstrated that oxalic acid deficient mutants lost pathogenici ty whereas a strain

PAGE 19

19 reverting to oxalate production also regain pathogenicity. A number of mechanisms by which oxalic acid aids in pathogenicity havi ng been proposed, reviewed by Bolton et al. (2006). These can be summarized as: i) provide favorable acidic pH environmen t for optimum CWDE activities (Favaron et al 2004) or pH-regulated genes nece ssary for the pathogenesis (Kim et al ., 2007); ii) suppress oxidative burst initiating plant defense response (Cessna et al ., 2000); iii) facilitate hyphal penetration by deregulating guard cel l functions to induce stomatal opening (Guimares and Stotz, 2004). One point that shou ld be emphasized here is that oxalic acid appears to be a primary physiological determinant of pathogenicity; but, oxalic acid also plays an important regulatory role as well. The full virulence of S. sclerotiorum relies on the correct regulation of genes in response to the ambient pH. Current evidence for this is that Pac1 activating mutants can constitutively accumulate oxalic acid under both low and high pH but exhibit an attenuated virulence phenotype (Kim et al ., 2007). Thus, oxalate is required for disease development but must be produced in th e proper time and amount to be fully virulent. Controlling plant diseases caused by S. sclerotiorum remains a challenge for modern agriculture. The primary reason that this disease ha s not been effectively managed is the lack of major simply inherited resistance in suscepti ble crops. After oxalic aci d was described as a determinant of pathogenicity (Godoy et al ., 1990), a number of independent labs worked to incorporate oxalic acid-degrading enzymes in to important crop plants including soybean, sunflower and peanut. A number of these transg enic lines have shown increased resistance to Sclerotinia spp. (Donaldson et al ., 2001; Hu et al 2003; Kesarwani et al., 2000; Livingstone et al ., 2005). However, in the only field-tested lines, the introduction of oxala te oxidase does not increase the seed output of transgenic sunflowers compared to wild-type (Burke and Rieseberg, 2003) though it does reduce diseas e severity in some enviro nments. The common control

PAGE 20

20 methods for Sclerotinia diseases continue to be the a pplication of fungicides for most Sclerotinia host plants (Mueller et al ., 2002) or crop rotation for certain crops such as sunflower where inoculum densities in the soil play a primary ro le in disease development. The possibility of biological control for Sclerotinia diseases has also been investigated in a number of studies. Some mycoparasites such as Coniothyrium minitans and Sporidesmium sclerotivorum specifically attack and degrade sclerotia. Both fungi have been commercially applied for Sclerotinia disease control (del Rio et al ., 2002; Li et al ., 2006; Partridge et al ., 2006). C. minitans appears to secrete an antifungal substance (A FS) that inhibits hypal growth or mycelial germination of sclerotia. The nature of this AFS has been investigated recently (McQuilken et al ., 2003; Yang et al ., 2007). One purified AFS activity wa s identified as macrosphelide A (McQuilken et al ., 2003). The research on mycoparasi tes and their eff ective antifungal substances will continue to be an active area of research as an alternative to chemical control methods. Why Study Sclerotial Development Most new infections of Sclerotinia di seases are initiated by ascospores yet we are unable to neglect the significance of sclero tial development in the cycle. Not only is the development of the ascospore-bearing apothecium dependent on sclerotia, but also, sclerotia themselves can initiate diseases on some hosts via myceliogenic germination. Sclerotial surv ival is a key link in the life cycle of S. sclerotiorum maintaining viability of the fungus under conditions in which hosts plants do not exist or under which diseas e development is not conducive. As such, the possibility to control Sclerotinia diseases by suppressing sclero tial formation or germination would eliminate new infections. In the laboratory, S. sclerotiorum stains have been observed that are attenuated in their virulence or that have lost altogether their ability to cause disease. Interestingly, these same strains have lost th eir capacity to produce normal sclerotia (Erental et

PAGE 21

21 al ., 2007; Godoy et al ., 1990; Jurick and Rollins, 2007; Rollins, 2003). Understanding the relationship between pathogenicity and sclerotial development ma y assist us in finding better ways to manage Sclerotinia diseases and give us some new insights to the physiological and genetic links between fungal de velopment and pathogenicity. Sclerotial Development Sclerotial Structure and Evolution True sclerotia are pr oduced by species within and outside of the Sclerotiniaceae. These stromata, compact masses of vegetative hyph ae that commonly support the development of asexual or sexual reproductive organs, are all ca tegorized as sclerotia based on several common features. First, functionally they are all quiescent resting structures that ma intain the viability of the fungus under harsh environment conditions. Sec ond, phenotypically all of them can be easily detached from the substratum at maturity whil e substratal stromata closely connect with the remains of the tissue and are difficult to separate from host tissue at maturity (Willetts and Bullock, 1992). Third, anatomically and histochemically they have similar ultrastructures. Three continuous layers can be distinguished in tuberoid and plano-convexoid sclerotia: rind, cortex and medulla. The rind, one to several cel ls deep, is the outer-most layer composed of thickened, pigmented, parenchyma-like cells. Pigmentation of the rind results from the deposition of melanin in the cell wall and is t hought to play a key role in protection from environmental stress in many fungal ti ssues (Bell and Wheeler, 1986; Henson et al ., 1999). Melanin deposited in the sclerotial rind decreases the permeability of sclerotia so that water and nutrients can be retained and the mature sclerotium can be protected from chemicals, radiation or other environmental factors that may otherw ise permeate into the sclerotium (Young and Ashford, 1992). Melanin is also th ought to protect the sclerotium from biological degradation because this heterogeneous phenolic polymer in the fungal walls can inhi bit the polysaccharidase

PAGE 22

22 secreted by antagonistic microorganisms (Willetts, 1971). Not all sclerotia form a discrete rind (Willetts and Bullock, 1992), but all true sclero tia formed by members of the Sclerotiniaceae do contain this layer. The cortex layer is position to the interior of the rind and th is dense tissue layer separates the rind from central mass (medulla) of the sclerotium. The thickest cortex among the Sclerotiniaceae is up to six ce lls thick (Kohn and Grenville, 1989a; Kohn and Grenville, 1989b). Its development appears to be related to the oxy gen concentration and availability of nutrients around the sclerotia during development though the thickness of this layer differs between different species and even within the species is not always morphologically distinguishable (Willetts and Bullock, 1992). The medulla is the interior-most layer and occu pies the greatest volume of a sclerotium. It consists of an aggregation of hyphal tissue embedde d within an extracellular matrix. This matrix is composed of polysaccharide secreted by the hyphae and appears to pl ay several important functions. It is presumed to play roles in sclerotial morphogenesi s, protection of sclerotia from dehydration, facilitation of wa ter uptake and provision of energy from a large reserve of carbohydrates (Willetts, 1971; Willetts and Bullo ck, 1992). Both of cortex and medulla accumulate nutrient reserves. Histochemical an alyses show less abundant storage bodies in cortex than in medulla. But the composition of these reserves, glycoge n, protein, polyphosphate and lipid within these two layers are very similar besides this small difference. Besides members of the Sclerotiniaceae, a num ber of taxonomically diverse species in both the Ascomycota and the Basidiomycota produce sclerotia. Claviceps purpurea is one such ascomycete that produces sclerotia and has received significant attent ion due to the ergot alkaloids produced within them. Additionally, species of Verticillium Aspergillus and

PAGE 23

23 Penicillium (anamorphs of ascomycetes) also produ ce sclerotia. In the Basidiomycota, some plant pathogens such as Typhula spp. (snow mould on turfgrass) and Sclerotium spp. (typically Scleortium rolfsii ) form sclerotia. These phylogenetically di stantly related speci es all evolved the ability to produce sclerotia, which play the similar roles in the life cycle of these diverse species. The patchy appearance of this character wi thin the fungal phylogenetic tree supports the hypothesis that sclerotia are the result of c onvergent evolution (Willetts, 1972). Willetts also proposed that sclerotia of different fungal spec ies originated from diffe rent fungal tissues and that a variety of degenerated or aborted structures might be the de velopmental origin of sclerotia. These include undifferentiated conidiophores or conidial masses from ascomycetes, sterile basidiocarps from basdiomycetes, and perithecia or cleistothecia from deuteromycetes (Willetts, 1972). Though the evidence is still limited, some i nvestigations from Sc lerotiniaceae species suggested that true sclerotia (t uberoid sclerotia and plano-conve xoid sclerotia) produced by these species were derived from sporogenous tissu e (Willetts, 1997). One supporting observation is that Monilinia spp., which produce substratal stromata, will produce some small black outgrowths on the surface of inf ected fruits when conidia diffe rentiation is inhibited under high humidity (Willetts, 1997; Willetts and Bullock, 1992). These are anatomically and histochemically similar to tuberoid sclerotia of Sclerotinia spp. Willetts suggested that the structure of the tuberoid sclerotium evolved fr om a pathway in common with a conidial chain developmental pathway in that these black outgr owths are terminally aggregated (Willetts, 1997; Willetts and Bullock, 1992). Another point of evid ence is that chain-like structures similar in appearance to chains of monilioid maroconidia were found in sclerotial initials and at the margins of cultures of S. sclerotiorum (Jayachandran, 1982). Jayacha ndran (1982) also observed Cristulariella -like multicellular anamorphs present in cultures. These structures may be the

PAGE 24

24 vestigial macroconidia and multihyphal reproduc tive anamorphs produced by the progenitor of S. sclerotiorum (Jayachandran, 1982; Willetts, 1997). The modern species producing tuberoid sclerotia have completely lost their ability to produce conidia. For species like Botrytis spp. producing plano-convexoid sclerotia, the conidial state is not co mpletely replaced by sclerotia; however; they do not produce sclero tia and conidia at the same ti me. Usually the environmental conditions suitable to induce coni dia formation inhibit sclerotial development and vice versa (Coley-Smith, 1980). This suggests that the primordia are indeterminant and will form planoconvexoid sclerotia or conidia depending on the envi ronment in which they initiate and develop. The sclerotia produced by Monilinia ssp. in Sclerotiniaceae are not considered true sclerotia but pseudosclerotia (Batra, 1991) since they are si mply interwoven randomly growing vegetative hyphae within the host and can not be detached from the host at maturity. However, the resting structures produced by the species outside of Scle rotiniaceae are considered true sclerotia based on the similarities in sclerotial development, ultr astructure and roles in fungal life cycles (Chet and Henis, 1975; Luttrell, 1980; Punja, 1985; Zarani and Christias, 1997). The evolutionary origins of sclerotia remain obscure, but the hypothesis made by Willetts may be testable as the core regulatory components of these diffe rent developmental pathways become known. Sclerotial Developmental Stages Apart from t he common features above shared by true sclerotia, sc lerotia also have a similar developmental course. Townsend and Wille tts (1954) described scle rotial development as a three-step sequential even t: i) initiation ii) development and iii) maturation. This characterization has been widely used by other re searchers. In culture, initiation of sclerotial development is marked by the appearance of sclerotial initials, white, aerial, fluffy hyphal aggregates, usually observed near the edge of ag ar medium once vegetative mycelia has covered the plate surface and hyphal extension is complete. Th ese sclerotial initials further aggregate and

PAGE 25

25 grow to a larger size and accumulate clear or yellow exudates on their su rfaces. Finally, sclerotia will enter the maturation stage through surf ace delimitation, melanization, consolidation and exudate evaporation. Factors Involved in Sclerotial Development Environmental factors There are many environm ental factors that can affect sclerotial de velopment. Chet and Henis (1975) reviewed various factors influenc ing sclerotial devel opment and later other researchers also discussed these general factors and added others (Le Tourneau, 1979; Willetts and Bullock, 1992). Some factors have been accep ted widely: 1) light conditions can influence sclerotial initia tion and further sclerotial development alt hough whether this is solely attributable to photo-oxidation or if specific photoreceptors ma y play a role is not yet understood yet; 2) temperature affects sclerotial maturation and pigmen tation; 3) an alkali pH environment inhibits sclerotial development; 4) oxygen is required for sclerotial imitation; 5) physical and chemical barriers that inhibit polar elonga tion of hyphae induce sclerotial in itiation; 6) staling products secreted by sclerotia-produc ing fungi or secondary meta bolites produced by other microorganisms can induce sclerotial development; 7) various nutrients affect sclerotial development such as carbon/nitrogen source, lipids, minerals, vitamins and sulfur-containing compounds. These general factors that affect sc lerotial development ha ve been known for many years. The molecular mechanisms underlying their influence have begun to be investigated only very recently. Current advancements in the und erstanding of the mol ecular regulators of sclerotial development are described below. Oxalic acid In the early 1990s, oxalic acid biosynthesis was demonstrated to be related to sclerotial for mation. Godoy et al. (1990) screened colonies derived fr om UV-irradiated ascospores for loss

PAGE 26

26 of oxalic acid production. Four independent mutant s that lost the abilit y to produce oxalic acid and cause disease, were also unable to form sc lerotia. A revertant mutant which regained oxalic acid production was also restored for the ability to produce sclerotia. This indicated that, oxalic acid, which accumulates to high concentrations in media accompanying mycelial growth is required for sclerotial developm ent. Later observations determined that these mutants produce numerous spermatia on young mycelia, which are only sporadically found on old mycelia and mature sclerotia of the wild type (Rollins, unpublished results). There a ppears to be a linkage between these developmental pathways that is influenced by oxalic acid biosynthesis. Whether this role is strictly metabolic or whether oxalic acid influences these developmental pathways as a component of the growth environment will re quire further investigation to elucidate. Ambient pH One way in which oxalic acid ma y influence sc lerotial development is by lowering the ambient pH environment. As mentioned above, the ambient pH environment is one of the general factors affecting scle rotial development. Rollins a nd Dickman (2001) reported that neutral ambient pH negatively regulates and an acidic ambient pH positively regulates sclerotial development. They also found that Pac1 acts as a pH-responsive transcription factor in S. sclerotiorum and loss-of-function Pac1 replacement mu tants display an aberrant sclerotial development and maturation phenotype (Rollins, 2003). This indicates that a pH-sensing signal transduction pathway is involved in sclerotial de velopment. Despite these observations, simply adding oxalic acid to growth medium at low pH is not sufficient to complement the sclerotial defects of various sclerotia minus strains. This indicates that the association is dynamic and may have a basis in general metabolism.

PAGE 27

27 Oxidative stress Chet and Henis (1975) first put forward the idea that O2 is required for sclerotial development. The role of oxygen in scleroti al development, however has not been well understood. Recent observations indicate that oxygen is needed to provide a hyperoxidant state of oxidative stress to initiate sclerotial development. Georgiou (1997) first determined that sclerotial biogenesis in S. rolfsii is associated with an incr ease of lipid pe roxidation. Lipid peroxides increase before the initiation of scleroti a and reach a maximum when sclerotial initials and early developing sclerotia are formed. Additi onally, the number of sclerotia is positively related to the level of lipid peroxidation in myce lia. Later, this same group determined that a series of hydroxyl radical scavengers as well as certain endogenous antio xidants had a negative effect on sclerotial metamorphosis (G eorgiou and Petropoulou, 2001a; Georgiou and Petropoulou, 2001b; Georgiou et al ., 2001; Georgiou and Zees, 2002; Patsoukis and Georgiou, 2007). These investigations suggest that oxidative stre ss triggers mycelial differentiation that initiates and propagates sclerotium development (Georgiou et al., 2006). cAMP and signaling pathway Rollins and Dickma n (1998) found that increases in endogenous and exogenous 3,5cyclic adenosine monophosphate (cAMP) levels inhibit sclerotial development. Recently, Jurick and Rollins (2007) also demonstrated that low leve ls of endogenous cAMP production via deletion of the adenylate cyclase-encoding gene, sac1 lead to abnormalities in sclerotial formation as well as hyphal growth. The cAMP-dependent protein kina se A (PKA) is an important recipient of the second messenger, cAMP, in cAMP-dependent signal transduction pathway. PKA activity has been shown to increase during sclerotial development but remains at low levels in a nonsclerotia-producing mutant of S. sclerotiorum (Harel et al ., 2005). However, deletion mutants of PKA catalytic subunit encoding gene, pka1, did not exhibit aberrant sclerotial formation or

PAGE 28

28 abolishment of sclerotial initiation (Jurick et al ., 2004). After investigating Pka1 orthologs in other filamentous fungi, these authors hypothesize d the existence of another PKA-encoding gene in the S. sclerotiorum genome. This hypothesis has been validated by the sequencing of the S. sclerotiorum genome . Their findings suggest that the second PKA gene might contribute full PKA activity in sclerotial development or there is anothe r PKA-independent signaling pa thway existing in sclerotial development. Later, Chen and Dickman (2005) reported that a Ras/MAPK pathway is required for sclerotial development and that this path way is negatively regulat ed by another small GTPase, Rap-1, in a novel cAMP-dependent but a PKA-independent pathway. Chen et al. (2004) provided evidence that this cAMP regulation ope rates antagonistically to ERK-type mitogenactivated protein kinase (MAP K) and G-protein signaling. They isolated a highly conserved Smk1-MAPK-encoding gene, smk1 from S. sclerotiorum Inhibition of smk1 transcript accumulation via antisense expression blocked sclerotial maturation (Chen et al ., 2004). In addition, smk1 shows positive pH-responsive regulation dur ing sclerotial development and its transcription can be inhibited by addition of cAMP. Results from this study suggest that a cAMP-dependent pathway might stimulate filamentous growth by inhibition of a smk1 dependent pathway. Erental et al. (2007) additionally showed that interference with protein phosphatase 2A (PP2A) activity vi a antisense suppression of the regulatory B subunit affected sclerotial maturation. Furthermore, PP2A activ ity was shown to be dependent on Smk1 and NADPH oxidase functions sugge sting interconnections betw een phosphatases, MAPKs and reactive oxygen signaling which is k nown to be an important regulator of sclerotial development (Georgiou et al ., 2006).

PAGE 29

29 Light regulation Light has been previously reported to affect sc lerotial morphogenesis; however, the role of light in this process remains poorly understood. One possible function of light is to produce oxidative stress by triggering phot osensitization reactions since light can reduce flavins and flavinoproteins which can react with molecu lar oxygen to produce reactive oxygen species (ROS) such as hydrogen peroxide, superoxide radicals, hydroxyl radi cals and singlet oxygen (Georgiou et al ., 2006). Miller and Limberta (1977) found that light exposure lead to melanin accumulation in sclerotia of S. rolfsii via induction of tyrosinase and also that light exposure cultures induced more sclerotia than cultures left in the dark. Melanin is known as a free radical scavenger which indirectly indicates that matu ration of sclerotia may occur as a protective response to oxidative stress ge nerated by light exposure or ot her sources of ROS. A gene involved in light induction of sclerotial formation is found recently in Aspergillus parasiticus The velvet gene, veA was originally described in A. nidulans as a light-dependent negative regulator of asexual sporulation and a positive regulator of the se xual cleistothecial development in the dark (Kim et al ., 2002). Calvo et al. (2004) found that the orth olog of this gene in A. parasiticus is also required for sclerotia l formation and the deletion of veA from wild type lead to the blockage of sclerotial production even under the optimal condition for wild type to form sclerotia. Storage proteins In addition to environmental factors and co m ponents of signal transduction pathways mentioned above, other gene products that may offer insight into sclerotial developmental regulation are proteins highly and specifically expressed during sclerotia development. Petersen et al. (1982) and Russo et al. (1982) isolated a 36kDa protein (Ssp) from sclerotia of three Sclerotinia species. These proteins were not detected in vegetative hyphae but made up

PAGE 30

30 approximately 35 to 40% of the total soluble sclerotial proteins. Russo and Van Etten (1982) purified Ssp from S. sclerotiorum and analyzed its biochemical characteristics. They demonstrated that Ssp protein consisted of thr ee charge isomers, with one isomer making up 80 to 90% of the total. Using TEM and immunoloca lization, they also demonstrated that Ssp accumulated in membrane-bound, organelle-like st ructures which resemble protein bodies found in seeds of many higher plants (Russo and Van Etten, 1985). The functional relationship between Ssp accumulation and sclerotial development has not been previously investigated. Genetic Approaches to Investigat ing Sclerotial Development in S. sclerotiorum Comprehensive Transcript Profiling by Microarray Analysis Though some advancements on the molecula r m echanisms regulating sclerotial development have been achieved, a more compre hensive and systematic study utilizing genomic and functional analyses should be carried out to gain new insights. As an important plant pathogen with broad host-range, the S. sclerotiorum genome was sequenced via a whole genome shotgun sequencing approach with an average of 8X coverage. The genome assembly was released late in 2005 ( http://www.broad.mit.edu/annotation/genom e/sclerotinia_sclerotiorum/ Home.html ). According to the current automated annotation using a combination of FGENESH and GENEID and comparing predicted genes to expressed seque nce tags (EST) data, there are 14,522 predicted genes residing in the ~38Mb genome. Further analysis of genome da ta revealed that 1) the gene density average is one gene for every 2,643bp of nucleotide sequence; 2) the average gene length is 1,067bp; and 3) the average intergenic lengt h is 974bp. Some misannotations have been found in predicted gene sequences but an optical map has validated the assembly and placed the genome into predicted chromosomal units. This genome data can be used as a resource for DNA microarray analysis so that we can initiate whole genome transcript profiling in sclerotial

PAGE 31

31 development and compare it to other developmenta l stages. In this dissertation, I have obtained transcript profiles comparing the stage of sclerotial initiation with vegetative growth using competitive hybridization microarray analyses. Th is method has been successfully applied onto other several filamentous fungi for developmental studies (Kasuga et al ., 2005; Nowrousian et al ., 2005; Qi et al ., 2006). We believe the application of microarray analysis to sclerotial development in S. sclerotiorum will help us to understand the genes and signal transduction pathways regulated in this process more comprehensively and systematically. Deletion of Candidate Genes Invol ved in Sclerotial Development Character izing the roles of specific genes in sclerotial development is another goal of my dissertation research. The first candi date I choose to focus on is the ssp1 gene encoding Ssp, the novel protein that specifically and highly accumulates in mature sclerotia but not in vegetative hyphae. Although this protein was fi rst described 26 years ago (Russo et al., 1982), the function of Ssp in sclerotial development is still unknow n. The tight relationship between Ssp expression and sclerotial development gave rise to my interest in characterizing th is gene. Another gene I characterized is ggt This gene encodes a -glutamyltranspeptidase (GGT). I chose this gene due to its high up-regulation during sclerotial initiati on vs. vegetative hyphal growth in a small-scale cDNA microarray hybridization performed previous ly. This up-regulation was validated using the whole genome microarrays. I investigated the role of GGT in sclerotial development by comparing the phenotype of S. sclerotiorum wild type strain and ggt knock-out mutant stains. Other genes exhibiting differential expression by microarray analysis were characterized bioinformatically and provide a valuable resource for future functional analyses.

PAGE 32

32 CHAPTER 2 REGULATION, ACCUMULATION AND TRANSL OCATION OF A SCLEROTIA DEVELOPMENT-SPECIFIC PROTEIN (SSP1) IN Sclerotinia sclerotiorum Introduction Sclerotinia s clerotiorum (Lib.) de Bary is an important plant pathogen that annually causes substantial world-wide losses in crop production (Bolton et al ., 2006; Purdy, 1979). The persistent infection capability of S. sclerotiorum is due in large part to the formation and longterm survival of sclerotia. These multihyphal, dar k, hard, tuberoid resting structures are capable of reproducing the fungus vegetatively and meiotica lly. Meiosis-related development is initiated within the sclerotium with the formation of apothecial primordia. The sclerotium serves as the sole source of nutrients during th is stage and during subsequent st ages of apothecial development and ascospore production. As such, the sclerotium en sures that new infections will occur locally as well as on hosts both temporally and spatia lly separated from the poi nt of initial infection. Mechanisms regulating sclerotial developmen t have been widely investigated in S. sclerotiorum Several recent articles ha ve reported on molecular signaling pathways and genes related to sclerotial development. One such pathway is the ambient pH signaling pathway. Neutral ambient pH negatively regulates sclerotial development and acidic ambient pH positively regulates sclerotial development (Ro llins and Dickman, 2001). Pac1 acts as a pHresponsive transcription factor in S. sclerotiorum and loss-of-function Pac1 replacement mutants display an aberrant sclerotial development and maturation phenotype (Rollins, 2003). Rollins and Dickman (1998) also found that endogenous and exogenous increases in 3,5cyclic Adenosine monophosphate (cAMP) levels inhibit sc lerotial development. Recently, the deletion of the adenylate cyclase-encoding gene, sac1 was demonstrated to lead to abnormalities in sclerotial formation as well as hyphal growth (Jurick and Rollins, 2007). cAMP-dependent protein kinase A (PKA) activity increases during sclerotial development but remains at low

PAGE 33

33 levels in a non-sclerotia-producing mutant of S. sclerotiorum (Harel et al ., 2005). However, a deletion mutant of PKA subunit gene pka1 did not show aberrant sclerotial formation or complete abolishment of sclerotial biogenesis (Jurick et al ., 2004) likely due to the function of another PKA homolog in S. sclerotiorum genome or to a PKA-independent signaling pathway functioning during sclerotial development. Later, Chen and Dickman illustrated (2005) that a Ras/MAPK pathway is required for sclerotial development and this pathway is negatively regulated by another small GTPase, Rap-1, in a novel cAMP-dependent but a PKA-independent pathway. They also provided evidence that th is cAMP regulation operates antagonistically to ERK-type mitogen-activated protein kinase (MAPK), Smk1, and G-protein signaling (Chen et al ., 2004). Inhibition of smk1 transcript accumulation throug h antisense expression blocked sclerotial maturation (Chen et al ., 2004). In addition, smk1 shows positive pH-responsive regulation during sclerotial development and its transcription can be in hibited by addition of cAMP. Results from this study suggest that a cAMP-dependent pathway might stimulate filamentous growth by inhibition of a smk1 -dependent pathway. Erental et al. (2007) additionally showed that interference with protein phosphatase 2A (PP2A) ac tivity via antisense suppression of the regulatory B subunit aff ected sclerotial matu ration. Furthermore, PP2A activity was shown to be dependent on Smk1 and NADPH oxidase f unctions suggesting interconnections between phosphatases, MAPKs and reactiv e oxygen signaling which is known to be an important regulator of sclerotial development (Georgiou et al., 2006). The velvet gene, veA was originally characterized in Aspergillus. nidulans as a positive regulator of cleistothecial production and a negative regulator of as exual sporulation (Kim et al ., 2002) has recently been shown to be required for sclerotial formation in Aspergillus parasiticus (Calvo et al., 2004). Deletion of veA

PAGE 34

34 from the wild type leads to lockage of sclerotial production even under the optimal condition for wild type sclerotia formation (Calvo et al ., 2004). In addition to the above mentioned genes a nd signal transduction pathways, genes and proteins that are highly and specifically e xpressed during sclerotia development may offer insight into sclerotial developmental regulation. In 1982, Petersen et al (1982) isolated a 36kDa protein (Ssp) from the sclerotia of three Sclerotinia species. These proteins were not detected in vegetative hyphae but made up approximately 35 to 40% of total soluble sclerotial proteins (Petersen et al ., 1982). Russo and Van Etten (1985) purified Ssp from S. sclerotiorum and analyzed its cytochemical characteristics. They de monstrated that Ssp protein consisted of three charge isomers, with one isomer making up 80 to 90% of the total. Using TEM and immunolocalization, they also demonstrated that Ssp accumulated in membrane-bound, organelle-like structures which resemble protein bodies found in seeds of many higher plants (Russo and Van Etten, 1985). Recently we identified a cDNA clone ( Ss_ssp1) encoding the Ssp1 protein from S. sclerotiorum Using this sequence we were able to identify homologous sequences from other closely related fungi. Due to the similar cytologi cal features of Ssp1-cont aing protein bodies and its comparable tissue-specific expression reminis cent of plant seed storage proteins (Guerche et al ., 1990; Higgins, 1984), we investigate its tissu e-specific expression and further try to determine if Ss_ssp1 transcript accumulation can be used as a biomarker for sclerotial initiation and development in S. sclerotiorum and other determinant sclerotial-forming fungi. There have been several examples of plant storage proteins used to explore temporal and spatial gene regulation in plan ts(Conceicao and Krebbers, 1994) and Ss_ssp1 may be used likewise for fungi. Our results demonstrate tight tissue-specific tran scriptional and translat ional regulation of ssp1

PAGE 35

35 and massive, developmentally-trigge red protein translocation. Furt hermore, the magnitude of its tissue-specific expression suggests promising potential for biotechnology application involving heterologous protein production. Materials and Methods Fungal Cultures and Tissue Collection The S. sclero tiorum wild type isolate and a sc lerotia minus mutant (A1) derived from this isolate were previously described by Godoy et al. (1990). Natural sclerotia minus isolates of S. sclerotiorum LMK28 and LMK44, were obtained from Dr. Linda Kohn (University of Toronto, Toronto, Canada).All isolates and the A1 strain were maintained and propagated on potato dextrose agar (PDA) (Difco, MI, U.S.A.) pl ates at room temperature. Mutants, pac 1 (Rollins, 2003) and snf 1 (Hutchens, 2005) forming aberrant sclerotia, were maintained and propagated on PDA containing 100g/ml hygromycin. To harvest the mycelia and aberrant sclerotia from agar plates, cellophane was overlaid on the medium before transferring mycelial plugs onto the media. Theref ore the mycelia or aberrant sclerotia tightly adhering with mycelia can be easily peeled off fr om the film without ag ar. Liquid shake cultures of wild type mycelia were obtained as previously described by Rollins (2003). Apothecia Induction and Ascospore Collection Mature sclerotia for apothecia induction were produced from Sclero tinia cultures growing on autoclaved diced potatoes at room temperatur e. To produce apothecia, mature sclerotia are washed with repeated changes in running water gently to avoid breaking sclerotia. Clean sclerotia were surface sterilized by immersion in 0.5% bleach for 5 min and then rinsed with sterile water for 5 min. After 3 rinses, sclerotia were dried in an air flow hood on sterile paper towels for 8 hours. Dried sclerotia were placed on the surface of autoclaved water-saturated vermiculite in glass petri dishes (10cm ). The freeze-thaw method of Russo et al. (1982) was

PAGE 36

36 used to condition sclerotia for carpogenic germin ation. Plates were placed at C for 24 hours and then at room temperature for 24 h for 3 cycles After the third cycle, plates were moved to a 15C incubator with constant lighting, using fl uorescent, cool white bulbs. Mature apothecia usually developed in 4-5 weeks. Ascospores were harvested from mature apothecia through a vacuumed funnel assembly previously de scribed by Steadman (Steadman and Cook, 1974). Identification of Ssp1-encoding Sequences Total soluble protein was extracted fr om matu re, PDA-grown sclerotia as described below. Twenty micrograms of soluble protein were denatured and separated in multiple lanes of a 12% SDS-PAGE gel. The major protein band migratin g at 36kD was excised from the gel, trypsin hydrolyzed, purified by reversed-pha se HPLC and subjected to internal Edman sequence analysis using an Applied Bioystems (ABI) 494 gas-phase/ pulsed-liquid Procise-HT sequencer at the University of Florida Protein Chemistry core fa cility. The sequences of five internal peptide fragments ranging in size from 8 to 16 amino aci d residues were obtained. These sequences were used to query a small collection (164 clones) of translated EST sequences (unpublished data) derived from a cDNA library prepared from pol yA+ RNA isolated from sclerotial initials (Rollins and Dickman, 2001). One translated EST sequence matched all five peptide fragments with 75-100% identity. This clone was fully sequenced on both stra nds and represents the full length Ss_ssp1 coding sequence. Genomic DNA Cloning The Universal Genome Walker Kit (BD Biosciences Clontech Inc., CA, USA) was used to amplify 5 upstream genomic sequence of Ss_ssp1 gene according to the manufacturers direction. To construct GenomeWa lker libraries, lyophilized myce lia from liquid shake cultures of S. sclerotiorum were used to isolate total genomic DNA with high purity and high molecular weight based on the method previously described by Yelton et al. (1984) for A. nidulans. Gene

PAGE 37

37 specific primer (sspGSP1) (5-CGAATTTCG ACGATGCCCATCTTGCCAT-3) was designed based on the sequence of Ss_ssp1 acquired from cDNA clone pSSPEST6.3. The forward primer was adaptor primer 1 (AP1) (5-GTAAT ACGACTCACTATAGGGC-3) provided by the GenomeWalker kit. Genome walking PCR program consisted of 7 cycles of 2s at 94C and 3min at 72C, and 32 cycles of 2s at 94C, 3min at 67C, and followed by 4min at 67C. The acquired 2kb PCR product was purified and cloned into TOPO plasmid (Invitrogen, CA, USA). E. coli strain DH5 was used to propagate plasmids. Multiple Sequence Alignment and Phenogram Construction The amino a cid sequences for Ss_Ssp1 (SS1G_14065.1), Bc_Ssp1 (BC1G_03185.1), and Ss_Ssp2 (SS1G_12133.1) were derived by transla tion of the coding sequences deposited in GenBank. Translated amino acid sequences for St_Ssp1 and Sm_Ssp1 were derived from sequenced cDNA sequences. The A. oryzae AO090038000546 (Ao_SspB) sequence was initially identified via a BlastP query of the N CBI non-redundant protein sequence database. Comparisons using the Sclerotinia and Botrytis sequences indicated that the three prime portion of the Botrytis gene was misannotated. The sequence wa s re-annotated based on nucleotide and amino acid multiple sequence alignments using Cl ustalX (Thompson et al., 1997) to include a third intron and a fourth exon. The A. flavus sequences (AFL2G_10697.2 (Af_SspA) and AFL2G_07878.2 (Af_SspB) were iden tified by BlastP query of translated transcripts in the Aspergillus Comparative Genomes Database ( https://www.broad.mit.edu:443/annotation/genome/aspergillus_group/MultiHome.html ). The A. oryzae Ao_SspA sequence was iden tified by tblastn query of the Aspergillus comparative genomic sequences database using the Ss_S sp1 sequence. Annotation of intron and exon junctions was performed via multiple sequence alignments with the other sequences. Amino acid sequences were aligned using ClustalX (Thompson et al ., 1997) and aligned sequences were

PAGE 38

38 edited manually in MacClade version 4.06 (Maddison and Maddison, 2003). An unrooted neighbor-joining tree was constructed using PAUP* 4.0b10 (Swofford, 2002). Northern Hybridization Analysis Total RNA used for Northern blots was isol at ed with Trizol reagent (Gibco BRL, MD, USA) according to the manuf acturers instructio ns. DNA/RNA transfer and hybridization analysis were conducted by previously reporte d procedures (Rollins, 2003). High stringency hybridization and membrane washing were at 65C, while low stringe ncy hybridization and membrane washing were conducted at 55C. A fragment of the ssp1 coding sequence digested from purified plasmid pEST6.3 by XbaI and Pst I was used as the probe for both DNA and RNA hybridization. Protein Extraction and Hybridization Lyophilized mycelia from liquid shake culture sclerotia and apothecia in different developmental stages were used to extract total soluble protein as described by Jurick et al. (2004). The only modification was the elimination of leupeptin, aproteinin and sodium fluoride from the protein extraction buffer. To ex tract soluble protein from ascospores, 500 l of 0.5mm glass beads were deposited in a tu be containing approximately 57 lyophilized ascospores scraped from filter paper. Beadbeating (Bio spec Products Inc., OK, USA) was used to homogenize ascospores using th ree 30sec pulses. Before each cycl e, the spore tube was placed into liquid nitrogen for 1min. 500 l of protein extraction buffer was added to the homogenized spores. After incubating the homogenized spores with extraction buffer on ice for 30min, the mixture was centrifuged at 4C for 30min and th e supernatant transferred to a new tube and stored at -20C. Primary antibody raised agai nst Ss_Ssp1 was acquired from Van Ettens lab (University of Nebraska, NE, USA). For Western blots, 20 g of extracted soluble proteins was separated by12% SDS-PAGE and then transferred on PVDF membrane (Bio-Rad, CA, USA).

PAGE 39

39 After semi-dry electroblotting, the membrane we re treated with PBST (80mM Na2HPO4, 20mM NaH2PO4, 100mM NaCl, 0.1% Tween20) containing 5% non-fat dry milk overnight at 4C and then incubated with primary antibody for 1hr at room temperature. The secondary antibody was goat anti-rabbit Ig-conjugated alkaline phospha tase (Bio-Rad, CA, USA). The blots were developed with substrate buffer c ontaining 0.1% NBT a nd 0.1% BCIP. Two-step Semiquantitative RT-PCR and Quantitative RT -PCR (qPCR) Five micrograms of total RNA were used as templates to synthesize the first strand cDNA using Superscript II (Inv itrogen, CA, USA) reverse transcript ase. Reverse tran scription reaction mixture includes 1 l of Superscript II reve rse transcriptase, 4 l of 5x first strand buffer (Invitrogen, CA, USA), 4 l of 25mM MgCl2, 2 l of 0.1mM DTT, 1 l of RNase inhibitor (Invitrogen, CA, USA), 1 l of 10mM dNTPs, 1 l of 0.5 g/ul oligo (dT), 5 g of total RNA and made up to a final volume of 20 l with RNase-free water. The reactions of in vitro reverse transcription were performed at 42C for 50mi n, then terminated by incubating the reaction mixture at 70C for 15min. RNaseH, 1 l, was used in a final step to degrade RNA templates. Two microliters of the 20 l reverse transcription reactions were used as templates for PCR. The PCR reaction mixture included 0.3 l 5U/ l Taq DNA polymerase 5 l of 10x Mg-free buffer, 2.5 l of 25mM MgCl2, 4 l of 2mM dNTPs, 1 l of 2mM primer, 2 l of undiluted or diluted RTreactions and made up to a final volume of 50 l with double-distilled sterile water. The thermocycle program consisted of 4min at 94C, 30 cycles of 1min at 94C, 1min at 55C and 1min at 72C, and followed by 7min at 72C. Primer pair, SspRT-R (5TTGAACCTTGTCTTTCGGAATGAAG-3) and sspRT-F (5TCTCTTCTTACCACG GAGCTTGCTTG-3), were used to amplify 680bp fragment in semiquantitative PCR products. A 338bp amplic on derived from Histone H3 SS1G_09608.1 (GenBank ID for CoreNucleotide sequence: XM_001589836), amplified using primer pair of

PAGE 40

40 H3-F2 (5-TCATCAATCCACAACAAC CAC-3) and H3-R1 (5AGAGCACCAATAGCGGAAGA-3), was used as a normalization control. To determine the absolute concentration of Ss_ssp1 transcripts in different deve lopmental stages, Bio-Rad qPCR cycler was used to perform qPCR and quantify values. A 10x dilution series of plasmid pSSP6.3 was used to construct a standard curve for qPCR. Primers, qPCR-F (5GTTCACAATGGGCATACTTTTCAGG-3) and sspRT-R, were used with diluted RT reactions from RNA of different sclerotia developmen tal stages to amplify a 250bp amplicon. The qPCR program consisted of 2min at 50C, 15sec at 95C and followed by 40 cycles of 15sec at 94C, 20sec at 56C and 30 sec at 70C. To investigate the transcriptional pattern of ssp2, the homologue of ssp1, in different developmental stages, primer pair of ssp2-F (5GTACCTCTGCGCCTGATGATA-3) and ssp 2-R (5TATTTCCATTGAACGCTCCAC-3) were used to amplify a 363bp amplicon. Tissue Fixation, Embedding and Sectioning Fresh ma ture sclerotia and carpogenically-ger minated sclerotia with apothecia were harvested, fixed and embedded using the method previously described by Kladnik et al.(2004). Embedded samples were sectioned (3 m) using a rotary microtome HM325 (Richard-Allan Scientific, MI, USA) and mounted on ProbeOne Plus Microscope Slides (F isher Scientific, USA) in cytoseal (Richard-Alla n Scientific, PA, USA). Immunolocalization Ready to use sections were dewaxed in Histoclear (National Diagnostics, GA, USA) and rehydrate in ethanol seri es and then hybridized with primary Ab described above for Western blots. Prim ary Ab was diluted (1:7500) in PBS with 10% goat-serum af ter the sections were blocked in PBS with 10% goat-serum for 20min. After an overnight incubation in a humidified chamber at 4 C, the slides were rinsed and incubated with PBS twice for 5min each time. The

PAGE 41

41 same secondary Ab (1:500) used in previous Western blots was used to conjugate with the Ssp1 Ab for 30min at RT. Histochemical detection was performed using NBT and BCIP substrate as described for Western blots for 1hr. The slides were dehydrated in the graded ethanol/water again and mounted in cytoseal for light microscopic observation. Constructing ssp1 Promoter-driven GFP Expression System Using ToxA promoter-driven GFP expression vector pCT-73 (Andrie et al 2005) was obtained from L. Ciuffettis lab (Oregon State Universit y, OR, USA). pCT-73 was modified by replacing the ToxA promoter with a ~1kb fragment containing the in-frame sequence of Ss _ssp1 encoding the first 6 codons of Ss _ssp1 and 1085bp 5 upstream of the start codon. A 1.4kb fragment containing a TrpC promoter driving hygromycin phosphotransferase (Carroll et al ., 1994) gene expression from pCT-74 (Andrie et al ., 2005) was digested with Sal I and cloned into the modified pCT-73 (pCT73-Pssp1) to make an Ss ssp1 promoter-driven GFP expression system, pCT74-Pssp1. The final constr uct is shown in Figure 2-10. Results Macroscopic Refinement of Sclerotial Developm ental Stages As a prerequisite to our studies, we sought to standardize the descri ption of macroscopic sclerotial development in culture based on invariable features appearing in each developmental stage. We refined descriptions of the sclerotial developmental process previously described as a three step process i) initiation, ii) developmen t and iii) maturation (Townsend and Willetts, 1954; Willetts and Bullock, 1992). From obse rvations made under a variety of in vitro growth conditions, six distinct, sequential stages have been defined for this study: I) multihyphal aggregation, II) exudation and condensation, III) enlargement, IV) consolidation, V) pigmentation, and VI) maturation (Figure 2-1). An important cav eat to defining stages of sclerotial development is that sufficient hyphal growth is a prerequisite for sclerotial formation.

PAGE 42

42 Evidence for this is observed in reports of ge ne deletion mutants that affect hyphal and colony vigor and also influence the number, size and morphology of sclerotia (Jurick and Rollins, 2007; Rollins, 2003). Secondly, sclerotia do not form in submerged cultures but do form rapidly if hyphae are moved to conditions with a hyphal-air interface (Hadar et al ., 1981). Hence, hyphal growth should be considered a prerequisite but not a committed step in sclerotial development. We designate vegetative hyphal growth before sc lerotial formation as stage 0 of sclerotial development (Figure 2-1). In the second stag e of development, vegetative hyphae begin to aggregate and form white aerial sclerotial initials. We designate sclerotia in this stage as stage I sclerotia or sclerotial initials (Figure 2-1). In the next stage, stage II (condensation and exudation), sclerotial in itials simultaneously condense and increase in size. Small amounts of exudates can be seen on the surf ace of aerial hyphae at this stag e and discrete delimited larger white aggregates are observed (Figure 2-1). In th e enlargement stage (stage III), the main feature is that the size of sclerotia increase at their highest rate and large amounts of exudates are observed. Sclerotia at this stage still exhi bit a white hyphal surface (Figure 1). In the consolidation stage (stage IV), the sclerotial color is buff and a delimited surface becomes visible while a small increase in size occurs (Figure 1) Stage V sclerotia are pigmented sclerotia as melanin accumulates during this period and clear or lightly pigmented exudates still exist on the sclerotial surface (Figure 2-1). Th e last stage (stage V I) of sclerotial development is maturation. In this period, sclerotia grow to full size and have a dark hard surface lacking exudates and sometimes are covered with a thin laye r of hyphae (Figure 2-1). The findings on ssp1 transcript and Ssp1 protein accumulation in this study are ba sed on this scheme of sclerotial developmental stages. Our results demonstrate tight tissue-specific transcriptional and tran slational regulation of ssp1 and massive, developmentally-t riggered protein translocation.

PAGE 43

43 Gene Sequence and Computational Analysis The partial cDNA sequence and the full length genom ic sequence of the ssp1 gene obtained before the release of the S. sclerotiorum genome sequence is identical with the sequence of predicted gene SS1G_14065.1 ( Ss_ssp1 ) in the genome database ( http://www.broad.mit.edu/annotatio n/fungi/sclerotinia_sclerotioru m/ ). The mRNA splice sites were determined by comparing the cDNA and geno mic sequences and confirmed the predicted 4 exons and 3 intron structures. The joined Ss-ssp1 exons are predicted to encode a 34.9 kDa novel protein with 311 amino acid residues, which is very close to the 36.1 kDa estimated by SDSPAGE (Russo et al 1982). Homologues of Ssp1 were found both in S. sclerotiorum and Botrytis cinerea by BLASTp queries of the Broad Institute fungal genome databases. Predicted gene SS1G_12133.1 ( Ss_ssp2 ) in the S. sclerotiorum database and BC1G_03185.1 ( Bc_ssp1 ) in B. cinerea database displayed high similarity to ssp1 (49% and 81% identity respectively) (Figure 2). DNA sequences for Ss_ssp1 orthologues in Sclerotinia trifoliorum and Sclerotinia minor were also acquired by amplifying genomic DNA us ing primers designed to conserved sequences flanking the Ss_ssp1 and Bc_ssp1 coding sequences. The S. trifoliorum ortholog of ssp1 (St_ssp1) shares 92% and S. minor (Sm_ssp1) shares 91% amino acid identity with Ss_ssp1. BlastP queries of the NCBI non-redundant protei n sequences also reveal ed significant homology (e-24) to one other sequen ce in the database other than Bc_Ssp1 (e-151) and Ssp2 (2e-95) This sequence (GenBank accession No.: BAE64317.1) is from Aspergillus oryzae and is annotated as an unnamed protein product. Addi tional BLAST queries to the Aspergillus Comparative Genomes database ( https://www.broad.mit.edu:443/annotation/genome/aspergillus_group/MultiHome.html ) identifi ed three additional ssp1-related sequences. Two of these sequences were from A. flavus (AFL2G_10697.2; designated Af_sspA and deposited in GenBank after correcting for a proposed

PAGE 44

44 intron as Accession######); AFL2G_07878.2 (designated Af_sspB and deposited in GenBank under Accession ######), and one sequence (supercontig 18.1 nucleotides 1658493-1659588 +) in addition to the previo usly identified GenBank BA E64317.1 sequence (AO090038000546) were identified from A. oryzae The intron-exon structure of thes e sequences was predicted from multiple sequence alignments. The supercontig 18.1 sequence was designated Ao_sspA and deposited in GenBank under accessi on #####. The BAE64317.1/AO090038000546 sequence was edited for a predicted intron and included ad ditional 3 coding sequence. This sequence was designated Ao_sspB and deposited in Genbank under accession #####. Multiple sequence alignment of Ssp1 homologs and an unrooted ne ighbor-joining tree are sh own in Figure 2-2 and Figure 2-3 respectively. No conserved domains were found in Ss_Ss p1 using biotools including InterPro Scan, Pfam, Smart and ProSite Scan, whereas a mini-mo tif of a potential C-terminal sorting signal VXPX was found in the C terminus of all Sclerotinia spp. homologs by MnM (Balla et al ., 2006) ( http://mnm.engr.uconn.edu) (Figure 22). This is consistent with the observation that Ss-Ssp1 is deposited in protein bodies of ma ture sclerotia enclosed within a cell membrane (Russo and Van Etten, 1985). This putative sorting signal is also found in the C terminus of Af/Ao_SspA but not in Bc_Ssp1 and Af/Ao_SspB. The similarities of sequences ~500bp 5 upstream from the start codon of Ss_ssp1 and its homologues were also compared. The TATA box, general transcriptional binding site, wa s found in all 5 sequences at ~100bp upstream of the start codon. A binding site perfectly matching the consen sus for binding AbaA (5-CATTCT-3), a known regulator of asexual development in Aspergillus nidulans (Andrianopoulos and Timberlake, 1994), was also found in all ssp1 orthologues as well as in ssp2 Additionally, an 8-bp sequence (5-TGGCGGCT-3) which shares 8of-9 identical nucleotides with the 9-bp palindromic

PAGE 45

45 sequence (5-TCGGCGGCT-3) of the CAR1 repressor (UME6/CAR80) (Strich et al. 1994) binding site (URS1C) was found in the Sclerotinia spp. Ss_ssp1 orthologs but not in Bc-ssp1 or in Ss_ssp2. Ssp1 Accumulation at Different Developmental Stages Total soluble proteins extracte d from 14 unique stages of the asexual and sexual life cycles were used for protein We stern Blots. Equal amount s (~20g) of total protein were loaded in each lane and polyclonal Ss_Ssp1 antibody was used to determine the presence of Ss_Ssp1 in distinct developmental stages. Detection of Ss_Ssp1 i ndicated that the protei n accumulated throughout sclerotial and apothecial devel opmental stages but not in any my celia stage (Figure 2-4) or in ascospores (results not shown). Developmental Accumulation of ssp1 Transcripts Total RNA isolated from the same diverse developmental tissues as before was used for Northern analysis and semiquantitative RT-PCR (F igure 2-4). Northern hybridization analysis failed to detect Ss_ssp1 transcripts in any a pothecial stage but transcript accumulation was detectable in sclerotial initials, peaking in stag e III and IV sclerotia and at the lowest level in mature (stage VI) sclerotia. RT-PCR revealed the same pattern and relative abundance observed with Northern hybridization. Quantitative RT-PCR qPCR was em ployed to quantitatively determine the concentration of Ss_ssp1 transcripts and relative Ss_ssp1 transcript levels during different stages of development. Results indicated that stage IV sclerotia had the highest transcript accumulation le vel among investigated stages (1.25E+10 copies/5g total RNA) while mycelia had the lowest transcript level (6.08E+4 copies/5g total RNA). This represents a dramatic 25 fold difference between minimum and maximum detected Ss_ssp1 transcripts. The relative concentrations of Ss_ssp1 transcripts in

PAGE 46

46 other stages compared to Ss_ssp1 transcripts in mycelial stag e were obtained by dividing copy numbers of Ss_ssp1 transcripts in other stag es with copy number of Ss_ssp1 transcripts in the mycelial stage (Figure 2-5). The pattern of Ss_ssp1 transcript accumulation levels obtained by qPCR is very similar qualitatively with that obtai ned by Northern analysis. The difference is that extremely low levels of Ss_ssp1 transcription can be detected in the mycelial stage and the etiolated stipe stage by qPCR while they can no t be detected by Nort hern hybridization or semiquantitative RT-PCR. Detection of Ss_ssp1 Transcripts as a Biomarker of Sclerotial Development Various mutations and physiologi cal treatm ents have been shown previously to inhibit or perturb sclerotial development. Since Ss_ssp1 transcripts could not be detected in any stage of mycelial growth via Northern hybridization but were readily detected in early stages of sclerotial development, we sought to determine if Ss_ssp1 transcript accumulation could be used as a biomarker of sclerotial initiation. To determine this, we examined Ss_ssp1 expression in a variety of mutants, natural sclerotia-minus isol ates and the wild type under conditions designed to inhibit sclerotial development. The result indicated that accumulation of Ss_ssp1 transcripts was undetectable by semiquantitative RT-PCR at any stage of growth or development in A-1 (an oxalate minus, sclerotia minus UV mutant), LMK28 and LMK44 (natural sclerotia minus isolates) and wild-type hyphae incubated under aerial stationary culture conditions at pH7. Relative to transcript accumulation in sclero tial initials, significantly reduced levels of Ss_ssp1 transcript were present in the aberrant sclerotia produced by snf 1 and pac 1 mutants and in wild-type hyphae treated w ith 2.5mM caffeine, a concentration th at partially inhibits sclerotial initiation (Figure 2-6).

PAGE 47

47 Accumulation of ssp1 in Other Sclerotia-forming Species Ssp1 proteins are also present in other de terminate sclerotia-forming Sclerotiniaceae species (Novak and Kohn, 1991; Petersen et al ., 1982). We sought to determine if the gene encoding these proteins were regulated similarly to Ss _ssp1. Therefore, total RNA from one isolate of S. minor one isolate of S. trifoliorum and one isolate of B. cinerea were used in Northern hybridization with the Ss ssp1 coding sequence. Under high stringency hybidization conditions, the Ss_ssp1 probe successfully hybridized with total RNA isolated from stage IV sclerotia from both of S. minor and S. trifoliorum but failed to hybridize w ith total RNA isolated from hyphae of either species (Figure 2-7). U nder low stringency hybridiz ation conditions, the Ss_ssp1 probe hybridized with total RNA isol ated from developing sclerotia of B. cinerea but not with total RNA isolated from B. cinerea hyphae (Figure 2-7). This indicates that Ssp1 proteins in other determinate sclerotia-forming species are related at the sequence and regulatory levels and may perform a conserved function. Ss_ssp2 Transcript Accumulation Pattern Semi quantitative RT-PCR indicated that Ss_ssp2 transcripts specifically accumulated in developing apothecia rather than in vegetative mycelia or sclerotia initials. (Figure 2-8). When searching the ESTs frequency for Ss_ssp1 and Ss_ssp2 in the data of S. sclerotiorum EST collections ( ESTs are available from three cDNA libraries made from my celia, sclerotial initials and developing stipes respectively in the Broad Institute database), we found 33 EST clones of Ss _ssp1 in the sclerotial initials EST collec tion and no sequence from the other two EST collections (mycelia and etiolated stipes). Two Ss_ssp2 ESTs were found in the developing stipes collection but none from the other two ESTs collect ions. This is consistent with RT-PCR results which suggested that expression of Ss_ssp1 and Ss_ssp2 have differing tissue specificities. This discovery of a related protein with apothecia-spec ific expression leads us to investigate whether

PAGE 48

48 our antibody detection of Ss_Ssp1 in apotheci a was actually cross reactive with Ss_Ssp2. For this, we isolated the Ss_Ssp1 bands from SD S-PAGE separated protein samples of mature sclerotia and developing apotheci a, and subjected them to tr ypsin digestion and tandem mass spectrometry analysis. The obtained peptide fragme nt profile identified Ss_Ssp1 as the dominant constituent of the band obtained both from scle rotia and from apotheci a (results no t shown). The Ss_Ssp1 Immunolocalization Following the work of Russo and Van Etten (1985), we used immunohistochemi stry to visualize protein bodies in mature sclerotia (Figure 2-9). We further observed that in carpogenically-germinated sclerotia, pr otein bodies were absent in the sclerotial region interior to the germination point resulting in a distinct cl ear zone in the medulla. This indicated that Ss_Ssp1 was being released from protein bodies and being metabolized or translocated into apothecia. Distinct visualization of Ss_Ssp1 in ap othecia stipes or discs as expected based on the ability to detect Ss_Ssp1 with western blots fr om apothecial proteins was not obtained. Yet, when Western blots with protei ns from carpogenically-germinati ng sclerotia were examined, no indications of digested Ss_Ss p1 were observed. Possibly, Ss_S sp1 is being solubilized in germinating sclerotia and is much less concentrated in apothecia than it is in sclerotia or perhaps interactions with other prot eins in the apothecia tissue prevent its visualization by immunolocalization. Ss_ssp1 Promoter as a Tool for Heterlogous Pr otein Expression The 1085 bp sequence upstream of the Ss_ ssp1 coding sequence was used to drive the expression of green fluorescent protein. GFP accumula tion was detected only in sclerotia and not in hyphae or apothecia (Figure 2-11). The observations corroborate our findings that Ss_ssp1 is only transcribed to signif icant levels during sclerotial develo pment. The lack of even diffuse GFP visualization further suggests that specific residues of Ss _Ssp1, not included in our GFP

PAGE 49

49 construct necessary for the translocation of prot ein from the sclerotium to the apothecium. The demonstrated tissue specificity of the ~1kb promot er fragment suggests that it can be used to heterologously express other proteins in S. sclerotiorum to high levels without concern for disrupting normal hyphae growth. Additional prom oter truncations should reveal minimum requirement for high levels of tissue-specific expression. Discussion Ss_Ssp1, a 34.9 kDa protein, accumulates in m e mbrane-bond protein bodies to comprise the major proportion of total soluble proteins in mature sclerotia. These characteristics are very similar to those of plant storage proteins (Shewry et al ., 1995). Plant storage proteins include seed storage proteins and vegetative storage prot eins. Seed storage proteins accumulate to high levels in late stages of seed development and are degraded during plant seed germination, and the resultant derived amino acids presumably serve as a source of nitroge n and carbon skeletons for the synthesis of new proteins required for ge rmination (Larkins, 1981; Muntz, 1998). The most well studied seed storage proteins are cereal a nd maize seed storage proteins (Coleman and Larkins, 1999; Shewry and Halford, 2002). These proteins are known to be processed by the secretory pathway and deposited in discrete protein bodies (Muntz, 1998) though some (e.g., globulins and prolamins) do not have distinct sequence signal conferring vacuolar targeting (Kermode and Bewley, 1999). A shor t potential signal peptide (VXPX) is found at C-terminus of Sclerotinia ssp. Ssp1 homologs and Af/Ao_SspA. It is di fficult to conclude that this is a true sorting signal or if there are other segments within the protein or if associat ed tertiary structure of the mature protein acts as a signal for its depositi on in protein bodies as has been hypothesized as a sorting mechanism of seed storage proteins without distinct cleavable signal domain at Nterminus (Shewry et al ., 1995). Most seed storage proteins ar e thought to be nutritional reservoirs

PAGE 50

50 for subsequent seed germination but not all of them are required for normal seed development and germination (Kriz and Wallace, 1991). Vegetative storage proteins comprise the s econd class of plant st orage proteins. These storage proteins specifically accumulate in vege tative tissues including le aves, stems and tubers. They exhibit more diverse biolog ical functions compared to se ed storage proteins. The most widely studied of these vegetative storage prot eins are patatin and its orthologs. These are soluble proteins and accumulate to high levels in potato or other tuber-forming plants (Shewry, 2003). They possess different enzymatic act ivities including phos pholipase (Hirschberg et al ., 2001), acidic -1,3-glucanase (Tonon et al ., 2001), antioxidant (Hou et al ., 2001), and carbonic anhydrase (Hou et al ., 1999) activities with roles in protect ing tubers from pests, pathogens and abiotic stresses (Shewry, 2003). Similar storage proteins and ti ssue specific proteins are also found in fungi. In the late 1970s and the early 1980s, Van Etten et al. (1979) and Peterson et al. (1983) reported a major protein, muiridin, which accumulates in dormant spores of Botrydiplodia theobromae but is not present or present in very low amounts in vegetative hyphae. The degradation of muiridin is tightly related to subsequent spore germination. Nowrousian et al (2007) recently found an abundant perithecial protein (App) that is specifically expressed in perithecia of Sordaria macrospore and Neurospora crassa but not present in hyphal tissu e. App is not required for the fertility in either species a nd there are no distinct differen ces in perithecial morphology or developmental timing between app and wild type strains. Like wise, the spore-specific protein ( ssp1) from Ustilago maydis which shares homology with other fungal oxygenases, is highly expressed in mature teliospor es, but disruption of this ge ne has no obvious phenotype (Huber et al ., 2002). This provides a caution that some fungal tissue specific protein might not be required

PAGE 51

51 for normal function of those tissues, even though they are highly temporally and spatially regulated during development, and like some plant seed storage proteins not necessarily required for normal development and germination. In immunolocalization assays of germinated sc lerotia, a clear region near the apothecial germination point suggests to me that Ss_Ssp1 may be utilized during apothecial germination. However, we did not observe degradation of Ss_S sp1 in germinated sclerotia or in apothecia by Western analysis. We did observe the reduc tion of Ss_Ssp1 in carpogenically-germinated sclerotia compared to ungerminated sc lerotia as previous ly reported (Russo et al ., 1982), but significantly, we also observed high levels of Ss_Ssp1 in apot hecia, a previously undescribed phenomenon. This apothecial-accumulation of Ss_Ssp1 protein occurs with approximately 104fold lower ssp1 transcript accumulation relative to stag e IV sclerotia. This suggests that the majority of the Ss_Ssp1 protein present in apothecia is the result of solubilization and translocation of Ss_Ssp1 from sclerotia to apothecia. Based on these observations, we can not conclude that Ss_Ssp1 functions as a nutrient source for apoth ecia germination analogous to plant seed storage proteins. Whether Ss_Ssp1 plays a role in carpogenic germination or myceliogenic germination or fulfills some other bi ologically relevant role will require mutational and phenotypic analyses. Levels of Ss_ssp1 transcript not only differed during sc lerotial development but differences were also observed in various st rains with aberrant sclerotial de velopment. In our investigations, strains and isolates of S. sclerotiorum with aberrant sclerotia (pac1, snf1 ), with few sclerotial initials (caffeine treated WT) or without scle rotia (A-1, LMK-28, LMK-44) have either less Ss_ssp1 transcripts than wild type sclerotial in itials, or fail to accumulate detectable Ss_ssp1 transcripts.

PAGE 52

52 Based on Blast queries of the NCBI non-re dundant databases and public fungal genome databases, Ssp1-encoding genes are absent from most fungal lineages. Th e exceptions we have found include closely related Sclerotiniaceae species ( S. trifoliorum S. minor and B. cinerea ) and surprisingly, the distantly related Eurotiomycetes A. flavus and A. oryzae A character that unites these Aspergillus spp. with the Sclerotiniaceae species is the production of determinate sclerotia. To our knowledge, S. sclerotiorum B. cinerea, A. flavus and A. oryzae are the only sclerotia-producing fungi whose genomes have been sequenced. The availability of sequenced genomes from eight varying Aspergillus species allowed us to comprehensively search for ssphomologous sequences in closely relate d sclerotia-produci ng and non-producing Aspergillus species. The presence of these sequ ences only within sclerotia-producing Aspergillus spp. genomes further suggests a f unctional relationship between sclerotia production and Ssp1. Determining whether these ssp homologs are truly associated w ith sclerotial development in A. flavus and A. oryzae whether other taxonomically diverse sclerotia-producing fungi have these genes, and whether indeterminate stroma-produc ing Sclerotiniaceae encode these genes, may provide valuable insights into th e evolution of fungal sclerotia. The absence of an ssp2 ortholog from the genome of both sequenced isolates of B. cinerea was initially surprising given the presence of two ssp-related sequences in both A. flavus and A. oryzae These Aspergillus sequences are obviously related to Ss p1 and Ssp2 based on the low BLASTP e value scores (e-60 to e-31) and the conserved positions of three introns. The orthologous relationships among the Ss_ ssp1, Ss_ssp2 and the Af/Ao_sspA and Af/Ao_sspB genes is not clear based on se quence homology. Best bi-directional BLAST queries of the A. flavus A. oryzae, and S. sclerotiorum genomes indicate that ssp1 is the best Sclerotinia gene match for both Af/Ao_sspA and Af/Ao_sspB. The pe rcent identity and similarity in global amino

PAGE 53

53 acid alignments also bears this out with Ss_S sp1 sharing 38% identity to Af/Ao_SspA and 32% similarity to Af/Ao_SspB compared to Ss_Ss p2 sharing 33% identity to Af/Ao_SspA and 25% similarity to Af/Ao_SspB. The neighbor joining phylogram further substantiates this observation and indicates that Ss_Ssp1 shares a more common evolutionary history with Ss_Ssp2 than with either Aspergillus gene but also that Ss_Ssp1 is more closely related to both Af/Ao_SspA and Af/Ao_SspB than is Ss_Ssp2. The high degree of Ssp1-Ssp2 divergence suggest that the presence of both genes in the S. sclerotiorum genome is the result of an ancient duplication and subsequent loss from the B. cinerea genome, or a more recent duplication in Sclerotinia and strong diversifying selection for function and regulation. Determining if the Aspergillus ssp gene duplication was independent of the Ss_ ssp duplication event or the sa me duplication event with differing selection pressure may provide insight into the biological function of these proteins and whether the original function ha s been split or if new func tions have been selected. In other studies, Ssp protein accumulation in several genera and species of the Sclerotiniaceae including both sclerotia-forming and substratal stromata-forming species by immunoblot and ELISA analysis using anti-S sp1 antibodies was i nvestigated (Kohn and Grenville, 1998; Novak and Kohn, 1991). These studies revealed antigen ically reactive Ssp1 proteins present in total scleroti al proteins from all sclerotial species but not in substratal stromatal species. With the Ss_ssp1 gene sequence now in hand, the major stroma-specific protein-encoding genes can be i nvestigated. Are Ssp proteins fr om sclerotiaand substratal stroma-forming Sclerotiniaceae merely antigenically unique or have they also arisen from evolutionarily distinct progenito rs as well? Our inability to PCR amplify homologous sequences from the substratal-forming species S. homoeocarpa using primers effective for other Sclerotinia spp. and B. cinerea suggests that the ssp genes from these substratal stroma species are

PAGE 54

54 phylogenetically unique. The specificity of Ss_ ssp1 transcript accumulation during sclerotial development can be utilized as biomarker of sclerotial initiation and de velopment and may help to elucidate the evolutionary origins of sclerotia and other stroma. Unexpectedly, the homologous ssp2 gene has an expression pa ttern quite distinct from ssp1. This paralog is specifically and highly transcribe d throughout apothecial developmen tal but not in sclerotia or other stages of the life cycle. Determining what regulatory elements result in these very different expression patterns of two similar genes may shed insight into the different regulatory pathways functioning in these unique multicellular developmental programs. Ss_ssp1 should be a valuable gene for understa nding spatial and temporal-specific gene expression in fungi. In silico promoter analysis found a potential CAR1 repressor (UME6/CAR80) binding site (URS1C) in the upstream of all Sclerotinia spp. ssp1 orthologs. CAR1 encodes an arginase that participates the first committed step of arginine degradation (Middelhoven, 1964). And the disruption of CAR1 enhanced freeze tolerance of Sacchromyces cerevisiae (Shima et al ., 2003). URS1 does not only function to repress CAR1 expression, it has also been found in the promoters of a wide vari ety of yeast genes including most early meiotic gene as well as some nonmeiotic genes like CAR1 (GailusDurner et al ., 1997). The current findings indicated that this bindi ng site may interact with an Ume6 ortholog. Other proteins like replication protein A may also be able to interact with this cis element and activate gene transcription (GailusDurner et al., 1997). Deletion and site-direct ed mutagenesis experiments on the ~1kb 5 region upstream of ssp1 to identify core promoter elements sufficient to initiate transcription of introduced GFP in a sclerotial-specific manner are planned. Using this construct to investigate tissue sp ecific expression in ot her sclerotial forming a nd non-forming fungi may also provide insight into the origins of scle rotial regulation. The st udy of Ssp1 regulation may

PAGE 55

55 not only help to better understand gene regulatio ns in fungi but also might be of industrial interest as a system for hetero logous eukaryotic protei n expression. It may be feasible to produce proteins within sclerotia using readily available agriculture waste products as a substrate and obtain large quantities of concentr ated protein in a readily harvested sclerotial packet within a period of ten days from inoculation to harvest. This would represent a unique eukaryotic protein expression tool in which proteinrich tissue could be readily produ ced and purified in a rapid and easily manipulated system.

PAGE 56

56 Figure 2-1. Sclerotia developmental stages. 0: Stage 0 (vegetative hyphal growth); I: Stage I (initiation); II: Stage II (condensation); I II: Stage III (enlargement); IV: Stage IV (consolidation); V: Stage V (pigme ntation); VI: Stage VI maturation.

PAGE 57

57 Figure 2-2. Multiple sequence alignment of Ssp1 homologs from S. sclerotiorum (Ss), S. minor (Sm), S. trifoliorum (St), B. cinerea (Bc) and A. flavus (Af). Conserved amino acid residues were shaded in the following ma nner: black = 100% identity or conserved substitution, grey > 80%identity or cons erved substitution, light grey >60% identity or conserved substitution, white 60% identity or conserved substitution. Amino acid residues are considered to be conserved s ubstitution in the same site as following: D=N, E=Q, S=T, K=R, F=Y=W, L=I=V=M. The positions of joint exons are labeled with solid triangles. The in trons either are present be tween codons of two residues separated by vertical lines or reside within the codon of the boxed residues. Intron no. is shown above the intron labels. Intron I, II and IV are present in all homologous sequences and Intron III is only present in Ss_Ssp2. The putative sorting signal peptide of Ssp1, VxPx is shown at N-terminus. VxPx IV III II I

PAGE 58

58 Figure 2-3. Phylogram of Ss_Ssp1 homologs from S. sclerotiorum (Ss), S. minor (Sm), S. trifoliorum (St), B. cinerea (Bc), A. flavus (Af) and A. oryzae (Ao). Unrooted neighbor-jointing phylogenetic tree cons tructed based on the multiple sequence alignment. Ao_SspA and Ao_SspB were a dded into the alignment and phylogram.

PAGE 59

59 Figure 2-4. Western blot, Northe rn blot and Semiquantitative RT-PCR analysis for Ssp1 protein accumulation and transcripts accumulation in different developmental stages. (S1= stage I sclerotia, S2=stage III sclerotia, S3=s tage IV sclerotia, Sma=mature sclerotia, Smy=myceliogenically germinated sclero tia, Sca= carpogenically germinated sclerotia, A1= etiolated stipes, A2= diffe rentiating tipes, A3= expanded apothecia, Ama=mature apothecia, pH3=mycelial susp ension culture in pH3 medium for 4 hours, pH7=mycelia suspension culture in pH7 medium for 4 hours).

PAGE 60

60 0 1 2 3 4 5 6 MyIIIIIVVIEtio Developmental StagesLog10 of relative copy number of ssp1 transcripts Figure 2-5. Quantitative RT-PCR results. The X axis represents the ssp1 transcripts in different developmental stages (My= mycelia, I= stage I sclerotia, III= stage III sclerotia, IV= stage IV sclerotia, VI= stage VI sclerotia, Etio= Etiolated stipes). The Y axis represents the LOG10 values of ssp1 transcript copy number in each developmental stages divided by the copy number of ssp1 transcripts in Mycelial stage.

PAGE 61

61 Figure 2-6. Semi-quantitative RT-PCR of ssp1 transcriptional products in different S. sclerotiorum isolates. (Lane1: vegetative mycelia of WT 1980 isolate, Lane2: mycelia of WT with sclerotial in itials, Lane3: LMK44, Lane4: LMK28, Lane5: A-1, Lane6: mycelia of WT 1980 isolate under pH7, Lane 7: mycelia of WT 1980 isolate treated with 2.5mM caffeine, Lane8: snf1 stage IV sclerotia, Lane9: pac1 stage IV sclerotia) 1 2 3 4 5 6 7 8 9 ssp1 histone3

PAGE 62

62 Figure 2-7. Northern hybridization for ssp1 transcription in other sclerotial forming species. Total RNA isolated from S. trifoliorum and S. minor strain was labeled as St and Sm respectively. Total RNA isolated from two B. cinerea strains was labeled as Bc1 and Bc2. Total RNA isolated from vegetati ve hyphae was labeled as my and total RNA from sclerotia was labeled as scl. Total RNA from S. sclerotiorum (labeled as Ss) sclerotial initials (labeled as initial) was used as a positive control. ssp1 coding sequence was used as a probe. Hybridization of ssp1 coding sequence with St/Sm RNA was performed under 65 C and hybridization of ssp1 coding sequence with Bc was performed under 55 C. Ss St St Sm Sm Initial my scl my scl Ss Bc1 Bc1 Bc2 Bc2 Initial my scl my scl

PAGE 63

63 Figure 2-8. Semi-quantitative RT-PCR of ssp2 transcriptional products in different developmental stages (My. = vegetative mycelia, S1= stage I sclerotia, A1= etiolated stipes, A2= differentiating stip e, A3= expanded apothecia) ssp2 histone3 My. S1 A1 A2 A3

PAGE 64

64 Figure 2-9. Immunolocalization of Ssp1 in mature sclerotium and carpogenic germinated sclerotium with apothecial s tipe. 1) bright field micrograph of Preimmune sclerotium with 10 magnification. 2) bright field micrograph of mature sclerotium reacting with Ssp1 Ab with 10 magnification. Blue spots are where Ssp1 protein bodies exist. 3) assembled bright field micrograph of carpogenically germinated sclerotium with apothecial stipe (10 ma gnification). A clear region (C) around the stipe (STI) germination site can be distinguished with other regions in germinated sclerotia (SCL) showing Ssp1 deposition.

PAGE 65

65 Figure 2-10. A GFP expression vector with ssp1 5-UTR, pCT74-Pssp1. pCT74-Pssp1 derived from pCT-73 and pCT-74 ( from Lynda Ci uffetti, Department of Botany and Plant Pathology, Oregon State University). A 1kb fr agment including ssp1 5-UTR and first 18 bp of ssp1 coding region replaced original ToxA promoter region and was inserted into SalI/NcoI sites of pCT-73. The modifi ed new vector was designated as pCT73Pssp1. The 1.4 kb SalI fragment containing the hygromycin resistance gene was digested from pCT-74 and was ligated into the SalI site of pCT73-Pssp1. This new vector was designated as pCT74-P ssp1. Pst I pCT74-P ssp1 ~6.7kb HygR cassette 1.4kb ssp1 5-UTR with a coding region coding first 6 amino residues of Ssp1 ~1kb SGFP ~800bp NOS ~400bp Sal I Sal I Nco I Not I Pst I T3 primer T7 primer

PAGE 66

66 Figure 2-11. Fluorescent micrograph (1-5) and Differentia l Interference Contrast micrograph (610) for GFP expression of pCT74-P ssp1 in WT vegetative hyphae and mature sclerotia. The vegetative hyph ae and mature sclerotia of transformant containing ToxA-driven GFP were used as a positive control since GFP in this transformant can be expressed in any developmental stages in S. sclerotiorum And WT vegetative hyphae and mature sclerotia were used a negative control.

PAGE 67

67 CHAPTER 3 FUNCTIONAL ANALYSIS OF A SCLEROT IA DEVELO PMENT-SPECIFIC PROTEIN (SSP1) IN Sclerotinia sclerotiorum BY GENE DELETION Introduction Sclerotinia s clerotiorum (Lib.) de Bary in the Sclerotini aceae family is a devastating plant pathogen capable of infecting more than 400 plant species (Boland and Hall, 1994). S. sclerotiorum does not produce macroconidia. Survival a nd further dispersal rely on the formation of a sclerotium, long-term persistence of th is multihyphal structure a nd appropriately timed germination of it. In the field or under laborat ory conditions, various environmental factors can trigger the morphogenesis of this compact, highl y melanized, tuber-like hyphal aggregate (Chet and Henis, 1975; Le Tourneau, 1979; Willetts and Bullock, 1992; Willetts and Wong, 1980). A sclerotium can tolerate a range of adverse envi ronmental conditions, such as low temperature, low humidity and UV irradiation, and survive long periods of time in agricultural soils. Survival for periods as long as eight years have b een documented (Adams and Ayers, 1979). Under favorable environmental conditions, a dormant sclerotium either germinates and forms vegetative hyphae (myceliogenic germination) or an apothecial fr uiting body (carpogenic germination) that produces millions of ascospores Both types of germination can lead to plant infections, but most Sclerotinia diseases are initiated from hyphae produced by ascospores (Bolton et al ., 2006). In the past fifty years, research on sclerotia l development has changed from histochemical and ultrastructural analyses to genetic invest igations. Some genes a nd signal transduction pathways involved in sclerotial development have been characterized. An ambient pH signaling pathway (Rollins, 2003; Rollins and Dickman, 2 001) and cAMP signal transduction pathways (Chen and Dickman, 2005; Chen et al ., 2004; Jurick et al ., 2004; Rollins and Dickman, 1998) are the well-documented pathways know n to regulate sclero tial development. Investigations of a

PAGE 68

68 mitogen-activated protein kinase (MAPK) in S. sclerotiorum (Smk1) revealed that crosstalk between these two pathways (Chen et al ., 2004). Oxidative stress is al so demonstrated to be an important trigger of sclerotial initiation (Georgiou et al ., 2006; Patsoukis and Georgiou, 2007). Protein phosphatase 2A (PP2A) (Erental et al ., 2007) was demonstrated to play a role in sclerotial maturation and its activity is regu lated by Smk1 and NADPH oxidase suggesting an interaction between phosphatase s, MAPKs and reactive oxygen signaling. Another finding, not from S. sclerotiorum but from Aspergillus spp., has demonstrated that a gene mediating developmental light responses, veA which is required for cleistothecia development in A. nidulans is also required for sclerotial development in A. parasiticus (Calvo et al ., 2004). Other components that might play a role in sc lerotial development or sclerotial function are proteins that specifically and hi ghly accumulate in developing and mature sclerotia but not in other developmental stages. Sc lerotial specific protein (SSP), first described by Russo et al. (1982; 1985), exhibited a high level of accumula tion in mature sclerotial but could not be detected in vegetative hyphae while a much lowe r amount of SSP was det ectable in apothecia. This protein is found not only in S. sclerotiorum but also in other Sclerotinia spp. (Petersen et al. 1982). Immunoblots and ELISA analysis usi ng polyclonal anti-SSP antibodies further revealed that SSP homologs are present universally in determinate sclero tia-forming species in the Sclerotiniaceae but not in substratal stro ma-forming species within the Sclerotiniaceae or sclerotial forming species outside of the Sc lerotiniaceae (Novak and Kohn, 1991). The high level of SSP accumulation in sclerotia of Sclerotinia spp. and its specific pres ence in sclerotia-forming species of the Sclerotiniaceae aroused my interest in this protein. In Chapter 2, I reported that we designated SSP in S. sclerotiorum as Ss_Ssp1. The full length cDNA sequence of the Ss_ssp1 gene was obtained before the releasing of S. sclerotiorum

PAGE 69

69 genomic sequence assembly from the Broad Inst itute by searching translated EST sequences with short peptide sequences acquired by trypsin -digested-Ss_Ssp1-peptide sequencing. The full length genomic sequence of this locus was obt ained through a genome walking strategy. BlastP queries indicated that Ss_Ssp1 is an unknown protein corresponding to locus ID SS1G_14065 in the released S. sclerotiorum genome sequence ( http://www.broad.mit.edu/annota tion/fungi/sclerotinia_sclerotiorum/ ). A homolog, Ssp2 (SS1G_12133) is also present within th e genome. Northern analysis using ssp1 coding sequence as a probe and semiquantitative RT-PCR i ndicated that the high transcription of ssp1 only occurs in sclerotial developmental stages but not in vegetative hyphae or apothecial developmental stages. However, Western hybridizations show proteins accumulation both in sclerotial stages and apothecial stages but not in vegetative growth stage. Immunolocalization assays using antiSSP antibody show cross-reaction with Ss_Ssp1 in mature sclerotia. But carpogenically germinated sclerotia displayed a clear regi on in medulla around the germinated point These observations are consistent with tr anslocation of Ss_Ssp1 protein from the sclerotium to the apothecium. This has led me to hypothesize that Ss_Ssp1 serves as a nutrition reservoir for sclerotial germination. However, the lack of observed Ss_Ssp1 degradation in mature sclerotia or germinated sclerotia does not support this hypothesis. To further clarify the function of Ss_Ssp1 in sclerotial de velopment and function, I created a Ss_ssp1 deletion mutant and investigate the effect of Ss_Ssp1 loss on sclerotial development and germination. Materials and Methods Fungal Cultures and Maintenance The S. sclero tiorum wild type 1980 isolate was main tained and propagated on potato dextrose agar (PDA) (Difco, MI, U.S.A. ) plates at room temperature. For ssp1 mutants or the

PAGE 70

70 complemented strain, Cssp1, hygromycin (final c oncentration was 100g/ml) or bialaphos (final concentration was 5g/ml) was added to P DA media for maintenance and propagation. Nucleic Acid Isolation and Hybridization Genom ic DNA and RNA were isolated as previously described (Yelton et al ., 1984). Southern and Northern hybridizat ion were done according to the descriptions of Rollins (2003). DNA restriction nuclease used for genomic DNA digestion and restricti on sites are shown in Figure 1 as well as probes used for hybridization. Gene Replacement and Complementation The Ss_ssp1 replacement vector was constructed in the m anner described by Jurick (2007). Gene specific primer pairs, 5ssp 1MuL1 (5-CAATGTTGTGTAAGCAGCCTTTAC3)/5ssp1MuR1 (5-AGGCGCGCC CAATCGACTTAAGTATGAGTGTTGG-3) and 3ssp1MuL1 (5-AGGCGCGCC GGTTAATAACGAGGAGGAGGA-3)/3ssp1MuR1 (5ATGGGAATAAAGGTGTGATTG-3) were used respectively to amplify 1.2kb 5-UTR sequence with an Asc I restriction site (unde rlined) at 3-end and a 1.2kb 3-UTR with an Asc I restriction site at 5-end (unde rlined). The two amplicons were cloned into pGEM-T vectors (Promega, WI, USA) and the resulting vect ors were designated pSSP1-5 and pSSP1-3 respectively. Both pSSP1-5 and pS SP1-3 were double digested with Not I/Asc I and fragments separated on a 0.8% agarose TBE gel. The pSSP1-5 1.2kb fragment containing the ssp1 5 UTR and the 4.2kb fragment of pSSP1-3containg the 3 UTR and vector sequences minus a small portion of the multi cloning site, were ligated to form pSSP1-5+3. A hygromycin phosphotransferase ( hph ) cassette containing trpC promoter and terminator was released from the pGEM-HPH vector made by Hutchens (2005) using Asc I and ligated into Asc I digested pSSP1-5+3 to give rise to a 7.6kb ssp1 replacement vector, pSSP1-5+hph+3. This construct was used as a template to obtain two ssp1-hph hybrid amplicons for DNA transformation. This is

PAGE 71

71 split-marker gene repl acement system (Fairhead et al ., 1996; Fu et al ., 2006) to improve homologous recombination efficiency during gene replacement. The strategy for this method is shown in Figure1. Primer pair, spL (5-CAATGTTGTGTAAGCAGCCTTTAC-3)/hy (5AAATTGCCGTCAACCAAGCTC-3) was applied to amplify a 2.5kb fragment containing 5UTR with first 1.2kb hph coding sequence using pSSP1-5+hph+3 as a template. Primer pair, yg (5-TTTCAGCTTCGATGTAGGAGG-3)/spR (5-ATGGGAATAAAGGTGTGATTG-3) was used to amplify a 2.9kb fragment composed of the second part of hph coding sequence joined with the 3-UTR using pSSP1-5+hph+3. The 3 portion of the hph coding sequence overlaps with the 5 portion of the hph coding sequence in a 741bp re gion so that homologous recombination can occur in this re gion to reconstitute a complete hph cassette when recombined. DNA transformation of protoplasts was done according to the me thod previously described by Rollins (2003) For ssp1 complementation, 3.4kb amplicon containing full length WT Ss_ssp1 open reading frame flanked with 5-UTR and 3-U TR was inserted into pBARKS1 as described by Jurick and Rollins (2007).and Jurick and Ro llins (2007). Shrimp Alkaline Phosphatase (Promega, WI, USA) was used to improve ligati on efficiency. Constructed plasmids were all transformed into E. coli strain DH5 for propagation and plasmid isolation, enzyme digestion, gel electrophoresis, DNA fragment purification and ligation were conducted using standard procedures (Sambrook and Russell, 2001). Western Hybridization and Immunolocalization Lyophilized suspension cultured myc elia, sclerotia and apothecia from the WT isolate, the ssp1 mutant and the ssp1 complemented strain (Cssp1) were used for total soluble protein extraction as described by Jurick et al. (2004). Primary antibody raised from rabbit immunized against denatured Ss_Ssp1 is acquired from J. Van Etten (University of Nebraska, NE, USA) and designated as SspVE-Ab. Other two antibodies ac quired from L. Kohn (University of Toronto,

PAGE 72

72 Toronto, Canada) were derived fr om immunized chicken. The one raised against native Ss_Ssp1 is designated as SspLKn-Ab and another one rais ed against denatured Ss_Ssp1 is designated as SspLKd-Ab. For Western blots, 20 g of extracted soluble protei ns were separated with 12% SDS-PAGE and transferred to PVDF membrane (Bio-Rad, CA, USA) by semi-dry electroblotting. The membranes were treated with PBST (80mM Na2HPO4, 20mM NaH2PO4, 100mM NaCl, 0.1% Tween-20) cont aining 5% non-fat dry milk overnight at 4C and then incubated with primary antibody for 1hr at room temperature. The secondary antibody was goat anti-rabbit Ig-conjugated alkaline phosphatase (Bio-Rad, CA, US A). The blots were developed with substrate buffer containing 0.1% NBT and 0.1% BCIP. For immunolocalization assays, fresh, mature sclerotia from the WT isolate, the ssp1 mutant and the Cssp1 strain were harvested, fixed and embedded using the method previously described by Kladnik et al. (2004) Embedded samples were sectioned (3 m) using a rotary microtome HM325 (Richard-Allan Scientific, MI, USA) and mounted on ProbeOne Plus Microscope Slides (F isher Scientific, USA) in cytoseal (Richard-Allan Scientific, PA, US A). Ready to use sections were dewaxed in histoclear (National Diagnostics GA, USA) and rehydrated in an ethanol series followed by hybridized with primary Ab described above for Western blots. Primary Ab was diluted (1:7500) in PBS with 10% goat-serum afte r the sections were blocked in PBS with 10% goat-serum for 20min. After an overnight incubatio n in a humidified chamber at 4C, the slides were rinsed and incubated with PBS twice for 5min each time. The same secondary Ab (1:500) used in previous Western blots was used to detect the Ss_Ssp1 Ab for 30min at RT. Histochemical detection was performed using NBT and BCIP substrate as descri bed for Western blots for 1hr. The slides were dehydrated in the graded etha nol/water series again and m ounted in cytoseal for light microscopic observation.

PAGE 73

73 Apothecia Production and Acqui sition of Ascospore Progeny Mature sclerotia for apotheci a induction were produced from cultures gro wn on autoclaved smashed potatoes containing 1.5% agar in petri dishes (20cm ) at room temperature. Antibiotics were added to this potato agar when needed. To produce apothecia, mature sclerotia were washed with repeated changes in running water gently to avoid breaking sclerotia. Clean sclerotia were surface sterilized by immersion in 0.5% bleach for 5 min and then rinsed with sterile water for 5min. After 3 rinses, sclerotia were dried in a sterile airf low hood on sterile paper towels for 8 hours. Dried sclerotia were placed on the surface of glass petri dishes (10cm ) which were covered on the bottom thinly with autoclaved, water-saturated vermiculite. Plates were placed at 0C fo r 24 hours and then at room temperature for 24 h for 3 cycles. After the third cycle, plates were moved to a 15C incubator with c onstant lighting, using fluorescent, cool white bulbs. Once mature apoth ecia developed 6-8 weeks, ascospores from the ssp1 mutant were harvested using a vacuum funnel assembly previously described by Steadman (1974). To acquire single-ascospor e isolates, diluted ascospore su spension was spread onto PDA plates to form into single colonies and then the hyphal tip of each colony was transferred to a new PDA plates with hygromycin to grow into mycelia. Two-step Semiquantitative RT-PCR Five mi crograms of total RNA were used as templates to synthesize first strand cDNAs using Superscript II (Inv itrogen, CA, USA) reverse transcript ase. Reverse tran scription reaction mixtures included 1 l of Superscript II reve rse transcriptase, 4 l of 5x first strand buffer (Invitrogen, CA, USA), 4 l of 25mM MgCl2, 2 l of 0.1mM DTT, 1 l of RNase inhibitor (Invitrogen, CA, USA), 1 l of 10mM dNTPs, 1 l of 0.5 g/ul oligo (dT), 5 g of total RNA and made up to a final volume of 20 l with RNase-free water. The reactions were performed at 42C

PAGE 74

74 for 50min, then terminated by incubating the re action mixture at 70C for 15min. RNaseH, 1 l, was used in a final step to degrade RNA te mplates for 30min. One microliter of 6x diluted reverse transcription reactions was used as templates for PCR. The PCR reaction mixture included 0.3 l of 5U/ l Taq DNA polymerase, 5 l of 10x Mg-free buffer, 2.5 l of 25mM MgCl2, 4 l of 2mM dNTPs, 1 l of 2mM primer, 2 l of undiluted or diluted RT-reactions and made up to a final volume of 50 l with double-distilled sterile wa ter. The thermocycle program consisted of 4min at 94C, 40 cycles of 15sec at 94C, 30sec at 56C a nd 30sec at 72C, followed by 7min at 72C. Primer pair, ssp1qR (5-TTGAACCTTGTCTTTCGGAATGAAG-3) and ssp1qF (5-GTTCACAATGGGCATACTTTTCAG -3), were used to amplify 269bp fragment in semi-quantitative PCR products. Primer pair, ssp2-R (5-TA TTTCCATTGAACGCTCCAC 3) and ssp2-F (5-GTACCTCTGCGCCTGATGATA3) were used to amplify a 363bp fragment as an indicator of ssp2 expression. A 338bp PCR product of Histone H3 SS1G_09608.1 (GenBank ID for CoreNucleotide sequence: XM_001589836), was amplified using primer pair H3-F2 (5-TCATCAATCCACAACAAC CAC-3) and H3-R1 (5AGAGCACCAATAGCGGAAGA-3) and used as an expression normalization control. Results Deletion of ssp1 Locus The split ma rker-based strategy used for ho mologous recombination and specific deletion of the Ss_ssp1 ( Ss_ssp1 ) locus is shown in Figure 3-1A To screen for homokaryotic Ss_ssp1 deletions within the hygromycin resistant transformants, a 5 -UTR sequence and the partial coding sequence of Ss_ssp1 were used as Southern hybridization probes with XbaI-digested genomic DNA isolated from hygromycin resistant transformants. As shown in Figure 3-1C, the wild type hybridizes with a 4415bp band when the 5-UTR sequence is used as a probe while the homokaryotic knock-out mutant hybridizes with a 5472bp band due to the replacement of

PAGE 75

75 Ss_ssp1 with the hygromycin cassette. Heterokaryotic transformants show both of 4415bp band and 5472bp band (results are not shown). When using Ss_ssp1 coding sequences as a probe, there is no band detected from homokaryotic tr ansformants while a 4415bp band is present in the wild type isolate (Figure 3-1B) and a comparatively weaker band of the same size can be seen for heterokaryotic transformants (results are not shown). Based on this Southern analysis, one out of ~80 Ss_ssp1 transformants proved to be a genetically pure Ss_ssp1 knock-out mutant. Genetic complementation of this strain was pursued using a vector containing the Ss_ssp1 coding sequence flanked with 1.2kb of contiguous upstream sequence and 1.2kb of contiguous downstream sequence on a vector containing the bar gene for bialaphos selection. Southern hybridization indicated that these sequences were successfully introduced back into the Ss_ssp1 mutant at multiple loci (Figure 3-1B). Absence of Ss_Ssp1 in the Ss_ssp1 Deletion Mutant Northern hybridization performe d with RNA isolated from WT and Ss_ssp1mutant sclerotia demonstrated that Ss_ssp1 transcripts are absent from the Ss_ssp1mutant (Figure 32A). A Ss_Ssp1 immunolocalization assay using mature sclerotia of the wild type and the Ss_ssp1mutant indicated that Ss_Ssp1 fails to accumulate in the Ss_ssp1 mutant whereas it is readily redetectable deposited in protein bodies of WT mature sclerotia (Figure 3-2B). Effects of Ss_ssp1 Deletion on Sclerotial Develo pment and Apothecia Development Deletion of Ss_ssp1 from S. sclero tiorum does not affect the phenotype of mature sclerotia when grown on PDA plates without hygromycin se lection while maturation of most sclerotia from mutants is blocked when grown on PDA with hygromycin selec tion (Figure 3-3). The Ss_ssp1mutant is a pure homokaryotic knock-out ba sed on the above Southern hybridization data. To further validate the purity, single asco spore isolates derived from this homokaryotic mutant were collected and also displayed this phenotype when grown on PDA with or without

PAGE 76

76 hygromycin (results are not shown). Th erefore the lack of maturation of Ss_ssp1sclerotia on PDA with hygromycin is not due to heteroka ryotic impurity conferring partial hygromycin resistance. By some mechanism, hygromycin itself appears to contribute to the formation of immature sclerotia on PDA with hygromycin. In contrast, a WT transformant containing a randomly inserted hygromycin casse tte does not display a block in sclerotial maturation on PDA with hygromycin (Figure 3-3) which indicates that the Ss_ssp1 deletion leads to the failure of maturation for most sclerotia formed on P DA plates with hygromycin. However, the Ss_ssp1 deletion does not cause a noticeabl e effect on apothecial developm ent. The mature sclerotia of Ss_ssp1 still germinated into fertile apothecia (Fi gure 3-3) though the timing for germination is delayed by approximately five weeks relative to wild type. Ssp2 and a 15.5kDa Protein are Upregulated in the Ss_ssp1 Mutant An interesting phenome non observed in Ss_ssp1 mutants is the upregulation of ssp2 transcript and protein accumulation in Ss_ssp1 sclerotia. ssp2 is the only homolog of Ss_ssp1 in S. sclerotiorum genome but its expre ssion pattern varies markedly from that of ssp1 (Chapter 2). RT-PCR results presented in Chapter 2 revealed that ssp2 transcripts accumulate preferentially throughout apothecial development but not in sclero tial initials or vegeta tive hyphae. Transcript accumulation results shown in Figure 3-5 indicate that in WT ssp2 transcripts are detectable in stage IV sclerotia at a low level compared to apothecia. However the accumulation of ssp2 transcripts in stage IV Ss_ssp1 sclerotia increased to a level exceeding that present in WT apothecia based on the semi-quantitative RT-PCR (Figure 3-5). Furthermore, Western hybridization with SspVE-Ab crossreacts with a protein approximately 1-2 kDa larger than Ss_Ssp1in both sclerotia and apothecia of the Ss_ssp1 mutant and complemented strain (Figure 3-4). This cross reactivity was not observed in western blots of WT sclerotial proteins previously. The observations that the migration of this protein matches that of Ssp2 and given the

PAGE 77

77 level of sequence conservation between Ss_Ss p1 and Ssp2, this antigenically crossreacting protein is likely to be Ssp2. The failure to observe a crossreacting band in WT sclerotial and apothecial Westerns previously is likely due to the low relative level of Ssp2 and masking of crossreactivity due to the abundance of Ss_Ssp1. The combination of Western analysis and RTPCR results strongly suggests that ssp2 expression is up-regulated as a result of Ss_ssp1 deletion. In the complemented strain, ssp2 expression levels in sclerotia and apothecia are not reduced to wild-type leve ls although Ss_ssp1 expression is recovered in matu re sclerotia. This might be attributed to a lower level of Ss_ssp1 expression in this strain due to the random insertion of Ss_ssp1 during complementation. We also observed th at the accumulation of the 15.5kDa protein previously described by Russo et al. (1982) is also increased in Ss_ssp1 mutant and the complemented strain. Discussion Previous stud ies have demonstrated that Ss_Ssp1 accumulates in membrane-bound protein bodies specifically in sclerotia (Russo and Va n Etten, 1985). Furthermore I demonstrated in Chapter 2 that Ss_Ssp1 is translocated from the sclerotium to the apothecium, but the Ss_ssp1 transcript is sclerotial specific. These findings indi cate that this protein plays an important role in the function of sclerotia, particularly in th e support of apothecial development, yet not necessarily a nutritional role. The deletion of the Ss_ssp1 gene did not affect the sclerotia development on solid media in the absence of antibiotics. Adding hygrom ycin to the growth medium, however, resulted in a block in the ma turation of most sclerotia without a distinct negative effect on hyphal growth. Although Ss_ssp1 is resistant to hygromycin via transformation using hph as a selection marker, and single ascospore selection and Southern analysis confirm the homokaryo tic state of the mutant, hygrom ycin still affects sclerotia development. This indicates that the deletion of Ss_ssp1 itself may attenuate the tolerance to

PAGE 78

78 hygromycin specifically during scle rotial development and lead to sclerotia arrested in an immature state. A mechanism for this decrease d tolerance in the scle rotial state is unknown. Lack of Ss_Ssp1 does not produce any observed effects on sclerotial germination other than a delay in germination. However, the observation that Ssp2 transcript and protein are both upregulated and another 15.5kDa major protein accumulation is also increased in Ss_ssp1 sclerotia and apothecia suggests that the Ss_Ssp1 homolog Ss_S sp2 or other proteins with similar functions might be able to functiona lly compensate for the absence of Ss_Ssp1. Consequently, the maturati on of sclerotia in the Ss_ssp1 null mutant affected by hygromycin indicates a possible role of Ss _Ssp1 in protecting sclerotia fr om compounds secreted by other organisms in the environment. Ss_ssp1 is a development specific gene accumu lates to a high level only in certain developmental stages. There are few other exam ples of genes with development specificity found in fungi, e.g., muiridin described by Van Etten et al. (1979) and Peterson et al. (1983) which accumulates in dormant spores of Botrydiplodia theobromae but is not present or present in very low amounts in vegetative hyphae; an abundant perithecial protein (App) found by Nowrousian et al. (2007) which is specifically expressed in perithecia of Sordaria macrospore and Neurospora crassa but not present in hyphal tissue; and the spore-specific protein ( ssp1) from Ustilago maydis which shares homology with ot her fungal oxygenases and is highly expressed in mature teliospores (Huber et al., 2002). The gene encoding muiridin and the biological function of this protein have not b een characterized. Deleti on of App unexpectedly had no effects on the fertility of S. macrospore or N. crassa and there are no distinct differences in perithecial morphology or developmental timing between app and wild type strains

PAGE 79

79 (Nowrousian et al ., 2007). Likewise, disruption of ssp1 in U. maydis did not give rise to an obvious phenotype either. Looking to other biological syst ems may give us some insight into the functions of highly accumulating, tissue-specific proteins. In plan ta, the most common development specific proteins are storage proteins. Russo and Van Etten (1982) even borrowed the term storage protein from plant storage protei n to refer Ss_Ssp1 as a fungal st orage protein since their similar developmental specificity and similar deposi tion location in cells (protein bodies). The investigations of plant storage proteins ar e comparatively much more comprehensive and thorough than studies in fungi. Thes e proteins can be categorized as seed storage proteins and as vegetative storage proteins (Shewry et al ., 1995). Most plant seed stor age proteins do not display biological activities besides the role of a nutritional reservoi r (Larkins, 1981). Some are not required for seed germination (Kriz and Wallace, 1991). But there are some storage proteins, especially tuber storage proteins (Flores et al., 2002; Shewry, 2003), which do show specific biological activities. Ss_Ssp1 does not show any seque nce similarity or structural similarity with any described plant storage protein. This suggests a very different evolutionary origin for fungal storage proteins and potentially differing f unctions. More examples of fungal developmentspecific genes should help to determine if func tional parallels can be drawn between storage proteins in plants and fungi and determin e if some functions are common to both.

PAGE 80

80 Figure 3-1. A Split-marker strategy used for Ss_ssp1 replacement and identification. A) The strategy used for Ss_ssp 1 replacement shows the recombination events and the resulting Ss_ssp1 deletion. B) and C) Southern hybridization with probe1 and probe2 to confirms the gene repl acement and genetic purity of Ss_ssp1and two single-ascospore isolates (Asco1 & Asco2). The reintroduction of the Ss_ssp1 gene into Ss_ssp1 to create a complemented strain (Cssp1) was also confirmed. Genomic DNAs from each strain were digested with XbaI. 500bp 5-UTR h y 3-UTR y g Xba I Xba I Xba I 5-UTR ssp1 3-UTR Probe 2Probe 1 5-UTR hyg 3-UTR hy yg spL spR A 5472bp 4415bp wt ssp1 C ssp1 pBAR Asco1 Asco2 C 4415bp wt ssp1 C ssp1 pBAR Asco1 Asco2 B Probe 1 Probe 2

PAGE 81

81 Figure 3-2. Transcript a nd protein accumulation of Ss_ssp1 in Ss_ssp1 sclerotia. A) Northern hybridization for the purified Ss_ssp1 mutant and a heterokaryot ic (ht) mutant stage IV sclerotia and wild type tissues. B) Immunolocaliza tion of wild type mature sclerotium and a Ss_ssp1 mature sclerotium. WT sclerotial initials WT mycelia ssp1 sclerotia ht sclerotia WT stage III sclerotia Total RNA ssp1 A WT mature sclerotium 40 x magnification ssp1 mature sclerotium 40 x magnification Ss p LKn-Ab B

PAGE 82

82 Figure 3-3 Phenotype of Ss_ssp1 sclerotia on PDA with and without hygromycin and apothecium of the ssp1 mutant. WT on PDA /-HPH WT -hph on PDA /+ HPH ssp1 on PDA /+ HPH ssp1 on PDA /HPH 0 5 10 15 20 25 30sclerotial number per plate 0 0.05 0.1 0.15 0.2 0.25 0.3Sclerotial dry weight per plate WT HPH empty vector ssp1on PDA /+ HPH ssp1 on PDA /HPH ssp1 germinated sclerotium with apothecium

PAGE 83

83 Figure 3-4. SDA-PAGE and West ern hybridization with scleroti al and apothecial proteins extracted from wild type, Ss_ssp1 and Cssp1 scl apo scl apo scl apo scl apo WT ssp1 Cssp1 WT diluted SDS-PAGE SspLKn-Ab SspVE-Ab 15.5kDa p rotein

PAGE 84

84 Figure 3-5. RT-PCR detection of Ss_ssp1 and Ss_ssp2 transcript accumulation in Ss_ssp1 stageIV sclerotia. Ss_ssp1 and Ss_ssp2 transcript accumulation in WT mycelia (my), StageIV sclerotia (scl) and expanded a pothecia (apo) are used for comparison. Histone H3 transcript accumulations in corresponding stages was used for normalization. s sp1 ssp2 M WT W T my scl apo my scl apo ssp1 scl ssp1 scl histone H3 my scl apo WT M ssp1 scl

PAGE 85

85 CHAPTER 4 TRANSCRIPT PROFILING DURING SCLEROT IAL INITIATION BY LONG-OLIGOMER MICROARRAY ANALYSIS Introductio n The filame ntous fungus, Sclerotinia sclerotiorum (Lib.) de Bary, is a necrotrophic plant pathogen with very broad host range (Bola nd and Hall, 1994; Purdy, 1979). An important characteristic of this fungus is its ability to form a specialized, multihyphal resting structure known as a sclerotium. These macroscopic t uberoid hyphal aggregates are surrounded by a melanized rind and can withstand adverse enviro nmental conditions under which mycelia can not survive. As a long-term survival structure, sc lerotia maintain viabi lity of the fungus through winters in temperate climates, in environments with low humidity and in conditions of high temperature and high UV radiati on. Upon return of optimal envi ronmental conditions, sclerotia germinate directly as mycelia (myceliogenic germination) or as one or multiple apothecia (carpogenic germination). The millions of ascospores forcibly discharged from a mature apothecium can germinate and grow saprophitica lly to propagate the fungus at a time and place distant from the original colonization. Hyphae originating from sclero tia or from ascosporederived, saprophytic mycelia can initiate new inf ections of plant hosts. Colonization causes cell death and necrosis of tissue. Under favorable environmental conditions the whole plant may become colonized and die. Thus, sclerotium developm ent is a critical stage in the disease cycle: it is essential for long-term survival and supports the production of inoculum. Studies of sclerotial development extend back for many decades with an early focus on microscopic and histochemical analyses (Bullock et al ., 1980; Saito, 1974; Willetts and Bullock, 1992; Willetts and Wong, 1971). In recent years, these studie s have moved towards dissecting molecular mechanisms involved in regulating sclerotia l development (Chen and Dickman, 2005; Chen et al ., 2004; Rollins, 2003; Rollins and Dickman, 1998).

PAGE 86

86 Small molecules and signal transduction path ways known to be involved in sclerotial development include: 1) ambient pH and the pH-responsive tran scription factor pac1 (Rollins, 2003; Rollins and Dickman, 2001); cAMP and the adenylate cyclase encoding gene sac1 (Jurick and Rollins, 2007; Rollins and Dickman, 1998); 3) a PKA-independent but Rap-1 dependent cAMP signal transduction pathway interac ting through the map kinase Smk1 (Chen and Dickman, 2005; Chen et al., 2004); 4) oxidative stress (Georgiou et al ., 2006; Patsoukis and Georgiou, 2007). 5) protein phosphatase 2A (PP2A) (Erental et al ., 2007) associated with Smk1 and NADPH oxidase; 6) veA a gene mediating developmental light responses, associated with Aspergillus parasiticus sclerotial development (Calvo et al., 2004). These investigations reveal that interplay exists among different signal tran sduction pathways. Since re gulation of sclerotial morphogenesis requires complex temporal a nd spatial coordination of multiple genes, investigations of individual ge nes or molecules do not provide a comprehensive view of the regulatory networks involved in this developmen tal process. Owing to the availability of the S. sclerotiorum genome sequence that was assembled and released by the Broad Institute , a full genome, long-oligomer microarray has been developed (Rollins et al unpublished) that will allow for the comprehensive analysis of di fferential gene expre ssion during sclerotial development. Since the first fungal microarray stu dy was reported in the budding yeast Saccharomyces cerevisiae in 1997 (DeRisi et al., 1997), microarrays using various platforms and completeness have been successfully constructed for more than 20 species of filamentous fungi. These have been used to identify differentially expre ssed genes related to metabolism, development, pathogenesis, symbiosis and processes of indus trial interest (Break spear and Momany, 2007).

PAGE 87

87 The earliest microarray studies for fungal de velopment were cDNA microarrays used to identifying light-regulated gene s and clock-controlled genes in Neurospora crassa (Correa et al ., 2003; Lewis et al ., 2002; Nowrousian et al ., 2003). cDNA microarrays were also used to investigate the expression of genes related to fruiting body development in Sordaria macrospora (Nowrousian et al ., 2005). Later, long-oligomer microarr ay technology was applied to identify genes differentially expressed during conidial germination in N. crassa (Kasuga et al., 2005) and Affymetrix genechips recently were used to inve stigate differential expression of genes involved in perithecium development of Fusarium graminearum (Hallen et al ., 2007). In this chapter, I use a long-oligomer microarray developed by th e Rollins lab to identif y genes differentially expressed during sclerotial initiation relative to vegetative hyphal growth in order to gain new insights into the number and iden tity of genes that change th eir expression when sclerotial development is initiated. Gene deletion analysis was used to conf irm if genes differentially expressed during sclerotial initiation play a role in sclerotial developm ent. I chose a gene encoding -glutamyl transpeptidase ( -GT) which was identified as being upregulated during sclerotial initiation for functional characterization. -GT is a ubiquitous enzyme cat alyzing the transfer of a -glutamyl moiety of glutathione (GSH) and other c-glutam yl compounds to amino acids and peptides (Tate and Meister, 1981). The transfer of a -glutamyl moiety from GSH is an essential first step in GSH degradation in mammals. -GT homologs in Arabidopsi s and yeast display similar enzymatic activity properties, post translationa l processing and cellular localization to the mammalian enzymes (Mehdi et al., 2001; Storozhenko et al ., 2002). Characteristics of -GTs function and regulation in filamentous fungi has not been established. There are three -GTencoding genes (SS1G_14127, SS1G_10940 and SS1G_05330) predicted in S. sclerotiorum

PAGE 88

88 genome. Previous preliminary cDNA microarray analysis for sclerotial in itiation indicated that one of these (SS1G_14127) is among the genes with the highest upregula tion during sclerotial initiation compared with vegetativ e hyphae from liquid shake cultures. I present here that this GT also displays a consistent differential expression pattern when comparing hyphal growth in plate culture versus sclerotia initiation in plate culture using long-oligomer microarray hybridization analysis. I further tested the hypothesis that deletion of the -GT-encoding gene (SS1G_14127) will affect sclerotial development and germination. Material and Method Culture Growth and Harvesting S. sclerotio rum wild type strain 1980 was cultured on potato dextro se agar (PDA) plates. An approximately 1cm2 mycelial plug from the expanding edge of a colony was transferred to a PDA plate overlaid with a cellophane film (Promega, WI, USA). Vegetative hyphae were harvested by peeling the colony from the film before the expanding hyphae reached the edge of the plate, ca. 2 days. To harvest tissue representing sclerotial init ials, the colonies were allowed to reach the edge of the plates until sclerotial initials (Stage I sclerotia) scattered on the surface of the plate were obvious before peeling the entire colony from the film, approximately 3 Days. Eight independent biological replications were collect ed of each tissue type. Construction of S. sclero tiorum Oligonucleotide Microarrays The construction of the S. sclerotiorum genome plus microarray will be described in a publication independent from this dissertation. In brief, two independent 60mer oligonucleotide probes were designed to repr esent all 14,522 predicted genes from the automated genome annotation < http://www.broad.mit.edu/annotation/genome/sclerotinia_sclerotiorum/ Home.html>. In addition, two independent probes representing 1,012 randomly selected reverse complemented predicted gene sequences; 1066 orphan Expressed Sequence Tags (ESTs) that did not match a

PAGE 89

89 predicted gene; 7 genes from host plants, and an additional pool that included only one probe from 7497 orphan ESTs based on a sequence clusteri ng analysis performed at the University of Floridas Interdisciplinary Center for Biot echnology Research bioinformatics core were included. These probes were synthesized in situ on glass slides by Agile nt Technologies (Santa Clara, CA) using phophoramidite chemistry (Hughes et al ., 2001). In addition there were 1,417 probes used as internal quality controls for each hybridization. This probe set, 40,028 independent probes, was printed in a 4x44k format, i.e., 4 arrays per glass slide each containing 40,028 probes. Total RNA Extraction, Microarray Hybr idization and Image Acquisition Total RNA was extracted from lyophilized tissues of each of the eight vegetative hyphae and the eight sclerotial initial samples descri bed above using TRIzol (Invitrogen, CA, USA) following the manufacturers instruction. RNA was purified via RNeasy Mini kit (Qiagen, MD, USA) to remove DNA from total RNA based on the manufacturers prot ocol. Eight biological replicates were performed for both vegetative hyphae and sclerotial init ials. cDNA synthesis, labeling and array hybridization were carried out according to the method described by Ma et al. (2006). Images of hybridization arrays were s canned using an Agilent scanner and the raw intensity hybridization signals were quantified using Agilent microarray scanner and feature extraction software. Data Analysis Statistical analyses of the hybr idization fluorescence intensities were perform ed by Drs. G. Casella and Jie Yang (University of Florida, Department of Statisti cs). In brief, signal intensity values for each probe were compared among th e biological replicati ons first for probe by treatment interactions. A probability that differe nces (magnitude or direction of expression) between two probes representing the same gene can be explained by chance was assigned.

PAGE 90

90 Second differential gene expres sion across all eight biological replications under different treatments for genes with 2 probes was analyzed by an F-Test and the probability of differential expression between treatments for each gene was assigned. A multiple corrections test was run and a Bonferroni cutoff of 0.001 was used to iden tify genes that were differentially regulated between vegetative hyphae and th e sclerotial init ial stage. To reduce the number of genes analyzed, we combined genes differentially expre ssed in this microarray analysis with genes determined to be differentially expressed in another microarray analysis for apothecial development (Rollins et al unpublished data). The Short-Time Series Expression Miner (STEM) tool (Ernst and Bar-Joseph, 2006) was used to examine the combined data for genes that have peak expression in vegetative hyphae or sclerotial initials and expression levels in apothecia lower than either of these two st ages. Expression patterns for thes e genes were chosen for further clustering analysis via Gene Clustering 3.0 (Eisen et al ., 1998). The functional annotations of autocalled genes were obtained from a secure website http://urgi.versailles.inra.fr/pascodb/ developed by the consortium for joint m anual annotation of the S. sclerotiorum and Botrytis cinerea genomes. Quantitative RT-PCR 5 g of DNaseI treated total RNA from the sa me pools used for microarray analysis were combined with 1 l of 0.5 g/ul oligo (dT) in a volume of 10 l, and incubated for 10min at 65C. The sample was cooled on ice for 5min and combined with 4 l of 5x first strand buffer (Invitrogen, CA, USA), 1 l of 100mM MgCl2, 2 l of 0.1mM DTT, 1 l of RNase inhibitor (Invitrogen, CA, USA) and 1 l of 10mM dNTPs. After incuba ting the mixture at 70 C for another 2min, 1 l of Superscript II reverse transcriptase was added to make a final volume of 20 l for the reverse transcription (RT) reaction. Re actions were performed at 42C for 50min, then terminated by incubating the mixt ure at 70C for 15min. RNaseH, 1 l, was used in a final step to

PAGE 91

91 degrade RNA templates. Real time PCR was performed in SmartCycler or SmartCycler II (Cepheid, CA, USA) with qPCR SuperMix fo r SyberGreen (Bio-Rad) in a volume of 25 l. Oligonucleotide primers used for qPCR are listed in Table 4-2. The thermocycle program was as follows: 4min at 94C, 40 cycles of 15sec at 94C, 30sec at 56C and 30sec at 72C, and followed by 7min at 72C. Each reaction was carried out in triplicate and mean Ct values of triplicates were used to calculate expression rations accord ing to delta-delta method presented by Perkin Elmer Applied Biosystems (Perkin Elmer, Forste r City, CA). The Ct values for the amplicon derived from Histone3 mRNA were used as the normalization reference. Constructing a -GT Gene Deletion Mutant ( ggt ) and its Genetic Complementation To improve homologous recombination efficien cy, a split-marker gene replacement system (Fairhead et al.1996; Fu et al .2006) was used to obtain a ggt (SS1G_14127) gene replacement knock-out mutant. The strategy for gene replacement is shown in Figure 4-3. A plasmid containing a hygromycin cassette flanked with ~1.2kb of 5-UTR and 3-UTR sequence from the wild type ggt locus (ggt-5+hph+3) was constructed ba sed on the method described by Jurick and Rollins (2007). Primer pairs, 5 ggtMu-L1 (5-TTCAAAAGGGCTGAGTGTGA3)/5ggtMu-R1 (5-AGGCGCGCC CAACCCGGGAGAATGAGTTA-3) and 3ggtMu-L1 (5AGGCGCGCC GGGGTTTTAATCTAGGATACGG-3)/3ggtMu-R1 (5GAAAGGTGGTGGACTTTGGA-3) were used respectively for PCR to acquire 5-UTR (attached with Asc I (underlined) at 3 end)and 3-UTR (attached with Asc I (underlined) at 5 end) amplicons of ggt from wild type S. sclerotiorum genomic DNA. The detailed steps for construction of the ggt-5+hph+3 construct followed the previously described procedure (2007). Two split fragments (5-UTR attached with first part hph sequence hy and the second part overlapping hph sequence yg attached with 3-UTR as shown in Figure 4-3) were transformed into wild type protoplasts. These fragments we re derived from amplification of ggt-5+hph+3

PAGE 92

92 using primer pairs ggtL (5-TTCAAAAGGGCTGAGTGTGA-3)/hy (5AAATTGCCGTCAACCAAGCTC-3) and yg (5-TTTCAGCTTCGATGTAGGAGG-3)/ggtR (5GAAAGGTGGTGGACTTTGGA-3). Transformation of wild type protoplasts was done according to the method described by Rollins (2003). For ggt complementation, 4.2kb amplicon containing a full length WT ggt open reading frame flanked with 5-UTR and 3-UTR was amplified and inserted into pBARKS1 with a bar gene for bialaphos se lection as described by Jurick and Rollins (2007). Shrimp Alkaline P hosphatase (Promega, WI, USA) was used to improve ligation efficiency. Constructed plasmids were all transformed into E. coli strain DH5 for propagation. Plasmid isolation, enzyme digestion, gel electrophoresis, DNA fragment purification and ligation were conducted using standard procedures (Sambrook and Russell, 2001) or according to the manufacturers instruction. Microscopy For light mi croscopic observation, fresh matu re sclerotia from the WT isolate, the ggt mutant and the genetically complemented stra in, Cggt, were harvested, fixed and embedded using the method previously described by Kladnik et al. (2004). Embedded samples were sectioned (5 m) using a rotary microtome HM325 (Richard-Allan Scientific, MI, USA) onto ProbeOne Plus microscope slides (Fisher Scientif ic, USA). Ready to use sections were dewaxed in Histoclear (National Diagnostics, GA, USA) and rehydrate in ethanol series, stained with Amido Black 10 B (Bullock et al ., 1980) and mounted in cytoseal (Richard-Allan Scientific, PA, USA). Apothecia Production for ggt Mature sclerotia for apotheci a induction were produced from cultures gro wn on autoclaved smashed potatoes with 1.5% ag ar in petri dishes (20cm ) at room temperature. Antibiotics were added to the potato agar when needed. To produce apothecia, mature sclerotia are washed

PAGE 93

93 with repeated changes in running water gently to avoid breaking sclerotia. Clean sclerotia were surface sterilized by immersion in 0.5% bleach for 5 min and then ri nsed with sterile water for 5 min. After 3 rinses, sclerotia were dried in hood on sterile paper towels for 8 hours. Dried sclerotia were placed on the su rface of glass petr i dishes (10cm ) containing a layer of autoclaved water-saturated ve rmiculite. Plates were placed into C for 24 hours and then room temperature for 24h for 3 cycles. After th e third cycle, plates were moved to a 15C incubator with constant lighting, us ing fluorescent, cool white bulbs. Results General Information for Microarray Analysis As shown in Table 4-1, mi croarray analysis indicated that 1177 genes out of 14,522 total autocalled genes (8%) were upregulated beyond a two-fold cut-off during sc lerotial in itiation. Of the 1177 genes, there are 634 (54%) encoding prot eins with known putative functions or known conserved domains based on Blast analysis. A tota l of 973 genes (7%) were downregulated more than two fold during sclerotial initiation with 700 genes among them (72%) encoding proteins with known putative functions or known conser ved domains. These differentially expressed genes encoding proteins with pr edicted functions can be categor ized into varied functional groups. The most distinct difference between ge nes upregulated and genes downregulated in sclerotial initiation was in ge ne groups involved in protein biosynthesis and mitochondria metabolism. There are 92 genes related to protein biosynthesis downregul ated during sclerotial initiation while only 9 genes in this group were up regulated during sclerotial initiation. A similar observation is made for genes involved in mito chondrial metabolism. There are 50 genes related to mitochondria synthesis or transport that ar e downregulated during sc lerotial initiation while only 5 genes in this category are upreglated during sclero tial initiation. The ten genes upregulated in sclerotial initia ls with highest F-values and hi ghest fold changes are listed in

PAGE 94

94 Table 4-3 and 4-4, respectively. Table 4-5 and 4-6 show downregulated genes in sclerotial initials with highest F-values and highest fo ld changes. Ten genes exhibiting varying fold expression changes and pattern of expression we re chosen for quantitative PCR to determine differential expression by an independent method. These genes all display the same direction and relative magnitude of change by qPCR as observed in the microarray data as shown in Table 4-2. Discovery of New Genes via Microarray Analysis 1066 orphan ESTs were also investigated by mi croarray hybridization. Among them, 56 were upregulated and 98 ESTs were downregulated more than two fold during sclerotial initiation. Blast queries with th ese EST sequences against the S. sclerotiorum genome sequence revealed that most orphan ESTs are actually the 5 prime or 3 prime portion of misannotated genes since the ESTs have overlapping sequen ce homology with predicted genes and usually these overlapping genes share similar different ial expression values with these ESTs in microarray data. Still some EST sequences do no t overlap with neighboring genes and do not share differential expression values with neighboring genes. Nine ESTs out of the 56 upregulated during sclerotial initiation were categorized as new genes. Th ese are listed in Table 4-7. STEM (Short-Time Series Ex pression Miner) Analysis To better analyze genes involve d in sclerotial in itiation I chose to focus on genes differentially expressed only duri ng sclerotial in itiation but not in apothecial developmental stages for which microarray data was availa ble (Rollins et al, unpub lished). This set of microarray data contained gene hybridization fluorescence intensity values of transcripts from dark-germinated apothecial stipes and UV-exposed apothecial stipes. This data set was combined with the current data set so that the genes expresse d to a higher level in ei ther of the two stages of apothecial development were removed fr om the gene list. The remaining genes are specifically upregulated or downreg ulated in sclerotial initials. Using these criteria, expression

PAGE 95

95 levels of genes in apothecial st ages are equal to or lower than the levels in vegetative hyphae. The microarray data acquired by combining the ge nes differentially expressed during sclerotial initiation and the genes differentia lly expressed in early apothecial development were input into STEM for clustering. In STEM analysis, the valu es at one time point ( one developmental stage here) are used as a normalization baseline, The values of ot her time points are compared to the baseline to obtain the pattern of change across the samples. Patterns representing genes differentially expressed during sclerotial initiation and at a lower ba sal level in the two apothecia developmental stages are shown in Figure 4-1 a nd 4-2. These genes were clustered by functional group and heat maps generated as shown in Figure 4-1 and 4-2. Differential Expression of ggt and its Orthologs During Sclerotial Initiation A cDNA mi croarray study pr eviously indicated that a gene encoding a gammaglutamyltranspeptidase (GGT) was highly upregulated during sclerotial initiation (data not shown). This gene is found to be SS1G_14127.1 ( Ss_ggt1 ) in the S. sclerotiorum genome database at the Broad Institute. Feature searches in S. sclerotiorum genome sequence (http://www.broad.mit.edu/annotation/genome/sclerotinia_sclerotiorum/FeatureSearch.html) revealed that two other genes encode GGT paralogs, SS1G_10940 ( Ss_ggt2 ) and SS1G_05330.1 ( Ss_ggt3 ). Among these three GGT proteins, Ss_Ggt2 and Ss_Ggt1 share 44% similarity while the identity of Ss_Ggt3 with Ss _Ggt1 or Ss_Ggt2 is less than 7%. Homologs of Ss_Ggt1 and Ss_Ggt2 can also be found in Arabidopsis (CAB_79679.1) and other plant and animal species whereas homologs of Ss_Ggt3 only exist in fungal and bacterial species. Long oligomer microarray analysis illu strated that both of Ss_ggt1 and Ss_ggt3 are upregulated during sclerotial initiation while Ss_ggt2 is downregulated (1.5 fold). The level of Ss_ggt1 transcript during sclerotial initiation is 14 fold higher than in vegetative hyphae. The level of Ss_ggt3 transcript during sclerotial initiation is 1.5 fold higher than in vegetative hyphae. Northern hybridization

PAGE 96

96 analysis indicated that the level of Ss_ggt1 transcript accumulation reach es a peak in Stage IV sclerotia as shown in Figure 4-4. Since Ss_ggt1 was demonstrated to be regulated by sclerotial development via microarray analysis, I investigated if the deletion of Ss_ggt1 affects sclerotial development or germination. Deletion of the Ss _ggt1 gene The strategy applied for Ss_ggt1 deletion is described in the Material & Methods and illust rated in Figure 4-3. The 3 -UTR sequences and partial Ss_ggt coding sequence were used as probes in Southern hybridization to screen for homokaryotic Ss_ggt knock-out mutants. As shown in Figure 4-3, five out of 22 hygromycin-re sistant transformants were found to be pure Ss_ggt1 -deletion mutants. Northern hybr idization also indicated that there is no accumulation of Ss_ggt1 transcripts in Ss_ggt1 sclerotia (Figure 4-4). Effects of Ss _ggt1 Deletion on Sclerotial Development and Germination The Ss _ggt1 deletion does not distinctly affect the number or size of sclerotia grown on PDA m edia compared to wild type. However, this mutation does affect sclerotial tissue organization. Mature sclerotia contain a ri nd (pigmented outer layer), a cortex (rounded, plectenchyma-cell layer between th e outer layer and the medulla la yer) and medulla (interwoven internal hyphae). When thin sections of mature sclerotia from Ss _ggt1 and wild type strain were compared, I found that the cortex layer in the gene deletion mutant is much thicker than wild type. The typical thickness of a WT mature sc lerotial cortex usually is 1-3 cells thick while the cortex of Ss _ggt1 mature sclerotia can reach up to 6-7 cells deep. I also observed the mature sclerotia harvested from another gene deleted mutant, Ss_ssp1 (chapter 3). The Ss_ssp1 sclerotial cortex layer is similar to WT sclerotia. The complemented strain of Ss _ggt1 exhibits a cortex of similar thickness as wild type (Figure 4-5). Interes tingly, a thicker cortex does not appear to benefit sclerotial health. Unlike the firm rind of normal WT sclerotia, the rind and

PAGE 97

97 cortex of fully mature Ss _ggt1 sclerotia can be easily peeled away from the medulla when harvested on or after 20 days from the date of plate inoculation (F igure 4-5). Staining and examination of thin sections determined that the cortex layer of old scle rotia partially separated from the medulla. These mutant sclerotia were still able to myceliogenically germinate on agar media. However, the ma ture sclerotia of the Ss _ggt1 knock-out mutant collected from potato media for carpogenic germination failed to germinat e into apothecia (resu lts not shown). Instead, they became soft during the incubation for car pogenic germination. This suggests that the separation of rind and cortex from sclerotial medulla impairs sclerotial viability after maturation so that these poorly protected sclerotia are una ble to function and deve lop into apothecia. Discussion Owing to the availability of S. sclero tiorum genome annotation and utilization of microarray analysis, the genes involv ed in sclerotial development in S. sclerotiorum could be investigated in a large scale for the first time. Initiation is the first committed step in sclerotial development. Therefore, the sclerotial initiation stage was chosen as the first subject for investigation of sclerotial devel opment via microarray analysis. This investigation revealed that large numbers of genes involved in protein biosynthesis and energy metabolism that are very active during vegetative gr owth, are downregulated during scle rotia initiation. There are also several genes that would normally be thought to be involved in fungal colonization of host plants (e.g., pectinases and polygalactur onases) that are downregulated during scleroti al initiation. These findings are consistent with the fact that sc lerotial initiation occurs in the infection cycle after hyphae have successfully colonized plant cells and used up most available nutrients. During this phase, most metabolic pathways used fo r colonization, energy and protein production are downregulated to adapt to lim ited nutrients. Conversely, many re gulatory proteins such as transcription factors involved in regulation of genes required for sclerotial development, certain

PAGE 98

98 catalytic enzymes involved in furt her modification of metabolic st ores and precur sors, proteins required as important reserves in sclerotia, specific transporters for the translocation of reserves as well as proteins with unknown functions are upregulated in th is stage. Two regulatory genes ( pac1 (Rollins, 2003) and sac1 (Jurick and Rollins, 2007)) that were previously demonstrated to affect the maturation of scleroti a are not differentially expressed during sclerotial initiation in this microarray analysis. This may be attributable to their function in late stages of sclerotial development. Genes encoding regulatory protei ns such as, STE-like transcription factor (SS1G_07136.1), Glutathione S-transferas e (SS1G_10108.1), polyketide synthase (SS1G_07098.1) and monosaccharide transporte r (SS1G_06620.1) did show differentially regulation during sclerotial initia tion. These genes have not been previously associated with sclerotial developmental regulati on and their functional analysis ma y provide greater insight into signal transduction pathways regulating the in itiation transition between hyphal elongation growth and sclerotial in itiation. Microarray analysis has also helped us to effectively identify new genes from the set of differentially expr essed orphan ESTs. Nine of the 56 ESTs (16%) upregulated in sclerotial initials are identified as new genes which were missed in the automated genome annotation. Extrapolating from this rate of discovery suggests that further analysis of the 1066 expressed ESTs uncovered in this analysis may add more than 100 new genes to the S. sclerotiorum genome. There are three -GT homologs present in S. sclerotiorum genome.Among these genes, microarray analysis indicated that Ss_ggt1 is the most highly upregulated during sclerotial initiation. Consequently, Ss _ggt1 was chosen to be functionally analyzed to determine if it is essential for sclerotial development or function. It has been known that -GT in animals are crucial enzymes mediating glutathione (GSH) de gradation, reabsorption and transportation of

PAGE 99

99 Cys in the form of GSH. Mu tant mice lacking a functional -GT die from Cys starvation since the Cys in the form of GSH exported outside cells can not be released and transported into cells again (Lieberman et al ., 1996). Therefore, I hypothesized that the loss of function mutant of Ss _ggt1 will produce unhealthy sclerotia on defined agar media or even on completed agar media due to the Cys starvation, which would result fr om reduced ability to recycle Cys. We did observe the morphological chage mi croscopically in knock-out mutant mature sclerotia (thicker cortex layer) compared to wild type sclerotia. The reason fo r this morphological change in Ss _ggt1 sclerotia is not fully underst ood. Our current hypothesis is that this ultrastructure phenotype is still related to Cys deficiency in mu tant cells and that increased oxidative stress may result in a thickened cortex tissue layer. The thicker cortex layer in Ss _ggt1 mature sclerotium did not benefit sclerotial viability. On the contrary, mature sclerotia lacking functional Ss _ggt1 develop a loose outer layer a ttached with the medulla such that this outer layer can be easily peeled away from the medulla and the medu lla therefore is not well protected from the external environment. A direct e ffect of this poor prot ection is that the viab ility of the sclerotium is weakened and the mutant sclerotia fail to germ inate into apothecia. However, the deletion of Ss _ggt1 does not impair sclerotial in itiation. This indicates that Ss _ggt1 is regulated by sclerotial initiation and the gene upregula tion during this stage affects fu rther sclerotial development but not sclerotial initiation. In the future, more genes regulated during sclerotial initiation will be chosen for functional characterization. How best to choose candidate genes from the pool containing hundreds of genes is an issue. Reducing the range of inves tigated genes by clustering genes differentially expressed in sclerotial development but not in other developm ental stages (such as vegetative growth, apothecial development, ascospore germ ination) is an effective way to solve this

PAGE 100

100 problem. Through STEM analysis, the genes upregul ated in sclerotial initials for further investigation are reduced from 1177 to 201. Th ese 201 genes are those only upregulated in sclerotial initials but not in vegetative growth or apothecial development. The same process was used to filter genes downregulated in sclerotial initia ls and the gene pool for further investigation was reduced from 973 to 649 genes. That means only less than 40% differentially expressed genes left for further screening.

PAGE 101

101 Table 4-1 Summary of unigenes differentially expressed on S. scle rotiorum microarray Number of unigenes S. sclerotiorum Unigene represented by 2 probes on array Represented on array Upregulated in sclerotial initials more than 2 folds Downregulated in sclerotial initials more than 2 folds Autocalled genes Orphan ESTs Reverse complemented autocalled genes Total 14,523 1066 1012 16,601 1177 (8%) (634 with known functions) 56 (5%) 29 (3%) 1262 (7.6%) 973 (7%) (700 with known functions) 98 (9%) 44 (4%) 1155 (6.9%) Table 4-2 Genes and primer pairs us ed for quantitative PCR confirmation Gene ID Gene Designation primer sequences (5-3) Mean fold change (scl/ veg) acquired from microarray Relative con. acquired from qPCR (scl/ veg) SS1G_07095.1 SS1G_07136.1 SS1G_10108.1 SS1G_11992.1 SS1G_14127.1 SS1G_14065.1 SS1G_00263.1 SS1G_05223.1 SS1G_05832.1 SS1G_09608.1 Integral membrane protein STE-like transcription factor Glutathione Stransferase Lipolytic enzyme G-DS-L Gammaglutamyltranspeptidase Ss_Ssp1 unknown protein methyltransferase polygalacturonase Histone H3 F:CTCGTTGATTTCGCGCTATT R:ATTGCAACGATTCCGAGAGT F:GCCGTCTGTTCAAGCGTTTA R:CAGATCCATCACCACGATCA F:TCAATGGCTCATGTTCCAAA R:CCAACAAGCCATTGTTTTCC F:CTTGGTGGTGGTGGAACTG R:GATCCTCCATCGTTGTGACC F:AGCGAAAGTTCGATTTGCTC R:GGAGCCATCTCACGAAAATC F:GTTCACAATGGGCATACTTTTCAGC R:TCTCTTCTTACCACGGAGCTTGCTTG F:CGTCAGCACATCCAGCTCTA R:GGAACACGCCCATAAACATC F:GCCGGAGATTAAGTGGGAAT R:TCCTCGAGATGCAGATAGCA F:TGGCCATGTAGTTTTCAGCA R:AGCGTTTTGGAAGACGAATG F:TACCGAGCATGGTTCGTTTG R:CGAGCCAGCTGAAAACCATT 13.45 2.19 10.78 9.99 14.62 35.5 -23.59 -21.86 -18.77 -0.4 1500 22.45 373.5 70.35 90.03 256.75 -264.43 -23.62 -39.61 1.8

PAGE 102

102 Table 4-3 Ten genes upregulated in scle rotial initials with highest F-Values Gene Name F-Value Blast Intelligent Mean of log2VEG/SCL Folds up SS1G_07295.1 3974.59 hypothetical protein -4.36 20.47 SS1G_00274.1 3621.66 covalently-linked cell wall protein -3.40 10.57 SS1G_03241.1 3443.76 hypothetical protein -2.44 5.41 SS1G_11285.1 3103.78 cysteine dioxygenase (EC 1.13.11.20) (CDO) -3.05 8.29 SS1G_00291.1 3015.08 hypothetical protein -4.40 21.11 SS1G_11992.1 2947.42 rhamnogalacturonan acetylesterase p recursor (EC 3.1.1.-) (RGAE) -3.32 9.97 SS1G_12510.1 2867.92 chitinase -3.28 9.74 SS1G_07095.1 2459.19 integral membrane protein -3.75 13.45 SS1G_08163.1 2439.6 p redicted protein -4.08 16.94 SS1G_06620.1 2055.5 monosaccharide transporter -4.96 31.13 Table 4-4 Genes upregulated in sclerotia l initials with highest fold changes Gene ID F-Value Blast Intelligent Mean of log2VEG/SCL Folds up SS1G_04565.1 619.71 metalloexopeptidase -5.46 44.02 SS1G_05915.1 423.31 mixed-linked glucanase (fragment) -5.40 41.06 SS1G_04563.1 222.81 p hosphatidylserine decarboxylase like protein -5.31 39.67 SS1G_13613.1 983.44 p redicted protein -5.31 39.58 SS1G_02331.1 466.51 haemolytic enterotoxin precursor -5.30 39.26 SS1G_03736.1 440.61 p lasma membrane ATPase (proton p ump) -5.17 35.92 SS1G_14065.1 994.02 p redicted protein -5.15 35.45 SS1G_05917.1 623.11 hypothetical protein B7A16.100 -4.97 31.36 SS1G_07098.1 982.32 p olyketide synthase -4.96 31.18 SS1G_06620.1 2055.5 monosaccharide transporter -4.96 31.13

PAGE 103

103 Table 4-5 Genes downregulated in scle rotial initials with highest F-Values Gene Name F-Value Blast Intelligent Mean of log2VEG/SCL Folds down SS1G_00263.1 3937.21 p redicted protein 4.56 -23.56 SS1G_10167.1 1473.22 neutral endopolygalacturonase SSPG1D 2.53 -5.77 SS1G_12210.1 1446.23 Aorsin (serine proteinase) precursor 2.72 -6.60 SS1G_05151.1 1221.99 cellobiose dehydrogenase 2.81 -7.03 G787P540RC1.T0 1209.56 SS1G_00215 (predicted protein) 1.18 -2.27 SS1G_02046.1 1145.34 p redicted protein 3.18 -9.04 SS1G_01855.1 1123.29 expressed protein 1.41 -2.66 SS1G_08099.1 1073.33 1-acyl-sn-glycerol-3-phosphate acyl transferase 3 (EC 2.3.1.51) 2.55 -5.84 SS1G_13860.1 1063.21 Cellulose (EC 3.2.1.4) 2.20 -4.61 SS1G_05859.1 1018.98 UV-induced protein UVI22 1.28 -2.43 Table 4-6 Genes downregulated in sclero tial initials with highest fold changes Gene Name F-Value Blast Intelligent Mean of log2VEG/SCL Folds down SS1G_00891.1 343.89 endoglucanase III 5.03 -32.65 SS1G_04177.1 254.58 p olygalacturonase 5 (pg5 ) 4.81 -28.01 SS1G_07491.1 203.56 hypothetical protein 4.31 -19.82 SS1G_05832.1 327.39 exo-polygalacturonase 4.23 -18.74 SS1G_02690.1 703.52 p redicted protein 4.20 -18.36 SS1G_13641.1 346.41 p olyketide synthase 4.45 -21.93 SS1G_05223.1 753.75 TRP-1 (methyltransferase) 4.45 -21.92 SS1G_00263.1 3937.21 p redicted protein 4.56 -23.56 SS1G_00468.1 246.08 p ectin methylesterase 4.40 -21.16 RC_SS1G_05832.1 108.19 antisense SS1G_05832.1 (exop olygalacturonase) 4.11 -17.30

PAGE 104

104 Table 4-7 New genes found in orphan ESTs via microarray analysis EST ID Support for new gene G787P566FA12.T0 A new gene overlap ping with SS1G_08026 or SS1G_ 02831 (1.12392E-20) in different superc ontigs (both of them are homologs of BC1G_15966 and no EST support). Reverse orientation G786P573RC4.T0 N ew gene 500bp upstream of SS1G_10336. SS1G_10336 is not differentially expressed G787P552RB2.T0 N ew gene with partial overlap with SS1G_02236 or misannotated SS1G_02236. SS1G_0 2236 is not differentially expressed. G787P562RC7.T0 N ew gene 100bp upstream of SS1G_12883 (Non-overlapping). N o differential expression of SS1G_12883. Ssc_BI_UF.185.C1___1_nr0nt A new gene on the antisense strand overlapping with SS1G_10229. SS1G_10229 is not differentially expressed. Ssc_BI_UF.119.C1___1_nr0nt N ew gene 100bp downstream of SS1G_11597. Reverse orientation, non-overlapping a nd no intergenic region. 1KB downstream of SS1G_11596. SS1G_11596 is differentially expressed while SS1G_11597 is not. Ssc_BI_UF.868.C1___1rc_nr1nt0 N ew gene between SS1G_07105 and SS1G_07106. Greater than 1kb from both. Ssc_BI_UF.746.C1___1_nr0nt1 N ew gene or misannotated SS1G_12567. EST is ~100bp overlapping with 3 end of th is gene. But SS1G_12567 is not differentially expressed in microarray. Ssc_BI_UF.983.C1___1_nr0nt N ew gene between SS1G_05337 and SS1G_05338. 4kb downstream of SS1G_05337 and 2kb upstream of SS1G_05338

PAGE 105

105 Figure 4-1 Heat maps generated for each func tional clusters specifically upregulated during sclerotial initia tion and the expression pattern representing these groups. Relative intensities are expressed as natural log va lues in Y-axis. X-axis represents four developmental stages: vegetative growth (InVEGest), sclerotial initiation (InSCLest), etiolated stipes in constant dark (InCDest) and etiolated stipes treated with UV (InUVest) Oxidoreductase DNA binding proteins Transcription factor Metabolism Zinc ion binding protein Catalytic activity Carbohydrate metabolism Integral to membrane

PAGE 106

106 Figure 4-2 Heat maps generated for ribosomal proteins specifically downregulated during sclerotial initiation and the expression pattern representing these genes. Relative intensities are expressed as natural valu es in Y-axis. X-axis represents four developmental stages: vegetative growth (InVEGest), sclerotial initiation (InSCLest), etiolated stipes in constant dark (InCDest) and etiolated stipes treated with UV (InUVest) Ribosomal biogenesis, assembly and translation (continued) Ribosomal bio g enesis assembl y and translation

PAGE 107

107 Figure 4-3 The split-marker strategy used for making ggt deletion mutants and Southern hybridization for scr eening homokaryotic ggt mutants (KO), heterokaryotic mutants (Ht), ectopic mutants (Ect.) and comple mented strains (CO).The wild type ggt locus localizes to a 5.2kb band while a homologous integration of the hph cassette gives rise to a 2.4kb band when double digested with Spe I and Sac I and hybridized with Probe2. 5-UTR hyg 3-UTR 500bp 5-UTR ggt 3-UTR Probe1 Probe2 hy yg spL spR 5-UTR h y 3-UTR y g Sac II Spe I Spe I 1 2 3 4 5 1 2 1 2 3 4 KO Ht. Ect. WT KO CO WT 1 2 3 4 5 1 2 3 KO Ht. Ect. WT 1 2 3 4 5 1 2 1 25.2kb 5.2kb 2.4kb 5.2kb p robe2 probe1 p robe1

PAGE 108

108 Figure 4-4 Northern hybridization analysis of ggt transcript accumulation in different wild type developmental stages (My. Susp.: mycelia l suspension culture; My. PDA: mycelia harvested from PDA plates; SI: stage I scle rotia; SIV: stage IV sclerotia; EA: etiolated stipes; A: mature apothecia); Ko1 and Ko2: Stage IV sclerotia from 2 independent ggt knock-out mutants. ggt Total RNA WT KO My My Susp. PDA Ko1 Ko2 SI SIV EA A

PAGE 109

109 Figure 4-5. Microscopic features (left two columns) and macroscopic features of mature sclerotia (right column) harvested from WT and ggt stains. Amido Black section staining displays the rind, co rtex and medulla (as indicated by arrows) of mature sclerotia from wild type, ggt knock-out mutants ( ggt ), a ggt complemented stain and ssp1. The right column displays the normal fully mature sclerotium and a ggt fully mature sclerotium with an easily peeled rind.

PAGE 110

110 CHAPTER 5 CONCLUSIONS During the course of my dissertation rese arch, genes regulated during sclerotial development in S. sclerotiorum were investigated thr ough individual function, gene characterizations and global microarray tran scriptome analyses. Ss_Ssp1 is a sclerotial development specific protein described previous ly. Our study indicated that the transcript accumulation of Ss_Ssp1 is tightly regulated by sclerotial development while the protein accumulates both in sclerotia and apothecia. Ss_Ss p1 in sclerotia is relocated from sclerotia to apothecia during germination. Orthologous sequences were also discovere d in other sclerotialforming Sclerotiniaceae species a nd even in sclerotia-forming Aspergillus species. A homologue of the Ss_ssp1 sequence ( ssp2) in the genome of S. sclerotiorum was also identified. ssp2 is highly transcribed in apotheci a but not in sclerotia. Observ ations of the pattern of Ss_ssp1 transcript accumulation in various sclerotial mutants, natural isolates a nd other sclerotia-forming species suggests that this gene is a good biomarker to identif y early stages of sclerotial development. An ~1kb sequence upstream of the Ss_ssp1 coding sequence was sufficient to drive tissue-specific expression of sGFP in scle rotia. Beyond understanding fundamental aspects of sclerotial development, the Ss_ssp1 promoter sequence may have biotechnology utility for expressing and obtaining high quant ity, localized, heterologous protei ns in sclerotia. To further illuminate the function of this fungal storage protein in sclero tial development and apothecia development, homokaryotic Ss_ssp1 deletion mutants were generated and the phenotype of the mutant was investigated. This hygromycin selected Ss_ssp1 strain formed 50% less mature sclerotia than wild type when growing on hygromycin-containing medium. The impaired sclerotial maturation under antibi otic selection seems to be the result of an interplay between Ss_ssp1 deletion and the effect of hygromycin b ecause the same phenotype was not observed

PAGE 111

111 with the Ss_ssp1 mutant grown on PDA plates without hygromycin or with a strain expressing hygromycin resistance from a randomly integrated hph cassette growing on hygromycincontaining medium. No noticeable effects of Ss_ssp1 deletion on carpogenic germination or apothecial development other than a delay in germination timing were observed. However, I could not conclude that Ss_Ssp1 has no function in sclerotial or apothecial development. The upregulation of ssp2 transcripts and protein accumulation as well as the higher accumulation of a 16kDa major protein in the Ss_ssp1 mutant sclerotia compared to the corresponding wild type controls suggests a possible functiona l compensation for loss of Ss_Ssp1 in S. sclerotiorum Transcriptome profiling during sclerotial initiati on was also investigated via long-oligomer microarray analysis. 14.8% of the total genes in the S. sclerotiorum genome were determined to be differentially expressed more than two fold during sclerotial initiation. Microarray analysis not only can provide a comparativ e and comprehensive view of ge ne regulation during sclerotial development but also can be used to identify ne w genes. Several putative new genes have been identified from an examination of differentially expressed orphan ESTs from the microarray analysis. A gene that was highly upregulated dur ing sclerotial initiation was the gamma-glutamyl transpeptidase-encoding gene (ggt ). This gene was chosen to for functional characterization. Lost-of-function mutant of ggt exhibit a thicker sclerotial cort ex and an easily peeled-off rind layer on fully mature sclerotia. These sclerotia fa il to germinate into apothecia as an apparent result of poor environmental protection or loss of integrity due to a di scontinuous sclerotial rind. The genes specifically regulated during sclerotial initiation but not comp aratively expressed in apothecia development or in vegetative growth ar e clustered into different functional groups. In the future, these genes will be candidates for investigating their invol vement in sclerotial development.

PAGE 112

112 APPENDIX A GENES DOWNREGULATED IN SCLEROTIAL INITIALS Electron trans p ort Cell wall, extracelluar region Carboh y drate metabolism Lipid metabolism Oxidoreductase activit y Nucleic acid binding Mitochondria inner membrane

PAGE 113

113 LIST OF REFERENCES Abawi, G. S., Grogan, R. G., 1979. Epidemiology of Diseases Caused by Sclero tinia Species. Phytopathology. 69 899-904. Adams, P. B., Ayers, W. A., 1979. Ecology of Sclerotinia species. Phytopathology. 69 896-899. Alghisi, P., Favaron, F., 1995. Pectin-Degrading Enzyme s and Plant-Parasite In teractions. Eur. J. Plant Pathol. 101 365-375. Andrianopoulos, A., Timberlake, W. E., 1994. The Aspergillus nidulans abaA gene encodes a transcriptional activator that acts as a genetic switch to control development. Mol. Cell Biol. 14, 2503-15. Andrie, R. M., Martinez, J. P., Ciuffetti, L. M., 2005. Development of ToxA and ToxB promoter-driven fluorescent protein expr ession vectors for use in filamentous ascomycetes. Mycologia. 97 1152-61. Anonymous, 2003. What is Sclerotinia (white mold). http://www.whitemoldresearch.com/HTML/what_is_sclerotinia.cfm Anonymous 2005a. Sclerotinia on white paper. http://www.whitemoldresearch.com/files/SIbrochure.pdf Anonymous 2005b. Sclerotinia white paper. http://www.uscanola.com Balla, S., Thapar, V., Verma, S., Luong, T., Faghri, T., Huang, C. H., Raj asekaran, S., del Campo, J. J., Shinn, J. H., Mohler, W. A., Maciejewski, M. W., Gryk, M. R., Piccirillo, B., Schiller, S. R., Schiller, M. R., 2006. Minimo tif Miner: a tool for investigating protein function. Nat. Methods. 3 175-7. Bardin, S. D., Huang, H. C., 2001. Research on biology and control of Sclerotinia diseases in Canada. Can. J. Plant Pathol. 23 88-98. Bateman, D. F., Beer, S. V., 1965. Simultaneous pr oduction and synergistic action of oxalic acid and polygalacturonase during pathogenesis by Sclerotium Rolfsii. Phytopathology. 55, 204-&. Batra, L. R., 1991. World species of Monilinia (Fungi): Their ecology, biosystematics and control. Cramer, Berlin, Stuttgart. Bell, A. A., Wheeler, M. H., 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24 411-451. Boland, G. J., Hall, R., 1994. Index of plant hosts of Sclerotinia sclerotiorum Can. J. Plant Pathol. 16, 93-108.

PAGE 114

114 Bolton, M. D., Thomma, B. P. H. J., Nelson, B. D., 2006. Sclerotinia sclerotiorum (Lib.) de Bary: Biology and molecular traits of a cosmopolitan pathogen. Mol. Plant Pathol. 7 1-16. Breakspear, A., Momany, M., 2007. The first fifty microarray st udies in filamentous fungi. Microbiology-Sgm. 153 7-15. Bullock, S., Ashford, A. E., Willetts, H. J., 1980. Th e structure and histochemistry of sclerotia of Sclerotinia minor Jagger .2. Histochemistry of extrace llular substances and cytoplasmic Reserves. Protoplasma. 104, 333-351. Burke, J. M., Rieseberg, L. H., 2003. Fitness effects of transgenic disease resistance in sunflowers. Science. 300 1250. Calvo, A. M., Bok, J., Brooks, W., Keller, N. P., 2004. veA is required for toxin and sclerotial production in Aspergillus parasiticus Appl. Environ. Microbiol. 70, 4733-4739. Carroll, N. C., Sweigard, J. A., Valent, B., 1994. Improved vector for selecting resistance to hygromycin. Fungal Genet. Newsl. 41 1. Cessna, S. G., Sears, V. E., Dickman, M. B., Low, P. S., 2000. Oxalic acid, a pathogenicity factor for Sclerotinia sclerotiorum suppresses the oxidative burst of the host plant. Plant Cell. 12 2191-200. Chen, C., Dickman, M. B., 2005. cAMP blocks MAPK activation and sclerotial development via Rap-1 in a PKA-independent manner in Sclerotinia sclerotiorum Mol. Microbiol. 55, 299-311. Chen, C., Harel, A., Gorovoits, R., Yarden, O., Dickman, M. B., 2004. MAPK regulation of sclerotial development in Sclerotinia sclerotiorum is linked with pH and cAMP sensing. Mol. Plant-Microbe Interact. 17 404-13. Chet, I., Henis, Y., 1975. Sclerotial morphoge nesis in fungi. Annu. Rev. Phytopathol. 13 169192. Coleman, C. E., Larkins, B. A., The prolamins of maize. In: P. R. Shewry, R. Casey, Eds.), Seed proteins. Kluwer Academic Publishers, Dordercht, 1999, pp. 109-39. Coley-Smith, J. R., Sclerotia and other structures in survival. In: K. V. J.R. Coley-Smith, W.R.Javis, (Ed.), The biology of botrytis. Academic Press, London, New York, 1980, pp. 85-114. Conceicao, A. D., Krebbers, E., 1994. A cotyledon regulatory region is responsible for the different spatial expression patterns of arabidopsis 2s albumin genes. Plant J. 5 493-505. Correa, A., Lewis, A. Z., Greene, A. V., March, I. J., Gomer, R. H., Bell-Pedersen, D., 2003. Multiple oscillators regulate circadian gene expression in Neurospora. Proc. Natl. Acad. Sci. USA. 100, 13597-13602.

PAGE 115

115 de Bary, A., 1887. Comparative morphology and bi ology of the fungi, mycet ozoa and bacteria. Oxford, UK, Clarendon Press. del Rio, L. E., Martinson, C. A., Yang, X. B., 2002. Biological control of Sc lerotinia stem rot of soybean with Sporidesmium sclerotivorum Plant Dis. 86 999-1004. DeRisi, J. L., Iyer, V. R., Brown, P. O., 1997. Ex ploring the metabolic a nd genetic control of gene expression on a genomic scale. Science. 278 680-686. Donaldson, P. A., Anderson, T., Lane, B. G., Davidson, A. L., Simmonds, D. H., 2001. Soybean plants expressing an active oligomeric oxala te oxidase from the wheat gf-2.8 (germin) gene are resistant to the oxalate-secreting pat hogen Sclerotina sclerotiorum. Physiol. Mol. Plant Pathol. 59 297-307. Eisen, M. B., Spellman, P. T., Brown, P. O., Botstein, D., 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA. 95 14863-14868. Erental, A., Harel, A., Yarden, O., 2007. Type 2A phosphoprotein phosphatase is required for asexual development and pathogenesis of Sclerotinia sclerotiorum Mol. Plant-Microbe Interact. 20 944-954. Ernst, J., Bar-Joseph, Z., 2006. STEM: a tool for the analysis of short time series gene expression data. Bmc Bioinformatics. 7, 191. Fairhead, C., Llorente, B., Denis, F., Soler, M., Dujon, B., 1996. New vectors for combinatorial deletions in yeast chromosomes and for gap-repair cloning using 'split-marker' recombination. Yeast. 12 1439-1458. Favaron, F., Sella, L., D'Ovidio, R., 2004. Relationships among endo-polygalacturonase, oxalate, pH, and plant polygalacturonase-inhibiting pr otein (PGIP) in the interaction between Sclerotinia sclerotiorum and soybean. Mol. Plan t-Microbe Interact. 17 1402-9. Flores, T., Alape-Giron, A., Flores-Diaz, M., Flores, H. E., 2002. Ocatin: a novel tuber storage protein from the Andean tuber crop oca with antibacterial and antif ungal activities. Plant Physiol. 128 1291-1302. Fraissinet-Tachet, L., Reymond-Cotton, P., Fevr e, M., 1995. Characterization of a multigene family encoding an endopolygalacturonase in Sclerotinia sclerotiorum Curr Genet. 29 96-9. Fu, J., Hettler, E., Wickes, B. L., 2006. Split marker transformation increases homologous integration frequency in Cryptococcus neoformans. Fungal Genet. Biol. 43 200-212. GailusDurner, V., Chintamaneni, C., Wilson, R., Brill, S. J., Vershon, A. K., 1997. Analysis of a meiosis-specific URS1 site: Sequence requi rements and involvement of replication protein A. Mol. Cell. Biol. 17, 3536-3546.

PAGE 116

116 Georgiou, C. D., 1997. Lipid peroxidation in Sclerotium rolfsii : A new look into the mechanism of sclerotial biogenesis in fungi. Mycol. Res. 101, 460-464. Georgiou, C. D., Patsoukis, N., Papapostolou, I., Zervoudakis, G., 2006. Sclerotial metamorphosis in filamentous fungi is induced by oxidative stress. Integr. Comp. Biol. 46, 691-712. Georgiou, C. D., Petropoulou, K. P., 2001a. Effect of the antioxidant ascorbic acid on sclerotial differentiation in Rhizoctonia solani Plant Pathol. 50 594-600. Georgiou, C. D., Petropoulou, K. P., 2001b. Role of er ythroascorbate and asco rbate in sclerotial differentiation in Sclerotinia sclerotiorum Mycol. Res. 105 1364-1370. Georgiou, C. D., Tairis, N., Polycratis A., 2001. Production of beta-carotene by Sclerotinia sclerotiorum and its role in sclerotium differentiation. Mycol. Res. 105 1110-1115. Georgiou, C. D., Zees, A., 2002. Lipofuscins and sclerotial differentia tion in phytopathogenic fungi. Mycopathologia. 153 203-208. Godoy, G., Steadman, J. R., Dickman, M. B., Dam, R., 1990. Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris Physiol. Mol. Plant Pathol. 37 179-191. Guerche, P., Tire, C., Desa, F. G., Declercq, A., Vanmontagu, M., Krebbers, E., 1990. Differential expression of the arabidopsis 2s albumin genes and the effect of Increasing gene family-size. Plant Cell. 2, 469-478. Guimares, R. L., Stotz, H. U., 2004. Oxalate production by Sclerotinia sclerotiorum deregulates guard cells during infection. Plant Physiol. 136 3703-3711. Hadar, Y., Henis, Y., Chet, I., 1981. The potential for the formation of sclerotia in submerged mycelium of Sclerotium rolfsii J. Gen. Microbiol. 122 137-141. Hallen, H. E., Huebner, M., Shiu, S. H., Giilden er, U., Trail, F., 2007. Gene expression shifts during perithecium development in Gibberella zeae (anamorph Fusarium graminearum ), with particular emphasis on ion transport proteins. Fungal Genet. Biol. 44 1146-1156. Harel, A., Gorovits, R., Yarden, O., 2005. Changes in protein kinase A activity accompany sclerotial development in Sclerotinia sclerotiorum Phytopathology. 95, 397-404. Henson, J. M., Butler, M. J., Day, A. W., 1999. Th e dark side of the mycelium: Melanins of phytopathogenic fungi Annu. Rev. Phytopathol. 37 447-471. Higgins, T. J. V., 1984. Synthesis and regulation of major proteins in seeds. Annu. Rev. Plant Physiol. Plant Mol. Biol. 35 191-221.

PAGE 117

117 Hirschberg, H. J. H. B., Simons, J. W. F. A., Dekker, N., Egmond, M. R., 2001. Cloning, expression, purification and characterization of patatin, a novel phospholipase A. Eur. J. Biochem. 268, 5037-5044. Holley, R. C., Nelson, B. D., 1986. Effect of plan t population and inoculum density on incidence of Sclerotinia wilt of sunflower. Phytopathology. 76 71-74. Hou, W. C., Lee, M. H., Chen, H. J., Liang, W. L., Han, C. H., Liu, Y. W., Lin, Y. H., 2001. Antioxidant activities of dioscori n, the storage protein of yam ( Dioscorea batatas Deene) tuber. J. Agric. Food Chem. 49 4956-4960. Hou, W. C., Liu, J. S., Chen, H. J., Chen, T. E., Chang, C. F., Lin, Y. H., 1999. Dioscorin, the major tuber storage protein of yam (Dioscorea batatas Decne) with carbonic anhydrase and trypsin inhibito r activities. J. Agric. Food Chem. 47 2168-2172. Hu, X., Bidney, D. L., Yalpani, N., Duvick, J. P., Crasta, O., Folkerts, O., Lu, G. H., 2003. Overexpression of a gene encoding hydrogen peroxide-generating oxa late oxidase evokes defense responses in sunflower. Plant Physiol. 133 170-181. Huber, S. M., Lottspeich, F., Kamper, J., 2002. A ge ne that encodes a produc t with similarity to dioxygenases is highly expr essed in teliospores of Ustilago maydis Mol. Genet. Genomics. 267, 757-71. Hughes, T. R., Mao, M., Jones, A. R., Burchard, J., Marton, M. J., Shannon, K. W., Lefkowitz, S. M., Ziman, M., Schelter, J. M., Meyer, M. R., Kobayashi, S., Davis, C ., Dai, H. Y., He, Y. D. D., Stephaniants, S. B., Cavet, G., Walker W. L., West, A., Coffey, E., Shoemaker, D. D., Stoughton, R., Blanchard, A. P., Friend, S. H., Linsley, P. S., 2001. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer. Nat. Biotechnol. 19 342-347. Hutchens, A. R. I., Ambient pHand carbon-regul ated gene expression in the necrotrophic phytopathogen Sclerotinia sclerotiorum Master Thesis. University of Florida, Gainesville, 2005. Inglis, G. D., Boland, G. J., 1990. The microflora of bean and rapeseed petals and the influence of the microflora of bean petals on white mold. Can. J. Plant Pathol. 12 129-134. Jayachandran, M., 1982.Studies on th e sclerotia and apothecia of Sclerotinia species. Master Thesis. University of New South Wales, Australia. Jurick, W. M., Dickman, M. B., Rollins, J. A., 2004. Characterization and f unctional analysis of a cAMP-dependent protein kinase A catalytic subunit gene (pka1) in Sclerotinia sclerotiorum Physiol. Mol. Plant Pathol. 64 155-163. Jurick, W. M., Rollins, J. A., 2007. Deletion of the adenylate cyclase (sac1) gene affects multiple developmental pathways and pathogenicity in Sclerotinia sclerotiorum Fungal Genet. Biol. 44, 521-530.

PAGE 118

118 Kars, I., Krooshof, G. H., Wagemakers, L., Joosten, R., Benen, J. A., van Kan, J. A., 2005. Necrotizing activity of five Botrytis ci nerea endopolygalactur onases produced in Pichia pastoris. Plant J. 43 213-25. Kasuga, T., Townsend, J. P., Tian, C. G., Gilbert, L. B., Mannhaupt, G., Taylor, J. W., Glass, N. L., 2005. Long-oligomer microarray profiling in Neurospora crassa reveals the transcriptional program underlying biochemi cal and physiological events of conidial germination. Nucleic Acids Res. 33 6469-6485. Kasza, Z., Vagvolgyi, C., Fevre, M., Cotton, P., 2004. Molecular characterization and in planta detection of Sclerotinia sclerotiorum endopolygalacturonase gene s. Curr. Microbiol. 48 208-13. Kermode, A. R., Bewley, J. D., 1999. Synthesis, pr ocessing and deposition of seed proteins: the pathway of protein synthesis and deposition of the cell. In: P. R. Shewry, R. Casey, Eds., Seed proteins. Kluwer Academic Publishers, Dordercht, pp. 807-41. Kesarwani, M., Azam, M., Natarajan, K., Me hta, A., Datta, A., 2000. Oxalate decarboxylase from Collybia velutipes : molecular cloning and its overexpres sion to confer resistance to fungal infection in transgenic tobacco and tomato. J. Biol. Chem. 275 7230-7238. Kim, H., Han, K., Kim, K., Han, D., Jahng, K., Chae, K., 2002. The veA gene activates sexual development in Aspergillus nidulans Fungal Genet. Biol. 37 72-80. Kim, Y. T., Prusky, D., Rollins, J. A., 2007. An activating mutation of the Sclerotinia sclerotiorum pac1 gene increases oxalic acid prod uction at low pH but decreases virulence. Mol. Plant Pathol. 8 611-622. Kladnik, A., Chamusco, K., Dermastia, M., Chourey, P., 2004. Evidence of programmed cell death in post-phloem trans port cells of the maternal pedicel tissue in developing caryopsis of maize. Plant Physiol. 136 3572-3581. Kohn, L. M., 1979. Delimitation of the ec onomically important plant pathogenic Sclerotinia species. Phytopathology. 69 881-886. Kohn, L. M., Grenville, D. J., 1989a. Anatomy a nd Histochemistry of Stromatal Anamorphs in the Sclerotiniaceae. Can. J. Bot. 67 371-393. Kohn, L. M., Grenville, D. J., 1989b. Ultrastr ucture of stromatal anamorphs in the sclerotiniaceae. Can. J. Bot. 67 394-406. Kohn, L. M., Grenville, D. J., 1998. Anatomy and hi stochemistry of stroma tal anamorphs in the Sclerotiniaceae. Can. J. Bot. 67 371-393. Kriz, A. L., Wallace, N. H., 1991. Characterization of the maize globulin-2 gene and analysis of 2 null alleles. Biochem. Genet. 29 241-254.

PAGE 119

119 Larkins, B. A., 1981. Seed storage proteins: ch aracterization and biosynt hesis In: A. Marcus, (Ed.), Proteins and Nucleic acids. Academic Press, New York, pp. 450-489. Le Tourneau, D., 1979. Morphology Cytology, and Physiology of Sclerotinia Species in Culture. Phytopathology. 69 887-890. Lewis, Z. A., Correa, A., Schwerdtfeger, C., Li nk, K. L., Xie, X., Gomer, R. H., Thomas, T., Ebbole, D. J., Bell-Pedersen, D., 2002. Overexpression of White Collar-1 (WC-1) activates circadian clock-associated genes, but is not sufficient to induce most lightregulated gene expression in Neurospora crassa Mol. Microbiol. 45 917-931. Li, G. Q., Huang, H. C., Miao, H. J., Erickson, R. S., Jiang, D. H., Xiao, Y. N., 2006. Biological control of sclerotinia diseases of rapeseed by aerial applications of the mycoparasite Coniothyrium minitans. Eur. J. Plant Pathol. 114 345-355. Libert, M. A., 1837. Plante crytogamicae arduenn ae (Exsiccati) no. 326. Published by the author. Lieberman, M. W., Wiseman, A. L., Shi, Z. Z., Carter, B. Z., Barrios, R., Ou, C. N., ChevezBarrios, P., Wang, Y., Habib, G. M., Goodman, J. C., Huang, S. L., Lebovitz, R. M., Matzuk, M. M., 1996. Growth retardati on and cysteine defi ciency in gammaglutamyl transpeptidase-deficient mice. Proc. Natl. Acad. Sci. USA. 93 7923-7926. Livingstone, D. M., Hampton, J. L., Phipps, P. M., Grabau, E. A., 2005. En hancing resistance to Sclerotinia minor in peanut by expressing a barley oxa late oxidase gene. Plant Physiol. 137, 1354-1362. Lumsden, R. D., 1979. Histology and physiology of pathogenesis in plant diseases caused by Sclerotinia species. Phytopathology. 69 890-896. Lumsden, R. D., Dow, R. L., 1973. Histopathology of Sclerotinia sclerotiorum infection of bean. Phytopathology. 63 708-715. Luttrell, E. S., 1980. Host-parasit e relationships and development of the ergot sclerotium in Claviceps purpurea Can. J. Bot./Rev. Can. Bot. 58 942-958. Ma, J., Morrow, D. J., Fernandes, J., Walbot, V., 2006. Comparative profiling of the sense and antisense transcriptome of maize lines. Genome Biology. 7, R22. Maddison, W. P., Maddison, D. R., 2003. MacCla de: Analysis of phylogeny and character evolution. Sinauer Associates, Sunderland, Massachusetts. Marciano, P., Dilenna, P., Magro, P., 1983. Oxalic-a cid, cell wall-degrading enzymes and pH in pathogenesis and their signifi cance in the virulence of 2 Sclerotinia sclerotiorum isolates on sunflower. Physiol. Plant Pathol. 22 339-345. Maxwell, D. P., Lumsden, R. D., 1970. Oxalic acid production by Sclerotinia sclerotiorum in infected bean and in culture. Phytopathology. 60 1395-&.

PAGE 120

120 McQuilken, M. P., Gemmell, J., Hill, R. A., Whipps, J. M., 2003. Production of macrosphelide A by the mycoparasite Coniothyrium minitans FEMS Microbiol. Lett. 219 27-31. Mehdi, K., Thierie, J., Penninckx, M. J., 2001. -glutamyl transpeptidase in the yeast Saccharomyces cerevisiae and its role in the vacuolar transport and metabolism of glutathione. Biochem. J. 359 631-637. Middelhoven, W. J., 1964. Pathwa y of arginine breakdown in Saccharomyces Cerevisiae. Biochim. Biophys. Acta. 93 650-&. Miller, R. M., Liberta, A. E., 1977. The effect s of light and tyrosina se during sclerotium development in Sclerotium rolfsii Sacc. Can. J. Microbiol. 23 278-87. Mueller, D. S., Dorrance, A. E., Derksen, R. C., Ozkan, E., Kurle, J. E., Grau, C. R., Gaska, J. M., Hartman, G. L., Bradley, C. A., Pedersen, W. L., 2002. Efficacy of fungicides on Sclerotinia sclerotiorum and their potential for control of Sclerotinia stem rot on soybean. Plant Dis. 86 26-31. Muntz, K., 1998. Deposition of storage proteins. Plant Mol. Biol. 38 77-99. Novak, L. A., Kohn, L. M., 1991. Electrophore tic and immunological comparisons of developmentally regulated proteins in memb ers of the Sclerotini aceae and other sclerotial Fungi. Appl. Environ. Microbiol. 57 525-534. Nowrousian, M., Duffield, G. E., Loros, J. J., Dunlap, J. C., 2003. The frequency gene is required for temperature-dependent regulat ion of many clock-controlled genes in Neurospora crassa. Genetics. 164 923-933. Nowrousian, M., Piotrowski, M., Kuck, U., 2007. Multip le layers of temporal and spatial control regulate accumulation of the fruiting body-specific protein APP in Sordaria macrospora and Neurospora crassa Fungal Genet. Biol. 44, 602-14. Nowrousian, M., Ringelberg, C., Dunlap, J. C., Loros, J. L., Kuck, U., 2005. Cross-species microarray hybridization to iden tify developmentally regulate d genes in the filamentous fungus Sordaria macrospora Mol. Genet. Genomics. 273 137-149. Noyes, R. D., Hancock, J. G., 1981. Role of oxalic acid in the Sclerotin ia wilt of sunflower. Physiol. Mol. Plant Pathol. 18 123-132. Partridge, D. E., Sutton, T. B., Jordan, D. L., Curtis, V. L., 2006. Management of Sclerotinia blight of peanut with th e biological control agent Coniothyrium minitans. Plant Dis. 90 957-963. Patsoukis, N., Georgiou, C. D., 2007. Effect of sulf ite-hydrosulfite and nitrite on thiol redox state, oxidative stress and sclerotial differentiation of filame ntous phytopathogenic fungi. Pestic. Biochem. Physiol. 88 226-235.

PAGE 121

121 Petersen, G. R., Dahlberg, K. R., Van Etten, J. L., 1983. Biosynthesis and degradation of storage protein in spores of the fungus Botryodiplodia theobromae J. Bacteriol. 155 601-6. Petersen, G. R., Russo, G. M., Vanetten, J. L., 1982. Identification of Major Proteins in Sclerotia of Sclerotinia minor and S.trifoliorum Exp. Mycol. 6 268-273. Pohronezny, K., Purdy L.H., 2002. Sclerotina dis ease of vegetable and fi eld crops in Florida. Plant Pathology Fact Sheet. UF Department of Plant Pathology, Gainesville, Florida, pp. PP-22:1-3. Punja, Z. K., 1985. The biology, ecology, and control of Sclerotium rolfsii Annu. Rev. Phytopathol. 23 97-127. Purdy, L. H., 1979. Sclerotinia sclerotiorum : history, diseases and symptomatology, host Range, geographic distribution, a nd impact. Phytopathology. 69 875-880. Qi, W. H., Chil, K., Trail, F., 2006. Microarray analysis of transcript accumulation during perithecium development in the filamentous fungus Gibberella zeae (anamorph Fusarium graminearum ). Mol. Genet. Genomics. 276, 87-100. Rollins, J. A., 2003. The Sclerotinia sclerotiorum pac1 gene is required for sclerotial development and virulence. Mo l. Plant-Microbe Interact. 16 785-95. Rollins, J. A., Dickman, M. B., 1998. Increase in endogenous and exogenous cyclic AMP levels Inhibits sclerotial development in Sclerotinia sclerotiorum Appl. Environ. Microbiol. 64 2539-44. Rollins, J. A., Dickman, M. B., 2001. pH signaling in Sclerotinia sclerotiorum : identification of a pacC /RIM1 homolog. Appl. Environ. Microbiol. 67 75-81. Russo, G. M., Dahlberg, K. R., Van Etten, J. L ., 1982. Identification of a development-specific protein in sclerotia of Sclerotinia sclerotiorum Exp. Mycol. 6 259-267. Russo, G. M., Van Etten, J. L., 1985. Synthesis and localization of a development-specific protein in sclerotia of Sclerotinia sclerotiorum J. Bacteriol. 163 696-703. Saito, I., 1974. Ultrastructu ral aspects of the matu ration of sclerotia of Sclerotinia sclerotiorum (Lib.) De Bary. Trans. Mycol. Soc. Jpn. 15:384-400. Sambrook, J., Russell, D. W., 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory. Cold Spri ng Harbor, NY, USA. Shewry, P. R., 2003. Tuber storag e proteins. Ann. Bot. (Lond). 91, 755-69. Shewry, P. R., Halford, N. G., 2002. Cereal seed storage proteins: structures, properties and role in grain utilization. J. Exp. Bot. 53, 947-58.

PAGE 122

122 Shewry, P. R., Napier, J. A., Tatham, A. S ., 1995. Seed storage prot eins: structures and biosynthesis. Plant Cell. 7 945-56. Shima, J., Sakata-Tsuda, Y., Suzuki, Y., Nakajim a, R., Watanabe, H., Kawamoto, S., Takano, H., 2003. Disruption of the CAR1 gene encoding ar ginase enhances freeze tolerance of the commercial baker's yeast Saccharomyces cerevisiae. Appl. Environ. Microbiol. 69 715-8. Steadman, J. R., Cook, G. E., 1974. Simple method for collecting ascospores of Whetzelinia sclerotiorum Plant Disease Reporter. 58, 190-190. Storozhenko, S., Belles-Boix, E., Babiychuk, E., Herouart, D., Davey, M. W., Slooten, L., Van Montagu, M., Inze, D., Kushnir, S., 2002. -glutamyl transpeptidase in transgenic tobacco plants. Cellular localization, pro cessing, and biochemical properties. Plant Physiol. 128 1109-1119. Strich, R., Surosky, R. T., Steber, C., Dubois, E., Messenguy, F., Esposito, R. E., 1994. Ume6 Is a key regulator of nitrogen repression and meiotic development. Genes Dev. 8, 796-810. Swofford, D. L., 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods). Sinauer Associates, Sunderland, Massachusetts. Tate, S. S., Meister, A., 1981. -glutamyl transpeptidase catalytic, structural and functional aspects. Mol. Cell. Biochem. 39 357-368. Thompson, J. D., Gibson, T. J., Plewniak, F ., Jeanmougin, F., Higgins, D. G., 1997. The CLUSTAL_X windows interface: Flexible stra tegies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25 4876-82. Tonon, C., Daleo, G., Oliva, C., 2001. An acidic be ta-1,3 glucanase from potato tubers appears to be patatin. Plant Physiol. Biochem. 39 849-854. Townsend, B. B., Willetts, H. J., 1954. The developmen t of sclerotia of certain fungi. Trans. Br. Mycol. Soc. 37 213-221. Turkington, T. K., Morrall, R. A. A., 1993. Use of petal Infestation to forecast Sclerotinia stem rot of canola the Influence of Inoculum variation over the flowering period and canopy density. Phytopathology. 83, 682-689. Van Etten, J. L., Freer, S. N., McCune, B. K., 1979. Presence of a major (storage?) protein in dormant spores of the fungus Botrydiplodia theobramae J. Bacteriol. 138 650-652. Wakefield, E. M., 1924. On the names Sclerotinia sclerotiorum (Lib.) Massee, and S.libertiana Fuckel. Phytopathology. 14 126-127. Whetzel, H. H., 1945. A synopsis of the genera and species of the Sclerotiniaceae, a family of stromatic inoperculate disc omycetes. Mycologia. 37 648-714.

PAGE 123

123 Willetts, H. J., 1971. Survival of fungal sclerotia under adverse environmental conditions. Biol. Rev. Camb. Philos. Soc. 46 387-&. Willetts, H. J., 1972. Morphogenesis and possible evol utionary origins of fungal sclerotia. Biol. Rev. Camb. Philos. Soc. 47 515-536. Willetts, H. J., 1997. Morphology, development and evolution of stromata/sclerotia and macroconidia of the Sclero tiniaceae. Mycol. Res. 101 939-952. Willetts, H. J., Bullock, S., 1992. Developmental biology of Sclerotia. Mycol. Res. 96, 801-816. Willetts, H. J., Wong, A. L., 1971. Ontogenetic diversity of sclerotia of Sclerotinia sclerotiorum and related species. Transactions of the British Mycological Society. 57 515-&. Willetts, H. J., Wong, J. A. L., 1980. The Biology of Sclerotinia.sclerotiorum S.trifoliorum and S. minor with emphasis on specific nomenclature. Bot. Rev. 46 101-165. Yang, R., Han, Y. C., Li, G. Q., Jiang, D. H., Huang, H. C., 2007. Suppression of Sclerotinia sclerotiorum by antifungal substances produced by the mycoparasite Coniothyrium minitans. Eur. J. Plant Pathol. 119 411-420. Yelton, M. M., Hamer, J. E., Timberlake, W. E., 1984. Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA. 81 1470-4. Young, N., Ashford, A. E., 1992. Changes during deve lopment in the permeab ility of sclerotia of Sclerotinia minor to an apoplastic tracer. Protoplasma. 167 205-214. Zarani, F., Christias, C., 1997. Sclero tial biogenesis in the basidiomycete Sclerotium rolfsii : a scanning electron microsc ope study. Mycologia. 89 598-602.

PAGE 124

124 BIOGRAPHICAL SKETCH Moyi Li was born September 9, 1978, in Wuhan, Peoples Republic of China, to Li Li and Fengying Guo. She grew up in this big city on the YangZi River and th e outdoor activity she liked the mo st before the age of 25 was to sear ch traditional Chinese cuisine in the alleys of Wuhan or hang out in the most pros perous streets of the city with her friends or her mother. But her favorite recreations are still novels, movi es, Karaoke and sleeping. Moyi attended Huazhong Agricultural University in September of 1996 wh ere she received a Bach elor of Science degree in microbiology in July 2000. In the Fall of the same year, she was recommended by her undergraduate university to star t her graduate school in th e School of Life Science and Technology, Huazhong University of Science and Technology. The masters research project focused on elicitation of taxol biosynthesis in Taxus chinensis suspension culture by oligosaccharide and polysaccharides secreted by Aspergillus niger and she received a Master of Science degree in July of 2003. Moyi was fortun ately awarded an Alumni Fellowship from the plant pathology department, Univers ity of Florida before the end of her masters studies and then she left China for USA to start her Ph.D program in August 2003. She decided to join Dr. Jeffrey A. Rollins lab very soon after meeting with him du e to his interesting rese arch projects in fungal development and molecular biology. Moyi complete d her doctoral studies related to sclerotial development in S. sclerotiorum in May 2008 and was awarded a Doctor of Philosophy degree. After graduation, she would like to continue in the area of development and molecular biology as a research scientist.