<%BANNER%>

Molecular and Genetic Determination of the Role of Elsinochrome Toxins Produced by Elsinoe fawcettii Causing Citrus Scab

Permanent Link: http://ufdc.ufl.edu/UFE0021942/00001

Material Information

Title: Molecular and Genetic Determination of the Role of Elsinochrome Toxins Produced by Elsinoe fawcettii Causing Citrus Scab
Physical Description: 1 online resource (175 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: citrus, cluster, efpks1, elsinochromes, elsinoe, esc, escs, fawcettii, fungus, gene, oxygen, perylenequinone, photosensitizer, phytopathogen, phytotoxin, pigment, pks, polyketide, scab, singlet, superoxide
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Citrus scab disease, caused by the fungus Elsino? fawcettii (Bitancourt & Jenkins), affects all varieties of citrus, resulting in serious fruit blemishes and economic losses in Florida. My study focused on genetic determination of the role of elsinochrome phytotoxins produced by E. fawcettii. Results indicated that elsinochromes function as photosensitizing compounds that exert toxicity to plant cells due to production of reactive oxygen species such as singlet oxygen and superoxides. Upon irradiation to light, elsinochromes alone rapidly killed suspension-cultured citrus and tobacco cells, induced necrotic lesions on rough lemon leaves, and provoked a steady increase of electrolyte leakage. The toxicity was drastically decreased or alleviated by the singlet oxygen quenchers, such as bixin, DABCO, or reduced glutathione. Accumulation of singlet oxygen and superoxides induced by elsinochromes after irradiation was also detected. An EfPKS1 gene encoding a fungal polyketide synthase (PKS) was cloned and characterized from E. fawcettii to confirm the roles of elsinochromes in fungal pathogenesis and lesion formation by genetic disruption and complementation strategies. In addition, accumulation of the EfPKS1 transcript and elsinochromes by the wild-type strain were coordinately regulated by light, carbon, nitrogen and pH. The results clearly indicate that elsinochromes play a consequential role in fungal pathogenesis. The genes involved in the biosynthesis of fungal secondary metabolites are often clustered. I sequenced a 30-kb region beyond EfPKS1 and identified nine putative genes; some of them encoding polypeptides are likely required for elsinochrome biosynthesis and regulation. In addition to EfPKS1, five genes, RDT1 encoding a reductase, OXR1 encoding an oxidoreductase, TSF1encoding a transcriptional factor, ECT1encoding a membrane transporter, and PRF1 encoding a prefoldin protein subunit were identified. Other four genes (designated as EfHP1-4) encode hypothetical proteins that are likely not associated with biosynthetic functions. The involvement of these genes in elsinochrome production was evident by analyzing the TSF1 gene encoding a putative pathway-specific regulator. Targeted disruption specifically occurred at the TSF1 gene created fungal mutants that are defective in elsinochrome production. Expression of the adjacent genes in the TSF1-disrupted mutants was markedly down-regulated. In addition, elsinochromes were extracted, for the first time, from affected lesions. A survey of 52 field-collected E. fawcettii isolates in Florida revealed that most of them were able to produce elsinochromes in cultures and/or in planta. A single isolate (Ef41) with distinct genetic traits from all others failed to infect rough lemon, grapefruit, and sour orange and produced no elsinochromes. Overall, my studies employing biochemical, molecular, and pathological approaches clearly demonstrated that elsinochromes play critical roles for fungal pathogenesis and lesion development.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Chung, Kuang-Ren.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021942:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021942/00001

Material Information

Title: Molecular and Genetic Determination of the Role of Elsinochrome Toxins Produced by Elsinoe fawcettii Causing Citrus Scab
Physical Description: 1 online resource (175 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: citrus, cluster, efpks1, elsinochromes, elsinoe, esc, escs, fawcettii, fungus, gene, oxygen, perylenequinone, photosensitizer, phytopathogen, phytotoxin, pigment, pks, polyketide, scab, singlet, superoxide
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Citrus scab disease, caused by the fungus Elsino? fawcettii (Bitancourt & Jenkins), affects all varieties of citrus, resulting in serious fruit blemishes and economic losses in Florida. My study focused on genetic determination of the role of elsinochrome phytotoxins produced by E. fawcettii. Results indicated that elsinochromes function as photosensitizing compounds that exert toxicity to plant cells due to production of reactive oxygen species such as singlet oxygen and superoxides. Upon irradiation to light, elsinochromes alone rapidly killed suspension-cultured citrus and tobacco cells, induced necrotic lesions on rough lemon leaves, and provoked a steady increase of electrolyte leakage. The toxicity was drastically decreased or alleviated by the singlet oxygen quenchers, such as bixin, DABCO, or reduced glutathione. Accumulation of singlet oxygen and superoxides induced by elsinochromes after irradiation was also detected. An EfPKS1 gene encoding a fungal polyketide synthase (PKS) was cloned and characterized from E. fawcettii to confirm the roles of elsinochromes in fungal pathogenesis and lesion formation by genetic disruption and complementation strategies. In addition, accumulation of the EfPKS1 transcript and elsinochromes by the wild-type strain were coordinately regulated by light, carbon, nitrogen and pH. The results clearly indicate that elsinochromes play a consequential role in fungal pathogenesis. The genes involved in the biosynthesis of fungal secondary metabolites are often clustered. I sequenced a 30-kb region beyond EfPKS1 and identified nine putative genes; some of them encoding polypeptides are likely required for elsinochrome biosynthesis and regulation. In addition to EfPKS1, five genes, RDT1 encoding a reductase, OXR1 encoding an oxidoreductase, TSF1encoding a transcriptional factor, ECT1encoding a membrane transporter, and PRF1 encoding a prefoldin protein subunit were identified. Other four genes (designated as EfHP1-4) encode hypothetical proteins that are likely not associated with biosynthetic functions. The involvement of these genes in elsinochrome production was evident by analyzing the TSF1 gene encoding a putative pathway-specific regulator. Targeted disruption specifically occurred at the TSF1 gene created fungal mutants that are defective in elsinochrome production. Expression of the adjacent genes in the TSF1-disrupted mutants was markedly down-regulated. In addition, elsinochromes were extracted, for the first time, from affected lesions. A survey of 52 field-collected E. fawcettii isolates in Florida revealed that most of them were able to produce elsinochromes in cultures and/or in planta. A single isolate (Ef41) with distinct genetic traits from all others failed to infect rough lemon, grapefruit, and sour orange and produced no elsinochromes. Overall, my studies employing biochemical, molecular, and pathological approaches clearly demonstrated that elsinochromes play critical roles for fungal pathogenesis and lesion development.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Chung, Kuang-Ren.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021942:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101111_AAAABC INGEST_TIME 2010-11-11T12:07:30Z PACKAGE UFE0021942_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 30603 DFID F20101111_AAATOF ORIGIN DEPOSITOR PATH liao_h_Page_102.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
b8e397021084f4f8dee497afc3f27d8d
SHA-1
0b4e5ded7af12a09b479a2cd13c2f1930f3af2e6
4348 F20101111_AAATNR liao_h_Page_089thm.jpg
a25ab8d8a89f37bb7c7b11751bb908bf
eeb9734015cd12d9cbc44a98fd20ceee8e514b1d
6900 F20101111_AAASKP liao_h_Page_108thm.jpg
cdda201bfef5d9759907e72fcc1a2762
62a87c5ff5456aecc95376800a15ff63c2ebfc11
5225 F20101111_AAASLD liao_h_Page_160thm.jpg
1daeda9c26a7b88e46a9ba37554338c0
ccb83f2d4859f9094c4234e4fcc77dbc0cef536b
6873 F20101111_AAATOG liao_h_Page_102thm.jpg
0a1859836568c3039c5458251c713b42
f2f43df2e3f2aa61aacb1c6a20de2284da818e71
13335 F20101111_AAATNS liao_h_Page_090.QC.jpg
02a80b76995b4ec71fc3d920501fae1b
7cf87f87969f124cd87079c953b64cdcea815d67
25271604 F20101111_AAASKQ liao_h_Page_076.tif
14fedcfa929ddc9cb99363f65622cf28
cf0c4fc2ec1e4f24936ab32f4808482ac84c8cd6
6659 F20101111_AAASLE liao_h_Page_059thm.jpg
a1d189a23b28bf38b64f54acc61b9580
0e44e0c15099ff9e4dae767802a019559fd36efa
6639 F20101111_AAATOH liao_h_Page_103thm.jpg
69e663f960a218050a4d4d5bb8fe79fc
38984dd1dbf68dd8cf97b1e1e9d18e70d5c03a41
26104 F20101111_AAATNT liao_h_Page_091.QC.jpg
6ae54f25d591f806fc577025478232e1
5e8cb960e01cdc056b276752cac9ac124d9951dc
2158 F20101111_AAASKR liao_h_Page_157thm.jpg
03ea30d3ebf6d6a5a4ae61bf0427781b
bedfb87fc5f2b133f9ae12f20310c59957c5ae34
70776 F20101111_AAASLF liao_h_Page_173.pro
4621c74b40ffc011e77febbca42cd3aa
8f7effa9afea4ad9d6585ab369525be7a35bd3a0
24671 F20101111_AAATOI liao_h_Page_104.QC.jpg
2e005ff8272433744ffe608e93c80ce9
99d959fe2ed7b1963426e36d6baa64d66c16427a
11417 F20101111_AAATNU liao_h_Page_092.QC.jpg
8cf23b1e4a908c173c8168d0bb817cad
85cdda3a282146c2f88644ca8d88ba7ebdb09b5e
85831 F20101111_AAASKS liao_h_Page_033.jpg
3995eb8636df3299717e08abd0252c0a
69377e1c79bbc6deefba5b4edf6fe5cbfbb28946
41852 F20101111_AAASLG liao_h_Page_046.pro
a585e299a71e8cc051a88986a3b64035
7d1cc03d85717106d2176cca78ab0e1c5a4234f2
5734 F20101111_AAATOJ liao_h_Page_104thm.jpg
dffc3a0dc4fddedfaccc59a79ca661e7
a7c789b374b2f7437a7ee308c5e49fdc315e6efe
19709 F20101111_AAATNV liao_h_Page_093.QC.jpg
bff1753593d3eef552832864afa0e8f4
25f57aa7aed0c0deae8e70d4907e35d997b0a954
1752 F20101111_AAASKT liao_h_Page_134.txt
c2d5cff1c0a8c12ec560c6acd3cd6cc6
4720722286655b50fce25da64ae4266fab6a5393
2805 F20101111_AAASLH liao_h_Page_127thm.jpg
1230fd252a05e0c1c7e947e6668685bb
a111f92d3bfade0408d3ea835566f23bf30660c2
29035 F20101111_AAATOK liao_h_Page_105.QC.jpg
01a048a68b08a345376c4467b79164d7
f7849e3db97efd88e164714d68f4ab4e13017949
5236 F20101111_AAATNW liao_h_Page_093thm.jpg
3f363d48afc252d764f86a3e7ac56ed6
16d7ecdc4fd45eb7ea09d480dbf8491b864d45b3
7285 F20101111_AAASKU liao_h_Page_031thm.jpg
44298f270e2b13fa7c403072d8df353a
e2535b02e7113fdab37a266963d358d957908b86
51638 F20101111_AAASLI liao_h_Page_033.pro
93122400c51c148dc0ae5413962daabc
bb917808f613765fd533c3117b498c5794809f11
29715 F20101111_AAATOL liao_h_Page_106.QC.jpg
1117ab7cd5b5146c4f30c60aa445a9f0
5283a38468288531a2f13b70c09e5619a16f93e9
5867 F20101111_AAATNX liao_h_Page_094thm.jpg
c29041deba488320b352e05333f9e791
f9fce7759dcde552928a29862b47d88523c594b0
31371 F20101111_AAASKV liao_h_Page_172.QC.jpg
709cb078e54f32df6607208d218936cc
50938a60fe311dba0f3c02e907e3fb62a0295a30
36815 F20101111_AAASLJ liao_h_Page_127.jpg
f9fa2a9926527b241f11130ef57fe60c
b5c02c5dc5b0f31c7c6bfc6432a6b87b8e85c607
2076 F20101111_AAATPA liao_h_Page_120thm.jpg
5d2237b5c16809ec9b3c3e85c76be2bb
309598bb65480dc1e210b089cffef988197e6455
30965 F20101111_AAATOM liao_h_Page_107.QC.jpg
f3c2edb7b84f60b4525ff12fe904f0d0
0f268252d4381aa36c23bed12251cc3e125e8ad8
6755 F20101111_AAATNY liao_h_Page_095thm.jpg
1ec17a07e2bd940cc19cf77bfa19435a
0c048fb83b2e7fe149b4f2bc972c7e61d86878dc
784479 F20101111_AAASKW liao_h_Page_056.jp2
1620fae2ddc51cb629f168f324539df4
694b77938e2e842f1845246d6b2bd7d25b66559c
2204 F20101111_AAASLK liao_h_Page_096.txt
4e76b3d0b974234e5c938d71ecfcb95e
ce7aaabf5063ce08840404dade922b226c1e0a0a
6457 F20101111_AAATPB liao_h_Page_121thm.jpg
5eb738b96871f02540ee0ac14143a9ae
d0fa015926edd16b4921b2935cd1e7a9712c177d
6994 F20101111_AAATON liao_h_Page_107thm.jpg
aa15efda980808e94a480c131c8bd8ce
611d8cd534d4c5acf5b6dcf39ddf826ce25b7597
21262 F20101111_AAATNZ liao_h_Page_096.QC.jpg
4f3cd2c5619764f05042328a80daef0c
855fc9b34ed9a4cacba39d98526d7f94ca536741
7080 F20101111_AAASKX liao_h_Page_133thm.jpg
5996a21aeaba07d19fd23f7f0454df55
46572d001f57ef9d6c8d9a02b939040d989b3477
1683 F20101111_AAASLL liao_h_Page_050.txt
6c19c28558092b31cf2eac0dce17b9ec
46747badf9c8295df04160113839b8f05e460901
20352 F20101111_AAATPC liao_h_Page_122.QC.jpg
0bb38112c8fe7bd289caaaf2f3f83297
e4342d330708bf2a5e2bb96bafa6278b63de1b75
29902 F20101111_AAATOO liao_h_Page_108.QC.jpg
fedd7f16c489dc42e48f404db983fb47
a4a16f1d29b3851fa2425bf53941161f843247a8
F20101111_AAASKY liao_h_Page_030.tif
3ebe26cb656b711ee940d310a53ab17a
e7b843eec059118d6d47cd688e1b8b7481ff8a8a
F20101111_AAASMA liao_h_Page_156.tif
5ddf98f645b3f6b9ef1f9be224c6de2e
0d720a9794a5e204385f5e186d482a265b03669c
6648 F20101111_AAASLM liao_h_Page_074thm.jpg
f1c4260dce93b0750aca0f40d4e8def7
4d591c5cd1c1920046442ae993b4ec2840ec676d
5533 F20101111_AAATPD liao_h_Page_122thm.jpg
213e29084ce251b9dc27c2ddb79ee538
d8e95440883115be7981db6ab9d01a4037241c9a
29272 F20101111_AAATOP liao_h_Page_109.QC.jpg
af11ce2f6e8b548a5b010becd38ce47b
4279d124842a3f50a6464298dd26a02405c20328
88495 F20101111_AAASKZ liao_h_Page_015.jpg
93643cf915ad726487703b7dc55a5322
20daee3e6ccf0835f0ea35fcbf9e2a46ddcdaf5b
53027 F20101111_AAASMB liao_h_Page_069.jpg
de30f4c6456e84306537bb93e0112fc0
34d23b28501e1350ac45d3b04db5ba65f77c7b17
86311 F20101111_AAASLN liao_h_Page_121.jpg
23b5e514d3e9fcb6a03d1a7f26c734ea
0ab0823b8f0643a7946c5a7f0e190538c67bdbbf
5885 F20101111_AAATPE liao_h_Page_123thm.jpg
5d15bad638c6fa4a5d63eb8f4c5a2e01
a8ad732ee91356da3386298c4655ed34019ec3cf
7019 F20101111_AAATOQ liao_h_Page_109thm.jpg
064fccadebcc87154d3079325daf8dfe
57348ab54859abc075accad3454f011fa63d10b7
777316 F20101111_AAASMC liao_h_Page_146.jp2
763d3a18f61580e88991a8669a7d3b34
c49deedbe02ceee5a450dfc58f2749313e96402d
1392 F20101111_AAASLO liao_h_Page_150.txt
0f3f05d3a6c54abf1fb8f0635b551fca
78a86bab3369b719d1b416fc24e251aa41e3b59d
4916 F20101111_AAATPF liao_h_Page_124thm.jpg
cf372953379a2b3701b7f7ad8efddc3b
3dc0d2954557a9811a8e6225dd04d233d926b33b
27641 F20101111_AAATOR liao_h_Page_110.QC.jpg
67d6dccebde4bfa2d8c83d3aeddb9bc0
876bd343edf638c8c53834712deef0c355d61719
19650 F20101111_AAASMD liao_h_Page_098.QC.jpg
77b02e36af4f443920ee4947c85fe855
4d38c23b690f9044e6f1d47904d72214ea661724
25352 F20101111_AAASLP liao_h_Page_097.QC.jpg
ca43316736216ac04ca5a44406b13a3c
b0c6e8d47909b475d7f9ac11cda7f7b464dda57e
17889 F20101111_AAATPG liao_h_Page_125.QC.jpg
6757c6be810a78eff6e501bf476f1df0
26179dc1ad2eed6f015bd5d14f102ff919b4ea67
6675 F20101111_AAATOS liao_h_Page_111thm.jpg
cb788254d58fc57f7b1375b9eb036ab0
1bd23d1a30fee7d87e562d9a9fe55ae7241c84c2
6297 F20101111_AAASME liao_h_Page_115thm.jpg
62f67fd2c000cdb57072a34379e48430
674c419dd9d5d29aad8c60f9d0827fa35aae5270
F20101111_AAASLQ liao_h_Page_121.tif
155d9bb188fe409cc62a5be189db6ebf
c85ec2b54a03ebe1249f980d084cae4f28556321
5015 F20101111_AAATPH liao_h_Page_125thm.jpg
810574f1b05313e8307386fde25608b1
ef46bc0da261f1f9b9a3fd4a7fb1de499b70850d
29563 F20101111_AAATOT liao_h_Page_113.QC.jpg
169b9b24b2c6eb054573949d303947e5
82d32466a1e3e28900651b0afba58ef7a7909c37
1332 F20101111_AAASMF liao_h_Page_056.txt
7dab245e28f4eb561270c46ce6b0a7c2
c59b9dd051abaae0c04273370cc628d7774c4efe
6779 F20101111_AAASLR liao_h_Page_023thm.jpg
a9c5cabc63d6e71bcf23e2b97a472963
5dde78106ed28f36db6acbaa52129b3f8c0c6647
4274 F20101111_AAATPI liao_h_Page_126thm.jpg
1de3399c404efe0e3976612ba4682bd3
34fc469cbaaa68be617a4314f7a5056575ce70ff
6897 F20101111_AAATOU liao_h_Page_113thm.jpg
b9909414a26fcc1d911ac273ee46e9f6
fbd5c44aed9248048f291443d14484333a406417
2412 F20101111_AAASMG liao_h_Page_142thm.jpg
07926f1ce4c2c2c1b34bf1e1e93550fc
cbaaa783a038946e18170e04b284db66fb42f77b
6319 F20101111_AAASLS liao_h_Page_040thm.jpg
ec74868bc5878f51f9c8e87d555abc2b
6d456a7f7723f51e5af1cba64d39d1135e544b0c
10790 F20101111_AAATPJ liao_h_Page_127.QC.jpg
d13a6e4cf33b5519c13c4d7f5adabc3b
b4120598fe4bbf903d30caf3fcaac06e0ebcaf2f
6920 F20101111_AAATOV liao_h_Page_114thm.jpg
b46bca3cff028b8459e173944d85ae3b
435cfa146a2e58deed7ee6a5e98e13476256963b
2577 F20101111_AAASMH liao_h_Page_166.txt
99130723a2f8c8ae714e38ae8ba9fa82
e9b553e1e1e9931ddafaf680336181bc3148cc33
2830 F20101111_AAASLT liao_h_Page_173.txt
6ec3cee43620f2984386e76e493f3542
9047a0f603f9e713358f0f5bc9db87ae2292da6a
6969 F20101111_AAATPK liao_h_Page_129thm.jpg
7dd32d5e1288103d593235b965bd888c
c6146b6ed35c55fab89403117772a44bae8e5b45
26798 F20101111_AAATOW liao_h_Page_115.QC.jpg
90686beee3430ec04689eb12dd2df56d
3a8b9a377276e587707d31c88a21393ace8d2876
397795 F20101111_AAASMI liao_h_Page_118.jp2
5d1be458212ace1902608ef1404fcefa
7159108db3d98b3145dc495b08553ad59d1a8e18
1051977 F20101111_AAASLU liao_h_Page_084.jp2
2188e858ff66918cc7c0d8fcdfcec74c
a058550f7da8892077e5e9ef12aaaf9f16abd3b8
27636 F20101111_AAATQA liao_h_Page_141.QC.jpg
3f61c0b61935a4a9ee5828818e1d4174
b3bace193e31b10f6680e697581868986e4349a0
28022 F20101111_AAATPL liao_h_Page_130.QC.jpg
a131454e473b342c8a348d3d21bcedb6
f0844903a3a4b263bfec3eab180397711786daad
2828 F20101111_AAATOX liao_h_Page_116.QC.jpg
fb0cee15d41f4f691d13808b9ab98b97
6ebf09c076ef19a8aac19f087f06c7ff62cbe4de
24113 F20101111_AAASMJ liao_h_Page_014.QC.jpg
732c48295e7f6693e0402783ebd80d28
e53508bd30ae928d4ad9a87940d40ea3c8ac3e30
56611 F20101111_AAASLV liao_h_Page_109.pro
4190bc018c691dd54416587eb05413d3
6efe96b125b26b459fa39a68707064a17bf14f32
6448 F20101111_AAATPM liao_h_Page_130thm.jpg
e8f2f1e8a36cbcbab18f3c6d5852d15e
144319be7af6531c10e397ee7f7de6388ba2d14e
18401 F20101111_AAATOY liao_h_Page_117.QC.jpg
2e2bf51a9daeccce579ab015175b89b2
2612c0403ed1f07562fa951a7515d426d875c0ff
89732 F20101111_AAASMK liao_h_Page_076.jpg
6e1e88c6d4884622f3b4b3c7c3b98f6d
61591c6795e51e50bb2f689029ed1551b587115e
97702 F20101111_AAASLW liao_h_Page_095.jpg
fb04a955691bab2d1bd284f43a0433e3
21bc23e1695b6c36f8536fc0d25dcdae30e8b964
10308 F20101111_AAATQB liao_h_Page_142.QC.jpg
76d7b673a383e3b446d9555aeccf40f6
8c8d6e7d83819ed71bd6badffeac7452541a8e71
26297 F20101111_AAATPN liao_h_Page_131.QC.jpg
c5057d3a1ec3a94f6037a75bb99a89b9
3cd782313457f0952c8294551f5a94d1f377e917
7673 F20101111_AAATOZ liao_h_Page_120.QC.jpg
6bc9a3f87a7b06a361e1ea63d2f16a88
5f28749930f726205eb281cc4dd369feb57e1e64
1051985 F20101111_AAASML liao_h_Page_059.jp2
50b74ba87f6e918839553ac50eda84bb
64cfb9f185edcdeb745b8f5a90241407ec62d06c
28744 F20101111_AAASLX liao_h_Page_103.QC.jpg
b8684a4827d61eaf73c2d0176c59c26c
41c3978f7a565f3f43f24fccba37d15fb4b04814
21258 F20101111_AAATQC liao_h_Page_143.QC.jpg
c5ddf9c1ca13940773815a3185975268
8a9c64737f881e7c178e236ac8a01ddb440d1b79
6549 F20101111_AAATPO liao_h_Page_132thm.jpg
5f4a2e21d49876ff84daf2d1155aa077
44a1c3c66c876f040cdefe47bb1f9e31ee2bbcd7
F20101111_AAASNA liao_h_Page_134.tif
8d241027cf76f0c8f176812684c7f842
8c1b7db27e870c62826426dabf2a31c8d4df0a0a
588603 F20101111_AAASMM liao_h_Page_150.jp2
e011db2784f28ca1da8c7576ffc89273
697aab30b6d7ad2d32a9d04f8090158b6eb8e87f
F20101111_AAASLY liao_h_Page_080.jp2
72622e538872018471295d50832df922
8ccde7766f0ab10ce0e39a4043aab0192fee29e7
4987 F20101111_AAATQD liao_h_Page_143thm.jpg
2c310d6cb25578ee31d165c691b62d26
3afb1a8a9a9973f705e39d172252b7c1b2e9d6ea
29859 F20101111_AAATPP liao_h_Page_133.QC.jpg
c665250fc90c4f561640b9666ee83ad0
11e3c7dbf827a700f6f62144d60ebb2744ee6143
1476 F20101111_AAASNB liao_h_Page_092.txt
38c813c83d961da4dabb5ad5cf446e6e
cef6377f56441d5f76c44f7abc054470aea8b07b
1051948 F20101111_AAASMN liao_h_Page_099.jp2
5a00e3d7fb8007cca8d9f38d500878b4
1df5427a8757b911e8fa66665dfe2cc13bc6c315
931 F20101111_AAASLZ liao_h_Page_049.txt
36aa5d48562a944a139ad1ce331941c5
7ae99a3886ee4467bed7bdc83bc839ca7db6832e
2859 F20101111_AAATQE liao_h_Page_145thm.jpg
07cd58f1cba205d75fc6707241ae752f
d7cde8eb50ab75d67a7b87d37b866445399a6075
24891 F20101111_AAATPQ liao_h_Page_134.QC.jpg
76f6385d55ceb7d81cc8b951eb79a4cb
8060f2d29e47e637765da481406a1fccb28f651d
102812 F20101111_AAASNC liao_h_Page_012.jpg
f5d5d1406fe686a74bfe978331155784
b740fcb3d39f6a1b94d2f335e976a6a66be6d1d8
F20101111_AAASMO liao_h_Page_085.tif
816d2b706dd784b49912f8310ac09a9e
51cb85bc6d3d926527edfc52971d8bf7b96cc733
16213 F20101111_AAATQF liao_h_Page_146.QC.jpg
6aa0d9922b53a82f8c9d325871c26131
18a424d0e73e5ef74a9cdc138391d29da95d751e
5932 F20101111_AAATPR liao_h_Page_134thm.jpg
dab403ef43835c217e58297d2462b0c3
966e0e8c2cfc5138e0a6fa20c08c2aa6adbf963d
115970 F20101111_AAASND liao_h_Page_031.jpg
c6e9b9b5f6a45da4d4f6ec915267ac83
44ec237ba0d80dc4070bf2f98a6afacee40009e0
F20101111_AAASMP liao_h_Page_084.tif
85d0e077f9a3d2297c46ed6e52374ffd
b88a081574c1aa8940f1089da3834cbd99153e86
4427 F20101111_AAATQG liao_h_Page_146thm.jpg
6adf90092469a4e628db2f29ae7f65e9
525488d3978a25916837a862e5397eb4c551050e
27022 F20101111_AAATPS liao_h_Page_135.QC.jpg
866587ed239e5497bc48cf0f8450d219
ac465d21f0fed7f20e554ac701b7dc9cabd28997
12536 F20101111_AAASNE liao_h_Page_028.pro
19fa8e0e20b347f38713688dc46d6440
320b8158ae232a4ead86b8f661057885fc0c1aad
52321 F20101111_AAASMQ liao_h_Page_103.pro
ce277c8b3debe6d9d48dd5c2092065e0
63c73fa0e852462c97407a8ee771b2f68506e32d
30409 F20101111_AAATQH liao_h_Page_147.QC.jpg
7d98943567c14a8d3a3390f38db3ec1b
9da3d810563bef067c96c68ccbf646f7ad4f0162
29639 F20101111_AAATPT liao_h_Page_136.QC.jpg
9f26416ea155d4118d9ca45e65a89ed1
b71229b50bce5c74e3232f51db18f74778c4074b
1051975 F20101111_AAASNF liao_h_Page_130.jp2
c888e4f163a4d8c71258b7e405ed9c1a
6e89b4a810e01be19c9f83a433ba73d016bdcc12
1051965 F20101111_AAASMR liao_h_Page_083.jp2
c03d8f982f122a1972db84fc9428be2b
3e21145ccebeba0712ea98ad21a0e8bbd5176e4c
18780 F20101111_AAATQI liao_h_Page_148.QC.jpg
4de4697e18bd1574e1d6250436691933
4dffae19ecb29d2a98b28b40ccbc04f992ba4d43
6749 F20101111_AAATPU liao_h_Page_136thm.jpg
a0c8b8311e17456aaf8d41025050d38c
2f29b5ef01e4da0903c3e3ead10e0cd0059d7599
55016 F20101111_AAASNG liao_h_Page_136.pro
2a0780318273f0f3c1853a3b1874c4cc
65e2444a335316cae555a49993250def43cdb537
813925 F20101111_AAASMS liao_h_Page_069.jp2
851568e8ae6c7bb999b1ea84afc4f334
599da7131c1029a4f127bf561cfe43b9dc2f3b38
5016 F20101111_AAATQJ liao_h_Page_148thm.jpg
77eb860ed947529a24ca7a6ec6986f8c
8f13a951b92e1980d7c39f9150bc14bab5df5b0b
28945 F20101111_AAATPV liao_h_Page_137.QC.jpg
5e2438cf24b1e657ec4a44b83f679275
293e57796484ae9f5dfce3b6716338123c5e5716
2024 F20101111_AAASNH liao_h_Page_084.txt
2b7cde2cba1540991290077c97db564a
34679d7064a663c6547b95b313dd267187710114
27918 F20101111_AAASMT liao_h_Page_162.QC.jpg
226a227d41bbf94b474c4b668d06e71a
1ed7f9fb18d69fd75ff411717836701324eace3b
16365 F20101111_AAATQK liao_h_Page_149.QC.jpg
8c3d1e1eea48a02ec962db2201aea273
4f6afba73fccc1ec1196848afc98ef65c3bf6c5b
6566 F20101111_AAATPW liao_h_Page_137thm.jpg
6676b46a8e913a61084a6f221ddd1e89
9060a29809fbc881b0bca5a317e076e2e29a5a90
6672 F20101111_AAASNI liao_h_Page_034thm.jpg
fcbe7aa8c2736b4017ff4ca8d795e1d1
288329b838e1087cbdfbee12da42a054d564da5f
3270 F20101111_AAASMU liao_h_Page_153thm.jpg
fb04c06c12d0b7320c6c3fd0c729831d
ddfee3778da1ae4afe5bfbc8193712e706b2716d
31120 F20101111_AAATRA liao_h_Page_165.QC.jpg
8cb83a7a5a278fd01f0bc9fa78ab2bd5
a6e1edaa606a0542fe11f46868838889de71de8b
5170 F20101111_AAATQL liao_h_Page_149thm.jpg
31e3b8a21246e67da204194f233c19d7
ac5ba1a1712f93990cbb33df3cd64595e5cfd90b
6702 F20101111_AAATPX liao_h_Page_138thm.jpg
0173d60ae40dde4a84231015bc9037ff
3868021f5717ef71ede5af94cca511053f7433a4
70841 F20101111_AAASNJ liao_h_Page_093.jpg
06bc4208ec7ed75e19c89b22125a9523
55225e6fb56bea8486cbf4a16e54679b7c61231f
F20101111_AAASMV liao_h_Page_022.tif
cc607f171fce39d64bcbb507cec5fe9f
af80e6d33b0e7b0306554533c2ccbc3719da82be
29674 F20101111_AAATRB liao_h_Page_166.QC.jpg
6f43775c34a2c22e2cdeb7c6eff35b3c
0b28385a9a8d5de0930a55c66933a8fa23e74010
13800 F20101111_AAATQM liao_h_Page_150.QC.jpg
17b2365c42b9e1fb2fc0180b21309a98
580071be2246427d18e8cf0ff422109a8133048f
30376 F20101111_AAATPY liao_h_Page_139.QC.jpg
1e3047212f729fa444d5544ed079de76
a218fd4cabc15229dbd3091291bf9dde14144b39
F20101111_AAASNK liao_h_Page_080.tif
49fd7a1a4eec5990579a1d41a2b378f6
752b7ac5074b720e13c7ec929b7a9e1872ad3ae9
2148 F20101111_AAASMW liao_h_Page_088.txt
691d1ba0c6a5aba0ec343b1a8c48cc45
17ef058db232ebbfe86979e46a6f20425d958e3f
3808 F20101111_AAATQN liao_h_Page_150thm.jpg
d6054db82a6313b99b123ecca64c4223
4ccd6485e6f66b4ceb7bfb36ade9d41cee0f4456
6786 F20101111_AAATPZ liao_h_Page_139thm.jpg
974f42c1cae3b374c73d711e7f0703cc
da4b733128bff02b6f3b8dc5f9cef303069c3258
F20101111_AAASNL liao_h_Page_150.tif
101db0f9c25c0007eda3ebd0ff1b7e1a
68a54c0fd1de95a6e54fa63280feac7e9e945a94
20249 F20101111_AAASMX liao_h_Page_156.pro
305fb1850c156739f54188003decfc37
ecdbb54f863e310107e4532c9ab107a49a0b6b70
7182 F20101111_AAATRC liao_h_Page_167thm.jpg
c787ad76149849338ba5a29b8d932349
965f678e053b312c42dfb8837efe5b1fabb92bdf
20616 F20101111_AAATQO liao_h_Page_152.QC.jpg
a8eecd3594abb957489668b7a4b85ded
d332864f7e79db8f6da2650f1fc6dce1cdaa0505
107866 F20101111_AAASMY liao_h_Page_173.jpg
c8a6c0f9906648531f4b44fdebf75096
cbcb74b841fe9ecb844cb77912489a426ec5f070
89933 F20101111_AAASOA liao_h_Page_032.jpg
cbd5e3c16f201529e1c0dea2a223a56d
af2e7e54c57b3547a727de94959343c925ae7024
28283 F20101111_AAASNM liao_h_Page_101.QC.jpg
a54a24d4541e5a80536bb832027870fc
516106f375dbf79c2c8b6d298d91c42b3328dba6
29750 F20101111_AAATRD liao_h_Page_171.QC.jpg
fce88174aee71f4878779e7939640861
c50f57c87e54bb2355220352cb44cd1db872c7c4
4812 F20101111_AAATQP liao_h_Page_152thm.jpg
6ecc75d796cb16cf4c95774f22932515
ab83e8799eeed6ed75890da3e40f3ed4b8b3942d
28668 F20101111_AAASMZ liao_h_Page_146.pro
0e9cef15f943338feb671c2f4b2da911
f2a812d76bf4b0c03b138a2c0f2f801921c6b46f
24555 F20101111_AAASOB liao_h_Page_121.QC.jpg
411f757727f518efe31110b6070eb033
dbbdcd30a15fcf5e10979c7b11d813ca148ea1f0
15152 F20101111_AAASNN liao_h_Page_120.pro
24e30ea3db92ec26743cf2e2a5b50cf5
54c33fb00d624b871151645f8aa833360bfad7a5
6818 F20101111_AAATRE liao_h_Page_171thm.jpg
12b41dec1b78482501df9aa4074b348d
0aa95d6b2db688bb7567b290aaf69584e6189bea
12288 F20101111_AAATQQ liao_h_Page_153.QC.jpg
f10de5ee9eac40daead5dd3d8e7a21b3
55fccd1186fe038c299c8cde5ce26c6635745392
91862 F20101111_AAASOC liao_h_Page_025.jpg
ea6cda6efe5a6e3d54e4f073ddc40f54
183aa792123e86aa13e60ff4980d39641d02fa6d
29865 F20101111_AAASNO liao_h_Page_163.QC.jpg
c94461534ce3ecfceae861b8d6c6035e
ab3d113407050d7abdb7af0e2e2de4bb0f679ea3
7314 F20101111_AAATRF liao_h_Page_173thm.jpg
ac6a99c617bea4491e44ced4ca5bae85
08d6a18be71678fddd7425711740947fa6ba57ee
7309 F20101111_AAATQR liao_h_Page_155.QC.jpg
cf35c558716602f2e19bd3ee62e2ba1c
8829fbb2b0ea7b214332ba91618f1415e1b568b5
2118 F20101111_AAASOD liao_h_Page_087.txt
25a4251d0b35c5fea7235ebce18a5181
95a893986cdcdffec28e164de3e9f705cd66ca47
1983 F20101111_AAASNP liao_h_Page_117.txt
2a9dc7b853b638794a3e3514ff08b29a
fd82047b5c41ed9811f1ce38bd2f7553b81ee223
17362 F20101111_AAATRG liao_h_Page_174.QC.jpg
6ccd6a61564c1e772bbfcd64663d6f45
00cb8efc3ce981c63498a7e51894779eab9abd8f
1768 F20101111_AAATQS liao_h_Page_155thm.jpg
3183a37412f8b757452a8d5f827da40e
9c9ddb1ea06d20150ca031d57de475650816e317
816104 F20101111_AAASOE liao_h_Page_124.jp2
90f2857566b38921be23897cff611068
19762179bb703bb314c212139ff1c28f63a5a3aa
349753 F20101111_AAASNQ liao_h_Page_157.jp2
e7ec96e43145931db6ea0363d1e3669f
63a237c31b7856d45923f17439d452b640f55280
9239 F20101111_AAATRH liao_h_Page_175.QC.jpg
7e642e2c3d1646ff53cf0461e62cb717
addb3fdf0a1593bbce4cf3b778ee9399d284640d
9712 F20101111_AAATQT liao_h_Page_156.QC.jpg
793a826d1f475709b18bae2ddd348fab
f72db81feabd84b2a74416af527e1b18817d71a9
1051984 F20101111_AAASOF liao_h_Page_138.jp2
1f28e968c5c16faa62f6f6e3702e00be
6e6d5fe198128c7ceeff54104ac33bf53448a63a
6393 F20101111_AAASNR liao_h_Page_081thm.jpg
eb417ac5c735b9039812f8438b9c2abb
1f8636b9bc439f3070357f6e7bf02f5b193c8105
2216 F20101111_AAATRI liao_h_Page_175thm.jpg
c3c902caf6aeb358906b30ae2dbb91b0
826527b8a7bde215b451bf29c39e5c870260358f
8720 F20101111_AAATQU liao_h_Page_157.QC.jpg
c9aed7e3f09b8cbf5bec7526362bfb74
fb7e72d6a2ec49055f4f4f8dba4a1b82b185e8d7
1051972 F20101111_AAASOG liao_h_Page_045.jp2
2b392c536f752822db71082971c79e41
e2e53a81419a5522f85c1e6368b967c5f381db83
50497 F20101111_AAASNS liao_h_Page_060.pro
feaf026b119436448a6e1585a908708a
68a259ddde6a04962dbf68629c2624a4bcbe1336
200091 F20101111_AAATRJ UFE0021942_00001.mets FULL
899ca9b83c5872909e65ff593b0dfa2d
9e3d8c13cf5ecf4842a8258c472b8606d3395145
11031 F20101111_AAATQV liao_h_Page_159.QC.jpg
e877f012d8f6ad87714a93c0eb798bb2
621a092657a7637ee1e95e7c95645383f7bb74be
55601 F20101111_AAASOH liao_h_Page_083.pro
12227cc12c3874748880e2a2c72d1d60
c346ff27e9dba09c509d2af95f1b0eb0bd049571
1051923 F20101111_AAASNT liao_h_Page_076.jp2
9c433e9a40d4b3793d184eb1ccef19d8
64508ff7ce9c626389953f2b83ab0aa4710c3002
3367 F20101111_AAATQW liao_h_Page_159thm.jpg
e0bb6807ad603f88ead6364626f1506b
0d8761c328c68868f8efb42cfbd5bc867a66a7ae
1051898 F20101111_AAASOI liao_h_Page_108.jp2
edc4e8bc062cb982ad0e381a43cf893a
9bf65e549f5e254bde87e3e13746652d6abf4dee
F20101111_AAASNU liao_h_Page_023.tif
5cb5ace7775b90a92066aacb69c5d161
34bd2e355dcca3fcef19235a740a3b407cfdbf99
21808 F20101111_AAATQX liao_h_Page_161.QC.jpg
ebeb8c933c180192e844f510dbef7188
a5fcc8ab8824aa76a689ccecc98ab136acbae64b
F20101111_AAASOJ liao_h_Page_128.tif
01364b405fd8c680fc60f8489a2fe915
8d60af37d2fc3ec38f219056f7577d0ed429635a
52303 F20101111_AAASNV liao_h_Page_032.pro
47b72414485e3a13dfc7037a9de3552f
93eca8a8e61e34f54bb0a6e7cd048b05dbc10300
4567 F20101111_AAATQY liao_h_Page_161thm.jpg
0154adafe976d9802dbd055fee3d2a18
c007fcbfc2fbb1eae0f4af9e79960d4436902a2c
40698 F20101111_AAASOK liao_h_Page_066.jpg
c1b0b5e22f50e46aff6688b13bbedfe8
74178536f244e8a3d9a4f03713b81c2d4ff63018
848770 F20101111_AAASNW liao_h_Page_072.jp2
41c00a8150d69083fd5d8e71c8ea8f8f
3aba27754feeb89d7b303cd0b463ef26a57182c7
6862 F20101111_AAATQZ liao_h_Page_162thm.jpg
6a90f50d3c06849c139a493c819c8548
466a2f72cd260a4ece926f819a6e7e61380389cf
86883 F20101111_AAASPA liao_h_Page_016.jpg
a071ce7ee242903e96fa61c2e6d50dcc
fba82ea737fa7da6f9ab558f5d30ee23594dfcc6
19545 F20101111_AAASOL liao_h_Page_071.QC.jpg
e127c6c5059d862e700d87178f15b709
21c9825b65cae0838ab01b5ce2b11b70cef80c14
814 F20101111_AAASNX liao_h_Page_047.txt
c26d3abe3462b68cce085d60667abd88
edf357412aded515e72c3cca0cb7907cb5442274
F20101111_AAASOM liao_h_Page_026.tif
77dfe4d10418483966321a95fa60a574
e22ed9e382f511ee3a32dd59ff13202ac4975081
81996 F20101111_AAASNY liao_h_Page_131.jpg
007128ccbcfec56eccb46dde69873079
5aa40ae5801c5161cf1c9037616dedc97f3ffd6d
86800 F20101111_AAASPB liao_h_Page_017.jpg
0604a630f644264091c4cbdaebfe97cd
c8170948906f5aca36554388f5a575dac9fcc038
2017 F20101111_AAASON liao_h_Page_058.txt
8ee186f91398a80fa7319973c39dea77
5c183e33029cd12987a596028821f22b32cfebb3
2132 F20101111_AAASNZ liao_h_Page_032.txt
f551a7f045f05984953846f351efdd15
8b079d67118343650b0057332913c821774d2c29
91074 F20101111_AAASPC liao_h_Page_018.jpg
6c63b5a0beff1cb7802398231c9a8a6d
add08b51b5450b80177d61defec49a88f641fa1d
4915 F20101111_AAASOO liao_h_Page_056thm.jpg
6960a673c5bcacd891b985548d60c65a
d8383e5fa7428c26e42adff5c62c7c8a04e0840d
93358 F20101111_AAASPD liao_h_Page_020.jpg
2a03a5d8166e5746c8be7fbc516e7d72
e4bce96f6466c39ed86432129a355e740f68eec0
29745 F20101111_AAASOP liao_h_Page_111.QC.jpg
d203ccb97fe46e161fa969e908dd167a
7bd70db3c306d11d8f5f9dd0e70914200d96c6b6
90351 F20101111_AAASPE liao_h_Page_022.jpg
603a2d541157e4904c09a789eab5ac08
a9f03172ec497c3b035f35e3c79f7ad8c2f6214f
258884 F20101111_AAASOQ UFE0021942_00001.xml
4ecef01f2f846c94baaeb66d7a44f071
19492f8f9537f7213d7315ac50733f0f8a32db70
92098 F20101111_AAASPF liao_h_Page_023.jpg
1d172e80af8a6ecb5d6402467ed16b77
5d0b6725b3cd79ec7dfa86a3496d6df10f2e3979
26714 F20101111_AAASPG liao_h_Page_029.jpg
a212f10521ef3d873c6734d676f32a81
5361634fdcf9801b1d6ffc5ed6409fb461adaa79
39659 F20101111_AAASPH liao_h_Page_030.jpg
c7cee720f5a286b44d60e4b4507f1ef1
09635e8d38cc5975fba40af71e2a35acac59eb5a
3528 F20101111_AAASOT liao_h_Page_002.jpg
0ad075d9de86a762247dc2ed944506f0
b14d0664b7306e0f37b4b57e2dd362b15ba31a78
90861 F20101111_AAASPI liao_h_Page_034.jpg
89f7a4a2fbc6c33ac4ba1b7c8ee2dd8e
4409e7ab34ac93c7cb9e326aa07f7b40fb0b8021
6518 F20101111_AAASOU liao_h_Page_003.jpg
e5f34149a27885f1277b225cfaeeecf9
5fe681a3353549e717b59ee20fedb613ee63c091
93116 F20101111_AAASPJ liao_h_Page_035.jpg
621b6ad066e1f1d6298e3b15135cd870
6d6cf4e3989110daa48de6b6b9fac6a4ad0aec7d
55892 F20101111_AAASOV liao_h_Page_004.jpg
7d3545c7b23d39f7b6ea8cc13fd0fd85
508b844b33d097cfaec4e27316d922478e98496d
90783 F20101111_AAASPK liao_h_Page_036.jpg
ff6eeb757010e339e4d543d9d76b6f3f
a351ea0db95813cb00d010a96c97d4905bc5c408
130561 F20101111_AAASOW liao_h_Page_006.jpg
3112ad4f04ea835adfc45a09d491ce1a
8aeeb94772574db4bc4d54c2893dfec8ddf64e61
88832 F20101111_AAASPL liao_h_Page_038.jpg
51073f96db186e526397764fcdaf2316
986c95da342cc36cfab303d743be6ceaba432364
122656 F20101111_AAASOX liao_h_Page_007.jpg
9aa5e308b2462bbd12814828623e56b6
1e27271190e870456783f51fba5315d176fbe9b5
87642 F20101111_AAASQA liao_h_Page_060.jpg
06b30ab8276e71c27e43b30d5cd5449c
14f4a94e4b71cc825c5edf7cd8032e4e43beeb0f
81525 F20101111_AAASPM liao_h_Page_039.jpg
5906f4041f723f5933f368b408f76754
7332abad72bd6607d4fd79f2df73091159833c24
115129 F20101111_AAASOY liao_h_Page_010.jpg
70f22b136ef4b141faaaa939cf257fd6
a272979be2f910c5e6c945a6e2208590d0881455
83708 F20101111_AAASQB liao_h_Page_061.jpg
d347a3e7e405c2f644dfa08023cf40b0
3d9cef790c7538e4e8f4d0f2939a1e9d7e2b0282
88654 F20101111_AAASPN liao_h_Page_040.jpg
4eac3be9d71bd480b266030e835ea338
3b4e77aff4114d6d66924586c7579592949157cd
77100 F20101111_AAASOZ liao_h_Page_014.jpg
5f86bf267e58854ba8cfa3909258fae8
295055aee7480345ded53d1dc89507ac8764f552
93730 F20101111_AAASPO liao_h_Page_043.jpg
0b8f2bb0dc500e3354c87d26d6a6c9fd
ef27d284dc06f78617848ca54e39ec4237def662
80816 F20101111_AAASQC liao_h_Page_062.jpg
88a583296f29d32b66b3f8cff1566537
7e7d5e844c092268bc577d2ebd36d637274f6eca
94116 F20101111_AAASPP liao_h_Page_044.jpg
7d8dc3bcf645cc4a6c243852cdd6249f
88a065e7c73993d1f8c7839eca6b9688673d0f29
90756 F20101111_AAASQD liao_h_Page_063.jpg
1dbb671ed445ecdda8dc3279b846b32a
8ebf669d8bf2fd6f3b571aec051bc134aa22f2ed
92166 F20101111_AAASPQ liao_h_Page_045.jpg
e2076a253375fa8a9c83c20969e945ce
d431563286aa12dbbe37c5a4d7154ee194721733
51809 F20101111_AAASQE liao_h_Page_067.jpg
6e8b7ff8c1ba96ea3d3e66100ac67c5f
51ee96ab553d64ece636ffb9f572095a0ed8647d
71901 F20101111_AAASPR liao_h_Page_046.jpg
237c13090154214d3e3de7d5c186e23d
5b7cbe3c5e0bd635fe47f8b95a631ae02a23b808
38180 F20101111_AAASQF liao_h_Page_068.jpg
776aee7b1f1d97131b8d446b00457e18
281f1933e224a20ff0bff9d21f67eac2cc95e2fc
30833 F20101111_AAASPS liao_h_Page_047.jpg
dbb1ecaa5e091200eb2d70c548a73253
bc81d7b47a2bb924f65978791fe59a96151030bd
59250 F20101111_AAASQG liao_h_Page_070.jpg
7eaf55134c4ce96b420df2e1114dd2b2
a111a90bc9f51311a1dbcf9c387f1548cd04c153
54569 F20101111_AAASPT liao_h_Page_048.jpg
944b1b5bebc4d2e607533b7a240e933b
f42d07f5a63aa4bfff84d4206875737405dc1588
64422 F20101111_AAASQH liao_h_Page_071.jpg
c87178eb8e76e10218f7d055da1a2a7c
541de3c495e2054512afa8b3837f7f57456875e2
77747 F20101111_AAASPU liao_h_Page_050.jpg
b7082c28730f93352a0259d739852a50
ab026df7ae99a958556f88d6b3a6c20a63cf1a70
77756 F20101111_AAASQI liao_h_Page_073.jpg
995a6349bf6388b6f3097dab51058fea
294348de50e92513e6fb82cafe509dd336b9964a
84452 F20101111_AAASPV liao_h_Page_051.jpg
f5c80309059533fecd4098ed83cc3867
a30ccaf0e46ac119e176024d673d2a05cca4724c
90865 F20101111_AAASQJ liao_h_Page_074.jpg
9007aed5512b2d7ced57113a1fadd96d
95ee21421f30c7d20906eceacaa4a1edc6602907
68701 F20101111_AAASPW liao_h_Page_052.jpg
8050210a3f7082967535bf581a01ad95
9e78c1673d17f4a23513a81db1755fbb65518efb
91964 F20101111_AAASQK liao_h_Page_075.jpg
d4e3769221189ce2a1d378f01fcd6862
54da7ba6bd8848955446ff410456140b30d1f89b
86035 F20101111_AAASPX liao_h_Page_055.jpg
e268fa532d5c9f7327b706af4912259d
c3c6c06290cfd4da370fc77b016148dee3bcd550
90538 F20101111_AAASRA liao_h_Page_100.jpg
cf6601baed863170a9b10b534e916619
5ea3c6425b4d82f0712e320d1efca9e76611fe3d
92553 F20101111_AAASQL liao_h_Page_077.jpg
4cc82e95fe0e02babb6fe0698829ddb5
c6cd699b8b90c9bec782403f1cb326046247e616
85439 F20101111_AAASPY liao_h_Page_058.jpg
cbe4e74c8b667519edabaf91a28c5895
215123cd9e4c5c2a36009719288b9bb761f669fe
95354 F20101111_AAASRB liao_h_Page_102.jpg
cdda70ab699c42d80f2607b74b1c689b
fce896f6082d6c9e71d64d3ff140078f498a96e2
93105 F20101111_AAASQM liao_h_Page_079.jpg
b1781722aa48055b3986489a2148d362
4d5cec62781944b4c8078381d05d91e8158781eb
92828 F20101111_AAASPZ liao_h_Page_059.jpg
070e5fa72d3eba90f83ac0b21a6dab98
bd5f71213e4b5fa4447dc4a28a4179c0c5e8b722
89569 F20101111_AAASRC liao_h_Page_103.jpg
7f76bdd6eb01f6b04c44e7543b9f1597
6cfcbd039189886d636a85646ba026ce007bd1fb
92910 F20101111_AAASQN liao_h_Page_080.jpg
478dfa855b0dc53cf796c84fb73d1c3e
9acb492d3adf2868308dd2e54062fecf2c8a2d90
95038 F20101111_AAASQO liao_h_Page_083.jpg
1f1a1875293e2984a8d25339059c8d73
5482e40dd1c6e68ae7c6ecd0cbc27809c9a757ee
77656 F20101111_AAASRD liao_h_Page_104.jpg
7a75cfb41aefa13715ec3b89874aa18d
f16c3ee2f63f7b030a5efe57bdd84b27ae4b1d8e
87725 F20101111_AAASQP liao_h_Page_084.jpg
41c277873c8eaeb1882bf47461fde0d1
af3a6702ab4747dd77727432faf4e3b713217415
92638 F20101111_AAASRE liao_h_Page_105.jpg
83de1ee8045c6a29abae43d56f88f98c
8bcaf6c04cbd6e7e33ccd261cc0c320d14263ae7
88743 F20101111_AAASQQ liao_h_Page_085.jpg
dc23ff2290098be62b0dc1e82ddaa6d2
f9c4c3ddd1dcaee14569ee92bfd0a1ee8bfd1426
98749 F20101111_AAASRF liao_h_Page_107.jpg
6264a72b93cef7aa921421f02918b0b0
7fec55acf9ab686e0331ed744e1a32717feb5393
91396 F20101111_AAASQR liao_h_Page_087.jpg
fd5e812e3e401f4d96804c5a150687c9
33d9f7f32238b794aeed9bbeea856bc8b1599582
93978 F20101111_AAASRG liao_h_Page_108.jpg
51868f320107ceaa721134c9cba8b03f
b0002c80f70b42aabc25ec62a916464ffcedba5e
92519 F20101111_AAASQS liao_h_Page_088.jpg
81a3bcccf859c69ed69003e2389552c3
85b57091dd1d0c255dd452d3a8826896512490c8
94248 F20101111_AAASRH liao_h_Page_109.jpg
a723572c9ba7789af9910c1ac12d5403
b3a58a782f237c98fab40d959c40e1a2b3d58cef
59405 F20101111_AAASQT liao_h_Page_089.jpg
5cdde10e831742fdb7b405d12dd765ff
3a3695da6fd16200e8585aa7db0bd486f3d7038e
95242 F20101111_AAASRI liao_h_Page_111.jpg
9c033086c02fb92c6e8dd3ab9373eb4a
4e0e1a9a8777a615307c0256e92508934e7f5068
51079 F20101111_AAASQU liao_h_Page_090.jpg
5295fd5ef969d97b1915eee71494e73d
f0dcc2bd99e4a8f79aff3e697f1458474247d2db
91223 F20101111_AAASRJ liao_h_Page_112.jpg
624c540acc9989e72a359dfe22b0b89a
4edcb5c63621b2879bace6cc1f1e618df72978e3
105029 F20101111_AAASQV liao_h_Page_091.jpg
d5b5a8ac0e31a48a254ff1f33830384a
4a55a453f675844a24b1a2efc766556e02ebf6ab
93672 F20101111_AAASRK liao_h_Page_113.jpg
89ea15b82a81123db5504c7e12ace4d1
29955f8d06c05e505066aa1d0359e49647dd7e32
78393 F20101111_AAASQW liao_h_Page_094.jpg
0c3248d3dbbeb6508b1f309a4cf86b13
8b14c1f51cd2ad849068dedb779339acc9cde908
90226 F20101111_AAASSA liao_h_Page_136.jpg
e081c99f32d2e7248ae9859331ff1f90
37e9776e511e7beaa296a7762a0c6144d24674d6
87666 F20101111_AAASRL liao_h_Page_115.jpg
251b133fb2ede49729631b1415932a98
1b24a159a7fa58301bd40152c92e34b55006191a
84472 F20101111_AAASQX liao_h_Page_097.jpg
342ffb5efb2a105dd97c2138877a01ca
fdd0629c63e2be0c507af3472b84963e9edf4233
90141 F20101111_AAASSB liao_h_Page_137.jpg
a756e07b90635864dbae6f27bb16f4ef
11deaf90305a8fc5cc08ff6e14841a76a4eb8842
7861 F20101111_AAASRM liao_h_Page_116.jpg
5e0edb6946003ba66cccc8079604d9d9
a1b2538cc538492253af4f751174698f000be9b6
66765 F20101111_AAASQY liao_h_Page_098.jpg
bc0ac89aafbddd0a3587cb6d52b1d7cb
3fa2991b3eecef5b125aeee90170acb48e24ef72
89029 F20101111_AAASSC liao_h_Page_138.jpg
755d7eb609d698d7150e82299bfbf1ce
af6c6a1e8c9c2ed40b3b41780f7b2a9c06a5237b
63367 F20101111_AAASRN liao_h_Page_117.jpg
b83ae01a3ad7624be33b3f8eb6d03de1
3bc74ca7820c21a4a2c496a402efc3439dbb00f5
84636 F20101111_AAASQZ liao_h_Page_099.jpg
e7157a17d6c8d55c9e90cd5f86065778
6e79965990381a4b1b431e29848451bb0cf7697e
93297 F20101111_AAASSD liao_h_Page_140.jpg
4bfdc2e2695925c0aa39a30d7c722b8c
8cf875b9c3f704b107283bf13a91b3491d3a576c
31389 F20101111_AAASRO liao_h_Page_118.jpg
2eb164643e683b527b1510f6fee262df
05dc9b88d3d27766999570c85a3cbd15cb66bd5e
31250 F20101111_AAASRP liao_h_Page_119.jpg
c9dd92dcb4539b0e1f9fee98a5cb7d12
aabdab2ac19ff105e9b448d836ba46be7ea7d7a3
89873 F20101111_AAASSE liao_h_Page_141.jpg
d0a8361c9b59e1b06351340b040914fa
0daa6915b2374b222388a5fb5f3fd32379edb572
84320 F20101111_AAASRQ liao_h_Page_123.jpg
b2b9f9c5b4181aa495e9987dc43e83a6
53d895a3e82ad3c2dae59653c0694a22ed8387ad
31350 F20101111_AAASSF liao_h_Page_142.jpg
e5b1a6ef0e40990ff985fb18a2721127
1398e7df7ea1018a6ae94328d54d39b3b2a0753a
54299 F20101111_AAASRR liao_h_Page_124.jpg
505c56a2f51322031aed9a5dd9981292
0c5fa07edbb1a7256087c04f2f13acb3080ec8a0
70809 F20101111_AAASSG liao_h_Page_143.jpg
320eb5449c9543c14bae14c5f9c8464a
d0da7dd4880ec640520a92decd14ea64b8d63861
58211 F20101111_AAASRS liao_h_Page_126.jpg
27f8586f8a7b727e3954e3d95c89609d
24e8da810e79d18d92724f6a944e6c6ddde4f0d0
96465 F20101111_AAASSH liao_h_Page_144.jpg
591d6f2f73077aa086e736bfaffec106
1b3688a32c473a76948099bedcfbe0317044b8af
91564 F20101111_AAASRT liao_h_Page_128.jpg
31d5fdf882d869b6545b535ecc98eeed
edea8fbb430735c31d9a486dd334e861853fc2a4
116894 F20101111_AAASSI liao_h_Page_147.jpg
63fdbaaf8a8c4d0d7803138c488d7728
c680a6e5ae6fc15136b0065f8127ac39648685a8
95583 F20101111_AAASRU liao_h_Page_129.jpg
d6721431c65f31596c6c86b084d4bbae
51b42171e77ec8802b9b60a8c4718c3df1f2683b
88782 F20101111_AAASRV liao_h_Page_130.jpg
e821928c1985c7b08bf6d8db1c82f9e3
8dd281a78c53dc01169365f328f09ef5b00bc700
50449 F20101111_AAASSJ liao_h_Page_149.jpg
d41ad138ed2c71abda7d98b7995c582e
3fc460bc51a49e634476652c174f33d45589d9fb
92009 F20101111_AAASRW liao_h_Page_132.jpg
6ae633ab081a1fa1556ba97de5f86758
68b1413c27ed9a5e2bfe652d0a54fe534a33045d
42652 F20101111_AAASSK liao_h_Page_150.jpg
1faf81f7ed67043b7942ec7e3ca34d0e
da75242faba445be304b02e5f2958295f47b4df6
93998 F20101111_AAASRX liao_h_Page_133.jpg
288155617bdec0964ffcef74d707022b
6ee771e02611b2c195429b6e5dbece59dbb04513
60807 F20101111_AAASTA liao_h_Page_003.jp2
6f2a7053ffc1d0d83b9d59acf6b99c61
76e2244613149903eab7294cb4e2c579aed74c9b
45427 F20101111_AAASSL liao_h_Page_151.jpg
b03644005555350e439efe7634fa6f68
39606d27920dcfed5584a38fd087acfdfac5e35a
79747 F20101111_AAASRY liao_h_Page_134.jpg
22bda669653e4ca0cf6bb0e256fea3b4
7df71197860887705e1576608959b7acc75450fe
732298 F20101111_AAASTB liao_h_Page_004.jp2
0f9b28980dc035e67ea982daef72bbb7
b4ba0be83f16a65b7755be693994260a81b05c41
77285 F20101111_AAASSM liao_h_Page_152.jpg
9a1d13bea068c6ccb52f75ef726cf9d8
5969cafb7f51ba6cdfce65ca6ab074be71e29b8d
87449 F20101111_AAASRZ liao_h_Page_135.jpg
e37c5d65ee82e132871d3ecd2c458d96
fe89cc0652126821fcf8b6fd1546917825f014ed
F20101111_AAASTC liao_h_Page_005.jp2
06a3acd48c90741f85325d526ffd65aa
3cf5dc745811c6fcde3db58c1e97d42805ebcdc6
40973 F20101111_AAASSN liao_h_Page_153.jpg
1104eafc7137a141b468e566be7e1a90
6a1aabbc059f160ad81360c1bfedff623424e45c
1051979 F20101111_AAASTD liao_h_Page_006.jp2
d736f8689843d3f3dd3218360f0426cf
aa218f24ce79d545af69c7858264fc43546e1072
25446 F20101111_AAASSO liao_h_Page_155.jpg
e88b96e472d9692786bded9197742584
db794bb679121cffcfb16923ad02442aabde75a4
1051981 F20101111_AAASTE liao_h_Page_007.jp2
501f23841f11a4c1444926e80ca59505
75383bd096765966b98bb7e4cf96ea74fd25039c
56206 F20101111_AAASSP liao_h_Page_158.jpg
3881297c3e4b9417d45fe008864ea92b
216147886ba03aced1ec7a38038a5a315b17a11e
91696 F20101111_AAASSQ liao_h_Page_161.jpg
05aa2cbd7d855078152bed056d478a15
04d6680c93c6fe06d9d53daa2f1ef3a50b75fc3c
258581 F20101111_AAASTF liao_h_Page_008.jp2
ff6e36129f0ed49b194a046e78b97bb8
53893e9dee6b5742edd88dffe0871d33cb647fd9
96913 F20101111_AAASSR liao_h_Page_162.jpg
a5014f5236f16a95bccc90ed090dde41
2286626476e02f407ca86bd75a0b66e34d6ae766
F20101111_AAASTG liao_h_Page_009.jp2
9c90ae737d8ea7e7f4bee4d005d39a64
a97ce8a27b084b87c2a8339788dddbe7c75ea081
105681 F20101111_AAASSS liao_h_Page_163.jpg
180de7b5397d588f8452543e7d27d6de
a7b2f213f2928880e330dac4f05376a7ef0e5f00
1051969 F20101111_AAASTH liao_h_Page_010.jp2
9d6cfd151f0ff03b5a29e046f95e7ac1
70470a9671f1152763a253b68be41472a37768a2
106120 F20101111_AAASST liao_h_Page_167.jpg
aedc81954afb771a4e65fb628416e5ae
38ee566c188a35d4e633023aba9bd47459734b84
1036940 F20101111_AAASTI liao_h_Page_013.jp2
b59f216ffa074414e24d291b07a6cdb7
2ff24641bcd89781198d72bedc1a61137160634b
107387 F20101111_AAASSU liao_h_Page_168.jpg
0c7d03182a3517db0d2641129ad7e926
938f2e284398c71f45965d1c7c20f39add002448
1043398 F20101111_AAASTJ liao_h_Page_014.jp2
46a48019b925ad177ff7af6c5654977f
20d508a83b9a1f74f365eb24f76864289814d996
103732 F20101111_AAASSV liao_h_Page_169.jpg
5084fe8e87389086982b49dbd900d24b
25d8fb5141f7cad0c2cabeb34915d960a8eb1c30
1051970 F20101111_AAASTK liao_h_Page_016.jp2
191b1378ff85c24171ba5f6a0e7ee724
9522ab3c7bcf47f6df48950e0a1d65425c699ebc
115118 F20101111_AAASSW liao_h_Page_170.jpg
5ecec85cf868a6b858f32f3b9b226620
f4ba2de2f093f8ee4f7c3c38fe8eacf9f9b45de5
958331 F20101111_AAASUA liao_h_Page_046.jp2
b4a2759dba67924808f569445f4bfd32
d68901ca2afea5ce856f294a13c7d295b693610c
1051971 F20101111_AAASTL liao_h_Page_017.jp2
b8c4ee6b67e84619f508a799bae1cf89
2df006d8b5cb85ff6153f00d9bf8e2cfa540e08a
109432 F20101111_AAASSX liao_h_Page_171.jpg
8cfdd1529d9c3290001d1ec601910ecf
3426b4abd32dd2552dd61d80822e67c16c5fa275
393441 F20101111_AAASUB liao_h_Page_047.jp2
feef47420fc757842f1f543f6ddeb37e
a2e00c13c3751e06c56f7cc2a21148c945dca734
1051934 F20101111_AAASTM liao_h_Page_018.jp2
b01f4efd9d4239a6ac31191df385ca11
c8cefeb0692fb091ba1cd21c53ce2a88628de48d
62531 F20101111_AAASSY liao_h_Page_174.jpg
f3974c38cb34db032f35fe03a8302a10
2d7076af278a6554d010f5b28f6ac8c633403a20
783558 F20101111_AAASUC liao_h_Page_048.jp2
51f264ec93da2e6eebf8c98fcf96391d
8f6d46c26d74696372691f7c48d5e41084e53796
1051966 F20101111_AAASTN liao_h_Page_019.jp2
67385c050cabd7f6ff2e8ac8e25fbba3
7402726e9ce96dbad6782c83dca19b22e935ec7d
29566 F20101111_AAASSZ liao_h_Page_175.jpg
18c539e1cc9c9f20e44b636c453cb118
778ec659360e99946c2ff0fbc7df064cadb7afef
811870 F20101111_AAASUD liao_h_Page_049.jp2
3af2a6ca167e1618942809d1fa3a73c2
a9226e72c4ddd4b6b84db8dbe351122d0399f65d
1051976 F20101111_AAASTO liao_h_Page_022.jp2
b337607af04e211f49766777b9e6b139
ee2ec5c2aa23026b3c23db11658c0b5f216eeabf
F20101111_AAASUE liao_h_Page_050.jp2
9154f9c846bbd464f57005c855844271
8fa85fddeb9576ec8ee0f405e5d2a38ec5008220
F20101111_AAASTP liao_h_Page_025.jp2
ae61a66e7ed84377638d82a06945f5b6
c40162755c29cdd16b14040ea9694d12910658f4
1051959 F20101111_AAASUF liao_h_Page_051.jp2
44f9636e41c62e6ad5989812c9d2a07d
85f135249209f6a758bc74065d1e5a3d6316d95d
F20101111_AAASTQ liao_h_Page_027.jp2
0dcbea68e06621e859234a400aceee2d
8f66f979180d5e3d1798575b3d60110eb8f88df4
1051980 F20101111_AAASTR liao_h_Page_032.jp2
6e9537fee72d9e7e909b0aaa5e234ec3
65c6cdc61316d44204721ba1a4321d0002f08551
F20101111_AAATAA liao_h_Page_140.tif
2365c7e0dc2a6ea8e23fe942e09421ea
cd4b7efa4e0dd9691c984afe80620ed3cf764467
965471 F20101111_AAASUG liao_h_Page_052.jp2
16dd7f18ef1530425beea30557a2e99a
5836501d3950588273ffa13d6330a016852cc9e7
1051949 F20101111_AAASTS liao_h_Page_033.jp2
92ff6d10a2dee1277458bdce7cd20186
c46fbb076837b3cbcfc862d96bd9175d11e4d8a9
F20101111_AAATAB liao_h_Page_141.tif
e6abdca884232547d54b74af199ef316
06c36312ae812519019f4676441d5960a09af371
1051938 F20101111_AAASUH liao_h_Page_053.jp2
caaebaf755f0fc568977b3a4c1355c87
0790f47d8ab8c32d2fb6019efe0215b3fc930281
F20101111_AAASTT liao_h_Page_034.jp2
453ac2f12fb5292961f97b1dae14de3d
0215022e6e829afd2f0536988fcb1e9b5f611085
F20101111_AAATAC liao_h_Page_143.tif
b980d35e58dbac27cb09eed9dc094d02
5374258fa9822fb3414e4799c552584da7a2cd25
1051889 F20101111_AAASUI liao_h_Page_054.jp2
0f8e3d457f212cc51b8d5241d6fe0e9e
502da74102f03dcef649a5eee70e17f38709b671
1051961 F20101111_AAASTU liao_h_Page_035.jp2
36a2ddce29188456dfe2bb4938b175b3
26bb1bacf185ae738dc70e68d57e472d9fbf11e3
F20101111_AAATAD liao_h_Page_144.tif
1d2d7347bb79fa2a4ecb9d5b69f6db1d
6cae2c2cd237ad2696405c64db50c8d44557c384
F20101111_AAASUJ liao_h_Page_055.jp2
782151ca1e3ff59e2a0f17eb960bfaef
e650c85d6b5159d52e2c1236851ff89b1a400bc0
F20101111_AAASTV liao_h_Page_036.jp2
3d17bf1df994bacce7cb6d948252cb98
f9f9b423e2e89edff81b2e979c362e02f59ec831
F20101111_AAATAE liao_h_Page_145.tif
fdbd4cde9ba5e5cd2bf2af25e95b90fe
da35765ecf31e00bd0e0c527251e44f36d15ad1e
805962 F20101111_AAASUK liao_h_Page_057.jp2
82b3c20a7744d672cb0696e50bc719be
438a3d94624c2097147348e1f04d07b528881bf1
F20101111_AAASTW liao_h_Page_040.jp2
7051f2b4a4118c5d495c5aa756c90f5d
41e091e3394a3c372af6e762a0ecb23803c4e912
F20101111_AAATAF liao_h_Page_147.tif
78fca0b19f6e3753703ad3436a9dc34a
ae6452d82e6225e07540cbf67c9c63e829aa33a2
1051907 F20101111_AAASUL liao_h_Page_058.jp2
00f5812729fd290e1ff353d5716a5ab5
f38fa5fb9d8a5d4d5b2ed37dfbd85255222d9767
1051986 F20101111_AAASTX liao_h_Page_041.jp2
3d544340d0edf19a21e24617a4136623
90951c8639c106b3b1e235fe6daff376b8137a7b
F20101111_AAATAG liao_h_Page_149.tif
b017613e068fffa93b890d8324c18b09
fe1e15657bf0dca413f4499c296b06a123075707
1051918 F20101111_AAASVA liao_h_Page_093.jp2
7d6a975a0fe5d40c1f842aa0046595e1
9adbcbfdeb326d97953449ea7f9717d34af03f8c
1051955 F20101111_AAASUM liao_h_Page_060.jp2
d7322392be9bc8d94ec1fa38baf4736b
9ab38aed911fba35a977173d20e94b88086c4130
1051945 F20101111_AAASTY liao_h_Page_043.jp2
42ce71f00484a875537154bdd3792860
deb1f6ab51a88f020161663e47fe58a3b988f5ae
F20101111_AAATAH liao_h_Page_151.tif
4f6c9d1a0611d47b8b306056d4f54335
0a5e96dedb1c8242bcad53d20a8958493a490102
1051983 F20101111_AAASVB liao_h_Page_094.jp2
6f2d966135e2ee5aada16e3fd20bc46f
5f399c3ff34823d2c6a32091eca6024e75f7caca
F20101111_AAATAI liao_h_Page_152.tif
bd7ab895f3f52e8b7634c7150751d5dd
188b6c0c04aeba7077780a9c9f5d94d1ac4684b7
1051908 F20101111_AAASUN liao_h_Page_061.jp2
db9f6dfede3c1acb0f493c3ee6f6b967
fe2e5812f28ef6a0a679db2a2811e2ce361ea2bf
F20101111_AAASTZ liao_h_Page_044.jp2
dc0291a54160f1aac8c3bfd83204103a
a13d56bcfab0e9789747462b5432b2f14f76fc1a
F20101111_AAASVC liao_h_Page_095.jp2
4170fc385a09220540b1e58991ee7d2a
76b4c51ec222c6882cda835b4dc2ceca5af7bbaa
F20101111_AAATAJ liao_h_Page_153.tif
681417a50d48f2d577389bad67440e1a
af795a27e633dce79ef87bf246912923dd09ef49
1051947 F20101111_AAASUO liao_h_Page_062.jp2
9333890f8e7c1ca68eeef3fef8425c65
45647e13a78278f3e94a55d6411249b09d656014
1051946 F20101111_AAASVD liao_h_Page_096.jp2
1fe979bc04413c303943c6099a7908b9
0695ecaae2b8efa196877afcc7e13b6c7cec6044
F20101111_AAATAK liao_h_Page_155.tif
d486bbe182ee5e465c20a87f50d9f295
2e8b979bfe3039af6c623fa7576655e6c66d19cb
969534 F20101111_AAASUP liao_h_Page_065.jp2
1ba239bb7ef98cf31bfe221bb407797a
9ec32a18786640ebe4c1cd1d3fcddcc37ae5f302
1051974 F20101111_AAASVE liao_h_Page_097.jp2
30148b2d0383503cb88d2e33593c81ed
f2ace9ac0c07c33b88b54d9c6807774a255a17ef
F20101111_AAATAL liao_h_Page_157.tif
5c90aeaed393f483438e9a817b841ff0
7d82676e70a7c75ad071d93e7b51c28c43c2665a
476546 F20101111_AAASUQ liao_h_Page_066.jp2
a4e37e3998b422cb26d41202c55fc6c8
57757c7eba0c31eff2c718fe352da0f3034865da
F20101111_AAASVF liao_h_Page_098.jp2
4eca8fef9bde113e6099ac7de711274b
6288735c65dbee7d091cdb178dbdb1efd87d9a0d
F20101111_AAATBA liao_h_Page_175.tif
7ef777edd2a495dc6aaf96074ee1666f
8e0399660006e77b266555960499dda3e9989cd2
F20101111_AAATAM liao_h_Page_158.tif
607ead9e195cb11d3652de001f423a53
22d73fcb9dc86d75aa2eadb225d14a0ba87c704b
858198 F20101111_AAASUR liao_h_Page_070.jp2
3e9375b49a22e9c8a075d46b50742df5
9770fe3f42fcb71a4f78a590f1a4ff6a44827c5d
1051936 F20101111_AAASVG liao_h_Page_101.jp2
f2e70848f0fb740be2fdd4ac0dfbaaa7
6d810c93d64a34dc4dbfccca92c674cc7cf0a178
807 F20101111_AAATBB liao_h_Page_002.pro
2b6db7fe8d266944757ff48b9bb52b6b
6742840d30c84399b1b486cb2184500361f52d1c
F20101111_AAATAN liao_h_Page_159.tif
d29bd6a02a940a473e6a72e802c3f2c2
818be68d6d83f113010720c837b71c169bc049dd
1051941 F20101111_AAASUS liao_h_Page_074.jp2
b9e183bad5129ab7bdbe2a11cf6cdc77
8e5cfd9223c1f0adde3340cb771ced663efdef7e
2235 F20101111_AAATBC liao_h_Page_003.pro
7f76b60dbdc4115fd0bf99ff1e5b5917
0184983dc4e09c18f6b8269b4a0454c5d715feea
8423998 F20101111_AAATAO liao_h_Page_161.tif
572b3d17140a0f159a5d6a393ccf9093
6588b4c9d345325d6d509d45b106846145c653df
1051939 F20101111_AAASUT liao_h_Page_077.jp2
942067f6c9f0d4251bedb508a45a9312
3d2da59556286143316bb264bd68dc0dab6e53b2
1051964 F20101111_AAASVH liao_h_Page_105.jp2
b497cf9e578c4271df6dbc527d5e2ce8
c5d613a6ed2c5844a189ef36c6aa3fdbc2385bd4
31804 F20101111_AAATBD liao_h_Page_004.pro
fd5ef752f0f030bb296c8746b280bc78
02572aeb7b188d5fd33bf9ffb3d566994a2cd7bb
F20101111_AAATAP liao_h_Page_163.tif
7c36b0079f9d67ed452db8e41468364d
41bd7e18ced191adfc15da92319d28b31460f0a0
1051954 F20101111_AAASUU liao_h_Page_078.jp2
640c13172ebab085b9bb9638efff3bdc
c97afda875b042fc3cdfc162290bbe3ff12bf5ec
1051924 F20101111_AAASVI liao_h_Page_106.jp2
aaebaee4bec2f68f4d0b58e398570602
0c9d7c65ece7b70ce06a7ffafc274f8ec3d32e7a
97373 F20101111_AAATBE liao_h_Page_005.pro
e4bd608082bc8b37ab33bf1308447f15
de3a00c7a62cde50ae08021f1e4dfa88bf1459ca
F20101111_AAATAQ liao_h_Page_164.tif
02bcea313ecea523f6da42691a19c313
0161dca7fcde61fce3aefa91545b4d23784b8cde
F20101111_AAASUV liao_h_Page_081.jp2
ce67aac54f5e140583a10606ce05fd6d
4be514f0ba299556dcde9e7639c880141d45712f
F20101111_AAASVJ liao_h_Page_109.jp2
0e432137f82606d14b162d220c7f68bd
4d6d81d5b47026adf5ea2d5d8ee55bf576d7ce29
109135 F20101111_AAATBF liao_h_Page_006.pro
973968a72305ede95e70592414192d26
93eabe44e8f08c5a5e8b9201b669504a070fdf2b
1051931 F20101111_AAASUW liao_h_Page_082.jp2
fbd6f0b04f527aee863dba4617d4a231
d5c3651718e51c297005c8688b9e6973f8513854
1051967 F20101111_AAASVK liao_h_Page_110.jp2
edb6359c6bb15970631b7872ac7171fd
1fa295e8fe33e0b71089af6cff5984d9836d7c17
10249 F20101111_AAATBG liao_h_Page_008.pro
adc110e0d72e908a7b2f82b030f581f1
8cc4e9de9cc1a53b4cc970a56eaf212c9907b73f
F20101111_AAATAR liao_h_Page_165.tif
25ea4f40cd40fc4dab7816440b722dd6
cd9b0ab90e1f115ce2e170ee2d20c2eeb15a73d8
F20101111_AAASUX liao_h_Page_086.jp2
63bb85cb6e360783a7a89f677ea1a13c
2dc4e91841b2481086e44a33aadd5f82562ec348
1051973 F20101111_AAASWA liao_h_Page_135.jp2
05090574b9a4a1cfd0725ec1c2a29113
d91261e9b22f6fb995527bf445b06986ebe9268d
F20101111_AAASVL liao_h_Page_113.jp2
f4f22658805610fe2aba136b0901fe96
580bb7c7bbac9de1faabf8016a3543fa847280dd
76541 F20101111_AAATBH liao_h_Page_010.pro
aad0307e18649775676500af69880fb8
b757db8b62ffed46d186712ac22f85d0ae5dabcf
F20101111_AAATAS liao_h_Page_166.tif
ce302a2f0bc2e3ed66115bdd7d0c917f
71483e49c6c58c9df2b0f0a2b18c637bd9efc61f
672917 F20101111_AAASUY liao_h_Page_090.jp2
735fa07e6e43859f988c71bc74faee80
9af5fc28ffce882045a2b6969d1227076c013b04
F20101111_AAASWB liao_h_Page_136.jp2
a19f686d4da196539feec7ddddde478c
c9f667635550e1f5c13146024b953e2207fa2be3
F20101111_AAASVM liao_h_Page_114.jp2
0b177359b609c872083716573dd61462
9782a6018df4d9a90d694671be01e1ab66afce96
80350 F20101111_AAATBI liao_h_Page_011.pro
a5fb0a85ba1f9c1fb69100c0004f6d7f
4628bec9b63482490964ad704a788d1ec6bfaac9
F20101111_AAATAT liao_h_Page_167.tif
ffffe2549d5da09d4d2109e0c93239f9
4139850085013ebb14d6a7c22f666f91c93a94aa
626726 F20101111_AAASUZ liao_h_Page_092.jp2
aae9e2e264ceb280b886a4e491c808c3
eca2d197f0ca0d83cc6dc5955b81e86b646f3627
1051982 F20101111_AAASWC liao_h_Page_137.jp2
13c2877f0595d7b3ebb7ce52e0937f6e
4b1b07247dfe9d53ea62dd3214b654e73a076c95
1051968 F20101111_AAASVN liao_h_Page_115.jp2
e8e4f0d47e3ae7124ff131c42318a99f
6508727fc79e0e8ae196860fa90e079b9baf4ffe
73027 F20101111_AAATBJ liao_h_Page_012.pro
ed5e033e16077d57d0660f92754c9eee
97fa04b83690ff977d6fa0ab1c1c4171d11cb0dd
F20101111_AAATAU liao_h_Page_168.tif
dc9da6e31fdf56e7f408ea5f8a313e86
d0b9fcb10793533aeb00b4075313b35e0ef74359
396528 F20101111_AAASWD liao_h_Page_142.jp2
9558c54b6bd51170c3f45459c4a61f42
7d532cabf7ff52a4ce0c4093ec715163edb9106f
79552 F20101111_AAASVO liao_h_Page_116.jp2
5d5c875ffdebc4db333d5a3b899e4522
1be6453cb032b5d049e1740b7d5bfa2934867cb9
44563 F20101111_AAATBK liao_h_Page_013.pro
6819d334c9d8ef99ac6ea15b67395d6c
a7225243967e012f3f2845a6fd1b91868f64a633
F20101111_AAATAV liao_h_Page_169.tif
763cad195f5a090ef3ed23a53ee27762
32a5f8645ab2879e5526deee8e827838e1b4d03c
F20101111_AAASWE liao_h_Page_144.jp2
bb2e5bf9029eea21e4337b68f25ee3a0
7aa14df8b63a53116990a31678e99c3ac9deaf88
844579 F20101111_AAASVP liao_h_Page_117.jp2
640537cbe48ca56c4317a4b101cf181b
129c37fda1c07cc6cd63d5b15e5131f004f2606c
45384 F20101111_AAATBL liao_h_Page_014.pro
84efb8a9b6f750b37af80a622f22e82e
daab5a84c6edf00be405e1f2ed8f73766d937dee
F20101111_AAATAW liao_h_Page_170.tif
24ac067c4c667c72889dfca137924b01
4fec06f85424148c6b2b25ee144af9b1236c4717
586887 F20101111_AAASWF liao_h_Page_145.jp2
efba42b85de5e0216978809a7c576f43
0967cd9070eed677fce82238b491b0ec0f432fe6
36529 F20101111_AAASVQ liao_h_Page_119.jp2
3d0d84832ee5c9e47cd8abefc5663f34
4cc1360f197f1b041905b769be2aff7d1c61c7bb
53187 F20101111_AAATCA liao_h_Page_040.pro
520b6b3ce1d86864ba8285dca2acb50a
78c78d3d5fe9d2cdff8a21c7d5904250e69183f1
52073 F20101111_AAATBM liao_h_Page_016.pro
17b71d6425271e25f49166d52fffda00
6b15a6b0b9bae718e4961f917faa548bc266fed2
F20101111_AAATAX liao_h_Page_171.tif
f1c5ed20bc01034927455d7af47d8cc3
8f5f8563a78d8b16ac36f3f2ee8fe990a4c56ea4
1009058 F20101111_AAASWG liao_h_Page_148.jp2
f76e2b4198deb7b4d2db414b1711e975
22296a580130dae5b3e7db344b8850dee5389373
F20101111_AAASVR liao_h_Page_121.jp2
77a2342e40a8cde846a6df8d053f8d1e
f1af6064ecadb182f00cb6fff29e61ffcbe236f1
53621 F20101111_AAATCB liao_h_Page_042.pro
a40c9341e1c8a7e45d5296a737f4a919
56c0fc7f1dd04c4c849fe02c7864bebc076b2f3d
54663 F20101111_AAATBN liao_h_Page_018.pro
781ea8cf17f438f1259c0800186d4066
6c6d2492707b38113e35db46631a48001a6897db
F20101111_AAATAY liao_h_Page_173.tif
1914f5aee8043a845d52a9accbd0fd78
46905ec5fe3ce8d090e84ad1a8e516654b3e435c
696989 F20101111_AAASWH liao_h_Page_149.jp2
7846bf9c21812e13a493d38162163354
904bde5ca4dd20f8dfcd394bf2bac10345675c59
F20101111_AAASVS liao_h_Page_122.jp2
f28c6b4baf1253e043671fb1edd9900c
7766db385a1b36660bf03ddc4df87312c8ce44bb
56606 F20101111_AAATCC liao_h_Page_043.pro
3136f95bcfb5a709e68c21c1d1efa365
e7715323bc8986a1a8a78c21a267ef00ee390fc1
51645 F20101111_AAATBO liao_h_Page_019.pro
4a0f836f015ff58db1ccd9796faf033a
cd73c2c305b2d25e64c7c3e873fe587e5b9ff2a6
F20101111_AAATAZ liao_h_Page_174.tif
0af19353a37c9135b972404c2eb7cc6a
35ef8fe78533122628fb3dc4a3e057390a261c43
1051978 F20101111_AAASVT liao_h_Page_123.jp2
e7b20c75e2eefa1234b7553af3c28cd9
e01cdf2d82b3c1899361e31f5cc8e06c2e6f2c06
56306 F20101111_AAATCD liao_h_Page_044.pro
56a6f37a05f88f60145a5dd0b96b79ff
33c8bfd6356fbfae7baaf6f2fecf4d332d5903b7
54923 F20101111_AAATBP liao_h_Page_020.pro
718ba7a7769906b13d558bb6e481dbb5
3a8b2cb010c09b8610fe7f5f4b8be74e0a293745
645771 F20101111_AAASWI liao_h_Page_151.jp2
2a0bae53b680b1c27c5da451c8d57963
8bc9f0808691c77dab0e2e7eb3a504b919b87453
874729 F20101111_AAASVU liao_h_Page_125.jp2
ddbc87b6774cfa6aca6ddccb45574639
782e77ed4341f63987b2e112bae03b4a4694d0c2
54442 F20101111_AAATCE liao_h_Page_045.pro
14fb1ed8b65c7224f7067ac6353d73da
45793430f5ee73adf95bcc8ec36fd4f7a90fa4ff
54165 F20101111_AAATBQ liao_h_Page_021.pro
f55f1ebe497b4a3a8615002bf276b164
cf04a8c00b13bf406e9c140e48778ca0c17fd352
1013182 F20101111_AAASWJ liao_h_Page_152.jp2
477784b7e896f0cd7e149deb0f70c63e
3de1e3ed68aba56e667cb749e4b0d5b18fd82def
542900 F20101111_AAASVV liao_h_Page_127.jp2
bad01f15580e3b6d588f3b40466f0e56
d677081836594215fa446d7ea5f0f600cb70cc30
27464 F20101111_AAATCF liao_h_Page_048.pro
77c69c764df0179e8edf96f3cc1c4a59
29cea346492c3b6b72a7f792365adcabaaaa12ed
53301 F20101111_AAATBR liao_h_Page_024.pro
3e9aa5b1831f0f4e64a97f132a1c6256
082bdb1f80f220c57dbb0bd45ded41eaf772a3e1
460348 F20101111_AAASWK liao_h_Page_154.jp2
d258f29717e539179e80a3cf17fa9de8
c45c4895aca685c9ecc5c6491e8fbdbfa5aa6dff
F20101111_AAASVW liao_h_Page_129.jp2
00a4835583bfbc5c0ffbcd7acb0793cd
11b108c783d2b5f6cd893be4b320e7d7801c0fee
34722 F20101111_AAATCG liao_h_Page_050.pro
4986bb64e5113f761ceecdd38036064e
3a1ff0345ca17d40ed4725f58c075476c1115c41
F20101111_AAASXA liao_h_Page_007.tif
ee4d402b4b3e3bd9d937abcf87825edd
d8413bcf8303c247359326a34b850f68dd710106
481117 F20101111_AAASWL liao_h_Page_156.jp2
6400b5da018cbec743a7abecf2a3a953
68404e3eef901bafc82f1e0c6065ca8a88b3753c
F20101111_AAASVX liao_h_Page_131.jp2
c7a272c6fef03bd0e94e4fa95c50d284
8ad77f6e271b343d424fd322838fbbf21b7013ea
29257 F20101111_AAATCH liao_h_Page_052.pro
a19887edc30832b9fcd310384dfc4c90
deb1635b90472faeebc923e0c57c9c50ea2954fc
55130 F20101111_AAATBS liao_h_Page_025.pro
3859f4a6310a68f442fcf92b461e7048
1535a35adb4bffcd965fb1f0f433cd535e608e30
F20101111_AAASXB liao_h_Page_009.tif
c3734d722db6a60f3c612ad30f1b4bb4
aea5bb1641a4f3c850d2768f2cb18b5559eb8974
566073 F20101111_AAASWM liao_h_Page_159.jp2
dc6e9896ab745b630f37e30ed006c027
16e68f71c65047751a02916ab7b8ab925c1cc668
F20101111_AAASVY liao_h_Page_133.jp2
54b04f2f9fb6790d49af18ab1df2fd64
2d9fdf33d53bef2c88c205fa80b96c9fb5d73f48
24687 F20101111_AAATCI liao_h_Page_053.pro
c066ba9ce86153520ce5fd2a1767c4e0
2490a18b42ed7ef9cce8409b6828fbcb5f7f2461
6607 F20101111_AAATBT liao_h_Page_026.pro
1722b9b9107ef0cbaa3bf985f7d95c92
611b75909816f3ed7ec49c4a16fd9f172fc29476
F20101111_AAASXC liao_h_Page_010.tif
97033e383666a84e31d0f52b619c8f9c
17f7a2c6686e8a3f35b2954c2cd2fdd769412a17
1051960 F20101111_AAASWN liao_h_Page_160.jp2
d98ab762420301dca1364e46c87be5fa
96f82d41c0f08816b0418c4c834fa51385952762
1051950 F20101111_AAASVZ liao_h_Page_134.jp2
bb55144428cac4157eec5fd4af128e48
76350368ae55adeb56ab53342c9b28ad9e7aa6cc
17250 F20101111_AAATCJ liao_h_Page_054.pro
49502eb128986e2bc5eae0d2e8eb20dc
033bd24ae57e459d953286162d588cd9529bd65b
8962 F20101111_AAATBU liao_h_Page_027.pro
8456dea0b1440a91ac8215807be818ff
86daa1e8900d327d4d653455f39bdc68105f7cd4
F20101111_AAASXD liao_h_Page_012.tif
c344ea1910e2ba14405b2160bc4e7ef6
37ecf8e8cd067ed23177674399d9dd040ab6d99f
F20101111_AAASWO liao_h_Page_161.jp2
1313dd6bd6ce97fe56477b02486c671d
ffc23b542bed10926685c1ad525c63daf3cd5922
40111 F20101111_AAATCK liao_h_Page_055.pro
2fa9021d10796e4dc807e874aad9851f
7b8e46799c097863a65870b81f0f83b9a7220514
8486 F20101111_AAATBV liao_h_Page_029.pro
3d4d9bb36029bea49506601171d42da5
1417c54f0c96a9c15fcfe569bd43657d7950d737
F20101111_AAASXE liao_h_Page_014.tif
35780cf940f8138b1b215018ebf2e973
2714d051eb6a7e279832ceb9dbcb768d5290432a
F20101111_AAASWP liao_h_Page_163.jp2
7076f2613eb4bd838f650ed0c055e98e
9cb256254dba73898128891abd3b1b8d0c10c7d1
27822 F20101111_AAATCL liao_h_Page_056.pro
5bd02874a7c09f51779c287919148940
54a57c2101e4b3eee4b974c1fb5fa64bc4ded1be
20531 F20101111_AAATBW liao_h_Page_030.pro
90b9e41c3e453e6c00f958a03c4f276c
06f9ae5e8909064fabf3a178ae5ded348d327e79
F20101111_AAASXF liao_h_Page_016.tif
1287346224c7305b70096cb468ecc8eb
7d1c20de23365a32febd81ce658fb2678102628c
F20101111_AAASWQ liao_h_Page_164.jp2
8c96a2be19f2abbbc9e8b7a9d0c3367a
5de6ca01cc9506f0f590e79e371be37cd5221d61
52923 F20101111_AAATDA liao_h_Page_085.pro
11de4b10f60b8dc56d070067b56f0db0
6edaf6a605f542047376f141f2d407ebc07bcb5e
48308 F20101111_AAATCM liao_h_Page_058.pro
4a588c2f660fba9238359b781921cd4f
586963c290816d0e9cabad17964c8f3dfda12d18
54109 F20101111_AAATBX liao_h_Page_035.pro
bd12afbb40b6b5755b104d9afe3835dd
1de2e592a94328a04f64ee775b9d12d9a6e8e71c
F20101111_AAASXG liao_h_Page_017.tif
f8181a63a1660a0e3c891ca4fbc9cf95
85d3108f8cac8596e270fbee3833e13f99c56603
F20101111_AAASWR liao_h_Page_165.jp2
1cbe0e00bca4078195b2e4635f0976ab
4a53ce738d47b4b4972dd12afa5fc38135d0a375
55435 F20101111_AAATDB liao_h_Page_086.pro
7bd4c01f5be2121e1df7ef05de738a54
64543213e85d0d76d74484e94da69df1ba284ab0
48383 F20101111_AAATCN liao_h_Page_061.pro
23f9068f0eae1cabefa78811ff4d0e51
b50a7dda0cff1b6d12c6a9fdae7e1d8d84e36136
53878 F20101111_AAATBY liao_h_Page_036.pro
739c5fa021ad8a4f9819e63c937b2040
282aad9b5f2cc1513d9c500e50f5cb6b24577a5f
F20101111_AAASWS liao_h_Page_168.jp2
7f5aab73dd42315dd04b247646836bac
a96903a105d57fc56fd4495a0ee17fcd705500f6
F20101111_AAASXH liao_h_Page_018.tif
cf68d43e640b00299f45ebb623274b90
8a5ba4936f71ba4657a3150ec6d4668bdbd05a1d
53928 F20101111_AAATDC liao_h_Page_087.pro
624d30aea51a8929eea162b9c65a1911
d1f614242ddc723322763029c8be7f3b7ff17e2f
54263 F20101111_AAATCO liao_h_Page_064.pro
4295b65107241fee9fc64988b116bbf7
c1e04170b3a6e00b02a1de5082eb9feefe41d5f7
47396 F20101111_AAATBZ liao_h_Page_039.pro
9630fd135e3a170d6d23fba8a065138f
c754b7392f71adf4b3bc18cb6b0ba49e5cbc80f2
F20101111_AAASWT liao_h_Page_169.jp2
ef16afd6a36571010aee99a99653372d
0ccb5dd9694d5b4249931de3dbc4cbb02f0748b4
23105 F20101111_AAASAA liao_h_Page_073.QC.jpg
fd6d9dd33097cbcabc64d6737057140f
8f78c413b153b924c8797ec9512b6163b4d813a2
F20101111_AAASXI liao_h_Page_020.tif
2d1bfe68b765da49c41fda52dc906a56
befd0ec4b1316c9796d35dd71deb9031205ad2af
54767 F20101111_AAATDD liao_h_Page_088.pro
11708fdab0690444e108038f3c7b0c8c
206d99d8447b9eb92fbb4d333621c770bbef7a94
25886 F20101111_AAATCP liao_h_Page_066.pro
bbeaf49527b0437ef9b62d5d601a8e9f
d8eef16e618aecf6afbd8ac400e6d5003599a1ef
F20101111_AAASWU liao_h_Page_173.jp2
92dc4701d2ed73a9e8d106bb2b6e093f
6f0a12b0a208812f9c68206b5ad02f936457fb48
17479 F20101111_AAASAB liao_h_Page_124.QC.jpg
28bc30bb954c0700f59406f8795a7433
9a257afb3e7b883841aeaa2fb8aa6050615eba83
60602 F20101111_AAATDE liao_h_Page_091.pro
57383df4d2656cb18e7df910d8bd95ce
e0656b1b08b61dd6f8eb183dcbc554d6bdb2c21e
23608 F20101111_AAATCQ liao_h_Page_067.pro
4efbe5a07a91cda94692a5bcc209ebba
fed79e5dcde4ee264a6cea0bcbfa41476bde5d03
F20101111_AAASWV liao_h_Page_001.tif
1092423acfb3e00c79d2c8b2a2d0d164
49a4a7f5766ae5ef2c00b05343e12e32a8987f18
F20101111_AAASAC liao_h_Page_089.tif
9d89caa849057fd86f33be01f36236cc
f6b6132026060860490ec0fa536cf62a067403ce
F20101111_AAASXJ liao_h_Page_021.tif
e622645b4936b3c35f7cb2cd0d80ac4f
f4484235ad8d81c94829145c0f3f890e15e0379d
24567 F20101111_AAATDF liao_h_Page_092.pro
250ff123340634430dce6fe9bdfabe48
a834b376a6b5bfc51b190a82a3c57c01d14d45bc
22148 F20101111_AAATCR liao_h_Page_069.pro
d42e95f626590434e5e5daa5a738bd25
bbee056b7635a7079580d7cf7c64768022eec19a
F20101111_AAASWW liao_h_Page_003.tif
d8d0264e37e581585abc866b428ca982
ff93b1863641266b89b76c1d474c07bf7b9ac436
11456 F20101111_AAASAD liao_h_Page_154.QC.jpg
1d874b9a6204c94dae79a5267406e475
81e111ff9d8b3be86a4d5419b5e475f26e1af928
F20101111_AAASXK liao_h_Page_024.tif
95693ef31eeaf46fd1e3fb0a0686ccdf
964c12ae5c13ddbb74f9f66bdba1c6c33e9ecd80
39121 F20101111_AAATDG liao_h_Page_093.pro
fb1067abfb15457245211eef153094e2
fed8b4d32103feea8f4590c266323769e6a9b987
15176 F20101111_AAATCS liao_h_Page_071.pro
0084971a8beab3a1637055123606cfbd
92d65bcf4d25782bb56415cb0aa74bc498c22bbe
F20101111_AAASWX liao_h_Page_004.tif
ee8c81ce8d063389739361cf36c21815
9740e6267a509047be7c8f1a8cb677a2c899d09d
91728 F20101111_AAASAE liao_h_Page_078.jpg
2e997822124e7d7e602bf3274dbfe3ae
3aeed4a6b2780dfa5967ec9bd21dac8c7bd6d071
F20101111_AAASYA liao_h_Page_052.tif
99db014328eda836808ad30c947b0737
698eb9d317977fed8450abd35526661ed66c7467
F20101111_AAASXL liao_h_Page_027.tif
4df1dd9cd7d47045ec04431f783bba52
7b3b267f91d36fe55b19eecb39199d2a01f2cb15
55586 F20101111_AAATDH liao_h_Page_095.pro
fb10498b7105dd4b436c47c94ef34d9f
580e1d11253371f0b8a95e0ac7aa53a5380e55de
F20101111_AAASWY liao_h_Page_005.tif
bc8b9467ff4839feb69f32c816a50a43
bd52146159fd60107aa7bf70a271a6974173e5d4
4879 F20101111_AAASAF liao_h_Page_026.QC.jpg
943fadae07fb18e18616892324235c1d
0023b2f4ed01c84a91bfc6d5be7e6bad064e6330
F20101111_AAASYB liao_h_Page_053.tif
a3064e82317d3c840adc2ba85a925a81
a7717ef38e025b324e55200765f04922ddc1b163
F20101111_AAASXM liao_h_Page_028.tif
156179b0707d933997c8a4d9406d0e5e
5b19b2b1ed84cef37f75159825b34df88ae611c8
21773 F20101111_AAATDI liao_h_Page_097.pro
e0ced58eaf20b8c5f455cdf9e9926700
780b66b07968bdb2b20072db1aa5dfc5daeaf51b
51743 F20101111_AAATCT liao_h_Page_074.pro
549c59dd5af37c8f7ee4bb659e9de8a5
571efac065f3e7d8f95d0784a6f4a1946f0a4864
F20101111_AAASWZ liao_h_Page_006.tif
505217e35f5799e5be32d8b31c48440b
efc3a4bb7bd0ef569dbe473ad39b6ca9121018e5
F20101111_AAASAG liao_h_Page_099.tif
bfb25d006f4c4f7d2927a9761d3ae39c
78a959061760fcdb9d79d6684ed18f8c3942f9e2
F20101111_AAASYC liao_h_Page_054.tif
da0ecff36877cd747decf90d10eb0d7a
a9590e27ea76bf258f806cd6b8099a349c947288
F20101111_AAASXN liao_h_Page_032.tif
584f49b958d3bf85704ed949ebedad14
de18c2265279e1e4a9827b5352652f2412f3fa26
53763 F20101111_AAATDJ liao_h_Page_100.pro
2c6561487b9624a856c4562b2b3c1cdd
ae0fb5b1ea437ee6ebd4daea1c9836e1f96d2c67
54119 F20101111_AAATCU liao_h_Page_076.pro
b1f199441da1f52743d319bf3ee186c0
974f2ea8b3f1d3c66c1094145e6d837f2c05050e
78398 F20101111_AAASAH liao_h_Page_013.jpg
65a21344f0b54c736fdf285b4c0ee60a
ec4da1d7354e037a7b6c4745e6c532334959531f
F20101111_AAASYD liao_h_Page_058.tif
110d0949ce90d88b010e46bbffb01712
815ccbe6eef3488c03a8fd69ab722ec22200050a
F20101111_AAASXO liao_h_Page_035.tif
d22879511228a40fa79b6e5c8c6d8daf
70a74840e63ab23a4eba776dcde52d874214eb59
51443 F20101111_AAATDK liao_h_Page_101.pro
923741e0aa09f1f8650dc207d368c6ad
bde98d50dedb616485a1cf771f966539dbe10cd3
52891 F20101111_AAATCV liao_h_Page_077.pro
a880975d284d0c23470dc3e1a33b7d3c
e110e30860f02e0ea8503d5eaaa66df70c9ebf1c
6595 F20101111_AAASAI liao_h_Page_105thm.jpg
b148b1e2ce54223b93aaf7fd3034ef35
45f8b2c08ea212d9875e2cbd23942f6eb320aa5a
F20101111_AAASYE liao_h_Page_059.tif
b5e0c6e17efebde0d45c4f30c8c37096
79146fa61c54fad9ff248f8a979324b25c80135d
F20101111_AAASXP liao_h_Page_036.tif
599f6c168d140e01bc6b7aaa4356c1d0
17df01d94359f46902c0cd44673c2597f7d47727
54457 F20101111_AAATDL liao_h_Page_105.pro
b7239e3de77622f292f185f8a50bdacb
18d4ed8a1ed6245b77f2a790e4b76b198a9e5915
51994 F20101111_AAATCW liao_h_Page_079.pro
27435cf40ad8766d17fdfbba023746c8
98c57eb4a9c2a4f31d64d49fd7170b77f3b05efd
89441 F20101111_AAASAJ liao_h_Page_024.jpg
22f1eacba989721036220b9e2b70c6d4
720cba8fa42f682d53eef942542faaf921c4cfa4
F20101111_AAASYF liao_h_Page_061.tif
2664f13de1b13d125addb78b120fb12a
f4ed472c6ec4cfeca1fc568b5be3756e7f88f34b
F20101111_AAASXQ liao_h_Page_037.tif
43e90344c33323d89c0a19e0cad9c535
1848ba2baa0022c6bc74e5d0ef31ae4a5ceb3d0c
20496 F20101111_AAATEA liao_h_Page_127.pro
0c90b2d26d2ad5045d6ede36597c61d5
e7bb251f75be41580a12cadbfff17c9b778900be
55196 F20101111_AAATDM liao_h_Page_106.pro
6481b96ab75e6746e9225b4282dcde3c
081d5a9784b3c265fd7e117203a87e6f7beeb6de
53964 F20101111_AAATCX liao_h_Page_080.pro
6337eedf5f993deff7c266de5d36b9bd
2af0b53e86c7b32f72c0b7bda64e3709aa888a51
F20101111_AAASAK liao_h_Page_172.tif
9c611f937eb07d27e48281cd72afdce0
04b247498ead9193f0a487eaa9e313deaa5979b8
F20101111_AAASYG liao_h_Page_062.tif
ee315bb8d6df708f4108f4c3247ce8a7
29c501700ec140f2ad683755f1cf2d291d8e7d68
F20101111_AAASXR liao_h_Page_039.tif
2fdf3b0737685a1ded483d6a32d0e2a9
ee792c316726416c805f32ebe916083234f515b7
56536 F20101111_AAATEB liao_h_Page_129.pro
a041627192c7cda1d1e9226ff6706958
c8378dc727c6c2385fdf127eb2823c22d98d34d0
57032 F20101111_AAATDN liao_h_Page_107.pro
dd020a2e4fb96f2850b54c9822a8dc3b
8c9453e872d4817aab80d40640afd8e6f473816a
53757 F20101111_AAATCY liao_h_Page_082.pro
09ee5ee0b6081b78bdc001c9ec5ec666
059fc98bd720b1c99ba82def802e2c18854790c8
65180 F20101111_AAASAL liao_h_Page_163.pro
263ced77409962653ff03d974f8033f1
7d8cffb9d42e6918fb807ae0698a884341dd2525
F20101111_AAASYH liao_h_Page_063.tif
0fc63ba76cdecb1f0f8494656e23763d
94e5211a128b611f3cf9026272c980d85aa29d97
F20101111_AAASXS liao_h_Page_041.tif
d3b55161efa75bd3e5fc6b70d59782c0
35299b3615e65c0838baa5a733adc11f0f459158
52444 F20101111_AAATEC liao_h_Page_130.pro
1b17254b8ccc631d00ba8db304cbfaf2
999a29ab27b698c8b61de249645688caab4cdbaf
53856 F20101111_AAATDO liao_h_Page_108.pro
11b698d041806173d841b52a95be4657
e72a9d6ec20de1e7ec601149a4f3cc53d6f4e823
51311 F20101111_AAATCZ liao_h_Page_084.pro
c00021643cd7bd09cf5b2fe342dfafb1
cbdd516b70ef9246f25d088dba49a974525a87c6
5905 F20101111_AAASAM liao_h_Page_098thm.jpg
8c3df06bc8e7e74432dcc4198e3ad004
e788c2c0423e237479a0d42fab573ff60ad83a3f
F20101111_AAASYI liao_h_Page_064.tif
92f56ab435d2ba67c07bcfb2a20d4e71
a93c3f8a3afcbf55b0c2e535030b97e53ee50391
F20101111_AAASXT liao_h_Page_043.tif
cb081a9a298a78f0dcd14a1fd9debe1f
54b0963ca51c40f3e0dcd99e2241fee36227d242
7224 F20101111_AAASBA liao_h_Page_172thm.jpg
c72d113b9a2dfdcd0cdfd66d2567980b
ed0350c3a0fa96f17dd939abef37f1f4210fd38f
48812 F20101111_AAATED liao_h_Page_131.pro
39be189e53154361b4fd87d33626badc
33b902635bea3d233edc6e6b5c86cdcaaa5440df
51137 F20101111_AAATDP liao_h_Page_110.pro
4e910d8818bfff8759ac8df32e6a5c8d
311bc94f5be0532ff21620b7912834e634315118
F20101111_AAASAN liao_h_Page_111.jp2
b866d154e88a701b748d01d3f10a5bcb
455f31dbff10637ede4b18f5d532d7cc1ae776a8
F20101111_AAASYJ liao_h_Page_065.tif
bcda0435bd2fcd178b97dac8ecc9a385
6916b659822c2de549ed60739f9c6d96e816acb9
F20101111_AAASXU liao_h_Page_044.tif
4e5be6c4a777dacc51d75df22c243144
8e77b528789349718ba33883c5b08ff5f788a093
902 F20101111_AAASBB liao_h_Page_124.txt
3f086582034ba6511514bfe72386cbe1
6cd5e9275608a70ecca3d18dce7c6ebd7479c577
53015 F20101111_AAATEE liao_h_Page_133.pro
9939e3792ad3779991a3e7ad7d6223e1
079633b2f3fe37e3d9fefdef8a8ee608068ddf05
54545 F20101111_AAATDQ liao_h_Page_114.pro
caed1abc76f190b0ad50d47521afebdc
3a2535219c50354d330ba1202f6e00e2d67ce51a
F20101111_AAASAO liao_h_Page_068.tif
4c64fa7856d2dac6bd0ff9f91f552866
2d3583504f6417d6984f2522c2ff7469400d258e
F20101111_AAASXV liao_h_Page_046.tif
c8607bee429ecf38c724e59394e986e1
b141824608e81728344fefa3fa6d104f4ea94756
6734 F20101111_AAASBC liao_h_Page_036thm.jpg
1ee604c1322d524f370e0a9c6ec23136
11144773c382607f741f5b61f3c5022eec03970d
53162 F20101111_AAATEF liao_h_Page_135.pro
f82db2f1b5e17d8fd157f13832b96b16
31e25283526ad0e7a5a5da932231465950c94d3d
52683 F20101111_AAATDR liao_h_Page_115.pro
e0e3767752f4b8d12f4c80fefe15b544
44841b9959d2aeba6671b6ef4f8908bef9c42f53
2089 F20101111_AAASAP liao_h_Page_063.txt
55f1df5b906ae044a04d429647540389
37bf5ca7f77546965b780e567bd9cecc7b389eb2
F20101111_AAASYK liao_h_Page_067.tif
783749c3fcdd669741a57e7c6d027898
017a31c08371514cc4d42e04f9f1ff7cbc122204
F20101111_AAASXW liao_h_Page_047.tif
3c2b58ec96a91309fa0a962aa627e009
65257e1eaa230f98930f0a1a450a3a023d8bf3c0
33891 F20101111_AAASBD liao_h_Page_089.pro
a4a0e53163d21c3b221b74a45c3af088
40500c820f27b944d1147714975aae2200535a68
54898 F20101111_AAATEG liao_h_Page_137.pro
52a9e697d4f0f414531572fe3f9a9250
7dac1ac68ee7ef5e4b9f08989f32805b3db9f01f
3264 F20101111_AAATDS liao_h_Page_116.pro
4662cecb35b1bfb211751856dc80020b
f445cf0446e34e988e373d3d797274e3097e8d5f
F20101111_AAASAQ liao_h_Page_091.jp2
b6a4ca7cb74da4c45583e69d6dfb311f
005715c8da9e2924d3d1cf9cf6c9a09ff054705c
F20101111_AAASZA liao_h_Page_096.tif
1cce0561f9eedc63841d015af5341f49
00b9dc0b76acd31eb73801c4299121c318a5207b
F20101111_AAASYL liao_h_Page_072.tif
84fbccd1b859269cd7c0b1509da7f206
4e0b36e5c2e2ec8383514475e15724c7487fc577
F20101111_AAASXX liao_h_Page_048.tif
da81cb9d72b66756fcf44d8918ef71bb
5e064997bb0f37143c19a35afdb738566d934fb4
14681 F20101111_AAASBE liao_h_Page_008.jpg
bb379c7188df10adada3e50b6c27f301
26bdd5ec693c8a62790113d6621ea49c16fc31c2
52589 F20101111_AAATEH liao_h_Page_138.pro
176ea17dc66db7219094c57660fc8092
fc778222fcc9ebdd4258e5cb7eb2e968b6e0123b
38032 F20101111_AAATDT liao_h_Page_117.pro
40e2d1cb8123d0fb0b1a154def8380a4
2803debe34e7f7828690aa1593b0370c9341488e
F20101111_AAASAR liao_h_Page_131.tif
e80add1c01c96c40559cb412ca49069c
63398392048ed7ef51b82918c73231e2844417b2
F20101111_AAASZB liao_h_Page_097.tif
ab1be6cc10d56f2ce697251676e8ea75
a3b1fd1a6a46fa7ff6dc6d2657fb692b106f5cc7
F20101111_AAASYM liao_h_Page_073.tif
cbaec0371c980d62ba48d44e26a484a5
03e518bd5429317a08e699c179a015621ac99b3b
F20101111_AAASXY liao_h_Page_050.tif
eb56c74c732f6f9927aa68146bc58cce
e48d5f580d85bb66ba4b17366f2428a76e7fa125
21912 F20101111_AAASBF liao_h_Page_094.QC.jpg
ac014d9e7a8f9f1d12d66a1ee8316680
1ac5e8c50bed0d5731877dac1980ad4f17bfc4fc
57618 F20101111_AAATEI liao_h_Page_139.pro
9bcdf1a9b1cb889ec265d83aac711ca7
e1e5ed33ec1370e3134ab59f8c6920fece4b64f1
F20101111_AAASZC liao_h_Page_098.tif
a740cf1aee2bb7cc0f145ce99688611f
7e73136cff570a0efd4d481c4d733f148ed9bfda
F20101111_AAASYN liao_h_Page_075.tif
227292727c5a61fe59238b489dfb8deb
23eda88b4b42dcb787e3d3db785a8b07ee639b84
F20101111_AAASXZ liao_h_Page_051.tif
5c9d3afa7e673a19057bfc6bfdbfd507
3cdb1d577d1a24059a068c6296c5bd8e74d3ffea
6735 F20101111_AAASBG liao_h_Page_106thm.jpg
36a1a9a18cfb008f64c6e49275d958bd
9eed051eb4a7e8890e31836871f09aff341bce52
55523 F20101111_AAATEJ liao_h_Page_140.pro
f75bf407f21483d53ca66436b9252a15
cd3ec953695cf98170582a4b4bdf1afc99b95714
20691 F20101111_AAATDU liao_h_Page_118.pro
dd37a1c757965218f338cffe404dafbe
c1c0621a91cf756ec81687b29d1ae4702272ec40
6323 F20101111_AAASAS liao_h_Page_131thm.jpg
f6b05665d9aa31a8dfa33f9729db6ed3
aaf567325667d8d9029cd038aa3ffab89706b1fc
F20101111_AAASZD liao_h_Page_100.tif
2c072f1f3ee7adb9e633c4d3490442da
b0bc20f75363746b99044f0d5fdd4af2fab77c45
F20101111_AAASYO liao_h_Page_077.tif
25ed460081eae79ec3d5a3eca1307b75
2cca158815e23cb0114d466f82d5394000b00a5b
1693 F20101111_AAASBH liao_h_Page_003.QC.jpg
3126c7c32deb6662a4d0812b1bfc2efc
e97b3057aa4d0c13b9482b07e03c3974842c76b9
54934 F20101111_AAATEK liao_h_Page_141.pro
3991340bfd7437805d068d5a2c627a54
c895a248fbfaab1bc0e0b8f96ea9ce1d18c31510
43332 F20101111_AAATDV liao_h_Page_122.pro
ff7aa3995c737b1c85cb0b0aab55567f
539f2084b1854595581856ea723e315242b0ee26
F20101111_AAARWC liao_h_Page_107.tif
19a4e5936f187cfbc2e9a2a803978210
de8c6b88965cab54952988183e6af7d4adb16f36
41922 F20101111_AAASAT liao_h_Page_065.pro
ebc3056fa30a468dc26f9f4b92f3a72c
1a2282478756484ab923bc8dea2a247a6baaafe2
F20101111_AAASZE liao_h_Page_101.tif
660ab9d80b85f75b13990bff0d3eae89
347e9631d8496f1d2a5212d1121729ff7d974c13
F20101111_AAASYP liao_h_Page_078.tif
ce9addcd1c4745347d1588c42a55efe7
780189f6dee67e96012c325403b4897d17bc8523
F20101111_AAASBI liao_h_Page_039.jp2
273582bce631ccc62dc46c4fee538a02
b846b1da683a0940f21f857a83e674c714e92c53
50968 F20101111_AAATEL liao_h_Page_143.pro
342533f7f248bce0341335a27d8267df
3bdce2257e6daca8812849ab05abe7fd82cc38b1
41821 F20101111_AAATDW liao_h_Page_123.pro
33990a907cfc76341033539ddaf3b384
a813e56596118e0814aee56fc01abdd27904e835
25912 F20101111_AAARWD liao_h_Page_051.QC.jpg
febf58f6888a8e3c7edd05c73b55ece9
421253cce2f0438ff4109699e6560ab9df9bab77
F20101111_AAASAU liao_h_Page_083.tif
7a9b3e745da0865c2f67dc7690dc94bf
69efd8bb73968573f50df132d558c28c86442451
F20101111_AAASZF liao_h_Page_106.tif
4f50a0f4d75d59590cb3a3119a865068
e88d7d2e0e1f3ea5ceab0008783c9fe3a4fba8ed
F20101111_AAASYQ liao_h_Page_079.tif
5cde5dd0de4b6a17aaba3925409d7c59
ae1d74cc4e2f4d66265a5dad0fe9a2e378d3424a
53061 F20101111_AAASBJ liao_h_Page_063.pro
8d4330507bf2ba406f13f448a34a9980
e68b3ae9c8198f35c5ba1ccc0b8bbab8b3c912cc
67858 F20101111_AAATFA liao_h_Page_168.pro
0a4496b62b62fe2ed06f1a9d07a958eb
d01553d768cfa7c2dc05a9039a0f94c10c3cbd5f
68790 F20101111_AAATEM liao_h_Page_144.pro
c53bd4f38f610dc694234c4810140377
0b69263aa1b463406de89c78987eef6f34da5dec
18079 F20101111_AAATDX liao_h_Page_124.pro
ea606bee0ffd103ac9495c12d32e052f
3f5a07b58f521f46d9f1409991c64307d8bfe818
F20101111_AAARWE liao_h_Page_140.jp2
2d09472fa47acb61f615fac0a0594bb7
d1711135b70c5ba2faa466df3a78ff1c6320c75b
2031 F20101111_AAASAV liao_h_Page_019.txt
7b2bcd057fecba8c8c0f1b6e8f416da4
1a0786ac5f6a2288b4eaac58044381087b5edf5f
F20101111_AAASZG liao_h_Page_109.tif
c93b98b4453f60bd2f0c3373310f8b75
1c2b6fee110bff6dfc6a94226be8a1729bbde90f
F20101111_AAASYR liao_h_Page_081.tif
ce321db225c6deb46f22b7cf003e4147
d882bc8eec8cdd315d9ceefa90a9837853fc4432
293789 F20101111_AAASBK liao_h_Page_155.jp2
df868d73e8e4c853c7ca51a2233f8684
274c508a75ab3b615308efbe9fa9348a2b1d1a4a
63932 F20101111_AAATFB liao_h_Page_169.pro
cd17919a52b3b29c6858e16ab0f48e2a
42ab45ec6a41756502f3700b8081625181c7a451
72459 F20101111_AAATEN liao_h_Page_147.pro
55c63fd5c810ca3c2a239a6c7460986c
87025ba95f0bebdba6bd49f7d97a75d85f1d6ccb
24660 F20101111_AAATDY liao_h_Page_125.pro
b37e12c413ca2ac94418e75dd1cac458
35e7afc9d7d1f2790c1315ac2a6844617c168e1c
3238 F20101111_AAARWF liao_h_Page_092thm.jpg
9d36677e4571a01bc9f7f8cf11fa701f
eb8452819ea6a3841abdf6c69c84b104b5262136
24306 F20101111_AAASAW liao_h_Page_073.pro
c64cdb3c31b9b3daa02d8b2ea26d14f8
5f66a172f49c6590808c4d08ecfadfe250912183
F20101111_AAASZH liao_h_Page_110.tif
20bed0a271d43f0903cb7e852892d9bc
809d441ace220a3456317b60efe2f56fe00b461b
F20101111_AAASYS liao_h_Page_082.tif
d72985d35f0357f3cd85167f9ab64546
ac4e14f40387fdd76b4d923da71c7e6f80a189e0
43858 F20101111_AAASBL liao_h_Page_134.pro
9191424ca13dd2a1fbae62223318ce40
0e4948f52ce772c02551d21fbb0a24537f5b3670
67898 F20101111_AAATFC liao_h_Page_170.pro
3ae4f6bb44087562e6c9837c91d110d3
e90725a5be4d4ad5006323bdeca913e280cd8568
40893 F20101111_AAATEO liao_h_Page_148.pro
28a6cc105dd1252c9caadeafea250322
f71590c7e75e3a7c3d3df6e9962638fd9c9aaf76
41258 F20101111_AAATDZ liao_h_Page_126.pro
a87ec1e4344ecbc64b05f8886fedcc0e
879fd03e77d8b9175671b94ea1a09cd63362e701
87357 F20101111_AAARWG liao_h_Page_019.jpg
58377636875d6ce011bd6a6c1c4f3bba
5a56876a9298d41c07d9172879dd8b78ebd13baf
F20101111_AAASAX liao_h_Page_037.jp2
85431381a79fe75bdc22f321ed586ca2
4a47324f852f3756577f0332339f94549c16e719
F20101111_AAASZI liao_h_Page_112.tif
b149e4c84998482381f36e6774e5e87f
2e7dd1cc1b2baced78142512e355eea044949f01
F20101111_AAASYT liao_h_Page_086.tif
419b9dc77997f7ed8b9558f6c5378cb3
ae17888bf4552c9977b4042a1d7f4a2e424ba114
55983 F20101111_AAASCA liao_h_Page_146.jpg
60263f31f3354fa880e9355ebbf63251
ec3a74818ea24cf5ba433c5256221ab50b7d38bd
F20101111_AAASBM liao_h_Page_166.jp2
b43659e3eb71e85a276a93876e08058f
d061cd5fa852cf4fc192324114b3fa7b12a3af05
64236 F20101111_AAATFD liao_h_Page_171.pro
8c52b9af12ccdf17bfb6c2067d3c04c6
55721a3db6e89a11f71171f07f5f5db999171dcf
20572 F20101111_AAATEP liao_h_Page_149.pro
50d9ecd705703d3a2aa95228f0563e21
9d11a39e723f9c2bf9a072a43a66f5dc1fcccdd8
36177 F20101111_AAARWH liao_h_Page_159.jpg
43ef5c1b702d7108be22c3f49099a2ea
feafc1ee3f2aee9c75a7dd70d6251265d91f9c61
F20101111_AAASAY liao_h_Page_011.tif
2393f91dacdf29e037cd1a02b29c360c
13085015a9c9e4003482cecca9733dd58864791a
F20101111_AAASZJ liao_h_Page_114.tif
dbc977e1f781f129bf2618ad972f30f5
83eff221297405aad6c8fb32e4a3996bf4dfae98
F20101111_AAASYU liao_h_Page_087.tif
2a731e4a18f007f2bdb769c077276209
ebb670021782eaa5af8be1ee3d66768bacb4a5c7
28256 F20101111_AAASCB liao_h_Page_100.QC.jpg
d7e86e4fe6fe252df3f1068bcce38a82
1fb8d12c2290598aaf3e1e05286d5ed6b92805ee
F20101111_AAASBN liao_h_Page_124.tif
33d26cc6a9354e183bf51228c548b99c
400bac9a5054f561b6dd54a80260d97562d2f9ab
68206 F20101111_AAATFE liao_h_Page_172.pro
8891d531ec162218ad73e41ef2410784
84d61a18e9741d79427d4e51f5b7b0ddf700f012
24990 F20101111_AAATEQ liao_h_Page_150.pro
c72aaca108a45428a5cf18b52d0571cb
694b4a4064aa8be91e92791c1188a7369b4741e1
F20101111_AAARWI liao_h_Page_074.tif
c6c4d12e3547e4cec3c495ed018aa382
e5f6731adc02574b74f5fa9dbca1080c58623fd9
3901 F20101111_AAASAZ liao_h_Page_151thm.jpg
6b6fd9d28b5de3fd7bf6f727559ebbc7
4d6ba87dec18e220c78af711e36a3c70126ecc3a
F20101111_AAASZK liao_h_Page_115.tif
44a2231a06ebe2ba5093b6dccdbf630b
239d69516a1b90f44fcbbd43984817796d198bee
F20101111_AAASYV liao_h_Page_090.tif
8d0ffab3ffc8c9e24ad84ebd395f9b9d
5033004ee9f42a643454563de3e8b5f5c47d7707
54351 F20101111_AAASCC liao_h_Page_034.pro
e17977889bbab4579ad7552607c9b40d
7c928047bdb5a62cb65dc7ce9ce9e00dd066ab55
93769 F20101111_AAASBO liao_h_Page_086.jpg
3e2756b4be4ba361f7abb7f90c8d9e39
9e63d71d774b18d92692613ba6f5bd50bfc2d931
35433 F20101111_AAATFF liao_h_Page_174.pro
ae43edc63a7342829400f179c70eebc2
ecf9cf1a7fdb7b5cb5c70f8d198947ad252cf45b
14850 F20101111_AAATER liao_h_Page_153.pro
5567e0ef496ff0437cef43426da51eee
b2abd7d339c205d9e3bf39d5ce810099fda97a73
F20101111_AAASYW liao_h_Page_091.tif
c270ef96c65e06af6f80f9af78bdf847
3312ae8ff9bc0249627c9ffdfa733c81ed30e37a
2704 F20101111_AAASCD liao_h_Page_118thm.jpg
48c635045329d8ac8534c7b0d9f70d4e
6595931669f218b8b6cde2eb4832d58c2080dc52
53941 F20101111_AAASBP liao_h_Page_022.pro
3c340e069b163cfe930ed739181bc7d6
12220402bd4aafe125ed07c0f37980f82af66a54
15314 F20101111_AAATFG liao_h_Page_175.pro
d61f8504e0cd6d6e4dfbff9de3a0b0ee
e6478b0273fdfc895b27b67574f9b03ab06c3886
24352 F20101111_AAATES liao_h_Page_154.pro
012826d7bf579eace362ad20fb2b67ff
908fde0a592cd8903436e0e3ba89f18448c29cb2
1051963 F20101111_AAARWJ liao_h_Page_132.jp2
ec37062b44e9e179984b5de017fad4d6
13ce77e33c18d97e6e8db4f950b788d51f4d81a3
F20101111_AAASZL liao_h_Page_116.tif
604da0b10f0afbf6858d8f905fda0220
842c65e22eabc7b9b9fe591c17a40041aefdd7e6
F20101111_AAASYX liao_h_Page_092.tif
f301b8cd5d00f389b3c9c96726009fc7
f67eb799652ecd5e4dbf90fb0886676bc9fa33df
F20101111_AAASCE liao_h_Page_108.tif
16a03af73db256aaec4856b9a48412f9
245693a625fafc0a8c7adfbbe60ddeec5888d2a3
26023 F20101111_AAASBQ liao_h_Page_099.QC.jpg
e17126682d58787f886078fbf48617be
51bd271c5a1d88a50786ac625e177ee2b9f115c1
516 F20101111_AAATFH liao_h_Page_001.txt
71957a1fbecdb29c771f9db40642e58f
a014b15d4d47b0b27c0e9248201ea3bd2d9c2fd2
10614 F20101111_AAATET liao_h_Page_155.pro
774b7038004831315d98103a90bf67b0
0947c481f93e407059326ff0b9ddfa4f7bc1e5c7
2943 F20101111_AAARWK liao_h_Page_030thm.jpg
aaad9cf30c461402a3d9017a60ebc7f4
1e38871a42b756bd7d71c04049a6a377011f2b25
F20101111_AAASZM liao_h_Page_118.tif
add3c869d74b92c751b3de09daaf2481
99015dc5e5bbb4ceb2dff76ff4b920a6d47f20f7
F20101111_AAASYY liao_h_Page_093.tif
026c079c880062886b7a9be11fb5d5df
e61b55402c943b2139540d5c0c7d4d5a605b6fcb
F20101111_AAASCF liao_h_Page_049.tif
d09c1f949c19e137391692d523863602
8d319d1f7091c1e953cc6abd3c2946dc0b7d542c
F20101111_AAASBR liao_h_Page_008.tif
fc3bdc59bfea7d9e689125556ca36e43
93d4febfa65fa3121e9e9961474dd6cb7c2a0c65
142 F20101111_AAATFI liao_h_Page_003.txt
9711e1cd41133a2c9b7c090287e18123
e3569fe3f515085be68f0d0eeb2f9db2ec57dcd5
11045 F20101111_AAATEU liao_h_Page_159.pro
8b379c06d8ea2e6af05239e9d2252519
0a75cf365115d5a28bab6d7b815e184159c164df
17691 F20101111_AAARWL liao_h_Page_158.pro
0132e1093437b6228860f64ab09055c3
444bf3c9ea2f3e6c7b48d4a5281221418e37275a
1053954 F20101111_AAASZN liao_h_Page_119.tif
cd6a11d3f26f1a2c827508e51164de2b
c2de15a00f539a17c5bdfa1a1533dedf4fb606ca
F20101111_AAASYZ liao_h_Page_095.tif
7543a6fa390ba52d8efb544b827fa1e8
c395c1e64a201e1e632d32035b52736a3edb8386
2899 F20101111_AAASCG liao_h_Page_095.txt
51bf2d5bd16346ae4c8d90800ef3c03c
b04da3dcd5f83b0ef846d368486be21831ea3431
F20101111_AAARXA liao_h_Page_172.jp2
e7b78cabcfe6e2063dc09e5f559010ee
16ab8415b159866691fa11fab62ec29884f78d08
2123 F20101111_AAASBS liao_h_Page_021.txt
82a37d766e445cabafc639ef2fee50ab
44eea12d6fd3102d83d3f01f1f61aff13928c355
1329 F20101111_AAATFJ liao_h_Page_004.txt
357555564ef98bc59c207996fcb2242c
152d4b160ff0808b7b940eaccb392dbd25c950ac
53987 F20101111_AAARWM liao_h_Page_112.pro
47b9c50c7b9fbb428f6552d8d0e73828
c0a0b681553636c1f019eb46dbd09ba623bac2b2
F20101111_AAASZO liao_h_Page_122.tif
02d191bcb7d71b74ab3b3754ac601e34
2d1c216a07fc358ec82cf5be5fd130ac81d8713c
80538 F20101111_AAASCH liao_h_Page_096.jpg
2683880dc46344a1d08ecb85874395e1
263eb450c36168a3ecd8f7f2d6af942aaa77d3f4
4036 F20101111_AAARXB liao_h_Page_174thm.jpg
c738e15e990063e4c7ca64620e421d4a
2cfb93341cc32f9a919dd33e3c35402d60fe1e47
4339 F20101111_AAATFK liao_h_Page_007.txt
a4f90108dabae2d082e7f831761d0684
042f32a478fe86fb571b4df0a360a76e88ba5452
40657 F20101111_AAATEV liao_h_Page_160.pro
a35b0ba3fca717d0aad7525269823a8a
1bd9c21f49186aa60cede62cb1b89076d3bdc50e
6242 F20101111_AAARWN liao_h_Page_058thm.jpg
b9bb911d00f4cb107cf9634163a1362a
80f4714ad6edb200dd9c50617b0fc1b49a33a203
F20101111_AAASZP liao_h_Page_123.tif
145c56769b844be0f3bce296af3c08f5
59e8c63d179f6bd805d778fff07a4e3d5b7ff8e2
1279 F20101111_AAASCI liao_h_Page_026thm.jpg
455bb3385e1d55c7d543d2d302d81887
342ffd117fb1a6469a0e54a825090bf3dfbf7b95
46392 F20101111_AAARXC liao_h_Page_062.pro
abcbaa804412a4acceb69c90859263cd
62056b7391b9706208d17e5b182deb1b3f6ed8f0
92296 F20101111_AAASBT liao_h_Page_114.jpg
6d4456d1a1f5024b6f97bd2a9828c75c
e4a7cda9a93de81ce52c5bd1d103cbb205840996
1824 F20101111_AAATFL liao_h_Page_009.txt
c7b175b77177afe51e02c2180e1fcf41
c30a0dc649398cd931d077ace4dda665f1b73856
19473 F20101111_AAATEW liao_h_Page_161.pro
f5392a521aafaf99cd6ca722fda7ec7f
4c70d3ff273ce1476e8915f1af361bec9eef21b1
29930 F20101111_AAARWO liao_h_Page_168.QC.jpg
4890fa9dc3da8a05715a51d1c3ada27f
af7b7b2a80ec55dd746396296998fad581b7b514
F20101111_AAASZQ liao_h_Page_125.tif
282af7b9ef4a4411a42b78f57e17cbfd
6392b9ffa260e1a35a71d71d0cc62088952c50ad
1051957 F20101111_AAASCJ liao_h_Page_011.jp2
e9645e4a5fad1f42e0b161a6c895c59d
311cbe5831ba30ec4efe3bb5ccbe97942412677e
28954 F20101111_AAARXD liao_h_Page_076.QC.jpg
7727b9852a31cd6e84185b51eb2d2041
6539a6e467f772507e6bda4ae4db96cd7303ac4a
360333 F20101111_AAASBU liao_h_Page_175.jp2
f81517e0aabf63fc400d86f907919f7a
e1518862e3500bc809bb2ac1c869c76931c3e85c
2057 F20101111_AAATGA liao_h_Page_038.txt
7350cfd582c85ef754c651cb8068e269
b6fb253293ce3d2b4950a7cbb8f4ed77a707beb3
3215 F20101111_AAATFM liao_h_Page_011.txt
c50480f00095c42902b83d825a7cb598
85fc7ea5c53baf1db89a11565b1f0721f2ce69e3
62191 F20101111_AAATEX liao_h_Page_162.pro
0b90ea0687d9b13f2b8b260e11fef7eb
13f13bee4d6af49a2f02255289ee674ae27167a8
F20101111_AAARWP liao_h_Page_013.tif
376f65b30bfd37eabe133c2309ef889c
1918b44b81fd4d83165562496930531f17595d73
F20101111_AAASZR liao_h_Page_126.tif
908c47a518af215e8594b502985a8a49
7abd75138b6a15344a7da6f60902304b070446ad
F20101111_AAASCK liao_h_Page_154.tif
50f6e2856f098e20516173023f2d380c
be5217a8125748feef13a2307c38d4e39a41eb85
5565 F20101111_AAARXE liao_h_Page_014thm.jpg
dbf79f7477faaa89c59c54adc479a750
3afeaa58f7873d09c7c093645cb21500a4a0cd2a
872971 F20101111_AAASBV liao_h_Page_126.jp2
cc991367c1585b95a08fc7d59455195d
fe81996103d95082428b86d060ed31126ccabb56
2150 F20101111_AAATGB liao_h_Page_041.txt
b2f4f05ee60bcb8ad921d4566a8cabd3
07e5706cc58cef883a38cf37e28833549cba6e57
2952 F20101111_AAATFN liao_h_Page_012.txt
c8c3bb556f192715f4dc3d6306cec88a
546973038cb6cfa094fe4a5b62e73b4312ca1158
67634 F20101111_AAATEY liao_h_Page_165.pro
458c139912668b8c0c82086284cd219c
07b27a2391c4c64e5fe5b86ec18d93c9b108d1e9
73120 F20101111_AAARWQ liao_h_Page_122.jpg
4572d50ef9975b6e10e7a3027f1365b5
b1fef884153372288c59866e2daf916179c85ad8
F20101111_AAASZS liao_h_Page_127.tif
69333967637f34828ae70eae0d931fe1
4818bf87e6964f74f3e092329efac8739bf9dfac
F20101111_AAASCL liao_h_Page_111.tif
0f0e146db69a92c217063ae54f59f113
d5bdaf0798667cb2e935b5e6fafb8f294c1c7c2e
27207 F20101111_AAARXF liao_h_Page_072.pro
442c942e4381048e298a1bbf92757e61
a0e430df37a8cf8bb97055023563dede517da22f
1051958 F20101111_AAASBW liao_h_Page_038.jp2
187001b7f632ec87334415586ba6ba6e
2b232dfedd8e90e397a692030b42ba17c4580645
2106 F20101111_AAATGC liao_h_Page_042.txt
95e2d9b00b9cc60c399ede1391044138
62ebd8180d079cf6466800a43cc332168ca1fc9e
1953 F20101111_AAATFO liao_h_Page_013.txt
e040b688097cd52e8bcc07a7c4de5e73
06d352f9ef0977053d97f2718a6293b7cdad6d89
69032 F20101111_AAATEZ liao_h_Page_167.pro
7f1729c4999bf109cebc9b05d2e79187
6a7d56096a53eaca7793cfd58b1e8ee3aa6c5061
F20101111_AAARWR liao_h_Page_117.tif
e670efba721988765f859142402ba728
4757a91cb76d0b12c362fd53948d8510fa86b437
F20101111_AAASZT liao_h_Page_132.tif
a8854618c37803128a17b8c463ae7cf2
93cb0a8d66b7a876744e3095f1981d6a458c9fd6
6562 F20101111_AAASDA liao_h_Page_060thm.jpg
22d7afa54628e2c4cf3bb4287aec9f8f
a9848df232cea87b04106609ddaf41c32f76c61e
F20101111_AAASCM liao_h_Page_034.tif
1c3caaa12b390296106277928ffafc96
ee2f3c9a38c407392e2c596541fe9ecc0ab70d09
F20101111_AAARXG liao_h_Page_120.tif
71e25aefd4ea0988a05697760934f88a
cb95204fc27888d52e3455095a46aa45d5898760
14504 F20101111_AAASBX liao_h_Page_057.QC.jpg
f0a24934a170086b9ffd7bc10f5340be
8cc26e455538a62b404fa8d7d5d3ba0c75e99eea
2258 F20101111_AAATGD liao_h_Page_043.txt
69823e24d5f5cc4553a1ab403bcf8c82
454866c333fd1d14f5705898ca837d901de4c03e
1807 F20101111_AAATFP liao_h_Page_014.txt
0351f30e0e8cc8aa7827a030227f75d0
6b19b584a83a2b258977f8ad7a3ca5ee56856c56
2699 F20101111_AAARWS liao_h_Page_143.txt
c0a8ac05e176a8422b0e31a6ac509277
09fa0e2a4d0fe1b8fa7be6d0ae0e592afcb99f20
F20101111_AAASZU liao_h_Page_133.tif
9d10998527e57e18e08bbbbbb2eff95e
4aa88ccf124e4f8645ce3c5f0c9df1a689479651
3111 F20101111_AAASDB liao_h_Page_090thm.jpg
12df25fee6348e9376d089c35326ba91
b601e5ee3e73b0ec6ea5eed940d6ee53b3f22473
2105 F20101111_AAASCN liao_h_Page_108.txt
8a06899d9e85d88493531c50cc1ff031
0e89b105dd2ceb1a7429933cc8b89476513f06f1
6844 F20101111_AAARXH liao_h_Page_141thm.jpg
67c4499128ccf536298854444a4a31c0
6afd34fab3dfdce62a1897f2a52ed14251be757d
6745 F20101111_AAASBY liao_h_Page_169thm.jpg
aa8e62c5b2456b5622ee65cf3dcd48c3
582a6e9291408c5b958325b67ac8df0696bc1b7f
2202 F20101111_AAATGE liao_h_Page_044.txt
eca4f86240933190a2d52a4a321f00fc
7418298ac7b0b6aeca94ce22346dfee13e23a7c9
2149 F20101111_AAATFQ liao_h_Page_018.txt
36358bfd03bae39d35a52fec039d9c61
170abc36d60f783b73c00932c579ed40f670868b
F20101111_AAARWT liao_h_Page_107.jp2
4606347f21bb9deedc091bdd7060cda4
b9c87e54a84aaf79389b068e2cd0271e6d9586d7
F20101111_AAASZV liao_h_Page_135.tif
ab56295383ac31e652056a9ee39d1e2f
c5868c23b08782cfd70d404c75f9526a99b6927f
F20101111_AAASDC liao_h_Page_031.jp2
5fc0910cbc851ba07431730f136590a6
95d6339d92daac7f3e03b79e135fc623eb6dacca
28495 F20101111_AAASCO liao_h_Page_087.QC.jpg
d597fbb6760ee7dc3c03203d9d620f16
fd5d4dece9a7f13d83b4aabf8109bff43f9dce3d
108766 F20101111_AAARXI liao_h_Page_164.jpg
4dbcc792cb3a29986ba7f4d998ef06ec
3718e8d0a7b044d6fd38576b39f74ab4fe175e96
14194 F20101111_AAASBZ liao_h_Page_026.jpg
1aaac6dc0320a7d7e804e752fe3ee340
0a991bd1d09d4ce6e0a6df632338d02eb67467da
1669 F20101111_AAATGF liao_h_Page_046.txt
67fdb545e6295923ce168378f797aec8
fb06ad2b67d215402f45ba21ceafd9a23b8e5834
F20101111_AAATFR liao_h_Page_022.txt
9b3fbd4329428bd1506f3898661e437b
f08bc7ee67e6cc58f00c3dab416e205621734669
F20101111_AAASZW liao_h_Page_136.tif
9681d6e072a5a1860d9c4e6ff5dd32f0
4535305604ee230ebbce51a7380d03e4fe0da6a4
1149 F20101111_AAASDD liao_h_Page_067.txt
a3d11ab87dc84e8e7a53dc3d294f0000
d796ca251a059fb9163dfd848aa49e7aaf7518e3
54879 F20101111_AAASCP liao_h_Page_023.pro
24d4aabe5fc5ea78a8ad2a5808bbd7ea
60bf9a8fc1fa7c991752aea84942905571dd9613
378362 F20101111_AAARXJ liao_h_Page_120.jp2
614361103dea18289653e9deaa138914
dfb767003400bf70c7176b277a0424bf82c0fad7
42661 F20101111_AAARWU liao_h_Page_104.pro
491537b0a8a7faaf12ad82cbe7206c2f
57d255e3fec9791293a49050f052d167fd9a71e6
1498 F20101111_AAATGG liao_h_Page_048.txt
2298374c3d276e3d801ec87ab0edc2f7
d304fe3f247eb3c3db211ca14d894a1bb0e3aab6
2162 F20101111_AAATFS liao_h_Page_023.txt
089959c40aeab124b06fe07cb8749d05
afb03c2315d605ec64f9f401426aba42df6457c5
F20101111_AAASZX liao_h_Page_137.tif
9357293ced380f387a393f9d0b3ef173
c94c870bd98c5c19b920777c8f34452f1b3a176f
5151 F20101111_AAASDE liao_h_Page_072thm.jpg
77e5bf77c2748da9964268a194db66d8
c7002648e4c4c53914cb0976591cc90812a7fe33
6557 F20101111_AAASCQ liao_h_Page_032thm.jpg
2c0c975eb17fb0b6fb2bdf658f719ab9
8892425f8cb311530bc33201d3a603c959a295b7
594599 F20101111_AAARWV liao_h_Page_028.jp2
389de668435f4e06aa5172215c5390cd
f73136bc128943cac0df3cd68dbd70465bf9a9e2
1516 F20101111_AAATGH liao_h_Page_051.txt
1416a3eeca00ae466592e7c28403f397
d85cd6581153d47141d06ed76e8e934b108a0436
2190 F20101111_AAATFT liao_h_Page_025.txt
78d0337f774872f657dad8fe4e09c1bd
4b8a3193dfeed1216bef5bcab5726188d09ba006
F20101111_AAASZY liao_h_Page_138.tif
923976b62519a2c7fb73d6afc0b8234e
ecf84242811271b509a5f4c16f8e1bd1f330274e
761556 F20101111_AAASDF liao_h_Page_068.jp2
9a1442ef2e4d602dcf434da1809d9e9c
170f8beef4cd57fb92425eea6a3ec0354a09abef
6718 F20101111_AAASCR liao_h_Page_083thm.jpg
5ecb5da1be55be9097c69403a4d51033
93cf7639f9bdfb2b189e0c180fbb2ca21af0f4ea
556880 F20101111_AAARXK liao_h_Page_153.jp2
0c6c9b7c76304ebe386e41c88fb1a7a3
23b46b4a15ad0333059122078c3b066741edfa02
27406 F20101111_AAARWW liao_h_Page_012.QC.jpg
ed72ae9251df3db51c996befb6b3a928
230661cc51803c3dd3dbfea875579e5d0fd4cc5e
1607 F20101111_AAATGI liao_h_Page_052.txt
360565561cc84489a1f586cbe4231285
ac5dea08c8010c3d6b4158031f71de51f4ee2f1d
450 F20101111_AAATFU liao_h_Page_027.txt
e858fd2aa3bde2a61eecb109d38ed469
199b12fffc7720b77a600c66cc131c58d34644eb
F20101111_AAASZZ liao_h_Page_139.tif
b39f3b62ad498aa4de3170ffa6f3748b
99a394265a37d86c6c8006a438866ef65adda72e
1051916 F20101111_AAASDG liao_h_Page_023.jp2
f7e14194f233ba70315fcc4b280691ad
124fefb3b5358669fe507f3940534a3ef2dc7c43
28681 F20101111_AAARYA liao_h_Page_059.QC.jpg
465877a9a8214daec3f429aae9066f32
e666572a0fedb47051ad97fc6b12d5e6a807ff35
2178 F20101111_AAASCS liao_h_Page_034.txt
298cef361afb0b5ed1437cf8ed9761ac
82ad99f846a6777648f9f84b2e19dd0e85b18e87
21280 F20101111_AAARXL liao_h_Page_057.pro
2a6918c4aa81ffe393720c5af6b437f8
9c7797cc01754a909ac7362a5f6f6a933d4cb914
2065 F20101111_AAARWX liao_h_Page_016.txt
513bc08d09c3ae22007f0cb9cc6b5595
c73942439a6836ca62590b8e1f96377fd584bf12
1243 F20101111_AAATGJ liao_h_Page_053.txt
1e0b4ccba8c075ead3d3189e2d81c4eb
40b59facbbc80958aed3a6642e4c3a1fed77e3fc
839 F20101111_AAATFV liao_h_Page_028.txt
2ceeb5aefdf7cc620c0035458328b6de
ae932aa18670124ef82cf183b28f046b362681a5
543 F20101111_AAASDH liao_h_Page_008.txt
2c14a611a45031d6f3a7a09fab15d60c
78cea72554c110acaedaf4a0c0a8af9da03c3326
28458 F20101111_AAARYB liao_h_Page_138.QC.jpg
323af0346c7b2fd67e2f197879171c34
decc21819e0cf81979dbad8d17d6fc4d0e52499e
57377 F20101111_AAASCT liao_h_Page_056.jpg
dee5e3605f2101f60fef1ccc025631b3
7efef717d3a342e3edaea367cb2b81234073c442
118878 F20101111_AAARXM liao_h_Page_011.jpg
f0f3e09df134c3da401bf9ebc9a83168
b2b6a15c4368f1d7b390f82117a60cea33d3e2c6
663 F20101111_AAARWY liao_h_Page_003thm.jpg
fc43418090d548f1c755d376409fddb9
a7ab38524a9a016cc861298a5c336415136a521b
922 F20101111_AAATGK liao_h_Page_054.txt
efbfe885d65d4058fbfdf1ce8605fcd4
0c0edcd9fdc0a84fd2304eb245f6ab6b4c603a9f
18443 F20101111_AAASDI liao_h_Page_072.QC.jpg
534c5408f19f677d66acb99ee50bdde3
b17a285df24b3edbe08a630a3d00e4078533a4b2
97260 F20101111_AAARYC liao_h_Page_139.jpg
5f1981b31b9c1fb8453cd5471a5ceb79
d95b53206cd02838decb366cc1b2a38530e6222d
94591 F20101111_AAARXN liao_h_Page_106.jpg
c9062e463b1d244eab7eba0627f11cd1
3c0631e94f63d2ee019a116fe5b0c4275ec300bc
14718 F20101111_AAARWZ liao_h_Page_151.pro
1a07fcb72902b26ff095a0e1b9f2ddb4
886a0b872f680976a098deae8b5f7165623494ef
983 F20101111_AAATGL liao_h_Page_057.txt
4b8f25039a51bd5e341446f6499daad9
aa26918faeac2ad58b610364e0a3a6e9a7ba5bee
3077 F20101111_AAATFW liao_h_Page_031.txt
cc9af0e319867b418e20c9894300cac2
56874d1c6a27f96d7f46a202982f77643f0b663d
2734 F20101111_AAASDJ liao_h_Page_170.txt
cc732ae25e5fc4b4d2826760b0207cc9
ce8b665b04aa8c7f27ab66932e57f95607d8a848
1189 F20101111_AAARYD liao_h_Page_156.txt
fa564f95397eaf1c6a4a08b37a765cdb
d3851b8677ea040207c7105ea1ecd97b5a171026
7151 F20101111_AAASCU liao_h_Page_147thm.jpg
a067aede3a955f8329a3ba114141842d
9996fce569daed67119c86a0d67eaad08d49be14
41618 F20101111_AAARXO liao_h_Page_096.pro
c9bbaa89e77e74e4a31576674d0537ba
5e6d5ec70d100c09b9193210fdf51ea861dbedd5
2048 F20101111_AAATHA liao_h_Page_078.txt
0c719d70be3ff4e74fadc38b6eb11d11
0c8e6ccdc84003952b8f101cb087ef83d12b4fe8
2180 F20101111_AAATGM liao_h_Page_059.txt
2c23f62afa9ca78626d237ac7604ffed
585ff6bfd2d201858b7aa8ab3dd4fc8f3dfdd867
F20101111_AAATFX liao_h_Page_035.txt
07b7d807b6fa5d4674355bef47a8c7ed
471be86e735ec837940dfbc1eca779d46866e79f
9058 F20101111_AAASDK liao_h_Page_047.QC.jpg
a2b7df378d2c3bb431d88a80b8fd565f
2b0150f24be87939f408112dc633ee72f54adc28
6180 F20101111_AAARYE liao_h_Page_033thm.jpg
f5151cde6c549867dfed4fb37d4d3e5a
eb0091275cbf79c360275bab67fa2ec8b88c98d0
787766 F20101111_AAASCV liao_h_Page_089.jp2
0d1ea1d2af5bce4941d585f975a7746c
a9b92c4a241761e79a7dc7b4ae221b97f74605cb
90187 F20101111_AAARXP liao_h_Page_101.jpg
6d6eab3094a4a37f78346709bd319f9f
e26a416c5418d5c0a570951178d437831131e210
2115 F20101111_AAATHB liao_h_Page_080.txt
31af2b90a9b4e258057b86bbe5162101
44bf6cf34db3941be54a736a02db4281cf80940a
2027 F20101111_AAATGN liao_h_Page_060.txt
0d784fd0e5b2e91013057c07d6927d5a
512fd2020c167dca0bb8e1e87c93500860c6e208
F20101111_AAATFY liao_h_Page_036.txt
9c43eaf5a74ae6ed00e6ad37e33fc06e
45f1b6295df4f214be04a18f02366f573dc0dd13
F20101111_AAASDL liao_h_Page_162.jp2
77bf41ef5484eac4c5ae28982f842264
fc9305eaf37f1e11e40b81ea79e225357283da46
791 F20101111_AAARYF liao_h_Page_116thm.jpg
0516cd6cf28eeb793359432f8529a0d2
0c2508de7816581d475f99d80419f164eab9874e
F20101111_AAASCW liao_h_Page_055.tif
8dcf7176f08421786c0e2dd41e950ce8
fc528b68045b4c4560fe61688a3e4d82a7b005f1
2714 F20101111_AAARXQ liao_h_Page_165.txt
dda7a93d26463dd4d6f69d2359359a9e
d0a4fbe02a267a590daecab5536aefe4c1b955c7
2073 F20101111_AAATHC liao_h_Page_081.txt
c1956b5ced644f3e25ace97946968847
efac5472ce409e758db00f6627db2925f3b551c9
1921 F20101111_AAATGO liao_h_Page_061.txt
654ef28279a80a7a4c7488d2e0a0c044
1e3ce51d0bed15c3b742cb44752fded900c2e58f
F20101111_AAATFZ liao_h_Page_037.txt
253b2e71fa702e71ccd6fc7024abf86a
160fcc8cb463a245174fa2cf94d05ba5a55a63df
28704 F20101111_AAASDM liao_h_Page_006.QC.jpg
db85d14140165c6db8ab641125630532
98c745fe92863d5f7dc0acef40ac0e5708cf952b
26393 F20101111_AAARYG liao_h_Page_095.QC.jpg
ca2db9d676050e18c61d8b9957785da9
26bf473173f3dff81e1ceb6b58eb9c68f0371527
2074 F20101111_AAASCX liao_h_Page_115.txt
4d34b7bd39a7b4801213d44fff9a7f82
c792e4e1b40483c99637032fe09f73c385324d1f
3194232 F20101111_AAARXR liao_h.pdf
5aec4cd73f943b0195ac1f89dcaedcea
1c119231f2a83b12d0e658be384412d7415be2b8
28201 F20101111_AAASEA liao_h_Page_085.QC.jpg
d5996c25b81808afdf9851fff62f2890
16afe5387e84513794558713f5a99b2dff7dd86a
2110 F20101111_AAATHD liao_h_Page_082.txt
6c206d99ec9b43ee3073b9f0cc3da370
97045aacf2d49071feda6d6a43236fd0f8601ef2
1877 F20101111_AAATGP liao_h_Page_062.txt
9b4f072aa4a288df2b0dd2d8a9e214c7
71257d20bc3ea4d28d9117f94bb7fd1fb974fe91
23085 F20101111_AAASDN liao_h_Page_123.QC.jpg
fe5af0e0d9e09b6c50e6ff8a7ac44777
3f16e4e31dce099ebd3ea98a91f97abc7a5b8b5b
29738 F20101111_AAARYH liao_h_Page_129.QC.jpg
34902df2e4f2f92edc6daf3192760359
213cdef1bdd1df74ed33ce5b515044942972868d
1314 F20101111_AAASCY liao_h_Page_154.txt
3e15961b746b4cee1cd8647d85135585
032b713063dc13dd08f09c1fa1b92799806b0c73
3531 F20101111_AAARXS liao_h_Page_154thm.jpg
ca6275de9c47ba611d69ee57e1619a64
975cc2cdd269131e2b8278eb3bc505b34dba1268
2154 F20101111_AAASEB liao_h_Page_015.txt
ada0b5ca9a75e37b572e4914f56b01c0
01ae5ab3186d52eb72608fc483a625d26af4f0e3
2173 F20101111_AAATHE liao_h_Page_083.txt
e5c74e90d660b218073f120e59407c09
6c03c3095c284cabd0b6abe8bf6e0e8b7c9916bc
2133 F20101111_AAATGQ liao_h_Page_064.txt
1f1d368d1aa49bbb76b29523426dc36e
a9673e9cb5bbc6f5cc755e8230f2db895b7c52be
69513 F20101111_AAASDO liao_h_Page_027.jpg
2b64aaddc39491c4c42ebb3066e10e5e
6affeb8ccfc4fd5c495cf0ff7deaba8641c14e66
29113 F20101111_AAARYI liao_h_Page_020.QC.jpg
162bed23eab0c584e8085545b521248f
5f60cd60d81df4d9c7f77f494f84a4aa75f5eaed
1051922 F20101111_AAASCZ liao_h_Page_079.jp2
eb32b8e0862057beb0e4cd96fa5f08ea
92ca99cba30b8617094b79425e9e6b4cdbd0cda4
F20101111_AAARXT liao_h_Page_056.tif
3f904ead77c0e5738f3c2450c6c52eb1
ecfe24b378ba82048c40f259c578660ef3997a43
F20101111_AAASEC liao_h_Page_170.jp2
ef996bac3e4223642ba5bb87a7fcb58b
e22c5ada0ce583ce07ae159138e215f7f6ffa3d9
2083 F20101111_AAATHF liao_h_Page_085.txt
e5595277995cbb5c9dff8c7d6c31c9ba
25edccd8b4aaf3218e14228da4f33c99afd7186a
1667 F20101111_AAATGR liao_h_Page_065.txt
c05fe9a1a90ac54bd583424484f2e9f2
49e00def50e0bb936f08a22b386364b65cd7b816
59263 F20101111_AAASDP liao_h_Page_049.jpg
8173fca7858c28db7eef2c92a5a10a9b
fec39c15e560376d90515d4dd587212212e3a380
109495 F20101111_AAARYJ liao_h_Page_166.jpg
450bd8ce9b5d79b5bd275685ff980202
205cafa9bd8a59f9d4e3ff0bfbe7ebf886a6a79f
92534 F20101111_AAARXU liao_h_Page_082.jpg
049a1e329165f1d3aaf4c9bb14e4a4d6
0e1296d8b02e637200b1e2c7d0a8dfb1d048c2ef
F20101111_AAASED liao_h_Page_094.tif
d659de7e880ccc5e1fc0ee2addd42170
d60e5ab8bde8bcd9594f27946cf04360e0c7dbf9
2210 F20101111_AAATHG liao_h_Page_086.txt
3b7f7cde9f528f8caa9356be89151052
44d0c72198466e911e71538a9003fb2e0a43ed82
1155 F20101111_AAATGS liao_h_Page_069.txt
de1f283e3d14804cbf93effb66541e7f
dfcf22a793b82d218a28a5b57b478ddb158139ca
31584 F20101111_AAASDQ liao_h_Page_051.pro
cc31d1e6ac8efa67d2aa7c9c48ff3cb0
cd82f637fe807cbcaedb647b5acf365c54ca0ca2
F20101111_AAARYK liao_h_Page_070.tif
2851c0c161bd7ff79f4d4d309d1d5575
89e2c7fee2613382888a4e2f87b7c0407a74f6ab
6881 F20101111_AAARXV liao_h_Page_163thm.jpg
0f84f6f1353c857ed04ec3242caf26d1
e27dc7e04502e534eff786ed03cef8eacfa8e034
115402 F20101111_AAASEE liao_h_Page_172.jpg
d45fd1a3ef6a86c7ddf37d8a86a9737c
e68a4e7672a7390368e1b9a4f1b0f1eda1517945
1341 F20101111_AAATHH liao_h_Page_089.txt
ff386e9c11c0d6ff6cf6f60cd02a0a7d
7249ec45c2045a8f99172acf5dd2ea08881428ac
1030 F20101111_AAATGT liao_h_Page_070.txt
039f5ad3908b2228ed0525b73e668d6d
885a74b6a2c6d354816b31d6811ae1dfee67694b
28892 F20101111_AAASDR liao_h_Page_120.jpg
fe454240e71b4ff0e801ec3e6d768dc2
347b5009fbdb316963bd0467394eaa0798a33ca3
16693 F20101111_AAARXW liao_h_Page_126.QC.jpg
102b9ae75f334112850a6d7975ff28f1
d1522b37592761da0a2dcfe046ca58688e689c51
28541 F20101111_AAASEF liao_h_Page_114.QC.jpg
e85cdc25abb8c86f9e1b63fe6014110f
cb76cc3ab81ae53e714ae3d93a598fccbde80d97
1367 F20101111_AAATHI liao_h_Page_090.txt
abe3ed64cc0818099282a91939f1794f
d7740b5e57a6aded927d064a9464ddcc65ce04b3
720 F20101111_AAATGU liao_h_Page_071.txt
80b85ac195bde1930b16ab8529520281
95fd592cfbca5bba318a5c768bbbf368fb39a922
55282 F20101111_AAARYL liao_h_Page_059.pro
993c1a9b242359a9a211c801b3777a1f
d2083e422a5cb8b4e9688bf5cfa72208d70256e2
F20101111_AAARXX liao_h_Page_064.jp2
72a5d4c12bc516fd1b0b58ed6e5d54a8
1cdcdc9086cffb802a9ad3982a21572b3fd61510
70945 F20101111_AAASEG liao_h_Page_054.jpg
331e5aa40e528e766e81c4cca0c5d38a
759bf33bbb82d3f93d70531f10999f4c81b0c533
2039 F20101111_AAARZA liao_h_Page_079.txt
bb55f3e0534192aca7717797030c44fa
9f010e24eb55f92ce8d8baaa10f0e8b374b75252
F20101111_AAASDS liao_h_Page_171.jp2
b606f5117f598631f92f689479aae2f5
5e0129f2e161bb11a097ee740fe57006384b640a
2707 F20101111_AAATHJ liao_h_Page_091.txt
29962ecea522d642294a08b336b75952
288512d82679892d9ad21e80c110e3018990912d
F20101111_AAATGV liao_h_Page_072.txt
0269b5e5f9b135b03c5e0886ff31945d
373afbbe8556f34d60cd5da4d88e0f3c6aa52444
389233 F20101111_AAARYM liao_h_Page_029.jp2
8acf5cefa56a696aa0fb088c86cf6bce
0abc3e326706130ddaaab0fa629dfe5400e0b052
62371 F20101111_AAARXY liao_h_Page_009.jpg
76ac151511b7933effab516d2a30aba6
9efb9f1cdb70d31cb2b567ad8ea78e0c257ed298
F20101111_AAASEH liao_h_Page_088.tif
a7c558d6da8ee134212e807abccfb181
cc3e231bba4234d275408ef6ef32c550b4e801fb
25120 F20101111_AAARZB liao_h_Page_039.QC.jpg
e3615a5ee488e4c2317f00742167f2bc
a62f76d2474c26e60618364a27d8c036a6a06644
F20101111_AAASDT liao_h_Page_042.jp2
c912eaa4853b73664ffccd9b88846ae1
5ab302136b8ac506201b53b5c0c567ed0f0e7d36
2116 F20101111_AAATHK liao_h_Page_093.txt
7192f6a95e0f18ad7fa0b03f4609c825
4704c192258a6d61d6ecef8440d790c1947e0ad7
2151 F20101111_AAATGW liao_h_Page_074.txt
82a2533339d3261ca135729b9aef785d
9837b5af616fc0fd2cf93cc9162912c0a3b3cb5a
F20101111_AAARYN liao_h_Page_057.tif
79d135ecfb8779633a178046ad09b3b3
3d7d418b7c67bd22228099e54483cdefc103f782
30228 F20101111_AAARXZ liao_h_Page_083.QC.jpg
56cb0e02e71cf79828ad1d96cd9dd38f
9397ab79d31a96ed28fe4305aa596a932cee47ad
53227 F20101111_AAASEI liao_h_Page_017.pro
e92cfc16ecefa21945f373aca2af0228
26349850468678846cb0c76f6219c8d3cebf40a9
1051919 F20101111_AAARZC liao_h_Page_020.jp2
738cae9d3fd9edd99d1e4fcedfc3798d
0a2bd7b60553b7e772f5ccd6ae79be80a9c925b8
2163 F20101111_AAASDU liao_h_Page_136.txt
16a8933e2d9a8b6fc6275fa11c06ef21
d8ca4004a10a26b2250509f0f5272fa79400db70
1804 F20101111_AAATHL liao_h_Page_094.txt
79d763d1e7b296515e3b01048cb4a0c4
3be24552d1784fd6d494862916d308f0538bf2ed
4312 F20101111_AAARYO liao_h_Page_004thm.jpg
025752a096e2192f902a602cfd7e3d82
8ca8c1107e375c13eb983e0a3f11942a996fa78a
379 F20101111_AAASEJ liao_h_Page_029.txt
cea2899ee9a85aadc7ef0e014ca2a3b4
c470bc6b9d13c82587a852dc9140e7bff02beada
F20101111_AAARZD liao_h_Page_085.jp2
44f1f31db19bb4f40c2b2c0375bf7e86
e9c2a3482f82aa342e90b5fbb4c884b27c29f504
694 F20101111_AAATIA liao_h_Page_120.txt
f981de1ec853ec094ec378acee7fd0e6
6d0f5d06442494c746644f0361515fd61ef9ddde
976 F20101111_AAATHM liao_h_Page_097.txt
712919b09273cd773df8eb2461961112
f0d7b80e32ef0fef47c25905f4229b9564476d2f
2138 F20101111_AAATGX liao_h_Page_075.txt
efe0d26fc56b3ccb8bd6405b37af1d5c
a3bd90c42955c3a59351e13ffb91861195eab84e
F20101111_AAARYP liao_h_Page_104.tif
3e53409737e3c850942ecfceeb5faf54
288c2699e094128a944617472dda7e8fcd166e0c
10649 F20101111_AAASEK liao_h_Page_119.QC.jpg
3c3f896f7cb1e5567164cd4fbbe8cf30
de118f1c4d473275fae0a1cdf5b5d83c80111fce
837 F20101111_AAARZE liao_h_Page_161.txt
50e6b144e65c65867ed2f2b8b9444784
2d68e058bc5cecc7b282cd4d7bc008a83cf2ef09
853 F20101111_AAASDV liao_h_Page_157.txt
be7d0174906b0187c780d85aec9bd8a0
0ee7f5b2ca20efcd2df3c9c804723f85d945ecfd
1859 F20101111_AAATIB liao_h_Page_123.txt
dbefc93c6773a30e1fd63b69d07295fb
338712ca48e75ed8236bc1c993c2f6d5275ce797
1233 F20101111_AAATHN liao_h_Page_098.txt
2bf879a2cc49620b490df82d5bc21c48
4698bfd083e58c8f048e6223985634c75d48fb77
2156 F20101111_AAATGY liao_h_Page_076.txt
408c775856c20647411f908644c6bbc9
3b0e0795775c32207b40f6e42d0a876ffdd11d3e
22905 F20101111_AAARYQ liao_h_Page_065.QC.jpg
fa9363e1586d4a026832e633a044da14
dd31cda29233bcd1c979f07f9ba67dc20d742180
89343 F20101111_AAASEL liao_h_Page_021.jpg
1f203438327b5c47655fda67e5b70f0b
fb2b92719e0603906e634c35492a7b65ec90491a
54837 F20101111_AAARZF liao_h_Page_041.pro
e48ee264049ae88ef27cadf3fef58f2e
a4a07e23c015f707e6003d546aeade69e8a37c26
451 F20101111_AAASDW liao_h_Page_002thm.jpg
ae58a06534e7161e170ccde9c7d28ecf
60491dcc3cbafd269da8fd31bcca6e4286cceab5
1128 F20101111_AAATIC liao_h_Page_125.txt
a1ad0145f41742052fbec1e36ae8b152
087c1be53275bd474c7bc136b67efb29ebde3757
1942 F20101111_AAATHO liao_h_Page_099.txt
d60aac2a814965a5704f419229ab5e87
f5fd155e2f903b8d8701d74a4d080674c6f52ee6
2077 F20101111_AAATGZ liao_h_Page_077.txt
4e220438eb83b18ca6cc32dc76918b54
a1a6e5d519c4f3cd64e6b56a27a39c2eb5e82205
17154 F20101111_AAARYR liao_h_Page_158.QC.jpg
7961c06deeb4fc0a34adcace171fe0d7
36f828d0c00f646e0dda1883d98ce1afcd2b4525
F20101111_AAASFA liao_h_Page_024.jp2
40b5ff82394af7d818e4ed0473f46232
210e64d2111f2d3abad5d52404154327a0658886
17587 F20101111_AAASEM liao_h_Page_142.pro
f4fe0091e2c28b044b035e0a01eba3f0
eba403b49d3c6e7fddafbc06363a5e813852fde1
66499 F20101111_AAARZG liao_h_Page_152.pro
376d3096c9a238184da47ecbbaefcc2f
5612a91880200f417c3103260f58644be2f8ae60
29160 F20101111_AAASDX liao_h_Page_043.QC.jpg
edeaef9506339ba5936101119ab7fdc6
a801ef996d22cc8650b2eb535dad766e81d1bba4
2365 F20101111_AAATID liao_h_Page_126.txt
eee867b79fa288daffe9b1ce06fe51fe
af187907af1d6a1a94b32aa1cee9abd42e728b1c
2053 F20101111_AAATHP liao_h_Page_101.txt
8d6bc7a7eb7cbcaf8ccc71ecc175df68
32b83c83ae34546349cf271715f61efad250e7d2
2136 F20101111_AAARYS liao_h_Page_114.txt
15b9ba51b2f5c75fd6742c9f676b3d12
8473e47613bb61527c6de39e4dc00e6fee532068
F20101111_AAASFB liao_h_Page_071.tif
adc4d566d23d20f3eb39913035546d1a
7f83bb9c2334aced8fdc56e593ee1f632edfd7e5
24589 F20101111_AAASEN liao_h_Page_001.jpg
c613866dd4bee5a3fcefe1e82ccb224c
3dd29fe230a8ec1c227affe4ee09bee68063ac07
1059 F20101111_AAARZH liao_h_Page_030.txt
e7aa5a4f49be85f260d1f627b803e438
fdde0dc0b1fe18b946e43251efce053f4a5e37af
F20101111_AAASDY liao_h_Page_087.jp2
a56d4ee552894e4148947a6bdb1cbd02
0081c4a4a25741d2150f9c41059b3f2ad15c8cf4
2199 F20101111_AAATIE liao_h_Page_128.txt
1432f5067c098fbc8786ae69265cc063
0b9417c765471828d0e059fce4e49d549bd3e020
2095 F20101111_AAATHQ liao_h_Page_102.txt
2efd0196558d9c2a0a3f01f4d404b16f
b6db5a875ba56568952b93bda4d802103832326e
2213 F20101111_AAARYT liao_h_Page_109.txt
0a3081c10a15377934c2a58a7da96c2b
bd3d658363af1840a55021dfef8a44f48b2c5652
787860 F20101111_AAASFC liao_h_Page_174.jp2
b1a29c569218d45a617b7005b8ebdb41
73ef95f5eb8923c2d29905ddc1f3e3107fa2ca1d
43167 F20101111_AAASEO liao_h_Page_009.pro
add5545c2e46c98b1968f2f5791f4d78
0c0feff79ef7e3258343e3bca62325d40226dbf0
29631 F20101111_AAARZI liao_h_Page_041.QC.jpg
dedb8b5082c8aa84acad242562129904
413bfb8ea4cefadcae2077eb953886969021cbe6
1299 F20101111_AAASDZ liao_h_Page_066.txt
38c77281e5851f913c737697b1c91333
be6a90f358b9c7b58db27720c347b2fb5d6cf537
2209 F20101111_AAATIF liao_h_Page_129.txt
3e5abc182e08f0a362ee4b2a5e4aeac0
77c59326ca47787e994811045875614dde62de49
1699 F20101111_AAATHR liao_h_Page_104.txt
01aab81893ea1b54cbcfbc78c4325be3
dcef13b5b4070e4aa46ceeec3d88a1a957922a17
F20101111_AAARYU liao_h_Page_142.tif
8dba99c9bb4e29b30cddba50d7242923
3fdedbc273fce4d91613809b0552938553132a95
F20101111_AAASFD liao_h_Page_146.tif
250bb85ee51930117d884e7e0e5b8e7a
51f57f624724400b39e18b39a4658e516b5655bc
6655 F20101111_AAASEP liao_h_Page_112thm.jpg
b55579642933a2e910e685b536db895a
326473c29efd2b8603120df526b53f163d45369a
31070 F20101111_AAARZJ liao_h_Page_173.QC.jpg
82f5016c90a7f0974e1b26cb7b3552b2
658a74fa8484604c5cd8d40a92ef9982fac37923
F20101111_AAATIG liao_h_Page_130.txt
818ba24bd659ae634e6db5d74595cc22
d97a2b80e43d8157e6f5f6325928bc6d3a4114f6
2157 F20101111_AAATHS liao_h_Page_106.txt
8cc5a0ab481bca40d1410bd5040117c1
00c514450bbf07e3084e37892c56bf55e04abc8a
F20101111_AAARYV liao_h_Page_061thm.jpg
f8cee8c534589350a9a048410aa0a8ae
132278c42c0e52ff8cc8d020c7f1b7f62517965d
29019 F20101111_AAASFE liao_h_Page_128.QC.jpg
a10b7168ed021ffb41a766349c3a876a
e5e9427d5a921c8b3de5c52e28d022314b265f2b
2070 F20101111_AAASEQ liao_h_Page_033.txt
d1c9429d8f3510909cc1d593fd396dcb
6f89166659ff73ca51c10fd2cd0b5cf0afe02006
100048 F20101111_AAARZK liao_h_Page_160.jpg
c38d011d2a303eb9a08361e8b9e0f1f2
3a7680d53fc26b988b8a580b30502a337406306f
2085 F20101111_AAATIH liao_h_Page_135.txt
843654fa1085851634cfec26b1d9a9db
fe4d5d468a481e2634a2dae7b692f252255a0c9b
2228 F20101111_AAATHT liao_h_Page_107.txt
3fc93c91404d48ab2abcf4a03806513b
fcf50ac353e4f0bd4e47065665ec57b25bdf17d3
2079 F20101111_AAARYW liao_h_Page_138.txt
b6dbb98643e748252d4002f154ff98da
c1d0d3238714c402f87b36130d8d6be9a1dc108c
29486 F20101111_AAASFF liao_h_Page_140.QC.jpg
5f0ba0c3ea55e38c37080caa3ae10c37
397fbd010d9315e10cc8d7a97eb6a300c55651c4
816 F20101111_AAASER liao_h_Page_068.txt
9e3be5e4071085df9c1de51b4239e8de
69c5b4ca5ba19b9da41ea4ebd54ed86740b6b03a
6352 F20101111_AAARZL liao_h_Page_135thm.jpg
381f7a63e8abf8aef0c9537e8b052ef7
d7ce36c842f081cef6eff8b97d50dc050b1209af
2153 F20101111_AAATII liao_h_Page_137.txt
92ba7a7a18497b640b88ba24fa799744
8f3a9f49b8e376a5bc14182385cdd18b03427055
2012 F20101111_AAATHU liao_h_Page_110.txt
adf803df5cd2ed59ab9f26b7e3ed606c
13db1301d60c512e2cb8717af6cfc89a1c9dcee0
F20101111_AAARYX liao_h_Page_042.tif
21bb88023d3942b9a3e64c808f8b60ce
77fc1ca8e53d999644bdee44f75f5b320dff8684
28439 F20101111_AAASFG liao_h_Page_022.QC.jpg
2cc1911bf7d6826c16c1d8c716a5f89f
7252f23718ec14b4d69c2af250a9e358c946a4b8
15426 F20101111_AAASES liao_h_Page_068.pro
0b65dabf9ec6ce2da667f3a2a05a6ae7
58f0140f472e35b1e28de2d4042448dbf942f3ee
2261 F20101111_AAATIJ liao_h_Page_139.txt
0b891d27b6e55e411b66560fa06ba224
d0d596c21f5ba49115ac35da18bec44c2e3ba82f
2224 F20101111_AAATHV liao_h_Page_111.txt
90e59102d169d06fc6290d2504cf7d50
bc459c37d499824156c180271c19c6f9e1e8de60
787151 F20101111_AAARYY liao_h_Page_067.jp2
8bbc377a7e2e5fce5c659dff670f22f4
faaba9a060184297278503f995eb0227a9608566
73754 F20101111_AAASFH liao_h_Page_065.jpg
a8a5b8b214ae4fbc421f4f1cce472d0a
6007b9d2fca248f93d60d8b2897dd2aa5bda7697
117327 F20101111_AAASET liao_h_Page_165.jpg
0a209030cca11671e5360f0b9da42870
41f8ba68b40156f109fd2056f9a9720d88f82ef7
38776 F20101111_AAARZM liao_h_Page_092.jpg
3a982446af2ff0e91059bfa55f29fd3d
c2cfb349e2dab7d69acc324646bf183d8adc9389
2226 F20101111_AAATIK liao_h_Page_140.txt
f66aacdf2e2b843fec56a6470dd883ab
160cde67ff1eb16685c3e4b87e6c18632c1fde77
2120 F20101111_AAATHW liao_h_Page_112.txt
83e13619d00ccda2d11876b2875770bf
21e55d19488ad454a72ca08a79dee6af34f9a11b
160425 F20101111_AAARYZ liao_h_Page_026.jp2
e13fef398ad064be74933940c2ae12c5
1cd5644fad2b14c317a981651971c2caa312d229
63959 F20101111_AAASFI liao_h_Page_166.pro
3be74a10f7b906609bbb34ee47159578
e90442c920252f025cfd83bee092091bdd2a6d79
F20101111_AAASEU liao_h_Page_060.tif
643c47b3dbf9526659153669a31f753c
4314292a2c3958e68031ecd8cfe0f795cdbee3df
60148 F20101111_AAARZN liao_h_Page_125.jpg
5ee4efe955477d8e7c92b499961567b2
e86e7e2ed66bd54d3ee41a62f264e53ea90245f8
F20101111_AAATIL liao_h_Page_141.txt
9c2c933fc02712969b7877de759d3ec7
3284ae43092f9b2aecbe6287f567cf4da1597130
134 F20101111_AAATHX liao_h_Page_116.txt
5a8d0a4f45ffb378464501ab2efb83f0
954203b0591a160d5b931048ccc4a3f0caf70095
5183 F20101111_AAASFJ liao_h_Page_046thm.jpg
63addf8ad1df89461427b63d795c5d3e
106db145c998dbb89210d5c2db99cddf88912e62
F20101111_AAASEV liao_h_Page_038.tif
165abaf9ea4b4e6bbd1dae5ea17c2f9d
e9918910964caa777d961bf6f9285c37efeeb3eb
2051 F20101111_AAARZO liao_h_Page_103.txt
7d9a828dd4d8cebae872a906257ba16d
fc56babde36a8f5ef8612ea4d63a04a79de12595
2831 F20101111_AAATJA liao_h_Page_164.txt
9768cf6be435e8d23b1746261d4ee05f
993826cb916dd52d237e0532006faa2073572811
697 F20101111_AAATIM liao_h_Page_142.txt
595738e73b18b43e8edba07b22bacbe2
7ab5e53f8c2f43e5212ea1dc4a89a96d8868666a
33552 F20101111_AAASFK liao_h_Page_145.pro
8ac5ffcde797060488cd78cd053744b2
bf79cf69cb4aced5a2fa64ac4b5b66f7fa7762a0
F20101111_AAARZP liao_h_Page_113.txt
71369110baa8de878b583afca8228560
851ddf4dd689e079f28224507e3c49e8a101e4cf
2768 F20101111_AAATJB liao_h_Page_167.txt
4c7adea2ce89825c094509f627ce7dc8
236b02bd64a3235756a3cb758be88d026b23145f
2918 F20101111_AAATIN liao_h_Page_144.txt
a1dedc0b50c3df8d7573a02930712e4e
ae6c7460549fba528ce5d1712cc7e036213f7999
1273 F20101111_AAATHY liao_h_Page_118.txt
bde39cdd61f4c9f45bc8b08e704a72b3
676dad9bbd250b4d448582dbc4a0050ff4c178ee
F20101111_AAASFL liao_h_Page_148.tif
701753248e5da201883aa9aac553e051
39e22ac49f80c733735654e0cfcd08fdd4ae78f2
6401 F20101111_AAASEW liao_h_Page_085thm.jpg
40aa7431928925b92fb6d0fbb841da42
1442f437e7fec7f534f277bd422fccbf5403e014
6791 F20101111_AAARZQ liao_h_Page_082thm.jpg
1f16ec8a23a8ee6d893370a17763f554
d851ed7bed14149c68f989c53e1f18dba78630d6
2733 F20101111_AAATJC liao_h_Page_168.txt
7a0a7c345d65255951c7f7437cb37ad5
59e5ad6ccd9e8fa84c6ac7387d0d18f4560db5f0
1495 F20101111_AAATIO liao_h_Page_145.txt
7b66e7a9300164bcaa2e3d1cff8d98f5
e0d55d5f2bc1156066fa5cb26aca7741c50f79e6
1135 F20101111_AAATHZ liao_h_Page_119.txt
4665aa49c0db117f6493b0455fa7ff88
7b28325b293e440582eb82167249eb0dd8b41f47
30323 F20101111_AAASFM liao_h_Page_164.QC.jpg
34f2f79a606f8026c04b75dbb04dd7d3
1a5a33255e7bb48f9abf59df64775df826bc25eb
1051932 F20101111_AAASEX liao_h_Page_141.jp2
d21bd289131fa76af467f8f3c84c0339
921ae56cc448839aab19dfd28968f79d52b479fd
2096 F20101111_AAARZR liao_h_Page_133.txt
a0b7186cde8e568d8d1685f5decb7820
19b11fbacd850ed0d0b5ebfed8beb3ca45a041d8
61805 F20101111_AAASGA liao_h_Page_072.jpg
b2fc29e8809733e2858f62654bbf0a0b
8c4ae38b394a792f5f087db554be22591e39c0dc
2591 F20101111_AAATJD liao_h_Page_171.txt
0d80f24684894f30dcbd7e8e00de629b
1e991cbd25825dc24341550784f9364e0367a2c0
1480 F20101111_AAATIP liao_h_Page_146.txt
d4bd549a3981fa6102cb1580338688ba
75c55435a69e721cb6ab520bc9c8baf0773efb5a
2171 F20101111_AAASFN liao_h_Page_100.txt
97e860b0626e5e7f8099e720724bdc74
63613ebcea9ebc889fa986626b0c9ae3dafd9330
51833 F20101111_AAASEY liao_h_Page_081.pro
34cea149ba80bb0c0bd3db20610f6b1e
d607d7d7f3e007b0d3f0284f034825050e10c887
982021 F20101111_AAARZS liao_h_Page_071.jp2
89dbb0c7ff146bbfda4c9efd3a142057
e8d7feca6ed77a956ccefe23251956ad3e6944db
1027996 F20101111_AAASGB liao_h_Page_104.jp2
da41330bdad353bea7a2e07a33c30c52
f7e96d3782c24babb21a38aedc6da18842f7a0e5
2750 F20101111_AAATJE liao_h_Page_172.txt
5792bd6be8e72e00bf3ff063173c4a69
8e52c95c55cd186a718aeb9de6a3750b5de29f5a
3397 F20101111_AAATIQ liao_h_Page_147.txt
6e5c81c652bf08c36a16de431a946012
e6cb547c14f5b5affe6abbd14a94237b63dcba6c
30056 F20101111_AAASFO liao_h_Page_167.QC.jpg
5776cfa8a88f50b2d42a2893b2106898
eacd6e5a0b6914621925cecda8f440b0e8276cb0
265 F20101111_AAASEZ liao_h_Page_026.txt
ebaf624e6e128a434c2842002d7c0551
b67324555cb1548a1dd17e5077e0b405253f5c99
38168 F20101111_AAARZT liao_h_Page_094.pro
eed393d1ab279d07ab99c2f80f305d3d
f8fb9832bda8878208fc2eb3de9c7aa4e5aa3414
33197 F20101111_AAASGC liao_h_Page_090.pro
8d559cdabbc4ce9fe645ca9d23a03fba
62058956db88e017280e530907ae79c262ea4651
1443 F20101111_AAATJF liao_h_Page_174.txt
eb2a6b9644113a9b3c48658b8dc440e0
beb5869177c8b54f63e908ac9a2a9f1f1e71e479
740 F20101111_AAATIR liao_h_Page_151.txt
6679ec3ce75aaa7dbcf35b2c80a34f3b
0b8c451233cfc8e325585a7c9fa5c34e094d5a11
52234 F20101111_AAASFP liao_h_Page_038.pro
a154966bf2a5d331a39b76f99e6157d1
60d2d28b6daedf819d507de125b421bc6456be6d
F20101111_AAARZU liao_h_Page_113.tif
3c500f1f16bd22ee42681068aeba6e40
b764a89e3de6de0a6fb939e221649f8627db489b
6944 F20101111_AAASGD liao_h_Page_168thm.jpg
1cf4dde424ab76126d715e431464af45
aee492cc9aafd72ab17eba943e9d0bb082b82f3c
648 F20101111_AAATJG liao_h_Page_175.txt
95583f9b59a4ec8559703a719e2318cb
8b0890c7bc66244581d19623324b3714390e5f30
4111 F20101111_AAATIS liao_h_Page_152.txt
28a987874ebafcb3c9faeaa2573e01c3
7a02e97ff0a6b709e9a77ecea4b71915523aa918
964211 F20101111_AAASFQ liao_h_Page_158.jp2
df4a43db10ca63823b0f9e2dfc4e8c53
9064b5007440311cc55332f489d5a0498f79bb0d
52074 F20101111_AAARZV liao_h_Page_015.pro
5387cd59b9cc0dfa67788556c3e0270a
7ea3068af2f7c52abaada3107dbceb6049f1644c
4613 F20101111_AAASGE liao_h_Page_158thm.jpg
b201c51d95c1815465466a1191e19170
ec47da3fcbe49cb8838a03c58ded34d27a7a51bf
1678 F20101111_AAATJH liao_h_Page_001thm.jpg
fe01d08cf3f5cd18dbfc3ece0b33d845
4d44cf70304e3fed248c7fced1db0523296b871a
745 F20101111_AAATIT liao_h_Page_153.txt
3a0d3ff748a5980f997550cad8397fc6
b43421777968d4ab323c6249e08110e7d1e20773
4699 F20101111_AAASFR liao_h_Page_117thm.jpg
c762370f4a3831af4e289d1b606b6eee
5a6df8bed6c31799d3c2ea2e60e2e4a0b8031750
52338 F20101111_AAARZW liao_h_Page_078.pro
984e3c307ed18a3455721f2d8682f536
47e84b1b1f76e5e388653dce5edf19c28d20a3bf
69876 F20101111_AAASGF liao_h_Page_164.pro
2d78ea21a58b2dae1976bbc9ec2e8432
d8940f89500ef3b343dbc31812368a0812cb9a1b
1019 F20101111_AAATJI liao_h_Page_002.QC.jpg
2760501d38711da420ce8ebae14ca200
e9aed81c3835f9fa40d8e98a67111f501fd7ad67
459 F20101111_AAATIU liao_h_Page_155.txt
6473c2388fbe611a76a00a86ef91e961
ddcb69a9805f4513fd4756ebf28929905b219272
53540 F20101111_AAASFS liao_h_Page_037.pro
6d3f0557ca12a5cf2f92273d3b5a3c9f
4e91fa1dc180af85f80b7eb274749b164c5e0378
F20101111_AAARZX liao_h_Page_015.jp2
0c78e44633b085211a9fc1b728509ca4
854705ae4ba49101b75d83ffd945d6f585bad0aa
12108 F20101111_AAASGG liao_h_Page_145.QC.jpg
25a8ab23dd025f85efd9bbcce6bf3b98
057c64bd2d0b755c273bb09c85e674d2e9974f9d
17597 F20101111_AAATJJ liao_h_Page_004.QC.jpg
a1743070c888baef7f39b30e254e6888
bf3debd27bcb56161c180a12b8774ce2bbabea79
842 F20101111_AAATIV liao_h_Page_158.txt
0d0a5285d5ca5114112498c0cc23db84
7a430d022982d9fce92c2f17a58594487352f01e
14390 F20101111_AAASFT liao_h_Page_047.pro
ab384406d221cdfd846c15085e64e335
0b01ebc79b97b2173d87653b693a273995e4c544
3071 F20101111_AAARZY liao_h_Page_119thm.jpg
e1770e3a48f1ab213dd7ace29d6d742e
afc4ce3e687178dadc63eb4ede9e742c41933061
6913 F20101111_AAASGH liao_h_Page_166thm.jpg
e93590b4adafc21a28061cf32ccb5086
d1f245cc661a93cc28b889864d6a0d843bafd0af
22672 F20101111_AAATJK liao_h_Page_005.QC.jpg
a97d48486570b2a4c1b9e107dc33c5d5
67340c14cad63c63593602a09fcfffb2912e4f70
501 F20101111_AAATIW liao_h_Page_159.txt
9f1a51ccc0d0a3c8e28cba33d447d58d
919766ab017d76f2b2ac0cd98123f21e9f660068
38163 F20101111_AAASFU liao_h_Page_154.jpg
a57ad05be6b01e31c82886f9399c76c3
1a1d5d762ae7e4011a994f2b99dffa801432d264
F20101111_AAARZZ liao_h_Page_160.tif
4eaf4300211fd23edaa04acbeb2e1770
265a893cbe2d6ef2eaa7852d0aa2f46cbd55bec9
1235 F20101111_AAASGI liao_h_Page_127.txt
3af3aa413a23f0315e5918e6bf7e948a
848b29666b6c3b459c050c23baf0c57efc197e1f
5321 F20101111_AAATJL liao_h_Page_005thm.jpg
29ec9c56682e4b8a4b505d95716074d0
88e29aa5f09a5ecf93a9513f7c4652d2a12e80d3
1690 F20101111_AAATIX liao_h_Page_160.txt
bf766f9879d3f8728fabecf91945543a
aa26325937a9b944dd493d688a41d711db82906c
37229 F20101111_AAASFV liao_h_Page_156.jpg
709032d3333ef5bc2a86d64a476c1aba
6584c888b7c93721b04832734c33d0c532c19ee9
F20101111_AAASGJ liao_h_Page_040.tif
209010b94502ef0c7688fea65e304a9c
366661bb40c2dc4e26f5f52004281bf87f2c2788
27386 F20101111_AAATKA liao_h_Page_016.QC.jpg
f0e79b4ae93d7a9f7a08e5c0e069636d
1ef3478ddb9e430e8b4ae9b137de2029e754d4d0
6585 F20101111_AAATJM liao_h_Page_006thm.jpg
65473be22e5af6f0dfe45ae2f23137d3
9aed9ecdcbd257c81f284d171849cd7c0a33b1f9
2495 F20101111_AAATIY liao_h_Page_162.txt
97631cd372ed06c3d54a6fdcf1904d32
d7339b4372a5f00660cabaae0f9f681fd5c74270
3132 F20101111_AAASFW liao_h_Page_010.txt
98a3406c07063cf49b9907a19a8ebe76
bc06c2eab351e712283a7db7e76fbaa6d328997a
24631 F20101111_AAASGK liao_h_Page_160.QC.jpg
f3036cf628abaa726bc1d83a0cc3a1f6
c74b73ea072629f2656b29b75e5166f5491370f4
6339 F20101111_AAATKB liao_h_Page_016thm.jpg
7f7d3e4823a8022f5c2c3f20644c805e
83a2df09cb075ab0990c9eb65702e5ae59af424a
6300 F20101111_AAATJN liao_h_Page_007thm.jpg
7c34ffc3a1931a5c15bb0cd243722077
3cdfe941b4edf4f77da4ef8d887156d087071af9
1051952 F20101111_AAASGL liao_h_Page_103.jp2
4752e8b0b7b09787af68dc70cc222dcf
d494d2818382457bdd53b29060442d507dfb5b99
27730 F20101111_AAATKC liao_h_Page_017.QC.jpg
83e2518d0f33179f15e35180fdf23399
5bb2ca8cea72cda4b7bb323864d8b8b8bc8d6058
4190 F20101111_AAATJO liao_h_Page_008.QC.jpg
09264b035ea49cc45914dd7cab888ee1
0b41fe398b41949b36d88ebf0cff6157ad746319
2631 F20101111_AAATIZ liao_h_Page_163.txt
4bd4520e1e337ddb34fe2790b9eaf33f
4253adece9b4f65e12f5c356f7be13385041a951
28169 F20101111_AAASFX liao_h_Page_112.QC.jpg
74be43f20e07767b03160766efa25810
fb8d986837294852c70945484faff58204cc4a5d
87743 F20101111_AAASHA liao_h_Page_081.jpg
54f5bc100c53842afe8ca2223e39be48
005b5dfa2beba1e487b7ae61e9a71588f12c7c19
12865 F20101111_AAASGM liao_h_Page_028.QC.jpg
5bd25a6aee13033d314ec0d06f4563cb
fd7681f6135b53ffe67ddd0ba6ed48a6534d3ccd
6565 F20101111_AAATKD liao_h_Page_017thm.jpg
d9670f8af51956e9afd362629a40f821
4d5817772b9777b8e977d5e2e2530a02c9528ca3
1272 F20101111_AAATJP liao_h_Page_008thm.jpg
bda76eaa4fffe7ed596c91c8f878e967
e3f71356f5461320a93f8fd3564245e41e069097
90154 F20101111_AAASFY liao_h_Page_042.jpg
e3caa2869567e6ea5e067f903f6ae092
3415e9552bcefa5040742f88a886c28a0274caad
21695 F20101111_AAASHB liao_h_Page_070.pro
fcdfd51a2560fd2f11b4a7e492f7d208
7e73f55e6357a91439fe34cebee853d80a415783
6606 F20101111_AAASGN liao_h_Page_128thm.jpg
69ce14ddc4bd4849eee4f994aca4348c
a8e5721c14d4b423b92c0e839b8b279118d63830
F20101111_AAATKE liao_h_Page_018thm.jpg
8050e5bcb6b62f84b43f3e2a62af8df0
2ba4478c09575e1d5860cf2593515b456522853e
16537 F20101111_AAATJQ liao_h_Page_009.QC.jpg
7fd01964d6d67df089a33c345991a32c
b07774335f4a9991a23c7e66b909d6c7bcdfcfdc
13537 F20101111_AAASFZ liao_h_Page_067.QC.jpg
b201218dcdba10538719a963eb26e1e1
94641e62aad93ce8cced95a76cb815569f47a6ba
31058 F20101111_AAASHC liao_h_Page_170.QC.jpg
85a67aa33ab9b5012bbe795d32450a1b
e414459d5643428c7990f13aa747bd2cfa4ea8ec
2582 F20101111_AAASGO liao_h_Page_156thm.jpg
bc8940ccf141b40ef2914396289bdd28
e2c76b41f47e53761cd6426156749f75336cc9fe
27050 F20101111_AAATKF liao_h_Page_019.QC.jpg
e53cfed2094ca1780df7fa55a6aa9c55
991f7997fbdff1e4bbb9a63942eb2fa0025b5b19
4248 F20101111_AAATJR liao_h_Page_009thm.jpg
2dbd314f07da4ba57102487f7eff4480
0c844272c0d1f8dc4a39f1522c0a7478fb3132b0
4478 F20101111_AAASHD liao_h_Page_006.txt
1a3b1799678da0bc5dd8fbbee8b7ba6c
3d698c171bfaddfbe1707f8d488b70ac3d7f231a
7203 F20101111_AAASGP liao_h_Page_164thm.jpg
22473da77eb92a26f6709d4d80bc65b3
bb499dd86a9210001e72014ce665f1673f81cf67
6415 F20101111_AAATKG liao_h_Page_019thm.jpg
8345c2ff9e268b835a91231fbaa86b2c
41c385cc471a00b7ac2b3919f61a03f544c0e2f6
29703 F20101111_AAATJS liao_h_Page_010.QC.jpg
fb25f1decd66eb58a2d879312be9b9b1
c62c0a288463493b114946899c93903e12740244
F20101111_AAASHE liao_h_Page_075.jp2
c2977510f854957466fc17330f7cfd13
d4d18b87da52749a3d7bf9c288db02abd9d71015
29203 F20101111_AAASGQ liao_h_Page_169.QC.jpg
93852b18e1d3a5cb8eb0edb64cdb552a
b83cb35b082c7a0a52b4e0a7f3c6144cd0283a96
28728 F20101111_AAATKH liao_h_Page_021.QC.jpg
d6f225a4ff86fd4e643c0c8f1fd96d10
f8e23c2968c1a2f87b901815d69187001c6b9f66
6886 F20101111_AAATJT liao_h_Page_010thm.jpg
43df1e682f335eba9671e0eee34ad801
715b2283d53cfa9d1818ba1606cfaa1dc9dcfee9
29262 F20101111_AAASHF liao_h_Page_157.jpg
0d1301b4366446db94650a61f48f003a
ab4876fda3900d378227ef8c8571580ac6310304
7051 F20101111_AAASGR liao_h_Page_165thm.jpg
f75e76c31b807b0240952d0efa44a2db
d0dc2add29e7ac115130d53456b8409815acc9d2
6431 F20101111_AAATKI liao_h_Page_021thm.jpg
30726cdbe77d2b15b4fb82aa2d42440c
dec0546978c2f78a0407d85a001089565fef1f34
31409 F20101111_AAATJU liao_h_Page_011.QC.jpg
1ee3648fd5a8d029698a52f3dbc030c8
11964258905a4451402250a7e24682cb8bbe72fc
F20101111_AAASHG liao_h_Page_029.tif
3f4ccd9d7ed70e22d46ce7a27d81f22e
dcf80f758881273bf055f4ba1081008c763de044
9229 F20101111_AAASGS liao_h_Page_001.pro
250105754deb037cb8c7677c0e11db03
2a2e51f79dce1af084c95a3e81497e5711ded835
6680 F20101111_AAATKJ liao_h_Page_022thm.jpg
d29a648f13e4950978daeb6065a60180
8d0b5ef8aabd45158c8f7bc8a7cbca34c16407e3
7260 F20101111_AAATJV liao_h_Page_011thm.jpg
3ee6d189a96b4786f3c819b7f20043a1
bb92ad10c39f2863cb45ef86f712ab4041f605a7
F20101111_AAASHH liao_h_Page_063.jp2
f13a42649cb8d308a4280c7349d3246c
cde4beacd8cf2eeb7017e7e10a6f12cfd43553c3
53521 F20101111_AAASGT liao_h_Page_102.pro
dbacfe7f58d71ed241d0a0dcd4836f54
f98089e1b2e1a1b678e4e26a6dbc2d8bd684a1b0
28372 F20101111_AAATKK liao_h_Page_023.QC.jpg
c05529842ad744ed14cc9e6604234d46
8421f08f282407aec9b29c431f2025358c97b975
F20101111_AAATJW liao_h_Page_012thm.jpg
19607877e83d15f40a4b45fbae75f851
c37ec089593ae324d3aad358e5aff523580afeed
F20101111_AAASHI liao_h_Page_019.tif
1ee56f59a2113406f6a6543e34319921
f5ebd5c9a54a8d78966fc0a8c46f78cdebc6cc9c
25431 F20101111_AAASGU liao_h_Page_144.QC.jpg
9798b04ea98f007421bb2ae56c164b86
2114cfc217417f6929def7cf2399ef7dda555ec9
28031 F20101111_AAATKL liao_h_Page_024.QC.jpg
0f546f448cc6377b3c65c871edeea34d
e7368db8773eb00db1f78c98366a710d69615e74
23379 F20101111_AAATJX liao_h_Page_013.QC.jpg
3268c0da98970ae57221c7774706d2dc
fef218e0a6941a2b9efec9b65cc81aa08050554c
F20101111_AAASHJ liao_h_Page_069.tif
ac2a5e3bdfb0670790fff3440439638e
a504acd433c4ccc08959372ffa905a6e16d7d521
2496 F20101111_AAASGV liao_h_Page_122.txt
a508b261011c48962e9ad99813b12aa3
0b87980600417b9eecd1faa918291358c8364c68
6622 F20101111_AAATLA liao_h_Page_035thm.jpg
a553152291849a7c90a30222132d6ea2
8058d2a15e116f469a5679150af4c065cca21900
6574 F20101111_AAATKM liao_h_Page_024thm.jpg
6a5f29bb73418ac090ca650fafe50dd9
7d0c530ef455606a62df3250df0a117cd843e2dc
5402 F20101111_AAATJY liao_h_Page_013thm.jpg
40c89381468684631682ef02f7a0d9dd
dba89dfb7de74d8dc67a1b983632b233463ee6e4
28844 F20101111_AAASHK liao_h_Page_045.QC.jpg
1b0e6da082345c7adc46df9b07f1d40f
3ad636ee35e35e51ba2b4e3c1c718b8ada170243
19831 F20101111_AAASGW liao_h_Page_049.pro
704f4c33723321d572bf9f156562b971
769b9adf653d6caf0e9c8c432fa44432e01f03de
28613 F20101111_AAATLB liao_h_Page_036.QC.jpg
dd53b9dbf287bf16a90e22ba99dbc8f3
b172cc1781bafdb93e09bdd64a9ae4f364bf600d
28968 F20101111_AAATKN liao_h_Page_025.QC.jpg
f6560ceeaf1eb0e4b8e2379ca12725e7
3a1bdd837e874095a76a549b921160560268b16c
6510 F20101111_AAATJZ liao_h_Page_015thm.jpg
eeee0f026aed5141fef7984de4f90f96
c03f4893a9dbaeb32e611116acc7e37315cc45e0
92795 F20101111_AAASHL liao_h_Page_064.jpg
664f3381695f720801fbfd47e6cf4794
a5b1f39f437170fd02f8aa38660abde92a728f96
F20101111_AAASGX liao_h_Page_033.tif
7e9f5c8957687d83be46b93720fcdc26
2b8f3b5967e90d4846ec1976f4747efbfdc2a430
27814 F20101111_AAATLC liao_h_Page_037.QC.jpg
0861bd27109e1e0f626cc42780d8970a
a8b42569dc1bb840037782580cbeded6e41a8238
6630 F20101111_AAATKO liao_h_Page_025thm.jpg
da4bf2e086491b19749130cc72a1316b
6e177114270251863f06abbe8ff67228554f4b12
F20101111_AAASIA liao_h_Page_132.txt
7ecbc156d1f4349ddc19a53d57783574
bc3565c0086c2d13fb007d88e361e8388c6b1f6f
F20101111_AAASHM liao_h_Page_105.tif
920e69eb4594b3ad9dd791a9d9f92c5e
a6ea76fe6ab86e2ec2def6857910a7d4c1178969
F20101111_AAATLD liao_h_Page_037thm.jpg
8d34163a04b8edd3d08f76dcb996f336
1258e715be03d370d202085b5c8524f5eb549f75
21615 F20101111_AAATKP liao_h_Page_027.QC.jpg
ae20fe12c3ab9e0bffad0a20ab93ffab
81963e32d8cda6f276af53e9040e5ddc33694b30
2088 F20101111_AAASIB liao_h_Page_024.txt
515784ca2486394645a3a79e5858b5db
6af89d010d8a8a4d3d03e42fcc9f7a277e6334c1
F20101111_AAASHN liao_h_Page_139.jp2
1e0bd2d7300b36f9be50cd02858df2e6
c7c33cbcb900bad99e7182b76e79aa71f6357ee2
29718 F20101111_AAASGY liao_h_Page_080.QC.jpg
3eb047334a650c81b278c29e4d1d130b
d7fa82749e74ff4ceb123ffe571ab9cac7ff0258
27496 F20101111_AAATLE liao_h_Page_038.QC.jpg
c189878f675cdf7d743955a7e1de7a47
51c23234eca977f0f365d76bf8ada2eeaeca30b8
6397 F20101111_AAATKQ liao_h_Page_027thm.jpg
f20da9e6b510841e2529865c7921e9da
d9488ecc771cdc18ea0cc657ca3f4c40159031a6
51131 F20101111_AAASIC liao_h_Page_057.jpg
44495b1bfde823bdaa15fc2d7230b7aa
09b32f805e394a970ab1e78760a38af16158bcca
6262 F20101111_AAASHO liao_h_Page_062thm.jpg
9e702db31d0cd9144f5ac8885169ef97
d43d941a2feb42ae21413905412a997e8c25c494
23825 F20101111_AAASGZ liao_h_Page_002.jp2
399a037de4594107d40ca7dbd7bf514e
57006be1109a8d8164392798b4125857d83a01ae
6540 F20101111_AAATLF liao_h_Page_038thm.jpg
0e70fbb11cf01818783dca18ac692dcb
47f9bd18b50cdbea08e823c7f9b63ad707a35b50
3819 F20101111_AAATKR liao_h_Page_028thm.jpg
ffa7bad2e55713b2b40056224fbaa558
9c9ceec0d72392a711c1b681f0f93b18d8c00086
F20101111_AAASID liao_h_Page_002.tif
b7f858d9baad82c7fd3d9a5776fb4659
48ef73e3c09e48214c9a65628d95101ad98aec51
F20101111_AAASHP liao_h_Page_045.tif
0ce93849fdcc3e1b53f94113c90629ca
8da45ef08d0a1e082730fd3567735750633be661
6110 F20101111_AAATLG liao_h_Page_039thm.jpg
22007de1d2cbae54d96dbf5eae3620ac
b7f45bb39a135c65fc5ceb4e571157fd55c493f3
8749 F20101111_AAATKS liao_h_Page_029.QC.jpg
26750497d2e9174e3d80ecba993bdfed
3ebffd0a8b382aed0145fe630317d5e9949454f0
53300 F20101111_AAASIE liao_h_Page_128.pro
7e964b9e47ce0c137134f81b3e615599
7cd01d48fd7c4da494fc7ddd72dbf89431b90f5f
6321 F20101111_AAASHQ liao_h_Page_073thm.jpg
4a582df80f6f6623d66a45b512d2d44c
11dc19c6c7868e12eb3814d683fb7a2ee6d677a1
28053 F20101111_AAATLH liao_h_Page_040.QC.jpg
09698263c4367709c13a26b1a8dfb3d6
c5186bbefa4c69e11a523959a259143960e6fb61
2340 F20101111_AAATKT liao_h_Page_029thm.jpg
909cca3a0523fee1151352520db5487a
2ec45c1cce6ec197f5ccdf71f1d1e0ea4a7e95c8
1110 F20101111_AAASIF liao_h_Page_073.txt
22180250c2a7a7cad38b3bb1c171512a
49ef2ae3e80cb3232129eee169837c04e169e3ae
17286 F20101111_AAASHR liao_h_Page_048.QC.jpg
5d1922b6a375ec48d395c9a73fd51038
db105d2e1b30443ad539a388f645a981ac508503
6859 F20101111_AAATLI liao_h_Page_041thm.jpg
7dda1a90e8002878440d77251e39d11a
02e0c4af8c637757802cd8c6e0d6b4a4bbf87bee
11056 F20101111_AAATKU liao_h_Page_030.QC.jpg
05f535ba17ddd3e4cfc53663fb806980
a18e86cc62279916f75279f73428075b379d38ae
F20101111_AAASIG liao_h_Page_015.tif
06a09d707739efdce4b15425442ec40e
88d5c2d4e3a270d6efbecd825c90029a972045a9
F20101111_AAASHS liao_h_Page_102.jp2
de4bad88e69082987b12f3cc5f1f1098
e0a3d24a984b0c07f1e52bb72edc2fc5cfcfb027
28544 F20101111_AAATLJ liao_h_Page_042.QC.jpg
29139ec6aaa0f5b64398bc0ac26d2c99
62a74d156a4443e1332f58298486afb15a3e42ee
30423 F20101111_AAATKV liao_h_Page_031.QC.jpg
de7ae5af76bccbb9615dcce930300646
6c2b6de1f700d4cc1ef6d1bc35dbe38e478278b6
F20101111_AAASIH liao_h_Page_112.jp2
e6a46c63fcb8bb92a7d6241e845614ea
e247a51b07ac4819dd9762d98ecb94625d31c8f3
F20101111_AAASHT liao_h_Page_103.tif
523b02737ae300f05a398ec9d159adc2
7f991f6b16ad6fb18c09e500510db28630d5ce33
6761 F20101111_AAATLK liao_h_Page_042thm.jpg
011f1e38e68d62272ecf85f5cd1e9aa9
c97174519d6a41be2b7db4464abfb15cb3888ba7
27863 F20101111_AAATKW liao_h_Page_032.QC.jpg
2a28a669251b58cb5d2858d7a59f82a9
772ce94ca39d746e2c1d1c430e85204bfd05be35
F20101111_AAASII liao_h_Page_073.jp2
1c9a61bf7ac347447bb60ccb60e1d3d3
b98209157017f5a90103c9e4724f70413fbec38f
F20101111_AAASHU liao_h_Page_025.tif
482ac134f51cbc1ec6f58b2817d88233
519c0e2d00750ab303fdd617e39254d2933b5210
6587 F20101111_AAATLL liao_h_Page_043thm.jpg
ef73c32e0a51092a95788b280c6af40e
34a76c53f156bd3abfb7a3f58ee7c8ca6e49c5c8
26464 F20101111_AAATKX liao_h_Page_033.QC.jpg
f3131a772afb04a6d8301992473b3f1a
0bd4507171fbaef7badce634348d80241964f810
22685 F20101111_AAASIJ liao_h_Page_098.pro
8230a6eb9bdd2d478bce69ae9f2ef3ed
a6c88938b15dde4df51981736c649c0334c4d6a8
55786 F20101111_AAASHV liao_h_Page_111.pro
d8ae2d383d38805bbb929de98f3196d1
d207bf0938f49f2d67ac5c5e76c57f1f08b625d1
22254 F20101111_AAATMA liao_h_Page_054.QC.jpg
1c93d71e3cd013d5fa26dbe8e2fa6ba4
e7f3481c8eed07c641ae9f2e6255d61b20290575
29629 F20101111_AAATLM liao_h_Page_044.QC.jpg
32c1ad41c695259f8180931aca34ad1a
a22781f0905423ba304c14681447737ce230c04e
28858 F20101111_AAATKY liao_h_Page_034.QC.jpg
82fafe641199f317022f45e81c8a6245
d6692ea453b0d2ba3c9ba8a7a8b6431d94abac6a
2177 F20101111_AAASIK liao_h_Page_105.txt
ecfbdee1ada7ed20c62b8528ca52cfc4
3672bad1875d2deb36bf63903ce02b3345f66252
F20101111_AAASHW liao_h_Page_012.jp2
98fc1f2792fe0c96082b56f9e2684efb
b311ed23d143644523ffd3e73fa9d48308267e2c
5861 F20101111_AAATMB liao_h_Page_054thm.jpg
ee2c342d182e02c3457d064791c8472c
af8acbdc852214d9d77f58b6ef1fbd0a6e99fb0c
F20101111_AAATLN liao_h_Page_044thm.jpg
5a1718dc035a0828f000c94b89b1d564
8590180d201951c198c04446fd4f96fd133c2c9d
29311 F20101111_AAATKZ liao_h_Page_035.QC.jpg
d36034bf3ca3adeec600944c4b2f4210
3ffebfc59c8b37a68b275bcdb745f938f292e0a6
F20101111_AAASIL liao_h_Page_162.tif
62ac9dbac03ba3a75477be28d4b95a33
d6908d0635b26df278c2b34c2c33deb53fd3296a
F20101111_AAASHX liao_h_Page_130.tif
352b89d308650db6d77e62fe567fb3d9
dd4a9169553b35450b4ba3381652683c0559175b
24245 F20101111_AAATMC liao_h_Page_055.QC.jpg
3b1be0cb1963be9a4f0a0e3b7a5421da
f56896968a66a2165a0dee88cb808f6615198dc1
6763 F20101111_AAATLO liao_h_Page_045thm.jpg
74bf3a3368d6205e04e1076cfdcbcfb0
2f22304970ad588c7389ffb3a578d3eb15fa9117
9370 F20101111_AAASIM liao_h_Page_118.QC.jpg
c9c8b7d58e5eff4804069b6f577e3290
c0a2e8a978e43bf94af581765b5cc0412e5ff6c4
858130 F20101111_AAASHY liao_h_Page_143.jp2
e4e34f7bc6769999731df9ad9f2f59b1
2b1980d4a06d41f93f53754e351f24d6b62f4537
5776 F20101111_AAASJA liao_h_Page_144thm.jpg
784fe0d9451d00ab70439db869333124
57e209f749ca5a9e8b16ced41ea13729f4f7dd3c
F20101111_AAATMD liao_h_Page_055thm.jpg
a97c2779cd6789eb58ebeec5ce9615e0
7c85cd537c1b30d53e5c6eafdc7347d621dcc64c
22339 F20101111_AAATLP liao_h_Page_046.QC.jpg
f77acff2417e8464a17748813bf6951a
5b63b5b38ef7a9ab330af3ef145f771f6501f5f9
530900 F20101111_AAASIN liao_h_Page_030.jp2
fe2d8ea423f4737161714450b20b102c
9c6d1bfa2fed5fd79ccbbea87f58b5f170d5e6da
5695 F20101111_AAASJB liao_h_Page_091thm.jpg
07fdaa87b74e35048654ba9e4954c075
f18e164205ee9e46cd23e0ce57bb9b0f83a783f6
16815 F20101111_AAATME liao_h_Page_056.QC.jpg
b7fc57c6042eb42a3a6df2b6df2929c1
d8bde7fb3ddc15a16387c4f34ec115b11ee2d95f
2735 F20101111_AAATLQ liao_h_Page_047thm.jpg
c64920c0d4294c68887484021376f556
0db70866db4ebce30f8e9d8a5c12683fe95eb2af
275390 F20101111_AAASIO liao_h_Page_001.jp2
f4fbb799243f655195d46b969cd1b326
a52553aa4a4e2a625565a352f27875622e05e7a5
3670 F20101111_AAASHZ liao_h_Page_069thm.jpg
b24e5cb615b4a4957714ef52fe809f83
5b3f0b6261446af2fb3fbfd395456b2a2078ec10
89097 F20101111_AAASJC liao_h_Page_110.jpg
ecbfd05f7efb1ffd89cc7d617c738af7
fd418a368cbac66fa9be60dba2d7b5bc2f06f08e
3989 F20101111_AAATMF liao_h_Page_057thm.jpg
ade49ff402cd08320f62ff4afdcaade9
fcdc232a3455b501010f7210142cf9b6d5afc126
4877 F20101111_AAATLR liao_h_Page_048thm.jpg
a85d4c5cd58d20fb9bea7fe60ce39500
4331a4781f08b0e7c8595830bfbe4e2f43cbc2c6
F20101111_AAASJD liao_h_Page_100.jp2
a519b1978205a4e2d741762f170563f8
145cf6c090bc5314dca500d45fa3075956ab6c60
1051956 F20101111_AAASIP liao_h_Page_021.jp2
490ad57bd507fafdb8acfa113b3754b0
cd292161f9de5f2872d3e447d374fb54dd2a508a
26112 F20101111_AAATMG liao_h_Page_058.QC.jpg
4a08ab085e55f932c9a729ca7c509c0d
51b688a3a038ec4ade3eb8e47bbd49972ba8db79
18310 F20101111_AAATLS liao_h_Page_049.QC.jpg
c509f620e6d425a5f22e076f1ddd43c7
16a45001d19fb7fb2f51c6ac0e25dd5ab0c0c712
1051912 F20101111_AAASJE liao_h_Page_128.jp2
b4f4d25e4c353ede8d5890d6c091e9ee
a0c7b131f3183b8978e0c3568af1e5fd3f7884b4
F20101111_AAASIQ liao_h_Page_121.txt
aa6ab6be834303bc3957e2eae152f423
dcd3948b481958bec0ada6caca7ed6777913588f
F20101111_AAATMH liao_h_Page_060.QC.jpg
d047c6c9193dd084deb8cb878197588a
8699be179e16f30f388f3347f453e9484247d5cc
5603 F20101111_AAATLT liao_h_Page_049thm.jpg
90262c44284095d6fc00fb52b3b7fe01
ae311d8dd109b2fd3b47cd9430f87b9864eae7ce
5611 F20101111_AAASJF liao_h_Page_052thm.jpg
53d59f93569aa3680ced490e67ff344e
1c58ef3de641596511acf9dae94884cd829bb670
6894 F20101111_AAASIR liao_h_Page_140thm.jpg
b3387fab72f976c57acba78fa1c1be12
f9122c3ba0c34385bfcfea6ce7f473058b098060
26817 F20101111_AAATMI liao_h_Page_061.QC.jpg
d6161f00fc6574b53c6e55dc9b8c94bd
74b87b621ad430ffb411459327f65912eaa09112
22411 F20101111_AAATLU liao_h_Page_050.QC.jpg
4a7ff314240c25e6621cf4044d58e170
9649956f53ad1a750fd81442bc3aa9a221135d24
F20101111_AAASJG liao_h_Page_031.tif
f5feee8c72c6524df833250346d9895a
4ae3d47cee3aeaa53c92a59f433ab764bdc5697a
65478 F20101111_AAASIS liao_h_Page_053.jpg
6fb2c6376ae6e3dd6d78567a3b21e964
b91b994eb2b3a1edec26a8888e31c9520802ebb9
25465 F20101111_AAATMJ liao_h_Page_062.QC.jpg
b36e9a76697b32f74af3914579aa9d69
8b54cbe62acae4bbd22ce7051f2d043caba449c2
6411 F20101111_AAATLV liao_h_Page_050thm.jpg
d1963bab8b48f184fb7798008f94b35a
d9fb5ebde1af877b01448704e0424d81432542e2
54617 F20101111_AAASJH liao_h_Page_075.pro
8e950d0d274bb7a0b64047a3c7bad8ea
b62d37d4c62b357b6e3c71fe8479714e59789510
38740 F20101111_AAASIT liao_h_Page_121.pro
f36977ae6c432c34041bd129643f4924
2573d20cc9183c094b4882d9b4d9b2c204d0d6a2
28519 F20101111_AAATMK liao_h_Page_063.QC.jpg
c0d99056487964e6bd5e7eb7557effb1
40a7193c31910736adb02ded46943eefb3d0096a
6716 F20101111_AAATLW liao_h_Page_051thm.jpg
1ea49b338640c974dbb95bdf54377dff
a6d9ddde9fc05ed6d6a6a5751415efe0e5ef3faf
F20101111_AAASJI liao_h_Page_020.txt
7f87768bfff2271d84f6e0ce0cac4d5f
b9b1bc92b81ddbba433ccb99953bb79d4140af98
53415 F20101111_AAASIU liao_h_Page_132.pro
d0dea0e2cccd9f7d0b1245c13e88a5b6
88e4aab13cb73bd604cd52951cc981d196866573
6615 F20101111_AAATML liao_h_Page_063thm.jpg
9bbbff9ce429e4955d7d528500bcc863
661622b883df81f99f4bd1b4032a6d5be3db9bbe
21007 F20101111_AAATLX liao_h_Page_052.QC.jpg
5d4ff15d1442755e5ab665379c46f705
31ff2aa2d04e94b373b055f87b430389041f8ea1
17131 F20101111_AAASJJ liao_h_Page_157.pro
372e28d8668b3cdc5447eeb6e88af367
4e871e81c376f346bf45424e049082604cb20436
F20101111_AAASIV liao_h_Page_020thm.jpg
b8d8b03aa337ed1ad2f6c83c3997b33d
da55eb3c150ba2c6ff68afa30cf2b2557592d8a4
6704 F20101111_AAATNA liao_h_Page_076thm.jpg
e0b8e2323ec403bcbb79b02febea3234
2b119f292eca684517468f5afc5dca2f01f95aff
29748 F20101111_AAATMM liao_h_Page_064.QC.jpg
204a52991f971ba547b2e5aeceb9f10b
20a29f432c509b33f6cfb07013de66a360cd7f0c
19355 F20101111_AAATLY liao_h_Page_053.QC.jpg
75cf5154788ed073f35caf7530960069
654942f9acb3de28beb7567cb6ffc321046ed2ef
F20101111_AAASJK liao_h_Page_167.jp2
06787d10a2deed227ce35850a8c23a17
2c9be9d5450d9c786d024f9496c05595ee9b0757
F20101111_AAASIW liao_h_Page_088.jp2
2959c827fced26f2ee12e8e9ae99191f
51e145392f3d09f36f0e5e82d39beb394680646e
29511 F20101111_AAATNB liao_h_Page_077.QC.jpg
b285cb1d1f0d3650d9a3aa35178bc75e
142c36f9ceae306d3c499aa70bc69de6aa906e06
6807 F20101111_AAATMN liao_h_Page_064thm.jpg
c4f1bd83809a406e7f75a76b280b404b
cebe029e850e795a63a072a962895df8f88c7c6a
5555 F20101111_AAATLZ liao_h_Page_053thm.jpg
35e90fa6bdbfcebe75ef5316f4680483
ddef3bebdd0aee26671601a3c51f63b4c2fda94f
27922 F20101111_AAASJL liao_h_Page_015.QC.jpg
b6ac8c72f1806f3ac0292640b35ff22d
6439ecc750c5784abcc841e70c808ba1723ef648
6555 F20101111_AAASIX liao_h_Page_110thm.jpg
afb1d1dc9ecb51f81a433f9fe41d2759
da3c3832446b83417e00bf181af02759537b2966
6773 F20101111_AAATNC liao_h_Page_077thm.jpg
20ef0c6a492c9efe6960162490b38948
3fd512e3e2321b39b9ebeb422549730ac5f0c854
5534 F20101111_AAATMO liao_h_Page_065thm.jpg
839f3e6b7f7f8899fb4c008b1ec8129a
05faef3e7bd71655247ad1aa0fd981d6ac75ae3f
6971 F20101111_AAASKA liao_h_Page_086thm.jpg
091e516b121e932022ed316901c1eafd
0e37afbd59d7f129601bffb260f751dae545c218
2586 F20101111_AAASJM liao_h_Page_169.txt
0dfe2ad196c2d722b2aea6b26ba76458
7a579e66677b0d414d6bcf6bfe7187e113b3cd91
90398 F20101111_AAASIY liao_h_Page_037.jpg
d63feb081944dc048664b11e29366999
26b573430683f0ba82cedd0f406549483381c209
29051 F20101111_AAATND liao_h_Page_078.QC.jpg
b763aa2e02ba7b4d7313bbd98c35343a
000ea778b09b0f78b1102c81ddca73883b87d59e
12244 F20101111_AAATMP liao_h_Page_066.QC.jpg
29dbf8b9db3ce9c26b16cf8449373bf3
2257c7d31958300a862f0f0641af0464ccefc05a
F20101111_AAASKB liao_h_Page_066.tif
52ccfb68dfe0b3bb3043822014b693a0
dca0aa30c98cf684d1d33b08787a19c8c99f73b8
F20101111_AAASJN liao_h_Page_102.tif
19f7bd6085063d01c4a53602c1f24d7b
f65e3c78cd02815de8dc61d877854e5695b283ed
1931 F20101111_AAASIZ liao_h_Page_131.txt
96cd2725a41b0b83a7858469cdead85f
33ecf056fc405250b29c16fc2da39e6c110ebbb9
6800 F20101111_AAATNE liao_h_Page_078thm.jpg
1a72155401ff10bda45d1de9fa8a157f
930f564f35aad6678d72b19963269bcf091e24e7
3332 F20101111_AAATMQ liao_h_Page_066thm.jpg
ad720398fd891b2ba9a0b8c25f96e44d
7e0c35fe3a91d020e1b11767d1d902a1b8786ea9
27717 F20101111_AAASKC liao_h_Page_007.QC.jpg
497ebe5dbc53fa6a5ab8984131e99166
d04161d0f5da43fb46caaaf72efceb7394dcea0a
68050 F20101111_AAASJO liao_h_Page_148.jpg
66116cd07fd391bda5c901edcbb91b27
a8d908b6cb84196d5d08baf61b528509e3318cfc
29825 F20101111_AAATNF liao_h_Page_079.QC.jpg
e07939ad17f79060ad459c5b5bab6ede
cabd48cc4ce8a8c434bbccd981e76a1987d257e7
11825 F20101111_AAATMR liao_h_Page_068.QC.jpg
eafe33d83fb81870917413b1424281e9
487f93f9d263fc1a2afc8fea95f35e72547bcd62
89 F20101111_AAASKD liao_h_Page_002.txt
212911f8b01abf0fcf5efb9cddb491fe
adb86da9823aa715ba148d54ec3fac249eda98f3
22003 F20101111_AAASJP liao_h_Page_119.pro
d49fe04344f00d36ea07d04bc7a3ee60
ecb6947fbbac6e131a462a8718fbe3c8bd874a80
6864 F20101111_AAATNG liao_h_Page_079thm.jpg
65118c03ea385054b5690aa085b1468e
2306d1a6c122e8a4abdf0db17f7dcac9c67803cf
3657 F20101111_AAATMS liao_h_Page_068thm.jpg
93e4f5678166f9baa512c7b94f16fa14
4a035ff68baf828ba97a215aa6814b877c4a60c9
7237 F20101111_AAASKE liao_h_Page_170thm.jpg
639c79ff532d074a896e1541b2b9b91b
f1fe309ee44adb0d1727d99d9d790018283893e4
4031 F20101111_AAASJQ liao_h_Page_005.txt
f00e13a2b40dd1d35eccc2719dc27979
76b752555f4c7475940fb2b5831eb8fae6cdef31
6774 F20101111_AAATNH liao_h_Page_080thm.jpg
0a7d8097204d322a2235e55d543ed4e5
a5e1fe8298e790465370fe1fb6b73c7dccd2cdd4
14966 F20101111_AAATMT liao_h_Page_069.QC.jpg
983d6169bdca75605e366277f4736240
0d8856a0c5f75635dbb662ef12fffcb9ae59e6bd
54968 F20101111_AAASKF liao_h_Page_113.pro
3a537a5a62ed7d674e04b7db8c2c991e
a84de203d0dfc74fd5cefcd33aade1b8b61ce65f
1923 F20101111_AAASJR liao_h_Page_148.txt
d63f74d497b8a34246087e93b76baa38
7155dd337fba7c8e269f4d1e2c0e1624d47baf08
28335 F20101111_AAATNI liao_h_Page_081.QC.jpg
9e5964a6de8b04abd4958f7b6f5f8e60
6303c489064931b57709827fbf00bde969b5e1c9
16966 F20101111_AAATMU liao_h_Page_070.QC.jpg
0381bd878c119a6ac0a3e29b2b2afa04
54b7b011ae4338a4a659e915a279a3006b0a0e02
F20101111_AAASKG liao_h_Page_147.jp2
43662bec686d621072daa46e83f1bc73
4a68fb882803dc8658148b8e8bea2e120a8419fb
92672 F20101111_AAASJS liao_h_Page_041.jpg
82be8b4d9aad2089011a9a91004c910e
c7ee4d1581a610d44a3e48afe1ddcdc83998ff31
29773 F20101111_AAATNJ liao_h_Page_082.QC.jpg
b83794f116e95231cda33ea3b0113bc8
2c5f4b11d6bed953205437eb9e893841c2b7462c
4742 F20101111_AAATMV liao_h_Page_070thm.jpg
e44c1d16daccb6bfb489e14329a8310a
a25b5308934d2141b065493e488dfe1e5d04c7be
F20101111_AAASKH liao_h_Page_031.pro
f1669b8356d74973aa5977bb6c0c42be
b51ee385a99271a07e544ee45046cbef5cdba85d
14275 F20101111_AAASJT liao_h_Page_151.QC.jpg
48ef4ece21161d7890bdfd2eb40ec6c0
36d0c50c9a3cc1a516ed94f48c426996431b66ca
27051 F20101111_AAATNK liao_h_Page_084.QC.jpg
dde3152c50f946b8fae75281d0bf747c
c63d6a04b419708c66afec14a2fac95aa979ca31
6014 F20101111_AAATMW liao_h_Page_071thm.jpg
6c6955b0de81361563ddd5d75e3c3b92
8280c4b494ba8c57cd14561fb0520a7781745aaa
2135 F20101111_AAASKI liao_h_Page_045.txt
0e1b8f03e303e127760987ce0b44bb68
d6dafa7e9fde7bb38933700c0b3da54a8021d0f5
7215 F20101111_AAASJU liao_h_Page_001.QC.jpg
e5101bf85d117eabaf7cbbf2cd9b3049
756a31ebaa97805cdaabd4dc04aaf036644bf2dc
F20101111_AAATNL liao_h_Page_084thm.jpg
b5d572f0275cf9dc050c6588d82ab775
d82ca4ccdb42f23f80de36ee501996875d350904
28129 F20101111_AAATMX liao_h_Page_074.QC.jpg
1f70192fcdd28a9f013468ed832c0e81
b2e9b594c8fd3db10cca934b7e3a98448dad55c5
39676 F20101111_AAASKJ liao_h_Page_028.jpg
018037252c852cd420371aa9c2ddb72d
72c5b11260432bb249a7534cba3ac0f70687398a
105671 F20101111_AAASJV liao_h_Page_007.pro
67edfcbcf56f9957a25185d2ed974617
08104cfa1c19748a1cd69ef291d1ce255a49cf91
5704 F20101111_AAATOA liao_h_Page_096thm.jpg
703060424c3ed1e4a225334df4383ea1
98ae11d85baf424819524b8364331f829c9897bf
29831 F20101111_AAATNM liao_h_Page_086.QC.jpg
fe85963c15144db1aea9bed3c80f4282
6a04ac0454d2d366dc2c713cc4b53180c96ce5ff
28617 F20101111_AAATMY liao_h_Page_075.QC.jpg
59d45bf52d6c43c75294bfa658d56bc6
afe54e6639e832fb18872b320e9dcf1518e00cf0
3903 F20101111_AAASKK liao_h_Page_067thm.jpg
079efa05e673a300382d2a990f27a1e0
33ed8926350c95ce70fb46b514ec02da6ab20742
1935 F20101111_AAASJW liao_h_Page_055.txt
23f421a44bbcc1da7fe990924003074c
b82edc2999a5ad42bd68a22eeb8d8959bf5769b4
7045 F20101111_AAATOB liao_h_Page_097thm.jpg
785e2f76aa0cebf170696b36f122db37
d8a3d4ebb044a32c4822262b8811b99778561f12
6677 F20101111_AAATNN liao_h_Page_087thm.jpg
fbd6fe5e3a7efd1adcd3d282d6ee19b1
ccf9f20a41c09aca375d90bd38612cffc06caef6
6727 F20101111_AAATMZ liao_h_Page_075thm.jpg
a8feb1b77dde9dc6a4e2f41975c52ef5
fed9b5b0f09ad4f9e8e823335567013359413a33
2094 F20101111_AAASKL liao_h_Page_017.txt
b4a19361a393a652be1ba33f6880d066
a92bc236eb13b39c9c6bc8133b4aeb77d17b7816
104117 F20101111_AAASJX liao_h_Page_005.jpg
5bbb8c7a354c07c9f292269b58e92cfe
1c79173de55e67606b0d0ac087b35b3d968da5a9
6056 F20101111_AAATOC liao_h_Page_099thm.jpg
e745ae193435fbd970a5f8aa41be7eb4
939f8fc6c9b1eb105ee2ca16c187dbee5a883d5a
28119 F20101111_AAATNO liao_h_Page_088.QC.jpg
7ecd0e931fdd89364d33d94ad6e588ed
df916cccade6438724bd235e902867b145b0090e
46039 F20101111_AAASKM liao_h_Page_145.jpg
e61df99a7863da7c0ec84916a62541d3
35ee0a20bfee5676ca4b0273b2c5103fbc7acaae
1916 F20101111_AAASJY liao_h_Page_039.txt
89448d56273c5491ed18397868a691cf
75609b2e9ea0ac25afc07f814bd49925c15c7254
F20101111_AAASLA liao_h_Page_129.tif
e9ef9519a9c148d017ad025f46b97b85
3f60017cce799172cb6f65f29aea2aa7a1267d52
6532 F20101111_AAATOD liao_h_Page_100thm.jpg
4656de93282a46f00d69c0d145b3e235
b4f822a38f090e57b0773755e544d9912f6effb2
6692 F20101111_AAATNP liao_h_Page_088thm.jpg
15beb9cf3d98279a77e6ceca3115b748
ac69f0a449675f2794835253ce52c2e24263ce9d
28609 F20101111_AAASKN liao_h_Page_132.QC.jpg
515f6c4487e1754b9db408353deda3a7
de94569d47d35ada430a8a21099c42301996cd1d
28108 F20101111_AAASJZ liao_h_Page_018.QC.jpg
a4337447b93481c1b3ddb421b06504cd
5c6522263c63415ab463eb770e93ce6508b35eb9
1084 F20101111_AAASLB liao_h_Page_149.txt
582a884e18c0d8447235d2ff9500007b
9c80c4cb4d9e614c8981bac6b473d05d740528d4
6770 F20101111_AAATOE liao_h_Page_101thm.jpg
f6dcd59562085aefe602417d514273d6
73f81b73368ee15b3c1314e5f4049ee2a82640f2
18625 F20101111_AAATNQ liao_h_Page_089.QC.jpg
960589a3d32e2a70e4f51c725a1761e6
e7edc39761dba18060c911ded17000a3a32e9dcc
2102 F20101111_AAASKO liao_h_Page_040.txt
955c8b3068517017b80753e2219820f7
9edcc203997cbd0204a230e7a492da778c2ebc99
47476 F20101111_AAASLC liao_h_Page_099.pro
589115c39fe6238988cb1ca6f5d8c571
87c4ea951446fc6dbf3b1b067df8cf885998427e







MOLECULAR AND GENETIC DETERMINATION OF THE ROLE OF ELSINOCHROME
TOXINS PRODUCED BY Elsino fawcettii CAUSING CITRUS SCAB





















By

HUI-LING LIAO


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008


































2008 Hui-Ling Liao


































To my grandmother, Ma-Men Liao, who always supports my educational pursuits









ACKNOWLEDGMENTS

I am grateful to several individuals who have helped me towards my education.

I would like to thank my advisor, Dr. Kuang-Ren Chung, for his wise guidance towards

my accomplishment. The excellent projects and the brilliant suggestions he gave sparked my

interest in research to a great extent.

Many thanks to all my supervisory committee members, Dr. Jacqueline Bums, Dr. James

Graham, and Dr. Jeffrey Rollins, for their sage counsel and help throughout my studies and

dissertation process.

A very sincere and warm gratitude goes to all my lovely friends that I have made in

Gainesville and CREC. Their love is the key factor supporting me over the past four years when

my family is million of miles away from me. A special thanks to my roommate, Karthik, who

took care of me like his family.

I thank my father- and mother-in-law for taking care of my lovely daughter, Chin-Chin, so

that I can be involved in research without being worried about anything. Much love and thanks

to my husband, Chih-Ming, for his constant support and encouragement.

Most importantly, I would like to give my heartfelt thanks to my grandma for the sacrifices

she has made to support me towards my education.









TABLE OF CONTENTS

page

A CK N O W LED G M EN T S ................................................................. ........... ............. .....

LIST OF TA BLES ......... .... ..... ..... ................................................................. 9

LIST OF FIGURES .................................. .. .... ..... ................. 10

A B S T R A C T ............ ................... ............................................................ 13

CHAPTER

1 INTRODUCTION AND LITERATURE REVIEW ............................................................15

Biology of Elsinoefawcettii Causing Citrus Scab............................................. .................. 15
Symptoms, Disease Cycles and Disease Control of Citrus Scab Caused by Elsinoe
faw cettii ............... ..... ..... ..............................................17
Symptom s ............... ............ ............................... ......... ... ...... .. 17
D disease C y cle ................................................................17
D ise a se C o n tro l ............................................................................................................... 1 8
Secondary M etabolites of Fungi ........... ................. ................. ..................... ............... 19
Secondary Metabolites of Fungi ............. ......... ........... .... ............... 19
Elsinochromes Produced by Elsinoefawcettii ..................................... .................20
P olyketide B iosynthesis........ .............................................................. ..... .... ... ..2 1
G e n e C lu ste rs ............................................................................................................. 2 4
Research Overview........... .......... ........... ... .. .... ...... .... .......... 25

2 CELLULAR TOXICITY OF ELSINOCHROME PHYTOTOXINS PRODUCED BY
Elsino face ttii ......... ...... .......... ...... ......................... ............... 32

Introduction ................ ........................................33
M materials and M methods ........................................ .......... ...... ........ .. 34
Biological Materials and Cultural Conditions.........................................34
Isolation and Analysis of the Red/Orange Pigments ........... .....................................35
Toxicity A says to Plant C ells......................................................... .................... 36
Detection of Singlet Oxygen and Superoxide Ions ............................... ............... .37
Determination of Electrolyte Leakage......................................................... 38
Statistical A n aly sis ................................................................39
Results .................... ....................... ...... ..... .... ...............................39
Isolation and Characterization of ESCs from Elsinoefawcettii ...............................39
Toxicity of ESCs from E. fawcettii to Host and Non-Host Cells..................................40
Antioxidants Reduce ESC Toxicity........ ........... .. ......... ....................... 40
E SC s are Toxic to Citrus Leaves.................... ........... .......................... .................... 41
Production of Reactive Oxygen Species by ESCs ......... .....................................41
Electrolyte Leakage Induced by ESCs ........................................ ........................ 42
D isc u ssio n ...............................4........... ............................................... ... 3









3 ENVIRONMENTAL FACTORS AFFECTING PRODUCTION OF
ELSIN OCHROM ES BY Elsinoefawcettii ................................................. ..................... 58

In tro d u ctio n ................... ...................5...................8..........
M materials and M ethods .......................................... ...... ...... ...................... ............... 60
Fungal Strains, Maintenance, and Culture Conditions................ ...............60
ESC Purification and Quantification................. ...................................61
Statistical A n aly sis ................................................................6 1
P reparation of C hem icals ........................................................................ .................. 6 1
Results and Discussion ...................... ................... ........... .. .. .................62
Fungal Growth and ESC Production in Response to Light, Media Components and
p H ...................................... .. ....... ... ...........................................6 2
Carbon Sources on Fungal Growth and ESC Production..........................................63
Effects of Inorganic and Organic Nitrogen on Fungal Growth and ESC Production .....63
Effects of Antioxidants on Fungal Growth and ESC Production ....................................64
Effects of Ions on ESC Production................................................... .................. 64
Co-culturing Enhances ESC Production ........................................ ...... ............... 65

4 GENETIC DISSECTION DEFINES THE ROLES OF ELSINOCHROME
PHYTOTOXIN FOR FUNGAL PATHOGENESIS AND CONIDIATION OF THE
CITRU S PATHOGEN Elsinoefawcettii .................................................................. ...... 74

In tro d u ctio n ................... ...................7...................4..........
M materials and M methods .................... ............................................................... ....... .. ... 76
Fungal Isolate and Growth Conditions................................ ......................... ........ 76
Extraction and A analysis of ESC Toxins.................................... ................................... 77
Molecular Cloning and Analysis of the EfPKS] Gene .............................................77
T targeted G ene D disruption ....................................................................... ..................78
G enetic Com plem entation ......... .. ....... ............................................... ............. 79
Miscellaneous Methods of Processing Nucleic Acids............... .................80
Preparation of Fungal Inoculum and Pathogenicity Assays........................... .........80
Results ............... ................................... ................. .... 81
Cloning and Characterization of EfPKS] Gene.......................................................81
Promoter Analysis of EfPKS] Gene.......................................................................... 82
Expression and Regulation of EfPKS] Gene and ESC Production..............................82
EfPKS] is Required for ESC Production ................................. ..................83
Disruption of EfPKS] Reduces Conidiation..... .................. ...............85
The EfPKS] Gene is Required for Full Virulence....................................................85
D isc u ssio n ................... ........................................................... ................ 8 6

5 CHARACTERIZATION OF A GENE CLUSTER REQUIRED FOR THE
BIOSYNTHESIS OF ELSINOCHROMES BY Elsinoefawcettii ................................. 99

In tro du ctio n ................... ...................1.............................0
M materials and M methods .............. .. ................... .... ...................... .. ...... ... .. ............. 10 1
Fungal Strains, Their Maintenance and Extraction/Analysis of ESC Toxin............... 101
Chromosomal W walking and Sequence Analysis............................................... 101


6









Targeted Gene Disruption and Genetic Complementation .......................................102
M molecular Techniques ................................................................. ....103
Conidia Production and Pathogenicity Assays.................................. ............... 104
N u cleotide Sequ ences.......................................................................... ......... ........... 104
R esu lts ..................... ......... ....... ........ ...... ............... ... ................. ...............10 5
Sequence Analysis and Determination of Open Reading Frames (ORFs) ....................105
Expression of Putative ORFs and ESC Accumulation ............................................... 106
Promoter Analysis for Identifying DNA Binding Motifs................................... 107
Targeted Disruption of the TSF1 Gene and Genetic Complementation........................108
Gene Regulation by TSF1 and Feedback Inhibition ....................................................110
D iscu ssio n ............................................................. ...... .......................................... 1 1 1

6 GENETIC AND PATHOLOGICAL DETERMINATIONS OF Elsinoefawcettii FIELD
ISOLA TES FROM FLORID A .............................................. ....... .............................. 128

Introduction ................... ........................................................ ................. 128
M materials and M methods .................................................................................... 130
Fungal Isolates and Growth Conditions ............................................. ............... 130
Extraction and Analysis of Elsinochromes (ESCs)...................................................... 130
Production and Germination of Conidia .......... ........... ............... .. ............... 131
P athogenicity A ssay s............ ... .............................................................. ....... .. ...... 13 1
Enzym atic A activity A ssays...................... ..... .. .......... ............... ................... 132
PCR-Restriction Fragment Length Polymorphism (RFLP) and Sequence Analysis
of IT S and P-tubulin G enes.......................................................................... ..... 133
Random Amplified Polymorphic DNA (RAPD) ..................................................134
Miscellaneous Methods of Processing Nucleic Acids............................................... 134
Results .............................. .......................................... 135
M orphological Examination...................... ....... ............................. 135
P athogenicity A ssay s............ .......... ........................................................ .. .... .. .... 135
Production of ESC Toxin in Culture .......................... ............ .. ............. .. 136
Extraction of ESCs from Scab Lesions ....................... .................. ............... .... 136
Further Characterization of a Nonpathogenic Elsinoefawcettii Isolate ........................137
Alterations in Hydrolytic Enzyme Activities ....................................... ..................137
Production of ESC and Expression of the EfPKS] gene in the Nonpathogenic
Isolate (Ef41) .................... ........................... ...... ...... ................. 138
Co-inoculation of Two E. fawcettii Isolates Reduces Lesion Formation .......... ......138
Molecular Evaluation of E. fawcettii Isolates............... .................... 139
D iscu ssion ............... ..... .... ............. ............................................140

APPENDIX

A SUPPLEMENTAL DATA FOR CHAPTER TWO ................................................. 153

B SUPPLEMENTAL DATA FOR CHAPTER THREE .......... ......................................154

C SUPPLEMENTAL DATA FOR CHAPTER FOUR ................................ .....................155









D SUPPLEMENTAL DATA FOR CHAPTER SIX.................................... ...............157

L IST O F R E F E R E N C E S ......... .. ............. .......................................................................... 162

B IO G R A PH IC A L SK E T C H ............ ........................................................... .......................... 175



















































8









LIST OF TABLES
Table page

3-1 Effects of ions and EGTA on ESC production by Elsinoefawcettii ..............................66

4-1 Conidial production in axenic cultures and pathogenicity assays on detached rough
lemon leaves by inoculating with agar plugs cut from cultures ofElsinoefawcettii
wild type (WT), EfPKS] null mutants (Dl, D2, D3, and D4), and strains (Cl and C2)
expressing a functional copy of EfPKS .................................................. ............... 90

5-1 Elsinochrome (ESC) biosynthetic gene cluster and adjacent EJHPl-4 genes encoding
hypothetical proteins in Elsino fawcettii ............ ...................... ................ 117

5-2 Promoter analysis of genes in the elsinochrome (ESC) biosynthetic gene cluster of
E lsino faw cettii ...................................... ............................... ................ 119

6-1 Pathogenicity and production of elsinochromes (ESCs) in vivo and inplanta by
different field isolates ofElsinoefawcettii ........................................... ............... 143

6-2 Sequence identity (%) of fungal partial P-tubulin gene................................................ 145

B-1 Effects of ions on ESC production on CM by E. fawcettii........ ... ............... 154

C Sequences of prim ers ..................... ...................................... ..................... 155

D-l Germination of Elsinoefawcettii isolates on detached leaves of rough lemon and
g ra p e fru it ................................................... ...................... ................ 1 5 7









LIST OF FIGURES
Figure page

1-1 Symptoms of citrus scab caused by the pathogenic fungus, Elsinoefawcettii ................27

1-2 Life cycle of Elsinoefawcettii, the causal agent of citrus scab. ......................................28

1-3 Structure of elsinochrom es. ...................................................................... ...................29

1-4 Proposed model for the formation of activated oxygen species by photosensitizers ........30

1-5 Biosynthesis of fatty acid and polyketide in fungi.................................. ............... 31

2-1 Thin-layer chromatography analysis of elsinochromes (ESCs) produced by Elsinoe
faw cettii ............... ....... ..... ......... .. ............................................47

2-2 Absorption spectrum of the acetone crude extracts of ESCs ..........................................48

2-3 Chemical properties of phenolic quinines of the acetone extracted ESCs ......................49

2-4 Reduction of live cells of citrus protoplasts, tobacco protoplasts, or suspension-
cultured tobacco cells treated with elsinochrome (ESC) phytotoxins ............................50

2-5 Cell viability of citrus protoplasts after treatment with elsinochromes (ESCs) isolated
from Elsinoefawcettii with and without antioxidant compounds ...................................51

2-6 Cell viability in suspension-cultured tobacco cells by elsinochromes (ESCs) with
antioxidants ............. .. ................. ............. .......................... 52

2-7 Development of necrotic lesions on detached rough lemon leaves after a 10-day
application of elsinochromes (ESCs) from Elsinoefawcettii, and prevention of
necrosis by co-application of antioxidants........................... ....................... ............... 53

2-8 Development of necrotic lesions on detached rough lemon leaves 10 days after
application of elsinochromes (ESCs) from Elsinoefawcettii and prevention of
necrosis by co-application of superoxide dismutase (SOD) or hyperoxidase ...................54

2-9 Superoxide production assays based on the reduction of nitrotetrazolium blue
chloride (N B T ) as sub state ...................................................................... ...................55

2-10 Oxidation of cholesterol by photosensitizers: hematoporphyrin (HP), cercosporin
(CR), and elsinochrom es (ESCs) under light................................... ....... ............... 56

2-11 Leakage of electrolytes from illuminated rough lemon leaf discs treated with
elsinochrom es (ESCs) ........ ............................................. ..... ......... 57

3-1 Effects of light and medium compositions on fungal growth and elsinochrome (ESC)
production by E. fawcettii ........................... ................ .......................67









3-2 ESC accumulation and growth of E. fawcettii at different pH on MM .............................68

3-3 Effects of various carbon sources on fungal growth and ESC production by E.
fawcettii assayed on CM m medium ....................................... .... ............................. 69

3-4 Effects of nitrogen sources on fungal growth and ESC production by E. fawcettii
assay ed in M M m medium ......................................... .... .................................................. 70

3-5 Effects of antioxidatants on ESC production by E. fawcettii in MM medium ..................71

3-6 Inhibition of ESC production by Ca2+, Co2+, and Li2 in E. fawcettii ......................... 72

3-7 Effects of the number of fungal colonies and the distances on ESC production by E.
f a w c e ttii ......... ..............................................................................................7 3

4-1 Putative polyketide synthase, EfPKS 1, in Elsinoefawcettii...................................91

4-2 Promoter analysis of 1.1 kb sequences upstream of the putative ATG translational
start codon of EfPKS] ....... .......................... ........ ...... ........ ........ ........ .... 93

4-3 Differential expression of the EfPKS] gene encoding a fungal polyketide synthase
and accumulation of ESC phytotoxins in a wild-type isolate Elsinoefawcettii ...............94

4-4 Strategy of EfPKS] targeted disruption in Elsinoefawcettii ..........................................95

4-5 EfPKS] gene expression and ESC production in EfPKS] disruptants ...........................96

4-6 Pathogenicity assays on detached rough lemon leaves inoculated with agar plugs of
wild type, four EfPKS] disruptants, and two strains expressing a functional EfPKS]
gene of E lsino faw cettii ............................ ..............................................................97

4-7 Pathogenicity assays using conidial suspensions of wild type, the EfPKS] disruptant,
and the complementation strain of Elsinoefawcettii on detached rough lemon leaves.....98

5-1 Elsinochrome (ESC) biosynthetic gene cluster.............. .............................................. 120

5-2 Northern-blot analysis of gene expression and elsinochrome (ESC) production in
response to nitrogen, pH, and glucose in Elsinoefawcettii ..........................................121

5-3 Targeted gene disruption of TSF1 encoding a putative transcription regulator which
contains dual Cys2His2 type zinc finger and GAL4-like Zn2Cys6 binuclear cluster
DNA-binding domain using a split-marker strategy in Elsinoefawcettii........................122

5-4 TSF1 gene expression and ESC production in TSF1 disruptants ..................................123

5-5 Northern-blot hybridization indicates that the Atsfl-disrupted mutants failed to
accumulate the EfPKS1 and reduce production ofRDT], PRF1 and EJHP1
transcripts ................. ..................................... ........................... 124









5-6 Northern-blot hybridization indicates a feedback inhibition of the ESC clustering
genes in Elsino fawcettii.............................. ......................................125

5-7 Hypothetical reaction pathway for the formation of elsinochromes (ESCs) by
function of the ESCs biosynthetic clustering genes....................................................... 126

5-8 Hypothetical signal transduction and regulatory controls for ESC biosynthesis and
accumulation ..................................... .................................. ........... 127

6-1 Thin-layer chromatography analysis (TLC) of ESC phytotoxins (the red/orange
pigments) extracted from affected rough lemon leaves inoculated with different
isolates of Elsino faw cettii ........................... ...... ......................................... 146

6-2 Determination of extracellular enzyme activities in different isolates of Elsinoe
faw cettii ............... .... .. .... ... ............... ..................................147

6-3 Alleviation of symptom development by co-inoculation of two Elsinoefawcettii
isolates........ ................................ ................................................ 14 8

6-4 Electrophoresis of the amplified internal transcribed spacer (ITS) rDNA fragments
after cleaved with restriction enzymes on 2% agarose gels..........................................149

6-5 Electrophoresis of the amplified partial 0-tubulin genes digested with restriction
enzym es on 2% agarose gels............................................. ......................................... 150

6-6 Electrophoresis of the randomly amplified polymorphic DNA fragments (RAPD) on
2% ag aro se g els ......................................................................... 15 1

6-7 Comparison of the internal transcribed spacer 1 (ITS 1) sequences between Elsinoe
fawcettii Florida isolates and other Elsinoe spp. and other species belonging to the
order of Loculoascomycetes via phylogenetic analysis............................152

A-i Spectrophotometric absorbance of elsinochromes (ESCs) treated with 3-(N-
morpholino) propanesulfonic acid (MOPS) buffer, nitrotetrazolium blue chloride, or
both M OPS and N B T at 560 nm ............................................. ............................. 153

C-l Strategies to obtain full-length of EfPKS............... .................. ...............156

D-l Elsinoefawcettii hyphae observed using a light microscope..................................... .....158

D-2 Variation of fungal colony under a dissection microscope........................................ 159

D-3 Alignment of nucleotide sequences of fungal partial 0-tubulin genes............................160









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

MOLECULAR AND GENETIC DETERMINATION OF THE ROLE OF ELSINOCHROME
TOXINS PRODUCED BY Elsinoefawcettii CAUSING CITRUS SCAB

By

Hui-Ling Liao

May 2008

Chair: Kuang-Ren Chung
Major: Plant Pathology

Citrus scab disease, caused by the fungus Elsinoefawcettii (Bitancourt & Jenkins), affects

all varieties of citrus, resulting in serious fruit blemishes and economic losses in Florida. My

study focused on genetic determination of the role of elsinochrome phytotoxins produced by E.

fawcettii.

Results indicated that elsinochromes function as photosensitizing compounds that exert

toxicity to plant cells due to production of reactive oxygen species such as singlet oxygen and

superoxides. Upon irradiation to light, elsinochromes alone rapidly killed suspension-cultured

citrus and tobacco cells, induced necrotic lesions on rough lemon leaves, and provoked a steady

increase of electrolyte leakage. The toxicity was drastically decreased or alleviated by the singlet

oxygen quenchers, such as bixin, DABCO, or reduced glutathione. Accumulation of singlet

oxygen and superoxides induced by elsinochromes after irradiation was also detected.

An EfPKS] gene encoding a fungal polyketide synthase (PKS) was cloned and

characterized from E. fawcettii to confirm the roles of elsinochromes in fungal pathogenesis and

lesion formation by genetic disruption and complementation strategies. In addition, accumulation

of the EfPKS] transcript and elsinochromes by the wild-type strain were coordinately regulated









by light, carbon, nitrogen and pH. The results clearly indicate that elsinochromes play a

consequential role in fungal pathogenesis.

The genes involved in the biosynthesis of fungal secondary metabolites are often clustered.

I sequenced a 30-kb region beyond EfPKS] and identified nine putative genes; some of them

encoding polypeptides are likely required for elsinochrome biosynthesis and regulation. In

addition to EfPKS], five genes, RDT1 encoding a reductase, OXR1 encoding an oxidoreductase,

TSF]encoding a transcriptional factor, ECT1encoding a membrane transporter, and PRF1

encoding a prefoldin protein subunit were identified. Other four genes (designated as EfHPl-4)

encode hypothetical proteins that are likely not associated with biosynthetic functions. The

involvement of these genes in elsinochrome production was evident by analyzing the TSF1 gene

encoding a putative pathway-specific regulator. Targeted disruption specifically occurred at the

TSF1 gene created fungal mutants that are defective in elsinochrome production. Expression of

the adjacent genes in the TSFl-disrupted mutants was markedly down-regulated.

In addition, elsinochromes were extracted, for the first time, from affected lesions. A

survey of 52 field-collected E. fawcettii isolates in Florida revealed that most of them were able

to produce elsinochromes in cultures and/or inplanta. A single isolate (Ef41) with distinct

genetic traits from all others failed to infect rough lemon, grapefruit, and sour orange and

produced no elsinochromes. Overall, my studies employing biochemical, molecular, and

pathological approaches clearly demonstrated that elsinochromes play critical roles for fungal

pathogenesis and lesion development.









CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW

Biology of Elsinoefawcettii Causing Citrus Scab

Citrus scab (formerly called sour orange scab) is caused by the pathogenic fungus, Elsinoe

fawcettii Bitancourt & Jenkins (Anamorph: Sphacelomafawcettii Jenkins) that belongs to the

kingdom Fungi, phylum Ascomycota, class Loculoascomycetes, order Myriangiales, and family

Elsinoaceae (Alexopoulos et al. 1996).

The teleomorph of Elsinoefawcettii is very rare and has been reported only in Brazil

(Bitancourt and Jenkins 1936a; 1936b). E. fawcettii forms stromata that contain numerous

spherical asci within the pseudothecial locules. Each ascus harbors eight filamentous ascospores

(sexual spores) that are hyaline and oblong elliptical with the size of 5-6 x 10-12 ism (Holliday

1980). Elsinoe spp. produces two kinds of conidia (asexual spores): hyaline conidia and spindle

conidia (Fig. 1-2). Hyaline conidia of Elsinoe spp. are one celled, elliptical, and 2-4 x 4-8 ism

and are the primary source for inoculation (Whiteside et al. 1988). Conidia are produced within

the acervulus which is typically a flat or saucer-shaped bed of conidiophores growing side by

side and arising from a stromatic mass of hyphae (Alexopoulos et al. 1996) and capable of

reproducing by formation of a new germ tube (Holliday 1980; Whiteside et al. 1988). In contrast,

the colored, spindle-shaped conidia that are produced mainly on scab lesions can germinate to

produce hyaline conidia. In culture, E. fawcettii produces raised, slow-glowing colonies that are

usually beige to tan or vinaceous to black. Isolates of E. fawcettii grow slowly in axenic culture,

forming < 10-mm colony size in 30 days. Most strains of E. fawcettii secrete red pigments after

10-15 day incubation in the light.

Identification of citrus scab pathogens is primarily based on their host ranges, because it is

difficult to differentiate based on their morphologies. Elsinoefawcettii causing common scab









was found in many citrus producing areas worldwide. Whiteside (1978; 1984) described two

pathotypes from Florida and later were designated as the "Florida broad host range (FBHR)" and

the "Florida narrow host range (FNHR)" (Timmer et al. 1996). The FBHR pathotype mainly

attacks the leaves and fruits of lemon (C. limon (L.) Burm. F.), sour orange (C. aurantium L.),

grapefruit (C. paradisi Macf), and Temple/Murcott tangors (C. sinensis (L.) Osbeck x C.

reticulata Blanco), and the fruit of sweet orange (C. sinensis). The FNHR pathotype fail to infect

sour orange, Temple tangor, and sweet orange fruit (Tan et al. 1996; Timmer et al. 1996). All

pathotypes of citrus scab attack rough lemon (Citrusjambhiri Lush).

E. australis Bitancourt & Jenkins (anamorph S. australis Bitancourt & Jenkins.), causing

sweet orange scab differs from E. fawcettii in host ranges and is limited to southern South

America. E. fawcettii rarely causes lesions on sweet orange, whereas E. australis attacks all

sweet oranges as well as some tangerines and their hybrids (Chung and Timmer 2005). Unlike E.

fawcettii that induces lesions on all parts of citrus, E. australis appears to affect only fruit. In

addition, E. australis can be distinguished from E. fawcettii based on the sizes of ascospores (12-

20 x 15-30 [im in E. australis) (Whiteside et al. 1988). Furthermore, E. australis does not

produce spindle-shaped conidia in scab lesions that are often associated with E. fawcettii.

Molecular studies have been employed recently for identification and differentiation of

different species and isolates ofElsinoe (Tan et al. 1996; Timmer et al. 1996; Hyun et al. 2001).

For example: E. fawcettii and E. australis are differentiated by endonuclease restriction analysis

of the amplified internal transcribed spacers (ITSs) of ribosomal DNA. E. fawcettii isolated from

Florida and Australia could be separated by random amplified DNA polymorphism (RAPD)

analysis (Tan et al. 1996).









In addition to citrus, Elsinoe spp. also cause diseases in a wide range of plants, such as

bean scab caused by E. phaseoli, leaf spot of Dracophyllum sp. caused by E. dracophylli, grape

anthracnose caused by E. ampelina, raspberry anthracnose caused by E. veneta, and twig disease

ofPittosporum tenuifolium caused by E. takoropuku (Phillips 1994; Johnston and Beever 1994;

Agrios 1997; Ridley 2005).

Symptoms, Disease Cycles and Disease Control of Citrus Scab Caused by Elsinoe fawcettii

Symptoms

Citrus scab affects fruit, leaves and twigs of susceptible varieties of citrus (Timmer et al.

2000) (Fig. 1-1). Symptoms start as small, pale orange or buff-colored slightly-raised pustules,

which consist of a mixture of fungal and host tissues. As the pustules develop on most of the

susceptible species and cultivars (e.g., lemons, Satsuma mandarins, Temples, and sour orange),

those spots become warty and creaky protuberance (Fig. 1-1A, and 1-1B). In contrast, on

grapefruit and sweet orange, the lesions appear to be flattened scabby sheets (Fig. 1-1C). The age

of the tissues at the time of infection also affects the elevation and size of lesions. Those formed

on young tissues tend to be raised and those on more mature tissues are flatter. Because of

variations among cultivars and infected-tissue age, it is difficult to differentiate citrus scab from

other citrus diseases on the basis of symptoms alone.

Disease Cycle

In the field, E. fawcettii survives under unfavorable conditions in pustules on leaves, stem

lesions and fruit. Ascospores most likely play no role in the infection process. E. fawcettii

survives in old lesions and produces conidia from acervuli on the surface of scab pustules (Fig.

1-2A). The mode of spread of conidia occurs mostly due to rain splash. Hyaline conidia die

rapidly when exposed to light or dry conditions. After periods of dew, production of spindle-

shaped conidia (Fig. 1-2B) on lesions are stimulated and are spread by wind. A short period of









moisture is needed for infection ofE. fawcettii after dispersal of conidia. The minimum humidity

period for production of conidia is 1-2 hr, and infection occurs within 2 to 3 hr at 24-27 C

(Timmer et al. 2000). The severity of citrus scab is markedly affected by wetness. Longer

periods of humidity (up to 24 hr) greatly facilitate infection even at suboptimal temperatures.

Under suitable conditions, scab lesions usually appear on the host, as early as 6 days to 7 days

after infection (Fig. 1-2C and D). Leaves are susceptible immediately after they emerge from the

bud, and become resistant when they are older (about 20 days after emergence). The young fruit

are susceptible until 6-8 weeks after petal fall. The infection often causes fruit to be misshapen

and fall prematurely (Bushong and Timmer 2000).

Disease Control

Citrus scab is a common disease in humid citrus-growing areas in many countries.

Although the damage produced by scab is superficial and does not affect internal fruit quality,

citrus scab reduces acceptability for the fresh-fruit market. Citrus scab is endemic in Florida

where climatic conditions are highly favorable for the pathogen cycle and disease. Scab disease

predominantly affects summer growth flushes as summer rain showers frequently occur in

Florida and produce sufficient wetness for conidial germination and infection. The most effective

strategy recommended for scab management is to remove and destroy the inoculum sources.

Frequent applications of fungicides are absolutely needed to manage citrus scab if the fruit is

intended for the fresh market. Several fungicides such as Topsin (thiophanate methyl),

Abound (azoxystrobin), Gem (trifloxystrobin), Headline, (pyraclostrobin), ferbam, and

copper fungicides are registered in Florida and can be used for control of citrus scab (Bushong

and Timmer 2000). However, fungicides are often not adequate for disease control. Application

of fungicides also raises concerns on resistance of the pathogens and environmental hazards

(Timmer and Zitko 1997).









Secondary Metabolites of Fungi


Secondary Metabolites of Fungi

Fungal products classified as secondary metabolites (Turner 1971; Turner and Aldridge

1983) often show significant biological activities or enigmatic properties, and they are not

essential for the microorganisms to complete their lifecycles. Many of those bioactive

compounds (e.g., phytotoxins and melanin) are required for development of diseases or fungal

structures. Some of them may increase fungal fitness, display antimicrobial activity, and

pharmaceutical activities (e.g., antibiotics and immunosuppressant) (Demain and Fang 2000).

Thereby, fungal secondary metabolites have been thought to confer competitive advantages for

the producing microorganisms in natural environments. In addition, fungal secondary

metabolites are of medical, industrial and/or agricultural importance.

Several fungal secondary metabolites have been shown to be associated with fungal

development. For example, linoleic acid-derived compounds produced by A. nidulans (Calvo et

al. 2001), zearalenone from Fusarium graminearum (Wolf and Mirocha 1973), and

butyrolactone I from Aspergillus terreus (Schimmel et al. 1998) are able to enhance sporulation.

Furthermore, dark brown-melanin pigments produced by many fungi by oxidative

polymerization of phenolic compounds function as fungal virulence factors due to their ability to

stimulate production of conidia (e.g., Alternaria alternate), appressoria (e.g., Colletotrichum

lagenarium), sclerotia (e.g., Scherotium spp.), and sexual bodies (e.g., Sordaria macrospora)

(Chet and Hittermann 1982; Kawamura et al. 1999; Takano et al. 2000; Butler et al. 2001; Engh

et al. 2007). Alternaria alternate produces melanin to enhance the integrity of sexual and asexual

spores (Kawamura et al. 1999). Melanin apparently contributes to the survival of the fungal

spores by protecting against UV light damage. Cercosporin phytotoxin produced by many









pathogenic Cercospora spp. is not required for spore development but plays a critical role during

fungal pathogenesis (Choquer et al. 2005; 2007).

Phytotoxins produced by many phytopathogenic fungi often damage plant cells or

influence the course of disease development and the formation of symptoms. Cercosporin

produced by Cercospora spp. and botrydial produced by Botrytis cinerea have been shown to

function as virulence factors and further exacerbate disease severity (Choquer et al. 2005; van

Kan 2006). Phytotoxins are classified into two classes: host-specific and non-host specific. Non-

host specific toxins exhibit general phytotoxicity toward a wide range of plant species including

non-host plants. However, host-specific toxins affect only plant varieties or genotypes that are

the hosts of the producing microorganisms.

Elsinochromes Produced by Elsinoefawcettii

Many Elsinoe fungal species produce light-activated, red/orange pigments, called

elsinochromes. Elsinochrome pigments containing a phenolic quinine chromophore consist of at

least four derivatives (A, B, C, and D) (Fig. 1-3). The bright red pigments, elsinochromes A, B,

and C were originally isolated from cultures of a pecan pathogen, Elsinoe randii (anamorph:

Sphaceloma randii) and their chemical structures and physical properties have been well

documented (Weiss et al. 1965; Lousberg et al. 1969). Elsinochromes B and C can be quickly

oxidized to A by chromium trioxide (Lousberg et al. 1969). In contrast, elsinochrome D, likely

derived from elsinochrome C by forming a methylenedioxy ring (Fig. 1-3), is an orange pigment

produced only by some Elsinoe species (Shirasugi and Misaki 1992). Elsinochromes are

structural analogs to several polycyclic perylenequinones such as altertoxin I produced by

Alternaria alternate, cercosporin produced by many Cercospora spp., hypericin produced by

Hypericum spp., hypocrellin A produced by Hypocrella bambusae, and phleichrome produced

by Cladosporium spp. (Yoshihara et al. 1975; Assante et al. 1977; Daub 1982a; Duran and Song









1986; Stierle and Cardellina 1989; Daub et al. 2005). All of these compounds have a common

4,9-dihydroxyperylene-3,10-quinone chromophore and only differ in attached side chains (Daub

et al. 2005). Additionally, these compounds are grouped as photosensitizers based on their ability

to sensitize cells to visible light, react with oxygen molecules, and produce reactive oxygen

species (ROS) (Yamazaki et al. 1975; Daub 1982a). Light and oxygen are two key components

for photodynamic function and toxicity of these compounds. Although elsinochromes

structurally resemble many photosensitizing perylenequinones, their toxicity has never been

investigated.

Photosensitizing compounds are a group of structurally diverse compounds and natural

products that are able to absorb light energy and are converted to an electronically excited triplet

state. The activated photosensitizers then react with oxygen molecules in two different ways to

form both radical and non-radical species of activated oxygen, including superoxide, hydrogen

peroxide, hydroxyl radical, and singlet oxygen (Dobrowolski and Foote 1983; Girotti 1990) (Fig.

1-4). Activated oxygen species have general toxicity, as they react with biomolecules common to

all cells, including lipids, proteins, and nucleic acids, and often result in cell death (reviewed by

Daub et al. 2005). The toxicities of radical oxygen species have been well known. Several lines

of evidence suggest that the non-radical-singlet oxygen (102) is also highly toxic to cells

(reviewed by Daub et al. 2005).

Polyketide Biosynthesis

Polyketides are a large family of natural products that are produced by bacteria, fungi, and

plants. Polyketide chain assembly is catalyzed by polyketide synthase (PKS). Three basic types

of bacterial PKSs are known to date (Shen 2003). Bacterial type I PKSs are modules which

contain one or more large multifunctional protein subunits similar to typical domains of fatty

acid synthases [KS (ketoacyl synthase), AT (acyltransferase), KR (ketoreductase), DH









(dehydratase), ER (enoyl reductase), ACP (acyl carrier protein), and TE (thioesterase)]. Each

module harbors a set of distinct, non-iterative activities responsible for the catalysis of one cycle

of polyketide chain elongation. The bacterial type I polyketides which resemble branched-chain

fatty acids include large carboxylic compounds (e.g., deoxyerythronolide B; erythromycin A)

(Cortes et al. 1990; Donadlo et al. 1991; Hutchinson 1999; Staunton and Weissman 2001; Shen

2003). Bacterial type II PKSs are multienzyme complexes that carry a single set of iterative

activities. The type II bacteria polyketides usually contain two or more aromatic rings fused into

polycyclic structures, such as tetracenomycin C, actinorhodin, and doxorubicin (Malpartida and

Hopwood 1984; Motamedi and Hutchinson 1987; Staunton and Weissman 2001; Shen 2003).

Bacterial type III PKSs are iterative homodimeric enzymes that act iteratively and independently

of ACP to synthesize aromatic polyketides, which are often monocyclic or bicyclic, such as

chalcone and stilbene (Funa et al. 1999; Shen 2003).

Fungal secondary metabolites are often synthesized by defined biosynthetic pathways

using various precursors such as shikimic acid, tricarboxylic acid, fatty acid, polyketides,

terpenoids, or amino acids (Keller et al. 2005). Fungal polyketides contain a diverse range of

structures, including a wide range of pigments, mycotoxins, and phytotoxins such as

naphthopyrone, aflatoxin (AF)/sterigmatocystin (ST), fumonisin, lovastatin, compactins,

melanins, and cercosporin.

Carbon skeletons of fungal polyketides are typically synthesized by the fungal iterative

type I PKSs that are composed of a single multifunctional polypeptide with a set of active site

domains similar to a module of bacterial type I PKSs, but they carry out biosynthetic reactions

repeatedly (Shen 2003). Recently, the type III PKSs have been found in some filamentous fungi,

such as Neurospora crassa and Aspergillus oryzae (Seshime et al. 2005; Funa et al. 2007).









PKSs are structurally and functionally similar to eukaryotic fatty-acid synthases (FASs),

both catalyzing sequential condensations between ACP (acyl carrier protein)-linked acyl-

thioesters, such as acetyl-CoA and malonyl-CoA (Fig. 1-5) via decarboxylation. However,

fungal type I PKSs do not always process 3-keto reduction, dehydration, and enoyl reduction that

are essential for the full processing of the P-carbon in fatty acids. All fungal PKSs contain P-

ketoacyl synthase (KS), acyltransferase (AT) and acyl carrier proteins (ACP) domains for

assembling polyketide backbone, whereas many of them, unlike FASs, lack ketoreductase (KR),

dehydratase (DH) and enoyl reductase (ER) domains (Fig. 1-5A).

Similar to FASs, fungal PKSs iteratively add a two-carbon unit to polyketide chains.

Generally, but not all, biosynthesis of fungal polyketides, such as cercosporin, is initiated when

acetyl and malonyl coenzyme A (CoA) are covalently linked, as thioesters, to the 4'-

phosphopantotheine of an acyl carrier (ACP) domain through the acyltransferase (AT) domain.

Condensation via decarboxylation then occurs with another thioester intermediate that is attached

to the ketoacyl CoA synthase (KS) domain. The KS domain is involved in both chain initiation

and elongation. After condensation, some of P-ketothioesters can be further modified by the

action of other domains such as ketoreductase (KR), dehydratase (DH), or enoyl reductase (ER)

domains if they are present. Further modifications may include cyclization, oxidation, hydration,

and methylation. PKSs that are required for squalestatin biosynthesis in Phoma sp. and fusarin C

production in Fusarium moniliforme and F. venenatum, contain a methyltransferase (MT)

domain that adds methyl groups to the a-carbon of the thioester (Fig. 1-5B) (Hopwood and

Sherman 1990; Bender et al. 1999; Cox et al. 2004; Song et al. 2004).

Once the polyketide chains are completed, they will be released from the enzyme complex

by the function of thioesterase (TE)/cyclase (CYC) domain that also catalyzes further ring









closure. Further modification processes involving monoxygenases, dehydrogenases, esterases, 0-

methltransferase, reductase, and oxidase contribute to a remarkable diversity of polyketide-

secondary metabolites in nature.

Gene Clusters

Biosynthetic genes that are involved in the production of fungal secondary metabolites are

frequently coordinately regulated and tightly clustered in the genomes (Zhang et al. 2004). Such

examples include the genes involved in the biosynthesis of penicillin by Penicillium spp. (Smith

et al. 1990), cercosporin by Cercospora nicotianae (Chen et al. 2007), aflatoxin

(AF)/sterigmatocystin (ST) by Aspergillus spp. (Yu et al. 2004), ergot alkaloids by Claviceps

pupurea (Tudzynski et al. 1999), fumonisin by Gibberella moniliformis (Proctor et al. 2003),

ochratoxin A by Penicillium nordicum (Karolewiez and Geisen 2005), aurofusarin by Fusarium

graminearum (Malz et al. 2005), and melanin by Alternaria alternate (Kimura and Tsuge 1993).

Regulation of the clustered genes is often governed by a pathway-specific regulator and also

influenced by many global regulatory factors which usually respond to various environmental

cues, such as carbon/nitrogen sources, light, and pH. The gene encoding a pathway-specific

transcription factor is often embedded within the clusters. It is currently unclear why fungal

genes that are responsible for secondary metabolite biosynthesis tend to be clustered. The

clustering of genes in fungi may evolve vertically through meiotic or mitotic processes due to

environmental selections or simply are obtained via horizontal gene transfer from prokaryotes

(Rosewich and Kistler 2000; reviewed by Walton 2000). Horizontal transfer has been proposed

to be a stable transfer of genetic material between microorganisms (Rosewich and Kistler 2000).

Horizontal transfer via assorted processes, such as conjugation, transformation, or transduction in

bacteria is very common. However, the mechanisms involved in horizontal gene transfer in









eukaryotes are largely unknown, and no direct evidence is available to explain how horizontal

transfer occurs in eukaryotes including fungi.

Research Overview

The major goal of this research is to determine the function of elsinochromes produced by

Elsinoefawcettii. Elsinochromes are structurally similar to many photosensitizing

perylenequinones, which has led to speculation that elsinochromes may function as

photosenitizers and are required for fungal virulence during plant-pathogen interactions. In this

study, biochemical, molecular, and genetic approaches were employed to investigate the

virulence determents that are required for Elsinoefawcettii to invade citrus. Particular

emphasizes was placed on the elsinochromes produced by E. fawcettii. Protocols for extraction

and quantification of elsinochromes were established and the toxicity of elsinochromes to plant

cells was determined to occur through generation of reactive oxygen species, primarily singlet

oxygen and superoxide (Chapter 2). Environmental stimuli affecting production of

elsinochromes in culture was also investigated (Chapter 3). Molecular and genetic approaches

were employed to conclusively determine the role of elsinochromes in fungal pathogenesis and

lesion development by cloning and disruption of an EfPKS] gene, encoding a fungal type I

polyketide synthase in E. fawcettii (Chapter 4). Chromosome walking and sequence analysis

beyond the EfPKS] gene allowed identification of additional genes whose products might also be

required for elsinochrome biosynthesis and regulation, indicating that some of the genes

involved in elsinochrome biosynthesis are clustered in the genome of E. fawcettii (Chapter 5).

Targeted disruption of a TSF1 gene encoding a putative transcription regulator generated fungal

mutants that failed to accumulate any measurable elsinochromes and displayed reduced

expression of the genes including EfPKS] in the cluster (Chapter 5). A survey of 52 isolates of E.

fawcettii obtained from citrus-growing areas in Florida revealed variations in fungal









pathogenicity to rough lemon, grapefruit, and sour orange and elsinochrome production among

isolates. DNA polymorphism analyses identified several E. fawcettii variants or pathotypes that

were not previously recognized in Florida (Chapter 6).











































Figure 1-1. Symptoms of citrus scab caused by the pathogenic fungus, Elsinoefawcettii. Warty
and scabby blister-shaped growths are produced on fruit of Murcutt (A) and Temple
(B). C) The infected grapefruit shows the flatter symptoms. D) The infected tangerine
leaf is covered with scabby and corky pustules. (Courtesy L. W. Timmer)












ACERVULUS with CONIDIA
S -- -Survives in old leaves
'. and stem lesions


Scab infested
fruits and leaves
Symptoms Spl sh
6-7 days Airb rne disposed




Tender fruit and leaves
infection with 5-6h wetting
at 24-27C
Colored Hyaline conidia
spindle-shaped
N. ^^- conidia




Figure 1-2. Life cycle ofElsinoefawcettii, the causal agent of citrus scab (Whiteside 1988;
Timmer et al. 2000).













O CH3


OCH3

OCH3

H



Elsinochrome
Elsinochrome
-CHOH-CH3
Elsinochrome
CH3


:HOHCH,


O CH3


A: R1
B: R1


= R2 = -CO-CH3
= -CO-CH,, R2 =


Elsinochrome D


C: R1 = R2 = -CHOH-


Figure 1-3. Structure of elsinochromes with various side-groups (R) (redrawn based on the work
of Weiss et al. 1987).








R.
hv
RvSS-" 0 S + 02-

L )S Type I


S102 +OS

Type II

Figure 1-4. Proposed model for the formation of activated oxygen species by photosensitizers.
The ground-state photosensitizers (oS) absorb light energy, and are converted to the
excited singlet (1S) and then long-lived triplet (3S) state. The activated sensitizers may
react with oxygen molecules via electron transfers in the presence of a reducing
substrate (R) to yield the radical forms of oxygen species, such as superoxide (02-'),
hydrogen peroxide (H202), or the hydroxyl radical (OH') (type I reaction).
Alternatively, triplet sensitizers may react directly with oxygen by an energy transfer
reaction to produce non-radical singlet oxygen (102) (type II reaction) (Daub and
Ehrenshaft 2000).











KS AT (EDH) (MT) (ER) (KR) AGP (CYC) (TE)


FAS FAS FAS

00 0 'C02
polyketide synthase O
FA fatty acid synthase k.
acyl carrier protein n.
[] -ketoacyl synthase O OH O
______J_____ 0 O OH 0


PT SH
or 0

ETE PDM SH TF
FASER DH KR KSM x6 M4FAST

O


0 0

4
LSH


KR O OH
/0 7
FAS
SH
DH O






FAS )
1\1 SH


Figure 1-5. Biosynthesis of fatty acid and polyketide in fungi. A) Conserved domains found in
the fungal polyketide synthase (PKS). Fungal type I PKSs produce a single, large
polypeptide with multifunctional domains. Formation of the polyketide backbone
requires ketoacyl CoA synthase (KS), acyltransferase (AT), and acyl carrier (ACP)
domains. Other domains (such as dehydratase (DH), methyltransferase (MT), enoyl
reductase (ER), ketoreductase (KR)) in brackets are not essential for all fungal PKSs.
B) An overall scheme for fatty acid synthesis and polyketide biosynthesis. In fatty
acid synthesis, acetyl-CoA and malonyl-CoA are converted into acetyl-ACP and
malonyl-ACP, respectively, by acetyl and malonyl transacylase. Fatty acid synthase
(FAS) subsequently condenses the two precursors, via a cycle of reduction, and
dehydration in the keto group. Biosynthesis of polyketide in fungi is somewhat
similar to fatty acid. Polyketide synthase (PKS), resembling FAS, is responsible for
condensation of precursors. The major difference between FAS and PKS is that in
addition to acetyl-CoA and malonyl-CoA, PKS may use different substrates as the
starter and extender groups. Furthermore, PKSs produce diverse products based on
the extent of reduction. The pathways, indicated by the letters (k, n, e, and a),
represent various possibilities to yield keto, hydroxyl, enoyl or alkyl group into the
growing polyketide chain after each condensation step. The carbon atoms of malonate
and acetate contributing to polyketide chain are indicated by numerals. The carbon of
malonate that is eliminated as CO2 is indicated by asterisks. The abbreviations: KS,
ketoacyl CoA synthase; AT, acyltransferase; DH, dehydrase; MT, methyltransferase;
ER, enoyl reductase; KR, ketoreductase; ACP, acyl carrier protein; CYC, cyclase; TE,
thioesterase; PT, palmityl transferase. (This figure is redrawn from the work of
Hopwood and Sherman 1990; Bender et al. 1999).









CHAPTER 2
CELLULAR TOXICITY OF ELSINOCHROME PHYTOTOXINS PRODUCED BY Elsinoe
fawcettii

Elsinochrome pigments (ESCs) were extracted from mycelia of cultured Elsinoefawcettii

by acetone and tested for cellular toxicity in this chapter. Thin-layer chromatography (TLC)

analysis was used to separate and identify at least five different derivatives of ESCs. A spectrum

scanning analysis of the crude extract of ESCs as well as the five distinct bands recovered from

TLC plates revealed an identical absorbance spectrum, showing a major absorbance at 460 nm

with two minor peaks at 530 and 570 nm. Chemical analyses revealed that the pigments

extracted from E. fawcettii cultures contain phenolic quinines, resembling ESC phytotoxins that

have been characterized in other Elsinoe spp. Upon irradiation with light, ESCs rapidly killed

suspension-cultured citrus and tobacco cells. The toxicity was decreased by adding the singlet

oxygen (102) quenchers, bixin (carotenoid carboxylic acid), DABCO (1, 4-diazabicyco octane),

the ascorbate, or reduced glutathione. Application of ESCs onto rough lemon leaves induced

necrotic lesions, whereas lesion development was inhibited by the addition of bixin, DABCO, or

ascorbate, but not a-tocopherol. Incubation of rough lemon leaf discs with ESCs in the light

resulted in a steady increase of electrolyte leakage. Similar with two photosensitizing compounds,

hematoporphyrin and cercosporin, the accumulation of 102 by ESCs after irradiation was

indicated by successful detection of the cholesterol oxidation product, 5a-hydroperoxide.

Addition of a potent quencher, 0-carotene, prevented 5a-hydroperoxide production. ESCs

generated superoxide ions (02 "), whereas accumulation of 02- was blocked by addition of the

superoxide dismutase, a scavenger of 02O-, but not the 102-quencher, DABCO. These

experiments indicated that ESCs function as photosensitizing compounds that produce 102 and

02'-, and exert toxicity to plant cells.









Introduction

Elsinoefawcettii Bitancourt & Jenkins is the causal agent of citrus scab. This disease is

widely distributed, occurring in many citrus growing areas where rainfall conditions are

conducive for infection. Conidia (asexual spores) are produced from the imperfect stage of the

fungus, Sphacelomafawcettii Jenkins, and serve as the primary source for inoculation in the field

(Hyun et al. 2001).

A large number of Elsinoe species are able to produce red pigments, named elsinochromes

(ESCs) (Meille et al. 1989). The structures of ESCs have been well established (Weiss et al.

1957; Weiss et al. 1965; Meille et al. 1989). ESCs contain at least four derivatives, A, B, C and

D, differing in side groups. Those derivatives all have a basic 4,9-dihydroxyperylene-3,10-

quinone chromophore similar to several perylenequinone compounds grouped as

photosensitizers based on their ability to sensitize cells to visible light and produce reactive

oxygen species (ROS) (Yamazaki et al. 1975; Daub 1982a). Light and oxygen are absolutely

required for the photodynamic function and toxicity of these compounds. Photosensitizing

compounds absorb light energy and convert to a stable electronically excited state (triplet state)

which in turn reacts with oxygen to produce toxic reactive oxygen species (ROS) such as

superoxides (02O-), hydrogen peroxide (H202), hydroxyl radical (OH'), and/or singlet oxygen

(102) (Dobrowolski and Foote 1983; Girotti 1990). In the Type I reaction, the activated triplet

photosensitizers can react with oxygen molecules directly by transferring a hydrogen atom or

electron from reducing substrates (such as NADPH, ascorbate, and L-cysteine), resulting in

reduced oxygen species including superoxides (02-) (Girotti 1990). In the Type II reaction, the

activated photosensitizers react with oxygen molecules by an energy-transfer process, producing

electronically reactive singlet oxygen (102) (Spikes 1989).









Both 102 and 02- are toxic to cells, causing the oxidation of various biological components

including fatty acids, membranes, proteins/enzymes, sugars, and nucleic acids, and often

resulting in cell death (reviewed by Daub et al. 2005). Many of the perylenequinone pigments

produced by fungi have been shown: 1) to be toxic to mice, bacteria, and many fungi, 2) to be

cytotoxic to animal tumors, 3) to be potent antiviral agents, and 4) to inactivate protein kinase C

(Tamaoki and Nakano 1990; Hudson and Towers 1991; Diwu 1995; Hudson et al. 1997). Except

for cercosporin produced by many members of the fungal genus Cercospora (Callahan et al.

1999; Choquer et al. 2005; 2007; Chen et al. 2007; Dekkers et al. 2007; Chen et al. 2007), none

of the perylenequinones of fungal origin have been demonstrated to act as a crucial factor in

plant diseases caused by the producing pathogen.

Many E. fawcettii isolates collected from Florida citrus growing areas produce red/orange

pigments in culture (see details in Chapter 6). However, the identity of these pigments remains

unknown. The aim of this study is first to isolate and characterize the pigments from E. fawcettii.

This chapter describes methodology for isolation and analysis of the extracted pigments and

reports their physical and chemical properties as ESC phytotoxins that have been described

elsewhere by Weiss and his colleagues (1987). In addition, the extracted ESC-like pigments from

one of the E. fawcettii isolates are demonstrated to be toxic to host and non-host plant cells.

Evidence is also presented for function of ESCs as photosensitizing agents in culture and in

plant, by producing toxic reactive oxygen species, mainly 102 and 02'-.

Materials and Methods

Biological Materials and Cultural Conditions

E.fawcettii Bitancourt & Jenkins (anamorph: Sphacelomafawcettii Jenkins) CAL WH-1

isolate used in this study was single-conidium isolate from scab affected calamondin (Citrus

madurensis Lour) fruit in Florida and was kindly provided by L. W. Timmer (University of









Florida, Citrus Research and Education Center, Lake Alfred, FL). The fungus was grown on a

sterilized filter paper, and stored at -20 OC for long-term storage. Fungal cultures were routinely

maintained on potato dextrose agar (PDA, Difco, Becton, Dickinson and Company, Sparks, MD,

USA). For toxin production, fungal mycelia were minced with a sterile blender, spread on PDA

and incubated under continuous fluorescent light for 5 days as previously described (Liao and

Chung 2008a).

A cell suspension of tobacco (Nicotiana tabacum cv. Xanthi) was kindly provided by D. J.

Lewandowski (Ohio State University, Columbus, OH, USA) and maintained in a Murashige and

Skoog medium (Murashige and Skoog 1962) with gentle agitation under a daily regime of 16-h

light and 8-h dark. Plant cells were subcultured weekly in a freshly prepared medium for toxicity

assays. For protoplast isolation, 4-day-old tobacco cells were harvested and digested with cell-

wall degrading enzymes (a mixture of 1.5 % cellulase and 0.15 % pectolyase) as described by

Lewandowski and Dawson (1998). Sweet orange (Citrus sinensis (L.) Osbeck) suspension cells,

kindly provided by J. W. Grosser (University of Florida, CREC, Lake Alfred, FL, USA), were

maintained in a Murashige and Tucker medium (1969). Citrus protoplasts were prepared by

incubating with 10 % of cell wall degrading enzyme complex (Sigma-Aldrich, St. Louis, MO)

for 2 h as described by Grosser et al. (1988). Rough lemon (Citrusjambhiri Lush) trees were

maintained in greenhouse and rapidly expanding immature leaves approx. 13-20 mm length and

4-7 mm wide, were harvested for toxicity assays.

Isolation and Analysis of the Red/Orange Pigments

The orange/red pigments secreted in culture were extracted twice from dried agar medium

bearing fungal mycelia with acetone for 16 h. Organic solvent was combined and evaporated

with a Model R1 10 of Rotavapor (Brinkmann, Buchi, Switzerland). For thin-layer

chromatography (TLC) analysis, the pigments were dissolved in acetone, spotted onto TLC









plates coated with a 60 F254 fluorescent silica gel (5 x 20 cm, Selecto Scientific, Suwanee, GA,

USA), and separated with a solvent system containing chloroform and ethyl acetate (1:1, v:v).

The crude extracts separated by TLC were examined by a hand-held long wavelength UV lamp

(UVP, San Gabriel, CA, USA). After separation, the pigments showing distinct bands were

scraped from the TLC plate, dissolved in acetone, and separated from silica gel by low-speed

centrifugation. The acetone was dried and the amounts of ESCs recovered were determined by

weight. The pigments dissolved in acetone were examined by spectrophotometry at absorbance

between 400 and 650 nm. Cercosporin was purified from cultures of Cercospora nicotianae in

separate studies (Choquer et al. 2005; Chen et al. 2007). The extracted ESC toxins were directly

mixed with plant cells for toxicity assays. Unless otherwise indicated, all chemicals were

purchased from Sigma-Aldrich (St. Louis, MO, USA).

Toxicity Assays to Plant Cells

Citrus or tobacco suspension cells or protoplasts at density 1 x 106 mL-1 were mixed with

various concentrations of ESCs (dissolved in acetone) with or without singlet oxygen (102)

quenchers, and placed on the top of 1 % agarose (in a 35 x 10 mm Petri dish). Cell cultures were

illuminated with fluorescent lights at an intensity of 3.5 J m-2 s-1 at room temperature (-25 C)

for citrus cells or at 32 C for tobacco cells. Light intensity was determined by a Dual-Display

light meter (Control Company, Friendswood, TX, USA). Dark-grown cultures were wrapped in

aluminum foil and incubated in the same conditions. Cells were examined over time by staining

with 1 % Evan's blue (Taylor and West, 1980). Dead cells were stained blue as they cannot

exclude Evan's blue, whereas live cells remained clear. Cell viability was determined with the

aid of a hemocytometer using a microscope at xl00 magnification. The percentage of cell

viability was calculated by the number of live cells divided by the total number of cells









examined. Control cultures were untreated or cells treated with equal volumes of acetone and/or

other solvents (final concentration < 1%) as appropriate.

The toxicity of ESCs on host plants was determined on detached rough lemon leaves (4-7

days after emergence). ESCs (1 mM, cercosporin equivalent) with or without antioxidants were

applied onto the surface of rough lemon leaves and incubated in a moist chamber under

fluorescent light (3.5 J m-2 s-1), and monitored daily for development of necrotic lesions.

Antioxidants used in this study include: bixin (carotenoid carboxylic acid), P-carotene, DABCO

(1,4-diazabicyco octane), a-tocopherol (vitamin E), reduced glutathione, L-cysteine, and (+)-

sodium L-ascorbate (vitamin C). Bixin, p-carotene, and a-tocopherol were dissolved in 95 %

ethanol and others were dissolved in water to make a stock solution.

Detection of Singlet Oxygen and Superoxide Ions

Production of 102 by ESCs upon irradiation was determined by their ability to oxidize

cholesterol by the protocol of Daub and Hangarter (1983) with modifications. The 102-

generating photosensitizers, hematoporphyrin and cercosporin, were used as the positive

controls. Photosensitizing compounds (8 mg each) in 20 mL pyridine were mixed with

cholesterol (200 mg), and irradiated under a fluorescent light at intensity of 2.2 joules m-2 s-1

with gentle bubbling for 5 h. After solvent was removed, the oxidized products were suspended

in 20 mL of hot methanol, passed through a filter to remove precipitation after cooling, and

analyzed by TLC with a solvent system containing hexane-isopropanol (9:1 or 24:1, v:v). The

oxidized products of cholesterol were visualized as bands after staining with a chromogenic

reagent, N, N-dimethyl-p-phenylenediamine (1 %) dissolved in methanol-H20-glacial acetic acid

(5:5:0.1, v/v/v) (Smith and Hill 1972; Smith et al. 1973). The cholesterol 5a-hydroperoxide

standard was prepared by photo-oxidation with hematoporphyrin as described by Ramm and

Caspi (1969).









Photochemical reduction of nitrotetrazolium blue chloride (NTB) was used to determine

02' production by ESCs (Daub and Hangarter 1983). Reactions were carried out in a solution

containing 5 mM 3-(N-morpholino) propanesulfonic acid (MOPS), 10 mM methionine (as a

reducing agent), 2.5 mM NBT, 2 iM riboflavin, 10 pM of ESCs or cercosporin, and superoxide

dismutase (SOD, 1 mg mL-1) or DABCO (1 mM). Nitrotetrazolium blue chloride was added into

the buffer before the addition of photosensitizers and the reaction mixture was irradiated under a

constant light at intensity of 4.7 J m-2 s-1. Superoxide production, as shown the increase

absorbance at 560 nm as a result of the reduction of NBT, was measured spectrophotometrically

(Beruchamp and Fridovich 1971).

Determination of Electrolyte Leakage

Electrolyte leakage was measured by the method of Alferez et al. (2006) with some

modifications. Leaf discs (0.5 cm in diameter) were cut from 4-day-old rough lemon leaves,

placed in a 96-well microtiter plate, and incubated with ESCs (2 mM; dissolved in 7 % acetone)

under constant fluorescent light (3.5 J m-2 s-1) or in complete darkness at room temperature.

Control leaf discs were treated with equal amounts of acetone or deionizer water as appropriate.

Leaf discs (10) were randomly collected at 12-h intervals, soaked in water for an additional 1 h

on a rotary shaker (60 r.p.m.), and measured for initial conductivity (IC). Leaf samples were

immediately frozen in liquid nitrogen and kept at -80 OC for at least 12 h to obtain the remain

conductivity of leaves. Total conductivity (TC) of leaves was determined after leaf discs were

thawed at room temperature for 10-15 min. Conductivity was determined by a Model 115 Orion

conductivity meter equipped with a Pentrode probe (Thermo Electron, Boston, MA, USA).

Electrolyte leakage, expressed as percentage of total conductivity, was calculated by dividing

initial conductivity (IC) by total conductivity (TC).









Statistical Analysis

Data were analyzed by ANOVA using SAS (PROCGLM) for PC (SAS Institute Inc., Cary,

N.C.). When differences were significant (P < 0.05), individual treatment means were separated

using Ducan's Multiple Range Test (P = 0.05).

Results

Isolation and Characterization of ESCs from Elsinoefawcettii

Acetone extracts from cultures of an E. fawcettii isolate produced five distinct bands after

TLC separation (Fig. 2-1). Bands 1, 2, and 3 [in order of decreasing Rfvalue (the ratio of the

distance migrated by a substance compared with the solvent front)] appeared to be major

compounds of the extracts based on band width, whereas bands 4 and 5 appeared to be minor

compounds. Spectrophotometric scanning revealed that the acetone extracted pigments displayed

a strong absorbance at 460 nm with two minor peaks at 530 and 570 nm (Fig. 2-2A) which

resembles the ESCs previously isolated from several Elsinoe species (Weiss et al. 1957; 1965).

Further analysis indicated that all five bands, recovered from TLC plates had similar absorption

spectra, also displaying three major absorption peaks at 460, 530 and 570 nm (Fig. 2-2B, C, D, E,

and F). In addition, the red/orange pigments from E. fawcettii had several typical characteristics

of ESCs containing phenolic quinines. Similar to ESCs described by Weiss et al. (1957; 1987),

the extracted red/orange pigments became bright green when dissolved in aqueous KOH or

sodium carbonate (Fig. 2-3). Further, the green pigment reverted to pink when alkaline sodium

dithionite was added (Fig. 2-3A). The green pigment changed to a distinct leuco compound,

showing yellow/greenish fluorescence when treated with zinc dust (Fig. 2-3B). These results

indicated that the red/orange pigments extracted from E. fawcettii were ESCs.









Toxicity of ESCs from E. fawcettii to Host and Non-Host Cells

The toxicity of ESCs was assayed using citrus protoplasts. As shown in Fig. 2-4A, ESCs

exhibited dosage-response toxicities with respect to citrus protoplasts. At 10 jiM, no viable citrus

cells remained after 5 h in the light. At 5 jiM, there was a decrease in the rate of cell death

throughout the assay period. By contrast, untreated citrus cells or cells treated with acetone alone

remained viable throughout the assay period. ESCs did not produce a toxic reaction when cells

were incubated in complete darkness.

The toxic effect of ESCs was also evaluated with suspension-cultured tobacco cells and

protoplasts. Similar to cercosporin produced by a tobacco pathogen, C. nicotianae (Daub 1982a),

ESCs caused rapid death of tobacco protoplasts (Fig. 2-4B) or cultured suspension cells (Fig. 2-

4C), in a dose-response manner within 1 h after irradiation with light. Untreated or acetone-

treated tobacco cells in the light or cells incubated in the darkness remained viable for the

duration of the experiment.

Antioxidants Reduce ESC Toxicity

The toxicity of ESCs was alleviated to various degrees by adding 400 jiM bixin (Fig. 2-

5A), 2 mM DABCO or 4 mM of ascorbate, or reduced glutathione (Fig. 2-5B-D). Compared

with bixin, DABCO, and ascorbate, reduced glutathione had less effect on the protection against

toxicity of ESCs, by showing an extended lag period. Application of antioxidants with lower

concentrations had little or no effect on reduction of toxicity by ESCs (data not shown). Addition

of a-tocopherol or L-cysteine (4 mM each) appeared to enhance elsinochrome phytotoxicity as

the duration of incubation increased (Fig. 2-5E and F).

Similar to citrus protoplasts, the cellular toxicity of ESCs to suspension-cultured tobacco

cells was alleviated by the addition of antioxidants such as bixin, DABCO, ascorbate, and a-

tocopherol (Fig. 2-6A-D). In the presence of bixin or DABCO, over 40 % of tobacco cells were









viable after incubation with ESCs for 24 h in the light. Both ascorbate and a-tocopherol

significantly delayed photo-induced cell death (by at least 18 h), yet neither compound was able

to protect cell death beyond 24 h. Untreated tobacco cells incubated in the dark were healthy for

the duration of the experiment (The inset of Fig. 2-4C).

ESCs are Toxic to Citrus Leaves

To determine if ESCs were toxic to the host, the crude extracts were applied onto detached

rough lemon leaves. After incubated for 10 days, the ESC-treated spots on rough lemon leaves

developed noticeable necrosis in the light (Fig. 2-7). Leaves treated with the solvent alone didn't

developed necrosis (Fig. 2-7). Mixture of ESCs with bixin, DABCO, or ascorbate on the leaves

prevented development of necrosis on detached rough lemon leaves (Fig. 2-7A-C). Bixin showed

a light brown color when dissolved in 95 % ethanol. Application of a-tocopherol alone, however,

resulted in a brownish necrotic spot and failed to alleviate the toxicity of ESCs (Fig. 2-7D).

Application of superoxide dismutase (SOD) or hyperoxidase also had effects on protection

against the toxicity of ESCs on rough lemon leaves (Fig. 2-8).

Production of Reactive Oxygen Species by ESCs

Production of 02O- by ESCs was evaluated with a superoxide scavenging assay (Beruchamp

and Fridovich 1971; Daub and Hangarter 1983) based on its ability to reduce nitrotetrazolium

blue chloride (NTB), and compared with the levels of 02O- induced by other photosensitizing

compounds such as cercosporin and riboflavin known to generate 02- (Oster et al. 1962; Daub

and Hangarter 1983). In the absence of NTB, photosensitizers dissolved in the MOPS buffer

produced lower absorbance values at 560 nm (Fig. 2-9A; Fig. A-i), representing the reaction

baseline. Mixing NTB with the crude extracts of ESCs significantly elevated absorbance values

because of reduction of NTB (Fig. 2-9A). However, the reactions were repressed in the presence

of 02'- scavenging enzyme, SOD, indicating the production of superoxide. Compared with









cercosporin and riboflavin, ESCs appeared to induce high levels of 02O- after irradiation (Fig. 2-

9B). Addition of SOD, but not DABCO, drastically reduced the accumulation of superoxides

from the actions of ESCs (Fig. 2-9C).

Production of cholesterol 5a-hydroperoxide from cholesterol is one of the best and

simplest ways to test for the presence of 102 (Kulig and Smith 1973). To assess the production of

102 in vitro, the extracted ESCs were mixed with cholesterol and illuminated. The resulting

products were chromatographed in two different solvent systems and detected as distinct bands

after staining with a chromogenic reagent, N, N-dimethyl-p-phenylenediamine. Reaction of

cholesterol 5a-hydroperoxide with dimethyl-p-phenylenediamine resulted in pink pigments on

the TLC plate which turned dark green 2h after staining. As with hematoporphyrin (positive

control) and cercosporin photosensitizers, ESCs converted cholesterol by 102-induced

photodynamic oxidation into the 5a-hydroperoxides of cholesterol in the light (Rf0.4 and 0.1 in

Fig. 2-10A and B, respectively). No visible band was detected from the untreated cholesterol.

Irradiation of cholesterol with UV light (240 nm) for 24h yielded several bands on TLC, but no

cholesterol 5a-hydroperoxide was detected (Fig. 2-10C). A faint band with slightly faster

migration of unknown identity was detected in products generated by cercosporin and ESCs. The

cholesterol 5a-hydroperoxides and the faint bands were undetectable when p-carotene, a potent

102 quencher, was added to the reaction mixture.

Electrolyte Leakage Induced by ESCs

When incubated with illumination for 24 h, the extracted ESCs induced an increase in

electrolyte leakage of rough lemon leaf discs (Fig. 2-11A). Leaf discs treated with water or

solvent alone, or leaf discs incubated in the dark showed relatively minor electrolyte leakage.

Electrolyte leakage induced by ESCs in the light steadily increased over time, whereas leakage

of the controls remained low (Fig. 2-11B).









Discussion

Elsino fawcettii isolates obtained in Florida citrus-growing areas produced red/orange

pigments in culture similar to ESCs produced by many Elsinoe spp. (Weiss et al. 1957; 1987),

and had a visible absorption spectra characteristic of ESCs. In addition, the orange/red pigments

had other typical characteristics of ESCs, such as forming a distinct yellow/greenish fluorescence

leuco compound when reacted with zinc dust in alkaline conditions (Weiss et al. 1957; 1987),

sparing solubility in water, but readily soluble in several organic solvents, such as acetyl acetate

and acetone. Thin-layer chromatography analysis of the acetone-extracted pigments revealed

significant variations of the pigments produced in culture. The results strongly suggest that these

pigments were ESC analogs containing a phenolic quinine chromophore.

Compared with studies of chemical characterization, little is known about the biological

function of ESCs. The photodynamic action of ESCs leading to cellular toxicity has been

predicted based on their structural similarity to many photosensitizing compounds such as

cercosporin, hypericin, or hypocrellin A (Daub et al. 2005), yet this has never been demonstrated

experimentally. In the present study evidence is presented for ESCs' toxicity to plant cells by

functioning as photosensitizers that generate reactive oxygen species (ROS). Since citrus

suspension cells aggregated to form massive clumps in culture, the toxicity assays were

performed only with citrus protoplasts. ESCs extracted from E. fawcettii rapidly killed citrus

protoplasts in a dose-dependent manner and only when cells were exposed to the light, consistent

with the mode of action for other photosensitizing compounds (Yamazaki et al. 1975; Daub

1982a; Spikes 1989). The cellular toxicity of ESCs was attenuated considerably when

antioxidant compounds were added into the culture, implying the involvement of reactive

oxygen species, particularly 02O- and/or 102. Carotenoids are efficient 102 quenchers in the

biological systems (Krinksy 1979). Bixin, a carotenoid carboxylic acid, has a lower molecular









weight than p-carotene and is more polar owing mainly to the presence of the carboxylic acid

group (Daub 1982a). Both bixin and P-carotene have the same isoprenoid chain length but bixin

is more soluble in aqueous solutions. Carotenoids quench 102 via energy transfer mechanisms

(Foote and Denny 1968; Foote et al. 1970) and are slowly consumed in the reaction.

DABCO (1,4-Diazabicyclo octane) also is an effective 102 quencher. Unlike bixin,

DABCO quenches 102 by a chemical reaction, and is quickly consumed (Oannes and Wilson

1968; Daub 1982a). These contrasting properties may account for why bixin provided a more

persistent protection of citrus cells than DABCO (Figs 2-5 and 2-6). In addition, the red

pigmented ESCs became bright green when dissolved in aqueous DABCO, indicating a direct

interaction between DABCO and ESCs. Both bixin and DABCO have been shown to decrease

the toxicity of cercosporin to tobacco cells (Daub 1982a). ESCs were also toxic to tobacco, a

nonhost plant of E. fawcettii. Similarly, addition of antioxidants also provided some protection

against the toxicity of ESCs, indicating a nonhost specificity of ESCs. The antioxidants bixin,

DABCO and ascorbic acid but not a-tocopherol decreased the toxicity of ESCs in culture and

provided some protection on detached rough lemon leaves. However, the concentrations required

for protection inplanta were far higher than those in culture, likely owing to the poor penetration

of antioxidants through the cuticle. Both ascorbic acid and the reduced form of glutathione were

also effective in protecting citrus cells against ESCs. By contrast, L-cysteine and a-tocopherol

had little or no effect on cellular protection against ESCs in culture and on citrus leaves.

Application of a-tocopherol alone at a concentration of 500 mM on young rough lemon leaves

induced necrosis. However, a-tocopherol provided some levels of protection against the toxicity

of ESCs to tobacco cells. a-tocopherol, with a well-known ability to terminate radical chain

oxidation by binding to cell membranes, has been often used in studies of nutritional or cell









membrane functions (Tinberg and Barber 1970; Tappel 1972). The requirement of a-tocopherol

binding to membranes may contribute to its ineffectiveness in cellular protection against ESCs

for citrus protoplasts and leaf tissues.

Photosensitizing compounds are able to generate reactive oxygen species upon activation

by light (Yamazaki et al. 1975; Daub 1982a; Dobrowolski and Foote 1983; Spikes 1989; Girotti

1990). Results derived from this study on the toxic effect of ESCs in vitro and in vivo confirm

that ESCs are damaging to citrus cells by the production of both 02'- and 102. This study has

demonstrated that antioxidants such as bixin, DABCO, and others capable of quenching 102

provide substantial protection from the toxicity of ESCs in both cultured citrus and tobacco cells

and on rough lemon leaves. Production of 102 by ESCs was confirmed by successful detection of

the cholesterol. 5a-hydroperoxide that is solely produced through the oxidation of cholesterol by

02 (Kulig and Smith 1973), which is one of the best indications of 102 production versus

production of 02- and other free radicals (Smith et al. 1973). Oxidation of cholesterol by 02'-,

UV or other radicals often generates multiple products, mainly the 7a- and 7p-hydroperoxides,

but never produce the 5a-hydroperoxide (Smith et al. 1973). By contrast, the oxidizing reaction

of 102 with cholesterol primarily produces the 5a-hydroperoxide. Addition of p-carotene, an

effective 102 quencher, completely prevented the production of the 5a-hydroperoxide by

hematoporphyrin, cercosporin and ESCs. Therefore, positive detection of the cholesterol 5a-

hydroperoxide indicates that ESCs were able to generate 102 after exposure to light. Singlet

oxygen is highly reactive and has been shown to be toxic to a wide range of cells (Foote and

Denny 1968; Foote et al. 1970; Daub and Ehrenshaft 2000). The results strongly implicate the

involvement of 102 in the toxicity of ESCs because 102 quenchers reduced cultured citrus cell

mortality and prevented necrosis on host leaves.









Production of O2'- by ESCs was demonstrated by a superoxide production assay used to

determine SOD enzymatic activity with NTB as substrate (Beruchamp and Fridovich 1971; Daub

and Hangarter 1983). It seemed that ESCs produced 02-' more efficiently than cercosporin.

Reduction of NTB induced by ESCs was inhibited by adding the 02' scavenging enzyme (SOD)

but not the 102 quencher, providing evidence to support that photodynamic reaction of ESCs also

generates 02'-. The detection of 02'- has important implication for involvement in ESC toxicity

since 02' also is toxic in biological systems.

To explore the potential toxic mechanisms of ESCs, electrolyte leakage of rough lemon

leaf discs was measured after treatment with ESCs. Treatment with ESCs under light induced

higher electrolyte leakage than water or solvent controls. The results suggested that ESCs

damage cell membranes, likely by inducing lipid peroxidation as demonstrated in cercosporin-

treated tobacco tissues (Daub 1982b). Unlike the rapidly (< 2 min) induced electrolyte leakage

caused by cercosporin in tobacco, ESC-induced ion leakage was not observed until several hours

after irradiation, indicating that the toxic activity on citrus membranes might not be direct.

Alternatively, this slow response of electrolyte leakage might result from the complexity of cell

membranes of citrus or the structure of its cuticle. Disruption of cell membranes followed by

nutrient release is beneficial to the invading pathogen. Therefore, ESCs may play a critical role

in pathogenesis during fungal penetration and colonization.









F, -- ---- R,

1 -0.68


2 -0.50




0.21- 3 -0.22

4 -0.11
5 A --0.06

CR ESCs


Figure 2-1. Thin-layer chromatography analysis of elsinochromes (ESCs) produced by Elsinoe
fawcettii and compared to cercosporin (CR) extracted from a tobacco pathogen,
Cercospora nicotianae. ESCs were extracted from agar plugs containing fungal
mycelium with acetone, spotted onto a silica gel plate, and separated with chloroform
and ethyl acetate, resulting in five distinct (red/orange) bands with Rfvalues (1-5).













ESC crude extracts A






II '-----------------------------I ------ -F ---------

+00 +50 500 550 oo00 50
03 ESC band C

025

01




+00 +50 500 550 00 o
O. ESC band 4 E








400 +3 50 M550 CM C

Os Acetone G


01



0


400 t.0 500 550 go 50


/03 ESC band 1 B

02


01



+000 100 550 o00 O50

ESC band 3 D




02 \

0 --------- ----- ---- .---7-- .
03
WO0 0 00 550 100 50

ESC band 5 F


02

01


400 300 500 __ 50


S 4 5 H



0.4 08



400 450 500 550 600 650


Wavelength (nm) Wavelength (nm)

Figure 2-2. Absorption spectrum of the acetone crude extracts of ESCs (A), and individual
bands, 1, 2, 3, 4 and 5, recovered from TLC plate (B, C, D, E, and F), showing three
major peaks at 460, 530 and 570 nm. Solvent alone (acetone) and pure cercosporin
(CR) (Sigma-Aldrich) were also used as controls (G and H).









KOH + Na2CO3+
ESCsAcetone ESCsAcetone







Sodium dithionite (Na204S2)
added under fluorescent light

:# t




MIlr


KOH +
ESCsAcetone



ri-rI


I


NaCO,+
ESCsAcetone
r*****-" mam


Figure 2-3. Chemical properties of phenolic quinines of the acetone extracted ESCs. The
red/orange pigments appear bright green in color when dissolved in aqueous KOH or
sodium carbonate. A) The green color was changed to a pink color when alkaline
sodium dithionite was added. B) The green color was changed to yellow/greenish
fluorescence immediately after treated with zinc dust in acidic conditions under UV
light (365 nm). In all cases, acetone alone was used as a negative control.


Acetic acid and Zinc dust
added
under 365 nm UV
t t











A. 100

80
a(
u 60
aD
40
0-
20

0




B. 100

so
SO'
(a 60
u
aD
40
-_
20

0


Light


0 1 2


3 4
Time (h)
Light


5 6


0 0.5 1 1.5 2 3 4
Time (h)


C. 100

co 80

60

4 40

20

0-
0.0 0.5 1.0 15
Time (h)


211 2.5


Dark


100

0 0





A B
O, A, Untreated
A, C, 5 pM ESCs


Dark



a)
__
2@M


o 05 1 15 2 3
Time (h)
O, Untreated
], 1 pM CR
A, 1 pM ESCs


C D
a, B, Acetone (2.5 IL)
A, D, 10 pM ESCs


, Acetone (1.25 pL)
, 5 pM CR
A,5 pM ESCs


Dark


Time (h)


O, Untreated
I, 5 pM CR
A, 5 pM ESCs


, Acetone (2.5 pL)
I, 10 pM CR
A, 10 pM ESCs


Figure 2-4. Reduction of live cells (%) of citrus protoplasts (A), tobacco protoplasts (B), or
suspension-cultured tobacco cells (C) treated with elsinochrome (ESC) phytotoxins
produced by Elsinoefawcettii or Cercosporin (CR) toxin extracted from a tobacco
pathogen, Cercospora nicotianae, and incubated under constant fluorescent light or in
the darkness. Cell viability of citrus protoplasts in the darkness was determined only
at 6 h after incubation (A). Insets indicate viability of plant cells incubated in the dark.
Data represent the means of two different experiments with at least three replicates.
Vertical bars represent standard deviation.


IF.










100

80

60

40

20
Bixin



100

80

60

40

20
Ascorbic acid

0 1 2 3 4 5 6

100

80

60

40

20
2 a-tocopherol

E 0 1 2 3 4
Time (h)


100

80

60

40

20
DABCO


100 -

80

60

40



0
Reduced glutathione

S0 1 2 3 4 5 6

100

80

60

40

20
L-cysteine
F 0 1 2 3 4

Time (h)


Figure 2-5. Cell viability (% live cells) of citrus protoplasts after treatment with elsinochromes
(ESCs) isolated from Elsinoefawcettii with and without antioxidant compounds: A)
400 iM bixin (carotenoid carboxylic acid); B) 2 mM DABCO (1,4-diazabicyco
octane); C) 4 mM L-ascorbic acid; D) 4 mM reduced glutathione; E) 4 mM a-
tocopherol; and F) 4 mM L-cysteine. Citrus protoplasts (1 x 106) were mixed with or
without ESCs (5 riM, cercosporin equivalent) and antioxidants as indicated under
constant fluorescent light. The controls were treated with acetone-H20 or acetone-
95% ethanol as appropriate. Data represent the means of two different experiments
with at least three replicates. Vertical bars represent standard deviation. Open circles,
control; closed circles, antioxidant; open triangles, ESCs; closed squares, ESCs +
antioxidant.










100


so0 \


60 60-

40 40-

20 20 DABCO

o0 A a-A 0
A 0 2 4 6 8 10 12 24 B 0 2 4 6 10 12 24
100 100


-tocopherol
60 60

A 40 40

20 20
Ascorbic acid
0 0
0 2 4 6 8 10 12 24 0 2 4 6 8 10 12 24

Time (h) Time (h)

Figure 2-6. Cell viability (% live cells) in suspension-cultured tobacco cells by 1 M
elsinochromes (ESCs) with antioxidants (400 iM bixin (carotenoid carboxylic acid),
2 mM DABCO (1,4-diazabicyco octane), 4 mM of L-ascorbic acid, or a-tocopherol).
Tobacco cells (1 x 106) were treated with ESCs in the presence or absence of
antioxidants, as indicated, and incubated under constant fluorescent light. Data
represent the means of two different experiments with at least three replicates.
Vertical bars represent standard deviation. Open circles, control (1 iL acetone-
ethanol); closed circles, antioxidant; open triangles, ESCs; closed squares, ESCs +
antioxidant.


100 I

so =














Mock

~^,.


Bixirn


Asco
ac

C


I;


ESCs


ESCs
& bixin


I.


)ck E





ES

rbi.: c
id a
1
)rbi, c
id L a


SCs


Cs

orbic
:id


ESCs
DAB(T, I &
DABCO

B I


Mock


a-toc :,:Ie ,'

D


Figure 2-7. Development of necrotic lesions on detached rough lemon leaves after a 10-day
application of 1 mM elsinochromes (ESCs) from Elsinoefawcettii, and prevention of
necrosis by co-application of antioxidants, A) 100 mM bixin (carotenoid carboxylic
acid), B) 300 mM of DABCO (1,4-diazabicyco octane), C) 300 mM L-ascorbic acid,
or D) 500 mM a-tocopherol). Citrus leaves were treated with or without ESCs and
antioxidants as indicated and incubated in a moist chamber under a constant
fluorescent light. The mocks were treated with equal volume (3 uL) of water, 95%
ethanol, and/or acetone as appropriate.


Mock


ESCs


M




























o 1




I
ES~s & SOD SCC,











ESCs & Hyperoxidase HII-1' i::1- + -

Figure 2-8. Development of necrotic lesions on detached rough lemon leaves 10 days after
application of 100 [tM elsinochromes (ESCs) from Elsinoefawcettii. Co-application
of ESCs and 100 [tM superoxide dismutase (SOD) or 100 [tg tL-1 hyperoxidase
prevents lesion formation induced by ESCs alone. Citrus leaves were treated with or
without ESCs and superoxide dismutase and hyperoxidase as indicated and incubated
in a moist chamber under a constant fluorescent light. The mocks were treated with
equal volume (3 tiL) of water and/or acetone as appropriate.











025 a u0 -

02 b 0.06


Time (m d e(min)
0.1 5


0 04

0 10 30 0 2 4 6 10
Time (min) Time (min)
C
0.2 ESCs + DABCO
ESCs
0.15

0 o.1


0.05



0 10 20 30
Time (min)

Figure 2-9. Superoxide production assays based on the reduction of nitrotetrazolium blue
chloride (NBT) as substrate. A) Spectrophotometric absorbance of elsinochromes
(ESCs) alone (open bars) or ESCs treated with NBT with (hatched bars) or without
(closed bars) superoxide dismutase (SOD) in the 3-(N-morpholino) propanesulfonic
acid (MOPS) buffer at 560 nm. B) Accumulation of superoxide ions (02O-) by
photosensitizing compounds riboflavin (circles), cercosporin (squares) extracted from
Cercospora nicotianae, and ESCs (triangles) extracted from cultures of Elsinoe
fawcettii after irradiation with light. The respective photosensitizers were dissolved in
buffer and used as the blanks. C) Suppression of ESC-induced superoxide
accumulation by addition of SOD but not DABCO (1,4-diazabicyco octane).
Reactions were carried out in the MOPS buffer solution containing 2.5 mM NBT, 10
mM methionine, and 10 atM of cercosporin or ESCs, or 2aM riboflavin, and/or SOD
(1mg mL-1) or DABCO (1 mM), and absorbance at 560 nm (A560) measured. Vertical
bars represent standard deviation. Means followed by the same letter are not different
at judged by Duncan's multiple range test at P < 0.0001.











8 -carotenE








B


S-carotene








c a

8 -carotene
A


HP
+


HP
+


CR


CR


ESCs
f


ESCs
+


9



V CR ESCs
uv
+ +
r~------


Figure 2-10. Oxidation of cholesterol by photosensitizers: hematoporphyrin (HP), cercosporin
(CR), and elsinochromes (ESCs) under light. Cholesterol (200 mg) was dissolved in
pyridine, mixed with photosensitizers with or without p-carotene, as indicated, and
incubated for 5 h. The oxidized products were separated by thin-layer
chromatography (TLC) with a hexane-isopropanol 9 : 1 (v : v) (A) or 24 : 1 (v : v) (B,
C) solvent system. Cholesterol 5a-hydroperoxide (Rf0.4 or 0.1 in solvent A or B)
formed distinct bands after staining with 1 % of N,N-dimethyl-p-phenylenediamine.
Radiation of cholesterol to UV light for 24 h resulted in multiple products, but no
cholesterol 5a-hydroperoxide (C). Untreated cholesterol (in chloroform) was not
visible after staining with the chromogen (C).


b .8W


*-- Rf 0.4


ERf 0.1













SRf 0. 1


e


I























H20 S ESC
dark


HO S ESC
light


--H20
S---Acetone (7%)
S ---ESCs (2 mM)


0 12 24 36 48 60 72 84

Figure 2-11. Leakage of electrolytes from illuminated rough lemon leaf discs treated with
elsinochromes (ESCs). A) Light increased electrolyte leakage of citrus leaf discs
treated with ESC compared with those treated with water or acetone (S) alone at 24 h.
B) Increasing electrolyte leakage of rough lemon leaf discs over time after treatment
with ESCs in the light. Water, open circles; acetone, closed circles; ESCs, triangles.
Data represent the means of two different experiments with five replicates. Vertical
bars represent standard deviation. Means followed by the same letter are not different
at judged by Duncan's multiple range test at P < 0.0001.


30


20


10









CHAPTER 3
ENVIRONMENTAL FACTORS AFFECTING PRODUCTION OF ELSINOCHROMES BY
Elsino fawcettii

Elsinochromes (ESCs), light-activated phytotoxins, are produced by many Elsinoe isolates

and are required for fungal virulence. In this chapter, the effects of environmental factors in

relation to ESC accumulation are investigated. The effects of environmental signals such as light,

pH, medium compositions, carbon and nitrogen sources, ions, and antioxidants on fungal radial

growth and ESC production by E. fawcettii were evaluated. Light and media compositions

influenced ESC production considerably. E. fawcettii produced the highest titers of ESCs on

PDA compared to other media tested. Production of ESCs was stimulated when the fungus was

grown in a medium with ample carbon sources or under nitrogen starvation stress. An increase in

ESC production correlated with an increase in the ambient pH. A reduction in ESC production

was observed when antioxidant agents such as cysteine, DABCO and glutathione, were

exogenously amended into PDA. Ascorbate dramatically enhanced ESC production. Addition of

ions such as CaC12-2H2O, Ca(N03)2-4H20, CoC12-6H20, or LiCl decreased ESC production,

whereas other ions tested markedly enhanced ESC production. Production of ESCs was also

affected by the presence of multiple colonies and the distance between two colonies on the same

agar plate, indicating that nutrient competition resulting in nitrogen depletion promoted ESC

production.

Introduction

Elsinoefawcettii, the causal agent of citrus scab, produces elsinochromes (ESCs) (Liao and

Chung 2008a). ESCs are phytotoxins produced by many species of Elsinoe (Weiss et al. 1987).

ESCs have been investigated as a fungal virulence factor since ESCs produce toxic reactive

oxygen species (ROS) (Liao and Chung 2008a; 2008b).









Production and accumulation of secondary metabolites by microbes are often regulated by

a number of environmental and nutritional factors. Physical parameters which affect production

of secondary metabolites include light intensity, temperature, and pH. Nutritional factors such as

carbon source and nitrogen source also affect production of secondary metabolites. Although

significant progress has been made in identifying the environmental factors for production of

fungal secondary metabolites, little is known about their role in ESC production in E. fawcettii.

Light has been demonstrated to be required for ESC biosynthesis and toxicity (Liao and

Chung 2008a; 2008b). ESCs were produced when the fungus was incubated under light and

production was markedly suppressed in the dark. In addition, ESCs having structures similar to

many photosensitizing compounds have been shown to produce reactive oxygen species in a

light-dependent manner (Daub et al. 2005; Liao and Chung 2008b). In Aspergillus species,

production of sterigmatocystin and aflatoxin was regulated by carbon sources (Calvo et al.

2002). Nitrogen sources have diverse effects in regulation of secondary metabolites. For example,

sterigmatocystin and aflatoxin were produced in ammonium-based media (Keller et al. 1997;

Morrice et al. 1998), whereas production of alternariol (AOH) and altemariol monomethyl ether

(AME) by Alternaria alternate (Orvehed et al. 1988) was inhibited by nitrogen. Ambient pH has

been reported to serve as a regulatory of production of many fungal secondary metabolites, such

as aflatoxin, sterigmatocystin, and penicillin (Cotty 1988; Shah et al. 1991; Keller et al. 1997). In

Aspergillus spp., production of fungal secondary metabolites was controlled by complex

regulatory networks involved in the G-protein/c-AMP/protein kinase signaling cascades in

response to environmental factors (Calvo et al. 2002).

Antioxidants, such as butylated hydroxyanisol (BHA) and prophy paraben (PP) have been

shown to inhibit fungal growth and toxin production by Fusarium verticillioides and F.









proliferatum (Reynoso et al. 2002; Famochi et al. 2004). Further, phenolic antioxidants inhibit

ochratoxin A and aflatoxin B production by Aspergillus species (Palumbo et al. 2007; Passone et

al. 2005).

Extrinsic ions are also known to affect toxin production in fungi (Marsh et al. 1975; Cuero

et al. 1988; Jackson et al. 1989). For example, Zn2+, Fe2+, and Cu2+ affect production of

aflatoxins in Aspergillusflavus and zearalenone in Fusarium graminearum (Cuero et al. 2003;

Cuero and Ouellet 2005). Normally, metal ions influence accumulation of fungal toxins via

controlling expression of the genes whose products are required for toxin biosynthesis. In this

study, environmental signals were demonstrated to have multiple effects on ESC production. For

example, co-culturing multiple colonies of E. fawcettii on the same medium tends to trigger early

production of ESCs and the distance between two colonies affects the timing of ESC production.

Materials and Methods

Fungal Strains, Maintenance, and Culture Conditions

The origin ofElsinoefawcettii Bitancourt & Jenkins (anamorph: Sphacelomafawcettii

Jenkins) isolate CAL WH-1 and the EfPKS] null mutants from this isolate used in this study

have been previously described (Chapter 2; Liao and Chung 2008b). Fungi were grown on a

sterilized filter paper, and stored at -20 OC for long-term storage.

The basal media used for fungal growth and toxin production included: potato dextrose

agar (PDA, difco, Becton, Dickinson and Company, Sparks, MD), a complete medium (CM)

containing 1 g Ca (NO3)-4H20, 0.2g KH2PO4, 0.25g MgSO4-7H20, 0.15g NaC1, 10g glucose, Ig

each of yeast extract and casein hydrolysate, and 15g agar per liter (Jenns et al. 1989), and a

minimal medium (MM) containing all components of CM but omitting yeast extract and casein

hydrolysate. The pH of media was adjusted by 0.1 M phosphate buffer as described (You et al.









2007). Glucose or sodium nitrate in CM medium was substituted with equal molarity of other

appropriate carbon or nitrogen sources.

To prepare fungal inoculum, the 5-day-old mycelium cultured on PDA under continuous

fluorescence light at an intensity of 3.5 J m-2 s-1 was minced with a sterile blender and suspended

in sterilized water. Hyphal suspension (3 [iL) was placed on the surface of the test medium (5

mL) in a 60 x 15 mm Petri dish and the plates were incubated under constant light at 25 C. The

plates were wrapped with aluminum foil for the dark control and incubated under the same

conditions. Fungal growth was determined by colony diameter (millimeters, mm) 3 weeks after

incubation and was measured prior to ESC extraction.

ESC Purification and Quantification

For ESC purification and quantification, four 7-mm diameter agar plugs cut from mycelial

cultures were extracted with 5N KOH in the dark for 16 hr, and the extracts were measured at

480 nm by a model Genesys 5 spectrophotometer (Spectromic Instruments, Rochester, NY). The

ESC concentration was calculated using a molar extinction coefficient of 23,300 (Yamazaki and

Ogawa 1972) and was reported as nano moles per agar plug.

Statistical Analysis

Data were analyzed by ANOVA using SAS (PROCGLM) for PC (SAS Institute Inc., Cary,

N.C.). When differences were significant (P < 0.05), individual treatment means were separated

using Ducan's Multiple Range Test (P = 0.05). Data are the means of two different experiments

with at least three replicates.

Preparation of Chemicals

Compounds CaC12-2H2O, Ca(NH3)2-4H20, LiC1, MgC12-6H20, NaCl and KC1 were

purchased from Fisher Scientific (Fair Lawn, NJ.), while all other chemicals used in this study

were purchased from Sigma (St. Louis, Mo.). Chemicals were dissolved in water to prepare stock









solutions as appropriate. All aqueous solutions were sterilized by filtration. All the chemical

stock solutions were added to solid media. An equal volume of sterile distilled water was added

as the mock control.

Results and Discussion

Fungal Growth and ESC Production in Response to Light, Media Components and pH

As assessed on PDA, E. fawcettii produced high amounts of ESCs under constant light

(Fig. 3-1A). Accumulation of ESCs significantly decreased (P < 0.01%) when the test fungus

was grown under the conditions alternating in a cycle of 12-h light and 12-h dark. ESC

production was almost completely suppressed when the fungus grown under darkness. E.

fawcettii grew slightly faster under light but there was no significant difference between

treatments. The results indicated that light is a critical factor for ESC production. Under constant

light, production of ESCs by the E. fawcettii isolate was highest when the fungus was grown on

PDA and significantly reduced when grown on CM or MM (Fig. 3-1B). Fungal growth was also

concomitantly affected. Minimum medium (MM) has of the same ingredients in CM, except

yeast extract and casein hydrolysate. MM and CM supported equivalent fungal radial growth, but

the fungus produced much less ESCs on CM than on MM, indicating that yeast extract and/or

casein hydrolysate had a negative effect on ESC production.

Effects of pH for fungal growth and ESC production were also tested (Fig. 3-2). A close

correlation between ESC production and pH was observed, i.e., accumulation of ESCs increased

as the pH of medium was elevated (Fig. 3-2). Thus, E. fawcettii alkaline conditions were most

favorable for production of ESCs. By contrast, fungal radial growth was slightly greater under

acidic pH.









Carbon Sources on Fungal Growth and ESC Production

As tested on CM, production of ESCs by E. fawcettii was enhanced when glucose was

used as a sole carbon source, in a concentration-dependent manner (Fig. 3-3). Substitution of

glucose with sucrose as the sole carbon source significantly enhanced ESC production, whereas

replacement of glucose with mannitol non-significantly reduced ESC production. Apparently, the

test fungus preferred higher amounts of carbon sources for radial growth and utilized the four

carbon sources equally well.

Carbon sources generally have diverse effects on fungal development and production of

secondary metabolites. Production of aflatoxin by Aspergillus spp. was greatly enhanced when

fungi were cultured in the glucose-containing medium, but not the mannitol-containing medium

(Calvo et al. 2002). However, E. fawcettii can utilize glucose or mannitol efficiently for ESC

production. Given that ESC is synthesized by a polyketide pathway, likely by condensation of

acetyl-CoA and malonyl-CoA (Liao and Chung 2008b), one would expect that high

concentration of carbon sources enhances the acetyl-CoA pool via glycolysis, and thus, boost the

ESC biosynthesis.

Effects of Inorganic and Organic Nitrogen on Fungal Growth and ESC Production

To determine if ESC production is affected by nitrogen sources, sodium nitrate in MM was

substituted with ammonium chloride, ammonium nitrate, glutamine, or glycine at various

concentrations as the sole nitrogen source and ESC production was measured. Ammonium

chloride and ammonium nitrate suppressed ESC production but only slightly affected fungal

radial growth (Fig. 3-4A). At higher concentration (4g L1) of ammonium chloride and

ammonium nitrate, production of ESCs was inhibited completely. ESC production was inhibited

when glutamine but not glycine was used as the sole nitrogen source even though fungal growth

was slightly stimulated (Fig. 3-4B). In a prior study, expression of the EfPKS] gene has been









shown to be regulated by carbon/nitrogen sources and pH (Liao and Chung 2008b). In addition,

several binding elements that are recognized and bound by global transcription factors for

specific gene expression, such as C/EBP (cAMP-inducible genes), AreA (nitrogen or light

regulatory genes), WC1/WC2 (light regulatory genes) and PacC (pH responsive genes), were

found in the promoter region of the EfPKS] gene, suggesting that environmental signals affected

ESC production via transcriptional activation of the ESC biosynthetic genes.

Effects of Antioxidants on Fungal Growth and ESC Production

Since ESCs generate reactive oxygen species in aerobic conditions upon exposure to light

(Liao and Chung 2008a), experiments were also performed to test if antioxidants such as

ascorbate, cysteine, DABCO, and reduced glutathione influence ESC production and fungal

growth. As tested on MM, addition of cysteine, DABCO, or reduced glutathione at higher

concentration (cysteine at 50 mM, each of DABCO and glutathione at 10 mM) inhibited ESC

production substantially (Fig. 3-5). Cysteine at 100 mM and DABCO at 50 mM completely

inhibited fungal growth. By contrast, addition of ascorbate into MM promoted both fungal

growth and ESC production in a dose-dependent manner (Fig. 3-5). Those antioxidants often

inactivate reactive oxygen species (ROS) and have been previously shown to alleviate the

cellular toxicity of ESCs (Liao and Chung 2008a). This study showed that the antioxidants might

interfere with biosynthesis of ESCs. By contrast, ascorbate, which has been reported to reduce

02 to H202 or to scavenge H202 from generating -OH (hydroxyl radicals) inplanta (Fry 1998),

enhanced both fungal growth and ESC production in this study. However, it is unknown how the

antioxidants inhibit or promote ESC production and fungal growth.

Effects of Ions on ESC Production

Addition of CaC12, Ca(N03)2-4H20, CoC12, or LiCl into PDA decreased ESC production

by E.fawcettii (Fig. 3-6). Metal ions CoC12 at 10 mM and LiCl at 100 mM suppressed fungal









radial growth. Addition of CuC12, FeC13, KC1, MgC12, MnC12, NaC1, or ZnCl2 into PDA elevated

ESC production to various levels, depending on the concentration of the compound tested (Table

3-1). Addition of EGTA, the Ca2+ chelator, enhanced ESC production. Similar inhibitory or

stimulatory effects of ions in PDA were also observed when fungus was cultured in CM (Table

B-1).

Co-culturing Enhances ESC Production

As described above, production of ESCs was influenced by diverse environmental factors.

The stimulatory effect of physical interactions between fungal colonies for ESC production was

observed. When a single colony of E. fawcettii was placed in the center of PDA medium,

accumulation of small amounts of ESCs was observed 10 days after inoculation and

continuously increased as duration of incubation increased (Fig. 3-7A). When three or five spots

(each was separated by 1-cm apart) were inoculated with the same E. fawcettii isolate on a PDA

plate, the rate for ESC production by each inoculated colony was much faster and the magnitude

of ESC accumulation was much higher as visually indicated by red pigment compared to those

produced by a single colony inoculated alone (Fig. 3-7A). Interestingly, ESCs secreted by each

of the colonies tended to diffuse toward one another in medium (Fig. 3-7B). Similar phenomena

were also observed in a distance-response manner when a wild-type isolate was co-cultured with

the EfPKS] null mutants, producing no ESCs (Fig. 3-7C). It is likely that competition for

nutrients, particularly nitrogen source, promoted early production of ESCs.










Table 3-1. Effects of ions and EGTA on ESC production by Elsinoe fawcettii
Treatment Conc. (mM) Mean colony dai. ESCs (nmoles per
(mm) SEM plug), mean + SEM


none


13.5 + 0.4


14.9 + 3.3


CuC12-2H20


0.1
1.0
10.0


FeC13


KC1


10.0

50.0
100.0

50.0
100.0

0.2
1.0
5.0
10.0
100.0

50.0
100.0


MgC12-6H20


MnC12-4H20






NaCl


ZnCl2



EGTA


0.1
1.0
10.0


14.0 + 0.3
13.5 0.9
0.0 + 0.0

14.6 0.4
15.1 0.5
15.3 1.4
16.0 + 0.8
14.3 0.5
0.0 + 0.0

12.5 0.8
11.9 0.5

13.1 0.5
12.3 0.3

14.1 0.3
12.0 + 0.4
12.2 0.6
5.1 0.3
0.0 0.0

12.6. 0.5
12.4 0.2

13.5 0.4
13.8 0.6
0.0 0.0

13.2 0.1
9.3 0.9
8.8 0.8


25.12 + 5.80
27.18 + 2.18
nd1

23.3 + 3.0
17.8 4.0
22.3 + 2.9
26.0 1.8
34.8 2.7
nd

32.8 + 5.2
24.5 + 7.6

36.5 + 7.5
45.7 + 6.2

14.7 2.8
13.9 4.3
24.9 3.2
20.5 + 4.5
nd

15.2 + 6.9
30.4 + 5.4

19.9 + 6.9
19.6 + 3.6
nd

22.6 3.4
17.6 + 2.2
19.2 1.0


'nd, not determined










A Fungal gr h Fungal growth
20 20


1 15 -


10 lgtar : 1 E 10


I i


light light/dark dark PDA CM MM



Figure 3-1. Effects of light (A) and medium compositions (B) on fungal growth and
elsinochrome (ESC) production by E. fawcettii. Insets indicate radial growth of
fungal colonies which were measured before ESC extraction. A) Fungal cultures
grown on PDA were incubated at 25 C under constant light, in complete darkness or
12-h light/dark alternation for 21 days. B) E. fawcettii was cultured on PDA, CM, or
MM, and incubated under constant light for 21 days. ESC was extracted with KOH
and measured at A480 nm. Vertical bars represent standard deviation. Means followed
by the same letter are not different at judged by Duncan's multiple range test at P <
0.0001.










Fungal growth
E 12
50 |


r
40

~4 5 6 7 8 .
SI pH
S30
0- b
CO
0
E
S- 20 b
CO

LUI
10



0

4 5 6 7 8
pH

Figure 3-2. ESC accumulation and growth ofE. fawcettii at different pH on MM. Insets indicate
the diameters of fungal colonies under the appropriate conditions. pH was adjusted to
4 with sodium phosphate buffer (0.1M) buffer and 5N HC1. Vertical bars represent
standard deviation. Means followed by the same letter are not different at judged by
Duncan's multiple range test at P < 0.0001.











50 .
so a ll |



'D 30 -
E c

Sd
e d
de
2 10d ded..

e e ~e a
2 10 30 60 2 10 30 60 2 10 30 60 2 10 30 60
glucose (g/L) mannitol (g/L) sorbitol (g/L) sucrose (g/L)

Figure 3-3. Effects of various carbon sources on fungal growth and ESC production by E.
fawcettii assayed on CM medium. Insets indicate the diameters of fungal colonies
under the appropriate conditions. Different concentration of glucose, mannitol,
sorbitol, and sucrose were used to substitute glucose as the sole carbon source in the
CM medium. Vertical bars represent standard deviation. Means followed by the same
letter are not different at judged by Duncan's multiple range test at P < 0.0001.












a


A s-

:3
g-
CL
aC
0
ID 4-
0
E
2-
CO






B










,)
Lu4

i2-

W0


a n,.l ,h ?,O



NH,CI NH,NO


b b b


2 4 6
NH4NO3(g/L)


' r I 4 1,


2 10 50 10 50 100 200
glutamine (mM) glycine (mM)


Figure 3-4. Effects of nitrogen sources on fungal growth and ESC production by E. fawcettii
assayed in MM medium. A) Ammonium chloride and ammonium nitrate suppressed
ESC production. B) ESC production was inhibited when glutamine but not glycine
was used as the sole nitrogen source. Insets indicate the diameters of fungal colonies
under the appropriate conditions for 21 days. Vertical bars represent standard
deviation. Means followed by the same letter are not different at judged by Duncan's
multiple range test at P < 0.001.


NI b b
2 4 6
NH4CI (g/L)















Cysteine


10 50


0
mM


D


20


n-15
CL
CJ
0 10
E

( 5


0
mM


- 2 10


1 10


1 10 50 100


Figure 3-5. Effects of antioxidatants, A) cysteine, B) DABCO (1,4-diazabicyco octane), C)
glutathione, and D) ascorbate on ESC production by E. fawcettii in MM medium.
Insets indicate the diameters of fungal colonies under the appropriate conditions for
21 days. Vertical bars represent standard deviation. Means followed by the same
letter are not different at judged by Duncan's multiple range test at P < 0.001.


0mM
rnM


0
mM











CaCI2/
Ca(NO3)2-4H2C
a

i


A

20
-3


Lu 12
O


o
C -
mM 4

0
mM


1111111_
mM 10 5010020010100
CaCI-2Hp Ca(NO 3)
4H20


200 10 100
Ca(NO3)24 H20


WNVO
Ca(N03) -4H20


Ca(NO0)2.4H20 (mM) 4


a


b


Fungal growth

CoCI,-6H2O

a ab | t
---


-a
D15
1O
0
10
c)
Co
wO
" 5


b


01
mM


mM 10 50 100


10 50 100


Figure 3-6. Inhibition of ESC production by Ca2+, Co2+, and Li2+ in E. fawcettii. Insets indicate
the diameters of fungal colonies under the appropriate conditions. In A, C, and D, the
fungus was grown on PDA medium either in the absence or presence of different
concentration of ions. B) Fungus was grown at MM medium with (+) or without (-)
the component of Ca(N03)2-4H20. Vertical bars represent standard deviation. Means
followed by the same letter are not different at judged by Duncan's multiple range
test at P < 0.01.


10 50 100
CaCI2 2H20


bc
bc bc bc
n n A


LiCI


20


-15-
S15
Ln
_a)

o 10
E

0 -
f5
co


0
mM


b
bec

F-:-


c
T






























9 10


Ifl


11 12 13
(Days)


Figure 3-7. Effects of the number of fungal colonies and the distances on ESC production by E.
fawcettii. Mycelial suspensions were place on PDA with different numbers and
distances and incubated under constant light. A) Production and diffusion of ESCs
were observed 10 (A-1) and 15 (A-2) days after incubation. B) Production of ESCs
on PDA was promoted when three colonies of E. fawcettii were inoculated with 1cm
apart between each and incubated for 9 to 17 days. The arrows indicate the red-
pigment started to accumulate in the side of colonies that are close to another colony
in 9- and 10-day-old cultures. C) The EfPKS1 mutants [Red arrows, D3; blue arrows,
D4 (Liao and Chung 2008b)] were inoculated around the wild type, showing similar
stimulation on ESC production and diffusion from wild type colonies (1, 2, 3, 4) 15
days post-incubation.


I cm


I n-- h









CHAPTER 4
GENETIC DISSECTION DEFINES THE ROLES OF ELSINOCHROME PHYTOTOXIN FOR
FUNGAL PATHOGENESIS AND CONIDIATION OF THE CITRUS PATHOGEN Elsinoe
fawcettii

Elsinochrome pigments produced by many phytopathogenic Elsinoe species are non-host

selective toxins which react with oxygen molecules after light activation to produce highly toxic

reactive oxygen species. This chapter describes the cloning, expression, and functional

characterization of the polyketide synthase-encoding gene, EfPKS], which is required for the

production of elsinochromes (ESCs) and fungal pathogenesis. Target disruption of EfPKS] in E.

fawcettii completely abrogated ESC production, drastically reduced conidiation, and

significantly decreased lesion formation on rough lemon leaves. All mutant phenotypes were

restored to the wild type in fungal strains expressing a functional copy of EfPKS1. Accumulation

of the EfPKS] transcript and ESCs by a wild-type strain appears to be coordinately regulated by

light, nutrients, and pH. The results clearly indicate that the product of EfPKS] is involved in the

biosynthesis of ESCs via a fungal polyketide pathway, and that ESCs play an important role in

fungal pathogenesis.

Introduction

Many phytopathogenic fungi produce perylenequinone pigments, which are light-activated

and nonhost-selective phytotoxins (Daub et al. 2005). For example, the compounds, alteichin,

altertoxin, alterlosin, and stemphyltoxin are produced by Alternaria spp. (Stack et al. 1986;

Davis and Stack 1991) and Stemphylium botryosum (Davis and Stack 1991); cercosporin and

isocercosporin are produced by many Cercospora spp. (Daub et al. 2005); ESCs are produced by

many Elsinoe and Sphaceloma spp. (Weiss et al. 1987; Liao and Chung 2008a); hypomycin A is

produced by Hypomyces spp. (Liu et al. 2001); hypocrellin is produced by Hypocrella bambusae

(Weiss et al. 1987); Shiraia bambusicola (Wu et al. 1989), and phleichrome, calphostin C,









cladochrome, and ent-isophleichrome are produced by Cladosporium spp. (Weiss et al. 1987;

Arnone et al. 1988). Among all phytotoxins identified, perylenequinone toxins are unique

because they contain a chromophore of phenolic quinine that absorbs light energy

(photosensitizers) and produces reactive oxygen species (ROS) such as the hydroxyl radical

(OH'), superoxide (02O-), hydrogen peroxide (H202), and singlet oxygen (102) (Daub and

Ehrenshaft 2000; Daub et al. 2005). Although the biological functions of the light-activated

perylenequinone toxins for the producing fungi remain largely unknown, their production by a

wide range of plant pathogens suggests an important role for these toxins in fungal pathogenesis

(Daub and Ehrenshaft, 2000). Perylenequinone toxins were originally investigated because of

their possible pharmaceutical application (Hudson and Towers 1991) or because of their

potential as food contaminants (Stack et al. 1986). In contrast, the role of perylenequinone toxins

in fungal pathogenesis has been investigated very little compared to many other host-specific

phytotoxins. Only the role of cercosporin in Cercospora diseases has been demonstrated

genetically (Upchurch et al. 1991; Callahan et al. 1999; Shim and Dunkle 2003; Choquer et al.

2005; Choquer et al. 2007; Dekkers et al. 2007).

ESCs are red/orange pigments produced by a number of phytopathogenic Elsinoe species.

ESCs comprise of at least four derivatives (A, B, C, and D) with a common perylenequinone

backbone but differing in side groups (Weiss et al. 1987). The bright red pigments, elsinochrome

A, B, and C were originally isolated from cultures of a pecan pathogen, Elsinoe randii

(anamorph: Sphaceloma randii). Elsinochrome D is likely derived from elsinochrome C by

formation of a methylenedioxy ring. Elsinoefawcettii infects lemons, grapefruit, and some

tangerines and their hybrids, producing exterior blemishes (citrus scab) on the fruit, which is a

serious problem for the fresh-fruit market worldwide. In the previous studies, elsinochrome









pigments were extracted from a field isolate ofE. fawcettii and the production of 102 and 0O'- by

ESCs upon exposure to light was demonstrated (Chapter 2; Liao and Chung 2008a). Crude

extracts containing a mixture of five elsinochrome derivatives from E. fawcettii cultures were

shown to be highly toxic to citrus and tobacco cells in suspension culture, and induced

electrolyte leakage of host leaves. The toxicity of ESCs was reduced considerably when 102

quenchers such as bixin, ascorbate, and reduced glutathione were present. Furthermore, ESCs

induced necrosis on rough lemon leaves when exposed to visible light, and the development of

necrosis was reduced by co-applying 102 quenchers (Liao and Chung 2008a). Thus ESCs

function as photosensitizing compounds that are toxic to plant cells by generating 102 and 02'.

Discovery of ESCs' toxicity to the plants led to studies of the role of ESCs in fungal

pathogenesis and the molecular mechanisms leading to its biosynthesis. ESCs were implicated as

the polyketide-derived based on their structural similarity with several perylenequinones.

However, no direct evidence of this structural of ESCs has been established. This chapter

describes the cloning, coordinate expression, and functional characterization of the polyketide

synthase-encoding gene, EfPKS1, for the production of ESCs. This was demonstrated by creating

and analyzing loss-of-function EfPKS] mutants of E. fawcettii. The results indicate that ESCs are

required for fungal pathogenesis.

Materials and Methods

Fungal Isolate and Growth Conditions

The wild type CAL WH-1 isolate that was single-spore isolated from scab affected

calamondin (Citrus madurensis Lour) fruit has been previously characterized (Liao and Chung

2008a; Chapter 2 and 3) and was used as the recipient host for transformation and targeted gene

disruption. This isolate was routinely maintained on potato dextrose agar (PDA, Difco, Sparks,

MD). For toxin production, fungal mycelia were mincing with a sterile blender, spread on media









and incubated under continuous fluorescent light for 5 or 7 days at room temperature (-25 C).

For generation of protoplasts, fungal isolates were grown in 50 mL of potato dextrose broth

(PDB, Difco) for 7 days, minced, and mixed with fresh PDB (200 mL), and incubated for

additional 15 h. Fungal cultures used for DNA or RNA isolation were grown on media with a

layer of sterile cellophane as previously described (Choquer et al. 2005). Complete medium

(CM), minimal medium (MM), and protoplast regeneration medium (RMM) used in this study

have been described in Chapter 3 and/or elsewhere (Jenns et al. 1989; Chung et al. 2002). The

pH of media was adjusted by 0.1 M phosphate buffer as previously described (You et al. 2007).

Extraction and Analysis of ESC Toxins

Isolation of fungal toxins from culture and TLC analysis are described in chapter 2.

Screening of ESC-deficient mutants was conducted on thin PDA as previously described

(Choquer et al. 2005; Chen et al. 2007).

Molecular Cloning and Analysis of the EfPKS1 Gene

Two degenerate oligonucleotides LCKS 1 (5'-GTNCCNGTNCCRTGCATYTC-3') and

LCKS2 (5'-GAYCCNMGNTTYTTYAAYATG-3') that are complementary to the conserved 3-

keto synthase (KS) domain of fungal type-I polyketide synthase genes (Bingle et al. 1999) were

synthesized and used for amplification from E. fawcettii genomic DNA using Taq DNA

polymerase (GenScript, Piscataway, NJ). The amplified DNA fragment (-700 bp) was cloned

into pGEM-T easy vector (Promega, Madison, WI) for sequencing analysis from both directions

at Eton Bioscience (San Diego, CA). Sequences were blasted against the databases at the

National Center for Biotechnology Information (NCBI) using the BLAST network service

(Altschul et al. 1997) to determine the similarity of the amplified fragment. The full-length

EfPKS] gene was obtained by PCR using a chromosome walking strategy as described

previously (Chen et al. 2005; You et al. 2007) and by PCR with two inverse primers (Table C-l;









Fig. C-l) (Choquer et al. 2005). A chromosome library of E. fawcettii was prepared from

genomic DNA cleaved with four different enzymes (EcoRV, Pvull, Smal and StuI), and ligated

to the adaptors from the Universal Genome Walker kit following the manufacturer's instructions

(BD Biosciences, San Jose, CA). To walk upstream and downstream into unknown genomic

regions, primer were synthesized to complement the known regions and used for multiple rounds

of PCR amplification with adaptor primers supplied with the kit. For PCR with inverse primers,

fungal DNA was digested with restriction endonucleases, self-ligated, and used as a template for

amplification. Oligonucleotide primers used for PCR amplification and sequence analysis were

synthesized by Integrated DNA Technologies (Coralville, IA), Allele Biotechnology and

Pharmaceuticals (San Diego, CA), respectively. Open reading frame (ORF) and exon/intron

positions were predicted using the Softberry gene finding software and confirmed by

comparisons of genomic and cDNA sequences. Functional domains were predicted according to

the PROSITE database using ExPASy (Gasteiger et al. 2003) or Motif/ProDom and Block

programs (Henikoff et al. 2000). Analysis of the promoter region was conducted using regulatory

sequence analysis tools (van Helden 2003).

Targeted Gene Disruption

To disrupt the EfPKS] gene in E. fawcettii, a 5.8-kb DNA fragment encompassing the

EfPKS] ORF was obtained by PCR with primers efup3 (5'-

CAATTACGCGAATGGGTCACAGAGC-3') and efdown 11(5'-

CGTCAAGGACATCAGCGAGTC-3'). The amplified DNA fragment was purified with a DNA

purification kit (Mo Bio Laboratories, Carlsbad, CA), and cloned into pGEM-T easy vector to

create pSPKS0311. A 1.3-kb EcoRV-KpnI DNA fragment, corresponding to the conserved acyl

transferase (AT) domain of EfPKS 1, was removed and replaced with an end-filled 2.1-kb

fragment harboring the hygromycin phosphotransferase B gene (HYG) cassette under the control









of the Aspergillus nidulans trpC gene promoter from pUCATPH (Lu et al., 1994) to yield the

disruption construct, pPKS0311 (Fig. 4-4A). A split marker strategy was used to enhance the

efficiency of double crossing-over recombination as previously described (Choquer et al. 2005).

A 4.6-kb DNA fragment containing truncated 5' EfPKS] fused with 3' HYG and a 3.3-kb

fragment encompassing 3' EfPKS] joined with 5' HYG were amplified, respectively, with

primers efup3/hygl (5'-AGGAGGGCGTGGATATGTCCTGCGGG-3') and efdown 1l/hyg2

(5'-CCGACAGTCCCGGCTCCGGATCGG-3') from pPKS0311 using the Takara Ex Tar PCR

system (Takara Bio USA, Madison, WI). Fungal protoplasts were prepared by the method of

Chung et al. (2002) except that hyphae were incubated with cell wall degrading enzyme cocktails

for 6 h instead of 2 h. The resulting DNA fragments were mixed and transformed into protoplasts

(1 x 105) of wild type using CaC12 and polyethylene glycol as previously described (Chung et al.

2002). The two hybrid fragments share 400-bp of overlapping sequence within the HYG gene.

The HYG gene is not functional unless recombination occurs between the two truncated HYG

DNA fragments. Fungal transformants appearing on RMM medium supplementing with 200 pg

mL-1 hygromycin (Roche Applied Science, Indianapolis, IN) after 2 to 3 weeks were selected

and tested for lack of ESC production (red/orange pigments) on thin PDA.

Genetic Complementation

For genetic complementation, a DNA fragment (8.4 kb) including the entire EfPKS] ORF

and its endogenous promoter was amplified from genomic DNA with primers efup3 and efdown

18 (5'-CTTTCGTCGTCGGCCCAAC-3') by an Expand High Fidelity PCR system (Roche

Applied Science) and co-transformed with plasmid pBarKS1 carrying a phosphinothrin

acetyltransferase gene responsible for bialaphos resistance under control of the A. nidulans trpC

promoter (Pall and Brunelli 1993) into an EfPKS] disruptant (D4). Transformants were selected









against 100 [g mL-1 of DL-phosphinothricin (chlorimuron ethyl; Chem Service, West Chester,

PA) and tested for restoration of ESC production.

Miscellaneous Methods of Processing Nucleic Acids

Fungal DNA was isolated with a DNeasy Plant kit (Qiagen, Valencia, CA). Standard

procedures were used for endonuclease digestion of DNA, electrophoresis, and Southern-and

Northern-blot hybridizations. Plasmid DNA was purified using a Wizard DNA purification kit

(Promega) from transformed Escherichia coli DH5a bacterial cells. Fungal RNA was extracted

with Trizol reagent (Invitrogen, Carlsbad, CA). Double stranded cDNA of EfPKS1 was

synthesized with a cDNA synthesis kit (BD Biosciences) following the manufacturer's

instructions and amplified with gene-specific primers. The amplified fragments were purified

and directly subjected to sequence analysis. DNA probes used for hybridization were labeled

with digoxigenin (DIG)-11-dUTP (Roche Applied Science) by PCR with gene-specific primers.

The manufacturer's recommendations were followed for probe labeling, hybridization, post-

hybridization washing and immunological detection of the probe using a CSPD

chemofluorescent substrate for alkaline phosphatase (Roche Applied Science).

Preparation of Fungal Inoculum and Pathogenicity Assays

Assays for fungal pathogenicity were conducted on detached rough lemon (Citrusjambhiri

Lush) leaves inoculated with conidial suspension or agar plugs covered with fungal hyphae.

Rough lemon is susceptible to all Elsinoe pathotypes of citrus (Timmer et al. 1996). Conidia

were prepared as described by Timmer and colleagues (1996) with modifications. Briefly, fungal

hyphae were minced in Fries medium (Fries 1978), placed on Petri dish (15 x 90 mm), and

incubated for 2 to 3 days in the dark to trigger conidial formation. Rough lemon seedlings were

maintained in a greenhouse and expanding immature leaves of approximately 13-20 mm length

and 4-7 mm width were collected for pathogenicity assays. A conidial suspension (2 pL, 1 x 105









mL-1) was carefully placed on the leaves and the inoculated leaves were incubated in a moist

chamber under constant fluorescence light for lesion formation. Pathogenicity also was evaluated

using agar plugs. Briefly, PDA agar plugs (4 mm in diameter) were cut from mycelial mats

cultured on PDA for 7 days and placed on the underside of rough lemon leaves (-12 days after

emergence). The inoculated leaves were incubated in a mist chamber and examined for lesion

formation daily.

Results

Cloning and Characterization of EfPKS1 Gene

A 0.7-kb DNA fragment was amplified from genomic DNA of E. fawcettii with degenerate

primers designed to anneal to the conserved P-keto-synthase (KS) domains of many type-I fungal

polyketide synthases. Sequence analysis revealed that the amplified fragment has strong

similarity to the KS of PKSs. The gene was named EfPKS] (E. fawcettii polyketide synthase

gene 1). Subsequently, the entire EfPKS] ORF sequences as well as its 5' and 3' nontranslated

regions were obtained by multiple rounds of PCR from chromosome walking library or with two

inverse primers from restriction enzyme-digested and self-ligated DNA pools. As a result, over 8

kb of genomic sequences were obtained, assembled, and deposited within EMBL/GenBank Data

Libraries under accession number EU086466.

Computer prediction and comparison between cDNA and genomic DNA sequences

revealed that EfPKS] contains two exons interrupted by a 52-bp intron near the 5' end of EfPKS]

(data not shown). The intron has characteristic splicing (5'-/gt---ag/-3') and internal lariat

(cta/gat/c) consensus sequences often found in genes of filamentous fungi. Conceptual

translation revealed that EfPKS] encodes a polypeptide containing 2192 amino acids that

displays considerable similarity and identity to numerous type-I PKSs of fungi, particularly those

involved in pigment formation and biosynthesis of secondary metabolites (Fig. 4-1). Similar to









many fungal type-I PKSs, the translated product of EfPKS] has a 0-keto-synthase (KS) domain,

an acyltransferase (AT) domain, two acyl carrier protein (ACP) domains, and a

thioesterase/claisen cyclase (TE/CYC) domain (Fig. 4-1A). Phylogenetic relationships of

EfPKS1 to other fungal polyketide synthases, inferred from the conserved KS or AT domain,

revealed that EfPKS1 is highly similar to the fungal non-reducing PKSs, including those

involved in the biosynthesis of melanin, cercosporin, bikaverin, sirodesmin, aflatoxin, and other

pigments (Fig. 4-1B and C).

Promoter Analysis of EfPKS1 Gene

To gain a better understanding in the regulation of EfPKS] gene expression, I analyzed

1.1-kb sequences upstream of the putative ATG translational start codon of EfPKS] and

identified several putative binding sites for diverse transcriptional regulators (Fig. 4-2). A TATA

box-like sequence (TATATC) on the sense strand was identified 264 bp upstream from the ATG

codon. The promoter region of EfPKS] has multiple GATA consensus motifs, potential binding

sites for the nitrogen-induced AreA (Marzluf 1997) and the light-regulated WC1/WC2 (Linden

et al. 1997) transcriptional activators. The EfPKS] promoter contains four ambient pH-regulated

PacC-binding consensus motifs (GCCARG; Espeso et al. 1997) and multiple cAMP-inducible

C/EBP-binding motifs (CCAAT or CAAT; Rangan et al. 1996). In addition, EfPKS] promoter

contains three MRAGGGR and two CATTCY consensus motifs that have been shown to serve

as binding sites for the conidial formation-related BrlA and AbaA transcriptional activators in A.

nidulans (Adams et al. 1998). Analysis of the complementary strand of the E/PKS] promoter

also identified multiple AreA, WC complex, PacC, C/EBP, and BrlA binding motifs (Fig. 4-2).

Expression and Regulation of EfPKS1 Gene and ESC Production

To determine the factors affecting ESC production and expression of the EfPKS] gene,

fungal cultures were grown on media with different carbon, nitrogen sources, pH values, or









incubated in the light or complete darkness. ESCs were extracted and analyzed by

spectrophotometry and total RNA was extracted and analyzed by Northern-blot hybridization. A

time-course analysis of EfPKS] RNA levels and ESC production revealed that the EfPKS] gene

transcript accumulated to a detectable level by day 3 and was elevated by days 4 and 5 (Fig. 4-

3A). Similarly, ESCs were detected at low concentration at days 3 and 4, yet accumulated

rapidly to high levels at day 5. Accumulation of EfPKS] transcript and ESCs was much higher

when fungal cultures were incubated under continuous light compared to those grown in the dark

(Fig. 4-3B). The EfPKS] gene was preferentially expressed and ESCs accumulated to high levels

when E. fawcettii was cultured in glucose-rich medium under illumination (Fig. 4-3C). By

contrast, ammonium nitrate deprivation stimulated the accumulation of both the EfPKS]

transcript and ESCs (Fig. 4-3D). Both expression of EfPKS] and production of ESCs were

favored when the fungus was grown under alkaline conditions (Fig. 4-3E).

EfPKS1 is Required for ESC Production

The function of EfPKS] in relation to ESC production was determined by targeted gene

disruption in E. fawcettii. A disruption plasmid (pPKS0311) carrying the hygromycin

phosphotransferase B gene (HYG) cassette flanked by truncated EfPKS] sequences on each side

was constructed. Two separate DNA fragments overlapping within the HYG gene (Fig. 4-4A)

were amplified and directly transformed into the wild type E. fawcettii for targeted gene

disruption. In total, 600 transformants were recovered from media containing hygromycin.

Among them, approximately 100 transformants failed to accumulate the red/orange pigments on

PDA after 30-days of incubation under constant light and were considered putative EfPKS]

mutants. Southern-blot analysis of genomic DNA isolated from 13 putative EfPKS] mutants

revealed that all transformants tested were missing the expected 3.5-kb hybridizing band of the

wild-type locus, when fungal DNA was cleaved with restriction endonuclease Clal, and









hybridized to probe I that recognizes sequences in the 5' end of EfPKS] (Fig. 4-4B and data not

shown). All 13 transformants displayed a 5.1-kb hybridizing band as a result of HYG insertion

within EfPKSl. Four mutants had a single 5.1-kb hybridizing band (Fig. 4-4B), whereas the other

nine mutants displayed additional hybridizing signals larger or smaller than 5.1 kb (data not

shown), likely resulting from ectopic insertions. When fungal genomic DNA was cleaved with

Xbal and hybridized to probe II that recognizes the 3' end sequences of EfPKS], an expected

7.9-kb band was detected in wild type (Fig. 4-4C). By contrast, all 13 transformants had a single

4.6-kb hybridizing band resulting from the HYG insertion at EfPKS] locus (Fig. 4-4C and data

not shown). The hybridizing profiles obtained from Southern-blot analysis with two different

probes indicated that EfPKS] of each transformant was replaced with the HYG gene cassette via

homologous integration.

Successful disruption of EfPKS] was confirmed by Northern-blot analysis (Fig. 4-5A). The

DNA probe (probe 3, Fig.4-4A) hybridized to total RNA of wild type displays a 6.6-kb

hybridizing signal. However, the probe failed to detect the EfPKS] transcript in three randomly

selected mutants, indicting that they are EfPKS] null mutants. Quantitative assays of ESC

production by the EfPKS] null mutants after KOH extraction revealed that the null mutants did

not accumulate measurable ESCs compared to wild type (Fig. 4-5B). No ESCs were detected

from the acetone extracts of four null mutants on TLC, indicating the disruption of EfPKS]

completely obliterated ESC production (Fig. 4-5C).

Genetic complementation experiments revealed that the ESC-deficient phenotype of a null

mutant (D4) was reverted by acquiring and expressing a functional EfPKS] gene with its

endogenous promoter (Fig. 4-5C), confirming the requirement for EfPKS] in ESC production in

E. fawcettii.









Disruption ofEfPKS1 Reduces Conidiation

The EfPKS] null mutants displayed normal radial growth comparable to wild type, yet

produced far fewer conidia relative to wild type (Table 4-1). Genetic complementation by

introducing a functional copy of EfPKS] gene into protoplasts of D4 null mutant, resulted in two

transformants with restored conidial production (Table 4-1), indicating a close link between

EfPKS] function and conidiation.

The EfPKS1 Gene is Required for Full Virulence

Since the EfPKS] null mutants were severely defective in conidial production, fungal

pathogenicity was first evaluated on detached rough lemon leaves inoculated with agar plugs cut

from fungal mycelium (without conidia). As shown in Fig. 4-6, inoculation of wild type and two

genetically reverted strains (C and C2) resulted in pink to light brown scab lesions with round

pustules around the edges, whereas the EfPKS] null mutants did not incite any visible lesions.

Quantitative assays indicated that over 65% of the sites inoculated with agar plugs from the

cultures of wild type or the complementation strains developed necrotic lesions (Table 4-1). By

contrast, none of the sites inoculated with EfPKS] null mutants or agar plugs alone produced

visible necrosis.

Pathogenicity assays also were performed on detached leaves inoculated with conidial

suspension. In this assay, only the D4 null mutant was evaluated for pathogenicity because the

other null mutants produced very few conidia. When assayed on young leaves (approximately 3

days after emergence), D4 mutant induced necrotic lesions at rates and magnitudes

indistinguishable from those induced by wild type and the C2 strain genetically expressing a

functional EfPKS] (Fig. 4-7A). Wild type and the C2 strain produced characteristic scab lesions

when inoculated onto older leaves (-7 days after emergence), whereas the D4 null mutant with

similar amounts of conidia (1 x 105 mL-1) incited fewer and smaller lesions presumably due to









lack of the production of ESCs (Fig. 4-7B). Nevertheless, disruption of EfPKS] yielded mutants

that were completely devoid of ESC production and defective in conidiation and scab lesion

formation, indicating that ESCs are a determinant of fungal virulence in E. fawcettii.

Discussion

ESCs, produced by many phytopathogenic fungi of the Elsinoe genus, consist of at least

four derivatives differing mainly in their side groups. In the present study, the fungal EfPKS]

gene was demonstrated to be required for ESC biosynthesis, and thereby ESCs were conclusively

shown to play a role in fungal virulence. The results also indicate that ESCs are synthesized via a

fungal polyketide pathway.

As with many type-I fungal polyketide synthases (Kroken et al. 2003; Choquer et al. 2005;

Keller et al. 2005), the EfPKS] product contains five functional domains, including a KS, an AT,

a TE/CYC, and two ACP domains, which are involved in catalyzing iterative condensations of

acetates and malonates, and chain elongation and cyclization of polyketomethylenes (Watanabe

and Ebizuka 2004). EfPKS1 also has a conserved cysteine residue in the KS domain and

conserved serine residues in the AT, ACP, and TE/CYC domains, similar to other fungal PKSs

belonging to the non-reducing group (Kroken et al. 2003). Integration of a hygromycin-

resistance gene cassette specifically at the EfPKS] locus resulted in fungal mutants that were

completely devoid of ESC production, severely defective in sporulation, and delayed in lesion

development on older rough lemon leaves. The mutant phenotypes were fully complemented in a

strain that genetically acquired and functionally expressed EfPKS1, confirming that mutation of

EfPKS] is responsible for the observed deficiencies and that ESCs are important virulence

factors. Pathogenicity assays on detached rough lemon leaves revealed that E. fawcettii incites

more severe necrotic lesions when inoculated with conidial inoculation compared to mycelium

cut from agar plugs. Although the EfPKS] null mutants were also defective in conidial formation,









reduction of fungal virulence was mainly attributed to the impairment of ESC production rather

than conidial formation and germination. When pathogenicity was evaluated with conidial

suspension, the D4 null mutant induced scab lesions on young leaves (3 days after emergence),

comparable to those induced by the wild type. Hence, the EfPKS1 null mutant was apparently

not deficient in conidial germination. However, the D4 null mutant induced fewer lesions on

older leaves (7 days after emergence) strongly indicating that production of ESCs in essential for

full virulence of E. fawcettii.

Expression of the EfPKS1 gene was correlated with accumulation of ESCs. The EfPKS1

transcript and ESCs accumulated to high levels when the fungus was grown in the light, in the

presence of higher amounts of glucose, at alkaline pH, or in the absence of a nitrogen source.

Differential expression of EfPKS1 in response to various environmental conditions was further

supported by analyzing the promoter region for putative DNA binding sites for global

transcriptional activators. For example, two GATA consensus sites, presumably involved in the

binding of the AreA/Nit2 nitrogen regulatory proteins (Marzluf 1997) and/or the WC1/WC2

light responsive transcriptional regulators (Linden et al. 1997) were identified. The promoter

region of EfPKS1 has three consensus GCCARG motifs that are likely involved in the binding of

the pH-responsive transcriptional regulator, PacC (Espeso et al. 1997). The EfPKS1 promoter

also has multiple CCAAT or CAAT consensus motifs involved in binding cAMP-activated

proteins such as CCAAT/enhancer-binding protein (C/EBP) (Ramji and Foka 2002).

In addition to complete abrogation of ESC production, EfPKS1 null mutants also were

severely defective in conidial production. The ESC-producing phenotype and conidiation were

fully restored by expressing a dominant-activated allele of an E. fawcettii EfPKS1 protein in a

null mutant. These findings indicate a tight connection between ESC biosynthesis and









conidiation. It has long been known that production of natural compounds by microorganisms is

often linked with cell development and/or differentiation (reviewed in Adams and Yu 1998;

Calvo et al. 2002; Yu and Keller 2005; Brodhagen and Keller 2006). It appears that both

conidiation and production of secondary metabolites in fungi respond to common environmental

cues, subsequently trigger signaling transduction pathways, and regulate gene expression inside

the cells. It is well known that environmental factors such as light, the types of carbon and

nitrogen sources, and ambient pH via a PacC-mediated pathway regulate both developmental

differentiation and biosynthesis of secondary metabolites in various fungi (Calvo et al. 2002).

The genetic mechanisms linking both processes are multifaceted and beginning to be unveiled

through molecular studies in several fungal species. The involvement of a G-

protein/cAMP/protein kinase A-mediated pathway in both asexual sporulation and mycotoxin

production in Aspergillus nidulans has provided significant insight into the close regulatory

interactions between these two phenotypes in other fungi. In addition, the mitogen-activated

protein (MAP) kinase and cyclin-dependent kinase pathways have also been shown to regulate

both conidiation and production of cercosporin in C. zeae-maydis (Shim and Dunkle 2003) and

fumonisins in F. verticillioides (Shim and Woloshuk 2001), respectively. Other cellular

regulators such as oxylipins and other lipid derivatives, polyamines, the CCAAT-binding protein

complex, and the proteins containing Trp-Asp (WD) repeats have also been shown to coordinate

regulation of both secondary metabolite production and sporulation in Aspergillus spp. (Calvo et

al. 2002; Tsitsigiannis and Keller 2006).

Coordinate regulation for conidiation and production of ESCs by E. fawcettii may mediate

similar regulatory pathways, as described in Aspergillus species. Such speculation in supported

by analysis of the EfPKS] promoter region, which identified multiple binding sequences for









transcriptional activators, including GATA factors of nitrogen and light regulation, PacC of pH

regulation, and the C/EBP-binding protein induced by cAMP. Furthermore, our results also

revealed that production of ESCs via a defined polyketide pathway is highly affected at the

transcriptional level by light, the levels of glucose and nitrogen sources, and pH values. In

addition to the binding motifs for global regulatory proteins, the EfPKS1 promoter contains two

distinct MRAGGGR motifs found in the promoter region of the gene encoding a conidiation-

specific Bristle (BrlA) transcriptional activator ofA. nidulans (Adams et al. 1998). Furthermore,

the EfPKS1 promoter has two CATTCY motifs (Y is a pyrimidine) that serve as the binding sites

for the AbaA transcriptional activator (Andrianopoulos and Timberlake 1994). AbaA, regulated

via BrlA, has been shown to be required for the final stages of conidiphore development in A.

nidulans (Andrianopoulos and Timberlake 1994). The presence of conserved BrlA and AbaA

binding elements in the promoter of EfPKS1 strongly suggests that the EfPKS1 product might be

directly involved in conidial formation. Whether or not conidiation of E. fawcettii is regulated by

light, pH, carbon/nitrogen sources, or cAMP remains to be determined.










Table 4-1. Conidial production in axenic cultures and pathogenicity assays on detached rough
lemon leaves by inoculating with agar plugs cut from cultures ofElsinoefawcettii
wild type (WT), EfPKS1 null mutants (Dl, D2, D3, and D4), and strains (Cl and C2)
expressing a functional copy of EfPKS1.
Fungal strains or Conidial formation Lesion development2
treatment conidiaa per mL)' Leaf sDots showing lesions/total sDots inoculated (%)


3.4 1.7x 106
5.0 7.0x 102
4.1 4.1x 103
1.1 0.6x 103
6.2 7.0x 104
3.9 1.9x 106
2.4 1 4x 106


21/29 (72%)
0/21 (0%)
0/21 (0%)
0/21 (0%)
0/28 (0%)
11/17 (65%)
14/14 (100%)


Agar plugs 0/50 (0%)
'Conidia were produced in Fries medium in the dark and were determined with the aid of a
hemacytometer by microscopy. Data are means and standard errors ( SEM) often different experiments
with four replicates of each isolate.
2A 4-mm agar plug cut from mycelial mats was placed onto detached rough lemon leaves. Inoculated
leaves were incubated in a moist chamber under florescent light for 25 days. The frequency of lesion
formation is indicated as the number of inoculated spots developing scab lesions relative to the total
number of spots inoculated.


Wild type
D1
D2
D3
D4
C1
C2











543 91 104 132 2001 2192
KS AT ACP ACP TE/CYC
N* n EfPKSI I C
DTACSSSL GHSLG GVDSL GMDSL GWSAGG

Figure 4-1. Putative polyketide synthase, EfPKS1, in Elsinoefawcettii. A) the putative
polyketide synthase, EfPKS1 containing 2192 amino acids in Elsinoefawcettii,
showing a keto synthase (KS) domain with acyl binding cysteine, an acyltransferase
(AT) domain containing pantotheine binding serine, a thioesterase/claisen cyclase
motif (TE/CYC), and two acyl carrier protein (ACP) domains containing
phosphopantotheine binding serine. Conserved amino acids for each of the domains
are also indicated under the map, and the active amino acids are underlined. EfPKS
lacks dehydratase (DH), enoyl reductase (ER), ketoacyl reductase (KR), and
methyltransferase (ME) domains. B) and C) Phylogenetic relationships of EfPKS1,
based on the conserved amino acids in the KS (B) or AT (C) domain, to other fungal
PKSs (accession number) including: Bipolaris oryzae BoPKS (BAD22832);
Cochliobolus heterostrophus ChPKS 18 (AAR90272); Botryotiniafuckeliana
BfPKS13 (AAR90249); Xylaria sp. XyPKS (AAM93545); Nodulisporium sp.
NoPKS (AAD38786); Ophiostomapiceae OpPKS (ABD47522); Glarea lozoyensis
G1PKS (AAN59953); Colletotrichum lagenarium C1PKS1(BAA18956); Sordaria
macrospore SmPKS (CAM35471); Aspergillus clavatus AcPKSP (XP_001276035);
Ceratocystis resinifera CrPKS 1 (AAO60166); B. fuckeliana BfPKS 12 (AAR90248);
A. fumigatus AfPKSP (AAC39471); Chaetomium globosum CgPKS
(XP_001219763); Emericella nidulans wA (1905375A); Nectria haematococca
NhPKSN (AAS48892); Gibberella zeae GzPKS12 (AAU10633); A. nidulans
AnSTCA (XP_681094); C. heterostrophus ChPKS19 (AAR90273); Cercospora
nicotianae CnCTB1 (AAT69682); G. moniliformis GmPKS3 (AAR92210); G.
moniliformis GmPKS4 (AAR92211); G. fujikuroi GfPKS4 (CAB92399);
Mycosphaerellapini MpPKS (AAZ95017); A. flavus AfPKSA (AAS89999); A.
oryzae AoPKS (BAE71314); A. parasiticus ApPKSL1 (Q12053); Leptosphaeria
maculans LmPKS1 (AAS92537); C. heterostrophus ChPKS1 (AAB08104); G.
moniliformis GmPKS11 (AAR92218); C. heterostrophus ChPKS25 (AAR90279);
and Penicillium patulum Pm6MSAS (P22367). The phylogram was created with the
program PHYLP (Saitou and Nei 1987).















I EfPKS1 (Elsinochromes red/orange pigments)
-I -I S I
AcPKSP
AfPKSP Melanin
wA
GzPKS12
S mPKS3
I,-, IP'l. -:4 (
t-F i 71 Bikaverin (red pigment)


Fungal non-reducing PKSs;
KS-AT-ACP-TE/CYC


I- ------ ,rlt. I I r os ro rl tr 31r-i l |en
S-A CA i Stgratoc Istp n Fungal toxins or pigments
7 LmPKS1 Sirodesmin
I -MpPKS Dothistromin
.^ 2 taflatoxin
ApPKSL1 ChPKS1 T-toxin I Fungal reducing PKSs,
G mPKS11Fumonsifn I KS-AT-DH-ME-ER-KR-ACP
C__hPKS25 ? Fungal 6MSASPKSs,
NhPKSN PpGMSAS Patulin I KS-AT-DH-KR-ACP
-- BfPKS13
IPKS

yPKS l Fungal non-reducing PKSs,
S X Melanin KS-AT-ACP-TE/CYC
SmPKS
Id0.Pl-
,: rF I I

0.1


-EfPKS1 (Elsinochromes red/orange pigments)


Melanin or red pigment


1Fumonsin


-AcPKSP
-AfPKSP
wA Melanin
-GzPKS12


-OpPKS
-SmPKS


01



Figure 4-1. (Continued)


I















Conserved N s ( ) Transcriptional Genes of
Symbol elements Nu) factor activation

I GATA 2 (-82,-969) 9
S2 Nitrogen or light
TATC 7 (-240,-262, -275,-69, AreA& regulatory genes
S (anti-GATA) -948, -967, -1024) WC1/WC2

GCCARG 3 (-378,-682,-919)
; YTGC (-PacC pH responsive genes
|tG ARG) 1 (-444) (Cys2-His2)
(anti-GCCAR G)
CCAAT 2 (-782,-910)
10 (-63, -405, -594, -636, cAMP-inducible
CAAT -648,-751,-794, -1001 CEBP genes
-1073,-1094)
ATTG 4 (-317, -457, -581, -108

MRAGGGR 2 (-821,-880) Br
BrlA
YCCCTYK 1 (447) (Cys-His2) Developmental/
(anti MRAGGGR) conidiation-
specific
CATTCY 2 (-250, -417) AbaA genes


Figure 4-2. Promoter analysis of 1.1 kb sequences upstream of the putative ATG translational
start codon of EfPKS] in both directions, identifying a number of putative binding
sites for global transcriptional regulators such as AreA (nitrogen regulatory protein),
the WC 1/WC2 complexes (light regulatory proteins), PacC (ambient pH regulatory
protein), and C/EBP (cAMP activated protein). The EfPKS] promoter also has
conserved sequences for recognition and binding of the conidial formation-associated
BrlA and AbaA transcriptional activators in A. nidulans. Definition of mixed bases: R
= A or G: M = Aor C: Y = C or T.









NMH Pn (.'L) pH
f- n N r a-


(6 6 kb1


rRNA


A B C D L
Ca
2 1
-~2 a2
nE a I
LU 3 4 5 LT DK 2 60 0 4 4 8



Figure 4-3. Differential expression of the EfPKS] gene encoding a fungal polyketide synthase
and accumulation of ESC phytotoxins in a wild-type isolate Elsinoefawcettii. Fungal
isolate was grown on PDA (A and B), on complete medium containing different
amounts of glucose (C), or on minimal medium containing different concentrations of
ammonium nitrate (D) or with different pH values (E) under continuous light (LT) or
darkness (DK). Unless indicated, fungal RNA was isolated from 7-day-old cultures,
electrophoresed in an agarose gel containing formaldehyde, transferred onto a nylon
membrane, and hybridized to an EfPKS1 gene-specific probe. Ribosomal RNA
(rRNA) stained with ethidium bromide is shown for relative loading of the samples.
ESCs were extracted with 5N KOH and measured at A480. The amounts of ESCs were
determined by reference to a regression line was established using ethyl acetate-
purified ESCs. ESC data represent the means of two different experiments with four
replicates of each treatment. Vertical bars represent standard deviation. Means
followed by the same letter are not different at judged by Duncan's multiple range
test at P < 0.0001.












Split marker Tp: : ::h/: I
up3 X down 11

c' (ATG) g C ,T A //G) X

pro e 1 proF 3 p-roe 2
3.5 kb 7
3I-b 3 k - -
7 9 kb

Mutants C (ATG) X X C X (TAG) X

M --------------------- --------T--I 4kb
(pPKS0311) I :: rp:C :::..::: ..:H G :::::.::: ::: P p ,.:. I
5.1 kb 4.6 kb


B C
Disruptants Disruptants
T D1 D2 D 3 D 4 D1 D2 D3 D 4 WT



471


3.5
(Kb, (k I
(Clal digestion, Probe 1) (Xbal digestion, Probe 2)

Figure 4-4. Strategy of EfPKS] targeted disruption in Elsinoefawcettii. A) Schematic depicting
a split-marker strategy for EfPKS1 (indicated by shaded) targeted disruption in
Elsino fawcettii. A 4.6-kb DNA fragment containing the 5' end ofEfPKS1 fused
with the TrpC terminator of A. nidulans and truncated hygromycin
phosphotransferase B gene (h/YG) and a 3.3-kb fragment containing the 3' end of
EfPKS] joined with the TrpC promoter and truncated HY/g were amplified from the
disruption construct pPKS0311 with the primers as indicated. The h/YG and HY/g
fragment share 400 bp of overlapping sequence. The split marker fragments were
directly transformed into protoplasts of the E. fawcettii wild-type strain for targeted
gene disruption via double crossing-over recombination. The relative locations of
DNA probes used for Southern and Northern-blot analyses are also indicated.
Abbreviations for restriction endonuclease site: C, Clal; X, Xbal. B) Southern-blot
analysis of genomic DNA from wild type (WT) and four putative EfPKS1 disruptants
(D1, D2, D3, and D4). Fungal DNA was cleaved with endonuclease Clal,
electrophoresed, blotted to a nylon membrane, and hybridized with the Probe 1. C)
Southern-blot analysis of genomic DNA digested with XbaI and hybridized with the
Probe 2. Sizes of hybridization bands are indicated in kilobase pairs (kb). Banding
patterns confirm disruption ofEfPKS1 gene.










A B
Disruptants
a
W-T D1 D2 D4


E




WT D1 D2 D4
Disruptants

C
Rf




0.22-


Disruptants Complementation


Figure 4-5. EfPKS] gene expression and ESC production in EfPKS1 disruptants. A) Northern-
blot analysis of fungal RNA purified from wild type (WT) and three putative EfPKS]
disruptants (Dl, D2, and D4) ofElsinoefawcettii. RNA was denatured in a
formaldehyde-containing gel, blotted to a nylon membrane, and hybridized to a DNA
probe (Probe 3 in Fig. 4-4A). Gel stained with ethidium bromide indicates relative
loading of RNA samples. Sizes of hybridization bands are indicated in kilobase pairs.
B) Quantitative analysis of elsinochromes (ESCs) produced by wild type and EfPKS]
disruptants. Fungal isolates were grown on PDA under continuous light for 5 days.
ESC pigments were extracted with 5N KOH from agar plugs covered with fungal
hyphae and measured at A480. The concentrations of ESCs were calculated by
referring to a regression line. Data represent the means of two different experiments
with four replicates of each treatment. Vertical bars represent standard deviation.
Means followed by the same letter are not different at judged by Duncan's multiple
range test at P < 0.0001. C) TLC analysis of ESCs extracted with acetone from the
cultures of wild type, four EfPKS] disruptants, and two strains (Cl and C2)
expressing a functional EfPKS] gene. ESCs were separated on a TLC plate coated
with a 60 F254 fluorescent silica gel and developed with chloroform and ethyl acetate
(1:1 by volume).















































Figure 4-6. Pathogenicity assays on detached rough lemon leaves inoculated with agar plugs (4-
mm in diameter) of wild type, four EfPKS] disruptants, and two strains (Cl and C2)
expressing a functional EfPKS] gene of Elsinoefawcettii. Fungal isolates were grown
on PDA for 7 days and agar plugs covered with mycelial mats were cut and placed
onto detached rough lemon leaves (14 days after emergence) in which fungal
mycelium directly contacts the leaf surface. Inoculated leaves (> 20 leaves) were
incubated for lesion development in a moist chamber under constant fluorescent light.
Photos were taken 25 days post inoculation. The inoculated areas were cropped and
enlarged for better illustration of necrotic lesions. The mocks were treated with agar
plugs without fungal mycelium.















rE...

Mock C2 Mra
aJ





3 days after flushing
B --















7 days after flushing

Figure 4-7. Pathogenicity assays using conidial suspensions of wild type, the EfPKS] disruptant
(D4), and the complementation strain (C2) of Elsino fawcettii on detached rough
lemon leaves 3 days (A) or 7 days (B) after emergence. Fungal conidia (1 x 105 mL'1)
were harvested and applied by applying 2 IL of suspension onto rough lemon leaves.
Inoculated leaves (> 20 leaves) were incubated in a moist chamber. Formation of
lesions was recorded 14 days post inoculation. The mocks were inoculated with water
only. Reduction in lesion numbers and sizes by inoculation of EfPKS] disruptant (D4)
are indicated by arrows. Only some of the representative replicates of the inoculated
leaves are shown.









CHAPTER 5
CHARACTERIZATION OF A GENE CLUSTER REQUIRED FOR THE BIOSYNTHESIS OF
ELSINOCHROMES BY Elsinoefawcettii

In this chapter, a mini-gene cluster required for elsinochrome (ESC) biosynthesis is

described. In the previous chapter, a polyketide synthase-encoding gene, EfPKS] (Elsinoe

fawcettii polyketide synthase gene 1), was demonstrated to be required for ESC biosynthesis.

Chromosome walking and inverse PCR were utilized to extend the sequences adjacent to

EfPKS] fragment and identify additional genes that might be involved in ESC production. In

addition to EfPKS1, nine putative open reading frames were identified in a span of 30 kb and

were designated as the ESC biosynthetic gene cluster. The ESC cluster includes genes encoding

a polyketide synthase (EfPKS 1), a reductase (RDT1), an oxidoreductase (OXR1), a transcription

factor (TSF1), a membrane transporter (ECT1) and a prefoldin protein subunit (PRF1) that are

likely required for ESC biosynthesis, regulation, and translocation. Four other putative genes

(EfHP1, EJHP2, EJHP3, and EfHP4) apparently do not encode polypeptides with obvious

association with biosynthetic functions.

To determine if newly identified genes were required for ESC accumulation, the TSF1

gene was deleted. The TSF1 gene encodes the dual Cys2His2 zinc finger and Zn(II)2Cys6

binuclear cluster DNA-binding motifs and likely functions as a transcriptional regulator for ESC

production. The TSF1 deletion mutants of E. fawcettii failed to produce ESCs. Expression of the

RDT1, EfPKS], PRF], and EJHP1 but not the ECT1, OXR1, EfHP2, EfHP3, and EJHP4 genes

was markedly down-regulated in the TSF or EfPKS] null mutants. The results indicate that the

RDT1, TSF], PRF], ECT1, EfPKS], and EJHP1 genes are required for ESC biosynthesis and

accumulation.









Introduction

Elsinoefawcettii, the causal agent of scab disease of citrus, produces elsinochromes

(ESCs), causing cell death, necrotic lesions, and electrolytic leakage via production of reactive

oxygen species (Liao and Chung 2008a). An EfPKS] (Elsinoefawcettii polyketide synthase gene

1) was cloned and shown to be required for ESC production, and that ESCs are virulence factors

during citrus pathogenesis (Liao and Chung 2008b).

Biosynthesis of secondary metabolites in fungi has long been known to respond to

environmental cues, including the carbon/nitrogen source, light and pH, presumably mediated

through the global regulatory factors such as CreA responding to carbon suppression; AreA

responding to nitrogen signaling; PacC responding to ambient pH (Dowzer and Kelly 1989;

Kudla et al. 1990; Tilburn et al. 1995). The global regulatory networks have been proposed to be

regulated by a signaling pathway, involving the G protein/c-AMP/protein kinase-mediated

signaling (Calvo et al 2002; Yu and Keller 2005). In Chapter three, accumulation of ESCs in

culture was demonstrated to be affected by carbon and nitrogen sources, pH, and additional

environmental factors. Thus, it seems likely that production of ESCs is also regulated by similar

signaling pathways.

Genes for biosynthesis of secondary metabolites in filamentous fungi are often clustered

and coordinately regulated by a pathway-specific transcriptional regulator (Yu and Keller 2005).

A number of polyketide-derived fungal secondary metabolites, such as fumonisin, aflatoxin,

ochratoxin A, aurofusarin, and cercosporin, are synthesized by clustered genes within the

genomes of fungi (Proctor et al. 2003; Yu et al. 2004; Karolewiez and Geisen 2005; Malz et al.

2005; Chen et al. 2007). In this chapter, a mini gene cluster comprised often genes (RDT], TSF],

OXR1, EfPKS], PRF1, ECT1 and EJHPl-4) is described in relation to ESC production in Elsinoe

fawcettii. To determine if the genes are coordinately regulated and are involved in ESC









production, a TSF1 gene was cloned and characterized as embedded in the cluster and encoding

for a putative transcription activator containing dual Cys2His2 zinc finger and Zn(II)2CyS6

binuclear cluster DNA-binding domains.

Materials and Methods

Fungal Strains, Their Maintenance and Extraction/Analysis of ESC Toxin

The wild-type CAL WH-1 isolate of Elsinoefawcettii Bitancourt & Jenkins (anamorph:

Sphacelomafawcettii Jenkins) was previously characterized (Liao and Chung 2008b). All

procedures used for fungal culturing, toxin extraction, and screening for ESC-deficiency mutants

were previously described (Chapter 2, 3, and 4).

Chromosomal Walking and Sequence Analysis

Fungal DNA was isolated employing a DNeasy Plant Mini kit (Qiagen, Valencia, CA). A

genomic library of E. fawcettii was constructed from DNA digested with Dral, EcoRI, Pvul and

StuI, and ligated to adaptors using the Universal GenomeWalker kit (BD Biosciences, Palo Alto,

CA) according to the manufacture's instructions. Primers were designed based the known

sequences and paired with adaptor primers to obtain DNA fragments harboring unknown

genomic regions using a Titanium or Advantage 2 DNA polymerase (BD Biosciences). In some

cases, DNA fragments were obtained by PCR with inverse primers from fungal DNA that was

digested with restriction endonucleases and self-ligated as previously described (Choquer et al.

2005). After purified with a DNA purification kit (Mo Bio Laboratories, Inc., Carlsbad, CA), the

amplified DNA fragments were either directly sequenced or first cloned into pGEM-T easy

vector (Promega) for sequence analysis at Eton Bioscience, Inc. (San Diego, CA).

Oligonucleotides used for PCR and sequencing were synthesized by Integrated DNA

Technologies (Coralville, IA) and Allele Biotechnology and Pharmaceuticals, Inc., (San Diego,

CA). Similarity searches using a BlastX program (Altschul et al., 1997) were performed at the









National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Prediction of

open reading frames (ORFs) and exon/intron junctions were first performed using the gene-

finding software at http://www.softberry.com and were further confirmed by comparing genomic

and cDNA sequence. Functional domains were identified using the PROSITE database in the

ExPASy Molecular Biology Server (http://us.expasy.org) (Gasteiger et al. 2003) and

Motif/ProDom and Block programs (Henikoff et al. 2000) at http://motif.genome.jp/. Analysis of

the promoter regions was conducted using regulatory sequence analysis tools (van Helden, 2003)

at http://rsat.ulb.ac.be/rsat/. Palindrome searches were performed at

http://bioweb.pasteur.fr/seqanal/interfaces/palindrome.html.

Targeted Gene Disruption and Genetic Complementation

To disrupt the TSF]gene in E. fawcettii, a 5.34-kb DNA fragment encompassing the whole

TSF1 ORF and flanking sequences was amplified by PCR with primers efup 11 (5'-

CATCTCGCATATCTGGACCCGTC-3') and efup28 (5'-CGGGCTATTCTTAGAGCAGAG-

3'). The amplified DNA fragment was purified with a DNA purification kit and cloned into

pGEM-T easy vector to become pSTSF 1128. Plasmid pSTSF1128 was digested with NruI,

blunted, and to accommodate an end-filled 2.1-kb fragment harboring the hygromycin

phosphotransferase B gene (HYG) cassette under the control of the Aspergillus nidulans trpC

gene promoter and terminator from pUCATPH (Lu et al. 1994) to create the disruption construct,

pTSF 1128 (Fig. 5-3). A split marker strategy was applied to facilitate double crossing-over

recombination as previously described (Choquer et al. 2005). Briefly, a 4.4-kb DNA fragment

containing truncated 5' TSF1 fused with 5' HYG and a 4.2-kb fragment encompassing 3' TSF1

linked to 3' HYG were amplified, respectively, with primers efupl 1/hyg3 (5'-

GGATGCCTCCGCTCGAAGTA-3') and efup28/hyg4 (5'-CGTTGCAAGAACTGCCTGAA-3')

from pTSF 1128 using the Takara Ex Tar PCR system (Takara Bio USA, Madison, WI). Fungal









protoplasts were released from fungal hyphae by a mixture of cell-wall degrading enzymes as

previously described (Chung et al. 2002). Fungal transformation using a CaC12 and polyethylene

glycol-mediated method was performed by mixing PCR fragments with protoplasts (1 x 105) as

previously described (Chung et al. 2002). The two hybrid fragments share 800 bp of overlapping

sequence within the HYG gene. The HYG gene cassette is not functional until recombination

takes place between the two truncated HYG DNA fragments. Fungal transformants were

recovered from RMM medium containing 200 ig mL-1 hygromycin (Roche Applied Science,

Indianapolis, IN) after 2 to 3 weeks and were screened for the loss of ESC production

(red/orange pigments) on thin PDA.

For genetic complementation, a functional TSF1 gene and its 5' non-translated region was

amplified from genomic DNA with primers efupl 1 and efup28 by an Expand High Fidelity PCR

system (Roche Applied Science) and confirmed by sequencing. The amplified TSF1 gene

cassette was co-transformed with plasmid pBARKS1 plasmid harboring a phosphinothrin

acetyltransferase gene under control of the A. nidulans trpC promoter that is responsible for

bialaphos resistance (Pall and Brunelli, 1993). Transformants were first identified from a

medium supplemented with 50 [g/mL bialaphos (Gold Biotech, St. Louis, MO) and tested for

production of the red/orange pigments (ESCs) on thin PDA plate as previously described (Liao

and Chung 2008a; 2008b).

Molecular Techniques

Unless otherwise specified, standard molecular techniques were used for endonuclease

digestion of DNA, electrophoresis, and Southern- and Northern-blot hybridizations. Plasmid

DNA was propagated in Escherichia coli DH5a bacterial cells and purified using a Wizard DNA

purification kit (Promega). Fungal RNA was purified by Trizol reagent per manufacture's

directions (Invitrogen, Carlsbad, CA). Single and double strand cDNA was prepared with a









cDNA synthesis kit (BD Biosciences) and amplified by reverse transcriptase (RT)-PCR with

gene-specific primers. The resulting fragments were purified and directly subjected to sequence

analysis. DNA probes used for Southern- and Northern-blot hybridization were labeled by PCR

to randomly incorporate digoxigenin (DIG)-11-dUTP (Roche Applied Science) into DNA with

gene-specific primers. Procedures used for probe labeling, hybridization, post-hybridization

washing and immunological detection of the probe using a CSPD (Ci8H19Cl207PNa2)

chemofluorescent substrate for alkaline phosphatase were performed following the

manufacturer's recommendations (Roche Applied Science).

Conidia Production and Pathogenicity Assays

Conidia were prepared as described in the Chapter 4. Fungal pathogenicity was evaluated

on detached rough lemon (Citrusjambhiri Lush) leaves inoculated with agar plugs as previously

described (Liao and Chung, 2008b). The inoculated leaves were incubated in a moist chamber

under constant fluorescence light at an intensity of 3.5 joules m-2 s1 and lesion formation was

monitored weekly. Rough lemon trees were maintained in greenhouse and leaves of 7-10 days

after flushing, with size approximately length 2.2-3.2 cm and width 1-1.5 cm, were harvested for

pathogenicity assays.

Nucleotide Sequences

Sequence data reported in this article can be retrieved from the EMBL/GenBank Data

Libraries under Accession nos. EfHP1 (EU414199), EfHP2 (EU414200), EfHP3 (EU414201),

RDTI (EU401704), TSF1 (EU401705), OXR1 (EU401706), EfPKS1 (EU086466), PRF1

(EU401707), ECT1 (EU414198), and EfHP4 (EU414202).









Results

Sequence Analysis and Determination of Open Reading Frames (ORFs)

A polyketide synthase gene (EfPKS1) required for elsinochromes (ESCs) biosynthesis has

been determined as described in Chapter 4. The EfPKS] gene disrupted mutants, D1, D2, D3,

and D4, were completely blocked in ESC production. Sequence analysis beyond the EfPKS1

gene was performed to determine if any of the genes adjacent to EfPKS1 are also required for

ESC biosynthesis. Using a combination of chromosome walking and inverse PCR cloning

strategies, over 30-kb of adjacent sequences were obtained after multiple rounds of polymerase

chain reaction (PCR). In each round, new primers complementary to the end of assembled

sequences were designed, synthesized and used to amplify overlapping DNA fragments from the

genome of E. fawcettii. The presence of exons/introns and the identification of putative ORFs

were first performed using computer software and were further confirmed by comparison of

genomic and cDNA sequences. Analysis of the compiled sequences led to identify nine putative

ORFs, in addition to the EfPKS1 gene (Table 5-1; Fig. 5-1).

A similarity search in the NCBI database using BLASTX was performed to predict the

function of the translated polypeptide. A PRF1 gene, located downstream from EfPKS1, contains

a 111-bp intron and encodes a putative polypeptide similar to prefoldin subunit 3. The putative

ECT1 gene product, excluding a 45-bp intron, displays strong similarity to numerous

hypothetical proteins and membrane transporters, with the highest hit to nitrate transporter of

Aspergillus terreus (E value = 3e-69; Table 5-1). A TSF1 gene that is located upstream and

transcribed divergently from EfPKS1 encodes a putative protein, showing strong similarity to

many zinc finger transcriptional factors of fungi. A RDTJ gene, located further upstream from

TSF], has a 47-bp intron and encodes a putative polypeptide similar to a wide range of

reductases, with strong similarity to 1,3,8-trihydroxy naphthalene (T3HN) reductase involved in









melanin biosynthesis (Table 5-1). An OXR1 gene contains a 45-bp intron and is located between

the EfPKS] and TSF1 genes. The OXR1 protein, rich in proline, has low similarity to

malate:quinone oxidoreductases of bacteria (Table 5-1). Three putative ORFs (designated as

EfHPl-3) upstream of the RDT1 gene encode hypothetical proteins with unknown functions. A

small segment, consisting of 44 amino acids, in the translated product of EfHP2, however,

displays low similarity to putative cation/multidrug efflux pump ofMarinomonas sp. (Table 5-

1). The EJHP1 and EfHP3 genes have introns of 57 and 69 bp, respectively, whereas EJHP2 is an

intronless gene. A small EJHP4 ORF, interrupted by 54-bp introns, is located downstream of

ECT1 and encodes a putative polypeptide, showing low similarity to isoleucyl t-RNA synthase

which did not appear to involve in metabolic functions. Sequencing beyond the EfHP1 or EJHP4

gene failed to produce reliable sequences after several attempts with different primers (data not

shown).

Expression of Putative ORFs and ESC Accumulation

In order to determine if the genes identified within the cluster were expressed and

coordinately regulated under the conditions favorable for ESC accumulation, Northern-blot

hybridization of RNA from E. fawcettii was conducted to examine the expression profiles of the

RDT1, TSFI,OXR1, EfPKS], PRF], ECT1 genes and four EfHP genes (Fig. 5-2A). All genes

except for EJHP3 were favorably expressed when the fungus was under nitrogen starvation and

their transcripts were nearly undetectable in the presence of ammonium nitrate. Expression of the

EJHP3 gene appeared to be constitutive as its transcript remained unchanged in all conditions

tested. Noticeably, accumulation of the TSF1, EfPKS], PRF1, ECT1, and EfHP2 gene transcripts

increased considerably when the fungus was incubated in alkaline conditions. Under acidic

conditions (pH 4), the RDT1 and EfHP1 gene transcripts accumulated slightly but not

significantly higher compared to those in alkaline conditions. By contrast, expression of the









EfHP3 or OXR1 gene was not affected by pH, as their transcripts were detected at similar levels

both in acidic and alkaline conditions. Apparently, the EfPKS], PRF1 and ECT]genes were

preferably expressed in the conditions with higher amounts of glucose, whereas accumulation of

the TSF1 and RDTI gene transcripts were repressed. Expression of the EfHP3 gene was not

regulated by glucose as its transcript accumulated equally well in both conditions (Fig. 5-2A).

Quantification assays for the accumulation of elsinochromes (ESCs) revealed that large quantity

of ESCs was exclusively detected when the fungus was cultured in the absence of nitrogen, in

alkaline conditions (pH 8.0), or in the presence of higher amounts of glucose (Fig. 5-2B).

Addition of ammonium nitrate, reducing the glucose concentration to 2 g L-1, or changing the

medium pH to acidic conditions (pH 4.0) completely suppressed ESC production.

Promoter Analysis for Identifying DNA Binding Motifs

The promoters of ten putative genes were analyzed to identify potential binding sequences

for common regulatory elements such as the nitrogen regulatory protein (AreA), the carbon

regulatory protein (CREA), the pH regulatory protein (PacC), and the light responsive proteins

(WC1/WC2 complex). Analysis sequences upstream of the putative ATG translational start

codon identified several consensus sequences in the RDT1, TSF1, OXR1, EfPKS], PRF1, ECT1,

and EfHPl-4 promoters (Table 5-2). The consensus TATA motif was found in the promoters of

all genes but TSF1, OXR1, PRF], and EfHP3. All genes, but EfHP4 contain at least one CAAT

or CCAAT consensus sequence in their promoter regions. The pH regulatory PacC-binding

sequence (5'-GCCA(A/G)G-3') was identified only in the promoter regions of TSF1, OXR1,

EfPKS1, PRF1, ECT1and EfHP2-4. All genes, except for EfHP3, have one or multiple GATA

consensus sequence that is potentially recognized and bound by the nitrogen regulatory AreA

protein or the light regulatory transcriptional WC1/WC2 complex (Kudla et al. 1990; Marzluf

1997; Linden et al. 1997). However, none of the promoter regions has the binding sequence (5'-









(G/C)PyGGGG-3') that is recognized by the CreA carbon repressor. The promoter regions of the

RDT1, EfPKS], and ECT1 genes have a consensus sequence, 5'-(A/C)(A/G)AGGG(A/G)-3' that

serves as a binding site for the conidial formation-related BrlA transcriptional activator in A.

nidulans (Adams et al, 1998). The promoter regions of the RDT1, OXR1, EfPKS], and ECT1

genes, however, have a consensus sequence, 5'-CATTC(C/T)-3' that acts a binding site for the

AbaA transcriptional activator involved in conidiophore development in A. nidulans

(Andrianopoulos and Timberlake 1994). Two palindrome sequences, 5'-TCG(N2-4)CGA-3' and

5'-CGG(N3-11)CCG-3', were also identified in the promoter regions of some but not all genes

(Table 5-2).

Targeted Disruption of the TSF1 Gene and Genetic Complementation

To determine if the genes that are clustered with TSF1 are also involved in ESC

biosynthesis and regulation, I characterized the TSF1 gene encoding a putative transcriptional

activator. The TSF1 gene contains 3075 nucleotides, interrupted by four introns of 49, 50, 43,

and 53 bp in lengths. The translated 959 amino acids of the TSF1 gene displays strong similarity

to numerous conserved proteins from the sequenced genomes of fungi and contains dual

Cys2His2 type zinc finger (CTYCGHSFTRDEHLERHILTH and

CFTCHMSFARRDLLQGHYTVH) and GAL4-like Zn2CyS6 binuclear cluster DNA-binding

(CSNCAKTKTKCDKKFPCSRCASRNLRC) domain signatures. The regulatory function of the

TSF1 gene product in relation to the biosynthesis of ESCs was determined genetically, by

creating and analyzing targeted disruptants that were specifically mutated at the TSF1 locus. To

increase the efficiency of recovery of transformants with targeted gene disruption, two split DNA

fragments overlapping 800 bp within the HYG cassette were amplified separately from the

disruption construct pTSF 1128 (Fig. 5-3A) and directly transformed into wild-type of E.

fawcettii. Since the HYG cassette was truncated in either fragment, only transformants with the









restored HYG function via homologous recombination would survive and form colonies on the

regeneration medium supplemented with hygromycin. All transformants recovered were then

screened for production of red/orange pigments (ESCs) on a thin PDA under constant fluorescent

light. Of 20 transformants tested, three failed to accumulate the red/orange pigments and were

considered TSF1 disruptants. Successful disruption of the TSF1 gene was confirmed by Southern

blot analysis. Hybridization of genomic DNA digested with PvuII endonuclease and hybridized

to a TSF1 gene probe resulted in a 4.8-kb hybridizing band in the wild type and two hybridizing

bands with expected sizes of 3.9 and 3.2 kb, as a result of integration of the HYG cassette, in the

putative disruptants (Fig. 5-3B). Hybridization of genomic DNA cleaved with BglI and Pvull

also yielded different banding patterns between the wild type and the putative disruptants as

expected (Fig. 5-3C), indicating a specific disruption at the TSF1 locus.

Northern-blot analysis was conducted to determine if the putative mutants accumulated the

TSF1 transcript. As shown in Fig. 5-4A, hybridization of total RNA identified a sole TSF1

transcript of 3.1-kb in size from wild type, but not from three disruptants. Apparently, integration

of the HYG cassette within the TSF1 ORF has completely abolished expression of the TSF1

gene, indicating they were TSF1 null mutants. Functional complementation was performed to

further determine the role of TSF1 in relation to the biosynthesis of ESCs. Transformants were

screened for recovery of the red-pigmented fungal strains that acquired and expressed a

functional TSF1 gene cassette. Two fungal strains (CA and CB) accumulated low amounts of the

red/orange pigments were selected for further characterization. Northern-blot analysis revealed

that the TSF1 transcript was detected in both CA and CB strains, but not in their progenitor T3

strain (Fig. 5-4A). Phenotypic analyses indicated that the TSF1 disruptants failed to accumulate

ESCs in axenic cultures compared to wild type, as either assayed spectrophotometry after KOH









extraction (Fig. 5-4B) or by TLC analysis (Fig. 5-4C). Compared to wild type, the CA and CB

complementation strains produced much less ESCs on PDA (Fig. 5-4B). TLC analysis of the

pigments extracted from the CA strain indicated that the band with Rf0.68 was the most

abundant pigment (band 1), whereas the extracts from wild type showed three derivatives of

pigments (Rf0.68, Rf0.50, and Rf0.22) with band 3 as the major compound (Fig. 5-4C).

Spectrophotometric scanning indicated that the acetone extracted pigments from wild type, CA,

and CB strains, displayed a strong absorbance at 460 nm with two minor peaks at 530 and 570

nm, whereas all Atsfl-disrupted mutants (T1, T2, and T3) had no absorbance peaks.

Gene Regulation by TSF1 and Feedback Inhibition

The central role of the TSF1 gene product as a transcriptional activator was assessed for

expression of the clustered genes in two TSF1 disruptants (Fig. 5-5). As shown in Fig. 5-5,

disruption of the TSF1 gene caused a decreased accumulation of the RDT1, EfPKS], PRF], and

EfHP1 gene transcripts, but did not cause a drastic reduction for expression of the OXR1, ECT1,

EfHP2, and EfHP3 genes. Expression of the EfPKS] gene was restored in the CA and CB

complementation strains. Accumulation of the gene transcripts was also examined in an EfPKS]

null mutant (D4) that is defective in ESC production. Northern hybridization analysis revealed a

marked reduction of transcripts of the RDT1, TSF1, PRF1, ECT1, and EfHP1 genes in the D4

mutant (Fig. 5-6). Accumulation of the RDT1, TSF1, PRF1, ECT1, and EfHP1 gene transcripts

was nearly restored in strains (Cl and C2) expressing a functional copy of the EfPKS] gene. In

contrast, expression of the OXR1, EfHP2, and EfHP3 gene transcripts was apparently not

influenced by disruption of the EfPKS] gene, as evidenced by the fact that their transcripts

accumulated to the levels comparable to those of wild type (Fig. 5-6).









Discussion

Elsinochrome (ESC) phytotoxins produced by many Elsinoe species contain a

perylenequinone backbone and is likely synthesized via a defined polyketide pathway. I have

previously demonstrated that deletion of the EfPKS] gene encoding a fungal polyketide synthase

in an isolate of E. fawcettii leads to complete inability in the production of ESC which

demonstrates that ESC plays an essential role in fungal virulence (Liao and Chung 2008b). The

genes involved in the biosynthesis of fungal polyketide compounds are often closely linked in

the genome. The case for the biosynthesis of ESCs by E. fawcettii, is no exception. In this

chapter, the regions flanking EfPKS] were sequenced to obtain a 30-kb continuous DNA stretch.

Nine additional putative ORFs were identified, some of which encode polypeptides likely

involved in biosynthesis, regulation, and accumulation of ESCs.

EfPKS1 functions in the assembly of the polyketide backbone of ESCs in an analogous

fashion to fatty acid and polyketide biosynthesis (Fig. 5-7). The putative biosynthetic pathway

begins with the condensation of acetyl-CoA (starter) and malonyl-CoA (extender) units. EfPKS1

contains several conserved domains including a keto synthase (KS), an acyltransferase (AT), a

thioesterase (TE) and two acyl carrier protein (ACP) domains that may act cooperatively to form

the polyketomethylene backbone of ESCs. The malonyl-CoA subunit is assumed to attach to the

ACP domains of EfPKS 1 to form a phosphopantotheine (PPT) complex (Watanabe and Ebizuka

2004) that accepts a unit from acetyl-CoA via the function of the AT domain. The KS domain of

EfPKS1 catalyzes condensation of the malonyl- and acetyl-CoAs by decarboxylation. After each

cycle of condensation, the malonyl keto group is reduced. The putative polyketide synthase

encoded by EfPKS1 iteratively catalyses the synthesis by incorporating two carbons in each

cycle into a linear polyketide chain which is then released and cyclized through a TE domain in

the EfPKS] (Birch 1967). Additional modification steps are present to produce a heptaketide









backbone ofESCs. ESCs have a bilateral symmetrical structure (Fig. 5-7). Thus, formation of the

mature ESCs is likely mediated by dimerization.

In addition to the EfPKS] gene, the RDT1 gene encoding a putative reductase, the TSF1

gene encoding a putative transcriptional activator, and the OXR1 gene encoding a putative

oxidoreductase are likely involved in modification ofESC backbone (Fig. 5-7). The ECT1 gene

encoding a probable membrane transporter is likely functioning in toxin secretion outside the

fungal cells to avoid toxicity (Fig. 5-7). In addition, there is no methyltransferase-coding gene in

the ESC cluster even though ESC has four methyl groups at position C3, C7, C8, and C12

(Weiss et al. 1965; Lousberg et al. 1969). It appears that the identified ESC gene cluster does not

contain all the genes responsible for ESC biosynthesis. The role of the PRF1 gene encoding a

putative prefoldin protein in relation to ESC production remains unknown. Similarly, the

remaining four ORFs (EfHPl-4) encode hypothetical proteins with unknown functions. Whether

or not they are involved in the ESC production will require further investigation by a deletion

strategy for the corresponding genes.

All the putative ORFs identified in the cluster were expressed as judged by Northern-blot

analysis. Apparently, ESCs were favorably produced when the fungus was cultured in lower

nitrogen, higher pH, and higher carbon supply. However, accumulation of the gene transcripts

was not fully congruent with the conditions conductive for ESC production. Expression of all

ORFs other than EJHP3 and accumulation ESCs were regulated under nitrogen starvation, but

obviously lacked strong correlation between gene expression and ESC accumulation in response

to pH or carbon source. Analysis of the promoter regions of the ESC clustering genes for

possible DNA binding sites of global transcriptional regulators revealed that all ten genes contain

nitrogen or light regulatory binding elements (GATA) in their promoter regions that are









recognized by AreA nitrogen regulator (Marzluf 1997; Wilson and Arst 1998), and the

WC1/WC2 light-responsive regulator (Linden et al. 1997). The GCCARG consensus motif

involved in the binding of the pH-responsive PacC regulator (Espeso et al. 1997) was found in

the 5'-untranslated regions of the TSF1, EfPKS], PRF], ECT1 and OXR1 genes but not RDT1

promoter regions. Expression of TSF1, EfPKS1, PRF1, and ECT1 but not RDT1 and OXR1 genes

increased at alkaline pH. Interestingly, PacC has been reported to regulate fungal virulence genes

required for phytopathogens (Rollins and Dickman 2001; Caracuel et al. 2003; You et al. 2007).

Thus, I predict that PacC may also function as a fungal virulence factor in E. fawcettii, likely via

regulation of the genes involved in ESC biosynthesis.

Many of the Zn2CyS6 harboring transcriptional activators have been shown to recognize

and bind the palindrome DNA sequence with inverted repeats of CGG or TCG elements

separated by a spacer with various nucleotides, such as [5'-CGG(N3-Nil)CCG-3'] or [5'-

TCG(N2-N4)CGA-3] (Marmorstein and Harrison 1994; Li and Kolattukudy 1997; Fernandes et

al. 1998; Ehrlich et al. 2002). Promoter analysis also identified similar palindrome DNA

sequence in the 5'- untranslated regions of TSF1, OXR1, EfPKS], and PRF], that may also be

involved in transcriptional regulation. Northern-blot analysis also uncovered that not all of the

clustered genes were coordinately regulated through the putative transcriptional regulator, TSF1,

implying the requirement of other transcriptional regulators whose coding sequences are not

linked to the ESC gene cluster. However, deletion of the TSF1 gene resulted in fungal mutants

that completely fail to accumulate any detectable TSF1 transcript and ESCs, indicating the TSF1,

likely acts as a core transcriptional activator, playing an essential role in ESC biosynthesis.

Deletion of the TSF1 gene influenced expression of the RDT1, EfPKS], and PRF1 gene

considerably, yet had little effect for transcriptional suppression of the ECT1 and OXR1 genes.









Similarly, it is not yet clear whether or not the putative EfHPl-4 ORFs close to the ESC cluster

are also involved in ESC biosynthesis even though the expression of some of these genes was

regulated by nitrogen starvation and affected by the deletion of EfPKS] or TSF1 gene. Thus, the

function of the ESC genes other than EfPKS] and TSF1 in the biochemical pathway leading to

ESC production can not be conclusively determined until each of the genes is inactivated.

Expression of the ESC clustering genes in an EfPKS] null mutant reveals a transcriptional

feedback inhibition, in which deletion of the EfPKS] gene suppressed expression of the RDT1,

TSF], PRF1, and ECT1 genes in the cluster. Expression of a copy of the functional EfPKS] gene

in a respective null mutant restored their expression to the extent comparable to those of their

wild-type progenitor, further supporting the requirement of the RDT1, TSF1, PRF1, and ECT1

genes for ESC biosynthesis.

In a prior study, deletion of the EfPKS] gene gave rise to a remarkable reduction in

conidiation in addition to deficiency in the ESC production. Similar to the EJPKSl-disrupted

mutants, the TSF1 null mutants were also severely disrupted in conidial production (data not

shown). The connections between production of secondary metabolites and cell development

and/or differentiation have also been investigated in other filamentous fungi (Adams and Yu

1998; Calvo et al. 2002; Yu and Keller 2005; Brodhagen and Keller 2006). Interestingly,

examination of the 5'-untranslated regions revealed the presence of the consensus MRAGGGR

motifs in the promoter regions of the RDT1, EfPKS], and ECT1 genes, which are presumably

involved in the binding for a conidiation-specific Bristle (BrlA)-like transcriptional activator as

described in A. nidulans (Adams et al. 1998). In addition, the consensus CATTCY motifs,

recognized by the AbaA transcriptional activator (Andrianopoulos and Timberlake 1994), are

found in the RDT1, OXR1, EfPKS], and ECT1 gene promoters. AbaA is activated by BrlA and is









involved in conidiphore development of A. nidulans (Andrianopoulos and Timberlake 1994). It

is possible that the proteins or intermediates involved in the ESC biosynthesis and conidial

formation might be coordinately regulated, at lease in part, by common transcriptional regulators

in a complex and intertwined networks that include the G-protein/cAMP/protein kinase A- and

the mitogen-activated protein (MAP) kinase-mediated signaling cassettes as described in other

filamentous fungi (Calvo et al. 2002).

Expression a functional TSF1 gene cassette in the respective null mutants failed to fully

restore conidiation, ESC production, or fungal pathogenesis. It is very unlikely that failure to

completely restore the mutant phenotypes was attributed to the transformed TSF1 gene.

Sequence analysis of the transformed TSF1 gene cassette revealed no nucleotide substitutions or

insertions (data not shown). Northern-blot analysis also showed a normal expression of the TSF1

gene in the recombinant transformants comparable to those of wild type. The failure of TSF1 to

complement ESC production, conidiation, and virulence, when controlled by its endogenous

promoter, was somewhat surprising and highlighted the requirement of specific regulation for the

function of TSF1 in particular and all other genes in the cluster in general.

As summarized in Fig. 5-8, I propose a regulatory model for the possible linkage of ESC

biosynthesis and environmental cues. Elsinoefawcettii responds to various external signals, such

as light, pH, and nutrients. Subsequently, membrane receptors relay the external stimuli into

fungal cells to elicit the global signaling pathways, such as G protein-mediated signaling

pathways to release various secondary messengers. These second messengers, such as cAMP,

Ca2+, 1,4,5-trisphosphate (IP3), or others, in turn trigger global transcription factors that directly

or indirectly activate TSF1. Since the EfPKS1- and TSF1- disrupted mutants resulted in a









reduced conidiation, it is very likely that biosynthesis of ESC and fungal conidiation are

coordinately regulated.










Table 5-1. Elsinochrome (ESC) biosynthetic gene cluster and adjacent EfHPl-4 genes encoding
hypothetical proteins in Elsinoefawcettii
Gene Length Intron no. Amino Closest blast match Amino E-
(accession (bp) (size in bp) acids proteins and species acid value
number) (accession no.) similarity
(%)


RDT1
(EU401704)


TSF1
(EU401705)






OXR1
(EU401706)


EfPKSl
(EU086466)


PRF1
(EU401707)





ECT1
(EU414198)


1(47)


3075 4 (49, 50,
43, and 53)






744 1 (45)



6631 1(52)



705 1(111)






1563 1(45)


267 Hypothetical protein,
Botryotiniafuckeliana
(EDN21223)
1,3,8-
trihydroxynaphthalene
reductase, Alternaria
alternate (BAA36503)
959 Hypothetical protein,
Phaeosphaeria
nodorum (EAT80399)
Transcription factor
Cmrl, Cochliobolus
heterostrophus
(ABI81496)
232 Malate:quinone
oxidoreductase,
Pseudomonas syringae
(AAY36032)
2192 Fungal type I
polyketide synthase,
Bipolaris oryzae
(BAD22832)
197 Hypothetical protein,
Phaeosphaeria
nodorum (EAT80391)
Probable prefoldin
subunit 3, Neosartorya
fischeri (EAW23892)
505 Hypothetical protein,
Phaeosphaeria
nodorum (EDN17791)
Highly affinity nitrate
transporter, Aspergillus
terreus (EAU39122)


224/264
(84%)


221/261 le-
(84%) 108


558/956 0
(58%)

659/1032 0
(63%)


65/163 1.1
(39%)


1656/219 0
7 (75%)


147/178 le-
(82 %) 67

151/190 2e-
(79 %) 57

273/522 2e-
(52 %) 82

260/513 3e-
(50 %) 69









Table 5-1. (Continued)
Gene Length Intron no. Amino Closest blast match Amino E-
(accession (bp) (size in bp) acids proteins and species acid value
number) (accession no.) similarity
(%)
EJHP1 993 1(57) 311 Hypothetical protein, 71/147 8e-
(EU414199) Chaetomium globosum (48%) 06
(EAQ88529)
EJHP2 1158 0 385 Putative 44/94 1.0
(EU414200) cation/multidrug efflux (46%)
pump, Marinomonas
sp. (EAQ67386)
EJHP3 819 1(69) 249 Hypothetical protein, 60/117 3e-
(EU414201) Coprinopsis cinerea (51%) 06
(EAU83036)
EJHP4 423 1 (54) 122 Isoleucyl-tRNA 39/80 0.26
(EU414202) synthase, Bacillus (48%)
subtilis (CAB13417)










Table 5-2. Promoter analysis of genes in the elsinochrome (ESC) biosynthetic gene cluster of
Elsinoe fawcettii
Gene RD TSF1 OXR1 EfPKS PRF ECT EfHP EfHP EfHP EfHP
T1 1 1 1 1 2 3 4
TATA 1 0 0 1 0 1 1 1 0 1
CCAATorCAAT 7 7 7 9 8 2 7 3 4 0
AreAor 3 4 1 8 5 1 1 6 0 7
WC1/WC2 GATA
pH regulatory 0 1 1 4 1 1 0 1 1 1
GCCA (A/G)G
BrlA 1 0 0 3 0 1 0 0 0 0
(A/C)(A/G)AGGG
(A/G)
AbaA CATTC 3 0 3 2 0 2 0 0 0 0
(C/T)
Palin- TCG(N2- 0 1, 1, 2, 2, 0 0 0 0 0
drome 4)CGA (N3) (N3) (N2 & 3) (N3 &
4)
CGG(N3_ 0 2, (N5& 2, (N 8 1, 1, 0 0 0 0 0
11)CCG 11) 9) (No) (N3)









EfHP
1 2 3 RDTI TSFf OXRI EfPKSf PRFi ECTi EfP4

10 12 08 08 (40) 31 07 66 0.7 16 04(kb)

Figure 5-1. Elsinochrome (ESC) biosynthetic gene cluster. The 30-kb DNA region harboring 10
genes is shown. The putative genes include RDT1 reductasee 1), TSF1 (transcription
factor 1), OXR1 (oxidoreductase 1), EfPKS1 (polyketide synthase 1), PRF1 (prefoldin
1), ECT1 (transporter 1). The nucleotide sequence of the 5' end flanking region
contains three ORFs designated EfHP1, EfHP2, and EfHP3, and the 3' end contains
one ORF designated EfHP4.











A EfHP
1 3 RDTI


NH4NO3 (g/L)
r --


TSFI OXRI EfPKS I PRF ECTf El
- ^- II


pH
/ -r


EfHPI 1 0-

EfHP2 1 2.

EfHP3 08-


Glucose (g/L)

2 60

Not tested
V r


TSFi 31.

OXR 107.

EfPKS 166-

PRF 07-

ECTI 1 6-
EfHP4 04.
rRNA (kb)


NH4NO, (g/L) pH


Glucose (g/L)


Figure 5-2. Northern-blot analysis of gene expression and elsinochrome (ESC) production in
response to nitrogen, pH, and glucose in Elsinoefawcettii. Fungal isolate was grown
on complete medium containing different amounts of glucose, or on minimal medium
containing different concentrations of ammonium nitrate or buffered to various pH as
indicated under continuous light. A) Fungal RNA was isolated from 7-day-old
cultures, electrophoresed in an agarose gel containing formaldehyde, transferred onto
a nylon membrane, and hybridized to the gene-specific probes. Ribosomal RNA
(rRNA) stained with ethidium bromide is shown for relative loading of the samples. B)
ESCs were extracted with 5 N KOH and measured at A480. The amounts of ESCs
were determined by reference to a regression line that was established using ethyl
acetate-purified ESCs. ESC data represent the means of two different experiments
with four replicates of each treatment. Vertical bars represent standard deviation.
Means followed by the same letter are not different at judged by Duncan's multiple
range test at P < 0.0001.










A
(N) trpC promoter
up11
=Hyv I f (N)trpC terminator
,h7 h (N), Split marker

up28

P B PB P \Nrul sBgr'Pvu II
------- ----T----T
up2G ---------

Probe -
up28
P B P (N) B P B P
I ";F 1T f 3 T-' I Disruptant
S- - - -7 - - (pTSF1128)
---->- --- ---- ----
1 3 kb 2 8 kb



B C
Disruptants Disruptants
T1 T2 T3 T1 T2 T3

411




(kb
(Pvull digestion) (Bg i I/Pvull digestion)


Figure 5-3. Targeted gene disruption of TSF1 encoding a putative transcription regulator which
contains dual Cys2His2 type zinc finger and GAL4-like Zn2Cys6 binuclear cluster
DNA-binding domain using a split-marker strategy in Elsinoefawcettii. A)
Restriction maps of the TSF1 gene in the genome of wild type (WT) and Atsfl-
disrupted mutant. Two truncated TSF1 fragments fused with an overlapping HYIYG
(hygromycin resistance gene cassette) were amplified by PCR with Oligonucleotide
primers (upl 1 paired with hyg3; up28 paired with hyg4) as indicated. Note: drawing
is not to scale. B, BglI; N, Nrul; P, Pvull. B) and C) Southern-blot analysis of
genomic DNA from wild type (WT) and three Atsfl-disrupted mutants (T1, T2 and
T3). Fungal DNA was digested with PvuII (B) or BgI/Pvull (C), electrophoresed,
blotted onto a nylon membrane and hybridized with TSF1 gene specific probe
amplified by primers, up 26/up28, as indicated in A. Hybridizing patterns indicate
disruption of the TSF1 gene.










Scomple-
TSF1 null mutants mentation
WT T1 T2 T3 T? T3 -A -R


-3.1 kb



rRNA


B C


Band Rf


0.68
0.5o
0.22


WT T1 T2 T3 CA CB

TSFI null mutants m
,
//


T1 T2 T3 CA
TSFf null mutants ,


Figure 5-4. TSF1 gene expression and ESC production in TSF1 disruptants. A) Northern-blot
analysis of fungal RNA purified from wild type (WT), three putative Atsfl-disrupted
mutants (T1, T2 and T3), and two TSFl-complemented strains (CA and CB) of
Elsinoefawcettii. RNA was denatured in a formaldehyde-containing gel, blotted to a
nylon membrane, and hybridized to a DNA probe (probe amplified by primers,
up26/up28 in Fig. 5-3A). Gel stained with ethidium bromide indicates relative
loading of the RNA samples. Sizes of hybridization bands are indicated in kilobase
pairs. B) Quantitative analysis of ESCs produced by wild type, TSF1 disruptants and
complemented strains. Fungal isolates were grown on PDA under continuous light for
7 days. ESC pigments were extracted with 5N KOH from agar plugs covered with
fungal hyphae and measured at A480. The concentrations of ESCs were calculated by
referring to a regression line. Data represent the means of two different experiments
with four replicates of each treatment. Vertical bars represent standard deviation.
Means followed by the same letter are not different at judged by Duncan's multiple
range test at P < 0.0001. C) TLC analysis of ESCs produced by wild type, three
Atsfl-disrupted mutants, and complemented strain (CA).


4
(D
ID2
01
E











Gene
probe:

EfHPI 1.0-


EfHP2 1.2-


EfHP3 0.8.


RDTI 0.8-


OXRI 0.7-


EfPKS 6.6.


PRF 0.7-

ECTI 1.6
(kb)
rRNA


comple-
TSF1 mutants mentation
T2 T3 CA CB







: Not tested





*


Figure 5-5. Northern-blot hybridization indicates that the Atsfl-disrupted mutants failed to
accumulate the EfPKS1 and reduce production of RDT], PRF1 and EfHP1 transcripts.
Ethidium bromide-stained rRNA indicates the relative loading of the samples. Total
RNA was isolated from fungal strains grown on potato dextrose agar under
continuous light for 7 days, electrophoresed in formaldehyde-containing gels, blotted
onto nylon membranes and hybridized to the probes as indicated at 50 OC.










EfPKSI comple-
mutant mentation
WT D4 C1 C2


Gene
probe:


-1.0


-3.1


EfHP2


EfHP:


rRNA


EfPKSI
mutant
VWT D4


-0.7



.1.2


-0.8


(kb)


-1.6
-1.3


Figure 5-6. Northern-blot hybridization indicates a feedback inhibition of the ESC clustering
genes in Elsinoefawcettii. Expression of the EfHP1, RDT1, TSF1, PRF1, and ECT1
genes in the EfPKS1 disrupted mutant, D4, was dramatically repressed. Functional
complementation by introducing a copy of EfPKS1 into a null mutant yielded two
fungal strains (C and C2) with a restored gene expression. Total RNA was isolated
from fungal strains grown on potato dextrose agar under continuous light for 7 days,
electrophoresed in formaldehyde-containing gels, blotted onto nylon membranes and
hybridized to the probes as indicated. Ethidium bromide-stained rRNA is shown to
indicate the relative loading of the samples.


Gene
probe:


RDTi


TSFP


PRF1


ECT1'


rRNA













Acetyl-CoA +


Malonyl-CoA
o o


HO- C S-ACP-SH

CoA-S CH3B 2
Condensation & decarboxylation ,-H
o02

Phosphopantotheine (PPT)
o 0 0 0
R S-KS R
H H H H


Pathway transcription
regulator: TSF1

Role of PRF1: uncer


nal EffI 1


tain polyketide


c "imTornafl3:1 et igatt i:
[: ketosvtia e
AT: actTrait rae
ACP: acl carrie r prol Ib
TE(CC): ilol Iesl raslalxe
cOiwe


0 0 0 0
R 8SCoA
I
Claisen con nation and ring i
closure EfPKS1 Formation of conidia &
conidiophores
Oxidation or Hydration- RDT1, OXR1 (?)

Methylation ?

Polyketomethylene unit


Dimerization & modification of side chains
H.
o 0





H
OCHJ -



H 3OCH2






Exportation EC T1
H
Elsinochrome A: R1 = R2 = -CO-CH,
Elsinochrome B: R1 = -CO-CH3, R2 = -CHOH-CH3
Elsinochrome C: R1 = R2 = -CHOH-CH,

Exportation EC T1


Figure 5-7. Hypothetical reaction pathway for the formation of elsinochromes (ESCs) by
function of the ESCs biosynthetic clustering genes. The TSF1 transcription factor is
proposed to regulate expression of the clustered genes. The early precursors (acetyl-
CoA and Malonyl-CoA) are incorporated into a growing polyketide chain, which is
released and cyclized by the function of EfPKS 1 as stated in the text. The products of
RDTI and OXR1, are thought to be required for post-polyketide-synthesis steps,
whereas the actual function of PRF remains unknown. ECT is assumed to be
responsible for ESC exportation.











Environmental cues
(e.g light, carbon sources, nitrogen sources)



Light receptors and signal receptors



Signaling pathways (e. g. cAMP-dependent, MAP kinase, calcium/calmodulin)
and global transcription factors activation (e. g. AreA; WC1WC2; PacC; C/EBP; BrlA; AbaA; others)



TSF1 RDT1 OXR1
EfHP1 EfHH2
TSF1 EfPH3
PRF1
E ECT1



EfPKS1



Elsinochromes export and accumulation Conidiation

Figure 5-8. Hypothetical signal transduction and regulatory controls for ESC biosynthesis and
accumulation. The biosynthetic pathway is assumed to be mainly regulated by
pathway-specific transcriptional regulator, TSF1, that is presumably activated by a
wide range of global regulatory factors in response to various environmental cues as
described in text.









CHAPTER 6
GENETIC AND PATHOLOGICAL DETERMINATIONS OF Elsinoefawcettii FIELD
ISOLATES FROM FLORIDA

Elsinoefawcettii, the causal pathogen of citrus scab, induces superficial corky lesions on

the affected tissues. Production of elsinochrome (ESC) phytotoxins has been shown to play an

essential role for E. fawcettii virulence and lesion development. In this study, 52 field-collected

E. fawcettii isolates from Florida citrus growing areas were examined for ESC production and

pathogenicity to three index citrus hosts: rough lemon, grapefruit, and sour orange. All

pathogenic isolates were found to produce ESCs in cultures and/or inplanta, further confirming

the important role of ESCs in fungal virulence. Several field-collected isolates of E. fawcettii

displayed different pathogenicity, host range, and ESC production, apparently differing from the

other isolates. One field isolate, Ef41, was completely non-pathogenic to rough lemon, grapefruit,

and sweet orange, and did not produce ESCs. Ef41 failed to express the EfPKS] gene and

differed considerably from other E. fawcettii isolates on the basis of phylogenetic analysis

inferred from ITS region. Moreover, as assays on detached rough lemon and grapefruit leaves,

co-inoculation of a low virulence isolate attenuated disease severity caused by the highly virulent

isolate.

Introduction

Citrus scab caused by Elsinoefawcettii is widely distributed in humid citrus-growing areas

worldwide. The development of superficial corky lesions induced by this pathogen leads to a

significant economic loss for the fruit intended for fresh market. Many phytopathogenic Elsinoe

species have been reported to produce elsinochromes (ESCs) (reviewed by Weiss, et al. 1987).

Limited work has been done to demonstrate the linkages between ESC production and fungal

pathogenesis. ESCs presumably react with oxygen upon illumination and generate superoxide

and singlet oxygen, which have been previously shown to be highly toxic to cells and tissues of









citrus and tobacco (Liao and Chung 2008a). Furthermore, the non-ESC producing E. fawcettii

mutants, derived from disruption of the EfPKS] gene, exhibited a reduced virulence to citrus

(Liao and Chung 2008b), further confirming the important role of ESCs in fungal pathogenesis.

However, ESC toxins have never been isolated from Elsinoe-induced lesions. Elsinoe species or

Elsinoefawcettii isolates are not readily distinguishable by morphological traits (M. Priest

unpublished data; Fantin 1988; Fortes, 1989; Timmer et al. 1996). Molecular approaches such as

restriction analysis of the amplified internal transcribed spacer (ITS) of ribosomal DNA digested

with several endonucleases and sequence analysis of the ITS have been applied to differentiate

the closely related species of Elsinoe, such as E. fawcettii, E. australis, and Sphacelomafawcettii

var. scabiosa (Tan et al. 1996). The internal transcribed spacer 1 (ITS 1) between 18S rDNA and

5.8S rDNA is relatively less conserved among species, and has been demonstrated to be a useful

marker for differentiating inter-relationships of fungal strains, species, and genera (Duncan et al.

1998; Brookman et al. 2000). For E. fawcettii, the random amplified polymorphic DNA (RAPD)

technique has been proven as a useful and easy tool for identifying Elsinoe species and the

isolates from different geographic areas (Tan et al. 1996). In Florida, two pathotypes of E.

fawcettii: Florida Broad Host Range (FBHR) and Florida Narrow Host Range (FNHR) have been

described on the basis of host range (Whiteside 1978; Timmer et al. 1996). The FBHR pathotype

primarily affects the leaves and fruit of grapefruit (C. paradisi Macf.), lemon (C. limon (L.)

Burm. F.), rough lemon (C.jambhiri Lush), Murcott and Temple tangors (C. sinensis (L.) Osbeck

x C. reticulata Blanco) and sour orange (C.aurantium L.), and the fruit of sweet orange (C.

sinensis). By contrast, the FNHR pathotype affects all of the above except sour orange, Temple

tangor, and sweet orange. Except for differences in host range, FBHR and FNHR pathotypes are

not distinguishable morphologically and genetically.









In the present study, I surveyed 52 E. fawcettii isolates from citrus groves in Florida and

found that many of the isolates accumulated red or orange pigments in culture. In this chapter,

close relationships between fungal virulence and ESC production in vitro and inplanta were

elucidated. Investigation of their host ranges and taxonomic relationships among isolates of E.

fawcettii suggests the presence of novel pathotypes or phylogenetic species of E. fawcettii in

Florida.

Materials and Methods

Fungal Isolates and Growth Conditions

All fungal isolates ofElsinoefawcettii Bitancourt & Jenkins (anamorph: Sphaceloma

fawcettii Jenkins) were collected from citrus-growing areas in Florida and were kindly provided

by L. W. Timmer (University of Florida). The origins of these isolates are indicated in Table 6-1.

Fungal isolates were maintained on potato dextrose agar (PDA, Difco, Sparks, MD) under

constant fluorescent light at 25 C. Other media used in this study include a complete medium

(CM) containing 1 g Ca(N03)2-4H20, 0.2 g KH2PO4, 0.25 g MgSO4-7H20, 0.15 g NaC1, 10 g

glucose, 1 g yeast extract, and 1 g casein hydrolysate per liter (Jenns et al. 1989), and a 10%

skim milk medium (Difco). For ESC production, fungal isolates were grown on thin PDA plates

(5 mL in 100 x 15 mm Petri dish plates) for 10 days under light. Fungal isolates were grown on

agar plate overlaid with a piece of sterile cellophane when DNA or RNA isolation was desired.

Extraction and Analysis of Elsinochromes (ESCs)

ESC toxins were extracted from fungal cultures and analyzed by TLC as described in

Chapter 2. Quantitative analysis of ESC produced in vitro was performed by extracting agar

plugs with fungal hyphae with 5 N KOH and measuring absorbance at 480 nm. To extract ESCs

from affected rough lemon leaves, leaf spots with necrotic lesions were cut, pooled, and

extracted twice with ethyl acetate at 4 OC for 16 h in the dark. Organic solvent was collected, air-









dried at room temperature, suspended in small volumes of acetone, and analyzed by

spectrophotometry at A480 and TLC. The concentration of ESCs was calculated by reference to a

regression line that was established using pure cercosporin (Sigma-Aldrich) as standard and was

expressed as cercosporin equivalents.

Production and Germination of Conidia

Conidia were prepared by the method described by Timmer and colleagues (1996) with

modifications. Approximately, 0.03 g of fungal hyphae was ground with a disposable pestle in 4

mL Fries medium (Fries, 1978), placed on a Petri dish (15 x 90 mm), and incubated at 25 C for

2 days in the dark to trigger conidial formation. Plates were washed with sterile, distilled water,

flooded with distilled water (pH 7.0) and incubated for additional 12-15 hr in the dark. Conidia

on the bottom of the plate were washed once with distilled water, scraped, re-suspended after

centrifugation (6000 rpm, 10 min), and passed through a filter to remove mycelia. Conidia were

counted and measured with the aid of a hemocytometer using a microscope at x 200

magnification. Germination of conidia was determined 2 days post inoculation on detached

rough lemon and grapefruit leaves as described below and was calculated in proportion to the

total number of conidia recovered from the inoculated spot.

Pathogenicity Assays

Assays for fungal pathogenicity were conducted on detached rough lemon (Citrusjambhiri

Lush), grapefruit (Citrus paradisi), and sour orange (Citrus aurantium) leaves inoculated with

conidial suspension. Rough lemon is susceptible to all Elsinoe pathotypes of citrus (Timmer et al.

1996). Conidial suspension (1ltL, 1 x 105 mL1) was carefully placed on the leaf surface and the

inoculated leaves were incubated in a mist chamber under constant fluorescence light for lesion

formation.









Enzymatic Activity Assays

Assays for enzymatic activities were determined as described (You and Chung 2007).

Glucose in the complete medium (CM) was substituted by appropriate carbon sources (1% citrus

pectin, pH4.5 or pH7.6; 1% polygalacturonic acid, pH4.5 or pH7.6; 0.5% carboxymethyl

cellulose; 10 g glucose plus 0.1% 16-hydroxyhexodecanoic acid cutinn monomer)) for induction

of the respective enzyme. Skin milk used for proteolytic activity assays was prepared by mixing

(3:22, v:v) solution A (10% skim milk dissolved in 0.05 M phosphate buffer, pH 6.8) and

solution B (Agar medium containing 0.23% yeast nitrogen base) after sterilization.

Extracellular activities CWDEs (cell wall degradation enzymes) were evaluated by

measuring the amounts of reducing sugar that was released from 1% polygalacturonic acid

(PGA), 1% citrus pectin or 0.5% carboxymethyl-cellulose (CMC) and reacted with

dinitrosalicylic acid (DNS) reagent under alkaline conditions (Bailey et al. 1993). Fungal isolates

were grown on a modified CM in which glucose was substituted by an appropriate

polysaccharide for 10 days. Five 5-mm agar plugs bearing fungal mycelia were cut and placed in

0.1M sodium phosphate buffer containing 1% PGA (pH 4.5 or pH 7.6), 1% citrus pectin (pH 4.5

or pH 7.6), or 0.5% CMC (pH 5). After incubation at 50 OC for 1 hour, an equal volume of DNS

reagent was added, boiled at 95 OC for 5 min, and absorbance was measured at A540nm. The

regression line and correlation coefficient (r2 > 0.98) were established using glucose as a

standard. One unit of enzyme activity is defined as 1 nmole of glucose liberated from the

substrate per minute.

Extracellular cutinase activities were determined by formation of a yellow color after

reacting with 50 mM paranitrophenyl butyrate (PNPB) in 0.1M sodium phosphate buffer (pH 5)

for 1 hour and measured at A405nm (Stahl and Schafer 1992). Fungal isolates were grown on a

modified CM containing 0.1% 16-hydroxyhexadecanoic acid (HHDA, dissolved in 1% sodium









acetate) as a sole carbon source for 8 days for induction before the enzymatic assays. One unit of

cutinase released is 1 nmolep-nitrophenol produced per minute.

Proteolytic activities were determined by formation of clear zones on 10% skim milk

plates. Fungal mycelia were ground in sterile water, and spread onto an agar plate. After

incubation at 28 C for 4 days, the sizes of clear zones were measured.

PCR-Restriction Fragment Length Polymorphism (RFLP) and Sequence Analysis of ITS
and P-tubulin Genes

The ITS regions of fungal rDNA were amplified by PCR with primer ITS 1 (5'-

TCCGTAGGTGAACCTGCGG-3') and ITS 4 (5'-TCCTCCGCTTATTGATATGC-3') as

described by White et al. (1990). A 600-bp DNA fragment, encompassing entire ITS 1, 5.8S and

partial 18S of rDNA, was amplified. Partial P-tubulin gene (- 500 bp) of fungal isolates were

amplified with primer sets BtlR (5'-GACGAGATCGTTCATGTTGAACTC-3') and BtlF (5'-

TTCCCCCGTCTCCACTTCTTCATG-3') as described (Glass and Donaldson 1995). The PCR

amplification reactions were carried out in a Peltier thermal cycler (MJ. Research, INC.,

Watertown, MA). The DNA was amplified by GoTaq Flexi DNA polymerase (Promega, WI)

in 50 [L reaction containing 0.2 [M of each of the primer set and 50 ng of genomic DNA.

Thermal cycling parameters for amplification of both ITS and P-tubulin include a single cycle of

95 C for 2 min, followed by 35 cycles of 45 sec at 95 OC, 45 sec at 56 C, and 1 min at 72 C

and a final step at 72 C for 5 min. The amplified DNA fragments were digested with 4-bp

recognition sequence restriction endonucleases, electrophoresed in 2% agarose gel, stained with

ethidium bromide, visualized, and photographed under ultraviolet light. The amplified ITS

fragments were cleaved with HaeIII, MspI, or Taqal, whereas the amplified P-tubulin gene

fragments were cut with AluI, DpnI, HaeIII, MspI, NIaIV, or Taqal. For direct sequencing, the

DNA fragments were amplified by an Expand High Fidelity PCR system (Roche Applied









Science). Otherwise, all fragments were cloned into pGEM-T easy vector (Promega, Madison,

WI) for sequencing analysis from both directions at Eton Bioscience (San Diego, CA). Similarity

was determined by Emboss MATCHER Program (Sanger Institute, Hinxton, Cambridge, UK.).

The ITS 1 sequences were aligned with published sequences and phylogenetic analyses were

performed using DS Gene v2.5 program (Accelrys Inc., San Diego).

Random Amplified Polymorphic DNA (RAPD)

RAPD fragments were amplified with a 10-mers primer, OPX-7 (5'-GAGCGAGGCT-3'),

OPX-13 (5'-ACGGGAGCAA-3'), or MtR 1 (5'-GTAAAGGGGG-3'), by Taq DNA polymerase

(GenScript, Piscataway, NJ). The cycling profile for amplification includes an initial cycle of 94

C for 3 min, immediately followed by 35 cycles of 94 C for 30 sec, 36 C for 45 sec, 72 C for

4 min and a final step of 72 C for 7 min. The amplified DNA fragments were separated by

electrophoresis in 2% agarose gel.

Miscellaneous Methods of Processing Nucleic Acids

Plasmid DNA was purified using a Wizard DNA purification kit (Promega) from

transformed Escherichia coli DH5a bacterial cells. Fungal RNA was extracted with Trizol

reagent (Invitrogen, Carlsbad, CA). Standard procedures were used for electrophoresis and

Northern-blot hybridization. DNA probes used for hybridization were labeled with digoxigenin

(DIG)-11-dUTP (Roche Applied Science) by PCR with gene-specific primers. The

manufacturer's recommendations were followed for probe labeling, hybridization, post-

hybridization washing and immunological detection of the probe using a CSPD

chemofluorescent substrate for alkaline phosphatase (Roche Applied Science).









Results


Morphological Examination

Isolates ofElsinoefawcettii were first examined for potential morphological variations

using light or dissection microscopes. All isolates produced filamentous mycelia, and formed

nodular/bulbous mycelia after a prolonged incubation (e.g., Fig. D-1). Pleomorphic colonies

were observed among isolates when cultured on PDA or CM culture (Fig. D-2 and data not

shown). All isolates had a limited mycelial extension, which were slightly raised in the center.

Some isolates (e.g., Efl2, Efl7, Ef29, Ef37, and Ef48) produced colonies that were dark red with

a little fluffy velvet-like mycelia, while others produced pale colonies (e.g., Ef30 and Ef49)

covered with or without fluffy mycelia. All isolates produced hyaline conidia, showing elliptical

to obclavate, and nonseptate cells (data not shown). The isolate Ef41 produced smaller conidia

having the means size of 3.4 x 1.9 [im (length x width), while other isolates produced conidia

with the mean size 4.1-5.1 x 2.2-2.7[im (length x width).

Pathogenicity Assays

As rough lemon is susceptible to all Elsinoe spp. (Timmer et al. 1996), fungal

pathogenicity was primarily evaluated in this citrus cultivar. In total, 52 E. fawcettii isolates

cultured from different citrus cultivars and geographic locations of citrus-growing areas in the

state of Florida were evaluated for pathogenicity on detached rough lemon leaves (Table 6-1).

All isolates produced substantial numbers of conidia, ranging from 0.1-50 x 106 conidia per mL.

As assayed on detached rough lemon leaves, all isolates except one (Ef41) incited necrotic

lesions on young leaves (7-10 days after flushing) and exhibited a reduced virulence to varying

degrees when inoculated onto older leaves (14-18 days after flushing, data not shown). Isolate

Ef41 failed to induce any necrosis on rough lemon, while isolates EflO and Ef29 had a weak

virulence on rough lemon. Pathogenicity of nine isolates (EflO, 12, 17, 29, 30, 37, 41, 48, and 49)









was also assessed after inoculation onto detached grapefruit and sour orange leaves (Table 6-1).

Isolates EflO and Ef29 were weakly virulent to either grapefruit or sour orange and isolate Ef41

was nonpathogenic to either citrus cultivar. Other isolates were weakly or moderately virulent to

grapefruit or sour orange (Table 6-1).

Production of ESC Toxin in Culture

ESCs produced by E. fawcettii isolates was extracted from agar plugs bearing fungal

mycelium with 5N KOH and quantified by measuring absorbance at 480 nm. As shown in Table

6-1, production of ESC toxins was variable among isolates, ranging from 1.4 to 16.6 nmoles per

agar plug. Noticeably, several isolates (Efl, 15, 25, 26, 27, and 47) produced little or no ESCs in

axenic cultures despite being pathogenic to rough lemon. i.e., there was no relationship between

in-vitro production of ESCs and lesion formation on rough lemon.

Extraction of ESCs from Scab Lesions

To determine if ESCs were accumulated during fungal colonization, 23 field isolates of E.

fawcettii, including five isolates (Efl, 25, 27, 41and 47) that produced no ESCs in cultures, were

inoculated onto detached rough lemon leaves. ESCs were then extracted from a pooled sample of

20 necrotic lesions of each isolate, and analyzed by TLC. ESCs with different banding profiles

and intensities were extracted from lesions induced by 22 isolates tested (Fig. 6-1). Isolate Ef41

did not incite any visible lesions on rough lemon leaves and accumulated no detectable ESCs.

Isolates Efl, Ef25, Ef27and Ef47 produced no detectable levels of ESCs in cultures, but

apparently produced ESCs inplanta and induced characteristic scab lesions on rough lemon

leaves (Fig. 6-1; Table 6-1). Judging from band width and intensity, band 1 (Rf0.68) appeared to

be the major compound of the leaf extracts, whereas band 3 (Rf0.22) was the most abundant

product of the cultural extracts. Spectrophotometric scanning indicated that the acetone extracted

pigments from scab lesions on rough lemon leaves displayed a strong absorbance at 460 nm with









two minor peaks at 530 and 570 nm, resembling those purified from E. fawcettii cultures as

described in Chapter 2.

Further Characterization of a Nonpathogenic Elsinoefawcettii Isolate

In addition to assays for fungal pathogenicity and ESC production, nine E. fawcettii

isolates, representing nonpathogenic (Ef41), weakly virulent (EflO, Efl7, Ef29, and Ef49) and

highly virulent isolates (Efl2, Ef30, Ef37, and Ef48), were further examined for potential genetic

variations. As shown in Table 6-1, isolates that were pathogenic to rough lemon were also

pathogenic to grapefruit. All isolates except Ef41 produced scab pustules on young leaves (7

days after flushing) of rough lemon and grapefruit and exhibited a reduced virulence to varying

degrees on older leaves (14 days after flushing). These nine E. fawcettii isolates were not all

pathogenic on sour orange. Only three isolates, Efl2, Efl7, and Ef48, of nine isolates produced

severe pustule lesions on sour orange.

Alterations in Hydrolytic Enzyme Activities

To determine if fungal hydrolytic enzymes are required for pathogenicity of E. fawcettii,

the extracellular activities of proteolytase, cellulase, pectinase, polygalacturonase and cutinase

were determined among nine isolates described above. Isolate Ef41 had no detectable proteolytic

activity, whereas isolates EflO, Efl7, Ef29, and Ef49 with lower virulence had lower proteolytic

activity compared to the pathogenic isolates Efl2, Ef30, Ef37, and Ef48 (Fig. 6-2A). Similarly,

isolates Efl2, Ef30, Ef37, and Ef48 displayed higher cellulase activity than other isolates tested

(Fig. 6-2B). All E. fawcettii isolates tested exhibited high levels of pectolytic activities when

grown in a medium containing citrus pectin as a sole carbon source (pH 4.5), but the overall

pectolytic activities decreased considerably at pH 7.6 (Fig. 6-2C). When grown in a medium

containing polygalacturonic acid as a sole carbon source, all isolates had no or little

polygalacturonase activity when the medium was buffered to pH 7.6. By contrast, isolate Ef41









exhibited marked polygalacturonase activity when the medium was buffered to pH 4.5 (Fig. 6-

2D). There was no significant difference in cutinase activities among all isolates tested, despite

that isolate Ef41 showed slightly but not significantly lower cellulase activity (Fig. 6-2E).

Production of ESC and Expression of the EfPKS1 gene in the Nonpathogenic Isolate (Ef41)

Of 52 isolates examined, only Ef41 isolate failed to infect rough lemon, grapefruit, or sour

orange and produced no ESC either in culture or inplanta (Table 6-1). Thus, expression of the

polyketide synthase-coding gene, EfPKS], that has been shown to be required for ESC

biosynthesis (Liao and Chung, 2008b) was examined in Efl2 and Ef41 isolates by Northern blot

analysis.

As shown in Fig. 6-2F, accumulation of the EfPKS] transcript was normal in the ESC-

producing isolate Efl2. The EfPKS] gene transcript was undetectable in isolate Ef41, which may

account for no ESC production.

Co-inoculation of Two E. fawcettii Isolates Reduces Lesion Formation

To test if the isolates with low virulence will compete with the isolates with high virulence,

various combinations of two E. fawcettii isolates were co-inoculated onto detached rough lemon

and grapefruit leaves and lesion formation was assessed.

Co-inoculation of conidial suspension of isolate Efl2 with either isolate Ef29 or Ef49

resulted in a repressed symptom development on both citrus cultivars compared to those

inoculated with the Efl2 isolate alone (Fig. 6-3). When isolate Efl2 alone was inoculated onto

rough lemon or grapefruit, over 65% of the total spots inoculated developed severe scab lesions

covered with numerous pustules (level 4-5). When isolate Efl2 was co-inoculated with isolate

Ef29 or Ef49, less than 14% of the inoculated spots on either rough lemon or grapefruit leaves

developed severe scab lesions. Co-inoculation of isolate Efl2, Ef29 or Ef49 with isolate Ef41 did

not alleviate symptom development (Fig. 6-3).









Molecular Evaluation of E. fawcettii Isolates

E. fawcettii isolates cultured from Florida citrus growing areas displayed variations in

virulence to rough lemon, grapefruit, and sour orange and ESC production. To determine if such

variations also occur at the genetic level, molecular approaches, including PCR-RFLP, RAPD,

and sequence analysis of internal transcribed spacer (ITS) region and the conserved gene (P-

tubulin), were used to further characterize E. fawcettii isolates with differ virulence.

As assessed by PCR-RFLP of the amplified ITS rDNA fragment (-600 bp) cleaved with

either HaeIII, MspI, or Taqal, isolate Ef41 apparently had DNA banding profiles that were

clearly distinguishable from those of other isolates tested (Fig. 6-4). Polymorphisms of the

amplified P-tubulin gene fragments digested with HaeIII or Taqal, also separated isolate Ef41

from other E. fawcettii isolates (Fig. 6-5). The amplified tubulin cleaved with AluI, DpnI, MspI,

or NIalV resulted in similar profiles among E. fawcettii isolates (Fig. 6-5). Furthermore, isolate

Ef41 was apparently different from other E. fawcettii isolates when randomly amplified DNA

fragments using a 10-mer primer OPX-7, OPX-13, or MtR 1 were compared (Fig. 6-6).

The amplified ITS 1 region from isolates Efl2, Ef29, Ef41, and Ef49 was sequenced and

compared with the published sequences in the database (National Center for Biotechnology

Information) to determine their phylogenetic relationships. The ITS sequences obtained from

isolates Ef29 and Ef49 were identical, showing 100% identity, while Efl2 had 90% identity to

those of E. fawcettii (EFU28058) and Sphacelomafawcettii (SFU28059). Isolate Ef41 displayed

lowest ITS sequence similarity and apparently was separated from other E. fawcettii isolates of

citrus (Fig. 6-7). Furthermore, partial P-tubulin gene sequences of isolates Efl2 and Ef41 were

compared with the published sequences in the database. The relative identity of fragments is

shown in Table 6-2, indicating that isolate Ef41 shared higher nucleotide identity with isolate

Efl2 (85.8%), whereas Efl2 displayed varying similarity of P-tubulin gene sequence to other









fungi including Aspergillus nidulans (88.9%), Cercospora beticola (87.0%), Mycosphaerella

graminicola (86.7%), Neurospora crassa (90.1%), and Neosartoryafischeri (87.7%) (Table 6-2).

Discussion

ESCs produced by E. fawcettii, due to the production of toxic oxygen species upon

irradiation, have been shown to be highly toxic to the cells and tissues of citrus and tobacco

(Liao and Chung 2008a) and also essential for full virulence of E. fawcettii (Liao and Chung

2008b). Analysis of ESC production and fungal pathogenicity on three index hosts of citrus

(rough lemon, grapefruit, and sour orange) revealed a marked variation among E. fawcettii

isolates cultured from Florida. Evidence presented in this study indicated that the majority of E.

fawcettii isolates produced ESCs in axenic culture (-90%, Table 6-1), but the production was

varied widely with isolate.

All E. fawcettii isolates that were pathogenic to rough lemon produced ESCs in culture

and/or in plant, in spite of lacking of a relationship between the amounts of ESCs accumulated

in culture and inplanta. The amounts of ESCs produced by an individual fungal isolate in

culture or inplanta did not account for the severity of scab disease induced by the same isolate.

A survey of 52 isolates revealed that four isolates (Efl, Ef25, Ef27, and Ef47) accumulated no

detectable level of ESCs in culture, but provoked characteristic scab lesions and accumulated

substantial amounts of ESCs in rough lemon leaves, implicating the presence of signals or

substrates from the plant for ESC production. The Ef41 isolate that was not pathogenic to rough

lemon, grapefruit, or sour orange, was unable to produce any detectable ESCs. Since ESCs are

extremely toxic upon reaction with oxygen molecules under light, this study further confirmed

the critical role of ESCs for lesion formation and fungal pathogenesis, consistent with the

previous finding from molecular analysis (Liao and Chung 2008b). As all pathogenic E. fawcettii

isolates produced varying amounts of ESCs inplanta, it is tempting to speculate that a trace









amount of ESCs, continuously produced by the pathogen, might be sufficient to facilitate fungal

invasion and colonization to its hosts.

The occurrence of citrus scab on various citrus species and cultivars has been reported in

different countries of the world, primarily based on field observation. Yet, little study has been

done toward delineating the host range and distribution of the species and pathotypes of citrus

scab fungi. The "Florida Broad Host Range (FBHR) and the "Florida Narrow Host Range

(FNHR)" described in Florida based on host range are not distinguishable genetically (Whiteside

1988; Timer et al. 1996). A recent study described a novel E. fawcettii pathotype that was only

pathogenic to Natsudaidia (C. natsudaidai Hayata) and Kinkoji (C. obovoidea Hort ex Tak.) fruit

in Korea (Hyun et al. 2001).

As is evident from the present study, it seems likely that additional pathotypes or new

species of Elsinoe might be present in Florida citrus-growing areas other than FBHR and FNHR.

The EflO and Ef29 isolates, originally cultured from infected SunCha Shakat mandarin and

Swingle citrumelo, respectively, were only weakly virulent to grapefruit, rough lemon, and sour

orange. The Efl7 isolate, originally cultured from infected Temple leaves, appeared to be highly

virulent to sour orange, yet induced moderate or mild scab lesions on rough lemon and grapefruit.

The Efl2 isolate was highly virulent to the three citrus hosts tested, but displayed low similarity

of the ITS 1 sequence to those of E. fawcettii. The Ef41 isolate, also cultured from infected

Temple leaves, was apparently different from other field isolates, in terms of pathogenicity,

morphology, toxin production, phylogenic variations, and other genetic variations and thus,

likely represents a novel phylogenic or biological species. Although the Ef41 isolate failed to

attack the leaves of three index citrus cultivars, it does not necessarily indicate that Ef41 is an E.

fawcettii saprophyte. Similar pathotypes that were nonpathogenic to rough lemon, grapefruit, and









sour orange have also been reported from field-collected isolates in Argentina (Timmer et al.

1996). However, the Argentina isolates had different ITS RFLP banding profiles from that of

Ef41 isolate. Since only a limited number of isolates were tested in this study, it is impossible to

conclusively determine if Ef41, Ef29, and Ef49 are different pathotypes of E. fawcettii or simply

represent novel cryptic Elsinoe species that have not yet been characterized in citrus. More field

isolates need to be tested and a broader range of citrus cultivars are required to be inoculated to

understand the complexity of all of the pathotypes of E. fawcettii in Florida.













Table 6-1. Pathogenicity and production of elsinochromes (ESCs) in vivo and inplanta by
different field isolates of Elsinoefawcettii
Fungal isolates Origins' Disease severity2 ESC production
(No. and names) detached-leaf (nmole per plug or spot)


# (Ef)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32


RL C


Name
Duda-Imk- 1
Duda-Imk-2
Duda-Imk-5
Eus-1
Eus-2
Eus-3
Eus-4
Lkpcd-2
Navarro-3
Scsk
Navarro-6
FtPierce-3a
FtPierce- 4b
FtPierce-3
Carrizo
Irrec-3
R-36
Labelle
Ftmead4
Duda-Imk-3
Ss-Imk-3
Ss-Imk-1
Tbl-La-2
Rl-2
Russel-15
Smoak 1
Ss Imk 1
Stl-Lv-d
Citro- 1
Eus-Lv-1
Eus-1
Ftmead 3


Temple
Temple
Temple
Murcott
Murcott
Murcott
Murcott
Temple
Grapefruit
Sun Shu Shakat
Grapefruit
Temple
Temple
Temple
Carrizo citrange
Murcott
Temple
Lemon
Grapefruit
Temple
Temple
Temple
Temple
Rough lemon
Temple
Temple
Tahiti lime
Temple
Swingle citrumelo
Murcott
Temple
Grapefruit


+++
++++
++++
+++++
+++
+++++
+++
+++++
+++++
+/-
+++++
++++
+++
+++
+++
+++
+
++
++++
++++
++++
++++
++++
++++
+++++
+++++
+++++
+++
+/-
++++
++
+++++


rF SO In vitro3
nd5 nd 0
nd nd 3.0 1.3
nd nd 8.8 0.4
nd nd 3.2 + 1.2
nd nd 1.8 0.6
nd nd 1.6 0.2
nd nd 2.6 0.2
nd nd 4.0 + 0.6
nd nd 5.0 + 0.2
+ + 12.6 3.0
nd nd 6.2 0.2
++ +++ 6.4 3.0
nd nd 5.6 0.6
nd nd 6.8 1.2
nd nd 0.2 0.0
nd nd 5.6 1.6
++ ++++ 1.4 0.0
nd nd 16.6 + 1.2
nd nd 5.6 0.6
nd nd 4.4 0.7
nd nd 3.0 + 0.6
nd nd 5.8 0.6
nd nd 6.2 0.8
nd nd 7.8 0.8
nd nd 0
nd nd 0.7 0.2
nd nd 0
nd nd 6.2 + 1.2
+ +/- 2.6 0.6
++++ +/- 3.8 0.4
nd nd 7.9 0.8
nd nd 3.0 + 0.4


In plant4
0.5
nd
nd
nd
nd
nd
nd
nd
8.9
0
11.6
nd
nd
nd
0.9
nd
1.1
nd
nd
nd
nd
2.2
6.0
4.6
2.9
7.7
2.6
1.7
0.9
nd
nd
nd










Table 6-1. (Continued)
Fungal isolates
(No. and names)


Disease severity2
detached-leaf


ESC production
(nmole per plug or spot)


Name
FtPierce-1
FtPierce-4c
Imk-Br-la
Imk-Br-lb
Imk-Br- c
Imk-br-2
SWFREC-Lv-1
Imk-Br-3a2
SWFREC- Imk-1
Imk-Br-3c
Tbl-La- 1
Imk-Br-3e
Imk-Br-4d
Lefond b
Lefond d
Manatee w-2
Cbl-Wh-1
Manatee w-5


# (Ef)
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50


Temple
Temple
Grapefruit
Grapefruit
Grapefruit
Grapefruit
Murcott
Grapefruit
Temple
Grapefruit
Temple
Grapefruit
Grapefruit
Grapefruit
Grapefruit
Temple
Unknown
Temple


SO In vitro3 In
d nd 5.4 0.8
d nd 5.8 0.6
d nd 5.2 0.8
d nd 5.6 0.4
+ +/- 6.2 1.2
d nd 5.2 0.6
d nd 5.2 0.6
d nd 3.8 0.8
- 0
d nd 3.2 0.4
d nd 6.4 0.4
d nd 7.2 0.2
d nd 5.6 0.4
d nd 6.0 1.4
d nd 0
+ ++++ 5.2 0.6
+ +/- 6.5 0.4
d nd 5.0 + 0.2


Splanta4


51 Avonpark m2 Unknown ++++ nd nd 5.8 0.6 7.5
52 Avonpark m3 Unknown ++++ nd nd 4.8 0.6 2.1
'Citrus species or cultivars (Citrus spp.). Temple (C. temple), Murcott (C. reticulate x C. sinensis),
Grapefruit (C. paradise), Sun Shu Shakat (C. sinesis), Carrizo citrange (C. sinensis x Poncitrus trifoliate),
Lemon (C. limon), Rough lemon (C. jambhiri), Tahiti lime (C. aurantifolia), Swingle citrumelo (C.
paradisi x P. trifoliata), sour orange (C. aurantium).
2Pathogenicity assays were performed on detached leaves (7-10 days after flushing) inoculated with
conidial suspension (1 x 105 mL-1). Inoculated leaves were kept in a moist chamber under constant
florescent light for 15 days. Disease severity was rated on a scale, for no lesion formation; +/-, chlorotic
reaction only, no scab pustules; +, lesions with minor necrosis, and +++++, lesions with severe necrosis.
RL, rough lemon; GF, grapefruit; SO, sour orange.
3Fungal isolates were cultured on PDA under constant light for 10 days and elsinochromes (ESCs) were
extracted with 5N KOH and measured at A480. Data are the means and standard errors of four replicates
containing 12 agar plugs of each sample.
4Conidial suspension was inoculated onto detached rough lemon leaves and incubated for 14 days. In total,
20 spots (2-mm in diameter) were cut from various leaves, pooled, and soaked in ethyl acetate. ESCs
were separated on TLC plate (Fig. 6-1) and quantified using a regression line established with known
concentrations of ESCs and cercosporin.
5nd, not determined


+++
++++
+++
+++
+++
+++
++++
++
++++


Origins'


ne
ne
ne
ne
n++
ne
ne










Table 6-2. Sequence identity (%) of fungal partial p-tubulin gene
Fungus1 Efl2 Ef41 AN CB MG NC NF SS VD
EF12 85.82 88.9 87.0 86.7 90.1 87.7 75.0 76.0
EF41 84.1 84.5 84.5 85.0 82.6 71.0 74.1
AN 87.7 85.2 90.8 92.5 75.4 76.3
CB 88.1 88.1 88.1 74.2 74.2
MG 86.7 85.5 74.0 73.8
NC 89.1 77.5 79.9
NF 75.8 75.7
SS 80.3
VD -
'Partial P-tubulin genes ofElsinoefawcettii isolates Efl2 and Ef41 were amplified and sequenced. Partial
1-tubulin genes from other fungi were obtained from Genbank with accession numbers. AN, Aspergillus
nidulans (XM_653694); CB, Cercospora beticola (AY856373); MG, Mycosphaerella graminicola
(AJ310917); NC, Neurospora crassa (XM_952576); NF, NeosartoryaJischeri (XM_001264677); SS,
Sclerotinia sclerotiorum (AY12374); VD, Verticillium dahliae (DQ266135)
2Nucleotide identity (%) was analyzed by emboss MATCHER program (Sanger Institute, Hinxton,
Cambridge, UK.). Approximately, 485-bp sequences from each organism were aligned and compared for
identities (Fig. D-3).














o.E '-
O.5'
0.2-
0.' I-
O.[i




Rt

06*-
0.5 :
0.2.--
0.11 .
00"


e pa e
* o -,, I., O.


C 22 23 42 50 51 52 9 11









r 1 4 I 5 M


zIi1 zU tO O o L I

Figure 6-1. Thin-layer chromatography analysis (TLC) of ESC phytotoxins (the red/orange
pigments) extracted from affected rough lemon leaves inoculated with different
isolates ofElsinoefawcettii. Fungal isolates were inoculated onto detached rough
lemon leaves and incubated for 15 days for lesion development in a moist chamber.
Leaf lesions were pooled and soaked in ethyl acetate. ESCs were recovered by
suspending in small volumes of acetone and separated on TLC plates with a solvent
system containing chloroform and ethyl acetate (1:1, v:v). ESCs extracted from
cultural filtrate (C) of CAL WH-1 isolate showing five distinct bands at Rf as
indicated were used as positive controls (Chapter 2), whereas negative controls were
the extracts of rough lemon leaves (L) inoculated with water only. Fungal isolates that
did not produce detectable ESCs in culture are circled.










25 40
Proteolytic activity b a
S2 Prote ytic activity ab b Cellulase activity
lc bh
CD I c c d
CD e e



10 17 29 49 12 30 37 48 10 17 29 49 12 30 37 48
C Low virulence High virulence D Low virulence High virulence
oo00 Pectolytic activity pH 4.5
(+C citrus pectin) a a IpHa7 a > P t2
go- a a a a Pectolytic activity
8 pH4.5
--o 150 H 5 (+Polygalacturonic acid) b
1 cd
2500 bd cw

LLI
I, I,
0- d d d cd to K Cd cd 50 iI

41 10 17 29 49 12 30 37 48 41 10 17 29 49 12 30 37 48
E Low virulence iHi.ji -I '-l F Low virulence High virulence
120- Cutinase activity Efl2 Ef4l












pectolytic activities (mainly pectin lyase, pH 4.5 and pectin methyl esterase, pH 7.6);
D) pectolytic activities (primarily endo- and exo-PGs, pH 4.5 and pectate lyase,
a a a a a ectolyte activity
Z_ 66



Lco r NA
(41) 10. 17.29 49 12 30 37 48

Low virulence High virulence replicates. Vertical barKS reprobe efdown3efdown6

Figure 6-2. Determination of extracellular enzyme activities: A) proteolysase; B) cellulase; in the
pectolytic activities (mainly pectin lyase, pH 4.5 and pectin methyl esterase, pH 7.6);
D) pectolytic activities (primarily endo- and exo-PGs, pH 4.5 and pectate lyase,
pH7.6); and E) cuElsinocfawcettii. RNA was denatured i isolates. Fungal isolates were grown on
CM with inducers [5% skim malk; 0.55% CMC; 10% PG; 10% citrus pectin, or 0.10%
HHDA] as appropriate for 4-10 days and enzymatic activities were measured either
by diameter of clear zone (proteolytic activity) or by spectrophotometry after reaction
with appropriate chromogens (cellulase, pectolytic, and cutinase activities). Each
column represents the mean value of enzymatic activity from two independent
experiments with at least three replicates. Vertical bars represent standard deviation.
Means followed by the same letter are not different at judged by Duncan's multiple
range test at P < 0.0001. Details in measuring enzymatic activities are described in the
text. F) Northern-blot analysis of fungal RNA purified from isolate Efl2 and Ef4l of
Elsino~fawcettii. RNA was denatured in a formaldehyde-containing gel, blotted to a
nylon membrane, and hybridized to a DNA probe (probe 3) generated from EfPKS]
gene of E. fawcettii CAL WH-1 isolate as described in chapter 4. Gel stained with
ethidium bromide indicates relative loading of the RNA samples. Sizes of
hybridization bands are indicated in kilobase pairs.


A _


R









A
100
sO
. 60
U-
S40
20
0
A-


Rough lemon





ILan L t


Diseaseseverlnty 012345 U012345' U12345 U12345' U12345'
S Ef41 Ef29 Ef49 Efl2 Ef12+Ef29
Non- Low/moderate- High-
pathogenicity virulence virulence

B
100- Grapefruit
4m
o-
.2 60-
40-
20-


Diseaseseverty 012345' 012345 012345' 012345
Ef41 Ef29 Ef49 Efl2
Non- Low/moderate- High-
pathogenicity virulence virulence


U12345 U12345 U12345' U12345
Ef12+Ef49 Ef41+Ef29 Ef41+Ef49 Ef41+Ef12


lii


012345 012345
Efl2+Ef29 Ef12+Ef49


012345 U12345 U12345
Ef41+Ef29 Ef41+Ef49 Ef41+Ef12


Figure 6-3. Alleviation of symptom development by co-inoculation of two Elsino fawcettii
isolates. Conidial suspensions (1 kL, 1 x 105 mL-1) of a non-pathogenic isolate (Ef41),
two low/moderate-virulent isolates (Ef29 and Ef49), and a high-virulent isolate (Efl2)
of Elsino fawcettii were placed alone or in combinations onto detached leaves of
rough lemon (A), and grapefruit (B) (14 days after emergence). Inoculated leaves
were incubated in a moist chamber. Formation of scab lesions was recorded 12 days
post inoculation. The controls were inoculated with water only. Disease severity is
rated on a scale, 0 for no lesion formation; 1, chlorotic reaction only, no scab pustules;
2, lesions with minor pustules; 3, scab pustules present, shower forming; 4, scab
formed on all sites; and 5, lesions with severe pustules. % leaves with symptoms was
calculated from over 100 leaves inoculated in three independent experiments.


---- -- -' ---' '









A Haelll
49E
369
24

122


(bp

B Mspl
496
369
246

123


(bp

C Taqal I

496
369

246


WkA 1 n A'


17 '0Q AO AP


P


M1 10 41 17 29 49 48 12 30 37 M2


) (


MA1 In Al 17 9Q AQ AF 1


bp)


qn q7 kA'


(bp)


(bp)


Figure 6-4. Electrophoresis of the amplified internal transcribed spacer (ITS) rDNA fragments
after cleaved with A) HaeIII; B) Mspl; C) Taqal on 2% agarose gels. The numbers of
Elsinoefawcettii isolates are marked upon the lanes. Ml, the 123 DNA ladder; M2, 1
kb ladder (Promega). Isolate Ef41 showed the different patterns among all three
restriction enzyme digestions compared to the remaining isolates.


*250




(bp)


3,
)-

*


11 in 17 A'A









A/ul Dpnl HaelII
12 41 4Q 19 41 4Q 19 41


50C 500
40400"'
30 300
20C 200
10C 100
(bp) (bp)


Taq aI MspI NIalV
M 12 41 49 12 41 49 12 41 49 M

40 500
30 400
20 200

100
(bp) (bp)


Figure 6-5. Electrophoresis of the amplified partial P-tubulin genes (-500bp) digested with six
different 4-bp recognition sequence restriction enzymes on 2% agarose gels. The
numbers of Elsinoefawcettii isolates are marked upon the lanes. M, the 100 bp DNA
ladder. The pattern of isolate Ef41 differed from the HaeIII and Taqal digestion
patterns of the other two remaining isolates, Efl2 and Ef49.











OPX7 OPX13
M 10 41 17 29 4948 12 30 37 M 1041 1729 49 48 12 30 37


(kb) (kb
40
30
2.5-
20,

15-
1.

10,

0 75,
O 75


0.5





0 25325
0.25,1


Figure 6-6. Electrophoresis of the randomly amplified polymorphic DNA fragments (RAPD) on
2% agarose gels. The numbers of Elsinoefawcettii isolates are marked upon the lanes.
M, 1 kb ladder (Promega). 10-mer primers, OPX-7, OPX-13, or MtR 1 was used to
randomly amplify DNA from the isolates. Isolate Ef41 showed the different patterns
from the remaining isolates in all three amplifications.


1W












I-pi crIii.: m.i.nroli-. l (tY7':01 &. Manihot esculenta Crantz, Brazil)
l jriai,.-- rj ,in liij jdia A'hc :' I ?. Manihot esculenta Crantz; Colombia)
52 Sphaceloma Elsinoe leucospermi (AF097573; Leucosprnum coraifolium. Australia)
Elsinoe leucospermi (AF097575; Leucadendron sp.. Austalia)
Elsinoe leucospermi (AF131091, Serruna florida; South Africa]
53
Elsince proteae (AF097578; Protea cynaroides; Soulh Africa)
S:~ 'liria .-i rnia 4 ili-e [ f_'.'u Aralia elata, South Korea)
89
100 Sphaceloma araliae (EF600972, Aralia elata, South Korea)
Elsince -:r,..ril [(-i W i72; Banksla prionotes: Australia)
Elsinoe fawcettii (AF097577: Citrus spp.: South Africa)
Sphaceloma protearum (AF131085, Protea cv susara; Zimbabwe)
SElsinoe banksiae (AF227197, Unknown, South Ainca)
97
Elsinoe ampelina (AY826764. Vitis spp; USA)
Elsinoe fawcettii isolate 25 [51.'-rangi citrumelo, Florida) -
58 Elsinoe fawcettii (EFU28058; Unknown)
S 58 Sphaceloma fawcettii (SFi'.i",4 h Unknown)

Elsinoe fawcettii Isolate 49 (Unknown, Florida)
Elsinoe fawcettii isolate 12 (Citrus temple; Florida) 4
98 -- Elsinoe australis (EAU28057: Unknown)
94 I Elsinoe eucalyptorum (00923530; Unknown; Australia)
Elsinoe fawcetti isolate 41 (citrus temple; Florida)
M ycosphaerella pini (EF059972)
7| Mycosphaerella hedericola (AY490772)
S Mycosphaerella african (AY490773)
Cerco5pora agavicola (AY647237)
SHoraea wernecki (AY213656)
Septoria quercicola (AY490771)
Venturia pyrina (EU035469)
1o00 Venturia inaequalis (EU035460)
Dichomnera eucolylpt (AY744373)
100 Dichomeraversiforrnis ','7447r>..
Dothidea sambuci (AY883094)
i a :; szi:..,liri oxysporum (EF029816)
S CladospDrium cladosporioides (DQ026006)
100 Cochliobolus hawaiiensis (EF540752)



Figure 6-7. Comparison of the internal transcribed spacer 1 (ITS 1) sequences between Elsinoe
fawcettii Florida isolates and other Elsinoe spp. and other species belonging to the
order of Loculoascomycetes via phylogenetic analysis. The phylogenetic tree was
generated by using DS Gene v2.5 program with 100 bootstrap replicates. E. fawcettii
Florida isolates Efl2, Ef29, Ef41, and Ef49 were sequenced in this study. Accession
numbers for all sequences obtained from GenBank, original-collected host of Elsinoe
spp, and location of Elsinoe spp. were indicated in parentheses.








APPENDIX A
SUPPLEMENTAL DATA FOR CHAPTER TWO


0.25


0.2


0.15 -


0.1 -


0.05 -


0 -


cd d








0


10 30


Time (min)

Figure A-1. Spectrophotometric absorbance of elsinochromes (ESCs) treated with 3-(N-
morpholino) propanesulfonic acid (MOPS) buffer (open bars), ESCs treated with
nitrotetrazolium blue chloride (NBT) (hatched bars), or ESCs treated with both
MOPS and NBT (closed bars) at 560 nm. Vertical bars represent standard deviation.
Means followed by the same letter are not different at judged by Duncan's multiple
range test at P < 0.0001.










APPENDIX B
SUPPLEMENTAL DATA FOR CHAPTER THREE


Table B-1. Effects of ions on ESC production on CM by E. fawcettii
Treatment Concn Mean colony dai. ESC (nmoles per plug), mean
(mM) (mm) + SEM SEM
none -10.31+ 0.24 2.72 0.32


CuC12z2H20


FeC13


KC1


MgC126H20


MnCl2A4H2


NaCl


ZnCl2


0.1
1.0
10.0

0.1
0.2
0.5
1.0
2.0
10.0

50.0
100.0

50.0
100.0

0.2
1.0
5.0
10.0
100.0

50.0
100.0


nd1
9.34 0.41
nd

10.22 0.21
10.97 0.12
10.97 0.45
9.72 0.12
10.19 0.65
nd

nd
10.56 0.24

nd
9.56 0.60

10.31 0.52
9.81 0.31
9.81 0.38
10.50 + 0.46
nd

nd
10.44 0.60

nd
11.00 + 0.43


nd
6.94 + 0.36
nd

3.84 + 0.22
3.00 1.24
3.70 1.52
3.56 1.08
5.60 + 0.70
nd

nd
3.08 0.16

nd
2.78 + 0.72

1.46 0.56
4.48 + 0.56
5.68 1.00
5.92 + 0.18
nd

nd
4.94 + 0.22

nd
5.52 + 0.38


10.0 nd nd
'nd, not determined









APPENDIX C
SUPPLEMENTAL DATA FOR CHAPTER FOUR


Table C-1. Sequences of primers
Name Sequences
efup 1 5'-GCACTCCTGACCCGATTGGA-3'
efup 5 5'-CCGATCTACGCTCCTTACCACGCTG-3'
efpks 1 5'-CTCCACGTGAAGCGGCACAGAC-3'
efpks 5 5'-GGATCAGTCTGTGCCGCTTCACGTGG-3'
efdown 5 5'-CGGTAGTTGTGCTGGATGCGACGAG-3'
efdown 8 5'-CCGAAACGCCCTTGGTTCAAAGATG-3'
ef down 10 5'-CATCATCGGCGGTTGGTCAGCAGG-3'











Bgll
IP b 23 071

CK 09S I
IP
CK
efup 5LCKS1 efpk 1 efdown 8 efdown 10
EfPKSI
efup 1 ATG efpks 5 LCKS2 efdown5 TAG
Figure C-1. Schematic describing the strategies to obtain full-length of EfPKSL. The amplified
DNA fragment (hatched bar, about 700 bp) by two degenerate oligonucleotides
(LCKS1/LCKS2) was first used for extension of 5' and 3' franking region of EfPKS1
gene. Chromosome walking (CW) and inverse PCR (IP) were used to obtain full-
length of EfPKS1. Arrowheads indicate relative positions of primers used for
chromosome walking (efpks 1, efpks 5, and efdown 10) and inverse PCR (efup 1/efup
5 and efdown 5/efdown 8). Restriction enzyme sites used for inverse PCR were
indicated. Drawing is not to scale.









APPENDIX D
SUPPLEMENTAL DATA FOR CHAPTER SIX

Table D-1. Germination ofElsinoefawcettii isolates on detached leaves of rough lemon and
grapefruit
Isolate no. Pathogenicity1 Germination (% of conidia with germ tube/total conidia)2
Rough lemon Grapefruit
41 none 0 0
29 low 4 0.3 2 0.1
12 high 33 4.3 23 3.0
'Pathogenicity assays were conducted on detached leaves as described in Table 6-1.
2Germination was evident by forming germ tube. For each isolate, 100 conidia were examined and the
data show the means and standard errors of three independent experiments.










Ef12 Ef17


A- / -l
3 f'.sf' *** *""t- **^.,,


Young
mycelia



Old
mycelia




Young
mycelia




Old
mycelia


N 1 I 2- I- ~ 'm


Figure D-1. Elsinoefawcettii hyphae observed using a light microscope at x 200 magnification.
Nonpathogenic isolate (Ef41), low virulence isolates (EflO, Efl7, Ef29, and Ef49),
and high virulence isolates (Efl2, Ef30, Ef37, and Ef48) ofElsinoefawcettii were
cultured on PDA under constant fluorescence light. Small pieces of young (4 day
culture) and old (8 day culture) mycelia were removed from PDA, suspended in water
and placed on slides for observation.


Ef48 Ef49

.






EflO Efl2 Efl'r f29 Ef30

0** Iie+


8 HEf49
p,


-25 mm


Figure D-2. Variation of fungal colony under a dissection microscope at x 25 magnification.
Non-pathogenic isolate (Ef41), low virulence isolates (EflO, Efl7, Ef29, and Ef49),
and high virulence isolates (Efl2, Ef30, Ef37, and Ef48) ofElsinoefawcettii were
cultured on PDA media under constant fluorescence light for 10 days.


iIL



















EF12T TT
EF41C AG
AN T CT
CB-C G
MG-C CAG
NC-T TT
NF-T TTC C C T T
SS C TTC T T T T T C T GTAAGTG
VD--C CT, TC T T C CG C C C CTGTAAGCTCTAC



EF12
EF41
AN
CB-
MG-
NC-
NF-
SS JAi-IT I-&L.L.W C
VD-CACCCCCCCTAAGCICG~CCAwTITGCTCTTTTCTAACAAAGTTTCCCTTCACCAG
EF12T C CG G G T Ta G C C CG g s GACoEG CC
EF41T fa TT G G C Cd E we a d by p r s B
AN T CT G G T C G G C C CMGAGAG CA
CB-T C CT G T C G C C CG GMGA G C
MG-C GT G G C C G C C CG GMGA G C
NC-T C CT G G T C G G C CGTGGAAG TC
NF-T T TT G G C C G G C C CMGTC G CA
SS I- T TT T G T Cr G C TG C A G TC
VD-T C TG G G CI CCG G C CGC GAG G C

Figure D-3. Alignment of nucleotide sequences of fungal partial 3-tubulin genes. The % identity
between organisms were described in Table 6-2. Partial 3-tubulin genes of Elsino&
fawcettii isolates, Efl2, and Ef41, were amplified by primer sets, BtlF and BtlR, and
sequenced. Partial P-tubulin genes from other fungi were obtained from Genbank
with accession numbers. AN, Aspergillus nidulans (XM_653694); CB, Cercospora
beticola (AY856373); MG, Mycosphaerella graminicola (AJ310917); NC,
Neurospora crassa (XM_952576); NF, Neosartoryafischeri (XM_001264677); SS,
Sclerotinia sclerotiorum (AY12374); VD, Verticillium dahliae (DQ266135).











EF12CTC)
EF41TGC(
AN GTC(
CB-TGC(
MG-CGC)
NC-TTC(
NF--GAG(
SS-TTC(
VD-TTC(


EF12ACGCCC
EF41AAAGCC
AN CCGCCC
CB-ACGCCC
MG-CCGT T
NC-CCGCTC
NF-CCGTCC
SS CCGTTC
VD-CCGT
EF12C G T C
EF41C G T C
AN C GC T
CB-C GC T
MG-T GC T
NC-C
NF-- C
SS--CGC
VD- C
EF12 T
EF41 C
AN T
CB TC G T
MG TGC G C
NC TGT G T
NF TC G T
SS TC T
VD T
EF12C C
EF41C C
AN C C
CB-G G
MG-G
NC-C C
NF-G C
SS-G C
VD-C C

Figure D-3. (Continued)


|T(
C(
QC
C(
C(
C(
QC
C(
,IC(


TCC CT C T G G C
TCG TT C C G G C
TCT TT C C G G C
GC TT G C G G C
TCC CT C T G G C
TCC CG C C G G C
TCC CT C C G G G
TCGCTC C C
TCC C C C









LIST OF REFERENCES


Adams, T. H., Wieser, J. K., and Yu, J.-K. 1998. Asexual sporulation in Aspergillus nidulans.
Microbiol. Mol. Biol. Rev. 62:35-54.

Adams, T. H., and Yu, J.-H. 1998. Coordinate control of secondary metabolite production and
asexual sporulation in Aspergillus nidulans. Curr. Opinion Microbiol. 1:674-677.

Agrios, G. N. 1997. Plant Pathology, 4th edition, Academic Press, San Diego, California.

Alexopoulos, C. J., Mims, C. W., and Blackwell, M. 1996. Introductory Mycology, 4th edition.
Wiley, New York.

Alferez, F., Pozo, L., and Burns, J. K. 2006. Physiological changes associated with senescence
and abscission in mature citrus fruit induced by 5-chloro-3-methyl-4-nitro-1H-pyrazole
and ethephon application. Physiologia Plantarum 127:66-73.

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.
J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucl. Acids Res. 25:3389-3402.

Andrianopoulos, A., and Timberlake, W. E. 1994. The Aspergillus nidulans abaA gene encodes a
transcriptional activator that acts as a genetic switch to control development. Mol. Cell.
Biol. 14:2503-2515.

Arnone, A., Assante, G., Di Modugno, V., Merlini, L., and Nasini, G. 1988. Perylenequinones
from cucumber seedlings infected with Cladosporium cucumerinum. Phytochem. 6:1675-
1678.

Assante, G., Merlini, G., and Nasini, G. 1977. +/- Abscisic acid a metabolite of the fungus
Cercospora rosicola. Experientia 33:1551-1557.

Bailey, M. J., Buchert, J., and Viikari, L. 1993. Effect of pH on production of xylanase by
Trichoderma reesei on xylan- and cellulose-based media. Appl. Microbiol. Biotech.
40:224-229.

Bender, C. L., Alarc6n-Chaidez, F., and Gross, D. C. 1999. Pseucomonas syringae Phytotoxins:
mode of action, regulation, and biosynthesis by peptide and polyketide synthases.
Microbiol. Mol. Biol. Rev. 63:266-292.

Beruchamp, C. O., and Fridovich, I. 1971. Superoxide dismutase: improved assays and an assay
applicable to acrylamide gel. Anal. Biochem. 44:276-287.

Bingle, L. E. H., Simpson, T. J., and Lazarus, C. M. 1999. Ketosynthase domain probes identify
two subclasses of fungal polyketide synthase genes. Fungal Genet. Biol. 26:209-223.

Birch, A. J. 1967. Biosynthesis of polyketides and related compounds. Science 156:202-206.









Bitancourt, A. A., and Jenkins, A. E. 1936a. Elsinoefawcettii, the perfect stage of the citrus scab
fungus. Phytopathol. 26:393-396.

Bitancourt, A. A., and Jenkins, A. E. 1936b. The perfect stage of the sweet orange scab fungus.
Mycologia 28:489-492.

Brodhagen, M., and Keller, N. P. 2006. Signalling pathways connecting mycotoxin production
and sporulation. Mol. Plant Pathol. 7:285-301.

Brookman, J. L., Mennim, G., Trinci, A. P. J., Thenodorou, M. K., and Tuckwell, D. S. 2000.
Identification and characterization of anaerobic gut fungi using molecular methodologies
based on ribosomal ITS 1 and 18S rRNA. Microbiol. 146:393-403.

Bushong, P. M., and Timmer, L. W. 2000. Evaluation of postinfection control of citrus scab and
melanose with benomyl, fenbuconazole, and azoxystrobin. Plant Dis. 84:1246-1249.

Butler, M. J., Day, A. W., Henson, J. M., and Money, N. P. 2001. Pathogenic properties of
fungal melanins. Mycologia 93:1-8.

Callahan, T. M., Rose, M. S., Meade, M. J., Ehrenshaft, M., and Upchurch, R. G. 1999. CFP, the
putative cercosporin transporter of Cercospora kikuchii, is required for wild type
cercosporin production, resistance, and virulence on soybean. Mol. Plant-Microbe Interact.
12:901-910.

Calvo, A. M., Gardner, H. W., and Keller, N. P. 2001. Genetic connection between fatty acid
metabolism and sporulation in Aspergillus nidulans. J. Biol. Chem. 276:25766-25774.

Calvo, A. M., Wilson, R. A., Bok, J. W., and Keller, N. P. 2002. Relationship between secondary
metabolism and fungal development. Microbiol. Mol. Biol. Rev. 66:447-459.

Caracuel, Z., Roncero, M. I. G., Espeso, E. A., Gonzalez-Verdejo, C. I., Garcia-Maceira, F. I.,
and Pietro, A. D. 2003. The pH signaling transcription factor PacC controls virulence in
the plant pathogen Fusarium oxysporum. Mol. Microbiol. 48:765-779.

Chen, H.-Q., Dekkers, K. L., Rollins, J. A., Ko, N. J., Timmer, L. W., and Chung, K.-R. 2005. A
gene with domains related to transcription regulation is required for pathogenicity in
Colletotrichum acutatum causing Key lime anthracnose. Mol. Plant Pathol. 6:513-525.

Chen H.-Q., Lee, M. H., Daub, M. E., and Chung, K.-R. 2007. Molecular analysis of the
cercosporin biosynthetic gene cluster in Cercospora nicotianae. Mol. Microbiol. 64:755-
770.

Chet, I., and Hittermann, A. 1982. De novo synthesis of polyphenol oxidase (Laccase) during
formation of sclerotia in Sclerotium rolfsii. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol.
Lett. 14:211-215.









Choquer, M., Dekkers, K. A., Chen, H.-Q., Ueng, P. P., Daub, M. E., and Chung, K.-R. 2005.
The CTB1 gene encoding a fungal polyketide synthase is required for cercosporin
biosynthesis and fungal virulence of Cercospora nicotianae. Mol. Plant-Microbe Interact.
18:468-476.

Choquer, M., Lee, M. H., Bau, H. J., and Chung, K.-R. 2007. Deletion of a MFS transporter-like
gene in Cercospora nicotianae reduces cercosporin toxin accumulation and fungal
virulence. FEBS (Fed. Eur. Biochem. Soc.) Lett. 581:489-494.

Chung, K.-R., Shilts, T., Li, W., and Timmer, L. W. 2002. Engineering a genetic transformation
system for Colletotrichum acutatum, the causal fungus of lime anthracnose and postbloom
fruit drop. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 213:33-39.

Chung, K.-R., and Timmer, L. W. 2005. Citrus disease exotic to Florida: Sweet orange scab
(SOS). Institution of Food and Agricultural Sciences, University of Florida, Gainesville. 12
January 2008.

Cortes, J., Haydock, S. F., Roberts, G. A., Bevitt, D. J., and Leadlay, P. F. 1990. An unusually
large multifunctional polypeptide in the erythromycin producing polyketide synthase of
Saccharopolyspora erythraea. Nature 348:176-178.

Cotty, P. J. 1988. Aflatoxin and sclerotial production by Aspergillusflavus: Influence of pH.
Phytopathol. 78:1250-1253.

Cox, R. J., Glod, F., Hurley, D., Lazarus, C. M., Nicholson, T. P., Rudd, B. A. M., Simpson, T.
J., Wilkinson, B., and Zhang, Y. 2004. Rapid cloning and expression of a fungal
polyketide synthase gene involved in squalestatin biosynthesis. Chem. Commun. 2260-
2261.

Cuero, R., Duffus, E., Williams, M., Baca, D. and Navarro, M. 1988. Effects of zinc and
associated mycoflora on fungal growth and toxin production: F. moniliforme, F.
graminearum, Aspergillusflavus. pp. 311-319. In Miraglia, M., van Egmond, H., Brera, C.
and Gilbert, J. (eds.). Mycotoxins and Phycotoxins-Developments in Chemistry,
Toxicology and Food Safety, Chapter 33. Fort Collins, CO: Alaken Inc.

Cuero, R., and Ouellet, T. 2005. Metal ions modulate gene expression and accumulation of the
mycotoxins aflatoxin and zearalenone. J. Appl. Microbiol. 98:598-605.

Cuero, R., Ouellet, T., Yu, J., and Mogongwa, N. 2003. Metal ion enhancement of fungal growth,
gene expression and aflatoxin synthesis in Aspergillusflavus: RT-PCR characterization. J.
Appl. Microbiol. 94:953-961.

Daub, M. E. 1982a. Cercosporin, a photosensitizing toxin from Cercospora species. Photopathol.
72:370-374.

Daub, M. E. 1982b. Peroxidation of tobacco membrane lipids by the photosensitizing toxin,
cercosporin. Plant Physiol. 69:1361-1364.









Daub, M. E., and Ehrenshaft, M. 2000. The photoactivated Cercospora toxin cercosporin:
contributions to plant disease and fundamental biology. Annu. Rev. Phytopathol. 38:461-
490.

Daub, M. E., and Hangarter, R. 1983. Light-induced production of singlet oxygen and
superoxide by the fungal toxin, cercosporin. Plant Physiol. 73:855-857.

Daub, M. E., Herrero, S., and Chung, K.-R. 2005. Photoactivated perylenequinone toxins in
fungal pathogenesis of plants. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 252:197-
206.

Davis, V. M., and Stack, M. E. 1991. Mutagenicity of stemphyltoxin III, a metabolite of
Alternaria alternate. Appl. Environ. Microbiol. 57:180-182.

Dekkers, L. A., You, B. J., Gowda, V. S., Liao, H.-L., Lee, M. H., Bau, H. J., Ueng, P. P., and
Chung, K.-R. 2007. The Cercospora nicotianae gene encoding dual O-methyltransferase
and FAD-dependent monooxygenase domains mediates cercosporin toxin biosynthesis.
Fungal Genet. Biol. 44:444-454.

Demain, A. L., and Fang, A. 2000. The natural functions of secondary metabolites. Adv.
Biochem. Eng. Biotechnol. 69:1-39.

Diwu, Z. 1995. Novel therapeutic and diagnostic applications of hypocrellins and hypericins.
Photochem. Photobiol. 61:529-539.

Dobrowolski, D. C., and Foote, C. S. 1983. Chemistry of singlet oxygen 46. Quantum yield of
cercosporin-sensitized singlet oxygen formation. Angewante Chemie 95:729-730.

Donadlo, S., Staver, M. J., McAlpine, J. B., Swanson, S. J., and Katz, L. 1991. Molecular
organization of genes required for complex polyketide biosynthesis. Science 252:675-679.

Dowzer, C., and Kelly, J. 1989. Cloning of the creA gene from Aspergillus nidulans: a gene
involved in carbon catabolite repression. Curr. Genet. 15:457-459.

Duncan, J. M., Cooke, D., Brich, P., and Toth, R. 1998. Molecular variability in sexually
reproducing fungal plant pathogens. pp. 19-39. In Bridge, P. D., Couteaudier, Y., and
Charkson, J. M. (eds.). Molecular Variability of Fungal Pathogens. Wallingford: CAB
International.

Duran, N., and Song, P. S. 1986. Hypericin and its photodynamic action. Photochem. Photobiol.
43:677-680.

Ehrlich, K. C., Montalbano, B. G., Cary, J. W., and Cotty, P. J. 2002. Promoter elements in the
aflatoxin patheay polyketide synthase gene. Biochimica Biophysica Acta 1576:171-175.

Engh, I., Nowrousian, M., and Kuick, U. 2007. Regulation of melanin biosynthesis via the
dihydroxynaphthalene pathway is dependent on sexual development in the ascomycete
Sordaria macrospore. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 275:62-70.









Espeso, E. A., Tilburn, J., SaAnchez-Pulido, L., Brown, C. V., Valencia, A., Arst, H. N. Jr., and
Pefialva, M. A. 1997. Specific DNA recognition by the Aspergillus nidulans three zinc
finger transcription factor PacC. J. Mol. Biol. 274:466-480.

Fantin, G. 1988. Caracterizacdo Morfol6gica, Fisiol6gica e Patogenica de Especies do Elsinoe
em Citros. Universidade de Sao Paulo, Piracicaba, Brazil.

Farnochi, M. C., Torres, A. M., Magan, N., and Chulze, S. N. 2004. Effect of antioxidants and
competing mycoflora on Fusarium verticillioides and F. proliferatum populations and
fumonisin production on maize grain. J. Stored Prod. Res. 41:211-219.

Fernandes, M., Keller, N. P., and Adams, T. H. 1998. Sequence-specific binding by Aspergillus
nidulans AflR, a C6 Zinc cluster protein regulating mycotoxin biosynthesis. Mol.
Microbiol. 28:1355-1365.

Foote, C. S., and Denny, R. W. 1968. Chemistry of singlet oxygen. VII. Quenching by P-
carotene. J. Am. Chem. Soc. 90:6233-6235.

Foote, C. S., Chang, Y. C., and Denny, R. W. 1970. Chemistry of singlet oxygen. X. Carotenoid
quenching parallels biological protection. J. Am. Chem. Soc. 92:5216-5218.

Fortes Villas Boas, R. 1989. Variabilidade Patogenica, Morfol6gica e Sorol6gica de Elsinoe
fawcettii Bitancourt & Jenkins em Citrus spp. Universidade Estadual Paulista, Botucatu,
San Paulo, Brazil.

Fries, N. 1978. Basidiospore germination in some mycorrhiza-forming hymenomycetes. Trans.
Brit. Mycol. Soc. 70:319-324.

Fry, S. C. 1998. Oxidative scission of plant cell wall polysaccharides by ascorbate-induced
hydroxyl radicals. Biochem. J. 332:507-515.

Funa, N., Awakawa, T., and Horinouchi, S. 2007. Pentaketide resorcylic acid synthesis by Type
III polyketide synthase from Neurospora crassa. J. Biol. Chem. 282:14476-14481.

Funa, N., Ohnishi, Y., Fujii, I., Shibuya, M., Ebizuka, Y., and Horinouchi, S. 1999. A new
pathway for polyketide synthesis in microorganisms. Nature 400:897-899.

Gasteiger, E., Gattiker, A., Hoogland, C., and Lvanyi, I. 2003. ExPASy: the proteomics server
for in-depth protein knowledge and analysis. Nucl. Acids Res. 31:3784-3788.

Girotti, A. W. 1990. Photodynamic lipid peroxidation in biological systems. Photochem.
Photobiol. 51:497-509.

Glass, N. L., and Donaldson, G. C. 1995. Development of primer sets designed for use with the
PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol.
61:1323-1330.









Grosser, J. W., Gmitter, F. G. Jr., and Chandler, J. L. 1988. Intergeneric somatic hybrid plants
from sexually incompatible woody species: Citrus sinensis and Severinia disticha.
Theoretical Appl. Genet. 75:397-401.

Henikoff, J. G., Greene, E. A., Pietrokovski, S., and Henikoff, S. 2000. Increased coverage of
protein families with the blocks database servers. Nucl. Acids Res. 28:228-230.

Holliday, P. 1980. Fungus diseases of tropical crops. pp. 147-148. Published by Cambridge
University Press, Cambridge, England.

Hopwood, D. A., and Sherman, D. H. 1990. Molecular genetics of polyketides and its
comparison to fatty acid biosynthesis. Annu. Rev. Genet. 24:37-66.

Hudson, J. B., and Towers, G. H. N. 1991. Therapeutic potential of plant photosensitizers.
Pharmacol. Ther. 49:181-222.

Hudson, J. B., Imperial, V., Haugland, R. P., and Diwu, Z. 1997. Antiviral properties of
photoactive perylenequinones. Photochem. Photobiol. 65:352-354.

Hutchinson, C. R. 1999. Microbial polyketide synthases: More and more prolific. Proc. Natl.
Acad. Sci. 96:3336-3338.

Hyun, J.-W., Timmer, L. W., Lee, S.-C., Yun, S.-H., Ko, S.-W., and Kim, K.-S. 2001.
Pathological characterization and molecular analysis of Elsinoe isolates causing scab
diseases of citrus in Jeju Island in Korea. Plant Dis. 85:1013-1017.

Jackson, M., Slinger, P. J., and Bothas, R. J. 1989. Effects of zinc, iron, cobalt, and manganese
on Fusarium moniliforme NRRL 1316 growth and fusarin C. Biosynthesis in submerged
cultures. Appl. Environ. Microbiol. 55:649-655.

Jenns, A. E., Daub, M. E., and Upchurch, R. G. 1989. Regulation of cercosporin accumulation in
culture by medium and temperature manipulation. Phytopathol. 79:213-219.

Johnston, P. R., and Beever, R. E. 1994. Elsinoe dracophylli sp. nov. N. Z. J. Bot. 32:519-520.

Karolewiez, A., and Geisen, R. 2005. Cloning a part of the ochratoxin A biosynthetic gene
cluster of Penicillium nordicum and characterization of the ochratoxin polyketide synthase
gene. Systematic Appl. Microbiol. 28:588-595.

Kawamura, C. T., Tsujimoto, T., and Tsuge, T. 1999. Targeted disruption of a melanin
biosynthesis gene affects conidial development and UV tolerance in the Japanese pear
pathotype of Alternaria alternate. Mol. Plant-Microbe Interact. 12:59-63.

Keller, N. P., Nesbitt, C., Sarr, B., Phillips, T. D., and Burow, G. B. 1997. pH regulation of
sterigmatocystin and aflatoxin biosynthesis in Aspergillus spp. Phytopathol. 87:643-648.

Keller, N. P., Turner, G., and Bennett, J. W. 2005. Fungal secondary metabolism-from
biochemistry to genomics. Nat. Rev. Microbiol. 3:937-947.









Kimura, N., and Tsuge, T. 1993. Gene cluster involved in melanin biosynthesis of the
filamentous fungus Alternaria alternate. J. Bacteriol. 175:4427-4435.

Krinksy, N. I. 1979. Carotenoid protection against oxidation. Pure Appl. Chem. 51:649-660.

Kroken, S., Glass, N. L., Taylor, J. W., Yoder, O. C., and Turgeon, B. G. 2003. Phylogenomic
analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc.
Natl. Acad. Sci. 100:15670-15675.

Kudla, B., Caddick, M. X., Langdon, T., Martinez-Rossi, N. M., Bennett, C. F., Sibley, S.,
Davies, R. W., and Arst, H. N. Jr. 1990. The regulatory gene areA mediation nitrogen
metabolite repression in Aspergillus nidulans. Mutations affecting specificity of gene
activation alter a loop residue of a putative zinc finger. EMBO J. 9:1355-1364.

Kulig, M. J., and Smith, L. L. 1973. Sterol metabolism. XXV. Cholesterol oxidation by singlet
molecular oxygen. J. Organic Chem. 38:3639-3642.

Lewandowski, D. J., and Dawson, W. O. 1998. Deletion of internal sequences results in tobacco
mosaic virus defective RNAs that accumulate to high levels without interfering with
replication of the helper virus. Virol. 251:427-437.

Li, D., and Kolattukudy, P. E. 1997. Cloning of cutinase transcription factor 1, a transactivating
protein containing Cys6Zn2 binuclear cluster DNA-binding motif. J. Biol. Chem.
272:12462-12467.

Liao, H.-L., and Chung, K.-R. 2008a. Cellular toxicity of elsinochrome phytotoxins produced by
the pathogenic fungus, Elsinoefawcettii causing citrus scab. New Phytologist 117:239-
250.

Liao, H.-L., and Chung, K.-R. 2008b. Genetic dissection defines the roles of elsinochrome
phytotoxin for fungal pathogenesis and conidiation of the citrus pathogen Elsinoefawcettii.
Mol. Plant-Microbe Interact. 21:469-479.

Linden, H., and Macino, G. 1997. White collar-2, a partner in blue light signal transduction,
controlling expression of light-regulated genes in Neurospora crassa. EMBO (Eur. Mol.
Biol. Organ.) J. 16:98-107.

Liu, W. Z., Shen, Y. X., Liu, X. F., Chen, Y. T., and Xie, J. L. 2001. A new perylenequinone
from Hypomyces sp. Chin. Chem. Lett. 12:431-432.

Lousberg, R. J. J. C., Salemink, C. A., Weiss, U., and Batterham, T. J. 1969. Pigments of Elsinoe
species II. Structure of elsinochromes A, B. and C. J. Chem. Soc. (C): 1219-1227.

Lu, S., Lyngholm, L., Yang, G., Bronson, C., Yoder, O. C., and Turgeon, B. G. 1994. Tagged
mutations at the Toxl locus of Cochliobolus heterostrophus by restriction enzyme-
mediated integration. Proc. Natl. Acad. Sci. 91:12649-12653.









Malpartida, F., and Hopwood, D. A. 1984. Molecular cloning of the whole biosynthetic pathway
of a Streptomyces antibiotic and its expression in a heterologous host. Nature 309:462-464.

Malz, S., Grell, M. N., Thrane, C., Maier, F. J., Rosager, P., Felk, A., Albertsen, K. S., Salomon,
S., Bohn, L., Schafer, W., and Giese, H. 2005. Identification of a gene cluster responsible
for the biosynthesis of aurofusarin in the Fusarium graminearum species complex. Fungal
Genet. Bio. 42:420-433.

Marmorstein, R., and Harrison, S. C. 1994. Crystal structure of a PPR1-DNA complex: DNA
recognition by proteins containing a Zn2Cys6 binuclear cluster. Genes Dev. 8:2504-2512.

Marsh, P., Simpson, M. E., and Truckess, M. W. 1975. Effects of trace metals on the production
of aflatoxins by Aspergillus parasiticus. J. Appl. Microbiol. 30:52-55.

Marzluf, G. A. 1997. Genetic regulation of nitrogen metabolism in the fungi. Microbiol. Mol.
Biol. Rev. 61:17-32.

Meille, S. V., Malpezzi, L., Allegra, G., and Nasini, G. 1989. Structure of elsinochrome A: a
perylenequinone metabolite. Acta. Cryst. C 45:628-632.

Morrice, J., Mackenzie, D. A., Parr, A. J., and archer, D. B. 1998. Isolation and characterization
of the acetyl-CoA carboxylase gene from Aspergillus nidulans. Curr. Genet. 34:379-385.

Motamedi, H., and Hutchinson, C. R. 1987. Cloning and heterologous expression of a gene
cluster for the biosynthesis of tetracenomycin C, the anthracycline antitumor antibiotic of
Streptomyces glaucescens. Proc. Natl. Acad. Sci. 84:4445-4449.

Murashige, T., and Skoog, F. 1962. A revised medium for rapid growth and bioassay with
tobacco tissue cultures. Physiologia Plantarum 15:473-497.

Murashige, T., and Tucker, D. P. H. 1969. Growth factor requirements of citrus tissue culture.
Proc. First Intl. Citrus Symp. 3:1155-1161.

Oannes, C., and Wilson, T. 1968. Quenching of singlet oxygen by tertiary aliphatic amines.
Effect ofDABCO. J. Am. Chem. Soc. 90:6527-6528.

Orvehed, M., Haggblom, P., and Soderhall, K. 1988. Nitrogen inhibition of mycotoxin
production by Alternaria alternate. Appl. Environ. Microbiol. 54:2361-2364.

Oster, G., Bellin, J. S., and Holmstrom, B. 1962. Photochemistry of riboflavin. Cellular Mol.
Life Sci. 18:249-253.

Pall, M. L., and Brunelli, J. P. 1993. A series of six compact fungal transformation vectors
containing polylinkers with multiple unique restriction sites. Fungal Genet. Newslett.
40:59-62.









Palumbo, J. D., Keeffe, T. L. 0., and Mahoney, N. E. 2007. Inhibition of ochratoxin A
production and growth of Aspergillus species by phenolic antioxidant compounds.
Mycopathologia. 164:241-248.

Passone, M. A., Resnik, S. L., and Etcheverry, M. G. 2005. In vitro effect of phenolic
antioxidants on germination, growth and aflatoxin B accumulation by peanut Aspergillus
section Flavi. J. Appl. Microbiol. 99:682-691.

Phillips, A. J. L. 1994. Occurrence of scab of Phaseolus vulgaris caused by Elsino phaseoli in
South Africa. Plant Pathol. 43:417-419.

Proctor, R. H., Brown, D. W., Plattner, R. D., and Desjardins, A. E. 2003. Co-expression of 15
contiguous genes delineates a fumonisin biosynthetic gene cluster in Gibberella
moniliformis. Fungal Genet. Bio. 38:237-249.

Ramji, D. P., and Foka, P. 2002. CCAAT/enhancer-binding proteins: structure, function and
regulation. Biochem. J. 365:561-575.

Ramm, P. J., and Caspi, E. 1969. The stereochemistry of tritium at carbon atoms 1, 7, and 15 in
cholesterol derived from (3R, 2R)-(2-3H) mevalonic acid. J. Biol. Chem. 244:6064-6073.

Rangan, V. S., Oskouian, B., and Smith, S. 1996. Identification of an inverted CCAAT box motif
in the fatty-acid synthase gene as an essential element for mediation of transcriptional
regulation by cAMP. J. Biol. Chem. 270:3757-3764.

Reynoso, M. M., Torres, A. M., Ramirez, M. L., Rodriguez, M. I., Chulze, S. N., and Magan, N.
2002. Efficacy of antioxidant mixtures on growth, fumonisin production and hydrolytic
enzyme production by Fusarium verticillioides and F. proliferatum in vitro on maize-
based media. Mycol. Res. 106:1093-1099.

Ridley, G. S. 2005. Elsinoe takoropuku sp. nov. infects twigs of Pittosporum tenuifolium in New
Zealand Mycologia 97:1362-1364.

Rollins, J. A., and Dickman, M. B. 2001. pH signaling in Sclerotinia sclerotiorum: Identification
of apaC/RIMIhomolog. Appl. Environ. Microbiol. 67:75-81.

Rosewich, U. L., and Kistler, H. C. 2000. Role of horizontal gene transfer in the evolution of
fungi. Annu. Rev. Phytopathol. 38:325-363.

Saitou, N., and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4: 406-425.

Schimmel, T. G., Coffman, A. D., and Parsons, S. J. 1998. Effect ofbutyrolactone I on the
producing fungus, Aspergillus terreus. Appl. Environ. Microbiol. 64:3703-3712.

Seshime, Y., Juvvadi, P. R., Fujii, I., and Kitamoto, K. 2005. Discovery of a novel superfamily
of type III polyketide synthases in Aspergillus oryzae. Biochem. Biophys. Res. Commun.
331:253-260.









Shah, A. J., Tilburn, J., Adlard, M. W., and Arst, H. N. Jr. 1991. pH regulation of penicillin
production in Aspergillus nidulans. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett.
77:209-212.

Shen, B. 2003. Polyketide biosynthesis beyond the type I, II and III polyketide synthase
paradigms. Curr. Opinion Chem. Biol. 7:285-295.

Shim, W.-B., and Dunkle, L. D. 2003. CZK3, a MAP kinase kinase kinase homolog in
Cercospora zeae-maydis, regulates cercosporin biosynthesis, fungal development, and
pathogenesis. Mol. Plant-Microbe Interact. 16:760-768.

Shim, W.-B., and Woloshuk, C. P. 2001. Regulation of 1 fumonisin B1 biosynthesis and
conidiation in Fusarium verticillioides by a cyclin-like (C-type) gene, FCC1. Appl.
Environ. Microbiol. 67:1607-1612.

Shirasugi, N., and Misaki, A. 1992. Isolation, characterization, and antitumor activities of the
cell wall polysaccharides from Elsinoe leucospila. Biosci. Biotechnol. Biochem. 56:29-33.

Smith, D. J., Burnham, M. K., Bull, J. H., Hodgson, J. E., Ward, J. M., Browne, P., Brown, J.,
Barton, B., Earl, A. J., and Turner, G. 1990. p-lactam antibiotic biosynthetic genes have
been conserved in clusters in prokaryotes and eukaryotes. EMBO J. 9:741-747.

Smith, L. L., and Hill, F. L. 1972. Detection of sterol hydroperoxides on thin-layer chromoplates
by means of the Wurster dyes. J. Chromatography 66:101-109.

Smith, L. L., Teng, J. I., Kulig, M. J., and Hill, F. L. 1973. Sterol metabolism XXII. Cholesterol
oxidation by radiation-induced process. J. Organic Chem. 38:1763-1765.

Song, Z., Cox, R. J., Lazarus, C. M., and Simpson, T. J. 2004. Fusarin C biosynthesis in
Fusarium moniliforme and Fusarium venenatum. Bio. Chem. 5:1196-1203.

Spikes, J. D. 1989. Photosensitization. In: Smith, K. C., (ed.). The Science of Photobiology. New
York, USA: Plenum Press, pp. 79-110.

Stack, M. E., Mazzola, E. P., Page, S. W., Pohland, A. E., Highet, R. S., Tempesta, M. S., and
Corely, D. G. 1986. Mutagenic perylenequinone metabolites ofAlternaria alternate:
altertoxins I, II, and III. J. Nat. Prod. 49:866-871.

Stahl, D. J. and Schafer, W. 1992. Cutinase is not required for fungal pathogenicity on pea. Plant
Cell 4:621-629.

Staunton, J., and Weissman, K. J. 2001. Polyketide biosynthesis: a millennium review. Nat. Prod.
Rep. 18:380-416.

Stierle, A. C., and Cardellina, J. H. 1989. Phytotoxins from Alternaria alternate, a pathogen of
spotted knapweed. J. Nat. Prod. 52:42-47.









Takano, Y., Kikuchi, T., Kubo, Y., Hamer, J. E., Mise, K., and Furusawa, I. 2000. The
Colletotrichum lagenarium MAP kinase gene CMKI regulates diverse aspects of fungal
pathogenesis. Mol. Plant-Microbe Interact. 13:374-383.

Tamaoki, T., and Nakano, H. 1990. Potent and specific inhibitors of protein kinase C of
microbial origin. Biotechnol. 8:732-735.

Tan, M. K., Timmer, L. W., Broadbent, P., Priest, M., and Cain, P. 1996. Differentiation by
molecular analysis ofElsinoe spp. causing scab diseases of citrus and its epidemiological
implications. Phytopathol. 86:1039-1044.

Tappel, A. L. 1972. Vitamin E and free radical peroxidation of lipids. Ann. N. Y. Sci. 203:12-28.

Taylor, J. A., and West, D. W. 1980. The use of Evan's blue stain to test the survival of plant
cells after exposure to high salt and high osmotic pressure. J. Exp. Bot. 31:571-576.

Tilburn, J., S., Sarkar, D. A., Widdick, E. A., Espeso, M., Orej as, J., Mungroo, M. A., Pefialva,
and Arst, H. N. Jr. 1995. The Aspergillus PacC zinc finger transcription factor mediates
regulation of both acid- and alkaline-expressed genes by ambient pH. EMBO J. 14:779-
790.

Tinberg, H. M., and Barber, A. A. 1970. Studies on vitamin E action: peroxidation inhibition in
structural protein-lipid micelle complexes derived from rat liver microsomal membranes. J.
Nutr. 100:413-418.

Timmer, L.W., Garnsey, S. M., and Graham, J. H. 2000. Compendium of citrus disease.2nd
edition The American Phytopathological Society, St, Paul, MN.

Timmer, L, W., Priest, M., Broadbent, P., and Tan, M. K. 1996. Morphological and pathological
characterization of species of Elsinoe causing scab disease of citrus. Phytopathol. 86:1032-
1038.

Timmer, L. W., and Zitko, S. E. 1997. Evaluation of fungicides for control of Alternaria brown
spot and citrus scab. Proc. Fla. State Hortic. Soc. 110:71-76.

Tsitsigiannis, D. I., and Keller, N. P. 2006. Oxylipins act as determinants of natural product
biosynthesis and seed colonization in Aspergillus nidulans. Mol. Microbiol. 59:882-892.

Tudzynski, P., Holter, K., Correia, T., Arntz, C., Grammel, N., and Keller, U. 1999. Evidence for
an ergot alkaloid gene cluster in Clavicepspupurea. Mol. Gen. Genet. 261:133-141.

Turner, W. B. 1971. Fungal metabolites. Academic Press, London.

Turner, W. B. and Aldridge, D. C. 1983. Fungal metabolites II. Academic Press, London.

Upchurch, R. G., Walker, D. C., Rollins, J. A., Ehrenshaft, M., and Daub, M. E. 1991. Mutants
of Cercospora kikuchii altered in cercosporin synthesis and pathogenicity. Appl. Environ.
Microbiol. 57:2940-2945.









van Helden, J. 2003. Regulatory sequence analysis 1 tools. Nucl. Acids Res. 31:3593-3596.

van Kan, J. A. L. 2006. Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in
Plant Sci. 11:247-253.

Walton, J. D. 2000. Horizontal gene transfer and the evolution of secondary metabolite gene
clusters in fungi: An hypothesis. Fungal Genet. Biol. 30:167-171.

Watanabe, A., and Ebizuka, Y. 2004. Unprecedented metabolism of chain length determination
in fungal aromatic polyketide synthases. Chem. Biol. 11:1101-1106.

Weiss, U., Flon, H., and Burger, W. C. 1957. The photodynamic pigment of some species of
Elsinoe and Sphaceloma. Arch. Biochem. Biophys. 69:311-319.

Weiss, U., Merlini, L., and Nasini, G. 1987. Naturally occurring perylenequinones. In: Herz, W.,
Grisebach, H., Kirby, G. W., Tamm, C. (eds.). Progress in the Chemistry of Organic
Natural Products. Springer-Verlag, New York, U.S.A.

Weiss, U., Ziffer, H., Batterham, T. J., Blumer, M., Hackeng, W. H. L., Copier, H., and
Salemink, C. A. 1965. Pigments of Elsinoe species I. Pigment production by Elsinoe
species: Isolation of pure elsinochromes A, B, and C. Can. J. Microbiol. 11:57-66.

White, T. J., Burns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. pp. 315-322. In: Innis, M, A., Gelfand, D.
H., sninsky, J. J., and White, T. J. (eds.). PCR Protocols: a guide to methods and
applications. Academic Press, New York.

Whiteside, J. O. 1978. Pathogenicity of two biotypes ofElsinoefawcettii pertaining to sweet
orange and some other cultivars. Phyopathol. 68: 1128-1131.

Whiteside, J. O. 1984. Infection of sweet orange fruit in Florida by a common biotype of Elsinoe
fawcettii. Proc. Int. Soc. Citric. 2:343-346.

Whiteside, J. O. 1988. Scab disease. pp. 26-27. In: Whiteside, J. O., Garnsey, S. M., Timmer, L.
W. (eds.). Compendium of citrus disease APS press. St. Paul, Minnesota.

Wilson, R. A., and Arst, H. N. 1998. Mutational analysis of AREA, a transcriptional activator
mediating nitrogen metabolite repression in Aspergillus nidulans and a member of the
"streetwise" GATA family of transcription factors. Microbiol. Mol. Biol. Rev. 62:586-597.

Wolf, J. C., and Mirocha, C. J. 1973. Regulation of sexual reproduction in Gibberella zeae
(Fusarium roseum 'Graminearum') by F-2 (zearalenone). Can. J. Microbiol. 19:725-734.

Wu, H., Lao, X. F., Wang, Q. W., and Lu, R. R. 1989. The shiraiachromes: novel fungal
perylenequinone pigments from .\lm, ua bambusicola. J. Nat. Prod. 5:948-951.

Yamazaki, S., and Ogawa, T. 1972. The chemistry and stereochemistry of cercosporin. Agric.
Biol. Chem. 36:1707-1718.









Yamazaki, S., Okube, A., Akiyama, Y., and Fuwa, K. 1975. Cercosporin, a novel photodynamic
pigment isolated from Cercospora kikuchii. Agric. Biol. Chem. 39:287-288.

Yoshihara, T., Shimanuki, T., Araki, T., and Sakamura, S. 1975. Phleichrome, a new phytotoxic
compound produced by Cladosporiumphlei. Agri. Biol. Chem. 39:1683-1684.

You, B. J. and Chung, K.-R. 2007. Phenotypic characterization of mutants of the citrus pathogen
Colletotrichum acutatum defective in a PacC-mediated pH regulatory pathway. Res. lett.
277:107-114.

You, B. J., Choquer, M., and Chung, K.-R. 2007. The Colletotrichum acutatum gene encoding a
putative pH-responsive transcription regulator is a key virulence determinant during fungal
pathogenesis on citrus. Mol. Plant-Microbe Interact. 20:1149-1160.

Yu, J., Chang, P.-K., Ehrlich, K. C., Cary, J. W., Bhatnagar, D., Cleveland, T. E., Payne, G. A.,
Linz, J. E., Woloshuk, C. P., and Bennett, J. W. 2004. Clustered pathway genes in
aflatoxin biosynthesis. Appl. Environ. Microbiol. 70:1253-1262.

Yu, J.-H., and Keller, N. 2005. Regulation of secondary metabolism in filamentous fungi. Annu.
Rev. Phytopathol. 43:437-458.

Zhang, Y.-Q., Wilkinson, H., Keller, N. P. and Tsitsigiannis, D. 2004. Secondary metabolite
gene clusters. pp. 355-386. In: An, A. (ed.). Handbook of Industrial Mycology. New York:
Marcel Dekker.









BIOGRAPHICAL SKETCH

Hui-Ling Liao was born in Taiwan in 1975. Before attending the University of Florida for

pursuing Ph.D in August 2004, she completed her Bachelor of Science in plant pathology at

National Chung Hsing University in June 1998, and obtained a Master of Science in plant

pathology at National Taiwan University in June 2000. She joined a plant pathology laboratory

as a research assistant at National Chung Hsing University from 2000 to 2001. Later, she was a

teaching assistant in the department of biology in Tunghai University in Taiwan from 2001 to

2004.





PAGE 1

1 MOLECULAR AND GENETIC DETERMINATI ON OF THE ROLE OF ELSINOCHROME TOXINS PRODUCED BY Elsino fawcettii CAUSING CITRUS SCAB By HUI-LING LIAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Hui-Ling Liao

PAGE 3

3 To my grandmother, Ma-Men Liao, who always supports my educational pursuits

PAGE 4

4 ACKNOWLEDGMENTS I am grateful to several individuals w ho have helped me towards my education. I would like to thank my advisor, Dr. Ku ang-Ren Chung, for his wise guidance towards my accomplishment. The excellent projects and th e brilliant suggestions he gave sparked my interest in research to a great extent. Many thanks to all my supervisory committee members, Dr. Jacqueline Burns, Dr. James Graham, and Dr. Jeffrey Rollins, for their sage counsel and help throughout my studies and dissertation process. A very sincere and warm gratitude goes to a ll my lovely friends that I have made in Gainesville and CREC. Their love is the key fact or supporting me over the past four years when my family is million of miles away from me. A special thanks to my roommate, Karthik, who took care of me like his family. I thank my fatherand mother-in-law for taki ng care of my lovely daughter, Chin-Chin, so that I can be involved in resear ch without being worried about anything. Much love and thanks to my husband, Chih-Ming, for his cons tant support and encouragement. Most importantly, I would like to give my heartf elt thanks to my grandma for the sacrifices she has made to support me towards my education.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES.......................................................................................................................10 ABSTRACT...................................................................................................................................13 CHAP TER 1 INTRODUCTION AND LITERATURE REVIEW..............................................................15 Biology of Elsino fawcettii Causing Citrus Scab .................................................................. 15 Symptoms, Disease Cycles and Disease Control of Citrus Scab Caused by Elsino fawcettii ...............................................................................................................................17 Symptoms....................................................................................................................... .17 Disease Cycle..................................................................................................................17 Disease Control...............................................................................................................18 Secondary Metabolites of Fungi............................................................................................. 19 Secondary Metabolites of Fungi...................................................................................... 19 Elsinochromes Produced by Elsino fawcettii ................................................................20 Polyketide Biosynthesis................................................................................................... 21 Gene Clusters...................................................................................................................24 Research Overview.............................................................................................................. ...25 2 CELLULAR TOXICITY OF ELSINOCHR OM E PHYTOTOXINS PRODUCED BY Elsino fawcettii ......................................................................................................................32 Introduction................................................................................................................... ..........33 Materials and Methods...........................................................................................................34 Biological Materials and Cultural Conditions................................................................. 34 Isolation and Analysis of the Red/Orange Pigments....................................................... 35 Toxicity Assays to Plant Cells.........................................................................................36 Detection of Singlet Oxyg en and Superoxide Ions ......................................................... 37 Determination of Electrolyte Leakage............................................................................. 38 Statistical Analysis.......................................................................................................... 39 Results.....................................................................................................................................39 Isolation and Characterization of ESCs from Elsino fawcettii ......................................39 Toxicity of ESCs from E. fawcettii to Host and Non-Host Cells .................................... 40 Antioxidants Reduce ESC Toxicity.................................................................................40 ESCs are Toxic to Citrus Leaves..................................................................................... 41 Production of Reactive Oxygen Species by ESCs.......................................................... 41 Electrolyte Leakage Induced by ESCs............................................................................42 Discussion...............................................................................................................................43

PAGE 6

6 3 ENVIRONMENTAL FACTORS AFFECTING PRODUCTION OF ELSINOC HROMES BY Elsino fawcettii ............................................................................58 Introduction................................................................................................................... ..........58 Materials and Methods...........................................................................................................60 Fungal Strains, Maintenance, and Culture Conditions.................................................... 60 ESC Purification and Quantification............................................................................... 61 Statistical Analysis.......................................................................................................... 61 Preparation of Chemicals................................................................................................ 61 Results and Discussion......................................................................................................... ..62 Fungal Growth and ESC Production in Res ponse to Light, Media Components and pH .................................................................................................................................62 Carbon Sources on Fungal Growth and ESC Production................................................63 Effects of Inorganic and Organic Nitrogen on Fungal Gr owth and ESC Production ..... 63 Effects of Antioxidants on Fungal Growth and ESC Production ....................................64 Effects of Ions on ESC Production..................................................................................64 Co-culturing Enhances ESC Production.........................................................................65 4 GENETIC DISSECTION DEFINES THE ROLES OF ELSINOCHROME PHYT OTOXIN FOR FUNGAL PATHOG ENESIS AND CONIDIATION OF THE CITRUS PATHOGEN Elsino fawcettii ................................................................................74 Introduction................................................................................................................... ..........74 Materials and Methods...........................................................................................................76 Fungal Isolate and Growth Conditions............................................................................ 76 Extraction and Analysis of ESC Toxins.......................................................................... 77 Molecular Cloning and Analysis of the EfPKS1 Gene ....................................................77 Targeted Gene Disruption...............................................................................................78 Genetic Complementation............................................................................................... 79 Miscellaneous Methods of Pr ocessing Nucleic A cids..................................................... 80 Preparation of Fungal Inoculum and Pathogenicity Assays ............................................ 80 Results.....................................................................................................................................81 Cloning and Characterization of EfPKS1 Gene ...............................................................81 Promoter Analysis of EfPKS1 Gene ................................................................................82 Expression and Regulation of EfPKS 1 Gene and ESC Production.................................82 EfPKS1 is Required for ESC Production ......................................................................... 83 Disruption of EfPKS1 Re duces Conidiation....................................................................85 The EfPKS1 Gene is Required for F ull Virulence........................................................... 85 Discussion...............................................................................................................................86 5 CHARACTERIZATION OF A GENE CLUSTER REQUIRED FOR THE BIOSYNTHESIS OF EL SINOCHROMES BY Elsino fawcettii .........................................99 Introduction................................................................................................................... ........100 Materials and Methods.........................................................................................................101 Fungal Strains, Their Maintenance and Extraction/Analysis of ESC Toxin .................101 Chromosomal Walking and Sequence Analysis............................................................ 101

PAGE 7

7 Targeted Gene Disruption and Genetic Complementation........................................... 102 Molecular Techniques................................................................................................... 103 Conidia Production and Pathogenicity Assays ..............................................................104 Nucleotide Sequences.................................................................................................... 104 Results...................................................................................................................................105 Sequence Analysis and Determination of Open Reading Fram es (ORFs)....................105 Expression of Putative ORFs and ESC Accum ulation.................................................. 106 Promoter Analysis for Identifying DNA Binding Motifs.............................................. 107 Targeted Disruption of the TSF1 Gene and Genetic Com plementation........................ 108 Gene Regulation by TSF1 and Feedback Inhibition..................................................... 110 Discussion.............................................................................................................................111 6 GENETIC AND PATHOLOGICAL DETERMINATIONS OF Elsino fawcettii FIELD ISOLATES FROM FLORIDA ............................................................................................. 128 Introduction................................................................................................................... ........128 Materials and Methods.........................................................................................................130 Fungal Isolates and Growth Conditions........................................................................130 Extraction and Analysis of Elsinochrom es (ESCs)....................................................... 130 Production and Germination of Conidia........................................................................ 131 Pathogenicity Assays.....................................................................................................131 Enzymatic Activity Assays............................................................................................ 132 PCR-Restriction Fragment Length Polymo rphism (RFLP) a nd Sequence Analysis of ITS and -tubulin Genes........................................................................................133 Random Amplified Polymorphic DNA (RAPD).......................................................... 134 Miscellaneous Methods of Pr ocessing Nucleic A cids................................................... 134 Results...................................................................................................................................135 Morphological Examination.......................................................................................... 135 Pathogenicity Assays.....................................................................................................135 Production of ESC Toxin in Culture.............................................................................136 Extraction of ESCs from Scab Lesions......................................................................... 136 Further Characterization of a Nonpathogenic Elsino fawcettii Isolate ........................137 Alterations in Hydrolyt ic Enzym e Activities................................................................ 137 Production of ESC and Expression of the EfPKS1 gene in the Nonpathogenic Isolate (Ef41) .............................................................................................................138 Co-inoculation of Two E. fawcettii Isolates Reduces Lesion F ormation...................... 138 Molecular Evaluation of E. fawcettii Isolates ................................................................ 139 Discussion.............................................................................................................................140 APPENDIX A SUPPLEMENTAL DATA FOR CHAPTER TWO............................................................. 153 B SUPPLEMENTAL DATA FOR CHAPTER THREE......................................................... 154 C SUPPLEMENTAL DATA FOR CHAPTER FOUR........................................................... 155

PAGE 8

8 D SUPPLEMENTAL DATA FOR CHAPTER SIX................................................................ 157 LIST OF REFERENCES.............................................................................................................162 BIOGRAPHICAL SKETCH.......................................................................................................175

PAGE 9

9 LIST OF TABLES Table page 3-1 Effects of ions and EGTA on ESC production by Elsino fawcettii .................................66 4-1 Conidial production in axenic cultures and pathogenicity assays on detached rough lem on leaves by inoculating with agar plugs cut from cultures of Elsino fawcettii wild type (WT), EfPKS1 null mutants (D1, D2, D3, and D4), and strains (C1 and C2) expressing a functional copy of EfPKS1 ............................................................................90 5-1 Elsinochrome (ESC) biosynthetic gene cluster and adjacent EfHP1-4 genes encoding hypothetical proteins in Elsino fawcettii ........................................................................117 5-2 Promoter analysis of genes in the elsinochrom e (ESC) biosynthetic gene cluster of Elsino fawcettii ...............................................................................................................119 6-1 Pathogenicity and production of elsinochrom es (ESCs) in vivo and in planta by different field isolates of Elsino fawcettii ......................................................................143 6-2 Sequence identity (%) of fungal partial -tubulin gene ................................................... 145 B-1 Effects of ions on ESC production on CM by E. fawcettii ..............................................154 C-1 Sequences of primers.......................................................................................................155 D-1 Germination of Elsino fawcettii isolates on detached l eaves of rough lemon and grapefruit ..........................................................................................................................157

PAGE 10

10 LIST OF FIGURES Figure page 1-1 Symptoms of citrus scab caused by the pathogenic fungus, Elsino fawcettii ..................27 1-2 Life cycle of Elsino fawcettii the causal agent of citrus scab. ........................................ 28 1-3 Structure of elsinochromes................................................................................................ 29 1-4 Proposed model for the formation of ac tivated oxygen species by photosensitizers ........30 1-5 Biosynthesis of fatty acid and polyketide in fungi.............................................................31 2-1 Thin-layer chromatography analysis of elsinochrom es (ESCs) produced by Elsino fawcettii ..............................................................................................................................47 2-2 Absorption spectrum of the ace tone crude extracts of ESCs ............................................. 48 2-3 Chemical properties of phenolic quin ines of the acetone extracted ESCs ......................... 49 2-4 Reduction of live cells of citrus protopl asts, tobacco protopla sts, or su spensioncultured tobacco cells treated wi th elsinochrome (ESC) phytotoxins............................... 50 2-5 Cell viability of citrus pr otoplasts af ter treatment with elsinochromes (ESCs) isolated from Elsino fawcettii with and without antioxidant compounds..................................... 51 2-6 Cell viability in suspension-cultured t obacco cells by elsino chromes (ESCs) with antioxidants........................................................................................................................52 2-7 Development of necrotic lesions on detached rough lem on leaves after a 10-day application of elsinochromes (ESCs) from Elsino fawcettii and prevention of necrosis by co-application of antioxidants......................................................................... 53 2-8 Development of necrotic lesions on detached rough lem on leaves 10 days after application of elsinochromes (ESCs) from Elsino fawcettii and prevention of necrosis by co-application of superoxi de dismutase (SOD) or hyperoxidase................... 54 2-9 Superoxide production assa ys based on the reduction of nitrotetrazolium blue chloride (NBT) as substrate............................................................................................... 55 2-10 Oxidation of cholesterol by photosens itizers: hem atoporphyrin (HP), cercosporin (CR), and elsinochromes (ESCs) under light..................................................................... 56 2-11 Leakage of electrolytes from illumina ted rough lem on leaf discs treated with elsinochromes (ESCs)........................................................................................................57 3-1 Effects of light and medium compositions on fungal growth and elsinochrom e (ESC) production by E. fawcettii ..................................................................................................67

PAGE 11

11 3-2 ESC accumulation and growth of E. fawcettii at different pH on MM ............................. 68 3-3 Effects of various carbon sources on f ungal growth and ESC production by E. fawcettii assayed on CM medium...................................................................................... 69 3-4 Effects of nitrogen sources on fungal growth and ESC production by E. fa wcettii assayed in MM medium..................................................................................................... 70 3-5 Effects of antioxida tants on ESC production by E fawcettii in MM medium.................. 71 3-6 Inhibition of ESC production by Ca2+, Co2+, and Li2+ in E. fawcettii ...............................72 3-7 Effects of the number of fungal colonies and the distances on ESC production by E. fawcettii ..............................................................................................................................73 4-1 Putative polyketide s ynthase, EfPKS1, in Elsino fawcettii ..............................................91 4-2 Promoter analysis of 1.1 kb sequences upstream of the putative ATG translational start codon of EfPKS1 ........................................................................................................93 4-3 Differential expression of the EfPKS1 gene encoding a fungal polyketide synthase and accum ulation of ESC phytotoxins in a wild-type isolate Elsino fawcettii ................94 4-4 Strategy of EfPKS1 targeted disruption in Elsino fawcettii .............................................95 4-5 EfPKS1 gene expression and ESC production in EfPKS1 disruptants .............................. 96 4-6 Pathogenicity assays on detached rough lem on leaves inoc ulated with agar plugs of wild type, four EfPKS1 disruptants, and two strain s expressing a functional EfPKS1 gene of Elsino fawcettii ....................................................................................................97 4-7 Pathogenicity assays using conidi al suspensions of wild type, the EfPKS1 disruptant, and the com plementation strain of Elsino fawcettii on detached rough lemon leaves.....98 5-1 Elsinochrome (ESC) bios ynthetic gene cluster................................................................ 120 5-2 Northern-blot analysis of gene expr ession and elsinochrom e (ESC) production in response to nitrogen, pH, and glucose in Elsino fawcettii .............................................121 5-3 Targeted gene disruption of TSF1 e ncoding a putative tran scription regulator which contains dual Cys2His2 type zinc finger and GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain using a split-marker strategy in Elsino fawcettii ........................122 5-4 TSF1 gene expression and ESC production in TSF1 disruptants .................................... 123 5-5 Northern-blot hybridizat ion indicates that the tsf 1-disrupted mutants failed to accumulate the EfPKS1 and reduce production of RDT1 PRF1 and EfHP1 transcripts.........................................................................................................................124

PAGE 12

12 5-6 Northern-blot hybridizati on indicates a feedback inhibition of the ESC clustering genes in Elsino fawcettii.................................................................................................125 5-7 Hypothetical reaction pathway for the for mation of elsinochromes (ESCs) by function of the ESCs biosynthetic clustering genes.........................................................126 5-8 Hypothetical signal trans duction and regulatory controls for E SC biosynthesis and accumulation................................................................................................................... .127 6-1 Thin-layer chromatography analysis ( TLC) of ESC phytotoxins (the red/orange pigm ents) extracted from affected rough le mon leaves inoculated with different isolates of Elsino fawcettii .............................................................................................146 6-2 Determination of extracellular enzyme activities in different isolates of Elsino fawcettii ............................................................................................................................147 6-3 Alleviation of symptom deve lopm ent by co-inoculation of two Elsino fawcettii isolates..............................................................................................................................148 6-4 Electrophoresis of the amplified internal transcribed spacer (ITS) rDNA frag ments after cleaved with restricti on enzymes on 2% agarose gels.............................................149 6-5 Electrophoresis of the amplified partial -tubulin genes digested with restriction enzym es on 2% agarose gels............................................................................................ 150 6-6 Electrophoresis of the randomly amp lified polym orphic DNA fragments (RAPD) on 2% agarose gels................................................................................................................ 151 6-7 Comparison of the internal transcri bed spacer 1 (ITS 1) sequences between Elsino fawcettii Florida isolates and other E lsino spp. and other species belonging to the order of Loculoascomycetes via phylogenetic analysis................................................... 152 A-1 Spectrophotometric absorbance of el sinochrom es (ESCs) treated with 3-( N morpholino) propanesulfonic acid (MOPS) buf fer, nitrotetrazolium blue chloride, or both MOPS and NBT at 560 nm...................................................................................... 153 C-1 Strategies to obt ain full-length of EfPKS1 .......................................................................156 D-1 Elsino fawcettii hyphae observed using a light m icroscope........................................... 158 D-2 Variation of fungal colony under a dissection microscope.............................................. 159 D-3 Alignment of nucleotide sequences of fungal partial -tubulin genes .............................160

PAGE 13

13 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR AND GENETIC DETERMINATI ON OF THE ROLE OF ELSINOCHROME TOXINS PRODUCED BY Elsino fawcettii CAUSING CITRUS SCAB By Hui-Ling Liao May 2008 Chair: Kuang-Ren Chung Major: Plant Pathology Citrus scab disease, caused by the fungus Elsino fawcettii (Bitancourt & Jenkins), affects all varieties of citrus, resulting in serious fruit blemishes and economic losses in Florida. My study focused on genetic determination of the role of elsinochrome phytotoxins produced by E. fawcettii. Results indicated that elsinochromes functi on as photosensitizing compounds that exert toxicity to plant cells due to production of reactive oxygen specie s such as singlet oxygen and superoxides. Upon irradiation to light, elsinochromes alone rapi dly killed suspension-cultured citrus and tobacco cells, induced necrotic le sions on rough lemon leaves, and provoked a steady increase of electrolyte leakage. The toxicity was drastically decreased or alleviated by the singlet oxygen quenchers, such as bixin, DABCO, or redu ced glutathione. Accumulation of singlet oxygen and superoxides induced by elsinochromes after irradi ation was also detected. An EfPKS1 gene encoding a fungal polyketide synthase (PKS) was cloned and characterized from E. fawcettii to confirm the roles of elsinochr omes in fungal pathogenesis and lesion formation by genetic disruption and comple mentation strategies. In addition, accumulation of the EfPKS1 transcript and elsinochromes by the wild-type strain were coor dinately regulated

PAGE 14

14 by light, carbon, nitrogen and pH. The results cl early indicate that elsinochromes play a consequential role in fungal pathogenesis. The genes involved in the biosynthesis of f ungal secondary metabolites are often clustered. I sequenced a 30-kb region beyond EfPKS1 and identified nine putative genes; some of them encoding polypeptides are like ly required for elsinochrome biosynthesis and regulation. In addition to EfPKS1 five genes, RDT1 encoding a reductase, OXR1 encoding an oxidoreductase, TSF1 encoding a transcriptional factor, ECT1 encoding a membrane transporter, and PRF1 encoding a prefoldin protein subunit were id entified. Other four genes (designated as EfHP1-4 ) encode hypothetical proteins th at are likely not associated wi th biosynthetic functions. The involvement of these genes in elsinochrom e production was evident by analyzing the TSF1 gene encoding a putative pathway-specifi c regulator. Targeted disruption specifically occurred at the TSF1 gene created fungal mutants that are defect ive in elsinochrome production. Expression of the adjacent genes in the TSF1 -disrupted mutants was markedly down-regulated. In addition, elsinochromes were extracted, for the first time, from affected lesions. A survey of 52 field-collected E. fawcettii isolates in Florida revealed that most of them were able to produce elsinochromes in cultures and/or in planta A single isolate (Ef 41) with distinct genetic traits from all others failed to inf ect rough lemon, grapefruit, and sour orange and produced no elsinochromes. Ov erall, my studies employing biochemical, molecular, and pathological approaches clearly demonstrated that elsinochromes play critical roles for fungal pathogenesis and lesion development.

PAGE 15

15 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Biology of Elsino faw cettii Causing Citrus Scab Citrus scab (formerly called sour orange scab) is caused by the pathogenic fungus, Elsino fawcettii Bitancourt & Jenkins (Anamorph: Sphaceloma fawcettii Jenkins) that belongs to the kingdom Fungi, phylum Ascomycota, class Loculoascomycetes, order Myriangiales, and family Elsinoaceae (Alexopoulos et al. 1996). The teleomorph of Elsino fawcettii is very rare and has been reported only in Brazil (Bitancourt and Jenkins 1936a; 1936b). E. fawcettii forms stromata that contain numerous spherical asci within the pseudothecial locules. Each ascus harbors eight filamentous ascospores (sexual spores) that are hyaline and oblong ellipti cal with the size of 5-6 x 10-12 m (Holliday 1980). Elsino spp. produces two kinds of conidia (asexual spores): hyaline conidia and spindle conidia (Fig. 1-2). Hyaline conidia of Elsino spp. are one celled, elliptical, and 2-4 x 4-8 m and are the primary source for inoculation (White side et al. 1988). Conidia are produced within the acervulus which is typically a flat or sa ucer-shaped bed of conidiophores growing side by side and arising from a stromatic mass of hyphae (Alexopoulos et al. 1996) and capable of reproducing by formation of a new germ tube (Ho lliday 1980; Whiteside et al. 1988). In contrast, the colored, spindle-shaped conidia that are prod uced mainly on scab lesions can germinate to produce hyaline conidia. In culture, E. fawcettii produces raised, slow-glo wing colonies that are usually beige to tan or vinaceous to black. Isolates of E. fawcettii grow slowly in axenic culture, forming < 10-mm colony size in 30 days. Most strains of E. fawcettii secrete red pigments after 10-15 day incubation in the light. Identification of citrus scab pathogens is pr imarily based on their host ranges, because it is difficult to differentiate based on their morphologies. Elsino fawcettii causing common scab

PAGE 16

16 was found in many citrus producing areas worl dwide. Whiteside (1978 ; 1984) described two pathotypes from Florida and later were designated as the Florida broad host range (FBHR) and the Florida narrow host range (FNHR) (Timmer et al. 1996). The FBHR pathotype mainly attacks the leaves and fruits of lemon ( C. limon (L.) Burm. F.), sour orange (C. aurantium L.), grapefruit ( C. paradisi Macf.), and Temple/Murcott tangors ( C. sinensis (L.) Osbeck x C. reticulata Blanco), and the fruit of sweet orange ( C. sinensis ). The FNHR pathotype fail to infect sour orange, Temple tangor, and sweet orange fr uit (Tan et al. 1996; Timmer et al. 1996). All pathotypes of citrus scab attack rough lemon ( Citrus jambhiri Lush). E. australis Bitancourt & Jenkins (anamorph S. australis Bitancourt & Jenkins.), causing sweet orange scab differs from E. fawcettii in host ranges and is limited to southern South America. E. fawcettii rarely causes lesions on sweet orange, whereas E. australis attacks all sweet oranges as well as some tangerines and their hybrids (Chung and Timmer 2005). Unlike E. fawcettii that induces lesions on all parts of citrus, E. australis appears to affect only fruit. In addition, E. australis can be distinguished from E. fawcettii based on the sizes of ascospores (1220 x 15-30 m in E. australis ) (Whiteside et al 1988). Furthermore, E. australis does not produce spindle-shaped conidi a in scab lesions that ar e often associated with E. fawcettii. Molecular studies have been employed recently for identification and differentiation of different species and isolates of Elsino (Tan et al. 1996; Timmer et al. 1996; Hyun et al. 2001). For example: E. fawcettii and E. australis are differentiated by endonucle ase restriction analysis of the amplified intern al transcribed spacers (IT Ss) of ribosomal DNA. E. fawcettii isolated from Florida and Australia could be separated by random amplified DNA polymorphism (RAPD) analysis (Tan et al. 1996).

PAGE 17

17 In addition to citrus, Elsino spp. also cause diseases in a wide range of plants, such as bean scab caused by E. phaseoli, leaf spot of Dracophyllum sp. caused by E. dracophylli grape anthracnose caused by E. ampelina raspberry anthracnose caused by E. veneta and twig disease of Pittosporum tenuifolium caused by E. takoropuku (Phillips 1994; Johnston and Beever 1994; Agrios 1997; Ridley 2005). Symptoms, Disease Cycles and Disease Control of Citrus S cab Caused by Elsino fawcettii Symptoms Citrus scab affects fruit, leav es and twigs of susceptible vari eties of citrus (Timmer et al. 2000) (Fig. 1-1). Symptoms start as small, pale orange or buff-colored slightly-raised pustules, which consist of a mixture of fungal and host ti ssues. As the pustules develop on most of the susceptible species and cultivars (e.g., lemons, Sa tsuma mandarins, Temples, and sour orange), those spots become warty and creaky protubera nce (Fig. 1-1A, and 1-1B). In contrast, on grapefruit and sweet orange, the lesions appear to be flattened scabby sheets (Fig. 1-1C). The age of the tissues at the time of infection also aff ects the elevation and size of lesions. Those formed on young tissues tend to be raised and those on more mature tissu es are flatter. Because of variations among cultivars and infected-tissue age, it is difficult to differentiate citrus scab from other citrus diseases on th e basis of symptoms alone. Disease Cycle In the field, E. fawcettii survives under unfavorable condi tions in pustules on leaves, stem lesions and fruit. Ascospores most likely play no role in th e infection process. E. fawcettii survives in old lesions and produces conidia fr om acervuli on the surface of scab pustules (Fig. 1-2A). The mode of spread of conidia occurs mostly due to rain splash. Hyaline conidia die rapidly when exposed to light or dry conditions. After periods of dew, production of spindleshaped conidia (Fig. 1-2B) on lesions are stimul ated and are spread by wind. A short period of

PAGE 18

18 moisture is needed for infection of E. fawcettii after dispersal of conidi a. The minimum humidity period for production of conidia is 1-2 hr, and infection occurs w ithin 2 to 3 hr at 24-27 C (Timmer et al. 2000). The severity of citrus sc ab is markedly affected by wetness. Longer periods of humidity (up to 24 hr) greatly facili tate infection even at suboptimal temperatures. Under suitable conditions, scab lesi ons usually appear on the host, as early as 6 days to 7 days after infection (Fig. 1-2C and D). Leaves are sus ceptible immediately after they emerge from the bud, and become resistant when th ey are older (about 20 days after emergence). The young fruit are susceptible until 6-8 weeks afte r petal fall. The infection ofte n causes fruit to be misshapen and fall prematurely (Bushong and Timmer 2000). Disease Control Citrus scab is a comm on disease in humid citrus-growing areas in many countries. Although the damage produced by scab is superficial and does not a ffect internal fruit quality, citrus scab reduces acceptability for the fresh-fr uit market. Citrus scab is endemic in Florida where climatic conditions are highly favorable fo r the pathogen cycle and disease. Scab disease predominantly affects summer growth flushes as summer rain showers frequently occur in Florida and produce sufficient wetn ess for conidial germination and infection. The most effective strategy recommended for scab management is to remove and destroy the inoculum sources. Frequent applications of fungicide s are absolutely needed to manage citrus scab if the fruit is intended for the fresh market. Several fungicides such as Topsin (thiophanate methyl), Abound (azoxystrobin), Gem (trifloxystrobin), Headline, (pyraclostrobin), ferbam, and copper fungicides are registered in Florida and ca n be used for control of citrus scab (Bushong and Timmer 2000). However, fungicides are often not adequate for disease control. Application of fungicides also raises con cerns on resistance of the pathogens and environmental hazards (Timmer and Zitko 1997).

PAGE 19

19 Secondary Metabolites of Fungi Secondary Metabolites of Fungi Fungal products classified as secondary m e tabolites (Turner 1971; Turner and Aldridge 1983) often show significant biological activities or enigmatic properties, and they are not essential for the microorganisms to complete their lifecycles. Many of those bioactive compounds (e.g., phytotoxins and melanin) are requi red for development of diseases or fungal structures. Some of them may increase fungal fitness, display antimic robial activity, and pharmaceutical activities (e.g., antibiotics a nd immunosuppressant) (Demain and Fang 2000). Thereby, fungal secondary metabolites have been thought to confer competitive advantages for the producing microorganisms in natural en vironments. In addition, fungal secondary metabolites are of medical, industrial and/or agricultural importance. Several fungal secondary metabolites have been shown to be associated with fungal development. For example, linoleic acid-derived compounds produced by A. nidulans (Calvo et al. 2001), zearalenone from Fusarium graminearum (Wolf and Mirocha 1973), and butyrolactone I from Aspergillus terreus (Schimmel et al. 1998) are ab le to enhance sporulation. Furthermore, dark brown-melanin pigments produced by many fungi by oxidative polymerization of phenolic compounds function as fungal virulence factors due to their ability to stimulate production of conidia (e.g., Alternaria alternata ), appressoria (e.g., Colletotrichum lagenarium ), sclerotia (e.g., Scherotium spp.), and sexual bodies (e.g., Sordaria macrospora) (Chet and Httermann 1982; Kawamura et al. 1 999; Takano et al. 2000; Butler et al. 2001; Engh et al. 2007). Alternaria alternata produces melanin to enhance the integrity of sexual and asexual spores (Kawamura et al. 1999). Melanin apparently contributes to the su rvival of the fungal spores by protecting against UV light dama ge. Cercosporin phytotoxin produced by many

PAGE 20

20 pathogenic Cercospora spp. is not required for spore developm ent but plays a critical role during fungal pathogenesis (C hoquer et al. 2005; 2007). Phytotoxins produced by many phytopathogenic fungi often damage plant cells or influence the course of disease development and the formation of symptoms. Cercosporin produced by Cercospora spp. and botrydial produced by Botrytis cinerea have been shown to function as virulence factors and further exacerba te disease severity (Choquer et al. 2005; van Kan 2006). Phytotoxins are classified into two classes: host -specific and non-host specific. Nonhost specific toxins exhibit gene ral phytotoxicity toward a wide range of plant sp ecies including non-host plants. However, host-specific toxins aff ect only plant varieties or genotypes that are the hosts of the produc ing microorganisms. Elsinochromes Produced by Elsino fawcettii Many Elsino fungal species produce light-activated, red/orange pigm ents, called elsinochromes. Elsinochrome pi gments containing a phenolic quini ne chromophore consist of at least four derivatives (A B, C, and D) (Fig. 1-3). The bright red pigments, elsinochromes A, B, and C were originally isolated from cultures of a pecan pathogen, Elsino randii (anamorph: Sphaceloma randii ) and their chemical structures and physical properties have been well documented (Weiss et al. 1965; Lousberg et al. 1969). Elsinochromes B and C can be quickly oxidized to A by chromium trioxi de (Lousberg et al. 1969). In c ontrast, elsinochrome D, likely derived from elsinochrome C by fo rming a methylenedioxy ring (Fi g. 1-3), is an orange pigment produced only by some Elsino species (Shirasugi and Misaki 1992). Elsinochromes are structural analogs to several polycyclic pe rylenequinones such as altertoxin I produced by Alternaria alternata cercosporin produced by many Cercospora spp., hypericin produced by Hypericum spp., hypocrellin A produced by Hypocrella bambusae and phleichrome produced by Cladosporium spp. (Yoshihara et al 1975; Assante et al. 1977; Daub 1982a; Duran and Song

PAGE 21

21 1986; Stierle and Cardellina 1989; Daub et al. 20 05). All of these compounds have a common 4,9-dihydroxyperylene-3,10-quinone chromophore and onl y differ in attached side chains (Daub et al. 2005). Additionally, these compounds are gr ouped as photosensitizers based on their ability to sensitize cells to visible light, react w ith oxygen molecules, a nd produce reactive oxygen species (ROS) (Yamazaki et al. 1975; Daub 1982a ). Light and oxygen are two key components for photodynamic function and toxicity of these compounds. Although elsinochromes structurally resemble many phot osensitizing perylene quinones, their toxicity has never been investigated. Photosensitizing compounds are a group of structurally diverse compounds and natural products that are able to absorb light energy and are converted to an electronically excited triplet state. The activated photosensitize rs then react with oxygen molecu les in two different ways to form both radical and non-radi cal species of acti vated oxygen, including superoxide, hydrogen peroxide, hydroxyl radical, and singlet oxygen (Dobrowolski and Foote 1983; Girotti 1990) (Fig. 1-4). Activated oxygen species have general toxicit y, as they react with biomolecules common to all cells, including lipids, protei ns, and nucleic acids, and often result in cell death (reviewed by Daub et al. 2005). The toxicities of radical oxygen species have been well known. Several lines of evidence suggest that th e non-radical-singlet oxygen (1O2) is also highly toxic to cells (reviewed by Daub et al. 2005). Polyketide Biosynthesis Polyketides are a large f amily of natural produ cts that are produced by bacteria, fungi, and plants. Polyketide chain assembly is catalyzed by polyketide synthase (PKS). Three basic types of bacterial PKSs are known to date (Shen 2003). Bacterial type I PKSs are modules which contain one or more large multifunctional protein subunits similar to typical domains of fatty acid synthases [KS (ketoacyl synthase), AT (acyltransferase), KR (ketoreductase), DH

PAGE 22

22 (dehydratase), ER (enoyl reductase), ACP (acyl carrier protein), and TE (thioesterase)]. Each module harbors a set of di stinct, non-iterative activities responsible for th e catalysis of one cycle of polyketide chain elongation. The bacterial type I polyketides wh ich resemble branched-chain fatty acids include large carboxylic compounds (e.g., deoxyerythronolide B; erythromycin A) (Cortes et al. 1990; Donadlo et al. 1991; Hutchinson 1999; Sta unton and Weissman 2001; Shen 2003). Bacterial type II PKSs are multienzyme complexes that carry a si ngle set of iterative activities. The type II bacteria polyketides usually contain two or more aromatic rings fused into polycyclic structures, such as tetracenomycin C, actinorhodin, and doxorubicin (Malpartida and Hopwood 1984; Motamedi and Hutchinson 1987 ; Staunton and Weissman 2001; Shen 2003). Bacterial type III PKSs are itera tive homodimeric enzymes that act iteratively and independently of ACP to synthesize aromatic polyketides, whic h are often monocyclic or bicyclic, such as chalcone and stilbene (Funa et al. 1999; Shen 2003). Fungal secondary metabolites are often synt hesized by defined biosynthetic pathways using various precursors such as shikimic aci d, tricarboxylic acid, fatty acid, polyketides, terpenoids, or amino acids (Keller et al. 2005). Fungal polyketides contain a diverse range of structures, including a wide range of pigments, mycotoxins, and phytotoxins such as naphthopyrone, aflatoxin (AF)/sterigmatocystin (ST), fumonisin, lovastatin, compactins, melanins, and cercosporin. Carbon skeletons of fungal polyketides are typically synthe sized by the fungal iterative type I PKSs that are composed of a single mu ltifunctional polypeptide with a set of active site domains similar to a module of b acterial type I PKSs, but they carry out biosynthetic reactions repeatedly (Shen 2003). Recently, the type III PKSs have been found in some filamentous fungi, such as Neurospora crassa and Aspergillus oryzae (Seshime et al. 2005; Funa et al. 2007).

PAGE 23

23 PKSs are structurally and functionally simila r to eukaryotic fattyacid synthases (FASs), both catalyzing sequential condensations betwee n ACP (acyl carrier protein)-linked acylthioesters, such as acetyl-CoA and malonyl-CoA (Fig. 1-5) via decarboxylation. However, fungal type I PKSs do not always process -keto reduction, dehydration, a nd enoyl reduction that are essential for the full processing of the -carbon in fatty acids. All fungal PKSs contain ketoacyl synthase (KS), acyltransferase (AT) and acyl carrier protei ns (ACP) domains for assembling polyketide backbone, whereas many of them, unlike FASs, lack ketoreductase (KR), dehydratase (DH) and enoyl reducta se (ER) domains (Fig. 1-5A). Similar to FASs, fungal PKSs iteratively add a two-carbon unit to polyketide chains. Generally, but not all, biosynthesis of fungal polyke tides, such as cercosporin, is initiated when acetyl and malonyl coenzyme A (CoA) are cova lently linked, as thioesters, to the 4phosphopantotheine of an acyl ca rrier (ACP) domain through the acyltransferase (AT) domain. Condensation via decarboxylation then occurs with another thioes ter intermediate that is attached to the ketoacyl CoA synthase (KS) domain. The KS domain is involved in both chain initiation and elongation. After c ondensation, some of -ketothioesters can be further modified by the action of other domains such as ketoreductase (KR), dehydratase (DH), or enoyl reductase (ER) domains if they are present. Further modifica tions may include cyclization, oxidation, hydration, and methylation. PKSs that are required for squalestatin biosynthesis in Phoma sp. and fusarin C production in Fusarium moniliforme and F. venenatum contain a methyltransferase (MT) domain that adds methyl groups to the -carbon of the thioester (Fig. 1-5B) (Hopwood and Sherman 1990; Bender et al. 1999; C ox et al. 2004; Song et al. 2004). Once the polyketide chains are completed, they will be released from the enzyme complex by the function of thioesterase (TE)/cyclase (CYC) domain that also catalyzes further ring

PAGE 24

24 closure. Further modification processes involving monoxygenases, dehydrogenases, esterases, Omethltransferase, reductase, and oxidase contri bute to a remarkable diversity of polyketidesecondary metabolites in nature. Gene Clusters Biosynthetic genes that are involved in the production of fungal sec ondary m etabolites are frequently coordinately regulated and tightly clustered in the ge nomes (Zhang et al. 2004). Such examples include the genes involved in the biosynthesis of penicillin by Penicillium spp. (Smith et al. 1990), cercosporin by Cercospora nicotianae (Chen et al. 2007), aflatoxin (AF)/sterigmatocystin (ST) by Aspergillus spp. (Yu et al. 2004), ergot alkaloids by Claviceps pupurea (Tudzynski et al. 1999), fumonisin by Gibberella moniliformis (Proctor et al. 2003), ochratoxin A by Penicillium nordicum (Karolewiez and Geisen 2005), aurofusarin by Fusarium graminearum (Malz et al. 2005), and melanin by Alternaria alternate (Kimura and Tsuge 1993). Regulation of the clustered gene s is often governed by a pathwayspecific regulator and also influenced by many global regula tory factors which usually respond to various environmental cues, such as carbon/nitrogen sources, light, and pH. The gene encoding a pathway-specific transcription factor is often embedded within th e clusters. It is curre ntly unclear why fungal genes that are responsible for secondary meta bolite biosynthesis tend to be clustered. The clustering of genes in fungi may evolve vertica lly through meiotic or mitotic processes due to environmental selections or simply are obtained via horizontal gene transfer from prokaryotes (Rosewich and Kistler 2000; re viewed by Walton 2000). Horizontal transfer has been proposed to be a stable transfer of genetic material between microorganisms (R osewich and Kistler 2000). Horizontal transfer via assorted processes, such as conjugation, transforma tion, or transduction in bacteria is very common. However, the mechan isms involved in horizontal gene transfer in

PAGE 25

25 eukaryotes are largely unknown, and no direct ev idence is available to explain how horizontal transfer occurs in euka ryotes including fungi. Research Overview The m ajor goal of this research is to dete rmine the function of el sinochromes produced by Elsino fawcettii Elsinochromes are structurally similar to many photosensitizing perylenequinones, which has led to specula tion that elsinochromes may function as photosenitizers and are required for fungal virulen ce during plant-pathogen interactions. In this study, biochemical, molecular, and genetic appr oaches were employed to investigate the virulence determents that are required for Elsino fawcettii to invade citrus. Particular emphasizes was placed on the elsinochromes produced by E. fawcettii. Protocols for extraction and quantification of elsinochromes were established and the toxicity of elsinochromes to plant cells was determined to occur through generati on of reactive oxygen species, primarily singlet oxygen and superoxide (Chapter 2). Environmental stimu li affecting production of elsinochromes in culture was also investigated (Chapter 3). Molecular and genetic approaches were employed to conclusively determine the role of elsinochromes in fungal pathogenesis and lesion development by cloning and disruption of an EfPKS1 gene, encoding a fungal type I polyketide synthase in E. fawcettii (Chapter 4). Chro mosome walking and sequence analysis beyond the EfPKS1 gene allowed identificati on of additional genes whos e products might also be required for elsinochrome bios ynthesis and regulation, indicating that some of the genes involved in elsinochrome biosynthesis are cluste red in the genome of E. fawcettii (Chapter 5). Targeted disruption of a TSF1 gene encoding a putative transcri ption regulator generated fungal mutants that failed to accumulate any measur able elsinochromes and displayed reduced expression of the genes including EfPKS1 in the cluster (Chapter 5). A survey of 52 isolates of E. fawcettii obtained from citrus-growing areas in Florida revealed variations in fungal

PAGE 26

26 pathogenicity to rough lemon, grapefruit, and sour orange and elsi nochrome production among isolates. DNA polymorphism analyses identified several E. fawcettii variants or pathotypes that were not previously recognized in Florida (Chapter 6).

PAGE 27

27 Figure 1-1. Symptoms of citrus scab caused by the pathogenic fungus, Elsino fawcettii. Warty and scabby blister-shaped growths are produ ced on fruit of Murcutt (A) and Temple (B). C) The infected grapefruit shows the flatter symptoms. D) The infected tangerine leaf is covered with scabby and cork y pustules. (Courtesy L. W. Timmer)

PAGE 28

28 Figure 1-2. Life cycle of Elsino fawcettii the causal agent of citrus scab (Whiteside 1988; Timmer et al. 2000).

PAGE 29

29 Figure 1-3. Structure of elsinochromes with various side-groups (R) (redrawn based on the work of Weiss et al. 1987).

PAGE 30

30 Figure 1-4. Proposed model for the formation of activated oxygen speci es by photosensitizers. The ground-state photosensitizers (0S) absorb light energy, and are converted to the excited singlet (1S) and then long-lived triplet (3S) state. The activated sensitizers may react with oxygen molecules via electron transfers in th e presence of a reducing substrate (R) to yield the radical forms of oxygen species, such as superoxide (O2 -), hydrogen peroxide (H2O2), or the hydroxyl radical (OH) (type I reaction). Alternatively, triplet sensiti zers may react directly with oxygen by an energy transfer reaction to produce non-radical singlet oxygen (1O2) (type II reaction) (Daub and Ehrenshaft 2000).

PAGE 31

31 Figure 1-5. Biosynthesis of fatty acid and polyketide in fungi. A) Conserved domains found in the fungal polyketide synthase (PKS). F ungal type I PKSs produce a single, large polypeptide with multifunctional domains. Formation of the polyketide backbone requires ketoacyl CoA synthase (KS), acyltra nsferase (AT), and acyl carrier (ACP) domains. Other domains (such as dehydrat ase (DH), methyltransferase (MT), enoyl reductase (ER), ketoreductase (KR)) in brack ets are not essential for all fungal PKSs. B) An overall scheme for fatty acid synthe sis and polyketide bios ynthesis. In fatty acid synthesis, acetyl-CoA and malonyl-C oA are converted into acetyl-ACP and malonyl-ACP, respectively, by acetyl and mal onyl transacylase. Fatty acid synthase (FAS) subsequently condenses the two pr ecursors, via a cycle of reduction, and dehydration in the keto group. Biosynthesis of polyketide in fungi is somewhat similar to fatty acid. Polyketide synthase (PKS), resembling FAS, is responsible for condensation of precursors. The major diffe rence between FAS and PKS is that in addition to acetyl-CoA and malonyl-CoA, PK S may use different substrates as the starter and extender groups. Furthermore, PKSs produce diverse products based on the extent of reduction. The pathways, indicated by the letters (k, n, e, and a), represent various possibilitie s to yield keto, hydroxyl, enoyl or alkyl group into the growing polyketide chain after each condensation step. The carbon atoms of malonate and acetate contributing to polyketide chain are indicated by numerals. The carbon of malonate that is eliminated as CO2 is indicated by asterisks. The abbreviations: KS, ketoacyl CoA synthase; AT, acy ltransferase; DH, dehydrase; MT, methyltransferase; ER, enoyl reductase; KR, ketoreductase; ACP, acyl carrier protein; CYC, cyclase; TE, thioesterase; PT, palmityl transferase. (T his figure is redrawn from the work of Hopwood and Sherman 1990; Bender et al. 1999).

PAGE 32

32 CHAPTER 2 CELLULAR TOXICITY OF ELSINOCHR OM E PHYTOTOXINS PRODUCED BY Elsino fawcettii Elsinochrome pigments (ESCs) were extracted from mycelia of cultured Elsino fawcettii by acetone and tested for cellular toxicity in this chapter. Thin-layer chromatography (TLC) analysis was used to separate and identify at leas t five different derivati ves of ESCs. A spectrum scanning analysis of the crude extract of ESCs as well as the five distinct bands recovered from TLC plates revealed an identical absorbance spectrum, showing a major absorbance at 460 nm with two minor peaks at 530 and 570 nm. Chemi cal analyses revealed that the pigments extracted from E. fawcettii cultures contain phenolic quinines, resembling ESC phytotoxins that have been characterized in other Elsino spp. Upon irradiation with light, ESCs rapidly killed suspension-cultured citrus and tobacco cells. Th e toxicity was decrease d by adding the singlet oxygen (1O2) quenchers, bixin (carotenoid carboxylic acid), DABCO (1, 4-diazabicyco octane), the ascorbate, or reduced glutathione. Application of ESCs onto rough lemon leaves induced necrotic lesions, whereas lesion development wa s inhibited by the additi on of bixin, DABCO, or ascorbate, but not -tocopherol. Incubation of rough lemon leaf discs with ESCs in the light resulted in a steady increase of electrolyte l eakage. Similar with tw o photosensitizing compounds, hematoporphyrin and cercosporin, the accumulation of 1O2 by ESCs after irradiation was indicated by successful detection of the cholesterol oxidation product, 5 -hydroperoxide. Addition of a potent quencher, -carotene, prevented 5 -hydroperoxide production. ESCs generated superoxide ions (O2 -), whereas accumulation of O2 was blocked by addition of the superoxide dismutase, a scavenger of O2 -, but not the 1O2-quencher, DABCO. These experiments indicated that ESCs functi on as photosensitizing compounds that produce 1O2 and O2 -, and exert toxicity to plant cells.

PAGE 33

33 Introduction Elsino fawcettii Bitancourt & Jenkins is the cau sal agent of citrus scab. This disease is widely distributed, occurring in many citrus growing areas where rainfall conditions are conducive for infection. Conidia (asexual spores) are produced from the imperfect stage of the fungus, Sphaceloma fawcettii Jenkins, and serve as the primary source for inoculation in the field (Hyun et al. 2001). A large number of Elsino species are able to produce red pigments, named elsinochromes (ESCs) (Meille et al. 1989). The structures of ESCs have been well established (Weiss et al. 1957; Weiss et al. 1965; Meille et al. 1989). ESCs contain at least f our derivatives, A, B, C and D, differing in side groups. Those derivativ es all have a basic 4,9-dihydroxyperylene-3,10quinone chromophore similar to severa l perylenequinone compounds grouped as photosensitizers based on their ability to sensit ize cells to visible li ght and produce reactive oxygen species (ROS) (Yamazaki et al. 1975; Da ub 1982a). Light and oxygen are absolutely required for the photodynamic function and toxi city of these com pounds. Photosensitizing compounds absorb light energy and c onvert to a stable electronically excited state (triplet state) which in turn reacts with oxygen to produce toxic reactive oxygen species (ROS) such as superoxides (O2 -), hydrogen peroxide (H2O2), hydroxyl radical (OH), and/or singlet oxygen (1O2) (Dobrowolski and Foote 1983; Gi rotti 1990). In the Type I re action, the activ ated triplet photosensitizers can react with oxygen molecules directly by transferri ng a hydrogen atom or electron from reducing substrates (such as NADPH, ascorbate, and L-cysteine), resulting in reduced oxygen species including superoxides (O2 -) (Girotti 1990). In th e Type II reaction, the activated photosensitizer s react with oxygen molecules by an energy-transfer process, producing electronically reactive singlet oxygen (1O2) (Spikes 1989).

PAGE 34

34 Both 1O2 and O2 are toxic to cells, causing the oxida tion of various biological components including fatty acids, membranes, proteins/e nzymes, sugars, and nucleic acids, and often resulting in cell death (revie wed by Daub et al. 2005). Many of the perylenequinone pigments produced by fungi have been shown: 1) to be t oxic to mice, bacteria, and many fungi, 2) to be cytotoxic to animal tumors, 3) to be potent antiv iral agents, and 4) to in activate protein kinase C (Tamaoki and Nakano 1990; Hudson and Towers 1991; Diwu 1995; Hudson et al. 1997). Except for cercosporin produced by many members of the fungal genus Cercospora (Callahan et al. 1999; Choquer et al. 2005; 2007; Chen et al. 2007; Dekkers et al. 2007; Ch en et al. 2007), none of the perylenequinones of fungal origin have been demonstrated to act as a crucial factor in plant diseases caused by the producing pathogen. Many E. fawcettii isolates collected from Florida citr us growing areas produce red/orange pigments in culture (see details in Chapter 6). Ho wever, the identity of these pigments remains unknown. The aim of this study is first to is olate and characterize the pigments from E. fawcettii This chapter describes methodology for isolation and analysis of the extracted pigments and reports their physical and chemical properties as ESC phytotoxins that have been described elsewhere by Weiss and his colleagues (1987). In addition, the extracted ES C-like pigments from one of the E. fawcettii isolates are demonstrated to be toxic to host and no n-host plant cells. Evidence is also presented for function of ESCs as photosensitizing agen ts in culture and in planta by producing toxic reactiv e oxygen species, mainly 1O2 and O2 -. Materials and Methods Biological Materials a nd Cultural Conditions E fawcettii Bitancourt & Jenkins (anam orph: Sphaceloma fawcettii Jenkins) CAL WH-1 isolate used in this study was single-conidium isolate fr om scab affected calamondin ( Citrus madurensis Lour) fruit in Florida an d was kindly provided by L. W. Timmer (University of

PAGE 35

35 Florida, Citrus Research and Education Center Lake Alfred, FL). The fungus was grown on a sterilized filter paper, and stored at -20 C fo r long-term storage. Fungal cultures were routinely maintained on potato dextrose agar (PDA, Di fco, Becton, Dickinson and Company, Sparks, MD, USA). For toxin production, fungal mycelia were mi nced with a sterile blender, spread on PDA and incubated under continuous fluor escent light for 5 days as pr eviously described (Liao and Chung 2008a). A cell suspension of tobacco ( Nicotiana tabacum cv. Xanthi) was kindly provided by D. J. Lewandowski (Ohio State University, Columbus, OH, USA) and maintained in a Murashige and Skoog medium (Murashige and Skoog 1962) with ge ntle agitation under a daily regime of 16-h light and 8-h dark. Plant cells were subcultured weekly in a fr eshly prepared medium for toxicity assays. For protoplast isolation, 4day-old tobacco cells were harv ested and digested with cellwall degrading enzymes (a mixture of 1.5 % cellu lase and 0.15 % pectolyase) as described by Lewandowski and Dawson (1998). Sweet orange ( Citrus sinensis (L.) Osbeck) suspension cells, kindly provided by J. W. Grosser (University of Florida, CREC, Lake Alfred, FL, USA), were maintained in a Murashige and Tucker medium (1969). Citrus protoplasts were prepared by incubating with 10 % of cell wa ll degrading enzyme complex (S igma-Aldrich, St. Louis, MO) for 2 h as described by Grosser et al. (1988). Rough lemon ( Citrus jambhiri Lush) trees were maintained in greenhouse and rapidly expanding immature leaves approx. 13-20 mm length and 4-7 mm wide, were harvested for toxicity assays. Isolation and Analysis of the Red/Orange Pigments The orange/red pigm ents secreted in culture were extracted twice from dried agar medium bearing fungal mycelia with acetone for 16 h. Organic solvent was combined and evaporated with a Model R110 of Rotavapor (Brinkma nn, Buchi, Switzerland). For thin-layer chromatography (TLC) analysis, the pigments we re dissolved in acet one, spotted onto TLC

PAGE 36

36 plates coated with a 60 F254 fluorescent silica ge l (5 x 20 cm, Selecto Scientific, Suwanee, GA, USA), and separated with a solvent system containing chloroform and et hyl acetate (1:1, v:v). The crude extracts separated by TLC were ex amined by a hand-held long wavelength UV lamp (UVP, San Gabriel, CA, USA). After separation, the pigments showing distinct bands were scraped from the TLC plate, dissolved in aceto ne, and separated from silica gel by low-speed centrifugation. The acetone was dried and the amount s of ESCs recovered were determined by weight. The pigments dissolved in acetone we re examined by spectrophotometry at absorbance between 400 and 650 nm. Cercosporin was purified from cultures of Cercospora nicotianae in separate studies (Choquer et al. 2005; Chen et al. 2007). The extracted ESC toxins were directly mixed with plant cells for toxicity assays. Un less otherwise indicated, all chemicals were purchased from Sigma-Aldric h (St. Louis, MO, USA). Toxicity Assays to Plant Cells Citrus or tob acco suspension cells or protoplasts at density 1 x 106 mL-1 were mixed with various concentrations of ESCs (dissolved in acetone) with or without singlet oxygen (1O2) quenchers, and placed on the top of 1 % agarose (in a 35 x 10 mm Petri dish). Cell cultures were illuminated with fluorescent light s at an intensity of 3.5 J m-2 s-1 at room temperature (~25 C) for citrus cells or at 32 C for tobacco cells. Light intensity was determined by a Dual-Display light meter (Control Company, Friendswood, TX, USA). Dark-grown cultures were wrapped in aluminum foil and incubated in the same conditi ons. Cells were examined over time by staining with 1 % Evans blue (Taylor and West, 1980). D ead cells were stained blue as they cannot exclude Evans blue, whereas live cells remained clear. Cell viability was determined with the aid of a hemocytometer using a microscope at x100 magnification. The percentage of cell viability was calculated by the number of live cells divided by the total number of cells

PAGE 37

37 examined. Control cultures were untreated or cells treated with equal volumes of acetone and/or other solvents (final concen tration < 1%) as appropriate. The toxicity of ESCs on host plants was determined on detached rough lemon leaves (4-7 days after emergence). ESCs (1 mM, cercosporin equivalent) with or w ithout antioxidants were applied onto the surface of rough lemon leaves and incubated in a moist chamber under fluorescent light (3.5 J m-2 s-1), and monitored daily for deve lopment of necr otic lesions. Antioxidants used in this study includ e: bixin (carotenoid carboxylic acid), -carotene, DABCO (1,4-diazabicyco octane), -tocopherol (vitamin E) reduced glutathione, L-cysteine, and (+)sodium L-ascorbate (vitamin C). Bixin, -carotene, and -tocopherol were dissolved in 95 % ethanol and others were dissolved in water to make a stock solution. Detection of Singlet Oxyge n and Superoxide Ions Production of 1O2 by ESCs upon irradiation was determined by their ability to oxidize cholesterol by the protocol of Daub and Hangarter (1983) with modifications. The 1O2generating photosensitizers, hematoporphyrin an d cercosporin, were used as the positive controls. Photosensitizing compounds (8 mg each) in 20 mL pyridine were mixed with cholesterol (200 mg), and irradiated under a fluorescent light at inte nsity of 2.2 joules m-2 s-1 with gentle bubbling for 5 h. After solvent was removed, the oxidized products were suspended in 20 mL of hot methanol, passed through a filte r to remove precipitation after cooling, and analyzed by TLC with a solvent system contai ning hexane-isopropanol (9 :1 or 24:1, v:v). The oxidized products of cholesterol were visuali zed as bands after stai ning with a chromogenic reagent, N, N-dimethylp-phenylenediamine (1 %) dissolved in methanol-H2O-glacial acetic acid (5:5:0.1, v/v/v) (Smith and Hill 1972; Smith et al. 1973). The cholesterol 5 -hydroperoxide standard was prepared by photo-oxidation wi th hematoporphyrin as described by Ramm and Caspi (1969).

PAGE 38

38 Photochemical reduction of nitrotetrazolium blue chloride (NTB) was used to determine O2 production by ESCs (Daub and Hangarter 1983). Reactions were carried out in a solution containing 5 mM 3-(N-morpholino) propanesulf onic acid (MOPS), 10 mM methionine (as a reducing agent), 2.5 mM NBT, 2 M riboflavin, 10 M of ESCs or cercosporin, and superoxide dismutase (SOD, 1 mg mL-1) or DABCO (1 mM). Nitrotetrazoliu m blue chloride was added into the buffer before the addition of photosensitizers and the reaction mixture was irradiated under a constant light at intensity of 4.7 J m-2 s-1. Superoxide production, as shown the increase absorbance at 560 nm as a result of the reductio n of NBT, was measured spectrophotometrically (Beruchamp and Fridovich 1971). Determination of Electrolyte Leakage Electrolyte leakage was m easured by the me thod of Alferez et al. (2006) with some modifications. Leaf discs (0.5 cm in diameter) were cut from 4-day-old rough lemon leaves, placed in a 96-well microtiter pl ate, and incubated with ESCs (2 mM; dissolved in 7 % acetone) under constant fluorescent light (3.5 J m-2 s-1) or in complete darkness at room temperature. Control leaf discs were treated with equal amounts of acetone or deionizer water as appropriate. Leaf discs (10) were randomly collected at 12-h intervals, soaked in wa ter for an additional 1 h on a rotary shaker (60 r.p.m.), and measured fo r initial conductivity (I C). Leaf samples were immediately frozen in liquid nitrogen and kept at -80 C for at least 12 h to obtain the remain conductivity of leaves. Total conduct ivity (TC) of leaves was dete rmined after leaf discs were thawed at room temperature for 10-15 min. Conductivity was determined by a Model 115 Orion conductivity meter equipped with a Pentrode probe (Thermo Electron, Boston, MA, USA). Electrolyte leakage, expressed as percentage of total conductivity, wa s calculated by dividing initial conductivity (IC) by total conductivity (TC).

PAGE 39

39 Statistical Analysis Data were a nalyzed by ANOVA using SAS (PRO CGLM) for PC (SAS Institute Inc., Cary, N.C.). When differences were significant (P < 0.05), individual treatment means were separated using Ducans Multiple Range Test (P = 0.05). Results Isolation and Characterization of ESCs from Elsino faw cettii Acetone extracts from cultures of an E. fawcettii isolate produced five distinct bands after TLC separation (Fig. 2-1). Bands 1, 2, and 3 [in order of decreasing Rf value (the ratio of the distance migrated by a substance compared with the solvent front)] appeared to be major compounds of the extracts based on band width, wh ereas bands 4 and 5 appeared to be minor compounds. Spectrophotometric scanni ng revealed that the acetone extracted pigments displayed a strong absorbance at 460 nm with two minor peaks at 530 and 570 nm (Fig. 2-2A) which resembles the ESCs previously isolated from several Elsino species (Weiss et al. 1957; 1965). Further analysis indicated that all five bands, recovered from TLC plates had similar absorption spectra, also displaying three major absorption pe aks at 460, 530 and 570 nm (Fig. 2-2B, C, D, E, and F). In addition, the red/orange pigments from E. fawcettii had several typical characteristics of ESCs containing phenolic quinines. Similar to ESCs described by Wei ss et al. (1957; 1987), the extracted red/orange pigments became bri ght green when dissolv ed in aqueous KOH or sodium carbonate (Fig. 2-3). Further, the green pigment reverted to pink when alkaline sodium dithionite was added (Fig. 2-3A). The green pigment changed to a distinct leuco compound, showing yellow/greenish fluorescence when treated with zinc dust (Fig. 2-3B). These results indicated that the red/orange pigments extracted from E. fawcettii were ESCs.

PAGE 40

40 Toxicity of ESCs from E. fawcettii to Host and Non-Host Cells The toxicity of ESCs was assayed using citr us protoplasts. As shown in Fig. 2-4A, ESCs exhibited dosage-response toxicities with respect to citrus protoplas ts. At 10 M, no viable citrus cells remained after 5 h in the light. At 5 M, there was a decrease in the rate of cell death throughout the assay period. By contra st, untreated citrus cells or cel ls treated with acetone alone remained viable throughout the assay period. ES Cs did not produce a toxic reaction when cells were incubated in complete darkness. The toxic effect of ESCs was also evaluate d with suspension-cultured tobacco cells and protoplasts. Similar to cercospor in produced by a tobacco pathogen, C. nicotianae (Daub 1982a), ESCs caused rapid death of tobacco protoplasts (F ig. 2-4B) or cultured suspension cells (Fig. 24C), in a dose-response manner within 1 h after irradiation w ith light. Untreated or acetonetreated tobacco cells in the light or cells inc ubated in the darkness remained viable for the duration of the experiment. Antioxidants Reduce ESC Toxicity The toxicity of ESCs was alleviated to various degrees by adding 400 M bixin (Fig. 25A), 2 m M DABCO or 4 mM of ascorbate, or reduced glutathione (Fig. 2-5B-D). Compared with bixin, DABCO, and ascorbate, reduced glutathione had less e ffect on the protection against toxicity of ESCs, by showing an extended lag period. Application of an tioxidants with lower concentrations had little or no effect on reduction of toxicity by ESCs (data not shown). Addition of -tocopherol or L-cysteine (4 mM each) appeared to enhance elsinochrome phytotoxicity as the duration of incubation in creased (Fig. 2-5E and F). Similar to citrus protoplasts, the cellular toxi city of ESCs to suspension-cultured tobacco cells was alleviated by the addition of antioxi dants such as bixin, DABCO, ascorbate, and tocopherol (Fig. 2-6A-D). In the presence of bi xin or DABCO, over 40 % of tobacco cells were

PAGE 41

41 viable after incubation with ESCs for 24 h in the light. Both ascorbate and -tocopherol significantly delayed photo-induced cell death (by at least 18 h), yet neither compound was able to protect cell death beyond 24 h. Untreated tobacco cells incubated in the dark were healthy for the duration of the experiment (The inset of Fig. 2-4C). ESCs are Toxic to Citrus Leaves To determ ine if ESCs were toxic to the host, the crude extracts were applied onto detached rough lemon leaves. After incubated for 10 days the ESC-treated spots on rough lemon leaves developed noticeable necrosis in the light (Fig. 2-7). Leaves treat ed with the solvent alone didnt developed necrosis (Fig. 2-7). Mi xture of ESCs with bixin, DABCO or ascorbate on the leaves prevented development of necrosis on detached rough lemon leaves (Fig. 2-7A-C). Bixin showed a light brown color when dissolved in 95 % ethanol. Application of -tocopherol alone, however, resulted in a brownish necrotic spot and failed to alleviate the toxicity of ESCs (Fig. 2-7D). Application of superoxide dismutase (SOD) or hyperoxidase also had effects on protection against the toxicity of ESCs on rough lemon leaves (Fig. 2-8). Production of Reactive Oxygen Species by ESCs Production of O2 by ESCs was evaluated with a supe roxide scavenging assay (Beruchamp and Fridovich 1971; Daub and Hangarter 1983) base d on its ability to reduce nitrotetrazolium blue chloride (NTB), and comp ared with the levels of O2 induced by other photosensitizing compounds such as cercosporin and riboflavin known to generate O2 (Oster et al. 1962; Daub and Hangarter 1983). In the absence of NTB, photosensitizers dissolved in the MOPS buffer produced lower absorbance values at 560 nm (Fi g. 2-9A; Fig. A-1), representing the reaction baseline. Mixing NTB with the crude extracts of ESCs significantly elevated absorbance values because of reduction of NTB (Fig. 2-9A). However, the reactions were repressed in the presence of O2 scavenging enzyme, SOD, indicating the production of superoxide. Compared with

PAGE 42

42 cercosporin and riboflavin, ESCs app eared to induce high levels of O2 after irradiation (Fig. 29B). Addition of SOD, but not DABCO, drastically reduced the accumulation of superoxides from the actions of ESCs (Fig. 2-9C). Production of cholesterol 5 -hydroperoxide from cholestero l is one of the best and simplest ways to test for the presence of 1O2 (Kulig and Smith 1973). To assess the production of 1O2 in vitro the extracted ESCs were mixed with cholesterol and illuminated. The resulting products were chromatographed in two different solvent systems and detected as distinct bands after staining with a chromogenic reagent, N, N-dimethylp-phenylenediamine. Reaction of cholesterol 5 -hydroperoxide with dimethyl-p-phenylenediamine resulted in pink pigments on the TLC plate which turned dark green 2h af ter staining. As with hematoporphyrin (positive control) and cercosporin photosensiti zers, ESCs converted cholesterol by 1O2-induced photodynamic oxidation into the 5 -hydroperoxides of choles terol in the light ( Rf 0.4 and 0.1 in Fig. 2-10A and B, respectively). No visible band was detected from the untreated cholesterol. Irradiation of cholesterol with UV light (240 nm) for 24h yielded several bands on TLC, but no cholesterol 5 -hydroperoxide was detected (Fig. 2-10C). A faint band with slightly faster migration of unknown identity was detected in products generated by cercosporin and ESCs. The cholesterol 5 -hydroperoxides and the faint ba nds were undetectable when -carotene, a potent 1O2 quencher, was added to the reaction mixture. Electrolyte Leakage Induced by ESCs When incubated with illum ination for 24 h, th e extracted ESCs induced an increase in electrolyte leakage of rough lem on leaf discs (Fig. 2-11A). Leaf discs treated with water or solvent alone, or leaf discs inc ubated in the dark showed relati vely minor electrolyte leakage. Electrolyte leakage induced by ESCs in the light steadily increased over time, whereas leakage of the controls remained low (Fig. 2-11B).

PAGE 43

43 Discussion Elsino fawcettii isolates obtained in Fl orida citrus-growing areas produced red/orange pigm ents in culture similar to ESCs produced by many Elsino spp. (Weiss et al. 1957; 1987), and had a visible absorption spectr a characteristic of ESCs. In a ddition, the orange/red pigments had other typical characteristics of ESCs, such as forming a distinct yellow/greenish fluorescence leuco compound when reacted with zinc dust in alkaline conditions (Weiss et al. 1957; 1987), sparing solubility in water, but readily soluble in several organic solvents, such as acetyl acetate and acetone. Thin-layer chromatography analysis of the acetone-extracted pigments revealed significant variations of the pigments produced in culture. The results strongly suggest that these pigments were ESC analogs contai ning a phenolic quinine chromophore. Compared with studies of ch emical characterization, little is known about the biological function of ESCs. The photodynamic action of ES Cs leading to cellula r toxicity has been predicted based on their structural similar ity to many photosensitizing compounds such as cercosporin, hypericin, or hypocrellin A (Daub et al 2005), yet this has never been demonstrated experimentally. In the present study evidence is presented for ESCs toxicity to plant cells by functioning as photosensitizers th at generate reactive oxygen sp ecies (ROS). Since citrus suspension cells aggregated to form massive clumps in culture, the t oxicity assays were performed only with citrus pr otoplasts. ESCs extracted from E. fawcettii rapidly killed citrus protoplasts in a dose-dependent ma nner and only when cells were e xposed to the light, consistent with the mode of action for other photosen sitizing compounds (Yamazaki et al. 1975; Daub 1982a; Spikes 1989). The cellular toxicity of ESCs was atte nuated considerably when antioxidant compounds were added into the culture, implying the involvement of reactive oxygen species, particularly O2 and/or 1O2. Carotenoids are efficient 1O2 quenchers in the biological systems (Krinksy 1979). Bixin, a carote noid carboxylic acid, has a lower molecular

PAGE 44

44 weight than -carotene and is more polar owing mainly to the presence of the carboxylic acid group (Daub 1982a). Both bixin and -carotene have the same isopr enoid chain length but bixin is more soluble in aqueous solutions. Carotenoids quench 1O2 via energy transfer mechanisms (Foote and Denny 1968; Foote et al. 1970) and are slowly consumed in the reaction. DABCO (1,4-Diazabicyclo octane) also is an effective 1O2 quencher. Unlike bixin, DABCO quenches 1O2 by a chemical reaction, and is qui ckly consumed (Oannes and Wilson 1968; Daub 1982a). These contrasting properties may account for why bixin provided a more persistent protection of citrus cells than DABCO (Figs 2-5 and 2-6). In addition, the red pigmented ESCs became bright green when dissolved in aqueous DABCO, indicating a direct interaction between DABCO and ESCs. Both bixin and DABCO have been shown to decrease the toxicity of cercosporin to tobacco cells (Daub 1982a). ESCs were also toxic to tobacco, a nonhost plant of E. fawcettii Similarly, addition of antioxidant s also provided some protection against the toxicity of ESCs, indicating a nonhost specificity of ESCs. The antioxidants bixin, DABCO and ascorbic acid but not -tocopherol decreased the toxic ity of ESCs in culture and provided some protection on detached rough lemon leaves. However, the concentrations required for protection in planta were far higher than those in culture likely owing to the poor penetration of antioxidants through the cuticle. Both ascorbic acid and the redu ced form of glutathione were also effective in protecting citrus cells against ESCs. By contrast, L-cysteine and -tocopherol had little or no effect on cellula r protection against ESCs in cu lture and on citrus leaves. Application of -tocopherol alone at a concentration of 500 mM on young rough lemon leaves induced necrosis. However, -tocopherol provided some levels of protection against the toxicity of ESCs to tobacco cells. -tocopherol, with a well-known abili ty to terminate radical chain oxidation by binding to cell membranes, has been often used in studies of nutritional or cell

PAGE 45

45 membrane functions (Tinberg and Barber 1970; Tappel 1972). Th e requirement of -tocopherol binding to membranes may contribute to its ineff ectiveness in cellular protection against ESCs for citrus protoplasts and leaf tissues. Photosensitizing compounds are able to generate reactive oxygen species upon activation by light (Yamazaki et al. 1975; Daub 1982a; Dobrow olski and Foote 1983; Spikes 1989; Girotti 1990). Results derived from this stud y on the toxic effect of ESCs in vitro and in vivo confirm that ESCs are damaging to citrus cells by the production of both O2 and 1O2. This study has demonstrated that antioxidants such as bi xin, DABCO, and others capable of quenching 1O2 provide substantial protection from the toxicity of ESCs in both cultured citrus and tobacco cells and on rough lemon leaves. Production of 1O2 by ESCs was confirmed by successful detection of the cholesterol. 5 -hydroperoxide that is solely produced through the oxidation of cholesterol by 1O2 (Kulig and Smith 1973), which is one of the best indications of 1O2 production versus production of O2 and other free radicals (Smith et al. 1973). Oxidation of cholesterol by O2 -, UV or other radicals often generates multiple products, mainly the 7 and 7 -hydroperoxides, but never produce the 5 -hydroperoxide (Smith et al. 1973). By contrast, the oxidizing reaction of 1O2 with cholesterol primarily produces the 5 -hydroperoxide. Addition of -carotene, an effective 1O2 quencher, completely prevented the production of the 5 -hydroperoxide by hematoporphyrin, cercosporin and ESCs. Therefor e, positive detection of the cholesterol 5 hydroperoxide indicates that ES Cs were able to generate 1O2 after exposure to light. Singlet oxygen is highly reactive and has been shown to be toxic to a wide range of cells (Foote and Denny 1968; Foote et al. 1970; Daub and Ehrensha ft 2000). The results strongly implicate the involvement of 1O2 in the toxicity of ESCs because 1O2 quenchers reduced cultured citrus cell mortality and prevented necrosis on host leaves.

PAGE 46

46 Production of O2 by ESCs was demonstrated by a supe roxide production assay used to determine SOD enzymatic activity with NTB as substrate (Beruchamp and Fridovich 1971; Daub and Hangarter 1983). It seemed that ESCs produced O2 more efficiently than cercosporin. Reduction of NTB induced by ESCs was inhibited by adding the O2 scavenging enzyme (SOD) but not the 1O2 quencher, providing evidence to support th at photodynamic reaction of ESCs also generates O2 -. The detection of O2 has important implication for involvement in ESC toxicity since O2 also is toxic in biological systems. To explore the potential toxic mechanisms of ESCs, electrolyte leakage of rough lemon leaf discs was measured after treatment with ESCs. Treatment with ESCs under light induced higher electrolyte leakage than water or solven t controls. The results suggested that ESCs damage cell membranes, likely by inducing lipid peroxidation as demonstrated in cercosporintreated tobacco tissues (Daub 1982b). Unlike the ra pidly (< 2 min) induced electrolyte leakage caused by cercosporin in tobacco, ESC-induced ion leakage was not observed until several hours after irradiation, indicating that the toxic activity on citrus me mbranes might not be direct. Alternatively, this slow response of electrolyte leakage might resu lt from the complexity of cell membranes of citrus or the structure of its cuticle. Disruption of cell membranes followed by nutrient release is beneficial to the invading pathogen. Therefore, ESCs may play a critical role in pathogenesis during fungal penetration and colonization.

PAGE 47

47 Figure 2-1. Thin-layer chromatography analysis of elsinochromes (ESCs) produced by Elsino fawcettii and compared to cercosporin (CR) extracted from a tobacco pathogen, Cercospora nicotianae. ESCs were extracted from agar plugs containing fungal mycelium with acetone, spotted onto a silica gel plate, and separated with chloroform and ethyl acetate, resulting in five distinct (red/orange) bands with Rf values (1-5).

PAGE 48

48 Figure 2-2. Absorption spectrum of the acetone crude extracts of ESCs (A), and individual bands, 1, 2, 3, 4 and 5, recovered from TLC pl ate (B, C, D, E, and F), showing three major peaks at 460, 530 and 570 nm. Solvent alone (acetone) and pure cercosporin (CR) (Sigma-Aldrich) were also used as controls (G and H).

PAGE 49

49 Figure 2-3. Chemical properties of phenolic qu inines of the acetone extracted ESCs. The red/orange pigments appear bright green in color when dissolved in aqueous KOH or sodium carbonate. A) The green color was changed to a pink color when alkaline sodium dithionite was added. B) The green color was changed to yellow/greenish fluorescence immediately after treated with zinc dust in acid ic conditions under UV light (365 nm). In all cases, acetone alone was used as a negative control.

PAGE 50

50 Figure 2-4. Reduction of live cells (%) of citrus protoplasts (A), tobacco protoplasts (B), or suspension-cultured tobacco cells (C) tr eated with elsinochrome (ESC) phytotoxins produced by Elsino fawcettii or Cercosporin (CR) toxi n extracted from a tobacco pathogen, Cercospora nicotianae and incubated under constant fluorescent light or in the darkness. Cell viability of citrus protopl asts in the darkness was determined only at 6 h after incubation (A). Insets indicate vi ability of plant cells incubated in the dark. Data represent the means of two different ex periments with at least three replicates. Vertical bars represent standard deviation.

PAGE 51

51 Figure 2-5. Cell viability (% live cells) of citrus prot oplasts after treatment with elsinochromes (ESCs) isolated from Elsino fawcettii with and without antioxidant compounds: A) 400 M bixin (carotenoid carboxylic acid) ; B) 2 mM DABCO (1,4-diazabicyco octane); C) 4 mM L-ascorbic acid; D) 4 mM re duced glutathione; E) 4 mM tocopherol; and F) 4 mM L-cysteine. Citrus protoplasts (1 x 106) were mixed with or without ESCs (5 M, cercosporin equiva lent) and antioxidants as indicated under constant fluorescent light. The cont rols were treated with acetone-H2O or acetone95% ethanol as appropriate. Data represent the means of two different experiments with at least three replicates. Vertical bars represent stan dard deviation. Open circles, control; closed circles, antioxidant; open triangles, ESCs; closed squares, ESCs + antioxidant.

PAGE 52

52 Figure 2-6. Cell viability (% live cells) in suspension-cultured tobacco cells by 1M elsinochromes (ESCs) with an tioxidants (400 M bixin (car otenoid carboxylic acid), 2 mM DABCO (1,4-diazabic yco octane), 4 mM of L-ascorbic acid, or -tocopherol). Tobacco cells (1 x 106) were treated with ESCs in the presence or absence of antioxidants, as indicated, and incubate d under constant fluorescent light. Data represent the means of two different expe riments with at least three replicates. Vertical bars represent standard deviati on. Open circles, control (1 L acetoneethanol); closed circles, an tioxidant; open triangles, ESCs; closed squares, ESCs + antioxidant.

PAGE 53

53 Figure 2-7. Development of necr otic lesions on detached rou gh lemon leaves after a 10-day application of 1 mM elsinochromes (ESCs) from Elsino fawcettii and prevention of necrosis by co-application of antioxidants, A) 100 mM bixin (carotenoid carboxylic acid), B) 300 mM of DABCO (1,4diazabicyco octane), C) 300 mM L-ascorbic acid, or D) 500 mM -tocopherol). Citrus leaves were treated with or without ESCs and antioxidants as indicated and incubated in a moist chamber under a constant fluorescent light. The mocks were treated wi th equal volume (3 L) of water, 95% ethanol, and/or acet one as appropriate.

PAGE 54

54 Figure 2-8. Development of necr otic lesions on detached rou gh lemon leaves 10 days after application of 100 M elsinochromes (ESCs) from Elsino fawcettii Co-application of ESCs and 100 M superoxide dismutase (SOD) or 100 g L-1 hyperoxidase prevents lesion formation induced by ESCs al one. Citrus leaves were treated with or without ESCs and superoxide dismutase and hyperoxidase as indicated and incubated in a moist chamber under a constant fluor escent light. The mocks were treated with equal volume (3 L) of water and/or acetone as appropriate.

PAGE 55

55 Figure 2-9. Superoxide production assays based on the reduction of nitrotetrazolium blue chloride (NBT) as substrate. A) Spectr ophotometric absorbance of elsinochromes (ESCs) alone (open bars) or ESCs treated with NBT with (hatched bars) or without (closed bars) superoxide dismutase (SOD) in the 3-( N -morpholino) propanesulfonic acid (MOPS) buffer at 560 nm. B) Accumulation of superoxide ions (O2 -) by photosensitizing compounds riboflavin (circles), cercosporin (square s) extracted from Cercospora nicotianae, and ESCs (triangles) extracted from cultures of Elsino fawcettii after irradiation with light The respective photosens itizers were dissolved in buffer and used as the blanks. C) S uppression of ESC-induced superoxide accumulation by addition of SOD but not DABCO (1,4-diazabicyco octane). Reactions were carried out in the MOPS buffer solution containing 2.5 mM NBT, 10 mM methionine, and 10 M of cercosporin or ESCs, or 2 M riboflavin, and/or SOD (1mg mL-1) or DABCO (1 mM), and absorbance at 560 nm ( A560) measured. Vertical bars represent standard deviation. Means fo llowed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 56

56 Figure 2-10. Oxidation of cholesterol by photos ensitizers: hematoporphyrin (HP), cercosporin (CR), and elsinochromes (ESCs) under light. Cholesterol (200 mg) was dissolved in pyridine, mixed with photosensitizers with or without -carotene, as indicated, and incubated for 5 h. The oxidized products were separated by thin-layer chromatography (TLC) with a hexane-isopropanol 9 : 1 (v : v) (A) or 24 : 1 (v : v) (B, C) solvent system. Cholesterol 5 -hydroperoxide ( Rf 0.4 or 0.1 in solvent A or B) formed distinct bands after staining with 1 % of N,N -dimethyl-p-phenylenediamine. Radiation of cholesterol to UV light fo r 24 h resulted in multiple products, but no cholesterol 5 -hydroperoxide (C). Untreated chol esterol (in chloroform) was not visible after staining with the chromogen (C).

PAGE 57

57 Figure 2-11. Leakage of electrolytes from illuminated rough lemon leaf discs treated with elsinochromes (ESCs). A) Light increased electrolyte leakage of citrus leaf discs treated with ESC compared with those treate d with water or acetone (S) alone at 24 h. B) Increasing electrolyte leakage of rough le mon leaf discs over time after treatment with ESCs in the light. Water, open circles; acetone, closed circ les; ESCs, triangles. Data represent the means of two different ex periments with five replicates. Vertical bars represent standard deviation. Means fo llowed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 58

58 CHAPTER 3 ENVIRONMENTAL FACTORS AFFECTING PRODUCTI ON OF ELSINOCHROMES BY Elsino fawcettii Elsinochromes (ESCs), light-activat ed phytotoxins, are produced by many Elsino isolates and are required fo r fungal virulence In this chapter, the effect s of environmental factors in relation to ESC accumulation are investigated. The e ffects of environmental signals such as light, pH, medium compositions, carbon and nitrogen sources, ions, and antioxidants on fungal radial growth and ESC production by E. fawcettii were evaluated. Light and media compositions influenced ESC production considerably. E. fawcettii produced the highest titers of ESCs on PDA compared to other media tested. Production of ESCs was stimulated when the fungus was grown in a medium with ample carbon sources or under nitrogen starvation stress. An increase in ESC production correlated with an increase in the ambient pH. A reduction in ESC production was observed when antioxidant agents such as cysteine, DABCO a nd glutathione, were exogenously amended into PDA. Ascorbate dram atically enhanced ESC production. Addition of ions such as CaCl2H2O, Ca(NO3)2H2O, CoCl2H2O, or LiCl decreased ESC production, whereas other ions tested markedly enhanced ESC production. Production of ESCs was also affected by the presence of multiple colonies a nd the distance between two colonies on the same agar plate, indicating that nutrient competition resulting in nitrogen depletion promoted ESC production. Introduction Elsino fawcettii the causal agen t of ci trus scab, produces elsinochromes (ESCs) (Liao and Chung 2008a). ESCs are phytotoxins produced by many species of Elsino (Weiss et al. 1987). ESCs have been investigated as a fungal virulence factor si nce ESCs produce toxic reactive oxygen species (ROS) (Liao and Chung 2008a; 2008b).

PAGE 59

59 Production and accumulation of secondary meta bolites by microbes are often regulated by a number of environmental and nut ritional factors. Phys ical parameters which affect production of secondary metabolites include light intensity, temperature, and pH. Nutritional factors such as carbon source and nitrogen source also affect production of secondary metabolites. Although significant progress has been made in identifyi ng the environmental fact ors for production of fungal secondary metabolites, little is known about their role in ESC production in E. fawcettii Light has been demonstrated to be required for ESC biosynthesis and toxicity (Liao and Chung 2008a; 2008b). ESCs were produced when the fungus was incubated under light and production was markedly suppressed in the dark. In addition, ESCs having structures similar to many photosensitizing compounds have been sh own to produce reactiv e oxygen species in a light-dependent manner (Daub et al. 2005; Liao and Chung 2008b). In Aspergillus species, production of sterigmatocystin and aflatoxin was regulated by carbon sources (Calvo et al. 2002). Nitrogen sources have diverse effects in re gulation of secondary metabolites. For example, sterigmatocystin and aflatoxin were produced in ammonium-based medi a (Keller et al. 1997; Morrice et al. 1998), whereas production of alternar iol (AOH) and alternariol monomethyl ether (AME) by Alternaria alternata (Orvehed et al. 1988) was inhi bited by nitrogen. Ambient pH has been reported to serve as a regulatory of pr oduction of many fungal seco ndary metabolites, such as aflatoxin, sterigmatocystin, and penicillin (C otty 1988; Shah et al. 1991; Keller et al. 1997). In Aspergillus spp., production of fungal secondary me tabolites was controlled by complex regulatory networks involved in the G-protein/c-AMP/ protein kinase signaling cascades in response to environmental f actors (Calvo et al. 2002). Antioxidants, such as butylated hydroxyaniso l (BHA) and prophy paraben (PP) have been shown to inhibit fungal gr owth and toxin production by Fusarium verticillioides and F.

PAGE 60

60 proliferatum (Reynoso et al. 2002; Farnochi et al. 2004) Further, phenolic antioxidants inhibit ochratoxin A and aflatoxin B production by Aspergillus species (Palumbo et al. 2007; Passone et al. 2005). Extrinsic ions are also known to affect toxi n production in fungi (Marsh et al. 1975; Cuero et al. 1988; Jackson et al. 1989). For example, Zn2+, Fe2+, and Cu2+ affect production of aflatoxins in Aspergillus flavus and zearalenone in Fusarium graminearum (Cuero et al. 2003; Cuero and Ouellet 2005). Normally, metal ions influence accumulation of fungal toxins via controlling expression of the genes whose products are required for toxin biosynthesis. In this study, environmental signals were demonstrated to have multiple effects on ESC production. For example, co-culturing multiple colonies of E. fawcettii on the same medium tends to trigger early production of ESCs and the distance between two colonies affects the timing of ESC production. Materials and Methods Fungal Strains, Maintenance, and Culture Conditions The origin o f Elsino fawcettii Bitancourt & Jenkins (anamorph: Sphaceloma fawcettii Jenkins) isolate CAL WH-1 and the EfPKS1 null mutants from this isolate used in this study have been previously described (Chapter 2; Liao and Chung 2008b). Fungi were grown on a sterilized filter paper, and stored at -20 C for long-term storage. The basal media used for fungal growth and toxin production included: potato dextrose agar (PDA, difco, Becton, Dickinson and Comp any, Sparks, MD), a complete medium (CM) containing 1 g Ca (NO3)H2O, 0.2g KH2PO4, 0.25g MgSO4H2O, 0.15g NaCl, 10g glucose, 1g each of yeast extract and casein hydrolysate, and 15g agar per liter (Jenns et al. 1989), and a minimal medium (MM) containing all components of CM but omitting yeast extract and casein hydrolysate. The pH of media was adjusted by 0.1 M phosphate buffer as described (You et al.

PAGE 61

61 2007). Glucose or sodium nitrate in CM medium was substituted with equal molarity of other appropriate carbon or nitrogen sources. To prepare fungal inoculum, the 5-day-ol d mycelium cultured on PDA under continuous fluorescence light at an intensity of 3.5 J m-2 s-1 was minced with a sterile blender and suspended in sterilized water. Hyphal suspension (3 L) was placed on the surface of the test medium (5 mL) in a 60 x 15 mm Petri dish and the plates were incubated under constant light at 25 C. The plates were wrapped with aluminum foil for the dark control and incubated under the same conditions. Fungal growth was determined by co lony diameter (millimeters, mm) 3 weeks after incubation and was measured prior to ESC extraction. ESC Purification and Quantification For ESC purification and quantification, four 7-mm diam eter agar plugs cut from mycelial cultures were extracted with 5N KOH in the dark for 16 hr, and the extracts were measured at 480 nm by a model Genesys 5 spectrophotometer (S pectromic Instruments, Rochester, NY). The ESC concentration was calculated using a mo lar extinction coefficient of 23,300 (Yamazaki and Ogawa 1972) and was reported as nano moles per agar plug. Statistical Analysis Data were a nalyzed by ANOVA using SAS (PRO CGLM) for PC (SAS Institute Inc., Cary, N.C.). When differences were significant (P < 0.05), individual treatment means were separated using Ducans Multiple Range Test (P = 0.05). Da ta are the means of two different experiments with at least three replicates. Preparation of Chemicals Com pounds CaCl2H2O, Ca(NH3)2H2O, LiCl, MgCl2H2O, NaCl and KCl were purchased from Fisher Scientific (Fair Lawn, NJ.) while all other chemicals used in this study were purchased from Sigma (St. Louis, Mo.). Chem icals were dissolved in water to prepare stock

PAGE 62

62 solutions as appropriate. All aqueous solutions we re sterilized by filtration. All the chemical stock solutions were added to solid media. An equal volume of sterile distilled water was added as the mock control. Results and Discussion Fungal Growth and ESC Production in Response to Light, Media Components and pH As assessed on PDA, E. fawcettii produced high amounts of ESCs under constant light (Fig. 3-1A). Accum ulation of ESCs significantly decreased (P < 0.01%) when the test fungus was grown under the conditions alternating in a cycle of 12-h light and 12-h dark. ESC production was almost completely suppresse d when the fungus grown under darkness. E. fawcettii grew slightly faster under light but th ere was no significant difference between treatments. The results indicated that light is a critical factor for ESC pr oduction. Under constant light, production of ESCs by the E. fawcettii isolate was highest when the fungus was grown on PDA and significantly reduced when grown on CM or MM (Fig. 3-1B). Fungal growth was also concomitantly affected. Minimum medium (MM) has of the same ingredients in CM, except yeast extract and casein hydrolysat e. MM and CM supported equivale nt fungal radial growth, but the fungus produced much less ESCs on CM than on MM, indicating that yeast extract and/or casein hydrolysate had a nega tive effect on ESC production. Effects of pH for fungal growth and ESC produc tion were also tested (Fig. 3-2). A close correlation between ESC production and pH was obs erved, i.e., accumulation of ESCs increased as the pH of medium was elevated (Fig. 3-2). Thus, E. fawcettii alkaline conditions were most favorable for production of ESCs By contrast, fungal radial gr owth was slightly greater under acidic pH.

PAGE 63

63 Carbon Sources on Fungal Grow th and ESC Production As tested on CM, production of ESCs by E. fawcettii was enhanced when glucose was used as a sole carbon source, in a concentration-dependent manner (Fig. 3-3). Substitution of glucose with sucrose as the sole carbon source significantly enhanced ESC production, whereas replacement of glucose with mannitol non-signif icantly reduced ESC production. Apparently, the test fungus preferred higher amounts of carbon sour ces for radial growth and utilized the four carbon sources equally well. Carbon sources generally have diverse eff ects on fungal development and production of secondary metabolites. Production of aflatoxin by Aspergillus spp. was greatly enhanced when fungi were cultured in the glucose-containing medium, but not the mannitol-containing medium (Calvo et al. 2002). However, E. fawcettii can utilize glucose or mannitol efficiently for ESC production. Given that ESC is synthesized by a polyketide pathway, likely by condensation of acetyl-CoA and malonyl-CoA (Liao and Chung 2008b), one would expect that high concentration of carbon sources en hances the acetyl-CoA pool via glycolysis, and thus, boost the ESC biosynthesis. Effects of Inorganic and Organic Nitrogen on Fungal Grow th and ESC Production To determine if ESC production is affected by nitrogen sources, sodium nitrate in MM was substituted with ammonium chlo ride, ammonium nitrate, glutam ine, or glycine at various concentrations as the sole nitrogen sour ce and ESC production was measured. Ammonium chloride and ammonium nitrate suppressed ES C production but only slightly affected fungal radial growth (Fig. 3-4A). At higher concentration (4g L-1) of ammonium chloride and ammonium nitrate, production of ESCs was inhibited completely. ESC production was inhibited when glutamine but not glycine was used as th e sole nitrogen source ev en though fungal growth was slightly stimulated (Fig. 3-4B). In a prior study, expression of the EfPKS1 gene has been

PAGE 64

64 shown to be regulated by carbon/nitrogen sources and pH (Liao and Chung 2008b). In addition, several binding elements that are recognized and bound by global transcription factors for specific gene expression, such as C/EBP (cAM P-inducible genes), AreA (nitrogen or light regulatory genes), WC1/WC2 (light regulatory genes) and PacC (pH responsive genes), were found in the promoter region of the EfPKS1 gene, suggesting that envi ronmental signals affected ESC production via transcriptional activation of the ESC biosynthetic genes. Effects of Antioxidants on Fun gal Grow th and ESC Production Since ESCs generate reactive oxygen species in aerobic conditions upon exposure to light (Liao and Chung 2008a), experiments were also pe rformed to test if antioxidants such as ascorbate, cysteine, DABCO, and reduced glutathione influence ESC production and fungal growth. As tested on MM, addi tion of cysteine, DABCO, or re duced glutathione at higher concentration (cysteine at 50 mM, each of DA BCO and glutathione at 10 mM) inhibited ESC production substantially (Fig. 3-5). Cysteine at 100 mM and DABCO at 50 mM completely inhibited fungal growth. By contrast, addition of ascorbate into MM promoted both fungal growth and ESC production in a dose-dependent manner (Fig. 3-5). Those antioxidants often inactivate reactive oxygen species (ROS) and have been previous ly shown to alleviate the cellular toxicity of ESCs (Liao and Chung 2008a). This study showed that the antioxidants might interfere with biosynthesis of ES Cs. By contrast, ascorbate, which has been reported to reduce O2 to H2O2 or to scavenge H2O2 from generating OH (hydroxyl radicals) in planta (Fry 1998), enhanced both fungal growth and ESC production in this study. However, it is unknown how the antioxidants inhibit or promote ESC production and fungal growth. Effects of Ions on ESC Production Addition of CaCl2, Ca(NO3)2H2O, CoCl2, or LiCl into PDA decreased ESC production by E. fawcettii (Fig. 3-6). Metal ions CoCl2 at 10 mM and LiCl at 100 mM suppressed fungal

PAGE 65

65 radial growth. Addition of CuCl2, FeCl3, KCl, MgCl2, MnCl2, NaCl, or ZnCl2 into PDA elevated ESC production to various levels, depending on the concentration of the compound tested (Table 3-1). Addition of EGTA, the Ca2+ chelator, enhanced ESC production. Similar inhibitory or stimulatory effects of ions in PDA were also observed when fungus was cultured in CM (Table B-1). Co-culturing Enhances ESC Production As described above, production of ESCs was in fluenced by diverse environm ental factors. The stimulatory effect of physical interactions between fungal colonies for ESC production was observed. When a single colony of E. fawcettii was placed in the center of PDA medium, accumulation of small amounts of ESCs was observed 10 days after inoculation and continuously increased as duration of incubation increased (Fig. 3-7A ). When three or five spots (each was separated by 1-cm apart) were inoculated with the same E. fawcettii isolate on a PDA plate, the rate for ESC producti on by each inoculated colony was mu ch faster and the magnitude of ESC accumulation was much higher as visually indicated by red pigment compared to those produced by a single colony inoculated alone (Fi g. 3-7A). Interestingly, ESCs secreted by each of the colonies tended to diffuse toward one a nother in medium (Fig. 3-7B). Similar phenomena were also observed in a distance-response manner when a wild-type isolate was co-cultured with the EfPKS1 null mutants, producing no ESCs (Fig. 37C). It is likely that competition for nutrients, particularly nitrogen source promoted early production of ESCs.

PAGE 66

66 Table 3-1. Effects of ions and EGTA on ESC production by Elsino fawcettii Treatment Conc. (mM) Mean colony dai. (mm) SEM ESCs (nmoles per plug), mean SEM none 13.5 0.4 14.9 3.3 CuCl2H2O 0.1 14.0 0.3 25.12 5.80 1.0 13.5 0.9 27.18 2.18 10.0 0.0 0.0 nd1 FeCl3 0.1 14.6 0.4 23.3 3.0 0.2 15.1 0.5 17.8 4.0 0.5 15.3 1.4 22.3 2.9 1.0 16.0 0.8 26.0 1.8 2.0 14.3 0.5 34.8 2.7 10.0 0.0 0.0 nd KCl 50.0 12.5 0.8 32.8 5.2 100.0 11.9 0.5 24.5 7.6 MgCl2H2O 50.0 13.1 0.5 36.5 7.5 100.0 12.3 0.3 45.7 6.2 MnCl2H2O 0.2 14.1 0.3 14.7 2.8 1.0 12.0 0.4 13.9 4.3 5.0 12.2 0.6 24.9 3.2 10.0 5.1 0.3 20.5 4.5 100.0 0.0 0.0 nd NaCl 50.0 12.6. 0.5 15.2 6.9 100.0 12.4 0.2 30.4 5.4 ZnCl2 0.1 13.5 0.4 19.9 6.9 1.0 13.8 0.6 19.6 3.6 10.0 0.0 0.0 nd EGTA 1.0 13.2 0.1 22.6 3.4 2.0 9.3 0.9 17.6 2.2 3.0 8.8 0.8 19.2 1.0 1nd, not determined

PAGE 67

67 Figure 3-1. Effects of light (A) and medi um compositions (B) on fungal growth and elsinochrome (ESC) production by E. fawcettii. Insets indicate radial growth of fungal colonies which were measured before ESC extraction. A) Fungal cultures grown on PDA were incubated at 25 C under constant light, in complete darkness or 12-h light/dark alternat ion for 21 days. B) E. fawcettii was cultured on PDA, CM, or MM, and incubated under constant light for 21 days. ESC was extracted with KOH and measured at A480 nm. Vertical bars represent st andard deviation. Means followed by the same letter are not different at j udged by Duncans multiple range test at P < 0.0001.

PAGE 68

68 Figure 3-2. ESC accumula tion and growth of E. fawcettii at different pH on MM. Insets indicate the diameters of fungal colonies under the appropriate conditions. pH was adjusted to 4 with sodium phosphate buffer (0.1M) buffer and 5N HCl. Vertical bars represent standard deviation. Means followed by the sa me letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 69

69 Figure 3-3. Effects of various carbon s ources on fungal growth and ESC production by E. fawcettii assayed on CM medium. Insets indica te the diameters of fungal colonies under the appropriate conditions. Different concentration of glucose, mannitol, sorbitol, and sucrose were used to substitute glucose as the sole carbon source in the CM medium. Vertical bars represent standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 70

70 Figure 3-4. Effects of nitrogen source s on fungal growth and ESC production by E. fawcettii assayed in MM medium. A) Ammonium chlo ride and ammonium nitrate suppressed ESC production. B) ESC production was inhibi ted when glutamine but not glycine was used as the sole nitrogen source. Insets indicate the diameters of fungal colonies under the appropriate conditions for 21 days Vertical bars represent standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.001.

PAGE 71

71 Figure 3-5. Effects of antioxidatants, A) cyst eine, B) DABCO (1,4-diazabicyco octane), C) glutathione, and D) asco rbate on ESC production by E. fawcettii in MM medium. Insets indicate the diameter s of fungal colonies under th e appropriate conditions for 21 days. Vertical bars represent standa rd deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.001.

PAGE 72

72 Figure 3-6. Inhibition of ESC production by Ca2+, Co2+, and Li2+ in E. fawcettii Insets indicate the diameters of fungal colonies under the ap propriate conditions. In A, C, and D, the fungus was grown on PDA medium either in the absence or presence of different concentration of ions. B) Fungus was grown at MM medium with (+) or without (-) the component of Ca(NO3)2H2O. Vertical bars represent standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.01.

PAGE 73

73 Figure 3-7. Effects of the number of fungal colonies and the distances on ESC production by E. fawcettii. Mycelial suspensions were place on PDA with different numbers and distances and incubated under constant lig ht. A) Production and diffusion of ESCs were observed 10 (A-1) and 15 (A-2) days after incubation. B) Production of ESCs on PDA was promoted when three colonies of E. fawcettii were inoculated with 1cm apart between each and incubated for 9 to 17 days. The arrows indicate the redpigment started to accumulate in the side of colonies that are close to another colony in 9and 10-day-old cultures. C) The EfPKS1 mutants [Red arrows, D3; blue arrows, D4 (Liao and Chung 2008b)] were inoculated around the wild type, showing similar stimulation on ESC production and diffusion from wild type colonies (1, 2, 3, 4) 15 days post-incubation.

PAGE 74

74 CHAPTER 4 GENETIC DISSECTION DEFINES THE ROLE S OF ELSI NOCHROME PHYTOTOXIN FOR FUNGAL PATHOGENESIS AND CONIDI ATION OF THE CITRUS PATHOGEN Elsino fawcettii Elsinochrome pigments produced by many phytopathogenic Elsino species are non-host selective toxins which react with oxygen molecules after light activation to produce highly toxic reactive oxygen species. This chapter desc ribes the cloning, expression, and functional characterization of the polyketide synthase-encoding gene, EfPKS1, which is required for the production of elsinochromes (ESCs) and f ungal pathogenesis. Target disruption of EfPKS1 in E. fawcettii completely abrogated ESC production, drastically reduced conidiation, and significantly decreased lesion formation on rough lemon leaves. All mutant phenotypes were restored to the wild type in fungal strains expressing a functional copy of EfPKS1 Accumulation of the EfPKS1 transcript and ESCs by a wild-type strain appears to be coordinately regulated by light, nutrients, and pH. The results clearly indicate that the product of EfPKS1 is involved in the biosynthesis of ESCs via a fungal polyketide pathway, and that ESCs play an important role in fungal pathogenesis. Introduction Many phytopathogenic fungi produce perylenequi none pigm ents, which are light-activated and nonhost-selective phytotoxins (Daub et al. 2005). For example, the compounds, alteichin, altertoxin, alterlosin, and stemphyltoxin are produced by Alternaria spp. (Stack et al. 1986; Davis and Stack 1991) and Stemphylium botryosum (Davis and Stack 1991); cercosporin and isocercosporin are produced by many Cercospora spp. (Daub et al. 2005); ESCs are produced by many Elsino and Sphaceloma spp. (Weiss et al. 1987; Liao and Chung 2008a); hypomycin A is produced by Hypomyces spp. (Liu et al. 2001); hy pocrellin is produced by Hypocrella bambusae (Weiss et al. 1987); Shiraia bambusicola (Wu et al. 1989), and phleichrome, calphostin C,

PAGE 75

75 cladochrome, and ent-isophleichrome are produced by Cladosporium spp. (Weiss et al. 1987; Arnone et al. 1988). Among all phytotoxins iden tified, perylenequinone toxins are unique because they contain a chromophore of phe nolic quinine that absorbs light energy (photosensitizers) and produces reactive oxygen species (ROS) such as the hydroxyl radical (OH), superoxide (O2 -), hydrogen peroxide (H2O2), and singlet oxygen (1O2) (Daub and Ehrenshaft 2000; Daub et al. 2005 ). Although the biological func tions of the light-activated perylenequinone toxins for the producing fungi remain largely unknown, their production by a wide range of plant pathogens suggests an importa nt role for these toxins in fungal pathogenesis (Daub and Ehrenshaft, 2000). Perylenequinone toxins were originally inve stigated because of their possible pharmaceutical application (Hudson and Towers 1991) or because of their potential as food contaminants (Sta ck et al. 1986). In contrast, th e role of perylenequinone toxins in fungal pathogenesis has been investigated ve ry little compared to many other host-specific phytotoxins. Only the role of cercosporin in Cercospora diseases has been demonstrated genetically (Upchurch et al. 1991; Callahan et al. 1999; Shim and D unkle 2003; Choquer et al. 2005; Choquer et al. 2007; Dekkers et al. 2007). ESCs are red/orange pigments produ ced by a number of phytopathogenic Elsino species. ESCs comprise of at least four derivatives (A, B, C, and D) with a common perylenequinone backbone but differing in side groups (Weiss et al. 1987). The bright red pigments, elsinochrome A, B, and C were originally isolated from cultures of a pecan pathogen, Elsino randii (anamorph: Sphaceloma randii ). Elsinochrome D is likely derived from elsinochrome C by formation of a methylenedioxy ring. Elsino fawcettii infects lemons, grapefruit, and some tangerines and their hybrids, producing exterior blemishes (citrus scab) on the fruit, which is a serious problem for the fresh-fruit market worl dwide. In the previous studies, elsinochrome

PAGE 76

76 pigments were extracted from a field isolate of E. fawcettii and the production of 1O2 and O2 by ESCs upon exposure to light was demonstrated (Chapter 2; Liao and Chung 2008a). Crude extracts containing a mixture of fi ve elsinochrome derivatives from E. fawcettii cultures were shown to be highly toxic to citrus and tob acco cells in suspension culture, and induced electrolyte leakage of host leaves. The toxicity of ESCs was reduced considerably when 1O2 quenchers such as bixin, ascorbate, and reduced glutathione were presen t. Furthermore, ESCs induced necrosis on rough lemon leaves when exposed to visible light, and the development of necrosis was reduced by co-applying 1O2 quenchers (Liao and Chung 2008a). Thus ESCs function as photosensitizing compounds that are toxic to plan t cells by generating 1O2 and O2 -. Discovery of ESCs toxicity to the plants le d to studies of the role of ESCs in fungal pathogenesis and the molecular mechanisms leading to its biosynthesis. ESCs were implicated as the polyketide-derived based on their structural similarity with several perylenequinones. However, no direct evidence of this structural of ESCs has been established. This chapter describes the cloning, coordinate expression, and functional charac terization of the polyketide synthase-encoding gene, EfPKS1 for the production of ESCs. This was demonstrated by creating and analyzing loss-of-function EfPKS1 mutants of E. fawcettii The results indicate that ESCs are required for fungal pathogenesis. Materials and Methods Fungal Isolate and Growth Conditions The wild typ e CAL WH-1 isolate that was single-spore isolated from scab affected calamondin ( Citrus madurensis Lour) fruit has been previous ly characterized (Liao and Chung 2008a; Chapter 2 and 3) and was used as the reci pient host for transforma tion and targeted gene disruption. This isolate was routinely maintained on potato dextrose agar (PDA, Difco, Sparks, MD). For toxin production, fungal my celia were mincing with a sterile blender, spread on media

PAGE 77

77 and incubated under continuous fluor escent light for 5 or 7 days at room temperature (~25 C). For generation of protoplasts, f ungal isolates were grown in 50 mL of potato dextrose broth (PDB, Difco) for 7 days, minced, and mixed with fresh PDB (200 mL), and incubated for additional 15 h. Fungal cultures used for DNA or RNA isolation were grown on media with a layer of sterile cellophane as previously de scribed (Choquer et al. 2005 ). Complete medium (CM), minimal medium (MM), and protoplast re generation medium (RMM) used in this study have been described in Chapter 3 and/or else where (Jenns et al. 1989; Chung et al. 2002). The pH of media was adjusted by 0.1 M phosphate buffe r as previously described (You et al. 2007). Extraction and Analys is of ESC Toxins Isolation of fungal toxins fr om culture and TLC analysis are described in chapter 2. Screening of ESC-deficient mutants was conduc ted on thin PDA as previously described (Choquer et al. 2005; Chen et al. 2007). Molecular Cloning and Analysis of the EfPKS1 Gene Two degenerate oligonucleotides LC KS1 (5-GTNCCNGT NCCRTGCATYTC-3) and LCKS2 (5-GAYCCNMGNTTYTTYAAYATG-3) that are complementary to the conserved keto synthase (KS) domain of fungal type-I polyke tide synthase genes (Bi ngle et al. 1999) were synthesized and used for amplification from E. fawcettii genomic DNA using Taq DNA polymerase (GenScript, Piscataway, NJ). Th e amplified DNA fragment (~700 bp) was cloned into pGEM-T easy vector (Promega, Madison, WI) for sequencing analysis from both directions at Eton Bioscience (San Diego, CA). Sequences were blasted against the databases at the National Center for Biotechnology Informati on (NCBI) using the BLAST network service (Altschul et al. 1997) to determine the similari ty of the amplified fragment. The full-length EfPKS1 gene was obtained by PCR using a chromo some walking strategy as described previously (Chen et al. 2005; You et al. 2007) and by PCR with tw o inverse primers (Table C-1;

PAGE 78

78 Fig. C-1) (Choquer et al. 2005). A chromosome library of E. fawcettii was prepared from genomic DNA cleaved with four different enzymes ( Eco RV, Pvu II, Sma I and Stu I), and ligated to the adaptors from the Universal Genome Walk er kit following the manufacturers instructions (BD Biosciences, San Jose, CA). To walk upstream and downstream into unknown genomic regions, primer were synthesized to complement the known regions and used for multiple rounds of PCR amplification with adapto r primers supplied with the kit. For PCR with inverse primers, fungal DNA was digested with restriction endonucleases, self-ligated, and used as a template for amplification. Oligonucleotide primers used for PCR amplification and sequence analysis were synthesized by Integrated DNA Technologies (Coralville, IA), Allele Biotechnology and Pharmaceuticals (San Diego, CA), respectivel y. Open reading frame (ORF) and exon/intron positions were predicted using the Softberry gene finding software and confirmed by comparisons of genomic and cDNA sequences. Func tional domains were pr edicted according to the PROSITE database using ExPASy (Gasteig er et al. 2003) or Mo tif/ProDom and Block programs (Henikoff et al. 2000). Analysis of th e promoter region was c onducted using regulatory sequence analysis tools (van Helden 2003). Targeted Gene Disruption To disrupt the EfPKS1 gene in E. fa wcettii a 5.8-kb DNA fragment encompassing the EfPKS1 ORF was obtained by PCR with primers efup3 (5CAATTACGCGAATGGGTCACAGAGC-3) and efdown11 (5CGTCAAGGACATCAGCGAGTC-3). The amplifie d DNA fragment was purified with a DNA purification kit (Mo Bio Laboratories, Carlsbad, CA), and cloned into pGEM-T easy vector to create pSPKS0311. A 1.3-kb Eco RVKpn I DNA fragment, corresponding to the conserved acyl transferase (AT) domain of EfPKS1, was removed and replaced with an end-filled 2.1-kb fragment harboring the hygromyc in phosphotransferase B gene ( HYG) cassette under the control

PAGE 79

79 of the Aspergillus nidulans trp C gene promoter from pUCATPH (Lu et al., 1994) to yield the disruption construct, pPKS0311 (Fig. 4-4A). A sp lit marker strategy was used to enhance the efficiency of double crossing-over recombination as previously descri bed (Choquer et al. 2005). A 4.6-kb DNA fragment cont aining truncated 5 EfPKS1 fused with 3 HYG and a 3.3-kb fragment encompassing 3 EfPKS1 joined with 5 HYG were amplified, respectively, with primers efup3/hyg1 (5-AGGAGGGCGTGGAT ATGTCCTGCGGG-3) and efdown11/hyg2 (5-CCGACAGTCCCGGCTCCGGATCGG-3) from pPKS0311 using the Takara Ex Tar PCR system (Takara Bio USA, Madison, WI). Funga l protoplasts were prepared by the method of Chung et al. (2002) except that hyph ae were incubated with cell wall degrading enzyme cocktails for 6 h instead of 2 h. The resulting DNA fragment s were mixed and transformed into protoplasts (1 x 105) of wild type using CaCl2 and polyethylene glycol as prev iously described (Chung et al. 2002). The two hybrid fragments share 400-bp of overlapping sequence within the HYG gene. The HYG gene is not functional unless recombina tion occurs between the two truncated HYG DNA fragments. Fungal transfor mants appearing on RMM medium supplementing with 200 g mL-1 hygromycin (Roche Applied Science, Indiana polis, IN) after 2 to 3 weeks were selected and tested for lack of ESC production (red/orange pigments) on thin PDA. Genetic Complementation For genetic com plementation, a DNA fragment (8.4 kb) including the entire EfPKS1 ORF and its endogenous promoter was amplified fr om genomic DNA with primers efup3 and efdown 18 (5-CTTTCGTCGTCGGCCCAAC-3) by an Expand High Fidelity PCR system (Roche Applied Science) and co-transformed with plasmid pBarKS1 carrying a phosphinothrin acetyltransferase gene responsible for bialaphos resistance under control of the A. nidulans trpC promoter (Pall and Brunelli 1993) into an EfPKS1 disruptant (D4). Transformants were selected

PAGE 80

80 against 100 g mL-1 of DL-phosphinothricin (chlorimuron et hyl; Chem Service, West Chester, PA) and tested for restoration of ESC production. Miscellaneous Methods of Processing Nucleic Acids Fungal DNA was isolated with a DNeasy Plan t kit (Qiagen, Valencia, C A). Standard procedures were used for endonuclease diges tion of DNA, electrophoresis, and Southern-and Northern-blot hybridizations. Plasmid DNA was purified using a Wizar d DNA purification kit (Promega) from transformed Escherichia coli DH5 bacterial cells. Fungal RNA was extracted with Trizol reagent (Invitrogen, Carl sbad, CA). Double stranded cDNA of EfPKS1 was synthesized with a cDNA synthesis kit (BD Biosciences) following the manufacturers instructions and amplified with gene-specific primers. The amplified fragments were purified and directly subjected to se quence analysis. DNA probes used for hybridization were labeled with digoxigenin (DIG)-11-dUTP (R oche Applied Science) by PCR with gene-specific primers. The manufacturers recommenda tions were followed for probe labeling, hybridization, posthybridization washing and immunological de tection of the probe using a CSPD chemofluorescent substrate for alkaline phosphatase (Roche Applied Science). Preparation of Fungal Inocul um and Pathogenicity Assays Assays for fungal pathogenicity were conducted on detached rough lem on ( Citrus jambhiri Lush) leaves inoculated with c onidial suspension or agar pl ugs covered with fungal hyphae. Rough lemon is susceptible to all Elsino pathotypes of citrus (Timmer et al. 1996). Conidia were prepared as described by Timmer and coll eagues (1996) with modifications. Briefly, fungal hyphae were minced in Fries medium (Fries 1978 ), placed on Petri dish (15 x 90 mm), and incubated for 2 to 3 days in the dark to trigger conidial formation. Rough lemon seedlings were maintained in a greenhouse and expanding immatu re leaves of approxi mately 13-20 mm length and 4-7 mm width were collected for pathoge nicity assays. A conidial suspension (2 L, 1 x 105

PAGE 81

81 mL-1) was carefully placed on the leaves and the i noculated leaves were incubated in a moist chamber under constant fluorescence light for lesion formation. Pat hogenicity also was evaluated using agar plugs. Briefly, PDA agar plugs (4 mm in diameter) were cut from mycelial mats cultured on PDA for 7 days and placed on the unde rside of rough lemon leaves (~12 days after emergence). The inoculated leaves were incubated in a mist chamber and examined for lesion formation daily. Results Cloning and Characterization of EfPKS1 Gene A 0.7-kb DNA frag ment was amplified from genomic DNA of E. fawcettii with degenerate primers designed to anneal to the conserved -keto-synthase (KS) domains of many type-I fungal polyketide synthases. Sequence analysis reveal ed that the amplified fragment has strong similarity to the KS of PKSs. The gene was named EfPKS1 ( E. fawcettii polyketide synthase gene 1). Subsequently, the entire EfPKS1 ORF sequences as well as its 5 and 3 nontranslated regions were obtained by multiple rounds of PCR from chromosome walking library or with two inverse primers from restriction enzyme-digeste d and self-ligated DNA pools. As a result, over 8 kb of genomic sequences were obtained, assemb led, and deposited within EMBL/GenBank Data Libraries under accession number EU086466. Computer prediction and comparison between cDNA and genomic DNA sequences revealed that EfPKS1 contains two exons interrupted by a 52-bp intron near the 5 end of EfPKS1 (data not shown). The intron has characteristic splicing (5-/gt---ag/-3) and internal lariat (cta/gat/c) consensus sequences often found in genes of fila mentous fungi. Conceptual translation revealed that EfPKS1 encodes a polypeptide containing 2192 amino acids that displays considerable similarity and identity to numerous type-I PK Ss of fungi, particularly those involved in pigment formation a nd biosynthesis of secondary meta bolites (Fig. 4-1). Similar to

PAGE 82

82 many fungal type-I PKSs, the translated product of EfPKS1 has a -keto-synthase (KS) domain, an acyltransferase (AT) domain, two acy l carrier protein (ACP) domains, and a thioesterase/claisen cyclase (TE/CYC) domain (Fig. 4-1A). Phylogene tic relationships of EfPKS1 to other fungal polyketide synthases, inferred from the conserved KS or AT domain, revealed that EfPKS1 is highly similar to the fungal non-reducing PKSs, including those involved in the biosynthesis of melanin, cercosporin, bikaverin, sirodesmin, aflatoxin, and other pigments (Fig. 4-1B and C). Promoter Analysis of Ef PKS1 Gene To gain a better understandi ng in the regulation of EfPKS1 gene expression, I analyzed 1.1-kb sequences upstream of the putativ e ATG translational start codon of EfPKS1 and identified several putative binding sites for divers e transcriptional regulators (Fig. 4-2). A TATA box-like sequence (TATATC) on the sense strand was identified 264 bp upstream from the ATG codon. The promoter region of EfPKS1 has multiple GATA consensus motifs, potential binding sites for the nitrogen-induced AreA (Marzluf 1997) and the light-regu lated WC1/WC2 (Linden et al. 1997) transcriptional activators. The EfPKS1 promoter contains f our ambient pH-regulated PacC-binding consensus motifs (GCCARG; Espeso et al. 1997) and multiple cAMP-inducible C/EBP-binding motifs (CCAAT or CAAT; Rangan et al. 1996). In addition, EfPKS1 promoter contains three MRAGGGR and tw o CATTCY consensus motifs that have been shown to serve as binding sites for the conidial formation-related BrlA and AbaA transcriptional activators in A. nidulans (Adams et al. 1998). Analysis of the complementary strand of the EfPKS1 promoter also identified multiple AreA, WC complex, PacC C/EBP, and BrlA bi nding motifs (Fig. 4-2). Expression and Regulation of EfPKS1 Gene and ESC Production To determ ine the factors affecting ESC production and expression of the EfPKS1 gene, fungal cultures were grown on media with differe nt carbon, nitrogen sources, pH values, or

PAGE 83

83 incubated in the light or complete darkne ss. ESCs were extracted and analyzed by spectrophotometry and total RNA was extracted and analyzed by Northern-blot hybridization. A time-course analysis of EfPKS1 RNA levels and ESC produc tion revealed that the EfPKS1 gene transcript accumulated to a detectable level by day 3 and was elevated by days 4 and 5 (Fig. 43A). Similarly, ESCs were detected at low concentration at days 3 and 4, yet accumulated rapidly to high levels at day 5. Accumulation of EfPKS1 transcript and ESCs was much higher when fungal cultures were incubated under continuous light compared to those grown in the dark (Fig. 4-3B). The EfPKS1 gene was preferentially expressed and ESCs accumulated to high levels when E. fawcettii was cultured in glucose-rich medium under illumination (Fig. 4-3C). By contrast, ammonium nitrate deprivation stimulated the accumulation of both the EfPKS1 transcript and ESCs (Fig. 43D). Both expression of EfPKS1 and production of ESCs were favored when the fungus was grown under alkaline conditions (Fig. 4-3E). EfPKS1 is Required for ESC Production The function of EfPKS1 in relation to ESC production was determ ined by targeted gene disruption in E. fawcettii A disruption plasmid (pPKS0311) carrying the hygromycin phosphotransferase B gene ( HYG) cassette flanked by truncated EfPKS1 sequences on each side was constructed. Two separate DNA fragments overlapping within the HYG gene (Fig. 4-4A) were amplified and directly transformed into the wild type E. fawcettii for targeted gene disruption. In total, 600 transformants were recovered from media containing hygromycin. Among them, approximately 100 transformants faile d to accumulate the red/orange pigments on PDA after 30-days of incubation under cons tant light and were considered putative EfPKS1 mutants. Southern-blot an alysis of genomic DNA isolated from 13 putative EfPKS1 mutants revealed that all transformants tested were missing the expected 3.5-kb hybridizing band of the wild-type locus, when fungal DNA was cleaved with restriction endonuclease ClaI, and

PAGE 84

84 hybridized to probe I that recogn izes sequences in the 5 end of EfPKS1 (Fig. 4-4B and data not shown). All 13 transformants displayed a 5.1-kb hybridizing band as a result of HYG insertion within EfPKS1. Four mutants had a single 5.1-kb hybridizing band (Fig. 4-4B), whereas the other nine mutants displayed additional hybridizing signals larger or smaller than 5.1 kb (data not shown), likely resulting from ectopic insertions When fungal genomic DNA was cleaved with XbaI and hybridized to probe II that r ecognizes the 3 end sequences of EfPKS1, an expected 7.9-kb band was detected in wild type (Fig. 4-4C). By contrast, all 13 transformants had a single 4.6-kb hybridizing band resulting from the HYG insertion at EfPKS1 locus (Fig. 4-4C and data not shown). The hybridizing profil es obtained from Southern-blot analysis with two different probes indicated that EfPKS1 of each transformant was replaced with the HYG gene cassette via homologous integration. Successful disruption of EfPKS1 was confirmed by Northern-blot analysis (Fig. 4-5A). The DNA probe (probe 3, Fig.4-4A) hybridized to to tal RNA of wild type displays a 6.6-kb hybridizing signal. However, th e probe failed to detect the EfPKS1 transcript in three randomly selected mutants, indicting that they are EfPKS1 null mutants. Quantitative assays of ESC production by the EfPKS1 null mutants after KOH extraction revealed that the null mutants did not accumulate measurable ESCs compared to wild type (Fig. 4-5B). No ESCs were detected from the acetone extracts of four null mutants on TLC, indicating the disruption of EfPKS1 completely obliterated ESC production (Fig. 4-5C). Genetic complementation experiments revealed that the ESC-deficient phenotype of a null mutant (D4) was reverted by ac quiring and expressing a functional EfPKS1 gene with its endogenous promoter (Fig. 4-5C), confirming the requirement for EfPKS1 in ESC production in E. fawcettii

PAGE 85

85 Disruption of EfPKS1 Reduces Conidiation The EfPKS1 null m utants displayed normal radial growth comparable to wild type, yet produced far fewer conidia relati ve to wild type (Table 41). Genetic complementation by introducing a functional copy of EfPKS1 gene into protoplasts of D4 null mutant, resulted in two transformants with restored conidial producti on (Table 4-1), indicating a close link between EfPKS1 function and conidiation. The EfPKS1 Gene is Required for Full Virulence Since the EfPKS1 null mutants were severely defec tive in conidial production, fungal pathogenicity was first evaluated on detached rough lemon leaves in oculated with agar plugs cut from fungal mycelium (without conidia). As shown in Fig. 4-6, inoculation of wild type and two genetically reverted strains (C1 and C2) resulted in pink to light brown scab lesions with round pustules around the edges, whereas the EfPKS1 null mutants did not incite any visible lesions. Quantitative assays indicated that over 65% of the sites inoculated with agar plugs from the cultures of wild type or the complementation stra ins developed necrotic lesions (Table 4-1). By contrast, none of the sites inoculated with EfPKS1 null mutants or agar plugs alone produced visible necrosis. Pathogenicity assays also were performed on detached leaves inocul ated with conidial suspension. In this assay, only the D4 null muta nt was evaluated for pathogenicity because the other null mutants produced very few conidia. When assayed on young leaves (approximately 3 days after emergence), D4 mutant induced necrotic lesions at rates and magnitudes indistinguishable from those induced by wild type and the C2 strain genetically expressing a functional EfPKS1 (Fig. 4-7A). Wild type and the C2 stra in produced characteristic scab lesions when inoculated onto older leaves (~7 days afte r emergence), whereas the D4 null mutant with similar amounts of conidia (1 x 105 mL-1) incited fewer and smaller lesions presumably due to

PAGE 86

86 lack of the production of ESCs (Fig. 4-7B). Nevertheless, disruption of EfPKS1 yielded mutants that were completely devoid of ESC production and defective in conidiation and scab lesion formation, indicating that ESCs are a determinant of fungal virulence in E. fawcettii Discussion ESCs, produced by m any phytopathogenic fungi of the Elsino genus, consist of at least four derivatives differing ma inly in their side groups. In the present study, the fungal EfPKS1 gene was demonstrated to be required for ESC bi osynthesis, and thereby ESCs were conclusively shown to play a role in fungal vi rulence. The results also indicate that ESCs are synthesized via a fungal polyketide pathway. As with many type-I fungal polyketide synt hases (Kroken et al. 2003; Choquer et al. 2005; Keller et al. 2005), the EfPKS1 product contains five functional domains, including a KS, an AT, a TE/CYC, and two ACP domains, which are invol ved in catalyzing itera tive condensations of acetates and malonates, and chain elongation a nd cyclization of polyketomethylenes (Watanabe and Ebizuka 2004). EfPKS1 also has a conserve d cysteine residue in the KS domain and conserved serine residues in the AT, ACP, a nd TE/CYC domains, similar to other fungal PKSs belonging to the non-reducing group (Kroken et al. 2003). Integration of a hygromycinresistance gene cassette specifically at the EfPKS1 locus resulted in fungal mutants that were completely devoid of ESC production, severely de fective in sporulation, and delayed in lesion development on older rough lemon leaves. The muta nt phenotypes were fully complemented in a strain that genetically acquired and functionally expressed EfPKS1 confirming that mutation of EfPKS1 is responsible for the observed deficienci es and that ESCs ar e important virulence factors. Pathogenicity assays on detached rough lemon leaves revealed that E. fawcettii incites more severe necrotic lesions when inoculated with conidial inoculation compared to mycelium cut from agar plugs. Although the EfPKS1 null mutants were also defective in conidial formation,

PAGE 87

87 reduction of fungal virulence was mainly attribut ed to the impairment of ESC production rather than conidial formation and germination. When pathogenicity was eval uated with conidial suspension, the D4 null mutant induced scab le sions on young leaves (3 days after emergence), comparable to those induced by the wild type. Hence, the EfPKS1 null mutant was apparently not deficient in conidial germ ination. However, the D4 null mutant induced fewer lesions on older leaves (7 days after emer gence) strongly indicating that pr oduction of ESCs in essential for full virulence of E. fawcettii Expression of the EfPKS1 gene was correlated with accumulation of ESCs. The EfPKS1 transcript and ESCs accumulated to high levels when the fungus was grown in the light, in the presence of higher amounts of glucose, at alkaline pH, or in the absence of a nitrogen source. Differential expression of EfPKS1 in response to various environmental conditions was further supported by analyzing the promoter regi on for putative DNA binding sites for global transcriptional activators. For example, two GATA consensus sites, presumably involved in the binding of the AreA/Nit2 nitrogen regulatory proteins (Marzluf 1997) and/or the WC1/WC2 light responsive transcriptional regulators (Linden et al. 1997) were identified. The promoter region of EfPKS1 has three consensus GCCARG motifs that are likely involved in the binding of the pH-responsive transcri ptional regulator, PacC (Espeso et al. 1997). The EfPKS1 promoter also has multiple CCAAT or CAAT consensu s motifs involved in binding cAMP-activated proteins such as CCAAT/enhancer-binding protein (C/EBP) (Ramji and Foka 2002). In addition to complete abrogation of ESC production, EfPKS1 null mutants also were severely defective in conidial production. Th e ESC-producing phenotype and conidiation were fully restored by expressing a dominant-activated allele of an E. fawcettii EfPKS1 protein in a null mutant. These findings indicate a tight connection between ESC biosynthesis and

PAGE 88

88 conidiation. It has long been known that production of natural compounds by microorganisms is often linked with cell development and/or di fferentiation (reviewed in Adams and Yu 1998; Calvo et al. 2002; Yu and Keller 2005; Brodha gen and Keller 2006). It appears that both conidiation and production of s econdary metabolites in fungi respond to common environmental cues, subsequently trigger signa ling transduction pathways, and re gulate gene expression inside the cells. It is well known that environmental f actors such as light, th e types of carbon and nitrogen sources, and ambient pH via a PacC-m ediated pathway regulate both developmental differentiation and biosynthesis of secondary me tabolites in various fungi (Calvo et al. 2002). The genetic mechanisms linking both processes are multifaceted and beginning to be unveiled through molecular studies in several f ungal species. The involvement of a Gprotein/cAMP/protein kinase A-mediated path way in both asexual sporulation and mycotoxin production in Aspergillus nidulans has provided significant insight into the close regulatory interactions between these two phenotypes in other fungi. In addition, the mitogen-activated protein (MAP) kinase and cyclin-dependent kinase pathways have also been shown to regulate both conidiation and produc tion of cercosporin in C. zeae-maydis (Shim and Dunkle 2003) and fumonisins in F. verticillioides (Shim and Woloshuk 2001), re spectively. Other cellular regulators such as oxylipins and other lipid derivatives, polyamines, the CCAAT-binding protein complex, and the proteins containing Trp-Asp (WD) repeats have also been shown to coordinate regulation of both secondary metabo lite production and sporulation in Aspergillus spp. (Calvo et al. 2002; Tsitsigiannis and Keller 2006). Coordinate regulation for conidi ation and production of ESCs by E. fawcettii may mediate similar regulatory pathways, as described in Aspergillus species. Such speculation in supported by analysis of the EfPKS1 promoter region, which identified multiple binding sequences for

PAGE 89

89 transcriptional activators, incl uding GATA factors of nitrogen and light regulation, PacC of pH regulation, and the C/EBP-binding protein induced by cAMP. Furthermore, our results also revealed that production of ESCs via a defined polyketide pathwa y is highly affected at the transcriptional level by light, the levels of gl ucose and nitrogen sources, and pH values. In addition to the binding motifs for global regulatory proteins, the EfPKS1 promoter contains two distinct MRAGGGR motifs found in the promoter region of the gene encoding a conidiationspecific Bristle (BrlA) transcriptional activator of A. nidulans (Adams et al. 1998). Furthermore, the EfPKS1 promoter has two CATTCY motifs (Y is a pyrimidine) that serve as the binding sites for the AbaA transcriptional activator (Andria nopoulos and Timberlake 1994). AbaA, regulated via BrlA, has been shown to be required for th e final stages of conidiphore development in A. nidulans (Andrianopoulos and Timberlake 1994). The presence of conserved BrlA and AbaA binding elements in the promoter of EfPKS1 strongly suggests that the EfPKS1 product might be directly involved in conidial form ation. Whether or not conidiation of E. fawcettii is regulated by light, pH, carbon/nitrogen sources, or cAMP remains to be determined.

PAGE 90

90 Table 4-1. Conidial production in axenic cultures and pathogenicity assays on detached rough lemon leaves by inoculating with agar plugs cut from cultures of Elsino fawcettii wild type (WT), EfPKS1 null mutants (D1, D2, D3, and D4), and strains (C1 and C2) expressing a functional copy of EfPKS1 Fungal strains or treatment Conidial formation (conidia per mL)1 Lesion development2 Leaf spots showing lesions/total spots inoculated (%) Wild type 3.4 1.7 x 106 21/29 (72%) D1 5.0 7.0 x 102 0/21 (0%) D2 4.1 4.1 x 103 0/21 (0%) D3 1.1 0.6 x 103 0/21 (0%) D4 6.2 7.0 x 104 0/28 (0%) C1 3.9 1.9 x 106 11/17 (65%) C2 2.4 1.4 x 106 14/14 (100%) Agar plugs 0/50 (0%) 1Conidia were produced in Fries medium in the dark and were determined with the aid of a hemacytometer by microscopy. Data are means and sta ndard errors ( SEM) of ten different experiments with four replicates of each isolate. 2A 4-mm agar plug cut from mycelial mats was placed onto detached rough lemon leaves. Inoculated leaves were incubated in a moist chamber under florescent light for 25 days. The frequency of lesion formation is indicated as the number of inoculated spots developing scab lesions relative to the total number of spots inoculated.

PAGE 91

91 Figure 4-1. Putative polyketid e synthase, EfPKS1, in Elsino fawcettii A) the putative polyketide synthase, EfPKS1 containing 2192 amino acids in Elsino fawcettii showing a keto synthase (KS) domain with acyl binding cysteine, an acyltransferase (AT) domain containing pantotheine binding serine, a thioesterase/claisen cyclase motif (TE/CYC), and two acyl carrier protein (ACP) domains containing phosphopantotheine binding serine. Conserve d amino acids for each of the domains are also indicated under the map, and the active amino acids ar e underlined. EfPKS1 lacks dehydratase (DH), enoyl reductas e (ER), ketoacyl re ductase (KR), and methyltransferase (ME) domains. B) and C) Phylogenetic relationships of EfPKS1, based on the conserved amino acids in the KS (B) or AT (C) domain, to other fungal PKSs (accession number) including: Bipolaris oryzae BoPKS (BAD22832); Cochliobolus heterostrophus ChPKS18 (AAR90272); Botryotinia fuckeliana BfPKS13 (AAR90249); Xylaria sp. XyPKS (AAM93545); Nodulisporium sp. NoPKS (AAD38786); Ophiostoma piceae OpPKS (ABD47522); Glarea lozoyensis GlPKS (AAN59953); Colletotrichum lagenarium ClPKS1(BAA18956); Sordaria macrospore SmPKS (CAM35471); Aspergillus clavatus AcPKSP (XP_001276035); Ceratocystis resinifera CrPKS1 (AAO60166); B. fuckeliana BfPKS12 (AAR90248); A. fumigatus AfPKSP (AAC39471); Chaetomium globosum CgPKS (XP_001219763); Emericella nidulans wA (1905375A); Nectria haematococca NhPKSN (AAS48892); Gibberella zeae GzPKS12 (AAU10633); A. nidulans AnSTCA (XP_681094); C. heterostrophus ChPKS19 (AAR90273); Cercospora nicotianae CnCTB1 (AAT69682); G. moniliformis GmPKS3 (AAR92210); G. moniliformis GmPKS4 (AAR92211); G. fujikuroi GfPKS4 (CAB92399); Mycosphaerella pini MpPKS (AAZ95017); A. flavus AfPKSA (AAS89999); A. oryzae AoPKS (BAE71314); A. parasiticus ApPKSL1 (Q12053); Leptosphaeria maculans LmPKS1 (AAS92537); C. heterostrophus ChPKS1 (AAB08104); G. moniliformis GmPKS11 (AAR92218); C. heterostrophus ChPKS25 (AAR90279); and Penicillium patulum Pm6MSAS (P22367). The phylogram was created with the program PHYLP (Saitou and Nei 1987).

PAGE 92

92 Figure 4-1. (Continued)

PAGE 93

93 Figure 4-2. Promoter analysis of 1.1 kb sequences upstream of the putative ATG translational start codon of EfPKS1 in both directions, identifying a number of putative binding sites for global transcriptional regulators such as AreA (nitrogen regulatory protein), the WC1/WC2 complexes (light regulatory proteins), PacC (ambient pH regulatory protein), and C/EBP (cAMP activated protein). The EfPKS1 promoter also has conserved sequences for recognition and bindi ng of the conidial formation-associated BrlA and AbaA transcriptional activators in A. nidulans. Definition of mixed bases: R = A or G; M = A or C; Y = C or T.

PAGE 94

94 Figure 4-3. Differentia l expression of the EfPKS1 gene encoding a fungal polyketide synthase and accumulation of ESC phytotoxins in a wild-type isolate Elsino fawcettii Fungal isolate was grown on PDA (A and B), on complete medium containing different amounts of glucose (C), or on minimal medium containing different concentrations of ammonium nitrate (D) or with different pH values (E) under con tinuous light (LT) or darkness (DK). Unless indicated, fungal RNA was isolated from 7-day-old cultures, electrophoresed in an agaros e gel containing formaldehyde, transferred onto a nylon membrane, and hybridized to an EfPKS1 gene-specific prob e. Ribosomal RNA (rRNA) stained with ethidium bromide is s hown for relative loadi ng of the samples. ESCs were extracted with 5N KOH and measured at A480. The amounts of ESCs were determined by reference to a regression line was established using ethyl acetatepurified ESCs. ESC data represent the means of two different experiments with four replicates of each treatment. Vertical ba rs represent standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 95

95 Figure 4-4. Strategy of EfPKS1 targeted disruption in Elsino fawcettii A) Schematic depicting a split-marker strategy for EfPKS1 (indicated by shaded) targeted disruption in Elsino fawcettii A 4.6-kb DNA fragment containing the 5 end of EfPKS1 fused with the Trp C terminator of A. nidulans and truncated hygromycin phosphotransferase B gene ( h/YG ) and a 3.3-kb fragment containing the 3 end of EfPKS1 joined with the Trp C promoter and truncated HY/g were amplified from the disruption construct pPKS0311 with the primers as indicated. The h/YG and HY/g fragment share 400 bp of overlapping seque nce. The split marker fragments were directly transformed in to protoplasts of the E. fawcettii wild-type strain for targeted gene disruption via double crossing-over re combination. The rela tive locations of DNA probes used for Southern and Northern-blot analyses are also indicated. Abbreviations for restric tion endonuclease site: C, ClaI; X, XbaI. B) Southern-blot analysis of genomic DNA from w ild type (WT) and four putative EfPKS1 disruptants (D1, D2, D3, and D4). Fungal DNA was cleaved with endonuclease ClaI, electrophoresed, blotted to a nylon membrane and hybridized with the Probe 1. C) Southern-blot analysis of genomic DNA digested with XbaI and hybridized with the Probe 2. Sizes of hybridization bands are in dicated in kilobase pairs (kb). Banding patterns confirm disruption of EfPKS1 gene.

PAGE 96

96 Figure 4-5. EfPKS1 gene expression and ESC production in EfPKS1 disruptants. A) Northernblot analysis of fungal RNA purified fr om wild type (WT) and three putative EfPKS1 disruptants (D1, D2, and D4) of Elsino fawcettii. RNA was denatured in a formaldehyde-containing gel, blotted to a nylon membrane, and hybridized to a DNA probe (Probe 3 in Fig. 4-4A). Gel stained with ethidium bromide indicates relative loading of RNA samples. Sizes of hybridization bands are indicated in kilobase pairs. B) Quantitative analysis of elsinochrom es (ESCs) produced by wild type and EfPKS1 disruptants. Fungal isolates were grown on PDA under continuous light for 5 days. ESC pigments were extracted with 5N KO H from agar plugs covered with fungal hyphae and measured at A480. The concentrations of ESCs were calculated by referring to a regression line. Data repres ent the means of two different experiments with four replicates of each treatment. Ve rtical bars represen t standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001. C) TLC analysis of ESCs extracted with acetone from the cultures of wild type, four EfPKS1 disruptants, and two strains (C1 and C2) expressing a functional EfPKS1 gene. ESCs were separated on a TLC plate coated with a 60 F254 fluorescent silica gel and deve loped with chloroform and ethyl acetate (1:1 by volume).

PAGE 97

97 Figure 4-6. Pathogenicity assays on detached rough lemon leaves in oculated with agar plugs (4mm in diameter) of wild type, four EfPKS1 disruptants, and two strains (C1 and C2) expressing a functional EfPKS1 gene of Elsino fawcettii. Fungal isolates were grown on PDA for 7 days and agar plugs covered with mycelial mats were cut and placed onto detached rough lemon leaves (14 da ys after emergence) in which fungal mycelium directly contacts the leaf surface. Inoculated leaves (> 20 leaves) were incubated for lesion development in a mois t chamber under constant fluorescent light. Photos were taken 25 days post inoculati on. The inoculated areas were cropped and enlarged for better illustration of necrotic lesions. The mocks were treated with agar plugs without fungal mycelium.

PAGE 98

98 Figure 4-7. Pathogenicity a ssays using conidial suspen sions of wild type, the EfPKS1 disruptant (D4), and the complementation strain (C2) of Elsino fawcettii on detached rough lemon leaves 3 days (A) or 7 days (B) after emergence. Fungal conidia (1 x 105 mL-1) were harvested and applied by applying 2 L of suspension onto rough lemon leaves. Inoculated leaves (> 20 leaves) were in cubated in a moist chamber. Formation of lesions was recorded 14 days post inoculation. The mocks were inoculated with water only. Reduction in lesion number s and sizes by inoculation of EfPKS1 disruptant (D4) are indicated by arrows. Only some of the re presentative replicates of the inoculated leaves are shown.

PAGE 99

99 CHAPTER 5 CHARACTERIZATION OF A GENE CLUSTER REQUIRED FOR THE BIOSYNTHESIS OF ELSINOC HROMES BY Elsino fawcettii In this chapter, a mini-gene cluster requi red for elsinochrome (ESC) biosynthesis is described. In the previous chapter, a polyketide synthase-encoding gene, EfPKS1 ( Elsino fawcettii polyketide synthase gene 1), was demonstr ated to be required for ESC biosynthesis. Chromosome walking and inverse PCR were uti lized to extend the sequences adjacent to EfPKS1 fragment and identify additional genes th at might be involved in ESC production. In addition to EfPKS1 nine putative open reading frames we re identified in a span of 30 kb and were designated as the ESC biosynthetic gene cluster. The ESC cluster includes genes encoding a polyketide synthase (EfPKS1), a re ductase (RDT1), an oxidoreductase (OXR1 ), a transcription factor (TSF1), a membrane transporter (ECT1) and a prefoldin protein subunit (PRF1) that are likely required for ESC biosynthe sis, regulation, and translocati on. Four other putative genes ( EfHP1, EfHP2, EfHP3 and EfHP4) apparently do not encode polypeptides with obvious association with biosynthetic functions. To determine if newly identified genes were required for ESC accumulation, the TSF1 gene was deleted. The TSF1 gene encodes the dual Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and likely func tions as a transcripti onal regulator for ESC production. The TSF1 deletion mutants of E. fawcettii failed to produce ESCs. Expression of the RDT1 EfPKS1 PRF1, and EfHP1 but not the ECT1, OXR1, EfHP2, EfHP3, and EfHP4 genes was markedly down-regulated in the TSF or EfPKS1 null mutants. The results indicate that the RDT1 TSF1 PRF1, ECT1, EfPKS1, and EfHP1 genes are required for ESC biosynthesis and accumulation.

PAGE 100

100 Introduction Elsino fawcettii the causal agen t of scab diseas e of citrus, produces elsinochromes (ESCs), causing cell death, necrotic lesions, and electr olytic leakage via production of reactive oxygen species (Liao and Chung 2008a). An EfPKS1 ( Elsino fawcettii polyketide synthase gene 1) was cloned and shown to be required for ES C production, and that ESCs are virulence factors during citrus pathogenesis (Liao and Chung 2008b). Biosynthesis of secondary metabolites in fungi has long been known to respond to environmental cues, including the carbon/nitrogen source, light and pH, presumably mediated through the global regulatory factors such as CreA responding to carbon suppression; AreA responding to nitrogen signaling; PacC responding to ambient pH (Dowzer and Kelly 1989; Kudla et al. 1990; Tilburn et al. 1995). The global regulato ry networks have been proposed to be regulated by a signaling pathway, involving th e G protein/c-AMP/protein kinase-mediated signaling (Calvo et al 2002; Yu and Keller 2005). In Chapter three, accumulation of ESCs in culture was demonstrated to be affected by ca rbon and nitrogen sources, pH, and additional environmental factors. Thus, it seems likely that production of ESCs is al so regulated by similar signaling pathways. Genes for biosynthesis of secondary metabolite s in filamentous fungi are often clustered and coordinately regulated by a pathway-specifi c transcriptional regula tor (Yu and Keller 2005). A number of polyketide-derived fungal second ary metabolites, such as fumonisin, aflatoxin, ochratoxin A, aurofusarin, a nd cercosporin, are synthesized by clustered genes within the genomes of fungi (Proctor et al. 2003; Yu et al. 2004; Karolewi ez and Geisen 2005; Malz et al. 2005; Chen et al. 2007). In this chapter, a mi ni gene cluster comprised of ten genes ( RDT1 TSF1 OXR1, EfPKS1 PRF1, ECT1 and EfHP1-4 ) is described in relation to ESC production in Elsino fawcettii. To determine if the genes are coordina tely regulated and are involved in ESC

PAGE 101

101 production, a TSF1 gene was cloned and characterized as embedded in the cluster and encoding for a putative transcription ac tivator containing dual Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding domains. Materials and Methods Fungal Strains, Their Maintenance a nd Extraction/Analysis of ESC Toxin The wild-ty pe CAL WH-1 isolate of Elsino fawcettii Bitancourt & Jenkins (anamorph: Sphaceloma fawcettii Jenkins) was previously charac terized (Liao and Chung 2008b). All procedures used for fungal culturing, toxin extr action, and screening for ESC-deficiency mutants were previously describe d (Chapter 2, 3, and 4). Chromosomal Walking and Sequence Analysis Fungal DNA was isolated em ploying a DNeasy Pl ant Mini kit (Qiagen, Valencia, CA). A genomic library of E. fawcettii was constructed from DNA digested with Dra I, EcoR I, Pvu I and Stu I, and ligated to adaptors using the Universa l GenomeWalker kit (BD Biosciences, Palo Alto, CA) according to the manufactures instructi ons. Primers were designed based the known sequences and paired with adaptor primers to obtain DNA fragments harboring unknown genomic regions using a Titanium or Advantag e 2 DNA polymerase (BD Biosciences). In some cases, DNA fragments were obtained by PCR with inverse primers from fungal DNA that was digested with restriction endonucle ases and self-ligated as previ ously described (Choquer et al. 2005). After purified with a DNA purification kit (M o Bio Laboratories, Inc., Carlsbad, CA), the amplified DNA fragments were either directly sequenced or first cloned into pGEM-T easy vector (Promega) for sequence analysis at Eton Bioscience, Inc. (San Diego, CA). Oligonucleotides used for PCR and sequenc ing were synthesized by Integrated DNA Technologies (Coralville, IA) and Allele Biot echnology and Pharmaceuticals, Inc., (San Diego, CA). Similarity searches using a BlastX program (Altschul et al., 1997) were performed at the

PAGE 102

102 National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/). Prediction of open reading fra mes (ORFs) and exon/intron junc tions were first performed using the genefinding software at http://www.softberry.com and were further confirmed by comparing genomic and cDNA s equence. Functional domains were id entified using the PROS ITE database in the ExPASy Molecular Biology Server ( http://us.expasy.org) (Gas teiger et al. 2003) and Motif/ProD om and Block programs (Henikoff et al. 2000) at http://motif.genome.jp/. Analysis of the prom oter regions was conducted using regulato ry sequence analysis tools (van Helden, 2003) at http://rsat.ulb.ac.be/rsat/. Palindr o me searches were performed at http://bioweb.pasteur.fr/seqanal/interfaces/palindrome.html. Targeted Gene Disruption and Genetic Complementation To disrupt the TSF1 gene in E. fawcettii, a 5.34-kb DNA frag ment encompassing the whole TSF1 ORF and flanking sequences was amplified by PCR with primers efup 11 (5CATCTCGCATATCTGGACCCGTC-3) and efup28 (5-CGGGCTATTCTTAGAGCAGAG3). The amplified DNA fragment was purified w ith a DNA purification kit and cloned into pGEM-T easy vector to become pSTSF 1128. Plasmid pSTSF1128 was digested with Nru I, blunted, and to accommodate an end-filled 2.1-kb fragment harboring the hygromycin phosphotransferase B gene ( HYG) cassette under the control of the Aspergillus nidulans trp C gene promoter and terminator from pUCATPH (Lu et al. 1994) to create th e disruption construct, pTSF1128 (Fig. 5-3). A split marker strategy was applied to facilitate double crossing-over recombination as previously described (Choque r et al. 2005). Briefly, a 4.4-kb DNA fragment containing truncated 5 TSF1 fused with 5 HYG and a 4.2-kb fragment encompassing 3 TSF1 linked to 3 HYG were amplified, respectivel y, with primers efup11/hyg3 (5GGATGCCTCCGCTCGAAGTA-3) and efup28/ hyg4 (5-CGTTGCAAGAACTGCCTGAA-3) from pTSF1128 using the Takara Ex Tar PCR sy stem (Takara Bio USA, Madison, WI). Fungal

PAGE 103

103 protoplasts were released from fungal hyphae by a mixture of cell-wall degrading enzymes as previously described (Chung et al. 20 02). Fungal transformation using a CaCl2 and polyethylene glycol-mediated method was performed by mixi ng PCR fragments with protoplasts (1 x 105) as previously described (Chung et al. 2002). The two hybrid fragments share 800 bp of overlapping sequence within the HYG gene. The HYG gene cassette is not functional until recombination takes place between the two truncated HYG DNA fragments. Fungal transformants were recovered from RMM medium containing 200 g mL-1 hygromycin (Roche Applied Science, Indianapolis, IN) afte r 2 to 3 weeks and were screen ed for the loss of ESC production (red/orange pigments) on thin PDA. For genetic complementation, a functional TSF1 gene and its 5 nontranslated region was amplified from genomic DNA with primers ef up11 and efup28 by an Expand High Fidelity PCR system (Roche Applied Science) and confirmed by sequencing. The amplified TSF1 gene cassette was co-transformed with plasmid pBARKS1 plasmid harboring a phosphinothrin acetyltransferase gene under control of the A. nidulans trp C promoter that is responsible for bialaphos resistance (Pall and Brunelli, 1993). Transformants we re first identified from a medium supplemented with 50 g/mL bialaphos (Gold Biotech, St. Louis, MO) and tested for production of the red/orange pigments (ESCs) on thin PDA plate as previously described (Liao and Chung 2008a; 2008b). Molecular Techniques Unless otherwise specified, standard molecu lar techniques were used for endonuclease digestion of DNA, electrophoresis, and Southern and Northern-blot hybridizations. Plasm id DNA was propagated in Escherichia coli DH5 bacterial cells and purified using a Wizard DNA purification kit (Promega). Fungal RNA was purified by Trizol reagent per manufactures directions (Invitrogen, Carlsbad, CA). Singl e and double strand cDNA was prepared with a

PAGE 104

104 cDNA synthesis kit (BD Biosciences) and amplified by reverse transcriptase (RT)-PCR with gene-specific primers. The resul ting fragments were purified and directly subjected to sequence analysis. DNA probes used for Southernand No rthern-blot hybridizatio n were labeled by PCR to randomly incorporate digoxigenin (DIG)-11-dUTP (Roche Applied Science) into DNA with gene-specific primers. Procedures used for probe labeling, hybridiz ation, post-hybridization washing and immunological detection of the probe using a CSPD (C18H19Cl2O7PNa2) chemofluorescent substrate for alkaline phosphatase were performed following the manufacturers recommendations (Roche Applied Science). Conidia Production and Pathogenicity Assays Conidia were prepared as described in the Chapter 4. Fungal pathogenicity was evaluated on detached rough lem on ( Citrus jambhiri Lush) leaves inoculated with agar plugs as previously described (Liao and Chung, 2008b). The inoculated leaves were incubated in a moist chamber under constant fluorescence light at an intensity of 3.5 joules m-2 s-1 and lesion formation was monitored weekly. Rough lemon trees were maintained in greenhouse and leaves of 7-10 days after flushing, with size approxi mately length 2.2-3.2 cm and wi dth 1-1.5 cm, were harvested for pathogenicity assays. Nucleotide Sequences Sequence data reported in this article can be retrieved from the EMBL/GenBank Data Libraries under Accession nos. EfHP1 (EU414199), EfHP2 (EU414200), EfHP3 (EU414201), RDT1 (EU401704), TSF1 (EU401705), OXR1 (EU401706), EfPKS1 (EU086466), PRF1 (EU401707), ECT1 (EU414198), and EfHP4 (EU414202).

PAGE 105

105 Results Sequence Analysis and Determination of Open Reading Frames (ORFs) A polyketide synthase gene ( EfPKS1 ) required for elsinochromes (ESCs) biosynthesis has been determined as described in Chapter 4. The EfPKS1 gene disrupted mutants, D1, D2, D3, and D4, were completely blocked in ESC production. Sequence analysis beyond the EfPKS1 gene was performed to determine if any of the genes adjacent to EfPKS1 are also required for ESC biosynthesis. Using a combination of chromosome walking and inverse PCR cloning strategies, over 30-kb of adjacent sequences were obtained after multiple rounds of polymerase chain reaction (PCR). In each round, new primers complementary to the end of assembled sequences were designed, synthesized and used to amplify overlapping DNA fragments from the genome of E. fawcettii. The presence of exons/introns and th e identification of putative ORFs were first performed using computer software and were further confirmed by comparison of genomic and cDNA sequences. Analysis of the comp iled sequences led to identify nine putative ORFs, in addition to the EfPKS1 gene (Table 5-1; Fig. 5-1). A similarity search in the NCBI database using BLASTX was performed to predict the function of the translated polypeptide. A PRF1 gene, located downstream from EfPKS1 contains a 111-bp intron and encodes a putative polypeptide similar to prefoldin subunit 3. The putative ECT1 gene product, excluding a 45-bp intron, disp lays strong similarity to numerous hypothetical proteins and membrane transporters, with the highest hit to nitrate transporter of Aspergillus terreus (E value = 3e-69; Table 5-1). A TSF1 gene that is located upstream and transcribed divergently from EfPKS1 encodes a putative protein, showing strong similarity to many zinc finger transcrip tional factors of fungi. A RDT1 gene, located further upstream from TSF1 has a 47-bp intron and encodes a putative polypeptide similar to a wide range of reductases, with strong similar ity to 1,3,8-trihydroxy naphthalene (T3HN) reductase involved in

PAGE 106

106 melanin biosynthesis (Table 5-1). An OXR1 gene contains a 45-bp intron and is located between the EfPKS1 and TSF1 genes. The OXR1 protein, rich in proline, has low similarity to malate:quinone oxidoreductases of bacteria (Table 5-1). Three putative ORFs (designated as EfHP1-3 ) upstream of the RDT1 gene encode hypothetical pr oteins with unknown functions. A small segment, consisting of 44 amino acids, in the translated product of EfHP 2, however, displays low similarity to putat ive cation/multidrug efflux pump of Marinomonas sp. (Table 51). The EfHP1 and EfHP3 genes have introns of 57 and 69 bp, respectively, whereas EfHP2 is an intronless gene. A small EfHP4 ORF, interrupted by 54-bp introns, is located downstream of ECT1 and encodes a putative polypeptide, showing low similarity to isoleucyl t-RNA synthase which did not appear to involve in metabolic func tions. Sequencing beyond the EfHP1 or EfHP4 gene failed to produce reliable seque nces after several attempts w ith different primers (data not shown). Expression of Putative ORFs and ESC Accumulation In order to d etermine if the genes identif ied within the cluster were expressed and coordinately regulated under the conditions favorable for ESC accumulation, Northern-blot hybridization of RNA from E. fawcettii was conducted to examine the expression profiles of the RDT1, TSF1,OXR1, EfPKS1, PRF1, ECT1 genes and four EfHP genes (Fig. 5-2A). All genes except for EfHP 3 were favorably expressed when the fungus was under nitrogen starvation and their transcripts were nearly undet ectable in the presence of ammonium nitrate. Expression of the EfHP 3 gene appeared to be constitutive as its tr anscript remained unchanged in all conditions tested. Noticeably, accumulation of the TSF1, EfPKS1 PRF1 ECT1, and EfHP2 gene transcripts increased considerably when the fungus was incubated in alkaline conditions. Under acidic conditions (pH 4), the RDT1 and EfHP1 gene transcripts accumulated slightly but not significantly higher compared to those in alkali ne conditions. By contra st, expression of the

PAGE 107

107 EfHP3 or OXR1 gene was not affected by pH, as their tran scripts were detected at similar levels both in acidic and alkaline conditions. Apparently, the EfPKS1 PRF1 and ECT1 genes were preferably expressed in the conditions with hi gher amounts of glucose, whereas accumulation of the TSF1 and RDT1 gene transcripts were repressed. Expression of the EfHP3 gene was not regulated by glucose as its transcript accumulate d equally well in both conditions (Fig. 5-2A). Quantification assays for the accumulation of elsi nochromes (ESCs) revealed that large quantity of ESCs was exclusively detected when the fungus was cultured in the absence of nitrogen, in alkaline conditions (pH 8.0), or in the presence of higher amo unts of glucose (Fig. 5-2B). Addition of ammonium nitr ate, reducing the glucose concentration to 2 g L-1, or changing the medium pH to acidic conditions (pH 4.0) completely suppressed ESC production. Promoter Analysis for Iden tifying DNA Binding Motifs The promoters of ten putative genes were an alyzed to identify potential binding sequences for common regulatory elements such as the nitrogen regulatory protein (AreA), the carbon regulatory protein (CREA), the pH regulatory protein (PacC), and the light responsive proteins (WC1/WC2 complex). Analysis sequences upstr eam of the putative ATG translational start codon identified several consensus sequences in the RDT1, TSF1, OXR1, EfPKS1 PRF1, ECT1, and EfHP1-4 promoters (Table 5-2). The consensus TA TA motif was found in the promoters of all genes but TSF1, OXR1 PRF1, and EfHP3. All genes, but EfHP4 contain at least one CAAT or CCAAT consensus sequence in their promot er regions. The pH regulatory PacC-binding sequence (5-GCCA(A/G)G-3) was identified only in the promoter regions of TSF1 OXR1 EfPKS1 PRF1, ECT1 and EfHP2-4 All genes, except for EfHP3 have one or multiple GATA consensus sequence that is potentially recognized and bound by the nitrogen regulatory AreA protein or the light regulatory transcriptional WC1/WC2 comp lex (Kudla et al. 1990; Marzluf 1997; Linden et al. 1997). However, none of the promoter regions has the binding sequence (5-

PAGE 108

108 (G/C)PyGGGG-3) that is recognized by the CreA carbon repressor. The promoter regions of the RDT1 EfPKS1 and ECT1 genes have a consensus sequence, 5-(A/C)(A/G)AGGG(A/G)-3 that serves as a binding site for the conidial forma tion-related BrlA transcriptional activator in A. nidulans (Adams et al, 1998). The promoter regions of the RDT1 OXR1 EfPKS1 and ECT1 genes, however, have a consensus sequence, 5-C ATTC(C/T)-3 that acts a binding site for the AbaA transcriptional activator invol ved in conidiophore development in A. nidulans (Andrianopoulos and Timberlake 1994) Two palindrome sequences, 5-TCG(N2-4)CGA-3 and 5-CGG(N3-11)CCG-3, were also identified in the prom oter regions of some but not all genes (Table 5-2). Targeted Disruption of the TSF1 Gene and Genetic Complementation To determ ine if the genes that are clustered with TSF1 are also involved in ESC biosynthesis and regulation, I characterized the TSF1 gene encoding a putative transcriptional activator. The TSF1 gene contains 3075 nucleotides, in terrupted by four introns of 49, 50, 43, and 53 bp in lengths. The translated 959 amino acids of the TSF1 gene displays strong similarity to numerous conserved proteins from the sequenced genomes of fungi and contains dual Cys2His2 type zinc finger (C TYCGHSFTRDEHLERHILTH and CFTCHMSFARRDLLQGHYTVH) and GAL4-like Zn2Cys6 binuclear cluster DNA-binding (CSNCAKTKTKCDKKFPCSRCASRNLRC) domain signa tures. The regulatory function of the TSF1 gene product in relation to the biosynthesi s of ESCs was determined genetically, by creating and analyzing targeted disruptants that were specifically mutated at the TSF1 locus. To increase the efficiency of rec overy of transformants with targ eted gene disruption, two split DNA fragments overlapping 800 bp within the HYG cassette were amplified separately from the disruption construct pTSF1128 (Fig. 5-3A) and directly transformed into wild-type of E. fawcettii. Since the HYG cassette was truncated in either fr agment, only transformants with the

PAGE 109

109 restored HYG function via homologous recombination woul d survive and form colonies on the regeneration medium supplemented with hygromyc in. All transformants recovered were then screened for production of red/orange pigments (ESCs) on a thin PDA under constant fluorescent light. Of 20 transformants tested, three failed to accumulate the red/orange pigments and were considered TSF1 disruptants. Successful disruption of the TSF1 gene was confirmed by Southern blot analysis. Hybridization of genomic DNA digested with Pvu II endonuclease and hybridized to a TSF1 gene probe resulted in a 4.8-kb hybridizing band in the wild type and two hybridizing bands with expected sizes of 3.9 and 3.2 kb, as a result of integration of the HYG cassette, in the putative disruptants (Fig. 5-3B). Hybrid ization of genomic DNA cleaved with Bgl I and Pvu II also yielded different banding patterns between the wild type and the putative disruptants as expected (Fig. 5-3C), indicati ng a specific disruption at the TSF1 locus. Northern-blot analysis was conducted to determine if the putative mutants accumulated the TSF1 transcript. As shown in Fig. 5-4A, hybrid ization of total R NA identified a sole TSF1 transcript of 3.1-kb in size from wild type, but not from three disruptants Apparently, integration of the HYG cassette within the TSF1 ORF has completely abo lished expression of the TSF1 gene, indicating they were TSF1 null mutants. Functional comp lementation was performed to further determine the role of TSF1 in relation to the biosynthesi s of ESCs. Transformants were screened for recovery of the red-pigmented fungal strains that ac quired and expressed a functional TSF1 gene cassette. Two fungal strains (CA and CB) accumulated low amounts of the red/orange pigments were selected for further ch aracterization. Northern-blot analysis revealed that the TSF1 t ranscript was detected in both CA and CB strains, but not in their progenitor T3 strain (Fig. 5-4A). Phenotypic analyses indicated that the TSF1 disruptants failed to accumulate ESCs in axenic cultures compared to wild t ype, as either assayed spectrophotometry after KOH

PAGE 110

110 extraction (Fig. 5-4B) or by TLC analysis (Fig. 5-4C). Compared to wild type, the CA and CB complementation strains produced much less ESCs on PDA (Fig. 5-4B). TLC analysis of the pigments extracted from the CA stra in indicated that the band with Rf 0.68 was the most abundant pigment (band 1), whereas the extracts from wild type showed three derivatives of pigments ( Rf 0.68, Rf 0.50, and Rf 0.22) with band 3 as the major compound (Fig. 5-4C). Spectrophotometric scanning indicat ed that the acetone extracted pigments from wild type, CA, and CB strains, displayed a strong absorbance at 460 nm with two minor peaks at 530 and 570 nm, whereas all tsf1-disrupted mutants (T1, T2, a nd T3) had no absorbance peaks. Gene Regulation by TSF1 and Feedback Inhibition The central role of the TSF1 gene product as a transcripti onal activ ator was assessed for expression of the clustered genes in two TSF1 disruptants (Fig. 5-5). As shown in Fig. 5-5, disruption of the TSF1 gene caused a decreased accumulation of the RDT1 EfPKS1 PRF1, and EfHP1 gene transcripts, but did not cause a drastic reduction for expression of the OXR1 ECT1, EfHP2, and EfHP3 genes. Expression of the EfPKS1 gene was restored in the CA and CB complementation strains. Accumulation of the gene transcripts was also examined in an EfPKS1 null mutant (D4) that is defec tive in ESC production. Northern hybr idization analysis revealed a marked reduction of transcripts of the RDT1 TSF1 PRF1, ECT1 and EfHP1 genes in the D4 mutant (Fig. 5-6). Accumulation of the RDT1 TSF1 PRF1, ECT1 and EfHP1 gene transcripts was nearly restored in strains (C1 a nd C2) expressing a functional copy of the EfPKS1 gene. In contrast, expression of the OXR1 EfHP2, and EfHP3 gene transcripts was apparently not influenced by disruption of the EfPKS1 gene, as evidenced by the fact that their transcripts accumulated to the levels comparable to those of wild type (Fig. 5-6).

PAGE 111

111 Discussion Elsinochrome (ESC) phytotoxins produced by m any Elsino species contain a perylenequinone backbone and is likely synthesi zed via a defined polyketide pathway. I have previously demonstrated that deletion of the EfPKS1 gene encoding a fungal polyketide synthase in an isolate of E. fawcettii leads to complete inability in the production of ESC which demonstrates that ESC plays an essential ro le in fungal virulence (Liao and Chung 2008b). The genes involved in the biosynthesis of fungal pol yketide compounds are often closely linked in the genome. The case for the biosynthesis of ESCs by E. fawcettii is no exception. In this chapter, the regions flanking EfPKS1 were sequenced to obtain a 30-kb continuous DNA stretch. Nine additional putative ORFs were identifie d, some of which encode polypeptides likely involved in biosynthesis, regul ation, and accumulation of ESCs. EfPKS1 functions in the assembly of the polyketide backbone of ESCs in an analogous fashion to fatty acid and polyketide biosynthesis (Fig. 5-7). Th e putative biosynthetic pathway begins with the condensation of acetyl-CoA (sta rter) and malonyl-CoA (e xtender) units. EfPKS1 contains several conserved domai ns including a keto synthase (KS), an acyltransferase (AT), a thioesterase (TE) and two acyl ca rrier protein (ACP) domains that may act cooperatively to form the polyketomethylene backbone of ESCs. The mal onyl-CoA subunit is assumed to attach to the ACP domains of EfPKS1 to form a phosphopantot heine (PPT) complex (Watanabe and Ebizuka 2004) that accepts a unit from acetyl-CoA via the function of the AT domain. The KS domain of EfPKS1 catalyzes condensation of the malonyl and acetyl-CoAs by decarboxylation. After each cycle of condensation, the malonyl keto group is reduced. The putative polyketide synthase encoded by EfPKS1 iteratively catalyses the sy nthesis by incorporating two carbons in each cycle into a linear polyke tide chain which is then released and cyclized through a TE domain in the EfPKS1 (Birch 1967). Additional modification steps are present to produce a heptaketide

PAGE 112

112 backbone of ESCs. ESCs have a bilateral symmetri cal structure (Fig. 5-7). Thus, formation of the mature ESCs is likely mediated by dimerization. In addition to the EfPKS1 gene, the RDT1 gene encoding a putative reductase, the TSF1 gene encoding a putative transc riptional activator, and the OXR1 gene encoding a putative oxidoreductase are likely involved in modification of ES C backbone (Fig. 5-7). The ECT1 gene encoding a probable membrane transporter is lik ely functioning in toxin secretion outside the fungal cells to avoid toxicity (F ig. 5-7). In addition, there is no methyltransferase-coding gene in the ESC cluster even though ESC has four methyl groups at position C3, C7, C8, and C12 (Weiss et al. 1965; Lousberg et al 1969). It appears that the identified ESC gene cluster does not contain all the genes responsible for ESC biosynthesis. The role of the PRF1 gene encoding a putative prefoldin protein in relation to ESC production remains unknown. Similarly, the remaining four ORFs ( EfHP1-4 ) encode hypothetical proteins with unknown functions. Whether or not they are involved in the ESC production will require further inve stigation by a deletion strategy for the corresponding genes. All the putative ORFs identifie d in the cluster were expressed as judged by Northern-blot analysis. Apparently, ESCs were favorably prod uced when the fungus was cultured in lower nitrogen, higher pH, and higher carbon supply. Ho wever, accumulation of the gene transcripts was not fully congruent with the conditions conductive for ESC production. Expression of all ORFs other than EfHP3 and accumulation ESCs were regu lated under nitrogen starvation, but obviously lacked strong correlation between gene expression and ESC accumulation in response to pH or carbon source. Analysis of the prom oter regions of the ESC clustering genes for possible DNA binding sites of global transcriptional regulators reveal ed that all ten genes contain nitrogen or light regulatory bi nding elements (GATA) in their promoter regions that are

PAGE 113

113 recognized by AreA nitrogen regulator (Mar zluf 1997; Wilson and Arst 1998), and the WC1/WC2 light-responsive regulator (Linden et al. 1997). The GCCARG consensus motif involved in the binding of the pH-responsive PacC regulator (Espeso et al. 1997) was found in the 5-untranslated regions of the TSF1 EfPKS1 PRF1, ECT1 and OXR1 genes but not RDT1 promoter regions. Expression of TSF1 EfPKS1 PRF1, and ECT1 but not RDT1 and OXR1 genes increased at alkaline pH Interestingly, PacC has been reported to regulate fungal virulence genes required for phytopathogens (Rolli ns and Dickman 2001; Caracuel et al. 2003; You et al. 2007). Thus, I predict that PacC may also f unction as a fungal virulence factor in E. fawcettii likely via regulation of the genes involved in ESC biosynthesis. Many of the Zn2Cys6 harboring transcriptional activators have been shown to recognize and bind the palindrome DNA sequence with inve rted repeats of CG G or TCG elements separated by a spacer with various nucleotides, such as [5-CGG(N3-N11)CCG-3] or [5TCG(N2-N4)CGA-3] (Marmorstein and Harrison 1994; Li and Kolattukudy 1997; Fernandes et al. 1998; Ehrlich et al. 2002). Promoter anal ysis also identified similar palindrome DNA sequence in the 5untr anslated regions of TSF1 OXR1 EfPKS1, and PRF1, that may also be involved in transcriptional regula tion. Northern-blot analysis also uncovered that not all of the clustered genes were coordinately regulated through the putative tr anscriptional regulator, TSF1, implying the requirement of other transcripti onal regulators whose c oding sequences are not linked to the ESC gene cluster. However, deletion of the TSF1 gene resulted in fungal mutants that completely fail to accumulate any detectable TSF1 transcript and ESCs indicating the TSF1, likely acts as a core transcriptional activator, playing an essential role in ESC biosynthesis. Deletion of the TSF1 gene influenced expression of the RDT1 EfPKS1 and PRF1 gene considerably, yet had little effect for transcriptional suppression of the ECT1 and OXR1 genes.

PAGE 114

114 Similarly, it is not yet clear whether or not the putative EfHP1-4 ORFs close to the ESC cluster are also involved in ESC biosynthesis even t hough the expression of some of these genes was regulated by nitrogen starvation and affected by the deletion of EfPKS1 or TSF1 gene. Thus, the function of the ESC genes other than EfPKS1 and TSF1 in the biochemical pathway leading to ESC production can not be conclusively determin ed until each of the genes is inactivated. Expression of the ESC clustering genes in an EfPKS1 null mutant reveals a transcriptional feedback inhibition, in which deletion of the EfPKS1 gene suppressed expression of the RDT1 TSF1 PRF1 and ECT1 genes in the cluster. Expre ssion of a copy of the functional EfPKS1 gene in a respective null mutant restored their expressi on to the extent comparable to those of their wild-type progenitor, further s upporting the requirement of the RDT1 TSF1 PRF1, and ECT1 genes for ESC biosynthesis. In a prior study, deletion of the EfPKS1 gene gave rise to a remarkable reduction in conidiation in addition to deficiency in the ESC production. Similar to the EfPKS1 -disrupted mutants, the TSF1 null mutants were also seve rely disrupted in coni dial production (data not shown). The connections between production of secondary metabolites and cell development and/or differentiation have also been investigat ed in other filamentous fungi (Adams and Yu 1998; Calvo et al. 2002; Yu and Keller 2005; Brodhagen and Keller 2006). Interestingly, examination of the 5-untranslated regions re vealed the presence of the consensus MRAGGGR motifs in the promoter regions of the RDT1 EfPKS1 and ECT1 genes, which are presumably involved in the binding for a conidi ation-specific Bristl e (BrlA)-like transcri ptional activator as described in A. nidulans (Adams et al. 1998). In additi on, the consensus CATTCY motifs, recognized by the AbaA transcri ptional activator (A ndrianopoulos and Timberlake 1994), are found in the RDT1 OXR1 EfPKS1 and ECT1 gene promoters. AbaA is activated by BrlA and is

PAGE 115

115 involved in conidiphore development of A. nidulans (Andrianopoulos and Timberlake 1994). It is possible that the proteins or intermediates involved in the ESC biosynthesis and conidial formation might be coordinately regulated, at lease in part, by common transcriptional regulators in a complex and intertwined networks that incl ude the G-protein/cAMP/protein kinase Aand the mitogen-activated protein (M AP) kinase-mediated signaling casse ttes as described in other filamentous fungi (C alvo et al. 2002). Expression a functional TSF1 gene cassette in the respective null mutants failed to fully restore conidiation, ESC production, or fungal pathogenesis. It is ve ry unlikely that failure to completely restore the mutant phenotype s was attributed to the transformed TSF1 gene. Sequence analysis of the transformed TSF1 gene cassette revealed no nucleotide substitutions or insertions (data not shown). No rthern-blot analysis also show ed a normal expression of the TSF1 gene in the recombinant transformants comparab le to those of wild type. The failure of TSF1 to complement ESC production, conidiation, and vi rulence, when controlled by its endogenous promoter, was somewhat surprising and highlighted the requirement of specific regulation for the function of TSF1 in particular and all other ge nes in the cluster in general. As summarized in Fig. 5-8, I propose a regulat ory model for the possible linkage of ESC biosynthesis and environmental cues. Elsino fawcettii responds to various external signals, such as light, pH, and nutrients. Subsequently, membra ne receptors relay the external stimuli into fungal cells to elicit the globa l signaling pathways, such as G protein-mediated signaling pathways to release various secondary messe ngers. These second messengers, such as cAMP, Ca2+, 1,4,5-trisphosphate (IP3), or others, in turn trigger global transcriptio n factors that directly or indirectly activate TSF1 Since the EfPKS1 and TSF1 disrupted mutants resulted in a

PAGE 116

116 reduced conidiation, it is very likely that biosynthesis of ESC a nd fungal conidiation are coordinately regulated.

PAGE 117

117 Table 5-1. Elsinochrome (ESC) biosynthetic gene cluster and adjacent EfHP1-4 genes encoding hypothetical proteins in Elsino fawcettii Gene (accession number) Length (bp) Intron no. (size in bp) Amino acids Closest blast match proteins and species (accession no.) Amino acid similarity (%) E value Hypothetical protein, Botryotinia fuckeliana (EDN21223) 224/264 (84%) 6e110 RDT1 (EU401704) 851 1 (47) 267 1,3,8trihydroxynaphthalene reductase, Alternaria alternata (BAA36503) 221/261 (84%) 1e108 Hypothetical protein, Phaeosphaeria nodorum (EAT80399) 558/956 (58%) 0 TSF1 (EU401705) 3075 4 (49, 50, 43, and 53) 959 Transcription factor Cmr1, Cochliobolus heterostrophus (ABI81496) 659/1032 (63%) 0 OXR1 (EU401706) 744 1 (45) 232 Malate:quinone oxidoreductase, Pseudomonas syringae (AAY36032) 65/163 (39%) 1.1 EfPKS1 (EU086466) 6631 1 (52) 2192 Fungal type I polyketide synthase, Bipolaris oryzae (BAD22832) 1656/219 7 (75%) 0 Hypothetical protein, Phaeosphaeria nodorum (EAT80391) 147/178 (82 %) 1e67 PRF1 (EU401707) 705 1 (111) 197 Probable prefoldin subunit 3, Neosartorya fischeri (EAW23892) 151/190 (79 %) 2e57 Hypothetical protein, Phaeosphaeria nodorum (EDN17791) 273/522 (52 %) 2e82 ECT1 (EU414198) 1563 1 (45) 505 Highly affinity nitrate transporter, Aspergillus terreus (EAU39122) 260/513 (50 %) 3e69

PAGE 118

118 Table 5-1. (Continued) Gene (accession number) Length (bp) Intron no. (size in bp) Amino acids Closest blast match proteins and species (accession no.) Amino acid similarity (%) E value EfHP1 (EU414199) 993 1 (57) 311 Hypothetical protein, Chaetomium globosum (EAQ88529) 71/147 (48%) 8e06 EfHP2 (EU414200) 1158 0 385 Putative cation/multidrug efflux pump, Marinomonas sp. (EAQ67386) 44/94 (46%) 1.0 EfHP3 (EU414201) 819 1 (69) 249 Hypothetical protein, Coprinopsis cinerea (EAU83036) 60/117 (51%) 3e06 EfHP4 (EU414202) 423 1 (54) 122 Isoleucyl-tRNA synthase, Bacillus subtilis (CAB13417) 39/80 (48%) 0.26

PAGE 119

119 Table 5-2. Promoter analysis of genes in the elsinochrome (ESC) biosynthetic gene cluster of Elsino fawcettii Gene RD T1 TSF1 OXR1 EfPKS 1 PRF 1 ECT 1 EfHP 1 EfHP 2 EfHP 3 EfHP 4 TATA 1 0 0 1 0 1 1 1 0 1 CCAAT or CAAT 7 7 7 9 8 2 7 3 4 0 AreA or WC1/WC2 GATA 3 4 1 8 5 1 1 6 0 7 pH regulatory GCCA (A/G)G 0 1 1 4 1 1 0 1 1 1 BrlA (A/C)(A/G)AGGG (A/G) 1 0 0 3 0 1 0 0 0 0 AbaA CATTC (C/T) 3 0 3 2 0 2 0 0 0 0 TCG(N24)CGA 0 1, (N3) 1, (N3) 2, (N2 & 3) 2, (N3 & 4) 0 0 0 0 0 Palindrome CGG(N311)CCG 0 2, (N5 & 11) 2, (N8 & 9) 1, (N10 ) 1, (N3 ) 0 0 0 0 0

PAGE 120

120 Figure 5-1. Elsinochrome (ESC) biosynthetic gene cluster. The 30-kb DNA region harboring 10 genes is shown. The putative genes include RDT1 (reductase 1), TSF1 (transcription factor 1), OXR1 (oxidoreductase 1), EfPKS1 (polyketide synthase 1), PRF1 (prefoldin 1), ECT1 (transporter 1). The nucleotide seque nce of the 5 end flanking region contains three ORFs designated EfHP1 EfHP2 and EfHP3, and the 3 end contains one ORF designated EfHP4

PAGE 121

121 Figure 5-2. Northern-blot analysis of gene expression and elsinochrome (ESC) production in response to nitrogen, pH, and glucose in Elsino fawcettii Fungal isolate was grown on complete medium containi ng different amounts of gluc ose, or on minimal medium containing different concentra tions of ammonium nitrate or buffered to various pH as indicated under continuous light. A) Fungal RNA was isolated from 7-day-old cultures, electrophoresed in an agarose ge l containing formaldehyde transferred onto a nylon membrane, and hybridized to the gene-specific probes. Ribosomal RNA (rRNA) stained with ethidium bromide is show n for relative loading of the samples. B) ESCs were extracted with 5 N KOH and measured at A480. The amounts of ESCs were determined by reference to a regre ssion line that was esta blished using ethyl acetate-purified ESCs. ESC data represent the means of two different experiments with four replicates of each treatment. Ve rtical bars represen t standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 122

122 Figure 5-3. Targeted gene disruption of TSF1 encoding a putative tran scription regulator which contains dual Cys2His2 type zinc finger and GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain using a split-marker strategy in Elsino fawcettii A) Restriction maps of the TSF1 gene in the genome of wild type (WT) and tsf1disrupted mutant. Two truncated TSF1 fragments fused with an overlapping HY / YG (hygromycin resistance gene cassette) we re amplified by PCR with Oligonucleotide primers (up11 paired with hyg3; up28 paired with hyg4) as indicated. Note: drawing is not to scale. B, Bgl I; N, Nru I; P, Pvu II. B) and C) Southe rn-blot analysis of genomic DNA from wild type (WT) and three tsf1-disrupted mutants (T1, T2 and T3). Fungal DNA was digested with Pvu II (B) or Bgl I/Pvu II (C), electrophoresed, blotted onto a nylon membra ne and hybridized with TSF1 gene specific probe amplified by primers, up 26/up28, as indicate d in A. Hybridizing patterns indicate disruption of the TSF1 gene.

PAGE 123

123 Figure 5-4. TSF1 gene expression and ESC production in TSF1 disruptants. A) Northern-blot analysis of fungal RNA purified from wild type (WT), three putative tsf1-disrupted mutants (T1, T2 and T3), and two TSF1 -complemented strains (CA and CB) of Elsino fawcettii RNA was denatured in a formaldehyde-containing gel, blotted to a nylon membrane, and hybridized to a DNA probe (probe amplified by primers, up26/up28 in Fig. 5-3A). Gel stained with ethidium bromide indicates relative loading of the RNA samples. Sizes of hybrid ization bands are indicated in kilobase pairs. B) Quantitative analysis of ESCs produced by wild type, TSF1 disruptants and complemented strains. Fungal isolates were grown on PDA under continuous light for 7 days. ESC pigments were extracted with 5N KOH from agar plugs covered with fungal hyphae and measured at A480. The concentrations of ESCs were calculated by referring to a regression line. Data repres ent the means of two different experiments with four replicates of each treatment. Ve rtical bars represen t standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001. C) TLC analysis of ESCs produced by wild type, three tsf1-disrupted mutants, and complemented strain (CA).

PAGE 124

124 Figure 5-5. Northern-blot hybrid ization indicates that the tsf1-disrupted mutants failed to accumulate the EfPKS1 and reduce production of RDT1 PRF1 and EfHP1 transcripts. Ethidium bromide-stained rRNA indicates the relative loading of the samples. Total RNA was isolated from fungal strains grown on potato dextrose agar under continuous light for 7 days, electrophoresed in formaldehyde-containing gels, blotted onto nylon membranes and hybridized to the probes as indicated at 50 C.

PAGE 125

125 Figure 5-6. Northern-blot hybridiz ation indicates a feedback i nhibition of the ESC clustering genes in Elsino fawcettii. Expression of the EfHP1, RDT1 TSF1 PRF1, and ECT1 genes in the EfPKS1 disrupted mutant, D4, was dramatically repressed. Functional complementation by introducing a copy of EfPKS1 into a null mutant yielded two fungal strains (C1 and C2) with a restored gene expression. Total RNA was isolated from fungal strains grown on potato dextrose agar under continuous light for 7 days, electrophoresed in formaldehyde-containi ng gels, blotted onto nylon membranes and hybridized to the probes as indicated. Ethi dium bromide-stained rRNA is shown to indicate the relative loading of the samples.

PAGE 126

126 Figure 5-7. Hypothetical reacti on pathway for the formation of elsinochromes (ESCs) by function of the ESCs biosynthetic clustering genes. The TSF1 transcription factor is proposed to regulate expression of the cluste red genes. The early precursors (acetylCoA and Malonyl-CoA) are incorporated into a growing polyketide chain, which is released and cyclized by the function of EfPKS1 as stated in the text. The products of RDT1 and OXR1 are thought to be required for post-polyketide-synthesis steps, whereas the actual function of PRF1 remains unknown. ECT1 is assumed to be responsible for ESC exportation.

PAGE 127

127 Figure 5-8. Hypothetical signal transduction and regulatory cont rols for ESC biosynthesis and accumulation. The biosynthetic pathway is assumed to be mainly regulated by pathway-specific transcriptional regulator, TSF1, that is presumably activated by a wide range of global regulatory factors in response to various environmental cues as described in text.

PAGE 128

128 CHAPTER 6 GENETIC AND PATHOLOGICAL DETERMINATIONS OF Elsino fawcettii FIELD ISOLATES FROM FL ORIDA Elsino fawcettii the causal pathogen of citrus scab, induces supe rficial corky lesions on the affected tissues. Production of elsinochrome (ESC) phytotoxins has been shown to play an essential role for E. fawcettii virulence and lesion development. In this study, 52 field-collected E. fawcettii isolates from Florida ci trus growing areas were ex amined for ESC production and pathogenicity to three index citrus hosts: rough lemon, grapefruit, and sour orange. All pathogenic isolates were found to produce ESCs in cultures and/or in planta further confirming the important role of ESCs in fungal virule nce. Several field-collected isolates of E. fawcettii displayed different pathogenicity, host range, and ESC production, apparently differing from the other isolates. One field isolate, Ef41, was comp letely non-pathogenic to rough lemon, grapefruit, and sweet orange, and did not produce ESCs. Ef41 failed to express the EfPKS1 gene and differed considerably from other E. fawcettii isolates on the basis of phylogenetic analysis inferred from ITS region. Moreover, as assays on detached rough lemon and grapefruit leaves, co-inoculation of a low virulence isolate attenuated disease severi ty caused by the highly virulent isolate. Introduction Citrus scab caused by Elsino fawce ttii is widely distributed in humid citrus-growing areas worldwide. The development of superficial cork y lesions induced by this pathogen leads to a significant economic loss for the fruit intended for fresh market. Many phytopathogenic Elsino species have been reported to produce elsinochromes (ESCs) (reviewed by Weiss, et al. 1987). Limited work has been done to demonstrat e the linkages between ESC production and fungal pathogenesis. ESCs presumably react with oxygen upon illumination and generate superoxide and singlet oxygen, which have been previously s hown to be highly toxic to cells and tissues of

PAGE 129

129 citrus and tobacco (Liao and Chung 2008a ). Furthermore, the non-ESC producing E. fawcettii mutants, derived from disruption of the EfPKS1 gene, exhibited a reduced virulence to citrus (Liao and Chung 2008b), further confirming the importa nt role of ESCs in fungal pathogenesis. However, ESC toxins have never been isolated from Elsino -induced lesions. Elsino species or Elsino fawcettii isolates are not readily distinguishable by morphological traits (M. Priest unpublished data; Fantin 1988; Fortes, 1989; Timmer et al. 1996). Molecular approaches such as restriction analysis of the amplified internal tr anscribed spacer (ITS) of ribosomal DNA digested with several endonucleases and sequence analysis of the ITS have been applied to differentiate the closely related species of Elsino such as E. fawcettii E. australis, and Sphaceloma fawcettii var. scabiosa (Tan et al. 1996). The internal transcri bed spacer 1 (ITS 1) between 18S rDNA and 5.8S rDNA is relatively less conserved among species, and has been demonstrated to be a useful marker for differentiating inter-rel ationships of fungal strains, sp ecies, and genera (Duncan et al. 1998; Brookman et al. 2000). For E. fawcettii the random amplified polymorphic DNA (RAPD) technique has been proven as a usef ul and easy tool for identifying Elsino species and the isolates from different geogra phic areas (Tan et al. 1996). In Florida, two pathotypes of E. fawcettii : Florida Broad Host Range (FBHR) and Flor ida Narrow Host Range (FNHR) have been described on the basis of host range (Whiteside 1978; Timmer et al. 1996). The FBHR pathotype primarily affects the leaves and fruit of grapefruit ( C. paradisi Macf.), lemon ( C. limon (L.) Burm. F.), rough lemon ( C.jambhiri Lush), Murcott and Temple tangors ( C. sinensis (L.) Osbeck x C reticulata Blanco) and sour orange (C.aurantium L.), and the fruit of sweet orange ( C. sinensis ). By contrast, the FNHR pathotype affects a ll of the above except sour orange, Temple tangor, and sweet orange. Except for differences in host range, FBHR and FNHR pathotypes are not distinguishable morphol ogically and genetically.

PAGE 130

130 In the present study, I surveyed 52 E. fawcettii isolates from citrus groves in Florida and found that many of the isolates accumulated red or orange pigments in culture. In this chapter, close relationships between fungal virulence and ESC production in vitro and in planta were elucidated. Investigation of their host ranges and taxonomic re lationships among isolates of E. fawcettii suggests the presence of novel pa thotypes or phylogenetic species of E. fawcettii in Florida. Materials and Methods Fungal Isolates and Growth Conditions All fungal isolates of Elsino fawcettii Bitancourt & Jenkins (anam orph: Sphaceloma fawcettii Jenkins) were collected from citrus-growi ng areas in Florida an d were kindly provided by L. W. Timmer (University of Florida). The origin s of these isolates are indicated in Table 6-1. Fungal isolates were maintained on potato de xtrose agar (PDA, Di fco, Sparks, MD) under constant fluorescent light at 25 C. Other media used in this study include a complete medium (CM) containing 1 g Ca(NO3)2H2O, 0.2 g KH2PO4, 0.25 g MgSO4H2O, 0.15 g NaCl, 10 g glucose, 1 g yeast extract, and 1 g casein hydrolysate per liter (Jenns et al. 1989), and a 10% skim milk medium (Difco). For ESC production, f ungal isolates were grown on thin PDA plates (5 mL in 100 x 15 mm Petri dish plates) for 10 days under light. Fungal isolates were grown on agar plate overlaid with a pi ece of sterile cellophane when DNA or RNA isolation was desired. Extraction and Analysis of Elsinochromes (ESCs) ESC toxins were extracted from fungal cult ures and analyzed by TLC as described in Chapter 2. Quantitative analysis of ESC produced in vitro was performed by extracting agar plugs with fungal hyphae with 5 N KOH and measur ing absorbance at 480 nm. To extract ESCs from affected rough lemon leaves, leaf spots with necrotic lesions were cut, pooled, and extracted twice with ethyl acetate at 4 C for 16 h in the dark. Organic solvent was collected, air-

PAGE 131

131 dried at room temperature, suspended in small volumes of acetone, and analyzed by spectrophotometry at A480 and TLC. The concentration of ESCs was calculated by reference to a regression line that was establis hed using pure cercosporin (Sigma-Aldrich) as standard and was expressed as cercosporin equivalents. Production and Germination of Conidia Conidia were prepared by the m ethod desc ribed by Timmer and colleagues (1996) with modifications. Approximately, 0.03 g of fungal hyphae was ground with a disposable pestle in 4 mL Fries medium (Fries, 1978), placed on a Petri di sh (15 x 90 mm), and incubated at 25 C for 2 days in the dark to trigger c onidial formation. Plates were wash ed with sterile, distilled water, flooded with distilled water (pH 7.0) and incubate d for additional 12-15 hr in the dark. Conidia on the bottom of the plate were washed once with distilled wate r, scraped, re-suspended after centrifugation (6000 rpm, 10 min), and passed thr ough a filter to remove mycelia. Conidia were counted and measured with the aid of a hemocytometer using a microscope at x 200 magnification. Germination of conidia was dete rmined 2 days post inoculation on detached rough lemon and grapefruit leaves as described below and was calculated in proportion to the total number of conidia recovered from the inoculated spot. Pathogenicity Assays Assays for fungal pathogenicity were conducted on detached rough lem on ( Citrus jambhiri Lush), grapefruit ( Citrus paradisi ), and sour orange ( Citrus aurantium ) leaves inoculated with conidial suspension. Rough lemon is susceptible to all Elsino pathotypes of citrus (Timmer et al. 1996). Conidial suspension (1 L, 1 x 105 mL-1) was carefully placed on th e leaf surface and the inoculated leaves were incubated in a mist chamber under consta nt fluorescence light for lesion formation.

PAGE 132

132 Enzymatic Activity Assays Assays for enzym atic activities were determined as described (You and Chung 2007). Glucose in the complete medium (CM) was subs tituted by appropriate carbon sources (1% citrus pectin, pH4.5 or pH7.6; 1% polygalacturon ic acid, pH4.5 or pH7.6; 0.5% carboxymethyl cellulose; 10 g glucose plus 0.1% 16-hydroxyhex odecanoic acid (cutin monomer)) for induction of the respective enzyme. Skin milk used for pr oteolytic activity assays was prepared by mixing (3:22, v:v) solution A (10% skim milk disso lved in 0.05 M phosphate buffer, pH 6.8) and solution B (Agar medium containing 0.23% yeast nitrogen base) after sterilization. Extracellular activities CWDEs (cell wall degradation enzymes) were evaluated by measuring the amounts of reducing sugar that was released from 1% polygalacturonic acid (PGA), 1% citrus pectin or 0.5% carboxymethyl-cellulose (CMC ) and reacted with dinitrosalicylic acid (DNS) reag ent under alkaline condi tions (Bailey et al. 1993). Fungal isolates were grown on a modified CM in which gl ucose was substitute d by an appropriate polysaccharide for 10 days. Five 5-mm agar plugs b earing fungal mycelia were cut and placed in 0.1M sodium phosphate buffer containing 1% PGA (pH 4.5 or pH 7.6), 1% citrus pectin (pH 4.5 or pH 7.6), or 0.5% CMC (pH 5). After incubation at 50 C for 1 hour, an equal volume of DNS reagent was added, boiled at 95 C for 5 min, and absorbance was measured at A540nm. The regression line and correlation coefficient (r2 > 0.98) were established using glucose as a standard. One unit of enzyme activity is defined as 1 nmole of glucose liberated from the substrate per minute. Extracellular cutinase activities were determined by formation of a yellow color after reacting with 50 mM paranitrophe nyl butyrate (PNPB) in 0.1M s odium phosphate buffer (pH 5) for 1 hour and measured at A405nm (Stahl and Schfer 1992). Funga l isolates were grown on a modified CM containing 0.1% 16-hydroxyhexadecanoic acid (HHDA, dissolved in 1% sodium

PAGE 133

133 acetate) as a sole carbon source fo r 8 days for induction before the enzymatic assays. One unit of cutinase released is 1 nmole p-nitrophenol produced per minute. Proteolytic activities were determined by fo rmation of clear zones on 10% skim milk plates. Fungal mycelia were ground in sterile wa ter, and spread onto an agar plate. After incubation at 28 C for 4 days, the si zes of clear zones were measured. PCR-Restriction Fragment Length Polymorphism (RFLP) and Sequence Analysis of ITS and -tubulin Genes The ITS regions of funga l rDNA were amplified by PCR with primer ITS 1 (5TCCGTAGGTGAACCTGCGG-3) and ITS 4 (5-TCCTCCGCTTATTGATATGC-3) as described by White et al. ( 1990). A 600-bp DNA fragment, encompassing entire ITS 1, 5.8S and partial 18S of rDNA, was amplified. Partial -tubulin gene (~ 500 bp) of fungal isolates were amplified with primer sets Bt1R (5-GAC GAGATCGTTCATGTTGAACTC-3) and Bt1F (5TTCCCCCGTCTCCACTTCTTCATG-3) as described (Glass and Donaldson 1995). The PCR amplification reactions were carried out in a Peltier thermal cycler (MJ. Research, INC., Watertown, MA). The DNA was amplified by Go Taq Flexi DNA polymerase (Promega, WI) in 50 L reaction containing 0.2 M of each of th e primer set and 50 ng of genomic DNA. Thermal cycling parameters for amplification of both ITS and -tubulin include a single cycle of 95 C for 2 min, followed by 35 cycles of 45 sec at 95 C, 45 sec at 56 C, and 1 min at 72 C and a final step at 72 C for 5 min. The amp lified DNA fragments were digested with 4-bp recognition sequence restriction e ndonucleases, electrophoresed in 2% agarose gel, stained with ethidium bromide, visualized, and photogra phed under ultraviolet light. The amplified ITS fragments were cleaved with Hae III, Msp I, or Taq I, whereas the amplified -tubulin gene fragments were cut with Alu I, Dpn I, Hae III, Msp I, NlaIV, or Taq I. For direct sequencing, the DNA fragments were amplified by an Expand Hi gh Fidelity PCR system (Roche Applied

PAGE 134

134 Science). Otherwise, all fragme nts were cloned into pGEM-T easy vector (Promega, Madison, WI) for sequencing analysis from both directions at Eton Bioscience (San Diego, CA). Similarity was determined by Emboss MATCHER Program (Sanger Institute, Hinxton, Cambridge, UK.). The ITS 1 sequences were aligned with publis hed sequences and phylogenetic analyses were performed using DS Gene v2.5 program (Accelrys Inc., San Diego). Random Amplified Polymorphic DNA (RAPD) RAPD fragm ents were amplified with a 10-mers primer, OPX-7 (5-GAGCGAGGCT-3), OPX-13 (5-ACGGGAGCAA-3), or MtR 1 (5 -GTAAAGGGGG-3), by Taq DNA polymerase (GenScript, Piscataway, NJ). The cycling profile fo r amplification includes an initial cycle of 94 C for 3 min, immediately followed by 35 cycles of 94 C for 30 sec, 36 C for 45 sec, 72 C for 4 min and a final step of 72 C for 7 min. The amplified DNA fragments were separated by electrophoresis in 2% agarose gel. Miscellaneous Methods of Processing Nucleic Acids Plasm id DNA was purified using a Wizard DNA purification kit (Promega) from transformed Escherichia coli DH5 bacterial cells. Fungal RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA ). Standard procedures were used for electrophoresis and Northern-blot hybridization. DNA probes used for hybridization were labeled with digoxigenin (DIG)-11-dUTP (Roche Applied Science) by PCR with gene-specific primers. The manufacturers recommendations were fo llowed for probe labe ling, hybridization, posthybridization washing and immunological de tection of the probe using a CSPD chemofluorescent substrate for alkaline phosphatase (Roche Applied Science).

PAGE 135

135 Results Morphological Examination Isolates of Elsino fawce ttii were first examined for pot ential morphological variations using light or dissection microscopes. All isol ates produced filamentous mycelia, and formed nodular/bulbous mycelia after a prolonged inc ubation (e.g., Fig. D-1). Pl eomorphic colonies were observed among isolates when cultured on PDA or CM culture (Fig. D-2 and data not shown). All isolates had a limited mycelial extension, which were s lightly raised in the center. Some isolates (e.g., Ef12, Ef17, Ef29, Ef37, and Ef48) produced colonies that were dark red with a little fluffy velvet-like mycelia, while others produced pale colonies (e.g., Ef30 and Ef49) covered with or without fluffy mycelia. All isol ates produced hyaline conidia, showing elliptical to obclavate, and nonseptate cells (data not s hown). The isolate Ef41 produced smaller conidia having the means size of 3.4 x 1.9 m (length x width), while other isolates produced conidia with the mean size 4.1-5.1 x 2.2-2.7m (length x width). Pathogenicity Assays As rough lemon is susceptible to all Elsino spp. (Timm er et al. 1996), fungal pathogenicity was primarily evaluated in this citrus cultivar. In total, 52 E. fawcettii isolates cultured from different citrus cultivars and geog raphic locations of citr us-growing areas in the state of Florida were evaluated for pathogenicity on detached rough lem on leaves (Table 6-1). All isolates produced subs tantial numbers of conidia, ranging from 0.1-50 x 106 conidia per mL. As assayed on detached rough lem on leaves, all isolates except one (Ef41) incited necrotic lesions on young leaves (7-10 days after flushing ) and exhibited a reduced virulence to varying degrees when inoculated onto olde r leaves (14-18 days after fl ushing, data not shown). Isolate Ef41 failed to induce any necrosis on rough lem on, while isolates Ef10 and Ef29 had a weak virulence on rough lemon. Pathogenicity of nine isolates (Ef10, 12, 17, 29, 30, 37, 41, 48, and 49)

PAGE 136

136 was also assessed after inoculation onto detached grapefruit and s our orange leaves (Table 6-1). Isolates Ef10 and Ef29 were weakly virulent to either grapefruit or sour orange and isolate Ef41 was nonpathogenic to either citrus cultivar. Other isolates were weakly or moderately virulent to grapefruit or sour orange (Table 6-1). Production of ESC Toxin in Culture ESCs produced by E. fa wcettii isolates was extracted from agar plugs bearing fungal mycelium with 5N KOH and quantified by measur ing absorbance at 480 nm. As shown in Table 6-1, production of ESC toxins was variable am ong isolates, ranging from 1.4 to 16.6 nmoles per agar plug. Noticeably, several isolates (Ef1, 15, 25, 26, 27, and 47) produced little or no ESCs in axenic cultures despite being pat hogenic to rough lemon. i.e., th ere was no relationship between in-vitro production of ESCs and lesion formation on rough lemon. Extraction of ESCs from Scab Lesions To determ ine if ESCs were accumulated dur ing fungal colonization, 23 field isolates of E. fawcettii, including five isolates (Ef 1, 25, 27, 41and 47) that produced no ESCs in cultures, were inoculated onto detached rough lemon leaves. ESCs were then extracted from a pooled sample of 20 necrotic lesions of each isolate, and analy zed by TLC. ESCs with different banding profiles and intensities were extracted from lesions indu ced by 22 isolates tested (Fig. 6-1). Isolate Ef41 did not incite any visible lesi ons on rough lemon leaves and a ccumulated no detectable ESCs. Isolates Ef1, Ef25, Ef27and Ef47 produced no detectable levels of ESCs in cultures, but apparently produced ESCs in planta and induced characteristic scab lesions on rough lemon leaves (Fig. 6-1; Table 6-1). Judging from band width and intensity, band 1 ( Rf 0.68) appeared to be the major compound of the leaf extracts, whereas band 3 ( Rf 0.22) was the most abundant product of the cultural extracts. Spectrophotometri c scanning indicated that the acetone extracted pigments from scab lesions on rough lemon leaves displayed a strong absorbance at 460 nm with

PAGE 137

137 two minor peaks at 530 and 570 nm, resembling those purified from E. fawcettii cultures as described in Chapter 2. Further Characterization of a Nonpathogenic Elsino faw cettii Isolate In addition to assays for fungal pa thogenicity and ESC production, nine E. fawcettii isolates, representing nonpathogenic (Ef41), weakly virulent (Ef10, Ef17, Ef29, and Ef49) and highly virulent isolates (Ef12, Ef30, Ef37, and Ef48) were further examined for potential genetic variations. As shown in Table 6-1, isolates that were pathogen ic to rough lemon were also pathogenic to grapefruit. All isolates excep t Ef41 produced scab pustules on young leaves (7 days after flushing) of rough le mon and grapefruit and exhibited a reduced virulence to varying degrees on older leaves (14 days after flushing). These nine E. fawcettii isolates were not all pathogenic on sour orange. Only three isolates, Ef12, Ef17, and Ef48, of nine isolates produced severe pustule lesions on sour orange. Alterations in Hydrolytic Enz yme Activities To determine if fungal hydrolytic enzy mes are required for pathogenicity of E. fawcettii the extracellular activities of proteolytase, ce llulase, pectinase, polyga lacturonase and cutinase were determined among nine isolates described a bove. Isolate Ef41 had no detectable proteolytic activity, whereas isolates Ef10, Ef 17, Ef29, and Ef49 with lower virulence had lower proteolytic activity compared to the pathogenic isolates Ef12, Ef30, Ef37, and Ef48 (F ig. 6-2A). Similarly, isolates Ef12, Ef30, Ef37, and Ef48 displayed higher cellulase activity than other isolates tested (Fig. 6-2B). All E. fawcettii isolates tested exhibited high leve ls of pectolytic activities when grown in a medium containing citrus pectin as a sole carbon source (p H 4.5), but the overall pectolytic activities d ecreased considerably at pH 7.6 (Fi g. 6-2C). When gr own in a medium containing polygalacturonic acid as a sole ca rbon source, all isolates had no or little polygalacturonase activity when the medium was buffered to pH 7.6. By contrast, isolate Ef41

PAGE 138

138 exhibited marked polygalacturonase activity when the medium wa s buffered to pH 4.5 (Fig. 62D). There was no significant difference in cutinase activities among all isolates tested, despite that isolate Ef41 showed slight ly but not significantly lower cellulase activity (Fig. 6-2E). Production of ESC and Expression of the EfPKS1 gene in the Nonpathogenic Isolate (Ef41) Of 52 isolates exam ined, only Ef41 isolate failed to infect rough lemon, grapefruit, or sour orange and produced no ES C either in culture or in planta (Table 6-1). Thus, expression of the polyketide synthase-coding gene, EfPKS1, that has been shown to be required for ESC biosynthesis (Liao and Chung, 2008b) was examined in Ef12 and Ef41 isolates by Northern blot analysis. As shown in Fig. 6-2F, accumulation of the EfPKS1 transcript was normal in the ESCproducing isolate Ef12. The EfPKS1 gene transcript was undetectab le in isolate Ef41, which may account for no ESC production. Co-inoculation of Two E. fawcettii Isolates Reduces Lesio n Formation To test if the isolates with low virulence will compete with the isolates with high virulence, various combinations of two E. fawcettii isolates were co-inocula ted onto detached rough lemon and grapefruit leaves and lesion formation was assessed. Co-inoculation of conidial suspension of is olate Ef12 with either isolate Ef29 or Ef49 resulted in a repressed symp tom development on both citrus cultivars compared to those inoculated with the Ef12 isolate alone (Fig. 6-3). When isolate Ef12 alone was inoculated onto rough lemon or grapefruit, over 65% of the total spots inoculated developed severe scab lesions covered with numerous pustules (level 4-5). Wh en isolate Ef12 was co-inoculated with isolate Ef29 or Ef49, less than 14% of the inoculated spots on either rough lemon or grapefruit leaves developed severe scab lesions. Co-inoculation of isolate Ef12, Ef29 or Ef 49 with isolate Ef41 did not alleviate symptom development (Fig. 6-3).

PAGE 139

139 Molecular Evaluation of E. fawcettii Isolates E. fawcettii isolates cultu red from Florida citrus growing areas displa yed variations in virulence to rough lemon, grapefruit, and sour or ange and ESC production. To determine if such variations also occur at the genetic level, molecular approaches, in cluding PCR-RFLP, RAPD, and sequence analysis of intern al transcribed spacer (ITS) re gion and the conserved gene ( tubulin), were used to further characterize E. fawcettii isolates with differ virulence. As assessed by PCR-RFLP of the amplified ITS rDNA fragment (~600 bp) cleaved with either Hae III, Msp I, or Taq I, isolate Ef41 apparently ha d DNA banding profiles that were clearly distinguishable from those of other isol ates tested (Fig. 6-4). Polymorphisms of the amplified -tubulin gene fragments digested with Hae III or Taq I, also separated isolate Ef41 from other E. fawcettii isolates (Fig. 6-5). The am plified tubulin cleaved with Alu I, Dpn I, Msp I, or NlaIV resulted in similar profiles among E. fawcettii isolates (Fig. 6-5). Furthermore, isolate Ef41 was apparently different from other E. fawcettii isolates when randomly amplified DNA fragments using a 10-mer primer OPX-7, OPX13, or MtR 1 were compared (Fig. 6-6). The amplified ITS 1 region from isolates Ef12, Ef29, Ef41, and Ef49 was sequenced and compared with the published sequences in the database (National Ce nter for Biotechnology Information) to determine their phylogenetic relationships. The ITS sequences obtained from isolates Ef29 and Ef49 were iden tical, showing 100% identity, while Ef12 had 90% identity to those of E. fawcettii (EFU28058) and Sphaceloma fawcettii (SFU28059). Isolate Ef41 displayed lowest ITS sequence similarity and a pparently was separated from other E. fawcettii isolates of citrus (Fig. 6-7). Fu rthermore, partial -tubulin gene sequences of isolates Ef12 and Ef41 were compared with the published sequences in the da tabase. The relative identity of fragments is shown in Table 6-2, indicating that isolate Ef41 shared higher nuc leotide identity with isolate Ef12 (85.8%), whereas Ef12 displayed varying similarity of -tubulin gene sequence to other

PAGE 140

140 fungi including Aspergillus nidulans (88.9%), Cercospora beticola (87.0%), Mycosphaerella graminicola (86.7%), Neurospora crassa (90.1%), and Neosartorya fischeri (87.7%) (Table 6-2). Discussion ESCs produced by E. fa wcettii, due to the production of toxic oxygen species upon irradiation, have been shown to be highly toxic to the cells and tissues of citrus and tobacco (Liao and Chung 2008a) and also essential for full virulence of E. fawcettii (Liao and Chung 2008b). Analysis of ESC production and fungal pat hogenicity on three index hosts of citrus (rough lemon, grapefruit, and sour orange) revealed a marked variation among E. fawcettii isolates cultured from Florida. Evidence presente d in this study indicated that the majority of E. fawcettii isolates produced ESCs in axenic cultu re (~90%, Table 6-1), but the production was varied widely with isolate. All E. fawcettii isolates that were pathogenic to rough lemon produced ESCs in culture and/or in planta in spite of lacking of a relationship between the amounts of ESCs accumulated in culture and in planta. The amounts of ESCs produced by an individual fungal isolate in culture or in planta did not account for the severity of scab disease induced by the same isolate. A survey of 52 isolates revealed that four isolates (Ef1, Ef25, Ef27, and Ef47) accumulated no detectable level of ESCs in culture, but pr ovoked characteristic scab lesions and accumulated substantial amounts of ESCs in rough lemon leaves, implicating the presence of signals or substrates from the plant for ESC production. The Ef41 isolate th at was not pathogenic to rough lemon, grapefruit, or sour orange, was unable to produce any detectable ESCs. Since ESCs are extremely toxic upon reaction with oxygen molecu les under light, this study further confirmed the critical role of ESCs for lesion formati on and fungal pathogenesis, consistent with the previous finding from molecular analys is (Liao and Chung 2008b). As all pathogenic E. fawcettii isolates produced varying amounts of ESCs in planta, it is tempting to speculate that a trace

PAGE 141

141 amount of ESCs, continuously pr oduced by the pathogen, might be su fficient to facilitate fungal invasion and colonization to its hosts. The occurrence of citrus scab on various citrus species and cultivars has been reported in different countries of the world, primarily based on field observati on. Yet, little study has been done toward delineating the host range and distribu tion of the species and pathotypes of citrus scab fungi. The Florida Broad Host Range (FBHR) and the Florida Narrow Host Range (FNHR) described in Florida based on host range are not distinguishable genetically (Whiteside 1988; Timer et al. 1996). A recent study described a novel E. fawcettii pathotype that was only pathogenic to Natsudaidia ( C. natsudaidai Hayata) and Kinkoji ( C. obovoidea Hort ex Tak.) fruit in Korea (Hyun et al. 2001). As is evident from the present study, it seem s likely that additional pathotypes or new species of Elsino might be present in Florida citrus-g rowing areas other than FBHR and FNHR. The Ef10 and Ef29 isolates, originally culture d from infected SunCha Shakat mandarin and Swingle citrumelo, respectively, were only weakly virulent to grapefruit, rough lemon, and sour orange. The Ef17 isolate, origina lly cultured from infected Temple leaves, appeared to be highly virulent to sour orange, yet indu ced moderate or mild scab lesions on rough lemon and grapefruit. The Ef12 isolate was highly virulent to the three ci trus hosts tested, but displayed low similarity of the ITS 1 sequence to those of E. fawcettii. The Ef41 isolate, also cultured from infected Temple leaves, was apparently different from ot her field isolates, in terms of pathogenicity, morphology, toxin production, phylogenic variations, and other ge netic variations and thus, likely represents a novel phylogeni c or biological species. Alt hough the Ef41 isolate failed to attack the leaves of three index citrus cultivars, it does not necessarily indicate that Ef41 is an E. fawcettii saprophyte. Similar pathotypes that were nonpa thogenic to rough lemon, grapefruit, and

PAGE 142

142 sour orange have also been re ported from field-collected isolat es in Argentina (Timmer et al. 1996). However, the Argentina isolates had diffe rent ITS RFLP banding profiles from that of Ef41 isolate. Since only a limited nu mber of isolates were tested in this study, it is impossible to conclusively determine if Ef41, Ef29, and Ef49 are different pathotypes of E. fawcettii or simply represent novel cryptic Elsino species that have not yet been characterized in citrus. More field isolates need to be tested and a broader range of citrus cultivars are required to be inoculated to understand the complexity of all of the pathotypes of E. fawcettii in Florida.

PAGE 143

143 Table 6-1. Pathogenicity and produ ction of elsinochromes (ESCs) in vivo and in planta by different field isolates of Elsino fawcettii Fungal isolates (No. and names) Disease severity2 detached-leaf ESC production (nmole per plug or spot) # (Ef) Name Origins1 RL GF SO In vitro3 In planta4 1 Duda-Imk-1 Temple +++nd5nd 0 0.5 2 Duda-Imk-2 Temple ++++ndnd3.0 1.3 nd 3 Duda-Imk-5 Temple ++++ndnd8.8 0.4 nd 4 Eus-1 Murcott +++++ndnd3.2 1.2 nd 5 Eus-2 Murcott +++ndnd1.8 0.6 nd 6 Eus-3 Murcott +++++ndnd1.6 0.2 nd 7 Eus-4 Murcott +++ndnd2.6 0.2 nd 8 Lkpcd-2 Temple +++++ndnd4.0 0.6 nd 9 Navarro-3 Grapefruit +++++ndnd5.0 0.2 8.9 10 Scsk Sun Shu Shakat +/-++12.6 3.0 0 11 Navarro-6 Grapefruit +++++ndnd6.2 0.2 11.6 12 FtPierce-3a Temple +++++++++6.4 3.0 nd 13 FtPierce4b Temple +++ndnd5.6 0.6 nd 14 FtPierce-3 Temple +++ndnd6.8 1.2 nd 15 Carrizo Carrizo citrange +++ndnd0.2 0.0 0.9 16 Irrec-3 Murcott +++ndnd5.6 1.6 nd 17 R-36 Temple +++++++1.4 0.0 1.1 18 Labelle Lemon ++ndnd16.6 1.2 nd 19 Ftmead4 Grapefruit ++++ndnd5.6 0.6 nd 20 Duda-Imk-3 Temple ++++ndnd4.4 0.7 nd 21 Ss-Imk-3 Temple ++++ndnd3.0 0.6 nd 22 Ss-Imk-1 Temple ++++ndnd5.8 0.6 2.2 23 Tbl-La-2 Temple ++++ndnd6.2 0.8 6.0 24 Rl-2 Rough lemon ++++ndnd7.8 0.8 4.6 25 Russel-15 Temple +++++ndnd 0 2.9 26 Smoak 1 Temple +++++ndnd0.7 0.2 7.7 27 Ss Imk 1 Tahiti lime +++++ndnd 0 2.6 28 Stl-Lv-d Temple +++ndnd6.2 1.2 1.7 29 Citro-1 Swingle citrumelo +/-++/-2.6 0.6 0.9 30 Eus-Lv-1 Murcott +++++++++/-3.8 0.4 nd 31 Eus-1 Temple ++ndnd7.9 0.8 nd 32 Ftmead 3 Grapefruit +++++ndnd3.0 0.4 nd

PAGE 144

144 Table 6-1. (Continued) Fungal isolates (No. and names) Disease severity2 detached-leaf ESC production (nmole per plug or spot) # (Ef) Name Origins1 RL GF SO In vitro3 In planta4 33 FtPierce-1 Temple +++++ndnd5.4 0.8 nd 34 FtPierce-4c Temple +++++ndnd5.8 0.6 nd 35 Imk-Br-1a Grapefruit +++ndnd5.2 0.8 nd 36 Imk-Br-1b Grapefruit +++ndnd5.6 0.4 nd 37 Imk-Br-1c Grapefruit +++++++++/-6.2 1.2 nd 38 Imk-br-2 Grapefruit +++ndnd5.2 0.6 nd 39 SWFREC-Lv-1 Murcott ++++ndnd5.2 0.6 4.9 40 Imk-Br-3a2 Grapefruit +++ndnd3.8 0.8 nd 41 SWFRECImk-1 Temple --0 0 42 Imk-Br-3c Grapefruit +++ndnd3.2 0.4 2.6 43 Tbl-La-1 Temple ++++ndnd6.4 0.4 7.9 44 Imk-Br-3e Grapefruit +++ndnd7.2 0.2 nd 45 Imk-Br-4d Grapefruit +++ndnd5.6 0.4 nd 46 Lefond b Grapefruit +++ndnd6.0 1.4 nd 47 Lefond d Grapefruit +++ndnd 0 1.1 48 Manatee w-2 Temple +++++++++++5.2 0.6 nd 49 Cbl-Wh-1 Unknown +++++/-6.5 0.4 1.2 50 Manatee w-5 Temple ++++ndnd5.0 0.2 4.7 51 Avonpark m2 Unknown ++++ndnd5.8 0.6 7.5 52 Avonpark m3 Unknown ++++ndnd4.8 0.6 2.1 1Citrus species or cultivars (Citrus spp.). Temple ( C. temple ), Murcott ( C. reticulate x C. sinensis ), Grapefruit ( C. paradisi ), Sun Shu Shakat ( C. sinesis ), Carrizo citrange ( C. sinensis x Poncitrus trifoliate ), Lemon ( C. limon ), Rough lemon ( C. jambhiri ), Tahiti lime ( C. aurantifolia ), Swingle citrumelo ( C. paradisi x P. trifoliata ), sour orange (C. aurantium ). 2Pathogenicity assays were performed on detached leav es (7-10 days after flushing) inoculated with conidial suspension (1 x 105 mL-1). Inoculated leaves were kept in a moist chamber under constant florescent light for 15 days. Disease severity was rated on a scale, for no lesion formation; +/-, chlorotic reaction only, no scab pustules; +, lesions with minor necrosis, and +++++, lesions with severe necrosis. RL, rough lemon; GF, grap efruit; SO, sour orange. 3Fungal isolates were cultured on PDA under constant light for 10 days and elsinochromes (ESCs) were extracted with 5N KOH and measured at A480. Data are the means and standard errors of four replicates containing 12 agar plugs of each sample. 4Conidial suspension was inoculated onto detached rough lemon leaves and incubated for 14 days. In total, 20 spots (2-mm in diameter) were cut from various leaves, pooled, and soaked in ethyl acetate. ESCs were separated on TLC plate (Fig. 6-1) and quan tified using a regression line established with known concentrations of ESCs and cercosporin. 5nd, not determined

PAGE 145

145 Table 6-2. Sequence identi ty (%) of fungal partial -tubulin gene Fungus1 Ef12 Ef41 AN CB MG NC NF SS VD EF12 85.82 88.9 87.0 86.7 90.1 87.7 75.0 76.0 EF41 84.1 84.5 84.5 85.0 82.6 71.0 74.1 AN 87.7 85.2 90.8 92.5 75.4 76.3 CB 88.1 88.1 88.1 74.2 74.2 MG 86.7 85.5 74.0 73.8 NC 89.1 77.5 79.9 NF 75.8 75.7 SS 80.3 VD 1Partial -tubulin genes of Elsino fawcettii isolates Ef12 and Ef41 were am plified and sequenced. Partial -tubulin genes from other fungi were obtain ed from Genbank with accession numbers. AN, Aspergillus nidulans (XM_653694); CB, Cercospora beticola (AY856373); MG, Mycosphaerella graminicola (AJ310917); NC, Neurospora crassa (XM_952576); NF, Neosartorya fischeri (XM_001264677); SS, Sclerotinia sclerotiorum (AY12374); VD, Verticillium dahliae (DQ266135) 2Nucleotide identity (%) was analyzed by embo ss MATCHER program (Sanger Institute, Hinxton, Cambridge, UK.). Approximately, 485-bp sequences fro m each organism were aligned and compared for identities (Fig. D-3).

PAGE 146

146 Figure 6-1. Thin-layer chromatography analysis (TLC) of ESC phytotoxi ns (the red/orange pigments) extracted from affected rough le mon leaves inoculat ed with different isolates of Elsino fawcettii. Fungal isolates were inoc ulated onto detached rough lemon leaves and incubated for 15 days for lesion development in a moist chamber. Leaf lesions were pooled and soaked in ethyl acetate. ESCs were recovered by suspending in small volumes of acetone and separated on TLC plates with a solvent system containing chloroform and ethyl ace tate (1:1, v:v). ESCs extracted from cultural filtrate (C) of CAL WH-1 isol ate showing five distinct bands at Rf as indicated were used as positive controls (Chapter 2), whereas negative controls were the extracts of rough lemon leaves (L) inocul ated with water only. Fungal isolates that did not produce detectable ES Cs in culture are circled.

PAGE 147

147 Figure 6-2. Determination of extr acellular enzyme activities: A) proteolysase; B) cellulase; C) pectolytic activities (m ainly pectin lyase, pH 4.5 and pectin methyl esterase, pH 7.6); D) pectolytic activities (primarily endoand exo-PGs, pH 4.5 and pectate lyase, pH7.6); and E) cutinase by Elsino fawcettii isolates. Fungal isolates were grown on CM with inducers [5% skim malk; 0.5% CM C; 1% PG; 1% citrus pectin, or 0.1% HHDA] as appropriate for 4-10 days and en zymatic activities were measured either by diameter of clear zone (proteolytic act ivity) or by spectrophotometry after reaction with appropriate chromogens (cellulase, pectolytic, and cutinase activities). Each column represents the mean value of enzymatic activity from two independent experiments with at least thr ee replicates. Vertical bars represent standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001. Details in measuring enzymatic activities are described in the text. F) Northern-blot analys is of fungal RNA purified from isolate Ef12 and Ef41 of Elsino fawcettii RNA was denatured in a formaldehyde-containing gel, blotted to a nylon membrane, and hybridized to a DNA probe (probe 3) generated from EfPKS1 gene of E. fawcettii CAL WH-1 isolate as described in chapter 4. Gel stained with ethidium bromide indicates relative lo ading of the RNA samples. Sizes of hybridization bands are indicat ed in kilobase pairs.

PAGE 148

148 Figure 6-3. Alleviation of symptom development by co-inoculation of two Elsino fawcettii isolates. Conidial suspensions (1 L, 1 x 105 mL-1) of a non-pathogenic isolate (Ef41), two low/moderate-virulent isolates (Ef29 a nd Ef49), and a high-virulent isolate (Ef12) of Elsino fawcettii were placed alone or in combina tions onto detached leaves of rough lemon (A), and grapefruit (B) (14 days after emergence). Inoculated leaves were incubated in a moist chamber. Forma tion of scab lesions was recorded 12 days post inoculation. The controls were inoculated with water only. Disease severity is rated on a scale, 0 for no lesion formation; 1, chlorotic reaction only, no scab pustules; 2, lesions with minor pustules; 3, scab pustules present, shower forming; 4, scab formed on all sites; and 5, lesions with severe pustules. % leaves with symptoms was calculated from over 100 leaves inoculated in three independ ent experiments.

PAGE 149

149 Figure 6-4. Electrophoresis of the amplified inte rnal transcribed spacer (ITS) rDNA fragments after cleaved with A) Hae III; B) Msp I; C) Taq I on 2% agarose gels. The numbers of Elsino fawcettii isolates are marked upon the lanes. M1, the 123 DNA ladder; M2, 1 kb ladder (Promega). Isolate Ef41 showed the different patterns among all three restriction enzyme digestions comp ared to the remaining isolates.

PAGE 150

150 Figure 6-5. Electrophoresis of the amplified partial -tubulin genes (~500bp) digested with six different 4-bp recognition sequence restriction enzymes on 2% agarose gels. The numbers of Elsino fawcettii isolates are marked upon the lanes. M, the 100 bp DNA ladder. The pattern of isol ate Ef41 differed from the Hae III and Taq I digestion patterns of the other two rema ining isolates, Ef12 and Ef49.

PAGE 151

151 Figure 6-6. Electrophoresis of the randomly amplified polymorphic DNA fragments (RAPD) on 2% agarose gels. The numbers of Elsino fawcettii isolates are marked upon the lanes. M, 1 kb ladder (Promega). 10-mer primer s, OPX-7, OPX-13, or MtR 1 was used to randomly amplify DNA from the isolates. Is olate Ef41 showed the different patterns from the remaining isolates in all three amplifications.

PAGE 152

152 Figure 6-7. Comparison of the internal tran scribed spacer 1 (ITS 1) sequences between Elsino fawcettii Florida isolates and other Elsino spp. and other species belonging to the order of Loculoascomycetes via phylogeneti c analysis. The phylogenetic tree was generated by using DS Gene v2.5 program with 100 bootstrap replicates. E. fawcettii Florida isolates Ef12, Ef29, Ef41, and Ef49 were sequenced in this study. Accession numbers for all sequences obtained from GenBank, original-collected host of Elsino spp, and location of Elsino spp. were indicated in parentheses.

PAGE 153

153 APPENDIX A SUPPLEMENTAL DATA FOR CHAPTER TWO Figure A-1. Spectrophotometric absorbance of elsinochromes (ESCs) treated with 3-( N morpholino) propanesulfonic acid (MOPS) buffer (open bars), ESCs treated with nitrotetrazolium blue chloride (NBT) (hat ched bars), or ESCs treated with both MOPS and NBT (closed bars) at 560 nm. Ver tical bars represent standard deviation. Means followed by the same letter are not different at judged by Duncans multiple range test at P < 0.0001.

PAGE 154

154 APPENDIX B SUPPLEMENTAL DATA FOR CHAPTER THREE Table B-1. Effects of ions on ESC production on CM by E. fawcettii Treatment Concn (mM) Mean colony dai. (mm) SEM ESC (nmoles per plug), mean SEM none 10.31 0.24 2.72 0.32 CuCl2H2O 0.1 nd1nd 1.0 9.34 0.416.94 0.36 10.0 ndnd FeCl3 0.1 10.22 0.21 3.84 0.22 0.2 10.97 0.12 3.00 1.24 0.5 10.97 0.45 3.70 1.52 1.0 9.72 0.12 3.56 1.08 2.0 10.19 0.65 5.60 0.70 10.0 nd nd KCl 50.0 nd nd 100.0 10.56 0.24 3.08 0.16 MgCl2H2O 50.0 nd nd 100.0 9.56 0.60 2.78 0.72 MnCl2H2O 0.2 10.31 0.52 1.46 0.56 1.0 9.81 0.31 4.48 0.56 5.0 9.81 0.38 5.68 1.00 10.0 10.50 0.46 5.92 0.18 100.0 nd nd NaCl 50.0 nd nd 100.0 10.44 0.60 4.94 0.22 ZnCl2 0.1 nd nd 1.0 11.00 0.43 5.52 0.38 10.0 nd nd 1nd, not determined

PAGE 155

155 APPENDIX C SUPPLEMENTAL DATA FOR CHAPTER FOUR Table C-1. Sequences of prim ers Name Sequences efup 1 5-GCACTCCTGACCCGATTGGA-3 efup 5 5-CCGATCTACGCTCCTTACCACGCTG-3 efpks 1 5-CTCCACGTGAAGCGGCACAGAC-3 efpks 5 5-GGATCAGTCTGTGCCGCTTCACGTGG-3 efdown 5 5-CGGTAGTTGTGCTGGATGCGACGAG-3 efdown 8 5-CCGAAACGCCCTTGGTTCAAAGATG-3 ef down 10 5-CATCATCGGCGGTTGGTCAGCAGG-3

PAGE 156

156 Figure C-1. Schematic describing the st rategies to obtain full-length of EfPKS1 The amplified DNA fragment (hatched bar, about 700 bp) by two degenerate oligonucleotides (LCKS1/LCKS2) was first used for extens ion of 5 and 3 franking region of EfPKS1 gene. Chromosome walking (CW) and inverse PCR (IP) were used to obtain fulllength of EfPKS1. Arrowheads indicate relative positions of primers used for chromosome walking (efpks 1, efpks 5, and efdown 10) and inverse PCR (efup 1/efup 5 and efdown 5/efdown 8). Restriction enzyme sites used for inverse PCR were indicated. Drawing is not to scale.

PAGE 157

157 APPENDIX D SUPPLEMENTAL DATA FOR CHAPTER SIX Table D-1. Germ ination of Elsino fawcettii isolates on detached l eaves of rough lemon and grapefruit Isolate no. Pathogenicity1 Germination (% of conidia with germ tube/total conidia)2 Rough lemon Grapefruit 41 none 0 0 29 low 4 0.3 2 0.1 12 high 33 4.3 23 3.0 1Pathogenicity assays were conducted on detached leaves as described in Table 6-1. 2Germination was evident by forming germ tube. Fo r each isolate, 100 conidia were examined and the data show the means and standard erro rs of three independent experiments.

PAGE 158

158 Figure D-1. Elsino fawcettii hyphae observed using a light mi croscope at x 200 magnification. Nonpathogenic isolate (Ef41), low virule nce isolates (Ef10, Ef17, Ef29, and Ef49), and high virulence isolates (Ef12, Ef30, Ef37, and Ef48) of Elsino fawcettii were cultured on PDA under constant fluorescence light. Small pieces of young (4 day culture) and old (8 day culture) mycelia were removed from PDA, suspended in water and placed on slides for observation.

PAGE 159

159 Figure D-2. Variation of fungal colony under a dissection microscope at x 25 magnification. Non-pathogenic isolate (Ef41), low viru lence isolates (Ef10, Ef17, Ef29, and Ef49), and high virulence isolates (Ef12, Ef30, Ef37, and Ef48) of Elsino fawcettii were cultured on PDA media under constant fluorescence light for 10 days.

PAGE 160

160 EF12CGAGCTGTGACCTGTTCCAGAGCTTACACAGCACATCTTCGACCCCAGGAACATGATGGC EF41CGCGCCGTTAGC_GTGCCAGAACTTACCCAGCAAATCTTCGACCCGAGGAACATGATGGC AN__CGCGCTGTTTCC_GTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGC CB__CGTGCTGTCACC_GTTCCAGAGCTCACCCAGCAAATCTTCGACCCCAAGAACATGATGGC MG__CGCGCCGTCACC_GTCCCCGAGCTCACCCAGCAAATCTTCGACCCCAAGAACATGATGGC NC__CGTGCCGTCTCC_GTGCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGC NF__CGTGCTGTCTCC_GTTCCTGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGC SS__CGTGCTGTTACT_GTTCCAGAGTTGACCCAACAAATGTATGATCCTAAGAACATGATGGC VD__CGTGCCGTCAGC_GTTCCTGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATGGC EF12TGC_TTCCGACTTCCGCAACGGTCGTTACCTCACCTGCTCTGCCATCTT___________ EF41CGC_AGCTGACTTCCGCAACGGACGCTACCTCACCTGCTCTGCCATCTT___________ AN__TGC_CTCTGACTTCCGCAACGGCCGCTACCTCACCTGCTCCGCTATCTT___________ CB__CGCCAGC_GACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTA___________ MG__CGCCAGC_GATTTCCGCAACGGTCGTTACCTCACCTGCTCCGCCATCTA___________ NC__TGC_TTCTGACTTCCGCAACGGTCGTTACCTCACCTGCTCTGCCATCTT___________ NF__TGC_TTCCGACTTCCGCAACGGACGTTACCTCACCTGCTCTGCCATTTT___________ SS__CGC_TTCCGATTTCCGTAACGGTCGTTACTTAACCTGCTCTGCTATCTTGTAAGTTTGCC VD__CGC_CTCTGACTTCCGTAACGGTCGCTACCTGACCTGCTCCGCCATCTTGTAAGCTCTAC EF12_________________________________________________________CCG EF41_________________________________________________________CCG AN___________________________________________________________CCG CB___________________________________________________________CCG MG___________________________________________________________CCG NC___________________________________________________________CCG NF___________________________________________________________CCG SS__ATATTACCCG_______________TCTGCAGCTCTATATATACTAATCGTGTGCAGCCG VD__CACCCCCCCTAAGCTCGTCCAAATTTGCTCTTTTCTAACAAAGTTTCCCTTCACCAGCCG EF12TGGCAAGGTCGCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTCCAGACCAAGAACCC EF41TGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATCCGTAACGTTCAGAACCGCAACCC AN__TGGAAAGGTCTCCATGAAGGAGGTTGAGGACCAGATGCGCAACATCCAGAGCAAGAACCA CB__TGGCAAGGTCTCCATGAAGGAAGTTGAGGACCAGATCCGCAACGTGCAGAACAAGAACAC MG__CGGAAAGGTGTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACAC NC__TGGCAAGGTCTCCATGAAGGAGGTTGAGGACCAGATGCGCAACGTTCAGAACAAGAACTC NF__TGGTAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACATCCAGTCCAAGAACCA SS__TGGTAAGGTTTCCATTAAGGAGGTTGAGGACCAAATGCGCAATGTCCAAAACAAGAACTC VD__TGGCAAGGTTGCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAGCAAGAACTC Figure D-3. Alignment of nucleo tide sequences of fungal partial -tubulin genes. The % identity between organisms were desc ribed in Table 6-2. Partial -tubulin genes of Elsino fawcettii isolates, Ef12, and Ef41, were amplifie d by primer sets, Bt1F and Bt1R, and sequenced. Partial -tubulin genes from other f ungi were obtained from Genbank with accession numbers. AN, Aspergillus nidulans (XM_653694); CB, Cercospora beticola (AY856373); MG, Mycosphaerella graminicola (AJ310917); NC, Neurospora crassa (XM_952576); NF, Neosartorya fischeri (XM_001264677); SS, Sclerotinia sclerotiorum (AY12374); VD, Verticillium dahliae (DQ266135).

PAGE 161

161 EF12CTCATACTTCGTCGAGTGGATCCCGAACAACGTCCAGACCGCCCTCTGCTCTATTCCCCC EF41TGCCTACTTCGTCGAGTGGATCCCCAACAACGTCCAGACCGCGCTGTGCTCAATCCCACC AN__GTCCTACTTCGTCGAGTGGATTCCCAACAACATCCAGACCGCTCTCTGCTCCATTCCTCC CB__TGCCTACTTCGTCGAGTGGATTCCAAACAACGTCCAGACCGCACTGTGCTCTATCCCACC MG__CGCATACTTCGTCGAGTGGATCCCGAACAACGTCCAGACCGCGCTGTGCTCCATTCCTCC NC__TTCCTACTTCGTCGAGTGGATCCCCAACAACGTCCAGACTGCCCTCTGCTCTATCCCTCC NF__GAGCTACTTCGTTGAGTGGATTCCCAACAACATCCAGACCGCTCTGTGCTCCATTCCCCC SS__TTCCTACTTCGTCGAGTGGATCCCTAACAATGTCCAAACCGCCCTTTGCTCCATTCCTCC VD__TTCGTACTTCGTTGAGTGGATCCCCAACAACGTCCAGACCGCCCTTTGCTCCATCCCTCC EF12ACGCGGCCTCAAGATGTCTTCCACCTTTGTCGGCAACTCCACCTCCATTCAGGAGCTCTT EF41AAAGGGCCTCAAGATGTCGTCGACTTTCGTCGGCAACTCGACTTCCATCCAGGAGCTCTT AN__CCGCGGCCTCAAGATGTCTTCCACCTTCATTGGAAACTCTACTTCCATCCAGGAGCTCTT CB__ACGCGGCCTCAAGATGTCTTCTACCTTCGTTGGAAACAGCACTTCGATCCAGGAGCTCTT MG__CCGTGGATTGAAGATGTCGTCCACCTTCGTCGGCAACTCCACCTCCATTCAGGAGCTCTT NC__CCGCGGTCTCAAGATGTCCTCCACCTTCGTCGGTAACTCCACCGCCATCCAGGAGCTCTT NF__CCGTGGCCTGAAGATGTCCTCCACCTTCATTGGTAACTCCACCTCCATCCAGGAGCTGTT SS__CCGTGGTCTCAAGATGTCCTCCACCTTCGTCGGTAACTCGGCCTCCATCCAAGAACTCTT VD__CCGTGGCCTCAAGATGTCCTCCACCTTCGTCGGTAACTCCACCGCCATCCAGGAGCTCTT EF12CAAGCGTGTTGGCGATCAGTTCACTGCTATGTTCCGTCGCAAGGCTTTCTTGCATTGGTA EF41CAAGCGTGTTGGCGACCAGTTCTCCGCTATGTTCCGTCGCAAGGCTTTCCTTCACTGGTA AN__CAAGCGTGTCGGTGACCAGTTCACTGCTATGTTCCGTCGCAAGGCTTTCTTGCATTGGTA CB__CAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCCTTCTTGCACTGGTA MG__TAAGCGTGTCGGTGACCAGTTCTCCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTA NC__CAAGCGTATCGGCGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTA NF__CAAGCGTGTCGGTGATCAGTTCACTGCTATGTTCCGTCGCAAGGCTTTCTTGCATTGGTA SS__CAAGCGTGTCGGTGATCAATTCACTGCTATGTTCAGAAGAAAGGCTTTCTTGCATTGGTA VD__CAAGCGTATCGGCGAGCAGTTCACTGCCATGTTCCGGCGCAAGGCTTTCCTTCACTGGTA EF12CACTGGTGAGGGCATGGACGAGATGGAGTTCACTGAGGCTGAGTTCAACATGAACGATCT EF41CACCAGCGAAGGTATGGACGAGATGGAGTTCACCGAAGCAGAGTTCAACATGAACGATCT AN__CACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCTGAGAGCAACATGAACGATCT CB__CACTGGCGAGGGTATGGACGAGATGGAGTTCACTGAGGCTGAGTCCAACATGAACGACTT MG__CACTGGCGAGGGCATGGATAAGATGGAGTTTACCGAGGCCGAGTCCAACATGAACGATTT NC__CACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCTGAGTCCAACATGAACGATCT NF__CACTGGCGAGGGTATGGACGAGATGGAGTTCACTGAGGCCGAGAGCAACATGAACGATCT SS__CACTGGCGAAGGTATGGACGAAATGGAGTTCACTGAGGCTGAGTCCAACATGAACGATTT VD__CACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCTGAGTTCAACATGAACGATCT EF12CGTC EF41CGTC AN__CGTC CB__GGTG MG__GGT NC__CGTC NF__GGTC SS__GGTC VD__CGTC Figure D-3. (Continued)

PAGE 162

162 LIST OF REFERENCES Ada ms, T. H., Wieser, J. K., and Yu, J.-K. 1998. Asexual sporulation in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 62:35-54. Adams, T. H., and Yu, J.-H. 1998. Coordinate c ontrol of secondary metabolite production and asexual sporulation in Aspergillus nidulans Curr. Opinion Microbiol. 1:674. Agrios, G. N. 1997. Plant Pathology, 4th edition, Academic Press, San Diego, California. Alexopoulos, C. J., Mims, C. W., and Blackwell, M. 1996. Introductory Mycology, 4th edition. Wiley, New York. Alferez, F., Pozo, L., and Burns, J. K. 2006. Phys iological changes associated with senescence and abscission in mature citrus fruit induced by 5-chloro-3-methyl-4-nitro-1 H -pyrazole and ethephon application. Physiologia Plantarum 127:66-73. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new ge neration of protein database search programs. Nucl. Acids Res. 25:3389-3402. Andrianopoulos, A., and Timb erlake, W. E. 1994. The Aspergillus nidulans abaA gene encodes a transcriptional activator that acts as a geneti c switch to control development. Mol. Cell. Biol. 14:2503-2515. Arnone, A., Assante, G., Di Modugno, V., Merlini, L., and Nasini, G. 1988. Perylenequinones from cucumber seedlings infected with Cladosporium cucumerinum. Phytochem. 6:16751678. Assante, G., Merlini, G., and Nasini, G. 1977. +/Abscisic acid a metabolite of the fungus Cercospora rosicola Experientia 33:1551-1557. Bailey, M. J., Buchert, J., and Viikari, L. 1993. Effect of pH on pr oduction of xylanase by Trichoderma reesei on xylanand cellulose -based media. Appl. Microbiol. Biotech. 40:224-229. Bender, C. L., Alarcn-Chaid ez, F., and Gross, D. C. 1999. Pseucomonas syringae Phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthases. Microbiol. Mol. Biol. Rev. 63:266-292. Beruchamp, C. O., and Fridovich, I. 1971. Superoxi de dismutase: improved assays and an assay applicable to acrylamide gel. Anal. Biochem. 44:276-287. Bingle, L. E. H., Simpson, T. J., and Lazarus, C. M. 1999. Ketosynthase domain probes identify two subclasses of fungal polyketide syntha se genes. Fungal Genet. Biol. 26:209-223. Birch, A. J. 1967. Biosynthesis of polyketi des and related com pounds. Science 156:202-206.

PAGE 163

163 Bitancourt, A. A., and Jenkins, A. E. 1936a. Elsino fawcettii, the perfect stage of the citrus scab fungus. Phytopathol. 26:393-396. Bitancourt, A. A., and Jenkins, A. E. 1936b. The pe rfect stage of the sweet orange scab fungus. Mycologia 28:489-492. Brodhagen, M., and Keller, N. P. 2006. Signallin g pathways connecting mycotoxin production and sporulation. Mol. Plant Pathol. 7:285-301. Brookman, J. L., Mennim, G., Trinci, A. P. J., Thenodorou, M. K., and Tuckwell, D. S. 2000. Identification and characterization of anaerob ic gut fungi using molecular methodologies based on ribosomal ITS 1 and 18S rRNA. Microbiol. 146:393-403. Bushong, P. M., and Timmer, L. W. 2000. Evaluation of postinfection control of citrus scab and melanose with benomyl, fenbuconazole, and azoxystrobin. Plant Dis. 84:1246-1249. Butler, M. J., Day, A. W., Henson, J. M., a nd Money, N. P. 2001. Pathogenic properties of fungal melanins. Mycologia 93:1-8. Callahan, T. M., Rose, M. S., Meade, M. J ., Ehrenshaft, M., and Upchurch, R. G. 1999. CFP, the putative cercosporin transporter of Cercospora kikuchii, is required for wild type cercosporin production, resistance and virulence on soybean. Mol. Plant-Microbe Interact. 12:901-910. Calvo, A. M., Gardner, H. W ., and Keller, N. P. 2001. Genetic connection between fatty acid metabolism and sporulation in Aspergillus nidulans J. Biol. Chem. 276:25766-25774. Calvo, A. M., Wilson, R. A., Bok, J. W., and Ke ller, N. P. 2002. Relationship between secondary metabolism and fungal development. Mi crobiol. Mol. Biol. Rev. 66:447-459. Caracuel, Z., Roncero, M. I. G., Espeso, E. A., Gonzlez-Verdejo, C. I., Garca-Maceira, F. I., and Pietro, A. D. 2003. The pH signaling transcription factor PacC controls virulence in the plant pathogen Fusarium oxysporum. Mol. Microbiol. 48:765-779. Chen, H.-Q., Dekkers, K. L., Rollins, J. A., Ko, N. J., Timmer, L. W., and Chung, K.-R. 2005. A gene with domains related to transcription regulation is required for pathogenicity in Colletotrichum acutatum causing Key lime anthracnose. Mol. Plant Pathol. 6:513-525. Chen H.-Q., Lee, M. H., Daub, M. E., and Chung, K.-R. 2007. Molecular analysis of the cercosporin biosynthetic gene cluster in Cercospora nicotianae. Mol. Microbiol. 64:755770. Chet, I., and Httermann, A. 1982. De novo synthe sis of polyphenol oxida se (Laccase) during formation of sclerotia in Sclerotium rolfsii FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 14:211-215.

PAGE 164

164 Choquer, M., Dekkers, K. A., Chen, H.-Q., Ue ng, P. P., Daub, M. E., and Chung, K.-R. 2005. The CTB1 gene encoding a fungal polyketide sy nthase is required for cercosporin biosynthesis and fungal virulence of Cercospora nicotianae. Mol. Plant-Microbe Interact. 18:468-476. Choquer, M., Lee, M. H., Bau, H. J., and Chung, K.-R. 2007. Deletion of a MFS transporter-like gene in Cercospora nicotianae reduces cercosporin toxin accumulation and fungal virulence. FEBS (Fed. Eur. Biochem. Soc.) Lett. 581:489-494. Chung, K.-R., Shilts, T., Li, W., and Timmer, L. W. 2002. Engineering a genetic transformation system for Colletotrichum acutatum, the causal fungus of lime anthracnose and postbloom fruit drop. FEMS (Fed. Eur. Microbio l. Soc.) Microbiol. Lett. 213:33-39. Chung, K.-R., and Timmer, L. W. 2005. Citrus dis ease exotic to Florida: Sweet orange scab (SOS). Institution of Food and Agricultural Scien ces, University of Florida, Gainesville. 12 January 2008. < http://edis.ifas .ufl.edu/PP147> Cortes, J., H aydock, S. F., Roberts, G. A., Bevitt, D. J., and Leadlay, P. F. 1990. An unusually large multifunctional polypeptide in the erythromycin producing polyketide synthase of Saccharopolyspora erythraea. Nature 348:176-178. Cotty, P. J. 1988. Aflatoxin and sclerotial production by Aspergillus flavus : Influence of pH. Phytopathol. 78:1250-1253. Cox, R. J., Glod, F., Hurley, D., Lazarus, C. M ., Nicholson, T. P., Rudd, B. A. M., Simpson, T. J., Wilkinson, B., and Zhang, Y. 2004. Ra pid cloning and expression of a fungal polyketide synthase gene i nvolved in squalestatin bios ynthesis. Chem. Commun. 22602261. Cuero, R., Duffus, E., Williams, M., Baca, D. and Navarro, M. 1988. Effects of zinc and associated mycoflora on fungal growth and toxin production: F. moniliforme F. graminearum Aspergillus flavus. pp. 311-319. In Miraglia, M., van Egmond, H., Brera, C. and Gilbert, J. (eds.). Mycotoxins an d Phycotoxins-Developments in Chemistry, Toxicology and Food Safety, Chapter 33. Fort Collins, CO: Alaken Inc. Cuero, R., and Ouellet, T. 2005. Metal ions modulate gene expression and accumulation of the mycotoxins aflatoxin and zearalenon e. J. Appl. Microbiol. 98:598-605. Cuero, R., Ouellet, T., Yu, J., and Mogongwa, N. 2003. Metal ion enhancement of fungal growth, gene expression and aflatoxin synthesis in Aspergillus flavus : RT-PCR characterization. J. Appl. Microbiol. 94:953-961. Daub, M. E. 1982a. Cercosporin, a photosensitizing toxin from Cercospora species. Photopathol. 72:370-374. Daub, M. E. 1982b. Peroxidation of tobacco memb rane lipids by the photosensitizing toxin, cercosporin. Plant Physiol. 69:1361-1364.

PAGE 165

165 Daub, M. E., and Ehrenshaft, M. 2000. The photoactivated Cercospora toxin cercosporin: contributions to plant disease and fund amental biology. Annu. Rev. Phytopathol. 38:461490. Daub, M. E., and Hangarter, R. 1983. Light -induced production of singlet oxygen and superoxide by the fungal toxin, cerco sporin. Plant Physiol. 73:855-857. Daub, M. E., Herrero, S., and Chung, K.-R. 2005. P hotoactivated perylenequinone toxins in fungal pathogenesis of plants. FEMS (Fe d. Eur. Microbiol. Soc.) Microbiol. Lett. 252:197206. Davis, V. M., and Stack, M. E. 1991. Mutagenic ity of stemphyltoxin III, a metabolite of Alternaria alternata Appl. Environ. Microbiol. 57:180-182. Dekkers, L. A., You, B. J., Gowda, V. S., Liao, H.-L., Lee, M. H., Bau, H. J., Ueng, P. P., and Chung, K.-R. 2007. The Cercospora nicotianae gene encoding dual O -methyltransferase and FAD-dependent monooxygenase domains medi ates cercosporin toxin biosynthesis. Fungal Genet. Biol. 44:444-454. Demain, A. L., and Fang, A. 2000. The natural functions of secondary metabolites. Adv. Biochem. Eng. Biotechnol. 69:1-39. Diwu, Z. 1995. Novel therapeutic and diagnostic applications of hypocrellins and hypericins. Photochem. Photobiol. 61:529-539. Dobrowolski, D. C., and Foote, C. S. 1983. Ch emistry of singlet oxygen 46. Quantum yield of cercosporin-sensitized singlet oxygen formation. Angewante Chemie 95:729-730. Donadlo, S., Staver, M. J., McAlpine, J. B ., Swanson, S. J., and Katz, L. 1991. Molecular organization of genes required for complex polyketide biosynthesis. Science 252:675-679. Dowzer, C., and Kelly, J. 1989. Cloning of the creA gene from Aspergillus nidulans : a gene involved in carbon catabolite repr ession. Curr. Genet. 15:457-459. Duncan, J. M., Cooke, D., Brich, P., and Tot h, R. 1998. Molecular variability in sexually reproducing fungal plant pathogens. pp. 19-39. In Bridge, P. D., Couteaudier, Y., and Charkson, J. M. (eds.). Molecular Variabil ity of Fungal Pathogens. Wallingford: CAB International. Duran, N., and Song, P. S. 1986. Hypericin and its photodynamic action. Photochem. Photobiol 43:677-680. Ehrlich, K. C., Montalbano, B. G., Cary, J. W., and Cotty, P. J. 2002. Promoter elements in the aflatoxin patheay polyketide synthase ge ne. Biochimica Biophys ica Acta 1576:171-175. Engh, I., Nowrousian, M., and Kck, U. 2007. Re gulation of melanin biosynthesis via the dihydroxynaphthalene pathway is dependent on sexual development in the ascomycete Sordaria macrospore FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 275:62-70.

PAGE 166

166 Espeso, E. A., Tilburn, J., Sanchez-Pulido, L., Br own, C. V., Valencia, A., Arst, H. N. Jr., and Pealva, M. 1997. Specific DNA recognition by the Aspergillus nidulans three zinc finger transcription factor P acC. J. Mol. Biol. 274:466-480. Fantin, G. 1988. Caracterizaco Morfolgica, Fisiolgica e Patognica de Especies do Elsino em Citros. Universidade de Sao Paulo, Piracicaba, Brazil. Farnochi, M. C., Torres, A. M., Magan, N., and Chulze, S. N. 2004. Effect of antioxidants and competing mycoflora on Fusarium verticillioides and F. proliferatum populations and fumonisin production on maize grain. J. Stored Prod. Res. 41:211-219. Fernandes, M., Keller, N. P., and Adam s, T. H. 1998. Sequence-specific binding by Aspergillus nidulans AflR, a C6 Zinc cluster protein regulating mycotoxin biosynthesis. Mol. Microbiol. 28:1355-1365. Foote, C. S., and Denny, R. W. 1968. Chemis try of singlet oxygen. VII. Quenching by carotene. J. Am. Chem. Soc. 90:6233-6235. Foote, C. S., Chang, Y. C., and Denny, R. W. 1970. Chemistry of singl et oxygen. X. Carotenoid quenching parallels biological protection. J. Am. Chem. Soc. 92:5216-5218. Fortes Villas Boas, R. 1989. Variabilidad e Patognica, Morfol gica e Sorolgica de Elsino fawcettii Bitancourt & Jenkins em Citrus spp. Universidade Estadual Paulista, Botucatu, San Paulo, Brazil. Fries, N. 1978. Basidiospore germination in so me mycorrhiza-forming hymenomycetes. Trans. Brit. Mycol. Soc. 70:319-324. Fry, S. C. 1998. Oxidative scission of plant ce ll wall polysaccharides by ascorbate-induced hydroxyl radicals. Biochem. J. 332:507-515. Funa, N., Awakawa, T., and Horinouchi, S. 2007. Pentaketide resorcylic acid synthesis by Type III polyketide synthase from Neurospora crassa. J. Biol. Chem. 282:14476-14481. Funa, N., Ohnishi, Y., Fujii, I., Shibuya, M., Ebizuka, Y., and Horinouchi, S. 1999. A new pathway for polyketide synthesis in microorganisms. Nature 400:897-899. Gasteiger, E., Gattiker, A., Hoogland, C., and Lv anyi, I. 2003. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucl. Acids Res. 31:3784-3788. Girotti, A. W. 1990. Photodynamic lipid peroxidation in biological systems. Photochem. Photobiol. 51:497-509. Glass, N. L., and Donaldson, G. C. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filame ntous ascomycetes. Appl. Environ. Microbiol. 61:1323-1330.

PAGE 167

167 Grosser, J. W., Gmitter, F. G. Jr., and Chandler J. L. 1988. Intergeneric somatic hybrid plants from sexually incompatible woody species: Citrus sinensis and Severinia disticha Theoretical Appl. Genet. 75:397-401. Henikoff, J. G., Greene, E. A., Pietrokovski, S ., and Henikoff, S. 2000. In creased coverage of protein families with the blocks database servers. Nucl. Acids Res. 28:228-230. Holliday, P. 1980. Fungus diseases of tropical crops. pp. 147-148. Published by Cambridge University Press, Cambridge, England. Hopwood, D. A., and Sherman, D. H. 1990. Mol ecular genetics of polyketides and its comparison to fatty acid biosynthe sis. Annu. Rev. Genet. 24:37-66. Hudson, J. B., and Towers, G. H. N. 1991. Ther apeutic potential of plant photosensitizers. Pharmacol. Ther. 49:181-222. Hudson, J. B., Imperial, V., Haugland, R. P., and Diwu, Z. 1997. Antiviral properties of photoactive perylenequinones. Photochem. Photobiol. 65:352-354. Hutchinson, C. R. 1999. Microbial po lyketide synthases: More and more prolific. Proc. Natl. Acad. Sci. 96:3336-3338. Hyun, J.-W., Timmer, L. W., Lee, S.-C., Yun, S.-H., Ko, S.-W., and Kim, K.-S. 2001. Pathological characterization and molecular analysis of Elsino isolates causing scab diseases of citrus in Jeju Isla nd in Korea. Plant Dis. 85:1013-1017. Jackson, M., Slinger, P. J., and Bothas, R. J. 1989. Effects of zinc, iron, cobalt, and manganese on Fusarium moniliforme NRRL 1316 growth and fusarin C. Biosynthesis in submerged cultures. Appl. Environ. Microbiol. 55:649-655. Jenns, A. E., Daub, M. E., and Upchurch, R. G. 1989. Regulation of cercos porin accumulation in culture by medium and temperature manipulation. Phytopathol. 79:213-219. Johnston, P. R., and Beever, R. E. 1994. Elsino dracophylli sp. nov. N. Z. J. Bot. 32:519-520. Karolewiez, A., and Geisen, R. 2005. Cloning a pa rt of the ochratoxin A biosynthetic gene cluster of Penicillium nordicum and characterization of the ochratoxin polyketide synthase gene. Systematic Appl. Microbiol. 28:588-595. Kawamura, C. T., Tsujimoto, T., and Tsuge, T. 1999. Targeted disr uption of a melanin biosynthesis gene affects coni dial development and UV tolera nce in the Japanese pear pathotype of Alternaria alternate Mol. Plant-Microbe Interact. 12:59-63. Keller, N. P., Nesbitt, C., Sarr, B., Phillips, T. D., and Burow, G. B. 1997. pH regulation of sterigmatocystin and aflatoxin biosynthesis in Aspergillus spp. Phytopathol. 87:643-648. Keller, N. P., Turner, G., and Bennett, J. W. 2005. Fungal secondary metabolism-from biochemistry to genomics. Nat. Rev. Microbiol. 3:937-947.

PAGE 168

168 Kimura, N., and Tsuge, T. 1993. Gene cluster involved in melanin biosynthesis of the filamentous fungus Alternaria alternate. J. Bacteriol. 175:4427-4435. Krinksy, N. I. 1979. Carotenoid protection ag ainst oxidation. Pure Appl. Chem. 51:649-660. Kroken, S., Glass, N. L., Taylor, J. W., Yode r, O. C., and Turgeon, B. G. 2003. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc. Natl. Acad. Sci. 100:15670-15675. Kudla, B., Caddick, M. X., Langdon, T., Martinez-Rossi, N. M., Bennett, C. F., Sibley, S., Davies, R. W., and Arst, H. N. Jr. 1990. The regulatory gene areA mediation nitrogen metabolite repression in Aspergillus nidulans Mutations affecting specificity of gene activation alter a loop resi due of a putative zinc finger. EMBO J. 9:1355-1364. Kulig, M. J., and Smith, L. L. 1973. Sterol metabolism. XXV. Cholesterol oxidation by singlet molecular oxygen. J. Organic Chem. 38:3639-3642. Lewandowski, D. J., and Dawson, W. O. 1998. Deleti on of internal sequences results in tobacco mosaic virus defective RNAs that accumulate to high levels wit hout interfering with replication of the helper virus. Virol. 251:427-437. Li, D., and Kolattukudy, P. E. 1997. Cloning of cutin ase transcription factor 1, a transactivating protein containing Cys6Zn2 binuclear cl uster DNA-binding motif. J. Biol. Chem. 272:12462-12467. Liao, H.-L., and Chung, K.-R. 2008a. Cellular toxici ty of elsinochrome phytotoxins produced by the pathogenic fungus, Elsino fawcettii causing citrus scab. New Phytologist 117:239250. Liao, H.-L., and Chung, K.-R. 2008b. Genetic diss ection defines the roles of elsinochrome phytotoxin for fungal pathogenesis and c onidiation of the citrus pathogen Elsino fawcettii Mol. Plant-Microbe Interact. 21:469-479. Linden, H., and Macino, G. 1997. White collar-2, a partner in blue light signal transduction, controlling expression of light-regulated genes in Neurospora crassa. EMBO (Eur. Mol. Biol. Organ.) J. 16:98-107. Liu, W. Z., Shen, Y. X., Liu, X. F., Chen, Y. T., and Xie, J. L. 2001. A new perylenequinone from Hypomyces sp. Chin. Chem. Lett. 12:431-432. Lousberg, R. J. J. C., Salemink, C. A., Weiss, U., and Batterham, T. J. 1969. Pigments of Elsino species II. Structure of elsinochromes A, B. and C. J. Chem. Soc. (C):1219-1227. Lu, S., Lyngholm, L., Yang, G., Bronson, C., Yo der, O. C., and Turgeon, B. G. 1994. Tagged mutations at the Tox 1 locus of Cochliobolus heterostrophus by restriction enzymemediated integration. Proc. Natl. Acad. Sci. 91:12649-12653.

PAGE 169

169 Malpartida, F., and Hopwood, D. A. 1984. Molecular cloning of th e whole biosynthetic pathway of a Streptomyces antibiotic and its expression in a heterologous host. Nature 309:462-464. Malz, S., Grell, M. N., Thrane, C., Maier, F. J., Rosager, P., Felk, A., Albertsen, K. S., Salomon, S., Bohn, L., Schfer, W., and Giese, H. 2005. Id entification of a gene cluster responsible for the biosynthesis of aurofusarin in the Fusarium graminearum species complex. Fungal Genet. Bio. 42:420-433. Marmorstein, R., and Harrison, S. C. 1994. Crys tal structure of a PPR1-DNA complex: DNA recognition by protei ns containing a Zn2Cys6 binuclear cluster. Genes Dev. 8:2504-2512. Marsh, P., Simpson, M. E., and Truckess, M. W. 1975. Effects of trace metals on the production of aflatoxins by Aspergillus parasiticus J. Appl. Microbiol. 30:52-55. Marzluf, G. A. 1997. Genetic regulation of nitr ogen metabolism in the fungi. Microbiol. Mol. Biol. Rev. 61:17-32. Meille, S. V., Malpezzi, L., A llegra, G., and Nasini, G. 1989. St ructure of elsinochrome A: a perylenequinone metabolite. Acta. Cryst. C 45:628-632. Morrice, J., Mackenzie, D. A., Parr, A. J., and archer, D. B. 1998. Isolation and characterization of the acetyl-CoA carboxylase gene from Aspergillus nidulans Curr. Genet. 34:379-385. Motamedi, H., and Hutchinson, C. R. 1987. Cloni ng and heterologous expression of a gene cluster for the biosynthesis of tetracenomycin C, the anthracycline antitumor antibiotic of Streptomyces glaucescens Proc. Natl. Acad. Sci. 84:4445-4449. Murashige, T., and Skoog, F. 1962. A revised me dium for rapid growth and bioassay with tobacco tissue cultures. Physiologia Plantarum 15:473. Murashige, T., and Tucker, D. P. H. 1969. Growth factor requirements of citrus tissue culture. Proc. First Intl. Citrus Symp. 3:1155-1161. Oannes, C., and Wilson, T. 1968. Quenching of singlet oxygen by tertiary aliphatic amines. Effect of DABCO. J. Am. Chem. Soc. 90:6527-6528. Orvehed, M., Hggblom, P., and Sderhll, K. 1988. Nitrogen inhibition of mycotoxin production by Alternaria alternate Appl. Environ. Microbiol. 54:2361-2364. Oster, G., Bellin, J. S., and Holmstrm, B. 1962. Photochemistry of riboflavin. Cellular Mol. Life Sci. 18:249-253. Pall, M. L., and Brunelli, J. P. 1993. A series of six compact fungal transformation vectors containing polylinkers with multiple unique restriction sites. Fungal Genet. Newslett. 40:59-62.

PAGE 170

170 Palumbo, J. D., Keeffe, T. L. ., and Mahoney, N. E. 2007. Inhi bition of ochratoxin A production and growth of Aspergillus species by phenolic antioxidant compounds. Mycopathologia. 164:241-248. Passone, M. A., Resnik, S. L., and Etcheverry, M. G. 2005. In vitro effect of phenolic antioxidants on germination, growth a nd aflatoxin B accumulation by peanut Aspergillus section Flavi. J. Appl. Microbiol. 99:682-691. Phillips, A. J. L. 1994. Occurrence of s cab of Phaseolus vulgaris caused by Elsino phaseoli in South Africa. Plant Pathol. 43:417-419. Proctor, R. H., Brown, D. W., Plattner, R. D ., and Desjardins, A. E. 2003. Co-expression of 15 contiguous genes delineates a fumoni sin biosynthetic gene cluster in Gibberella moniliformis Fungal Genet. Bio. 38:237-249. Ramji, D. P., and Foka, P. 2002. CCAAT/enhance r-binding proteins: stru cture, function and regulation. Biochem. J. 365:561-575. Ramm, P. J., and Caspi, E. 1969. The stereochemis try of tritium at carbon atoms 1, 7, and 15 in cholesterol derived from (3R, 2R)-(2 -3H) mevalonic acid. J. Biol. Chem. 244:6064-6073. Rangan, V. S., Oskouian, B., and Smith, S. 1996. Id entification of an inverted CCAAT box motif in the fatty-acid synthase gene as an esse ntial element for mediation of transcriptional regulation by cAMP. J. Biol. Chem. 270:3757-3764. Reynoso, M. M., Torres, A. M., Ramirez, M. L., R odrguez, M. I., Chulze, S. N., and Magan, N. 2002. Efficacy of antioxidant mixtures on gr owth, fumonisin production and hydrolytic enzyme production by Fusarium verticillioides and F. proliferatum in vitro on maizebased media. Mycol. Res. 106:1093-1099. Ridley, G. S. 2005. Elsino takoropuku sp. nov. infects twigs of Pittosporum tenuifolium in New Zealand Mycologia 97:1362-1364. Rollins, J. A., and Dickman, M. B. 2001. pH signaling in Sclerotinia sclerotiorum : Identification of a paC/RIMI homolog. Appl. Environ. Microbiol. 67:75-81. Rosewich, U. L., and Kistler, H. C. 2000. Role of horizontal gene transfer in the evolution of fungi. Annu. Rev. Phytopathol. 38:325-363. Saitou, N., and Nei, M. 1987. The neighbor-joini ng method: a new met hod for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425. Schimmel, T. G., Coffman, A. D., and Parsons, S. J. 1998. Effect of butyrolactone I on the producting fungus, Aspergillus terreus Appl. Environ. Microbiol. 64:3703-3712. Seshime, Y., Juvvadi, P. R., Fujii, I., and K itamoto, K. 2005. Discovery of a novel superfamily of type III polyketide synthases in Aspergillus oryzae. Biochem. Biophys. Res. Commun. 331:253-260.

PAGE 171

171 Shah, A. J., Tilburn, J., Adlard, M. W., and Ar st, H. N. Jr. 1991. pH regulation of penicillin production in Aspergillus nidulans. FEMS (Fed. Eur. Microbio l. Soc.) Microbiol. Lett. 77:209-212. Shen, B. 2003. Polyketide biosynthesis beyond th e type I, II and III polyketide synthase paradigms. Curr. Opinion Chem. Biol. 7:285-295. Shim, W.-B., and Dunkle, L. D. 2003. CZK3 a MAP kinase kinase kinase homolog in Cercospora zeae-maydis regulates cercosporin biosynthesis, fungal development, and pathogenesis. Mol. PlantMicrobe Interact. 16:760-768. Shim, W.-B., and Woloshuk, C. P. 2001. Regul ation of 1 fumonisin B1 biosynthesis and conidiation in Fusarium verticillioides by a cyclin-like (C-type) gene, FCC1 Appl. Environ. Microbiol. 67:1607-1612. Shirasugi, N., and Misaki, A. 1992. Isolation, char acterization, and antitumor activities of the cell wall polysaccharides from Elsino leucospila Biosci. Biotechnol. Biochem. 56:29-33. Smith, D. J., Burnham, M. K., Bull, J. H., H odgson, J. E., Ward, J. M., Browne, P., Brown, J., Barton, B., Earl, A. J., and Turner, G. 1990. -lactam antibiotic biosynthetic genes have been conserved in clusters in prokar yotes and eukaryotes. EMBO J. 9:741-747. Smith, L. L., and Hill, F. L. 1972. Detection of sterol hydroperoxides on thin-layer chromoplates by means of the Wurster dyes. J. Chromatography 66:101-109. Smith, L. L., Teng, J. I., Kulig, M. J., and Hill, F. L. 1973. Sterol metabolism XXII. Cholesterol oxidation by radiation-induced process. J. Organic Chem. 38:1763-1765. Song, Z., Cox, R. J., Lazarus, C. M., and Si mpson, T. J. 2004. Fusari n C biosynthesis in Fusarium moniliforme and Fusarium venenatum Bio. Chem. 5:1196-1203. Spikes, J. D. 1989. Photosensitization. In: Smit h, K. C., (ed.). The Science of Photobiology. New York, USA: Plenum Press, pp. 79-110. Stack, M. E., Mazzola, E. P., Page, S. W., Pohla nd, A. E., Highet, R. S., Tempesta, M. S., and Corely, D. G. 1986. Mutagenic perylenequinone metabolites of Alternaria alternata : altertoxins I, II, and I II. J. Nat. Prod. 49:866-871. Stahl, D. J. and Schfer, W. 1992. Cutinase is no t required for fungal pathogenicity on pea. Plant Cell 4:621-629. Staunton, J., and Weissman, K. J. 2001. Polyketide biosynthesis: a millennium review. Nat. Prod. Rep. 18:380-416. Stierle, A. C., and Cardellina, J. H. 1989. Phytotoxins from Alternaria alternata a pathogen of spotted knapweed. J. Nat. Prod. 52:42-47.

PAGE 172

172 Takano, Y., Kikuchi, T., Kubo, Y., Hamer, J. E., Mise, K., and Furusawa, I. 2000. The Colletotrichum lagenarium MAP kinase gene CMKI regulates diverse aspects of fungal pathogenesis. Mol. PlantMicrobe Interact. 13:374-383. Tamaoki, T., and Nakano, H. 1990. Potent and speci fic inhibitors of protein kinase C of microbial origin. Biotechnol. 8:732-735. Tan, M. K., Timmer, L. W., Broadbent, P., Priest, M., and Cain, P. 1996. Differentiation by molecular analysis of Elsino spp. causing scab diseases of citrus and its epidemiological implications. Phytopathol. 86:1039-1044. Tappel, A. L. 1972. Vitamin E and free radical peroxidation of lipids. Ann. N. Y. Sci. 203:12-28. Taylor, J. A., and West, D. W. 1980. The use of Evans blue stain to test the survival of plant cells after exposure to high salt and high osmotic pressure. J. Exp. Bot. 31:571-576. Tilburn, J., S., Sarkar, D. A., Widdick, E. A., Espeso, M., Orej as, J., Mungroo, M. A., Pealva, and Arst, H. N. Jr. 1995. The Aspergillus PacC zinc finger transc ription factor mediates regulation of both acidand alkaline-expressed genes by ambient pH. EMBO J. 14:779790. Tinberg, H. M., and Barber, A. A. 1970. Studies on vitamin E action: peroxidation inhibition in structural protein-lipid micelle complexes derived from rat liver microsomal membranes. J. Nutr. 100:413-418. Timmer, L.W., Garnsey, S. M., and Graham, J. H. 2000. Compendium of citrus disease.2nd edition The American Phytopathol ogical Society, St, Paul, MN. Timmer, L, W., Priest, M., Br oadbent, P., and Tan, M. K. 1996. Morphological and pathological characterization of species of Elsino causing scab disease of c itrus. Phytopathol. 86:10321038. Timmer, L. W., and Zitko, S. E. 1997. Evaluation of fungicides for control of Alternaria brown spot and citrus scab. Proc. Fl a. State Hortic. Soc. 110:71-76. Tsitsigiannis, D. I., and Keller, N. P. 2006. Oxylipins act as de terminants of natural product biosynthesis and seed colonization in Aspergillus nidulans Mol. Microbiol. 59:882-892. Tudzynski, P., Hlter, K., Correia, T., Arntz, C ., Grammel, N., and Keller, U. 1999. Evidence for an ergot alkaloid gene cluster in Claviceps pupurea Mol. Gen. Genet. 261:133-141. Turner, W. B. 1971. Fungal metabolites. Academic Press, London. Turner, W. B. and Aldridge, D. C. 1983. F ungal metabolites II. Academic Press, London. Upchurch, R. G., Walker, D. C., Rollins, J. A., Ehrenshaft, M., and Daub, M. E. 1991. Mutants of Cercospora kikuchii altered in cercosporin synthesis and pathogenicity. Appl. Environ. Microbiol. 57:2940-2945.

PAGE 173

173 van Helden, J. 2003. Regulatory sequence analys is 1 tools. Nucl. Acids Res. 31:3593-3596. van Kan, J. A. L. 2006. Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Sci. 11:247-253. Walton, J. D. 2000. Horizontal gene transfer a nd the evolution of sec ondary metabolite gene clusters in fungi: An hypothesis. Fungal Genet. Biol. 30:167-171. Watanabe, A., and Ebizuka, Y. 2004. Unprecedented metabolism of chain length determination in fungal aromatic polyketide s ynthases. Chem. Biol. 11:1101-1106. Weiss, U., Flon, H., and Burger, W. C. 1957. The photodynamic pigment of some species of Elsino and Sphaceloma Arch. Biochem. Biophys. 69:311-319. Weiss, U., Merlini, L., and Nasini, G. 1987. Natu rally occurring perylenequinones. In: Herz, W., Grisebach, H., Kirby, G. W., Tamm, C. (eds .). Progress in the Chemistry of Organic Natural Products. Springer-Verlag, New York, U.S.A. Weiss, U., Ziffer, H., Batterham, T. J., Blum er, M., Hackeng, W. H. L., Copier, H., and Salemink, C. A. 1965. Pigments of Elsino species I. Pigment production by Elsino species: Isolation of pure el sinochromes A, B, and C. Can. J. Microbiol. 11:57-66. White, T. J., Burns, T., Lee, S. and Taylor, J. 1990. Amplification a nd direct sequencing of fungal ribosomal RNA genes for phylogenetics. pp. 315-322. In: Innis, M, A., Gelfand, D. H., sninsky, J. J., and White, T. J. (eds.) PCR Protocols: a guide to methods and applications. Academic Press, New York. Whiteside, J. O. 1978. Pathogenicity of two biotypes of Elsino fawcettii pertaining to sweet orange and some other cultivars. Phyopathol. 68: 1128-1131. Whiteside, J. O. 1984. Infection of sweet ora nge fruit in Florida by a common biotype of Elsino fawcettii. Proc. Int. Soc. Citric. 2:343-346. Whiteside, J. O. 1988. Scab disease. pp. 26-27. In: Whiteside, J. O., Garnsey, S. M., Timmer, L. W. (eds.). Compendium of citrus di sease APS press. St. Paul, Minnesota. Wilson, R. A., and Arst, H. N. 1998. Mutational analysis of AREA, a tran scriptional activator mediating nitrogen metabolite repression in Aspergillus nidulans and a member of the streetwise GATA family of transcription factors. Microb iol. Mol. Biol. Rev. 62:586-597. Wolf, J. C., and Mirocha, C. J. 1973. Regulation of sexual reproduction in Gibberella zeae ( Fusarium roseum Graminearum) by F-2 (zearalenone ). Can. J. Microbiol. 19:725-734. Wu, H., Lao, X. F., Wang, Q. W., and L u, R. R. 1989. The shiraiachromes: novel fungal perylenequinone pigments from Shiraia bambusicola. J. Nat. Prod. 5:948-951. Yamazaki, S., and Ogawa, T. 1972. The chemistry and stereochemistry of cercosporin. Agric. Biol. Chem. 36:1707-1718.

PAGE 174

174 Yamazaki, S., Okube, A., Akiyama, Y., and Fuwa, K. 1975. Cercosporin, a novel photodynamic pigment isolated from Cercospora kikuchii. Agric. Biol. Chem. 39:287-288. Yoshihara, T., Shimanuki, T., Araki, T., and Sakamura, S. 1975. Phleichrome, a new phytotoxic compound produced by Cladosporium phlei Agri. Biol. Chem. 39:1683-1684. You, B. J. and Chung, K.-R. 2007. Phenotypic characte rization of mutants of the citrus pathogen Colletotrichum acutatum defective in a PacC-mediated pH regulatiory pathway. Res. lett. 277:107-114. You, B. J., Choquer, M., and Chung, K.-R. 2007. The Colletotrichum acutatum gene encoding a putative pH-responsive transcript ion regulator is a key virule nce determinant during fungal pathogenesis on citrus. Mol. Pl ant-Microbe Interact. 20:1149-1160. Yu, J., Chang, P.-K., Ehrlich, K. C., Cary, J. W., Bhatnagar, D., Cleveland, T. E., Payne, G. A., Linz, J. E., Woloshuk, C. P., and Bennett, J. W. 2004. Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol. 70:1253-1262. Yu, J.-H., and Keller, N. 2005. Regulation of secondary metabolism in filamentous fungi. Annu. Rev. Phytopathol. 43:437-458. Zhang, Y.-Q., Wilkinson, H., Keller, N. P. and Tsitsigiannis, D. 2004. Secondary metabolite gene clusters. pp. 355-386. In: An, A. (ed.). Handbook of Industrial Mycology. New York: Marcel Dekker.

PAGE 175

BIOGRAPHICAL SKETCH Hui-Ling Liao was born in Taiwan in 1975. Befo re attending the University of Florida for pursuing Ph.D in August 2004, she com pleted her Bachelor of Science in plant pathology at National Chung Hsing University in June 1998, a nd obtained a Master of Science in plant pathology at National Taiwan University in J une 2000. She joined a plant pathology laboratory as a research assistant at Na tional Chung Hsing University from 2000 to 2001. Later, she was a teaching assistant in the department of biology in Tunghai University in Taiwan from 2001 to 2004.