<%BANNER%>

Role of Activating Transcription Factor-2 in Control of Pocket Protein Expression and Regulation of Chondrocyte Growth

Permanent Link: http://ufdc.ufl.edu/UFE0021887/00001

Material Information

Title: Role of Activating Transcription Factor-2 in Control of Pocket Protein Expression and Regulation of Chondrocyte Growth
Physical Description: 1 online resource (81 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: chondrocytes, endorchondral, retinoblastoma, skeleton
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Endochondral ossification is the process of skeletal bone growth through the formation of a cartilage template that subsequently undergoes mineralization to form trabecular bone. Genetic mutations affecting the proliferation or differentiation of chondrocytes results in skeletal abnormalities. Activating transcription factor-2 (ATF-2) modulates expression of cell cycle regulatory genes in chondrocytes, and mutation of ATF-2 results in a dwarfed phenotype. The overall aim of these studies was to further examine the role ATF-2 plays in cell cycle progression. Previous data had identified sites of ATF-2 binding located in promoters of the pocket protein family of cell cycle regulators. Initial studies indicated changes in pocket protein expression in response to loss of ATF-2 function. Mutation of ATF-2 lead to reduced expression of retinoblastoma (pRb), a member of the pocket protein family. pRb regulates cell cycle progression and influences cellular proliferation and terminal differentiation. Using an in vitro chondrogenesis model, we observed that pRb influenced cell cycle exit and differentiation. Transgenic mice expressing a conditional truncation of pRb in chondrocytes were produced to further delineate the role of pRb in endochondral development. Although no gross skeletal abnormalities were observed conditional mutants displayed reduced size at birth. The observed size difference was overcome with age. Histological examination of the growth plate demonstrated changes in growth plate architecture of neonates in response to pRb mutation. Growth plates of older animals were re-organized indicating the observed alterations in growth plate structure were transient. Immunohistchemical localization of proliferative markers indicated that pRb conditional deletion allowed prolonged chondrocyte proliferation in newborn mice. These studies suggest that pRb may influence chondrocyte proliferation and differentiation, but its role is largely insignificant in overall endochodral development.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: LuValle, Phyllis A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021887:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021887/00001

Material Information

Title: Role of Activating Transcription Factor-2 in Control of Pocket Protein Expression and Regulation of Chondrocyte Growth
Physical Description: 1 online resource (81 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: chondrocytes, endorchondral, retinoblastoma, skeleton
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Endochondral ossification is the process of skeletal bone growth through the formation of a cartilage template that subsequently undergoes mineralization to form trabecular bone. Genetic mutations affecting the proliferation or differentiation of chondrocytes results in skeletal abnormalities. Activating transcription factor-2 (ATF-2) modulates expression of cell cycle regulatory genes in chondrocytes, and mutation of ATF-2 results in a dwarfed phenotype. The overall aim of these studies was to further examine the role ATF-2 plays in cell cycle progression. Previous data had identified sites of ATF-2 binding located in promoters of the pocket protein family of cell cycle regulators. Initial studies indicated changes in pocket protein expression in response to loss of ATF-2 function. Mutation of ATF-2 lead to reduced expression of retinoblastoma (pRb), a member of the pocket protein family. pRb regulates cell cycle progression and influences cellular proliferation and terminal differentiation. Using an in vitro chondrogenesis model, we observed that pRb influenced cell cycle exit and differentiation. Transgenic mice expressing a conditional truncation of pRb in chondrocytes were produced to further delineate the role of pRb in endochondral development. Although no gross skeletal abnormalities were observed conditional mutants displayed reduced size at birth. The observed size difference was overcome with age. Histological examination of the growth plate demonstrated changes in growth plate architecture of neonates in response to pRb mutation. Growth plates of older animals were re-organized indicating the observed alterations in growth plate structure were transient. Immunohistchemical localization of proliferative markers indicated that pRb conditional deletion allowed prolonged chondrocyte proliferation in newborn mice. These studies suggest that pRb may influence chondrocyte proliferation and differentiation, but its role is largely insignificant in overall endochodral development.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: LuValle, Phyllis A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021887:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101111_AAAAAG INGEST_TIME 2010-11-11T06:48:52Z PACKAGE UFE0021887_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1368 DFID F20101111_AAAEPP ORIGIN DEPOSITOR PATH valecruz_d_Page_61.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
29676734a08780879b64ed728140b979
SHA-1
659e01d2f495d23f38dea1b7c47ef6f81c90e660
27824 F20101111_AAADYY valecruz_d_Page_13.QC.jpg
b734d4d7a2ad53b7a4cfa1be2a22364d
bdce46c5b7318aad2b8efafeefc50a53c0650a28
8078 F20101111_AAAEAY valecruz_d_Page_47.pro
39067407da96e02a8fbf8cb1e582d97e
5075a6642e7370035a069a9bb9ef46b7dde40322
1053954 F20101111_AAAEKS valecruz_d_Page_01.tif
77d37ba82bddb5a7f9e54930e01c3693
9e6aeae8d01f8d3a1ba6498739e8e4840dc41568
910 F20101111_AAAEFV valecruz_d_Page_81.txt
b8dcd35a293c26948e1e4b532cb74b1c
4382d9016a3df8fd648126f9507cea8412439594
632 F20101111_AAAEPQ valecruz_d_Page_63.txt
2710d8f8d3f5caa78382a72e65d7297a
f80d16835f4dc26a8fcab5c79066aa0ce8785167
29312 F20101111_AAAEAZ valecruz_d_Page_17.QC.jpg
68de881eb471cd882be1596ebb630d7f
d8b67d48dafd870cfdcc976aa32670b1991a4deb
F20101111_AAAEKT valecruz_d_Page_02.tif
bd5336424965368d89eb6929138381d5
99da096cc399728cc86c2dd9c3c9b7045bbf78f3
2145 F20101111_AAAEFW valecruz_d_Page_14.txt
f43a4557fef7fed6c6b712247ac39ec4
c774293e4ef28d185ae55036884ad34ff36abb37
1332 F20101111_AAAEPR valecruz_d_Page_65.txt
95d52d1c8fc26529f1e30cdf0dea047b
041dd203426ed28b12104f81dd5c33c77870f603
26937 F20101111_AAADYZ valecruz_d_Page_04.pro
bff01ea780c94878e66635d0734b37cb
3e24dcc106e24c8463b9aec10ee5d22a5ef53936
F20101111_AAAEKU valecruz_d_Page_03.tif
5738817b6674f3860618ee7021c4308c
ce190ac2f982910e3d5f6bc231dc99dda8b3c8f3
F20101111_AAAEFX valecruz_d_Page_13.tif
58bf2d5c461e151a79f16e69cd2de5c5
7236a10e90ea86f6bda688fcb4d82ae08b171220
767 F20101111_AAAEPS valecruz_d_Page_66.txt
ad43b0abf1369af89028c996278ce443
4a39fe02e74b50d3ab990d145d41066fe87be34a
25271604 F20101111_AAAEKV valecruz_d_Page_06.tif
5897cf1f7d6cffa68feae7fde3c155c7
5fa3c0e82c93c1dd8d0e1ba9885656e122e37647
55854 F20101111_AAAEDA valecruz_d_Page_60.pro
5a7f86ea42c55a3de646286a8eb9d583
0952f04e07449d7e195a126472b305390c4c04e3
F20101111_AAAEFY valecruz_d_Page_48.tif
abf21dd56c0d963c74bbd19cee9079f3
24c0cf751a1ee81be9872c284a200b966d7c1b63
2275 F20101111_AAAEPT valecruz_d_Page_67.txt
694e1704995f82e8100c59b75e0389dc
48e67c4c6f473342be3166e53fdbec6aca4fac1e
F20101111_AAAEKW valecruz_d_Page_09.tif
3167154ea229ec36ac0948ebc805e9e5
a4ccf149b3c84fb25eab3204874030da022a9c8c
6195 F20101111_AAAEDB valecruz_d_Page_20thm.jpg
3037c5376816a54832c1f0c4c3b30d2b
f04d005ed6a9931a37353ec72d6b9cdeb9dd36a0
F20101111_AAAEFZ valecruz_d_Page_62.tif
fe9dd0722193c0e26bee179369d983e5
5a72007420faca703c5ebf05b3f9964189300131
2189 F20101111_AAAEPU valecruz_d_Page_68.txt
2f32e7da83fe5d3f1e9b11bfe9c6fe84
e6eff60f4858852944f518f5d0a97dbc122c8133
F20101111_AAAEKX valecruz_d_Page_11.tif
65d56e081388d0f280e1082576048d5d
ce6734b7ca02a05d5b78242f57b9c98376f07751
90292 F20101111_AAAEDC valecruz_d_Page_30.jpg
b80489640905df6699bb720bdf010c6e
ee9f736551ba63f6be19f52b4f2a2d556d459655
1010 F20101111_AAAEPV valecruz_d_Page_71.txt
da4bc8fac3eec7f022ae2890133eb695
5bedcb0714359cf0875a528d609e4787cf18cb51
91151 F20101111_AAAEIA valecruz_d_Page_40.jpg
94da1d6bd9191ff09763e231be5b591b
e3d17a9b804987d72757ea078e6c8e1096f5cde2
F20101111_AAAEKY valecruz_d_Page_12.tif
a333a10097a092486a83f51531d7bc25
ed202468d77868e628769b5542d6da38806a9d21
2598 F20101111_AAAEPW valecruz_d_Page_74.txt
80b2865c003b0f6e4a8ca3c4eb0ef489
c2741246fd22c46018963aac4c7db96525178336
34643 F20101111_AAAEIB valecruz_d_Page_41.jpg
4df217b0b71897b6aad19d37d7e2b585
bf105ec5a902e4218a32265c661a5a971aebd3dc
F20101111_AAAEKZ valecruz_d_Page_15.tif
c59474a267c049436890dd389b063a93
2c55521f797094a5951b5cfbcdbe89135458d87d
26596 F20101111_AAAEDD valecruz_d_Page_09.QC.jpg
cfe0d25c28b3093c1c446edca77d5977
a02705d0cdea0c9b4888e9969e0a20989f5770d6
2735 F20101111_AAAEPX valecruz_d_Page_75.txt
267b4fb567f4d7e6562e6206a30e8f28
a8b1a7bb3059521d0958ae7940c12cb98635b825
77357 F20101111_AAAEIC valecruz_d_Page_43.jpg
31bcaba61544fa2677d2ff7f78ffb6e7
500bbcf88f9f8c59dc7d133711de9fefcfdb30be
26996 F20101111_AAAEDE valecruz_d_Page_20.QC.jpg
4405adc47d81ae991928e0bb7902fc9c
9e81894ce0d7649416425356273b156f969b1ff8
2595 F20101111_AAAEPY valecruz_d_Page_76.txt
70f1784a7ed1090488500067ac66538b
b429545a60164216567746a240dbb31003867e75
13683 F20101111_AAAEID valecruz_d_Page_44.jpg
f27d7b3336c663772b5b6859aef2f6ac
e95385da4ce367770fea314c49f4124551f96259
F20101111_AAAEDF valecruz_d_Page_04.tif
739b05494dbfc124d933fc802466e0f0
7372b5ab2af156ae7fe9ac076a480e21e6c009cf
54471 F20101111_AAAENA valecruz_d_Page_31.pro
ac9ce517f936edeea7c47c581545950b
5d7b4a321d8a5b9f2a5c6dcadbdc3ff2bcb84bf8
2513 F20101111_AAAEPZ valecruz_d_Page_77.txt
ddcf4f3ec094f1fba33550490f64d44e
27d9ef360f77dfc1101d483fb760e29808c380b2
68725 F20101111_AAAEIE valecruz_d_Page_45.jpg
55245dddbe677d15cebd239ee3e0f7be
ff5b5b83b3b0d37b4c02b75ae3ef9c93dca31240
4351 F20101111_AAAEDG valecruz_d_Page_48thm.jpg
84476e5814f9ea47b217c1f3168f826b
d19fce63cc0c4a795cecb4b72a830094ea2bd7a9
55707 F20101111_AAAENB valecruz_d_Page_32.pro
60e0d1a14750e718ec38e730f44c9099
59c2bcccde72d4b9aa401ac7531314d4ff034ca0
71876 F20101111_AAAEIF valecruz_d_Page_48.jpg
a988d27b6175fc42fc4b0a841f7cf087
b6c43f83f08feda832ba00e5efd232d9adb10383
6842 F20101111_AAAEDH valecruz_d_Page_76thm.jpg
c6466b7e949bceb7d5fe6e882bcb1b0d
2114cf5255891515b3050162d18fe52e9c5e9951
56257 F20101111_AAAENC valecruz_d_Page_35.pro
d456598bdc12e7c799b645c6aac965d1
c68c410eeed802f1ef62ef23365e973c8ba27b5f
1769 F20101111_AAAESA valecruz_d_Page_44thm.jpg
ac95eb21776ceecc59f1015fee5f6177
3e8d6cef2f25b8a1c74752c7a0ed62cff48ce698
85865 F20101111_AAAEIG valecruz_d_Page_49.jpg
bc1a8cdf338fbfaccdd108e98c264a85
d8ad4ac2162f5a0cf6c551548404b2561038e8da
5302 F20101111_AAAEDI valecruz_d_Page_37thm.jpg
308687f92e8afbe20a8b48bd21959f0b
3b0e4d5b3662a69bebb645e86938ee89453fd5f7
33467 F20101111_AAAEND valecruz_d_Page_38.pro
eef4db8f4ec4909ba4ac2614d14d88aa
a0340e9c784a627c495ec86d969b417c7adae187
19192 F20101111_AAAESB valecruz_d_Page_45.QC.jpg
2de29b27452ae4bc63aa19f3016db626
c0dea5d0ce303cafebaf223cfc264ad7b734fb45
88941 F20101111_AAAEIH valecruz_d_Page_50.jpg
78bcc87536e7ed99f0d71c3f4c9998d3
b27d1055e14dfb14de4fc1547372b0d0b63b4d6a
107598 F20101111_AAAEDJ valecruz_d_Page_28.jp2
b1145f81548111b947b79e648f0fa0ad
7885f44a6a276c90373388480b3cdac87381f143
30323 F20101111_AAAENE valecruz_d_Page_39.pro
9d4f3bbbf06af1c0f1fd0f605e895ac4
21eba09e177bac835e4f522293518dd91a6d468e
19125 F20101111_AAAESC valecruz_d_Page_46.QC.jpg
a2a9f30212cab6469401f15e11a548fd
5f4bf52c615ceac55837176e555e9b413edf7567
F20101111_AAAEDK valecruz_d_Page_40.tif
c99d303e3061a77a0268e97e4649e64d
0836cd415d26bd1942e82d0568fed129eac7bde6
10022 F20101111_AAAENF valecruz_d_Page_41.pro
bf241dd68e6be8b5208ecc682c429774
cc67eb106f9233b8e056167f23725e9978756f20
4940 F20101111_AAAESD valecruz_d_Page_46thm.jpg
b428ddfe4e01a5ef5228102c1be61902
bbfe4e3e0cfe5573f7041ce1d5e03761b354a663
34257 F20101111_AAAENG valecruz_d_Page_42.pro
d8a81226e277aade33ddfe02be9db81a
72cd88a13027ad0ffcf1f06373a4d41375086c46
90482 F20101111_AAAEII valecruz_d_Page_52.jpg
ab70c202cd8f95535198466860c6c793
6c347bb974794a2197c5568765d8b1950074aeeb
2680 F20101111_AAAEDL valecruz_d_Page_73.txt
e509c1d1e91650f2d6cac01be5644c01
51d7697712a90841a39f021a2ad50f26b117d687
6782 F20101111_AAAESE valecruz_d_Page_47.QC.jpg
bc3939d7083b45c6a71ed227f7f94731
1e71c0c93eb5825addd9550f78f97bd5405fc903
3918 F20101111_AAAENH valecruz_d_Page_44.pro
d1460f55cf2e8a4406da87c00461b37e
b349336224ea400c4efd3ee2ef0fddca1de811f7
84533 F20101111_AAAEIJ valecruz_d_Page_53.jpg
77cbf1649bb9d49027eab880f1ee9684
d5cdb8c231adfe8588b38d0b17e20c678350eb98
52268 F20101111_AAAEDM valecruz_d_Page_18.pro
1f69a30a36754f8579f5d3cefcc5abe7
36fb88d7d8d90d999378aa98b453f705a92b6b58
2246 F20101111_AAAESF valecruz_d_Page_47thm.jpg
48460a47f61b8ba71af45c085d213408
bf7872c6bf24c926c7855d9f0a92fa578a6ae295
24279 F20101111_AAAENI valecruz_d_Page_46.pro
ba85540ed253d0a505624e64fa827f7d
b03cde90dcbb3ccc6d4fd0b2aba410bf81f66d13
90775 F20101111_AAAEIK valecruz_d_Page_56.jpg
40028d2e08a35d0454ae58ac1eeffc61
a160cbe8193711021f6e2ca6b16e0d1fa5ea656f
6378 F20101111_AAAEDN valecruz_d_Page_03.jp2
cf6be3953f9b3aaf9dbecf4023a5c52d
c1e73d77c8410899bd22f5baec8fa2cdb65b006b
6437 F20101111_AAAESG valecruz_d_Page_49thm.jpg
56512096b9e91034f3ff992becce097b
7c498e20b40fe4a7dee33258e4c921ac885fc7b8
29995 F20101111_AAAENJ valecruz_d_Page_49.pro
05b35ee2ca87e53b3eef303d6707c18a
436ebc493f4d4c49399e13a6b5ebbd4c645bd8ba
91044 F20101111_AAAEIL valecruz_d_Page_57.jpg
1f93bfa439b07bb03236e32dd84afe9c
fe84881ebf6812c5f0c4fbaa5a65ec17b67cfb5e
6819 F20101111_AAAEDO valecruz_d_Page_36thm.jpg
930998227410641fc6e7a15b89b92a73
c421098336cf9b0a3bf305671a85bad67c99ca77
27482 F20101111_AAAESH valecruz_d_Page_50.QC.jpg
5fd18e973d37a14522a6b18b325311c4
555127508cc5a80928a5e237cc1e6851d7b904ce
51551 F20101111_AAAENK valecruz_d_Page_50.pro
dbaa8e06753260c8eb4c1bf62b2c282d
1cfde70ad3430f3f387e43ca43fb8643be906a10
88715 F20101111_AAAEIM valecruz_d_Page_59.jpg
21aebd897ce51b40b4589410267effb0
81a7c057d387a07dec9789314b0dc9fda9f19b0b
F20101111_AAAEDP valecruz_d_Page_52.tif
280e1868291d1828606535563bd0deca
832b4f5f7498c19a14bec075d6ecf7e78c8999e5
28681 F20101111_AAAESI valecruz_d_Page_51.QC.jpg
9e09a03edc43c4f9bb89dc6e34b5a616
dbc036d9a1847be0ec97e6b3a81e3b3ba8c85f85
55336 F20101111_AAAENL valecruz_d_Page_51.pro
0908d079dd373e11833f3c9f2893a87b
0d9a3e8bc4bf73180e9fc84cd5e57f5b5e6bb4f6
57984 F20101111_AAAEIN valecruz_d_Page_61.jpg
3ba761d6bb583d9f72b963f790f9f2be
08ad9f2f49ac31b5677ea461612820b19261091f
18282 F20101111_AAAEDQ valecruz_d_Page_61.QC.jpg
a196351bb566fa3ce3f04cc1e63dc2ab
68f06503ca9563b1a14f85bc60a477c7e7e1604c
6635 F20101111_AAAESJ valecruz_d_Page_51thm.jpg
9447802874edb13e7898a8647b16a5a0
9f8af2db1ff8eca7cd343d5de13c1c94c8b28a7f
47521 F20101111_AAAENM valecruz_d_Page_53.pro
da2923ec2b498d91ad2e125f48b9b6f9
83376548af57b67520cb8e926e0380771cb0e4f7
56578 F20101111_AAAEIO valecruz_d_Page_63.jpg
0ab7bc69cd08ee8f97cb214ee1b77629
56c3ae652c3b445c984538e9588616ed1f67f150
3180 F20101111_AAAEDR valecruz_d_Page_81thm.jpg
172c10afcb8a603d27c10cad02468dd8
7f1dd5b4f7ea7809a5730a5ebe3b2dbd3cac1980
6606 F20101111_AAAESK valecruz_d_Page_52thm.jpg
32578fd803389f4fe0360cdf751d2602
0e835d6de0e0c2e305751eb79745e14c6e3108f8
130463 F20101111_AAAEDS valecruz_d_Page_76.jp2
9aef38570a6f6109ffa7d7b3d1533069
033c83e2e58f40c0b4ba221896ac187dd3189ebc
83583 F20101111_AAAEIP valecruz_d_Page_65.jpg
4529ba6e78bb35d588628559e594ec5f
716b8821092b4f2e73f4bdb0822d8bfd49aa476f
26488 F20101111_AAAESL valecruz_d_Page_53.QC.jpg
3c24f9f088f3d9abce77ae30c2306bb0
170632847f078e022b5e971d9465675e2095bf35
50177 F20101111_AAAENN valecruz_d_Page_54.pro
04b76e1a47eaf9077ca5f538cf09d635
5ae35dd36cbf9c68f3f9e73753be79935efd08e0
4751 F20101111_AAAEDT valecruz_d_Page_65thm.jpg
924adc1aacf842e7cf2995f926817fdc
cbca77f0b229af050bf582bf4cc367173cb09985
65086 F20101111_AAAEIQ valecruz_d_Page_66.jpg
007a9f0f0a9d8104ea818f95c225591b
ffd072ce4acb0c81e55e330768af361fab78ab1c
26698 F20101111_AAAESM valecruz_d_Page_54.QC.jpg
46755a720baa9a877ec0f01b6f0a0f87
8f9cd606a98a9b4200368c5d20afe82f08533d02
48164 F20101111_AAAENO valecruz_d_Page_55.pro
3857b9236fe26429eaa5828f83aa746b
6ebc6975773e797f9cd35961b34c8c1fd624a583
F20101111_AAAEDU valecruz_d_Page_05.tif
5073d20b1dfc33b1f493421522d44499
a224c0fcecaf2a98d9cbc6742587246072ffbcf5
80858 F20101111_AAAEIR valecruz_d_Page_67.jpg
f8d9f11535abd330cb3a079b896e151b
9ebdd2bbe95d4af2945d0582e0d313cdda2a1d52
28424 F20101111_AAAESN valecruz_d_Page_56.QC.jpg
c9e772a9daa9cbc428e40577e5f29961
2792ce2e6d1311cc3a53ad3cdca7fa3bfed7205d
54955 F20101111_AAAENP valecruz_d_Page_56.pro
c031c2eb10ddbf95cdb9d84c556a0bb4
7f1bc925c20f6669ed111ec62a3a9eca110a790e
F20101111_AAAEDV valecruz_d_Page_37.tif
245bd15bbd9f297148a611954b10273f
68e84532542b3fe109d4d2d7b5dc898df3b3e176
90627 F20101111_AAAEIS valecruz_d_Page_70.jpg
1a17dc8932012db11c6544f77718d836
954419c605b315902e27e4cd32e663d6b4429a1d
28294 F20101111_AAAESO valecruz_d_Page_57.QC.jpg
7c9903be10fc1fd5bc291ac8ab8bf291
f44902192ff6001f7a207a645ed9386fc64e510c
56103 F20101111_AAAENQ valecruz_d_Page_57.pro
786feec53c963a5121b3a6b46baf935b
c8657f52bbb2b21bd53c6136be14283320c13db1
100034 F20101111_AAAEDW valecruz_d_Page_27.jp2
d99c8195277d8c9ea13ffd6a6b70a541
c757a18d28f37684c92beeb32ec7595057fb044b
105988 F20101111_AAAEIT valecruz_d_Page_73.jpg
a52cce94e7938f00a1016d5de3d108db
7f75c7c990bf80c3809dcd411a9f4b0e49287a09
7008 F20101111_AAAESP valecruz_d_Page_57thm.jpg
a22cf4a2b5365d50037c263aed39439c
70e5557a58c0bfd020990af6766207670bf26a29
56223 F20101111_AAAENR valecruz_d_Page_58.pro
317f549d1e98c2f8a7fc52a05196d495
78d1b564d0a81450bb69e68ea25a7f5792afba07
81375 F20101111_AAAEDX valecruz_d_Page_55.jpg
ac9f2380ff26bcb2f0d1f4bcaf77e877
80392a7330f449416bf20d129b79484fbbbd1d14
104394 F20101111_AAAEIU valecruz_d_Page_74.jpg
36232d8220252765084357bd9ca0790c
5cabff67507cb3a08fa9b266bb4eac589fc49028
28646 F20101111_AAAESQ valecruz_d_Page_58.QC.jpg
1ef41f790ee6432e9ce74ad7607f0311
a890cba1c4d54c02fe2d2d6204cc8c68d502638f
17048 F20101111_AAAENS valecruz_d_Page_63.pro
4f68628551443b9922e4a3c506c332e5
07c2fd7bbddf6e38e96a20de7ae22e668aca9f7d
1974 F20101111_AAAEBA valecruz_d_Page_54.txt
bf11e4221e575e17f6719edf5cab7fa7
dc404ebdbecc66e777210d0b2605c41f4e9b0889
F20101111_AAAEDY valecruz_d_Page_76.tif
05d17079b66b01e72fe409040ca8970d
8c034a277bc9ccf64792c5adbf97b87d24e2c82f
101904 F20101111_AAAEIV valecruz_d_Page_76.jpg
a3d5415aab9eb4df36b9506355b9f5bc
2474f56320c6bd403c286dab0ecddc767a40e219
27466 F20101111_AAAESR valecruz_d_Page_59.QC.jpg
656a84608a93b5f10a6afa91c1d31dad
fe2388774b96db9a79187e28499cd061e9a4ed68
15796 F20101111_AAAENT valecruz_d_Page_64.pro
1ce6d1af41dfdd247683927855e50c61
a5c68768897a0ceb251800ad4b8206ff4fc8e1d2
90737 F20101111_AAAEDZ valecruz_d_Page_37.jp2
8d5c7f0a8b76532741a06a0a5d074461
58b6743731998ca84059c6d6d10e8bdaec287751
101572 F20101111_AAAEIW valecruz_d_Page_78.jpg
be3acc27c491c4d56dd2051392e2be39
abdafc90db59d45e58aa4e77144a7a3ebbb3785b
53628 F20101111_AAADZA valecruz_d_Page_19.pro
1eca23131686919c26b32a23552f19e9
d3cac0759e66c7d4afff30cda0a50f579997b2e1
29662 F20101111_AAAENU valecruz_d_Page_65.pro
851c862ab858bb306cd26063f8f699df
8c1bbcaebf057d4baccd5b955c93f45a6cab4165
93398 F20101111_AAAEBB valecruz_d_Page_60.jpg
ca68ebd59ac580a3c0f03f6077631f5d
611d5ef641366b83540f946354d53ce90304c4db
103647 F20101111_AAAEIX valecruz_d_Page_79.jpg
e3ad3b2078e6546ac5dbced4d5db688a
770c5e6e08d3e37a869b0373303e4ef6e745de13
28705 F20101111_AAADZB valecruz_d_Page_01.jp2
75a2cdcb8abc31b5104b5cac4235f507
09be6830526bb69cf6976a6d972c13245ad3682b
6568 F20101111_AAAESS valecruz_d_Page_59thm.jpg
0660efb85bdf9df095c7bb26160ccc58
84e42535a1e7e47344c0c68c6272695ad8245fa9
17762 F20101111_AAAENV valecruz_d_Page_66.pro
8b9d2cc4c59f139721ae601d74559d32
8e63e16bc0af2c10f0ca499c2143e3dc56520d03
6092 F20101111_AAAEGA valecruz_d_Page_24thm.jpg
4707a14923cd271056ded693f86a7edf
35c5d686d455dc9b674189bd9697a39987d29f91
40732 F20101111_AAAEIY valecruz_d_Page_81.jpg
b7f3db27946e3c300af5521a80e85742
a8d05f2a44f59f7f13fb57a505e541d8997aa85e
53554 F20101111_AAADZC valecruz_d_Page_26.pro
f7aeb0dd07e43fc7773d959c10da4471
e50ab1287a4b64596bf22e2a3db6e39370791fc7
24160 F20101111_AAAEBC valecruz_d_Page_49.QC.jpg
5bb22f02c7736012e6beaa30a0464fd5
dca68adb5697b70f64baa69baa83386f25a50a99
6854 F20101111_AAAEST valecruz_d_Page_60thm.jpg
42a4d4195c8804fafa919cd06c9387ae
b24141aa52470bfa0a93b189a9b170d85934d2bc
52877 F20101111_AAAENW valecruz_d_Page_68.pro
fa1d1c73baa4c0c8cddb3863800b60b9
eaa02e9f5277ea14b44ae1cdf95416fa0353fac1
F20101111_AAAEGB valecruz_d_Page_74.tif
5281975b7bc2dcbb0cb144f6730d3741
2620ec5eb2ce73c9df2f1e8639bcd0fe1e04d9f6
7134 F20101111_AAAEIZ valecruz_d_Page_02.jp2
2f8f55d08c351c6e209a57a26a4fcdb5
bf9e1058589524fe593d1fde5bf3c2d173d08e99
53435 F20101111_AAADZD valecruz_d_Page_33.pro
c775d5685b612047085d67e17d2d3cf3
3f166d9e78e4a7a50fcc703002d6090f05165b35
92844 F20101111_AAAEBD valecruz_d_Page_36.jpg
6f95d33d03781a1ae9bf16024e82c864
375bc888a6d20b16d35e9a89c049c4599132e720
4584 F20101111_AAAESU valecruz_d_Page_61thm.jpg
b1bb14333f0b29e63ac32482499397de
494eef10361840f71e1fbfe5b20d4e27c617d424
53365 F20101111_AAAENX valecruz_d_Page_69.pro
dd173ec570495dfd6473a04524cae6ce
23063dd0e64dbba289eb55f6e30d67f820944722
26885 F20101111_AAAEGC valecruz_d_Page_10.QC.jpg
ba3166bc80ad851e8bb8d366fcc1513e
4637bd5f4ba691a5597bcadaa42d43fda9c3577d
1342 F20101111_AAADZE valecruz_d_Page_42.txt
fcb8b63f731e38ea3bc05a50927ebbbb
73499b9e76700f12644aff2260ef3c6552392f8e
61905 F20101111_AAAEBE valecruz_d_Page_42.jpg
44e657799de8d1b497d12c8870ad6ed2
bbb6f91b353445fd5139f04e69fbc960689e243c
18543 F20101111_AAAESV valecruz_d_Page_63.QC.jpg
49d3862e4f75aced62b753e81471bf30
8a9de3efcbfcbe478a2be75af9ff52d495456187
54657 F20101111_AAAENY valecruz_d_Page_70.pro
153685807ee78a58a97e55360170b640
28f584afb2cb477af59d4a72b0310d09ecee86ff
F20101111_AAAELA valecruz_d_Page_16.tif
460003c93e7b14e824cd831a949f751c
5d227e11655a45d1ffc48f41f77e3744a72bb734
2134 F20101111_AAAEGD valecruz_d_Page_69.txt
0aa66951b839d1abaa05cd7fe6269d1c
069ce76f0bde31d8d7cb3b6984ee0e07551f598d
107301 F20101111_AAADZF valecruz_d_Page_75.jpg
62db8b40d9a187a2b46721da916c427f
94029798b67c6e95dad58829d7569ef43c91e46d
118891 F20101111_AAAEBF valecruz_d_Page_58.jp2
0aa88e6240c02c4164fa290201454133
965ac73c0336ca06d0029cc356928038eb676e98
10349 F20101111_AAAESW valecruz_d_Page_64.QC.jpg
0d5128eff00796ff395233821ed148d6
860347fdc5fb56c20620f4d768e1a31aa7ab9ade
63928 F20101111_AAAENZ valecruz_d_Page_74.pro
8634134fb7aa18784042d4126b7163ee
bb308f84435f2cdea3d4aec61880b1020d1a434e
F20101111_AAAELB valecruz_d_Page_17.tif
5e0fbf0cad66621f3916aec5789baad7
1b85424d317db199c806fb7dc9876de628d7a6ee
85474 F20101111_AAAEGE valecruz_d_Page_25.jpg
0dfbbfee1ddbe7f4372c72a9f1bc4204
f1214f2fd4f87c1b407a0e4859e318782c1653fc
131399 F20101111_AAADZG valecruz_d_Page_74.jp2
afc6eda1541f11980d11898ecbb208c5
e49fba8f2841ab7f36bfb7560af87bceda0b359f
51163 F20101111_AAAEBG valecruz_d_Page_10.pro
2eeee6c391828ebcc954d08f1a3622f0
ea4ebb5e56d06263d9d935fe70f23b0cc1a6f631
18511 F20101111_AAAESX valecruz_d_Page_66.QC.jpg
cabe06ac24050e984b05aaa64af51f1e
cdb571ffa9ff2967d5506d755f7d83980e5a85d1
F20101111_AAAELC valecruz_d_Page_18.tif
d53c9500ebe306cf7b6dcf8c44efccd4
5ab46bb8bdfd548e8df21f83eff5a3d916a31694
F20101111_AAAEGF valecruz_d_Page_07.tif
bde045e60ffabf54ff1a5d8dd027a966
d3e13d25ef990657e42d9c4fefa684ecf2f09728
42922 F20101111_AAADZH valecruz_d_Page_27.pro
3d146f55d6d125c6da92ff5cc0b608c5
f2768088ee83b273fe86af1267fab78d5cd30eac
1822 F20101111_AAAEBH valecruz_d_Page_02.pro
d5a5bf08ce09fb4f1aff1a98409d5b21
0b9932b20643ca6a97b9f172b1203a0818895381
4673 F20101111_AAAESY valecruz_d_Page_66thm.jpg
7bda3091fe629487617c3e32a7fde0cf
5bc9588ff314c8620f51e5f607cafbf26c262e42
2702 F20101111_AAAEQA valecruz_d_Page_78.txt
633cffb93bb39831837080e3bfa3bd60
2307253583c34878d731895e7bf2f15f60743142
F20101111_AAAELD valecruz_d_Page_20.tif
77ca014b3a0120a591630279a08ddaaa
a6a7761c6b4726561c1894cdf2d956e9ac7d4ad2
41156 F20101111_AAADZI valecruz_d_Page_37.pro
011308b8e0cd9b21205846ede2bd0aa3
9d019f5af1eecf38f5dfbe903c825a7b905d5048
60941 F20101111_AAAEBI valecruz_d_Page_77.pro
b0ff86d422d3803f0e4a3adf56f12337
a37419339d18c3432af9a0d6804ee5780a2149fd
20078 F20101111_AAAESZ valecruz_d_Page_67.QC.jpg
c61ded13218463ce89f18b95fcaeba76
fab4a05a520c14f64d4b35353a5c162630612d78
29478356 F20101111_AAAEQB valecruz_d.pdf
3ac3b0cc690b15d7e35691c653bdf0b7
195b79fe7c90762e02237fc518c5180729c21e5c
F20101111_AAAELE valecruz_d_Page_21.tif
b235a4d74e9cb76f7d119a764ce92e0f
6453b0f46b48bb52557c31e1b6fbfc21ff8f88b3
F20101111_AAAEGG valecruz_d_Page_32.tif
c2832dc81cb54184b665ef729751743c
806ce7075656efabec71ef70bf98dd15c71ff157
F20101111_AAADZJ valecruz_d_Page_23.tif
9bcae96184a5937d7ddf0c9d33d53d5e
e874a9d76231520f95042808a4227d3a5f528338
F20101111_AAAEBJ valecruz_d_Page_65.tif
647cfc38e62201c998c1025cf3e55926
a425d0f8bd31984331da5e58c7dff747717a2ad0
1702 F20101111_AAAEQC valecruz_d_Page_01thm.jpg
6f194ffc7182df986a299acfb6ddb085
ed89039d70ad2fdc3c93b92431fd6ec2086595db
F20101111_AAAELF valecruz_d_Page_24.tif
5e361b54933d00bb9bf86a793cd1d3c0
87e6fbeeda33e0412cfd7411997ee1229d7ab621
29491 F20101111_AAAEGH valecruz_d_Page_22.QC.jpg
dfc8bc00c2cdc0b96163a50572fa3871
ba35e89bdc939f3155c4fa1d7b4e9d701365aeb7
117494 F20101111_AAADZK valecruz_d_Page_14.jp2
3125770c17c0bc8e7b9a7fd5e73e9430
30ac6741a805a9fd7c30f889f6fa15d78da63d7c
2121 F20101111_AAAEBK valecruz_d_Page_29.txt
f82b631005e429728f501744287dffc8
54547defa75d8ad1301383e62039ede57fc6ba8d
95803 F20101111_AAAEQD UFE0021887_00001.mets FULL
fa75b3da4c4db9ed594a4136190027e3
ad28d2907f397f44f3176a3b31142454e3800331
F20101111_AAAELG valecruz_d_Page_25.tif
8b961e093acede8ed7d60fec36289d49
0bfaa85b86facf8d43195f9cee61c162fa995274
29072 F20101111_AAAEGI valecruz_d_Page_60.QC.jpg
9e2795b6d8a2354a179f626bf05df80d
e1b378bacb1847def2b6f59708538b615cd5cc3e
11466 F20101111_AAADZL valecruz_d_Page_62.pro
8e7ac24f16a4de0155f44516d491fdaa
d1dc34a805761cd8422231d706d6e9986101d898
6207 F20101111_AAAEBL valecruz_d_Page_55thm.jpg
856c251a99a691f6367a9975287a149a
db3b8429db7d65f4a10eeae340d345fd1b4e7a2b
7274 F20101111_AAAEQE valecruz_d_Page_01.QC.jpg
adba6a3b338efb8e53fa5a839621e3e8
59a7070737e42b415812c94e639c34c90615f8aa
F20101111_AAAELH valecruz_d_Page_26.tif
cfc95368b08d0cb8050d6ea5c39442b0
29cf4f491da39c7ed3fb1fa6688521cbdd213984
49082 F20101111_AAAEGJ valecruz_d_Page_28.pro
a4c94784d5dd265a319a545e2311f6c3
a5f6fe24003b7e9e742b33bacb5ec4c6eb7ac033
50057 F20101111_AAADZM valecruz_d_Page_15.pro
b51b72b3bf81d0063a490f71c8e83e49
5ad7640faab6df9da3369c1c10de3762a37b08b4
119254 F20101111_AAAEBM valecruz_d_Page_26.jp2
fddde86f988f13a69db4d3fdec544b9b
6e3b6ad06acafd34c2a17b63e45132e4ce6a14e4
1285 F20101111_AAAEQF valecruz_d_Page_03.QC.jpg
af1342f07286c5477c7d81602d6647f0
64e2fdd9db35b491c7550adf48f8a5ce4af70470
F20101111_AAAELI valecruz_d_Page_27.tif
15f65d33e49c9230dc7e2bfe78e01f2d
911963f921a137f90dc3131d7afed9e0f0aef133
6620 F20101111_AAAEGK valecruz_d_Page_12thm.jpg
bbb4167a74119788433bef0fe97d1225
0c9760430e8071c20594a5447b000cea70ca8a7e
F20101111_AAADZN valecruz_d_Page_08.tif
7f4e581ea5b7eaf9ec6c9dbc92b3b04e
1e030be314ba03f5aac71f1da7430ea552d5feb5
70396 F20101111_AAAEBN valecruz_d_Page_46.jpg
bd33b6fbc663d264563df17e8a20136b
c75b08e10f15121c1e020492d4ddb1c98d465d7f
473 F20101111_AAAEQG valecruz_d_Page_03thm.jpg
a7ca774cfa3d441923b5b0b400538c7a
6ee694cb1a7246b5ebd5e695fa76a7c9b16b0f7f
F20101111_AAAELJ valecruz_d_Page_29.tif
7b07b45df3d657d037f18454d378c011
79c3a2b05a9784c2a66c35cfb9b63d0af53a63bd
92179 F20101111_AAAEGL valecruz_d_Page_26.jpg
5bcc7fae61dcf4e99144c6080263c341
849a978ef64c6bbc2fc693f6a45ec8863564f634
6715 F20101111_AAADZO valecruz_d_Page_13thm.jpg
2e0fb96a8bfa62237f33eaf748aedbdb
41a4f8cd38c156e85a3ca42553747a86a15b31fd
1421 F20101111_AAAEBO valecruz_d_Page_02.QC.jpg
73a7983263c368ddb3387d28df61df79
a2948417cb87ba02b76cade479a9e318768e7ead
3550 F20101111_AAAEQH valecruz_d_Page_04thm.jpg
8d42cf654500f789aeb2ad9e4e4f2607
0c325c3aa435f732d527839ca99c1c61baaf994c
F20101111_AAAELK valecruz_d_Page_30.tif
89acd185f645ccbf73bd8c2ac07fd1f9
0c8d80fa08f5e8249cf5bfb793def45e12604772
F20101111_AAAEGM valecruz_d_Page_51.tif
1fe06bb407d0b3daea9b2d50a37840cb
5d97f686bc3dd9317dd14a59ab6affe2cb52d050
4728 F20101111_AAADZP valecruz_d_Page_44.QC.jpg
2cf3a45e44338fd74254c0cbfb1c45bc
98d277423c9a4661c059feae47570100a308dcc3
53299 F20101111_AAAEBP valecruz_d_Page_34.pro
5740ea858158d71bb55c5e9b04601f23
9f0dd004c4efaaafa4890488b3ba7f4bb5fdb3e2
17767 F20101111_AAAEQI valecruz_d_Page_05.QC.jpg
d22162f063eb883612f3f428bd617319
2877abadfbd713bdc598018b02d4630e9da4771c
85512 F20101111_AAAEGN valecruz_d_Page_15.jpg
49cf1984a7b0ad1d7611ef5c4a3777e4
b49415945e61d0956de2625e0d4d761d48d2dd13
3052 F20101111_AAADZQ valecruz_d_Page_64thm.jpg
d332f87821b4a827c0f3d4c48edaf2c6
03d37b03c956bbf23802d0d78348dca166341485
63185 F20101111_AAAEBQ valecruz_d_Page_72.pro
76add45cf2c647281d51220c38fb90d7
e0a85fa4c0881d1c5c909d8cf564de3a1c29a0fd
22329 F20101111_AAAEQJ valecruz_d_Page_06.QC.jpg
be6bde6154ff17d243e576418e02f7b1
b33637f1b11c9a457a7a2b7aa03aecccd96580c3
6565 F20101111_AAAEGO valecruz_d_Page_53thm.jpg
00732300dc5ed74c724d76649a681444
1d90441496cfdad5acc4db05e519cee30b47e976
557 F20101111_AAADZR valecruz_d_Page_02thm.jpg
c66228d2be9833a99d53912336b65ae2
9aa4f462f3b119eeb94651e6e3966dd0619dd185
F20101111_AAAEBR valecruz_d_Page_27.txt
792e55f84eac9744192d14bc9568f58a
67946da5ccbd4dbbf0ed86d6f9056eedb38e6ae2
F20101111_AAAELL valecruz_d_Page_31.tif
cef95efa25dafbb2c3a28d97fe6dcffb
9c64abefbf5b086e8d029ae07789945da372b3f2
5376 F20101111_AAAEQK valecruz_d_Page_06thm.jpg
fdf009fcb2746184f982832cd4250481
f74afc8ff059c7636c5caa6d295011dd28062de3
110578 F20101111_AAAEGP valecruz_d_Page_54.jp2
b27f4c9968984ff8a76410e36cbd85db
ffa9d64dba13c5123ca5142fc64925791403bae1
F20101111_AAADZS valecruz_d_Page_56.tif
27c1b703927b79dff4fbec60a39743e6
b0e3cb0979be380938453eb75d159e0bbaa4551d
F20101111_AAAEBS valecruz_d_Page_34.tif
2ca01b8205cdbeebfd7ebd723df555be
9078a11da9de88b64b50a8287dc373e7cfe7b97a
F20101111_AAAELM valecruz_d_Page_35.tif
0326d30861877e57bda33b9c4a38545d
ad7e51db25725fe6eeaaa697da03fc647f99901b
24447 F20101111_AAAEQL valecruz_d_Page_07.QC.jpg
b99e49a477bd98fa16b1f8151295dc5d
092ecdaf7f44033149c5b4a7ffc2887f4919d18f
6704 F20101111_AAAEGQ valecruz_d_Page_69thm.jpg
32b6445e276eb3f87f684f073e37f0ca
6e94de090692e242be7bcb59a312daf817694cb1
F20101111_AAADZT valecruz_d_Page_50.tif
763590a9ad33bba5c28cd2675a775ac8
9f37d06d44ee21015bacbaa18381800f9f3f9c96
16672 F20101111_AAAEBT valecruz_d_Page_48.pro
36406e8cd1d089f2459db0b5d599c413
b99d39f5cfa0e74a894c8a8e9f7a29f11c5fe227
F20101111_AAAELN valecruz_d_Page_36.tif
58d2a21e9228af6cdd6d766739a2e985
93df2fa39a4633293126302354596de1755cbf15
5972 F20101111_AAAEQM valecruz_d_Page_07thm.jpg
2a45bfc2dea2c5a4f68d5df02b79dbc3
9ad5af6afe6d4bdcc777c876e37300a8f47dce01
3680 F20101111_AAAEGR valecruz_d_Page_03.jpg
2d527ff1576c87fc15759655038be496
eded9872da60b7e2fa450ba810d747ebc54f2665
84257 F20101111_AAADZU valecruz_d_Page_54.jpg
0016d05db3236070f0e4db15bc62ce81
094fa0f495270f0ecc72b2554d0d28bb00c9da67
119066 F20101111_AAAEBU valecruz_d_Page_31.jp2
0ea61bfb45b9d37551f5b33f71eba44f
005dc576c7096cfd18983e2d451b28702f9eed8f
F20101111_AAAELO valecruz_d_Page_38.tif
4bb38d3796193c205c0926012b31a1bc
c2da3ed11548f7cecf034d7eb62908cd5598a624
2413 F20101111_AAAEQN valecruz_d_Page_08thm.jpg
927b14c82c7c9067f7f5e6612b407f6c
a5a8c77ef0a7d3ba6f08836832f25101fe2bf6a9
21556 F20101111_AAAEGS valecruz_d_Page_47.jpg
a53dd00b8346395d803c9a010dc5d62f
696477017a061afad8806737ab214675970e6bc5
F20101111_AAADZV valecruz_d_Page_70.tif
495c2dd940cb9c48e0dd17c1f1aedadc
995529b8160768ea0da50d362b6dd3c7a67a6a26
28324 F20101111_AAAEBV valecruz_d_Page_33.QC.jpg
e6afdd31a058704bd8bd4fdc138d6425
ee02aded115638f633fa9da249846e9c19eab07e
F20101111_AAAELP valecruz_d_Page_39.tif
5b22be18db7c6c46c63ecc22efddc449
019d36c0944f0d351fc073f0d7d33078a2694838
6181 F20101111_AAAEQO valecruz_d_Page_09thm.jpg
5695bf6a16b0ff199d088303b2950974
ed16deee8fc3b57efd1ca06c57f107550c93ada2
134567 F20101111_AAAEGT valecruz_d_Page_75.jp2
0b3efd2dcea151b6d9907a49f2b55a84
bafd6bd84b2dc1eda4a25685e2f2bd4c3aea4bf7
88865 F20101111_AAADZW valecruz_d_Page_68.jpg
bcbfb528d5c80969814b7795771b4189
0abccbc78109857b17db3567e504130e8c389c46
25997 F20101111_AAAEBW valecruz_d_Page_28.QC.jpg
522773e23a54cb68dc86f36631e682db
32ef7529289ef587957e5aa9ee3b9274818ece1e
F20101111_AAAELQ valecruz_d_Page_41.tif
7f769ca91b920c018c5c3a8c866f3b9c
491c8efcb5937a60eab07c9e1140e0468e6836fa
27760 F20101111_AAAEQP valecruz_d_Page_11.QC.jpg
a8f026312e88b31b36b2f6b6c2cc4df1
18749f6986e52ab057bd1487bb996b46cddcdbae
F20101111_AAAEGU valecruz_d_Page_44.tif
eefd10e985b9cfada661f505b52cd570
72d2a23945fd1527967b97f6e0ec44830dde2900
1981 F20101111_AAADZX valecruz_d_Page_28.txt
a88e39129d62ebc1e2b93f724d963b46
1a2d084b88ad781002f4a8598967c4a7af3275ff
5242 F20101111_AAAEBX valecruz_d_Page_45thm.jpg
daf9799e9723647f7310ae6adfb2f53b
a75416100501f7c6ab83bd40d02fe83ae2dce3b7
F20101111_AAAELR valecruz_d_Page_42.tif
7ced5e900073d8c124bf5417cf950cc6
7160bd1861eb325185a823349e9c127517eb223c
25295 F20101111_AAAEGV valecruz_d_Page_71.pro
0ebf3c2fcde775c4a2c0dfd93382a02a
250ff74632cb0631b76faab269664a14d703abb3
6949 F20101111_AAADZY valecruz_d_Page_26thm.jpg
4b5757578e9ace5c62271f9510090176
24d8c571dc3b45cdb6da9e5894b7ff679dc16095
5386 F20101111_AAAEBY valecruz_d_Page_02.jpg
c9d711f933bc758c2b5916e113ddf847
e94f45cd28be35d9abfd94fa8c56a759742c0d2d
F20101111_AAAELS valecruz_d_Page_43.tif
0021a7545617350b501a4209576f264d
d8f1147925ca08fefe89be5444c137f109e81615
6504 F20101111_AAAEQQ valecruz_d_Page_11thm.jpg
36855937393a40248057763756ee04f9
b2795a73405033fddc099b799cfd8a0233aa1453
123786 F20101111_AAAEGW UFE0021887_00001.xml
95f81eae2261f939b26bd520cf7baec4
285256273c328dac90f48f3e226eb97530350033
36076 F20101111_AAADZZ valecruz_d_Page_64.jpg
a9f5e65f8350e6b6e3e575fd80c68631
2707b414fd250ea1f59b3d13bca01786c748292b
88963 F20101111_AAAEBZ valecruz_d_Page_69.jpg
16a55126cfbe359c10f8209dfbd3d20f
4f7f885c92c7ff58b1652ef295f38ff10473e9e0
F20101111_AAAELT valecruz_d_Page_45.tif
7b689c9b46fcd48213c85714abb91fea
7cd6da30f68e5dd86ee719cfdf8169b2f85bfbe4
26777 F20101111_AAAEQR valecruz_d_Page_12.QC.jpg
876583ef6bd5294966868cfa9797c51d
7e6de710d70862d2bb963d247376339d80c9e76e
F20101111_AAAELU valecruz_d_Page_46.tif
e7950408daa1d2e51a2c97da896e8247
09024ca3e3b3c1039bbe7bc35a4a46c4f0d360c0
27757 F20101111_AAAEQS valecruz_d_Page_14.QC.jpg
68219d79b27d6f028bd31cf8b1dddebe
461c54f02063e9308ff802ad8e8ef668b106d1a1
F20101111_AAAELV valecruz_d_Page_47.tif
4c694a3164f395db74f55e3fcb642111
6505b0db295be05fa81390a7be41e9d18caf8a6d
54168 F20101111_AAAEEA valecruz_d_Page_16.pro
7779190d0f8f5e66f28aecfab6cdd189
f02b7b22f98e867b52a9d854eb0b4ab9cfee62e9
26304 F20101111_AAAEQT valecruz_d_Page_15.QC.jpg
8752e0b98e9c3b8dc966e542a8ca47a7
2d7c5858e59846f94d5fa2039140605e5f45bfb3
24670 F20101111_AAAEGZ valecruz_d_Page_01.jpg
53b5a4d813f50568231ff15f5a9079b5
3e7f7911c289227c8168945201c299b50d50c51a
F20101111_AAAELW valecruz_d_Page_53.tif
33cf60d797629412f9363a2017abe873
6623ceb7a285185aeecb040d10b043829b571e02
2283 F20101111_AAAEEB valecruz_d_Page_06.txt
64f7ef3c27857a1747469894602ebc03
094af6bde342f53dbb8ade883e21a263fe362cdc
6457 F20101111_AAAEQU valecruz_d_Page_15thm.jpg
cb0f079ef25d1a9dbbb7db86d1cb4a3e
43ac573ba9338bf241af077068bb945d8791c8a2
F20101111_AAAELX valecruz_d_Page_57.tif
0ed684dc44d07f1d120612bc77e1c5fc
415dab74ada193d0216398d4b13a7f0b3d50cd3b
83244 F20101111_AAAEEC valecruz_d_Page_07.jpg
e1d68fa3e028b37cad9fe0e38df21579
1697cd2dac5a52bba8a7572fb7b6b41f90aa782d
27698 F20101111_AAAEQV valecruz_d_Page_16.QC.jpg
e18eff0bf562fab5803403720d7db671
28658dda1efa27036417cb88c15045d9ac552751
62002 F20101111_AAAEJA valecruz_d_Page_04.jp2
2a678c9a4d725ae08f465353d958f223
2df80700ffd7aa0e508584520c57d52d154b12cb
F20101111_AAAELY valecruz_d_Page_58.tif
0106ababa28bff5492309a6b704d7038
124fed4a1312bf184f9caeace1d4dd5051056f34
7011 F20101111_AAAEED valecruz_d_Page_32thm.jpg
fcb9ccee7581a2bc179f33e1120b3b59
9a643fd0ad70848f2b71d26a29355f9226d5b21c
6649 F20101111_AAAEQW valecruz_d_Page_16thm.jpg
4e51b7de86022078581946f6565daaad
342fa223ce0436f76aa671d78240984466fa7d6f
104752 F20101111_AAAEJB valecruz_d_Page_07.jp2
0c4e937c3dac63d054cf8d657ae074e8
b66ee73ce1837ccc91e0c14627abb297dfe39aee
F20101111_AAAELZ valecruz_d_Page_59.tif
8bddd8d22a6851858a37c77e15638b95
7a1c242e677a6a4abff387302442bd5b6c79e45d
6844 F20101111_AAAEQX valecruz_d_Page_17thm.jpg
741d0a6594dbb77c6de2fa4f993c7a38
edb64c56375ea66b4e723edf4e6bf9b28bfc1c0f
40370 F20101111_AAAEJC valecruz_d_Page_08.jp2
3be06966890dff9a1bbb838866c43687
4060d14bf1ae1966b9dd663ce9e9e6e209c4823b
91435 F20101111_AAAEEE valecruz_d_Page_58.jpg
e1cecbfdd0b734ed942262465348894c
4b9ac25a9ed60bbda8a27107ba531d5d39341f96
6683 F20101111_AAAEQY valecruz_d_Page_18thm.jpg
a6460352043cc7835a81daaf80af364a
0957783ffea0901d7816633a53b9290c26e0edbe
63288 F20101111_AAAEOA valecruz_d_Page_76.pro
e8c34ff6166888fa9fcf029a62d5ac9a
51f02545df356c0e5aa88ed3ccd5d42bf198983a
109993 F20101111_AAAEJD valecruz_d_Page_09.jp2
b3bf882b5dadece11a113784718acd6a
8db3d8cbf3a8ed51fed2b7bc92f346e684441258
83948 F20101111_AAAEEF valecruz_d_Page_10.jpg
53418b9d1ecedb0a3e2c0b9372a17222
3a573a0f400534a90d1006a59a8f129f5959d190
6710 F20101111_AAAEQZ valecruz_d_Page_19thm.jpg
0716643cce797c0b3cefa5180f1f8c62
e377fbb7b3c1e1b3b3d3296b37cfbd41b93a8ee3
65877 F20101111_AAAEOB valecruz_d_Page_78.pro
0d3e7baaa782d4da90f1865663cd8153
eada186f6a8a10207f98853a074318dd229e2c5b
117326 F20101111_AAAEJE valecruz_d_Page_13.jp2
5731a9add1ac0908aa85cc4a454dd1a4
7de6fe85233296c8b93f45597685e62b9f246b1d
2013 F20101111_AAAEEG valecruz_d_Page_20.txt
1697127003b677ff7e767c66f318b69e
ee51ebac9117861202f033e734be6e22921b1991
24586 F20101111_AAAEOC valecruz_d_Page_80.pro
aabe32af1ab0b4d0c4743473ec86a631
579e0e4566b2f8b6a65c56bbc4e14f02d8e16902
110149 F20101111_AAAEJF valecruz_d_Page_15.jp2
cec86388e7fd74112c19c2d1cfd92b62
3c6d65be0f9bda7e7f0cc51f607e79db0bc10b28
1051984 F20101111_AAAEEH valecruz_d_Page_66.jp2
091a52bcd4a569a208241f896c20c531
1d7174e7c7be414a42dc7906ceeed329195c407a
4377 F20101111_AAAETA valecruz_d_Page_67thm.jpg
cde1eaa9f6a65fb04f438fbfef1c941f
59a3b378d9314acf760756cdde01bf12f2e50d20
22030 F20101111_AAAEOD valecruz_d_Page_81.pro
445d1b12733cece7a20749a74bf6d3a4
d4da890124b8db5477f19ae0d216f0dc89936c2e
115906 F20101111_AAAEJG valecruz_d_Page_16.jp2
c9f716c4e1727fbb64dfbd4f3e69446c
c4c7edb99cd80899d15cf73b829957bbed4b52ba
54294 F20101111_AAAEEI valecruz_d_Page_14.pro
2a5f7a527aaa46390824766270039cc6
369e3cbb502112027c57f9eeb236dc21095fd05d
27785 F20101111_AAAETB valecruz_d_Page_68.QC.jpg
ad212cfd5cad48be563acc3315eaa3d3
336d4cd9614d8500f8776ab3d0b6aee938ea0dfa
507 F20101111_AAAEOE valecruz_d_Page_01.txt
68ddbe3aa75bfdd15d17cbcb1fdb54f7
2feb9a0a5c82042409914f7d3a9b1af5bc8a27d0
113639 F20101111_AAAEJH valecruz_d_Page_18.jp2
c3ae6080c682bb392144a30778e1594a
6e74707d8333fe65fd33a9d4437c1c8983b5aa98
6942 F20101111_AAAEEJ valecruz_d_Page_56thm.jpg
11572f1a4019c73842166066bb32cddb
0d9a304fb352b1b6b4b6e7ee9ecb827cfb23c327
6561 F20101111_AAAETC valecruz_d_Page_68thm.jpg
7d19063fe689d2472262350e352992f4
e6e31a2af15834cb7d1c2b9ad63aac89ee608e8b
128 F20101111_AAAEOF valecruz_d_Page_02.txt
16abed4c863ea5b29dfd236900fae57a
0c3d5a1e547e8ed3208812335226b7a23a9a225d
106717 F20101111_AAAEJI valecruz_d_Page_21.jp2
4dec727cea1fdc0a2d659139b7160df6
9e27c3c0df4ee0d92825bd00ab6684ae46ecffd6
110301 F20101111_AAAEEK valecruz_d_Page_10.jp2
8a2fdd074fd317e8248449137cc5f0b9
a267f27a3e3f5d116dc55d26c41d920baa6bc5a8
27921 F20101111_AAAETD valecruz_d_Page_69.QC.jpg
1594c27afecff5d054197f7ab6c90ea4
16577649c612c58dbe2b036f84db72d79ef30374
93 F20101111_AAAEOG valecruz_d_Page_03.txt
bd4a28832c35a399c19470849bc13dba
48efccf4d7ff0dc192dd615b620c147850dbf98c
101847 F20101111_AAAEEL valecruz_d_Page_77.jpg
3fe715049f875d36df3502d53df84ad5
f44935a3f2f7e706024b006788faccfbdaf052f4
28102 F20101111_AAAETE valecruz_d_Page_70.QC.jpg
9c297c6b2bb1264b420f0f463854282c
8eb447d80dae63c3e53e06ccd90d17ab806f3322
1117 F20101111_AAAEOH valecruz_d_Page_04.txt
6f99339ac5bbdab0cbefc99c62e9f2b2
e3ed8d6dd0c6e6a714671cf6eb01d5a477e8dbec
121178 F20101111_AAAEJJ valecruz_d_Page_22.jp2
1eb9b1d3055db6459549cfb8be8fb0c0
4aeb62eba641c43ea49b5f5673920acb18171b75
2060 F20101111_AAAEEM valecruz_d_Page_07.txt
8c889d40df4ed38a5166b6180a7c4eb0
875c2bd3be12c6370bf840de22f19b84b84b56f2
6719 F20101111_AAAETF valecruz_d_Page_70thm.jpg
9f44e21d47c1e381f552f0a95d9d8c02
daedbc1c7263b578951af4136fba6cfe342e394b
669 F20101111_AAAEOI valecruz_d_Page_08.txt
78b2b2fb34c72f5011b0cf82b1a6837f
471ffd266fadb1fa628fa2f281748c5ef9fe67fe
119032 F20101111_AAAEJK valecruz_d_Page_23.jp2
077fdac2e275c8344b1838cbc13c519b
c2e034d067f014bc7deb1bb165839261fc3a32ee
47274 F20101111_AAAEEN valecruz_d_Page_24.pro
0ee79224d9c8e8f76d26fb3a46ab139a
39984b47562487567541de08d77dcb7fb5fce71c
14356 F20101111_AAAETG valecruz_d_Page_71.QC.jpg
b64bc5c35bbde2cc3c21890620acd2c5
9547ce9fa8146c5b6441ca6a6643e8dac4be9a9c
2077 F20101111_AAAEOJ valecruz_d_Page_09.txt
8908d778cfbbd47d9ef0b7d8501674a3
2000cb7e1ce09863f51dc8dcdd291e5ef1daf003
104788 F20101111_AAAEJL valecruz_d_Page_24.jp2
147c5e09135913f05164ffba0b67477b
b196e4cc3bb9f1569ab3aeebe468ce52f9e913b1
1026 F20101111_AAAEEO valecruz_d_Page_80.txt
b8d5b3dae350620e7e38b7806aa25138
773a18128d39d23f4765190428fdae45b50d3799
3377 F20101111_AAAETH valecruz_d_Page_71thm.jpg
1c8307c23884b2312e68478b88aeb44d
f47eaaa2b9c899c736b928c1faec393ea452dbf5
2128 F20101111_AAAEOK valecruz_d_Page_11.txt
99b5a617a90d1d30f67e32475c3e3d8e
7b45b9d497d6833d2b730fefd1f36751dd028ab2
117331 F20101111_AAAEJM valecruz_d_Page_30.jp2
ec4840be47dcc009430a446ba7840ecf
3ff0fa52988cd8f68647b5afa7e14fef5c15b1f9
5644 F20101111_AAAEEP valecruz_d_Page_63thm.jpg
55846bc5aebc80b37b2790946ef63b96
9af8f9df02d8cb8f83ce1bbcd3cb42edd4372e0d
28595 F20101111_AAAETI valecruz_d_Page_72.QC.jpg
1faac3502d9c88a301d956a7221f6ebf
ddd30a7868cf5a1e9a40dc2798b4ce89fc80bd09
2049 F20101111_AAAEOL valecruz_d_Page_12.txt
77d6987db5d7fe6de7ee3810ec1d90d8
4c986ef26f615afeeec75909fa0be916f861885a
120092 F20101111_AAAEJN valecruz_d_Page_32.jp2
e341a298247f7340feb2b226bd5cd26e
0e2313524435fb37ec4996caa00153fb545bffe7
F20101111_AAAEEQ valecruz_d_Page_69.tif
988f81089fc368e86cfbe9649939fd35
43a717c654588888d28c4579cf38f939d9fd3ceb
7078 F20101111_AAAETJ valecruz_d_Page_72thm.jpg
f5c3ac67a5126ef3a4cea527821d16f1
838f2228dfae2993eaded4cc7456366982bbeefe
2161 F20101111_AAAEOM valecruz_d_Page_13.txt
c0e20742efc9f71b74efb83ac2109285
c34622480318b4c349cf49380e06132f80435820
115884 F20101111_AAAEJO valecruz_d_Page_33.jp2
26ef3b6aa68f2a782b2527ff625b9345
60b787cc0b559ff37d65ec749d74b83b0f588454
23851 F20101111_AAAEER valecruz_d_Page_40.QC.jpg
10810c83ef23bf02009f6a27009c6a3e
7b024f158cb3dd947daaa93846cc08e471cc62ed
21869 F20101111_AAADXU valecruz_d_Page_65.QC.jpg
8cd35874f6849d328b9f537336d02448
638b730a9bca136cedf3cc8f55af600ccf05262a
29225 F20101111_AAAETK valecruz_d_Page_73.QC.jpg
2aeb60e3f8385de7eb5386bcfda6f9cc
26ed4e925e9654bfb68be8d49e82a60cd1e74bbe
F20101111_AAAEON valecruz_d_Page_16.txt
7d7ff56232d89a8c1883acdc4d9cfedc
f26452117dd13b7f1fae778b725bb0c039024121
119843 F20101111_AAAEJP valecruz_d_Page_36.jp2
b887ed7f478b9ee9cba0db30dcb27407
178bf75f59fe2e1a997b6c3a5dbd6bd8753175b9
2181 F20101111_AAAEES valecruz_d_Page_32.txt
0b592cf942404faef9c46a2692944eb7
528e6ce8140cfe56b6d6f5c799fbde5dd33cfa7a
2561 F20101111_AAADXV valecruz_d_Page_05.txt
00996dafa82331f741dfb528abffdaa9
4d5f74e6ef29e21d0363d4fc0ec9959beaa14ab5
7236 F20101111_AAAETL valecruz_d_Page_73thm.jpg
d7db03142f57e0383e71cabd1bc34ece
18f2308741a6682977f9d3215eaacd51b0f453b2
1051961 F20101111_AAAEJQ valecruz_d_Page_38.jp2
aa1a9b397c1f4b5ff3df4de113a629b2
e4c12b8f59f6a24ae3560440741caad6cd648cf5
44430 F20101111_AAAEET valecruz_d_Page_80.jpg
5e930b11ec49cfc68ca532b36e54fdb0
12bff6fee07b39fbed732fcec3b10ea97186feea
1051985 F20101111_AAADXW valecruz_d_Page_05.jp2
91da54217e299aa3e0e17a80b9793c0f
d9ac78f48420dcb905e27e680fea4a7f055c7534
30179 F20101111_AAAETM valecruz_d_Page_75.QC.jpg
38185b8ebf4e5eeedaad431dc920e25c
46d537cb50ffb6678ef68ea3b2d94917968efe89
2253 F20101111_AAAEOO valecruz_d_Page_17.txt
de258b42af3326e043b507fd4c2794ad
f73e002dd6ee781566bb7fce2a5536d34ad9b199
1051970 F20101111_AAAEJR valecruz_d_Page_39.jp2
f53ed29dd009bfcb6dd5cef87c87abe3
8ae1d05c015b1ad13b79c20fa098ec8edd9f7a8b
1984 F20101111_AAAEEU valecruz_d_Page_21.txt
764028845eae0ed2715fc40718ed0057
381b600e0c0835aa2162ad044b14280460a422fc
1907 F20101111_AAADXX valecruz_d_Page_24.txt
d0e07b19876fa7b25f19f55d4f04ada2
f8fd92f4c1e5cff3bb7320bb3afa7ea9ad6d7d66
28300 F20101111_AAAETN valecruz_d_Page_76.QC.jpg
83b1de061201776c7d5f356ae3fcdfda
1128c7f77d82f679629ffe93bbc062fe34904241
2108 F20101111_AAAEOP valecruz_d_Page_19.txt
095edde570329d2aa697f2e74a8e17c5
264bb71aed8de00bf8d272f8d7d22220d9b59e6e
1051983 F20101111_AAAEJS valecruz_d_Page_40.jp2
69c43a84b441919f5635097809bb9fa5
e4135bac44d99c365cfacc5e8f91761c832b4618
22256 F20101111_AAAEEV valecruz_d_Page_37.QC.jpg
36291e8f0fd81907ec0c8e04abd49acb
4b858562ecae6e381741f7fd91e5a618f8255c66
27992 F20101111_AAAETO valecruz_d_Page_77.QC.jpg
0b5bdc15e31146ab8f70f58658466ce7
39bff812af833884bebd45690e926c8fd9146784
1940 F20101111_AAAEOQ valecruz_d_Page_25.txt
d59a2ad192f11f97ac01bc1110accc53
82c7db11dd866d11f09f51f3f099ab7c8b6260e7
511290 F20101111_AAAEJT valecruz_d_Page_41.jp2
3861badbef9fbc30afcda5ee18651b56
2185d57a6d7c654581726b0cc0e15903574ca71e
6499 F20101111_AAAEEW valecruz_d_Page_50thm.jpg
11e3c743d7294f739e83c8c521d1894c
092dbabb23c3c057424c95adcb71c5daa38250e7
985253 F20101111_AAADXY valecruz_d_Page_43.jp2
17f4e7b7fae1f71295959a7e5feef567
00d8db68914e762deb47e56c740766cc529a517f
7130 F20101111_AAAETP valecruz_d_Page_78thm.jpg
a58e85818f15b90c3377c935b14ad63c
e65084c486b2e968614fab7d2a61a368fa178184
2100 F20101111_AAAEOR valecruz_d_Page_26.txt
4fed49582f0e6275b8572642416e51be
7fb42bf30b74a79756c81592216269435b6e3770
772954 F20101111_AAAEJU valecruz_d_Page_42.jp2
36c39aa00624a35fa250a660c2bceb5d
edf14f987e98a1c4cb5516f20ecc0f6603ee558e
2117 F20101111_AAAEEX valecruz_d_Page_45.txt
36d712560d47bf7a1391d47285b13c5b
b05c77e5305f5f2f8c9d7116b09088442325f907
29912 F20101111_AAADXZ valecruz_d_Page_40.pro
5dcae3d3f92dc0bc2ad9b90a89b65c3e
dc40434b3c38eb7d37b4431440bbb85225574a8e
6834 F20101111_AAAETQ valecruz_d_Page_79thm.jpg
5fd6b523c10eaddc81d2955e1c5d17cb
306d0263e250eb48babc61a19f77986536800ce1
2091 F20101111_AAAEOS valecruz_d_Page_30.txt
8265683928a0fb6c0a857df459f0c369
1b1461ee58c33bffa6ea5071b68cdc990e8cca14
993462 F20101111_AAAEJV valecruz_d_Page_45.jp2
5e1ece7eeb0cdac61b964b6f6deaa2ab
b5375222488762f025a2a0cbe4e8154ff9a0977c
134400 F20101111_AAAECA valecruz_d_Page_73.jp2
dc0b3fe1d89a00e26d9931436ae13714
3086bf5dcfe77ab0ece5dae2fad1c90c79ba809c
F20101111_AAAEEY valecruz_d_Page_22.tif
3b25924189521e323000584eeb0297f3
0321f3ad9f582ca435a84ceeeedeec65281ff83d
11973 F20101111_AAAETR valecruz_d_Page_80.QC.jpg
535d4fbd30ceb74c52da3637b11e51cd
ea9bc276b735ad809497fd5ffd183cc3d56959a3
2144 F20101111_AAAEOT valecruz_d_Page_31.txt
30540e6c9cf1b1d06b8a351f4b6b1feb
04172d7adda2de76d5f834bbd3cb04c47da7428c
1051935 F20101111_AAAEJW valecruz_d_Page_49.jp2
d15594962aee58d0f61e73dc3bf9bdde
df08cdcd896ad3cd30d84360573708ea77eebf1a
469 F20101111_AAAECB valecruz_d_Page_41.txt
fcd746960ec34880486bd30bf9bd2cb5
dc01c1fc14ee800c57b9475491a56223d4f0224a
F20101111_AAAEEZ valecruz_d_Page_33.tif
f8c2f50894ea6544b3e80abe3e028310
7e34ffb018cad1d87d95b4d981a7947b9cf9d4e5
3015 F20101111_AAAETS valecruz_d_Page_80thm.jpg
37081e433590ebcf788d1a889e816197
cb7efa4e3c4e311ac9872d71fd897ba92923e3c9
2102 F20101111_AAAEOU valecruz_d_Page_33.txt
d6572b0ff38161191251a2484d602b7c
32a28c8249de03541d8b400e338c099ec85493cd
113051 F20101111_AAAEJX valecruz_d_Page_50.jp2
6bf5b0e5f9be7843972881a65833460a
8ca27eb6f733c3ea22fc4d6cc9aed70295fa8fb9
2136 F20101111_AAAEOV valecruz_d_Page_34.txt
18e8a421d75af7e2278b1a8f7e4fc67d
e68646d932dae5ddc62176e1699bd9cda4e3b40e
117692 F20101111_AAAEJY valecruz_d_Page_51.jp2
f2e94e03241167055b7bff39af6cd0f7
7ff877b069491171e7ee9de455a0b6634f605f48
114492 F20101111_AAAECC valecruz_d_Page_34.jp2
15aef175ed733f8f2788fdf8ea2ee3c9
295e54b733460b6b682ced00ba95a3c01be56044
47607 F20101111_AAAEHA valecruz_d_Page_04.jpg
6d692f4da764ce26fea3e9463b6a1157
7b68e72f8d49d05d3ff6b583a38e179e5519a5aa
12940 F20101111_AAAETT valecruz_d_Page_81.QC.jpg
15dea40e8be2b0206673d541d7bc81ee
17e532e9dcb79619c187876288797a568dc72768
2202 F20101111_AAAEOW valecruz_d_Page_35.txt
9ef6535feac2301792a0cb017df1771b
17ff68136cd208915c32e4e946bb2d76639d04f0
115443 F20101111_AAAEJZ valecruz_d_Page_52.jp2
7832c6bed862900c78207a5e8a77cdc0
0d4df76648504eb51c886378eb02d0268ae6c5ff
732 F20101111_AAAECD valecruz_d_Page_64.txt
4a50eae59311835e0070e08d9e07e996
29b0eefa34f71cb09e8ca3ff9e0b83314df46dc5
82225 F20101111_AAAEHB valecruz_d_Page_06.jpg
ec1cfc9396cfb4d52773e8cb3c4c90f9
f8c3b0df976c04a0b5689633d109421a45cb1a3c
2197 F20101111_AAAEOX valecruz_d_Page_36.txt
fbbd1af185bf010dbdd2e56fed78e5c1
bd43d2e0259e96f5c1a7909ca14b46fc98f2630a
44611 F20101111_AAAECE valecruz_d_Page_43.pro
6d6ae348c7316c70182b4c79e9063237
524d05eb7c1e52c1cd2f6150f750b11c50b79bc8
30758 F20101111_AAAEHC valecruz_d_Page_08.jpg
694b8794a3f04a113ecfa1e9756f1d35
489dc95423e6805530af1e4df96cf84ddc930510
1644 F20101111_AAAEOY valecruz_d_Page_37.txt
b91808f83e3d3ff868d3b7e44174987d
4b090df28a0898aa250c345189c05d167df7a223
70101 F20101111_AAAECF valecruz_d_Page_05.jpg
7c575238fdb8a2f8e879711dbd0e094c
c6d6898fb78f73250802804700e1f2b796a900bc
F20101111_AAAEMA valecruz_d_Page_60.tif
d1cc6cb9d89dd627b1ad264e5ecfc630
5d92f0f113c36759d1669bbdf71e544335873cbb
84703 F20101111_AAAEHD valecruz_d_Page_09.jpg
481c5170992bebdff92f54957fed9cd8
0db291f315db2257e4deb9784a9c83adc7d13e2e
1053 F20101111_AAAEOZ valecruz_d_Page_38.txt
9468fb2dd8b9104d75cebb7929a75a2c
5ff6b498bf29db1cb4935583538ef29fdcc7d0b2
20239 F20101111_AAAECG valecruz_d_Page_43.QC.jpg
572a9a4470430da2971da4d28b186952
7027bada6b5fa5a05acb5603778acd9644121802
F20101111_AAAEMB valecruz_d_Page_61.tif
97fc5ba576a63e78317d0c47ec92e2cc
28b6000563496525d10836b89ce32e9bc570d60c
90174 F20101111_AAAEHE valecruz_d_Page_11.jpg
d0cbadc197c8fe20e86f7b993210ff95
01c26ec4c4cea043762a9bc1a54d14a4be6fae12
1516 F20101111_AAAECH valecruz_d_Page_39.txt
80fbf21f61265ddcc723e5475bd3dcf0
82e9757d652c290d1665db6ce41b386cdd41bc11
F20101111_AAAEMC valecruz_d_Page_63.tif
63e885424b03f94088df2346ede9a7d6
1f0dba919ad1bc16c8499335a1e43377befeb51e
89696 F20101111_AAAEHF valecruz_d_Page_13.jpg
332b1549f32161bd96d84d14abd03feb
4fdbf8d2d2656c3a6991c0311364af33b58720f6
6096 F20101111_AAAERA valecruz_d_Page_21thm.jpg
a5bf6a6337bc156f9de39b045ce4b82d
f0a183fc5d3a903c2da15af6b038cdd0c7d3df51
117855 F20101111_AAAECI valecruz_d_Page_11.jp2
c167a9b3ff8963879a6c86d08f63d0c9
b0d16df86f32e5f2ecdbf88a9c7d4e251d7fea67
F20101111_AAAEMD valecruz_d_Page_66.tif
455a5966cd7d58c3140c082728068518
6e4d62b8f8ee51e4ec70303494720191ee55c786
88711 F20101111_AAAEHG valecruz_d_Page_14.jpg
36341a4e57d8f2cf3d3270b914db2861
ef572353df87278cb8a31e557adc13401ec1104b
6937 F20101111_AAAERB valecruz_d_Page_22thm.jpg
603a0ec96f7d391775e55f3ced0d9a80
107eb3bcde64c7b23182db38a0b0d4376ad267fc
117239 F20101111_AAAECJ valecruz_d_Page_19.jp2
9bec2846fa641485c22529af902ff564
b2ca96ad4da965084cba2ecd9e73e1816d18abd8
F20101111_AAAEME valecruz_d_Page_67.tif
e00634a007e6e8d19482814adf298b1d
91aebd6df06708248f43223aafefe246e7b65c9a
28899 F20101111_AAAERC valecruz_d_Page_23.QC.jpg
c41826ed6643839e34c0fa8a54520da2
d4b3e62e93cd2272638a9615517e116bc47f8067
F20101111_AAAECK valecruz_d_Page_14.tif
b2aa856827ae5661207162819021f0fe
f3f814c384ebf45d0dbc568bb0361f6eede3fde0
F20101111_AAAEMF valecruz_d_Page_68.tif
ea3c223bc26584cbd93609fcd07abae8
842fe0cbc7ba320c2afbda0ec607e52a9f7a43b2
89966 F20101111_AAAEHH valecruz_d_Page_16.jpg
36a4c7cf2334e56381b256c649b58165
4b9e7121db70ae1f6811c21d49203a418d620ec1
6526 F20101111_AAAERD valecruz_d_Page_25thm.jpg
554661d277b9262e863afc805462ce83
e0a4639e72e9d204cbdc7a9eb5d383396284354b
10159 F20101111_AAAECL valecruz_d_Page_08.QC.jpg
2d3b97dda7d9db0b692792eb6d2c98a6
b051f33e48275ada5a08f8bd9ab39a52ed232a64
F20101111_AAAEMG valecruz_d_Page_71.tif
c885115f3a6eff8b85fbf38e17b449e0
58e9b2319bb08e86796c7b1774ad17214fb3fc2b
95114 F20101111_AAAEHI valecruz_d_Page_17.jpg
28c39973708fb3cb326e5b70db9fa53f
f9ef5e79a9471b03f987a73b3e221e690fff9400
25341 F20101111_AAAERE valecruz_d_Page_27.QC.jpg
22dc7d6a15d59814a7b41689141fdc0b
916fc237c14e2ba8301885e6ae144ccaa9d21cda
2140 F20101111_AAAECM valecruz_d_Page_70.txt
46d59abc94c615926327b3ac5f6fdce8
5eddfc975fe19357419af6b488f5d4fac31d3729
F20101111_AAAEMH valecruz_d_Page_75.tif
9e43a9393a36341a1b51cc9ce2b9b0d3
8f2dbd832eb31297cef4226d7b46b8cac3657e0d
86930 F20101111_AAAEHJ valecruz_d_Page_18.jpg
810832b5355e5649fb046d7ddafd04ff
6bfc5f90b7d51ee2d3c43766f509dc9ec90d08e1
5934 F20101111_AAAERF valecruz_d_Page_27thm.jpg
16399033baf23415aa2b413c38a1483f
44c9d89f746865082dc39733ddb6078678d1aa33
1051979 F20101111_AAAECN valecruz_d_Page_06.jp2
54127fddbe5cf3080557ed78f25d88cf
333a44291dae6e5965b8fa6baa5fe221be1c3335
F20101111_AAAEMI valecruz_d_Page_79.tif
ca04e7021f18cee3e484124b7eba3c80
b259d7dde4b55842cdef559fddd06df5eb26a1ea
84726 F20101111_AAAEHK valecruz_d_Page_20.jpg
a46b34fc8995da91bba7a48695a67a57
4e32f7214f7bf296bb8bf416034a91075f7cce60
6388 F20101111_AAAERG valecruz_d_Page_28thm.jpg
d742c1da52a365af348dc301b8ef5cb8
8f18af543b03ccfec4c8ad71fc537abdc74fa363
62509 F20101111_AAAECO valecruz_d_Page_79.pro
eec47fce098b8feaa3d44be639e2f44a
30668fc1ff1912d4a668d0858b90d91564ce2ecb
F20101111_AAAEMJ valecruz_d_Page_80.tif
647775c91a84585d1a874a3fb14f642f
2a4b476c61d8f8087522c6a88d0b2312f6de6250
83719 F20101111_AAAEHL valecruz_d_Page_21.jpg
a0c643f9a6781003c9ac26619023e28b
e02f3297e5afa8131681a1ad5ab09238e7b852f4
28654 F20101111_AAAERH valecruz_d_Page_29.QC.jpg
99ccde0bff5250dfcd07003364f1139b
57a6337347d74942a8db30018223ee48b359fab1
F20101111_AAAECP valecruz_d_Page_49.tif
c84374c4569e27014da5d3b3e38a9d9a
180885f5182d24b11f03fa7cae98ef5e4fb3a1bc
F20101111_AAAEMK valecruz_d_Page_81.tif
0c64024a328a83728299ab17b34e358c
b5a20109317fe72f93feedb2b68dadbac383cab0
93732 F20101111_AAAEHM valecruz_d_Page_22.jpg
38d9b920bef17896df27c8d79066e325
e24a99a540f42f0360c9ee18bec31a5539863642
28153 F20101111_AAAERI valecruz_d_Page_30.QC.jpg
0f14d34988cfeed13b1f06c55447b73e
b6ad91f75fe1ca044c73405942512768c086ed88
3339 F20101111_AAAECQ valecruz_d_Page_62thm.jpg
8fc9ddb7a2926152ee4aecaf4d6b7c18
06910f9ffd655e5687ee2eb12cdc68d26ecece79
9392 F20101111_AAAEML valecruz_d_Page_01.pro
cecb1eef02e5d4fe80491e3e4ffbcef3
681bb7e6c1dbb88aff79daf82fb68a334cf68262
92517 F20101111_AAAEHN valecruz_d_Page_23.jpg
f9f7de9f8cfb3019aba1d135964b2bb7
7132db24650a15f20c63ce059ae1a3001e03b20e
28865 F20101111_AAAERJ valecruz_d_Page_31.QC.jpg
cf0f562a9f3af40468df3ff6c3275ae6
a0add73beace911d0033935604d88418f0dfe784
2082 F20101111_AAAECR valecruz_d_Page_18.txt
3f7c172d6b6d20839ce6aad7e5f44e5a
03b179568ad893b25b4cebcd46857d9de7b71194
81406 F20101111_AAAEHO valecruz_d_Page_24.jpg
0ae48920ec09552055fd0119f731e08a
99623c8e194dedf072d6f48dad6747c1d0c5be04
6807 F20101111_AAAERK valecruz_d_Page_31thm.jpg
cbd1b8b27b99950368f036659857823a
755e05d0ecb19f5a859d3f5a8e88fafd92b1fff6
28120 F20101111_AAAECS valecruz_d_Page_26.QC.jpg
2185a24725a0c8d698a66ad9f4a1c38e
e00bbd78794d3118312df1a6d2bbc10b51a84c34
1018 F20101111_AAAEMM valecruz_d_Page_03.pro
99fd2a3c45c9eaca272c9389824d36a5
b212bd8dceae2cad66688bc48262e73c6d51ab0a
79642 F20101111_AAAEHP valecruz_d_Page_27.jpg
ebe0aeb7b6bfb89576b45612bd28b74d
ed54b64b907b4f925be04169eceb52742cb4ba02
29005 F20101111_AAAERL valecruz_d_Page_32.QC.jpg
530ddd0f1ac258b01fdf42a83ba29ea6
1e9a1d83f74c6c804f06a4f0a12de1b37ab3dc0f
36109 F20101111_AAAECT valecruz_d_Page_62.jpg
e9e72e5ea998eb4561138de7ac5e3e82
f141d52ad50f79d388ff7a03d613e0123978d8a2
55970 F20101111_AAAEMN valecruz_d_Page_06.pro
d47b94aff582ff03ad21d4982911d146
01833b1a47c0933b5ed30335ca9696d857841997
82884 F20101111_AAAEHQ valecruz_d_Page_28.jpg
51c2c7f0918fc502ab3c605c005732dd
97005e5faf82b8dd3206bd5cdb7b947e3e925dea
6653 F20101111_AAAERM valecruz_d_Page_33thm.jpg
78744bea7ec853b4fb27606f733e6d21
257dd14042ebe0f34c3df775e51fd28b6283bb1f
6628 F20101111_AAAECU valecruz_d_Page_30thm.jpg
2a5e4fb56e8418aa7eb8907667471518
e9f4fe4baa2f5fe3a4c0c8ae2ced3a79119a8b79
47542 F20101111_AAAEMO valecruz_d_Page_07.pro
d0baa03d0cd44728575859653539ebff
42af33fc0b18123814aee40e9a043bcfa19d0cd2
91564 F20101111_AAAEHR valecruz_d_Page_29.jpg
c0811bb66afa53bba61ec319d36d6a9a
b1719d9c9da40f159996cebe644983a8a267b24c
27768 F20101111_AAAERN valecruz_d_Page_34.QC.jpg
345e28bf5909dd025ffb335799fde791
7c8d96808d6e84d89ce7efcafd87f6a76db4a300
7220 F20101111_AAAECV valecruz_d_Page_74thm.jpg
fdc4325553feacb7c4bfb6f431fc9050
11a9e012904a20f00da6581538c071adaf1ebb44
16862 F20101111_AAAEMP valecruz_d_Page_08.pro
dec8ea38b3b8b16e62b029a037f526e7
e0b2a4a94e72e90efa7575521649392e2533eddc
91535 F20101111_AAAEHS valecruz_d_Page_31.jpg
6ec7428252930e90c821414de5a4829f
dee77abb6f427c33005678fcae4c72b8c8f4e93c
6708 F20101111_AAAERO valecruz_d_Page_34thm.jpg
20a87682ce8d144b62dbddd4aaa3d2d1
7dd4b0e5f0fa209d053e786b290d9105d8299ce0
86415 F20101111_AAAECW valecruz_d_Page_12.jpg
4dcb58dda92630722481945cac772689
60a8700f34a915c4aacfd5d53e66fada6541eef0
50401 F20101111_AAAEMQ valecruz_d_Page_09.pro
cd18a4ed151faa7d021f04f8385a033f
b48d7f3b7e25c111ba4eb4455b0d12efe55d115b
92858 F20101111_AAAEHT valecruz_d_Page_32.jpg
e6cad481ff903ef906ef1257d06cc7e2
5a9644ddd574e32008af7a0d428ffd3b4a607812
28913 F20101111_AAAERP valecruz_d_Page_35.QC.jpg
845369e81c8a147c022a270fc837b772
d50b9cfb971b7ed16f8172c78bba39b25e8019ac
54346 F20101111_AAAEMR valecruz_d_Page_11.pro
c2839b6bc0ac806d282125fe5f452c03
adac07db807f6667c0636cfa1d72e0be5dbf4230
89299 F20101111_AAAEHU valecruz_d_Page_33.jpg
c296188830a47db446a4240d6237677c
55ce7db27270646025a81b91e45510a62d0c187e
112300 F20101111_AAAECX valecruz_d_Page_12.jp2
9593fc3af1548acf809505b81765649a
c49bee823704514fd2874b256906c134dd5d2c16
6849 F20101111_AAAERQ valecruz_d_Page_35thm.jpg
1a8af452ead49dce9e8ae88aa7845955
bfb07dd627f9246c29f853eac5c48d404ba35091
51954 F20101111_AAAEMS valecruz_d_Page_12.pro
0fa31456fa05767bcd5242d082ac0cc1
2729751595db39a4a912d1ec61f89da6fa907398
87397 F20101111_AAAEHV valecruz_d_Page_34.jpg
89cbc155685d42728d94fadbcb81421c
b71b84653c395b11ffe719716d9264effda90376
117349 F20101111_AAAECY valecruz_d_Page_29.jp2
36f8ba390f2a399a2567c5ca6d2a4a29
ed25545afd1854829f25f8e0c6943d064242f947
53786 F20101111_AAAEMT valecruz_d_Page_13.pro
b5011d8040712dd4082cabd9e73db97d
351d1bf8d736ab319125049622a77c3d60aa09f6
92873 F20101111_AAAEHW valecruz_d_Page_35.jpg
1f7b5890e7119fbcd39d02dedbcee6f6
144c9a0c9fd9508cd4d6b9be95a5e9ec51d5753d
56153 F20101111_AAADYA valecruz_d_Page_22.pro
e852ecbfc26e45d2b7173269ea6c1555
4752b7a899eb11c40b90f7a28bff6abad4c7ee56
2009 F20101111_AAAEAA valecruz_d_Page_15.txt
f398ac442c07a4a293bb1fb1e9d7ae08
4c69478671d9b8d59c9c2eae4774002490172096
486 F20101111_AAAECZ valecruz_d_Page_62.txt
e16ceab955c07703e8ca8b2efbb92ded
5a9a3d68fe828a6edd4dd377f2bd742367c1815f
29177 F20101111_AAAERR valecruz_d_Page_36.QC.jpg
9d0641eb9b7e65050a8556efa5577e4b
24e0d25e036e7fc4bfb5924dc5aab833d8363fb4
57614 F20101111_AAAEMU valecruz_d_Page_17.pro
fb7d5ae938ff94d4ccf1f17e30ecc9eb
9f95061bb5d654bb70b4b05eb5dbca2adb0b96c5
70030 F20101111_AAAEHX valecruz_d_Page_37.jpg
15c1c32fb5cbe5cf9b473d943518ea6a
e9353d4009ba5b8aedb0b8a7128529c89db79452
2571 F20101111_AAADYB valecruz_d_Page_79.txt
580e61cbf95c86033e2e75d5c3e68184
ec94d6ca5b6f44b090b6734049938d93f341e674
4015 F20101111_AAAEAB valecruz_d_Page_05thm.jpg
95e6d2b503b06f5e15c692ff7502ba79
4a5f737564fd15c5b79c58576107c5d16cb9b1a0
20341 F20101111_AAAERS valecruz_d_Page_38.QC.jpg
4bdeb773c1e3ab6ecd18c28dfa247f48
bfd9632b7c7330de9e0534f7611d426ec3b5e1e7
50925 F20101111_AAAEMV valecruz_d_Page_20.pro
341b7cd4695ab4873d562453b00c9fb5
81b0b10eac6ffefa8fc3be7e65422a757a1fdbd6
F20101111_AAAEFA valecruz_d_Page_58thm.jpg
8fd380445a296da987a83675829b88b4
4f71337eec505b781f64c0e409706dec0f6f7e7b
79666 F20101111_AAAEHY valecruz_d_Page_38.jpg
0df575a1e4e74888dfb166da33c3539f
79d9eaac8d1591a858456e67f5ac6e2082e3756e
5407 F20101111_AAADYC valecruz_d_Page_39thm.jpg
aa4952dfe3fd11e03c7c8b7e2bfa88db
53db5b48e9f5443578ae953053cb98db0a2c43e5
27871 F20101111_AAAEAC valecruz_d_Page_79.QC.jpg
45dd1bb424176eedf95c6c545e9a10bd
a411e5acc8eda193b2b503c44027da1821840aae
4901 F20101111_AAAERT valecruz_d_Page_38thm.jpg
7319929a6bf3a9931a31a840cdcada79
e13c7e92713cd33f8a67e7d15b65518d22b46c2d
47586 F20101111_AAAEMW valecruz_d_Page_21.pro
50092401ac172400fbf7c1cc9df33420
87a9ebdab6aa5b34aef6f98932d8ce833dfd48e3
124948 F20101111_AAAEFB valecruz_d_Page_44.jp2
ec63f4fefc5f6ad98a8fb2498c8c0ddb
e7ea756eed35e4cc39b8bd36f40dc137fca04516
87789 F20101111_AAAEHZ valecruz_d_Page_39.jpg
8cc3cc65df6bff9536f3c8b7af2d9e72
4f79d242ff2cfe9464cca05f5e65484e8d5988a6
113986 F20101111_AAADYD valecruz_d_Page_59.jp2
8873e4157a3f32a2d5ae99362d252c02
ac2e1d7d625a21b12d9fd1119145b99ddeccefb5
29589 F20101111_AAAEAD valecruz_d_Page_74.QC.jpg
27eb4fbedba3da8e34bbd5ecc8c54e38
2b8599a27a6a1a3e157e132925efe7614fdb444b
22890 F20101111_AAAERU valecruz_d_Page_39.QC.jpg
92077dc38fb55347102d1ea080391e10
c85f18bc0c6067fc97751039dc84a5547acf97fe
49266 F20101111_AAAEMX valecruz_d_Page_25.pro
b7fcb4b8f723347c73d3e18201b739d3
a52314c96611a64f139f67559a79b523b6fe2647
F20101111_AAAEFC valecruz_d_Page_10.tif
984f367e33900b39627ce3b4fb48e646
68878097fb1ef1b02f22b434e1e4ebbd9d53c747
53130 F20101111_AAADYE valecruz_d_Page_59.pro
39ddba900ff420f36984c9ec0451f0e4
c7e4cd20882692d24f9356f4d27ff606088c9416
44311 F20101111_AAAEAE valecruz_d_Page_45.pro
fa982fa3bfdc2c798ef574114cd8cec3
9819166ec71d5d25307b16443181f04c13702e76
11178 F20101111_AAAERV valecruz_d_Page_41.QC.jpg
c20ef45b961a6f29c0c366dfe6de3b5e
9237fd9f9093bffc3c213483f041416635385017
54027 F20101111_AAAEMY valecruz_d_Page_29.pro
320e9c35313b2b3b5a62dc55fb88fdbd
c9902e0dfe0703b98c837057e17a1689d9924b86
442100 F20101111_AAAEFD valecruz_d_Page_64.jp2
a63220f528df12157074b4ca83328439
10ca835f0d77497ac713eca0c5556bac9c7d82c2
5587 F20101111_AAADYF valecruz_d_Page_40thm.jpg
26719c4edbcba0e42808baf23a1d1756
63e7156e94a963a0401b9cc2dce3ac03247b9ad4
27929 F20101111_AAAEAF valecruz_d_Page_19.QC.jpg
20951b449a6164ba8b0c7a48d61185bd
7edde24bcfe31fc5c42c380860c0abb07eb10a6a
108878 F20101111_AAAEKA valecruz_d_Page_53.jp2
b4a796a5151a83f2a7007651428e3cbd
d91daefcf1e9f041a4cde294e962d1ff00485b91
3522 F20101111_AAAERW valecruz_d_Page_41thm.jpg
4bc351353725b58fb01df58d3ace5799
78a83759040312137fee7c08331902f10afe8b7e
53140 F20101111_AAAEMZ valecruz_d_Page_30.pro
e204f0e012bf8203bd8b28d849bdb05b
55da9fcc091c7a04c23fedb065f2e2900cd7948d
1051967 F20101111_AAAEFE valecruz_d_Page_46.jp2
d89205247f6e46c1e6602000a558fa2d
660e9f3e0497a40ef6b0990e6ca79bda2ebe30df
6700 F20101111_AAADYG valecruz_d_Page_14thm.jpg
82214cc0194b61a962c223c73b4b37bf
3bb76be5bede1ee7eae99467bc72827218480215
28105 F20101111_AAAEAG valecruz_d_Page_52.QC.jpg
29c44d4c7eda148b672fe08be143d759
f71c144cfa2d0cac58ea57255b89d63714b66019
107763 F20101111_AAAEKB valecruz_d_Page_55.jp2
22de86f0c48a71ab3b76c3a067c7a48a
fd770b9a3f25737afba360279f10d31b4c763d1a
16821 F20101111_AAAERX valecruz_d_Page_42.QC.jpg
91f7f32df00ce1b61d1e28cc1d0e4bdd
f04267120d03b5b241508174f2f60193ca157f7e
54126 F20101111_AAADYH valecruz_d_Page_52.pro
330223d42621bcd20e625784b2f2d996
ede911440ef89c32e0083d52a5092b12aae75d47
110844 F20101111_AAAEAH valecruz_d_Page_25.jp2
1b41d04def8d84be9873cd0ec1c90412
d1ca7e33790d3007b36316f1adcab23718f65059
115739 F20101111_AAAEKC valecruz_d_Page_56.jp2
98962a2b4b3dd9fcf2bd44e56c24fd00
9885b0b52d66737f91e529409452f79f78c53810
4253 F20101111_AAAERY valecruz_d_Page_42thm.jpg
74e004714280acc7907a887b17cbe23c
91942904266100bde00a31cf439993e94bd1677f
1669 F20101111_AAAEPA valecruz_d_Page_40.txt
2f6869104066e5cc9354817981f2e49e
b02c68bb25309b76616a4769efbbf137320da1b9
2196 F20101111_AAAEFF valecruz_d_Page_57.txt
cfc6edc137562f2718cd62cca07bb83c
7973b27267ef4b31a68016386d2deb2cad6d5c43
90692 F20101111_AAADYI valecruz_d_Page_51.jpg
b977a67fb51a0391e3b3b5196e9e6dcd
6e8ec58fc7894e7aa089ca7ac16505d6a302dcd5
7025 F20101111_AAAEAI valecruz_d_Page_77thm.jpg
7fcd0468762ef14a63a2d3cbf94ee9ce
062fb26f80cf45a60c0b0939a11385b5a3bd97c0
118911 F20101111_AAAEKD valecruz_d_Page_57.jp2
fc60a6029e3dd9914ac947e6917dd05f
1a0650de53cf41baa7b23d4f73bac605870ca278
5042 F20101111_AAAERZ valecruz_d_Page_43thm.jpg
0b9206e3b6bb126cacf86883ee78928d
d3c027abf77919d445462fce5380b55ff12d4b5c
1812 F20101111_AAAEPB valecruz_d_Page_43.txt
5a767dbeed49dedb4fb8d47727df605a
bf7e2cb869bec056f109eabd5300603fe9c1efd2
117590 F20101111_AAAEFG valecruz_d_Page_70.jp2
fac3dbd2edf181645c7cf10c2638309c
0cc1ab9f230d70cf0d2a093e1f8b3ee31c25676f
6706 F20101111_AAADYJ valecruz_d_Page_54thm.jpg
6470a685bf7b1330af6ed93d21d7e7d2
35db1fb9f991a2520e386b94a9101fbdea30f17d
109986 F20101111_AAAEAJ valecruz_d_Page_20.jp2
92ea7f6a5c5228d2a361c371096eba79
7ca0dd40f8da7f2fc72b5def9a373dd05cb7c06a
120466 F20101111_AAAEKE valecruz_d_Page_60.jp2
2bb7df2aceccc19568a540b9f97d887c
011831fbcd9f6f56018fd4cea1335ba63220678e
239 F20101111_AAAEPC valecruz_d_Page_44.txt
aca79c25230556be7cbde308563392d6
42f88f376516c15ca644da2d53e95238717eedf4
6535 F20101111_AAAEFH valecruz_d_Page_10thm.jpg
2f851143b6fad245facba27150306923
eb9bb8bfe4aaaaf9e1ca5c2e981d81fed4e00332
2171 F20101111_AAADYK valecruz_d_Page_23.txt
e2c4765f39cae6bd05266923bb716795
0376414717ca6a2c4326047c51d3f7ce3d7d8a06
2572 F20101111_AAAEAK valecruz_d_Page_72.txt
220892dce2ec19ad116a84e7e7e51913
eb55f9d5431b881a1a606521b75af3b7803d574a
76162 F20101111_AAAEKF valecruz_d_Page_61.jp2
3f2c06600ec2a79c66898bdd9bfe3b3e
a28fd0e22b4c4e8ea54ed365103b200c3f2fc19a
986 F20101111_AAAEPD valecruz_d_Page_46.txt
83334720f5ab19057febeaef694195fe
ed9d629d29c8cff1347c53d3f8d2c02694e9476f
121635 F20101111_AAAEFI valecruz_d_Page_17.jp2
867b809bc3483b6513d111bf0ebc7097
7b8d95ecf036867918ba1178cf31428247a10c5e
F20101111_AAADYL valecruz_d_Page_55.tif
4af0807d283006e1b622386ce5ae858d
6a262ddaf2abc41bb1f63e3f3043a280aa2e6223
10857 F20101111_AAAEAL valecruz_d_Page_62.QC.jpg
3c34529a48e5afa8073c2b4815bfc6e6
913ede0992913a01a9e8e6078325d8fb508abe9e
558363 F20101111_AAAEKG valecruz_d_Page_62.jp2
96cc0b9178c942d12c3a7269d8de62c4
12596c73cc438796830f87522a58d2b1d84eef15
673 F20101111_AAAEPE valecruz_d_Page_47.txt
50329e473638917c01ce65faf8863305
d7f6df2217c23b7d6e8be672dd613b8d7c18b4a0
F20101111_AAAEFJ valecruz_d_Page_28.tif
ca4df13f2ee3eaa6a09b67476ac2eff7
e8d4b8b744ccb5f8106e8fffdd4ec1a69941b876
F20101111_AAADYM valecruz_d_Page_73.tif
7d362deb1446310820ff04db6e396fdb
0dc2ab4db2c18385df42baa166d3a4dd4347abad
F20101111_AAAEAM valecruz_d_Page_77.tif
a9edbfbe54850d13598ada2f86428ffc
83400be2b97ddfd960baef47ae656579965dcc79
818264 F20101111_AAAEKH valecruz_d_Page_63.jp2
83c94d1e0e5e53112693b4d9fa8fd1e4
7dda304d4c68c1cda8cad7f9956e9db2c9edf83f
939 F20101111_AAAEPF valecruz_d_Page_48.txt
d491aa22a29f4fd540737f2ab8726e39
39d13d89a69fe6b47c672440955045ca67f309eb
44511 F20101111_AAAEFK valecruz_d_Page_67.pro
aaad21f8e10a0a78bc9b3bf0d3c89c32
4d00fd91ef0a615ed406897fa81feddac404e6c6
6895 F20101111_AAADYN valecruz_d_Page_23thm.jpg
f53a689c0065ffebd788af81358daba3
cf689d0032a342cb2dfc780b3bac19408cac4481
1051966 F20101111_AAAEAN valecruz_d_Page_48.jp2
e9ff240ef60b60a2061cf9d6979060e5
ecbd03f68a596864f1c0d8fc3fec2fbe719673ce
1051981 F20101111_AAAEKI valecruz_d_Page_65.jp2
4d82b88a4c8357245ae863e72fa35973
6e15f38c9c307568f7dcb9f4a93136e0c2840160
1240 F20101111_AAAEPG valecruz_d_Page_49.txt
2c99b5ff3b6003192e28a21f6615bdd0
7552b8eb195c063dbf7eaf5dfc198b827510e6b6
102380 F20101111_AAAEFL valecruz_d_Page_72.jpg
5be01d0bc6616066451db94cd23fcb90
afdaf72dc851357398b076a724cb7bc6335ae616
6707 F20101111_AAADYO valecruz_d_Page_29thm.jpg
ae559e4d72834a064e98bd497b1829e1
0b21cfda52c15dd88693a4dada17740ad3156621
F20101111_AAAEAO valecruz_d_Page_54.tif
03abae0e5d70a66d18a0352c421d9caf
9dfce3d6f70830186e649ceff8a735e6ac58482e
1051812 F20101111_AAAEKJ valecruz_d_Page_67.jp2
511e457683fe6d45acf1dc95b299989c
62e5a5c6b67549ba17694c85f347e670a4617d2b
2113 F20101111_AAAEPH valecruz_d_Page_50.txt
ee7f75fe1300a7d1233381b32d4b00b5
137a78950935c9c88ed9045433ed0193451fb13a
25451 F20101111_AAAEFM valecruz_d_Page_21.QC.jpg
4737b820edd2a605258dd0129bc06aa9
3f303d5524a8fd677c9f78b2cd8fdaf7168c38f8
34106 F20101111_AAADYP valecruz_d_Page_61.pro
0e9059dd836982f2d2dea768c839032e
a6b15630f4ba64c3d142c11a26f788c723f7b953
55251 F20101111_AAAEAP valecruz_d_Page_23.pro
ea2558e129ddf21b05eb4b9f6c77dc2c
4b936c0c4392889dbc9b6618276ba69b225d62da
2175 F20101111_AAAEPI valecruz_d_Page_51.txt
92d648380d6724fe6cb9df9514473e90
4f711795e31377f4787564f93b6ed45a6ede9e11
F20101111_AAAEFN valecruz_d_Page_72.tif
7c270eaddef9666ea228a9d6873c9449
3c3b787297ef18a594e3444b6c34be907536e328
2199 F20101111_AAADYQ valecruz_d_Page_22.txt
8d32e6e2be34486f534ef88e1c945809
97d78a8bf9f26b1acde71415415cceec1015dcb0
2055 F20101111_AAAEAQ valecruz_d_Page_10.txt
f791fafb7c6dec8b4d664b5a479e73f3
9b60044861b602720d20c94fae559eb7443d17a3
114659 F20101111_AAAEKK valecruz_d_Page_68.jp2
19f1ea9078711bb430032ec7705c9062
0b1a470ea8a3d447ba6adf273aa93f195898afef
2133 F20101111_AAAEPJ valecruz_d_Page_52.txt
34ab059fa852694f8071f8c98c7d4f66
3a7d2916450013914d9bf2369670e5b04e02316d
119476 F20101111_AAAEFO valecruz_d_Page_35.jp2
aaf4ad07db148f2bd340611774b93793
0142b2b47bd65bad9d6f58e346c5e620a0e98820
28735 F20101111_AAADYR valecruz_d_Page_78.QC.jpg
66f00a5789531b5039a51c761a3b90cd
2448c66bd83a7293c865790c7c0fccb4e6aed603
55937 F20101111_AAAEAR valecruz_d_Page_36.pro
55b6cdef9db192906d4ebe67f8682cfd
56488be754763222a9da2a043108796438b98284
115050 F20101111_AAAEKL valecruz_d_Page_69.jp2
bb449642ae425f9a70acb5c2d0b2cac7
0525f77d68d908592bc87c1286f3606ac7d37273
1876 F20101111_AAAEPK valecruz_d_Page_53.txt
a6545e3ce2927ea0909fb963e4c367bd
76c5952419c89b624619de3c0de12e3497b2f6c3
60740 F20101111_AAAEFP valecruz_d_Page_05.pro
ae4439e54b6017e4113b580377b1de1b
c8ac1c1afa76f519f979a8e3464066532043df58
67188 F20101111_AAADYS valecruz_d_Page_75.pro
d8a13723c7813666224d728d0db0613f
6e75898e0372ff8587a71a3a9d3919a3faa142c3
27894 F20101111_AAAEAS valecruz_d_Page_18.QC.jpg
e0fb1442e59b3fade2994b5dd04fc513
c93218720afb0b565931f2f22814cb1abd948455
57086 F20101111_AAAEKM valecruz_d_Page_71.jp2
862a14ff8267f427dea9b316183a923b
ea7ba5ce2158f2c4cf0403be1c18b9d71dba234b
1939 F20101111_AAAEPL valecruz_d_Page_55.txt
70b877037dc6edfe3522c3536b0d8d77
c6fa08b4cb8188e529cd4988c450b501f884e6c9
65886 F20101111_AAAEFQ valecruz_d_Page_73.pro
eab9610b4a6f02b8e4755d84645b2749
e5a40b1de1ad543b8c9aa53a62e134c951382e43
126675 F20101111_AAADYT valecruz_d_Page_72.jp2
68e4f5eed35a5036a5dba35c80c197e5
bdc6c11c99f090bb7d0b460d683c9e658eec545a
25645 F20101111_AAAEAT valecruz_d_Page_55.QC.jpg
a7777e5f742a019d38655b6dc10ce8c6
d3f08db51aaa72c83fbd792610796732974c98b3
126988 F20101111_AAAEKN valecruz_d_Page_77.jp2
69d6a9e74aa83d1dc99391f2b92cedc4
687004285fbd8e1715a9716300d68960e8d51486
2159 F20101111_AAAEPM valecruz_d_Page_56.txt
b100a3bc533d6656624a6fa542a77a21
29ac573d1f29537b691183b5ff76c50ce76a2d33
318356 F20101111_AAAEFR valecruz_d_Page_47.jp2
657acf4b6ed6f131fe0d178fc92e3035
ba913693b15fa5270a7d3c79b71f241375fa647b
26802 F20101111_AAADYU valecruz_d_Page_25.QC.jpg
059ab057dc7c3dbd71a473511c000256
4325f10c506b9c591467a8e12ff753959a899306
25122 F20101111_AAAEAU valecruz_d_Page_24.QC.jpg
dfc7415fb65f2b3bdaf34c5179aae0d7
9b41c8076aca2a5400d1839711bef455437b0c59
135580 F20101111_AAAEKO valecruz_d_Page_78.jp2
c3427b0ab3fd8c8698694b6ff7dee331
6ec1f8fad816942fbc60c276781b1ac1c509c6bc
2201 F20101111_AAAEPN valecruz_d_Page_58.txt
3724020edb31e1c1aa9edc4b82b87f0d
4d559c8be13d693ee11d9196486c5050bcac2767
18025 F20101111_AAAEFS valecruz_d_Page_48.QC.jpg
620a416987f42ca9ff0fb204901f1770
e5fa9be22fb26919d32e015711626f69436e416c
45188 F20101111_AAADYV valecruz_d_Page_71.jpg
65fb8dc48b31b98e8a65064bcb1d58dd
0056f5faec22e049da0ea42c6c3b9b839934f5cb
F20101111_AAAEAV valecruz_d_Page_19.tif
a3e300493878ff16a3059f1639a23c51
de2508582baaf88d4974004a0fb5ac6fb6d11410
128774 F20101111_AAAEKP valecruz_d_Page_79.jp2
67060f12d5e1d630b438534ff7c5cda5
a88596a27b4d03610372062d3651450ef8e907f2
2138 F20101111_AAAEPO valecruz_d_Page_59.txt
2a34c3c0b37c10b9ec9410942ad85292
36034af3102156d7a9ab08132a066008666770cc
90335 F20101111_AAADYW valecruz_d_Page_19.jpg
6f38f3fad585a4e78179bf621ecfa4d6
bdd5670636e4172e76fa0712636dc4bcc7f52bcc
2194 F20101111_AAAEAW valecruz_d_Page_60.txt
9df6d0ef61fd9242113a7e74d05daced
54f5a9698edd88366fc5dea0244cc0f0043b6d1d
53890 F20101111_AAAEKQ valecruz_d_Page_80.jp2
b185d1b49f43c45249060528972df274
bd031aa2de8ebaa7e7af48ccc57dcc415d9b211d
F20101111_AAAEFT valecruz_d_Page_64.tif
5ff5678d322932463bad4a175df7b9ee
585526b198a640d3f7cac22cb6a9ef422f2cc3f4
15043 F20101111_AAADYX valecruz_d_Page_04.QC.jpg
555e629fd73918a9db06eb78827a8359
056daf82d480b840d0ec321544430c8b56f98aea
7291 F20101111_AAAEAX valecruz_d_Page_75thm.jpg
55a8dc39c7ec66c099a79059b8e1d10c
31a9386bbcc73f5dc7337d6152fc39aacbd1b82a
50693 F20101111_AAAEKR valecruz_d_Page_81.jp2
72e24313e9c4733703ba34334d757b06
70ee11708951c5013fcdede10243f1946a712189
F20101111_AAAEFU valecruz_d_Page_78.tif
d454110616321817a3df5291b3a30e1f
c5d7374704dd1f3c0acb960f3ba2130b600489b2







ROLE OF ACTIVATING TRANSCRIPTION FACTOR-2 IN CONTROL OF POCKET
PROTEIN EXPRESSION AND REGULATION OF CHONDROCYTE GROWTH




















By

DUSTIN SHAWN VALE-CRUZ


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008



































To my wife, Kristi, for her unconditional love and support.
































2008 Dustin Shawn Vale-Cruz









ACKNOWLEDGMENTS

I would like to thank my advisor Phyllis Luvalle. Since I started working with Phyllis

she has respected and fostered my independence as a scientist. She has always kept my best

interests in mind. I would also like to thank my supervisory committee for providing valuable

insight, positive feedback, and considerable guidance. The faculty and staff of the Anatomy and

Cell Biology department deserve acknowledgement for providing insight into technical concerns

and for offering assistance. I am grateful to all the members of the Open Lab, past and present,

for exchanging ideas and offering constructive criticism.

Finally, and most importantly, I would like to thank my wife Kristi for all she has

sacrificed in order for me to pursue my goals. She has constantly made my education and career

goals a priority. Her constant love and support inspired me to continue pursuing my goals even

seemingly insurmountable hardships. I offer my deepest appreciation for all she has given to me

and our family.









TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ........ .............................. ........4.

LIST OF FIGURES ................... ................... .................................6

ABSTRACT ............................................................................................. 7

CHAPTER

1 INTRODUCTION................... ..................................... ....... 9

Skeletal D evelopm ent................... .................. .................. ..... .... ... 10
Skeletal B one G row th..................................... .... ........ ..... .. ...... .... .13
Role of Activating Transcription Factor-2 (ATF-2) in Skeletal Bone Growth ...........15
Pocket Proteins and Cell Cycle Control...................................... ...................... ........... 18

2 ACTIVATING TRANSCRIPTION FACTOR-2 AFFECTS SKELETAL GROWTH BY
MODULATING PRB GENE EXPRESSION ........... .........................21

Introduction...........................................................................................21
M materials and M ethods................... ................... ...... .. ................. .....24
Results ................... ..................... ................... ................ 28
Discussion........................ ............... ................................. 34

3 CONDITIONAL DELETION OF RETINOBLASTOMA IN CHONDROCYTES.........50

In tro d u ctio n ........................................................................... ................ 5 0
M materials and M ethods................... ................................... ..... ...... 53
Results ................... .................... ................... ............... 55
D iscussion................... .................................................. 59

4 CON CLU SION S ..................................... ............................. 68

Overview of Findings .............................................. ....... ....... .......... .....68
Q questions and F uture Studies.......................................... ............................................69

LIST OF REFERENCES................... ........................................... 72

BIOGRAPHICAL SKETCH ........................... ..............................81









LIST OF FIGURES


Figure page

2-1. Immunohistochemical localization of pocket proteins in newborn growth plates............38

2-2. Immunolocalization of pocket proteins in 1-week-old growth plates ............................39

2-3. Immunohistochemical localization of pocket proteins in 3 week-old growth plates. .......40

2-4. Expression of pocket proteins is altered in response to ATF-2 mutation.......................41

2-5. Levels of pRb mRNA are reduced in ATF-2 mutant chondrocytes as opposed to wild
ty p e............. ...................... ............................................... . ...... 42

2-6. Expression of pRb mRNA is increased coincident with chondrgenic differentiation.......43

2-7. Cell cycle analysis of ATDC5 undergoing chondrogenic differentiation ......................45

2-8. Type X collagen immunostaining in wild type (+/+) and ATF-2 mutant (m/m)
hypertrophic chondrocytes .......................................................... ................ 46

2-9. Immunostainingfor Ki67 in wild type (+/+) and ATF-2 mutant (m/m) animals ..............48

2-10. Incorporation of BrdU in wild type (+/+) and ATF-2 mutant (m/m) primary
chondrocytes ................................................................. ......... .........49

3-1. Comparison of normal and conditional mutant animals...............................................62

3-2. Skeletal staining of newborn wild type and pRb conditional deletion mutants ..............63

3-3. Skeletal staining of 1-week-old pRb conditional knockout and wild type mice...............64

3-4. Histological examination of tibial growth plates of wild type and conditional
m u ta n ts .................................. ........................................ ............... 6 5

3-5. Von Kossa staining of growth plate of wild type and conditional mutants...................66

3-6. Immunolocalization of proliferation markers Ki67 and PCNA in wild-type and pRb
con edition al m u tants ...................................... ............................................ 6 7









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ROLE OF ACTIVATING TRANSCRIPTION FACTOR-2 IN CONTROL OF POCKET
PROTEIN EXPRESSION AND REGULATION OF CHONDROCYTE GROWTH


By

Dustin Shawn Vale-Cruz

May 2008

Chair: Phyllis LuValle
Major: Medical Sciences-Molecular Cell Biology

Endochondral ossification is the process of skeletal bone growth through the formation of

a cartilage template that subsequently undergoes mineralization to form trabecular bone. Genetic

mutations affecting the proliferation or differentiation of chondrocytes results in skeletal

abnormalities. Activating transcription factor-2 (ATF-2) modulates expression of cell cycle

regulatory genes in chondrocytes, and mutation of ATF-2 results in a dwarfed phenotype.

The overall aim of these studies was to further examine the role ATF-2 plays in cell cycle

progression. Previous data had identified sites of ATF-2 binding located in promoters of the

pocket protein family of cell cycle regulators. Initial studies indicated changes in pocket protein

expression in response to loss of ATF-2 function. Mutation of ATF-2 lead to reduced expression

of retinoblastoma (pRb), a member of the pocket protein family. pRb regulates cell cycle

progression and influences cellular proliferation and terminal differentiation. Using an in vitro

chondrogenesis model, we observed that pRb influenced cell cycle exit and differentiation.

Transgenic mice expressing a conditional truncation of pRb in chondrocytes were

produced to further delineate the role of pRb in endochondral development. Although no gross

skeletal abnormalities were observed conditional mutants displayed reduced size at birth. The









observed size difference was overcome with age. Histological examination of the growth plate

demonstrated changes in growth plate architecture of neonates in response to pRb mutation.

Growth plates of older animals were re-organized indicating the observed alterations in growth

plate structure were transient. Immunohistchemical localization of proliferative markers

indicated that pRb conditional deletion allowed prolonged chondrocyte proliferation in newborn

mice. These studies suggest that pRb may influence chondrocyte proliferation and

differentiation, but its role is largely insignificant in overall endochodral development.









CHAPTER 1
INTRODUCTION

The vertebrate skeleton is comprised of cartilage and bone and serves three distinct

functions. First, the skeleton serves as the framework for the body, and provides support and

protection for the internal organs. Second, the skeleton is a storage center for vitamins and

minerals. Bone is a depot for calcium and phosphorous utilized by the body. Third, the skeleton

is the center for production of blood cells from the bone marrow. Both white and red blood cells

are produced within the bone marrow cavities of the skeleton, giving the skeleton an added

function in aiding immune response.

The skeleton is the product of different embryonic cell lineages. Cells from distinct

lineages form high-density mesenchymal condensations at sites specific for skeletal elements.

The condensed mesenchyme then undergoes differentiation to chondrocytes and osteoblasts

(Hall and Miyake, 1992). Two distinct processes control further skeletal growth:

intramembranous and endochondral ossification. The bones of the skull are formed through

intramembranous ossification, while the long bones comprising much of the appendicular

skeleton develop through the process of endochondral ossification.

Most of what we know regarding skeletal growth and development is the result of

observations of human bone disorders and experimental animal studies. Correlation between the

function of genes and specific embryological events has been determined through the use of

transgenic and knockout animals. Genetic studies of inherited disorders involving bone and

cartilage have identified novel genes and pathways and furthered our knowledge of the

underlying molecular mechanisms of skeletal development and growth.

Given the number of inherited genetic disorders implicated in skeletal growth, this

dissertation seeks to elucidate further the molecular mechanisms involved in activating









transcription factor-2 (ATF-2) regulation of bone growth. Moreover, these studies seek to

identify genes important in bone growth that are altered in response to loss of ATF-2 function

and further characterize their function in bone growth.

Skeletal Development

Morphogenesis of the skeleton is the result of cell migrations from sites of embryonic

origin to locations of specific skeletal elements and condensation into the mesenchymal

precursors of cartilage and bone. Different portions of the skeleton are derived from distinct

embryonic cell lineages. Genes that control morphogenesis largely encode for transcription

factors that control cellular fate decisions and migration events.

The craniofacial skeleton is derived from the cranial neural crest, and is comprised of the

bones of the skull and face. The majority of the bone of the face and skull are of neural crest

origin (Bronner-Fraser, 1994). These cells migrate from the dorsal aspect of the neural tube to

the frontonasal mass forming cartilage and bone tissue. Cranial neural crest commitment to

skeletal fate is controlled through interactions with the overlying epithelium. Epithelial cells

produce cytokine-based signals that stimulate signaling pathways and expression of various

transcription factors within the mesenchyme. As a result of the activated state of the

mesenchyme, factors are secreted that in turn control the proliferation and differentiation of the

overlying epithelium.

A multitude of genes are therefore vital for craniofacial development. These include

genes that encode for transcription factors, cytokines, growth factors, and proteolytic enzymes.

Transcription factors important for development include: homeobox-containing transcription

factors such as Msx] and Hoxal (for review see Alappat et al., 2003), polycomb group genes,

basic helix-loop-helix factors such as Twist (Howard et al., 1997), and PAX genes encoding









paired-box containing transcription factors (for review see Lang et al., 2007). Bone

morphogenic proteins (BMPs) (Ripamonti et al., 2005), the transforming growth factor-P (TGF-

P3) family (Chai et al., 2003), and fibroblast growth factors (FGFs) (Chen and Deng, 2005; Nie et

al., 2006) are important cytokines and growth factors implicated in craniofacial development.

Extracellular matrix degrading enzymes such as the matrix metalloproteases (MMPs) and their

inherent inhibitors (tissue inhibitor of metalloprotease, TIMPs) are essential in normal

craniofacial development (Letra et al., 2007; Egeblad et al., 2007). Genetic defects or mutations

in these or other related factors produce developmental disorders of the skull and face such as

craniosynostosis (premature closure of skull sutures), cleft palate, lack of teeth, and mandible

defects. Alterations in signaling, including BMPs, TGFs, FGFs sonic hedgehog (Shh) among

others, disrupt normal development and lead to anomalies. Furthermore, the communication

between the overlying epithelium and mesenchyme is critical in formation and patterning of

structures such as teeth. Clearly, the processes that govern craniofacial development are

complex and rely heavily on patterning and cell fate determination to insure normal

development.

Paraxial mesoderm tissue is the embryonic precursor to the axial skeleton, which consists

of the vertebral column and the dorsal portion of the rib cage. Somites are formed following

segmentation of the paraxial mesoderm that subsequently differentiates into sclerotomes (for

review see Monsoro-Burq, 2005). Somitic derived tissues also include the dermis of the skin and

skeletal muscle of the body wall and limbs (for review see Christ et al., 2007). Genes that

control the segmentation of the paraxial mesoderm largely influence somitic development.

Somite formation occurs bilaterally in a rostro-caudal timed sequence. Expression of hairy-1

(Palmeirim et al., 1997) modulates Notch signaling by regulating expression of lunatic fringe.









The importance of Notch signaling in somite development is evident in the numerous mouse

knockouts that affect the pathway. Knockouts ofNotch] (Conlon et al., 1995) and other

modulators of Notch signaling including Delta-likel (Dill) (Hrabe de Angelis et al., 1997), D113

(Kusumi et al., 1998), and lunatic fringe (Zhang and Gridley, 1998) display abnormal somite

phenotypes resulting in vertebral and rib defects.

Differentiation of cells within the somite is necessary for formation of sclerotomes and

further development of skeletal elements. These signals induce epithelial-mesenchymal

transformation and proliferation of somatic cells and their migration to form the sclerotomes.

The sclerotome arises from the ventral portion of the somites and gives rise to the cartilage of the

vertebral body and the dorsolateral portion of the ribs (Christ et al., 2000). Shh signaling,

originating from the notochord and floorplate of the neural tube is vital for sclerotome formation

as Shh-null embryos are devoid of vertebrae and the dorsolateral portion of the ribs (Chiang et

al., 1996). Shh signaling conditions sclerotomal cells to be competent for responding to BMP

actions and subsequent differentiation into chondrocytes (Murtaugh et al., 1999). Pax genes 1

and 9, specific to the cells of sclerotome, are induced by Shh signaling. Pax 1 mutants display

skeletal defects in the vertebral column, scapula, and sternum (Chalepakis et al., 1991; Wilm et

al., 1998).

Anterior to posterior patterning of the axial skeleton is controlled by expression of

homeotic (Hox) genes. These genes control the identification of individual vertebrae through an

overlapping expression domain along the vertebral column (Burke et al., 1995; Favier and Dolle,

1997). Disruptions in Hox gene expression patterns result in the loss or addition of vertebral

elements or alterations into shapes resembling other skeletal elements (Zakany et al., 1997; Chen

et al., 1998).









Skeletal tissues of the limb are derived from lateral plate mesoderm (Cohn and Tickle,

1996). Other tissues such as nerves, muscles, and blood vessels are derived from the developing

somites and migrate into the limb buds. Interactions between the developing mesenchyme and

overlying epithelium control the patterning and shaping of the limb (Ng et al., 1999). Limb

outgrowth is controlled by FGF signaling originating from specialized epithelium covering the

limb bud composing the apical ectodermal ridge (AER). Patterning of the limb is further

accomplished through the actions of Shh and Wnt7a signaling and expression of transcription

factors such as LIM-homeodomain protein (Lmxlb) and engrailed (for review see Robert and

Lallemand, 2006). The cartilage anlagen are formed in a proximal to distal sequence coincident

with the development of the limb bud. The more proximal bones such as the femur and humerus

are formed first, while the phalanges and metatarsals are formed last. The cartilage is formed as

continuous rods through a series of divisions and segmentations that give rise to the limb

skeleton (for review see Tuan, 2004). BMP signaling, segmentation and eventual apoptosis are

vital for the formation of the joints (for review see Rosen, 2006 and Khan et al., 2007).

Disruptions in the genetic or signaling mechanisms that control limb bud outgrowth or

patterning are manifested in various ways. Shortening of the bones of the fingers and toes

(brachydactylies) and the absence or fusion of joints have been shown to be the result of

disruptions of normal BMP signaling. Disruptions in Shh signaling are manifested as the

occurrence of extra digits (polydactyly) or the fusion of digits (syndactyly), among others.

Skeletal Bone Growth

The bones of the skeleton are mineralized in various modes depending on the type of

bone being formed. Intramembranous ossification is manifested via mesenchymal cell

differentiation into osteoblasts and bone, formed in the absence of a cartilage precursor. The flat









bones of the skull, face and scapula are mineralized through the process of intramembranous

ossification. Perichondral ossification is the most common form of ossification which utilizes a

cartilage precursor. Perichondral ossification starts with the transformation of the perichondrium

into the periosteum (Scott-Savage and Hall, 1980).

Endochondral ossification is the primary mode of mineralization within the long bones of

the skeleton. The process of endochondral ossification involves a cartilaginous template that is

replaced by bone matrix. The overall process of endochondral ossification involves the tightly

regulated coordination of chondrocyte proliferation, differentiation into hypertrophic

chondrocytes, apoptosis and ultimately calcification of the remaining cartilage matrix.

Mesenchymal progenitor cells follow the chondrocyte lineage following condensation.

Chondrocytes within the resting zone of the growth plate are arrested in the cell cycle forming a

suppository of cells necessary for proliferation. Resting zone chondrocytes are stimulated to

initiate proliferation through multiple signaling cascades. Chondrocytes are stimulated to

proliferate and become organized in a columnar fashion. These chondrocytes also begin the

production of type II collagen. Later, chondrocytes cease proliferating and begin differentiation

to pre-hypertrophic chondrocytes, which undergo further increases in cellular volume to become

hypertrophic chondrocytes which initiate the production of type X collagen. The post-mitotic,

terminally differentiated hypertrophic chondrocytes then undergo apoptosis, leaving behind the

calcified cartilage matrix. Osteoblasts are then recruited to begin deposition of bony matrix over

the mineralized cartilage residue.

Several factors are critical in allowing normal longitudinal bone growth. Both the

proliferation of chondrocytes and expanse of cellular volume are essential factors in skeletal

growth. The proliferation of chondrocytes is a critical step in providing an adequate number of









cells for growth. The increase in cellular volume established during hypertrophy also contributes

to the longitudinal lengthening of the bone. Genetic disruption of normal chondrocyte

proliferation results in appendicular skeletal abnormalities (for review see Shum et al., 2003).

Mutations affecting chondrocyte differentiation and subsequent hypertrophy results in skeletal

malformations.

Role of ATF-2 in Skeletal Bone Growth

Activating transcription factor (ATF)-2 is a basic helix-loop-helix DNA binding protein

that belongs to the ATF/CREB family of transcription factors. Members of the ATF/CREB

family regulate transcription of target genes through interactions with cyclic AMP-response

elements (CREs) located within target gene promoters. Members of the ATF/CREB family can

form homo- or hetero-dimers that modulate transcription of regulated genes.

The importance of ATF-2 in skeletal growth was demonstrated by the production of

transgenic mouse mutants. Two independent groups produced ATF-2 mutations that had severe

phenotypes. Maekawa et al. (1999) produced ATF-2 null mice through gene targeting. These

mice displayed perinatal lethality due to severe respiratory distress similar to meconium

aspiration syndrome. Reimold et al. (1996) first described the phenotype of ATF-2 mutant

animals harboring a gene disruption created by the introduction of an antibiotic resistance

cassette resulting in the truncation of ATF-2 protein expression. In this case, ATF-2 mutants

displayed ataxia, hyperactivity and diminished hearing. ATF-2 mutant mice also displayed a

disruption in endochondral ossification at the epiphyseal growth plate similar to human

hypochondrodysplasia and achondrodysplasia.

Within the developing bone, ATF-2 mRNA is expressed within the resting and

proliferating zones suggesting a potential role in regulating chondrocyte proliferation. Indeed,









chondrocyte proliferation was decreased in ATF-2 mutant animals assayed by incorporation of

[3H]-thymidine (Reimold et al., 1996).

Chondrocyte proliferation is stimulated by parathyroid hormone related peptide (PTHrP)

and TGF-j3 signaling (Beier et al., 2001). PTHrP signaling is mediated through binding of the

PTHrP ligand to its putative receptor. During endochondral development PTHrP is expressed in

the perichondrium, while the PTHrP receptor is expressed at low levels by proliferating

chondrocytes and at higher levels in pre-hypertrophic chondrocytes (Lanske et al., 1996;

Vortkamp et al., 1996). Genetic ablation of PTHrP results in animals that exhibit perinatal

lethality and severe abnormalities in bones that form during endochondral ossification including

shortening of the snout, mandible, and limbs (Karaplis et al., 1994). Shortening of the bones

results from premature transition of proliferative chondrocytes to hypertrophic chondrocytes.

Interestingly, when PTHrP is overexpressed in chondrocytes animals are born with shoirtened

limbs due to decreased mineralization and delayed maturation of chondrocytes (Weir et al.,

1996). These data illustrate the importance of PTHrP signaling in the endochondral process, and

further underscore the necessity for the organization and control of chondrocyte proliferation,

differentiation and apoptotic cell death in bone elongation.

PTHrP is a mediator of Ihh activity within the growth plate. Ihh is expressed in the

maturation region between proliferative and hypertrophic regions of the growth plate. Ihh

inhibits chondrocyte differentiation by inducing expression of PTHrP (Lanske et al., 1996;

Vortkamp et al., 1996). Deletion of Ihh results in the loss of PTHrP mRNA expression and a

predominance of hypertrophic chondrocytes coupled with a decrease in chondrocyte proliferation

(St-Jacques et al., 1999). A negative feedback loop is then established where Ihh maintains

chondrocyte proliferation through the induction of PTHrP expression which in turn delays Ihh









production. Again, the delicate balance between chondrocyte proliferation and differentiation is

evident in the intricacies of the PTHrP/Ihh negative feedback loop.

TGF-P3 and PTHrP regulate the proliferation of growth plate chondrocytes by modulating

cyclin-DI expression (Beier et al., 2001). Cyclin Dl regulates cellular proliferation by

regulating cell cycle progression through its interaction with cyclin-dependent kinases (CDKs).

The cyclin-CDK complex is then activated and phosphorylates cell cycle regulatory proteins

such as retinoblastoma (pRb). The role of cyclin Dl in chondrocyte proliferation is evident in

the skeletal phenotype exhibited in cyclin Dl mutant mice (Fantl et al., 1995; Sicinski et al.,

1995). ATF-2 has been shown to regulate cyclin Dl promoter activity and expression (Beier et

al., 1999). Cyclin Dl expression is necessary to drive cell cycle progression through the

modification of cell cycle inhibitors. Proliferation of chondrocytes is altered in response to ATF-

2 loss due to lack of cyclin Dl expression and subsequent inability of cyclin D1-CDK complexes

to phosphorylate and inactivate cell cycle regulator proteins. Inactivation of cell cycle inhibitors

is paramount in cell cycle progression and ultimately cell proliferation. This may account for the

reduction in chondrocyte proliferation observed in ATF-2 mutant animals (Reimold et al., 1996).

Chondrocyte proliferation is also stimulated by TGF-P3 treatment (Beier et al., 2001; Ferguson et

al., 2000; Pateder et al., 2000; Ionescu et al., 2003; Dong et al., 2005) by induction of cyclin Dl

expression through P3-catenin signaling (Li et al., 2006). ATF-2 has the ability to regulate cell

cycle progression by modulating expression of target genes important for cell cycle progression.

Loss of ATF-2 would influence cell cycle progression through the reduction of cell cycle

inhibitor expression (Luvalle et al., 2003) or by limiting the expression of genes necessary for

inactivation of cell cycle inhibitors, resulting in reduced proliferation due to sequestration of

transcription factors necessary for cell cycle progression (Beier et al., 1999). The skeletal









phenotype observed in ATF-2 mutant animals is likely indicative of the importance of ATF-2

signaling. However, the number of potentially regulated genes involved in skeletal growth

suggests that the observed phenotype is likely the result of numerous disruptions in normal

skeletal development.

Pocket Proteins and Cell Cycle Control

The retinoblastoma family of proteins consists of pRb as well as the closely related p107

and p130 proteins. These proteins function as cell cycle regulators through the binding of E2F

transcription factors and modulating transcription of S-phase related genes. The proteins share

significant similarities within the protein domains that comprise the "pocket region" consisting

of two A and B boxes. pRb shares little similarity with p107/pl30 outside of the pocket domain,

while p107 and p130 share a highly conserved spacer region residing between the two A and B

boxes. The pocket region is critical for binding and regulation of E2F transcription factors (for

review see Nevins et al., 1997).

Studies have demonstrated the cell cycle regulatory function of the pocket proteins by

inducing G1 phase growth arrest following over-expression of all three proteins (Dyson, 1998).

It has been shown that pRb regulates the G1 to S phase transition of the cell cycle by blocking S-

phase entry, promoting terminal differentiation (Weinberg et al., 1995). The interactions

between E2F and the pocket proteins play a central role in cell cycle progression and DNA

replication by regulating expression of E2F responsive genes (Macaluso et al., 2005). p107 and

p130 also regulate cell cycle progression through interactions with cyclin A/cdk2 and cyclin E

cdk2 complexes (Mulligan and Jacks, 1998). Viral oncoproteins allow unregulated cell cycle

progression by displacing cellular proteins such as E2Fs (for review see Lee and Cho, 2002).

E2Fs regulate the timing and expression of many genes important for cell cycle regulation and









progression such as cyclins A, E and Dl, and cdk2 (for review see Nevins, 1998). The pocket

proteins show preferential binding for specific E2Fs with pRb able to bind to E2F1-5, while

pl07/pl30 interact with E2F 4 and 5 (for review see Dimova nd Dyson, 2005). The pocket

protein-E2F paradigm lies at the heart of cell cycle regulation and progression, along with further

complications in cell cycle exit and cellular differentiation.

Studies have implicated the pocket proteins in development of the limb and endochondral

growth. Cobrinik et al (1996) first demonstrated that p107 and p130 had overlapping roles in

limb development. Moreover, p107 and p130 were shown to regulate chondrocyte proliferation.

Embryos that were nullizygous for both p107 and p130 (pl07T-; pl30--) displayed a higher

proliferative index as demonstrated through bromo-deoxyurindine (BrdU) incorporation.

Although p107--; pl30-- embryos displayed elevated chondrocyte proliferation, they exhibited

shortened limbs. Chondrocytes lacking p107/pl30 cell cycle control do eventually cease

proliferation, likely due to other growth regulators such as pRb and cyclin-dependent kinase

inhibitors (CKIs) such as p16, p21, and p27, which function to inhibit cell cycle progression by

blocking the activity of CDKs.

Subsequent studies further elucidated the functions of these proteins by illustrating

distinct and overlapping roles of pl07 and p130 in cartilage development. During the

condensation of mesenchyme, p107 is required for cell cycle withdrawal, while p130 is not

expressed at this time (Rossi et al., 2002). Growth plate chondrocytes devoid of p107 expression

cause severe defects. During mesenchymal condensation, p130 can compensate for p107 loss by

aiding in cell cycle withdrawal and hypertrophic differentiation (Rossi et al., 2002).

Simultaneous deletion of pl07, and p130 blocked hypertrophic differentiation and expression of

the transcription factor Runx2 the function of which is important in chondrocyte differentiation









(Rossi et al., 2002). pRb has yet to be implicated in cell cycle withdrawal during chondrocyte

differentiation. Antiproliferative effects of FGFs in chondrocytes are mediated through the rapid

dephosphorylation of p107, with a more delayed dephosphorylation of pRb and p130 (Laplantine

et al., 2002; Dailey et al., 2003). It has also been shown that p107 is absolutely necessary for

FGF-induced growth arrest, whereas p130 contributes to cell cycle arrest, while involvement of

pRb in FGF-growth arrest has not been identified (Laplantine et al., 2002; Dailey et al., 2003).

These results indicate the importance of p107/p130 in cell cycle control, but also raise the

question of what role, if any, pRb may play in cartilage development.

Each of the pocket proteins contains putative CREs within their promoter regions. These

promoter elements are binding sites for a multitude of transcription factors, including ATF-2.

ATF-2 has been shown previously to regulate pRb promoter activity (Zacksenhaus et al., 1993).

More recently, studies have shown that mutation of ATF-2 in mice leads to decreased expression

of pRb (Luvalle et al., 2003).

In conclusion, development of the vertebrate skeleton is a complex, yet highly ordered,

controlled process. The exquisite control is demonstrated by the phenotypic manifestations

observed following genetic disruption of genes involved in the process of endochondral

ossification. Ablation of ATF-2 is one example of the type of genetic disruption that alters the

delicate balance within the growth plate. Loss of ATF-2 signaling influences numerous cellular

processes vital for chondrocyte proliferation and differentiation. The purpose of the studies

within this dissertation is to further the understanding of the regulatory role that ATF-2 plays in

endochondral ossification. The studies contained herein also examine a plausible role of pRb

plays in endochodral development.









CHAPTER 2
ACTIVATING TRANSCRIPTION FACTOR-2 AFFECTS SKELETAL GROWTH BY
MODULATING PRB GENE EXPRESSION


Introduction

Growth of skeletal long bones occurs through the process of endochondral ossification.

Endochondral bone formation is initiated with the condensation and chondrogenic

differentiation of mesenchymal cells. Condensed mesenchymal cells are induced to undergo

chondrogenesis by several regulatory pathways including those of transforming growth factor-P

(TGF-P), parathyroid hormone relater peptide (PTHrP), hedgehog family proteins, as well as

various other transcription factors. The Sox family of transcription factors regulate the formation

of chondrogenic condensations and cartilage by controlling the expression of type II collagen

and aggrecan, two cartilage specific markers (Bell et al., 1997; Lefebvre et al., 1998; Sekiya et

al., 2000).

Endochondral bone growth is dependent upon the coordinated regulation of proliferation

and differentiation of chondrocytes to form the cartilage template. Chondrocytes are found in a

quiescent state in the resting zone of the growth plate where they are stimulated to proliferate.

The proliferation of chondrocytes is maintained in part by both Indian Hedgehog (Ihh) action and

the PTHrP gradient. After several cycles of proliferation, chondrocytes exit the cell cycle

coincident with the reduction of the PTHrP gradient and begin to increase in cellular volume

(hypertrophy), forming the pre-hypertrophic, or maturation, region. The expansion of

hypertrophic chondrocytes contributes significantly to the length of the developing bone.

Hypertrophic chondrocytes are terminally differentiated and commence expression of type X

collagen. Within the late hypertrophic region, the cartilage matrix undergoes both mineralization









and vascularization. The mineralized cartilage matrix is replaced with bone matrix. The most

mature hypertrophic chondrocytes undergo apoptosis, leaving behind a trabecular bone matrix.

Activating transcription factor-2 (ATF-2) is a member of the ATF/CREB (cAMP

Response Element Binding protein) family of transcription factors, characterized by a basic

region and a leucine zipper DNA-binding domain. This family of transcription factors binds

cAMP-response elements (CREs) within target gene promoter regions in either homo- or

heterodimers. ATF-2 has been shown to regulate promoter activity of genes that are important

for cartilage and bone growth. Data from our laboratory has shown that ATF-2 is essential for

modulating the activity of the cell cycle related genes cyclin Dl (Beier et al., 1999) and cyclin A

(Beier et al., 2000) within growth plate chondrocytes. Gene expression of both cyclin A and

cyclin Dl are targets of ATF-2 trans-activation, while loss of ATF-2 action in mutant ATF-2

chondrocytes leads to a decrease in gene expression. Addition of an exogenous ATF-2

expression plasmid restores promoter activity, further supporting the role of ATF-2 in regulating

the expression of cyclins A and Dl in chondrocytes. The promoter regions of several other

genes contain CRE motifs, but have yet to be examined for ATF-2 regulation. Additional genes,

such as osteopontin, osteocalcin, alkaline phosphatase, and the Rb family that contain CREs may

also be controlled by ATF-2. Within the growth plate, ATF-2 is expressed in the resting and

proliferating zones, yet is excluded from the hypertrophic region. The importance of ATF-2 in

skeletal development was demonstrated with the production of ATF-2 deficient mice (Reimold et

al., 1996). ATF-2 deficient mice (ATF-2 m/m) express low amounts of a splice variant of ATF-

2 that rescues -50% of transgenic animals from neonatal lethality. ATF-2 deficient mice are

smaller than wild-type littermates at birth, and those that survive past weaning develop a

hypochondroplasia-like dwarfism characterized by abnormal epiphysis and curvature of the









spine. Chondrocyte proliferation is also reduced as determined by in vivo [3H]-thymidine

incorporation (Reimhold, 1996). True ATF-2 null mice die at birth due to respiratory difficulties

(Maekawa et al., 1999).

The retinoblastoma protein family, or pocket proteins, is comprised of retinoblastoma

(pRb) and pRb-related proteins, p107 and p130. These proteins regulate the G1 to S phase

transition by sequestering the E2F family (E2F1 to E2F5) of transcription factors necessary for

cell cycle progression (for review see Cobrinik, 2005). pRb is found within resting (GO) cells in

a hypo-phosphorylated state that allows for binding and sequestration of E2Fs. E2F proteins are

released from pRb sequestration following phosphorylation by cyclin D-cyclin dependent kinase

(cdk) 4 and 6 complexes in early G1 and cyclin E/cdk 2 complexes later in G1. After E2Fs are

released, the cell enters S-phase and is committed to progress through the cell cycle. The

dynamic relationship between the pocket proteins and E2Fs is essential in regulating cell

proliferation and, in turn, differentiation. The pocket proteins differ with respect to their cellular

expression patterns and in their interactions with E2Fs. pRb shows selective interactions with

E2F1-3 while p107 and p130 bind more readily to E2F 4-5 (for review see Cobrinik 2005).

Disruption of E2F-pocket protein dynamics inhibits normal skeletal bone growth by

disrupting the endochondral ossification process. Chondrocytic differentiation of ATDC5 cells,

a chondro-progenitor cell line (Atsumi et al., 1990), is inhibited by ectopic expression of E2F1 as

evidenced by inhibition of expression of the cartilage markers type II collagen, type X collagen

and aggrecan (Scheijen et al., 2003). Fibroblast growth factor (FGF) signaling inhibits

longitudinal bone growth by specifically targeting p107 and p130 to induce chondrocyte cell

cycle arrest. p107 and p130 have also been implicated in limb development (Cobrinik et al.,

1996) and in the regulation of chondrocyte proliferation and differentiation (Rossi et al., 2002).









Our lab has shown that protein levels of pRb are reduced in ATF-2 m/m chondrocytes (Luvalle

et al., 2003) suggesting that pRb expression is dependent on ATF-2 function. Basal pRb

promoter activity is regulated through ATF-2 binding of the CRE motif (Zacksenhaus, et al.,

1993). The promoter regions of p107 and p130 also contain CREs that may be targets of ATF-2

regulation. The phenotype of ATF-2 m/m mice may be the result of cumulative effects of

various target genes including the pRb family.

Here we further investigate the abnormal development of ATF-2 deficient mice by

examining the relationship between ATF-2 and pRb. We show that the normal spatial and

temporal expression of each pocket protein within the growth plates of wild type animals and

their altered expression in ATF-2 mutants. Expression of pRb mRNA is reduced in ATF-2 m/m

chondrocytes compared to wild type due to the reduction of pRb promoter activity. We also

show that that pRb expression is upregulated in ATDC5 undergoing chondrogenic

differentiation. ATF-2 deficient mice also exhibit reductions in collagen type X expression as

compared to wild type counterparts. We also show that ATF- 2 mutant mice display increases

cellular proliferation as compared to their wild type littermates, both in vivo and in vitro. Taken

together these data show that the loss of ATF-2 activity results in the decreased expression of

pRb, and this decrease contributes to chondrocyte cell cycle deregulation and differentiation

affecting hypertrophy, consequently resulting in appendicular dwarfism.

Materials and Methods

Mice and genotyping

Mice harboring either wild type or inactivated alleles of the ATF-2 gene were genotyped

as previously described (Reimold et al., 1996). Genomic DNA was isolated from the distal









portion of the tail by standard phenol-chloroform extraction and genotype was determined by

polymerase chain reaction (PCR).

Cell Culture

ATDC5 chondrogenic cells were propagated in a 50:50 mixture of DMEM/F12 media

supplemented with 5% fetal bovine serum, 100 [tg/ml penicillin and 100 [tg/ml streptomycin.

For differentiation experiments, ATDC5cells at confluence were given complete media further

supplemented with insulin-transferrin-selenium (ITS) reagent. Media was replaced every other

day for the indicated time periods. Primary mouse chondrocytes were isolated from the ventral

ribcage as previously described (Lefevbre et al., 1994). Briefly, ventral ribcages were excised

from neonate pups less than 2 days old. Tissues were digested in pronase, followed by digestion

with collagenase D (3 mg/ml) in complete DMEM (DMEM + 10% FBS, 100 [tg penicillin, 100

[tg streptomycin). Cells were then grown in suspension over 1.5% agarose in phosphate buffered

saline (PBS) coated plates for 3 days to ensure chondrogenic phenotype. Cell aggregates were

digested in collagenase and plated in monolayer culture on sterile plastic dishes at 370C in a 5%

CO2 atmosphere in complete DMEM.

Immunhistochemistry

Knee joints from newborn, 1-week-old, and 3-week-old mice were dissected and fixed in

4% paraformaldehyde in PBS (w/v) for 24 hours at 40C. Tissues were processed though xylenes,

dehydrated through graded alcohols and embedded in paraffin wax. Tissue sections were cut at 5

[m and attached to SuperFrost Plus (Fisher) microscope slides. For immunohistochemisty,

slides were deparaffinized in Citrasolve (Fisher), and rehydrated through graded alcohols to

distilled water. Microwave antigen retrieval was performed using Antigen Unmasking Solution

according to manufacturer's recommendations (Vector). The Vector Elite ABC Staining kit was









used for immunohistochemical localization. Antibodies and working concentrations were as

follows: rabbit anti-pRb (Delta bioLabs, 0.2 [tg/ml); rabbit anti-pl07 (Delta Biolabs, 0.2 [tg/ml)

rabbit anti-pl30 (ABCam, 0.2 [tg/ml); rabbit anti-Ki67 (ABCam, 0.1[tg/ml). As a negative

control, normal rabbit IgG at the same concentration was used in place of primary antibody.

Immunoflourescence for type X collagen was performed using a rabbit polyclonal antibody (gift

from Danny Chan, Department of Biochemistry, The University of Hong Kong, Pokfulam, Hong

Kong, China). Antigen unmasking was accomplished though incubation with 0.8% hylaranidase

in PBS for 30 minutes prior to incubation with the primary antibody (1:2000). Alexa 488

(Molecular Probes, Invitrogen) goat anti-rabbit was used as a secondary antibody (1:1000).

Omission of primary antibody served as a negative control. Immunofluorescence was visualized

on a fluorescent microscope (DM IRBE; Leica) equipped with a digital camera. Intensity of

immunofluorescence was measured using digital imaging software (IP Lab). Average intensities

were determined from separate measurements of each growth plate of at least three individual

animals. Bar graphs represent the mean of measured fluorescence intensity of at least 3 different

animals at the indicated time points. Error bars represent the standard deviation of the mean.

RNA isolation and RT-PCR

RNA was extracted from confluent cells using the TriZol reagent according to

manufacturer's suggestions. Reverse transcription of 2 [tg of total cellular RNA was performed.

Total cDNA was diluted 1:10 in sterile water, and 1 tl was used in subsequent PCR reactions.

Quantitative real-time PCR for type X collagen mRNA expression was performed using the

DyNAmo HS SYBR Green PCR kit (New England Biolabs) according to manufacturer's

instructions. Real-time PCR analysis for pRb mRNA was performed using TaqMan Gene

Expression Array combined with the TaqMan Universal PCR Master Mix (Applied Biosystems).









PCR results were normalized to GAPDH PCR values. Primers used for SYBR green RT-PCR

are as follows (target; forward, reverse): type X collagen; 5'-

TGCCCGTGTCTGCTTTTACTGTCA-3', 5'-TCAAATGGGATGGGGGCACCTACT-3';

GAPDH, 5'-CGGACTCAACGGATTTGGTCGTAT-3', 5'-

AGCCTTCTCCATGGTGGTGAAGAC-3'; (3-actin, 5'-CGTGGGCCGCCCTAGGCACCA-3',

5'-TTGGCCTTAGGGTTCAGGGGGG-3'. Comparisons made between groups of SYBR green

reactions were performed using the Pfaffl method (Pfaffl, 2001), and the AACt method for

TaqMan Assay PCRs. The Pfaffl method takes into account different efficiencies of

amplification between various primer sets in order to make accurate comparisons.

Transfections and Luciferase Assays

Primary chondrocytes were plated in a 24-well plastic culture plate at a cell density of

1.25x105 in DMEM media with 10% FBS without antibiotics for 24 hours prior to transfection.

Each well contained 0.2[tg of reporter plasmid DNA and 0.02[tg of pRLSV40 plasmid used for

transfection normalization. Lipofectamine 2000 was used for transfections according to

manufacturer's recommendations with few exceptions; briefly, plasmid DNA and 1 tl of

transfection reagent were diluted separately in Opti-MEM serum free media. Diluted DNA and

transfection reagent were combined to form complexes for 20 minutes prior to adding to cells.

Cells were collected for luciferase activity 24 hours after transfection. Luciferase assays were

performed as previously described (Ma et al., 2007). ATDC5 cells were transfected 24 hours

prior to collection as were those for primary cultures and collected at indicated time points for

luciferase activity.









Cell Cycle Analysis

ATDC5 cells were collected at the indicated times following differentiation by adding

hypotonic cell lysis buffer (0.5 g Sodium Citrate, 0.1% (v/v) Triton-X100) followed by removal

of cells from the culture plate with a cell scraper. Propidium iodide solution was added to a final

concentration of 30 [tg/ml with RNase A in order to stain DNA content. The cell suspension was

then processed for flow cytometry in a FACS Calibur (BD BioSciences) flow cytometer. Cell

cycle profiles were obtained using Cell Quest software. Analyses of cell cycle populations were

performed using the ModFit Software package.

BrdU Incorportation

Primary chondrocytes from wild-type and ATF-2 m/m newborn mice were isolated,

differentiated over agarose and plated on plastic cell culture dishes at a cell density of 1.25x106

cells/ml. The next day, cells were pulse labeled with bromo-deoxyuridine (BrdU) to a final

concentration of 10 [tM in complete cell culture media for 4 hours. The media was removed,

cells were washed with PBS, and supplemented with fresh media for 6 hours before collection

for cell cycle analysis. BrdU incorporation was detected by incubation with a FITC labeled

BrdU antibody (BD Biosciences) according to the manufacturer's recommendations.

Results

Several studies have documented the functions of the pRb protein family in regulating

chondrocyte cell cycle arrest and differentiation (Laplantine et al., 2002). The effects of FGF

signaling on chondrocyte cell cycle arrest are modulated through p107 and p130. Our

laboratory, as noted earlier, has shown that loss of ATF-2 signaling leads to a reduction in pRb

protein levels. Since ATF-2 expression is restricted to the resting and proliferative zones of the

growth plate, we first sought to identify the spatial and temporal expression of the pRb family









members within the growth plate in wild type and ATF-2 m/m animals at 0, 1 and 3 weeks of

age. Expression of pRb was localized to the resting and proliferative region in newborn wild type

proximal tibial sections (Figure 2-la). In contrast, pRb expression was observed in the

maturation and early hypertrophic regions in ATF-2 m/m proximal tibia (Figure 2-1b).

Expression of p107 was not detected in wild type animals (Figure 2-1c), however p107 staining

was observed in tibial growth plate sections from newborn ATF-2 m/m animals (Figure 2-1d).

Staining was localized to the late proliferative region. Expression of pl30 was observed

throughout the growth plate in both wild type and ATF-2 m/m tissues (Figure 2-le,f). ATF-2

m/m sections displayed more intense p130 staining as opposed to wild type tissue sections.

By 1-weekof age, pocket protein expression was increased and more uniform (Figure 2-

2). pRb expression was localized to the late proliferative zone and pervaded throughout most of

the hypertrophic region in wild type proximal tibia sections (Figure 2-2a). Expression of pRb

was more restricted to the late proliferative and early hypertrophic regions of ATF-2 m/m growth

plates (Figure 2-2b). There was some observed pRb immunostaining in the resting zones of both

wild type and ATF-2 m/m sections (Figure 2-2a,b). p107 expression was localized to the late

proliferative and early hypertrophic zones in sections of wild type growth plate tissues (Figure 2-

2c). p107 expression was observed in the late proliferative region, with sparse staining in the

hypertrophic zone in ATF-2 m/m sections (Figure 2-2d). Staining for p130 expression was

observed throughout the proliferative and hypertrophic zones in both wild type and ATF-2 m/m

sections (Figure 2-2 e,f). At 3 weeks, pRb expression was detectable in wild type growth plates

while expression in ATF-2 m/m tissues was diminished (Figure 2-3a,b). Expression of pl07 was

reduced in wild type and ATF-2 m/m tissues at 3 weeks of age (Figure 2-3c,d). p130 expression









was observed predominantly in the proliferative region (Figure 2-3e,f) with some staining

observed in resting zones (Figure 2-3e,f).

We performed immunoblot experiments with protein from cultured primary chondrocytes

to correlate the observed differences seen in immunohistochemical localization of the pRb

protein family. Reduction of pRb protein expression has been demonstrated previously in ATF-2

m/m chondrocytes (pRb blot reprinted with permission LuValle et al., 2003). Expression of

p107 was up-regulated in response to ATF-2 deficiency. Expression ofpl30 was unchnaged in

ATF-2 m/m animals. Actin was used as a loading control (Figure 2-4).

ATF-2 recognizes CRE elements located in target gene promoters and subsequently alters

gene expression. Given our results from immunohistochemistry and western blot experiments,

we sought to determine the changes, if any, in mRNA expression in response to loss of ATF-2.

Primary chondrocytes were isolated and cultured in vitro as described previously (Lefevbre et

al., 1994). Real-time PCR TaqMan Expression Assays were used to determine quantitative

differences in pRb mRNA expression between wild type and ATF-2 m/m primary cells. Total

RNA was isolated using the TriZol reagent, and cDNA was reverse-transcribed in combination

with an oligo-d(T) primer. ATF-2 m/m chondrocytes demonstrated a 40% reduction in pRb

expression compared to cells isolated from wild type littermates (Figure 2-5A). Luciferase assays

were used to examine the regulatory nature of ATF-2 in the pRb promoter region in order to

correlate observed differences with the known function of ATF-2 as a transcription factor.

Primary chondrocytes from wild type, heterozygous and ATF-2 m/m animals were co-

transfected with plasmid DNA corresponding to a 1.3 kb fragment of the mouse pRb promoter

cloned into the pGV-B luciferase reporter plasmid (Delehouzee et al., 2005). A Renilla

expression plasmid (pRLSV40) was used to normalize data for transfection efficiency. Wild









type chondrocytes had the highest promoter activity, while ATF-2 m/m chondrocytes displayed

an approximate 30% reduction in pRb promoter activity (Figure 2-5B).

To examine the role of pRb in chondrocyte development, we utilized the ATDC5

chondrogenic cell line to monitor pRb expression in response to differentiation. ATDC5 cells

were grown to near confluence in DMEM/F 12 (50:50) media with serum and antibiotics. Insulin-

Transferrin-Selenium (ITS, Sigma) reagent was added after reaching confluence. Insulin at this

concentration has been shown to induce differentiation of the cells to a more chondrocytic

phenotype (Shukunami et al., 1996). Cells were then collected at various time points for mRNA

expression. pRb mRNA expression was quantified using the TaqMan Expression Array as

described (Pfaffl, 2001) After the cells were differentiated for 8 days there was a 4-fold increase

in pRb mRNA expression compared to cells at day 0. A further increase was seen in cells at day

11, and sustained levels were seen at day 14 (Figure 2-6A, closed bars). Expression of type X

collagen was low from day 0 through day 4. After day 4, type X expression levels increased

until day 14 when there was an observed 6-fold increase in mRNA expression from cells

collected at day 0 (Figure 2-6A, open bars). pRb promoter activity in ATDC5 cells

differentiated with ITS was coincident with observed expression changes over time (Figure 2-

6B). After 8 days post ITS treatment promoter activity increased 10-fold above the activity

observed at the time of ITS treatment initiation (Figure 2-6B, compare DO to D8). After day 8,

promoter activity increased further and remained elevated through day 14. These data suggest

that pRb expression was up-regulated in response to exogenous treatment of cells with insulin

which induces chondrogenic differentiation of ATDC5 cells.

Cell cycle exit is a critical determinant in cellular differentiation. The role of pRb in

regulating cell cycle progression has been well established. pRb family members p107 and p130









mediate FGF induced cell cycle arrest in chondrocytes in response to FGF signaling (Laplantine

et al., 2002). Since the expression of pRb is up regulated in ATDC5 cells undergoing

differentiation, we sought to correlate pRb and type X collagen expression with cell cycle exit.

ATDC5 cells were collected in hypotonic lysis buffer and stained with propidium iodide for flow

cytometric analysis. Supplementing ATDC5 cell culture with insulin resulted in chondrogenic

cell differentiation (Shukunami et al., 1996). ATDC5 cells displayed a normal asynchronous cell

cycle profile at the time of ITS supplementation (Day 0, Figure 2-7). After 24 hours (Day 1) of

ITS treatment, the number of cells in S-phase increased. Cell cycle profiles of cell cultures

collected at subsequent time points showed a steady decrease in the number of cells in S- and

G2/M-phases. The decrease in cellular growth was coincident with the increase in the number of

cells in G1/GO, indicative of cell cycle exit.

Type X collagen is a marker of terminal differentiation in chondrocytes (Kielty et al.,

1985; Reichenberger et al., 1991). Type X collagen expression is restricted to the hypertrophic

region within the growth plate. Immunofluorescence was used to examine the role that ATF-2

loss plays in chondrocyte differentiation. Tissues from 0-, 1- and 3-week-old wild type and

ATF-2 m/m animals were fixed, processed, embedded in paraffin, and further processed for

immunofluorescence. Type X collagen expression was evident in the hypertrophic region in all

tissues examined. Tibial growth plate sections from wild type and ATF-2 mutant animals

displayed equal staining for type X collagen at 0 weeks of age (Figure 2-8A panels a,b). Type X

collagen staining was much more evident in wild type versus ATF-2 m/ m animals at 1-weekof

age (Figure 2-8A panels c,d). Type X collagen staining in tibial growth plate section from 3-

week-old animals was more intense in wild type as compared to ATF-2 m/m animals (Figure 2-

8A panels d,e). The observed differences in type X collagen staining fluorescence intensity were









measured in each growth plate in order to provide a quantitative comparison between groups.

The fluorescence intensity corresponding to type X collagen was significantly different between

wild type and mutant animals at 1 and 3 weeks of age (Figure 2-8B, P<0.005). Growth plate

sections from wild type animals demonstrated higher type X collagen expression than ATF-2

mutants at 1-weekand 3 weeks of age. These data indicate that ATF-2 mutation does affect the

expression of type X collagen reflecting a plausible role in the differentiation of chondrocytes.

ATF-2 affects chondrocyte differentiation indirectly through regulation of the expression of one

or multiple target genes.

The regulatory function of pRb in controlling the cell cycle occurs at the G1 to S phase

transition. The reduction of pRb expression observed in ATF-2 m/m animals could result in the

loss of cell cycle control. We examined the proliferation of chondrocytes within the growth plate

by immunostaining for Ki67, a well-known marker for proliferative cells. There was a clear

increase in the number of Ki67 positive cells in ATF-2 m/m animals compared to wild-type at

the 0 week time point (Figure 2-9a,b). Chondrocytes within the late proliferative and

hypertrophic regions were negative for Ki67 indicative of cell cycle exit. Ki67 staining was

more prevalent in wild type chondrocytes at 1-weekof age than in ATF-2 m/m littermates (Figure

2-9c,d). Finally, at 3 weeks of age, Ki67 staining was still observed in ATF-2 m/m tissues, while

not detected in wild type tissues (Figure 2-9e,f).

We also tested the cell cycle behavior of primary chondrocytes by BrdU labeling.

Primary chondrocytes were labeled with BrdU for 4 hours in order to determine the population

of cell actively undergoing DNA synthesis. We determined a difference in G1 to S phase

transition between wild type and ATF-2 m/m chondrocytes, a checkpoint controlled by pRb.

Incorporation of BrdU was increased in cells from ATF-2 m/m animals (Figure 2-10). The









percentage of cells within the S-phase fraction of the cell cycle was increased in ATF-2 m/m

cells. Theses results, taken together with the immunostaining for Ki67, indicate that ATF-2 loss

results in aberrant cell cycle control mainly at the G1 to S transition.

Discussion

Endochondral ossification is dependent on the coordinated regulation of chondrocyte

proliferation and differentiation. Previous results from our lab have demonstrated that ATF-2

acts as a global regulator of chondrocyte proliferation through regulation of the cyclin Dl (Beier

et al., 1999) and cyclin A (Beier et al., 2000) promoters. We have, more recently, implicated

ATF-2 in controlling apoptosis of hypertrophic chondrocytes via regulation of the bcl-2 promoter

(Ma et al., 2007). Other potential target genes of ATF-2 include the pocket proteins pRb, p107

and p130. The necessary regulation of cell cycle exit and terminal differentiation of

chondrocytes renders the pocket proteins ideal candidates for ATF-2 regulation. Pocket protein

function involves regulation of cell cycle progression, therefore centrally modulating cellular

proliferation and differentiation processes. Regulation of pocket protein expression is a plausible

mechanism for ATF-2 function in chondrocytes.

Previous data from our laboratory have shown that pRb protein levels were decreased in

response to ATF-2 loss (LuValle et al., 2003). Interestingly, p107 protein levels were increased

in ATF-2 mutant chondrocytes while p130 remained stable. The increase in p107 levels may

reflect a response to diminished levels of pRb and a compensatory mechanism whereby the

increased p107 levels could interact and sequester E2F transcription factors necessary for cell

cycle progression. Spatially, pRb is expressed in the resting and early proliferative region of the

growth plate. However, ATF-2 deficient mice express pRb in the maturation and hypertrophic

regions. The increase in pRb expression combined with the altered, more downstream spatial









expression inATF-2 m/m animals may be indicative of the important role pRb plays in regulating

cell cycle exit and ultimately chondrocyte differentiation. It also suggests that the ATF-2 m/m

phenotype results from not only the reduced number of proliferative cells (Reimold et al., 1996)

but also a possible disruption in the normal differentiation program, specifically control of cell

cycle exit. pRb plays a central role in cell cycle regulation, but also functions in terminal

differentiation of numerous cell types (Cobrinik et al., 1996; Zacksenhaus et al., 1996; Walsh,

1997; Thomas et al., 2001; Fajas et al., 2002). Results from western blots indicate that p107

expression is increased in ATF-2 m/m chondrocytes while p130 levels are unaffected (Figure 2-

4). Our immunohistochemical data replicate this phenomenon, demonstrating that spatial

expression of pl07 in the ATF-2 m/m growth plate is localized to the maturation region.

ATF-2 may control the normal differentiation of chondrocytes indirectly, by influencing

the expression of pRb. There is a clear increase in pRb expression in the ATF-2 m/m growth

plate that does not correlate with results from immunoblotting experiments (Figures 2-1-3

compared to Figure 2-4). However, chondrocytes within the resting zone in wild type growth

plates express higher levels of pRb than those of ATF-2 m/m chondrocytes. This difference

could account for the discrepancy between in vitro (immunoblot) and in vivo

(immunohistochemistry) results where pRb expression is reduced in primary ATF-2 mutant

chondrocytes. This phenomenon is not mirrored in vivo by ATF-2 mutant chondrocytes where

pRb expression is not dramatically reduced. The most striking result may be the spatial change

in pRb expression. pRb is expressed in the resting zone and in the late proliferative zone in wild

type chondrocytes, but in ATF-2 m/m chondrocytes pRb expression is observed in the

maturation zone at higher levels than in wild type, as well as throughout the hypertrophic region.

There is also a clear reduction in the number of cells expressing pRb in the resting zone. The









reduction in pRb expression may be the result of sub-optimal activation of the pRb promoter

following loss of ATF-2 activation. Results from promoter studies (Figure 2-5B) support this

finding. Likewise, ATF-2 has been shown to be necessary for optimal pRb promoter activity

(Zacksenhaus et al., 1993). The alteration of pRb expression may allow cells to enter the cell

cycle earlier and exit earlier, leading to premature growth plate closure and culminating in the

observed dwarfed phenotype. Our results indicate that this may be the case. Increased Ki67

immunostaining in ATF-2 m/m growth plates combined with the increase in BrdU incorporation

in primary chondrocytes from ATF-2 m/m animals indicate a loss of cell cycle control which

may contribute to the observed phenotype. Another contributing factor to the dwarfed phenotype

of ATF-2 m/m animals is the increase of p107 expression. This increase, combined with steady

levels of p130 observed in ATF-2 m/m animals, may result in a shorter period of chondrocyte

proliferation, resulting in premature cell cycle exit and growth retardation.

Chondrocyte growth arrest has been largely associated with p107 and p130, with little

mention regarding pRb. We were able to examine pRb expression in differentiating cells by

using the ATDC5 chondrogenic cell line. We show here that pRb expression is tightly correlated

with expression of type X collagen, a marker for chondrocyte differentiation. Furthermore,

ATDC5 cells treated with insulin have been shown to produce increased amounts of

proteoglycans, another chondrocyte differentitation marker (Phornphutkul et al., 2006). ATDC5

cells express type X collagen and pRb at higher levels following prolonged insulin treatment.

These data imply that pRb plays a definitive role in chondrocyte differentiation in vitro.

Cell cycle exit is a hallmark of terminal differentiation. The accumulation of cells in

Gl/GO of the cell cycle is a sufficient indication of removal from the cell cycle. As the number

of cells in G1/GO increase, there is a decrease in the number of cells in S- and G2/M phases of









the cell cycle. Differentiation of ATDC5 cells stimulates expression of pRb and type X collagen

while simultaneously yielding an increase of cells exiting the cell cycle. These results suggest

that pRb not only regulates cell cycle exit, but also plays a role in determining the normal

chondrocyte differentiation program.

The temporal pattern of pRb expression in the distinct regions of the growth plate directly

effect growth plate development. The altered spatial/temporal expression of pRb in response to

loss of ATF-2 signaling could induce cells to exit the cell cycle prematurely. Exit from the cell

cycle would likely trigger advanced terminal differentiation, ultimately leading to closure of the

growth plate and a dwarfed phenotype. The reduced expression of pRb in ATF-2 mutant cells

lead to delayed differentiation. The combination of reduced proliferation, delayed

differentiation, and increased apoptosis in later stage hypertrophic chondrocytes is likely to

contribute additively to the observed dwarfed phenotype of the ATF-2 m/m mice.

The unique ability of endochondral cartilage to undergo maturation prior to hypertrophy

may delineate the role of pRb in bone development. Expression of pRb throughout the

maturation region suggests a plausible role ofpRb in this region. Cartilage specific deletion of

pRb would best demonstrate the role of pRb in the endochondral process aside from fetal limb

development (Cobrinik et al., 1996). Our lab is currently undertaking these projects to better

understand the function of pRb in the growth plate.












m/m


* 4,


-N" -> ~,, -s. **+tH



a. -


* -..
rw,


., LuC


at., i ",,




''p



V.'.. a'.. i
* .i ~ r '

,.9 *11-


Immunohistochemical localization of pocket proteins in newborn growth plates.
Knee joints from wild type (+/+) and ATF-2 mutant (m/m) newborn mice were
fixed in 4% paraformaldehyde, embedded in paraffin and sectioned at 5 [tm for

immunohistochemistry. Primary antibodies against pRb (a,b), p107 (c,d), and
p130 (e,f) were used as noted in Material and Methods. Control sections were
incubated with non-specific IgG from the same host species as primary
antibodies. Micrographs were taken at 20X magnification using a Leica DM2000
microscope equipped with a Leica DFC420C digital camera.


..


HT~
-I


Figure 2-1.


"j I
:::.:,' L~
-"
~~~ 1


I -All 1. 11


i
:.







:?'
i:










+/+ m/m

















HT HT
+. +- '+--i- i .t.- .






-d






-At
*- t 4.*a


.*..eq u ip p e d w ith a L e ic a D FC d l .i l c a .
d; -. .. -.





H i HT ii- .-. ,, .. r+ .
p- -- -- -' -< ~ .-









S..;.*. ;.- .. .. H
Si ,, A.'".,: -.0 .

k" ,"" .k ,
,, :':. -4 ,' ,. ,...




Immunolocalization of pocket proteins in 1-week old growth plates. Knee joints
from 1-week old wild type (+/+) and ATF-2 mutant (m/m) mice were fixed in 4%
paraformaldehyde, embedded in paraffin and sectioned at 5 urm for
immunohistochemistry. Primary antibodies against pRb (a,b), p107 (c,d), and p130
(e,f) were used as noted in Material and Methods. Control sections were incubated
with non-specific IgG from the same host species as primary antibodies.
Micrographs were taken at 20X magnification using a Leica DM2000 microscope
equipped with a Leica DFC420C digital camera.


Figure 2-2.









+/+ m/m











P -, .. .- .-a. *" ..
b. -
^.^^Si^ ^^.:'--. *--"








P -. P, .


HT H .... T

HT ... '


HT






HT ,' ..' .- ,', r o '" o', ;'. .. f HT
,. ." ,' 7:- -. ,'5,' / -









Figure 2-3. Immunohistochemical localization of pocket proteins in 3 week-old growth plates.
Knee joints from wild type (+/+) and ATF-2 mutant (m/m) 3 week-old mice were
fixed in 4% paraformaldehyde, embedded in paraffin and sectioned at 5 [tm for
immunohistochemistry. Primary antibodies against pRb (a,b), pl07 (c,d), and pl30
(e,f) were used as noted in Material and Methods. Control sections were incubated
with non-specific IgG from the same host species as primary antibodies.
*. jr... L. t


p^ : *-; -













Micrographs were taken at 20X magnification using a Leica DM2000 microscope
equipped with a Leica DFC420C digital camera.







+/+


+/m m/m


pRb



,mI p107


p130



--U .~ -actin


Expression of pocket proteins is altered in response to ATF-2 mutation. Total
protein from primary chondrocytes isolated from wild type (+/+), heterozygous
(+/-), and ATF-2 mutant (m/m) mice were analyzed by Western blot. Equal loading
was demonstrated by probing with an antibody against actin.


Figure 2-4.














1.2 -

1.0.
0
U-
S0.8 -
X
x
LI
0.6-
>

0) 0.4 -
Cr

0.2 -


0 1


+/+ m/m


I







m/m


+/m


Levels of pRb mRNA are reduced in ATF-2 mutant chondrocytes as opposed to
wild type. A) Total RNA was extracted from primary chondrocytes isolated from
wild type (+/+) and ATF-2 mutant (m/m) mice. 2 [tg of total RNA was reversed
transcribed using Superscript II reverse transcriptase with an oligo-d(T) primer.
Real-time PCR was performed using TaqMan Gene Expression Array kit for mouse
pRb on an ABI7000 machine. Values were normalized to (3-actin mRNA levels and
represent means from 3 different animals run in triplicate. Comparisons between
groups were made using the AACt method. B) pRb promoter activity in primary
chondrocytes. A 1.3 kb portion of the pRb promoter preceding a luciferase reporter
construct was transfected into primary chondrocytes isolated from wild type (+/+),
heterozygous (+/m) and ATF-2 mutant (m/m) animals. Bar graphs represent the
mean normalized luciferase activity of triplicate samples from three different
animals for each genotype. Error bars represent SEM. pRb promoter activity in
ATF-2 mutant (m/m) chondrocytes is roughly 30% decreased as compared to
activity in wild type (+/+) chondrocytes.


Figure 2-5.











Rb
El coll X


5.0


V 4.0
0

O 3.0

E
0 2.0

rr
O 1.0
,U)

F 1 o -6.


-1.0


-2.0


Figure 2-6.


D11 D14


Days post ITS treatment


Expression of pRb mRNA is increased coincident with chondrgenic differentiation.
A) ATDC5 cells were treated with insulin-transferrin-selenium reagent (ITS) to
induce chondrgenic differentiation. Total RNA was extracted at various timepoints
(day 0, DO; day 1, D1; day 4, D4; day 8, D8; day 11, D11; day 14, D14) after
treatment initiation. Total RNA was extracted and reverse transcribed as previously
described. Real time PCR for pRb was performed as previously described. Real
time PCR for type X collagen was performed using Dynamo DS Sybr green qPCR
kit (New England Biolabs) with primers for type X collagen and normalized to [3-
actin. Type X collagen mRNA expression comparisons were determined using the
Pfaffl method (Pfaffl, 2001), accounting for unequal PCR efficiencies between
primer sets. RT-PCR was performed in triplicate on cDNA from at least 3 different
animals. B) pRb promoter activity in differentiated ATDC5 cells. Differentiated
ATDC5 cells were transfected 24 hours prior to collection with the pRb promoter-
luciferase construct. Cell were collected and assayed for luciferase activity on days
indicated (DO, day 0= initiation of ITS treatment). Luciferase activity was
normalized to Renilla luciferase activity for transfection efficiency. Bar graphs
represent the mean normalized luciferase activity of triplicate samples from three
independent experiments. Error bars represent SEM. pRb promoter activity is
increased as differentiation progresses, mirroring the observed increased expression
of pRb mRNA.


D1



















S50
<
CO
(U 40
o5






0

10

DO


IL
D1 D4 D8
Days post ITS supplementation


Figure 2-6. Continued


mRb
pGV-B


D11


D14














Debris
Apoptosis
Dip G1
Dip G2
Dip S

G1:62.73 %
G2: 12.89 %
S: 24.38 %


Day 1 Debris
Apoptosis
Dip G12
Dip S
G1:42.12 %
G2:16.39 %
S: 41.49%









50 100o 150 20.
Channels (FL2-H-Propldlum Iodide)


Day 14






-


Apoptosis
Dip G
Dip G2
Dip S

G1: 64.71%
G2: 9.36 %
S: 25.94 %


channels I-,.. i. I .. I-,


SDebris
Apoptosis
Dip G
Dip S
G p: 8

fj G1: 86.67%


G2: 5.
S: 7.6


73%
0%


Channels (FL -H Proopidiu Iodide)


SDebris
Apoptosis
Dip G1
0DlpG2
Dip S
G1: 94.28%
SG2: 4.52%
S: 1.90%









h50 100 150 200 250
Channels (FL2-H-Propldlum Iodide)


Debris
Apoptosls
DipGI
Dip G2
Dip S

G1: 85.07%
G2: 2.46%
S: 12.47%


Channels (FL2-H-Propldium Iodide)


Cell cycle analysis of ATDC5 cells undergoing chondrgenic differentiation.

ATDC5 cells were cultured and treated with ITS reagent to stimulate chondrogenic

differentiation. At indicated timepoints, cells were collected in hypotonic lysis

buffer with propidium iodide and processed for flow cytometry. DNA content was

measured to determine the cell cycle profile. At least 30,000 cell nuclei were

analyzed for each collected time point. Cell cycle profiles were analyzed using the

ModFit software package. Accumulation of cells in G1/GO occurs over time is

indicative of cell cycle exit. At the time of ITS initiation (DO), 62% of cells were

found in G1/GO. After 24 hours of ITS treatment, 42% of cells were in G1/GO.

The number of cells in G1 then increases over time to a maximum of 94% at D11.

The sub-G1 peak represents the sub-population of cells undergoing apoptosis.


Figure 2-7.


^*1 1 1 1 1













































Type X collagen immunostaining in wild type (+/+) and ATF-2 mutant (m/m)
hypertrophic chondrocytes. A) Growth plates from wild type and ATF-2 m/m
animals were dissected, processed and sectioned for immunohistochemistry as
previously described. Tibial growth plates from newborn (a,b), 1-week (c,d) and 3-
week (e,f) old mice were used. Staining was restricted, as expected, to the
hypertrophic region. B) Intensity of fluorescence from immunostaining was
measured using IP Lab digital imaging software. Mean intensity per unit area was
measured from at least three different animals per time point and genotype.
Statistical comparisons were made using Student's t-test. Bars represent mean
intensities + the standard deviation of the respective mean. Asterisk (*) indicates
significant difference (P<0.05) between wild type and mutant growth plates at the
specific age.


Figure 2-8.











B

700



600



2 500


S. wk +/+
S400- Owk m/m
0 1wk +/+
St lwk m/m
4 300 U 3wk +/+
C
0 M 3wk m/m

S200 -



100



O0




Figure 2-8. Continued













0 week





+/


R

m/m










HT


Figure 2-9.


1 week


3 week


C


R


:`


_i i;

"--
'" .i

-i~ ",'r
-'


< *-HT









S':-.







S: HT
i '.' "


HT


Immunostainingfor Ki67 in wild type (+/+) and ATF-2 mutant (m/m) animals.
Growth plates from wild type and ATF-2 m/m animals were dissected, processed and
sectioned for immunohistochemistry as previously described. Tibial growth plates
from newborn (a,b), 1-week (c,d) and 3-week (e,f) old mice were used. Hematoxylin
was used as a counterstain. Ki67 staining was observed within chondrocytes actively
undergoing cell cycle progression.


p




HT



:5
,i.


`"

2'
1











m/m


0 200


400 600
Propidium Iodide


800 1000


0 200 400 600 800 1000
Propidium Iodide


E Debris
DipGl
DipG2
Di DipS

G1: 43.88%
G2: 7.46%
S: 48.66%


C 10hanns 20 o250
Channels (FL2,HPropddum Iodide)


Figure 2-10.


El Debris
DipG1
DipG2
E DipS
G1: 36.5%
G2: 4.52%
S: 58.89%


h5 10 150 200 250
Channels (FL2-H-Propidurn Iodide)


Incorporation of BrdU in wild type (+/+) and ATF-2 mutant (m/m) primary
chondrocytes. Primary chondrocytes from wild type and ATF-2 mutant animals
were isolated and plated in plastic cell culture plates. Cells were labeled with 10
[tM BrdU for 4 hours in complete DMEM media. BrdU containing media was then
removed, followed by washing with PBS and replacement with fresh media. Cells
were allowed to recuperate for 6 hours before being collected and processed for
flow cytometric analysis of cell cycle status, and BrdU incorporation. The number
of BrdU positive cells was increased in ATF-2 m/m chondrocytes. Cell cycle
analysis of the fraction of cells that were BrdU positive shows an increase in the S
phase fraction.









CHAPTER 3
CONDITIONAL DELETION OF RETINOBLASTOMA IN CHONDROCYTES

Introduction

Endochondral development of skeletal long bones is dependent upon the proliferation and

differentiation of chondrocytes. Ordered control of proliferation is necessary to ensure and

adequate number of cells are present to promote longitudinal growth. As noted previously,

several signaling mechanisms are essential in maintaining chondrocyte proliferation including

the Ihh-PTHrP negative feedback loop, FGFs and TGF-j3 pathways. Various cellular proteins

are also vital in controlling proliferation, such as cyclin Dl (Beier et al., 1999), ATF-2 (Luvalle

et al., 2003) and E2Fs. Differentiation of chondrocytes is dependent on additional signaling

mechanisms (for review see Adams et al., 2007). Cell cycle exit and hypertrophy of

chondrocytes are two hallmarks of chondrocyte terminal differentiation. Disruption of any of the

signaling mechanisms or activity of vital cellular proteins severely inhibits longitudinal bone

growth.

The retinoblastoma (pRb) family of proteins include pRb, p107 and p130, which function

as cell cycle regulators. These proteins regulate cell cycle progression by binding and

sequestration of E2F transcription factors that are necessary for S phase progression (for review

see Dimova and Dyson, 2005). Phosphorylation of these proteins modulate their ability to bind

E2Fs. In the hypo-phosphorylated state, the proteins are capable of interactions with E2Fs thus

inhibiting cell cycle progression. Following mitogenic stimulation, cyclins bind to their

respective cyclin dependent kinases (CDKs) allowing for phosphorylation of the pocket proteins.

Hyperphosphorylation of the proteins weakens its affinity for E2Fs, allowing for free E2F

transcription factors to bind responsive promoters and induce transcription of vital S-phase

related genes. Pocket protein family members can also inhibit E2F activity by recruiting









chromatin modifying enzymes to E2F sites thereby making DNA inaccessible to transcription

factors (Brehm et al., 1998; Stiegler et al., 1998). The pocket proteins differ with respect to their

expression during the cell cycle and in their affinity for certain E2Fs. pRb is expressed in both

quiescent and cycling cells. pRb is present during G1 in the hypo-phosphorylated, active form

completing with E2F1 and 3 predominantly (Lipinski and Jacks, 1999). p130, in quiescent cells,

is mainly found bound with E2F4 acting as a transcriptional repressive complex. As cells enter

the cell cycle and progress to S-phase, p107 replaces p130 as the major partner for E2F4

(Nevins, 1998).

Inactivation of the pocket proteins leads to loss of cell cycle control in several cellular

systems (for review see Giacinti and Giordano, 2006 and Genovese et al., 2006). Numerous

cancers harbor genetic alterations leading to inactivation of pRb function. Loss of pRb function

leads to abrogated restriction checkpoint control allowing for continuous cell cycle progression.

The pRb family has been shown to regulate terminal cell cycle exit through two distinct

mechanisms. The first is a direct result of their function in regulating E2Fs and the second is

unique to cellular differentiation and the interaction of pRb family members with transcriptional

repressors. As cells enter terminal mitosis, p107 levels decrease whereas p130 levels increase

resulting in a predominance of p130/E2F4 complexes (for review see Lipinski and Jacks, 1999).

This switch is simultaneous with a decrease in free E2Fs to very low levels in fully differentiated

cells. pRb activity during differentiation is much more complex and is cell type dependent. Its

levels are not subject to the dramatic differences in expression as observed in p107 and p130.

pRb levels can increase slightly as seen in muscle (Condorelli et al., 1995; for review see De

Falco et al., 2006), remain stable as in adipocytes (Rampalli et al., 1998) or decrease as observed

in most neuronal differentiation systems (Callaghan et al., 1999).









The control of proliferation and differentiation of chondrocytes is vital in maintaining

normal endochondral bone development. Cell cycle related genes, such as the pRb family, have

been shown to play important roles in chondrocyte proliferation and differentiation. Embryos

that are devoid of p107 and p130 display perinatal lethality and pronounced defects in

endochondral bone development due to abnormal cell cycle exit (Cobrinik et al., 1996). pRb has

not been linked to defects in endochondral ossification. Indirectly, pRb has been shown to

regulate the activity of the transcription factor Cbfal which has important roles in hypertrophic

differentiation (Inada et al., 1999; Kim et al., 1999; Takeda et al., 2001; Ueta et al., 2001). It is

possible that pRb regulates chondrocyte maturation and differentiation through regulation of

Cbfal, or other genes important for differentiation. pRb has also been shown to regulate the

activity of ATF-2 (Kim et al., 1992), an important transcription factor in developing

chondrocytes. E2F1 is another transcription factor that is regulated by pRb. Overexpression of

E2F 1 in chondrocytes results in severe defects in endochondral ossification by inhibiting

differentiation (Scheijen et al., 2003). Given the role that pRb plays in regulating E2F1 activity

and its role in terminal cell cycle exit required for differentiation (for review see Lipinski and

Jacks, 1999), it is probable that pRb plays an integral role in chondrocyte differentiation.

A conditional knockout mouse was generated in order to disseminate the role of pRb in

controlling chondrocyte proliferation and differentiation. Mice harboring a floxed pRb (Rb-

loxP) allele were crossed with mice expressing Cre recombinase under the control of the type II

collagen (Col2Cre) promoter. These pairings resulted in conditional functional deletion through

the excision of exon 19 of the pRb gene within developing chondrocytes. Conditonal deletion of

pRb allows for examination of the role pRb plays in endochondral development.









Material and Methods


Mice and Genotyping

Genetically engineered mice containing two loxP (Rb fl/fl) sites flanking exon 19 of the

retinoblastoma gene as described previously (Vooijs et al., 1998) were obtained from the

National Cancer Institute. Mice were housed in a specific pathogen free environment and cared

for according to IACUC guidelines. Mice harboring the gene encoding the bacterial Cre

recombinase under the control of the type II collagen promoter (Col2Cre +/+) were transferred

from the University of Texas (a gift from Gerard Karsenty). These mice express the transgene

in chondrocytes as described previously by Ovchinnikov and colleagues (2000). Mice were

genotyped by polymerase chain reaction (PCR). Lysis of liver tissue was performed in 200 tl of

50 mM KCL, 10 mM Tris (pH 8.0), 2.5 mM MgC12, 0.1 mg/ml gelatin, 0.45% NP-40 (v/v) and

0.45% Tween-20 (v/v) and 2 [tl of 20 mg/ml proteinase K. Samples were incubated at 65C for

2 hours, followed by incubation at 95C to inactivate proteinase K. An appropriate amount (0.5-

2 tl) of DNA was used in subsequent PCR reactions. Primers used for genotyping are as

follows: for Rb loxP: RbfloxFW 5'-GGCGTGTGCCATCAATG-3' and RbGen701 5'-

ATCTACCTCCCTTGCCCTGT-3'; for Col2Cre: CreFW 5'-

GAGTGATGAGGTTCGCAAGAAC-3' and CreRV 5'-TCGCCATCTTCCAGCAGG-3'.

Histology

Hind limbs from Rb fl/fl and Col2Cre +/-; Rb fl/fl mice were dissected from newborn

mice and fixed for 24 hours in 4% paraformaldehyde or embedded in tissue OCT (TissueTek) for

frozen sectioning. Sections were then transferred from paraformaldehyde to phosphate buffered

saline (PBS) and processed for paraffin embedding at the University of Florida College of

Medicine Molecular Pathology Core Lab. Paraffin sections were cut at 6 atm and attached to









Fisher SuperFrost Plus slides. Hematoxylin and eosin staining was performed by the Molecular

Core Lab using an automated staining apparatus.

Skeletal Preparations

Newborn, 1-week, and 3-week old mice were sacrificed by CO2 asphyxiation according

to IACUC guidelines. Mouse carcasses were skinned and eviscerated. Liver tissue was

collected for genotyping. Excess skeletal muscle and fat were removed. Skeletons were then

immersed in Alcian Blue staining solution (0.1% Alcian Blue 8X, 90% EtOH, 10% Acetic Acid)

for 1-2 days. Alcian blue stains for cartilaginous elements of the skeleton. Skeletons were then

rehydrated through graded alcohols as follows: 2X 100% EtOH for 1 hr, 2X 90% EtOH for lhr,

2 X 70% EtOH for 1 hr, IX H20 1 hr. Following rehydration, skeletal preps were rinsed in NaCl

solution (0.15 M NaC1), and subsequently digested with 1% trypsin (Gibco-BRL) in NaCl

solution for 3 hours to overnight depending on the size of the skeleton. Remaining skeletal

muscle and excess tissue was then removed, followed by incubation with alizarin red stain in 1%

KOH solution for 24-48 hours. Stained skeletons were then processed through a series of 1%

KOH: glycerol solutions for long-term storage (3 parts 1% KOH, 1 part glycerol; 2 parts 1%

KOH, 2 parts glycerol; 1 part 1% KOH, 3 parts glycerol).

Von Kossa Staining

Frozen embedded tissues were sectioned at 6 [m and attached to SuperFrost Plus

microscope slides. Sections were fixed in ice cold 70% methanol for 10 minutes then allowed to

air dry. Fixed sections were incubated in 1% silver nitrate solution (w/v) under UV-irradiation

for 10 minutes. Slides were then rinsed in distilled water followed by removal of excess silver

ions by incubation in 5% sodium thiosulfate (w/v) for 5 minutes. Slides were then rinsed in

distilled water and counterstained with Nuclear Fast Red staining solution (VectorLabs) for 3









minutes. Stained slides were then dehydrated through an ethanol gradient and mounted for

microscopic evaluation.

Immunohistochemistry

Sections from paraffin embedded tissues were cut at 6 [m and attached to charged

microslope slides. Sections were processed for immunohistochemistry by dewaxing and

rehydration through graded alcohols to distilled water. Microwave antigen retrieval was

performed by heating in Antigen Unmasking Solution (VectorLabs) buffer for 20 minutes.

Endogenous peroxide activity was blocked with 3% H202 in water for 5 minutes. Antibody

incubation and detection of antibody binding was performed using the VectaStain Elite kit

(Vector Labs) according to manufacturer's recommendations. Diaminobenzidine was used as a

peroxidase substrate for the colorimetric reaction. Digital images were taken using a Leica DFC

720 model camera and associated capture software.

Results

Conditional knockout animals were produced in order to investigate the importance of

pRb in chondrocyte proliferation and differentiation,. Mice expressing Cre recombinase under

the control of the type II collagen promoter were bred to mice with loxP site flanking exon 19 of

the pRb gene. Excision of exon 19 yielded a truncated pRb protein resulting in a functional

deletion equivalent to a null allele (Vooijs et al., 1998; Vooijs and Berns, 1999). Double

heterozygous individual males were produced and backcrossed to RbloxP homozygous females

in order to maximize the number of knockout animals. Mice were genotyped by PCR for

homozygosity for the presence of loxP sites and positive expression of the Cre enzyme.

Conditional knockout animals were observed at normally expected ratios, indicating that deletion

of pRb within chondrocytes is not embryonic lethal. Conditional pRb negative neonates were









smaller in size compared to their wild type (Cre -/-; pRb fl/fl) littermates (Figure 3-1A). At one

week of age, pRb negative animals were still smaller than Cre -/-; pRb fl/fl littermates (Figure 3-

1B). However, by 3 weeks of age, Cre +/-; pRb fl/fl conditional knockouts were observed to be

of equal size compared to Cre -/-; pRb fl/fl littermates (Figure 3-1C).

Skeletal staining preparations were utilized to visualize the calcification and cartilage

formation within the bones. Newborn littermates displayed reduced body size in response to

pRb mutation. Comparison of bone length of the humerus from Cre -/-; pRb fl/fl animals and

Cre +/-; pRb fl/fl conditional knockouts demonstrates the size difference (Figure 3-2A). All

normal elements of the skeleton were present, however conditional mutants were smaller in size

compared to their wild-type littermates (Figure 3-2 A-D). Normal formation and calcification of

the ribs and vertebrae were evident (Figure 3-2 C,D). Skeletal staining of one-week old animals

revealed no difference in the amount of calcified bone within the long bone (Figure 3-3 A,B).

However, within the secondary ossification centers, alizarin red staining was less prominent in

Cre +/-; pRb fl/fl conditional mutants than that seen in Cre -/-; pRb fl/fl animals (Figure 3-3 A,B

arrows). The overall size of the bones was smaller in conditional mutants, but not as dramatic as

seen in the neonates.

The histological architecture of the developing bone was examined by staining with

hematoxylin and eosin. Cre -/-; pRb fl/fl and Cre +/-; pRb fl/fl animals were sacrificed and

tissues were fixed and embedded in paraffin wax. Sections from the proximal tibia were

examined for histology. The characteristic zones of the growth plate were present in Cre -/-; pRb

fl/fl animals and sufficiently normal (Figure 3-4A). Cre +/-; pRb fl/fl growth plate sections

displayed some deviations from normal (Figure 3-4B). Resting zone chondrocytes within Cre

+/-; pRb fl/fl animals were smaller in cellular volume. Proliferative chondrocytes develop









characteristic columns in the normal tissues. However, the columns were less organized in the

conditional mutants (Figure 3-4B). There is a clear pre-hypertrophic region in the Cre -/-; pRb

fl/fl growth plate and the hypertrophic region is well defined. Tissue sections from Cre +/-; pRb

fl/fl animals displayed little to no pre-hypertrophic region and a slightly disorganized and smaller

hypertrophic region (Figure 3-4B). Histological examination of growth plates from 1-week-old

Cre -/-; pRb fl/fl (Figure 3-4C) and Cre +/-; pRb fl/fl (Figure 3-4D) mice revealed little

difference in response to pRb deletion. Interestingly, there was an observed reorganization of the

growth plate in Cre +/-; pRb fl/fl tissues (compare Figure 3-4 B to C,D). At 1-weekof age, the

growth plate had developed the characteristic columns of proliferating cells. This re-

organization resulted in a growth plate displaying no visible differences from that of wild-type

(Cre -/-; pRb fl/fl) animals.

Von Kossa staining was used to further investigate calcification of the developing bone.

Whole skeletal staining revealed a reduction in the amount of calcified bone observed in Cre +/-;

pRb fl/fl animals as compared to their wild type litter mates. Tissue sections from the proximal

tibia were incubated with 1 % silver nitrate and exposed to UV light for 5 minutes. This

procedure displaces calcium within the bone for the silver ions allowing for observation of

calcified bone. Tissues from Cre -/-; pRb fl/fl animals displayed normal amounts of calcified

bone equivalent to that observed in Cre +/-; pRb fl/fl tissues (Figure 3-5 A, B). To confirm or

refute the observed difference in calcium staining in the secondary ossification centers seen in

skeletal preparations, tissues from 1 week-old mice were processed for von Kossa staining also

(Figure 3-5 C, D). Bone mineralization was not effected by pRb deletion in 1-week tissues as

observed by von Kossa staining. Areas of secondary ossification were not observed to be

calcified at a delayed rate as suspected from skeletal preparations. Differences among individual









animals or the precise area of sectioning may account for the lack of noticeable mineralization of

secondary ossification centers.

The inherent cellular function of pRb is to regulate the transition from the G1 phase of

the cell cycle to S phase. Deletion or genetic alteration of normal pRb function leads to

abnormal cell cycle progression and is often associated with uncontrolled cell proliferation.

Immunohistochemical localization of cellular proliferation markers were used to ascertain the

effect of the pRb conditional deletion on chondrocyte growth. Sections of proximal tibia from

Cre -/-; pRb fl/fl (Figure 3-6 A, B, C) and Cre +/-; pRb fl/fl (Figure 6D, E) were stained for the

cellular proliferation markers, Ki67 and PCNA. Staining for Ki67 in Cre -/-; pRb fl/fl tissues

was observed in early proliferative cells of the resting zone and throughout the characteristic

columns of expanding chondrocytes (Figure 3-6B). Notably, staining for Ki67 is not observed in

the pre-hypertrophic or hypertrophic regions. The lack of immunoreactivity is expected given

that Ki67 is a cellular nuclear antigen present within cells actively engaged in the cell cycle.

Chondrocytes within these areas cells have exited the cell cycle, and thus do not express Ki67.

Ki67 expression in Cre +/-; pRb fl/fl tissues was observed in cells throughout the resting zone

and proliferative region (Figure 3-6D). Staining was less prevalent in Cre -/-; pRb fl/fl tissues as

compared to Cre +/-; pRb fl/fl tissues (compare Figure 3-6B to D). PCNA is most closely

associated with cellular DNA synthesis, another hallmark of proliferating cells. Immunostaining

for PCNA in Cre -/-; pRb fl/fl tissues were observed in chondrocytes in the resting, proliferative

and to a lesser extent in the pre-hypertrophic and hypertrophic regions (Figure 3-6C).

Expression of PCNA was also observed in the resting, proliferative, pre-hypertrophic and

hypertrophic regions in Cre +/-; pRb fl/fl tissues (Figure 3-6E). Conditional deletion of pRb

allows for the increase of cellular proliferation observed through the expression of proliferative









markers. Chondrocytes from Cre +/-; pRb fl/fl tissues express proliferative markers at higher

levels and at earlier spatiotemporal points than in chondrocytes from Cre -/-; pRb fl/fl tissues.

The sustained expression of Ki67 in chondrocytes in the pre-hypertrophic and hypertrophic

regions further signifies the alteration in chondrocyte proliferation resulting from pRb deletion.

Discussion

Normal endochondral bone formation is dependent on adequate chondrocyte proliferation

and subsequent terminal differentiation. Alteration of chondrocyte proliferation by genetic

mutations in many cell cycle regulatory pathways results in abnormal development, such as the

cyclin Dl and p21Cipl/Wafl genes (for review see Beier, 2005). The importance of cell cycle

control is not only manifested in the proliferation of chondrocytes, but also in terminal cell cycle

exit and hypertrophic differentiation. Several cell cycle-related proteins have been shown to be

important in regulating cell cycle progression and terminal exit.

The retinoblastoma family of proteins is a group of proteins central to cell cycle control.

Family members pRb, p107 and p130 are key cell cycle regulators that bind and sequester E2F

transcription factors necessary for DNA synthesis. p107 and p130 have been shown previously

to play important roles in growth plate development (Cobrinik et al., 1996; Rossi et al., 2002;

Laplantine et al., 2002) through the regulation of chondrocyte growth arrest and hypertrophic

differentiation. Previous results from our lab have implicated pRb in chondrocyte growth in

response to ATF-2 loss (Chapter 2, Luvalle et al., 2003).

In order to assess the contribution that pRb plays in chondrocyte proliferation and

differentiation, a conditional pRb deletion mutant was utilized. Conditional mutant animals

displayed no gross phenotypic abnormalities besides the reduced size at birth (Figure 3-1A, and

Figure 3-2). The difference in body size observed in newborn mice was overcome as the









conditional mutants grew to adulthood (Figure 3-1C). These findings suggest that pRb may be

necessary for optimal chondrocyte growth in utero, but likely has a diminished post-natal role.

Members of the retinoblastoma protein family display affinity for specific members of

the E2F family of transcription factors. pRb has been shown to bind preferentially to E2F 1-3a,

whereas p107 and p130 bind to E2F 4-5 (for review see Macaluso et al., 2006). Evidence also

exists that supports a compensation mechanism whereby p107 expression is up-regulated in

response to pRb mutation or deletion (Lee et al., 1996; Jiang and Zacksenhaus, 2002; Donovan et

al., 2006). Constitutive overexpression of E2F l, the preferential binding partner for pRb, results

in dwarfism and skeletal abnormalities (Scheijin et al., 2003). The lack of similar defects in pRb

conditional mutants as observed with E2F overexpression suggests a plausible role for a

compensatory mechanism. It is possible that p107 or p130 can counteract the loss of pRb

function through the binding and sequestration of E2Fs normally bound by pRb.

It is possible that pRb plays a very insignificant role in controlling chondrocyte

proliferation in general. Chondrocyte growth arrest is induced by FGF signaling primarily

through p107 and p130, but not pRb (Rossi et al., 2002; Laplantine et al., 2002). Disruption of

p107 and p130 together prevent hypertrophic differentiation of growth plate chondrocytes

whereas pRb does not appear to play a significant role (Rossi et al., 2002). The observed

phenotype of pRb conditional mutant animals suggests a role for pRb upstream of chondrocyte

cell cycle exit. Increased expression of proliferation markers Ki67 and PCNA in conditional

mutants demonstrates that pRb functions by regulating cellular proliferation in early postnatal

animals. However, the observed re-organization of growth plate chondrocytes at 1-week

postnatal age indicates the insignificance of pRb in normal endochondral development. The re-

organization of the growth plate may signify an increased role of p107 in response to pRb









deletion. As observed in response to ATF-2 loss, p107 may be up-regulated with the loss of

pRb.

Another plausible explanation for the seemingly transient role pRb plays in endochondral

development are the roles that pRb plays in other cellular processes. In addition to its role in cell

cycle control, pRb is a transcription factor that can regulate transcription of target genes through

regulation of respective promoter regions (Markey et al., 2002). pRb may regulate the

expression and/or activity of putative growth factors required for endochondral development

during late embryonic and early post natal development. pRb may directly or indirectly control

the expression of pl07 and/or p130 through modulating their respective promoters. Loss of

ATF-2 signaling causes a reduction of pRb levels, with a coincident increase in p107 levels

(Chapter 2, Luvalle et al., 2003).

The findings described here provide evidence that pRb is not required for normal

endochondral bone development. However, there exists a possible role for pRb in early postnatal

growth that is overcome by more important signaling mechanisms. Likely, it is a compensatory

mechanism by p107 and the roles of p107 and p130, more than those of pRb, that insure normal

endochodral development in pRb conditional mutants.


















N\


Comparison of normal and conditional mutant animals. (A) Conditional mutants
were smaller at birth but displayed no gross phenotypic skeletal abnormalities in
response to pRb loss. B) At 1-week of age, conditional mutants were still
slightly smaller than wild type littermates. (C) By 3 weeks of age, there was no
observed difference in body size between wild type and conditional mutants.


Figure 3-1.


(ICC-
iril~il







A


N


Skeletal staining of newborn wild type and pRb conditional deletion mutants. (A)
Humerus bones from Cre -/-; pRb fl/fl and Cre +/-; pRb fl/fl animals demonstrate
the observed size difference among littermates. (B) The hips and vertebral column
of littermates showed no difference in axial skeleton development other than a
reduced size. (C) Staining of the cranial bones showed no difference in craniofacial
development aside from the size difference. (D) Normal development and
mineralization of the ribs and vertebrae were observed wild type and pRb
conditional mutants.


Figure 3-2.


tlr










r i

~ r) 2
r i'
;r*
9"
r t



~P
~3L ;~)
2

r


Skeletal staining of 1-week-old pRb conditional knockout and wild type mice. (A)
Hindlimbs from conditional knockout mice (upper) displayed slightly smaller
overall length of the limb as compared to wildtype littermates (lower). Secondary
ossification centers (arrows) were more prominent in normal tissues. (B) Forelimbs
from mice with the pRb conditional deletion (lower) displayed reduction in size and
delayed ossification as compared to wild-type littermates (upper). Arrows again
indicate centers of secondary ossification.


Figure 3-3.










*'A'-:;' "; ".** ""' "










.* "! .. .* ; -. .
.
.5 4 -


:.." ""

. .. ,



." .



L-, .... W .:- -
-.;: ': .;-. .- ... --;.
i. .. .
..4~ ...
' .: 2.- :".


: '. i




.: -. nr-
I -










Histological examination of tibial growth plates of wild type and conditional
mutants. Tissue section from proximal tibial growth plates were sectioned and
stained with hematoxylin and eosin. Tissues from newborn (A, B) and 1-week-old
(C, D) mice are presented. Cre-/-; pRb fl/fl mice diplsayed the normal architecture
of the growth with requisite columns of proliferating chondrocytes and a clear
defined hypertrophic region (A). Cre +/-; pRb fl/fl mice do not display the normal
columnar formation and show increased numbers of cells (B). At 1-weekof age,
Cre -/-; pRb fl/fl animals show normal growth plate development (C). Cre +/-; pRb
fl/fl animals also show normal growth plate development indicating a re-
organization of the growth plate (D).


Figure 3-4.


















































Von Kossa staining of growth plate of wild type (A, C) and conditional mutants (B,
D). Frozen sections of proximal tibial growth plates were analyzed for
mineralization by von Kossa staining. (A) Newborn tissue section from Cre -/-;
pRb fl/fl animals showed normal calcification of bone. (B) Newborn Cre +/-; pRb
fl/fl conditional mutant bone displayed similar mineralization as their wild type
littermates. (C) Tissues from 1-week-old Cre -/-; pRb fl/fl mice showed normal
bone mineralization. (D) Cre +/-; pRb fl/fl tissues displayed normal bone
mineralization similar to that observed from wild type littermates (compare C, D).


Figure 3-5.


r :r
r.














Ur


C '"`'
r rr :
:~ ~ '
." *

, +.;r. -c.l. .Y
:i
r
'" 1"' -~.~--" "
5' "~: r
r
'i r
c' r.
t~ ''- '
1 ;' ;- .. `:
;' "'
-"
=- t ...,
-r
;: ^-- z

.r ~ r
-
.r
i

: :


*; .*- : ..' ''i 's '
," '" s .*

-*' '* .' ^ '*


conditional mutants. Proximal tibial sections from newborn Cre -/-; pRb fl/fl (A, B,





.C) .Cre +/-; pRb f/f (D, E) mice were processed for immunohistochem istry and


















counterstained with hematoxylin. (A) Control section of newborn wild type growth
(C) Tissue section from Cre -/-; pRb f/f animals immunostained for PCNA. (D)
-' "' : a' "















Immunostaining for Ki67 in Cre +/-; pRb f/f conditional mutants. An increase in
Im munolocalization of prolifer. E atio n mars Ki67 an PCNA in Cw e +/-; pRb

conditional mutants. Proximal tibial sections from newborn Cre -i-; pRb fl/fl (A, B,

C) and Cre +/-; pRb fl/fl (D, E) mice were processed for immunohistochemistry and
counterstained with hematoxylin. (A) Control section of newborn wild type growth

plate. (B) Tissue section from Cre -/-; pRb fl/fl animals immunostained for Ki67.

(C) Tissue section from Cre -/-; pRb fl/fl animals immunostained for PCNA. (D)

Immunostaining for Ki67 in Cre +/-; pRb fl/fl conditional mutants. An increase in

Ki67 immunoreactiivity is observed in conditional mutants over wild type

littermaters (compare B and D). (E) Immunostaining for PCNA in Cre +/-; pRb

fl/fl conditional mutant animals. Immunoreactivity for PCNA is similar between

wild type and conditional mutants (compare C and E).


Figure 3-6.


.



~-


r ;' ;;~..`
:
`i'
5- ~
C .~
"r

; "
r
n. t
:
r

1"2."
-= 1-.
.t


i









CHAPTER 4
CONCLUSIONS

Overview of Findings

At the time these studies began, the role of ATF-2 in endochondral ossification was

primarily viewed as a modulator of expression of genes involved in cell cycle progression. Most

of the research on the role of ATF-2 in bone and cartilage development focused around promoter

activation of genes involved in chondrocyte proliferation. The research presented here seeks to

examine the role that ATF-2 plays in regulating the expression of cell cycle regulators, pRb,

p107 and p130. Moreover, an understanding of the interplay between ATF-2 and the pocket

proteins in chondrocyte proliferation and differentiation, as well as the role of pRb in regulation

of chondrocyte cell cycle progression is justified in terms of developing a better understanding of

how ATF-2 controls growth plate development and the role of pRb in skeletal growth.

Building on the knowledge of the function of ATF-2 in control of promoter activity by

binding the CRE located in target gene promoters, we examined the expression of possible target

genes pRb, p107 and p130. Given the cellular function of these proteins as cell cycle regulators

and the alteration of pRb expression in response to ATF-2 loss, we confirmed the importance of

pRb in chondrocyte differentiation using an in vitro chondrogenic system (Chapter 2).

Chondrogenic differentiation of ATDC5 cells induced cell cycle exit. This was temporally

associated with increased expression of pRb and type X collagen mRNA, and supported a role

for pRb in chondrocyte differentiation (Chapter 2). Building upon the observed role of pRb in

chondrocyte differentiation in vitro, we sought to characterize its role in vivo. Conditional

deletion of pRb in chondrocytes did not produce gross skeletal abnormalities, and skeletal

growth was affected transiently, at best (Chapter 3). A reduced size was observed at birth, but

was overcome by 3 weeks of age. Examination of the histology and immunolocalization of









proliferation marker Ki67 and PCNA revealed increased chondrocyte proliferation in conditional

mutants (Chapter 3). The difference in histology observed between conditional pRb mutants and

normal animals was resolved by 1-weekof age. These studies suggest that the role of pRb within

growth plate development is insignificant as compared to that of pl07 and p130.

Questions and Future Studies

As is the case with any scientific research, when results are obtained, more questions

arise and future directions are explored. Expression of ATF-2 is predominantly localized to the

resting and proliferating zones of the growth plate suggesting its function is concentrated in those

areas. However, loss of ATF-2 function yields effects on the growth plate at distal sites from

those having ATF-2 expression (Chapter 2; Ma et al., 2007). ATF-2 is expressed in the resting

and proliferating regions of the growth plate, yet ATF-2 loss results in alteration in the

hpyertrophic zone, a region lacking ATF-2 expression. The reduction in type X collagen

expression and overall size of the hypertrophic region observed in ATF-2 deficient animals

suggests a role for ATF-2 in controlling the differentiation of growth plate chondrocytes. It is

still unknown how ATF-2 regulates this process. It is possible that through the altered

expression of the pocket proteins that chondrocytes exit the cell cycle earlier. Premature

chondrocyte cell cycle growth arrest combined with the decreased expression of bcl-2 in ATF-2

deficient animals (Ma et al., 2007) may lead to increased apoptosis within the hypertrophic

region, ultimately resulting in a reduction in hypertrophic region size. The reduced expression of

type X collagen observed in ATF-2 deficient animals (Chapter 2) may be an indirect result of the

reduced size of the hypertrophic region.

The increase in p107 levels in response to ATF-2 deficiency is another unresolved topic.

Expression ofpl07 is increased in response to pRb loss (Lee et al., 1996; Jiang and









Zacksenhaus, 2002; Donovan et al., 2006). The p107 promoter region contains a putative CRE

that may be a target for ATF-2 regulation. The reduction of pRb levels may result in a

transcriptionally activated p107 promoter. pRb can repress transcription of genes by forming a

repressor complex on target promoters. It is possible that the p107 promoter is a target of pRb

repression. Lengthy promoter deletion as well as chromatin immunopreciptation studies would

be necessary to determine if pRb can regulate p107 promoter activity in chondrocytes.

Secondary to this would be the elucidation of the plausible compensatory mechanism that may

exist between pRb and p107. Overexpression of E2F1 results in skeletal defects (Scheijin et al.,

1003) suggesting that p107 cannot compensate for pRb while pRb is still expressed. It would be

interesting to determine if E2F 1 overexpression results in similar anomalies in pRb conditional

mutants, or if pl07 is highly up-regulated and compensates for pRb loss. Similarly, it would be

beneficial to examine which E2F family members interact with p107 in ATF-2 deficient

chondrocytes. These experiments would demonstrate how p107 may compensate for the

reduction in pRb expression. It would also be informative to investigate the role of pl30 in

compensating for pRb loss.

Another unresolved issue is the discrepancy between the observed decrease in

chondrocyte proliferation (Reimold et al., 1996) and the loss of pRb expression in ATF-2 mutant

animals. The two results seem contradictory. Also, our results from pRb conditional mutants

(Chapter 3) suggest that there is a transient increase in proliferation seen in newborn growth

plate chondrocytes. Again, the importance of p107 in chondrocyte proliferation is demonstrated.

The increase in p107 expression seen in ATF-2 mutant animals could compensate for pRb loss,

and provide increased cell cycle control and possibly premature growth arrest. Contributing to

this could be the role that ATF-2 plays in regulating the expression of cyclin Dl (Beier et al.,









1999). Reduced cyclin Dl expression may influence the phosphorylation status of p107 which

in turn would allow for a hypophosphorylated state whereby p107 can bind E2Fs and contribute

more greatly to chondrocyte growth arrest. In the case of pRb conditional mutants,

chondrocytes still express a truncated form of the protein. It is possible that the truncated protein

still confers some properties that may influence p107 expression. Studies investigating the

occupancy of the p107 promoter in the pRb conditional mutants would be informative to

determine changes in transcriptional activity.

In conclusion, the studies described in this dissertation have identified the regulatory role

ATF-2 plays on the expression of the pocket proteins and provided evidence for the importance

of pRb in regulating chondrocyte cell cycle progression. These findings will affect future efforts

of scientists investigating cartilage development and growth plate biology.









LIST OF REFERENCES


Adams, S. L., Cohen, A. J., and Lassova, L. (2007). Integration of signaling pathways regulating
chondrocyte differentiation during endochondral bone formation. J Cell Physiol 213, 635-
41.

Alappat, S., Zhang, Z. Y., and Chen, Y. P. (2003). Msx homeobox gene family and craniofacial
development. Cell Res 13, 429-42.

Atsumi, T., Miwa, Y., Kimata, K., and Ikawa, Y. (1990). A chondrogenic cell line derived from
a differentiating culture of AT805 teratocarcinoma cells. Cell Differ Dev 30, 109-16.

Beier, F. (2005). Cell-cycle control and the cartilage growth plate. J Cell Physiol 202, 1-8.

Beier, F., Ali, Z., Mok, D., Taylor, A. C., Leask, T., Albanese, C., Pestell, R. G., and LuValle, P.
(2001). TGFbeta and PTHrP control chondrocyte proliferation by activating cyclin Dl
expression. Mol Biol Cell 12, 3852-63.

Beier, F., Lee, R. J., Taylor, A. C., Pestell, R. G., and LuValle, P. (1999). Identification of the
cyclin Dl gene as a target of activating transcription factor 2 in chondrocytes. Proc Natl
Acad Sci U S A 96, 1433-8.

Beier, F., Taylor, A. C., and LuValle, P. (2000). Activating transcription factor 2 is necessary for
maximal activity and serum induction of the cyclin A promoter in chondrocytes. J Biol
Chem 275, 12948-53.

Bell, D. M., Leung, K. K., Wheatley, S. C., Ng, L. J., Zhou, S., Ling, K. W., Sham, M. H.,
Koopman, P., Tam, P. P., and Cheah, K. S. (1997). SOX9 directly regulates the type-II
collagen gene. Nat Genet 16, 174-8.

Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Bannister, A. J., and Kouzarides, T.
(1998). Retinoblastoma protein recruits histone deacetylase to repress transcription.
Nature 391, 597-601.

Bronner-Fraser, M. (1994). Neural crest cell formation and migration in the developing embryo.
Faseb J 8, 699-706.

Burke, A. C., Nelson, C. E., Morgan, B. A., and Tabin, C. (1995). Hox genes and the evolution
of vertebrate axial morphology. Development 121, 333-46.

Callaghan, D. A., Dong, L., Callaghan, S. M., Hou, Y. X., Dagnino, L., and Slack, R. S. (1999).
Neural precursor cells differentiating in the absence of Rb exhibit delayed terminal
mitosis and deregulated E2F 1 and 3 activity. Dev Biol 207, 257-70.

Chai, Y., Ito, Y., and Han, J. (2003). TGF-beta signaling and its functional significance in
regulating the fate of cranial neural crest cells. Crit Rev Oral Biol Med 14, 78-88.









Chalepakis, G., Fritsch, R., Fickenscher, H., Deutsch, U., Goulding, M., and Gruss, P. (1991).
The molecular basis of the undulated/Pax-1 mutation. Cell 66, 873-84.

Chen, F., Greer, J., and Capecchi, M. R. (1998). Analysis of Hoxa7/Hoxb7 mutants suggests
periodicity in the generation of the different sets of vertebrae. Mech Dev 77, 49-57.

Chen, L., and Deng, C. X. (2005). Roles of FGF signaling in skeletal development and human
genetic diseases. Front Biosci 10, 1961-76.

Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H., and Beachy, P. A.
(1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene
function. Nature 383, 407-13.

Christ, B., Huang, R., and Scaal, M. (2007). Amniote somite derivatives. Dev Dyn 236, 2382-96.

Christ, B., Huang, R., and Wilting, J. (2000). The development of the avian vertebral column.
Anat Embryol (Berl) 202, 179-94.

Cobrinik, D. (2005). Pocket proteins and cell cycle control. Oncogene 24, 2796-809.

Cobrinik, D., Lee, M. H., Hannon, G., Mulligan, G., Bronson, R. T., Dyson, N., Harlow, E.,
Beach, D., Weinberg, R. A., and Jacks, T. (1996). Shared role of the pRB-related p130
and p107 proteins in limb development. Genes Dev 10, 1633-44.

Cohn, M. J., and Tickle, C. (1996). Limbs: a model for pattern formation within the vertebrate
body plan. Trends Genet 12, 253-7.

Condorelli, G. L., Testa, U., Valtieri, M., Vitelli, L., De Luca, A., Barberi, T., Montesoro, E.,
Campisi, S., Giordano, A., and Peschle, C. (1995). Modulation of retinoblastoma gene in
normal adult hematopoiesis: peak expression and functional role in advanced erythroid
differentiation. Proc Natl Acad Sci U S A 92, 4808-12.

Conlon, R. A., Reaume, A. G., and Rossant, J. (1995). Notchl is required for the coordinate
segmentation of somites. Development 121, 1533-45.

Dailey, L., Laplantine, E., Priore, R., and Basilico, C. (2003). A network of transcriptional and
signaling events is activated by FGF to induce chondrocyte growth arrest and
differentiation. J Cell Biol 161, 1053-66.

De Falco, G., Comes, F., and Simone, C. (2006). pRb: master of differentiation. Coupling
irreversible cell cycle withdrawal with induction of muscle-specific transcription.
Oncogene 25, 5244-9.

Delehouzee, S., Yoshikawa, T., Sawa, C., Sawada, J., Ito, T., Omori, M., Wada, T., Yamaguchi,
Y., Kabe, Y., and Handa, H. (2005). GABP, HCF-1 and YY1 are involved in Rb gene
expression during myogenesis. Genes Cells 10, 717-31.









Dimova, D. K., and Dyson, N. J. (2005). The E2F transcriptional network: old acquaintances
with new faces. Oncogene 24, 2810-26.

Dong, Y., Drissi, H., Chen, M., Chen, D., Zuscik, M. J., Schwarz, E. M., and O'Keefe, R. J.
(2005). Wnt-mediated regulation of chondrocyte maturation: modulation by TGF-beta. J
Cell Biochem 95, 1057-68.

Donovan, S. L., Schweers, B., Martins, R., Johnson, D., and Dyer, M. A. (2006). Compensation
by tumor suppressor genes during retinal development in mice and humans. BMC Biol 4,
14.

Dyson, N. (1998). The regulation of E2F by pRB-family proteins. Genes Dev 12, 2245-62.

Egeblad, M., Shen, H. C., Behonick, D. J., Wilmes, L., Eichten, A., Korets, L. V., Kheradmand,
F., Werb, Z., and Coussens, L. M. (2007). Type I collagen is a genetic modifier of matrix
metalloproteinase 2 in murine skeletal development. Dev Dyn 236, 1683-93.

Fajas, L., Landsberg, R. L., Huss-Garcia, Y., Sardet, C., Lees, J. A., and Auwerx, J. (2002). E2Fs
regulate adipocyte differentiation. Dev Cell 3, 39-49.

Fantl, V., Stamp, G., Andrews, A., Rosewell, I., and Dickson, C. (1995). Mice lacking cyclin Dl
are small and show defects in eye and mammary gland development. Genes Dev 9, 2364-
72.

Favier, B., and Dolle, P. (1997). Developmental functions of mammalian Hox genes. Mol Hum
Reprod 3, 115-31.

Ferguson, C. M., Schwarz, E. M., Reynolds, P. R., Puzas, J. E., Rosier, R. N., and O'Keefe, R. J.
(2000). Smad2 and 3 mediate transforming growth factor-betal-induced inhibition of
chondrocyte maturation. Endocrinology 141, 4728-35.

Genovese, C., Trani, D., Caputi, M., and Claudio, P. P. (2006). Cell cycle control and beyond:
emerging roles for the retinoblastoma gene family. Oncogene 25, 5201-9.

Giacinti, C., and Giordano, A. (2006). RB and cell cycle progression. Oncogene 25, 5220-7.

Hall, B. K., and Miyake, T. (1992). The membranous skeleton: the role of cell condensations in
vertebrate skeletogenesis. Anat Embryol (Berl) 186, 107-24.

Howard, T. D., Paznekas, W. A., Green, E. D., Chiang, L. C., Ma, N., Ortiz de Luna, R. I.,
Garcia Delgado, C., Gonzalez-Ramos, M., Kline, A. D., and Jabs, E. W. (1997).
Mutations in TWIST, a basic helix-loop-helix transcription factor, in Saethre-Chotzen
syndrome. Nat Genet 15, 36-41.

Hrabe de Angelis, M., McIntyre, J., 2nd, and Gossler, A. (1997). Maintenance of somite borders
in mice requires the Delta homologue DIIl. Nature 386, 717-21.










Inada, M., Yasui, T., Nomura, S., Miyake, S., Deguchi, K., Himeno, M., Sato, M., Yamagiwa,
H., Kimura, T., Yasui, N., Ochi, T., Endo, N., Kitamura, Y., Kishimoto, T., and Komori,
T. (1999). Maturational disturbance of chondrocytes in Cbfal-deficient mice. Dev Dyn
214, 279-90.

Ionescu, A. M., Schwarz, E. M., Zuscik, M. J., Drissi, H., Puzas, J. E., Rosier, R. N., and
O'Keefe, R. J. (2003). ATF-2 cooperates with Smad3 to mediate TGF-beta effects on
chondrocyte maturation. Exp Cell Res 288, 198-207.

Jiang, Z., and Zacksenhaus, E. (2002). Coordinated expression of Rb gene family in the
mammary gland. Gene Expr Patterns 2, 35-8.

Karaplis, A. C., Luz, A., Glowacki, J., Bronson, R. T., Tybulewicz, V. L., Kronenberg, H. M.,
and Mulligan, R. C. (1994). Lethal skeletal dysplasia from targeted disruption of the
parathyroid hormone-related peptide gene. Genes Dev 8, 277-89.

Khan, I. M., Redman, S. N., Williams, R., Dowthwaite, G. P., Oldfield, S. F., and Archer, C. W.
(2007). The development of synovial joints. Curr Top Dev Biol 79, 1-36.

Kielty, C. M., Kwan, A. P., Holmes, D. F., Schor, S. L., and Grant, M. E. (1985). Type X
collagen, a product of hypertrophic chondrocytes. Biochem J 227, 545-54.

Kim, I. S., Otto, F., Zabel, B., and Mundlos, S. (1999). Regulation of chondrocyte differentiation
by Cbfal. Mech Dev 80, 159-70.

Kim, S. J., Wagner, S., Liu, F., O'Reilly, M. A., Robbins, P. D., and Green, M. R. (1992).
Retinoblastoma gene product activates expression of the human TGF-beta 2 gene through
transcription factor ATF-2. Nature 358, 331-4.

Kusumi, K., Sun, E. S., Kerrebrock, A. W., Bronson, R. T., Chi, D. C., Bulotsky, M. S., Spencer,
J. B., Birren, B. W., Frankel, W. N., and Lander, E. S. (1998). The mouse pudgy
mutation disrupts Delta homologue D113 and initiation of early somite boundaries. Nat
Genet 19, 274-8.

Lang, D., Powell, S. K., Plummer, R. S., Young, K. P., and Ruggeri, B. A. (2007). PAX genes:
roles in development, pathophysiology, and cancer. Biochem Pharmacol 73, 1-14.

Lanske, B., Karaplis, A. C., Lee, K., Luz, A., Vortkamp, A., Pirro, A., Karperien, M., Defize, L.
H., Ho, C., Mulligan, R. C., Abou-Samra, A. B., Juppner, H., Segre, G. V., and
Kronenberg, H. M. (1996). PTH/PTHrP receptor in early development and Indian
hedgehog-regulated bone growth. Science 273, 663-6.

Laplantine, E., Rossi, F., Sahni, M., Basilico, C., and Cobrinik, D. (2002). FGF signaling targets
the pRb-related p107 and p130 proteins to induce chondrocyte growth arrest. J Cell Biol
158, 741-50.










Lee, C., and Cho, Y. (2002). Interactions of SV40 large T antigen and other viral proteins with
retinoblastoma tumour suppressor. Rev Med Virol 12, 81-92.

Lee, M. H., Williams, B. O., Mulligan, G., Mukai, S., Bronson, R. T., Dyson, N., Harlow, E.,
and Jacks, T. (1996). Targeted disruption of pl07: functional overlap between p107 and
Rb. Genes Dev 10, 1621-32.

Lefebvre, V., and de Crombrugghe, B. (1998). Toward understanding SOX9 function in
chondrocyte differentiation. Matrix Biol 16, 529-40.

Lefebvre, V., Garofalo, S., Zhou, G., Metsaranta, M., Vuorio, E., and De Crombrugghe, B.
(1994). Characterization of primary cultures of chondrocytes from type II collagen/beta-
galactosidase transgenic mice. Matrix Biol 14, 329-35.

Letra, A., Silva, R. A., Menezes, R., Astolfi, C. M., Shinohara, A., de Souza, A. P., and
Granjeiro, J. M. (2007). MMP gene polymorphisms as contributors for cleft lip/palate:
association with MMP3 but not MMP1. Arch Oral Biol 52, 954-60.

Li, T. F., Chen, D., Wu, Q., Chen, M., Sheu, T. J., Schwarz, E. M., Drissi, H., Zuscik, M., and
O'Keefe, R. J. (2006). Transforming growth factor-beta stimulates cyclin Dl expression
through activation of beta-catenin signaling in chondrocytes. J Biol Chem 281, 21296-
304.

Lipinski, M. M., and Jacks, T. (1999). The retinoblastoma gene family in differentiation and
development. Oncogene 18, 7873-82.

Luvalle, P., Ma, Q., and Beier, F. (2003). The role of activating transcription factor-2 in skeletal
growth control. J Bone Joint Surg Am 85-A Suppl 2, 133-6.

Ma, Q., Li, X., Vale-Cruz, D., Brown, M. L., Beier, F., and LuValle, P. (2007). Activating
transcription factor 2 controls Bcl-2 promoter activity in growth plate chondrocytes. J
Cell Biochem 101, 477-87.

Macaluso, M., Montanari, M., Cinti, C., and Giordano, A. (2005). Modulation of cell cycle
components by epigenetic and genetic events. Semin Oncol 32, 452-7.

Macaluso, M., Montanari, M., and Giordano, A. (2006). Rb family proteins as modulators of
gene expression and new aspects regarding the interaction with chromatin remodeling
enzymes. Oncogene 25, 5263-7.

Maekawa, T., Bernier, F., Sato, M., Nomura, S., Singh, M., Inoue, Y., Tokunaga, T., Imai, H.,
Yokoyama, M., Reimold, A., Glimcher, L. H., and Ishii, S. (1999). Mouse ATF-2 null
mutants display features of a severe type of meconium aspiration syndrome. J Biol Chem
274, 17813-9.









Markey, M. P., Angus, S. P., Strobeck, M. W., Williams, S. L., Gunawardena, R. W., Aronow,
B. J., and Knudsen, E. S. (2002). Unbiased analysis of RB-mediated transcriptional
repression identifies novel targets and distinctions from E2F action. Cancer Res 62, 6587-
97.

Monsoro-Burq, A. H. (2005). Sclerotome development and morphogenesis: when experimental
embryology meets genetics. Int J Dev Biol 49, 301-8.

Mulligan, G. J., Wong, J., and Jacks, T. (1998). p130 is dispensable in peripheral T lymphocytes:
evidence for functional compensation by p107 and pRB. Mol Cell Biol 18, 206-20.

Murtaugh, L. C., Chyung, J. H., and Lassar, A. B. (1999). Sonic hedgehog promotes somitic
chondrogenesis by altering the cellular response to BMP signaling. Genes Dev 13, 225-
37.
Nevins, J. R. (1998). Toward an understanding of the functional complexity of the E2F and
retinoblastoma families. Cell Growth Differ 9, 585-93.

Nevins, J. R., Leone, G., DeGregori, J., and Jakoi, L. (1997). Role of the Rb/E2F pathway in cell
growth control. J Cell Physiol 173, 233-6.

Ng, J. K., Tamura, K., Buscher, D., and Izpisua-Belmonte, J. C. (1999). Molecular and cellular
basis of pattern formation during vertebrate limb development. Curr Top Dev Biol 41,
37-66.

Nie, X., Luukko, K., and Kettunen, P. (2006). FGF signalling in craniofacial development and
developmental disorders. Oral Dis 12, 102-11.

Ovchinnikov, D. A., Deng, J. M., Ogunrinu, G., and Behringer, R. R. (2000). Col2al-directed
expression of Cre recombinase in differentiating chondrocytes in transgenic mice.
Genesis 26, 145-6.

Palmeirim, I., Henrique, D., Ish-Horowicz, D., and Pourquie, O. (1997). Avian hairy gene
expression identifies a molecular clock linked to vertebrate segmentation and
somitogenesis. Cell 91, 639-48.

Pateder, D. B., Rosier, R. N., Schwarz, E. M., Reynolds, P. R., Puzas, J. E., D'Souza, M., and
O'Keefe, R. J. (2000). PTHrP expression in chondrocytes, regulation by TGF-beta, and
interactions between epiphyseal and growth plate chondrocytes. Exp Cell Res 256, 555-
62.

Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Res 29, e45.

Phornphutkul, C., Wu, K. Y., and Gruppuso, P. A. (2006). The role of insulin in chondrogenesis.
Mol Cell Endocrinol 249, 107-15.









Rampalli, A. M., Gao, C. Y., Chauthaiwale, V. M., and Zelenka, P. S. (1998). pRb and p107
regulate E2F activity during lens fiber cell differentiation. Oncogene 16, 399-408.

Reichenberger, E., Aigner, T., von der Mark, K., Stoss, H., and Bertling, W. (1991). In situ
hybridization studies on the expression of type X collagen in fetal human cartilage. Dev
Biol 148, 562-72.

Reimold, A. M., Grusby, M. J., Kosaras, B., Fries, J. W., Mori, R., Maniwa, S., Clauss, I. M.,
Collins, T., Sidman, R. L., Glimcher, M. J., and Glimcher, L. H. (1996).
Chondrodysplasia and neurological abnormalities in ATF-2-deficient mice. Nature 379,
262-5.

Ripamonti, U. (2005). Bone induction by recombinant human osteogenic protein-1 (hOP-1,
BMP-7) in the primate Papio ursinus with expression of mRNA of gene products of the
TGF-beta superfamily. J Cell Mol Med 9, 911-28.

Robert, B., and Lallemand, Y. (2006). Anteroposterior patterning in the limb and digit
specification: contribution of mouse genetics. Dev Dyn 235, 2337-52.

Rosen, V. (2006). BMP and BMP inhibitors in bone. Ann N Y Acad Sci 1068, 19-25.

Rossi, F., MacLean, H. E., Yuan, W., Francis, R. O., Semenova, E., Lin, C. S., Kronenberg, H.
M., and Cobrinik, D. (2002). p107 and p130 Coordinately regulate proliferation, Cbfal
expression, and hypertrophic differentiation during endochondral bone development. Dev
Biol 247, 271-85.

Scheijen, B., Bronk, M., van der Meer, T., and Bernards, R. (2003). Constitutive E2F1
overexpression delays endochondral bone formation by inhibiting chondrocyte
differentiation. Mol Cell Biol 23, 3656-68.

Scott-Savage, P., and Hall, B. K. (1980). Differentiative ability of the tibial periosteum for the
embryonic chick. Acta Anat (Basel) 106, 129-40.

Sekiya, I., Tsuji, K., Koopman, P., Watanabe, H., Yamada, Y., Shinomiya, K., Nifuji, A., and
Noda, M. (2000). SOX9 enhances aggrecan gene promoter/enhancer activity and is up-
regulated by retinoic acid in a cartilage-derived cell line, TC6. J Biol Chem 275, 10738-
44.

Shukunami, C., Shigeno, C., Atsumi, T., Ishizeki, K., Suzuki, F., and Hiraki, Y. (1996).
Chondrogenic differentiation of clonal mouse embryonic cell line ATDC5 in vitro:
differentiation-dependent gene expression of parathyroid hormone (PTH)/PTH-related
peptide receptor. J Cell Biol 133, 457-68.

Shum, L., Coleman, C. M., Hatakeyama, Y., and Tuan, R. S. (2003). Morphogenesis and
dysmorphogenesis of the appendicular skeleton. Birth Defects Res C Embryo Today 69,
102-22.










Sicinski, P., Donaher, J. L., Parker, S. B., Li, T., Fazeli, A., Gardner, H., Haslam, S. Z., Bronson,
R. T., Elledge, S. J., and Weinberg, R. A. (1995). Cyclin Dl provides a link between
development and oncogenesis in the retina and breast. Cell 82, 621-30.

Stiegler, P., De Luca, A., Bagella, L., and Giordano, A. (1998). The COOH-terminal region of
pRb2/pl30 binds to histone deacetylase 1 (HDAC1), enhancing transcriptional repression
of the E2F-dependent cyclin A promoter. Cancer Res 58, 5049-52.

St-Jacques, B., Hammerschmidt, M., and McMahon, A. P. (1999). Indian hedgehog signaling
regulates proliferation and differentiation of chondrocytes and is essential for bone
formation. Genes Dev 13, 2072-86.

Takeda, S., Bonnamy, J. P., Owen, M. J., Ducy, P., and Karsenty, G. (2001). Continuous
expression of Cbfal in nonhypertrophic chondrocytes uncovers its ability to induce
hypertrophic chondrocyte differentiation and partially rescues Cbfal-deficient mice.
Genes Dev 15, 467-81.

Thomas, D. M., Carty, S. A., Piscopo, D. M., Lee, J. S., Wang, W. F., Forrester, W. C., and
Hinds, P. W. (2001). The retinoblastoma protein acts as a transcriptional coactivator
required for osteogenic differentiation. Mol Cell 8, 303-16.

Tuan, R. S. (2004). Biology of developmental and regenerative skeletogenesis. Clin Orthop Relat
Res, S105-17.

Ueta, C., Iwamoto, M., Kanatani, N., Yoshida, C., Liu, Y., Enomoto-Iwamoto, M., Ohmori, T.,
Enomoto, H., Nakata, K., Takada, K., Kurisu, K., and Komori, T. (2001). Skeletal
malformations caused by overexpression of Cbfal or its dominant negative form in
chondrocytes. J Cell Biol 153, 87-100.

Vooijs, M., and Berns, A. (1999). Developmental defects and tumor predisposition in Rb mutant
mice. Oncogene 18, 5293-303.

Vooijs, M., van der Valk, M., te Riele, H., and Berns, A. (1998). Flp-mediated tissue-specific
inactivation of the retinoblastoma tumor suppressor gene in the mouse. Oncogene 17, 1-
12.

Vortkamp, A., Lee, K., Lanske, B., Segre, G. V., Kronenberg, H. M., and Tabin, C. J. (1996).
Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related
protein. Science 273, 613-22.

Walsh, K. (1997). Coordinate regulation of cell cycle and apoptosis during myogenesis. Prog
Cell Cycle Res 3, 53-8.

Weinberg, R. A. (1995). The retinoblastoma protein and cell cycle control. Cell 81, 323-30.









Weir, E. C., Philbrick, W. M., Amling, M., Neff, L. A., Baron, R., and Broadus, A. E. (1996).
Targeted overexpression of parathyroid hormone-related peptide in chondrocytes causes
chondrodysplasia and delayed endochondral bone formation. Proc Natl Acad Sci U S A
93, 10240-5.

Wilm, B., Dahl, E., Peters, H., Balling, R., and Imai, K. (1998). Targeted disruption of Paxl
defines its null phenotype and proves haploinsufficiency. Proc Natl Acad Sci U S A 95,
8692-7.

Zacksenhaus, E., Gill, R. M., Phillips, R. A., and Gallie, B. L. (1993). Molecular cloning and
characterization of the mouse RB 1 promoter. Oncogene 8, 2343-51.

Zakany, J., Gerard, M., Favier, B., and Duboule, D. (1997). Deletion of a HoxD enhancer
induces transcriptional heterochrony leading to transposition of the sacrum. Embo J 16,
4393-402.
Zhang, N., and Gridley, T. (1998). Defects in somite formation in lunatic fringe-deficient mice.
Nature 394, 374-7.









BIOGRAPHICAL SKETCH

Dustin Shawn Vale-Cruz was born in Providence, Rhode Island, to Lani Vale-Cruz and

Daniel Miguel Jr. He attended Bishop Hendricken High School in Warwick, RI. He received a

Bachelor of Science degreein animal science from the University of Rhode Island where he met

his wife, Kristi. After graduation, he enrolled in graduate school at the University of Florida

(UF) in the department of Animal Science. He received his Masters of Science degree in animal

science in 2001. He worked for 2 years prior to returning to the UF to pursue his doctoral degree

in the Interdisciplinary Program for Biomedical Research in 2003. In summer 2004, he joined

the Anatomy and Cell Biology Department under the supervision of Dr. Phyllis LuValle. In

2005, Dustin and Kristi celebrated the birth of their daughter, Avery Ilene.





PAGE 1

1 ROLE OF ACTIVATING TRANSCRIPTION FACTOR 2 IN CONTROL OF POCKET PROTEIN EXPRESSION AND REGULATION OF CHONDROCYTE GROWTH By DUSTIN SHAWN VALE CRUZ A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 To my wife, Kristi, for her unconditional love and support.

PAGE 3

3 2008 Dustin Shawn Vale Cruz

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor Phyllis Luvalle. Since I started working with Phyllis she has respected and fostered my independence as a scientist. She has always kept my best interests in mind. I would also like to thank my superviso ry committee for providing valuable insight, positive feedback, and considerable guidance. The faculty and staff of the Anatomy and Cell Biology department deserve acknowledgement for providing insight into technical concerns and for offering assistance. I am grateful to all the members of the Open Lab, past and present, for exchanging ideas and offering constructive criticism. Finally, and most importantly, I would like to thank my wife Kristi for all she has sacrificed in order for me to pursue my goal s. She has constantly made my education and career goals a priority. Her constant love and support inspired me to continue pursuing my goals even seemingly insurmountable hardships. I offer my deepest appreciation for all she has given to me and our fam ily.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...4 LIST OF FIGURES.....6 ABSTRACT.7 CHAPTER 1 INTRODUCTION...9 Skeletal Develop ment....10 Skeletal Bone Growth....13 Role of Activating Transcription Factor 2 (ATF 2) in Skeletal Bone Growth.....15 Pocket Proteins and Cell Cycle Control.............................................. ...............................18 2 ACTIVATING TRANSCRIPTION FACTOR 2 AFFECTS SKELETAL GROWTH BY MODULATING PRB GENE EXPRESSION...21 Introduction............21 Materials and Methods............ ...........24 Results........................28 Discussion..........34 3 CONDITIONAL DELETION OF RETINOBLASTOMA IN CHONDROCYTES.........50 Introduction................................................... .....................................................................50 Materials and Methods.......53 Results........55 Discussion......................59 4 CONCLUSIONS......... ......................................................................................................68 Overview of Findings........................................................................................................68 Questions and Future St udies............................................................................................69 LIST OF REFERENCES...72 BIOGRAPHICAL SKETCH.81

PAGE 6

6 LIST OF FIGURES Figure page 2 1. Immunohistochemical localization of pocket proteins in newborn growth plates ............ 38 2 2. Immunolocalization of pocket proteins in 1 week old growth plates .............................. 39 2 3. Immunohistochemical localization of pocket proteins in 3 wee k old growth plates. ....... 40 2 4. Expression of pocket proteins is altered in response to ATF 2 mutation. ........................ 41 2 5. Levels of pRb mRNA are reduced in ATF 2 mutant chondrocytes as opposed to wild type ................................ ................................ ................................ ................................ 42 2 6. Expression of pRb mRNA is increased coincident with c hondrgenic differentiation ....... 43 2 7. Cell cycle analysis of ATDC5 undergoing chondrogenic differentiation ........................ 45 2 8. Type X collagen immunostaining in wild type (+/+) and ATF 2 mutant (m/m) hypertrophic chondrocytes ................................ ................................ ............................. 46 2 9. Immunostainingfor Ki67 in wild type (+/+) and ATF 2 mutant (m/m) animals .............. 48 2 10. Incorporation of BrdU in wild type (+/+) and ATF 2 mutant (m/m) primary chondrocytes ................................ ................................ ................................ .................. 49 3 1. Comparison of normal and condtional mutant animals ................................ ................... 62 3 2. Skeletal staining of newborn wild type and pRb conditional deletion mutants ................ 63 3 3. Skeletal staining of 1 week old pRb conditional knockout and wild type mice ............... 64 3 4. Histological examination of tibial growth plates of wild type and conditional mutants ................................ ................................ ................................ .......................... 65 3 5. Von Kossa staining of growth plate of wild type an d conditional mutants ...................... 66 3 6. Immunolocalization of proliferation markers Ki67 and PCNA in wild type and pRb conditional mutants. ................................ ................................ ................................ ....... 67

PAGE 7

7 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF ACTIVATING TRANSCRIPTION FACTOR 2 IN CONTROL OF POCKET PROTE IN EXPRESSION AND REGULATION OF CHONDROCYTE GROWTH By Dustin Shawn Vale Cruz May 2008 Chair: Phyllis LuValle Major: Medical Sciences Molecular Cell Biology Endochondral ossification is the process of skeletal bone growth through the formation of a cart ilage template that subsequently undergoes mineralization to form trabecular bone. Genetic mutations affecting the proliferation or differentiation of chondrocytes results in skeletal abnormalities. Activating transcription factor 2 (ATF 2) modulates ex pression of cell cycle regulatory genes in chondrocytes, and mutation of ATF 2 results in a dwarfed phenotype. The overall aim of these studies was to further examine the role ATF 2 plays in cell cycle progression. Previous data had identified sites of ATF 2 binding located in promoters of the pocket protein family of cell cycle regulators. Initial studies indicated changes in pocket protein expression in response to loss of ATF 2 function. Mutation of ATF 2 lead to reduced expression of retinoblastoma (pRb), a member of the pocket protein family. pRb regulates cell cycle progression and influences cellular proliferation and terminal differentiation. Using an in vitro chondrogenesis model, we observed that pRb influenced cell cycle exit and differenti ation. Transgenic mice expressing a conditional truncation of pRb in chondrocytes were produced to further delineate the role of pRb in endochondral development. Although no gross skeletal abnormalities were observed conditional mutants displayed reduced s ize at birth. The

PAGE 8

8 observed size difference was overcome with age. Histological examination of the growth plate demonstrated changes in growth plate architecture of neonates in response to pRb mutation. Growth plates of older animals were re organized ind icating the observed alterations in growth plate structure were transient. Immunohistchemical localization of proliferative markers indicated that pRb conditional deletion allowed prolonged chondrocyte proliferation in newborn mice. These studies suggest that pRb may influence chondrocyte proliferation and differentiation, but its role is largely insignificant in overall endochodral development.

PAGE 9

9 CHAPTER 1 INTRODUCTION The vertebrate skeleton is comprised of cartilage and bone and serves three distinct functions. First, the skeleton serves as the framework for the body, and provides support and protection for the int ernal organs. Second, the skeleton is a storage center for vitamins and minerals. Bone is a depot for calcium and phosphorous utilized by the body. Third, the skeleton is the center for production of blood cells from the bone marrow. Both white and red blood cells are produced within the bone marrow cavities of the skeleton, giving the skeleton an added function in aiding immune response. The skeleton is the product of different embryonic cell lineages. Cells from distinct lineages form high density mesenchymal condensations at sites specific for skeletal elements. The condensed mesenchyme then undergoes differentiation to chondrocytes and osteoblasts ( Hall and Miyake, 1992 ). Two distinct processes control further skeletal growth: intramembranous and endochondral ossification. The bones of the skull are formed through intramembranous ossification, while the long bones comprising much of the appendicular skeleton develop through the process of endochondral ossification. Most of what we know rega rding skeletal growth and development is the result of observations of human bone disorders and experimental animal studies. Correlation between the function of genes and specific embryological events has been determined through the use of transgenic and k nockout animals. Genetic studies of inherited disorders involving bone and cartilage have identified novel genes and pathways and furthered our knowledge of the underlying molecular mechanisms of skeletal development and growth. Given the number of i nherited genetic disorders implicated in skeletal growth, this dissertation seeks to elucidate further the molecular mechanisms involved in activating

PAGE 10

10 transcription factor 2 (ATF 2) regulation of bone growth. Moreover, these studies seek to identify genes important in bone growth that are altered in response to loss of ATF 2 function and further characterize their function in bone growth. Skeletal Development Morphogenesis of the skeleton is the result of cell migrations from sites of embryonic origin to locations of specific skeletal elements and condensation into the mesenchymal precursors of cartilage and bone. Different portions of the skeleton are derived from distinct embryonic cell lineages. Genes that control morphogenesis largely encode for tran scription factors that control cellular fate decisions and migration events. The craniofacial skeleton is derived from the cranial neural crest, and is comprised of the bones of the skull and face. The majority of the bone of the face and skull are of n eural crest origin (Bronner Fraser, 1994). These cells migrate from the dorsal aspect of the neural tube to the frontonasal mass forming cartilage and bone tissue. Cranial neural crest commitment to skeletal fate is controlled through interactions with t he overlying epithelium. Epithelial cells produce cytokine based signals that stimulate signaling pathways and expression of various transcription factors within the mesenchyme. As a result of the activated state of the mesenchyme, factors are secreted t hat in turn control the proliferation and differentiation of the overlying epithelium. A multitude of genes are therefore vital for craniofacial development. These include genes that encode for transcription factors, cytokines, growth factors, and prote olytic enzymes. Transcription factors important for development include: homeobox containing transcription factors such as Msx1 and Hoxa1 (for review see Alappat et al., 2003), polycomb group genes, basic helix loop helix factors such as Twist (Howard et al., 1997), and PAX genes encoding

PAGE 11

11 paired box containing transcription factors (for review see Lang et al., 2007). Bone morphogenic proteins (BMPs) (Ripamonti et al., 2005), the transforming growth factor (TGF ) family (Chai et al., 2003), and fibrobl ast growth factors (FGFs) (Chen and Deng, 2005; Nie et al., 2006) are important cytokines and growth factors implicated in craniofacial development Extracellular matrix degrading enzymes such as the matrix metalloproteases (MMPs) and their inherent inhi bitors (tissue inhibitor of metalloprotease, TIMPs) are essential in normal craniofacial development (Letra et al., 2007; Egeblad et al., 2007). Genetic defects or mutations in these or other related factors produce developmental disorders of the skull an d face such as craniosynostosis (premature closure of skull sutures), cleft palate, lack of teeth, and mandible defects. Alterations in signaling, including BMPs, TGFs, FGFs sonic hedgehog (Shh) among others, disrupt normal development and lead to anomali es. Furthermore, the communication between the overlying epithelium and mesenchyme is critical in formation and patterning of structures such as teeth. Clearly, the processes that govern craniofacial development are complex and rely heavily on patterning and cell fate determination to insure normal development. Paraxial mesoderm tissue is the embryonic precursor to the axial skeleton, which consists of the vertebral column and the dorsal portion of the rib cage. Somites are formed following segmentati on of the paraxial mesoderm that subsequently differentiates into sclerotomes (for review see Monsoro Burq, 2005 ). Somitic derived tissues also include the dermis of the skin and skeletal muscle of the body wall and limbs (for review see Christ et al., 200 7). Genes that control the segmentation of the paraxial mesoderm largely influence somitic development. Somite formation occurs bilaterally in a rostro caudal timed sequence. Expression of hairy 1 (Palmeirim et al., 1997) modulates Notch signaling by re gulating expression of lunatic fringe

PAGE 12

12 The importance of Notch signaling in somite development is evident in the numerous mouse knockouts that affect the pathway. Knockouts of Notch1 (Conlon et al., 1995) and other modulators of Notch signaling includi ng Delta like1 ( DllI ) ( Hrabe de Angelis et al., 1997 ), Dll3 (Kusumi et al., 1998), and lunatic fringe (Zhang and Gridley, 1998) display abnormal somite phenotypes resulting in vertebral and rib defects. Differentiation of cells within the somite is nece ssary for formation of sclerotomes and further development of skeletal elements. These signals induce epithelial mesenchymal transformation and proliferation of somatic cells and their migration to form the sclerotomes. The sclerotome arises from the ven tral portion of the somites and gives rise to the cartilage of the vertebral body and the dorsolateral portion of the ribs (Christ et al., 2000). Shh signaling, originating from the notochord and floorplate of the neural tube is vital for sclerotome forma tion as Shh null embryos are devoid of vertebrae and the dorsolateral portion of the ribs (Chiang et al., 1996). Shh signaling conditons sclerotomal cells to be competent for responding to BMP actions and subsequent differentiation into chondrocytes (Murt augh et al., 1999). Pax genes 1 and 9, specific to the cells of sclerotome, are induced by Shh signaling. Pax 1 mutants display skeletal defects in the vertebral column, scapula, and sternum (Chalepakis et al., 1991; Wilm et al., 1998). Anterior to po sterior patterning of the axial skeleton is controlled by expression of homeotic ( Hox ) genes. These genes control the identification of individual vertebrae through an overlapping expression domain along the vertebral column (Burke et al., 1995; Favier an d Dolle, 1997). Disruptions in Hox gene expression patterns result in the loss or addition of vertebral elements or alterations into shapes resembling other skeletal elements (Zakany et al., 1997; Chen et al., 1998).

PAGE 13

13 Skeletal tissues of the limb are deri ved from lateral plate mesoderm (Cohn and Tickle, 1996). Other tissues such as nerves, muscles, and blood vessels are derived from the developing somites and migrate into the limb buds. Interactions between the developing mesenchyme and overlying epithel ium control the patterning and shaping of the limb (Ng et al., 1999). Limb outgrowth is controlled by FGF signaling originating from specialized epithelium covering the limb bud composing the apical ectodermal ridge (AER). Patterning of the limb is furt her accomplished through the actions of Shh and Wnt7a signaling and expression of transcription factors such as LIM homeodomain protein (Lmx1b) and engrailed (for review see Robert and Lallemand, 2006). The cartilage anlagen are formed in a proximal to di stal sequence coincident with the development of the limb bud. The more proximal bones such as the femur and humerus are formed first, while the phalanges and metatarsals are formed last. The cartilage is formed as continuous rods through a series of div isions and segmentations that give rise to the limb skeleton (for review see Tuan, 2004). BMP signaling, segmentation and eventual apoptosis are vital for the formation of the joints (for review see Rosen, 2006 and Khan et al., 2007). Disruptions in t he genetic or signaling mechanisms that control limb bud outgrowth or patterning are manifested in various ways. Shortening of the bones of the fingers and toes (brachydactylies) and the absence or fusion of joints have been shown to be the result of disr uptions of normal BMP signaling. Disruptions in Shh signaling are manifested as the occurrence of extra digits (polydactyly) or the fusion of digits (syndactyly), among others. Skeletal Bone Growth The bones of the skeleton are mineralized in various mo des depending on the type of bone being formed. Intramembranous ossification is manifested via mesenchymal cell differentiation into osteoblasts and bone, formed in the absence of a cartilage precursor. The flat

PAGE 14

14 bones of the skull, face and scapula are m ineralized through the process of intramembranous ossification. Perichondral ossification is the most common form of ossification which utilizes a cartilage precursor. Perichondral ossification starts with the transformation of the perichondrium into the periosteum (Scott Savage and Hall, 1980). Endochondral ossification is the primary mode of mineralization within the long bones of the skeleton. The process of endochondral ossification involves a cartilaginous template that is replaced by bone matrix. The overall process of endochondral ossification involves the tightly regulated coordination of chondrocyte proliferation, differentiation into hypertrophic chondrocytes, apoptosis and ultimately calcification of the remaining cartilage matrix. Mesench ymal progenitor cells follow the chondrocyte lineage following condensation. Chondrocytes within the resting zone of the growth plate are arrested in the cell cycle forming a suppository of cells necessary for proliferation. Resting zone chondrocytes are stimulated to initiate proliferation through multiple signaling cascades. Chondrocytes are stimulated to proliferate and become organized in a columnar fashion. These chondrocytes also begin the production of type II collagen. Later, chondrocytes cease proliferating and begin differentiation to pre hypertrophic chondrocytes, which undergo further increases in cellular volume to become hypertrophic chondrocytes which initiate the production of type X collagen. The post mitotic, terminally differentiated hypertrophic chondrocytes then undergo apoptosis, leaving behind the calcified cartilage matrix. Osteoblasts are then recruited to begin deposition of bony matrix over the mineralized cartilage residue. Several factors are critical in allowing normal l ongitudinal bone growth. Both the proliferation of chondrocytes and expanse of cellular volume are essential factors in skeletal growth. The proliferation of chondrocytes is a critical step in providing an adequate number of

PAGE 15

15 cells for growth. The increas e in cellular volume established during hypertrophy also contributes to the longitudinal lengthening of the bone. Genetic disruption of normal chondrocyte proliferation results in appendicular skeletal abnormalities (for review see Shum et al., 2003). Mu tations affecting chondrocyte differentiation and subsequent hypertrophy results in skeletal malformations. Role of ATF 2 in Skeletal Bone Growth Activating transcription factor (ATF) 2 is a basic helix loop helix DNA binding protein that belongs to the ATF/CREB family of transcription factors. Members of the ATF/CREB family regulate transcription of target genes through interactions with cyclic AMP response elements (CREs) located within target gene promoters. Members of the ATF/CREB family can form h omo or hetero dimers that modulate transcription of regulated genes. The importance of ATF 2 in skeletal growth was demonstrated by the production of transgenic mouse mutants. Two independent groups produced ATF 2 mutations that had severe phenotypes. Maekawa et al. (1999) produced ATF 2 null mice through gene targeting. These mice displayed perinatal lethality due to severe respiratory distress similar to meconium aspiration syndrome. Reimold et al. (1996) first described the phenotype of ATF 2 muta nt animals harboring a gene disruption created by the introduction of an antibiotic resistance cassette resulting in the truncation of ATF 2 protein expression. In this case, ATF 2 mutants displayed ataxia, hyperactivity and diminished hearing. ATF 2 mut ant mice also displayed a disruption in endochondral ossification at the epiphyseal growth plate similar to human hypochondrodysplasia and achondrodysplasia. Within the developing bone, ATF 2 mRNA is expressed within the resting and proliferating zones su ggesting a potential role in regulating chondrocyte proliferation. Indeed,

PAGE 16

16 chondrocyte proliferation was decreased in ATF 2 mutant animals assayed by incorporation of [ 3 H] thymidine (Reimold et al., 1996). Chondrocyte proliferation is stimulated by pa rathyroid hormone related peptide (PTHrP) and TGF signaling (Beier et al., 2001). PTHrP signaling is mediated through binding of the PTHrP ligand to its putative receptor. During endochondral development PTHrP is expressed in the perichondrium, while the PTHrP receptor is expressed at low levels by proliferating chondrocytes and at higher levels in pre hypertrophic chondrocytes (Lanske et al., 1996; Vortkamp et al., 1996). Genetic ablation of PTHrP results in animals that exhibit perinatal lethality a nd severe abnormalities in bones that form during endochondral ossification including shortening of the snout, mandible, and limbs (Karaplis et al., 1994). Shortening of the bones results from premature transition of proliferative chondrocytes to hypertr ophic chondrocytes. Interestingly, when PTHrP is overexpressed in chondrocytes animals are born with shoirtened limbs due to decreased mineralization and delayed maturation of chondrocytes (Weir et al., 1996). These data illustrate the importance of PTHr P signaling in the endochondral process, and further underscore the necessity for the organization and control of chondrocyte proliferation, differentiation and apoptotic cell death in bone elongation. PTHrP is a mediator of Ihh activity within the growt h plate. Ihh is expressed in the maturation region between proliferative and hypertrophic regions of the growth plate. Ihh inhibits chondrocyte differentiation by inducing expression of PTHrP (Lanske et al., 1996; Vortkamp et al., 1996). Deletion of Ihh results in the loss of PTHrP mRNA expression and a predominance of hypertrophic chondrocytes coupled with a decrease in chondrocyte proliferation ( St Jacques et al., 1999 ). A negative feedback loop is then established where Ihh maintains chondrocyte prol iferation through the induction of PTHrP expression which in turn delays Ihh

PAGE 17

17 production. Again, the delicate balance between chondrocyte proliferation and differentiation is evident in the intricacies of the PTHrP/Ihh negative feedback loop. TGF and PTHrP regulate the proliferation of growth plate chondrocytes by modulating cyclin D1 expression (Beier et al., 2001). Cyclin D1 regulates cellular proliferation by regulating cell cycle progression through its interaction with cyclin dependent kinases (C DKs). The cyclin CDK complex is then activated and phosphorylates cell cycle regulatory proteins such as retinoblastoma (pRb). The role of cyclin D1 in chondrocyte proliferation is evident in the skeletal phenotype exhibited in cyclin D1 mutant mice ( Fan tl et al., 1995; Sicinski et al., 1995 ). ATF 2 has been shown to regulate cyclin D1 promoter activity and expression (Beier et al., 1999). Cyclin D1 expression is necessary to drive cell cycle progression through the modification of cell cycle inhibito rs. Proliferation of chondrocytes is altered in response to ATF 2 loss due to lack of cyclin D1 expression and subsequent inability of cyclin D1 CDK complexes to phosphorylate and inactivate cell cycle regulator proteins. Inactivation of cell cycle inhib itors is paramount in cell cycle progression and ultimately cell proliferation. This may account for the reduction in chondrocyte proliferation observed in ATF 2 mutant animals (Reimold et al., 1996). Chondrocyte proliferation is also stimulated by TGF treatment (Beier et al., 2001; Ferguson et al., 2000; Pateder et al., 2000; Ionescu et al., 2003; Dong et al., 2005) by induction of cyclin D1 expression through catenin signaling (Li et al., 2006). ATF 2 has the ability to regulate cell cycle progres sion by modulating expression of target genes important for cell cycle progression. Loss of ATF 2 would influence cell cycle progression through the reduction of cell cycle inhibitor expression (Luvalle et al., 2003) or by limiting the expression of genes necessary for inactivation of cell cycle inhibitors, resulting in reduced proliferation due to sequestration of transcription factors necessary for cell cycle progression (Beier et al., 1999). The skeletal

PAGE 18

18 phenotype observed in ATF 2 mutant animals is l ikely indicative of the importance of ATF 2 signaling. However, the number of potentially regulated genes involved in skeletal growth suggests that the observed phenotype is likely the result of numerous disruptions in normal skeletal development. Pocket Proteins and Cell Cycle Control The retinoblastoma family of proteins consists of pRb as well as the closely related p107 and p130 proteins. These proteins function as cell cycle regulators through the binding of E2F transcription factors and modulatin g transcription of S phase related genes. The proteins share significant similarities within the protein domains that comprise the "pocket region" consisting of two A and B boxes. pRb shares little similarity with p107/p130 outside of the pocket domain, while p107 and p130 share a highly conserved spacer region residing between the two A and B boxes. The pocket region is critical for binding and regulation of E2F transcription factors (for review see Nevins et al., 1997). Studies have demonstrated th e cell cycle regulatory function of the pocket proteins by inducing G1 phase growth arrest following over expression of all three proteins (Dyson, 1998). It has been shown that pRb regulates the G1 to S phase transition of the cell cycle by blocking S pha se entry, promoting terminal differentiation (Weinberg et al., 1995). The interactions between E2F and the pocket proteins play a central role in cell cycle progression and DNA replication by regulating expression of E2F responsive genes (Macaluso et al., 2005). p107 and p130 also regulate cell cycle progression through interactions with cyclin A/cdk2 and cyclin E cdk2 complexes (Mulligan and Jacks, 1998). Viral oncoproteins allow unregulated cell cycle progression by displacing cellular proteins such a s E2Fs ( for review see Lee and Cho, 2002 ). E2Fs regulate the timing and expression of many genes important for cell cycle regulation and

PAGE 19

19 progression such as cyclins A, E and D1, and cdk2 (for review see Nevins, 1998). The pocket proteins show preferentia l binding for specific E2Fs with pRb able to bind to E2F1 5, while p107/p130 interact with E2F 4 and 5 (for review see Dimova nd Dyson, 2005). The pocket protein E2F paradigm lies at the heart of cell cycle regulation and progression, along with further c omplications in cell cycle exit and cellular differentiation. Studies have implicated the pocket proteins in development of the limb and endochondral growth. Cobrinik et al (1996) first demonstrated that p107 and p130 had overlapping roles in limb deve lopment. Moreover, p107 and p130 were shown to regulate chondrocyte proliferation. Embryos that were nullizygous for both p107 and p130 (p107 / ; p130 / ) displayed a higher proliferative index as demonstrated through bromo deoxyurindine (BrdU) incorpora tion. Although p107 / ; p130 / embryos displayed elevated chondrocyte proliferation, they exhibited shortened limbs. Chondrocytes lacking p107/p130 cell cycle control do eventually cease proliferation, likely due to other growth regulators such as pRb a nd cyclin dependent kinase inhibitors (CKIs) such as p16, p21, and p27, which function to inhibit cell cycle progression by blocking the activity of CDKs. Subsequent studies further elucidated the functions of these proteins by illustrating distinct and overlapping roles of p107 and p130 in cartilage development. During the condensation of mesenchyme, p107 is required for cell cycle withdrawal, while p130 is not expressed at this time (Rossi et al., 2002). Growth plate chondrocytes devoid of p107 expre ssion cause severe defects. During mesenchymal condensation, p130 can compensate for p107 loss by aiding in cell cycle withdrawal and hypertrophic differentiation (Rossi et al., 2002). Simultaneous deletion of p107, and p130 blocked hypertrophic differen tiation and expression of the transcription factor Runx2 the function of which is important in chondrocyte differentiation

PAGE 20

20 (Rossi et al., 2002). pRb has yet to be implicated in cell cycle withdrawal during chondrocyte differentiation. Antiproliferative e ffects of FGFs in chondrocytes are mediated through the rapid dephosphorylation of p107, with a more delayed dephosphorylation of pRb and p130 (Laplantine et al., 2002; Dailey et al., 2003). It has also been shown that p107 is absolutely necessary for FGF induced growth arrest, whereas p130 contributes to cell cycle arrest, while involvement of pRb in FGF growth arrest has not been identified (Laplantine et al., 2002; Dailey et al., 2003). These results indicate the importance of p107/p130 in cell cycle c ontrol, but also raise the question of what role, if any, pRb may play in cartilage development. Each of the pocket proteins contains putative CREs within their promoter regions. These promoter elements are binding sites for a multitude of transcription factors, including ATF 2. ATF 2 has been shown previously to regulate pRb promoter activity ( Zacksenhaus et al., 1993 ). More recently, studies have shown that mutation of ATF 2 in mice leads to decreased expression of pRb (Luvalle et al., 2003). In con clusion, development of the vertebrate skeleton is a complex, yet highly ordered, controlled process. The exquisite control is demonstrated by the phenotypic manifestations observed following genetic disruption of genes involved in the process of endochon dral ossification. Ablation of ATF 2 is one example of the type of genetic disruption that alters the delicate balance within the growth plate. Loss of ATF 2 signaling influences numerous cellular processes vital for chondrocyte proliferation and differe ntiation. The purpose of the studies within this dissertation is to further the understanding of the regulatory role that ATF 2 plays in endochondral ossification. The studies contained herein also examine a plausible role of pRb plays in endochodral de velopment.

PAGE 21

21 CHAPTER 2 ACTIVATING TRANSCRIPTION FACTOR 2 AFFECTS SKELETAL GROWTH BY MODULATING PRB GENE EXPRESSION Introduction Growth of skeletal long bones occurs through the process of endochondral ossification. Endochondral bone formation is inititated with the condensation and chondrogenic differentiation of mesenchymal cells. Condensed mesenchymal cells are induced to undergo chondrogenesis by several regulatory pathways including those of transforming growth factor (TGF ), parathyroid hormone relater pept ide (PTHrP), hedgehog family proteins, as well as various other transcription factors. The Sox family of transcription factors regulate the formation of chondrogenic condensations and cartilage by controlling the expression of type II collagen and aggreca n, two cartilage specific markers (Bell et al., 1997; Lefebvre et al., 1998; Sekiya et al., 2000). Endochondral bone growth is dependent upon the coordinated regulation of p roliferation and differentiation of chondrocytes to form the cartilage templat e. Chondrocytes are found in a quiescent state in the resting zone of the growth plate where they are stimulated to proliferate. The proliferation of chondrocytes is maintained in part by both Indian Hedgehog (Ihh) action and the PTHrP gradient. After s everal cycles of proliferation, chondrocytes exit the cell cycle coincident with the reduction of the PTHrP gradient and begin to increase in cellular volume (hypertrophy), forming the pre hypertrophic, or maturation, region. The expansion of hypertrophic chondrocytes contributes significantly to the length of the developing bone. Hypertrophic chondrocytes are terminally differentiated and commence expression of type X collagen. Within the late hypertrophic region, the cartilage matrix undergoes both mine ralization

PAGE 22

22 and vascularization. The mineralized cartilage matrix is replaced with bone matrix. The most mature hypertrophic chondrocytes undergo apoptosis, leaving behind a trabecular bone matrix. Activating transcription factor 2 (ATF 2) is a member of the ATF/CREB (cAMP Response Element Binding protein) family of transcription factors, characterized by a basic region and a leucine zipper DNA binding domain. This family of transcription factors binds cAMP response elements (CREs) within target gene promoter regions in either homo or heterodimers. ATF 2 has been shown to regulate promoter activity of genes that are important for cartilage and bone growth. Data from our laboratory has shown that ATF 2 is essential for modulating the activity of the c ell cycle related genes cyclin D1 (Beier et al., 1999) and cyclin A (Beier et al., 2000) within growth plate chondrocytes. Gene expression of both cyclin A and cyclin D1 are targets of ATF 2 trans activation, while loss of ATF 2 action in mutant ATF 2 cho ndrocytes leads to a decrease in gene expression. Addition of an exogenous ATF 2 expression plasmid restores promoter activity, further supporting the role of ATF 2 in regulating the expression of cyclins A and D1 in chondrocytes. The promoter regions of several other genes contain CRE motifs, but have yet to be examined for ATF 2 regulation. Additional genes, such as osteopontin, osteocalcin, alkaline phosphatase, and the Rb family that contain CREs may also be controlled by ATF 2. Within the growth pl ate, ATF 2 is expressed in the resting and proliferating zones, yet is excluded from the hypertrophic region. The importance of ATF 2 in skeletal development was demonstrated with the production of ATF 2 deficient mice (Reimold et al., 1996). ATF 2 defic ient mice (ATF 2 m/m) express low amounts of a splice variant of ATF 2 that rescues ~50% of transgenic animals from neonatal lethality. ATF 2 deficient mice are smaller than wild type littermates at birth, and those that survive past weaning develop a h ypochondroplasia like dwarfism characterized by abnormal epiphysis and curvature of the

PAGE 23

23 spine. Chondrocyte proliferation is also reduced as determined by in vivo [ 3 H] thymidine incorporation (Reimhold, 1996). True ATF 2 null mice die at birth due to respi ratory difficulties (Maekawa et al., 1999). The retinoblastoma protein family, or pocket proteins, is comprised of retinoblastoma (pRb) and pRb related proteins, p107 and p130. These proteins regulate the G1 to S phase transition by sequestering the E 2F family (E2F1 to E2F5) of transcription factors necessary for cell cycle progression (for review see Cobrinik, 2005). pRb is found within resting (G0) cells in a hypo phosphorylated state that allows for binding and sequestration of E2Fs. E2F proteins are released from pRb sequestration following phosphorylation by cyclin D cyclin dependent kinase (cdk) 4 and 6 complexes in early G1 and cyclin E/cdk 2 complexes later in G1. After E2Fs are released, the cell enters S phase and is committed to progress t hrough the cell cycle. The dynamic relationship between the pocket proteins and E2Fs is essential in regulating cell proliferation and, in turn, differentiation. The pocket proteins differ with respect to their cellular expression patterns and in their i nteractions with E2Fs. pRb shows selective interactions with E2F1 3 while p107 and p130 bind more readily to E2F 4 5 (for review see Cobrinik 2005). Disruption of E2F pocket protein dynamics inhibits normal skeletal bone growth by disrupting the endo chondral ossification process. Chondrocytic differentiation of ATDC5 cells, a chondro progenitor cell line (Atsumi et al., 1990), is inhibited by ectopic expression of E2F1 as evidenced by inhibition of expression of the cartilage markers type II collagen type X collagen and aggrecan (Scheijen et al., 2003). Fibroblast growth factor (FGF) signaling inhibits longitudinal bone growth by specifically targeting p107 and p130 to induce chondrocyte cell cycle arrest. p107 and p130 have also been implicated in limb development (Cobrinik et al., 1996) and in the regulation of chondrocyte proliferation and differentiation (Rossi et al., 2002).

PAGE 24

24 Our lab has shown that protein levels of pRb are reduced in ATF 2 m/m chondrocytes (Luvalle et al., 2003) suggesting tha t pRb expression is dependent on ATF 2 function. Basal pRb promoter activity is regulated through ATF 2 binding of the CRE motif (Zacksenhaus, et al., 1993). The promoter regions of p107 and p130 also contain CREs that may be targets of ATF 2 regulation. The phenotype of ATF 2 m/m mice may be the result of cumulative effects of various target genes including the pRb family. Here we further investigate the abnormal development of ATF 2 deficient mice by examining the relationship between ATF 2 and pRb. We show that the normal spatial and temporal expression of each pocket protein within the growth plates of wild type animals and their altered expression in ATF 2 mutants. Expression of pRb mRNA is reduced in ATF 2 m/m chondrocytes compared to wild type d ue to the reduction of pRb promoter activity. We also show that that pRb expression is upregulated in ATDC5 undergoing chondrogenic differentiation. ATF 2 deficient mice also exhibit reductions in collagen type X expression as compared to wild type coun terparts. We also show that ATF 2 mutant mice display increases cellular proliferation as compared to their wild type littermates, both in vivo and in vitro Taken together these data show that the loss of ATF 2 activity results in the decreased express ion of pRb, and this decrease contributes to chondrocyte cell cycle deregulation and differentiation affecting hypertrophy, consequently resulting in appendicular dwarfism. Materials and Methods Mice and genotyping Mice harboring either wild type or inac tivated alleles of the ATF 2 gene were genotyped as previously described (Reimold et al., 1996). Genomic DNA was isolated from the distal

PAGE 25

25 portion of the tail by standard phenol chloroform extraction and genotype was determined by polymerase chain reaction (PCR). Cell Culture ATDC5 chondrogenic cells were propagated in a 50:50 mixture of DMEM/F12 media supplemented with 5% fetal bovine serum, 100 g/ml penicillin and 100 g/ml streptomycin. For differentiation experiments, ATDC5cells at confluence were given complete media further supplemented with insulin transferrin selenium (ITS) reagent. Media was replaced every other day for the indicated time periods. Primary mouse chondrocytes were isolated from the ventral ribcage as previously described (Lefev bre et al., 1994). Briefly, ventral ribcages were excised from neonate pups less than 2 days old. Tissues were digested in pronase, followed by digestion with collagenase D (3 mg/ml) in complete DMEM (DMEM + 10% FBS, 100 g penicillin, 100 g streptomyci n). Cells were then grown in suspension over 1.5% agarose in phosphate buffered saline (PBS) coated plates for 3 days to ensure chondrogenic phenotype. Cell aggregates were digested in collagenase and plated in monolayer culture on sterile plastic dishes at 37 ¡ C in a 5% CO 2 atmosphere in complete DMEM. Immunhistochemistry Knee joints from newborn, 1 week old and 3 week old mice were dissected and fixed in 4% paraformaldehyde in PBS (w/v) for 24 hours at 4 ¡ C. Tissues were processed though xylenes, deh ydrated through graded alcohols and embedded in paraffin wax. Tissue sections were cut at 5 m and attached to SuperFrost Plus (Fisher) microscope slides. For immunohistochemisty, slides were deparaffinized in Citrasolve (Fisher), and rehydrated through graded alcohols to distilled water. Microwave antigen retrieval was performed using Antigen Unmasking Solution according to manufacturer's recommendations (Vector). The Vector Elite ABC Staining kit was

PAGE 26

26 used for immunohistochemical localization. Antibodi es and working concentrations were as follows: rabbit anti pRb (Delta bioLabs, 0.2 g/ml); rabbit anti p107 (Delta Biolabs, 0.2 g/ml) rabbit anti p130 (ABCam, 0.2 g/ml); rabbit anti Ki67 (ABCam, 0.1 g/ml). As a negative control, normal rabbit IgG at th e same concentration was used in place of primary antibody. Immunoflourescence for type X collagen was performed using a rabbit polyclonal antibody (gift from Danny Chan, Department of Biochemistry, The University of Hong Kong, Pokfulam, Hong Kong, China ). Antigen unmasking was accomplished though incubation with 0.8% hylaranidase in PBS for 30 minutes prior to incubation with the primary antibody (1:2000). Alexa 488 (Molecular Probes, Invitrogen) goat anti rabbit was used as a secondary antibody (1:1000) Omission of primary antibody served as a negative control. Immunofluorescence was visualized on a fluorescent microscope (DM IRBE; Leica) equipped with a digital camera. Intensity of immunofluorescence was measured using digital imaging software (IP La b). Average intensities were determined from separate measurements of each growth plate of at least three individual animals. Bar graphs represent the mean of measured fluorescence intensity of at least 3 different animals at the indicated time points. Error bars represent the standard deviation of the mean. RNA isolation and RT PCR RNA was extracted from confluent cells using the TriZol reagent according to manufacturer's suggestions. Reverse transcription of 2 g of total cellular RNA was performed Total cDNA was diluted 1:10 in sterile water, and 1 l was used in subsequent PCR reactions. Quantitative real time PCR for type X collagen mRNA expression was performed using the DyNAmo HS SYBR Green PCR kit (New England Biolabs) according to manufact urer's instructions. Real time PCR analysis for pRb mRNA was performed using TaqMan Gene Expression Array combined with the TaqMan Universal PCR Master Mix (Applied Biosystems).

PAGE 27

27 PCR results were normalized to GAPDH PCR values. Primers used for SYBR gree n RT PCR are as follows (target; forward, reverse): type X collagen; 5' TGCCCGTGTCTGCTTTTACTGTCA 3', 5' TCAAATGGGATGGGGGCACCTACT 3'; GAPDH, 5' CGGACTCAACGGATTTGGTCGTAT 3', 5' AGCCTTCTCCATGGTGGTGAAGAC 3'; actin, 5' CGTGGGCCGCCCTAGGCACCA 3', 5' TTGGCCTTAG GGTTCAGGGGGG 3'. Comparisons made between groups of SYBR green reactions were performed using the Pfaffl method (Pfaffl, 2001), and the # # Ct method for TaqMan Assay PCRs. The Pfaffl method takes into account different efficiencies of amplification between various primer sets in order to make accurate comparisons. Transfections and Luciferase Assays Primary chondrocytes were plated in a 24 well plastic culture plate at a cell density of 1.25x10 5 in DMEM media with 10% FBS without antibiotics for 24 hours prior to transfection. Each well contained 0.2 g of reporter plasmid DNA and 0.02 g of pRLSV40 plasmid used for transfection normalization. Lipofectamine 2000 was used for transfections according to manufacturer's recommendations with few exceptions; bri efly, plasmid DNA and 1 l of transfection reagent were diluted separately in Opti MEM serum free media. Diluted DNA and transfection reagent were combined to form complexes for 20 minutes prior to adding to cells. Cells were collected for luciferase act ivity 24 hours after transfection. Luciferase assays were performed as previously described (Ma et al., 2007). ATDC5 cells were transfected 24 hours prior to collection as were those for primary cultures and collected at indicated time points for lucifer ase activity.

PAGE 28

2 8 Cell Cycle Analysis ATDC5 cells were collected at the indicated times following differentiation by adding hypotonic cell lysis buffer (0.5 g Sodium Citrate, 0.1% (v/v) Triton X100) followed by removal of cells from the culture plate with a cell scraper. Propidium iodide solution was added to a final concentration of 30 g/ml with RNase A in order to stain DNA content. The cell suspension was then processed for flow cytometry in a FACS Calibur (BD BioSciences) flow cytometer. Cell cycle profiles were obtained using Cell Quest software. Analyses of cell cycle populations were performed using the ModFit Software package. BrdU Incorportation Primary chondrocytes from wild type and ATF 2 m/m newborn mice were isolated, differentiated ov er agarose and plated on plastic cell culture dishes at a cell density of 1.25x10 6 cells/ml. The next day, cells were pulse labeled with bromo deoxyuridine (BrdU) to a final concentration of 10 M in complete cell culture media for 4 hours. The media was removed, cells were washed with PBS, and supplemented with fresh media for 6 hours before collection for cell cycle analysis. BrdU incorporation was detected by incubation with a FITC labeled BrdU antibody (BD Biosciences) according to the manufacturer's recommendations. Results Several studies have documented the functions of the pRb protein family in regulating chondrocyte cell cycle arrest and differentiation (Laplantine et al., 2002). The effects of FGF signaling on chondrocyte cell cycle arrest are modulated through p107 and p130. Our laboratory, as noted earlier, has shown that loss of ATF 2 signaling leads to a reduction in pRb protein levels. Since ATF 2 expression is restricted to the resting and proliferative zones of the growth plate, we first sought to identify the spatial and temporal expression of the pRb family

PAGE 29

29 members within the growth plate in wild type and ATF 2 m/m animals at 0, 1 and 3 weeks of age. Expression of pRb was localized to the resting and proliferative region in newborn wild type proximal tibial sections (Figure 2 1a). In contrast, pRb expression was observed in the maturation and early hypertrophic regions in ATF 2 m/m proximal tibia (Figure 2 1b). Expression of p107 was not detected in wild type animals (Figure 2 1c), however p107 staining was observed in tibial growth plate sections from newborn ATF 2 m/m animals (Figure 2 1d). Staining was localized to the late proliferative region. Expression of p130 was observed throughout the growth plate in both wild type and A TF 2 m/m tissues (Figure 2 1e,f). ATF 2 m/m sections displayed more intense p130 staining as opposed to wild type tissue sections. By 1 weekof age, pocket protein expression was increased and more uniform (Figure 2 2). pRb expression was localized t o the late proliferative zone and pervaded throughout most of the hypertrophic region in wild type proximal tibia sections (Figure 2 2a). Expression of pRb was more restricted to the late proliferative and early hypertrophic regions of ATF 2 m/m growth pl ates (Figure 2 2b). There was some observed pRb immunostaining in the resting zones of both wild type and ATF 2 m/m sections (Figure 2 2a,b). p107 expression was localized to the late proliferative and early hypertrophic zones in sections of wild type gro wth plate tissues (Figure 2 2c). p107 expression was observed in the late proliferative region, with sparse staining in the hypertrophic zone in ATF 2 m/m sections (Figure 2 2d). Staining for p130 expression was observed throughout the proliferative and hypertrophic zones in both wild type and ATF 2 m/m sections (Figure 2 2 e,f). At 3 weeks, pRb expression was detectable in wild type growth plates while expression in ATF 2 m/m tissues was diminished (Figure 2 3a,b). Expression of p107 was reduced in wil d type and ATF 2 m/m tissues at 3 weeks of age (Figure 2 3c,d). p130 expression

PAGE 30

30 was observed predominantly in the proliferative region (Figure 2 3e,f) with some staining observed in resting zones (Figure 2 3e,f). We performed immunoblot experiments with protein from cultured primary chondrocytes to correlate the observed differences seen in immunohistochemical localization of the pRb protein family. Reduction of pRb protein expression has been demonstrated previously in ATF 2 m/m chondrocytes (pRb blot reprinted with permission LuValle et al., 2003). Expression of p107 was up regulated in response to ATF 2 deficiency. Expression of p130 was unchnaged in ATF 2 m/m animals. Actin was used as a loading control (Figure 2 4). ATF 2 recognizes CRE element s located in target gene promoters and subsequently alters gene expression. Given our results from immunohistochemistry and western blot experiments, we sought to determine the changes, if any, in mRNA expression in response to loss of ATF 2. Primary chon drocytes were isolated and cultured in vitro as described previously (Lefevbre et al., 1994). Real time PCR TaqMan Expression Assays were used to determine quantitative differences in pRb mRNA expression between wild type and ATF 2 m/m primary cells. Total RNA was isolated using the TriZol reagent, and cDNA was reverse transcribed in combination with an oligo d(T) primer. ATF 2 m/m chondrocytes demonstrated a 40% reduction in pRb expression compared to cells isolated from wild type littermates (Figure 2 5A) Luciferase assays were used to examine the regulatory nature of ATF 2 in the pRb promoter region in order to correlate observed differences with the known function of ATF 2 as a transcription factor. Primary chondrocytes from wild type, heterozygous and ATF 2 m/m animals were co transfected with plasmid DNA corresponding to a 1.3 kb fragment of the mouse pRb promoter cloned into the pGV B luciferase reporter plasmid (Delehouzee et al., 2005). A Renilla expression plasmid (pRLSV40) was used to normalize d ata for transfection efficiency. Wild

PAGE 31

31 type chondrocytes had the highest promoter activity, while ATF 2 m/m chondrocytes displayed an approximate 30% reduction in pRb promoter activity (Figure 2 5B). To examine the role of pRb in chondrocyte developmen t, we utilized the ATDC5 chondrogenic cell line to monitor pRb expression in response to differentiation. ATDC5 cells were grown to near confluence in DMEM/F12 (50:50) media with serum and antibiotics. Insulin Transferrin Selenium (ITS, Sigma) reagent was added after reaching confluence. Insulin at this concentration has been shown to induce differentiation of the cells to a more chondrocytic phenotype (Shukunami et al., 1996). Cells were then collected at various time points for mRNA expression. pRb mR NA expression was quantified using the TaqMan Expression Array as described (Pfaffl, 2001) After the cells were differentiated for 8 days there was a 4 fold increase in pRb mRNA expression compared to cells at day 0. A further increase was seen in cells at day 11, and sustained levels were seen at day 14 (Figure 2 6A, closed bars). Expression of type X collagen was low from day 0 through day 4. After day 4, type X expression levels increased until day 14 when there was an observed 6 fold increase in mRN A expression from cells collected at day 0 (Figure 2 6A, open bars). pRb promoter activity in ATDC5 cells differentiated with ITS was coincident with observed expression changes over time (Figure 2 6B). After 8 days post ITS treatment promoter activity i ncreased 10 fold above the activity observed at the time of ITS treatment initiation (Figure 2 6B, compare D0 to D8). After day 8, promoter activity increased further and remained elevated through day 14. These data suggest that pRb expression was up reg ulated in response to exogenous treatment of cells with insulin which induces chondrogenic differentiation of ATDC5 cells. Cell cycle exit is a critical determinant in cellular differentiation. The role of pRb in regulating cell cycle progression has b een well established. pRb family members p107 and p130

PAGE 32

32 mediate FGF induced cell cycle arrest in chondrocytes in response to FGF signaling (Laplantine et al., 2002). Since the expression of pRb is up regulated in ATDC5 cells undergoing differentiation, we sought to correlate pRb and type X collagen expression with cell cycle exit. ATDC5 cells were collected in hypotonic lysis buffer and stained with propidium iodide for flow cytometric analysis. Supplementing ATDC5 cell culture with insulin resulted in c hondrogenic cell differentiation (Shukunami et al., 1996). ATDC5 cells displayed a normal asynchronous cell cycle profile at the time of ITS supplementation (Day 0, Figure 2 7). After 24 hours (Day 1) of ITS treatment, the number of cells in S phase incr eased. Cell cycle profiles of cell cultures collected at subsequent time points showed a steady decrease in the number of cells in S and G2/M phases. The decrease in cellular growth was coincident with the increase in the number of cells in G1/G0, indic ative of cell cycle exit. Type X collagen is a marker of terminal differentiation in chondrocytes (Kielty et al., 1985; Reichenberger et al., 1991). Type X collagen expression is restricted to the hypertrophic region within the growth plate. Immunofl uorescence was used to examine the role that ATF 2 loss plays in chondrocyte differentiation. Tissues from 0 1 and 3 week old wild type and ATF 2 m/m animals were fixed, processed, embedded in paraffin, and further processed for immunofluorescence. Ty pe X collagen expression was evident in the hypertrophic region in all tissues examined. Tibial growth plate sections from wild type and ATF 2 mutant animals displayed equal staining for type X collagen at 0 weeks of age (Figure 2 8A panels a,b). Type X co llagen staining was much more evident in wild type versus ATF 2 m/ m animals at 1 weekof age (Figure 2 8A panels c,d). Type X collagen staining in tibial growth plate section from 3 week old animals was more intense in wild type as compared to ATF 2 m/m a nimals (Figure 2 8A panels d,e). The observed differences in type X collagen staining fluorescence intensity were

PAGE 33

33 measured in each growth plate in order to provide a quantitative comparison between groups. The fluorescence intensity corresponding to type X collagen was significantly different between wild type and mutant animals at 1 and 3 weeks of age (Figure 2 8B, P<0.005). Growth plate sections from wild type animals demonstrated higher type X collagen expression than ATF 2 mutants at 1 weekand 3 week s of age. These data indicate that ATF 2 mutation does affect the expression of type X collagen reflecting a plausible role in the differentiation of chondrocytes. ATF 2 affects chondrocyte differentiation indirectly through regulation of the expression of one or multiple target genes. The regulatory function of pRb in controlling the cell cycle occurs at the G1 to S phase transition. The reduction of pRb expression observed in ATF 2 m/m animals could result in the loss of cell cycle control. We exa mined the proliferation of chondrocytes within the growth plate by immunostaining for Ki67, a well known marker for proliferative cells. There was a clear increase in the number of Ki67 positive cells in ATF 2 m/m animals compared to wild type at the 0 we ek time point (Figure 2 9a,b). Chondrocytes within the late proliferative and hypertrophic regions were negative for Ki67 indicative of cell cycle exit. Ki67 staining was more prevalent in wild type chondrocytes at 1 weekof age than in ATF 2 m/m litterma tes (Figure 2 9c,d). Finally, at 3 weeks of age, Ki67 staining was still observed in ATF 2 m/m tissues, while not detected in wild type tissues (Figure 2 9e,f). We also tested the cell cycle behavior of primary chondrocytes by BrdU labeling. Primary chondrocytes were labeled with BrdU for 4 hours in order to determine the population of cell actively undergoing DNA synthesis. We determined a difference in G1 to S phase transition between wild type and ATF 2 m/m chondrocytes, a checkpoint controlled by pRb. Incorporation of BrdU was increased in cells from ATF 2 m/m animals (Figure 2 10). The

PAGE 34

34 percentage of cells within the S phase fraction of the cell cycle was increased in ATF 2 m/m cells. Theses results, taken together with the immunostaining for K i67, indicate that ATF 2 loss results in aberrant cell cycle control mainly at the G1 to S transition. Discussion Endochondral ossification is dependent on the coordinated regulation of chondrocyte proliferation and differentiation. Previous results f rom our lab have demonstrated that ATF 2 acts as a global regulator of chondrocyte proliferation through regulation of the cyclin D1 (Beier et al., 1999) and cyclin A (Beier et al., 2000) promoters. We have, more recently, implicated ATF 2 in controlling apoptosis of hypertrophic chondrocytes via regulation of the bcl 2 promoter (Ma et al., 2007). Other potential target genes of ATF 2 include the pocket proteins pRb, p107 and p130. The necessary regulation of cell cycle exit and terminal differentiation of chondrocytes renders the pocket proteins ideal candidates for ATF 2 regulation. Pocket protein function involves regulation of cell cycle progression, therefore centrally modulating cellular proliferation and differentiation processes. Regulation of p ocket protein expression is a plausible mechanism for ATF 2 function in chondrocytes. Previous data from our laboratory have shown that pRb protein levels were decreased in response to ATF 2 loss (LuValle et al., 2003). Interestingly, p107 protein lev els were increased in ATF 2 mutant chondrocytes while p130 remained stable. The increase in p107 levels may reflect a response to diminished levels of pRb and a compensatory mechanism whereby the increased p107 levels could interact and sequester E2F tran scription factors necessary for cell cycle progression. Spatially, pRb is expressed in the resting and early proliferative region of the growth plate. However, ATF 2 deficient mice express pRb in the maturation and hypertrophic regions. The increase in pRb expression combined with the altered, more downstream spatial

PAGE 35

35 expression inATF 2 m/m animals may be indicative of the important role pRb plays in regulating cell cycle exit and ultimately chondrocyte differentiation. It also suggests that the ATF 2 m /m phenotype results from not only the reduced number of proliferative cells (Reimold et al., 1996) but also a possible disruption in the normal differentiation program, specifically control of cell cycle exit. pRb plays a central role in cell cycle regula tion, but also functions in terminal differentiation of numerous cell types (Cobrinik et al., 1996; Zacksenhaus et al., 1996; Walsh, 1997; Thomas et al., 2001; Fajas et al., 2002). Results from western blots indicate that p107 expression is increased in A TF 2 m/m chondrocytes while p130 levels are unaffected (Figure 2 4). Our immunohistochemical data replicate this phenomenon, demonstrating that spatial expression of p107 in the ATF 2 m/m growth plate is localized to the maturation region. ATF 2 may con trol the normal differentiation of chondrocytes indirectly, by influencing the expression of pRb. There is a clear increase in pRb expression in the ATF 2 m/m growth plate that does not correlate with results from immunoblotting experiments (Figures 2 1 3 compared to Figure 2 4). However, chondrocytes within the resting zone in wild type growth plates express higher levels of pRb than those of ATF 2 m/m chondrocytes. This difference could account for the discrepancy between in vitro (immunoblot) and in v ivo (immunohistochemistry) results where pRb expression is reduced in primary ATF 2 mutant chondrocytes. This phenomenon is not mirrored in vivo by ATF 2 mutant chondrocytes where pRb expression is not dramatically reduced. The most striking result may b e the spatial change in pRb expression. pRb is expressed in the resting zone and in the late proliferative zone in wild type chondrocytes, but in ATF 2 m/m chondrocytes pRb expression is observed in the maturation zone at higher levels than in wild type, as well as throughout the hypertrophic region. There is also a clear reduction in the number of cells expressing pRb in the resting zone. The

PAGE 36

36 reduction in pRb expression may be the result of sub optimal activation of the pRb promoter following loss of AT F 2 activation. Results from promoter studies (Figure 2 5B) support this finding. Likewise, ATF 2 has been shown to be necessary for optimal pRb promoter activity (Zacksenhaus et al., 1993). The alteration of pRb expression may allow cells to enter the cell cycle earlier and exit earlier, leading to premature growth plate closure and culminating in the observed dwarfed phenotype. Our results indicate that this may be the case. Increased Ki67 immunostaining in ATF 2 m/m growth plates combined with the i ncrease in BrdU incorporation in primary chondrocytes from ATF 2 m/m animals indicate a loss of cell cycle control which may contribute to the observed phenotype. Another contributing factor to the dwarfed phenotype of ATF 2 m/m animals is the increase of p107 expression. This increase, combined with steady levels of p130 observed in ATF 2 m/m animals, may result in a shorter period of chondrocyte proliferation, resulting in premature cell cycle exit and growth retardation. Chondrocyte growth arrest has been largely associated with p107 and p130, with little mention regarding pRb. We were able to examine pRb expression in differentiating cells by using the ATDC5 chondrogenic cell line. We show here that pRb expression is tightly correlated with expressi on of type X collagen, a marker for chondrocyte differentiation. Furthermore, ATDC5 cells treated with insulin have been shown to produce increased amounts of proteoglycans, another chondrocyte differentitation marker (Phornphutkul et al., 2006). ATDC5 ce lls express type X collagen and pRb at higher levels following prolonged insulin treatment. These data imply that pRb plays a definitive role in chondrocyte differentiation in vitro Cell cycle exit is a hallmark of terminal differentiation. The accu mulation of cells in G1/G0 of the cell cycle is a sufficient indication of removal from the cell cycle. As the number of cells in G1/G0 increase, there is a decrease in the number of cells in S and G2/M phases of

PAGE 37

37 the cell cycle. Differentiation of ATDC5 cells stimulates expression of pRb and type X collagen while simultaneously yielding an increase of cells exiting the cell cycle. These results suggest that pRb not only regulates cell cycle exit, but also plays a role in determining the normal chondrocyt e differentiation program. The temporal pattern of pRb expression in the distinct regions of the growth plate directly effect growth plate development. The altered spatial/temporal expression of pRb in response to loss of ATF 2 signaling could induce cells to exit the cell cycle prematurely. Exit from the cell cycle would likely trigger advanced terminal differentiation, ultimately leading to closure of the growth plate and a dwarfed phenotype. The reduced expression of pRb in ATF 2 mutant cells lead to delayed differentiation. The combination of reduced proliferation, delayed differentiation, and increased apoptosis in later stage hypertrophic chondrocytes is likely to contribute additively to the observed dwarfed phenotype of the ATF 2 m/m mice. The unique ability of endochondral cartilage to undergo maturation prior to hypertrophy may delineate the role of pRb in bone development. Expression of pRb throughout the maturation region suggests a plausible role of pRb in this region. Cartilage sp ecific deletion of pRb would best demonstrate the role of pRb in the endochondral process aside from fetal limb development (Cobrinik et al., 1996). Our lab is currently undertaking these projects to better understand the function of pRb in the growth pla te.

PAGE 38

38 Figure 2 1. Immunohistochemical localization of pocket proteins in newborn growth plates. Knee joints from wild type (+/+) and ATF 2 mutant (m/m) newborn mice were fixed in 4% paraformaldehyde, embedded in paraffin and sectioned at 5 m for immunohistochemistry. Primary antibodies against pRb (a,b), p107 (c,d), and p130 (e,f) were used as noted in Material and Methods. Control sections were incubated with non specific IgG from the same host species as primary antibodies. Micrographs were t aken at 20X magnification using a Leica DM2000 microscope equipped with a Leica DFC420C digital camera.

PAGE 39

39 Figure 2 2. Immunolocalization of pocket proteins in 1 week old growth plates. Knee joints from 1 week old wild type (+/+) and ATF 2 mutant (m/m) mice were fixed in 4% paraformaldehyde, embedded in paraffin and sectioned at 5 m for immunohistochemistry. Primary antibodies against pRb (a,b), p107 (c,d), and p130 (e,f) were used as noted in Material and Methods. Control sections were incubated with non specific IgG from the same host species as primary antibodies. Micrographs were taken at 20X magnification using a Leica DM2000 microscope equipped with a Leica DFC420C digital camera.

PAGE 40

40 Figure 2 3. Immunohistochemical localization of pocket prot eins in 3 week old growth plates. Knee joints from wild type (+/+) and ATF 2 mutant (m/m) 3 week old mice were fixed in 4% paraformaldehyde, embedded in paraffin and sectioned at 5 m for immunohistochemistry. Primary antibodies against pRb (a,b), p107 (c ,d), and p130 (e,f) were used as noted in Material and Methods. Control sections were incubated with non specific IgG from the same host species as primary antibodies. Micrographs were taken at 20X magnification using a Leica DM2000 microscope equipped wit h a Leica DFC420C digital camera.

PAGE 41

41 Figure 2 4. Expression of pocket proteins is altered in response to ATF 2 mutation. Total protein from primary chondrocytes isolated from wild type (+/+), heterozygous (+/ ), and ATF 2 mutant (m/m) mice were anal yzed by Western blot. Equal loading was demonstrated by probing with an antibody against actin.

PAGE 42

42 Figure 2 5. Levels of pRb mRNA are reduced in ATF 2 mutant chondrocytes as opposed to wild type. A) Total RNA was extracted from prima ry chondrocytes isolated from wild type (+/+) and ATF 2 mutant (m/m) mice. 2 g of total RNA was reversed transcribed using Superscript II reverse transcriptase with an oligo d(T) primer. Real time PCR was performed using TaqMan Gene Expression Array kit for mouse pRb on an ABI7000 machine. Values were normalized to actin mRNA levels and represent means from 3 different animals run in triplicate. Comparisons between groups were made using the # # Ct method. B) pRb promoter activity in primary chondrocyt es. A 1.3 kb portion of the pRb promoter preceding a luciferase reporter construct was transfected into primary chondrocytes isolated from wild type (+/+), heterozygous (+/m) and ATF 2 mutant (m/m) animals. Bar graphs represent the mean normalized lucife rase activity of triplicate samples from three different animals for each genotype. Error bars represent SEM. pRb promoter activity in ATF 2 mutant (m/m) chondrocytes is roughly 30% decreased as compared to activity in wild type (+/+) chondrocytes.

PAGE 43

43 Fi gure 2 6. Expression of pRb mRNA is increased coincident with chondrgenic differentiation. A) ATDC5 cells were treated with insulin transferrin selenium reagent (ITS) to induce chondrgenic differentiation. Total RNA was extracted at various timepoints (day 0, D0; day 1, D1; day 4, D4; day 8, D8; day 11, D11; day 14, D14) after treatment initiation. Total RNA was extracted and reverse transcribed as previously described. Real time PCR for pRb was performed as previously described. Real time PCR for ty pe X collagen was performed using Dynamo DS Sybr green qPCR kit (New England Biolabs) with primers for type X collagen and normalized to actin. Type X collagen mRNA expression comparisons were determined using the Pfaffl method (Pfaffl, 2001), accountin g for unequal PCR efficiencies between primer sets. RT PCR was performed in triplicate on cDNA from at least 3 different animals. B) pRb promoter activity in differentiated ATDC5 cells. Differentiated ATDC5 cells were transfected 24 hours prior to coll ection with the pRb promoter luciferase construct. Cell were collected and assayed for luciferase activity on days indicated (D0, day 0= initiation of ITS treatment). Luciferase activity was normalized to Renilla luciferase activity for transfection effi ciency. Bar graphs represent the mean normalized luciferase activity of triplicate samples from three independent experiments. Error bars represent SEM. pRb promoter activity is increased as differentiation progresses, mirroring the observed increased ex pression of pRb mRNA.

PAGE 44

44 Figure 2 6. Continued

PAGE 45

45 Figure 2 7. Cell cycle analysis of ATDC5 cells undergoing chondrgenic differentiation. ATDC5 cells were cultured and treated with ITS reagent to stimulate chondrogenic di fferentiation. At indicated timepoints, cells were collected in hypotonic lysis buffer with propidium iodide and processed for flow cytometry. DNA content was measured to determine the cell cycle profile. At least 30,000 cell nuclei were analyzed for ea ch collected time point. Cell cycle profiles were analyzed using the ModFit software package. Accumulation of cells in G1/G0 occurs over time is indicative of cell cycle exit. At the time of ITS initiation (D0), 62% of cells were found in G1/G0. After 24 hours of ITS treatment, 42% of cells were in G1/G0. The number of cells in G1 then increases over time to a maximum of 94% at D11. The sub G1 peak represents the sub population of cells undergoing apoptosis.

PAGE 46

46 A Figure 2 8. Type X collagen immuno staining in wild type (+/+) and ATF 2 mutant (m/m) hypertrophic chondrocytes. A) Growth plates from wild type and ATF 2 m/m animals were dissected, processed and sectioned for immunohistochemistry as previously described. Tibial growth plates from newbor n (a,b), 1 week (c,d) and 3 week (e,f) old mice were used. Staining was restricted, as expected, to the hypertrophic region. B) Intensity of fluorescence from immunostaining was measured using IP Lab digital imaging software. Mean intensity per unit area was measured from at least three different animals per time point and genotype. Statistical comparisons were made using Student's t test. Bars represent mean intensities + the standard deviation of the respective mean. Asterisk (*) indicates signif icant difference (P<0.05) between wild type and mutant growth plates at the specific age.

PAGE 47

47 Figure 2 8. Continued

PAGE 48

48 Figure 2 9. Immunostainingfor Ki67 in wild type (+/+) and ATF 2 mutant (m/m) animals. Growth plates from wild t ype and ATF 2 m/m animals were dissected, processed and sectioned for immunohistochemistry as previously described. Tibial growth plates from newborn (a,b), 1 week (c,d) and 3 week (e,f) old mice were used. Hematoxylin was used as a counterstain. Ki67 s taining was observed within chondrocytes actively undergoing cell cycle progression.

PAGE 49

49 Figure 2 10. Incorporation of BrdU in wild type (+/+) and ATF 2 mutant (m/m) primary chondrocytes. Primary chondrocytes from wild type and ATF 2 mutant a nimals were isolated and plated in plastic cell culture plates. Cells were labeled with 10 M BrdU for 4 hours in complete DMEM media. BrdU containing media was then removed, followed by washing with PBS and replacement with fresh media. Cells were allo wed to recuperate for 6 hours before being collected and processed for flow cytometric analysis of cell cycle status, and BrdU incorporation. The number of BrdU positive cells was increased in ATF 2 m/m chondrocytes. Cell cycle analysis of the fraction o f cells that were BrdU positive shows an increase in the S phase fraction.

PAGE 50

50 CHAPTER 3 CONDITIONAL DELETION OF RETINOBLASTOMA IN CHONDROCYTES Introduction Endochondral development of skeletal long bones is dependent upon the proliferation and differentiation of chondrocytes. Ordered control of proliferation is necessary to ens ure and adequate number of cells are present to promote longitudinal growth. As noted previously, several signaling mechanisms are essential in maintaining chondrocyte proliferation including the Ihh PTHrP negative feedback loop, FGFs and TGF pathways. Various cellular proteins are also vital in controlling proliferation, such as cyclin D1 (Beier et al., 1999), ATF 2 (Luvalle et al., 2003) and E2Fs. Differentiation of chondrocytes is dependent on additional signaling mechanisms (for review see Adams et al., 2007). Cell cycle exit and hypertrophy of chondrocytes are two hallmarks of chondrocyte terminal differentiation. Disruption of any of the signaling mechanisms or activity of vital cellular proteins severely inhibits longitudinal bone growth. T he retinoblastoma (pRb) family of proteins include pRb, p107 and p130, which function as cell cycle regulators. These proteins regulate cell cycle progression by binding and sequestration of E2F transcription factors that are necessary for S phase progres sion (for review see Dimova and Dyson, 2005). Phosphorylation of these proteins modulate their ability to bind E2Fs. In the hypo phosphorylated state, the proteins are capable of interactions with E2Fs thus inhibiting cell cycle progression. Following m itogenic stimulation, cyclins bind to their respective cyclin dependent kinases (CDKs) allowing for phosphorylation of the pocket proteins. Hyperphosphorylation of the proteins weakens its affinity for E2Fs, allowing for free E2F transcription factors to bind responsive promoters and induce transcription of vital S phase related genes. Pocket protein family members can also inhibit E2F activity by recruiting

PAGE 51

51 chromatin modifying enzymes to E2F sites thereby making DNA inaccessible to transcription factors (Brehm et al., 1998; Stiegler et al., 1998). The pocket proteins differ with respect to their expression during the cell cycle and in their affinity for certain E2Fs. pRb is expressed in both quiescent and cycling cells. pRb is present during G1 in the hypo phosphorylated, active form complexing with E2F1 and 3 predominantly (Lipinski and Jacks, 1999). p130, in quiescent cells, is mainly found bound with E2F4 acting as a transcriptional repressive complex. As cells enter the cell cycle and progress to S phase, p107 replaces p130 as the major partner for E2F4 (Nevins, 1998). Inactivation of the pocket proteins leads to loss of cell cycle control in several cellular systems (for review see Giacinti and Giordano, 2006 and Genovese et al., 2006). Nume rous cancers harbor genetic alterations leading to inactivation of pRb function. Loss of pRb function leads to abrogated restriction checkpoint control allowing for continuous cell cycle progression. The pRb family has been shown to regulate terminal ce ll cycle exit through two distinct mechanisms. The first is a direct result of their function in regulating E2Fs and t he second is unique to cellular differentiation and the interaction of pRb family members with transcriptional repressors. As cells ente r terminal mitosis, p107 levels decrease whereas p130 levels increase resulting in a predominance of p130/E2F4 complexes (for review see Lipinski and Jacks, 1999). This switch is simultaneous with a decrease in free E2Fs to very low levels in fully differ entiated cells. pRb activity during differentiation is much more complex and is cell type dependent. Its levels are not subject to the dramatic differences in expression as observed in p107 and p130. pRb levels can increase slightly as seen in muscle (C ondorelli et al., 1995; for review see De Falco et al., 2006), remain stable as in adipocytes (Rampalli et al., 1998) or decrease as observed in most neuronal differentiation systems (Callaghan et al., 1999).

PAGE 52

52 The control of proliferation and differenti ation of chondrocytes is vital in maintaining normal endochondral bone development. Cell cycle related genes, such as the pRb family, have been shown to play important roles in chondrocyte proliferation and differentiation. Embryos that are devoid of p10 7 and p130 display perinatal lethality and pronounced defects in endochondral bone development due to abnormal cell cycle exit (Cobrinik et al., 1996). pRb has not been linked to defects in endochondral ossification. Indirectly, pRb has been shown to reg ulate the activity of the transcription factor Cbfa1 which has important roles in hypertrophic differentiation (Inada et al., 1999; Kim et al., 1999; Takeda et al., 2001; Ueta et al., 2001). It is possible that pRb regulates chondrocyte maturation and dif ferentiation through regulation of Cbfa1, or other genes important for differentiation. pRb has also been shown to regulate the activity of ATF 2 (Kim et al., 1992), an important transcription factor in developing chondrocytes. E2F1 is another transcrip tion factor that is regulated by pRb. Overexpression of E2F1 in chondrocytes results in severe defects in endochondral ossification by inhibiting differentiation (Scheijen et al., 2003). Given the role that pRb plays in regulating E2F1 activity and its role in terminal cell cycle exit required for differentiation (for review see Lipinski and Jacks, 1999), it is probable that pRb plays an integral role in chondrocyte differentiation. A conditional knockout mouse was generated in order to disseminate the role of pRb in controlling chondrocyte proliferation and differentiation. Mice harboring a floxed pRb (Rb loxP) allele were crossed with mice expressing Cre recombinase under the control of the type II collagen (Col2Cre) promoter. These pairings resulted in conditional functional deletion through the excision of exon 19 of the pRb gene within developing chondrocytes. Conditonal deletion of pRb allows for examination of the role pRb plays in endochondral development.

PAGE 53

53 Material and Methods Mice and Genot yping Genetically engineered mice containing two loxP (Rb fl/fl) sites flanking exon 19 of the retinoblastoma gene as described previously (Vooijs et al., 1998) were obtained from the National Cancer Institute. Mice were housed in a specific pathogen free environment and cared for according to IACUC guidelines. Mice harboring the gene encoding the bacterial Cre recombinase under the control of the type II collagen promoter (Col2Cre +/+) were transferred from the University of Texas (a gift from Gerard Kar senty). These mice express the transgene in chondrocytes as described previously by Ovchinnikov and collegues (2000 ). Mice were genotyped by polymerase chain reaction (PCR). Lysis of liver tissue was performed in 200 l of 50 mM KCL, 10 mM Tris (pH 8.0 ), 2.5 mM MgCl 2 0.1 mg/ml gelatin, 0.45% NP 40 (v/v) and 0.45% Tween 20 (v/v) and 2 l of 20 mg/ml proteinase K. Samples were incubated at 65 ¡ C for 2 hours, followed by incubation at 95 ¡ C to inactivate proteinase K. An appropriate amount (0.5 2 l) of D NA was used in subsequent PCR reactions. Primers used for genotyping are as follows: for Rb loxP: RbfloxFW 5' GGCGTGTGCCATCAATG 3' and RbGen701 5' ATCTACCTCCCTTGCCCTGT 3'; for Col2Cre: CreFW 5' GAGTGATGAGGTTCGCAAGAAC 3' and CreRV 5' TCGCCATCTTCCAGCAGG 3'. Histology Hind limbs from Rb fl/fl and Col2Cre +/ ; Rb fl/fl mice were dissected from newborn mice and fixed for 24 hours in 4% paraformaldehyde or embedded in tissue OCT (TissueTek) for frozen sectioning. Sections were then transferred from parafor maldehyde to phosphate buffered saline (PBS) and processed for paraffin embedding at the University of Florida College of Medicine Molecular Pathology Core Lab. Paraffin sections were cut at 6 m and attached to

PAGE 54

54 Fisher SuperFrost Plus slides. Hematoxylin and eosin staining was performed by the Molecular Core Lab using an automated staining apparatus. Skeletal Preparations Newborn, 1 week, and 3 week old mice were sacrificed by CO 2 asphyxiation according to IACUC guidelines. Mouse carcasses were skinned and eviscerated. Liver tissue was collected for genotyping. Excess skeletal muscle and fat were removed. Skeletons were then immersed in Alcian Blue staining solution (0.1% Alcian Blue 8X, 90% EtOH, 10% Acetic Acid) for 1 2 days. Alcian blue stains fo r cartilaginous elements of the skeleton. Skeletons were then rehydrated through graded alcohols as follows: 2X 100% EtOH for 1 hr, 2X 90% EtOH for 1hr, 2 X 70% EtOH for 1 hr, 1X H 2 O 1 hr. Following rehydration, skeletal preps were rinsed in NaCl soluti on (0.15 M NaCl), and subsewuently digested with 1% trypsin (Gibco BRL) in NaCl solution for 3 hours to overnight depending on the size of the skeleton. Remaining skeletal muscle and excess tissue was then removed, followed by incubation with alizarin red stain in 1% KOH solution for 24 48 hours. Stained skeletons were then processed through a series of 1% KOH: glycerol solutions for long term storage (3 parts 1% KOH, 1 part glycerol; 2 parts 1% KOH, 2 parts glycerol; 1 part 1% KOH, 3 parts glycerol). V on Kossa Staining Frozen embedded tissues were sectioned at 6 m and attached to SuperFrost Plus microscope slides. Sections were fixed in ice cold 70% methanol for 10 minutes then allowed to air dry. Fixed sections were incubated in 1% silver nitrate so lution (w/v) under UV irradiation for 10 minutes. Slides were then rinsed in distilled water followed by removal of excess silver ions by incubation in 5% sodium thiosulfate (w/v) for 5 minutes. Slides were then rinsed in distilled water and counterstain ed with Nuclear Fast Red staining solution (VectorLabs) for 3

PAGE 55

55 minutes. Stained slides were then dehydrated through an ethanol gradient and mounted for microscopic evaluation. Immunohistochemistry Sections from paraffin embedded tissues were cut at 6 m and attached to charged microslope slides. Sections were processed for immunohistochemistry by dewaxing and rehydration through graded alcohols to distilled water. Microwave antigen retrieval was performed by heating in Antigen Unmasking Solution (Vector Labs) buffer for 20 minutes. Endogenous peroxide activity was blocked with 3% H 2 O 2 in water for 5 minutes. Antibody incubation and detection of antibody binding was performed using the VectaStain Elite kit (Vector Labs) according to manufacturer's recomm endations. Diaminobenzidine was used as a peroxidase substrate for the colorimetric reaction. Digital images were taken using a Leica DFC 720 model camera and associated capture software. Results Conditional knockout animals were produced in order to investigate the importance of pRb in chondrocyte proliferation and differentiation,. Mice expressing Cre recombinase under the control of the type II collagen promoter were bred to mice with loxP site flanking exon 19 of the pRb gene. Excision of exon 19 yielded a truncated pRb protein resulting in a functional deletion equivalent to a null allele (Vooijs et al., 1998; Vooijs and Berns, 1999). Double heterozygous individual males were produced and backcrossed to RbloxP homozygous females in order to maxim ize the number of knockout animals. Mice were genotyped by PCR for homozygosity for the presence of loxP sites and positive expression of the Cre enzyme. Conditional knockout animals were observed at normally expected ratios, indicating that deletion of pRb within chondrocytes is not embryonic lethal. Conditional pRb negative neonates were

PAGE 56

56 smaller in size compared to their wild type (Cre / ; pRb fl/fl) littermates (Figure 3 1A). At one week of age, pRb negative animals were still smaller than Cre / ; pRb fl/fl littermates (Figure 3 1B). However, by 3 weeks of age, Cre +/ ; pRb fl/fl conditional knockouts were observed to be of equal size compared to Cre / ; pRb fl/fl littermates (Figure 3 1C). Skeletal staining preparations were utilized to visual ize the calcification and cartilage formation within the bones. Newborn littermates displayed reduced body size in response to pRb mutation. Comparison of bone length of the humerus from Cre / ; pRb fl/fl animals and Cre +/ ; pRb fl/fl conditional knock outs demonstrates the size difference (Figure 3 2A). All normal elements of the skeleton were present, however conditional mutants were smaller in size compared to their wild type littermates (Figure 3 2 A D). Normal formation and calcification of the ri bs and vertebrae were evident (Figure 3 2 C,D). Skeletal staining of one week old animals revealed no difference in the amount of calcified bone within the long bone (Figure 3 3 A,B). However, within the secondary ossification centers, alizarin red stain ing was less prominent in Cre +/ ; pRb fl/fl conditional mutants than that seen in Cre / ; pRb fl/fl animals (Figure 3 3 A,B arrows). The overall size of the bones was smaller in conditional mutants, but not as dramatic as seen in the neonates. The hi stological architecture of the developing bone was examined by staining with hematoxylin and eosin. Cre / ; pRb fl/fl and Cre +/ ; pRb fl/fl animals were sacrificed and tissues were fixed and embedded in paraffin wax. Sections from the proximal tibia we re examined for histology. The characteristic zones of the growth plate were present in Cre / ; pRb fl/fl animals and sufficiently normal (Figure 3 4A). Cre +/ ; pRb fl/fl growth plate sections displayed some deviations from normal (Figure 3 4B). Resti ng zone chondrocytes within Cre +/ ; pRb fl/fl animals were smaller in cellular volume. Proliferative chondrocytes develop

PAGE 57

57 characteristic columns in the normal tissues. However, the columns were less organized in the conditional mutants (Figure 3 4B). T here is a clear pre hypertrophic region in the Cre / ; pRb fl/fl growth plate and the hypertrophic region is well defined. Tissue sections from Cre +/ ; pRb fl/fl animals displayed little to no pre hypertrophic region and a slightly disorganized and smal ler hypertrophic region (Figure 3 4B). Histological examination of growth plates from 1 week old Cre / ; pRb fl/fl (Figure 3 4C) and Cre +/ ; pRb fl/fl (Figure 3 4D) mice revealed little difference in response to pRb deletion. Interestingly, there was a n observed reorganization of the growth plate in Cre +/ ; pRb fl/fl tissues (compare Figure 3 4 B to C,D). At 1 weekof age, the growth plate had developed the characteristic columns of proliferating cells. This re organization resulted in a growth plate displaying no visible differences from that of wild type (Cre / ; pRb fl/fl) animals. Von Kossa staining was used to further investigate calcification of the developing bone. Whole skeletal staining revealed a reduction in the amount of calcified bone observed in Cre +/ ; pRb fl/fl animals as compared to their wild type litter mates. Tissue sections from the proximal tibia were incubated with 1 % silver nitrate and exposed to UV light for 5 minutes. This procedure displaces calcium within the bone for the silver ions allowing for observation of calcified bone. Tissues from Cre / ; pRb fl/fl animals displayed normal amounts of calcified bone equivalent to that observed in Cre +/ ; pRb fl/fl tissues (Figure 3 5 A, B). To confirm or refute the observed difference in calcium staining in the secondary ossification centers seen in skeletal preparations, tissues from 1 week old mice were processed for von Kossa staining also (Figure 3 5 C, D). Bone mineralization was not effected by pRb deletion in 1 week tissues as observed by von Kossa staining. Areas of secondary ossification were not observed to be calcified at a delayed rate as suspected from skeletal preparations. Differences among individual

PAGE 58

58 animals or the precise area of sectioning may account for the lack of noticeable mineralization of secondary ossification centers. The inherent cellular function of pRb is to regulate the transition from the G1 phase of the cell cycle to S phase. Deletion or genetic alteration of normal pRb function leads to a bnormal cell cycle progression and is often associated with uncontrolled cell proliferation. Immunohistochemical localization of cellular proliferation markers were used to ascertain the effect of the pRb conditional deletion on chondrocyte growth. Secti ons of proximal tibia from Cre / ; pRb fl/fl (Figure 3 6 A, B, C) and Cre +/ ; pRb fl/fl (Figure 6D, E) were stained for the cellular proliferation markers, Ki67 and PCNA. Staining for Ki67 in Cre / ; pRb fl/fl tissues was observed in early proliferativ e cells of the resting zone and throughout the characteristic columns of expanding chondrocytes (Figure 3 6B). Notably, staining for Ki67 is not observed in the pre hypertrophic or hypertrophic regions. The lack of immunoreactivity is expected given that Ki67 is a cellular nuclear antigen present within cells actively engaged in the cell cycle. Chondrocytes within these areas cells have exited the cell cycle, and thus do not express Ki67. Ki67 expression in Cre +/ ; pRb fl/fl tissues was observed in cel ls throughout the resting zone and proliferative region (Figure 3 6D). Staining was less prevalent in Cre / ; pRb fl/fl tissues as compared to Cre +/ ; pRb fl/fl tissues (compare Figure 3 6B to D). PCNA is most closely associated with cellular DNA synth esis, another hallmark of proliferating cells. Immunostaining for PCNA in Cre / ; pRb fl/fl tissues were observed in chondrocytes in the resting, proliferative and to a lesser extent in the pre hypertrophic and hypertrophic regions (Figure 3 6C). Expres sion of PCNA was also observed in the resting, proliferative, pre hypertrophic and hypertrophic regions in Cre +/ ; pRb fl/fl tissues (Figure 3 6E). Conditional deletion of pRb allows for the increase of cellular proliferation observed through the express ion of proliferative

PAGE 59

59 markers. Chondrocytes from Cre +/ ; pRb fl/fl tissues express proliferative markers at higher levels and at earlier spatiotemporal points than in chondrocytes from Cre / ; pRb fl/fl tissues. The sustained expression of Ki67 in chondr ocytes in the pre hypertrophic and hypertrophic regions further signifies the alteration in chondrocyte proliferation resulting from pRb deletion. Discussion Normal endochondral bone formation is dependent on adequate chondrocyte proliferation and subse quent terminal differentiation. Alteration of chondrocyte proliferation by genetic mutations in many cell cycle regulatory pathways results in abnormal development, such as the cyclin D1 and p21 Cip1/Waf1 genes (for review see Beier, 2005). The importanc e of cell cycle control is not only manifested in the proliferation of chondrocytes, but also in terminal cell cycle exit and hypertrophic differentiation. Several cell cycle related proteins have been shown to be important in regulating cell cycle progre ssion and terminal exit. The retinoblastoma family of proteins is a group of proteins central to cell cycle control. Family members pRb, p107 and p130 are key cell cycle regulators that bind and sequester E2F transcription factors necessary for DNA syn thesis. p107 and p130 have been shown previously to play important roles in growth plate development (Cobrinik et al., 1996; Rossi et al., 2002; Laplantine et al., 2002) through the regulation of chondrocyte growth arrest and hypertrophic differentiation. Previous results from our lab have implicated pRb in chondrocyte growth in response to ATF 2 loss (Chapter 2, Luvalle et al., 2003). In order to assess the contribution that pRb plays in chondrocyte proliferation and differentiation, a conditional pRb deletion mutant was utilized. Conditional mutant animals displayed no gross phenotypic abnormalities besides the reduced size at birth (Figure 3 1A, and Figure 3 2). The difference in body size observed in newborn mice was overcome as the

PAGE 60

60 conditional mu tants grew to adulthood (Figure 3 1C). These findings suggest that pRb may be necessary for optimal chondrocyte growth in utero, but likely has a diminished post natal role. Members of the retinoblastoma protein family display affinity for specific mem bers of the E2F family of transcription factors. pRb has been shown to bind preferentially to E2F 1 3a, whereas p107 and p130 bind to E2F 4 5 (for review see Macaluso et al., 2006). Evidence also exists that supports a compensation mechanism whereby p107 expression is up regulated in response to pRb mutation or deletion (Lee et al., 1996; Jiang and Zacksenhaus, 2002; Donovan et al., 2006). Constitutive overexpression of E2F1, the preferential binding partner for pRb, results in dwarfism and skeletal abno rmalities (Scheijin et al., 2003). The lack of similar defects in pRb conditional mutants as observed with E2F overexpression suggests a plausible role for a compensatory mechanism. It is possible that p107 or p130 can counteract the loss of pRb function through the binding and sequestration of E2Fs normally bound by pRb. It is possible that pRb plays a very insignificant role in controlling chondrocyte proliferation in general. Chondrocyte growth arrest is induced by FGF signaling primarily through p10 7 and p130, but not pRb (Rossi et al., 2002; Laplantine et al., 2002). Disruption of p107 and p130 together prevent hypertrophic differentiation of growth plate chondrocytes whereas pRb does not appear to play a significant role (Rossi et al., 2002). The observed phenotype of pRb conditional mutant animals suggests a role for pRb upstream of chondrocyte cell cycle exit. Increased expression of proliferation markers Ki67 and PCNA in conditional mutants demonstrates that pRb functions by regulating cellula r proliferation in early postnatal animals. However, the observed re organization of growth plate chondrocytes at 1 week postnatal age indicates the insignificance of pRb in normal endochondral development. The re organization of the growth plate may si gnify an increased role of p107 in response to pRb

PAGE 61

61 deletion. As observed in response to ATF 2 loss, p107 may be up regulated with the loss of pRb. Another plausible explanation for the seemingly transient role pRb plays in endochondral development are t he roles that pRb plays in other cellular processes. In addition to its role in cell cycle control, pRb is a transcription factor that can regulate transcription of target genes through regulation of respective promoter regions (Markey et al., 2002). pRb may regulate the expression and/or activity of putative growth factors required for endochondral development during late embryonic and early post natal development. pRb may directly or indirectly control the expression of p107 and/or p130 through modulat ing their respective promoters. Loss of ATF 2 signaling causes a reduction of pRb levels, with a coincident increase in p107 levels (Chapter 2, Luvalle et al., 2003). The findings described here provide evidence that pRb is not required for normal endoc hondral bone development. However, there exists a possible role for pRb in early postnatal growth that is overcome by more important signaling mechanisms. Likely, it is a compensatory mechanism by p107 and the roles of p107 and p130, more than those of p Rb, that insure normal endochodral development in pRb conditional mutants.

PAGE 62

62 Figure 3 1. Comparison of normal and condtional mutant animals. (A) Conditional mutants were smaller at birth but displayed no gross phenotypic skeletal abnormalities in r esponse to pRb loss. B) At 1 week of age, conditional mutants were still slightly smaller than wild type littermates. (C) By 3 weeks of age, there was no observed difference in body size between wild type and conditional mutants.

PAGE 63

63 Figure 3 2. S keletal staining of newborn wild type and pRb conditional deletion mutants. (A) Humerus bones from Cre / ; pRb fl/fl and Cre +/ ; pRb fl/fl animals demonstrate the observed size difference among littermates. (B) The hips and vertebral column of litterma tes showed no difference in axial skeleton development other than a reduced size. (C) Staining of the cranial bones showed no difference in craniofacial development aside from the size difference. (D) Normal development and mineralization of the ribs and vertebrae were observed wild type and pRb conditional mutants.

PAGE 64

64 Figure 3 3. Skeletal staining of 1 week old pRb conditional knockout and wild type mice. (A) Hindlimbs from conditonal knockout mice (upper) displayed slightly smaller overall length of th e limb as compared to wildtype littermates (lower). Secondary ossification centers (arrows) were more prominent in normal tissues. (B) Forelimbs from mice with the pRb conditional deletion (lower) displayed reduction in size and delayed ossification as co mpared to wild type littermates (upper). Arrows again indicate centers of secondary ossification.

PAGE 65

65 Figure 3 4. Histological examination of tibial growth plates of wild type and conditional mutants. Tissue section from proximal tibial grow th plates were sectioned and stained with hematoxylin and eosin. Tissues from newborn (A, B) and 1 week old (C, D) mice are presented. Cre / ; pRb fl/fl mice diplsayed the normal architecture of the growth with requisite columns of proliferating chondroc ytes and a clear defined hypertrophic region (A). Cre +/ ; pRb fl/fl mice do not display the normal columnar formation and show increased numbers of cells (B). At 1 weekof age, Cre / ; pRb fl/fl animals show normal growth plate development (C). Cre +/ ; pRb fl/fl animals also show normal growth plate development indicating a re organization of the growth plate (D).

PAGE 66

66 Figure 3 5. Von Kossa staining of growth plate of wild type (A, C) and conditional mutants (B, D). Frozen sections of proximal tibial gr owth plates were analyzed for mineralization by von Kossa staining. (A) Newborn tissue section from Cre / ; pRb fl/fl animals showed normal calcification of bone. (B) Newborn Cre +/ ; pRb fl/fl conditional mutant bone displayed similar mineralization as their wild type littermates. (C) Tissues from 1 week old Cre / ; pRb fl/fl mice showed normal bone mineralization. (D) Cre +/ ; pRb fl/fl tissues displayed normal bone mineralization similar to that observed from wild type littermates (compare C, D).

PAGE 67

67 Figure 3 6. Immunolocalization of proliferation markers Ki67 and PCNA in wild type and pRb conditional mutants. Proximal tibial sections from newborn Cre / ; pRb fl/fl (A, B, C) and Cre +/ ; pRb fl/fl (D, E) mice were processed for immunohistochemi stry and counterstained with hematoxylin. (A) Control section of newborn wild type growth plate. (B) Tissue section from Cre / ; pRb fl/fl animals immunostained for Ki67. (C) Tissue section from Cre / ; pRb fl/fl animals immunostained for PCNA. (D) I mmunostaining for Ki67 in Cre +/ ; pRb fl/fl conditional mutants. An increase in Ki67 immunoreactiivity is observed in conditional mutants over wild type littermaters (compare B and D). (E) Immunostaining for PCNA in Cre +/ ; pRb fl/fl conditional mutant animals. Immunoreactivity for PCNA is similar between wild type and conditional mutants (compare C and E).

PAGE 68

68 CHAPTER 4 CONCLUSIONS Overview of Findings At the time these studies began, the role of ATF 2 in endochondral ossification was primarily viewed as a modulator of expression of genes involved in cell cycle progression. Most of the research on the role of ATF 2 in bone and cartilage development focused around promoter activation of genes involved in chondrocyte proliferation. The research presented here seeks to examine the role that ATF 2 plays in regulating the expression of cell cycle regulator s, pRb, p107 and p130. Moreover, an understanding of the interplay between ATF 2 and the pocket proteins in chondrocyte proliferation and differentiation, as well as the role of pRb in regulation of chondrocyte cell cycle progression is justified in terms of developing a better understanding of how ATF 2 controls growth plate development and the role of pRb in skeletal growth. Building on the knowledge of the function of ATF 2 in control of promoter activity by binding the CRE located in target gene promo ters, we examined the expression of possible target genes pRb, p107 and p130. Given the cellular function of these proteins as cell cycle regulators and the alteration of pRb expression in response to ATF 2 loss, we confirmed the importance of pRb in chon drocyte differentiation using an in vitro chondrogenic system (Chapter 2). Chondrogenic differentiation of ATDC5 cells induced cell cycle exit. This was temporally associated with increased expression of pRb and type X collagen mRNA, and supported a role for pRb in chondrocyte differentiation (Chapter 2). Building upon the observed role of pRb in chondrocyte differentiation in vitro we sought to characterize its role in vivo Conditional deletion of pRb in chondrocytes did not produce gross skeletal abn ormalities, and skeletal growth was affected transiently, at best (Chapter 3). A reduced size was observed at birth, but was overcome by 3 weeks of age. Examination of the histology and immunolocalization of

PAGE 69

69 proliferation marker Ki67 and PCNA revealed in creased chondrocyte proliferation in conditional mutants (Chapter 3). The difference in histology observed between conditional pRb mutants and normal animals was resolved by 1 weekof age. These studies suggest that the role of pRb within growth plate dev elopment is insignificant as compared to that of p107 and p130. Questions and Future Studies As is the case with any scientific research, when results are obtained, more questions arise and future directions are explored. Expression of ATF 2 is predomi nantly localized to the resting and proliferating zones of the growth plate suggesting its function is concentrated in those areas. However, loss of ATF 2 function yields effects on the growth plate at distal sites from those having ATF 2 expression (Chap ter 2; Ma et al., 2007). ATF 2 is expressed in the resting and proliferating regions of the growth plate, yet ATF 2 loss results in alteration in the hpyertrophic zone, a region lacking ATF 2 expression. The reduction in type X collagen expression and ov erall size of the hypertrophic region observed in ATF 2 deficient animals suggests a role for ATF 2 in controlling the differentiation of growth plate chondrocytes. It is still unknown how ATF 2 regulates this process. It is possible that through the alt ered expression of the pocket proteins that chondrocytes exit the cell cycle earlier. Premature chondrocyte cell cycle growth arrest combined with the decreased expression of bcl 2 in ATF 2 deficient animals (Ma et al., 2007) may lead to increased apoptos is within the hypertrophic region, ultimately resulting in a reduction in hypertrophic region size. The reduced expression of type X collagen observed in ATF 2 deficient animals (Chapter 2) may be an indirect result of the reduced size of the hypertrophic region. The increase in p107 levels in response to ATF 2 deficiency is another unresolved topic. Expression of p107 is increased in response to pRb loss ( Lee et al., 1996; Jiang and

PAGE 70

70 Zacksenhaus, 2002; Donovan et al., 2006). The p107 promoter region c ontains a putative CRE that may be a target for ATF 2 regulation. The reduction of pRb levels may result in a transcriptionally activated p107 promoter. pRb can repress transcription of genes by forming a repressor complex on target promters. It is poss ible that the p107 promoter is a target of pRb repression. Lengthy promoter deletion as well as chromatin immunopreciptation studies would be necessary to determine if pRb can regulate p107 promoter activity in chondrocytes. Secondary to this would be th e elucidation of the plausible compensatory mechanism that may exist between pRb and p107. Overexpression of E2F1 results in skeletal defects (Scheijin et al., 1003) suggesting that p107 cannot compensate for pRb while pRb is still expressed. It would be interesting to determine if E2F1 overexpression results in similar anomalies in pRb conditional mutants, or if p107 is highly up regulated and compensates for pRb loss. Similarly, it would be beneficial to examine which E2F family members interact with p 107 in ATF 2 deficient chondrocytes. These experiments would demonstrate how p107 may compensate for the reduction in pRb expression. It would also be informative to investigate the role of p130 in compensating for pRb loss. Another unresolved issue is the discrepancy between the observed decrease in chondrocyte proliferation (Reimold et al., 1996) and the loss of pRb expression in ATF 2 mutant animals. The two results seem contradictory. Also, our results from pRb conditional mutants (Chapter 3) sugg est that there is a transient increase in proliferation seen in newborn growth plate chondrocytes. Again, the importance of p107 in chondrocyte proliferation is demonstrated. The increase in p107 expression seen in ATF 2 mutant animals could compensate f or pRb loss, and provide increased cell cycle control and possibly premature growth arrest. Contributing to this could be the role that ATF 2 plays in regulating the expression of cyclin D1 (Beier et al.,

PAGE 71

71 1999). Reduced cyclin D1 expression may influenc e the phosphorylation status of p107 which in turn would allow for a hypophosphorylated state whereby p107 can bind E2Fs and contribute more greatly to chondrocyte growth arrest. In the case of pRb conditional mutants, chondrocytes still express a trunca ted form of the protein. It is possible that the truncated protein still confers some properties that may influence p107 expression. Studies investigating the occupancy of the p107 promoter in the pRb conditional mutants would be informative to determine changes in transcriptional activity. In conclusion, the studies described in this dissertation have identified the regulatory role ATF 2 plays on the expression of the pocket proteins and provided evidence for the importance of pRb in regulating chondr ocyte cell cycle progression. These findings will affect future efforts of scientists investigating cartilage development and growth plate biology.

PAGE 72

72 LIST OF REFERENCES Adams, S. L., Cohen, A. J., and Lassova, L. (2007). Integration of signaling pathways regulating chondrocyte differentiation during endochondral bone formation. J Cell Physiol 213, 635 41. Alappat, S., Zhang, Z. Y., and Chen, Y. P. (200 3). Msx homeobox gene family and craniofacial development. Cell Res 13, 429 42. Atsumi, T., Miwa, Y., Kimata, K., and Ikawa, Y. (1990). A chondrogenic cell line derived from a differentiating culture of AT805 teratocarcinoma cells. Cell Differ Dev 30, 109 16. Beier, F. (2005). Cell cycle control and the cartilage growth plate. J Cell Physiol 202, 1 8. Beier, F., Ali, Z., Mok, D., Taylor, A. C., Leask, T., Albanese, C., Pestell, R. G., and LuValle, P. (2001). TGFbeta and PTHrP control chondrocyte prolifer ation by activating cyclin D1 expression. Mol Biol Cell 12, 3852 63. Beier, F., Lee, R. J., Taylor, A. C., Pestell, R. G., and LuValle, P. (1999). Identification of the cyclin D1 gene as a target of activating transcription factor 2 in chondrocytes. Proc Natl Acad Sci U S A 96, 1433 8. Beier, F., Taylor, A. C., and LuValle, P. (2000). Activating transcription factor 2 is necessary for maximal activity and serum induction of the cyclin A promoter in chondrocytes. J Biol Chem 275, 12948 53. Bell, D. M., Le ung, K. K., Wheatley, S. C., Ng, L. J., Zhou, S., Ling, K. W., Sham, M. H., Koopman, P., Tam, P. P., and Cheah, K. S. (1997). SOX9 directly regulates the type II collagen gene. Nat Genet 16, 174 8. Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Ban nister, A. J., and Kouzarides, T. (1998). Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391, 597 601. Bronner Fraser, M. (1994). Neural crest cell formation and migration in the developing embryo. Faseb J 8, 699 706. Burke, A. C., Nelson, C. E., Morgan, B. A., and Tabin, C. (1995). Hox genes and the evolution of vertebrate axial morphology. Development 121, 333 46. Callaghan, D. A., Dong, L., Callaghan, S. M., Hou, Y. X., Dagnino, L., and Slack, R. S. (1999). Neura l precursor cells differentiating in the absence of Rb exhibit delayed terminal mitosis and deregulated E2F 1 and 3 activity. Dev Biol 207, 257 70. Chai, Y., Ito, Y., and Han, J. (2003). TGF beta signaling and its functional significance in regulating the fate of cranial neural crest cells. Crit Rev Oral Biol Med 14, 78 88.

PAGE 73

73 Chalepakis, G., Fritsch, R., Fickenscher, H., Deutsch, U., Goulding, M., and Gruss, P. (1991). The molecular basis of the undulated/Pax 1 mutation. Cell 66, 873 84. Chen, F., Greer, J. and Capecchi, M. R. (1998). Analysis of Hoxa7/Hoxb7 mutants suggests periodicity in the generation of the different sets of vertebrae. Mech Dev 77, 49 57. Chen, L., and Deng, C. X. (2005). Roles of FGF signaling in skeletal development and human genetic diseases. Front Biosci 10, 1961 76. Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H., and Beachy, P. A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383, 407 13. Chris t, B., Huang, R., and Scaal, M. (2007). Amniote somite derivatives. Dev Dyn 236, 2382 96. Christ, B., Huang, R., and Wilting, J. (2000). The development of the avian vertebral column. Anat Embryol (Berl) 202, 179 94. Cobrinik, D. (2005). Pocket proteins and cell cycle control. Oncogene 24, 2796 809. Cobrinik, D., Lee, M. H., Hannon, G., Mulligan, G., Bronson, R. T., Dyson, N., Harlow, E., Beach, D., Weinberg, R. A., and Jacks, T. (1996). Shared role of the pRB related p130 and p107 proteins in limb devel opment. Genes Dev 10, 1633 44. Cohn, M. J., and Tickle, C. (1996). Limbs: a model for pattern formation within the vertebrate body plan. Trends Genet 12, 253 7. Condorelli, G. L., Testa, U., Valtieri, M., Vitelli, L., De Luca, A., Barberi, T., Montesoro, E., Campisi, S., Giordano, A., and Peschle, C. (1995). Modulation of retinoblastoma gene in normal adult hematopoiesis: peak expression and functional role in advanced erythroid differentiation. Proc Natl Acad Sci U S A 92, 4808 12. Conlon, R. A., Reaume A. G., and Rossant, J. (1995). Notch1 is required for the coordinate segmentation of somites. Development 121, 1533 45. Dailey, L., Laplantine, E., Priore, R., and Basilico, C. (2003). A network of transcriptional and signaling events is activated by FG F to induce chondrocyte growth arrest and differentiation. J Cell Biol 161, 1053 66. De Falco, G., Comes, F., and Simone, C. (2006). pRb: master of differentiation. Coupling irreversible cell cycle withdrawal with induction of muscle specific transcriptio n. Oncogene 25, 5244 9. Delehouzee, S., Yoshikawa, T., Sawa, C., Sawada, J., Ito, T., Omori, M., Wada, T., Yamaguchi, Y., Kabe, Y., and Handa, H. (2005). GABP, HCF 1 and YY1 are involved in Rb gene expression during myogenesis. Genes Cells 10, 717 31.

PAGE 74

74 Dim ova, D. K., and Dyson, N. J. (2005). The E2F transcriptional network: old acquaintances with new faces. Oncogene 24, 2810 26. Dong, Y., Drissi, H., Chen, M., Chen, D., Zuscik, M. J., Schwarz, E. M., and O'Keefe, R. J. (2005). Wnt mediated regulation of ch ondrocyte maturation: modulation by TGF beta. J Cell Biochem 95, 1057 68. Donovan, S. L., Schweers, B., Martins, R., Johnson, D., and Dyer, M. A. (2006). Compensation by tumor suppressor genes during retinal development in mice and humans. BMC Biol 4, 14. Dyson, N. (1998). The regulation of E2F by pRB family proteins. Genes Dev 12, 2245 62. Egeblad, M., Shen, H. C., Behonick, D. J., Wilmes, L., Eichten, A., Korets, L. V., Kheradmand, F., Werb, Z., and Coussens, L. M. (2007). Type I collagen is a genetic modifier of matrix metalloproteinase 2 in murine skeletal development. Dev Dyn 236, 1683 93. Fajas, L., Landsberg, R. L., Huss Garcia, Y., Sardet, C., Lees, J. A., and Auwerx, J. (2002). E2Fs regulate adipocyte differentiation. Dev Cell 3, 39 49. Fantl, V., Stamp, G., Andrews, A., Rosewell, I., and Dickson, C. (1995). Mice lacking cyclin D1 are small and show defects in eye and mammary gland development. Genes Dev 9, 2364 72. Favier, B., and Dolle, P. (1997). Developmental functions of mammalian Hox gene s. Mol Hum Reprod 3, 115 31. Ferguson, C. M., Schwarz, E. M., Reynolds, P. R., Puzas, J. E., Rosier, R. N., and O'Keefe, R. J. (2000). Smad2 and 3 mediate transforming growth factor beta1 induced inhibition of chondrocyte maturation. Endocrinology 141, 47 28 35. Genovese, C., Trani, D., Caputi, M., and Claudio, P. P. (2006). Cell cycle control and beyond: emerging roles for the retinoblastoma gene family. Oncogene 25, 5201 9. Giacinti, C., and Giordano, A. (2006). RB and cell cycle progression. Oncogene 2 5, 5220 7. Hall, B. K., and Miyake, T. (1992). The membranous skeleton: the role of cell condensations in vertebrate skeletogenesis. Anat Embryol (Berl) 186, 107 24. Howard, T. D., Paznekas, W. A., Green, E. D., Chiang, L. C., Ma, N., Ortiz de Luna, R. I ., Garcia Delgado, C., Gonzalez Ramos, M., Kline, A. D., and Jabs, E. W. (1997). Mutations in TWIST, a basic helix loop helix transcription factor, in Saethre Chotzen syndrome. Nat Genet 15, 36 41. Hrabe de Angelis, M., McIntyre, J., 2nd, and Gossler, A. (1997). Maintenance of somite borders in mice requires the Delta homologue DII1. Nature 386, 717 21.

PAGE 75

75 Inada, M., Yasui, T., Nomura, S., Miyake, S., Deguchi, K., Himeno, M., Sato, M., Yamagiwa, H., Kimura, T., Yasui, N., Ochi, T., Endo, N., Kitamura, Y., Ki shimoto, T., and Komori, T. (1999). Maturational disturbance of chondrocytes in Cbfa1 deficient mice. Dev Dyn 214, 279 90. Ionescu, A. M., Schwarz, E. M., Zuscik, M. J., Drissi, H., Puzas, J. E., Rosier, R. N., and O'Keefe, R. J. (2003). ATF 2 cooperates with Smad3 to mediate TGF beta effects on chondrocyte maturation. Exp Cell Res 288, 198 207. Jiang, Z., and Zacksenhaus, E. (2002). Coordinated expression of Rb gene family in the mammary gland. Gene Expr Patterns 2, 35 8. Karaplis, A. C., Luz, A., Glowa cki, J., Bronson, R. T., Tybulewicz, V. L., Kronenberg, H. M., and Mulligan, R. C. (1994). Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone related peptide gene. Genes Dev 8, 277 89. Khan, I. M., Redman, S. N., Williams, R., D owthwaite, G. P., Oldfield, S. F., and Archer, C. W. (2007). The development of synovial joints. Curr Top Dev Biol 79, 1 36. Kielty, C. M., Kwan, A. P., Holmes, D. F., Schor, S. L., and Grant, M. E. (1985). Type X collagen, a product of hypertrophic chond rocytes. Biochem J 227, 545 54. Kim, I. S., Otto, F., Zabel, B., and Mundlos, S. (1999). Regulation of chondrocyte differentiation by Cbfa1. Mech Dev 80, 159 70. Kim, S. J., Wagner, S., Liu, F., O'Reilly, M. A., Robbins, P. D., and Green, M. R. (1992). R etinoblastoma gene product activates expression of the human TGF beta 2 gene through transcription factor ATF 2. Nature 358, 331 4. Kusumi, K., Sun, E. S., Kerrebrock, A. W., Bronson, R. T., Chi, D. C., Bulotsky, M. S., Spencer, J. B., Birren, B. W., Fran kel, W. N., and Lander, E. S. (1998). The mouse pudgy mutation disrupts Delta homologue Dll3 and initiation of early somite boundaries. Nat Genet 19, 274 8. Lang, D., Powell, S. K., Plummer, R. S., Young, K. P., and Ruggeri, B. A. (2007). PAX genes: roles in development, pathophysiology, and cancer. Biochem Pharmacol 73, 1 14. Lanske, B., Karaplis, A. C., Lee, K., Luz, A., Vortkamp, A., Pirro, A., Karperien, M., Defize, L. H., Ho, C., Mulligan, R. C., Abou Samra, A. B., Juppner, H., Segre, G. V., and Kron enberg, H. M. (1996). PTH/PTHrP receptor in early development and Indian hedgehog regulated bone growth. Science 273, 663 6. Laplantine, E., Rossi, F., Sahni, M., Basilico, C., and Cobrinik, D. (2002). FGF signaling targets the pRb related p107 and p130 p roteins to induce chondrocyte growth arrest. J Cell Biol 158, 741 50.

PAGE 76

76 Lee, C., and Cho, Y. (2002). Interactions of SV40 large T antigen and other viral proteins with retinoblastoma tumour suppressor. Rev Med Virol 12, 81 92. Lee, M. H., Williams, B. O., Mulligan, G., Mukai, S., Bronson, R. T., Dyson, N., Harlow, E., and Jacks, T. (1996). Targeted disruption of p107: functional overlap between p107 and Rb. Genes Dev 10, 1621 32. Lefebvre, V., and de Crombrugghe, B. (1998). Toward understanding SOX9 functi on in chondrocyte differentiation. Matrix Biol 16, 529 40. Lefebvre, V., Garofalo, S., Zhou, G., Metsaranta, M., Vuorio, E., and De Crombrugghe, B. (1994). Characterization of primary cultures of chondrocytes from type II collagen/beta galactosidase trans genic mice. Matrix Biol 14, 329 35. Letra, A., Silva, R. A., Menezes, R., Astolfi, C. M., Shinohara, A., de Souza, A. P., and Granjeiro, J. M. (2007). MMP gene polymorphisms as contributors for cleft lip/palate: association with MMP3 but not MMP1. Arch Or al Biol 52, 954 60. Li, T. F., Chen, D., Wu, Q., Chen, M., Sheu, T. J., Schwarz, E. M., Drissi, H., Zuscik, M., and O'Keefe, R. J. (2006). Transforming growth factor beta stimulates cyclin D1 expression through activation of beta catenin signaling in chon drocytes. J Biol Chem 281, 21296 304. Lipinski, M. M., and Jacks, T. (1999). The retinoblastoma gene family in differentiation and development. Oncogene 18, 7873 82. Luvalle, P., Ma, Q., and Beier, F. (2003). The role of activating transcription factor 2 in skeletal growth control. J Bone Joint Surg Am 85 A Suppl 2, 133 6. Ma, Q., Li, X., Vale Cruz, D., Brown, M. L., Beier, F., and LuValle, P. (2007). Activating transcription factor 2 controls Bcl 2 promoter activity in growth plate chondrocytes. J Cell Biochem 101, 477 87. Macaluso, M., Montanari, M., Cinti, C., and Giordano, A. (2005). Modulation of cell cycle components by epigenetic and genetic events. Semin Oncol 32, 452 7. Macaluso, M., Montanari, M., and Giordano, A. (2006). Rb family proteins as modulators of gene expression and new aspects regarding the interaction with chromatin remodeling enzymes. Oncogene 25, 5263 7. Maekawa, T., Bernier, F., Sato, M., Nomura, S., Singh, M., Inoue, Y., Tokunaga, T., Imai, H., Yokoyama, M., Reimold, A., Glimc her, L. H., and Ishii, S. (1999). Mouse ATF 2 null mutants display features of a severe type of meconium aspiration syndrome. J Biol Chem 274, 17813 9.

PAGE 77

77 Markey, M. P., Angus, S. P., Strobeck, M. W., Williams, S. L., Gunawardena, R. W., Aronow, B. J., and K nudsen, E. S. (2002). Unbiased analysis of RB mediated transcriptional repression identifies novel targets and distinctions from E2F action. Cancer Res 62, 6587 97. Monsoro Burq, A. H. (2005). Sclerotome development and morphogenesis: when experimental em bryology meets genetics. Int J Dev Biol 49, 301 8. Mulligan, G. J., Wong, J., and Jacks, T. (1998). p130 is dispensable in peripheral T lymphocytes: evidence for functional compensation by p107 and pRB. Mol Cell Biol 18, 206 20. Murtaugh, L. C., Chyung, J. H., and Lassar, A. B. (1999). Sonic hedgehog promotes somitic chondrogenesis by altering the cellular response to BMP signaling. Genes Dev 13, 225 37. Nevins, J. R. (1998). Toward an understanding of the functional complexity of the E2F and retinoblasto ma families. Cell Growth Differ 9, 585 93. Nevins, J. R., Leone, G., DeGregori, J., and Jakoi, L. (1997). Role of the Rb/E2F pathway in cell growth control. J Cell Physiol 173, 233 6. Ng, J. K., Tamura, K., Buscher, D., and Izpisua Belmonte, J. C. (1999) Molecular and cellular basis of pattern formation during vertebrate limb development. Curr Top Dev Biol 41, 37 66. Nie, X., Luukko, K., and Kettunen, P. (2006). FGF signalling in craniofacial development and developmental disorders. Oral Dis 12, 102 11. Ovchinnikov, D. A., Deng, J. M., Ogunrinu, G., and Behringer, R. R. (2000). Col2a1 directed expression of Cre recombinase in differentiating chondrocytes in transgenic mice. Genesis 26, 145 6. Palmeirim, I., Henrique, D., Ish Horowicz, D., and Pourquie, O. (1997). Avian hairy gene expression identifies a molecular clock linked to vertebrate segmentation and somitogenesis. Cell 91, 639 48. Pateder, D. B., Rosier, R. N., Schwarz, E. M., Reynolds, P. R., Puzas, J. E., D'Souza, M., and O'Keefe, R. J. (2000) PTHrP expression in chondrocytes, regulation by TGF beta, and interactions between epiphyseal and growth plate chondrocytes. Exp Cell Res 256, 555 62. Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real time RT PCR. Nuclei c Acids Res 29, e45. Phornphutkul, C., Wu, K. Y., and Gruppuso, P. A. (2006). The role of insulin in chondrogenesis. Mol Cell Endocrinol 249, 107 15.

PAGE 78

78 Rampalli, A. M., Gao, C. Y., Chauthaiwale, V. M., and Zelenka, P. S. (1998). pRb and p107 regulate E2F a ctivity during lens fiber cell differentiation. Oncogene 16, 399 408. Reichenberger, E., Aigner, T., von der Mark, K., Stoss, H., and Bertling, W. (1991). In situ hybridization studies on the expression of type X collagen in fetal human cartilage. Dev Bio l 148, 562 72. Reimold, A. M., Grusby, M. J., Kosaras, B., Fries, J. W., Mori, R., Maniwa, S., Clauss, I. M., Collins, T., Sidman, R. L., Glimcher, M. J., and Glimcher, L. H. (1996). Chondrodysplasia and neurological abnormalities in ATF 2 deficient mice. Nature 379, 262 5. Ripamonti, U. (2005). Bone induction by recombinant human osteogenic protein 1 (hOP 1, BMP 7) in the primate Papio ursinus with expression of mRNA of gene products of the TGF beta superfamily. J Cell Mol Med 9, 911 28. Robert, B., and Lallemand, Y. (2006). Anteroposterior patterning in the limb and digit specification: contribution of mouse genetics. Dev Dyn 235, 2337 52. Rosen, V. (2006). BMP and BMP inhibitors in bone. Ann N Y Acad Sci 1068, 19 25. Rossi, F., MacLean, H. E., Yuan, W., Francis, R. O., Semenova, E., Lin, C. S., Kronenberg, H. M., and Cobrinik, D. (2002). p107 and p130 Coordinately regulate proliferation, Cbfa1 expression, and hypertrophic differentiation during endochondral bone development. Dev Biol 247, 271 85. Sch eijen, B., Bronk, M., van der Meer, T., and Bernards, R. (2003). Constitutive E2F1 overexpression delays endochondral bone formation by inhibiting chondrocyte differentiation. Mol Cell Biol 23, 3656 68. Scott Savage, P., and Hall, B. K. (1980). Differenti ative ability of the tibial periosteum for the embryonic chick. Acta Anat (Basel) 106, 129 40. Sekiya, I., Tsuji, K., Koopman, P., Watanabe, H., Yamada, Y., Shinomiya, K., Nifuji, A., and Noda, M. (2000). SOX9 enhances aggrecan gene promoter/enhancer acti vity and is up regulated by retinoic acid in a cartilage derived cell line, TC6. J Biol Chem 275, 10738 44. Shukunami, C., Shigeno, C., Atsumi, T., Ishizeki, K., Suzuki, F., and Hiraki, Y. (1996). Chondrogenic differentiation of clonal mouse embryonic ce ll line ATDC5 in vitro: differentiation dependent gene expression of parathyroid hormone (PTH)/PTH related peptide receptor. J Cell Biol 133, 457 68. Shum, L., Coleman, C. M., Hatakeyama, Y., and Tuan, R. S. (2003). Morphogenesis and dysmorphogenesis of t he appendicular skeleton. Birth Defects Res C Embryo Today 69, 102 22.

PAGE 79

79 Sicinski, P., Donaher, J. L., Parker, S. B., Li, T., Fazeli, A., Gardner, H., Haslam, S. Z., Bronson, R. T., Elledge, S. J., and Weinberg, R. A. (1995). Cyclin D1 provides a link betwe en development and oncogenesis in the retina and breast. Cell 82, 621 30. Stiegler, P., De Luca, A., Bagella, L., and Giordano, A. (1998). The COOH terminal region of pRb2/p130 binds to histone deacetylase 1 (HDAC1), enhancing transcriptional repression o f the E2F dependent cyclin A promoter. Cancer Res 58, 5049 52. St Jacques, B., Hammerschmidt, M., and McMahon, A. P. (1999). Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes D ev 13, 2072 86. Takeda, S., Bonnamy, J. P., Owen, M. J., Ducy, P., and Karsenty, G. (2001). Continuous expression of Cbfa1 in nonhypertrophic chondrocytes uncovers its ability to induce hypertrophic chondrocyte differentiation and partially rescues Cbfa1 deficient mice. Genes Dev 15, 467 81. Thomas, D. M., Carty, S. A., Piscopo, D. M., Lee, J. S., Wang, W. F., Forrester, W. C., and Hinds, P. W. (2001). The retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation Mol Cell 8, 303 16. Tuan, R. S. (2004). Biology of developmental and regenerative skeletogenesis. Clin Orthop Relat Res, S105 17. Ueta, C., Iwamoto, M., Kanatani, N., Yoshida, C., Liu, Y., Enomoto Iwamoto, M., Ohmori, T., Enomoto, H., Nakata, K., Takad a, K., Kurisu, K., and Komori, T. (2001). Skeletal malformations caused by overexpression of Cbfa1 or its dominant negative form in chondrocytes. J Cell Biol 153, 87 100. Vooijs, M., and Berns, A. (1999). Developmental defects and tumor predisposition in Rb mutant mice. Oncogene 18, 5293 303. Vooijs, M., van der Valk, M., te Riele, H., and Berns, A. (1998). Flp mediated tissue specific inactivation of the retinoblastoma tumor suppressor gene in the mouse. Oncogene 17, 1 12. Vortkamp, A., Lee, K., Lanske, B., Segre, G. V., Kronenberg, H. M., and Tabin, C. J. (1996). Regulation of rate of cartilage differentiation by Indian hedgehog and PTH related protein. Science 273, 613 22. Walsh, K. (1997). Coordinate regulation of cell cycle and apoptosis during myog enesis. Prog Cell Cycle Res 3, 53 8. Weinberg, R. A. (1995). The retinoblastoma protein and cell cycle control. Cell 81, 323 30.

PAGE 80

80 Weir, E. C., Philbrick, W. M., Amling, M., Neff, L. A., Baron, R., and Broadus, A. E. (1996). Targeted overexpression of para thyroid hormone related peptide in chondrocytes causes chondrodysplasia and delayed endochondral bone formation. Proc Natl Acad Sci U S A 93, 10240 5. Wilm, B., Dahl, E., Peters, H., Balling, R., and Imai, K. (1998). Targeted disruption of Pax1 defines it s null phenotype and proves haploinsufficiency. Proc Natl Acad Sci U S A 95, 8692 7. Zacksenhaus, E., Gill, R. M., Phillips, R. A., and Gallie, B. L. (1993). Molecular cloning and characterization of the mouse RB1 promoter. Oncogene 8, 2343 51. Zakany, J ., Gerard, M., Favier, B., and Duboule, D. (1997). Deletion of a HoxD enhancer induces transcriptional heterochrony leading to transposition of the sacrum. Embo J 16, 4393 402. Zhang, N., and Gridley, T. (1998). Defects in somite formation in lunatic fring e deficient mice. Nature 394, 374 7.

PAGE 81

71 BIOGRAPHICAL SKETCH Dustin Shawn Vale Cruz was born in Providence, Rhode Island, to Lani Vale Cruz and Daniel Miguel Jr. He attended Bishop Hendricken High School in Warwick, RI. He received a Bachelor of Science degreein animal science from the Universi ty of Rhode Island where he met his wife, Kristi. After graduation, he enrolled in graduate school at the University of Florida (UF) in the department of Animal Science. He received his Masters of Science degree in animal science in 2001. He worked for 2 years prior to returning to the UF to pursue his doctoral degree in the Interdisciplinary Program for Biomedical Research in 2003. In summer 2004, he joined the Anatomy and Cell Biology Department under the supervision of Dr. Phyllis LuValle. In 2005, D ustin and Kristi celebrated the birth of their daughter, Avery Ilene.